Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic analysis of receptor-like protein SNC2-mediated plant resistance in Arabidopsis Ding, Yuli 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_may_ding_yuli.pdf [ 9.19MB ]
Metadata
JSON: 24-1.0364581.json
JSON-LD: 24-1.0364581-ld.json
RDF/XML (Pretty): 24-1.0364581-rdf.xml
RDF/JSON: 24-1.0364581-rdf.json
Turtle: 24-1.0364581-turtle.txt
N-Triples: 24-1.0364581-rdf-ntriples.txt
Original Record: 24-1.0364581-source.json
Full Text
24-1.0364581-fulltext.txt
Citation
24-1.0364581.ris

Full Text

GENETIC ANALYSIS OF RECEPTOR-LIKE PROTEIN  SNC2-MEDIATED PLANT RESISTANCE IN ARABIDOPSIS  by  Yuli Ding  B.Sc., China Agricultural University, 2012  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in The Faculty of Graduate and Postdoctoral Studies (Botany) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) March 2018
 © Yuli Ding, 2018    ii   The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled:  GENETIC ANALYSIS OF RECEPTOR-LIKE PROTEIN SNC2-MEDIATED PLANT RESISTANCE IN ARABIDOPSIS  submitted by Yuli Ding in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Botany  Examining Committee: Dr. Yuelin Zhang, Botany Supervisor  Dr. James Kronstad, Plant Science Supervisory Committee Member  Dr. George Haughn, Botany University Examiner Dr. Richard Hamelin, Forestry University Examiner  Additional Supervisory Committee Members: Dr. Carl Douglas, Botany Supervisory Committee Member Dr. Xin Li, Botany Supervisory Committee Member   iii Abstract  Plant immunity is usually governed by two types of immune receptors: 1) pattern recognition receptors (PRRs) recognize the conserved molecular features of pathogens (pathogen-associated molecular patterns, PAMPs) and trigger PTI (PAMP-triggered immunity) and 2) nucleotide-binding and leucine-rich repeats-containing proteins (NLRs) serve as intracellular immune receptors to recognize the presence of relatively diverse pathogen effectors and trigger ETI (effector-triggered immunity). The Arabidopsis thaliana mutant snc2-1D (suppressor of npr1-1, constitutive 2) contains a gain-of-function mutation in a receptor-like protein (RLP) and displays a dwarf morphology.  Here I report the characterization of bda4-1D (bian da 4-1D), which was identified as a complete suppressor of snc2-1D dwarf morphology. Positional cloning showed bda4-1D contains a gain-of-function mutation in Non-Expressor of Pathogenesis-Related Proteins 4 (renamed npr4-4D). Functional analysis indicated NPR4, as well as its close homolog NPR3 (Non-Expressor of Pathogenesis-Related Proteins 3), function as transcriptional repressors. They function downstream of SNC2, independent of NPR1 (Non-Expressor of Pathogenesis-Related Proteins 1). In addition, salicylic acid (SA) was shown to inhibit the transcriptional activities of NPR3/4 and promote the expression of key immune regulators. The npr4-4D mutation leads to constitutive repression of SA-induced immune responses, indicating that the mutant protein can no longer respond to SA. On the other hand, the equivalent mutation in NPR1 also abolishes its ability to bind SA and renders reduced SA-induced defence gene expression. My results demonstrated that both NPR1 and NPR3/NPR4 are bona fide SA receptors, but play opposite roles in transcriptional regulation of SA-induced defence gene expression. In the independent eds5-3 snc2-1D npr1-1 suppressor screen, I report the identification and characterization of four more bda mutants, bda3-1D, bda5-1, bda6 and bda7. Cloning of BDA6 and BDA7 showed that they encode FMO1 and ALD1 respectively, which are involved in biosynthesis of N-Hydroxypipecolic Acid (NHP) and pipecolic acid. My results indicate that enzymes involved in Lysine metabolism are also important for signaling in SNC2-mediated immune pathway.  iv Overall, the studies I completed in my Ph.D. thesis expand our knowledge in understanding of the signaling pathways downstream of SNC2 as well as the general regulatory mechanisms of SA receptors in plant innate immunity.                              v Lay summary  This work aims at providing knowledge of how to protect plants from serious diseases. Using Arabidopsis thaliana as a model system, the main goal of this work is to understand how immune gene regulators, especially one of the cell-surface receptors, work at the molecular level, how they are activated or repressed, and how the positive or negative effects consequently influence the amplitude of immune responses. Part of this work represents a major breakthrough in the understanding of the perception and molecular signaling of salicylic acid, one of the most important plant immune-related phytohormones. Together with others, findings from this work will largely contribute to a better understanding of plant immune system. In addition, molecular mechanisms revealed by this work can provide sustainable solutions to crop diseases by engineering plant resistance.                    vi Preface   The chapters reported in this Ph.D. thesis describe the research results collected from September 2012 through January 2018. Below is a list of manuscripts (published or in revision) and the author contributions that comprise this thesis.   Chapter 2- Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity was modified from the manuscript: Ding, Y. *; Sun, T.*; Ao, K.; Peng, Y.; Zhang, Y.X.; Li, X.; Zhang Y. Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity. (* Co-first authors) • The candidate performed most of the experiments under the supervision of Y.Z. and wrote the relevant results and methods sections. T. S. performed the following experiments and wrote the methods: [3H]SA-binding assays; generation of pSARD1::Luc, pSARD1(mt)::Luc, and pUC19-35S-RLUC constructs; chromatin immunoprecipitation; generation of NPR3-related transgenic lines; yeast two-hybrid analysis (with the help of the candidate); RNA sample preparation for RNA-seq; qRT-PCR analysis on MC2, NAC004, RLP23 and WRKY51; generation of npr1-7 npr4-4D and qRT-PCR analysis. K. A. analyzed the RNA-seq data. Y. P. performed the co-immunoprecipitaton in N. benthamiana with constructs generated by the candidate and T. S.. Y.X. Z. carried out the snc2-1D npr1-1 suppressor screen and isolated the bda4-1D snc2-1D npr1-1. Y.Z. wrote the abstract, introduction and discussion parts of the manuscript. X.L. and Y.Z. revised the manuscript drafts.  Chapter 3- A forward genetic screen to identify novel components in the SNC2-mediated plant resistance pathway • The candidate performed all the experiments under the supervision of Y. Z..     vii Table of contents Abstract ........................................................................................................................ iii Lay summary ................................................................................................................. v Preface ......................................................................................................................... vii Table of contents ....................................................................................................... viii List of tables .................................................................................................................. x List of figures .............................................................................................................. xii List of abbreviations .................................................................................................. xiii Acknowledgements .................................................................................................. xvii 1 Introduction ................................................................................................. 1 1.1 Plant disease and plant defense systems .................................................... 1 1.2 Recognition and response at the plant cell surface .................................... 1 1.2.1 Microbial patterns and plant pattern recognition receptors ........................... 1 1.2.2 PRR activation complex ............................................................................... 2 1.2.3 PRR downstream signaling .......................................................................... 4 1.3 Pathogen effectors perturbing plant immunity ............................................ 5 1.4 Effector-triggered immunity (ETI) ................................................................. 5 1.4.1 Nucleotide-binding/leucine-rich-repeat (NLR) proteins ................................. 5 1.4.2 Recognition of pathogen effectors by NLRs ................................................. 6 1.5 Systemic acquired resistance (SAR) ............................................................ 7 1.5.1 SAR signal molecules .................................................................................. 8 1.5.2 The role of SA in SAR ................................................................................ 10 1.6 Suppressors of npr1 .................................................................................... 13 1.7 SNC2-mediated immune pathway ............................................................... 14 1.8 Thesis objectives ......................................................................................... 15 2 Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity ............................................................ 17 2.1 Summary ...................................................................................................... 17 2.2 Introduction .................................................................................................. 17  viii 2.3 Results .......................................................................................................... 20 2.3.1 Identification and characterization of bda4-1D snc2-1D npr1-1 .................. 20 2.3.2 bda4-1D carries a gain-of-function mutation in NPR4 ................................. 22 2.3.3 Arg-419 residue in NPR4 is conserved in plants......................................... 24 2.3.4 npr4-4D suppresses the expression of SARD1, CBP60g and WRKY70 ..... 25 2.3.5 The npr4-4D mutation results in compromised basal defence .................... 28 2.3.6 Loss of both NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression……. ................................................................................................................. 29 2.3.7 NPR3 and NPR4 function as transcriptional repressors that negatively regulate the expression of SARD1 and WRKY70 .............................................................. 31 2.3.8 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70 .................................................................................. 34 2.3.9 SA inhibits the transcriptional repression activity of NPR4 .......................... 38 2.3.10 NPR1 promotes the transcription of SARD1 and WRKY70 in response to SA………………. ............................................................................................................... 43 2.3.11 NPR4 functions independently of NPR1 .................................................... 47 2.3.12 Opposite roles of NPR1 and NPR4 in early defence gene expression in response to SA …………………………………………………………………………………….51 2.4 Discussion .................................................................................................... 55 2.5 Material and methods .................................................................................. 59 2.5.1 Plant Material and Growth Condition .......................................................... 59 2.5.2 Mutant characterization .............................................................................. 60 2.5.3 Genetic mapping of npr4-4D ...................................................................... 61 2.5.4 Promoter-luciferase Assay ......................................................................... 61 2.5.5 Yeast two-hybrid assay .............................................................................. 62 2.5.6 ChIP analysis ............................................................................................. 63 2.5.7 Co-immunoprecipitation ............................................................................. 63 2.5.8 Recombinant protein expression and purification ....................................... 64 2.5.9 [3H]SA-binding assay ................................................................................. 65 2.5.10 RNA-Seq analysis ..................................................................................... 66 3 A forward genetic screen to identify novel components in the SNC2-mediated plant resistance pathway ........................................................................... 70 3.1 Summary ...................................................................................................... 70  ix 3.2 Introduction .................................................................................................. 70 3.3 Results .......................................................................................................... 72 3.3.1 eds5-3 snc2-1D npr1-1 suppressor screen ................................................. 72 3.3.2 Four novel bda mutants suppress autoimmunity in eds5-3 snc2-1D npr1-1 plants………… .................................................................................................................. 74 3.3.3 BDA6 and BDA7 encode essential enzymes involved in SAR .................... 76 3.4 Discussion .................................................................................................... 79 3.5 Material and methods .................................................................................. 82 3.5.1 Plant materials and growth conditions ........................................................ 82 3.5.2 Mutant Characterization ............................................................................. 82 3.5.3 Cloning of bda mutants .............................................................................. 83 4. Conclusions and future directions ........................................................................ 86 References................................................................................................................... 92                   x List of tables  Table 2.1 Primer used in chapter 2 ............................................................................... 67 Table 3.1 Primer used in chapter 3 ............................................................................... 83                           xi List of figures Figure 2.1 bad4-1D/npr4-4D suppresses the constitutive defence responses in snc2-1D npr1-1. ................................................................................................................... 21 Figure 2.2 bda4-1D carries a gain-of-function mutation in NPR4. ................................. 23 Figure 2.3 Suppression of the dwarf morphology of snc2-1D npr1-1 by NPR3R428Q ..... 25 Figure 2.4 Repression of the expression of SARD1, CBP60g and WRKY70 by npr4-4D. ............................................................................................................................... 27 Figure 2.5 npr4-4D mutation leads to compromised basal defence and PTI................. 29 Figure 2.6 Loss of both NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression. ............................................................................................................ 30 Figure 2.7 NPR3 and NPR4 function as transcriptional repressors that negatively regulate the expression of SARD1 and WRKY70. ................................................. 32 Figure 2.8 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70. ..................................................................... 36 Figure 2.9 SA inhibits the transcriptional repression activity of NPR4 and the npr4-4D mutation abolishes SA-binding and renders SA insensitivity. ................................ 40 Figure 2.10 NPR1 promotes the expression of SARD1 and WRKY70 upon SA induction. ............................................................................................................................... 45 Figure 2.11 NPR3 and NPR4 function independently of NPR1..................................... 49 Figure 2.12 Opposite roles of NPR1 and NPR4 in early defence gene expression in response to SA. ..................................................................................................... 53 Figure 2.13 A working model of NPR1/NPR3/NPR4 in SA-induced defence activation. 59 Figure 3.1 Map of known gene mutations. .................................................................... 73 Figure 3.2 bad3-1D, bda5-1, bda6 and bda7 suppress the constitutive defense responses in eds5-3 snc2-1D npr1-1. .................................................................... 75 Figure 3.3 BDA6 encodes FMO1. ................................................................................. 77 Figure 3.4 BDA7 encodes ALD1. .................................................................................. 78 Figure 3.5 fmo1 and eds5-3 have additive effects on the suppression of the autoimmune phenotypes of snc2-1D. ......................................................................................... 80 Figure 3.6 BDA3 functions independent of EDS5 downstream of SNC2. ..................... 81   xii List of abbreviations  35S a strong constitutive promoter from Cauliflower mosaic virus (CaMV) ACD6 Accelerated Cell Death 6 ALD1 AGD2-Like Defence Response Protein 1  ANOVA Analysis of Variance Avr Avirulence AvrB Avirulence protein B; an avirulence effector from Pseudomonas syringae pv. glycinea AvrPita Avirulence protein Pita; an avirulence effector from Magnaporthe grisea AvrPto Avirulence protein Pto; an avirulence protein from Pseudomonas syringae AvrRpm1  Avirulence protein Rpm1; an avirulence protein isolated from Pseudomonas syringae pv. maculicola strain M2 AvrRpt2  Avirulence protein Rpt2; an avirulence protein isolated from Pseudomonas syringae pv. tomato AzA Azelaic Acid BAK1 BRI1- Associated Receptor Kinase 1 BIK1 Botrytis-Induced Kinase 1  BDA Bian Da; “becoming big” in Chinese BSK1 BR-Signaling Kinase 1 BTB/POZ Broad-Complex, Tramtrack, Bric-à-brac/Poxvirus, Zinc-finger bZIP basic leucine zipper  Cas9 CRISPR-associated 9 CBP60 Calmodulin Binding Protein 60 CC Coiled-Coil  CERK1 Chitin Elicitor Receptor Kinase 1 CEBiP Chitin Elicitor Binding Protein CFU Colony-Forming Unit ChIP Chromatin Immunoprecipitation  CHS Chilling Sensitive  CLV2 Clavata 2 CME Clathrin-Mediated Endocytosis  Col-0 Columbia-0, an Arabidopsis ecotype; it is also referred as wild type in  xiii this thesis work CPSF Cleavage and Polyadenylation Specificity Factor  CRCK3 Calmodulin-binding Receptor-like Cytoplasmic Kinase 3 CRISPR Clustered Regularly Interspaced Short Palindromic Repeats CSPR Receptor-like protein Required for CSP22 Responsiveness C terminal  Carboxyl terminal Cul Cullin DA Dehydroabietinal  E. coli  Escherichia coli EAR Ethylene-responsive element binding factor-associated Amphiphilic Repression ECD Ectodomain EDS Enhanced Disease Susceptibility  EF-Tu Elongation Factor Tu  EFR EF-TU Receptor  EGF Epidermal Growth Factor elf18 a conserved N-terminal epitope of the bacterial elongation factor Tu  EMS  Ethyl Methane Sulfonate; a chemical mutagen EMSA Electrophoretic Mobility Shift Assay ERF Ethylene Response Factor  ETI Effector-Triggered Immunity ETS Effector-Triggered Susceptibility FLAG  An epitope protein tag composed of a single or repeated DYKDDDDK sequence flg22 a conserved 22-amino acid epitope of the N terminus of the bacterial flagellin  FLS2 Flagellin Sensing 2 FMO1 Flavin-Dependent Monooxygenase 1 G3P Glycerol-3-Phosphate  GD Gal4 DNA-binding domain  GO Gene Ontology  GST Glutathione S-Transferase GUS β-glucuronidase H.a. Hyaloperonospora arabidopsidis  HA  Hemagglutinin; an epitope protein tag composed of a single or repeated YPYDVPDYA sequence  xiv His Histidine ICS Isochorismate Synthases  INA 2,6-dichloroisonicotinic acid LD-VP16 LexA DNA-binding domain-VP16 activation domain Ler  Landsberg erecta; an Arabidopsis ecotype LRR Leucine-Rich Repeat  Luc firefly luciferase LysM Lysine motif MAPK Mitogen-Associated Protein Kinase MBP Maltose-Binding Protein MeSA Methyl salicylate  mRNA messenger RNA  MS  Murashige and Skoog NADPH  Nicotinamide adenine dinucleotide phosphate NB-LRR  Nucleotide Binding-Leucine Rich Repeat NDR1 Non-race-specific Disease Resistance 1 NHP N-Hydroxypipecolic Acid NIMIN1 NIM1-Interacting 1 NLP Necrosis and ethylene-inducing peptide1-like protein NLR Nucleotide-binding/leucine-rich-repeat  N terminal Amino Terminal NPR Non-Expressor of Pathogenesis-Related Proteins OD Optical Density P2C Δ1-piperideine-2-carboxylic acid  PAD4 Phytoalexin Deficient 4 PAL Phenylalanine ammonia-lyase  PAMP Pathogen-associated molecular pattern PBL PBS1-LIKE  PCRK PTI Compromised Receptor-like Cytoplasmic Kinase PEPR1 PEP receptor 1 Pip Pipecolic acid  PR Pathogenesis-related  PRR Pattern recognition receptor P.s.m. Pseudomonas syringae pv. maculicola  P.s.t. Pseudomonas syringae pv. tomato  xv PTI PAMP-triggered immunity  pv  Pathovar qRT-PCR  Quantitative Reverse Transcriptase PCR  R Resistance RbohD Respiratory Burst Oxidase Homolog D ReMax Receptor of eMax RIN4 RPM1-Interacting Protein 4 RLCK Receptor-like cytoplasmic kinase RLK Receptor-like kinase RLP Receptor-like protein RLUC Renilla luciferase ROS Reactive oxygen species  RPM1  Resistance to P. syringae pv. maculicola 1 RPS2 Resistant to P. syringae 2 RPS4 Resistant to P. syringae 4 RRS1  Resistance to R. solanacearum 1 SA Salicylic acid SAG SA O-β-glucoside  SAG101 Senescence Associated Gene 101 SAR Systemic acquired resistance  SARD Systemic acquired resistance deficient  SERK Somatic embryogenesis receptor kinase SNC Suppressor of npr1-1, constitutive  SOBIR1 Suppressor of BIR1  SRFR1 Suppressor of rps4-RLD 1 SsE1 Sclerotinia sclerotiorum Elicitor-1 SUMM2 Suppressor of mkk1 mkk2 2 T-DNA Transfer DNA TIR Toll/interleukin-1 Receptor TMM Too Many Mouths TMV Tobacco mosaic virus  TNV Tobacco necrosis virus TTSS Type III secretion systems     xvi Acknowledgements  Many people have contributed to this research project and I feel immensely fortunate and grateful for the scientific and personal support I have received throughout my degree. First and foremost, I would like to thank my supervisor, Dr. Yuelin Zhang. His diligence to work has strongly motivated me to work through all the difficulties in science during my Ph.D.. His availability in the lab allowed me to discuss questions or to explore new puzzles efficiently with him whenever they arose. My projects would not have gone so smoothly without his patient supervision. As a bonus, a five-year training on lab management has also helped me build up some very useful skills and connections.  Thanks to my committee members, Dr.  Xin Li, Dr. James Kronstad and Dr. Carl Douglas, for their advice and guidance during the course of my degree. Thanks to my graduate advisor, Dr. Ljerka Kunst, for her enthusiasm and for the many ways she has encouraged and supported me.  Thanks to all the past and current lab members. The Zhang lab has been a wonderful place to work, from China to Canada. Without exception, I am grateful to everyone I have met. I would like to give special thanks to Dr. Yaxi Zhang, for all the previous work she has done for my project and her mentorship in genetic screening. Thanks to Tongjun Sun, Yujun Peng, Kevin Ao and Weijie Huang for their contributions to my projects. I really appreciate it. Lastly, I would also like to thank all the Li Lab members who provided me with lots of support and help that allowed me to finish my degree successfully. I feel extremely lucky to be involved in the wonderful PRoTECT (Plant Responses To Eliminate Critical Threats) program with Georg-August-University in Goettingen, Germany. Many thanks to Prof. Dr. Ivo Feussner and Mr. Dmitrij Rekhter. The SARD4 project would not be accomplished so nicely without this fantastic collaboration. Thanks to all the staff, faculty members and students in the PRoTECT program, as well as all the Feussner lab members, for being such terrific hosts. I am pleased that we had the opportunity to work together and discuss science.  xvii Thanks to Biol112 teaching team, especially to Ms. Karen Smith, for showing me what great leadership is like and being a role model for teaching. I am very happy to see my growth in my teaching abilities and I am really thankful for the freedom and supportive environment this course provided.  I am grateful to the Chinese Scholarship Council (CSC) for the major financial support during my Ph.D. as well as other resources including TAship, Dewar Cooper Doctoral Scholarship and Natural Sciences and Engineering Research Council of Canada (NSERC). Thank you to my parents, for their understanding and support throughout my degree. I would not have thought about studying aboard without their initial encouragements. Thanks to all my friends, especially the new ones I met in Vancouver, for your kindness and for great times. Your friendship made my life so colourful in the past five years. Last but not least, I would like to thank Dr. Pingtao Ding, not only for his mentorship during my Ph.D., but mostly for his love and huge mental support during some really difficult periods. Thanks for having faith in me all the time.  1 1 Introduction  1.1 Plant disease and plant defense systems  Plant diseases contribute greatly to annual crop losses and pose a real threat to food security worldwide. One of the most often cited examples is the Great Irish Famine in the 19th century as the result of potato late blight epidemic caused by Phytophthora infestans. This disease not only caused the deaths of over one million people, but it also led to a mass emigration out of Ireland into North America. The Irish potato famine is of specific importance because disputes about the cause of the rotted potatoes over decades finally gave birth to the science of plant pathology (Holub 2001; Judelson and Blanco 2005). Nevertheless, many food-and cash-crops, such as wheat, rice, maize, soybean, barley, potato, cotton, canola, and others are still under threat of many different types of diseases.  Even though plants are host to every type of microbial pathogen (including fungi, oomycetes, bacteria, and viruses), plants have evolved complicated immune systems to combat pathogen infections. Physical barriers on the plant surface, such as epidermal hairs, wax layers and the cell wall, can prevent the initial establishment of pathogens (Thordal-Christensen 2003). Additionally, anti-microbial enzymes and other specialized metabolites present in the apoplast compose a chemical barrier to limit pathogen invasion (Heath, 2000). However, adapted pathogens can bypass those barriers to colonize host plants. When these pathogens are recognized by plant immune receptors, a two-branched innate immune system is activated (Jones and Dangl, 2006).   