UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Biological control of common postharvest diseases of apples with Pseudomonas fluorescens and potential… Wallace, Rhiannon Louise 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_may_wallace_rhiannon.pdf [ 19.45MB ]
Metadata
JSON: 24-1.0364036.json
JSON-LD: 24-1.0364036-ld.json
RDF/XML (Pretty): 24-1.0364036-rdf.xml
RDF/JSON: 24-1.0364036-rdf.json
Turtle: 24-1.0364036-turtle.txt
N-Triples: 24-1.0364036-rdf-ntriples.txt
Original Record: 24-1.0364036-source.json
Full Text
24-1.0364036-fulltext.txt
Citation
24-1.0364036.ris

Full Text

BIOLOGICAL CONTROL OF COMMON POSTHARVEST DISEASES OF APPLES WITH PSEUDOMONAS FLUORESCENS AND POTENTIAL MODES OF ACTION  by  Rhiannon Louise Wallace  B.Sc. (Hons.), The University of British Columbia Okanagan, 2013  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE COLLEGE OF GRADUATE STUDIES  (Biology)  THE UNIVERSITY OF BRITISH COLUMBIA  (Okanagan)  February 2018   © Rhiannon Louise Wallace, 2018  ii The following individuals certify that they have read, and recommend to the College of Graduate Studies for acceptance, a thesis/dissertation entitled:   BIOLOGICAL CONTROL OF COMMON POSTHARVEST DISEASES OF APPLES WITH PSEUDOMONAS FLUORESCENS AND POTENTIAL MODES OF ACTION   submitted by Rhiannon Louise Wallace  in partial fulfillment of the requirements of   the degree of   Doctor of Philosophy        .   Dr. Louise Nelson, Biology, Irving K. Barber School of Arts and Sciences  Supervisor Dr. Daniel Durall, Biology, Irving K. Barber School of Arts and Sciences Supervisory Committee Member Dr. Robert Lalonde, Biology, Irving K. Barber School of Arts and Sciences Supervisory Committee Member Dr. Deborah Roberts, School of Engineering, Faculty of Applied Science University Examiner Dr. Zamir Punja, Department of Biological Sciences, Simon Fraser University External Examiner  Additional Committee Members include: Dr. Danielle Hirkala, Adjunct Professor, Biology and Quality Development Projects Coordinator & Plant Pathologist, BC Tree Fruits Cooperative Supervisory Committee Member     iii Abstract  Postharvest diseases are a serious issue faced by the pome fruit industry worldwide.  Three major postharvest fungal pathogens, Penicillium expansum, Botrytis cinerea, and Mucor piriformis, commonly infect and rot apples in storage in British Columbia, Canada. Fungicides have been applied extensively to reduce postharvest loss, but pathogen resistance is emerging and public pressure to reduce fungicide use has led to increased research for safer alternatives such as biological control agents (BCAs). Three isolates of Pseudomonas fluorescens, 1-112, 2-28, and 4-6, isolated from the rhizosphere of pulse crops in Western Canada, were studied as potential BCAs under commercial cold and controlled atmosphere (CA) storage with apple varieties ‘Gala’, ‘McIntosh’, ‘Ambrosia’, and ‘Spartan’. Disease incidence and lesion diameters of apples inoculated with each of the three pathogens and biological control strains were determined after 15 weeks in commercial cold storage or varying periods of time in CA storage and compared with the fungicide Scholar® (fludioxonil) and the BCA BioSave® (Pseudomonas syringae). On apples, among the isolates of P. fluorescens tested, isolates 1-112 and 4-6 provided the best control of postharvest disease. Of all the biological and chemical treatments tested, Scholar® consistently performed the best, but when P. fluorescens isolate 4-6 was combined with sodium bicarbonate (SBC), the biological control activity of the antagonist was comparable to the fungicide. Overall, the efficacy of the P. fluorescens isolates varied with pathogen, apple variety, and storage environment. In dual culture and volatile tests, all three isolates or their metabolites significantly inhibited the mycelial growth and spore germination of P. expansum, B. cinerea, and M. piriformis in vitro. Scanning electron microscopy (SEM) indicated that all three P. fluorescens isolates adhered to the fungal hyphae of P. expansum, B. cinerea, and M.  iv piriformis in vitro and in vivo, and colonized the wounds of apples. The ability of P. fluorescens to compete for nutrients and space, form a biofilm and produce inhibitory metabolites that target spore germination and mycelial growth may be the basis for its biological control capabilities. Collectively, these results suggest that P. fluorescens has potential to control common postharvest fungal pathogens during commercial storage. v  Lay Summary  Fruit losses due to postharvest decay caused by fungal pathogens not only cause a large economic burden to the fresh fruit industry, but also contribute to food shortages around the globe. Chemicals have been the predominant means to combat postharvest fruit losses, but consumer concerns about chemical residues on the fruit and the development of resistance by the fungal pathogens have led to research on alternative control strategies. The overarching objective of this PhD project was to assess the potential of Pseudomonas fluorescens isolates to control common postharvest diseases of apples in commercial storage and to study the mechanisms of action of the bacteria. P. fluorescens was able to inhibit common postharvest pathogens of apple in commercial storage and in vitro results indicated that the bacteria utilized a variety of mechanisms to inhibit fungal growth, suggesting that P. fluorescens is a promising alternative strategy to control postharvest diseases of apples.   vi Preface  A version of Chapter 3 has been published as a journal article. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2017. Postharvest biological control of blue mold of apple by Pseudomonas fluorescens during commercial storage and potential modes of action. Postharvest Biology & Technology 133, 1-11. I conducted the experiments, collected the data, conducted the analyses, and wrote the manuscript. A version of Chapter 4 has been published as a journal article. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2018. Mechanisms of action of three isolates of Pseudomonas fluorescens active against postharvest grey mold decay of apple during commercial storage. Biological Control 117, 13-20. I conducted the experiments, collected the data, conducted the analyses, and wrote the manuscript. A version of Chapter 5 has been submitted to the Canadian Journal of Microbiology for publication. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2018. Efficacy of Pseudomonas fluorescens for control of Mucor rot of apple during commercial storage and potential modes of action. I conducted the experiments, collected the data, conducted the analyses, and wrote the version presented in this thesis. Please see the first pages of these chapters to see footnotes with similar information. A version of Chapter 6 will be submitted as a journal article (Wallace, R.L., Hirkala, D.L., Nelson, L.M. Control of postharvest apple decay with bacterial antagonists in combination with low-doses of chemicals and controlled atmosphere storage). I conducted the experiments, collected the data, conducted the analyses, and wrote the manuscript. I also co-authored the following paper during my PhD study: Wallace, R.L., Hirkala, D.L., Nelson, L.M., 2016. Biological control of Botrytis cinerea, Penicillium expansum, and  vii Mucor piriformis on 'Gala' and 'McIntosh' apples using Pseudomonas fluorescens strains. Acta Hort. 1144, 113-120.  viii Table of Contents  Abstract ................................................................................................................................... iii Lay Summary .......................................................................................................................... v Preface ..................................................................................................................................... vi Table of Contents ................................................................................................................. viii List of Tables ......................................................................................................................... xii List of Figures ........................................................................................................................ xx List of Abbreviations ......................................................................................................... xxvi Acknowledgements .......................................................................................................... xxviii Chapter 1: Introduction ......................................................................................................... 1 1.1 Objectives and Hypotheses........................................................................................... 3 1.2 Outline of the Thesis ..................................................................................................... 5 Chapter 2: Literature Review ................................................................................................ 6 2.1 Commercial Apple Production and Storage in British Columbia ........................... 6 2.2 Postharvest Fungal Pathogens of Pome Fruit .......................................................... 10 2.2.1 Botrytis cinerea ...................................................................................................... 10 2.2.2 Mucor piriformis .................................................................................................... 14 2.2.3 Penicillium expansum ............................................................................................ 19 2.3 Commercial Disease Control Strategies .................................................................... 22 2.4 Biological Control Agents ........................................................................................... 27 2.5 Mechanisms of Biological Control ............................................................................. 33 2.5.1 Competition for nutrients and space ...................................................................... 34 2.5.2 Antibiosis ............................................................................................................... 36 2.5.3 Parasitism ............................................................................................................... 38 2.5.4 Induction of host resistance ................................................................................... 39 2.6 Improvement of Biological Control ........................................................................... 40 Chapter 3: Postharvest Biological Control of Blue Mold of Apple by Pseudomonas fluorescens During Commercial Storage and Potential Modes of Action ....................... 44 3.1 Background ................................................................................................................. 44  ix 3.2 Materials and Methods ............................................................................................... 46 3.2.1 Antagonists ............................................................................................................ 46 3.2.2 Pathogen ................................................................................................................. 46 3.2.3 Fruit ........................................................................................................................ 47 3.2.4 Biological control activity on apples ..................................................................... 48 3.2.5 Biological control activity in vitro ......................................................................... 49 3.2.6 Detection of antibiotic biosynthesis genes ............................................................. 51 3.2.7 Production of lytic enzymes ................................................................................... 55 3.2.8 Scanning Electron Microscopy in vitro ................................................................. 55 3.2.9 Scanning Electron Microscopy in vivo .................................................................. 56 3.2.10 Data analysis ........................................................................................................ 57 3.3 Results .......................................................................................................................... 57 3.3.1 Biological control activity in vivo .......................................................................... 57 3.3.2 Biological control activity in vitro ......................................................................... 60 3.3.3 Presence of antibiotic biosynthesis genes in P. fluorescens .................................. 62 3.3.4 Lytic enzyme production by P. fluorescens ........................................................... 63 3.3.5 Scanning Electron Microscopy in vitro ................................................................. 63 3.3.6 Scanning Electron Microscopy in vivo .................................................................. 64 3.4 Discussion .................................................................................................................... 66 Chapter 4: Mechanisms of Action of Three Isolates of Pseudomonas fluorescens Active Against Postharvest Grey Mold Decay of Apple During Commercial Storage .............. 73 4.1 Background ................................................................................................................. 73 4.2 Materials and Methods ............................................................................................... 75 4.2.1 Antagonists ............................................................................................................ 75 4.2.2 Pathogen ................................................................................................................. 76 4.2.3 Fruit and physiological quality parameters ............................................................ 76 4.2.4 Antagonism in vivo ................................................................................................ 76 4.2.5 Antagonism in vitro ............................................................................................... 77 4.2.6 Scanning Electron Microscopy in vivo .................................................................. 79 4.2.7 Biofilm formation .................................................................................................. 79 4.2.8 Data analysis .......................................................................................................... 80  x 4.3 Results .......................................................................................................................... 80 4.3.1 Antagonism in vivo ................................................................................................ 80 4.3.2 Antagonism in vitro ............................................................................................... 83 4.3.3 Scanning electron microscopy in vivo ................................................................... 86 4.3.4 Biofilm formation .................................................................................................. 88 4.4 Discussion .................................................................................................................... 89 Chapter 5: Biological Control of Mucor Rot of Apple by Pseudomonas fluorescens During Commercial Storage and Potential Modes of Action ........................................... 94 5.1 Background ................................................................................................................. 94 5.2 Materials and Methods ............................................................................................... 96 5.2.1 Antagonists ............................................................................................................ 96 5.2.2 Pathogen ................................................................................................................. 96 5.2.3 Fruit ........................................................................................................................ 97 5.2.4 Antagonism in vivo ................................................................................................ 97 5.2.5 Antagonism in vitro ............................................................................................... 97 5.2.6 Scanning Electron Microscopy in vitro ................................................................. 99 5.2.7 Scanning Electron Microscopy in vivo .................................................................. 99 5.2.8 Data analysis .......................................................................................................... 99 5.3 Results ........................................................................................................................ 100 5.3.1 Fruit quality characteristics .................................................................................. 100 5.3.2 Antagonism in commercial cold storage .............................................................. 101 5.3.3 Mechanisms of antagonism, in vitro .................................................................... 104 5.3.4 Bacterial-fungal interaction ................................................................................. 106 5.4 Discussion .................................................................................................................. 109 Chapter 6: Control of Postharvest Apple Decay with Bacterial Antagonists in Combination with Low-Doses of Chemicals and Controlled Atmosphere Storage ...... 115 6.1 Background ............................................................................................................... 115 6.2 Materials and Methods ............................................................................................. 118 6.2.1 Antagonists .......................................................................................................... 118 6.2.2 Pathogens ............................................................................................................. 119 6.2.3 Fruit ...................................................................................................................... 119  xi 6.2.4 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA in vitro .................................................................................................... 119 6.2.5 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA on apples in cold storage ........................................................................ 120 6.2.6 Biological control activity of P. fluorescens on apples in CA storage ................ 121 6.2.7 Data analysis ........................................................................................................ 121 6.3 Results ........................................................................................................................ 122 6.3.1 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA in vitro .................................................................................................... 122 6.3.2 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA on apples in cold storage ........................................................................ 125 6.3.3 Biological control activity of P. fluorescens on apples in CA storage ................ 128 6.4 Discussion .................................................................................................................. 131 Chapter 7: Conclusion ........................................................................................................ 137 7.1 General Discussion .................................................................................................... 137 7.2 Future Research Directions ..................................................................................... 146 References ............................................................................................................................ 149 Appendices ........................................................................................................................... 174 Appendix A: Culture Media Recipes ............................................................................ 174 Appendix B: P. fluorescens Standard Calibration Curves ......................................... 177 Appendix C: Apple Starch Assessments ....................................................................... 180 Appendix D: Supplementary Commercial Storage Data ............................................ 185   xii List of Tables  Table 2.1  Commercial management strategies to control postharvest decay development of apples after harvest in Canada. .................................................................... 26  Table 2.2  Biological control agents that have been commercialized for management of postharvest decay (Modified from Wisniewski et al., 2016). .......................... 29  Table 3.1  Target antibiotic genes and primers used in polymerase chain reaction analysis of P. fluorescens DNA. .................................................................................... 53  Table 3.2  Physiological fruit quality characteristics of untreated ‘McIntosh’ and ‘Spartan’ apples after 15 weeks in commercial cold storage trials, 2015-16. .. 60  Table 3.3  Effect of P. fluorescens isolates, 1-112, 2-28 or 4-6 (108 CFU mL-1) on conidial germination of P. expansum (106 conidia mL-1) in filter-sterilized apple juice. ....................................................................................................... 61  Table 3.4  Effect of volatile organic compounds (VOCs) produced by three isolates of P. fluorescens isolates 1-112, 2-28 and 4-6 on the germination of conidia of P. expansum on ¼ tryptic soy agar/potato dextrose agar plates. .......................... 61  Table 3.5  Production of extracellular hydrolytic enzymes by P. fluorescens isolates 1-112, 2-28 and 4-6. ............................................................................................ 63  Table 4.1  Physiological fruit quality characteristics of apples prior to commercial storage, 2014-15. .............................................................................................. 81  Table 4.2  Effect of cell-free supernatant (CFS) or volatile organic compounds (VOCs) produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the mycelial growth of B. cinerea after 72 h incubation at 20°C. ........................................ 85   xiii Table 5.1  Physiological fruit quality characteristics of apples after 15 weeks in commercial cold storage at 0°C, 2014-15. ..................................................... 100  Table 5.2  Effect of cell-free supernatant (CFS) or volatile organic compounds (VOCs) produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the mycelial growth of M. piriformis after 72 h incubation at 20oC. .................................. 105  Table 5.3  Spore germination of M. piriformis incubated with P. fluorescens, isolates 1-112, 2-28, and 4-6, living cells or cell-free supernatant (CFS) in filter-sterilized apple juice at 20°C for 14 h. ........................................................................... 106  Table 6.1  Effect of P. fluorescens isolate 4-6 alone or in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) in comparison to the registered biological control agent, BioSave® and fungicide, Scholar® on the control of B. cinerea, M. piriformis and P. expansum in 'Ambrosia' apples. .......................................................................................... 127  Table 6.2  Effect of P. fluorescens isolate 4-6 alone or in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) in comparison to the registered biological control agent, BioSave® and fungicide, Scholar® on the control of B. cinerea, M. piriformis and P. expansum in 'Ambrosia' apples. .......................................................................................... 128  Table 7.1  Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against P. expansum. ........................................................................................................................ 144  Table 7.2  Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to  xiv positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against B. cinerea. .. 145  Table 7.3  Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against M. piriformis. ........................................................................................................................ 146  Table D.1  Physiological fruit quality characteristics of apples prior to commercial cold storage, 2014-15. ............................................................................................ 185  Table D.2  Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2014-15. .................................................................................... 185  Table D.3  Physiological fruit quality characteristics of apples prior to commercial storage, 2015-16. ............................................................................................ 186  Table D.4  Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2015-16. .................................................................................... 186  Table D.5  Physiological fruit quality characteristics of apples prior to commercial storage, 2016-17. ............................................................................................ 186  Table D.6  Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2016-17. .................................................................................... 187  Table D.7  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2014-15. ................................................................................................................... 187   xv Table D.8  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2015-16. ............................................................. 188  Table D.9  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2016-17. ............................................................. 188  Table D.10  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2014-15. ......................................................................................................... 189  Table D.11  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2015-16. ......................................................... 189  Table D.12  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2016-17. ......................................................... 190  Table D.13  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2014-15. ......................................................................................................... 190   xvi Table D.14  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2015-16. ............................................................. 191  Table D.15  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2016-17. ............................................................. 191  Table D.16  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2014-15. ......................................................................................................... 192  Table D.17  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2015-16. ......................................................... 192  Table D.18  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2016-17. ......................................................... 193  Table D.19  Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'Ambrosia' apples after 15 weeks in cold storage at 0°C, 2015-16. ............................................ 194   xvii Table D.20  Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'Ambrosia' apples after 15 weeks in cold storage at 0°C, 2016-17. ............................................ 195  Table D.21  Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'McIntosh' apples after 15 weeks in cold storage at 0°C, 2015-16. ............................................ 196  Table D.22  Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'McIntosh' apples after 15 weeks in cold storage at 0°C, 2016-17. ............................................ 197  Table D.23  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Gala' apples after 20 weeks in commercial controlled atmosphere storage at 0°C, 2014-15. ............................................ 198  Table D.24  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Gala' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2015-16. ......... 198  Table D.25  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Gala' apples after 33  xviii weeks in commercial controlled atmosphere storage plus two weeks in commercial cold storage at 0°C, 2016-17. ..................................................... 199  Table D.26  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'McIntosh' apples after 10 weeks in commercial controlled atmosphere storage at 0°C, 2014-15. ............................................ 199  Table D.27  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'McIntosh' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2015-16. .... 200  Table D.28  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'McIntosh' apples after 33 weeks in commercial controlled atmosphere storage plus 2 weeks in commercial cold storage at 0°C, 2016-17. ..................................................... 200  Table D.29  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Spartan' apples after 25 weeks in commercial controlled atmosphere storage at 0°C, 2014-15. ............................................ 201  Table D.30  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Spartan' apples after 14 weeks in commercial controlled atmosphere storage at 0°C, 2015-16. ......... 201  Table D.31  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the  xix postharvest fungal pathogen Penicillium expansum on 'Spartan' apples after 11 weeks in commercial controlled atmosphere storage at 0°C, 2016-17. ......... 202  Table D.32  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Ambrosia' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2014-15. ............................................ 202  Table D.33  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Ambrosia' apples after 10 weeks in commercial controlled atmosphere storage at 0°C, 2015-16. .... 203  Table D.34  Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Ambrosia' apples after 11 weeks in commercial controlled atmosphere storage at 0°C, 2016-17. .... 203  Table D.35  Effect of cell-free supernatant produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the spore germination of P. expansum after 72 h incubation at 20°C. ............................................................................................................... 204   xx List of Figures  Figure 2.1  B. cinerea A) colony on PDA medium with numerous black sclerotia, B) electron micrograph of conidiophores and conidia and C) ‘Gala’ apple completely decayed by grey mold. ................................................................... 11  Figure 2.2  Postharvest disease cycle of the causal agent of grey mold on apple, B. cinerea (anamorph) and Botryotinia fuckeliana (teleomorph). ..................................... 13  Figure 2.3  M. piriformis A) colony on PDA medium, B) electron micrograph of ruptured sporangia containing sporangiospores and C) ‘Ambrosia’ apple infected with Mucor rot. ......................................................................................................... 15  Figure 2.4  Postharvest disease cycle of the causal agent of Mucor rot on apple, M. piriformis. ......................................................................................................... 18  Figure 2.5  P. expansum A) colony on PDA medium, B) electron micrograph of conidiophores and conidia and C) ‘McIntosh’ apple infected with blue mold.  .......................................................................................................................... 20  Figure 2.6  Postharvest disease cycle of the causal agent of blue mold of apple, P. expansum. ......................................................................................................... 21  Figure 3.1  Blue mold lesion diameter and disease incidence of ‘McIntosh’ (A & B) and ‘Spartan’ (C & D) apples inoculated with the fungal pathogen P. expansum after 15 weeks in commercial cold storage at 0°C. Apples treated with P. expansum were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2015-16 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). ................................................................................................................ 59  xxi  Figure 3.2  Inhibitory effect of P. fluorescens isolates, 1-112, 2-28 and 4-6, on mycelial growth of P. expansum in vitro on ¼ tryptic soy agar/potato dextrose agar after 5 d of incubation at 20°C. Each value is the mean of 5 replicates ± standard error. Different letters indicate significant differences according to Tukey’s test (P < 0.05). ........................................................................................................ 60  Figure 3.3  Agarose gel showing the polymerase chain reaction amplification of A) 587 bp fragments and B) 1050 bp fragments for hydrogen cyanide and phenazine-carboxylic acid biosynthesis genes in P. fluorescens, respectively. ................ 62  Figure 3.4  Scanning electron micrograph of healthy P. expansum hyphae (h) and conidia (c) (A) and P. expansum interacting with P. fluorescens (p) isolate 1-112 (B), 2-28 (C) and 4-6 (D) on ¼ tryptic soy agar/potato dextrose agar after 5 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens. ....................................................................................................... 64  Figure 3.5  Scanning electron micrograph of healthy P. expansum hyphae (h) and conidia (c) (A) and P. expansum interacting with P. fluorescens (p) isolate 1-112 (B), 2-28 (C) and 4-6 (D) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens. ....................................... 66  Figure 4.1  Grey mold lesion diameter and disease incidence of ‘Ambrosia’ (A & B) and ‘Spartan’ (C & D) apples after 15 weeks in commercial cold storage at 0°C. Apples treated with B. cinerea were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). ............................................................... 83  Figure 4.2  Effect of P. fluorescens, isolates 1-112, 2-28 and 4-6, living cells or cell-free supernatant (CFS) on spore germination of B. cinerea in filter-sterilized apple  xxii juice after 14 h incubation at 20°C. Each value is the mean of 6 replicates ± standard error from two independent experiments. Different letters indicate significant differences according to Tukey’s ................................................... 84  Figure 4.3  Scanning electron micrographs of healthy B. cinerea hyphae (h) and spores (s) (A & B) and B. cinerea interacting with P. fluorescens (p) isolates 1-112 (C & D), 2-28 (E & F) and 4-6 (G & H) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens. .............. 88  Figure 4.4  Assessment of biofilm formation by P. fluorescens isolates 1-112, 2-28 and 4-6 on polystyrene plastic when incubated in A) tryptic soy broth (TSB) or B) filter-sterilized apple juice (FSAJ) at 20°C. Each value is the mean of 3 replicates ± standard error. Different letters at each time point indicate significant differences according to Tukey’s test (P < 0.05). .......................... 89  Figure 5.1  Mucor rot lesion diameter on A) ‘Gala’, B) ‘McIntosh’, C) ‘Ambrosia’, and D) ‘Spartan’ apples after 15 weeks in cold storage at 0°C. Apples were inoculated with the fungal pathogen, M. piriformis, and subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). ............................................................. 102  Figure 5.2  Mucor rot disease incidence on A) ‘Gala’, B) ‘McIntosh’, C) ‘Ambrosia’, and D) ‘Spartan’ apples after 15 weeks in cold storage at 0°C. Apples were inoculated with the fungal pathogen, M. piriformis, and subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). ........................ 104  xxiii  Figure 5.3  Scanning electron micrographs of antagonistic P. fluorescens (p) isolates 1-112 (A & B), 2-28 (C), and 4-6 (D) interacting with M. piriformis hyphae (h) and spores (s) on ¼ tryptic soy agar/potato dextrose agar after 5 d incubation at 20°C. ............................................................................................................... 107  Figure 5.4  Scanning electron micrographs of healthy M. piriformis hyphae (h) and sporangia (sp) (A & B) and M. piriformis hyphae and spores (s) interacting with P. fluorescens (p) isolates 1-112 (C & D), 2-28 (E & F) and 4-6 (G & H) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens. ........................................................................... 109  Figure 6.1  Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on the mycelial growth of B. cinerea on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean ± standard error from two independent experiments. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05). ................................................................................... 123  Figure 6.2  Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on mycelial growth of M. piriformis on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean of three replicates ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05). .............................................................................................................. 124  Figure 6.3  Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on mycelial growth of P. expansum on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean of three replicates ± standard error. Means followed by a  xxiv common letter are not significantly different according to Tukey's test (P < 0.05). .............................................................................................................. 125  Figure 6.4  Grey mold A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 15 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with B. cinerea were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). ................................................................................................ 129  Figure 6.5  Mucor rot A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 15 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with M. piriformis were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). .................................................................................. 130  Figure 6.6  Blue mold A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 10 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with P. expansum were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates of 10 apples each ± standard error from a single experiment (2015-16 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05). .................................................................................. 131   xxv Figure B.1  Standard calibration curve for the microbial antagonist P. fluorescens isolate 1-112 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Nelson lab, 2007). ......................................................................... 177  Figure B.2  Standard calibration curve for the microbial antagonist P. fluorescens isolate 2-28 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Wallace, 2014). .............................................................................. 178  Figure B.3  Standard calibration curve for the microbial antagonist P. fluorescens isolate 4-6 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Nelson lab, 2007). ......................................................................... 179  Figure C.1  Iodine solution preparation procedure (BCTFC, 2006). ................................ 180  Figure C.2  ‘Ambrosia’ apple starch chart (BCTFC, 2006). ............................................. 181  Figure C.3  ‘Royal Gala’ apple starch chart (BCTFC, 2011). ........................................... 182  Figure C.4  ‘McIntosh’ apple starch chart (BCTFC, 2011). ............................................. 183  Figure C.5  ‘Spartan’ apple starch chart (BCTFC, 2011). ................................................ 184	   xxvi List of Abbreviations   ANOVA analysis of variance ATCC American type culture collection BCA biological control agent BCTFC British Columbia Tree Fruits Cooperative BCTFPG British Columbia tree fruit production guide CA controlled atmosphere CaCl2 calcium chloride CFS cell-free supernatant CFU colony forming units CHC Canadian Horticulture Council CO2 carbon dioxide DAPG 2,4-diacetylphloroglucinol  DNA deoxyribonucelic acid FAO Food and Agriculture Organization of The United Nations  FSAJ filter-sterilized apple juice GLM general linear model GRAS generally regarded as safe HCN hydrogen cyanide IDT integrated DNA technologies NRRL Northern Regional Research Laboratory O2 oxygen OD optical density OMAFRA Ontario Ministry of Agriculture Food and Rural Affairs  PAL phenylalanine ammonia-lyase PCA phenazine-1-carboxylic acid  PCR polymerase chain reaction PDA potato dextrose agar PDB potato dextrose broth  xxvii Plt pyoluteorin POD peroxidase PPO polyphenol oxidase PR pathogenesis-related Prn pyrrolnitrin SA salicylic acid SBC sodium bicarbonate SEM scanning electron microscopy TA titratable acidity TSA tryptic soy agar TSB tryptic soy broth TSS total soluble solids UBC University of British Columbia UBCO University of British Columbia Okanagan Campus VOC volatile organic compound WSU Washington State University    xxviii Acknowledgements   I would like to extend my sincere appreciation to my supervisor, Dr. Louise Nelson for her support and guidance throughout my graduate studies. Thank you for allowing me to join your lab as an honors student 5 years ago and giving me the opportunity to pursue a graduate degree, an option I had not even considered until I started in your lab. I would also like to extend my sincere thanks to my supervisory committee members, Dr. Daniel Durall, Dr. Robert Lalonde, and Dr. Danielle Hirkala for their constructive feedback on my project and challenging questions which have broadened my thinking and deepened my understanding of the scientific process. Special thanks to Mr. Michael Weis, without your electron microscopy expertise, the SEM aspects of my research would not have been possible. Thank you for your patience, expertise and time.  I would also like to thank the members of the Nelson lab, Geet Hans, Tanja Voegel, Paige Munro, Ravnit Latchman, Melissa Larrabee, and Tirhas Mebratu, for your friendship and providing me with an enjoyable community experience as a graduate student at The University of British Columbia Okanagan Campus (UBCO). A special thank you to Tristan Watson for 5 years of stimulating discussions, constructive criticism, and hours of editing that you have provided me. Processing thousands of apples each year would not have been possible without the help of many honours students; Mackenzie Cairns, Paige Munro, Ariel Smith, Ravnit Latchman, Melissa Larrabee, Amanda Sambrielaz; directed studies students: Liam Nolan and Hanujah Ganesh; and countless work study students and volunteers. Thank you for making our commercial storage trials possible.  