UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of a novel protein tether enriched at endoplasmic reticulum-plasma membrane contact sites… Benítez de la Fuente, Francisco 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_september_benitez_francisco.pdf [ 5.88MB ]
Metadata
JSON: 24-1.0368556.json
JSON-LD: 24-1.0368556-ld.json
RDF/XML (Pretty): 24-1.0368556-rdf.xml
RDF/JSON: 24-1.0368556-rdf.json
Turtle: 24-1.0368556-turtle.txt
N-Triples: 24-1.0368556-rdf-ntriples.txt
Original Record: 24-1.0368556-source.json
Full Text
24-1.0368556-fulltext.txt
Citation
24-1.0368556.ris

Full Text

   IDENTIFICATION OF A NOVEL PROTEIN TETHER ENRICHED AT ENDOPLASMIC RETICULUM-PLASMA MEMBRANE CONTACT SITES AND INVOLVED IN SALT STRESS TOLERANCE IN ARABIDOPSIS  by   Francisco Benítez de la Fuente   B.Sc., Universidad de Málaga, 2015    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE    in   The Faculty of Graduate and Postdoctoral Studies (Botany)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) June 2018  © Francisco Benítez de la Fuente, 2018  ii  Committee Page The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis/dissertation entitled:  IDENTIFICATION OF A NOVEL PROTEIN TETHER ENRICHED AT ENDOPLASMIC RETICULUM-PLASMA MEMBRANE CONTACT SITES AND INVOLVED IN SALT STRESS TOLERANCE IN ARABIDOPSIS submitted by FRANCISCO BENITEZ  in partial fulfilment of the requirements for the degree of MASTER OF SCIENCE in BOTANY   Examining Committee: ABEL ROSADO, BOTANY Supervisor  LJERKA KUNST, BOTANY Supervisory Committee Member  GEOFFREY WASTENEYS, BOTANY Supervisory Committee Member ELIZABETH CONIBEAR, BIOCHEMISTRY  Additional Examiner   Additional Supervisory Committee Members: XIN LI, BOTANY Supervisory Committee Member  Supervisory Committee Member     iii  Abstract Plants are sessile and are exposed to environmental changes that can compromise their survival and yield. Salt stress is one of the most common environmental stresses. Arabidopsis SYT1 is a key player in plant response to salt stress mediated by Ca2+, and acts as protein bridge, tethering the endoplasmic reticulum to the plasma membrane. These regions of close contact between organelles, called membrane contact sites, are conserved in eukaryotes, and are involved in functions such as Ca2+ signaling and lipid homeostasis. However, their relationship with salt stress in plants is unknown. In this project, I aimed to discover new contact site tethers in the model organism Arabidopsis thaliana and shed light on the relation of endoplasmic reticulum-plasma membrane contact sites (EPCS) and salt stress tolerance. I used bioinformatic, phylogenetic and cellular biological approaches and I related an Arabidopsis protein family, the N-terminal transmembrane C2 domain (NTMC2) family, to contact sites. A putative tether called Arabidopsis thaliana Ca2+-dependent Lipid Binding (AtCLB) belongs to the NTMC2 family. AtCLB has a subcellular localization pattern of beads and strings, which resembles the pattern found for the plant EPCS tether SYT1. AtCLB pattern becomes more punctate under depletion of cytosolic Ca2+, suggesting that intracellular Ca2+ is important for AtCLB contact with the plasma membrane. Mutant plants lacking functional AtCLB did not show any visible phenotype in salt stress conditions. Under salt stress treatments, however, the normal subcellular pattern of AtCLB was altered, EPCS formation was increased and the intermembrane distance was decreased. This result suggests a role for AtCLB in salt stress tolerance that might be phenotypically masked by functional redundancy. This subcellular alteration and the reduction of intermembrane distance was mimicked when the amount of phosphatidylinositol-(4,5)-bisphosphate was artificially increased at the plasma membrane. These results point towards a model of EPCS tethering involving cytosolic Ca2+, salt stress and negatively charged phosphoinositides. Further study will be required to fully understand EPCS regulation. In summary, these discoveries clarify some mechanistic aspects of EPCS tethering in plants and open a door to the discovery of new contact site protein tethers from the plant protein family NTMC2.  iv  Lay Summary Plants are sessile and are exposed to environmental changes that can compromise their survival and yield. Among all environmental factors that affect plants, drought is one of the most extended. Drought produces an increase in the concentration of salts in the soil, causing salt stress. Understanding how plants respond to salt stress is fundamental to improve crop yield and to secure food for the rapidly growing world population. In this project, I used the model organism Arabidopsis thaliana and bioinformatic and microscopy techniques to find new proteins important for plant tolerance to salt stress. I discovered the protein AtCLB, which belong to the family NTMC2 and it is implicated in the communication between different parts of the cell during salt stress, although it is not required for plant tolerance to salt. Future studies will decipher the precise role of AtCLB in plant response to salt stress.          v  Preface In Chapter III, a preliminary SMP consensus sequence and a preliminary phylogenetic analysis was performed by Dr. Sunjoo Joo, research assistant in Dr. Jae-Hyeok Lee’s lab, Department of Botany, UBC. I carried out the final SMP consensus sequence and the subsequent phylogenetic analysis, with guidance by Dr. Abel Rosado. I performed the rest of the work described in Chapter III, including the structural prediction, study and alignment of the putative tethers, and the gene expression analysis. In Chapter IV, I generated AtCLB-GFP, SYTF-GFP and 2TMCLB-GFP transgenic lines, with early technical support from Dr. Makoto Shirakawa, post doctoral fellow in Dr. Abel Rosado’s lab. I obtained the insertional mutant atclb1-3 and performed the phenotypic analysis and subsequent quantification. I performed the qRT-PCR analysis with technical support of Dr. Eun Kyoung Lee, research associate in Dr. Abel Rosado’s lab. The co-immunoprecipitation analysis that detected AtCLB as an interactor of SYT1 was performed by Dr. Jessica Pérez Sancho, a former PhD student at Dr. Miguel Ángel Botella’s lab, in the University of Málaga. The chemical treatments used in confocal microscopy experiments were conceived by Dr. Abel Rosado, Dr. Eun Kyoung Lee, and myself. I performed AtCLB-GFP and SYT1-GFP-related confocal microscopy experiments, and subsequent quantification with early guidance and technical support by Dr. Eun Kyoung Lee. Dr. Eun Kyoung Lee performed the experiments and quantifications related to CITRINE-2xPHPLC, HDEL and MAPPER fluorescent markers, with exception of the quantification of GFP-HDEL reticulated structures areas in NaCl stress, which was performed by me. Preparation of UBQ10:AtCLB-tRFP, UBQ10:SYTF-tRFP, UBQ10:2TMCLB-RFP, pAtCLB:AtCLB-GFP, pSYTF:SYTF-GFP, p2TMCLB:2TMCLB-GFP and pAtCLB:GUS  constructs was performed by myself with the subsequent transformation into Arabidopsis Col-0 background. I also transformed UBQ10:AtCLB-tRFP, UBQ10:SYTF-tRFP and UBQ10:2TMCLB-RFP constructs into transgenic plants expressing SYT1-GFP, for co-localization analysis. We thank Dr. Geoffrey Wasteneys for the gift of the UBQ10 promoter-driven C terminal tagRFP fusion destination binary vector and Dr. Mathias Schuetz for  vi  the gift of the C4H-GFP transgenic plants. I generated the double mutants atclb1-3 syt1 and atclb1-3 syt5 and the triple mutant atclb1-3 syt1/5 while the double mutant syt1/5 was previously generated in Dr. Abel Rosado’s lab.       vii  Table of Contents Abstract ....................................................................................................................................................... iii Lay Summary ............................................................................................................................................. iv Preface .......................................................................................................................................................... v Table of Contents ...................................................................................................................................... vii List of Tables .............................................................................................................................................. xi List of Figures ............................................................................................................................................ xii List of Abbreviations ............................................................................................................................... xiv Acknowledgements .................................................................................................................................. xvi Dedication ............................................................................................................................................... xviii Chapter I: Introduction .............................................................................................................................. 1 1.1. Salt stress sensing and response in plants ................................................................................ 1 1.1.1. Ion transporters and channels in NaCl tolerance .............................................................. 1 1.1.2.  ABA signaling during NaCl stress................................................................................... 3 1.1.3. Phospholipid signaling during NaCl stress ....................................................................... 4 1.2. Intracellular communication during NaCl stress ..................................................................... 5 1.3. Structure of membrane contact sites and their associated functions ........................................ 6  viii  1.3.1. MCS tethers in non-vesicular lipid transfer ...................................................................... 7 1.3.2. Organelle inheritance and autophagy at MCSs ................................................................. 9 1.3.3 EPCS tethers in Ca2+ signaling and homeostasis ............................................................. 10 1.4. EPCS tethers in plants ........................................................................................................... 11 1. 1.5 Structure and function of the SMP domain ................................................................... 14 2. 1.6. Research objectives ...................................................................................................... 15 Chapter II: Methods ................................................................................................................................. 17 2.1 Bioinformatic Analysis ........................................................................................................... 17 2.2 Plant material and growth conditions. .................................................................................... 18 2.3 Molecular cloning ................................................................................................................... 18 2.4 Generation of transgenic plants and transformants selection ................................................. 20 2.5 Chemical treatments, image acquisition and quantifications .................................................. 20 2.6 Physiological treatments ......................................................................................................... 21 2.7 Quantitative RT-PCR.............................................................................................................. 21 2.8 Accession numbers ................................................................................................................. 21 Chapter III: The search for MCS tethers ............................................................................................... 22 3.1. Results ................................................................................................................................... 22 3.1.1. AtCLB, a putative MCS tether, belongs to the NTMC2 family ..................................... 22 3.1.2. The NTMC2 tethers have Ca2+-binding and lipid-binding domains ............................... 25 3.1.3. The SMP domain has conserved residues in eukaryotes ................................................ 29  ix  3.1.4. The expression pattern of the putative tethers indicates roles in abiotic stress ............... 30 3. 2. Discussion ....................................................................................................................... 34 3.2.1. The Arabidopsis NTMC2 family might contain more MCS tethers ............................... 34 3.2.2. Different subfamilies of NTMC2 proteins have evolved differentially in plants ........... 35 3.2.3. Conserved residues in eukaryotic SMP domains suggest that SMP-protein dimerization and lipid-transport may also occur in plants. ...................................................................................... 35 3.2.4. Putative tether expression patterns suggest functions in abiotic and biotic stresses ....... 38 Chapter IV: Characterization of the putative tethers ........................................................................... 41 4.1. Results ................................................................................................................................... 41 4.1.1. AtCLB and SYTF show a “beads and strings” pattern at the cortical ER ...................... 41 4.1.2. SYT1 and AtCLB reticulations increase under salt stress .............................................. 43 4.1.3. atclb1-3 does not show Ca2+-mediated NaCl stress phenotypes ..................................... 46 4.1.4. Depletion of cytosolic Ca2+ increases SYT1 and AtCLB puncta pattern ....................... 49 4.1.5. SYT1 and AtCLB subcellular pattern expands after increases of PtdIns(4,5)P2 at the plasma membrane ............................................................................................................................... 51 4.2. Discussion .............................................................................................................................. 53 4.2.1. AtCLB and SYTF subcellular distribution patterns resemble SYT1 and suggest EPCS localization .......................................................................................................................................... 53 4.2.2. Decreases in cytosolic Ca2+ promote EPCS formation by SYT1 and AtCLB ................ 54 4.2.3. AtCLB is not required for plant tolerance to NaCl stress ............................................... 55  x  4.2.4. Salt stress and PtdIns(4,5)P2 increases induce SYT1 and AtCLB EPCS and reduce intermembrane distance ...................................................................................................................... 56 Chapter V: Conclusions ........................................................................................................................... 58 Bibliography .............................................................................................................................................. 62 Appendices ................................................................................................................................................. 71 Appendix A: Expression level of NTMC2 genes according to RNAseq data .............................. 71 Appendix B: Alignment of 2TMCLB model with ESyt2 SMP and C2 domains. ........................ 73 Appendix C: Alignment of SYTF model with ESyt2 SMP and C2 domains. .............................. 74 Appendix D: SYT1 co-immunoprecipitation analysis shows AtCLB as interactor in vitro. ........ 75 Appendix E: SYT1-GFP and AtCLB localization under KCl, MgCl2 and Na2SO4 stresses. ........ 76 Appendix F: PtdIns(4,5)P2 increases under NaCl stress and after blockage of PLC. ................... 77 Appendix G: HDEL-GFP subcellular localization under depletion of cytosolic Ca2+. ................. 78 Appendix H: SYT1-GFP and HDEL-GFP localization upon increases of cytosolic Ca2+. ........... 79 Appendix I:  SYT1 and HDEL co-localization under NaCl stress. .............................................. 80 Appendix J:  MAPPER shows decrease of intermembrane distance upon salt stress .................. 81     xi  List of Tables Table 2.1: List of primers used in the thesis. .................................................................................... 19 Table 2.2: List of constructs generated. ............................................................................................ 20 Table 3.1: Protein members of the NTMC2 family .......................................................................... 23 Table 3.2: Expression levels of the tether candidates in different tissue. ......................................... 32              xii  List of Figures Figure 1.1: Model for Na+ compartmentalization by SOS pathway. .................................................. 3 Figure 1.2: Model for TMEM24 non-vesicular lipid transport at EPCSs. .......................................... 8 Figure 1.3: Model for STIM1-Orai1 Ca2+ signaling at EPCSs ......................................................... 10 Figure 1.4: Model for SYT1 binding at EPCSs ................................................................................ 13 Figure 3.1: Phylogenetic tree of SMP-containing proteins in plants. ............................................... 25 Figure 3.2: Ribbon diagrams of the alignment between the ESyt2 SMP domain and the consensus SMP model.................................................................................................................................................. 27 Figure 3.3: Ribbon diagrams of the alignment between AtCLB model and the SMP and C2 domains of ESyt2 ...................................................................................................................................................... 28 Figure 3.4: Functional domains of the AtCLB, 2TMCLB and SYTF tether candidates .................. 29 Figure 3.5: Alignment of the consensus SMP domain and the SMP domain of the MCS tethers. ... 30 Figure 3.6: Microarray-based expression levels of SYT1, AtCLB, SYTF and 2TMCLB in different developmental stages .................................................................................................................................. 31 Figure 3.7: Up and downregulation of the putative tethers under different treatments .................... 33 Figure 3.8: Crystal structure of human ESyt2 SMP and C2 domains .............................................. 36 Figure 3.9: Alignment of the consensus SMP and the SMP domains of the MCS tethers and Arabidopsis NTMC2 proteins ..................................................................................................................... 37 Figure 4.1: Subcellular localization of C4H-GFP, SYT1-GFP, AtCLB-GFP and SYTF-GFP ........ 42 Figure 4.2: Subcellular localization of C4H and 2TMCLB-GFP. .................................................... 43 Figure 4.3: Subcellular localization of SYT1-GFP and AtCLB-GFP under NaCl, K2SO4 and sorbitol stress. ........................................................................................................................................................... 44 Figure 4.4: Quantification of closed reticulated structures of SYT1-GFP and AtCLB-GFP under NaCl, K2SO4 and sorbitol treatments .......................................................................................................... 45  xiii  Figure 4.5: Distribution of HDEL-GFP reticulated structures area under NaCl stress. .................... 46 Figure 4.6: Phenotypical characterization of atclb1-3 mutant in NaCl stress and different Ca2+ conditions. ................................................................................................................................................... 47 Figure 4.7: Relative AtCLB mRNA abundance in atclb1-1 and atclb1-3 mutants ........................... 48 Figure 4.8: Subcellular localization of SYT1-GFP and AtCLB-GFP after depletion of Ca2+cyt by EGTA and LaCl3. ....................................................................................................................................... 49 Figure 4.9: Quantification of puncta number of SYT1-GFP and AtCLB-GFP in cytosolic Ca2+ depletion treatments. ................................................................................................................................... 