Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of connexin 43 in regulating wound healing-related gene expression in human skin and gingival fibroblasts Tarzemany, Rana 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_may_tarzemany_rana.pdf [ 6.75MB ]
Metadata
JSON: 24-1.0364278.json
JSON-LD: 24-1.0364278-ld.json
RDF/XML (Pretty): 24-1.0364278-rdf.xml
RDF/JSON: 24-1.0364278-rdf.json
Turtle: 24-1.0364278-turtle.txt
N-Triples: 24-1.0364278-rdf-ntriples.txt
Original Record: 24-1.0364278-source.json
Full Text
24-1.0364278-fulltext.txt
Citation
24-1.0364278.ris

Full Text

ROLE OF CONNEXIN 43 IN REGULATING WOUND HEALING-RELATED GENE EXPRESSION IN HUMAN SKIN AND GINGIVAL FIBROBLASTS by  Rana Tarzemany  D.D.S., Tehran Azad Dental University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY  in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES   (Craniofacial Science)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   March 2018  © Rana Tarzemany 2018 ii  Abstract Wound healing in human oral mucosal gingiva is faster and results in significantly reduced scar formation as compared to similar skin wounds. Fibroblasts are the most abundant group of connective tissue cells that play a key role in wound healing and scar formation. It is possible that differential healing outcomes in skin and gingiva may relate to the distinct phenotypic features of fibroblasts residing in these tissues. In fibroblasts, cells-to-cell communication occurs partly through connexin (Cx) hemichannels (HCs) and gap junctions (GJs). Findings from previous studies have shown that functional blockage of connexin 43 (Cx43), the most ubiquitous Cx in skin (SFBLs) and gingival fibroblasts (GFBLs), accelerates wound closure in skin and may alleviate scarring, but the mechanisms are poorly understood and may involve modulation of Cx43 function in fibroblasts. In the present dissertation, we show that (1) Cx43 was the most abundant Cx present in cultured human SFBLs and GFBLs. (2) Its abundance was potently downregulated at the early stage of human gingival wound healing. (3) Cx43 assembled into GJ and HC plaques in skin and gingival epithelium and connective tissue fibroblasts, although its distribution into GJs or HCs was markedly different in these two tissues. (4) Cx43 mainly assembled into HCs in GFBLs while in SFBLs only a few HCs were present in vivo and in vitro. (5) Using an in vivo-like 3D culture model and Cx43 mimetic peptides to block its function, we showed that the GJ, HC, and channel-independent functions of Cx43 distinctly upregulate anti-fibrotic and downregulate profibrotic wound healing-related genes in GFBLs and SFBLs. (6) In GFBLs this response was mainly mediated by activation of ERK1/2 pathway via Cx43 HC blockage.  Thus, Cx43 assembly into GJs and HCs and its function are distinct in SFBLs and GFBLs, which may contribute to the different wound healing outcomes in these tissues. iii  Furthermore, specific blockage of Cx43 HC functions may provide a novel target to promote wound healing and alleviate scar formation. iv  Lay Summary Scar formation is the outcome of skin injury that can cause physiological and psychological problems. Unfortunately, there exists no effective treatment to prevent scars. On the other hand, oral mucosa heals with minimal scaring. Therefore, studying these two tissues may provide novel information about the molecular mechanisms involved in scar formation, which may be further used to prevent or treat scars. This project focused on the role of connexin 43 (Cx43), a cell-to-cell communication molecule, in human wound healing and scar formation. We investigated and compared Cx43 presence in skin and mucosa. Then, to study its possible role, we blocked its function using specific laboratory methods. Subsequently, the expression of key wound healing- and scar formation-related genes were studied. Findings from this project suggested the important role of Cx43 in differential healing outcomes in skin and mucosa, and may be used to develop better therapeutic modalities to treat scars.             v  Preface  The work presented in this thesis has already been published or submitted for publication. Dr. Lari Häkkinen was the principal investigator of the research project and critically reviewed all the manuscripts included in this thesis. This is to confirm that Rana Tarzemany is the first author in all publications included in this thesis as shown below.  Chapter 2: Tarzemany R, Jiang G, Larjava H, Häkkinen L. Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts. PLoS One. 10, e0115524 (2015).  Chapter 3: Tarzemany R, Jiang G, Jiang JX, Larjava H, Häkkinen L. Connexin 43 Hemichannels Regulate the Expression of Wound Healing-Associated Genes in Human Gingival Fibroblasts. Sci Rep. 7, 14157 (2017).  Chapter 4: Tarzemany R, Jiang G, Jiang JX, Gallant-Behm C, Wiebe C, Hart D, Larjava H, Häkkinen L. Connexin 43 Distinctly Regulates the Expression of Wound Healing-Related Genes in Human Gingival and Skin Fibroblast. [Conditionally Accepted]  Tissue donors provided written informed consent. Procedures were reviewed and approved by the Office of Research Ethics of the University of British Columbia (C05-0585 and C05-0047) and comply with the ethical rules for human experimentation that are stated in the 1975 Declaration of Helsinki. To collect pig tissue samples, all procedures were reviewed and approved by the Animal Care Committee of the Faculty of Medicine, University of Calgary (Calgary, AB, Canada; protocol number M03037.M08025, 2009). vi  Authors’ contribution to generate this work follows as below: Conceived and designed the experiments: Rana Tarzemany, Guoqiao Jiang, and Lari Häkkinen. Performed the experiments: Rana Tarzemany and Guoqiao Jiang.  Analyzed the data: Rana Tarzemany and Lari Häkkinen. Contributed reagents/materials/analysis tools: Hannu Larjava and Lari Häkkinen Wrote the main manuscript text and analyzed the results: Rana Tarzemany, Guoqiao Jiang, Hannu Larjava, and Lari Häkkinen. Developed and affinity purified the Cx43(E2) antibody: Jean X. Jiang Participated in the pig experiment: Corrie Gallant-Behm, Colin Wiebe, David Hart, Hannu Larjava, and Lari Häkkinen. All the authors reviewed the manuscripts prior to submission for publication.    vii  Table of Contents Abstract .................................................................................................................................. ii Lay Summary ......................................................................................................................... iv Preface ................................................................................................................................... v Table of Contents.................................................................................................................. vii List of Tables ........................................................................................................................ xiii List of Figures ........................................................................................................................ xv List of Abbreviations .......................................................................................................... xviii Acknowledgements ............................................................................................................. xxi Dedication .......................................................................................................................... xxii Chapter 1: Introduction .......................................................................................................... 1 1.1 Wound Healing ..................................................................................................................... 1 1.1.1 Skin Wound Healing ................................................................................................................. 1 1.1.2 Gingival Wound Healing ........................................................................................................... 2 1.2 Fibroblasts ............................................................................................................................ 3 1.2.1 Role of Fibroblasts in Wound Healing ...................................................................................... 3 1.2.2 Distinct Phenotypic Features of Skin and Gingival Fibroblasts ................................................ 5 1.3 Connexins, Hemichannels, and Gap Junctions: Structure and Function ................................... 6 1.3.1 Connexin 43: Synthesis, Regulation, and Function .................................................................. 8 1.3.1.1 Synthesis and Regulation ................................................................................................................. 8 viii  1.3.1.2 Hemichannel Functions ................................................................................................................. 10 1.3.1.3 Gap Junction Functions .................................................................................................................. 11 1.3.1.4 Intercellular Communications Through Tunnelling Nanotubes and Extracellular Vesicles ........... 12 1.3.1.5 Channel-independent Functions.................................................................................................... 13 1.4 Role of Connexin 43 in Skin Healing ..................................................................................... 14 1.5 Role of Connexin 43 in Gingival Healing ............................................................................... 15 1.6 Hypotheses and Objectives ................................................................................................. 16 1.6.1 Hypothesis 1 ........................................................................................................................... 17 1.6.2 Specific Aim 1 ......................................................................................................................... 17 1.6.3 Hypothesis 2 ........................................................................................................................... 17 1.6.4 Specific Aim 2 ......................................................................................................................... 17 1.6.5 Hypothesis 3 ........................................................................................................................... 18 1.6.6 Specific Aim 3 ......................................................................................................................... 18 1.7 Figures ................................................................................................................................ 19 Chapter 2: Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts ............................................................................................................................ 20 2.1 Introduction ........................................................................................................................ 20 2.2 Materials and Methods ....................................................................................................... 24 2.2.1 Tissue Samples ....................................................................................................................... 24 2.2.2 Cell Culture ............................................................................................................................. 25 2.2.3 Ethics Statement .................................................................................................................... 25 2.2.4 Blocking of Cx43 Function by Mimetic Peptides or MFA ....................................................... 25 2.2.5 Blocking Cx43 Expression by siRNA Technique ...................................................................... 26 ix  2.2.6 Real-Time PCR ........................................................................................................................ 26 2.2.7 Preparation of Cell Lysates/Conditioned Medium Samples for Western Blotting ................ 27 2.2.8 Western Blotting .................................................................................................................... 28 2.2.9 Use of Chemical Inhibitors to Block Signaling Pathways ....................................................... 29 2.2.10 Dye Transfer Experiments ...................................................................................................... 29 2.2.11 Scratch Wound Cell Migration Assay ..................................................................................... 30 2.2.12 Immunostaining ..................................................................................................................... 31 2.2.13 Statistical Analysis .................................................................................................................. 32 2.3 Results ................................................................................................................................ 32 2.3.1 Cx43 Is the Major Connexin Expressed by Gingival Fibroblasts ............................................. 32 2.3.2 Cx43 Is Strongly Downregulated in Gingival Epithelium and Fibroblasts During Wound Healing  ............................................................................................................................................... 33 2.3.3 Blocking of Cx43 Function Significantly Regulates the Expression of a Distinct Set of Wound Healing-Associated Genes in Gingival Fibroblasts .............................................................................. 35 2.3.4 Characterization of Proteins Regulated by Gap27 Treatment in Gingival Fibroblasts .......... 38 2.3.5 Blocking of Cx43 Function by Gap27 Modulates Key Signaling Pathways in Gingival Fibroblasts .......................................................................................................................................... 38 2.3.6 Distinct Involvement of Gap27-Regulated Signaling Pathways in Modulation of Wound Healing-Associated Genes in Gingival Fibroblasts .............................................................................. 39 2.4 Discussion .......................................................................................................................... 41 2.5 Tables ................................................................................................................................. 51 2.6 Figures ................................................................................................................................ 76 x  Chapter 3: Connexin 43 Hemichannels Regulate the Expression of Wound Healing-Associated Genes in Human Gingival Fibroblasts .................................................................................... 98 3.1 Introduction ........................................................................................................................ 98 3.2 Materials and Methods ..................................................................................................... 101 3.2.1 Tissue Samples ..................................................................................................................... 101 3.2.2 Cell Culture ........................................................................................................................... 102 3.2.3 Ethics Statement .................................................................................................................. 102 3.2.4 Immunostaining ................................................................................................................... 102 3.2.5 Modulation of Cx43 GJ and HC Function ............................................................................. 103 3.2.6 Quantitative Real-Time RT-PCR (qPCR) ................................................................................ 103 3.2.7 Preparation of Cell Lysates for Western Blotting................................................................. 104 3.2.8 Western Blotting .................................................................................................................. 104 3.2.9 Blocking of ERK1/2 and ATP Signaling Pathways ................................................................. 105 3.2.10 Dye Transfer Experiments .................................................................................................... 105 3.2.11 Statistical Analysis ................................................................................................................ 106 3.3 Results .............................................................................................................................. 107 3.3.1 Immunolocalization of Cx43 GJs and HCs in Human Gingiva in vivo ................................... 107 3.3.2 Cx43 Assembles into GJs and HCs in Cultured Gingival Fibroblasts ..................................... 108 3.3.3 Gingival Fibroblasts Possess Functional Cx43 GJs and HCs .................................................. 109 3.3.4 Targeting of Cx43 with TAT-Gap19 Significantly Regulates Gene Expression Similar to Gap27 in Gingival Fibroblasts ....................................................................................................................... 110 3.3.5 Modulation of Cell Cycle by Gap27 and TAT-Gap19 in Gingival Fibroblasts ........................ 111 xi  3.3.6 Targeting of Cx43 with TAT-Gap19 Modulates ERK Signaling Pathway Similar to Gap27 in Gingival Fibroblasts ........................................................................................................................... 112 3.3.7 Distinct Involvement of ERK1/2 Signaling Pathway in Modulation of Cx43-Regulated Genes in Gingival Fibroblasts ....................................................................................................................... 112 3.3.8 Inhibition of ATP Signaling Partially Recapitulates Gene Expression Changes Induced by TAT-Gap19 in Gingival Fibroblasts ........................................................................................................... 114 3.3.9 Modulation of mRNA Abundance of ATP and Adenosine Receptors by Gap27 and TAT-Gap19 in Gingival Fibroblasts ........................................................................................................... 114 3.3.10 Blocking of ATP Signaling Activates ERK1/2 Signaling Pathway Similar to Cx43 Mimetic Peptides in Gingival Fibroblasts ........................................................................................................ 115 3.4 Discussion ......................................................................................................................... 116 3.5 Tables ............................................................................................................................... 121 3.6 Figures .............................................................................................................................. 134 Chapter 4: Connexin 43 Regulates the Expression of Wound Healing-Related Genes in Human Gingival and Skin Fibroblasts ............................................................................................... 148 4.1 Introduction ...................................................................................................................... 148 4.2 Materials and Methods ..................................................................................................... 151 4.2.1 Human Tissue Samples ........................................................................................................ 151 4.2.2 Pig Tissue Samples ............................................................................................................... 151 4.2.3 Cell Culture ........................................................................................................................... 152 4.2.4 Ethics Statement .................................................................................................................. 152 4.2.5 Immunostaining ................................................................................................................... 153 4.2.6 Quantitative Real-Time RT-PCR (qPCR) ................................................................................ 153 xii  4.2.7 Western Blotting .................................................................................................................. 154 4.2.8 Modulation of Cx43 GJ and HC Function ............................................................................. 154 4.2.9 Dye Transfer Experiments .................................................................................................... 154 4.2.10 Statistical Analysis ................................................................................................................ 155 4.3 Results .............................................................................................................................. 155 4.3.1 Human Gingival Fibroblasts and Epithelial Cells Show Abundant Immunostaining of Cx43 HCs Compared to Skin in vivo. .......................................................................................................... 155 4.3.2 Skin Fibroblasts Express Increased Amount of Cx43 Protein but Possess Fewer Cx43 HCs than Gingival Fibroblasts in 3D Cultures. .......................................................................................... 157 4.3.3 Gingival and Skin Fibroblasts Possess Functional Cx43 GJs and HCs. .................................. 159 4.3.4 A Set of Wound Healing-Associated Genes is Distinctly Regulated via Cx43 GJs and HCs in Gingival and Skin Fibroblasts. ........................................................................................................... 161 4.3.5 Gap27 and TAT-Gap19 Treatments Distinctly Modulate Expression of a Set of Wound Healing-Associated Genes in Human Gingival Compared to Skin Fibroblasts.................................. 162 4.4 Discussion ......................................................................................................................... 163 4.5 Tables ............................................................................................................................... 170 4.6 Figures .............................................................................................................................. 183 Chapter 5: Discussion and Conclusion ................................................................................. 193 5.1 Study Limitations and Future Directions ............................................................................ 199 References .......................................................................................................................... 202 xiii  List of Tables Table 2-1: List of the human gingival fibroblast lines used for the study. .................................... 51 Table 2-2: Primers used for real-time PCR. ................................................................................... 52 Table 2-3: List of antibodies used for immunostaining and Western blotting. .............................. 63 Table 2-4: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of genes involved in protein degradation during wound healing in gingival fibroblasts. .............. 67 Table 2-5: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of extracellular matrix proteins and cell contractility and myofibroblast-associated genes in gingival fibroblasts. ........................................................................................................................ 69 Table 2-6: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of genes involved in TGF-β signaling and encoding VEGF-A and CXCL12/SDF-1α in gingival fibroblasts. ...................................................................................................................................... 71 Table 2-7: Blocking of Cx43 function with Gap27 treatment upregulates significantly expression of Cx43 and Cadherin-2 expression involved in formation of cell-cell junctions. ........................ 73 Table 2-8: Blocking of Cx43 function with Gap27 treatment activates distinct signaling pathways that regulate wound healing-associates genes in gingival fibroblasts. ........................................... 74 Table 3-1: List of antibodies used for immunostaining and Western blotting. ............................ 121 Table 3-2:Primers used for quantitative real-time RT-PCR. ........................................................ 123 Table 3-3: Summary of Involvement of ATP and ERK1/2 Signaling Pathways in Cx43 HC- or GJ-Regulated Genes. .................................................................................................................... 132 Table 4-1: List of the human gingival and skin fibroblast lines used for the study. .................... 170 Table 4-2: List of antibodies used for immunostaining and Western blotting. ............................ 171 Table 4-3: Primers used for quantitative real-time RT-PCR. ....................................................... 172 xiv  Table 4-4: Regulation of the Expression of Wound Healing-Associated Genes by Cx43 GJ and HC Blocking Peptides in Gingival and Skin Fibroblasts. ............................................................ 179 Table 4-5: Regulation of the Expression of Wound Healing-Associated Genes by Cx43 GJ and HC Blocking Peptides in Gingival Fibroblasts in two- and three-Dimensional Cell Culture Models. ......................................................................................................................................... 181 xv  List of Figures  Figure 1-1: Schematic summary of Connexin structure, and Connexin 43 function and peptide binding sites. ................................................................................................................................... 19 Figure 2-1: Gingival fibroblasts express Cx43 as their major connexin protein. .......................... 76 Figure 2-2: Cx43 is downregulated in gingival fibroblasts during wound healing. ....................... 77 Figure 2-3: Cx43 is downregulated in gingiva during wound healing. .......................................... 79 Figure 2-4: Immunolocalization of Cx43 in gingival wound macrophages. .................................. 81 Figure 2-5: Immunolocalization of Cx43 in gingival wound myofibroblasts. ............................... 82 Figure 2-6: Phase contrast images of gingival fibroblast cultures treated with or without Gap27. ........................................................................................................................................................ 83 Figure 2-7: Gap27 and MFA suppress GJ-mediated dye transfer in gingival fibroblasts. ............. 84 Figure 2-8: Gap27-treatment promotes gingival fibroblast migration. .......................................... 85 Figure 2-9: Effect of Gap27-mediated blocking of Cx43 function on gene expression in parallel gingival fibroblast lines. ................................................................................................................. 86 Figure 2-10: Effect of Gap26 and Gap27 treatment on gene expression in gingival fibroblasts. .. 87 Figure 2-11: Expression of a set of genes in gingival fibroblasts treated with connexin inhibitor meclofenamic acid (MFA) relative to untreated samples. ............................................................. 88 Figure 2-12: Cx43 siRNA treatment suppresses Cx43 expression, abundance, and GJ-mediated dye transfer in gingival fibroblasts. ................................................................................................ 89 Figure 2-13: Blocking of Cx43 by Gap27 resulted in significantly increased secretion of active MMP-1 and MMP-10, and pro-MMP-3 by gingival fibroblasts. ................................................... 91 Figure 2-14: Blocking of Cx43 function by Gap27 promotes secretion of VEGF-A, and suppresses DCN levels in gingival fibroblast cultures. .................................................................. 93 xvi  Figure 2-15: Gap27 treatment increases Cx43 protein abundance significantly. .......................... 94 Figure 2-16: Western blotting analysis of key signaling pathways modulated by Gap27 in gingival fibroblasts. ........................................................................................................................ 95 Figure 2-17: Modulation of Gap27-regulated gene expression in gingival fibroblasts by pharmacological inhibitors of AP1, SP1, TGF-β, p38, MEK1/2 and GSK3α/β signaling pathways. ........................................................................................................................................................ 96 Figure 3-1: Localization of Cx43 GJs and HCs in human gingiva in vivo. ................................. 134 Figure 3-2: Immunolocalization of Cx43 GJs and HCs in cultured human gingival fibroblasts. 135 Figure 3-3: The expression, abundance and distribution of Cx43 in high- and low-density cultures of human gingival fibroblasts. ...................................................................................................... 136 Figure 3-4: Gingival fibroblasts have functional Cx43 GJs and HCs. ......................................... 138 Figure 3-5: Gap27 and TAT-Gap19 induce partially similar gene expression response in human gingival fibroblasts. ...................................................................................................................... 140 Figure 3-6: The expression of a set of genes in human gingival fibroblasts treated with increasing concentrations of TAT-Gap19 or Gap19 relative to control samples. ......................................... 141 Figure 3-7: Western blotting analysis of activation of ERK1/2 of the MAPK pathway by Cx43 GJs and HCs in gingival fibroblasts. ............................................................................................ 142 Figure 3-8: Modulation of Gap27 and TAT-Gap19-regulated gene expression by pharmacological inhibitor of ERK1/2 signaling pathway. ...................................................................................... 143 Figure 3-9: Blocking of ATP signaling pathway significantly modulates amount of mRNA for key wound healing-associated genes and activates of the ERK1/2 pathway. .............................. 144 Figure 3-10: The expression of a set of genes in human gingival fibroblasts treated with TAT-Gap19 with or without apyrase relative to control samples. ........................................................ 146 xvii  Figure 3-11: The expression of a set of ATP and adenosine receptor signaling genes in human gingival fibroblasts treated with Gap27 or TAT-Gap19 relative to control samples. .................. 147 Figure 4-1: Localization of Cx43 GJs and HCs in human gingiva and skin in vivo. ................... 183 Figure 4-2: Cx43 expression and localization in cultured gingival and skin fibroblasts. ............ 185 Figure 4-3: Gingival and skin fibroblasts have functional Cx43 GJs and HCs. .......................... 187 Figure 4-4: Gap27 and TAT-Gap19 effect on gene expression response in human gingival and skin fibroblast cultures. ................................................................................................................ 188 Figure 4-5: The expression of a set of genes in human gingival and skin fibroblasts treated with increasing concentrations of Gap27 or TAT-Gap19 relative to control samples. ........................ 190 Figure 4-6: Gene expression response to Gap27 or TAT-Gap19 treatment in human gingival and skin fibroblast cultures. ................................................................................................................ 191  xviii  List of Abbreviations ADA   Adenosine Deaminase APMA   Aminophenylmercury Acetate AP1   Activator Protein 1 AS-ODN  Antisense Oligodeoxynucleotides ATP   Adenosine Triphosphate     BGN   Biglycan B2M   Beta-2-microglobulin CL   Cytoplasmic Loop   CT   C-terminal    CTGF   Connective Tissue Growth Factor   CTSK   Cathepsin K   Cx   Connexin    DCN   Decorin   DMEM  Dulbecco's Modified Eagle's Medium  ECM   Extracellular Matrix   EDA-FN  Domain A-Fibronectin   EDB-FN  Domain B-Fibronectin   EGR   Early Growth Response     EV   Extracellular Vesicle    FBS   Fetal Bovine Serum    FGF   Fibroblast Growth Factor   FMOD   Fibromodulin xix  GAPDH  Glyceraldehydes-3-phosphate ddehydrogenase   GFBL   Gingival Fibroblast    GJ   Gap Junction  GJIC   Gap Junction Intercellular Communication    GT   Granulation Tissue   HC   Hemichannel HD   High Density HGF/SF  Hepatocyte Growth Factor/Scatter Factor HPRT1  Hypoxanthine Phosphoribosyltransferase I    IL   Interleukin    IP3   Inositol-3-Phosphate    KGF   Keratinocyte Growth Factor LD   Low Density   LUM   Lumican MFA   Meclofenamic Acid    MMP   Matrix Metalloproteinase  NAB   NGFI-A Binding Protein      NMMII  Non-Muscle Myosin II   ODDD   Oculodentodigital Dysplasia   PBS   Phosphate-Buffered Saline   PI   Propidium iodide  qPCR   Quantitative Real-Time RT-PCR    SEM   Standard Error of the Mean   xx  SFBL   Skin Fibroblast siRNA   Small Interfering RNA SP1   Specificity Protein 1 TBP   TATAA-box binding protein   TGF-β   Transforming Growth factor   TGF-βR1  TGF-β Receptor 1   TGF-βR2  TGF-β Receptor 2   TIMP   Tissue Inhibitor of Metalloproteinase TN-C   Tenascin-C  TNF-α   Tumor Necrosis Factor-α TNT   Tunnelling Nanotube   UBC   Ubiquitin C    VEGF-A  Vascular Endothelial Growth Factor-A   WCT   Wound Connective Tissue   ZO   Zonula Occludens  α-SMA  α-Smooth Muscle Actin 2D   Two-Dimensional 3D   Three-Dimensional   xxi  Acknowledgements I am extremely grateful to my research supervisor, Dr. Lari Häkkinen, for his encouragement, continuous support, excellent guidance and the opportunity that he provided me to mature as a researcher.  I would also like to extend my sincere gratitude to the members of my supervisory committee, Dr. Hannu Larjava and Dr. Clive Roberts, for their interest in my research and their valuable guidance throughout the development of this research work.  I wish to extend my appreciation and gratitude to all the technical staff working at the Lab of Periodontal Biology, in particular Dr. Guoqiao Jiang, Dr. Leeni Koivisto, and Mr. Cristian Sperantia for their advice and unparalleled assistance during the experimental phases of this thesis.  The financial support for this work was provided by Canadian Institutes of Health Research (MOP-77550 and PJT-153223 to Lari Häkkinen), Natural Sciences and Engineering Research Council of Canada (to Lari Häkkinen), Osteology Foundation (to Lari Häkkinen), National Institute of Health (CA196214 to Jean X. Jiang), Welch Foundation Grant (AQ-1507 to Jean X. Jiang), UBC Faculty of Dentistry Graduate Awards (to Rana Tarzemany), and Travel awards (to Rana Tarzemany) including, CIHR Institute Community Support Travel Award (for IADR Annual Conference, Seattle, USA, 2012), Colgate-Palmolive Travel Award (for VOLPE International Periodontal Research Competition, Ohio State University, Columbus, USA, 2015), Canadian Dental Specialties Association (CDSA) Graduate Student Travel Award (for Research Forum Poster Competition at the American Academy of Periodontology (AAP) annual meeting, San Diego, USA, 2016), University of North Carolina (UNC) Travel Award to attend the UNC Perio  Expo (Chapel Hill, NC, USA, 2017). xxii  Dedication To my parents, for their continuous encouragement, support, and confidence in me.  To my husband, Kian, for his endless sacrifice, support, and love.   To my brother and best friend, Hamed.   1  Chapter 1: Introduction 1.1 Wound Healing 1.1.1 Skin Wound Healing Wound healing is a multifaceted and complex process that aims to maintain tissue integrity after injury and is governed by sequential yet overlapping phases including hemostasis, inflammation, proliferation, and remodeling. In skin, scar formation is a common and unavoidable outcome of the wound healing. Scars, clinically, may vary from fine lines to pathological keloids or hypertrophic scars with significant mortality and morbidity and subsequent impart immense functional, psychological and economic impact. For instance, anti-scaring therapy in skin applications alone costs approximately $12 billion in the United States annually [Sen et al., 2009; Leavitt et al., 2016; Lindley et al., 2016; Wang et al., 2017]. At the molecular level, the excessive accumulation of abnormally organized collagen-rich extracellular matrix (ECM) by fibroblasts during the remodeling phase of wound healing is the hallmark of scar formation. In contrast to intact skin, scar tissue contains densely-packed, abnormally-thin, and paralleled collagen bundles that result in a tissue with reduced tensile strength [Larjava et al., 2011]. Strong evidence highlights the role of inflammation in scar formation. Dermal healing is linked with increased and prolonged inflammatory reaction, whereas scarless healing in fetal skin or adult oral mucosa is associated with a significantly attenuated inflammatory response. Various studies have also shown the central influence of other key factors including upregulated activity of scar-prone TGF-1, profibrotic fibroblast phenotype, and increased ECM composition and its decreased turnover rate in skin in determining the healing outcome, as compared to the non scar-forming tissues [Larjava et al., 2011; Leung et al., 2012; Landen et al., 2016; Leavitt et al., 2016; Wang et al., 2017]. Yet, the 2  exact mechanisms underlying wound healing and scar formation are not completely understood. In addition, no clinically predictable and effective treatment is currently available to treat scars, emphasizing the need to better understand the fundamental mechanisms involved in scar formation. Minimally scar-forming oral mucosal or scarless fetal skin wound healing provide valuable sources to study the molecular and cellular pathways that regulate scarless wound healing, and thus to the development of more effective therapies [Leavitt et al., 2016].   1.1.2 Gingival Wound Healing Oral mucosal gingiva provides a practical source to study regenerative healing in adults, due to its easy accessibility and common discard during surgical procedures. Wound healing in human oral mucosal attached gingiva is faster and is associated with a milder inflammatory response, resulting in significantly reduced scar formation as compared to similar skin wounds [Michalopoulos and DeFrances, 1997; Stoick-Cooper et al., 2007; Wong et al., 2009; Chen et al., 2010; Glim et al., 2013, Häkkinen et al., 2015]. Several fundamental differences have been reported between oral mucosa and skin tissues that may contribute to the differential nature of healing responses in these tissues. For instance, adult oral mucosal gingiva harbours mesenchymal stem cells with multipotent differentiation capacity and fetal-like phenotype, and fibroblasts with distinct non-fibrotic properties (to be discussed in more detail below) that may play key roles in scar-free gingival healing [Fournier et al., 2013; Häkkinen et al., 2014]. Intact human oral mucosa ECM composition is also different than in skin. For example, in oral mucosa as compared to skin, ED-A Fibronectin and blood vessels are increased while elastin fibers are decreased. In the epithelium, oral mucosal keratinocytes exhibit greater proliferatory and migratory capacity associated with highly-expressed molecules related to the cellular movement 3  and proliferation as compared to skin keratinocytes, which may be a contributing factor to the faster healing in gingiva [Glim et al., 2014; Turabelidze et al., 2014; Leavitt et al., 2016].  To better identify the mechanisms of scar-free healing in humans, it would be ideal to compare scarless gingival and scar-prone dermal healing in the same individual. However, this may not be an easy task due to the ethical issues. Interestingly, the red Duroc pig wound healing model closely resembles the human healing pattern in skin and gingiva, with similar healing outcomes and molecular composition over time [Mak et al., 2009; Wong et al., 2009; Larjava et al., 2011; Glim et al., 2013]. Therefore, both pig and human gingiva may serve as ideal wound healing models to offer a rationale for therapeutic development to treat scars. 1.2 Fibroblasts 1.2.1 Role of Fibroblasts in Wound Healing Fibroblasts are heterogeneous and the most abundant cell population of the connective tissue. By regulating inflammation, ECM production and remodeling, and reepithelialization fibroblasts play a key role in wound healing and scar formation [Häkkinen et al., 2012; Glim et al., 2013; Leavitt et al., 2016]. During the inflammation phase of wound healing, fibroblasts recruit key immune cells including T-helper cells and macrophages to the wound site by secreting various inflammatory cytokines such as TGF-β, interleukins and TNF-. Proinflammatory interleukin-1β released from fibroblasts regulates the production of other growth factors and cytokines important in wound healing. Furthermore, fibroblasts themselves are also responsive to these secreted cytokines. TGF-β1, a profibrotic cytokine, stimulates fibroblasts differentiation into myofibroblasts that facilitate the ECM deposition and wound contraction in the remodeling stage [Kendall and Feghali-Bostwick, 2014; Mescher et al., 2017].  4  The inflammation-related function of fibroblasts is shortly replaced by a new significant role, the rapid deposition and remodeling of new ECM components to reestablish tissue strength and function. Fibroblasts are responsible for the production of different types of collagen proteins that rapidly accumulate during the early granulation tissue formation. Then, during the remodeling phase, in which the new ECM turns into a well-organized connective tissue, fibroblasts involve themselves in the excessive collagen-rich ECM degradation and inflammation suppression necessary for normal healing [Schwartz, 2010; Häkkinen et al., 2012; Karin and Clevers, 2016]. Proliferation and migration of keratinocytes over the provisional matrix to eventually close the wound is also partly regulated by fibroblast-derived growth factors and cytokines such as keratinocyte growth factor (KGF), hepatocyte growth factor/scatter factor (HGF/SF), and interleukin-6 (IL-6) [Ghahary and Ghaffari, 2007; Werner et al., 2007; Glim et al., 2013; Häkkinen et al., 2015].  It is important to note that phenotypic properties of fibroblasts are markedly regulated by their interactions with local ECM (niche) through different mechanisms including receptor-ligand interactions, growth factors, and mechanosensory signals. During different stages of wound healing the pericellular niche constantly changes, which consequently affects the fibroblasts phenotype and activity, which are important in the healing process [Andersson-Sjöland et al., 2011; Häkkinen et al., 2012 and 2015; Mah et al., 2017]. In addition, the presence of fibroblast subpopulations with distinct phenotypes in a given tissue, including skin and gingiva, also contributes to the healing outcome. For instance, fibroblast subpopulations residing in the deep skin connective tissue exhibit a pro-fibrotic gene expression profile, and interestingly, resemble fibroblasts found in hypertrophic scars [Van Beurden et al., 2003; Wang et al., 2008; Häkkinen et al., 2012].  