xxix I would like to thank UBCO for providing me with several scholarships over the course of my degree. I would also like to thank the Canadian Horticulture Council (CHC) and Agriculture and Agri-Food Canada for funding this research project. I would further like to thank the British Columbia Tree Fruits Cooperative (BCTFC) for the donation of the apples, use of their commercial storage facilities and their quality development lab in Winfield, BC; Dr. Peter Toivonen of Agriculture and Agri-Food Canada Summerland Research and Development Centre, Summerland, BC for the use of his lab for the TA analysis and Lucie Grant (Jet Harvest Solutions, FL) for kindly providing BioSave®. Thank you to Jim Swezey from the United States Department of Agriculture - Agricultural Research Service Culture Collection for providing Pseudomonas fluorescens 2-79, and Dr. Peter Sholberg from Agriculture and Agri-Food Canada - Summerland Research and Development Centre for providing P. expansum Link strain 1790, B. cinerea Pers.:Fr strain 27, and M. piriformis Fischer strain 563.  Finally, I would like to thank my family for supporting me throughout my time as a “career student”. They have taught me about hard work, discipline and independence. Grams, I am especially grateful for your support, love and encouragement throughout my educational journey at UBCO. You have always been there for me as a listening ear, voice of reason, and, at times, that extra push I needed to step out of my comfort zone. A special thanks to my significant other, Benoît Loriaux, your love, patience, understanding and encouragement have helped me get where I am today. Thank you for your constant support.    1 Chapter 1: Introduction  In Canada, apples are the largest tree fruit crop by volume and value, and a key contributor to the national horticulture sector (CHC, 2013). Fruits are an important part of the human diet because they are rich in vitamins and antioxidants, such as flavonoids and polyphenolics. Consumer awareness of the link between nutrition and health has resulted in an increased demand for fresh fruits. In the orchard apples are exposed to a variety of microorganisms capable of causing fruit decay. Fruit may become infected by postharvest fungal pathogens before, during or after harvest. Factors influencing postharvest decay development include: cultivar susceptibility, postharvest environment, fruit maturity stage, postharvest hygiene and preventative treatments. Postharvest diseases are classified as i) latent (quiescent) or ii) wound infections (Prusky et al., 2013). In quiescent infections, the pathogen initiates infection, but enters a period of inactivity until the physiological status of the host tissue changes in such a way that infection can continue (Prusky, 1996). In wound infections, and the focus of this thesis, disease arises from physical wounds or blemishes on the fruit surface incurred at harvest, during transportation or during processing at the packinghouse. In the Okanagan valley, BC, Canada, Botrytis cinerea, Mucor piriformis, and Penicillium expansum are the three most important postharvest fungal pathogens of apples causing grey mold, Mucor rot, and blue mold, respectively (Hirkala, personal communication). Decayed fruit not only pose an economic concern, but also several genera of fungi including Penicillium spp. and Alternaria spp. are known to produce mycotoxins under certain conditions (Coates and Johnson, 1997).   2 Traditionally, the development of mold on fruit has been controlled with chemical fungicides, such as Mertect® (a.i. thiabendazole) and Scholar® (a.i. fludioxonil) when permitted. The development of resistance to fungicides by the fungal pathogens and the public’s demand for produce without chemical residues has led to research for safer alternatives. Additionally, regulatory restrictions on the use of chemical fungicides (Droby et al., 2016) and the lack of continued approval of some of the most effective fungicides (Gullino and Kuijpers, 1994) have driven the search for alternative control strategies. Biological control, using microbial antagonists such as yeast or bacteria, has been shown to be a promising alternative to the use of chemical fungicides. A considerable amount of information is available regarding the efficacy of BCAs alone or in combination with low doses of fungicides or food additives. However, the mechanisms by which biological control agents (BCAs) inhibit pathogens in the postharvest system have not yet been fully elucidated (Di Francesco et al., 2016).  One of the best studied groups of bacteria for biological control of plant diseases is Pseudomonas. Within the genus Pseudomonas, P. fluorescens is a Gram-negative bacterium that naturally inhabits water, soil and plant surfaces (Pujol et al., 2005; Raaijmakers et al., 1999). The three isolates of P. fluorescens used in this study were isolated from the rhizosphere of pulse crops in Saskatchewan, Canada (Hynes et al., 2008), and previously had shown potential as BCAs on apple against blue mold, grey mold and Mucor rot (Nelson et al., 2011; Wallace et al., 2016). Adaptation of these bacteria to cold Canadian soils makes them ideal candidates for control of postharvest disease of apple during commercial storage. P. fluorescens has been studied extensively as a BCA for plant diseases in the rhizosphere (Bull et al., 1991; Van Wees et al., 1997; Raaijmakers et al., 1999; Wang et al., 2000), but   3 little is known of its potential as a BCA for postharvest diseases of apple (Etebarian et al., 2005; Peighami-Ashnaei et al. 2009). 1.1 Objectives and Hypotheses  Given the above gaps in knowledge, the specific objectives of the thesis were defined as: Objective #1 To investigate the ability of P. fluorescens isolates 1-112, 2-28 and 4-6 to suppress P. expansum (blue mold) on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples in commercial cold storage, and investigate their possible mechanisms of action in vitro.   Objective #2 To assess the antagonistic activity of three isolates of P. fluorescens to control B. cinerea (grey mold) under commercial cold storage conditions with four varieties of apple, ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’, and investigate possible mechanisms of action. Objective #3 To determine the biological control capability of three isolates of P. fluorescens against M. piriformis (Mucor rot) on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples in commercial cold storage, and investigate their possible mechanisms of action in vitro. Objective #4 To determine if the biological control activity of P. fluorescens could be enhanced when combined with calcium chloride (CaCl2), sodium bicarbonate (SBC), salicylic acid (SA) or controlled atmosphere (CA) storage against common postharvest fungal pathogens on ‘McIntosh’ and ‘Ambrosia’ apples in commercial storage. The overarching hypotheses of my thesis were i) that the bacterial antagonist, P. fluorescens isolates 1-112, 2-28 and 4-6, would provide levels of disease control of blue mold, grey mold, and Mucor rot of apples, during commercial storage, comparable to that of   4 the commercial biofungicide, BioSave®; ii) living cells of the antagonist or metabolites they produce would inhibit mycelial growth and spore germination of B. cinerea, M. piriformis, and P. expansum in vitro; and iii) the mechanisms of action of the three isolates of P. fluorescens would include the direct physical interaction of the antagonist with the pathogen, production of inhibitory metabolites and biofilm formation.   The first specific hypothesis of my thesis, which is addressed in chapter 3, is that P. fluorescens isolates 1-112, 2-28, and 4-6 will reduce the size of the lesion and disease incidence of blue mold on ‘Gala’, ‘McIntosh’, ‘Spartan’, and Ambrosia’ apples during commercial cold storage at 0°C, compared to apples that have not had the BCA applied. The second specific hypothesis of my thesis, which is addressed in chapter 4, is that P. fluorescens isolates 1-112, 2-28, and 4-6 will reduce the size of the lesion and disease incidence of grey mold on ‘Gala’, ‘McIntosh’, ‘Spartan’, and Ambrosia’ apples during commercial cold storage at 0°C, compared to apples that have not had the BCA applied. The third specific hypothesis of my thesis, which is addressed in chapter 5, is that P. fluorescens isolates 1-112, 2-28, and 4-6 will reduce the size of the lesion and disease incidence of Mucor rot on ‘Gala’, ‘McIntosh’, ‘Spartan’, and Ambrosia’ apples during commercial cold storage at 0°C, compared to apples that have not had the BCA applied. The fourth specific hypothesis of my thesis, which is addressed in chapter 6, is that the biological control activity of P. fluorescens isolate 4-6 will be enhanced when combined with CaCl2, SBC, or SA on ‘McIntosh’ and ‘Ambrosia’ apples during commercial cold storage at 0°C, compared to apples treated with the BCA alone. The fifth specific hypothesis of my thesis, which is addressed in chapter 6, is that P. fluorescens isolates 1-112, 2-28, and 4-6 will reduce the size of the lesion and disease   5 incidence of grey mold, Mucor rot, and blue mold on ‘Gala’, ‘McIntosh’, ‘Spartan’, and Ambrosia’ apples during commercial controlled atmosphere storage at 0°C, compared to apples that have not had the BCA applied. 1.2 Outline of the Thesis Chapter 2 will provide a detailed literature review of past and current research on postharvest diseases of apples and biological control. Chapter 3 will cover the first objective, assessing the potential of P. fluorescens to control blue mold on apples. The second objective, focusing on control of grey mold on apples by P. fluorescens, will be covered in Chapter 4. Objective 3, focusing on the potential biological control agent P. fluorescens to control Mucor rot will be covered in Chapter 5. Chapter 6 will cover objective 4, investigating the possibility of improving the efficacy of P. fluorescens to control common postharvest pathogens of apple. Finally, conclusions of the overall thesis research and future research directions will be discussed in Chapter 7.    6 Chapter 2: Literature Review  2.1 Commercial Apple Production and Storage in British Columbia In British Columbia apples (Malus domestica L.) are harvested from mid-August to mid-late October depending on the growing season and apple cultivar. Four major varieties of apples grown in British Columbia that are the focus of this thesis are as follows: ‘Gala’ apples originated in New Zealand in the 1920s and are a cross between ‘Golden Delicious’ and ‘Kidd’s Orange Red’ apple varieties (BC Tree, n.d.). ‘Gala’ apples, are harvested from late August to mid-September in BC. Harvest for this variety is based on starch conversion and ground colour change of the skin from green to a cream-white colour. Although production of ‘Gala’ apples is increasing throughout the world, they are susceptible to powdery mildew, apple scab, and fire blight caused by Podosphaera leucotricha, Venturia inaequalis, and Erwinia amylovora, respectively (BCTFPG, n.d.; (Ontario Ministry of Agriculture, Food and Rural affairs (OMAFRA), 2016).  ‘McIntosh’ apples originated in Ontario, where John McIntosh discovered an apple seedling on his land in 1811, but the parentage of this apple variety remains unknown (BC Tree, n.d.). ‘McIntosh’ apples are harvested right after ‘Gala’ apples in BC (early September). A change of the skin over-colour to red is one of the major criteria monitored when determining the harvest date for this variety of apple. Similar to ‘Gala’ apples, ‘McIntosh’ apples are susceptible to scab, powdery mildew, and fire blight (BC Tree, n.d.).  ‘Spartan’ apples were introduced in 1936 and were developed at the breeding program at the Agriculture and Agri-Food Canada Summerland Research and Development Centre in Summerland, BC (BC Tree, n.d.). ‘Spartan’ apples are a cross between ‘McIntosh’   7 and ‘Newtown Pippin’ (Agriculture and Agri-Food Canada, 2017). In BC ‘Spartan’ apples are generally harvested after ‘Gala’ and ‘McIntosh’, from mid to late September (BCTFPG, n.d.). Red over-colour in the skin and starch conversion are the main criteria that are used to determine the harvest date for this apple variety. ‘Spartan’ apples are moderately susceptible to scab and powdery mildew (AHDB Horticulture, n.d.).  ‘Ambrosia’ apples originated in BC from a chance seedling discovered in the 1990s (OMAFRA Ambrosia, 2009). Its parentage is not known, but the original orchard where the seedling was discovered was full of ‘Jonagold’, as well as ‘Golden Delicious’ and ‘Red Delicious’ (BC Tree, n.d.). ‘Ambrosia’ apples are generally harvested in late September to early October. The timing of harvest for this apple variety is based solely on starch conversion (BCTFPG, n.d.). In comparison to ‘Gala’, McIntosh’ and ‘Spartan’ apples, ‘Ambrosia’ is a relatively new apple variety, and as a result only limited information is presently available on its susceptibility to disease. Similar to ‘McIntosh’, ‘Ambrosia’ are very susceptible to apple scab, and have medium to high susceptibility to fire blight (OMAFRA Ambrosia, 2009).  For ‘Gala’, McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples, postharvest disease may occur on the tree through the calyx, lenticel or stalk-end between blossom and harvest (AHDB Horticulture, n.d.). At harvest the main source of fruit damage is from stem-end punctures (Hirkala, personal communication). At blossom and petal fall fruit is most susceptible to infection, but as the fruit develops throughout the growing season, its susceptibility to disease declines (AHDB Horticulture, n.d.).   Apples have a narrow window of time when they reach the correct maturity stage to be picked in order to ripen and develop the full flavour and aroma of that specific cultivar   8 (OMAFRA), 2016). However, at the time of harvest, the markets may be overstocked and the fruit may need to be placed in storage. Once harvested, fruit are either sold for immediate consumption or they are stored. If apples are harvested too late, then their storage life will be greatly reduced (OMAFRA, 2016). For example, over mature fruit may be too soft for long-term controlled atmosphere (CA) storage and will also be more susceptible to physical injury and thus infection by opportunistic postharvest fungal pathogens. Apples that are past their optimal maturity date will not only be more prone to physiological disorders such as watercore and internal breakdown, but they may also develop poor eating quality and off-flavors. The two main types of commercial storage used for apples in Canada are cold storage and CA storage. In commercial cold storage, the temperature is lowered to 0°C, while the atmosphere remains unchanged. Apple varieties ‘Gala’ and ‘Ambrosia’ may be placed in cold storage for up to 3.5 months, while ‘McIntosh’ is often only stored for 2 months as fruit quality deteriorates (British Columbia Tree Fruit Production Guide (BCTFPG), n.d.). Low storage temperatures reduce moisture loss, metabolic activity, and physiological changes in the apple that lead to ripening and senescence (Barkai-Golan, 2001). At temperatures close to 0°C, the mycelial growth and spore germination of fungal pathogens can be reduced directly and indirectly since ripening and senescence are delayed in the host. Although many postharvest pathogens, including B. cinerea, M. piriformis and P. expansum, have optimum temperatures for growth close to 20°C (Michailides and Spotts, 1990a; Errampalli, 2014; Xiao, 2014), they can still cause decay on apples at cold storage temperatures; thus, lowering the temperature alone is not sufficient to prevent postharvest disease. Due to the limitations of cold storage,   9 producers recognized the need for a more effective way to store fresh fruit and produce for longer periods of time. CA storage is a technology that was first developed in the 1930s (Kupferman, 2003). The primary objective of CA storage is to extend the marketing period of fresh fruit postharvest (Kupferman, 2003). During CA storage, fresh produce is stored in a sealed room in which the temperature, oxygen (O2), carbon dioxide (CO2) and humidity levels are all regulated (Coates and Johnson, 1997). For apples, the O2 levels are reduced to 1-4% and CO2 levels are increased to 2-5%; these combined conditions lower the respiration of the apples and the overall ripening process. To successfully store apples in CA storage, fruit should be harvested when they are physiologically mature, but not ripe (OMAFRA, 2016). Once apples are harvested, fruit bins should be transported the same day as the fruit was picked to the storage facilities where the fruit can be cooled as quickly as possible. This is particularly important as fruit off the tree matures much faster. The longer it takes to reduce the temperature and O2 and increase the CO2 within the storage room, the less effective the length of storage will be (OMAFRA, 2016). Once apples are harvested they should be cooled and the optimal atmosphere should be achieved within 5 days in order to ensure good quality fruit upon removal from long term storage (OMAFRA, 2016).  Varieties ‘Gala’ and ‘Ambrosia’ apples can be stored for up to 6 months in CA, while ‘Spartan’ apples may be stored for up to 9 months (BCTFPG, n.d.). ‘McIntosh’ apples have a short storage life and often are not placed in cold storage for more than 8 weeks, but may be stored for 5-6 months in standard CA storage (OMAFRA, 2016). In the absence of molecular O2, most fungi are not able to grow, but the reduction in O2 required to inhibit spore germination, mycelial growth and decay development varies greatly among species (Barkai-Golan, 2001). For   10 example, B. cinerea grows well and produces numerous aerial hyphae in 1% O2, but does not sporulate in this environment; meanwhile, spore germination of this fungus is only significantly inhibited at O2 levels below 0.25% (Barkai-Golan, 2001).  2.2 Postharvest Fungal Pathogens of Pome Fruit After harvest, pome fruits may be stored for up to 12 months but become increasingly susceptible to decay by postharvest pathogens. Fungal pathogens are the principal cause of fresh produce losses at the postharvest, distribution, and consumption stages (Spadaro and Droby, 2016). Over 90 species of fungi have been documented to cause postharvest decay (Li et al., 2011). The most important fungi of concern to the apple industry in Canada are B. cinerea, M. piriformis and P. expansum as they commonly infect and rot apples in storage in the Okanagan Valley (Hirkala, personal communication). An improved understanding of the symptoms, morphology and the biology of the pathogens, as well as the role of environmental and postharvest factors in infection and disease development will ultimately help to develop strategies to minimize losses due to storage rots. 2.2.1 Botrytis cinerea B. cinerea (anamorph) and Botryotinia fuckeliana (teleomorph) is a necrotrophic fungal pathogen which kills the host plant cells and then colonizes the dead tissue, causing grey mold disease (Romanazzi and Feliziani, 2014). Based on scientific and economic importance, B. cinerea was recently reported as the second most important pathogen in plant pathology, affecting more than 200 plant species globally (Williamson et al., 2007; Dean et al., 2012). Some of the fruits susceptible to attack by B. cinerea include apple, blueberry, blackberry, grape, kiwi, lemon, raspberry, strawberry, peach and cherry (Romanazzi and   11 Feliziani, 2014). Grey mold is caused by B. cinerea and can result in fruit losses ranging from 20 to 60% during long-term storage (Xiao, 2014).   Lesions on apple due to grey mold infection appear light to dark brown (Fig. 2.1C) and the decayed fruit tissue is rubbery and inseparable from healthy tissue. After long-term storage under high relative humidity, fluffy white to grey mycelium and greyish spore masses may appear on infected fruit (Romanazzi and Feliziani, 2014; Xiao, 2014). In vitro B. cinerea mycelium is brown and sclerotia are often formed when cultured on half strength potato dextrose agar (½ PDA) (Fig 2.1A). Unlike fruit infected with Mucor spp. or Penicillium spp., grey mold does not have a distinct odor.    Figure 2.1 B. cinerea A) colony on ½ PDA medium with numerous black sclerotia, B) electron micrograph of conidiophores and conidia and C) ‘Gala’ apple completely decayed by grey mold.   Hyphae of B. cinerea are branched and septate. Conidiophores arise directly from the mycelium and bear terminal conidia, the products of asexual reproduction, in grape-like clusters (Fig. 2.1B). Conidia are single celled, smooth, grey, ellipsoidal to obovoid, and 6-10 µm wide by 7.5-14 µm long (Romanazzi and Feliziani, 2014; Xiao, 2014). Sclerotia, hardened masses of fungal mycelium containing food reserves, are formed when conditions become unfavorable and often serve as overwintering structures of the fungus (Romanazzi and Feliziani, 2014). Sclerotia are initially hyaline but later turn brown to black from the   12 deposition of melanic pigments in the outer rind. Over long periods the inner mycelium of the sclerotia are protected from desiccation, UV radiation and microbial attack by the melanized rind and β–glucans that encase the mycelium (Romanazzi and Feliziani, 2014). When environmental conditions become favorable hyphae will emerge from the sclerotia and may form sexual structures called apothecia (Fig. 2.2). Asci containing 8 ascospores arise in a fascicle from the base of the apothecium (Errampalli, 2014). Although sexual and asexual reproduction have been well documented in this fungus, asexual reproduction through conidia formed on conidiophores is more common as most isolates of B. cinerea collected in nature have been heterothallic or self-sterile (Romanazzi and Feliziani, 2014). Figure 2.2 shows the asexual and sexual reproductive cycles of B. cinerea in relation to the postharvest system. B. cinerea persists in the orchard as conidia, ascospores, mycelia or sclerotia on decaying organic material such as leaf litter or mummified fruit. The fungal inoculum is primarily dispersed by wind, watersplash or insects (Fig. 2.2). Mycelium and conidia of B. cinerea can germinate at temperatures as low as -2°C and 0°C, respectively (Xiao, 2014).  The maximum temperature for growth of this fungal pathogen is 30°C, while the optimum temperature is 20°C. Fruit may become infected by B. cinerea before harvest and subsequently remain quiescent until storage when the humidity is increased and temperature is decreased, slowing the defense responses of the fruit.  13  Figure 2.2 Postharvest disease cycle of the causal agent of grey mold on apple, B. cinerea (anamorph) and B. fuckeliana (teleomorph)  14 Conidia may also be transported to the packinghouse by contaminated bins where they may later spread to dump tank water (Fig. 2.2). B. cinerea forms appressoria, but they are unique in the fact that they are unable to penetrate healthy host tissue (Williamson et al., 2007); as a result, infection by this pathogen usually originates from wounds, cracks, bruises or insect damage on the fruit. During prolonged storage, grey mold mycelium may be spread from fruit-to fruit through direct contact (nesting) in storage bins. The ability of B. cinerea mycelia and conidia to survive for extended periods of time, grow at low temperatures, survive on diverse hosts as inoculum sources and form sclerotia has made it a difficult postharvest pathogen to control. 2.2.2 Mucor piriformis Mucor rot is a fungal disease of pome and stone fruit caused by M. piriformis A. Fischer in the United States, Canada, Australia, South Africa and Europe (Guo et al., 1999; Spotts, 2014).  Specifically, in the Pacific Northwest, infection of d’Anjou pear and apple fruits by M. piriformis has resulted in significant losses (Michailides and Spotts, 1990a). Unlike other postharvest fungal pathogens, no fungicides are currently registered for control of Mucor rot. Infections from M. piriformis arise at the stem or calyx end or through wounds on the fruits (Spotts, 2014). Infected tissue is light brown and soft with a sharp margin between infected and healthy tissues. Often, sporangia can be observed protruding from cracks and lenticels in over-mature infected fruit (Fig. 2.3C). After several months in cold storage fruit may completely decay, releasing large quantities of juice containing sporangiospores (Michailides and Spotts, 1990a). Well-rotted apples and pears will have a characteristic sweet-alcoholic odor.    15    Figure 2.3 M. piriformis A) colony on ½ PDA medium, B) electron micrograph of ruptured sporangia containing sporangiospores and C) ‘Ambrosia’ apple infected with Mucor rot.   The vegetative mycelium of M. piriformis consists of white, eucarpic, coenocytic branched hyphae that are usually prostrate (Spotts, 2014) with sporangiophores bearing terminal columellae or sporangia. Tall erect sporangiophores bear sporangia that are white-yellow and 120-285 µm in diameter with or without spine-like projections (Michailides and Spotts, 1990a). Columellae are smooth and ellipsoidal up to 182 by 144 µm (Spotts, 2014). Sporangiospores are oval-ellipsoidal and vary in size from 5 to 9 µm in diameter (Spotts, 2014). During germination, sporangiospores may produce up to three germ tubes. Germinated collumellae and sporangia are often observed in 10-day old cultures in vitro (Michailides and Spotts, 1990a). Fusion of gametangia from opposite mating types (+/-) produce spherical to subglobose zygosporangia (120- 180 µm in diameter) (Spotts, 2014). Sexual spores naturally occurring on pome fruit were first reported by Michailides and Spotts (1988) who found zygospores on 1.6% of pear fruits naturally infected with M. piriformis in an orchard in Oregon, USA. Guo et al. (1999) reported that up to 27.7% of apples in orchards in California, USA that were naturally infected with M. piriformis had zygospores, with the + mating type being recovered more frequently. Under alternating wet and dry conditions, zygospores germinate to produce one or two (rare) germ-sporangiophores with terminal   16 sporangia, that will later rupture and release sporangiospores (Michailides and Spotts, 1988). The sexual cycle of this fungus, particularly the production of zygospores, may play an important role in the survival of M. piriformis under hot temperatures (Guo et al., 1999). Figure 2.4 shows the asexual and sexual reproductive cycles of M. piriformis in relation to the postharvest system. M. piriformis is a soilborne fungus that survives saprophytically in the orchard as sporangiospores, zygospores or mycelia in soil or organic matter such as fallen fruit or leaf litter (Michailides and Ogawa, 1987a; Michailides and Spotts, 1990a). The asexual propagules, sporangiospores (Michailides and Ogawa, 1987b), are primarily dispersed by watersplash, birds or insects such as nitidulid beetles (Carpophilus spp.) and vinegar flies (Drosophila melanogaster) (Michailides and Spotts, 1990b). Unlike conidia of B. cinerea and P. expansum, M. piriformis spores are not dispersed by wind because they are embedded in a mucilaginous matrix (Michailides and Spotts, 1986; Michailides and Spotts, 1990a). This fungus grows and sporulates extensively at -1 to 24°C. The maximum temperature for growth is 27°C and the optimum temperature range for growth and reproduction is 15-20°C (Michailides and Ogawa, 1987b; Michailides and Spotts, 1990a). As a result, warm summer temperatures have a detrimental effect on M. piriformis survival as this fungus is a poor competitor with native soil microorganisms at temperatures above 20°C (Michailides and Ogawa, 1989; Guo et al., 1999). In contrast, cool fall and winter temperatures, as well as fruit on the orchard floor, are conducive for the survival and reproduction of M. piriformis (Guo et al., 1999). Fruit that has fallen onto the orchard floor may become infected by contact with infested soil, infected fruit, insects or birds (Michailides and Spotts, 1986; Michailides and   17 Spotts, 1990b). When a favorable nutrient status, cool temperatures, and high moisture levels prevail, propagules of this pathogen will increase in the orchard (Dobson et al., 1989).  18   Figure 2.4 Postharvest disease cycle of the causal agent of Mucor rot on apple, M. piriformis.  19 Fruit and bins may become contaminated with M. piriformis and transported to the packinghouse, where rot rapidly develops at 0°C (Michailides and Spotts, 1986). In the orchard, pome fruit is most susceptible to infection by M. piriformis in the last month before harvest and its susceptibility increases throughout storage (Spotts, 2014). The ability of M. piriformis to grow and reproduce rapidly at low temperatures, produce resistant structures (zygospores) and the absence of fungicides effective against Mucor rot have all contributed to the limited control of this devastating postharvest pathogen of pome fruit.  2.2.3 Penicillium expansum  Blue mold or soft rot caused by P. expansum, is the most important disease of pome fruit (Borecka, 1977; Vilanova et al., 2014). Over 17 species of Penicillium have been linked to fruit decay, but P. expansum Link. is by far the most common (Sanderson and Spotts, 1994). The range of fruit species susceptible to infection by blue mold includes apples, pears, nectarines, apricots, plums, cherries, grapes, strawberries, raspberries, mangos and passion fruit (Rosenberger, 2014). Prior to the widespread use of fungicides and CA storage, blue mold accounted for as much as 90% of total postharvest losses (Rosenberger, 2014). Annual economic losses from blue mold on fresh fruit and vegetables are estimated at 10 to 30% and may reach upwards of 50% in developing countries (Errampalli, 2014). P. expansum is of particular concern to the apple industry and consumers as it can produce patulin, a carcinogenic, mutagenic and teratogenic mycotoxin (Xu and Berrie, 2005). Infections from P. expansum originate at the stem or calyx end or through wounds on the fruit (Rosenberger, 2014). In senescent or over mature fruit P. expansum may also cause disease by infecting through lenticels (Rosenberger, 2014). The epidermis of infected fruit is light to dark brown, soft and watery with blue-green tufts of conidia (Fig. 2.5C). In the   20 absence of masses of conidia on the fruit surface, blue mold may be incorrectly diagnosed as Mucor rot (Rosenberger, 2014). Blue mold lesions have a sharp margin between infected and healthy tissues and decayed tissue is easily separable from healthy tissue (Errampalli, 2014). Fruit well decayed by P. expansum have a characteristic earthy or musty odor (Errampalli, 2014; Rosenberger, 2014).    Figure 2.5 P. expansum A) colony on ½ PDA medium, B) electron micrograph of conidiophores and conidia and C) ‘McIntosh’ apple infected with blue mold.   All species of Penicillium produce dense mycelial growth with conidia (Fig. 2.5B) (Rosenberger, 2014). Mycelia are profusely branched with septate hyphae. Conidiophores of this fungus are smooth, erect and 400-700 µm long, developing from the vegetative mycelium, bearing asymmetrical terverticillate conidial heads (Errampalli, 2014). Conidia are produced in chains at the tip of phialides where the youngest spore is located at the base of the chain (Errampalli, 2014). Asexual spores or conidia of P. expansum are spherical to elliptical and significantly smaller than those of B. cinerea or M. piriformis, often not exceeding 4.5-5 µm in diameter (Rosenberger, 2014). When cultured on PDA P. expansum is initially white and eventually turns dull yellow around the edges and blue-green in the center (Fig. 2.5A) (Errampalli, 2014). Although the ability of P. expansum to reproduce sexually has not been documented, Julca et al. (2015) recently identified two alternative mating types   21 in different P. expansum isolates, consistent with the existence of sexual recombination and heterothallism. Figure 2.6 shows the asexual reproductive cycle of P. expansum in relation to the postharvest system.  Figure 2.6 Postharvest disease cycle of the causal agent of blue mold of apple, P. expansum.   Penicillium spp. are ubiquitous saprophytic inhabitants of agricultural soil and may exist as mycelia or conidia (Borecka, 1977; Sanderson and Spotts, 1994). Conidia are the most important source of inoculum and are primarily dispersed by wind, water splash or insects (Errampalli, 2014). The occurrence of blue mold disease in the field is rare, except on fruit that has fallen on the orchard floor. Propagules of this fungus may be transported to the packinghouse via contaminated soil or organic matter present on bins where the fungus may later spread to dump tank water or become airborne in the storage facilities (Errampalli,   22 2014; Rosenberger, 2014). The majority of blue mold infections arise from waterborne spores in packinghouse drench solutions and flume waters used to float fruit onto packing lines. Conidia can also survive throughout the summer on contaminated wooden fruit bins (Rosenberger, 2014). This fungal pathogen grows optimally at 90% relative humidity and temperatures below 25°C (Errampalli, 2014). P. expansum is a psychrotroph, capable of growing at temperatures as low as -3°C and conidia can germinate at 0°C. In CA storage, where the CO2 is increased above 1% and O2 levels are decreased below 1%, sporulation of this fungus is rare, but can occur after CA rooms are opened (Errampalli, 2014; Rosenberger, 2014). Unlike other fungal pathogens, P. expansum lacks specialized structures such as appressoria to penetrate healthy host tissue and, as a result, infection occurs through blemishes, bruises or puncture wounds on the fruit (Rosenberger, 2014; Vilanova et al., 2014). The ability of P. expansum to grow at low temperatures, produce an abundance of extremely small conidia that are easily dispersed, as well as its increasing resistance to commercial fungicides (Errampalli, 2014) has made it a difficult postharvest pathogen to manage.  2.3 Commercial Disease Control Strategies  According to the Food and Agriculture Organization of the United Nations approximately 3.7 trillion apples are thrown away annually (FAO, 2012) and postharvest disease is partially responsible for this staggering number. Traditionally, the most common approach to controlling postharvest diseases has been the application of chemical fungicides either before or after harvest (Errampalli, 2014). Commercial strategies utilized by the apple industry to minimize postharvest losses can be grouped into three categories: 1) cultural controls, 2) preharvest treatments and 3) postharvest treatments.   23  Proper hygiene throughout the growing season and following harvest into storage is critical to minimizing postharvest disease. Maintenance of hygiene starts in the orchard and a basic understanding of the primary pathogens capable of causing significant losses is essential to effectively reduce inoculum levels. The majority of postharvest diseases begin in the orchard as opportunistic wound pathogens (Coates and Johnson, 1997). As a result, careful harvesting, sorting and packing of fruit can help minimize damage to the fruit and subsequent disease development (Barkai-Golan, 2001). As many postharvest pathogens naturally inhabit the soil, removing leaf litter and fallen fruit will help reduce fungal propagules in the orchard. At harvest, picking apples at the correct maturity stage, cleaning bins thoroughly before filling and avoiding picking fruit that is wet will help reduce the risk of disease (WSU Postharvest Information Network, 2017). At the packinghouse, daily removal of damaged fruit, regular cleaning of storage room walls and floors, as well as proper maintenance of dump tank water with a disinfectant such as sodium hypochlorite will all help prevent disease development (WSU Postharvest Information Network, 2017).   Preharvest application of chemicals or natural compounds is another approach to manage postharvest disease. Captan (a.i. N-trichloromethylthio-4-cyclohexene-1,2-dicarboximide) is a fungicide that can be applied in the orchard up to 7 days before harvest to control postharvest diseases, such as Bull’s-Eye rot caused by Neofabraea spp. (BCTFPG, n.d.). Similarly, Scala® (a.i. pyrimethanil) may be applied 14 days before harvest to help control postharvest rots (BCTFPG, n.d.). Foliar calcium sprays have also been reported to make fruit less prone to physiological disorders as well as storage rots (WSU Postharvest Information Network, 2017). Overall, preventative treatments applied in the orchard to   24 control postharvest diseases are generally less effective than treatments applied after harvest, as most storage rots develop from wounds that arise during or after harvest.  The postharvest application of chemical fungicides continues to be an important strategy to minimize the risk of postharvest decay development. The choice of which fungicide to use depends on the fruit commodity and target pathogen. In Canada, there are four fungicides and one biofungicide registered for postharvest use to control storage rots on apples (Table 2.1). Fungicides or biofungicides may be applied in the packinghouse as drenches, sprays, fogs or in waxes and box liners (Coates and Johnson, 1997). Exclusive and intensive use of Mertect® has led to the selection of fungicide-resistant fungal pathogens in the United States (Chand-Goyal and Spotts, 1995), British Columbia (Sholberg and Haag, 1996) and Ontario, Canada (Errampalli, 2004). The development of fungal resistance to fungicides has led to the search for alternative chemical control strategies (Errampalli, 2004). Scholar® is a reduced risk synthetic fungicide that was first registered for use in the United States in 2004 (Tedford, 2004) and has been shown to be effective at inhibiting mycelial growth and conidial germination of P. expansum (Errampalli, 2004). BioSave® is a biofungicide also registered to control postharvest decay on pome fruits, but widespread use has not been achieved, mainly due to inconsistent levels of performance, and the levels of disease control are less than that of fungicides presently on the market (Errampalli and Brubacher, 2006; Wisniewski et al., 2016). Apples stored in CA are often treated with SmartFresh® (a.i. 1-methylcyclopropene), which blocks the apples’ ethylene receptors preventing them from ripening, thus retaining certain fruit qualities such as firmness, texture and taste (AgroFresh, 2015). The application of 1-MCP delays senescence, allowing fruit to   25 be stored longer, transported further and delays disease development as the fruit’s natural ability to fend off pathogens is retained (DeEll et al., 2007).  Although chemical fungicides are still the most common way to control postharvest storage rots (Spadaro and Droby, 2016), increasing efforts are being put towards the search for alternative control strategies such as biological control using naturally occurring microorganisms. Consumer concerns with chemical residues on the fruit, environmental impact, as well as the development of resistant fungal biotypes has resulted in increased regulatory restrictions on chemical fungicides (Droby et al., 2016). Overall, finding alternative controls that are widely accepted and commercially viable continues to be a challenge (Wisniewski et al., 2016).     26 Table 2.1 Commercial management strategies to control postharvest decay development of apples after harvest in Canada.   Product* Type FRAC code Active ingredient Target site Target pathogens Academy Chemical 3 Difenconazole C14- demethylase in sterol biosynthesis B. cinerea, P. expansum, Neofabraea spp.   12 Fludioxonil MAP/Histidine Kinase in osmotic signal transduction BioSave Biological M P. syringae Unknown B. cinerea, M. piriformis, P.       expansum       EcoFog-160 Chemical 9 Pyrimethanil Methionine biosynthesis B. cinerea, P. expansum       Mertect SC Chemical 1 Thiabendazole ß-tubulin assembly in mitosis B. cinerea, Penicillium spp.       Scholar Chemical 12 Fludioxonil MAP/Histidine Kinase in osmotic signal transduction B. cinerea, P. expansum *(BCTFPG, n.d)       27 2.4 Biological Control Agents In plant pathology, biological control is defined as the utilization of introduced or naturally occurring microorganisms to suppress the activities of one or more plant pathogens (Pal and Gardener, 2006). The emergence of postharvest biological control research started in the mid 1980s when Wilson and Pusey (1985) published a featured article on the use of Bacillus subtilus to control brown rot on peach caused by Monilinia fructicola. Prior to that publication, there was only one other report that had investigated the use of microbial antagonists to control postharvest disease (Tronsmo and Dennis, 1977). Throughout the 1980s there were one to two publications per year on postharvest BCAs; now there are hundreds of publications per year on this topic (Droby et al., 2009). The primary reason for pursuing postharvest biological control research was to reduce the use of chemical fungicides because of concerns regarding human health, particularly that of children, as well as environmental concerns (Droby et al., 2009). In 1989 Wilson and Wisniewski outlined criteria for an ideal antagonist which stated that the organism should be: 1) genetically stable, 2) effective at low concentrations 3) not fastidious in nutrient requirements 4) able to survive at low temperatures 5) effective against a wide range of pathogens on a variety of hosts 6) able to grow in inexpensive medium in fermenters 7) prepared in form that can easily be stored and dispensed 8) unable to produce toxic compounds 9) resistant to pesticides 10) compatible with other chemical and physical treatments and 11) non-pathogenic to the host. Work by Wilson and Wisniewski (1989) laid the foundation for the field of postharvest biological control research and many of their criteria for an ideal antagonist are still applicable today.    28 The initial prospects for the success of postharvest BCA were greater than BCAs developed to manage soil or foliar diseases as conditions such as temperature and humidity can be altered in the storage environment to favor the antagonist (Janisiewicz and Korsten, 2002). A study by Zhang et al. (2011) performed at 0°C on apples stored for 120 days showed that Pichia guillermondii was able to reduce the incidence of grey mold caused by B. cinerea from 45.3% (control) to 20%. Similarly, Aureobasidium pullulans was effective against B. cinerea, Colletotrichum acutatum and P. expansum, inhibiting over 86% of the decay on ‘Gala’ apples stored at 20°C (Mari et al., 2012). More recently, Spadaro et al. (2013) reported that Metschnikowia fructicola AL27 significantly inhibited blue mold decay and reduced patulin accumulation caused by P. expansum on ‘Golden Delicious’, ‘Granny Smith’, ‘Red Chief’ and ‘Royal Gala’ apples. Although over the past 30 years there have been hundreds of reports documenting candidate, commercially-viable antagonists, the widespread use of BCAs has not been achieved commercially. To date, nine BCAs have been registered for commercial use against postharvest pathogens (Table 2.2). Out of these nine products, only three are still registered for use. Consumer acceptance, cost relative to fungicides, inconsistent performance, short shelf life, registration hurdles and formulation issues have all contributed to the limited success of postharvest BCAs (Droby et al., 2009; Wisniewski et al., 2016).    