1.2 Recognition and response at the plant cell surface  1.2.1 Microbial patterns and plant pattern recognition receptors  The first active line of plant defence is governed by the recognition of evolutionarily conserved pathogen–associated molecular patterns (PAMPs), such as   2 fungal chitin or flagellin from bacteria. PAMPs are usually essential for microbial lifecycles, making them ideal targets for detection by immune receptors. PAMPs are recognized by pattern recognition receptors (PRRs) and trigger profound physiological changes in plant cells resulting in PAMP-triggered immunity (PTI) (Boller and Felix, 2009). Plant PRRs are typically trans-membrane receptor-like kinases (RLKs) or receptor-like proteins (RLPs) (Boller and Felix, 2009). Both RLKs and RLPs comprise an extracellular ectodomain (ECD) and a transmembrane domain, but RLPs lack a C-terminal intracellular kinase domain. According to domains or motifs in the ECDs, PRRs can be classified into different subfamilies: leucine-rich repeat (LRR) domain, lysine motifs (LysM), lectin domain, or epidermal growth factor (EGF)-like domain (Dangl and Jones 2001; Couto and Zipfel 2016; Tang et al. 2017). All known LRR-containing PRRs bind proteins or peptides. For example, the Arabidopsis bacterial flagellin receptor, LRR-RLK FLAGELLIN SENSING2 (FLS2) binds a conserved 22-amino acid epitope (flg22) of the N terminus of the bacterial flagellin (Chinchilla et al. 2006). EF-TU RECEPTOR (EFR) recognizes a conserved N-terminal epitope (elf18) of the bacterial elongation factor Tu (EF-Tu) (Zipfel et al. 2006). Several LRR-RLPs have been shown to recognize proteinaceous patterns. Arabidopsis RLP23 specifically binds and recognizes nlp20, a conserved 20-amino-acid fragment from necrosis and ethylene-inducing peptide1-like proteins (NLPs), which are widely produced by multiple prokaryotic (bacterial) and eukaryotic (fungal, oomycete) species (Albert et al., 2015). In tobacco (Nicotiana benthamiana), the LRR-RLP RECEPTOR-LIKE PROTEIN REQUIRED FOR CSP22 RESPONSIVENESS (CSPR) confers resistance to the epitope csp22 derived from bacterial cold shock protein (Saur et al., 2016).   1.2.2 PRR activation complex  Ligand-induced dynamic rearrangement of PRR complexes with co-receptors and other regulatory proteins ensures prompt signaling activation and attenuation. Upon ligand binding, PRRs of the LRR-RLK class recruit BRI1- ASSOCIATED RECEPTOR   3 KINASE (BAK1), a member of SOMATIC EMBRYOGENESIS RECEPTOR KINASES (SERKs) family (Couto and Zipfel 2016). For example, FLS2 and BAK1 form heterodimers in the presence of flg22, which results in rapid phosphorylation of both FLS2 and BAK1 and activation of downstream signaling events (Chinchilla et al. 2007; Schulze et al. 2010). Molecular and genetic studies showed that SERKs are also required for signaling mediated by EFR and XA21 receptor in rice, which recognizes conserved protein in many Xanthomonas species (Schulze et al. 2010; Chen et al. 2014; Song et al. 1995). As LRR-RLPs do not carry a cytoplasmic kinase domain. They associate with RLKs to transmit the signal to downstream components. In rice, chitin binding to LysM-RLP CEBiP recruits CHITIN ELICITOR RECEPTOR KINASE 1 (CERK1) to form a heterocomplex for signaling (Shimizu et al. 2010). The LRR-RLK SUPPRESOR of BIR1 (SOBIR1) has been shown to function as a common adaptor for a number of LRR-RLP-type PRRs (Gust and Felix 2014). SOBIR1 constitutively associates with tomato Ve1 and Cf4 as well as Arabidopsis RLP23 in a ligand-independent manner (Liebrand et al. 2013; Albert et al. 2015). In addition, SOBIR1 also associates with RLP30, which is involved in the perception of elicitor SCLEROTINIA SCLEROTIORUM ELICITOR-1 (SsE1) from Sclerotinia sclerotiorum (Zhang et al. 2013). Therefore, LRR-RLPs form a complex with adaptor RLK before ligand binding and then recruit SERK family members to form an active receptor complex upon ligand binding. A number of receptor-like cytoplasmic kinases (RLCKs) have emerged as essential components linking PRRs to downstream defence. The best studied BOTRYTIS-INDUCED KINASE1 (BIK1) associates with FLS2 and BAK1 in the absence of ligand. Upon flg22 elicitation, BIK1 is phosphorylated and then dissociates from the PRR complex to activate downstream signaling (Lu et al. 2010; J. Zhang et al. 2010). Additional Arabidopsis RLCKs, including PBS1-LIKE1 (PBL1), PBS1-LIKE27 (PBL27), PCRKs, and BR-signaling kinase 1 (BSK1), have also been shown to play important roles in pattern-triggered immunity by directly interacting with PRRs (J. Zhang et al. 2010; Shinya et al. 2014; Kong et al. 2016; Shi et al. 2013).      4 1.2.3 PRR downstream signaling  Upon PAMP recognition, a series of cellular events are triggered in minutes, including production of reactive oxygen species (ROS), activation of mitogen-associated protein kinases (MAPK) cascade, increase calcium influx and anion effluxes as well as extracellular alkalization (Boller and Felix 2009). Extracellular ROS is proposed to act as a cross-linker of plant cell wall components as well as a secondary messenger to trigger downstream immune responses (Lamb and Dixon 1997). In Arabidopsis, the plasma-membrane localized NADPH oxidase RESPIRATORY BURST OXIDASE HOMOLOG D (RbohD) is essential for pattern-triggered ROS production (Torres et al. 2005). RbohD is constitutively associated with the PRR complex at the plasma membrane. Within this complex, the plasma-membrane-associated BIK1 directly binds and rapidly phosphorylates RbohD upon PAMP perception (Kadota et al. 2014; Li et al. 2014).  MAPK cascades are conserved modules in all eukaryotes. They are composed of three sequentially activated kinases, a MAPK kinase kinase (MAPKKK or MEKK), a MAPK kinase (MAPKK or MKK) and a MAPK (MPK). Two canonical MAPK cascades have been shown to play crucial roles downstream of PTI in regulating defence gene expression and phytoalexin biosynthesis (Meng and Zhang 2013). One is known to positively regulate plant defence, with an unknown MAPKKK, MKK4/MKK5 (two redundant MAPKKs) and MPK3/MPK6 (two partially redundant MAPKs). Upon activation, MPK3 and MPK6 further induce massive transcriptional programming via phosphorylation of different transcription factors, such as WRKY33 and ETHYLENE RESPONSE FACTOR6 (ERF6) (Asai et al. 2002). Both have been identified as direct substrates of MPK3 and MPK6 to promote biosynthesis of camalexin and indole glucosinolates respectively (Ren et al. 2008; Mao et al. 2011; Xu et al. 2016).  The other cascade, MEKK1-MKK1/MKK2-MPK4 was originally considered to negatively regulate plant immune responses as loss of function mutants of MEKK1, MKK1/MKK2, and MPK4 all exhibit constitutive defence responses (Petersen et al. 2000; Gao et al. 2008). Analysis of mkk1 mkk2 suppressor mutants revealed the autoimmune phenotypes in the mutants of this cascade are actually caused by activation of defence responses mediated by the intracellular nucleotide-binding/leucine-rich-repeat (NLR)   5 protein SUMM2 (SUPPRESSOR OF mkk1 mkk2 2)(Zhang et al. 2012). Further studies showed that the MEKK1-MKK1/MKK2-MPK4 cascade promotes basal resistance against pathogens and is guarded by SUMM2, which monitors the phosphorylation status of MPK4 substrate CRCK3 (Calmodulin-binding receptor-like cytoplasmic kinase 3) (Zhang et al. 2017).   1.3 Pathogen effectors perturbing plant immunity  Adapted pathogens usually deliver a suite of effectors into the plants, which promotes pathogen virulence and results in effector-triggered susceptibility (ETS) in host plants (Jones and Dangl 2006). Plant pathogenic bacteria deliver effectors into host cells using type III secretion systems (TTSS). Some fungal and oomycete effectors have also been detected intracellularly.  A large number of effectors in plant pathogens have been cloned. Many of them contribute to virulence by targeting different components of the PTI pathways to suppress plant defence response. For example, Pseudomonas syringae effector AvrPto directly targets and inhibits the kinase activities of PRRs, such as FLS2 and EFR, thus blocking PAMP-induced immunity in Arabidopsis (Xiang et al. 2008). In addition, MAPK cascades are directly targeted by pathogenic effectors. Pseudomonas HopAI1 effector protein inactivates MPK3 and MPK6 to promote virulence (Zhang et al. 2007) and MPK4 was shown to be an additional virulence target of HopAI1 (Zhang et al. 2012). Together, these examples demonstrate that by secreting effectors, pathogens have employed various mechanisms to evade host perception and suppress host defence responses.  1.4 Effector-triggered immunity (ETI)  1.4.1 Nucleotide-binding/leucine-rich-repeat (NLR) proteins  Pathogen effectors are recognized by specific disease resistance (R) genes. Most R genes were found to encode NLR proteins. Genome-wide analysis revealed that   6 there are around 150 NLR coding genes in Arabidopsis, which mainly fall into two distinct groups: TIR-NB-LRR (TNL) group with an N-terminal Toll and interleukin-1 (TIR)-like domain, and CC-NB-LRR (CNL) group with an N-terminal coiled-coil domain (Meyers et al. 2003). TNLs, such as SNC1 (Suppressor of npr1-1, constitutive 1) and RPS4 (RESISTANT TO P. syringae 4)/RRS1 (Resistance to R. solanacearum 1), require the lipase-like family proteins EDS1 (Enhanced Disease Susceptibility 1) / PAD4 (Phytoalexin Deficient 4) and SAG101 (Senescence Associated Gene 101) complex for signaling (Aarts et al. 1998; Feys et al. 2005). Several TNLs appear to act in the nucleus, but some well-characterized CNLs, such as RPM1 (RESISTANCE TO P. syringae pv. maculicola 1) and RPS2 (RESISTANT TO P. syringae 2), are associated with the cell membrane and require NDR1 (Non-race-specific Disease Resistance 1) for their functions (Aarts et al. 1998).   1.4.2 Recognition of pathogen effectors by NLRs  Harold Flor’s studies on the genetic relationships between races of flax rust fungus and a number of flax varieties in 1940s raised the gene for gene hypothesis: the resistant variant of the plant has a gene for resistance in correspondence to the avirulence (Avr) gene of pathogens (Flor 1971). This classic gene-for-gene model was supported by various studies showing that plant NLRs directly interact with the products of Avr genes. For example, rice NLR protein Pita detects effector AvrPita from rice blast fungus, Magnaporthe grisea by direct protein-protein interaction (Jia et al. 2000). However, a number of cases indicated the perception of pathogen effectors by NLRs is mostly indirect as physical interactions cannot be detected between various R-Avr combinations. In 1998, Eric Van der Biezen and Jonathan Jones proposed the guard model. It predicts that NLRs “guard” (ie monitor the integrity of) the virulence target (guardee) of the effector to activate defence after detection of effector-induced modifications (Van der Biezen and Jones 1998; Dangl and Jones 2001). A well-established example of such a pathogen-modified protein in plants is RIN4 (RPM1-INTERACTING PROTEIN 4).   7 RIN4 is localized to the plasma membrane, and is monitored by the likewise localized CNLs, RPM1 and RPS2. P. syringae effectors AvrB and AvrRpm1, target RIN4 and lead to its phosphorylation which triggers the activation of RPM1 (Chung et al. 2011; Liu et al. 2011). Another P. syringe effector AvrRpt2 cleaves RIN4, activating RPS2-mediated immunity (Axtell and Staskawicz 2003; Chung et al. 2011; Mackey et al. 2003). In an elaboration of the guard model, the newly proposed decoy model implies that the plants could evolve guarded decoys that had lost their original functionality and now only functioned as “effector baits” (van der Hoorn and Kamoun 2008). As an example, the Xanthomonas campestris pv vesicatoria effector AvrBs3 functions as a transcription factor and binds to the promoter of the resistance gene Bs3 (pBs3) in resistant pepper plants. Bs3 encodes a flavin monooxygenase but the expression of Bs3 has not been detected in the absence of AvrBs3 (Römer et al. 2007). These data suggested that effector target, such as pBs3, is a decoy which only functions in the detection of the effector by the NLRs and itself has no critical role during the development of disease or resistance (Zhou and Chai 2008; van der Hoorn and Kamoun 2008). Altogether, the guard and decoy models describe efficient mechanisms by which a plant can use a limited repertoire of NLRs to recognise a multitude of pathogens via specifically guarding a limited number of host proteins.  1.5 Systemic acquired resistance (SAR)  After the defence response is activated locally, a secondary immune response is activated in distal tissue of plants, named systemic acquired resistance. The history of SAR can be retraced back to early 20th century. In 1901, Beauverie and Ray independently realized that plants previously infected by a pathogen could better resist further infection (Beaunerie 1901; Ray 1901). In 1933, Chester reviewed over 200 published studies and raised the theory of physiological acquired immunity (Chester 1933). In the 1960s, Ross showed that tobacco plants challenged with tobacco mosaic virus (TMV) developed increased resistance to secondary infection in distal tissues. Moreover, the infected tobacco plants also showed resistance against tobacco necrosis virus (TNV) and some other bacterial pathogens (Ross 1961). This spread of resistance   8 throughout the plant’s tissues was later termed systemic acquired resistance. The resistance conferred is long-lasting and effective against a broad-spectrum of pathogens including viruses, bacteria, fungi, and oomycetes (Ryals et al. 1996; Sticher et al. 1997).  Associated with SAR is the expression of a set of genes called SAR genes. Most of the SAR genes encode proteins whose presence or activity is tightly correlated with maintenance of the resistance state. Analysis of SAR proteins showed that many belong to the class of pathogenesis-related (PR) proteins (Van Loon and Van Strien 1999). PR proteins were originally identified as novel proteins accumulating after TMV infection of tobacco leaves (Van Loon and Van Kammen 1970). Although many PR proteins have antimicrobial properties in vitro (Van Loon and Van Strien 1999), the role of each PR protein in establishing SAR has not been clearly defined. Nevertheless, PR genes still serve as useful molecular markers for the onset of SAR. In Arabidopsis, the widely-used marker genes are PR1, PR2, and PR5 (Uknes et al. 1992).  1.5.1 SAR signal molecules  For SAR to be activated in the systemic tissue, a signal must be generated in the inoculated tissue and transported systemically via the vascular system, generally the phloem (Vlot et al. 2008; Shah 2009). Early grafting experiments have supported this idea, showing that a primary infected leaf of a plant can produce a systemic signal that is graft transmissible from the rootstock to scion (Dean and Kuć 1986; Jenns and Kuc 1979). While this signal is not species specific, the nature of the mobile signal has been a subject of controversy for many years.   1.5.1.1 Salicylic acid (SA)  SA was proposed as the first candidate of mobile signal for SAR as significant amounts of SA was detected in the phloem and systemic leaves (Métraux et al. 1990; Yalpani et al. 1991). Compelling evidence supporting this idea also comes from the labeling studies in TMV-infected tobacco, which showed that 69% of the SA   9 accumulated systemically was made and exported from the inoculated leaf (Shulaev et al. 1995; Molders et al. 1996).  However, there is clear evidence arguing against SA being the mobile signal. The strongest evidence comes from the grafting experiment in tobacco between wild-type scions and nahG-expressing rootstocks. The bacterial gene nahG, encoding salicylate hydroxylase, removes SA by conversion to catechol (Friedrich et al. 1995). Although the nahG-expressing rootstock is not able to accumulate SA, the chimeric plants containing a wild type scion grafted onto this SA-deficient rootstock was still able to develop SAR (Vernooij et al. 1994). This result suggests that either SA is not the long-distance signal or very small amount of SA in infected leaves are sufficient for full SAR induction.  1.5.1.2 Other putative long-distance signals  Continued efforts to identify the phloem-mobile SAR signal have implicated more candidates, including a methylated derivative of SA (MeSA), a glycerol-3-phosphate (G3P)-dependent signal, a lipid-based signal molecule, the dicarboxylic acid, azelaic acid (AzA), the abietane diterpenoid, dehydroabietinal (DA), and the amino acid-derivative pipecolic acid (Pip) (Park et al. 2007; Chanda et al. 2011; Maldonado et al. 2002; Jung et al. 2009; Chaturvedi et al. 2012; Návarová et al. 2012). Some of these signals work cooperatively to activate SAR and/or regulate MeSA metabolism (Dempsey and Klessig 2012). However, Pip, a product of lysine derivative, appears to activate SAR via an independent pathway in the systemic tissue (Bernsdorff et al. 2016) . Pip accumulates in local and systemic leaves after pathogen infection in Arabidopsis. AGD2-Like Defence Response Protein 1 (ALD1), which is required for SAR, was shown to be also required for pathogen-induced Pip accumulation. ALD1 functions as an aminotransferase, which converts lysine to the precursor of Pip, Δ1-piperideine-2-carboxylic acid (P2C). P2C is further reduced by the reductase SARD4 (SYSTEMIC ACQUIRED RESISTANCE DEFICIENT 4) to produce Pip (Ding et al. 2016; Hartmann et al. 2017).    10 Arabidopsis FMO1 (Flavin-Dependent Monooxygenase 1) is also required for SAR (Koch et al. 2006; Mishina and Zeier 2006). Overexpression of FMO1 results in constitutive defence responses, which requires both ALD1 and SARD4 (Koch et al. 2006; Ding et al. 2016). Interestingly, the pathogen-induced level of is increased in the fmo1 mutant (Návarová et al. 2012; Ding et al. 2016), suggesting it may be involved in the synthesis of a defence signal molecule derived from Pip. A very recent study showed that FMO1 functions as a pipecolate N-hydroxylase, catalyzing the biochemical conversion of Pip to N-Hydroxypipecolic Acid (NHP) (Hartmann et al. 2018)  1.5.2 The role of SA in SAR  Despite that fact that it is unlikely that the mobile signal for SAR is SA, SA plays key roles in both local defence and SAR signaling. Exogenous SA can induce SAR and SAR gene expression (White 1979; Ward et al. 1991; Uknes et al. 1992) while mutants with defects in SA accumulation are compromised in SAR, indicating that SA accumulation is required for SAR induction (Wildermuth et al. 2001; Cao et al. 1994).  1.5.2.1 SA synthesis  SA in plants can be generated via two distinct pathways, the isochorismate (IC) and the phenylalanine ammonia-lyase (PAL) pathways. Both pathways require the primary metabolite chorismate, the end product of the shikimate pathway, to produce SA (Dempsey et al. 2011). Chorismate-derived L-phenylalanine can be converted into SA via either benzoate intermediates or coumaric acid via a series of enzymatic reactions initially catalyzed by PAL enzymes. Chorismate can also be converted into SA via isochorismate catalyzed by isochorismate synthases (ICS) (Lee et al. 1995; Wildermuth et al. 2001; Strawn et al. 2007; Garcion et al. 2008). Homologs of ICS and PAL genes are present throughout the plant kingdom, including Arabidopsis, tobacco, tomato, poplar, sunflower, and pepper (Wildermuth et al. 2001; Cochrane et al. 2004; Uppalapati et al. 2007; Catinot et al. 2008; Yuan et al. 2009; Sadeghi et al. 2013; Kim and Hwang 2014), suggesting that these two SA biosynthesis pathways are   11 evolutionary conserved. Arabidopsis quadruple PAL mutants, in which PAL activity is reduced to 10%, show lower SA accumulation (50%) compared to the wild type upon pathogen infection (Huang et al. 2010). On the other hand, Arabidopsis encodes two ICS enzymes. Mutations in ICS1 lead to an approximately 90% loss of SA accumulation induced by pathogens or UV light (Wildermuth et al. 2001). The appearance of residual SA in an ics1 ics2 double mutant confirms that the ICS pathway is not the only source of SA in Arabidopsis (Garcion et al. 2008). Therefore, the ICS pathway is the major route for SA biosynthesis during plant immunity although contribution of the PAL pathway is still evident.  In chloroplasts, ICS catalyzes the conversion of chorismate into isochorismate, which is further converted to SA (Wildermuth et al. 2001; Strawn et al. 2007; Garcion et al. 2008; Dempsey et al. 2011). SA export from chloroplasts is likely to be mediated by the MATE-transporter EDS5 (ENHANCED DISEASE SUSCEPTIBILITY 5) (Serrano et al. 2013). Since SA accumulation is compromised in eds5 mutants, this export seems to be important for SA accumulation and distribution in the cell (Nawrath et al. 2002; Ishihara et al. 2008). Most of the SA produced in planta is converted into SA O-β-glucoside (SAG) by a pathogen-inducible SA glucosyltransferase (Lee and Raskin 1998; Lee and Raskin 1999; Song 2006). SAG is actively transported from the cytosol into the vacuole (Dean and Mills 2004; Dean et al. 2005), where it may function as an inactive storage form that can be converted back to SA.  1.5.2.2 Regulation of SA biosynthesis  Salicylic acid biosynthesis is tightly regulated since constitutive SA accumulation has a detrimental effect on plant fitness. The CaM-binding transcription factor CBP60g (CALMODULIN BINDING PROTEIN 60g) and its homolog SARD1 (SYSTEMIC ACQUIRED RESISTANCE DEFICIENT 1) were found to promote pathogen-induced SA synthesis by regulating ICS1 transcript (Wang et al. 2009; Y. Zhang, Xu, et al. 2010; Wang et al. 2011; Wan et al. 2012). CaM-binding is required for CBP60g function, whereas SARD1 does not appear to be a CaM-binding protein (Wang et al. 2009).   12 Despite this difference, CBP60g and SARD1 are partially redundant in regulating ICS1 expression and SA accumulation during immunity (Y. Zhang, Xu, et al. 2010; Wang et al. 2011). Another close homolog of CBP60g, CBP60a, negatively regulates ICS1 expression upon CaM-binding (Truman et al. 2013). Therefore, regulation of SA synthesis involves multiple level of control. In the absence of pathogen, CBP60a is repressing immunity while CBP60g and SARD1 have low activity. Upon pathogen infection, CBP60g and SARD1 bind to the ICS1 promoter and activate its expression and release the negative regulation by CBP60a.  1.5.2.3 SA-mediated signaling  Signaling downstream of SA is largely regulated via NON-EXPRESSOR OF PATHGENESIS-RELATED PROTEINS 1 (NPR1). Mutations in NPR1 lead to an almost complete loss of SA-induced PR gene expression and enhanced susceptibility to biotrophic pathogens (Cao et al. 1994; Shah et al. 1997; Volko et al. 1998; Dong 2004). NPR1 contains a BTB/POZ (Broad-Complex, Tramtrack, Bric-à-brac/Poxvirus, Zinc-finger) domain, an ankyrin-repeat domain and a nuclear localization signal (Cao et al. 1997; Ryals et al. 1997). Functional studies have shown that accumulation of NPR1 in the nucleus after treatment with SAR inducers is essential for PR gene induction (Mou et al. 2003). Yeast two-hybrid screens have revealed direct interactions between NPR1 and several members of the TGA family of basic leucine zipper (bZIP) transcription factors. In Arabidopsis, NPR1 interacts specificity for TGA2, TGA3, TGA5, and TGA6 (Zhang et al. 1999; Zhou et al. 2000; Kim and Delaney 2002). Reverse genetic analysis revealed that the tga2 tga5 tga6 triple mutant has phenotypes similar to npr1, showing compromised SAR and decreased tolerance to high concentrations of SA (Zhang, Tessaro, et al. 2003). All three genes must be inactivated to observe the phenotype, indicating that TGA2, TGA5, and TGA6 play essential and redundant roles in the induction of SAR. As transcription factors, TGA proteins bind to the consensus DNA sequence TGACG, which is found in promoters of genes activated during defence, such as Arabidopsis PR1 (Katagiri et al. 1989; Lebel et al. 1998). Electrophoretic mobility   13 shift assays (EMSA) confirmed that TGA2 binds to the promoter of PR1 (Zhang et al. 1999; Després et al. 2000). Furthermore, binding of TGA2 was enhanced by the addition of NPR1, suggesting that NPR1 functions as a transcriptional activator (Després et al. 2000).   1.6 Suppressors of npr1   To identify other components of SAR signaling, several genetic screens in Arabidopsis have been conducted to look for suppressors of npr1. One screen used a transgenic line expressing the GUS (β-glucuronidase) reporter gene driven by the promoter of PR2 in the null allele of NPR1, npr1-1 (Li et al. 2001). Unlike npr1-1, the suppressor mutants showed constitutive or SA-inducible GUS activity. Interestingly, a number of autoimmune mutants were isolated from the screen. They generally exhibit phenotypes including dwarfism, elevated SA levels, constitutive expression of defence genes and enhanced disease resistance to pathogens, and in some cases with spontaneous lesion formation (van Wersch et al. 2016).  To date, four snc (suppressor of npr1-1, constitutive) mutations have been cloned and further characterized. snc1 contains one single amino acid change in a TNL, which leads to over-accumulation of the SNC1 protein and activation of defence responses (Zhang, Goritschnig, et al. 2003; Cheng et al. 2011). Similarly, snc6-1D contains a gain-of-function mutation in an atypical TNL, CHILLING SENSITIVE 3 (CHS3), with an extra LIM domain on its C terminus (Bi et al. 2011). snc2-1D contains a gain-of-function mutation in a LRR-RLP (Y. Zhang, Yang, et al. 2010). Besides the gain-of-function mutations in plant immune receptors, SNC5/SRFR1 (SUPPRESSOR OF RPS4-RLD 1) was identified as a negative regulator involved in regulating SNC1 protein levels (Li et al. 2010). Overall, the studies of snc mutants provided new knowledge input in plant immunity. More importantly, the distinct morphological phenotypes caused by autoimmunity serves as a nice tool for genetic analysis or screens.       14 1.7 SNC2-mediated immune pathway  SNC2 encodes a LRR-RLP with an extracellular LRR domain, a transmembrane domain and a short cytoplasmic tail with only four amino acids. The snc2-1D mutation (G412R) in the conserved GXXXG motif of the trans-membrane domain leads to a constitutively activated defence response. Loss of function of SNC2 results in enhanced susceptibility to virulent bacteria strain Pseudomonas syringae pv tomato (P.s.t.) DC3000 and the type III secretion deficient bacteria strain P.s.t. DC3000 hrcC-, indicating that SNC2 plays an important role in basal resistance and PTI (Y. Zhang, Yang, et al. 2010).  