UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Phosphorylation of MYB75 transcription factor by MAP kinases in Arabidopsis thaliana Kreynes, Anna Evgenya 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2018_september_kreynes_anna.pdf [ 4.86MB ]
Metadata
JSON: 24-1.0369253.json
JSON-LD: 24-1.0369253-ld.json
RDF/XML (Pretty): 24-1.0369253-rdf.xml
RDF/JSON: 24-1.0369253-rdf.json
Turtle: 24-1.0369253-turtle.txt
N-Triples: 24-1.0369253-rdf-ntriples.txt
Original Record: 24-1.0369253-source.json
Full Text
24-1.0369253-fulltext.txt
Citation
24-1.0369253.ris

Full Text

PHOSPHORYLATION OF MYB75 TRANSCRIPTION FACTOR BY MAP KINASES IN ARABIDOPSIS THALIANA by ANNA EVGENYA KREYNES B.Sc., The University of Toronto, 2006. M.Sc., The University of British Columbia, 2008.  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2018  © Anna Evgenya Kreynes, 2018. ii   The following individuals certify that they have read and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: “Phosphorylation of MYB75 transcription factor by MAP kinases in Arabidopsis thaliana.”  Submitted by Anna E. Kreynes, in partial fulfilment of the requirements for the degree of Doctor of Philosophy, in Botany. Examining committee:  Dr. Brian Ellis, Land and Food Sciences, University of British Columbia     Supervisor  Dr. Juergen Ehlting, Biology, University of Victoria        Supervisory committee member  Dr. Christine Scaman, Land and Food Sciences, University of British Columbia    University Examiner  Dr. David Kitts, Land and Food Sciences, University of British Columbia     University Examiner   Additional supervisory committee members: Dr. Leonard Foster, Proteomics, University of British Columbia      Supervisor  Dr. Shawn Mansfield, Forestry, University of British Columbia      Supervisory committee member        iii  ABSTRACT The Arabidopsis transcription factor MYB75 has been described in the literature as a positive transcriptional regulator of anthocyanin biosynthetic genes.  More recently, MYB75 was shown to also negatively regulate lignin and other secondary cell wall biosynthetic genes. MYB75 has two canonical MAP kinase phosphorylation sites, at threonines 126 and 131; we wanted to explore the possibility that MYB75 is regulated post translationally through phosphorylation by MPKs.  In our lab, Dr. Yonge found that MYB75 could be phosphorylated in vitro by MPK3, MPK4, MPK6 and MPK11, almost exclusively at threonine 131. Subsequently, I demonstrated that MYB75 interacts in vitro with a large number of Arabidopsis MAP kinases, suggesting that it could be a target for multiple MPKs. We decided to explore how phosphorylation affects MYB75 function, in terms of protein-protein interaction, protein turnover and localization, and describe the impact of this putative phosphorylation event on the ability of MYB75 to drive transcription of target genes. For this purpose we used point mutants, MYB75T131A and MYB75T131E to mimic permanently non-phosphorylated and phosphorylated versions of MYB75, respectively.   While protein localization and protein-protein interactions of MYB75 were not strongly impacted in the point mutants, several in vivo experiments indicated that MYB75T131E is more labile than either MYB75WT or MYB75T131A, suggesting that phosphorylation at T-131 negatively affects protein stability.  iv   Over-expressor lines, 35Spr:3xHA:MYB75 gene, as well as inducible DEXpr:3xHA:MYB75 gene lines were used, to analyze MYB75 protein dynamics in vivo  and to assess the ability of each phosphovariant to drive anthocyanin production. Arabidopsis plants over-expressing MYB75WT, MYB75T131A or MYB75T131E displayed increased anthocyanin production, compared to Col-0 WT, suggesting that phosphorylation status at T-131 does not affect this aspect of MYB75 function. However, HPLC analysis revealed quantitative differences between the biochemical species of anthocyanins and flavonols that accumulate in different phosphovariant over-expressing plants.  Transcriptome analysis revealed that MYB75T131E is a more potent regulator of gene expression. This finding, along with distinct developmental differences between MYB75 phosphovariants, suggest that phosphorylation at T-131 could affect the ability of MYB75 to drive the expression of a broader spectrum of genes than previously described in the literature.         v  LAY SUMMARY  My research project is part of a larger body of work, aimed at understanding how plants sense their environment, respond to stress and ultimately adapt to unfavourable conditions. My project is focused in particular on a gene that controls production of anthocyanins and flavonoids, which are antioxidant compounds that help plants cope with different stresses and are of interest to humans as medicinal and nutritional supplements. My findings suggest that certain environmental signals can alter the types of flavonoids and anthocyanins that the plants produce, through regulation of my gene of interest (MYB75). Additionally, I found that this gene has additional roles in development, which should be explored further. My findings can help us understand how plants change their biochemical composition in response to specific environmental stimuli. This knowledge can be used for growing medicinal plants as well as antioxidant rich crops, where the desired biochemical output is achieved through manipulation of environmental factors rather than genetic engineering.          vi  PREFACE This dissertation is based on original experimental work performed primarily in the laboratory of Dr. Brian Ellis, in the Michael Smith Laboratories. The text in this dissertation is original work, not taken from previous publications or collaborative written products. Experiments described in Ch2 which were performed by other lab members, include in vitro phosphorylation assay, described in section 2.3. These experiments were initially designed and performed by a post-doctoral fellow, Dr. Zhenhua Yonge, and were repeated by another post doctoral fellow, Dr. Xiao Min Liu. Dr. Liu also performed the intracellular localization experiments described in section 2.4.1 of Ch2.  Dr. Zhenhua Yonge performed site-directed mutagenesis on MYB75 cDNA, to generate the phosphovariants MYB75T126A, MYB75T131A, MYB75T126/131A, MYB75T126E, MYB75T131E, MYB75T126/131E. Dr. Yonge then cloned these cDNA versions of MYB75 into a binary vector behind an endogenous MYB75 promoter to generate MYB75pr:MYB75 cDNA constructs which she transformed into Arabidopsis plants, that I subsequently analysed for anthocyanin production in Ch 3. I performed the yeast two-hybrid experiments described in Ch2 (sections 2.2 and 2.4.2) and was responsible for cloning all the constructs required for these experiments, with the exception of MPK3-DBD, MPK4-DBD, and MPK6-DBD, which were cloned by Dr. Liu.  I conducted site-directed mutagenesis on the full gene version of MYB75, to create MYB75T131A and MYB75T131E, which I subsequently cloned into binary vectors generating 35Spr:3xHA:MYB75 gene and DEXpr:3xHA:MYB75 gene constructs. I transformed these constructs into Arabidopsis plants, to obtain transgenic lines. I performed all experiments vii  pertaining to MYB75 turnover in vivo, anthocyanin quantification and analysis of developmental phenotypes.  I processed tissue samples from 35Spr:3xHA:MYB75 Arabidopsis plants which I submitted for HPLC analysis, conducted by Dr. Lina Midilao. Anthocyanin and flavonol profiles obtained from HPLC analysis were processed and quantified by Dr. Simone Castellarin. I also processed tissue samples from 35Spr:3xHA:MYB75 Arabidopsis plants to submit to the Brain Research Centre at UBC, for transcriptome analysis by next generation sequencing. The raw data was processed by Dr. Darren Wong, from the Castellarin lab. I subsequently conducted detailed analysis and classification of the genes up- and down-regulated in each phosphovariant over-expressor line.             viii  TABLE OF CONTENTS   ABSTRACT ......................................................................................................................................... iii LAY SUMMARY .................................................................................................................................. v PREFACE ........................................................................................................................................... vi TABLE OF CONTENTS ....................................................................................................................... viii LIST OF TABLES ................................................................................................................................ xii LIST OF FIGURES .............................................................................................................................. xiii LIST OF SUPPLEMENTARY MATERIALS .............................................................................................. xv LIST OF ABBREVIATIONS .................................................................................................................. xvi ACKNOWLEDGEMENTS ................................................................................................................. xxiv CHAPTER1 General Introduction .........................................................................................................1 1.1 Phenylpropanoid metabolism ............................................................................................................. 1 1.2 Transcriptional regulation of flavonoid and anthocyanin biosynthesis .............................................. 4 1.3 MYB75 transcription-regulatory complexes required to drive flavonoid and anthocyanin biosynthesis .............................................................................................................................................. 7 1.4 Role of MYB75 in cell wall biosynthesis and lignin deposition ........................................................... 7 1.5 MYB75 protein-protein interactions; additional layers of regulation .............................................. 11 1.6 Plant hormones and flavonoid biosynthesis ..................................................................................... 14 1.7 MAP kinase signalling in plants ......................................................................................................... 15 1.8 MYB transcription factor phosphorylation by MAP kinases ............................................................. 18 1.9 Role of MAP kinases in ROS and light signalling ............................................................................... 20 1.10 Light and plant development .......................................................................................................... 22 1.11 Plant photoreceptors ...................................................................................................................... 23 1.12 Plastid-derived signals .................................................................................................................... 25 1.13 Global regulators of light-driven gene expression .......................................................................... 26 1.14 Possible role of MYB75 in light signalling ....................................................................................... 28 1.15 Research Objectives ........................................................................................................................ 29 CHAPTER 2  MYB75 interaction with Arabidopsis MAP kinases, in vitro phosphorylation, and differences in protein function among MYB75 phosphovariants ........................................................ 30 2.1 Introduction ...................................................................................................................................... 30 ix  2.2 MYB75 interaction with Arabidopsis MAP kinases in yeast .............................................................. 30 2.3 In vitro phosphorylation of MYB75 by MPK3, MPK4, MPK6 and MPK11 ......................................... 34 2.4 Impact of MYB75 phosphorylation on protein function ................................................................... 37 2.4.1 Impact of phosphorylation status on MYB75 localization ......................................................... 40 2.4.2 Impact of MYB75 phosphorylation on protein-protein interactions with known binding partners ............................................................................................................................................... 43 2.4.3 Impact of MYB75 phosphorylation on protein turnover in Arabidopsis seedlings .................... 48 2.5 Discussion .......................................................................................................................................... 55 2.6 Materials and Methods ..................................................................................................................... 64 2.6.1 Yeast two-hybrid screen ............................................................................................................ 64 2.6.2 In vitro phosphorylation of MYB75 by MAP kinases .................................................................. 69 2.6.3 Intracellular localization of different phosphovariants of MYB75 protein: cloning of MYB75:GFP constructs and Agrobacterium-mediated infiltration of Nicotiana benthamiana epidermis (performed by Dr. Liu). ...................................................................................................... 70 2.6.4 Protein degradation assay ......................................................................................................... 71 CHAPTER 3  The impact of MYB75 protein phosphorylation status on production of anthocyanins and flavonoids in Arabidopsis plants ....................................................................................................... 74 3.1 Introduction ...................................................................................................................................... 74 3.2  Expression of different MYB75 phosphovariants from the MYB75 endogenous promoter............ 76 3.3 Impact of sucrose and light on MYB75 protein stability and anthocyanin production in Arabidopsis seedlings ................................................................................................................................................. 84 3.4 Anthocyanin production in mature Arabidopsis plants over-expressing different MYB75 phosphovariants ..................................................................................................................................... 94 3.4.1 Total anthocyanin quantification in mature Arabidopsis lines over-expressing MYB75 ........... 94 3.4.2 Flavonoid profiles of mature Arabidopsis plants over-expressing MYB75, as determined by high performance liquid chromatography ........................................................................................ 101 3.5 Discussion ........................................................................................................................................ 113 3.6 Materials and Methods ................................................................................................................... 127 3.6.1 Creation of transgenic Arabidopsis plant lines expressing different phosphovariant forms of MYB75 protein .................................................................................................................................. 127 3.6.2 Sucrose treatment of Arabidopsis seedlings ............................................................................ 132 3.6.3 Total anthocyanin quantification ............................................................................................. 133 3.6.4 Recombinant MYB75 protein extraction, immunodetection and relative quantification of protein levels using ImageJ ............................................................................................................... 134 x  3.6.5 RNA extraction, reverse-transcription PCR and qPCR ............................................................. 134 3.6.6 Biochemical profiling of flavonoids and anthocyanins in 35Spr:3xHA:MYB75 gene plants by high performance liquid chromatography ........................................................................................ 136 CHAPTER 4  Developmental changes in Arabidopsis plants over-expressing MYB75T131A and MYB75T131E phosphovariants ............................................................................................................................ 138 4.1 Introduction .................................................................................................................................... 138 4.2 Impaired germination rates in MYB75pr:MYB75 cDNA plants, expressing MYB75T131A and MYB75T131E phosphovariants ................................................................................................................. 150 4.3   Flowering time and senescence are delayed in Arabidopsis plants over-expressing MYB75T131E 152 4.4   Ectopic vessel development in stems of mature Arabidopsis plants over-expressing different MYB75 phosphovariants ....................................................................................................................... 157 4.5   Global gene expression analysis in Arabidopsis plants over-expressing different phosphovariants of MYB75 ............................................................................................................................................... 168 4.5.1 Flavonoid .................................................................................................................................. 174 4.5.2 Cell wall-related genes ............................................................................................................. 176 4.5.3 Development and Differentiation ............................................................................................ 178 4.5.4 Hormones ................................................................................................................................. 182 4.5.5 Stress Response and Signalling ................................................................................................ 183 4.5.6 Photosynthesis ......................................................................................................................... 185 4.6 Discussion ........................................................................................................................................ 186 4.6.1 Germination ............................................................................................................................. 187 4.6.2 Flowering time ......................................................................................................................... 189 4.6.3 Vascular development ............................................................................................................. 192 4.6.4 Global gene expression analysis of 35Spr:MYB75 lines ........................................................... 194 4.7  Materials and Methods .................................................................................................................. 196 4.7.1 Germination rate in MYB75pr:MYB75 cDNA lines ................................................................... 196 4.7.2 Plant growth conditions and flowering time ........................................................................... 197 4.7.3 Stem sections and histochemical staining ............................................................................... 198 4.7.4 Gene expression analysis: next generation sequencing .......................................................... 198 Chapter 5 General Discussion ......................................................................................................... 200 5.1 Introduction .................................................................................................................................... 200 5.2 MYB75 interaction with Arabidopsis MAP kinases and phosphorylation....................................... 201 5.3 Protein-protein interactions between MYB75 and known binding partners ................................. 207 xi  5.4 MYB75 protein turnover ................................................................................................................. 208 5.5 Impact of MYB75 phosphorylation on expression of downstream genes ...................................... 211 5.6 Conclusions ..................................................................................................................................... 213 References ..................................................................................................................................... 216 APPENDIX ...................................................................................................................................... 245                         xii   LIST OF TABLES Table 2.1 Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 and 20 Arabidopsis MAP kinases .............................................................................................. 65 Table 2.2  Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 phosphovariants and previously characterized interacting partners of MYB75 ............... 66 Table 3.1 Primers for site-directed mutagenesis, used to generate each phosphovariant version of the full length MYB75 gene .............................................................................................................. 128 Table 3.2 List of constructs used for stable transformation of Arabidopsis plants to create lines expressing various MYB75 phosphovariants under endogenous (MYB75pr), constitutive (35Spr) and inducible(DEXpr) promoters .......................................................................................................... 132 Table 3.3 Primer sequences used for semi-quantitative RT-PCR and qPCR…………. ..................... 136 Table 4.1 Germination score in homozygous MYB75pr:MYB75 cDNA plants ............................... 197              xiii  LIST OF FIGURES Fig 1.1 . Simplified diagrammatic representation of the phenylpropanoid biosynthesis pathway in Arabidopsis ................................................................................................................................................ 10 Fig 2.1 MYB75 interacts with several Arabidopsis MAP kinases in yeast ......................................... 33 Fig 2.2 In vitro phosphorylation of MYB75 by Arabidopsis MPK3, MPK4, MPK6 and MPK11 ....... 36 Fig 2.3 Nuclear localization of MYB75WT , MYB75T131A and MYB75T131E  in N. benthamiana epidermal cells .......................................................................................................................................... 42 Fig 2.4 Linear representation of MYB75 amino acid sequence depicting different domains ....... 45 Fig 2.5 Interaction between different phosphovariants of MYB75 and its known binding   partners, in yeast ...................................................................................................................................... 47 Fig 2.6 Degradation of MYB75WT and MYB75T131E in Arabidopsis seedlings… ................................. 52 Fig 2.7 Heterozygous Arabidopsis lines (T2) carrying DEXpr:3xHA:MYB75 constructs, 48 hours after application of DEX ........................................................................................................................... 54 Fig 2.8 Experimental design for MYB75-TCP3 competitive binding assay ....................................... 60 Fig 2.9 Replica plating procedure used in directed yeast two-hybrid screen .................................. 68 Fig 3.1 Complementation of anthocyanin biosynthesis in Arabidopsis myb75- null mutants, by different MYB75 phosphovariants, driven by the MYB75 endogenous promoter ......................... 79 Fig 3.2 Light and sucrose-driven changes in anthocyanin production, and levels of recombinant MYB75 protein, in 11-day-old Arabidopsis seedlings expressing MYB75WT, MYB75T131A and MYB75T131E from a constitutive 35S promoter ..................................................................................... 88 Fig 3.3 The impact of light and sucrose on stability of recombinant  MYB75WT, MYB75T131A and MYB75T131E, protein, in 14-day-old Arabidopsis seedlings ................................................................. 93 Fig 3.4 Visible anthocyanin accumulation in 35Spr:3xHA:MYB75 gene plants at different rosette stages correlates with expression of recombinant MYB75 protein in all   phosphovariants ................................ 96 Fig 3.5 Quantification of total anthocyanin levels and relative expression of anthocyanin biosynthetic genes in rosette leaves of mature, 5-week-old Arabidopsis plants expressing different phosphovariant forms of MYB75 from a constitutive 35S promoter (CAMV35S) ........ 100 Fig 3.6 Biochemical profiling and quantification of flavonoid compounds in adult 35Spr:MYB75 plants using high performance liquid chromatography (HPLC) ....................................................... 107 Fig 3.7 Anthocyanin modifying enzymes in Arabidopsis ................................................................... 111 Fig 3.8 Flavonol modifying enzymes in Arabidopsis .......................................................................... 112 xiv  Fig 3.9 Relative levels of MYB75 expression in Arabidopsis, throughout adult stages and during embryo development ............................................................................................................................ 114 Fig 3.10 MYB75 promoter- MYB75 cDNA cassette, used to transform Arabidopsis plants (myb75- Nossen) .................................................................................................................................................... 129 Fig 4.1 Simplified flavonoid biosynthetic pathway in Arabidopsis, depicting key flavonoid biosynthetic enzymes and corresponding tt mutants....................................................................... 144 Fig 4.2 Germination rates in MYB75pr:MYB75 cDNA lines in the myb75- Nossen background ............................ ………………………………………………………………………………………………………………………………..152 Fig 4.3 Developmental differences in bolting and flowering time of plants over-expressing different phosphovariants of MYB75 .................................................................................................. 156 Fig 4.4 Diagramatic representation of Arabidopsis stem cross-sections, at young and mature stages ................. ………………………………………………………………………………………………………………………………..159 Fig 4.5 Ectopic vessels development in stems of 8-week-old Arabidopsis plants overexpressing different phosphovariants of MYB75 .................................................................................................. 162 Fig 4.6 Ectopic vessel development in stems of 7-week-old Arabidopsis plants over-expressing different phosphovariants of MYB75 .................................................................................................. 166 Fig 4.7 Genes upregulated in mature rosette leaves of Arabidopsis plants over-expressing MYB75T131A and MYB75T131E, compared to Col-0 WT plants ............................................................ 171 Fig 4.8 Genes downregulated in mature rosette leaves of Arabidopsis plants over-expressing MYB75T131A and MYB75T131E, compared to Col-0 WT plants ............................................................ 173 Fig S2.1 Manipulation of Western Blot images used for quantification of recombinant MYB75 protein by Image J in Fig 2.6 ................................................................................................................. 245 Fig S2.2  Degradation of MYB75WT and MYB75T131E in Arabidopsis seedlings: additional                                                           results        . ................................................................................................................................. 246      xv  LIST OF SUPPLEMENTARY MATERIALS Table S4.1       Next Generation Sequencing data: gene expression analysis of Arabidopsis plants overexpressing MYB75T131A or MYB75T131E.                         xvi  LIST OF ABBREVIATIONS ABA   abscisic acid ABCB/PGP (1,19)  ATP-binding cassette B protein, auxin transport channel / P-glycoprotein ACS (4,5, 11)  1-aminocyclopropane-1-carboxylate synthase 4 AD   activation domain Ade   adenine Ala   alanine ANS/LDOX  anthocyanidin synthase/leucoanthocyanidin dioxygenase ARF   auxin response factor ARR (5,15)  Arabidopsis response regulator 15 AS1   asymmetric leaves 1 ATBLU10 Arabidopsis thaliana anthocyanin 3-O-6-O-coumaroylglucoside: glucosyltransferase ATEXP Arabidopsis thaliana expansin ATHB8   Arabidopsis thaliana homeobox gene 8 ATMAT Arabidopsis thaliana anthocyanin 5-glucoside malonyltransferase ATP   adenosine triphosphate ATSBT1  Arabidopsis thaliana subtilisin-like serine protease AT3AT (1,2) Arabidopsis thaliana anthocyanidin 3-O-glucoside coumaroyl CoA transferase AUX/IAA  auxin/indole acetic acid repressors BEE3   brassinosteroid enhanced expression 3  bHLH   basic helix-loop-helix BIFC   bimolecular fluorescence complementation BSA   bovine serum albumin xvii  CAMKK  constitutively active mitogen activated kinase kinase CA-MPK  constitutively active mitogen activated protein kinase CAMV35S  cauliflower mosaic virus 35S promoter CCR   cinnamoyl-CoA reductase cDNA   complementary DNA CDS   coding sequence CFP   cyan or cerulean fluorescent protein CHI   chalcone Isomerase CHIP   chromatin immunoprecipitation CHS   chalcone synthase CHX   cycloheximide CO-IP   co-immunoprecipitation Col-0   Columbia Arabidopsis ecotype COMT   caffeic acid O-methyl transferase COP1   constitutive photomorphogenic 1 COV1   continuous vascular ring 1 CRF2 or TMO3  cytokinin response factor2 or target of Monopteros3 CRY (1,2,3)  cryptochrome photoreceptors CSLA1   cellulose synthase-like A1 CSLG3   cellulose synthase-like G3 CYP   cytochrome P-450 C4H   cinnamate 4-hydroxylase DAPI   4’6-diamino-2-phenylindole DBD   DNA binding domain xviii  DEX   dexamethasone DFR   dihydroflavonol reductase DIN (2,11)  dark inducible DNA   deoxyribonucleic acid DPBA   diphenylboric acid 2-aminoethyl ester ECL   enhanced chemiluminescence EGL3   enhancer of glabra 3 ELF4   early flowering 4 EMS   ethyl methylsulfonate FRET   fluorescent resonance energy transfer ERF   ethylene response factor ESI   electrospray ionization FKF   flavin-binding kelch repeat F-box photoreceptor FLA (1,13)   fasciclin-like arabinogalactan FLAG tag  epitope tag with the amino acid sequence DYKDDDDK FLC   flowering locus C FLS   flavonol synthase FLS2   flagellin-sensitive 2 F3’H/TT7  flavonol 3’-hydroxylase F3H/TT6  flavonone 3’-hydroxylase GA   gibberellic acid GAL4   yeast transcription factor driving galactose-induced gene expression GASA   gibberellic acid-stimulated protein GA3OX1  gibberellin 3-oxidase 1 xix  GFP   green fluorescent protein Glc   glucose Glu   glutamic acid GL3   glabra 3 GO    gene ontology GMO   genetically modified organism GST   glutathione S-transferase GUS   β-glucoronidase HA-tag   hemagglutinin-tag HCA2   high cambial activity 2 HCl   hydrochloric acid His   histidine HPLC   high performance liquid chromatography HRP   horseradish peroxidase HsfA2    heat stress factor A2 HY5   elongated hypocotyl 5 IAA   indole-3-acetic acid IAN   Indole-3-acetonitrile IPTG   isopropyl 1-thio-ß-galactopyranoside JAZ   jasmonate ZIM-domain proteins kDa   kilodaltons KNAT7   knotted Arabidopsis thaliana protein 7 LAC (2 and 7)  laccase 7 LB   Luria broth xx  LBD38   lateral organ boundary domain 38 LC   liquid chromatography Ler   Landsberg Arabidopsis ecotype Leu   leucine LKP2   Lov kelch repeat protein 2 photoreceptor MADS   MCM1 agamous, deficiens srf MAF5   MADS affecting flowering MAPK/MPK  mitogen activated protein kinase MAPKK /MAP2K mitogen activated protein kinase kinase MAPKKK/MAP3K mitogen activated protein kinase kinase kinase MES   2-(N-Morpholino) ethanesulfonic acid MG-ProtoIX  magnesium-protoporphyrin IX MP   monopteros ½ MS   ½ Murashige and Skoog basal media MS   mass spectrometry MYB   myeloblastoma NCBI   national centre for biotechnology information NDPK2   nucleotide diphosphate kinase 2 NES   nuclear export signal NGS   next generation sequencing NLS   nuclear localization signal NPA   N-1-naphthylphthalamic acid NPC   nuclear pore complex OMT1   flavonol-3-O-methyltransferase xxi  ORF   open reading frame OSR1 or NAC3  organ size related 1 OX   over-expressor PA   proanthocyanidin PAP1-D  production of anthocyanin pigment-1 dominant PAL   phenylalanine ammonia-lyase PCR   polymerase chain reaction PHY (A-E)  phytochrome photoreceptors PIF   phytochrome interacting factors PIN   pin formed, auxin transport channel PVDF   polyvinylidene fluoride qPCR   quantitative reverse transcription polymerase chain reaction RAM   root apical meristem RBCS1A/RUBISCO ribulose-1,5-bisphosphate carboxylase/oxygenase RNA   ribonucleic acid ROS   reactive oxygen species RP-HPLC  reverse phase high performance liquid chromatography RT-PCR  reverse transcription polymerase chain reaction SAM   shoot apical meristem SAQR   senescence-associated and qua-quine starch-related SAT   sinapoyl-glucose: anthocyanin acyltransferase SD   standard deviation SD (-trp-leu-ade-his) synthetic defined media without one or more amino acid or base; tryptophan, leucine, adenine and histidine.  xxii  SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electrophoresis SE standard error Ser serine SPA (1,3 and 4) suppressor of PHYA-105 SPL9   squamosa promoter binding protein-like 9 TAIR   the Arabidopsis information resource TCP3   teosinte branched 1, cycloidea and pcf transcription factor 3 Thr   threonine TT (2,3,4,5,6 and 8) transparent testa  TTG (1 and 2)  transparent testa glabra  T (0,1,2 etc…) generation of plants after genetic transformation, where T0 is the parent plant that was transformed by floral dip, and T1 plants are the progeny of the transformed parent UDP uridine diphosphate UFGT   UDP flavonoid-glucosyltransferase UGT71B5  quercetin 3-O-glucosyltransferase UGT73C6  flavonol-7-O-glucosyltransferase UGT75C1  anthocyanidin 5-O-glucosyltransferase UGT78D1  flavonol-3-O-rhamnosyltransferase UGT78D2  flavonoid-3-O-glycosyltransferase UGT78D3  flavonol-3-O-arabinosyltransferase UGT84A2  sinapic acid:UDP-glucose glucosyltransferase UGT89C1  flavonol-7-O-rhamnosyltransferase UV   ultraviolet  UVR-8   ultraviolet receptor 8 xxiii  WDR   tryptophan (W) aspartic acid (D) repeat  WT   wild type XCP2   xylem cysteine peptidase Y2H   yeast two-hybrid ZTL   zeitlupe photoreceptor 3AT   3-amino 1,2,4-triazole 4CL   4-coumarate-CoA ligase 4-OH-ICN  4-hydroxyindole-3-carbonyl nitrile 6xHis-tag  polyhistidine tag, containing 6 consecutive histidine residues                xxiv  ACKNOWLEDGEMENTS First, I would like to thank my supervisor, Dr. Brian Ellis, for his extraordinary patience, compassion and support through all the challenges I faced in my academic career, during my PhD. I want to thank my co-supervisors, Dr. Carl Douglas and Dr. Leonard Foster as well as my committee members, Dr. Shawn Mansfield, and Dr. Juergen Ehlting, for their guidance and scientific advice.  I want to thank the Canadian Army Reserves, particularly Vancouver’s Infantry regiment, the Seaforth Highlanders of Canada, not only for financial support, but for being my family all these years, and a brotherhood that I could lean on in difficult times. I also want to thank Vancover’s 6 intelligence company and the 39 Brigade, for providing me with employment opportunities during the last few years.  I want to thank my mom Tatyana, and my brother Arseny for their continued encouragement and for pushing me to succeed, as well as my partner Sean, for being there for me through all my challenges. I also want to thank my good friend and mentor, Dr. Wenzislava Ckurshumova for shaping my early scientific career and encouraging me to carry on in science.   I also want to thank everyone in the Ellis, Douglas and Samuels labs, for sharing this challenging experience and assisting me in accessing different tools that enriched my research. Finally, I want to thank UBC graduate studies, and particularly the Department of Botany and the Michael Smith Laboratories.1  CHAPTER1 General Introduction 1.1 Phenylpropanoid metabolism  Plant secondary metabolism is a vast network of biochemical pathways producing thousands of different classes of phytochemicals. Although, by definition, secondary metabolites are not essential for survival under optimal conditions, these compounds are vital for the plants’ ability to cope with biotic and abiotic stress, and thus play a pivotal role in plant ecology, species distribution and adaptation to unique niches. Phenylpropanoids comprise one of the largest groups of secondary compounds with over 8000 different phytochemicals known to date (Tohge et al.,2013). Phenylpropanoid compounds are largely restricted to land plants, with the exception of a few phenolics and early phenylpropanoid biosynthetic enzymes found in algae and prokaryotes, believed to be the evolutionary precursors of the complex phenylpropanoid metabolism found in vascular plant (Tohge et al.,2013). The diversification of phenylpropanoid compounds is believed to be a key evolutionary adaptation in land plants. The production of soluble phenolics such as coumarins and flavonoids, improved plant resistance to increased UV light exposure in terrestrial environments and the evolution of lignin in vascular plants, imparted physical strength, allowing organisms to reach colossal sizes, and develop a vascular system for long-distance transport of water and nutrients.  Despite its small genome and relative simplicity Arabidopsis thaliana is emerging as a model for the study of secondary metabolism, as research in recent years revealed this small plant to have many of the same classes of compounds as other plant taxa (D’Auria and Gershenzon, 2005; Kliebenstein, 2004.). While plant-environment interaction has been an 2  established role for many secondary compounds, increasing evidence in recent years has demonstrated that some of these phytochemicals have an impact on primary plant functions.  Phenylpropanoid metabolism branches off the primary shikimate pathway, which leads to the synthesis of aromatic amino acids in plants, bacteria and fungi. The first step of phenylpropanoid metabolism is the conversion of the amino acid phenylalanine to cinnamic acid, catalyzed by a highly conserved enzyme, phenylalanine ammonia lyase (PAL1-4 in Arabidopsis). This step is followed by hydroxylation, catalyzed by coumarate 4-hydroxylase (C4H), and formation of CoA thioester 4-coumaroyl-CoA, mediated by 4-coumarate-CoA ligase (4CL). 4-coumaroyl-CoA is a key branching point in phenylpropanoid biosynthesis, as it can be converted to p-coumaroyl-shikimate, the entry point to biosynthesis of lignin and sinapate esters. Alternatively 4-coumaroyl-CoA can be combined with three malonyl-CoA units to produce naringenin chalcone, in a condensation reaction mediated by chalcone synthase (CHS), which marks the entry point into flavonoid biosynthetic branch of phenylpropanoid metabolism (reviewed in Fraser and Chapple, 2011; Vogt, 2010). Naringenin chalcone is then converted to naringenin by chalcone isomerase and to dihydroflavonol by flavonol 3-hydroxylase (F3H). Dihydroflavonol represents another key branching point in flavonoid metabolism, as it can be converted to flavonols by flavonol synthase (FLS) or to anthocyanins by dihydroflavonol reductase (DFR) (Fig 1.1). Flavonoids are a diverse group of soluble end products of phenylpropanoid metabolism, which comprise several major subgroups including aurones, flavones, chalcones, flavandiols, isoflavones, flavonols, anthocyanins and proanthocyanidins. With over 6000 flavonoid 3  compounds identified in different plant species, these phytochemicals display immense functional diversity. In the roots of legumes, flavonoids (mainly flavonols and flavones) are essential for nodulation (Abdel-Lateif et al., 2012; Wasson et al., 2006; Zhang et al., 2009). They also play an important role in protection against pathogen attacks, as many of these compounds are toxic to insect herbivores (reviewed in Simmonds, 2003). Flavonoids (particularly anthocyanins) are responsible for bright flower colour in many species, which attract pollinators (Grotewold, 2006; Winkel-Shirley, 2001). In vegetative tissues anthocyanins act as sunscreens, shielding the photosynthetic machinery and other cell components from harmful UV radiation and excess light. Anthocyanins and other flavonoids are well known for their antioxidant properties, as these compounds can chelate free radical-generating metal ions, and reduce harmful reactive oxygen species (ROS) (Deng et al., 1997). Apart from protecting plants from oxidative stress, antioxidant properties of flavonoids have made them a central topic in plant medicine, with anti-allergic, anti-inflammatory and anti-microbial properties in mammalian systems, and showing promising results in treatment of neurodegenerative disease and cancer (reviewed in Kumar and Pandey, 2013; Sandhar et al., 2011). The widespread roles in plant and human health, has made flavonoid biosynthesis a hot topic in plant biology. Having only three classes of flavonoids, (flavonols, anthocyanins and proanthocyanidins) Arabidopsis is a simple model for understanding flavonoid chemistry and biosynthesis, and has been vital in elucidating the flavonoid biosynthetic pathway and the regulatory networks that control flavonoid biosynthesis (reviewed in Saito et al., 2013).  4  1.2 Transcriptional regulation of flavonoid and anthocyanin biosynthesis     MYB (MYEOLOBLASTOSIS) family of proteins is a group of transcription factors found across eukaryotic species. Initially discovered in avian myeloblastosis virus, MYBs have been established as key players in cell growth, development, and homeostasis in mammalian systems (reviewed in Oh and Reddy, 1999). In the plant kingdom this protein family has undergone significant expansion and functional diversification, resulting in MYBs controlling a broad spectrum of functions (Dubos et al., 2010; Stracke et al., 2001).  The MYB family is defined by their characteristic DNA binding domain; an imperfect helix-turn-helix repeat of about 50 amino acids. Subfamilies of MYB transcription factors can be categorized as R1, R2R3 and R3, according to the number adjacent repeats in their MYB domain (Stracke et al., 2001). Members of the R2R3 subfamily of MYB transcription factors participate in a range of plant-specific processes, including development, tissue differentiation, cell fate determination and secondary metabolism (Dubos et al., 2010; Stracke et al., 2001). Plant MYBs are key transcriptional regulators of phenylpropanoid biosynthetic genes. MYB11, MYB12 and MYB111 are positive regulators of early flavonoid biosynthesis enzymes, driving expression of CHS, CHI, FLS and F3H (Mehrtens et al., 2005; Stracke et al., 2007). Late flavonoid and anthocyanin biosynthesis genes on the other hand are positively regulated by MYB75, MYB90, MYB113 and MYB114 (Gonzalez et al., 2008; Borevitz et al., 2000). Among these latter MYBs, MYB75 appears to be the most important player in driving flavonoid and anthocyanin production, showing higher levels of expression than MYB90, MYB113, or MYB114 in developing seedlings and adult plants. Furthermore, the myb75-null mutant (Nossen ecotype) 5  fails to accumulate anthocyanins even in the presence of sucrose, a known driver of anthocyanin production (Gonzalez et al., 2008).  MYB75 was initially identified in an activation-tag screen, where its over-expression induced a purple colouration in Arabidopsis, resulting from the accumulation of anthocyanins throughout the plant. For this reason, it was initially given the name PAP1-D for Production of Anthocyanin Pigment-1 Dominant (Borevitz et al., 2000). Since its initial discovery, MYB75 has been widely studied in the context of anthocyanin biosynthesis and has been of great interest as a target for metabolic engineering.  A study by Tohge et al., (2005) combined transcriptome analysis with metabolomics to reveal details of gene-expression and biochemical changes in PAP1-D plants compared to WT Arabidopsis. The authors demonstrated that 11 species of anthocyanins (A1-A11) which accumulated in Arabidopsis leaves are more abundant in PAP1-D plants than in WT Arabidopsis. While different plant organs showed distinct molecular profiles (for instance roots only accumulated five anthocyanins; A1-A3, A5 and A8),  PAP1-D plants consistently showed at least ten-fold increase in abundance for each molecular species compared to WT plants (Tohge et al., 2005). Over-expression of MYB75 in PAP1-D plants also had an apparent impact on flavonol profiles. Among kaempferol derivatives (F1-F3), the usually abundant kaempferol dirhamnoside (F1) was slightly reduced in leaves of PAP1-D plants, while quercetin glycosides (F4-F6) showed a 10 fold increase. Interestingly, there was no significant shift in flavonol profiles in roots under the conditions tested (Tohge et al., 2005). As expected, transcriptome analysis revealed up-regulation of genes involved in anthocyanin biosynthesis (ANS, DFR, F3H, F3’H and GST) as well as early flavonoid biosynthesis genes (4CL, CHI, and CHS). Additionally, a number of flavonoid glycosyltransferases and acyltransferases were upregulated 6  in PAP1-D plants, suggesting that expression of flavonoid-modifying enzymes is also influenced by MYB75 expression (Tohge et al., 2005).  In a different study, several direct targets of MYB75 were identified, along with a promoter consensus sequences required for MYB75-mediated transcriptional activation (Dare et al., 2008). The authors showed that MYB75 was able to drive reporter expression from the promoters of dihydroflavonol reductase (DFR), glutathione S-transferase (GST), leucoanthocyanidin dioxygenase (LDOX) also known as anthocyanidin synthase (ANS), UDP flavonoid 5-O-glucosyltransferase (UFGT), chalcone synthase (CHS), MYB114 and flavonone-3-hydroxylase (F3H). The analysis of these reporters identified the essential consensus sequence, YCNC/TCACRWK, which was termed PAP1 cis-element (PCE; Dare et al., 2008). The conserved C/TCAC core in the PCE is consistent with previously described type I MYB-regulatory elements (Feldbrugge et al., 1997; Berendzen et al., 2012). Genes showing the highest level of upregulation by MYB75 encode enzymes required for anthocyanin biosynthesis (DFR, LDOX, UFGT and GST), while enzymes required for earlier steps of flavonoid biosynthesis (CHS, F3H), showed more moderate induction by MYB75 (Dare et al., 2008) (Fig 1.1). These data agree with earlier studies which showed MYB75 to be primarily a positive regular of anthocyanin biosynthesis (Gonzalez et al., 2008; Teng et al., 2005). Although recent evidence suggests that MYB75 may influence other branches of phenylpropanoid metabolism, such as lignin biosynthesis, as well as biosynthesis of other components of the secondary cell wall (Bhargava et al., 2010).  7  1.3 MYB75 transcription-regulatory complexes required to drive flavonoid and anthocyanin biosynthesis While MYB11, MYB12, and MYB111 are sufficient to drive transcription of genes involved in flavonol biosynthesis, transcriptional regulation of anthocyanin biosynthetic genes by MYB75 typically requires the formation of regulatory complexes with other transcription factors. In vegetative tissues, MYB75 forms a complex with the WD repeat protein TTG1 and either one of the bHLH proteins, GL3, EGL3 or TT8 (Gonzalez et al., 2008) to drive anthocyanin biosynthesis (Baudry et al., 2004; Zimmerman et al., 2004). The MYB/bHLH/WD transcriptional complexes, highly conserved in plants, are also implicated in epidermal cell differentiation and cell fate determination (Bernhardt et al., 2004, Schellmann and Hulskamm, 2005; Serna, 2005; Serna and Martin 2006; Ramsay and Glover; 2005, Song et al.,2011). While bHLH and WD repeat proteins can have a broad spectrum of functions, the MYB transcription factors convey specificity to the MYB/bHLH/WDR complex (Ramsay and Glover, 2005); in the case of MYB75 this specificity is thought to be restricted to flavonoid and anthocyanin biosynthetic genes (Fig 1.1) 1.4 Role of MYB75 in cell wall biosynthesis and lignin deposition In addition to regulating anthocyanin production within MYB/bHLH/WDR complexes, MYB75 has also been shown to interact with KNAT7 (Bhargava et al., 2010), a member of the Knotted Arabidopsis Thaliana Protein family. KNAT7 activity negatively affects lignin deposition and secondary cell wall thickness in interfascicular fibers (Bhargava et al., 2013; Li et al., 2012), and appears to act synergistically with MYB75 in inflorescence stems and the seed coat by down-regulating lignin biosynthesis (Bhargava et al., 2013). MYB75 by itself is a weak 8  transcriptional activator, while KNAT7 has transcriptional repressor activity (Bhargava et al., 2013). The myb75- null mutants have thicker secondary cell walls in interfascicular fibers of Arabidopsis stems, whereas PAP1-D plants (over-expressing MYB75) have thinner cell walls in both interfascicular fibers and vessels (Bhargava et al., 2010). Lignin content was significantly greater in myb75- mutants and lower in PAP1-D plants, as determined by Klason analysis of mature stems. Lignin composition analysis by thioacidolysis revealed that myb75-  plants had lower levels of syringyl (S) lignin monomers while PAP1-D plants had higher levels of syringyl and lower levels of guaiacyl (G) lignin in their stems (Bhargava et al., 2010). The changes in total lignin content, and the shift in the S/G ratio in both mutants, implicate MYB75 in the regulation of gene expression important for lignin biosynthesis and composition. The impact of MYB75 on gene expression varies in different tissues. Earlier studies performed on either seedlings or adult vegetative leaves showed that MYB75 is a positive regulator, not only of genes responsible for anthocyanin biosynthesis, but also of early flavonoid (CHS, F3H, F3’H) and phenylpropanoid (4CL, and PAL) genes, which contribute to lignin accumulation (Gonzalez et al., 2008; Borevitz et al., 2000). In contrast, when examining specifically the lower portion of Arabidopsis stems, where secondary cell wall deposition is prominent, MYB75 emerges as a negative regulator of the lignin branch of phenylpropanoid metabolism (Bhargava et al., 2010).  Although neither PAP1-D nor myb75- mutants showed significant changes in cell wall carbohydrate content or composition, myb75- mutants showed an increase in expression of genes responsible for synthesis of cellulose and hemicellulose in secondary cell walls, implicating MYB75 in regulation of plant cell wall development, beyond phenylpropanoid metabolism (Bhargava et al., 2010). Most importantly, these studies bring to 9  light additional roles of MYB75 in developmental and biochemical processes, in different tissues and at different stages of the Arabidopsis life cycle, highlighting the importance of spatial and temporal regulation of MYB75 activity.                10    Fig 1.1 11  Fig 1.1 Simplified diagrammatic representation of the phenylpropanoid biosynthetic pathway in Arabidopsis, depicting key biochemical compounds within the flavonoid and lignin branches of the pathway, as well enzymes required to catalyze their biosynthesis. Enzymes required for biosynthesis of different compounds within the phenylpropanoid pathway are indicated in coloured boxes, colour-coded according to their responsiveness to transcriptional regulation by MYB75. Flavonoid and anthocyanin biosynthesis enzymes highlighted in red and orange are very strongly and moderately upregulated by MYB75 respectively, while those highlighted in yellow are weakly upregulated by MYB75. Genes highlighted in green have been reported to be upregulated by MYB75 in some studies, but not in others. Genes highlighted in blue are downregulated by MYB75. Transcription of genes highlighted in grey is not known to be affected by MYB75. (Based on combined data from: Borevitz et al., 2000; Teng et al., 2005; Dare et al., 2008; Gonzalez et al., 2008; Bhargava et al., 2010, 2013).  1.5 MYB75 protein-protein interactions; additional layers of regulation Recent work has unveiled additional players which regulate MYB75 function through direct interaction with MYB75 or its bHLH partners. Light intensity, photoperiod length, and circadian rhythm influence the levels of regulatory and biosynthetic genes of phenylpropanoid metabolism, including MYB75 (Rogers et al., 2005; Shi and Xie, 2010). High light intensity and longer days typically lead to an increase in accumulation of anthocyanins and flavonoids (Shi and Xie, 2010). This can be, in part, accounted for by increased sucrose availability resulting from greater photosynthetic activity under abundant light conditions. However, an independent signalling mechanism through photoreceptors allows light to directly influence gene expression and levels of certain proteins, through post-translational regulation, that contribute to anthocyanin accumulation, independently of sucrose response (Chang et al., 2008; Shin et al., 2007; Rogers et al., 2008). MYB75 protein accumulates in the light and is degraded in the dark. Accumulation of MYB75 under high light conditions is partly dependent on HY5, a bZIP family transcription factor which plays a central role in photomorphogenesis, 12  and positively regulates MYB75 expression, by directly binding to the MYB75 promoter and driving its transcription (Chang et al., 2008). In the dark MYB75 is targeted for degradation by a tetrameric complex of COP1 and SPA proteins which are E3 ubiquitin ligases, known to target transcription factors for degradation by the 26S proteasome (Maier et al., 2013). SPA1, SPA3 and SPA4 (which form a complex with COP1) are able to directly bind MYB75 in the dark, leading to its degradation, thus regulating MYB75 levels post translationally. In the light, the COP/SPA complex is de-stabilized, and therefore unable to drive protein turnover, which allows MYB75 to accumulate (Maier et al., 2013). Anthocyanins are known to accumulate during senescence and in response to various abiotic stresses: this process is in part be driven by the phytohormone jasmonic acid (Shan et al., 2009). Jazmonate-ZIM-Domain (JAZ) proteins are transcriptional repressors that can bind the MYB75/bHLH/WDR complex and block its ability to drive transcription of target genes. The degradation of these JAZ proteins triggered by jasmonate hormone, leads to the release of the MYB75/bHLH/WDR complex, allowing it to drive transcription of anthocyanin biosynthetic genes (Qi et al., 2011). JAZ1 and JAZ8 have been shown to specifically bind to MYB75, blocking anthocyanin biosynthesis (Qi et al., 2011).  