Open Collections will be undergoing maintenance Monday June 8th, 2020 11:00 – 13:00 PT. No downtime is expected, but site performance may be temporarily impacted.

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mutation of an L-type calcium channel gene leads to a novel primary cellular immunodeficiency in mice… Fenninger, Franz 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_september_fenninger_franz.pdf [ 3.66MB ]
Metadata
JSON: 24-1.0371139.json
JSON-LD: 24-1.0371139-ld.json
RDF/XML (Pretty): 24-1.0371139-rdf.xml
RDF/JSON: 24-1.0371139-rdf.json
Turtle: 24-1.0371139-turtle.txt
N-Triples: 24-1.0371139-rdf-ntriples.txt
Original Record: 24-1.0371139-source.json
Full Text
24-1.0371139-fulltext.txt
Citation
24-1.0371139.ris

Full Text

MUTATION OF AN L-TYPE CALCIUM CHANNEL GENE LEADS TO A NOVEL PRIMARY CELLULAR IMMUNODEFICIENCY IN MICE AND HUMANS by  Franz Fenninger  B.A., Graz University of Technology, 2011  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology & Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2018  © Franz Fenninger, 2018   ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled:  Mutation of an L-type calcium channel gene leads to a novel primary cellular immunodeficiency in mice and humans  submitted by Franz Fenninger  in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology & Immunology  Examining Committee: Wilfred Jefferies, Microbiology and Immunology Supervisor  Martin Hirst, Microbiology and Immunology Supervisory Committee Member   Supervisory Committee Member Brad Nelson, Medical Genetics University Examiner Jan Peter Dutz, Experimental Medicine University Examiner   Additional Supervisory Committee Members: Michael Gold, Microbiology and Immunology Supervisory Committee Member Kenneth Harder, Microbiology and Immunology Supervisory Committee Member iii  Abstract  Human primary immunodeficiencies are inherited diseases that can provide valuable insight into our immune system. Calcium (Ca2+) is a vital secondary messenger in T cells that regulates a vast array of important events including maturation, homeostasis, activation, and apoptosis. The proper orchestration of Ca2+ signalling is essential to prevent immune related diseases. Upon antigen binding to the T cell receptor, extracellular Ca2+ enters the cell through CRAC, TRP and CaV channels. Here we describe a mutation in the L-type Ca2+ channel CaV1.4 leading to a novel immunological disorder. Three CaV1.4-deficient siblings presented with X-linked incomplete congenital stationary night blindness as well as recurrent infections, autoimmunity and pro-inflammatory cytokine production. The subjects uniformly exhibited a T cell memory phenotype and T cell exhaustion as well as chronic activation of their B cells. Moreover, their T cells but not B cells exhibited a reduced Ca2+ flux, compared to healthy control donors. This is the first example where the mutation of any CaV channel causes a primary immunodeficiency in humans and establishes their physiological importance in the immune system. In parallel, we detected a remarkably similar phenotype in a CaV1.4-deficient mouse model. In a separate set of experiments, a commercially available C57BL/6 mouse strain harbouring an undescribed mutation in Dock2, was introduced into our breeding stock resulting in some mice with a double deficiency of DOCK2 and CaV1.4. This provided the opportunity to assess the compound phenotype. We found that the double-deficient mouse model exhibited severe splenic cytopenia as well as chronic B cell activation but impaired BCR-induced activation / Ca2+ mobilization.  iv  Lay Summary  Calcium (Ca2+) is a vital signalling molecule of our immune cells regulating their maturation, survival, activation, and death. Ca2+ enters the cells through specific channels in the cell membrane that are essential for the proper function of immune cells. We discovered that a mutation of the channel CaV1.4, which is better known for its role in neuronal and muscle cells, leads to severe immunodeficiencies. In three young brothers, the lack of a functional CaV1.4 channel severely weakened their immune system. They presented with recurrent infections as well as signs of auto-immunity. Their immune cells were in an exhausted, memory state as it is usually only seen in people with chronic viral infections. Additionally, we found that their immune cells were unable to mobilize Ca2+ properly, which most likely was a direct effect of the dysfunctional CaV1.4 channel.     v  Preface  Under the supervision of Dr. Wilfred Jefferies, I designed, conducted and analysed all experiments myself with the following exceptions: Chapter 2: Blood samples of patients were drawn by Dr. Kate Sullivan at the Children’s Hospital of Philadelphia (CHOP). Blood samples from control donors were drawn by Steve Hur from the Kastrup lab at the Michael Smith Laboratories. Chapter 3: Murine gamma herpes virus was provided and injected into mice by Iryna Shanina from the Horwitz lab at the Life Sciences Institute. Chapter 4: B cell activation and proliferation assays were performed by Dr. Lilian Nohara. Dr. Libin Abraham from the Gold lab at the Life Sciences Institute conducted the actin polymerization assay.  Section 1.2 “Calcium channels in lymphocytes” is to be submitted as a review.  Data of chapter 2 and 3 are to be submitted as a manuscript: CaV1.4 Deficiency Leads to a Novel Primary Cellular Immunodeficiency in Mice and Humans.  Animal studies were conducted in the Animal Research Unit and the Modified Barrier Facility at the University of British Columbia. All animal work was performed in strict accordance with the recommendations of the Canadian Council for Animal Care. Animal protocols were approved by the Animal Care Committee of the University of British Columbia (A14-0267, A17-0184). The University of British Columbia - Clinical Research Ethics Board granted approval for the human study titled: Rare disease patients and immunity on Sept. 22, 2016 (H16-02515). vi  Table of Contents   Abstract ......................................................................................................................................... iii Lay Summary ............................................................................................................................... iv Preface .............................................................................................................................................v Table of Contents ......................................................................................................................... vi List of Figures .................................................................................................................................x List of Abbreviations .................................................................................................................. xii Acknowledgements ......................................................................................................................xv Dedication ................................................................................................................................... xvi Chapter 1: Introduction ............................................................................................................... 1 1.1 T cells and adaptive immunity .................................................................................... 1 1.1.1 TCR/BCR signalling ............................................................................................... 1 1.1.2 T cell development .................................................................................................. 4 1.1.3 T cell immune response .......................................................................................... 5 1.1.4 T cell exhaustion ..................................................................................................... 6 1.2 Calcium channels in lymphocytes ............................................................................ 11 1.2.1 CRAC channel (Orai1, STIM1) ............................................................................ 11 1.2.2 TRPs ...................................................................................................................... 15 1.2.3 IP3Rs and RYRs .................................................................................................... 17 1.2.4 P2X receptors ........................................................................................................ 18 1.2.5 NMDA receptors ................................................................................................... 20 vii  1.2.6 CaV channels ......................................................................................................... 21 1.2.7 Summary ............................................................................................................... 26 1.3 Environmental factors alter the immune system ....................................................... 11 1.4 Research aims ........................................................................................................... 33 1.4.1 CaV1.4 deficiency in humans ................................................................................ 33 1.4.2 CaV1.4 deficiency in mice ..................................................................................... 34 1.4.3 B cell phenotype of Cacna1f and Dock2-deficient mice ...................................... 34 Chapter 2: CaV1.4 in the human immune system .................................................................... 36 2.1 Introduction ............................................................................................................... 36 2.2 Results ....................................................................................................................... 38 2.2.1 Patients harbour R625X mutation in CACNA1F gene ......................................... 39 2.2.2 CaV1.4 deficiency leads to a reduced CD4/CD8 T cell ratio ................................ 40 2.2.3 CaV1.4 deficiency causes a memory T cell phenotype ......................................... 41 2.2.4 T cells of CaV1.4-deficient patients are persistently activated/exhausted ............ 43 2.2.5 B cells of CaV1.4-deficient patients are chronically activated .............................. 44 2.2.6 CaV1.4 deficiency impairs Ca2+ flux in T but not B cells ..................................... 45 2.2.7 PD-L1 and CD32 is downregulated on monocytes of CaV1.4-deficient patients . 47 2.3 Discussion ................................................................................................................. 48 2.4 Material and methods ................................................................................................ 54 Chapter 3: CaV1.4 deficiency in the murine immune system ................................................. 57 3.1 Introduction ............................................................................................................... 57 3.2 Results ....................................................................................................................... 57 3.2.1 Insert disrupts the Cacna1f gene ........................................................................... 57 viii  3.2.2 CaV1.4-deficient mice have a reduced frequency of CD8 T cells ........................ 58 3.2.3 CaV1.4 deficiency leads to a memory T cell phenotype ....................................... 58 3.2.4 CaV1.4-deficient T cells are continuously activated and exhausted ..................... 61 3.2.5 CaV1.4 deficiency causes chronic B cell activation .............................................. 63 3.2.6 CaV1.4-deficient T but not B cells exhibit a reduced Ca2+ flux ............................ 65 3.2.7 CaV1.4 during MHV-68 infection ......................................................................... 67 3.2.7.1 CaV1.4 KO mice exhibit an increased CD4/CD8 T cell ratio postinfection . 67 3.2.7.2 CaV1.4 deficiency leads to a higher CD4 TEff cell frequency postinfection . 68 3.2.7.3 CaV1.4-deficient TCM cells upregulate exhaustion markers postinfection ... 69 3.2.7.4 Chronic B cell activation is amplified in CaV1.4 KO mice postinfection .... 71 3.3 Discussion ................................................................................................................. 72 3.4 Material and methods ................................................................................................ 76 Chapter 4: CaV1.4/DOCK2 double-deficient mice exhibit B cell dysfunction ...................... 78 4.1 Introduction ............................................................................................................... 78 4.2 Results ....................................................................................................................... 80 4.2.1 Double KO mice show a reduction of splenic B cells, particularly MZ B cells. .. 80 4.2.2 BAFF-R induction is impaired in immature double KO B cells .......................... 81 4.2.3 CaV1.4/DOCK2-deficient B cells are chronically activated ................................. 82 4.2.4 Double KO B cells show impaired BCR-mediated activation and proliferation .. 83 4.2.5 Double KO B Cells Fail to Polymerize Actin upon BCR crosslinking ................ 85 4.2.6 CaV1.4/DOCK2 KO B cells display a reduced BCR-induced Ca2+ flux .............. 86 4.2.7 Double KO mice have autoantibodies in their sera .............................................. 87 4.2.8 CaV1.4/DOCK2 KO mice have elevated IgG1 antibody levels in their sera ........ 88 ix  4.2.9 CaV1.4/DOCK2-/- B cells exhibit increased IgG1 class switching in vitro ......... 89 4.2.10 Double KO B cells have normal BCR-mediated p-Syk and p-ERK signalling 91 4.2.11 NFAT and NF-κB signalling is impaired in CaV1.4/DOCK2 KO B cells ........ 92 4.3 Discussion ................................................................................................................. 94 4.4 Material and methods ................................................................................................ 97 Chapter 5: Segregating the CaV1.4-/- and DOCK2-/- phenotype ......................................... 102 5.1 Introduction ............................................................................................................. 102 5.2 Results ..................................................................................................................... 106 5.2.1 Cacna1f-/- mice have normal splenic B cell frequencies. ................................... 108 5.2.2 Cacna1f-/- B cells express normal levels of BAFF-R. ....................................... 109 5.2.3 Cacna1f-/- B cells are still chronically activated. ............................................... 109 5.2.4 Reduced CD4/CD8 T cell ratio segregates with DOCK2 deficiency. ................ 110 5.2.5 Cacna1f-/- T cells still express reduced levels of and IL7R and CD62L. .......... 111 5.2.6 Expression of PD-1 is higher in Cacna1f KO than in double KO T cells. ......... 111 5.2.7 Cacna1f-/- T cells have elevated levels of CTLA-4 ........................................... 112 5.3 Discussion ............................................................................................................... 113 5.4 Material and methods .............................................................................................. 115 Chapter 6: Conclusion .............................................................................................................. 118 6.1 Future directions ..................................................................................................... 119 References ...................................................................................................................................122  x  List of Figures  Figure 1.1 T cell receptor signalling. .............................................................................................. 3 Figure 1.2 Inhibitory receptors during T cell exhaustion. ............................................................ 10 Figure 1.3 Structure of the L-type Ca2+ channel complex. ........................................................... 22 Figure 1.4 Calcium channels in lymphocytes. .............................................................................. 28 Figure 2.1 CaV1.4-deficient patients have a reduced frequency of CD4 T cells .......................... 40 Figure 2.2 CaV1.4 deficiency results in a memory T cell phenotype............................................ 42 Figure 2.3 CaV1.4-deficient T cells are exhausted ........................................................................ 44 Figure 2.4 CaV1.4 deficiency leads to an activated B cell phenotype .......................................... 45 Figure 2.5 CaV1.4-deficient T cells exhibit a reduced Ca2+ flux .................................................. 46 Figure 2.6 Monocytes of CaV1.4-deficient patients show reduced levels of CD32 and PD-L1 ... 47 Figure 2.7 Naïve CD4 T cells express a splice variant of CACNA1F missing exon 32 and 37 ... 48 Figure 3.1 CaV1.4-deficient mice have an insert in their Cacna1f gene. ...................................... 57 Figure 3.2 Cacna1f-/- mice have a reduced frequency of splenic CD8 T cells ............................ 58 Figure 3.3 CaV1.4 deficiency results in a memory T cell phenotype............................................ 60 Figure 3.4 CaV1.4 deficiency results in T cell activation/exhaustion ........................................... 62 Figure 3.5 CaV1.4 deficiency leads to an activated B cell phenotype .......................................... 64 Figure 3.6 CaV1.4-deficient T cells exhibit a reduced Ca2+ flux .................................................. 66 Figure 3.7 MHV-68 infected CaV1.4 KO mice have an increased CD4/CD8 T cell ratio ........... 68 Figure 3.8 MHV-68 infected CaV1.4 KO cells have higher CD4 TEff cell frequencies ................ 69 Figure 3.9 Post MHV-68 infection exhaustion is amplified in TCM cells of Cacna1f-/- mice ..... 70 Figure 3.10 Activation status of B cells is amplified by MHV-68 infection in CaV1.4 KO mice 72 xi  Figure 4.1 CaV1.4/DOCK2 deficiency leads to a reduced number of splenic B cells .................. 81 Figure 4.2 BAFF-R expression is reduced on double KO B cells ................................................ 82 Figure 4.3 CaV1.4/DOCK2 KO B cells are chronically activated ................................................ 83 Figure 4.4 BCR-induced activation is impaired in CaV1.4/DOCK2-deficient B cells ................. 84 Figure 4.5 CaV1.4/DOCK2-deficient mice exhibit impaired BCR-induced proliferation ............ 85 Figure 4.6 BCR-induced actin-clearance is impaired in double KO mice. .................................. 86 Figure 4.7 CaV1.4/DOCK2 deficiency results in reduced BCR-induced Ca2+ flux ...................... 87 Figure 4.8 Double KO mice exhibit elevated levels of α-DNA antibodies .................................. 88 Figure 4.9 Double KO mice exhibited a trend of elevated IgG1 antibody levels in their sera ..... 89 Figure 4.10 Double KO B cells exhibit increased class switching to IgG1 .................................. 90 Figure 4.11 IgG1 germline transcription is upregulated in double KO B cells ............................ 91 Figure 4.12 BCR-induced phosphorylation of ERK and Syk is normal in double KO B cells .... 92 Figure 4.13 BCR-induced NFAT translocation is impaired in double KO B cells. ..................... 93 Figure 4.14 BCR-induced NF-κB translocation is impaired in double KO B cells. ..................... 93 Figure 5.1 The Dock2Hsd allele exists in our CaV1.4 KO mouse model ..................................... 106 Figure 5.2 Double KO mice were bred to get homozygous single KO mice. ............................ 107 Figure 5.3 Breeding yielded a few mice that were Cacna1f-/- devoid of Dock2Hsd ................... 108 Figure 5.4 Most of the B cell phenotype segregates with the Dock2 mutation .......................... 110 Figure 5.5 CaV1.4-/- T cells exhibit upregulated levels of PD-1 and CTLA-4, a T cell phenotype not observed in double-KO mice ................................................................................................ 112  xii  List of Abbreviations  APC Antigen presenting cells ATP Adenosine triphosphate BAFF B cell activating factor BAFF-R BAFF-Receptor BCR B cell receptor Ca2+ Calcium CACNA1F Calcium voltage-gated channel subunit alpha1 f CRAC channel Ca2+ release-activated Ca2+ channel CSNB Congenital stationary night blindness CTLA-4 Cytotoxic T lymphocyte-associated protein 4 DAG Diacylglycerol DOCK2 Dedicator of cytokinesis 2 EAE Experimental autoimmune encephalomyelitis ER Endoplasmic reticulum ERK Extracellular signal-regulated kinase IFN Interferon IL Interleukin IMD Immunodeficiency IP3 Inositol trisphosphate IP3R IP3 receptor LCMV Lymphocytic choriomeningitis virus xiii  MHC Major histocompatibility complex MHV-68 Murine gammaherpesvirus 68 MZ Marginal zone NFAT Nuclear factor of activated T cells NF-κB Nuclear factor κB NMDAR N-methyl-D-aspartate receptor PBMCs Peripheral blood mononuclear cells PD-1 Programmed cell death protein 1 PIP2 Phosphatidylinositol 4,5-bisphosphate PLCγ1 Phospholipase Cγ1 RyR Ryanodine receptor SCID Severe combined immunodeficiencies SOCE Store-operated Ca2+ entry STIM1 Stromal interaction molecule 1 Syk Spleen tyrosine kinase TCM cell Central memory T cell TCR T cell receptor TEff cell Effector T cell TEM cell Effector memory T cell TFH T follicular helper TH1 T helper 1 TH17 T helper 17 TH2 T helper 2 xiv  TNF Tumour necrosis factor Tregs Regulatory T cells  TRP  Transient receptor potential TRPA TRP ankyrin  TRPC TRP canonical TRPM TRP melastatin TRPML TRP mucolipin TRPP TRP polycystin TRPV TRP vanilloid VDCC Voltage-dependent Ca2+ channels xv  Acknowledgements  First, I would like to thank my supervisor Dr. Wilf Jefferies for his continuous support, his original ideas and encouragement throughout my Ph.D. I am also grateful to all my lab members for making the time in the lab an enjoyable and cheerful one. Particularly, I would like to thank KB Choi and Dr. Lilian Nohara, Lonna Munro and Dr. Cheryl Pfeifer for providing technical assistance, managing our mouse colonies, ordering reagents and always having all animal/human ethics protocols in place.  I also want to thank my committee members Drs. Michael Gold, Ken Harder and Martin Hirst for their time and effort as well as their valuable input during committee meetings.  Thank you also to the patients and their family for their willingness to participate in our study.  Also, I am thankful to the Austrian Academy of Sciences for awarding me a DOC scholarship that funded three years of my Ph.D. as well as Dr. Maryana Apel for her generous scholarship in memory of her son Dr. Dmitry Apel.  Thank you so much to Sarah Mansour for being an amazing companion and going with me through the ups and downs of my PhD.   Lastly, I also want to thank my family for all their support and always believing in me.  xvi  Dedication  To my family.  1  Chapter 1: Introduction  1.1 T cells and adaptive immunity T cells are important players of the adaptive immune response and essential to fight pathogens that invade our body. They also play critical roles during autoimmune diseases, which is why their activation and signalling needs to be strictly regulated. Activation of T cells occurs by binding of their specific T cell receptor (TCR) to a peptide presented on major histocompatibility complex (MHC) proteins on the surface of an antigen presenting cell (APC). The fate of a T cell depends on the strength of this TCR-MHC binding interaction and costimulatory signals, as well as the developmental stage of the T cell at the time of binding. During T cell maturation, low-affinity binding of self-antigen leads to a tonic pro-survival signal that maintains the homeostasis of a T cell. A high-affinity interaction with self-antigen during development will result in negative selection and the T cell will undergo apoptosis [1]. In a mature naïve CD8 T cell, a strong TCR signal activates the T cell to differentiate into a cytotoxic T cell, which confers cell-mediated immunity by destroying pathogen-infected cells. An activated CD4 T cell helps to activate B cells, which provide humoral immunity against extracellular pathogens [2].  1.1.1 TCR/BCR signalling When a T cell with its TCR binds to antigen-peptide presented on the MHC (peptide-MHC) of an APC, a signalling cascade, which includes various phosphorylation events, is triggered (Figure 1.1). The signalling molecules that are activated during early TCR signalling include, among others, the Lck (lymphocyte-specific protein tyrosine kinase), the Syk (spleen tyrosine kinase) family kinase ZAP-70 (zeta-activated protein 70 kDa) and LAT (linker for activation of 2  T cells), which forms a complex with SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa). SLP-76 recruits VAV, which initiates cytoskeleton remodelling via the GTPase Rac1, which is also dependent on the guanine nucleotide exchange factor DOCK2. The LAT/SLP-76 complex also recruits phospholipase C (PLC)γ1 to cleave the membrane phospholipid PIP2 (phosphatidylinositol 4,5-bisphosphate) into IP3 (inositol trisphosphate) and DAG (diacylglycerol) [3]. DAG triggers NF-κB (nuclear factor κB) through PKC-θ (protein kinase C- θ), which is also Ca2+ dependent, and the ERK (extracellular signal-regulated kinase) signalling pathway. The other PIP2 cleavage product IP3 binds to the IP3 receptor (IP3R) on the membrane of the endoplasmic reticulum (ER), which leads to the release of calcium (Ca2+) from the ER into the cytoplasm. Upon Ca2+ depletion of the ER, Ca2+ channels in the plasma membrane are activated and lead to the influx of more Ca2+ from the extracellular space. Calmodulin then binds to Ca2+ and forms a complex with calcineurin. This complex subsequently dephosphorylates NFAT (nuclear factor of activated T cells) in the cytoplasm, which leads to its nuclear translocation and subsequent transcription of target genes (Figure 1.1). B cells are central mediators of the humoral immune response and fight extracellular pathogens by secreting antibodies. To produce antibodies a B cell must initially be activated by binding of antigen to its B cell receptor (BCR). It usually also requires signals from an activated helper T cell with the same antigen specificity. Consequently, the B cell can then differentiate into an antibody-producing plasma cell. Like T cell signalling, the signalling cascade triggered by BCR engagement causes the activation/phosphorylation of several downstream molecules, including Syk, BTK (Bruton tyrosine kinase), BLNK (B cell linker) and PLCγ2, eventually resulting in IP3 production. As in T cells, IP3 subsequently leads to the increase of intracellular Ca2+, NFAT translocation, and transcription of target genes [4]. 3   Figure 1.1 T cell receptor signalling.4  Figure 1.1 Continued. Upon its phosphorylation by Lck, CD3 recruits and activates the Syk family kinase ZAP-70, which then phosphorylates a complex of the membrane-associated scaffold molecules LAT and SLP-76. The guanine nucleotide exchange factor VAV1 then binds to SLP-76 and promotes cytoskeletal rearrangements via the DOCK2 dependent GTPase Rac1. The LAT/SLP-76 complex also recruits PLCγ1 to cleave PIP2 into IP3 and DAG. DAG triggers the NF-κB signalling pathway through the activation of PKC-θ, which is also Ca2+ dependent, as well as ERK signalling via Ras and Raf. ERK signalling can also be turned on by the exchange factor SOS (son of sevenless), which is recruited by LAT. The other PIP2 cleavage product IP3 binds to the IP3R on the membrane of the ER, which leads to the release of Ca2+ from the ER into the cytoplasm. Upon depletion of this Ca2+ store, Ca2+ channels in the plasma membrane are activated and lead to the influx of extracellular Ca2+. Calmodulin then binds to Ca2+ and forms a complex with calcineurin. This complex subsequently dephosphorylates cytoplasmic NFAT, which leads to its nuclear translocation and transcription of target genes. Figure was adjusted from “Smart Servier Medical Art” at smart.servier.com, licensed under a Creative Commons Attribution 3.0 Unported License.  1.1.2 T cell development T cells progenitors migrate from the bone marrow into the thymus, their primary maturation site. Here their TCR genes are rearranged and somatically mutated to create a vast repertoire of antigen-specific cells. Subsequently, the thymocytes undergo selection. Cells that have low affinity for self-antigen (which is presented by MHC) are positively selected. Autoreactive progenitor T cells that bind strongly to self-peptide-MHC, on the other hand, are negatively selected to avoid autoreactivity of mature T cells in the periphery [5,6]. In the thymus medullary thymic epithelial cells and thymic dendritic cells present tissue-specific self-antigens to the thymocytes so that positive and negative selection can take place [7]. From this selection process emerge conventional naïve CD4 and CD8 αβ T cells that leave the thymus and migrate to the periphery, where they are ready to respond to invading pathogens [8].  