5  Collectively, fibroblasts are key modulators of different phases of wound healing, and therefore their phenotypic characteristics may partly determine the healing outcome.  1.2.2 Distinct Phenotypic Features of Skin and Gingival Fibroblasts Accumulating evidence suggests that the outcome of the wound healing may depend on the phenotypic features of the resident fibroblasts in a given tissue. For instance, skin and gingiva that are characterized by different healing outcomes harbour fibroblasts with distinct properties. Human gingival fibroblasts (GFBLs) display a non-fibrotic gene expression phenotype compared to the pro-fibrotic skin fibroblasts (SFBLs) [Glim et al., 2013; Mah et al., 2014 and 2017]. Findings from co-cultures of keratinocytes with GFBLs and SFBLs indicate that matrix metalloproteinase-1 (MMP-1), a major collagenase involved in keratinocytes migration and ECM remodeling during wound healing, is differentially expressed in GFBLs and SFBLs [Koivisto et al., 2012]. Furthermore, scarless oral gingival and fetal skin fibroblasts similarly share certain phenotypic traits that are distinct from the scar-forming adult dermal fibroblasts [Glim et al., 2013; Rinkevich et al., 2015]. The GFBLs migration rate into the early provisional wound matrix is faster compared to the SFBLs, suggesting their possible contribution to the faster healing in gingiva compared to skin [Lorimier et al., 1998]. Different developmental origins of the GFBLs and SFBLs may indicate their distinct phenotypes. Interestingly, it has been shown that different developmental origins result in distinct gene expression profiling phenotype of postnatal cells [Rinn et al., 2006]. A majority of GFBLs originate from the neural crest, whereas trunk and limb SFBLs originate from the somite and lateral plate mesoderm [Xu et al., 2013; Häkkinen et al., 2014; Leavitt et al., 2016; Thulabandu et al., 2017]. Thus, it is becoming clear that distinct phenotypic traits of GFBLs and SFBLs may underlie the different wound healing outcomes in gingiva and skin.  6  1.3 Connexins, Hemichannels, and Gap Junctions: Structure and Function During physiological and pathological conditions, cells communicate with each other and the surrounding environment in various ways, including direct cell-to-cell contact, auto-, para- and endocrine signaling, and recently introduced tunnelling nanotubes (TNTs) and extracellular vesicles (EVs), to maintain the tissue homeostasis in a community environment [Boitano et al., 2004; Camussi et al., 2010; Roy and Kornberg 2015; Teimouri and Kolomeisky, 2016; Baker, 2017]. Findings from dye transfer experiments and electron microscopy analysis have shown that in fibroblasts cell-to-cell communication partly occurs through gap junctions (GJs) and hemichannels (HCs), in vivo and in vitro [Gabbiani et al., 1978; Salomon et al., 1988; Kar et al., 2012; Ehrlich, 2013; Pinheiro et al., 2013]. In humans, GJs and HCs are composed of subunit proteins, connexins (Cxs) and pannexins. Assembly of six homomeric (identical) or heteromeric (different) Cxs forms one HC or connexon. Hexameric or octameric assembly of pannexins can also form HCs. HCs provide a pathway for the transfer of small ions, metabolites, and signaling molecules between the cell cytosol and the extracellular environment, and also participate in the regulation of various cell functions including survival, proliferation, migration, oxidative stress, and gene expression via auto- and paracrine mechanisms [Goodenough and Paul, 2003; Burra and Jiang 2011; Iyyathurai et al., 2013].  Head-to-head docking of two HCs from neighboring cells forms a GJ channel. These channels provide direct cell-to-cell contact for the exchange of various small signaling molecules, including inositol-3-phosphate (IP3) and cAMP, ions such as Ca2+, metabolites, amino acids, and microRNAs, between cytoplasms of the communicating cells. They also regulate important biological events such as tissue differentiation, remodeling, homeostasis, and cell survival and death [Kar et al., 2012; Iyyathurai et al., 2013; Sáez and Leybaert; 2014].  7  Findings from in vitro studies have shown that after Cxs are synthesized, they are delivered to the cell membrane as HCs where they then join the existing GJ plaque clusters [Lauf et al., 2002; Nielsen et al., 2012; Sáez and Leybaert, 2014; Zhang and Cui, 2017]. In physiological resting condition, GJ channels are usually open, while HCs are typically closed. Several similar factors regulate both GJs and HCs, although the effects are often opposite. For example, while increased levels of inflammatory cytokines, elevation of intracellular Ca2+ concentration, or oxidative stress promote the opening of HCs during wound healing or ischemia, they may cause closure of GJs [Schalper et al., 2012; Iyyathurai et al., 2013; Willebrords et al., 2016].  In humans, Cxs are a family of 21 molecules, each composed of four transmembrane-spanning domains, two extracellular loops (E1 and E2), and the cytoplasmic domains including the N-terminus, C-terminal domain (CT), and the cytoplasmic loop (CL). The transmembrane regions participate in formation of the GJs and HCs central pore. E1 and E2 are responsible for the docking of two opposing HCs through intramolecular disulfide bonds between cysteines that are located within both extracellular loops, maintaining a 2-3 nm gap between the junctional membranes. Either the alteration of the position or the mutation of these cysteine residues can affect the formation of functional intercellular GJs [Goodenough and Paul, 2003; Sáez et al., 2003]. The CL and CT domains are variable in length and sequence, contributing to the differential Cxs properties, while other structural regions are highly conserved among different Cxs [Goodenough and Paul, 2003; Saez et al., 2003; Dbouk et al., 2009]. The cytoplasmic domains serve as an interactive platform for several cytoskeletal and junctional proteins and enzymes like kinases or phosphatases, and, therefore play an important regulatory role in cellular and developmental functions such as gene expression, cell adhesion, migration, and apoptosis, 8  which are independent from channel-related functions of Cxs. For instance, interaction of the CT domain with microtubules such as α- and β-tubulin is essential for the transport of newly synthesized HCs to the plasma membrane. Also, interaction with the actin cytoskeleton and zonula occludens-1 (ZO-1) stabilizes GJs and regulates their size and distribution, respectively, at the plasma membrane. The existence of several phosphorylation sites on the cytoplasmic domains of Cxs allows for interactions with several protein kinases that consequently affect the regulation of Cx trafficking, assembly into HCs and GJs, intercellular communication, and turnover [Hunter et al., 2005; Giepmans, 2006; Kardami et al., 2007; Nambara et al., 2007; Herve et al., 2012; Thevenin et al., 2013; Wang et al., 2013; Abudara et al., 2014]. These channel-independent functions of Cxs are, however, not yet completely understood [Jiang and Gu, 2005; Nielsen et al., 2012; Zhou and Jiang, 2014].  Increasing evidence from several animal and human studies have indicated the spatiotemporally-regulated expression of various Cxs during wound healing and shown that their expression is altered in non-healing chronic wounds and in tissue fibrosis [Trovato-Salinaro et al., 2006; Jansen et al., 2012, Vinken et al., 2012; Churko and Laird, 2013; Martin et al., 2014; Sutcliffe et al., 2015]. Therefore, given that Cxs are involved in cell-to-cell communication mechanisms, important in maintaining tissue hemostasis in both normal and disease/wound conditions, their regulation and function may also partly determine the healing outcome in a given tissue.  1.3.1 Connexin 43: Synthesis, Regulation, and Function 1.3.1.1 Synthesis and Regulation  Cx43 is the most ubiquitous and abundantly expressed Cx in several tissue and cell types including cultured human skin and gingival fibroblasts [Ko et al., 2000; Wright et al., 2009; 9  Churko et al., 2011], which assembles into clusters of GJ plaques in vivo and in vitro [Thévenin et al., 2013]. The fact that Cx43 knockout mice die shortly after birth, due to cardiac malformation, well emphasizes its critical regulatory role in physiological events [Reaume et al., 1995; Nielsen et al., 2012].  Studies using fluorescent-tagged Cx43 have shown that it has a high dynamic nature with a relatively short lifetime of 1-3 h. After assembly into hexamer HCs in the Golgi network, Cx43 HCs are then transported into the cell membrane, where they laterally or directly join the previously formed GJs. The size of these plaques is balanced by internalization of the whole plaque (annular junction) or small vesicles containing the oldest proteins to be degraded by lysosomes and/or proteosomes. After internalization, deubiquitylation of Cx43 may rescue it from degradation, and therefore it recycles back into the plasma membrane [Sosinsky et al., 2007; Nielsen et al., 2012; Solan and Lampe, 2014; Ribeiro-Rodrigues et al., 2017].  Cx43 expression and function are regulated through different mechanisms. For instance, Cx43 phosphorylation, by a variety of kinases such as AKT, PKC, and ERK1/2, regulates its trafficking, assembly, plaque size, channel-gating properties, and turnover. It is important to note that at least 19 phosphorylation sites have been identified on Cx43. Loss of the Cx43 CT domain that contains several phosphorylation sites, due to the specific mutations in Cx43 encoding gene, results in an autosomal dominant human disease, oculodentodigital dysplasia (ODDD), which affects the development of a variety of tissues and organs and manifests several characteristics such as craniofacial abnormalities, enamel loss, and delayed wound healing [Vreeburg et al., 2007; Churko et al., 2011; Solan and Lampe, 2014].  Cx43 interactions with intracellular proteins such as microtubules, ZO-1 and ZO-2 also play a key role in regulating its function. It has been shown that the interaction of ZO-1 with 10  Cx43 CT domain negatively regulates GJ size by preventing Cx43 transition into GJ plaques [Hunter et al., 2005; Solan and Lampe, 2014]. In addition, transcriptional factors like Specificity protein-1 (SP1), Activator protein-1 (AP1) and, several wound healing-related factors including cytokines and growth factors such as IL-1, TNF-, TGF- and hypoxia have been shown to modulate Cx43 expression in a cell- or tissue-specific manner [Nielsen et al., 2012; Solan and Lampe, 2014; Stains et al., 2014; Willebrords et al., 2016; Zhang and Cui, 2017].  1.3.1.2 Hemichannel Functions When present as HCs, Cx43 participates in regulating various physiological and pathological functions through auto- and paracrine signaling. Administration of Gap26 or Gap27, two mimetic peptides that bind to the E1 and E2 domains of Cx43, respectively, resulted in closure of the ischemia-induced open HCs, by yet undetermined mechanisms, before or after occurrence of cardiac ischemia in vivo and significantly reduced the infarct size as compared to untreated hearts in a rat model [Chaytor et al., 1997; Hawat et al., 2010 and 2012]. Several studies have specifically shown that Cx43 HCs also modulate the inflammatory response by regulating ATP release, an important mediator of inflammation. Blocking of Cx43 HC function by JM2, a mimetic peptide that binds to the microtubule-binding region of Cx43 CT domain and reduces Cx43 GJs size and GJ/HC activity, significantly reduced Cx43 HC-mediated ATP release in cultured human endothelial cells and was associated with reduced inflammatory infiltrate surrounding the silicone implants in a rat model [Calder et al., 2015; Rhett et al., 2017]. Furthermore, using synthetic TAT-L2 peptide, which binds to the L2 region of Cx43 CL and interferes with the interaction between the CT tail and the CL, also inhibited ATP release through Cx43 HCs in bovine corneal endothelial cells [Ponsaerts et al., 2010; Iyyathurai et al., 11  2013]. Modulation of ATP release through Cx43 HCs is significant, as increased inflammation delays wound healing and promotes fibrosis and scar formation [Qian et al., 2016].     In addition, Gap19 that binds to the L2 domain of Cx43 CL, selectively blocked Cx43 HCs without affecting its GJ function, and inhibited HC-mediated unitary currents and ATP release. Its application in ischemia-induced mice, in vivo, also reduced the infarct size after myocardial ischemia. Interestingly, Gap19 only blocked Cx43 HCs and had no effect on other Cx HCs [Iyyathurai et al., 2013; Wang et al., 2013; Abudara et al., 2014], which further highlights its specificity in regulating Cx43 HC functions.  Treatment with low concentrations of Peptied5, a mimetic peptide that binds to the Cx43 extracellular loop domains, also resulted in closure of Cx43 HCs and prevented secondary tissue damage after cerebral or spinal cord injuries by suppressing inflammatory cytokines in a rat model [O’Carroll et al., 2008 and 2013]. Furthermore, the selective blockage of Cx43 HCs only, but not GJ, by Cx43(E2) antibody against the E2 region, significantly prevented secretion of prostaglandin E2, a critical mediator of bone formation, in chick osteocytes [Siller-Jackson et al., 2008].  1.3.1.3 Gap Junction Functions When present as GJs, Cx43 also contributes to important biological events in various tissue types to maintain the homeostasis of the healthy organism. In the heart, Cx43 is the major Cx present in ventricle myocardium, contributing to the synchronized current passage between myocardium cells by GJ intercellular communication (GJIC). Nervous system astrocytes extensively express Cx43 and communicate with each other and with adjacent oligodendrocytes through Cx43 GJIC [Verheule et al., 1997; Orthmann-Murphy et al., 2007; Nielsen et al., 2012]. Furthermore, Cx43 remains to also be the most abundantly expressed Cx in bone tissue, and 12  controls bone function and development by transferring the calcium waves, signaling molecules, and small metabolites by GJIC between cells [Civitelli et al., 1993; Donahue et al., 1995; Jaing et al., 2007; Bing et al., 2016; Willebrords et al., 2016]. Interestingly, blocking Cx43 GJIC using Cx43-specific antisense oligodeoxynucleotides (AS-ODN) delayed osteoblasts differentiation and was associated with downregulation of ECM mineralization-related genes [Lecanda et al., 1998]. The blockage of GJIC between the neighbouring cells may offer tissue protection during pathological conditions. For instance, Cx43 coupling and its GJIC is significantly reduced after inflammatory cytokine treatments or human immunodeficiency virus infection in various human and animal studies [Duffy et al., 2000; Haghikia et al., 2008; Losso et al., 2010; Nielsen et al., 2012; Orellana et al., 2013; Willebrords et al., 2016; Ribeiro-Rodrigues et al., 2017].  1.3.1.4 Intercellular Communications Through Tunnelling Nanotubes and Extracellular Vesicles Interestingly, recent studies have shown that Cx43 can also mediate intercellular communication via other mechanisms rather than its conventional GJ- and HC-related functions, namely through tunnelling nanotubes (TNTs) and extracellular vesicles (EVs) between very closely related cells. TNTs are thin and long (up to 100 m) actin-rich tubular structures that are involved in the transfer of diverse materials, including miRNAs, prion proteins, and viruses, between connected cells. TNTs have been observed in several cell types including fibroblasts and epithelial cells. It is suggested that the presence of Cx43 is required for TNT-mediated coupling, and inhibition of Cx43 GJIC results in the blockage of TNT-mediated calcium and electrical signaling between neurons and astrocytes [Baker, 2017; Ribeiro-Rodrigues et al., 2017].  13  Cx43 also assembles into functional channels at the surface of EVs and docks with Cx43 HCs on target cells and therefore, may accelerate the transfer of the EVs content to its destination.  EVs are formed through the fusion of multivesicular bodies with the cell surface (50-200 nm in diameter), or by direct outward budding of the plasma membrane (100-1000 nm) and are secreted by several cell types including retinal epithelial cells, endothelial cells, and cardiac cell lines [Wang et al., 2012; Soares et al., 2015; Lock et al., 2016; Ribeiro-Rodrigues et al., 2017]. The role of Cx43 in TNT- or EV-mediated cellular communications, particularly in fibroblasts, remains to be studied.  1.3.1.5 Channel-independent Functions  Furthermore, Cx43 can also affect cellular behavior through its channel-independent functions. Cx43 directly interacts with intracellular signaling molecules via its cytoplasmic domains and regulates cell adhesion, migration, apoptosis, and gene expression independent from its channel-related functions. For instance, Cx43 promotes TGF-β signaling, an important modulator of wound healing, tissue fibrosis, and scar formation, as a result of competing with Smad2/3 for binding to β-tubulin. In asthmatic fibroblasts, derived from bronchoscopic biopsy specimens of patients with asthma, significant TGF-β-induced Cx43 upregulation was associated with enhanced myofibroblastic differentiation through Samd2 activation, independent from Cx43 GJIC. In addition, Cx43 positively regulates α-SMA expression, a myofibroblast and cell contractility-related molecule, through activation of the TGF-β signaling pathway by competing with SMAD2/3 proteins for binding to β-tubulin and thus forcing release of SMAD2/3, which is needed for its activation and downstream signaling [Jiang and Gu, 2005; Dai et al., 2007; Asazuma-Nakamura et al., 2009; Vinken et al., 2012; Zhou and Jiang, 2014; De Bock et al., 2015; Willbrords et al., 2016; Paw et al., 2017; Ribeiro-Rodrigues et al., 2017].  14  Thus, collectively, Cx43 vitally contributes to several cellular events by its channel- or non-channel-dependent functions during physiological and pathological processes.   1.4 Role of Connexin 43 in Skin Healing  Previous studies have shown expression of nine Cxs in the epidermis, with Cx43 the most predominant Cx in vivo and in cultured human keratinocytes and fibroblasts [Fitzgerald et al., 1994; Brandner et al., 2004; Wright et al., 2009 and 2012; Solan and Lampe, 2014].  In skin, Cx43 plays key regulatory roles during wound healing. In non-healing diabetic human and rat skin wounds, Cx43 is significantly upregulated at mRNA and protein levels in the epidermis and dermis as compared to the non-diabetic wounds. Although, the regulation of Cx43 in fibroblasts, in particular, remained unclear [Wang et al., 2007; Becker et al., 2012; Mendoza-Naranj et al., 2012]. Interestingly, application of ACT1, a Cx43 mimetic peptide that binds to the CT domain and blocks its function, to human non-healing diabetic foot ulcers in a multicenter randomized clinical study showed significantly greater wound closure when compared to control wounds [Grek et al., 2015].  Findings from Cx43+/- mice have shown the earlier onset of keratinocyte migration and accelerated wound closure, increased dermal fibroblasts proliferation rate, and upregulated expression levels of ECM remodeling mediators [Kretz et al., 2003 and 2004; Cogliati et al., 2015]. In addition, downregulation of Cx43 expression and/or function by transient treatment of murine skin wounds with ACT1, and Cx43 AS-ODN or siRNA at the early stage of wound healing resulted in faster wound closure via increased keratinocyte and fibroblasts migration and proliferation, and promoted connective tissue healing by reducing inflammation and stimulating collagen deposition, angiogenesis, and earlier recruitment of myofibroblast and wound contraction [Goliger and Paul, 1995; Coutinho et al., 2003; Qiu et al., 2003; Gourdie et al., 2006; 15  Mori et al., 2006; Rhett et al., 2008; Ghatnekar et al., 2009; Grek et al., 2014; Lorraine et al., 2015; Gilmartin et al., 2016; Wong et al., 2016].  Cx43 has a key assignment in regulating scar-related molecules and therefore contributes to scar formation and fibrosis in skin. Studies from a pig wound healing model have shown that blocking Cx43 function using its mimetic peptide ACT1, promotes dermal histoarchitecture and mechanical strength of skin and reduces scar formation by regulating inflammation [Ghatnekar et al., 2009; Ongstad et al., 2013; Zhang and Cui, 2017]. Application of ACT1 peptide into submuscularly-implanted silicone disks in rats also significantly reduced collagen deposition, hallmark of scars, and downregulated inflammatory infiltrate, long-linked with scar formation [Soder et al., 2009; Zhang and Cui, 2017]. Of note, the pig skin wound healing model closely resembles human dermal healing, while skin wound healing in rodents may differ somewhat from humans owing to their loose skin and differential inflammatory response to wounding [Larjava et al., 2011; Ongstad et al., 2013].  Interestingly, in a recent multicentre randomized clinical study, immediate or early application of ACT1 gel to the human laparoscopic incisional wounds significantly improved scar pigmentation, thickness, and surface roughness as compared to untreated wounds [Grek et al., 2017]. Yet, the exact mechanisms by which Cx43 modulates scar formation remains to be investigated. Importantly, several cell types present at wound site are possibly regulated by these treatments. Therefore, there is a need for further studies to investigate the role of Cx43 in regulation of scar formation in a cell-specific manner in more detail.  1.5 Role of Connexin 43 in Gingival Healing  The expression and localization of several Cxs has previously been shown in oral buccal (cheek) mucosal wounds in mice. In the intact non-keratinized buccal mucosal epithelium, 16  distinct from keratinized gingival epithelium, the expression of Cx43 was significantly higher when compared to epidermis in the same animals. During wound healing, Cx43 expression was similarly downregulated in migrating keratinocytes in buccal mucosa and in skin [Davis et al., 2013]. The expression of Cx43 has also been previously shown in normal human gingival epithelium [Ye et al., 2000; Hatakeyama et al., 2006; Fujita et al., 2008].  Despite emerging evidence about the role of Cxs in skin wound healing, nothing is known about Cx43 expression and function in gingival fibroblasts and during gingival wound healing.  1.6 Hypotheses and Objectives  Wound healing in human oral mucosal attached gingiva is faster and results in significantly reduced scar formation as compared to similar skin wounds [Wong et al., 2009; Glim et al., 2013]. Given that Cx43 plays a key role in accelerated wound healing in skin, it is possible that it may also contribute to fast gingival healing, and therefore may partly determine the privileged healing outcome in gingiva.  However, nothing is known about Cx43 expression and function during gingival wound healing. Also, no information is available about the expression of Cx43 in skin fibroblasts (SFBLs) in unwounded tissue and during wound healing in vivo. Therefore, in this study we will examine the expression and function of Cx43 during human gingival healing, particularly in fibroblasts, due to their significant role in modulating wound healing and scar formation. We will also compare the expression, abundance and distribution of Cx43 between human gingival fibroblasts (GFBLs) and SFBLs in vivo and in vitro. The possible differential Cx43 functionality in GFBLs and SFBLs will be studied by analyzing Cx43-mediated gene expression regulation in these cells.  The specific hypotheses and objectives of this study were:  17  1.6.1  Hypothesis 1 Cx43 function is downregulated during human gingival wound healing, which in fibroblasts promotes expression of genes conducive for fast and scarless wound healing. 1.6.2 Specific Aim 1  To characterize in detail the localization and function of Cx43, a key connexin associated with skin wound healing, in the fast and scarless human gingival wound healing: Initially, the expression of Cxs in cultured human GFBLs was analyzed using quantitative real-time RT-PCR (qPCR), immunoblotting and immunostaining. The spatiotemporal localization of Cx43 was assessed in human gingival wounds by immunostaining. To study Cx43 function, we blocked its function in cultured GFBLs by mimetic peptides, siRNA, or chemically, and the activation of key wound healing- associated signaling pathways and expression of a set of genes was analyzed. 1.6.3 Hypothesis 2 Cx43 HCs and GJs distinctly regulate the expression of wound healing-associated genes in GFBLs.  1.6.4 Specific Aim 2  To characterize Cx43 HCs and GJs in human GFBLs, and determine their roles in regulating fibroblast gene expression relevant for wound healing: The expression and localization of Cx43 HCs and GJs were examined in human gingiva by immunostaining, and in cultured human GFBLs by qPCR, Western blotting, and immunostaining. To study Cx43 function, we used blocking peptides selectively targeting Cx43 GJs or HCs, and the expression of a set of wound healing-associated genes and activation of signaling pathways was analyzed. 18  1.6.5 Hypothesis 3 SFBLs and GFBLs display distinct expression or function of Cx43 and that this may partly underlie the different wound healing outcomes in skin and gingiva. 1.6.6 Specific Aim 3  To characterize Cx43 HCs and GJs in human GFBLs and SFBLs in vivo, and to compare the function of Cx43 HCs and GJs in GFBLs and SFBLs by using a well-established three-dimensional (3D) cell culture model: The expression and localization of Cx43 HCs and GJs was examined in human gingiva and skin by immunostaining, and in 3D-cultured human GFBLs and SFBLs by qPCR, Western blotting, and immunostaining.  To study Cx43 function, we used blocking peptides selectively targeting Cx43 GJs or HCs, and the expression of a set of wound healing-associated was analyzed.  19  1.7 Figures  Figure 1-1: Schematic summary of Connexin structure, and Connexin 43 function and peptide binding sites.  (A) Each Connexin (Cx) is composed of four transmembrane-spanning domains (M1-M4), two extracellular loops (E1 and E2), a N-terminal domain, a C-terminal domain and the cytoplasmic loop (CL).  (B) Cx43 assembles into hemichannels (HCs) and gap junctions (GJs) on the cell membrane and participates in transferring small signaling molecules between the cytoplasm and extracellular space and between connecting cells, respectively. (C) Cx43 mimetic peptides binding sites. Gap26 and Gap27 bind to the E1 and E2 domains of Cx43, respectively, and block its HC and GJ functions. Gap19 binds to Cx43 CL domain and specifically blocks its HC functions.   20  Chapter 2: Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts1 2.1 Introduction  Connexins (Cxs) are a family of transmembrane proteins that assemble to form connexons (hemichannels) or gap junctions (GJs). Each connexin protein is composed of four transmembrane-spanning domains, two extracellular loops, and the cytoplasmic domains including N-terminus, C-terminal domain and the cytoplasmic loop. Assembly of six connexin subunits generates one connexon or hemichannel, which functions in auto- and paracrine signaling by providing a pathway for transfer of signaling molecules, including ATP, NAD+, Ca2+ and glutamate, between cells and extracellular environment. Two connexons from neighboring cells can also dock to form GJs, which provide conduits for direct exchange of small (<1 kDa) signaling molecules between communicating cells [Goodenough and Paul, 2003; Wright et al., 2009; Wang et al., 2013]. In addition to the channel functions, connexins participate in intracellular signaling cascades, and regulate gene expression and cell migration [Jiang et al., 2005; Wright et al., 2009; Nielsen et al., 2012; Zhou and Jiang, 2014].  Connexins are expressed virtually by all cells in the body, and play crucial role during development and normal tissue functions, and contribute to development of various pathologies [Nielsen et al., 2012; Zhou and Jiang, 2014]. In addition, they may play a role in skin wound healing [Churko and Laird, 2013; Ehrlich, 2013; Ongstad et al., 2013]. In skin, the expression and localization of connexins have been best described in epithelium of normal tissue and in                                                  1 A version of this chapter has been published. Tarzemany R, Jiang G, Larjava H, Häkkinen L. Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts. PLoS One. 10, e0115524 (2015).  21  epithelium of experimental wounds in various murine and human models. For instance, in normal skin in mice, epithelial cells at various layers, and cultured human skin keratinocytes, express several connexins, including Cx26, Cx30, Cx30.3, Cx31, Cx31.1, Cx37, Cx40, and Cx43 [Goliger and Paul, 1995; Coutinho et al., 2003; Kretz et al., 2003 and 2004; Wright et al., 2009]. Likewise, based on immunostaining, human epidermis contains at least Cx26, Cx30, and Cx43 [Brandner et al., 2004]. Interestingly, wound healing induces rapid but transient changes in epithelial cell connexins. For instance, in mouse skin, Cx26, Cx30, Cx31, Cx31.1, and Cx43 are strongly downregulated in the migrating wound epithelium, while Cx26 and Cx30 are upregulated at the wound margins [Goliger and Paul, 1995; Coutinho et al., 2003; Kretz et al., 2003 and 2004]. Until re-epithelialization is complete, the expression of connexins is further spatiotemporally regulated at different epithelial layers [Coutinho et al., 2003]. Similar findings have also been reported for Cx26, Cx30, and Cx43 in human skin wound epithelium [Brandner et al., 2004; Richards et al., 2004]. During the early stages of murine skin wound healing, decreased expression of Cx26 and Cx43 in hair follicles at the wound site, and upregulation of Cx43 in blood vessels close to wound area has also been reported [Coutinho et al., 2003], but very little is known about the expression of connexins in wound fibroblasts.  In general, fibroblasts in normal skin express connexins, and appear connected to each other by GJs [Salomon et al., 1988; Ko et al., 2000; Moyer, 2002; Langevin et al., 2004]. The major GJ protein in cultured murine skin fibroblasts is Cx43 [Becker et al., 2012]. Similarly, cultured human skin fibroblasts express Cx43 as their major connexin, but they also express lower levels of Cx40 and Cx45 [Wright et al., 2009; Churko et al., 2011]. Electron microscopy analysis has suggested that wound myofibroblast-like cells are connected to each other by GJs [Gabbiani et al., 1978], but the identity of the connexins involved and their spatiotemporal 22  regulation during wound healing is unclear.  Based on the above studies, Cx43 appears a key connexin expressed by skin cells, and it is strongly downregulated in the wound epithelium at the early stages of wound healing. To study its role in more detail, different strategies to further suppress its function or expression in experimental murine skin wounds have been used. For instance, transient blocking of Cx43 function at the early stage of wound healing by ACT1, a peptide that binds to the cytoplasmic carboxy-tail of Cx43 [Hunter et al., 2005], or transient suppressing its expression by topical Cx43-specific antisense oligodeoxynucleotides (AS-ODN), promotes re-epithelialization and wound closure via increased keratinocyte migration and proliferation [Goliger and Paul, 1995; Coutinho et al., 2003]. Studies from conditional Cx43 knockout mice have also shown an earlier onset of keratinocyte migration and increased proliferation, resulting in faster skin wound closure as compared to control mice [Kretz et al., 2003 and 2004]. In addition to the epithelial effects, transient treatment of murine skin wounds with ACT1, Cx43 AS-ODN or siRNA suppresses inflammation, and promotes certain aspects of connective tissue healing. For instance, connective tissue cell proliferation, angiogenesis, collagen deposition, and earlier myofibroblast recruitment and wound contraction are stimulated, resulting to reduced wound connective tissue size at the early remodeling stage as compared to control wounds [Goliger and Paul, 1995; Coutinho et al., 2003; Kretz et al., 2003 and 2004; Qiu et al., 2003; Gourdie et al., 2006; Mori et al., 2006; Wang et al., 2007; Nakano et al., 2008; Rhett et al., 2008; Ghatnekar et al., 2009]. Thus, downregulation of Cx43 appears to accelerate wound granulation tissue formation and remodeling. Interestingly, transient downregulation of Cx43 expression by AS-ODN or modulation of its function by ACT1 at the very early stage of wound healing also improves the clinical appearance of the wounds and increases wound breaking strength in long term in mouse 23  and pig models [Coutinho et al., 2005; Ghatnekar et al., 2009]. However, it is unclear whether the above effects of early and transient Cx43 inhibition in wounds are secondary to the reduced inflammation and/or due to the altered Cx43 function in fibroblasts. In any case, downregulation of Cx43 by AS-ODN, or blocking of its function by ACT1, or by Gap26 and Gap27, two Cx43 mimetic peptides that block its hemichannel and GJ functions [Wang et al., 2013], promotes fibroblast, and also keratinocyte, proliferation and migration in vitro [Krets et al., 2003; Qui et al., 2003; Mori et al., 2006; Kandyba et al., 2008; Wright et al., 2009; Becker et al., 2012; Wright et al., 2012]. Thus, connexin inhibition may also have direct wound healing promoting effects on these cells, but the mechanisms remain largely undefined.   Interestingly, wound healing in human and pig oral mucosal attached gingiva is faster and results in significantly reduced scar formation as compared to similar skin wounds [Mak et al., 2009; Wong et al., 2009; Glim et al., 2013; Häkkinen et al., 2015]. Therefore, gingival wound healing provides a model to study molecular and cellular pathways that regulate fast and scarless wound healing. Given that connexins play a role in wound healing, it is possible that they have a key role determining the wound healing outcome also in human gingiva. Previously, connexins have been localized in oral mucosal wounds in a mouse buccal (cheek) mucosal wound model. In the unwounded buccal mucosal epithelium, a non-keratinized epithelium distinct from keratinized gingival epithelium, keratinocytes expressed Cx26, Cx40, and Cx43, and their levels were significantly elevated as compared to epidermis in the same animals [Davis et al., 2013]. Similar to skin wounds, these connexins were downregulated in migrating keratinocytes in the mucosal wounds [Davis et al., 2013]. Connexin expression has also been studied in normal human gingival epithelium, where keratinocytes express Cx26 and Cx43 [Ye et al., 2000; Hatakeyama et al., 2006; Fujita et al., 2008]. However, nothing is known about connexin 24  expression and function in gingival connective tissue cells and during gingival wound healing. Therefore, the aim of the present study was to characterize in detail the localization and function of Cx43, a key connexin associated with skin wound healing, in the fast and scarless human gingival wound healing. We hypothesized that Cx43 function is downregulated during human gingival wound healing, which in fibroblasts promotes expression of genes conducive for fast and scarless wound healing. 2.2 Materials and Methods 2.2.1 Tissue Samples  Tissue sections from experimental wounds created in palatal attached gingival mucosa in three healthy males (mean age 38 years) that have been previously extensively characterized were used [Häkkinen et al., 2000; Ghersi et al., 2002; Honardoust et al., 2006 and 2008; Eslami et al., 2009; Wong et al., 2009]. Briefly, identical, standardized, full-thickness excisional wounds (about 12 mm long, 2 mm wide and at least 10 mm away from each other) were prepared under local anesthesia in the palatal mucosa in an area between the canine and the third molar using a double-bladed scalpel. The tissue obtained from the initial wounds served as the control samples (day 0 sample). After the surgery, subjects were instructed to use standard dosages of acetaminophen or ibuprofen for postoperative pain control. Wound biopsies were collected at days 3, 7, 14, 28, and 60 after wounding. In order to record the original location of the wounds, they were photographed, and each wound was biopsied only one time. Immediately after collection, the samples were embedded in Optimal Cutting Temperature Compound (Sakura Finetek Inc., Torrance, CA, USA) and frozen in liquid nitrogen. Tissue sections (6 μm) were cut using a 2800 Frigocut Cryostat Microtome (Leica, Nussloch, Germany), placed on 3-aminopropyltriethoxysilane-coated slides and stored at -86°C until use. For the study, minimum 25  of three tissue/mid-wound sections from two to three subjects at each time point were used.  2.2.2 Cell Culture  Four primary gingival fibroblast lines (GFBLs) were isolated from clinically healthy attached gingiva from healthy human donors, as previously described [Häkkinen et al., 1994] (Table 2-1). Cells were routinely maintained in Dulbecco’s Modified Eagle’s medium (DMEM), supplemented with 1% antibiotic/antimycotic and 10% fetal bovine serum (FBS) (Gibco Life Technologies, Inc., Grand Island, NY, USA) at 37oC and 5% CO2. Cells were routinely seeded for experiments when they reached about 95% confluence. Experiments were performed at passages 5 to 10.  2.2.3 Ethics Statement  Gingival tissue donors provided a written informed consent, and procedures were reviewed and approved by the Office of Research Ethics of the University of British Columbia, and complies with the ethical rules for human experimentation that are stated in the 1975 Declaration of Helsinki. 2.2.4 Blocking of Cx43 Function by Mimetic Peptides or MFA  To block the Cx43 function, GFBLs were seeded on 6-well plates (42,000 cells/cm2) in their normal growth medium. At day 2 when cultures became confluent, culture medium was replaced with serum-free medium. At day 3, cells were treated with 150 μM of Gap27 (SRPTEKTIFII; Biomatik, Cambridge, ON, Canada) [Chaytor et al., 1997; Hawat et al., 2012; Wang et al., 2013], equal molar amount of Gap26 (VCYDKSFPISHVR) [Chaytor et al., 1997; Hawat et al., 2010 and 2012; Wang et al., 2013], or corresponding scrambled Gap27 (TFEPDRISITK) [Wright et al., 2012] or Gap26 (YSIVCKPHVFDRS) [Hawat et al., 2010] 26  control peptides, respectively, for up to 24 h before total RNA isolation or collection of cell lysates/conditioned medium for Western blotting. In a set of experiments, cells were treated with increasing concentrations (25, 50, 75, 100 μM) of meclofenamic acid (MFA; M4531, Sigma-Aldrich, St. Louis, MO, USA), a pharmacological connexin inhibitor [Harks et al., 2001], or corresponding amount of MFA diluent (dH2O) for 24 h before RNA isolation.  2.2.5 Blocking Cx43 Expression by siRNA Technique  To block the expression of Cx43, GFBLs were seeded in 6-well plates as described above. After 24 h, siRNA transfection was carried out using Lipofectamine RNAiMax reagent (Invitrogen, Carlsbad, CA, USA). To this end, 22 µl of Lipofectamine RNAiMax and 150 picomoles of Cx43 siRNAs (siRNA-1; UUUUGCAAGUGUAAACAGC or siRNA-2; AAUGAAAAGUACUGACAGC; Invitrogen) or control siRNAs (control siRNA-1 ACUUCGACACAUCGACUGC or control siRNA-2 ATCGCAAATCCGGACCTAT; Invitrogen) were mixed with 2.4 ml of Opti-MEM medium (Invitrogen), and incubated at room temperature for 5 min. The mixtures of transfection reagent and individual siRNAs were combined and incubated at room temperature for 20 min for complex formation. Then the reagent was diluted with Opti-MEM to yield final siRNA concentration of 30 nM, and added to the cells. After 5 h in cell culture incubator, the transfection reagent was removed, and cells fed with their normal growth medium overnight. Medium was then replaced with serum-free growth medium, and RNA isolation and sample collection for Western blotting was performed after 48 h.  2.2.6 Real-Time PCR  Real-time PCR analysis was performed according to MIQE guidelines [Bustin et al., 2009] 27  as we have described in detail previously [Mah et al., 2014]. Briefly, total RNA from cultured GFBLs was isolated using NucleoSpin RNA II kit according to the manufacturer's protocol (Macherey-Nagel). Total RNA (1 μg) was reverse transcribed using iScript Select cDNA Synthesis Kit (Bio-Rad, Mississauga, ON, Canada) and random oligodeoxynucleotide primers according to the manufacturer’s instructions, as described previously. The primers used for real-time PCR are listed in Table 2-2. Real-time PCR amplification was performed on the CFX96 System (Bio-Rad) using the following program: 1 cycle at 94o C for 3 min 35 cycles at 94oC for 10 s, 60oC for 20 s, and reaction completion with reading plate and a melt curve analysis from 65oC to 95oC, 5 s for each 0.5oC. Amplification reactions were conducted for target genes with ubiquitin C (UBC), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase I (Hprt1), TATAA-box binding protein (TBP), and Beta-2-microglobulin (B2M) as reference genes. For a given experiment, at least two reference genes were chosen [Liu et al., 2015]. Non-transcribed RNA samples were used as a negative control. The PCR reactions were performed in triplicate for each sample. The data was analyzed and is presented based on the comparative Ct method (CFX Manager Software Version 2.1, Bio-Rad).  2.2.7 Preparation of Cell Lysates/Conditioned Medium Samples for Western Blotting  Confluent GFBL cultures were treated as described above. The conditioned medium was then collected and immediately treated with Complete Protease Inhibitor Cocktail (Roche Diagnostics, Manheim, Germany). The samples were concentrated (30-40 times) by centrifugation (5,000g) using Centrifugal Filter Units (Amicon Ultra-4 3K, 3000 MWCO; Millipore, Bedford, MA, USA) for 3 h, and stored at −80oC until use. To collect cell lysates, cells were washed with ice-cold phosphate-buffered saline (PBS), and lysed with a buffer containing 25 mM Tris-HCL (pH 7.6), 100 mM Octyl β-D-glucopyranoside, 5 mM NaF, 1 mM 28  Na3VO4,  (Sigma-Aldrich, St. Louis, MO, USA), and the Complete Protease Inhibitor Cocktail (Roche Diagnostics), dissolved in H2O. Lysates were collected using a rubber policeman, and filtered through a NucleoSpin Filter (Macherey-Nagel) by centrifugation at 5,000g for 10 min.  2.2.8 Western Blotting  Immunoblotting analysis was conducted as described in detail previously [Mah et al., 2014]. Briefly, total protein concentration in call lysates/conditioned medium samples was determined using the Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad). Equal amount of protein of each sample was solubilized in SDS sample buffer containing 2-mercaptoethanol (5%) and separated by 10-12% SDS-polyacrylamide gel electrophoresis. The proteins were transferred onto a nitrocellulose membrane (Hybond-ECL membrane, GE Healthcare Bioscience, Buckinghamshire, UK). The nonspecific binding sites were blocked by incubating the membranes in Odyssey Blocking Buffer (LI-COR Biosciences; Lincoln, NE, USA) at room temperature for 1 h, followed by incubation with the primary antibody (Table 2-3) at 4oC overnight. After washing with TBS containing 0.1% Tween-20 (TBS-T), the membranes were incubated with an appropriate IRdye-conjugated secondary antibody (1:10,000; LI-COR Biosciences). Dried membranes were then detected using the LI-COR Odyssey infrared reader (LI-COR Bioscience, Nebraska, USA). Intensity of the protein bands was quantitated using ImageJ software (NIH).   