50 Figure 4.10: Subcellular localization of SYT1-GFP and AtCLB-GFP after PLC inactivation by U73122 ........................................................................................................................................................ 51 Figure 4.11: Quantification of closed reticulate structures of SYT1-GFP and AtCLB-GFP under U73122 treatment ........................................................................................................................................ 52         xiv  List of Abbreviations ABA Abscisic Acid ABI1 Abscisic Acid Insensitive 1 AtCLB Arabidopsis thaliana Calcium-dependent Lipid-binding Arabidopsis Arabidopsis thaliana CBL   Calcineurin B-like  CIPK   CBL-interacting Protein Kinase  DAG   Diacylglycerol EPCS Endoplasmic Reticulum-Plasma Membrane Contact Site ER   Endoplasmic Reticulum ERMES   ER-mitochondria Encounter Structure ESyt   Extended Synaptotagmin GFP   Green Fluorescent Protein IP3   Inositol-1,4,5-triphosphate MCS   Membrane Contact Site MSP   Major Sperm NVJ   Nucleus-Vacuole Junction ORP   OSBP-related Proteins OSBP   Oxysterol-binding Protein  xv  OSCA1   Reduced Hyperosmolarity-induced Calcium Increase 1   PI   Phosphatidylinositol PI4K   Phosphatidylinositol 4 Kinase PIP5K   Phosphatidylinositol 4-phosphate 5 Kinase PKC  Protein Kinase C PLC   Phospholipase C PM   Plasma Membrane PP2B  Protein Serine/threonine Phosphatase 2B PtdIns(4,5)P2  Phosphatidylinositol-(4,5)-bisphosphate SMP   Synaptotagmin-like Mitochondrial Lipid-binding Protein SOS    Salt Overly Sensitive StART   Steroidogenic Acute Regulatory Transfer STIM    Stromal Interaction Molecule SYT   Synaptotagmin TMEM24  Transmembrane Protein 24 TULIP   Tubular Lipid  VAP   VAMP-associated Protein VST   VAP-related Suppressor of TMM [Ca2+]cyt  Cytosolic concentration of Ca2+ ions   xvi  Acknowledgements First, I would like to thank my supervisor, Dr. Abel Rosado, who gave me the opportunity to come to UBC and who supported me during these years, financially, intellectually, and personally. My settling in Vancouver was much easier thanks to him, who really understood how important sunshine can be for an  Andalusian. I also would like to thank my supervisory committee, Dr. Xin Li, Dr Geoffrey Wasteneys and Dr. Ljerka Kunst, for their guidance and useful suggestions.  Thanks to Dr. Makoto Shirakawa, whose guidance and support at the beginning of the project introduced me to research. I would never be grateful enough to Dr. Eun Kyoung Lee: she has been indispensable in my learning of molecular cloning, confocal microscopy and research in general. This project would not have been possible without her guidance, mentorship, scientific discussions, and answers to my never-ending questions. I also want to thank the undergraduate students that helped me through the project: Melissa, Geety and Lydia.  I am also grateful to Dr. Robin Young. She was a great guidance and support during my teaching assistantships, and she helped me to understand how important teaching is and how much I love it. Her advice will have a profound influence on my future teaching.  I would like to thank Dr. Ljerka Kunst and Dr. George Haughn lab members for their helpful advice through my learning and their comradeship. There was always a good atmosphere thanks to them.  I am immensely grateful to UBC, for the financial support, and to the Botany office staff, specially Isabel Ferens and Alice Liou, who were always willing to help with the ins and outs of bureaucracy.   xvii   Last, but not least, I want to thank my friends and my Spanish and Vancouverite families because they gave me the support and joy every scientist needs to overcome the bad moments. This thesis is specially dedicated to them.   xviii  Dedication    La patience est amère, mais son fruit est doux      Jean-Jacques Rousseau. Philosopher and botanist.  Chapter I: Introduction 1  Chapter I: Introduction 1.1. Salt stress sensing and response in plants Being sessile, plants must cope with adverse environmental conditions, such as soil salinity, drought, and extreme temperatures, which reduce plant growth and yield (Cramer et al., 2011). Among these physical and/or chemical factors, NaCl stress is one of the most important environmental constraints limiting crop productivity worldwide (Parre et al., 2007; Zhu, 2016). NaCl is the most common compound causing stress and its physiological effects in plants include, among others, ion toxicity (Luan et al., 2009), restriction of water availability (Zhu, 2016), damage to cellular lipid membranes (Schapire et al., 2008), oxidative stress and metabolic alterations such as photosynthesis inhibition (Zhu, 2016). Despite the important physiological alterations caused by NaCl in plants, the molecular components responsible for sensing and responding to NaCl are largely uncharacterized (Zhu, 2016). In this context, one of best-characterized cellular responses to NaCl stress, the cytosolic accumulation of Ca2+ ions ([Ca2+]cyt), has been used to identify components of the NaCl signaling pathway and highlighted the roles of Na+ transporters, hormones and lipids in the NaCl stress response in Arabidopsis thaliana (de Zelicourt et al., 2016; Zhu, 2016). 1.1.1. Ion transporters and channels in NaCl tolerance The analysis of loss- and gain-of-function mutants with altered Ca2+ signaling responses to osmotic and/or ionic stress has been essential for the identification of the molecular components involved in NaCl tolerance. For example, the analysis of mutants with reduced [Ca2+]cyt after hyperosmotic stress in Arabidopsis  enabled the identification of the hyperosmolarity-gated Ca2+-channel OSCA1 (reduced hyperosmolarity-induced calcium increase 1). OSCA1 is located at the plasma membrane (PM). Therefore, this identification also highlighted the important role of PM-localized Ca2+ channels as putative NaCl sensors (Yuan et al., 2014). Along the same line, other studies proposed that PM-localized mechano-Chapter I: Introduction 2  sensitive Ca2+ channels could act as sensors for osmotic and salt stress, since both stresses reduce cell turgor and affect membrane tension (Swarbreck et al., 2013). However, the functional redundancy of these mechano-sensitive Ca2+ channels has hindered their functional characterization as NaCl stress signaling components. A mechanism used by plants to tolerate salt stress is ion compartmentalization (Figure 1.1), which involves the active transport of Na+ ions (Luan, 2009). In this process, the [Ca2+]cyt increase produced by NaCl stress is detected by Ca2+-binding proteins which trigger the Salt Overly Sensitive (SOS) protein kinase signaling pathway (Zhu, 2002, 2016). In this pathway, SOS3, a member of the Ca2+-binding Calcineurin B-like (CBL) protein family, acts as a Ca2+ sensor that binds and activates the CBL-interacting protein kinase (CIPK) SOS2 upon [Ca2+]cyt increase (Luan, 2009). The SOS3/SOS2 complex, now active, phosphorylates and activates the PM-localized Na+/H+ antiporter SOS1 (Kim et al., 2007). SOS1 uses the positive H+ gradient between the cytosol and the apoplast to shuttle Na+ from the cytosol to the apoplast while PM ATPases maintain the pH gradient, pumping H+ back to the apoplast (Kim et al., 2007; Luan, 2009; Zhu, 2000). SOS3 is expressed in roots and directs the expulsion of Na+ to the soil but other SOS3 paralogs such as CBL10 are expressed mainly in shoots and leaves indicating  that Na+  compartmentalization occurs in all plant tissues (Kim et al., 2007).  In this case, the CBL10/SOS2 complex is targeted to the tonoplast, where it might activate tonoplast Na+ transporters such as  NHX1 that pump Na+ into the central vacuole against its concentration gradient (Figure 1.1) (Deinlein et al., 2014; Kim et al., 2007). Finally, an additional Na+/H+ antiporter, HKT1, is expressed in parenchyma and vascular cells. HTK1 links the Na+ detoxification mechanisms in shoots and roots by loading Na+ from leaves to the vascular system and unloading Na+, in combination to SOS1 from the roots to the soil (Figure 1.1) (Mäser et al., 2002; Zhu, 2000).  Chapter I: Introduction 3   1.1.2.  ABA signaling during NaCl stress In plants, the cellular responses to NaCl stress generally involve an increase of abscisic acid (ABA), an important phytohormone activated in response to multiple environmental stresses. ABA signalling requires three main components: a member of the PYR/PYL/RCAR family of ABA receptors, a member of the  protein phosphatase PP2C family that acts as a negative regulator, and the protein kinase SnRK2 that displays auto-phosphorylation activity and acts as a positive regulator of the ABA signaling pathway Figure 1.1: Model for Na+ compartmentalization by SOS pathway. During salt stress, Ca2+ signaling activates Ca2+-binding proteins CBL10 and SOS3, which activate Na+ compartmentalization to vacuole in leaves and Na+ expelling to soil, respectively. Na+ transporter HKT1 contributes to Na+ expulsion to soil through the vascular system. Pictures taken in the cortical region of 5-days-old shoot epidermal cells. Scale bars = 20µm. Chapter I: Introduction 4  (de Zelicourt et al., 2016). In the absence of ABA, the autophosphorylation activity of SnRK2 is inhibited by the binding of the phosphatase PP2C, negatively regulating the signaling pathway. The binding of ABA to the PYR/PYL/RCAR receptor promotes the interaction of the receptor with PP2C and leads to the inhibition of PP2C phosphatase activity. The inactivation of PP2C allows SnRK2 autophosphorylation, capable now of phosphorylating its targets and activating the ABA signaling pathway (Boudsocq et al., 2007). SnRK2s have been shown to phosphorylate transcription factors and membrane proteins such as transporters and channels (Sato et al., 2009; de Zelicourt et al., 2016). Members of the ABA signalling pathway have been recently related to the activation of proteins from the MAP kinase pathway, a phosphorylation pathway widely reported in the regulation of biotic stress responses, starting to clarify the role of MAP kinases in abiotic stress response  (Boudsocq et al., 2015; Danquah et al., 2015; Mitula et al., 2015). 1.1.3. Phospholipid signaling during NaCl stress In plants, PM lipids that increase in response to ABA, such as phosphatidic acid (PA), have been postulated to act as important signaling molecules during NaCl stress. For example, ABA increases PA levels by regulating the activity of the PA biosynthesis enzyme phospholipase D (Zhang et al., 2004). PA interacts with the abscisic acid insensitive 1 (ABI1) PP2C, anchoring it to the plasma membrane, reducing its movement in the cytosol and decreasing its activity as negative regulator of ABA signaling (Zhang et al., 2004). Salt and osmotic stress also cause an increase of PA and phosphoinositides such as phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2) (DeWald et al., 2001; Meijer et al., 2001; Munnik et al., 2000). In salt stress conditions, PA activates MAP kinase 6 which leads to the phosphorylation of SOS1 (Yu et al., 2010). On the other hand, PtdIns(4,5)P2 serves as substrate for the phospholipase C (PLC), a peripheral protein that is anchored to the cytosolic side of the plasma membrane in a Ca2+-dependent manner (Singh et al., 2015). PLC catalyzes a reaction producing inositol-1,4,5-triphosphate (IP3) and 1,2-diacylglycerol (DAG) from PtdIns(4,5)P2. IP3 is a well-known signalling lipid in animals, which also produces a increase in [Ca2+]cyt in plants (DeWald et al., 2001; Singh et al., 2015; Zhu, 2016). Intriguingly, Chapter I: Introduction 5  tomato plants with reduced levels of IP3 showed higher tolerance to drought and metabolic alterations, suggesting a complex involvement of IP3 in plant tolerance to abiotic stress (Khodakovskaya et al., 2010). 1.2. Intracellular communication during NaCl stress In response to stress, plant cells need to regulate the activity of different organelles that spatially separate incompatible biochemical reactions (Lunn, 2007). To coordinate such segregated activities, plant cells use highly dynamic inter-organelle communication networks regulated by either vesicular exchange, that relies on the formation of vesicles that transport proteins, solutes and lipids from the ER and/or Golgi apparatus to destination organelles, including the plasma membrane or the vacuole (Jürgens, 2004) or through non-vesicular mechanisms involving the establishment of transient and/or stable physical attachments between closely apposed organelle membranes, known as membrane contact sites (MCS) (Schrader et al., 2015).  In Arabidopsis, the role of vesicular transport in NaCl tolerance is illustrated by transgenic plants overexpressing RabG3e, a protein involved in endocytic processes, whose overexpression leads to the accumulation of Na+ in the vacuoles and to an improved  plant tolerance to salt and osmotic stresses (Mazel et al., 2004). PIP aquaporins internalization rate increases during salt stress (Li et al., 2011; Luu et al., 2012). These endocytic and internalization responses could facilitate the removal of ion transporters at the plasma membrane and the prevention of water loss (Baral et al., 2015). The role of non-vesicular transport in salt stress tolerance has been recently proposed and most mechanistic information has been gathered through the physiological characterization of the Arabidopsis Synaptotagmin 1 mutant (syt1). SYT1 is a molecular tether that bridges the endoplasmic reticulum (ER) and the plasma membrane (PM), the loss-of-function of which causes Ca2+-dependent NaCl stress hypersensitivity, through a largely unknown mechanism involving ER-PM membrane contact sites (Pérez-Sancho et al., 2015; Schapire et al., 2008). This research project  aims at identifying additional molecular Chapter I: Introduction 6  components putatively involved in non-vesicular communication in Arabidopsis and characterize their putative function in ionic stress response. 1.3. Structure of membrane contact sites and their associated functions Membrane contact sites (MCS) can be defined as intracellular regions where the membranes of two different organelles are in close proximity (Prinz, 2014). These regions were first identified in the 1970s thanks to electron micrographs of onion stems and rat liver (Morré et al., 1971). In eukaryotes, the MCS intermembrane distance ranges between 10 and 30 nm due to the linkage of specific protein tethering complexes that prevent membrane fusion (McFarlane et al., 2017; Prinz, 2014).   In eukaryotes, membrane contact sites involving almost every organelle have been identified. Because the ER is an extensive and active organelle, which needs to communicate with the rest of the cell, it is involved in most of the contact sites discovered so far. ER-PM contact sites (EPCS) have been found in plants, yeast and mammals (Besprozvannaya et al., 2018; Giordano et al., 2013; Lees et al., 2017; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012; Wang et al., 2014) and are the most studied ones. Membrane contact sites between the ER and the mitochondria (Hamasaki et al., 2013; Lackner et al., 2013; Staehelin, 1997) and the ER and the Golgi complex (B. E. Juniper, 1982; Liu et al., 2017; Sohn et al., 2016) have also been identified in eukaryotes. Contact sites between the ER and the vacuole (Staehelin, 1997; Toulmay and Prinz, 2012) are present in yeast and plants. Interestingly, the existence of contact sites involving the chloroplast (Andersson et al., 2007; Tan et al., 2011) and EPCS at plasmodesmata (Bayer et al., 2017) point towards a specific role of these MCS in plants, absent in its eukaryotic counterparts.  The protein tethers at MCS are not only structural components that bridge two membranes, but also have important roles in non-vesicular lipid transport, Ca2+ homeostasis and signalling, autophagy, and organelle division. However, the molecular components involved in those processes at plant MCS remain largely unknown and most of our knowledge derives from the mammalian and yeast literature (Pérez-Sancho et al., 2016; Prinz, 2014).  Chapter I: Introduction 7  1.3.1. MCS tethers in non-vesicular lipid transfer Several mammal- and yeast-based studies have shown that MCS tethers are involved in lipid homeostasis, mainly in ER-PM and ER- mitochondria (Ghai et al., 2017; Jeong et al., 2017; Kim et al., 2015; Lees et al., 2017; Yu et al., 2016).  Glycerophospholipids such as phosphatidylcholine (PC), PA, phosphatidylglycerol (PG) and phosphatidylserine (PS) can be potentially transported, in a non-vesicular manner, through the yeast ER-mitochondria encounter structure (ERMES) complex, localized at ER-mitochondria contact sites (Jeong et al., 2017). Mammalian ORPs (OSBP-related proteins) are ER proteins which are recruited to EPCS by binding to PtdIns(4,5)P2 and are suggested to transport phosphoinositides between those membranes (Ghai et al., 2017). Similarly, the mammalian ER protein extended-synaptotagmin 1 (ESyt) is also localized at EPCS and it is capable of selectively transporting glycerophospholipids through its lipid-binding synaptotagmin-like mitochondrial-lipid-binding protein (SMP) domain (Giordano et al., 2013; Yu et al., 2016).  The function of the mammalian ER membrane protein transmembrane protein 24 (TMEM24) as negative regulator of Ca2+ signaling exemplifies the lipid transport roles associated with EPCS tethers (Lees et al., 2017) (Figure 1.2). TMEM24 is present at EPCS as a dimer, anchored to the ER membrane through a N-terminal TM domain and attached to the PM by a C-terminal poly-basic domain, thanks to electrostatic interactions with negatively charged phosphoinositides in the cytosolic side of the PM. TMEM24 also has a SMP domain that preferentially binds phosphatidylinositol (PI). In resting cells TMEM24 transports PI (labelled as a red glycerolipids) from the ER, where it is synthesized, to the PM, where it can be sequentially phosphorylated by phosphatidylinositol 4 kinase (PI4K) and phosphatidylinositol 4-phosphate 5 kinase (PIP5K) to produce PtdIns(4,5)P2 (Figure 1.2a). In response to a stimulus, [Ca2+]cyt increases (Figure 1.2b), triggering PLC activity (Figure 1.2c). PLC hydrolyzes PtdIns(4,5)P2 into DAG and IP3, further increasing [Ca2+]cyt (Figure 1.2d). The increase in [Ca2+]cyt also activates the protein kinase C (PKC), that phosphorylates the poly-basic domain of TMEM24 (Figure 1.2e). The poly-basic domains of TMEM24 Chapter I: Introduction 8  now have a negative charge due to the acquisition of the phosphate groups, that repel the negatively charged phosphoinositides, breaking the ER-PM bridge and stopping the lipid transfer (Figure 1.2f). Eventually, the activity of the PLC reduces PtdIns(4,5)P2 pool at the PM and the high [Ca2+]cyt cannot be maintained anymore. When [Ca2+]cyt levels return to resting state, the protein serine/threonine phosphatase 2B (PP2B) de-phosphorylates TMEM24 poly-basic domains (Figure 1.2g), that recover the PM binding and, consequently, the PI transport to the PM, indirectly restoring the PtdIns(4,5)P2 pool for a new round of Ca2+ signaling event (Lees et al., 2017) (Figure 1.2h). Lipid transfer at MCSs has not been reported yet in plants. However, putative tethers in plants have annotated lipid-binding domains similar to those found in yeast and mammalian MCS tethers with lipid-transfer roles, including the oxysterol binding (OSB) domain or the SMP domain. This suggests that non-Figure 1.2: Model for TMEM24 non-vesicular lipid transport at EPCSs. The TM domain anchors TMEM24 to the ER membrane while the polybasic (PB) domain is attached to negatively charged phosphoinositides at the PM. PI (labelled as red and black glycerolipids) are transported from the ER to the PM when the contact site is stablished under low [Ca2+]cyt. Increments in [Ca2+]cyt break TMEM24 contact site and stop PI transport through phosphorylation of the PB domain of TMEM24. Modified from Lees et al., (2017). Chapter I: Introduction 9  vesicular lipid transfer could also occur in plants (Pérez-Sancho et al., 2016). Additionally, trans-organellar complementation studies involving the ER and the chloroplast suggested that nonpolar substrates can be moved between the ER and the chloroplast (Mehrshahi et al., 2013). This may be explained by the presence of protein tethers forming contact sites and/or the presence of membrane hemifusion. In the membrane hemiphusion model a hybrid between the ER and the outer chloroplast lipid membranes is formed, allowing enzymes in the ER lumen to access substrates in the outer membrane of the chloroplast (Mehrshahi et al., 2014). 