29 Table 2.2 Biological control agents that have been commercialized for management of postharvest decay (Modified from Wisniewski et al., 2016). Product Microorganism Company and/or country Fruit Target pathogens In Use Aspire Candida oleophila Ecogen/ USA Pome fruit, Citrus,  Botrytis, Penicillium,  No    Strawberry, Stone fruit Monilinia  YieldPlus Cryptococcus albidus Lallemand/ South Africa Pome fruit, Citrus Botrytis, Penicillium, Mucor No       Candifruit Candida sake IRTA, Sipcam-Inagra/ Spain Pome fruit Botrytis, Penicillium,  No     Rhizopus  BioSave P. syringae Jet Harvest Solutions/ USA Pome fruit, Citrus, Cherry Botrytis, Penicillium, Mucor Yes    Strawberry, Potato   Avogreen Bacillus subtilis South Africa Avocado Cercospora, Colletotrichum No       Nexy C. oleophila  Lesaffre/ Belgium Pome fruit, Citrus Botrytis, Penicillium Yes       BoniProtect A. pullulans Bio-ferm/ Austria Pome fruit Botrytis, Penicillium,  Yes     Monilinia, Gloeosporium  Pantovital Pantoea agglomerans IRTA, Sipcam-Inagra/ Spain Pome fruit, Citrus Botrytis, Penicillium,  No     Monilinia  Shemer Metschnikowia fructicola Bayer, Koppert/ The Netherlands Pome fruit, Table grape,  Botrytis, Penicillium,  No    Strawberry, Stone fruit, Sweet  Rhizopus, Aspergillus     potato       30 Over the past decade yeast antagonists have been at the forefront of postharvest biological control research (Bencheqroun et al., 2007; Usall et al., 2008; Liu et al., 2013). Many researchers have argued that yeast antagonists are superior to bacterial antagonists as yeast grow rapidly, have simple nutritional requirements and do not produce toxic metabolites, such as antibiotics (Droby et al., 2016; Spadaro and Droby, 2016). Others have made the case that consumers would be more comfortable with food that has been treated with yeasts, microorganisms that are used in baking and making beer, rather than bacteria, microorganisms that are often associated with foodborne diseases (Wisniewski et al., 2016). These are valid points for studying yeast antagonists over bacterial antagonists, but one of the first and longest available postharvest biofungicides, BioSave® (Jet Harvest Solutions, Longwood, Florida, USA), is based on the bacterium P. syringae. In the packinghouse BioSave® can be applied to harvested fruit as a spray or a drench, generally before the fruit is waxed as the wax coating has been shown to protect the bacteria from the dryer, where temperatures are generally 130-140˚F (Jet Harvest Solutions, 2018). It is also interesting to note that Scholar®, one of the more recently registered fungicides for control of postharvest decay, has the active ingredient fludioxonil which is a derivative of pyrrolnitrin (Prn), an antibiotic produced by Pseudomonas pyrrocinia (Tedford, 2004). The annual worldwide market growth from 2012 to 2020 for biopesticides is estimated to reach 12.3% in comparison to 5% for chemical pesticides (Droby et al., 2016), highlighting the importance of continued research into new postharvest BCAs.  Pseudomonas spp. are an ecologically diverse group of bacteria that have been extensively studied as BCAs against many plant pathogens. Pseudomonads have simple nutritional requirements and this is reflected by their abundance in soil, water and foliage   31 (O’Sullivan and O’Gara, 1992). Fluorescent Pseudomonas spp. are particularly promising BCAs, and can be differentiated from other Pseudomonas spp. by their ability to produce water-soluble fluorescent-yellow/green pigments (O’Sullivan and O’Gara, 1992). In the rhizosphere, the success of Pseudomonas spp. has often been attributed to their ability to rapidly colonize the plant host and stimulate plant growth (O’Sullivan and O’Gara, 1992). The importance of the production of toxic metabolites such as diacetylphloroglucinol (DAPG), phenazine-1-carboxylic acid (PCA), Prn, pyoluteorin (Plt) and hydrogen cyanide (HCN) by fluorescent pseudomonads in biological control of plant diseases has been well documented (Dowling and O’Gara, 1994; Haas and Keel, 2003). For example, the antifungal activity of Pseudomonas fluorescens 2-79 against plant pathogens in the rhizosphere has been linked to the production of phenazine antibiotics (Thomashow and Weller, 1988). In the postharvest biological control system, Janisiewicz and Roitman (1988) reported the principal mode of action of Pseudomonas cepacia against P. expansum and B. cinerea was through antagonism by the production of Prn. In the phyllosphere, Pseudomonas putida and Pseudomonas graminis, have been reported to effectively control Colletotrichum acutatum (leaf spot) and Erwinia amylovora (fire blight), respectively (Moreira et al., 2014; Mikiciński et al., 2016). In the postharvest system of pome fruit, P. syringae, P. fluorescens, and P. cepacia have been reported to control apple blue (P. expansum) and grey molds (Botrytis spp.) (Janisiewicz and Roitman, 1988; Zhou et al., 2001; Mikani et al., 2008). The ability of fluorescent pseudomonads to rapidly colonize the plant host, utilize simple nutrients, and produce toxic metabolites has made them a promising alternative to chemical fungicides.   The three isolates of P. fluorescens, 1-112, 2-28, and 4-6, used in this PhD study were originally isolated from the roots of chickpea, lentil, and pea grown in Saskatchewan,   32 respectively (Hynes et al. 2008). These three bacterial isolates were part of a collection of 563 soil bacteria that were screened for several plant growth-promoting traits for suppression of legume fungal pathogens, and for plant growth promotion. Hynes et al. (2008) reported that all three P. fluorescens isolates were positive for the production of siderophores, negative for the production of indole and only isolate 2-28 showed ACC deaminase activity. Isolate 1-112 inhibited the fungal pathogens Pythium, Rhizoctonia and Fusarium by 14-23% in vitro, but did not promote the growth of canola roots. Isolate 2-28 promoted the growth of canola roots and inhibited the growth of Rhizoctonia and Fusarium by 10 and 14% in vitro, respectively. Although isolate 4-6 was unable to promote the elongation of canola roots, it inhibited the growth of Pythium, Rhizoctonia and Fusarium by 7, 17, and 23% in vitro, respectively (Hynes et al., 2008). More recently, Nelson et al. (2011) further characterized isolates 1-112, 2-28 and 4-6 for control of postharvest fungal decay of pome fruit. All three isolates grew well in sterile apple juice at temperatures from 1 to 28˚C and at pH 5-7. Nelson et al. (2011) reported that the isolates were able to use the major carbon sources in apples, namely carbohydrates and organic acids such as fructose, sucrose, glucose and L-malic acid. When the isolates were screened for their ability to use amino acids present in mature apple fruit as sole nitrogen sources, isolates 1-112 and 4-6 were capable of using all 7 of the amino acids tested, while isolate 2-28 was capable of using all the amino acids tested except threonine. Isolate 4-6 consistently increased the pH of sterile apple juice above 7.5, regardless of the initial pH of the medium. It was proposed that the modification of the apple host pH may be a mechanism used by this bacterial antagonist to suppress the growth of fungal pathogens. Cell-free supernatant of isolate 4-6 showed inhibitory activity against P.   33 expansum on ‘Gala’ apples in comparison to control fruit that were treated only with spores of the pathogen (Nelson et al., 2011).  The use of microbial antagonists is a promising alternative to chemical fungicides as they are environmentally friendly, have a low production cost and leave no harmful residues on the product (Bonaterra et al., 2012). Although there are many obstacles to commercializing a BCA, Wisniewski et al. (2016) argue that consistent and reliable production under a broad array of conditions remains the greatest obstacle. There is an abundance of literature on reports of potentially commercially viable BCAs, but very few antagonists have been implemented on large scales (Droby et al., 2016). In order to have greater success with microbial antagonists, the gap between research and industry must be bridged (Wisniewski et al., 2016). Finally, in order to achieve levels of control that are commercially acceptable and comparable to fungicides, which are in the range of 98-100% (Droby et al., 2016), BCAs will need to be combined with other disease management strategies.  2.5 Mechanisms of Biological Control  Microbial antagonists are living organisms that may possess an array of mechanisms to combat postharvest fungal pathogens. In the postharvest system, biological control studies to date have primarily been on bacteria and yeasts and to a lesser extent fungi (Di Francesco et al., 2016). Understanding the mechanisms of action utilized by BCAs is not only of importance to enhance their viability and efficacy in disease control, but also a prerequisite of product development and registration (Droby et al., 2016). Biological control activity has been attributed to four main mechanisms of action: 1) competition for nutrients and space, 2)   34 production of antibiotics, 3) parasitism and 4) induction of host resistance (Janisiewicz and Korsten, 2002; Di Francesco et al., 2016; Droby et al., 2016). 2.5.1 Competition for nutrients and space  Competition between the pathogen and BCA for space and nutrients is considered the main mechanism of action of microbial antagonists (Sharma et al., 2009; Di Francesco et al., 2016). As many of the postharvest pathogens arise from wounds or damage to the fruit, it is imperative for BCAs to grow quickly, deplete nutrients and physically occupy the wound space (Barkai-Golan, 2001). In the postharvest system, the BCA may compete for vitamins and minerals or major carbon and nitrogen sources, such as sugars and amino acids, respectively, on the fruit. Although competition for nutrients and for space are often coupled together, Janisiewicz et al. (2000) developed a non-destructive method of studying competition for nutrients without competition for space; they were able to show conclusively that the yeast antagonist, A. pullulans depleted amino acids and inhibited P. expansum conidial germination in apple juice. Using the method developed by Janisiewicz et al. (2000), Poppe et al. (2003) were able to show that P. agglomerans CPA-2 inhibited conidial germination at low but not high nutrient concentrations, suggesting that competition for nutrients can be important for effective biological control in nutrient-limited systems. In vivo, Bencheqroun et al. (2007) demonstrated that the application of exogenous amino acids to apple wounds significantly decreased the biological control efficacy of A. pullulans against P. expansum. The inhibition provided by outcompeting the pathogen for nutrients is often only fungistatic as the pathogen is able to germinate and grow after the addition of nutrients (Di Francesco et al., 2016).      35 Iron is a critical microelement for microbial growth and development and is often in limited supply in fruit wounds. Bacterial and yeast antagonists may benefit from the low O2 and iron in the wound environment as they can produce siderophores (Di Francesco et al., 2016). Siderophores are iron-chelating compounds that form tight and stable complexes with ferric iron, making it unavailable to competing microorganisms (Droby et al., 2016). Both bacteria and fungi have the ability to produce siderophores, but bacterial siderophores have a higher affinity for iron, thus giving bacterial antagonists an advantage to obtaining this microelement (Compant et al., 2005). Some BCAs may go a step further and exhibit siderophore piracy, drawing iron from heterologous siderophores from other microorganisms (Compant et al., 2005). In vitro iron depletion by Metschnikowia pulcherrima was shown to inhibit mycelial growth and conidial germination of B. cinerea, P. expansum and Alternaria alternata (Droby et al., 2016). Calvente et al. (1999) demonstrated that siderophore production by Rhodotorula glutinis was closely related to the iron concentration of the medium and siderophore production helped inhibit P. expansum. There is also substantial evidence that the siderophores produced by fluorescent Pseudomonas spp. play a significant role in their biological control capabilities (Santoyo et al., 2012).  In order for microbial antagonists to successfully compete with postharvest pathogens for space, they must rapidly colonize the host. Li et al. (2011) attributed the antagonism provided by Rhodotorula mucilaginosa to its ability to rapidly colonize the wounds, physically excluding the fungal pathogen from occupying the wound site. Similarly, Bonaterra et al. (2003) reported that P. agglomerans EPS125’s pre-emptive exclusion of the pathogen by wound colonization contributed to its biological control capabilities. In order, to colonize intact or damaged fruit surfaces, BCAs should have specific mechanisms to   36 facilitate adherence, colonization and multiplication, such as biofilm formation (Spadaro and Droby, 2016). A biofilm is an assemblage of surface-associated microorganisms that are enclosed in a hydrated matrix containing proteins, nucleic acids and polysaccharides (Annous et al., 2009). A study by Vero et al. (2013) evaluated yeasts from Antarctic soils for biological control potential against postharvest diseases and reported that biofilm formation is an important attribute of microbial antagonists as it allows enhanced adhesion and increased resistance to stress. Pu et al. (2014) demonstrated that Kloeckera apiculata 34-9 was able to form a biofilm on citrus fruits, creating a mechanical barrier between the wound site and the pathogen. Our understanding of the role of biofilms in controlling postharvest diseases is still very incomplete, mainly because their importance in controlling pathogenic fungi has been discussed only recently in the literature (Pu et al., 2014; Spadaro and Droby, 2016). 2.5.2 Antibiosis  Antibiosis is considered the second most important mechanism utilized by microbial antagonists to suppress plant pathogens. Antibiosis is defined as the production of toxic substances, namely antibiotics, that inhibit or kill potential plant pathogens (Di Francesco et al., 2016).  The primary mechanism of action of bacterial BCAs has commonly been attributed to the production of toxic metabolites such as antibiotics (Raaijmakers et al., 2002; Sharma et al., 2009). The importance of the production of DAPG, PCA, Prn and Plt by fluorescent pseudomonads in biological control of plant diseases has been well documented (Haas and Keel, 2003; Santoyo et al., 2012). The main modes of action of the commercially available BCA BioSave® (a.i. P. syringae) are competition for nutrients and space, but the production   37 of syringomycin E may also play a role in its ability to control postharvest decay (Bull et al., 1998). Janisiewicz and Roitman (1988) reported that the principal mode of action of Pseudomonas cepacia against P. expansum and B. cinerea was through antagonism by the production of Prn. Genetic mutation studies of Bacillus amyloliquefaciens PPCB004 elucidated the importance of iturin in control of postharvest pathogens, Alternaria, Colletotrichum and Penicillium (Arrebola et al., 2010). Although there are many reports of antibiosis as a mechanism of biological control, antimicrobial compounds have not been widely detected in fruit (Di Francesco et al., 2016). Furthermore, relying on microbial antagonists to control plant pathogens through the production of antibiotics may lead to inconsistent levels of control as antibiotic production is influenced by abiotic factors as well as the physiological state of the antagonist (Di Francesco et al., 2016). Among the antifungal compounds produced by BCAs, volatile organic compounds (VOCs) are often involved in the control of postharvest fungal pathogens (Di Francesco et al., 2016). Mari et al. (2016) recently reviewed the antimicrobial activity of VOC-producing microbial antagonists. P. fluorescens ALEB 7B has been reported to produce volatiles with fungicidal activity and dimethyl disulphide (DMDS) played a major role (Zhou et al., 2014a). Similarly, Hernández- León et al. (2015) showed that several Pseudomonas biological control strains produced an abundance of sulfur containing volatiles with antifungal activity, including DMDS. Preliminary work on fumigation using a BCA by Mercier and Jiménez (2003) showed that fumigation of apples with Muscodor albus cultures for 7 days gave complete control of blue mold and grey mold in wound-inoculated fruits. Di Francesco et al. (2015) demonstrated that VOCs produced by A. pullulans L1 and L8 gave excellent control of P. expansum, B. cinerea and Colletotrichum acutatum on ‘Golden Delicious’ apple.    38 Although antibiotic producing microbial antagonists have been shown to be highly effective at controlling postharvest pathogens and have even led to the development of some synthetic fungicides such as Scholar® (Tedford, 2004), the current emphasis is being placed on non-antibiotic producing microorganisms (Sharma et al., 2009). Microbial antagonists unable to produce antibiotics are likely to be more easily accepted by consumers as they avoid the possibility of the development of antibiotic resistance by human and fruit pathogens. Finally, microorganisms capable of producing VOCs open new possibilities for managing postharvest disease as they can be effectively applied under controlled conditions and they do not require the living microbial antagonist to be in direct contact with the fruit (Mari et al., 2016). 2.5.3 Parasitism  A third mechanism of action utilized by microbial antagonists is parasitism, where the antagonist benefits at the expense of the pathogen often directly by obtaining nutrients from the pathogen or indirectly through increased access to nutrients on the fruit. In order to parasitize the pathogen, microbial antagonists often produce lytic enzymes capable of direct destruction or lysis of fungal propagules (Spadaro and Droby, 2016). Glucan, chitin and protein, are the main components of fungal cell walls and constitute approximately 55, 20 and 25%, respectively, by dry weight of the wall (Spadaro and Droby, 2016). Degradation of the fungal cell wall by BCAs requires the activity of several enzymes including β-1,3-glucanases, chitinases and proteinase.  One of the first reports of the role of parasitism in biological control showed Pichia guilliermondii cells attached to the hyphae of B. cinerea and Penicillium and when removed from the hyphae, the hyphal surfaces were partially degraded (Wisniewski et al., 1991).    39 Chan and Tian (2005) concluded that tenacious attachment, as well as the production of lytic enzymes, glucanase and exo-chitinase, played a role in the biological control activity of Pichia membranefaciens and C. albidus. Similarly, Hashem et al. (2014) reported that C. albidus utilized mycoparasitism as its primary mechanism of action as it tenaciously adhered to and degraded the fungal hyphae of P. expansum. Moreover, the addition of chitin, inducing the activity of chitinase, has been shown to enhance the biological control efficacy of Cryptococcus laurentii against the fungal pathogen P. expansum (Yu et al., 2008b).  With the use of biotechnology, mutant strains of Pichia anomala, lacking genes for glucanase production, showed a significantly reduced ability to control grey mold on wounded apple fruit (Friel et al., 2007). Bonaterra et al. (2003) reported that the direct interaction of P. agglomerans EPS125 is necessary for inhibition of postharvest pathogens, Rhizopus stolonifer and Monilinia laxa. The colonization of the fungal hyphae by the microbial antagonist may act directly to kill the pathogen through parasitism, as mentioned above, or indirectly by restricting access of the pathogen to essential nutrients. 2.5.4 Induction of host resistance   When elucidating the mechanisms of action of potential BCAs it is important to also consider the role of the plant host in preventing disease development. The ability of BCAs to induce defense related responses in the fruit has been suggested as another mechanism of antagonism and has been well documented (Sharma et al., 2009; Di Francesco et al., 2016; Spadaro and Droby, 2016).  Microbial antagonists can induce host defenses by activating pathogenesis-related (PR) proteins, such as glucanases and chitinases, and defense-related enzymes, such as peroxidase (PODs), polyphenol oxidase (PPOs) and phenylalanine ammonia-lyase (PALs)   40 (Di Francesco et al., 2016). Ippolito et al. (2000) provided one of the first reports of the role of induced defense responses in biological control of grey and blue mold on apple; they found that treatment of apple wounds with A. pullulans caused a transient increase in glucanase, chitinase and POD activities starting at 24 h post inoculation. They also noted that fruit wounding induced the production of defense-related enzymes in apple, but the response was significantly less than when fruit were treated with the antagonist, A. pullulans (Ippolito et al., 2000). Similarly, Candida saitoana is capable of inducing systemic resistance in apple fruit against the postharvest pathogen B. cinerea by inducing the production of PR proteins in the host (El Ghaouth et al., 2002). The yeast antagonist, R. mucilaginosa has been shown to enhance the resistance of apples to grey and blue mold decay by inducing the activity of POD, PPO and by inhibiting lipid peroxidation (Li et al., 2011).  Although there has been much work done on microbial antagonists inducing defense responses in apple, the results are only correlative and direct evidence for the ability of induced substances to inhibit postharvest disease are lacking. Furthermore, many yeast antagonists produce chitinases and glucanases, so deciphering if “induced PR proteins” are of plant or microbial origin continues to be a challenge. The age of the fruit must also be considered when applying an antagonist that inhibits decay by induction of host resistance as the induction of PR protein activity is comparatively lower in stored fruit than in fruit treated right after harvest (El Ghaouth et al., 2002). 2.6 Improvement of Biological Control  Over the past 30 years the use of microbial antagonists to control postharvest diseases of fruits has been extensively studied (Janisiewicz and Korsten, 2002; Droby et al., 2009; Wisniewski et al., 2016). A recent review by Wisniewski et al. (2016) stated that we are   41 seeing a trend from simple approaches to manage postharvest disease with BCAs to complex approaches that utilize many physical, chemical and biological control strategies. The primary barriers to the widespread use of BCAs in controlling postharvest disease have been: inconsistent performance, consumer acceptance and registration hurdles (Droby et al., 2016). As a result, significant efforts have been put into research on the combination of microbial antagonists with 1) low doses of fungicides, 2) generally regarded as safe (GRAS) compounds, or 3) chemical inducers of host resistance.  The intensive use of fungicides has led to the emergence of resistant biotypes (Chand-Goyal and Spotts, 1996; Sholberg and Haag, 1996) and the development of resistance management programs. One approach to managing the development of fungal resistance has been the integration of BCAs with low dosages of fungicides (Errampalli and Brubacher, 2006). P. syringae applied in combination with the fungicide cyprodinil was more effective at controlling blue mold on apple than the treatment of the microorganism or fungicide alone (Errampalli and Brubacher, 2006). Lima et al. (2011) also observed that an integrated approach, combining Rhodosporidium kratochvilovae or C. laurentii with boscalid or cyprodinil, reduced blue mold decay by as much as 98% after 7 days of storage. The combination of low dosages of fungicides with BCAs looks to be a very promising approach to reduce fungicide residues and control postharvest disease.  Another approach to enhance the efficacy of microbial antagonists, avoiding the use of chemical fungicides altogether, combines BCAs with GRAS compounds. Conway et al. (2007) reported that M. pulcherrima applied in combination with C. laurentii and sodium bicarbonate completely inhibited decay caused by P. expansum on fruit under CA conditions. C. laurentii applied with CaCl2, a commonly used preservative and firming agent in fruit,   42 was more effective at controlling grey and blue mold on pear then the antagonist alone (Yu et al., 2012). The authors hypothesized that the antagonist acted as the primary line of defense (especially during the first day of infection) while CaCl2 served as the second line of defense, triggering defense responses in the fruit tissue (Yu et al., 2012). These reports suggest that the proper combination of BCAs with alternative control strategies can provide commercially acceptable levels of disease control.  A third strategy to improve the control provided by microbial antagonists is applying them in combination with natural compounds that activate defense-related responses in the fruit. Yu and Zheng (2006) reported that the simultaneous application of SA, a plant hormone, with C. laurentii to apple wounds improved the control provided by the yeast antagonist against P. expansum. Yu et al. (2008a) reported that indole-3-acetic acid, a plant growth regulator, improved the control provided by C. laurentii against P. expansum on apple. The combination of M. pulcherrima with methyl jasmonate, a volatile compound involved in a plant’s reaction to stress, reduced blue mold more effectively than treatment with methyl jasmonate or the yeast antagonist alone (Ebrahimi et al., 2013). The application of BCAs with compounds that improve disease control by enhancing the defense response of the fruit looks to be another promising alternative to improve biological control.  Although much work has been done in the area of postharvest biological control, continued research on new microbial antagonists is necessary because antagonists identified in specific geographic areas may be more effective against pathogen strains in that region (Li et al., 2011). Preliminary work in the field of postharvest biological control sought to find a “silver bullet” microorganism that alone could effectively control a variety of pathogens on numerous fruit products; that has not been the reality. In order to make biological control a   43 commercially viable strategy to control postharvest diseases we need to continue to develop integrated management strategies, incorporating low dosages of fungicides, GRAS compounds and natural inducers of plant defenses, that will ultimately provide consistent, high levels of disease control.   44 Chapter 3: Postharvest Biological Control of Blue Mold of Apple by Pseudomonas fluorescens During Commercial Storage and Potential Modes of Action1  3.1 Background Pome fruit are highly perishable products and become particularly susceptible to postharvest diseases caused by fungal pathogens during packing, storage and transportation. To date, over 90 fungal species have been identified as causal agents of postharvest decay of apples during storage (Li et al., 2011). Blue mold caused by the psychotrophic fungal pathogen P. expansum Link. is the most important postharvest disease of apples and can result in fruit losses of up to 50% (Quaglia et al., 2011; Vilanova et al., 2014). P. expansum also produces the mycotoxin patulin which can have acute and chronic effects on human health (Etebarian et al., 2005; Quaglia et al., 2011;). Traditionally, the pome fruit industry has controlled postharvest diseases with chemical fungicides (Janisiewicz and Korsten, 2002; Chan and Tian, 2005). Synthetic fungicides such as Mertect® (a.i. thiabendazole) and Scholar® (a.i. fludioxonil) have been applied extensively to tree fruits to reduce postharvest losses, but pathogen resistance is emerging (Errampalli et al., 2006). Public pressure to reduce fungicide use and for produce free of synthetic fungicides, has led to research for safer alternatives such as BCAs (Janisiewicz and Korsten, 2002; Chan and Tian, 2005).                                                  1 A version of Chapter 3 has been published as a journal article. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2017. Postharvest biological control of blue mold of apple by Pseudomonas fluorescens during commercial storage and potential modes of action. Postharvest Biology & Technology 133, 1-11.   45 The majority of new fungicides have site-specific targets with a lower potential for negative impacts on the environment, but these fungicides are at high risk for development of resistance by fungal pathogens (Brent and Hollomon, 2000). Biological control using microbial antagonists is a promising alternative to fungicides as BCAs have many modes of action to combat fungal pathogens, making pathogen resistance unlikely (Brent and Hollomon, 2000). Modes of action utilized by microbial antagonists include direct parasitism (Li et al., 2016), competition for nutrients or space (Janisiewicz et al., 2000; Bencheqroun et al., 2007), production of lytic enzymes (Zhang et al., 2011) or antibiotics (Janisiewicz and Roitman, 1988), and induction of host defenses (Ippolito et al., 2000; Li et al., 2011). Elucidating the mechanisms of action of microbial antagonists may allow for enhanced disease control. Many yeast antagonists have shown promise in controlling blue mold of apple, including Pichia caribbica (Cao et al., 2013), A. pullulans (Ippolito et al., 2000; Mari et al., 2012), M. fructicola (Spadaro et al., 2013) and C. laurentii (Lima et al., 2010); several bacterial antagonists have also shown potential including Rahnella aquatilis (Calvo et al., 2007), Pseudomonas cepacia (Janisiewicz and Roitman, 1988), P. syringae (Janisiewicz and Jeffers, 1997) and Burkholderia gladioli (Scuderi et al., 2009).  The objectives of this chapter were: (i) to compare the ability of P. fluorescens isolates 1-112, 2-28 and 4-6 to control P. expansum, on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples during commercial storage, to that of commercial controls, Scholar® and BioSave®; (ii) to investigate the possible modes of action utilized by the bacteria to inhibit P. expansum in vitro.     46 3.2 Materials and Methods 3.2.1 Antagonists P. fluorescens isolates 1-112, 2-28 and 4-6 were obtained from the roots of chickpea, lentil, and pea in Saskatchewan, Canada, respectively (Hynes et al., 2008). For long-term storage, the bacteria were preserved at -80°C in 20% glycerol. For each experiment, P. fluorescens isolates were taken from -80°C stock cultures and streaked, to obtain isolated colonies, on half strength tryptic soy agar (½ TSA: Appendix A). After 2 d of incubation at 28°C, ½ TSA plates containing isolated colonies with no visible contamination were transferred to a 4°C cooler for short term storage. Bacterial inocula were prepared by incubating the three isolates of P. fluorescens in tryptic soy broth (½ TSB: Appendix A) for 2 d at 28oC on a rotary shaker set at 220 rpm. The optical density (OD) of the incubated culture was measured with a spectrophotometer at 600 nm and the colony forming units (CFU) per mL were determined using standard calibration curves (Appendix B) and adjusted to the desired concentration depending on the experiment. 3.2.2 Pathogen P. expansum Link strain 1790 was obtained from Dr. P. Sholberg, Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland, BC and working cultures were maintained on ½ PDA (Appendix A) at 4°C. For long term storage, a 6 mm plug of a 7-d old culture of the fungus grown on ½ PDA was preserved in 20% glycerol and stored at -80°C. For each experiment, fungal plugs were taken from the -80°C stock and transferred to a fresh plate of ½ PDA where the fungus were incubated at 20°C for 7 d. A conidial suspension was prepared according to the method used by Errampalli (2004). The conidia were enumerated with a Petroff-Hauser counting chamber and conidial   47 suspensions were adjusted to the appropriate concentration with sterile distilled water. In order to maintain the pathogenicity of the fungus, conidial suspensions were inoculated into wounded apples, incubated at 20°C for 7-14 d, before a sample of decayed apple tissue was excised and transferred to a fresh plate of ½ PDA. After 7 d of incubation at 20°C, ½ PDA plates containing pure cultures with no visible contamination were transferred to a 4°C cooler for short term storage. Apples were inoculated with spores of the pathogen that had been recently passed through fruit, prior to starting the in vivo commercial storage trials. 3.2.3 Fruit Apple (Malus domestica Borkh.) fruit of cv. ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ were harvested at commercial maturity in the Okanagan Valley, British Columbia, Canada in 2014, 2015 and 2016 and provided by the British Columbia Tree Fruits Cooperative (BCTFC) (9751 Bottom Wood Lake Road, Lake Country, BC V4V 1S7) for this study. Fruit were selected for their uniform size and absence of blemishes or visible rot. Harvested fruit were stored at 0°C, for no longer than one month, prior to treatment. Apples were placed into high-density polyethylene mesh bags (53.3 cm (length) x 30.5 cm (height); Hubert Company, Toronto, ON, Canada) and surface disinfected with 6% sodium hypochlorite and 0.01% Tween 20 for 4 min, rinsed with tap water for 4 min, and dried. Each mesh bag contained 10 apples. Physiological fruit quality parameters were assessed on healthy apples after 15 weeks in commercial cold storage. Firmness was measured on each apple at two opposite sites along the equatorial region with a Güss Fruit Texture Analyzer (Güss, Strand, South Africa) with an 11-mm probe. The probe descended towards the apple at 1.0 mm s-1 and the maximum force (lbs) required to penetrate the apple was defined as firmness. Total soluble   48 solids (TSS) were determined by measuring the refractive index of pressed juice using a digital hand-held pocket refractometer PAL-1 (Atago, California, U.S.A.) (Spadaro et al., 2013). The starch index was determined by slicing the apples in half equatorially followed by spraying with an iodine solution (Figure C.1). After drying for one minute the apples were visually compared to the Cornell Starch chart, where 1 indicates high levels and 9 indicates low levels of starch (Blanpied and Silsby, 1992; Figure C.2-C.5). Fifteen milliliters of pressed juice were diluted with 60 mL of distilled water and used to measure titratable acidity (TA). Titratable acidity was determined by titrating the pressed juice with 0.1 N NaOH to a final pH of 8.1. The final volume of NaOH added when the endpoint of the titration was reached was used to determine the mg of malic acid per 100 mL of juice (Toivonen and Hampson, 2014).  3.2.4 Biological control activity on apples Each apple was wounded (2 x 2 x 7 mm) twice with a sterile nail and then inoculated by submersing the bag of fruit into 1 x 108 CFU mL-1 of P. fluorescens for one minute, allowed to sit for one minute, followed by drenching for one minute in 1 x 104 conidia mL-1 of P. expansum. Similarly, apples were drenched in commercial controls, BioSave® (Jet Harvest Solutions, Longwood, Florida, USA) with the active ingredient P. syringae or Scholar® 50 WG (Syngenta, Guelph, Ontario, Canada) with the active ingredient (a.i.) fludioxonil, as per manufacturer’s instructions, allowed to sit for one minute, followed by drenching for one minute in 1 x 104 conidia mL-1 of P. expansum. The drenching method of inoculation was used to mimic commercial practices where packinghouses apply fungicides or BCAs as a drench prior to storage. Each replicate consisted of a bag of 10 apples and each treatment had three replicates and each experiment was performed at least twice. After   49 inoculation bags of apples were placed in large plastic totes and transferred to a 0°C commercial cold storage room at the BCTFC in Winfield, BC. Three holes (40 mm in diameter) were cut in the lid of each tote and covered with 0.45 µm filters to allow for aeration and prevent microbial dispersal in the storage facilities. Treatments included non-inoculated controls, positive controls of the fungal pathogen alone, negative controls of each bacterial isolate alone, the pathogen in combination with each P. fluorescens isolate, or the fungicide Scholar®, or a BCA, BioSave®. The lesion diameters and disease incidence were determined after 15 weeks in 0°C commercial cold storage. Disease incidence of each apple was determined by the number of wounds that had visible fungal decay. Independent experiments were conducted in 2014, 2015 and 2016 for ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples, but only data from the 2015-16 storage trials on ‘McIntosh’ and ‘Spartan’ apples are presented in this chapter.  3.2.5 Biological control activity in vitro The three isolates of P. fluorescens were tested for their antagonistic effect on the  mycelial growth of P. expansum as described by Tolba and Soliman (2013) with slight modifications. A fungal lawn of P. expansum was created on ¼ TSA/PDA (Appendix A) by spreading 100 µL of 106 conidia mL-1 with a sterile glass rod. Concomitantly, the three different isolates of P. fluorescens (10 µL of a solution of 108 CFU mL-1) were inoculated onto sterile 6-mm filter discs (VWR 415 filter paper). The inoculated filter discs were allowed to air dry before being transferred onto the middle of the fungal lawn and incubated at 20°C for 5 d. Negative controls consisted of a fungal lawn with a filter disc inoculated with 10 µL of sterile water. After 5 d the efficacy of the different isolates of P. fluorescens was determined by measuring the diameter of fungal inhibition from the center of the filter   50 disc to the closest edge of the fungal lawn. Each treatment was replicated five times and the experiment performed three times.  The effect of P. fluorescens isolates on conidial germination of P. expansum was assessed as described by Spadaro et al. (2013) with slight modifications. Conidial germination was assessed in 50% filter-sterilized apple juice (FSAJ) pH 6.5. FSAJ was made using Ambrosia apples obtained from the BCTFC, Winfield, BC.  Whole apples were cored, and then juiced using a Breville Juice Fountain Plus (JE98XL, Breville, England). Apple juice was centrifuged at 2000 rpm for 5 min at 4°C and filtered through Whatman No. 2 filter paper (8 µm particle retention). The pH of the apple juice was adjusted to 6.5 using 1.0 M sodium hydroxide followed by filtration through a Nalgene Sterile Filtration System (0.22 um pore size) (ThermoFisher Scientific, Waltham, MA, U.S.A.). The pH of the apple juice was increased as apple juice with an unadjusted pH (3.9-4.2) did not support the growth of P. fluorescens. Previous trials showed that apple juice with a pH adjusted to 6.5 was optimal for in vitro antagonism assays. The FSAJ was stored at 4°C until use (Leelasuphakul et al., 2008). Five hundred microliters of FSAJ were transferred into each well of a 24-well tissue culture plate (NuncTM, ThermoFisher Scientific, Waltham, MA, U.S.A.). A conidial suspension (250 µL of a solution containing 106 conidia mL-1) of P. expansum alone, or in combination with living cells (250 µL; 108 CFU mL-1) of each P. fluorescens isolate was added to the wells. As a control, 250 µL of the fungal pathogen were added to 500 µL of FSAJ plus 250 µL of sterile water. After 14 h of incubation at 20oC on a rotary shaker (100 rpm), a minimum of 100 spores was observed per replicate with a light microscope and percent germination was determined by counting how many spores produced germ tubes. The conidia were considered germinated when the size of the germ tube was twice the size of   51 the conidia. Each treatment was completed in triplicate and the experiment was performed three times.  In addition, a dual culture assay was performed to assess the activity of VOCs produced by P. fluorescens on conidial germination of P. expansum. The sealed plate assay described by Dennis and Webster (1971) was used with a few modifications. P. fluorescens isolates 1-112, 2-28 and 4-6 were grown in TSB for 48 h at 20oC. Each P. fluorescens isolate was then spread (100 µL of a solution containing 109 CFU mL-1) onto the surface of a ¼ TSA/PDA plate. After 24 h of incubation at 20oC the lid was replaced with a base plate of ¼ TSA/PDA inoculated with 100 µL of a conidial suspension (103 conidia mL-1) of P. expansum. The two plates were sealed immediately with a double layer of parafilm and incubated at 20oC for three days. Plates inoculated with only P. expansum served as the control. After three days the number of conidia that germinated was determined (Di Francesco et al., 2015). After four days, an agar plug of the inhibited fungus was removed and transferred to a new plate of ½ PDA. The viability of the fungal culture was assessed after incubation for three days at 20°C (Leelasuphakul et al., 2008). Each treatment was replicated five times and the experiment was performed twice. 3.2.6 Detection of antibiotic biosynthesis genes The presence of genes for the biosynthesis of DAPG, PCA, Prn, Plt and HCN was determined by polymerase chain reaction (PCR) using the primer sets described in Table 3.1. P. fluorescens strain 2-79 (Northern Regional Research Laboratory (NRRL) B-15132), kindly provided by Jim Swezey from the United States Department of Agriculture - Agricultural Research Service Culture Collection, that produces PCA and strain Pf-5 (American type culture collection (ATCC) BAA-477) that produces DAPG, Prn, Plt and   52 HCN, were used as positive controls. Deoxyribonucleic acid (DNA) was extracted from each isolate of P. fluorescens using the E.Z.N.A.