The activation of signaling pathways by Gap27 treatment was studied in cell lysates obtained as described above. For the experiments, GFBLs were seeded on 6-well plates, treated with Gap27 (150 μM) or equal amount of control peptide for 1, 2, 6, and 24 h, and cell lysates collected, as above. Western blotting was performed with antibodies against total or phosphorylated forms of β-Catenin and GSK3α/β (β-Catenin pathway), SMAD3 (TGF-β 29  pathway), ERK1/2 and p38 (MAPK pathway) (Table 2-3). β-Tubulin was used as a loading control.    To identify latent and active MMPs, a set of cell/conditioned medium samples was treated with or without p-aminophenylmercury acetate (APMA; 1.0 mM, pH=7.4; Sigma-Aldrich) at 37oC for 4 h to activate latent enzymes [Nagase et al., 1991] prior to gel electrophoresis and Western blotting (data not shown).  2.2.9 Use of Chemical Inhibitors to Block Signaling Pathways  To determine the role of key signaling pathways in Gap27-induced gene expression, we blocked TGF-β pathway with SB431542 (20 μM; Selleckchem, Houston, TX, USA), MEK1/2 with PD184352 (10 μM; Sigma-Aldrich), p38 with SB203580 (10 μM; Cell Signaling, Danvers, MA, USA), GSK3α/β with SB415286 (30 μM; Biomol, Hamburg, Germany), AP1 with curcumin (30 μM; Sigma-Aldrich), and SP1 with WP631 (5 nM; Sigma-Aldrich) in Gap27-treated cells, respectively. To this end, confluent GFBL cultures were pre-incubated with inhibitors at 37 oC for 1 h, and then treated with Gap27 (150 μM) with or without the inhibitors in serum-free growth medium for 24 h. All inhibitors were dissolved in DMSO, and control samples were treated with respective amounts of DMSO only. Total RNA was collected for real-time PCR as described above.  2.2.10 Dye Transfer Experiments   To assess the GJ function of Cx43, dye transfer assays were performed. To this end, GFBL cultures were generated on gelatin-coated glass coverslips in 24-well plates as described previously [King and Parsons, 2011]. Briefly, the coverslips were incubated in 0.2% gelatin in PBS at 37oC for 1 h. After rinsing with PBS, coverslips were incubated in 1% glutaraldehyde at room temperature for 30 min, then washed with PBS, followed by incubation with DMEM at 30  37oC for 30 min. Coverslips were then washed with PBS and stored at 4oC or used immediately. To assess dye transfer through GJs by scrape loading, cells (GFBL-DC) were seeded on the coverslips in their normal growth medium as described above for 24 h, and then serum-starved in DMEM for another 24 h. Confluent cultures were then pre-incubated with Gap27 or the control peptide (150 μM; 24 h), or with MFA (50 μM; 1 h) or vehicle control (dH2O; 1 h) in DMEM at 37oC, media was removed, and a scrape wound was created through the cell layer with a 10 μL pipette tip, and cells incubated as above with 0.5% Lucifer Yellow (Molecular Probes Inc., Eugene, OR, USA) in PBS+ (containing 1 mM Ca2+ and Mg2+) for 5 min at 37oC. Cells were rinsed once with PBS+ and then fixed with 4% formaldehyde at room temperature for 20 min. Nuclei were then stained with 300 nM DAPI (Molecular Probes Inc.) in PBS for 5 min. In a set of experiments, cells were transfected with Cx43 siRNA-1, siRNA-2 or control siRNA (30 nM) as above before seeding on the coverslips for 24 h, serum-starved for 24 h, and then subjected to the dye transfer experiment as above. Samples were mounted with Immu-Mount solution (Thermo Scientific, Pittsburgh, PA, USA), examined using the ECLIPSE 80i Microscope (Nikon, Tokyo, Japan), and images captured using NIS-Elements BR software (Version 4.20, Nikon). 2.2.11 Scratch Wound Cell Migration Assay   To assess role of Cx43 in cell migration, GFBLs were grown on gelatin-coated glass coverslips, serum-starved, and pretreated with Gap27 or control peptides (150 μM) for 24 h as above. A wound was then created through the cell layer using a 100 μL pipette tip. Cells were then cultured in DMEM with the peptides in a cell culture incubator, and wound closure recorded over time by standardized digital images taken from the samples using a phase contrast microscope (Nikon Eclipse, TS100) and a digital camera (Nikon Coolpix 995). In a set of 31  experiments, cells were transfected with Cx43 siRNA-1 or -2 and control siRNA-1 or -2 (30 nM) separately as above, seeded on gelatin-coated glass coverslips for 24 h, and serum-starved for 6 h before wounding. Experiments were performed in triplicate per treatment group, and images were captured from three to four different areas of the wound on each coverslip. Wound closure rate was determined measuring the area of the open wound at each time point relative to the area of the wound at the time of wounding using the Adobe Photoshop for Mac software (https://www.adobe.com). 2.2.12 Immunostaining   For immunostaining, confluent GFBLs were seeded on gelatin-coated glass coverslips in their normal growth medium (24 h) and then serum starved (24 h) as described above, fixed with 4% formaldehyde at room temperature for 20 min, and then permeabilized using 0.5% Triton X-100 in PBS for 4 min. All samples were then blocked with PBS+ containing BSA (10 mg/ml) and glycine (1 mg/ml) at room temperature for 30 min, followed by an incubation with the primary antibody (Table 2-3) diluted in PBS containing BSA (1 mg/ml) in a humidified chamber at 4oC overnight. The samples were then washed with PBS containing BSA (1 mg/ml) and 0.01% Triton X-100, and incubated with an appropriate Alexa-conjugated secondary antibody (1:200 dilution; Alexa 488/594; Molecular Probes Inc.) at room temperature for 1 h. Nuclei were then stained with DAPI and samples mounted as above.   For immunostaining of human gingival tissue samples, sections were fixed with cold acetone (-20oC) at room temperature for 5 min. Samples were then washed, blocked, and incubated separately with each primary antibody (Table 2-3) overnight, followed by washing, incubation with appropriate Alexa 488 and 594-conjugated secondary antibodies, nuclear staining with DAPI and mounting as above. Images were acquired using optical sectioning at 1 32  μm (ECLIPSE 80i Microscope; Nikon), and are presented as z-stacks created by the NIS-Elements BR software (Nikon). Control stainings were performed by omitting the primary antibody incubation step. 2.2.13 Statistical Analysis  All data is presented as mean ± standard error of the mean (SEM) from repeated experiments. Statistical analysis was performed by using Student’s t-test, p<0.05 was considered statistically significant. Values obtained from the real-time PCR by the comparative Ct-method were Log2 transformed for statistical testing [Rieu and Powers, 2009]. 2.3 Results 2.3.1 Cx43 Is the Major Connexin Expressed by Gingival Fibroblasts   Previous studies have shown that Cx43 is present in human skin, periodontal ligament and gingival fibroblasts, but that skin and periodontal ligament fibroblasts also express Cx32, Cx40 and Cx45 [Ko et al., 2000; Yamaoka et al., 2002; Churko and Laird, 2013]. Therefore, we assessed the expression of Cx32, Cx40, Cx43 and Cx45 in four parallel human gingival fibroblast (GFBL) lines from different donors in confluent monolayer cultures that allowed abundant cell-cell contacts to form. Real-time PCR (Figure 2-1 A) and Western blotting (Figure 2-1 B) analysis showed that GFBLs expressed Cx43 as their major connexin protein, with moderate levels of Cx45, very low levels of Cx32, and no expression of Cx40. Immunolocalization of Cx43 and Cx45 showed a punctate staining, likely representing connexin plaques. Some of these connexin plaques localized to long cellular processes contacting nearby cells likely representing GJs (Figure 2-1 C). In addition, they localized to areas with no apparent cell-cell contacts, possibly representing intracellular and/or cell surface non-junctional hemichannel plaques (Figure 2-1 C). In general, the number of Cx43- compared to Cx45-postive 33  plaques was markedly higher (Figure 2-1 C), reflecting the real-time PCR and Western blotting analysis.  2.3.2 Cx43 Is Strongly Downregulated in Gingival Epithelium and Fibroblasts During Wound Healing   In order to assess expression of Cx43 during gingival wound healing, we compared localization of Cx43 in unwounded human gingiva, and in experimental excisional gingival wounds 3, 7, 14, 28 and 60 days after wounding by immunostaining (Figure 2-2 and Figure 2-3). Fibroblasts were identified based on their elongated, spindle-shaped morphology, and positive immunostaining for vimentin, a mesenchymal cell marker highly expressed in fibroblasts [Hematti, 2012]. Cx43 was present in unwounded gingival epithelium where it showed strong, punctate staining in the cell-cell contacts at the spinous layer. In addition, a weaker and sparse staining was noted between some basal and granular layer cells (Figure 2-3). A punctate, positive staining for Cx43, likely representing Cx43 plaques [Hunter et al., 2005], was also noted throughout connective tissue (Figure 2-2 A and B), where it associated with vimentin-positive fibroblast-like cells. Many of the Cx43-positive plaques were fairly large in size (>1 μm in diameter), and some localized to long processes extending from these cells (Figure 2-2 B). At day 3 after wounding, abundance of Cx43 was strongly reduced in the migrating wound epithelium (Figure 2-3), and in the fibroblasts residing at the wound edge and migrating into the wound (Figure 2-2 C and D and Figure 2-3). At day 7 when wound epithelium had completely covered the wound, and granulation tissue formation was underway, Cx43 was abundantly present in 2-3 most basal cell layers of the wound epithelium, while the spinous layer showed some weak positive staining (Figure 2-3). In general, in the connective tissue cells at the wound edge (Figure 2-2 E and Figure 2-3), and in the wound granulation tissue (Figure 2-2 F and Figure 34  2-3), only very few Cx43-positive plaques were noted. At day 14, Cx43 was still most abundant in 2-3 most basal wound epithelial cell layers, but its staining was now increased also in more suprabasal cells (Figure 2-3). Our previous analysis of these same wounds has shown that at this stage, the granulation tissue had started contraction, contained abundantly α-SMA-positive fibroblasts, and was being remodeled to wound connective tissue [Honardoust et al., 2006 and 2008; Wong et al., 2009]. At this stage, vimentin-stained fibroblast-like cells at the wound edge showed some Cx43-positive plaques (Figure 2-3). In general, the highly cellular wound connective tissue showed only very few such structures in vimentin-positive cells (Figure 2-2 G and H), or in M2 macrophages (Figure 2-4), also abundantly present in these same wounds at this stage [Häkkinen et al., 2015], or in α-SMA-positive myofibroblasts (Figure 2-5). At day 28, while the typical gingival epithelial long rete pegs were not yet formed, abundance and localization of Cx43 in the epithelium at the wound site was almost similar to normal unwounded tissue, being weakly present in the basal cells, and most strongly stained in the spinous layer (Figure 2-3). At this stage, wound contraction was still underway, but cellularity and the number of myofibroblasts and M2 macrophages had dramatically decreased [Honardoust et al., 2006 and 2008; Wong et al., 2009; Häkkinen et al., 2015]. Vimentin-stained fibroblast-like cells at the wound edge and within the newly formed wound connective tissue displayed increased number of Cx43-positive plaques as compared with earlier time points, but the number and size of the plaques was clearly reduced as compared to unwounded tissue (Figure 2-2 I and J and Figure 2-3). Few M2 macrophages that were still present in the wounds showed very little Cx43 positive staining (Figure 2-4). At day 60 when the epithelium had reformed long rete pegs and connective tissue structure was normalized, the localization and abundance of Cx43 was similar to unwounded tissue both at the epithelium and connective tissue at the wound site 35  (Figure 2-2 K and L and Figure 2-3). 2.3.3 Blocking of Cx43 Function Significantly Regulates the Expression of a Distinct Set of Wound Healing-Associated Genes in Gingival Fibroblasts  Having established that Cx43 is the major connexin expressed by GFBLs, and that abundance of Cx43 plaques is strongly reduced during gingival wound healing, we wanted to find out the functional significance of this downregulation. Downregulation of the number of Cx43-positive plaques in wound fibroblasts can result in reduced hemichannel and GJ function. Treatment of cells with Cx43 mimetic peptides can be used to specifically block these channel functions [Evans et al., 2012], which promotes connective tissue wound healing in vivo [Ongstad et al., 2013]. Therefore, we treated GFBLs with Gap27, a mimetic peptide that binds to the 11-amino acid sequence in the second Cx43 extracellular loop and blocks Cx43 channel functions [Desplantez et al., 2012; Evans et al., 2012]. Treatment with Gap27 (150 μM) did not markedly affect cell morphology (Figure 2-6). However, it reduced GJ- mediated dye transfer, similar to meclofenamic acid (MFA), a pharmacological connexin inhibitor [Harks et al., 2001], also in this model as expected (Figure 2-7). Gap27 treatment also significantly promoted GFBL migration in the scratch wound healing model (Figure 2-8), as previously described for skin fibroblasts [Wright et al., 2009]. Thus, reduced Cx43 abundance/function may promote fibroblast recruitment at the early stages of human gingival wound healing. In addition to being absent from migrating fibroblasts in early wounds, Cx43 abundance was also strongly suppressed in fibroblasts abundantly present inside gingival granulation and wound connective tissue at day 7-28 post-wounding. This coincides with resolution of inflammation, angiogenesis, ECM deposition, myofibroblast differentiation, contraction and remodeling stages of wound healing [Häkkinen et al., 2015]. Therefore, we next assessed the effect of suppressing Cx43 function by 36  Gap27 in confluent cell cultures on expression of genes important specifically for these stages of wound healing. Real-time PCR results showed that Gap27 treatment significantly upregulated expression of 15, and downregulated 7, of the 54 genes analyzed (Tables 2-4 to 2-7). The selected genes encoded proteases (MMPs and their inhibitors), important in regulation of inflammation, angiogenesis and ECM remodeling [Steffensen et al., 2001; Dufour and Overall, 2013], molecules involved in intracellular ECM degradation (Endo180 and Cathepsin K) (Table 2-4), ECM proteins (fibrillar and matricellular proteins, and small leucine-rich proteoglycans), cell contractility and myofibroblast-associated proteins (Table 2-5), TGF-β signaling associated molecules and cytokines involved in inflammation, angiogenesis and re-epithelialization (CXCL12, FGF-2, VEGF-A, IL1β, IL10 and TNF-α) [Häkkinen et al., 2015] (Table 2-6), and cell-cell junction proteins (connexins and cadherins) [Degen and Gourdie, 2012] (Table 2-7). To rule out significant but potentially biologically irrelevant minor changes, we used minimum of +/- 1.5-fold change threshold for the significantly regulated genes. This yielded 17 significantly regulated genes of which 11 were upregulated (MMP-1, -3, -10 and -14, TIMP-1 and -3, Tenascin-C, TGF-β1, VEGF-A, Cx43 and Cadherin-2), and 6 downregulated (Collagen type I, Decorin, Fibromodulin, α-SMA, NMMIIB and CXCL12) (Tables 2-4 to 2-7). The responses were concentration-dependent at least up to 300 μM peptide concentration (data not shown).  In order to find out, whether the Gap27-mediated regulation of gene expression is a common property of GFBLs, we assessed its effect on expression on a set of the above genes in three parallel GFBL lines in the same experiment (Figure 2-9). The findings confirmed a gene expression response to Gap27 treatment in all GFBL lines that was consistent with initial findings using GFBL-DC (Tables 2-4 to 2-7).  To confirm specificity of the Gap27 treatment, we also blocked Cx43 function by Gap26, 37  another connexin mimetic peptide corresponding to a 13 amino acid sequence in the first Cx43 extracellular loop [Desplantez et al., 2012; Evans et al., 2012], and by MFA, and assessed expression of a set of genes as above. Gap27 and Gap26 treatments caused in general similar gene expression changes in GFBLs, although the magnitude of change slightly varied (Figure 2-10). MFA treatment induced a concentration-dependent increase in MMP-1 and -10, Tenascin-C and VEGF-A expression, and downregulated CXCL12 (Figure 2-11), similar to Gap27 (Tables 2-4 to 2-6) and Gap26 treatment (Figure 2-10). Interestingly, Gap27 (Table 2-7), Gap26 (Figure 2-10) and MFA (Figure 2-11) induced up to about 2-fold increase in expression of Cx43 mRNA. Likewise, Gap27 and Gap26 caused about 2-fold increase in Cx43 protein level, while MFA had no effect (data not shown).   In a set of experiments, we also suppressed Cx43 expression in three parallel GFBL lines using two different Cx43 siRNAs (Cx43 siRNA-1 and -2), and studied the expression of the above wound healing-associated genes. Treatment of GFBLs with both Cx43 siRNAs consistently resulted in about 80% downregulation of Cx43 at both mRNA and protein levels, while expression of the two other connexins expressed by these cells, Cx32 and Cx45, were not affected (Figure 2-12 A). Cx43 siRNA treatment with both Cx43 siRNA-1 and -2 effectively suppressed GJ-mediated dye transfer (Figure 2-12 B), but did not have a significant effect on fibroblast migration in the scrape-wound assay (Figure 2-8). Similar to Gap27 treated cells, Cx43 siRNA treatments significantly increased expression of Tenascin-C (1.46 +/- 0.15-fold change; p<0.05) and reduced expression of Collagen type I (0.89 +/- 0.03-fold change; p<0.001) as compared to control treatment. However, possibly due to incomplete Cx43 downregulation, the gene expression responses to Cx43 siRNA treatment were small with none of the studied genes reaching the +/- 1.5-fold change threshold (data not shown).  38  2.3.4 Characterization of Proteins Regulated by Gap27 Treatment in Gingival Fibroblasts   As gene expression analysis showed that blocking of Cx43 function by Gap27 strongly regulated expression of several genes (Tables 2-4 to 2-7), we further assessed the protein levels of a set of genes that showed significant, minimum of +/- 1.5-fold change relative to control treatment in the real-time PCR analysis. Western blotting analysis showed that treatment of GFBLs with Gap27 (Figure 2-13) resulted in markedly increased secretion of active and/or total MMP-1 (Figure 2-13 A and B) and -10 (Figure 2-13 H and J) compared to control treatments. In addition, Gap27-treated cells produced significantly elevated levels of pro-MMP-3 in the cell layer (Figure 2-13 F and G). The expression of mRNA for Decorin (Table 2-5), a small leucine-rich proteoglycan that regulates cell functions involved in wound healing and fibrosis, and VEGF-A (Table 2-6), a potent pro-angiogenic growth factor [Häkkinen et al., 2015], were also strongly suppressed and upregulated, respectively, by Gap27 treatment. Accordingly, Western blotting showed robust downregulation of Decorin and upregulation of VEGF-A levels in the cell culture medium of Gap27-treated GFBL cultures (Figure 2-14). Gap27 treatment also significantly increased Cx43 expression at mRNA (Table 2-7) and total protein levels (Figure 2-15). However, no changes in the relative intensities of the three bands corresponding to the differently phosphorylated forms of Cx43 recognized by the Cx43 antibody (P0: pS368; P1:pS279/282 and pS255; P2: pS262) [Sosinsky et al., 2007; Solan and Lampe, 2009] were noted in the Western blots (Figure 2-15 A). 2.3.5 Blocking of Cx43 Function by Gap27 Modulates Key Signaling Pathways in Gingival Fibroblasts  Having established that during gingival wound healing, Cx43 abundance and/or GJ and 39  hemichannel functions maybe strongly reduced, and that suppressing Cx43 function in cultured fibroblasts distinctly regulates expression of a set of wound healing-associated genes, we wanted to find out which intracellular signaling pathways are involved. To this end, we treated GFBLs with Gap27 and assessed phosphorylation changes in TGF-β (SMAD3), MAPK (ERK1/2 and p38), GSK3α/β and β-Catenin pathways that have been previously associated with Cx43-mediated signaling [Garcia-Dorado et al., 2002; Dai et al., 2007; Ishikawa et al., 2012; Vinken et al., 2012; Hebert and Stains, 2013; Solan and Lampe, 2014; Stains et al., 2014; Zhou and Jiang, 2014], and wound healing and fibrosis [Cheon et al., 2006; Profyris et al., 2012; Wong et al., 2012; Akita et al., 2013; Principi et al., 2013] (Figure 2-16). Gap27 induced robust phosphorylation of p38 and ERK1/2 already after 1 h after treatment. These responses lasted at least for 6 h, before returning to the levels of untreated cells by 24 h (Figure 2-16 C-F). Gap27 treatment also markedly increased GSK3α/β phosphorylation at 1-6 h, returning to the normal level by 24 h (Figure 2-16 G and H), while phosphorylated and non-phosphorylated β-Catenin levels, downstream targets of GSK3α/β, did not show marked changes (Figure 2-16 I and J). Gap27 treatment did not noticeably affect SMAD3 phosphorylation until 24 h, when the steady-state p-SMAD3 levels were markedly increased (Figure 2-16 A and B). Thus, in gingival fibroblasts, blocking of Cx43 by Gap27 treatment induced fast activation of MAPK and GSK3α/β signaling pathways, while TGF-β pathway was activated via a slower, possibly indirect, mechanism.  2.3.6 Distinct Involvement of Gap27-Regulated Signaling Pathways in Modulation of Wound Healing-Associated Genes in Gingival Fibroblasts  In order to further assess the role of the above pathways in Gap27-induced gene expression changes, we blocked TGF-β signaling by SB431542, MEK1/2 by PD184352, p38 by SB203580, 40  and GSK3α/β by SB415286 in Gap27-treated cells, and assessed gene expression changes relative to untreated cells by real-time PCR. In addition, we assessed involvement of AP1 and SP1, transcription factors previously linked to Cx43 signaling [Sullivan et al., 1993; Niger et al., 2011; Stains et al., 2014], by treating cells with curcumin and WP631, respectively. We specifically focused on assessing expression of the genes that were significantly modulated (with a minimum by +/- 1.5-fold change threshold) by Gap27 in the above experiments. Results showed that MEK1/2 signaling was most widely involved in Gap27-induced change in gene expression, as its inhibition totally blocked Gap27-induced expression change of 10 genes. These genes included proteases and their inhibitors (MMP-1, -3 and -10, TIMP-1 and -3), ECM molecules (Collagen type I and Tenascin-C), cell contractility-associated genes (α-SMA and NMMIIB), and Cadherin-2 (Table 2-8 and Figure 2-17). In addition, this pathway partially regulated (inhibited Gap27-induced expression change by at least 50%) expression of growth factors (TGF-β1 and VEGF-A) and Cx43. The only genes that were not affected by blocking of MEK1/2 were MMP-14, two leucine-rich proteoglycans (Decorin and Fibromodulin), and CXCL12. The other examined pathways also totally or partially regulated Gap27-modulated expression of several genes. For instance, inhibition of GSK3α/β resulted to total inhibition of Gap27-induced upregulation of TIMP-1 and -3 expression, while it partially blocked MMP-1 and TGF-β1 upregulation. Findings also showed variable and complex interplay between the studied pathways in regulation of Gap27-induced gene expression. For instance, Gap27-induced MMP-10 upregulation and Collagen type I downregulation was only blocked by the MEK1/2 inhibitor. In contrast, Gap27-induced TIMP-1 expression was totally blocked by SP1, TGF-β, MEK1/2 and GSK3α/β inhibitors, and partially by p38 inhibitor. On the other hand, Gap27-induced Tenascin-C expression was totally inhibited by AP1 and MEK1/2 inhibitors, and partially by SP1, TGF-β 41  and p38 inhibitors. Transcription factors AP1 or SP1 were distinctly involved in regulating 7 of the Gap27-modulated genes. Interestingly, inhibition of SP1 totally blocked Gap27 induced upregulation of Cx43 expression, while blocking of AP1, p38 and MEK1/2 had a partial effect. Gap27-induced upregulation of VEGF-A and downregulation of CXCL12 were only partially blocked by MEK1/2 and SP1 inhibitors, respectively, suggesting that also other unidentified pathways are involved. In addition to the above effects, interestingly, blocking of GSK3α/β strongly potentiated Gap27-induced upregulation of MMP-3 (Figure 2-17) and Tenascin-C expression (Figure 2-17). Moreover, Gap27 treatment with simultaneous inhibition of MEK1/2 resulted to strongly induced α-SMA expression (by more than 7-fold), while treatment with Gap27 alone reduced its expression by about 50% (Figure 2-17). 2.4 Discussion   Gingival fibroblasts that participate in scarless oral wound healing expressed Cx43 as the major connexin, which is similar to skin fibroblasts [Wright et al., 2009; Churko et al., 2011]. In oral wounds, Cx43 expression was strongly downregulated in gingival wound epithelium during epithelial migration stage. This is in agreement with studies assessing Cx43 localization in the epithelium of murine skin and buccal mucosal, and in human skin wounds [Goliger and Paul, 1995; Coutinho et al., 2003; Kretz et al., 2003 and 2004; Brandner et al., 2004; Richards et al., 2004; Davis et al., 2013]. Thus far, very little was known about Cx43 expression and localization in connective tissue cells during wound healing. Interestingly, in gingival fibroblasts, which were identified based on morphological criteria and positive immunostaining for the mesenchymal cell marker vimentin [Hematti, 2012], strong Cx43 immunoreactivity localized to large plaque-like structures in unwounded tissue. In order to form functional GJs, connexins cluster on the cell membrane to form plaques. Cell culture findings suggest that connexins are first transported to 42  the cell membrane as hemichannels where they then join GJ plaques directly or by moving laterally towards them [Lauf et al., 2002; Nielsen et al., 2012]. The size of the plaques can reach few micrometers [Lauf et al., 2002], and can be therefore detected by immunostaining. In contrast, individual connexins or hemichannels are undetectable by this method [Goodenough and Paul, 2009; Nielsen et al., 2012]. Atomic force microscopy of cardiac GJs has also suggested existence of large (up to 2 μm2) hemichannel plaques [Lal et al., 1995]. Connexins can also be present intracellularly during synthesis and transport to the cell membrane, and when being endocytosed or assembled to the mitochondrial membrane. However, these intracellular connexins have not been reported to organize into large plaque-like structures [Nielsen et al., 2012]. Thus, the Cx43-positive structures observed in gingival fibroblasts in vivo likely represent Cx43 hemichannel and/or GJ plaques on the cell membrane.  Interestingly, the Cx43-positive plaques found in fibroblasts in unwounded tissue were missing from fibroblasts at the wound edge and those migrating into the wound at days 3 and 7 post-wounding. This could be explained by reduced recruitment of Cx43 to hemichannel and GJ plaques, or their redistribution, resulting to smaller plaques undetectable by immunostaining, or from downregulation of Cx43 expression and/or its increased turnover. The factors that modulate these processes during wound healing in vivo are not clear, but are likely cell type-specific and could include effects of wound healing-related cytokines, growth factors and mechanosignaling [Nielsen et al., 2012; Schalper et al., 2012]. In any case, similar to cultured skin fibroblasts [Wright et al., 2009], blocking of Cx43 function by Gap27 promoted gingival fibroblast migration, suggesting that Cx43 may regulate fibroblast recruitment into the wound provisional matrix. Interestingly, Cx43 was also still largely absent from the vimentin-positive cell population established in the wound at day 14 and 28 post-wounding. These cells could include 43  fibroblasts, myofibroblasts and macrophages that all express vimentin [Mor-Vaknin et al., 2003; Fournier et al., 2013]. Reparative M2 macrophages are abundant and the predominant macrophages in these same gingival wounds at day 14 and 28 post-wounding [Häkkinen et al., 2015]. However, our double immunostaining showed that very few Cx43 plaques were detected in M2 macrophages at this stage. Previous studies have not explored Cx43 in wound macrophages. However, contrary to our findings, M2 macrophages in thyroid tumor stroma show abundant Cx43-positive plaques [Caillou et al., 2011]. Our previous analysis has also shown that the number of α-SMA-rich myofibroblasts is strongly increased, and wound contraction is underway, already at day 14 in these same wounds [Honardoust et al., 2006 and 2008; Wong et al., 2009]. However, only few Cx43-positive plaques were noted in areas where myofibroblasts were abundant at this stage. Therefore, it is possible that in human gingival wounds absence of Cx43 plaques promotes myofibroblast differentiation and wound contraction. In support of this, suppressing Cx43 expression or function in murine models of wound healing results to earlier recruitment and disappearance of myofibroblasts from the wounds, and reduced wound connective tissue size [Becker et al., 2012], suggesting that in these wounds myofibroblast differentiation and contraction occurred earlier and/or was accelerated. Curiously though, in cultured rat cardiac fibroblasts, Cx43 positively regulates α-SMA expression [Asazuma-Nakamura et al., 2009], and in mouse fibroblasts, Cx43 deficiency associates with a reduced ability of the cells to contract a collagen gel, a model for wound contraction [Ehrlich et al., 2000]. In addition, our findings showed that blocking of Cx43 function by Gap27 significantly reduced expression of α-SMA and non-muscle myosin IIB (NMMIIB), another cytoskeletal protein involved in tissue contraction [Komatsu et al., 2010]. Thus, role of Cx43 function in α-SMA expression, myofibroblast differentiation and contraction appears cell- and context-44  dependent, and requires further investigation. Nevertheless, it is possible that the early reduction of Cx43 plaques, and their slow reformation in gingival fibroblasts at the late stages of wound healing has functional significance for the scarless gingival wound-healing outcome. In particular, reduced abundance of Cx43 plaques at days 14 and 28 post-wounding in wound fibroblasts coincides not only with myofibroblast differentiation and contraction, but also with resolution of inflammation, angiogenesis, ECM deposition and remodeling stages of wound healing [Ghersi et al., 2002; Honardoust et al., 2006 and 2008; Eslami et al., 2009; Häkkinen et al., 2015], suggesting a role for Cx43 in modulating also these events.  To study the significance of reduced Cx43 function for these later stages of wound healing, we blocked its function in human gingival fibroblasts by Cx43 mimetic peptide Gap27 [Wang et al., 2013]. Our findings showed that Gap27 reduced GJ-mediated dye transfer as expected, confirming its inhibitory effect also in human gingival fibroblasts. Furthermore, Gap27 treatment significantly regulated a number of genes that may be beneficial for scarless gingival wound healing. These effects were not limited to Gap27, as similar results were also obtained by using Gap26, another Cx43 mimetic peptide [Wang et al., 2013]. It is interesting that the mimetic peptides significantly upregulated several genes. This suggests that for those genes that were upregulated by the treatment, normal Cx43 function is inhibitory, i.e. it is needed to suppress expression of these genes. Therefore, during gingival wound healing reduced expression/function of Cx43 in fibroblasts may allow increased expression of these molecules. This group of molecules includes several MMPs, TIMP-1 and -3, Tenascin-C, TGF-β1 and VEGF-A, which are important modulators of inflammation, cell migration, angiogenesis and ECM deposition [Häkkinen et al., 2012], and may contribute to reduced inflammation and efficient angiogenesis found in gingival wounds [Glim et al., 2013; Häkkinen et al., 2015]. Of note, Tenascin-C 45  accumulation is strongly induced in early granulation tissue of human gingival wounds [Häkkinen et al., 2000; Wong et al., 2009], suggesting that downregulation of Cx43 expression or function may drive this process in vivo. The hallmark of scar formation and fibrosis is increased accumulation of ECM and increased cell contractility [Penn et al., 2012]. Therefore, it is also interesting to note that blocking of Cx43 function in gingival fibroblasts caused a robust downregulation of several ECM (Collagen type I, Decorin and Fibromodulin) and cell contractility-associated genes (α-SMA and NMMIIB). Interestingly similar to our findings, comparable treatment of human skin fibroblasts with Gap27 was also recently shown to significantly increase expression of MMP-1 mRNA [Wright et al., 2012], while unlike in gingival fibroblasts, Collagen type I and CTGF, two genes strongly associated with scar formation and fibrosis in vivo [Penn et al., 2012], were significantly upregulated [Wright et al., 2012]. There is increasing evidence that human skin and gingival fibroblasts are phenotypically distinct [Glim et al., 2013; Häkkinen et al., 2014 and 2015; Mah et al., 2014]. Therefore, it is possible that different function of Cx43 in skin and gingival fibroblasts may in part contribute to the different wound healing outcomes in these two tissues, but this needs further experimental verification.  The mechanisms of the mimetic peptide-induced gene expression change in gingival fibroblasts may include blocking of transfer of signaling molecules via hemichannels and/or GJs, peptide-induced changes in Cx43 levels, conformation and/or phosphorylation of its cytoplasmic tail that interacts with the signaling molecules [Herve et al., 2012; Wang et al., 2013; Solan and Lampe, 2014; Zhou and Jiang, 2014]. The latter channel-independent effects maybe mediated via Cx43 cytoplasmic tail that recruits and interacts with intracellular signaling effectors, including MAPK (ERK1/2 and p38), GSK3/β-Catenin and PI3K-Akt-GSK3 pathway mediators [Garcia-46  Dorado et al., 2002; Ishikawa et al., 2012; Vinken et al., 2012; Hebert and Stains, 2013; Solan and Lampe, 2014; Stains et al., 2014; Zhou and Jiang, 2014] also involved in wound healing and scar formation [Profyris et al., 2012; Wong et al., 2012]. In addition, Cx43 competes with SMAD2/3 for binding to tubulin releasing SMAD2/3 from the microtubules and promoting TGF-β signaling [Dai et al., 2007]. Our findings showed that MFA, a pharmacological connexin channel inhibitor [Harks et al., 2001], also blocked GJ-mediated dye transfer in gingival fibroblasts, and induced similar changes in the expression of a set of genes as the Cx43 mimetic peptides, suggesting that the noted Gap27-induced gene expression changes depended on the channel functions of Cx43. However, Gap27 also caused a robust activation of the above Cx43 cytoplasmic tail-mediated signaling pathways. Thus, regulation of both channel-dependent and -independent functions may be involved in Gap27-regulated gene expression in gingival fibroblasts.   In order to study the role of the above signaling pathways in regulation of Gap27-induced fibroblast gene expression in more detail, we used pathway-specific pharmacological inhibitors. In addition, we blocked two transcriptional regulators (AP1 and SP1) that associate with Cx43 signaling [Sullivan et al., 1993; Niger et al., 2011; Stains et al., 2014]. Blocking of these pathways distinctly, and co-operatively regulated Gap27-modulated gene expression, and most notably, as Gap27 caused a robust early activation (phosphorylation) of ERK1/2 and p38 MAPKs, pharmacological blocking of these pathways totally or partially blocked Gap27-modulated expression of 14 out of the 17 genes analyzed. Inhibition of MEK1/2 alone, an upstream regulator of ERK1/2 [Seger and Krebs, 1995], totally blocked Gap27-induced change of 10 genes. These included MMP-10 and Collagen type I that were not affected by the other pathways studied. Thus, MEK-ERK1/2 pathway is a major target of Gap27-induced signaling in 47  gingival fibroblasts. Whether this depends on the reported ability of MAPKs to regulate Cx43 channel functions and phosphorylation of the cytoplasmic tail [Solan and Lampe, 2014] remains to be shown.  As mentioned above, Cx43 can also promote TGF-β-induced signaling [Dai et al., 2007]. Interestingly, Gap27 treatment did not affect phosphorylation of SMAD3 during the first 6 h after treatment. However, an increased level of p-SMAD3 was noted after 24 h. Therefore, Gap27 induces activation of TGF-β pathway in gingival fibroblasts, but this may occur via a distinct, indirect mechanism. The inhibitory effect of Gap27 is time-dependent, as it blocks hemichannels within minutes to few hours, while GJ inhibition may require up to 24 hours to occur [Wang et al., 2013]. Thus, the late activation of SMAD3 after Gap27 treatment may also depend on its distinct effects on GJs rather than hemichannels. In any case, pharmacological inhibition of TGF-β signaling totally or partially suppressed Gap27-induced change in expression of nine of the studied genes, indicating that this Cx43-mediated pathway has a role in modulating cell functions relevant to wound healing.   Treatment of gingival fibroblasts with Gap27 also induced fast phosphorylation of GSK3α/β, but this did not associate with marked changes in the phosphorylation or levels of its downstream target β-Catenin. Phosphorylation of GSK3α/β renders it inactive removing its inhibitory effect on its targets, which include more than 40 proteins and transcription factors [McCubrey et al., 2014]. Therefore, Cx43-mediated phosphorylation of GSK3α/β likely affects other downstream targets than the β-Catenin pathway. The involvement of this pathway is supported by the finding that pharmacological blocking of phosphorylation of GSK3α/β totally blocked TIMP-1 and -3, and partially MMP-1 and TGF-β1 upregulation induced by Gap27 treatment. Furthermore, blocking of GSK3α/β potentiated Gap27-induced expression of MMP-3 48  and Tenascin-C. Thus, in gingival fibroblasts GSK3α/β controls Cx43 regulated expression of molecules involved in proteolytic processing of the wound ECM, cytokines and growth factors (MMP-1, TIMP-1 and -3), and ECM deposition (TGF-β1) [Steffensen et al., 2001; Dufour and Overall, 2013; Häkkinen et al., 2015].   Interestingly, Gap27 treatment also significantly increased expression of Cx43 at both mRNA and total protein levels, although it did not affect relative proportions of the differently phosphorylated forms of the protein in the Western blots. Increased Cx43 mRNA expression was also noted after MFA treatment. These findings are different from previous observations where treatment of human skin fibroblasts with Gap27 in a scratch wound model did not upregulate Cx43 levels, but promoted its phosphorylation at S368 [Pollok et al., 2011]. It is possible that Gap27 treatment of confluent cell layers (as in the present study) or in the scratch wounding protocol [Pollok et al., 2011] may result in a different cell response to the peptide. Another possibility is that the responses depend on the previously described distinct phenotype of human gingival and skin fibroblasts [Häkkinen et al., 2014; Mah et al., 2014]. In any case, in the present study, the dye transfer assays, which showed reduced GJ-mediated dye transfer by Gap27 treatment, were performed after 24 h pre-incubation with Gap27 to allow Gap27-induced Cx43 upregulation to occur. Thus, despite of the elevated levels of Cx43 in gingival fibroblasts, Gap27 was still able to block Cx43 GJ channel functions as expected. Therefore, whether Gap27-induced gene expression changes in cultured human gingival fibroblasts depend on Gap27-induced upregulation of Cx43 expression and/or reduced GJ function, and how this relates to reduced Cx43 immunostaining and potential function in gingival wounds, remains to be shown.   In order to assess the mechanisms of Gap27-induced Cx43 upregulation in gingival fibroblasts we used pharmacological inhibitors to key signaling pathways that associate with 49  Cx43. Previous findings have indicated that transcriptional modulator AP1 regulates Cx43 expression by various signals [Nielsen et al., 2012]. Accordingly, its inhibition also partially suppressed Gap27-induced Cx43 expression. In addition, Gap27-induced Cx43 expression was partially regulated by MEK1/2 and p38 inhibitors, two upstream modulators of AP1 [Gopalakhrisnan et al., 2006; Salameh et al., 2008]. Interestingly, though, Gap27-induced Cx43 induction was totally blocked by the SP1 inhibitor, suggesting that this transcription factor is another important regulator of Gap27-induced Cx43 expression in gingival fibroblasts. A recent molecular study has also linked SP1 to regulation of Cx43 expression [Negoro et al., 2013]. SP1 also modulates Cx43-induced expression of a set of genes in various cells [Stains et al., 2014]. Accordingly, blocking of SP1 totally or partially inhibited Gap27-induced expression of 7 genes in the present study.    To summarize, our findings demonstrate that Cx43 shows similar spatiotemporal regulation in gingival wound epithelium over time as previously describe for skin. In addition, we showed for the first time that the abundance of Cx43-positive plaques is strongly reduced in fibroblasts at the early stages of human gingival wound healing, returning to the level of normal tissue by day 60 post-wounding. Thus, wounding-induced suppression of Cx43 in wound fibroblasts leads to disruption of the connexin-mediated intercellular communication network in the connective tissue, resulting in a gene expression change that may be important for the fast and scarless wound healing outcome in gingiva. Interestingly, blocking of Cx43 function by mimetic peptides strongly regulated expression of a number of wound healing- and scar formation-associated genes in human gingival fibroblasts. These changes involved p38, MEK1/2-ERK1/2, TGF-β-SMAD3 and GSK3α/β mediated signaling pathways, and AP1 and SP1 transcription factors. Among these pathways, ERK1/2-MEK1/2 appeared to be a key 50  regulator of Cx43 mimetic peptide-modulated gene expression. Thus, Cx43 mimetic peptides may provide an efficient tool to modulate fibroblast gene expression during wound healing. The exact mechanisms by which the Cx43 mimetic peptides cause these effects, and the mechanisms and importance of Cx43 downregulation for fast and scarless wound healing outcome in human gingiva in vivo warrant further investigation.   