To dissect signal transduction pathways downstream of SNC2, a suppressor screen was performed in the snc2-1D npr1-1 background. BDA1 (for Bian Da; “becoming big” in Chinese) encodes a novel protein with N-terminal ankyrin-repeat and domain and C-terminal trans-membrane domains. Loss-of-function mutations in BDA1 suppress the dwarf morphology and constitutive defence responses in snc2-1D npr1-1 and result in enhanced susceptibility to pathogens. By contrast, a gain-of-function allele of BDA1, bda1-17D, constitutively activates cell death and defence responses, suggesting that BDA1 is a critical regulator of plant immunity. However, the biochemical function of BDA1 as well as the mechanism of how BDA1 regulates plant defence response is still largely unknown (Y. Zhang, Yang, et al. 2010; Yang et al. 2012). BDA2 encodes the transcription factor WRKY70. WRKY70 was shown to play complex roles in modulating defence responses and senescence (Li et al. 2004; Knoth et al. 2007; Besseau et al. 2012). Interestingly, free SA levels in wrky70 snc2-1D npr1-1 are comparable to those in snc2-1D npr1-1, suggesting that WRKY70 functions in an SA-independent pathway downstream of SNC2. Additionally, the partial suppression of the autoimmune phenotype of snc2-1D npr1-1 by eds5-3 mutation also supports the presence of SA-independent pathway downstream of SNC2 (Y. Zhang, Yang, et al. 2010).       15 1.8 Thesis objectives   As newly discovered PRRs, the signaling pathways mediated by LRR-RLPs are still largely unknown compared with LRR-RLKs. The autoimmune RLP mutant in Arabidopsis, snc2-1D, provides a nice platform to conduct genetic analysis. The reported studies of bda mutants showed the characterization of these mutants are of great use in dissecting signaling pathways downstream of SNC2.  The primary aim of this research is to further dissect signaling pathways downstream of SNC2. The specific objectives of my research were: (1) to screen for novel suppressors of snc2-1D to identify signaling components involved in the SNC2-mediated resistance pathway and (2) to characterize the isolated suppressor mutants, identify mutated genes and decipher the mechanism of how these proteins regulate plant defence responses downstream of SNC2. In chapter 2, I describe the characterization of bda4-1D snc2-1D npr1-1. Positional cloning showed that bda4-1D contains a gain-of-function mutation in NPR4 (renamed npr4-4D). Functional analysis indicated that NPR4, as well as its close homolog NPR3, function as transcriptional repressors. They function downstream of SNC2, independent of NPR1. In addition, SA was shown to inhibit the transcriptional activities of NPR3/4 and promote the expression of key immune regulators. The npr4-4D mutation leads to constitutively repression of SA-induced immune responses, indicating that the mutant protein can no longer respond to SA. On the other hand, the equivalent mutation in NPR1 also abolishes its ability to bind SA and renders reduced SA-induced defence gene expression. My results demonstrated that both NPR1 and NPR3/NPR4 are bona fide SA receptors, but play opposite roles in transcriptional regulation of SA-induced defence gene expression. In chapter 3, I describe another suppressor screen of snc2-1D in the eds5-3 snc2-1D npr1-1 background. I isolated 66 mutant lines with restored morphological phenotype. After Sanger sequencing analysis, I chose to focus on four novel bda mutants, bda3-1D, bda5, bda6 and bda7. Cloning of BDA6 and BDA7 showed that they encode FMO1 and ALD1 respectively, which are both essential components in SAR. My   16 results indicate that enzymes involved in secondary metabolite synthesis in SAR, are also important for signaling in SNC2-mediated immune pathway.  In chapter 4, I summarize key results and conclusions of my work and discuss their significance in a broader context. I also highlight some of the questions that arose from my research that could be addressed in the future.                            17 2 Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity  2.1 Summary  Salicylic acid (SA) is a plant defence hormone required for immunity. Arabidopsis NPR1 and NPR3/NPR4 were previously shown to bind SA and all three proteins were proposed as SA receptors. NPR1 functions as a transcriptional activator, whereas NPR3/NPR4 were suggested to function as E3 ligases that promote NPR1 degradation.  Here we report that NPR3/NPR4 function as transcriptional repressors and SA inhibits their activities to promote the expression of downstream immune regulators. npr4-4D, a newly identified gain-of-function npr4 allele that renders NPR4 unable to bind SA, constitutively represses SA-induced immune responses. In contrast, the equivalent mutation in NPR1 abolishes its ability to bind SA and promotes SA-induced defence gene expression. Further analysis revealed that NPR3/NPR4 and NPR1 function independently to regulate SA-induced immune responses. Our study indicates that both NPR1 and NPR3/NPR4 are bona fide SA receptors, but play opposite roles in transcriptional regulation of SA-induced defence gene expression.  2.2 Introduction  Salicylic acid (SA) is a phytohormone important for plant defence against pathogens (Vlot et al., 2009). Following pathogen infections, SA accumulates in both infected and systemic tissue, and it is required for both local and systemic acquired resistance (SAR) (Delaney et al. 1994; Gaffney et al. 1993). Exogenous application of SA or SA analogs induces immunity to pathogens (Görlach et al. 1996; Metraux Ahl-Goy, P., Staub, T., Speich, J., Steinemann, A., Ryals, J., and Ward, E. 1991), whereas reducing SA accumulation by expressing the bacterial salicylate hydroxylase gene NahG in transgenic plants results in SAR deficiency (Gaffney et al. 1993). Similarly, SA-deficient mutants such as sid2 and eds5 in Arabidopsis exhibit defects in basal   18 resistance and SAR (Nawrath et al. 2002; Nawrath and Métraux 1999). SID2 encodes an isochorismate synthase that converts chorismate to isochorismate (Wildermuth et al. 2001), which is further converted to SA through an unknown mechanism. EDS5 encodes a MATE transporter that is likely involved in exporting SA from chloroplast to cytoplasm (Nawrath et al. 2002; Serrano et al. 2013).  In Arabidopsis, pathogen-induced SA is mainly synthesized through Isochorismate Synthase 1 (ICS1/SID2) (Wildermuth et al. 2001). Two plant-specific transcription factors SARD1 and CBP60g promote pathogen-induced SA synthesis by regulating the expression of ICS1 (Wang et al. 2009; Wang et al. 2011; Y. Zhang, Xu, et al. 2010). In addition to ICS1, SARD1 and CBP60g also bind to the promoter regions of a large number of genes including those that encode positive regulators of SAR as well as signaling components for effector-triggered immunity and pathogen-associated molecular pattern (PAMP)-triggered immunity, suggesting that these two transcription factors play broad roles in regulating plant immunity (Sun et al. 2015). Arabidopsis NPR1 is required for SA-induced PR gene expression and resistance against pathogens (Cao et al. 1994; Delaney et al. 1995; Shah et al. 1997). Loss of NPR1 results in SA-insensitivity, leading to enhanced disease susceptibility and compromised SAR. NPR1 contains an N-terminal BTB/POZ domain, a central ankyrin-repeat domain and a C-terminal transactivation domain (Cao et al. 1997; Rochon et al. 2006). NPR3 and NPR4 are two paralogs of NPR1 with very similar domain structures as NPR1 (Liu et al. 2005). Loss of NPR3 and NPR4 does not affect the induction of PR gene by SA. Instead it results in elevated PR gene expression and enhanced disease resistance in the npr3 npr4 double mutants (Zhang et al. 2006). The constitutive disease resistance phenotype of npr3 npr4 can be complemented by NPR3 as well as NPR4, suggesting that NPR3 and NPR4 play redundant roles in negative regulation of immunity.  Intriguingly, NPR1 and NPR3/NPR4 all interact with TGA transcription factors (Després et al. 2000; Zhang et al. 2006; Zhang et al. 1999; Zhou et al. 2000). NPR1 has been shown to serve as a transcriptional activator (Fan and Dong 2002; Rochon et al. 2006) and NPR3/NPR4 were suspected to also function in transcription regulation (Kuai et al. 2015; Zhang et al. 2006). Among the TGA transcription factors that interact with   19 NPR1/NPR3/NPR4, TGA2, TGA5 and TGA6 function redundantly in positive regulation of SA-induced PR gene expression and pathogen resistance (Zhang, Tessaro, et al. 2003). However, basal PR gene expression levels are elevated in the tga2 tga5 tga6 triple knockout mutant, suggesting that TGA2/TGA5/TGA6 are also involved in negative regulation of defence responses (Zhang, Tessaro, et al. 2003).  A large number of SA-binding proteins with different affinity to SA have been identified in plants (Klessig et al. 2016), but how SA is perceived as a defence hormone remains controversial. In one study, NPR3 was suggested as a low-affinity and NPR4 as a high-affinity SA receptor, whereas NPR1 was ruled out as an SA receptor based on its lack of SA-binding activity (Fu et al. 2012). On the other hand, NPR1 was shown to bind SA with high affinity in two separate studies (Manohar et al. 2014; Wu et al. 2012), and two Cysteine residues (C521 and C529) in the C-terminal domain of NPR1 are required for the binding of SA and SA-induced PR1 expression (Rochon et al. 2006; Wu et al. 2012). NPR3 and NPR4 were proposed to function as E3 ligases that mediate the degradation of NPR1 (Fu et al. 2012). It was hypothesized that low levels of SA inhibit the interaction between NPR4 and NPR1 to allow for NPR1 accumulation, whereas high levels of SA during pathogen infection promote the association between NPR3 and NPR1 and degradation of NPR1. As previously discussed by Kuai et al., this model is inconsistent with some of the biochemical and genetic data observed from the npr3, npr4 and npr3 npr4 mutant plants and cannot explain the apparent genetic redundancy between NPR3 and NPR4 (Kuai et al. 2015). As NPR1 and NPR3/NPR4 belong to the same gene family, share similar domain structures and have high sequence similarity, it is surprising that NPR1 functions as a transcriptional activator, but NPR3/NPR4 are proposed to work as E3 ligases. Here we report that NPR3/NPR4 serve as transcriptional repressors for SA-responsive genes. Multiple lines of evidences suggest NPR4 and NPR1 function separately to regulate SA-induced immune responses. By inhibiting the transcriptional repression activity of NPR4 and promoting the transcriptional activation activity of NPR1, SA activates the expression of key immune regulators. A gain-of-function npr4-4D mutant that is unable to bind SA constitutively represses SA-induced immune responses, whereas the equivalent mutation in NPR1 abolishes its SA-binding activity   20 and its ability to promote SA-induced defence gene expression, indicating that NPR1 and NPR3/NPR4 are all bona fide SA receptors despite their opposite roles in transcriptional regulation of SA-induced defence gene expression.  2.3 Results  2.3.1 Identification and characterization of bda4-1D snc2-1D npr1-1  Arabidopsis SNC2 encodes a receptor-like protein required for basal resistance against bacterial pathogens (Y. Zhang, Yang, et al. 2010). A dominant mutation in SNC2 leads to constitutive activation of immune responses and dwarfism in the snc2-1D npr1-1 double mutant (Y. Zhang, Yang, et al. 2010). From a suppressor screen of snc2-1D npr1-1 to search for NPR1-independent immune regulators, we identified the bda4-1 snc2-1D npr1-1 triple mutant (BDA: Bian DA; becoming bigger in Chinese) (Y. Zhang, Yang, et al. 2010). When backcrossed with the snc2-1D npr1-1 parent, the F1 plants exhibited similar size and morphology as bda4-1 snc2-1D npr1-1 (Figure 2.1B), indicating that the bda4-1 mutation is dominant. Therefore, the mutant was renamed as bda4-1D snc2-1D npr1-1. In bda4-1D snc2-1D npr1-1, the dwarf morphology of snc2-1D npr1-1 was almost fully suppressed (Figure 2.1A). Real-time RT-PCR (qRT-PCR) analysis showed that the constitutive expression of defence marker genes PR1 (Figure 2.1C) and PR2 (Figure 2.1D) in snc2-1D npr1-1 is completely suppressed in the bda4-1D snc2-1D npr1-1 triple mutant. In addition, the enhanced resistance to the virulent oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 in snc2-1D npr1-1 is also suppressed in bda4-1D snc2-1D npr1-1 (Figure 2.1E). Taken together, bda4-1D suppresses the dwarf morphology as well as constitutive defence responses in snc2-1D npr1-1.    21  Figure 2.1 bad4-1D/npr4-4D suppresses the constitutive defence responses in snc2-1D npr1-1.  (A) Morphology of wild type (WT), bda4-1D snc2-1D npr1-1, snc2-1D npr1-1 and BDA4/bda4-1D snc2-1D npr1-1 heterozygous plants. Plants were grown on soil and photographed four weeks after planting. (B) Morphology of wild type (WT), npr1-1, snc2-1D npr1-1 and bda4-1D snc2-1D npr1-1 plants. The photo was taken four weeks after planting.    22 (C-D) Expression of PR1 (C) and PR2 (D) in the indicated genotypes. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (E) Growth of H.a. Noco2 on the indicated genotypes. Two-week-old seedlings were sprayed with spores of H.a. Noco2 (5×104 spores/ml). Infection was scored seven days after inoculation by counting the numbers of spores per gram of leaf samples. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 4).  2.3.2 bda4-1D carries a gain-of-function mutation in NPR4  The bda4-1D mutation was mapped to a region between markers 10.6 Mb and 10.9 Mb on chromosome 4. A single G-to-A mutation in NPR4 (AT4G19660) was identified in this region by whole genome re-sequencing. This mutation results in an amino acid change (Arg-419 to Gln-419) located in the C-terminal domain of NPR4 (Figure 2.2A). To confirm that this mutation in NPR4 is responsible for the suppression of the autoimmune phenotype of snc2-1D npr1-1, a genomic clone containing the mutant NPR4 gene was transformed into snc2-1D npr1-1. As shown Figure 2.2B, the transgenic plants displayed bda4-1D snc2-1D npr1-1-like morphology (Figure 2.2B). Analysis of three representative transgenic lines showed that constitutive expression of PR1 and PR2 and enhanced resistance to H.a. Noco2 in snc2-1D npr1-1 were completely suppressed in these lines (Figure 2.2C-E), suggesting that the Arg-419 to Gln-419 mutation in NPR4 is responsible for the suppression of snc2-1D npr1-1 mutant phenotypes by bda4-1D. Thus, we conclude that bda4-1D is a dominant allele of NPR4 and renamed bda4-1D as npr4-4D.  Loss of both NPR4 and NPR3 results in elevated PR gene expression and enhanced disease resistance (Zhang et al. 2006). To determine whether npr4-4D is a gain-of-function or dominant-negative mutation, we transformed the npr4-4D mutant gene under the control of its native promoter into npr3-2 npr4-2 background. As shown in Figure 2.2 F-G, elevated PR1 and PR2 expression in npr3-2 npr4-2 was suppressed in three independent transgenic lines, indicating that npr4-4D is a gain-of-function   23 mutation of NPR4 that suppresses the constitutive defence responses in snc2-1D npr1-1 as well as in npr3-2 npr4-2.  Figure 2.2 bda4-1D carries a gain-of-function mutation in NPR4. (A) Map position and the mutation in bda4-1D.   24 (B) Morphology of four-week-old transgenic lines expressing the bda4-1D mutant gene in the snc2-1D npr1-1 background.  (C-D) Expression of PR1(C) and PR2(D) in wild type (WT), npr1-1, snc2-1D npr1-1, bda4-1D snc2-1D npr1-1 and transgenic lines expressing the bda4-1D mutant gene in snc2-1D npr1-1 background. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (E) Growth of H.a. Noco2 on the indicated genotypes. Two-week-old seedlings were sprayed with spores of H.a. Noco2 (5×104 spores/ml). Infection was scored seven days after inoculation. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 4). (F-G) Expression of PR1(F) and PR2(G) in wild type (WT), npr3-2 npr4-2 and transgenic lines expressing the npr4-4D mutant gene in npr3-2 npr4-2 background. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats.  2.3.3 Arg-419 residue in NPR4 is conserved in plants  Interestingly, the Arg-419 residue in NPR4 is conserved not only in NPR1 and NPR3, but also in their homologs of other plants (Figure 2.3A). To test whether NPR3 functions similarly as NPR4, we mutated the corresponding residue Arg-428 in NPR3 to Gln and expressed NPR3R428Q under the 35S promoter in snc2-1D npr1-1. As shown in Figure 2.3B and 2.3C, the dwarf morphology of snc2-1D npr1-1 was suppressed by NPR3R428Q, but not the wild type NPR3, confirming that NPR3 and NPR4 have redundant functions.   25  Figure 2.3 Suppression of the dwarf morphology of snc2-1D npr1-1 by NPR3R428Q (A) Alignment of the conserved C-terminal regions of NPR1/NPR3/NPR4. At: Arabidopsis thaliana; Sl: Tomato, Solanum lycopersicum; Os: Rice, Oryza sativa. * indicates the mutation site in npr4-4D. (B-C) Morphology of four-week-old soil-grown wild type (WT), snc2-1D npr1-1 and transgenic lines expressing the 35S: NPR3R428Q (B) or 35S: NPR3 (C) in the snc2-1D npr1-1 background.   2.3.4 npr4-4D suppresses the expression of SARD1, CBP60g and WRKY70   Several transcription factors including SARD1, CBP60g and WRKY70 are required for the autoimmunity of snc2-1D npr1-1 (Sun et al. 2015; Y. Zhang, Yang, et al. 2010). qRT-PCR analysis revealed that the expression of SARD1, CBP60g and WRKY70 is much higher in snc2-1D npr1-1 than in wild-type and npr1-1, but the increased expression of these genes is completely blocked in npr4-4D snc2-1D npr1-1 (Figure 2.4A-C). To test whether npr4-4D affects the induction of SARD1, CBP60g and WRKY70 by pathogens, we crossed npr4-4D snc2-1D npr1-1 with wild-type Col-0 and isolated the npr4-4D single mutant. As shown in Figure 2.4 D-F, the expression of these three genes is strongly induced by the type III secretion deficient bacteria strain Pseudomonas syringae pv. tomato (P.s.t.) DC3000 hrcC- in wild type plants, but the   26 induction is dramatically reduced in npr4-4D. Similarly, the induction of SARD1, CBP60g and WRKY70 by the virulent bacterial strain Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 is also greatly reduced in npr4-4D (Figure 2.4 G-I). These data suggest that NPR4 negatively regulates the expression of SARD1, CBP60g and WRKY70.    27  Figure 2.4 Repression of the expression of SARD1, CBP60g and WRKY70 by npr4-4D.   28 (A-C) Expression of SARD1 (A), WRKY70 (B) and CBP60g (C) in wild type (WT), npr1-1, snc2-1D npr1-1 and npr4-4D snc2-1D npr1-1 plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (D-F) Induction of SARD1 (D), WRKY70 (E) and CBP60g (F) by P.s.t. DC3000 hrcC- in plants of WT and npr4-4D. Leaves of three-week-old plants grown in short-day conditions were infiltrated with P.s.t. DC3000 hrcC- at a dose of OD600 = 0.05. hpi: hours post inoculation. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (G-I) Induction of SARD1 (G), WRKY70 (H) and CBP60g (I) by P.s.m. ES4326 in plants of wild type (WT) and npr4-4D. Leave of three-week-old plants grown in short-day conditions were infiltrated with P.s.m. ES4326 at a dose of OD600 = 0.001. hpi: hours post inoculation. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats.  2.3.5 The npr4-4D mutation results in compromised basal defence   Next we tested whether npr4-4D affects basal resistance against pathogens. Similar to the positive control (agb1-2), npr4-4D supported considerably higher growth of P.s.t. DC3000 hrcC- compared with the wild type (Figure 2.5A). When npr4-4D was challenged with the virulent bacteria P.s.m. ES4326, similar to npr1, npr4-4D plants also supported significantly higher growth of the pathogen than the wild type (Figure 2.5B), suggesting that npr4-4D suppresses basal resistance.   29  Figure 2.5 npr4-4D mutation leads to compromised basal defence and PTI. (A) Growth of P.s.t. DC3000 hrcC- on WT, agb1-2, and npr4-4D plants. Leaves of four-week-old plants were infiltrated with a bacterial suspension at a dose of OD600 = 0.002. cfu, Colony-forming units. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 6). (B) Growth of P.s.m. ES4326 on plants of WT, npr1-1 and npr4-4D. Leaves of four-week-old plants were infiltrated with a bacterial suspension at a dose of OD600 = 0.0002. cfu, Colony-forming units. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 6).   2.3.6 Loss of both NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression   To test whether the expression of SARD1, CBP60g and WRKY70 is affected in loss-of-function mutants of NPR3 and NPR4, we compared their expression levels in wild type and npr3 npr4 double mutants. As shown in Figure 2.6A-B, SARD1 and WRKY70 expression is dramatically elevated in the npr3-2 npr4-2 double mutant, whereas the CBP60g expression level is only modestly increased in npr3-2 npr4-2 (Figure 2.6C). A slight increase of SARD1 expression was also observed in the npr3-2   30 and npr4-2 single mutants (Figure 2.6A). Similar to npr3-2 npr4-2, the npr3-1 npr4-3 double mutant also exhibit elevated basal SARD1 and WRKY70 expression (Figure 2.6D-E). These data suggest that NPR3 and NPR4 function redundantly in negative regulation of SARD1 and WRKY70 expression.    Figure 2.6 Loss of both NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression.   31 (A-C) Expression of SARD1 (A), WRKY70 (B) and CBP60g (C) in wild type (WT), npr3-2, npr4-2 and npr3-2 npr4-2 plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (D-E) Expression levels of SARD1 (D) and WRKY70 (E) in plants of wild type (WT), npr3-1, npr4-3 and npr3-1 npr4-3 plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats.  2.3.7 NPR3 and NPR4 function as transcriptional repressors that negatively regulate the expression of SARD1 and WRKY70  NPR4 was previously shown to interact with TGA transcription factors (Zhang et al. 2006). To test whether NPR3/NPR4 serve as transcriptional repressors to negatively regulate SARD1 and WRKY70 expression, we made constructs expressing a luciferase reporter gene under the control of the promoters of SARD1 or WRKY70. As shown in Figure 2.7A, when the pSARD1::Luc reporter gene was co-transformed with plasmids over-expressing NPR3 or NPR4 into protoplasts, the expression of luciferase is significantly reduced compared with the empty vector control. Co-transformation of plasmids over-expressing NPR3 or NPR4 with the pWRKY70::Luc reporter gene also results in reduced reporter gene expression (Figure 2.7B). These data suggest that overexpression of NPR3 or NPR4 in Arabidopsis protoplasts represses the expression of SARD1 and WRKY70, and they are likely transcriptional repressors.  At the C-terminus of NPR3 and NPR4 but not NPR1, there is a conserved motif (VDLNETP) that has high similarity to the ethylene-responsive element binding factor-associated amphipathic repression motif (EAR; L/FDLNL/F(x)P) (Ohta et al. 2001). To determine whether this motif is required for the transcriptional repression activity of NPR4, we mutated the conserved amino acid sequence “DLN” in NPR4 to “GVK”, the corresponding amino acid sequence in NPR1. The NPR4GVK mutant protein can still interact with TGA2 in the yeast two-hybrid assay (Figure 2.7C), but it no longer represses the expression of SARD1 and WRKY70 when expressed in protoplasts (Figure 2.7D-E).    32 To further test the transcriptional repression activity of NPR3/NPR4, we made constructs expressing NPR3 or NPR4 fused to the Gal4 DNA-binding domain (GD). Co-transformation of these constructs with a Renilla luciferase reporter gene driven by a promoter containing 2×Gal4 DNA-binding sites in protoplasts resulted in suppression of the expression of the reporter gene (Figure 2.7F), confirming that NPR3/NPR4 function as transcriptional repressors. Transforming a construct expressing GD fused with the NPR4 C-terminal domain (NPR4C) together with the Renilla luciferase reporter gene also results in suppression of the reporter gene (Figure 2.7G), suggesting that the C-terminal domain of NPR4 serves as a transcriptional repression domain.  Figure 2.7 NPR3 and NPR4 function as transcriptional repressors that negatively regulate the expression of SARD1 and WRKY70.   33 (A-B) Firefly luciferase activities in Arabidopsis protoplasts co-transformed with effector constructs [empty vector (EV), 35S:NPR3 or 35S:NPR4] and the pSARD1-Luc (A) or pWRKY70-Luc (B) reporter constructs. Statistical differences are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). (C) Yeast two-hybrid analysis of interactions between the NPR4 mutants and TGA2. Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic drop media without Leu and Trp (SD-L-W) plate or synthetic drop media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (D-E) Firefly luciferase activities in Arabidopsis protoplasts co-transformed with effector constructs [EV, 35S:NPR4 or 35S:NPR4(GVK)] and the pSARD1-Luc (D) or pWRKY70-Luc (E) reporter constructs. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (F) Relative Renilla luciferase activities in Arabidopsis protoplasts co-transformed with a Renilla luciferase reporter gene and constructs expressing GAL4 DNA-binding domain (GD), GD-NPR3, GD-NPR4 were shown. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (G) Relative Renilla luciferase activities in Arabidopsis protoplasts co-transformed with a Renilla luciferase reporter gene and constructs expressing GAL4 DNA-binding domain (GD), or GD fused with the C terminal domain of NPR4 (GD-NPR4C) were shown. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). For (A-B) and (D-E), a Renilla luciferase reporter under the control the promoter of UBQ1 was included as the internal transfection control. The transformed protoplasts were incubated for 16-20 h before the luciferase activities were measured using a Dual-Luciferase Reporter Assay (Promega). The ratio of firefly luciferase/Renilla luciferase was used to calculate the relative luciferase activities. The value was compared with empty vector control, which was set as 1.  For (F-G), A construct expressing the LexA DNA-binding domain-VP16 activation domain (LD-VP16) fusion protein was included in all the assays for the activation of the reporter gene. A 35S promoter-driven firefly luciferase reporter was included as internal control. The transformed protoplasts were incubated for 16-20 h before the luciferase   34 activities were measured using a Dual-Luciferase Reporter Assay (Promega). The ratio of Renilla luciferase/firefly luciferase was used to calculate the relative luciferase activities. Values were compared with the GD control, which was set as 1.  