5  1.1.3 T cell immune response During an acute infection, antigen-specific T cells become activated by foreign bacterial or viral peptides presented on APCs in the context of MHC. They then enter an expansion phase in which they proliferate and turn into effector T (TEff) cells. These TEff cells then enter the bloodstream to migrate to sites of infection. In the case of an intracellular viral or bacterial infection a type I immune response is triggered. This entails the differentiation of naïve CD8 T cells into cytotoxic T cells, which produce perforins and granzymes to induce apoptosis in infected target cells. Cytotoxic T cells are also important producers of cytokines like interferon γ (IFNγ) and tumour necrosis factor α (TNFα) [9]. CD4 T cells, on the other hand, differentiate into T helper 1 (TH1) cells, which also secrete IFNγ and TNFα as well as interleukin 2 (IL-2) to aid the cytotoxic T cells in killing their target cells. At the same time, a small subset of CD4 T cells matures into T helper 2 (TH2) and T follicular helper (TFH) cells. TH2 and TFH cells help B cells in forming germinal centers and producing high-affinity antibodies, which play an important role in fighting extracellular pathogens [10]. Another subset of the T helper cell lineage are T helper 17 (TH17) cells, named after their capacity of producing IL-17. They recruit neutrophils and macrophages to infected tissues and stimulate other immune cells to produce pro-inflammatory cytokines [11]. Lastly, regulatory T cells (Tregs), exert a suppressive effect on the immune system, by inhibiting uncontrolled expansion of effector T cells and avoiding autoimmune responses [12].  After clearing the invading pathogen, the immune system will enter the contraction phase in which most of the specific TEff cells will die off. However, a fraction will survive to develop into memory cells. These cells are able to provide long-term immunity by rapidly mounting an 6  immune response upon a secondary infection [13]. TEff cells that express the pro-survival receptor IL7-R are more likely to become memory T cells. IL7-R signalling gives the developing memory cells the ability to survive over long periods of time, independent of the presence of their cognate antigen, thanks to their self-renewal ability, that is induced by the IL-7R ligands as well as IL-15 [14]. Memory T cells can be further divided into two subsets: Central memory (TCM) and effector memory T cells (TEM). TCM cells are generally found in secondary lymphoid organs and have great proliferative potential. They can therefore quickly differentiate into secondary TEff cells in a recall response and produce cytokines like IL-2. TEM cells, on the other hand, reside in non-lymphoid tissues and have a shorter lifespan. They can, however, rapidly carry out effector functions such as cytotoxicity. In a secondary infection CD4 TEM immediately secrete cytokines such as IFNγ and TNFα whereas CD8 TEM rapidly produce granzymes and perforins to kill the already known target [9,15].  1.1.4 T cell exhaustion Generally, in acute infections, effector functions of memory CD8 T cells improve further after a secondary infection. Secondary memory CD8 T cells are therefore more efficient in fighting pathogens than their primary counterparts. However, in mice it was found that during chronic infections, like, for example, by lymphocytic choriomeningitis virus (LCMV), secondary memory CD8 T cell were less able to control the infection than primary memory CD8 T cells. The T cells exhibit an exhaustion phenotype [16]. This a phenomenon that occurs in many chronic infections where persistent exposure to antigen continuously stimulates T cells leading to prolonged inflammation. During such conditions, memory T cells enter an entirely different differentiation program that ends in T cell exhaustion. Exhausted T cells were first discovered in 7  mice during chronic viral infection in which T cells became activated but exhibited no effector functions [17]. Apart from this lack of effector functions, an exhausted T cell is further characterized by the expression of inhibitory receptors, the inability to survive long-term independent of its cognate antigen, a distinct epigenetic profile and as a result, an altered transcriptome compared to that of effector or memory T cells. The latter also includes the lack of transcriptional modules for quiescence as well as an altered use of transcription factors and hence differentially expressed immune response genes [18]. The severity of exhaustion is based on antigen persistence. In a chronic LCMV infection model, early removal of antigen allowed the T cells primed for exhaustion to revert and develop into functional memory T cells. However, prolonged exposure to the antigen pushed the T cells to a point of no return where they lost this plasticity and where they were fully committed to T cell exhaustion. A functional memory response could not be restored even after removing the antigen [19,20].  The inhibitory receptors that exhausted T cells upregulate, include programmed cell death protein 1 (PD-1), lymphocyte activation gene 3 (LAG3), B And T Lymphocyte-Associated protein (BTLA), 2B4, CD160, T cell immunoglobulin domain and mucin domain-containing protein 3 (TIM-3), T cell immunoreceptor with immunoglobulin and ITIM domains (TIGIT) and cytotoxic T lymphocyte-associated protein 4 (CTLA-4) [21] (Figure 1.2). Inhibitory receptors negatively regulate TCR signalling pathways and are usually expressed transiently during activation of TEff cells to prevent excessive immune responses. Because of their immune-dampening properties, they also play an important role in tolerance and preventing autoimmunity [22]. Their sustained expression, however, is typically used to identify exhausted T cells [23]. The higher the number of different inhibitory receptors that are upregulated the more severe and 8  the better the evidence for exhaustion. This notion has been demonstrated in several chronic infections where PD-1 upregulation coincided with increased expression of other inhibitory markers like CTLA-4, LAG3 or TIM-3 [24–26]. Like chronic infections in mice, T cell exhaustion was also observed in humans during HIV infection or cancer, where the immune system loses control over infections and tumours respectively. By targeting inhibitory molecules like PD-1 and CTLA-4 it is possible to modulate the downstream inhibitory pathways and take the brakes off the immune response and reverse exhaustion [27,28].  Apart from these characteristic inhibitory receptors, also the presence of several cytokines is a hallmark of T cell exhaustion. These include type I IFNs, as well as immunosuppressive cytokines like IL-10 and TGFβ. Type I IFNs like IFNα and IFNβ have important antiviral properties and play an integral role in acute infections. However, in chronic infections type I IFNs lead to chronic immune activation, resulting in the promotion of T cell exhaustion and disease progression. Interestingly, blockade of the type I IFN pathway can reverse the exhaustion phenotype and eventually lead to control of the chronic viral infection [29,30]. Also, IL-10 production is significantly upregulated in chronic infection in mice resulting in the suppression of cellular immune responses. The use of IL-10 receptor blockers was shown to reverse T cell exhaustion in these mice and led to resolution of the infection [31,32]. TGFβ signalling in CD8 T cells is another pathway that is amplified during chronic infections. While TGFβ upregulation did not cause functional exhaustion of T cells, it did lead to the apoptosis of virus-specific CD8 T cells. Attenuation of TGFβ signalling rescued T cells from apoptosis and led to clearance of the viral infection [33].   9  One of the main transcription factors (TFs) controlling T cell exhaustion is NFAT. Its overexpression triggered a typical T cell exhaustion phenotype such as decreased TCR signalling and upregulation of inhibitory receptors. Furthermore, in a mouse model, it decreased the ability of CD8 T cells to control Listeria infections as well as tumour growth [34]. The TFs T-bet and EOMES are both expressed by functional CD8 TEff cells, whereas exhausted T cells can be divided into two subsets that either express one or the other. One subset is T-bet+ PD-1int and constitutes progenitor cells that are still able to proliferate. T-bet has been shown to repress PD-1 expression in these cells, probably giving them the ability to still proliferate [35]. However, prolonged antigen exposure of these cells leads to further proliferation but also the loss of T-bet expression and instead the upregulation of EOMES. The resulting terminally differentiated EOMES+ PD-1+ cells constitute the other subset and are much larger in number.  Recently it was found that exhausted T cells not only display changes in their mRNA transcription but also exhibit a different epigenetic landscape that distinguishes them from TEff cells. Interestingly, this epigenetic profile remained unchanged when exhausted T cells were reinvigorated by blocking PD-L1, the ligand of PD-1. Although the cells temporarily regained their effector functions they reverted to an exhausted state after removal of the blockade [36,37]. This shows that antibody treatment, despite temporary revitalization, is not sufficient to reprogram exhausted T cells to acquire a functional memory state.   10   Figure 1.2 Inhibitory receptors during T cell exhaustion. Upon binding of antigen to the TCR a naïve T cell differentiates into an effector cell, which produces inflammatory cytokines as well as granzyme B to attack infected target cells. During that phase effector cells also transiently upregulate several inhibitory receptors like BLTA, PD-1, CTLA-4, LAG3, TIM-3, and TIGIT. After antigen clearance, effector cells will develop into memory T cells in which the expression of most inhibitory receptors is again downregulated. However, if the antigen persists these receptors will continue to be expressed on the cell surface dampening the immune response of the T cells. This will eventually result in the loss of cytotoxicity and a T cell becomes exhausted. Figure was adjusted from “Smart Servier Medical Art” at smart.servier.com, licensed under a Creative Commons Attribution 3.0 Unported License11  1.2 Calcium channels in lymphocytes Calcium (Ca2+) signalling is a vital event in lymphocytes as it regulates various fundamental processes including, differentiation, activation, proliferation, survival, and apoptosis. The mechanisms that govern the levels of intracellular Ca2+ involve membrane receptors, signalling molecules and a diverse array of Ca2+ channel. Antigen receptor-induced increase of cytosolic Ca2+ in lymphocytes is a well-understood event nowadays. At the end of the signalling cascade initiated by antigen receptor stimulation Ca2+ is released from intracellular stores into the cytoplasm. This is followed by Ca2+ entering the cell from the extracellular space through Ca2+ channels in the plasma membrane [38]. Over the last 20 years, there has been significant progress identifying and characterizing these plasma membrane channels. The expression of different Ca2+ channels can vary based on the subset of lymphocyte and the stage of lymphocyte maturation. Also, it is not uncommon that these channels are expressed as novel splice variants, often modifying their gating characteristics [39]. Importantly, these channels play an integral role in lymphocyte development and effector functions, which will be explored further in this section.  1.2.1 CRAC channel (Orai1, STIM1) The best-described mechanism of extracellular Ca2+ entering lymphocytes is through the Ca2+ release-activated Ca2+ (CRAC) channel. TCR/BCR engagement triggers a signalling cascade that leads to the depletion of Ca2+ levels in the ER. The Ca2+ levels in the ER are monitored by the Ca2+ sensing protein stromal interaction molecule 1 (STIM1), the regulatory subunit of the CRAC channel. STIM1 proteins, which are usually readily spread-out in the ER membrane, oligomerize in certain puncta during low levels of Ca2+. These areas are in close proximity to the plasma membrane so that STIM1 can interact with and activate Orai1, the pore forming unit of 12  the CRAC channel and trigger a Ca2+ influx from the extracellular space (Figure 1.4). The process is termed store-operated Ca2+ entry (SOCE) and the CRAC channel is the prime example of it [40,41]. The existence of the CRAC channel in T cells was recognized well before its constituents Orai1 and STIM1 were discovered [42]. In fact, SOCE and CRAC channel deficiencies were known to lead to severe combined immunodeficiencies (SCID) in several patients [43–45]. These patients exhibited normal T cell development but a reduced TCR-induced Ca2+ current and other effector function defects resulting in life-threatening recurrent infections, such as pneumonia and severe cytomegalovirus infections [43–45]. A decade after the initial pathogenic characterization of these patients, genomic linkage analysis of more CRAC channel-deficient patients [46–48] as well as RNA interference screens in Drosophila cells [49,50] identified Orai1 and STIM1 as the main components of the CRAC channel. The CRAC channel-deficient patients harboured mutations in either the Orai1- or STIM1- encoding genes that led to an abrogation of their T cell Ca2+ influx and CRAC channel function. Depending on whether the mutated gene was Orai1 or STIM1 the resulting disease was termed immunodeficiency 9 or 10 (IMD9 or IMD10) respectively. Soon after, it was confirmed in a mouse model that Orai1 and STIM1 were the building blocks of the CRAC channel and that their deficiency led to a reduced SOCE [51,52].   While the role of Orai1 is now well described in the literature, its paralog Orai2 has not yet been fully characterized. Recently, Veath et al. reported that while Orai1/Orai2 double-deficient T cells were completely devoid of SOCE, the deletion of the paralog Orai2 alone surprisingly increased SOCE into mouse cells [53]. The authors went on to demonstrate that this phenomenon was due to Orai1 and Orai2 forming a heteromeric CRAC channel, in which Orai2 conferred an 13  inhibitory role to fine-tune immune responses. The STIM1 paralog STIM2 was also found to regulate Ca2+ flux but its absence, however, did not cause equally severe defects as STIM1 deficiency and interfered mostly with sustained Ca2+ influx [52].  On a molecular level, Orai1 and STIM1 deficiency impairs the downstream NFAT pathway. This is true in humans as seen in the previously described CRAC channel-deficient SCID patients [46,48] as well as in mice. In a mouse model, STIM1 deficiency led to reduced SOCE and impairment of the NFAT pathway. This further resulted in defects in cytokine production and cell proliferation [52,54]. Comparable observations were also made in T cells of Orai1-/- mice [51,55]. Furthermore, Shaw et al. found that antiviral responses of T cells required a functional CRAC channel. Without STIM1/2 during viral infections CD8-naïve T cells could not fully differentiate into cytolytic TEff cells and, as such, they exhibited impaired recall responses upon secondary infections [56]. As a result, acute viral infections would turn chronic. Similarly, STIM1/2 was also required to prevent engraftment and control the growth of tumours in a melanoma and adenocarcinoma mouse model [57]. Finally, also T cell homing is dependent on a functional CRAC channel. T cell migration into peripheral organs like the spleen and lymph nodes was impaired in human and mouse T cells transduced with the dominant negative Orai1 E106A mutant [58]. However, another study found no defects in homing when examining T cells expressing the similar Orai1 E106Q mutant [59], leaving this aspect controversial.  While Orai1 and STIM1 were important for proper effector functions of T cells, they were dispensable for their maturation, as demonstrated in traditional murine TCRαβ+ T cells [51]. Conversely, agonist selected T cells, which include regulatory T cells (Tregs) and invariant 14  natural killer T cells, exhibited defective development in the absence of STIM1 [52,60]. It is believed that this occurred due to reduced NFAT translocation, which is necessary for the induction of forkhead-box-protein P3 (FOXP3), a transcription factor required for differentiation and function of Tregs [61]. Also, for further differentiation of naïve CD4 T cells to T helper 17 (TH17) cells, Orai1 was indispensable, as shown by pharmacological inhibition. TH1 and TH2 cell differentiation, on the other hand, was not affected [62]. This, too, was due to impaired NFAT signalling, which would normally activate the TH17 lineage transcription factor retinoic-acid-receptor-related-orphan-receptor (ROR) but did not do so after Orai1 inhibition. Given the proinflammatory role of TH17 cells, it makes sense that in vivo this suppression of TH17 differentiation translated to reduced severity of experimental autoimmune encephalomyelitis (EAE), a murine model of multiple sclerosis. Similarly, T cell-specific STIM1 and STIM2 deficiency was found to reduce EAE severity by impairing TH1 and TH17 proinflammatory cytokine production [63]. Intriguingly, graft-versus-host disease was also attenuated following adoptive transfer of STIM1-deficient CD4 T cells into MHC-mismatched recipient mice [54].  Along with T lymphocytes, it was demonstrated that Orai1-deficient B cells also exhibited impaired BCR-induced Ca2+ flux, as well as defects in cell proliferation [51]. While Orai1 and STIM1-deficient B cells were left with a residual Ca2+ flux, STIM1/2 double deficiency led to a complete abrogation of Ca2+ flux and even more severe proliferation defects [64]. Intriguingly the antibody responses of these B cells were normal, suggesting the mechanisms controlled by STIM1/2 do not regulate this process. However, STIM1/2 deficiency also led to impaired IL-10 production due to defective NFAT signalling upon BCR crosslinking. The anti-inflammatory cytokine IL-10 is a negative regulator of auto-immunity. Its absence caused by B cell-specific 15  STIM1/2 deficiency has been shown to aggravate disease severity in an EAE mouse model [64]. Analogous to T cells, B cells developed normally in the absence of STIM1. However, STIM1 overexpression increased the Ca2+ entry into maturing B cells and was sufficient to activate a newly discovered proapoptotic ERK signalling pathway predisposing the cells to negative selection [65,66]. In conclusion, T cells are more dependent on CRAC channels than B cells as the mediated Ca2+ flux is not required for antibody production and other B cell related immune responses [38].  Despite the CRAC channel being the best-studied contributor to the TCR/BCR-induced Ca2+ flux, several additional Ca2+ channels have been detected in the plasma membrane of lymphocytes [67].   1.2.2 TRPs The transient receptor potential (TRP) protein contains six transmembrane domains of which the two most C-terminal ones encompass the pore-forming domain [68]. Currently, 28 mammalian TRP channel homologs have been described and can be divided into six subfamilies based on their amino acid sequence: TRPC (canonical), TRPM (melastatin), TRPV (vanilloid), TRPA (ankyrin), TRPML (mucolipin), and TRPP (polycystin). TRP channels are permeable for Ca2+ and sodium cations and are best known for their role as pain receptors in the field of neuroscience [69]. However, there also exists accumulating evidence for a functional role of TRP channels in lymphocytes. In fact, before the discovery of Orai1, several TRP channels were suspected to encode the pore forming unit of the CRAC channel and to be responsible for SOCE [70,71]. Instead, TRPV1, for example, is now known to contribute to the TCR-induced Ca2+ flux 16  as a non-SOCE channel in CD4 T cells. Using a TRPV1-/- mouse model Bertin et al. showed that the ensuing reduced Ca2+ flux translated to impaired TCR signalling and subsequent defects in T cell activation and cytokine production. In vivo TRPV1 deficiency was also shown to be protective in a mouse model of CD4 T cell mediated colitis [72]. Additionally, the functional role of TRPV1 was confirmed in human CD4 T cells using siRNA and antagonists [73]. Furthermore, the authors reported a similar role for TRPV4, as its inhibition was also found to reduce the TCR-induced Ca2+ influx as well as T cell activation and cytokine production in mouse and human CD4 T cells. By contrast, TRPA1 was found to inhibit the activity of TRPV1. TRPA1 deficiency, therefore, resulted in an amplified TCR-induced Ca2+ flux and subsequent hyperactivation of CD4 T cells as well as increased severity of colitis [74]. In TEff cells, TRPC5 was upregulated upon binding of GM1 ganglioside to galectin-1 expressed on Tregs. The binding event provoked a Ca2+ flux in TEff cells and inhibited their proliferation. This Ca2+ flux and the proliferation inhibition were both diminished after knockdown of TRPC5, demonstrating the contribution of TRPC5 in TEff cells to autoimmune suppression by Tregs [75]. Another TRP channel important for T cell effector function is TRPM2 [76]. A deficient mouse model exhibited reduced T cell proliferation and proinflammatory cytokine secretion after TCR stimulation. The absence of TRPM2 also led to an attenuated phenotype of EAE. In another study using Jurkat cells, it was shown that TRPM2 can also be activated and provoke a Ca2+ flux by stimulation with the second messenger molecules cyclic ADP-ribose (cADPR) and nicotinic acid adenine dinucleotide phosphate (NAADP) [77]. Another member of the TRPM family, namely TRPM4 plays a role in T helper cells. TRPM4 demonstrated opposite functions in TH1 and TH2 cells. While siRNA mediated knockdown diminished Ca2+ flux in TH1 cells Ca2+ flux was amplified in TH2 cells. Accordingly, NFAT nuclear translocation and IL-2 secretion 17  decreased in TH1 and increased in TH2 cells upon inhibition of TRPM4 mRNA [78]. Finally, TRPC3 is another channel with a functional role in T cell as its mutation is associated with a reduction of the TCR-mediated Ca2+ flux in Jurkat cells [79]. Accordingly, siRNA knockdown in human CD4 T cell causes a proliferation defect [80]. More studies in Jurkat cells using shRNA and specific inhibitors suggest that apart from TRPC3 also TRPC6 contributes to the Ca2+ flux [81,82].  In B cells, very little is known about the role of TRP channels. Although TRPC1, 3 and 7 all were shown to be involved in BCR-induced signalling these observations have so far been limited to the DT40 chicken B cell line [83–85]. Recently, however, a clinical study of patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) revealed that TRPM3 is expressed on B as well as natural killer (NK) cells of healthy donors and reduced on CFS/ME patients. Additionally, the Ca2+ influx upon BCR stimulation or thapsigargin treatment was significantly reduced in the patient’s B cells compared to healthy controls [86].  1.2.3 IP3Rs and RYRs IP3 receptors (IP3Rs) are well described in the ER membrane, where they release Ca2+ from the ER stores into the cytoplasm upon binding of their ligand IP3 [87]. As described earlier, IP3 is the product of PIP2 cleavage upon antigen receptor stimulation. There have also been a few reports of IP3R presence in the plasma membrane of T cells although their role is not quite clear [88,89]. In DT40 chicken - and mouse B cells it was reported that only about 1-3 functional IP3Rs are located in the plasma membrane where they conduct, despite their small number, a substantial BCR-induced Ca2+ current [90,91]. This is in stark contrast to many 1000s of Orai1 proteins 18  spread throughout the plasma membrane and might facilitate the entry of extracellular Ca2+ at very specific foci [92].   Similar to IP3Rs, ryanodine receptors (RyRs) are located in the ER membrane. In cardiac- and muscle cells they release Ca2+ from intracellular stores upon excitation [93]. RyRs occur in three different isoforms RyR1-3. RyR1 has been detected in B cells and several mutations have been associated with increased basal Ca2+ concentrations, likely causative of malignant hyperthermia (MH) [94]. Stimulating naïve B cell with 4–chloro–m–cresol, a potent activator of RyR1, showed a greater Ca2+ response in B cells of MH patients compared to controls and also correlated with a greater metabolic activity [95]. Another study demonstrated that caffeine, which is also used to activate RyRs increased intracellular Ca2+ concentrations in naïve splenic lymphocytes from mice [96]. The activity RyRs was found to be ligand-modulated by cADPR [97]. In T cells, cADPR has Ca2+ mobilizing properties and pharmacological studies in Jurkat T cells have confirmed that these properties indeed are conferred through RyRs [98]. RyRs have also demonstrated functional roles in primary human T cells. RyR inhibitors reduced the amount of TH1 and TH17 cells in cultured human T cells. Additionally, a gain of function mutation of RyR1 in an EAE mouse model exacerbated disease, while a RyR inhibitor alleviated disease symptoms [99].    1.2.4 P2X receptors Purinergic P2X receptors are cation channels that can flux Ca2+ and sodium into the cell and potassium out. They do so upon the binding of the energy metabolite and nucleic acid building block adenosine triphosphate (ATP), giving it a role as a signalling molecule [100]. Of the seven 19  P2X receptors that have been identified, foremost P2X7 but also P2X1, P2X4, and P2X5, have been detected and were shown to be functional in T lymphocytes. ATP is usually released by stressed or apoptotic cells through membrane channels, such as pannexin-1. ATP is consequently amplified and spread in an autocrine/paracrine fashion by binding to P2X receptors on the cells the ATP was released from, as well as neighboring cells [101]. This mechanism was found to play an important role in negative selection during T cell development. The high number of apoptotic cells led to high extracellular ATP concentrations. The high ATP concentration resulted in ATP-induced apoptosis of nearby thymocytes, which was mediated by the activation of the P2X7 receptor [102]. Additionally, also in mature T cells, P2X7 was essential for induction of cell death not only by ATP but also nicotinamide adenine dinucleotide (NAD) at much lower concentrations [103]. ATP is also released by activated T cells through pannexin-1 hemichannels and causes autocrine activation of P2X receptors. P2X receptor activation was found to be essential for sustained ERK signalling in murine cells; its disruption using pharmacological inhibitors decreased IL-2 expression and T cell proliferation [104]. Similarly, using P2X7 inhibitors caused a reduction of TCR-mediated Ca2+ flux in Jurkat cells and impaired IL-2 production in human peripheral blood mononuclear cells (PBMCs). Accordingly, scavenging extracellular ATP in Jurkat cells reduced the TCR-induced Ca2+ flux as well as IL-2 production [105]. Paracrine ATP signalling was also found to reduce the motility of neighboring bystander T cells. This was mediated by P2X4 and P2X7 and may aid in the creation of clusters of lymphocytes during an antigen challenge [106]. Furthermore, P2X7 was essential for ATP-induced shedding of CD62L, CD27, CD23 as well as IL-6R in human T cells. This shedding often converts the membrane proteins into soluble effector proteins and was further demonstrated to be conferred through metalloproteases [107–110]. Another study demonstrated that in Tregs 20  P2X7 activation inhibited the immunosuppressive role of the cells and instead promoted their conversion to TH17 cells in vivo. P2X7 inhibition, on the other hand, promoted the differentiation of CD4 T cells into Tregs [111]. P2X1 and P2X4 have also been detected in human peripheral blood CD4 T cells and were shown, together with pannexin1, to translocate to the immune synapse upon T cell activation. Pharmacological antagonism and genetic mutation of both P2X receptors as well as removal of extracellular ATP reduced TCR-mediated Ca2+ flux as well as NFAT translocation and IL-2 synthesis. It is therefore thought that ATP release induced by TCR-stimulation and subsequent ATP binding to the P2X channels governs T-cell activation at the immune synapse [112]. Finally, a novel P2X5 transcript was discovered in human CD4 T cells and its expression was upregulated upon T-cell activation. Its SiRNA-mediated knockdown led to an increased production of IL-10 [113].  1.2.5 NMDA receptors N-methyl-D-aspartate (NMDA) receptors (NMDARs) are ionotropic glutamate receptors that permeate Ca2+ upon binding of the neurotransmitter L-glutamate. They are best described in neurobiology, where their dysfunction has been associated with several neurological disorders such as stroke, epilepsy and Alzheimer’s disease [114]. However, NMDARs have also been identified in lymphocytes and have demonstrated roles in immune regulation [40].  