51  2.5 Tables Table 2-1: List of the human gingival fibroblast lines used for the study.        Cell line name Origin Sex Age (years) GFBL-DC Attached gingiva Male 41  GFBL-OL Attached gingiva Male 30  GFBL-HN Attached gingiva Female 18  GFBL-DW Attached gingiva Female 30  52  Table 2-2: Primers used for real-time PCR. GeneBank Gene Primer sequence Orientation Location Amplicon (bp) MMPs and TIMPs NM_002421 MMP-1 GCTAACAAATACTGGAGGTATGATG Forward 1250-1275 100   GTCATGTGCTATCATTTTGGGA Reverse 1304-1325     NM_001127891 MMP-2   AGACATACATCTTTGCTGGAG Forward 1900-1920 88   ATCTGCGATGAGCTTGG Reverse 1988-1972     NM_001166308 MMP-3   ATGATGAACAATGGACAAAGGA Forward 661-682 91   GAGTGAAAGAGACCCAGGGA Reverse 751-732  NM_214207 MMP-7   TATGCTGCAACTCATGAAC Forward 722-740 82   CGTAGGTTGGATACATCAC Reverse 804-785       NM_004994  MMP-9 CACTACTGTGCCTTTGAGTCC    Forward 1531-1551 62 CGATGGCGTCGAAGATGTT Reverse 1592-1574               NM_002425 MMP-10   TTATACACCAGATTTGCCAAGA Forward 394-415 56   TTCAGAGCTTTCTCAATGG Reverse 450-432    53  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_005940 MMP-11   CTATCCTCCAAAGCCATTGTAA Forward 2258-2179 106   CAACTGTGTTTAATGACAATCCTC Reverse 2254-2231 NM_002426 MMP-12   GTATGATGAAAGGAGACAGATGAT Forward 1303-1326  166   TACGTTGGAGTAGGAAGTCAT Reverse 1469-1449 NM_002427  MMP-13   CAGGAATTGGTGATAAAGTAGAT Forward 1302-1324 85   CTGTATTCAAACTGTATGGGTC  Reverse 1365-1386  NM_004995  MMP-14 TCTCCCAGAGGGTCATTCAT Forward 618-1637                       70 TTCCAGTATTTGTTCCCCTTGTAG Reverse 1688-1665   NM_002429 MMP-19 CCTGTCACAATATGGGTACCTAC Forward 232-254                                  72 CTCGGTGATATCTTCTGGCTT Reverse 304-284         NM_003254 TIMP-1   CTGTGTCCCACCCCACC Forward 267-283 64   GAACTTGGCCCTGATGACGA Reverse 330-311      NM_003255  TIMP-2 ACATTTATGGCAACCCTATCAA  Forward 481-502 70 54  GeneBank Gene Primer sequence Orientation Location Amplicon (bp)   TCAGGCCCTTTGAACATCTTTA Reverse 550-529      NM_000362 TIMP-3   AGGACGCCTTCTGCAAC Forward 1281-1297 68   CTCCTTTACCAGCTTCTTCC Reverse 1348-1329 NM_003256 TIMP-4   ACCTGTCCTTGGTGCAGA  Forward 927-944 80   TGTAGCAGGTGGTGATTTGG Reverse 1004-985 Molecules involved in intracellular ECM degradation NM_000396 CTSK  (Cathepsin K) TCGACTATCGAAAGAAAGGATA  Forward 585-606  70 AAAGCCCAACAGGAACCA  Reverse 655-637     AF134838 Endo180  (CD280) AAGAGGCCCAGCTGGTCA Forward 3144-3161 100 GCATGGAGGCCAATCCAAAG  Reverse 3243-3224 Fibrillar ECM proteins BC036531 Collagen type I (alpha 1) AACCAAGGCTGCAACCTGGA          Forward 3951-3970 80   GGCTGAGTAGGGTACACGCAGG    Reverse 4030-4009 55  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_000090 Collagen type III (alpha 1) CTCCTGGGATTAATGGTAGT  Forward 1271-1290 70   CCAGGAGCTCCAGGAAT Reverse 1340-1324 NM_212482  EDA-FN (Extra Domain A-Fibronectin)  CACAGTCAGTGTGGTTGCCT Forward 5633-5652 68 CTGTGGACTGGGTTCCAATCA     Reverse 5700-5680      NM_212482  EDB-FN (Extra Domain B-Fibronectin) CAGTAGTTGCGGCAGGAGAA  Forward 4168-4188 65 GTATCCTACTGAGGAGTCCACAAAATC Reverse 4232-4206      Matricellular proteins NM_002160 TN-C  (Tenascin-C)   CAACCTGATGGGGAGATATGGGGA Forward 6769-6792 75 GAGTGTTCGTGGCCCTTCCAG Reverse 6846-6826      NM_001901 CTGF (CCN2)   ATGATGTTCATCAAGACCTGTGCCTG Forward 199-183 80 CTTCCTGTAGTACAGGGATTCAAAGAT Reverse 199-184 56  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) GTC Small Leucine-Rich Proteoglycans NM_001711 BGN  (Biglycan) CTCAAGCTCCTCCAGGTGGTC Forward 1067-1087 93   CCGAAGCCCATGGGACAGAAGTC  Reverse 1151-1127      BT019800 DCN  (Decorin) CTGACACAACTCTGCTAGAC   Forward 242-261 97   GACAAGAATCAATGCGTGAAG Reverse 339-319   NM_002023 FMOD (Fibromodulin) CACAATGAGATCCAGGAAG Forward 761-779 85   TCCGAAGGTGGTTATAACTC  Reverse 845-826        BT006707  LUM  (Lumican) TAGACAACAATAAGATCAGCAACA Forward 635-658 85 TTCGTTGTGAGATAAACGCAG Reverse 720-700         Contractility and myofibroblast associated proteins NM_001613  α –SMA (α-Smooth Muscle Actin) AGCGTGGCTATTCCTTCGT Forward 637-655 97 CTCATTTTCAAAGTCCAGAGCTACA Reverse 733-707 57  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_001142483 P311   CCTGGACTGAAGAGAGG  Forward 321-447    78 CAGACAAAGAGTTCTGGGTA Reverse 508-489  NM_001004439  11 integrin  GAAGGCACCAACAAGAACGA Forward 1144-1163   60 AGGAAAAGCCCGTCTGTGA   Reverse 1204-1186       NM_002473  NMMIIA (Non-Muscle Myosin IIA)  ACCGAGAAGATCAATCCATC Forward 722-741      81   AGATACTGGATGACCTTCTTG Reverse 803-783 NM_005964 NMMIIB (Non-Muscle Myosin IIB)  CCGTTTTACATAATCTGAAGGATC Forward 395-418 98   TTGGAAGATTCTTGTAAGGGTT Reverse 493-472 TGF- Signaling related genes NM_000660 TGF-β1  CAACGAAATCTATGACAAGTTCAAGCAG Forward 1218-1245 76   CTTCTCGGAGCTCTGATGTG Reverse 1294-1275      58  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_003238 TGF-β2  TGGTGAAAGCAGAGTTCAGAG Forward 1883-1903  140   CACAACTTTGCTGTCGATGTAG Reverse 2022-2001 NM_003239 TGF-β3  ACACCAATTACTGCTTCCGCAA Forward 1161-1182 81   GCCTAGATCCTGTCGGAAGTC Reverse 1242-1220     NM_001130916 TGF-βR1 (TGF-β Receptor 1)  GTGTATAGCTGAAATTGACTTAA Forward 286-308 99 TGATTGCAGCAATATGTTGTA Reverse 384-364 NM_003242 TGF-βR2 (TGF-β Receptor 2) CTGGTGAGACTTTCTTCATGTG Forward 768-789 127 CTGATGCCTGTCACTTGAAA Reverse 894-875  NM_001964  EGR1  (Early Growth Response 1)  ACGTCTTGGTGCCTTTTGTG Forward 2663-2682  75 GAGGTGAGCATGTCCCTCA Reverse 2737-2719         NM_001136179 EGR2  (Early Growth Response 2)  AGCTTTGCTCCCGTCTCTG Forward 469-487 88 AGCTGGCACCAGGGTACT Reverse 556-539             59  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_004430 EGR3  (Early Growth Response 3)  CGTTGGACAGCAATCTCTTC Forward 903-922 74 AATGGAGCCCATGTCGTTG Reverse 976-958 NM_005966 NAB1  (NGFI-A Binding Protein-1) CAAAGTCCCACTCATCAGAGA Forward 1930-1950   114 TCACAGCTATCTTGAATCTTCAG Reverse 2043-2020           NM_005967 NAB2  (NGFI-A Binding Protein-2) CACATCCCTGCTAAAGCTGAA Forward 1170-1190 111 ATGATGCTGTATTTGCGGATCT Reverse 1280-1259           Growth factors & cytokines NM_001171630 VEGF-A (Vascular Endothelial Growth Factor-A) AGTGTGTGCCCACTGAGGA Forward 1316-1334    97   GTGCTGTAGGAAGCTCATCTC Reverse 1413-1393     60  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_002006  FGF-2 (Fibroblast Growth Factor-2)  AGTTGGTATGTGGCACTGAA Forward 831-850 75   GTATAGCTTTCTGCCCAGGTC                                  Reverse 886-906  NM_199168 CXCL12/SDF-1α TACAGATGCCCATGCCGA Forward 174-191        93   CTGAAGGGCACAGTTTGGAG Reverse 266-247  NM_000576  IL1Interleukin-1 beta)CAGTGAAATGATGGCTTATT       Forward 111-130       75 CTTCATCTGTTTAGGGCCA                Reverse 186-168           NM_000572     IL10Interleukin-10) AGAACCTGAAGACCCTCAG Forward 400-418                          103 CTTATTAAAGGCATTCTTCACCT Reverse 503-481       NM_000594    TNF-α (Tumor Necrosis Factor-α) TCCCCAGGGACCTCTCTCTAATC Forward 357-379    92 CTACAACATGGGCTACAGGCTTG Reverse 449-427        Cell-cell junction proteins NM_000166  Cx32 TCATCTTCATCTTCAGAATCATGG Forward 226-249     85 61  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) GTGTTGCAGATGAAGGAAGA   Reverse 310-291      NM_181703  Cx40 GAATGTCTTCATTGTCTTTATGCTG    Forward 753-777        105 ACAAATCGCTGTCTGATCTTC    Reverse 857-837        NM_000165 Cx43 AGCAGTCTGCCTTTCGTTGTA Forward 393-412 73 GATTGGGAAAGACTTGTCATAGCAG Reverse 466-442                         NM_001097519 Cx45 AGCTGGGTCCAACAAAAGC   Forward 1151-1169    108 ACCATAAACTATGAGAAGCACAGATT Reverse 1258-1233              NM_001792 Cadherin-2 TGAGGAGTCAGTGAAGGAG Forward 843-861 91 CTTCTGCCTTTGTAGGTGG Reverse 933-915 NM_001797 Cadherin-11 TTCCTTCGTGTTGTCATTTGTTG Forward 174-196 89 CTTCTTCACCCATTGGATACTTG Reverse 262-240 Housekeeping genes NM_002046 GAPDH CTTTGTCAAGCTCATTTCCTGGTA Forward 1020-1043 70 62  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) (Glyceraldehydes-3-phosphate d-dehydrogenase) GGCCATGAGGTCCACCA Reverse 1089-1073     M31642  HPRT1 (Hypoxanthine phosphoribosyltransferase I) TGTTGGATTTGAAATTCCAGACAAG Forward 619-643 107 CTTTTCCAGTTTCACTAATGACACAA Reverse 727-700        NM_021009 UBC  (Ubiquitin C)  GTGGCACAGCTAGTTCCGT                     Forward 371-389 96 CTTCACGAAGATCTGCATTGTCA Reverse 444-467 NM_004048 B2M (Beta-2-microglobulin) TGTCTTTCAGCAAGGACTGGTCTTTC Forward 281-306 92 ATGGTTCACACGGCAGGCATA Reverse 351-372    NM_001172085 TBP  (TATAA-box binding protein) TTCGGAGAGTTCTGGGATTG Forward 542-562 94 ACGAAGTGCAATGGTCTTTAG Reverse 635-614 63  Table 2-3: List of antibodies used for immunostaining and Western blotting. *Non- reducing conditions were used in Western blotting. Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-Vimentin DakoCytomation, Burlington, ON, CA Mouse 1:200  Anti-Connexin32 Chemicon International, Billerica, MA, USA Mouse  1:500 Anti- Connexin40 Chemicon International Rabbit  1:1000 Anti-Connexin43 (C6219) Sigma-Aldrich, St. Louis, MO, USA Rabbit 1:800 1:8000 Anti-MMP-1 (N-17) (sc-8834-R) Santa Cruz Rabbit  1:1000 Anti-MMP-3 (ab77962) Abcam Inc., Cambridge, MA, USA Mouse  1:2000 64  Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-MMP-10 R&D Systems Inc., Minneapolis, MN, USA Goat  1:1000 Anti-VEGF (A-20) (sc-152) Santa Cruz Rabbit  1:500* Anti-human Decorin R&D Systems Inc. Mouse  1:500 Anti-human SMAD3 (ab28379) Abcam Inc. Rabbit  1:2000 Anti-human phospho-SMAD3 (ab52903) Abcam Inc. Rabbit  1:2000 Anti-GSK3/ (0011-A): sc-7291 Santa Cruz Mouse  1:1000 65  Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti- GSK3/ (Ser21/9) Cell Signaling, Danvers, MA, USA Rabbit  1:1000 Anti-human ERK1 (ab7947) Abcam Inc. Rabbit  1:500 Anti-active MAPK (ERK1/2) (pTEpY) Abcam Inc. Rabbit  1:2000 Anti-ACTIVE® p38 (pTGpY) Promega, Madison, WI, USA Rabbit  1:2000 Anti-human p38 MAP kinase (L53F8) Cell Signaling Mouse  1:1000 Anti-active β-Catenin (clone 8E7) Millipore, Temecula, CA, USA Mouse  1:1000 66  Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-β-Catenin (total) (ab32572) Abcam Inc. Rabbit  1:10000 Anti-phospho--Catenin (Ser33/37/Thr41) Cell Signaling Rabbit  1:1000 Anti-β-Tubulin (ab21057) Abcam Inc. Goat  1:1000 Anti--SMA (ab5694) Abcam Inc. Rabbit 1:200  Anti-Clever-1 (M2 macrophages) Kindly provided by Dr. Sirpa Jalkanen, University of Turku, Turk, Finland Rat 20 g/ml     67  Table 2-4: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of genes involved in protein degradation during wound healing in gingival fibroblasts. Target Gene Ct Value Relative Expression Mean ± SEM p-Value  MMPs and TIMPs MMP-3 22≤Ct≤23 6.22 ± 0.93 ***1.72608E-06 MMP-1 17≤Ct≤21 4.83 ± 0.59 ***1.40031E-09 MMP-10 20≤Ct≤23 4.72 ± 0.49 ***1.89712E-10 TIMP-3 17≤Ct≤24 2.05 ± 0.34   **0.001 MMP-14 20≤Ct≤23 1.65 ± 0.11 ***7.93526E-05 TIMP-1 15≤Ct≤20 1.63 ± 0.18   **0.001 MMP-11 24≤Ct≤26 1.19 ± 0.07       0.16 TIMP-2 15≤Ct≤22 1.05 ± 0.05       0.30 MMP-2 13≤Ct≤16 0.98 ± 0.04       0.67 MMP-19 23≤Ct≤26 0.81 ± 0.09       0.11 TIMP-4 18≤Ct≤27 0.70 ± 0.05 ***0.0001 MMP-7 Ct>30   MMP-9 Ct>30   MMP-12 Ct>30   MMP-13 Ct>30   Molecules involved in intracellular ECM degradation 68       Results show real-time PCR analysis of relative mRNA expression in confluent GFBL-DC cultures treated with Gap27 (150 μM) relative to control peptide-treated samples for 24 h. Results represent mean ± SEM from minimum of three repeated experiments (**p<0.01, ***p<0.001; Student’s t-test). Genes that are bolded show ≥ 1.5-fold up or downregulation relative to control peptide treated samples. Genes with negligible expression (Ct>30) were not analyzed further. MMP: Matrix Metalloproteinase; TIMP: Tissue Inhibitor of Metalloproteinase; CTSK: Cathepsin K.     Target Gene Ct Value Relative Expression Mean ± SEM p-Value  CTSK 17≤Ct≤19 0.88 ± 0.03       0.07 Endo180 (CD280) 19≤Ct≤21 0.83 ± 0.06       0.12 69  Table 2-5: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of extracellular matrix proteins and cell contractility and myofibroblast-associated genes in gingival fibroblasts. Target Gene Ct Value Relative Expression Mean ± SEM p-Value  Fibrillar ECM proteins EDA-FN 18≤Ct≤22 1.20 ± 0.09     *0.04 EDB-FN 19≤Ct≤24 1.20 ± 0.09     *0.04 Collagen type III 21≤Ct≤24 0.72 ± 0.11       0.07 Collagen type I 18≤Ct≤21 0.62 ± 0.06 ***0.0007 Matricellular proteins TN-C 22≤Ct≤24 5.5 ± 0.79 ***4.88554E-08 CTGF (CCN2) 19≤Ct≤23 1.0 ± 0.14       0.81 Small Leucine-Rich Proteoglygans LUM 19≤Ct≤20 1.23 ± 0.13       0.09 BGN 19≤Ct≤26 1.23 ± 0.17       0.19 DCN 15≤Ct≤16 0.63 ± 0.03 ***5.62708E-06 FMOD 24≤Ct≤27 0.61 ± 0.06 ***0.0006 Contractility and myofibroblast associated protein 11 integrin 26≤Ct≤27 1.27 ± 0.07       0.05 NMMIIA 21≤Ct≤22 1.20 ± 0.12       0.12 P311 26≤Ct≤27 0.89 ± 0.05       0.09 70       Results show real-time PCR analysis of relative mRNA expression in confluent GFBL-DC cultures treated with Gap27 (150 μM) relative to control peptide-treated samples for 24 h. Results represent mean ± SEM from minimum of three repeated experiments (*p<0.05, ***p<0.001; Student’s t-test). Genes that are bolded show ≥ 1.5-fold up or downregulation relative to control peptide treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; BGN: Biglycan; DCN: Decorin; FMOD: Fibromodulin; LUM: Lumican; α-SMA: α-Smooth Muscle Actin; NMMIIA: Non-Muscle Myosin IIA; NMMIIB: Non-Muscle Myosin IIB.     Target Gene Ct Value Relative Expression Mean ± SEM p-Value  -SMA 19≤Ct≤21 0.60 ± 0.04 ***6.79753E-06 NMMIIB 26≤Ct≤27 0.59 ± 0.14 ***0.0002 71  Table 2-6: Blocking of Cx43 function with Gap27 treatment modulates significantly expression of genes involved in TGF-β signaling and encoding VEGF-A and CXCL12/SDF-1α in gingival fibroblasts. Target Gene Ct Value Relative Expression Mean ± SEM p-Value  TGF-β signaling related genes TGF-1 18≤Ct≤21 1.60 ± 0.10 ***4.64896E-06 EGR1 22≤Ct≤25 1.54 ± 0.80       0.49 TGF-3 25≤Ct≤28 1.42 ± 0.14     *0.01 NAB1 24≤Ct≤26 1.26 ± 0.02   **0.005 NAB2 23≤Ct≤24 1.15 ± 0.26       0.59 TGF-R2 21≤Ct≤23 0.89 ± 0.05       0.16 TGF-R1 25≤Ct≤29 0.87 ± 0.12       0.41    TGF-2 24≤Ct≤26 0.63 ± 0.22       0.27 EGR2 25≤Ct≤28 0.56 ± 0.13       0.12 EGR3 Ct>30   Growth factors & cytokines VEGF-A 23≤Ct≤24 3.48 ± 0.43 ***6.29123E-07 FGF-2 23≤Ct≤24 1.19 ± 0.13       0.15 CXCL12/SDF-1α 20≤Ct≤21 0.34 ± 0.05 ***1.39169E-05 IL1 Ct>30   72       Results show real-time PCR analysis of relative mRNA expression in confluent GFBL-DC cultures treated with Gap27 (150 μM) relative to control peptide-treated samples for 24 h. Results represent mean ± SEM from minimum of three repeated experiments (*p<0.05, **p<0.01, ***p<0.001; Student’s t-test). Genes that are bolded show ≥ 1.5-fold up or downregulation relative to control peptide treated samples. Genes with negligible expression (Ct>30) were not analyzed further. TGF-βR1: TGF-β Receptor 1; TGF-βR2: TGF-β Receptor 2; EGR1: Early Growth Response 1; EGR2: Early Growth Response 2; EGR3: Early Growth Response 3; NAB1: NGFI-A Binding Protein-1; NAB2: NGFI-A Binding Protein-2; VEGF-A: Vascular Endothelial Growth Factor-A; FGF-2: Fibroblast Growth Factor-2; IL1β Interleukin-1β; IL10 Interleukin-10; TNF-α: Tumor Necrosis Factor-α.     Target Gene Ct Value Relative Expression Mean ± SEM p-Value  IL10 Ct>30   TNF- Ct>30   73  Table 2-7: Blocking of Cx43 function with Gap27 treatment upregulates significantly expression of Cx43 and Cadherin-2 expression involved in formation of cell-cell junctions.           Results show real-time PCR analysis of relative mRNA expression in confluent GFBL-DC cultures treated with Gap27 (150 μM) relative to control peptide-treated samples for 24 h. Results represent mean ± SEM from minimum of three repeated experiments (*p<0.05, **p<0.01, ***p<0.001; Student’s t-test). Genes that are bolded show ≥ 1.5-fold up or downregulation relative to control peptide treated samples. Cx43: Connexin 43; Cx45: Connexin 45; Cx32: Connexin 32.   Target Gene Ct Value Relative Expression Mean ± SEM p-Value  Cell-cell junction molecules Cx43 21≤Ct≤23 1.79 ± 0.15 ***3.05801E-05 Cadherin-2 22≤Ct≤23 1.68 ± 0.21   **0.002 Cx45 24≤Ct≤27 1.18 ± 0.15       0.21 Cadherin-11 21≤Ct≤22 1.03 ± 0.06       0.69 Cx32 27≤Ct≤30 0.95 ± 0.24       0.85 74  Table 2-8: Blocking of Cx43 function with Gap27 treatment activates distinct signaling pathways that regulate wound healing-associates genes in gingival fibroblasts. GENE AP1 SP1 TGF- p38 MEK1/2 GSK3/ MMP-1     T P MMP-3  P  T T  MMP-10     T  MMP-14   P P   TIMP-1  T T P T T TIMP-3 P  P T T T Collagen type I     T  TN-C T P P P T  DCN P  T    FMOD  P P    -SMA P    T  NMMIIB   P  T  TGF-1 P  P T P P VEGF-A     P  CXCL12/SDF-1α  P     Cx43 P T  P P  Cadherin-2 T T P T T   Results show a summary of involvement of AP1, SP1, TGF-β p MEK1/2 and GSK3α/β signaling pathways in Gap27-mediated regulation of gene expression in GFBLs. Results were obtained from real-time PCR analysis of relative mRNA expression in confluent GFBL-DC cultures treated with Gap27 (150 75  μM) with or without corresponding signaling pathway inhibitors for 24 h, and show results relative to control peptide/vehicle treated samples. T: Inhibition of the pathway completely blocks Gap27-induced change in gene expression. P: Inhibition of the pathway partially (by at least 50%) blocks Gap27-induced change in gene expression. TN-C: Tenascin-C; DCN: Decorin; FMOD: Fibromodulin; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; VEGF-A: Vascular Endothelial Growth Factor-A.   76  2.6 Figures  Figure 2-1: Gingival fibroblasts express Cx43 as their major connexin protein. (A) Results show real-time PCR analysis of major connexins previously described in fibroblasts (Cx32, Cx40, Cx43 and Cx45) in cultured human gingival fibroblasts from four different individuals (GFBL-HN, GFBL-CM, GFBL-OL and GFBL-DC). All cell lines expressed Cx43 as their major connexin, with moderate levels of Cx45, low level of Cx32, and no expression of Cx40. Range of Ct-values obtained from real-time PCR is indicated below each gene name. (B) Similar findings were found when the same connexins were analyzed in cell lysates using Western blotting. (C) Immunostaining of a representative confluent cell culture (GFBL-DC) for Cx43 and Cx45. Gingival fibroblasts contained numerous Cx43-positive plaques, while much fewer similar structures positive for Cx45 were noted.  In general, connexin-positive plaques were localized at cell-cell contact areas, possibly representing GJs (arrows), and other areas not associated with cell-cell contacts (arrowheads). 77   Figure 2-2: Cx43 is downregulated in gingival fibroblasts during wound healing. Representative immunostainings of Cx43 (red) and vimentin (green; a mesenchymal cell marker) in unwounded human oral mucosal connective tissue (attached gingiva) (A and B), and in gingival granulation and wound connective tissue 3 (C and D), 7 (E and F), 14 (G and H), 28 (I and J) and 60 days (K and L) post-wounding. (A and B) In the unwounded gingival connective tissue, abundant Cx43 78  immunoreactivity was present as punctate staining, likely representing Cx43 plaques, in vimentin-positive fibroblast-like cells throughout the tissue. (C and D) At day 3 post-wounding, Cx43 was downregulated in fibroblasts at wound edge as compared to unwounded tissue (A and B). First fibroblasts that had migrated into the wound area showed no immunoreactivity for Cx43 (D). (E-H) At day 7 (E and F) and 14 (G and H) post-wounding, very few Cx43 positive structures were noted in fibroblasts in the highly cellular granulation and connective tissue. (I and J) At day 28 after wounding, abundance of Cx43-positive plaques in connective tissue cells in the newly formed connective tissue at the wound area was increased as compared to earlier time points. However, size of these plaques was clearly smaller than in the unwounded tissue (A and B). (K and L) At day 60 after wounding, structure of the connective tissue formed at the wound area was closely similar to unwounded tissue. Size and number of Cx43-positive plaques in fibroblast-like cells in the regenerated wound area was similar to the unwounded tissue (A and B). Data shown represents minimum of three sections stained in parallel samples from two to three individual donors at each time point. CT: connective tissue; W Edge: wound edge; W Area: wound area; GT: granulation tissue; WCT: wound connective tissue. Nuclear staining (blue) was performed using DAPI.     79   Figure 2-3: Cx43 is downregulated in gingiva during wound healing. Representative immunostainings of Cx43 (red) and vimentin (green; a mesenchymal cell marker) in unwounded human oral mucosal tissue (attached gingiva) (A–C), and in gingival wounds 3- (D–F), 7- (G–I), 14- (J–L), 28- (M–O) and 60-days (P–Q) post-wounding. (A–C) In unwounded gingiva, abundant Cx43 staining was localized in suprabasal epithelial cells. Most intensely stained cells were located in the 80  stratum spinosum, but weak staining was also noted in basal epithelial cells. Inserts in (B) and (C) show higher magnification images of Cx43 localization in basal cells at the connective tissue papilla and rete peg areas, respectively. (D–F) At day 3 post-wounding, Cx43 was downregulated in migrating epithelial cells (D and E) and fibroblasts at wound edge (F; arrowheads indicate wound edge). (G–I) At day 7 post-wounding, when the wound was completely covered with a new epithelium, 2-3 most basal epithelial cell layers showed Cx43 staining in the wound epithelium, while there was only a very weak immunoreactivity for Cx43 in the spinous layer (G and H). Very little Cx43 immunoreactivity was noted in fibroblasts at the wound edge (I). (J–L) At day 14 post-wounding, Cx43 was confined to the 2-3 most basal layers of wound epithelium (J and K). At this stage, immunoreactivity for Cx43 was slightly increased at the wound edge connective tissue (L) as compared to 7-day wounds (I). (M–O) At day 28 after wounding, Cx43 immunoreactivity was normalized in the epithelium at the wound site, being present mainly in suprabasal cells of the stratum spinosum (M and N). Abundance of Cx43-positive plaques in connective tissue cells at the wound edge (O) was increased as compared to earlier time points (I and L). (P–Q) At day 60 after wounding, structure of the epithelium and connective tissue formed at the wound area was closely similar to unwounded tissue. Cx43 immunoreactivity was also similar to unwounded tissue in the epithelium at the wound site (P and Q). (R) Negative control staining of Cx43 in unwounded epithelium. Data shown represents minimum of three sections stained in parallel samples from two to three individual donors at each time point. Arrowheads (D, E, F, G, I, J and M) indicate wound edge. E: epithelium; CT: connective tissue; FC: fibrin clot; W Edge: wound edge; WE: wound epithelium; GT: granulation tissue; WCT: wound connective tissue. Nuclear staining (blue) was performed using DAPI. Magnification bars in the inserts in B, C and Q: 50 μm.   81   Figure 2-4: Immunolocalization of Cx43 in gingival wound macrophages. Immunolocalization of Cx43 in gingival wound macrophages. (A and B) Representative images of wound samples double immunostained with anti-Cx43 (red) and anti-Clever-1 (green; M2 macrophage marker) antibodies. (A) At day 14 post-wounding, very few Cx43-positive structures (arrowheads) were noted in some of the macrophages located in the newly made wound connective tissue. (B) At day 28 post-wounding, number of M2 macrophages was strongly reduced compared to day 14, with very little macrophage-associated Cx43 immunoreactivity. Magnification bar: 10 μm.    82   Figure 2-5: Immunolocalization of Cx43 in gingival wound myofibroblasts. (A and B) Representative images of the same wound location in parallel day 14 wound sections stained with an antibody against α-SMA (A) and Cx43 (B). At day 14 post-wounding, the wound contained numerous α-SMA-positive myofibroblasts. However, very few Cx43-positive structures (arrowheads) were noted in cells in the myofibroblast-rich area. Magnification bar: 10 μm.    83   Figure 2-6: Phase contrast images of gingival fibroblast cultures treated with or without Gap27. Confluent fibroblast cultures (GFBL-DC) were cultured in their normal growth medium (DMEM) (A), or treated with control peptide (B) or Gap27 (C) (150 μM), and images acquired 24 h after treatment. Magnification bar: 50 μm.    84   Figure 2-7: Gap27 and MFA suppress GJ-mediated dye transfer in gingival fibroblasts. (A-F) Confluent GFBL-DC cultures maintained in DMEM were scrape-loaded with Lucifer Yellow (0.5 %; green) in the presence of control peptide (A and B; 150 μM), Gap27 (C; 150 μM), vehicle (dH2O; D and E), or MFA (50 μM; F), and dye transfer was followed for 5 min. Treatment of cells with Gap27 (C) or MFA (F) markedly reduced dye transfer as compared to control samples treated with the control peptide (A and B) or vehicle (D and E). Results show representative images from minimum of three repeated experiments. For the experiments, cells were pretreated with Gap27 and control peptide or MFA and vehicle for 24 h or 1 h before the experiments, respectively. Magnification bars: 50 μm.    85   Figure 2-8: Gap27-treatment promotes gingival fibroblast migration. (A) Representative images of human gingival fibroblast (GFBL-DC) migration in the presence of Gap27 or control peptide (150 μM) across a scrape wound over time. Lines indicate original wound margins. Magnification bar: 20 μm. (B) Quantification of Gap-27-induced fibroblast migration over time. (C) Representative images of human gingival fibroblast (GFBL-DC) migration in the presence of control siRNA-1 or -2 or Cx43 siRNA-1 or -2 (30 nM) across a scrape wound over time. Wounds were completely closed in all groups at 24 h. Lines indicate original wound margins. Magnification bar: 40 μm. (D) Quantification of cell migration in Cx43 and control siRNA treated samples over time. Results show pooled data for Cx43 siRNA-1 and -2, and control siRNA-1 and -2 treated samples, respectively. Wounds were completely closed in all groups at 24 h. For the experiments, siRNA transfection was performed 30 h before wounding. Wound closure rate was determined measuring the area of the open wound at each time point relative to the area of the same wound at the time of wounding. Results show mean ± SEM from minimum of triplicate samples. Statistical testing was performed comparing test and control samples at the given time point (*p<0.05, **p<0.01; Student’s t-test). Non-treated samples (incubated in DMEM only) did not show difference to control peptide or control siRNA-treated samples, and are not shown.  86   Figure 2-9: Effect of Gap27-mediated blocking of Cx43 function on gene expression in parallel gingival fibroblast lines. Confluent cultures of gingival fibroblasts from three different individuals (GFBL-HN, GFBL-CM and GFBL-DC) were treated with Gap27 or control peptide (150 μM) for 24 h, and expression of a set of genes involved in wound healing was analyzed by real-time PCR. Results represent mean ± SEM of mRNA expression relative to control peptide-treated cells from triplicate samples in one experiment (*p<0.05, **p<0.01, ***p<0.001; Student’s t-test). Horizontal line indicates relative mRNA expression for the control-peptide treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN:  Extra Domain B-Fibronectin; TN-C: Tenascin-C; CTGF: Connective Tissue Growth factor (CCN2); α-SMA: α-Smooth Muscle Actin; VEGF-A: Vascular Endothelial Growth Factor-A.    87   Figure 2-10: Effect of Gap26 and Gap27 treatment on gene expression in gingival fibroblasts. Confluent fibroblast cultures (GFBL-DC) were treated with Gap26 or control peptide (300 μM), and Gap27 or control peptide (150 μM) for 24 h, and expression of a set of genes was analyzed by real-time PCR. Results show mean mRNA expression relative to control-peptide treated samples from triplicate samples from one experiment. Horizontal line indicates relative mRNA expression for the control-peptide treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN:  Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; VEGF-A: Vascular Endothelial Growth Factor-A.   88   Figure 2-11: Expression of a set of genes in gingival fibroblasts treated with connexin inhibitor meclofenamic acid (MFA) relative to untreated samples. Real-time PCR results from GFBL-DC cultures treated with increasing concentrations of MFA for 24 h relative to vehicle-treated samples are shown. Results represent mean of triplicate samples in one experiment. MFA induced a concentration-dependent increase in expression of MMP-1, MMP-10, Vascular Endothelial Growth Factor-A (VEGF-A), Tenascin-C (TN-C) and Cx43, and downregulation of CXCL12 (SDF-1α).    89    Figure 2-12: Cx43 siRNA treatment suppresses Cx43 expression, abundance, and GJ-mediated dye transfer in gingival fibroblasts. 90  (A) Confluent GFBL-DC cultures were transfected with Cx43 siRNA-1, siRNA-2, or control siRNA (30 nM) for 48 h, and connexin expression analyzed by real-time PCR (a), Western blotting (b) and immunostaining (c and d). (a) Both Cx43 siRNAs caused a significant, about 80%, down regulation of Cx43 expression, while expression of Cx32 and Cx45 remained unaltered. Results show mean ± SEM of mRNA expression (n=3 experiments) in cells treated with the Cx43 siRNAs relative to control siRNA (indicated by a horizontal line). (b) Similar results were obtained at protein level by Western blotting. (c and d) Immunostaining showed strongly reduced number of Cx43 positive plaques in Cx43 siRNA-treated fibroblasts (d) as compared with control siRNA treated cells (c). Results show data from siRNA-1 transfected cells in b, c, and d. (B) Confluent GFBL-DC cultures transfected with control siRNA-1 (a and b), Cx43 siRNA-1 (c) or Cx43 siRNA-2 (d) were scrape-loaded with Lucifer Yellow (green), and dye transfer was followed for 5 min. Treatment of cells with Cx43 siRNA-1 and -2 reduced markedly dye transfer as compared to control siRNA-1 (results for control siRNA-2 were identical to control siRNA-1, and are not shown). Results show representative images from triplicate samples. For the experiments, siRNA transfections were performed 48 h before the experiment. Magnification bars: 50 μm.      91   Figure 2-13: Blocking of Cx43 by Gap27 resulted in significantly increased secretion of active MMP-1 and MMP-10, and pro-MMP-3 by gingival fibroblasts. Confluent cultures of gingival fibroblasts (GFBL-DC) were treated with Gap27 or control peptide (150 μM) for 24 h, and abundance of MMP-1 (A-D), MMP-3 (E-G), and MMP-10 (H-J) in the conditioned medium and cell layer was analyzed by Western blotting. (B, D, G and J) Quantitation of MMP levels in 92  Western blots shows mean ± SEM from three independent experiments (*p<0.05, ***p<0.001; Student’s t-test). Sample loading for cell layer fraction was normalized for β-Tubulin levels. Identity of active and pro-forms of the enzymes was confirmed by pretreatment of a set of samples with or without APMA to activate latent enzymes prior to Western blotting (data not shown).   93   Figure 2-14: Blocking of Cx43 function by Gap27 promotes secretion of VEGF-A, and suppresses DCN levels in gingival fibroblast cultures. Confluent cultures of gingival fibroblasts (GFBL-DC) were treated with Gap27 or control peptide (150 μM) for 24 h, and Vascular Endothelial Growth Factor-A (VEGF-A) and Decorin (DCN) levels were analyzed in the conditioned medium by Western Blotting. Representative results from three independent experiments are shown.  94   Figure 2-15: Gap27 treatment increases Cx43 protein abundance significantly. (A) Confluent cultures of gingival fibroblasts (GFBL-DC) were treated with Gap27 or control peptide (150 μM) for 24 h, and abundance of Cx43 was analyzed by Western blotting. Gap27 treatment did not affect the relative intensities of three bands corresponding to differently phosphorylated forms of Cx43 (P0: pS368; P1:pS279/282 and pS255; P2: pS262). (B) Quantitation of Cx43 levels in Western blots shows mean ± SEM from three independent experiments (**p<0.01; Student’s t-test). Sample loading was normalized for β-Tubulin levels.   95   Figure 2-16: Western blotting analysis of key signaling pathways modulated by Gap27 in gingival fibroblasts. Confluent cultures of gingival fibroblasts (GFBL-DC) were treated with Gap27 or control peptide (150 μM) for 1, 2, 6, and 24 h. Cell lysates were analyzed for protein levels of total SMAD3 and phosphorylated SMAD3 (p-SMAD3) (A), total p38 and phosphorylated p38 (p-p38) (C), total ERK1/2 and phosphorylated ERK1/2 (p-ERK1/2) (E), total GSK3α/β and phosphorylated GSK3α/β (p-GSK3α/β) (G), and total β-Catenin, phosphorylated β-Catenin (p-β-Catenin) and non-p-β-Catenin (I). (B, D, F, H and J) Quantitation of the phosphorylated or non-phosphorylated signaling molecules relative to their total levels at time 0 (control samples), and at 1, 2, 6 and 24 h after Gap27 treatment. Sample loading was normalized for β-Tubulin levels. Results from one experiment are shown.  96   Figure 2-17: Modulation of Gap27-regulated gene expression in gingival fibroblasts by pharmacological inhibitors of AP1, SP1, TGF-β, p38, MEK1/2 and GSK3α/β signaling pathways. 97  Confluent cultures of gingival fibroblasts (GFBL-DC) were treated with Gap27 (150 μM) with or without curcumin (AP1 inhibitor), WP631 (SP1 inhibitor), SB431542 (TGF-β inhibitor), PD184352 (p38 inhibitor), SB203580 (MEK1/2 inhibitor) or SB415286 (GSK3α/β inhibitor) for 24 h, and expression of MMPs and TIMPs (A), ECM proteins and contractility-associated genes (B), TGF-β1 and growth factors (C), and cell-cell junction proteins (D) was analyzed by real-time PCR. Results represent mean mRNA expression relative to non-treated cells from triplicate samples in one experiment. DMSO: Cells treated with the vehicle (DMSO) only; TN-C: Tenascin-C; DCN: Decorin; FMOD: Fibromodulin; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; VEGF-A: Vascular Endothelial Growth Factor-A.   98  Chapter 3: Connexin 43 Hemichannels Regulate the Expression of Wound Healing-Associated Genes in Human Gingival Fibroblasts2  3.1 Introduction  Connexins (Cxs) are a family of 21 molecules in humans that form hemichannels (HCs) and gap junctions (GJs) on the cell membrane. Each Cx molecule is composed of four transmembrane domains, two extracellular loops (E1 and E2), a cytoplasmic N-terminus, a cytoplasmic loop, and a C-terminal domain critical for the regulation of Cx function [Kar et al., 2012; Iyyathurai et al., 2013]. When present as HCs, Cxs form unopposed channels between cells and the extracellular space. HC opening can be induced by factors associated with, for example, wound healing, inflammation, hypoxia, oxidative stress, mechanical signals, changes in intra- and extracellular osmolarity and Ca2+ concentration, and cytosolic pH [Burra and Jiang, 2011; Decrock et al., 2011; Kar et al., 2012; Gault et al., 2014]. This provides a pathway for the transfer of small ions, metabolites, and signaling molecules between the cytosol and the extracellular space that regulate cell functions via auto- and paracrine mechanisms and by changing the intracellular milieu [Kar et al., 2012; Iyyathurai et al., 2013; Saez and Leybaert, 2014]. For instance, ATP, which has an intracellular concentration several-fold higher than the outside, moves out via HCs to interact with purinergic receptors in order to elicit auto- or paracrine signaling [Schwiebert and Zsembery, 2003; Iyyathurai et al., 2013]. Collectively, HCs are involved in the regulation of various cell functions including survival, proliferation, migration, oxidative stress and gene expression [Burra and Jiang, 2011].                                                  2 A version of this chapter has been published. Tarzemany R, Jiang G, Jiang JX, Larjava H, Häkkinen L. Connexin 43 Hemichannels Regulate the Expression of Wound Healing-Associated Genes in Human Gingival Fibroblasts. Sci Rep. 7, 14157 (2017).  99   When Cxs form GJs, two HCs from opposing cells connect across the intercellular space, forming a channel that links the cytoplasms of the participating cells. This process is regulated by phosphorylation of Cxs at specific cytoplasmic sites, and interactions with cytoplasmic scaffolding proteins. Typically, several GJs cluster laterally to form large (several micrometers) detergent-insoluble GJ plaques, where only a proportion of GJs maybe open at a given time [Rhett and Gourdie, 2012; Thevenin et al., 2013]. When GJs are open, they mediate the exchange of various small signaling molecules, including inositol-3-phosphate (IP3) and cAMP, ions such as Ca2+, metabolites, amino acids and microRNAs, between communicating cells. Unlike in HC-mediated auto- or paracrine signaling, GJs allow the signals to directly spread via the cytoplasms of connected cells to synchronize cell functions [Kar et al., 2012; Iyyathurai et al., 2013]. Many of the same factors that regulate HCs also regulate GJs, but the effects are often opposite. For instance, growth factors, inflammatory cytokines, oxidative stress, ischemia or a moderate elevation of intracellular Ca2+ concentration that induces HCs to open may cause closing of GJs [Decrock et al., 2011; Schalper et al., 2012; Iyyathurai et al., 2013]. Thus, processes such as inflammation or wound healing may promote HC-mediated signaling and suppress GJ-communication. In addition to the above channel-dependent functions, the cytoplasmic domain of Cxs can directly interact with other molecules independent of the channel functions, and participate in intracellular signaling cascades that control gene expression, among other functions [Jiang and Gu, 2005; Wright et al., 2009; Nielsen et al., 2012; Zhou and Jiang, 2014]. The biological roles of Cx HCs, GJs and channel-independent functions are still incompletely understood.  Wound healing in skin and mucosa is a critical process that re-establishes the structure and function of the tissue after trauma, and in ideal cases results in fast and complete tissue 100  regeneration. Aberrations of wound healing are common in skin, and include excessive scarring and delayed or deficient wound healing [Greaves et al., 2013; Greenhalgh, 2014]. Several animal and human studies have shown that the expression of Cxs is spatiotemporally regulated during wound healing, and that their expression is altered in non-healing chronic wounds and in tissue fibrosis, suggesting that Cxs could play a role in these processes [Trovato-Salinaro et al., 2006; Jansen et al., 2012; Vinken, 2012; Churko and Laird, 2013; Martin et al., 2014; Sutcliffe et al., 2015]. For instance, early downregulation of Cx43 has been linked to proper wound closure [Kretz et al., 2003] while its upregulation is associated with non-healing chronic wounds [Sutcliffe et al., 2015]. Moreover, suppressing the expression of Cx43 (the most ubiquitous Cx in skin) by antisense oligonucleotides (AS ODN) upon wounding, results in faster skin wound re-epithelialization and closure, and accelerates wound granulation tissue formation [Kretz et al., 2003 and 2004; Coutinho et al., 2005]. Thus, early downregulation of Cx43 expression appears beneficial for wound healing. A wound healing-promoting effect has also been achieved by a mimetic peptide (ACT1) corresponding to the cytoplasmic carboxyl-terminus of Cx43 [Ghatnekar et al., 2009 and 2015; Grek et al., 2015]. In contrast to Cx43 AS ODN treatment, which reduces the total Cx43 expression resulting in reduced Cx43 GJ and HC abundance [Mori et al., 2006], ACT1 peptide specifically interferes with the interaction of Cx43 with a cytoplasmic molecule ZO-1, and may induce HC sequestration while increasing GJs [Ghatnekar et al., 2009 and 2015; Soder et al., 2009; Rhett et al., 2011; Rhett and Gourdie, 2012]. Interestingly, unlike Cx43 AS ODN treatment, ACT1 suppresses collagen deposition, resulting in a reduced fibrotic response in vivo [Soder et al., 2009]. Thus, Cx43 HCs and GJs may have different effects on the wound healing outcome.  Our recent findings have shown that in human oral mucosal gingival wounds, which heal 101  faster and result in significantly less scarring than skin wounds [Mak et al., 2009; Wong et al., 2009; Larjava et al., 2011; Glim et al., 2013; Häkkinen et al., 2015], abundance of Cx43 plaques was strongly suppressed in wound fibroblasts, suggesting that reduced GJ and/or HC function may promote wound healing in gingiva [Tarzemany et al., 2015]. To further assess the functions of Cx43 in human gingival fibroblasts (GFBLs), we blocked it by mimetic peptides Gap27 or Gap26. These peptides specifically target both Cx43 HCs and GJs at the same time [Wang et al., 2013]. Interestingly, the peptide treatments strongly modulated the expression of several key genes and proteins associated with wound healing via specific intracellular signaling pathways [Tarzemany et al., 2015]. Thus, downregulation of Cx43 function may promote the GFBL phenotype conducive for efficient wound healing, but it is not clear whether these functions distinctly depended on Cx43 HCs or GJs. Therefore, the aim of the present study was to characterize Cx43 HCs and GJs in human GFBLs, and determine their roles in regulating fibroblast gene expression relevant for wound healing. We hypothesized that Cx43 HCs and GJs distinctly regulate the expression of wound healing-associated genes in human GFBLs.  3.2 Materials and Methods 3.2.1 Tissue Samples  To obtain gingival tissue samples from three healthy individuals (26- and 27-year-old females and a 48-year-old-male), standardized, full-thickness excisional biopsies (2x10 mm) were collected under local anesthesia from healthy palatal attached gingiva in an area between the canine and the third molar using a double-bladed scalpel. Samples were processed for frozen sectioning as described previously [Tarzemany et al., 2015]. For the study, a minimum of three tissue sections from each of the three subjects was analyzed.  102  3.2.2 Cell Culture  Three primary human gingival fibroblast strains (GFBLs; GFBL-OL, GFBL-DC, and GFBL-HN) were isolated from clinically healthy attached gingiva from healthy 30 and 41-year-old male and 18-year-old female donors, respectively, as previously described [Häkkinen et al., 1994]. These cell lines have been extensively characterized previously [Tarzemany et al., 2015; Mah et al., 2017]. These fibroblast strains express Cx43 as their main GJ protein [Tarzemany et al., 2015]. Cells were routinely maintained in Dulbecco’s Modified Eagle’s medium (DMEM), supplemented with 1% antibiotic/antimycotic and 10% fetal bovine serum (FBS) (Gibco Life Technologies, Inc., Grand Island, NY, USA) at 37oC and 5% CO2, and seeded for experiments when they reached about 95% confluence. For high-density cultures, cells were seeded at a density of 42,000 cells/cm2, and for low-density cultures at 4,200 cells/cm2. Experiments were performed at passages 5 to 10.  3.2.3 Ethics Statement  Gingival tissue donors provided written informed consent. Procedures were reviewed and approved by the Office of Research Ethics of the University of British Columbia, and comply with the ethical rules for human experimentation that are stated in the 1975 Declaration of Helsinki. 