1.3.2. Organelle inheritance and autophagy at MCSs A number of MCS tethers has been associated with the functions related to autophagy and organelle division (Hamasaki et al., 2013; Knoblach et al., 2013; Lackner et al., 2013; Park et al., 2016; Wijdeven et al., 2016). In yeast, proteins such as Num1, Inp1p, and Pex3p, form contact sites between the ER and the mitochondria. These proteins have been related to mitochondria inheritance, division and distribution (Knoblach et al., 2013; Lackner et al., 2013). Similarly, the yeast protein Vps13 localizes to endosome-mitochondria contact sites and to nucleus-vacuole junctions (NVJ), where it is thought to regulate mitophagy (mitochondria autophagy) in response to nitrogen starvation conditions (Park et al., 2016). In mammals, autophagosomes for mitochondria autophagy form at ER-mitochondria contact sites. Autophagosome marker ATG14 is recruited by the ER-resident protein STX17 to form ER-mitochondria contact sites in response to starvation (Hamasaki et al., 2013). The presence of contact sites involving the ER, the vacuole and plastids in plants (Andersson et al., 2007; Staehelin, 1997; Tan et al., 2011) suggests that MCSs could also regulate organelle inheritance and autophagy in plant cells. A recent study found that the Physcomitrella patens ER protein MELL1 has a dual ER-mitochondria localization. MELL1 is involved in ER-mitochondria associations and in the mitochondria shape and number, reinforcing the idea of organelle inheritance as MCS function in plants (Mueller and Reski, 2015). Chapter I: Introduction 10  1.3.3 EPCS tethers in Ca2+ signaling and homeostasis The function of EPCS in Ca2+ homeostasis is well-exemplified by the mammalian protein complex formed by the stromal interaction molecule (STIM) and Orai (Derler et al., 2016) (Figure 1.3). STIM1 is a protein located in the ER membrane thanks to a transmembrane (TM) domain, where it is usually found as a homodimer. In this inactive state, the STIM1 N-terminal domain faces the lumen of the ER where its EF-hand and SAM domains are bound to Ca2+, abundant in the ER lumen in the cell resting state (Figure 1.3a). Depletion of ER Ca2+ stores change STIM1 conformation (Figure 1.3b), causing its multimerization and activation (Derler et al., 2016). The conformational change is transmitted to the C-terminal polybasic Figure 1.3: Model for STIM1-Orai1 Ca2+ signaling at EPCSs. The TM domain anchors STIM1 to the ER membrane while the N-terminal domains, in the ER lumen, are bound to Ca2+ in resting state. Depletion of ER luminal Ca2+ cause STIM1 conformation to change, activating it and recruiting it to EPCSs. STIM1 then interacts with and activates Orai1, a Ca2+ channel at the PM. Orai1 allows then the entrance of Ca2+ from the extracellular space, further increasing [Ca2+]cyt. Adapted from Derler et al., (2016). Chapter I: Introduction 11  domain which binds PtdIns(4,5)P2 at the PM (Figure 1.3c). STIM1, in its inactive state, moves along the microtubules and has a homogeneous localization. However, after the conformational change, STIM1 is recruited to EPCS and its localization becomes more punctate and stable (Derler et al., 2016). STIM1, now in contact with the PM, interacts with Orai1(Figure 1.3d). Orai1 is a Ca2+-selective ion channel that is activated upon interaction with STIM1, allowing the passive entrance of Ca2+ through the PM into the cytosol and further increasing [Ca2+]cyt (Derler et al., 2016; Prakriya and Lewis, 2015) (Figure 1.3e).  In plants, the Arabidopsis EPCS tether SYT1 has demonstrated functions related to Ca2+ signalling. SYT1 possesses two Ca2+-dependent lipid binding C2 domains (Figure 1.4), that can bind phosphoinositides in vitro (Pérez-Sancho et al., 2015; Schapire et al., 2008). syt1 mutant plants show hypersensibility to salt and cold stress mediated by Ca2+ (Schapire et al., 2008; Yamazaki et al., 2008). However, how the Ca2+-dependent lipid binding properties of SYT1 affect its roles in salt and cold stress tolerance requires clarification. 1.4. EPCS tethers in plants Despite the early identification of MCS in plants, no molecular components involved in their establishment have been described until recently. In this context, Perez-Sancho and coworkers (2016) used homology searches for putative MCS tethers in Arabidopsis and divided them into two groups: transmembrane and cytosolic tethers. Among the cytosolic tethers are the ORPs and the steroidogenic acute regulatory transfer (StART) proteins; in the group of transmembrane tethers are the VAMP-associated protein (VAP) and the SMP families (Pérez-Sancho et al., 2016). These four protein families have homologs in yeast and mammals that are known MCSs tethers (Ghai et al., 2017; Giordano et al., 2013; Wilhelm et al., 2017). The most studied MCSs in plants are the EPCS. Two transmembrane proteins have been demonstrated to be EPCS tethers in Arabidopsis: VAP27-1, a member of the VAP family, and SYT1, member of the SMP family (Pérez-Sancho et al., 2015, 2016; Wang et al., 2014). Chapter I: Introduction 12  VAP27-1 contains a TM domain and an MSP (major sperm) domain. The TM domain attaches VAP27-1 to the ER membrane while the MSP domain is used for protein-protein interaction. The EPCS is formed due to the association of VAP27-1 MSP domain with NET3C, a member of the plant NET family of actin-binding proteins. These contact sites also include actin filaments and microtubules, which influence NET3C and VAP27-1 turnover, respectively (Wang et al., 2014). More recently, it has been shown that the VAP27 plant protein family includes nine more members, some of them with TM domains and EPCS localization (Wang et al., 2016). Interestingly, several studies have related VAP27 tethers with lipid-binding proteins as demonstrated for their eukaryote homologues (Barajas et al., 2014; Ho et al., 2016; Petersen et al., 2009; Saravanan et al., 2009). The sphingosine transfer protein ACD11 interacts with VAP27-1; considering the EPCS localization of VAP27-1, sphingosine transfer by ACD11 might take place at those sites (Petersen et al., 2009; Wang et al., 2014). Arabidopsis sterol-binding protein ORP3a has a ER localization dependent on VAP27-3 (Saravanan et al., 2009). VAPs and ORPs have also been related to virus infection in plant cells, suggesting that plant MCS proteins might be involved in biotic stress (Barajas et al., 2014). Recently, VAP27-8 (named by Ho et al., 2016 as VAP-related suppressor of TMM; VST1), a PM protein (Wang et al., 2016) has been reported to be involved in stomatal development by interacting with ERL2 receptor kinase (Ho et al., 2016). Bimolecular fluorescence complementation studies confirmed the interaction of VAP27-8 and SYT1. Furthermore, SYT1 EPCS localization and requires functional VAP27-8/-9 and -10. These data suggest that SYT1, ERL2 and at least VAP27-8 might be required for stomata signalling, adding another process to the MCSs functions in plants (Ho et al., 2016).  The Arabidopsis SYT1 belongs to the SMP family, with a total of five members known so far. While SYT1 and SYT5 are ubiquitously expressed, SYT2, SYT3 and SYT4 are specifically expressed in anthers, senescent and mature leaves, and dry seeds, respectively (unpublished; appendix A). Arabidopsis SYTs contain an SMP domain, a TM domain and a minimum of two Ca2+-dependent lipid-binding C2 domains (Pérez-Sancho et al., 2016). SYT1 is localized at EPCSs, with its N-terminal TM domain anchored to the ER membrane and its C-terminal C2 domains in contact with the PM (Pérez-Sancho et al., 2015). Chapter I: Introduction 13  Unpublished data from our lab suggest an EPCS localization also for SYT5, following the SYT1 tethering model. Additionally, unpublished data from a collaborator indicate that SYT1 can form homodimers, and heterodimers with SYT5 (appendix D) (Figure 1.4). SYT1 C2 domains bind glycerophospholipids and negatively charged phosphoinositides in vitro, but only the C2A domain does it in a Ca2+ dependent manner (Pérez-Sancho et al., 2015; Schapire et al., 2008). The lipid-binding activity of the SYT1 C2 domains resembles the results obtained in its mammalian counterparts, the ESyts (Giordano et al., 2013). Loss of function mutant syt1-2 shows hypersensitivity to mechanical stress, a process that has been related to the role of SYT1 in membrane maintenance (Pérez-Sancho et al., 2015; Schapire et al., 2008). Membrane integrity is also important in freezing tolerance. Studies have shown that SYT1 is important for the Ca2+-dependent freezing tolerance in Arabidopsis protoplasts. Furthermore, Arabidopsis SYT1 RNAi plants were hypersensitive to freezing stress, presumably because of a lack of membrane resealing due to SYT1 absence (Yamazaki et al., 2008). syt1-2 also shows hypersensitivity to salt stress, but only in conditions Figure 1.4: Model for SYT1 binding at EPCSs. The TM domain anchors SYT1 to the ER membrane while the lipid binding C2 domains are attached to negatively charged phosphoinositides at the PM (labelled in blue). Note that only the C2A domain has Ca2+-binding activity. The SMP domains interact, forming the SYT1 homodimer and the SYT1/SYT5 heterodimer. Chapter I: Introduction 14  with low Ca2+ in the medium, suggesting that Ca2+ is involved in SYT1 role in salt stress tolerance (Schapire et al., 2008). SYT1 was reported to be co-localize with VAP27-1 (Pérez-Sancho et al., 2015) although a more recent study shows that SYT1- and VAP27-1-resident contact sites are distinct (Siao et al., 2016). Absence of SYT1 increased VAP27-1 turnover and destabilized the ER network, suggesting that SYT1 might indirectly stabilize VAP27-1 contact sites by restraining ER movement (Siao et al., 2016). Accordingly, reticulon proteins RTNLB3 and 6, involved in the regulation of ER curvature, interact with SYT1 (Kriechbaumer et al., 2015). Interestingly, RTNLB3/6 are present in plasmodesmata, specialized plant channels that allow the connection of the ER network between cells (Kriechbaumer et al., 2015; Nicolas et al., 2017a). Mutant plants lacking functional SYT1 showed less viral movement between cells and abolition in the accumulation of viral proteins in plasmodesmata, suggesting that SYT1 could promoted cell-to-cell movement of viral proteins through plasmodesmata. This data reinforces the function of plant MCS in biotic stress (Levy et al., 2015; Uchiyama et al., 2014). At plasmodesmata, the ER, the PM and actin filaments converge and it has been suggested that specialized EPCS could exist there (Nicolas et al., 2017b; Pérez-Sancho et al., 2016). Like VAP27-1, SYT1 also shows association with the cytoskeleton: SYT1 puncta localize to microtubule-depleted regions and actin filaments depolymerizing drugs such as latrunculin-B cause aggregation of SYT1 in equatorial ER regions of epidermal cells, without affecting cortical regions. These data suggest that stablished SYT1 EPCSs do not depend on the cytoskeleton while delivery of SYT1 to contact sites might required a functional cytoskeleton. Furthermore, depolymerization of microtubules after oryzalin treatments did not affect SYT1 localization (Pérez-Sancho et al., 2015).. 1. 1.5 Structure and function of the SMP domain The SMP domain is present in eukaryote MCS tethers, including the ESyts and the tricalbins, the EPCS tethers homologous to Arabidopsis SYT1 in mammals and yeast, respectively (Lees et al., 2017; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012). The SMP domain was first identified in yeast proteins belonging to the ERMES complex, a complex forming contact sites between the ER and the mitochondria Chapter I: Introduction 15  and important for inter-organelle phospholipid interchange (Kornmann et al., 2009). A bioinformatic study showed that the SMP domain of the ERMES proteins had similarity to an annotated domain called TULIP (tubular lipid). The TULIP domain was reported to fold in a hydrophobic tunnel shape that, presumably, could bind and transport lipids (Kopec et al., 2010). The SMP domain has been demonstrated to bind and transport glycerophospholipids across membranes at MCSs in yeast and mammals, showing some degree of specificity depending on the protein (Jeong et al., 2017; Lees et al., 2017; Yu et al., 2016). The lipid-transport function of the SMP domain has not been probed yet in plants. Interestingly, the SMP domain is present in tethers located at different contact sites, such as ER-mitochondria, ER-PM and nucleus-vacuole junctions (NVJ) (Giordano et al., 2013; Kornmann et al., 2009; Lees et al., 2017; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012). Furthermore, a study demonstrated that human proteins containing the SMP domain were directed to MCS also in yeast, suggesting that the SMP domain could be important for a MCS localization (Toulmay and Prinz, 2012). 2. 1.6. Research objectives The information about MCS and the tethers forming them in plants is scarce, compared to yeast and mammals (Pérez-Sancho et al., 2016). MCS are formed by protein complexes. The existence of distinct contact sites and the different functions of MCS tethers in yeast and mammals make us suggest that more MCS tethers might exist in plants (Pérez-Sancho et al., 2016; Prinz, 2014; Siao et al., 2016). Also, SYT1, a plant EPCS tether, has been to be required for  abiotic stress tolerance, specially salt stress tolerance, an important function for plants as sessile organisms (Pérez-Sancho et al., 2015; Schapire et al., 2008; Yamazaki et al., 2008). Thus, we hypothesized that more MCS tethers could exist in plants and that they might have roles in salt stress tolerance. Following this hypothesis, my M.Sc. focuses on two objectives: 1. Identification of membrane contact sites tethers in Arabidopsis thaliana using reverse genetic approaches (Chapter 3 and 4). Based on Prinz and Toulmay (2004), who proposed that the SMP domain may be indicative of MCS tethers, and the EPCS localization of SYT1 (Pérez-Sancho Chapter I: Introduction 16  et al., 2015), I hypothesized that proteins containing the SMP domain could be localized at MCS in plants. To test this hypothesis, I used bioinformatic data and phylogenetic analysis to find new SMP-containing proteins as putative MCS tethers.  2. Functional characterization of the putative tethers in response to salt stress (Chapter 4). Focusing on NaCl stress tolerance among the SYT1 tether functions (Schapire et al., 2008), I hypothesized that the putative tethers could have functions in NaCl tolerance and/or signaling mediated by Ca2+. To test this hypothesis, I performed physiological treatments in insertional mutants of the putative tethers looking for hypersensitivity or resistance phenotypes to ionic stress in different Ca2+ conditions. I also studied the localization of the putative tethers in the physiological conditions mentioned above using live-cell imaging.Chapter II: Methods 17  Chapter II: Methods 2.1 Bioinformatic Analysis The annotated SMP domain sequences from Nvj2p (Uniprot accession: Q06833; amino acid 300 to amino acid 505), Mmm1 (P41800; 190-409), Tcb1 (Q12466; 150-375), Tcb2 (P48231; 150-375), Tcb3 (Q03640; 150-375), SYT1 (Q9SKR2; 62-248), SYT5 (Q8L706; 70-248), ESyt1 (Q9BSJ8; 135-313), ESyt2 (A0FGR8; 191-370), ESyt3 (A0FGR9114-290) were aligned and further used for obtaining the SMP consensus sequence. All alignments were performed using Seaview through ClustalW2 algorithm (Gouy et al., 2010). Jalview software was used for obtaining the SMP consensus sequence from the SMP alignment by selection of the residues with the highest identity in each position, and for the visualization of the alignments (Waterhouse et al., 2009). The Arabidopsis Information Resource (TAIR) protein BLAST tool was used for the search of SMP-containing proteins in Arabidopsis thaliana, applying an e-value threshold of 0,0001 and using TAIR10 protein dataset. The National Center for Biotechnology Information (NCBI) BLAST tool was used for searching SMP-proteins in different plant species. Representative species of different phyla, classes, orders and families were selected for the phylogenetic tree, applying a e-value threshold of 10-20. MEGA7 (Kumar et al., 2016) was used for the creation of the phylogenetic tree, using the maximum likelihood method and 100 replicates (bootstrap). TraVA (Klepikova et al., 2016) and GENEVESTIGATOR (Zimmermann, 2004) were used to obtain the mRNA expression information for the putative tethers from RNAseq and micro-array data, respectively. The RNAseq data by TraVA show the absolute read counts normalized by TMM (Trimmed mean of M-values). Expression changes in different conditions were studied using ePlant and GENEVESTIGATOR (Waese et al., 2017; Zimmermann, 2004). TMHMM and PSIPRED bioinformatic tools were used for the prediction of transmembrane domains (Buchan et al., 2013; Sonnhammer et al., 1998) while Uniprot and Metallopred were used for the identification of the C2 domains and metal-binding ability, respectively (Bateman et al., 2017; Naik, 2011). Chapter II: Methods 18  Structures of the SMP consensus and the putative tethers were predicted using Phyre2 and subsequently visualized and aligned using Chimera (Kelly et al., 2015; Pettersen et al., 2004); structure of the SMP and C2 domain of ESyt2 were obtained from PDB (ID 4P42) (Schauder et al., 2014). 2.2 Plant material and growth conditions. Arabidopsis thaliana Columbia (Col-0) ecotype was used as wild type and as genetic background for transgenes. Previously published lines used in this M.Sc. Thesis are SYT1-GFP (Pérez-Sancho et al., 2015), syt1-2 (SAIL_775_A08) (Schapire et al., 2008) and atclb1-1 (Salk_006298) (De Silva et al., 2011). TDNA insertion line atclb1-3 (Salk_076501) was also used in this thesis and obtained from ABRC (Arabidopsis Biological Resource Center, Columbus, Ohio, USA). Seeds were sterilized using a solution containing 4:1 of 87.5% ethanol and 30% hydrogen peroxide, respectively, for 1 minute. Seedlings were grown on half strength Murashige and Skoog (MS) medium (Caisson Labs, Smithfield, Utah, USA) at 21ºC/24h-light, after 48h/4ºC stratification. They were subsequently transferred, if needed, to soil (Sunshine mix #4, Sun Gro Horticulture Canada Ltd., Hadashville, Manitoba, Canada) and grown at 22°C under 16-h light/8-h dark cycle.  2.3 Molecular cloning  DNeasy Mini Kit and RNeasy Plant Mini Kit (Qiagen, Montreal, Canada) were used for the extraction of Arabidopsis DNA and RNA, respectively. SuperScript II reverse Transcriptase (Invitrogen, Waltham, Massachusetts, USA) was used for the reverse transcription of RNA to cDNA. Phusion High-fidelity Taq polymerase (New England Biolabs, Whitby, Ontario, Canada) and specific primers (Table 2.1) were used for the amplification of the CDS, promotor and genomic sequences of AtCLB, SYTF and 2TMCLB. pENTR-D-TOPO (Life Technologies, Carlsbad, California, USA) was used to generate entry vectors containing AtCLB, SYTF and 2TMCLB CDS, as well as pAtCLB:AtCLB, while entry vectors containing the promoter region of SYTF and 2TMCLB were created using pENTR-5’-TOPO (Life Chapter II: Methods 19  Technologies). R4 Gateway Binary Vector technology (Nakanawa et al., 2008) was used for obtaining pSYTF:SYTF(CDS) and p2TMCLB:2TMCLB (CDS) entry vectors. Gateway LR Clonase II (Life Technologies) was used for the recombination of inserts from entry vectors to UBQ10 promoter-driven C-terminal GFP/tagRFP fusion destination binary vectors or pGWB (for GUS fusion or native promoter-driven C-terminal GFP fusions) binary destination vectors. Entry and destination vectors were transformed into NEB 10-β competent Escherichia coli cells (New England Biolabs) by heat shock (37°C for 5 minutes) and plated onto selective lysogeny broth (LB) solid medium (Fisher Bioreagents, Pittsburgh, Pennsylvania, USA) containing 100μg/ml kanamycin (entry vectors) or 100 μg/ml hygromycin (destination vectors) (Sigma Aldrich, Oakville, Ontario, Canada). Positive colonies were confirmed by colony PCR, digestion Table 2.1: List of primers used in the thesis. Overhang sequences used for pENTR-D-TOPO insertion are underlined.    Primer Sequence (5’-3’) Forward AtCLB CDS CACCATGGGTTTGATTTCTGGGATTCTG Reverse AtCLB CDS CTGCTGTTTTGCACCATCGTTTTCTGG Forward Prom. AtCLB  CACCCTAATATTATGCACGCTT Reverse Prom. AtCLB TTTTCCTGCAACCGAAACAAAGATTA Forward SYTF CDS CACCATGGGTCGGAGAATAAAGAGGA Reverse SYTF CDS AGAATCTCGAGACGGGGCTTGAGCT Forward Prom. SYTF AAGTAAATTGTAGAGCT Reverse Prom. SYTF CTCTTCGATTCGCCTTCAA Forw. At1g53590 CDS CACCATGGAGTCTTCTTTAATTCATC Rev. At1g53590 CDS CTTTGAAGATGATTCCTTTTCTTCCCC Forw. Prom. At1g53590 AATTATGGAAGCAAATGATTTTTATCAGA Rev. Prom. At1g53590 CGTATCCTTTTCTATGATCAGAACC Forw. qRT-PCR ACT2 CTGGATCGGTGGTTCCATTC Rev. qRT-PCR ACT2 CCTGGACCTGCCTCATCATAC Forw. qRT-PCR AtCLB TGGCTGGCTGGAGTCGTATG Rev. qRT-PCR AtCLB ACCTGTTCAAATGCTGGAAACGA Chapter II: Methods 20  with restriction enzymes and sequencing. A list of all final constructs and the vectors used are listed in Table 2.2. 