MYBL2 and SPL9 are two negative regulators of anthocyanin biosynthesis which can disrupt the MYB/bHLH/WDR complex, or prevent it from binding to target promoters through competitive protein-protein and protein-DNA interactions, respectively. MYBL2 is a single repeat MYB lacking the C-terminal transcriptional activation domain that can bind to bHLH proteins, preventing the formation of functional complex with MYB75 and TTG1 (Dubos et al., 2008). Similarly, SPL9 (SQUAMOSA PROMOTER BINDING PROTEIN LIKE 9) can disrupt the MYB/bHLH/WDR complex by binding to R2R3 MYBs, including MYB75 and MYB113. 13  Additionally, SPL9 can compete with MYB75 for binding sites in the promoters of anthocyanin biosynthetic genes (Gou et al., 2011).  On the other hand, TCP3 is a transcription factor that positively regulates complex-formation between MYB75, TT8/GL3/EGL3 and TTG1, leading to increased anthocyanin biosynthesis. TCP3 is also able to bind MYB11, MYB12 and MYB111, and appears to enhance their ability to drive transcription of early flavonoid biosynthetic genes (Li and Zachgo, 2013). Interestingly, both SPL9 and TCP3 have been implicated in developmental processes connected to the hormone auxin.  In Arabidopsis plants over-expressing TCP3, increased levels of flavonols coincide with inhibition of auxin-response, resulting in widespread developmental abnormalities such as altered vessel development, organ shape, root growth and reduced apical dominance (Li and Zachgo, 2013).  According to Gou et al., (2011), the spatial-temporal distribution of SPL9 modulates the proportion of anthocyanins to flavonols in developing stems. The authors demonstrated that SPL9 over-expression promotes flavonol and inhibits anthocyanin accumulation. Since flavonols and anthocyanins are made from the same dihydroflavonol precursor, their accumulation is competitive. Therefore, the relative proportions of these classes of compounds in Arabidopsis stems can affect certain aspects of development, such as time of floral transition, in which SPL proteins have been implicated (Gou et al., 2011, Wang et al., 2009).  Growing evidence suggests a high degree of interconnectedness between secondary metabolism and primary developmental functions. Until recently MYB75 was primarily thought to regulate a restricted number of genes controlling anthocyanin biosynthesis, with possible 14  indirect impact on other flavonol compounds through metabolic channeling. The findings of Bhargava et al., (2010) demonstrated that MYB75 is involved in lignin production in mature stems, demonstrating that this gene may have a broader spectrum of functions in plants than previously described. Thus, we cannot exclude the possibility that MYB75 may have additional roles, and other transcriptional targets that have not yet been identified, in tissues and/or developmental contexts that are yet to be explored. 1.6 Plant hormones and flavonoid biosynthesis  Plant hormones constitute a diverse group of small molecules that mediate signals important in plant growth and development as well as secondary metabolism and response to stress. These molecules are vital for systemic signal transduction between distant plant organs, but can also participate in localized cell to cell communication. Many physiological stresses and developmental cues, which induce flavonoid and anthocyanin accumulation, are under the influence of hormonal regulation. In turn, flavonoids can influence hormone signalling in plants; perhaps the most prominent example of this is the modulation of auxin flow by flavonols. An in-depth analysis of how flavonoids impact auxin-regulated developmental processes was done by Buer et al., (2013), where the entire collection of transparent testa mutants, defective in enzymes required for different steps of flavonoid biosynthesis was examined. The authors describe the perturbations among tt mutants, in terms of accumulation and tissue-specific distribution of individual flavonoid compounds, and correlate these changes with perturbations in auxin flow, as well as specific developmental defects. Various transparent testa mutants showed alterations in root architecture, gravitropic response and aerial tissue development, which coincided with blockage of shootward (acropetal) and rootward (basipetal) flow of auxin 15  (Buer et al., 2013). Flavonols, including quercetin, kaempferol and their glycoside derivatives, can negatively impact auxin flow (Buer et al., 2013; Brown et al., 2001) by directly binding to auxin ABCB1 and ABCB19 transporters (Bouchard et al., 2006; Bailly et al.,2008). Additionally, flavonols can influence the localization of PIN efflux channels, which mediate directional auxin transport, and drive auxin canalization required for vascular differentiation (Michniewicz et al., 2007; Heinrich et al., 2012).  The relationship between MYB75, development and the hormone auxin is intuitive, yet not well defined. Accumulation of MYB75 in cyanic cells of the plant epidermis leading to anthocyanin production has been most widely studied. Only the most recent work began to expose additional roles of MYB75 in cell wall deposition; a process typically coupled with vascular development, which is largely an auxin driven process. Interaction between MYB75 and transcription factors such as KNAT7 and TCP3, implicated in cell wall development and auxin response respectively, suggests that MYB75 may have different roles depending on the cellular, environment and developmental contexts. Uncovering these additional roles will require fine tuning our understanding of how plants integrate different signals controlling development and response to the environment, and how these signals affect MYB75 function. 1.7 MAP kinase signalling in plants MAP kinase signalling pathways are highly conserved among eukaryotes and are essential for relaying messages from outside to inside the cell, and in crosstalk between parallel and antagonistic signalling pathways, which allows for integration of multiple stimuli. MAP kinase signalling typically starts with the activation of a cell-surface receptor-kinase, triggered 16  by binding of a ligand to its extracellular domain or a change in the extracellular environment. Such cell surface receptors have either tyrosine or serine/threonine kinase activity. Upon activation, they can recruit downstream signalling components such as adaptor proteins and members of the MAP kinase phosphorelay (Gomez-Gomez et al., 2000; Schulze et al., 2010). The core components of the MAP kinase cascade include MAP kinase kinase kinase (MAP3K), MAP kinase kinase (MAP2K) and MAP kinase (MAPK). MAP3Ks can be phosphorylated and activated by the receptor itself or by associated kinases. MAP3K’s are serine/threonine kinases, which can activate MAP2Ks by phosphorylation of their activation loop. Activated MAP2K can phosphorylate and activate MAP kinases on specific threonine and tyrosine residues. Once activated MAP kinases can phosphorylate serine and threonine residues on a wide spectrum of targets, including enzymes, transcription factors and cytoskeletal proteins (reviewed in Rodriguez et al., 2010; Colcombet and Hirt, 2008). Phosphorylation typically causes a topological or conformational change in the target protein and this process can affect one or more aspects of protein function, including protein-protein interactions, protein localization and stability and susceptibility to proteolytic degradation. In the case of transcription factors phosphorylation can affect transcriptional activity and the ability to bind to target promoter sequences (reviewed in Whitmarsh and Davis, 2000). A given target can have multiple phosphorylation sites, which can be phosphorylated by different kinases, affecting different aspects of its function, and sometimes having antagonistic effects on the target protein (Yoo et al., 2008).  In the Arabidopsis genome 20 MAP kinases, 10 MAP2Ks and 80 MAP3Ks have been identified, on the basis of homology to analogous families in animals and fungi (Ichimura et al., 17  2002). In plants, some of the best studied MAP kinase-regulated pathways are involved in responses to a variety of abiotic stresses (reviewed in Rodriguez et al., 2010), including ozone (Lee and Ellis, 2007; Miles et al., 2009), drought, heat (Rizhsky et al., 2004), oxidative stress (Kovtun et al., 2000, Nakagami et al., 2006), salt, cold (Teige et al., 2004; Mizoguchi et al., 1996), touch, water stress (Mizoguchi et al., 1996), UV radiation (González Besteiro et al., 2011), heavy metals (Jonak et al., 2004), and nutrient deprivation (Wang et al., 2002). MAP kinase signalling pathways also play a crucial role in plant responses to biotic stresses such as herbivory (Heinrich et al., 2011) and pathogen attack, as MAPK activity is vital for mounting a defense response (Petersen et al., 2000; Asai et al., 2002; Del Pozo et al., 2004; Andreasson et al., 2005; Jones and Dangl, 2006; Chinchilla et al., 2007, Boller and Felix, 2009). In Arabidopsis, MAP kinases MPK3, MPK4 and MPK6 have been most widely studied. Interestingly, many of the stresses, which are known to activate MAP kinase signalling are also known to trigger anthocyanin accumulation. MAP kinases are also implicated in growth, development and differentiation (Ohashi-Ito and Bergmann, 2006; MacAlister et al., 2007; Wang et al., 2007; Kanaoka et al., 2008, Lampard et al., 2008.). Many MAP cascades exhibit significant crosstalk with phytohormone signalling pathways, creating a complex network which allows for the integration of multiple stimuli (reviewed in Rodriguez et al., 2010). While some MAP kinase modules are highly specific for a small subset of cellular targets, others are more promiscuous. For instance MPK3 and MPK6 are implicated in a variety of biotic and abiotic stress responses (reviewed in Rodriguez et al., 2010), in hormone signalling (Yoo et al., 2008) as well as development and cell differentiation (Lampard et al., 2008). MAP kinases activation in response to auxin has been demonstrated in 18  Arabidopsis roots. The authors found that kinase activation was reduced in auxin-insensitive mutants, and auxin-inducible marker expression was abolished in the root elongation zone upon chemical inhibition of MAP kinase activation, implicating MAP kinase signalling in auxin-driven developmental processes (Mokaitis and Howell, 2000).  1.8 MYB transcription factor phosphorylation by MAP kinases  Regulation of MYB transcription factor-function by phosphorylation has been well documented in animals (Miglarese et al., 1996; Bessa M., et al., 2001; Cesi et al., 2002), and more recently in plants (Ito et al., 2001, Haga et al., 2007, Popescu et al., 2009). Recent work in Pinus taeda revealed that the xylem-specific R2R3-MYB transcription factor PtMYB4, is phosphorylated by PtMPK6 (Morse et al., 2009). The authors showed that PtMPK6 was able to phosphorylate PtMYB4 at a serine residue found in its activation domain, which has a negative impact on the transcriptional activity of PtMYB4, without affecting its ability to bind the target DNA sequence (Morse et al., 2009). The Arabidopsis homologues most closely related to PtMYB4 are AtMYB46 and AtMYB83, both of which are global regulators of secondary cell wall development (Zhong and Ye, 2012), while the closest Arabidopsis homologue of PtMPK6 is AtMPK6.  MYB75 has two threonine residues (T126 and T131) that appear as canonical MAP kinase phosphorylation sites, where the threonine residue is followed by a proline. Unlike other global regulators in the MYB family, MYB75 has a relatively restricted number of target genes and a predictable set of functions defined to date; neither the over expression nor deletion of the gene have severe consequences that would compromise plant survival. These features of MYB75 make it good candidate for connecting MAP kinase signalling to stress response and 19  secondary metabolism, and to uncover how phosphorylation can impact this transcription factor family, and the biological functions they regulate.  In living cells protein phosphorylation is an ongoing and dynamic process, with kinetics of target phosphorylation ranging from seconds to minutes of stimulation with an elicitor of kinase activation (Peck, 2006; Leoni et al., 2013). Protein phosphorylation events can be cyclical: for example, proteins responsible for cell cycle checkpoints and progression are often activated by phosphorylation at specific stages of cell growth (Pearce and Humphreys, 2001). Alternatively, phosphorylation can occur in response to an external or intracellular stimulus.  Some prominent examples in plants include activation of FLS2 receptor by flagellin (flg22), which initiates an immune response (Gomez-Gomez and Boller, 2000; Shulze et al., 2010), and the activation of a MAP kinase signalling cascade in response to an oxidative burst (reviewed in Liu and He, 2017). In all of these cases, by altering the function of existing proteins, phosphorylation can elicit a rapid response, localized in a specific cell or tissue that would otherwise require significant transcriptional reprogramming.  Additionally, phosphorylation signalling cascades are kept in check through the antagonistic action of protein phosphatases which de-phosphorylate proteins (Lee et al., 2008; González Besteiro et al., 2011; Bhalla et al., 2002), making this form of post-translational modification reversible and transient,  and therefore challenging to capture and study. Point mutations have been routinely used to simulate phosphorylated and un-phosphorylated protein forms. Serine and threonine residues are commonly mutated to alanine, creating a form of the protein that can no longer be phosphorylated. Replacing a serine with an aspartic acid, or a threonine with a glutamic acid residue creates another non-phosphorylatable form of the protein, however, the large 20  electronegative groups present in aspartic and glutamic acids simulate the presence of a phosphate group on the serine or threonine respectively, as they mimic the steric and electrostatic properties of phosphoserine and phosphothreonine. Throughout this work phosphomutants are employed to describe the impact of phosphorylation on MYB75 protein function. Initially, threonines 126 and 131 were replaced with alanine or glutamic acid residues creating phosphomutant and phosphomimic versions of MYB75, respectively. The point-mutants used in our analysis initially included MYB75T126A, MYB75T126E, MYB75T131A and MYB75T131E as well as the double mutants, MYB75AA and MYB75EE, however, as my focus shifted towards threonine 131, MYB75T131A and MYB75T131E were primarily used in my final experiments. 1.9 Role of MAP kinases in ROS and light signalling An overwhelming volume of literature on MAP kinases implicates these signalling cascades in responses to a wide variety of biotic and abiotic stresses. A common feature of many such stress responses is the burst of reactive oxygen species (ROS) which accompanies the initial perception of the stress elicitor. Reactive oxygen species include hydroxyl radicals (HO˙), singlet oxygen (1O2), superoxide anions (O2˙-), and hydrogen peroxide H2O2. These molecular species can cause severe oxidative damage to cell components, but they also play an important role in stress perception and response (reviewed in Liu and He, 2017). The vast majority of knowledge on how MAPK kinase phosphorelay is involved in ROS signalling comes from analyses of various null mutants of mkkk, mkk and mpk genes (reviewed in Liu and He, 2017). The precise mechanism of how MAP kinase cascades affect ROS-driven changes in gene expression is far from being fully elucidated, however, several lines of evidence 21  suggest that phosphorylation of transcription factors is an important part of this regulation (Wang et al., 2013, reviewed in Liu and He, 2017). MPK3 and MPK6 are the best described regulators of ROS signalling. These MAP kinases are activated by H2O2 and can modulate expression of genes, such as ROS-scavenging enzymes, that enable plants to cope with oxidative stress (Xing et al., 2007;2008;2013), supporting previous data which showed that MAP kinase cascade activation enhances stress tolerance and acclimation (Kovtun et al., 2000).  ROS signalling is not only part of stress response, but is an ongoing monitoring system of cell and organelle redox status. Chloroplasts are major hubs for ROS production, generated as byproducts of photosynthesis (reviewed in Asada, 2006; Pospisil, 2009). Excess light can cause overexcitation of chlorophyll and excess reduction of the photosynthetic apparatus, leading to generation of reactive oxygen species (Tipathy and Oelmϋller, 2012). Because of this direct connection between light and ROS signalling, it is not surprising that MAP kinases are emerging as important players in light-dependent stress signals, connected to photomorphogenesis.    Recent work has demonstrated the involvement of plastid signals in activation of MPK6, when plants were shifted from low to high light (Vogel et al., 2014). Although the authors suggest that metabolites exported from the chloroplast act as signals that lead to MPK6 activation, an earlier study showed that MKK4 can localize to the chloroplast, suggesting that the plastid can also be a site of MPK cascade initiation (Samuel et al., 2008). In another study MKK3 was shown to be necessary for acclimation when plants were shifted from dark to light (Lee, 2015), consistent with previous findings showing that MKK3-MPK6 modules play an important role in seedlings photomorphogenesis (Sethi et al., 2014). Since increased exposure to light is accompanied by increased light stress (including ROS accumulation), these recent 22  findings reinforce the role of MAP kinases in managing stress response and maintenance of homeostasis. 1.10 Light and plant development As autotrophs, plants rely on light for growth, development and reproduction. It is therefore not surprising that light has a profound influence on every aspect of plant physiology. Plants are able to perceive light quality and quantity, and adjust to suboptimal lighting conditions. Photomorphogenesis is plant development shaped by light, aimed at maximizing photosynthesis, ultimately ensuring survival and reproduction. Photomorphogenesis is most commonly used to describe changes in early plant development, when a seedling transitions from heterotrophy (relying on nutrients stored in the seed) to photosynthesis. Key events in this transition include chloroplast development and establishing of stem cell populations in the apical meristems, which initiate organ differentiation. Additionally, photomorphogenesis can shape the plants’ later stages of development, and has been shown to affect core processes, including seed germination, hypocotyl de-etiolation, organ expansion, stem elongation, apical dominance, chloroplast biogenesis, as well as floral initiation and flowering time (reviewed in Arsovski et al., 2012). At the genetic and cellular levels, photomorphogenesis involves large scale reprogramming of gene expression, leading to visible morphological and developmental changes. Prominent examples of this light-dependent reprogramming include seedling etiolation in the dark and de-etiolation upon exposure to light. Besides shaping the early plant-developmental stages, photomorphogenesis is also important in driving shade avoidance of plants under a canopy. The molecular components which control these processes comprise vast signalling networks, where light perception is intertwined with hormonal signals, the circadian 23  clock and various environmental cues. The comprehensive description of all molecular components of light signalling and their relationships is beyond the scope of this thesis. This work will focus on describing only key developmental trends and global regulators of photomorphogenesis that may be pertinent to the role of MYB75 in light-dependent developmental processes.  1.11 Plant photoreceptors Plants have several classes of photoreceptors which allow them to perceive light quantity and quality. Some of the best studied light signalling pathways are associated with phytochromes (PHYA-E), which absorb red and far-red light (600-750nm) (reviewed in Li et al., 2011) and cryptochromes (CRY1, CRY2 and CRY3) which absorb blue light and UV-A (320-500nm) (reviewed in Lin, 2002; Yu et al., 2010). Other classes of blue-light and UV-A photoreceptors discovered in recent years include phototropins (PHOT1-2) (reviewed in Lin 2002), ZEITLUPE (ZTL) (Kim et al, 2007)., FLAVIN-BINDING KELCH REPEAT F-BOX (FKF) (Nelson et al., 2000) and LOV KELCH REPEAT PROTEIN 2 (LKP2)(Baudry et al., 2010). Additionally, UVR-8 was a recently described UV-B photoreceptor, shown to mediate UV-B stress response (280-315nm) (Rizzini et al., 2011; Tilbrook et al., 2013). Together red and blue light photoreceptors monitor light in the spectrum that is required for photosynthesis, and can work synergistically and antagonistically to relay highly detailed light information to the plant cell.  Phytochromes and cryptochromes are the best described photoreceptors in terms of structure and function. They consist of a protein linked to distinct types of chromophores, which absorb specific wavelengths of light and trigger a conformational change in the protein portion, essential to initiate the light signalling cascade downstream of that photoreceptor.  24  In the case of phytochromes photoactivation-driven transition from the inactive conformation (Pr) to the active form (Pfr), leads to relocation of the photoreceptor from the cytosol to the nucleus, where it can impact gene expression. Cryptochromes on the other hand are predominantly found in the nucleus; their activation requires both photoexcitation and phosphorylation, which promotes their interaction with downstream signalling components, inducing blue-light driven developmental changes (Reviewed in Lin ,2002; Liu et al., 2011, Gyula et al., 2003).  Phytochromes and cryptochromes influence light-driven gene expression in several ways. They can bind directly to distinct transcriptional regulators, and target them to specific promoters. These photoreceptors can also trigger phosphorylation of transcription factors and other regulatory proteins, altering their stability or the ability to drive gene expression, due to altered protein-protein and/or protein-DNA interactions (reviewed in Lin, 2002; Gyula et al., 2003., Schepens et al 2004., Liu et al., 2011., Li et al., 2011., Wang and Wang 2015). Perhaps the best described function of phytochromes and cryptochromes is their ability to disrupt COP1/SPA ubiquitin ligase complexes, which target photomorphogenic transcription factors for degradation. In this manner photoreceptors can lead to global changes in gene expression, through stabilization of light responsive transcriptional regulators.  Phytochromes and cryptochromes have unique and overlapping functions. Most of these photoreceptors are able to drive seedling de-etiolation and photomorphogenesis during early development, when exposed to appropriate wavelengths of light. PHYA is important for mediating far-red light responses, while the remaining phytochromes (PHYB-PHYE) predominantly drive red light-activated processes (Li et al., 2011). In Arabidopsis PHYA 25  promotes flowering, while PHYB inhibits floral initiation, along with PHYD and PHYE (Schepens et al., 2004; Wang and Wang ,2015; Li et al., 2011). Blue light has also been shown to induce flowering, through CRY1 and CRY2. Additionally CRY1 can mediate hypocotyl de-etiolation and chloroplast biogenesis, thus having overlapping functions with phytochromes. Years of research have unveiled increasing complexity and connectivity between different photoreceptors and their downstream signalling components; in recent years this complexity has increased, as researchers discovered the involvement of plastid signals in light perception and response. 1.12 Plastid-derived signals In addition to photoreceptors, chloroplasts can act as monitors of light quality and quantity as well as cell redox status. Plastids can communicate with the nucleus, optimizing gene expression to coordinate development with energy output from photosynthesis, and protect the plant from photooxidative damage. A recent study demonstrated that the chloroplast controls approximately half of light-regulated genes (Ruckle et al., 2012). The authors used lincomycin antibiotic (a plastid-specific translational inhibitor), in conjunction with global transcriptional analysis, to show that of ~6400 genes whose expression changed in response to increased light intensity, over 3000 genes depended on a functional chloroplast. The major classes of genes dependent on plastid integrity included those required for photosynthesis, plastid biogenesis and maintenance, as well as stress response and photoprotection.  Interestingly, expression of chalcone synthase (CHS) was increased in seedlings treated with lincomycin, indicating that flavonoid biosynthesis can be influenced by plastid-derived signals (Ruckcle et al., 2012, Hills et al ., 2015).  26   Although our understanding of chloroplast to nucleus communication is still limited, the overall emerging view is that various metabolites (such as chlorophyll biosynthetic intermediates) generated as a result of damage or disruption of chloroplast function, activate signalling cascades that can affect nuclear gene expression. For instance, MG-protoporphyrrin IX (MG-ProtoIX), a precursor in chlorophyll biosynthesis, acts as a signalling molecule that can impact nuclear gene expression (Mochizuki et al., 2001, Kindren et al., 2012). In turn, chloroplast function is tightly linked to light signalling through phytochromes and cryptochromes, and is heavily reliant on the function of nuclear genes, regulated by these photoreceptors (Susek et al., 1993; Kohchi et al., 2001). Recently, a direct link between plastid signals mediated by MG-ProtolIX were shown to negatively affect expression of photosynthesis-associated nuclear genes, through HY5 - a global regulator of light signal transduction and photomorphogenesis, and a direct regulator of MYB75 expression. 1.13 Global regulators of light-driven gene expression  Two classes of global gene-expression regulators controlled by photoreceptor activity include a group of bHLH proteins called phytochrome interacting factors (PIFs) and the bZIP-family transcription factor LONG HYPOCOTYL 5 (HY5). In the dark HY5 is targeted for degradation by COP/SPA ubiquitin ligase complexes (Osterlund et al., 2000; Saijo et al., 2003). Exposure to light and photoreceptor activation, allows HY5 to accumulate and drive light-dependent development. During seedling development HY5 acts as a positive regulator of photomorphogenesis in the light, inhibiting hypocotyl elongation, while promoting cotyledon expansion and chloroplast biogenesis, leading to greening of plant tissues and establishment of autotrophy (Oyama et al., 1997). Conversely, PIFs are important in driving processes such as 27  skotomorphogenesis (plant development in the dark), and shade avoidance in suboptimal light conditions. PIFs accumulate in the dark and act primarily as negative regulators of light-driven developmental programs: PIFs can inhibit seed germination (Piskurewicz et al., 2009), cotyledon expansion, chlorophyll biosynthesis (Huq et al., 2004; Chen et al., 2013) and plastid development (Barnes et al., 1996; Stephenson et al., 2009), while promoting hypocotyl elongation (Reviewed in Castillon et al., 2007 and Leivar and Monte, 2014). In the dark PIFs accumulate and drive global changes in gene expression. In the light, activated phytochromes (Pfr) can bind and phosphorylate PIFs, leading to their degradation (Al-Sady et al., 2006), or, in some cases, disruption of transcriptional activity or binding to target promoters (reviewed in Leivar and Monte, 2014). Overall, PIFs have a growth-promoting function in plants, which drives the rapid extension of the hypocotyl during etiolation and stem growth during shade avoidance, as well as growth and development throughout the lifecycle of the plant.  Although initially PIFs and HY5 were defined by their light-responsive functions, the last two decades of research have unveiled their participation in a broad range of developmental processes. HY5 has been linked to the action of different hormones, including ethylene (Yu et al., 2013), brassinosteroids (Li and He, 2016; Shi, 2011), auxin and cytokinin (Cluis et al., 2004), and as a result is implicated in a broad spectrum of developmental functions throughout the life of the plant.  PIFs have been shown to act as communication lines between light signals and circadian clock (reviewed in Hayama and Coupland, 2003; Shin et al., 2013). The ability of PIFs and HY5 to regulate a wide spectrum of genes depends largely on their ability to form complexes with other transcriptional regulators (reviewed in Castillon et al., 2007; Gangappa and Botto, 2016).  28  Both HY5 and PIF3 can positively regulate anthocyanin biosynthesis on exposure to light, by binding to promoters of anthocyanin biosynthetic genes, in a HY5-dependent manner (Shin et al., 2007). Crucially, HY5 was shown to positively regulate MYB75 expression by directly binding to its promoter (Shin et al., 2013). 1.14 Possible role of MYB75 in light signalling    MYB75 is already known to be part of the light signalome as it is a direct transcriptional target of HY5, and is turned over in the dark, through ubiquitination mediated by COP/SPA complexes, which are known to promote degradation of various light-responsive transcription factors, including HY5 (Osterlund et al., 2000; Saijo et al., 2003; Maier et al., 2013). The participation of MYB75 in light responses is intuitive, as anthocyanins provide a photoprotective screen for the photosynthetic machinery and other cellular components by absorbing excess photons. Regulation of anthocyanin production through MYB75 is therefore an important dimmer switch that dictates how much light reaches the photosynthetic machinery.  A recent publication demonstrated that MYB75 phosphorylation by MPK4 at threonines 126 and 131 is necessary to stabilize MYB75, enabling it to drive anthocyanin biosynthesis (Li et al., 2016). The study showed that far red light was responsible for MPK4 activation, which also appeared to activate MPK3 and MPK6. While our data contradicts some of their conclusions (to be addressed later in this thesis), activation of multiple MAP kinases by far red light, is congruent with our findings that MYB75 phosphorylation status may help define additional roles of MYB75 in developmental processes connected to light signals.   The Ellis lab has pioneered the idea that MYB75 participates in developmental processes beyond anthocyanin production by demonstrating that MYB75 can negatively impact secondary 29  cell wall biosynthesis (Bhargava et al., 2010). This discovery is in stark contrast with dozens of papers that type-cast MYB75 as solely a regulator of anthocyanin production, and demonstrates an ongoing paradigm shift in science, where increasing connectivity between different biological processes reveals increasing multi-functionality of their regulators.  1.15 Research Objectives The main research goal in this thesis is to determine how phosphorylation of MYB75 affects its function and describe the impact of this phosphorylation event on plant growth and development. The primary tools used in this body of work are the phosphovariant mutants described earlier. The first part of the project required determining that MYB75 can in fact bind to and be phosphorylated by one or several of the 20 Arabidopsis MAP kinases. The second part of the project focused on determining how phosphorylation affects various aspects of MYB75 function in different phosphorylation states, using MYB75 phosphovariants. MYB75 protein localization, stability, and interaction with known binding partners were tested. Subsequently, I set out to describe the impact of MYB75 phosphorylation on its function in-vivo, using Arabidopsis plants expressing different MYB75 phosphovariants from the endogenous MYB75 and constitutive 35S promoters. Functionality of each phosphovariant was primarily evaluated with respect to anthocyanin biosynthesis, however, notable changes in development were also observed and recorded.    30  CHAPTER 2  MYB75 interaction with Arabidopsis MAP kinases, in vitro phosphorylation, and differences in protein function among MYB75 phosphovariants  2.1 Introduction  In depth exploration of how phosphorylation affects MYB75 function, requires prior demonstration that MYB75 is in fact phosphorylated, and determining which of the 20 Arabidopsis MAP kinases are able to phosphorylate each putative target site. MYB75 has two canonical MAPK phosphorylation sites at threonines 126 and 131; the phosphopeptide containing these residues has been identified by mass spectrometry (Li et al., 2016). In this chapter I demonstrate that MYB75 is a target for phosphorylation by several Arabidopsis MAP kinases in vitro. This chapter will also explore how this phosphorylation can impact the function of MYB75, in terms of subcellular protein localization, the physical interaction of MYB75 with known binding partners, and the protein’s stability. A recent paper, which was published while I was completing this thesis, demonstrated that MYB75 was phosphorylated by MPK4. The authors showed that both threonines T126 and T131 were target sites for phosphorylation by MPK4 and that phosphorylation at these residues stabilized MYB75 protein in vivo (Li et al, 2016). The results presented by Li et al., (2016) contradict some our findings; these differences as well as possible explanations for such discrepancies will be addressed in the discussion.   2.2 MYB75 interaction with Arabidopsis MAP kinases in yeast  Phosphorylation events catalyzed by MAP kinases require a physical interaction between the MAP kinase and its intended target protein. In order to determine which MAP kinases might be involved in phosphorylating MYB75, a directed yeast two-hybrid screen was 31  conducted, testing the interaction between MYB75 and each of the 20 Arabidopsis MAP kinases. The results of the Y2H screen indicated that MYB75 was able to interact with several MAP kinases in vitro (Fig 2.1). Interestingly, a few MAP kinases, particularly MPK4 and MPK11 displayed background reporter gene activation in yeast; yeast colonies in the control lanes for these MPKs appear light pink rather than red when growing on SD-trp-leu culture medium and they survived on medium without histidine containing up to 1mM 3AT. Despite this background signal, the strength of MYB75’s interaction with each MAP kinase could be assessed on selective media with higher stringency (higher 3AT concentration). Survival of yeast cells on drop-out media lacking histidine, under higher concentrations of 3AT (2.5mM-10mM), as well as on medium lacking adenine, indicated that the strongest interacting partners of MYB75 were MPK3, MPK10, MPK11, MPK13, MPK14 and MPK20. Moderate interaction strength was observed for MPK6, MPK10, MPK18 and MPK19, while weak binding was seen in MPK1, MPK2, MPK4, MPK7 and MPK17. MYB75 did not interact with MPK5, MPK8, MPK9, MPK12, MPK15 or MPK16 in this assay.  This apparent MYB75 binding promiscuity made it difficult to narrow down the search for possible pathways that might connect MAP kinase signalling with MYB75 function. While biological functions have been demonstrated for some of the strong or moderate interactor MPKs (e.g MPK3, 6, 18), for others (e.g. MPK13, 14, 19 and 20) there is little or no information in the literature. Since preliminary experiments in our laboratory had demonstrated that a small subset of the strong/moderate interacting MPKs (3, 4, 6 and 11) might directly phosphorylate recombinant MYB75 in vitro, further experiments focused on these MAP kinases. Although MPK4 showed only a weak interaction with MYB75 in my yeast 2-hybrid screen, it was 32  included in the more detailed in vitro phosphorylation assays because it is a very close paralog of MPK11 (a strong interactor). Furthermore, much like MPK3 and MPK6, MPK4 has been relatively well studied, and implicated in signalling, in response to biotic and abiotic stress (reviewed in Rodriguez et al., 2010).   33   Fig. 2.1 MYB75 interacts with several Arabidopsis MAP kinases in yeast. MYB75 interaction with each of the 20 Arabidopsis MAP kinases was tested in a yeast two-hybrid system, using MYB75 cDNA fused to GAL4-AD and each MAP kinase fused to GAL4-DBD. The interaction strength was evaluated visually, based on colony colour when grown on medium lacking leucine and tryptophan, and by evaluating survival on media lacking histidine, with addition of 1-25mM 3-aminotriazole (3AT), and on medium lacking adenine. Negative control rows (-) display results of MPK-DBD co-transformed with the empty pGADT7 (AD) vector. Rows (+) are results from co-transformation of MYB75-AD and MPK-DBD. MYB75 displays a strong interaction with MPK3, MPK11, MPK13, MPK14, and MPK20, moderate strength interaction with MPK6, MPK10, MPK18, and MPK19, and only a weak interaction with MPK1, MPK2, MPK4, MPK7 and MPK17.  Fig 2.1 34  2.3 In vitro phosphorylation of MYB75 by MPK3, MPK4, MPK6 and MPK11  Among the 20 Arabidopsis MPKs the best studied family members are MPK3, MPK4 and MPK6. These three MPKs, are known to be involved in signalling responses to biotic and abiotic stresses, and such stresses are often accompanied by increased anthocyanin accumulation in stressed plant tissues. This correlation made these members of the MPK family plausible candidates for MYB75-modifying kinases. MPK3 and MPK6 are closely related paralogs that often (but not always) share the ability to mediate the same signalling responses (reviewed in Rodriguez et al., 2010). MPK4 and MPK11 form another pair of closely related paralogs, however, despite sharing 87% amino acid sequence similarity, there is little evidence that the biological roles of MPK4 and MPK11 overlap. While mpk4 mutants display severe developmental defects, including dwarfism and partial male sterility, mpk11 mutants appear relatively normal (Petersen et al., 2000; Zeng et al., 2011). Furthermore, expression of the MPK11 coding sequence under the control of an MPK4 promoter in an mpk4 knock-out background failed to complement the mpk4 loss-of-function phenotype, indicating that there is no apparent functional overlap between these MAP kinases (Zeng et al.,2011). Nevertheless, the strong amino acid sequence similarity between MPK4 and MPK11 suggests that some similarities in terms of function or target specificity may exist. When Dr. Zhenhua Yonge in our laboratory began to explore the possibility that MYB75 might be phosphorylated by Arabidopsis MAP kinases, she conducted a directed yeast two-hybrid screen using the Invitrogen Proquest® kit. With this system, she found that MPK11 was the only MAP kinase able to interact with MYB75. She then tested four MAP kinases (MPK3, 4, 6 and 11) to determine if they a) can 35  phosphorylate recombinant MYB75 in vitro, b) whether phosphorylation is occurring at one or both of the two canonical PXT sites in MYB75, and c) whether there was any evidence for a preferential phosphorylation by each MPK for either of the two target site threonines. Dr. Yonge showed that recombinant GST-tagged MYB75 can indeed be phosphorylated by all four MAP kinases tested (Fig 2.2). In addition, when mutated forms of MYB75 were tested, in which either the T126 or T131 residue, or both, were replaced with alanine, it was apparent that T131 was the preferred site of phosphorylation for all four MAP kinases (Fig 2.2). With the knowledge that MYB75 can interact physically with MPKs and can serve as an in vitro substrate for MPK phosphorylation, my next goal was to understand the impact of such a phosphorylation event on MYB75 function.           36                   Fig. 2.2 In vitro phosphorylation of MYB75 by Arabidopsis MPK3, MPK4, MPK6 and MPK11. Recombinant proteins with a GST tag (MYB75, MAP kinases 3,4,6 and 11, as well as CAMKK6 and CAMKK9) were expressed in E. coli (BL21) and recovered from bacterial cell extracts using glutathione-sepharose® 4B beads. The in vitro phosphorylation assay was performed by combining each MPK with MYB75 in the presence of radiolabelled [Ƴ-32P] ATP, and a ‘constitutively active’ MAP kinase kinase (CAMKK). Wild type MYB75 was used, along with point mutants where threonine 126, threonine 131, or both, was replaced with alanine, preventing phosphorylation at this site. X-ray film was used to detect signal from radiolabelled phosphate. The pattern of autoradiogram signals indicates prominent phosphorylation by all four MAP kinases, of wild type MYB75 and of MYB75T126A, with only negligible signal in lanes with the MYB75T131A mutant forms. Red * indicate background bands present in all samples.  Fig 2.2 CAMKK9 + MPK3 +MYB75   MYB75 MYB75 CAMKK6 + MPK6 +MYB75  CAMKK6 + MPK4 +MYB75  MYB75 CAMKK6 + MPK11 + MYB75  MYB75 WT T126A T131A T126/131A WT T126A T131A T126/131A WT T126A T131A T126/131A WT T126A T131A T126/131A * * * * * 37  2.4 Impact of MYB75 phosphorylation on protein function  Post translational modification through phosphorylation can affect many different classes of proteins, including enzymes, membrane receptors, ion channels, structural and regulatory proteins (reviewed in Ranjeva and Boudet, 1987; Johnson, 2009; Nishi et al., 2011). At the molecular level, phosphorylation results in the addition of a large electronegative phosphate group to a specific site, which leads to topological and electromagnetic changes near that site. Phosphorylation can also result in large-scale conformational changes in the protein, ranging from localized shifts in secondary structure to dramatic, long range conformational changes, such as disorder-to-order and order-to-disorder transitions (Groban et al., 2006; Nishi et al., 2011; Bah et al., 2015). In summary, phosphorylation impacts protein function by modifying the physiochemical properties of the target site, and/or by causing a conformational change that leads to the exposure or blockage of features important for the functionality of the protein.   The impact of phosphorylation on a particular aspect of protein function can potentially be either positive or negative, while the type of functions which phosphorylation can affect are as diverse as the classes of proteins subject to this form of post translational regulation. In transcription factors, phosphorylation plays an important role in nucleocytoplasmic shuttling, by mediating exposure or blockage Nuclear Localization and/or Nuclear Export Signal sequences (NLS and NES respectively). Phosphorylation can affect NLS and NES exposure through inducing intrinsic conformational changes in the transcription factor itself, or by promoting or inhibiting interactions of the modified protein with binding partners that affect accessibility of these sequences (reviewed in Whitmarsh and Davis 2000; Endt et al 2002). In this manner, by 38  inducing nuclear translocation or cytosolic sequestration, phosphorylation can control the ability of a transcriptional regulator to reach target promoters and modify gene expression. In addition to altering target protein localization, the DNA binding activity of transcription factors can also be affected by phosphorylation. Typically, if the phosphorylation site is directly located in the DNA binding domain, addition of a negatively charged phosphate group has an adverse effect on the protein-DNA interaction (Smykowski et al., 2015; reviewed in Meshi and Iwabuchi, 1995; Whitmarsh and Davis, 2000; Endt et al., 2002). However, in many cases phosphorylation has been shown to have a positive impact on DNA-binding activity of transcriptional regulators, enhancing the interaction between the transcription factor and a specific cis-element in the target promoter sequence (Menke et al., 2005; reviewed in Ishimara and Yoshioka, 2012). Phosphorylation can also directly impact transcriptional activity. An example of this is the xylem-specific PtMYB4, found in pine, which is phosphorylated on a serine residue located in its transcriptional activation domain. The ability of recombinant phosphomimic mutant PtMYB4 to drive transcription of reporter genes, in yeast, was reduced compared to a wild type version of the recombinant protein, while the DNA-binding activity of the MYB was not affected (Morse et al., 2009).  In some cases phosphorylation affects protein stability, indirectly, by influencing protein-protein interactions. Some protein-protein interactions can have a stabilizing effect on one or both interacting partners, whereas others promote degradation. For instance, Ubiquitin ligases bind their target proteins; this interaction is necessary for target protein polyubiquitination and subsequent degradation by the 26S proteasome (reviewed in Whitmarsh and Davis, 2000; Endt et al., 2002). Prominent examples of this mode of regulation 39  in plants include the phosphorylation of light-regulated components, HY5 and phytochrome interacting factors (PIFs). In the case of HY5, phosphorylation was shown to interfere with the binding of HY5 to COP1 protein (Hardtke et al., 2000). Since the interaction with COP1 leads to HY5 polyubiquitination and degradation (Osterlund et al., 1999), phosphorylation has a stabilizing effect on HY5 (Hardtke et al., 2000). Conversely, light induced PIF1 phosphorylation promotes its binding to the CUL4 COP1-SPA E3 ubiquitin ligase complex, which leads to polyubiquitination and rapid degradation of PIF1 (Zhu et al., 2015). Protein-protein interactions can thus influence multiple aspects of protein function while in turn, phosphorylation can significantly impact protein-protein interactions (reviewed in Whitmarsh and Davis, 2000; Endt et al., 2002; Ishimara and Yoshioka, 2012; Johnson, 2009; Nishi et al., 2011). For transcription factors that participate in combinatorial control of gene expression, phosphorylation can define which transcriptional complexes form, by enhancing or suppressing interactions between specific transcriptional complex components, thus influencing the ability of the complex to drive the expression of a specific subset of genes (Shen et al., 2003; reviewed in Nishi et al., 2011; Chi et al., 2013). In addition, phosphorylation can modulate the interaction between transcription factors and other regulatory proteins, such as binding partners that block the ability of a transcriptional regulator to bind to target promoters or initiate transcription (reviewed in Whitmarsh and Davis, 2000; Endt et al., 2002; Ishimara et al., 2011; Chi et al., 2013).   The goal of the experiments described below was to better understand how phosphorylation might affect MYB75, in terms of the localization of the protein, its turnover, 40  and its ability to bind known interacting partners. In these experiments phospho-analogues of MYB75 (phospho-null MYB75T131A, and phosphor-mimic MYB75T131E) were used to model unphosphorylated and permanently phosphorylated MYB75 protein, respectively.  2.4.1 Impact of phosphorylation status on MYB75 localization  The main function of transcription factors is to drive expression of target genes from specific promoters. Accessing these target promoters requires localization of the transcription factor to the appropriate cellular compartment. In the case of MYB75, whose known target genes are found in the nuclear genome, localization of the protein to the nucleus is essential for performing its main function. In eukaryotes, the selective import of proteins into the nucleus requires active transport through the Nuclear Pore Complex (NPC), which begins with the physical interaction between the protein designated for nuclear import and the NPC (reviewed in Hicks et al., 1993; Lange et al., 2006; McGonigle et al., 2017). In order to bind to parts of the cellular machinery that mediate nuclear import, a cargo protein must possess a nuclear localization signal (NLS). Unlike some transport-related signal peptides, NLSs are not cleaved upon translocation to the nucleus, which means that the signal sequence can be located anywhere in the protein sequence. Animals, plants and fungi use similar NLS signal peptides. In plants, three main NLS types that have been well characterized, a) SV40-like sequences consisting of a single short stretch of basic amino acids (e.g. PKKKRKV); b) bipartite sequences, which contain two short stretches of basic amino acids (R/K) separated by ~10 undefined residues, and c) MAT α2-like NLS (K/RIPIK/R) which contains basic residues within a short stretch of hydrophobic amino acids (reviewed in Raikhel, 1992; Varagona et al., 1992; Carrington et al., 1991; Smith et al., 1997). In addition, six other classes of NLS types have been 41  identified which bind importin-α, a key component of nuclear import machinery found in plants, animals and fungi (Smith et al., 1997; Hϋbner et al., 1999; Kosugi et al., 2009). However, nuclear localization can be challenging to predict simply by looking at the amino acid sequence, as NLSs are loosely conserved, defined largely by the presence of short stretches of basic amino acids. Furthermore, nuclear localization of a protein is thought to involve multiple protein-protein interactions (for an example in plants, see McGonigle et al., 2017). MYB75 contains several NLS’s, including two classical bipartite sequences and two importin-α binding sites (Fig 2.3 A and B). None of these NLS sequences-overlap with the proposed phosphorylation sites, threonine 126 or 131, although one of bipartite NLSs is very close, ending at amino acid 123 (Fig 2.3 A and B).   Nuclear localization of wild type MYB75 has been previously demonstrated in Arabidopsis protoplasts (Bhargava et al., 2010). However, little is known about the mechanism of MYB75 nuclear localization, or how that process is regulated. In order to assess whether the phosphorylation status at threonine 131 can affect MYB75 protein localization, each MYB75 phosphovariant was fused C-terminally to Green Fluorescent Protein (GFP) and introduced into N. benthamiana epidermal cells using Agrobacterium-mediated infiltration, for transient expression. This experiment was performed by Dr. Xiaomin Liu. Visualization of the transformed cells by fluorescence microscopy revealed that WT, T131A and T131E versions of MYB75 all localized to the nuclei of the epidermal cells, as is evident from the co-localization of the green GFP signal with DAPI nuclear label (Fig 2.3). While this was only a preliminary experiment, conducted at relatively low resolution, Dr. Liu’s data suggest that phosphorylation at threonine 131 does not have any obvious effect on MYB75 subcellular localization.  42        Fig 2.3 43  Fig 2.3 Nuclear localization of MYB75WT, MYB75T131A and MYB75T131E in N. benthamiana epidermal cells. MYB75 has several nuclear localization sites, including two bipartite sequences (A), and two α–importin binding sites (B). Each of the MYB75 phosphovariants was C-terminally fused to GFP and introduced into Agrobacterium tumefaciens strain GV3103. Mature leaves of 3-week old N. benthamiana plants were infiltrated with A. tumefaciens culture carrying each of the GFP-fused MYB75 phosphovariants. Two days after infiltration, the leaves were mounted in water and visualized using Zeiss Pascal Scanning confocal microscope. MYB75WT, MYB75T131A and MYB75T131E all show nuclear localization, as GFP signal co-localized with DAPI nuclear stain (C).   2.4.2 Impact of MYB75 phosphorylation on protein-protein interactions with known binding partners  MYB75 function in vivo is thought to be largely defined by its protein interaction network which includes the formation of regulatory complexes with several bHLH partners and TTG1, to drive expression of flavonoid biosynthetic genes (Gonzalez et al., 2008). Interaction between MYB75 and TCP3 promotes the formation of the MYB/bHLH/WDR complex and enhances transcription of flavonoid biosynthetic genes (Li and Zachgo, 2013), while binding to JAZ1 and JAZ8 proteins has the opposite effect (Qi et al., 2011). MYB75 also interacts with KNOX-homeodomain transcription factor, KNAT7, to negatively regulate secondary cell wall biosynthesis (Bhargava et al., 2013). Finally, MYB75 transcript turnover is diurnally regulated (Pan et al,m 2009) and it can be hypothesized that the size of the intracellular pool of MYB75 protein is therefore also likely to oscillate. Indeed, turnover of MYB75 in the dark has been shown to be mediated by its interaction with SPA1, SPA3 and SPA4, which leads to polyubiquitination of MYB75 by the COP-SPA complex and degradation by the 26S proteasome (Maier et al., 2013).  The domains of MYB75 which participate in different types of protein-protein interaction have been defined for some, but not all of its known binding partners (Fig 2.4). For 44  instance, a detailed characterization of MYB-bHLH interaction has led to the identification of a specific motif and key residues, within the R3 domain of several MYB proteins (including MYB75), that are vital for interaction with bHLH transcription factors. (Fig 2.4 B) (Zimmermann et al., 2004). Interestingly, the R3 domain was also shown to be important for interaction of MYB75 with KNAT7 (Bhargava et al., 2013). JAZ1 and JAZ8 proteins were reported to bind to the C-terminal half of MYB75 (Fig 2.4 C), but in this case, the authors did not narrow down this interaction down to a specific domain (Qi et al., 2011). The specific domain(s) of MYB75 required for interaction with TCP3, SPA1, SPA3 and SPA4 are unknown.            45    Fig 2.4 Linear representation of MYB75 amino acid sequence depicting different domains. The DNA binding domain is located near the N-terminus, and contains the R2R3 repeats, while the transcriptional activation domain lies in the last 58 amino acid of the C-terminus (A). The sequence required for binding to bHLH partners lies in the R3 domain of MYB75; the consensus sequence essential for the interaction with these partners is indicated, with key residues highlighted in blue (Zimmermann et al., 2004) (B). (C). JAZ1 and JAZ8 are known to bind broadly to the C-terminal portion of MYB75, amino acids 111-248 (Qi et al., 2011) (C). The R3 repeat region is required for interaction with KNAT7 (Bhargava et al., 2013). Red asterisks indicate the location of the phosphorylation sites T126 and T131 (D).  