® Bacterial DNA Kit and centrifugation protocol (Omega-Bio Tek, Norcross, U.S.A.). DNA was stored at -20°C until use for subsequent analysis  53 Table 3.1 Target antibiotic genes and primers used in polymerase chain reaction analysis of P. fluorescens DNA. Target gene & product Target group Primer Sequence Length Reference phlD (2,4-diacetylphloroglucinol) f. Pseudomonas1 Phl2a GAGGACGTCGAAGACCACCA 745 bp Raaijmakers et al., 1997   Phl2b ACCGCAGCATCGTGTATGAG   phzCD (phenazine-1-carboxylic acid) f. Pseudomonas1 PCA2a TTGCCAAGCCTCGCTCCAAC 1,150 bp Raaijmakers et al., 1997   PCA3b CCGCGTTGTTCCTCGTTCAT   prnD (pyrrolnitrin) Pseudomonas PRND1 GGGGCGGGCCGTGGTGATGGA 786 bp de Souza and Raaijmakers, 2003   PRND2 YCCCGCSGCCTGYCTGGTCTG   pltC (pyoluteorin) Pseudomonas PLTC1 AACAGATCGCCCCGGTACAGAACG 438 bp de Souza and Raaijmakers, 2003   PLTC2 AGGCCCGGACACTCAAGAAACTCG   hcnBC (hydrogen cyanide) Pseudomonas ACa ACTGCCAGGGGCGGATGTGC 587 bp Ramette et al., 2003     ACb ACGATGTGCTCGGCGTAC     1fluorescent Pseudomonas     54 All PCR reactions were performed in a volume of 25 µL containing 1 µL of bacterial DNA, 1 X PCR buffer (New England Biolabs, Ipswich, U.S.A.), 5% dimethyl sulfoxide (Fluka, Buchs, Switzerland), 100 µM each of dATP, dCTP, dGTP, and dTTP, 0.4 µM of each primer, and 1.25 U of Taq DNA polymerase (Amersham Pharmacia) (Kim et al., 2013). All primers were obtained from Integrated DNA Technologies (IDT), The University of British Columbia (UBC), Vancouver, BC. PCR was performed on an Applied Biosystems Veriti® 96-Well Thermocycler (ThermoFisher Scientific, Waltham, U.S.A.). The method for amplification of the gene encoding for HCN production, hcnBC, was performed as described by Ramette et al. (2003). Following amplification, detection of PCR products was determined on a 1% agarose gel stained with SYBR® Safe DNA Gel Stain (Invitrogen, Carlsbad, U.S.A.). The DNA Clean and ConcentratorTM-5 (Zymo Research, Irvine, U.S.A.) kit was used to purify the PCR products, except for P. fluorescens isolate 4-6 where multiple bands were observed on the agarose gel for the Aca/Acb primer set. When multiple bands were amplified with the respective primer set the bands were excised from the agarose gel using a sterile scalpel and purified using the E.Z.N.A. Gel Extraction Kit (Omega Bio-Tek, U.S.A.). The PCR products were quantified using a NanoDrop® ND-1000 spectrophotometer (Thermo Scientific, U.S.A.) and sent to the Fragment Analysis and DNA Sequencing Services (FADSS) at the University of British Columbia Okanagan Campus for sequencing. Sequences were assembled and proof-read with SequencherTM 4.7 software (Gene Codes Corp., Ann Arbor, U.S.A.). BLASTn was used to confirm the identity of the PCR product.     55 3.2.7 Production of lytic enzymes In order to assess the ability of P. fluorescens to produce and secrete lytic enzymes (chitinase, protease, cellulase and glucanase), qualitative tests were performed on solid agar amended with the various substrates as described by Lutz et al. (2013).  To assess chitinolytic activity bacteria were cultured on medium amended with 0.5% (w/v) colloidal chitin (Appendix A).  Isolates that showed zones of clearing after 7 d of incubation at 28°C on chitin agar were considered as chitinase producers. Proteolytic activity of the bacteria was assessed by observing zones of precipitation of paracasein around bacterial colonies grown on 1% (w/v) skim milk agar (Appendix A) and incubated at 28°C for 2 d (Morris et al., 2012). Cellulolytic activity of the bacteria was assessed by observing zones of clearing around bacterial colonies grown on 1% (w/v) cellulose-amended medium after staining with Congo-red (Amresco) (Appendix A) following 7 d of incubation at 28°C (Essghaier et al., 2008). Glucanolytic activity of the bacteria was assessed by screening for degradation halos around bacterial colonies grown on 0.5% (w/v) laminarin-amended medium (Appendix A) after 3 d of incubation at 28°C (Lutz et al., 2013; Renwick et al., 1991). 3.2.8 Scanning Electron Microscopy in vitro The possible physical interaction of the bacteria and fungal pathogen was assessed in mini Petri dishes (60 mm in diameter) containing ¼ TSA/PDA. Mycelial discs (5 mm in diameter) of 7 d old cultures were inserted into the middle of the Petri dish. Bacteria were cultured in ½ strength TSB for two days at 20°C and streaked in parallel 15 mm from the centre of the fungal disc. Cultures were incubated at 20°C for 5 d. Samples were prepared for SEM observation using the routine protocol described by Alves et al. (2013) with slight modifications. Culture plates were flooded with fixative solution, 2.5% glutaraldehyde in 0.1   56 M sodium cacodylate buffer at pH 7.2, and gently agitated at 40 rpm on a rotary shaker for 1 h then 5 mm2 of solid medium containing both bacteria and fungi were removed from the plate and transferred to 10-mL glass vials filled with 3 mL of fixative and gently agitated at 50 rpm on a rotary shaker for 3 h. Fixative was removed from the vials and samples were washed in 0.1 M sodium cacodylate buffer solution, followed by washes in distilled water. Distilled water was removed from the vials and samples were dehydrated in graded series with ethanol (25, 50, 75, 90 and 100% once for concentrations up to 90% and twice for the 100% concentration). Samples were dried with a critical point dryer (CPD 020, Balzers Union, Aktiengesellschaft, Balzers, Liechtenstein) and affixed to aluminum stubs with carbon tape followed by sputter coating with 20 nm of gold. The samples were then observed with a Tescan Mira3 XMU Field Emission Scanning Electron Microscope (Tescan Orsay Holding a.s., Brno, Czech Republic). 3.2.9 Scanning Electron Microscopy in vivo The possible physical interaction of the bacteria and fungal pathogen was assessed in apple wounds. Apples were sliced so that four faces were obtained from a single apple, allowing a large surface area of peel to remain on each slice. Apple slices were placed in a petri dish containing 2 mL of sterile water with the peel side facing up. A 2 mm deep 4 x 4 x 4 mm wide triangular wound was made at the equatorial region using a scalpel. The peel from the wound was removed and 25-µL aliquots of P. fluorescens isolates 1-112, 2-28 or 4-6, at 1 x 108 CFU mL-1 were inoculated into each wound site. After 2 h, a 25-µL suspension of P. expansum at 1 x 105 spores mL-1 was inoculated into each wound, plates were sealed with parafilm to maintain high humidity and incubated at 20°C for 7 d. Wounded tissue (8 mm3) was excised from treated fruit with a scalpel and immediately immersed in 2.5%   57 glutaraldehyde fixative solution in 0.1 M sodium cacodylate buffer at pH 7.2 for 5 h. Apple wound samples were prepared for SEM as described in section 3.2.8. 3.2.10 Data analysis All data were analyzed using the general linear model (GLM) analysis of variance (ANOVA) procedures with SPSS software (Version 20.0, SPSS Inc., Chicago, IL, USA). Percentage data were subjected to arcsine-square root transformation before the ANOVA. Mean separations were performed by a Tukey’s test (P < 0.05). Data from repeated experiments were combined for analysis when variance between experiments was homogenous (P < 0.05). This was assessed by running a GLM ANOVA and adding experiment to the model as a main effect. The in vitro data presented in this chapter are the result of one individual experiment and were representative of at least two independent experiments with similar results. The in vivo data from the commercial storage trials were not pooled from multiple years and analyzed together because the time the apples were in commercial storage prior to inoculation, the physical condition of the apples and the maturity stage of the apples (Table D.1-6), were highly variable from year-to-year. 3.3 Results 3.3.1 Biological control activity in vivo The antifungal activity of P. fluorescens isolates was tested against P. expansum on ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples during commercial cold storage at 0°C and compared to commercial controls, BioSave® and Scholar® (Fig. 3.1; Table D.7-18). After 15 weeks in cold storage, isolates 1-112 (1.3 mm), 4-6 (4.1 mm), BioSave® (1.1 mm) and Scholar® (0.4 mm) reduced the size of the lesion of blue mold on ‘McIntosh’ apples in comparison to the control (13.4 mm) (Fig. 3.1A; Table D.11). Isolates 1-112 and 4-6 reduced   58 the incidence of blue mold on ‘McIntosh’ apples by 91 and 74%, respectively, in comparison to the control and both were comparable to BioSave® and Scholar®, at reducing the lesion diameter. P. fluorescens isolate 1-112 was the most effective at inhibiting blue mold caused by P. expansum and its efficacy was similar to that of commercially available controls, BioSave® and Scholar®, on ‘McIntosh’ apple (Fig. 3.1A & B; Table D.11). Results from the 2014-15 commercials storage trials (Table D.7, D.10, D.13 & D.16) have been excluded from this chapter due to low incidence of disease in the control fruit. ‘McIntosh’ commercial storage results from 2016-17 (Table D.12) have been excluded due to the low incidence of blue mold (<10%) in the control fruit. After 15 weeks in cold storage P. fluorescens isolate 2-28 significantly reduced the lesion diameter of blue mold on ‘Spartan’ apples in comparison to the control (Fig. 3.1C; Table D.14). Isolates 1-112 and 2-28 reduced the incidence of blue mold on ‘Spartan’ apples by 68 and 88% respectively in comparison to the control and were comparable to BioSave® (Fig. 3.1D; Table D.14). On ‘Spartan’ apples, P. fluorescens isolate 2-28 was the most effective at inhibiting blue mold caused by P. expansum and its efficacy was similar to the registered BCA, BioSave®, and the chemical fungicide, Scholar® (Fig. 3.1C & D; Table D.14). In the 2016-17 storage trials, isolates 2-28 and 4-6 reduced the size of the blue mold lesion, but not the incidence of disease in comparison to the control fruit (Table D.15). ‘Gala’ commercial storage results from the 2015-17 trials (Table D.8-9) have been excluded due to the low incidence of blue mold (<10%) in the control fruit. In the 2015-16 storage trials, isolate 4-6 reduced the size of the lesion and the incidence of blue mold on ‘Ambrosia’ apples in comparison to the control fruit (Table D.17); isolates 1-112 and 2-28   59 were not tested during this storage trial. In the 2016-17 storage trials, only Scholar® controlled blue mold on ‘Ambrosia’ apples after 15 weeks of storage (Table D.18).  Figure 3.1 Blue mold lesion diameter and disease incidence of ‘McIntosh’ (A & B) and ‘Spartan’ (C & D) apples inoculated with the fungal pathogen P. expansum after 15 weeks in commercial cold storage at 0°C. Apples treated with P. expansum were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2015-16 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).   After 15 weeks of storage, ‘McIntosh’ apples were smaller, firmer and had higher TA than ‘Spartan’ apples (Table 3.2; Table D.4). The cultivars did not differ significantly in starch and TSS content. Table D.3 and D.4 summarize the physiological fruit quality characteristics of all 4 apple varieties before and after 15 weeks of commercial cold storage in 2015-16.  05101520Lesion diameter (mm)Control1-1122-284-6BioSave®Scholar®acabbcc c0510152025Lesion diameter (mm) aabbabbb0102030405060Disease incidence (%) acabbc bcc0102030405060Disease incidence (%) abccbcabbA BC DTreatment Treatment  60 Table 3.2 Physiological fruit quality characteristics of untreated ‘McIntosh’ and ‘Spartan’ apples after 15 weeks in commercial cold storage trials, 2015-16. Cultivar Weight (g)a Firmness (Ibs)a Starch Indexa TSS (%)a TA (% malic acid)b McIntosh 157 ± 7 b* 10.0 ± 0.2 a 9 ± 0 a 14.2 ± 0.2 a 0.60 ± 0.02 a Spartan 190 ± 10 a 8.6 ± 0.2 b 9 ± 0 a 14.4 ± 0.2 a 0.39 ± 0.01 b a Weight, firmness, starch and TSS are the means ± the standard error of 10 apples.  b TA data is the mean ± the standard error of 12 apples or 4 replicates.  * Means followed by a common letter within a column are not significantly different according to Tukey's test (P < 0.05).  3.3.2 Biological control activity in vitro  All three P. fluorescens isolates inhibited P. expansum in vitro (Fig. 3.2). P. fluorescens isolate 1-112 yielded the largest inhibition zone (15.1 mm), followed by isolate 4-6 (10.1 mm) and P. fluorescens isolate 2-28 produced the smallest inhibition zone (4. 0 mm) (Fig. 3.2). A filter disc inoculated with sterile water served as the control and did not result in inhibition of P. expansum (data not shown).  Figure 3.2 Inhibitory effect of P. fluorescens isolates, 1-112, 2-28 and 4-6, on mycelial growth of P. expansum in vitro on ¼ TSA/PDA after 5 d of incubation at 20°C. Each value is the mean of 5 replicates ± standard error. Different letters indicate significant differences according to Tukey’s test (P < 0.05).  1-112 2-28 4-605101520TreatmentZone of inhibition (mm)acb  61  P. fluorescens isolates 1-112, 2-28 and 4-6 inhibited conidial germination of P. expansum by 98.7, 91.5 and 99.7%, respectively (Table 3.3). In the control, 92.1 % of the conidia germinated. P. fluorescens isolates 1-112 and 4-6 provided the greatest inhibition of P. expansum conidial germination in FSAJ after 14 h incubation at 20°C. Table 3.3 Effect of P. fluorescens isolates, 1-112, 2-28 or 4-6 (108 CFU mL-1) on conidial germination of P. expansum (106 conidia mL-1) in filter-sterilized apple juice.   Treatment Conidial germination (%) Control 92.1 ± 3.7 a* 1-112  1.2 ± 0.6 c 2-28 7.8 ± 0.9 b 4-6 0.3 ± 0.3 c * Each value is the mean of three replicates ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).  In the sealed plate assay, there was no physical contact between P. fluorescens and P. expansum; thus, the antifungal effect on conidial germination could be attributed to the VOCs. The VOCs generated by all three isolates of P. fluorescens inhibited conidial germination of P. expansum by 100% in comparison to the control (Table 3.4). Although VOCs produced by P. fluorescens inhibited germination of P. expansum conidia, the fungus recovered when transferred to new PDA plates. Table 3.4 Effect of volatile organic compounds (VOCs) produced by three isolates of P. fluorescens isolates 1-112, 2-28 and 4-6 on the germination of conidia of P. expansum on ¼ TSA/PDA plates. Treatment CFU Control 58 ± 5.4 a* 1-112 0 ± 0 b 2-28 0 ± 0 b 4-6 0 ± 0 b  *Each value is the mean of five replicates ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).    62  3.3.3 Presence of antibiotic biosynthesis genes in P. fluorescens  In order to assess if P. fluorescens isolates 1-112, 2-28 and 4-6 have the potential to produce common pseudomonad antibiotics, total DNA was amplified by PCR with specific primers for genes for DAPG, PCA, Prn, Plt and HCN biosynthesis. Only isolate 2-28 was positive for the hydrogen cyanide biosynthesis gene (Fig. 3.3A). Both isolates 1-112 and 4-6 amplified 1050 bp fragments for the gene encoding the production of PCA (Fig. 3.3B). All three isolates were negative for the genes encoding the production of Plt, DAPG and Prn.  Figure 3.3 Agarose gel showing the polymerase chain reaction amplification of A) 587 bp fragments and B) 1050 bp fragments for hydrogen cyanide and phenazine-1-carboxylic acid biosynthesis genes in P. fluorescens, respectively.         63  3.3.4 Lytic enzyme production by P. fluorescens All three biological control isolates were positive for protease, but negative for the lytic enzymes cellulase, chitinase and glucanase (Table 3.5). Table 3.5 Production of extracellular hydrolytic enzymes by P. fluorescens isolates 1-112, 2-28 and 4-6.  Isolate Cellulase Protease Chitinase Glucanase 1-112 - + - - 2-28 - + - - 4-6 - + - -   3.3.5 Scanning Electron Microscopy in vitro   The interaction of P. fluorescens isolates 1-112, 2-28 and 4-6 with the fungal pathogen P. expansum in vitro was examined with SEM after 5 d of incubation (Fig. 3.4). Untreated hyphae of P. expansum were smooth, healthy and bearing numerous conidia on phialides (Fig. 3.4). All three isolates of P. fluorescens colonized the fungal hyphae (Fig. 3.4B- D), while only isolate 1-112 was observed to colonize the conidia of P. expansum (Fig. 3.4B). Large amounts of an extracellular matrix accumulated around the hyphae in the interaction with isolate 2-28 (Fig. 3.4C), and smaller amounts in the interaction with isolate 4-6 (Fig. 3.4D). Although isolate 4-6 appeared to produce smaller amounts of an extracellular matrix, it may produce toxic compounds capable of degrading the hyphae as multiple holes were observed in the hyphal cell wall (Fig. 3.4D). In some areas, P. expansum hyphae were completely surrounded by P. fluorescens cells (Fig. 3.4C).   64        Figure 3.4 Scanning electron micrograph of healthy P. expansum hyphae (h) and conidia (c) (A) and P. expansum interacting with P. fluorescens (p) isolate 1-112 (B), 2-28 (C) and 4-6 (D) on ¼ tryptic soy agar/potato dextrose agar after 5 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens.  3.3.6 Scanning Electron Microscopy in vivo  The interaction of the antagonist with the fungal pathogen in apple wounds was examined with SEM after 7 d incubation (Fig. 3.5). In the control, apple wounds inoculated   65 with only a conidial suspension of P. expansum, a dense mycelium with numerous branched conidiophores with intact conidia was observed (Fig. 3.5A). After co-culturing the pathogen with the antagonist, numerous individual un-germinated conidia of P. expansum were observed (Fig. 3.5B-D). In the wounds of apple fruits inoculated with P. fluorescens and P. expansum, the antagonist adhered to the fungal hyphae (Fig. 3.5B- D), but to a lesser extent than was observed in vitro (Fig. 3.4B- D). Although all three isolates of P. fluorescens colonized the hyphae of P. expansum, only isolate 1-112 was observed to colonize the conidia in apple wounds (Fig. 3.5B). P. fluorescens isolates 1-112, 2-28 and 4-6 colonized the apple wound, decreasing colonization by the fungal pathogen, and produced an extracellular matrix (Fig. 3.5B-D). They also appeared to reduce colonization of the wound by the fungal pathogen, but no quantitative assessment was made.       66   Figure 3.5 Scanning electron micrograph of healthy P. expansum hyphae (h) and conidia (c) (A) and P. expansum interacting with P. fluorescens (p) isolate 1-112 (B), 2-28 (C) and 4-6 (D) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens.  3.4 Discussion  Over the past 30 years many scientists and several commercial companies have focused their research efforts on the use of BCAs as an alternative to chemical fungicides.   67 The development of resistant fungal pathogens, de-registration of key fungicides, as well as environmental and human health concerns have been the main driving forces towards alternative control strategies (Wilson and Wisniewski, 1989; Droby et al., 2016). The carposphere has been extensively investigated for new antagonists effective at controlling common postharvest pathogens (Mari et al., 2012), but these microorganisms are often poorly adapted to the commercial storage environment (Lutz et al., 2012; Hu et al., 2015). My study examined the potential of three cold-adapted isolates of P. fluorescens, previously isolated from the rhizosphere of pulse crops in Saskatchewan, Canada (Hynes et al., 2008), to control P. expansum on ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples in 0°C commercial cold storage. To elucidate the possible mechanisms of action of P. fluorescens isolates 1-112, 2-28 and 4-6 to control P. expansum I studied the interaction of the antagonist and the pathogen as well as the antagonist’s ability to produce inhibitory metabolites such as VOCs, antibiotics and lytic enzymes capable of inhibiting conidial germination and mycelial growth. This study indicated that all three isolates of P. fluorescens were able to provide some control against P. expansum during commercial cold storage. On ‘McIntosh’ apples isolates 1-112 and 4-6 reduced the lesion size and incidence of blue mold decay and were both comparable to BioSave® and Scholar®. On ‘Spartan’ apples isolate 2-28 provided disease control comparable to BioSave® and Scholar®. Isolate 1-112 reduced the incidence of blue mold on ‘Spartan’ apples but not the size of the lesion. My findings are consistent with Etebarian et al. (2005), who showed P. fluorescens 1100-6 provided control of Penicillium spp. comparable to BioSave® on ‘Gala’ apples after two months storage at 0°C. Mikani et al. (2008) showed that 10 strains of P. fluorescens were effective at controlling Botrytis mali on   68 apples stored at 5°C for 25 d. The variability in the level of disease control provided by each isolate of P. fluorescens is in agreement with other studies that have shown biological control capabilities can vary among different strains of the same antagonist species (Mikani et al., 2008; Spadaro et al., 2013). Spadaro et al. (2013) attributed the higher level of control provided by yeast antagonists on ‘Golden Delicious’ apples, compared to ‘Granny Smith’, ‘Red Chief’ and ‘Royal Gala’ apples, to their higher soluble solids content, as one of the main modes of action of yeast BCAs is competition for nutrients, particularly carbon sources. In our study ‘McIntosh’ and ‘Spartan’ apples did not differ significantly in their TSS content, but did differ in weight, firmness and malic acid content. Janisiewicz et al. (2000) investigated the competition between A. pullulans and P. expansum for limited nutrients and showed that the antagonist inhibited conidial germination and depleted amino acids. A more comprehensive understanding of the fruit quality parameters, particularly carbon and nitrogen compounds, of ‘McIntosh’ and ‘Spartan’ apples may help explain why better control of blue mold was observed on ‘McIntosh’ apples in my study. In 2014-17, storage trials were also performed on ‘Gala’ apples, but very low levels of disease were observed in the positive control fruit. Similarly, trials were performed on ‘Ambrosia’ apples, but of our three isolates of P. fluorescens, only isolate 4-6 was tested (Table D.17).  All three isolates of P. fluorescens reduced conidial germination and mycelial growth of P. expansum in vitro. In vitro, zones of inhibition were observed between the bacteria and the mycelial lawn of P. expansum, where isolate 1-112 produced the largest inhibition zone. The inhibition provided by the three isolates could be due to diffusible inhibitory compounds produced by P. fluorescens or the direct interaction with P. expansum resulting in suppressed growth of the pathogen. Fungal spores are a major source of postharvest disease. As a result,   69 when investigating a new BCA, it is imperative to determine the effect of the antagonist on the ability of the fungal pathogen to germinate.  My in vitro experiments showed that P. fluorescens isolates 1-112, 2-28 and 4-6 were highly effective at inhibiting conidial germination of P. expansum in FSAJ by over 90% in comparison to the control. Isolates 1-112 and 4-6 were the most effective, inhibiting conidial germination by more than 98%. My findings are in agreement with other studies that have shown the ability of microbial antagonists to inhibit spore germination of postharvest fungal pathogens in liquid culture (Calvo et al., 2007; Lee et al., 2012; Spadaro et al., 2013). All three isolates of P. fluorescens produced VOCs that inhibited the conidial germination of P. expansum in vitro. Preliminary work on fumigation by a BCA (Mercier and Jiménez, 2003) showed that fumigation of apples with Muscodor albus cultures for 7 d gave complete control of blue mold and grey mold in wound-inoculated fruits. Di Francesco et al. (2015) demonstrated that VOCs produced by A. pullulans L1 and L8 gave excellent control of P. expansum, B. cinerea and Colletotrichum acutatum on ‘Golden Delicious’ apple. Whether the antifungal VOCs produced by P. fluorescens isolates 1-112, 2-28 and 4-6 contribute to blue mold suppression on apple remains to be demonstrated. My findings demonstrated that direct contact of P. fluorescens with P. expansum is not required for antagonism in vitro and bio-fumigation with P. fluorescens volatiles could be a potential alternative strategy for controlling postharvest diseases. The primary mechanism of action of bacterial BCAs has commonly been attributed to the production of toxic metabolites such as antibiotics (Raaijmakers et al., 2002; Haas and Keel, 2003; Sharma et al., 2009). The importance of the production of DAPG, PCA, Prn, Plt and HCN by fluorescent pseudomonads in biological control of plant diseases has been well   70 documented (Haas and Keel, 2003; Mavrodi et al., 2006; Santoyo et al., 2012). For example, the antifungal activity of P. fluorescens 2-79 against plant pathogens in the rhizosphere has been linked to the production of phenazine antibiotics (Thomashow and Weller, 1988). Selin et al. (2010) showed that PCA is not responsible for the biological control activity of Pseudomonas chlororaphis PA23, but it is essential for biofilm formation. Genetic modification of P. fluorescens F113 by Delany et al. (2001) elucidated the importance of DAPG in the control of the oomycete Pythium ultimum. The main modes of action of the commercially available BCA BioSave® (a.i. P. syringae) are competition for nutrients and space, but the production of syringomycin E may also play a role in its ability to control postharvest decay (Bull et al. 1998). Janisiewicz and Roitman (1988) reported the principal mode of action of Pseudomonas cepacia against P. expansum and B. cinerea was through antagonism by the production of Prn. Pyoluteorin is another antibiotic that is commonly produced by fluorescent pseudomonads and is characterized by its bactericidal, herbicidal and fungicidal activities (Vinay et al., 2016). Altering the expression of genes for the production of Plt by P. fluorescens Pf-5 resulted in enhanced disease control compared to the wild type strain (Kraus and Loper, 1995). Voisard et al. (1989) concluded that the production of the volatile compound HCN by P. fluorescens CHAO is important in the control of black root rot of tobacco. To assess if the production of antifungal metabolites could be a mechanism of antagonism utilized by our isolates of P. fluorescens, I screened them for the presence of biosynthesis genes encoding the production of antibiotics commonly associated with pseudomonad BCAs. Molecular evidence for the potential to produce the antibiotic, PCA, in isolates 1-112 and 4-6 as well as the potential for HCN production in isolate 2-28 was obtained by PCR. None of the isolates was positive for the primers specific for the genes   71 involved in Plt, DAPG and Prn production. My findings suggest that P. fluorescens isolates 1-112, 2-28 and 4-6 may rely on other mechanisms of antagonism, as they appear to lack some of the genes necessary for the production of antibiotics commonly associated with fluorescent pseudomonads. The physical interaction of the antagonist with the pathogen has been shown to play a major role in the biological control capabilities of the antagonist (Cook, 2002; Di Francesco et al., 2016). Chan and Tian (2005) observed that the potential BCAs, C. albidus and P. membranefaciens loosely adhered to the hyphae of P. expansum in the wounds of apple. Earlier work by Hashem et al. (2014) showed that C. albidus heavily colonized the hyphae of P. expansum in vitro and formed an extracellular matrix. In my study SEM was used to elucidate the interaction between the fungal pathogen, P. expansum, and the antagonist, P. fluorescens, in vitro and in the wounds of apples. I found that P. fluorescens colonized the fungal hyphae of P. expansum to varying degrees depending on the growth medium (Fig. 3.4 & 3.5). In vitro, the fungal hyphae were heavily colonized by P. fluorescens, but in the apple wound little colonization of the hyphae was observed. All three isolates colonized the wounds of apples, excluding the pathogen from much of the wound site. The colonization of the fungal hyphae and wound site by P. fluorescens may inhibit P. expansum mycelial growth and conidial germination by restricting access of the pathogen to essential nutrients. My findings that all three isolates failed to produce chitinases, cellulases or glucanases is supported by the fact that little degradation of the fungal hyphae was observed in vitro and in the apple wound. Inhibition of P. expansum conidial germination by P. fluorescens isolates 1-112, 2-28 and 4-6 can be inferred from the numerous individual conidia that were not germinated in the apple wounds. This is in agreement with my in vitro findings, which   72 showed that all three isolates of P. fluorescens inhibited conidial germination of P. expansum in sterile apple juice. Both in vitro and in vivo all three isolates were observed to form an extracellular matrix that resembled a biofilm. Due to the nature of sample preparation for electron microscopy, further work is needed to confirm the ability of P. fluorescens isolates to form a biofilm. Interestingly, only isolate 1-112 was observed to colonize the conidia of P. expansum. My findings suggest that mechanisms, such as competition for nutrients and space at the wound site, may play a larger role in P. fluorescens biological control capabilities than direct parasitism on P. expansum. The nature of the interaction of the antagonistic bacteria with the fungal pathogen was observed to vary from isolate to isolate and is highly influenced by the medium on which the organisms were cultured. The results of this study showed that P. fluorescens isolates 1-112 and 4-6 were effective agents for control of P. expansum on ‘McIntosh’ apples stored at 0°C for 15 weeks. Similarly, isolate 2-28 was effective at controlling P. expansum on ‘Spartan’ apples. These results suggest that P. fluorescens may have the ability to control blue mold during commercial cold storage. Potential modes of action may include competition for nutrients and space, production of inhibitory metabolites, and biofilm formation, all of which target conidial germination and mycelial growth. These data suggest that development of resistance by fungal pathogens to these BCAs may be unlikely, compared to that developed by pathogens to fungicides with a single mode of action. In order to achieve efficacy similar to that of chemical fungicides, which is in the range of 98-100%, P. fluorescens may need to be applied in combination with other physical or chemical controls or lower doses of fungicides.  73 Chapter 4: Mechanisms of Action of Three Isolates of Pseudomonas fluorescens Active Against Postharvest Grey Mold Decay of Apple During Commercial Storage2  4.1 Background B. cinerea (anamorph) and its teleomorph (B. fuckeliana), a necrotrophic fungal pathogen affecting more than 200 plant species worldwide (Williamson et al., 2007), was recently reported as the second most important pathogen in plant pathology (Dean et al., 2012). It causes grey mold decay on apples and is one of the most destructive postharvest pathogens of pome fruit (Xiao, 2014). Postharvest losses from fungal decay have been reported as high as 25 and 50% in developed and developing countries, respectively (Janisiewicz and Korsten, 2002; Sharma et al., 2009). Chemical fungicides such as thiabendazole (Mertect®) and fludioxonil (Scholar®) have been applied extensively to fruit to reduce postharvest loss, but pathogen resistance is emerging (Errampalli et al., 2006; Panebianco et al., 2015a; Jurick et al., 2017). The declining effectiveness of fungicides due to the development of fungal resistance, the de-registration of key fungicides, and public demand for produce free of chemicals have led to heightened interest in finding more eco-friendly and sustainable alternatives. The use of microbial antagonists or BCAs is a promising alternative as they pose less risk to human health and the environment (Janisiewicz and Korsten, 2002; Manso and Nunes, 2011).                                                  2 A version of Chapter 4 has been published as a journal article. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2018. Mechanisms of action of three isolates of Pseudomonas fluorescens active against postharvest grey mold decay of apple during commercial storage. Biological Control 117, 13-20.   74 Many candidate BCAs isolated from fruit or plant surfaces have since been reported to be effective in controlling grey mold decay on pome fruit including: M. pulcherrima (Piano et al., 1997), P. guilliermondii (Zhang et al., 2011), R. mucilaginosa (Li et al., 2011), A. pullulans (Mari et al., 2012), R. aquatilis (Calvo et al., 2007), and Bacillus licheniformis (Jamalizadeh et al., 2008). Although much of the research done in the past two decades has focused on the potential of yeast antagonists to control postharvest fungal pathogens (Sharma et al. 2009; Spadaro and Droby, 2016), one of the first and longest commercially registered postharvest biofungicides, BioSave® (Jet Harvest Solutions, Longwood, Florida, USA), is based on the bacterium P. syringae. The efficacy of P. syringae has been well documented in laboratory and storage trials for controlling common postharvest fungal pathogens (Janisiewicz and Jeffers, 1997; Errampalli and Brubacher, 2006; Xiao and Boal, 2013; Panebianco et al., 2015b). Also, one of the more recently registered synthetic fungicides for managing postharvest decay, Scholar®, has the active ingredient fludioxonil which is a derivative of Prn, an antibiotic first isolated from Pseudomonas sp. (Arima et al., 1964).  Microbial antagonists are living organisms that may possess an array of mechanisms to combat postharvest fungal pathogens. Understanding the mechanisms of action of BCAs is not only of importance to enhance their viability and efficacy in disease control, but, also as a prerequisite of product development and registration (Droby et al., 2016). The primary mechanism of action of microbial antagonists often has been attributed to competition with the fungal pathogen for limited nutrients, such as iron or nitrogen, at the wound site or for space (Janisiewicz et al. 2000; Janisiewicz and Korsten, 2002; Bencheqroun et al., 2007). Additional modes of action such as antibiosis, biofilm formation, production of VOCs, quorum sensing, lytic enzyme production, parasitism and induction of host defenses have   75 also been suggested (Di Francesco et al., 2016; Spadaro and Droby, 2016). Biological control agents can exhibit a wide range of mechanisms of action that may be influenced by a number of factors including the fruit host, fungal pathogen and storage environment, and a single mechanism may not be responsible for complete disease control (Chan and Tian, 2005; Li et al., 2011). In our earlier studies, three isolates of the bacterium P. fluorescens, 1-112, 2-28 and 4-6, isolated from the rhizosphere of pulse crops in Saskatchewan, Canada (Hynes et al., 2008) showed strong inhibitory activity against common postharvest pathogens (Nelson et al., 2011; Wallace et al., 2016). The aims of this chapter were to: (i) evaluate the potential of three isolates of P. fluorescens to control B. cinerea on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples during commercial cold storage at 0°C and compare them to commercial controls, Scholar® and BioSave®; (ii) investigate the effect of P. fluorescens isolates or their metabolites on the growth of B. cinerea in vitro; (iii) observe the interaction of P. fluorescens with B. cinerea in apple wounds; and (iv) assess the ability of P. fluorescens to form a biofilm in vitro. 4.2 Materials and Methods 4.2.1 Antagonists P. fluorescens isolates, 1-112, 2-28 and 4-6, were obtained from the rhizosphere of pulse crops in Saskatchewan Canada by Hynes et al. (2008). Bacterial isolates were maintained as described in section 3.2.1. Before the experiment, bacterial inocula were prepared by incubating each isolate of P. fluorescens in TSB at 20°C on a rotary shaker set at 185 rpm. The OD of the incubated culture was measured with a spectrophotometer (ThermoFisher Scientific, Waltham, MA, U.S.A.) at 600 nm. The CFU per mL of each   76 bacterial isolate were determined using standard calibration curves (Appendix B) and adjusted to the desired concentration depending on the experiment. 4.2.2 Pathogen B. cinerea Pers.:Fr strain 27 was kindly provided by Dr. P. Sholberg, Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland, BC and was maintained as described in section 3.2.2. A spore suspension was prepared according to the method of Errampalli (2004). The spores were enumerated with a Petroff-Hauser counting chamber and spore suspensions were adjusted to the appropriate concentration with sterile distilled water.  4.2.3 Fruit and physiological quality parameters Apple (Malus domestica Borkh.) fruit of cv. ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ were harvested from orchards in the Okanagan Valley, British Columbia, Canada in 2014 and kindly provided by the BCTFC for this study. Fruit were selected and prepared for the experiments as described in section 3.2.3.  Physiological fruit quality parameters were assessed on healthy untreated apples prior to commercial storage. Firmness, TSS, starch index, and TA were measures as described in section 3.2.3. 4.2.4 Antagonism in vivo The fruit were wounded and then inoculated with the bacteria, fungicide and/or spores of B. cinerea as described in section 3.2.4. The drenching method of inoculation was chosen as it closely resembles commercial operations where packinghouses apply fungicides or bio-fungicides as a drench prior to storage. There were 3 replicates of 10 fruits for each treatment. After inoculation bags of apples were placed in plastic totes and transferred to a   77 0°C commercial cold storage room at the BCTFC in Winfield, BC. Treatments included positive controls of the fungal pathogen alone, and the pathogen in combination with each P. fluorescens isolate, or the fungicide Scholar®, or the BCA, BioSave®. The lesion diameters and disease incidence, percentage of wounds visibly infected with the pathogen, were determined after 15 weeks in 0°C commercial cold storage. Independent experiments were conducted in 2014-15 on ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples, but only results from the ‘Spartan’ and ‘Ambrosia’ apple trials are presented in this chapter. 4.2.5 Antagonism in vitro  The effect of P. fluorescens isolates or their metabolites on B. cinerea spore germination was assessed in FSAJ. The FSAJ was prepared as described in section 3.2.5. P. fluorescens isolates 1-112, 2-28 and 4-6 were cultivated in TSB for 30 h at 20°C. The OD of the incubated bacterial cultures was determined with a spectrophotometer and the cultures were diluted in sterile distilled water to obtain a solution of 108 CFU mL-1. Alternatively, incubated bacterial cells were centrifuged at 6,000 g for 20 min and the supernatant was filtered through a 0.22 µm filter (MillexTM, EMD Millipore, Billerica, MA, U.S.A.) to obtain the cell-free supernatant (CFS). A spore suspension (250 µL of a solution containing 105 spores mL-1) of B. cinerea alone (prepared as described in section 3.2.2), or in combination with living cells (250 µL; 108 CFU mL-1) or CFS (250 µL) of each P. fluorescens isolate was added to the wells. As a control, 250 µL of the fungal pathogen were added to 500 µL of FSAJ plus 250 µL of sterile water. After 14 h of incubation at 20°C on a rotary shaker set at 100 rpm, a minimum of 100 spores was observed microscopically per replicate and percent germination was determined by counting how many spores produced germ tubes. The spores were considered germinated when the size of the germ tube was twice the size of the spore.   78 Each treatment was conducted in triplicate and the experiment was performed twice. The ability of P. fluorescens isolates 1-112, 2-28 and 4-6 to produce metabolites with inhibitory activity against B. cinerea mycelial growth was assessed by culturing the fungus on ¼ TSA/PDA medium amended with P. fluorescens CFS. P. fluorescens isolates 1-112, 2-28 and 4-6 were cultivated in TSB for 48 h at 20°C. Quarter strength TSA/PDA supports the growth of both fungus and bacterium and enabled comparison with an earlier study using whole bacterial cells (Wallace et al., 2016). After the incubation period, cells were centrifuged at 6,000 g for 20 min and the supernatant was decanted into a sterile vacuum filtration unit (0.2 µm PES sterile membrane). Autoclaved media (PDB, TSB and agar in half the volume of water) and sterile-filtered CFS were placed in a 55°C water bath and allowed to reach the same temperature. The CFS of each isolate of P. fluorescens was combined with the molten ¼ TSA/PDA by substituting it for half the volume of the distilled water (Appendix A). Once combined the components were immediately mixed and poured into petri dishes and allowed to solidify. A 7-mm plug of B. cinerea was inserted into the center of the petri dish containing CFS-amended ¼ TSA/PDA and incubated at 20°C. B. cinerea cultured on ¼ TSA/PDA that was not amended with CFS served as the control. After 72 h the diameter of the fungal mycelium was measured. Each treatment was replicated four times and the experiment was performed twice.  The dual culture sealed plate assay of Dennis and Webster (1971) was performed to assess the activity of VOCs produced by P. fluorescens on the mycelial growth of B. cinerea. The experiment was conducted as described in section 3.2.5, except a 7-mm plug of the fungus was inserted into the middle of the petri dish instead of spreading a lawn of conidia on top of the medium. After 72 h the diameter of the fungal mycelium was measured. The   79 production of volatile compounds was determined based on the inhibition of the radial growth of the fungus. After 96 h of incubation, an agar plug of the inhibited fungal mycelium was removed and transferred to a new plate of ½ PDA. The viability of the fungal culture was assessed after an additional 96 h of incubation at 20°C (Leelasuphakul et al., 2008). Each treatment was replicated five times and the experiment was performed twice.  4.2.6 Scanning Electron Microscopy in vivo The physical interaction of the bacteria and fungal pathogen was assessed in apple wounds. Samples were prepared for SEM as described in section 3.2.9. The samples were observed with a Tescan Mira3 XMU Field Emission Scanning Electron Microscope (Tescan Orsay Holding a.s., Brno, Czech Republic). 4.2.7 Biofilm formation To assess the ability of P. fluorescens isolates to form a biofilm in vitro the method of Christensen et al. (1985) was followed with slight modifications using a polystyrene 24-well tissue culture plate. Bacteria were incubated in TSB for 22 h at 20°C on a rotary shaker set at 185 rpm and then diluted (1:100) with FSAJ or TSB and 500 µL were transferred to wells of a tissue culture plate. Bacteria were incubated for 4, 8, 12 and 16 h at 22°C without agitation. Culture was removed from the wells, followed by three washes in distilled water to remove any unattached bacteria. Subsequently, wells were stained with 750 µL of 1% (w/v) crystal violet for 15 min at room temperature. Crystal violet was removed and the wells were washed three times with distilled water to remove any residual dye and unattached bacteria. Stained biofilm cells were detached from the wells with 750 µL of 95% ethanol (15 min), and the absorbance at 600 nm (A600) of the solubilized biofilm was determined with a spectrophotometer. This procedure was repeated with non-inoculated media to obtain blanks   80 for measuring the optical densities of the bacterial samples with a spectrophotometer. Each treatment was completed in triplicate and the experiment was repeated twice. 4.2.8 Data analysis Statistical analyses were performed with SPSS version 20.0 (SPSS Inc., Chicago, IL, USA) and analyzed using the GLM ANOVA procedures. When the analysis of variance was statistically significant, Tukey’s test was used to separate means.  Differences at P < 0.05 were considered significant. Percentage data were subjected to arcsine-square root transformations and lesion diameter data were subjected to plus 0.5 square root transformations before the ANOVA. All experiments were performed at least twice and when the treatment means were similar the data were pooled and analyzed together as described in section 3.2.10.  