2.4 Generation of transgenic plants and transformants selection  Destination vectors were transformed into Agrobacterium tumefaciens, strain GV3101 carrying the PMP90 Ti plasmid, by electroporation. Floral dip technique was used for Arabidopsis transformation (Clough and Bent, 1998). Transgenic lines were selected using half strength MS medium containing 15µg/mL glufosinate-ammonium or 25µg/mL hygromycin (pUB10 and pGWB constructs, respectively; Sigma-Aldrich). A minimum of 5 lines was selected and the presence of the insertion was confirmed by PCR. Homozygous transformants with a single insertion were obtained after analyzing the T2 ratio of resistant plants.  2.5 Chemical treatments, image acquisition and quantifications  5-days-old Arabidopsis seedlings grown vertically on half strength MS solid medium were transferred into tenth strength MS liquid medium containing 100mM NaCl, 100mM KCl, 50mM MgCl2, 50mM Na2SO4, 50mM K2SO4, 200mM sorbitol, 75µM U73122, 1mM LaCl3 or 5mM EGTA (all from Sigma Aldrich) and incubated for 16h in darkness. Pictures were taken using a Nikon C1 confocal laser scanning microscope equipped with 488 and 515/30nm emission filter and Nikon Plan Apochromat oil Table 2.2: List of constructs generated. These constructs were subsequently transformed into Arabidopsis plants, Col-0 ecotype.  Constructs Generated Overexpression constructs Endogenous expression constructs pUB10:AtCLB(CDS)-GFP (AtCLB-GFP) pAtCLB:AtCLB-GFP pUB10:AtCLB(CDS)-tRFP pAtCLB:GUS pUB10:SYTF(CDS)-GFP (SYTF-GFP) pSYTF:SYTF(CDS)-GFP  pUB10:SYTF(CDS)-tRFP - pUB10:2TMCLB(CDS)-GFP (2TMCLB-GFP) p2TMCLB:2TMCLB(CDS)-GFP pUB10:2TMCLB(CDS)-RFP  - Chapter II: Methods 21  immersion objectives (40 × 1.0 NA and 60 × 1.4 NA, respectively). Image analysis was performed using FIJI (Schindelin et al., 2012). Puncta and close reticulate structures numbers were quantified on 225µm2 cortical regions of a minimum of 20 epidermal cells from 5 independent seedlings. Statistical differences were identified by analysis of variance (ANOVA) test using Excel 10 software (Microsoft). 2.6 Physiological treatments 5-days-old Arabidopsis seedlings grown vertically in tenth strength MS solid medium were transferred into tenth strength MS solid medium containing 100mM NaCl, 3mM CaCl2, or 100mM NaCl plus 3mM CaCl2 (all from Sigma Aldrich) and incubated for 4 days. When transferred, all seedlings had a root length of 130mm. Root length was measured using FIJI (Schindelin et al., 2012). At least 15 biological replicates for each mutant were used in two independent experiments. Statistical differences were identified by analysis of variance (ANOVA) test using Excel 10 software (Microsoft). 2.7 Quantitative RT-PCR  cDNA used in qRT-PCR was obtained as explained in section 2.2, using Arabidopsis 10-days old seedlings and 1µg of RNA for the retro-transcriptase reaction per sample. qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad) and a iQ5 Multicolor Real-Time PCR Detection system (Bio-Rad). Relative expression was calculated by the 2-ΔΔCt method (Livak and Schmittgen, 2001), using ACT2 as a control. Primers used for the qRT-PCR are listed in Table 2.1. 2.8 Accession numbers The Arabidopsis Genome Initiative locus identifiers for genes mentioned in this thesis are SYT1 (At2g20990), HDEL (At1g29330), C4H (At2g30490), ACT2 (At3g18780), AtCLB (At3g61050), SYTF (At3g18370) and 2TMCLB (At1g53590).  Chapter III: The search for MCS tethers 22  Chapter III: The search for MCS tethers 3.1. Results 3.1.1. AtCLB, a putative MCS tether, belongs to the NTMC2 family In yeast and mammals, MCS components are usually multigene families of proteins involved in the physical tethering of the apposed membranes. Apart from this structural function, MCS components also have additional regulatory functions in non-vesicular transfer of lipids and Ca2+ signaling (Prinz, 2014). In plants, the two MCS tethers characterized so far, SYT1 and VAP27-1, also belong to multigene protein families (Pérez-Sancho et al., 2015, 2016; Wang et al., 2014). Given the multiplicity of MCS functions described in yeast and mammals, I hypothesized that some as yet uncharacterized Arabidopsis proteins might represent additional MCS tethers that, as in other organisms, establish multiprotein tethering complexes (Giordano et al., 2013; Jeong et al., 2017; Pérez-Sancho et al., 2016). To identify the most probable MCS tether candidates in Arabidopsis, I performed homology studies using the SMP domain as query. The SMP domain is conserved in all eukaryotes and it is a functional domain found in MCS-localized proteins in mammals, yeast and plants (Giordano et al., 2013; Lees et al., 2017; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012).  First, I built a SMP consensus sequence to be used as a query against the Arabidopsis genome. To build the SMP consensus sequence, the SMP domain sequences from experimentally validated MCS tethers were aligned and the most common residues were selected. These sequences included the human EPCS tethers ESyt1/2 and 3 (Giordano et al., 2013; Schauder et al., 2014; Toulmay and Prinz, 2012), the yeast EPCS tethers tricalbin1/2 and 3 (Toulmay and Prinz, 2012) and the plant EPCS tethers SYT1 and SYT5 (Pérez-Sancho et al., 2015; unpublished data). Additionally, to identify MCS components outside the ER-PM interface I included the SMP domain sequence of the yeast Nvj2p tether, a protein localized in the Chapter III: The search for MCS tethers 23  nucleus-vacuole junctions (Toulmay and Prinz, 2012), and of Mmm1, a protein localized at the ER-mitochondria contact sites (Jeong et al., 2017; Toulmay and Prinz, 2012). The SMP consensus sequence was used as query in a protein BLAST search, looking for SMP-containing proteins in Arabidopsis thaliana.  Apart from members of the SYT family (SYT1 to SYT5) the only protein obtained with an e-value above the selected threshold (see section 2.1.1. Bioinformatic analysis) was At3g61050, annotated as the Arabidopsis thaliana calcium-dependent lipid-binding protein (AtCLB). AtCLB belongs to a protein family called N-terminal transmembrane C2 domain (NTMC2), which includes the SYT family (SYT1 to SYT5 plus a new putative member, SYTF/6) and several proteins with unknown function (Table 3.1). Proteins from the NTMC2 family are characterized by the putative presence of similar domains: one or more N-terminal TM domains, a SMP domain and at least one C-terminal C2 domain. The NTMC2 family is divided into subfamilies or types, from type 1 (T1) to type 6 (T6) (Table 3.1). Two ubiquitously expressed NTMC2 proteins (appendix A) not identified in our BLAST search, a type 3 NTMC2 At3g18370 (SYT6/SYTF), and a type 6 NTMC2 At1g53590 (named 2TMCLB due to the prediction of 2 transmembrane domains; see next section) were used as controls to assess the Table 3.1: Protein members of the NTMC2 family. The column on the right shows the subfamily type of each protein.  Protein ID NTMC2 Subfamily At2g20990 (SYT1) At1g20080 (SYT2) At5g04220 (SYT3) Type 1 At5g11100 (SYT4) At1g05500 (SYT5) Type 2 At3g18370 (SYT6/F) Type 3 At3g61050 (AtCLB) Type 4 At1g50260 At3g19830 Type 5 At1g53590 (2TMCLB) At3g14590 Type 6 Chapter III: The search for MCS tethers 24  specificity of the approach and to determine whether the SMP consensus sequence used in the analysis was too restrictive for the identification of putative MCS candidates.  In this study, I also analyzed how SMP proteins evolved in plants by performing a phylogenetic analysis of SMP-containing proteins from representative species across the plant kingdom. For this analysis, I selected  SMP-containing proteins from  non-vascular plants including algae (Klebsormidium nitens and Micromonas commode), a moss (Physcomitrella patens) and a liverwort (Marchantia polymorpha); and vascular plants including pteridophytes (Selaginella moellendorffii, fern), gymnosperms (Picea sitchensis, conifer), monocotyledons (Elaeis guineensis, palm tree; Ananas comosus, pineapple; Zea mays, maize and Oryza sativa, rice) and different families of dicotyledons, such as Solanaceae (Solanum lycopersicum, tomato) and Rosaceae (Fragaria vesca, wild strawberry and Prunus persica, peach). The phylogenetic analysis of the selected SMP-containing proteins shows that the SMP proteins can be separated in three branches (Figure 3.1). In the first branch (Figure 3.1, blue) non-annotated and SYT-like proteins from algae, moss, fern, monocotyledons and different dicotyledon species appear related to Arabidopsis SYT1, SYT2 and SYT3; in the second branch (Figure 3.1, orange), SYT5 and SYT4 related-proteins are the predominant ones; in the third branch (Figure 3.1, green) proteins from an alga, tomato and liverwort are related to the putative tether, AtCLB. However, in some cases, the protein annotations do not match this distribution as, for example, the S. lycopersicum SYT1 appears in the AtCLB branch, and the O. sativa CLB, appears in SYT4 and SYT5 branch. The fact that CLB-like proteins were identified in such diverse species across the plant kingdom, indicates that members of the family have an early evolutionary origin and have been conserved during plant evolution (Figure 3.1).     Chapter III: The search for MCS tethers 25   3.1.2. The NTMC2 tethers have Ca2+-binding and lipid-binding domains Contact sites tethers are able to maintain two membranes at close distance thanks to the presence of protein domains capable of  docking  to one of the membranes such as transmembrane domains or lipid-binding domains, and/or  protein-protein interaction domains capable of establishing multiprotein tethering Oryza sativa – CLB1 Zea mays – SYT5 Arabidopsis thaliana – SYT5 Fragaria vesca – SYT5-like Solanum lycopersicum – SYT7 Solanum lycopersicum – SYT 12g009700.1 Solanum lycopersicum – SYT 07g007680.2 Ananas comosus– SYT5 Arabidopsis thaliana – SYT4 Solanum lycopersicum – SYT 08g021940.1 Klebsormidium nitens – CLB Solanum lycopersicum – CLB1 Solanum lycopersicum – SYT1 Arabidopsis thaliana – CLB Marchantia polymorpha – Unknown Elaeis guineensis– SYT2-like Solanum lycopersicum – SYT 01g111520.2 Prunus persica– SYT1 Arabidopsis thaliana – SYT1 Arabidopsis thaliana – SYT2 Picea sitchensis – Unknown Selaginella moellendorffii – SYT Physcomitrella patens – SYT Arabidopsis thaliana – SYT3 Micromonas commode – Unknown Figure 3.1: Phylogenetic tree of SMP-containing proteins in plants. The blue background marks the SYT1/2/3 branch; the orange region marks the SYT4/5 branch and the green background marks the CLB branch. The SYT family is labelled in colored bold; AtCLB is labelled in green bold. Chapter III: The search for MCS tethers 26  complexes.(Giordano et al., 2013; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012; Wang et al., 2014).  In this study, I analyzed the presence of such domains in the three putative NTMC2 tethers. A bioinformatic search on Uniprot showed annotated transmembrane domains for SYTF (30aa-50aa) and 2TMCLB (5-22; 28-45) (Bateman et al., 2017). Those predictions were reinforced by software such as TMHMM (Sonnhammer et al., 1998) and PSIPRED (Buchan et al., 2013). However, the predictions are not clear for AtCLB: PSIPRED shows a transmembrane domain close to the N-terminus (2-22); TMHMM also detects a hydrophobic, transmembrane domain but advises of the possible presence of a signal peptide in that region, due to the short distance between this hydrophobic region and the N-terminus of AtCLB. On the other hand, all three tether candidates have Ca2+-dependent lipid-binding C2 domains: AtCLB (250-361), 2TMCLB (283-383) and SYTF (292-403; 482-576; 606-701), that might be involved in the docking function. Additionally, Metallopred, a bioinformatic tool that predicts metal-binding activity based on the protein sequence (Naik, 2011) showed that AtCLB, 2TMCLB and SYTF can bind divalent cations, concurring with the Ca2+-requirement for the phospholipid binding mediated by SYT C2A domain. The SMP domain was annotated in Uniprot for AtCLB (69-247) and 2TMCLB (62-268) (Bateman et al., 2017). However, no data were available for the SMP domain in SYTF. The position of the SMP domain in SYTF (94-280) was later identified by aligning the consensus SMP domain to the protein sequence of SYTF.  To generate more evidence supporting the presence of C2 and SMP domains in the putative tethers, Phyre2 online tool (Kelly et al., 2015) was used to predict the 3D folding of the consensus SMP and of AtCLB, SYTF and 2TMCLB proteins. Those 3D structures were then compared to the crystalized SMP and C2 domains of Esyt2 (Schauder et al., 2014; Xu et al., 2014), looking for structural similarities. The output models of the consensus SMP, AtCLB, SYTF and 2TMCLB had an 84%, 57%, 72% and 38% of residues modelled with a 90% of accuracy, respectively. The consensus SMP was first aligned to the SMP domain of ESyt2 (Figure 3.2a). The structural alignment had a quality score (Q-score) of 0.3. The Q-score varies from 1 (identical structures) to 0 (completely different structures), indicating that the two SMP domains have 70% of their residues unaligned. However, the folding of the SMP consensus resembled Chapter III: The search for MCS tethers 27  ESyt2 SMP domain, including the arrangement of α-helixes and β-sheets and the characteristic hydrophobic tunnel of the SMP domain, with lipid-transport function in yeast and mammals (Kopec et al., 2010; Schauder et al., 2014; Yu et al., 2016) (Figure 3.2b,c). Afterwards, the SMP and C2 domains of ESyt2 were aligned to the predicted models of AtCLB (Figure 3.3), 2TMCLB and SYTF (appendices B and C, respectively).  The SMP and C2 domains of ESyt2 aligned regions within the AtCLB predicted model with Q-scores of 0.84 and 0.68, respectively. The structural alignment of ESyt2 SMP domain showed the tunnel folding of AtCLB SMP domain, having with similar arrangement of α-helixes and β-sheets (Figure 3.3b). The structural alignment also reinforced the annotated position of the SMP domain (69-247). The alignment of a c b Figure 3.2: Ribbon diagrams of the alignment between the ESyt2 SMP domain and the consensus SMP model. a, front view. b, top view, showing the tunnel-like conformation typical of the SMP domain. c, top view, including lipids passing through the domain. ESyt2 SMP: yellow; consensus SMP: purple; lipid ligand: grey.  C-terminus N-terminus N-terminus Chapter III: The search for MCS tethers 28  the C2 domains showed some unaligned regions corresponding to the turns between β-strands (Figure 3.3c) but showed similarities in the folding of the C2 domain, formed by a pair of four β-strands facing each other and connected by an α-helix (Figure 3.3c). The alignment of the C2 domains indicated a different region corresponding the C2 domain of AtCLB with respect to the annotated one (263-390). The alignment of the SMP and C2 domains of ESyt2 into 2TMCLB model (Q-scores of 0.82 and 0.67, respectively) (appendix B) indicated new positions for the SMP and C2 domains of 2TMCLB (68-260 and 282-397, respectively). Additionally, a disorder region was identified from the end of the C2 domain to the C-terminus of the protein (appendix B), accordingly with the absence of domains annotated in Uniprot. On the other hand, alignment of SYTF model with SMP domain of ESyt2 (Q-score of 0.8) confirmed the position of SYTF SMP domain already suggested by sequence alignment (94-280) (appendix C). The alignment of the C2 domain of ESyt2 with SYTF model indicated the presence of 3 C2 domains with Q-scores of 0.40 (C2A), Figure 3.3: Ribbon diagrams of the alignment between AtCLB model and the SMP and C2 domains of ESyt2. a, front view. b, close view of the C2 domain alignment. c, top view of the SMP domain alignment. AtCLB model: grey; ESyt2 SMP: red; ESyt2 SMP: yellow; AtCLB TM predicted region: blue. a b c Chapter III: The search for MCS tethers 29  0.70 (C2B) and 0.63 (C2C) (appendix C), as previously annotated by Uniprot, and suggested new positions (C2A: 292-446; C2B: 480-593; C2C: 606-716). An additional short disordered region was identified close to the C-terminus (appendix C). This information, together with the prediction of transmembrane domains, was used to establish the domains’ organization of the tether candidates (Figure 3.4). 3.1.3. The SMP domain has conserved residues in eukaryotes I next considered whether the SMP domains from different organisms across eukaryotes have conserved residues, which could be important for their function and therefore conserved through evolution. For this purpose, I created a new alignment including the consensus SMP sequence, the SMP domain sequences of the MCS (yeast tricalbins, plant SYTs, human ESyts and yeast Mmm1 and Nvj2p) and the SMP domain sequences of the putative tethers (AtCLB, SYTF and 2TMCLB).  Three residues were conserved in all proteins: a tryptophan (W) at position 128 in the alignment, an asparagine (N) at position 130, and a glycine (G) at position 186 (Figure 3.5, red squares and arrows). We noticed that the residue 129, located between the conserved tryptophan and the conserved asparagine, was hydrophobic in all proteins, varying between leucine (L), the most common, and alanine (A), isoleucine (I), methionine (M) or phenylalanine (F) (Figure 3.5, yellow square and arrow). Other hydrophobic residues such as tryptophan, valine (V) and proline (P) and hydrophilic residues such as glutamate (E), lysine (L) Figure 3.4: Functional domains of the AtCLB, 2TMCLB and SYTF tether candidates. Blue, yellow and red ovals represent predicted transmembrane, SMP and C2 domains, respectively. Total residues’ number is shown at the C-terminus of each putative tether. Chapter III: The search for MCS tethers 30  and arginine (R), located along the SMP domain sequences, were conserved in most of the proteins (Figure 3.5).  3.1.4. The expression pattern of the putative tethers indicates roles in abiotic stress MCS tethers have been associated with many different functions including lipid and Ca2+ transport, Ca2+ signalling, organelle inheritance and organelle division in yeast and mammals (Prinz, 2014). The few plant EPCS tethers have been shown to be involved in root hair development to salt, cold and mechanical stress tolerance (Kim et al., 2016; Pérez-Sancho et al., 2015; Schapire et al., 2008; Uchiyama et al., 2014; Wang et al., 2016).  Figure 3.5: Alignment of the consensus SMP domain and the SMP domain of the MCS tethers. Residues are coloured based on the percentage of identity, where bluer residues have a higher identity among the sequences; only residues with a minimum of 60% of identity are coloured.  Red squares and arrows show residues conserved in all sequences while the yellow square and arrow show the hydrophobic residues conserved in position 129. Numbers indicate residues’ position within the alignment of the SMP domains. ESyt: Human extended synaptotagmin; Tcb: yeast tricalbin; Mmm1: yeast maintenance of mitochondrial morphology 1; Nvj2p: yeast nucleus-vacuole junction 2 protein. Chapter III: The search for MCS tethers 31  To obtain more information about the possible function of the tether candidates I analyzed their transcriptional profiles at different developmental stages. For this study I used a publicly available RNAseq database, TraVA (Klepikova et al., 2016) and a microarray database, GENEVESTIGATOR (Zimmermann, 2004). As a result, I established that the transcriptional levels of AtCLB and especially SYTF and 2TMCLB were much lower than those of SYT1 in all tissues analyzed (Table 3.2) These RNAseq data were somewhat supported by microarray analyses showing that SYT1 and AtCLB were highly expressed compared to the average expression levels of Arabidopsis genes (Figure 3.6) while SYTF and 2TMCLB expression was lower and close to the average values (Table 3.2; Figure 3.6). Interestingly, SYT1 and AtCLB are highly expressed Figure 3.6: Microarray-based expression levels of SYT1, AtCLB, SYTF and 2TMCLB in different developmental stages. Expression showed in log2. On the left side, a comparison with the expression of Arabidopsis genes show how much are expressed SYT1, AtCLB, SYTF and 2TMCLB respect to the average. SYT1, yellow dots; AtCLB, red dots; SYTF, blue dots; 2TMCLB, green dots. Chapter III: The search for MCS tethers 32  during senescence and in seeds (Figure 3.6). This agrees with RNAseq data, where SYT1 and AtCLB have the highest expression values in dry and germinating seeds (Table 3.2). SYTF and 2TMCLB have lower expression values in most tissues. SYTF is more highly expressed in senescent internodes, mature leaves, germinating seeds, pedicels, and seedling hypocotyls while 2TMCLB is more expressed in senescent internodes, internodes, and seedling hypocotyls (Table 3.2).  