To assess whether MYB75 phosphorylation status affects any of the known MYB75 protein-protein interactions, a directed yeast two-hybrid screen was conducted, using each of the MYB75 phosphovariants as prey and most of the MYB75 interacting partners as bait. The Fig 2.4  46  only known interacting partner that was not included in the screen was SPL9; it was ultimately omitted due to time constraints and technical difficulties in cloning this gene into the pGBKT7 vector. The results of the yeast two-hybrid screen indicated that the interacting partners tested can bind all phosphovariants of MYB75 with equal affinity, with the exception of TCP3, which appeared to have a slightly weaker interaction with MYB75T131E (Fig 2.5). Since TCP3-DBD displayed a high level of auto-activation in yeast, the strength of its interaction with MYB75 had to be assessed in higher stringency medium. Fig 2.5 (B) shows reduced growth of yeast colonies where TCP3-DBD was co-transformed with MYB75T131E-AD compared to those co-transformed with MYB75 WT-AD, in drop out medium lacking histidine, but supplemented with 25mM 3AT. These data suggest that phosphorylation at T131 may weaken the ability of MYB75 to bind TCP3, an effect that may, in turn, interfere with the ability of TCP3 to induce the formation of the MYB-bHLH-WDR complex.    47     Fig 2.5 48  Fig 2.5 Interaction between different phosphovariants of MYB75 and its known binding partners, in yeast. MYB75 interaction with previously described binding partners was assessed in a Y2H screen, using MYB75 cDNA (WT and all phosphovariants) fused to GAL4-AD and each MYB75 binding partner fused to GAL4-DBD. The results in panel (A) indicate that the majority of partner proteins interact with all phosphovariant forms of MYB75 with equal affinity, except TCP3, which displayed a weaker interaction with MYB75T131E. Panel (B) shows additional TCP3 test colonies growing on drop-out medium without histidine and with 25mM 3AT added, where yeast in which TCP3 was co-transformed with MYB75T131E displays reduced growth compared to TCP3 co-transformation with MYB75WT. 2.4.3 Impact of MYB75 phosphorylation on protein turnover in Arabidopsis seedlings In eukaryotes, several mechanisms of protein turnover exist which differ in terms of target specificity and method of degradation; three of the major pathways are autophagy, proteasomal degradation of polyubiquitinated proteins and cleavage by specific proteases.  Autophagy is a recycling system, involved in turnover of cellular debris, multi-molecular complexes, organelles and proteins, primarily for nutrient remobilization. In plants and yeast this process involves sequestration of cytosolic components destined for degradation in small membrane-bound vesicles called, autophagosomes, which deliver their contents to the central vacuole where they are degraded by hydrolases (reviewed in Araújo et al., 2011; Li and Vierstra, 2012; Izumi et al., 2013). Proteins destined for degradation by autophagy can also be targeted to the vacuole by chaperones, with a higher degree of target specificity. However, although this mechanism has been established in animals, it has not yet been described in plants (reviewed in Li and Vierstra, 2012).  Polyubiquitination and degradation of proteins by the 26S proteasome is a mechanism that plays a vital role both in recycling of misfolded proteins and in degradation of specific 49  protein targets (reviewed in Moon et al., 2004; Vierstra, 2009). Ubiquitin is a 76 amino acid polypeptide that can be polymerized into polyubiquitin chains by E1 and E2 ubiquitin ligases, and covalently linked to a target protein by E3 ubiquitin ligases. The specificity displayed by this pathway depends on the ability of a particular E3 ubiquitin ligase to bind to a specific target protein. As previously described, SPA1, SPA3, and SPA4 are E3 ubiquitin ligases that bind to MYB75 and mediate its degradation in the dark (Maier et al., 2013).   Plant proteases constitute another major mechanism of target-specific protein cleavage and degradation. Over 600 proteolytic enzymes have been identified in Arabidopsis, and many have been functionally characterized, although determination of in vivo target specificity remains a challenge. Proteases play a vital role in different aspects of development as well as response to environmental stimuli and stress, with perturbations in the expression of some proteases leading to lethal consequences for the plant (reviewed in Schaller, 2004; Van der Hoorn, 2008). Proteases recognize short peptide sequences and cleave the substrate proteins at specific amino acids within that site. The affinity of a protease for a particular target site can be affected by charge, polarity, pH, hydrophobicity and steric properties of the proteolytic substrate (Gu and Walling, 2000; Galiullina et al., 2015). Furthermore, the substrate specificity of many proteases is ensured through their localization to specific cellular compartments where their targets are present (reviewed in Gu and Walling, 2000; Schaller, 2004; Van der Hoorn, 2008). To date, the only specific proteolytic mechanism known to be associated with MYB75 turnover is polyubiquitination of MYB75 by COP-SPA complexes in the dark.  50    To determine if phosphorylation can affect MYB75 turnover, a time-course protein degradation assay was conducted, using Arabidopsis seedlings transformed with either wild type MYB75 or the phosphomimic MYB75T131E gene, both with an N-terminal 3xHA tag, expressed under the control of a DEX-inducible promoter. The assay was performed using small pools of seedlings incubated in 24 well plates, (~20-40 seedlings per well), containing liquid ½MS medium. To maximize protein accumulation, 11-day old seedlings were incubated for 24 hours in medium containing dexamethasone (DEX), which induced expression of the transgene, plus the MG132 proteasome inhibitor, which would prevent degradation of the newly synthesized 3xHA:MYB75 protein. After a period of induction, further protein translation was blocked via subsequent treatment with cycloheximide (CHX), and total protein was extracted from pooled samples of ~20-40 seedlings at different time points. The level of recombinant 3xHA:MYB75 protein in each pool of seedlings was assessed using western blot analysis and ImageJ quantification of the blot signals.  The results revealed a distinct difference in stability between the wild type and the T131E versions of 3xHA:MYB75, where MYB75T131E was degraded much faster than its wild type counterpart (Fig 2.6). Both versions of the protein accumulate to comparable levels at the time of cycloheximide application (Fig 2.6 A, 0 hours), but after four hours MYB75T131E was no longer detectable in the western blot, while the wild type protein remained abundant. The assay was repeated at least three times (see appendix for additional western blots), and while the absolute levels of protein detected could vary from one experiment to another at most time points, the pattern of more rapid degradation of the 3xHA:MYB75T131E was observed in all replicates. Since the degradation experiment was performed under conditions of continuous 51  light, it is unlikely that COP-SPA complexes are involved in this differential degradation of MYB75T131E. That interpretation is supported by the yeast two-hybrid data which demonstrated that the strength of interaction between MYB75 and SPA1, SPA3 or SPA4 is not affected by the phosphorylation status of the MYB75 protein (Fig 2.5). Together these data indicate that another protein turnover mechanism may be acting on MYB75, and that, at least under these conditions, MYB75T131E is more susceptible to this type of degradation.              52     Fig 2.6 53  Fig 2.6 Degradation of MYB75WT and MYB75T131E in Arabidopsis seedlings. MYB75T131E is degraded more rapidly than MYB75WT, in 12-day-old Arabidopsis seedlings, treated with cycloheximide (CHX), in liquid ½MS medium under continuous light. The protein degradation assay was performed using heterozygous Arabidopsis seedlings expressing N-terminal, 3xHA-tagged MYB75 (WT or T131E), under the control of a DEX-inducible promoter. Seedlings were grown on ½MS agar medium with 30µg/ml Hygromycin, under light fluence of ~35 µmol m-2 s-1, and 16h light/8h dark photoperiod. Ten days after germination, hygromycin-resistant seedlings were transferred to 24 well plates, containing liquid ½MS medium, with ~20-40 seedlings per well. Recombinant MYB75 protein expression was induced by addition of 30µM DEX, with overnight incubation under continuous light, in the presence of 50µM MG132 proteasome inhibitor, to prevent protein degradation. The following day, the DEX/MG132-containing medium was removed and replaced with liquid ½MS containing 1mM CHX. Each well was harvested at a specific time point, immediately before (0h) and after (1h, 2h, 4h and 8h) addition of CHX. The seedlings were ground in liquid nitrogen and resuspended in a proportional amount of 2xSDS loading buffer. Western blot analysis was performed to detect the relative amount of recombinant MYB75 protein, present in the seedlings at each time point. Recombinant MYB75 was detected with anti-HA antibody (left panel), and the Ponceau-stained membrane was used to evaluate relative amounts of total protein loaded in each well (right panel) (A). Plot of MYB75 protein levels overtime, quantified using band intensities generated in western blots and analyzed with ImageJ software, with each western blot signal normalized to Ponceau background signal in the corresponding lane (B). Additional replicates displayed in the appendix Fig S2.2.              54      Fig 2.7 Heterozygous Arabidopsis lines (T2) carrying DEXpr:3xHA:MYB75 constructs, 48 hours after application of DEX.  Heterozygous lines carrying recombinant MYB75 gene tagged with a 3xHA tag, under the control of a DEX-inducible promoter, were selected from a pool of T1 plants which displayed anthocyanin production 24-48 hours after DEX application.  Four independent lines were isolated for each DEXpr:3xHA:MYB75WT and DEXpr:3xHA:MYB75T131E, all of which displayed patches of bright purple color after DEX application and abundant accumulation of recombinant MYB75 protein. DEXpr:3xHA:MYB75T131A could not be isolated. Fig 2.7 55  The DEX-inducible lines used in this assay were initially isolated based on visible anthocyanin accumulation in T1 plants after application of DEX to adult transformants growing on soil. These T1 plants showed anthocyanin accumulation in rosette leaves, manifested as purple colouration, approximately 48h after application of DEX (Fig 2.7). Plants showing this purple phenotype had MYB75 protein expression levels which could be readily detected by western blot. Curiously, none of these lines showed visible signs of anthocyanin accumulation after DEX induction in the seedling stage, i.e. under the conditions used in this protein degradation assay, despite expressing substantial amounts of recombinant MYB75 protein. It therefore appears that the experimental conditions employed in this degradation assay somehow prevented anthocyanin accumulation in seedlings, whereas DEX-induced MYB75 expression in soil-grown mature plants, led to abundant anthocyanin production. This observation prompted further exploration of how MYB75 protein stability and function might be affected by different environmental conditions in vivo, and the resulting consequences for anthocyanin production.  2.5 Discussion  In discussing the experimental results presented above, it is important to address the details of the recently published work on MYB75 phosphorylation by MPK4 (Li et al., 2016), particularly the differences between their results and ours. Many of the differences between our findings and those of Li et al., (2016) can probably be attributed to the tools employed in the two studies, starting with their use of a mutant ‘constitutively active’ form of MPK4 (CA-MPK4), which contains two amino acid substitutions (D198G/E202A). The authors initially identified MYB75 as a possible target of MPK4 phosphorylation by conducting a yeast two-56  hybrid screen using the CA-MPK4 protein as bait and an Arabidopsis cDNA library as prey. According to their data, and contrary to ours, the native form of MPK4 did not interact with MYB75 in yeast. While yeast two-hybrid screening is a powerful tool for identifying putative protein-protein interactions, it can display a great deal of variability, as stringency and sensitivity of the assay differs between different yeast two-hybrid kits, and between the yeast strains used in a given experiment. We observed this in our own work: when Dr. Zhenhua Yonge initially started working on this project, she conducted a directed yeast two-hybrid screen using the Invitrogen Proquest ® kit. In this system, only MPK11 could interact with MYB75 (unpublished observations). When I repeated the directed yeast two-hybrid experiment using the Clontech Matchmaker® system, I was able to corroborate Dr. Yonge’s data, showing that MYB75 interacted strongly with MPK11. However, I also observed that MYB75 interacted very strongly with MPK3, MPK13, MPK14 and MPK20, and showed a moderate level of interaction with MPK6, MPK10, MPK18 and MPK19. In the work reported by Li et al., (2016), the yeast two-hybrid experiments were conducted using Clontech Matchmaker® Gold kit, which is an updated version of the Matchmaker® kit used in my work. While the basic constructs employed by Clontech kits are the same, the yeast strains and the selectable markers have distinct differences. In my work, I used histidine and adenine deficiency as the primary selectable markers to identify interactions, and increasing stringency of selection using 3AT to evaluate interaction strength. In contrast, the authors of Li et al., (2016) used serial dilutions of their yeast cultures to demonstrate interaction strength. Furthermore, the Y2HGold yeast strain, employed in their study contains an additional selectable marker, namely resistance to Aureobasidin antibiotic, which is activated upon positive bait-prey interaction. Together, these 57  technical differences could potentially explain why I was able to identify a broad range of MYB75 interacting partners, among the 20 native Arabidopsis MAP kinases.  A major information gap in my work is the lack of in vivo data to corroborate our yeast two-hybrid results. Li et al., (2016) demonstrated that MYB75 could interact in N. benthamiana epidermal cells with both CA-MPK4 and native MPK4, but not with a mutated kinase-inactive form of MPK4 (T201A/Y203F), using a Bimolecular Fluorescence Complementation (BIFC) assay and co-immunoprecipitation (CO-IP) of MPK4 using HA-tagged MYB75 (Li et al., 2016, Fig 1 B and C). Their results suggest that either N. benthamiana can activate some of the transgenic MPK4 from Arabidopsis, or that MYB75 has some affinity for native MPK4 in vivo.   Our data also differ from the findings reported by Li et al., (2016) with respect to the in vitro phosphorylation of MYB75 by MAP kinases. According to the data generated by Dr. Zhenhua Yonge, and subsequently corroborated by Dr. Xiaomin Liu in our lab, MYB75 phosphorylation by MPK3, MPK4, MPK6 and MPK11 occurs almost exclusively at threonine 131 (Fig 2.2). In contrast, Li et al., (2016) demonstrated that both threonine 126 and 131 are phosphorylated by CA-MPK4 in vitro (Li et al., 2016, Fig 5A). Once again, there are several technical differences between our experiments and those described by Li et al., (2016). In our lab, MYB75 was N-terminally fused to glutathione S-transferase (GST). The protein was produced in E. coli and purified in vitro, then combined with each recombinant MAPK in the presence of radiolabelled ATP and a constitutively active recombinant MKK (see Material and Methods). In Li et al., (2016), MYB75 was fused to a smaller, affinity tag (6xHis), and the in vitro phosphorylation was performed using recombinant CA-MPK4. The advantage of our approach is 58  that it involved a genuine MPK activation by CAMKKs, while Li et al., (2016) used a mutant form of MPK4, one which imitated the activated form of the MAP kinase. One major shortcoming of our approach is the use of a large GST tag on the recombinant MYB75 construct. While GST is a commonly used and proven tool, this tag is ~24kDa in size, which could present significant steric hindrance for a relatively small protein like MYB75 (~28kDa), possibly blocking access to some sites. If the large N-terminal GST tag happened to shield threonine 126 in our assay, leaving only threonine 131 to be phosphorylated by MPKs, this steric hindrance would be one possible explanation for the divergence between our in vitro phosphorylation data and the results presented by Li et al., (2016).   The authors of Li et al., (2016) also did not address the impact of MYB75 phosphorylation on protein-protein interactions with known MYB75 binding partners, whereas I conducted a comprehensive yeast two-hybrid screen of all known binding partners of MYB75 (except SPL9), against all MYB75 phosphovariants, and found that MYB75T131E displayed reduced binding affinity to TCP3. I next intended to corroborate this yeast-based observation in vivo, using BIFC in plant cells. Demonstrating that the interaction between MYB75T131Eand TCP3 had been reduced compared to MYB75WT, but not eliminated, required at least a semi-quantitative method. For this purpose, I designed a multi-colour BIFC assay, where TCP3 was fused to a C-terminal portion of a cyan fluorescent protein; MYB75WT was fused to the N-terminal portion of Venus (a variant of yellow fluorescent protein); and MYB75T131E was fused to the N-terminal portion of cerulean (a variant of blue fluorescent protein). The experiment was designed as a competitive binding assay, whereby the final colour detected by fluorescence 59  microscopy of the protoplast population would be indicative of which variant of MYB75 (WT or T131E) had greater affinity for TCP3 (Fig 2.8).  Unfortunately, the transformation efficiency I obtained in Arabidopsis protoplasts was not high enough to allow me to perform this assay in a quantifiable fashion. Co-transformation of each TCP3 and individual MYB75 variants (WT or T131E) yielded a fluorescence signal in each case, but only 1-3 nuclei were showing fluorescence for each interaction pair tested. However co-transformation of three constructs (N-VENUS:MYB75WT, N-CERULEAN:MYB75T131E and C-CFP:TCP3), for the final competitive fluorescence assay did not yield any signal. Despite several attempts, I was unable to improve the protoplast transformation efficiency, and I concluded that alternative approaches to testing the interaction strength between TCP3 and each variant of MYB75 will be required. One such alternative would be transient co-infiltration of all three constructs into N. benthamiana epidermal cells, or Arabidopsis seedlings, which typically yields a higher transformation efficiency. This approach, however, would have required the transfer of existing BIFC constructs into binary vectors, for Agrobacteria-mediated infiltration and transient expression, which would have demanded more time than was available at this point.        60   Fig 2.8 Experimental design for MYB75-TCP3 competitive binding assay.  Each MYB75 ORF (either WT or T131E) was cloned into pSAT4-nVENUS-N and pSAT4-nCERULEAN-N, creating fusion proteins where each MYB75 phosphovariant was N-terminally fused to the N-terminal portions of either VENUS or CERULEAN florescent proteins respectively. TCP3 was cloned into pSAT4-cCFP-C, fusing TCP3 to the C-terminal portion of CFP. The competitive binding assay was conducted by co-transforming all three constructs displayed above into Arabidopsis protoplasts, for transient expression. The ability of TCP3 to interact with one or both phosphovariants of MYB75 should be assessed by observing the predominant colour of fluorescence in the nuclei of the protoplasts, using a fluorescent microscope. If TCP3 has equal affinity for both phosphovariants, yellow and blue fluorescence should be observed in equal proportion, however, if MYB75T131E has a reduced affinity for TCP3, only yellow (or mostly yellow) but little or no blue fluorescence should be observed.   Since Dr. Yonge and Dr. Liu demonstrated that in vitro phosphorylation of MYB75 by MPK3, MPK4, MPK6 and MPK11 occurs predominantly at threonine 131 (Fig 2.2), I chose to focus my subsequent experiments on phosphovariants T131A and T131E. Li et al., (2016), on the other hand used double mutants, T126/131A (AA) and T126/131D (DD). For unknown Fig 2.8 61  reasons they chose to use aspartic acid instead of glutamic acid to replace threonines 126 and 131 in their phosphomimic form of MYB75, although most phosphomimic studies have used glutamate to replace threonine. A detailed discussion on multi-site phosphorylation of target proteins will be postponed until Chapter 3; here, I will address how different experimental conditions in the protein degradation assays performed in our lab and those performed by Li et al., (2016) could have led to opposing results. My data indicates that phosphomimic MYB75T131E is degraded more rapidly in vivo than MYB75WT (Fig 2.6), while Li et al., (2016) found that phosphomimic MYB75 was more stable than WT (or AA mutant). In my protein degradation experiment, I used DEX inducible lines expressing 3xHA-tagged MYB75 (WT and T131E), and the degradation assay was performed as a time course experiment (0-8 hours) under continuous light, in liquid ½MS (see Materials and Methods). Li et al., (2016) evaluated degradation of MYB75 in dark-adapted seedlings grown on solid medium after a period of 24 hours. Some of the factors that could have affected MYB75 turnover rate in our experiment include prolonged immersion in liquid medium and incubation in small wells which could possibly limit gas exchange. Notably, anthocyanin accumulation was not observed in these seedlings, despite incubation under continuous light for over 48 hours, and induction of substantial levels of recombinant MYB75 protein expression by DEX treatment. Anthocyanins have been shown to accumulate in various plant species, (including Arabidopsis) in response to drought (reviewed in Chalker-Scott, 2002). Excess water, on the other hand, can suppress accumulation of flavonoids and anthocyanins in submerged plant tissues (Nanjo et al., 2011), which could explain why seedlings floating in liquid media did not show purple colour despite over-expressing MYB75. Additionally, ethylene gas can have a negative impact on 62  anthocyanin production, and ethylene has been shown to prevent anthocyanin accumulation under conditions of poor gas exchange (Craker and Wetherbee, 1973; Jeong et al., 2010).  The differences between the experimental conditions I used and those used by Li et al., (2016) make it very challenging to compare our data. Since little is known about post-translational regulation of MYB75, it is possible that there are undiscovered mechanisms of MYB75 protein turnover that are specific to particular environmental conditions. Our data suggest that, in seedlings immersed in liquid for a period over 48 hours, MYB75T131E undergoes a faster turnover than MYB75WT, despite being continuously exposed to light. These striking differences between my results and those of Li et al., (2016) may provide a starting point for investigation of the interaction between light, gas exchange (ethylene), and other aspects of the plant physical environment in controlling turnover of MYB75.  Protein degradation experiments conducted by Li et al., (2016) suggest that the action of the 26S proteasome plays a key role in MYB75 turnover, since addition of MG132 led to significant increase in protein levels of MYB75AA and MYB75WT, as well as moderate increases in the levels of MYB75DD protein (the levels of this phosphomimic form were relatively high prior to addition of MG132) (Li et al., 2016 Fig 7B). In my experiments MG132 was primarily used, in conjunction with DEX, to induce accumulation of recombinant MYB75 protein: both DEX and MG132 were removed prior to addition of cycloheximide, at the beginning of the time course experiment (0h), and thus protein turnover was monitored in the absence of MG132. Although both my data and that of Li et al., (2016) show that 26S proteasome plays an important role in MYB75 turnover, we cannot exclude the possibility that other protein degradation mechanisms 63  participate in MYB75 protein degradation. To answer this question it is worthwhile repeating my time-course experiments with MG132 included in the cycloheximide-containing media in order to monitor protein turnover rates in the absence of 26S proteasome function, which could help uncover additional MYB75 protein degradation mechanisms, and determine how phosphorylation affects this process.  Perhaps the biggest challenge in studying MYB75 dynamics is the fact that anthocyanin production, and therefore MYB75 expression respond rapidly to multiple environmental stimuli. Environmental condition had to be considered carefully in designing each experiment, with the understanding that those particular conditions would inevitably influence the outcome, and hence my interpretation of the results. My data indicates that MYB75 phosphorylation at threonine 131 has a negative impact on protein stability under certain conditions and has a reduced affinity towards TCP3 in vitro. Both of these outcomes would be anticipated to have a negative effect on anthocyanin accumulation in vivo. While some of our data contradicts the conclusions presented by Li et al., (2016), these discrepancies can potentially reflect the technical differences between the two studies. It is also important to bear in mind that the scope of my study differed from that of the Li group; they focused on delineating the impact of MPK4 phosphorylation on MYB75 (at T126 and T131), while my focus was on understanding how phosphorylation of MYB75 by one of several MPKs (at T131 alone) impacts flavonoid biochemistry and plant development in vivo.  64  2.6 Materials and Methods 2.6.1 Yeast two-hybrid screen 2.6.1.1 Cloning constructs for Yeast two-hybrid screen To test the interaction between MYB75 and 20 Arabidopsis MAP kinases, and between different MYB75 phosphovariants and known MYB75 binding partners, a directed Yeast two-hybrid screen was conducted using the Clontech Matchmaker® yeast two-hybrid kit. To create bait and prey constructs, the full length CDS of each gene was amplified by PCR from total Arabidopsis cDNA (Col-0 ecotype), using Phusion® polymerase (New England Biolabs) and primers listed in tables 2.1 and 2.2. Purified PCR products were digested with corresponding restriction enzymes and ligated into pGBKT7 or pGADT7 vector, using T4 DNA ligase (Invitrogen), creating bait and prey constructs respectively. For cloning of MYB75 phosphovariants, cDNA clones provided by Dr. Zhenhua Yonge were used as templates: these were generated by Dr. Yonge, through site-directed mutagenesis, using QuickChange II kit (Agilent Technologies). I created all the constructs listed in tables 2.1 and 2.2, with the exception of MPK3, MPK4 and MPK6 in pGBKT7, which were cloned by Dr. Xiao Min Liu. MYB75 and GL3 display transcriptional activity in yeast, which resulted in strong false positives when either of these proteins was fused to the GAL4 DNA-binding domain. To test the interaction between MYB75 and GL3, a truncated version of each MYB75 phosphovariant (MYB75-58aa), lacking the transcriptional activation domain, was cloned into pGBKT7, while GL3 was cloned into pGADT7.   65  Table 2.1 Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 and 20 Arabidopsis MAP kinases.  cDNA PRIMER SEQUENCES Restriction sites VECTOR MPK1 F-5’ GGCGAATTCGCGACTTTGGTTGATCCTCC R-5’ GCCGGATCCGTCAGAGCTCAGTGTTTAAGGTTG EcoRI/BamHI pGBKT7 MPK2 F-5’ GGCGAATTCGCGACTCCTGTTGATCCACCTAATGG R-5’ GCCGGATCCGTCAAAACTCAGAGACCTCATTG EcoRI/BamHI pGBKT7 MPK3 F-5’ CGCGAATTCATGAACACCGGCGGTGGCC R-5’ GCGGATCCCTAACCGTATGTTGGATTGAG EcoRI/BamHI pGBKT7 MPK4 F-5’ CGCGAATTCATGTCGGCGGAGAGTTGTTTC R-5’ GCGGATCCTCACACTGAGTCTTGAGG EcoRI/BamHI pGBKT7 MPK5 F-5’ GGCCCATGGAGGCGAAGGAAATTGAATCAGCGACAG R-5’ GGCGTCGACG TTAAATGCTCGGCAGAGGATTGAACTTC NcoI/SalI pGBKT7 MPK6 F-5’ CGCCATATGATGGACGGTGGTTCAGGTC R-5’ GCGGATCCCTATTGCTGATATTCTGGATTG NdeI/BamHI pGBKT7 MPK7 F-5’ GGCGAATTCGCGATGTTAGTTGAGCCACCAAATGG R-5’ GCCCTGCAGCTTAGGCATTTGAGATTTCAGCTTCAGG EcoRI/PstI pGBKT7 MPK8 F-5’ GGCCATATGGGTGGTGGTGGGAATCTCGTCGACG R-5’ GGCCCATGGGCTTAAGAATTGTGAAGAGAAGCAACTTTATC NdeI/NcoI pGBKT7 MPK9 F-5’ GGCGAATTCGATCCTCATAAAAAGGTTGCACTGG R-5’ GCCCTGCAGCTCAAGTGTGGAGAGCCGCGACCTTTTGAGAC EcoRI/PstI pGBKT7 MPK10 F-5’ GGCGAATTCGAGCCAACTAACGATGCTGAGAC R-5’ GCCGGATCCGTCAATCATTGCTGGTTTCAGGGT EcoRI/BamHI pGBKT7 MPK11 F-5’ GGCCCATGGAG TCAATAGAGAAACCATTCTTCGGTGATG R-5’ GGCGTCGACGTTAAGGGTTAAACTTGACTGATTCACGA NcoI/SalI pGBKT7 MPK12 F-5’ GGCGAATTCTCTGGAGAATCAAGCTCTGGTTCTACCG R-5’ GCCGGATCCGTCAGTGGTCAGGATTGAATTTGACAG EcoRI/BamHI pGBKT7 MPK13 F-5’ GGCGAATTCGAGAAAAGGGAAGATGGAGGGA R-5’ GCCGGATCCGTTACATATTCTTGAAGTGTAAAGACTC EcoRI/BamHI pGBKT7 MPK14 F-5’ GGCGAATTCGCGATGCTAGTTGATCCTCCAAATG R-5’ GCCGGATCCGTTAAGCTCGGGGGAGGTAATGAAGC EcoRI/BamHI pGBKT7 MPK15 F-5’ GCCGGATCCGTGGTGGTGGTGGCAATCTCGTCGACGG R-5’ GCCCTGCAGCCTAAGAATTGTGTAGAGATGCAACTTTCAC BamHI/PstI pGBKT7 66  Table 2.1 (continued) Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 and 20 Arabidopsis MAP kinases. MPK 16 F-5’ GGCCCATGGAGCAGCCTGATCACCGCAAAAAGTCATCAG R-5’ GGCGTCGACGTTAATACCAGCGACTCATTGCAGTATCTTG NcoI/SalI pGBKT7 MPK17 F-5’ GGCCCATGGAGTTGGAGAAAGAGTTTTTCACGGAGTATGG R-5’ GGCGTCGACGCTATGACACTGCAGAGGAGACACCAACAC NcoI/SalI pGBKT7 MPK18 F-5’ GGCGAATTCCAACAAAATCAAGTGAAGAAGGGC R-5’ GCCGGATCCGCTATGATGCTGCGCTGTAACTAATTGTGC EcoRI/BamHI pGBKT7 MPK19 F-5’ GGCGAATTCCAAAAAACTCAGGAGAAGAAGAACATGAAAGAGATGG R-5’ GCCGGATCCGCTAAGACATGCCATACCCAACAGCTCC EcoRI/BamHI pGBKT7 MPK20 F-5’ GCCGGATCCGTCAGCAAGATAATCGCAAAAAGAATAATCTG R-5’ GGCGTCGACGCTAGTACATCTTTGACATACCGTACCG BamHI/SalI pGBKT7 MYB75 F-5’ GGCGAATTCGAGGGTTCGTCCAAAGGGCTG R-5’ GCCGGATCCGCTAATCAAATTTCACAGTCTCTCC EcoRI/BamHI pGADT7   Table 2.2 Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 phosphovariants and previously characterized interacting partners of MYB75.   cDNA PRIMER SEQUENCES Restriction sites VECTOR MYB75 F-5’ GGCGAATTCGCGACTTTGGTTGATCCTCC R-5’ GCCGGATCCGTCAGAGCTCAGTGTTTAAGGTTG EcoRI/BamHI pGADT7 MYB75-58aa F-5’ GGCGAATTCGCGACTCCTGTTGATCCACCTAATGG R-5’ GCCGGATCCGCTATTGGTCTTTCTTCTTATCTTTGTTG EcoRI/BamHI pGBKT7 EGL3 F-5’ GGCGAATTCGCAACCGGAGAAAACAGAACG R-5’ GCCGGATCCGTTAACATATCCATGCAACCCTTTG EcoRI/BamHI pGBKT7 GL3 F-5’ GCCGAATTCGCTACCGGACAAAACAGAACAACTG R-5’ GCCGGATCCGTCAACAGATCCATGCAACCCTTTG EcoRI/BamHI pGADT7 TT8 F-5’ GGCGAATTCGATGAATCAAGTATTATTCCGGC R-5’ GGCGGATCCGCTATAGATTAGTATCATGTATTATGACTTG EcoRI/BamHI pGBKT7 TCP3 F-5’ GGCGGATCCGTGCACCAGATAACGACCATTTC R-5’ GCCCTGCAGCTTAATGGCGAGAATCGGATGAAGC BamHI/PstI pGBKT7 JAZ1 F-5’ GGCGAATTCTCGAGTTCTATGGAATGTTCTG R-5’ GCCGGATCCGTCATATTTCAGCTGCTAAACCGAGC EcoRI/BamHI pGBKT7 67  Table 2.2 (continued) Primers for cloning constructs for the directed yeast two-hybrid screen between MYB75 phosphovariants and previously characterized interacting partners of MYB75.  JAZ8 F-5’ GGCCCATGGAGAAGCTACAGCAAAATTGTGAC R-5’ GCCCTGCAGCTTATCGTCGTGAATGGTACGGTG NcoI/PstI pGBKT7 SPA1 F-5’ GGCCCATGGAGCCTGTTATGGAAAGAGTAGCTG R-5’ GCCCTGCAGCTCAAACAAGTTTTAGTAGCTTCATG NcoI/PstI pGBKT7 SPA3 F-5’  GGCGAATTCGAAGGTTCTTCAAATTCTAACTCTAGGG R-5’ GCCGGATCCGTCAAGTCATCATCTCCAGAATT EcoRI/BamHI pGBKT7 SPA4 F-5’ GGCGAATTCAAGGGTTCTTCAGAATCTAGTTCC    R-5’ GCCGGATCCGTCATACCATCTCCAAAATCTTGATA EcoRI/BamHI pGBKT7 KNAT7 F-5’ GGCGAATTCCAAGAAGCGGCACTAGG R-5’ GCCGGATCCGTTAGTGTTTGCGCTTGGAC EcoRI/BamHI pGBKT7      2.6.1.2 Yeast transformation and screen for protein-protein interactions by yeast two-hybrid  Yeast strain AH109 (Clontech), which has the phenotype -leu-trp-his-ade, was used for the directed yeast two-hybrid screen. Competent AH109 cells were co-transformed with 1-2µg of each prey and bait constructs, plated on agar plates containing dropout media without leucine and tryptophan (SD-trp-leu), and incubated for three-four days at 30˚C. Successful transformations (plates with at least 100 colonies), were used for replica plating on different selective media as shown in Fig 2.6. Interaction strength was determined based on colony colour, on the medium SD-trp-leu (red= no interaction, white= strong, pink= weak-moderate), and on survival on dropout media without histidine (SD-trp-leu-his) with either 1mM, 2.5mM, 5mM, 10mM or 25mM 3-aminotriazole (3AT), as well as on medium lacking histidine and adenine (SD-trp-leu-his-ade). A total of eight representative colonies were replica plated per bait-prey combination.   68    Fig. 2.9 Replica plating procedure used in the directed yeast two-hybrid screen. Yeast colonies co-transformed with bait and prey constructs, growing on SD-trp-leu plates were replica-plated on different selective media to test the strength of interaction between the fusion proteins. A total of eight colonies were used per bait-prey combination. Each colony was resuspended in 40µL of 0.9% NaCl, and 2µL of cell suspension were pipetted unto each selection plate. The media used in the screen included SD-trp-leu, SD-trp-leu-his-ade and SD-trp-leu-his+3AT with 3AT concentrations of 1mM, 2.5mM, 5mM, 10mM and 25mM. The replica plates were incubated for 3 days at 30ᵒC, and the resulting colonies were photographed. Interaction strength was determined based on colour on SD-trp-leu, and colony survival on SD-trp-leu-his+3AT, and SD-trp-leu-his-ade media.        Yeast colonies co-transformed with bait and prey growing on SD-trp-leu dropout media 1 2 3 4 1 1 2 2 3 3 4 4 Yeast colonies resuspended in ~40µL of 0.9% NaCl Resuspended yeast colonies replica-plated on selective media SD-trp-leu SD-trp-leu-his+3AT Fig 2.9 69  2.6.2 In vitro phosphorylation of MYB75 by MAP kinases This experiment was performed by Dr. Zhenhua Yonge and Dr. Xiao Min Liu 2.6.2.1 Cloning and recombinant protein purification  Constitutively active MKK6 and MKK9 (CAMKK6 and CAMKK9) were previously created by Dr. Jin Suk Lee, by replacing serine and threonine residues, found in the activation loop with acidic residues, using site-directed mutagenesis (S221D and T227E for CAMKK6, and S195E and S201E for CAMKK9; Lee, 2008). CAMKK6, CAMKK9, MPK3, MPK4, MPK6 and MPK11 were cloned by Dr. Jin Suk Lee into pGEX 4T-2 vector, to create recombinant proteins containing an N-terminal Glutathione S-transferase (GST) tag. Full cDNA of WT MYB75, as well as phosphonull mutants (MYB75T126A, MYB75T131A and MYB75T126/131A) were cloned by Dr. Zhenhua Yonge into pGEX 4T-1 to generate recombinant proteins with N-terminal GST tags. All expression vectors were transformed into chemically competent E.coli (BL21). Induction of recombinant protein expression was performed by adding 0.5mM isopropyl 1-thio-ß-galactopyranoside (IPTG), to liquid cultures in mid-log phase, followed by an additional incubation for 4h at 25ᵒC. Recombinant proteins were purified using Glutathione Sepharose® 4B beads (GE Healthcare), according to manufacturer’s protocol. The concentration of each purified recombinant protein was determined using Bio-Rad protein assay, with BSA as a standard.  2.6.2.2 In vitro kinase assay This experiment was performed by Dr. Zhenhua Yonge.   Phosphorylated MAPKs were prepared as described in Ellis and Lee (2007), by pre-incubating purified GST-MPK3 with GST-CAMKK9, and each GST-MPK4, GST-MPK6 and GST-MPK11 with GST-CAMKK6, at a CAMKK:MPK ratio of 1:4, in kinase reaction buffer (25mM Tris-HCl pH7.5, 5mM ß-glycerolphosphate, 2mM dithiothreitol, 10mM MgCl2, 200µM ATP), at 30ᵒC 70  for 30 min. MYB75 in vitro phosphorylation was performed by combining 3mg of each GST-MYB75 phosphovariant (T126A, T131A and T126/131A) with 1mg of each activated GST-MPK, in 20ml of kinase reaction buffer. The reaction was initiated with 1µCi [Ƴ-32P] ATP, and incubated at 30ᵒC for 45 min, and terminated by adding 5µL of 4xSDS loading buffer, boiling the samples for 5min, and cooling them on ice. The samples were resolved on a 12% SDS-PAGE gel, transferred to a nylon membrane and visualized using autoradiography, and Coomassie brilliant blue R-250 staining.   2.6.3 Intracellular localization of different phosphovariants of MYB75 protein: cloning of MYB75:GFP constructs and Agrobacterium-mediated infiltration of Nicotiana benthamiana epidermis (performed by Dr. Liu).   Full cDNA of each MYB75WT, MYB75T131A and MYB75T131E was amplified by PCR using the forward-5’CGGGGTACCATGGAGGGTTCGTCCAAAGG, and reverse-5’ CGCTCTAGAATCAAATTTCACAGTCTCTC primers. Each PCR product was purified, digested with KpnI and XbaI restriction enzymes, and ligated, using T4 DNA ligase (Invitrogen), into the binary vector pCAM1300-35S-GFP (which was previously digested with KpnI and XbaI), to create MYB75:GFP fusion proteins. The constructs were introduced into competent Agrobacteria tumefaciens strain GV3101. For transient expression in N. benthamiana, Agrobacterial cultures, carrying each construct were grown overnight at 30ᵒC. The following day, OD600 was determined and the bacterial cells were harvested by centrifugation. Each culture was resuspended in infiltration buffer (10mM MES pH5.6, 10mM MgCl2, 0.15mM acetosyringone), to a final OD600=1.0. Infiltration was performed by injecting the suspension into the abaxial side of mature leaves of three-week-old N. benthamiana plants (kept covered overnight to induce 71  stomatal opening), using a plastic syringe. The plants were incubated for two days after the infiltration. After two days the transformed leaves were sampled and the area infiltrated was cut out and mounted in water unto microscope slides. Images were acquired using a Zeiss Pascal scanning confocal microscope.   2.6.4 Protein degradation assay 2.6.4.1 Constructs and plant material   Plants used in this assay were Arabidopsis seedlings (Col-0 background) carrying MYB75 gene (WT and T131E) fused in frame with a 3X Hemagglutinin tag at the N-terminus, and under the control of a dexamethasone-inducible promoter; DEXpr:3xHA:MYB75 gene (see section 3.6.1). Heterozygous T2 seedlings were selected on ½ Murashige and Skoog (½MS) agar medium, containing 30µg/ml hygromycin and surviving seedlings were used for the protein degradation assay described below. Phosphovariant genotypes of all transgenic plants were confirmed by sequencing the transgene. 2.6.4.2 Time-course protein degradation assay  Arabidopsis seedlings were germinated and grown on petri plates, containing ½ MS agar medium with hygromycin, under long day conditions (16h light/8h dark), and light fluence of ~35µmol m-2 s-1. Nine day old Arabidopsis seedlings carrying DEXpr:3XHA:MYB75WT and DEXpr:3XHA:MYB75T131E were transferred from selection plates to liquid ½MS in 24 well plates, with 1ml of medium in each well and approximately 20-40 seedlings per well. Plants were incubated overnight under the same light conditions to allow them to adjust to the liquid medium. The next day, the medium was removed and replaced with liquid ½ms containing 30µM dexamethasone (DEX; Sigma Aldrich), and 50µM MG132 proteasome inhibitor (Santa 72  Cruz Biotech), to induce MYB75 gene expression and prevent protein degradation respectively. After addition of DEX and MG132 the seedlings were incubated under continuous light (~35µmol m-2 s-1) overnight, to increase MYB75 protein accumulation. The next day the medium was removed, and the seedlings were washed at least three times with liquid ½MS, before adding 1ml of ½MS containing 1mM cycloheximide (CHX; Sigma Aldrich) to each well, to block protein translation. At each time point (1h,2h,4h and 8h) all the seedlings were harvested from a single well, dried by blotting on a kimwipe, weighed and immediately frozen in liquid nitrogen. MYB75 protein in each pool of seedlings was detected by western blot analysis, using an anti-HA primary antibody and relative protein levels were determined by evaluating band intensity using ImageJ. 2.6.4.3 SDS-PAGE and Western Blot analysis  Plant tissue expressing 3XHA-tagged MYB75 was frozen in liquid nitrogen, ground to a fine powder and 2XSDS loading buffer was directly added to the ground tissue. In assays where relative protein quantification was required, fresh weight of the plant tissue was determined, and 1µL of 2xSDS loading buffer was added for every 1mg of plant tissue, to facilitate equal loading of protein lysate. For each sample, 10µL of plant lysate was loaded per well and protein samples were resolved on SDS-PAGE (10% acrylamide). Wet protein transfer from SDS-PAGE gel to Immun-Blot® PVDF membrane (Biorad) was performed for 1h at 100V. Western blot detection of recombinant MYB75 protein was performed using a 1:1000 dilution of a primary anti-HA antibody (high affinity rat-monoclonal, clone 3F10, Roche), and a 1:5000 dilution of a secondary antibody conjugated with HRP (goat anti-rat IgG-HRP Santa Cruz Biotech Sc-2032). Chemiluminescent signal detection was performed using ECL western blot reagent (Pierce ™ 73  ECL plus) and recorded on photosensitive film (Bioflex Blue Lite EC by Mandel Scientific). After western blot detection, each PVDF membrane was stained with IDGel™ PONCEAU dye (DGel Electrosystems Inc.) to determine relative amount of total protein in each well. All blots and PONCEAU-stained membranes were scanned for subsequent analysis using ImageJ.  2.6.4.4 ImageJ quantification of relative protein levels  ImageJ was used to determine relative protein levels, by quantifying band intensity in western blots images. In blots where high levels of protein resulted in signal bleed through between individual lanes, such that bands appeared fused, individual bands were moved apart in Microsoft Paint prior to conducting ImageJ analysis, ensuring that neither background nor individual band intensity was altered (see Appendix, Fig S2.1).  Band intensity was determined for each western blot sample (MYB75 band), and corresponding lane from PONCEAU stained membrane. Relative MYB75 protein quantity detected in the western blot was determined by dividing the area representing western blot band intensity by the normalized area obtained from the PONCEAU stain of the corresponding well. Each semi-quantitative western blot analysis was performed at least twice, to ensure that the patterns of protein degradation are reproducible. Results displayed in Fig 2.5 are from a single representative experiment.      74  CHAPTER 3  The impact of MYB75 protein phosphorylation status on production of anthocyanins and flavonoids in Arabidopsis plants 3.1 Introduction The transient nature of protein phosphorylation presents a large obstacle to understanding the impact of this post-translational modification on protein function in vivo, and the effect it has on processes controlled by the protein in question. With transcription factors such as MYB75 it is particularly challenging, as any alterations to protein function can have pleiotropic effects on the organism. To understand how phosphorylation might be impacting MYB75 function in vivo I chose to create stable transgenic Arabidopsis lines expressing different phosphovariant mutant forms of the MYB75 protein. I then examined the impact of expression of these phosphovariant proteins on the plant phenotype. MYB75 is known to play a role in cell wall development (Bhargava et al, 2013) and may be implicated in other developmental processes, either directly or through its influence on flavonol levels (Buer and Djordjevic 2009; Peer et al, 2001). However, phenotypic abnormalities such as changes in cell wall thickness or developmental modifications can be difficult to quantify and interpret, particularly in lines where MYB75 expression is driven by a constitutive CAMV35S promoter, which results in ectopic production of the protein. Anthocyanin accumulation, on the other hand, can be visually monitored in plants, and total anthocyanin quantities can be measured using biochemical extraction and spectrophotometric determination methods. Furthermore, anthocyanin levels are very responsive to MYB75 activity. Accumulation of anthocyanin visibly 75  spikes in Arabidopsis plants that are over-expressing MYB75, such as the PAP1-D over-expression lines, first described by Borevitz et al, (2000). The work described in this chapter explores the ability of different MYB75 phosphovariants to drive anthocyanin production in Arabidopsis, under regular growth conditions and under stress, such as continuous light and elevated sucrose, both conditions that are known to induce MYB75-dependent anthocyanin accumulation. The ultimate goal of these experiments was to gain insight into how phosphorylation might affect the ability of MYB75 to drive transcription of anthocyanin biosynthetic genes in Arabidopsis. This chapter also describes how MYB75 protein accumulation is affected by different conditions, building on our results from Chapter 2, where the phosphovariant MYB75T131E was shown to be more labile than MYB75WT. Finally, I describe how the biochemical profiles of flavonol and anthocyanin compounds are affected in Arabidopsis plants over-expressing different phosphovariants of MYB75.   The first part of this chapter describes initial attempts to create transgenic Arabidopsis lines expressing different phosphovariant versions of MYB75. While these experiments ultimately did not yield transgenic lines that lent themselves to robust analyses, they did provide useful insights into the functional importance of introns in the MYB75 gene and highlighted some differences between the Nossen and Col-0 Arabidopsis ecotypes, with respect to anthocyanin production. The remainder of the chapter describes work performed using transgenic MYB75 over-expression lines, in which the gene version of each phosphovariant, with an N-terminal 3xHA- epitope tag, was expressed under the control of a strong, constitutive promoter (CAMV35S).  76  3.2  Expression of different MYB75 phosphovariants from the MYB75 endogenous promoter   My initial attempt to create transgenic MYB75 phosphovariant plants involved transforming Arabidopsis myb75- null mutants (Nossen background) with each MYB75 phosphovariant cDNA, under the control of the MYB75 endogenous promoter. This project was initially undertaken by Dr. Zhenhua Yonge, who created the constructs and transformed Arabidopsis plants, at which point I took over, and began selecting T1 plants by screening for enhanced anthocyanin production under high light conditions. The ability of each MYB75 phosphovariant to drive anthocyanin production was tested simultaneously with promoter functionality, by stressing the adult transgenic plants with continuous light, for at least 48hours before measuring anthocyanin content in mature rosette leaves. Complementation of anthocyanin deficiency typical of myb75- null mutant plants, by each phosphovariant, was evaluated by comparing anthocyanin levels in transgenic lines to levels in Nossen wild type plants, grown under the same conditions. Analysis of numerous T1 plants generated with each phosphovariant revealed that MYB75T126A -expressing plants, grown under light stress conditions were able to accumulate average anthocyanin levels, comparable to those seen in Nossen wild type plants. In contrast, plants carrying MYB75T131A and MYB75T126/131A phosphovariants showed only marginal levels of anthocyanin production, which did not differ significantly from those seen in the parental myb75- mutant phenotype (Fig 3.1A). In other words, these phosphovariant forms did not show complementation of the myb75- mutant anthocyanin accumulation phenotype. 77   The anthocyanin accumulation data presented in Fig 3.1 (A) were generated using pooled tissue samples, derived from several individual transgenic lines. When data from the individual lines were plotted separately, however (Fig 3.1B), it is obvious that the apparent genotype-specific differences seen in Fig 3.1 (A) data stemmed from pronounced differences seen in between individual lines. This was particularly clear for the MYB75T126A lines, where lines 1,2,5 and 6 showed anthocyanin levels comparable to Nossen wild type plants, while lines 3 and 4 displayed anthocyanin levels closer to those of the untransformed myb75- mutant (Fig 3.1B). Despite these large differences between individual transgenic lines, the overall pattern suggested that blocking possible phosphorylation at threonine 126 did not interfere with the ability of the phosphomutant MYB75 to upregulate anthocyanin production under light stress, whereas blocking phosphorylation at threonine 131 renders MYB75 ineffective as a complementing agent. Upon examining the levels of MYB75 transcripts in these lines, however, using semi-quantitative reverse transcription polymerase chain reaction, it became clear that MYB75 expression levels correlated with anthocyanin production in each line. (Fig 3.1C). The activity of the endogenous MYB75 promoter is highly sensitive to light, at least in part through positive regulation by HY5 (Shin et al, 2013), and accordingly, in our experiments MYB75 expression was relatively high under continuous light, in both Col-0 and Nossen wild type plants, as well as in MYB75T126A lines 1,2 and 5, as shown in Fig 3.1C (lines 6 RNA was degraded and was not included in the analysis). The failure of MYB75T131A lines to yield MYB75 expression levels comparable to wild type, made these lines unsuitable for further experiments. A similar problem was encountered with MYB75T126E and MYB75T131E, transgenic lines; transgenic MYB75 78  expression in these plants was extremely low, and no complementation of the myb75- anthocyanin deficiency phenotype was observed (data not shown).                     79    Fig 3.1 80    Fig 3.1 Complementation of anthocyanin biosynthesis in Arabidopsis myb75- null mutants, by different MYB75 phosphovariants, driven by the MYB75 endogenous promoter. MYB75 cDNA (including wild type and each phosphovariant single and double point-mutant), was introduced into a binary vector, along with ~2.7kb of sequence upstream of the MYB75 translational start site, as the endogenous MYB75 promoter. Each MYB75pr:MYB75 cDNA construct was transformed into myb75- mutant plants (Nossen background), and several lines were isolated for each phosphovariant genotype. The ability of each phosphovariant to complement anthocyanin production in myb75- mutants was evaluated in ~6-week-old heterozygous T2 plants, exposed to continuous light, for over 48 hours. Total anthocyanin was extracted from mature rosette leaves, using 49% methanol, 1% acetic acid aqueous solution. Anthocyanin levels were evaluated spectrophotometrically and normalized to fresh weight using the formula (A530-A650X.25)/g. Expression of recombinant MYB75 was determined using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) and quantified using ImageJ software. Total anthocyanin levels for each genotype are shown in (A) and represent average values for 6-12 plants (see materials and methods), error bars represent +SD. Average anthocyanin levels suggest that anthocyanin production was recovered in MYB75T126A lines, but not in MYB75T131A or MYB75T126/131A mutants (A). Examination of anthocyanin levels in individual lines revealed that only lines 1,2,5 and 6 from MYB75T126A genotype produced anthocyanin levels comparable to Nossen wild type (B).  Gene expression analysis revealed that only lines which showed anthocyanin complementation were expressing recombinant MYB75 to levels comparable to wild type plants (C). Fig 3.1 continued 81  Assessing the impact of MYB75 phosphorylation on anthocyanin production required that all phosphovariants be expressed at comparable levels, in order to correlate anthocyanin quantity with presence of MYB75 protein. Furthermore, since MYB75 protein stability appeared to be affected by phosphorylation, as demonstrated in Chapter 2, detectable protein levels were essential to support any claim that a biochemical change might be due to MYB75 phosphorylation status. In an ongoing effort to establish Arabidopsis lines with stable expression of MYB75 protein, Dr. Xiao Min Liu attempted to detect different tagged versions of MYB75T131A and MYB75T131E, when expressed in a myb75- null mutant background (Nossen ecotype). Unfortunately, lines expressing hemagglutinin epitope-tagged (HA-tagged) MYB75 cDNA, driven by the endogenous MYB75 promoter did not yield any detectable protein, for any of the phosphovariants (data not shown). Use of a strong constitutive (CAMV35S) promoter to drive FLAG-tagged MYB75 cDNA lines (also created by Dr. Liu) yielded marginally better results; protein was detectable only after transformed seedlings were incubated overnight with proteasome inhibitor, MG132, under continuous light. Protein could not be detected in soil grown mature plants, and no changes in anthocyanin levels were observed, either visually or after extraction and spectrophotometric evaluation (data not shown).  I initially attributed the failure to recover a single line with easily detectable ectopic MYB75 protein expression, even when the cDNA expression was being driven by a strong constitutive promoter, to the ecotype background being used. Since Nossen wild type plants were known to produce slightly less anthocyanin than the Col-0 wild type (Teng et al., 2005), I hypothesized that MYB75 protein levels might be under tighter regulation in the Nossen ecotype, either through enhanced MYB75 protein degradation or through artificial selection of 82  transgenic lines with lower MYB75 transgene expression, driven by embryonic and/or seedling lethality of T1 plants that express higher levels of MYB75. However, although attempts to express tagged MYB75 cDNA from a CAMV35S promoter in the Col-0 background yielded plants with strong anthocyanin production, it was still not possible to detect the recombinant MYB75 protein in tissue extracts (data not shown). Finally, I decided to use the full gene version of MYB75 instead of the cDNA, since previous studies by Borevitz et al., (2000) and Dare et al., (2008), involved over-expression of the full length MYB75 gene.  I first used site-directed mutagenesis to generate MYB75T131A and MYB75T131E versions of the MYB75 gene. I then chose to use the constitutive CAMV35S promoter rather than the endogenous promoter, to drive the expression of the full gene variants. This was done in order to ensure high levels of MYB75 expression, but also to avoid possible autoregulation effects alluded to in the literature (Dare et al., 2008), where the authors suggested that MYB75 may affect its own expression, an idea that is substantiated by the presence of PCE cis-elements in the MYB75 promoter. Such autoregulation has been demonstrated for TT8, (a transcriptional regulator of anthocyanin biosynthesis and a binding partner of MYB75). TT8 was shown to regulate its own expression in plants by binding to its own promoter (Baudry et al., 2006). If such an autoregulation mechanism existed for MYB75 and were in any way affected by the protein’s phosphorylation status, levels of transgenic MYB75 could be differentially influenced in individual phosphovariant lines, thus leading to different expression levels of the protein. Since assessing the ability of each phosphovariant to drive anthocyanin production requires that the transgenic lines used in the analysis produce comparable levels of recombinant MYB75, it was important to eliminate any variables that could impact expression levels of individual 83  phosphovariants. I reasoned that using a constitutive promoter would eliminate any differences in recombinant protein expression that might result from autoregulation and allow me to obtain high levels of MYB75 protein expression, thereby facilitating correlation of recombinant protein levels with anthocyanin accumulation.   