2.3.8 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70   SARD1 and WRKY70 each contain two TGACG motifs in their promoter region. To test whether the TGA-binding motifs are required for the repression of SARD1 and WRKY70 by NPR4, we mutated these motifs in the pSARD1::Luc and pWRKY70::Luc luciferase reporter genes (Figure 2.8A). As shown in Figure 2.8B-C, overexpression of NPR4 in Arabidopsis protoplasts does not lead to repression of the mutant pSARD1::Luc and pWRKY70::Luc luciferase reporter genes. These data suggest that the TGA factors are likely necessary for transcriptional repression of SARD1 and WRKY70. Similar to npr3 npr4 double mutants, the tga6-1 tga2-1 tga5-1 (tga256) triple knockout mutant also has elevated PR gene expression (Zhang, Tessaro, et al. 2003). To test whether TGA2/TGA5/TGA6 also regulate the expression of SARD1 and WRKY70, we compared the basal expression levels of SARD1 and WRKY70 in wild type and tga256. As shown in Figure 2.8D-E, the expression of SARD1 and WRKY70 is much higher in the tga256 triple mutant and modestly increased in the tga25 double mutant compared to the wild type. These data suggest that TGA2/TGA5/TGA6 are also required for negative regulation of the basal expression of SARD1 and WRKY70.   To determine whether SARD1 and WRKY70 are direct targets of the TGA transcription factors, ChIP-qPCR experiments were carried out on wild type and tga256 plants using anti-TGA2 antibodies (Figure 2.8F). As shown in Figure 2.8G-I, DNA in the promoter regions of SARD1 and WRKY70, but not CBP60g, is clearly enriched in the immuno-precipitated samples from the wild type, but not the tga256 mutant plants, suggesting that SARD1 and WRKY70 are both direct targets of TGA2. Since NPR3/NPR4 and TGA2/TGA5/TGA6 interact with each other and are both required for the negative regulation of SARD1 and WRKY70 expression, we further   35 determined whether TGA2/TGA5/TGA6 are required for the repression of SARD1 or WRKY70 by NPR4. First we checked whether the repression of defence responses in snc2-1D npr1-1 by npr4-4D requires TGA transcription factors. We crossed npr4-4D snc2-1D npr1-1 with the tga256 triple mutant to obtain the npr4-4D snc2-1D npr1-1 tga6-1, npr4-4D snc2-1D npr1-1 tga25 and npr4-4D snc2-1D npr1-1 tga256 mutant lines. As shown in Figure 2.8J, while npr4-4D snc2-1D npr1-1 tga6-1 and npr4-4D snc2-1D npr1-1 tga25 plants have a similar morphology to npr4-4D snc2-1D npr1-1, the sextuple mutant npr4-4D snc2-1D npr1-1 tga256 shows extreme dwarf morphology similar to snc2-1D npr1-1. Consistently, the constitutive expression of SARD1 and WRKY70 is restored in the sextuple mutant (Figure 2.8K-L).  We further tested whether NPR4 can repress the expression of the pSARD1::Luc and pWRKY70::Luc luciferase reporter genes in the tga256 protoplasts. As shown in Figure 2.8M-N, overexpression of NPR4 reduces the expression of both reporter genes in wild type, but not in the tga256 mutant protoplasts. These data provide strong genetic evidence that NPR3/NPR4 work together with TGA2/TGA5/TGA6 to repress the expression of SARD1 and WRKY70.     36  Figure 2.8 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70. (A) Reporter constructs used in the promoter activity assay. The original TGACG motif sequence and ttaaa mutant sequences are colored. (B-C) Firefly luciferase activities in Arabidopsis protoplasts transformed with empty vector (EV) or 35S:NPR4 effector constructs together with a luciferase reporter driven by wild type or mutant SARD1(B)/WRKY70(C) promoters with mutation in the “TGACG”   37 motifs. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (D-E) Expression levels of SARD1(D) and WRKY70(E) in wild type (WT), tga2-1 tga5-1, tga6-1 and tga2-1 tga5-1 tga6-1 plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (F) Characterization of the TGA2 antibody. Western blot analysis was carried out on total proteins extracted from wild type (WT), tga2-1 tga5-1, tga6-1 and tga2-1 tga5-1 tga6-1 using the anti-TGA2 antibody. (G-I) Binding of TGA2 to promoter regions of SARD1(G), WRKY70(H) and CBP60g(I) as revealed by chromatin immunoprecipitation assay. Twelve-day-old seedlings were collected and cross-linked with 1% formaldehyde. TGA2 chromatin complexes were immunoprecipitated with anti-TGA2 antibodies and protein A-agarose beads. Control reactions were performed in parallel using non-immunized serum (no Ab). The bound DNA was quantified by qPCR. ChIP results are presented as 10-4 of signal relative to input. Bars represent means ± s.d. (n = 3).   (J) Morphology of the indicated genotypes. Plants were grown on soil and photographed four weeks after planting. (K-L) Expression levels of SARD1(K) and WRKY70(L) in plants of wild type (WT), npr1-1, snc2-1D npr1-1, snc2-1D npr1-1 npr4-4D, snc2-1D npr1-1 npr4-4D tga2-1 tga5-1 tga6-1, snc2-1D npr1-1 npr4-4D tga2-1 tga5-1 and snc2-1D npr1-1 npr4-4D tga6-1. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (M-N) Firefly luciferase activities in Arabidopsis wild type (WT) and tga2-1 tga5-1 tga6-1 protoplasts transformed with empty vector (EV) or 35S:NPR4 effector constructs together with the pSARD1-Luc (M) or pWRKY70-Luc (N) reporter constructs. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). For (B-C) and (M-N), a Renilla luciferase reporter under the control the promoter of UBQ1 was included as the internal transfection control. The transformed protoplasts were incubated for 16-20 h before the luciferase activities were measured using a Dual-Luciferase Reporter Assay (Promega). The ratio of firefly luciferase/Renilla luciferase   38 was used to calculate the relative luciferase activities. The value was compared with empty vector control, which was set as 1.   2.3.9 SA inhibits the transcriptional repression activity of NPR4   Following SA treatment, the expression of both SARD1 and WRKY70 is rapidly induced and the induction is greatly reduced in npr4-4D (Figure 2.9A-B). Since SA can bind to NPR4, we tested whether the transcriptional repression activity of NPR4 is affected by SA. We treated wild type Arabidopsis protoplasts co-transformed with the 35S:NPR4 plasmid and the pSARD1::Luc or pWRKY70::Luc reporter gene with SA and examined the expression of luciferase 3h later. As shown in Figure 2.9C-D, overexpression of NPR4 represses the expression of both reporter genes, and the repression is released by SA treatment. In contrast, repression of the reporter genes by 35S:npr4-4D was not affected by SA treatment. These data suggest that SA inhibits the transcriptional repression activity of NPR4 and the npr4-4D mutant protein no longer responds to SA treatment.  To test whether SA affects the recruitment of NPR4 to the promoters of SARD1 and WRKY70, we carried out ChIP-qPCR experiments using transgenic plants expressing NPR4-3HA protein. As shown in Figure 2.9E-G, NPR4-3HA was recruited to the promoters of SARD1 and WRKY70 but not CBP60g, and treatment with SA did not affect the association of NPR4-3HA with SARD1 and WRKY70 promoters. ChIP-qPCR experiments using transgenic plants expressing NPR3-3HA protein showed similar results where NPR3-3HA was also recruited to the promoters of SARD1 and WRKY70 (Figure 2.9H-I) and the interactions between NPR3-3HA and the promoters are not affected by SA treatment. Consistent with the data from ChIP-qPCR experiments, SA does not disrupt the interactions between NPR3/NPR4 and TGA2 in the yeast two-hybrid assay (Figure 2.9J). Interestingly, treatment of SA abolishes the repression of the Renilla luciferase reporter gene under the promoter with 2×Gal4 DNA-binding sites by GD-NPR3 and GD-NPR4 (Figure 2.9K), indicating a negative effect of SA on the transcriptional repression activities of NPR3/NPR4.     39 Next we tested whether SA-induced disease resistance is affected in the npr4-4D mutant. We treated wild type and npr4-4D seedlings with the SA analog INA (2,6-dichloroisonicotinic acid) and challenged the plants with H.a. Noco2. As shown in Figure 2.9L, exogenous application of INA renders the wild type plants resistant to the pathogen. Like in npr1-1, INA-induced resistance against H.a. Noco2 is largely blocked in npr4-4D, confirming that npr4-4D is an SA-insensitive mutant. Previously GST-tagged NPR3 and NPR4 recombinant proteins were shown to bind SA with different affinities (Fu et al. 2012). To confirm the binding of SA to NPR3 and NPR4 and determine whether the npr4-4D mutation affects SA binding, we expressed His6-MBP-tagged NPR3, NPR4 and NPR4-4D (NPR4R419Q) proteins in Escherichia coli (E. coli) and purified the recombinant proteins for SA binding assays. The His6-MBP tag was used because the previously reported GST-NPR3 and GST-NPR4 fusion proteins did not express well under our experimental conditions (Fu et al. 2012). As shown in Figure 2.9M-N, both NPR3 and NPR4 have high binding affinity to [3H]-SA. The dissociation constants (Kd) for NPR3 and NPR4 were 176.7 ± 28.31 nM and 23.54 ± 2.743 nM respectively. The NPR4R419Q mutant protein can still interact with TGA2 (Figure 2.7C) and form homodimers (Figure 2.9O). However, it has hardly detectable binding affinity with [3H]-SA (Figure 2.9P and Figure 2.9N), exhibiting an estimated Kd of about 250-fold lower than the wild type protein, suggesting that the Arg-419 residue in NPR4 is essential for its SA-binding activity.    40   Figure 2.9 SA inhibits the transcriptional repression activity of NPR4 and the npr4-4D mutation abolishes SA-binding and renders SA insensitivity.   41 (A-B) Induction of SARD1(A) and WRKY70(B) gene expression by SA in plants of wild type (WT) and npr4-4D. Two-week-old seedlings grown on MS media were sprayed with 0.2 mM SA for quantitative RT-PCR analysis. Samples were collected at 0 and 1 h after treatment. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (C-D) Firefly luciferase activities in Arabidopsis wild type protoplasts co-transformed with effector constructs (empty vector, 35S:NPR4 or 35S: npr4-4D) and the pSARD1-Luc (C) or pWRKY70-Luc (D) reporter constructs. After overnight incubation, an aliquot of the cells was treated with 0.2 mM SA for three hours before the luciferase activities were measured. The value was compared with empty vector transfection, which was set as 1. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (E-G) Chromatin immunoprecipitation (ChIP)-PCR analysis of the effect of SA on the binding of NPR4-3HA to the promoter regions of SARD1(E), WRKY70 (F) and CBP60g(G). Twelve-day-old seedlings were sprayed with or without 50 μM SA one hour before cross-linking with 1% formaldehyde.  Chromatin complexes were immunoprecipitated with an anti-HA antibody. Control reactions were performed on non-transgenic plants (WT). The immunoprecipitated DNA was quantified by qPCR. ChIP-PCR results are presented as 10-3 of signal relative to input. Bars represent means ± s.d. (n = 3).   (H-I) Chromatin immunoprecipitation-PCR analysis of the effect of SA on binding of NPR3-3HA to the promoter regions of SARD1(H) and WRKY70 (I). Twelve-day-old seedlings were sprayed with or without 50 μM SA one hour before cross-linking with 1% formaldehyde. Chromatin complexes were immunoprecipitated with an anti-HA antibody. Control reactions were performed on non-transgenic plants (WT). The immunoprecipitated DNA was quantified by qPCR. ChIP-PCR results are presented as % of signal relative to input. Bars represent means ± s.d. (n = 3).   (J) Yeast two-hybrid analysis of interactions between NPR3/NPR4 and TGA2 with or without the presence of SA (0.1mM). Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic drop media without Leu   42 and Trp (SD-L-W) plate or synthetic drop media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (K) Relative Renilla luciferase activities in Arabidopsis protoplasts co-transformed with a Renilla reporter gene and constructs expressing GAL4 DNA-binding domain (GD), GD-NPR3 or GD-NPR4. A construct expressing the LexA DNA-binding domain-VP16 activation domain (LD-VP16) fusion protein was included in all the assays for activation of the reporter gene. After overnight incubation, an aliquot of the cells was treated with 0.2 mM SA for three hours before the luciferase activities were measured. The values were compared with the GD control, which was set as 1. Statistical differences among treatments/genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (L) Growth of H.a. Noco2 on wild type (WT), npr1-1 and npr4-4D plants. Two-week-old seedlings were sprayed with water or 0.1 mM INA. H.a. Noco2 spores (5×104 spores/ml) were sprayed one day after INA treatment. Infection was scored seven days after inoculation. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 4).  (M) Saturation SA-binding assay of NPR3 using size exclusion chromatography. 1.5 μg of His6-MBP-NPR3 protein was incubated with [3H] SA at different concentrations (from 6.25 to 800 nM). Three replicates in a single experiment were used to calculate the Kd of NPR3 (176.7 ±28.31 nM). The experiment was repeated twice with similar results. Bars represent means ± s.d. (n = 3). CPM, count per minute. (N) Saturation SA-binding assay of NPR4 and NPR4R419Q using size exclusion chromatography. 1.5 μg of His6-MBP-NPR4 or His6-MBP-NPR4R419Q protein was incubated with [3H] SA at different concentrations (from 6.25 to 800 nM). Three replicates in a single experiment were used to calculate the Kd for NPR4 (23.54 ± 2.74 nM). The experiment was repeated twice with similar results. Bars represent means ± s.d. (n = 3).  (O) Analysis of homodimerization of NPR4 and NPR4R419Q by co-immunoprecipitation. The proteins were transiently expressed in N. benthamiana using Agrobacteria strains carrying constructs expressing NPR4-3HA, NPR4R419Q-3HA, NPR4-3FLAG or   43 NPR4R419Q-3FLAG under a 35S promoter. IP was carried out using anti-FLAG beads. Western blot analysis was carried out using anti-FLAG or anti-HA antibodies. (P) Binding of NPR4 protein to [3H] SA as revealed by size exclusion chromatography. 0.4 μg/μl of HIS6-MBP-NPR4 or HIS6-MPB-NPR4R419Q protein was incubated with 200 nM [3H] SA in 50 μl of PBS buffer with or without 10,000-fold excess of unlabeled SA (cold SA). The reaction without protein (No protein) was used as negative control. Bars represent means ± s.d. (n = 4). CPM, count per minute.  2.3.10  NPR1 promotes the transcription of SARD1 and WRKY70 in response to SA  Since the Arg-419 residue in NPR4 is conserved in NPR1 (Figure 2.3A), we tested whether the corresponding Arg-432 in the C-terminal domain of NPR1 is also required for binding SA. We expressed His6-MBP-tagged NPR1 and NPR1R432Q proteins in E. coli and purified them for testing SA binding activities. As shown in Figure 2.10A, the His6-MBP-tagged NPR1 has high binding affinity for [3H]-SA, with a Kd of 223.1 ± 38.85 nM. The NPR1R432Q mutant protein exhibits very low binding affinity for [3H]-SA (Figure 2.10A), with a Kd estimated to be about 50-fold lower than the wild type protein, suggesting that Arg-432 plays an important role in SA binding. To determine whether the R432Q mutation affects the other functions of NPR1, we tested interactions of NPR1R432Q with TGA2 and NIMIN1 (NIM1-INTERACTING 1), which interact with the ankyrin repeats and the C-terminal domain of NPR1, respectively (Weigel et al. 2001; Zhang et al. 1999). As shown in Figure 2.10B, NPR1R432Q still interacts with both TGA2 and NIMIN1 in yeast two-hybrid assays.  NPR1 was previously shown to function as a transcriptional activator for PR1 expression in response to SA (Fan and Dong 2002; Rochon et al. 2006). It is partially required for SA-induced WRKY70 expression (Figure 2.10D) (Li et al. 2004). Induction of SARD1 by SA is also partially dependent on NPR1 (Figure 2.10C). To determine whether the NPR1R432Q mutation affects the function of NPR1 in the induction of SARD1 and WRKY70 by SA, we made transgenic lines expressing HA-tagged NPR1 or NPR1R432Q in the npr1-1 background (Figure 2.10E). As shown in Figure 2.10F and   44 2.10G, transgenic lines expressing NPR1-HA in the npr1-1 background showed similar expression levels of SARD1 and WRKY70 as wild type after SA treatment. INA-induced resistance to H.a. Noco2 was also restored in the NPR1-HA transgenic lines (Figure 2.10H). In contrast, in the transgenic lines expressing NPR1R432Q-HA, the expression levels of SARD1 and WRKY70 after SA treatment are similar in npr1-1. In addition, INA-induced resistance to H.a. Noco2 was not restored in the NPR1R432Q-HA transgenic lines either. These data suggest that NPR1R432Q cannot complement the defect of npr1-1 in SA-induced defence responses.  We further tested whether the NPR1R432Q mutation affects SA-induced pSARD1::Luc reporter gene expression. When a construct expressing wild type NPR1 was co-transformed with the pSARD1::Luc reporter gene construct into npr1-1 protoplasts, SA treatment induces the expression of luciferase (Figure 2.10I). In contrast, when the NPR1R432Q construct was co-transformed with the reporter gene construct into npr1-1 protoplasts, the expression of luciferase is not induced by SA, confirming that the NPR1R432Q mutation renders NPR1 insensitive to SA. SA treatment did not induce the expression of the pSARD1::Luc reporter gene with mutations in the “TGACG” motifs (Figure 2.10J), suggesting that the induction of pSARD1::Luc expression by SA is dependent on the “TGACG” motifs in the SARD1 promoter.   45  Figure 2.10 NPR1 promotes the expression of SARD1 and WRKY70 upon SA induction.   46 (A) Saturation binding assay of NPR1 and NPR1R432Q using size exclusion chromatography. 5 μg of His6-MBP-NPR1 or His6-MBP-NPR1R432Q protein was incubated with [3H] SA at different concentrations (from 12.5 to 800 nM). Three replicates in a single experiment were used to calculate the Kd of NPR1 (221.3 ±38.85 nM). The experiment was repeated twice with similar results. Bars represent means ± s.d. (n = 3). CPM, count per minute.  (B) Yeast two-hybrid analysis of interactions between NPR1R432Q and TGA2 or NIMIN1. Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic drop media without Leu and Trp (SD-L-W) plate or synthetic drop media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (C-D) Induction of SARD1 (C) and WRKY70 (D) expression by SA in plants of wild type (WT) and npr1-1. Error bars represent the standard deviation of three repeats. (E) NPR1-HA and NPR1R432Q-HA protein levels in transgenic lines in the npr1-1 background. Western blot analysis was carried out on total plant proteins using an anti-HA antibody. (F-G) Induction of SARD1 (F) and WRKY70 (G) by SA in WT, npr1-1 and the NPR1-HA or NPR1R432Q-HA transgenic lines in the npr1-1 background. Error bars represent the standard deviation of three repeats. (H) Growth of H.a. Noco2 on WT, npr1-1 and the NPR1-HA or NPR1R432Q-HA transgenic lines in the npr1-1 background. Two-week-old seedlings were sprayed with water or 0.1 mM INA one day before spraying with H.a. Noco2 spores (5×104 spores/ml). Infection was scored seven days later. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 4). (I) Luciferase activities in npr1-1 protoplasts co-transformed with effector constructs (empty vector, 35S:NPR1 or 35S:NPR1R432Q) and the pSARD1-LUC reporter construct. Statistical differences are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). (J) Luciferase activities in npr1-1 protoplasts co-transformed with effector constructs (empty vector or 35S:NPR1) and the wild type or mutant pSARD1-LUC reporter construct with mutations in the TGACG motifs. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3).   47 For (C-D and F-G), two-week-old seedlings grown on MS media were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. For (I-J), Samples were collected three hours after 0.2 mM SA treatment. The value was compared with empty vector control, which was set as 1.   2.3.11  NPR4 functions independently of NPR1  NPR3/NPR4 were previously reported to interact with NPR1 and function as E3 ligases for degrading NPR1 (Fu et al. 2012). However, we were not able to confirm the interactions between NPR3/NPR4 and NPR1 in yeast two-hybrid assays (Figure 2.11A). We also failed to detect interactions between NPR3/NPR4 and Cul3A in co-immunoprecipitation assays using epitope-tagged proteins transiently expressed in Nicotiana benthamiana (Figure 2.11B and 2.11C). To further determine the relationship between NPR3/NPR4 and NPR1, we analyzed the expression of SARD1 and WRKY70 in the npr1-1 npr3-2 npr4-2 triple mutant. As shown in Figure 2.11D and 2.11E, elevated SARD1 and WRKY70 expression in npr3-2 npr4-2 is not affected by npr1-1, suggesting that activation of SARD1 and WRKY70 in npr3-2 npr4-2 is independent on NPR1. Next we performed promoter-luciferase assays in npr1-1 protoplasts by transforming the pSARD1-Luc or pWRKY70-Luc reporter gene together with the 35S:NPR4 construct. As shown in Figure 2.11F and 2.11G, NPR4 can still repress the expression of the pSARD1::Luc and pWRKY70::Luc reporter genes in npr1-1 protoplasts, suggesting that NPR4 regulates SARD1 and WRKY70 expression independent of NPR1.  To test whether NPR1 and NPR4 function in parallel in SA-induced gene expression, we compared SA-induced SARD1 expression in the npr1-1 and npr4-4D single mutants and the npr1-1 npr4-4D double mutant. As shown in Figure 2.11H, induction of SARD1 by SA is partially blocked in npr4-4D and npr1-1, but it is completely blocked in the double mutant, suggesting that NPR1 and NPR4 function independently to regulate SA-induced SARD1 expression. Analysis of the induction of SARD1 and the defence marker gene PR2 by P.s.m. ES4326 further showed that their induction is only   48 partially affected in the npr1-1 and npr4-4D single mutants, but completely blocked in the npr1-1 npr4-4D double mutant (Figure 2.11I-J).  In addition, we analyzed the contribution of npr1-1 and npr4-4D to the suppression of snc2-1D. As shown in Figure 2.11K, snc2-1D npr1-1 and snc2-1D npr4-4D plants are only slightly bigger than snc2-1D, whereas the snc2-1D npr1-1 npr4-4D triple mutant has similar size as the wild type. The expression of SARD1 and WRKY70 in snc2-1D is lower in snc2-1D npr1-1 and snc2-1D npr4-4D, and further reduced in snc2-1D npr1-1 npr4-4D (Figure 2.11L-M). Similarly, the enhanced resistance against H.a. Noco2 in snc2-1D is not significantly affected in snc2-1D npr1-1 and snc2-1D npr4-4D, but completely lost in snc2-1D npr1-1 npr4-4D (Figure 2.11N). These data suggest that npr4-4D and npr1-1 have additive effects on the suppression of the autoimmune phenotype of snc2-1D, further supporting that NPR1 and NPR4 function independently to regulate SA responses. We further tested the effects of npr1-1 and npr4-4D on basal resistance against pathogens. As shown in Figure 2.11O and 2.11P, npr1-1 and npr4-4D supported significantly higher growth of H.a. Noco2 and P.s.t. DC3000. The npr1-1 npr4-4D double mutant supported even higher growth of these two pathogens than the single mutants. When npr1-1, npr4-4D and npr1-1 npr4-4D were challenged with the non-pathogenic P.s.t. DC3000hrcC-, growth of the bacteria was also significantly higher in the single mutants and further increased in the npr1-1 npr4-4D double mutant (Figure 2.11Q). All these data indicate that NPR1 and NPR3/NPR4 function separately.   49   Figure 2.11 NPR3 and NPR4 function independently of NPR1. (A) Yeast two-hybrid analysis of interactions between NPR3/NPR4 and NPR1 in the presence or absence of SA (0.1mM). Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic drop media without Leu   50 and Trp (SD-L-W) plate or synthetic drop media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (B-C) Analysis of interactions between NPR3 (B)/NPR4 (C) and Cul3A by co-immunoprecipitation. The E3 ligase BTB-POZ-CONTAINING PROTEIN 1 (POB1)/ LIGHT-RESPONSE BTB 2 (LRB2) was used as a positive control. The Cul3A-3HA and FLAG-ZZ-tagged NPR3/NPR4/POB1 proteins were transiently expressed in N. benthamiana by infiltrating leaves of 4-week-old plants with Agrobacterium (OD600 = 0.5) carrying plasmids expressing the Cul3A or NPR3/NPR4/POB1 fusion proteins. Samples were harvested 48 h post-inoculation. Immunoprecipitation was carried out on the total protein extracts using anti-FLAG conjugated beads. Cul3A-3HA was detected by immunoblot using an anti-HA antibody.  (D-E) Expression levels of SARD1 (D) and WRKY70 (E) in wild type (WT), npr1-1, npr3-2 npr4-2 and npr1-1 npr3-2 npr4-2 plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (F-G) Luciferase activities in Arabidopsis wild type (WT) and npr1-1 protoplasts transformed with empty vector (EV) or 35S:NPR4 effector constructs, together with the pSARD1-Luc (F) or pWRKY70-Luc (G) reporter constructs. Statistical differences are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3). (H) Induction of SARD1 by SA in wild type (WT), npr1-1, npr4-4D and npr1-1 npr4-4D double mutant plants. Two-week-old seedlings grown on MS media were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (I-J) Induction of SARD1 (I) and PR2 (J) by P.s.m. ES4326 in the indicated genotypes. Leaves of three-week-old plants were infiltrated with P.s.m. ES4326 at a dose of OD600 = 0.001. Samples were collected at 0 and 24 h for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (K) Morphology of plants of wild type (WT), snc2-1D, snc2-1D npr1-1, snc2-1D npr4-4D and snc2-1D npr1-1 npr4-4D plants. The picture was photographed four weeks after planting.   51 (L-M) Expression of SARD1 (L) and WRKY70 (M) in wild type (WT), snc2-1D, snc2-1D npr1-1, snc2-1D npr4-4D and snc2-1D npr1-1 npr4-4D plants. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (N) Growth of H.a. Noco2 on wild type (WT), snc2-1D, snc2-1D npr1-1, snc2-1D npr4-4D and snc2-1D npr1-1 npr4-4D. Two-week-old seedlings were sprayed with spores of H.a. Noco2 [5×104 spores/ml]. Infection was scored seven days after inoculation by counting the numbers of spores per gram of leaf samples. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 4).  (O) Growth of H.a. Noco2 on wild type (WT), npr1-1, npr4-4D and npr1-1 npr4-4D double mutant plants. Two-week-old seedlings were sprayed with spores of H.a. Noco2 [1×104 spores/ml]. Infection was scored seven days after inoculation by counting the numbers of spores per gram of leaf samples. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 4).  (P-Q) Growth of P.s.t. DC3000 (P) or P.s.t. DC3000 hrcC- (Q) on the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.t. DC3000 (OD600 = 0.0002) or P.s.t. DC3000 hrcC– (OD600 = 0.002). cfu, Colony-forming units. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 6).   