The expression levels of the different candidates in response to changes in environmental conditions was also evaluated. For these analyses I used the microarray data available from ePlant (Waese et al., 2017). In the analysis, the expression data was represented as “fold” values, indicating the ratio of expression obtained compared to control conditions: values below 1 indicate downregulation and values above 1 indicate upregulation. Only treatments with a minimum of 30% expression change were considered (Figure 3.7).  Table 3.2: Expression levels of the tether candidates in different tissue. Values expressed as absolute read counts. SYT1 is shown as comparison.  Higher expression values have deeper green colours while lower values have deeper red colours. Intermediate values are shown in white and lighter colours. Data modified from TraVA. Chapter III: The search for MCS tethers 33  My results show that AtCLB is downregulated in Arabidopsis plants exposed to abiotic stresses, such as salt (0.66-fold) and osmotic stress (0.48-fold). Moreover, expression of AtCLB in Arabidopsis leaves after inoculation of ABA decreases to 0.15-fold (Pandey et al., 2010). Interestingly, Arabidopsis leaves inoculated with Pseudomonas syringae or bacterial-derived elicitors also suffer a decrease of AtCLB expression (0.47-fold and 0.67-fold, respectively) (Waese et al., 2017). In contrast, SYTF is upregulated after osmotic stress treatments (2.25-fold) as well as salt (1.56-fold) and cold stresses (1.74-fold) (Kilian et al., 2007). Expression of SYTF in leaves decreases to 0.15-fold after inoculation of ABA (Pandey et al., 2010). SYTF is upregulated (1.8-fold) when Arabidopsis seedlings are incubated with AgNO3, an ethylene inhibitor (Goda et al., 2008). SYTF is also upregulated in biotic stress-related treatments: incubated of seedlings with salicylic acid (SA) and infection of leaves with Phytophthora infestans, a eukaryotic microorganism causing the plant disease known as “potato blight” (1.77-fold and 1.97-fold, respectively) (Goda et al., 2008; Waese et al., 2017). Like SYTF, 2TMCLB is upregulated after osmotic (2.59-fold), salt (1.76-fold) and cold stresses (2.78-fold) (Kilian et al., 2007). Inoculation of ABA causes downregulation of SYTF (0.16 fold) (Pandey et al., 2010). Additionally, incubation of SA downregulates of 2TMCLB down Figure 3.7: Up and downregulation of the putative tethers under different treatments. The red and blue dotted line indicate the upper and lower limits considered for significant fold change values. Likewise, red, and blue bars indicate up or down regulation of the expression. White bars indicate values that do not reach the threshold for being considered up or down regulations. Data modified from ePlant. Chapter III: The search for MCS tethers 34  to 0.6-fold in Arabidopsis seedlings (Goda et al., 2008). Gibberellic acid (GA) synthesis inhibitor propiconazole also downregulates 2TMCLB seedlings (0.6-fold) (Goda et al., 2008).  3. 2. Discussion 3.2.1. The Arabidopsis NTMC2 family might contain more MCS tethers The finding of AtCLB, a SMP-containing protein and a putative MCS tether, revealed a connection between a protein family, NTMC2, and MCSs. The Arabidopsis SYT family also belongs to the NTMC2 family (Table 3.1), reinforcing the relation between the NTMC2 protein family and MCS. This also gives an additional interest to the several proteins with unknown function present in the NTMC2 family (Table 3.1), since these proteins could also be located at MCS. The NTMC2 family has also been identified in rice (Oryza sativa), as a family with sequence and domain similarity to animal synaptotagmins (members of the animal NTMC2) and ESyts tethers (Craxton, 2007, 2010; Giordano et al., 2013; Huang et al., 2017). Remarkably, all the Arabidopsis NTMC2 family members analyzed posses transmembrane, SMP and C2 domains, resembling those characterized in SYT1 (Figure 3.4; Figure 3.3; appendix B; appendix C) (Pérez-Sancho et al., 2015). The domains’ similarity between the tether candidates AtCLB, SYTF and 2TMCLB, and the EPCS tether SYT1 reinforces the relation between the NTMC2 family and MCSs, specifically EPCSs. On the other hand, the majority of tethers used in the creation of the SMP consensus sequence were EPCS: tricalbins (Toulmay and Prinz, 2012), ESyts (Giordano et al., 2013) and SYT1 (Pérez-Sancho et al., 2015). This could have enriched the bioinformatic analysis towards the selection of EPCS candidates, preventing the discovery of other types of contact site tethers. Therefore, the SMP consensus approach might not be adequate to identify other types of contact sites components. Nevertheless, my work suggests that among the unknown members of the NTMC2 family, new protein tethers at MCS could be identified.   Chapter III: The search for MCS tethers 35  3.2.2. Different subfamilies of NTMC2 proteins have evolved differentially in plants The phylogenetic analysis described in Figure 3.1 shows that the SMP proteins are not grouped by species but separated into three main clades: one clade for SYT1, SYT2 and SYT3-related proteins (Figure 3.1, blue), a second clade for SYT4 and SYT5-related proteins (Figure 3.1, orange) and a third clade for AtCLB-related proteins (Figure 3.1, green). This distribution also represents the early evolutionary divergence of the different NTMC2 subfamilies as SYT1, SYT2 and SYT3 belong to the NTMC2 type 1 subfamily, SYT4 and SYT5 to the NTMC2 type 2 subfamily, and AtCLB belongs to the NTMC2 type 4 subfamily (Table 3.1). In my analysis I also uncovered that some genes could be mis-annotated in different plant genomes. For example, a closer analysis of the annotated S. lycopersicum SYT1 shows a higher degree of similarity with the Arabidopsis AtCLB than with the Arabidopsis SYT1, and the annotated O. sativa CLB was more similar to the Arabidopsis SYT5 than to AtCLB. I therefore conclude that my phylogenetic analysis can be used as a tool to identify the most likely EPCS tether orthologs in crops. 3.2.3. Conserved residues in eukaryotic SMP domains suggest that SMP-protein dimerization and lipid-transport may also occur in plants.  The alignment of SMP domains of the MCS tethers and putative tethers used in this study shows that three amino acid residues are conserved in all proteins: Trp128, Asn130, and Gly186 (Figure 3.5, red squares, and arrows). Also, the residue 129, located between the conserved Trp128 and Asn130, was hydrophobic in all proteins (Figure 3.5, yellow square and arrow). The conservation of these residues despite the phylogenetical distance separating these organisms (human, Arabidopsis and yeast) and the different contact site localization of the tethers (EPCS, NVJ and ER-mitochondria), suggest that they are important for the integrity of the SMP structure and/or function.  Trp128, Asn130 and Gly186 are located at the N-terminus of the SMP domain. Crystallization of the mammalian and yeast (Zygosaccharomyces rouxii) SMP-containing tethers ESyt-2 and Mmm1(Jeong et al., 2017; Schauder et al., 2014) showed that these proteins dimerize by interaction of the SMP domains, Chapter III: The search for MCS tethers 36  forming a hydrophobic tunnel which is capable of transporting glycerophospholipids. The lipid-transport property of the SMP domain was bioinformatically predicted (Kopec et al., 2010) and later, experimentally demonstrated in vitro by incubation of the protein tethers with vesicles of a known lipid composition and by subsequent analyses in the change of the vesicles’ composition (Lees et al., 2017; Yu et al., 2016). The N-terminal region of the SMP domains is involved in the SMP-SMP interaction, as shown by the crystal structures (Jeong et al., 2017; Schauder et al., 2014), suggesting that Trp128, Asn130 and Gly186 might be important for SMP dimerization. Moreover, Trp128, Asn130 and Gly186 are also conserved in zrMmm1. Interestingly, residues Trp221 (corresponding to Trp128 in the SMP alignment) and Phe222 (corresponding to the conserved hydrophobic residue in position 129 of the alignment) of zrMmm1, located at the N-terminus region of the SMP domain, are important to stabilize zrMmm1 dimer by hydrophobic interactions between SMP domains (Jeong et al., 2017).  Figure 3.8: Crystal structure of human ESyt2 SMP and C2 domains. Different ESyt2 proteins within the dimer are coloured in blue and orange. SMP domains are highlighted in lighter colours, showing the tunnel structure capable of lipid transport. Residues Trp197, Leu198 and Asn199 are highlighted in red, green and magenta, respectively. Inset I: the conserved Trp197 and the juxtaposed hydrophobic residue, Leu198, are in the junction between SMP domains. Insets II and III: Asn199 residues appear facing a β-strand of their respective SMP domains. Crystal structure modified from Schauder et al,. 2014. Chapter III: The search for MCS tethers 37  The conserved Trp and the juxtaposed hydrophobic residue on the crystal structure of ESyt2 (Trp197 and Leu198) are also at the junction between SMP domains (Schauder et al., 2014) (Figure 3.8, Inset I), suggesting that they may be important for stabilizing the interaction of SMP domains. However, the position of the conserved Asn in ESyt2 (Asn199), facing a β-strand within the structure of the SMP domain (Figure 3.5, Inset II and III), do not seem to support a role in tether dimerization by SMP interaction, but SMP folding instead. The conservation of the Trp and its juxtaposed hydrophobic residue in yeast and mammals (Figure 3.5) and their position at the junction between SMP domains in yeast Mmm1 and mammalian ESyt2 tethers (Jeong et al., 2017) (Figure 3.8) suggest that the hydrophobic effect of these two residues and especially, the steric properties of the Trp, are important for the dimerization and for the lipid-transfer properties of  SMP-tethers in yeast and mammal. It is unclear, however, what is the function of the conserved Asn.  Remarkably, the conservation of the Trp128, Asn130 and Gly186 residues can be expanded to the SMP domains of the NTMC2 family proteins, as shown in Figure 3.9. Given the amino acid conservation in the N-terminus of eukaryotic SMP domains I hypothesize that the Arabidopsis NTMC2 proteins may be able to dimerize and transfer lipids following the same mechanisms described for yeast and mammal SMP-Figure 3.9: Alignment of the consensus SMP and the SMP domains of the MCS tethers and Arabidopsis NTMC2 proteins. Residues are coloured based on the percentage of identity, where bluer residues have a higher identity among the sequences; only residues with a minimum of 60% of identity are coloured.  Red squares and arrows show residues conserved in all sequences while the yellow square and arrow show the hydrophobic residues conserved at position 129. Numbers indicate residue position within the alignment of the SMP domains. ESyt: Human extended synaptotagmin; Tcb: yeast tricalbin; Mmm1: yeast maintenance of mitochondrial morphology 1; Nvj2p: yeast nucleus-vacuole junction 2 protein. Chapter III: The search for MCS tethers 38  tethers (Jeong et al., 2017; Schauder et al., 2014). This idea is further supported by co-immunoprecipitation analyses using the Arabidopsis SYT1 as a bait, indicating that SYT1 can form homodimers and heterodimers with SYT5 and AtCLB (appendix D). 3.2.4. Putative tether expression patterns suggest functions in abiotic and biotic stresses  The study of the putative tether expression indicated that AtCLB has expression levels similar to the ones of SYT1, while SYTF and 2TMCLB have lower expression levels (Table 3.2 and Figure 3.6). This may suggest that SYTF and 2TMCLB function primarily in response to certain stimuli and could be upregulated by such or that they need a lower protein turn-over with respect to SYT1 and AtCLB. Although the three putative tethers are ubiquitously expressed, SYTF and 2TMCLB have more specific expression patterns compared to AtCLB (Table 3.2) reinforcing the idea of a more tissue-specific function while AtCLB may have a more general function since it is highly expressed in all tissues and developmental stages (Table 3.2; Figure 3.6). SYT1 and AtCLB have their highest expression in dry and germinating seeds (Table 3.2). This correlates with an increase of their expression in senescent tissues, specifically dry seeds (Figure 3.6), suggesting that AtCLB function might be especially important in that process.  The study of the expression changes of the putative tethers under different stresses and treatments indicated different up and downregulation patterns for AtCLB, on one hand, and SYTF and 2TMCLB, on the other hand (Figure 3.7). AtCLB is downregulated in abiotic stress treatments and after the inoculation of Arabidopsis leaves with ABA (Figure 3.7). ABA is a phytohormone whose levels increase during abiotic stress responses (de Zelicourt et al., 2016); therefore, AtCLB might work in the negative regulation of abiotic stress tolerance. AtCLB is also downregulated in bacteria-related biotic stress treatments (Figure 3.7). Interestingly, SYT1 plays a role in biotic stress as negative regulator of cell-to-cell virus movement (Uchiyama et al., 2014). The downregulation of AtCLB under biotic stresses, although only in bacterial-related infections, suggests that AtCLB may also have a role in the negative regulation of biotic stresses. AtCLB is downregulated under inhibitions of ethylene. The higher expression levels of AtCLB in seeds and Chapter III: The search for MCS tethers 39  the function of ethylene in the promotion of germination in dormant seeds support that AtCLB might be especially important in that developmental stage (Table 3.2) (Corbineau et al., 2014). In addition, the downregulation of AtCLB after incubation with ABA agreed with the antagonist function of ABA and ethylene in seed dormancy (Figure 3.7) (Corbineau et al., 2014). Considering this, AtCLB might have roles in the positive regulation of seed dormancy, being positively regulated by ethylene and negatively regulated by ABA.  SYTF and 2TMCLB are both highly upregulated in abiotic stress treatments. In addition, they are strongly downregulated after inoculation of ABA (Figure 3.7). Given the role of ABA as general modulator of abiotic stress responses (de Zelicourt et al., 2016), it is plausible that SYTF and 2TMCLB have functions in the abiotic stress signalling pathway, working upstream of ABA and being regulated by it through a negative feed-back . The additional function of ABA in leaf senescence (Zhang et al., 2012) could also indicate that SYTF and 2TMCLB, genes that exhibit have a peak of expression in mature leaves (Table 3.2),  might function as negative regulators of leaf senescence, being downregulated by ABA once the senescence process starts. SYTF is also upregulated is some biotic stress treatments: it is upregulated after incubation with salicylic acid, a phytohormone involved in the response to biotic stress, and infection with Phytophthora infestans, an eukaryote pathogen (Figure 3.7). However, it is not upregulated after infection with Pseudomonas syringae or incubation with bacterial-derived elicitors, suggesting that SYTF may be working in the response against specific pathogens. Inhibition of ethylene, a phytohormone involved in senescence, upregulates SYTF. Considering that SYTF exhibit a higher expression in senescent internodes and mature leaves (Table 3.2), this data suggests a role for SYTF in senescence. However, ethylene was shown to work in later stages of leaf development rather than in seedlings (Fischer, 2012), where SYTF is also highly expressed (Table 3.2) suggesting that SYTF may have different functions in different tissues. On the other hand, ethylene can also break dormancy in seeds, working antagonistically with ABA and Chapter III: The search for MCS tethers 40  inhibiting its synthesis (Corbineau et al., 2014). SYTF is highly expressed in seeds and germinating seeds (Table 3.2) suggesting it may function with ethylene in the negative regulation of seed dormancy. Finally, 2TMCLB is downregulated after the inhibition of GA synthesis. 2TMCLB has a peak of expression in seedling hypocotyls and internodes, where cell elongation is promoted (Daviere and Achard, 2013), suggesting a role for 2TMCLB downstream of GA, acting in cell elongation. Salicylic acid also causes 2TMCLB downregulation. Accumulation of SA in Arabidopsis plants results is a dwarf phenotype while plants with mutations in SA synthesis have an elevated growth rate (Rivas-San Vicente and Plasencia, 2011). These data suggest an antagonistic role for 2TMCLB and salicylic acid in cell elongation. However, 2TMCLB also has a peak of expression in senescent internodes, implying a more complex role for 2TMCLB in different tissues and developmental stages.        Chapter IV: Characterization of the putative tethers 41  Chapter IV: Characterization of the putative tethers 4.1. Results 4.1.1. AtCLB and SYTF show a “beads and strings” pattern at the cortical ER  An important characteristic of MCS tethers is their dual localization in the membranes that are bridged by them. To determine whether the localization of the MCS candidates identified in this study is compatible with a bridging function we performed subcellular localization analyses using confocal microscopy. For that purpose, we generated transgenic Arabidopsis lines harbouring translational fusions of the putative tethers with the green fluorescent protein (GFP). Since the putative tethers have predicted transmembrane domains at the N-terminus (figure 3.4) we attached the GFP tag on the C-terminus of the proteins to minimize protein mislocalization. Due to the low expression levels of SYTF and 2TMCLB (Table 3.2; Figure 3.6) all the constructs were driven by a constitutive promoter (UB10) that ensures a strong ectopic expression of Arabidopsis genes (Grefen et al., 2010). The Arabidopsis database TAIR was used to identify splice variants of the putative tethers. As a result, no splice variants were identified for 2TMCLB and SYTF and a single splice variant, lacking the last intron and a small part of the 3’-UTR was detected for AtCLB (At3g61050.2) (Figure 4.6a, striped box and dashed line).  To assess the subcellular localization of the markers at the cortical ER we compared their localization profiles to those of C4H-GFP, a well-stablished ER-membrane marker (Ro et al., 2001), and pSYT1:SYT1-GFP (hereafter, SYT1-GFP), a previously described EPCS marker (Pérez-Sancho et al., 2015).  As shown in Figure 4.1a, C4H-GFP fluorescence showed the typical ER-membrane localization pattern with clear reticulate structures in the cortical region of epidermal cells, a continuous signal in equatorial regions, and strong fluorescence in the transvacuolar strands (Figure 4.1, white arrows). SYT1-GFP localized as a network of beads and strings in the cortical region of epidermal cells and a punctate and Chapter IV: Characterization of the putative tethers 42  discontinuous signal in the equatorial regions. A weak fluorescent SYT1-GFP signal was also visible in transvacuolar strands (Figure 4.1b). The subcellular localization analyses of the tether candidates show that the pattern of UB10:AtCLB-GFP (hereafter, AtCLB-GFP) resembles that of SYT1-GFP marker, as it shows open, reticulate structures formed by puncta and tubules in the cortical regions of epidermal cells. In the equatorial plane, a clear punctate pattern and weak transvacuolar strand signals were observed (Figure 4.1c). Similarly, UB10:SYTF-GFP (hereafter, SYTF-GFP) had a beads and strings pattern in the cortical region of epidermal cells while showing a punctate pattern in the equatorial region. Like for AtCLB-GFP, transvacuolar strands were occasionally visible in seedlings expressing SYTF-GFP (Figure 4.1d). Remarkably, the subcellular localization of UB10:2TMCLB-GFP (hereafter 2TMCLB-GFP) resembled that of the C4H-GFP marker with completely closed reticulate structures in cortical regions of epidermal cells, and strong labelling of the transvacuolar strands (Figure 4.2b), as also seen for C4H-GFP (Figure 4.2a). In equatorial regions, 2TMCLB-GFP showed a continuous signal (Figure 4.2b), distinct from the one observed in AtCLB-GFP and SYTF-GFP (Figure 4.1b, c, d) but similar to that of C4H-GFP (Figure 4.2a). Figure 4.1: Subcellular localization of C4H-GFP, SYT1-GFP, AtCLB-GFP and SYTF-GFP. a, C4H-GFP. b, SYT1-GFP. c, AtCLB-GFP. d, SYTF-GFP. Upper panels: cortical region; bottom panels: equatorial region. White arrows indicate transvacuolar strands. White squares show 2x zoom-in regions. Pictures taken in epidermal cells of 5-day-old cotyledons. Scale bars = 10µm. Chapter IV: Characterization of the putative tethers 43  4.1.2. SYT1 and AtCLB reticulations increase under salt stress Due to time limitations for a M.Sc. project, I focused my efforts on characterizing AtCLB, the most promising candidate identified in the BLAST search using the consensus SMP sequence (see Chapter 3). AtCLB localization resembles that of SYT1, AtCLB has the highest expression levels among the three NTMC2 putative tethers analyzed (Table 3.2) and co-immunoprecipitation experiments from a collaborator identified AtCLB as a potential SYT1 interactor (appendix D).   