Pharmacological studies demonstrated that NMDARs antagonists can inhibit thapsigargin-induced Ca2+ flux in T cells. Since Ca2+ release from intracellular stores was not affected while Ca2+ entry from the extracellular space was reduced, NMDARs are thought to participate in SOCE. In the same publication, it was shown that NMDAR inhibition impaired mainly Ras/Rac dependent signalling [115]. In another study using NMDAR blockers in thymocytes, it was 21  found that NMDARs were required for caspase-3 activation, implying a role of NMDARs in apoptosis. During this process, NMDARs were recruited to the immunological synapse where the thymocytes and antigen-pulsed dendritic cells bound to each other. Glutamate released by the dendritic cells bound to the NMDARs of the T cells triggering the Ca2+ signalling pathway and caspase-3 activation [116]. In another study, the use of NMDAR antagonists led to dysfunctional antigen-specific T cell proliferation as well as cytotoxicity of mature T cells and impaired the migration of the cells toward chemokines. Molecularly this was associated with reduced Ca2+ signalling and downstream impairment of NFAT and ERK signalling. Furthermore, NMDAR inhibition also diminished the cytokine production of antagonist-treated TH1 and TH2 cells [117]. Interestingly these observations could not be confirmed in an NMDAR-deficient mouse model. Instead, the authors found that NDMAR blockers impaired the conductivity of the potassium channels Kv1.3 and KCa3.1. As most pharmacological NMDAR studies used the same inhibitors this should be taken into consideration when evaluating their results.  1.2.6 CaV channels The voltage-dependent Ca2+ channels (VDCC) or CaV channels are expressed in neuronal and muscle cells where they flux Ca2+ in response to membrane depolarization [118]. They are grouped into three major families, which are further divided into different subtypes based on their amino acid sequence: CaV1 family (CaV1.1–CaV1.4) contains L (long-lasting and large)-type channels; the CaV2 family consists of P/Q (Purkinje)-type (CaV2.1), N (neuronal)-type (CaV2.2), and R (toxin-resistant)-type (CaV2.3) channels; and the CaV3 channels (CaV3.1–CaV3.3) are also referred to as the T (transient and tiny)-type channels [119].   22  The fully assembled CaV channels are structurally comprised of the α1, α2δ, β and the γ subunits (Figure 1.3). The α1 subunit forms the pore in the membrane. It consists of four homologous repeated domains (I–IV), each containing six transmembrane segments (S1–S6). S5 and S6 are separated by a pore-forming loop (P-loop) including the ion-selectivity filter between, while the S4 region contains the voltage sensor. The auxiliary subunits α2δ and β do not take part in pore formation but instead modulate the expression and biophysical properties of the channel. While the γ channel was found to also constitute the L-type channels, very little is known about its function [119].   Figure 1.3 Structure of the L-type Ca2+ channel complex. The L-type Ca2+ channel family CaV1 consists of the α1, α2δ, β and the γ subunits. The α1 subunit forms a tetramer (only 2 units shown here) that creates the pore in the membrane. The auxiliary subunits α2δ, β, and γ don’t take part in formation but regulate the expression of the channel and influence its biophysical properties. Figure was adjusted from “Smart Servier Medical Art” at smart.servier.com, licensed under a Creative Commons Attribution 3.0 Unported License.  23  Several studies have now demonstrated that the pore-forming CaV1 α1- as well as the β regulatory subunits are, apart from neuronal and muscle cells, also expressed in lymphocytes and that these channels have little sensitivity to membrane depolarization [120–122]. The first VDCC that was found to be expressed in lymphocytes was CaV1.4, whose α1 subunit is encoded by the gene CACNA1F (calcium voltage-gated channel subunit alpha1 f). CaV1.4 is best known for its role in the retina where it mediates Ca2+ entry into photoreceptors. Mutations in CACNA1F have been linked to congenital stationary night blindness (CSNB) [123]. Interestingly the splice variants first found in the Jurkat T cell leukaemia line and human peripheral blood T lymphocytes (PBTs) differ from those in the retina. One of them, called CaV1.4a, misses exons 31-34 and 37, which translates to a deletion of the transmembrane segments S3, S4, S5 and half of S6 of domain IV. The affected region includes a voltage sensing domain and might impact voltage gating and reaction to depolarization [120]. Additionally, a frameshift caused a change in the amino acid sequence of the C-terminal resulting in a 40 % homology with CaV1.1. CaV1.4b, another novel splice variant is missing the exons 32 and 37, resulting in a deletion of the extracellular loop between S3 and S4 and part of the transmembrane segment S6 in domain IV. Although the voltage sensor is still present in this splice variant, loss of the S3-S4 extracellular loop might still have an impact on the voltage gating characteristics as it is in close proximity [120]. Also, CaV1.1 was recently shown to exist as a splice variant in activated T cells. In this spliceform, the initial two N-terminal exons, which are used in muscle cells, were replaced with five new exons. Additionally, exon 29 was excised. Paralleling the earlier study describing the novel CaV1.4b splice variant [120], skipping exon 29 of CaV1.1 also resulted in the deletion of the linker region between S3 and S4 in domain IV and changed the gating characteristics of the channel as demonstrated in a human embryonic kidney (HEK) cell transfection model [124]. 24  Various splice variants of CaV1.4 were also found during the extensive examination of retinal tissues, likely contaminated with blood cells of various types. No less than 19 splice variants of CaV1.4 were revealed suggesting splicing has a very significant role in tuning CaV dependent Ca2+ currents [125].   These splice variants provide an explanation for why CaV1 channels in non-excitable cells are less sensitive to membrane depolarization and suggest other mechanisms, for example, TCR signalling, trigger a Ca2+ flux in these channels. Pharmacological studies by Kotturi et al. have shown that this is indeed the case. Treating Jurkat – as well as human PBTs with the CaV1 channel antagonist nifedipine severely reduced their TCR-induced Ca2+ flux, ERK phosphorylation, and IL-2 production. In Jurkat cells, the transcriptional activity of NFAT was reduced by nifedipine after TCR crosslinking [126]. The CaV1 agonist Bay K8644, on the other hand, increased intracellular Ca2+ levels and phosphorylation of ERK. Later the role of CaV1 channels in T cells was also confirmed using genetically engineered mouse models. Badou et al. showed that mice lacking the β3 or β4 regulatory subunit exhibit an impaired TCR-mediated Ca2+ response. This further resulted in reduced NFAT translocation and compromised CD4 T cell cytokine production. Additionally, the absence of the β regulatory subunits also led to a decrease of the CaV1.1 pore forming unit, which suggests that it might assemble with the regulatory subunits and likely has a role in T cells [121]. Sure enough, CaV1.1 was later shown to be required for TCR-induced Ca2+ entry in knockdown experiments using lentiviral shRNA by the same group [124].   25  While the β3 subunit is important in CD4 T cells only for effector functions, CD8 T cells require it also for survival. Along with the defects in TCR-induced Ca2+ flux, NFAT translocation and proliferation, also the number of CD8 T cells was reduced in β3-deficient mice and these remaining cells exhibited an activated memory T cell phenotype [122]. The authors also showed that the β3 subunit forms a complex with CaV1.4 in naïve CD8 T cells and co-localized with T cell signalling kinases in lipid rafts. By using a CaV1.4-deficient mouse model our lab has previously shown that CaV1.4 is essential for TCR-induced SOCE in naïve CD4 and CD8 T cells and subsequent activation of the ERK and NFAT pathways [127]. CaV1.4-deficient mice also displayed a memory T cell phenotype and upregulated activation markers. Upon Listeria monocytogenes infection, the CaV1.4 KO mice exhibited severe immune deficiencies as reflected in a reduced number of functional antigen-specific CD4 and CD8 T cells. It is interesting to note that the phenotypes of β3- as well as CaV1.4-deficient mice, are reminiscent of T cell exhaustion as often seen in chronic viral infections. The persistent activation – and memory phenotype of T cells, the reduced ability to proliferate and to secrete cytokines, as well as the impaired NFAT signalling pathway, are all hallmarks of exhaustion [23,128].  Apart from the different subunits that are essential to form a CaV channel, it was found that the protein AHNAK1 acts as a scaffold protein for the channel. It is thought to physically interact with the β regulatory subunits. Accordingly, similar to the deficiency of β regulatory subunits, the absence of AHNAK1 was shown to reduce CaV1.1 protein expression [129]. Consequently, AHNAK1 was also required for proper effector function of CD4 T cells as well as cytolysis of target cells by cytotoxic T cells [129,130].  26  Additional studies highlight the role of CaV channels in leukocyte biology. CaV1.2 is expressed in human TH2 cells where its antisense – and pharmacological inhibition decreased Ca2+ flux and cytokine responses in a protein kinase C dependent matter [131]. Recently it has also been demonstrated that the inhibition of the α2δ2 auxiliary subunit in TH2 cells is also sufficient to disrupt TCR-induced Ca2+ flux and cytokine production [132]. A very intriguing regulatory mechanism for CaV1.2 and potentially other L-type Ca2+ channels was described by Wang et al. and Park et al. Apart from the activation of the earlier described CRAC channel the Ca2+ sensor STIM1 was also found to inhibit CaV1.2 by internalization (Figure 1.4) [133,134]. This reciprocal role of STIM1 has major implications for Ca2+ signalling and the control of the downstream pathways.  Finally, T type channels have also been shown to be functional in T cells. CaV3.1 was required for in vitro TH17 polarization and its absence impaired GM-CSF production in TH1 and TH17 cells. While it did not contribute to a TCR-mediated Ca2+ flux it was responsible for a consistent substantial Ca2+ influx in resting naïve T cells. Furthermore, CaV3.1 deficiency conferred a protective role in an EAE mouse model [135].   1.2.7 Summary While the best-known contributor to antigen receptor-mediated Ca2+ flux in lymphocytes, the CRAC channel, has been thoroughly described, the role of many other Ca2+ channels that are found in the plasma membrane remains poorly understood. In fact, not long ago there was doubt that additional plasma membrane Ca2+ channels reside in the membranes of lymphocytes. Studies on functional CaV channels in lymphocytes eventually settled this debate and the 27  literature has been expanding since this time to include a constellation of leukocyte Ca2+ channels. The expression of many of these channels may be restricted to specific developmental stages and subsets of lymphocytes giving rise to the hypothesis that they all control very specific mechanisms. Additionally, the spliceforms that are expressed in lymphocytes are different from those found in neuronal- and muscle cells where these channels were originally identified. Although most channels are responsive to antigen receptor crosslinking, the mechanisms that lead to the opening/closing of the channels remain for the most part elusive. Therefore, more research is necessary to better understand how the channels orchestrate the levels of intracellular Ca2+ and to assign specific functions to the Ca2+ currents. Nevertheless, Ca2+ channel inhibition is a promising avenue for therapeutic drug intervention, particularly if it becomes possible to target the specific splice variants that exist in lymphocytes. An array of immune deficiencies and autoimmune diseases as well as complications due to transplant rejection could possibly be treated.   28   Figure 1.4 Calcium channels in lymphocytes.29  Figure 1.4 Continued. Binding of antigen to the TCR/BCR initiates the signalling cascade that activates PLCγ, which cleaves PIP2 producing IP3. IP3 subsequently binds to the Ca2+ channel IP3R in the ER membrane, triggering a release of Ca2+ from the ER stores into the cytoplasm. The depletion of Ca2+ in the ER can be picked up on by the Ca2+ sensor STIM1, which subsequently accumulates in regions of the ER close to the plasma membrane. Here it can directly interact with the pore-forming units of the CRAC channel Orai1/2 and trigger the opening of the channel. CaV1 channels, on the other hand, are thought to be open in resting lymphocytes possibly in order to maintain basal Ca2+ levels and therefore ensure T cell homeostasis. STIM1 can also interact with members of the CaV1 family but takes on a reciprocal role and inhibits CaV1 upon Ca2+ depletion of the ER. Other Ca2+ channels in the plasma membrane also lead to Ca2+ influx following TCR stimulation. These include plasma membrane IP3R, TRP channels, P2X receptors, NMDA receptors. The exact mechanisms of how these channels are regulated however remain poorly understood. The P2X receptors are gated by ATP, which is released from the cell through the hemichannel Pannexin 1. The increase of cytosolic Ca2+ concentration activates calmodulin-calcineurin, which dephosphorylates NFAT and thereby induces its nuclear translocation. NFAT then prompts the transcription of target genes important in lymphocyte development, homeostasis, activation, proliferation, and apoptosis. Figure was adjusted from “Smart Servier Medical Art” at smart.servier.com, licensed under a Creative Commons Attribution 3.0 Unported License.  1.3 Environmental factors alter the immune system Environmental influences can have a profound impact on the immune system. This is illustrated in laboratory mice, housed in controlled environments, which allow for different levels of exposure to commensal microbes. Studies have shown that mice kept in germ-free conditions display severe immunological changes when compared to conventionally-housed mice, which are usually colonized by an array of commensal microbes. More specifically, important host immune responses like recruitment of neutrophils, cytokine production by macrophages, differentiation of TH17 and Treg cells as well as IgA production by B cells were found to be dependent on interactions with symbiotic microbes that colonize the host. These symbionts include bacteria, archaea, viruses, fungi and protozoa and are collectively termed microbiota [136].   30  Unsurprisingly, the host-microbiota interactions were found to play important roles in several murine disease models. For example, in an experimental autoimmune encephalomyelitis model (EAE), a mouse model for multiple sclerosis, germ-free mice developed strongly attenuated EAE, which was attributed to impaired generation of TH17 cells [137]. Also, in a mouse model of Crohn’s disease, colitis is induced using dextran sodium sulphate. When mice were raised in a specific pathogen free environment their susceptibility to inducing inflammation along with other disease hallmarks was strongly reduced compared to mice raised in conventional settings. The gut microbiota was significantly different between the conventionally – and pathogen-freely housed mice [138].   Also in humans, environmental factors play a significant role in the development of the immune system. In monozygotic twins, it was shown that immunological parameters, including immune cell populations, abundance of serum proteins and cytokine production, were largely dependent on non-heritable, environmental factors. With increasing age of the twins, these parameters diverged even further indicating that environmental influences have a cumulative effect on the immune system. The same study also demonstrated that viral infections often modify the behaviour of the immune system. In monozygotic twins, discordant for cytomegalovirus (CMV) infections, more than half of the examined immune parameters were altered in CMV-infected individuals when compared to their uninfected twins. The differences of theses parameters between both uninfected twins was far less pronounced [139].   As already discussed in mice, there also exist several genetic disorders in humans that are triggered or exacerbated by environmental stimuli. One example is the primary 31  immunodeficiency X-linked lymphoproliferative (XLP) syndrome, which is caused by a mutation in the SH2D1A (SH2 Domain Containing 1A) gene, which encodes the signalling lymphocyte activation molecule (SLAM)-associated protein (SAP), on the X-chromosome. Affected individuals appear healthy initially but suffer from severe infectious mononucleosis and lymphoproliferation upon infection with Epstein-Barr virus (EBV) [140]. Another example where EBV infection exacerbates the disease phenotype is interleukin-2-inducible T cell kinase (ITK) deficiency. ITK is a proximal TCR signalling molecule and regulates PLCγ1 phosphorylation and subsequently T cell activation. Upon EBV infection ITK-deficient patients exhibit severe lymphoproliferation and Hodgkin’s lymphoma along with high EBV viral load [141].  Understandably there are concerns that the abnormally hygienic barrier facilities that laboratory mice are housed in, do not properly recapitulate the environment humans live in and that this results in profound differences of their immune systems. A recent study found that compared to laboratory mice, feral and pet-store mice displayed a substantial enrichment of antigen-experienced CD8 T cells, particularly effector memory T cells. Additionally, these antigen-experienced T cells also exhibited several hallmarks of end-stage effector T cell markers. This absence of effector-differentiated T cells in laboratory mice is similar to neonatal humans but does not resemble the T cell populations of adult humans [142]. It is therefore important to consider what settings laboratory mice are housed in when studying immune disorders, as different environments can have a profound impact on the phenotype.  32  1.4 Modifier genes in health and disease Another variable that can affect the human and murine immune system are modifier alleles. While there exists a large body of research describing disease-causing variants, the investigation of alleles modifying and, in some cases, completely protecting from disease has been neglected until recently [143]. Modifier alleles are thought to influence the penetrance and expressivity of an otherwise monogenic disease. The mechanisms through which they exert their function include direct interaction with a target gene, contribution to the same biological process or compensation by acting through an alternative pathway [144].  For example, BCL2-deficient mice exhibit increased apoptosis in various cell types and develop kidney disease [145]. Deletion of the modifier gene Bid has no effect on its own but improves lymphocyte survival in Bcl2-/- mice without however improving kidney disease [146]. Interestingly, also the genetic background of mice plays an important role in the BCL2 KO mouse model. While the KO is most severe in C57BL/6 mice, a 129/SvJ background attenuates the disease and even protects the mice from renal failure [146].  In humans congenital longQT syndrome is a heart rhythm condition that can lead to fast, chaotic heartbeats. It has mainly been attributed to a missense mutation in the voltage-gated potassium channel gene KCNQ1 [147]. Interestingly, mutations in NOS1AP (nitric acid synthase 1 adaptor protein) have been found to increase clinical disease severity, as seen by a greater probability for cardiac arrest [148]. Also, the existence of protective alleles in humans has been demonstrated by a recent study of a so-called Wellderly cohort (aged individuals without any major chronic disease). Investigators found that ~70% of participants were heterozygous for at least one 33  pathogenic mutation implicated in cancer or cardiovascular disease risk. However, none of them exhibited any signs of pathogenicity, indicating that the presence of the variants does not automatically lead to disease [143]. Apart from environmental influences this phenomenon can mostly be attributed to the presence of modifier genes.  1.5 Research aims 1.5.1 CaV1.4 deficiency in humans We had the rare opportunity to work with three male siblings that all presented with severe immunodeficiencies reflected in frequently recurring infections, particularly of the ear and the upper respiratory tract, as well as signs of autoimmunity and pro-inflammatory cytokine production. They all harboured a non-sense hemizygous mutation in their CaV1.4 encoding gene CACNA1F on the X chromosome, which they inherited from their mother, a heterozygous carrier. We have previously demonstrated in our lab that CaV1.4 is an important regulator of T cell homeostasis and activation in mice [127]. CaV1.4-deficient T cells exhibited impaired survival and attenuated pathogen-specific responses. Molecularly, this was associated with reduced SOCE in T cells [127]. Samples provided by these patients enabled us to investigate the role of CaV1.4 in human lymphocytes. Owing to the previous observations in the CaV1.4-deficient mouse model, our hypothesis was that the immune disorders, presenting in these patients, like their increased susceptibility to infections, were due to their mutation of the CaV1.4 gene. A skewed lymphocyte population and deficiencies in Ca2+ signalling cause by the CACNA1F variant could explain the immune phenotype of the patients. We set out to analyze their lymphocyte populations by evaluating the frequency of CD4 and CD8 T cells as well as B cells. We also quantified the naïve, memory and effector T cell subsets and determined the levels 34  of expression of various activation and exhaustion markers on lymphocytes. Additionally, we also tested the ability of the patients’ lymphocytes to mobilize Ca2+, as a reduced Ca2+ flux could have severe impacts on the effector functions of the lymphocytes. These experiments gave us further insights and a better understanding of their immunodeficiency and could potentially aid in developing a treatment strategy.  1.5.2 CaV1.4 deficiency in mice While we were studying the CaV1.4-deficient patients we also sought to further investigate the role of CaV1.4 in the murine immune system to see if it resembles that of the siblings. Using murine splenocytes of a Cacna1f-/- mouse model we conducted experiments analogous to those done with the patients’ PBMCs. Our goal was to also quantify the markers of activation, exhaustion and memory expressed on murine lymphocytes as well as to test the effect of CaV1.4 deficiency on Ca2+ mobilization. This unique combination of CaV1.4-deficient patients and mouse model presented us with the opportunity to confirm the phenotype we observed in the patients in mice. Additionally, we hypothesized that a chronic infection might exacerbate the phenotype as it is the case in many PIDs. A chronic infection, especially if not controlled properly could drive the immune system into exhaustion making it more susceptible to other pathogens. We tested this hypothesis by infecting the mouse model with murine gamma herpes virus and evaluating its effect on lymphocyte populations.   1.5.3 B cell phenotype of Cacna1f and Dock2-deficient mice We previously also used the CaV1.4-deficient mouse model in our lab to describe the role of CaV1.4 in B cells in more detail. During the course of our experiments to elucidate the B cell 35  phenotype of the mouse model we discovered that in addition to the Cacna1f mutation, the mice harboured an additional homozygous mutation in the Dock2 (Dedicator of cytokinesis 2) gene. The second half of my thesis describes the B cell phenotype of these Cacna1f / Dock2 double KO mice. However, at this point it was not clear, how the Dock2 mutation would modify the observed phenotype. We suspected that at least parts of this phenotype were caused or modified by DOCK2 deficiency and bred this mouse model to separate the mutations into two different models so CaV1.4 and DOCK2 deficiency could be looked at individually. Certain experiments conducted with the double KO mouse model were repeated with the single KOs to determine which phenotypes segregate with which mutation and what might be a result of the combination of the two mutations. 36  Chapter 2: CaV1.4 in the human immune system  2.1  Introduction Human primary immunodeficiencies (PIDs) are rare familial diseases, which can be caused by a mutation in a variety of genes that affect the immune system [149]. PIDs often exhibit functional defects of T and B lymphocytes as well as natural killer (NK) cells despite normal maturation of these cells [150]. Deficiency of the cytoplasmic tyrosine kinase ZAP-70, for example, leads to SCID in which patients, due to CD8 T cell specific developmental and survival defects, have no CD8 T cells in their blood. Additionally, despite normal CD4 T cell maturation, affected individuals exhibit strongly attenuated CD4 T cell function [151]. In many PIDs, the patients have an increased susceptibility to Epstein-Barr virus (EBV) and EBV-infection often causes disease progression to a life-threatening lymphoproliferative disorder. For example, in X-linked lymphoproliferative (XLP) disease affected individuals mount an aggravated cellular immune response when infected with EBV. The hyperproliferation of T as well as NK cells, results in fever, irreversible liver damage due to hepatitis and malignant lymphoma [152]. The disease is usually caused by a mutation on the X-chromosome in the gene SH2D1A, which encodes the signalling lymphocyte activation molecule (SLAM)-associated protein (SAP) and is important for cytotoxic T cell and NK cell function [153]. Deficiencies in Ca2+ signalling often underlie PIDs [150]. Calcium (Ca2+) is a vital signalling molecule in all cells including immune cells and controls important processes like differentiation, homeostasis, activation, proliferation, and apoptosis [154]. In lymphocytes, crosslinking the antigen receptor activates a signalling cascade that eventually leads to Ca2+ release from the endoplasmic reticulum (ER) into the cytoplasm [39]. Upon Ca2+ depletion of the ER, Ca2+ channels in the plasma membrane open and a Ca2+ 37  influx from the extracellular space is triggered. This process is called store-operated Ca2+ entry (SOCE) and the main channel involved in it is coined Ca2+ release-activated Ca2+ (CRAC) channel [40]. The CRAC channel consists of the pore-forming unit called ORAI1 and a Ca2+ sensing protein named STIM1, which detects low levels of Ca2+ in the ER to activate the channel. Loss of function mutations in ORAI1 or STIM1 genes result in the partial abrogation of SOCE and defective T cell activation and represent another class of PIDs termed Immunodeficiency 9 (IMD9, OMIM# 612782) and 10 (IMD10, OMIM# 612783) [46–48] respectively.  Apart from the CRAC channel however there exist numerous other Ca2+ channels in the plasma membrane of lymphocytes that also contribute to the antigen receptor-mediated flux. In mice, TRPV1 deficiency, for example, lowered the TCR-induced Ca2+ flux in CD4 T cells and led to impaired TCR signalling and T cell-activation [72]. The voltage-dependent Ca2+ channels (VDCCs) also have emerged as important players in immune cells. VDCCs consist of the pore-forming CaV (α1)-, the β regulatory- and several other auxiliary subunits. They have been grouped into different families including the L-type Ca2+ channels, which are further divided into CaV1.1, 1.2, 1.3 and 1.4. Since they are traditionally activated by a change in membrane potential, these channels have primarily been described in electrically excitable cells but more recent studies have also demonstrated that L-type Ca2+ channels play critical roles in leukocytes [39,155]. Our lab has previously shown that CaV1.4 specifically plays an important role in T cell homeostasis and activation in mice [127]. CaV1.4, whose α1 subunit is encoded by the gene CACNA1F, is also expressed in human T lymphocytes, which led us to hypothesize that it might be important for T cell function in humans too [120,126]. For humans, the function of CaV1.4 is 38  well described in the eye as its absence or mutation can lead to incomplete congenital stationary night blindness (CSNB) [156] but the role of CaV1.4 in the human immune system remains elusive. We had the opportunity to examine three male siblings, who all harboured a CANCA1F mutation leading to incomplete CSNB, that we determined uniformly exhibit immune deficiencies. Here we describe the effect of CaV1.4 deficiency in human lymphocytes and mechanisms underlying a new X-linked immunological disorder.  