In addition to this consideration, I chose to use Col-0 wild type plants to transform the recombinant full length MYB75 gene phosphovariant constructs, rather than use the Nossen background, since Col-0 plants over-expressing MYB75 (PAP1-D) are known to accumulate very high levels of anthocyanins (Borevitz et al., 2001). The PAP1-D phenotype thus, provides a reference point for the anthocyanin levels we can expect to obtain from successful MYB75 over-expression. Col-0 plants also displayed higher levels of anthocyanin accumulation in our own experiments than did plants of the Nossen ecotype. This is consistent with published data by Teng et al., (2005; Fig 2) where natural variation in anthocyanin accumulation, elicited by sucrose treatment was evaluated across 43 separate ecotypes, and Col-0 plants displayed higher levels of anthocyanin production than did the Nossen ecotype.  I generated multiple lines expressing the full gene version of wild type, phosphonull and phosphomimic MYB75 (referred to as MYB75WT, MYB75T131A and MYB75T131E respectively), under the control of the CAMV35S promoter. In each case the ectopic protein carried an N-terminal 3xHA- epitope tag to enable easy protein detection. These lines will be referred to here as 35pr:3xHA:MYB75 gene lines, and the shorthand notation used throughout this thesis is 35Spr:MYB75 (MYB75WT, MYB75T131A and MYB75T131E, where specification of the phosphovariant was required).  84  Several lines were established for each phosphovariant by immunoscreening T1 plants to identify those which were producing detectable levels of MYB75 protein. Such plants also consistently displayed bright purple colouration in mature rosette leaves, resulting from accumulation of anthocyanins. Four lines were isolated for35Spr:MYB75WT; L2, L11, L12 and L14 (L2 was rarely used due to its low germination rates). In addition, three lines were established for MYB75T131A; L1, L22 and L23, and four for MYB75T131E; L2, L4, L5 and L9. I chose to use heterozygous T2 plants throughout this thesis, in order to save time and avoid losing transgene expression through gene silencing over generations, which has been reported in Arabidopsis and transgenic crops where the 35S promoter was used (reviewed in Rajeevkumar et al 2015).  3.3 Impact of sucrose and light on MYB75 protein stability and anthocyanin production in Arabidopsis seedlings   35Spr:3xHA:MYB75 gene lines were isolated by immunoscreening a large number of T1 plants (at least 50 plants were screened per genotype) for MYB75 protein expression, using western blotting and a monoclonal antibody raised against the hemagglutinin polypeptide. Several lines of each phosphovariant, expressing detectable MYB75 protein, were isolated in this fashion, all the T1 plants which showed detectable protein levels also displayed purple colouration in mature rosette leaves, resulting from anthocyanin accumulation, reminiscent of PAP1-D. Curiously however, none of these lines showed any visible signs of anthocyanin production while growing on petri plates under long day conditions as seedlings (see Materials and Methods), that are comparable to PAP1-D seedlings, which displayed a distinct purple colour, visible with the naked eye, under the same conditions. This lack of anthocyanin accumulation in 35Spr:MYB75 seedlings in petri dishes could have been caused by a number of 85  environmental factors, suppressing anthocyanin biosynthesis, or promoting anthocyanin degradation, including lower light fluence in the chamber where the petri plates were incubated, than in the growth chambers where the mature plants were grown (see Materials and Methods).  Sucrose and light are both known to positively regulate MYB75 expression and anthocyanin production. While sucrose has been shown to affect MYB75 primarily at the transcriptional level (Teng et al., 2005), light is also known to promote MYB75 protein stability by destabilizing COP/SPA ubiquitin ligase complexes, which target MYB75 protein for degradation in the dark (Maier et al, 2013). The goal of the first series of experiments I conducted (using transgenic lines over-expressing the full gene version of each MYB75 phosphovariant), was to examine how sucrose and light affected the levels of recombinant MYB75 protein in seedlings, and ultimately to determine if there are any differences between the phosphovariants of MYB75, in terms of protein stability or ability to drive anthocyanin production at early stages of the plant life cycle.  To test the impact of sucrose and light on 35Spr:3xHA:MYB75 gene lines, heterozygous T2 seedlings were germinated on ½ MS medium with hygromycin and grown for ten days. Ten- day-old seedlings were transferred to petri plates containing solid ½MS medium supplemented with 6% sucrose and incubated under continuous light for 24 hours, using 20-30 seedlings for each phosphovariant, with proportional representation of each line. The untreated control plants were kept on the original plates without sucrose and incubated under short day photoperiod (16 hours dark, 8 hours light). Although 35Spr:MYB75 seedlings did not display accumulation of anthocyanin comparable to PAP1-D lines, closer examination of 35Spr:MYB75 86  seedlings, using a dissecting scope (see Material and Methods), revealed that even under short day conditions, without sucrose, 35Spr:MYB75 gene lines displayed subtle signs of anthocyanin production, not seen in the Col-0 wild type controls. Seedlings of over-expressor lines, including 35Spr:MYB75WT, 35Spr:MYB75T131A and 35Spr:MYB75T131E, but not Col-0 WT, displayed limited but visible accumulation of anthocyanins near the apical meristem (Fig 3.2A). After treatment with 6% sucrose under continuous light, all plants, including Col-0 wild type controls, showed visible signs of increased anthocyanin accumulation, manifested as purple colouration in all plant organs, with some variation in colour intensity between individuals of each line (Fig 3.2A). Notably, some of the transgenic seedlings over-expressing MYB75WT, MYB75T131A and MYB75T131E displayed darker purple colouration than the Col-0 wild type plants on sucrose; this increased anthocyanin accumulation was particularly apparent in emerging leaves. Spectrophotometric quantification of total anthocyanin content in each genotype corroborated these visual observations, confirming that in the short-day treatment without sucrose, all three phosphovariants produced more anthocyanin than wild type controls (Fig 3.2B). Furthermore, anthocyanin levels under these conditions were twice as high in the MYB75T131A genotype then in either MYB75WT or MYB75T131E. This latter trend was also observed in sucrose-treated plants, where anthocyanin levels spiked in all the genotypes, but were higher in MYB75T131A than in the other two phosphovariants (Fig 3.2B). Although all plants, including the wild type controls displayed an increase in anthocyanin levels after sucrose treatment, the 35Spr:MYB75 lines showed greater anthocyanin accumulation than did Col-0 wild type plants, suggesting that ectopic expression of the transgene contributes to an increase in anthocyanin quantity under these experimental conditions.  87  The variation in anthocyanin levels observed between different MYB75 phosphovariants in these experiments might indicate that different MYB75 phosphorylation states vary in their ability to drive anthocyanin production in Arabidopsis seedlings. Alternatively, differences in phosphovariant protein stability could affect the amount of recombinant MYB75 present in each phosphovariant genotype, which in turn could lead to genotype differences in total anthocyanin accumulation. To test the second hypothesis, I examined the relative levels of MYB75 protein for each genotype under each treatment condition. Western blot detection and quantification of recombinant HA-tagged MYB75 (Fig 3.2C) revealed that MYB75T131E protein levels are lower than the levels of the other phosphovariants, under short day conditions.  MYB75WT protein levels were only marginally higher than the levels of MYB75T131E, while the levels of MYB75T131A recombinant protein were the highest among all three genotypes.  In response to sucrose and light treatments, recombinant MYB75 protein levels increased in all phosphovariant plants. Protein levels of MYB75T131E showed the most dramatic increase between seedlings incubated under short day conditions, without sucrose, and continuous light with 6% sucrose. MYB75T131E protein levels were also the highest among all three phosphovariants, after incubation on 6% sucrose with continuous light. In MYB75WT and MYB75T131A plants protein levels after light and sucrose treatment were comparable (MYB75WT being slightly lower), however, the change in protein levels between treatments was more dramatic in MYB75WT, than in MYB75T131A which showed only a modest increase between plants under short day conditions and continuous light with sucrose (Fig 3.2C).    88       Fig 3.2 89        Fig 3.2 continued 90  Fig 3.2 Light and sucrose-driven changes in anthocyanin production, and levels of recombinant MYB75 protein, in 11-day-old Arabidopsis seedlings expressing MYB75WT, MYB75T131A and MYB75T131E under the control of a constitutive 35S promoter. Heterozygous T2 seedlings were germinated on ½MS medium containing 30µM hygromycin and grown under 16h light/8h dark conditions. At 10-days-old, seedlings from each genotype were transferred to ½MS plates containing 6% sucrose, and incubated under continuous light for 24h, while the seedlings on the original plate were covered with foil for 16h to simulate short day lighting conditions. Seedlings were photographed using a digital camera mounted on a dissecting microscope. Anthocyanin and protein quantification was performed using a pool of 20-30 seedlings for each treatment. Each pool of seedlings was used for total anthocyanin extraction and spectrophotometric quantification, using the formula Qanthocyanin=[A530-(A650x0.25)]/mass(g). Western blot detection of recombinant MYB75 protein was used in conjunction with ImageJ software to quantify protein levels. Under short day conditions without sucrose, anthocyanin accumulation could be seen in the apical meristem region in all three phosphovariant genotypes, but not in Col-0 WT controls (A). After application of sucrose, under continuous light, all plants, including Col-0 WT controls accumulated abundant anthocyanin in all plant organs. Anthocyanin production in 35Spr:MYB75 lines, was higher than in Col-0 WT in all treatments (B). Increased levels of recombinant MYB75 protein was observed for all three phosphovariants after light and sucrose treatment and corresponded to the increased anthocyanin levels. MYB75T131E showed the most dramatic change in recombinant protein levels, after treatment with light and sucrose, while MYB75T131A protein levels showed the least amount of change between treatments, maintaining consistently higher levels of recombinant MYB75 under all conditions than the other phosphovariants of MYB75 (C).  To corroborate the results obtained in this experiment (Fig 3.2), and to further explore the individual effects of sucrose and light stress treatments on MYB75 protein levels, the experiment was repeated under slightly different conditions. First, the plants were older than before (14 days vs. 11 days), and thus had more developed emerging leaves and more overall biomass, which facilitated more accurate measurements of fresh weight, required to quantify total anthocyanin levels. Then different treatments were used; 48 hours of growth in continuous darkness without sucrose, 48 hours of growth in continuous light without sucrose, and 48 hours of growth in continuous light with 6% sucrose. As seen previously, levels of MYB75T131E protein were lower than levels of either MYB75WT and MYB75T131A, after incubation in the dark, confirming that this phosphovariant is less stable than MYB75WT and MYB75T131A 91  under these conditions (Fig 3.3). As before, recombinant MYB75 protein levels increased dramatically in MYB75WT and MYB75T131E plants after incubation under continuous light but showed only a modest increase in MYB75T131A lines. Surprisingly, application of light alone had a greater positive effect on protein levels in all genotypes than did the treatment with light and sucrose together (Fig 3.3B). Most strikingly, western blot analysis and signal quantification with ImageJ suggest that only MYB75T131E protein levels increase after treatment with sucrose and light together, compared to dark-treated plants, while the other phosphovariants treated simultaneously with sucrose and light displayed protein levels comparable to those seen in seedlings incubated in the dark without sucrose. Unfortunately, the limited availability of T2 generation plant material made it impossible to repeat the experiment enough times to generate data sets amenable to statistical analysis. However, the results seen in figures 3.2C and 3.3 are consistent with the trends observed in the protein degradation experiments performed in Chapter 2, which suggest that MYB75T131E is more labile than MYB75WT under the conditions used (Fig 2.5). Most importantly, the data in Figures 3.2 and 3.3 consistently demonstrate that levels of MYB75T131A are generally unaffected by these stress treatments. These observations fill the gap in the results from the previous protein degradation experiments, when only DEXpr:MYB75WT and DEXpr:MYB75T131E lines were available. Finally, these data suggest that phosphorylation of MYB75 may be impacting anthocyanin production by influencing the cellular levels of MYB75 protein, since increases in protein levels were paralleled by increases in total anthocyanin production in all three phosphovariants (Fig 3.2B).  To compare the ability of each MYB75 phosphovariant to drive anthocyanin production, anthocyanin quantification had to be performed in an experimental system that allowed 92  harvest of enough biomass, to enable statistical analysis to be performed. Thus, the focus of the project shifted to the use of mature Arabidopsis plants.      93    Fig 3.3 The impact of light and sucrose on stability of recombinant MYB75WT, MYB75T131A, and MYB75T131E protein, in 14-day-old Arabidopsis seedlings. Heterozygous T2 seedlings carrying 35Spr:3xHA:MYB75 gene constructs were germinated on ½ MS medium containing 30µM hygromycin. Twelve days after germination the seedlings were transferred to media without antibiotic, either with or without 6% sucrose. Approximately 30 seedlings were used for each treatment: the treatments included 48 hours in the dark without sucrose, 48 hours under continuous light without sucrose, and 48 hours under continuous light with 6% sucrose. After 48 hours the seedlings were harvested and recombinant MYB75 was detected in total plant tissue extracts by western blot analysis (A). Relative amount of recombinant MYB75 protein in each pool of seedlings was quantified using the western blots shown in 3.3A and ImageJ software (B).   Fig 3.3 94  3.4 Anthocyanin production in mature Arabidopsis plants over-expressing different MYB75 phosphovariants 3.4.1 Total anthocyanin quantification in mature Arabidopsis lines over-expressing MYB75  All Arabidopsis lines carrying 35Spr:3xHA:MYB75 gene constructs had individual plants that displayed visible signs of anthocyanin accumulation, shortly after being transferred from petri dishes to soil, when grown under long day photoperiod; 16 hour light/ 8 hours dark. Vivid purple colouration could be observed across all lines, throughout different rosette stages (Fig 3.4A), throughout mature stages and senescence. Some differences were observed between individual lines of 35Spr:MYB75WT. Lines 2 (not shown) and 11 displayed anthocyanin accumulation that was most concentrated near the centre of the rosette and in mid veins of rosette leaves, while lines 12 and 14 showed more even distribution of anthocyanin throughout the epidermis. MYB75T131A lines 1, 22 and 23, as well as MYB75T131E lines 2,4,5 and 9 showed expression patterns similar to MYB75WT lines 12 and 14, with anthocyanin accumulation visible throughout the epidermis of aerial organs (Fig 3.4A). In MYB75WT lines 2 and 11, all plants showed uniformly high, visible levels of anthocyanin accumulation. On the other hand, in MYB75WT lines 12 and 14, MYB75T131A lines 1,22 and 23, and MYB75T131E lines 2,4,5, and 9 purple colouration was observed in only a portion of the plants (Fig 3.4A). No consistent ratio of green to purple plants was observed within any of the lines, and some plants changed colour throughout development, suggesting either stochastic silencing of the transgene, or variations in developmentally controlled turnover of MYB75 protein between individual plants. Hygromycin-based selection of transgenic plants prior to transfer onto soil eliminated any possibility that the green plants are simply not carrying the transgene, and hygromycin-induced 95  mortality of approximately one third was observed in each line, consistent with the presence of a single insert in the transformants. Gene expression analysis by RT-PCR showed that both purple and green plants were expressing recombinant MYB75, whereas western blot detection of recombinant MYB75 showed that protein production was only detectable in purple plants (Fig 3.4B). Together these results indicate that post-translational silencing of MYB75 protein expression may be occurring in individual plants resulting in failure to accumulate high levels of anthocyanins in these individuals. Since the focus of these experiments was to examine the relationship between MYB75 phosphorylation status and anthocyanin production, only purple plants were used for biochemical and gene expression analyses in the remainder of this chapter.  96   Fig 3.4 97  Fig 3.4. Visible anthocyanin accumulation in 35Spr:3xHA:MYB75 gene plants at different rosette stages correlates with expression of recombinant MYB75 protein in all phosphovariants. Heterozygous T2 plants were transferred from hygromycin selection plates to soil around 10 days after germination and grown under regular photoperiod conditions: 16h light/8h dark. MYB75WT line 11 showed consistent visible accumulation of anthocyanins in all individuals: in this line the concentration of purple pigment was most predominant near the centre of the rosette and in leaf vasculature. Lines 12 and 14 of the MYB75WT phosphovariant, as well as all lines from MYB75T131A (lines 1,22 and 23) and MYB75T131E (lines 2,4,5 and 9) displayed bright purple colour in the epidermis of some plants, while others remained green, with no specific ratio of green to purple plants (A). Gene expression analysis performed using reverse transcription polymerase chain reaction (RT-PCR) revealed that green and purple plants expressed recombinant MYB75, while western blot analysis detected recombinant protein only in purple plants (B).   Observation of wild type Arabidopsis plants during their growth cycle revealed that Col-0 and Nossen ecotypes do not show visible signs of anthocyanin production until about six weeks of age, when grown under long day photoperiod and regular light conditions (see Materials and Methods). Shortly after six weeks, as the plants approach senescence, they display a spike in anthocyanin production, with visible purple colouration accumulating in mature rosette leaves, stems and other aerial organs. The high degree of variation between individual wild type plants in levels of total anthocyanins accumulated, after six weeks of age, makes quantitative biochemical analysis at this stage problematic. Furthermore, senescing plants express higher levels of endogenous MYB75; as depicted in eFP Browser, where MYB75 transcript abundance is shown to be significantly higher in senescing rosette leaves than any other tissues or developmental stage (Schmid et al., 2005).  Since 35Spr:3xHA:MYB75 gene lines possess both the transgene and the endogenous MYB75 gene, this extra copy can potentially lead to background MYB75 activity which would interfere with any interpretation of biochemical data in these lines. Thus, for analysis of anthocyanin production in mature Arabidopsis, plant tissue was harvested at approximately five 98  weeks of age, a stage when endogenous MYB75 expression levels are relatively low compared to recombinant MYB75 expression, while expression of recombinant MYB75 protein was abundant and comparable between different phosphovariant lines (Fig.3.4B). This difference in MYB75 expression was clearly demonstrated when visually comparing 5-week-old 35Spr:MYB75 plants with Col-0 wild type plants; the35Spr:MYB75 plants were bright purple, while the Col-0 wild type controls were uniformly green.  Total anthocyanin quantification in mature 35Spr:MYB75 lines revealed a significant increase in anthocyanin levels across all three phosphovariants compared to Col-0 WT controls. However, there was no significant difference between the various phosphovariants in their ability to drive total anthocyanin accumulation (Fig 3.5A). The anthocyanin quantification data was corroborated by gene expression analysis. Quantitative RT-PCR (qPCR) revealed that MYB75WT, MYB75T131A and MYB75T131E lines displayed increased expression of flavonoid and anthocyanin biosynthesis genes compared to Col-0 WT controls (Fig 3.5B). The genes analysed in this figure have previously been shown to be direct targets of MYB75 (Dare et al., 2008). These target genes include chalcone synthase (CHS), dihydroflavonol reductase (DFR), anthocyanin synthase (ANS), UDP-glucose flavonoid glucosyltransferase (UGT75C1) and glutathione S-transferase (GST). The variability observed in gene expression levels was consistent with the biochemical variation found between those individuals, in terms of total levels of anthocyanin. Despite this variation, the overall pattern of these results corroborated published data showing upregulation of MYB75 target genes in 35Spr:MYB75 Arabidopsis lines, and demonstrated, that under these experimental conditions, MYB75 phosphorylation status 99  does not have a significant impact on expression of core flavonoid biosynthetic genes or on anthocyanin levels, in the Col-0 wild type background.  I then considered the possibility that anthocyanin production in each transgenic line might be the result of not only the activity of the recombinant MYB75 protein, but the activity of the endogenous MYB75 gene. However, neither qPCR, nor semi-quantitative RT-PCR analyses yielded a detectable signal when performed with primers specifically designed to detect only the endogenous MYB75 transcripts (data not shown), indicating that, at least at this stage, transcription of endogenous MYB75 is negligible compared to the levels of transgene transcripts. Therefore, I concluded that the increased expression of anthocyanin and flavonoid biosynthesis genes, observed in the 35Spr:MYB75 lines, was being driven primarily by the presence of elevated levels of recombinant MYB75, and that this process was not impacted by phosphovariant status at threonine 131.           100    Fig 3.5 101     Fig 3.5 Quantification of total anthocyanin levels and relative expression of anthocyanin biosynthetic genes in rosette leaves of mature, 5-week-old Arabidopsis plants expressing different phosphovariant forms of MYB75 from a constitutive 35S promoter (CAMV35S).  (A) Rosette leaves were harvested from ~5 -week-old Arabidopsis plants, grown under regular photoperiod conditions, 16h light/8h dark. Total anthocyanin was extracted from mature rosette leaves and measured spectrophotometrically. Approximately 23-48 samples were used for each genotype (see Materials and Methods), with each sample containing tissue from 1-2 plants. Error bars representing + SD (A). Quantitative real-time PCR was performed on total RNA, extracted from rosette leaves of ~5-week-old plants. Relative expression levels were determined as described in Pfaffl (2001), using actin1 and actin8 as reference genes. Each average represents six biological replicates and two technical replicates, error bars represent +SE (B,C).   3.4.2 Flavonoid profiles of mature Arabidopsis plants over-expressing MYB75, as determined by high performance liquid chromatography   The total anthocyanin levels did not differ significantly between plants over-expressing different phosphovariants of MYB75, in mature rosette leaves, where levels of recombinant Fig 3.5 continued 102  protein were comparable between different phosphovariants (Fig 3.4 and 3.5). However, the assay used in the previous section only provides a crude estimate of total anthocyanin levels and does not reveal any details about the biochemical species of flavonoids present in the extract. Therefore, high performance liquid chromatography (HPLC) was used to determine whether there were any changes in the flavonoid profiles, i.e. in the relative abundance of specific molecular species in the extracts obtained from different phosphovariant genotypes. This experiment included analysis of flavonol compounds as well as anthocyanins. MYB75 has been shown to affect the initial steps of flavonoid metabolism through regulation of early flavonoid biosynthesis enzymes (Dare et al., 2008, Borevitz et al., 2000), and these biosynthetic intermediates are thought to be directed towards other flavonoid end-products, including the anthocyanin branch and the flavonol branch, through metabolic channelling (Tohge et al., 2005; Stracke et al., 2007).  Total flavonoids were extracted from mature rosette leaves of 5-week-old Arabidopsis plants using 50% aqueous methanol and prepared for HPLC analysis and quantification. To ensure that total extract concentrations were comparable between samples, the amount of methanol added to the plant tissue was proportional to the fresh weight of plant tissue used in each sample (see Materials and Methods). The chromatography and peak quantification was performed by Dr. Simone Castillarin and Dr. Lina Madilao. Although Col-0 wild type plants were also analysed as a baseline reference, the impact of each T-131 phosphovariant mutation (T131A and T131E) on biochemical profiles was assessed by comparing 35Spr:MYB75T131A and 35Spr:MYB75T131E lines to the WT over-expressor, 35Spr:MYB75WT.   103  As previously reported in the literature, total anthocyanin levels in all MYB75 over-expressing lines were about 50 times greater than in Col-0 WT (Fig 3.6 A), while flavonol levels only showed a marginal increase in 35Spr:MYB75 lines compared to Col-0 WT controls (Fig 3.6 B).   Qualitatively, the anthocyanin profiles were similar for all three MYB75 over-expressing genotypes. The molecular species present included A5, A6, A8, A9, A10, A11 and A13, with A11 being the most abundant anthocyanin, as previously reported in the literature (Tohge et al., 2005). However, several of the resolved peaks showed statistically significant differences in the abundance, as assessed by peak area. The T131A and T131E mutations resulted in a decrease in the abundance of A5, A8 and A13, with A5 and A8, by about half in both phosphovariants compared to the WT over-expressor, while levels of A13 in the mutant lines are only at 1/5 the amount found in 35Spr:MYB75WT(Fig 3.6 A).   In order to interpret these results, it is important to first discuss how different anthocyanin molecular species are generated. The aglycone core of flavonoid molecules (e.g. cyanidin, for anthocyanins, and quercetin and kaempferol for flavonols) are products of phenylpropanoid metabolism. However, most of the molecular diversity among these compounds is generated through modifications of their aglycone skeletons by methylation and glycosylation as well as acylation reactions involving addition of organic acids (sinapoyl, malonyl and p-coumaroyl moieties) to the flavonoid molecule at various positions. This process of flavonoid decoration is mediated by a suite of enzymes of which only a small number have been biochemically characterized.  104   Anthocyanin modification occurs in sequential stages and, in Arabidopsis thaliana ultimately leads to the generation of highly decorated anthocyanin (A11) that contains a malonyl, sinapoyl and glucoasylated p-coumaroyl groups (Fig 3.6). The different enzymes required for anthocyanin decoration in Arabidopsis, and their biochemical functions are depicted in Fig 3.7. In summary, the core cyanidin molecule is glycosylated at the C3 and C5 positions of the flavonoid C and A rings respectively, in reactions catalyzed by UGT75C1 (anthocyanin 5-O-glucosyltrasferase), and UGT79B1, (flavonoid 3-O-glucosyltransferase) (Tohge et al., 2005). The glucosyl group attached to C3 position is then decorated with a xylosyl group and p-coumaroyl groups, while the glucosyl group at C5 position can be malonylated (reviewed in Sasaki et al., 2014). Glycosylation of the 3 position, as well as the subsequent decorating of the glycosyl moiety are thought to precede glycosylation at C5 (reviewed in Sasaki et al., 2014).   UGT75C1 has been identified as a direct target of MYB75 (Dare et al., 2008), but according to our results its expression was not affected by the T131A and T131E mutations (Fig 3.5). Other genes which are known to show increased expression in PAP1-D (MYB75 over-expressor) plants include UGT78D2, At3AT1 and At3AT2 (Tohge et al., 2005; Luo et al., 2007), however, it is not known whether these or any other anthocyanin modifying genes are direct transcriptional targets of MYB75. In some cases, gene deletion/silencing experiments can generate plants in which interpretation of the anthocyanin profiles is relatively straightforward, particularly when the mutation results in failure to produce an anthocyanin species containing a specific modifying group. For instance, an insertional mutant with a disrupted At5MAT gene, was found to lack malonylated anthocyanins, A5, A8 and A9 (Luo et al., 2007). On the other hand, some anthocyanin modifications are important for overall stability of the pigment 105  molecule and mutations in these genes can result in a reduction in the total anthocyanin content. For example, deletion of UGT78D2 resulted in a 21% reduction of total anthocyanins, indicating that glycosylation of the C3 position of the anthocyanin C ring is important for overall stability and/or sequestration of the molecule (Tohge et al., 2005).   The common structural feature shared by anthocyanins A5, A8 and A13 (all of which are reduced In MYB75T131A and MYB75T131E mutants) is the p-coumaroyl group at the R2 position. This could mean that expression of At3AT1 and At3AT2, whose gene products are required for anthocyanin p-coumaroylation, is reduced in MYB75T131A and MYB75T131E compared to MYB75WT. However, neither MYB75T131A nor MYB75T131E are entirely deficient in the expression of these enzymes, since both mutants accumulate A11 (which has a p-coumaroyl group) to levels comparable to MYB75WT plants. Furthermore, all three phosphovariants of MYB75 have significantly more anthocyanins, including more of each molecular species, than does the Col-0 WT control, indicating that all the anthocyanin-modifying enzymes required to produce these compounds are upregulated in MYB75-over-expressing plants, regardless of the phosphovariant form of the protein.   Flavonol profiles in the rosette leaves of PAP1-D plants, as reported in the literature, display a 30% reduction in kaempferol glycosides, and a ten-fold increase in quercetin derivatives compared to WT controls (Tohge et al., 2005). This shift in flavonol abundance was not observed in our experiment. Instead overall flavonol levels were slightly elevated in all 35Spr:MYB75 lines compared to the Col-0 WT controls, and the types of molecular species found across all genotypes were qualitatively comparable. When compared to 35Spr:MYB75WT, the phosphomutant over-expressor, 35Spr:MYB75T131A displayed a decrease in F8, (quercetin-106  dirhamnoside), as well as an unknown flavonol compound corresponding to peak 6. Conversely, 35Spr:MYB75T131E plants displayed an increase in several types of flavonols, including three kaempferol glycosides, F2, F3 and F20, and a quercetin glycoside, F5. Fig 3.8 lists some of the flavonol modifying enzymes characterized to date, which are responsible for the addition of rhamnosyl and glycosyl groups to the flavonoid A and C rings, at the indicated positions. In contrast to the pattern seen in PAP1-D plants, it appears that ectopic expression of MYB75 may be impacting the biosynthesis of the flavonol aglycone core. Among the phosphovariant genotypes, the phosphomimic form of MYB75T131E appears to have a stronger positive influence on flavonol accumulation.       107   Fig 3.6 A 108      R-time (min) Peak ID PEAK AREAS Significant changes Col-0 WT 35Spr:MYB75WT 35Spr:MYB75T131A 35Spr:MYB75T131E 10.4 A10  7.78 + 1.42 7.32 + 2.42 5.12 + 1.76  10.6 A6  9.78 + 1.60 11.50 + 4.72 9.10 + 3.08  11.1 A8 0.584 67.00 + 13.9 74.98 + 27.12 73.15 + 16.26  11.2 A8   45.62 + 13.04 32.35 +  12.53 22.70 + 6.47   T131A,T131E 12.01 A10  43.48 + 9.13 30.62+ 13.40 32.02 + 8.17  12.4 A11 1.555 257.18 + 59.29 225.3 + 95.08 251.8 + 77.21  12.6 A13  8.95 + 1.78 8.50+ 3.64 10.92 + 4.73  12.7 A13   24.70 + 6.19 16.15 + 6.00 12.72 +5.38    T131A,T131E 13.6 A11  6.88 + 2.04 4.98 + 2.71 6.10 + 2.72  14.1 A5 0.4025 51.40 + 26.35 12.8 + 4.09 14.52 + 2.96    T131A,T131E 15.3 A9  25.35 + 9.23 10.68 + 5.41 13.98 + 9.85                        Fig 3.6 A continued 109    Fig 3.6 B  110    R-time (min) Peak ID PEAK AREAS Significant changes Col-0 WT 35Spr:MYB75WT 35Spr:MYB75T131A 35Spr:MYB75T131E 9.9 F8  2.10 + 1.69 29.78 +9.13 10.98 + 5.64 22.40 + 2.46        T131A 10.6 A6,A10  2.25 + 0.56 25.45 + 4.17 6.35 + 2.34 7.92 + 1.18  10.86 F3  62.22 + 26.57 93.72 + 11.30 91.85 +  39.09 216.40 + 43.62        T131E 11.1 A8  34.58 + 11.68 113.32 + 10.76 65.85 + 24.82 63.45 +  2.23  11.6 ?   24.58 + 4.62    11.82 ?  4.68 + 2.40 97.65 + 8.55 34.82 + 12.56 98.95 + 44.98        T131A 12.49 A11  2.30  102.60 + 23.38 88.50 + 36.37 83.80 + 22.81  12.75 F2,F5, F2 58.45 + 23.74 109.00 + 5.79 106.28 + 52.88 236.45 + 50.03        T131E 14.18 F1  517.75+ 125.1 858.55 + 44.85 617.32 + 172.49 816.38 + 22.94  14.5 ?  77.02 + 13.74 115.65 + 6.05 79.68 + 15.14 81.15 + 5.84  15.32 A9  1.18 + 0.31 10.62 + 3.80 4.62 + 2.15 8.75 + 5.05   Fig 3.6. Biochemical profiling and quantification of flavonoid compounds in adult 35Spr:MYB75 plants using high performance liquid chromatography (HPLC). Heterozygous T2 plants were germinated on ½MS medium with hygromycin. Ten days after germination plants were transferred to soil and grown under 16h light, 8h dark light cycle. Mature rosette leaf tissue was harvested from 5-week-old plants and flavonoids were extracted in 50% methanol. Four samples were collected for each genotype, each sample was collected from at least two individual plants, from a single line. The lines used in this analysis were as follows: 35Spr:MYB75WT L11, L12, L14, 35Spr:MYB75T131A L1, L22, L23 and 35Spr:MYB75T131E, L2, L4, L5, L9. HPLC was performed as described in materials and methods. Major peaks were identified, and quantification of each compound was performed by integrating the area under each peak and taking the average among the four samples for each genotype. Statistical analysis was performed using ANOVA and post-hoc Tukey, to identify quantitative differences in the biochemical profiles between genotypes. Significant changes are highlighted in purple (A) and yellow (B) in the tables above. Phosphomutant and phosphomimic over-expressor lines (35Spr:MYB75T131A and 35Spr:MYB75T131E, respectively) were compared to the WT over-expressor (35Spr:MYB75WT). Flavonol quantification shows that compared to 35Spr:MYB75WT lines, T131A mutation results in decreased amounts of F8 (quercetin 3-7-dirhamnoside) and an unidentified compound (peak 6), whereas T131E mutation results in an increased amount of F3 (kaemferol 3-7-dirhamnoside) as well as compounds represented by peak 8, which include F2 (kaempferol 3-O-rhamnoside 7-O-glycoside), F5 (quercetin 3-7-dirhamnoside), and F20 (kaempferol 3-O-glucoside 7-O-rhamnoside (B).    Fig 3.6 B continued  111   Fig 3.7 Anthocyanin modifying enzymes in Arabidopsis.  Gene name/AGI Function Reference UGT78D2 (At5g17050) Flavonoid-3-O-glycosyltransferase, Glycosylation of anthocyanidins and flavonols at C3 Tohge et al., 2005. UGT79B1 (At5g54060) Anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase, Xylosylation of anthocyanin at glucosyl group attached to C3. Yonekura-Sakakibara et al., 2012. UGT84A2 (At3g21560) Sinapic acid:UDP-glucose glucosyltransferase,   Synthesis of 1-O-sinapoylglucose for anthocyanin modification. Yonekura-Sakakibara et al., 2012. UGT75C1 (At4g14090) Anthocyanidin 5-O-glucosyltransferase,  Glycosylation of anthocyanin “A” ring at position 5 Tohge et al., 2005. At3AT1 (At1g03940) Anthocyanidin 3-O-glucoside coumaroyl CoA transferase, p-coumaroylation of anthocyanins at R2  Luo et al., 2007. At3AT2 (At1g03495) Anthocyanidin 3-O-glucoside coumaroyl CoA transferase,  p-coumaroylation of anthocyanins at R2 Luo et al., 2007. SAT (At2g3000) Sinapoyl-Glc:anthocyanin acyltransferase,  Sinapoylation of xylosyl group, at R1 Fraser et al., 2007. AT5MAT (At3g29590) Anthocyanin 5-glucoside malonyltransferase,  Malonylation of anthocyanin at R3 D’auria et al, 2007; Luo et al., 2007. AtBLU10 (At4g27830) Anthocyanin 3-O-6-O-coumaroylglucoside: glucosyltransferase, Glycosylation of p-coumaroyl group attached to R2.  Miyahara et al., 2013.   Fig 3.7  112     Fig 3.8. Flavonol modifying enzymes in Arabidopsis. Gene name/AGI Function Reference UGT78D1 (At1g30530) Flavonol-3-O-rhamnosyltransferase, Addition of rhamnosyl group at R1 Jones et al., 2003. UGT78D2 (At5g17050) Flavonoid-3-O-glucosyltransferase, Addition of glucosyl group at R1 Tohge et al., 2005. UGT78D3 (At1g30530) Flavonol-3-O-arabinosyltransferase, Addition of arabinosyl group at R1 Yonekura-Sakakibara et al., 2008. UGT73C6 (At2g36790) Flavonol-7-O-glucosyltransferase, Addition of glucosyl group at R2 Jones et al., 2003. UGT89C1 (At1g06000) Flavonol-7-O-rhamnosyltransferase, Addition of rhamnosyl group at R2 Yonekura-Sakakibara et al., 2007. UGT71B5 Quercetin 3-O-glucosyltransferase,  Addition of glucosyl group at R1 Lim et al., 2004. OMT1 (At5g54160) Flavonol-3-O-methyltransferase, Addition of a methyl group to R1 Muzac et al., 2000. F3’H (TT7) (AT5G07990) Flavonoid 3’-hydroxylase, Addition of hydroxyl group to carbon 3 of B ring Schoenbohm et al., 2005. F3H (TT6) (AT3G51240) Flavonone 3’-hydroxylase, Addition of hydroxyl group to carbon 3 of C ring Pelletier and Shirley, 1996.   Fig 3.8  113  3.5 Discussion  The aim of the experiments described in this chapter was to investigate how the phosphorylation status of MYB75 might affect flavonoid metabolism in vivo, by examining the biochemical phenotypes of plants carrying different phosphovariant versions of MYB75. My initial attempts to express MYB75 from its endogenous promoter, in the myb75- background did not yield consistent expression levels of the MYB75 phosphovariants in these transgenic lines, making complementation analysis impossible. The possibility that transcriptional autoregulation of MYB75 might be a feature of the MYB75 regulatory network, and the potential impact of phosphorylation status on such a putative process, may provide a possible explanation for differences in expression levels of the various phosphovariants, when driven by the endogenous MYB75 promoter. However, another possibility (and perhaps a more likely explanation) for my failure to isolate transgenic lines expressing adequate levels of MYB75, could be involvement of this gene in early developmental processes. According to expression data in eFP Browser, mature Arabidopsis plants display the highest levels of MYB75 expression in senescing leaves (Winter et al., 2007; Schmit et al., 2005). However, a closer look at the developmental expression of MYB75 reveals very specific expression pattern in the embryo, beginning with the heart stage, where MYB75 expression levels are slightly elevated in cotyledons, compared to other organs. The torpedo stage displays an even more intricate distribution of MYB75, with the highest expression levels observed in the root apical meristem (Fig 3.9).  114   Fig 3.9 Relative levels of MYB75 expression in Arabidopsis, throughout developmental stages (A) and during embryo development (B). Arabidopsis eFPBrowser at bar.utoronto.ca.   (Winter et al., 2007; Schmit et al., 2005).   Fig 3.9 A B 115  The precise patterning of MYB75 expression in these organs indicates a possible involvement of MYB75 in development at early embryonic growth stages. Perturbation in MYB75 expression levels (and possibly phosphorylation status) in these developing tissues could potentially be lethal to the embryo. Failure to isolate any lines at all from transformation experiments with certain phosphovariants under the control of the endogenous MYB75 promoter might also indicate that these particular phosphovariants are embryo-lethal. The idea of embryo lethality arising from MYB75 mis-expression is supported by the observation that successful over-expression of the MYB75 gene (35Spr:3xHA:MYB75 gene lines) consistently yielded only a few lines, despite screening over 50 individual T1 plants for each genotype. In addition to low recovery of transgenic progeny, the surviving lines did not display the canonical PAP1-D phenotype at early seedling stages, and only began to display prominent purple colour at mature stages, or when seedlings were transferred medium containing sucrose. In conclusion, although complementation experiments did not yield informative results with respect to anthocyanin accumulation patterns, they did highlight the possible importance of this gene in other developmental processes. I therefore wanted to address the question of whether MYB75 could be influencing development indirectly, through regulation of phenylpropanoid/flavonoid biosynthesis genes, or whether, like its bHLH and WDR partners, MYB75 participates directly in regulation of genes participating in development.  Repeated attempts to express different MYB75 phosphovariants using a 35S promoter to drive the cDNA version of MYB75 failed to yield detectable proteins levels, in myb75- mutant (Nossen), and Col-0 backgrounds. Although the lack of detectable MYB75 protein in these lines was very surprising at first, a recent publication shed light on a possible reason for this pattern. 116  It appears that the first intron of MYB75 is vital for transcriptional upregulation in response to sucrose (Broekling et al., 2016). Most importantly, those authors showed that PAP1Dwg:GUS, (a reporter construct consisting of the MYB75 promoter, together with the full length gene, including all introns and exons), displayed not only responsiveness to elevated sucrose but a much wider distribution of reporter expression across different tissues and organs, than did the PAP1Dpro:GUS reporter (Broekling et al., 2016). The visual reporter expression pattern was confirmed by RT-PCR analysis and coincided with AtGenEXPRESS gene expression data (Broekling et al., 2016; Schmid et al., 2005). In the study by Broekling et al., (2016) PAP1Dwg:GUS lines grown on 2% sucrose displayed GUS activity in the hypocotyl, root, and emerging leaves of 14-day-old seedlings, with high concentration of GUS activity along petioles and mid vein; in contrast, no GUS activity was observed in PAP1Dpro:GUS lines at this stage of development. The ability of introns to boost gene expression in a manner comparable to cis-elements found in promoter sequences has been widely reported in plants and animals (Laxa, 2016). Additionally, introns have been shown to be important for mRNA stability in Arabidopsis and other species (Narsai et al., 2007; Wang et al., 2007). Thus, my use of the full-length MYB75 gene instead of the cDNA was probably vital in ensuring sufficient MYB75 expression, and yielding detectable levels of MYB75 protein, in 35Spr:3xHA:MYB75 gene lines.   Despite being under the control of a strong constitutive 35S promoter, visible anthocyanin accumulation in Arabidpopsis plants carrying 35Spr:3xHA:MYB75 gene constructs was only observed once they were transferred to soil. The most likely explanation for this delayed response is the difference in light fluence between the growth space where plants were selected on petri dishes containing hygromycin and the growth chamber where the plants 117  were soil-grown (see Materials and Methods). Anthocyanin accumulation in petri plates may also have been suppressed by accumulation of ethylene, due to poor gas diffusion in the closed petri dishes in which the seedlings were germinated (Jeong et al., 2010). This type of environmental control of anthocyanin production in 35Spr:PAP1D plants has been reported in the past (Rowan et al., 2009). When 35Spr:PAP1D Arabidopsis plants were grown under high light and low temperature conditions they accumulated abundant anthocyanins and the leaves displayed purple colouration. This increase in anthocyanin levels coincided with an increase in expression of flavonoid biosynthetic genes, including (PAL1, CHS, CHI, F3H, F3’H and DFR) as well as regulatory genes, including TT8, GL3 and EGL3. However, when these MYB75 over-expressing plants were transferred to low light and high temperature conditions expression levels of these genes, along with anthocyanin production decreased dramatically (Rowan et al., 2009). Some of this environmental control of anthocyanin production appears to act through transcriptional regulation of MYB75-interacting partners, including TT8, EGL3 and GL3. However, posttranslational regulation of MYB75, including turnover/stability of the MYB75 protein, cannot be excluded from playing a part in this process as well.   When transgenic seedlings were grown on petri plates under continuous, low fluence light and 6% sucrose, they showed signs of anthocyanin accumulation, typical of the PAP1-D phenotype. Pigment accumulation in seedlings carrying 35Spr:MYB75 gene constructs was visibly stronger than in Col-0 WT plants (Fig 3.2). In addition, the levels of total anthocyanin accumulation correlated with MYB75 protein levels for all the phosphovariants (Fig 3.2 B, C and Fig 3.3). MYB75 protein levels decreased in the dark, as anticipated, but the MYB75T131A phosphovariant showed the smallest decrease, indicating that it may be less susceptible to 118  degradation than MYB75WT and MYB75T131E. The observation that phosphorylation at T-131 renders MYB75 less stable in the dark, appears to contradict the conclusions presented by Li et al (2016), who reported that phosphorylation at both T126E and T131E was necessary to stabilize MYB75 protein. One way to reconcile my data with their published results is to entertain the possibility that phosphorylation at threonine 131 alone has the opposite effect on protein stability than phosphorylation at both sites. Multisite phosphorylation has been well documented in mammals and has been shown to be an important mechanism of transcription factor-regulation through integration of multiple input signals (reviewed in Holmberg et al., 2002). Phosphorylation at different sites of a given protein can affect different aspects of protein function or have opposing effect on the same function. For instance, phosphorylation of the p53 tumour suppressor factor at Ser315 by the kinase Cdk2 increases the ability of p53 to bind DNA (Vousden, 2002; Apella and Anderson, 2001), while phosphorylation at Ser15, Thr18, Ser20 and Ser37 by several different kinases, disrupts the interaction between p53 and Mdm2, (an E3 ubiquitin ligase), prevents p53 from being targeted for degradation, and facilitates its nuclear translocation. Stability of p53 is also regulated through phosphorylation by several different kinases: phosphorylation at Ser33, Thr81 and Ser392 stabilizes p53, while phosphorylation at Thr55, Ser371 and Ser376 triggers degradation (Bech-Otschir et al., 2001; Saito et al., 2002). Other examples include the HSF1 transcription factor, whose transcriptional activity can be both positively and negatively regulated through phosphorylation of different sites (Holmberg et al., 2001; Chu et al., 1998). In Arabidopsis, HsfA2 (heat stress factor A2), is a transcription factor that plays a role in response to heat stress and is phosphorylated by MPK6 at Thr249. This phosphorylation event induces translocation of HsfA2 to the nucleus (Evrard et 119  al., 2013). In the same publication the authors showed that total inhibition of phosphorylation reduced the cellular abundance of Hsf2 protein, but that MPK6 was not important for Hsf2 stability, implying that phosphorylation at other sites was responsible for stabilizing the protein (Evrard et al., 2013). Examples of plant multisite phosphorylation are less well-documented than those from mammalian systems. However, there is enough evidence to suggest that this phenomenon is broadly conserved between species, and is particularly prevalent in transcription factors which, like MYB75, require the integration of multiple stimuli to fulfil their function. Therefore, it is possible that phosphorylation of MYB75 at Thr131 versus phosphorylation at both threonine 126 and 131 may have opposing effects on protein stability.  The exact degradation pathway that is affected by phosphorylation status is not entirely clear. Although Li et al., (2016) showed that COP1 and MPK4 had opposing effects on anthocyanin accumulation, the cop1/mpk4 double mutant accumulated very little anthocyanin, indicating that the stabilizing effect of MYB75 phosphorylation by MPK4 is not dependent on MYB75 binding the COP/SPA complex (Li et al., 2016, Fig8D). This is congruent with my data presented in Chapter 2, where MYB75 binding to SPA proteins was not affected in any of the phosphovariants (Fig 2.4). Furthermore, Li et al., (2016) demonstrated that all MYB75 phosphovariants still respond to changes in light intensity (Li et al., 2016, Fig8A), which I also observed in my results (Fig 3.2 and 3.3), reinforcing the idea that there is likely an additional mechanism of MYB75 turnover; one that is affected by phosphorylation, but not necessarily tied to turnover mediated by COP/SPA complexes.  120  Five-week-old Arabidopsis plants over-expressing MYB75WT, MYB75T131A and MYB75T131E showed visible signs of anthocyanin accumulation and produced abundant MYB75 protein (Fig 3.4). However, no significant differences were observed in the total anthocyanin production (Fig 3.5A) or expression of anthocyanin biosynthetic genes between different phosphovariants (Fig 3.5 B, C). On the other hand, HPLC analysis of anthocyanin and flavonol biochemical profiles, revealed quantitative differences in some biochemical species between MYB75WT, and the phosphovariant over-expressors, MYB75T131A and MYB75T131E. Analysis of anthocyanin profiles by HPLC revealed a reduction in the levels of the A5, A8 and A13 components in both, MYB75T131A and MYB75T131E compared to the MYB75WT over-expressor (Fig 3.6A). The common feature among these compounds is a p-coumaroyl group (which is glycosylated in A8) at the R2 position. This would suggest that the expression of enzymes required for the catalysis of anthocyanin p-coumaroylation, (At3AT1 and At2AT2; Luo et al., 2007) is reduced in the phosphomutant plants compared to MYB75WT. The challenge with this interpretation is that other biochemical species containing a p-coumaroyl group, which include A3, A6, A7, A9, A10 and A11, in the anthocyanin HPLC profiles, appear to be unaffected and accumulate to comparable levels among the three over-expressor genotypes (Fig 3.6A). This suggests a more complex relationship between MYB75 phosphorylation status and the abundance of these metabolic products, than simply a change in the ability of MYB75 to regulate transcription of specific biosynthetic enzymes. Finally, the reduction of A5, A8 and A13 in both MYB75T131A and MYB75T131E genotypes might indicate that the activity of both phosphorylated and unphosphorylated MYB75 is required for most efficient production of these compounds.  121  MYB75 has been shown to regulate some of the anthocyanin modifying enzymes. UGT75C1, which catalyzes glycosylation of the anthocyanin A ring at the C5 position, was shown earlier to be a direct target of MYB75 (Dare et al., 2008). In addition, UGT78D2 (flavonoid-3-O-glycosyltransferase), as well as the enzymes required for p-coumaroylation, At3AT1 and At2AT2, are up-regulated in PAP1-D plants (Tohge et al., 2005, Luo et al., 2007). Finally, analysis of publicly available microarray data showed that UGT79B1 and UGT82A2 were co-expressed with anthocyanin biosynthetic genes, including MYB75 (Yonekura-Sakakibara et al., 2012). Asides from UGT75C1 (Dare et al., 2008), it is not known if MYB75 can regulate the expression of anthocyanin modifying genes directly and whether phosphorylation status might have an impact on this process.  Anthocyanin and flavonol profiles in plants change in response to environmental stimuli and stress. For instance, in wild type Arabidopsis seedlings grown under high light conditions on ½MS medium with 3% sucrose, showed higher proportion of anthocyanin A9 compared to control conditions, where A11 was the predominant molecular species (Kovinich et al., 2014). In the same study, the control plants displayed accumulation of only A8, A9 and A11, while in seedlings treated with sucrose and high light A3, A5, A7, A8, A9 and A11 were detected. The authors concluded that some anthocyanin species, such as A3, A5 and A7 accumulate exclusively in response to stress, while others, such as A11 are present constitutively. Furthermore, the authors demonstrated that expression levels of many anthocyanin modifying enzymes responded to stress, and that changes in the level of expression of a particular enzyme corresponded to changes in the abundance of a biochemical species whose formation requires its catalytic activity. 122   It is difficult to compare my results to the data published by Kovinich et al., (2014), as the age and genotypes of the plants used in my work are different from theirs. However, those authors demonstrated an important fundamental point: plants have a way of regulating which anthocyanin species accumulate in response to a particular stress signal, and that this process is at least in part controlled at the transcriptional level. In addition to stress-induced changes, anthocyanin profiles differ in different tissues and organs; in this case, as in stress response, differential expression of anthocyanin modifying enzymes appears to be a major mechanism driving changes in biochemical profiles (reviewed in Saito et al., 2013).  