3.2.4 Immunostaining   Human gingival frozen tissue sections and the fibroblast cultures were fixed and stained as described previously [Tarzemany et al., 2015]. In order to investigate the localization of total Cx43, a polyclonal antibody against the cytoplasmic domain of Cx43 that recognizes intracellular, GJ-, and HC-associated Cx43 (total Cx43) was used (Table 3-1) [Sosinsky et al., 2007; Solan and Lampe, 2009]. To localize Cx43 HCs, immunostaining was performed with an 103  affinity-purified rabbit antibody Cx43(E2) that specifically targets the E2 loop domain of Cx43 and also blocks its HC function without affecting GJs (Table 3-1) [Siller-Jackson et al., 2008; Kar et al., 2013]. Localization of Cx43 on cell membranes and intracellularly was assessed with treatment of fixed cell with or without Triton X-100, respectively, before immunostaining. Images were acquired using optical sectioning at 1 μm (ECLIPSE 80i Microscope; Nikon, Tokyo, Japan), and are presented as z-stacks created by the NIS-Elements BR software (Nikon). Control stainings were performed by omitting the primary antibodies used in the study. 3.2.5 Modulation of Cx43 GJ and HC Function   To study Cx43 function, fibroblasts were seeded on 6-well plates in their normal growth medium as above. After 48 h, cells were serum-starved for 24 h, and then treated with Cx43 mimetic peptide Gap27 (150 μM; SRPTEKTIFII; Biomatik, Cambridge, ON, Canada) that corresponds to the second extracellular (E2) loop domain of Cx43, and blocks its GJ and HC functions [Chaytor et al., 1997; Hawat et al., 2012; Wang et al., 2013], and Gap19 (250 and 400 μM; KQIEIKKFK; LifeTein, Hillsborough, NJ, USA) or TAT-Gap19 peptide (200, 400, 500, and 600 μM;YGRKKRRQRRR-KQIEIKKFK; LifeTein) that interacts with nine amino acids in the LT-domain of the cytoplasmic loop of Cx43 and specifically blocks its HC function without affecting GJs [Wang et al., 2013; Abudara et al., 2014]. Control samples were treated with scrambled control Gap27 peptide (TFEPDRISITK; Biomatik) [Wright et al., 2012], or mutated, function-deficient control TAT-Gap19 peptide (YGRKKRRQRRR-KQAEIKKFK; LeifTein) [Wang et al., 2013], respectively.  3.2.6 Quantitative Real-Time RT-PCR (qPCR)  qPCR analysis was performed according to MIQE guidelines [Bustin et al., 2009] as we have described in detail previously [Tarzemany et al., 2015]. The primers used for qPCR and 104  reference genes are listed in Table 3-2. Amplification reactions for qPCR were performed using the CFX96 System (Bio-Rad). For a given experiment, at least two reference genes were chosen [Liu et al., 2015]. Non-transcribed RNA samples were used as a negative control. The qPCR reactions were performed in triplicate for each sample. The data was analyzed and is presented based on the comparative Ct method (CFX Manager Software Version 2.1, Bio-Rad). 3.2.7 Preparation of Cell Lysates for Western Blotting  To collect cell lysates, cells were washed with ice-cold phosphate-buffered saline (PBS), and lysed with a buffer containing 25 mM Tris-HCL (pH 7.6), 100 mM Octyl β-D-glucopyranoside, 5 mM NaF, 1 mM Na3VO4  (Sigma-Aldrich, St. Louis, MO, USA), and the Complete Protease Inhibitor Cocktail (Roche Diagnostics, Laval, Quebec, Canada), dissolved in H2O. Lysates were collected using a rubber policeman, and filtered through a NucleoSpin Filter (Macherey-Nagel) by centrifugation at 5,000g for 10 min.   To assess the distribution of Cx43 in different cellular fractions, cell lysates were obtained by sequential treatment with 1% Triton X-100 (representing non-lipid raft-associated and intracellular pool) followed by a treatment with octyl β-D-glucopyranoside containing buffer (representing Triton X-100 insoluble lipid raft-associated pool) as above [Schubert et al., 2002; Hunter et al., 2005]. 3.2.8 Western Blotting  The activation of the ERK1/2 signaling pathway by Cx43 mimetic peptides or apyrase (Sigma-Aldrich), which selectively degrades extracellular ATP [Langevin et al., 2013; Pinheiro et al., 2013], was studied by Western blotting as described previously [Tarzemany et al., 2015] using cell lysates obtained as described above. For the experiments, GFBLs were seeded on 6-well plates, treated with Gap27 (150 µM), TAT-Gap19 (400 µM), and apyrase (1 U/mL), or 105  equal amount of control peptides and vehicle control (dH2O) for 1, 2, 6, and 24 h, and cell lysates collected as above. Western blotting was performed with antibodies against total or phosphorylated forms of the ERK1/2 pathway (Table 3-1). β-Tubulin was used as a loading control.   3.2.9 Blocking of ERK1/2 and ATP Signaling Pathways  To determine the role of the ERK1/2 signaling pathway in Cx43 mimetic peptide-induced gene expression, we blocked this pathway by MEK1/2 inhibitor PD184352 (10 μM; Sigma-Aldrich) in Gap27- or TAT-Gap19-treated cells, respectively. To this end, confluent GFBL cultures were pre-incubated with PD184352 at 37oC for 1 h, and then treated with Gap27 (150 μM) or TAT-Gap19 (400 μM) with PD184352 in serum-free growth medium for 24 h. PD184352 was dissolved in DMSO, and control samples were treated with respective amounts of DMSO only. Total RNA was collected for qPCR as described above.   To study the role of the ATP signaling pathway in Cx43 HC-regulated gene expression, cells were cultured in high density in their normal growth medium, and serum-starved as above, and then treated with apyrase (1 U/mL) or appropriate vehicle control (dH2O) in serum-free growth medium for 24 h. Total RNA was then collected for qPCR as described above.  3.2.10 Dye Transfer Experiments   To assess the GJ and HC functions of Cx43, dye transfer assays were performed [Schalper et al., 2008]. To this end, fibroblast cultures were generated on gelatin-coated glass coverslips in 24-well plates as described previously [Tarzemany et al., 2015]. To assess dye transfer through GJs by scrape loading, cells were seeded on the coverslips in their normal growth medium as described above and then serum-starved in DMEM for 24 h, followed by pre-incubation with Gap27 (150 μM), TAT-Gap19 (400 μM), Cx43(E2) antibody (1 mg/mL), meclofenamic acid 106  (MFA; 50 μM; Sigma-Aldrich), a widely used GJ inhibitor [Harks et al., 2001], or with corresponding peptide, non-immune rabbit IgG, or vehicle controls in DMEM at 37oC for 1 h. Medium was then removed and a scrape wound was created through the cell layer with a 10-μL pipette tip, and cells incubated as above with 0.5% Lucifer Yellow (Molecular Probes Inc., Eugene, OR, USA) in PBS+ for 5 min at 37oC. Cells were then rinsed and fixed as described previously [Tarzemany et al., 2015].  To assess the HC function of Cx43, cells were cultured on gelatin-coated glass coverslips and serum-starved for 24 h as above. Cells were then preincubated in their normal growth medium (DMEM) that contains 1.8 mM Ca2+, or in EMEM (Lonza, Walkersville, MD, USA) supplemented with 180 nM Ca2+ (low calcium medium), which induces the opening of Cx HCs [Wang et al., 2013], and treated with Gap27, TAT-Gap19, and Cx43(E2) antibody, or corresponding controls, as above for 1 h, followed by incubation in the respective media with the inhibitors or controls and Propidium Iodide (2.5 mM; Sigma-Aldrich) for 20 min. After incubation, media was removed and cells were rinsed with PBS+, and fixed as described previously [Tarzemany et al., 2015]. 3.2.11 Statistical Analysis  The data is presented as mean ± standard error of the mean (SEM) from a minimum of three biological replicates, unless otherwise indicated. Statistical analysis was performed by using two-tailed t-test; p<0.05 was considered statistically significant. Values obtained from the qPCR by the comparative Ct-method were Log2 transformed for statistical testing [Rieu and Powers, 2009]. 107  3.3 Results 3.3.1 Immunolocalization of Cx43 GJs and HCs in Human Gingiva in vivo  We have previously shown that in vivo human GFBLs assemble Cx43 into large plaques typical of GJs [Tarzemany et al., 2015], but it is unclear whether these cells also possess Cx43 HCs in vivo. To this end, we immunostained Cx43 in normal human gingiva using a polyclonal antibody against the cytoplasmic domain of Cx43 that recognizes intracellular, GJ-, and HC-associated Cx43 (total Cx43) [Sosinsky et al., 2007; Solan and Lampe, 2009], or with the Cx43(E2) antibody developed against the E2 extracellular loop that binds only to the HC-associated Cx43 [Siller-Jackson et al., 2008; Kar et al., 2013]. Fibroblasts were identified based on their elongated, spindle-shaped morphology, and positive immunoreactivity for vimentin, a molecule highly expressed in fibroblasts [Hematti, 2012]. In gingival epithelium, total Cx43 staining localized as large plaques at the cell-cell contact areas of the basal and spinous layers (Figure 3-1 A). HC-specific Cx43(E2) immunoreactivity was also most abundantly present at the cell-cell contact areas of the basal and spinous layers (Figure 3-1 C), but the positively stained structures were also markedly smaller than those observed with the antibody recognizing total Cx43 (Figure 3-1 A). As expected, staining of total Cx43 in connective tissue cells localized to punctate, fairly large plaque-like structures (>1 μm in diameter), typical of GJs, and associated mostly with long cellular processes reaching out from vimentin-positive fibroblast-like cells (Figure 3-1 B). The cell processes and some areas of the cell body in these cells also showed positive staining with the HC-specific Cx43(E2) antibody (Figure 3-1 D), but the immunopositive plaque-like structures were in general somewhat smaller (0.5-1 μm in diameter) than those observed with the antibody against total Cx43 (Figure 3-1 B). Thus, in human gingiva, fibroblasts and keratinocytes assemble Cx43 into large plaques typical of GJs, and to smaller 108  plaques recognized with the Cx43 HC-specific antibody, suggesting the presence of both GJ and HC plaques in human gingival cells in vivo. 3.3.2 Cx43 Assembles into GJs and HCs in Cultured Gingival Fibroblasts  We have previously shown that Cx43 is the major Cx and forms functional GJ plaques in confluent monolayer cultures of human GFBLs [Tarzemany et al., 2015]. In order to assess whether GFBLs also possess Cx43 HCs, we compared the localization of total and HC-associated Cx43 in confluent cultures by immunostaining as above (Figure 3-2). To detect cell-cell contacts, we double-immunostained the cells with an antibody against ZO-1, an intracellular molecule involved in the recruitment of Cxs to GJ plaques and an indicator of cell-cell contacts [Thevenin et al., 2013]. Results showed that in cells permeabilized with 0.5% Triton X-100 treatment, Cx43-positive structures colocalized with ZO-1 staining between closely positioned cells, and in a few locations on the cell body, likely representing GJ plaques at cell-cell contacts (Figure 3-2 A-C). In addition, some Cx43 plaques that did not colocalize with ZO-1 were present in the cell body, suggesting that they represented intracellular and/or HC-associated Cx43 (Figure 3-2 A-C). In order to localize Cx43 HCs in the cell membrane and intracellular pools, or present only on the cell membrane, we permeabilized cells with 0.5% Triton X-100 or left them non-permeabilized, respectively, before immunostaining with the HC-specific Cx43(E2) antibody. In both permeabilized (Figure 3-2 D-F) and non-permeabilized (Figure 3-2 G-I) cells, Cx43(E2)-positive plaques were found distributed along the cell body. In permeabilized cells, this staining did not colocalize with ZO-1 (Figure 3-2 D-F), indicating that Cx43 plaques were non-junctional. As expected, no immunoreactivity for ZO-1, an intracellular molecule, was detected in non-permeabilized cells, confirming that the antibodies did not have access to the cytosol in non-permeabilized cells (Figure 3-2 G and I). Thus, cultured human GFBLs possess 109  both Cx43 GJ and HC plaques that associate with cell-cell contacts and non-junctional cell membranes, respectively.  To further characterize Cx43 GJs and HCs, we cultured GFBLs in high density (HD; 100% confluence) to allow cells to form abundant GJ-mediated cell-cell contacts, or in low density (LD; 10% confluence), which results in the formation of fewer cell-cell contacts and GJs. To further study the localization of Cx43 into GJs that are typically present in cell membrane lipid rafts, a set of cultures was pretreated with 1% Triton X-100 to remove non-lipid raft-associated Cx43 (HCs and cytoplasmic pool) [London and Brown, 2000; Schubert et al., 2002; Hunter et al., 2005; Leithe et al., 2009; Wang et al., 2013]. Results showed that Cx43 assembled into GJs and HCs in both HD and LD cultures (Figure 3-3 A-J), and that cell density did not affect Cx43 expression at mRNA (Figure 3-3 K) or protein (Figure 3-3 L and M) levels. However, immunostaining and Western blotting confirmed that increasing the cell density caused a redistribution of Cx43 from a mostly non-junctional (representing intracellular and HC pool of Cx43) to a mostly junctional pool (representing GJ fraction of Cx43) (Figure 3-3 A-J and L-N) as expected.  3.3.3 Gingival Fibroblasts Possess Functional Cx43 GJs and HCs  Having established that GFBLs possess both Cx43 GJs and HCs, we wanted to reveal their functionality. To test Cx43 GJs, cells were scrape-loaded with Lucifer Yellow and dye transfer was assessed by fluorescence microscopy [Schalper et al., 2008]. After 5 min, GFBLs in control samples showed avid Lucifer Yellow transfer extending to several cells from the wound edge (Figure 3-4; a, b, d, e, g, h, j, k). However, when cells were pretreated with MFA (Figure 3-4 A; c), a non-specific Cx inhibitor [Harks et al., 2001], or Gap27 (Figure 3-4 A; f) that specifically binds to the Cx43 extracellular loop and blocks its GJ and HC functions [Chaytor et al., 1997; 110  Hawat et al., 2012; Wang et al., 2013], dye transfer was potently blocked. As expected, dye transfer was unaffected when cells were treated with TAT-Gap19 peptide (Figure 3-4 A; i) or with the Cx43(E2) antibody (Figure 3-4 A; l), which both specifically block Cx43 HC functions without affecting GJs [Siller-Jackson et al., 2008; Kar et al., 2013; Wang et al., 2013; Abudara et al., 2014]. Thus, human GFBLs possess functional Cx43 GJs that can be blocked with Gap27 or MFA, while the HC-targeting TAT-Gap19 and Cx43(E2) antibody have no effect.  To assess Cx43 HC functions, GFBLs were incubated in low Ca2+ medium (180 nM Ca2+) to induce the opening of Cx HCs, and then treated with HC-permeable Propidium Iodide (PI) [Schalper et al., 2008]. Dye transfer via HCs was assessed after 20 min using fluorescence microscopy. While cells kept in high Ca2+-containing medium (1.8 mM Ca2+) did not show any dye transfer as expected (Figure 3-4 B; a), practically all GFBLs in low Ca2+ displayed nuclear PI staining (Figure 3-4 B; b), indicating efficient HC-mediated dye transfer. To assess the involvement of Cx43 HCs in this process, we then treated cells with PI in the presence of Gap27 (Figure 3-4 B; d), TAT-Gap19 (Figure 3-4 B; f), or Cx43(E2) antibody (Figure 3-4 B; h). All treatments completely blocked dye transfer, indicating that it occurred via Cx43 HCs. Corresponding control treatments did not have any effect on the dye transfer (Figure 3-4 B; c, e, g). Thus, GFBLs also have functional Cx43 HCs that can be blocked with Gap27, which also blocks Cx43 GJs, and TAT-Gap19 and Cx43(E2) antibody, which do not affect Cx43 GJs in these cells. 3.3.4 Targeting of Cx43 with TAT-Gap19 Significantly Regulates Gene Expression Similar to Gap27 in Gingival Fibroblasts  We have previously shown that Gap27 treatment significantly regulates mRNA and protein expression of a set of key wound healing-associated genes in human GFBLs cultured in HD 111  [Tarzemany et al., 2015]. However, it is not known whether the gene expression change is mediated by Cx43 GJs or HCs. Therefore, we treated confluent GFBL cultures with Gap27 (150 μM) to block both Cx43 HCs and GJs, or TAT-Gap19 (400 μM), which blocks its HC function, and analyzed gene expression by qPCR. Results showed that Gap27 treatment significantly changed the expression of 21 of the 25 genes analyzed, while having no effect on four of the assessed genes (TIMP-2, EDA-FN, EDB-FN, and Cx45) (Figure 3-5 A), which is consistent with our previous data [Tarzemany et al., 2015]. Similar to Gap27, TAT-Gap19 treatment induced significant up or downregulation of 16 (MMP-1, -3, -10, -14, Collagen type I, Collagen type III, Tenascin-C, Decorin, α-SMA, NMMIIB, TGF-β1, TGF-β3, NAB1, VEGF-A, CXCL12, and Cx43) of the 21 Gap27-responsive genes, although the magnitude of change relative to the untreated cells slightly varied between Gap27 and TAT-Gap19 treated cells (Figure 3-5 A). Findings from set of experiments showed that TAT-Gap19 responses were concentration-dependent from 200 µM up to 500 µM (Figure 3-6 A). Similarly, Gap19 peptide that was not linked with the TAT cell-penetrating peptide caused concentration-dependent gene expression changes, albeit at a slightly lower efficiency (Figure 3-6 B). Thus, the expression of the above 16 genes maybe regulated via blocking of the Cx43 HC function by Gap27 and TAT-Gap19. In contrast, the expression of the five genes (TIMP-1, -3, -4, Cadherin-2, and Fibromodulin), which were significantly regulated by Gap27, but not by TAT-Gap19, may depend on Gap27-mediated inhibition of GJ functions. The expression of the four genes (TIMP-2, EDA-FN, EDB-FN, and Cx45) not regulated by Gap27 was also unaffected by TAT-Gap19 (Figure 3-5 A), confirming that their expression is not regulated by Cx43 GJs or HCs in these cells.  3.3.5 Modulation of Cell Cycle by Gap27 and TAT-Gap19 in Gingival Fibroblasts  To assess whether gene expression changes caused by blocking of Cx43 function by the 112  mimetic peptides were associated with cell cycle modulation, we performed qPCR for Cyclin A2, Cyclin B1, Cyclin D1, and Cyclin E1, four genes that are distinctly expressed during different stages of cell cycle [Hochegger et al., 2008]. To this end, we treated confluent GFBL cultures with Gap27 (150 μM) or TAT-Gap19 (400 μM), and analyzed gene expression by qPCR. Results showed that Cyclin D1, a gene that regulates transition from G1 to S phase of the cell cycle [Hochegger et al., 2008], was significantly elevated by both Gap27 and TAT-Gap19 while the other cyclins did not show significant change compared to control samples (Figure 3-5 B).  3.3.6 Targeting of Cx43 with TAT-Gap19 Modulates ERK Signaling Pathway Similar to Gap27 in Gingival Fibroblasts  We have previously shown that most gene expression changes induced by Gap27 treatment are linked to the activation of the ERK1/2 signaling pathway in GFBLs [Tarzemany et al., 2015]. Therefore, having established that targeting Cx43 HCs with TAT-Gap19 regulates the expression of a set of wound healing-associated genes similar to Gap27, we wanted to find out whether TAT-Gap19 also activates the ERK1/2 signaling pathway. Similar to Gap27, TAT-Gap19 treatment already markedly induced phosphorylation of ERK1/2 after 1 h of treatment. With both treatments, ERK1/2 activation lasted for at least 6 h, before returning to the level of untreated cells by 24 h (Figure 3-7). Thus, in GFBLs, targeting Cx43 with TAT-Gap19 or Gap27 treatment similarly involves activation of the ERK1/2 signaling pathway.  3.3.7 Distinct Involvement of ERK1/2 Signaling Pathway in Modulation of Cx43-Regulated Genes in Gingival Fibroblasts   In order to further study the role of the ERK1/2 pathway in Gap27 and TAT-Gap19-induced gene expression, we blocked the ERK1/2 pathway by PD184352 in Gap27 or TAT-113  Gap19-treated cells and assessed gene expression changes by qPCR. We specifically assessed the expression of a set of 17 wound healing-related genes that were previously significantly modulated (with a minimum 1.5-fold change threshold) by Gap27 treatment [Tarzemany et al., 2015]. These include 13 genes commonly regulated by Gap27 and TAT-Gap19. As previously reported [Tarzemany et al., 2015], inhibition of the ERK1/2 pathway by PD184352 blocked Gap27-induced expression changes of 13 of these genes (MMP-1, -3, -10, TIMP-1, -3, Collagen type I, Tenascin-C, α-SMA, NMMIIB, TGF-β1, VEGF-A, Cx43, and Cadherin-2), while the expression of four genes (MMP-14, Decorin, Fibromodulin, and CXCL12) was not regulated by this pathway (Figure 3-8 A). Likewise, PD184352 treatment significantly blocked TAT-Gap19-induced expression changes in nine of the above 13 genes (MMP-1, -3, -10, Collagen type I, Tenascin-C, α-SMA, NMMIIB, TGF-β1, and VEGF-A). While Gap27 and TAT-Gap19 bind to different domains in the Cx43 molecule, their common property is their ability to block function of Cx43 HCs [Abudara et al., 2014]. Therefore, expression of the above nine genes maybe regulated by Gap27 and TAT-Gap19-induced suppression of Cx43 HC function and subsequent activation of the ERK1/2 pathway. In contrast, expression changes of three genes (MMP-14, Decorin, and CXCL12) commonly regulated by Gap27 and TAT-Gap19 were not affected by PD184352 treatment, suggesting the involvement of an ERK1/2-independent Cx43 HC-regulated pathway (Figure 3-8 B). Both Gap27 and TAT-Gap19 treatments significantly induced expression of Cx43. Interestingly, however, the Gap27-induced Cx43 mRNA increase was sensitive to PD184352 treatment while TAT-Gap19 was not, suggesting that Gap27 and TAT-Gap19 induce Cx43 expression by distinct mechanisms in GFBLs.   114  3.3.8 Inhibition of ATP Signaling Partially Recapitulates Gene Expression Changes Induced by TAT-Gap19 in Gingival Fibroblasts   Cx43 HCs are known to mediate the release from cells of ATP, which is a powerful auto- and para-crine signaling molecule. Gap27 and TAT-Gap19 have been shown to efficiently block the Cx43 HC-mediated ATP release in various cells [Evans et al., 2012; Abudara et al., 2014]. Furthermore, ATP-regulated cell signaling has been linked to the ERK1/2 pathway [Jacques-Silva et al., 2004; Lu et al., 2012]. Therefore, to study whether suppression of ATP-mediated signaling is important in the regulation of gene expression by Gap27 and TAT-Gap19, we treated cells with apyrase that selectively degrades extracellular ATP [Langevin et al., 2013; Pinheiro et al., 2013], and assessed gene expression changes relative to vehicle-treated cells by qPCR after 24 h. The analysis focused on the above 13 genes commonly regulated by TAT-Gap19 and Gap27. Results showed that 10 of these genes (MMP-1, -3, -10, -14, Collagen type I, Tenascin-C, α-SMA, NMMIIB, VEGF-A, and CXCL12) were also significantly up or downregulated by apyrase (Figure 3-9 A), which was similar to Gap27 and TAT-Gap19 treatment. In contrast, when cells were pretreated with TAT-Gap19, apyrase treatment did not have any additional effect on the expression of these genes (Figure 3-10). This suggests that the expression of the above 10 genes is regulated by the blocking of HC-mediated ATP release by Gap27 and TAT-Gap19. In contrast, TAT-Gap19 and Gap27-induced expression of Decorin, TGF-β1, and Cx43 was not affected by apyrase treatment, suggesting the involvement of other mechanisms. 3.3.9 Modulation of mRNA Abundance of ATP and Adenosine Receptors by Gap27 and TAT-Gap19 in Gingival Fibroblasts  In order to find out whether Gap27 and TAT-Gap19 treatments also affect the expression of cell surface receptors involved in ATP or adenosine (a metabolite of ATP) signaling 115  [Burnstock et al., 2012; Ferrari et al., 2016], we performed qPCR for the Cx43-mimetic peptide-treated samples as above. The peptide treatments did not significantly modulate abundance of mRNA of ATP receptors P2X4 and P2X7 or adenosine receptor P1A2bR and adenosine deaminase (ADA), a modulator of adenosine signaling, compared to control samples (Figure 3-11). However, unlike TAT-Gap19, Gap27 treatment caused a significant down- and upregulation of CD39 and CD73 mRNA abundance, respectively, two receptors involved in generation of adenosine from ATP [Burnstock et al., 2012; Ferrari et al., 2016], compared to control samples (Figure 3-11). Abundance of mRNA of ATP receptors P2Y1 and P2Y2 and adenosine receptors P1A1R, P1A2aR, and P1A3R in GFBLs was negligible and were not explored further.  3.3.10 Blocking of ATP Signaling Activates ERK1/2 Signaling Pathway Similar to Cx43 Mimetic Peptides in Gingival Fibroblasts  The findings from above showed that blocking of Cx43 HC function with TAT-Gap19 or Gap27 treatment causes activation of the ERK1/2 signaling pathway (Figure 3-7), and blocking ATP signaling with apyrase results in a similar gene expression response (10 out of 13 genes) as treatment with Gap27 or TAT-Gap19 (Figure 3-9 A). Therefore, we wanted to ask whether the apyrase-modulated gene expression response was also associated with activation of the ERK1/2 signaling pathway. To this end, we treated GFBLs with apyrase and assessed ERK1/2 phosphorylation over time by Western blotting. Similar to Gap27 and TAT-Gap19 (Figure 3-7), apyrase treatment already markedly induced phosphorylation of ERK1/2 after 1 h of treatment, which lasted for at least 6 h, before returning to the level of untreated cells by 24 h (Figure 3-9 B, C).    Collectively, the findings indicate that in GFBLs, the expression of a set of wound healing-related genes (MMP-1, -3, -10, -14, Collagen type I, Tenascin-C, α-SMA, NMMIIB, VEGF-A, 116  CXCL12, TGF-β1, and Decorin) is regulated by Cx43 HCs (genes that were responsive to both Gap27 and TAT-Gap19). The expression change of the majority of these genes (except for TGF-β1 and Decorin) was ATP-dependent (ATP inhibition by apyrase caused a similar expression change as blocking of Cx43 HC function). Among Cx43 HC-regulated genes that were dependent on inhibition of ATP activity, the expression of eight out of 10 genes (MMP-1, -3, -10, Collagen type I, Tenascin-C, α-SMA, NMMIIB, and VEGF-A) was also regulated by the ERK1/2 pathway (Table 3-3). Our findings also suggest that the expression of four genes (TIMP-1, -3, Cadherin-2, and Fibromodulin) is regulated by Cx43 GJs (genes that were only responsive to Gap27 but not to TAT-Gap19). Out of these genes, the expression change of TIMP-1, -3, and Cadherin-2 was ERK1/2 mediated. Among the studied genes, the expression of four genes (TIMP-2, EDA-FN, EDB-FN, and Cx45) was not regulated by Cx43 GJs or HCs (Table 3-3). The regulation of Cx43 expression in GFBLs by Cx mimetic peptides appears complex. Both Gap27 and TAT-Gap19 significantly upregulate Cx43 expression, but the Gap27-mediated response was ERK-dependent while the response to TAT-Gap19 was not. Furthermore, Cx43 expression was not affected by apyrase treatment (ATP signaling). The gene expression changes caused by Gap27 and TAT-Gap19 were commonly associated with significantly increased expression of cyclin D1, a modulator of cell cycle [Hochegger et al., 2008]. In addition, Gap27, but not TAT-Gap19, also modulated the expression of CD39 and CD73, two receptors involved in ATP metabolism to adenosine [Burnstock et al., 2012; Ferrari et al., 2016]. 3.4 Discussion   The findings in the present study showed that Cx43 assembles into distinct plaques in GFBLs in vivo and in vitro. Based on immunostaining of tissue sections and GFBL cultures using Cx43 antibodies that recognizes total Cx43 or only HC-associated Cx43, we further 117  showed that some of these plaques were composed of Cx43 HCs while others localized to cell-cell contacts likely representing Cx43 GJ plaques. It is widely accepted that Cx43 forms GJ plaques in vivo and in vitro in various cells and tissues [Thevenin et al., 2013]. Evidence from atomic force microscopy has also suggested the presence of up to 2 μm2 HC plaques in cardiac cells in vivo [Lal et al., 1995], but it remains unclear whether such HC plaques also exist in other tissues or cells. Elegant human and animal epithelial and fibroblast cell culture studies have shown that to form GJs, Cxs are first transported to the cell membrane as HCs, where they then cluster into plaques and assemble into GJs [Lauf et al., 2002; Nielsen et al., 2012]. These Cx plaques can be several micrometers in size and, therefore, unlike individual Cxs, are detectable by immunostaining [Thevenin et al., 2013]. Thus, some of the Cx43 plaques noted in GFBLs are likely composed of both Cx HCs and GJs. However, in cultured GFBLs, the localization of Cx43 HC plaques was mainly noted along the cell body not associated with cell contacts, suggesting that these plaques are composed of HCs only. Cxs have not been shown to organize into plaque-like structures intracellularly [Nielsen et al., 2012], suggesting that the noted plaques are associated with the cell membrane. This is further supported by our findings also showing Cx43 HC staining in cells not permeabilized by Triton X-100 prior to staining. In any case, our biochemical fractionation and Cx43 immunoblotting data (Figure 3-3) indicate the presence of two distinct pools of Cx43 in GFBLs, as described previously for other cell types [Solan and Lampe, 2009]. These pools likely represent GJs that can be mostly found in the Triton X-100 insoluble cell membrane lipid raft fraction, while the detergent-soluble non-lipid raft pool consists of Cx43 HCs present on the membrane and intracellularly [Leithe et al., 2009]. Thus, collectively, the above findings show for the first time the presence of both Cx43 GJs and HCs in GFBLs in vivo and in vitro.  118   Our GJ and HC-specific dye transfer experiments and functional blocking of Cx43 GJs and HCs by specific peptides further indicate that Cx43 GJs and HCs are functional in GFBLs. Interestingly, however, in cultures where GFBLs possess both Cx43 GJs and HCs abundantly, specific blocking of both Cx43 GJ and HC function by Gap27 or only HC function by TAT-Gap19 showed in general a similar effect on gene expression, and this was mediated by the activation of the ERK1/2 pathway. Thus, the Cx43 HC-mediated pathway appears to play an important role in the regulation of wound healing-associated genes in cultured GFBLs. Cx43 HCs are important conduits for auto- and paracrine signaling mediated by ATP [Rhett et al., 2016]. Our data also suggests that the gene expression response and activation of the ERK1/2 pathway by Cx43 HC-blocking peptides depends on reduced ATP signaling by GFBLs. This is based on the findings that inhibition of ATP activity by apyrase caused in general a similar gene expression response and activation of the ERK1/2 pathway as the blocking of Cx43 HCs by the peptides. Furthermore, inhibition of ATP signaling by apyrase did not have an additional effect over the gene expression change induced by Cx43 HC blocking by TAT-Gap19 (Figure 3-10). Thus, in cultures of human GFBLs where the cells possess functional Cx43 GJs and HCs, the blocking of Cx43 HC function and ATP signaling by Cx43 mimetic peptides causes a robust ERK1/2-dependent change in the expression of a set of wound healing-associated genes. These changes include significant upregulation of MMPs (MMP-1, -3, and -10) that modulate inflammation and tissue remodeling [Steffensen et al., 2001; Dufour and Overall, 2013], TN-C that regulates cell migration and suppresses fibrosis [Yates et al., 2016], and VEGF-A that promotes angiogenesis [Liakouli et al., 2011], and downregulation of Collagen type I, α-SMA and NMMIIB that are associated with fibrosis [Penn et al., 2012]. Thus, the inhibition of Cx43 HC-dependent ATP signaling by Cx43 HC-specific blocking peptides may be used to promote a 119  gene expression response that may be beneficial for fast and scarless wound healing. The targeting of Cx43 HCs to promote wound healing by blocking peptides may also have beneficial effects via other mechanisms. ATP released by connective tissue and inflammatory cells is an important pro-inflammatory signal during the early stages of wound healing [Rhett et al., 2014]. In certain animal models, the blocking of Cx43 function prevents this pro-inflammatory ATP release [Calder, et al., 2015]. This is significant as increased inflammation delays wound healing and promotes fibrosis and excessive scar formation [Qian et al., 2016]. In line with the above, the transient blocking of Cx43 functions has been shown to promote experimental wound healing and reduce fibrosis [Qiu et al., 2003; Ghatnekar et al., 2009; Soder et al., 2009]. Interestingly, however, fibroblasts from two fibrotic skin conditions (hypertrophic scars and keloids) display reduced Cx43 levels and GJ-mediated intercellular communication, suggesting that the normal GJ functions of Cx43 may be important for normal fibroblast function [Cogliati et al., 2016]. Therefore, our finding that specifically targeting Cx43 HC function without affecting GJs promotes the expression of wound healing-related genes in fibroblasts may provide a novel specific target to modulate functions beneficial for wound healing. Specific targeting of Cx43 HCs may also be desirable as the blocking of Cx43 GJ functions may have more systemic side effects, including impaired cardiac function [Reaume et al., 1995; Kurtenbach et al., 2014].  Interestingly, a subset of genes in GFBLs (TIMP-1, TIMP-3, Cadherin-2 and Fibromodulin) was significantly modulated by Gap27, but not by TAT-Gap19, suggesting that their expression is regulated by Cx43 GJs. This was not associated with differential cell cycle regulation by the two peptides, as both caused a significant increase in Cyclin D1 mRNA abundance. However, Gap27 treatment was distinctly associated with a significant change in mRNA abundance of CD39 and CD73, two receptors that metabolize ATP to adenosine 120  [Burnstock et al., 2012; Ferrari et al., 2016]. Importance of this pathway in Cx43-regulated gene expression warrants further investigation.  While our results showed that Cx43 expression was significantly upregulated with both Gap27 and TAT-Gap19 treatments, the former response was ERK-dependent but the latter was not. Furthermore, Cx43 expression was not affected by apyrase-mediated extracellular ATP degradation that also induced ERK activation, a situation mimicking inhibition of HC-mediated ATP release from cells. Therefore, the regulation of Cx43 expression may involve distinct Cx43 GJ and HC-mediated feedback mechanisms.  To summarize, we have shown for the first time that in human GFBLs, Cx43 not only assembles into GJ plaques but also forms HC plaques in vitro and in vivo. In cultured GFBLs, selective blockage of Cx43 HCs modulates the expression of key wound healing-associated genes through suppression of ATP release and activation of the ERK1/2 signaling pathway.  121  3.5 Tables Table 3-1: List of antibodies used for immunostaining and Western blotting.  Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-Vimentin (M7020; Vim 3B4)   DakoCytomation, Burlington, ON, CA Mouse 1:200  Anti-Connexin 43 (C6219) Sigma-Aldrich, St. Louis, MO, USA Rabbit 1:800 1:8000 Cx43(E2) Kindly provided by Dr. Jean X. Jiang,  University of Texas Health Science Center,  San Antonio, TX, USA Rabbit 1:300  Anti-ERK1  (ab7947) Abcam Inc. Cambridge, MA, USA Rabbit  1:500 Anti-active MAPK  (pTEpY) Promega, Madison, WI, USA Rabbit  1:2000 122   Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-β-Tubulin (ab21057) Abcam Inc. Goat  1:1000 123  Table 3-2:Primers used for quantitative real-time RT-PCR. GeneBank Gene Primer sequence Orientation Location Amplicon (bp) MMPs and TIMPs NM_002421 MMP-1 GCTAACAAATACTGGAGGTATGATG Forward 1250-1275 100   GTCATGTGCTATCATTTTGGGA Reverse 1304-1325     NM_001166308 MMP-3   ATGATGAACAATGGACAAAGGA Forward 661-682 91   GAGTGAAAGAGACCCAGGGA Reverse 751-732  NM_002425 MMP-10   TTATACACCAGATTTGCCAAGA Forward 394-415 56   TTCAGAGCTTTCTCAATGG Reverse 450-432    NM_004995  MMP-14 TCTCCCAGAGGGTCATTCAT Forward 618-1637                       70 TTCCAGTATTTGTTCCCCTTGTAG Reverse 1688-1665   NM_003254 TIMP-1   CTGTGTCCCACCCCACC Forward 267-283 64   GAACTTGGCCCTGATGACGA Reverse 330-311      NM_003255  TIMP-2   ACATTTATGGCAACCCTATCAA  Forward 481-502 70 TCAGGCCCTTTGAACATCTTTA Reverse 550-529      124  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_000362 TIMP-3   AGGACGCCTTCTGCAAC Forward 1281-1297 68   CTCCTTTACCAGCTTCTTCC Reverse 1348-1329 NM_003256 TIMP-4   ACCTGTCCTTGGTGCAGA  Forward 927-944 80   TGTAGCAGGTGGTGATTTGG Reverse 1004-985 Fibrillar ECM proteins BC036531 Collagen type I (alpha 1) AACCAAGGCTGCAACCTGGA          Forward 3951-3970 80   GGCTGAGTAGGGTACACGCAGG    Reverse 4030-4009 NM_000090 Collagen type III (alpha 1) CTCCTGGGATTAATGGTAGT  Forward 1271-1290 70   CCAGGAGCTCCAGGAAT Reverse 1340-1324 NM_212482  EDA-FN (Extra Domain A-Fibronectin)  CACAGTCAGTGTGGTTGCCT Forward 5633-5652 68 CTGTGGACTGGGTTCCAATCA     Reverse 5700-5680      NM_212482  EDB-FN (Extra Domain B-CAGTAGTTGCGGCAGGAGAA  Forward 4168-4188 65 GTATCCTACTGAGGAGTCCACAAAATC Reverse 4232-4206      125  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) Fibronectin) Matricellular proteins NM_002160 TN-C  (Tenascin-C) CAACCTGATGGGGAGATATGGGGA Forward 6769-6792 75 GAGTGTTCGTGGCCCTTCCAG Reverse 6846-6826      Contractility and myofibroblast associated proteins NM_001613  α –SMA (α-Smooth Muscle Actin) AGCGTGGCTATTCCTTCGT Forward 637-655 97   CTCATTTTCAAAGTCCAGAGCTACA Reverse 733-707 NM_005964 NMMIIB (Non-Muscle Myosin IIB)  CCGTTTTACATAATCTGAAGGATC Forward 395-418 98   TTGGAAGATTCTTGTAAGGGTT Reverse 493-472 Small leucine-rich proteoglycans BT019800 DCN  (Decorin) CTGACACAACTCTGCTAGAC   Forward 242-261 97 GACAAGAATCAATGCGTGAAG Reverse 339-319   126  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_002023 FMOD (Fibromodulin) CACAATGAGATCCAGGAAG Forward 761-779 85   TCCGAAGGTGGTTATAACTC  Reverse 845-826        TGF- signaling related genes NM_000660 TGF-β1  CAACGAAATCTATGACAAGTTCAAGCAG Forward 1218-1245 76   CTTCTCGGAGCTCTGATGTG Reverse 1294-1275      NM_003239 TGF-β3  ACACCAATTACTGCTTCCGCAA Forward 1161-1182 81   GCCTAGATCCTGTCGGAAGTC Reverse 1242-1220     NM_005966 NAB1  (NGFI-A Binding Protein-1) CAAAGTCCCACTCATCAGAGA Forward 1930-1950   114 TCACAGCTATCTTGAATCTTCAG Reverse 2043-2020           Growth factors and cytokines NM_001171 VEGF-A AGTGTGTGCCCACTGAGGA Forward 1316-1334    97 127  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) 630 (Vascular Endothelial Growth Factor-A) GTGCTGTAGGAAGCTCATCTC Reverse 1413-1393       NM_199168 CXCL12/SDF-1α TACAGATGCCCATGCCGA Forward 174-191        93   CTGAAGGGCACAGTTTGGAG Reverse 266-247  Cell-cell junction proteins NM_000165 Cx43 AGCAGTCTGCCTTTCGTTGTA Forward 393-412 73 GATTGGGAAAGACTTGTCATAGCAG Reverse 466-442                         NM_001097519 Cx45 AGCTGGGTCCAACAAAAGC   Forward 1151-1169    108 ACCATAAACTATGAGAAGCACAGATT Reverse 1258-1233              NM_001792 Cadherin-2 TGAGGAGTCAGTGAAGGAG Forward 843-861 91 CTTCTGCCTTTGTAGGTGG Reverse 933-915 ATP and adenosine signaling NM_001776 CD39 CCTCTATGGCAAGGACTACA Forward 1044~1063 133 128  GeneBank Gene Primer sequence Orientation Location Amplicon (bp)  ATGAAAGCATGGGTCCCT Reverse 1177~1159 NM_001204813 CD73  AGCATTCCTGAAGATCCAAGC Forward 1493~1513 149 GTTGCCCATGTTGCATTCTC Reverse 1642~1623 NM_000022 ADA (Adenosine deaminase) CACCCTGGACACTGATTACC Forward 1034~1053 149 CCATAGGCTTTATAGAGCAGGT Reverse 1183~1162 NM_000674 P1A1R  CTACATTGCCATCTTCCTCAC Forward 1243~1263 111 GAAATGGTCATTCCAAATCTTAAGG Reverse 1354~1330 NM_000675 P1A2aR  TCGGTTGTGAATCCCTTCATCTA Forward 1300~1321 111 CAGCTGCCTTGAAAGGTTCTT Reverse 1411~1391 NM_000676 P1A2bR  CTGCCTCTCTTGAGCACTTC Forward 1437~1456 134 GCTGTTGGCATAATCCACAC Reverse 1571~1552 NM_000677 P1A3R  GCTTGTGTGGTCTGCCATC Forward 1662~1680 114 TGTTGATGGGGAATCTGAAGG Reverse 1776~1756 129  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_002563  P2Y1  GACAAGTGTTCACTCACATCTG Forward 2803~2824 154 TGTGGATGACTGTCAACCTC Reverse 2957~2938 NM_002564 P2Y2  TGAGCACAGAGAAAAGTCAGG Forward 2318~2338 91 AATGGCTTAACATTTACCAGCA Reverse 2409~2388 NM_002560  P2X4  ACAACATCTGGTATCCCAAA Forward 876~895 141 TTCTCCACTATTTTGCCAAGA Reverse 1017~997 NM_002562 P2X7 CAGCCCTGTGTGGTCAAC Forward 1266~1283 143 TTGCAGACTTCTCCCTAGTAGC Reverse 1409~1388 Cell cycle NM_001237 Cyclin A2 TCACTAACAGTATGAGAGCTATCC    Forward 922-945 128 GCACTGACATGGAAGACAG    Reverse 1050-1032 NM_031966 Cyclin B1 TGTGTCAGGCTTTCTCTGA  Forward 678-696 121 CTCAAGTTGTCTCAGATAAGCA   Reverse 799-778 130  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_053056 Cyclin D1 GGAGAGGATTAGGTTCCATCC   Forward 1479-1499 137 TCAGGAAAAGCACAAGAATATGT   Reverse 1616-1594 NM_001322262 Cyclin E1 GCTGGGCAAATAGAGAGGA  Forward 462-480 136 CTCCATTAACCAATCCAGAAGAA   Reverse 598-576 Reference genes NM_002046 GAPDH (Glyceraldehydes-3-phosphate d-dehydrogenase) CTTTGTCAAGCTCATTTCCTGGTA Forward 1020-1043 70 GGCCATGAGGTCCACCA Reverse 1089-1073     M31642  HPRT1 (Hypoxanthine phosphoribosyltransferase I) TGTTGGATTTGAAATTCCAGACAAG Forward 619-643 107 CTTTTCCAGTTTCACTAATGACACAA Reverse 727-700        NM_021009 UBC   GTGGCACAGCTAGTTCCGT                     Forward 371-389 96 131  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) (Ubiquitin C) CTTCACGAAGATCTGCATTGTCA Reverse 444-467 NM_004048 B2M (Beta-2-microglobulin) TGTCTTTCAGCAAGGACTGGTCTTTC Forward 281-306 92 ATGGTTCACACGGCAGGCATA Reverse 351-372    NM_001172085 TBP  (TATAA-box binding protein) TTCGGAGAGTTCTGGGATTG Forward 542-562 94 ACGAAGTGCAATGGTCTTTAG Reverse 635-614  132  Table 3-3: Summary of Involvement of ATP and ERK1/2 Signaling Pathways in Cx43 HC- or GJ-Regulated Genes. Cx43-independent Genes Cx43 GJ-regulated Genes  Cx43 HC-regulated Genes TIMP-2 EDA-FN EDB-FN Cx45 ERK1/2-mediated Not ERK1/2- mediated  ATP-dependent Not ATP-dependent   TIMP-1 TIMP-3 Cadherin-2 FMOD  ERK1/2- mediated Not ERK1/2- mediated ERK1/2- mediated Not ERK1/2- mediated  MMP-1 MMP-3 MMP-10 Coll I TN-C -SMA NMMIIB VEGF-A MMP-14 CXCL12 TGF-1 DCN   Table shows a summary of expression changes of key wound healing-associated genes whose regulation was mediated by Cx43 GJs (genes that were only responsive to Gap27 but not to TAT-Gap19) or by 133  Cx43 HCs (genes that were responsive to both Gap27- and TAT-Gap19-treatment) in human GFBLs. These genes are further categorized based on whether or not their expression change was inhibited by apyrase (ATP-regulated genes) or ERK1/2 inhibitor (ERK1/2-mediated). Results were obtained from qPCR analysis of relative amount of mRNA in confluent GFBL-DC cultures treated with Gap27 (150 μM) or TAT-Gap19 (400 μM) with or without MEK1/2 signaling pathway inhibitor (PD184352; 10 μM), and with ATP inhibitor (apyrase; 1U/mL) for 24 h, and show results relative to control peptide/vehicle treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; FMOD: Fibromodulin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB, VEGF-A: Vascular Endothelial Growth Factor-A; DCN: Decorin.  