2.2 Results There are currently no studies that address immune deficiencies in humans with any heritable CaV mutations. Three male siblings (16 – 20 years old) who all harbour the same mutation in the CACNA1F gene and who all present immune deficiencies in addition to incomplete CSNB were studied. Their immune deficiencies include recurrent infections, signs of autoimmunity and auto-inflammation. Also, other symptoms including fatigue, muscle weakness, joint hypermobility, intermittent CPK abnormalities, postural orthostatic tachycardia syndrome, Ehlers-Danlos syndrome and rashes were reported. Interestingly, in previous clinical tests our patients were shown to have high levels of serum antibodies against EBV and they reported that their symptoms worsened after the initial EBV infection, which occurred in their early teens. For one sibling, a recent lab test showed that the IgG antibody titers for EBV early antigen were 14.7U/ml (ref: 0-8.9U/ml), for EBV viral capsid antigen 519U/ml (ref: 0-17.9U/ml) and for EBV nuclear antigen 339U/ml (ref: 0-17.9U/ml). The EBV viral load in plasma was 581 copies/ml.   39  2.2.1 Patients harbour R625X mutation in CACNA1F gene The siblings underwent several genetic tests including Whole Exome Sequence Analysis by GeneDX (XomeDxPlus). In this analysis their symptoms were mapped to a R625X (p.Arg625Ter) point mutation that leads to a premature stop codon in the CACNA1F gene. The amino acid substitution is caused by the 1873C>T (NM_005183.3) nucleotide mutation changing the codon CGA to TGA in exon 14. The dbSNP identifier is rs886039559 and the surrounding DNA sequence is GCAGCCCTTGGGCATCTCAGTGCTC[C/T]GATGTGTGCGCCTCCTCAGGATCTT. The R625X variant was previously described in a family with incomplete CSNB [157] and is predicted to cause loss of normal protein function due to protein truncation or nonsense-mediated mRNA decay. It was not observed in the approximately 6503 individuals in the NHLBI Exome Sequencing Project nor in the 60706 unrelated individuals in the ExAC database. This variant is present in all three siblings who inherited the mutated allele from their mother who is a heterozygous carrier. Since CACNA1F is encoded on the X chromosome the siblings are all hemizygous for the mutation. The youngest of the three siblings is also hemizygous for the missense V40M variant in the SH2D1A gene (dbSNP rs199639961). The middle sibling is homozygous and the oldest heterozygous for the Q45X (dbSNP rs17602729) and P81L (dbSNP rs61752479) variants in the AMPD gene.  In previous clinical tests, it was found that all three sons have a low CD4/CD8 T cell ratio, an expansion of memory T cells, as well as elevated numbers of natural killer cells but decreased function (measured by lysing target cells). Furthermore, two of the three siblings exhibited impaired responses to Tetanus, Pokeweed mitogen, and Candida, while responses to PHA and 40  ConA were normal. These patients appear to be the first examples of any CaV channel mutation in humans that leads to an immune deficiency.  2.2.2 CaV1.4 deficiency leads to a reduced CD4/CD8 T cell ratio In order to further explore the role of CaV1.4 in humans, we isolated PBMCs from whole blood of these patients as well as from several age- and sex-matched control donors. We analysed the patients’ T cell populations by flow cytometry and could confirm the decreased CD4/CD8 T cell ratio in these patients. This was mostly due to a reduced frequency of CD4 T cells, which was compensated by an increase of CD4-, CD8- double negative cells. There was a trend of increased CD8 T cell frequency and the frequency of B cells (CD19+) was comparable to control donors (Figure 2.1).   Figure 2.1 CaV1.4-deficient patients have a reduced frequency of CD4 T cells PBMCs of patients (n=3) and healthy controls (n=9) were stained with antibodies against CD3, CD4, CD8 and CD19 and analysed by flow cytometry. Representative of two independent experiments. ** p<0.01. 41   2.2.3 CaV1.4 deficiency causes a memory T cell phenotype We next examined naïve and memory T cell subsets in these patients to assess to which specific population the reduced frequency of CD4 T cells can be attributed. In humans, memory T cells are generally CD45RA-, CD45RO+, IL7-R+ and can be further divided into two subsets: effector memory T cells (TEM), which are CD25-, CD62L-, CCR7- and central memory T cells (TCM), which are CD25+, CD62L+, CCR7+ [158]. For our purposes, we used flow cytometry markers to group the cells into naïve (CD62L+ CD45RO-), TCM (CD62L+ CD45RO+), TEM (CD62L- CD45RO+) and end-stage TEff cells (CD62L- CD45RO-) (Figure 2.2A). Compared to healthy control donors the patients had a higher frequency of CD8 TCM cells as well as an increased frequency of TEM cells, which was more pronounced in the CD8 T cell subset. While their naïve CD8 T cell frequency was normal, the naïve CD4 frequency was reduced, which is the main reason for the reduced frequency of total CD4 T cells (Figure 2.2B).  42   Figure 2.2 CaV1.4 deficiency results in a memory T cell phenotype43  Figure 2.2 Continued. PBMCs of patients (n=3) and healthy controls (n=9) were stained with antibodies against CD3, CD4, CD8, CD62L and CD45RO and analysed by flow cytometry. Gating strategy is shown (A). The different population frequencies shown in boxplots are classified as CD62L+ CD45RO- (naïve), CD62L+ CD45RO+ (TCM), CD62L- CD45RO+ (TEM), CD62L- CD45RO- (end-stage TEff) (B). Representative of two independent experiments. *p<0.05 ** p<0.01.  2.2.4 T cells of CaV1.4-deficient patients are persistently activated/exhausted Next, we looked at activation and exhaustion markers on the patients’ T cells. T cell exhaustion develops during chronic infections as well as cancers and leads to poor effector function of T cells [21]. Affected T cells can be identified by the continuous high expression levels of inhibitory receptors like PD-1 and low levels of the nascent memory marker IL-7R [159]. Patients’ memory and TEff cells of both the CD4 and CD8 subsets exhibited increased levels of PD-1 on their cell surface (Figure 2.3). TCM cells and CD4 TEM cells were especially affected. We also observed a trend of IL-7R downregulation in TCM cells. The upregulation of the inhibitory receptor PD-1 demonstrates that CaV1.4 deficiency possibly leads to T cell exhaustion in humans. However, it should be taken into consideration that these observed expression changes are also transiently induced during T cell activation. The cells could therefore just be temporarily activated.  44   Figure 2.3 CaV1.4-deficient T cells are exhausted PBMCs of patients (n=3) and healthy controls (n=9) were stained with antibodies against CD3, CD4, CD8, CD62L, CD45RO, PD-1 and IL7R and analysed by flow cytometry. The PD-1+ as well as the IL7R- frequency is shown in boxplots for the indicated populations, which are classified as CD62L+ CD45RO- (naïve), CD62L+ CD45RO+ (TCM), CD62L- CD45RO+ (TEM), CD62L- CD45RO- (end-stage TEff). Representative of two independent experiments. *p<0.05 ** p<0.01.  2.2.5 B cells of CaV1.4-deficient patients are chronically activated B cells are activated by binding to an antigen with their BCR. In T cell-dependent responses, they additionally bind to CD40L, expressed on T helper cells, which together with their secreted cytokines such as IL4 and IL-21 provide a costimulatory signal for the B cells [160]. Throughout this process, B cells upregulate several activation markers on their cell surface, including the MHCII receptor. B cells (CD19+) of the patients expressed high levels of the MHCII receptor allele HLA-DR (Figure 2.4), implying that they are in an activated state. Also, the expression 45  levels of the adhesion molecule CD62L, which is shed upon B cell activation, were strongly reduced on the surface of the patients’ B cells.  Figure 2.4 CaV1.4 deficiency leads to an activated B cell phenotype PBMCs of patients (n=3) and healthy controls (n=9) were stained with antibodies against CD19, HLA-DR and CD62L and analysed by flow cytometry. The population quantified is gated on B cells only (CD19+). Representative of two independent experiments. ** p<0.01 *** p<0.001.  Although the three brothers exhibit frequent infections, they have not reported any infections immediately prior to our analysis. We, therefore, hypothesize that the memory T cell phenotype, the increased expression of exhaustion/activation markers as well as the activation of B cells are a chronic and endogenous state without any underlying infection. This conclusion is supported by the fact that the same deficiencies were present using samples drawn at two different time points.  2.2.6 CaV1.4 deficiency impairs Ca2+ flux in T but not B cells Lastly, we also performed a Ca2+ flux assay using the patients’ PBMCs. PBMCs were labelled with different lymphocyte markers, stimulated with thapsigargin and the Ca2+ flux was recorded by flow cytometry. While B cells of the patients displayed a normal flux, the Ca2+ mobilization in their CD8 and CD4 T cells was reduced, compared to healthy donor cells (Figure 2.5).  46   Figure 2.5 CaV1.4-deficient T cells exhibit a reduced Ca2+ flux PBMCs of patients (n=3) and healthy controls (n=8) were stained with Ca2+ dyes Fluo-4 and Fura-Red and antibodies against CD3, CD4, CD8 and CD19 and analysed by flow cytometry. Thapsigargin was added to cells after 30 s of acquisition. The boxplots show the quantified slopes of increasing Ca2+ concentration for each cell type (A). The flow cytometry kinetics plots show the actual Ca2+ influx over time (B). Representative of two technical replicates. * p<0.05. 47  Thapsigargin triggers a flux of extracellular Ca2+ into the cytoplasm by blocking the reuptake of Ca2+ into the ER. This leads to SOCE without engaging the antigen receptor and triggering the associated TCR/BCR signalling pathway. We, therefore, hypothesize that CaV1.4 is also involved during SOCE and that its absence leads to a reduction of the induced Ca2+ flux.   2.2.7 PD-L1 and CD32 is downregulated on monocytes of CaV1.4-deficient patients Monocytes travel around the bloodstream towards sites of inflammation where they migrate into the affected tissues and differentiate into macrophages, which engulf and clear apoptotic cells. Fc receptors on the surface of macrophages help them to engulf bacteria that has been bound by antibodies, by recognizing the Fc portion of the attached antibodies. We found that the Fc receptor CD32 was significantly downregulated on the patients’ monocytes (identified as CD14+). Additionally, the expression of PD-L1, which is thought to downmodulate T cell responses by binding to the inhibitory receptor PD-1, was also strongly reduced (Figure 2.6).   Figure 2.6 Monocytes of CaV1.4-deficient patients show reduced levels of CD32 and PD-L1  PBMCs of patients (n=3) and healthy controls (n=9) were stained with antibodies against CD14, CD32 and PD-L1 and analysed by flow cytometry. The population quantified is gated on monocytes only (X+, CD14+). Representative of two independent experiments. * p<0.05 *** p<0.001. 48  2.3 Discussion This appears to be the first example of a mutated CaV channel causing a primary immunodeficiency in humans. The patients we worked with have a point mutation called R625X that leads to a premature stop codon in their CACNA1F gene. Many mutations in CACNA1F including this one have been linked to CSNB [157]. The patients also exhibit this phenotype and participated in a study further describing this disease [161]. The immune disorders, however, are a novel phenotype of CaV1.4 deficiency in humans. Our lab has previously demonstrated that CaV1.4 mRNA is expressed in human PBMCs in the form of alternative splice variants [120]. One of these variants misses exon 32 and 37 of the CACNA1F gene and could also be detected in the Canadian Epigenetic, Environmental and Health Research Consortium (CEEHRC) RNA sequencing database in human naïve CD4 T cells (Figure 2.7).   Figure 2.7 Naïve CD4 T cells express a splice variant of CACNA1F missing exon 32 and 37 RNA sequencing data from CEEHRC was visualized using UCSC genome browser. The cells sequenced were donated by healthy male and female donors between 30-40 years old.  Our lab has previously also described a CaV1.4-deficient mouse model, which exhibits severe immunodeficiencies due to impaired T cell homeostasis and activation [127]. The patients we 49  worked with in this study also exhibit several immune defects and show a perturbed lymphocyte population. They exhibit a low CD4 T cell frequency and hence a low CD4/CD8 T cell ratio, as well as a memory T cell phenotype and a high frequency of activated/exhausted T cells, a phenotype that is more often observed in aged individuals but also during chronic infections, such as HIV. A reduced CD4/CD8 ratio is an established predictor for disease progression to AIDS in HIV positive patients for example [162]. Interestingly, a low CD4/CD8 T cell ratio has also been associated with a shift from a naïve to an effector memory T cell phenotype and a higher frequency of activated/exhausted CD4 and CD8 T cells in HIV infected adolescents [163]. Also, an increase of exhausted CD4 TCM and TEM cells that express HLA-DR and PD-1 was observed in HIV-infected children [164]. These similarities of the phenotype of the patients to that of a chronic viral infection poses the question of how the phenotype developed. One possibility is that the T cell phenotype is a result of impaired T cell development/homeostasis since T cells require CaV1.4 for these processes. The resulting pre-activated CaV1.4-deficient T cells, particularly T helper cells, then induce the chronic B cell activation by binding to them and secreting inflammatory cytokines. The other possibility is that CaV1.4-deficient T cells develop properly but then cannot efficiently respond to pathogens and clear infections. This leads to many recurrent infections that drive the T cells toward the memory and exhaustion phenotype. Because of these continuous infections, the B cells of the patients also remain in a chronic state of activation. The exhibited CaV1.4-deficient phenotype could also be a combination of the two scenarios as seen in XLP syndrome, where the genetic disease is only triggered after an EBV infection.  50  It is also possible that the B cell activation phenotype is endogenous and B cells need CaV1.4 to remain in a quiescent state. Since the thapsigargin-induced Ca2+ flux defect is a T cell specific defect and is not observed in CaV1.4-deficient B cells we believe this to be the less likely scenario. Also, online RNA-Seq data demonstrates that CaV1.4 is expressed at higher levels in T cell and only minimally in B cells, which also supports the first hypothesis, in which activated CaV1.4-deficient T cells lead to B cell activation.  CRAC channel deficiencies that cause the SCID IMD9/10 do not impair T cell development but lead to severely reduced T cell proliferation and effector function due to strongly impaired SOCE [43–45]. Thapsigargin treatment induced a lower Ca2+ influx into our patients’ T cells than into those of healthy controls. Since thapsigargin skips other TCR/BCR-induced signalling pathways and directly induces SOCE, this reduction in Ca2+ mobilization demonstrates that like the CRAC channel, CaV1.4 also contributes to SOCE. Most likely it directly responds to the depletion of Ca2+ in the ER stores. Alternatively, the observed defects in Ca2+-flux could also be attributed to the high expression of exhaustion markers such as PD-1, which is known to dampen T cell effector functions by inhibiting TCR signalling. However, because of thapsigargin bypassing the TCR signalling pathway, this is less probable. Our lab has previously demonstrated that the L-type Ca2+ channel inhibitor nifedipine blocks a TCR-induced Ca2+ flux in Jurkat T cells and human PBMCs. Since CaV1.4 was found to be expressed in PBMCs it is most likely the channel responsible for the reduced flux [126]. Despite the different methods for triggering the flux (thapsigargin vs TCR engagement), these data agree with the impaired flux seen in the CaV1.4-deficient patients. In the same publication, it was also shown that nifedipine treatment reduced the TCR-induced translocation of NFAT as well as the secretion of IL-2 and the expression of 51  the IL-2 receptor. Also, proliferation responses were reduced in nifedipine-treated PBMCs. These studies using nifedipine suggest that these effector functions are also impaired in the CaV1.4-deficient patients and provide an explanation for their recurrent infections. In that case the molecular mechanisms of their immunodeficiency closely resemble those of CRAC channel-deficient patients.  It is important to note that although there exist many cases of CSNB that are caused by mutations in CACNA1F, for the most part, these patients do not complain about recurrent infections and therefore don’t seem to display the immune phenotype we observed. It is possible that a specific, potentially chronic infection triggered the disease in our patients. In many PIDs EBV as well as cytomegalovirus infections are reported to exacerbate the disease. An example for this is XLP disorder where an EBV infection leads to disease progression resulting in hyperproliferation of T cells and an aggravated cellular immune response. Interestingly, in previous clinical tests our patients were shown to have high levels of serum antibodies against EBV and they reported that their symptoms worsened after mononucleosis during their teens. An alternative explanation for the manifestation of an immune phenotype in our patients but not in other CaV1.4-deficient individuals is that it requires a specific genetic context for the CACNA1F mutation to become pathogenic in the immune system. The V40M variant of the SH2D1A gene (the gene that is often mutated in XLP disorder) in the youngest sibling for example could contribute to the phenotype. However, no clinical significance has been attributed to this variant and a clinical test showed that the encoded protein SAP is expressed at normal levels on the patient’s CD8 T cells. The common Q45X and P81L variants in the AMPD gene in the other two brothers usually segregate together and are known to cause adenosine monophosphate deaminase deficiency, leading to 52  fatigue and muscle pain in some affected individuals [165]. Since this disorder is inherited in an autosomal recessive pattern and only the middle sibling is homozygous for the variants they can also not account for the phenotype in the other brothers. This leaves the R625X mutation in CACNA1F as the common denominator in the siblings. Other unique non-synonymous SNPs could still contribute to the immune disorders in our patients, while the different genetic background of other CaV1.4-deficient individuals might be able to at least partially compensate the deficient lymphocyte functions. Another possibility that could affect the phenotype of our patients is the existence of modifier genes. SNPs in modifier genes can alter phenotypes that are usually caused by a mutation in another gene, the so called target gene [144]. This can affect the penetrance and expressivity of the target gene mutation. Modifier genes have been proposed to alter disease severity of night blindness of patient with a CACNA1F mutation [166]. It is therefore plausible that modifier alleles also alter the immune phenotype caused by CaV1.4 deficiency and thereby change the penetrance and expressivity of the disease. An incomplete penetrance can also be observed in STIM1 deficiency where two cousins that, despite reduced SOCE and impaired NK effector functions, lack clinical symptoms [167].  The L-type Ca2+ channel inhibitor nifedipine mentioned earlier is also used to treat cardiovascular disorders like hypertension by preventing the contraction of cardiac and smooth muscles. Interestingly, a study in patients who take nifedipine as a hypertension drug, found that nifedipine treatment transiently impaired lymphocyte proliferation due to reduced IL2 production of T cells [168].  53  Interestingly, the human CACNA1F-/- B cells also exhibited a loss of CD62L. CD62L is an adhesion molecule that is necessary for cell migration to the site of inflammation by mediating the rolling of leukocytes on the endothelium. It was found that the P2X7 receptor agonist benzoyl-benzoyl-ATP induces shedding of CD62L on lymphocytes [169]. As P2X receptors also flux Ca2+ across the plasma membrane of lymphocytes, this implies a potential role of Ca2+ in the shedding of CD62L. Interestingly phorbol 12-myristate. 13-acetate, a strong B cell activator, also induced shedding of CD62L in B CLL lymphocytes [108], which is why we also considered CD62L downregulation as an activation marker.  The observed downregulation of the Fc receptor CD32 on monocytes was surprising to us. Fc receptors are found on most leukocytes and are most abundant on monocytes and macrophages. They bind to the Fc region of antibodies that are bound to infected cells or pathogens, which in phagocytes like macrophage leads to the internalization of the complex. As monocytes are the precursors of macrophages, the downregulation of CD32 suggests that phagocytosis might be impaired in the CaV1.4-deficient patients. Interestingly, a downmodulation of CD32 on monocytes was reported in common variable immunodeficiency patients [170]. More experiments are required to follow up on this hypothesis. Also, the PD-L1 downregulation on monocytes was an unexpected finding. However, a similar phenotype was reported in systemic lupus erythematosus and PD-L1 expression could be restored by stimulating the monocytes with cytokines IL-10 and TNFα [171]. In the context of GvHD, it has recently been shown that intravenous immunoglobulin (IVIg) confers an inhibitory effect on T cells through PD-L1 induction on monocytes and blocking of PD-L1 de-represses T cell activity [172]. The dramatic downregulation of PD-L1 on our patients’ monocytes should therefore also be taken into 54  consideration when evaluating the activation/exhaustion phenotype of their T cells. Whether PD-L1 downregulation is a direct consequence of CaV1.4 deficiency or a compensatory mechanism to counteract the PD-1 upregulation on T cells, will have to be investigated in the future.  In conclusion, we have identified the first primary human immunodeficiency associated with a genetic mutation in an L-type Ca2+ channel, which results in impaired Ca2+ signalling in T cells and causes further immune-related phenotypes as seen in chronic infections. Studies to correct these deficits may now be directed at restoring homeostatic SOCE signalling in the immune system.   2.4 Material and methods Human ethics: The University of British Columbia - Clinical Research Ethics Board granted approval for the human study. Informed consent was obtained from all volunteers before whole-blood donation. PBMCs isolation: 10 ml of whole blood were collected into tubes containing sodium citrate (12 mM). PBMCs were then isolated using Lymphoprep (STEMCELL Technologies, cat. nr. 07801) according to protocol and used in subsequent experiments or frozen down in fetal bovine serum (FBS) with 10% DMSO (Thermo Fisher). Flow cytometry with human PBMCs: Freshly isolated 2 x 106 human PBMCs, resuspended in PBS with 2% FBS, were labelled for 30 min at 4°C in the dark with different antibody panels. The antibodies used were: α-CD8 (RPA-T8, Biolegend, cat. nr. 301005), α-CD4 (RPA-T4, Biolegend, cat. nr. 300511), α-CD3 (UCHT1, Biolegend, cat. nr. 300427), α-CD62L (DREG-56, Biolegend, cat. nr. 304841), α-CD45RO (UCHL1, Biolegend, cat. nr. 304205), α-PD-1 55  (EH12.2H7, Biolegend, cat. nr. 329915), α-IL7R (A019D5, Biolegend, cat. nr. 351317), α-CD19 (HIB19, Biolegend, cat. nr. 302211), α-PD-L1 (29E.2A3, Biolegend, cat. nr. 329717), α-HLA-DR (L243, Biolegend, cat. nr. 307623), α-CD32 (FUN-2, Biolegend, cat. nr. 303205), α-CD14 (63D3, Biolegend, cat. nr. 367111). The cells were then washed twice with PBS, resuspended in PBS with 2% FBS and data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Ca2+ flux human PBMCs: Frozen 4 x 106 human PBMCs were thawed, resuspended in HBSS with 2% FBS and labelled with 1 μM Fluo-4, 2 μM Fura Red (Thermo Fisher, cat. nr. F14201, F3021) for 45 min at room temperature in the dark. Cells were then washed, stained with α-CD19 (HIB19, Biolegend, cat. nr. 302211), α-CD8 (RPA-T8, Biolegend, cat. nr. 301026), α-CD4 (RPA-T4, Biolegend, cat. nr. 300511), for 30 min on ice, washed again and resuspended in HBSS with 2% FBS. After prewarming the cells for 15 min at 37°C, baseline Ca2+ levels were acquired for 30s by flow cytometry. 1 μM thapsigargin (Thermo Fisher, cat. nr. T7458) was then added to the cells and acquisition was continued for a total of 5 min. Data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Exome Sequencing by GeneDX: Using genomic DNA from specimen of the three siblings, their mother and their father the Agilent Clinical Research Exome kit was used to target the exonic regions and flanking splice junctions of the genome. These targeted regions were sequenced simultaneously by massively parallel (NextGen) sequencing on an Illumina HiSeq sequencing system with 100bp paired-end reads. Bi-directional sequence was assembled, aligned to reference gene sequences based on human genome build GRCh37/UCSC hg19, and analysed for sequence variants using a custom-developed analysis tool (Xome Analyzer, GeneDx, Gaithersburg, MD, USA). Capillary sequencing or another appropriate method was used to 56  confirm all potentially pathogenic variants identified in the siblings and their parents. Sequence alterations were reported according to the Human Genome Variation Society (HGVS) nomenclature guidelines. The exome was covered at a mean depth of 138x, with a quality threshold of 93.7%.  Statistical tests: Statistical significance was determined using unpaired Student's t tests using RStudio.  57  Chapter 3: CaV1.4 deficiency in the murine immune system  3.1 Introduction As in humans, in mice, the chief mechanism by which Ca2+ enters a T cell upon antigen binding to the TCR is through SOCE with the CRAC channel being the principal route of entry. However, this does not exclude other channels that are known to be expressed in lymphocytes from participating in this process [39]. Recently, the Ca2+ TRPV1 channel, for example, was found to be functionally expressed in murine CD4 T cells where it contributes to the TCR-induced Ca2+ flux [72]. Using a KO mouse model, our lab has previously shown that the L-type Ca2+ channel CaV1.4 plays a crucial role in T cell homeostasis, survival and activation [127]. In light of the memory and exhaustion phenotypes we observed in CaV1.4-deficient patients (chapter 2), we turned to characterize the T and B cell populations of this CaV1.4-deficient mouse model.  3.2 Results 3.2.1 Insert disrupts the Cacna1f gene The Cacna1f gene of these animals is disrupted by an insert in exon 7, leading to a premature stop codon (15). We first verified the presence of this insert in the Cacna1f-/- mouse model (Figure 3.1). Cacna1f-/- C57BL/6NCrl197 bp267 bp Figure 3.1 CaV1.4-deficient mice have an insert in their Cacna1f gene. Genotyping of three KO and WT mice. KO mice carry a 70 bp insert in their Cacna1f gene. 58  3.2.2 CaV1.4-deficient mice have a reduced frequency of CD8 T cells To characterize the immune phenotype of the CaV1.4-deficient mouse model, we harvested spleens of WT and Cacna1f-/- mice and used a variety of flow cytometry-based assays to analyze their splenocytes. We initially examined the abundance of CD4 and CD8 T cells as well as B cells in these mice. In contrast to the CaV1.4-deficient patients, CaV1.4 deficiency in mice led to a modest reduction of CD8 T cell frequencies. The frequencies of CD4 T cells and that of B cells were similar to those of WT mice (Figure 3.2).   Figure 3.2 Cacna1f-/- mice have a reduced frequency of splenic CD8 T cells Splenocytes of WT (n=18 or n=22) and KO (n=22 or n=26) mice were stained with antibodies against CD3, CD4, CD8 and B220 and analysed by flow cytometry. Boxplots show four pooled experiments. * p<0.05.  3.2.3 CaV1.4 deficiency leads to a memory T cell phenotype We next examined the distribution of T cells into naïve, memory and effector cell subsets by flow cytometry. In mice, memory T cells generally express CD44 and IL7-R and can be further 59  divided into two subsets: effector memory T cells (TEM), which are CD62L-, CCR7-, and CD44+ and central memory T cells (TCM), which are CD62L+ CCR7+ and CD44+ [13,173]. We classified CD62L+ IL7R+ CD44- as naïve, CD62L+ IL7R+ CD44+ as TCM, CD62L- IL7R+ as TEM and CD62L- IL7R- as TEff cells (Figure 3.3A). Similar to the earlier described CaV1.4-deficient patients, CaV1.4-deficient mice exhibited a memory T cell phenotype. Although TCM cell frequencies of CaV1.4 KO mice were comparable to WT levels, their CD4 and CD8 TEM subsets were significantly increased. Also, the Cacna1f-/- mice had an increased frequency of TEff cells, again for CD4 and CD8 T cells. Accordingly, the naïve T cell frequency was reduced. (Figure 3.3B).   60   Figure 3.3 CaV1.4 deficiency results in a memory T cell phenotype61  Figure 3.3 Continued. Splenocytes of WT (n=15 or n=22) and KO (n=18 or n=26) mice were stained with antibodies against CD3, CD4, CD8, CD62L, IL7R and CD44 and analysed by flow cytometry. Gating strategy is shown (A). The different population frequencies shown in boxplots are classified as CD62L+ IL-7R+ CD44- (naïve), CD62L+ IL-7R+ CD44+ (TCM), CD62L- IL-7R+ (TEM), CD62L- IL-7R- (end-stage TEff) (B). Boxplots show four pooled experiments * p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.   3.2.4 CaV1.4-deficient T cells are continuously activated and exhausted We next examined activation and exhaustion in different T cell subsets, by analysing the expression of the inhibitory receptors PD-1 and CTLA-4. CD4 T cells exhibited high expression of PD-1 (Figure 3.4A), which was particularly pronounced in TCM, TEM, as well as TEff cells. Interestingly, this increase of PD-1 was restricted to the CD4 subset as CD8 T cells had normal levels of PD-1. While PD-1 is known to be upregulated on antigen-experienced T cells, CTLA-4 is functional during the initial phase of T cell activation and is therefore found on naïve T cells [174]. Accordingly, we observed increased CTLA-4 levels in CaV1.4-deficient naïve T cells, particularly in the CD8 subset. In addition, TCM cells of both CD4 and CD8 subsets exhibited increased expression of the inhibitory marker (Figure 3.4B). This T cell exhaustion/activation phenotype also closely resembles that of the patients.   