2.3.12  Opposite roles of NPR1 and NPR4 in early defence gene expression in response to SA  To assess the contribution of NPR1 and NPR4 to early SA-induced gene expression, we carried out RNA-sequencing (RNA-seq) analysis on wild-type, npr1-1 and npr4-4D plants before and after SA treatment. Two-week-old seedlings were treated with SA for one hour prior to sample collection. In the wild type plants, 2455 genes were found to be differentially expressed upon SA treatment (fold change ≥ 2 and false discovery rate (FDR) < 0.05), including 1543 induced genes and 912 repressed   52 genes. Gene ontology enrichment analysis showed that genes involved in defence responses were highly enriched among SA-induced genes (Figure 2.12A). Consistent with the involvement of TGA transcription factors in SA-induced defence gene expression, the preferred TGA2-binding sequence “TGACTT” is overrepresented in the promoters (1 kb upstream of the translation start sites) of the 1543 SA-induced genes (P <10−9). Surprisingly, many key regulators of plant immunity were induced within one hour after SA treatment. Consistent with the antagonistic interactions between SA and JA, genes involved in JA-related processes are enriched among genes down-regulated in response to SA treatment (Figure 2.12A).  Among the 1543 genes induced by SA, the induction of 1107 and 286 genes is attenuated in npr1-1 and npr4-4D respectively (log fold change ≥ 0.5 and FDR <0.05). Most genes affected by npr4-4D were also affected by npr1-1 (Figure 2.12B and 2.12C), which is not surprising considering that regulation of defence gene expression by NPR1 and NPR4 is mediated by the same TGA transcription factors. Further analysis showed that 588 out of the 1107 genes affected by npr1-1 and 252 out of the 286 genes affected by npr4-4D can still be partially induced by SA. To determine whether npr1-1 and npr4-1D have additive effect on the induction of these genes, we carried out additional RNA-seq analysis on the npr1-1 npr4-4D double mutant before and after SA treatment. The induction of 331 genes partially affected in npr1-1 and 181 gene partially affected in npr4-4D is completely blocked in the double mutant (FDR <0.05), confirming the additive effect of npr1 and npr4-4D mutants in SA-induced immunity.  The expression of five representative genes regulated by both NPR1 and NPR4 (WRKY70, MC2, NAC004, RLP23, and WRKY51) was validated by qRT-PCR analysis. As shown in Figure 2.12D and 2.12E, the induction of these genes by SA is lower in npr1-1 and npr4-4D than in the wild type, and further reduced in npr1-1 npr4-4D compared with the single mutants. We also examined the induction of SARD1, MC2, NAC004, and WRKY51 in npr1-7, a deletion mutant lacking the translation start codon and most of the coding region of NPR1. Similarly, induction of these four genes by SA is partially blocked in npr1-7 and completely blocked in the npr1-7 npr4-4D double mutant (Figure 2.12F). Together these data support that NPR1 and NPR4 act independently in the regulation of SA-induced gene expression.   53  Figure 2.12 Opposite roles of NPR1 and NPR4 in early defence gene expression in response to SA.   54 (A) Gene ontology (GO) enrichment analysis of SA-induced and SA-repressed genes. The x-axis indicates the enrichment scores for each of the biological process GO terms. Up to the top 15 significantly enriched GO terms are shown. Red = GO-term enrichment of SA-induced genes, Green = GO-term enrichment of SA-repressed genes. (B) Clustering analysis of RNA-seq samples. Raw counts were rlog transformed and compared using R package pheatmap. The y-axis represents SA-induced and SA-repressed genes, the x-axis represents the independent samples, and the fill represents the rlog normalized expression relative to the mean of the expression across all samples. WTS1, SA-treated wild type sample 1; WTS2, SA-treated wild type sample 2; N4S1: SA-treated npr4-4D sample 1; N4S2: SA-treated npr4-4D sample 2; N1S1: SA-treated npr1-1 sample 1; N1S2: SA-treated npr1-1 sample 2; WTM1, mock-treated wild type sample 1; WTM2, mock-treated wild type sample 2; N4M1, mock-treated npr4-4D sample 1; N4M2, mock-treated npr4-4D sample 2; N1M1, mock-treated npr1-1 sample 1; N1M2, mock-treated npr1-1 sample 2.  (C) SA-induced genes dependent on NPR1 or NPR4. Among genes induced by SA, the induction of 1107 genes is attenuated in npr1-1 and the induction of 286 genes is attenuated in npr4-4D (log fold change ≥ 0.5 and FDR <0.05). (D-E) Induction of WRKY70 gene expression by SA in wild type (WT), npr1-1, npr4-4D and npr1-1 npr4-4D plants. Two-week-old seedlings were sprayed with 50 µM SA. Samples were collected 0 and 1 h after treatment for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (E) Induction of MC2, NAC004, RLP23 and WRKY51 gene expression by SA in wild type (WT), npr1-1, npr4-4D and npr1-1 npr4-4D plants. Two-week-old seedlings were sprayed with 50 µM SA. Samples were collected 0 and 1 h after treatment for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (F) Induction of SARD1, MC2, NAC004 and WRKY51 by SA in wild type (WT), npr1-7, npr4-4D and npr1-7 npr4-4D. Two-week-old seedlings grown on MS media were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment for qRT-  55 PCR analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats.  2.4 Discussion  Previously we showed that NPR3 and NPR4 function redundantly as negative regulators of plant immunity (Zhang et al. 2006), but the mechanism of how they regulate plant defence responses was unclear. Here we show that NPR3/NPR4 serve as transcriptional repressors of key immune regulators such as SARD1 and WRKY70 and repression of SARD1 and WRKY70 expression by NPR3/NPR4 is facilitated by their interacting transcription factors TGA2/TGA5/TGA6. When tethered to the Gal4 DNA-binding domain, NPR3/NPR4 repress the transcription of a reporter gene under the control of a promoter with Gal4 DNA-binding sites, further supporting that NPR3/NPR4 function as transcriptional repressors. Surprisingly, SA serves as an inhibitor of NPR3/NPR4. In the SA-insensitive npr4-4D mutant, SA-induced defence gene expression is attenuated. In addition, treatment with SA abolishes the repression of the pSARD1::Luc and pWRKY70::Luc reporter genes by NPR4, but not the SA-insensitive NPR4R419Q mutant.  Multiple lines of evidence suggest that SA-induced de-repression of defence genes is critical in activating plant immunity, despite that the number of genes affected by the npr4-4D mutation is much less than those affected in npr1-1. Similar to npr1-1, npr4-4D displayed enhanced susceptibility to H.a. Noco2 and INA-induced resistance to the pathogen is completely blocked in npr4-4D. npr4-4D is also more susceptible to P.s.t. DC3000 and P.s.t. DC3000 hrcC-. In addition, the constitutive defence responses in snc2-1D npr1-1 are almost completely suppressed by npr4-4D. The effects of npr4-4D and npr1-1 on plant defence are almost always additive, suggesting that both de-repression and activation of SA-responsive genes are important to activating plant immunity. Our study confirms NPR1 as a high-affinity SA-binding protein and provides strong evidence that the SA-binding activity of NPR1 is required for it function in SA-induced immunity. Previously two evolutionarily unconserved Cys residues   56 (Cys521/Cys529) in NPR1 were shown to be required for SA-binding and SA-induced PR1 expression (Rochon et al. 2006; Wu et al. 2012). Whether they are required for the induction of other defence genes and resistance to pathogens by SA is unclear. Unlike Cys521/Cys529, the Arg-432 residue in NPR1 and the corresponding Arg-419 in NPR4 are highly conserved among NPR1/NPR3/NPR4 and their orthologs in other plants. The NPR1 R432Q mutation, which disrupts SA-binding but not its interactions with TGA2 and NIMIN1, abolishes its function in promoting SA-induced defence gene expression and pathogen resistance. Together these data strongly support that NPR1 is a bona fide SA receptor.  Our data do not support the previous hypothesis that NPR3/NPR4 regulate plant immunity by controlling NPR1 protein levels (Fu et al. 2012). Multiple lines of evidence from our study suggest that NPR3/NPR4 function independently of NPR1 in plant immunity. First, the npr4-4D mutant was isolated in a background containing the npr1-1 mutation, a null allele of NPR1 that was previously shown to completely abolish its interaction with the TGA transcription factors and SA-induced PR gene expression (Cao et al. 1994; Zhang et al. 1999), and the npr4-4D and npr1-1 mutations have additive effects on the suppression of the autoimmune phenotypes of snc2-1D. Second, the npr1-1 mutation has no effect on the increased SARD1 and WRKY70 expression in npr3 npr4 mutant plants. Third, repression of the pSARD1::Luc and pWRKY70::Luc reporter genes by NPR4 is not affected by npr1-1. Finally, the induction of a large number of genes by SA is partially affected in the npr4-4D and npr1-1 single mutants, but completely blocked in the npr4-4D npr1-1 double mutant. Furthermore, previously reported interactions between NPR3/NPR4 and NPR1 cannot be independently confirmed under our experimental conditions. Whether NPR3/NPR4 really function as E3 ligases for degrading NPR1 needs to be further evaluated.  SA has been known as an inducer of plant defence responses for many years, but how SA treatment results in enhanced resistance against pathogens was unclear. Our RNA-seq analysis revealed that SA treatment results in rapid induction of a large number of genes within one hour. Among the early SA-induced genes, many encode key regulators required for plant immunity. Overexpression of some of these immune regulators such as SARD1, WRKY70, SOBIR1, ALD1, ADR1 and EDS1/PAD4 has   57 previously been shown to result in enhanced pathogen resistance (Cecchini et al. 2015; Cui et al. 2017; Gao et al. 2009; Grant et al. 2003; Li et al. 2004; Y. Zhang, Xu, et al. 2010),  suggesting that their induction by SA contributes to SA-induced immunity. Interestingly, a number of known negative regulators of plant immunity are also rapidly up-regulated following SA treatment. The induction of these genes might play important roles in negative feedback regulation of defence responses.  Our SA-binding data suggest that both NPR3 and NPR4 are high-affinity SA receptors. The SA-binding affinities for NPR3 (Kd = 176.7 ± 28.31 nM) and NPR1 (Kd = 223.1 ± 38.85) are comparable, whereas the affinity of NPR4 to SA (Kd = 23.54 ± 2.743 nM) is considerably higher. The Kds for the MBP-tagged NPR1 and NPR4 protein in our study are similar to the previously reported Kds for NPR1 and NPR4 (Fu et al. 2012; Manohar et al. 2014; Wu et al. 2012), but the Kd for the MBP-tagged NPR3 is much lower than the previously reported Kd for the GST-tagged NPR3, which could be due to low activity of the GST-NPR3 recombinant protein used in the assay. In the absence of pathogen infection, the basal level of SA in Arabidopsis leaf tissue is around 1.4 µM (0.2 µg per g of tissue) (Kong et al. 2016), which is much higher than the Kds for NPR1 and NPR3/NPR4. As defence genes are not strongly induced by the basal level of SA, the SA-binding affinities for endogenous NPR1 and NPR3/NPR4 proteins might be considerably lower than what is observed with the recombinant proteins due to potential post-translational modifications in the plant cells. Alternatively, the concentration of SA in the nucleus could be lower than the average SA level in case of uneven distribution of SA in different subcellular compartments. NPR1 was previously shown to interact with the promoter of PR1 before and after SA treatment (Rochon et al. 2006). SA induces a conformational change in the C-terminal transactivation domain of NPR1, which results in the release of the inhibitory effect of the N-terminal BTB/POZ domain and activation of NPR1 (Wu et al. 2012). Interestingly, SA was also shown to promote the interaction between NPR1 and TGA2 in transient expression assays using tobacco and potato protoplasts (Subramaniam et al. 2001). Our ChIP-PCR data showed that NPR3/NPR4 also interact with the promoters of defence genes. SA treatment has no effect on these interactions, consistent with the observation that SA does not block the interactions between TGA2   58 and NPR3/NPR4. As SA abolishes GD-NPR3 and GD-NPR4-mediated repression of the luciferase reporter gene driven by a promoter with Gal4 DNA-binding sites, it is likely that binding of SA directly affects the transcriptional repression activities of NPR3/NPR4. In summary, NPR1 functions as a transcriptional activator and NPR3/NPR4 serve as redundant transcriptional repressors for SA-responsive defence genes. NPR1 and NPR3/NPR4 all interact with and are dependent on TGA transcription factors for their activities. We propose a model where there is an equilibrium of NPR:TGA:promoter complexes in the plant cells, with dynamic exchange of specific NPR and TGA proteins (Figure 2.13). Binding of SA to NPR3/NPR4 inhibits their transcriptional repression activity, whereas perception of SA by NPR1 enhances its transcriptional activation activity, both contribute to induction of defence gene expression. Although SA is the first case in plants where one hormone is perceived by multiple non-redundant receptors, such examples do exist among neurohormones such as epinephrine, dopamine and histamine. The evolution and maintenance of different receptors for SA is most likely due to the requirement for intricate control of the SA responses. When the SA levels are low, NPR3/NPR4 repress defence gene expression, which prevents autoimmunity. Increased SA accumulation removes the repression and allows further induction of defence gene expression through the transcription activator NPR1.     59  Figure 2.13 A working model of NPR1/NPR3/NPR4 in SA-induced defence activation. (A) When the SA level is low under uninfected state, NPR3/NPR4 interacts with TGA2/TGA5/TGA6 to inhibit the expression of defence-related gene expression.  (B) As the SA level increases during pathogen infection, SA binds to NPR3/NPR4 to release the transcriptional repression of defence genes.  (C) Meanwhile, binding of SA to NPR1 promotes activation of the transcription of the defence genes.   2.5 Material and methods  2.5.1 Plant Material and Growth Condition  All Arabidopsis mutants used are in the Columbia (Col-0) ecotype. The npr1-1, agb1-2, snc2-1D, snc2-1D npr1-1, npr3-1 npr4-3, npr3-1 npr4-3 npr1-1, tga2-1 tga5-1 (tga25), tga6-1 and tga2-1 tga5-1 tga6-1 (tga256) mutants were reported previously (Cao et al. 1994; Sun et al. 2015; Ullah et al. 2003; Zhang et al. 2006; Zhang, Tessaro, et al. 2003; Y. Zhang, Yang, et al. 2010). The npr3-2 npr4-2 npr1-1 triple mutant was obtained by crossing npr1-1 with npr3-2 npr4-2. The bda4-1D (npr4-4D) snc2-1D npr1-1   60 mutant was identified from an EMS-mutagenized snc2-1D npr1-1 mutant population (Y. Zhang, Yang, et al. 2010). The npr4-4D single and snc2-1D npr4-4D double mutant were obtained by crossing npr4-4D snc2-1D npr1-1 with Col-0 wild type plants. The npr4-4D npr1-1 double mutant was obtained by crossing npr1-1 with npr4-4D. The sextuple mutant snc2-1D npr1-1 npr4-4D tga256 was obtained by crossing snc2-1D npr1-1 npr4-4D with tga256. snc2-1D npr1-1 npr4-4D tga25 and snc2-1D npr1-1 npr4-4D tga6-1 were isolated from the same population. The npr1-7 and npr4-4D npr1-7 mutants were generated by transforming a CRISPR-Cas9 construct expressing two guide RNAs targeting the NPR1 locus into wild type and npr4-4D background. The deletion in npr1-7 was confirmed by Sanger sequencing. The NPR1-HA and NPR1R432Q-HA transgenic lines were generated by transforming npr1-1 plants with Agrobacteria strains carrying pCambia1305-NPR1-3HA or pCambia1305-NPR1R432Q-3HA constructs, which contain the wild type or mutant NPR1 gene driven by its own promoter. Plants were grown under 16 h light at 23℃ and 8 h dark at 19℃ for long day conditions and 12 h light at 23℃ and 12 h dark at 19℃ for short day conditions.   2.5.2 Mutant characterization  For gene expression analysis, RNA was isolated from two-week-old seedlings grown on ½ MS media and used for subsequent quantitative reverse transcription PCR (qRT-PCR) analysis. Each experiment was repeated three times with independently grown plants. Briefly, RNA was extracted using the EZ-10 Spin Column Plant RNA Mini-Preps Kit from Biobasic (Canada) and treated with RQ1 RNase-Free DNase (Promega, USA) to remove the genomic DNA contaminations. Reverse transcription was carried out using the EasyScript™ Reverse Transcriptase (ABM, Canada). qPCR was performed using the Takara SYBR Premix Ex (Clontech, USA). Primers for qPCR were described previously (Sun et al. 2015; Zhang, Tessaro, et al. 2003) or listed in Table 2.1. Analysis of resistance to H.a. Noco2 was carried out by spraying two-week-old seedlings with H.a. Noco2 spores at a concentration of 5×104 spores/mL. Growth of H.a. Noco2 was quantified as previously described (Bi et al. 2010). Bacterial infection assays   61 were carried out by infiltrating two fully grown leaves of four-week-old plants grown under short day conditions.   2.5.3 Genetic mapping of npr4-4D  Crude mapping of the npr4-4D mutation was carried out using the F2 population of a cross between npr4-4D snc2-1D npr1-1 (in Col-0 ecotype background) and Landsberg erecta (Ler). The genome of npr4-4D snc2-1D npr1-1 was re-sequenced using Illumina sequencing to identify single nucleotide polymorphisms between the mutant and wild type. Fine mapping was carried out using F2 population of a cross between npr4-4D snc2-1D npr1-1 and snc2-1D npr1-1 using single nucleotide polymorphisms identified by the whole genome sequencing.  To confirm that the npr4-4D mutation is responsible for the suppression of the autoimmunity in snc2-1D npr1-1, a genomic fragment of NPR4 was amplified from npr4-4D genomic DNA using primers NPR4-KpnI-F and NPR4-SalI-R and cloned into the binary vector pCambia1305. The construct was transformed into Agrobacteria strain GV3101 and used to transform snc2-1D npr1-1 and npr3-2 npr4-2 plants.  A genomic fragment of NPR3 was amplified using primers NPR3-BamHI-F and NPR3-PstI-R and cloned into binary vector pCambia1305-35S. The NPR3R428Q mutant was generated by overlapping PCR using primers NPR3-RQ-R and NPR3-RQ-F. The resulting constructs were used to transform snc2-1D npr1-1 plants. The sequence of primers used for cloning is listed in Table 2.1.  2.5.4 Promoter-luciferase Assay  An 1887 bp fragment upstream of SARD1 coding sequence or a 1075 bp fragment upstream of WRKY70 coding sequence was cloned into pGreenII0229-LUC-nos vector. Promoter with mutations in the TGACG motif was generated by overlapping PCR.  The 35S-NPR3 (pCambia1300-35S-NPR3-3HA) and 35S-NPR4 (pCambia1300-35S-NPR4-3HA) constructs were generated by inserting PCR fragments containing the coding regions of NPR3 or NPR4 into pCambia1300-35S-3HA. The NPR4GVK mutation   62 was generated by overlapping PCR and introduced into the 35S-NPR4 construct. The constructs used in the transcriptional repressor assays were described previously (Tiwari et al. 2006) except that the GUS reporter gene was replaced with a PCR fragment containing the Renilla luciferase reporter gene amplified using primers Rluc-XhoI-F and Rlus-SacI-R. The coding regions of NPR3, NPR4 and the C-terminus region of NPR4 was amplified from the wild type cDNA and cloned in to pUC19-35S-GD. Primers used for the PCR amplification are listed in Table 2.1 and All constructs were confirmed by Sanger sequencing. Promoter activity assays were performed in Arabidopsis protoplasts by transforming the reporter constructs together with the different effector constructs. Protoplasts were prepared as previously described (Wu et al. 2009). A pUBQ1-driven Renilla luciferase reporter was included in the firefly luciferase assays as internal transfection control. A 35S-driven firefly luciferase reporter was included in the Renilla luciferase assays as internal transfection control. After 16 h incubation, protoplasts were collected and the dual-luciferase assay system (Promega) was used to measure the activity of firefly luciferase and renilla luciferase sequentially using a BioTekTM SynergyTM 2 Multi-Mode Microplate Reader.  2.5.5 Yeast two-hybrid assay  The yeast two-hybrid vectors pBI880 (BD vector) and pBI881 (AD vector) and the constructs pBI880-NPR3 (BD-NPR3), pBI880-NPR4 (BD-NPR4) and pBI881-TGA2 (AD-TGA2) were described previously (Kohalmi Nowak, J., and Crosby, W.L. 1997; Zhang et al. 2006). TGA2, NIMIN1, NPR3 and NPR4 fragments were subcloned into pBI881 or pBI880 to obtain pBI881-NIMIN1 (AD-NIMIN1), pBI881-NPR3 (AD-NPR3), pBI881-NPR4 (AD-NPR4) and pBI880-TGA2 (BD-TGA2). The NPR4R419Q coding sequence was amplified from total cDNA of npr4-4D seedlings and the NPR4GVK mutant gene was generated by overlapping PCR. The DNA fragments were inserted into pBI880 to obtain pBI880-NPR4R419Q (BD-NPR4R419Q) and pBI880-NPR4GVK (BD-NPR4GVK). The NPR1 coding sequence was amplified by PCR and inserted into modified pBI880/pBI881 vectors with two Sfi I sites. The NPR1R432Q mutation was   63 introduced by overlapping PCR. All the constructs were confirmed by sequencing and the sequences of primers used for cloning are listed in Table 2.1. Different combinations of the yeast two-hybrid constructs were co-transformed into the yeast strain YPH1347. Colonies grown on synthetic drop media without Leu and Trp (SD-L-W) were cultured for 20 hr in SD-L-W liquid media. The cultures were then serially diluted and plated on synthetic drop media without Leu, Trp and His (SD-L-W-H) containing 4 mM 3-aminotriazole (3AT). Plates were kept at 30℃ for 2 days before taking photos.  2.5.6 ChIP analysis  ChIP-PCR assays were performed as previously described (Sun et al. 2015). The chromatin complex containing TGA2/5/6 proteins were pulled down using anti-TGA2 antibodies and Protein A Agarose beads (GE). The anti-TGA2 antibody was purified form the serum of Rabbit immunized with recombinant TGA2 protein. The specificity of the TGA2 antibodies was confirmed by western blot using total proteins from wild type and tga256 mutant plants. The NPR3-3HA and NPR4-3HA transgenic plants used for ChIP assays were generated by transforming wild type plants with Agrobacteria strains carrying pCambia1300-35S-NPR3-3HA or pCambia1300-35S-NPR4-3HA. Twelve-day-old seedlings were sprayed with 50 μM SA in H2O (plus 0.01% silwet L-77) or H2O one hour before crosslinking. The chromatin complexes containing NPR3-3HA or NPR4-3HA fusion protein were immunoprecipitated using an anti-HA antibody (Roche) and Protein A/G Agarose beads (GE). The immunoprecipitated DNA was analyzed by qPCR using gene specific primers which were listed in the Table 2.1.  2.5.7 Co-immunoprecipitation  The pCambia1300-35S-NPR4-3FLAG construct was generated by inserting a genomic fragment of NPR4 amplified by PCR using primers NPR4cds-KpnI-F and NPR4cds-BamHI-R into pCambia1300-35S-3flag. The pCambia1300-35S-NPR4R419Q-3FLAG construct was generated similarly using PCR fragments amplified from npr4-4D   64 genomic DNA. Constructs expressing NPR3-FLAG-ZZ and NPR4-FLAG-ZZ fusion proteins were generated by subcloning NPR3 and NPR4 genomic fragments into a modified pCambia1305 vector pBASTA-35S-FLAG-ZZ. The coding sequence of Cul3A was amplified from WT cDNA by PCR and cloned into pCambia1300-35S-3HA to obtain pCambia1300-35S-Cul3A-3HA. All the constructs were confirmed by sequencing and the sequences of primers used for cloning are listed in Table 2.1. The constructs were transformed into Agrobacteria strain GV3101. For transient expression of the epitope tagged proteins in N. benthamiana, leaves of about four-week-old plants were infiltrated with Agrobacteria suspension (OD600 = 0.5). Two days later, about 2 g of tissue from the infiltrated area was collected and frozen with liquid nitrogen. The tissue was grinded into powder using a mortar and a pestle. All subsequent steps were carried out on ice or in a 4°C cold room. Briefly, about two volumes of extraction buffer (10% glycerol, 25 mM Tris–HCl pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.15% NP-40, 1mM NaF, 1mM PMSF, 10 mM DTT, 2% PVPP, 1× protease inhibitor cocktail from Roche) were added to each sample to homogenize the powder. The resuspended samples were centrifuged at 14,000 rpm for 10 min and the supernatant was subsequently transferred to 2 ml microcentrifuge tubes. The supernatant was centrifuged again to remove additional debris. Afterwards it was transferred to a new tube containing anti-FLAG-conjugated beads (Sigma) and incubated for 2 h. The beads were collected by centrifugation and washed four times with the extraction buffer. Protein bound to the beads were eluted by adding 1´ SDS loading buffer (preheated to 95°C) followed with 5-min incubation at room temperature. The eluted proteins were analyzed by western blot using an anti-FLAG antibody (Sigma) or an anti-HA antibody (Roche).  2.5.8 Recombinant protein expression and purification  The coding sequences of NPR1 and NPR4 were amplified by PCR and cloned into a modified pMAL-c2x (NEB) vector to express the His6-MBP fusion proteins.  NPR4R419Q was amplified from the cDNA prepared from npr4-4D total RNA. The NPR1R432Q mutation was introduced by overlapping PCR. All the constructs were   65 confirmed by sequencing and the sequences of primers used for cloning are listed in Table 2.1. For protein expression, the constructs were transformed into the E. coli Rosetta2 (DE3) strain. The bacteria were cultured in LB media containing 100 μg/ml Ampicillin and 34 μg/ml chloramphenicol to an OD600 of 0.4 at 37°C and then switch to 18°C. One hour after switching, IPTG was added to a final concentration of 0.2 mM to induce protein expression. After incubation at 18°C for 20 hr, the bacteria were collected by centrifugation and stored at -80°C until use. The recombinant proteins were purified following the procedure described previously (Manohar et al. 2014). The bacteria were resuspended in lysis buffer (50 mM tris pH 7.4, 500 mM NaCl, 10% glycerol, 20 mM Imidazole, 0.1% triton X-100 and 1 mM PMSF) and lysed by sonication. After spinning at 15000 g for 30 min at 4°C, the clear supernatant was applied to an Ni-NTA column and washed with about 40× bed volumes of lysis buffer containing increasing concentrations (20, 30, and 40 mM) of imidazole. Proteins were eluted by adding lysis buffer containing 250 mM of imidazole. The eluted His6-MBP-NPR1 protein was dialyzed three times with PBS buffer containing 10% glycerol and 0.1% Triton X100 at 4°C. The eluted His6-MBP-NPR4 protein was treated with 200 mM DTT for 30 min on ice before dialysis against PBS buffer with 10% glycerol, 2mM DTT and 0.1% Triton X100 at 4°C. The protein after dialysis was aliquoted and stored at −80°C until use.  2.5.9 [3H]SA-binding assay  Size exclusion chromatography was used for [3H] SA binding assays as described previously (Manohar et al. 2014). Size exclusion columns were prepared by adding 0.1g of sephadex™ G-25 (GE healthcare) to QIAGEN shredder columns. The columns were pre-equilibrated with PBS buffer containing 0.1% Tween-20 overnight at 4°C, and excess buffer was removed by spinning at 735×g for 2 min. The binding reactions were carried out with 200 nM [3H] SA (American Radiolabelled Chemicals, specific activity 30 Ci/mmol) with or without the presence of unlabeled SA (10,000-fold excess) in 50 μl of PBS buffer. The reaction mixtures were incubated on ice for 1 h, and then loaded to the columns and centrifuged immediately as above. The flow through   66 was collected and the radioactivity was measured by a scintillation counter (LS6500; Beckman Coulter). The saturation binding experiments were performed using [3H] SA concentration from 6.25 to 800 nM and the dissociation constant (Kd) was calculated by fitting the specific binding data into non-linear model of Michaelis-Menten equation using GraphPad Prism4.  