134  3.6 Figures  Figure 3-1: Localization of Cx43 GJs and HCs in human gingiva in vivo. Representative images of human gingival tissue sections double immunostained with an antibody recognizing all forms of the Cx43 molecule (Cx43; A and B) or only HC-associated Cx43 (Cx43(E2); C and D) and vimentin (a mesenchymal cell marker) in human gingival epithelium (A and C) and connective tissue (B and D). In the basal and spinous layers of the epithelium, Cx43 immunostaining localized most abundantly at the cell-cell contacts as fairly large plaque-like structures typical to GJs (A). Staining with the Cx43 HC-specific Cx43(E2) antibody also showed localization of Cx43 at the epithelial cell-cell contacts, but the immunopositive structures were markedly smaller. In addition, some punctate immunoreactivity was noted on the cell body of the keratinocytes (C). (B) In the gingival connective tissue, Cx43 immunoreactivity was also present as large plaque-like staining that mostly localized in the long cellular processes reaching out from the vimentin-positive cells (arrowheads). (D) In these cells, Cx43 HCs detected by the Cx43(E2) antibody were also mainly present as plaque-like structures that localized in the cell processes (arrowheads), but some staining was also present on the cell body (arrows). Representative immunostaining images from a minimum of three parallel sections from three individual donors are shown. Nuclear staining (blue) was performed using DAPI. E: Epithelium; CT: Connective tissue. Magnification bars = 10 μm.   135   Figure 3-2: Immunolocalization of Cx43 GJs and HCs in cultured human gingival fibroblasts. (A-C) Representative images from GFBL-DC cultures fixed and permeabilized with 0.5% Triton X-100 treatment before double immunostaining with antibodies against all forms of Cx43 (red) and ZO-1 (green), indicator of cell-cell contacts. Fibroblasts displayed numerous Cx43-positive plaque-like structures throughout the cell body. Some of these plaques colocalized with ZO-1 staining at apparent cell-cell contacts and over the cell body (arrowheads in A), likely representing GJ plaques. However, Cx43-positive structures that did not colocalize with ZO-1 (arrows) were also present. (D-F) Representative images of confluent GFBL-DC cultures fixed and permeabilized with 0.5% Triton X-100 treatment before double immunostaining with Cx43(E2) antibody specific for Cx43 HCs (red) and ZO-1 (green). Cx43 HCs were also organized in plaque-like structures present along the cell body, but they were not colocalized with ZO-1 present in the cell-cell contact areas (arrowheads in D). Some cells showed localization of ZO-1 in the nucleus consistent with its function also as a transcription factor. (G-I) Representative images of a confluent gingival fibroblast (GFBL-DC) culture fixed and then double immunostained with the Cx43(E2) (red) and ZO-1 (green) antibodies without permeabilization with 0.5% Triton X-100 to detect only cell surface-associated Cx43 HCs. In these cells, the Cx43(E2)-positive HC-plaques localized along the cell body, but their number was reduced compared to the permeabilized cells (D and E). No immunoreactivity for the intracellular ligand ZO-1 was detected as expected (I). Nuclear staining (blue) was performed using DAPI. Magnification bar = 10 μm.  136   Figure 3-3: The expression, abundance and distribution of Cx43 in high- and low-density cultures of human gingival fibroblasts. (A and B) Representative phase contrast images from human gingival fibroblasts (GFBL-DC) cultured at high-density (HD; 100% confluence, A) and low-density (LD; 10% confluence, B) conditions. Immunolocalization of Cx43-positive plaques in HD and LD cultures detected with an antibody that recognizes all Cx43 molecules (C, D, G and H), and with the Cx43 HC-specific Cx43(E2) antibody (E, F, I and J). (C-F) Cells were fixed and permeabilized with 0.5% Triton X-100 treatment before immunostaining. In HD (C) and LD (D), total Cx43 staining localized abundantly throughout the cells. 137  Cx43 HC plaques were markedly smaller than total Cx43 staining in both HD (C and E, respectively) and LD (D and F, respectively) cultures. In LD cultures, no Cx43 HC-specific immunoreactivity was noted in the long cell extensions (insert in F), while they contained plaques that were detected with the antibody against total Cx43 (insert in D). (G-J) Immunolocalization of Cx43-positive plaques with the total Cx43 (G and H) or Cx43(E2) antibody (I and J) in HD (G and I, respectively) and LD (H and J, respectively) cultures pretreated with 1% Triton X-100 for 10 min before fixation and immunostaining as above. In general, Triton X-100 pretreatment resulted in significant reduction in the amount of small Cx43-positive plaques (likely representing detergent soluble non-lipid raft and intracellular Cx43) as compared to non-pretreated samples (G-J and C-F, respectively). Immunostaining of the Triton X-100 insoluble fractions with the Cx43 antibody in HD (G) showed presence of large Cx43-positive plaques, likely representing lipid raft-associated Cx43 gap junction plaques (GJs), while the number of these plaques was markedly reduced in LD cultures (H). Immunostaining of the Triton X-100 insoluble fractions with the Cx43(E2) antibody in HD (I) and in LD (J) cultures revealed presence of few small- sized Cx43 non-lipid raft associated plaques in detergent insoluble fractions. Magnification bars = 10 m. (K) qPCR analysis of HD and LD cultures showed similar relative amount of Cx43 mRNA in both conditions. (L and M) Similarly, Western blotting showed that the total Cx43 protein abundance per cell was not affected by cell density. However, cells in HD cultures showed significantly higher levels of Cx43 phosphorylated at S262 (P2), and S279/282 and S256 (P1), previously associated with Cx43 present in GJs [39,40], as compared to LD cultures. In contrast, LD cultures had a significantly higher level of Cx43 phosphorylated at S368 (P0), corresponding to the previously described non-junctional (HC and intracellular) Cx43 pool [39,40]. Sample loading was normalized for -Tubulin levels. Results show mean ± SEM from three independent experiments. Statistical analysis was performed by Student’s t-test (*p<0.05, **p<0.01). (N) Western blotting analysis of distribution of Cx43 in 1% Triton X-100 (TX-100) insoluble (lipid raft-associated Cx43) and soluble (non-lipid raft and intracellular Cx43) fractions in HD cultures. Majority of Cx43 phosphorylated forms (P1 and P2) were associated with the Triton X-100 insoluble (lipid raft-associated) pool, while Triton X-100 soluble Cx43 was predominantly non-phosphorylated (P0). For adequate signal detection, sample loading in detergent soluble and insoluble fractions was increased relative to total.   138   Figure 3-4: Gingival fibroblasts have functional Cx43 GJs and HCs. (A) Confluent GFBL-DC cultures maintained in DMEM were scrape-loaded with Lucifer Yellow (green) in the presence of vehicle (dH2O) (a and b), a non-specific Cx inhibitor meclofenamic acid (MFA; 50 μM) (c), Gap27 control peptide (150 μM) (d and e), Cx43 mimetic peptide Gap27 (150 μM) (f), TAT-Gap19 control peptide (400 μM) (g and h), TAT-Gap19 (400 μM) (i), non-immune rabbit IgG (1 mg/mL) (j and k), or Cx43(E2) antibody (1 mg/mL) (l), and dye transfer via GJs was followed for 5 min. Treatment of cells with MFA (c) or Gap27 (f) markedly reduced dye transfer as compared to corresponding control samples (a and b or d and e, respectively), while TAT-Gap19 (i) or Cx43(E2) (l) had no effect, as expected. (B) Confluent GFBL-DC cultures incubated in DMEM (containing 1.8 mM Ca+2) (a) or low Ca+2-containing medium (EMEM supplemented with 180 nM Ca+2) (b) in the presence of Cx HC-permeable Propidium Iodide (PI; 2.5 mM, red) for 20 min. No dye uptake was noted in cells incubated in DMEM (a), while incubation of cells in EMEM potently induced dye uptake (b). (c-h) Fibroblasts were incubated in EMEM and treated with Gap27 control peptide (c) or Gap27 (150 μM) (d), TAT-Gap19 control peptide (e) or TAT-Gap19 (400 μM) (f), and non-immune rabbit IgG (g) or Cx43(E2) antibody (1 mg/mL) against Cx43 HCs (h). Gap27 (d), TAT-Gap19 (f), and Cx43(E2) antibody (h) potently blocked Cx HC-mediated dye uptake as expected. Results show representative images from a 139  minimum of three repeated experiments. For the experiments, cells were pretreated with the inhibitors or controls for 1 h before the experiments. Nuclear staining (blue) was performed using DAPI. Magnification bars in A = 30 μm (a, d, g and j) and 50 μm (b, c, e, f, h, i, k and l); in B = 20 μm.  140   Figure 3-5: Gap27 and TAT-Gap19 induce partially similar gene expression response in human gingival fibroblasts.  Confluent GFBL-DC cultures were treated with Gap27 or control peptide (150 μM), and TAT-Gap19 or control peptide (400 μM) for 24 h, and the expression of a set of genes involved in (A) wound healing and (B) regulation of cell cycle was analyzed by qPCR. Results represent mean ± SEM of amount of mRNA relative to control peptide-treated cells from a minimum of three repeated experiments. Statistical testing was performed by comparison of Gap27- or TAT-Gap19-induced gene expression change relative to the controls (*p<0.05, **p<0.01, ***p<0.001; two-tailed t-test). Horizontal line indicates relative amount of mRNA for the control peptide-treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A. 141   Figure 3-6: The expression of a set of genes in human gingival fibroblasts treated with increasing concentrations of TAT-Gap19 or Gap19 relative to control samples. Confluent GFBL-DC cultures were treated with (A) increasing concentrations of TAT-Gap19 (200, 400 and 500 μM) or control peptide (200, 400 and 500 μM), and (B) increasing concentrations of Gap19 (250 and 400 μM) or control peptide (250 and 400 μM) for 24 h, and expression of a set of genes involved in wound healing was analyzed by qPCR. Results represent mean ± SEM of mRNA amount relative to control peptide-treated cells from two repeated experiments. TN-C: Tenascin-C.   142   Figure 3-7: Western blotting analysis of activation of ERK1/2 of the MAPK pathway by Cx43 GJs and HCs in gingival fibroblasts. Confluent GFBL-DC cultures were treated with Gap27 or control peptide (150 μM) (A), and TAT-Gap19 or control peptide (400 μM) (C) for 1, 2, 6, and 24 h. Gap27 treatment was used as a positive control for signaling pathway activation. Cell lysates were analyzed for protein levels of total ERK1/2 and phosphorylated ERK1/2 (p-ERK1/2). (B and D) Quantitation of p-ERK1/2 abundance relative to its total levels at time 0 (control samples) and at 1, 2, 6, and 24 h after treatment. Sample loading was normalized for β-Tubulin levels. Results represent mean ± SEM of relative protein abundance from two repeated experiments.     143   Figure 3-8: Modulation of Gap27 and TAT-Gap19-regulated gene expression by pharmacological inhibitor of ERK1/2 signaling pathway. (A and B) Confluent cultures of GFBL-DC were treated with Gap27 (150 μM) (A), or with TAT-Gap19 (400 μM) (B) with or without MEK1/2 inhibitor (PD184352; 10 μM) for 24 h, and amount of mRNA for wound healing-associated genes was analyzed by qPCR. Results represent mean ± SEM of relative amount of mRNA from two repeated experiments in A, and three repeated experiments in B (*p<0.05, **p<0.01; two-tailed t-test). Horizontal line indicates relative mRNA expression for the control samples (vehicle-treated cells; 0.1% DMSO). TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; DCN: Decorin; FMOD: Fibromodulin; VEGF-A: Vascular Endothelial Growth Factor-A. 144   Figure 3-9: Blocking of ATP signaling pathway significantly modulates amount of mRNA for key wound healing-associated genes and activates of the ERK1/2 pathway.   (A) Results show qPCR analysis of relative amount of mRNA in confluent GFBL-DC cultures treated with apyrase (1 U/mL) relative to vehicle control (dH2O) for 24 h. Results represent mean ± SEM from a minimum of three repeated experiments (**p<0.01, ***p<0.001; two-tailed t-test). EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A. (B) Results show Western blotting analysis of ERK1/2 pathway activation in confluent GFBL-DC cultures that were treated with apyrase (1 U/mL) or vehicle control (dH2O) for 1, 2, 6, and 24 h. Cell lysates were analyzed for protein 145  levels of total ERK1/2 and phosphorylated ERK1/2 (p-ERK1/2). (C) Quantitation of p-ERK1/2 abundance relative to its total levels at time 0 (control sample) and at 1, 2, 6, and 24 h after treatment. Sample loading was normalized for β-Tubulin levels.  146   Figure 3-10: The expression of a set of genes in human gingival fibroblasts treated with TAT-Gap19 with or without apyrase relative to control samples. Confluent GFBL-DC cultures were treated with TAT-Gap19 (400 μM) with or without apyrase (1 U/mL) for 24 h, and expression of a set of genes involved in wound healing was analyzed by qPCR. Results represent mean ± SEM of mRNA amount relative to control peptide/vehicle treated cells from three parallel samples from one experiment. TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; VEGF-A: Vascular Endothelial Growth Factor-A.   147   Figure 3-11: The expression of a set of ATP and adenosine receptor signaling genes in human gingival fibroblasts treated with Gap27 or TAT-Gap19 relative to control samples. Confluent cultures of GFBL-DC were treated with Gap27 (150 μM) or TAT-Gap19 (400 μM) for 24 h, and amount of mRNA for set of ATP and adenosine receptor genes was analyzed by qPCR. Results represent mean ± SEM of relative amount of mRNA from a minimum of three repeated experiments (**p<0.01, ***p<0.001; two-tailed t-test). ADA: adenosine deaminase.   148  Chapter 4: Connexin 43 Regulates the Expression of Wound Healing-Related Genes in Human Gingival and Skin Fibroblasts3 4.1 Introduction   Fibroblasts are a heterogeneous and abundant group of connective tissue cells. Such cells play a key role in wound healing and scar formation by regulating ECM production and remodeling, inflammation, angiogenesis and reepithelialization [Häkkinen et al., 2012; Greaves et al., 2013; Leavitt et al., 2016]. Accumulating evidence indicates that the outcome of a wound may depend on the phenotype of the fibroblasts in a given tissue. For example, gingiva, which is characterize by fast and significantly reduced scar-forming wound healing as compared to skin [Szpaderska et al., 2003; Mak et al., 2009, Wong et al., 2009, Larjava et al., 2011; Glim et al., 2014], harbors fibroblasts with a phenotype and regenerative potential that is distinct from adult skin fibroblasts [Nishi et al., 2010; Glim et al., 2014; Häkkinen et al., 2014]. Human gingival fibroblasts (GFBLs) display a gene expression pattern that is less pro-fibrotic than do skin fibroblasts (SFBLs) [Glim et al., 2013; Mah et al., 2014; Mah et al., 2017]. GFBLs also migrate faster into the early provisional wound matrix and degrade it quicker than SFBLs, another factor which may contribute to efficient gingival wound healing [Lorimier et al., 1998]. Some suggest that this difference in GFBLs and SFBLs may derive from their different developmental origins. Most of GFBLs may originate from neural crest. In contrast, fibroblasts in trunk and limb dermis derive from somites and lateral plate mesoderm [Xu et al., 2013; Häkkinen et al., 2014; Leavitt et                                                  3 A version of this chapter has been conditionally accepted for publication. Rana Tarzemany, Guoqiao Jiang, Jean X. Jiang, Corrie Gallant-Behm, Colin Wiebe, David A. Hart, Hannu Larjava, Lari Häkkinen. Connexin 43 Distinctly Regulates the Expression of Wound Healing-Related Genes in Human Gingival and Skin Fibroblasts.   149  al., 2016; Thulabandu et al., 2017]. Thus, the distinct phenotypic properties of GFBLs and SFBLs may underlie the different wound healing outcomes in these tissues.  Connexins (Cxs) are a family of 21 transmembrane proteins that play an integral role in wound healing [Sutcliffe et al., 2015]. However, very little is known regarding their expression and function in GFBLs compared to SFBLs in vivo or in vitro. Each Cx protein contains four transmembrane domains with two extracellular loops, one cytoplasmic loop, and N- and C-terminal intracellular domains.  Assembly of six Cx subunits forms a hemichannel (HC), establishing a conduit for the transfer of small ions and signaling molecules between the cell cytosol and the extracellular environment. Head-to-head docking of two HCs from neighboring cells forms a gap junction (GJ), which provides direct cell-to-cell contact for communication via the exchange of small (< 1 kDa) molecules [Kar et al., 2012; Iyyathurai et al., 2013]. Typically, Cx GJs and HCs cluster in large plaques on cell membranes, and these plaques can be detected by immunostaining [Lauf et al., 2002; Brandner et al., 2004; Tarzemany et al., 2017].  In general, channel functions of both HCs and GJs are regulated by similar factors although, interestingly, they are often affected in opposing manners. For example, while increased levels of inflammatory cytokines, elevation of intracellular Ca2+ concentration or oxidative stress promote the opening of HCs during wound healing or ischemia, they may also induce closure of GJs [Schalper et al., 2012; Iyyathurai et al., 2013]. Cx HCs and GJs also distinctly regulate various cell functions including proliferation, migration, death, survival, wound healing, and gene expression [Burra et al., 2011]. Cxs can also regulate gene expression, cell adhesion, migration, and apoptosis through functions that are not related to the Cx channel functions, but instead involve interactions of Cx43 cytoplasmic domains with other cytoplasmic signaling molecules. These channel-independent functions of Cxs are still not completely 150  understood [Jiang and Gu, 2005; Nielsen et al., 2012; Zhou and Jiang, 2014].  Cx43 is the most ubiquitous Cx in skin and gingiva, and its expression is dynamically regulated during wound healing in these tissues.  In skin, Cx43 also regulates the wound healing process [Tarzemany et al., 2015; Cogliati et al., 2016]. For instance, compared to normal skin, Cx43 is strongly downregulated in the epidermis during wound re-epithelialization [Goliger and Paul, 1995; Coutinho et al., 2003]. In wounded mouse dermis, Cx43 abundance is also markedly reduced in hair follicles while it is upregulated in blood vessels [Coutinho et al., 2003]. Cx43 is also, in general, upregulated in the dermis in non-healing diabetic human and rat skin wounds compared to non-diabetic wounds [Mendoza-Naranj et al., 2012]. Interestingly, transient blocking of Cx43 expression or function during the early stages of wound healing accelerates wound re-epithelialization and granulation tissue formation in skin in various wound healing models [Kretz at al., 2003 and 2004; Coutinho et al., 2005; Ghatnekar et al., 2009 and 2015; Grek et al., 2015]. In addition, blocking Cx43 function reduces dermal scar formation in rodent models [Ghatnekar et al., 2009; Soder at al., 2009; Ongstad et al., 2013]. In a recent study, immediate or early application of ACT1 (synthetic peptide mimicking the Cx43 C-terminus) gel to human laparoscopic incisional wounds significantly improved scar pigmentation, thickness, and surface roughness as compared to untreated wounds, likely by inhibiting ZO-1 association with endogenous Cx43 [Grek et al., 2017]. Therefore, early down regulation of Cx43 function or expression may be beneficial for wound healing and suppress scar formation.   In gingival wound healing, the abundance of Cx43 is strongly reduced in the epithelium and fibroblasts during the early stages of wound healing [Tarzemany et al., 2015]. Furthermore, selective blockage of Cx43 HCs or GJs by mimetic peptides resulted in a distinct upregulation of anti-fibrotic genes and a downregulation of pro-fibrotic genes in cultured GFBLs, and this 151  response was mainly mediated by Cx43 HCs [Tarzemany et al., 2017].  Thus, reduced Cx43 HC function may be important for fast and relatively scar-free gingival wound healing.  Given that GFBLs and SFBLs have distinct phenotypic properties that may underlie the wound healing outcomes, it is possible that the expression and/or function of Cx43 is also different in these two cell types.  Therefore, the aim of the present studies was to first characterize Cx43 HCs and GJs in human GFBLs and SFBLs in vivo. By using a well-established three-dimensional (3D) cell culture model that mimics wound healing [Iyer et al., 1999; Beacham et al., 2007; Walmsley et al., 2015; Kaukonen et al., 2017], we compared the function of Cx43 HCs and GJs in GFBLs and SFBLs. We hypothesized that SFBLs and GFBLs display distinct phenotypes regarding expression and/or function of Cx43, and that this may partly contribute to the different wound healing outcomes in skin and gingiva. 4.2 Materials and Methods 4.2.1 Human Tissue Samples   Palatal gingival tissue samples were obtained from three healthy individuals (26-, 27-year-old females and a 48-year-old male) and processed for frozen sectioning as described previously [Tarzemany et al., 2015]. Frozen tissue sections from normal human breast (from two 31-year-old female donors) and abdominal (from a 55-year-old male donor) skin of healthy subjects were obtained from Origene Technologies Inc. (Rockville, MD). For the study, a minimum of three tissue sections from each subject was analyzed. 4.2.2 Pig Tissue Samples  Skin and palatal gingival tissue samples were obtained from juvenile female red Duroc pigs (Neufeld Farm, Acme, AB, Canada) as described previously [Mak et al., 2009]. Briefly, 152  three parallel palatal gingival and dorsal skin tissue samples were collected from three pigs, immediately frozen in liquid nitrogen, and used for total RNA isolation and quantitative real-time RT-PCR (qPCR) as described previously [Mah et al., 2017]. 4.2.3 Cell Culture  Primary human skin fibroblasts (SFBLs; five strains from different donors) from clinically healthy human breast were obtained from PromoCell (Heidelberg, Germany). Primary human gingival fibroblasts (GFBLs; five strains from different donors) were isolated as previously described [Häkkinen et al., 1994] from attached gingiva of clinically healthy human donors (Table 4-1). Cells were routinely maintained in Dulbecco’s Modified Eagle’s medium (DMEM), supplemented with 1% antibiotic/antimycotic and 10% fetal bovine serum (FBS) (Gibco Life Technologies, Inc., Grand Island, NY, USA) at 37oC and 5% CO2, and seeded for experiments when they reached about 95% confluence. Experiments were performed at passages 5 to 10. To generate three-dimensional (3D) in vivo-like cultures [Beacham et al., 2007], cells (42,000 cells/cm2) were seeded and cultured for 24 h, followed by incubation in the above medium supplemented with 50 μg/ml of ascorbic acid up to 14 days, with medium changes every other day [Mah et al., 2014]. The cultures were serum-starved for 24 h prior to analyses or further treatment (see below).  4.2.4 Ethics Statement  Tissue donors provided written informed consent. All procedures were reviewed and approved by the Office of Research Ethics of the University of British Columbia, and comply with the 1975 Declaration of Helsinki. All animal procedures were reviewed and approved by the Animal Care Committee of the Faculty of Medicine, University of Calgary (Calgary, AB, Canada; protocol number M03037.M08025, 2009). 153  4.2.5 Immunostaining   Human frozen tissue sections and fibroblasts grown on gelatin-coated glass coverslips in 24-well plates were fixed and immunostained as described previously [Mah et al., 2014; Tarzemany et al., 2015]. Cx43 and Cx43(E2) antibodies were used to localize all Cx43 molecules and Cx43 located on cell surface only, respectively. Antibodies against vimentin and ZO-1 were used to identify fibroblasts and cell-cell contact areas, respectively. All antibodies used are listed in Supplemental Table S2. Images were acquired using optical sectioning at 1 μm (ECLIPSE 80i Microscope; Nikon, Tokyo, Japan), and are presented as z-stacks created by the NIS-Elements BR software (Nikon). Control staining was performed by omitting the primary antibodies used in the study. Cx43-positive plaques were quantified from a minimum of 100 cells per culture from five standardized microscopic fields which were derived from three parallel samples using Fiji software [Schindelin et al., 2012; http://fiji.sc/]. The analyses were replicated in two independent experiments. A threshold was set to detect Cx43-positive plaques with minimal background noise, and it remained the same for all images. 4.2.6 Quantitative Real-Time RT-PCR (qPCR)  qPCR analysis was performed according to MIQE guidelines [Bustin et al., 2009] as we have described in detail previously [Tarzemany et al., 2015]. The primers used for qPCR and reference genes are listed in Table 4-3. Amplification reactions for qPCR were performed using the CFX96 System (Bio-Rad). For a given experiment, at least two reference genes were chosen [Liu et al., 2015]. Non-transcribed RNA samples were used as a negative control. The qPCR reactions were performed in triplicate for each sample. The data was analyzed and is presented based on the comparative Ct method (CFX Manager Software Version 2.1, Bio-Rad).  154  4.2.7 Western Blotting  SFBLs and GFBLs were lysed and collected at day-7 post-seeding as described previously [Mah et al., 2014]. Western blotting was performed with the antibody against total Cx43 (Table 4-2). β-Tubulin was used as a loading control.  Intensity of the protein bands was quantified using ImageJ software version 1.51h (NIH, Bethesda, MD; http:// imagej.nih.gov/ij). 4.2.8  Modulation of Cx43 GJ and HC Function   GFBLs and SFBLs were grown on 6-well plates as described above. At day-6 post-seeding, cells were serum-starved for 24 h, and then treated with Gap27 (150 μM; SRPTEKTIFII; Biomatik, Cambridge, ON, Canada) which blocks Cx43 GJ and HC functions [Chaytor et al., 1997; Hawat et al., 2012; Wang et al., 2013], or TAT-Gap19 peptide (400 μM; YGRKKRRQRRR-KQIEIKKFK; LifeTein, Somerset, NJ, USA) which specifically blocks Cx43 HCs without affecting GJs [Wang et al., 2013; Abudara et al., 2014]. Control samples were treated with a scrambled control Gap27 peptide (TFEPDRISITK; Biomatik) [Wright et al., 2012], or a mutated, function-deficient control TAT-Gap19 peptide (YGRKKRRQRRR-KQAEIKKFK; LeifTein) [Wang et al., 2013], respectively.  4.2.9 Dye Transfer Experiments   Fibroblasts were grown on glass coverslips as described above, and then serum-starved in DMEM for 24 h. To assess the GJ function of Cx43, cells were preincubated with Gap27 (150 μM), TAT-Gap19 (400 μM), or with the corresponding control peptides in DMEM at 37oC for 1 h. Medium was then removed, cells were scrape-loaded with 0.5% Lucifer Yellow (Molecular Probes Inc., Eugene, OR, USA) for 5 min, and then rinsed and fixed as described previously [Tarzemany et al., 2015].  To assess the HC function of Cx43, cells were preincubated in their normal growth 155  medium (DMEM; containing 1.8 mM Ca2+), or in EMEM (Lonza, Walkersville, MD, USA) supplemented with 180 nM Ca2+ (low calcium medium) to induce the opening of Cx HCs [Wang et al., 2013], with or without Gap27, TAT-Gap19, or corresponding controls, as above for 1 h. Cultures were then treated in the respective media with the inhibitors or controls, and Propidium Iodide (2.5 mM; Sigma-Aldrich) for 20 min.  4.2.10 Statistical Analysis  The data is presented as mean ± standard error of the mean (SEM) from a minimum of three biological replicates, unless otherwise indicated. Statistical analysis was performed by using two-tailed t-test; p<0.05 was considered statistically significant. Values obtained from the qPCR by the comparative Ct-method were Log2 transformed for statistical testing [Rieu and Powers, 2009]. 4.3 Results 4.3.1 Human Gingival Fibroblasts and Epithelial Cells Show Abundant Immunostaining of Cx43 HCs Compared to Skin in vivo.  To compare the abundance of Cx43 in skin and gingiva, we first assessed the expression of Cx43 mRNA in paired samples from normal dorsal skin and attached palatal gingiva from three separate red Duroc pigs. The tissue structure and wound healing response in the skin and gingiva of these animals closely resembles that of the corresponding human tissues [Gallant-Behm et al., 2005; Ramos et al., 2008; Wong et al., 2009]. Findings showed that expression of Cx43 mRNA in skin was 4-fold (p<0.033, Student’s t-test) higher than in gingiva. To investigate the localization of Cx43, tissue sections obtained from human gingiva and skin were immunostained using an antibody that recognizes intracellular, GJ- and HC-associated Cx43 (total Cx43) [Sosinsky et al., 2007; Solan and Lampe, 2009], or with an antibody that detects only the cell 156  surface HC-associated Cx43 [Cx3(E2); Siller-Jackson et al., 2008; Kar et al. 2013]. Consistent with our previous findings [Tarzemany et al., 2015 and 2017], in gingival epithelium, total Cx43 staining was localized to cell-cell contact areas of keratinocytes, with stronger immunoreactivity at the basal and spinous layers and a less abundant staining at the upper layers (Figure 4-1 A and B, respectively). In contrast, HC-specific Cx43(E2) staining was present only in the basal and spinous epithelial layers (Figure 4-1 D), with no immunoreactivity observed at the upper layers (Figure 4-1 E). Staining of Cx43 plaques with the antibody against total Cx43 detected markedly more plaques in the basal and spinous layers of the epithelium than the Cx43(E2) antibody against Cx43 HCs (Figure 4-1 A and D, respectively).   Using both antibodies against total Cx43 (Figure 4-1 C) or Cx43 HCs (Figure 4-1 F) fairly large plaque-like structures were also detected in GFBLs as identified by double-immunostaining for vimentin. The most notable staining with both Cx43 antibodies was associated with long fibroblast processes (inserts in Figure 4-1 C and F). Unlike in the epithelium that showed more abundant staining for total Cx43 than Cx43 HCs, the density of the Cx43 plaques stained with both of the antibodies appeared relatively equal in GFBLs.   In dermal epithelium, a very intense immunoreactivity against total Cx43 was observed at the upper layers, with markedly less abundant staining in the basal and spinous layers (Figure 4-1 G). In contrast to the gingival epithelium, skin epidermis contained few Cx43 HCs located in the superficial layers, while the basal and spinous layers were largely negative (Figure 4-1 I).   Similar to findings with GFBLs (Figure 4-1 C and insert), total Cx43-positive plaques were present and located mainly on the long processes of SFBLs (Figure 4-1 H and insert). However, in contrast to observations with GFBLs (Figure 4-1 F), Cx43 HC plaques were almost totally absent from SFBLs (Figure 4-1 J), and when present, were localized along the fibroblast 157  processes as in the GFBLs (insert in Figure 4-1 J).  Taken together, expression of Cx43 mRNA in skin is significantly higher than in gingiva. In GFBLs in vivo, the density of total Cx43 and Cx43 HC plaques are relatively similar, suggesting that the majority of Cx43 plaques contain Cx43 HCs. In contrast, SFBLs show abundant immunoreactivity for total Cx43, while they possess only very few Cx43 HC plaques. Similarly, skin epidermis shows a stronger total Cx43 staining and fewer Cx43 HC plaques, especially in the basal and spinous layers of the epithelium, compared to the gingival epithelium. In both gingival and skin epithelium, the number of Cx43 positive plaques detected by the total Cx43 antibody is markedly higher than those detected by the HC-specific Cx43(E2) antibody, suggesting that Cx43 HCs comprise a minor proportion of total Cx43 found in both epithelia. 4.3.2 Skin Fibroblasts Express Increased Amount of Cx43 Protein but Possess Fewer Cx43 HCs than Gingival Fibroblasts in 3D Cultures.   Having established that SFBLs abundantly display total Cx43-positive plaques, but have very few Cx43 HCs compared to GFBLs in vivo, we wanted to compare expression and abundance of Cx43 by these cells in vitro. To this end, a well-established in vivo-like three-dimensional (3D) cell culture model was used. In this model, fibroblasts are initially cultured as a high density monolayer which are then stimulated with serum and ascorbic acid to proliferate, express a transcriptome similar to that observed during wound healing, and produce a multilayered 3D ECM over time, a situation that mimics connective tissue wound healing [Iyer et al., 1999; Beacham et al., 2007; Walmsley et al., 2015; Kaukonen et al., 2017]. In addition, cells become embedded in their own cell type-specific extracellular matrix, allowing them to interact with the 3D matrix using similar cell adhesion receptors found in vivo [Cukierman et al., 2001; Cukierman et al., 2002; Green and Yamada 2007; Yamada and Cukierman, 2007; Pouyani 158  et al., 2012; Kimlin et al., 2013; Kaukonen et al., 2017]. We have previously shown that GFBLs and SFBLs display distinct tissue-specific phenotypes in this model [Mah et al., 2014 and 2017]. Using five parallel GFBL and SFBL strains, the expression of key Cxs previously found in fibroblasts (Cx32, Cx37, Cx40, Cx43, and Cx45) were assessed by qPCR. As expected, based on mRNA levels, Cx43 was the major Cx detected in both GFBLs and SFBLs at day-3 post-seeding (Figure 4-2 A). In addition, both cell types expressed low levels of Cx45, while expression of Cx32, Cx37 and Cx40 was negligible (Figure 4-2 A). During propagation of the 3D cultures, SFBLs showed a time-dependent and significant increases in Cx43 expression from day-3 to -14 post-seeding (Figure 4-2 B). However, no significant differences were detected in the levels of Cx43 mRNA between GFBLs and SFBLs at any time point studied (Figure 4-2 A and B). Interestingly, at day-7 post-seeding, when the 3D architecture of the cultures was well established [Beacham et al., 2007; Mah et al., 2014], SFBLs produced significantly higher levels of Cx43 protein compared to GFBLs (Figure 4-2 C and D).  To study in more detail the abundance and localization of Cx43 in the 3D cultures, we performed Western blotting for total Cx43 and immunostaining for Cx43 using the antibodies against total and HC-associated Cx43 in GFBLs and SFBLs at 3-, 7- and 14-days post-seeding. Double-immunostaining with ZO-1 was performed to indicate the cell-cell contacts where GJs are formed [Thévenin et al., 2013] (Figure 4-2 E). Consistent with our previous findings from GFBLs [Tarzemany et al., 2017], immunostaining showed few plaques that were positive for total Cx43 antibody and colocalized with ZO-1, likely representing GJ plaques at cell-cell contacts, were detected in both GFBLs and SFBLs (Figure 4-2 E; a-f). The observation that the majority of these Cx43-positive plaques did not colocalize with ZO-1 suggests that they represented intracellular and/or HC-associated Cx43 (Figure 4-2 E; a-c). As reported previously 159  for GFBLs [Tarzemany et al., 2017], Cx43(E2)-positive HC plaques were present and located throughout the cell body for both GFBLs and SFBLs. As expected, they did not colocalize with ZO-1-positive cell-cell contacts (Figure 4-2 E; g-l). Quantification of immunostaining indicated that almost equal number of plaques were stained with the antibodies against total Cx43 and Cx43 HCs in GFBLs (Figure 4-2 F). Thus, in GFBL 3D cultures, most Cx43 assembles into HCs and GFBLs possess only few Cx43 GJs.   When compared to GFBLs, SFBLs displayed somewhat elevated numbers of total Cx43-positive plaques and these differences were most apparent at day-7 and -14 post-seeding (Figure 4-2 F). However, SFBLs showed markedly fewer Cx43 HCs at day-3 and -7 post-seeding than did GFBLs (Figure 4-2 F). As a result, the plaques stained with the total Cx43 antibody significantly outnumbered the Cx43 HCs at day-3, -7, and -14 post-seeding in SFBLs (Figure 4-2 F). Therefore, unlike in GFBLs, only a small proportion of the SFBL Cx43 assembled into HC plaques in SFBLs. The number of these Cx43 HCs in SFBLs increased significantly over time, reaching levels similar to those of GFBLs at day-14 post-seeding (Figure 4-2 F). Taken together, both GFBLs and SFBLs express Cx43 as their major Cx. In 3D cultures, expression of total Cx43 protein was significantly higher in SFBLs than in GFBLs. Similar to findings in normal skin and gingiva in vivo, 3D cultures of SFBLs possessed significantly fewer Cx43 HCs, while they were abundant in GFBLs at day-3 post-seeding. During propagation of the 3D cultures over time, mimicking wound healing, the number of Cx43 HCs in SFBLs increased reaching the levels detected in GFBLs at day-14 post-seeding. 4.3.3 Gingival and Skin Fibroblasts Possess Functional Cx43 GJs and HCs.    We have previously shown that cultured GFBLs have functional Cx43 GJs and HCs [Tarzemany et al., 2015 and 2017].  Having established that SFBLs also possess both Cx43 GJs 160  and HCs, we wanted to also evaluate their functionality. To assess the Cx43 GJ function, GFBLs and SFBLs were cultured for three days as above, scrape-loaded with Lucifer Yellow and dye transfer was followed for 5 min, as described previously [Tarzemany et al., 2017]. Both GFBLs and SFBLs showed potent dye transfer that extended several cells away from the scratch wound edge indicating that they possess functional GJs (Figure 4-3 A; a, b, d, e and g, h, j, k, respectively). To confirm whether the dye transfer occurred via Cx43 GJs, cells were pretreated with Gap27, a Cx43 mimetic peptide that binds to the Cx43 extracellular loop and specifically blocks its GJ and HC functions [Chaytor et al., 1997; Hawat et al., 2012]. Gap27 treatment effectively blocked dye transfer in both GFBLs and SFBLs indicating that it was mediated by Cx43 (Figure 4-3 A; c and i, respectively). As expected, treatment of cells with TAT-Gap19 peptide, which specifically blocks Cx43 HC functions without affecting GJs [Siller-Jackson et al., 2008; Abudara et al., 2014], did not affect dye transfer in either GFBLs or SFBLs (Figure 4-3 A; f and i, respectively).   To assess Cx43 HC function, the above cultures were incubated in low Ca2+-containing medium (180 nM Ca2+) to induce the opening of Cx HCs, and then treated with HC-permeable Propidium Iodide (PI) [Schalper et al., 2008]. HC-mediated dye transfer was assessed after 20 min using fluorescence microscopy as described previously [Tarzemany et al., 2017]. Both GFBLs and SFBLs showed avid PI uptake when kept in low Ca2+-containing medium (Figure 4-3 B; d and j). As expected, dye transfer was effectively blocked when cells were incubated with high Ca2+-containing medium (1.8 mM Ca2+) (Figure 4-3 B; a and g) that maintains Cx HCs in a closed state. Treatment of cells kept in low Ca2+-containing medium with Gap27 (Figure 4-3 B; e and k) or TAT-Gap19 (Figure 4-3 B; f and l) resulted in complete blockage of PI uptake as compared to treatments with corresponding control peptides (Figure 4-3 B; b, h and c, i, 161  respectively). Thus, human GFBLs and SFBLs display functional Cx43 GJs and HCs that can be blocked with Gap27. TAT-Gap19 effectively blocked Cx43 HC function without affecting GJs in both cell types. 4.3.4 A Set of Wound Healing-Associated Genes is Distinctly Regulated via Cx43 GJs and HCs in Gingival and Skin Fibroblasts.   Using standard 2D cultures, we have previously shown that Gap27 and TAT-Gap19 significantly regulate expression of a set of wound healing-associated genes in GFBLs, suggesting that Cx43 GJs and HCs play a role in the cell phenotype [Tarzemany et al., 2015 and 2017]. To explore this further using 3D cultures that better mimic the skin in vivo, we next compared gene expression of the previously validated set of wound healing-associated genes [Mah et al., 2014; Tarzemany et al., 2015 and 2017] in response to Gap27 and TAT-Gap19 treatment in GFBLs and SFBLs. To this end, cells were maintained in 3D cultures for seven days, treated with Gap27 (150 μM) to block both Cx43 GJs and HCs or TAT-Gap19 (400 μM) to block Cx43 HCs only for 24 h, and gene expression assessed by qPCR. At this time point, SFBLs expressed significantly higher levels of Cx43 proteins, but had a markedly lower abundance of Cx43 HCs than GFBLs (Figure 4-2 C-F). Results showed that compared to controls, both Gap27 and TAT-Gap19 treatments significantly increased the expression of 10 of the 25 genes analyzed in RNA from GFBLs (MMP-1, -3, -10, TIMP-1, Tenascin-C, TGF-β1, TGF-β3, VEGF-A, Cx43, and Cadherin-2). The expression of seven of these 10 genes (MMP-1, -3, -10, Tenascin-C, VEGF-A, Cx43, and Cadherin-2) was significantly more potently upregulated by TAT-Gap19 compared to Gap27 treatment (Figure 4-4 A). Five other genes (TIMP-3, Collagen type I, NMMIIB, NAB1, and CXCL12) were significantly regulated only by TAT-Gap19 (Figure 4-4 A). In contrast, two genes (TIMP-4 and Collagen type III) were 162  significantly regulated only by Gap27 treatment. Neither of the peptide treatments had a significant effect on eight of the genes assessed (MMP-14, TIMP-2, EDA-FN, EDB-FN, α-SMA, Decorin, Fibromodulin, and Cx45) (Figure 4-4 A).   When compared to controls, only four (MMP-1, -3, -10, and VEGF-A) out of the above 25 genes were significantly increased by both Gap27 and TAT-Gap19 treatments in SFBLs (Figure 4-4 B). Further analysis showed that eight of the studied genes (TIMP-3, Collagen type I, EDA-FN, EDB-FN, NMMIIB, Decorin, Fibromodulin, and CXCL12) showed a different response to the two peptide treatments in SFBLs (Figure 4-4 B). Among these genes, EDB-FN was significantly upregulated only by the Gap27 treatment. Out of the remaining seven genes, two (TIMP-3 and EDA-FN) were significantly upregulated, and five (Collagen type I, NMMIIB, Decorin, Fibromodulin, and CXCL12) were downregulated, by TAT-Gap19, while Gap27 had no effect (Figure 4-4 B). Out of the 25 genes analyzed, 13 genes (MMP-14, TIMP-1, -2, -4, Collagen type III, Tenascin-C, α-SMA, TGF-β1, TGF-β3, NAB1, Cx43, Cx45, and Cadherin-2) did not show significant expression changes in response to either of the peptide treatments in SFBLs (Figure 4-4 B). This indicates that the expression of these genes is not under the control of Cx43 GJs or HCs in SFBLs in this model. Findings from a set of additional experiments showed that for the genes that responded to the Gap27 and TAT-Gap19 treatments, the responses were concentration-dependent from 50 μM up to 300 μM, and from 400 μM up to 600 μM, respectively (Figure 4-5). Therefore, the expression of a set of wound healing-related genes is distinctly regulated by Gap27 and TAT-Gap19 in GFBLs and SFBLs (Figure 4-4 and Table 4-4). 4.3.5 Gap27 and TAT-Gap19 Treatments Distinctly Modulate Expression of a Set of Wound Healing-Associated Genes in Human Gingival Compared to Skin Fibroblasts.   Next, we wanted to evaluate the effect of each peptide treatment on GFBLs and SFBLs to 163  compare the response patterns. To this end, we compared the gene expression fold-changes induced by Gap27 (Figure 4-6 A) or TAT-Gap19 (Figure 4-6 B) relative to corresponding control peptide-treated samples between GFBLs and SFBLs. MMP3 was the only gene that was significantly upregulated by TAT-Gap19 in both GFBLs and SFBLs (Figure 4-4 A and B), and which showed a significantly more pronounced upregulation in GFBLs compared to SFBLs (Figure 4-6 B). Out of the remaining 24 genes studied, expression of three genes (TGF-β1, TGF-β3, and Cx43) was significantly higher after treatment with both Gap27 (Figure 4-6 A) and TAT-Gap19 (Figure 4-6 B) in GFBLs compared to SFBLs, as only GFBLs responded to the treatments. Likewise, two genes (TIMP-1 and Cadherin-2) showed increased expression in response to TAT-Gap19 treatment in GFBLs, but not in SFBLs (Figure 4-6 B). Decorin was the only gene that was significantly downregulated in SFBLs compared to GFBLs by TAT-Gap19, because only SFBLs responded to the treatment (Figure 4-6 A). Thus, the expression of the above seven genes (MMP-3, TIMP-1, TGF-β1, TGF-β3, Cx43, Decorin, and Cadherin-2) was significantly influenced by TAT-Gap19 in GFBLs compared to SFBLs. Three of the above seven genes (TGF-β1, TGF-β3, and Cx43) were also potently regulated by Gap27 in GFBLs, but not in SFBLs. Therefore, the phenotype of GFBLs was more potently regulated by Gap27 and TAT-Gap19 than SFBLs. 