It is important in interpreting my data to consider that regulation of anthocyanin biosynthesis and decoration is likely a coordinated effort involving different transcriptional regulators, responsive to specific environmental and developmental cues. From this perspective, it is therefore possible that spatial and temporal distribution of MYB75 protein plays a part in that process. According to my results, MYB75T131E is more labile than MYB75T131A, particularly in the dark. It is also apparent that treatment with sucrose and/or continuous light has a stabilizing effect on MYB75, with the greatest change in protein abundance observed in MYB75T131E. These data indicate that phosphorylation of MYB75 at threonine 131 makes the protein more susceptible to turnover under specific conditions, which in turn can lead to differential spatial and temporal distribution of phosphorylated and unphosphorylated forms of MYB75, depending on the cellular environment. Therefore, it is possible that the differences in the biochemical profiles observed between phosphovariants are a result of differences in distribution of MYB75 protein, between different tissues and cell types within the mature leaves that were being sampled. 123  MYB75 is known to affect flavonol production. Leaves of PAP1-D-over-expressing Arabidopsis plants have reduced amounts kaempferol dirhamnoside (F1), which is the major flavonol in that tissue, where it comprises ~50% of the flavonol content in wild type plants (Tohge et al., 2005). On the other hand, the same study reported an increase in quercetin glycosides (F4-F6) in PAP1-D over-expressing plants, with levels ten times higher than in wild type controls (Tohge et al., 2005). My experiments tell a somewhat different story; first, all the flavonol species increase in quantity in MYB75 over-expressing lines compared to Col-0 WT (Fig 3.6B). Second, the 35Spr:MYB75T131A genotype shows a decrease in F8, (a quercetin derivative) compared to 35Spr:MYB75WT lines. Finally, MYB75T131E lines have the highest flavonol levels, with a significant increase in kaempferol glycosides (F2 and F3) as well as quercetin glycosides (F5 and F20), relative to the MYB75WT over-expressor.  MYB75 is a direct transcriptional activator of genes encoding the flavonoid biosynthetic enzymes CHS and F3H (Dare et al., 2008), as well as UGT75C1 glycosyltransferase (Tohge et al., 2005), all of which are important for flavonol accumulation. However, there is no report of MYB75 affecting the expression of flavonol synthase (FLS), whose activity is required for the biosynthesis of kaempferol and quercetin aglycones, nor is there any record of MYB75 regulating any of the flavonol modifying enzymes listed in Fig 3.8. Like anthocyanins, different flavonol molecular species accumulate in different tissues and in response to different stimuli (Tohge et al., 2005). Therefore, differential degradation of each MYB75 phosphovariant may be the driving mechanism for differences in biochemical profiles. We cannot however exclude the possibility that MYB75 plays a role in driving the expression of particular flavonol modifying 124  enzymes, and that MYB75T131E is a more potent activator of this process than the other phosphovariants.  Another possible explanation for increased flavonol levels in 35Spr:MYB75T131E plants compared to the other over-expressor genotypes, is that MYB75 phosphorylation status has an indirect impact on flavonol biosynthesis, through its interaction with TCP3. As previously described, TCP3 binds to MYB75 and facilitates the formation of the MYB-bHLH-WDR complex, which is responsible for enhancing transcription of anthocyanin biosynthetic genes. However, TCP3 is also reported to interact with MYB12 and MYB111, thereby increasing transcription of flavonol biosynthetic genes (Li and Zachgo, 2013). TCP3 thus plays a role in metabolic channelling, and can influence both anthocyanin and flavonol biosynthesis, depending on the interacting partners. MYB75 itself can negatively influence flavonol levels, through metabolic channelling of flavonoid precursors into the anthocyanin branch. However, the interplay between TCP3 and different MYBs provides an additional explanation as to why some studies, such as Tohge et al., (2005) reported decreased levels of certain flavonols in PAP1D over-expressing plants. Over-expression of MYB75 protein may result in sequestration of TCP3, making it unavailable for interaction with MYB12 and MYB111, and thereby negatively influence transcription of the flavonol biosynthetic genes. This idea falls in line with the Y2H data presented in Chapter 2, where MYB75T131E displayed a weaker interaction with TCP3 than did any other phosphovariant in yeast (Fig 2.4). If this is also true in planta a reduction in MYB75-TCP3 interaction strength could mean that in 35Spr:MYB75T131E plants, more TCP3 would be available to interact with MYBs associated with flavonol biosynthesis. Conversely, MYB75T131A might sequester TCP3, preventing it from binding to MYB12 and MYB111, resulting 125  in the reduced flavonol content observed in Fig 3.6B. Assuming our phosphovariants accurately represent protein phosphorylation status, then flavonol profiles in 35Spr:MYB75WT would vary depending on the proportion of MYB75 that is phosphorylated, which is ultimately dictated by environmental and developmental cues. While this variable sequestration hypothesis would potentially explain the differences in total flavonol levels observed in plants over-expressing MYB75, it does not explain why some biochemical species of flavonols increase while others decrease in specific MYB75 phosphovariant lines.  MYB11, MYB12 and MYB111 are known to regulate flavonols biosynthesis and have been shown to impact core flavonol biosynthetic genes, including chalcone isomerase, flavonol 3-hydroxylase and flavonol synthase (Stracke et al., 2007). These MYBs also appear to influence expression of flavonol modifying enzymes. Interestingly, each gene has a different expression pattern and a distinct influence on flavonol profiles, indicating that spatial and temporal distribution of flavonoid-regulating transcription factors does influence the biochemical profiles, and that a particular tissue and cell type is wired to produce a unique set of molecular species of flavonoids at a given growth stage. Although the regulation of flavonoid biosynthetic genes by MYB transcription factors has been well characterized, little is known about the way flavonoid modifying enzymes are regulated, and what transcriptional regulators are involved. It is clear that most genes participating in phenylpropanoid metabolism are controlled by several transcription factors, reinforcing the idea that the biochemical profile is a result of cooperative action of multiple transcriptional regulators found in a particular cellular milieu. This picture is further complicated by the different stability of each biochemical species (Rowan et al., 2009); thus, biochemical profiles are not only controlled through the biochemical activity of gene 126  products required to catalyze synthesis of specific compounds, but also by the activity of enzymes responsible for their turnover.  In addition to responding to stress, spatial and temporal regulation of flavonoid metabolism is developmentally controlled, implicating these compounds in development. Flavonols have been shown to influence auxin transport and therefore can potentially have a profound impact on a variety of developmental processes. Although MYB75 has been shown to influence flavonol content in Arabidopsis, none of the studies on MYB75 have explored developmental changes in plants either lacking or over-expressing the protein. My data suggests that MYB75 phosphorylation status has an impact on the biochemical profiles of anthocyanins and flavonols, and that 35Spr:MYB75T131E plants in particular, accumulate more quercetin and kaempferol glycosides than do plants over-expressing 35Spr:MYB75WT or 35Spr:MYB75T131A. MYB75 expression patterns reported in the eFPBrowser database also suggest that this protein has a highly specific and vital role to play during embryogenesis. Therefore, my results as well as previously published data prompted me to examine MYB75-over-expressing plants at different life stages to determine if there are any developmental differences between different phosphovariant over-expressor lines.      127  3.6 Materials and Methods 3.6.1 Creation of transgenic Arabidopsis plant lines expressing different phosphovariant forms of MYB75 protein  3.6.1.1 Creation of MYB75 phosphovariants by point mutation, using site-directed mutagenesis To generate the full gene version of each phosphovariant, site-directed mutagenesis was used to replace the threonine residue (either T126 or T131) with an alanine or a glutamic acid. MYB75 gene locus was PCR-amplified using Phusion® polymerase, and the primers F-5’ GCCGGATCCATGGAGGGTTCGTCC AAAGGGC and R-5’ GCCCTGCAGCTAATCAAATTTCACAG TCTCTCC. Purified PCR products were digested with BamHI and PstI restriction endonucleases and ligated into linearized pUC19 vector using T4 DNA ligase. The resulting construct was used as a template for the creation of MYB75-gene phosphovariants by employing the Q5 ® site-directed mutagenesis kit (New England Biolabs), in conjunction with primers shown in table 3.1 Mutagenized versions of MYB75 were sequenced to verify that each threonine residue was appropriately replaced with either alanine or glutamic acid, and to ensure that there are no errors in the gene sequence.          128     Table 3.1 Primers for site-directed mutagenesis, used to generate each phosphovariant version of the full length MYB75 gene.  cDNA Primer sequences and modification Thr (WT codon) Ala Glu WT MYB75 ATTACGCCCATTCCTACAACACCGG T126-> ACG T131-> ACA ------- ------- T126A F- GACATTGCGCCCATTCCTACAACACC R- TCTCTTTTTCATCTTTATCTTACAACACGGTTCATG ACG GCG --- T131A F- TACAGCACCGGCACTAAAAAACAATGTTTATAAGCC R- GGAATGGGCGTAATGTCTCTCTTTTTCATC ACA GCA --- T126/131A F- TACAGCACCGGCACTAAAAAACAATGTTTATAAGCC R- GGAATGGGCGCAATGTCTCTCTTTTTCATC ACG ACA GCG GCA --- T126E F-  GACATTGAGCCCATTCCTACAACACC R- TCTCTTTTTCATCTTTATCTTACAACACGGTTCATG ACG  --- GAG T131E F- TACAGAACCGGCACTAAAAAACAATGTTTATAAGCC R- GGAATGGGCGTAATGTCTCTCTTTTTCATC ACA --- GAA T126/131E F- TACAGAACCGGCACTAAAAAACAATGTTTATAAGCC R- GGAATGGGCTCAATGTCTCTCTTTTTCATC ACG ACA --- GAG GAA     3.6.1.2 Cloning constructs for plant transformation  Constructs carrying cDNA of MYB75 phosphovariants were provided by Dr. Zhenhua Yonge: these included MYB75T126A, MYB75T131A, MYB75T126/131A, MYB75T126E, MYB75T131E and MYB75T126/131E, which Dr. Yonge generated by site-directed mutagenesis. All of the above phosphovariants were cloned by Dr. Yonge into the gateway entry vector pENTR2B, behind an endogenous MYB75 promoter, encompassing 2742bp of genomic sequence upstream of the MYB75 translational start site (Fig 3.10). The MYB75pr:MYB75 cDNA constructs were transferred into the binary gateway vector pEARLY-GATE301, by recombination based cloning, using LR Clonase II (Thermo Fisher Scientific). The resulting constructs were subsequently used to transform myb75- (Nossen) mutant plants.  Table 3.1 129    Fig 3.10 MYB75 promoter- MYB75 cDNA cassette, used to transform Arabidopsis plants (myb75- Nossen).    GATEWAY® recombination-based cloning was employed to generate constructs that were transformed into Arabidopsis plants to over-express full gene versions of MYB75, with an N-terminal 3X Hemagglutinin-epitope tag, under the control of a constitutive CAMV35S promoter. Each phosphovariant was amplified from mutagenized MYB75 gene templates described in 3.6.1.1, by PCR, using Phusion® polymerase and GATEWAY® compatible primers: F-5’ GGGGACAAGTTTG TACAAAAAAGCAGGC TTCATGGAGGGT TCGTCCAAAGGGC and R-5’GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAATCA AATTTCACAGTCTCTCC . Purified PCR products were inserted into the entry vector pDONRzeo (invitrogen), by recombination-based cloning, using the BP Clonase II enzyme (Thermo Fischer Scientific), and transformed into TOP10 competent E.coli cells (Thermo Fischer Scientific). Successful clones were isolated and sequenced for subsequent recombination, using LR Clonase II enzyme (Thermo Fischer Scientific), into the GATEWAY® compatible binary vector, pGWB15, which contains a 35S promoter an N-terminal 3xHA- epitope tag sequences. The constructs 35Spr:3XHA:MYB75WT, ATG TAG MYB75 cDNA MYB75 promoter 2742 bp 747 bp Fig 3.10 130  35Spr:3XHA:MYB75T131A, and 35Spr:3XHA:MYB75T131E were transformed into Arabidopsis Col-0 WT plants.  Dexamethasone-inducible lines were generated by PCR amplifying 3xHA:MYB75 gene fusion cassette using the 35Spr:3xHA:MYB75 gene constructs, described above, as templates. Each 3xHA:MYB75 cassette (MYB75WT, MYB75T131A and MYB75T131E) was amplified by PCR using Phusion® polymerase, and the primers F-5’ CCGCTCGAGATGGGG TTAATTAAC ATCTTTTACCC and R-5’ GGCCTCGAGCTAATCAAATTTCAC AGTCTCTCCATCG. Purified PCR products were digested with XhoI restriction endonuclease and ligated into the binary vector pTA7002, which was linearized with XhoI. The generated constructs DEXpr:3XHA:MYB75WT, DEXpr:3XHA:MYB75T131A, and DEXpr:3XHA:MYB75T131E were sequenced to confirm appropriate cassette orientation downstream of the DEX promoter, and were subsequently transformed into Arabidopsis Col-0 WT plants.  3.6.1.3 Plant growth conditions and transformation  Arabidopsis seeds were surface-sterilized using chlorine gas and plated on petri dishes containing ½ Murishige and Skoog (½MS) medium, with 0.8% plant agar. All seeds were vernalized at 4ᵒC in the dark for 3-4, days before being put into the light. Seeds were germinated under a light fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, at 21ᵒC and grown under these conditions until they were transferred to soil. Between 7-12 days after germination seedlings were planted in soil and transferred to a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark, and temperature of 21ᵒC.    Plant transformation was performed using Agrobacterium tumefaciens GV3101 strain. Each construct destined for transformation into plants was first transformed into chemically 131  competent Agrobacteria. Successfully transformed Agrobacteria were selected on LB media with 50µg/ml gentamycin and a second antibiotic specific for each construct (Table 3.2). To perform plant transformation by floral dipping, 100ml of Agrobacterium culture was grown for each construct, in liquid LB medium with antibiotics, at 28ᵒC, in the dark, until OD600 ~ 0.8. Cultures were harvested by centrifugation at 5500 x g, for 20 min at room temperature and resuspended in transformation solution (30ml distilled water, 1.5g sucrose, 9µL Silwet-77). Flowers of ~5-week-old Arabidopsis plants grown under 16h light/8h dark photoperiod were submerged in the transformation suspension for 1-2 min, with gentle agitation. Dipped plants were laid down in trays, covered, and left in the dark overnight. The following day the plants were returned into the growth chamber. Each plant was dipped twice, with each dip being one week apart, to increase the number of transformants. Seeds (T0) from transformed plants were harvested and plated on ½MS plates with appropriate selection, to isolate successfully transformed T1 plants (Table 3.2). Dr. Zhenhua Yonge transformed myb75- Nossen mutants with MYB75pr:MYB75 cDNA constructs (all phosphovariants). I performed the transformations of 35Spr:3xHA:MYB75 gene and DEXpr:3xHA:MYB75 gene lines.   Lines over-expressing MYB75 (35Spr:3xHA:MYB75 gene) were isolated by visually screening adult T1 plants for anthocyanin accumulation, which was manifested as purple colouration in the rosette leaves. The visual screen was followed by western blot detection of recombinant MYB75 protein, using an anti HA-tag antibody. DEXpr:3xHA:MYB75 gene lines were isolated by spraying adult T1 plants with 30µM DEX, and looking for anthocyanin accumulation visually, and immunoscreening for recombinant protein production. All lines which displayed dark purple colour also showed high levels of recombinant MYB75 protein 132  expression. Several plant lines were established for each genotype: 35Spr:MYB75WT; L11, L12, L14, 35Spr:MYB75T131A; L1, L22, L23, 35Spr: MYB75T131E; L2, L4, L5 and L9, DEXpr:3xHA:MYB75WT; L1, L3, L4, L5 and DEXpr:3xHA:MYB75T131E; L6, L7 and L9. These lines were used in subsequent experiments, using equal proportions of each line to represent a specific genotype.   Table 3.2 List of constructs used for stable transformation of Arabidopsis plants to create lines expressing various MYB75 phosphovariants under endogenous (MYB75pr), constitutive (35Spr) and inducible (DEXpr) promoters. CONSTRUCT VECTOR Selection  bacteria Selection  Plants Plant background MYB75pr:MYB75WT (cDNA) pEarleyGate301 Kan * Basta  ** myb75- Nossen MYB75pr:MYB75T126A (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen MYB75pr:MYB75T131A (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen MYB75pr:MYB75T126E (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen MYB75pr:MYB75T131E (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen MYB75pr:MYB75T126/131A (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen MYB75prMYB75T126/131E (cDNA) pEarleyGate301 Kan  Basta  myb75- Nossen 35Spr:3xHA:MYB75 WT (gene) pGWB15 Kan  Hyg *** Col-0 WT 35Spr:3xHA:MYB75T131A (gene) pGWB15 Kan  Hyg  Col-0 WT 35Spr:3xHA:MYB75T131E (gene) pGWB15 Kan  Hyg  Col-0 WT DEXpr:3xHA:MYB75 WT (gene) pTA7002 Kan  Hyg  Col-0 WT DEXpr:3xHA:MYB75T131A (gene) pTA7002 Kan  Hyg  Col-0 WT DEXpr:3xHA:MYB75T131E (gene) pTA7002 Kan  Hyg  Col-0 WT *Kan= Kanamycin 50µg/ml  **Basta= Glufosinate/Basta 10µg/ml ***Hyg= Hygromycin 30µg/ml  3.6.2 Sucrose treatment of Arabidopsis seedlings  Heterozygous T2 seedlings carrying 35Spr:3xHA:MYB75 gene (MYB75WT, MYB75T131A and MYB75T131E) were grown on petri dishes containing ½MS medium supplemented with hygromycin, under growth conditions described in section 3.6.1.3. At ten days post germination Table 3.2 133  the seedlings were transferred to ½MS medium containing 6% sucrose and incubated for 24 hours under continuous light, at a fluence of ~35 µmol m-2s-1. Control plants were left in dark on ½MS without sucrose. The seedlings were photographed using a Cannon (EOS rebel T5) digital camera mounted on a Zeiss Stemi 2000-C dissecting scope. Anthocyanin quantification was performed as described in section 3.6.3 using a pool of 20-40 seedlings for each phosphovariant. Western blot analysis was performed as described in section 2.6.4.3 using a pool of 20-40 seedlings for each phosphovariant.  3.6.3 Total anthocyanin quantification  MYB75pr:MYB75 cDNA plants (myb75- Nossen background) were sampled after 48h of continuous light, at a fluence ~100-120 µmol m-2s-1, to observe promoter responsiveness to light and to determine if any of the MYB75 phosphovariants can complement the myb75- mutant phenotype in terms of anthocyanin accumulation. Plant lines carrying 35Spr:3xHA:MYB75 gene constructs (MYB75WT, MYB75T131A and MYB75T131E), were grown and sampled under 16h light/8h dark conditions (fluence ~100-120 µmol m-2s-1). Anthocyanin quantification was performed as described by Mehrtens et al., (2005). Mature rosette leaves from ~5week old plants were collected into microcentrifuge tubes (1-2mg) and fresh weight was recorded for each sample. The tissue was frozen in liquid nitrogen, ground to a powder and resuspended in 1ml of extraction solution (49.5% methanol, 49.5% distilled water, 1% acetic acid). The samples were incubated at 45ᵒC for 4h, centrifuged at 15000 rpm and the cleared supernatant was transferred to a cuvette. Absorbance was measured at A530 and A650 and total anthocyanin quantity was determined using the equation Qanthocyanin=[A530-(A650x0.25)]/mass(g).  134  3.6.4 Recombinant MYB75 protein extraction, immunodetection and relative quantification of protein levels using ImageJ   Detection of recombinant MYB75 protein was performed as described in Chapter 2, sections 2.6.4.2, 2.6.4.3, and 2.6.4.4. 3.6.5 RNA extraction, reverse-transcription PCR and qPCR  RNA extraction from mature rosette leaves of ~5-week-old Arabidopsis plants was performed using TRIzol® reagent (Thermo Fischer Scientific), according to manufacturer’s protocol. RNA quality was evaluated by running 5µL of RNA on 2% agarose gel, and the RNA concentration was determined spectrophotometrically using NanoDrop® (Thermo Fischer Scientific). Reverse transcription was performed using SuperscriptII (Invitrogen) to obtain total cDNA.  Semi-quantitative RT-PCR was performed using MangoMix™ (Bioline), and by running the PCR reaction for 25 cycles. The resulting products were analysed by gel electrophoresis and relative amount of cDNA for each gene was quantified by evaluating band intensity using ImageJ. Real time PCR (or qPCR) was performed using SsoAdvanced™ Universal SYBR® Green Supermix (BIO-RAD), on a CFX connect real time system (BIORAD). Primers used for these experiments are shown in table 3.3. To differentiate between endogenous and recombinant MYB75 expression, two different primer sets were designed. One set of primers was designed to amplify the end of the MYB75 gene to the UTR (not present in the recombinant transcript), in order to detect endogenous MYB75, while recombinant MYB75 expression was detected using a forward primer that binds the linker sequence between the HA-epitope tag and a reverse primer that binds to the end of the MYB75 coding region. 135  Quantification of relative gene expression, by real-time PCR was performed as follows. Primer efficiency was determined for each primer set prior to running the final qPCR. Raw Ct data was processed using the Pfaffl mathematical model (Pfaffl 2001), where the expression ratio= [EtargetΔCt(control-sample)]÷[ EreferenceΔCt(control-sample)]. This formula was used to account for differences in amplification rates caused by primer efficiencies higher than 100% (100% efficiency E=2.0). The housekeeping genes used as reference samples were actin1 and actin 8, and the control genotype used was Col-0 WT.                 136   Table 3.3 Primer sequences used for semi-quantitative RT-PCR and qPCR.   GENE and AGI code FORWARD REVERSE Product size (bp) Primer Efficiency  Act1  At3G18780 CCACCTGAAAGGAAGTACAGTG GTGAACGATTCCTGGACCTG 119 2.57 Act8  At1G49240 TCTAAGGAGGAGCAGGTTTGA TTATCCGAGTTTGAAGAGGCT 131 2.15 MYB75 At1G56650 (endogenous) T CCT AGA GGA AAG CCA AGA GG ACACAAACGCAAACAAATGTTCG 159 2.27 MYB75 At1G56650 T CCT AGA GGA AAG CCA AGA GG CTAATCAAATTTCACAGTCTCTCCATCG 132  HA:MYB75 CAGTGCAGCGCTGTTATCACAAG CTAATCAAATTTCACAGTCTCTCCATCG 792  DFR  At5G42800 CGTTCGAGATCCCGGTAATTTG ATGGCATCATCGTAGCTTCCTT 120 2.5 ANS At4G22880 CGAGTCAGACGATGAAAAGATCCGTGAG CGGCTTTCTTGACACGCTCCATTAGATCA 131 2.58 UGT75C1 At4G14090 CTCAAACGATGTGGTTCAAACGCCCT CGGTGATAGGCTCTGTTTCGGTGG 82 2.58 GST At5G17220 GGCTGACGTGGAGACCTA CCAAGACCACTCCTAGCTTCAC 137 2.54 CHS At5G13930 ACACATGTGTGCTTACATGGC TTAGGGACTTCGACCACCAC 69 2.82  3.6.6 Biochemical profiling of flavonoids and anthocyanins in 35Spr:3xHA:MYB75 gene plants by high performance liquid chromatography  Mature rosette leaves of ~5-week-old Arabidopsis plants carrying 35Spr:3xHA:MYB75 (MYB75WT, MYB75T131A, MYB75T131E), grown on soil under 16h light/ 8h dark light cycle under a light fluence of ~100-120 µmol m-2s-1  were harvested, weighed and ground on liquid nitrogen. For each phosphovariant genotype a total of four samples were used, each sample containing tissue from 2-3 plants. All lines belonging to a particular phosphovariant genotype were equally represented in the samples tested. Total phenolic extraction was performed in 50% methanol Table 3.3 137  solution, using an extraction volume proportional to the fresh weight of the tissue in each sample, to ensure exctracts were equally concentrated. Samples were analysed by liquid chromatography (LC) and LC-mass spectrophotometry (MS) by Dr. Lina Midilao, while quantitative analysis of the resolved peaks was performed by Dr. Simone Castellarin. Anthocyanins were measured on an Agilent 1100 LC/MSD Trap XCT Plus mass spectrometer. Separation of anthocyanin compounds was achieved on an Agilent Zorbax SB-C18 column (150mm × 4.6mm ID, 1.8μm, 3.5um pore size) held at 57°C. The mobile phases were: water-formic acid (2%), solvent A, and acetonitrile-formic acid (2%), solvent B. Flow rate was 0.8ml/min. The solvent gradient program was 0.5min, 6% B; 4 min, 10 % B; 13min, 25 % B; 20 min, 35% B; 25min, 60% B; 30min, 95% B; and 32min, 6% B. A Diode array detector was used to detect absorbance at 365 nm for flavonols and 520 nm for anthocyanins. The flavonols and anthocyanins mass spectra were analysed after electrospray ionization (ESI) in alternating positive and negative ionization mode with a scan range between 50 and 850 m/z. Annotation of compounds was based on the comparison of absorption spectra, MS fragmentation patterns, and relative elution time with the ones of Arabidopsis thaliana flavonols and anthocyanins reported in previous studies, as a reference (Yonekura-Sakakibara et al., 2008; Yonekura-Sakakibara et al., 2012; Shi and Xie 2014). Quantity of each flavonol and anthocyanin molecular species was reported a speak areas. Statistical analysis was performed to determine differences in the quantity of each compound: statistics (ANOVA and Tukey test for separating the averages) for each peak as well as for the total area. 138  CHAPTER 4  Developmental changes in Arabidopsis plants over-expressing MYB75T131A and MYB75T131E phosphovariants  4.1 Introduction  By definition, plant secondary metabolites such as flavonoids are dispensable for immediate survival and reproduction. Over the years of plant research, in controlled laboratory settings we have come to accept this view, and in some ways overlooked the profound impact that these compounds can have on development. In deciduous trees, autumnal leaf senescence reveals the accumulation of foliar anthocyanins, manifested as bright red and orange colours. It is widely believed that anthocyanins play a photoprotective role, shielding the photosynthetic machinery from damaging light, at a stage when other protective mechanisms, as well as cellular repair machinery are shutting down. Shielding the photosystems from excess light prevents photoinhibition and enables ongoing energy production, during nutrient resorption from senescing leaves. This process ensures that nutrient stores in perennial tissues are sufficient for overwintering and for supporting new growth during the subsequent spring (Field et al., 2001; Hoch et al., 2001; Hoch et al., 2003). Autumnal anthocyanin accumulation is induced by cold temperatures but appears also to be closely tied to the onset of chlorophyll degradation (Ishikura,1973; Hoch et al., 2001), indicating that plastid-derived signals may play a role in regulating anthocyanin production. In Arabidopsis leaf senescence also involves nutrient remobilization, resorption, and redistribution to reproductive organs. However, unlike studies of deciduous trees in the field, chronic stress experiments with Arabidopsis performed in a laboratory setting, did not show any correlation between anthocyanin levels and chlorophyll turnover (Misyura et al., 2012). Furthermore, analysis of transparent testa mutants indicated 139  that the inability to produce anthocyanins did not impact the plant’s ability to remobilize nutrients under chronic moderate stress conditions (Misyura et al., 2013). Nevertheless, anthocyanins play a vital role in development, as they control how much visible light reaches the photosynthetic machinery, which can ultimately affect light harvesting, photosynthesis and photomorphogenesis (reviewed in Steyn et al., 2002).  Flavonols also have an established role in development, due to their ability to modulate auxin flow (Brown et al, 2001). In his pioneering study, Brown et al., (2001) demonstrated that Arabidopsis seedlings grown on a medium containing the flavonoid precursor, naringenin, exhibited phenotypes similar to seedlings grown on NPA (N-1-naphtylphtalamic acid; a potent auxin inhibitor), including decreased root growth and gravitropism. Brown et al., (2001) demonstrated that the flavonoid deficient tt4 mutants displayed elevated auxin flow in seedlings, and in stems of mature plants. In wild type Arabidopsis plants auxin flow was highest in stem segments close to the apex and slightly lower in basal sections. Conversely, tt4 mutants lacking the key flavonoid biosynthetic enzyme chalcone synthase (CHS), displayed an increase of over 300% in auxin flow near the stem base and significantly higher overall rate of basipetal auxin flow, from the shoot to the root (Brown et al., 2001). The transparent testa (tt) mutations in Arabidopsis have provided crucial insights into the relationship between flavonoid metabolism and plant development. Fig 4.1 displays a simplified flavonoid biosynthetic pathway with abbreviated gene names and the corresponding transparent testa mutations. Analysis of different transparent testa mutants, in the Landsberg (Ler) Arabidopsis ecotype, which are deficient in different flavonoid biosynthetic enzymes and regulatory proteins, has revealed a range of phenotypic changes in root and shoot architecture. 140  These mutants displayed a change in the number, position and initiation site of root hairs, and lateral roots. In aerial tissues they displayed changes in inflorescence height and number, as well as changes in silique density (Buer and Djorjevic, 2009). Further examination of transparent testa mutants revealed that tt4 (CHS), tt5 (CHI) and tt7 (F3’H) had numerous lateral root initiation points, located close to each other, resulting in aberrant root architecture, while mutations in the regulatory genes, tt8 and ttg2 led to a shallower root system (Buer et al., 2013; Fig 3, Table4). Analysis of aerial organ development revealed that the mutants tt1, tt2 (MYB transcription factor) and tt4 had slower leaf expansion, while tt8 plants showed faster leaf expansion. Bolting time and inflorescence elongation rates were faster in tt8, ttg1 and ttg2 and slower in tt4, tt6 and tt7 (Buer et al., 2013; Table6).  In WT Arabidopsis plants different molecular species of flavonols displayed specific distribution patterns. Quantification of flavonols in different tissues of Arabidopsis seedlings revealed that quercetin and kaempferol accumulated in the upper root, root-hypocotyl transition zone and, to a smaller extent in the upper hypocotyl. Staining with diphenylboric acid 2-aminoethyl ester (DPBA), enables in vivo visualization of flavonol distribution using fluorescence microscopy: quercetin derivatives produce golden yellow fluorescence, while kaempferol and naringenin (and their corresponding glycosides) fluoresce yellow-green. This method, in conjunction with biochemical analyses of different plant organs, has been instrumental in determining the distribution of flavonols in Arabidopsis. In young seedlings, kaempferol was the primary flavonol in the lower root, while small amounts of quercetin were found in the lower hypocotyl (Peer et al., 2001). Developing cotyledons contained mainly glycosylated flavonols, while aglycones were the predominant flavonols in hypocotyls, upper 141  root and root-hypocotyl transition zone, for a brief period of time, between 3 and 7 days post-germination (Peer et al., 2001). In developing seedlings quercetin is widely distributed throughout the root, with brightest gold-yellow fluorescence observed in cotyledonary nodes of DPBA-treated seedling. Generally, flavonols were found to be most concentrated in transition zones and actively growing tissues, such as the root-hypocotyl junction, cotyledonary nodes and root elongation zone (Peer et al., 2001; Buer et al., 2013). In some cases these compounds display a cell specific localization pattern; yellow-green fluorescence, indicative of kaempferol accumulation was observed in a ring of cells near the root cortex, with a cone of gold-yellow quercetin-containing cells located below (Peer et al., 2001; Fig 2). In mature plants flavonoids accumulated only in actively growing tissues, including immature siliques, flowers and upper inflorescence stems, where primary growth was ongoing (Peer et al., 2001; Fig 3). Quercetin predominated in floral organs and upper inflorescence stems, with higher concentration of aglycones found in growing tissues, close to the apex, and decreased closer to the base. Anthocyanin accumulation on the other hand, showed the opposite pattern, with higher levels of anthocyanins near the base, and less anthocyanins near the apex (Peer et al., 2001; Fig 4).    Mutations in flavonoid biosynthetic and regulatory genes led to alterations in flavonoid accumulation patterns, and in many cases changes in auxin flow in specific parts of the plant. For instance, the tt3 mutant, containing a lesion in the DFR gene, accumulated more flavonols in the root tips, and concurrently showed a decrease in root-ward auxin flow. Similarly, tt7- plants with a mutation in F3’H, had lower levels of quercetin and, were devoid of kaempferol aglycone, in the root-shoot junction; this mutant also showed decreased basipetal (rootward) and acropetal (shootward) auxin transport. Conversely, the mutants tt5 and tt6 displayed 142  increased basipetal auxin transport; the root tips of the mutants, tt5, tt6, and tt7 were deficient in quercetin-3-glycoside, although tt5 accumulated this compound in the root-shoot junction (Buer et al., 2013). These experiments illustrate a complex relationship between auxin flow and accumulation of different flavonol biochemical species at specific locations in the plant. In most cases, mutations that result in reduced total flavonol levels lead to overall increased auxin flow (such as in tt4 mutants). In other cases however, auxin flow was reduced as a result of failure to accumulate specific flavonol compounds (for instance in the tt7 mutant) (Buer et al., 2013). The most plausible explanation for this observation is that auxin flow requires canalization, that is to say, site specific auxin accumulation, which normally drives development and organogenesis and requires auxin flow be restricted to specific cell channels or routes. It appears that accumulation of flavonols in organ junctions and areas of active growth, could be playing a role in controlling auxin flow and direction, and thereby influence development. What remains unclear is how each molecular species of flavonol acts to influence auxin flow and how the distribution of these specific flavonols can influence development through regulation of auxin distribution. Fig 4.1 displays a simplified flavonoid biosynthetic pathway with abbreviated gene names and corresponding transparent testa mutations.    Increasing evidence suggest that specific molecular species of flavonols play unique roles in controlling auxin flow. Initially it was thought that only aglycones have a biological role to play in auxin distribution, while the glycosides had no effect on auxin flow (reviewed in Peer et al., 2001). However, subsequent experiments demonstrated that the apparent lack of biological function for the glycosides in vitro was caused by failure of plants to take up exogenously applied flavonol glycosides (Buer et al., 2013), and recent work revealed that 143  kaempferol 3-O-rhamnoside-7-O-rhamnoside can inhibit polar auxin transport (Yin et al., 2014). These authors found that a mutation in UGT78D2 (flavonol-3-O-glycosyltransferase) led to increased accumulation of kaempferol 3-O-rhamnoside-7-O-rhamnoside. The ugt78d2 null mutant plants displayed reduced basipetal auxin flow in stems as well as reduced apical dominance and increased branching. Additionally, ugt78d2 mutants displayed a dwarf phenotype, resembling the abcb1/abcb19 double mutant known to be defective in auxin transport channels. Analysis of several mutants defective in different steps of flavonol modification demonstrated that it was specifically the accumulation of kaempferol 3-O-rhamnoside-7-O-rhamnoside (K1) that was responsible for the observed phenotypes (Yin et al., 2014). Recent analysis of another Arabidopsis mutant, with a lesion in UGT89C1 (flavonol-7-O-rhamnosyltransferase) revealed that plants deficient in 7-rhamnosylated flavonols have severe phenotypic defects, including deformed trichomes, upward bending cotyledons, and abnormally shaped epidermal cells (Kuhn et al., 2016). Unlike tt mutants, mutation in ugt89c1 did not result in alteration to auxin flow. Instead, null mutants accumulated higher levels of the auxin precursor, indole-3-acetonitrile (IAN), as well as various degradation products, indicating that 7-rhamnosylated flavonols affect auxin metabolism rather than transport. These developmental phenotypes, as well as the accumulation of auxin derivatives, are suppressed in mutant backgrounds where the flavonol backbone is not produced, such as fls and tt4, reinforcing the idea that specifically decorated flavonols play unique roles in plant development (Yin et al.,2014; Kuhn et al., 2016). Interestingly, localization studies using fluorescent protein fusions, showed that UGT89C1 gene products localized near sites of vascular development in the root (Kuhn et al., 2016; Fig 5).  144    Fig 4.1 Simplified flavonoid biosynthetic pathway in Arabidopsis, depicting key flavonoid biosynthetic enzymes and corresponding tt mutants; adapted from Buer et al., 2013.   Flavonols have been shown to affect auxin fluxes in several ways. For instance, exogenous application of quercetin to Arabidopsis roots triggered relocation of the PIN1 auxin efflux channels, redirecting auxin flow during the gravitropic response (Santelia et al., 2007). Fig 4.1 145  Another study demonstrated that the expression patterns of different PIN efflux channel proteins (PIN1, PIN2, PIN3 and PIN4) changed in tt3 and tt4 mutants. The authors also showed, using immunolocalization, that PIN efflux channels, normally restricted to the vascular cells, were mislocalized in tt mutants, and could be found in the cortex and epidermis, adjacent to the vasculature (Peer et al., 2004). Interestingly, treatment of tt4 Arabidopsis plants with am auxin influx inhibitor restored normal PIN localization, indicating that changes in gene expression and localization patterns of PIN channels in tt mutants was caused by deregulation of auxin transport, in the absence of flavonols (Peer et al., 2004).  More recently, another group of auxin efflux channels ABCB1/PGP1 and ABCB19/PGP19, were shown to be a target of flavonol-mediated inhibition of auxin transport. In this case, flavonols were shown to negatively regulate auxin transport by disrupting the interaction between the ABCB/PGP channel and TWD1 (twisted dwarf 1) protein, which form a complex necessary to mediate auxin transport (Bailly et al., 2008). The exact mechanism by which flavonols modulate PIN channel function has not been established, however, there is evidence to suggest that flavonols influence cell signalling, particularly kinase/phosphatase activity of proteins that regulate PIN channel trafficking and localization to specific membranes (reviewed in Peer and Murphy, 2007). Possible targets include the serine/threonine kinase PINOID (At2g34650) (Christensen et al., 2000; Benjamins et al., 2001; Friml et al., 2004) as well as WAG kinases (At1g53700, At3g14370) (Santner and Watson, 2006). Although we are only beginning to elucidate how flavonols influence auxin signalling, it is clear that these phenolics have a profound effect on auxin flow. It is worthwhile at this point in our discussion to describe how 146  auxin is believed to influence development through localized accumulation and regulation of gene expression, in a cell autonomous fashion.   Auxin can drive global changes in gene expression required for development and differentiation, by driving expression of genes required for hormone biosynthesis and signalling, as well as transcription factors, including global regulators. Auxin affects gene expression primarily by driving the degradation of Aux/IAA repressors, which bind to Auxin Response Factors (ARFs), suppressing their ability to drive expression of auxin-responsive genes (reviewed in Chapman and Estelle, 2009).The products of auxin-responsive genes act as the initiators of  signalling and gene expression cascades, that can impact a wide range of physiological and developmental processes, with auxin distribution acting as a spatial and temporal cue for developmental programming of specific cell populations (reviewed in Chapman and Estelle, 2009; Fabregas et al., 2015).  Auxin synthesis, transport and perception are vital at all stages of development, starting from embryogenesis, where spatial and temporal distribution of auxin concentration maxima determine cell fate and subsequent positional organogenesis. Mutations in genes required for auxin biosynthesis, transport or perception lead to severe defects in early development (reviewed in Mӧller and Weijers, 2009). A prominent example of how auxin impacts embryogenesis includes the MONOPTEROS (MP) mutant, defective in a transcription factor required to elicit auxin response. Arabidopsis mp mutants fail to develop hypocotyls and roots, resulting from the inability to establish a normal apical-basal tissue pattern during embryogenesis (Berleth and Jϋrgens, 1993). Auxin biosynthesis can also have a profound impact on early development; the Arabidopsis quadruple mutant (yuc1/yuc4/yuc10/yuc11) 147  defective in embryo-specific flavin monooxygenases (required for auxin biosynthesis), fail to develop a hypocotyl and a root meristem (Cheng et al., 2007). Auxin transport mutants, defective in one or more PIN efflux channels show a variety of developmental abnormalities, stemming from aberrant cell division during various stages of embryogenesis (reviewed in Mӧller and Weijers, 2009).   During post-embryonic development, positioning of organs and tissues within the plant body are highly dependent on specific spatial and temporal distributions of local auxin concentration maxima (Heisler et al., 2005; reviewed in Fukuda et al., 2004), and the creation of these maxima depends largely on localization of specific auxin efflux and influx channels (Gӓlweiler et al., 1998; Heisler et al., 2005; reviewed in Fabregas et al., 2015). For instance, localization of PIN1 efflux channels can direct auxin flow to sites of organ initiation (Heisler et al., 2005). Furthermore, auxin accumulation was shown to drive PIN1 expression, indicating that there is a positive autoregulatory mechanism that helps to establish the accumulation of auxin maxima at specific positions in the plant (Heisler et al., 2005). In summary, auxin flow initiates a sequence of events, driven by changes in gene expression, that ultimately lead to tissue differentiation and organogenesis.  Most of the plant body architecture is derived from differentiation of meristematic cells located in the shoot apical meristem (SAM) and root apical meristem (RAM): these meristems give rise to aerial parts of the plant and root system, respectively. Two additional meristematic tissues, the procambium and cambium give rise to the plant vascular tissues during primary and secondary growth, respectively. The procambium develops in emerging organs and forms continuous cell files, which eventually develop into mature vasculature. Establishment and 148  maintenance of the procambium is dependent on polar auxin flow, driven primarily by the localization of PIN channels to the basal side of cells (reviewed in Fukuda, 2004; Krecek et al., 2009). Development of the procambium as continuous, connected cell files, which ultimately ensures continuity of plant vasculature, is driven by auxin canalization in narrow cell files, and drainage of auxin from neighboring tissues. This process is at least, in part, driven by positive a feedback loop, whereby auxin upregulates expression of PIN channels. Thus, auxin efflux from one cell to the next increases auxin flow through that cell, leading to auxin canalization through continuous cell files (Sachs, 1981;2000; reviewed in Fukuda et al., 2004).  Besides establishment and positioning of the procambium, auxin plays a central role in the differentiation and development of the plant vasculature, essential for transport of water and nutrients throughout the plant. The plant vascular system is composed of xylem, which transports water and minerals, and phloem, which transports photoassimilates. Each of these tissues contains distinct cell types: the phloem is composed of sieve elements and companion cells as well as phloem parenchyma cells, while the xylem made up of tracheary elements and xylem fibres and xylem parenchyma cells. During primary growth all of these cell types originate from the procambium, and therefore their development depends on auxin transport and auxin response. Arabidopsis AtPIN1 channel localizes in vascular bundles, in procambium and xylem parenchyma cells, and is the primary PIN channel required for vascular development in aerial tissues (Gӓlweiler et al, 1998). The role of auxin in vascular development is best depicted in studies of xylary vessel differentiation. Auxin drives xylem differentiation through activation of global regulators such as MONOPTEROS (ARF5), which in turn drives the expression of HD-ZIP family transcription factors (such as AtHB8) that lead to global changes in gene expression, 149  driving vessel differentiation (Matson et al., 2003). For instance, auxin, along with cytokinin positively regulate the expression of the transcription factors VND6 and VND7 which are global regulators of xylem differentiation (Kubo et al., 2005). These transcriptional regulators trigger a cascade of changes in gene expression that eventually orchestrate key events in vessel differentiation, such as secondary cell wall deposition and programmed cell death (reviewed in Shuetz et al, 2013). Vascular differentiation is a complex process that involves vast regulatory cascades and signalling networks that are beyond the scope of this thesis. The key takeaway for this discussion is that auxin transport and canalization are vital driving mechanisms for vascular development, including vascular continuity, as well as vessel anatomy and positioning.   As a known regulator of flavonoid biosynthesis, MYB75 clearly has an influence on development, at least at the level of metabolite accumulation. However, recent work from the Ellis and Douglas labs has demonstrated that MYB75 is also a regulator of cell wall development (Bhargava et al., 2013), a process closely tied to vascular differentiation and therefore influenced by auxin. The significance of the findings by Bhargava et al., (2013) is that MYB75 probably has additional transcriptional targets, beyond flavonoid biosynthetic genes, and that those targets could be playing a much broader role in plant development. Finally, MYB75 has been identified as a target for phosphorylation by MAP kinases (Li et al; 2016), which play a role in mediating plant stress responses as well as in development. Together, these observations raised the question whether mis-expression of MYB75 or its phosphorylated isoforms might have developmental consequences beyond potential changes in anthocyanin accumulation. In this chapter, I describe distinct developmental phenotypes that appeared in plants over-expressing different phosphovariants of MYB75 and analyse differential gene expression 150  patterns in 35Spr:MYB75 gene over-expressing lines. It is important to note that the data described in this chapter is not a true depiction of the role of MYB75 in development, as the CAMV35S promoter used to over-express different MYB75 phosphovariants leads to ubiquitous protein expression in tissues and developmental contexts where MYB75 would not typically be found. Additionally, the previously observed differential degradation of MYB75T131E phosphovariant, implies that phosphovariants may have different distribution throughout the plant, which further complicates interpretation of my results. Nevertheless, 35Spr:MYB75 over-expressor lines are a powerful tool to identify additional processes that can potentially be influenced by MYB75 phosphorylation status, and to identify new target genes for this transcription factor.   4.2 Impaired germination rates in MYB75pr:MYB75 cDNA plants, expressing MYB75T131A and MYB75T131E phosphovariants  In Chapter 3 I described early attempts to express MYB75 cDNA by the endogenous MYB75 promoter, in a myb75- background. After screening a large number of T1 plants for anthocyanin production and recombinant MYB75 expression, it was determined that some phosphovariants were failing to complement the myb75- mutation because of very low transgene expression. One possible explanation for this is that the expression of one or another phosphovariant is detrimental to early developmental stages, such as embryogenesis or germination, resulting in artificial selection of plants that express very low levels of MYB75. Because of low transgene expression these lines were abandoned after the initial screen, and MYB75pr:MYB75WTcDNA control lines were never established. Nevertheless, I wanted to determine if MYB75pr:MYB75T131A and MYB75pr:MYB75T131E plants showed impaired 151  germination, in order to test my hypothesis that MYB75 expression and phosphorylation status can have an impact on early development. For this purpose I used seeds from homozygous parent plants, from independent lines including six MYB75pr:MYB75T131A and four MYB75pr:MYB75T131E lines. The seeds were plated on ½ MS medium and germination was scored 10 days after placing them in the light. Both Nossen WT and myb75- mutant showed germination rates close to 100%. In contrast, lines carrying MYB75T131A and MYB75T131E  transgene displayed severely impaired germination (26.8% and 62%, respectively) (Fig 4.2). It is challenging to assess this phenotype in the absence of MYB75pr:MYB75WT transgenic control, nevertheless when the two phosphovariants are compared to each other, it is apparent that germination is significantly lower in MYB75T131A expressing plants than in MYB75T131E , indicating that unphosphorylated MYB75 has a greater negative effect on germination than the phosphorylated version. An alternative explanation is that there is simply less recombinant protein in MYB75T131E lines, as this phosphovariant protein was shown to be more labile under certain conditions (see Chapters 2 and 3). Although this data is preliminary, the low germination rates support the idea that my failure to isolate transgenic lines expressing high levels of MYB75pr:MYB75T131A and MYB75pr:MYB75T131E was caused by artificial selection for plants that express lower levels of MYB75. This idea, that ectopic expression of MYB75 is deleterious at early stages of development may also explain why I was subsequently only able to isolate a very small number of 35Spr:MYB75 gene lines, despite screening large numbers of T1 transformants.   152    Fig 4.2. Germination rates in MYB75pr:MYB75 cDNA lines in the myb75- Nossen background.  Seeds from homozygous T3 plants were plated on ½ MS medium along with myb75- and Nossen controls. After vernalization the petri dishes containing transgenic seeds and controls were transferred into the light, and germinated under 8h dark, 16 h light photoperiod. Germination rate was scored ten days after transferring the plates into light. Percentage germination was determined for each line by counting the total number of seeds and the total number of germinated plants. Percentages of germinated plants were averaged for each genotype. Bars represent standard deviation in the germination percentage. Germination rates were 26.8% (SD=9.99) for MYB75pr:MYB75T131A plants and 62% (SD=12.62) for MYB75pr:MYB75T131A . These data indicate that MYB75T131A plants have a significantly lower germination rate than MYB75T131E. T test P <0.05.   4.3   Flowering time and senescence are delayed in Arabidopsis plants over-expressing MYB75T131E  As described in Chapter 3, plants over-expressing MYB75 gene (35Spr:MYB75 gene) did not show anthocyanin accumulation at the seedling stages, unless stressed with continuous light or elevated sucrose concentration in the media. On the other hand, mature plants showed Fig 4.2 153  abundant MYB75 protein expression, accompanied by high levels of anthocyanin production. To determine how MYB75 over-expression and protein phosphorylation status affect development, I monitored the time of bolting and flowering, as well as onset of senescence in 35Spr:MYB75WT, 35Spr:MYB75T131A, and 35Spr:MYB75T131E lines. These experiments were initiated because I noticed that different transgenic lines seemed to flower at different times. However, in order to investigate these flowering-related phenotypes systematically, I needed to synchronize the growth of different MYB75 over-expressor lines along with Col-0 WT controls.  Approximately ten days after germination, lines over-expressing different MYB75 phosphovariants (35Spr:MYB75WT, 35Spr:MYB75T131A, and 35Spr:MYB75T131E) along with Col-0 WT controls were transferred to soil and grown side by side in the same chamber under regular photoperiod, 16h light/ 8h dark, and light fluence ~100-120 µmol m-2s-1. Instead of recording the precise time of bolting for each genotype, I focused on comparing them to each other. Wild type Col-0 plants began to bolt and flower after 4-5 weeks of growth. Transgenic 35Spr:MYB75WT plants showed differences in flowering time between different lines; Line11 displayed flowering time comparable to Col-0 WT plants, while Lines 12 and 14 produced an inflorescence stem and flowers before Col-0 WT of the same age (Fig 4.3 A). This apparent acceleration in development persisted after bolting, as MYB75WT lines 12 and 14 displayed abundant formation of lateral branches and flowers, at a stage when Col-0 WT and MYB75WT line 11 plants had only developed the main inflorescence (Fig 4.3A). Similar developmental acceleration was observed in MYB75T131A lines 1, 22 and 13. Early bolting, flowering and development of numerous lateral branches was consistently observed in all MYB75T131A plants, with only minor differences in developmental speed between lines (Fig 4.1A). Conversely, all 154  MYB75T131E plants displayed a delay in bolting and flowering compared to Col-0 WT Arabidopsis (Fig 4.3A). The developmental delay observed in MYB75T131E lines was most evident in later stages of development. At 7 weeks of age Col-0 WT as well 35Spr:MYB75WT and 35Spr:MYB75T131A lines ceased to flower, had formed mature siliques, and showed signs of senescence manifested as yellowing of the rosette leaves, and desiccating siliques, while all 35Spr:MYB75T131E lines displayed abundant flowers formation at 7 weeks, with only a few young siliques forming at this stage, and healthy green tissue throughout the plant (with no signs of senescence; Fig 4.3C). Despite the variability between individual lines in MYB75WT plants, a clear trend emerged between the phosphovariant plant lines: development is accelerated in plants over-expressing MYB75T131A and retarded in those over-expressing MYB75T131E (Fig 4.3B).  