62    Figure 3.4 CaV1.4 deficiency results in T cell activation/exhaustion Splenocytes of WT (n=15 or n=22) and KO (n=18 or n=26) mice were stained with antibodies against CD3, CD4, CD8, CD62L, IL7R, CD44, PD-1 and CTLA-4 and analysed by flow cytometry. The PD-1+ frequency (A) and CTLA-4 MFI (B) are shown in boxplots for different populations, which are classified as CD62L+ IL-7R+ CD44- (naïve), CD62L+ IL-7R+ CD44+ (TCM), CD62L- IL7R+ (TEM), CD62L- IL7R- (end-stage TEff) (B). Boxplots show four pooled experiments. Histograms show one representative sample of each genotype. * p<0.0.5 ** p<0.01 *** p<0.001 **** p<0.0001.  63  3.2.5 CaV1.4 deficiency causes chronic B cell activation Furthermore, also analogous to the patients, the B cells of Cacna1f-/- mice are in an activated state as demonstrated by the high expression levels of the activation markers CD86, CD69 and MHCII (Figure 3.5). Our observations were consistent, regardless of the age of the mice, which ranged from 8 - 14 weeks. This suggests that the T cell activation/exhaustion, as well as the activation status of B cells are chronic conditions.   64   Figure 3.5 CaV1.4 deficiency leads to an activated B cell phenotype Splenocytes of WT (n=14 or n=10) and KO (n=16 or n=12) mice were stained with antibodies against B220, CD86, CD69 and IAb and analysed by flow cytometry. The population quantified are B cells only (B220+). Boxplots show four pooled experiments. Histograms show one representative sample of each genotype. ** p<0.01 **** p<0.0001.  65  3.2.6 CaV1.4-deficient T but not B cells exhibit a reduced Ca2+ flux We next measured the Ca2+-flux in splenic CD4 and CD8 T cells as well as B cells after thapsigargin stimulation. While B cells of CaV1.4-deficient mice had an unchanged Ca2+ flux compared to WT cells, CD8 and CD4 T cells both showed a significantly reduced flux after stimulation (Figure 3.6). Strikingly, the human and mouse data also concur here and suggest that CaV1.4 is also part of SOCE in mice.   66   Figure 3.6 CaV1.4-deficient T cells exhibit a reduced Ca2+ flux Splenocytes of WT (n=4) and KO (n=5) mice were stained with Ca2+ dyes Fluo-4 and Fura-Red as well as antibodies against CD4, CD8 and B220 and analysed by flow cytometry. Thapsigargin was added to cells after 30 s of acquisition. The boxplots show the quantified slopes of increasing Ca2+ concentration for each cell type (A). The flow cytometry kinetics plots show the actual Ca2+ influx over time (B). Representative of two independent experiments. ** p<0.01 *** p<0.001.  67  3.2.7 CaV1.4 during MHV-68 infection As already discussed in the general introduction, environmental factors can significantly alter the progression of various diseases. In many PIDs, like XLP syndrome for example, environmental cues, such as an EBV infection, trigger or exacerbate the disease. It was reported that all three sons, analysed in chapter 1, have high levels of serum antibodies against EBV and their symptoms were exacerbated after mononucleosis. We therefore postulated that EBV infection could also aggravate the observed immune phenotype in CaV1.4 deficiency. To investigate the hypothesis, we infected WT and Cacna1f-/- mice with murine gammaherpesvirus 68 (MHV-68), which is utilized to model human EBV infections as the disease progression is very similar [175]. We then sacrificed the animals four weeks postinfection and analysed their splenic lymphocyte populations.  3.2.7.1 CaV1.4 KO mice exhibit an increased CD4/CD8 T cell ratio postinfection Interestingly, the CaV1.4-deficient animals had an increased CD4/CD8 T cell ratio compared to WT animals, postinfection, which was mostly due to a higher frequency of CD4 T cells. The B cell frequencies were reduced equally in WT and CaV1.4-deficient animals (Figure 3.7).   68   Figure 3.7 MHV-68 infected CaV1.4 KO mice have an increased CD4/CD8 T cell ratio Splenocytes of uninfected (n=5)/MHV-68 infected (n=7) WT and KO mice were stained with antibodies against CD3, CD4, CD8 and B220 and analysed by flow cytometry. Experiment was only performed once. *p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.  3.2.7.2 CaV1.4 deficiency leads to a higher CD4 TEff cell frequency postinfection CaV1.4 KO animals exhibited a significantly higher CD4 TEff cell frequency than WT mice and demonstrated a further reduced frequency of their naïve CD8 T cells (Figure 3.8). Interestingly their frequency of CD8 TCM cells was also reduced upon infection while the WT levels remained unchanged. CD4 TCM cell frequencies, on the other hand, were diminished similarly in WT and KO mice postinfection. The TEM cell frequency of both WT and KO animals increased to equal levels postinfection.  69   Figure 3.8 MHV-68 infected CaV1.4 KO cells have higher CD4 TEff cell frequencies Splenocytes of uninfected (n=5)/MHV-68 infected (n=7) WT and KO mice were stained with antibodies against CD3, CD4, CD8, CD62L, IL7R and CD44 and analysed by flow cytometry. The different population frequencies shown in boxplots are classified as CD62L+ IL7R+ CD44- (naïve), CD62L+ IL7R+ CD44+ (TCM), CD62L- IL7R+ (TEM), CD62L- IL7R- (end-stage TEff). Experiment was only performed once. *p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.  3.2.7.3 CaV1.4-deficient TCM cells upregulate exhaustion markers postinfection In the context of T cell exhaustion, the PD-1+ population increased in the TCM subset and was still significantly larger in CaV1.4-deficient T cells compared to WT cells. (Figure 3.9) Also, CTLA-4 expression showed a similar, although not as significant, trend.    70   Figure 3.9 Post MHV-68 infection exhaustion is amplified in TCM cells of Cacna1f-/- mice 71  Figure 3.9 Continued. Splenocytes of uninfected (n=5)/MHV-68 infected (n=7) WT and KO mice were stained with antibodies against CD3, CD4, CD8, CD62L, IL7R, CD44, PD-1 and CTLA-4 and analysed by flow cytometry. The PD-1+ frequency (A) and CTLA-4 MFI (B) is shown in boxplots for different populations, which are classified as CD62L+ IL7R+ CD44- (naïve), CD62L+ IL7R+ CD44+ (TCM), CD62L- IL7R+ (TEM), CD62L- IL7R- (end-stage TEff). Experiment was only performed once. *p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.  3.2.7.4 Chronic B cell activation is amplified in CaV1.4 KO mice postinfection The examined B cell activation markers were all further upregulated after MHV-68 infection in both WT and KO animals. The difference of expression between them was similar to that of uninfected mice (Figure 3.10).   Overall, the MHV-68 infection intensified the memory, exhaustion phenotype as well as the chronic B cell activation and caused a significant expansion of CD4 TEff cells in the CaV1.4-deficient animals.  72   Figure 3.10 Activation status of B cells is amplified by MHV-68 infection in CaV1.4 KO mice Splenocytes of uninfected (n=5)/MHV-68 infected (n=7) WT and KO mice were stained with antibodies against B220, CD86, CD69 and IAb and analysed by flow cytometry. The population quantified are B cells only (B220+). Boxplots show results of the experiment, which was only performed once. Histograms show one representative sample of each genotype in uninfected and infected mice. ** p<0.01 *** p<0.001 **** p<0.0001.  3.3 Discussion Although CRAC channels are known to be the main route of entry of Ca2+ into T cells, there also exists an array of other channels that contribute to TCR-mediated Ca2+ flux. Among them are the L-type voltage-gated Ca2+ channels, including CaV1.4 whose role in T cell homeostasis and activation our lab has described previously [127]. Here we further investigate the phenotype of the mouse model and find that CaV1.4 deficiency leads to an activated memory T cell phenotype. 73  This is reflected in the decreased frequency of naïve T cells, and increase of TEff and TEM cell frequencies in CD4 and CD8 subsets. A memory T cell phenotype based on CD44 expression has already been described previously by our lab [127] as well as by Jha et al. in a KO mouse model of the β3 regulatory subunit that also constitutes the CaV1.4 channel [122]. In contrast to the CaV1.4-deficient patients, frequency of total CD4 T cells did not change in the KO mouse model. Instead the CD8 T cells subset is modestly reduced in frequency in Cacna1f-/- mice, which is also consistent with the β3 KO mouse of Jha et al. [122].  The upregulation of CTLA-4 on naïve and TCM cells is a novel phenotype of CaV1.4-deficient mice that has not been reported previously. CTLA-4 is a homolog of CD28, a co-receptor on the surface of T cells. It competes for the binding of the ligand B7 on APCs but unlike CD28 it does not produce a stimulatory signal but instead inhibits T cell activation [174]. This could potentially explain the reduced TCR-mediated proliferation capacity observed previously in Cacna1f and β3-deficient mice [122,127]. Also, treatment of mice with nifedipine, an L-type Ca2+ channel antagonist, was shown to inhibit the proliferation of splenic T cells, indicating that CaV1.4 might be essential for T cells to divide [126].  PD-1 is another inhibitory marker that can interfere with phosphorylation in TCR signalling and as a result, reduce proliferation and effector functions. Also this marker was upregulated in Cacna1f-/- mice, which has already been described previously in our lab [127]. Here we show that this PD-1 upregulation is confined to CD4 TCM, TEM and TEff cells. Also, the B cells of Cacna1f-/- mice exhibit an activated phenotype as seen by the upregulation of the activation markers CD86, CD69 and MHCII. During T-dependent antigen responses, B cells require help 74  from CD4 T cell to be activated. CD4 TFH cells are a specialized subset of T cells for this job and provide co-stimulatory signals via expression / secretion of CD40L, IL-21, and IL-4 [176]. Possibly, the activated phenotype of CD4 T cells also leads to an increase of these stimulatory signals that activate B cells. In this context it is interesting to note that PD-1 is typically found on TFH cells [177]. The increase of PD-1 on CD4 T cells could also be the result of the expansion of the TFH cell subset. An increase of this population could potentially also cause the chronic B cell activation. Interestingly we only observed a reduced Ca2+ flux in CaV1.4-deficient T cells but not B cells. This also supports the hypothesis that CaV1.4 deficiency has a T cell intrinsic effect and the impact on B cell is of secondary nature. Further investigation will be required to confirm this.  The reduced Ca2+ mobilization in T cells was also seen in previous work in our lab with this mouse model [127]. In β3 KO CD4 T cells, CD3 crosslinking also led to a diminished Ca2+ flux but, conversely, thapsigargin-induced Ca2+ flux was normal [121]. However, both KO mouse models, displayed impaired nuclear translocation of NFAT, which has been shown to result in reduced cytokine production [121,122,127]. In our α1 subunit KO mouse, it also led to impaired proliferation responses [127].   Our results demonstrate that CaV1.4 deficiency leads to an activated/exhausted phenotype of T and B cells as it is often seen during chronic infections. Since the mouse facility where these animals were housed are free of pathogens it is likely that the phenotype arose without an infectious trigger. However, in many genetic PIDs, like for example XLP syndrome, the disease is only triggered after an EBV infection. To establish whether these kinds of environmental factors also play a role in CaV1.4 deficiency, we infected WT and KO mice with MHV-68, a 75  murine model virus for EBV. The infection model revealed that the activation/exhaustion phenotypes are amplified in CaV1.4 KO mice during MHV-68 infection. The increased frequency of CD4 TEff cells in Cacna1f-/- mice 4 weeks postinfection demonstrated that CaV1.4 deficiency leads to a skewed T cell response. It is possible that due to impaired effector function there is a need to produce more TEff cells in order to control MHV-68 infection in CaV1.4 KO mice. Furthermore, the higher expression of PD-1 seen on CD4 but not CD8 subsets before infection might provide a stronger inhibitory signal that dampens CD4 T cell responses and necessitates a higher number of CD4 TEff cells.   The inhibitory marker CTLA-4 and particularly PD-1 were further upregulated in TCM cells after MHV-68 infection. Since TFH cells are known to express PD-1 the upregulation of the marker could also mean an increase of the TFH population. During primary infection MHV-68 targets alveolar cells and splenocytes and then goes dormant in B cells, causing a chronic infection. Interestingly this B cell latency requires the help of TFH cells [178]. Thus, the further increase of activation markers on B cells after MHV-68 infection could be a result of an increased TFH population providing more help for MHV-68 to infect B cells in CaV1.4 KO mice than in WT.  The MHV-68 infection model demonstrates that the immune phenotype of the CaV1.4-deficient mice can be aggravated by environmental factors. It is possible that also other bacterial / viral infections of pathogenic or commensal nature have similar effects. Since the housing conditions are pathogen-free, this often provides a setting in which immunodeficient mice can thrive as they don’t encounter the same environmental challenges as they would in the wild.  76  3.4 Material and methods Mice: Mice were bred at the Animal Research Unit at UBC under specific-pathogen-free conditions. Cacna1f −/− mice have been previously described [156] and were backcrossed to  C57BL/6NHsd from Harlan Sprague Dawley (Indianapolis, IN, USA) for 13 generations. To eliminate the Dock2 mutation this colony harboured [179], mice were further backcrossed to C57BL/6NCrl mice from Charles River Laboratories (Wilmington, MA, USA) for one generation. This F1 generation was then allowed to interbreed and in the F2 generation Cacna1f-/- only mice were selected to establish a new colony. C57BL/6NCrl mice were also used as control animals. All studies followed guidelines set by both the University of British Columbia's Animal Care Committee and the Canadian Council on Animal Care. Splenocytes extraction: 8-14 weeks old mice were euthanized and their spleens excised. Spleens were then mashed through a 70μm cell strainer using a syringe plunger to obtain a single cell suspension. Red blood cells were then lysed using ACK lysing buffer and the remaining white blood cells were washed with PBS and resuspended in PBS with 2% FBS. Flow cytometry with mouse splenocytes: Freshly isolated 2 x 106 mouse splenocytes, resuspended in PBS with 2% FBS, were labelled for 30 min at 4°C in the dark with different antibody panels. The antibodies used were: α-CD8 (5H10, Thermo Fischer, cat. nr. MCD0828TR), α-CD4 (RM4-5, Thermo Fischer, cat. nr. 56-0042-80), α-CD3 (17A2, eBioscience, cat. nr. 46-0032-80), α-CD62L (MEL-14, Biolegend, cat. nr. 104411), α-CD44 (IM7, Biolegend, cat. nr. 103005), α-PD-1 (29F-1A12, Biolegend, cat. nr. 135223), α-IL7R (A7R34, Biolegend, cat. nr. 135031), α-CTLA-4 (UC10-4B9, eBioscience, cat. nr. 12-1522-81), α-B220 (RA3-6B2, eBioscience, cat. nr. 47-0452-82), α-CD21 (eBio4E3, eBioscience, cat. nr. 48-0212-80), α-CD23 (B3B4, Biolegend, cat. nr. 101612), α-CD86 (GL1, eBioscience, cat. nr. 77  12-0862-81), α-CD69 (H1.2F3, eBioscience, cat. nr. 11-0691-81), α-IAb (AF6-120.1, eBioscience, cat. nr. 46-5320-80). All flow cytometry antibodies were purchased from either Invitrogen, eBioscience or Biolegend. The cells were then washed twice with PBS, resuspended in PBS with 2% FBS and data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Ca2+ flux with mouse splenocytes: 4 x 106 freshly isolated mouse splenocytes, resuspended in HBSS with 2% FBS, were labelled with 1 μM Fluo-4, 2 μM Fura Red (Thermo Fisher, cat. nr. F14201, F3021) for 45 min at room temperature in the dark. Cells were then washed, stained with α-B220 (RA3-6B2, eBioscience, cat. nr. 47-0452-82), α-CD8 (5H10, Thermo Fischer, cat. nr. MCD0828TR), and α-CD4 (RM4-5, Thermo Fischer, cat. nr. 56-0042-80) for 30 min on ice, washed again and resuspended in HBSS with 2% FBS. After prewarming the cells for 15 min at 37°C, baseline Ca2+ levels were acquired for 30s. 1 μM thapsigargin (Thermo Fisher, cat. nr. T7458) was then added to the cells and acquisition was continued for a total of 3 min. Data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). MHV-68 infection: 8-week-old mice were injected intraperitoneally with 104 pfus of MHV-68 WUMS strain (purchased from ATCC cat. nt. VR-1465, propagated on BHK cells) and sacrificed 4 weeks later. Their spleens were then harvested and processed for flow cytometry analysis. Statistical tests: Statistical significance was determined using unpaired Student's t tests using RStudio. For some mouse experiments, data of 3-4 different experiments, each using 3-5 animals per experimental group, were pooled. In that case the experiments were performed using the same flow cytometry antibodies (same vials) and the exact same laser settings on the flow cytometer. 78  Chapter 4: CaV1.4/DOCK2 double-deficient mice exhibit B cell dysfunction   During my Ph.D. I investigated the role of CaV1.4 in B cells. Initially, in addition to a CaV1.4 deficiency, the used mouse model harboured a mutation in another gene, namely Dock2 (Dedicator of cytokinesis 2). This mutation appears to have been introduced into our breeding stock from a standard commercially available C57BL/6 mouse strain from Harlan Sprague Dawley Inc. (now Envigo). This strain, which was ordered by UBC Animal Care, harboured a mutation in Dock2, which went unreported for a long time [179]. DOCK2 mutation also leads to a PID in humans and we took advantage of this situation to examine the phenotype of the CaV1.4/DOCK2 double KO mice. In this chapter, I report their phenotype.  4.1 Introduction DOCK2 is a CDM family protein that is uniquely expressed in hematopoietic cells [180] and plays an essential role in migration of T and B lymphocytes. DOCK2 deficiency results in severe cytopenia, as observed by a stark reduction of T and B cells in the spleen and lymph nodes of DOCK2-/- mice. Particularly, DOCK2-/- mice exhibited an almost complete loss of marginal zone (MZ) B cells [181]. The number of developing B cells in the bone marrow, on the other hand, was not impacted by the absence of DOCK2 and the thymocyte populations were also only altered to a small extent. The reduced emigration of mature thymocytes and B cells to the periphery, therefore, seems to be the main reason for the observed cytopenia. This emigration process is known to be mediated by chemokine signalling, which triggers actin polymerization via activation of the GTPase Rac. This chemokine-induced actin polymerization, however, was completely abolished in DOCK2-/- lymphocytes, revealing the mechanism of DOCK2 79  deficiency leading to migration defects. The Ca2+ mobilization in response to chemokine stimulation, on the other hand, was intact in DOCK2-/- lymphocytes [182].   Also, the activation of integrins, which are important for cell-matrix interaction and therefore attaching to high endothelial venules and subsequent migration into lymphoid organs, are induced by chemokines. This integrin activation and therefore adhesion of cells is impaired in DOCK2-/- B cells but interestingly DOCK2-/- T cells do not exhibit this defect [183]. DOCK2-/- T cells, however, are unable to move laterally along apical and basal endothelial surfaces, which could also explain their low number in the periphery [184].   The activation of Rac is also diminished in DOCK2 KO T cells when, instead of using chemokines, they are stimulated through their TCR. This further leads to impaired immunological synapse formation because, upon antigen binding, the TCR and lipid rafts are unable to translocate to the interface with the APC. Subsequently, DOCK2-deficient T cells exhibit severe defects in TCR-induced proliferation as well as impaired ERK signalling [185]. However, TCR-induced Ca2+ flux as well as several other signalling pathways including the activation of Lck, ZAP-70, JNK (JUN N-terminal kinase), PYK2 (protein tyrosine kinase 2), AKT and PLCγ1 were not affected by DOCK2 deficiency [186,187].  DOCK2 deficiency also was found to be the cause of a PID in humans. Affected patients presented with severe infections of viral and bacterial origin. Similar to DOCK2-/- mouse models, patients with DOCK2 mutations exhibited impaired Rac activation and actin 80  polymerization as well as lymphocyte migration. As a result, the patients all showed severe T and B cell lymphopenia, impaired T cell proliferation and IFN production [188].   As our CaV1.4-deficient mouse model initially harboured also a mutation in the DOCK2 gene we here describe the B cell phenotype of DOCK2 and CaV1.4 double-deficient mice.  4.2 Results  4.2.1 Double KO mice show a reduction of splenic B cells, particularly MZ B cells. First, we analysed the B cell populations in the bone marrow and spleen of the mice and noticed a reduction of splenic B cells. While B cell development in the bone marrow was normal, CaV1.4/DOCK2-deficient mice had significantly fewer B cells in the spleen. Namely, transitional 1 (T1), transitional 2 (T2), follicular and particularly marginal zone (MZ) B cell numbers were all reduced (Figure 4.1). This implies a defect in B cell development starting after the immature B cell stage when the cells migrate from the bone marrow to the spleen.   81   Figure 4.1 CaV1.4/DOCK2 deficiency leads to a reduced number of splenic B cells Freshly isolated WT (n=4) and double KO (n=4) cells from bone marrow and spleen were stained with different B cell markers (B220, IgM, IgD, CD21, CD23, CD43) to distinguish the different B cell developmental stages and analysed by flow cytometry. Representative of three independent experiments. ** p<0.01 *** p<0.001 **** p<0.0001.  4.2.2 BAFF-R induction is impaired in immature double KO B cells Expression of the BAFF (B cell activating factor) receptor (BAFF-R) is crucial for the survival of B cells. The BAFF-R becomes upregulated during B cell development and then, through interaction with its ligand BAFF, sends a tonic signal that promotes B cell survival. This also makes it important for positive B cell selection during the immature B cell stage, which is also the time when its expression is initially induced [189]. Because of the significant reduction of B cell numbers after that critical immature B cell stage, we hypothesized that BAFF-R expression is reduced in double KO B cells once they reach this developmental checkpoint. To address this question, we quantified BAFF-R expression in different developmental stages and confirmed that it is first expressed in immature B cells. However, CaV1.4/DOCK2-/- B cells only upregulate its expression to about 50 % of WT levels. The reduction of BAFF-R expression is also observed in all subsequent developmental stages (Figure 4.2) and therefore is in accordance with the reduced 82  number of splenic B cells in CaV1.4/DOCK2-/- B cells. Apart from the already identified impaired B cell migration due to DOCK2 deficiency [182], this provides another explanation for the reduced number of peripheral B cells and suggests that the BAFF-R induction is dependent on CaV1.4 or DOCK2.   Figure 4.2 BAFF-R expression is reduced on double KO B cells Freshly isolated WT (n=2 or n=5) and double KO (n=2 or n=6) cells from bone marrow and spleen were stained with different B cell markers (B220, IgM, IgD, CD21, CD23, CD43) and BAFF-R antibody and analysed by flow cytometry. Representative of three independent experiments. ** p<0.01 **** p<0.0001.   4.2.3 CaV1.4/DOCK2-deficient B cells are chronically activated  Next, we addressed the activation status of the remaining CaV1.4/DOCK2 -/- B cells in the spleen. To this end, we isolated splenic follicular B cells and stained them with the activation markers CD86 and MHCII as well as the Ca2+ dye Fluo-4. The double KO B cells expressed more activation markers on their cell surface and were also more granular (as measured by the 83  SSC (side-scattered light)). They also exhibit elevated levels of intracellular basal Ca2+ (Figure 4.3). The double KO B cells are in a chronic state of activation.    Figure 4.3 CaV1.4/DOCK2 KO B cells are chronically activated Freshly isolated follicular B cells from WT (n=4 or n=3) and CaV1.4/DOCK2-/- mice (n=4 or n=3) were stained for activation markers CD86, MHCII and the Ca2+ dye Fluo-4 (for basal Ca2+ concentrations) and analysed using flow cytometry. SSC represents granularity of the cells. Representative of three independent experiments. * p<0.05 ** p<0.01 **** p<0.0001.  4.2.4 Double KO B cells show impaired BCR-mediated activation and proliferation Given the chronic activation of the CaV1.4/DOCK2-deficient B cells, we tested the ability of the cells to be further activated and to proliferate upon BCR crosslinking. When stimulating isolated splenic B cells with α-IgM, they were not activated to the same extent as WT cells as indicated by the activation marker CD86 (Figure 4.4). This effect was more pronounced when using low concentrations of α-IgM. When using LPS as a stimulant, however, KO and WT cells were 84  activated to a similar extent. Correspondingly, α-IgM-induced proliferation of double KO B cells was impaired. The deficient B cells did not divide as often as WT B cells did (Figure 4.5). LPS mediated proliferation responses, on the other hand, were normal. In summary, BCR-specific responses are impaired in CaV1.4/DOCK2-/- mice, while signalling via the LPS/TLR4 pathway is normal.   Figure 4.4 BCR-induced activation is impaired in CaV1.4/DOCK2-deficient B cells Freshly isolated follicular B cells were stimulated with different ligands and their activation levels were assessed after 16 hours using CD86 expression levels as readout by flow cytometry. This experiment was done by Dr. Lilian Nohara. Representative of three independent experiments.  85   Figure 4.5 CaV1.4/DOCK2-deficient mice exhibit impaired BCR-induced proliferation Freshly isolated follicular B cells were labelled with CFSE and stimulated with different ligands. Their proliferative capacity was assessed after 72 hours by flow cytometry. This experiment was done by Dr. Lilian Nohara. Representative of three independent experiments.  4.2.5 Double KO B Cells Fail to Polymerize Actin upon BCR crosslinking In order to further characterize the effects of the compromised BCR-mediated activation of B cells, we examined actin spreading in CaV1.4/DOCK2-deficient B cells. Actin spreading is a key event in BCR-triggered B cell activation and essential for immunological synapse formation. In collaboration with Dr. Libin Abraham from Dr. Gold’s lab, we showed that double KO B cells fail to reorganize their actin cytoskeleton to accumulate at the edge of the cell membrane upon BCR crosslinking (Figure 4.6).   86   Figure 4.6 BCR-induced actin-clearance is impaired in double KO mice. Splenic B cells were incubated and allowed to spread on a coverslip coated with either non-stimulatory α-MHCII (not shown) or α-IgΚ and stained for F-Actin and IgM. This experiment was done once by Dr. Libin Abraham.  4.2.6 CaV1.4/DOCK2 KO B cells display a reduced BCR-induced Ca2+ flux Because of the BCR-specific defects in activation, proliferation and actin polymerization, we suspected Ca2+ signalling to be impaired in the BCR signalling cascade. We examined the Ca2+ flux upon BCR crosslinking in WT and double KO B cells. The CaV1.4/DOCK2 -/- B cells showed impaired mobilization of Ca2+ after α-IgM stimulation (Figure 4.7). Due to this deficiency in Ca2+ flux, the Ca2+ dependent arm of the BCR signalling cascade is most likely not propagated, which explains the deficiency of the effector functions we observed.  WT    Double KO 87   Figure 4.7 CaV1.4/DOCK2 deficiency results in reduced BCR-induced Ca2+ flux Freshly isolated follicular B cells were loaded with the Ca2+ dyes Fluo-4 and Fura-Red and analysed by flow cytometry. α-IgM was added to cells after 60 s of acquisition. The Ca2+ flux was measured as the ratio of Fluo-4/Fura-Red. Representative of three independent experiments.  4.2.7 Double KO mice have autoantibodies in their sera To evaluate the production of autoantibodies we analysed the sera of young (8 weeks old) and old (40 weeks old) mice for the presence of α-DNA antibodies. While there was no significant difference between the young mice, the sera of the old CaV1.4/DOCK2-/- mice contained significantly more α-DNA antibodies than that of the old WT controls (Figure 4.8).   88   Figure 4.8 Double KO mice exhibit elevated levels of α-DNA antibodies Sera of young (n=6) and old (n=10) WT and CaV1.4/DOCK2-/- mice were subjected to ELISA plates coated with salmon sperm DNA to detect α-DNA antibodies. Representative of two technical replicates.  4.2.8 CaV1.4/DOCK2 KO mice have elevated IgG1 antibody levels in their sera We also compared the IgG1 and IgG3 antibody levels in the sera of young and old mice. Although not significant, there was a trend of elevated IgG1 levels in the sera of old CaV1.4/DOCK2-deficient mice (Figure 4.9), indicative of spontaneous class switching. The IgG3 isotype levels, on the other hand, exhibited a decreased trend in the sera of old double KO mice.  89   Figure 4.9 Double KO mice exhibited a trend of elevated IgG1 antibody levels in their sera IgG1 and IgG3 antibodies in the sera of young (n=6) and old (n=10) mice were quantified using ELISA. Representative of two technical replicates.  