4.4 Discussion  GFBLs and SFBLs from normal tissue display distinct phenotypes, and this may contribute to the different wound healing outcomes in these two tissues [Mak et al., 2009; Wong et al., 2009; Glim et al., 2013; Mah et al., 2014 and 2017]. The expression and function of Cx43 is also an important modulator of wound healing [Cogliati et al., 2016]. We have shown that in human gingiva, fibroblasts and keratinocytes assemble Cx43 into both GJ and HC plaques in vivo 164  [Tarzemany et al., 2015 and 2017]. Findings from other human studies have also shown the presence of Cx43 GJs in skin keratinocytes in vivo [Brandner et al., 2004]. However, it is not known whether these two tissues distinctly express Cx43 GJs and HCs. Findings from the present studies demonstrated that, similar to the gingival tissue [Tarzemany et al., 2017], Cx43 assembles into GJ and HC plaques in human skin epithelium and connective tissue fibroblasts in vivo. However, gingiva and skin showed marked differences in the abundance of Cx43. Based on analysis of pig tissue samples that contained both epithelium and connective tissue, skin expressed significantly higher levels of Cx43 mRNA than did gingiva. Cx43 immunostaining was also greater in the human skin epidermis compared to gingival epithelium. More specifically, in skin epidermis total Cx43-posivite plaques were most abundant at the upper epidermal layers with notably less staining in the basal and spinous layers, which is consistent with previous findings [Brandner et al., 2004]. Cx43(E2) staining, on the other hand, showed very few and weakly positive Cx43 HC plaques at the spinous and upper epithelial layers, while the basal layer was negative. Therefore, in the skin epidermis, Cx43 forms mainly GJ plaques and only few HCs are present and localize to the suprabasal layers. In contrast to the epidermis, in gingival epithelium, Cx43 was assembled into distinct GJ and HC plaques at the basal and spinous layers. However, the upper keratinocytes presented only Cx43-positive GJs and no HCs. Thus, human skin epithelium possesses markedly greater abundance of total Cx43-positive plaques, but few Cx43 HCs as compared to gingival epithelium. The different localization of total Cx43 and Cx43 HCs into basal and suprabasal layers in gingival and skin epithelium, respectively, suggests that Cx43 plays distinct roles in keratinocyte differentiation and function in these two tissues. Cx43 expression and GJ formation modulates keratinocyte differentiation in organotypic cultures and during fetal development [Wiszniewski et al., 2000; Arita et al., 2002; 165  Langlois et al., 2007], but the role of Cx43 HCs in this process and in other keratinocyte functions is poorly understood.  In connective tissue, Cx43 was also present in SFBLs and GFBLs in vivo, with total Cx43-positive plaques localized on the cell body and processes. Interestingly, however, Cx43 HCs were almost totally absent in SFBLs, while in GFBLs their abundance appeared similar to the plaques stained with the total Cx43 antibody. Therefore, GFBLs appear to mainly contain Cx43 HCs, while in SFBLs Cx43 plaques may represent mostly GJs in vivo. Findings from our dye transfer experiments have shown that fibroblasts residing in intact human skin likely communicate with each other through the GJs although the identity of the Cxs involved remained unknown [Salomon et al., 1988]. As Cx43 is the major Cx in SFBLs and GFBLs, it is likely that it also plays a key role in gap junctional intercellular communication (GJIC) in these tissues in vivo. In any case, it is intriguing that SFBLs largely lacked Cx43 HCs while they were abundant in GFBLs in vivo. Clearly, the functional role of Cx43 HCs in skin and gingival connective tissue, like in the epithelium, needs further clarification. The functional significance of the higher abundance of Cx43 HCs in normal gingival epithelium and fibroblasts as compared to skin may relate to the relatively high tissue turnover rate in gingival epithelium and connective tissue compared to skin [Glim et al., 2013]. In addition, unlike skin, healthy gingiva is characterized by a subclinical inflammation [Cekici et al., 2014] that may be important for the defense against oral microbes. It is well established that Cx43 HCs play a key role in the inflammatory response [Willebrords et al., 2016], but their role in gingiva has remained unexplored.   In any case, there is strong evidence that Cx43 plays an important role in wound healing [Ongstad et al., 2013; Lorraine et al., 2015] and distinct expression or function of Cx43 in gingiva and skin may contribute to different wound healing outcomes in these tissues. Our 166  previous findings have shown that while abundance of total Cx43 is strongly downregulated in GFBLs during the early inflammatory and granulation tissue formation stages of gingival wound healing, there is a gradual increase in Cx43 abundance at the matrix deposition and remodeling stages of healing when the fibroblasts have fully populated the wound area and inflammation has subsided [Tarzemany et al., 2015]. Furthermore, a transient downregulation of Cx43 expression or function at the early stages of wound healing promotes skin wound closure and reduces scaring [Ongstad et al., 2013; Lorraine et al., 2015]. Therefore, to compare Cx43 expression and function in GFBLs and SFBLs in relation to wound healing, we used five cell lines of human GFBLs and SFBLs in a 3D culture model, which mimics the matrix deposition and remodeling stages of wound healing better than the traditional 2D cultures [Iyer et al., 1999; Cukierman et al., 2001; Cukierman et al., 2002; Green and Yamada 2007; Pouyani et al., 2012; Walmsley et al., 2015; Kaukonen et al., 2017]. In this model, Cx43 was the major Cx expressed by both GFBLs and SFBLs, and it formed functional GJs and HCs in both cell types. While GFBLs and SFBLs did not show significant differences in Cx43 mRNA expression, SFBLs produced significantly higher levels of total Cx43 protein. This suggests that posttranscriptional Cx43 processing and turnover is likely distinctly regulated in SFBLs and GFBLs. In many cell types, Cx43 turnover is fast, and involves several mechanisms that modulate its biosynthesis, transport and assembly in the cell membrane, endocytosis, degradation and recycling [Nielsen et al., 2012]. Very little is known about these processes specifically in fibroblasts. Nonetheless, based on immunostaining with total and Cx43 HC-specific antibodies, and consistent with our previous data from standard 2D cultures [Tarzemany et al., 2017], Cx43 was mainly assembled into HC plaques in GFBLs. Interestingly, at day-3 and -7 cultures, SFBLs displayed significantly less Cx43 HCs than did GFBLs, which is similar to the above findings in vivo. The abundance of 167  Cx43 HCs in SFBLs increased over time, reaching levels similar to those of GFBLs by day-14 post-seeding. Collectively, in this model, SFBLs, but not GFBLs, increase the abundance and distribution of Cx43 into HC plaques over time. In order to explore the functional significance of this finding, we used Cx43 mimetic peptides as tools to dissect regulation of gene expression by Cx43 GJs and HCs in SFBLs compared to GFBLs. Gap27, blocks both of its GJ and HC functions [Chaytor at al., 1997; Hawat et al., 2012], while TAT-Gap19 blocks only Cx43 HC functions without affecting GJs [Wang et al., 2013].  In addition, TAT-Gap19 may also affect Cx43 channel-independent functions by inducing conformational changes that perturb interactions of the cytoplasmic domains with intracellular signaling molecules [Nambara et al., 2007; Hervé et al., 2012; Wang et al., 2013; Abudara et al., 2014]. Our analysis focused on 21 wound healing-related genes that were previously regulated by these peptides in standard 2D cultures of GFBLs. We also included four genes in the analysis that were not regulated by either of the peptides in 2D cultures of GFBLs [Tarzemany et al., 2015 and 2017]. Similar to the 2D cultures [Tarzemany et al., 2015 and 2017], the above four genes were not regulated by either of peptide treatments in GFBLs also in this 3D model. However, the expression of these four additional genes also remained unchanged after the peptide treatments in GFBLs in the 3D model. As in our previous study, the expression of nine genes was regulated by only Gap27 treatment or by both peptides, respectively, in the 3D model. The expression of the remaining eight genes, however, was apparently regulated by different mechanisms in the 3D model when compared to the previous 2D model data (Table 4-5) [Tarzemany et al., 2017]. Taken together, the function of Cx43 GJs and HCs in GFBLs may be modulated by the 3D environment distinctly different from the 2D cultures. Cx GJIC and HC functions and signaling can be regulated by various mechanisms that involve interplay with signals elicited by cell adhesion to 168  the extracellular matrix, mechanosensing, and auto- and paracrine cytokines/growth factors, which may be different between the 2D and 3D cultures [Cukierman et al., 2002; Yamada and Cukierman, 2007; Thévenin et al., 2013; Kaukonen et al., 2017; Wong et al., 2017].  When comparing gene expression changes induced by the peptide treatments between GFBLs and SFBLs in the 3D model, 12 out of 25 studied genes showed similar responses to the peptide treatments in both GFBLs and SFBLs. From these genes, the expression of MMP-14, TIMP-2, -SMA, and Cx45 was not regulated by either of the peptides in both cell types, suggesting that their expression is not regulated by Cx43 in either GFBLs or SFBLs. Interestingly, 13 genes were differently regulated by the peptide treatments in GFBLs and SFBLs. These genes included six ECM proteins (EDA-FN, EDB-FN, Collagen type III, Tenascin-C, Decorin, and Fibromodulin) involved in wound healing (Häkkinen et al., 2012), two protease inhibitors (TIMP-1 and TIMP-4) that modulate inflammation and tissue remodeling [Steffensen et al., 2001; Dufour and Overall, 2013], and three TGF-β signaling-related genes (TGF-β1, TGF-β3, and NAB1) involved in fibrosis and scar formation [Penn et al., 2012]. They also included Cx43 and Cadherin-2, which play a role in intercellular communications [Dbouk et al., 2009]. From the above 13 genes, six (TIMP-1, Tenascin-C, TGF-β1, TGF-β3, Cx43, and Cadherin-2) were significantly upregulated by both Gap27 and TAT-Gap19 treatments in GFBLs, suggesting that they are regulated by Cx43 HCs in these cells. In contrast, expression of these six genes was not affected by either of the peptide treatments in SFBLs. Moreover, the expression of EDB-FN in SFBLs and TIMP-4 and Collagen type III in GFBLs was regulated by only Gap27 and not by TAT-Gap19, suggesting that these genes are distinctly regulated by Cx43 GJs in GFBLs and SFBLs.   It is intriguing that some genes in both GFBLs and SFBLs (TIMP-3, Collagen Type I, 169  NMMBII, and CXCL12), or in only GFBLs (NAB1) or SFBLs (EDA-FN, Decorin, and Fibromodulin) were significantly regulated by TAT-Gap19 but not with Gap27, although both peptides are expected to block Cx43 HCs. Gap27 binds to the Cx43 extracellular loop, whereas TAT-Gap19 binds to the L2 domain of the cytoplasmic loop altering its interaction with the C-terminal tail. In addition to blocking Cx43 HC functions, this may perturb interactions of the Cx43 cytoplasmic domains with the intracellular signaling molecules affecting Cx43 channel-independent signaling [Nambara et al., 2007; Hervé et al., 2012; Wang et al., 2013; Abudara et al., 2014]. Therefore, it is possible that the expression changes in the above genes resulting from exposure to only TAT-Gap19 are mediated by the channel-independent functions of Cx43. Distinct regulation of the above four genes (NAB1, EDA-FN, Decorin, and Fibromodulin) by this mechanism in GFBLs compared to SFBLs suggests that Cx43 channel-independent functions are also distinctly regulated in these two cell types in this model.  To summarize, we have shown for the first time that Cx43 distinctly assembles into Cx43 GJs and HCs in human skin and gingiva in vivo. Interestingly, in contrast to GFBLs, Cx43 HCs composed only a small proportion of total Cx43 in SFBLs in vivo and in vitro. Using the 3D culture model, we further showed that the GJ, HC, and channel-independent functions of Cx43, the major Cx expressed by these cells, distinctly regulate wound healing-related gene expression patterns in GFBLs and SFBLs. Therefore, it is possible that the distinct wound healing outcomes in skin and gingiva may partly derive from inherently different assembly and function of Cx43 in the resident fibroblasts.   170  4.5 Tables Table 4-1: List of the human gingival and skin fibroblast lines used for the study. Cell line name Origin Sex Age (years) GFBL-DC Attached gingiva Male 41  GFBL-OL Attached gingiva Male 30  GFBL-HN Attached gingiva Female 18  GFBL-DW Attached gingiva Female 30  GFBL-IE Attached gingiva Male 26  SFBL-2-C Caucasian breast dermis Female 40  SFBL-1-2 Caucasian breast dermis Female 44  SFBL-4-1 Caucasian breast dermis Female 41  SFBL-302 Caucasian breast dermis Female 38  SFBL-406 Caucasian breast dermis Female 35     171  Table 4-2: List of antibodies used for immunostaining and Western blotting.  Antibody Manufacturer Source Dilution Immunostaining Western blotting Anti-Vimentin (M7020; Vim 3B4)  DakoCytomation, Burlington, ON, CA, USA Mouse 1:200  Anti-Connexin 43 (C6219) Sigma-Aldrich, St. Louis, MO, USA Rabbit 1:800 1:8000 Cx43(E2) Kindly provided by Dr. Jean X. Jiang,  University of Texas Health Science Center,  San Antonio, TX, USA Rabbit 1:300  Anti-β-Tubulin (ab21057) Abcam Inc., Eugene, OR, USA Goat  1:1000 172  Table 4-3: Primers used for quantitative real-time RT-PCR. GeneBank Gene Primer sequence Orientation Location Amplicon (bp) MMPs and TIMPs NM_002421 MMP-1 GCTAACAAATACTGGAGGTATGATG Forward 1250-1275 100   GTCATGTGCTATCATTTTGGGA Reverse 1304-1325     NM_001166308 MMP-3   ATGATGAACAATGGACAAAGGA Forward 661-682 91   GAGTGAAAGAGACCCAGGGA Reverse 751-732  NM_002425 MMP-10   TTATACACCAGATTTGCCAAGA Forward 394-415 56   TTCAGAGCTTTCTCAATGG Reverse 450-432    NM_004995  MMP-14 TCTCCCAGAGGGTCATTCAT Forward 618-1637                       70 TTCCAGTATTTGTTCCCCTTGTAG Reverse 1688-1665   NM_003254 TIMP-1   CTGTGTCCCACCCCACC Forward 267-283 64   GAACTTGGCCCTGATGACGA Reverse 330-311      NM_003255  TIMP-2   ACATTTATGGCAACCCTATCAA  Forward 481-502 70 TCAGGCCCTTTGAACATCTTTA Reverse 550-529      173  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_000362 TIMP-3   AGGACGCCTTCTGCAAC Forward 1281-1297 68   CTCCTTTACCAGCTTCTTCC Reverse 1348-1329 NM_003256 TIMP-4   ACCTGTCCTTGGTGCAGA  Forward 927-944 80   TGTAGCAGGTGGTGATTTGG Reverse 1004-985 Fibrillar ECM proteins BC036531 Collagen type I (alpha 1) AACCAAGGCTGCAACCTGGA          Forward 3951-3970 80   GGCTGAGTAGGGTACACGCAGG    Reverse 4030-4009 NM_000090 Collagen type III (alpha 1) CTCCTGGGATTAATGGTAGT  Forward 1271-1290 70   CCAGGAGCTCCAGGAAT Reverse 1340-1324 NM_212482  EDA-FN (Extra Domain A-Fibronectin)  CACAGTCAGTGTGGTTGCCT Forward 5633-5652 68 CTGTGGACTGGGTTCCAATCA     Reverse 5700-5680      NM_212482  EDB-FN (Extra Domain B-CAGTAGTTGCGGCAGGAGAA  Forward 4168-4188 65 GTATCCTACTGAGGAGTCCACAAAATC Reverse 4232-4206      174  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) Fibronectin) Matricellular proteins NM_002160 TN-C  (Tenascin-C) CAACCTGATGGGGAGATATGGGGA Forward 6769-6792 75 GAGTGTTCGTGGCCCTTCCAG Reverse 6846-6826      Contractility and myofibroblast associated proteins NM_001613  α –SMA (α-Smooth Muscle Actin) AGCGTGGCTATTCCTTCGT Forward 637-655 97   CTCATTTTCAAAGTCCAGAGCTACA Reverse 733-707 NM_005964 NMMIIB (Non-Muscle Myosin IIB)  CCGTTTTACATAATCTGAAGGATC Forward 395-418 98   TTGGAAGATTCTTGTAAGGGTT Reverse 493-472 Small leucine-rich proteoglycans BT019800 DCN  (Decorin) CTGACACAACTCTGCTAGAC   Forward 242-261 97 GACAAGAATCAATGCGTGAAG Reverse 339-319   175  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) NM_002023 FMOD (Fibromodulin) CACAATGAGATCCAGGAAG Forward 761-779 85   TCCGAAGGTGGTTATAACTC  Reverse 845-826        TGF- signaling related genes NM_000660 TGF-β1  CAACGAAATCTATGACAAGTTCAAGCAG Forward 1218-1245 76   CTTCTCGGAGCTCTGATGTG Reverse 1294-1275      NM_003239 TGF-β3  ACACCAATTACTGCTTCCGCAA Forward 1161-1182 81   GCCTAGATCCTGTCGGAAGTC Reverse 1242-1220     NM_005966 NAB1  (NGFI-A Binding Protein-1) CAAAGTCCCACTCATCAGAGA Forward 1930-1950   114 TCACAGCTATCTTGAATCTTCAG Reverse 2043-2020           Growth factors and cytokines NM_001171 VEGF-A AGTGTGTGCCCACTGAGGA Forward 1316-1334    97 176  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) 630 (Vascular Endothelial Growth Factor-A) GTGCTGTAGGAAGCTCATCTC Reverse 1413-1393       NM_199168 CXCL12/SDF-1α TACAGATGCCCATGCCGA Forward 174-191        93   CTGAAGGGCACAGTTTGGAG Reverse 266-247  Cell-cell junction proteins NM_000165 Cx43 AGCAGTCTGCCTTTCGTTGTA Forward 393-412 73 GATTGGGAAAGACTTGTCATAGCAG Reverse 466-442                         NM_001097519 Cx45 AGCTGGGTCCAACAAAAGC   Forward 1151-1169    108 ACCATAAACTATGAGAAGCACAGATT Reverse 1258-1233              NM_001792 Cadherin-2 TGAGGAGTCAGTGAAGGAG Forward 843-861 91 CTTCTGCCTTTGTAGGTGG Reverse 933-915 Human reference genes NM_002046 GAPDH CTTTGTCAAGCTCATTTCCTGGTA Forward 1020-1043 70 177  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) (Glyceraldehydes-3-phosphate d-dehydrogenase) GGCCATGAGGTCCACCA Reverse 1089-1073     M31642  HPRT1 (Hypoxanthine phosphoribosyltransferase I) TGTTGGATTTGAAATTCCAGACAAG Forward 619-643 107 CTTTTCCAGTTTCACTAATGACACAA Reverse 727-700        NM_021009 UBC  (Ubiquitin C)  GTGGCACAGCTAGTTCCGT                     Forward 371-389 96 CTTCACGAAGATCTGCATTGTCA Reverse 444-467 NM_004048 B2M (Beta-2-microglobulin) TGTCTTTCAGCAAGGACTGGTCTTTC Forward 281-306 92 ATGGTTCACACGGCAGGCATA Reverse 351-372    NM_001172085 TBP  (TATAA-box binding protein) TTCGGAGAGTTCTGGGATTG Forward 542-562 94 178  GeneBank Gene Primer sequence Orientation Location Amplicon (bp) Pig reference genes XM_001925271 UBC  (Ubiquitin C) TGCCGCTATACAATGCAG               Forward 161-178 90 GACATTCTCAATGGTGTCA Reverse 250-232 AF452448 B2M (Beta-2-microglobulin) TGTCTTTCAGCAAGGACTGGTCTTTC Forward 3935-3960 90 TGCTTCACGCGGCAGCTATAC Reverse 4025-4005    179  Table 4-4: Regulation of the Expression of Wound Healing-Associated Genes by Cx43 GJ and HC Blocking Peptides in Gingival and Skin Fibroblasts. Genes not regulated by Gap27 and TAT-Gap19 Genes regulated by Gap27 only Genes regulated by TAT-Gap19 only Genes regulated by both Gap27- and TAT-Gap19 GFBLs SFBLs GFBLs SFBLs GFBLs SFBLs GFBLs SFBLs MMP-14 TIMP-2 -SMA Cx45 EDA-FN EDB-FN DCN FMOD  MMP-14 TIMP-2 -SMA Cx45 TIMP-1 TIMP-4 Coll III TN-C TGF-1 TGF-3 NAB1 Cx43 Cadherin-2 TIMP-4 Coll III  EDB-FN TIMP-3 Coll I NMMIIB CXCL12 NAB1  TIMP-3 Coll I NMMIIB CXCL12 EDA-FN DCN FMOD   MMP-1 MMP-3 MMP-10 VEGF-A TIMP-1 TN-C  TGF-1 TGF-3 Cx43 Cadherin-2  MMP-1 MMP-3 MMP-10 VEGF-A   The table summarizes data from Figure 4-4. Genes are indicated based on whether their expression was significantly (p<0.05; two-tailed Student’s t-test) changed only by Gap27, only by TAT-Gap19, by both Gap27 and TAT-Gap19, or genes that were not regulated by Gap27 and TAT-Gap19 relative to corresponding controls. For the experiment, day-7 3D cultures from three parallel GFBL and SFBL strains were treated with Gap27 (150 μM), TAT-Gap19 (400 μM) or corresponding control peptides for 180  24 h. Results are from qPCR analysis of mRNA amount relative to control peptide-treated samples. Genes regulated by different mechanisms in GFBLs and SFBLs are bolded. Coll I: Collagen type I; Coll III: Collagen type III; EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB, DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A.  181  Table 4-5: Regulation of the Expression of Wound Healing-Associated Genes by Cx43 GJ and HC Blocking Peptides in Gingival Fibroblasts in two- and three-Dimensional Cell Culture Models.   Genes not regulated by Gap27 and TAT-Gap19 Genes regulated by Gap27 only Genes regulated by TAT-Gap19 only Genes regulated by both Gap27- and TAT-Gap19 2D 3D 2D 3D 2D 3D 2D 3D TIMP-2  EDA-FN  EDB-FN  Cx45 TIMP-2  EDA-FN  EDB-FN  Cx45 MMP-14 α-SMA DCN FMOD  TIMP-4 TIMP-1  TIMP-3  FMOD Cadherin-2  TIMP-4 Coll III   TIMP-3 Coll I NMMIIB NAB1 CXCL12   MMP-1  MMP-3 MMP-10 TGF-1 TGF-3 TN-C VEGF-A  Cx43 MMP-14 Coll I Coll III α-SMA NMMIIB DCN NAB1 CXCL12 MMP-1 MMP-3 MMP-10 TGF-1 TGF-3 TN-C  VEGF-A Cx43 TIMP-1 Cadherin-2   182  Table compares the gene expression changes between day-7 3D (from present study) and traditional day-3 2D [Tarzemany et al., 2017] GFBL cultures treated with Gap27 (150 μM), TAT-Gap19 (400 μM) or corresponding control peptides for 24 h. Genes are indicated based on whether their expression was significantly (p<0.05; two-tailed Student’s t-test) changed only by Gap27, only by TAT-Gap19, by both Gap27 and TAT-Gap19, or genes that were not regulated by Gap27 and TAT-Gap19 relative to corresponding controls. Results are from qPCR analysis of mRNA amount relative to control peptide-treated samples. Genes regulated by different mechanisms in 2D and 3D cultures are bolded. Results from 3D cultures (this study) represent three parallel GFBL strains (GFBL-DC, GFBL-IE, and GFBL-DW). Results from 2D cultures [Tarzemany et al., 2017] represent GFBL-DC from a minimum of three repeated experiments. Coll I: Collagen type I; Coll III: Collagen type III; EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB, DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A.  183  4.6 Figures  Figure 4-1: Localization of Cx43 GJs and HCs in human gingiva and skin in vivo. Representative images of human gingival (A-F) and dermal (G-J) tissue sections double immunostained with an antibody recognizing all forms of the Cx43 molecule (Cx43; A-C, G and H) or only HC-associated Cx43 (Cx43(E2); D-F, I and J) and vimentin (green; a mesenchymal cell marker) in human 184  gingival (A, B, D and E) and dermal (G and I) epithelium, and gingival (C and F) and dermal (H and J) connective tissue. In the gingival epithelium, Cx43 immunostaining localized most abundantly at the cell-cell contacts as plaque-like structures typical to GJs in the basal and spinous layers (A and B). Staining with the Cx43 HC-specific Cx43(E2) antibody, however, showed localization of Cx43 only at the basal and lower spinous layers (D), with no immunoreactivity at the upper layers of the epithelium (E). In the gingival connective tissue, Cx43 (C) and Cx43(E2) (F) staining was also present as plaque-like staining that mostly localized in the long cellular processes reaching out from the vimentin-positive cells (arrows). In the dermal epithelium (G and I), Cx43 immunostaining (G) localized at the cell-cell contacts with strong immunoreactivity at the upper epithelial layers. Weak staining was noted with Cx43(E2) antibody only at the superficial layers (I). In the dermal connective tissue, Cx43 immunostaining localized abundantly in the long cellular processes (H), similar to the gingival connective tissue (C). Cx43(E2) staining, however, was almost absent from the skin fibroblast processes (J) being only occasionally detected (insert in J). Inserts in (C), (F), (H), and (J) show higher magnification images of Cx43 localization in the long cellular processes. Representative immunostaining images from a minimum of three parallel sections from three individual donors are shown. Nuclear staining (blue) was performed using DAPI.        185    Figure 4-2: Cx43 expression and localization in cultured gingival and skin fibroblasts.   186  (A) Results show qPCR analysis of relative mRNA amount of major Cxs in gingival (GFBLs; GFBL-DW, GFBL-HN, GFBL-OL, GFBL-IE, and GFBL-DC) and skin (SFBLs; SFBL-2-C, SFBL-406, SFBL-302, SFBL-4-1, and SFBL-1-2) fibroblast cultures at day-3 post-seeding. Cx43 was the major Cx expressed in both GFBLs and SFBLs. (B) qPCR analysis of relative Cx43 mRNA amount in GFBLs and SFBLs, 3-, 7-, and 14-days post-seeding. Results represent mean ± SEM from a minimum of three repeated experiments (* p<0.05, ** p<0.01; pairwise comparisons were done using two-tailed Student’s t-test). Results in A and B represent mRNA amount relative to GFBL-DC. Range of the Ct-values obtained from qPCR is indicated below each gene name. (C and D) Western blotting analysis (C) and quantitation (D) of Cx43 in GFBLs and SFBLs day-7 (D7) 3D cultures. SFBLs showed significantly higher abundance of Cx43 compared to GFBLs. Sample loading was normalized for β-Tubulin levels. (E) Representative images from GFBL-DC and SFBL-1-2 day-7 3D cultures double-immunostained for total Cx43 (red) and ZO-1 (green; indicator of cell-cell contacts) (a-f), or HC-associated Cx43 (Cx43(E2); red) and ZO-1 (g-l). (a-f) Cx43 staining was abundantly present in both GFBLs and SFBLs throughout the cell body. In addition, Cx43 staining colocalized with ZO-1 staining at cell-cell contact areas (arrowheads in a and d), likely representing GJ plaques. (g-l) GFBLs and SFBLs also showed numerous Cx43(E2)-positive plaques that did not colocalize with ZO-1 (arrows in g and j) at the cell-cell contacts, likely representing Cx43 HCs. Nuclear staining (blue) was performed using DAPI. Representative immunostaining images from three parallel samples from two repeated experiments are shown. (F) Quantitation of mean number of total and HC-associated Cx43 plaques per cell over time in culture in GFBL-DC and SFBL-1-2. For quantitation, five standard fields from each coverslip were randomly selected. Cx43-positive plaques were counted in minimum of 100 cells per field. Results are relative to the number of Cx43(E2)-positive plaques in SFBL-1-2.   187   Figure 4-3: Gingival and skin fibroblasts have functional Cx43 GJs and HCs. (A) Assessment of Cx43 GJ function. Confluent day-3 cultures of GFBL-DC (A; a-f) and SFBL-1-2 (A; g-l) were scrape-loaded in DMEM with Lucifer Yellow (green) in the presence of Gap27 control peptide (150 μM) (A; a, b, g, and h), Cx43 mimetic peptide Gap27 (150 μM) (A; c and i), TAT-Gap19 control peptide (400 μM) (A; d, e, j, and k), or TAT-Gap19 (400 μM) (A; f and l), and dye transfer via GJs was followed for 5 min. Gap27 treatment (A; c and i) markedly reduced dye transfer as compared to corresponding control samples (A; a, b, g, and h), while TAT-Gap19 (A; f and l) and corresponding control treatment (A; d, e, j, and k) had no effect. (B) Assessment of Cx43 HC function. Confluent day-3 cultures of GFBL-DC (B; a-f) and SFBL-1-2 (B; g-l) were incubated in DMEM (containing 1.8 mM Ca+2) (B; a and g) or low Ca+2-containing medium (EMEM supplemented with 180 nM Ca+2) (B; d and j) in the presence of Cx HC-permeable Propidium Iodide (PI; 2.5 mM, red) for 20 min. Incubation of both GFBLs and SFBLs in EMEM resulted in avid dye uptake (B; d and j), which was blocked when cells were maintained in DMEM (B; a and g). (B; b, c, e, f, h, i, k, and l) Cells were incubated in EMEM and treated with Gap27 control peptide (B; b and h) or Gap27 (150 μM) (B; e and k), TAT-Gap19 control peptide (B; c and i) or TAT-Gap19 (400 μM) (B; f and l). Gap27 (B; e and k) and TAT-Gap19 treatments (B; f and l) markedly blocked Cx43 HC-mediated dye uptake as compared to corresponding control samples (B; b, c, h, I, respectively). Results show representative images from a minimum of two repeated experiments. For the experiments, cells were pretreated with the inhibitors or controls for 1 h before the experiments. Nuclear staining (blue) was performed using DAPI. Magnification bars in A = 30 μm (a, d, g and j) and 50 μm (b, c, e, f, h, i, k and l); in B = 50 μm.  188   Figure 4-4: Gap27 and TAT-Gap19 effect on gene expression response in human gingival and skin fibroblast cultures. 189  Day-7 3D cultures of GFBLs (A; GFBL-DC, GFBL-IE, and GFBL-DW) and SFBLs (B; SFBL-1-2, SFBL-4-1, and SFBL-302) were serum-starved for 24 h and then treated with Gap27 or control peptide (150 μM), and TAT-Gap19 or control peptide (400 μM) for 24 h, and the expression of a set of genes involved in wound healing was analyzed by qPCR. Results represent mean ± SEM of amount of mRNA relative to control peptide-treated cells. Statistical testing was performed using two-tailed Student’s t-test by comparison between Gap27- or TAT-Gap19-induced gene expression changes ($ p<0.05, $$ p<0.01), or relative to the corresponding control peptide-treated samples, respectively (* p<0.05, ** p<0.01, *** p<0.001). Horizontal line (= 1) indicates relative amount of mRNA for the control peptide-treated samples. EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A.                                      190   Figure 4-5: The expression of a set of genes in human gingival and skin fibroblasts treated with increasing concentrations of Gap27 or TAT-Gap19 relative to control samples.  Day-7 3D cultures of GFBLs (GFBL-DC) (A and C) and SFBLs (SFBL-1-2) (B and D) were serum-starved for 24 h and then treated with (A and B) increasing concentrations of Gap27 (50, 150, and 300 μM) or control peptide (50, 150, and 300 μM), or (C and D) increasing concentrations of TAT-Gap19 (400 and 600 μM) or control peptide (400 and 600 μM) for 24 h, and expression of a set of genes involved in wound healing was analyzed by qPCR. Results represent mean ± SEM of mRNA amount relative to control peptide-treated cells from three parallel samples from one experiment. VEGF-A: Vascular Endothelial Growth Factor-A.  191   Figure 4-6: Gene expression response to Gap27 or TAT-Gap19 treatment in human gingival and skin fibroblast cultures. 192  Day-7 3D cultures of GFBLs (GFBL-DC, GFBL-IE, and GFBL-DW) and SFBLs (SFBL-1-2, SFBL-4-1, and SFBL-302) were treated with (A) Gap27 or control peptide (150 μM), or (B) TAT-Gap19 or control peptide (400 μM) for 24 h, and the expression of a set of genes involved in wound healing was analyzed by qPCR. Results represent mean ± SEM of amount of mRNA relative to control peptide-treated cells (= 1). Statistical testing was performed between GFBLs and SFBLs for each peptide treatment (* p<0.05, ** p<0.01; two-tailed Student’s t-test). Horizontal line (= 1) indicates relative amount of mRNA for the control peptide-treated samples in both GFBLs and SFBLs. EDA-FN: Extra Domain A-Fibronectin; EDB-FN: Extra Domain B-Fibronectin; TN-C: Tenascin-C; α-SMA: α-Smooth Muscle Actin; NMMIIB: Non-Muscle Myosin IIB; DCN: Decorin; FMOD: Fibromodulin; NAB1: NGFI-A Binding Protein-1; VEGF-A: Vascular Endothelial Growth Factor-A.  193  Chapter 5: Discussion and Conclusion Human skin wound healing nearly always results in fibrotic scar formation, which is a tremendous physical and psychological burden on public health. Despite the introduction of various therapeutic interventions introduced, no clinically predictable and effective anti-scaring treatment is currently available [Larjava et al., 2011; Lindley et al., 2016]. Studying biological processes that underlie fibrotic conditions provides us with a better understanding of mechanisms involved and, therefore, facilitates the development of more effective therapeutic modalities.  Animal models are useful tools for studying mechanisms of wound healing and scar formation, however considering their limitations in resembling human wound healing, the results from these studies may not always be applied to humans. Therefore, utilizing and studying human scar-forming and scarless tissues provide an ideal model to investigate the underling cellular and molecular mechanisms in this regard [Larjava et al., 2011; Leavitt et al., 2016; Lindley et al., 2016; Wang et al., 2017]. Here, we used human gingival healing as our model to study the scarless wound healing in human. Gingival wounds heal fast with negligible scar formation compared to corresponding skin wounds [Wong et al., 2009; Chen et al., 2010; Glim et al., 2013; Häkkinen et al., 2015].  We focused on the role of fibroblasts, in particular, considering their significant potential in modulating different phases of wound healing, specifically scar formation, owing to their key roles in the depositing and remodeling of ECM molecules, e.g. collagen - the hallmark of scars [Häkkinen et al., 2012; Glim et al., 2013; Leavitt et al., 2016]. Studies have suggested that the characteristics of fibroblasts, at least in part, may contribute to the healing outcome in a given tissue. For instance, the anti-fibrotic and fetal skin-like phenotypes of gingival fibroblasts and their high turnover rate may determine the scarless healing in gingiva [Lorimier et al., 1998; Glim et al., 2013; Mah et al., 2014 and 2017].  194  Emerging evidence has shown the key wound healing regulatory role of Cx43, the most abundant Cx, in various cell types and tissues including skin epithelium and connective tissue cells [Ghatnekar et al., 2009 and 2015; Grek et al., 2015; Cogliati et al., 2016; Zhang and Cui, 2017]. However, very little is known about the expression and localization of Cx43 in skin fibroblasts (SFBLs) in unwounded tissue and during wound healing in vivo. It is important to note that the presence and possible functions of Cx43 has not been investigated in human scarless gingival healing. In agreement with previous studies, we have shown that Cx43 was the most expressed Cx in cultured human gingival fibroblasts (GFBLs) and SFBLs. We have provided the first evidence indicating the presence and localization of Cx43 in GFBLs in vivo and in human gingival keratinocytes and fibroblasts during wound healing, a critical discovery. In unwounded gingival tissue, using total Cx43 antibody that recognizes Cx43 GJs, HCs, and intracellular pool [Sosinsky et al., 2007; Solan and Lampe, 2009], Cx43 localized into large plaque-like structures in keratinocytes and fibroblasts, whose abundance was markedly reduced during the early stage of wound healing. Downregulation of Cx43 in gingival keratinocytes was in agreement with previous studies showing a marked early reduction of Cx43 in human skin wounds [Coutinho et al., 2003; Zhang and Cui, 2017]. Findings from cultured SFBLs and keratinocytes have shown that blocking Cx43 function or expression at the early stage of wound healing results in increased proliferation and migration rate of these cells [Grek et al., 2014; Lorraine et al., 2015; Gilmartin et al., 2016; Wong et al., 2016]. Therefore, it is possible that the early downregulation of Cx43 in gingival wounds may contribute to the fast healing in gingiva through the increased rate of keratinocytes and fibroblasts migration. It is important to point out that the exact mechanisms by which the early downregulation of Cx43 is modulated in gingival healing, 195  remained unclear in our study. Findings from other studies have shown that several cytokines and growth factors such as TNF-α, IFN-γ, TGF-β, and IL-1β are abundantly released at the inflammatory phase of healing [Glim et al., 2013; MacLeod and Mansbridge, 2016]. Interestingly, cytokines such as TNF-α and IL-1β negatively regulate Cx43 expression and function in various cell types, while growth factors like TGF-β, which are also present at granulation tissue formation and remodeling stages of healing, induce Cx43 expression, GJ formation and GJIC [Chanson et al., 2005; Paw et al., 2017]. Consequently, one might speculate that the marked downregulation of Cx43 is related to the increased levels of inflammatory cytokines at the early inflammatory phase, whose level is decreased later during granulation tissue formation and remodeling, and therefore the upregulatory effects of the growth factors such as TGF- may partially induce the upregulation of Cx43 level during the later stages of wound healing. Cx43 re-appearance at the matrix deposition and remodeling stages is of particular interest. During this phase, fibroblasts differentiate into α-smooth muscle actin (α-SMA)-rich myofibroblasts, which provide contractile force to reduce wound size [Häkkinen et al., 2012]. Interestingly, Cx43 positively regulates α-SMA expression in cultured rat cardiac fibroblasts [Asazuma-Nakamura et al., 2009], and Cx43 deficiency in mouse fibroblasts associates with a reduced ability of the cells to contract the collagen gel [Ehrlich et al., 2000].  It also remained unclear whether Cx43-positive plaques in human GFBLs represent Cx43 GJs or HCs. This is an important issue to be addressed as GJs and HCs distinctly regulate biological events in physiological and wound conditions. For instance, while HCs remain primarily in a closed state under resting conditions, GJs are open and provide a direct communication between connecting cells. Furthermore, HCs extensively regulate tissue inflammatory responses through ATP auto- or paracrine signaling whereas GJs are mainly closed 196  during inflammation [Iyyathurai et al., 2013; Wong et al., 2017]. Previous findings from atomic force microscopy experiments have suggested the presence of HC plaques in cardiac cells in vivo [Lal et al., 1995], but no information is available as to whether HC plaques also exist in other tissue or cell types. Using Cx43(E2) antibody that binds to the E2 domain of Cx43 and specifically detects surface Cx43 HCs [Siller-Jackson et al., 2008; Kar et al., 2013], we provided the first evidence that Cx43 also assembles into HC plaque-like structures. We specifically localized Cx43 HCs in human SFBLs and GFBLs in vitro and in vivo, and in skin and gingival keratinocytes in vivo. Immunostaining results showed distinct distribution of Cx43 HCs and GJs in skin and gingiva. Skin keratinocytes assembled Cx43 mainly into GJ plaques, whereas in gingival keratinocytes Cx43 formed distinct GJ and HC plaques. In connective tissue, GFBLs mainly possessed Cx43 HCs, while in SFBLs Cx43 plaques mostly represented GJs in vivo.  To determine the functional significance of the downregulation of Cx43 plaques in GFBLs in gingival healing in vivo, and also to compare Cx43 expression and function in GFBLs and SFBLs in more detail, we cultured human GFBLs and SFBLs using conventional 2D and in vivo-like 3D cell culture models, and treated them with Cx43 function-blocking peptides. Then, we studied and compared the regulation of key wound healing-associated gene expression by Cx43 GJs and HCs in SFBLs and GFBLs. An important advantage of using the 3D cell culture model over 2D is that this model better mimics the matrix deposition and remodeling stages of wound healing as cells actively proliferate, and are imbedded in and interact with their own 3D ECM over time [Iyer et al., 1999; Cukierman et al., 2001, Green and Yamada 2007; Pouyani et al., 2012; Mah et al., 2014 and 2017; Walmsley et al., 2015].   We extensively used Gap27, a Cx43 mimetic peptide that binds to its E2 domain and blocks Cx43 GJ and HC functions [Chaytor et al., 1997; Hawat et al., 2012; Wang et al., 2013], 197  and TAT-Gap19, a Cx43 mimetic peptide that binds to its CL domain and specifically blocks Cx43 HC functions without affecting GJs [Wang et al., 2013; Abudara et al., 2014] as our tools to block Cx43 functions in GFBLs and SFBLs. It is important to note that Gap27 may also inhibit channels constructed from other Cxs including Cx32, Cx37, and Cx40 in various cell types and tissues [Evans and Leybaert, 2007]. However, our findings from qPCR analysis revealed negligible expression of these Cxs in the studied cells, suggesting that Gap27 likely targeted Cx43 channels. TAT-Gap19, on the other hand, specifically blocks Cx43 HCs only and not the other Cxs channels [Wang et al., 2013; Abudar et al., 2014]. The qPCR results showed that Gap27 and TAT-Gap19 differentially regulated the expression of the analyzed wound healing-related genes, suggesting that Cx43 has distinct GJ, HC, and channel-independent functions to regulate various genes in GFBLs and SFBLs. In general, gene expression changes by Gap27 and TAT-Gap19 in GFBLs in 2D model included a significant upregulation of several MMPs and TGF-β signaling molecules, which modulate inflammation and tissue remodeling [Penn et al., 2012; Dufour and Overall, 2013], Tenascin-C, which regulates cell migration and suppresses fibrosis [Yates et al., 2017], and VEGF-A, which promotes angiogenesis [Liakouli et al., 2011], while pro-fibrotic molecules including, Collagen type I, α-SMA, and NMMIIB, which are associated with wound contraction and fibrosis [Penn et al., 2012], were significantly downregulated in 2D-cultured GFBLs compared to control peptide-treated samples. Interestingly, when 3D-cultured GFBLs were compared to the 2D model, the expression of eight out of 25 studied genes was different. It has been shown that signals elicited by cell adhesion to the extracellular matrix, mechanosensing, and auto- and paracrine cytokines/growth factors such as TGF-β, which may be different between the 2D and 3D cultures, can regulate Cx GJIC and HC functions [Thévenin et al., 2013; Mah et al., 2014; Wong et al., 2017]. In SFBLs, Gap27 and 198  TAT-Gap19 treatments also significantly upregulated several MMPs and VEGF-A, and downregulated profibrotic Collagen type I and NMMIIB, similar to GFBLs. However, 13 genes were differentially regulated by the peptide treatments in 3D-cultured GFBLs and SFBLs, suggesting that these genes are distinctly regulated by Cx43 HCs, GJs, or by Cx43 channel-independent functions in GFBLs and SFBLs. For instance, in SFBLs, the expression of Fibromodulin and Decorin, which are involved in inflammation, ECM regulation, and collagen fibrillogenesis [Iozzo and Schaefer, 2010; Frey et al., 2013; Mah et al., 2014] were significantly downregulated by blocking Cx43 function while their expression was Cx43 independent in GFBLs. On the other hand, the expression of TGF-β isoforms remained unchanged in peptide-treated samples in SFBLs while their expression was significantly upregulated in GFBLs.  In particular, gene expression changes were regulated by TAT-Gap19 treatment in 2D-cultured GFBLs by activation of the ERK1/2 signaling pathway and possibly through the suppression of ATP, since inhibition of ATP activity by apyrase caused in general a similar gene expression response and activation of the ERK1/2 pathway as the blocking of Cx43 HCs by the peptides. It, however, remained unclear whether TAT-Gap19 directly blocked ATP release from Cx43 HCs or whether other mechanisms were involved. For instance, activation of the ERK1/2 pathway by TAT-Gap19 may also be mediated via interfering with Cx43 cytoplasmic tail interaction with intracellular signaling effectors including ERK1/2 [Zhou and Jiang, 2014]. TAT-Gap19 binds to the intracellular L2 domain of the CL and sterically inhibits its interactions with the cytoplasmic tail [Wang et al., 2013]. It also may induce conformational changes that perturb interactions of the cytoplasmic domains with intracellular signaling molecules such as ERK1/2 and p38 [Nambara et al., 2007; Hervé et al., 2012; Wang et al., 2013; Abudara et al., 2014]. In 199  SFBLs, the mechanisms by which Gap27 and TAT-Gap19 regulated gene expression remained in need of further study.  