4.3 Results 4.3.1 Antagonism in vivo ‘Ambrosia’ and ‘Spartan’ apples differed significantly in several fruit quality parameters including firmness, starch, TSS and TA prior to commercial storage in fall 2014 (Table 4.1; Table D.1). ‘Ambrosia’ apples were firmer, lower in starch and malic acid content and higher in sugar content (TSS) than ‘Spartan’ apples. The two cultivars did not differ significantly in weight (Table 4.1; Table D.1). Tables D.1 and D.2 summarize the physiological fruit quality characteristics of all 4 apple varieties before and after 15 weeks of commercial cold storage in 2014-15.      81 Table 4.1 Physiological fruit quality characteristics of apples prior to commercial storage, 2014-15. Cultivar Weight (g)a Firmness (N)a Starch Indexa TSS (%)a TA (g malic acid/100 mL)b Spartan 194 ± 11 a  68.9 ± 0.9 b  3.5d ± 0.2 b  11.8 ± 0.3 b  0.51 ± 0.01 a  Ambrosia 216 ± 8 a  77.0 ± 1.3 a  6.6 ± 0.3 a  13.1 ± 0.3 a  0.33 ± 0.01 b  aWeight, firmness, starch and TSS are the means ± the standard error from 10 apples.  bTA data are the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test. d 9= low starch content and 1=high starch content.   The inhibitory activity of P. fluorescens isolates against B. cinerea was assessed on ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples stored for 15 weeks in commercial cold storage at 0°C and compared to commercial controls, BioSave® and Scholar® (Fig. 4.1; Table D.7, D.10, D.13 & D.16). After 15 weeks in cold storage all three isolates of P. fluorescens reduced the size of the lesion and incidence of grey mold on ‘Ambrosia’ apples and were comparable to the biofungicide BioSave® (Fig. 4.1A & B; Table D.16). In comparison to the control fruit, isolates 1-112, 2-28 and 4-6 reduced the size of the grey mold lesions by 63.8, 59.5 and 61.5%, respectively (Fig. 4.1A; Table D.16). Similarly, isolates 1-112, 2-28 and 4-6 reduced the incidence of grey mold on ‘Ambrosia’ apples by more than 50% on average, compared to the control fruit (Fig. 4.1B; Table D.16). On ‘Spartan’ apples stored for 15 weeks, isolates 1-112, 2-28 and 4-6 reduced the size of the grey mold lesions by 82.8, 81.0 and 99.1%, respectively, and were comparable to BioSave® and Scholar® (Fig. 4.1C; Table D.13). In comparison to the control, isolates 1-112 and 4-6 reduced the incidence of grey mold on ‘Spartan’ apples by 82.3 and 94.0%, respectively (Fig. 4.1D; Table D.13). ‘Spartan’ control apples had a mean disease incidence of 28.3%, substantially lower than that of the ‘Ambrosia’ control apples, which were completely infected with the fungal pathogen (Fig.   82 4.1; Table D.13 & D.16).  In 2014-15 commercial storage trials on ‘Gala’ apples, all three isolates inhibited the incidence of grey mold, and were comparable to BioSave®, after 15 weeks in commercial cold storage (Table D.7). Isolates 2-28 and 4-6 reduced the size of the grey mold lesion on ‘Gala’ apples and were comparable to BioSave®, but not Scholar (Table D.7). On ‘McIntosh’ apples, only the fungicide Scholar® inhibited grey mold (Table D.10).     83  Figure 4.1 Grey mold lesion diameter and disease incidence of ‘Ambrosia’ (A & B) and ‘Spartan’ (C & D) apples after 15 weeks in commercial cold storage at 0°C. Apples treated with B. cinerea were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).  4.3.2 Antagonism in vitro  The effect of P. fluorescens isolates 1-112, 2-28 and 4-6 living cells or their metabolites (in the form of CFS) on spore germination of B. cinerea was assessed in FSAJ (Fig. 4.2). In the control, 93.1 % of B. cinerea spores germinated (Fig. 4.2). Living cells of P. Control1-112 2-284-6 Bio-Save®Scholar®020406080TreatmentLesion diameter (mm) ab bbbcControl1-112 2-284-6 Bio-Save®Scholar®0510152025TreatmentLesion diameter (mm) ab bb b bControl1-112 2-284-6 Bio-Save®Scholar®020406080100TreatmentDisease incidence (%)acbb bbControl1-112 2-284-6 Bio-Save®Scholar®010203040TreatmentDisease incidence (%)ababbabbA BC D  84 fluorescens and CFS of the bacterium significantly reduced the germination of B. cinerea spores in FSAJ. When spores were co-cultured with living cells of P. fluorescens isolates 1-112, 2-28 or 4-6, spore germination was completely inhibited (Fig. 4.2). Similarly, the CFS of P. fluorescens isolates 1-112, 2-28 and 4-6 inhibited the germination of B. cinerea spores by 62.9, 78.2 and 72.6%, respectively, in comparison to the control. Thus, living cells of the antagonist were more effective at inhibiting spore germination than CFS.  Figure 4.2 Effect of P. fluorescens, isolates 1-112, 2-28 and 4-6, living cells or cell-free supernatant (CFS) on spore germination of B. cinerea in filter-sterilized apple juice after 14 h incubation at 20°C. Each value is the mean of 6 replicates ± standard error from two independent experiments. Different letters indicate significant differences according to Tukey’s  test (P < 0.05).  The antifungal activity of metabolites produced by P. fluorescens on B. cinerea mycelial growth was assessed on ¼ TSA/PDA amended with P. fluorescens CFS. After 72 h of incubation at 20°C, CFS of all three isolates of P. fluorescens inhibited the mycelial growth of B. cinerea (Table 4.2). In comparison to the control, CFS of isolate 1-112, 2-28 and 4-6 reduced the mycelial growth of B. cinerea by 59.8, 44.3 and 72.7%, respectively. P. Control1-1121-112 CFS 2-28 2-28 CFS 4-64-6 CFS020406080100Treatment% Germinationabbcccb  85 fluorescens 4-6-CFS was the most effective at inhibiting B. cinerea mycelial growth in vitro (Table 4.2).  In the dual culture sealed plate assay, there was no physical contact between the bacteria and the fungal pathogen; thus, antifungal effects observed could be attributed to VOCs generated by P. fluorescens. The VOCs produced by all three isolates significantly inhibited the mycelial growth of B. cinerea (Table 4.2). In comparison to the control, VOCs generated by the antagonists reduced mycelial growth by 82.2% on average after 72 h of incubation at 20°C. All three isolates of P. fluorescens emitted VOCs that provided comparable levels of inhibition of B. cinerea mycelial growth in vitro (Table 4.2). Although P. fluorescens’ VOCs inhibited the mycelial growth of B. cinerea, once fungal plugs of the inhibited B. cinerea were removed, the fungus completely recovered when transferred to fresh PDA plates.  Table 4.2 Effect of cell-free supernatant (CFS) or volatile organic compounds (VOCs) produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the mycelial growth of B. cinerea after 72 h incubation at 20°C.   Treatment Mycelial diameter (mm)     CFSa VOCb Control 57.5 ± 1.4 ac 58.3 ± 0.7 a 1-112 23.1 ± 0.6 c  10.9 ± 1.6 b 2-28 32.0 ± 0.3 b 8.4 ± 0.9 b 4-6 15.7 ± 0.8 d 11.9 ± 1.7 b aP. fluorescens cell-free supernatant was amended with ¼ TSA PDA to assess inhibitory activity against B. cinerea.   bVolatiles produced by P. fluorescens were assessed for inhibitory activity against B. cinerea using the dual culture sealed plate method.   cEach value is the mean ± standard error from two independent experiments. Different letters within a column indicate significant differences according to Tukey’s test (P < 0.05).          86 4.3.3 Scanning electron microscopy in vivo  The interaction of P. fluorescens isolates 1-112, 2-28 and 4-6 with the fungal pathogen, B. cinerea, in apple wounds was examined with SEM after 7 d incubation at 20°C (Fig. 4.3). In the control fruit, in wounds containing the pathogen only, numerous spores and long unbranched hyphae were observed growing within the apple tissue (Fig. 4.3A & B). In the presence of the pathogen all three isolates of P. fluorescens colonized the wound site (Fig. 4.3C-H). When co-cultured with isolate 1-112, numerous non-germinated spores embedded in a matrix of bacteria were observed on the surface of the wound (Fig. 4.3D). On the fruit tissue as well as the fungal hyphae of B. cinerea, both isolates 1-112 and 4-6 produced a dense extracellular matrix that resembled a biofilm (Fig. 4.3C & G), while little to no extracellular matrix was observed with isolate 2-28 (Fig. 4.3E-F).    87                                                                                         88                                                      Figure 4.3 Scanning electron micrographs of healthy B. cinerea hyphae (h) and spores (s) (A & B) and B. cinerea interacting with P. fluorescens (p) isolates 1-112 (C & D), 2-28 (E & F) and 4-6 (G & H) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens.  4.3.4 Biofilm formation  All three isolates formed a biofilm on polystyrene plastic after 16 h incubation in TSB at 20°C (Fig. 4.4A). When incubated in TSB, P. fluorescens biofilm formation appeared to reach a maximum after 8-12 h of incubation. However, at 16 h biofilm formation by the antagonists in TSB decreased. The biofilm formed by isolates 2-28 and 4-6 in TSB was markedly less than that of isolate 1-112 at 8 and 12 h (Fig. 4.4A). After 16 h of incubation in FSAJ, only isolate 1-112 and 4-6 formed a biofilm on polystyrene plastic (Fig. 4.4B). At all times tested, isolate 2-28 was unable to adhere to the polystyrene plastic when cultured in FSAJ. Unlike biofilm formation in TSB, biofilm formation in FSAJ increased linearly and did not appear to reach a maximum for isolates 1-112 and 4-6 during the 16-h incubation period (Fig. 4.4B). Isolate 1-112 had a significantly stronger ability to form a biofilm on polystyrene when incubated in FSAJ than isolates 2-28 and 4-6, at all times tested (Fig.   89 4.4B).   Figure 4.4 Assessment of biofilm formation by P. fluorescens isolates 1-112, 2-28 and 4-6 on polystyrene plastic when incubated in A) tryptic soy broth (TSB) or B) filter-sterilized apple juice (FSAJ) at 20°C. Each value is the mean of 3 replicates ± standard error. Different letters at each time point indicate significant differences according to Tukey’s test (P < 0.05).  4.4 Discussion  The use of microbial antagonists such as yeast, filamentous fungi and bacteria is a promising alternative to chemical fungicides and is gaining popularity for control of postharvest pathogens worldwide (Janisiewicz and Korsten 2002; Sharma et al., 2009; Wisniewski et al., 2016). Continued research on new microbial antagonists is necessary because antagonists identified in specific geographic areas may be more effective against pathogen strains in those regions (Li et al., 2011). P. fluorescens was chosen as the potential biological control organism in this study as it was isolated from cold Canadian soils and thus, suitable for survival and growth in commercial cold storage conditions of apples (Nelson et al. 2011). The use of fluorescent pseudomonads to control plant pathogens preharvest (Stockwell and Stack, 2007) and in the rhizosphere (Haas and Défago, 2005) has been well documented.   The present study showed that all three isolates of P. fluorescens significantly reduced the size of the lesion and incidence of grey mold on ‘Ambrosia’ apples after 15 4 8 12 160.00.51.01.52.0Time (h)Absorbance (600 nm)TSBAabaab bacb aabb4 8 12 160.00.51.01.52.0Time (h)Absorbance (600 nm)1-112 2-28 4-6 FSAJBacbacabcacbb  90 weeks in cold storage. On ‘Gala’ apples, P. fluorescens isolates 2-28 and 4-6 also provided significant levels of control against B. cinerea (Table D.7). Our findings are consistent with Mikani et al. (2008) who reported that 10 strains of P. fluorescens were effective at controlling B. mali on apples stored at 5°C for 25 d. In 2014-15, storage trials were also performed with ‘McIntosh’ apples, but the results were variable and none of the biological treatments tested provided control of grey mold (Table D.10). The ‘Ambrosia’ apples used in this study had significantly higher TSS content than the ‘Spartan’ apples, and were more susceptible to decay caused by B. cinerea. The abundance of carbon sources in ‘Ambrosia’ apples, in the form of sugars, may have reduced the importance of competition for nutrients as a mechanism of biological control in this apple variety. Our findings are in partial agreement with Poppe et al. (2003) who showed that P. agglomerans CPA-2 inhibited Penicillium spp. at low but not high nutrient concentrations, suggesting that competition for nutrients can be important for effective biological control in nutrient limited systems. Our research also showed that treatment of apples with the antagonist, P. fluorescens, did not adversely impair fruit quality parameters, weight, firmness, starch, TSS and malic acid content (results not shown).   To understand the putative mechanisms by which P. fluorescens controls postharvest disease of apples, we investigated the effects of living cells of P. fluorescens or their metabolites, in the form of CFS or VOCs, on spore germination and mycelial growth of B. cinerea in vitro. In an earlier report (Wallace et al., 2016), using a dual culture assay with living cells of the antagonist, we showed that isolates 1-112, 2-28 and 4-6 inhibited B. cinerea mycelial growth by 23.5, 51.2 and 58.3%, respectively, in vitro. In this study CFS and VOCs produced by all three isolates of P. fluorescens reduced spore germination and/or   91 mycelial growth of B. cinerea in vitro. When investigating a new BCA, it is important to assess the effect of the antagonist on spores of the fungus as they are the primary propagules of the pathogen that may be dispersed in the orchard or packinghouse. Unlike the majority of postharvest biological control studies, we chose sterile apple juice (FSAJ) as our culture medium for the spore germination assays as the nutrient content better resembles that found under natural conditions. As metabolites (CFS) of P. fluorescens significantly inhibited spore germination of B. cinerea in FSAJ, living cells were not required for inhibition of B. cinerea, but they did provide superior inhibition of spore germination compared to CFS. Cell-free supernatant of the antagonists was also able to inhibit mycelial growth of B. cinerea by 44.3 to 72.7% in vitro. Similar findings were reported by Jamalizadeh et al. (2008) with the bacterial antagonist, B. licheniformis and the postharvest pathogen, B. mali. In the present study, the growth reduction of B. cinerea mycelium obtained from VOCs produced by all three P. fluorescens isolates was greater than that observed with CFS. Our findings are in agreement with Mikani et al. (2008) who reported that cell-free metabolites and VOCs produced by P. fluorescens were highly inhibitory against B. mali in vitro. Although volatile compounds emitted by the antagonist showed the strongest inhibitory activity against B. cinerea, the fungus completely recovered when transferred to fresh PDA, suggesting the antagonism observed was only fungistatic. These results suggest that limiting mycelial growth and spore germination directly, by living cells of P. fluorescens, or indirectly, by the production of toxic metabolites or VOCs, may be mechanisms of antagonism utilized by P. fluorescens in the control of B. cinerea. However, their role in the biological control of grey mold in vivo remains to be elucidated.   The attachment of microbial antagonists to fungal hyphae has been suggested as an   92 important factor in biological control. Using SEM we examined the physical interaction of P. fluorescens isolates 1-112, 2-28 and 4-6 with B. cinerea in the wounds of apple. We found that all three isolates of P. fluorescens colonized the wounds of apples and to a lesser extent the hyphae of B. cinerea. The antagonist was also observed to surround germinated and non-germinated spores. Calvo et al. (2007) reported similar observations with the bacterial antagonist, R. aquatilis and suggested that spores of the pathogen may be leaking endogenous nutrients which attract and stimulate the growth of the antagonist. B. cinerea spores require exogenous nutrients for germination; thus, restricting access of this pathogen to nutrients at the wound site is an effective strategy to minimize postharvest grey mold decay development. Electron microscopy observations as well as the inability of the antagonists to produce cellulase, chitinase and glucanase (section 3.3.4; Wallace et al. 2017) suggest that lytic enzyme production by P. fluorescens isolates 1-112, 2-28 and 4-6 does not play a major role in their biological control capabilities of B. cinerea on apple. This is in contrast to Chan and Tian (2005), who reported that secretion of extracellular lytic enzymes may play a role in the biological control activity of the yeast antagonists, P. membranefaciens and C. albidus. Extracellular matrices of P. fluorescens isolates 1-112 and 4-6 accumulated around the hyphae of B. cinerea in the wounds of apples, suggesting that P. fluorescens forms a biofilm in the apple wounds. The ability of a microbial antagonist to form a biofilm is often considered an important attribute of successful biological control as it assists the antagonist in colonizing the fruit wound (Vero et al., 2013). Our in vitro assay confirmed the ability of all three isolates of P. fluorescens to form a biofilm when cultured in TSB. In agreement with our SEM observations in the wounds of apples, only isolates 1-112 and 4-6 were able to form a biofilm when cultured in FSAJ. These results highlight the   93 importance of choosing a culture medium for in vitro assays that closely resembles natural conditions of the fruit. The ability of P. fluorescens to form a biofilm on the apple tissue and fungal hyphae may inhibit decay development by physically excluding the pathogen from the wound site. To our knowledge, this work represents the first examination of the physical interaction between the bacterial antagonist, P. fluorescens and the fungal pathogen, B. cinerea in apple wounds.   The results reported here suggest that P. fluorescens isolates 1-112 and 4-6 have potential as BCAs for the control of postharvest grey mold of apples caused by B. cinerea in commercial cold storage. Potential modes of action include competition for nutrients and space, production of toxic metabolites and biofilm formation that inhibit B. cinerea spore germination and mycelial growth. Protection of fruit wounds by bacteria is a complex, interactive process. Further elucidation of the mechanisms of antagonism of P. fluorescens will aid in assessing its suitability for development as a commercial biofungicide.  94 Chapter 5: Biological Control of Mucor Rot of Apple by Pseudomonas fluorescens During Commercial Storage and Potential Modes of Action3  5.1 Background  M. piriformis belonging to the subdivision Mucormycotina is a serious postharvest fungal pathogen infecting a wide variety of fruit including pears, apples, strawberries, peaches, nectarines, and plums (Michailides et al., 1997). In pome fruit, M. piriformis causes Mucor rot; its sweet alcoholic odour and light brown colour with sporangia protruding from cracks make it easily distinguishable from other postharvest diseases such as blue mold or grey mold. It has been estimated that M. piriformis can cause losses of total yield in apple from 5 to 25% during postharvest storage and commercialization (Jijakli and Lepoivre, 2004). Initially M. piriformis was only regarded as a pathogen of minor importance, but reports of this pathogen causing decay in pome fruit in California (Michailides and Spotts, 1990), Ireland (Colhoun, 1938), Italy (Caccioni and Guizzardi, 1992), and Pennsylvania (Li et al., 2014), reinforce the need to develop control strategies for this economically important pathogen. In Canada, Mucor rot was not reported as a postharvest pathogen until 1972 when it was isolated from decayed Anjou pears in cold storage in Kelowna, British Columbia (Lopatecki and Peters, 1972). In 1985, M. piriformis was responsible for an estimated loss of $70,000 to a British Columbia packinghouse due to fruit rot and repacking costs (Sholberg and Owen, 1991).                                                  3 A version of this chapter is under consideration for publication in the Canadian Journal of Microbiology. Wallace, R.L., Hirkala, D.L., Nelson, L.M. 2018. Efficacy of Pseudomonas fluorescens for control of Mucor rot of apple during commercial storage and potential modes of action.    95  In Canada, commercial products such as eFOGTM, Mertect®, and Scholar® are chemical fungicides used to control common postharvest pathogens on pome fruit, but they are not registered for the control of Mucor rot. Meanwhile, BioSave®, with the active ingredient P. syringae, is a commercially available BCA in North America and is registered for control of M. piriformis on pome fruit, but this product is not yet widely used in packinghouses (Droby et al., 2016). The primary means to reduce the risk of fruit decay by M. piriformis are cultural practices such as good orchard sanitation, placing dry fruit into storage, and treating dump tank water with a disinfectant such as chlorine (Li et al., 2014), but this is not always sufficient to reduce losses to a commercially acceptable level. The ineffectiveness of fungicides and the high pathogenicity of this fungus, to certain apple varieties such as McIntosh (Lopatecki and Peters, 1972), suggest research into safe, sustainable decay management strategies is needed.   Over the past 30 years biological control, using epiphytic microorganisms such as yeasts, fungi, and bacteria, has emerged as an effective alternative strategy to chemical fungicides to control major postharvest pathogens of fruits (Janisiewicz and Korsten, 2002; Droby et al., 2009; Sharma et al., 2009; Droby et al., 2016). Biological control can be divided into two categories (1) the use of the naturally occurring microorganisms on the produce itself or (2) microorganisms that can be artificially introduced to control postharvest pathogens (Sharma et al., 2009). The latter, artificially inoculating microbial antagonists, has been extensively studied and has been shown to be more effective in controlling postharvest diseases of fruits and vegetables than other means of biological control (Sharma et al., 2009). To date the majority of postharvest biological control studies have investigated the control of grey mold and blue mold on apple (Janisiewicz and Korsten, 2002; Sharma et al., 2009), but   96 few have investigated the potential of microbial antagonists to control Mucor rot on apple (Janisiewicz and Roitman, 1988; Nelson et al., 2011). In previous chapters, three isolates of the bacterium P. fluorescens, 1-112, 2-28 and 4-6, isolated from the rhizosphere of pulse crops in Saskatchewan, Canada (Hynes et al., 2008) showed strong inhibitory activity against common postharvest pathogens (Nelson et al., 2011; Chapter 3; Chapter 4). The aims of this chapter were to: (i) evaluate the potential of three isolates of P. fluorescens to control M. piriformis on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples during commercial cold storage at 0°C and compare them to commercial controls, Scholar® and BioSave®; (ii) investigate the effect of P. fluorescens isolates or metabolites they produce on the growth of M. piriformis in vitro; (iii) observe the interaction of P. fluorescens with M. piriformis in apple wounds. 5.2 Materials and Methods 5.2.1 Antagonists P. fluorescens isolates, 1-112, 2-28 and 4-6, were obtained from the rhizosphere of pulse crops in Saskatchewan Canada by Hynes et al. (2008). Bacterial isolates were maintained as described in section 3.2.1. Prior to the experiment, bacterial inocula were prepared by incubating the three isolates of P. fluorescens in TSB at 20°C on a rotary shaker set at 185 rpm. The OD of the incubated culture was measured with a spectrophotometer and the CFU per mL were determined using standard calibration curves (Appendix B) and adjusted to the desired concentration depending on the experiment. 5.2.2 Pathogen M. piriformis Fischer strain 563 was kindly provided by Dr. P. Sholberg, Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland, BC   97 and was maintained as described in section 3.2.2. The spores were enumerated with a Petroff-Hauser counting chamber and spore suspensions were adjusted to the appropriate concentration with sterile distilled water.  5.2.3 Fruit Apple (Malus domestica Borkh.) fruit of cv. ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ were harvested in orchards in the Okanagan Valley, British Columbia, Canada in 2014 and kindly provided by the BCTFC for this study. Fruit were selected and prepared for the experiments as described in section 3.2.3.  Physiological fruit quality parameters were assessed on healthy untreated apples after 15 weeks of commercial storage. Firmness, TSS, starch index, and TA were measured as described in section 3.2.3. 5.2.4 Antagonism in vivo The fruit were wounded and then inoculated with the antagonist, P. fluorescens isolate 1-112, 2-28, or 4-6, or BioSave® (Jet Harvest Solutions, Longwood, Florida, USA) or Scholar® 50 WG (a.i. fludioxonil, Syngenta, Guelph, Ontario, Canada) and the pathogen, M. piriformis, as described in section 3.2.4. Treatments included positive controls of the fungal pathogen alone, and the pathogen in combination with each P. fluorescens isolate, or the fungicide Scholar®, or the BCA, BioSave®. The lesion diameters and disease incidence were determined after 15 weeks in 0°C commercial cold storage. Independent experiments were conducted in 2014-15 on ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples. 5.2.5 Antagonism in vitro  The effect of P. fluorescens isolates or metabolites they produce on M. piriformis spore germination was assessed in FSAJ. The FSAJ was prepared as described in section 3.2.5. P.   98 fluorescens isolates 1-112, 2-28 and 4-6 were cultivated in TSB for 30 h at 20°C. The bacterial inocula and CFS was prepared as described in section 4.2.5. A spore suspension (250 µL of a solution containing 105 spores mL-1) of M. piriformis alone (prepared as described in section 3.2.2), or in combination with living cells (250 µL; 108 CFU mL-1) or CFS (250 µL) of each P. fluorescens isolate was added to the wells. As a control, 250 µL of the fungal pathogen were added to 500 µL of FSAJ plus 250 µL of sterile water. After 14 h of incubation at 20°C on a rotary shaker set at 100 rpm, a minimum of 100 spores was observed microscopically per replicate and percent germination was determined by counting how many spores produced germ tubes. The spores were considered germinated when the size of the germ tube was twice the size of the spore. Each treatment was completed in triplicate and the experiment was performed twice. The ability of P. fluorescens isolates 1-112, 2-28 or 4-6 to produce metabolites with inhibitory activity against mycelial growth of M. piriformis was assessed by culturing the fungus on ¼ TSA/PDA medium amended with P. fluorescens CFS (Appendix A). A 7-mm plug of M. piriformis was inserted into the center of the petri dish containing CFS-amended ¼ TSA/PDA and incubated at 20°C. M. piriformis cultured on ¼ TSA/PDA that was not amended with CFS served as the control. After 72 h the diameter of the fungal mycelium was measured. Each treatment was replicated three times and the experiment was performed three times.  The dual culture sealed plate assay of Dennis and Webster (1971) was performed to assess the activity of VOCs produced by P. fluorescens on the mycelial growth of M. piriformis as described in section 4.2.5. The production of volatile compounds was determined based on the inhibition of the radial growth of the fungus. After 96 h of   99 incubation, an agar plug of the inhibited fungal mycelium was removed and transferred to a new plate of ½ PDA. The viability of the fungal culture was assessed after an additional 96 h of incubation at 20°C. Each treatment was replicated three times and the experiment was performed three times.  5.2.6 Scanning Electron Microscopy in vitro The physical interaction of the bacteria and fungal pathogen was assessed in mini Petri dishes (60 mm in diameter) containing ¼ TSA/PDA. Samples were prepared for SEM as described in section 3.2.8. Samples were observed with a Tescan Mira3 XMU Field Emission Scanning Electron Microscope (Tescan Orsay Holding a.s., Brno, Czech Republic). 5.2.7 Scanning Electron Microscopy in vivo The possible physical interaction of the bacteria and fungal pathogen was assessed in apple wounds. Samples were prepared for SEM as described in section 3.2.9. Samples were observed with a Tescan Mira3 XMU Field Emission Scanning Electron Microscope (Tescan Orsay Holding a.s., Brno, Czech Republic). 5.2.8 Data analysis Statistical analyses were performed with SPSS version 20.0 (SPSS Inc., Chicago, IL, USA) and analyzed using the GLM ANOVA procedures. When the analysis of variance was statistically significant, Tukey’s test was used to separate means.  Differences at P < 0.05 were considered significant. Percentage data were subjected to arcsine-square root transformations and lesion diameter data were subjected to plus 0.5 square root transformations before the ANOVA. All experiments were performed at least twice and when the treatment means were similar the data were pooled and analyzed together as described in section 3.2.10.   100 5.3 Results 5.3.1 Fruit quality characteristics   ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ differed significantly in several physiological fruit quality characteristics after 15 weeks of commercial cold storage at 0°C (Table 5.1; Table D.2). ‘Ambrosia’ apples were larger and firmer than ‘McIntosh’ and ‘Spartan’ apples, but did not differ significantly from ‘Gala’ apples. After 15 weeks of storage all four cultivars had low levels of starch and did not differ significantly from one another. ‘Spartan’ and ‘Gala’ apples had the highest TSS content, while ‘McIntosh’ apples had the lowest. ‘McIntosh’ and ‘Spartan’ apples had the highest malic acid content, but ‘Spartan’ apples were comparable to ‘Gala’. Malic acid content of ‘Ambrosia’ apples was significantly less than that of the other three apple cultivars (Table 5.1; Table D.2).  Prior to commercial cold storage, ‘McIntosh’ apples were softer and had higher titratable acidity than the other three apple varieties (Table D.1). ‘Ambrosia’ apples had the lowest titratable acidity and highest starch index, of the four apple varieties tested, prior to commercial cold storage (Table D.1). Table 5.1 Physiological fruit quality characteristics of apples after 15 weeks in commercial cold storage at 0°C, 2014-15. Cultivar Weight (g)a Firmness (N)a Starch Indexa TSS (%)a TA (% malic acid)b Gala 214 ± 10 ab* 59.2 ± 0.9 a 9 ± 0 a 14.3 ± 0.2 a 0.36 ± 0.01 b McIntosh 172 ± 11 c 38.3 ± 0.9 b 9 ± 0 a 11.9 ± 0.2 c 0.44 ± 0.01 a Spartan 184 ± 8 bc 39.6 ± 0.4 b 9 ± 0 a 14.2 ± 0.3 a 0.40 ± 0.02 ab Ambrosia 225 ± 10 a 56.0 ± 1.3 a 9 ± 0 a 12.8 ± 0.2 b 0.21 ± 0.01 c aWeight, firmness, starch and TSS are the means ± the standard error of the means from 10 apples.  bTA data is the mean ± the standard error of 12 apples or 4 replicates.  *Means followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.    101 5.3.2 Antagonism in commercial cold storage The biological control potential of P. fluorescens isolates, 1-112, 2-28 and 4-6, against M. piriformis was assessed on ‘Gala’, ‘McIntosh’, ‘Ambrosia’ and ‘Spartan’ apples after 15 weeks in commercial cold storage at 0°C and compared to commercial controls, BioSave® and Scholar® (Fig. 5.1; Table D.7, D.10, D.13 & D.16). After 15 weeks in cold storage, isolate 4-6 reduced the size of the Mucor rot lesion on ‘Gala’ apples by 83.6% in comparison to the control (Fig. 5.1A; Table D.7). On ‘McIntosh’ apples, the amount of Mucor rot observed was highly variable and none of the treatments tested provided significant levels of disease control against M. piriformis (Fig. 5.1B; Table D.10). The commercial fungicide Scholar® significantly reduced the size of the lesion caused by M. piriformis on ‘Ambrosia’ apples, while none of the biological control isolates, nor BioSave®, provided control (Fig. 5.1C; Table D.16). On ‘Spartan’ apples stored for 15 weeks, isolates 2-28 and 4-6 reduced the size of the Mucor rot lesion by 92.5 and 99.7%, respectively, in comparison to the control (Fig. 5.1D; Table D.13).   102  Figure 5.1 Mucor rot lesion diameter on A) ‘Gala’, B) ‘McIntosh’, C) ‘Ambrosia’, and D) ‘Spartan’ apples after 15 weeks in cold storage at 0°C. Apples were inoculated with the fungal pathogen, M. piriformis, and subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).  The ability of P. fluorescens isolates to reduce the incidence of Mucor rot was assessed on ‘Gala’, ‘McIntosh’, ‘Ambrosia’ and ‘Spartan’ apples after 15 weeks in commercial cold storage at 0°C and compared to commercial controls, BioSave® and Scholar® (Fig. 5.2; Table D.7, D.10, D.13 & D.16). None of the isolates of P. fluorescens was able to reduce the incidence of Mucor rot on ‘Gala’, ‘McIntosh’ and ‘Ambrosia’ apples Control  1-1122-28  4-6   Bio-Save®Scholar®  01020304050TreatmentLesion diameter (mm) a abbabaabControl  1-1122-28  4-6   Bio-Save®Scholar®  020406080TreatmentLesion diameter (mm)ababcbaabControl  1-1122-28  4-6   Bio-Save®Scholar®  010203040TreatmentLesion diameter (mm)aaaaaaControl  1-1122-28  4-6   Bio-Save®Scholar®  01020304050TreatmentLesion diameter (mm) abbbababA BC D  103 after 15 weeks of storage at 0°C (Fig. 5.2; Table D.7, D.10 & D.16). On ‘Spartan’ apples, isolates 2-28 and 4-6 reduced the incidence of Mucor rot by 92.7 and 96.3%, respectively, in comparison to the control (Fig. 5.2D; Table D.13). The commercially registered biofungicide, BioSave®, did not control M. piriformis on any of the apple varieties tested (Fig. 5.2; Table D.7, D.10, D.13 & D.16); while, the synthetic fungicide, Scholar®, significantly reduced the incidence of Mucor rot only on ‘Ambrosia’ apples (Fig. 5.2C; Table D.16).     104  Figure 5.2 Mucor rot disease incidence on A) ‘Gala’, B) ‘McIntosh’, C) ‘Ambrosia’, and D) ‘Spartan’ apples after 15 weeks in cold storage at 0°C. Apples were inoculated with the fungal pathogen, M. piriformis, and subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error. Different letters indicate significant differences according to Tukey’s test (P < 0.05).  5.3.3 Mechanisms of antagonism, in vitro  The effect of metabolites, in the form of CFS, produced by P. fluorescens isolates 1-112, 2-28 and 4-6 on the mycelial growth of M. piriformis was assessed on ¼ TSA/PDA amended with P. fluorescens CFS (Table 5.2). After 72 h of incubation, isolates 1-112 and 4-6 reduced the mycelial growth of M. piriformis by 18.1 and 25.7%, respectively, in Control  1-1122-28  4-6   Bio-Save®Scholar®  020406080TreatmentDisease incidence (%) ab abbabaabControl  1-1122-28  4-6   Bio-Save®Scholar®  020406080100TreatmentDisease incidence (%)b bbcabControl  1-1122-28  4-6   Bio-Save®Scholar®  020406080TreatmentDisease incidence (%)aaaaaaControl  1-1122-28  4-6   Bio-Save®Scholar®  0204060TreatmentDisease incidence (%) aababbbabA BC D  105 comparison to the control (Table 5.2).  Metabolites produced by isolate 2-28 did not show any inhibitory activity against M. piriformis mycelial growth in vitro.  The effect of volatiles produced by P. fluorescens on the mycelial growth of M. piriformis was assessed using the sealed plate method (Table 5.2). There was no physical contact between the antagonist and the pathogen; thus, inhibition could be attributed to the production of diffusible VOCs produced by P. fluorescens. After 72 h incubation, isolates 1-112, 2-28 and 4-6 reduced the mycelial growth of M. piriformis by 18.6, 42.7 and 33.1%, respectively, in comparison to the control (Table 5.2). Although the VOCs produced by all three isolates of P. fluorescens showed inhibitory activity against M. piriformis, the fungus completely recovered when transferred to fresh PDA plates. Table 5.2 Effect of cell-free supernatant (CFS) or volatile organic compounds (VOCs) produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the mycelial growth of M. piriformis after 72 h incubation at 20oC. Treatment Mycelial diameter (mm)   CFSa VOCsb Control 81.2 ± 0.7 ac 79.2 ± 0.6 a 1-112 66.5 ± 1.5 b  64.5 ± 3.1 b  2-28 78.3 ± 0.7 a 45.4 ± 3.3 c 4-6 60.3 ± 1.0 c 53.0 ± 1.0 c aP. fluorescens cell-free supernatant was amended with ¼ tryptic soy agar/potato dextrose agar to assess inhibitory activity against M. piriformis. bVolatiles produced by P. fluorescens were assessed for inhibitory activity against M. piriformis using the dual culture sealed plate method. cEach value is the mean ± standard error from three independent experiments or 9 replicates. Different letters within a column indicate significant differences according to Tukey’s test (P < 0.05).  The inhibitory activity of P. fluorescens isolates 1-112, 2-28 and 4-6 living cells or their metabolites (in the form of CFS) on spore germination of M. piriformis was assessed in FSAJ (Table 5.3). When spores were co-cultured with living cells of the antagonist, all three isolates of P. fluorescens inhibited spore germination by more than 99%.  Metabolites   106 produced by isolates 1-112, 2-28 and 4-6 inhibited M. piriformis spore germination by 67.5, 61.7 and 55.6%, respectively, in comparison to the control (Table 5.3).  Although both living cells of the antagonists and their metabolites inhibited M. piriformis spore germination in FSAJ, living cells exhibited inhibitory activity that was superior to that of the CFS. Table 5.3 Spore germination of M. piriformis incubated with P. fluorescens, isolates 1-112, 2-28, and 4-6, living cells or cell-free supernatant (CFS) in filter-sterilized apple juice at 20°C for 14 h. Treatment Spore germination (%)a Control 97.1 ± 0.9 a 1-112  0.0 ± 0.0 d 1-112 CFS 31.6 ± 2.3 c 2-28 0.2 ± 0.2 d 2-28 CFS 37.2 ± 2.7 bc 4-6 0.0 ± 0.0 d 4-6 CFS 43.2 ± 2.6 b aEach value is the mean of six replicates from two independent experiments ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).  5.3.4 Bacterial-fungal interaction  The interaction of P. fluorescens isolates 1-112, 2-28, and 4-6 with M. piriformis on ¼ TSA/PDA was examined with SEM after 5 d incubation (Fig. 5.3). All three isolates heavily colonized the hyphae of M. piriformis, but only isolate 1-112 was observed to colonize the spores of the fungus (Fig. 5.3B). Isolate 1-112 appeared to prefer to colonize the younger terminal region of the hyphae over the older hyphae (Fig. 5.3A).    107   Figure 5.3 Scanning electron micrographs of antagonistic P. fluorescens (p) isolates 1-112 (A & B), 2-28 (C), and 4-6 (D) interacting with M. piriformis hyphae (h) and spores (s) on ¼ tryptic soy agar/potato dextrose agar after 5 d incubation at 20°C.   The interaction of P. fluorescens isolates 1-112, 2-28, and 4-6 with M. piriformis in apple wounds was examined with SEM after 7 d incubation (Fig. 5.4). In the control fruit, an abundance of hyphae and large sporangia was observed (Fig. 5.4A & B). In the presence of   108 the pathogen, all three isolates of P. fluorescens successfully colonized the apple tissue and to a lesser extent, the hyphae of the fungus. In the wounds of apple, P. fluorescens isolates 1-112, 2-28, and 4-6 were surrounded with an extracellular matrix (Fig 5.4D-H). In comparison to the control, the density of hyphae was less in wounds treated with the bacterial antagonists (Fig. 5.4).         109       Figure 5.4 Scanning electron micrographs of healthy M. piriformis hyphae (h) and sporangia (sp) (A & B) and M. piriformis hyphae and spores (s) interacting with P. fluorescens (p) isolates 1-112 (C & D), 2-28 (E & F) and 4-6 (G & H) in apple wounds after 7 d incubation at 20°C. Note the extracellular matrix (e) produced by P. fluorescens.  5.4 Discussion  This study indicates that P. fluorescens isolates 1-112, 2-28, and 4-6 have some level of antagonistic biological control efficacy against M. piriformis, the causal agent of Mucor   110 rot. The biological control activity of the three isolates varied with apple variety, but isolate 4-6 was the most effective at reducing decay in commercial cold storage. On ‘Gala’ apples, only isolate 4-6 reduced the size of the Mucor rot lesion in comparison to the control. On ‘Spartan’ apples isolates 2-28 and 4-6 reduced the incidence of Mucor rot as well as the size of the lesion. No control was observed against Mucor rot on ‘McIntosh’ apples, while only Scholar® reduced decay on ‘Ambrosia’ apples. This is in contrast to our work with B. cinerea, where all three isolates reduced the size of the lesion and incidence of grey mold on ‘Ambrosia’ apples (Chapter 4; Wallace et al., 2018). In general, BioSave® and Scholar® were ineffective at controlling M. piriformis on apples in commercial cold storage. In pears, C. laurentii, C. albidus, and Cryptococcus flavus reduced the incidence of Mucor rot (Roberts, 1990). Chand-Goyal and Spotts (1996) reported that C. laurentii, Cryptococcus infirmo-miniatus, and R. glutinis alone or in combination with a low dose of thiabendazole reduced the incidence and severity of Mucor rot on d’Anjou pear. To my knowledge, this is the first report investigating the efficacy of a bacterial BCA to control Mucor rot on apples.  With respect to the physiological quality parameters of the fruit, ‘Gala’ and ‘Spartan’ apples had higher TSS. The higher TSS in ‘Gala’ and ‘Spartan’ could be related to a higher level of antagonism, because one of the main mechanisms of action utilized by microbial antagonists is competition for nutrients such as sugars (Spadaro et al., 2010). Information on the most important postharvest pathogens and the relative susceptibility of different apple cultivars to diseases is presently lacking (Konstantinou et al., 2011). Resistance of apple tissue to fungal decay is affected by several biochemical parameters, which may also influence the efficacy of BCAs on the fruit. Konstantinou et al. (2011) investigated the susceptibility of four apple cultivars to common postharvest pathogens and reported that   111 phenolic content, flavonoid content, and antioxidant activity were negatively correlated with grey mold decay. However, the range of cultivars assessed was different than mine and, consequently, a direct comparison of the results of these two studies is not possible. A more comprehensive understanding of the biochemical parameters of the major apple cultivars and the fungal species predominating in a given apple growing region may aid the apple industry in reducing the incidence of postharvest decay, while improving the efficacy of BCAs. The limited control of M. piriformis exhibited by our three isolates of P. fluorescens, as well as BioSave® and Scholar®, highlight the need for continued research into alternative strategies to control Mucor rot on pome fruit.   