4.2.9 CaV1.4/DOCK2-/- B cells exhibit increased IgG1 class switching in vitro To follow up on this trend of increased IgG1 serum levels, we also tested the capability of the CaV1.4/DOCK2-deficient B cells to class switch in vitro. When stimulated with different ligands and cytokines that induce switching to IgG1, the double KO cells exhibited a higher frequency of IgG1 switched B cells than their WT controls (Figure 4.10). Switching to IgG3, on the other hand, was normal (not shown).   90   Figure 4.10 Double KO B cells exhibit increased class switching to IgG1 WT and double KO follicular B cells were incubated with different stimuli to induce IgG1 class switching for 5 days. The cells were then stained with α-IgG1 and analysed using flow cytometry. Representative of two independent experiments.  In order to class switch, RNA-polymerase binds to and unwinds the donor and acceptor constant region on the IgH locus. This is thought to make the locus accessible to AID, the enzyme that mediates double-stranded DNA breaks and that way confers class switching. A by-product of this process are sterile germline transcripts produced from the donor and acceptor region [190]. In resting CaV1.4/DOCK2-/- B cells the IgG1 germline transcripts are about 7-fold more abundant than in WT B cells (Figure 4.11). This indicates that the locus is more accessible to AID and could explain the preferred switching to IgG1 in the KO cells.  91   Figure 4.11 IgG1 germline transcription is upregulated in double KO B cells RNA was isolated from WT and CaV1.4/DOCK2-/- follicular B cells and analysed for different Ig germline transcripts using qPCR. Representative of three independent experiments.  4.2.10 Double KO B cells have normal BCR-mediated p-Syk and p-ERK signalling  Binding of an antigen to the BCR triggers a signalling cascade, which includes several phosphorylation steps and eventually leads to the transcription of target genes that control different events in B cells including survival apoptosis and proliferation. To examine this signalling cascade, we first examined BCR-induced phosphorylation of Syk, which is among the first proteins in the BCR signalling pathway to be phosphorylated. We also examined the phosphorylation of ERK, which acts independent of Ca2+ signalling. Upon BCR crosslinking both proteins were phosphorylated to the same extent in WT and double KO B cells (Figure 4.12).  92   Figure 4.12 BCR-induced phosphorylation of ERK and Syk is normal in double KO B cells Freshly isolated splenocytes were stimulated for 5 min with 10 μg/ml of α-IgM, fixed and permeabilized. Cells were stained with α-B220, α-p-ERK and α-p-Syk and analysed by flow cytometry. Expression levels of p-Syk (right panel) and p-ERK (left panel) in B cells (B220+) are shown. Shaded histogram represents unstimulated -, clear histograms stimulated cells. Representative of three independent experiments.  4.2.11 NFAT and NF-κB signalling is impaired in CaV1.4/DOCK2 KO B cells NFAT and NF-κB nuclear translocation also constitute important downstream signalling events upon BCR crosslinking. These signalling pathways, which are known to be Ca2+ dependent [191], were deficient in double-KO B cells (Figure 4.13, Figure 4.14).   93   Figure 4.13 BCR-induced NFAT translocation is impaired in double KO B cells. Freshly isolated follicular B cells were stimulated with different concentrations of α-IgM for 16 hours. The cells were fractionated in nuclear and cytoplasmic parts and the nuclear fraction was then lysed for a Western Blot. The NFAT quantification was normalized to β-actin. Representative of two independent experiments.   Figure 4.14 BCR-induced NF-κB translocation is impaired in double KO B cells. Freshly isolated follicular B cells were stimulated with different concentrations of α-IgM for 16 hours. The cells were fractionated in nuclear and cytoplasmic parts and the nuclear fraction was then lysed for a Western Blot. The NF-κB quantification was normalized to β-actin. Representative of two independent experiments 94  4.3 Discussion  Due to the initially unnoticed mutation in the Dock2 gene, we had the opportunity to study the compound phenotype of a CaV1.4/DOCK2 double-deficient mouse model. In this discussion we compared our findings to the literature to determine what phenotype was most likely caused by DOCK2 deficiency and what by the Cacna1f mutation. Although several of the phenotypes in the CaV1.4/DOCK2 double KO mice segregate with the Dock2 mutation alone, there also were indications of both, a phenotype that segregated with the Cacna1f mutation alone, as well as a phenotype that only appears in the CaV1.4/DOCK2 double KO mice.  The reduced number of B cells and the almost complete absence of MZ B cell has been described previously in a mouse model with a different Dock2 mutation [182]. A reduction of B cells was also observed in a KO mouse model of IRF (interferon regulatory factor) 5 as well as SIAE (sialic acid acetylesterase). Additionally, both of these mouse models harboured the same Dock2 mutation found in our mouse model, which turned out to be the cause of the B cell reduction [179,192]. It is therefore likely that the decrease of B cells in our double KO mouse model is also caused by DOCK2 deficiency [182].  The DOCK2-dependence of BCR-induced activation and proliferation of B cells as well as actin polymerization has been demonstrated previously. Ushijima et al. have shown that BCR crosslinking leads to impaired activation and proliferation in DOCK2-deficient B cells, while proliferation is normal in response to α-CD40 and LPS [193]. Defects in actin polymerization due to impaired Rac activation are also well described in DOCK2-deficient mouse models and humans [182,183,187,188]. It further results in impaired chemokine-induced egression of 95  maturing lymphocytes to the periphery, which is most likely also the reason for the splenic B cell cytopenia in our mouse model. Also, BCR-induced actin polymerization was shown to be DOCK2 dependent. In that scenario, actin remodelling is necessary for establishing BCR microclusters, a process that is essential for immunological synapse formation and that was abolished in DOCK2-deficient lymphocytes [185,194].  Also, the increase of IgG1 in the serum was observed previously in an IRF5-/- DOCK2-/- double KO mouse and disappeared in IRF5-/- single KO mice [195]. The increase of IgG1 isotype antibodies in serum and the preferred IgG1 switching in vitro could be a result of the increased germline transcription of the IgG1 constant region. The preferential binding of RNA polymerase to that region would make the locus more accessible to AID, which could result in spontaneous IgG1 switching. This increase in IgG1 class switching in vitro and the increased IgG1 germline transcription have not been reported before and need to be investigated further.  The higher amount of auto-antibodies in the sera of our double KO mice was also seen in SIAE KO mice [196] that later turned out also to be DOCK2-deficient [179]. Since both models exhibited this phenotype and their common denominator is DOCK2 deficiency there is a good chance this was also the cause of the increased sera auto-antibodies.  BCR-induced Ca2+ flux, on the other hand, was not found to be impaired in DOCK2 KO animals [193], which suggests that CaV1.4 deficiency leads to the observed reduction of Ca2+ mobilization. In chapter 3, however, we saw that CaV1.4 deficiency does not decrease Ca2+ flux in B cells upon thapsigargin stimulation. In this case, the different stimuli could account for this 96  discrepancy. Thapsigargin bypasses the BCR signalling pathway and blocks SERCA pumps to directly induce SOCE. By contrast BCR crosslinking needs to trigger the BCR signalling cascade first to induce a Ca2+ flux. The chronic activation of CaV1.4-deficient B cells could desensitize the cells to the BCR stimulus and subsequently lead to the reduced flux. Alternatively, the decreased BCR induced Ca2+ flux could also be a phenotype that only manifests when both, Cacna1f and Dock2 mutations are present.   The DOCK2 dependency of BCR-induced NFAT and NF-κB translocation has not been investigated. However, since these are Ca2+ dependent processes [191] and Ca2+ flux is not affected by DOCK2 deficiency, we hypothesize that the absence of DOCK2 is not the reason for the impaired transcription factor translocation we observed. Instead, it is more likely that CaV1.4 deficiency or maybe the combination of the two mutations causes this phenotype.   The BAFF-R becomes upregulated in immature B cells that have passed positive selection and promotes their differentiation into transitional B cells [189]. The reduced levels of the BAFF-R we observed in our double KO mice have not been reported before in DOCK2-deficient animals. However impaired Rac signalling, which occurs downstream of DOCK2, has been implicated in BAFF-R upregulation [197], which suggests a role for DOCK2 in the regulation of the BAFF-R and therefore B cell selection. Interestingly, DOCK2 was found to be important during T cell selection [185], so it is likely that it has an analogous role in B cells. The severe reduction of splenic B cells in our double KO model could therefore not only occur due to defects during B cell migration but also selection.  97  In conclusion the CaV1.4/DOCK2 double-deficient mouse model exhibits several B cell deficiencies that start at the immature stage and include a severe reduction of B cells in the periphery as well as impaired BCR-induced signalling. The literature suggests that parts of this phenotype segregate with DOCK2 deficiency but does not exclude the Cacna1f mutation as causative. In the next chapter I tried to get a better, more definitive understanding of the contributions of each mutation to the observed phenotype.  4.4 Material and methods Mice: Mice were bred at the Animal Research Unit at UBC under specific-pathogen-free conditions. Cacna1f−/− mice have been previously described [156] and were backcrossed to  C57BL/6NHsd, harbouring the Dock2 mutation from Harlan Sprague Dawley (Indianapolis, IN, USA) for 13 generations. C57BL/6NCrl mice from Charles River Laboratories (Wilmington, MA, USA) were used as control animals. All studies followed guidelines set by both the University of British Columbia's Animal Care Committee and the Canadian Council on Animal Care. Bone marrow isolation: 8-12 weeks old mice were euthanized and bone marrow was flushed out of femur and tibia with ice-cold PBS, using a 23G needle and syringe and resuspended into a single cell suspension. Red blood cells were then lysed using ACK lysing buffer and the remaining white blood cells were washed with PBS and resuspended in PBS with 2% FBS. Splenocytes extraction: 8-12 weeks old mice were euthanized and their spleens excised. Spleens were then mashed through a 70μm cell strainer using a syringe plunger to obtain a single cell suspension. Red blood cells were then lysed using ACK lysing buffer and the remaining white blood cells were washed with PBS and resuspended in PBS with 2% FBS. 98  Flow cytometry with mouse bone marrow cells and splenocytes: Freshly isolated 2 x 106 mouse bone marrow cells or splenocytes, resuspended in PBS with 2% FBS, were labelled for 30 min at 4°C in the dark with different antibody panels. The antibodies used were: α-B220 (RA3-6B2, eBioscience, cat. nr. 47-0452-82), α-IgM (RMM-1, Biolegend, 406505), α-IgD (11-26c.24, Biolegend, cat. nr. 405715), α-CD21 (eBio4E3, eBioscience, cat. nr. 48-0212-80), α-CD23 (B3B4, Biolegend, cat. nr. 101612), α-CD43 (S7, BD Pharmingen, cat. nr. 553271), α-BAFFR (7H22-E16, Biolegend, cat. nr. 134105), α-CD86 (GL1, eBioscience, cat. nr. 12-0862-81), α-IAb (AF6-120.1, eBioscience, cat. nr. 46-5320-80). All flow cytometry antibodies were purchased from either Invitrogen, eBioscience or Biolegend. To asses basal Ca2+ levels, cells were also labelled with 1 μM Fluo-4 (Thermo Fisher, cat. nr. F14201). The cells were then washed twice with PBS, resuspended in PBS with 2% FBS and data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Follicular B cell purification: B cells were purified from freshly isolated splenocytes using the EasySep Mouse B Cell Negative Isolation Kit (STEMCELL Technologies, cat. nr. 19854). Subsequently MZ B cells were depleted using the EasySep Biotin Positive Selection Kit (STEMCELL Technologies, cat. nr. 18559) and a biotinylated α-CD23 (B3B4, Biolegend, cat. nr. 101603) antibody.  In vitro activation assay: Freshly isolated and purified follicular B cells were cultured in RPMI 1640 containing 10% fetal bovine serum (FBS) and 1% Pen/Strep (all Thermo Fisher) and stimulated with different concentrations of F(ab’)2 fragment α-IgM (Jackson ImmunoResearch, cat. nr. 115-006-020) or LPS (Sigma) for 16 hours. Their activation levels were then assessed using CD86 expression levels (with α-CD86 (GL1, eBioscience, cat. nr. 12-0862-81)) as a 99  readout by flow cytometry. Data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). In vitro proliferation assay: Freshly isolated follicular B cells were labelled with CFSE (Thermo Fisher, cat. nr. C34554), cultured in RPMI 1640 containing 10% FBS and 1% Pen/Strep (all Thermo Fisher) and stimulated with different concentrations of F(ab’)2 fragment α-IgM (cat. nr. 115-006-020, Jackson ImmunoResearch) or LPS (Sigma). After 72 hours, their proliferation was analysed by flow cytometry. Data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Actin spreading assay: Ex vivo splenic B cells settled on cover slips coated with either non-stimulatory α-MHC-II (0.25 µg/cm2; Millipore; cat. nr. MABF33) or stimulatory α-IgΚ (2 µg/cm2; Southern Biotech; cat. nr. 1050-01) for 10 minutes. Cells were fixed, permeabilized (0.1% Triton-X100) and stained for F-actin (Alexa Fluor 488 conjugated Phalloidin; Thermo Fisher, cat. nr. A12379) and IgM (Cy3-conjugated α-IgM Fab; Jackson ImmunoResearch Laboratories, cat. nr. #115-167-020). Images were then captured using a III spinning-disk confocal microscope based on an inverted Zeiss Axiovert 200M microscope with a 100x NA 1.45 oil objective and a QuantEM camera. Ca2+ flux of mouse follicular B cells: Freshly isolated and purified follicular B cells in HBSS with 2% FBS were labelled with 1 μM Fluo-4, 2 μM Fura Red ((Thermo Fisher, cat. nr. F14201, F3021) for 45 min at room temperature and washed twice. After prewarming the cells for 15 min at 37°C Ca2+ flux was analysed by flow cytometry. Baseline Ca2+ levels were acquired for 60s. F(ab’)2 fragment α-IgM (3 μg/ml, Jackson ImmunoResearch, cat. nr. 115-006-020) was then added to the cells and acquisition was continued for a total of 7 min. Data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc).  100  Serum collection of mice: Blood was collected from 8 and 40-week-old mice by cardiac puncture and allowed to clot at room temperature for 30 min. Blood was then centrifuged at 2000 g for 10 min and supernatant was collected as serum. Serum autoantibody/antibody isotype detection: Sera of mice were subjected to 96 well ELISA plates coated with salmon sperm DNA to detect α-DNA antibodies or α-IgG1 / α-IgG3 (Biolegend, cat. nr. 406601 / 406802) to detect IgG1/IgG3 isotype antibodies. The wells were then washed and incubated with α-IgG antibodies conjugated to HRP (Biolegend, cat. nr. 405306) and, after subsequent washing, incubated for 2 min with TMB substrate (Cell Signaling Technology, cat. nr. 7004) and the reaction was stopped using STOP solution (Cell Signaling Technology, cat. nr. 7002). In vitro class switching: Freshly isolated and purified follicular B cells were incubated with 2.5 μg/ml LPS (Sigma), 2.5 μg/ml LPS (Sigma) + 25 ng/ml ng IL-4 (Sigma) or 10 μg/ml α-CD40 (eBioscience) and 25 ng/ml IL-4 (Sigma) to induce IgG1 class switching for 5 days. The cells were then stained with α-IgG1 (RMG1-1, Biolegend, cat. nr. 406613) and analysed using flow cytometry. Representative of two independent experiments. IgH locus germline transcription quantification: RNA was isolated from freshly isolated and purified follicular B cells using Trizol (Thermo Fisher, cat. nr. 15596026) and analysed for different IgH germline transcripts by qPCR using QuantiTect SYBR Green RT-PCR Kit (Qiagen, cat. nr. 204243) in duplicates. The primers used were: IgG1 Fwd: TCGAGAAGCCTGAGGAATGT, IgG1 Rev: ATAGACAGATGGGGGTGTCG, IgG3 Fwd: CAGAGAAGAGGTGGCCAGAG, IgG3 Rev: GTCACCGAGGATCCAGATGT, IgE Fwd: GAGATTCACAACGCCTGG, IgE Rev: CTTTACAGGGCTTCAAGGG 101  ERK/Syk phosphorylation assay: Freshly isolated splenocytes were stimulated for 5 min with 10 μg/ml of F(ab’)2 fragment α-IgM (Jackson ImmunoResearch, cat. nr. 115-006-020) and subsequently fixed and permeabilized (Biolegend, fix buffer cat. nr. 420801; perm/wash buffer cat. nr. 421002). Cells were then washed and stained with surface antibody α-B220 (RA3-6B2, eBioscience, cat. nr. 47-0452-82) as well as α-phospho-ERK (Cell Signaling Technology, cat. nr. 4377) or α-phospho-Syk (Cell Signaling Technology, cat. nr. 2710) and analysed by flow cytometry. Nuclear translocation assay: Freshly isolated and purified follicular B cells were stimulated with different concentrations of 0, 1, 3 or 10 μg/ of F(ab’)2 fragment α-IgM (Jackson ImmunoResearch, cat. nr. 115-006-020) for 16 hours. The cells were then fractionated in nuclear and cytoplasmic parts (NE-PER, Thermo Fisher, cat. nr. 78833) and the nuclear fraction was then lysed for a Western Blot. Briefly, samples were subjected to SDS-polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane and blocked with 5% skim milk in PBST. Membranes were probed with primary antibodies (rabbit α-NFAT1, Abcam, cat. nr. ab2722 or rabbit α-NF-κB p105-p50 (Abcam, cat. nr. ab32360) or rabbit α-Histone H3 (Millipore, cat. nr. 07-449)) in 5% skim milk in PBST overnight at 4°C. The membranes were then probed with secondary goat anti-rabbit Alexa Fluor 680 antibody (Thermo Fisher, cat. nr. A-21109) for 1 h at room temperature. Bands were visualized with the Odyssey infrared imaging system (LI-COR Biosciences) and quantified using ImageJ (NIH). Statistical tests: Statistical significance was determined using unpaired Student's t tests using RStudio.  102  Chapter 5: Segregating the CaV1.4-/- and DOCK2-/- phenotype  5.1  Introduction Mice are one of the most common species utilized in research. They are used to model human diseases, test drugs and understand genotype-phenotype relationships. They have become the model organism of choice because they can be bred to homozygosity and housed in large numbers. Another benefit of mice as a model organism is that they are not very hard to genetically manipulate, easy to work with, generally inexpensive and genetically similar to humans. While the use of mouse models led to many advances in answering fundamental biological questions, it has proven more difficult to apply this newly gained knowledge to humans [198]. Many therapeutics for example that worked very well in animal models of diseases failed in clinical trials [199,200]. This can in part be attributed to the genetic differences between the two species, which translates to variances in protein expression and general discrepancies in their immune responses. Similarly, different strains of mice exhibit significant inconsistencies in their genome. Some strains are more prone to certain diseases than others due to polymorphisms causing immune deficits. This has made the SJL/J strain, for example, the strain of choice for induction of EAE, a mouse model of multiple sclerosis. A naturally occurring polymorphism in the IL-12 encoding gene increases the IL-12 responsiveness and predisposes SJL/J mice along with other immune dysfunctions to EAE induction [201]. Interestingly different mouse strains also favour different T helper (TH) type responses. While C57BL/6 mice exhibit a TH1 type response, other strains like BALB/c, for example, demonstrated a TH2 response towards pathogens [202,203]. Another example, where mouse strain differences impact the immune system is the naturally occurring mutation in the toll-like receptor 4 (TLR4) gene in 103  the C3H/HeJ substrain that leads to the lack of TLR4 protein expression. TLR4 is the receptor for lipopolysaccharide (LPS) and an important regulator of innate immune responses. The C3H/HeJ strain, therefore, exhibits increases susceptibility to several intracellular pathogen infections [204,205]. In a recent study the gene expression of CD4 T cells and neutrophils from 39 inbred mouse strains was quantified. Strikingly, 22% of the transcriptome was differentially expressed by more than 2-fold, demonstrating the large degree of gene expression variability across the different strains [206].  Besides these inter-strain differences, there also exist genetic intra-strain discrepancies. Depending on their source, inbred mouse strains are not always genetically identical. Due to genetic drift in animal colonies, the genome of a mouse strain obtained from one source can significantly differ from the same strain obtained from another source or colony. The most common mouse strain used in biomedical research today is C57BL/6. Although C57BL/6 is how this strain is generally referred to in the literature, it is important to note that there exist several different substrains that are genetically not identical. The C57BL/6J substrain refers to The Jackson Laboratory as a source while C57BL/6N identifies substrains derived from the National Institutes of Health (NIH). The NIH acquired their C57BL/6N mice originally from Jackson in 1951 and they were then further shared with other vendors leading to more substrains. Ideally, all these substrains should be identified by an abbreviation specifying their supplier. The most common of these substrains include C57BL/6NCrl (Charles River), C57BL/6NTac (Taconic) and C57BL/6NHsd (Harlan, now Envigo) [198]. The genetic differences between these strains are often ignored as researchers choose their mouse vendors based on costs or existing contracts. Also, when researchers breed their animals “in-house” without backcrossing them on a regular 104  basis, it leads inevitably to genetic drift. Often these animals are then shared with collaborators, a process in which the strain information often gets lost or confused. Simon et al. compared the genome sequence of C57BL/6J and C57BL/6N mice and identified 34 SNPs, 2 indels, and 15 structural variants in coding regions that distinguish the two strains [207]. One of the structural variants within the coding region of the gene Nicotinamide Nucleotide Transhydrogenase (Nnt) has been reported previously and was found to play a role in insulin secretion [208]. Also, many of the other variants discovered impacted the phenotype of these mice demonstrating that these strains are not interchangeable. More recently a severe immune phenotype was discovered in C57BL/6Hsd mice by Mahajan, Demissie et al. and was subsequently confirmed by the supplier Harlan (now Envigo). These mice carry a mutation in the Dock2 gene that leads to nonsense-mediated mRNA decay [179]. DOCK2 is a scaffolding protein uniquely expressed in hematopoietic cells and regulates the small GTPase Rac. DOCK2-deficient B and T cells exhibit defects in actin polymerization and migration and as a direct or indirect consequence a series of other abnormalities [182,186]. The Dock2 variant (Dock2Hsd) was discovered by Mahajan, Demissie et. al. in a mouse model, their lab used in a previous publication [179]. In this previous paper Cariappa et. al. have described a defect in B cell development in two engineered mouse strains with altered sialic acid physiology due to a mutation in the gene Siae (sialic acid acetyl esterase) [196]. The phenotype of these mice included accelerated and enhanced BCR signalling, impaired peripheral B cell development, striking decrease in MZ progenitor and MZ B cells (CD21+) and a more modest reduction in follicular B cells, increase in CD8 memory phenotype T cells (CD8, CD44+, CD122hi), as well as spontaneous increases in class-switched immunoglobulins and 105  autoantibodies. These mice had been originally backcrossed to C57BL/6NHsd mice from Harlan but when they were now further backcrossed to C57BL/6J mice from Jackson their phenotype disappeared. Mahajan, Demissie et. al. eventually found that the phenotype was not linked to mutated Siae gene but instead to a gene encoding a guanine nucleotide exchange factor, Dock2, on chromosome 11. Using whole-genome sequencing they found a duplication of exons 28 and 29 of Dock2. This mutation was also present in the original C57BL/6NHsd colony from Harlan but not in the C57BL/6J mice from Jackson, which explains the disappearance of the phenotype when backcrossing to that latter strain [179].  One aim of my Ph.D. research was to define the role of the L-type Ca2+ channel CaV1.4 (encoded by Cacna1f) in B cells. The CaV1.4-deficient mouse model we used for this purpose also harboured the aforementioned Dock2Hsd mutation, most likely introduced to our colony by backcrossing to C57BL/6NHsd mice from Harlan, ordered by UBC Animal Care. This, however, provided the opportunity to characterize the immune deficiencies of the CaV1.4/DOCK2 double KO mice, which exhibited a B cell phenotype that is described in the previous chapter 4. We came to realize that the Dock2Hsd allele existed in our colony, when crossing our original mouse model to another transgenic mouse model and the mutation in the Cacna1f gene did not segregate with the phenotype we initially observed. This phenotype was remarkably similar to the one described by Mahajan, Demissie et al., which led us to believe that also our mouse model harbours the described Dock2Hsd variant. Indeed, a PCR analysis revealed that our CaV1.4 KO colony also carried that mutation while C57BL/6NCrl mice from Charles River that we used as controls didn’t (Figure 5.1). Since parts of the phenotype did not segregate with the mutated Cacna1f gene they were most likely caused by the Dock2 mutation. However, not every aspect 106  of the phenotype observed in chapter 4 was analysed when crossing the mouse model. In this chapter, I addressed whether the observed deficiencies stem from the mutation in Cacna1f, Dock2 or the combination of the two.   Figure 5.1 The Dock2Hsd allele exists in our CaV1.4 KO mouse model The CaV1.4 mouse colony was genotyped for the Cacna1f -and the Dock2 mutation  5.2 Results In order to remove the Dock2Hsd allele from our mouse colony, we bred a double KO female (Cacna1f is encoded on the X chromosome) mouse to a C57BL/6NCrl male mouse. Since we wanted to avoid the further use of C57BL/6NHsd mice from Harlan for backcrossing we chose the C57BL/6NCrl strain from Charles River for that purpose. Based on a SNP analysis their genome, except for the Dock2 mutation, of course, was found to be very similar to that of Harlan mice [209]. The offspring of this breeding pair was heterozygous for the Dock2Hsd allele and had one copy of the mutated Cacna1f allele. Females also had a WT allele of Cacna1f on their 2nd X chromosome. This F1 offspring was then allowed to interbreed, giving us a 1/16 chance to get a pup homozygous for the Cacna1f mutation and the Dock2 WT allele (Figure 5.2). 107     Figure 5.2 Double KO mice were bred to get homozygous single KO mice. Double-deficient mice were bred to WT C57BL/6Crl mice and the resulting F1 offspring again mated with each other.  We had male and female animals of the desired Cacna1f-/- only genotype in the F2 generation so we could now breed this colony in our lab devoid of the Dock2Hsd allele. (Figure 5.3). We also obtained WT, double KO and homo-/heterozygous Dock2 KO pups in these litters, which we did not breed any further but used to evaluate their phenotype and compare it to Cacna1f KO mice. Due to the nature of the Dock2 mutation (duplication event of a 23.5 kbp region), we could not determine by PCR whether mice that carried the Dock2Hsd allele were homo- or heterozygous mutants. Since heterozygous carriers still had their MZ B cells while homozygous mutant did not, we instead based the genotypic classification on this phenotypic observation as it has been recommended previously [179].   108   Figure 5.3 Breeding yielded a few mice that were Cacna1f-/- devoid of Dock2Hsd New animals of the F2 generation were genotyped by PCR. A band in the Dock2 panel means a Dock2Hsd allele is present. In the Cacna1f panel, the lower band stands for a WT Cacna1f allele, while the higher band is amplified from the mutated allele. Presence of both bands means that the sample is from a heterozygous mouse (only possible for females).  After determining the genotype of the new animals, we phenotyped their splenocytes. To this end, we repeated a number of experiments that we have previously performed on the old double KO mouse model with the new one and C57BL/6NCrl controls. In these experiments, we also included mice from the old double KO colony and a Dock2-/- only mouse for phenotypic comparisons. The results of this analysis I described in this chapter, while a more thorough description of the B cell phenotype of the double KO mouse can be found in the previous chapter 4.  