In summary, in this thesis we showed that Cx43 was the most abundant Cx present in cultured human SFBLs and GFBLs. Its abundance was significantly downregulated at the early stage of fast and scarless gingival wound healing. Cx43 assembled into GJ and HC plaques in skin and gingival epithelium and connective tissue fibroblasts, although its distribution into GJs or HCs was markedly different in these two tissues. Blocking its function with Cx43 mimetic peptides, Gap27 or TAT-Gap19 distinctly regulated expression of key wound healing-associated genes.   5.1 Study Limitations and Future Directions Limitations of the current study and the possible solutions to circumventing these limitations are discussed below: 1. We characterized the Cx43-positive plaques and their regulation during human gingival healing. Although it remained unclear whether these plaques represent GJs or HCs. Having established the significant role of Cx43 HCs in regulating wound healing-associated genes in cultured GFBLs, assessing the possible presence and modulation of Cx43 HCs during human gingival healing is recommended. Analyzing wound samples from red Duroc pigs may be considered as an alternative approach.  2. We were able to show that Cx43 distinctly assembled into Cx43 GJs and HCs in human skin in vivo, and that these plaques distinctly regulated expression of key wound healing-associated genes in cultured human SFBLs. The regulation of Cx43 HCs and GJs during skin healing, however, was not studied in this project. Utilizing human skin wounds or corresponding red Duroc pig samples, alternatively, to study 200  the possible regulation of Cx43 HCs and GJs during the skin healing process is recommended.  3. We did not assess the expression and abundance of Cx43 in human dermal scars. Human scar tissue samples can be utilized for immunostaining with total Cx43 and Cx43(E2) antibodies to characterize the localization of total Cx43-positive plaques and Cx43 HCs, respectively, in these tissue samples.  4. Using a 3D cell culture model, we showed that Cx43 function-blocking peptides significantly regulated key wound healing genes at the mRNA level. Further investigation of the regulation of these molecules at the protein level, e.g. by Western blotting, is recommended. 5. Using a 2D cell culture model, we showed that gene expression response and activation of the ERK1/2 signaling pathway by TAT-Gap19 in GFBLs was, in general, similar in response as to the inhibition of ATP activity by apyrase. The direct inhibitory effect of TAT-Gap19 on ATP release from GFBL Cx43 HCs may be further studied using a high-sensitive ATP measuring assay.  6. Cx43 blocking peptide-induced ERK1/2 activation was the major studied signaling pathway in the regulation of gene expression in 2D-cultured GFBLs. However, the exact mechanism by which Cx43 or its blockage regulate the activation of ERK1/2 pathway needs to be studied. Also, the possible involvement of the ERK1/2 or other Cx43-mediated signaling pathways in regulation of wound healing-related gene expression in SFBLs needs to be further investigated.  7. Using 3D cell culture model, we showed that the abundance of Cx43 HCs in SFBLs was significantly increased over time (from day-3 to day-14 post-seeding). The 201  abundance of Cx43 HCs in GFBLs, however, did not change over time. To find out the functional significance of the upregulation of Cx43 HCs in SFBLs compared to GFBLs, analysis of Cx43 blocking peptides-induced gene expression at day-3 and day-14 post-seeding by qPCR is recommended.  8. To assess the efficacy of Cx43 blocking peptides in dermal healing and scar reduction, especially TAT-Gap19, which specifically blocks the Cx43 HCs without blocking its GJ functions, may be applied into full-thickness red Duroc pig skin wounds. Timing of the peptide application to the wounds needs to be determined based on the findings from the regulation of Cx43 HCs and GJs during skin healing. Clinical and histological assessment of scar formation may be performed by taking standardized digital images and analyzing biopsy samples for gene expression (qPCR) or localization/abundance of Cx43 HCs and GJs (immunostaining), respectively, taken at different healing time points (up to 60 days). Transdermal delivery of the peptides in a sustained release formulation is recommended.  9. A previous study has shown that Gap27 treatment dose-dependently downregulated Cx43 protein level up to 6 h in NIH 3T3 cells [Glass et al., 2015]. Our findings, however, showed that Gap27 treatment increased Cx43 mRNA and protein levels in 24 h. Therefore, it is possible that short- or long-term effects of Gap27 on Cx43 levels in human GFBLs and DFBLs may be different and needs to be further investigated.   202  References  Abudara V, et al. The connexin43 mimetic peptide Gap19 inhibits hemichannels without altering gap junctional communication in astrocytes. Front Cell Neurosci. 21, 306 (2014).  Akita S, Akino K, Hirano A. Basic Fibroblast Growth Factor in Scarless Wound Healing. Adv Wound Care (New Rochelle). 2, 44-49 (2013).  Andersson-Sjöland A, et al. Fibroblast phenotypes and their activity are changed in the wound healing process after lung transplantation. J Heart Lung Transplant. 30, 945-54 (2011).   Arita K, et al. Changes in gap junction distribution and connexin expression pattern during human fetal skin development. J Histochem Cytochem. 50, 1493-500 (2002).  Asazuma-Nakamura Y, et al. Cx43 contributes to TGF-beta signaling to regulate differentiation of cardiac fibroblasts into myofibroblasts. Exp Cell Res. 315, 1190-1199 (2009).   Baker M. How the Internet of cells has biologists buzzing. Nature. 549, 322-324 (2017).  Beacham DA, Amatangelo MD, Cukierman E. Preparation of extracellular matrices produced by cultured and primary fibroblasts. Curr Protoc Cell Biol, Chapter 10:Unit 10.9 (2007).  Becker DL, Thrasivoulou C, Phillips AR. Connexins in wound healing; perspectives in diabetic patients. Biochim Biophys Acta. 1818, 2068-2075 (2012).   Bing T, et al. Inhibition of connexin 43 prevents trauma-induced heterotopic ossification. Sci Rep. 6, 37184 (2016).   Boitano S, Safdar Z, Welsh DG, Bhattacharya J, Koval M. Cell-cell interactions in regulating lung function. Am J Physiol Lung Cell Mol Physiol. 287, 455-459 (2004).  Brandner JM, Houdek P, Hüsing B, Kaiser C, Moll I. Connexins 26, 30, and 43: differences among spontaneous, chronic, and accelerated human wound healing. J Invest Dermatol. 122, 1310-1320 (2004).  Burnstock G, Knight GE, Greig AV. Purinergic signaling in healthy and diseased skin. J Invest Dermatol. 132, 526-546 (2012).  Burra, S, Jiang JX. Regulation of cellular function by connexin hemichannels. Int J Biochem Mol Biol. 2, 119-128 (2011).   Bustin SA, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, 611-622 (2009).   Caillou B, et al. Tumor-associated macrophages (TAMs) form an interconnected cellular 203  supportive network in anaplastic thyroid carcinoma. PLoS One. 6, e22567 (2011).   Calder BW, et al. Inhibition of connexin 43 hemichannel-mediated ATP release attenuates early inflammation during the foreign body response. Tissue Eng Part A. 21, 1752-1762 (2015).   Camussi G, Deregibus MC, Bruno S, Cantaluppi V, Biancone L. Exosomes/microvesicles as a mechanism of cell-to-cell communication. Kidney Int. 78, 838-848 (2010).  Cekici A, Kantarci A, Hasturk H, Van Dyke TE. Periodontol 2000. Inflammatory and immune pathways in the pathogenesis of periodontal disease. Periodontol 2000. 64, 57-80 (2014).    Chanson M, et al. Gap junctional communication in tissue inflammation and repair. Biochim Biophys Acta. 1711, 197–207 (2005).  Chaytor AT, Evans WH, Griffith TM. Peptides homologous to extracellular loop motifs of connexin 43 reversibly abolish rhythmic contractile activity in rabbit arteries. J Physiol. 503, 99-110 (1997).  Chen L, et al. Positional differences in the wound transcriptome of skin and oral mucosa. BMC Genomics. 11, 471 (2010).  Cheon SS, et al. Beta-catenin regulates wound size and mediates the effect of TGF-beta in cutaneous healing. FASEB J. 20, 692-701 (2006).  Churko JM, Laird DW. Gap junction remodeling in skin repair following wounding and disease. Physiology (Bethesda). 28, 190-198 (2013).   Churko JM, et al. Human dermal fibroblasts derived from oculodentodigital dysplasia patients suggest that patients may have wound-healing defects. Hum Mutat. 32, 456-466 (2011).   Civitelli R, et al. Connexin43 mediates direct intercellular communication in human osteoblastic cell networks. J Clin Invest. 91,1888-1896 (1993).  Cogliati B, et al. Connexin 43 deficiency accelerates skin wound healing and extracellular matrix remodeling in mice. J Dermatol Sci. 79, 50-56 (2015).  Cogliati B, et al. Connexins, Pannexins, and Their Channels in Fibroproliferative Diseases. J Membr Biol. 249, 199-213 (2016).  Coutinho P, Qiu C, Frank S, Tamber K, Becker D. Dynamic changes in connexin expression correlate with key events in the wound healing process. Cell Biol Int. 27, 525-541 (2003).   Coutinho P, et al. Limiting burn extension by transient inhibition of Connexin43 expression at the site of injury. Br J Plast Surg. 58, 658-667 (2005).  204  Cukierman E, Pankov R, Stevens DR, Yamada KM. Taking cell-matrix adhesions to the third dimension. Science. 294, 1708-1712 (2001).  Cukierman E, Pankov R, Yamada KM. Cell interactions with three-dimensional matrices. Curr Opin Cell Biol. 14, 633-639 (2002).   Dai P, Nakagami T, Tanaka H, Hitomi T, Takamatsu T. Cx43 mediates TGF-beta signaling through competitive Smads binding to microtubules. Mol Biol Cell. 18, 2264-2273 (2007).   Davis NG, Phillips A, Becker DL. Connexin dynamics in the privileged wound healing of the buccal mucosa. Wound Repair Regen. 21, 571-578 (2013).   Dbouk HA, Mroue RM, El-Sabban ME, Talhouk RS. Connexins: a myriad of functions extending beyond assembly of gap junction channels. Cell Commun Signal. 12, 7 (2009).   De Bock M, Wang N, Decrock E, Bultynck G, Leybaert L. Intracellular Cleavage of the Cx43 C-Terminal Domain by Matrix-Metalloproteases: A Novel Contributor to Inflammation? Mediators Inflamm.  2015, 257471 (2015).   Decrock E, et al. Calcium and connexin-based intercellular communication, a deadly catch? Cell Calcium. 50, 310-321 (2011).  Degen KE, Gourdie RG. Embryonic wound healing: a primer for engineering novel therapies for tissue repair. Birth Defects Res C Embryo Today. 96, 258-270 (2012).   Desplantez T, Verma V, Leybaert L, Evans WH, Weingart R. Gap26, a connexin mimetic peptide, inhibits currents carried by connexin43 hemichannels and gap junction channels. Pharmacol Res. 65, 546-552 (2012).   Donahue HJ, et al. Cell-to-cell communication in osteoblastic networks: cell line-dependent hormonal regulation of gap junction function. J Bone Miner Res. 10, 881-889 (1995).  Duffy HS, John GR, Lee SC, Brosnan CF, Spray DC. Reciprocal regulation of the junctional proteins claudin-1 and connexin43 by interleukin-1beta in primary human fetal astrocytes. J Neurosci. 20, RC114 (2000).  Dufour A, Overall CM. Missing the target: matrix metalloproteinase antitargets in inflammation and cancer. Trends Pharmacol Sci. 34, 233-242 (2013).   Ehrlich HP. A Snapshot of Direct Cell-Cell Communications in Wound Healing and Scarring. Adv Wound Care (New Rochelle). 2, 113-121 (2013).  Ehrlich HP, Gabbiani G, Meda P. Cell coupling modulates the contraction of fibroblast-populated collagen lattices. J Cell Physiol. 184, 86-92 (2000).  205  Eslami A, et al. Expression of integrin alphavbeta6 and TGF-beta in scarless vs scar-forming wound healing. J Histochem Cytochem. 57, 543-557 (2009).   Evans WH, Leybaert L. Mimetic Peptides as Blockers of Connexin Channel-Facilitated Intercellular Communication, Cell Communication & Adhesion, 14, 265-273 (2007).  Evans WH, Bultynck G, Leybaert L. Manipulating connexin communication channels: use of peptidomimetics and the translational outputs. J Membr Biol. 245, 437-449 (2012).   Ferrari D, et al. Purinergic signaling in scarring. FASEB J. 30, 3-12 (2016).  Fitzgerald DJ, et al. Expression and function of connexin in normal and transformed human keratinocytes in culture. Carcinogenesis. 15,1859-1865 (1994).   Fournier BP, Larjava H, Häkkinen L. Gingiva as a source of stem cells with therapeutic potential. Stem Cells Dev. 22, 3157-3177 (2013).   Frey H, Schroeder N, Manon-Jensen T, Iozzo RV, Schaefer L. Biological interplay between proteoglycans and their innate immune receptors in inflammation. FEBS J. 280, 2165-2179 (2013).   Fujita T, et al. Irsogladine maleate counters the interleukin-1 beta-induced suppression in gap-junctional intercellular communication but does not affect the interleukin-1 beta-induced zonula occludens protein-1 levels in human gingival epithelial cells. J Periodontal Res. 43, 96-102 (2008).   Gabbiani G, Chaponnier C, Hüttner I. Cytoplasmic filaments and gap junctions in epithelial cells and myofibroblasts during wound healing. J Cell Biol 76: 561-568 (1978).  Gallant-Behm CL, Olson ME, Hart DA. Cytokine and growth factor mRNA expression patterns associated with the hypercontracted, hyperpigmented healing phenotype of red duroc pigs: a model of abnormal human scar development? J Cutan Med Surg. 9:165e177 (2005).    Garcia-Dorado D, Ruiz-Meana M, Padilla F, Rodriguez-Sinovas A, Mirabet M. Gap junction-mediated intercellular communication in ischemic preconditioning. Cardiovasc Res. 55, 456-465 (2002).  Gault WJ, Enyedi B, Niethammer P. Osmotic surveillance mediates rapid wound closure through nucleotide release. J Cell Biol. 207, 767-82 (2014).   Ghahary A, Ghaffari A. Role of keratinocyte-fibroblast cross-talk in development of hypertrophic scar. Wound Repair Regen. 15, 46-53 (2007).   206  Ghatnekar GS, Grek CL, Armstrong DG, Desai SC, Gourdie RG. The effect of a connexin43-based Peptide on the healing of chronic venous leg ulcers: a multicenter, randomized trial. J Invest Dermatol. 135, 289-298 (2015).  Ghatnekar GS, et al. Connexin43 carboxyl-terminal peptides reduce scar progenitor and promote regenerative healing following skin wounding. Regen Med. 4, 205-223 (2009).   Ghersi G, et al. Regulation of fibroblast migration on collagenous matrix by a cell surface peptidase complex. J Biol Chem. 277, 29231-29241 (2002).   Giepmans BN. Role of connexin43-interacting proteins at gap junctions. Adv Cardiol. 42, 41-56 (2006).  Gilmartin DJ, et al. Sustained Release of Cx43 Antisense Oligodeoxynucleotides from Coated Collagen Scaffolds Promotes Wound Healing. Adv Healthc Mater. 5, 1786-1799 (2016).  Glass BJ, Hu RG, Phillips AR, Becker DL. The action of mimetic peptides on connexins protects fibroblasts from the negative effects of ischemia reperfusion. Biol Open. 4, 1473-1480 (2015).  Glim JE, Everts V, Niessen FB, Ulrich MM, Beelen RH. Extracellular matrix components of oral mucosa differ from skin and resemble that of fetal skin. Arch Oral Biol. 59:1048e1055 (2014).  Glim JE, van Egmond M, Niessen FB, Everts V, Beelen RH. Detrimental dermal wound healing: what can we learn from the oral mucosa? Wound Repair Regen. 21, 648-660 (2013).   Goliger JA, Paul DL. Wounding alters epidermal connexin expression and gap junction-mediated intercellular communication. Mol Biol Cell. 6, 1491-1501 (1995).  Goodenough DA, Paul DL. Beyond the gap: functions of unpaired connexon channels. Nat Rev Mol Cell Biol. 4, 285-294 (2003).  Goodenough DA, Paul DL. Gap Junctions. Cold Spring Harb Perspect Biol 1: a002576 (2009).  Gopalakrishnan A, et al. Modulation of activator protein-1 (AP-1) and MAPK pathway by flavonoids in human prostate cancer PC3 cells. Arch Pharm Res. 29, 633-644 (2006).  Gourdie RG, et al. The unstoppable connexin43 carboxyl-terminus: new roles in gap junction organization and wound healing. Ann N Y Acad Sci. 1080, 49-62 (2006).  Greaves NS, Ashcroft KJ, Baguneid M, Bayat A. Current understanding of molecular and cellular mechanisms in fibroplasia and angiogenesis during acute wound healing. J Dermatol Sci. 72, 206e217 (2013).  Greaves NS, Iqbal SA, Baguneid M, Bayat A. The role of skin substitutes in the management of chronic cutaneous wounds. Wound Repair Regen. 21, 194-210 (2013). 207  Green JA, Yamada KM. Three-dimensional microenvironments modulate fibroblast signaling responses. Adv Drug Deliv Rev. 59, 1293-1298 (2007).  Greenhalgh, D. G. The use of dermal substitutes in burn surgery: acute phase. Wound Repair Regen. 22, 1-2 (2014).  Grek CL, et al. Topical administration of a connexin43-based peptide augments healing of chronic neuropathic diabetic foot ulcers. A multicenter, randomized trial. Wound Repair Regen. 23, 203-212 (2015).  Grek CL, Rhett JM, Ghatnekar GS. Cardiac to Cancer: Connecting Connexins to Clinical Opportunity. FEBS Lett. 588, 1349-1364 (2014).  Grek CL, et al. A Multicenter Randomized Controlled Trial Evaluating a Cx43-Mimetic Peptide in Cutaneous Scarring. J Invest Dermatol. 137, 620-630 (2017).  Haghikia A, et al. Intracellular application of TNF-alpha impairs cell to cell communication via gap junctions in glioma cells. J Neurooncol.  86, 143-152 (2008).   Häkkinen L, Heino J, Koivisto L, Larjava H. Altered interaction of human granulation-tissue fibroblasts with fibronectin is regulated by alpha 5 beta 1 integrin. Biochim Biophys Acta. 1224, 33-42 (1994).  Häkkinen L, Koivisto L, Heino J, Larjava H. Cell and Molecular Biology of Wound Healing. In: Vishwakarma A, Sharpe P, Shi S, Wang XP, Ramalingam M, editors. Stem Cell Biology and Tissue Engineering in Dental Sciences. Elsevier, USA. pp. 669-690 (2015).  Häkkinen L, Larjava H, Fournier BPJ. Distinct Phenotype and Therapeutic Potential of Gingival Fibroblasts. Cytotherapy. 16, 1171-1186 (2014).  Häkkinen L, Larjava H, Koivisto L. Granulation Tissue Formation and Remodeling. In: Larjava H, editor. Oral Wound Healing: Cell Biology and Clinical Management. John Wiley & Sons, Inc., Ames, USA, pp. 125-173 (2012).  Häkkinen L, Uitto VJ, Larjava H. Cell biology of gingival wound healing. Periodontol 2000. 24,127-152 (2000).  Harks EG, et al. Fenamates: a novel class of reversible gap junction blockers. J Pharmacol Exp Ther. 298, 1033-1041 (2001).  Hatakeyama S, et al. Expression pattern of adhesion molecules in junctional epithelium differs from that in other gingival epithelia. J Periodontal Res. 41, 322-328 (2006).  Hawat G, Benderdour M, Rousseau G, Baroudi G. Connexin 43 mimetic peptide Gap26 confers protection to intact heart against myocardial ischemia injury. Pflugers Arch. 460, 583-592 208  (2010).   Hawat G, Hélie P, Baroudi G. Single intravenous low-dose injections of connexin 43 mimetic peptides protect ischemic heart in vivo against myocardial infarction. J Mol Cell Cardiol. 53, 559-566 (2012).  Hebert C, Stains JP. An intact connexin43 is required to enhance signaling and gene expression in osteoblast-like cells. J Cell Biochem. 114, 2542-2550 (2013).   Hematti P. Mesenchymal stromal cells and fibroblasts: a case of mistaken identity? Cytotherapy. 14, 516-521 (2012).   Hervé JC, Derangeon M, Sarrouilhe D, Giepmans BN, Bourmeyster N. Gap junctional channels are parts of multiprotein complexes. Biochim Biophys Acta 1818: 1844-1865 (2012).   Hochegger H, Takeda S, Hunt T. Cyclin-dependent kinases and cell-cycle transitions: does one fit all? Nat Rev Mol Cell Biol. 9, 910-916 (2008).   Honardoust D, Eslami A, Larjava H, Häkkinen L. Localization of small leucine-rich proteoglycans and transforming growth factor-beta in human oral mucosal wound healing. Wound Repair Regen. 16, 814-823 (2008).   Honardoust HA, et al. Expression of Endo180 is spatially and temporally regulated during wound healing. Histopathology. 49, 634-648 (2006).  Hunter AW, Barker RJ, Zhu C, Gourdie RG. Zonula occludens-1 alters connexin43 gap junction size and organization by influencing channel accretion. Mol Biol Cell. 16, 5686-5698 (2005).   Ishikawa S, et al. Role of connexin-43 in protective PI3K-Akt-GSK-3β signaling in cardiomyocytes. Am J Physiol Heart Circ Physiol. 302, 2536-2544 (2012).   Iyer VR, et al. The transcriptional program in the response of human fibroblasts to serum. Science. 283, 83e87 (1999).  Iyyathurai J, et al. Peptides and peptide-derived molecules targeting the intracellular domains of Cx43: gap junctions versus hemichannels. Neuropharmacology. 75, 491-505 (2013).   Jacques-Silvaa MC, Bernardia A, Rodnighta R, Lenzb G. ERK, PKC and PI3K/AKT pathways mediate extracellular ATP and adenosine-induced proliferation of U138-MG human glioma cell line. Oncology. 67, 450-459 (2004).  Jansen JA, et al. Reduced Cx43 expression triggers increased fibrosis due to enhanced fibroblast activity. Circ Arrhythm Electrophysiol. 5, 380-390 (2012).  209  Jiang JX, Gu S. Gap junction- and hemichannel-independent actions of connexins. Biochim Biophys Acta. 1711, 208-214 (2005).  Jiang JX, Siller-Jackson AJ, Burra S. Roles of gap junctions and hemichannels in bone cell functions and in signal transmission of mechanical stress Front Biosci. 12, 1450-1462 (2007).   Kandyba EE, Hodgins MB, Martin PE. A murine living skin equivalent amenable to live-cell imaging: analysis of the roles of connexins in the epidermis. J Invest Dermatol. 128, 1039-1049 (2008).   Kar R, Batra N, Riquelme MA, Jiang JX. Biological role of connexin intercellular channels and hemichannels. Arch Biochem Biophys. 524, 2-15 (2012).  Kar R, Riquelme MA, Werner S, Jiang JX. Connexin 43 channels protect osteocytes against oxidative stress-induced cell death. J Bone Miner Res. 28, 1611-1621 (2013).  Kardami E, et al. The role of connexins in controlling cell growth and gene expression. Prog Biophys Mol Biol. 94, 245-64 (2007).   Karin M, Clevers H. Reparative inflammation takes charge of tissue regeneration. Nature. 529, 307-315 (2016).  Kaukonen R, Jacquemet G, Hamidi H, Ivaska J. Cell-derived matrices for studying cell proliferation and directional migration in a complex 3D microenvironment. Nat Protoc. 12, 2376-2390 (2017).  Kendall RT, Feghali-Bostwick CA. Fibroblasts in fibrosis: novel roles and mediators. Front Pharmacol. 5, 123 (2014).  Kimlin LC, Casagrande G, Virador VM. In vitro three-dimensional (3D) models in cancer research: an update. Mol Carcinog. 52, 167-182 (2013).   King SJ, Parsons M. Imaging cells within 3D cell-derived matrix. Methods Mol Biol. 769, 53-64 (2011).   Ko K, Arora P, Lee W, McCulloch C. Biochemical and functional characterization of intercellular adhesion and gap junctions in fibroblasts. Am J Physiol Cell Physiol. 279, 147-157 (2000).  Koivisto L, Larjava H, Häkkinen L. Reepithelialization of wounds. Endodontic Topics. 24, 59e93 (2012).  Komatsu I, et al. Dupuytren's fibroblast contractility by sphingosine-1-phosphate is mediated through non-muscle myosin II. J Hand Surg Am. 35, 1580-1588 (2010).   210  Kretz M, et al. Altered connexin expression and wound healing in the epidermis of connexin-deficient mice. J Cell Sci. 116, 3443-3452 (2003).   Kretz M, Maass K, Willecke K. Expression and function of connexins in the epidermis, analyzed with transgenic mouse mutants. Eur J Cell Biol. 83, 647-654 (2004).  Kurtenbach S, Kurtenbach S, Zoidl G. Gap junction modulation and its implications for heart function. Front Physiol. 5, 82 (2014).  Lal R, John SA, Laird DW, Arnsdorf MF. Heart gap junction preparations reveal hemiplaques by atomic force microscopy. Am J Physiol. 268, 968-977 (1995).  Landén NX, Li D, Ståhle M. Transition from inflammation to proliferation: a critical step during wound healing. Cell Mol Life Sci. 73, 3861-3885 (2016).  Langevin HM, Cornbrooks CJ, Taatjes DJ. Fibroblasts form a body-wide cellular network. Histochem Cell Biol. 122, 7-15 (2004).   Langevin HM, et al. Fibroblast cytoskeletal remodeling induced by tissue stretch involves ATP signaling. J Cell Physiol. 228, 1922-1926 (2013).  Langlois S, et al. Connexin levels regulate keratinocyte differentiation in the epidermis. J Biol Chem. 282, 30171-30180 (2007).   Larjava H, et al. Exploring scarless healing of oral soft tissues. J Can Dent Assoc. 77, b18 (2011).  Lauf U, et al. Dynamic trafficking and delivery of connexons to the plasma membrane and accretion to gap junctions in living cells. PNAS 99: 10446-10451 (2002).  Leavitt T, et al. Scarless wound healing: finding the right cells and signals. Cell Tissue Res. 365, 483-93 (2016).   Lecanda F, et al. Gap junctional communication modulates gene expression in osteoblastic cells. Mol Biol Cell. 9, 2249-2258 (1998).  Leithe E, et al. Ubiquitylation of the gap junction protein connexin-43 signals its trafficking from early endosomes to lysosomes in a process mediated by Hrs and Tsg101. J Cell Sci. 122, 3883-3893 (2009).  Leung A, Crombleholme TM, Keswani SG. Fetal wound healing: implications for minimal scar formation. Curr Opin Pediatr. 24, 371-378 (2012).   Liakouli, V. et al. Angiogenic cytokines and growth factors in systemic sclerosis. Autoimmun Rev. 10, 590-594 (2011). 211  Lindley LE, Stojadinovic O, Pastar I, Tomic-Canic M. Biology and Biomarkers for Wound Healing. Plast Reconstr Surg. 138, 18-28 (2016).   Liu LL, et al. Identification of valid reference genes for the normalization of RT-qPCR expression studies in human breast cancer cell lines treated with and without transient transfection. PLoS One. 10, e0117058 (2015).   Lock JT, Parker I, Smith IF. Communication of Ca(2+) signals via tunneling membrane nanotubes is mediated by transmission of inositol trisphosphate through gap junctions. Cell Calcium. 60, 266-272 (2016).  London E, Brown DA. Insolubility of lipids in triton X-100: physical origin and relationship to sphingolipid/cholesterol membrane domains (rafts). Biochim Biophys Acta. 23, 182-195 (2000).  Lorimier S, et al. Morphometric studies of collagen and fibrin lattices contracted by human gingival fibroblasts; comparison with dermal fibroblasts. J Dent Res. 77, 1717e29 (1998).  Lorraine C, Wright CS, Martin PE. Connexin43 plays diverse roles in co-ordinating cell migration and woundclosure events. Biochem Soc Trans. 43, 482-488 (2015).   Losso JN, Truax RE, Richard G. Trans-resveratrol inhibits hyperglycemia-induced inflammation and connexin downregulation in retinal pigment epithelial cells. J Agric Food Chem. 58, 8246-8252 (2010).  Iozzo RV, Schaefer L. Proteoglycans in health and disease: novel regulatory signaling mechanisms evoked by the small leucine-rich proteoglycans. FEBS J. 277, 3864-3875 (2010).  Lu D, Soleymani S, Madakshire R, Insel PA. ATP released from cardiac fibroblasts via connexin hemichannels activates profibrotic P2Y2 receptors. FASEB J. 26, 2580-2591 (2012).  MacLeod AS, Mansbridge JN. The Innate Immune System in Acute and Chronic Wounds. Adv Wound Care. 5, 65-78 (2016).  Mah W, et al. Human gingival fibroblasts display a non-fibrotic phenotype distinct from skin fibroblasts in three-dimensional cultures. PLoS One. 9, e90715 (2014).   Mah W, et al. Elevated CD26 Expression by Skin Fibroblasts Distinguishes a Profibrotic Phenotype Involved in Scar Formation Compared to Gingival Fibroblasts. Am J Pathol.  187, 1717-1735 (2017).   Mak K, et al. Scarless healing of oral mucosa is characterized by faster resolution of inflammation and control of myofibroblast action compared to skin wounds in the red Duroc pig model. J Dermatol Sci. 56, 168-180 (2009).   Martin PE, Easton JA, Hodgins MB, Wright CS. Connexins: sensors of epidermal integrity that 212  are therapeutic targets. FEBS Lett. 588, 1304-1314 (2014).  McCubrey JA, et al. Multifaceted roles of GSK-3 and Wnt/β-catenin in hematopoiesis and leukemogenesis: opportunities for therapeutic intervention. Leukemia. 28, 15-33 (2014).   Mendoza-Naranjo A, et al. Overexpression of the gap junction protein Cx43 as found in diabetic foot ulcers can retard fibroblast migrationCell Biol Int. 36, 661-667 (2012).  Michalopoulos GK, DeFrances MC. Liver regeneration. Science. 276, 60-66 (1997).   Mor-Vaknin N, Punturieri A, Sitwala K, Markovitz DM. Vimentin is secreted by activated macrophages. Nat Cell Biol. 5, 59-63 (2003).  Mori R, Power KT, Wang CM, Martin P, Becker DL. Acute downregulation of connexin43 at wound sites leads to a reduced inflammatory response, enhanced keratinocyte proliferation and wound fibroblast migration. J Cell Sci. 119, 5193-5203 (2006).  Moyer KE, Davis A, Saggers GC, Mackay DR, Ehrlich HP. Wound healing: the role of gap junctional communication in rat granulation tissue maturation. Exp Mol Pathol. 72, 10-16 (2002).  Nagase H, Suzuki K, Enghild JJ, Salvesen G. Stepwise activation mechanisms of the precursors of matrix metalloproteinases 1 (tissue collagenase) and 3 (stromelysin). Biomed Biochim Acta. 50, 749-754 (1991).  Nakano Y, et al. Connexin43 knockdown accelerates wound healing but inhibits mesenchymal transition after corneal endothelial injury in vivo. Invest Ophthalmol Vis Sci. 49, 93-104 (2008).   Nambara C, Kawasaki Y, Yamasaki H. Role of the cytoplasmic loop domain of Cx43 in its intracellular localization and function: possible interaction with cadherin. J Membr Biol. 217, 63-69 (2007).   Negoro H, et al. Role of Rev-erbα domains for transactivation of the connexin43 promoter with Sp1. FEBS Lett. 587, 98-103 (2013).  Nielsen MS, et al. Gap junctions. Compr Physiol. 2, 1981-2035 (2012).  Niger C, et al. The transcriptional activity of osterix requires the recruitment of Sp1 to the osteocalcin proximal promoter. Bone. 49, 683-692 (2011).   Nishi H, et al. Wound healing effects of gingival fibroblasts cultured in animal-free medium. Oral Dis.16, 438-444 (2010).  213  O’Carroll SJ, Alkadhi M, Nicholson LF, Green CR. Connexin 43 mimetic peptides reduce swelling, astrogliosis, and neuronal cell death after spinal cord injury. Cell Commun. Adhes. 15, 27e42 (2008).  O’Carroll SJ, Gorrie CA, Velamoor S, Green CR, Nicholson LF. Connexin43 mimetic peptide is neuroprotective and improves function following spinal cord injury. Neurosci. Res. 75, 256e267 (2013).  Ongstad EL, O'Quinn MP, Ghatnekar GS, Yost MJ, Gourdie RG. A Connexin43 Mimetic Peptide Promotes Regenerative Healing and Improves Mechanical Properties in Skin and Heart. Adv Wound Care (New Rochelle). 2, 55-62 (2013).  Orellana JA, Martinez AD, Retamal MA. Gap junction channels and hemichannels in the CNS: regulation by signaling molecules. Neuropharmacol. 75, 567-582 (2013).  Orthmann-Murphy JL, Abrams CK, Scherer SS. Gap junctions couple astrocytes and oligodendrocytes. J Mol Neurosci. 35, 101-116 (2008).  Paw M, et al. Connexin43 Controls the Myofibroblastic Differentiation of Bronchial Fibroblasts from Patients with Asthma. Am J Respir Cell Mol Biol. 57, 100-110 (2017).  Penn JW, Grobbelaar AO, Rolfe KJ. The role of the TGF-β family in wound healing, burns and scarring: a review. Int J Burns Trauma. 2, 18-28 (2012).  Pinheiro AR, et al. Bradykinin-induced Ca2+ signaling in human subcutaneous fibroblasts involves ATP release via hemichannels leading to P2Y12 receptors activation. Cell Commun Signal. 18, 70 (2013).   Pollok S, et al. Connexin 43 mimetic peptide Gap27 reveals potential differences in the role of Cx43 in wound repair between diabetic and non-diabetic cells. J Cell Mol Med. 15, 861-873 (2011).  Ponsaerts R, et al. Intramolecular loop/tail interactions are essential for connexin 43- hemichannel activity. FASEB J. 24, 4378e4395 (2010).  Pouyani T, Papp S, Schaffer L. Tissue-engineered fetal dermal matrices. In Vitro Cell Dev Biol Anim. 48, 493-506 (2012).  Principi M, et al. Fibrogenesis and fibrosis in inflammatory bowel diseases: Good and bad side of same coin? World J Gastrointest Pathophysiol. 4, 100-107 (2013).  Profyris C, Tziotzios C, Do Vale I. Cutaneous scarring: Pathophysiology, molecular mechanisms, and scar reduction therapeutics Part I. The molecular basis of scar formation. J Am Acad Dermatol. 66, 1-10 (2012).   214  Qian LW, et al. Exacerbated and prolonged inflammation impairs wound healing and increases scarring. Wound Repair Regen. 24, 26-34 (2016).   Qiu C, et al. Targeting connexin43 expression accelerates the rate of wound repair. Curr Biol. 13, 1697-1703 (2003).  Ramos ML, Gragnani A, Ferreira LM. Is there an ideal animal model to study hypertrophic scarring? J Burn Care Res. 29, 363-368 (2008).  Reaume AG, et al. Cardiac malformation in neonatal mice lacking connexin43. Science. 267, 1831-1834 (1995).  Rhett JM, et al. Novel therapies for scar reduction and regenerative healing of skin wounds. Trends Biotechnol. 26, 173-180 (2007).  Rhett JM, Gourdie RG. The perinexus: a new feature of Cx43 gap junction organization. Heart Rhythm. 9, 619-623 (2012).  Rhett JM, Fann SA, Yost MJ. Purinergic signaling in early inflammatory events of the foreign body response: modulating extracellular ATP as an enabling technology for engineered implants and tissues. Tissue Eng Part B Rev. 20, 392-402 (2014).   Rhett JM, Jourdan J, Gourdie RG. Connexin 43 connexon to gap junction transition is regulated by zonula occludens-1. Mol Biol Cell. 22, 1516-1528 (2011).   Rhett JM, Wang H, Bainbridge H, Song L, Yost MJ. Connexin-Based Therapeutics and Tissue Engineering Approaches to the Amelioration of Chronic Pancreatitis and Type I Diabetes: Construction and Characterization of a Novel Prevascularized Bioartificial Pancreas. J Diabetes Res. 7262680 (2016).   Rhett JM, et al. Mechanism of action of the anti-inflammatory connexin43 mimetic peptide JM2. Am J Physiol Cell Physiol. 313, 314-326 (2017).    Ribeiro-Rodrigues TM, Martins-Marques T, Morel S, Kwak BR, Girão H. Role of connexin 43 in different forms of intercellular communication - gap junctions, extracellular vesicles and tunnelling nanotubes. J Cell Sci.130, 3619-3630 (2017).   Richards TS, et al. Protein kinase C spatially and temporally regulates gap junctional communication during human wound repair via phosphorylation of connexin43 on serine368. J Cell Biol. 167, 555-562 (2004).  Rieu I, Powers SJ. Real-time quantitative RT-PCR: design, calculations, and statistics. Plant Cell. 21, 1031-1033 (2009).   215  Rinkevich Y, et al. Skin fibrosis: identification and isolation of a dermal lineage with intrinsic fibrogenic potential. Science. 348, aaa2151 (2015).   Rinn JL, Bondre C, Gladstone HB, Brown PO, Chang HY. Anatomic demarcation by positional variation in fibroblast gene expression programs. PLoS Genet. 2, e119 (2006).  Roy S, Kornberg TB. Paracrine signaling mediated at cell-cell contacts. Bioessays. 37, 25-33 (2015).   Sáez JC, Berthoud VM, Branes MC, Martinez AD, Beyer EC. Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev. 83, 1359-1400 (2003).  Sáez JC, Leybaert L. Hunting for connexin hemichannels. FEBS Lett. 588, 1205-1211 (2014).  Salameh A, et al. Signal transduction and transcriptional control of cardiac connexin43 up-regulation after alpha 1-adrenoceptor stimulation. J Pharmacol Exp Ther. 326, 315-322 (2008).   Salomon D, Saurat JH, Meda P. Cell-to-cell communication within intact human skin. J Clin Invest. 82, 248-254 (1988).  Schalper KA, Palacios-Prado N, Orellana JA, Sáez JC. Currently used methods for identification and characterization of hemichannels. Cell Commun Adhes. 15, 207-218 (2008).   Schalper KA, et al. Modulation of gap junction channels and hemichannels by growth factors. Mol Biosyst. 8, 685-698 (2012).  Schubert AL, Schubert W, Spray DC, Lisanti MP. Connexin family members target to lipid raft domains and interact with caveolin-1. Biochemistry. 41, 5754-5764 (2002).  Schwartz MA. Integrins and extracellular matrix in mechanotransduction. Cold Spring Harbor Perspectives in Biology. 2, a005066 (2010).  Schwiebert EM, Zsembery A. Extracellular ATP as a signaling molecule for epithelial cells. Biochim Biophys Acta. 1615, 7-32 (2003).  Seger R, Krebs EG. The MAPK signaling cascade. FASEB J. 9, 726-735 (1995).  Sen CK, et al. Human skin wounds: a major and snowballing threat to public health and the economy. Wound Repair Regen. 17, 763-771 (2009).  Siller-Jackson AJ, et al. Adaptation of connexin 43-hemichannel prostaglandin release to mechanical loading. J Biol Chem. 283, 26374-26382 (2008).  Soares AR, et al. Gap junctional protein Cx43 is involved in the communication between extracellular vesicles and mammalian cells. Sci Rep. 5, 13243 (2015). 216  Soder BL, et al. The connexin43 carboxyl-terminal peptide ACT1 modulates the biological response to silicone implants. Plast Reconstr Surg. 123, 1440-1451 (2009).  Solan JL, Lampe PD. Connexin43 phosphorylation: structural changes and biological effects. Biochem J. 419, 261-272 (2009).   Solan JL, Lampe PD. Specific Cx43 phosphorylation events regulate gap junction turnover in vivo. FEBS Lett. 588, 1423-1429 (2014).   Sosinsky GE, et al. The C-terminus of connexin43 adopts different conformations in the Golgi and gap junction as detected with structure-specific antibodies. Biochem J. 408, 375-385 (2007).  Stains JP, Watkins MP, Grimston SK, Hebert C, Civitelli R. Molecular mechanisms of osteoblast/osteocyte regulation by connexin43. Calcif Tissue Int 94, 55-67 (2014).   Steffensen B, Häkkinen L, Larjava H. Proteolytic events of wound-healing--coordinated interactions among matrix metalloproteinases (MMPs), integrins, and extracellular matrix molecules. Crit Rev Oral Biol Med. 12, 373-398 (2001).  Stoick-Cooper CL, Moon RT, Weidinger G. Advances in signaling in vertebrate regeneration as a prelude to regenerative medicine. Genes Dev.21, 1292-1315 (2007).  Sullivan R, et al. Structure, sequence and expression of the mouse Cx43 gene encoding connexin 43. Gene 130, 191-199 (1993).  Sutcliffe JE, et al. Abnormal connexin expression in human chronic wounds. Br J Dermatol. 173, 1205-1215 (2015).  Szpaderska AM, Zuckerman JD, DiPietro LA. Differential injury responses in oral mucosal and cutaneous wounds. J Dent Res. 82, 621-626 (2003).  Tarzemany R, Jiang G, Jiang JX, Larjava H, Häkkinen L. Connexin 43 Hemichannels Regulate the Expression of Wound Healing-Associated Genes in Human Gingival Fibroblasts. Sci Rep. 7, 14157 (2017).  Tarzemany R, Jiang G, Larjava H, Häkkinen L. Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts. PLoS One. 10, e0115524 (2015).  Teimouri H, Kolomeisky AB. New Model for Understanding Mechanisms of Biological Signaling: Direct Transport via Cytonemes. J Phys Chem Lett. 7, 180-185 (2016).   Thévenin AF, et al. Proteins and mechanisms regulating gap-junction assembly, internalization, and degradation. Physiology (Bethesda). 28, 93-116 (2013).   217  Thulabandu V, Chen D, Atit RP. Dermal fibroblast in cutaneous development and healing. Wiley Interdiscip Rev Dev Biol. 7, (2018).  Trovato-Salinaro A, et al. Altered intercellular communication in lung fibroblast cultures from patients with idiopathic pulmonary fibrosis. Respir Res. 7, 122 (2006).  Turabelidze A, et al. Intrinsic Differences between Oral and Skin Keratinocytes. PLoS One. 9, e101480 (2014).   van Beurden HE, Snoek PA, Von den Hoff JW, Torensma R, Kuijpers-Jagtman AM. Fibroblast subpopulations in intra-oral wound healing. Wound Repair Regen. 11, 55-63 (2003).  Verheule S, van Kempen MJ, te Welscher PH, Kwak BR, Jongsma HJ. Characterization of gap junction channels in adult rabbit atrial and ventricular myocardium. Circ Res. 80, 673-681 (1997).  Vinken, M. Gap junctions and non-neoplastic liver disease. J Hepatol. 57, 655-662 (2012).  Vinken M, et al. Non-channel functions of connexins in cell growth and cell death. Biochim Biophys Acta. 1818, 2002-2008 (2012).   Vreeburg M, et al. Skin changes in oculodento-digital dysplasia are correlated with C- terminal truncations of connexin 43. Am J Med Genet A. 143, 360-363 (2007).  Walmsley GG, et al. Live fibroblast harvest reveals surface marker shift in vitro. Tissue Eng Part C Methods. 21, 314-321 (2015).  Wang CM, Lincoln J, Cook JE, Becker DL Abnormal connexin expression underlies delayed wound healing in diabetic skin. Diabetes. 56, 2809-2817 (2007).  Wang N, et al. Connexin targeting peptides as inhibitors of voltage- and intracellular Ca2+ -triggered Cx43 hemichannel opening. Neuropharmacology. 75, 506-516 (2013).  Wang N, et al. Selective inhibition of Cx43 hemichannels by Gap19 and its impact on myocardial ischemia/reperfusion injury. Basic Res Cardiol. 108, 309 (2013).  Wang R. et al. Lipid rafts control human melanoma cell migration by regulating focal adhesion disassembly. Biochim Biophys Acta. 1833, 3195-3205 (2013).  Wang PH, Huang BS, Horng HC, Yeh CC, Chen YJ. Wound healing. J Chin Med Assoc. S1726-4901, 30308-8 (2017).  Wang J, et al. Deep dermal fibroblasts contribute to hypertrophic scarring. Laboratory Investigation. 88, 1278-1290 (2008).  218  Wang X, Bukoreshtliev NV, Gerdes HH. Developing neurons form transient nanotubes facilitating electrical coupling and calcium signaling with distant astrocytes. PLoS ONE. 7, e47429 (2012).  Werner S, Krieg T, Smola H. Keratinocyte-fibroblast interactions in wound healing. J Invest Dermatol. 127, 998-1008 (2007).   Willebrords J, et al. Connexins and their channels in inflammation. Crit Rev Biochem Mol Biol. 51, 413-439 (2016).  Wiszniewski L, Limat A, Saurat JH, Meda P, Salomon D. Differential expression of connexins during stratification of human keratinocytes. J Invest Dermatol.  115, 278-85 (2000).  Wong JW, et al. Wound healing in oral mucosa results in reduced scar formation as compared with skin: evidence from the red Duroc pig model and humans. Wound Repair Regen. 17, 717-729 (2009).   Wong P, Laxton V, Srivastava S, Chan YW, Tse G. The role of gap junctions in inflammatory and neoplastic disorders (Review). Int J Mol Med. 39, 498-506 (2017).   Wong P, et al. The Role of Connexins in Wound Healing and Repair: Novel therapeutic approaches. Front Physiol. 7, 596 (2016).  Wong VW, Longaker MT, Gurtner GC. Soft tissue mechanotransduction in wound healing and fibrosis. Semin Cell Dev Biol. 23, 981-986 (2012).  Wright CS, Pollok S, Flint DJ, Brandner JM, Martin PE. The connexin mimetic peptide Gap27 increases human dermal fibroblast migration in hyperglycemic and hyperinsulinemic conditions in vitro. J Cell Physiol. 227, 77-87 (2012).   Wright CS, van Steensel MA, Hodgins MB, Martin PE. Connexin mimetic peptides improve cell migration rates of human epidermal keratinocytes and dermal fibroblasts in vitro. Wound Repair Regen. 17, 240-249 (2009).  Xu X, et al. gingivae contain neural-crest- and mesoderm-derived mesenchymal stem cells. J Dent Res. 92, 825-832 (2013).  Yamada KM, Cukierman E. Modeling tissue morphogenesis and cancer in 3D. Cell.  130, 601-610 (2007).  Yamaoka Y, Sawa Y, Ebata N, Ibuki N, Yoshida S Cultured periodontal ligament fibroblasts express diverse connexins. Tissue Cell. 34, 375-380 (2002).  Yates CC, et al. Improved transplanted stem cell survival in a polymer gel supplemented with tenascin-C accelerates healing and reduces scarring of murine skin wounds. Cell Transplant. 26, 219  103-113 (2017).  Ye P, Chapple CC, Kumar RK, Hunter N. Expression patterns of E-cadherin, involucrin, and connexin gap junction proteins in the lining epithelia of inflamed gingiva. J Pathol 192: 58-66 (2000).  Zhang XF, Cui X. Connexin 43: Key roles in the skin. Biomed Rep. 6, 605-611 (2017).  Zhou JZ, Jiang JX. Gap junction and hemichannel-independent actions of connexins on cell and tissue functions--an update. FEBS Lett. 588, 1186-1192 (2014).    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0364278/manifest

Comment

Related Items