To understand the antagonistic mechanisms utilized by P. fluorescens to control postharvest disease of apples, I investigated the effects of living cells of P. fluorescens or their metabolites, in the form of CFS or VOCs, on spore germination and mycelial growth of M. piriformis in vitro. In an earlier study (Wallace et al., 2016), we showed that living cells of isolates 1-112, 2-28, and 4-6 inhibited M. piriformis mycelial growth by 58.4, 60.6, and 55.4%, respectively, in vitro. In the present work, VOCs produced by isolates 1-112, 2-28, and 4-6 inhibited mycelial growth of the pathogen by 18.6, 42.7, and 33.1%, respectively. Although all three isolates of P. fluorescens produced volatile compounds with inhibitory activity against M. piriformis mycelium in vitro, the fungus completely recovered when transferred to fresh PDA. This suggests that the antagonism provide by the VOCs is only fungistatic. Zhou et al. (2014a) reported that P. fluorescens ALEB 7B produced volatiles with fungicidal activity and dimethyl disulphide (DMDS) played a major role. Similarly, Hernández- León et al. (2015) showed that several Pseudomonas biological control strains produced an abundance of sulfur-containing volatiles with antifungal activity, including   112 DMDS. Presently, it is unknown if sulfur containing compounds produced by my three isolates of P. fluorescens are responsible for the antagonism observed in vitro. To my knowledge, the effect of VOCs produced by P. fluorescens has not been investigated against M. piriformis. In this study, CFS of all three isolates inhibited spore germination in FSAJ, while only CFS of isolate 1-112 and 4-6 inhibited mycelial growth of M. piriformis. On average metabolites (CFS) produced by the antagonists inhibited spore germination by 61.6%, while living cells of P. fluorescens inhibited spore germination by more than 99%. These results suggest living cells are not required for inhibition of M. piriformis, but they do provide significantly greater inhibition than the CFS. Similar to Janisiewicz et al. (2000), we chose sterile apple juice or FSAJ as our culture medium, as the substrate closely resembles that found under natural conditions. My findings suggest that limiting mycelial growth and spore germination directly, by living cells of P. fluorescens, or indirectly, by the production of toxic metabolites or VOCs, may be mechanisms of antagonism utilized by P. fluorescens in the control of M. piriformis. Future studies examining the composition and identity of the metabolites produced by P. fluorescens could prove useful in enhancing the biological control activity of this bacterium against Mucor rot on apple.  The direct physical attachment of microbial antagonists has been suggested as a possible mechanism of antagonism. Chen et al. (2016) found that B. amyloliquefaciens inhibited mycelial growth and altered the morphology of the fungal pathogen Botrytis dothidea. In this study, I used SEM to examine the interaction of P. fluorescens isolates 1-112, 2-28 and 4-6 with M. piriformis in vitro and in the wounds of apple. Scanning electron microscopy confirmed the considerable ability of all three isolates to colonize the hyphae of M. piriformis in vitro and to a lesser extent in the wounds of apples. Although my three   113 isolates of P. fluorescens colonized the hyphae of the pathogen, they did not parasitize them which has been documented with other BCAs (Wisniewski et al., 1991; Chan and Tian, 2005; Hashem et al., 2014). These findings support our previous work where we reported the inability of P. fluorescens to produce lytic enzymes such as glucanase, chitinase and cellulase (section 3.3.4; Wallace et al., 2017), as no significant physical degradation of M. piriformis hyphae was observed in vitro or in vivo.  To my knowledge, this work represents the first examination of the physical interaction between the microbial antagonist, P. fluorescens and the postharvest pathogen, M. piriformis in vitro and in apple wounds. In the wounds of apple, an extracellular matrix surrounded P. fluorescens and accumulated around the hyphae of M. piriformis. Biofilm formation by the yeast antagonist Leucosporidium scottii has been suggested as a potential mechanism of biological control utilized by this antagonist against blue mold and grey mold of apple (Vero et al., 2013). The ability of P. fluorescens to form a biofilm (section 4.3.4; Wallace et al., 2018), creating a mechanical barrier between the pathogen and the nutrient rich wound site, may be another mechanism contributing to its biological control capabilities in vivo.  The colonization of the fungal hyphae and wound site by P. fluorescens may inhibit M. piriformis mycelial growth and conidial germination by restricting access of the pathogen to essential nutrients. Preliminary work by Hynes et al. (2008) characterizing P. fluorescens isolates 1-112, 2-28 and 4-6 confirmed their ability to produce siderophores, extracellular low-molecular weight iron (III) transport agents. Fruit wounds are nutrient rich, but microelements critical for fungal development such as iron are limited (Di Francesco et al., 2016). Numerous reports have shown the significance of siderophores produced by   114 fluorescent Pseudomonas spp. in biological control of plant pathogens (Loper, 1988; Thomashow and Weller, 1990; Cabrefiga et al., 2007; Di Francesco et al., 2016). The ability of our P. fluorescens isolates to chelate iron, making it less available to the competing fungal pathogen, may contribute to their biological control capabilities.  The results obtained in this study have demonstrated that P. fluorescens isolates 2-28 and 4-6 were able to inhibit Mucor rot on ‘Spartan’ apples after 15 weeks of cold storage. On ‘Gala’ apples, isolate 4-6 reduced the size of the Mucor rot lesion, but not the incidence of the rot. Our work with the fungal pathogens B. cinerea and P. expansum showed P. fluorescens was highly effective at controlling grey mold (Chapter 4; Wallace et al., 2018) and blue mold (Chapter 3; Wallace et al., 2017) decay of apples, respectively, but only limited control was observed against Mucor rot in the present study. In vitro, all three isolates were highly effective at inhibiting M. piriformis. Potential mechanisms of action of P. fluorescens isolates 1-112, 2-28, and 4-6 may include competition for nutrients and space, production of inhibitory metabolites and biofilm formation that target spore germination and mycelial growth. A better understanding of the mechanisms of antagonism utilized by P. fluorescens in vitro could aid in enhancing their efficacy in controlling Mucor rot on apples during commercial storage. Further studies are warranted to enhance the activity of P. fluorescens so that it is effective against multiple postharvest fungal pathogens on several apple varieties in order to be considered for development into a commercial product.  115 Chapter 6: Control of Postharvest Apple Decay with Bacterial Antagonists in Combination with Low-Doses of Chemicals and Controlled Atmosphere Storage  6.1 Background Millions of dollars are lost annually to postharvest diseases of fruits and vegetables (Janisiewicz and Korsten, 2002), resulting in total yield losses from 5 to 25% (Stockwell and Stack, 2007). Postharvest disease can be a limiting factor for the long-term storage of many varieties of apples. Three major postharvest fungal pathogens, B. cinerea, M. piriformis, and P. expansum, commonly infect and rot apples in storage in British Columbia, Canada.  On pome fruit, B. cinerea, M. piriformis and P. expansum are the causal agents of grey mold, Mucor rot and blue mold, respectively. Chemical fungicides such as Mertect® (thiabendazole) and Scholar® (fludioxonil) have been applied to tree fruits to reduce postharvest loss, however, pathogen resistance is emerging. Public pressure to reduce fungicide use and the demand for produce free of synthetic fungicides, has led to research for safer alternatives such as BCAs (Janisiewicz and Korsten, 2002). Biological control of postharvest decay has made significant advances over the past three decades with 9 microbial antagonists being developed into commercial products (Wisniewski et al., 2016). The commercial product BioSave® 10LP (Jet Harvest Solutions, Longwood, FL) containing saprophytic P. syringae ESC-10 (Janisiewicz and Jeffers, 1997) was registered for use in Canada in 2011 by the Pest Management Regulatory Agency (PMRA). The use of BioSave® throughout North America has been continually increasing (Janisiewicz et al., 2008). In the United States, BioSave® was initially only registered for postharvest application on apples,   116 pears and citrus fruit, but registration has been extended to use on cherries (Buckner, 2005), potatoes (Holmes and Edmunds, 2005), and sweet potatoes (Stockwell and Stack 2007). Initially it was suggested that control of postharvest decay by microbial antagonists was greater than their potential to control preharvest diseases in the field (Janisiewicz and Korsten, 2002). The basis for this theory was the fact that the postharvest environment, with its controlled temperature, humidity and atmospheric content, was more conducive to supporting BCAs; however, this has not been the case (Droby et al., 2016; Wisniewski et al., 2016). Yeast BCAs have been shown to be very effective in reducing fruit decays, but their effectiveness may decline under suboptimal conditions (Janisiewicz et al., 2008). For example, preharvest treatments of fungicides or salts used for flotation in packing may weaken the antagonist and reduce its survival, resulting in less disease control (Janisiewicz et al., 2001). In general, BCAs have a narrow spectrum of activity, have shown inconsistent performance under commercial conditions and are generally less effective than the chemical fungicides presently on the market (Droby et al., 2016; Wisniewski et al., 2016). As a result, further research is needed to enhance the efficacy of BCAs, so they can provide control comparable to or superior to the commercially available fungicides.  One approach to enhance the efficacy of BCAs that has shown promise is the application of BCAs in combination with GRAS compounds such as CaCl2 and SBC. In the fresh produce industry, CaCl2 is a widely used preservative and firming agent (Martín-Diana et al., 2007). Many researchers have shown that calcium plays an important role in control of postharvest disease of fruits (Conway et al., 1992) and can enhance the efficacy of some BCAs (Wisniewski et al., 1995). Yu et al. (2012) reported that treating pears with C. laurentii in combination with CaCl2 provided greater control of grey mold and blue mold in   117 comparison to either treatment alone. Not only has calcium been shown to enhance the activity of BCAs, but it may also allow reduced amounts of both products to be applied without compromising decay control (Janisiewicz et al., 1998). Sodium bicarbonate is a commonly used food additive that is readily available, inexpensive and has little risk of phytotoxicity when applied at low concentrations (1-4%) (Palou et al., 2001). This additive has been used to reduce postharvest decay of fruit. The combination of two yeast antagonists, M. pulcherrima and C. laurentii, with SBC completely eliminated P. expansum on ‘Golden Delicious’ apples in CA storage (Conway et al., 2007). Similarly, SBC applied in combination with the commercial product AspireTM (Ecogen, Inc. Langhorne, PA), containing C. oleophila, resulted in superior control of postharvest fungal pathogens compared with either treatment alone (Droby et al., 2003). Another approach to enhancing the level of control provided by BCAs is applying them in combination with natural inducers of resistance such as SA. The role of SA in local plant defenses and in systemic acquired resistance, as a signal molecule, has been well documented (Yu and Zheng, 2006). In the absence of the pathogen, exogenous application of SA has been shown to activate resistance in plants (Durrant and Dong, 2004). Terry and Joyce (2004) showed that SA not only plays a role in induction of disease resistance but also has direct antimicrobial activity in the postharvest system of fruits. Combined treatment of the biological control yeast C. laurentii with SA resulted in improved control of P. expansum and B. cinerea infections in pear fruit (Yu et al., 2007). In citrus fruit, SA enhanced the control efficacy of Pichia membranaefaciens to blue and green mold (Zhou et al., 2014b).  Controlled atmosphere storage, where O2 levels are decreased to 1-4% and CO2 levels are increased to 2-5%, has been found to be effective in delaying the onset of storage   118 disorders (Smock, 1979). Although CA storage has been shown to significantly reduce physiological disorders such as softening, bitter pit, and internal breakdown, its effects on decay development are variable (Conway et al., 2007). While many studies have investigated the ability of microbial antagonists to control postharvest decay in cold storage, very few studies have looked at the ability of BCAs to inhibit disease in commercial CA storage. In semi-commercial trials, P. agglomerans provided control of blue mold and grey mold on ‘Golden Delicious’ apples in low O2 storage comparable to the fungicide imazalil (Nunes et al., 2002). The objectives of this chapter were to: (i) investigate the potential of three isolates of P. fluorescens, 1-112, 2-28 and 4-6, alone or in combination with CaCl2, SBC or SA to inhibit mycelial growth of B. cinerea, M. piriformis, and P. expansum in vitro; (ii) evaluate the potential of P. fluorescens isolate 4-6 alone or in combination with CaCl2, SBC or SA to control grey mold, Mucor rot and blue mold on ‘McIntosh’ and ‘Ambrosia’ apples during commercial cold storage at 0°C and compare them to commercial controls, Scholar® and BioSave® and (ii) assess the ability of three isolates of P. fluorescens, 1-112, 2-28 and 4-6, to control grey mold, Mucor rot and blue mold on ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ apples during commercial CA storage at 0°C and compare them to commercial controls. 6.2 Materials and Methods 6.2.1 Antagonists  The bacterial isolates, P. fluorescens 1-112, 2-28, and 4-6, were isolated from the rhizosphere of pulse crops in Saskatchewan, Canada (Hynes et al., 2008). Bacteria were maintained as described in section 3.2.1. For experiments, bacteria were transferred from   119 TSA to half strength TSB and incubated at 20°C for 30 h on a rotary shaker set at 185 rpm. A spectrophotometer was used to measure the OD of the cultures at 600 nm. Cell concentrations were determined using standard calibration curves (Appendix B) and cultures were diluted in sterile distilled water to the desired concentration for each experiment. 6.2.2 Pathogens B. cinerea Pers.:Fr strain 27, M. piriformis Fischer strain 563 and P. expansum Link strain 1790 were obtained from Dr. P. Sholberg, Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland, BC and maintained as described in section 3.2.2. The spore concentration of each pathogen was counted with a Petroff-Hauser counting chamber. Pathogen inoculum was prepared by diluting the spore suspensions in sterile distilled water in order to obtain the desired concentration.  6.2.3 Fruit Apple (Malus domestica Borkh.) fruit of cv. ‘Gala’, ‘McIntosh’, ‘Spartan’, and ‘Ambrosia’ were harvested in orchards in the Okanagan Valley, British Columbia, Canada in 2014, 2015 and 2016 and kindly provided by the BCTFC for this study. Fruit were selected and prepared for the experiments as described in section 3.2.3.  6.2.4 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA in vitro To assess the effect of P. fluorescens alone or in combination with various chemicals on the mycelial growth of B. cinerea, M. piriformis and P. expansum, dual culture inhibition assays were performed. Agar plugs (6 mm in diameter) containing mycelia from the 1-week-old cultures of B. cinerea or M. piriformis were placed in the center of petri dishes containing ¼ TSA/PDA (Appendix A) medium amended with no chemicals (NC) or amended with   120 CaCl2 (Sigma, 5.0 g / L), SBC (Fisher, 1.0 g / L), or SA (Sigma, 0.1 g / L). The antagonist, P. fluorescens isolates 1-112, 2-28 or 4-6, was then streaked 2 cm away on either side of the fungal plug. P. expansum inhibition assays were performed as stated in section 3.2.5 using the culture media described above. Cultures were incubated at 25°C until the pathogen covered the positive control plates, containing only the fungi. Once the control plates were covered, the mycelial diameter of B. cinerea and M. piriformis, or the inhibition zone of P. expansum, was measured. Each treatment contained five replicates and the experiment was performed twice. 6.2.5 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA on apples in cold storage  The fruit were wounded (section 3.2.4) and then inoculated by submersing the bag of apples into a solution of CaCl2 (1.0 % w/v), SBC (0.5 % w/v) or SA (0.01 % w/v) for one minute. Treated apples sat for 1 min, followed by drenching for one minute in 1 x 108 CFU mL-1 of P. fluorescens 4-6, allowed to sit for one min, followed by drenching for one minute in 1 x 104 spores mL-1 of B. cinerea, M. piriformis, or P. expansum. Some fruit were treated, by drenching in CaCl2, SBC or SA and successive inoculation with the antagonist, P. fluorescens isolate 4-6, prior to inoculation with spores of the pathogen. Other fruit were exposed to one single treatment, by drenching with P. fluorescens isolate 4-6, CaCl2, SBC, SA, BioSave® (Jet Harvest Solutions, Longwood, Florida, USA) or Scholar® 50 WG (a.i. fludioxonil, Syngenta, Guelph, Ontario, Canada), prior to inoculation with spores of the pathogen. Positive controls consisted of apples treated only with spores of the pathogen. Negative control consisted of apples treated with P. fluorescens isolate 4-6, CaCl2, SBC, or SA alone, or the bacteria in combination with one of the chemicals. The lesion diameters and   121 disease incidence were determined after 15 weeks in 0°C commercial cold storage at the BCTFC in Winfield, BC, Canada. Each treatment contained three replicates of 10 fruit each and each experiment was performed twice. Independent experiments were conducted in 2015-16 and 2016-17 on ‘McIntosh’ and ‘Ambrosia’ apples, but only results from the ‘Ambrosia’ apple trials with B. cinerea that were conducted in 2015-16 and M. piriformis and P. expansum trials that were conducted in 2016-17 are presented in this chapter. 6.2.6 Biological control activity of P. fluorescens on apples in CA storage After ‘Gala’, ‘McIntosh’, ‘Spartan’ and ‘Ambrosia’ apples were disinfected (section 3.2.3) and wounded (section 3.2.4) they were inoculated with the antagonist, P. fluorescens isolate 1-112, 2-28, or 4-6, or BioSave® or Scholar® 50 WG and the pathogen, B. cinerea, M. piriformis, or P. expansum, as described in section 3.2.4. Positive controls consisted of apples treated with spores of the pathogen only. The lesion diameters and disease incidence were determined after 10-15 weeks of incubation in 0°C commercial CA storage (1.5% CO2 and 1.2% O2) at the BCTFC in Winfield, BC, Canada. Each treatment contained three replicates of 10 fruit each. In this chapter I am presenting only the results on ‘Ambrosia’ apples from storage trials with B. cinerea and M. piriformis that were conducted in 2014-15 and from storage trials with P. expansum that were conducted in 2015-16. 6.2.7 Data analysis All statistical analyses were performed with SPSS version 20.0 (SPSS Inc., Chicago, IL, USA). To test the effect of the treatment, the data were analyzed using the GLM ANOVA procedures. Mean separation was performed using Tukey’s test. Differences at P < 0.05 were considered significant. Disease incidence data were subjected to arcsine-square root transformations. All experiments, except the in vivo CA trials with B. cinerea and M.   122 piriformis, were performed at least twice and when the treatment means were similar the data were pooled and analyzed together as described in section 3.2.10. 6.3 Results 6.3.1 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA on apples in vitro   In vitro, all three isolates of P. fluorescens inhibited the mycelial growth of B. cinerea by more than 60%, on average, when cultured on ¼ TSA/PDA not amended with any chemicals, in comparison to the NC control treatment (Fig. 6.1). When the culture medium was supplemented with CaCl2 or SBC, isolates 1-112, 2-28 and 4-6 provided comparable levels of inhibition of B. cinerea. When the fungus (control) was grown on medium containing 0.1% (1.0 g / L) SBC the mean mycelial diameter was 37.2 mm, while in the absence of SBC, the mean mycelial diameter of the fungus (NC control) was 71.7 mm. When the concentration of SBC was increased (5.0 g / L), growth of B. cinerea was completely inhibited (data not shown). The combination of isolates 1-112 and 4-6 with SA provided greater inhibition of B. cinerea than isolate 2-28 plus SA. When the concentration of SA was increased (1.0 g / L) the growth of the antagonist in vitro was inhibited (data not shown). In comparison to the NC control, the mycelial growth of the fungus was inhibited by 16.5% on the SA control (antagonist absent). Both chemical additives, SBC and SA alone provided direct inhibition of B. cinerea in vitro in comparison to the NC control.    123  Figure 6.1 Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on the mycelial growth of B. cinerea on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean ± standard error from two independent experiments. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).   All three isolates of P. fluorescens alone or in combination with SBC, CaCl2 or SA, inhibited M. piriformis in vitro (Fig. 6.2). Isolate 2-28 alone provided greater inhibition of the pathogen than isolate 1-112 or 4-6 alone. On average, all three isolates inhibited the growth of M. piriformis by more than 53 % when combined with CaCl2. When the isolates were combined with SBC, isolate 2-28 had the greatest inhibitory activity. The growth of M. piriformis was completely inhibited when the concentration of SBC was increased (5.0 g / L) (data not shown). When combined with SA, the antagonistic activity of isolate 1-112 was enhanced in comparison to treatment with isolate 1-112 alone. The biological control activity of isolates 2-28 and 4-6 was not enhanced when they were combined with any of the NCCaCl 2 SBC SA020406080100TreatmentMycelial diameter (mm) Control1-1122-284-6   adef fgbcafgdef efgfg fg gcde cdefg fg  124 chemicals tested. In vitro, SBC and SA alone provided direct inhibition of M. piriformis in comparison to the NC control.  Figure 6.2 Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on mycelial growth of M. piriformis on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean of three replicates ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).   All three isolates alone or in combination with one of the chemicals provided inhibition of P. expansum in vitro (Fig. 6.3). Isolate 1-112 alone provided greater inhibition of P. expansum than isolates 2-28 and 4-6 alone. None of the chemical additives tested enhanced the biological control activity of P. fluorescens against P. expansum. Isolates 1-112 and 4-6 in combination with CaCl2 provided superior levels of control in comparison to isolate 2-28 in combination with CaCl2. When combined with the additive SBC, all three isolates provided comparable levels of control of P. expansum. When the concentration of NCCaCl 2 SBC SA020406080100TreatmentMycelial diameter (mm) Control1-1122-284-6 adecbagde degd defg de dede ef  125 SBC was increased (5.0 g / L), growth of P. expansum was completely inhibited (data not shown). Isolates 1-112 and 4-6 in combination with SA provided superior levels of control in comparison to isolate 2-28 in combination with SA. In general, isolates 1-112 and 4-6 showed the strongest inhibitory activity against P. expansum in vitro.   Figure 6.3 Inhibitory effect of P. fluorescens isolates 1-112, 2-28 and 4-6 on mycelial growth of P. expansum on ¼ tryptic soy agar/potato dextrose agar amended with no chemicals (NC) or amended with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) after 72 h incubation at 25°C. Data represent the mean of three replicates ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).  6.3.2 Biological control activity of P. fluorescens alone or in combination with CaCl2, SBC, and SA on apples in cold storage   All treatments tested, except BioSave®, significantly reduced the size of the lesion caused by B. cinerea on ‘Ambrosia’ apples, in comparison to the control (Table 6.1; Table NCCaCl 2 SBC SA0246810TreatmentZone of inhibition (mm) 1-1122-284-6 abcdeaabcd abcabcdabbcdcde debcd  126 D.19). The combination of the bacteria with the chemical additives did not enhance the biological control activity of the antagonist against grey mold. Of the treatments of P. fluorescens tested, only isolate 4-6 in combination with SBC significantly reduced Mucor rot decay to a level comparable to BioSave® and Scholar®. Treatment with CaCl2 and SBC alone also significantly reduced the size of the Mucor rot lesion. Of the bacterial antagonist treatments tested, only treatment with isolate 4-6 in combination with SBC provided levels of decay control comparable to BioSave® and Scholar®. The biological control activity of isolate 4-6 against P. expansum was not enhanced when the antagonist was combined with SBC, SA or CaCl2, in comparison to the antagonist alone. Results from the 2015-16 trials with M. piriformis and P. expansum on ‘Ambrosia’ apples (Table D.19) were excluded from this chapter due to the lower incidence of disease observed in the control fruit in comparison to the 2016-17 storage trial results (Table 6.1; Table D.20). In 2016-17, positive control fruit for the B. cinerea storage trials were not wounded, thus no disease developed (Table D.20).              127 Table 6.1 Effect of P. fluorescens isolate 4-6 alone or in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) in comparison to the registered biological control agent, BioSave® and fungicide, Scholar® on the control of B. cinerea, M. piriformis and P. expansum in 'Ambrosia' apples.      Lesion diameter (mm) after 15 weeks in cold storage at 0°C Treatment B. cinereaa M. piriformisb P. expansumb Control 42.7 ac 78.9 ab 27.4 a  4-6  1.1 b 80.9 a 11.6 bcd  4-6 + CaCl2 0.5 b 72.2 abc 10.5 bcd  4-6 + SBC 0.0 b 44.3 d 4.2 de  4-6 + SA 2.2 b 80.3 a 8.0 cd CaCl2 2.2 b 50.1 cd 4.8 cde SBC 0.0 b 52.1 cd 13.9 abc SA 5.5 b 86.0 a 22.1 ab BioSave® 37.6 a 57.6 bcd 8.3 cd Scholar® 0.3 b 38.3 d 0.2 e aB. cinerea results are from a single storage trial conducted in 2015-16. bM. piriformis and P. expansum results are from a single storage trial conducted in 2016-17. cEach value represents the mean of three replicates (n=3) of 10 apples each from a single experiment. Different letters within a column indicate significant differences according to Tukey’s test (P < 0.05).  There was a significant reduction in the disease incidence of B. cinerea on ‘Ambrosia’ apples by all treatments tested, except BioSave® (Table 6.2; Table D.19). The biological control activity of isolate 4-6 was not enhanced by combining it with CaCl2, SBC or SA. The greatest reduction in the incidence of M. piriformis on ‘Ambrosia’ apples was provided by isolate 4-6 in combination with SBC and Scholar®. Of the chemical treatments alone, only SBC significantly reduced the incidence of Mucor rot. The best control of blue mold decay was achieved with the fungicide Scholar® and isolate 4-6 in combination with SBC. Only isolate 4-6 in combination with SBC was able to reduce the incidence of P. expansum to a level that was comparable to Scholar®.  The effect of isolate 4-6 alone or in combination with CaCl2, SBC or SA on the control of B. cinerea, M. piriformis and P. expansum on ‘McIntosh’ apples in the 2015-16   128 storage trials (Table D.21) and the 2016-17 storage trials (Table D.22) have been excluded, so a single apple variety (‘Ambrosia’) could be assessed in this chapter. Table 6.2 Effect of P. fluorescens isolate 4-6 alone or in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) in comparison to the registered biological control agent, BioSave® and fungicide, Scholar® on the control of B. cinerea, M. piriformis and P. expansum in 'Ambrosia' apples.      Disease incidence after 15 weeks in cold storage at 0°C Treatment B. cinereaa M. piriformisb P. expansumb Control 70.0 ac 86.7 abc 65.0 a  4-6  1.7 b 86.7 abc 33.3 bc  4-6 + CaCl2 3.3 b 81.7 bcd 31.7 bc  4-6 + SBC 0.0 b 51.7 e 15.0 cd  4-6 + SA 3.3 b 88.3 abc 31.7 bc CaCl2 3.3 b 63.3 cde 16.7 c SBC 0.0 b 60.0 de 41.7 abc SA 10.0 b 96.7 ab 53.3 ab BioSave® 76.7 a 96.7 a 66.7 a Scholar® 5.0 b 41.7 e 1.7 d aB. cinerea results are from a single storage trial conducted in 2015-16. bM. piriformis and P. expansum results are from a single storage trial conducted in 2016-17. cEach value represents the mean of three replicates (n=3) of 10 apples each from a single experiment. Different letters within a column indicate significant differences according to Tukey’s test (P < 0.05).  6.3.3 Biological control activity of P. fluorescens on apples in CA storage  Results of ‘Gala’ (Table 23-25), ‘McIntosh’ (Table D.26-28) and ‘Spartan’ (Table D.29-31) apples stored in CA have been excluded, so a single apple variety (‘Ambrosia’) could be assessed in this chapter. After 15 weeks in commercial CA storage, all treatments tested reduced the size of the lesion and incidence of grey mold on ‘Ambrosia’ apples in comparison to the control (Fig. 6.4; Table D.32). On average, the three isolates of P. fluorescens reduced the size of the grey mold lesion by 38.9%, in comparison to the control (Fig. 6.4A; Table D.32). Although the best control of B. cinerea was achieved with Scholar®, P. fluorescens isolates 1-112, 2-28 and 4-6 provided levels of decay control that were   129 comparable to the commercial product, BioSave®. All three isolates of the antagonist provided comparable levels of control of grey mold in CA storage.  Figure 6.4 Grey mold A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 15 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with B. cinerea were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).   The only treatment tested that significantly reduced the size of the lesion and incidence of Mucor rot on ‘Ambrosia’ apples after 15 weeks on commercial CA storage was Scholar® (Fig. 6.5; Table D.32). None of the biological treatments tested was effective at inhibiting the growth of M. piriformis on apples.  Control1-112 2-284-6 Bio-Save®Scholar®020406080Lesion diameter (mm) ab bbbcControl1-112 2-284-6 Bio-Save®Scholar®020406080100Disease incidence (%)ab bbbcA BTreatment  130  Figure 6.5 Mucor rot A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 15 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with M. piriformis were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2014-15 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).   After 10 weeks of commercial CA storage, all the treatments tested significantly reduced the size of the blue mold lesion on ‘Ambrosia’ apples. Isolates 1-112, 2-28 and 4-6 reduced the size of the decay lesion by 64.4, 53.9 and 74.9%, respectively (Fig. 6.6A; Table D.33). Of the isolates of P. fluorescens tested, isolates 1-112 and 4-6 were the most effective at reducing the incidence of blue mold and were both comparable to BioSave®. The best control of blue mold on ‘Ambrosia’ apples in CA storage was provided by Scholar®. Results from the commercial storage trials performed in 2014-15 (Table D.32) and 2016-17 (Table D.34) on ‘Ambrosia’ apples have been excluded from this chapter due to the low incidence of blue mold in the control fruit. Control1-112 2-284-6 Bio-Save®Scholar®0102030405060Lesion diameter (mm)abbcabaabcControl1-112 2-284-6 Bio-Save®Scholar®020406080Disease incidence (%)aaba abaTreatmentA B  131  Figure 6.6 Blue mold A) lesion diameter and B) disease incidence of ‘Ambrosia’ apples after 10 weeks in commercial controlled atmosphere storage at 0°C. Apples treated with P. expansum were also subjected to treatment with each isolate of P. fluorescens, 1-112, 2-28 or 4-6, or BioSave® or Scholar®. Control apples were treated with the pathogen only. Each bar represents the mean of three replicates (n=3) of 10 apples each ± standard error from a single experiment (2015-16 storage trials). Different letters indicate significant differences according to Tukey’s test (P < 0.05).  6.4 Discussion  Based on previous in vivo trials in commercial cold storage (Chapter 3-5; Wallace et al., 2016; Wallace et al., 2017; Wallace et al., 2018), here I examined the effect of CaCl2, SBC and SA on postharvest pathogens, B. cinerea, M. piriformis, and P. expansum, to determine if they enhanced the efficacy of P. fluorescens isolate 4-6 on apples. Preliminary studies in vitro showed that all three isolates of P. fluorescens, 1-112, 2-28 and 4-6, alone or in combination with CaCl2, SBC and SA inhibited the mycelial growth of B. cinerea, M. piriformis and P. expansum.  Since alternatives, such as BCAs, to fungicides generally do not possess a broad spectrum of activity and are less effective than chemical treatments, I investigated the combination of P. fluorescens with GRAS compounds, CaCl2 and SBC on ‘McIntosh’ Control1-112 2-284-6 Bio-Save®Scholar®051015202530Lesion diameter (mm)abcbbccddControl1-112 2-284-6 Bio-Save®Scholar®020406080100Disease incidence (%)abcabc cdA BTreatment  132 (Appendix D) and ‘Ambrosia’ apples in commercial cold storage. Preharvest treatment with calcium is a routine practice in orchards that are prone to calcium-related disorders such as bitter pit (Biggs, 1999). Increased calcium content has also been shown to be effective at prolonging the storage life of produce, possibly by ameliorating physiological disorders (Conway, 1982). Consequently, calcium may indirectly reduce the activity of postharvest pathogens on fruits and vegetables in storage (Conway et al., 1992). Fan and Tian (2001) reported that CaCl2 enhanced the biological control activity of C. albidus against B. cinerea and P. expansum on apples. P. syringae in combination with heat treatment and calcium has also been shown to significantly reduce the incidence of blue mold on ‘Gala’ apples (Conway et al., 1999). More recently, Tian et al. (2002a) reported that combining CaCl2 with yeast significantly enhanced the biological control activity of Candida guilliermondii on peaches and P. membranefaciens on nectarines. In contrast to previous reports, in this study combining CaCl2 with P. fluorescens isolate 4-6 did not enhance the biological control activity of the bacteria in vitro or on ‘Ambrosia’ apples. Although Janisiewicz et al. (1998) reported that combining the bacterial antagonist P. syringae with CaCl2 resulted in enhanced decay control, these findings are not directly comparable to ours as they used a higher concentration of calcium (4%) and used pressure infiltration to apply the chemical. Future studies should investigate if calcium infiltration is a more effective method than calcium drenching to apply this GRAS compound and reduce postharvest decay on apples. Sodium bicarbonate is inexpensive, readily available and can be applied to fruit with minimal risk of injury. In previous work, a combination of SBC with the biological control product, AspireTM, which contains the yeast C. oleophila, resulted in superior control of grey mold and blue mold, compared with either treatment alone (Droby et al., 2003). Control of green   133 mold of oranges by P. syringae strain ESC-10 has also been improved when its application followed fruit treatments in heated solutions of SBC (Smilanick et al., 1999). More recently, the combination of two yeast antagonists, M. pulcherrima and C. laurentii with SBC (2% w/v) was an effective treatment to control P. expansum on ‘Golden Delicious’ apples in commercial CA storage (Janisiewicz et al., 2008). Although SBC had direct antifungal activity in vitro in the present study, it is a poor eradicant and does not kill spores (Spadaro et al., 2004); thus, the application of this chemical alone is not sufficient to control postharvest decay. Preliminary in vitro studies indicated that 0.5 % SBC completely inhibited the growth of all three fungal pathogens, without adversely affecting the bacteria (data not shown). As a result, for the commercial storage trials with apples we increased the concentration of SBC from 0.1%, used in the in vitro experiments (Fig. 6.1-6.3), to 0.5 %. On apples, the combination of SBC with P. fluorescens isolate 4-6 was the only treatment of the antagonist that effectively controlled Mucor rot and was comparable to the commercial product Scholar®. Similarly, the combination of isolate 4-6 with SBC, was the only treatment that provided levels of control against blue mold that were comparable to the synthetic fungicide, Scholar®. Our results also show that treatment with SBC directly inhibits grey mold and Mucor rot on ‘Ambrosia’ apples. A disadvantage of the use of SBC is its activity is only fungistatic and salt residues must remain on the fruit or at least within the wound, for the treatment to inhibit infection (Smilanick et al., 1999). The combination of microbial antagonists with GRAS compounds overcomes significant shortcomings of either of these treatments alone. The use of P. fluorescens in this study has been found to be compatible with food additives, CaCl2 and SBC, and commercial cold storage. However further research   134 is needed to assess the potential of P. fluorescens isolate 4-6 in combination with GRAS compounds, particularly SBC, to control postharvest pathogens in commercial CA storage. In order to enhance the activity of P. fluorescens isolate 4-6 against postharvest decay of apples we also investigated applying the bacteria with SA, a chemical inducer of resistance. In a previous report, SA induced fruit resistance to blue mold and grey mold, and markedly enhanced the biological control activity of C. laurentii (Yu et al., 2007). Although Quaglia et al. (2011) confirmed the antimicrobial activity of chemical inducers of resistance, acibenzolar-S-methyl, β-aminobutyric acid and methyl jasmonate the resistance response activated in apple following biological or chemical treatment was ineffective against P. expansum infection. My findings are in agreement with Yu et al. (2007) who saw little direct inhibitory effect of SA against B. cinerea and P. expansum in vitro. I hypothesized that when SA was combined with P. fluorescens, the antagonist would serve as a primary line of defense against decay, while SA would serve as a secondary line of defense, activating the apple fruit natural resistance. In this study, the antagonistic activity of P. fluorescens was not enhanced by SA. Many postharvest elicitors such as β-aminobutyric acid (Porat et al., 2003), chitosan (Molloy et al., 2004), sodium silicate (Bi et al., 2006) and UV irradiation (de Capdeville et al., 2002) have effectively induced disease resistance against postharvest pathogens, but only after they were applied one to several days before inoculation. These reports suggest that in order to enhance the control of postharvest pathogens on apple by P. fluorescens, SA should be applied at least 24 h before the antagonist. As a result, applying SA one minute before P. fluorescens was likely not enough time to induce the natural resistance of the apple before the infection process commenced. On apples, SA had no direct antifungal activity except against the postharvest pathogen B. cinerea.   135 Controlled atmosphere storage is commonly used by packinghouses to reduce fruit rot, delay senescence and maintain the quality of fresh fruit (Tian et al., 2002b). The growth of pathogenic fungi is generally inhibited by low temperature, high CO2, and low O2, but B. cinerea, M. piriformis and P. expansum can cause decay in fruit even at 0°C (Errampalli, 2014; Xiao, 2014; Spotts, 2014). The results of my experiments demonstrated that all three isolates of P. fluorescens were capable of controlling grey mold and blue mold decay on ‘Ambrosia’ apples in commercial CA storage at 0°C. In our previous work, only isolates 1-112 and 4-6 on ‘McIntosh’ and isolate 2-28 on ‘Spartan’ apples provided control of blue mold in commercial cold storage (Chapter 3; Wallace et al., 2017). Similarly, when the three isolates of P. fluorescens were tested for their ability to control grey mold on ‘Spartan’ apples in commercial cold storage, only isolates 1-112 and 4-6 provided significant levels of decay control (Chapter 4; Wallace et al., 2018). These findings suggest the combination of decreased O2, increased CO2 and low temperature enhance the performance of the bacteria in commercial storage to control grey mold and blue mold decay of apples. In agreement with my findings, two yeast antagonists, Trichosporon sp. and C. albidus, were more effective at controlling apple decay in CA storage than air storage (Tian et al., 2002b). On ‘Golden Delicious’ apples, Pantoea agglomerans has been shown to effectively control P. expansum under seven different CA conditions (Nunes et al., 2002). Previous work showed that the bacterial antagonist, P. syringae MA-4 significantly inhibited the growth of P. expansum on ‘Empire’ and ‘Delicious’ apples under conditions similar to commercial air and CA storage (Zhou et al., 2001). Further work is needed to assess the population dynamics of P. fluorescens in vivo to determine if their ability to quickly colonize the wound site and   136 multiply rapidly under commercial storage conditions is the basis for their biological control capabilities in vivo.   The growing public concern over adverse human health and environmental effects associated with the use of chemical fungicides will continue to drive the search for alternative control strategies. Although I hypothesized that integration of P. fluorescens isolate 4-6 with GRAS compounds, CaCl2 and SBC, or a chemical inducer of resistance, SA, would result in enhanced disease control on apples, the combination of the bacteria with low doses of chemicals generally did not increase the biological control activity of the antagonist. However, our findings suggest that P. fluorescens isolate 4-6 in combination with SBC is a promising alternative to control economically important postharvest pathogens, by providing levels of disease control comparable to the synthetic fungicide Scholar®, on apples in commercial cold storage. In commercial CA storage, all three isolates of P. fluorescens provided control of grey mold and blue mold on ‘Ambrosia’ apples, and isolates 1-112 and 4-6 had efficacy comparable to the commercial product, BioSave®.   137 Chapter 7: Conclusion  7.1 General Discussion  In this thesis, I examined the potential BCA, P. fluorescens, isolates 1-112, 2-28, and 4-6, and their ability to control common postharvest fungal pathogens of apple. This bacterium has not been well studied as a BCA for control of fungal pathogens in the postharvest system of fruit. Throughout the introduction (chapter 1) I provided a brief overview of postharvest disease of apple and biological control, while highlighting some of the gaps in knowledge in this area. During my review of the literature (chapter 2) I recognized that the majority of postharvest biological control studies investigated the use of microbial antagonists to control decay in controlled laboratory settings, while few reports have examined the performance of potential BCAs under commercial storage conditions. While there is an abundance of studies that have looked at new yeast antagonists to control postharvest disease, studies investigating new bacterial antagonists are in the minority. I also recognized that while there are many studies that have attempted to elucidate the mechanisms utilized by BCAs to inhibit postharvest pathogens, our understanding is still very incomplete. In this PhD thesis, I have attempted to fill some of these gaps in our understanding.  