5.2.1 Cacna1f-/- mice have normal splenic B cell frequencies. One of the most striking deficiencies of in the old double KO mice was the severe B cell cytopenia. When we now examined the new CaV1.4-/- mice we found that their frequency of splenic B cells (B220+) is comparable to that of WT animals. The DOCK2-/- mouse on the other 109  had a strongly reduced frequency of B220+ cells, similar to the old CaV1.4/DOCK2-/- colony (Figure 5.4A). Likewise, MZ B cells were completely absent in the CaV1.4/DOCK2-/- and DOCK2-/- mice while their frequency was only somewhat reduced in CaV1.4-/- animals compared to WT (Figure 5.4B).   5.2.2 Cacna1f-/- B cells express normal levels of BAFF-R. The BAFF receptor (BAFF-R) is an important pro-survival receptor on B cells and its expression was reduced on our double KO B cells. This downregulation seems to be a result of DOCK2 deficiency. DOCK2-/- B cells exhibit reduced BAFF-R levels similar to CaV1.4/DOCK2-/- B cells, while the levels of CaV1.4-/- B cells are comparable to WT (Figure 5.4C).  5.2.3 Cacna1f-/- B cells are still chronically activated. The chronic activation of CaV1.4/DOCK2-/- B cells (measured by CD86 and CD69 upregulation) on the other hand persisted in CaV1.4-/- mice as well as in the DOCK2-/- mouse (Figure 5.4D & E). However, the granularity of CaV1.4-/- B cells (measured by SSC-A) was comparable to WT cells (Figure 5.4F).  110   Figure 5.4 Most of the B cell phenotype segregates with the Dock2 mutation Freshly isolated splenocytes of WT (n=4), Cacna1f-/- (n=4), Dock2-/- (n=1) and double KO mice (n=4) were stained with antibodies against B220, CD21, CD23, BAFF-R, CD86 and CD69 and analysed by flow cytometry. Histograms show one representative sample of each genotype. This experiment was only done once. * p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.  5.2.4 Reduced CD4/CD8 T cell ratio segregates with DOCK2 deficiency. Apart from the already in chapter 4 described B cell phenotype, our double-deficient mouse model also exhibited a severe T cell phenotype. Since DOCK2 has already been shown to play important roles in T cell actin polymerization and migration [182] this is not further surprising. 111  One of the most obvious phenotypes in our double KO mouse model was the reduced CD4/CD8 T cell ratio. After separating the Dock2 and Cacna1f mutations it was revealed that the DOCK2-/- mouse exhibits a similar reduced CD4/CD8 T cell ratio seen in CaV1.4/DOCK2-/- animals (Figure 5.5A). In CaV1.4-/- mice, on the other hand, there was a trend of an increased CD4/CD8 T cell ratio. Although not significant in this experiment, we saw in chapter 3 (Figure 3.2) that when given more samples this difference becomes significant.  5.2.5 Cacna1f-/- T cells still express reduced levels of and IL7R and CD62L. The activation/memory markers IL7R and CD62L were both strongly reduced on double KO T cells. This was also true for DOCK2-deficient T cells, implying a correlation of this phenotype with the Dock2 mutation. Interestingly, CaV1.4-/- T cells also exhibited reduced levels of these markers compared to WT T cells, although not to the same extent as the double KO T cells did (Figure 5.5B & C)   5.2.6 Expression of PD-1 is higher in Cacna1f KO than in double KO T cells. We previously also saw an upregulation of the inhibitory receptor PD-1 on T cells of our double-deficient mice. These higher levels of PD-1 persisted in both single KO mouse models (Figure 5.5D). Interestingly we noticed that in CD4 CD62L- T cells the PD-1 levels were upregulated in CaV1.4-/- mice particularly (Figure 5.5E), which is worthy of further exploration. We have done so in chapter 3.   112  5.2.7 Cacna1f-/- T cells have elevated levels of CTLA-4 The expression levels of another inhibitory receptor, namely CTLA-4 are also significantly elevated in CaV1.4-/- CD8 T cells (Figure 5.5F). This also was a new finding not observed in CaV1.4/DOCK2-/- T cells nor DOCK2-deficient T cells. Again, this is worthy of further investigation and was done in chapter 3.  Figure 5.5 CaV1.4-/- T cells exhibit upregulated levels of PD-1 and CTLA-4, a T cell phenotype not observed in double-KO mice 113  Figure 5.5 Continued. Freshly isolated splenocytes of WT (n=3), Cacna1f-/- (n=4), Dock2-/- (n=1) and double KO mice (n=4) were stained with antibodies against CD3, CD4, CD8, CD62L, IL7R, PD-1 and CTLA-4 and analysed by flow cytometry. Histograms show one representative sample of each genotype. This experiment was only done once. The Dock2-/- group is only represented by one mouse. * p<0.05 ** p<0.01 *** p<0.001 **** p<0.0001.  5.3 Discussion The discovery of the Dock2Hsd variant by Mahajan, Demissie et al. may have a considerable impact on the field. Laboratories using C57BL/6NHsd mice from Harlan for backcrossing or as controls will need to carefully review and reinterpret their studies. Due to the expression of DOCK2 in primarily hematopoietic cells, this is particularly important, when investigating immune phenotypes. We also detected the Dock2Hsd variant in our CaV1.4 mouse colony. At some point in the past UBC Animal Care had ordered Harlan mice instead of Jackson because their mice were less expensive and they were unaware of the substrain differences between the Harlan and Jackson C57BL/6 colony. This is most likely the source of the Dock2 mutation in our breeding stock. This discovery forced us to revisit the data we collected on this mouse model (see previous chapter 4 for original data). By further backcrossing the double KO mouse model to C57BL/6NCrl mice and selecting for the Cacna1f mutant gene but not the Dock2 mutation we were able to obtain a CaV1.4-deficient mouse model without the contaminating mutation. When investigating this new mouse model and comparing it to WT C57BL/6NCrl, double KO as well as DOCK2 KO mice we realized that a significant portion of the previously observed phenotype, particularly the B cell phenotype, was due to the Dock2 mutation. However, there was a residual as well as a completely novel phenotype in the new CaV1.4-/- animals.  114  As already hypothesized in the previous chapter, the reduced number of splenic B cells and the almost complete absence of MZ B cells observed in the double KO mice segregated with the Dock2 mutation. This was in accordance with the findings of Mahajan, Demissie et al. [179] as well as an earlier publication by Fukui et al. showing that DOCK2 deficiency led to splenic cytopenia, including B cells, as well as a significant reduction of MZ B cells [182]. Also, the reduced expression of the BAFF-R disappeared in CaV1.4-/- B cells but correlated with DOCK2 deficiency instead. We already anticipated this correlation in the previous chapter, since the DOCK2 dependent GTPase Rac has been shown to induce the upregulation of the BAFF-R [197]. Nevertheless, the DOCK2 dependence of the BAFF-R is a novel finding not described in the literate so far and is worthy of further investigation.  The reduced CD4/CD8 T cell ratio in the double KO mice was not seen in CaV1.4-/- mice but instead clearly segregated with DOCK2 deficiency. This was also previously seen by Fukui et al. [182]. The IL7R, as well as CD62L, were significantly downregulated in double-KO T cells. Also, here similar levels of downregulation were seen in the DOCK2-/- T cells. However, CaV1.4-/- T cells also exhibited decreased CD62L and IL7R expression but not as severe as in DOCK2 and double KO T cells.  Besides the substantial dependence of the double KO phenotype on DOCK2, significant aspects of the phenotype were retained in the CaV1.4-/- mouse model. This includes the chronic activation of B cells since both single KO mouse models kept this phenotype. For T cells, a milder memory phenotype as in the double KO mice was seen in the CaV1.4-/- mice. Interestingly, the upregulation of PD-1 was not only retained but amplified in CaV1.4-deficient T 115  cells, compared to the double KO cells, especially pronounced in the CD4 CD62L- subset. Another novel phenotype of CaV1.4-only deficiency was increased CTLA-4 expression on CD8 T cells.  These results demonstrate that CaV1.4 and DOCK2 both play important roles in lymphocyte physiology and as deficiencies in either lead to PIDs in humans they are both worthy, either alone or together, of further investigation.  In conclusion the discovery of the Dock2Hsd allele in our mouse colony demonstrates how wide-spread this mutation is and emphasize the importance of monitoring mouse colonies for genetic drift.  5.4 Material and methods Mice: Mice were bred at the Animal Research Unit at UBC under specific-pathogen-free conditions. Cacna1f −/− mice have been previously described [156] and were backcrossed to  C57BL/6NHsd from Harlan Sprague Dawley (Indianapolis, IN, USA) for 13 generations. To eliminate the Dock2 mutation this colony harboured [179], mice were further backcrossed to C57BL/6NCrl mice from Charles River Laboratories (Wilmington, MA, USA) for one generation. This F1 generation was then allowed to interbreed and in the F2 generation Cacna1f-/- only mice were selected to establish a new colony. C57BL/6NCrl mice were also used as control animals. All studies followed guidelines set by both the University of British Columbia's Animal Care Committee and the Canadian Council on Animal Care.  116  Genotyping: Ear notches were digested in ear notch buffer with Proteinase K and extracted DNA was used as template in PCR using Taq PCR Master Mix Kit (Qiagen, cat. nr. 201443). To target the insert disrupting Cacna1f the primer sequences used were: Cacna1f Fwd: ATATGGAAGCAGAGGAGGACC, Cacna1f Rev: CCAGTAGAGGACGTCTGTCCA as described previously [156]. The PCR cycles were the following: 95°C for 2 min, followed by 30 cycles at 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec followed by 5 min at 72°C. For detection of the Dock2Hsd mutation the following primers were used: Dock2 Fwd: GACCTTATGAGGTGGAACCACAACC, Dock2 Rev: GATCCAAAGATTCCCTACAGCTCCAC as described previously [179]. The PCR cycles were the following: 95°C for 2 min, followed by 30 cycles at 95°C for 30 sec, 65°C for 30 sec and 72°C for 30 sec followed by 5 min at 72°C. The PCR products were then run on 2% agarose gel with SYBR Safe (Thermo Fisher, cat. nr. S33102) diluted 1/10000 and visualized under UV light. Splenocytes extraction: 8-12 weeks old mice were euthanized and their spleens excised. Spleens were then mashed through a 70μm cell strainer using a syringe plunger to obtain a single cell suspension. Red blood cells were then lysed using ACK lysing buffer and the remaining white blood cells were washed with PBS and resuspended in PBS with 2% FBS. Flow cytometry with mouse splenocytes: Freshly isolated 2 x 106 mouse splenocytes, resuspended in PBS with 2% FBS, were labelled for 30 min at 4°C in the dark with different antibody panels. The antibodies used were: α-B220 (RA3-6B2, eBioscience, cat. nr. 47-0452-82), α-CD21 (eBio4E3, eBioscience, cat. nr. 48-0212-80), α-CD23 (B3B4, Biolegend, cat. nr. 101612), α-BAFFR (7H22-E16, Biolegend, cat. nr. 134105), α-CD86 (GL1, eBioscience, cat. nr. 12-0862-81), α-CD69 (H1.2F3, eBioscience, cat. nr. 11-0691-81), α-CD8 (5H10, Thermo 117  Fischer, cat. nr. MCD0828TR), α-CD4 (RM4-5, Thermo Fischer, cat. nr. 56-0042-80), α-CD3 (17A2, eBioscience, cat. nr. 46-0032-80), α-CD62L (MEL-14, Biolegend, cat. nr. 104411), α-PD-1 (29F-1A12, Biolegend, cat. nr. 135223), α-IL7R (A7R34, Biolegend, cat. nr. 135031), α-CTLA-4 (UC10-4B9, eBioscience, cat. nr. 12-1522-81). All flow cytometry antibodies were purchased from either Invitrogen, eBioscience or Biolegend. The cells were then washed twice with PBS, resuspended in PBS with 2% FBS and data were acquired on an LSRII (BD Biosciences) and analysed with FlowJo software (Treestar, Inc). Statistical tests: Statistical significance was determined using unpaired Student's t tests using RStudio.   118  Chapter 6: Conclusion  PIDs are a class of rare genetic diseases that affect the immune system adversely and increase the susceptibility of the affected individual to infections. Ca2+ is a crucial second messenger in the immune system that when not regulated properly, due to genetic deficits, can lead to PIDs. An example of such a disorder is IMD9/10, which is caused by a mutation in the genes encoding the CRAC channel, the main conductor of Ca2+ in lymphocytes. Patients with this disease exhibit impaired TCR-mediated SOCE leading to reduced effector functions of T cells, making them very susceptible to severe viral and bacterial infections. We have identified a new primary human immunodeficiency that although not as severe as IMD9/10 impairs Ca2+ signalling in T cells and causes further immune-related phenotypes. The underlying mutation in this disease is within the gene CACNA1F, which encodes the α1 subunit of the L-type Ca2+ channel CaV1.4. This seems to be the first example of an L-type Ca2+ channel deficiency causing an immune phenotype in humans. We were also able to confirm the immune phenotype in a CaV1.4-deficient mouse model. The phenotypes of CaV1.4 mice and patients were remarkably similar. In both, we observed an increased frequency of memory T cells as well as signs of chronic T cell activation/exhaustion. Also, we found different markers of B cell activation upregulated in CaV1.4-deficient mice and humans, which demonstrates that the B cells too are in a chronic state of activation. Furthermore, the results of Ca2+-flux assays were also analogous in CaV1.4-deficient mice and patients. They both exhibit defects in Ca2+-mobilization during SOCE in T cells but not B cells.   119  Interestingly, while most Cacna1f nonsense or missense mutations always lead to incomplete CSNB this is the first time a mutation in that gene is associated with an immune phenotype. Other variants in the SH2D1A and the AMPD genes could possibly contribute to the patients’ phenotype but were not observed in all three siblings leaving the CACNA1F mutation as their common denominator. The possibility remains that other undetected SNPs cooperate with the variant. Alternatively, unique environmental circumstances might have triggered the phenotype in the patients. According to the family, EBV infection of the siblings in their early teens severely exacerbated their symptoms, a phenomenon that is also often seen in other PIDs like XLP syndrome.  PIDs provide opportunities to shed light on the role of the mutated gene in the immune processes it affects. These studies confirm a role of the L-type Ca2+ channel CaV1.4 in lymphocytes. While the CRAC channel is known to be the main entry of Ca2+ in lymphocytes several other Ca2+ channels are now known to also contribute to TCR/BCR-induced Ca2+ flux and are also thought to contribute to the homeostasis of resting lymphocytes. Our lab has previously already demonstrated the importance of CaV1.4 in T cells in a murine mouse model. Here we show for the first time in human lymphocytes that a mutated gene encoding a Ca2+ channel other than the CRAC channel affects the homeostasis of lymphocytes and the Ca2+ mobilization in T cells.   6.1 Future directions In order to further characterize the T cell populations of CaV1.4-deficient mice and patients, it would be interesting to use more markers in the flow cytometry analysis. That way the CD4 population could be further split up into TH1/2/17 as well as TFH cells. This would give insight 120  into whether there exist certain lymphocyte populations that are affected to a greater extent by CaV1.4 deficiency than others. It is possible that the reduced Ca2+ flux also stems from a different composition of the T cell subsets in CaV1.4-deficient mice/patients. The separation of lymphocyte populations would therefore also be informative during Ca2+ flux assays, so one can tell if there is a certain population that exhibits a more severe reduction of Ca2+ flux than others. Also using other stimuli like TCR/BCR crosslinking, as well as the L-type Ca2+ channel agonist BayK would be interesting, to better characterize the nature of the Ca2+ flux deficiency.  The T cell exhaustion needs to be confirmed by staining for other inhibitory markers on CaV1.4-deficient T cells. Also, RNA sequencing would be very informative as exhausted T cells exhibit a characteristic signature transcriptome. To further support the exhaustion-phenotype it would be interesting to also run several functional assays to test the T cells ability to proliferate as well as other effector function like the secretion of cytotoxic granules and cytokines.  Another question that remains is, whether the memory phenotype and exhaustion is the result of a flaw in the maturation of the cells or caused by chronic infections, which the functionally impaired T cells are less able to control. SiRNA knockdown of CaV1.4 in lymphocytes of control donors / WT mice would be a way to address this question. If the knockdown lymphocytes phenocopy the genetically deficient cells, it would indicate that the phenotype is purely due to CaV1.4 deficiency as the cells all shared the same maturation.  Lastly, although there exist many patients with CSNB due to CaV1.4 deficiency, it seems to be less penetrant in causing an immune phenotype. It would therefore be beneficial to identify more 121  CaV1.4-deficient patients and analyze their immune phenotype as this would give insight into the immune phenotype penetrance and would overall strengthen the results of the CaV1.4 deficiency in humans. 122  References  1.  Klein L, Kyewski B, Allen PM, Hogquist KA. Positive and negative selection of the T cell repertoire: what thymocytes see (and don’t see). Nat Rev Immunol. 2014 Jun;14(6):377–91.  2.  Brownlie RJ, Zamoyska R. T cell receptor signalling networks: branched, diversified and bounded. Nat Rev Immunol. 2013 Apr;13(4):257–69.  3.  Huse M. The T-cell-receptor signaling network. J Cell Sci. 2009 May 1;122(9):1269–73.  4.  Kurosaki T, Shinohara H, Baba Y. B Cell Signaling and Fate Decision. Annu Rev Immunol. 2010 Mar;28(1):21–55.  5.  June CH, Warshauer JT, Bluestone JA. Is autoimmunity the Achilles’ heel of cancer immunotherapy? Nat Med. 2017 May 5;23(5):540–7.  6.  Metzger TC, Anderson MS. Control of central and peripheral tolerance by Aire. Immunol Rev. 2011 May;241(1):89–103.  7.  Kumar BV, Connors TJ, Farber DL. Human T Cell Development, Localization, and Function throughout Life. Immunity. 2018 Feb;48(2):202–13.  8.  Stritesky GL, Jameson SC, Hogquist KA. Selection of Self-Reactive T Cells in the Thymus. Annu Rev Immunol. 2012 Apr 23;30(1):95–114.  9.  Kaech SM, Cui W. Transcriptional control of effector and memory CD8+ T cell differentiation. Nat Rev Immunol. 2012 Nov;12(11):749–61.  10.  Sahoo A, Wali S, Nurieva R. T helper 2 and T follicular helper cells: Regulation and function of interleukin-4. Cytokine Growth Factor Rev. 2016 Aug;30:29–37.  123  11.  Crome SQ, Wang AY, Levings MK. Translational Mini-Review Series on Th17 Cells: Function and regulation of human T helper 17 cells in health and disease. Clin Exp Immunol. 2010 Feb;159(2):109–19.  12.  Benoist C, Mathis D. Treg Cells, Life History, and Diversity. Cold Spring Harb Perspect Biol. 2012 Sep 1;4(9):a007021–a007021.  13.  Jameson SC, Masopust D. Diversity in T Cell Memory: An Embarrassment of Riches. Immunity. 2009 Dec;31(6):859–71.  14.  Kaech SM, Tan JT, Wherry EJ, Konieczny BT, Surh CD, Ahmed R. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat Immunol. 2003 Dec;4(12):1191–8.  15.  Masopust D, Vezys V, Marzo AL, Lefrançois L. Preferential localization of effector memory cells in nonlymphoid tissue. Science. 2001 Mar 23;291(5512):2413–7.  16.  Nolz JC, Harty JT. Protective capacity of memory CD8+ T cells is dictated by antigen exposure history and nature of the infection. Immunity. 2011 May 27;34(5):781–93.  17.  Zajac AJ, Blattman JN, Murali-Krishna K, Sourdive DJ, Suresh M, Altman JD, et al. Viral immune evasion due to persistence of activated T cells without effector function. J Exp Med. 1998 Dec 21;188(12):2205–13.  18.  Doering TA, Crawford A, Angelosanto JM, Paley MA, Ziegler CG, Wherry EJ. Network analysis reveals centrally connected genes and pathways involved in CD8+ T cell exhaustion versus memory. Immunity. 2012 Dec 14;37(6):1130–44.  19.  Brooks DG, McGavern DB, Oldstone MBA. Reprogramming of antiviral T cells prevents inactivation and restores T cell activity during persistent viral infection. J Clin Invest. 2006 Jun;116(6):1675–85.  124  20.  Angelosanto JM, Blackburn SD, Crawford A, Wherry EJ. Progressive loss of memory T cell potential and commitment to exhaustion during chronic viral infection. J Virol. 2012 Aug;86(15):8161–70.  21.  Wherry EJ. T cell exhaustion. Nat Immunol. 2011 Jun;131(6):492–9.  22.  Sharpe AH, Wherry EJ, Ahmed R, Freeman GJ. The function of programmed cell death 1 and its ligands in regulating autoimmunity and infection. Nat Immunol. 2007 Mar;8(3):239–45.  23.  Wherry EJ, Kurachi M. Molecular and cellular insights into T cell exhaustion. Nat Rev Immunol. 2015 Aug;15(8):486–99.  24.  Fourcade J, Sun Z, Benallaoua M, Guillaume P, Luescher IF, Sander C, et al. Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen-specific CD8+ T cell dysfunction in melanoma patients. J Exp Med. 2010 Sep 27;207(10):2175–86.  25.  Blackburn SD, Shin H, Haining WN, Zou T, Workman CJ, Polley A, et al. Coregulation of CD8+ T cell exhaustion by multiple inhibitory receptors during chronic viral infection. Nat Immunol. 2009 Jan;10(1):29–37.  26.  Kaufmann DE, Kavanagh DG, Pereyra F, Zaunders JJ, Mackey EW, Miura T, et al. Upregulation of CTLA-4 by HIV-specific CD4+ T cells correlates with disease progression and defines a reversible immune dysfunction. Nat Immunol. 2007 Nov;8(11):1246–54.  27.  Barber DL, Wherry EJ, Masopust D, Zhu B, Allison JP, Sharpe AH, et al. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature. 2006 Feb 9;439(7077):682–7.  28.  Pauken KE, Wherry EJ. Overcoming T cell exhaustion in infection and cancer. Trends Immunol. 2015 Apr;36(4):265–76.  125  29.  Teijaro JR, Ng C, Lee AM, Sullivan BM, Sheehan KCF, Welch M, et al. Persistent LCMV infection is controlled by blockade of type I interferon signaling. Science. 2013 Apr 12;340(6129):207–11.  30.  Wilson EB, Yamada DH, Elsaesser H, Herskovitz J, Deng J, Cheng G, et al. Blockade of chronic type I interferon signaling to control persistent LCMV infection. Science. 2013 Apr 12;340(6129):202–7.  31.  Brooks DG, Trifilo MJ, Edelmann KH, Teyton L, McGavern DB, Oldstone MBA. Interleukin-10 determines viral clearance or persistence in vivo. Nat Med. 2006 Nov;12(11):1301–9.  32.  Ejrnaes M, Filippi CM, Martinic MM, Ling EM, Togher LM, Crotty S, et al. Resolution of a chronic viral infection after interleukin-10 receptor blockade. J Exp Med. 2006 Oct 30;203(11):2461–72.  33.  Tinoco R, Alcalde V, Yang Y, Sauer K, Zuniga EI. Cell-Intrinsic Transforming Growth Factor-β Signaling Mediates Virus-Specific CD8+ T Cell Deletion and Viral Persistence In Vivo. Immunity. 2009 Jul;31(1):145–57.  34.  Martinez GJ, Pereira RM, Äijö T, Kim EY, Marangoni F, Pipkin ME, et al. The transcription factor NFAT promotes exhaustion of activated CD8+ T cells. Immunity. 2015 Feb 17;42(2):265–78.  35.  Kao C, Oestreich KJ, Paley MA, Crawford A, Angelosanto JM, Ali M-AA, et al. Transcription factor T-bet represses expression of the inhibitory receptor PD-1 and sustains virus-specific CD8+ T cell responses during chronic infection. Nat Immunol. 2011 May 29;12(7):663–71.  126  36.  Pauken KE, Sammons MA, Odorizzi PM, Manne S, Godec J, Khan O, et al. Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade. Science. 2016 02;354(6316):1160–5.  37.  Sen DR, Kaminski J, Barnitz RA, Kurachi M, Gerdemann U, Yates KB, et al. The epigenetic landscape of T cell exhaustion. Science. 2016 02;354(6316):1165–9.  38.  Feske S, Wulff H, Skolnik EY. Ion Channels in Innate and Adaptive Immunity. Annu Rev Immunol. 2015 Mar 21;33(1):291–353.  39.  Nohara LL, Stanwood SR, Omilusik KD, Jefferies WA. Tweeters, Woofers and Horns: The Complex Orchestration of Calcium Currents in T Lymphocytes. Front Immunol [Internet]. 2015 May 21 [cited 2017 Dec 30];6. Available from: http://journal.frontiersin.org/Article/10.3389/fimmu.2015.00234/abstract 40.  Omilusik KD, Nohara LL, Stanwood S, Jefferies WA. Weft, Warp, and Weave: The Intricate Tapestry of Calcium Channels Regulating T Lymphocyte Function. Front Immunol [Internet]. 2013 [cited 2017 Dec 30];4. Available from: http://journal.frontiersin.org/article/10.3389/fimmu.2013.00164/abstract 41.  Scharenberg AM, Humphries LA, Rawlings DJ. Calcium signalling and cell-fate choice in B cells. Nat Rev Immunol. 2007 Oct;7(10):778–89.  42.  Zweifach A, Lewis RS. Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores. Proc Natl Acad Sci U S A. 1993 Jul 1;90(13):6295–9.  43.  Partiseti M, Le Deist F, Hivroz C, Fischer A, Korn H, Choquet D. The calcium current activated by T cell receptor and store depletion in human lymphocytes is absent in a primary immunodeficiency. J Biol Chem. 1994 Dec 23;269(51):32327–35.  127  44.  Le Deist F, Hivroz C, Partiseti M, Thomas C, Buc HA, Oleastro M, et al. A primary T-cell immunodeficiency associated with defective transmembrane calcium influx. Blood. 1995 Feb 15;85(4):1053–62.  45.  Feske S, Müller JM, Graf D, Kroczek RA, Dräger R, Niemeyer C, et al. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in T lymphocytes of two male siblings. Eur J Immunol. 1996 Sep;26(9):2119–26.  46.  Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel S-H, Tanasa B, et al. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature. 2006 May 11;441(7090):179–85.  47.  McCarl C-A, Picard C, Khalil S, Kawasaki T, Röther J, Papolos A, et al. ORAI1 deficiency and lack of store-operated Ca2+ entry cause immunodeficiency, myopathy, and ectodermal dysplasia. J Allergy Clin Immunol. 2009 Dec;124(6):1311-1318.e7.  48.  Picard C, McCarl C-A, Papolos A, Khalil S, Lüthy K, Hivroz C, et al. STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med. 2009 May 7;360(19):1971–80.  49.  Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, et al. STIM1, an essential and conserved component of store-operated Ca2+ channel function. J Cell Biol. 2005 May 9;169(3):435–45.  50.  Zhang SL, Yeromin AV, Zhang XH-F, Yu Y, Safrina O, Penna A, et al. Genome-wide RNAi screen of Ca(2+) influx identifies genes that regulate Ca(2+) release-activated Ca(2+) channel activity. Proc Natl Acad Sci U S A. 2006 Jun 13;103(24):9357–62.  128  51.  Gwack Y, Srikanth S, Oh-hora M, Hogan PG, Lamperti ED, Yamashita M, et al. Hair Loss and Defective T- and B-Cell Function in Mice Lacking ORAI1. Mol Cell Biol. 2008 Sep 1;28(17):5209–22.  52.  Oh-hora M, Yamashita M, Hogan PG, Sharma S, Lamperti E, Chung W, et al. Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol. 2008 Apr;9(4):432–43.  53.  Vaeth M, Yang J, Yamashita M, Zee I, Eckstein M, Knosp C, et al. ORAI2 modulates store-operated calcium entry and T cell-mediated immunity. Nat Commun. 2017 Mar 15;8:14714.  54.  Beyersdorf N, Braun A, Vogtle T, Varga-Szabo D, Galdos RR, Kissler S, et al. STIM1-Independent T Cell Development and Effector Function In Vivo. J Immunol. 2009 Mar 15;182(6):3390–7.  55.  McCarl C-A, Khalil S, Ma J, Oh-hora M, Yamashita M, Roether J, et al. Store-Operated Ca2+ Entry through ORAI1 Is Critical for T Cell-Mediated Autoimmunity and Allograft Rejection. J Immunol. 2010 Nov 15;185(10):5845–58.  56.  Shaw PJ, Weidinger C, Vaeth M, Luethy K, Kaech SM, Feske S. CD4+ and CD8+ T cell–dependent antiviral immunity requires STIM1 and STIM2. J Clin Invest. 2014 Oct 1;124(10):4549–63.  57.  Weidinger C, Shaw PJ, Feske S. STIM1 and STIM2-mediated Ca 2+ influx regulates antitumour immunity by CD8 + T cells: Antitumour immunity depends on STIM1 and STIM2. EMBO Mol Med. 2013 Sep;5(9):1311–21.  58.  Greenberg ML, Yu Y, Leverrier S, Zhang SL, Parker I, Cahalan MD. Orai1 Function Is Essential for T Cell Homing to Lymph Nodes. J Immunol. 2013 Apr 1;190(7):3197–206.  129  59.  Waite JC, Vardhana S, Shaw PJ, Jang J-E, McCarl C-A, Cameron TO, et al. Interference with Ca 2+ release activated Ca 2+ (CRAC) channel function delays T-cell arrest in vivo: Molecular immunology. Eur J Immunol. 2013 Dec;43(12):3343–54.  60.  Oh-Hora M, Komatsu N, Pishyareh M, Feske S, Hori S, Taniguchi M, et al. Agonist-selected T cell development requires strong T cell receptor signaling and store-operated calcium entry. Immunity. 2013 May 23;38(5):881–95.  61.  Wu Y, Borde M, Heissmeyer V, Feuerer M, Lapan AD, Stroud JC, et al. FOXP3 Controls Regulatory T Cell Function through Cooperation with NFAT. Cell. 2006 Jul;126(2):375–87.  62.  Kim K-D, Srikanth S, Tan Y-V, Yee M-K, Jew M, Damoiseaux R, et al. Calcium signaling via Orai1 is essential for induction of the nuclear orphan receptor pathway to drive Th17 differentiation. J Immunol Baltim Md 1950. 2014 Jan 1;192(1):110–22.  63.  Ma J, McCarl C-A, Khalil S, Lüthy K, Feske S. T-cell-specific deletion of STIM1 and STIM2 protects mice from EAE by impairing the effector functions of Th1 and Th17 cells. Eur J Immunol. 2010 Nov;40(11):3028–42.  64.  Matsumoto M, Fujii Y, Baba A, Hikida M, Kurosaki T, Baba Y. The calcium sensors STIM1 and STIM2 control B cell regulatory function through interleukin-10 production. Immunity. 2011 May 27;34(5):703–14.  65.  Limnander A, Depeille P, Freedman TS, Liou J, Leitges M, Kurosaki T, et al. STIM1, PKC-δ and RasGRP set a threshold for proapoptotic Erk signaling during B cell development. Nat Immunol. 2011 May;12(5):425–33.  66.  Limnander A, Weiss A. Ca 2+ -dependent Ras/Erk signaling mediates negative selection of autoreactive B cells. Small GTPases. 