2.5.10 RNA-Seq analysis  For RNA-seq analysis, two-week-old seedlings of npr1-1, npr4-4D, npr1-1 npr4-4D and wild- type plants grown on ½ MS media were sprayed with 50 µM SA and samples were collected 0 or 1 h after treatment with SA. RNA was extracted using RNeasy Mini Kit (Qiagen) with on-column DNase digestion, following the manufacturer’s instructions. Library preparation and RNA-seq were performed by BGI America or Novogene using an Illumina HiSeq 2000 resulting in ~21-25 million reads per sample. Raw RNA-seq reads were subjected to quality checking and trimming to remove adaptor sequences, contamination and low-quality reads. The trimmed reads of each sample were aligned to the publicly available reference genome of Arabidopsis (TAIR10, https://support.illumina.com/sequencing/sequencing_software/igenome.html) using HISAT2 version 2.0.4 on default parameters (Kim et al. 2015). SAMtools version 0.1.12 was used to convert SAM files, sort and index BAM files (Li et al. 2009). Read counts were generated for each gene using summarizeOverlaps (R package GenomicAlignments) with the following settings: mode = "Union", ignore.strand = TRUE, inter.feature  = FALSE, singleEnd = TRUE (Lawrence et al. 2013). R package DESeq2 version 1.16.1 was used to determine differentially expressed genes (Love et al. 2014). Gene Ontology (GO) analysis was performed to search for significantly over- or under-represented GO terms using the R package goseq version 1.28.0 (Young et al. 2010) with TAIR10 GO annotations. Clustering was performed using R package pheatmap version 1.0.8 using rlog transformed counts. Finally, plots were created using R package ggplot2 version 2.2.1.    67 Table 2.1 Primer used in chapter 2 Primer 5'-3' sequence Purpose Vector NPR4-KpnI-F ccggGGTACCCATGAGTTTTGCTACTCGTG Cloning pCAM1305 NPR4-SalI-R gcggcgGTCGACtccagagtctgttacaggtt Cloning pCAM1305 NPR3-BamHI-F CGCGGATCCATGGCTACTTTGACTGAGC Cloning pCAM1305-35S NPR3-PstI-R AAAACTGCAGTGTTGTGTTGTGCAGGTCAT  Cloning pCAM1305-35S WRKY701kbpro-KpnI-F ccggGGTACCtttccgggtgaaagaaaatac Cloning pG229-Luc-Nos WRKY701kbpro-EcoRI-R ccgGAATTCttgttagttttgaggaagttt Cloning pG229-Luc-Nos W70pro-MT-F atttaatttgagcttatttaaagctcaccataagcaaaa Cloning pG229-Luc-Nos W70pro-MT-NR gtgagctttaaataagctcaaattaaatagtgatgaatg Cloning pG229-Luc-Nos NPR4cds-KpnI-F ccggGGTACCATGGCTGCAACTGCAATAGA Cloning pCAM1300-35S-3HA NPR4cds-StuI-R gagaAGGCCTTGTTGGATTCTCTAAGGCTTC Cloning pCAM1300-35S-3HA NPR3cds-KpnI-F ccggGGTACCATGGCTACTTTGACTGAGCCA Cloning pCAM1300-35S-3HA NPR4cds-BamHI-R cgccgcGGATCCTGTTGGATTCTCTAAGGCTTC Cloning pCAM1300-35S-3flag NPR3-SpeI-R cccACTAGTTGTTGTGTTGTGCAGGTCATC Cloning pCAM1300-35S-3HA NPR4-GVK-F GGTAAAGTCGgTgTAAAgGAAACGCCTTATG Cloning pCAM1300-35S-3HA NPR4-GVK-R CATAAGGCGTTTCcTTTAcAcCGACTTTACC Cloning pCAM1300-35S-3HA NPR3-RQ-R cagtcaattacCTTGCTTTTCTAGGTACA Cloning pCAM1305-35S NPR3-RQ-F TGTACCTAGAAAAGCAAGgtaattgactg Cloning pCAM1305-35S NPR1pro-KpnI-F ccggGGTACCtttatacaatatatgtacgg Cloning pCAM1305-3HA NPR1-BamHI-R CGCCGCGGATCCCCGACGACGATGAGAGAGTT Cloning pCAM1305-3HA SARD1-PF AACACCGCTCGAGGGAGATGACTCGAGCTCATA Cloning pG229-Luc-Nos SARD1-PR CGCGGATCCGGAATTGTTCTGGTGAGTTGT Cloning pG229-Luc-Nos SARD1pro-mutF tttaaattaaaagtctccctatttattaaaccataaatagattattcg Cloning pG229-Luc-Nos SARD1pro-mutR Ggtttaataaatagggagacttttaatttaaactccaatttagaaagc Cloning pG229-Luc-Nos pAtUBQ1-HindIII-F tgcAAGCTTcccgggatatttcacaaatt Cloning pUC19 pAtUBQ1-BamHI-R ggcGGATCCtttgtgtttcgtcttctctc Cloning pUC19 Rluc-BamHI-F ggcGGATCCATGACTTCGAAAGTTTAT Cloning pUC19 Rluc-sacI-R cggGAGCTCTTATTGTTCATTTTTGAG Cloning pUC19 NPR1-RQ-F(genomic) TCGATCTTGAAAATCAAGGTATCTATCAAG Cloning pCAM1305-3HA   68 Table 2.1 Primer used in chapter 2 Primer 5'-3' sequence Purpose Vector NPR1-RQ-R(genomic) CTTGATAGATACCTTGATTTTCAAGATCGA Cloning pCAM1305-3HA NPR1-NdeISfi1A-F cggaattcCATATG aGGCCGTCAAGGCCa ATGGAC ACCACCATTGATGG Cloning pBI880 NPR1-Sfi1BSacI-R cgggatccGAGCTC GGCCCATGAGGCCTCACCGAC GACGATGAGAGA Cloning pBI880 NPR1CDS-RQ-F TCGATCTTGAAAATcaaGTTGCACTTGCTC Cloning  NPR1CDS-RQ-R GAGCAAGTGCAACttgATTTTCAAGATCGA Cloning  Rluc-Xho1-F GGATTCCTCGAGATGACTTCGAAAGTTTATGA Cloning  Rluc-sacI-R cggGAGCTCTTATTGTTCATTTTTGAG Cloning  NPR4-Sfi1A-F cgcggatccGGCCGTCAAGGCCaATGGCTGCAACTG CAATAGA Cloning pUC19-GD NPR4-Sfi1B-R cgcggatccGGCCCATGAGGCCTCATGTTGGATTCT CTAAGG Cloning pUC19-GD NPR4Cter-Sfi1A-F cgcggatccGGCCGTCAAGGCCaATGTGTAGGAGA CTCACTAG Cloning pUC19-GD NPR3-Sfi1A-F cgcggatccGGCCGTCAAGGCCaATGGCTACTTTGA CTGAGCC Cloning pUC19-GD NPR3-Sfi1B-R cgcgaattcGGCCCATGAGGCCTCATGTTGTGTTGT GCAGGTC Cloning pUC19-GD CUL3A-KpnI-F cggGGTACCtttgttttggattcaggtttcaaaat cloning pCAM1300-35S-3HA CUL3A-StuI-R gccAGGCCTGGCTAGATAGCGGTAAAGTT cloning pCAM1300-35S-3HA AtPOB1-KpnI-F cggGGTACCATGAGAGGTACTACTGAGAA cloning pBasta-35s-Flag-zz AtPOB1-SpeI-F aaggACTAGTAGGATCTGTAGACCTTTTGAT cloning pBasta-35s-Flag-zz WRKY70RT-F GCCAAATTCCCAAGAAGTTAC RT  WRKY70RT-R CTTGTGATCTTCGGAATCCAT RT  NAC004-RT-F CGATTGAGGAGGAATGGAAA RT  NAC004-RT-R GGACCTTGGCTCACCTCTT RT  RLP23-RT-F ATCAAGGTCCTCTCGGGTTT RT  RLP23-RT-R TATAACCATAGCCGCCTTCG RT  MC2-RT-F GATGAGGAAGAGGAAGTAAACC RT  MC2-RT-R GCTCAACTGTGGTTCCTGAGT RT  WRKY51-RT-F TGGAGGAAGTATGGCAAGAAA RT  WRKY51-RT-R TAAGCTGCATCGTCACCATC RT    69 Table 2.1 Primer used in chapter 2 Primer 5'-3' sequence Purpose Vector FCA2-F GTTGATGGAACCATCCGAGGATCC Mapping  FCA2-R GGAGCATGGTGCACTCCTCCTAG Mapping  T13J8-F ATGTTCCCAGGCTCCTTCCA Mapping  T13J8-R GAGATGTGGGACAAGTGACC Mapping  NPR4-F gcttcgtaactatgttgagaag Genotyping  NPR4-R atctttcggcctagtgagtc Genotyping  NPR3-F ctccagatgagactgttgtacc Genotyping  NPR3-R cgcggatcctggtgcagtttcatgttgtg Genotyping  NPR1_gR1_BsF ATATATGGTCTCGATTGATTCATCGGAACCTGTT GAGTT Cloning pHEE401E NPR1_gR1_F0 TGATTCATCGGAACCTGTTGAGTTTTAGAGCTAG AAATAGC Cloning pHEE401E NPR1_gR2_R0 AACCAAGCCAGTTGAGTCAAGTCAATCTCTTAGT CGACTCTAC Cloning pHEE401E NPR1_gR2_BsR ATTATTGGTCTCGAAACCAAGCCAGTTGAGTCA AGTC Cloning pHEE401E SARD1pro0.3kb-chipF ggaaccgtccatttgtcaac ChIP-PCR  SARD1pro0.3kb-chipR ttcgaagaacgacaaaggaaa ChIP-PCR  CBP60Gpro0.15kb-chipF gtttcactgctgcttcgtca ChIP-PCR  CBP60Gpro0.15kb-chipR GGCTGTTCCGAATCTTCATt ChIP-PCR  WRKY70-P-FP AAGCAAAAGAAATGGGTGGA ChIP-PCR  WRKY70-P-RP TTTCCTCTTGGTGTGGTTTG ChIP-PCR             70 3 A forward genetic screen to identify novel components in the SNC2-mediated plant resistance pathway  3.1 Summary  Plants utilize a large number of immune receptors to recognize pathogens and activate defence responses. A small number of these receptors belong to the receptor-like protein family. Previously, we showed that a gain-of-function mutation in the receptor-like protein SNC2 leads to constitutive activation of defence responses in snc2-1D mutant plants. To identify additional defence signaling components downstream of SNC2, we carried out a suppressor screen in the Arabidopsis eds5-3 snc2-1D npr1-1 mutant background. Four new mutants were identified from this screen. Map-based cloning of two of the suppressor genes, BDA5 and BDA6, showed that they encode FMO1 and ALD1 respectively, which are involved in biosynthesis of N-Hydroxypipecolic Acid (NHP) and Pip. Loss-of-function mutations in FMO1 or ALD1 can suppress the dwarf morphology and constitutive defence responses in eds5-3 snc2-1D npr1-1 and also result in enhanced susceptibility to virulent oomycete pathogens. These data suggest that FMO1 and ALD1 are positive regulators functioning downstream of SNC2 to regulate plant immunity.  3.2 Introduction  RLPs are plasma-membrane-localized receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail (Dangl and Jones 2001). In Arabidopsis thaliana, there are 57 putative RLP-encoding genes (Wang et al. 2008). CLV2 and TMM are the first two well-studied RLPs involved in plant development. CLAVATA2 (CLV2) was found to be crucial for maintaining a balanced meristematic stem cell population (Jeong et al. 1999). TOO MANY MOUTHS (TMM), is involved in regulation of stomatal distribution across the epidermis (Nadeau and Sack 2002).    71 In several plant species, RLPs have also been found to play important roles in disease resistance. Cf-9, the first RLP gene identified from tomato (Solanum lycopersicum) mediates resistance against strains of the leaf mold fungus Cladosporium fulvum (Jones et al. 1994). Several other Cf resistance genes have been cloned from tomato that all to belong to the RLP gene family (Dixon et al. 1996; Dixon et al. 1998; Thomas et al. 1997; Takken et al. 1999). In apple (Malus domestica), the RLP HcrVf-2 confers resistance against the apple scab fungus Venturia inaequalis (Belfanti et al. 2004). Emerging studies came out in recent years with newly discovered RLPs involved in plant immunity, including Arabidopsis RLP23, RLP30, RLP1/ReMax (Receptor of eMax) and tobacco NbCSPR (Jehle et al. 2013; Zhang et al. 2013; Albert et al. 2015; Saur et al. 2016).  Unlike most RLPs, SNC2 is highly conserved in plants (Fritz-Laylin et al. 2005). A gain-of-function mutation in SNC2 (snc2-1D) leads to autoimmunity (Y. Zhang, Yang, et al. 2010). The snc2-1D mutant provides a unique system to perform genetic analysis of RLP-mediated immunity in Arabidopsis. Epistasis analysis showed that SNC2-mediated defence responses do not require common signaling components in NLR-mediated signaling, such as EDS1, PAD4 and NDR1 (Y. Zhang, Yang, et al. 2010). This suggests SNC2-mediated resistance pathways are distinct from the NLRs. In addition, mutation in the SA-transporter EDS5 (eds5-3) only partially blocks the expression of the defence marker gene PR2 and has limited effects on the snc2-1D dwarf morphology, suggesting that both SA-dependent and SA-independent resistance pathways are activated downstream of SNC2 (Y. Zhang, Yang, et al. 2010).  On the other hand, the partial suppression of dwarfism by the eds5-3 mutation largely recovers the sterile phenotype of the original snc2-1D npr1-1 double mutant. The eds5-3 snc2-1D npr1-1 triple mutant sets a large number of seeds, which makes it a useful genetic material to perform a more saturated suppressor screen.        72 3.3 Results  3.3.1 eds5-3 snc2-1D npr1-1 suppressor screen  To identify suppressors of eds5-3 snc2-1D npr1-1, approximately 10,000 eds5-3 snc2-1D npr1-1 seeds were treated with ethyl methane sulfonate (EMS). Roughly 4,000 M1 plants were allowed to self-fertilize and harvested into 250 pools with 16 plants per pool. The primary screen was carried out using 500 M2 plants per pool to look for mutants displaying wild-type like morphology. In total, 158 putative eds5-3 snc2-1D npr1-1 suppressors were isolated from the primary screen.  Among the 158 M2 mutant lines that were identified based on morphology, one of the largest plants from each pool was picked and checked for heritability. In the M3 generation, 71 lines showed heritable suppression of the dwarf morphology. To exclude the possibility of wild type contamination, DNA was extracted from each line and subjected to sanger sequencing analysis on SNC2. Among the 71 lines, 5 lines do not contain the original snc2-1D mutation and therefore were excluded from further analysis. Meanwhile, 13 lines of intragenic suppressors were identified by sequencing of SNC2. The mutations are clustered in the LRR domains and a region of 60 amino acids before the LRR domain of the SNC2 protein (Figure 3.1A). As mutations in BDA1 or WRKY70 were previously reported to suppress the autoimmunity in snc2-1D npr1-1 plants (Y. Zhang, Yang, et al. 2010; Yang et al. 2012), the remaining 53 lines were subjected to additional sequencing of BDA1 and WRKY70. 19 mutant lines were found to contain mutations in BDA1, with mutations mostly occuring in the ankyrin repeat domain and the linker between ankyrin repeat domain and transmembrane domain (Figure 3.1B). 2 mutant lines contain mutations in WRKY70 (Figure 3.1 C-D). Excluding mutants with mutations in SNC2, BDA1 or WRKY70, 31 lines emerged as potential novel suppressors. Among them, 7 wild-type like lines were chosen to perform further genetic analysis.    73   Figure 3.1 Map of known gene mutations. (A) Map of thirteen intragenic SNC2 mutations. LRR, leucine rich repeat; TM, transmembrane motif. The G204E and L310F mutations were found twice in mutants from different M1 pool.  (B) Map of nineteen BDA1 mutations. ANK, ankyrin repeat. TM, transmembrane motif. The G217D and S251F mutations were found twice and S242F mutation was found three times in mutants from different M1 pool. (C-D) Map of the WRKY70 mutations. Mutation in (D) occurs in the junction of the second intron and the third exon.      74 3.3.2 Four novel bda mutants suppress autoimmunity in eds5-3 snc2-1D npr1-1 plants  To determine whether the mutation in each mutant is dominant or recessive, backcrosses were performed between each mutant and eds5-3 snc2-1D npr1-1. F1 plants are homozygous for the background mutations (eds5-3 snc2-1D npr1-1) but heterozygous for the mutation of the suppressor. Therefore, a wild-type like morphology observed in the F1 progeny indicates dominant mutations, while a dwarf morphology indicates recessive mutations. Among the 7 bda mutants, only one mutant contains a dominant mutation (Figure 3.2A). Allelism tests and crude mapping revealed that the 7 mutants fall into four complementation groups, named bda3-1D, bda5, bda6, and bda7 (Figure 3.2 B-E).  To further characterize these bda mutants, defence-related phenotypes including PR gene expression and resistance to H.a. Noco2 were assessed. All the mutants showed almost complete suppression of elevated PR2 gene expression except that the bda5-1 eds5-3 snc2-1D npr1-1 plants displayed a partial reduction (Figure 3.2F). Consistently, the enhanced resistance to the virulent oomycete pathogen H.a. Noco2 in eds5-3 snc2-1D npr1-1 plants is fully suppressed by bda3-1D, bda6, and bda7 mutations, and partially suppressed by bda5-1 mutation (Figure 3.2 I-K). Taken together, the bda3-1D, bda5-1, bda6, and bda7 mutations suppress the dwarf morphology as well as constitutive defence responses in the eds5-3 snc2-1D npr1-1 background.   75  Figure 3.2 bad3-1D, bda5-1, bda6 and bda7 suppress the constitutive defense responses in eds5-3 snc2-1D npr1-1.   76 (A) Morphology of wild type (WT), bda3-1D eds5-3 snc2-1D npr1-1, eds5-3 snc2-1D npr1-1 and BDA3/bda3-1D eds5-3 snc2-1D npr1-1 heterozygous plants. Plants were grown on soil and photographed four weeks after planting. (B-E) Morphology of bda3-1D eds5-3 snc2-1D npr1-1 (B), bda5-1 eds5-3 snc2-1D npr1-1(C), bda6 eds5-3 snc2-1D npr1-1 (D), and bda7 eds5-3 snc2-1D npr1-1 (E) and control genotypes. Plants were grown on soil and photographed four weeks after planting. (F-H) Expression of PR2 in wild type (WT), eds5-3 snc2-1D npr1-1 and bda3-1D eds5-3 snc2-1D npr1-1 (F), bda5-1 eds5-3 snc2-1D npr1-1(F), bda6 eds5-3 snc2-1D npr1-1 (G), and bda7 eds5-3 snc2-1D npr1-1 (H). Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (I-K) Growth of H.a. Noco2 on wild type (WT), npr1-1, eds5-3 snc2-1D npr1-1 and bda3-1D eds5-3 snc2-1D npr1-1 (I), bda5-1 eds5-3 snc2-1D npr1-1(I), bda6 eds5-3 snc2-1D npr1-1 (J), and bda7 eds5-3 snc2-1D npr1-1 (K). Two-week-old seedlings were sprayed with spores of H.a. Noco2 (5×104 spores/ml). Infection was scored seven days after inoculation.   3.3.3 BDA6 and BDA7 encode essential enzymes involved in SAR  Crude mapping revealed that three alleles of bda6 all showed genetic linkage with the FMO1 locus on Chromosome 1, while two alleles of bda7 showed linkage on Chromosome 2 where ALD1 is located. Sequencing analysis of FMO1 showed that bda6-1 and bda6-2 mutants contain missense mutations in FMO1 and bda6-3 contains a G to A mutation in the junction of the third exon and intron of FMO1 (Figure 3.3A), which probably affects the intron splicing of FMO1. To confirm that loss of function of FMO1 results in suppression of the snc2-1D mutant phenotype, a T-DNA allele with an insertion in the fourth exon of FMO1 (Figure 3.3A) was crossed into eds5-3 snc2-1D npr1-1 plants. The fmo1 eds5-3 snc2-1D npr1-1 quadruple mutant showed a similar morphology as the three bda6 alleles, with almost complete suppression of the dwarf morphology of eds5-3 snc2-1D npr1-1 plants (Figure 3.3B). Additionally, the elevated PR2 gene expression and enhanced disease resistance against H.a. Noco2 were also suppressed by the T-DNA insertion mutation (Figure 3.3C-D).   77    Figure 3.3 BDA6 encodes FMO1. (A) Map of the bda6 mutations and the T-DNA insertion position.  (B) Morphology of wild-type (WT), eds5-3 snc2-1D npr1-1, three bda6 eds5-3 snc2-1D npr1-1 alleles and fmo1 eds5-3 snc2-1D npr1-1. Plants were grown on soil and photographed four weeks after planting. (C) Expression of PR2 in wild type (WT), eds5-3 snc2-1D npr1-1, three bda6 eds5-3 snc2-1D npr1-1 alleles and fmo1 eds5-3 snc2-1D npr1-1. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (D) Growth of H.a. Noco2 on wild type (WT), npr1-1, eds5-3 snc2-1D npr1-1, three bda6 eds5-3 snc2-1D npr1-1 alleles and fmo1 eds5-3 snc2-1D npr1-1. Two-week-old   78 seedlings were sprayed with spores of H.a. Noco2 (5×104 spores/ml). Infection was scored seven days after inoculation.   In parallel, sequencing analysis performed on ALD1 showed that bda7-1 and bda7-2 plants contain missense mutations in ALD1 (Figure 3.4A). To confirm that BDA7 encodes ALD1, a T-DNA allele with an insertion in the first exon of ALD1 was crossed into eds5-3 snc2-1D npr1-1 plants. The ald1 eds5-3 snc2-1D npr1-1 quadruple mutant showed similar morphology as the plants with the two bda7 alleles, with almost complete suppression of the dwarf morphology of eds5-3 snc2-1D npr1-1 plants (Figure 3.4B). Consistently, the elevated PR2 gene expression and enhanced disease resistance against H.a. Noco2 were also suppressed by introducing the ald1 mutation (Figure 3.4 C-D).    Figure 3.4 BDA7 encodes ALD1. (A) Map of the bda7 mutations and the T-DNA insertion position.    79 (B) Morphology of wild-type (WT), eds5-3 snc2-1D npr1-1, two bda7 eds5-3 snc2-1D npr1-1 alleles and fmo1 eds5-3 snc2-1D npr1-1. Plants were grown on soil and photographed four weeks after planting. (C) Expression of PR2 in wild type (WT), eds5-3 snc2-1D npr1-1, two bda7 eds5-3 snc2-1D npr1-1 alleles and ald1 eds5-3 snc2-1D npr1-1. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three repeats. (D) Growth of H.a. Noco2 on wild type (WT), npr1-1, eds5-3 snc2-1D npr1-1, two bda6 eds5-3 snc2-1D npr1-1 alleles and ald1 eds5-3 snc2-1D npr1-1. Two-week-old seedlings were sprayed with spores of H.a. Noco2 (5×104 spores/ml). Infection was scored seven days after inoculation.   3.4 Discussion  Here we report the suppressor screen of eds5-3 snc2-1D npr1-1 plants to identify novel components involved in resistance pathways downstream of SNC2. From the screen, we identified four novel bda mutants showing various degree of suppression of autoimmunity in eds5-3 snc2-1D npr1-1 plants. bda3-1D completely suppresses and bda5 only partially suppresses the phenotypes of the eds5-3 snc2-1D npr1-1 triple mutant. Another 5 mutants fall into two complementation groups, bda6 and bda7. Sequencing analysis showed that they contain mutations in FMO1 and ALD1 respectively. Further studies with T-DNA insertion alleles confirmed that FMO1 and ALD1 are positive regulators downstream of SNC2.  ALD1 has been known to be an essential component in basal resistance and SAR (Song et al. 2004; Jing et al. 2011; Cecchini et al. 2015). ALD1 has been shown to function as an aminotransferase, converting lysine to the precursor of Pip, Δ1-piperideine-2-carboxylic acid (P2C) (Ding et al. 2016; Hartmann et al. 2017).  Suppression of eds5-3 snc2-1D npr1-1 by ald1 suggests that Pip plays an important role in SNC2-mediated defence responses, which is consistent with a previous report that SA and Pip act both independently and synergistically in Arabidopsis (Bernsdorff et al. 2016).    80 FMO1 is also known to play key roles in basal resistance and SAR (Koch et al. 2006; Mishina and Zeier 2006). A very recent study showed that FMO1 functions as a pipecolate N-hydroxylase, catalyzing the biochemical conversion of Pipecolic acid to NHP (Hartmann et al. 2018). Epitasis analysis indicated that fmo1 and eds5-3 mutations have additive effect on the suppression of snc2-1D autoimmunity (Figure 3.5). This is consistent with a previous report that mutations in SID2 and FMO1 have additive effect on RPP2-mediated resistance against H.a. Cala2 (Bartsch et al. 2006). These data suggest that in general FMO1 functions in a defence pathway in parallel with SA. Previously it was shown that the pathogen-induced Pip level is significantly higher in a fmo1 mutant compared to WT (Bernsdorff et al. 2016; Ding et al. 2016). This suggests that FMO1 may be involved in the synthesis of a defence signal molecule derived from Pip.     Figure 3.5 fmo1 and eds5-3 have additive effects on the suppression of the autoimmune phenotypes of snc2-1D. Morphology of indicated genotypes. Plants were grown on soil and photographed four weeks after planting.    81 The mechanism by which FMO1 and ALD1 contribute to SNC2-mediated signaling remains to be explored. One possibility is they are regulated by transcription factors since the transcripts of ALD1 and FMO1 are both highly upregulated upon pathogen treatment. ChIP-seq analysis identified both ALD1 and FMO1 as direct targets of transcription factors SARD1 and CBP60g. This is further supported by the suppression of the autoimmunity in snc2-1D by a sard1 cbp60g double mutant (Sun et al. 2015), indicating that SARD1 and CBP60g are also positive regulators downstream of SNC2. The cloning of BDA3 and BDA5 indicate that they both encode novel components in plant immunity. BDA3 encodes a clathrin assembly protein-like protein while BDA5 is potentially involved in post-transcriptional modification. Similar to FMO1 and ALD1, BDA5 also acts additively with EDS5 in suppression of the autoimmunity of snc2-1D npr1-1. However, the suppression of bda3-1D is independent of EDS5 (Figure 3.6). These preliminary genetic data could guide future analyses of these two proteins to determine how they’re involved in SNC2-mediated resistance or plant immunity in general.     Figure 3.6 BDA3 functions independent of EDS5 downstream of SNC2. Morphology of wild-type (WT), eds5-3, bda3-1D eds5-3 snc2-1D npr1-1, and bda3-1D snc2-1D npr1-1. Plants were grown on soil and photographed four weeks after planting.   82 3.5 Material and methods  3.5.1 Plant materials and growth conditions  All Arabidopsis thaliana mutants used are in the Columbia (Col-0) ecotype. The npr1-1, eds5-3, snc2-1D, snc2-1D npr1-1, eds5-3 snc2-1D npr1-1 mutants were reported previously (Cao et al. 1994; Nawrath et al. 2002; Sun et al. 2015; Y. Zhang, Yang, et al. 2010). fmo1 (salk_026163) and ald1-T2 (SALK_007673) were obtained from the Arabidopsis Biological Resource Center. The fmo1 eds5-3 snc2-1D npr1-1 and ald1-T2 eds5-3 snc2-1D npr1-1 quadruple mutant was obtained by crossing eds5-3 snc2-1D npr1-1 with fmo1 (salk_026163) or ald1-T2 respectively. The snc2-1D fmo1 double mutant and snc2-1D npr1-1 fmo1 triple mutant were isolated from the same population as fmo1 eds5-3 snc2-1D npr1-1. The bda3-1D snc2-1D npr1-1 triple mutant was obtained by crossing bda3-1D eds5-3 snc2-1D npr1-1 with Col-0 wild type plants. Plants were grown under 16 h light at 23℃ and 8 h dark at 19℃.   3.5.2 Mutant Characterization  For gene expression analysis, RNA was isolated from two-week-old seedlings grown on ½ MS media and used for subsequent quantitative reverse transcription PCR (qRT-PCR) analysis. Each experiment was repeated three times with independently grown plants. Briefly, RNA was extracted using the EZ-10 Spin Column Plant RNA Mini-Preps Kit from Biobasic (Canada) and treated with RQ1 RNase-Free DNase (Promega, USA) to remove the genomic DNA contaminations. Reverse transcription was carried out using the EasyScript™ Reverse Transcriptase (ABM, Canada). qPCR was performed using the Takara SYBR Premix Ex (Clontech, USA).  Analysis of resistance to H.a. Noco2 was carried out by spraying two-week-old seedlings with H.a. Noco2 spores at a concentration of 5×104 spores/ml. Growth of H.a. Noco2 was quantified as previously described (Bi et al. 2010). Bacterial infection assays were carried out by infiltrating two fully grown leaves of four-week-old plants grown under short day conditions.    83 3.5.3 Cloning of bda mutants  Crude mapping of the bda mutations was carried out using the F2 population of a cross between bda3-1D/bda5/bda6/bda7 eds5-3 snc2-1D npr1-1 (in Col-0 ecotype background) and Landsberg erecta (Ler).  Fine mapping was carried out on bda3-1D and bda5 using F3 population from F2 lines which are heterozygous for the mutation (i.e. heterozygous at both flanking markers) and are homozygous at the SNC2 locus (snc2-1D) and EDS5 locus. When the mutation is narrowed down to 1Mb, the genome of bda3-1D eds5-3 snc2-1D npr1-1 and bda5-1 eds5-3 snc2-1D npr1-1 was re-sequenced using Illumina sequencing to identify single nucleotide polymorphisms between the mutant and wild type. Based on chromosome linkage identified in crude mapping, bda6 and bda7 were subjected to sequencing analysis of FMO1 and ALD1 respectively.  