SYT1 is an EPCS tether required for NaCl stress tolerance (Pérez-Sancho et al., 2015; Schapire et al., 2008) and our preliminary AtCLB expression analysis indicates that AtCLB is downregulated under salt and osmotic stress (Figure 3.7). Thus, I hypothesized that AtCLB may also be involved in NaCl stress Figure 4.2: Subcellular localization of C4H and 2TMCLB-GFP. a, C4H-GFP. b, 2TMCLB-GFP. Upper panels: cortical region; bottom panels: equatorial region. White arrows indicate transvacuolar strands. White squares show 2x zoom-in regions. Pictures taken in epidermal cells of 5-day-old cotyledons. Scale bars = 10µm. Chapter IV: Characterization of the putative tethers 44  tolerance and that NaCl stress could cause changes in SYT1-GFP and AtCLB-GFP subcellular localization. To test this hypothesis, I performed localization analyses in Arabidopsis seedlings expressing SYT1-GFP and AtCLB-GFP subjected to 100mM NaCl stress. My results show that after 16-hours of incubation the characteristic “beads and strings” GFP signal pattern shown in mock conditions changes to a well-defined cortical reticulated pattern, indicative of an increase in EPCSs (Figure 4.3). Next, I determined whether this effect was caused by Na+ or Cl- toxicity or by a more general response to ion toxicity. For this purpose, I treated Arabidopsis seedlings with K2SO4, an ion stress generator that does not contain Na+ or Cl- ions. The treatment with K2SO4 shows that SYT1-GFP and AtCLB-GFP display a closed reticulated pattern similar to the one obtained after NaCl treatment (Figure 4.3). Further treatments with other salts, including KCl, MgCl2 and Na2SO4, showed closed reticulated patterns similar to the ones observed in response to NaCl and K2SO4 treatments (appendix E). Since NaCl stress has both ionic and osmotic components (Zhu, 2016), I also tested whether the signal distribution change observed in SYT1-GFP and AtCLB-GFP was specific for ionic stresses. To answer this question, I treated the SYT1-GFP and AtCLB-GFP lines with sorbitol, a chemical that generates Figure 4.3: Subcellular localization of SYT1-GFP and AtCLB-GFP under NaCl, K2SO4 and sorbitol stress. White squares show 2x zoom-in regions. Pictures taken in the cortical region of epidermal cells of 5-day-old cotyledons. Scale bars = 10µm. Chapter IV: Characterization of the putative tethers 45  osmotic stress without the ionic component. As result of the treatment, SYT1-GFP and AtCLB-GFP showed a “beads and strings” pattern, that strongly resembles that of the untreated controls (Figure 4.3). To provide quantitative values to the observed phenotypes, I quantified the number of closed reticulations in the cortical regions of SYT1-GFP and AtCLB-GFP epidermal cells after different treatments. The ionic stress generators NaCl and K2SO4 caused statistically significant increases in the number of closed reticulations, compared to the control, while the osmotic stress generator sorbitol showed no significant increase in the number of closed reticulated structures for both SYT1-GFP and AtCLB-GFP markers (Figure 4.4). Once I stablished that general ionic stress induces the expansion of the cortical SYT1-GFP and AtCLB-GFP signals, I asked whether the underlying ER morphology was also affected by NaCl stress. To answer this question, I used transgenic plants expressing the luminal ER marker HDEL-GFP and studied changes in localization at the cell cortex using different concentrations of NaCl. The reticulated HDEL-GFP network observed in untreated conditions was expanded upon 100mM NaCl treatment, as indicated by the larger area of its polygonal structures (Figure 4.5). Remarkably, the reticulate structures did not have Figure 4.4: Quantification of closed reticulated structures of SYT1-GFP and AtCLB-GFP under NaCl, K2SO4 and sorbitol treatments. Numbers indicate means ± standard deviation. Bars with different letters are significantly different (p<0,001) by two-ways ANOVA followed by LSD test. Mock K2SO4 Sorbitol NaCl a a b b Number of Closed Reticulated Structures Chapter IV: Characterization of the putative tethers 46  a homogenous expansion in response to NaCl treatment, as a fraction of small area polygons (approximately 30%) were still present in NaCl treated seedlings (Figure 4.5). Together, these results indicate that ionic stress changes both cortical ER morphology and EPCS distribution in Arabidopsis seedlings. 4.1.3. atclb1-3 does not show Ca2+-mediated NaCl stress phenotypes In a previous report, it was shown that the loss-of-function mutant syt1-2 was hypersensitive to NaCl stress under low Ca2+ conditions (Schapire et al., 2008). Because both SYT1-GFP and AtCLB-GFP display similar changes in subcellular localization upon NaCl stress (Figure 4.3), I asked whether the loss-of-function of AtCLB also induce NaCl hypersensitive phenotypes.  To address this question, I obtained a T-DNA mutant line, atclb1-3, harbouring an insertional mutation in the eighth exon (Figure 4.6a) and used an additional allele, atclb1-1, that harbours a T-DNA Figure 4.5: Distribution of HDEL-GFP reticulated structures area under NaCl stress. Numbers on the x-axis refer to individual reticulated structures out of 285 total measured; the reticulations were organized from widest to narrowest within each treatment. The y-axis refers to the area in µm2 of each individual reticulate structure. Pictures shown are representative of the reticulate expansion in different treatments. Scale bars = 2µm. Chapter IV: Characterization of the putative tethers 47  insertion in the tenth intron, which was proposed to confer salt tolerance through an unknown mechanism (Figure 4.6a) (De Silva et al., 2011). First, the AtCLB expression levels in both mutants were measured using quantitative RT-PCR. atclb1-3 displayed a severe reduction in AtCLB mRNA levels (up to 90%), while atclb1-1 showed only a slight reduction in AtCLB mRNA accumulation (10 to 20%) compared to WT plants (Figure 4.7). Based on this result, I selected atclb1-3 as the more suitable mutant allele to perform further phenotypic characterization.  To asses the Ca2+-dependent NaCl sensitivity of atclb1-3, mutant seedlings were germinated and grown on 1/10 MS medium for 5 days and then transferred to the same medium supplemented with different concentrations of NaCl, CaCl2 or NaCl+CaCl2, and root elongation measurements were performed 4 days a a b c d Figure 4.6: Phenotypical characterization of atclb1-3 mutant in NaCl stress and different Ca2+ conditions. a, schematic representation of the intron (lines) and exon (boxes) structure of AtCLB. Dark grey boxes show UTR regions; light grey boxes show the CDS region; the punctate line and the stripped box show the missing region in At3g61050.2 splice variant; the black arrow shows the start codon and the black square shows the stop codon; white arrows show the location of atclb1-3 insertion, used in this study, and atclb1-1/2 used in De Silva et al., 2011; grey arrows show the position of the primers used for qRT-PCR (see Figure 4.7); the first intron, of 400bp, is used as scale. b, effect of 100mM NaCl, 3mM CaCl2 and 100mM NaCl + 3mM CaCl2 treatments in atclb1-3; syt1 used as positive control. c, quantification of salt treatment performed in b: 5-day-old Col-0, syt1 and atclb1-3 seedlings were transferred to treatment media and root length was measured after 4 days. Numbers indicate means ± standard deviation. Bars with different letters are significantly different (p<0,001) by two-ways ANOVA followed by LSD test. c a b Chapter IV: Characterization of the putative tethers 48  after the transfer. In this experiment, Col-0 (WT) and syt1-2 seedlings were used as negative and positive controls, respectively. Figure 4.6b shows no difference in root elongation between WT and mutant seedlings under control conditions. Under NaCl treatments, WT, syt1-2 and atclb1-3 root growth were reduced. As expected, this effect was stronger for syt1-2 but no differences between the root growth of WT and atclb1-3 seedlings were observed. CaCl2 supplementation did not influence the root growth when applied alone, but it alleviated the NaCl-induced growth reduction. Thus, in agreement with Schapire et al., (2008), the addition of CaCl2 rescued the hypersensitivity to salt stress of syt1-2. Altogether, our results show no significant difference between atclb1-3 and WT seedlings in root length, suggesting that redundancy for AtCLB function might exist (Figure 4.6c). Figure 4.7: Relative AtCLB mRNA abundance in atclb1-1 and atclb1-3 mutants. 10-days-old seedlings, measured by qRT-PCR and analyzed by 2-ΔΔCt method. Abundance relative to Col-0 expression, using ACT2 as housekeeping. Data shows means ± SD of 2 biological replicates with 3 technical replicates each. 1.2 1 0.8 0.6 0.4 0.2 0 Chapter IV: Characterization of the putative tethers 49  4.1.4. Depletion of cytosolic Ca2+ increases SYT1 and AtCLB puncta pattern In mammalian cells, the Extended Synaptotagmin 1 (ESyt1) tether accumulates on EPCS in response to increases in  [Ca2+]cyt in a process that might be used to coordinate lipid transfer in response to stress (Giordano et al., 2013; Yu et al., 2016). In plants, AtCLB and SYT1 share EPCS localization and both contain putative Ca2+-dependent phospholipid binding C2 domains (Figure 3.4) (Pérez-Sancho et al., 2015; Schapire et al., 2008). I hypothesized then that Ca2+ could be an important factor in SYT1 and AtCLB distribution at EPCS. To test this hypothesis, I used pharmacological approaches to asses the putative role of Ca2+ in the subcellular localization of AtCLB and SYT1 and the subsequent organization of the plant EPCS.  Figure 4.8: Subcellular localization of SYT1-GFP and AtCLB-GFP after depletion of Ca2+cyt by EGTA and LaCl3. White squares show 2x zoom-in regions. Pictures taken in the cortical region of epidermal cells of 5-day-old cotyledons. Scale bars = 10µm. Chapter IV: Characterization of the putative tethers 50  In these experiments, I incubated stable transgenic lines expressing either SYT1-GFP or AtCLB-GFP in liquid media supplemented with either ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid, EGTA, a membrane permeable chelator which would sequestrate [Ca2+]cyt (Nakagawa et al., 2007), or LaCl3, a plasma membrane Ca2+ channel blocker which would prevent the influx of apoplastic Ca2+ into the cytosol (Knight, 1996). My results show that, upon EGTA treatment, the SYT1-GFP and AtCLB-GFP subcellular localization in the cell cortex evolves into a denser pattern, with fewer tubules and more punctate structures (Figure 4.8). This effect on SYT1-GFP and AtCLB-GFP localization was even more pronounced when the entry of Ca2+ into the cytosol via Ca2+ channel was blocked by LaCl3 treatments (Figure 4.8). The number of puncta by unit area at the cell cortex was taken as a proxy for the quantification of SYT1-GFP and AtCLB-GFP changes in subcellular localization under [Ca2+]cyt depletion. The quantification and subsequent statistical analyses show significant increases on the cortical SYT1-GFP and AtCLB-GFP signals under EGTA- or LaCl3-induced Ca2+ depletion, but no significant differences between SYT1-GFP and AtCLB-GFP distribution were found in any of the treatments tested (Figure 4.9). a b c LaCl3 EGTA Mock Figure 4.9: Quantification of puncta number of SYT1-GFP and AtCLB-GFP in cytosolic Ca2+ depletion treatments. Numbers indicate means ± standard deviation. Bars with different letters are significantly different (p<0,001) by two-ways ANOVA followed by LSD test. Chapter IV: Characterization of the putative tethers 51  4.1.5. SYT1 and AtCLB subcellular pattern expands after increases of PtdIns(4,5)P2 at the plasma membrane  In Arabidopsis, NaCl stress induces the accumulation of negatively charged lipids, such as PA and PtdIns(4,5)P2 at the plasma membrane (DeWald et al., 2001; Meijer et al., 2001; Singh et al., 2015; Zhang et al., 2004), and the expansion of SYT1-GFP and AtCLB-GFP labelled EPCS. Since SYT1 and AtCLB binding to the PM is predicted to occur through the C2 phospholipid binding domains, I hypothesized that the increase in negatively charged lipids at the PM upon NaCl stress could be responsible for the SYT1- and AtCLB-mediated EPCS expansion. A prediction derived from this model is that the accumulation of negatively charged phosphoinositides at the PM should mimic the effect of NaCl stress on EPCS expansion. To test this prediction, we used a pharmacological approach and treated plants expressing SYT1-GFP and AtCLB-GFP with a liquid medium containing U73122, an amino steroid that blocks the PLC activity, effectively increasing the amount of PtdIns(4,5)P2 at the PM (Parre et al., 2007) (Figure 4.10a). Figure 4.10: Subcellular localization of SYT1-GFP and AtCLB-GFP after PLC inactivation by U73122. a, schematic representation of IP3 pathway and U713122 inactivation of PLC. b, localization pattern of SYT1-GFP and AtCLB-GFP in the cortical region of epidermal cells of 5-days-old cotyledons after U73122 treatment. White squares show 2x zoom-in regions. Scale bars = 10µm. Chapter IV: Characterization of the putative tethers 52  Previous unpublished experiments in our lab used the fluorescent sensor CITRINE-2xPHPLC,which specifically binds to PtdIns(4,5)P2 (Simon et al., 2014) to show that PtdIns(4,5)P2 accumulates 3-4 fold in response to NaCl stress and U73122 treatments (appendix F). In terms of subcellular localization, the U73122 treatment induced the expansion of the SYT1-GFP and AtCLB-GFP EPCS, generating a reticulated pattern that closely resembles that obtained in response to NaCl treatment (Figure 4.10b). The pattern changes were quantified, taking into consideration the increase in closed reticulated structures. SYT1-GFP and AtCLB-GFP significantly increase the number of closed reticulated structures in U73122 treatment compared to control conditions. Non-significant differences were found between SYT1-GFP and AtCLB-GFP. Non-significant differences in closed reticulations number were found between NaCl and U73122 treatments (Figure 4.11).  Figure 4.11: Quantification of closed reticulate structures of SYT1-GFP and AtCLB-GFP under U73122 treatment. NaCl quantification is shown for comparison. Numbers indicate means ± standard deviation. Bars with different letters are significantly different (p<0,001) by two-ways ANOVA followed by LSD test. Mock U73122 a b NaCl b Number of Closed Reticulated Structures Chapter IV: Characterization of the putative tethers 53  4.2. Discussion 4.2.1. AtCLB and SYTF subcellular distribution patterns resemble SYT1 and suggest EPCS localization  The analyses of the GFP-tagged putative MCS tethers localization in epidermal cells revealed that the subcellular patterns of AtCLB-GFP and SYTF-GFP resemble the one of SYT1-GFP (Figure 4.1) (Pérez-Sancho et al., 2015). These results suggest that AtCLB and SYTF are EPCS localized tethers. Additionally, co-immunoprecipitation experiments from a collaborator found AtCLB as interactor of SYT1 (appendix D), reinforcing the idea of AtCLB as EPCS tether. Recent research studying reticulons, proteins involved in the ER curvature, found that the plasmodesmata-localized reticulon proteins RTNLB3 and RTNLB6 interact with SYT1 and AtCLB (Kriechbaumer et al., 2015). SYT1 is also present in  plasmodesmata-localized EPCS, supporting the presence of AtCLB at EPCSs (Bayer et al., 2017). In contrast, AtCLB was previously reported as a nuclear-localized protein by immunolocalization techniques, in contradiction with our results (De Silva et al., 2011). However, the authors did not identify AtCLB SMP domain and did not discuss the possible presence of a TM domain at the N-terminus region, incompatible with nuclear localization (Figure 3.4).  2TMCLB-GFP shows a reticulated pattern with intense signal in transvacuolar strands, resembling ER-membrane markers (Figure 4.2). This subcellular localization does not support 2TMCLB as EPCS tether. On the other hand, there are reports of MCS between the ER and other organelles in plants (Andersson et al., 2007; Mehrshahi et al., 2013; Mueller and Reski, 2015) and the SMP domain is present in tethers forming contact sites other than EPCS in yeast (Toulmay and Prinz, 2012), suggesting that 2TMCLB, as SMP-containing protein, might be a tether between the ER and other organelles. It is also important to consider that the ER-like, reticulated pattern of 2TMCLB could be due to the high expression caused by the UBQ10 promoter.  Chapter IV: Characterization of the putative tethers 54  Thus, further studies of the putative tethers driven by their native promoters and co-localization with EPCS and organelle markers are needed to confirm not only AtCLB and SYTF EPCS localization but also 2TMCLB ER-like pattern. 4.2.2. Decreases in cytosolic Ca2+ promote EPCS formation by SYT1 and AtCLB  The study of SYT1-GFP and AtCLB-GFP subcellular localization under depletion of [Ca2+]cyt by EGTA or LaCl3 revealed an increase of GFP signal through the promotion of the puncta pattern, indicating that the decrease in [Ca2+]cyt induces the formation of new EPCS (Figure 4.8; Figure 4.9). Previous studies in our lab have shown that ER morphology is greatly affected by LaCl3, although an obvious effect was not noticed for EGTA (appendix G). This suggests that strong depletion of cytosolic Ca2+ affects not only SYT1 and AtCLB localization but also ER morphology.  EPCS formation by the mammalian ESyt1 is promoted upon increase of [Ca2+]cyt (Giordano et al., 2013) and phosphoinositide binding by SYT1 C2 domains is also promoted by the presence of Ca2+ (Pérez-Sancho et al., 2015; Schapire et al., 2008). In sharp contrast, unpublished data from our group did not show an increase in EPCS formation by SYT1-GFP upon increase of [Ca2+]cyt by addition of exogenous CaCl2 or by treatments with thapsigargin, a drug that blocks Ca2+ uptake by the ER and activates SOCE (store-operated Ca2+ entry) (appendix H) (Giordano et al., 2013). Thapsigargin has been successfully used in mammals (Giordano et al., 2013), but plants have no clear homologues of SOCE components (Kudla et al., 2010). Instead, thapsigargin partially blocks plant Ca2+ ATPases and heavy-metal co-transporters but does not affect Ca2+ uptake by ER vesicles (Moreno et al., 2008; Ordenes et al., 2002). This may suggest that the [Ca2+]cyt increase caused by thapsigargin in plants may not be sufficient to trigger a response in SYT1 and AtCLB and an increase in EPCS formation by them. Together, these data suggest that EPCS promotion under depletion of [Ca2+]cyt could cause a change in ER morphology, bringing the ER closer to the plasma membrane. It could also suggest that depletion of [Ca2+]cyt change ER morphology which in turn promotes the formation of new EPCS. However, the role of Chapter IV: Characterization of the putative tethers 55  Ca2+ in plant EPCS formation requires further clarification. Experimental controls would be needed in future studies to assure that the addition of exogenous CaCl2 and the thapsigargin treatment are actually causing an increase in [Ca2+]cyt in plant cells. 4.2.3. AtCLB is not required for plant tolerance to NaCl stress syt1-2 loss-of-function insertional mutant is hypersensitive to NaCl stress in low Ca2+ conditions (Schapire et al., 2008). Both SYT1 and AtCLB are ubiquitously expressed and both AtCLB and SYT1 belong to the NTMC2 superfamily and share similar domain distribution. Although AtCLB is downregulated by salt stress, our phenotypic analyses did not find any differences between WT seedlings and atclb1-3 loss-of-function insertional mutant seedlings under NaCl stress treatments supplemented with different Ca2+ concentrations.  Previously, AtCLB was reported to be a nuclear-localized C2-containing protein, working as transcription factor of the thalianol synthase gene and acting as negative regulator of root length and NaCl tolerance (De Silva et al., 2011). However, contrary to these previous reports, atclb1-1 insertional mutation is not located in the tenth exon of AtCLB but in the previous intron (Figure 4.6a). As a result, qRT-PCR analyses demonstrated that atclb1-1 mutant has AtCLB expression levels resembling WT plants (Figure 4.7), suggesting that the phenotypes observed by the authors may be due to a second insertion, instead of by reduced amounts of AtCLB.  