In chapters 3, 4, and 5, I investigated the potential of three isolates of P. fluorescens, 1-112, 2-28 and 4-6, to control blue mold, grey mold and Mucor rot of apple and assessed potential modes of action of the antagonists in vitro. The search for alternative strategies, such as the use of microbial antagonists, to control postharvest disease can be attributed to i) consumer concern with chemical residues on the fruit, and ii) the development of resistance by the fungi to fungicides. I found that P. fluorescens could control the two most important   138 pathogens, P. expansum and B. cinerea, of apple, but the level of disease control varied among bacterial isolates and apple variety. For example, isolates 1-112 and 4-6 provided significant levels of disease control of blue mold on ‘McIntosh’ apples, while only isolate 2-28 was able to control blue mold on ‘Spartan’ apples. These findings highlight the importance of testing a new BCA on more than one variety of apple. A major drawback of using the drenching method of inoculation was that the apple wounds were very small (2 mm in diameter), so the amount of bacteria that established within each fruit wound may have varied among apples. I recommend that future postharvest biological control studies, as a preliminary method of assessment, inoculate fruit by pipetting the antagonist and the pathogen directly into the wound site. Although this approach does not simulate commercial conditions, it will ensure a known volume and concentration of the antagonist and pathogen are in each wound, potentially leading to more consistent results.  In my preliminary studies aimed at assessing the antagonistic activity of the bacterial isolates in vitro, I found that all three P. fluorescens isolates significantly inhibited spore germination and mycelial growth of all three fungal pathogens, B. cinerea, M. piriformis, and P. expansum; however, all three bacterial isolates did not provide significant levels of disease control on all apple varieties against all three fungal pathogens, highlighting the fact that in vitro results do not always provide insight into how a BCA will perform in a commercial storage environment. Although my apple storage trials were performed at the BCTFC packinghouse in Winfield, BC, my experimental apples were stored in large plastic totes. The lids of the apple totes had holes covered with 0.45 µm filters to allow for aeration and prevent microbial dispersal in the storage facility. In order to best utilize the space in the storage room, the totes were stacked 2-3 units high on wooden pallets. It is unknown if the   139 totes on the bottom and middle of the pallets had the same aeration as totes on the top of the pallet, thus the atmospheric content within the tote may have differed from that in the storage room as volatile compounds such as ethylene could have accumulated within the plastic totes.  In chapter 5, I assessed the ability of P. fluorescens to control the wound pathogen, M. piriformis on four varieties of apple. Even in the control fruit decay was highly variable and this may be attributed to the inoculation technique used, drenching as opposed to directly pipetting the fungi into the wound. Control of Mucor rot was only provided by isolate 4-6 on ‘Gala’ apples and isolates 2-28 and 4-6 on ‘Spartan’ apples, while no control was observed on ‘McIntosh’ or ‘Ambrosia’ apples. Although in vitro P. fluorescens living cells, metabolites and VOCs inhibited all three fungal pathogens (Chapter 3-6), on apples P. fluorescens isolates were less effective at controlling Mucor rot than blue mold or grey mold. There are only a limited number of reports on Mucor rot of apple and even fewer reports examining BCAs to control this pathogen; due to the lack of literature on this pathogen I can only speculate as to why our bacterial isolates provide only limited disease control of M. piriformis in commercial storage. From careful examination of the electron micrographs it was evident that B. cinerea grew into the fruit tissue and P. expansum grew on the tissue, while M. piriformis formed large erect hyphae or sporangiophores that extended hundreds of micrometers from the wound surface. The ability of M. piriformis to grow further away from the wound site and the bacteria, avoiding colonization by the antagonist, may be a strategy utilized by the pathogen to avoid attack. It should also be noted that there is a large size difference between the three fungal pathogens. Spores of B. cinerea, P. expansum and M. piriformis are approximately 3, 10, and 10 µm, respectively, while sporangia of M. piriformis   140 may exceed 100 µm in diameter. Similarly, the hyphae of M. piriformis are much larger, in length and width, than the hyphae of the other two fungi. Therefore, the inability of the antagonist, which is approximately 0.5 x 2 µm in size, to colonize significant portions of the fungus, physically excluding it from nutrients at the wound site, may contribute to the limited levels of disease control observed. I suggest that future research investigate applying a higher concentration of the bacteria to the fruit in order to control Mucor rot.  Zygomycetes are known to produce the polycarboxylate siderophore rhizoferrin, and Renshaw et al. (2003) showed that Mucoraceous fungi can also produce hydroxomate siderophores. In apple wounds, if the antagonist and pathogen are competing for nutrients that are not abundant, such as iron, then the ability to chelate iron, making it unavailable to the bacteria, may contribute to this pathogen’s success in causing decay. Further work is needed to determine if the isolate of M. piriformis I worked with produces multiple types of siderophores and if these siderophores have a higher affinity for iron than siderophores produced by P. fluorescens. A better understanding of the etiology of M. piriformis on pome fruit may elucidate why our bacteria only provide limited control of this pathogen on apples in commercial storage.   In my final data chapter (chapter 6) I combined the antagonist, P. fluorescens, with GRAS compounds, SA, or commercial CA storage to determine if any of these could enhance their biological control activity. Many BCAs have shown promise as they significantly reduce the incidence of decay on stored fruit, but the level of disease control is generally inferior to that of chemical fungicides. Although I had hypothesized that the combination of the bacteria with a chemical additive would act synergistically to inhibit postharvest fungal pathogens, providing better disease control than either treatment alone, the   141 combination generally did not enhance the level of disease control in vitro or on apples. I found that when P. fluorescens isolate 4-6 was combined with SBC, grey mold, Mucor rot and blue mold were controlled to levels comparable to that of the fungicide Scholar®. Although we investigated enhancing the biological control activity by combining the antagonist with low doses of chemicals, we did not assess the optimal time between BCA and chemical additive application to the fruit. A better understanding of the BCA’s population dynamics on the fruit in commercial storage may provide valuable insight on when the best time to apply the chemical additive is, in order to optimize BCA performance.  If the bacterial isolates were to be developed into a commercial product it would be important to know how many of the bacteria were still alive on the fruit when the apples were removed from storage. Additionally, are there concerns if a person were to consume fruit harboring the living bacteria? These are areas of research I did not explore, but are important to consider when developing a BCA that will be applied to a consumable product.  I also examined the ability of P. fluorescens to inhibit postharvest pathogens of apple in commercial CA storage. Although I did not directly compare the performance of P. fluorescens in cold versus CA storage, my results suggest that P. fluorescens may provide better disease control when O2 levels are decreased and CO2 levels are increased. A limitation of performing this research in a commercial setting was the fact that I had no control over when the CA rooms with our experimental apples were opened; thus, the storage time in this environment was variable and could not be directly compared to our cold storage results.  This thesis provides novel information on the bacterial antagonist P. fluorescens, a well characterized BCA in the rhizosphere, and its ability to control postharvest decay of   142 apples. Although competition for space and nutrients is often regarded as the main mechanism of action of bacterial and yeast BCAs, the physical interaction of the antagonist and pathogen should not be disregarded. In this study, I showed that metabolites produced by P. fluorescens inhibited spore germination, but the metabolites were less effective than the living cells, suggesting the physical presence of the bacteria was necessary for superior disease control. The importance of this mechanism, direct physical interaction, was highlighted by my SEM work that clearly showed P. fluorescens colonized the hyphae of the pathogen, and, in some cases, the spores. To date very few studies have used electron microscopy to investigate the interaction of a BCA with a fungal pathogen on fruit. My work is the first report to clearly show how the bacterium P. fluorescens interacts with three different fungal pathogens, B. cinerea, M. piriformis, and P. expansum, in vitro and in fruit wounds. Similarly, my work is one of the few reports, if not the first, to show that metabolites and VOCs produced by P. fluorescens have strong inhibitory activity against B. cinerea, M. piriformis and P. expansum in vitro, suggesting that identification of these metabolites could lead to novel products for disease control in the absence of living cells.  The production of antibiotics by fluorescent pseudomonads and their role in biological control in the rhizosphere has been well documented. In this study, I screened my three isolates of P. fluorescens for genes encoding the production of antibiotics that are commonly produced by Pseudomonas spp. and have been shown to contribute to their biological control capabilities. Bacterial isolates, 1-112, 2-28 and 4-6, lacked most of the genes necessary for the production of these common antibiotics. These findings may prove advantageous, if any of these bacterial isolates were to be commercialized, as a bacterium producing antibiotics may be more difficult to register for use on a consumable product. My   143 work is also one of the few published reports that have conducted large scale postharvest BCA storage trials in a commercial setting. For our in vivo methodology, we chose to apply our BCA by drenching as opposed to pipetting the bacteria directly into the wound in order to simulate commercial conditions, which is in contrast to many reports in the literature. It is important in assessing the potential of a new BCA product that it be tested under commercial conditions.  Table 7.1 provides a summary of all the results obtained from the in vitro and in vivo experiments, conducted during this PhD study, where P. fluorescens isolates 1-112, 2-28 or 4-6 inhibited P. expansum by more than 80%. In vitro, only living cells of all three bacterial antagonists were able to inhibit spore germination of P. expansum by more than 80%; this suggests that these isolates may be useful as a preventative treatment, inhibiting fungal spores before they germinate, but these isolates may be ineffective as a curative treatment, as they provide less inhibition of the mycelial growth of P. expansum. In vivo, attaining control greater than 80% depended on the apple variety and the year of the storage trial. As a result, I recommend that future research, on these three isolates, focus on optimizing the performance of the living cells of the bacteria so that they can consistently control blue mold, on multiple varieties of apple, to an acceptable level (>80% fungal inhibition) in commercial storage.          144 Table 7.1 Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against P. expansum.     Treatment     1-112 2-28 4-6 4-6 + CaCl2 4-6 + SBC 4-6 + SA In vitro Living cells (SG) + + + NAa NA NA Living cells (MG)b - - - - - - CFS (SG)c - - - NA NA NA VOCs (MG) + + + NA NA NA   Gala (DI) NDd NDd NDd NA NA NA In vivo- McIntosh (DI) + - - -/+e -/+e -/+e cold storage Spartan (DI) - +/-f - NA NA NA   Ambrosia (DI) - - - - - - In vivo- Gala (DI) -/+g + -/+g NA NA NA controlled McIntosh (DI)d -/+h - -/+h NA NA NA atmosphere Spartan (DI)d -/+i -/+i - NA NA NA storage Ambrosia (DI) - - - NA NA NA aNA= Not assayed. bWallace et al., 2016. cTable D.35. dND= No data. 2014-17 <10% disease incidence was observed in control fruit; thus, no conclusions can be made for this variety of apple. eIn 2015-16, the inhibition provided by this treatment was <80%, but >80% in the 2016-17 trials. fIn 2015-16, isolate 2-28 inhibited P. expansum by >80%, but <80% in 2016-17 trials. gIn 2014-15, isolate 1-112 and 4-6 inhibited P. expansum by <80%, but >80% in the 2016-17 trials. hIn 2015-16, isolate 1-112 and 4-6 inhibited P. expansum by <80%, but >80% in the 2016-17 trials. iIn 2015-16, isolate 1-112 and 2-28 inhibited P. expansum by <80%, but >80% in the 2016-17 trials.  Table 7.2 provides a summary of all the results obtained from the in vitro and in vivo experiments, conducted during this PhD study, where P. fluorescens isolates 1-112, 2-28 or 4-6 inhibited B. cinerea by more than 80%. In vitro, living cells of all three bacterial antagonists and VOCs produced by the bacteria, were able to inhibit B. cinerea by more than 80%. In vivo, all three isolates inhibited grey mold on ‘Spartan’ apples in cold storage and ‘McIntosh’ apples in CA storage by more than 80%. On ‘Ambrosia’, and in some cases ‘McIntosh’, apples isolate 4-6 in combination with CaCl2, SBC and SA inhibited grey mold by more than 80%. Based on these findings, I believe that further research efforts should focus on the VOCs produced by these three isolates of P. fluorescens, as applying them in a commercial setting could be a more attractive alternative control strategy as 1) there would   145 not be living P. fluorescens on the fruit and 2) it may be easier to bio-fumigate a sealed commercial storage room full of apples than dip or drench the fruit into a BCA solution.  Table 7.2 Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against B. cinerea.     Treatment     1-112 2-28 4-6 4-6 + CaCl2 4-6 + SBC 4-6 + SA In vitro Living cells (SG) + + + NAa NA NA Living cells (MG)b - - - - - - CFS (SG) - - - NA NA NA CFS (MG) - - - NA NA NA VOCs (MG) + + + NA NA NA   Gala (DI) - - - NA NA NA In vivo- McIntosh (DI) - - - + -/+c -/+c cold storage Spartan (DI) + + + NA NA NA   Ambrosia (DI) - - - + + + In vivo- Gala (DI) - - - NA NA NA controlled McIntosh (DI) + + + NA NA NA atmosphere Spartan (DI) - +d +d NA NA NA storage Ambrosia (DI) - - - NA NA NA aNA= Not assayed. bWallace et al., 2016. cIn 2015-16, this treatment inhibited B. cinerea by < 80%, but >80% in the 2016-17 trials. dIn 2014-15, control by isolate 2-28 and 4-6 reduced the incidence of disease by >80%, but the level of inhibition was not statistically significant in comparison to the control fruit.  Table 7.3 provides a summary of all the results obtained from the in vitro and in vivo experiments, conducted during this PhD study, where P. fluorescens isolates 1-112, 2-28 or 4-6 inhibited M. piriformis by more than 80%. In vitro, living cells of all three bacterial antagonists inhibited M. piriformis by more than 80%. In vivo, isolates 1-112 and 4-6 showed the most promise as they inhibited Mucor rot on more apple varieties in commercial storage than isolate 2-28. As I result, I recommend that future research efforts focus on optimizing the performance of isolates 1-112 and 4-6, so that they can more consistently control Mucor rot on multiple varieties of apple in a commercial setting.     146 Table 7.3 Summary of assays where P. fluorescens isolates 1-112, 2-28, and 4-6 alone or isolate 4-6 in combination with calcium chloride (CaCl2), sodium bicarbonate (SBC) or salicylic acid (SA) exhibited inhibitory activity ≥ 80%, relative to positive control treatments, against spore germination (SG) and/or mycelial growth (MG) in vitro or disease incidence (DI) in vivo against M. piriformis.     Treatment     1-112 2-28 4-6 4-6 + CaCl2 4-6 + SBC 4-6 + SA In vitro Living cells (SG) + + + NAa NA NA Living cells (MG)b - - - - - - CFS (SG) - - - NA NA NA CFS (MG) - - - NA NA NA VOCs (MG) - - - NA NA NA   Gala (DI) - - + NA NA NA In vivo- McIntosh (DI) + + - + + -/+c cold storage Spartan (DI) + + + NA NA NA   Ambrosia (DI) - - - - - - In vivo- Gala (DI) + - + NA NA NA controlled McIntosh (DI)d + - + NA NA NA atmosphere Spartan (DI)d + + + NA NA NA storage Ambrosia (DI) - - - NA NA NA aNA= Not assayed. bWallace et al., 2016. cIn 2015-16, this treatment inhibited M. piriformis by <80%, but >80% in the 2016-17 trials. dDisease incidence in control fruit were < 15%.  Overall, my research contributes new knowledge to the field of postharvest pathology by elucidating the physical interaction of P. fluorescens with three common postharvest fungal pathogens of apple, while also providing insight into the mechanisms used by the bacteria to inhibit these fungi. Although there are limitations to the work described, this study provides novel insight into the potential of P. fluorescens to control economically important postharvest fungal pathogens of apple in a commercial setting.  7.2 Future Research Directions  Although my PhD research advances our understanding of the use of P. fluorescens to control common postharvest pathogens of apples and the potential mechanisms of antagonism of the bacteria, it also provides several avenues of research for further investigation. In chapter 3 I showed that two of my bacterial isolates, 1-112 and 4-6, had the   147 potential for synthesis of the antibiotic, PCA, but lacked the genes for biosynthesis of three other antibiotics, Prn, DAPG, and Plt. Further work is needed to assess if the production of the antibiotic PCA, by isolates 1-112 and 4-6, plays a role in the antagonism to B. cinerea, M. piriformis or P. expansum on apple. This could be accomplished by knocking out the gene for PCA biosynthesis and comparing the performance of the antagonist to the wild type isolate. For example, antibiotic biosynthesis gene knockout mutants of P. fluorescens strain Psd showed that PCA and Prn play a major role in its antifungal activity (Upadhyay and Srivastava, 2011). In vitro I showed that metabolites, in the form of CFS, produced by all three isolates of P. fluorescens inhibited the mycelial growth and spore germination of all three fungal pathogens. A future study could attempt to identify and isolate the active metabolites being produced by P. fluorescens and assess if they could be applied in a purified form to control disease. This would remove any concern consumers may have regarding eating fruit drenched in a soil bacterium, as well as the variable levels of performance associated with a living microorganism. Similarly, volatiles produced by the antagonist showed strong inhibitory activity against B. cinerea, M. piriformis and P. expansum in vitro; as a result, I recommend that future research try to identify the specific VOCs with antifungal activity. Further research could also investigate the potential to bio-fumigate apples in commercial storage with P. fluorescens VOCs as an alternative to treating fruit with the living bacteria. Recent work by Di Francesco et al. (2015) illustrated that bio-fumigation of apples with VOCs produced by the yeast antagonist, A. pullulans controlled postharvest disease of apples, but to the best of my knowledge, there are no reports examining the potential of bacterial VOCs to inhibit fungal pathogens on fruit.    148 In this thesis, I investigated the ability of three isolates of P. fluorescens to control postharvest decay on apple varieties, ‘Gala’, ‘McIntosh’, ‘Ambrosia’, and ‘Spartan’. While significant levels of disease control were observed by some isolates on some apple varieties, none of the isolates of P. fluorescens was able to inhibit all three fungal pathogens on all the apple varieties in both storage environments. I assessed key physiological fruit quality parameters of each apple variety including: weight, firmness, starch, TSS (sugar), and TA (malic acid content), before and after commercial storage. These results did not appear to correlate with the levels of disease control provided by each bacterial isolate. One of the main modes of action of yeast and bacterial BCAs is competition for nutrients, thus a more comprehensive analysis of the biochemistry of each variety of apple, particularly in regard to the carbon and nitrogen compounds, may provide insight into the variable levels of disease control observed among apple varieties, as well as how best to optimize the application and performance of BCAs. Finally, further work is needed to assess if isolate 4-6 in combination with SBC can enhance the activity of the antagonist to provide levels of disease control comparable to Scholar® in CA storage.  149 References  AHDB Horticulture, n.d. Apple best practice guide. http://apples.ahdb.org.uk/apple-canker- additional-information.asp (accessed 21.01.18)> Agriculture and Agri-Food Canada, 2017. Canadian apple industry- Varieties by province.  http://www.agr.gc.ca/eng/industry-markets-and-trade/international-agri-food-market-intelligence/canada/canadian-apple-industry-varieties-by-province/?id=1410083148449 (accessed 21.01.18). AgroFresh, 2015. SmartFresh technology. https://www.agrofresh.com/smartfresh- technology (accessed 31.01.17). Alves, E., Lucas, G.C., Pozza, E.A., Alves, M.d.C., 2013. Scanning electron microscopy  for fungal sample examination, in: Gupta, V.K., Tuohy, M.G., Ayyadamy, M., Turner, K.M., O’Donovan, A. (Eds.), Laboratory protocols in fungal biology: Current methods in fungal biology. Springer Science + Business Media, LLC, New York, pp. 133-150.  Annous, B.A., Fratamico, P.M., Smith, J.L., 2009. Quorum sensing in biofilms: why  bacteria behave the way they do. J. Food Sci. 74, R24-37. Arima, K., Imanaka, H., Kousaka, M., Fukuta, A., Tamura, G., 1964. Pyrrolnitrin, a new  antibiotic substance, produced by Pseudomonas. Agric. Biol. Chem. 28, 575-576. Arrebola, E., Jacobs, R., Korsten, L., 2010. Iturin A is the principal inhibitor in the  biocontrol activity of Bacillus amyloliquefaciens PPCB004 against postharvest  fungal pathogens. J. Appl. Microbiol. 108, 386-395. Barkai-Golan, R., 2001. Postharvest diseases of fruits and vegetables- Development and  control. Elsevier, Amsterdam, The Netherlands.   150 BCTFPG, n.d. Apple varieties. http://www.bctfpg.ca/horticulture/varieties-and-  pollination/apple-varieties/ (accessed 27.01.17). BC Tree, n.d. Apples. http://www.bctree.com/fruits/apples/ (accessed  21.01.18). Bencheqroun, S.K., Bajji, M., Massart, S., Labhilili, M., El Jaafari, S., Jijakli, M.H.,  2007. In vitro and in situ study of postharvest apple blue mold biocontrol by Aureobasidium pullulans: Evidence for the involvement of competition for nutrients. Postharvest Biol. Technol. 46, 128-135. Bi, Y., Tian, S.P., Guo, Y.R., Ge, Y.H., Qin, G.Z., 2006. Sodium silicate reduces  postharvest decay on Hami melons: induced resistance and fungistatic effects. Plant Dis. 90, 279-283. Biggs, A.R., 1999. Effect of calcium salts on apple bitter rot caused by two  Colletotrichum spp. Plant Dis. 83, 1001-1005. Jet Harvest Solutions, 2018. Bio-Save FAQS. https://jetharvest.com/bio-save-faqs/ (accessed  21.01.18). Blanpied, G.D., Silsby, K.J., 1992. Predicting Harvest Date Windows for Apples. Cornell  Cooperative Extension Information Bulletin 221,12 pp. Bonaterra, A., Badosa, E., Cabrefiga, J., Frances, J., Montesinos, E., 2012. Prospects and  limitations of microbial pesticides for control of bacterial and fungal pomefruit tree disease. Trees 26, 215-226. Bonaterra, A., Mari, M., Casalini, L., Montesinos, E., 2003. Biological control of    151 Monilinia laxa and Rhizopus stolonifer in postharvest stone fruit by Pantoea agglomerans EPS125 and putative mechanisms of antagonism. Int. J. Food Microbiol. 84, 93-104. Borecka, H., 1977. Fungi of the genus Penicillium on apples and pears during the storage  period. Acta Agrobot. 30, 213-227. Brent, K. J., Hollomon, D. W., 2000. Fungicide resistance management. Plant Dis. Res.  15, 1-13. Buckner, S., 2005. Good bugs vs. bad; beneficial micro-organisms gain grounds in  disease battles. Grower 38, B12-14. Bull, C.T., Wadsworth, M.L., Sorensen, K.N., Takemoto, Y.J., Austin, R.K., Smilanick,  J.L., 1998. Syringomycin E produced by biological control agents controls green mold on lemons. Biol. Control 12, 89-95. Bull, C.T., Weller, D.M., Thomashow, L.S., 1991. Relationship between root  colonization and suppression of Gaeumannomyces graminis var. tritici by Pseudomonas fluorescens strain 2-79. Phytopathol. 81, 954-959. Cabrefiga, J., Bonaterra, A., Montesinos, E., 2007. Mechanisms of antagonism of  Pseudomonas fluorescens EPS62e against Erwinia amylovora, the causal agent of fire blight. Int. Microbiol. 10, 123-132. Caccioni, D., Guizzardi, M., 1992. Mucor piriformis Fisher su pomacee in post-raccolta.  Inf. Fitopatol. 9, 59–62. Calvente, V., Benuzzi, D., de Tosetti, M.I.S., 1999. Antagonistic action of siderophores  from Rhodotorula glutinis upon the postharvest pathogen Penicillium expansum. Int. Biodeterior. Biodegrad. 43, 167-172.   152 Calvo, J., Calvente, V., de Orellano, M.E., Benuzzi, D., de Tosetti, M.I.S., 2007.  Biological control of postharvest spoilage caused by Penicillium expansum and Botrytis cinerea in apple by using the bacterium Rahnella aquatilis. Int. J. Food Microbiol. 113, 251-257. Cao, J., Zhang, H., Yang, Q., Ren, R., 2013. Efficacy of Pichia caribbica in controlling  blue mold rot of patulin degradation in apples. Int. J. Food Microbiol. 162, 167-173. Chan, Z., Tian, S., 2005. Interaction of antagonistic yeasts against postharvest pathogens  of apple fruit and possible mode of action. Postharvest Biol. Technol. 36, 215-223. Chand-Goyal, T., Spotts, R.A., 1996. Control of postharvest pear diseases using natural  saprophytic yeast colonists and their combination with a low dosage of thiabendazole. Postharvest Biol. Technol. 7, 51-64. Chand-Goyal, T., Spotts, R.A., 1997. Biological control of postharvest diseases of apple  and pear under semi-commercial and commercial conditions using three saprophytic yeasts. Biol. Control 10, 199-206. CHC, 2013. Canada’s apple industry. http://www.plant.uoguelph.ca/treefruit/documents  /Canada.pdf (accessed 27.01.17). Chen, X., Zhang, Y., Fu, X., Li, Y., Wang, Q., 2016. Isolation and characterization of  Bacillus amyloliquefaciens PG12 for the biological control of apple ring rot. Postharvest Biol. Technol. 115, 113-121. Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F., Melton,  D.M., Beachey, E.H., 1985. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices. J. Clin. Microbiol. 22, 996-1006.   153 Coates, L.M., Johnson, G.I., 1997. Chapter 33 Postharvest diseases of fruit and  vegetables, in: Brown, J., Ogle, H. (Eds.), Plant Pathogens and Plant Diseases. Rockvale Publications, Armidale, Australia, pp. 533-548. Colhoun, J., 1938. Fungi causing rots of apple fruit in storage in Northern Ireland. Ann.  Appl. Biol. 25, 88-99. Compant, S., Duffy, B., Nowak, J., Clément, C., Barka, E.A., 2005. Use of plant growth- promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action and future prospects. Appl. Environ. Microbiol. 71, 4951-4959. Conway, W.S., 1982. Effect of postharvest calcium treatment on decay of Delicious  apples. Plant Dis. 66, 402-403. Conway, W.S., Janisiewicz, W.J., Klein, J.D., Sams, C.E., 1999. Strategy for combining  heat treatment, calcium infiltration, and biological control to reduce postharvest decay of ‘Gala’ apples. HortSci. 34, 700-704. Conway, W.S., Janisiewicz, W.J., Leverentz, B., Saftner, R.A., Camp, M.J., 2007.  Control of blue mold of apple by combining controlled atmosphere, an antagonist mixture, and sodium bicarbonate. Postharvest Biol. Technol. 45, 326-332. Conway, W.S., Sams, C.E., McGuire, R.G., Kelman, A., 1992. Calcium treatment of  apples and potatoes to reduce postharvest decay. Plant Dis. 76, 329-334. Cook, D.W.M., 2002. A laboratory simulation for vectoring of Trichosporon pullulans by  conidia of Botrytis cinerea. Phytopathol. 92, 1293-1299. Dean, R., Van Kan, J.A.L., Pretorius, Z.A., Hammond-Kosack, K.E., Di Pietro, A.,  Spanu, P.D., Rudd, J.J., Dickman, M., Kahmann, R., Ellis, J., Foster, G.D., 2012. The top fungal pathogens in molecular plant pathology. Molec. Plant Pathol. 13, 414-430.   154 de Capdeville, G., Wilson, C.L., Beer, S.V., Aist, J.R., 2002 Alternative disease control  agents induce resistance to blue mold in harvest ‘Red Delicious’ apple fruit. Phytopathol. 92, 900-908. DeEll, J.R., Ayres, J.T., Murr, D.P., 2007. 1-Methylcyclopropene influences ‘Empire’  and ‘Delicious’ apple quality during long-term commercial storage. Hort. Technol. 17, 46-51. Delany, I.R., Walsh, U.F., Ross, I., Fenton, A.M., Corkery, D.M., O’Gara, F.O., 2001.  Enhancing the biocontrol efficacy of Pseudomonas fluorescens F113 by altering the regulation and production of 2,4-diacetylphloroglucinol. Plant Soil 232, 195-205. Dennis, C., Webster, J., 1971. Antagonistic properties of species-groups of Trichoderma.  II, Production of volatile antibiotics. Trans. Br. Mycol. Soc. 57, 41-48. de Souza, J.T., Raaijmakers, J.M., 2003. Polymorphisms within the prnD, and pltC genes  from pyrrolnitrin and pyoluteorin-producing Pseudomonas and Burkholderia spp. FEMS Microbiol. Ecol. 43, 21-34. Di Francesco, A., Martini, C., Mari, M., 2016. Biological control of postharvest disease  by microbial antagonists: how many mechanisms of action? Eur. J. Plant Pathol. 145, 711-717. Di Francesco, A., Ugolini, L., Lazzeri, L., Mari, M., 2015. Production of volatile organic  compounds by Aureobasidium pullulans as a potential mechanism of action against postharvest fruit pathogens. Biol. Control 81, 8-14. Dobson, R.L., Michailides, T.J., Cervantes, L.A., Spotts, R.A., 1989. Population  dynamics of Mucor piriformis in pear orchard soils as related to decaying pear fruit. Phytopathol. 79, 657-660.   155 Dowling, D.N., O’Gara, F., 1994. Metabolites of Pseudomonas involved in the biocontrol  of plant disease. Trends Biotechnol. 12, 133-141. Droby, S., Wisniewski, M., El Ghaouth, A., Wilson, C., 2003. Influence of food additives  on the control of postharvest rots of apple and peach and efficacy of the yeast-based biocontrol product Aspire. Postharvest Biol. Technol. 27, 127-135. Droby, S., Wisniewski, M., Macarisin, D., Wilson, C., 2009. Twenty years of postharvest  biocontrol research: Is it time for a new paradigm? Postharvest Biol. Technol. 52, 137-145. Droby, S., Wisniewski, M., Teixidó, N., Spadaro, D., Jijakli, M.H., 2016. The science,  development, and commercialization of postharvest biocontrol products.  Postharvest Biol. Technol. 122, 22-29. Durrant, W.E., Dong, X., 2004. Systemic acquired resistance. Annu. Rev. Phytopathol.  42, 185-209. Ebrahimi, L., Etebarian, H.R., Aminian, H., Sahebani, N., 2013. Effect of Metschnikowia  pulcherrima and methyl jasmonate on apple blue mold disease and the possible mechanisms involved. Phytoparasitica 41, 515-519. El Ghaouth, A., Wilson, C.L., Wisniewski, M., 2002. Control of postharvest decay of  apple fruit with Candida saitoana and induction of defense responses. Phytopathol. 93, 344-348. Errampalli, D., 2004., Effect of fludioxonil on germination and growth of Penicillium  expansum and decay in apple cvs. Empire and Gala. Crop Prot. 23, 811-817. Errampalli, D., 2014. Penicillium expansum (Blue mold), in: Bautista-Baños, S. (Ed.),  Postharvest Decay Control Strategies. Elsevier, USA, pp. 189-231.   156 Errampalli, D., Brubacher, N.R., 2006. Biological and integrated control of postharvest  blue mold (Penicillium expansum) of apples by Pseudomonas syringae and cyprodinil. Biol. Control 36, 49-56. Errampalli, D., Brubacher, N.R., DeEll, J.R., 2006. Sensitivity of Penicillium expansum  to diphenylamine and thiabendazole and postharvest control of blue mold with fludioxonil in ‘McIntosh’ apples. Postharvest Biol. Technol. 39, 101-107. Essghaier, B., Fardeau, M.L., Cayol, J.L., Hajlaoui, M.R., Boudabous, A., Jijakli, H.,  Sadfi-Zouaoui, N., 2008. Biological control of grey mould in strawberry fruits by halophilic bacteria. J. Appl. Microbiol. 106, 833-846. Etebarian, H.R., Sholberg, P.L., Eastwell, C., Sayler, R.J., 2005. Biological control of  apple blue mold with Pseudomonas fluorescens. Can. J. Microbiol. 51, 591-598. Fan, Q., Tian, S.P., 2001. Postharvest biological control of grey mold and blue mold on  apple by Cryptococcus albidus (Saito) Skinner. Postharvest Biol. Technol. 21, 341-350.  FAO, 2012. Save food: Global initiative on food loss and waste reductions.  http://www.fao.org/save-food/resources/keyfindings/infographics/fruit/en/ (accessed 31.01.17).  Friel, D., Pessoa, N.M.G., Vandenbol, M., Jijakli, M.H., 2007 Separate and combined  disruptions of two exo-β-1,3-glucanase genes decrease the efficiency of Pichia anomola (strain K) biocontrol against Botrytis cinerea on apple. Mol. Plant Microbe Interact. 20, 371-379. Gullino, M.L., Kuijpers, L.A.M., 1994. Social and political implications of managing    157 plant diseases with restricted fungicides in Europe. Annu. Rev. Phytopathol. 32, 559-579. Guo, L.Y., Michailides, T.J., Morgan, D.P., 1999. Survival of Mucor piriformis in soil of  apple orchards in California. Plant Dis. 83, 189-193. Haas, D., Défago, G., 2005. Biological control of soil-borne pathogens by fluorescent  pseudomonads. Nature Rev. Microbiol. 3, 307-319. Haas, D., Keel, C., 2003. Regulation of antibiotic production in root-colonizing  Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev. Phytopathol. 41, 117-153. Hashem, M., Alamri, S.A., Hesham, A.E., Al-Qahtani, F.M., Kilany, M., 2014.  Biocontrol of apple blue mould by new yeast strains: Cryptococcus albidus KKUY0017 and Wickerhamomyces anomalus KKUY0051 and their mode of action. Biocontrol Sci. Technol. 24, 1137-1152. Hernández-León, R., Rojas-Solís, D., Contreras-Pérez, M., Orozco-Mosqueda, M.D.C.,  Marcías-Rodríguez, L.I., Reyes-de la Cruz, H., Valencia-Cantero, E., Santoyo, G., 2015. Characterization of antifungal and plant growth-promoting effects of diffusible and volatile organic compounds produced by Pseudomonas fluorescens strains. Biol. Control 81, 83-92. Holmes, G.J., Edmunds, B., 2005. Bio-Save 11LP gets label for postharvest use in sweet  potatoes. In: Toth, S.J. (Ed.), North Carolina Pest News, NC State Univ. 20(4). Available at http://ipm.ncsu.edu/currentipm/05PestNews/05News4/fruitveg.html (accessed August 2017). Hu, H., Yan, F., Wilson, C., Shen, Q., Zheng, X., 2015. The ability of a cold-adapted    158 Rhodotorula mucilaginosa strain from Tibet to control blue mold of pear. Antonie van Leeuwenhoek 108, 1391-1404. Hynes, R.K., Leung, G.C., Hirkala, D.L., Nelson, L.M., 2008. Isolation, selection and  characterization of beneficial rhizobacteria from pea, lentil and chickpea grown in western Canada. Can. J. Microbiol. 54, 248-258. Ippolito, A., El Ghaouth, A., Wilson, C.L., Wisniewski, M., 2000. Control of postharvest  decay of apple fruit by Aureobasidium pullulans and induction of defense responses. Postharvest Biol. Technol. 19, 265-272. Jamalizadeh, M., Etebarian, H.R., Alizadeh, A., Aminian, H., 2008. Biological control of  gray mold on apple fruits by Bacillus licheniformis (EN74-1). Phytoparasitica 36, 23-29. Janisiewicz, W.J., Conway, W.S., Glenn, D.M., Sams, C.E., 1998. Integrating biological  control and calcium treatment for controlling postharvest decay of apples. HortSci. 33, 105-109. Janisiewicz, W.J., Jeffers, S.N., 1997. Efficacy of commercial formulation of two  biofungicides for control of blue mold and gray mold of apples in cold storage. Crop Prot. 16, 629-633. Janisiewicz, W.J., Korsten, L., 2002. Biological control of postharvest disease of fruits. Annu. Rev. Phytopathol. 40, 411-441.  Janisiewicz, W.J., Roitman, J., 1988. Biological control of blue mold and gray mold on  apple and pear with Pseudomonas cepacia. Phytopathol. 78, 1697-1700. Janisiewicz, W.J., Saftner, R.A., Conway, W.S., Yoder, K.S., 2008. Control of blue mold    159 decay of apple during commercial controlled atmosphere storage with yeast antagonists and sodium bicarbonate. Postharvest Biol. Technol. 49, 374-378. Janisiewicz, W.J., Tworkoski, T.J., Sharer, C., 2000. Characterizing the mechanism of  biological control of postharvest diseases on fruits with a simple method to study competition for nutrients. Biol. Control 90, 1196-1200. Jijakli, M.H., Lepoivre, P., 2004. State of the art and challenges of postharvest disease  management in apples, in: Mukerji, K.G. (Ed.), Fruit and Vegetable Diseases. Kluwer Academic Publishers, Dordrecht, NL, pp. 59-94. Julca, I., Droby, S., Sela, N., Marcet-Houben, M., Gabaldón, T., 2015. Contrasting  genomic diversity in two closely related postharvest pathogens: Penicillium digitatum and Penicillium expansum. Genome Biol. Evol. 8, 218-227. Jurick, W.M., Macarisin, O., Gaskins, V.L., Park, E., Yu, J.J., Janisiewicz, W., Peter,  K.A., 2017. Characterization of postharvest fungicide-resistant Botrytis cinerea isolates from commercially stored apple fruit. Phytopathol. 107, 362-368. Kim, J.S., Mele, P.M., Crowley, D.E., 2013. Application of PCR primer sets for detection  of Pseudomonas sp. functional genes in the plant rhizosphere. J. Agric. Chem. Environ. 2, 8-15. Konstantinou, S., Karaoglanidis, G.S., Bardas, G.A., Minas, I.S., Doukas, E., Markoglou,  A.N., 2011. Postharvest fruit rots of apple in Greece: Pathogen incidence and relationships between fruit quality parameters, cultivar susceptibility, and patulin production. Plant Dis. 95, 666-672. Kraus, J., Loper, J.E., 1995. Characterization of a genomic region required for production    160 of the antibiotic pyoluteorin by the biological control agent Pseudomonas fluorescens Pf-5. Appl. Environ. Microbiol. 61, 849-854. Kupferman, E., 2003. Controlled atmosphere storage of apples and pears. Postharvest  Information Network, Tree Fruit Research and Extension Center, Washington State University, Wenatchee, WA. http://postharvest.tfrec.wsu.edu/emk2001d.pdf (accessed 27.01.17). Lee, G.W., Ko, J.A., Oh, B.T., Choi, J.R., Lee, K.J., Chae, J.C., Kamala-Kannan, S.,  2012. Biological control of postharvest diseases of apples, peaches and nectarines by Bacillus subtilis S16 isolated from halophytes rhizosphere. Biocontrol Sci. Technol. 22, 251-361. Leelasuphakul, W., Hemmanee, P., Chuenchitt, S., 2008. Growth inhibitory properties of  Bacillus subtilis strains and their metabolites against the green mold pathogen (Penicillium digitatum Sacc.) of citrus fruit. Postharvest Biol. Technol. 48, 113-121. Li, B., Peng, H., Tian, S., 2016. Attachment capability of antagonistic yeast Rhodotorula  glutinis to Botrytis cinerea contributes to biocontrol efficacy. Front. Microbiol. 7, 601. Li, J., Gaskins, V.L., Yan, H.J., Luo, Y.G., Jurick, W.M., 2014. First report of Mucor rot  in stored ‘Gala’ apple fruit caused by Mucor piriformis in Pennsylvania. Dis. Notes 98, 1157. Li, R., Zhang, H., Liu, W., Zheng, X., 2011. Biocontrol of postharvest gray and blue  mold decay of apples with Rhodotorula mucilaginosa and possible mechanisms of action. Int. J. Food Microbiol. 146, 151-156. Lima, G., Castoria, R., De Curtis, F., Raiola, A., Ritieni, A., De Cicco, V., 2011.    161 Integrated control of blue mould using new fungicides and biocontrol yeasts lowers levels of fungicide residues and patulin contamination in apples. Postharvest Biol. Technol. 60, 164-172. Lima, G., De Curtis, F., Castoria, R., De Cicco, V., 2010. Activity of the yeasts  Cryptococcus laurentii and Rhodotorula glutinis against post-harvest rots on different fruits. Biocontrol Sci. Technol. 8, 257-267. Liu, J., Sui, Y., Wisniewski, M., Droby, S., Liu, Y., 2013. Review: Utilization of  antagonistic yeasts to manage postharvest fungal diseases of fruit. Int. J. Food Microbiol. 167, 153-160. Lopatecki, L.E., and Peters, W., 1972. A rot of pears in cold storage caused by Mucor  piriformis. Can. J. Plant Sci. 52, 875-879. Loper, J.E., 1988. Role of fluorescent siderophore production in biological control of  Pythium ultimum by a Pseudomonas fluorescens strain. Phytopathol. 78, 166-172. Lutz, M.C., Lopes, C.A., Rodriguez, M.E., Sosa, M.C., Sangorrín, M.P., 2013. Efficacy  and putative mode of action of native and commercial antagonistic yeasts against postharvest pathogens of pear. Int. J. Food Microbiol. 164, 166-172. Lutz, M.C., Lopes, C.A., Sosa, M.C., Sangorrín, M.P., 2012. A new improved strategy  for the selection of cold-adapted antagonist yeasts to control postharvest pear diseases. Biocontrol Sci. Technol. 22, 1465-1483. Manso, T., Nunes, C., 2011. Metschnikowia andauensis as a new biocontrol agent of fruit  postharvest diseases. Postharvest Biol. Technol. 61, 64-71. Mari, M., Bautista-Baños, Sivakumar, D., 2016. Decay control in the postharvest system:    162 Role of microbial and plant volatile organic compounds. Postharvest Biol. Technol. 122, 70-81. Mari, M., Martini, C., Spadoni, A., Rouissi, W., Bertolini, P., 2012. Biocontrol of apple  postharvest decay by Aureobasidium pullulans. Postharvest Biol. Technol. 73, 56-62. Martín-Diana, A.B., Rico, D., Frías, J.M., Barat, J.M., Henehan, G.T.M., Barry-Ryan, C.,  2007. Calcium for extending the shelf life of fresh whole and minimally processed fruits and vegetables: a review. Trends Food Sci. Technol. 18, 210-218. Mavrodi, D.V., Blankenfeldt, W., Thomashow, L.S., 2006. Phenazine compounds in  fluorescent Pseudomonas spp. biosynthesis and regulation. Annu. Rev. Phytopathol. 44, 417-445. Mercier, J., Jiménez, J.I., 2003. Control of fungal decay of apples and peaches by the  biofumigant fungus Muscodor albus. Postharvest Biol. Technol. 31, 1-8. Michailides, T.J., Guo, L.Y., Morgan, D.P., 1997. Factors affecting zygosporogenesis in  Mucor piriformis and Gilbertella persicaria. Mycologia, 89, 603-609. Michailides, T.J., Ogawa, J.M., 1987a. Colonization, sporulation, and persistence of  Mucor piriformis in unamended and amended orchard soil. Phytopathol. 77, 257-261. Michailides, T.J., Ogawa, J.M., 1987b. Effect of soil temperature and moisture on the  survival of Mucor piriformis. Phytopathol. 77, 251-256. Michailides, T.J., Ogawa, J.M., 1989. Effects of high temperatures on the survival and  pathogenicity of propagules of Mucor piriformis. Phytopathol. 79, 547-554. Michailides, T.J., Spotts, R.A., 1986. Factors affecting dispersal of Mucor piriformis in  pear orchards and into the packinghouse. Plant Dis. 70, 1060-1063. Michailides, T.J., Spotts, R.A., 1988. Germination of zygospores of Mucor piriformis (on    163 the life history of Mucor piriformis). Mycologia 80, 837-844. Michailides, T.J., Spotts, R.A., 1990a. Postharvest diseases of pome and stone fruits  caused by Mucor piriformis in the Pacific Northwest and California. Plant Dis. 74, 287-291. Michailides, T.J., Spotts, R.A., 1990b. Transmission of Mucor piriformis to fruit of  Prunus persica by Carpophilus spp. and Drosophila melanogaster. Plant Dis. 74, 537-543. Mikani, A., Etebarian, H.R., Sholberg, P.L., O’Gorman, D.T., Stokes, S., Alizadeh, A.,  2008. Biological control of apple gray mold caused by Botrytis mali with Pseudomonas fluorescens strains. Postharvest Biol. Technol. 