Interestingly, even in lines where anthocyanin production varied in a seemingly stochastic manner, yielding both green and purple plants within the same population, plants of both colour classes displayed the flowering-related developmental phenotypes described above. In the previous chapter, Fig 3.4 demonstrated the stochastic nature of recombinant MYB75 protein accumulation in 35Spr:MYB75 lines, resulting in some plants being purple while others were green (except MYB75WT line11 where all plants were purple). While all plants expressed the transgenic MYB75, only purple plants produced MYB75 protein levels that could be detected by immunoscreening. Those lines with detectable levels of MYB75 protein were also purple from abundant anthocyanin accumulation. Nevertheless, green plants still expressed MYB75 transcripts, according to my RT-PCR results (Fig 3.4 B). The observation of similar developmental differences (with respect to bolting, flowering time and senescence) in both purple and green 35Spr:MYB75 gene lines suggest that recombinant MYB75 is likely being 155  expressed in some tissues of green plants, and that this ectopic expression is sufficient to trigger the developmental change observed, even though it does not lead to anthocyanin accumulation typical of PAP1-D over-expression. This leads to the conclusion that perhaps it is phosphorylation status in combination with ectopic expression of MYB75, driven by the constitutive 35S promoter, rather than MYB75 abundance per se, that results in these phenotypes.                  156    Fig 4.3 Developmental differences in bolting and flowering time of plants over-expressing different phosphovariants of MYB75. Heterozygous T2 plants were plated on ½MS medium with hygromycin, vernalized at 4ᵒC in the dark for 3-4, days before being put into light, with a fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, at 21ᵒC. Between 7-12 days after germination seedlings were planted in soil and transferred to a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark, and temperature at 21ᵒC. Development, including bolting, flowering time and onset of senescence was monitored and recorded for all lines. Among 35Spr:MYB75WT lines, line 11 bolted and flowered at a rate comparable to Col-0 WT, while lines 12 and 14 displayed early bolting and flowering compared to Col-0 controls (A). All 35Spr:MYB75T131A lines bolted and flowered early compared to Col-0 WT (A). Conversely, 35Spr:MYB75T131E plants showed delayed bolting and flowering compared  Fig 4.3 157  Fig 4.3 (continued) to Col-0 WT (A). Overall, the T131A mutation led to earlier bolting and flowering, while T131E mutation appears to slow down the transition from vegetative to reproductive growth (B). Furthermore, 35Spr:MYB75T131E lines displayed delayed maturation and senescence compared to Col-0 plants (D).  4.4   Ectopic vessel development in stems of mature Arabidopsis plants over-expressing different MYB75 phosphovariants In Chapter 3, biochemical analysis by HPLC revealed that MYB75T131E plants accumulated higher levels of specific flavonol species. As described in the introduction of this chapter these compounds are known to influence auxin flow, which affects almost every aspect of development. Auxin flow is closely tied to vascular differentiation, and perturbations in auxin transport often leads to abnormal vasculature. Furthermore, MYB75 has been implicated in secondary cell wall formation (Bhargava et al., 2010), a process tightly linked to vascular development. I therefore decided to examine cross-sections of mature Arabidopsis plants over-expressing different phosphovariants of MYB75, to determine what effect (if any) the over-expression of each MYB75 phosphovariant had on the plant stem vasculature. Other than the cell wall phenotypes described by Barghava et al., in 2010, no other changes associated with vascular development have been reported in myb75- or PAP1-D plants, however. In order to determine if MYB75 over-expression or protein phosphorylation status has any impact on vascular development, I performed a stem sectioning experiment on mature 35Spr:MYB75 gene plants and examined the distribution of vascular and supporting tissues in the cross-sections, using phloroglucinol-HCl and toluidine blue histochemical stains.  In wild type Arabidopsis stems the plant vasculature is organized into distinct vascular bundles, distributed along the stem circumference. The xylem tissues are found on the inner 158  side of the vascular bundles, close to the centre of the stem, while the phloem tissues are found on the outer side of each vascular bundle. A small population of meristematic procambial cells, which gives rise to xylem and phloem, is located between these two tissues in each vascular bundle. In mature stems these bundles display a distinct organization and can be easily recognized in a stem cross-section (Fig 4.4). Mature stems can also develop another meristematic tissue, called the cambium, which drives secondary growth. In woody species the cambium is prominent and can generate abundant secondary vasculature, leading to the formation of wood. In Arabidopsis cambium activity is limited to later stages of development and can contribute to small amount of secondary growth reminiscent of woody species (reviewed in Nieminen et al, 2004; Ragni and Greb, 2017). Interfascicular fibres are strong, lignified cells found organized in arcs between vascular bundles, which provide support for the stem (Fig 4.4).    159   Fig 4.4 Diagramatic representation of Arabidopsis stem cross-sections, at young and mature stages, adapted from Rangi and Greb, 2017. The Arabidopsis inflorescence stem displays a distinct pattern of tissue organization. The vasculature is organized into bundles, comprised of xylem and phloem tissues, divided by a layer of meristematic cells, known as the procambium. During primary growth, procambial cells give rise to xylem and phloem, through periclinal cell division and subsequent differentiation. Xylem and phloem are comprised of vessels and sieve tube elements respectively, as well as fascicular fibres and parenchyma cells. Some parenchyma cells found between vascular bundles differentiate into interfascicular fibres, which develop heavily lignified cell walls, providing support to the plant stem. These interfascicular cells form arcs between the vascular bundles. Upon cessation of primary growth, another meristematic tissue, the cambium, emerges. Fascicular cambium is derived from the procambium, while interfascicular cambium arises from parenchyma cells found between vascular bundles. The cambium drives secondary growth, through anticlinal cell division, providing the plant with girth and rigidity. Reviewed in Rangi and Greb, 2017; Miyashima et al., 2013.  My first round of stem sectioning was performed on plants that were just over 8 weeks old; at this stage, the developmentally delayed 35Spr:MYB75T131E lines had formed mature siliques and were beginning to show signs of senescence, while Col-0 WT, 35Spr:MYB75WT and Fig 4.4 160  35Spr:MYB75T131A plants had reached full senescence and were beginning to desiccate. All plants were watered in the usual cycle, to ensure that the stems did not dry out, which could lead to vascular collapse. The lower portions of the stems, approximately 5cm from the base of the main inflorescence stem, were hand-sectioned, and the stem sections were stained with phloroglucinol-HCl (see Materials and Methods). For economy of effort, only purple plants were used, ensuring that only specimens with higher levels of recombinant MYB75 protein expression were analysed. Phloroglucinol-HCl is a lignin specific stain, that reacts with cinnamaldehyde end groups in lignin, producing a red or fuchsia colour in interfascicular fibres, and a darker red/maroon colour in the xylem of vascular bundles (Mitra and Loqué, 2014).  As expected, wild type Arabidopsis stems showed a normal tissue organization, with vessels elements appearing as clusters of cells with dark reddish-brown-staining cell walls, restricted to vascular bundles (Fig 4.5A). On the other hand, transgenic plants showed what appear to be vessel-like cells in the interfascicular region, with dark reddish-brown staining walls, and a larger cell diameter compared to the surrounding fibres (Fig 4.5 B-D). In 35Spr:MYB75WT plants, the phenotype was relatively mild, with only a few isolated dark cell files in the interfascicular region, made up of cells with a slightly larger diameter than the surrounding fibres (Fig 4.5 B). In 35Spr:MYB75T131A plants, these darker staining cells were more prominent, with a diameter comparable to vessel elements found in the vascular bundles; however, only a few such cells, or very small cell clusters could be seen in the interfascicular region (Fig 4.5 C). In contrast, in plants over-expressing the phosphomimic MYB75T131E, abundant development of vessel elements could be observed in the interfascicular region, with large cell clusters, resembling vessels, stretching between the vascular bundles. In some cases, 161  these clusters spanned the entire length of the interfascicular arc (Fig 4.5D). These phenotypes showed a great deal of variability for each phosphovariant; some of the transgenic stems examined did not show any abnormal tissue distribution at all. However at least 50% of the stems sectioned in plants each genotype (MYB75WT, MYB75T131A and MYB75T131E) showed at least some ectopic vessel production, with a few isolated vessel-like cells in the interfascicular region. About 25-30% of the stems examined for each transgenic line showed the most extreme phenotypes (Fig 4.5), with prominent vessel cell-files in the interfascicular region of MYB75WT and MYB75T131A, and extensive vessel clusters, spanning the entire interfascicular arc in MYB75T131E stems.    162   Fig 4.5 A  B  C  D  If Xy 163  Fig 4.5 Ectopic vessels development in stems of 8-week-old Arabidopsis plants over-expressing different phosphovariants of MYB75. Heterozygous T2 plants carrying 35Spr:MYB75 gene constructs were plated on ½ MS medium with hygromycin, Col-0 WT plants were plated on ½ MS without antibiotic. The seeds were vernalized at 4ᵒC in the dark for 3-4, days before being put into light, with a fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, at 21ᵒC. Between 7 and 12 days after germination, seedlings were planted in soil and transferred to a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark, and temperature at 21ᵒC. After 8 weeks stems from Col-0 WT plants, as well as those from purple transgenic plants were harvested, and the bottom 5cm of each stem was hand sectioned and stained in phloroglucinol solution (2% w/v phloroglucinol in 95% ethanol), by submerging the sections in the solution and adding concentrated HCl dropwise. After 5min incubation the sections were washed three times in distilled water, mounted in water on slides and imaged using a Leica Mecatron precision DMR compound microscope. Stem sections from Col-0 WT plants (A) display normal distribution of vessels, within vascular bundles, where xylem vessels (Xy) can be seen as large perforated cells with dark reddish-brown staining walls. The interfascicular fibres (If) appear as bright red/fuchsia cells, organized in arcs between the vascular bundles. In MYB75 over-expressing lines, ectopic vessels appear in the interfascicular region. 35Spr:MYB75WT (B) and 35Spr:MYB75T131A (C) lines show only a few vessel-like elements between the bundles, while 35Spr:MYB75T131E (D) lines display prominent files of vessels developing in the interfascicular region. Scale bars represent 150µm.   These results indicate that over-expression of MYB75 leads to ectopic differentiation of cells in the interfascicular region that appear to be vessels, and that the MYB75T131E phosphovariant is more effective at driving this process. At this point in development Arabidopsis plants can undergo secondary growth in their lower stems (Altamura et al., 2001; reviewed in Ragni and Greb, 2017). Signs of this secondary growth were observed in all genotypes, including Col-0 WT, with the appearance of cells around the periphery of the stem, with dark staining cell walls, reminiscent of vessel elements (Fig 4.5). It was important at this point to distinguish this normal secondary growth, present in all genotypes, from what I believed to be ectopic vessel formation in MYB75 over-expressing lines. Therefore, for my next round of sectioning I chose somewhat younger plants, in hopes of detecting phenotypic changes in their mature stem sections before, normal secondary growth would have begun. In 164  addition to phloroglucinol-HCl staining, I used toluidine blue stain, which offers a better colour contrast between vessels and fibres. In toluidine blue-stained sections, interfascicular fibre walls appear bright turquoise, whereas the xylem vessels are greenish grey. Finally, in order to show that the wall phenotypes observed in 35Spr:MYB75 plants correlated with transgene expression, it was important to determine whether recombinant MYB75 protein was actually being expressed in the stems. For this purpose, I performed a western blot and conducted RT-PCR analysis on tissue extracts from the lower 5cm of the mature Arabidopsis stems.  The histochemical analysis shown in Fig 4.6 (A) indicates that at this stage in development Col-0 WT plants do not appear to show significant signs of secondary growth. Furthermore, ectopic vessel differentiation was not observed in 35Spr:MYB75WT plants (Fig 4.6 B), and only a mild phenotype was seen in 35Spr:MYB75T131A plants (Fig 4.6 C). On the other hand, 35Spr:MYB75T131E plants showed prominent ectopic vessels developing as small bundles or cell files in the interfascicular arcs (Fig 4.6 D). In toluidine blue-stained cross-sections, the vascular bundles appear greenish grey, in contrast to the bright blue-green interfascicular fibres. Cell clusters with greenish grey walls can be seen in the interfascicular arcs of 35Spr:MYB75T131E stems, but not in the 35Spr:MYB75WT plants (Fig 4.6 E). As in the phloroglucinol-stained sections, these unusual cells have a larger diameter than the surrounding interfascicular fibre cells and are similar in appearance to vessels found in the vascular bundles. I therefore concluded that these are, in fact, ectopic vessel elements that develop in the interfascicular region of MYB75 over-expressing transgenic plants, most prominently in 35Spr:MYB75T131E lines. Due to the limited availability of heterozygous T2 plants, only about a dozen plants were used for each genotype in each round of sectioning. 165  Nevertheless, within this sample pool 35Spr:MYB75T131E plants consistently showed more prominent ectopic vessel development than the other genotypes. Finally, western blot analysis and RT-PCR confirmed that the transgene was being expressed and that the corresponding recombinant protein was being produced in the stems of 35Spr:MYB75 plants. Interestingly, MYB75T131A lines showed a much stronger signal in western blots, while MYB75WT and MYB75T131E protein versions were barely detectable. If this pattern is correct, it suggests that different MYB75 phosphovariants may accumulate to different levels in stems tissues, which could be an important consideration when interpreting how MYB75 over-expression and phosphorylation influence vascular development.      166   Fig 4.6  A B C D E If Xy 167    Fig 4.6 Ectopic vessel development in stems of 7-week-old Arabidopsis plants over-expressing different phosphovariants of MYB75. Heterozygous T2 plants carrying 35Spr:MYB75 gene constructs were plated on ½MS medium with hygromycin, while Col-0 WT plants were plated on ½ MS without antibiotic. The seeds were vernalized at 4ᵒC in the dark for 3, days before being put into light, with a fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, at 21ᵒC. Between 7 and12 days after germination seedlings were planted in soil and transferred to a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark, and temperature at 21ᵒC. After eight weeks stems from Col-0 WT plants, as well as from purple transgenic plants were harvested, and the bottom 5cm of each stem was hand sectioned and stained in phloroglucinol-HCl (A-D), or toluidine blue (E). Stem sections from Col-0 WT plants (A) display normal distribution of vessels, within vascular bundles, where xylem vessels can be seen as large perforated cells. In phloroglucinol-HCl stained sections, vessel walls appear dark reddish-brown, while interfascicular fibres are bright red/fuchsia arcs between the vascular bundles. Lines over-expressing 35Spr:MYB75WT, displayed normal stem tissue organization (B, E left panel). In 35Spr:MYB75T131A plants isolated cells or short cell files, reminiscent of vessels could be seen in the interfascicular region (C). In 35Spr:MYB75T131E   plants large clusters of vessels could be seen in the interfascicular region (D and E, right panel). In toluidine blue-stained sections interfascicular fibres are bright blue green, while xylem vessels are stained a greenish grey. The large lignified cells which form prominent clusters in the interfascicular region of 35Spr:MYB75T131E plants, stain greenish grey, the same as vessel elements found in vascular bundles. Scale bars represent 150µm. Expression of MYB75 in stems of 35Spr:MYB75 plants, was confirmed using RT-PCR and recombinant protein was detected using western blot and immunostaining with anti HA-tag antibody (F). Five stems of each genotype were pooled for each western blot and RT-PCR sample.      Fig 4.6 continued  F 168  4.5   Global gene expression analysis in Arabidopsis plants over-expressing different phosphovariants of MYB75    Biochemical and gene expression analysis performed in Chapter 3 did not yield striking differences between Arabidopsis lines over-expressing different MYB75 phosphovariants, in terms of their ability to regulate core flavonoid biosynthetic genes. It thus appears that phosphorylation does not have a dramatic effect on transcription of genes encoding enzymes in the phenylpropanoid pathway that had previously been identified in the literature as targets of MYB75. However, detailed biochemical profiling of 35Spr:MYB75 gene plants by HPLC revealed quantitative differences between T131A and T131E phosphovariants in accumulation of flavonol and anthocyanin molecular species. Throughout Chapter 4 I have described several developmental changes observed in the 35Spr:MYB75 lines. Biochemical profiling and developmental phenotypes described in Chapters 3 and 4, strongly suggested that MYB75 has a broader role to play in development than regulation of flavonoid metabolism. Furthermore, the distinct phenotypic differences between 35Spr:MYB75T131A and 35Spr:MYB75T131E genotypes led me to believe that these two forms of MYB75 are able to regulate different subsets of genes.    In order to explore this idea further, I conducted global gene expression analysis, using next generation sequencing of total RNA extracted from mature rosette leaves of plants over-expressing either MYB75T131A or the MYB75T131E phosphovariant, using Col-0 WT as the control. Rosette leaves from purple 5-week-old Arabidopsis plants were chosen as the source of RNA for two reasons: first l wished, to look for any correlation between the biochemical profiles  obtained in Chapter 3 (Fig 3.6) and gene expression changes, which required using the same type of tissue as in the HPLC analysis; and second, mature rosette leaves of purple 169  35Spr:MYB75 plants consistently displayed high expression levels of recombinant MYB75 protein, and the amount of total protein produced in this tissue was comparable between different phosphovariants. I did not include 35Spr:MYB75WT plants in my analysis, primarily because without knowing the extent of MYB75 phosphorylation in vivo, results from MYB75WT over-expressing lines would be uninterpretable. Instead, I compared MYB75T131A and MYB75T131E, separately to Col-0 WT, using published expression data on 35Spr:MYB75 and PAP1-D as an independent reference when discussing my results. The goal of this analysis was to obtain an overview of how MYB75 phosphorylation state affected gene expression. Venn analysis was conducted on the entire dataset (by Dr. Darren Wong), to determine which genes displayed changes in their expression levels, in either one or both phosphovariants. Only genes that were up-or down-regulated at least twofold in each phosphovariant (compared to Col-0 WT) were described in the final analysis (Fig 4.7 and Fig 4.8). When classifying genes, instead of using GO annotation I chose to create my own categories that were more pertinent to this study. Genes were classified according to their best characterized function which was determined (when possible) from relevant publications found in TAIR. Some genes were broadly classified in metabolism and homeostasis, as they appeared in various publications in broad biological contexts. These include genes required for biosynthesis of amino acids, carbohydrate metabolism and various membrane transport proteins. Some genes classified in this category were enzymes whose catalytic function has been predicted, but whose involvement in a precise biological process is not well defined, as they are implicated in a wide range of cellular processes. Genes in this category, as well as those classified as “unknown”, may need to be reclassified in the future, when their exact function is refined. For the purposes 170  of this study, I will focus on changes in the expression of genes that pertain to flavonoid biosynthesis and modification, auxin signalling, as well as genes that might explain developmental changes observed in different MYB75-overexpessing lines.  The total number of upregulated genes in lines over-expressing either phosphovariant of MYB75 is significantly larger than the number of downregulated genes, with a total of 219 genes upregulated at least twofold in either one or both phosphovariants, while only 93 genes were downregulated at least twofold (Fig 4.7A, Fig 4.8A), suggesting that MYB75 has a more prominent role as a positive regulator of gene expression and a relatively minor role as a repressor. Interestingly, no genes were up or down-regulated more than ten-fold in any of the phosphovariants. The number of genes upregulated was significantly larger in 35Spr:MYB75T131E plants than in 35Spr:MYB75T131A, with a total of 118 genes upregulated uniquely in 35Spr:MYB75T131E while only 17 genes were upregulated uniquely in 35Spr:MYB75T131A (Fig 4.7A). Similarly, among the genes downregulated in MYB75-over-expressing lines, 34 are unique to 35Spr:MYB75T131E while only 15 were unique to 35Spr:MYB75T131A.  These results indicate that MYB75T131E is more potent as both a positive and negative regulator of gene expression and that perhaps phosphorylation of MYB75 may enhance its ability to regulate expression of target genes. It is important to note that this discussion of gene expression changes does not attempt to provide a comprehensive explanation for the biochemical and developmental changes observed in the phosphovariant plants. The intent is to highlight general patterns and offer possible leads that are worth exploring in the future.   171   Fig 4.7 A B 172  Fig 4.7 Genes upregulated in mature rosette leaves of Arabidopsis plants over-expressing MYB75T131A and MYB75T131E, compared to Col-0 WT plants.   Heterozygous T2 plants carrying 35Spr:MYB75T131Agene and 35Spr:MYB75T131Egene constructs were selected on ½ MS plates with hygromycin and grown alongside Col-0 WT plants under a light fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, for ten days before being transferred to soil, in a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark and a temperature of 21ᵒC. Mature rosette leaves of 5-week-old Arabidopsis plants were harvested and total RNA was extracted using TRIZOL reagent. RNA from three lines was pooled for the 35Spr:MYB75T131A genotype (L1, L22 and L23) and four lines for the 35Spr:MYB75T131E genotype (L2, L4, L5, L9). Total RNA concentration in each sample was determined using NanoDrop® (ThermoFischer), and RNA quality (intactness) was evaluated by running 5µl of each sample on a 2% agarose gel. Final samples were obtained for each genotype by pooling equal amounts of total RNA from each line belonging to that genotype. The control samples for Col-0 WT was generated by pooling four samples each representing two different Col-0 WT plants. RNA sequencing was performed on each final sample using the Illumina NextSeq500, at 15-30 million reads. The data was trimmed and analysed by Dr. Darren Wong (Castellarin lab, UBC Wine Research Centre) as follows: trimmed reads were aligned to the Arabidopsis thaliana reference genome (TAIR 10 genome release), using the HISat2 alignment tool. Dr. Wong identified differentially expressed genes whose expression changed in 35Spr:MYB75T131A and 35Spr:MYB75T131E plants compared to Col-0 WT controls, as determined by the GFold program (Feng et al., 2012), and performed VENN analysis on the entire dataset. The Venn diagram (A) was generated using the “venny” online tool (http://bioinfogp.cnb.csic.es/tools/venny/). The pie charts (B) were generated using only genes whose expression was upregulated at least twofold. Each gene was categorized based primarily on its function as described in the literature, while GO annotation in conjunction with information on related genes was used to classify genes whose function was poorly defined in published data. Gene expression data from which this figure was derived is available in supplmenetary materials in Table S4.1.       173   Fig 4.8 A B 174  Fig 4.8 Genes downregulated in mature rosette leaves of Arabidopsis plants over-expressing MYB75T131A and MYB75T131E, compared to Col-0 WT plants.   Heterozygous T2 plants carrying 35Spr:MYB75T131Agene and 35Spr:MYB75T131Egene constructs were selected on ½ MS plates with hygromycin and grown alongside Col-0 WT plants under a light fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, for ten days before being transferred to soil, in a growth chamber with a light fluence of ~100-120 µmol m-2s-1, photoperiod of 16h light/8h dark and a temperature of 21ᵒC. Mature rosette leaves of 5-week-old Arabidopsis plants were harvested and total RNA was extracted using TRIZOL reagent. Three lines were used for 35Spr:MYB75T131A genotype (L1, L22 and L23) and four lines for the lines 35Spr:MYB75T131E genotype (L2, L4, L5, L9). Total RNA concentration in each sample was determined using NanoDrop® (ThermoFischer), and RNA quality (intactness) was evaluated by running 5µl of each sample on a 2% agarose gel. Final samples were obtained for each genotype by pooling equal amounts of total RNA from each line belonging to that genotype. Final samples for Col-0 WT were generated by pooling four samples, each representing two different Col-0 WT plants. RNA sequencing was performed on each final sample using the Illumina NextSeq500, at 15-30 million reads. The data was trimmed and analysed by Dr. Darren Wong (Castellarin lab, UBC wine research centre) as follows: trimmed reads were aligned to the Arabidopsis thaliana reference genome (TAIR 10 genome release), using HISat2 alignment tool. Dr. Wong identified differentially expressed genes whose expression changed in 35Spr:MYB75T131A and 35Spr:MYB75T131E plants compared to Col-0 WT controls, as determined by GFold (Feng et al., 2012). VENN analysis was performed on the entire dataset. The Venn diagram (A) was generated using “venny” online tool http://bioinfogp.cnb.csic.es/tools/venny/. The Pie charts (B) were generated using only genes which were downregulated at least twofold. Each gene was categorized based primarily on its function as described in the literature, while GO annotation in conjunction with information on related genes were used to classify genes whose function was poorly defined in published data. Gene expression data from which this figure was derived is available in supplmenetary materials in Table S4.1.  4.5.1 Flavonoid  Gene expression analysis corroborated my conclusions from Chapter 3 with respect to expression levels of core flavonoid biosynthesis genes. Both 35Spr:MYB75T131A and 35Spr:MYB75T131E lines showed an increase in expression of anthocyanin biosynthesis genes (Fig 4.7B), as was reported in previous studies performed on PAP1-D and 35Spr:MYB75 plants (Borevitz et al., 2001, Gonzalez et al., 2008). As a result, the FLAVONOID category is found only in the pie chart representing genes that are upregulated by both phosphovariants (Fig 4.7B). These genes include leucoanthocyanidin dioxygenase (LDOX, At4g22880), and dihydroflavonol 175  reductase (DFR, At5G42800), as well as several anthocyanin modifying enzymes, including anthocyanidin 5-O-glycosyltransferase (UGT75C1, At4g14090), anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase (UGT79B1, AT5G54060), malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase (AT5MAT,AT3g29590) and glutathione S-transferase (GST, At5G17220). Many of the genes that I had anticipated finding in the lists of up- and down- regulated transcripts did not meet the cutoff of two-fold change, or were not present in the ‘differentially regulated’ list. Two such genes that are worth mentioning are chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL1). PAL1 was upregulated 2.2 fold in 35Spr:MYB75T131E plants but only 1.6 fold in 35Spr:MYB75T131A plants, and therefore was not included in Fig 4.7, since it did not meet the cutoff criteria, and could not be considered as uniquely upregulated in 35Spr:MYB75T131E lines. Chalcone synthase (CHS) on the other hand was upregulated 1.5 fold only in 35Spr:MYB75T131E but was absent from the list of downregulated or upregulated genes in 35Spr:MYB75T131A lines. Although these fold changes are very low, if this data could be corroborated it would mean that MYB75T131E is more efficient at up-regulating two major entry points into phenylpropanoid (PAL1) and flavonoid (CHS) pathways. This could explain, at least partially, some of the results of our biochemical analysis, which suggested that MYB75T131E-over-expressing plants produce more flavonols than either MYB75WT or MYB75T131A -over-expressing lines. Interestingly, two regulatory genes, MYB113 and MYB90, which are both homologues of MYB75, and reported to be positive regulators of anthocyanin biosynthesis were downregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E plants, suggesting the existence of a negative feedback loop, whereby MYB transcription factors can shut down expression of their close homologues to control the accumulation of anthocyanins.  176  A gene encoding a known flavonol-modifying enzyme, quercetin 3-O-glycosyltransferase, (UGT71B5, At4G15280) was downregulated in 35Spr:MYB75T131E plants. This is somewhat surprising, as these lines displayed increased levels of several flavonols, including F5, (Quercetin-3-O-glucoside, 7-O-rhamnoside) which is glycosylated at the C3 position (Fig 3.6B). It is possible that there are other glycosyltransferases that can add a glycosyl group to the C3 position of quercetin, or that there is a sufficient supply of this enzyme to glycosylate the flavonol backbone, even under conditions where the UGT71B5 gene is being downregulated. However, it is important to remember that in the gene expression analysis of 35Spr:MYB75 lines, the MYB75T131A and MYB75T131E over-expressors were compared to Col-0 WT plants, while in the HPLC analysis conducted in Chapter 3, the biochemical profile of each phosphovariant over-expressor was compared to 35Spr:MYB75WT plants, in order to get a clear idea of how biochemical profiles change with phosphorylation status. It would therefore be important to determine how the expression of the UGT71B5 gene is affected in 35Spr:MYB75WT plants, before looking for correlations between biochemical profiles. 4.5.2 Cell wall-related genes  Genes required for the biosynthesis and remodelling of primary or secondary cell walls, as well as cell wall-associated proteins were classified as “CELL WALL” genes in the pie charts of Fig 4.7 and 4.8. Among cell wall-related genes downregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E lines, I found two lignin biosynthetic genes, caffeic acid O-methyl transferase (COMT, AT1G33030) and cinnamoyl-CoA reductase (CCR-like, AT1G76470), as well as laccase 7, (LAC7, AT3G09220), which is a member of a gene family implicated in lignin polymerization (Zhao et al., 2013). These findings are congruent with the idea that MYB75 is a negative 177  regulator of cell wall biosynthesis, as described by Bhargava et al., (2010). These results are preliminary and should be re-examined in detail, particularly because the results reported by Bhargava et al., (2010), showed that COMT and CCR1 (another member of the cinnamoyl-CoA reductase) were among the very few lignin biosynthetic genes whose expression was not significantly affected in either the myb75- null mutant or the MYB75OX lines, relative to control plants. However, it is important to note that, in the Bhargava et al., (2010) publication, the authors used PAP1-D activation tag lines instead of the 35Spr:MYB75 used in the current study.  Perhaps more importantly, they used RNA isolated from the lower portion of mature inflorescence stems for their gene expression analysis, whereas I used mature leaf tissue. Interestingly, one lignin-associated gene, Laccase 2 (LAC2, AT2G29130), was upregulated uniquely in 35Spr:MYB75T131A, and was the only cell-wall associated gene upregulated in this genotype. Two cellulose synthase-like genes, cellulose synthase-like A1 (AtCSLA1, AT4G16590), and cellulose synthase-like G3 (CSLG3, AT4G23990), which have been implicated in hemicellulose biosynthesis, were also downregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E plants. Although their biochemical function has been well described (Liepman et al., 2005), it is not known to what degree each of these genes participates in secondary verses primary cell wall biosynthesis.   The major class of cell wall-related genes upregulated in 35Spr:MYB75 plants include genes required for cell wall remodelling during cell growth and expansion. Several expansins, including ATEXP1, ATEXP3, ATEXP8, ATEXP11 as well as a cellulase (GH9B13, AT4G02290) and pectin lyase (AT3G07010) were upregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E plants, and ATEXP15 was upregulated uniquely in MYB75T131E lines. The cellulase and pectin 178  lyase hydrolyze glycosidic bonds in cellulose and pectic polymers respectively, thus potentially loosening the cell wall and allowing for cellular expansion and growth (reviewed in Cosgrove, 2016). The precise mechanism by which expansins contribute to cell wall loosening is not known, but their mode of action is associated with auxin-driven acidification of the cell wall space (reviewed in Cosgrove, 2016). The genes uniquely upregulated in 35Spr:MYB75T131E plants include a number of genes required for the biosynthesis, modification and cleavage of carbohydrate components of the cell wall. Examples include a xylogalacturonan xylosyltransferase (AT5G03795), required for pectin biosynthesis, as well as pectin methyltransferase (AT5G20740) and pectinacetylesterase (AT5G26670), which participate in pectin decoration. Apart from cell wall biosynthetic and modifying enzymes, there were three cell wall associated proteins upregulated uniquely in 35Spr:MYB75T131E lines, which play important roles in growth and development. These includes a growth promoting subtilisin-like serine protease (ATSBT1, AT1G01900), required for proteolytic processing of peptide precursors to produce phytosulfokine, a peptide phytohormone which promotes cell proliferation (Srivastava et al., 2008). The other two genes in this category are fasciclin-like arabinogalactans, (FLA1, AT5G55730 and FLA13, AT5G44130), which appear to play a role in anchoring the plant cell wall to the plasma membrane. These proteins are thought to be important in maintaining cell matrix integrity and have been implicated in a number of developmental processes (Johnson et al., 2003; 2011).  4.5.3 Development and Differentiation  This category is perhaps the most difficult to describe and discuss, as many genes on this list are implicated in multiple developmental processes, in various biological contexts. In this 179  section, I will focus on highlighting a few interesting genes that may have a connection to some of the developmental processes which appear to be altered in 35Spr:MYB75 plants.  On the list of genes upregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E plants, were three transcription factors that are known to participate in flavonoid biosynthesis as well as epidermal cell development. These transcription factors are TT8/bHLH42, TTG2/WRKY44 and LBD38. These transcriptional regulators influence flavonoid and anthocyanin biosynthesis and could have been classified in that category. However, because they have a broader role in development, beyond regulation of phenylpropanoid metabolism, I elected to classify these genes in development and differentiation. The role of TT8 in anthocyanin biosynthesis and epidermal cell fate determination has been discussed in detail earlier in this thesis. Similarly, TTG2/WRKY44 regulates epidermal cell fate, including trichome and root hair development, as well as being a positive regulator for the biosynthesis of proanthocyanidins in the Arabidopsis seeds (Verwiej et al., 2016, Johnson et al., 2002; Ishida et al., 2007). Expression of both TT8 and TTG2 has been shown to be directly regulated by MYB75 (Baudry et al., 2006; Ishida et al., 2007), but our data suggests that this positive regulation is not impacted by phosphorylation.  The transcription factor LBD38 is known as a global negative regulator of anthocyanin biosynthesis but is also involved in driving changes in expression of developmental genes in a nitrogen status-dependent manner. LBD38 function is therefore required for processes such as nitrogen uptake and assimilation, as well as plant growth and shoot branching (Rubin et al., 2009). Regulation of LBD38 by MYB75 has not been reported previously, and it would be interesting to know if LBD38 is a direct target of MYB75.   180  Another vascular development-associated gene that is upregulated in both phosphovariants is a xylem cysteine peptidase 2 (AT1G20850, XCP2). This gene plays a role in the proteolysis of cellular components during programmed cell death, required for vessel differentiation (Funk et al, 2002). This would appear to be pertinent to our observation that 35Spr:MYB75 plants developed ectopic vessels in their mature stems (Fig 4.6). This phenotype was particularly prominent in 35Spr:MYB75T131E lines where, XCP2 expression was upregulated 2.7 fold compared to 2.3 fold increase in 35Spr:MYB75T131A plants.  In an effort to find an explanation for the differences I observed in bolting and flowering time between different phosphovariants, I examined the gene differential expression list for genes that are known to be implicated in regulation of flowering time. MADS (MCM1, Agamous, Deficiens Srf) Affecting Flowering 5 (MAF5, AT5G65080), is upregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E plants: this transcription factor is a member of a gene family (MAF2-MAF5) of floral repressors in Arabidopsis. These genes are part of a regulatory network controlling the transition from vegetative to reproductive stage of the plant life cycle, by integrating signals in response to day length, light, and temperature (Ratcliffe et al, 2003). Over-expression of MAF5 would explain the late flowering phenotype of 35Spr:MYB75T131E plants, however, since it is upregulated in both 35Spr:MYB75T131E and 35Spr:MYB75T131A genotypes, upregulation of MAF5 is not sufficient to explain the observed phenotypes. The function of these genes is highly dependent on environmental inputs, and it is likely that other genetic factors play an important role in modulating their function. Indeed, in the original report, late flowering phenotype predominated in 35Spr:MAF2 lines, but at the same time, a 181  significant portion of the transgenic population displayed an early flowering phenotype (Ratcliffe et al., 2003). Within the subset of differentially-expressed genes known to be involved in development I identified several that were uniquely up-or down-regulated in one or the other phosphovariant. Two genes whose expression increased uniquely in 35Spr:MYB75T131E plants (Histones H3.1 and H2A11), could potentially account for large developmental changes, such as delayed transition from vegetative to reproductive stage. Both of these histone variants are implicated in controlling flowering time. For instance, specific Histone3 methylation, at lysine 4, has a direct impact on expression of flowering locus C (FLC) during vernalization (Tamada et al., 2009), which ultimately controls flowering time. Deposition of histone H2A11 (aka H2A.Z) onto chromatin is required for FLC expression (Deal et al., 2007). A detailed discussion of all the ways that histones can impact development is beyond the scope of this thesis; it is sufficient to say that over-expression of these genes in 35Spr:MYB75T131E lines may be implicated in the developmental changes observed in these plants, and in the differences observed in between 35Spr:MYB75T131A and 35Spr:MYB75T131E phosphovariants.  Most of the genes downregulated in one or both phosphovariants were associated with senescence. Dark inducible 11 (DIN11, At3g49620) was downregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E lines, while DIN2 (AT3G60140) was downregulated uniquely in 35Spr:MYB75T131A. These gene products accumulate in senescing leaves and their expression is induced in the dark (Fujiki et al., 2001). Among genes downregulated uniquely in 35Spr:MYB75T131E lines I found a senescence related gene, Senescence-Associated and QQS-Related, (SAQR, AT1G64360), which is involved in integrating senescence related changes and 182  primary metabolism (Jones et al., 2016), and ATNAC3/ANAC059 (AT3G29035), a transcription factor which regulates global changes in gene expression associated with leaf senescence (Balazadeh et al., 2011).  4.5.4 Hormones Among transcripts which show increased expression in both 35Spr:MYB75T131A and 35Spr:MYB75T131E, I found genes associated with several plant hormones. The list includes a gene required for ethylene biosynthesis (ACS4, AT2G22810), two GASA domain proteins (AT5G14920 and GASA6; AT1G74670), which participate in gibberellic acid (GA) signal transduction and response respectively, as well as gibberellin 3-oxidase 1 (GA3OX1, AT1G15550), required for gibberellic acid biosynthesis. A brassinosteroid signalling component, called BR-enhanced expression 3 (BEE3, AT1G73830), which has been implicated in shade avoidance was also on the list of differentially-expressed genes. Of particular interest, however, were those genes whose function is linked to auxin and cytokinin, as these hormones play a critical role in vessel differentiation. An auxin responsive gene, IAA29 is known to be upregulated in developing vessels, and although the exact biochemical function of this gene is not known, it frequently appears in the literature, pertaining to integration of light and auxin signals in plant growth and development (Wang et al., 2017; reviewed in Halliday et al., 2009). Last but not least, Target of Monopteros 3, also known as Cytokinin Response Factor 2 (TMO3/CRF2, AT4G23750), appeared on our list of genes upregulated in both phosphovariant over-expressors. As a downstream target of both cytokinin and auxin (through the auxin responsive global regulator, MONOPTEROS), TOM3/CRF2 plays a vital role in organ 183  development (both shoots and roots) and in cell fate determination (Ckurshumova et al., 2014; Jeon et al., 2016).  Genes which participate in auxin and cytokinin signalling and response were also found on the list of transcripts upregulated uniquely in 35Spr:MYB75GT131E lines. These include Arabidopsis Response Regulator 15 (ARR15, AT1G74890), which is involved in auxin and cytokinin crosstalk during cell fate specification (Chandler and Werr, 2015). Another cytokinin responsive gene on this list is ARR5; according to GO annotation this gene is implicated in negative feedback regulation of cytokinin signalling, as well as integration of light and circadian clock signals during development. Other hormone-related genes upregulated uniquely in 35Spr:MYB75T131E lines, were genes required for ethylene biosynthesis (ACS11, AT4G08040; ACS5, At5G65800) and ethylene response genes (ATERF6, At4G17490 and ERF/AP2, AT3G60490). Ethylene is a versatile hormone, involved in a broad spectrum of developmental processes and stress responses. Since the effect of this hormone on any particular aspect of plant function largely depends on other hormones and signals present, it is challenging to interpret how changes in the expression of these particular genes might account for any of the observed phosphovariant phenotypes, but their identification in this experimental context may prove to be important in future explorations of MYB75 function, particularly in integration of development and stress responses.  4.5.5 Stress Response and Signalling Stress response and signalling are arguably the most relevant categories to MAP kinase signal transduction and protein phosphorylation. Biotic and abiotic stress response genes were equally represented in the list of transcripts which were upregulated in both 35Spr:MYB75T131A 184  and 35Spr:MYB75T131E plants. On the other hand, most of the genes upregulated uniquely in 35Spr:MYB75T131E were associated with defense, plant immunity and other responses to biotic stress. Interestingly, genes downregulated in both phosphovariant over-expressors were also primarily associated with defense and response to pathogen attack, with the exception of two genes associated with osmotic stress, and one drought responsive gene. Three members of the cytochrome P450 gene family were downregulated in both phosphovariants, including CYP82C2, (AT4G31970), CYP71A13 (AT2G30770), and CYP71B15 (AT3G26830). These were classified as stress response genes, as they are required for biosynthesis of camalexin (Klein et al., 2013; Chapman et al., 2016), and a cyanogenic compound, 4-hydroxyindole-3-carbonyl nitrile (4-OH-ICN) (Rajniak et al., 2015), metabolites that are important in plant defense. Among the genes classified under the “signalling” category, early flowering 4-like 3 (ELF4-like 3, AT2G06255), was downregulated in 35Spr:MYB75T131E plants. ELF4 plays an important role in transcriptional regulation of genes downstream of PHYB signalling and was shown to be important for seedling de-etiolation under red light (Khanna et al., 2003). ELF4 is also required for the integration of circadian rhythm and flowering time, and elf4 null mutants flower early under short day conditions (Doyle et al., 2002). This gene might therefore be an interesting candidate for further analysis, when searching for possible explanations for the observed differences in flowering time between 35Spr:MYB75T131E and 35Spr:MYB75T131A lines. One gene associated with cell signalling that was uniquely upregulated in 35Spr:MYB75T131E which I found particularly interesting was nucleotide diphosphate kinase 2 (NDPK2, AT5G63310). This kinase is known to interact physically with phytochromes and plays an important role in photomorphogenic processes such as cotyledon opening and greening during 185  seedling development. Mutant ndpk2 seedlings have abnormal cotyledons, smaller rosettes and lower chlorophyll content (Choi et al., 2005). In addition, ndpk2 mutants display altered polar auxin transport and reduced expression of auxin-responsive genes (Choi et al., 2005). I found this gene interesting because while it connects light and auxin signalling, two processes in which MYB75 is implicated, it does not yet have a defined biochemical. If NDPK2 were shown to be a direct target of MYB75, and as our data suggests, only a target of the phosphorylated form of MYB75, it would be a direct connection between MYB75 and auxin driven development as well as photomorphogenesis.  4.5.6 Photosynthesis Development, assembly and maintenance of the chloroplast and photosynthetic machinery is a complex process that is tightly linked to light signalling. Perhaps the most interesting and novel piece of data that came out of my gene expression analysis is the relatively large number of photosynthesis-associated genes which were upregulated uniquely in 35Spr:MYB75T131Eplants. With a total of 16 genes (not counting seven more that barely missed the cutoff, with ~1.9 fold upregulation), this category constitutes about 10% of the genes whose expression increased uniquely in the 35Spr:MYB75T131E phosphovariant (Fig 4.7B). The genes on this list include those required for chloroplast protein folding, light harvesting complex organization, as well as chloroplast ribosomal proteins. The list also included key components of the photosynthetic machinery, including photosystem I and photosystem II light harvesting proteins, as well as RUBISCO (RBCS1A, AT1G67090). The expression of many of these genes is canonically used as a marker of photomorphogenic and developmental processes: for instance, their expression increases with the onset of photosynthesis in germinating seedlings, 186  and decreases during senescence. Upregulation of photosynthesis-associated genes in 35Spr:MYB75T131E is particularly relevant since these plants displayed delayed development, and therefore delayed onset of senescence compared to 35Spr:MYB75WT and 35Spr:MYB75T131A plants.  4.6 Discussion The aim of this chapter was to explore several aspects of development in plants over-expressing T131A and T131E phosphovariant forms of MYB75, in an effort to uncover possible new roles of this transcription factor and determine how phosphorylation could potentially influence MYB75 function in a developmental context. This work was primarily undertaken because, according to the data presented in Chapter 3, phosphorylation status did not have a dramatic effect on the ability of MYB75 to drive expression of known and well- defined target genes required for biosynthesis of anthocyanins. However, at the same time, distinct and consistent developmental differences were observed between the various phosphovariant 35Spr:MYB75 lines, which suggested that MYB75 phosphorylation status can influence development.  While I concluded that phosphorylation status of MYB75 has no obvious effect on total anthocyanin levels, I did note that it can influence the types of flavonoid biochemical species that accumulate in transgenic phosphovariant plants. Accumulation of several flavonol glycosides (including three kaempferol and one quercetin derivatives) increased in 35Spr:MYB75T131E, while 35Spr:MYB75T131A lines showed a decrease in the levels of two distinct flavonol biochemical species (a quercetin glycoside and an unknown flavonol), when compared to 35Spr:MYB75WT plants. As discussed in the introduction of this chapter, flavonols can 187  modulate auxin fluxes and therefore can play a vital role in developmental processes regulated by this hormone. The most conservative explanation for the observed developmental phenotypes is that altered flavonol profiles in 35Spr:MYB75 lines lead to perturbations in auxin flow, which in turn affects germination, flowering time and vascular development. However, I cannot exclude the possibility that MYB75 has additional transcriptional targets that have not been characterized in the literature, and that the developmental phenotypes I observed result from a combination of changes in auxin transport and differential regulation of gene expression in each phosphovariant.  4.6.1 Germination My analysis of germination rates in MYB75pr:MYB75 cDNA lines was performed to test the idea that my failure to isolate lines which express recombinant MYB75T131A or MYB75T131E from the endogenous MYB75 promoter was caused by lethality at early stages among these phosphovariants. I hypothesized that there was an artificial selection for plants that had reduced or silenced transgene expression, and my data (Fig 4.2) establish that germination rates are, indeed, severely impaired in plants expressing MYB75T131A and MYB75T131E. Furthermore, plants expressing MYB75T131A showed significantly lower germination rates than those expressing MYB75T131E, suggesting that the phosphorylation status of MYB75 can impact germination rate. Seed dormancy and germination are complex processes regulated by several hormones, including ABA, GA and auxin (reviewed in Shu et al., 2016). The balance between the dormancy promoting ABA and germination-promoting GA hormones ensures that seeds germinate at the appropriate time. Our gene expression analysis suggests that MYB75 can influence (directly or indirectly) the expression of genes which participate in the biosynthesis 188  and signal transduction of these hormones. However, there is no apparent pattern of transcriptional changes that can easily explain the poor germination rate observed in MYB75pr:MYB75 cDNA (T131A and T131E) lines.   From the assay which was conducted to generate the data shown in Fig 4.2 I am unable to assess whether these plants are impaired in germination, or simply fail to germinate because of embryonic arrest or lethality. In order to understand how MYB75 affects these early developmental stages we would need to determine whether plants expressing these MYB75 phosphovariants display embryonic defects, which would require us to dissect a large number of developing seeds and look for abnormalities at different stages of embryogenesis, possibly with the help of embryonic molecular markers. Given the involvement of auxin in early embryo patterning, I suspect that it is aberrant embryo development, rather than failure to germinate, that is the underlying cause for low germination rates in these plant lines. Supporting this conclusion, is the widespread developmental arrest observed among seedlings of these lines: many seedlings derived from the MYB75pr:MYB75T131A and MYB75pr:MYB75T131E lines remained small (about half the size of myb75- and Nossen controls) even 10 days after germination, while some failed to develop leaves, and did not survive when transferred to soil. Since auxin plays a central role in embryogenesis and seedling development, it is possible that perturbations in auxin flow, driven by changes in flavonol profiles, led to developmental abnormalities, and in some cases arrest at these early stages. Although the impact of flavonols on auxin transport is thought to be relatively mild in adult plants, at early stages of development small perturbations in auxin flow can have catastrophic effects (reviewed in Mӧller and Weijers, 2009).  