2011 Sep;2(5):282–8.  130  67.  Robert V, Triffaux E, Savignac M, Pelletier L. Calcium signalling in T-lymphocytes. Biochimie. 2011 Dec;93(12):2087–94.  68.  Clapham DE. International Union of Pharmacology. XLIII. Compendium of Voltage-Gated Ion Channels: Transient Receptor Potential Channels. Pharmacol Rev. 2003 Dec 1;55(4):591–6.  69.  Julius D. TRP channels and pain. Annu Rev Cell Dev Biol. 2013;29:355–84.  70.  Bertin S, Raz E. Transient Receptor Potential (TRP) channels in T cells. Semin Immunopathol. 2016 May;38(3):309–19.  71.  Schwarz EC, Wolfs MJ, Tonner S, Wenning AS, Quintana A, Griesemer D, et al. TRP channels in lymphocytes. Handb Exp Pharmacol. 2007;(179):445–56.  72.  Bertin S, Aoki-Nonaka Y, de Jong PR, Nohara LL, Xu H, Stanwood SR, et al. The ion channel TRPV1 regulates the activation and proinflammatory properties of CD4+ T cells. Nat Immunol. 2014 Oct 5;15(11):1055–63.  73.  Majhi RK, Sahoo SS, Yadav M, Pratheek BM, Chattopadhyay S, Goswami C. Functional expression of TRPV channels in T cells and their implications in immune regulation. FEBS J. 2015 Jul;282(14):2661–81.  74.  Bertin S, Aoki-Nonaka Y, Lee J, de Jong PR, Kim P, Han T, et al. The TRPA1 ion channel is expressed in CD4+ T cells and restrains T-cell-mediated colitis through inhibition of TRPV1. Gut. 2017 Sep;66(9):1584–96.  75.  Wang J, Lu Z-H, Gabius H-J, Rohowsky-Kochan C, Ledeen RW, Wu G. Cross-Linking of GM1 Ganglioside by Galectin-1 Mediates Regulatory T Cell Activity Involving TRPC5 Channel Activation: Possible Role in Suppressing Experimental Autoimmune Encephalomyelitis. J Immunol. 2009 Apr 1;182(7):4036–45.  131  76.  Melzer N, Hicking G, Göbel K, Wiendl H. TRPM2 Cation Channels Modulate T Cell Effector Functions and Contribute to Autoimmune CNS Inflammation. Stangel M, editor. PLoS ONE. 2012 Oct 12;7(10):e47617.  77.  Beck A, Kolisek M, Bagley LA, Fleig A, Penner R. Nicotinic acid adenine dinucleotide phosphate and cyclic ADP-ribose regulate TRPM2 channels in T lymphocytes. FASEB J Off Publ Fed Am Soc Exp Biol. 2006 May;20(7):962–4.  78.  Weber KS, Hildner K, Murphy KM, Allen PM. Trpm4 differentially regulates Th1 and Th2 function by altering calcium signaling and NFAT localization. J Immunol Baltim Md 1950. 2010 Sep 1;185(5):2836–46.  79.  Philipp S, Strauss B, Hirnet D, Wissenbach U, Mery L, Flockerzi V, et al. TRPC3 mediates T-cell receptor-dependent calcium entry in human T-lymphocytes. J Biol Chem. 2003 Jul 18;278(29):26629–38.  80.  Wenning AS, Neblung K, Strauß B, Wolfs M-J, Sappok A, Hoth M, et al. TRP expression pattern and the functional importance of TRPC3 in primary human T-cells. Biochim Biophys Acta BBA - Mol Cell Res. 2011 Mar;1813(3):412–23.  81.  Tseng P-H, Lin H-P, Hu H, Wang C, Zhu MX, Chen C-S. The canonical transient receptor potential 6 channel as a putative phosphatidylinositol 3,4,5-trisphosphate-sensitive calcium entry system. Biochemistry (Mosc). 2004 Sep 21;43(37):11701–8.  82.  Carrillo C, Hichami A, Andreoletti P, Cherkaoui-Malki M, del Mar Cavia M, Abdoul-Azize S, et al. Diacylglycerol-containing oleic acid induces increases in [Ca(2+)](i) via TRPC3/6 channels in human T-cells. Biochim Biophys Acta. 2012 Apr;1821(4):618–26.  132  83.  Mori Y, Wakamori M, Miyakawa T, Hermosura M, Hara Y, Nishida M, et al. Transient receptor potential 1 regulates capacitative Ca(2+) entry and Ca(2+) release from endoplasmic reticulum in B lymphocytes. J Exp Med. 2002 Mar 18;195(6):673–81.  84.  Lievremont J-P, Numaga T, Vazquez G, Lemonnier L, Hara Y, Mori E, et al. The role of canonical transient receptor potential 7 in B-cell receptor-activated channels. J Biol Chem. 2005 Oct 21;280(42):35346–51.  85.  Numaga T, Nishida M, Kiyonaka S, Kato K, Katano M, Mori E, et al. Ca2+ influx and protein scaffolding via TRPC3 sustain PKCbeta and ERK activation in B cells. J Cell Sci. 2010 Mar 15;123(Pt 6):927–38.  86.  Nguyen T, Staines D, Nilius B, Smith P, Marshall-Gradisnik S. Novel identification and characterisation of Transient receptor potential melastatin 3 ion channels on Natural Killer cells and B lymphocytes: effects on cell signalling in Chronic fatigue syndrome/Myalgic encephalomyelitis patients. Biol Res [Internet]. 2016 Dec [cited 2018 Jan 20];49(1). Available from: http://biolres.biomedcentral.com/articles/10.1186/s40659-016-0087-2 87.  Akimzhanov AM, Boehning D. IP3R function in cells of the immune system. Wiley Interdiscip Rev Membr Transp Signal. 2012 May;1(3):329–39.  88.  Tanimura A. Evidence that type I, II, and III inositol 1,4,5 trisphosphate receptors can occur as integral plasma membrane proteins. J Biol Chem [Internet]. 2000 Jun 28 [cited 2018 Jan 12]; Available from: http://www.jbc.org/cgi/doi/10.1074/jbc.M004495200 89.  Khan A, Steiner J, Klein M, Schneider M, Snyder S. IP3 receptor: localization to plasma membrane of T cells and cocapping with the T cell receptor. Science. 1992 Aug 7;257(5071):815–8.  133  90.  Taylor CW, Dellis O. Plasma membrane IP3 receptors. Biochem Soc Trans. 2006 Nov;34(Pt 5):910–2.  91.  Dellis O, Dedos SG, Tovey SC, Taufiq-Ur-Rahman  null, Dubel SJ, Taylor CW. Ca2+ entry through plasma membrane IP3 receptors. Science. 2006 Jul 14;313(5784):229–33.  92.  Gill DL, Spassova MA, Soboloff J. Signal transduction. Calcium entry signals--trickles and torrents. Science. 2006 Jul 14;313(5784):183–4.  93.  Lanner JT, Georgiou DK, Joshi AD, Hamilton SL. Ryanodine Receptors: Structure, Expression, Molecular Details, and Function in Calcium Release. Cold Spring Harb Perspect Biol. 2010 Nov 1;2(11):a003996–a003996.  94.  Vukcevic M, Broman M, Islander G, Bodelsson M, Ranklev-Twetman E, Müller CR, et al. Functional properties of RYR1 mutations identified in Swedish patients with malignant hyperthermia and central core disease. Anesth Analg. 2010 Jul;111(1):185–90.  95.  Hoppe K, Hack G, Lehmann–Horn F, Jurkat–Rott K, Wearing S, Zullo A, et al. Hypermetabolism in B–lymphocytes from malignant hyperthermia susceptible individuals. Sci Rep [Internet]. 2016 Dec [cited 2018 Jan 12];6(1). Available from: http://www.nature.com/articles/srep33372 96.  Ritter M, Menon S, Zhao L, Xu S, Shelby J, Barry WH. Functional importance and caffeine sensitivity of ryanodine receptors in primary lymphocytes. Int Immunopharmacol. 2001 Feb;1(2):339–47.  97.  Galione A, Lee H, Busa W. Ca(2+)-induced Ca2+ release in sea urchin egg homogenates: modulation by cyclic ADP-ribose. Science. 1991 Sep 6;253(5024):1143–6.  134  98.  Guse AH, da Silva CP, Emmrich F, Ashamu GA, Potter BV, Mayr GW. Characterization of cyclic adenosine diphosphate-ribose-induced Ca2+ release in T lymphocyte cell lines. J Immunol Baltim Md 1950. 1995 Oct 1;155(7):3353–9.  99.  Osipchuk NC, Allen PD, Cruz-Orengo L, Soulika A, Fomina A. Manipulation of Ryanodine Receptor Activity Modulates Autoimmune Responses in Mice. Biophys J. 2016 Feb;110(3):268a.  100.  Haag F, Menzel S, Javed S, Rissiek A, Adriouch S, Tolosa E, et al. The Multiple Roles of ATP-Gated P2(X) Ion Channels in T Lymphocytes. Messenger. 2015 Jun 1;4(1):67–81.  101.  Cekic C, Linden J. Purinergic regulation of the immune system. Nat Rev Immunol. 2016 Feb 29;16(3):177–92.  102.  Lépine S, Le Stunff H, Lakatos B, Sulpice JC, Giraud F. ATP-induced apoptosis of thymocytes is mediated by activation of P2 X 7 receptor and involves de novo ceramide synthesis and mitochondria. Biochim Biophys Acta. 2006 Jan;1761(1):73–82.  103.  Seman M, Adriouch S, Scheuplein F, Krebs C, Freese D, Glowacki G, et al. NAD-induced T cell death: ADP-ribosylation of cell surface proteins by ART2 activates the cytolytic P2X7 purinoceptor. Immunity. 2003 Oct;19(4):571–82.  104.  Schenk U, Westendorf AM, Radaelli E, Casati A, Ferro M, Fumagalli M, et al. Purinergic control of T cell activation by ATP released through pannexin-1 hemichannels. Sci Signal. 2008 Sep 30;1(39):ra6.  105.  Yip L, Woehrle T, Corriden R, Hirsh M, Chen Y, Inoue Y, et al. Autocrine regulation of T-cell activation by ATP release and P2X7 receptors. FASEB J Off Publ Fed Am Soc Exp Biol. 2009 Jun;23(6):1685–93.  135  106.  Wang CM, Ploia C, Anselmi F, Sarukhan A, Viola A. Adenosine triphosphate acts as a paracrine signaling molecule to reduce the motility of T cells. EMBO J [Internet]. 2014 May 19 [cited 2018 Jan 13]; Available from: http://emboj.embopress.org/cgi/doi/10.15252/embj.201386666 107.  Garbers C, Jänner N, Chalaris A, Moss ML, Floss DM, Meyer D, et al. Species specificity of ADAM10 and ADAM17 proteins in interleukin-6 (IL-6) trans-signaling and novel role of ADAM10 in inducible IL-6 receptor shedding. J Biol Chem. 2011 Apr 29;286(17):14804–11.  108.  Gu B, Bendall LJ, Wiley JS. Adenosine triphosphate-induced shedding of CD23 and L-selectin (CD62L) from lymphocytes is mediated by the same receptor but different metalloproteases. Blood. 1998 Aug 1;92(3):946–51.  109.  Moon H, Na H-Y, Chong KH, Kim TJ. P2X7 receptor-dependent ATP-induced shedding of CD27 in mouse lymphocytes. Immunol Lett. 2006 Jan 15;102(1):98–105.  110.  Ronald Sluyter, Wiley JS. P2X7 receptor activation induces CD62L shedding from human CD4+ and CD8+ T cells. Inflamm Cell Signal [Internet]. 2014 Mar 15 [cited 2018 Jan 13]; Available from: http://www.smartscitech.com/index.php/ICS/article/view/92 111.  Schenk U, Frascoli M, Proietti M, Geffers R, Traggiai E, Buer J, et al. ATP Inhibits the Generation and Function of Regulatory T Cells Through the Activation of Purinergic P2X Receptors. Sci Signal. 2011 Mar 1;4(162):ra12–ra12.  112.  Woehrle T, Yip L, Elkhal A, Sumi Y, Chen Y, Yao Y, et al. Pannexin-1 hemichannel-mediated ATP release together with P2X1 and P2X4 receptors regulate T-cell activation at the immune synapse. Blood. 2010 Nov 4;116(18):3475–84.  136  113.  Abramowski P, Ogrodowczyk C, Martin R, Pongs O. A Truncation Variant of the Cation Channel P2RX5 Is Upregulated during T Cell Activation. Unutmaz D, editor. PLoS ONE. 2014 Sep 2;9(9):e104692.  114.  Zhu S, Stein RA, Yoshioka C, Lee C-H, Goehring A, Mchaourab HS, et al. Mechanism of NMDA Receptor Inhibition and Activation. Cell. 2016 Apr;165(3):704–14.  115.  Zainullina LF, Yamidanov RS, Vakhitov VA, Vakhitova YV. NMDA receptors as a possible component of store-operated Ca2+ entry in human T-lymphocytes. Biochem Biokhimiia. 2011 Nov;76(11):1220–6.  116.  Affaticati P, Mignen O, Jambou F, Potier M-C, Klingel-Schmitt I, Degrouard J, et al. Sustained calcium signalling and caspase-3 activation involve NMDA receptors in thymocytes in contact with dendritic cells. Cell Death Differ. 2011 Jan;18(1):99–108.  117.  Kahlfuß S, Simma N, Mankiewicz J, Bose T, Lowinus T, Klein-Hessling S, et al. Immunosuppression by N-methyl-D-aspartate receptor antagonists is mediated through inhibition of Kv1.3 and KCa3.1 channels in T cells. Mol Cell Biol. 2014 Mar;34(5):820–31.  118.  Catterall WA. Voltage-Gated Calcium Channels. Cold Spring Harb Perspect Biol. 2011 Aug 1;3(8):a003947–a003947.  119.  Tyson JR, Snutch TP. Molecular nature of voltage-gated calcium channels: structure and species comparison: Molecular nature of voltage-gated calcium channels. Wiley Interdiscip Rev Membr Transp Signal. 2013 Sep;2(5):181–206.  120.  Kotturi M, Jefferies W. Molecular characterization of L-type calcium channel splice variants expressed in human T lymphocytes. Mol Immunol. 2005 Aug;42(12):1461–74.  137  121.  Badou A, Jha MK, Matza D, Mehal WZ, Freichel M, Flockerzi V, et al. Critical role for the beta regulatory subunits of Cav channels in T lymphocyte function. Proc Natl Acad Sci U S A. 2006 Oct 17;103(42):15529–34.  122.  Jha MK, Badou A, Meissner M, McRory JE, Freichel M, Flockerzi V, et al. Defective survival of naive CD8+ T lymphocytes in the absence of the beta3 regulatory subunit of voltage-gated calcium channels. Nat Immunol. 2009 Dec;10(12):1275–82.  123.  Strom TM, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber BH, et al. An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness. Nat Genet. 1998 Jul;19(3):260–3.  124.  Matza D, Badou A, Klemic KG, Stein J, Govindarajulu U, Nadler MJ, et al. T Cell Receptor Mediated Calcium Entry Requires Alternatively Spliced Cav1.1 Channels. Dryer SE, editor. PLOS ONE. 2016 Jan 27;11(1):e0147379.  125.  Tan GMY, Yu D, Wang J, Soong TW. Alternative Splicing at C Terminus of Ca V 1.4 Calcium Channel Modulates Calcium-dependent Inactivation, Activation Potential, and Current Density. J Biol Chem. 2012 Jan 6;287(2):832–47.  126.  Kotturi MF, Carlow DA, Lee JC, Ziltener HJ, Jefferies WA. Identification and Functional Characterization of Voltage-dependent Calcium Channels in T Lymphocytes. J Biol Chem. 2003 Nov 21;278(47):46949–60.  127.  Omilusik K, Priatel JJ, Chen X, Wang YT, Xu H, Choi KB, et al. The CaV1.4 Calcium Channel Is a Critical Regulator of T Cell Receptor Signaling and Naive T Cell Homeostasis. Immunity. 2011 Sep;35(3):349–60.  128.  Davenport B, Li Y, Heizer JW, Schmitz C, Perraud A-L. Signature Channels of Excitability no More: L-Type Channels in Immune Cells. Front Immunol [Internet]. 2015 Jul 23 138  [cited 2018 Jan 20];6. Available from: http://journal.frontiersin.org/Article/10.3389/fimmu.2015.00375/abstract 129.  Matza D, Badou A, Kobayashi KS, Goldsmith-Pestana K, Masuda Y, Komuro A, et al. A scaffold protein, AHNAK1, is required for calcium signaling during T cell activation. Immunity. 2008 Jan;28(1):64–74.  130.  Matza D, Badou A, Jha MK, Willinger T, Antov A, Sanjabi S, et al. Requirement for AHNAK1-mediated calcium signaling during T lymphocyte cytolysis. Proc Natl Acad Sci U S A. 2009 Jun 16;106(24):9785–90.  131.  Robert V, Triffaux E, Paulet P-E, Guéry J-C, Pelletier L, Savignac M. Protein kinase C-dependent activation of CaV1.2 channels selectively controls human TH2-lymphocyte functions. J Allergy Clin Immunol. 2014 Apr;133(4):1175–83.  132.  Rosa N, Triffaux E, Robert V, Mars M, Klein M, Bouchaud G, et al. The β and α2δ auxiliary subunits of voltage-gated calcium channel 1 (Cav1) are required for TH2 lymphocyte function and acute allergic airway inflammation. J Allergy Clin Immunol. 2017 Nov 10;  133.  Wang Y, Deng X, Mancarella S, Hendron E, Eguchi S, Soboloff J, et al. The Calcium Store Sensor, STIM1, Reciprocally Controls Orai and CaV1.2 Channels. Science. 2010 Oct 1;330(6000):105–9.  134.  Park CY, Shcheglovitov A, Dolmetsch R. The CRAC channel activator STIM1 binds and inhibits L-type voltage-gated calcium channels. Science. 2010 Oct 1;330(6000):101–5.  135.  Wang H, Zhang X, Xue L, Xing J, Jouvin M-H, Putney JW, et al. Low-Voltage-Activated Ca V 3.1 Calcium Channels Shape T Helper Cell Cytokine Profiles. Immunity. 2016 Apr;44(4):782–94.  139  136.  Kim D, Zeng MY, Núñez G. The interplay between host immune cells and gut microbiota in chronic inflammatory diseases. Exp Mol Med. 2017 May 26;49(5):e339.  137.  Lee YK, Menezes JS, Umesaki Y, Mazmanian SK. Proinflammatory T-cell responses to gut microbiota promote experimental autoimmune encephalomyelitis. Proc Natl Acad Sci. 2011 Mar 15;108(Supplement_1):4615–22.  138.  Rogala AR, Schoenborn AA, Fee BE, Cantillana VA, Joyce MJ, Gharaibeh RZ, et al. Environmental factors regulate Paneth cell phenotype and host susceptibility to intestinal inflammation in Irgm1-deficient mice. Dis Model Mech. 2018 Feb 1;11(2):dmm031070.  139.  Brodin P, Jojic V, Gao T, Bhattacharya S, Angel CJL, Furman D, et al. Variation in the Human Immune System Is Largely Driven by Non-Heritable Influences. Cell. 2015 Jan;160(1–2):37–47.  140.  Cannons JL, Schwartzberg PL. SAP and Lessons Learned from a Primary Immunodeficiency. J Immunol. 2017 Sep 1;199(5):1531–3.  141.  Ghosh S, Bienemann K, Boztug K, Borkhardt A. Interleukin-2-Inducible T-Cell Kinase (ITK) Deficiency - Clinical and Molecular Aspects. J Clin Immunol. 2014 Nov;34(8):892–9.  142.  Beura LK, Hamilton SE, Bi K, Schenkel JM, Odumade OA, Casey KA, et al. Normalizing the environment recapitulates adult human immune traits in laboratory mice. Nature. 2016 Apr 20;532(7600):512–6.  143.  Harper AR, Nayee S, Topol EJ. Protective alleles and modifier variants in human health and disease. Nat Rev Genet. 2015 Dec;16(12):689–701.  144.  Riordan JD, Nadeau JH. From Peas to Disease: Modifier Genes, Network Resilience, and the Genetics of Health. Am J Hum Genet. 2017 Aug;101(2):177–91.  140  145.  Veis DJ, Sorenson CM, Shutter JR, Korsmeyer SJ. Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell. 1993 Oct 22;75(2):229–40.  146.  Ni H-M, Chen X, Chen L, DiFrancesca D, Harada H, Yin X-M. The impact of genetic background and Bid on the phenotype of Bcl-2-deficiency in mice. Apoptosis. 2008 Jan;13(1):53–62.  147.  Huang H, Kuenze G, Smith JA, Taylor KC, Duran AM, Hadziselimovic A, et al. Mechanisms of KCNQ1 channel dysfunction in long QT syndrome involving voltage sensor domain mutations. Sci Adv. 2018 Mar;4(3):eaar2631.  148.  Crotti L, Monti MC, Insolia R, Peljto A, Goosen A, Brink PA, et al. NOS1AP Is a Genetic Modifier of the Long-QT Syndrome. Circulation. 2009 Oct 27;120(17):1657–63.  149.  Fischer A. Human primary immunodeficiency diseases. Immunity. 2007 Dec;27(6):835–45.  150.  Picard C, Al-Herz W, Bousfiha A, Casanova J-L, Chatila T, Conley ME, et al. Primary Immunodeficiency Diseases: an Update on the Classification from the International Union of Immunological Societies Expert Committee for Primary Immunodeficiency 2015. J Clin Immunol. 2015 Nov;35(8):696–726.  151.  Au-Yeung BB, Shah NH, Shen L, Weiss A. ZAP-70 in Signaling, Biology, and Disease. Annu Rev Immunol. 2018 Apr 26;36(1):127–56.  152.  Zhang K, Wakefield E, Marsh R. Lymphoproliferative Disease, X-Linked. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJ, Stephens K, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993 [cited 2018 Jan 3]. Available from: http://www.ncbi.nlm.nih.gov/books/NBK1406/ 141  153.  Homepage. National Library of Medicine (US). Genetics Home Reference [Internet]. Bethesda (MD): The Library; [Internet]. 2018 [cited 2018 Jan 3]. Available from: https://ghr.nlm.nih.gov/condition/x-linked-lymphoproliferative-disease 154.  Smith-Garvin JE, Koretzky GA, Jordan MS. T Cell Activation. Annu Rev Immunol. 2009 Apr;27(1):591–619.  155.  Badou A, Jha MK, Matza D, Flavell RA. Emerging Roles of L-Type Voltage-Gated and Other Calcium Channels in T Lymphocytes. Front Immunol [Internet]. 2013 [cited 2017 Dec 30];4. Available from: http://journal.frontiersin.org/article/10.3389/fimmu.2013.00243/abstract 156.  Mansergh F, Orton NC, Vessey JP, Lalonde MR, Stell WK, Tremblay F, et al. Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina. Hum Mol Genet. 2005 Oct 15;14(20):3035–46.  157.  Boycott KM, Maybaum TA, Naylor MJ, Weleber RG, Robitaille J, Miyake Y, et al. A summary of 20 CACNA1F mutations identified in 36 families with incomplete X-linked congenital stationary night blindness, and characterization of splice variants. Hum Genet. 2001 Feb;108(2):91–7.  158.  Golubovskaya V, Wu L. Different Subsets of T Cells, Memory, Effector Functions, and CAR-T Immunotherapy. Cancers. 2016 Mar 15;8(12):36.  159.  Lang KS, Recher M, Navarini AA, Harris NL, Löhning M, Junt T, et al. Inverse correlation between IL-7 receptor expression and CD8 T cell exhaustion during persistent antigen stimulation. Eur J Immunol. 2005 Mar;35(3):738–45.  160.  Crotty S. A brief history of T cell help to B cells. Nat Rev Immunol. 2015 Mar;15(3):185–9.  142  161.  Chen RWS, Greenberg JP, Lazow MA, Ramachandran R, Lima LH, Hwang JC, et al. Autofluorescence Imaging and Spectral-Domain Optical Coherence Tomography in Incomplete Congenital Stationary Night Blindness and Comparison With Retinitis Pigmentosa. Am J Ophthalmol. 2012 Jan;153(1):143-154.e2.  162.  Lu W, Mehraj V, Vyboh K, Cao W, Li T, Routy J-P. CD4:CD8 ratio as a frontier marker for clinical outcome, immune dysfunction and viral reservoir size in virologically suppressed HIV-positive patients. J Int AIDS Soc [Internet]. 2015 Jun 29 [cited 2018 Mar 13];18(1). Available from: http://doi.wiley.com/10.7448/IAS.18.1.20052 163.  Sainz T, Serrano-Villar S, Díaz L, González Tomé MI, Gurbindo MD, de José MI, et al. The CD4/CD8 ratio as a marker T-cell activation, senescence and activation/exhaustion in treated HIV-infected children and young adults. AIDS Lond Engl. 2013 Jun 1;27(9):1513–6.  164.  Foldi J, Kozhaya L, McCarty B, Mwamzuka M, Marshed F, Ilmet T, et al. HIV-Infected Children Have Elevated Levels of PD-1+ Memory CD4 T Cells With Low Proliferative Capacity and High Inflammatory Cytokine Effector Functions. J Infect Dis. 2017 Sep 15;216(6):641–50.  165.  Zabielska MA, Borkowski T, Slominska EM, Smolenski RT. Inhibition of AMP deaminase as therapeutic target in cardiovascular pathology. Pharmacol Rep. 2015 Aug;67(4):682–8.  166.  Men CJ, Bujakowska KM, Comander J, Place E, Bedoukian EC, Zhu X, et al. The importance of genetic testing as demonstrated by two cases of CACNA1F-associated retinal generation misdiagnosed as LCA. Mol Vis. 2017;23:695–706.  167.  Parry DA, Holmes TD, Gamper N, El-Sayed W, Hettiarachchi NT, Ahmed M, et al. A homozygous STIM1 mutation impairs store-operated calcium entry and natural killer cell 143  effector function without clinical immunodeficiency. J Allergy Clin Immunol. 2016 Mar;137(3):955-957.e8.  168.  Morgano A, Pierri I, Stagnaro R, Setti M, Puppo F, Indiveri F. Decreased lymphocyte blastogenesis, IL2 production and NK activity following nifedipine administration to healthy humans. Eur J Clin Pharmacol. 1990 Dec 1;39(6):545–50.  169.  Sengstake S, Boneberg E-M, Illges H. CD21 and CD62L shedding are both inducible via P2X7Rs. Int Immunol. 2006 Jul;18(7):1171–8.  170.  Amoras ALB, Da Silva MTN, Zollner RL, Kanegane H, Miyawaki T, Vilela MMS. Expression of Fcγ and complement receptors in monocytes of X-linked agammaglobulinaemia and common variable immunodeficiency patients: Fcγ, CR1 and CR3 monocytes receptors of XLA and CVI. Clin Exp Immunol. 2007 Sep 27;150(3):422–8.  171.  Stevens AM, Ou J-N. PD-L1 expression on monocytes marks active systemic lupus erythematosus in patients without nephritis. Pediatr Rheumatol. 2012;10(Suppl 1):A2.  172.  Padet L, Loubaki L, Bazin R. Induction of PD-L1 on monocytes: A new mechanism by which IVIg inhibits mixed lymphocyte reactions. Immunobiology. 2014 Sep;219(9):687–94.  173.  Dutton RW, Bradley LM, Swain SL. T CELL MEMORY. Annu Rev Immunol. 1998 Apr;16(1):201–23.  174.  Buchbinder EI, Desai A. CTLA-4 and PD-1 Pathways. Am J Clin Oncol. 2016 Feb;39(1):98–106.  175.  Olivadoti M, Toth LA, Weinberg J, Opp MR. Murine gammaherpesvirus 68: a model for the study of Epstein-Barr virus infections and related diseases. Comp Med. 2007 Feb;57(1):44–50.  144  176.  Crotty S. T Follicular Helper Cell Differentiation, Function, and Roles in Disease. Immunity. 2014 Oct;41(4):529–42.  177.  Crotty S. Follicular Helper CD4 T Cells (T FH ). Annu Rev Immunol. 2011 Apr 23;29(1):621–63.  178.  Collins CM, Speck SH. Expansion of Murine Gammaherpesvirus Latently Infected B Cells Requires T Follicular Help. PLOS Pathog. 2014 May 1;10(5):e1004106.  179.  Mahajan VS, Demissie E, Mattoo H, Viswanadham V, Varki A, Morris R, et al. Striking Immune Phenotypes in Gene-Targeted Mice Are Driven by a Copy-Number Variant Originating from a Commercially Available C57BL/6 Strain. Cell Rep. 2016 May;15(9):1901–9.  180.  Nishihara H, Kobayashi S, Hashimoto Y, Ohba F, Mochizuki N, Kurata T, et al. Non-adherent cell-specific expression of DOCK2, a member of the human CDM-family proteins. Biochim Biophys Acta. 1999 Nov 11;1452(2):179–87.  181.  Reif K, Cyster J. The CDM protein DOCK2 in lymphocyte migration. Trends Cell Biol. 2002 Aug;12(8):368–73.  182.  Fukui Y, Hashimoto O, Sanui T, Oono T, Koga H, Abe M, et al. Haematopoietic cell-specific CDM family protein DOCK2 is essential for lymphocyte migration. Nature. 2001 Aug 23;412(6849):826–31.  183.  Nombela-Arrieta C, Lacalle RA, Montoya MC, Kunisaki Y, Megı́as D, Marqués M, et al. Differential Requirements for DOCK2 and Phosphoinositide-3-Kinase γ during T and B Lymphocyte Homing. Immunity. 2004 Sep;21(3):429–41.  184.  Shulman Z, Pasvolsky R, Woolf E, Grabovsky V, Feigelson SW, Erez N, et al. DOCK2 regulates chemokine-triggered lateral lymphocyte motility but not transendothelial migration. Blood. 2006 Oct 1;108(7):2150–8.  145  185.  Sanui T, Inayoshi A, Noda M, Iwata E, Oike M, Sasazuki T, et al. DOCK2 is essential for antigen-induced translocation of TCR and lipid rafts, but not PKC-theta and LFA-1, in T cells. Immunity. 2003 Jul;19(1):119–29.  186.  Tybulewicz VLJ, Henderson RB. Rho family GTPases and their regulators in lymphocytes. Nat Rev Immunol. 2009 Sep;9(9):630–44.  187.  Le Floc’h A, Tanaka Y, Bantilan NS, Voisinne G, Altan-Bonnet G, Fukui Y, et al. Annular PIP3 accumulation controls actin architecture and modulates cytotoxicity at the immunological synapse. J Exp Med. 2013 Nov 18;210(12):2721–37.  188.  Dobbs K, Domínguez Conde C, Zhang S-Y, Parolini S, Audry M, Chou J, et al. Inherited DOCK2 Deficiency in Patients with Early-Onset Invasive Infections [Internet]. http://dx.doi.org/10.1056/NEJMoa1413462. 2015 [cited 2018 Mar 21]. Available from: http://www.nejm.org/doi/10.1056/NEJMoa1413462 189.  Rowland SL, Leahy KF, Halverson R, Torres RM, Pelanda R. BAFF Receptor Signaling Aids the Differentiation of Immature B Cells into Transitional B Cells following Tonic BCR Signaling. J Immunol. 2010 Oct 15;185(8):4570–81.  190.  Stavnezer J, Schrader CE. IgH Chain Class Switch Recombination: Mechanism and Regulation. J Immunol. 2014 Dec 1;193(11):5370–8.  191.  Antony P, Petro JB, Carlesso G, Shinners NP, Lowe J, Khan WN. B cell receptor directs the activation of NFAT and NF-kappaB via distinct molecular mechanisms. Exp Cell Res. 2003 Nov 15;291(1):11–24.  192.  Purtha WE, Swiecki M, Colonna M, Diamond MS, Bhattacharya D. Spontaneous mutation of the Dock2 gene in Irf5-/- mice complicates interpretation of type I interferon production and antibody responses. Proc Natl Acad Sci. 2012 Apr 10;109(15):E898–904.  146  193.  Ushijima M, Uruno T, Nishikimi A, Sanematsu F, Kamikaseda Y, Kunimura K, et al. The Rac Activator DOCK2 Mediates Plasma Cell Differentiation and IgG Antibody Production. Front Immunol [Internet]. 2018 Feb 16 [cited 2018 Mar 22];9. Available from: http://journal.frontiersin.org/article/10.3389/fimmu.2018.00243/full 194.  Wang J, Xu L, Shaheen S, Liu S, Zheng W, Sun X, et al. Growth of B Cell Receptor Microclusters Is Regulated by PIP 2 and PIP 3 Equilibrium and Dock2 Recruitment and Activation. Cell Rep. 2017 Nov;21(9):2541–57.  195.  Yasuda K, Nündel K, Watkins AA, Dhawan T, Bonegio RG, Ubellacker JM, et al. Phenotype and function of B cells and dendritic cells from interferon regulatory factor 5-deficient mice with and without a mutation in DOCK2. Int Immunol. 2013 May;25(5):295–306.  196.  Cariappa A, Takematsu H, Liu H, Diaz S, Haider K, Boboila C, et al. B cell antigen receptor signal strength and peripheral B cell development are regulated by a 9-O-acetyl sialic acid esterase. J Exp Med. 2009 Jan 16;206(1):125–38.  197.  Walmsley MJ, Ooi SKT, Reynolds LF, Smith SH, Ruf S, Mathiot A, et al. Critical roles for Rac1 and Rac2 GTPases in B cell development and signaling. Science. 2003 Oct 17;302(5644):459–62.  198.  Sellers RS. Translating Mouse Models: Immune Variation and Efficacy Testing. Toxicol Pathol. 2017 Jan;45(1):134–45.  199.  Mak IW, Evaniew N, Ghert M. Lost in translation: animal models and clinical trials in cancer treatment. Am J Transl Res. 2014;6(2):114–8.  200.  Prinz F, Schlange T, Asadullah K. Believe it or not: how much can we rely on published data on potential drug targets? Nat Rev Drug Discov. 2011 Sep;10(9):712–712.  147  201.  Zwiers A, Fuss IJ, Seegers D, Konijn T, Garcia-Vallejo JJ, Samsom JN, et al. A polymorphism in the coding region of Il12b promotes IL-12p70 and IL-23 heterodimer formation. J Immunol Baltim Md 1950. 2011 Mar 15;186(6):3572–80.  202.  Heinzel FP. Reciprocal expression of interferon gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for expansion of distinct helper T cell subsets. J Exp Med. 1989 Jan 1;169(1):59–72.  203.  Mills CD, Kincaid K, Alt JM, Heilman MJ, Hill AM. M-1/M-2 macrophages and the Th1/Th2 paradigm. J Immunol Baltim Md 1950. 2000 Jun 15;164(12):6166–73.  204.  Chassin C, Picardeau M, Goujon J-M, Bourhy P, Quellard N, Darche S, et al. TLR4- and TLR2-Mediated B Cell Responses Control the Clearance of the Bacterial Pathogen, Leptospira interrogans. J Immunol. 2009 Aug 15;183(4):2669–77.  205.  Viriyakosol S, Matthias MA, Swancutt MA, Kirkland TN, Vinetz JM. Toll-Like Receptor 4 Protects against Lethal Leptospira interrogans Serovar Icterohaemorrhagiae Infection and Contributes to In Vivo Control of Leptospiral Burden. Infect Immun. 2006 Feb 1;74(2):887–95.  206.  Mostafavi S, Ortiz-Lopez A, Bogue MA, Hattori K, Pop C, Koller D, et al. Variation and Genetic Control of Gene Expression in Primary Immunocytes across Inbred Mouse Strains. J Immunol. 2014 Nov 1;193(9):4485–96.  207.  Simon MM, Greenaway S, White JK, Fuchs H, Gailus-Durner V, Wells S, et al. A comparative phenotypic and genomic analysis of C57BL/6J and C57BL/6N mouse strains. Genome Biol. 2013;14(7):R82.  208.  Freeman H, Shimomura K, Horner E, Cox RD, Ashcroft FM. Nicotinamide nucleotide transhydrogenase: a key role in insulin secretion. Cell Metab. 2006 Jan;3(1):35–45.  148  209.  Zurita E, Chagoyen M, Cantero M, Alonso R, González-Neira A, López-Jiménez A, et al. Genetic polymorphisms among C57BL/6 mouse inbred strains. Transgenic Res. 2011 Jun;20(3):481–9.    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0371139/manifest

Comment

Related Items