One of the difficulties in the functional characterization of contact site tethers is the redundancy among their sequences (Pérez-Sancho et al., 2016) which may cause functional redundancy. Additionally, contact site tethers seem to be involved in several functions, from lipid and Ca2+ homeostasis to organelle dynamics (Prinz, 2014); specifically, AtCLB expression is regulated by abiotic and biotic stresses as well as phytohormones signalling (Figure 3.7), suggesting that AtCLB might have more complex functions not only related to NaCl stress.  Chapter IV: Characterization of the putative tethers 56  To further clarify the role of AtCLB in NaCl stress, functional characterization of double mutant plants in SYT1 and AtCLB would be needed. Also, it would be interesting to study the sensitivity to salt stress of triple mutant plants in SYT1, AtCLB and SYT5, since they three are ubiquitously expressed (Table 3.2; appendix A), can interact in vitro (appendix D), and have a similar “beads and string” pattern at the cell cortex (Figure 4.1; data not shown for SYT5). 4.2.4. Salt stress and PtdIns(4,5)P2 increases induce SYT1 and AtCLB EPCS and reduce intermembrane distance  I have demonstrated that salt stress, but not osmotic stress, changes SYT1-GFP and AtCLB-GFP subcellular distribution from a beads and string network into a more closed reticulated network almost lacking puncta (Figure 4.3; Figure 4.4). I have showed that NaCl stress also affects ER morphology, expanding the normal reticulate pattern of the ER-luminal marker GFP-HDEL (Figure 4.5). Interestingly, the partial co-localization of SYT1-RFP and GFP-HDEL in normal conditions increased upon NaCl stress (appendix I). Unpublished experiments in our group used the artificial EPCS marker MAPPER (Chang et al., 2013), made with a ER-luminal GFP, the N-terminal TM domain of the mammalian STIM1 and a cytosolic C-terminal polybasic domain, which binds to phosphoinositides at the plasma membrane, to study the ER-PM intermembrane distance in plants. MAPPER showed a EPCS-like puncta and tubular pattern under normal conditions, but it did not completely co-localize with SYT1, reinforcing the idea that different EPCS exist is plants (appendix J, a) (Siao et al., 2016). MAPPER localization under salt stress resembled those of SYT1 and AtCLB (appendix J, b). Additionally, and likewise SYT1-GFP, MAPPER co-localization with RFP-HDEL increased during NaCl stress (appendix J, c), suggesting that NaCl is promoting EPCS formation by decreasing the distance between the ER and the plasma membrane.  On the other hand, an increase in PtdIns(4,5)P2 concentration by blockage of PLC changed AtCLB and SYT1 subcellular distribution, mimicking the results obtained in salt stress treatments (Figure 4.10; Chapter IV: Characterization of the putative tethers 57  Figure 4.11). Similar results were obtained using MAPPER, suggesting that an increase in PtdIns(4,5)P2 promotes EPCSs formation and reduce the intermembrane distance. Thus, I hypothesize that salt stress facilitates EPCS formation by promoting the interaction of SYT1 and AtCLB C2 domains and PtdIns(4,5)P2 located at the plasma membrane. The EPCS promotion could be required for non-vesicular replenishment of PM-localized phosphoinositides such as PtdIns, which are important for PLC signalling, as already discovered for mammalian SMP-EPCS tethers (Lees et al., 2017; Yu et al., 2016). Interestingly, this lipid-transfer function would only be required under ionic stresses, since AtCLB-GFP and SYT1-GFP subcellular distribution is not affected by non-ionic hyperosmotic stress. The specificity of this putative function is supported by a report showing that the accumulation of proline, a well-known compatible osmolyte, under ionic stress requires Ca2+ signaling and PLC activity (Parre et al., 2007). However, PLC signaling was not required for proline accumulation in non-ionic hyperosmotic stress, suggesting that the lipid signaling pathway could discriminate between ionic and non-ionic stresses (Parre et al., 2007).   This hypothesis would suggest an exciting model where EPCS formation might be promoted not only by the presence of negatively charged phosphoinositides at the PM, but also by increases in [Ca2+]cyt due to external stimuli such as ionic stress. Further studies are required to explore the possibility of non-vesicular lipid-transfer function of SMP-proteins in plants and how this function may be integrated in the EPCS promotion by salt stress.  Chapter V: Conclusions 58  Chapter V: Conclusions MCS are subcellular microdomains conserved in all eukaryotes where the membranes of two organelles are in close apposition thanks to protein tethers, which have diverse functions, such as mediating Ca2+ homeostasis and non-vesicular lipid transport (Prinz, 2014). Although multiple tethering complexes have been characterized in yeast and mammals, little is known about contact site tethers in plants (Pérez-Sancho et al., 2016). Previous work in our lab identified the Arabidopsis EPCS tether SYT1 as component required for Ca2+-dependent responses to NaCl stress (Pérez-Sancho et al., 2015; Schapire et al., 2008). In this study, I aimed at expanding the knowledge of the molecular components involved in MCS establishment in plants using bioinformatics and cell biology approaches. The research objectives of this thesis are: 1. Identification of novel membrane contact sites tethers in Arabidopsis thaliana. 2. Functional characterization of the putative tethers in salt stress responses mediated by Ca2+. As a tool to identify contact site tethers in the model organism Arabidopsis thaliana, I used the SMP domain, a lipid-binding domain present in MCS tethers in eukaryotes (Toulmay and Prinz, 2012). I created a SMP consensus sequence by aligning the SMP sequence of experimentally demonstrated MCS tethers and used it as query in BLAST searches against the Arabidopsis database. This approach enabled the identification of AtCLB, an SMP-containing protein and a putative MCS tether. AtCLB belongs to the NTMC2 protein family, which comprises the already known Arabidopsis SYT family and a group of unknown proteins. Two of those proteins, SYTF and 2TMCLB, were also selected as putative tether candidates. The subsequent analyses of the three candidates showed that the SMP consensus approach was too restrictive in the search of MCS tethers as SYTF, a member of the NTMC2 family not identified in the bioinformatic approach, was indeed localized at MCSs. The SMP consensus strategy was useful to identify AtCLB, an EPCS component also identified by unpublished co-immunoprecipitation experiments using Chapter V: Conclusions 59  SYT1 as bait (appendix D). All proteins in the NTMC2 family posses a predicted TM domain at the N-terminus, an internal SMP domain and, at least one C-terminal C2 domain. The domain distribution of these proteins, resembling known eukaryotic MCS tethers (Giordano et al., 2013; Pérez-Sancho et al., 2015; Toulmay and Prinz, 2012) and the presence of a SMP domain (Toulmay and Prinz, 2012) suggest that the unknown members of the newly discovered NTMC2 family might be contact site tethers. This would require further study using light and electron microscopy approaches to test whether these new SMP-containing proteins are MCS tethers. The study of the SMP domain across eukaryotes revealed highly conserved amino acid residues. One of these residues, a tryptophan located at the N-terminus of the SMP domain, has been identified as important for SMP interaction and protein dimerization (Jeong et al., 2017). This dimerization is essential for the non-vesicular transfer of lipids between membranes in mammalian and yeast cells and the residue conservation in plants suggest that NTMC2 proteins might also dimerize through SMP domain interactions and could be involved in non-vesicular lipid transfer. Future experiments would need to test the lipid-transfer function of plant EPCS tethers and, using directed mutagenesis, study the importance of the conserved residues in the tethers’ function (Figure 3.9). In Chapter IV, the study of transgenic plants expressing AtCLB, SYTF and 2TMCLB translationally attached to fluorescent tags revealed that AtCLB and SYTF had a subcellular distribution resembling that of the well-characterized EPCS tether SYT1, while 2TMCLB subcellular distribution was similar to that of the ER marker C4H-GFP. It is important to mention that the AtCLB, SYTF and 2TMCLB GFP fusions were driven by a strong promoter (UB10) that might generate localization artifacts. Therefore, experiments using transgenic plants expressing translational fusions of the putative tethers driven by their native promoter are required to confirm their MCS localization. The subcellular localization of AtCLB, SYTF and 2TMCLB suggests that the SMP consensus sequence, mostly made of yeast and mammalian EPCS tethers, is useful to identify EPCS tethers but might not be a good approach to identify putative tethers involved in the contact of the ER with other organelles.   Chapter V: Conclusions 60  Concerning these next steps in the project, I have already generated transgenic plants expressing GFP-tagged translational reporters of AtCLB, SYTF and 2TMCLB, driven by their native promoters, to further study the MCS localization of the tethers. I have also generated transgenic plants expressing AtCLB-RFP, SYTF-RFP or 2TMCLB-RFP and SYT1-GFP or GFP-HDEL, as a first step in the co-localization analyses that will further verify the MCS localization of the putative tethers.  In this study, I further showed that depletions of [Ca2+]cyt increase the puncta subcellular pattern of SYT1 and AtCLB. Conversely, high cytosolic Ca2+ has been reported to increase EPCSs formation by the mammalian ESyt1 (Giordano et al., 2013) and to promote in vitro phosphoinositide binding of SYT1 C2 domains (Pérez-Sancho et al., 2015; Schapire et al., 2008), although I have been unable to demonstrate an increase in plant EPCS formation in vivo after increase in [Ca2+]cyt by exogenous addition of CaCl2 or pharmacological treatments with thapsigargin. Additionally, treatment with LaCl3 also showed strong alterations in ER morphology. The question that remains to be addressed is whether the ER morphology changes are causing the EPCS formation or the sudden increase of ER-PM contacts are modifying ER morphology. Future experiments will reveal how the increase in [Ca2+]cyt affects EPCS formation. Also, it would be interesting to study how ER morphology is affected in plants lacking EPCS tethers such as AtCLB, SYT1 and SYT5, to shed light on whether depletion of [Ca2+]cyt affects ER in the absence of ER-PM tethers.  The results of the phenotypic analysis of the loss-of-function insertional mutant atcbl1-3 suggest that AtCLB is not essential for plant tolerance to salt stress. This can be due to functional redundancy, common in MCS tethers (Pérez-Sancho et al., 2016), or to the involvement of AtCLB in other processes, given AtCLB regulation in different treatments and the multiple roles of MCS tethers (Prinz, 2014). Since SYT1 can interact with SYT5 and AtCLB (appendix D) and these 3 SMP proteins are ubiquitously expressed, I hypothesized that they can form a complex at EPCS, regulating abiotic stress tolerance with SYT1 as the key player. Regarding the next steps in this project, I have generated the double mutants atclb1-3 syt1 and atclb1-3 syt5 and the triple mutant atclb1-3 syt1/5, which will be used in further salt stress Chapter V: Conclusions 61  experiments to test the function of SYT5 and AtCLB in absence of SYT1 and how the lack of the three components of our putative EPCS complex affect salt stress tolerance.  Finally, my study shows that salt stress and increases in PtdIns(4,5)P2 produce changes in the SYT1-GFP and AtCLB-GFP subcellular distribution at the cell cortex that could be linked to EPCS expansions. The EPCS expansions mediated by PtdIns(4,5)P2 have been previously reported in mammalian cells (Giordano et al., 2013), suggesting that it is a conserved mechanism in eukaryotes. This discovery clarifies the regulation of EPCS formation in plants. However, it does not explain the purpose of EPCS formation. Non-vesicular lipid transfer is an exciting hypothesis, already demonstrated for mammalian SMP-proteins which would require further biochemical studies, mimicking the ones performed in mammals (Lees et al., 2017; Yu et al., 2016).  In summary, in this thesis I successfully identified two members of the NTMC2 family as putative EPCS tethers, demonstrating that the SMP domain can be used as a bioinformatic tool to identify MCS tethers in plants. In addition, I have identified highly conserved residues in the SMP domain of eukaryotes, which may be important for tether dimerization and function. I have also shown that the localization of SYT1 and AtCLB is modified by Ca2+, PtdIns(4,5)P2 and salt stress, although I have been unable to clarify the specific role of AtCLB in salt stress tolerance and signaling. Further studies are required to shed light on the function of the SMP-containing proteins AtCLB and SYT1 in salt stress tolerance and to identify putative MCS tethers among the newly discovered NTMC2 proteins.  Bibliography 62  Bibliography Andersson, M.X., Goksör, M., and Sandelius, A.S. (2007). Optical manipulation reveals strong attracting forces at membrane contact sites between endoplasmic reticulum and chloroplasts. J. Biol. Chem. 282, 1170–1174. B. E. Juniper, C.R.H. and J.C.H. (1982). The relationships between the dictyosomes and the forms of endoplasmic reticulum in plant cells with different export programs. Bot. Gaz. 143, 135–145. Barajas, D., Xu, K., de Castro Martín, I.F., Sasvari, Z., Brandizzi, F., Risco, C., and Nagy, P.D. (2014). Co-opted Oxysterol-Binding ORP and VAP Proteins Channel Sterols to RNA Virus Replication Sites via Membrane Contact Sites. PLoS Pathog. 10, 34–45. Baral, A., Shruthi, K.S., and Mathew, M.K. (2015). Vesicular trafficking and salinity responses in plants. IUBMB Life 67, 677–686. Bateman, A., Martin, M.J., O’Donovan, C., Magrane, M., Alpi, E., Antunes, R., Bely, B., Bingley, M., Bonilla, C., Britto, R., et al. (2017). UniProt: The universal protein knowledgebase. Nucleic Acids Res. 45, D158–D169. Bayer, E.M., Sparkes, I., Vanneste, S., and Rosado, A. (2017). From shaping organelles to signalling platforms: the emerging functions of plant ER–PM contact sites. Curr. Opin. Plant Biol. 40, 89–96. Besprozvannaya, M., Dickson, E., Li, H., Ginburg, K.S., Bers, D.M., Auwerx, J., and Nunnari, J. (2018). GRAM domain proteins specialize functionally distinct ER-PM contact sites in human cells. 1, 1–25. Boudsocq, M., Droillard, M.J., Barbier-Brygoo, H., and Laurière, C. (2007). Different phosphorylation mechanisms are involved in the activation of sucrose non-fermenting 1 related protein kinases 2 by osmotic stresses and abscisic acid. Plant Mol. Biol. 63, 491–503. Boudsocq, M., Danquah, A., Zélicourt, A. De, Hirt, H., and Colcombet, J. (2015). Plant MAPK cascades: Just rapid signaling modules? Plant Signal. Behav. 10. Buchan, D.W.A., Minneci, F., Nugent, T.C.O., Bryson, K., and Jones, D.T. (2013). Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic Acids Res. 41, 349–357. Chang, C.L., Hsieh, T.S., Yang, T.T., Rothberg, K.G., Azizoglu, D.B., Volk, E., Liao, J.C., and Liou, J. (2013). Feedback Regulation of Receptor-Induced Ca2+ SignalingMediated by E-Syt1 and Nir2 at Endoplasmic Reticulum-Plasma Membrane Junctions. Cell Rep. 5, 813–825. Clough, S.J., and Bent, A.F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Corbineau, F., Xia, Q., Bailly, C., and El-Maarouf-Bouteau, H. (2014). Ethylene, a key factor in the regulation of seed dormancy. Front. Plant Sci. 5, 1–13. Bibliography 63  Cramer, G.R., Urano, K., Delrot, S., Pezzotti, M., and Shinozaki, K. (2011). Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol. 11, 163. Craxton, M. (2007). Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans. BMC Genomics 8, 259. Craxton, M. (2010). A manual collection of Syt, Esyt, Rph3a, Rph3al, Doc2, and Dblc2 genes from 46 metazoan genomes - an open access resource for neuroscience and evolutionary biology. BMC Genomics 11, 1–21. Danquah, A., de Zélicourt, A., Boudsocq, M., Neubauer, J., Frei dit Frey, N., Leonhardt, N., Pateyron, S., Gwinner, F., Tamby, J.-P., Ortiz-Masia, D., et al. (2015). Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana. Plant J. 82, 232–244. Daviere, J.-M., and Achard, P. (2013). Gibberellin signaling in plants. Development 140, 1147–1151. Deinlein, U., Stephan, A.B., Horie, T., Luo, W., Xu, G., and Schroeder, J.I. (2014). Plant salt-tolerance mechanisms. Trends Plant Sci. 19, 371–379. Derler, I., Jardin, I., and Romanin, C. (2016). Molecular mechanisms of STIM/Orai communications. Am. J. Physiol. - Cell Physiol. 310, C643–C662. DeWald, D.B., Torabinejad, J., Jones, C. a, Shope, J.C., Cangelosi,  a R., Thompson, J.E., Prestwich, G.D., and Hama, H. (2001). Rapid accumulation of phosphatidylinositol 4,5-bisphosphate and inositol 1,4,5-trisphosphate correlates with calcium mobilization in salt-stressed arabidopsis. Plant Physiol. 126, 759–769. Fischer, A.M. (2012). The Complex Regulation of Senescence. CRC. Crit. Rev. Plant Sci. 31, 124–147. Ghai, R., Du, X., Wang, H., Dong, J., Ferguson, C., Brown, A.J., Parton, R.G., Wu, J.W., and Yang, H. (2017). ORP5 and ORP8 bind phosphatidylinositol-4, 5-biphosphate (PtdIns(4,5)P2) and regulate its level at the plasma membrane. Nat. Commun. 8. Giordano, F., Saheki, Y., Idevall-Hagren, O., Colombo, S.F., Pirruccello, M., Milosevic, I., Gracheva, E.O., Bagriantsev, S.N., Borgese, N., and De Camilli, P. (2013). PI(4,5)P2-Dependent and Ca2+-Regulated ER-PM interactions mediated by the extended synaptotagmins. Cell 153, 1494–1509. Goda, H., Sasaki, E., Akiyama, K., Maruyama-Nakashita, A., Nakabayashi, K., Li, W., Ogawa, M., Yamauchi, Y., Preston, J., Aoki, K., et al. (2008). The AtGenExpress hormone and chemical treatment data set: Experimental design, data evaluation, model data analysis and data access. Plant J. 55, 526–542. Gouy, M., Guindon, S., and Gascuel, O. (2010). Seaview version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 27, 221–224. Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R. (2010). Bibliography 64  A ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies. Plant J. 64, 355–365. Hamasaki, M., Furuta, N., Matsuda, A., Nezu, A., Yamamoto, A., Fujita, N., Oomori, H., Noda, T., Haraguchi, T., Hiraoka, Y., et al. (2013). Autophagosomes form at ER-mitochondria contact sites. Nature 495, 389–393. Ho, C.M.K., Paciorek, T., Abrash, E., and Bergmann, D.C. (2016). Modulators of Stomatal Lineage Signal Transduction Alter Membrane Contact Sites and Reveal Specialization among ERECTA Kinases. Dev. Cell 38, 345–357. Huang, R., Zhao, J., Liu, J., Wang, Y., Han, S., and Zhao, H. (2017). Genome-wide analysis and expression profiles of NTMC2 family genes in Oryza sativa. Gene 637, 130–137. Jeong, H., Park, J., Jun, Y., and Lee, C. (2017). Crystal structures of Mmm1 and Mdm12–Mmm1 reveal mechanistic insight into phospholipid trafficking at ER-mitochondria contact sites. Proc. Natl. Acad. Sci. 10, 201715592. Jürgens, G. (2004). Membrane Trafficking in Plants. Annu. Rev. Cell Dev. Biol. 20, 481–504. Kelly, L.A., Mezulis, S., Yates, C., Wass, M., and Sternberg, M. (2015). The Phyre2 web portal for protein modelling, prediction, and analysis. Nat. Protoc. 10, 845–858. Khodakovskaya, M., Sword, C., Wu, Q., Perera, I.Y., Boss, W.F., Brown, C.S., and Winter Sederoff, H. (2010). Increasing inositol (1,4,5)-trisphosphate metabolism affects drought tolerance, carbohydrate metabolism and phosphate-sensitive biomass increases in tomato. Plant Biotechnol. J. 8, 170–183. Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., D&apos;Angelo, C., Bornberg-Bauer, E., Kudla, J., and Harter, K. (2007). The AtGenExpress global stress expression data set: Protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. Plant J. 50, 347–363. Kim, B.G., Waadt, R., Cheong, Y.H., Pandey, G.K., Dominguez-Solis, J.R., Schültke, S., Lee, S.C., Kudla, J., and Luan, S. (2007). The calcium sensor CBL10 mediates salt tolerance by regulating ion homeostasis in Arabidopsis. Plant J. 52, 473–484. Kim, H., Kwon, H., Kim, S., Kim, M.K., Botella, M.A., Yun, H.S., and Kwon, C. (2016). Synaptotagmin 1 Negatively Controls the Two Distinct Immune Secretory Pathways to Powdery Mildew Fungi in Arabidopsis. Plant Cell Physiol. 