189  MYB75 (along with MYB123/TT2) participates in flavonoid biosynthesis during embryogenesis, where proanthocyanidins are the end product (Sharma and Dixon, 2005). Proanthocyanidins (PA’s) accumulate in different parts of the developing seed coat, including the micropyle, chalaza and the endothelium (an inner layer of cells in the seed coat, enclosing the developing embryo) (reviewed in Xu et al., 2015, Fig 2). Recent evidence suggests that seed coat development can influence cellularization of the endosperm which has a direct impact on embryogenesis (Doughty et al., 2014). The authors suggest that part of this mechanism involves modulation of auxin fluxes in the endosperm by flavonoid accumulation in the endothelium. Among genes which participate in this process, I found TTG2; to be on the list of transcripts upregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E lines; this transcription factor is associated with increased seed size, as ttg2 mutants have smaller seeds, and are pale in colour due to their failure to accumulate PA’s in the endothelium (Doughty et al., 2014).  4.6.2 Flowering time The transition from vegetative to flowering stage is an immensely complex process, driven by a vast regulatory network that integrates signals from multiple plant hormones and environmental cues such as light, photoperiod and temperature, as well as the circadian clock. A detailed overview of this subject matter is far beyond the scope of this thesis, so I will limit my discussion to describing some relationships between auxin flow and the floral transition, in the context of possible connections between altered flavonol levels found in 35Spr:MYB75T131A and 35Spr:MYB75T131E plants, and the observed differences in flowering time in these lines. Among the developmental changes described in different transparent testa (tt) mutants were distinct differences in the timing of the transition from vegetative to floral developmental 190  stages among different mutant genotypes. Lesions in tt6 and tt7 genes, for example, resulted in an early flowering phenotype (Buer et al., 2013). Since these gene products are essential for synthesis of kaempferol and quercetin, this observation indicates that the absence of these flavonols may be associated with accelerated flowering (Buer et al., 2013). Our data appears to follow a similar trend, where MYB75T131E plants, which show increased levels of certain flavonols, bolt and flower later than MYB75T131A plants, which, in turn, display reduced flavonol levels compared to MYB75WT over-expressor and have early bolting and flowering times. However, there is one difficulty with this comparison; all 35Spr:MYB75 plants showed increased levels of flavonols compared to Col-0 WT plants (the shifts in flavonol and anthocyanin profiles in 35Spr:MYB75T131A and 35Spr:MYB75T131E were described in relation to 35Spr:MYB75WT plants). Therefore, a simple change in total flavonol levels cannot account for the developmental changes I observed in Fig 4.3. Instead, I would have to postulate that changes in levels of specific flavonol species (as described in the introduction) are responsible for the observed phenotypes.  The fact that 35Spr:MYB75T131E plants displayed not only delayed bolting and flowering time but also delayed onset of senescence, is consistent with a model of global developmental reprogramming, one which appears to slow down development overall. An example of comparable phenotypes described in the literature includes the arf2 mutant, defective in an auxin response factor, found upstream of two GA-responsive transcription factors. Mutant arf2 plants displayed delayed flowering and senescence similar to my 35Spr:MYB75T131E plants; this mutant phenotype was partially rescued by exogenous application of GA (Richter et al., 2013). Unfortunately, our global gene expression profiles did not show any differential expression of 191  ARFs on the list that might connect the observed phenotypes to this particular pathway. However, there are other genes in the list that could potentially account for global changes in gene expression in 35Spr:MYB75T131E plants. These include Histones H3.1 and H2A.11/H2A.Z, upregulated in 35Spr:MYB75T131E plants, and ATNAC3 (OSR1/ATNAC3, AT3G29035), a global regulator of senescence that was downregulated in 35Spr:MYB75T131E. Decreased expression of the NAC3 (OSR1) transcription factor could account for the increased expression of photosynthetic genes exclusively observed in 35Spr:MYB75T131E plants, since an inverse correlation has been observed between OSR1 expression levels and chlorophyll content (Balazadeh et al., 2011), which is dependent on expression of photosynthetic and chloroplast associated genes.  Upregulation of photosynthesis genes, differences in flowering time and phosphorylation of MYB75 have a common theme: light signalling, through phytochromes. Interestingly, Li et al., (2016) showed that MPK3, MPK4, and MPK6 were activated by high light in wild type plants but not in phyAphyB double mutants. Light therefore appears to be connected to MPK4 activation and subsequent phosphorylation of MYB75 at threonines 126 and 131. The authors also showed that anthocyanin production is reduced in mpk3/4 double mutants and completely abolished in phyAphyB double mutants, as in myb75- plants. It is clear that many aspects of MYB75 function, including transcription, turnover and phosphorylation are controlled by light, at least in part through phytochrome signalling, and that this process is an important part of the regulation of anthocyanin biosynthesis. However, my data also suggests that MYB75 has a broader role to play in development, possibly through flavonol-192  mediated regulation of auxin flow, or through activation of other, as yet unidentified, target genes under transcriptional regulation by MYB75. 4.6.3 Vascular development  Much like flowering time, vascular development involves massive changes in gene expression, dependent on the integration of multiple environmental and developmental cues. Therefore, the development of ectopic vessels that I observed in 35Spr:MYB75 plants can potentially have many underpinnings. Although polar auxin flow plays a central role in driving vascular differentiation and continuity, there are additional developmental cues required for vessel positioning, which should not be overlooked when trying to understand the observed changes in vascular patterning. One prominent example of such a mechanism is depicted in the analysis of the COV1 (continuous vascular ring) gene. This gene was identified in an EMS mutagenesis screen, where the isolated cov1 null mutants displayed abnormal vascular patterning in the stem, where vascular tissue development occurred in the interfascicular region (Parker et al., 2003), much as in my 35Spr:MYB75T131E plants.  Another possible scenario which can account for ectopic vessel development is early onset of cambial activity. As described in the introduction, the onset of cambial activity in later stages of development results in formation of a secondary vasculature which spans the entire circumference of the Arabidopsis stem, in a pattern reminiscent of wood formation. A dominant mutant in the high cambial activity 2 (HCA2) transcription factor appears to control the onset of cambial activity. Over-expression of this gene leads to precocious cambium activation, which results in a radial vascular pattern (Gou et al., 2009). The radial distribution of vessel elements seen in 35Spr:MYB75T131E stems could be a symptom of early cambium 193  activation in these plants, particularly since HCA2 (At5g62940) was upregulated slightly (~1.5 fold) in lines 35Spr:MYB75T131E. Although this level of upregulation failed to meet the 2 fold cutoff, it is worth noting that CHS, a known target of MYB75, was also only upregulated ~1.5 fold, in this phosphovariant. A 1.5 fold increase in transcription may, therefore, not be insignificant, and it would probably be worthwhile to examine more closely whether expression of phosphomimic MYB75 has a significant impact on HCA2 expression.   There is, however, a potentially simpler explanation for the observed vascular phenotypes, one based on auxin transport inhibition by flavonols. The clues can be found in early published work with auxin inhibitors and pin mutants. The pin1pin2 double mutants defective in auxin efflux channels, as well as plants treated with the auxin transport inhibitor NPA, display disorganized vessel positioning, with numerous xylem vessels differentiating in the interfascicular regions, outside their normal vascular bundle positions (Ibañes et al., 2009). Canalization and drainage of auxin is an essential part of vascular differentiation and continuity. The absence or blockage of auxin efflux carriers results in failure to canalize auxin, leading to spilling of auxin into neighboring cells, which can result in their reprogramming and differentiation into vessel elements. Therefore, the phenotypes that I observed can potentially be a result of reduced polar auxin flow, driven by increased intracellular flavonol levels. All 35Spr:MYB75 plants had elevated flavonol levels compared to Col-0 WT plants, and all of these lines also showed some degree of ectopic vessel formation. The phenotype was most severe, and apparent in earlier stages of development only in 35Spr:MYB75T131E lines, most likely because these plants accumulated more flavonols than the other over-expressor lines. This hypothesis obviously needs further experimental support, such as determining to what degree 194  auxin flow is affected in stems of each phosphovariant over-expressor. The gene expression analysis should be repeated, using RNA isolated from stems instead of mature leaves, to determine how over-expression and phosphorylation of MYB75 can affect genes required for vascular differentiation and patterning in mature stems.  4.6.4 Global gene expression analysis of 35Spr:MYB75 lines  In retrospect, an experiment that evaluates global changes in gene expression should be done at early stages of a project such as this, particularly when working with a transcription factor such as MYB75. However, my project was framed initially as a question of whether post-translational phosphorylation of MYB75 was possible, and if it were, how this might influence MYB75’s ability to regulate anthocyanin biosynthesis, which was the accepted role for this transcription factor. We felt optimistic that, if phosphorylation of MYB75 at threonine 131 had any impact on its function, this would be reflected in the anthocyanin biochemical profiles. However, my results showed that none of the known MYB75 target genes in the anthocyanin biosynthesis pathway were affected by either T131A or T131E mutations, whereas these plants displayed striking developmental changes unique to each phosphovariant. It therefore became imperative to conduct global gene expression analysis, to try to understand how MYB75 (and particularly its phosphorylation status) might be affecting development.  In section 4.5 I discussed a number of differentially expressed genes, in 35Spr:MYB75 lines, as potentially relevant players in the observed developmental changes. However, it is important to note that these results are necessarily still preliminary and specific gene expression changes should be confirmed by real time PCR (qPCR). Nevertheless, several robust and important patterns emerged from this next generation sequencing analysis. First, gene 195  expression profiling confirmed that the core anthocyanin biosynthesis genes, and many genes encoding anthocyanin-modifying enzymes, were upregulated in both phosphovariant over-expressors. Furthermore, a number of lignin biosynthesis-related genes were downregulated in both 35Spr:MYB75T131A and 35Spr:MYB75T131E genotypes, corroborating previously described involvement of MYB75 in this process. Finally, the number of genes whose expression changed as a result of MYB75T131E over-expression was substantially larger than the number of genes affected by over-expression of MYB75T131A. This is perhaps the most important and robust observation, as it indicates that MYB75T131E is a more potent regulator of gene expression than the phospho null MYB75T131A, and suggests that MYB75 phosphorylation has a positive impact on its ability to regulate gene expression. Since the ability of a transcription factor to drive gene expression is a function of its affinity for a particular promoter sequence, and of its transcriptional activation/repression strength, either one of those functions could potentially be affected by phosphorylation. However, since anthocyanin biosynthesis genes were similarly upregulated in both phosphovariant genotypes, it is unlikely that general transcriptional activity is enhanced in the MYB75T131E phosphovariant. The most likely explanation is that MYB75T131E can bind a wider range of target promoters, to either positively or negatively regulate expression of these genes. It is also possible that phosphorylated MYB75 has additional interacting partners that enable phospho-MYB75 to participate in transcriptional activation or repression of a wider range of targets. Finally, the list of genes whose expression is affected by MYB75T131E includes several global regulators, such as ATNAC3 involved in regulating senescence, or histones, which can affect chromatin organization. Therefore, MYB75T131E may 196  affect a much wider range of genes than MYB75T131A, through direct or indirect regulation of genes that can in turn lead to global changes in gene expression.  4.7  Materials and Methods 4.7.1 Germination rate in MYB75pr:MYB75 cDNA lines The transgenic Arabidopsis plant material used in this assay were seeds from homozygous T3 plants carrying the MYB75pr:MYB75 cDNA constructs, in a myb75- mutant background (Nossen ecotype). Six independent lines carrying MYB75pr:MYB75T131AcDNA and four lines carrying MYB75pr:MYB75T131EcDNA were used, along with myb75- mutant and Nossen WT controls. Seeds were surface sterilized, plated on ½ MS plates and vernalized for 3 days at 4ᵒC. Plates were put into light and left for 10 days at light fluence of ~30 µmol m-2s-1 and 16h light/8h dark photoperiod, at 21ᵒC. Ten days after exposure to light, the germination percentage was scored for each plate by counting the number of unresponsive seeds and the number of germinated plants. Plants which were counted as germinated included any seed that showed signs of an emerging seedling. The number of seeds used to evaluate the germination rate for each line is depicted in Table 4.1 below.        197  Table 4.1 Germination score in homozygous MYB75pr:MYB75 cDNA plants.  Line Total number of seeds plated Number of seeds germinated Percentage germination MYB75pr:MYB75T131A L1 580 132 22.7% MYB75pr:MYB75T131A L2 673 219 32.5% MYB75pr:MYB75T131A L3 274 73 26.6% MYB75pr:MYB75T131A L4 584 231 39.6% MYB75pr:MYB75T131A L5 809 82 10.1% MYB75pr:MYB75T131A L6 432 127 29.4% MYB75pr:MYB75T131E L1 669 472 70% MYB75pr:MYB75T131E L2 820 447 55% MYB75pr:MYB75T131E L3 724 540 75% MYB75pr:MYB75T131E L4 720 350 48.6% Nossen WT 213 209 98% myb75- 245 240 98%   4.7.2 Plant growth conditions and flowering time Plants were grown as described in section 3.6.1.3, until the plants were approximately 5 weeks old. Individuals representative of each line were photographed on the same day to demonstrate different flowering times and developmental stages. The plants were photographed again at 7 weeks of age.   198  4.7.3 Stem sections and histochemical staining  The lower 5cm of the stems of 7 and 8-week-old Arabidopsis plants were hand-sectioned. Lignin staining was performed by submerging stem sections in phloroglucinol (Sigma) solution (2% w/v phloroglucinol in 95% ethanol) and adding concentrated HCl dropwise. After 5min incubation, the sections were washed three times in distilled water, mounted in water on slides and imaged immediately. Other stem sections were stained with toluidine blue by submerging the sections in 0.02% toluidine blue solution (in distilled water). After 1-2 min incubation the sections were rinsed in distilled water (at least three times), mounted on a slide in water and imaged immediately. All imaging was performed using a Leica Mecatron Precision DMR compound microscope, with a mounted digital camera, Canon EOS Rebel T5.  4.7.4 Gene expression analysis: next generation sequencing  Arabidopsis plants carrying 35Spr:MYB75T131Agene and 35Spr:MYB75T131Egene constructs were grown as described in section 3.6.1.3, alongside Col-0 WT plants. Mature rosette leaves of 5-week-old Arabidopsis plants were harvested and total RNA was extracted as described in section 3.6.5 of Chapter 3. Each RNA sample was obtained from two leaves, harvested from two individual plants belonging to the same line. Three separate lines were used for the 35Spr:MYB75T131A genotype (L1, L22 and L23) and four lines for the 35Spr:MYB75T131E genotype (L2, L4, L5, L9). Total RNA concentration in each sample was determined using NanoDrop® (Thermo Fischer), and RNA quality (intactness) was evaluated by running 5µl of each sample on a 2% agarose gel. Only RNA samples where the banding pattern appeared intact, with no significant smearing from RNA degradation were used to generate the final samples. The final samples were obtained for each genotype by pooling equal amounts of total RNA from each 199  line belonging to that genotype: for example MYB75T131AL1, MYB75T131AL22 and MYB75T131AL23 were pooled to obtain the final sample for 35Spr:MYB75T131A. The final sample for Col-0 WT was generated by pooling four samples from different Col-0 WT plants. RNA sequencing was performed on each final sample using the Illumina NextSeq500, at 15-30 million reads, which were trimmed using the Trimmomatic platform (Bolger et al., 2014). Raw data was processed by Dr. Darren Wong (Castellarin lab, UBC wine research centre) as follows: trimmed reads were aligned to the Arabidopsis thaliana reference genome (TAIR 10 genome release), using the HISat2 alignment tool. Dr. Wong identified differentially expressed genes whose expression changed in 35Spr:MYB75T131A and 35Spr:MYB75T131E plants compared to Col-0 WT control, as determined by GFold software (Feng et al, 2012), and performed VENN analysis on the entire dataset, creating six lists: T131A and T131E overlap upregulated, T131A unique upregulated, T131E unique upregulated, T131A and T131E overlap downregulated, T131A unique downregulated, and T131E unique downregulated. To generate the pie charts in Fig 4.7 and Fig 4.8, I eliminated all genes from each list whose expression change was less than twofold, creating a final set of six gene lists. Each gene was functionally categorized based primarily on its predicted function as described in the literature, while GO annotation plus information on related genes, was used to classify genes, in cases where there was insufficient published data on the gene in question. Complete NGS data is available electronically in EXcel format in supplementary materials Table S4.1.     200  Chapter 5 General Discussion 5.1 Introduction  The biological role of MYB75 has been described in a large number of publications, primarily as a positive regulator of flavonoid and anthocyanin biosynthesis. While accumulation of flavonols and anthocyanins is known to be orchestrated by various environmental and developmental factors, less is known about how these different stimuli are integrated to control anthocyanin production. When our lab decided to explore the possibility that MYB75 is regulated post translationally though phosphorylation by MAP kinases, nothing was known about MYB75 phosphorylation except that the MYB75 amino acid sequence contained, two canonical MPK target sites at threonines 126 and 131. In the early stages of this project the work was divided between myself and two post-doctoral fellows, Dr. Yonge and Dr. Liu: their goal was to determine which of the 20 Arabidopsis MPKs can phosphorylate MYB75 recombinant protein, while my job was to describe how MYB75 protein function changes with phosphorylation status and how this affects plant biochemistry and development. My portion of the project included both in vitro and in vivo approaches, in both cases using point mutants to mimic phosphorylated or unphosphorylated MYB75 protein. In pursuing my project, I encountered several technical setbacks, particularly when trying to express different phosphomimic and phosphonull versions of MYB75 in Arabidopsis. On the other hand, many of these setbacks revealed important information about this protein and its possible involvement in plant development. Most crucially, as I was approaching the end of my research, a publication appeared (Li et al., 2016) that confirmed our findings about MYB75 phosphorylation by MPK4 and demonstrated that MYB75 is stabilized by phosphorylation at both threonines 126 201  and 131, during high light growth conditions. The authors described how this event influences anthocyanin production, in the context of light signalling. Under the circumstances, I needed to emphasize in my thesis aspects of MYB75 phosphorylation that made my findings distinct from the published work by Li et al., (2016). Therefore, I chose to build upon my observations of the phenotypes of 35Spr:MYB75 Arabidopsis lines, observations which had already prompted me to explore other aspects of MYB75 function, particularly developmental changes resulting from phosphorylation. Unfortunately, time and financial constraints did not allow me to develop an in-depth mechanistic explanation for how MYB75 phosphorylation status might be driving the observed developmental changes, leaving this part of the project in its exploratory stages. Nevertheless, I feel that my work does indicate that this transcription factor plays a much broader role in development than previously described, and that MYB75 phosphorylation (presumably by MPKs) plays a pivotal role in this process. In this final chapter I will describe future experiments that should be conducted to refine my findings, to test hypotheses, and to further define the role of MYB75 phosphorylation in regulation of flavonoid biosynthesis and development.  5.2 MYB75 interaction with Arabidopsis MAP kinases and phosphorylation  In Chapter 2, I demonstrated that recombinant MYB75 can interact with a relatively large number of Arabidopsis MAP kinases in vitro, using a yeast two-hybrid system (Clontech). Dr. Yonge and Dr. Liu demonstrated that recombinant MYB75 can be phosphorylated in vitro by MPK3, MPK4, MPK6 and MPK11, in the presence of the appropriate CAMKK, and contrary to the data published by Li et al., (2016), showed that only threonine 131, and not 126 was 202  important for this phosphorylation event. These results defined the path of my thesis research, as I subsequently focused on studying plants overexpressing single point mutants, MYB75T131A, MYB75T131E that would mimic modifications to the T131 site. However, these early in vitro experiments should be re-visited and extended in order to be able to tell a complete story, delineating a pathway from MPK activation to MYB75 phosphorylation and subsequent change in protein function.   First and foremost, interaction between MYB75 and MAP kinases should be examined in planta, using BIFC (bimolecular fluorescence complementation assay) in N. benthamiana leaves or Arabidopsis protoplasts. Furthermore, we need to demonstrate that MYB75 is phosphorylated in vivo by the MPKs which were shown to interact with MYB75 in yeast. A method commonly used to detect phosphorylation of a protein in vivo is separation of protein extract by electrophoresis on a Phos-tag™ acrylamide gel, followed by conventional immunodetection by western blot. Phos-tag™ acrylamide slows down the migration of phosphorylated proteins, thus phosphorylation at each site causes an upward shift of the protein on the gel, leading to a distinct banding pattern, with higher degrees of phosphorylation resulting in increasingly greater shifts. This technique was attempted in our lab, first by Dr. Liu using 35Spr:MYB75 cDNA lines, which unfortunately did not yield sufficient expression levels of recombinant MYB75 protein to effectively conduct this analysis. I later attempted to repeat this assay with my 35Spr:MYB75 gene lines, which produced significantly more protein, However, I was not successful either, as my western blot results showed a wide range of band sizes, instead of the discrete banding pattern corresponding to MYB75 and its different phosphorylation states. I believe this problem can be amended by using a cleaner 203  protein extraction protocol. Since recombinant MYB75 was very prone to rapid degradation, I chose not to use conventional protein extraction protocols, but instead I ground plant tissue and directly resuspended it in SDS running buffer, minimizing handling time and therefore reducing protein degradation. It is possible that cellular debris and phosphorylated cell components, contaminating my protein samples caused the high background in the Phos-tag™ acrylamide gel, even though in regular SDS gel electrophoresis there was no significant background signal near the recombinant MYB75 band. Therefore, I believe this experiment would require optimization, in terms of the protein extraction protocol and the Phos-tag™ concentration in the acrylamide gel, in order to detect MYB75 and its phosphorylated forms.  I had originally planned to conduct a number of experiments, together with Dr. Liu, to demonstrate that MYB75 was phosphorylated as a result of activation of MPK3, MPK4 and MPK6 by upstream MKK enzymes in vivo. To this end, I crossed my 35Spr:MYB75WTgene plants, into DEXpr:CAMKK6 and DEXpr:CAMKK9, Arabidopsis lines, previously established and characterized in the Ellis lab. These constitutively active but conditionally expressed MKKs have the ability to activate a specific subset of MAP kinases: CAMKK6 can activate MPK4 and MPK6 while CAMKK9 specifically activates MPK6 (Lee et al., 2008) My plan was to induce CAMKK expression in successfully crossed progeny (35Spr:MYB75WTX DEXpr:CAMKK6) using dexamethasone, and look for a correlation between the activation of specific MAP kinases and increased phosphorylation of MYB75, using phospho-p44/42 antibodies to detect any activated MPKs, and Phos-tag™ acrylamide gel to detect MYB75 phosphorylation. Unfortunately, due to lack of time and resources I never managed to optimize this protocol, as describing the 204  phenotypes of 35Spr:MYB75 gene lines became the main focus of my project and took priority over other experiments.   When determining which MPKs can phosphorylate MYB75 in vitro our lab chose to focus on the MAP kinases whose function is most widely discussed in the literature and therefore best defined: this includes MPK3, MPK4, and MPK6, as well as MPK11, which is a close homologue of MPK4. Some aspects of development which these MPKs regulate are relevant to the developmental changes I observed in different 35Spr:MYB75 phosphovariant plants, and many of these developmental processes are also regulated by the hormone auxin. MPK3 and MPK6 participate in leaf development through phosphorylation of another MYB transcription factor, ASSYMETRIC LEAVES 1 (AS1), which regulates adaxial cell fate in developing Arabidopsis leaves (Park et al., 2013). MPK6 has also been shown to be involved in embryo, floral and inflorescence development. In mpk6 mutant plants, a large proportion of the embryos were reported to be protruding out of the seed coat (Bush and Krysan, 2007). In the same publication, the authors rescued mpk6 null mutants from embryonic defects, by complementation experiments using a YFP-MPK6 fusion protein. However, plants carrying this recombinant version of MPK6 also displayed reduced apical dominance, indicating that YFP interferes with MPK6 function with respect to inflorescence development (Bush and Krysan, 2007). These are only a few examples on the growing list of developmental processes regulated by MAP kinases. However, other MAP kinases which I found to interact with MYB75 in yeast may be of interest, particularly in the context of developmental changes I describe in Chapter 4. For instance, MPK13, which interacts strongly with MYB75 in yeast, is involved in lateral root formation, which is an auxin-regulated process (Zeng et al., 2011). MPK14, another strong 205  binding partner of MYB75, whose function is not well defined in plants, is activated downstream of ABA signalling (Danquah et al., 2015) which is pertinent to seed dormancy and germination. MAP kinases that display moderate interaction strength with recombinant MYB75 in yeast include MPK6, MPK10, MPK18 and MPK19. A recent publication identified MPK10 as another participant in auxin signalling and vascular development (Stanko et al., 2014). Unlike its close relatives, MPK3 and MPK6, which display broadly distributed expression patterns throughout the plant, MPK10 is transiently expressed in developing seedlings at sites of auxin maxima. In addition, MPK10 promoter activity was observed in veins, consistent with the idea that this gene plays a role in vascular development. Accordingly, mpk10 mutants, as well as mutants defective in mkk2, (required for MPK10 activation) displayed altered venation patterns in cotyledons (Stanko et al., 2014, Fig 4). Most importantly, mpk10 null mutants were delayed in bolting and flowering (Stanko et al., 2014 Fig 3), similar to our 35Spr:MYB75T131E lines. This seems somewhat counter-intuitive: if MPK10 regulates flowering transition through MYB75 phosphorylation then MYB75T131A might be expected to display a phenotype similar to mpk10. However, it is difficult to draw parallels between the Stanko et al., (2014) publication and my data, as our approaches were quite different. For instance, the authors in Stanko et al., (2014) used continuous light, whereas we used a 16h light/8h dark photoperiod, which can impact a number of other factors pertinent to the regulation of flowering time. Furthermore, MPK10 has a very specific expression pattern, whereas the 35S promoter used in my work typically leads to ubiquitous protein expression. I also do not know whether MPK10 can phosphorylate T-126, T-131, or both residues, or how phosphorylation status of T-126 might affect MYB75 function with respect to flowering time. Nevertheless, the late onset of bolting and flowering in mpk10 206  mutants is a promising lead potentially connecting MYB75 and development. The authors in Stanko et al., (2014), concluded that MPK10 participates in localized regulation of polar auxin transport, necessary for proper vein patterning in leaves. A possible model connecting MPK10 to control of auxin flow, is that MPK10 phosphorylates MYB75 at threonine 131, which leads to increased accumulation of flavonols, and localized inhibition of polar auxin transport in certain cells, channeling auxin flow through specific cell files. This is just one example of how the phenotypes I described may help build a connection between a particular MAP kinase and the process it regulates, by looking for parallels among phenotypes observed in different MAP kinase mutants and the phosphovariants of MYB75.  The production of anthocyanins under a wide range of stresses and developmentally regulated processes may help explain why MYB75 appears to bind to so many different MPKs. However, there is another explanation for this apparent promiscuity, one that may broaden our horizons in understanding how MYB75 participates in development and plant biochemistry. A large gap in our understanding of MPK signalling is a lack of plant-specific docking proteins that bridge interactions between different components of the MAP kinase signalling cascades. A recent publication describes the role of MYB44 as a scaffold for the interaction between MKK4 and its targets MPK3 and MPK6, in regulation of response to osmotic stress (Persak and Pitzschke, 2013). Interestingly, this function of MYB44 was affected by phosphorylation status of a specific residue on the MYB44 protein, indicating that this docking function, which regulates MPK signalling, is itself regulated by MPK-mediated phosphorylation. The possibility that MYB75 may also have such a docking function is an enticing one, as it would open the doors to a wider number of possible explanations for the phenotypes we observed in plants 207  expressing different phosphovariant types. Some informative experiments that could explore this idea would include confirming in vivo interaction between MYB75 and the MPKs that displayed interaction with MYB75 in yeast (as noted above), and determining if MYB75 can bind any of the components of the MPK signalling cascade upstream of these MPKs, such as MKK, or MKKKs.  5.3 Protein-protein interactions between MYB75 and known binding partners  The yeast two-hybrid assay that I conducted to determine if protein-protein interactions between MYB75 and its known binding partners are affected by phosphorylation status, at either or both threonines 126 and 131, did not yield results that would indicate that phosphorylation is important for this aspect of MYB75 function. I therefore chose not to repeat the assay in vivo. The only exception to this interaction pattern was TCP3, which positively regulates MYB-bHLH-WDR complex formation: interaction between MYB75 and TCP3 was slightly reduced by the T131E mutation, according to my yeast two-hybrid data. I designed an experiment to verify this in protoplasts, using multi-colour BIFC to try to confirm preference of TCP3 for MYB75WT over MYB75T131E (see discussion in Chapter 2 for details). Although I thought this approach to be elegant, it proved to be unsuitable for examining quantitative data, such as comparative interaction strength, because protoplast transformation efficiency is typically too low to be amenable to statistical analysis. Examining the interaction dynamics between MYB75 and TCP3 in plants would require a robust expression system, perhaps using FRET (fluorescent resonance energy transfer). Another option is repeating the multi-colour BIFC assay that I used in protoplasts, in tobacco leaves or Arabidopsis seedlings, using Agrobacterium-mediated 208  infiltration of plant tissues, which typically results in higher transformation efficiency than do protoplast assays.  It might also be interesting to determine if complex formation between and bHLH and WDR proteins is affected in MYB75T131E compared to MYB75WT (since TCP3 is a positive regulator of this process). This could be done in vitro using a yeast three-hybrid system, analogous to the experiment conducted by Li and Zachgo (2011), in which they examined how TCP3 enhances MYB-bHLH-WDR complex formation. However, before embarking on such experiments it is worth considering whether such a putative change in interaction strength justifies further work: I found that total anthocyanin production, and transcription of core anthocyanin biosynthetic genes was not reduced in 35Spr:MYB75T131E lines compared to other phosphovariants, indicating that, at least in plants overexpressing MYB75, TCP3 is not limiting for this process, or that perhaps the reduced interaction strength between TCP3 and MYB75T131E is not significant enough to affect anthocyanin biosynthesis under the conditions employed in our study.  5.4 MYB75 protein turnover  The data described in Chapter 2 and 3 suggest that phosphomimic MYB75T131E is degraded more rapidly than MYB75WT, and that this susceptibility to degradation is not dependent on the interaction of MYB75 with COP1/SPA ubiquitin ligase complexes. As described in Chapter 2, protein turnover can be a part of a general protein recycling mechanism or be a very target-specific process. Although we cannot exclude the possibility that MYB75T131E is generally less stable than its unmodified progenitor, I suspect that there is a specific degradation pathway that results in turnover of MYB75 when it is phosphorylated at threonine 209  131. My rationale for this lies in our global gene expression analysis (Chapter 4), that indicate that MYB75T131E is a far more potent regulator of gene expression than MYB75T131A (Fig 4.7 and Fig 4.8), and therefore I hypothesize that more rapid degradation of this phosphovariant is a control measure that prevents phosphorylated MYB75 from driving dramatic changes in gene expression that could be detrimental to the plant. To this end, I believe it would be worthwhile to explore the spatial and temporal distribution of each phosphovariant throughout the plant, as I believe that differential distribution of MYB75 protein, depending on its phosphorylation status could play a part in defining the pattern of MYB75 participation in development. Determining how each MYB75 phosphovariant is distributed throughout the plant would require an in vivo approach that allows us to track the protein and its variants through development, across different tissues and organs. An ideal experiment would be to create a MYB75 promoter-gene cassette, for each phosphovariant of interest, fused to the β-glucuronidase (GUS) reporter (MYB75pr:MYB75 gene:GUS), and transform these constructs into the myb75- background in the Col-0 ecotype (recently created by Li et al., 2016). One potential challenge in this approach is low germination rate and early seedling mortality in MYB75pr:MYB75 cDNA (T131A and T131E) lines, described in Chapter 4 (Fig 4.2). Therefore, this approach may require the use of a truncated version of each phosphovariant, where the transcriptional activation domain of MYB75 (last 58 amino acids at the C-terminus) is removed, to prevent MYB75 from triggering developmental arrest during early stages of development. This approach would allow me to determine how each phosphovariant is distributed throughout the plant (based on GUS reporter distribution), but could also be used to test the impact of different environmental stimuli on protein accumulation in different tissues and 210  organs. Importantly, this approach addresses not only protein expression, driven by the endogenous promoter, but MYB75 protein distribution, which is dependent on both protein production and turnover.  It is also important to show that the protein degradation story highlighted in Chapters 2 and 3 applies not only to phosphomimic versions of MYB75 but is also reproducible in the context of genuine phosphorylation events. The crosses which I created between my overexpressor lines and plants carrying CAMKK6 or CAMKK9 under control of a DEX-inducible promoter (35Spr:MYB75 gene X DEXpr:CAMKK), could be used for this purpose. I would suggest conducting degradation assays comparable to those performed in Chapter 2, but also using these crosses to show that a genuine (at least from a chemical point of view) phosphorylation event can lead to differences in turnover. Additional crosses may be necessary to use as controls; for instance, crossing 35Spr:MYB75T131A into the DEXpr:CAMKK as a non-phosphorylatable negative control, and perhaps integrating modifications of threonine 126 into the story, in order to relate our results to the published data by Li et al., (2016). I would also cross 35Spr:MYB75T126A and 35Spr:MYB75T126A/T131A into DEXpr:CAMKK lines to determine how each phosphorylation event affects protein stability; again, to reconcile our data with that of Li et al., (2016). These experiments, however, would have to be conducted in conjunction with Phos-tag™ acrylamide gel shift assays, to demonstrate that activation of CAMKK transcription upon addition of DEX actually leads to MYB75 phosphorylation. Therefore, this series of experiments would still require optimization as well as additional genetic crosses.   211  5.5 Impact of MYB75 phosphorylation on expression of downstream genes  MYB75 transcriptional activity and promoter specificity was not explicitly tested in this thesis, because none of the known target genes appeared to be affected by point mutations mimicking different T-131 phosphorylation states. However, our RNA sequencing data suggests that MYB75T131E is a more potent regulator of gene expression on a global scale than is MYB75T131A. A number of approaches could be used to understand how MYB75T131E affects the expression of a specific subset of genes, and how these expression changes might be connected to the particular developmental changes observed in 35Spr:MYB75T131E plants. These approaches include transcriptional activation experiments in protoplasts, using either a generic promoter to test transcriptional activity of each phosphovariant, or specific promoters, to test the ability of each phosphovariant to drive the expression of particular genes of interest. However, I believe at this stage additional exploratory experiments are required, to help us define a subset of genes that may be targets of MYB75, whose transcription is dependent on MYB75 phosphorylation status. First, we should repeat the global transcriptome analysis performed on 35Spr:MYB75T131A and 35Spr:MYB75T131E lines, to corroborate the results depicted in Fig 4.7, and Fig 4.8. From here, we should focus on a subset of genes that appear consistently up- or down-regulated in a specific phosphovariant, or perform a yeast one-hybrid screen, to identify promoters that each phosphovariant can bind in vitro, before conducting transcriptional activation assays in protoplasts. Alternatively, existing 35Spr:3xHA:MYB75 gene lines described in this thesis can be used to conduct a CHIP (chromatin immunoprecipitation) assay, to identify promoters bound by each phosphovariant in vivo. 212   As previously discussed, when considering the impact of a particular phosphovariant on global changes of gene expression we must consider the possibility that MYB75 can potentially have an indirect influence on a wide spectrum of genes. Modulation of auxin flow, through differential control of flavonol biochemical profiles by each phosphovariant is one possible mechanism by which MYB75 could potentially affect different aspects of development and gene expression. To corroborate this model we must first define the exact perturbations in auxin flow (if any) in 35Spr:MYB75 plants expressing different MYB75 phosphovariants. Relating MYB75 phosphorylation status to auxin flow through control of flavonols would require us to have a better understanding how different biochemical species of flavonols are distributed throughout the plant and how each can affect auxin dynamics. Since this field of study is still in its infancy, relating MYB75 phosphorylation status to the distribution of specific flavonol species and consequent changes in auxin flow still represents a major technical challenge.  Another approach to understanding the role of MYB75 phosphorylation in development, involves connecting a particular MPK to MYB75, by looking for analogous phenotypes, such as the flowering delay observed in mpk10 mutants and 35Spr:MYB75T131E. This approach can be useful in delineating a pathway from a specific MPK activation event to changes in gene expression driven by phosphorylated MYB75. It would require re-assessing the phenotypes of 35Spr:MYB75 plants and MPK mutants under the same conditions, and creating crosses between 35Spr:MYB75 lines and the MAP kinase mutants, to demonstrate a connection between the MPK in question and MYB75.  213  Perhaps the biggest question that still needs to be answered is whether the properties of my phosphomimic and phosphonull lines reflect true phosphorylation-related biological events. Would native phosphorylated MYB75 yield biochemical profiles and developmental changes similar to those that I observed in 35Spr:MYB75T131E plants? This is perhaps the most challenging undertaking. Phosphorylation is generally considered to be a transient event, whereas the developmental phenotypes observed in 35Spr:MYB75 plants were a result of continuous ectopic expression of a particular phosphovariant. I believe the path to uncovering the role of MYB75 phosphorylation in plant biochemistry and development will require a multifaceted approach, that entails understanding how each phosphovariant is distributed throughout the plant, how phosphorylation affects the MYB75 interaction network, and finally how all of these factors affect the subset of genes that MYB75 can regulate when it is in a particular phosphorylation state. Once target genes of interest are identified, we can look for changes in their expression that result from the activation of a particular MAP kinase, correlating this event with MYB75 phosphorylation, thus delineating a pathway from MPK activation to changes in gene expression, through phosphorylation of MYB75. Many of the tools which I highlighted in the text above will be instrumental to conducting these experiments. 5.6 Conclusions  The complexity of plant development and biochemistry stems from the connectivity of these processes. As sessile organisms, plants are immensely dependent on their ability to adjust to changing environments, in coordination with developmental cues. It is not surprising that as we learn more about plant signalling networks we uncover more and more connections between seemingly unrelated pathways. As our understanding of plant genetics and molecular 214  biology grows, we learn that some genes participate in multiple processes, in different biological contexts. This universality is apparent when looking at GO annotations in TAIR or NCBI and reading publication abstracts for a particular gene; fewer and fewer genes are defined by a single function. This is particularly true for a global regulator like MYB75, initially thought to be only a positive regulator of anthocyanin, and to some extent flavonol biosynthesis, and more recently shown to be a repressor of secondary cell wall biosynthetic genes, acting in concert with KNAT7. It is very possible that MYB75 has additional roles in plants that have not yet been described. Although many questions remain to be answered and many experiments should be refined, I believe my work has significantly broadened our horizons in understanding the role of this transcription factor in the biochemistry and development of Arabidopsis, opening doors to new direction for anyone interested in studying this transcriptional regulator.   Finally, some practical applications that are relevant to this project, revolve around understanding how environmental and developmental cues can be used to obtain a desired biochemical outcome. Most laboratory studies examine each stress or stimulus in isolation. However, I believe that understanding the synergy between different environmental and developmental cues is the key to controlling plant biochemistry. For instance, application of continuous light to seedlings overexpressing MYB75 can boost anthocyanin production on soil or ½ MS agar plates, but not on liquid ½ MS, indicating that immersion in liquid media has a negative effect on anthocyanin biosynthesis. Understanding the relationship between each stimulus and a regulator like MYB75 can potentially help us modify plant biochemistry in a directed manner without the use of genetically modified organisms (GMOs). The field of study of how microenvironmental factors affect plant biochemistry is becoming an active research 215  topic in sustainable agriculture. These principles are being applied in forest farming of medicinal plants (Gallespie et al., 2006), and other agricultural models that are coming to the forefront with the need for sustainable farming practices (reviewed in Pretty, 2008).                   216  References  1. Abdel-Lateif K., Bogusz D., Hocher V., (2012). The role of flavonoids in establishment of plant root endosymbioses with arbuscular micorrhizal fungi, rhizobia and frankia bacteria. Plant Signalling and Behaviour. 7(6):636-641.  2. Al-Sady B., Ni W., Kircher S., Schafer E., Qual P.H., (2006). Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated degradation. Molecular Cell.23:439-446.    3. Altamura M.M., Possenti M., Matteucci A., Baima S., Ruberti I., Morelli G., (2001). Development of the vascular system in the inflorescence stem of Arabidopsis. New Phytologist. 151:381-389.  4. Andreasson E., Jenkins T., Brodersen P., Thorgrimsen S., Petersen N.H.T., Zhu S., Qiu J-L., Pernille Micheelsen P., Rocher A., Morten Petersen M., Mari-Anne Newman M-A., Nielsen H.B., Hirt H., Somssich I., Mattsson O., Mundy J., (2005). The MAP kinase substrate MKS1 is a regulator of plant defense responses. The EMBO Journal. 24:2579-2589.  5. Appella E. and Anderson C.W., (2001). Post-translational modifications and activation of p53 by genotoxic stresses. European Journal of Biochemistry. 268:2764–2772. 6. Araújo W.L., Tohge T., Ishizaki K., Leaver C.J., Fernie A.R., (2011). Protein degradation- an alternative respiratory substrate for stressed plants. Trends in Plant Science. 16(9):489-498. 7. Arsovski A.A., Galstyan A., Guseman J.M., Nemhauser J.L., (2012). Photomorphogenesis. The Arabidopsis Book. January 31. doi: 10.1199/tab.0147   8. Asada K., (2006). Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiology. 141:391-396.  9. Asai T., Tena G., Plotnikova J., Willmann MR., Chiu WL., Gomez-Gomez L., Boller T., Ausubel F.M., Sheen J., (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature. 415:977–83.  10. Bah A., Vernon R.M., Siddiqui., Krzeminski M., Muhandiran R., Zhao C., Sonenberg N., Kay L.E., Forman-Kay J.D., (2015). Folding of an intrinsically disordered protein by phosphorylation as a regulatory switch. Nature. 519:106-109. 217  11. Barnes S.A., Nishizawa N.K., Quaggio R.B., Whitelam G.C., Chua N-H., (1996). Far-red light blocks greening of Arabidopsis seedlings via a phytochrome A-mediated change in plastid development. The Plant Cell. 8:601-615.  12. Bailly A., Sovero V., Vincenzetti V., Santelia D., Bartnik D., Koenig B.W., Mancuso S., Martinoia E., Geisler M., (2008). Modulation of P-glycoproteins by auxin transport inhibitors is mediated by interaction with immunophillins. The Journal of Biological Chemistry. 283(31):21817-21826.  13. Balazadeh S., Kwasniewski, M., Caldana, C., Mehrnia, M., Zanor, M. I., Xue, G. P., Mueller-Roeber B., (2011). ORS1, an H2O2-responsive NAC transcription factor, controls senescence in Arabidopsis thaliana. Molecular Plant. 4(2):346-360. 14. Baudry A., Heim M.A., Dubreucq B., Caboche M., Weisshar B., Lepiniec L., (2004). TT2,             TT8 and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. The Plant Journal. 39:366-380.  15. Baudry A., Caboche M., Lepinec L., (2006). TT8 controls its own expression in a feedback regulation involving TTG1 and homologous MYB and bHLH factors allowing a strong and cell specific accumulation of flavonoids in Arabidopsis thaliana. The Plant Journal. 46(5): 768-779. 16. Baudry A., Ito S., Song Y.H., Strait A.A., Kiba T., Lu S., Henriques R., Pruneda-Paz J.L., Chua N.H., Tobin E.M., Kay S.A., Imaizumi T., (2010). F-box protein FKF1 and LPK2 act in concert with ZEITLUPE to control Arabidopsis clock progression. Plant Cell. 22(3):606-622.  17. Bech-Otschir D. Kraft R., Huang X., Henklein P., Kapelari B., Pollmann C., Dubiel W.,  (2001). COP9 signalosome specific phosphorylation targets p53 to degradation by the ubiquitin system. The EMBO Journal. 20(7):1630–1639. 18. Benjamins R., Quint A., Weijers D., Hooykaas P., Offringa R., (2001). The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development. 128:4057–4067.  19. Berleth T., and Jϋrgens G., (1993). The role of the monopteros gene in organising the basal region of the Arabidopsis embryo. Development. 118:575-587. 218  20. Bessa M., Saville M.K., Watson R.J., (2001). Inhibition of cyclin A/Cdk2 phosphorylation impairs B-Myb transactivation function without affecting interaction with DNA or the CBP coactivator. Oncogene. 20:3376-3386.    21. Bhalla U. S., Ram P. T., Iyengar R., (2002). MAP kinase phosphatase as a locus of flexibility in a Mitogen-activated protein kinase signalling network. Science. 297:1018-1024.   22. Bhargava A., Mansfield S.D., Hall H.C., Douglas C.J, Ellis B. E., (2010). MYB75 functions in the regulation of secondary cell wall formation in Arabidopsis inflorescence stem. Plant Physiology. 154:1428-1438.  23. Bhargava A., Ahad A., Wang S., Mansfield D., Haughn G.W., Douglas C.J., Ellis B.E., (2013). The interacting MYB75 and KNAT7 transcription factors modulate secondary cells wall deposition both in stems and seed coat of Arabidopsis. Planta. 237:1199-1211.  24. Berendzen K.W., Weiste C., Wanke D., Kilian J., Harter K., Droge-Laser W., (2012). Bioinformatic cis-element analysis performed in Arabidopsis and rice disclose bZIP- and MYB-related binding sites in potential AuxRE-coupling elements in auxin-mediated transcription. BMC Plant Biology. 12(125). doi: 10.1186/1471-2229-12-125  25. Bernhardt C., Zhao M., Gonzalez A., Lloyd A., Schiefelbein J., (2005). The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis. Development. 132:291-298.  26. Bolger A.M., Lohse M., Usadel B., (2014). Trimmomatic: a flexible trimmer for illumina sequence data. Bioinformatics. 30(15):2114-2120. 27. Boller T., and Felix G., (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annual Reviews in Plant Biology. 60:379–406.  28. Borevitz J.O., Xia Y., Blount J., Dixon R.A., Lamb C., (2000). Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. The Plant Cell. 12(12):2383 2393.   219  29. Bouchard R., Bailly A., Blakeslee J. J., Oehring S.C., Vincenzetti V., Lee O. R., Paponov I., Palme K., Mancuso S., Murphy A.S., Schulz B., Geisler M., (2006). Immunophilin-like TWISTED DWARF1 modulates auxin efflux activities of Arabidopsis P-glycoproteins. Journal of Biological Chemistry. 281:30603-30612.  30. Broekling B.E., Watson R.A., Steinward B., Bush D.R., (2016). Intronic sequence regulates sugar-dependent expression of Arabidopsis thaliana Production of Anthocyanin Pigment1/MYB75. PLOS One. 11(6). doi: https://doi.org/10.1371/journal.pone.0156673 31. Brown D.E., Rashotte A.M., Murphy A.S., Normanly J., Tague B.W., Peer W.A., Taiz L., Munday G.L., (2001). Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis. Plant Physiology. 126:524-535.  32. Buer C.S., Djordjevic M.A., (2009). Architectural phenotypes in the transparent testa mutants of Arabidopsis thaliana. Journal of Experimetnal Botany. 60(3):751-763.   33. Buer C.S., Kordbacheh F., Truong T.T., Hocart C.H., Djordjevic M.A., (2013). Alterations of flavonoid accumulation patterns in transparent testa mutants disturbs auxin transport, gravity responses, and imparts long-term effects on root and shoot architecture. Planta. 238:171-189.  34. Bush S.M., and Krysan P.J., (2007). Mutational evidence that the Arabidopsis MAP kinase MPK6 is involved in anther, inflorescence, and embryo development. Journal of Experimental Botany. 58(8):2181-2191.   35. Carrington J.C., Freed D.D., Leinicke A.J., (1991). Bipartite signal sequence mediates nuclear translocation of the plant potyviral NIa protein. The Plant Cell. 3:935-962. 36. Castillon A., Shen H., Huq E., (2007). Phytochrome Interacting Factors: central players in phytochrome-mediated signalling network. Trends in Plant Science. 12(11):514-521.  37. Cesi V., Tanno B., Vitali R., Mancini C., Giuffrida M.L., Calabretta B., Raschella G., (2002). Cyclin D1-dependent regulation of B-myb activity in early stages of neuroblastoma differentiation. Cell Death and Differentiation. 