The sequences of primers used for crude mapping and sequencing analysis are listed in   Table 3.1 Primer used in chapter 3 Primer 5'-3' sequence Purpose SNC2-F GAACCGGTTCGGTTATTCTC sequencing SNC2-R CAACTGTCACATGACCCATC sequencing BDA1-F1 CATAACCTTAAGCACCTACAG sequencing BDA1-F2 TACCACCGGACATTTGTATG sequencing BDA1-R1 GTCAATAGACTCACTACTCAG sequencing WRKY70-F1 ACAGTACATACACTCATTAGAG sequencing WRKY70-R2 CACACACTTCTCTTCTTTCC sequencing WRKY70-F3 AGCTCAGACCACATTTATGG sequencing FMO1-F4 ATCCTTGACCAAGGTCATAC sequencing FMO1-F6 CCACTGAGGAGAGTAGAAGC sequencing FMO1-R1 GACGTTCCAAGAATACCAGC sequencing FMO1-R5 CCATTCCTCTCCTC sequencing ALD1-F3 GGTTATTGGTACTTACTTGGAG sequencing genotyping ALD1-F5 TGGTCATAGCAAATGCATCG sequencing ALD1-F4 GTATCAGATGGTGCACAAAG sequencing    84 Table 3.1 Primer used in chapter 3 Primer 5'-3' sequence Purpose ALD1-R1 GGGTTTAGGTCGGATGAATA sequencing ALD1-R2 GGTAGGATCTTGCACAGCAA sequencing ALD1-R6 ATTATGGTACAAGAGGTGGAAG sequencing ALD1-R8 GAAGAAATACTCTATCCGGG sequencing genotyping F13K23IND-F TTTATTTCACACATAGTGCAG crude mapping F13K23IND-R GGAGATTTAGGGGATTACGAGATCG crude mapping F14M2-F CGCATACGTGTCACCGTGAG crude mapping F14M2-R TGTCCGGGACTGCCTTTAGC crude mapping T2E12-F TGGTGTTATAATCATGAAGC crude mapping T2E12-R GTGTTCCATTTTGGTACTTAG crude mapping T12J2-F TGAACCCTTATAATATGGCTGGC crude mapping T12J2-R GGTAAGCAAGGAAAGGAACAATTC crude mapping F27D4-F AGAGTCTTAAGAGTCTCAAGAAGC crude mapping F27D4-R TAGAATCGCAAGAAGAGTACG crude mapping T16B12-F CGAACTAAAGCAATCGATCAG crude mapping T16B12-R GCTAGGGTGACTAACACATG crude mapping MIE1-F CTAAGTTCTTCCACCATCTG  crude mapping MIE1-R CAAGGAGCATCTAGCCAGAG crude mapping T13J10-F ATTCGGACAAGATCGGTGC  crude mapping T13J10-R TGATTCTTCTGAGCATAGAG crude mapping F24B22-F GTGTTGTGTATGTCCTGAGC crude mapping F24B22-R CCTAAAGTACAATGCCAAGACG crude mapping T13D4-F CATACCAAGCCTACGTCAAC crude mapping T13D4-R AAACTCCCTGGATCAGGCAG crude mapping FCA5-F AATGCGGTGTTACCCATGGC crude mapping FCA5-R ACTCTTCCGATAAACTTCCTC crude mapping T13J8-F ATGTTCCCAGGCTCCTTCCA crude mapping T13J8-R GAGATGTGGGACAAGTGACC crude mapping F19H22-F ATGACGAGGCTAGAAGGTGG crude mapping F19H22-R GGGTTCAATCTTCTCATCCG crude mapping T9L3-F GTAACGTATGCATGGTTTG crude mapping T9L3-R AAGTTTTGGTTAGATTACAC crude mapping F3F24-F CTAAATGCACCATCACCGTG crude mapping F3F24-R CTTGCGATTTGAAATCTGTTACC crude mapping K19E20-F GACAAGAACCACATGAGAGC crude mapping K19E20-R GTTATGTGTACACTTCAGGTC crude mapping   85 Table 3.1 Primer used in chapter 3 Primer 5'-3' sequence Purpose MUB3-F AATAGATCAAAGCCTGGCTG crude mapping MUB3-R GATTCCTTTGCTTACCACAC crude mapping F3N11-F ATGTAAGTACCAAGATCACC crude mapping F3N11-R AATCAGATACTGTCGCCATC crude mapping T9J22-F GGACACACCTCACATAAGTC fine mapping T9J22-R ACTCCTACATGgtttgtgac fine mapping F13M23-F gtgtgtggtttttacgcttg fine mapping F13M23-R tgtcggtaaaccctagacac fine mapping M4I22-F atttccaccactttcatcgg fine mapping M4I22-R acacatttcgtgaactttgac fine mapping F28A21-F aagcacattcaaacaaaatctcc fine mapping F28A21-R gtttcttgatatggccaagc fine mapping FMO1-TDNA-F CTCTCTTCTGGTTAGTCATC genotyping FMO1-TDNA-R GGCTTCCACTTGTACCACTG genotyping                  86 4. Conclusions and future directions  The main goal of my Ph.D. project was to further dissect the signaling pathways downstream of the Arabidopsis immune receptor SNC2. The gain-of-function snc2-1D mutant displays autoimmune phenotypes including enhanced PR gene expression, elevated levels of salicylic acid and reduced pathogen growth. Additionally, the constitutive defence responses in snc2-1D plants lead to a dwarf morphology with dark green and curly leaves. These phenotypes provide a unique system to perform genetic analyses to study SNC2-mediated immunity in Arabidopsis. For example, a previous snc2-1D npr1-1 suppressor screen resulted in successful identification of BDA1 and WRKY70 as positive regulators downstream of SNC2.  In my Ph.D. study, I fully characterized another suppressor mutant isolated from the snc2-1D npr1-1 screen, bda4-1D. Map-based cloning revealed that bda4-1D contains a gain-of-function mutation in NPR4. NPR4, as well as its close homolog NPR3, were previously identified as redundant negative regulators in plant immunity. The npr3-1 npr4-3 knockout mutant shows elevated PR gene expression and enhanced disease resistance against P.s.m. ES4326 and H.a. Noco2 (Zhang et al. 2006). In contrast, the npr4-4D single mutant exhibits enhanced disease susceptibility, further supporting the idea that NPR4 functions as a negative regulator downstream of SNC2.  Epistasis analysis showed that npr1-1 and npr4-4D have additive effects on the suppression of the autoimmune phenotypes of snc2-1D, indicating NPR1 and NPR3/4 function independently downstream of SNC2. This is further confirmed by the analysis of the npr1-1 npr4-4D double mutant, which is always more susceptible to pathogens than the single mutants. NPR1 and NPR3/NPR4 have all been shown to interact with TGA transcription factors (Zhang et al. 1999; Liu et al. 2005; Zhang et al. 2006). NPR1 functions as a transcriptional activator whereas NPR3/4 serve as transcriptional repressors downstream of SNC2 to repress SARD1 and WRKY70, both encoding essential positive regulators downstream of SNC2. Furthermore, the repression activity is fully dependent on TGA transcription factors. Consistently, repression of defence responses in snc2-1D npr1-1 plants by npr4-4D also requires TGA transcription factors.    87 NPR1 and NPR3/NPR4 were previously shown to bind SA and proposed as SA receptors (Wu et al. 2012; Fu et al. 2012; Klessig et al. 2016). Interestingly, SA treatment releases the repression activity of NPR3 and NPR4. The npr4-4D mutation results in loss of SA-binding activity and leads to insensitivity of SA and its analog INA. RNA-seq analysis revealed that NPR1 and NPR4 act independently in the regulation of SA-induced gene expression. The complete suppression of the autoimmune phenotypes of snc2-1D by npr1-1 and npr4-4D indicates that SA perception is essential in SNC2-mediated resistance pathways. Collectively, our data showed that both de-repression and activation of SA-responsive genes are important to plant immunity. On the other hand, overexpression of NPR1 has been shown to enhance broad-spectrum disease resistance in Arabidopsis, rice and wheat, suggesting the importance of NPR1-mediated defense mechanism during the course of evolution (Cao et al. 1998; Chern et al. 2005; Makandar et al. 2006). These studies have led to strategies of engineering resistant crops through ectopic transcription of NPR1. However, enhanced resistance obtained through such strategies is often associated with substantial penalties to fitness. For example, the overexpression of OsNPR1/NH1 in rice spontaneously activated resistant genes and resulted in a lesion-mimic phenotype (Chern et al. 2005). In contrast to NPR1, NPR3 and NPR4 function as negative regulators in plant immunity. Knockout mutants of NPR3 and NPR4 in Arabidopsis showed enhanced disease resistance against pathogens but without any significant morphology change, such as the size of the plants or reproductions. As NPR3 and NPR4 are also conserved in different plant species (Wang et al. 2015), generation of knockout mutants or conditional knockdown of NPR3 and NPR4 in crop plants might enable us to engineer plant resistance with reduced fitness costs. To further decipher the signaling pathways activated by SNC2, I sought to identify novel components downstream of SNC2 by performing a forward genetic screen in the eds5-3 snc2-1D npr1-1 background. This screen resulted in the isolation of 71 putative suppressors. Seven suppressor mutants, which fell into four complementation groups, designated bda3-1D, bda5, bda6, and bda7, were further analyzed.    88 The bda7 alleles contain mutations in ALD1, which could largely suppress the autoimmunity in eds5-3 snc2-1D npr1-1 plants. ALD1 encodes an aminotransferase, converting lysine to the precursor of Pip, Δ1-piperideine-2-carboxylic acid (P2C) (Ding et al. 2016; Hartmann et al. 2017). As one of the enzymes involved in Pip biosynthesis pathway, ALD1 is required for both local and systemic accumulation of Pip (Návarová et al. 2012; Ding et al. 2016). The isolation of ald1 alleles in the eds5-3 snc2-1D npr1-1 suppressor screen suggests Pip is also required for SNC2-mediated defence responses. The additive effect of the eds5-3 and ald1 mutations on the suppression of snc2-1D mutant phenotype indicates that SA and Pip act independently downstream of SNC2.  SARD4 was recently identified as another critical enzyme involved in biosynthesis of Pip in systemic leaves. Unlike ald1, the sard4 mutant still shows a significant amount of Pip accumulation in local tissue (Ding et al. 2016). Interestingly, loss of SARD4 does not show significant suppression of autoimmunity in eds5-3 snc2-1D npr1-1 plants (data not shown). This indicates that additional components are involved in Pip biosynthesis downstream of SNC2.  The bda6 mutants were found to be alleles of fmo1. Similar to ALD1, FMO1 also plays critical roles in both basal and systemic resistance. Overexpression of FMO1 leads to increased resistance against virulent pathogens, whereas loss of function of FMO1 leads to enhanced susceptibility to pathogens and complete loss of SAR (Koch et al. 2006; Mishina and Zeier 2006). Consistent with previous studies, the suppression of snc2-1D autoimmunity depends on mutation in both EDS5 and FMO1, further validating that FMO1 functions independently of SA. Although pathogen-induced Pip accumulation is not reduced in fmo1 plants, mutations in ALD1 or SARD4 can fully suppress the enhanced resistance conferred by overexpression of FMO1, suggesting that FMO1 may be involved in the synthesis of a defense signal molecule derived from Pip (Ding et al. 2016). A very recent study showed that FMO1 functions as a pipecolate N-hydroxylase, catalyzing the biochemical conversion of Pipecolic acid to NHP (Hartmann et al. 2018). The role of NHP in SNC2-mediated signaling pathway could be further analyzed.  While my Ph.D. thesis study has led to further understanding of the signaling pathways downstream of SNC2, there are still some missing links that remain to be   89 identified. Multiple studies have shown that RLPs associate with RLKs to transduce signal (Liebrand et al. 2014; Albert et al. 2015; Couto and Zipfel 2016). However, no such RLK(s) were found to mediate SNC2-mediated resistance in two independent suppressor screens. This might be due to genetic redundancy. Biochemical approaches could be utilized to look for potential interactors of SNC2, which may lead to identification of the RLK(s) working together with SNC2.   Apart from the unidentified RLKs which function together with SNC2 as the core receptor complex, it is also unknown if other common RLK co-receptors, such as the SERK family members (Liebrand et al. 2014), are involved. Preliminary data indicated that BAK1 and SER4/BKK1 (BAK1-LIKE 1) are not involved in SNC2-mediated signaling pathways. The carboxyl terminal tail (CT) of BAK1 was shown to be required for PTI but dispensable for brassinosteroid responses and BAK1/BKK1-inhibited cell death signaling (Wu et al. 2017). Mutants of other LRR-RLK homologs with this unique CT structure can be tested in order to identify additional RLK co-receptors.  Further studies are required regarding BDA1 and WRKY70 and their roles in plant immunity. BDA1 encodes a protein with ankyrin repeats and transmembrane domains (Yang et al. 2012). In Arabidopsis, there are 37 predicted ankyrin-repeat transmembrane proteins (Becerra et al. 2004). Among them, the ACCELERATED CELL DEATH 6 (ACD6) is involved in positive regulation of SA signaling in local defence (Lu et al. 2003). ACD6 interacts with PRRs, including FLS2 and CERK1, and positively regulates the abundance of the PRRs (Zhang et al. 2014; Tateda et al. 2014). Since BDA1 also interacts with SNC2 (data not shown), it might be similarly involved in the regulation of SNC2 protein turn over. In addition, a gain-of-function mutation in the second transmembrane domain of BDA1 (bda1-17D) leads to constitutively activate cell death and defence responses (Yang et al. 2012). Interestingly, the gain-of-function mutation in acd6-1 also occurs in a predicted transmembrane helix (Lu et al. 2003). These data suggest that the transmembrane domains of BDA1 and ACD6 may play critical roles in their self-inhibitions. Another plausible explanation could be that these transmembrane domains interact with their negative regulators and that the mutations in bda1-17D and acd6-1 disrupt these interactions.   90 WRKY70 was shown to function in modulating defence responses and senescence (Li et al. 2004; Knoth et al. 2007; Besseau et al. 2012). WRKY70 is a direct target of transcription factor SARD1 (Sun et al. 2015). However, a more recent study showed WRKY70 can also bind to the promoter of SARD1 in vitro (Zhou et al. 2018), suggesting a feedback regulation is potentially involved. However, snc2-1D npr1-1 sard1 plants do not show significant suppression of the dwarf morphology compared to snc2-1D npr1-1 wrky70 plants (data not shown). This could be explained by the redundant roles between SARD1 and CBP60g, so it is worthy of testing if WRKY70 can regulate CBP60g gene expression through its binding to the promoter of CBP60g. In addition, performing ChIP-seq analysis for WRKY70 protein will reveal genes specifically regulated by WRKY70 but not SARD1, which can also be used to explain the different phenotypes between snc2-1D npr1-1 wrky70 and snc2-1D npr1-1 sard1.  Further studies on BDA3 and BDA5 would provide new insights into how SNC2-mediated signaling pathways are regulated. BDA3 encodes a clathrin assembly protein-like protein. Clathrin protein, composed of light and heavy chains, is one of the coat proteins involved in vesicle budding in multiple pathways (Robinson and Bonifacino 2001; Hwang and Robinson 2009). In plants, clathrin-mediated endocytosis (CME) is the predominant endocytic mechanism. It has been shown that three different cell-surface immune receptors FLS2, EFR and PEPR1 (PEP receptor 1) are all removed from the cell surface via CME during immune activation. Given that CME occurred on the plasma membrane, further analysis on the subcellular localization of BDA3 could validate its role in CME. Identification of the targets of BDA3 might provide potential leads to the missing RLK(s) in the pathway. Preliminary studies suggest that BDA5 encodes a potential cleavage and polyadenylation specificity factor (CPSF) in Arabidopsis. CPSFs play important roles in the cleavage of the 3' signaling region from a newly synthesized pre-messenger RNA (pre-mRNA) molecule in the process of gene transcription (Mandel et al. 2006). It remains to be determined whether BDA5 functions as a CPSF and, if it does, how the CPSF function plays a role in the immune signaling mediated by SNC2. In summary, I have identified several new components involved in the regulation of SNC2-mediated defence responses through the genetic screens. Analysis of these   91 components has helped to better understand NPR1/SA-independent defence responses. Further studies need to be carried out to dissect the missing links in the SNC2 mediated immune pathways.                                92 References  Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J. and Parker, J.E. 1998. Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 95(17), pp. 10306–10311. Albert, I., Böhm, H., Albert, M., Feiler, C.E., Imkampe, J., Wallmeroth, N., Brancato, C., Raaymakers, T.M., Oome, S., Zhang, H., Krol, E., Grefen, C., Gust, A.A., Chai, J., Hedrich, R., Van den Ackerveken, G. and Nürnberger, T. 2015. An RLP23-SOBIR1-BAK1 complex mediates NLP-triggered immunity. Nature Plants 1, p. 15140. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.-L., Gomez-Gomez, L., Boller, T., Ausubel, F.M. and Sheen, J. 2002. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415(6875), pp. 977–983. Axtell, M.J. and Staskawicz, B.J. 2003. Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112(3), pp. 369–377. Bartsch, M., Gobbato, E., Bednarek, P., Debey, S., Schultze, J.L., Bautor, J. and Parker, J.E. 2006. Salicylic acid-independent ENHANCED DISEASE SUSCEPTIBILITY1 signaling in Arabidopsis immunity and cell death is regulated by the monooxygenase FMO1 and the Nudix hydrolase NUDT7. The Plant Cell 18(4), pp. 1038–1051. Beaunerie, J. 1901. Essais d’immunisation des végétaux contre les maladies cryptogamiques. C R Acad Sci Ser 133, pp. 107–110. Becerra, C., Jahrmann, T., Puigdomènech, P. and Vicient, C.M. 2004. Ankyrin repeat-containing proteins in Arabidopsis: characterization of a novel and abundant group of genes coding ankyrin-transmembrane proteins. Gene 340(1), pp. 111–121. Belfanti, E., Silfverberg-Dilworth, E., Tartarini, S., Patocchi, A., Barbieri, M., Zhu, J., Vinatzer, B.A., Gianfranceschi, L., Gessler, C. and Sansavini, S. 2004. The HcrVf2 gene from a wild apple confers scab resistance to a transgenic cultivated variety.   93 Proceedings of the National Academy of Sciences of the United States of America 101(3), pp. 886–890. Bernsdorff, F., Döring, A.-C., Gruner, K., Schuck, S., Bräutigam, A. and Zeier, J. 2016. Pipecolic Acid Orchestrates Plant Systemic Acquired Resistance and Defense Priming via Salicylic Acid-Dependent and -Independent Pathways. The Plant Cell 28(1), pp. 102–129. Besseau, S., Li, J. and Palva, E.T. 2012. WRKY54 and WRKY70 co-operate as negative regulators of leaf senescence in Arabidopsis thaliana. Journal of Experimental Botany 63(7), pp. 2667–2679. Bi, D., Cheng, Y.T., Li, X. and Zhang, Y. 2010. Activation of plant immune responses by a gain-of-function mutation in an atypical receptor-like kinase. Plant Physiology 153(4), pp. 1771–1779. Bi, D., Johnson, K.C.M., Zhu, Z., Huang, Y., Chen, F., Zhang, Y. and Li, X. 2011. Mutations in an Atypical TIR-NB-LRR-LIM Resistance Protein Confer Autoimmunity. Frontiers in plant science 2, p. 71. Boller, T. and Felix, G. 2009. A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annual review of plant biology 60, pp. 379–406. Cao, H., Bowling, S.A., Gordon, A.S. and Dong, X. 1994. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. The Plant Cell 6(11), pp. 1583–1592. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S. and Dong, X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88(1), pp. 57–63. Cao, H., Li, X. and Dong, X. 1998. Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proceedings of the National Academy of Sciences of the United States of America 95(11), pp. 6531–6536.   94 Catinot, J., Buchala, A., Abou-Mansour, E. and Métraux, J.-P. 2008. Salicylic acid production in response to biotic and abiotic stress depends on isochorismate in Nicotiana benthamiana. FEBS Letters 582(4), pp. 473–478. Cecchini, N.M., Jung, H.W., Engle, N.L., Tschaplinski, T.J. and Greenberg, J.T. 2015. ALD1 regulates basal immune components and early inducible defense responses in arabidopsis. Molecular Plant-Microbe Interactions 28(4), pp. 455–466. Chanda, B., Xia, Y., Mandal, M.K., Yu, K., Sekine, K.-T., Gao, Q., Selote, D., Hu, Y., Stromberg, A., Navarre, D., Kachroo, A. and Kachroo, P. 2011. Glycerol-3-phosphate is a critical mobile inducer of systemic immunity in plants. Nature Genetics 43(5), pp. 421–427. Chaturvedi, R., Venables, B., Petros, R.A., Nalam, V., Li, M., Wang, X., Takemoto, L.J. and Shah, J. 2012. An abietane diterpenoid is a potent activator of systemic acquired resistance. The Plant Journal: for Cell and Molecular Biology 71(1), pp. 161–172. Chen, X., Zuo, S., Schwessinger, B., Chern, M., Canlas, P.E., Ruan, D., Zhou, X., Wang, J., Daudi, A., Petzold, C.J., Heazlewood, J.L. and Ronald, P.C. 2014. An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors. Molecular Plant 7(5), pp. 874–892. Cheng, Y.T., Li, Y., Huang, S., Huang, Y., Dong, X., Zhang, Y. and Li, X. 2011. Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proceedings of the National Academy of Sciences of the United States of America 108(35), pp. 14694–14699. Chern, M., Fitzgerald, H.A., Canlas, P.E., Navarre, D.A. and Ronald, P.C. 2005. Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Molecular Plant-Microbe Interactions 18(6), pp. 511–520. Chester, K.S. 1933. The Problem of Acquired Physiological Immunity in Plants. The Quarterly Review of Biology 8(3), pp. 275–324.   95 Chinchilla, D., Bauer, Z., Regenass, M., Boller, T. and Felix, G. 2006. The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. The Plant Cell 18(2), pp. 465–476. Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nürnberger, T., Jones, J.D.G., Felix, G. and Boller, T. 2007. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448(7152), pp. 497–500. Chung, E.-H., da Cunha, L., Wu, A.-J., Gao, Z., Cherkis, K., Afzal, A.J., Mackey, D. and Dangl, J.L. 2011. Specific threonine phosphorylation of a host target by two unrelated type III effectors activates a host innate immune receptor in plants. Cell Host & Microbe 9(2), pp. 125–136. Cochrane, F.C., Davin, L.B. and Lewis, N.G. 2004. The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry 65(11), pp. 1557–1564. Couto, D. and Zipfel, C. 2016. Regulation of pattern recognition receptor signalling in plants. Nature Reviews. Immunology 16(9), pp. 537–552. Cui, H., Gobbato, E., Kracher, B., Qiu, J., Bautor, J. and Parker, J.E. 2017. A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity. The New Phytologist 213(4), pp. 1802–1817. Dangl, J.L. and Jones, J.D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411(6839), pp. 826–833. Dean, J.V. and Mills, J.D. 2004. Uptake of salicylic acid 2-O-beta-D-glucose into soybean tonoplast vesicles by an ATP-binding cassette transporter-type mechanism. Physiologia Plantarum 120(4), pp. 603–612. Dean, J.V., Mohammed, L.A. and Fitzpatrick, T. 2005. The formation, vacuolar localization, and tonoplast transport of salicylic acid glucose conjugates in tobacco cell suspension cultures. Planta 221(2), pp. 287–296. Dean, R.A. and Kuć, J. 1986. Induced systemic protection in cucumbers: the source of the “signal.” Physiological and Molecular Plant Pathology 28(2), pp. 227–233.   96 Delaney, T.P., Friedrich, L. and Ryals, J.A. 1995. Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proceedings of the National Academy of Sciences of the United States of America 92(14), pp. 6602–6606. Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H., Ward, E. and Ryals, J. 1994. A central role of salicylic Acid in plant disease resistance. Science 266(5188), pp. 1247–1250. Dempsey, D.A. and Klessig, D.F. 2012. SOS - too many signals for systemic acquired resistance? Trends in Plant Science 17(9), pp. 538–545. Dempsey, D.A., Vlot, A.C., Wildermuth, M.C. and Klessig, D.F. 2011. Salicylic Acid biosynthesis and metabolism. The Arabidopsis book / American Society of Plant Biologists 9, p. e0156. Després, C., DeLong, C., Glaze, S., Liu, E. and Fobert, P.R. 2000. The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. The Plant Cell 12(2), pp. 279–290. Ding, P., Rekhter, D., Ding, Y., Feussner, K., Busta, L., Haroth, S., Xu, S., Li, X., Jetter, R., Feussner, I. and Zhang, Y. 2016. Characterization of a pipecolic acid biosynthesis pathway required for systemic acquired resistance. The Plant Cell 28(10), pp. 2603–2615. Dixon, M.S., Hatzixanthis, K., Jones, D.A., Harrison, K. and Jones, J.D. 1998. The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number. The Plant Cell 10(11), pp. 1915–1925. Dixon, M.S., Jones, D.A., Keddie, J.S., Thomas, C.M., Harrison, K. and Jones, J.D. 1996. The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell 84(3), pp. 451–459. Dong, X. 2004. NPR1, all things considered. Current Opinion in Plant Biology 7(5), pp. 547–552.   97 Fan, W. and Dong, X. 2002. In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. The Plant Cell 14(6), pp. 1377–1389. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral, A. and Parker, J.E. 2005. Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. The Plant Cell 17(9), pp. 2601–2613. Flor, H.H. 1971. Current status of the gene-for-gene concept. Annual Review of Phytopathology 9(1), pp. 275–296. Friedrich, L., Vernooij, B., Gaffney, T., Morse, A. and Ryals, J. 1995. Characterization of tobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Molecular Biology 29(5), pp. 959–968. Fritz-Laylin, L.K., Krishnamurthy, N., Tör, M., Sjölander, K.V. and Jones, J.D.G. 2005. Phylogenomic analysis of the receptor-like proteins of rice and Arabidopsis. Plant Physiology 138(2), pp. 611–623. Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel, S.H., Tada, Y., Zheng, N. and Dong, X. 2012. NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486(7402), pp. 228–232. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H. and Ryals, J. 1993. Requirement of salicylic Acid for the induction of systemic acquired resistance. Science 261(5122), pp. 754–756. Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S. and Zhang, Y. 2008. MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Research 18(12), pp. 1190–1198. Gao, M., Wang, X., Wang, D., Xu, F., Ding, X., Zhang, Z., Bi, D., Cheng, Y.T., Chen, S., Li, X. and Zhang, Y. 2009. Regulation of cell death and innate immunity by two receptor-like kinases in Arabidopsis. Cell Host & Microbe 6(1), pp. 34–44.   98 Garcion, C., Lohmann, A., Lamodière, E., Catinot, J., Buchala, A., Doermann, P. and Métraux, J.-P. 2008. Characterization and biological function of the ISOCHORISMATE SYNTHASE2 gene of Arabidopsis. Plant Physiology 147(3), pp. 1279–1287. Görlach, J., Volrath, S., Knauf-Beiter, G., Hengy, G., Beckhove, U., Kogel, K.H., Oostendorp, M., Staub, T., Ward, E., Kessmann, H. and Ryals, J. 1996. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. The Plant Cell 8(4), pp. 629–643. Grant, J.J., Chini, A., Basu, D. and Loake, G.J. 2003. Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens. Molecular Plant-Microbe Interactions 16(8), pp. 669–680. Gust, A.A. and Felix, G. 2014. Receptor like proteins associate with SOBIR1-type of adaptors to form bimolecular receptor kinases. Current Opinion in Plant Biology 21, pp. 104–111. Hartmann, M., Kim, D., Bernsdorff, F., Ajami-Rashidi, Z., Scholten, N., Schreiber, S., Zeier, T., Schuck, S., Reichel-Deland, V. and Zeier, J. 2017. Biochemical principles and functional aspects of pipecolic acid biosynthesis in plant immunity. Plant Physiology 174(1), pp. 124–153. Hartmann, M., Zeier, T., Bernsdorff, F., Reichel-Deland, V., Kim, D., Hohmann, M., Scholten, N., Schuck, S., Bräutigam, A., Hölzel, T., Ganter, C. and Zeier, J. 2018. Flavin Monooxygenase-Generated N-Hydroxypipecolic Acid Is a Critical Element of Plant Systemic Immunity. Cell. Holub, E.B. 2001. The arms race is ancient history in Arabidopsis, the wildflower. Nature Reviews. Genetics 2(7), pp. 516–527. van der Hoorn, R.A.L. and Kamoun, S. 2008. From Guard to Decoy: a new model for perception of plant pathogen effectors. The Plant Cell 20(8), pp. 2009–2017. Huang, J., Gu, M., Lai, Z., Fan, B., Shi, K., Zhou, Y.-H., Yu, J.-Q. and Chen, Z. 2010. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiology 153(4), pp. 1526–1538.   99 Hwang, I. and Robinson, D.G. 2009. Transport vesicle formation in plant cells. Current Opinion in Plant Biology 12(6), pp. 660–669. Ishihara, T., Sekine, K.T., Hase, S., Kanayama, Y., Seo, S., Ohashi, Y., Kusano, T., Shibata, D., Shah, J. and Takahashi, H. 2008. Overexpression of the Arabidopsis thaliana EDS5 gene enhances resistance to viruses. Plant Biology 10(4), pp. 451–461. Jehle, A.K., Lipschis, M., Albert, M., Fallahzadeh-Mamaghani, V., Fürst, U., Mueller, K. and Felix, G. 2013. The receptor-like protein ReMAX of Arabidopsis detects the microbe-associated molecular pattern eMax from Xanthomonas. The Plant Cell 25(6), pp. 2330–2340. Jenns, A.E. and Kuc, J. 1979. Graft transmission of systemic resistance of cucumber to anthracnose induced by Colletotrichum lagenarium and tobacco necrosis virus. Phytopathology 7, pp. 753–56. Jeong, S., Trotochaud, A.E. and Clark, S.E. 1999. The Arabidopsis CLAVATA2 gene encodes a receptor-like protein required for the stability of the CLAVATA1 receptor-like kinase. The Plant Cell 11(10), pp. 1925–1934. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P. and Valent, B. 2000. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. The EMBO Journal 19(15), pp. 4004–4014. Jing, B., Xu, S., Xu, M., Li, Y., Li, S., Ding, J. and Zhang, Y. 2011. Brush and spray: a high-throughput systemic acquired resistance assay suitable for large-scale genetic screening. Plant Physiology 157(3), pp. 973–980. Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J. and Jones, J.D.G. 1994. Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266(5186), pp. 789–793. Jones, J.D.G. and Dangl, J.L. 2006. The plant immune system. Nature 444(7117), pp. 323–329. Judelson, H.S. and Blanco, F.A. 2005. The spores of Phytophthora: weapons of the plant destroyer. Nature Reviews. Microbiology 3(1), pp. 47–58.   100 Jung, H.W., Tschaplinski, T.J., Wang, L., Glazebrook, J. and Greenberg, J.T. 2009. Priming in systemic plant immunity. Science 324(5923), pp. 89–91. Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., Jones, J.D.G., Shirasu, K., Menke, F., Jones, A. and Zipfel, C. 2014. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. Molecular Cell 54(1), pp. 43–55. Katagiri, F., Lam, E. and Chua, N.H. 1989. Two tobacco DNA-binding proteins with homology to the nuclear factor CREB. Nature 340(6236), pp. 727–730. Kim, D., Langmead, B. and Salzberg, S.L. 2015. HISAT: a fast spliced aligner with low memory requirements. Nature Methods 12(4), pp. 357–360. Kim, D.S. and Hwang, B.K. 2014. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. Journal of Experimental Botany 65(9), pp. 2295–2306. Kim, H.S. and Delaney, T.P. 2002. Over-expression of TGA5, which encodes a bZIP transcription factor that interacts with NIM1/NPR1, confers SAR-independent resistance in Arabidopsis thaliana to Peronospora parasitica. The Plant Journal: for Cell and Molecular Biology 32(2), pp. 151–163. Klessig, D.F., Tian, M. and Choi, H.W. 2016. Multiple targets of salicylic acid and its derivatives in plants and animals. Frontiers in immunology 7, p. 206. Knoth, C., Ringler, J., Dangl, J.L. and Eulgem, T. 2007. Arabidopsis WRKY70 is required for full RPP4-mediated disease resistance and basal defense against Hyaloperonospora parasitica. Molecular Plant-Microbe Interactions 20(2), pp. 120–128. Koch, M., Vorwerk, S., Masur, C., Sharifi-Sirchi, G., Olivieri, N. and Schlaich, N.L. 2006. A role for a flavin-containing mono-oxygenase in resistance against microbial pathogens in Arabidopsis. The Plant Journal: for Cell and Molecular Biology 47(4), pp. 629–639. Kohalmi Nowak, J., and Crosby, W.L., S.E. 1997. The yeast two-hybrid system. In: Hansen, E. and Harper, G. eds. Differentially Expressed Genes in Plants: A Bench Manual. London: Taylor and Francis, p. 63?2.   101 Kong, Q., Sun, T., Qu, N., Ma, J., Li, M., Cheng, Y.-T., Zhang, Q., Wu, D., Zhang, Z. and Zhang, Y. 2016. Two Redundant Receptor-Like Cytoplasmic Kinases Function Downstream of Pattern Recognition Receptors to Regulate Activation of SA Biosynthesis. Plant Physiology 171(2), pp. 1344–1354. Kuai, X., MacLeod, B.J. and Després, C. 2015. Integrating data on the Arabidopsis NPR1/NPR3/NPR4 salicylic acid receptors; a differentiating argument. Frontiers in plant science 6, p. 235. Lamb, C. and Dixon, R.A. 1997. The oxidative burst in plant disease resistance. Annual review of plant physiology and plant molecular biology 48, pp. 251–275. Lawrence, M., Huber, W., Pagès, H., Aboyoun, P., Carlson, M., Gentleman, R., Morgan, M.T. and Carey, V.J. 2013. Software for computing and annotating genomic ranges. PLoS Computational Biology 9(8), p. e1003118. Lebel, E., Heifetz, P., Thorne, L., Uknes, S., Ryals, J. and Ward, E. 1998. Functional analysis of regulatory sequences controlling PR-1 gene expression in Arabidopsis. The Plant Journal: for Cell and Molecular Biology 16(2), pp. 223–233. Lee, H.I., León, J. and Raskin, I. 1995. Biosynthesis and metabolism of salicylic acid. Proceedings of the National Academy of Sciences of the United States of America 92(10), pp. 4076–4079. Lee, H.I. and Raskin, I. 1998. Glucosylation of Salicylic Acid in Nicotiana tabacum Cv. Xanthi-nc. Phytopathology 88(7), pp. 692–697. Lee, H.I. and Raskin, I. 1999. Purification, cloning, and expression of a pathogen inducible UDP-glucose:Salicylic acid glucosyltransferase from tobacco. The Journal of Biological Chemistry 274(51), pp. 36637–36642. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. and 1000 Genome Project Data Processing Subgroup 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25(16), pp. 2078–2079.   102 Li, J., Brader, G. and Palva, E.T. 2004. The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. The Plant Cell 16(2), pp. 319–331. Li, L., Li, M., Yu, L., Zhou, Z., Liang, X., Liu, Z., Cai, G., Gao, L., Zhang, X., Wang, Y., Chen, S. and Zhou, J.-M. 2014. The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity. Cell Host & Microbe 15(3), pp. 329–338. Li, X., Clarke, J.D., Zhang, Y. and Dong, X. 2001. Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Molecular Plant-Microbe Interactions 14(10), pp. 1131–1139. Li, Y., Li, S., Bi, D., Cheng, Y.T., Li, X. and Zhang, Y. 2010. SRFR1 negatively regulates plant NB-LRR resistance protein accumulation to prevent autoimmunity. PLoS Pathogens 6(9), p. e1001111. Liebrand, T.W.H., van den Berg, G.C.M., Zhang, Z., Smit, P., Cordewener, J.H.G., America, A.H.P., Sklenar, J., Jones, A.M.E., Tameling, W.I.L., Robatzek, S., Thomma, B.P.H.J. and Joosten, M.H.A.J. 2013. Receptor-like kinase SOBIR1/EVR interacts with receptor-like proteins in plant immunity against fungal infection. Proceedings of the National Academy of Sciences of the United States of America 110(24), pp. 10010–10015. Liebrand, T.W.H., van den Burg, H.A. and Joosten, M.H.A.J. 2014. Two for all: receptor-associated kinases SOBIR1 and BAK1. Trends in Plant Science 19(2), pp. 123–132. Liu, G., Holub, E.B., Alonso, J.M., Ecker, J.R. and Fobert, P.R. 2005. An Arabidopsis NPR1-like gene, NPR4, is required for disease resistance. The Plant Journal: for Cell and Molecular Biology 41(2), pp. 304–318. Liu, J., Elmore, J.M., Lin, Z.-J.D. and Coaker, G. 2011. A receptor-like cytoplasmic kinase phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor. Cell Host & Microbe 9(2), pp. 137–146. Love, M.I., Huber, W. and Anders, S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology 15(12), p. 550.   103 Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L. and He, P. 2010. A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America 107(1), pp. 496–501. Lu, H., Rate, D.N., Song, J.T. and Greenberg, J.T. 2003. ACD6, a novel ankyrin protein, is a regulator and an effector of salicylic acid signaling in the Arabidopsis defense response. The Plant Cell 15(10), pp. 2408–2420. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R. and Dangl, J.L. 2003. Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112(3), pp. 379–389. Makandar, R., Essig, J.S., Schapaugh, M.A., Trick, H.N. and Shah, J. 2006. Genetically engineered resistance to Fusarium head blight in wheat by expression of Arabidopsis NPR1. Molecular Plant-Microbe Interactions 19(2), pp. 123–129. Maldonado, A.M., Doerner, P., Dixon, R.A., Lamb, C.J. and Cameron, R.K. 2002. A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature 419(6905), pp. 399–403. Mandel, C.R., Kaneko, S., Zhang, H., Gebauer, D., Vethantham, V., Manley, J.L. and Tong, L. 2006. Polyadenylation factor CPSF-73 is the pre-mRNA 3’-end-processing endonuclease. Nature 444(7121), pp. 953–956. Manohar, M., Tian, M., Moreau, M., Park, S.-W., Choi, H.W., Fei, Z., Friso, G., Asif, M., Manosalva, P., von Dahl, C.C., Shi, K., Ma, S., Dinesh-Kumar, S.P., O’Doherty, I., Schroeder, F.C., van Wijk, K.J. and Klessig, D.F. 2014. Identification of multiple salicylic acid-binding proteins using two high throughput screens. Frontiers in plant science 5, p. 777. Mao, G., Meng, X., Liu, Y., Zheng, Z., Chen, Z. and Zhang, S. 2011. Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis. The Plant Cell 23(4), pp. 1639–1653. Meng, X. and Zhang, S. 2013. MAPK cascades in plant disease resistance signaling. Annual Review of Phytopathology 51, pp. 245–266.   104 Metraux Ahl-Goy, P., Staub, T., Speich, J., Steinemann, A., Ryals, J., and Ward, E., J.P. 1991. Induced resistance in cucumber in response to 2,6-dichloroisonicotinic acid and pathogens. In: Hennecke, H. and Verma, D. P. S. eds. Advances in Molecular Genetics of Plant-Microbe Interactions. Dordrecht, The Netherlands: Kluwer Academic Publishers, pp. 432–439. Métraux, J.P., Signer, H., Ryals, J., Ward, E., Wyss-Benz, M., Gaudin, J., Raschdorf, K., Schmid, E., Blum, W. and Inverardi, B. 1990. Increase in salicylic Acid at the onset of systemic acquired resistance in cucumber. Science 250(4983), pp. 1004–1006. Meyers, B.C., Kozik, A., Griego, A., Kuang, H. and Michelmore, R.W. 2003. Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. The Plant Cell 15(4), pp. 809–834. Mishina, T.E. and Zeier, J. 2006. The Arabidopsis flavin-dependent monooxygenase FMO1 is an essential component of biologically induced systemic acquired resistance. Plant Physiology 141(4), pp. 1666–1675. Molders, W., Buchala, A. and Metraux, J.P. 1996. Transport of Salicylic Acid in Tobacco Necrosis Virus-Infected Cucumber Plants. Plant Physiology 112(2), pp. 787–792. Mou, Z., Fan, W. and Dong, X. 2003. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113(7), pp. 935–944. Nadeau, J.A. and Sack, F.D. 2002. Control of stomatal distribution on the Arabidopsis leaf surface. Science 296(5573), pp. 1697–1700. Návarová, H., Bernsdorff, F., Döring, A.-C. and Zeier, J. 2012. Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. The Plant Cell 24(12), pp. 5123–5141. Nawrath, C., Heck, S., Parinthawong, N. and Métraux, J.-P. 2002. EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. The Plant Cell 14(1), pp. 275–286.   105 Nawrath, C. and Métraux, J.P. 1999. Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. The Plant Cell 11(8), pp. 1393–1404. Ohta, M., Matsui, K., Hiratsu, K., Shinshi, H. and Ohme-Takagi, M. 2001. Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. The Plant Cell 13(8), pp. 1959–1968. Park, S.-W., Kaimoyo, E., Kumar, D., Mosher, S. and Klessig, D.F. 2007. Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318(5847), pp. 113–116. Petersen, M., Brodersen, P., Naested, H., Andreasson, E., Lindhart, U., Johansen, B., Nielsen, H.B., Lacy, M., Austin, M.J., Parker, J.E., Sharma, S.B., Klessig, D.F., Martienssen, R., Mattsson, O., Jensen, A.B. and Mundy, J. 2000. Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103(7), pp. 1111–1120. Ray, J. 1901. Les maladies cryptogamiques des végétaux. Revue générale de Botanique 13, pp. 145–151. Ren, D., Liu, Y., Yang, K.-Y., Han, L., Mao, G., Glazebrook, J. and Zhang, S. 2008. A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 105(14), pp. 5638–5643. Robinson, M.S. and Bonifacino, J.S. 2001. Adaptor-related proteins. Current Opinion in Cell Biology 13(4), pp. 444–453. Rochon, A., Boyle, P., Wignes, T., Fobert, P.R. and Després, C. 2006. The coactivator function of Arabidopsis NPR1 requires the core of its BTB/POZ domain and the oxidation of C-terminal cysteines. The Plant Cell 18(12), pp. 3670–3685. Römer, P., Hahn, S., Jordan, T., Strauss, T., Bonas, U. and Lahaye, T. 2007. Plant pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science 318(5850), pp. 645–648.   106 Ross, A.F. 1961. Systemic acquired resistance induced by localized virus infections in plants. Virology 14, pp. 340–358. Ryals, J., Weymann, K., Lawton, K., Friedrich, L., Ellis, D., Steiner, H.Y., Johnson, J., Delaney, T.P., Jesse, T., Vos, P. and Uknes, S. 1997. The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kappa B. The Plant Cell 9(3), pp. 425–439. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y. and Hunt, M.D. 1996. Systemic Acquired Resistance. The Plant Cell 8(10), pp. 1809–1819. Sadeghi, M., Dehghan, S., Fischer, R., Wenzel, U., Vilcinskas, A., Kavousi, H.R. and Rahnamaeian, M. 2013. Isolation and characterization of isochorismate synthase and cinnamate 4-hydroxylase during salinity stress, wounding, and salicylic acid treatment in Carthamus tinctorius. Plant Signaling & Behavior 8(11), p. e27335. Saur, I.M.L., Kadota, Y., Sklenar, J., Holton, N.J., Smakowska, E., Belkhadir, Y., Zipfel, C. and Rathjen, J.P. 2016. NbCSPR underlies age-dependent immune responses to bacterial cold shock protein in Nicotiana benthamiana. Proceedings of the National Academy of Sciences of the United States of America 113(12), pp. 3389–3394. Schulze, B., Mentzel, T., Jehle, A.K., Mueller, K., Beeler, S., Boller, T., Felix, G. and Chinchilla, D. 2010. Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1. The Journal of Biological Chemistry 285(13), pp. 9444–9451. Serrano, M., Wang, B., Aryal, B., Garcion, C., Abou-Mansour, E., Heck, S., Geisler, M., Mauch, F., Nawrath, C. and Métraux, J.-P. 2013. Export of salicylic acid from the chloroplast requires the multidrug and toxin extrusion-like transporter EDS5. Plant Physiology 162(4), pp. 1815–1821. Shah, J. 2009. Plants under attack: systemic signals in defence. Current Opinion in Plant Biology 12(4), pp. 459–464. Shah, J., Tsui, F. and Klessig, D.F. 1997. Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-  107 inducible expression of the tms2 gene. Molecular Plant-Microbe Interactions 10(1), pp. 69–78. Shi, H., Shen, Q., Qi, Y., Yan, H., Nie, H., Chen, Y., Zhao, T., Katagiri, F. and Tang, D. 2013. BR-SIGNALING KINASE1 physically associates with FLAGELLIN SENSING2 and regulates plant innate immunity in Arabidopsis. The Plant Cell 25(3), pp. 1143–1157. Shimizu, T., Nakano, T., Takamizawa, D., Desaki, Y., Ishii-Minami, N., Nishizawa, Y., Minami, E., Okada, K., Yamane, H., Kaku, H. and Shibuya, N. 2010. Two LysM receptor molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice. The Plant Journal: for Cell and Molecular Biology 64(2), pp. 204–214. Shinya, T., Yamaguchi, K., Desaki, Y., Yamada, K., Narisawa, T., Kobayashi, Y., Maeda, K., Suzuki, M., Tanimoto, T., Takeda, J., Nakashima, M., Funama, R., Narusaka, M., Narusaka, Y., Kaku, H., Kawasaki, T. and Shibuya, N. 2014. Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27. The Plant Journal: for Cell and Molecular Biology 79(1), pp. 56–66. Shulaev, V., Leon, J. and Raskin, I. 1995. Is salicylic acid a translocated signal of systemic acquired resistance in tobacco? The Plant Cell 7(10), pp. 1691–1701. Song, J.T. 2006. Induction of a salicylic acid glucosyltransferase, AtSGT1, is an early disease response in Arabidopsis thaliana. Molecules and Cells 22(2), pp. 233–238. Song, J.T., Lu, H., McDowell, J.M. and Greenberg, J.T. 2004. A key role for ALD1 in activation of local and systemic defenses in Arabidopsis. The Plant Journal: for Cell and Molecular Biology 40(2), pp. 200–212. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C. and Ronald, P. 1995. A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270(5243), pp. 1804–1806. Sticher, L., Mauch-Mani, B. and Métraux, J.P. 1997. Systemic acquired resistance. Annual Review of Phytopathology 35, pp. 235–270.   108 Strawn, M.A., Marr, S.K., Inoue, K., Inada, N., Zubieta, C. and Wildermuth, M.C. 2007. Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. The Journal of Biological Chemistry 282(8), pp. 5919–5933. Subramaniam, R., Desveaux, D., Spickler, C., Michnick, S.W. and Brisson, N. 2001. Direct visualization of protein interactions in plant cells. Nature Biotechnology 19(8), pp. 769–772. Sun, T., Zhang, Yaxi, Li, Y., Zhang, Q., Ding, Y. and Zhang, Yuelin 2015. ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity. Nature Communications 6, p. 10159. Takken, F.L., Thomas, C.M., Joosten, M.H., Golstein, C., Westerink, N., Hille, J., Nijkamp, H.J., De Wit PJ and Jones, J.D. 1999. A second gene at the tomato Cf-4 locus confers resistance to cladosporium fulvum through recognition of a novel avirulence determinant. The Plant Journal: for Cell and Molecular Biology 20(3), pp. 279–288. Tang, D., Wang, G. and Zhou, J.-M. 2017. Receptor Kinases in Plant-Pathogen Interactions: More Than Pattern Recognition. The Plant Cell 29(4), pp. 618–637. Tateda, C., Zhang, Z., Shrestha, J., Jelenska, J., Chinchilla, D. and Greenberg, J.T. 2014. Salicylic acid regulates Arabidopsis microbial pattern receptor kinase levels and signaling. The Plant Cell 26(10), pp. 4171–4187. Thomas, C.M., Jones, D.A., Parniske, M., Harrison, K., Balint-Kurti, P.J., Hatzixanthis, K. and Jones, J.D. 1997. Characterization of the tomato Cf-4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9. The Plant Cell 9(12), pp. 2209–2224. Thordal-Christensen, H. 2003. Fresh insights into processes of nonhost resistance. Current Opinion in Plant Biology 6(4), pp. 351–357. Tiwari, S., Wang, S., Hagen, G. and Guilfoyle, T.J. 2006. Transfection assays with protoplasts containing integrated reporter genes. Methods in Molecular Biology 323, pp. 237–244.   109 Torres, M.A., Jones, J.D.G. and Dangl, J.L. 2005. Pathogen-induced, NADPH oxidase-derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nature Genetics 37(10), pp. 1130–1134. Truman, W., Sreekanta, S., Lu, Y., Bethke, G., Tsuda, K., Katagiri, F. and Glazebrook, J. 2013. The CALMODULIN-BINDING PROTEIN60 family includes both negative and positive regulators of plant immunity. Plant Physiology 163(4), pp. 1741–1751. Uknes, S., Mauch-Mani, B., Moyer, M., Potter, S., Williams, S., Dincher, S., Chandler, D., Slusarenko, A., Ward, E. and Ryals, J. 1992. Acquired resistance in Arabidopsis. The Plant Cell 4(6), pp. 645–656. Ullah, H., Chen, J.-G., Temple, B., Boyes, D.C., Alonso, J.M., Davis, K.R., Ecker, J.R. and Jones, A.M. 2003. The β-subunit of the Arabidopsis G protein negatively regulates auxin-induced cell division and affects multiple developmental processes. The Plant Cell 15(2), pp. 393–409. Uppalapati, S.R., Ishiga, Y., Wangdi, T., Kunkel, B.N., Anand, A., Mysore, K.S. and Bender, C.L. 2007. The phytotoxin coronatine contributes to pathogen fitness and is required for suppression of salicylic acid accumulation in tomato inoculated with Pseudomonas syringae pv. tomato DC3000. Molecular Plant-Microbe Interactions 20(8), pp. 955–965. Van der Biezen, E.A. and Jones, J.D. 1998. Plant disease-resistance proteins and the gene-for-gene concept. Trends in Biochemical Sciences 23(12), pp. 454–456. Van Loon, L.C. and Van Kammen, A. 1970. Polyacrylamide disc electrophoresis of the soluble leaf proteins from Nicotiana tabacum var. ‘Samsun’ and ‘Samsun NN.’ Virology 40(2), pp. 199–211. Van Loon, L.C. and Van Strien, E.A. 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55(2), pp. 85–97. Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz-Jawhar, R., Ward, E., Uknes, S., Kessmann, H. and Ryals, J. 1994. Salicylic acid is not the translocated signal   110 responsible for inducing systemic acquired resistance but is required in signal transduction. The Plant Cell 6(7), pp. 959–965. Vlot, A.C., Klessig, D.F. and Park, S.-W. 2008. Systemic acquired resistance: the elusive signal(s). Current Opinion in Plant Biology 11(4), pp. 436–442. Volko, S.M., Boller, T. and Ausubel, F.M. 1998. Isolation of new Arabidopsis mutants with enhanced disease susceptibility to Pseudomonas syringae by direct screening. Genetics 149(2), pp. 537–548. Wan, D., Li, R., Zou, B., Zhang, X., Cong, J., Wang, R., Xia, Y. and Li, G. 2012. Calmodulin-binding protein CBP60g is a positive regulator of both disease resistance and drought tolerance in Arabidopsis. Plant Cell Reports 31(7), pp. 1269–1281. Wang, C., Liu, Y., Li, S.-S. and Han, G.-Z. 2015. Insights into the origin and evolution of the plant hormone signaling machinery. Plant Physiology 167(3), pp. 872–886. Wang, G., Ellendorff, U., Kemp, B., Mansfield, J.W., Forsyth, A., Mitchell, K., Bastas, K., Liu, C.M., Woods-Tör, A., Zipfel, C., de Wit, P.J.G.M., Jones, J.D.G., Tör, M. and Thomma, B.P.H.J. 2008. A genome-wide functional investigation into the roles of receptor-like proteins in Arabidopsis. Plant Physiology 147(2), pp. 503–517. Wang, L., Tsuda, K., Sato, M., Cohen, J.D., Katagiri, F. and Glazebrook, J. 2009. Arabidopsis CaM binding protein CBP60g contributes to MAMP-induced SA accumulation and is involved in disease resistance against Pseudomonas syringae. PLoS Pathogens 5(2), p. e1000301. Wang, L., Tsuda, K., Truman, W., Sato, M., Nguyen, L.V., Katagiri, F. and Glazebrook, J. 2011. CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. The Plant Journal: for Cell and Molecular Biology 67(6), pp. 1029–1041. Ward, E.R., Uknes, S.J., Williams, S.C., Dincher, S.S., Wiederhold, D.L., Alexander, D.C., Ahl-Goy, P., Metraux, J.P. and Ryals, J.A. 1991. Coordinate gene activity in response to agents that induce systemic acquired resistance. The Plant Cell 3(10), pp. 1085–1094.   111 Weigel, R.R., Bäuscher, C., Pfitzner, A.J. and Pfitzner, U.M. 2001. NIMIN-1, NIMIN-2 and NIMIN-3, members of a novel family of proteins from Arabidopsis that interact with NPR1/NIM1, a key regulator of systemic acquired resistance in plants. Plant Molecular Biology 46(2), pp. 143–160. van Wersch, R., Li, X. and Zhang, Y. 2016. Mighty dwarfs: arabidopsis autoimmune mutants and their usages in genetic dissection of plant immunity. Frontiers in plant science 7, p. 1717. White, R.F. 1979. Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99(2), pp. 410–412. Wildermuth, M.C., Dewdney, J., Wu, G. and Ausubel, F.M. 2001. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414(6863), pp. 562–565. Wu, D., Liu, Y., Xu, F. and Zhang, Y. 2017. Differential requirement of BAK1 C-terminal tail in development and immunity. Journal of integrative plant biology. Wu, F.-H., Shen, S.-C., Lee, L.-Y., Lee, S.-H., Chan, M.-T. and Lin, C.-S. 2009. Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method. Plant Methods 5, p. 16. Wu, Y., Zhang, D., Chu, J.Y., Boyle, P., Wang, Y., Brindle, I.D., De Luca, V. and Després, C. 2012. The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell reports 1(6), pp. 639–647. Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J. and Zhou, J.-M. 2008. Pseudomonas syringae effector AvrPto blocks innate immunity by targeting receptor kinases. Current Biology 18(1), pp. 74–80. Xu, J., Meng, J., Meng, X., Zhao, Y., Liu, J., Sun, T., Liu, Y., Wang, Q. and Zhang, S. 2016. Pathogen-Responsive MPK3 and MPK6 Reprogram the Biosynthesis of Indole Glucosinolates and Their Derivatives in Arabidopsis Immunity. The Plant Cell 28(5), pp. 1144–1162.   112 Yalpani, N., Silverman, P., Wilson, T.M., Kleier, D.A. and Raskin, I. 1991. Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. The Plant Cell 3(8), pp. 809–818. Yang, Y., Zhang, Yaxi, Ding, P., Johnson, K., Li, X. and Zhang, Yuelin 2012. The ankyrin-repeat transmembrane protein BDA1 functions downstream of the receptor-like protein SNC2 to regulate plant immunity. Plant Physiology 159(4), pp. 1857–1865. Young, M.D., Wakefield, M.J., Smyth, G.K. and Oshlack, A. 2010. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biology 11(2), p. R14. Yuan, Y., Chung, J.-D., Fu, X., Johnson, V.E., Ranjan, P., Booth, S.L., Harding, S.A. and Tsai, C.-J. 2009. Alternative splicing and gene duplication differentially shaped the regulation of isochorismate synthase in Populus and Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 106(51), pp. 22020–22025. Zhang, J., Li, W., Xiang, T., Liu, Z., Laluk, K., Ding, X., Zou, Y., Gao, M., Zhang, X., Chen, S., Mengiste, T., Zhang, Y. and Zhou, J.-M. 2010. Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector. Cell Host & Microbe 7(4), pp. 290–301. Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., Chen, S., Tang, X. and Zhou, J.-M. 2007. A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. Cell Host & Microbe 1(3), pp. 175–185. Zhang, W., Fraiture, M., Kolb, D., Löffelhardt, B., Desaki, Y., Boutrot, F.F.G., Tör, M., Zipfel, C., Gust, A.A. and Brunner, F. 2013. Arabidopsis receptor-like protein30 and receptor-like kinase suppressor of BIR1-1/EVERSHED mediate innate immunity to necrotrophic fungi. The Plant Cell 25(10), pp. 4227–4241. Zhang, Y., Cheng, Y.T., Qu, N., Zhao, Q., Bi, D. and Li, X. 2006. Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs. The Plant Journal: for Cell and Molecular Biology 48(5), pp. 647–656.   113 Zhang, Y., Fan, W., Kinkema, M., Li, X. and Dong, X. 1999. Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proceedings of the National Academy of Sciences of the United States of America 96(11), pp. 6523–6528. Zhang, Y., Goritschnig, S., Dong, X. and Li, X. 2003. A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. The Plant Cell 15(11), pp. 2636–2646. Zhang, Y., Tessaro, M.J., Lassner, M. and Li, X. 2003. Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. The Plant Cell 15(11), pp. 2647–2653. Zhang, Y., Xu, S., Ding, P., Wang, D., Cheng, Y.T., He, J., Gao, M., Xu, F., Li, Y., Zhu, Z., Li, X. and Zhang, Yuelin 2010. Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors. Proceedings of the National Academy of Sciences of the United States of America 107(42), pp. 18220–18225. Zhang, Y., Yang, Y., Fang, B., Gannon, P., Ding, P., Li, X. and Zhang, Yuelin 2010. Arabidopsis snc2-1D activates receptor-like protein-mediated immunity transduced through WRKY70. The Plant Cell 22(9), pp. 3153–3163. Zhang, Z., Liu, Y., Huang, H., Gao, M., Wu, D., Kong, Q. and Zhang, Y. 2017. The NLR protein SUMM2 senses the disruption of an immune signaling MAP kinase cascade via CRCK3. EMBO Reports 18(2), pp. 292–302. Zhang, Z., Shrestha, J., Tateda, C. and Greenberg, J.T. 2014. Salicylic acid signaling controls the maturation and localization of the arabidopsis defense protein ACCELERATED CELL DEATH6. Molecular Plant 7(8), pp. 1365–1383. Zhang, Z., Wu, Y., Gao, M., Zhang, J., Kong, Q., Liu, Y., Ba, H., Zhou, J. and Zhang, Y. 2012. Disruption of PAMP-induced MAP kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2. Cell Host & Microbe 11(3), pp. 253–263.   114 Zhou, J.-M. and Chai, J. 2008. Plant pathogenic bacterial type III effectors subdue host responses. Current Opinion in Microbiology 11(2), pp. 179–185. Zhou, J.M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Shah, J. and Klessig, D.F. 2000. NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Molecular Plant-Microbe Interactions 13(2), pp. 191–202. Zhou, M., Lu, Y., Bethke, G., Harrison, B.T., Hatsugai, N., Katagiri, F. and Glazebrook, J. 2018. WRKY70 prevents axenic activation of plant immunity by direct repression of SARD1. The New Phytologist 217(2), pp. 700–712. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T. and Felix, G. 2006. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125(4), pp. 749–760.     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0364581/manifest

Comment

Related Items