57, 1133–1141. Kim, Y.J., Guzman-Hernandez, M.L., Wisniewski, E., and Balla, T. (2015). Phosphatidylinositol-Phosphatidic Acid Exchange by Nir2 at ER-PM Contact Sites Maintains Phosphoinositide Signaling Competence. Dev. Cell 33, 549–561. Klepikova, A. V., Kasianov, A.S., Gerasimov, E.S., Logacheva, M.D., and Penin, A.A. (2016). A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq profiling. Plant J. 88, 1058–1070. Knight, H. (1996). Cold Calcium Signaling in Arabidopsis Involves Two Cellular Pools and Bibliography 65  a Change in Calcium Signature after Acclimation. Plant Cell Online 8, 489–503. Knoblach, B., Sun, X., Coquelle, N., Fagarasanu, A., Poirier, R.L., and Rachubinski, R.A. (2013). An ER-peroxisome tether exerts peroxisome population control in yeast. EMBO J. 32, 2439–2453. Kopec, K.O., Alva, V., and Lupas, A.N. (2010). Homology of SMP domains to the TULIP superfamily of lipid-binding proteins provides a structural basis for lipid exchange between ER and mitochondria. Bioinformatics 26, 1927–1931. Kornmann, B., Currie, E., Collins, S.R., Schuldiner, M., Nunnari, J., Weissman, J.S., and Walter, P. (2009). An ER-Mitochondria Tethering Biology Screen. Science (80-. ). 325, 477–481. Kriechbaumer, V., Botchway, S.W., Slade, S.E., Knowx, K., Frigerio, L., Oparka, K., and Hawes, C. (2015). Reticulomics: Protein-protein interaction studies with two plasmodesmata-localized reticulon family proteins identify binding partners enriched at plasmodesmata, endoplasmic reticulum, and the plasma membrane. Plant Physiol. 169, 1933–1945. Kudla, J., Batistic, O., and Hashimoto, K. (2010). Calcium Signals: The Lead Currency of Plant Information Processing. Plant Cell 22, 541–563. Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33, 1870–1874. Lackner, L.L., Ping, H., Graef, M., Murley, A., and Nunnari, J. (2013). Endoplasmic reticulum-associated mitochondria-cortex tether functions in the distribution and inheritance of mitochondria. Proc. Natl. Acad. Sci. U. S. A. 110, E458-67. Lees, J.A., Messa, M., Sun, E.W., Wheeler, H., Torta, F., Wenk, M.R., De Camilli, P., and Reinisch, K.M. (2017). Lipid transport by TMEM24 at ER–plasma membrane contacts regulates pulsatile insulin secretion. Science (80-. ). 355, eaah6171. Levy, A., Zheng, J.Y., and Lazarowitz, S.G. (2015). Synaptotagmin SYTA Forms ER-Plasma Membrane Junctions that Are Recruited to Plasmodesmata for Plant Virus Movement. Curr. Biol. 25, 2018–2025. Li, X., Wang, X., Yang, Y., Li, R., He, Q., Fang, X., Luu, D.-T., Maurel, C., and Lin, J. (2011). Single-Molecule Analysis of PIP2;1 Dynamics and Partitioning Reveals Multiple Modes of Arabidopsis Plasma Membrane Aquaporin Regulation. Plant Cell 23, 3780–3797. Liu, L.K., Choudhary, V., Toulmay, A., and Prinz, W.A. (2017). An inducible ER-Golgi tether facilitates ceramide transport to alleviate lipotoxicity. J. Cell Biol. 216, 131–147. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Luan, S. (2009). The CBL-CIPK network in plant calcium signaling. Trends Plant Sci. 14, 37–42. Luan, S., Lan, W., and Chul Lee, S. (2009). Potassium nutrition, sodium toxicity, and calcium signaling: connections through the CBL-CIPK network. Curr. Opin. Plant Biol. 12, 339–346. Bibliography 66  Lunn, J.E. (2007). Compartmentation in plant metabolism. J. Exp. Bot. 58, 35–47. Luu, D.T., Martiniãre, A., Sorieul, M., Runions, J., and Maurel, C. (2012). Fluorescence recovery after photobleaching reveals high cycling dynamics of plasma membrane aquaporins in Arabidopsis roots under salt stress. Plant J. 69, 894–905. Mazel, A., Leshem, Y., Tiwari, B.S., and Levine, A. (2004). Induction of salt and osmotic stress tolerance by overexpression of an intracellular vesicle trafficking protein AtRab7 (AtRabG3e). Plant Physiol. 134, 118–128. McFarlane, H.E., Lee, E.K., van Bezouwen, L.S., Ross, B., Rosado, A., and Samuels, A.L. (2017). Multiscale Structural Analysis of Plant ER–PM Contact Sites. Plant Cell Physiol. 2, pcw224. Mehrshahi, P., Stefano, G., Andaloro, J.M., Brandizzi, F., Froehlich, J.E., and DellaPenna, D. (2013). Transorganellar complementation redefines the biochemical continuity of endoplasmic reticulum and chloroplasts. Proc. Natl. Acad. Sci. U. S. A. 110, 12126–12131. Mehrshahi, P., Johnny, C., and DellaPenna, D. (2014). Redefining the metabolic continuity of chloroplasts and ER. Trends Plant Sci. 19, 501–507. Meijer, H.J.G., Arisz, S.A., Van Himbergen, J.A.J., Musgrave, A., and Munnik, T. (2001). Hyperosmotic stress rapidly generates lyso-phosphatidic acid in Chlamydomonas. Plant J. 25, 541–548. Mitula, F., Tajdel, M., Cies̈la, A., Kasprowicz-Malus̈ki, A., Kulik, A., Babula-Skowrońska, D., Michalak, M., Dobrowolska, G., Sadowski, J., and Ludwików, A. (2015). Arabidopsis ABA-Activated Kinase MAPKKK18 is Regulated by Protein Phosphatase 2C ABI1 and the Ubiquitin-Proteasome Pathway. Plant Cell Physiol. 56, 2351–2367. Moreno, I., Norambuena, L., Maturana, D., Toro, M., Vergara, C., Orellana, A., Zurita-Silva, A., and Ordenes, V.R. (2008). AtHMA1 is a thapsigargin-sensitive Ca2+/heavy metal pump. J. Biol. Chem. 283, 9633–9641. Morré, D.J., Merritt, W.D., and Lembi, C.A. (1971). Connections between mitochondria and endoplasmic reticulum in rat liver and onion stem. Protoplasma 73, 43–49. Mueller, S.J., and Reski, R. (2015). Mitochondrial Dynamics and the ER: The Plant Perspective. Front. Cell Dev. Biol. 3, 1–7. Munnik, T., Meijer, H.J.G., Riet, B. Ter, Hirt, H., Frank, W., Bartels, D., and Musgrave, A. (2000). Hyperosmotic stress stimulates phospholipase D activity and elevates the levels of phosphatidic acid and diacylglycerol pyrophosphate. Plant J. 22, 147–154. Naik, P.K. (2011). MetalloPred: A tool for hierarchical prediction of metal ion binding proteins using cluster of neural networks and sequence derived features. J. Biophys. Chem. 2, 112–123. Nakagawa, Y., Katagiri, T., Shinozaki, K., Qi, Z., Tatsumi, H., Furuichi, T., Kishigami, A., Sokabe, M., Kojima, I., Sato, S., et al. (2007). Arabidopsis plasma membrane protein crucial for Ca2+ influx and touch sensing in roots. Proc. Natl. Acad. Sci. 104, 3639–3644. Bibliography 67  Nakanawa, T., Nakamura, S., Tanaka, K., Kawamukai, M., Suzuki, T., Nakamura, K., Kimura, T., and Ishiguro, S. (2008). Development of R4 Gateway Binary Vectors (R4pGWB) Enabling High-Throughput Promoter Swapping for Plant Research. Biosci. Biotechnol. Biochem. 72, 624–629. Nicolas, W.J., Grison, M.S., Trépout, S., Gaston, A., Fouché, M., Cordelières, F.P., Oparka, K., Tilsner, J., Brocard, L., and Bayer, E.M. (2017a). Architecture and permeability of post-cytokinesis plasmodesmata lacking cytoplasmic sleeves. Nat. Plants 3. Nicolas, W.J., Grison, M.S., and Bayer, E.M. (2017b). Shaping intercellular channels of plasmodesmata: The structure-to-function missing link. J. Exp. Bot. 69, 91–103. Ordenes, V.R., Reyes, F.C., Wolff, D., Orellana, A., Ordenes, V.R., Reyes, F.C., Wolff, D., and Orellana, A. (2002). A Thapsigargin-Sensitive Ca2+ Pump Is Present in the Pea Golgi Apparatus Membrane. 129, 1820–1828. Pandey, S., Wang, R.S., Wilson, L., Li, S., Zhao, Z., Gookin, T.E., Assmann, S.M., and Albert, R. (2010). Boolean modeling of transcriptome data reveals novel modes of heterotrimeric G-protein action. Mol. Syst. Biol. 6, 1–17. Park, J.-S., Thorsness, M.K., Policastro, R., McGoldrick, L.L., Hollingsworth, N.M., Thorsness, P.E., and Neiman, A.M. (2016). Yeast Vps13 promotes mitochondrial function and is localized at membrane contact sites. Mol. Biol. Cell 27, 2435–2449. Parre, E., Ghars, M.A., Leprince, A.-S., Thiery, L., Lefebvre, D., Bordenave, M., Richard, L., Mazars, C., Abdelly, C., and Savoure, A. (2007). Calcium Signaling via Phospholipase C Is Essential for Proline Accumulation upon Ionic But Not Nonionic Hyperosmotic Stresses in Arabidopsis. Plant Physiol. 144, 503–512. Pérez-Sancho, J., Vanneste, S., Lee, E., McFarlane, H.E., Esteban Del Valle, A., Valpuesta, V., Friml, J., Botella, M.A., and Rosado, A. (2015). The Arabidopsis synaptotagmin1 is enriched in endoplasmic reticulum-plasma membrane contact sites and confers cellular resistance to mechanical stresses. Plant Physiol. 168, 132–143. Pérez-Sancho, J., Tilsner, J., Samuels, A.L., Botella, M.A., Bayer, E.M., and Rosado, A. (2016). Stitching Organelles: Organization and Function of Specialized Membrane Contact Sites in Plants. Trends Cell Biol. 26, 705–717. Petersen, N.H.T., Joensen, J., McKinney, L. V., Brodersen, P., Petersen, M., Hofius, D., and Mundy, J. (2009). Identification of proteins interacting with Arabidopsis ACD11. J. Plant Physiol. 166, 661–666. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera - A visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612. Prakriya, M., and Lewis, R.S. (2015). Store-Operated Calcium Channels. Physiol. Rev. 95, 1383–1436. Prinz, W.A. (2014). Bridging the gap: Membrane contact sites in signaling, metabolism, and organelle dynamics. J. Cell Biol. 205, 759–769. Bibliography 68  Rivas-San Vicente, M., and Plasencia, J. (2011). Salicylic acid beyond defence: Its role in plant growth and development. J. Exp. Bot. 62, 3321–3338. Ro, D.K., Mah, N., Ellis, B.E., and Douglas, C.J. (2001). Functional characterization and subcellular localization of poplar (Populus trichocarpa x Populus deltoides) cinnamate 4-hydroxylase. Plant Physiol. 126, 317–329. Saravanan, R.S., Slabaugh, E., Singh, V.R., Lapidus, L.J., Haas, T., and Brandizzi, F. (2009). The targeting of the oxysterol-binding protein ORP3a to the endoplasmic reticulum relies on the plant VAP33 homolog PVA12. Plant J. 58, 817–830. Sato, A., Sato, Y., Fukao, Y., Fujiwara, M., Umezawa, T., Shinozaki, K., Hibi, T., Taniguchi, M., Miyake, H., Goto, D.B., et al. (2009). Threonine at position 306 of the KAT1 potassium channel is essential for channel activity and is a target site for ABA-activated SnRK2/OST1/SnRK2.6 protein kinase. Biochem. J. 424, 439–448. Schapire, A.L., Voigt, B., Jasik, J., Rosado, A., Lopez-Cobollo, R., Menzel, D., Salinas, J., Mancuso, S., Valpuesta, V., Baluska, F., et al. (2008). Arabidopsis Synaptotagmin 1 Is Required for the Maintenance of Plasma Membrane Integrity and Cell Viability. Plant Cell 20, 3374–3388. Schauder, C.M., Wu, X., Saheki, Y., Narayanaswamy, P., Torta, F., Wenk, M.R., De Camilli, P., and Reinisch, K.M. (2014). Structure of a lipid-bound extended synaptotagmin indicates a role in lipid transfer. Nature 510, 552–555. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: An open-source platform for biological-image analysis. Nat. Methods 9, 676–682. Schrader, M., Godinho, L.F., Costello, J.L., and Islinger, M. (2015). The different facets of organelle interplay—an overview of organelle interactions. Front. Cell Dev. Biol. 3, 1–22. Siao, W., Wang, P., Voigt, B., Hussey, P.J., and Baluska, F. (2016). Arabidopsis SYT1 maintains stability of cortical endoplasmic reticulum networks and VAP27-1-enriched endoplasmic reticulum-plasma membrane contact sites. J. Exp. Bot. 67, 6161–6171. De Silva, K., Laska, B., Brown, C., Sederoff, H.W., and Khodakovskaya, M. (2011). Arabidopsis thaliana calcium-dependent lipid-binding protein (AtCLB): A novel repressor of abiotic stress response. J. Exp. Bot. 62, 2679–2689. Simon, M.L.A., Platre, M.P., Assil, S., Van Wijk, R., Chen, W.Y., Chory, J., Dreux, M., Munnik, T., and Jaillais, Y. (2014). A multi-colour/multi-affinity marker set to visualize phosphoinositide dynamics in Arabidopsis. Plant J. 77, 322–337. Singh, A., Bhatnagar, N., Pandey, A., and Pandey, G.K. (2015). Plant phospholipase C family: Regulation and functional role in lipid signaling. Cell Calcium 58, 139–146. Sohn, M., Ivanova, P., Brown, H.A., Toth, D.J., Varnai, P., Kim, Y.J., and Balla, T. (2016). Lenz-Majewski mutations in PTDSS1 affect phosphatidylinositol 4-phosphate metabolism at ER-PM and ER-Golgi junctions. Proc. Natl. Acad. Sci. 113, 4314–4319. Sonnhammer, E.L., von Heijne, G., and Krogh,  a (1998). A hidden Markov model for predicting transmembrane helices in protein sequences. Proc. Int. Conf. Intell. Syst. Mol. Biol. 6, Bibliography 69  175–182. Staehelin, L.A. (1997). The plant ER: A dynamic organelle composed of a large number of discrete functional domains. Plant J. 11, 1151–1165. Swarbreck, S.M., Colaco, R., and Davies, J.M. (2013). Plant Calcium-Permeable Channels. Plant Physiol. 163, 514–522. Tan, X., Wang, Q., Tian, B., Zhang, H., Lu, D., and Zhou, J. (2011). A Brassica napus lipase locates at the membrane contact sites involved in chloroplast development. PLoS One 6, e26831. Toulmay, A., and Prinz, W.A. (2012). A conserved membrane-binding domain targets proteins to organelle contact sites. J. Cell Sci. 125, 49–58. Uchiyama, A., Shimada-Beltran, H., Levy, A., Zheng, J.Y., Javia, P.A., and Lazarowitz, S.G. (2014). The Arabidopsis synaptotagmin SYTA regulates the cell-to-cell movement of diverse plant viruses. Front. Plant Sci. 5, 584. Waese, J., Fan, J., Pasha, A., Yu, H., Fucile, G., Shi, R., Cumming, M., Kelley, L., Sternberg, M., Krishnakumar, V., et al. (2017). ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology. Plant Cell 29, tpc.00073.2017. Wang, P., Hawkins, T.J., Richardson, C., Cummins, I., Deeks, M.J., Sparkes, I., Hawes, C., and Hussey, P.J. (2014). The plant cytoskeleton, NET3C, and VAP27 mediate the link between the plasma membrane and endoplasmic reticulum. Curr. Biol. 24, 1397–1405. Wang, P., Richardson, C., Hawkins, T.J., Sparkes, I., Hawes, C., and Hussey, P.J. (2016). Plant VAP27 proteins: Domain characterization, intracellular localization and role in plant development. New Phytol. 210, 1311–1326. Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., and Barton, G.J. (2009). Jalview Version 2-A multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189–1191. Wijdeven, R.H., Janssen, H., Nahidiazar, L., Janssen, L., Jalink, K., Berlin, I., and Neefjes, J. (2016). Cholesterol and ORP1L-mediated ER contact sites control autophagosome transport and fusion with the endocytic pathway. Nat. Commun. 7, 1–14. Wilhelm, L.P., Wendling, C., Védie, B., Kobayashi, T., Chenard, M., Tomasetto, C., Drin, G., and Alpy, F. (2017). STARD3 mediates endoplasmic reticulum‐to‐endosome cholesterol transport at membrane contact sites. EMBO J. 36, 1412–1433. Xu, J., Bacaj, T., Zhou, A., Tomchick, D.R., Südhof, T.C., and Rizo, J. (2014). Structure and Ca2+-binding properties of the tandem C2Domains of E-Syt2. Structure 22, 269–280. Yamazaki, T., Kawamura, Y., Minami, A., and Uemura, M. (2008). Calcium-dependent freezing tolerance in Arabidopsis involves membrane resealing via synaptotagmin SYT1. Plant Cell 20, 3389–3404. Yu, H., Liu, Y., Gulbranson, D.R., Paine, A., Rathore, S.S., and Shen, J. (2016). Extended synaptotagmins are Ca2+-dependent lipid transfer proteins at membrane contact sites. Proc. Natl. Acad. Sci. U. S. A. 113, 4362–4367. Bibliography 70  Yu, L., Nie, J., Cao, C., Jin, Y., Yan, M., Wang, F., Liu, J., Xiao, Y., Liang, Y., and Zhang, W. (2010). Phosphatidic acid mediates salt stress response by regulation of MPK6 in Arabidopsis thaliana. New Phytol. 188, 762–773. Yuan, F., Yang, H., Xue, Y., Kong, D., Ye, R., Li, C., Zhang, J., Theprungsirikul, L., Shrift, T., Krichilsky, B., et al. (2014). OSCA1 mediates osmotic-stress-evoked Ca2+increases vital for osmosensing in Arabidopsis. Nature 514, 367–371. de Zelicourt, A., Colcombet, J., and Hirt, H. (2016). The Role of MAPK Modules and ABA during Abiotic Stress Signaling. Trends Plant Sci. 21, 677–685. Zhang, K., Xia, X., Zhang, Y., and Gan, S.S. (2012). An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senescence in Arabidopsis. Plant J. 69, 667–678. Zhang, W., Qin, C., Zhao, J., and Wang, X. (2004). Phospholipase D 1-derived phosphatidic acid interacts with ABI1 phosphatase 2C and regulates abscisic acid signaling. Proc. Natl. Acad. Sci. 101, 9508–9513. Zhu, J. (2000). Update on Stress Signaling Genetic Analysis of Plant Salt Tolerance Using Arabidopsis. 124, 941–948. Zhu, J.-K. (2002). SALT AND DROUGHT STRESS SIGNAL TRANSDUCTION IN PLANTS. Annu. Rev. Plant Biol. 53, 247–273. Zhu, J.-K. (2016). Abiotic Stress Signaling and Responses in Plants. Cell 167, 313–324. Zimmermann, P. (2004). GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox. Plant Physiol. 136, 2621–2632.          Appendices 71  Appendices Appendix A: Expression level of NTMC2 genes according to RNAseq data  Table A (continue in next page): Expression levels of the NTMC2 family genes in different tissues and developmental stages. Values show absolute read counts.  Higher expression values have greener colors while lower values have redder colors; intermediate values have whiter colors.   Appendices 72    Table A: Expression levels of the NTMC2 family genes in different tissues and developmental stages. Values show absolute read counts.  Higher expression values have greener colors while lower values have redder colors; intermediate values have whiter colors.   Tissue  At3g61050 (AtCLB) At1g53590(2TMCLB) At3g14590 At1g50260 At3g19830Anthers (Opened) 1409 504 1315 908 2685Anthers (Mature flow.) 2065 320 318 254 2892Carpels (Mature flow.) 2209 661 69 266 402Stamen filaments (Mature flow.) 2976 917 153 183 2359Petals (Mature flow.) 2330 688 367 258 1288Sepals (Mature flow.) 1937 749 304 820 830Flower 2020 645 168 304 456Internode 1983 1796 462 170 773Senescent internode 2436 2900 1680 448 1322Whole leaf (Mature) 2081 1574 324 616 618SAM at 7-d 2979 878 121 271 138Meristem at 10-d 3316 1420 201 400 552Inflorescence meristem at 15-d 2169 844 42 196 231Pod of the senescent silique 2060 1103 770 2035 643Pedicel 2578 972 56 388 814Root without apex 1391 988 476 227 312Seedling cotyledons 2633 593 51 398 1288Seedling hypocotyl 1999 2145 209 337 292Seedling root 1745 1094 429 181 341Dry seeds 3650 888 6918 3112 1202Germinating seeds 3195 1038 5618 2158 1079Appendices 73  Appendix B: Alignment of 2TMCLB model with ESyt2 SMP and C2 domains.        Figure B: Ribbon diagram of the alignment between 2TMCLB model and the SMP and C2 domains of ESyt2. 2TMCLB model: grey; ESyt2 SMP: pink; ESyt2 SMP: light brown; 2TMCLB TM predicted regions: blue; disorder region: green. Appendices 74  Appendix C: Alignment of SYTF model with ESyt2 SMP and C2 domains.    Figure C: Ribbon diagram of the alignment between SYTF model and the SMP and C2 domains of ESyt2. The SMP domain of ESyt2 was aligned 3 times, each one corresponding to a SYTF C2 domain. a, front view. b, top view. SYTF model: grey; ESyt2 SMP: pink; ESyt2 SMP: shades of brown; SYTF TM predicted region: blue; disorder region: green. a b Appendices 75   Appendix D: SYT1 co-immunoprecipitation analysis shows AtCLB as interactor in vitro.         Figure D: SYT1 interacts with SYT1, SYT5 and AtCLB in vitro. Co-immunoprecipitation analysis of SYT1-GFP and SYT5-GFP using anti-GFP antibodies. Numbers represent the amount of peptide fragments obtained that match the given protein. SYT1, SYT5 and AtCLB are labelled in red. Appendices 76  Appendix E: SYT1-GFP and AtCLB localization under KCl, MgCl2 and Na2SO4 stresses.       Figure E: Subcellular localization of SYT1-GFP and AtCLB-GFP under KCl, MgCl2 and Na2SO4 treatments. White squares show 2x zoom-in regions. Pictures taken in epidermal cells of 5-days-old cotyledons. Scale bars = 10µm.  Appendices 77  Appendix F: PtdIns(4,5)P2 increases under NaCl stress and after blockage of PLC.       Figure F: PtdIns(4,5)P2 increases after NaCl or U73122 treatments. a, fluorescence of the CITRINE-2xPHPLC sensor in mock, 100mM NaCl or 50µM U73122 treatments. b, quantification of fluorescence intensity of CITRINE-2xPHPLC. N represent the numbers of cells measured on each treatment. Values represent means ± SD and are normalized with the mock. **P < 0,01 by a Student’s t-test. Scale bars = 50µm. Mock U73122 NaCl a b Appendices 78  Appendix G: HDEL-GFP subcellular localization under depletion of cytosolic Ca2+.           Figure G: Subcellular localization of HDEL-GFP after depletion of Ca2+cyt by EGTA and LaCl3. 5mM EGTA or 500µM LaCl3 incubation for 16h. Pictures taken in the cortical region of epidermal cells of 5-days-old cotyledons. Scale bars = 20µm. Mock LaCl3 HDEL-GFP EGTA Appendices 79   Appendix H: SYT1-GFP and HDEL-GFP localization upon increases of cytosolic Ca2+.           Figure H: Subcellular localization of SYT1-GFP and HDEL-GFP upon [Ca2+]cyt increases. Pictures taken in the cortical region of 5-days-old shoot epidermal cells. Scale bars = 20µm.  Appendices 80  Appendix I:  SYT1 and HDEL co-localization under NaCl stress.          Figure I: Co-localization analysis of SYT1-RFP and GFP-HDEL in NaCl Stress treatment. Pictures taken in the cortical region of 5-days-old shoot epidermal cells. Scale bars = 15µm.  Appendices 81  Appendix J:  MAPPER shows decrease of intermembrane distance upon salt stress   Figure J: NaCl promotes EPCS expansion. a, co-localization analysis of SYT1-RFP and MAPPER-GFP. b, MAPPER-GFP subcellular localization under NaCl stress and U73122 treatment. c, co-localization analysis of MAPPER-GFP and RFP-HDEL upon NaCl stress. Pictures taken in the cortical region of 5-days-old shoot epidermal cells. Scale bars a, b = 20µm; c = 15 µm. a b c 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0368556/manifest

Comment

Related Items