9:1232-1239.  38. Chandler J.W., and Werr W., (2015). Cytokinin-auxin crosstalk in cell type specification. Trends in Plant Science. 20(5):291-300. 220  39. Chalker-Scott L., (2002). Do Anthocyanins function as osmoregulators in leaf tissues? Advances in Botanical Research. 37:104-114.  40. Chang C-S J., Li Y-H., Chen L-T., Chen W-C., Hsieh W-P., Shin J., Jane W-N., Chou S-J.,  Hu J-M., Somerville S., Wu S-H., (2008). LZF1, a HY5-regulated transcriptional factor, functions in Arabidopsis de-etiolation. The Plant Journal. 54:205-219.  41. Chapman A., Lindermayr C., Glawisching E., (2016). Expression of antimicrobial peptides under control of camalexin-biosynthetic promoter confers enhanced resistance against Pseudomonas syringae. Phytochemistry. 122:76-80. 42. Chapman E.J., and Estelle M., (2009). Mechanism of auxin-regulated gene expression in plants. Annual Reviews in Genetics. 43:265-285. 43. Chen D., Xu G., Tang W., Jing Y., Ji Q., Fei Z., Lin R., (2013). Antagonistic basic helix-loop-helix/bZIP transcription factors form transcriptional modules that integrate light and reactive oxygen species signalling in Arabidopsis. The Plant Cell. 25:1657-1673.  44. Cheng Y., Dai X., Zhao Y., (2007). Auxin synthesized by the YUCCA flavin monooxygenases is essential for embryogenesis and leaf formation in Arabidopsis. The Plant Cell. 19:2430-2439. 45. Chi Y., Yang Y., Zhou Y., Fan B., Yu J-Q., Chen Z., (2013). Protein-protein interactions in the regulation of WRKY transcription factors. 6(2):287-300. 46. Chinchilla D., Zipfel C., Robatzek S., Kemmerling B., Nϋrnberger T., Jones J.D., Felix G., Boller T., (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defense. Nature. 448:497–500.  47. Choi G., Kim J-I., Hong S-W., Shin B., Choi G., Blakeslee J.J., Murphy A.S., Seo Y.W., Kim K., Koh E-J., Song P-S. Lee H., (2005). A possible role for NDPK2 in regulation of auxin-mediated responses for plant growth and development. Plant Cell Physiology. 46(8)1246-1254. 48. Christensen S.K., Dagenais N., Chory J., Weigel D., (2000). Regulation of auxin response by the protein kinase PINOID. Cell. 100:469–478. 49. Chu B., Zhong R., Soncin F., Stevenson M.A., Calderwood S.K., (1998). Transcriptional activity of heat shock factor 1 at 37°C is repressed through phosphorylation on two distinct serine residues by glycogen synthase kinase 3 and protein kinases Cα and Cζ. Journal of Biological Chemistry. 273:18640–18646. 221  50. Ckurshumova W., Smirnova T., Marcos D., Zayed Y., Berleth T., (2014). Irrepressible MONOPTEROS/ARF5 promotes de novo shoot formation. New Phytologist. 204:556-566. 51. Cluis C.P., Mouchel C.F., Hardtke C.S., (2004). The Arabidopsis transcription factor HY5 integrates light and hormone signalling pathways. The Plant Journal. 38:332-347.  52. Colcombet J., and Hirt H., (2008). Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochemistry Journal. 413:217-226.  53. Cosgrove D.J., (2016). Catalysts of plant cell wall loosening. F1000 Research. 5. doi: 10.12688/f1000research.7180.1 54. Craker L.E., and Wetherbee P.J., (1973). Ethylene, light and anthocyanin synthesis. Plant Physiology. 51:436-438. 55. Danquah A., Zelicourt A., Boudsocq M., Neubauer J., Frey N.F., Leonhardt N., Pateyron S., Gwinner F., Tamby J-P., Ortiz-Masia D., Marcote M.J., Hirt H., Colcombet J., (2015). Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana. The Plant Journal. 82:232-244.  56. Dare.A.P., Schaffer R.J., Lin-Wang K., Allan A.C., Hellens R.P., (2008). Identification of a  cis-regulatory element by transient analysis of co-ordinately regulated genes. Plant Methods. 4(17). doi: 10.1186/1746-4811-4-17  57. D’Auria J. C., and Gershenzon J., (2005). The secondary metabolism of Arabidopsis thaliana: growing like a weed. Current Opinion in Plant Biology. 8(3):308-316.  58. Deal R.B., Topp C.N., McKinney E.C., Meagher R.B., (2007). Repression of flowering in Arabidopsis requires activation of FLOWERING LOCUS C expression by histone variant H2A.Z. The Plant Cell. 19:74-83. 59. Del Pozo O., Pedley KF., Martin G.B., (2004). MAPKKK alpha is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23:3072–3082.  60. Deng W., Fang X., Wu J., (1997). Flavonoids function as antioxidants by scavenging reactive oxygen species or by chelating iron? Radiation Physics and Chemistry. 50(3):271-276.  222  61. Doughty J., Aljabri M., Scott R.J., (2014). Flavonoids and the regulation of seed size in Arabidopsis. Biochemical Society Transactions. 42(2):364-369.  62. Dubos C., Le Gourrierec J., Baudry A., Huep G., Lanet E., Debeaujon I., Routaboul J.M., Alboresi A, Weisshaar B, Lepiniec L., (2008). MYBL2 is a new regulator of flavonoid biosynthesis in Arabidopsis thaliana. Plant Journal. 55:940–53.  63. Doyle M.R.M., Davis S.J., Bastow R.M., McWatters H.G., Kozma-Bognar L., Nagy F., Millar A.J., Amasino M., (2002). The ELF4 gene controls circadian rhythms and flowering time in Arabidopsis thaliana. Nature. 419:74-77.  64. Dubos C., Stracke R., Grotewold E., Weisshaar B., Martin C., Lepiniec L., (2010). MYB transcription factors in Arabidopsis. Trends in Plant Science. 15(10):573-581.   65. Endt D.V., Kiljne J.W., Memelink J., (2002). Transcription factors controlling plant secondary metabolism: what regulates the regulators? Phytochemistry. 61:107-114. 66. Evrard A., Kumar M., Lecourieux D., Lucks J., Koskull-Dӧring P.V., Hirt H., (2013). Regulation of the heat stress response in Arabidopsis by MPK6-targeted phosphorylation of the heat stress factor HsfA2. Peer Journal. doi: 10.7717/peerj.59 67. Fabregas N., Foermosa-Jordan P., Confraria A., Siligato R., Alonso J.M., Swarup R., Bennett M.J., Mahӧnen A.P., Caño-Delgado A.I., Ibañes M., (2015). Auxin influx carriers control vascular patterning and xylem differentiation in Arabidopsis thaliana. PLOS Genetics. 11(4). doi: 10.1371/ journal.pgen.1005183 68. Feldbrugge M., Sprenger M., Hahlbrock K., Weisshaar B., (1997). PcMYB1, a novel plant protein containing a DNA-binding domain with one MYB repeat, interacts in-vivo with a light-regulatory promoter. The Plant Journal. 11(5):1079-1093.  69. Feng J., Meyer C.A., Wang Q., Liu J.S., Liu X.S., Zhang Y., (2012). GFOLD: a generalized fold change for ranking differentially expressed genes from RNA-seq data. Bioinformatics. 28(21):2782-2788. 70. Field S.T., Lee D.W., Holbrook M.N., (2001). Why leaves turn red in autumn. The role of anthocyanins in senescing leaves of red-osier dogwood. Plant Physiology. 127: 566-574.   223  71. Fraser C.M., Thompson M.G., Shirley, A.M., Ralph, J., Schoenherr, J.A., Sinlapadech T., Hall, M.C., Chapple, C., (2007). Related Arabidopsis serine carboxypeptidase-like sinapoylglucose acyltransferases display distinct but overlapping substrate specificities. Plant Physiology. 144:1986–1999. 72. Fraser C.M., and Chapple C., (2011). The phenylpropanoid pathway in Arabidopsis. The Arabidopsis Book. American society of plant biologists. e0152. doi: 10.1199/tab.0152  73. Friml J., Vieten A., Sauer M., Weijers D., Schwarz H., Hamann T., Offringa R., Jurgens, G., (2003). Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis. Nature. 426:147–153. 74. Friml J., Yang X., Michniewicz M., Weijers D., Quint A., Tietz O., Benjamins R., Ouwerkerk P.B., Ljung K., Sandberg G., Hooykaas P.J., Palme K., Offringa R., (2004). A PINOID-dependent binary switch in apicalbasal PIN polar targeting directs auxin efflux. Science. 306: 862–865.  75. Fujiki Y., Yoshikawa Y., Sato T., Inada N., Ito M., Nishida I., Watanabe A., (2001). Dark-inducible genes from Arabidopsis thaliana are associated with leaf senescence and repressed by sugars. Physiologia Plantarum. 111(3):345-352. 76. Fukuda H., (2004). Signals that control plant vascular cell differentiation. Nature Reviews Molecular Cell Biology. 5:379-391. 77. Galiullina R.A., Kasperkiewicz P., Chechkova N.C., Szalek A., Serebryakova M.V., Poreba M., Drag M., Vartapetian A.B., (2015). Substrate specificity and possible heterologous targets of phytaspase, a plant cell death protease. The Journal of Biological Chemistry. 290(41):24806-24815.  78. Gallespie A.R., Yu C.K., Tathfon R., Seifert J.R., (2006). Microenvironments for forest-farming of medicinal herbs in varying forest structures of the Midwestern USA. Journal of Sustainable Agriculture. 27(4):71-96.  79. Gangappa S.N., and Botto J.F., (2016). The multifaceted role of HY5 in growth and development. Molecular Plant. 9:1353-1369.  80. Gӓlweiler L., Guan C., Mϋller A., Wisman E., Mendgen K., Yephpremov A., Palme K., (1998). Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science. 282:2226-2230. 224  81. Gomez-Gomez L., and Boller T., (2000). FLS2: An LRR receptor–like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular Cell. 5:1003–1011.  82. González Besteiro M.A., Barterls S., Albert A., Ulm R., (2011). Arabidopsis MAP kinase phosphatise1 and its targets MAP kinases 3 and 6 antagonistically determine UV-B stress tolerance, independent of the UVR8 photoreceptor pathway. The Plant Journal. 68:727-737.  83. Gonzalez A., Zhao M., Leavitt J.M., Lloyd A.M., (2008). Regulation of the anthocyanin  biosynthesis pathway by the TTG1/bHLH/MYB transcriptional complex in Arabidopsis seedlings. The Plant Journal. 53:814-827.  84. Gou J.Y., Felipes, F.F., Liu, C. J., Weigel, D. and Wang, J.W., (2011) Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell. 23:1512–1522.  85. Groban E.S., Narayanan A., Jacobson M., (2006). Conformational changes in protein loops and helices induced by post-translational phosphorylation. PLOS Computational Biology. 2(4):238-250. 86. Grotewold E., (2006) The genetics and biochemistry of floral pigments. Annual Review in Plant Biology. 57:761-780.  87. Gu Y-Q., and Walling L.L., (2000). Specificity of the wound-induced leucine aminopeptidase (LAP-A) of tomato. European Journal of Biochemistry. 267:1178-1187. 88. Gyula P., Shafer E., Nagy F., (2003). Light perception and signalling in higher plants. Current Opinions in Plant Biology. 6:446-452.  89. Haga, N., Kato K., Murase M., Araki S., Kubo M., Demura T., Mϋller I., Voss U., Ito M., (2007). R1R2R3-Myb proteins positively regulate cytokinesis through activation of KNOLLE transcription in Arabidopsis thaliana. Development. 134:1101–1110.  90. Halliday K.J., Martinez-Garcia J.F., Josse E-M., (2009). Integration of light and auxin signalling. Cold Spring Harbour Perspectives in Biology. 1(6): a001586. doi: 10.1101/ cshperspect.a001586  225  91. Hardtke C.S., Gohda K., Osterlund M.T., Oyama T., Okada K., Deng X.W., (2000). HY5 activity in Arabidopsis is regulated by phosphorylation in its COP1 binding domain. European Molecular Biology Organization. 19(18):4997-5006. 92. Hayama R., and Coupland G., (2003). Shedding light on the circadian clock and photoperiodic flowering. Current Opinion in Plant Biology. 6:13-19.  93. Heinrich M., Baldwin I.T., Wu J., (2011). Two mitogen-activated protein kinase kinases,     MKK1 and MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca sexta induced responses in Nicotiana attenuata. Journal of Experimental Botany. doi: 10.1093/jxb/err162  94. Heisler M.G., Ohno C., Das P., Sieber P., Reddy G.V., Long J.A., Meyerowitz E.M., (2005). Pattern of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem. Current Biology. 15: 1899-1911.  95. Hicks G.R. and Raikhel N.V., (1993). Specific binding of nuclear localization sequence to plant nuclei. The Plant Cell. 5:983-994. 96. Hills A.C., Khan S., Lopez-Juez E., (2015). Chloroplast biogenesis-associated nuclear genes: control by plastid signals evolved prior to their regulation as part of photomorphogenesis. Frontiers in Plant Sciences. 6(1078):1-13.  97. Hoch W. A., Zeldin E.L., McCown B.H., (2001). Physiological significance of anthocyanins during autumnal leaf senescence. Tree Physiology. 21:1-8. 98. Hoch W.A., Singsaas E.L., McCown B.H., (2003). Resorption protection. Anthocyanins facilitate nutrient recovery in autumn by shielding leaves from potentially damaging light levels. Plant Physiology. 133:1296-1305.  99. Holmberg C.I., Hietakangas V., Mikhailov A., Rantanen J.O., Kallio M., Meinander A., Hellman J., Morrice N., MacKintosh C., Morimoto R.I., Eriksson J.E., Sistonen L., (2001). Phosphorylation of serine 230 promotes inducible transcriptional activity of heat shock factor 1. The EMBO Journal. 20(14):3800–3810. 100. Holmberg C.I., Tran S.E.F., Eriksson J.E., Sistonen L., (2002). Multisite phosphorylation provides sophisticated regulation of transcription factors. Trends in Biochemical Sciences. 27(12):619-627.  226  101. Hϋbner S., Smith H.M.S., Hu W., Chan C.K., Rihs H-P., Paschall B.M., Raikhel N.V., Jans D.A., (1999). Plant importin α binds nuclear localization sequences with high affinity and can mediate nuclear import independent of importin ß. The Journal of Biological Chemistry. 274(32):22610-22617. 102. Huq E., Al-Sady B., Hudson M., Kim C., Apel K., Quail P.H., (2004). PHYTOCHROME-INTERACTING FACTOR 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science. 305(5692):1937-1941.  103. Ibañes M., Fabregas N., Chory J., Caño-Delgado., (2009). Brassinosteroid signalling and auxin transport are required to establish the periodic pattern of Arabidopsis shoot vascular bundles. Proceedings of the National Academy of Science. 106(32):13630-13635. 104. Ichimura K., Shinozaki K., Tena G., Sheen J., Henry Y., Champion A., Kreis M., Zhang S., Hirt H., Wilson C., Heberle-Bors E., Ellis B.E., Morris P.C., Innes R.W., Ecker J.R., Scheel D., Klessig D.F., Machida Y., Mundy J., Ohashi Y., Walker J.C., (2002). Mitogen-activated protein kinase cascades in plants:a new nomenclature. Trends in Plant Science. 7(7):301-308.  105. Ishida T., Hattori S., Sano R., Inoue K., Shirano Y., Hayashi H., Shibata D., Sato S., Kato T., Tabata S., Okada K., Wada T., (2007). Arabidopsis TRANSPARENT TESTA GLABRA2 is directly regulated by R2R3 MYB transcription factors and is involved in regulation of GLABRA2 transcription in epidermal differentiation. The Plant Cell. 19:2531-2543. 106. Ishikura N., (1973). The changes in anthocyanin and chlorophyll content during the autumnal reddening of leaves. Kumamoto Journal of Science. 2:43–50. 107. Ishimara N., and Yoshioka H., (2012). Post-translational regulation of WRKY transcription factors in plant immunity. Current Opinion in Plant Biology. 15:431-437. 108. Ito M., Araki S., Matsunaga S., Itoh T., Nishihama R., Machida Y., Doonan J.H., Watanabe A., (2001). G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-Like transcription factors. The Plant Cell. 13:1891-1905.  109. Izumi M., Hidema J., Makino A., Ishida H., (2013). Autophagy contributes to night time energy availability for growth in Arabidopsis. Plant Physiology. 161: 1682-1693. 110. Jeon J., Cho C., Lee M.R., Binh N.V., Kim J., (2016). Cytokinin Response Factor2 (CRF2) and CRF3 regulate lateral root development and response to cold stress in Arabidopsis. The Plant Cell. 28:1828–1843. 227  111. Jeong S-W., Das P.K., Jeoung S. C., Song J-Y., Lee H.K., Kim Y-K., Kim W.J., Park Y.I., Yoo S-D., Choi S-B., Choi G., Park Y-I., (2010). Ethylene suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. Plant Physiology. 154:1514-1531. 112. Johnson C.S., Kolevski B., Smyth D.R., (2002). TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. The Plant Cell. 14:1359-1375. 113. Johnson K.L., Jones B.J., Basic A., Schultz C., (2003). The fasciclin-like arabinogalactan proteins of Arabidopsis. A multigene family of putative cell adhesion molecules. Plant Physiology. 133:1911-1925. 114. Johnson K.L., Kibble N.A.j., Basic A., Schultz C.J., (2011). A fasciclin-like arabinogalactan-protein (FLA) mutant of Arabidopsis thaliana, fla1, shows defects in shoot regeneration. PLOS ONE. 6(9): e25154. doi: 10.1371/journal.pone.0025154 115. Johnson L.N., (2009). The regulation of protein phosphorylation. Biochemical Society Transactions. 37:627-641. 116. Jonak C., Nakagami H., Hirt H., (2004). Heavy metal stress activation of distinct mitogen-activated protein kinase pathways by copper and cadmium1. Plant Physiology. 136:3276-3283.  117. Jones D.C., Zheng W., Huang S., Du C., Zhaoe X., Yennamalli R.M., Sen T.Z. Nettleton D., Wurtele E.S., Li L., (2016). A clade-specific Arabidopsis gene connects primary metabolism and senescence. Frontiers in Plant Science. doi: https://doi.org/10.3389/ fpls.2016.00983 118. Jones J.D, and Dangl J.L., (2006). The plant immune system. Nature 444:323–29.  119. Jones P., Messner B., Nakajima J., Schaffner A.R., Saito K., (2003). UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana. Journal of Biological Chemistry. 278:43910-43918. 120. Kanaoka M.M., Pillitteri L.J., Fujii H., Yoshida Y., Bogenschutz N.L., Takabayashi J., Zhu J-K., Torii K.U., (2008). SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to Arabidopsis stomatal differentiation. Plant Cell. 20:1775–85.  121. Kato Y., and Sakamoto W., (2014). Phosphorylation of photosystem II core proteins prevents undesirable cleavage of D1 and contributes to the fine-tuned repair of photosystem II. The Plant Journal. 79:312-321. 228  122. Khanna R., Kikis E.A., Quail P.H., (2003). EARLY FLOWERING 4 functions in phytochrome B-regulated seedling de-etiolation. Plant Physiology. 133:1530-1538. 123. Kim W-Y., Fujiwara S., Suh S-S., Kim J., Kim Y., Han L., Karine D., Putterill J., Nam H.G., Somers D.E., (2007). ZEITLUPE is a circadian photoreceptor stabilized by GIGANTEA in blue light. Nature. 499:356-360.   124. Kindren P., Noren L., Lopez J.D.B., Shaikhali J., Strand A., (2012). Interplay between HEAT SHOCK PROTEIN 90 and HY5 controls PhANG expression in response to GUN5 plastid signal. Molecular Plant. 5(4):901-913.  125. Kliebenstein D.J., (2004). Secondary metabolites and plant/environment interactions: a view through Arabidopsis thaliana tinged glasses. Plant Cell & Environment. 27(6):675-684.   126. Klein A.P., Anarat-Cappillino G., Sattely E.S., (2013). Minimum set of cytochromes P450 for reconstituting the biosynthesis of camalexin, a major Arabidopsis antibiotic. Angewandte Chemie. 52(51):13625-13628. 127. Kohchi T., Mokougawa K., Frankenberg N., Musada M., Yokota A., Lagarias J.C., (2001). The Arabidopsis HY2 gene encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. The Plant Cell. 13:425-436.  128. Kosugi S., Hasebe M., Matsumura N., Takashima H., Miyamoto-Sato E., Tomita M., Yanagawa H., (2009). Six classes of nuclear localization signals specific to different binding grooves of importin α. The Journal of Biological Chemistry. 284(1):478-485.  129. Kovinich N., Kayanja G., Chanoca A., Riedl K., Ostegui M.S., Grotewold E. (2014). Not all anthocyanins are born equal: distinct patterns induced by stress in Arabidopsis. Planta. 240:931-940. 130. Kovtun Y., Chiu W.L., Tena G., Sheen J., (2000). Functional analysis of oxidative stress-activated mitogen activated protein kinase cascade in plants. Proceeding of National Academy of Science. 97:2940–45.  131. Krecek P., Skupa P., Libus J., Naramoto S., Tejos R. Friml J., Zazimalova E., (2009). The PIN-formed protein family of auxin transporters. Genome Biology. 10(12):249. doi: 10.1186/gb-2009-10-12-249  132. Kubo M., Udagawa M., Nishikubo N., Horiguchi G., Yamaguchi M., Ito J., Mimura T., Fukuda H., Demura T., (2005). Transcription switches for protoxylem and metaxylem vessel formation. Genes & Development. 19:1855-1860. 229  133. Kuhn B.M., Errafi S., Bucher R., Dobrev P., Geisler M., Bigler L., Zazimalova E., Ringli C., (2016). 7-Rhamnosylated flavonols modulate homeostasis of the plant hormone auxin and affect plant development. The Journal of Biological Chemistry. 291: 5385-53-95.  134. Kumar S., and Pandey A.K., (2013). Chemistry and biological activities of flavonoids: an overview. The Scientific World Journal. doi: http://dx.doi.org/10.1155/2013/162750  135. Lampard G.R., Macalister C.A., Bergmann D.C., (2008). Arabidopsis stomatal initiation is controlled by MAPK-mediated regulation of the bHLH SPEECHLESS. Science. 322:1113–1116.  136. Lange A., Mills R.E., Lange C.J., Stewart M., Devine S.E., Corbett A.H., (2006). Classical Nuclear Localization Signals: definition, function and interaction with importin-α. Journal of Biological Chemistry. 282(8):5101-5105. 137. Laxa M., (2017). Intron-mediated enhancement: a tool for heterologous gene expression in plants? Frontiers in Plant Science. 7(1977). doi: 10.3389/fpls.2016.01977  138. Lee H., (2015). Mitogen-activated protein kinase kinase 3 is required for regulation during dark-light transition. Molecular Cell. 38(7):651-656.  139. Lee J.S., and Ellis B.E., (2007). Arabidopsis MAPK Phosphatase 2 (MPK2) positively regulates oxidative stress tolerance and inactivates MPK3 and MPK6 MAPKs. Journal of Biological Chemistry. 282(34):25020-25029.  140. Lee J.S., Huh K.W., Bhargava A., Ellis B.E., (2008). Comprehensive analysis of protein-protein interactions between Arabidopsis MAPKs and MAPK kinases helps define potential MAPK signalling modules. Plant Signaling and Behaviour. 3(12):1037-1041. 141. Lee K., Song E.H., Kim H.S., Yoo J.H., Han H.J., Jung S.M., Lee S.M., Kim K.E., Kim M.C., Cho M.J., Chung W.S., (2008). Regulation of MAPK phosphatase 1 (AtMKP1) by calmodulin in Arabidopsis. Journal of Biological Chemistry. 283:23581–23588.  142. Leivar P., and Monte E., (2014). PIFs: systems integrators in plant development. The Plant Cell. 26:56–78.  143. Leoni C., Pietrzykowska M., Kiss A. Z., Suorsa M., Ceci L R., Aro E-M., Jansson S., (2013). Very rapid phosphorylation kinetics suggest a unique role for Lhcb2 during state transition in Arabidopsis. The Plant Journal. 76:236-246.  230  144. Li E., Bhargava A., Qiang W., Friedmann M.C., Forniers N., Savidge R.A., Johnson L.A.,  Mansfield S.D., Ellis B.E., Douglas C.J., (2012). The Class II KNOX gene KNAT7 negatively regulates secondary wall formation in Arabidopsis and is functionally conserved in Populus. New Phytologist. 194(1):102-115.  145. Li F., and Vierstra R.D., (2012). Autophagy: a multifaceted intracellular system for bulk and selective recycling. Trends in Plant Science. 17(9):526-537.  146. Li J., Li G., Wang H., Deng X-W., (2011). Phytochrome signalling mechanisms. The Arabidopsis Book. doi: 10.1199/tab.0148  147. Li Q.F., and He J.X., (2016). BZR1 interacts with HY5 to mediate brassinosteroid-and light-regulated cotyledon opening in Arabidopsis in darkness. Molecular Plant. 4(9)113-125.  148. Li S., and Zachgo S., (2013). TCP3 interacts with R2R3-MYB proteins, promotes flavonoid biosynthesis and negatively regulates the auxin response in Arabidopsis thaliana. The Plant Journal. 76:901-913.  149. Li S., Wang W., Gao J., Yin K., Wang R., Wang C., Petersen M., Mundy J., Qiu J-L., (2016). MYB75 phosphorylation by MPK4 is required for light-induced anthocyanin accumulation in Arabidopsis. The Plant Cell. 28:2866-2883.  150. Liepman A.H., Wilkerson C.G., Keegstra K., (2005). Expression of cellulose synthase-like (Csl) genes in insect cells reveals CslA family members encode mannan synthases. Proceedings of the National Academy of Science. 102(6)2221-2226. 151. Liepman A.H., Cavalier D.M., (2012). The CELLULOSE SYNTHASE-LIKE A and CELLULOSE-SYNTHASE-LIKE C families: recent advances and future perspectives. Frontiers in Plant Sciences. 3(109). doi: 10.3389/fpls.2012.00109 152. Lim E-K., Ashford D.A., Hou B., Jackson R.G., Bowles D.J., (2004). Arabidopsis glycosyltransferases as biocatalysts in fermentation of regioselective synthesis of diverse quercetin glycosides. Biotechnology and Bioengineering. 87(5):623-631. 153. Lin C., (2002). Blue light receptors and signal transduction. The Plant Cell. S207-S225.  154. Liu H., Liu B., Zhao C., Pepper M., Lin C., (2011). The action mechanisms of plant cryptochromes. National Institute of Health. 16(2):684-691.  231  155. Liu Y., and He C., (2017). A review of redox signalling and the control of MAP kinase pathway in plants. Redox Biology. 11:192-204.  156. Luo J., Nishiyama Y., Fuell C., Taguchi G., Elliott K., Hill L., Tanaka Y., Kitayama M., Yamazaki M., Bailey P., Parr A., Michael A.J., Saito K., Martin C., (2007). Convergent evolution of BAHD family of acyl transferases: identification and characterization of anthocyanin acyl transferases from Arabidopsis thaliana. The Plant Journal. 50:678-695.  157. MacAlister C.A., Ohashi-Ito K., Bergmann D.C., (2007). Transcription factor control of asymmetric cell divisions that establish the stomatal lineage. Nature. 445:537–40.  158. Maier A., Schrader A., Kokkelink L., Flake C., Welter B., Iniesto E., Rubio V., Uhrig J.F., Hulskamp M., Hoeker U., (2013). Light and the E3 ubiquitin ligase COP1/SPA control the protein stability of MYB transcription factors PAP1 and PAP2 involved in anthocyanin accumulation in Arabidopsis. The Plant Journal. 74:638-651.  159. Mattsson J., Ckurshumova W., Berleth T., (2003). Auxin signalling in Arabidopsis leaf vascular development. Plant Physiology. 131:1337-1329. 160. McGonigle B., Bouhidel K., Irish V.F., (2017). Nuclear localization of Arabidopsis APETALA3 and PISTILLATA homeotic gene products depends on their simultaneous expression. Genes and Development. 10:1812-1821  161. Mehrtens F., Kranz H., Bednarek P., Weisshaar B., (2005). The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid. Plant Physiology. 138:1083-1096.  162. Menke F.L.H., Kang H-G., Chen Z., Park J.M., Kumar D., Klessig D.F., (2005). Tobacco transcription factor WRKY1 is phosphorylated by the MAP kinase SIPK and mediates HR-like cell death in Tobacco. Molecular Plant-Microbe Interactions. 18(10):1027-1034. 163. Meshi T., and Iwabuchi M., (1995). Plant transcription factors. Plant Cell Physiology. 36(8):1405-1420. 164. Michniewicz M., Zago M.K., Abas L., Weijers D., Schweighofer A., Meskiene I., Heisler, M.G., Ohno C., Zhang J., Huang F., Schwab R., Weigel D., (2007). Antagonistic regulation of PIN phosphorylation by PP2A and PINOID directs auxin flux. Cell. 130:1044-1056.   232  165. Miglarese M.R., Richardson A.F., Aziz N., Bender T.P., (1996). Differential regulation of c-Myb-induced transcription activation by a phosphorylation site in the negative regulatory domain. The Journal of Biological Chemistry. 271(37):22697-22705.  166. Miles G.P., Samuel M.A., Ranish J.A., Donohoe S.M., Sperrazzo G.M., Ellis B.E., (2009). Quantitative proteomics identified oxidant-induced AtMPK6-dependednt changes in Arabidopsis thaliana protein profiles. Plant Signalling & Behavior. 4(6):497-505.  167. Misyura M., Colasanti J., Rothstein S.J., (2013). Physiological and genetic analysis of Arabidopsis thaliana anthocyanin biosynthesis mutants under chronic adverse environmental conditions. Journal of Experimental Botany. 64(1):229-240. 168. Mitra P.P., and Loqué D., (2014). Histochemical staining of Arabidopsis thaliana secondary cell wall elements. Journal of Visualized Experiments. 87. doi: 10.3791/51381 169. Miyahara T., Sakiyama R., Ozeki Y., Sasaki N., (2013). Acyl-glucose-dependent glucosyltransferase catalyzes the final step of anthocyanin formation in Arabidopsis. Journal of Plant Physiology. 170(6):619-624.  170. Miyashima S., Sebastian J., Lee J-Y., Helariutta Y., (2013). Stem cell function during plant development. The EMBO Journal. 32:178-193. 171. Mizoguchi T., Irie K., Hirayama T., Hayashida N., Yamaguchi-Shinozaki K., Matsumoto K., Shinozaki K., (1996). A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proceedings of National Academy of Science. 93:765-769.  172. Mochizuki N., Brusslan J.A., Larkin R., Nagatani A., Chory J., (2001). Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proceedings of the National Academy of Sciences. 98(4):2053-2058.  173. Mokaitis K., and Howell S.H., (2000). Auxin induced mitogenic activated protein kinase (MAPK) activation in Arabidopsis seedlings. The Plant Journal. 24(6):785-796.  174. Mӧller B., and Weijers D., (2009). Auxin control of embryo patterning. Cold Spring Harbor Perspectives in Biology. 1(5): a001545. doi: 10.1101/cshperspect.a001545 233  175. Moon J., Parry G., Estelle M., (2004). The ubiquitin proteasome pathway and plant development. Plant Cell. 16:3181-3195. 176. Morse A.M., Whetten R.W., Dubos C., Campbell M.M., (2009). Post-translational modification of an R2R3-MYB transcription factor by a MAP kinase during xylem development. New Phytologist. 183:1001-1013.  177. Murphy A., Peer W.A., Taiz L., (2000). Regulation of auxin transport by aminopeptidases and endogenous flavonoids. Planta. 211:315-324 178. Muzac I., Wang J., Anzellotti D., Zhang H., Ibrahim R.K., (2000). Functional expression of an Arabidopsis cDNA clone encoding a flavonol-3’-O-methyltransferase and characterization of gene product. Archives of Biochemistry and Biophysics. 375:385-388. 179. Nakagami H., Soukupova H., Schikora A., Zarsky V., Hirt H., (2006). A mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. Journal of Biological Chemistry. 281:38697-38704.  180. Nanjo Y., Maruyama K., Yasue H., Yamaguchi-Shinozaki K., Shinozaki K., Komatsu S., (2011). Transcriptional response to flooding stress in roots including hypocotyl in soybean seedlings. Plant Molecular Biology. 77:129-144 181. Narsai R., Howell K.A., Miller A.H., O’Toole N., Small I., Whelan J., (2007). Genome-wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana. The Plant Cell. 19:3418-3436. 182. Nelson D.C., Lasswell J., Rogg L.E., Cohen M.A., Bartel B., (2000). FKF1, a clock-controlled gene that regulates the transition to flowering in Arabidopsis. Cell. 101(3):331-340.  183. Nieminen K.A., Kauppinen L., Helariutta Y., (2004). A weed for wood? Arabidopsis as a genetic model for xylem development. Plant Physiology. 135:653-659. 184. Nishi H., Hashimoto K., Panchencko A., (2011). Phosphorylation in protein-protein binding: effect on stability and function. Structure. 19:1807-1815.  185. Ohashi-Ito K., and Bergmann D.C., (2006). Arabidopsis FAMA controls the final proliferation/differentiation switch during stomatal development. Plant Cell. 18:2493–505.  234  186. Oh Il-H., and Reddy E.P., (1999). The MYB gene family in cell growth, differentiation and apoptosis. Oncogene. 18:3017-3033.  187.  Osterlund M.T., Wei N., Deng X.W., (2000). The roles of photoreceptor systems and the COP1-targeted destabilization of HY5 in light control of Arabidopsis seedling Development. Plant Physiology. 124:1520-1524.  188. Oyama T., Shimura Y., Okada K., (1997). The Arabidopsis HY5 gene encodes a bZIP protein that regulates stimulus-induced development of root and hypocotyl. Genes and Development. 11:2983-2995.  189. Pan Y., Michael T.P., Hudson M.E., Kay S.A., Chory J., Schuler M.A., (2009). Cytochrome P450 monooxygenases as reporters for circadian-regulated pathways. Plant Physiology.150:858-878. 190. Park H.C., Han H.J., Lee S.M., Yun D-J. Chung W.S., (2013). ASYMETRIC LEAVES1 is phosphorylated by MPK3/6 in Arabidopsis thaliana. Journal of Plant Biology. 56:208-215. 191. Parker G., Schofield R., Sundberg B., Turner S., (2003). Isolation of COV1, a gene involved in the regulation of vascular patterning in the stem of Arabidopsis. Development. 130: 2139-2148.  192. Pearce A.K., and Humphrey T.C., (2001). Integrating stress response and cell-cycle checkpoint pathways. Trends in Cell Biology. 11(10):426-433.  193. Peck S.C., (2006). Analysis of protein phosphorylation: methods and strategies for studying kinases and their substrates. The Plant Journal. 45:512-522.  194. Peer W.A., Brown D.E., Tague B.E., Muday G.K., Taiz L., Murphy A.S., (2001). Flavonoid accumulation pattern in transparent testa mutants. Plant Physiology. 126(2):536-548. 195. Peer W.A., Bandyopadhyay A., Blakeslee J.J., Makam S.N., Chen R.J., Masson P.H., Murphy A.S., (2004). Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. The Plant Cell. 16:1898-1911. 196. Peer W.A., and Murphy A.S., (2007). Flavonoids and auxin transport: modulators or regulators? Trends in Plant Science. 12(12):556-563.  235  197. Pelletier M.K., and Shirley B.W., (1996). Analysis of flavonone 3-hydroxylase in Arabidopsis seedlings. Plant Physiology. 111:339-345. 198. Petersen M., Brodersen P., Naested, H., Andreasson E., Lindhart U., Johansen B., Nielson H.B., Lacy M., Austin M.J., Parker J.E., Sharma S.B., Klessig D.F., Martienssen R., Mattsson O., Jensen A.B., Mundy J., (2000) Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell. 103:1111–1120.  199. Persak H., and Pitzschke A., (2013). Tight interconnection and multi-level control of Arabidopsis MYB44 in MAPK cascade signalling. PLOS ONE. 8(2): e57547.   200. Piskurewicz U., Tureckova V., Lacombe E., Lopez-Molina L., (2009). Far-red light inhibits germination through DELLA-dependent stimulation of ABA synthesis and ABI3 activity. European Molecular Biology Organization. 28:2259–2271.  201. Popescu S.C., Popescu G.V., Bachan S., Zhang Z., Gerstein M., Snyder M., Dinesh-Kumar S.P., (2009). MAPK target networks in Arabidopsis thaliana revealed using functional protein microarrays. Genes and Development. 23:80-92.  202. Pospisil P., (2009). Production of reactive oxygen species by photosystem II.  Biochimica et Biophysica Acta. 1787:1151-1160.  203. Pretty J., (2008). Agricultural sustainability: concepts, principles and evidence. Philosophical Transactions of Royal Society. 363:447-465. 204. Qi T., Song S., Ren Q., Wu D., Hunag H., Chen Y., Fan M., Peng W., Ren C., Xie D., (2011). The Jasmonate-ZIM-Domain proteins interact with the WD-Repeat/bHLH/Myb complex to regulate Jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. The Plant Cell. 23:1795-1814.  205. Ragni L., and Greb T., (2017). Secondary growth as a determinant for plant shape and form.  Seminars in Cell and Developmental Biology. doi: http://dx.doi.org/10.1016/j. semcdb.2017.08.050 206. Rajeevkumar S., Anunanthini P., Sathishkumar R., (2015). Epigenetic silencing in transgenic plants. Frontiers in Plant Science. 6(693). doi: 10.3389/fpls.2015.00693 207. Rajniak J., Barco B., Clay N.K., Sattely E.S., (2015). A new cyanogenic metabolite in Arabidopsis required for inducible pathogen defence. Nature. 525(7569):376-379. 208. Raikhel N., (1992). Nuclear targeting in plants. Plant Physiology. 100:1627-1632. 236  209. Ramsay N.A., and Glover B.J., (2005). MYB-bHLH-WD40 protein complex and the evolution of cellular diversity. Trends in Plant Science. 10(2):63-70.  210. Ratcliffe O.J., Kumimoto R.W., Wong B.J., Riechmann J.L., (2003). Analysis of the Arabidopsis MADS AFFECTING FLOWERING gene family: MAF2 prevents vernalization by short periods of cold The Plant Cell. 15:1159-1169.  211. Ranjeva R., and Boudet A.M., (1987). Phosphorylation of proteins in plants: regulatory effects and potential involvement of stimulus/response coupling. Annual Reviews in Plant Physiology. 38:73-93. 212. Richter R., Behringer C., Zourelidou M., Schwechheimer., (2013). Convergence of auxin and gibberellins signalling on the regulation of the GATA transcription factors GNC and GNL in Arabidopsis thaliana. Proceedings of the National Academy of Science. 110 (32): 13192-13197. 213. Rizhsky L., Liang H., Shuman J., Shulaev V., Davletova S., Mittler R., (2004). When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. Plant Physiol. 134:1683–96.  214. Rizzini L., Favory J-J., Cloix C., Faggionato D., O’Hara A., Kaiserli E., Beaumeister R., Schafer E., Nagy F., Jenkins G.I., Ulm R., (2011). Perception of UV-B by Arabidopsis UVR8 protein. Science. 332(6025):103-106.  215. Rodriguez M.C.S., Petersen M., Mundy J., (2010). Mitogen-activated protein kinase signalling in plants. Annual Reviews in Plant Biology. 61:621–49.  216. Rogers L., Dubos C., Cullis I.F., Surman C., Poole M., Willment J., Mansfield S., Campbell M.M., (2005). Light, the circadian clock and sugar perception in the control of lignin biosynthesis. Journal of Experimental Botany. 56(416):1651-1653.  217. Rowan D.D., Cao M., Lin-Wang K., Cooney J.M., Jensen D.J., Austin P.T., Hunt M.B., Norling C., Hellens R.P., Schaffer R.J., Allan A.C., (2009). Environmental regulation of leaf colour in red 35S:PAP1 Arabidopsis thaliana. New Phytologist. 182:102-115. 218. Rubin G., Tohge T., Matsuda F., Saito K., Scheible W-R., (2009). Members of the LBD family of transcription factors repress anthocyanin synthesis and affect additional nitrogen responses in Arabidopsis. The Plant Cell. 21:3567-3584.  237  219. Ruckle M.E., and Larkin R., (2009). Plastid signals that affect photomorphogenesis in Arabidopsis thaliana are dependent on GENOMES UNCOUPLED1 and cryptochrome1. New Phytologist. 182:367-379.  220. Ruckle M.E., Burgoon L.D., Lawrence L.A., Christopher A.S., Larkin R.M., (2012). Plastids are major regulators of light signalling in Arabidopsis. Plant Physiology. 159:366-390.  221. Sachs T., (1981). The control of the patterned differentiation of vascular tissues. Advances in Botanical Research. 9:152–262.  222. Sachs T., (2000). Integrating cellular and organismic aspects of vascular differentiation. Plant Cell Physiology. 41:649–656. 223.  Saijo Y., Sullivan J.A., Wang H., Yang J., Shen Y., Rubio V., Ma L., Hoecker U., Deng X-W., (2003). The COP1–SPA1 interaction defines a critical step in phytochrome A-mediated regulation of HY5 activity. Genes and Development. 17:2642–2647.  224. Saito K., Yonekura-Sakakibara K., Nakabayashi R., Higashi Y., Yamazaki M., Tohge T., Fernie A.R., (2013). The flavonoid biosynthetic pathway in Arabidopsis: structural and genetic diversity. Plant Physiology and Biochemistry. 72:21-34.  225. Saito, S., Goodarzi A.A., Higashimoto Y., Noda Y., Lees-Miller S.P., Apella E., Andershon C.W., (2002). ATM mediates phosphorylation at multiple p53 sites, including Ser(46), in response to ionizing radiation. Journal of Biological Chemistry. 277:12491–12494. 226. Samuel M.A., Chaal B.K., Lampard G., Green B.R., Ellis B.E., (2008). Surviving the passage. Non-canonical stromal targeting of an Arabidopsis mitogen-activated protein kinase kinase. Plant signalling & Behavior. 3(1):6-12.  227. Sandhar H.K., Bimilesh K., Prasher S., Tiwari P., Slhan M., Sharma P., (2011). A review of phytochemistry and pharmacology of flavonoids. Internationale Pharmaceutica Sciencia. 11(1):25-41.   228. Santelia D., Henrichs., Vincenzetti V., Sauer M., Bigler L., Klein M., Bailly A., Lee Y., Friml J., Geisler M., Martinoia E., (2008). Flavonoids redirect PIN-mediated polar auxin fluxes during root gravitropic responses. Journal of Biological Chemistry. 283(45):31218-31226. 229. Santner A.A., and Watson J.C., (2006). The WAG1 and WAG2 protein kinases negatively regulate root waving in Arabidopsis. Plant Journal. 45:752–764. 230. Sasaki N., Nishizaki Y., Ozeki Y., Miyahara T., (2014). The role of acyl-glucose in anthocyanin modifications. Melocules. 19:18747-18766. 238  231. Schaller A., (2004). A cut above the rest: the regulatory function of plant proteases. Planta. 220:183-197. 232. Schellmann S., and Hulskamp M., (2005). Epidermal differentiation: trichomes in Arabidopsis as a model system. International Journal of Developmental Biology. 49:579-584.  233. Schepens I., Duek P., Fankhauser C., (2004). Phytochrome-mediated light signalling in Arabidopsis. Current Opinions in Plant Biology. 7:1-6.  234. Schmid M., Davison T.S., Henz S.R., Pape U.J., Demar M., Vingron M., Schӧlkopf B., Weigel D., Lohmann J.U., (2005). A gene expression map of Arabidopsis thaliana development. Nature Genetics. 37(5):501–506. 235. Schoenbohm C., Martens S., Eder C., Forkmann G., Wesshaar B., (2005). Identification of the Arabidopsis thaliana Flavonoid 3’-hydroxylase gene and functional expression of the encoded P450 enzyme. Biological Chemistry. 381(8):749-753. 236. Schuetz M., Smith R., Ellis B., (2013). Xylem tissue specification, patterning and differentiation mechanisms. Journal of Experimental Botany. 64(1):11-31.  237.  Serna L., (2005). Epidermal cell patterning and differentiation throughout apical-basal axis of the seedling. Journal of Experimental Botany. 56:1983-1989.  238. Serna L., and Martin C., (2006). Trichomes: different regulatory networks lead to convergent structures. Trends in Plant Science. 11:274-280.   239. Sethi V., Ramghuram B., Sinha A. K., Chattopadhyay S., (2014). A mitogen-activated protein kinase cascade module, MKK3-MPK6 and MYC2, is involved in blue light-mediated seedling development in Arabidopsis. The Plant Cell. 26:3343-3357.  240. Shan X., Zhang Y., Peng W., Wang Z., Xie D., (2009). Molecular mechanism for jasmonate-induction of anthocyanin accumulation in Arabidopsis. Journal of Experimental Botany. 60(13):3849-3860.  241. Shen Y.H., Godlewski J., Bronisz A., Bronisz A., Zhu J., Comb M.J., Avruch J., Tzivion G., (2003). Significance of 14–3–3 self-dimerization for phosphorylation-dependent target binding. Molecular Biology of the Cell. 14:4721-4733.  239  242. Shi M-Z., and Xie D-Y., (2010). Features of anthocyanin biosynthesis in PAP1-D and wild –type Arabidopsis thaliana grown in different light intensity and culture conditions. Planta. 231:1385-1400.  243. Shi Q-M., Yang X., Song Li., Xue H-W., (2011). Arabidopsis MSBP1 is activated by HY5 and HYH and is involved in photomorphogenesis and brassinosteroid sensitivity regulation. Molecular Plant. 4(6):1092–1104.  244. Shi M-Z., and Xie D-Y., (2014). Biosynthesis and metabolic engineering of anthocyanins in Arabidopsis thaliana. Recent Patents on Biotechnology. 8(1):47-60. 245. Shin D.H., Choi M., Kim K., Bang G., Cho M., Choi S-B., Choi G., Park Y-I., (2013). HY5 regulates anthocyanin biosynthesis by inducing transcriptional activation of the MYB75/PAP1 transcription factor in Arabidopsis. FEBS Letters. 587(10):1543-1547. 246. Shin J., Park E., Choi G., (2007). PIF3 regulates anthocyanin biosynthesis in an HY5- dependent manner with both factors directly binding anthocyanin biosynthetic gene promoters in Arabidopsis. Plant Journal. 49:981–994.  247. Shin J., Anwar M. U., Davis S.J., (2013). Phytochrome-Interacting Factors (PIFs) as bridges between environmental signals and the circadian clock: diurnal regulation of growth and development. Molecular Plant. 6(3):592-595.  248. Shu K., Liu X-D., Xie Q., He Z-H., (2016). Two faces of one seed: hormonal regulation of dormancy and germination. Molecular Plant. 9:34-45Schulze B., Mentzel T., Jehle A.K., Mueller K., Beeler S., Boller T., Felix G., (2010). Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1. Journal of Biological Chemistry. 285(13):9444-9451.  249. Simmonds M.S.J., (2003). Flavonoid-insect interactions: recent advances in our knowledge. Phytochemistry. 64:21-30.  250. Smith H.M.S., Hicks G.R., Raikhel N.V., (1997). Importin α from Arabidopsis thaliana is a nuclear import receptor that recognizes three classes of import signals. Plant Physiology. 114:411-417. 251. Smykowski A., Fischer S.M., Zentgraf U., (2015). Phosphorylation affects DNA-binding of the senescence-regulating bZIP transcription factor GBF1. Plants (Basel). 4:691-709. 240  252. Song S.K., Ryu K.H., Kang Y.H., Song J.H., Choo Y.H., Schiefelbein J., Lee M.M., (2011). Cell fate in Arabidopsis root epidermis is determined by competition between WEREWOLF and CAPRICE. Plant Physiology. 157(3):1196-1208.  253. Srivastava R., Liu J-X., Howell S.H., (2008). Proteolytic processing of a precursor protein for growth-promoting peptide by subtilisin serine protease in Arabidopsis. The Plant Journal. 56:219-227. 254. Stanko V., Guiliani C., Retzer K., Djamei A., Wahl V., Wurzinger B., Wilson C., Heberle-Bors E., Teige M., Kragler F., (2014). Timing is everything: highly specific and transient expression of a MAP kinase determines auxin-induced leaf venation patterns in Arabidopsis. Molecular Plant. 7(11):11637-1652. 255. Stephenson P.G., Fankhauser C., Terry M.J., (2009). PIF3 is a repressor of chloroplast development. Proceedings of the National Academy of Science. 106(18):7654-7659.  256. Steyn W.J., Wand S.J.E., Holcroft D.M., Jacobs G., (2002). Anthocyanin in vegetative tissues: a proposed unified function in photoprotection. New Phytologist. 155:349-361. 257. Stracke R., Werber M., Weisshaar B., (2001). The R2R3 gene family in Arabidopsis thaliana. Current Opinions in Plant Biology. 4:447-456.  258. Stracke R., Ishihara H., Huep G., Mehrtens F., Niehaus K., Weisshaar B., (2007). Differential regulation of closely related R2R3-MYB transcription factors control flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant Journal 50(4):660-677.  259. Susek R.E., Ausubel F.M., and Chory J., (1993). Signal transduction mutants of Arabidopsis uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell. 74:787-799.  260. Tamada Y., Yun J-Y., Woo S.C., Amasino R.M., (2009). Arabidopsis TRITHORAX-RELATED7 is required for methylation of lysine 4 of Histone3 H3 and for transcriptional activation of FLOWERING LOCUS C. The Plant Cell. 21:3257-3269  261. Teige M., Scheikl E., Eulgem T., Doczi R., Ichimura K., Shonozaki K., Dangl J.L., Hirt H., (2004). The MKK2 pathway mediates cold and salt stress signalling in Arabidopsis. Molecular Cell. 15:141–52.    241  262. Teng S., Keurentjes J., Bentsink L., Koornneef M., Smeekens S., (2005). Sucrose-specific  induction of anthocyanin biosynthesis in Arabidosis requires MYB75/PAP1 gene. Plant Physiology. 139:1840-1852  263. Tepperman J.M., Hwang Y.S., Quail P.H., (2006). PhyA dominates in transduction of red-light signals to rapidly responding genes at the initiation of Arabidopsis seedling de-etiolation. Plant Journal. 48:728-742.  264. Tilbrook K., Arongaus A.B., Binkert M., Heijde M., Yin R., Ulm R., (2013). The UVR8 UV-B photoreceptor:perception, signalling and response. The Arabidopsis Book. doi: 10.1199/tab.0164   265. Tipathy B.C., and Oelmϋller R., (2012). Reactive oxygen species generation and signalling in plants. Plant Signalling and Behaviour. 7(12):1621-1633.  266. Tohge T., Nishiyama Y., Yokota Hirai M., Yano M., Nakajima J-I., Awazuhara M., Inoue E., Takahashi H., Goodenowe D.B., Kitayama M., Noji M., Yamazaki M., Saito K., (2005). Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing a MYB transcription factor. The Plant Journal. 42:218-235.  267. Tohge T., Watanabe M., Hoefgen R., Fernie A.R., (2013). The evolution of phenylpropanoid metabolism in green lineage. Critical Reviews in Biochemistry and Molecular Biology. 48(2):123-152.  268. Van der Hoorn R.A.L., (2008). Plant proteases: from phenotypes to molecular mechanisms. Annual Reviews in Plant Biology. 59:191-223. 269. Varagona M.J., Schmidt R.J., Raikhel N.V., (1992). Nuclear localization signal(s) required for nuclear targeting of maize regulator protein Opaque-2. The Plant Cell. 4:1213-1227.  270. Verweij W., Spelt C.E., Bliek M., Vries M., Wit N., Faraco M., Koes R., Quattrocchio F.M., (2016). Functionally similar WRKY proteins regulate vacuolar acidification in Petunia and hair development in Arabidopsis. The Plant Cell. 28:786-803.  271. Vierstra R.D., (2009). The ubiquitin-26S proteasome system at the nexus of plant biology. Nature Reviews in Molecular and Cell Biology. 10:385-397. 272. Vogel M.O., Moore M., Kӧnog K., Pecher P., Alsharafa K., Lee J., Dietz K-J., (2014). Fast retrograde signalling in response to high light involves metabolite export, MITOGEN-ACTIVATED PROTEIN KINASE 6 and AP2/ERF transcription factors in Arabidopsis. The Plant Cell. 26:1151-1165.  242  273. Vogt T., (2010). Phenylpropanoid biosynthesis. Molecular Plant. 3(1):2-10.  274. Vousden, K.H., (2002) Activation of the p53 tumour suppressor protein. Biochimica et Biophysica Acta. 1602:47–59. 275. Wang H-F., Feng L., Niu D-K., (2007). Relationship between mRNA stability and introns presence. Biochemical and Biophysical Research Communications. 1(2):203-308. 276. Wang H., Ngwenyama N., Liu Y., Walker J.C., Zhang S., (2007). Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell. 19:63–73.   277. Wang H. and Wang H., (2015). Phytochrome signalling: time to tighten up the loose ends. Molecular Plant. 8:540-551.  278. Wang L., Wu L.M., Greaves I.K., Zhu A., Dennis E.S., Peacock W.J., (2017). PIF4-controlled auxin pathway contributes to hybrid vigor in Arabidopsis thaliana. Proceedings of the National Academy of Science. 114(17): e3555-e3562. doi: https://doi.org/10.1073/pnas. 1703179114 279. Wang, P., Xue, L., Batelli, G., Lee, S., Hou, Y.-J., Van Oosten, M. J., Zhang H., Tao W.A., Zhu J.K., (2013). Quantitative phosphoproteomics identifies SnRK2 protein kinase substrates and reveals the effectors of abscisic acid action. Proceedings of the National Academy Science U.S.A. 110(27):11205–11210.  280. Wang Y-H., Garvin D.F., Kochian L.V., (2002). Rapid induction of regulatory and transporter genes in response to phosphorus, potassium, and iron deficiencies in tomato roots. Evidence for cross talk and root/rhizosphere-mediated signals. Plant Physiology. 130(3):1361-1370.  281. Wasson A.P., Pellerone F.I., and Mathesius U., (2006). Silencing the flavonoid pathway in Medicago truncutula inhibits root nodule formation and prevents auxin transport regulation by Rhizobia. Plant Cell. 18:1617-1629.  282. Whitmarsh A.J., and Davis R.J., (2000). Regulation of transcription factor function by phosphorylation. Cell and Molecular Life Sciences. 57:1172–1183.  283. Winkel-Shirley B., (2001). Flavonoid biosynthesis, a colourful model for genetics, biochemistry, cell biology and biotechnology. Plant Physiology. 126:485-493.  284. Winter D., Vinegar B., Nahal H., Ammar R., Wilson G.V., Provart N.J., (2007). An “Electronic Fluorescent Pictograph” browser for exploring and analyzing large-scale biological data sets. PLOS One. 2(8): e718. doi: 10.1371/journal.pone.0000718  243  285. Xing Y., Jia W.S., Zhang J.H., (2007). AtMEK1 mediates stress-induced gene expression of  CAT1 catalase by triggering H2O2 production in Arabidopsis. Journal of Experimental Botany. 58:2969-2981.  286. Xing Y., Jia W., Zhang J., (2008). AtMKK1 mediates ABA-induced CAT1 expression and H2O2 production via AtMPK6-coupled signalling in Arabidopsis. Plant Journal. 54:440–51.  287. Xing Y., Cao Q., Zhang Q., Qin L., Jia W., Zhang J., (2013). MKK5 regulates high light-induced gene expression of Cu/Zn superoxide dismutase 1 and 2 in Arabidopsis. Plant Cell Physiology. 54:1217-1227.   288. Xu W., Dubos C., Lepiniec L., (2015). Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends in Plant Science. 20(3):176-185.  289. Yin, R., Han, K., Heller, W., Albert, A., Dobrev, P.I., Zazímalová, E., Schäffner, A.R., (2014) Kaempferol 3-O-rhamnoside-7-O-rhamnoside is an endogenous flavonol inhibitor of polar auxin transport in Arabidopsis shoots. New Phytologist. 201:466–475. 290. Yonekura-Sakakibara T., Tohge T., Niida R., Saito K., (2007). Identification of a flavonol 7-O-rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics. Journal of Biological Chemistry. 282:14932-14941.  291. Yonekura-Sakakibara T., Tohge T., Matsuda F., Nakabayashi R., Takayama H., Niida R., Watanabe-Takahashi A., Inoue E., Saito K., (2008). Comprehensive profiling and transcription coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. Plant Cell. 20:2160-2176. 292. Yonekura-Sakakibara K., Fukushima A., Nakabayashi R., Hanada K., Matsuda F., Sugawara S., Inoue E., Kuromori T., Ito T., Shinozaki K., Wangwattana B., Yamazaki M., Saito K., (2012). Two glycosyltransferases involved in anthocyanin modification delineated by transcriptome independent component analysis in Arabidopsis thaliana. The Plant Journal. 69:154-167. 293. Yoo S-D., Cho Y., Sheen J., (2009). Emerging connections in the ethylene signalling network. Trends in Plant Science. 14(5):270-279.  294. Yu Y., Wang J., Zhang Z., Quan R., Zhang H., Deng X.W., Ma L., Huang R., (2013). Ethylene promotes hypocotyl growth and HY5 degradation by enhancing the movement of COP1 into the nucleus in the light. PLOS One Genetics. 9(12):1-13. 244  295. Yu X., Liu H., Klejnot J., Lin C., (2010). The Cryptochrome blue light receptors. The Arabidopsis Book. e0135:1-27  296. Zeng Q., Chen J-G., Ellis B.E., (2011). AtMPK4 is required for male-specific meiotic cytokinesis in Arabidopsis. The Plant Journal. 67:895-906. 297. Zeng Q., Sritubtim S., Ellis B.E., (2011). AtMKK6 and AtMPK13 are required for lateral root formation in Arabidopsis. Plant Signaling &Behavior. 6(10):1436-1439. 298. Zhang J., Subramanian S., Stacey G., and Yu O., (2009). Flavones and flavonols play distinct critical roles during nodulation of Medicago truncatula by Sinorhizobium meliloti. Plant Journal. 57:171-183.  299. Zhao Q., Nakashima J., Chen F., Yin Y., Fu C., Yun J., Shao H., Wang X., Wang Z-Y., Dixon R.A., (2013). LACCASE is necessary and non redundant with PEROXIDASE for lignin polymerization during vascular development in Arabidopsis. The Plant Cell. 25:3976-3987. 300. Zhu L., Bu Q., Xu X., Paik I., Huang X., Hoecker U., Deng X W., Huq E., (2015). CUL4 forms an E3 ligase with COP1 and SPA to promote light-induced degradation of PIF1. Nature Communications. 6(7245). doi: 10.1038/ncomms824 301. Zimmermann M.I., Heim M.A., Weisshaar B., Uhrig J.F., (2004). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like bHLH proteins. The Plant Journal. 40:22-34.  302. Zhong R. and Ye Z-H., (2009). Secondary Cell Walls. Encyclopedia of Life Sciences. John Wiley & Sons, Ltd. doi: https://doi.org/10.1002/9780470015902.a0021256      245  APPENDIX Fig. S2.1  Fig S2.1 Manipulation of western blot images used for quantification of recombinant MYB75 protein by ImageJ in Fig 2.6. SDS PAGE and Western blot analysis was conducted to monitor degradation of recombinant MYB75 protein in DEXpr:MYB75 gene Arabidopsis seedlings. The chemiluminescent signal detecting recombinant of MYB75 was captured on photosensitive film and the original image displayed in Fig 2.6 as well as above. Due to signal bleed through between individual lanes, the original image was edited to facilitate ImageJ analysis, as depicted above.      246   Fig. S2.2 A 247    Fig. S2.2 continued B 248  Fig S2.2 Degradation of MYB75WT and MYB75T131E in Arabidopsis seedlings: additional results. The western blots above were performed as described in Fig 2.6. Results from Fig 2.6 are displayed here (A; first five lanes) along with additional samples. Ten days after germination, hygromycin-resistant seedlings were transferred to 24 well plates, containing liquid ½MS medium, with ~20-40 seedlings per well. Recombinant MYB75 protein expression was induced by addition of 30µM DEX, with overnight incubation under continuous light, in the presence of 50µM MG132 proteasome inhibitor, to prevent protein degradation. The following day, the DEX/MG132-containing medium was removed and replaced with liquid ½MS containing 1mM CHX with or without phosphorylation inhibitors, 10µM U0126 and 100µM PD98059. The seedlings were subsequently incubated in the light or in the dark, and isolated at different time points, weighed and frozen in liquid nitrogen for subsequent western blot analysis. These results consistently show that MYB75T131E is degraded more rapidly under all treatments than MYB75WT. Phosphorylation inhibitors, 10µM U0126 and 100µM PD98059 appear to have a mild positive effect on the abundance of MYB75WT protein, in the light and in the dark, particularly at earlier time points (1h and 2 h).          

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0369253/manifest

Comment

Related Items