48, 107-112. Mikiciński, A., Sobiczewski, P., Pulawska, J., Maciorowski, R., 2016. Control of fire  blight (Erwinia amylovora) by a novel strain 49M of Pseudomonas graminis from the phyllosphere of apple (Malus spp.). Eur. J. Plant Pathol. 145, 265- 276. Molloy, C., Cheah, L., Koolaard, J., 2004. Induced resistance against Scleortinia  sclerotiorum in carrots treated with enzymatically hydrolysed chitosan. Postharvest Biol. Technol. 33, 61-65. Moreira, R.R., Nesi, C.N., De Mio, L.L.M., 2014. Bacillus spp. and Pseudomonas putida  as inhibitors of the Colletotrichum acutatum group and potential to control Glomerella leaf spot. Biol. Control 72, 30-37. Morris, L.A., Evans, J., Marchesi, J.R., 2012. A robust plate assay for detection of  extracellular microbial protease activity in metagenomic screens and pure cultures. J. Microbiol. Methods 91, 144-146. Nelson, L.M., Nagel, C., Bose-Roberts, N., Mantyka, D., Hirkala, D., Sholberg, P.L.,    164 2011. Characterization of cold-adapted rhizobacteria for control of postharvest fungal decay of pome fruit. Acta Hort. 905, 181-188. Nunes, C., Usuall, J., Teixidó, N., Fons, E., Viñas, I., 2002. Post-harvest biological  control by Pantoea agglomerans (CPA-2) on Golden Delicious apples. J. Appl. Microbiol. 92, 247-255. OMAFRA, 2016. Harvesting and handling apples. http://www.omafra.gov.on.ca/english/  crops/facts/00-003.htm (accessed 27.01.17). OMAFRA Ambrosia, 2009. Commercial production of Ambrosia apples in Ontario.  http://www.omafra.gov.on.ca/english/crops/facts/09-041.htm (accessed 21.01.18). O’Sullivan, D.J., O’Gara, F., 1992. Traits of fluorescent Pseudomonas spp. involved in  suppression of plant root pathogens. Microbiol. Rev. 56, 662-676. Pal, K.K., Gardener, B.M., 2006. Biological control of plant pathogens. The Plant Health Instructor DOI: 10.1094/PHI-A-2006-1117-02. Palou, L., Smilanick, J.L., Usall, J., Viñas, I., 2001. Control of postharvest blue and green  molds of oranges by hot water, sodium carbonate, and sodium bicarbonate. Plant Dis. 85, 371-376. Panebianco, A., Castello, I., Cirvilleri, G., Perrone, G., Epifani, F., Ferrara, M., Polizzi,  G., Walters, D.R., Vitale, A., 2015a. Detection of Botrytis cinerea field isolates with multiple fungicide resistance from table grape in Sicily. Crop Prot. 77, 65-73. Panebianco S., Vitale A., Polizzi G., Scala F., Cirvilleri G., 2015b. Enhanced control of  postharvest citrus fruit decay by means of the combined use of compatible biocontrol agents. Biol. Control 84, 19-27. Peighami-Ashnaei, S., Sharifi-Tehrani, A., Ahmadzadeh, M., Behboudi, K., 2009.    165 Interaction of different media on production and biocontrol efficacy of Pseudomonas fluorescens P-35 and Bacillus subtilis B-3 against grey mould of apple. J. Plant Pathol. 91, 65-70. Piano, S., Neyrottie, V., Migheli, Q., Gullino, M.L., 1997. Biocontrol capability of  Metschnikowia pulcherrima against Botrytis postharvest rot of apple. Postharvest Biol. Technol. 11, 131-140. Poppe, L., Vanhoutte, S., Höfte, M., 2003. Modes of action of Pantoea agglomerans  CPA-2, an antagonist of postharvest pathogens on fruits. Eur. J. Plant Pathol. 109, 963-973. Porat, R., Vinokur, V., Weiss, B., Cohen, L., Daus, A., Goldschmidt, E.E., Droby, S.,  2003. Induction of resistance to Penicillium digitatum in grapefruit by β-aminobutyric acid. European J. Plant Pathol. 109, 901-907. Prusky, D., 1996., Pathogen quiescence in postharvest diseases. Annu. Rev. Phytopathol.  34, 413-434. Prusky, D., Alkan, N., Mengiste, T., Fluhr, R., 2013. Quiescent and necrotrophic lifestyle  choice during postharvest disease development. Annu. Rev. Phytopathol. 51, 155-176. Pu, L., Jingfan, F., Kai, C., Chao-an, L., Yunjiang, C., 2014. Phenylethanol promotes  adhesion and biofilm formation of the antagonistic yeast Kloeckera apiculata for the control of blue mold of citrus. FEMS Yeast Res. 14, 536-546. Pujol, M., Badosa, E., Cabrefiga, J., Montesinos, E., 2005. Development of a strain- specific quantitative method for monitoring Pseudomonas fluorescens EPS62e, a novel biocontrol agent of fire blight. FEMS Microbiol. Lett. 249, 343-352.   166 Quaglia, M., Ederli, L., Pasqualini, S., Zazzerini, A., 2011. Biological control agents and  chemical inducers of resistance for postharvest control of Penicillium Link. on apple fruit. Postharvest Biol. Technol. 59, 307-315. Raaijmakers, J.M., Bonsall, R.F., Weller, D.M., 1999. Effect of population density of  Pseudomonas fluorescens on production of 2,4-diacetylphloroglucinol in the rhizosphere of wheat. Phytopathol. 89, 470-475.  Raaijmakers, J.M., Vlami, M., de Souza, J.T., 2002. Antibiotic production by bacterial  biocontrol agents. Antonie van Leeuwenhoek 81, 537-547. Raaijmakers, J.M., Weller, D.M., Thomashow, L.S., 1997. Frequency of antibiotic- producing Pseudomonas spp. in natural environments. Appl. Environ. Microbiol. 63, 881-887. Ramette, A., Frapolli, M., Defago, G., Moenne-Loccoz, Y., 2003. Phylogeny of HCN  synthase-encoding hcnBC genes in biocontrol fluorescent pseudomonads and its relationship with host plant species and HCN synthesis ability. Mol. Plant Microbe Interact. 16, 525-535. Renshaw, J.C., Halliday, V., Robson, G.D., Trinci, A.P.J., Wiebe, M.G., Livens, F.R.,  Collison, D., Taylor, R.J., 2003. Development and application of an assay for uranyl complexation by fungal metabolites, including siderophores. Appl. Environ. Microbiol. 69, 3600-3606. Renwick, A., Campbell, R., Coe, S., 1991. Assessment of in vivo screening systems for  potential biocontrol agents of Gaeumannoymces graminis. Plant Pathol. 40, 524- 532. Roberts, R.G., 1990. Biological control of Mucor rot of pears by Cryptococcus laurentii,    167 C. flavus and C. albidus. Phytopathol., 80, 1051. Romanazzi, G., and Feliziani, E., 2014. Botrytis cinerea (Gray mold), in: Bautista-Baños,  S. (Ed.), Postharvest Decay Control Strategies. Elsevier, USA, pp. 131-146. Rosenberger, D.A., 2014. Blue mold, in: Sutton, T.B., Aldwinckle, H.S., Agnello, A.M.,  Walgenbach, J.F. (Eds.), Compendium of Apple and Pear Diseases and Pests. American Phytopathological Society Press, St Paul, MN, pp. 76-77. Sanderson, P.G., Spotts, R.A., 1994. Postharvest decay of winter pear and apple fruit  caused by species of Penicillium. Phyopathol. 85, 103-110. Santoyo, G., Orozco-Mosqueda, M.D.C., Govindappa, M., 2012. Mechanisms of  biocontrol of plant growth-promoting activity in soil bacterial species of Bacillus and Pseudomonas: a review. Biocontrol Sci. Technol. 22, 855-872. Scuderi, G., Bonaccorsi, A., Panebianco, S., Vitale, A., Polizzi, G., Cirvilleri, G., 2009.  Some strains of Burkholderia gladioli are potential candidates for postharvest biocontrol of fungal rots in citrus and apple fruits. J. Plant Pathol. 91, 207-213. Selin, C., Habibian, R., Poritsanos, N., Athukorala, S.N.P., Fernando, D., de Kievit, T.R.,  2010. Phenazines are not essential for Pseudomonas chlororaphis PA23 biocontrol of Sclerotinia sclerotiorum, but do play a role in biofilm formation. FEMS Microbiol. Ecol. 71, 73-83. Sharma, R.R., Singh, D., Singh, R., 2009. Biological control of postharvest diseases of  fruits and vegetables by microbial antagonists: A review. Biol. Control 50, 205-221. Sholberg, P.L., Haag, P.D., 1996. Incidence of postharvest pathogens of stored apples in  British Columbia. Can. J. Plant Pathol. 18, 81-85. Sholberg, P.L., Owen, G.R., 1991. Populations of propagules of Mucor spp. during    168 immersion dumping of Anjou pears. Can. Plant Dis. Surv. 71, 33-35. Smilanick, J.L., Margosan, D.A., Mlikota, F., Usall, J., Michael, I.F., 1999. Control of  citrus green mold by carbonate and bicarbonate salts and the influence of commercial postharvest practices on their efficacy. Plant Dis. 83, 139-145. Smock, R.M., 1979. Controlled atmosphere storage of fruits. Hort. Rev. 1, 301-336. Spadaro, D., Ciavorella, A., Zhang, D., Garibaldi, A., Gullino, M.L., 2010. Effect of  culture media and pH on the biomass production and biocontrol efficacy of a Metshnikowia pulcherrima strain to be used as a biofungicide for postharvest disease control. Can. J. Microbiol. 56, 128-137. Spadaro, D., Droby, S., 2016. Development of biocontrol products for postharvest  diseases of fruit: The importance of elucidating the mechanisms of action of yeast  antagonists. Trends Food Sci. Tech. 47, 39-49. Spadaro, D., Garibaldi, A., Gullino, M.L., 2004. Control of Penicillium expansum and  Botrytis cinerea on apple combining a biocontrol agent with hot water dipping and acibenzolar-S-methyl, baking soda, or ethanol application. Postharvest Biol. Technol. 33, 141-151. Spadaro, D., Lorè, A., Garibaldi, A., Gullino, M.L., 2013. A new strain of Metschnikowia  fructicola for postharvest control of Penicillium expansum and patulin accumulation on four cultivars of apple. Postharvest Biol. Technol. 75, 1-8. Spotts, R.A., 2014. Mucor rot, in: Sutton, T.B., Aldwinckle, H.S., Agnello, A.M.,  Walgenbach, J.F. (Eds.), Compendium of Apple and Pear Diseases and Pests. American Phytopathological Society Press, St Paul, MN, pp. 80-81. Stockwell, V.O., Stack, J.P., 2007. Using Pseudomonas spp. for integrated biological    169 control. Phytopathol. 97, 244-249. Tedford, E.C., 2004. Scholar- A new broad spectrum postharvest fungicide for  pomefruits. http://postharvest.tfrec.wsu.edu/pc2004g.pdf (accessed 23.01.17). Terry, L.A., Joyce, D.C., 2004. Elicitors of induced disease resistance in postharvest  horticultural crops: a brief review. Postharvest Biol. Technol. 32, 1-13. Thomashow, L.S., Weller, D.M., 1990. Role of antibiotics and siderophores in biocontrol  of take-all disease of wheat. Plant Soil 129, 93-99. Thomashow, L.S., Weller, D.M., 1988. Role of phenazine antibiotic from Pseudomonas  fluorescens in biological control of Gaeumannomyces graminis var. tritici. J. Bacteriol. 170, 3499-3508. Tian, S.P., Fan, Q., Xu, Y., Jiang, A.L., 2002a. Effects of calcium on biocontrol activity  of yeast antagonists against the postharvest fungal pathogen Rhizopus stolonifer. Plant Pathol. 51, 352-358. Tian, S.P., Fan, Q., Xu, Y., Liu, H., 2002b. Biocontrol efficacy of antagonist yeasts to  gray mold and blue mold on apples and pears in controlled atmosphere. Plant Dis. 86, 848-853. Toivonen, P.M.A., Hampson, C.R., 2014. Relationship of IAD index to internal quality  attributes of apples treated with 1-methylcyclopropene and stored in air or controlled atmospheres. Postharvest Biol. Technol. 91, 90-95. Tolba, I.H., Soliman, M.A., 2013. Efficacy of native antagonistic bacterial isolates in  biological control of crown gall disease in Egypt. Ann. Agric. Sci. 58, 43-49. Tronsmo, A., Dennis, C., 1977. The use of Trichoderma species to control strawberry  fruit rots. Neth. J. Plant Pathol. 83, 449-455.   170 Upadhyay, A., Srivastava, S., 2011. Phenazine-1-carboxylic acid is a more important  contributor to biocontrol Fusarium oxysporum than pryrrolnitrin in Pseudomonas fluorescens strain Psd. Microbiol. Res. 166, 323-335. Usall, J., Smilanick, J., Palou, L., Denis-Arrue, N., Teixidó, N., Torres, R., Viñas, I.,  2008. Preventative and curative activity of combined treatments of sodium  carbonates and Pantoea agglomerans CPA-2 to control postharvest green mold of citrus fruit. Postharvest Biol. Control 50, 1-7. Van Wees, S.C., Pieterse, C.M., Trijssenaar, A., Van’t Westende, Y.A., Hartog, F., Van  Loon, L.C., 1997. Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Mol. Plant-Microbe Interact. 6, 716-724. Vero, S., Garmendia, G., González, M.B., Bentancur, O., Wisniewski, M., 2013.  Evaluation of yeasts obtained from Antarctic soil samples as biocontrol agents for the management of postharvest diseases of apple (Malus x domestica). FEMS Yeast Res. 13, 189-199. Vilanova, L., Viñas, I., Torres, R., Usall, J., Buron-Moles, G., Teixidó, N., 2014.  Increasing maturity reduces wound response and lignification processes against Penicillium expansum (pathogen) and Penicillium digitatum (non-host pathogen) infection in apples. Postharvest Biol. Technol. 88, 54-60. Vinay, J.U., Naik, M.K., Rangeshwaran, R., Chennappa, G., Shaikh, S.S., Sayyed, R.Z.,  2016. Detection of antimicrobial traits in fluorescent pseudomonads and molecular characterization of an antibiotic pyoluteorin. 3 Biotech 6, 1-11. Voisard, C., Keel, C., Haas, D., Défago, G., 1989. Cyanide production by Pseudomonas  fluorescens helps suppress black root rot of tobacco under gnotobiotic conditions.   171 EMBO J. 8, 351-358. Wallace, R.L., Hirkala, D.L., Nelson, L.M., 2016. Biological control of Botrytis cinerea,  Penicillium expansum, and Mucor piriformis on 'Gala' and 'McIntosh' apples using Pseudomonas fluorescens strains. Acta Hort. 1144, 113-120. Wallace, R.L., Hirkala, D.L., Nelson, L.M., 2017. Postharvest biological control of blue  mold of apple by Pseudomonas fluorescens during commercial storage and potential modes of action. Postharvest Biol. Technol. 133, 1-11. Wallace, R.L., Hirkala, D.L., Nelson, L.M., 2018. Mechanisms of action of three  isolates of Pseudomonas fluorescens active against postharvest grey mold decay of apple during commercial storage. Biol. Control 117, 13-20. Wang, C., Knill, E., Glick, B.R., Défago, G., 2000. Effect of transferring 1- aminocyclopropane-1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 and its gacA derivative CHA96 on their growth-promoting and disease-suppressive capacities. Can. J. Microbiol. 46, 898-907. Williamson, B., Tudzynski, B., Tudzynski, P., Van Kan, J.A.L., 2007. Botrytis cinerea:  the cause of grey mould disease. Molec. Plant Pathol. 8, 561-580. Wilson, C.L., Pusey, P.L., 1985. Potential for biological control of postharvest plant  diseases. Plant Dis. 69, 375-378. Wilson, C.L., Wisniewski, M.E., 1989. Biological control of postharvest diseases of fruits  and vegetables: An emerging technology. Annu. Rev. Phytopathol. 27, 425-441. Wisniewski, M., Biles, C., Droby, S., McLaughlin, R., Wilson, C., Chalutz, E., 1991.    172 Mode of action of the postharvest biocontrol yeast, Pichia guilliermondii. I Characterization of attachment to Botrytis cinerea. Physiol. Mol. Plant Pathol. 39, 245-258. Wisniewski, M., Droby, S., Chalutz, E., Eilam, Y., 1995. Effect of Ca2+ and Mg2+ on  Botrytis cinerea and Penicillium expansum in vitro and on the biocontrol activity of Candida oleophila. Plant Pathol. 44, 1016-1024. Wisniewski, M., Droby, S., Norelli, J., Liu, J., Schena, L., 2016. Alternative management  technologies for postharvest disease control: The journey from simplicity to complexity. Postharvest Biol. Technol. 122, 3-10. WSU Postharvest Information Network, 2017. Practices to minimize decay of apples and  pears. http://postharvest.tfrec.wsu.edu/pages/N7I3B (accessed 30.01.17). Xiao, C.L., 2014. Gray mold, in: Sutton, T.B., Aldwinckle, H.S., Agnello, A.M.,  Walgenbach, J.F. (Eds.), Compendium of Apple and Pear Diseases and Pests. American Phytopathological Society Press, St Paul, MN, pp. 77-78. Xiao, C.L., Boal, R.J., 2013. Biological control of Phacidiopycnis rot in ‘d’Anjou’  pear. Acta Hort. 1001, 255-258. Xu, X.M., Berrie, A.M., 2005. Epidemiology of mycotoxigenic fungi associated with  Fusarium ear blight and apple blue mould: A review. Food Addit. Contam. 22, 290-310. Yu, T., Chen, J., Chen, R., Huang, B., Liu, D., Zheng, X., 2007. Biocontrol of blue and  gray mold diseases of pear fruit by integration of antagonistic yeast with salicylic acid. Int. J. Food Microbiol. 116, 339-345. Yu, T., Chen, J., Lu, H., Zheng, X., 2008a. Indole-3-acetic acid improves postharvest    173 biological control of blue mold rot of apple by Cryptococcus laurentii. Phytopathol. 99, 259-264. Yu, T., Wang, L., Yin, Y., Wang, Y., Zheng, X., 2008b. Effect of chitin on the  antagonistic activity of Cryptococcus laurentii against Penicillium expansum in pear fruit. Int. J. Food Microbiol. 122, 44-48. Yu, T., Yu, C., Lu, H., Zunun, M., Chen, F., Zhou, T., Sheng, K., Zheng, X., 2012. Effect  of Cryptococcus laurentii and calcium chloride on control of Penicillium expansum and Botrytis cinerea infections in pear fruit. Biol. Control 61, 169-175. Yu, T., Zheng, X.D., 2006. Salicylic acid enhances biocontrol efficacy of the antagonist  Cryptococcus laurentii in apple fruit. J. Plant Growth Regul. 25, 166-174. Zhang, D., Spadaro, D., Garibaldi, A., Gullino, M.L., 2011. Potential biocontrol activity  of a strain of Pichia guilliermondii against grey mold of apples and its possible modes of action. Biol. Control 57, 193-201. Zhou, J.Y., Zhao, X.Y., Dai, C.C., 2014a. Antagonistic mechanisms of endophytic  Pseudomonas fluorescens against Athelia rolfsii. J. Appl. Microbiol. 117, 1144-1158. Zhou, T., Chu, C.L., Liu, W.T., Schaneider, E., 2001. Postharvest control of blue mold  and grey mold of apples using isolates of Pseudomonas syringae. Can. J. Plant Pathol. 23, 246-252. Zhou, Y., Ming, J., Deng, L., Zeng, K., 2014b. Effect of Pichia membranaefaciens in  combination with salicylic acid on postharvest blue and green mold decay in citrus fruits. Biol. Control 74, 21-29.    174 Appendices Appendix A: Culture Media Recipes  Half strength- Tryptic soy agar (½ TSA)  15.0 g of tryptic soy broth (TSB) 15.0 g of agar 1,000 ml of water  Half strength- Tryptic soy broth (½ TSB)  15.0 g of TSB 1,000 ml of water  Half strength- Potato dextrose agar (½ PDA) 12.0 g of potato dextrose broth (PDB) 15.0 g of agar 1,000 ml of water  Half strength- Potato dextrose broth (½ PDB) 12.0 g of PDB 1,000 ml of water  Quarter strength- ¼ TSA/PDA 7.5 g of TSB 6.0 g of PDB   175 15.0 g of agar 1,000 ml of water  0.5% Colloidal chitin agar 5.0 g of chitin 7.0 g of (NH4)2SO4  1.0 g of K2HPO4  0.1 g of MgSO4.7H2O  0.5 g of TSB  15.0 g of agar 1,000 ml of water  1.0% Skim milk agar 10.0 g of skim milk powder 5.0 g of TSB 15.0 g of agar 1,000 ml of water  1.0% Cellulose-amended medium 10.0 g of cellulose 5.0 g of TSB 15.0 g of agar 1,000 ml of water   176 0.5% Laminarin-amended medium 5.0 g of laminarin 5.0 g of TSB 15.0 g of agar 1,000 ml of water  ¼ TSA/PDA amended with P. fluorescens CFS 7.5 g of TSB 6.0 g of PDB 15.0 g of agar 500 ml of P. fluorescens isolates 1-112, 2-28, or 4-6 CFS 500 ml of water    177 Appendix B: P. fluorescens Standard Calibration Curves   Figure B.1 Standard calibration curve for the microbial antagonist P. fluorescens isolate 1-112 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Nelson lab, 2007).     178  Figure B.2 Standard calibration curve for the microbial antagonist P. fluorescens isolate 2-28 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Wallace, 2014).   Undiluted1/21/41/101/501/100y = 2E-10x + 0.0917R² = 0.9823800.20.40.60.811.21.41.61.80 2E+09 4E+09 6E+09 8E+09OD 600 nmCFU/mL  179  Figure B.3 Standard calibration curve for the microbial antagonist P. fluorescens isolate 4-6 illustrating the relationship between absorbance at 600 nm and the log CFU/mL (Nelson lab, 2007).    180 Appendix C: Apple Starch Assessments   Figure C.1 Iodine solution preparation procedure (BCTFC, 2006).    181  Figure C.2 ‘Ambrosia’ apple starch chart (BCTFC, 2006).  2 0 0 6  O k a n a g a n  T r e e  F r u i t  C o m p a n y  A M B R O S I A G D  G D  B a s e d  o n  t h e  G o l d e n  D e l i c i o u s  S t a r c h  C h a r t  Procedure: Cut 5 apples and apply the iodine solution. Harvest Window Starts @ 3 of 5 apples with #2.5 on AmbrosiaGD chart Starch Movement: 1.2 to 2.0 units per week  A Category- 3 or more apples #3.0 or less on AmbrosiaGD starch chart  B Category- 3 or more apples #4.2 or less on AmbrosiaGD starch chart  C Category- Not “A” or “B” Category P r o d u c e d  B y :  Q u a l i t y  D e v e l o p m e n t ,  O k a n a g a n  T r e e  F r u i t  C o m p a n y     182  Figure C.3 ‘Royal Gala’ apple starch chart (BCTFC, 2011).  2 0 1 1  O k a n a g a n  T r e e  F r u i t  C o o p e r a t i v e  2011+Starch+Charts Created by Quality Development 27/09/11   R O Y A L  G A L A   Procedure: Cut 10 apples and apply the iodine solution. Harvest Window Starts @ 6 of 10 apples with #2.5 on Gala chart Starch Movement: 1.0 to 1.5 units per week “The risk of cracking increases significantly over a starch reading of 4.” A Category All lots on or before A Category Cutoff Date by Lot Maturity Area. ABC Category All lots on or before ABC Category Cutoff Date by Lot Maturity Area.    ~ A Category:  Average starch less than 4.5*   ~ B Category:  Average starch greater than or equal to 4.5* and less than 5.5*   ~ C Category: Average starch greater than or equal to 5.5* C Category All lots on or before C Category Cutoff Date by Lot Maturity Area. L Category All lots after C Category Cutoff Date by Lot Maturity Area. Minimum Colour Standard:  Extra Fancy 1: 50% #4 + 25% #2  Extra Fancy: 35% #2  Fancy: 25%#2     183  Figure C.4 ‘McIntosh’ apple starch chart (BCTFC, 2011).  2 0 1 1  O k a n a g a n  T r e e  F r u i t  C o o p e r a t i v e  2011+Starch+Charts Created by Quality Development 27/09/11    M c I N T O S H  Procedure: Cut 10 apples and apply the iodine solution. Harvest Window Starts @ 6 of 10 apples with #2.5 on McIntosh chart Starch Movement: 0.6 to 0.8 units per week A Category All lots on or before A Category Cutoff Date by Lot Maturity Area. ABC Category All lots on or before ABC Category Cutoff Date by Lot Maturity Area.    ~ A Category:  Average starch less than 4.0*   ~ B Category:  Average starch greater than or equal to 4.0* and less than 5.0*   ~ C Category: Average starch greater than or equal to 5.0* C Category All lots on or before C Category Cutoff Date by Lot Maturity Area. Minimum Colour Standard:  Fancy: 30% #4                                184  Figure C.5 ‘Spartan’ apple starch chart (BCTFC, 2011).2 0 1 1  O k a n a g a n  T r e e  F r u i t  C o o p e r a t i v e  2011+Starch+Charts Created by Quality Development 27/09/11    S P A R T A N  Procedure: Cut 10 apples and apply the iodine solution. Harvest Window Starts @ 6 of 10 apples with #2.5 on Spartan chart Starch Movement: 0.5 to 1.0 units per week A Category All lots on or before A Category Cutoff Date by Lot Maturity Area. ABC Category All lots on or before ABC Category Cutoff Date by Lot Maturity Area.    ~ A Category:  Average starch less than 3.0*   ~ B Category:  Average starch greater than or equal to 3.0* and less than 4.0*   ~ C Category: Average starch greater than or equal to 4.0* C Category All lots on or before C Category Cutoff Date by Lot Maturity Area. L Category All lots after C Category Cutoff Date by Lot Maturity Area. Minimum Colour Standard:  Extra Fancy: 65% #6  Fancy: 30% #4      185 Appendix D: Supplementary Commercial Storage Data  Physiological Fruit Quality Data 2014-17  Table D.1 Physiological fruit quality characteristics of apples prior to commercial cold storage, 2014-15. Cultivar Weight (g)a Firmness (Ibs)a Starch Index a Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 214 ± 9 ac 17.5 ± 0.4 a 4.7 ± 0.3 b 14.5 ± 0.2 a 0.53 ± 0.02 b McIntosh 172 ± 9 b 16.9 ± 0.4 a 3.8 ± 0.3 bc 10.8 ± 0.4 c 0.63 ± 0.02 a Spartan 194 ± 11 ab 15.5 ± 0.2 b 3.5 ± 0.2 c 11.8 ± 0.3 c 0.51 ± 0.01 b Ambrosia 216 ± 8 a 17.3 ± 0.3 a 6.6 ± 0.3 a 13.1 ± 0.3 b 0.33 ± 0.01 c aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples.  bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.    Table D.2 Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2014-15. Cultivar Weight (g) a Firmness (Ibs)a Starch Indexa Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 214 ± 10 abc 13.3 ± 0.2 a 9 ± 0 a 14.3 ± 0.2 a 0.36 ± 0.01 b McIntosh 172 ± 11 c 8.6 ± 0.2 b 9 ± 0 a 11.9 ± 0.2 c 0.44 ± 0.01 a Spartan 184 ± 8 bc 8.9 ± 0.1 b 9 ± 0 a 14.2 ± 0.3 a 0.40 ± 0.02 ab Ambrosia 225 ± 10 a 12.6 ± 0.3 a 9 ± 0 a 12.8 ± 0.2 b 0.21 ± 0.01 c aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples. bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.      186 Table D.3 Physiological fruit quality characteristics of apples prior to commercial storage, 2015-16. Cultivar Weight (g)a Firmness (Ibs)a Starch Indexa Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 189 ± 6 abc 17.7 ± 0.3 b 5.9 ± 0.3 a 13.1 ± 0.3 b 0.36 ± 0.01 c McIntosh 167 ± 8 b 16.3 ± 0.3 c 4.6 ± 0.2 b 14.2 ± 0.3 a 0.83 ± 0.02 a Spartan 204 ± 13 a 16.6 ± 0.4 bc 3.1 ± 0.1 c 13.7 ± 0.4 ab 0.50 ± 0.02 b Ambrosia 183 ± 10 ab 19.9 ± 0.3 a 6.0 ± 0.3 a 13.1 ± 0.1 b 0.31 ± 0.01 c aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples.  bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.  Table D.4 Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2015-16. Cultivar Weight (g)a Firmness (Ibs)a Starch Indexa Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 203 ± 7 ac 12.8 ± 0.4 b 9 ± 0 a 12.9 ± 0.2 c 0.30 ± 0.01 c McIntosh 157 ± 7 b 10.0 ± 0.2 c 9 ± 0 a 14.2 ± 0.2 ab 0.60 ± 0.02 a Spartan 190 ± 10 a 8.6 ± 0.2 d 9 ± 0 a 14.4 ± 0.2 a 0.39 ± 0.01 b Ambrosia 155 ± 6 b 15.3 ± 0.4 a 9 ± 0 a 13.6 ± 0.1 bc 0.18 ± 0.01 d  aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples. bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.  Table D.5 Physiological fruit quality characteristics of apples prior to commercial storage, 2016-17. Cultivar Weight (g)a Firmness (Ibs)a Starch Indexa Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 198 ± 12 abc 18.0 ± 0.3 a  4.4 ± 0.5 a 10.2 ± 0.3 c  0.34 ± 0.01 b McIntosh 162 ± 9 b 14.7 ± 0.3 b  4.3 ± 0.3 a 13.2 ± 0.3 a  0.51 ± 0.01 a Spartan 250 ± 12 a 14.6 ± 0.3 b 2.1 ± 0.3 b 12.3 ± 0.2 b 0.51 ± 0.02 a Ambrosia 249 ± 21 a 17.2 ± 0.3 a 3.4 ± 0.5 ab 12.0 ± 0.2 b 0.33 ± 0.01 b aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples.  bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.   187 Table D.6 Physiological fruit quality characteristics of apples after 15 weeks commercial cold storage, 2016-17. Cultivar Weight (g)a Firmness (Ibs)a Starch Indexa Total soluble solids (%)a Titratable acidity (% malic acid)b Gala 225 ± 14 ac 14.1 ± 0.3 a  9 ± 0 a 12.4 ± 0.3 c  0.34 ± 0.01 McIntosh 161 ± 12 b 9.0 ± 0.3 c  9 ± 0 a 11.9 ± 0.2 c  0.35 ± 0.01  Spartan 247 ± 9 a 9.4 ± 0.2 c  9 ± 0 a 15.4 ± 0.3 a  0.35 ± 0.01 Ambrosia 243 ± 20 a 12.6 ± 0.4 b  9 ± 0 a 13.7 ± 0.4 b  0.20 ± 0.01 aWeight, firmness, starch and total soluble solids are the means ± the standard error of the means from 10 apples. bTitratable acidity data is the mean ± the standard error of 12 apples or 4 replicates.  cMeans followed by a common letter within a column are not significantly (P < 0.05) different according to Tukey's test.      Commercial Cold Storage Data 2014-17  Table D.7 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2014-15. *      B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 71.6 ± 0.0 a 100.00 ± 0.0 a 39.1 ± 7.7 a 55.0 ± 10.4 ab - - P. fluorescens 1-112 37.4 ± 3.4 ab 53.3 ± 0.0 b 34.2 ± 10.4 ab 48.3 ± 14.8 ab - - P. fluorescens 2-28 32.9 ± 6.6 b 46.7 ± 0.0 b 42.2 ± 6.0 a 59.2 ± 8.0 a - - P. fluorescens 4-6 15.2 ± 4.7 b 21.7 ± 6.7 bc 6.4 ± 3.2 b 10.0 ± 5.0 b - - BioSave® 19.1 ± 4.4 b 26.7 ± 6.0 b 15.4 ± 1.1 ab 21.7 ± 1.7 ab - - Scholar® 2.4 ± 2.4 c 3.3 ± 3.3 c 11.9 ± 6.3 ab 16.7 ± 8.8 ab - - aLD= Lesion diameter. DI= Disease incidence. bNo disease was observed in the control fruit, so no analyses were performed on this data set. *Each value represents the mean of three replicates of 10 apples each ± standard error.     188 Table D.8 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 1.4 ± 1.1 8.3 ± 6.0 P. fluorescens 1-112 0.6 ± 0.6 1.7 ± 1.7 P. fluorescens 2-28 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 4-6 0.0 ± 0.0 0.0 ± 0.0 BioSave® 0.1 ± 0.1  1.7 ± 1.7 Scholar® 0.0 ± 0.0 0.0 ± 0.0 aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note these data have been excluded from the thesis due to extremely low disease incidence in the control fruit. No data analysis was performed due to the lack of disease.  Table D.9 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Gala' apples after 15 weeks in commercial storage at 0°C, 2016-17.*       P. expansum Treatment LDa (mm) DIa (%) Control 0.4 ± 0.2 3.3 ± 1.7 P. fluorescens 1-112 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 2-28 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 4-6 0.0 ± 0.0 0.0 ± 0.0 BioSave® 0.0 ± 0.0 0.0 ± 0.0 Scholar® 0.0 ± 0.0 0.0 ± 0.0 aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note these data have been excluded from the thesis due to extremely low disease incidence in the control fruit. No data analysis was performed due to the lack of disease.    189 Table D.10 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2014-15.*       B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 76.7 ± 0.0 a 100.0 ± 0.0 a 32.1 ± 4.8 a 50.0 ± 10.0 a - - P. fluorescens 1-112 49.5 ± 10.8 a 68.3 ± 13.6 a 3.2 ± 3.0 a 5.0 ± 2.9 a - - P. fluorescens 2-28 57.6 ± 1.8 a 83.3 ± 1.7 a 2.8 ± 1.5 a 10.0 ± 5.0 a - - P. fluorescens 4-6 55.9 ± 9.2 a 75.0 ± 11.5 a 17.4 ± 13.8 a 25.0 ± 18.0 a - - BioSave® 58.9 ± 8.7 a 81.7 ± 10.1 a 6.8 ± 2.1 a 11.7 ± 1.7 a - - Scholar® 2.6 ± 2.6 b 3.3 ± 3.3 b 4.2 ± 3.5 a 8.3 ± 6.0 a - - aLD= Lesion diameter. DI= Disease incidence. bNo disease was observed in the control fruit, so no analyses were performed on this data set. *Each value represents the mean of three replicates of 10 apples each ± standard error.    Table D.11 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2015-16. *      P. expansum Treatment LDa (mm) DIa (%) Control 13.4 ± 3.6 a 38.3 ± 7.3 a P. fluorescens 1-112 1.3 ± 1.3 c 3.3 ± 3.3 c P. fluorescens 2-28 7.4 ± 0.4 ab 26.7 ± 1.7 ab P. fluorescens 4-6 4.1 ± 1.4 bc 10.0 ± 2.9 bc BioSave® 1.1 ± 0.6 c 6.7 ± 4.4 bc Scholar® 0.4 ± 0.4 c 1.7 ± 1.7 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.     190 Table D.12 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'McIntosh' apples after 15 weeks in commercial storage at 0°C, 2016-17. *      P. expansum Treatment LDa (mm) DIa (%) Control 1.9 ± 0.6 6.7 ± 1.7 P. fluorescens 1-112 0.2 ± 0.2 1.7 ± 1.7 P. fluorescens 2-28 0.1 ± 0.1 1.7 ± 1.7 P. fluorescens 4-6 1.9 ± 1.3 5.0 ± 2.9 BioSave® 0.6 ± 0.3 6.7 ± 3.3 Scholar® 0.3 ± 0.3 3.3 ± 3.3 aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note these data have been excluded from the thesis due to extremely low disease incidence in the control fruit. No data analysis was performed due to the lack of disease.   Table D.13 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2014-15. *      B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 17.9 ± 2.4 a 28.3 ± 1.7 a 33.7 ± 5.6 a 45.0 ± 7.6 a - - P. fluorescens 1-112 3.1 ± 2.3 b 5.0 ± 2.9 b 5.3 ± 2.6 ab 8.3 ± 4.4 ab - - P. fluorescens 2-28 3.4 ± 2.4 b 8.3 ± 4.4 ab 2.5 ± 2.5 b 3.3 ± 3.3 b - - P. fluorescens 4-6 0.2 ± 0.2 b 1.7 ± 1.7 b 0.1 ± 0.1 b 1.7 ± 1.7 b - - BioSave® 0.5 ± 0.1 b 11.7 ± 4.4 ab 2.1 ± 1.8 b 10.0 ± 5.8 ab - - Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 b 12.6 ± 9.1 ab 16.7 ± 12.0 ab - - aLD= Lesion diameter. DI= Disease incidence. bNo disease was observed in the control fruit, so no analyses were performed on this data set. *Each value represents the mean of three replicates of 10 apples each ± standard error.     191 Table D.14 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 18.8 ± 1.9 a 41.7 ± 6.0 a P. fluorescens 1-112 5.7 ± 3.3 ab 13.3 ± 6.0 b P. fluorescens 2-28 2.1 ± 0.1 b 5.0 ± 0.0 bc P. fluorescens 4-6 6.6 ± 4.0 ab 20.0 ± 7.6 ab BioSave® 2.7 ± 0.6 b 8.3 ± 1.7 bc Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.     Table D.15 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Spartan' apples after 15 weeks in commercial storage at 0°C, 2016-17.*       P. expansum Treatment LDa (mm) DIa (%) Control 17.4 ± 4.3 a 42.6 ± 10.3 a P. fluorescens 1-112 6.1 ± 1.2 ab 18.7 ± 4.1 ab P. fluorescens 2-28 2.6 ± 0.2 bc 11.7 ± 1.7 ab P. fluorescens 4-6 6.3 ± 3.4 b 20.0 ± 12.6 ab BioSave® 0.7 ± 0.6 bc 6.7 ± 4.4 b Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 b aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.       192 Table D.16 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, M. piriformis, and P. expansum, on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2014-15. *      B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 77.1 ± 0.0 a 100.00 ± 0.0 a 45.6 ± 0.6 ab 60.0 ± 0.0 b 12.1 ± 6.0 20.0 ± 8.7  P. fluorescens 1-112 27.9 ± 6.8 b 38.3 ± 8.8 b 40.2 ± 8.9 ab 53.3 ± 11.7 b 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 2-28 31.2 ± 4.8 b 41.7 ± 7.3 b 52.1 ± 3.0 ab 68.3 ± 4.4 b 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 4-6 29.7 ± 12.2 b 41.7 ± 14.2 b 30.6 ± 8.4 b 43.3 ± 12.0 b 0.0 ± 0.0 0.0 ± 0.0 BioSave® 24.3 ± 4.3 b 55.0 ± 11.5 b 73.3 ± 2.0 a 98.3 ± 1.7 a 3.9 ± 0.8 36.7 ± 10.9 Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 c 2.2 ± 1.7 c 6.7 ± 3.3 c 0.5 ± 0.3 5.0 ± 2.9 aLD= Lesion diameter. DI= Disease incidence. bData were not included in the thesis for this pathogen due to low disease incidence in the control fruit. No data analysis was performed due to the lack of disease. *Each value represents the mean of three replicates of 10 apples each ± standard error.   Table D.17 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 21.9 ± 6.7 a 48.3 ± 10.9 a P. fluorescens 1-112 - - P. fluorescens 2-28 - - P. fluorescens 4-6 2.9 ± 1.5 bc 10.0 ± 5.0 b BioSave® 8.2 ± 1.3 ab 71.7 ± 3.3 a Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 b aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note fruit were not treated with isolate 1-112 and 2-28 in this experiment and as a result these data were not included in the thesis.    193 Table D.18 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen P. expansum on 'Ambrosia' apples after 15 weeks in commercial storage at 0°C, 2016-17. *     P. expansum Treatment LDa (mm) DIa (%) Control 39.2 ± 3.9 a 85.0 ± 2.9 ab P. fluorescens 1-112 24.0 ± 3.1 ab 58.3 ± 4.4 b P. fluorescens 2-28 20.1 ± 10.1 ab 78.3 ± 8.8 ab P. fluorescens 4-6 36.1 ± 10.2 a 75.0 ± 11.5 ab BioSave® 31.3 ± 1.8 a 96.7 ± 1.7 a Scholar® 0.9 ± 0.4 b 3.3 ± 1.7 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.                       194 Commercial Cold Storage Data- Low Dose Chemical Trials 2015-17  Table D.19 Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'Ambrosia' apples after 15 weeks in cold storage at 0°C, 2015-16.*      B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 42.7 ± 2.8 a 70.0 ± 5.8 a 46.3 ± 4.0 a 71.7. ± 6.7 ab 1.7 ± 1.0 3.3 ± 1.7  4-6  1.1 ± 1.1 b 1.7 ± 1.7 b 19.9 ± 2.6 ab 35.0 ± 5.8 bc 0.0 ± 0.0 0.0 ± 0.0  4-6 + CaCl2 0.5 ± 0.5 b 3.3 ± 3.3 b 21.5 ± 5.8 ab 33.3 ± 8.8 bc 0.0 ± 0.0 0.0 ± 0.0  4-6 + SBC 0.0 ± 0.0 b 0.0 ± 0.0 b 21.6 ± 3.7 ab 40.0 ± 5.0 abc 0.0 ± 0.0 0.0 ± 0.0  4-6 + SA 2.2 ± 2.2 b 3.3 ± 3.3 b 9.1 ± 4.7 b 16.7 ± 7.3 c 0.0 ± 0.0 0.0 ± 0.0 CaCl2 2.2 ± 2.2 b 3.3 ± 3.3 b 15.5 ± 4.5 ab 25.0 ± 7.6 c 0.0 ± 0.0 0.0 ± 0.0 SBC 0.0 ± 0.0 b 0.0 ± 0.0 b 10.0 ± 6.0 b 21.7 ± 7.3 c 0.0 ± 0.0 0.0 ± 0.0 SA 5.5 ± 2.9 b 10.0 ± 5.8 b 9.4 ± 5.2 b 30.0 ± 10.4 c 0.0 ± 0.0 0.0 ± 0.0 BioSave® 37.6 ± 6.5 a 76.7 ± 9.3 a 25.4 ± 3.8 ab 78.3 ± 6.0 a 5.0 ± 0.4 63.3 ± 4.4 Scholar® 0.3 ± 0.3 b 5.0 ± 5.0 b 5.6 ± 3.6 b 16.7 ± 1.7 c 0.3 ± 0.3 5.0 ± 5.0 aLD= Lesion diameter. DI= Disease incidence. bData were not analyzed due to low incidence of disease in the control fruit. *Each value represents the mean of three replicates of 10 apples each ± standard error.                195 Table D.20 Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'Ambrosia' apples after 15 weeks in cold storage at 0°C, 2016-17.*      B. cinereab M. piriformis P. expansum Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control - - 78.9 ± 3.1 ab 86.7 ± 1.7 abc 27.4 ± 4.0 a 65.0 ± 7.6 a  4-6  - - 80.9 ± 1.6 a 86.7 ± 1.7 abc 11.6 ± 3.2 bcd 33.3 ± 10.9 bc  4-6 + CaCl2 - - 72.2 ± 5.3 abc 81.7 ± 3.3 bcd 10.5 ± 3.1 bcd 31.7 ± 6.7 bc  4-6 + SBC - - 44.3 ± 1.4 d 51.7 ± 1.7 e 4.2 ± 1.3 de 15.0 ± 5.0 cd  4-6 + SA - - 80.3 ± 1.2 a 88.3 ± 1.7 abc 8.0 ± 2.8 cd 31.7 ± 6.0 bc CaCl2 - - 50.1 ± 7.7 cd 63.3 ± 9.3 cde 4.8 ± 0.7 cde 16.7 ± 1.7 c SBC - - 52.1 ± 6.8 cd 60.0 ± 5.8 de 13.9 ± 1.8 abc 41.7 ± 4.4 abc SA - - 86.0 ± 2.8 a 96.7 ± 1.7 a 22.1 ± 0.5 ab 53.3 ± 1.7 ab BioSave® - - 57.6 ± 4.6 bcd 96.7 ± 3.3 ab 8.3 ± 0.6 cd 66.7 ± 4.4 a Scholar® - - 38.3 ± 4.6 d 41.7 ± 4.4 e 0.2 ± 0.2 e 1.7 ± 1.7 d aLD= Lesion diameter. DI= Disease incidence. bControl fruit were not wounded, thus no diseased developed. *Each value represents the mean of three replicates of 10 apples each ± standard error.                  196 Table D.21 Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'McIntosh' apples after 15 weeks in cold storage at 0°C, 2015-16.*      B. cinerea M. piriformis P. expansum Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 32.4 ± 4.2 a 51.7 ± 9.3 a 15.6 ± 4.5 ab 25.0 ± 7.6 abc 3.6 ± 2.4 ab 16.7 ± 10.1 a  4-6  0.8 ± 0.8 b 1.7 ± 1.7 b 2.3 ± 2.3 bc 5.0 ± 5.0 bcd 5.1 ± 0.8 a 10.0 ± 0.0 a  4-6 + CaCl2 4.7 ± 4.7 b 6.7 ± 6.7 b 3.0 ± 1.9 bc 5.0 ± 2.9 bcd 0.8 ± 0.1 ab 5.0 ± 0.0 a  4-6 + SBC 7.7 ± 4.8 b 13.3 ± 8.8 ab 2.2 ± 2.2 bc 3.3 ± 3.3 cd 1.5 ± 0.5 ab 5.0 ± 0.0 a  4-6 + SA 15.1 ± 4.7 ab 25.0 ± 7.6 ab 10.0 ± 5.0 abc 15.0 ± 7.6 abcd 2.2 ± 0.6 ab 8.3 ± 3.3 a CaCl2 8.7 ± 2.8 b 18.3 ± 7.3 ab 14.3 ± 4.6 ab 23.3 ± 6.0 abc 0.0 ± 0.0 b 0.0 ± 0.0 a SBC 0.7 ± 0.7 b 5.0 ± 5.0 b 12.9 ± 2.0 abc 30.0 ± 2.9 ab 2.2 ± 1.1 ab 6.7 ± 3.3 a SA 11.4 ± 5.7 ab 21.7 ± 11.7 ab 21.1 ± 4.7 a 35.0 ± 8.7 a 1.7 ± 1.3 ab 8.3 ± 6.0 a BioSave® 5.6 ± 2.8 b 11.7 ± 6.0 ab 4.4 ± 2.9 abc 8.3 ± 6.0 abcd 1.6 ± 1.1 ab 3.3 ± 1.7 a Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 b 0.0 ± 0.0 c 0.0 ± 0.0 d 0.0 ± 0.0 b 0.0 ± 0.0 a aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.                   197 Table D.22 Effect of Pseudomonas fluorescens isolate 4-6 alone or in combination with sodium bicarbonate (SBC), salicylic acid (SA) or calcium chloride (CaCl2) in comparison to the fungicide, Scholar® and registered biocontrol, BioSave® on the control of B. cinerea, M. piriformis, and P. expansum on 'McIntosh' apples after 15 weeks in cold storage at 0°C, 2016-17. *     B. cinerea M. piriformis P. expansum Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 40.9 ± 0.7 a 65.0 ± 0.0 a 40.2 ± 4.7 a 63.3 ± 7.3 a 8.9 ± 1.6 a 38.3 ± 7.3 a  4-6  4.3 ± 2.9 cd 6.7 ± 4.4 cd 3.6 ± 3.6 b 6.7 ± 6.7 b 0.0 ± 0.0 c 0.0 ± 0.0 c  4-6 + CaCl2 2.7 ± 2.6 d 6.7 ± 4.4 cd 2.2 ± 2.2 b 3.3 ± 3.3 b 2.1 ± 0.2 bc 5.0 ± 0.0 bc  4-6 + SBC 5.0 ± 1.1 cd 10.0 ± 0.0 cd 8.7 ± 2.2 b 13.3 ± 3.3 ab 0.5 ± 0.5 bc 3.3 ± 3.3 bc  4-6 + SA 4.6 ± 3.5 cd 10.0 ± 7.6 bcd 5.1 ± 1.1 b 8.3 ± 1.7 b 0.5 ± 0.5 bc 3.3 ± 3.3 bc CaCl2 6.0 ± 1.9 cd 11.7 ± 4.4 bcd 2.2 ± 2.2 b 3.3 ± 3.3 b 0.8 ± 0.5 bc 3.3 ± 3.3 bc SBC 17.4 ± 1.3 bc 28.3 ± 1.7 abc 2.5 ± 2.0 b 5.0 ± 2.9 b 5.0 ± 2.0 ab 16.7 ± 4.4 ab SA 27.5 ± 2.6 b 45.0 ± 2.9 ab 6.5 ± 3.7 b 10.0 ± 5.8 b 2.3 ± 1.6 bc 6.7 ± 4.4 bc BioSave® 10.4 ± 5.4 cd 16.7 ± 8.8 bcd 2.2 ± 2.2 b 3.3 ± 3.3 b 0.4 ± 0.4 bc 1.7 ± 1.7 bc Scholar® 0.0 ± 0.0 d 0.0 ± 0.0 d 10.8 ± 7.8 b 16.7 ± 12.0 b 0.0 ± 0.0 c 0.0 ± 0.0 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.                   198 Commercial Controlled Atmosphere Storage Data 2014-17  Table D.23 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Gala' apples after 20 weeks in commercial controlled atmosphere storage at 0°C, 2014-15.*       B. cinerea M. piriformis P. expansum Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 69.0 ± 1.6 a 96.7 ± 3.3 a 43.8 ± 3.4 a 61.7 ± 4.4 a 9.5 ± 1.5 a 75.0 ± 5.8 a P. fluorescens 1-112 33.0 ± 4.4 b 45.0 ± 5.0 b 8.1 ± 1.0 bc 11.7 ± 1.7 bc 0.0 ± 0.0 b 0.0 ± 0.0 b P. fluorescens 2-28 31.1 ± 3.7 b 43.3 ± 7.3 b 35.1 ± 10.4 ab 51.7 ± 13.0 ab 0.0 ± 0.0 b 0.0 ± 0.0 b P. fluorescens 4-6 24.2 ± 7.1 b 35.0 ± 10.0 b 5.0 ± 4.1 c 11.7 ± 7.3 c 2.4 ± 2.4 b 3.3 ± 3.3 b BioSave® 15.1 ± 4.2 b 23.3 ± 6.7 b 3.3 ± 2.1 c 5.0 ± 2.9 c 0.3 ± 0.0 b 5.0 ± 0.0 b Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 c 7.2 ± 4.1 c 10.0 ± 5.8 c 0.0 ± 0.0 b 0.0 ± 0.0 b aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.    Table D.24 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Gala' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2015-16.       P. expansum Treatment LDa (mm) DIa (%) Control - - P. fluorescens 1-112 - - P. fluorescens 2-28 - - P. fluorescens 4-6 - - BioSave® - - Scholar® - - aLD= Lesion diameter. DI= Disease incidence. Note these data have been excluded from the thesis because no disease was observed, even in control fruit.    199 Table D.25 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Gala' apples after 33 weeks in commercial controlled atmosphere storage plus two weeks in commercial cold storage at 0°C, 2016-17.*       P. expansum Treatment LDa (mm) DIa (%) Control 12.0 ± 1.2 21.7 ± 4.4 P. fluorescens 1-112 6.6 ± 3.3 11.7 ± 6.0 P. fluorescens 2-28 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 4-6 5.1 ± 2.6 10.0 ± 5.0 BioSave® 1.3 ± 0.6 8.3 ± 3.3 Scholar® 0.0 ± 0.0 0.0 ± 0.0 aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note these data have been excluded from the thesis due to extremely low disease incidence in the control fruit. No data analysis was performed due to the lack of disease.  Table D.26 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'McIntosh' apples after 10 weeks in commercial controlled atmosphere storage at 0°C, 2014-15.*       B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 40.2 ± 6.2 a 60.0 ± 5.8 a 7.7 ± 4.0 a 11.7 ± 4.4 a - - P. fluorescens 1-112 8.0 ± 3.7 b 11.7 ± 4.4 b 0.0 ± 0.0 a 0.0 ± 0.0 b - - P. fluorescens 2-28 0.0 ± 0.0 b 0.0 ± 0.0 b 2.6 ± 2.6 a 3.3 ± 3.3 ab - - P. fluorescens 4-6 4.3 ± 3.1 b 6.7 ± 4.4 b 0.0 ± 0.0 a 0.0 ± 0.0 b - - BioSave® 3.1 ± 1.9 b 6.7 ± 4.4 b 0.0 ± 0.0 a 0.0 ± 0.0 b - - Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 b 0.0 ± 0.0 a 0.0 ± 0.0 b - - aLD= Lesion diameter. DI= Disease incidence. bNo disease was observed for this experiment. *Each value represents the mean of three replicates of 10 apples each ± standard error.     200 Table D.27 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'McIntosh' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 17.6 ± 2.8 a 51.7 ± 6.7 a P. fluorescens 1-112 1.0 ± 0.5 b 3.3 ± 1.7 b P. fluorescens 2-28 6.6 ± 3.4 ab 18.3 ± 10.1 ab P. fluorescens 4-6 1.1 ± 0.7 b 5.0 ± 2.9 b BioSave® 1.1 ± 1.1 b 3.3 ± 3.3 b Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 b aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.     Table D.28 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'McIntosh' apples after 33 weeks in commercial controlled atmosphere storage plus 2 weeks in commercial cold storage at 0°C, 2016-17.*      P. expansum Treatment LDa (mm) DIa (%) Control 20.3 ± 6.5 a 35.0 ± 10.4 a P. fluorescens 1-112 4.3 ± 2.8 ab 11.7 ± 7.3 ab P. fluorescens 2-28 7.4 ± 3.9 ab 16.7 ± 4.4 ab P. fluorescens 4-6 11.8 ± 2.6 ab 20.0 ± 5.0 a BioSave® 5.5 ± 3.5 ab 11.7 ± 4.4 ab Scholar® 0.0 ± 0.0 b 0.0 ± 0.0 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note very low disease incidence was observed in the control fruit.     201 Table D.29 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Spartan' apples after 25 weeks in commercial controlled atmosphere storage at 0°C, 2014-15.*       B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 12.0 ± 2.8 a 18.3 ± 4.4 a 10.1 ± 2.5 a 13.3 ± 3.3 a 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 1-112 3.2 ± 2.6 ab 10.0 ± 7.6 a 0.0 ± 0.0 b 0.0 ± 0.0 b 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 2-28 1.3 ± 1.3 b 1.7 ± 1.7 a 0.0 ± 0.0 b 0.0 ± 0.0 b 0.4 ± 0.4 1.7 ± 1.7 P. fluorescens 4-6 1.1 ± 1.1 b 1.7 ± 1.7 a 0.0 ± 0.0 b 0.0 ± 0.0 b 0.1 ± 0.1 1.7 ± 1.7 BioSave® 3.1 ± 2.3 ab 5.0 ± 2.9 a 0.4 ± 0.4 b 3.3 ± 3.3 ab 0.8 ± 0.8 11.7 ± 11.7 Scholar® 0.4 ± 0.4 b 1.7 ± 1.7 a 1.0 ± 0.6 b 3.3 ± 1.7 ab 0.0 ± 0.0 0.0 ± 0.0 aLD= Lesion diameter. DI= Disease incidence. bNo disease was observed in the control fruit, so no analyses were performed on this data set. *Each value represents the mean of three replicates of 10 apples each ± standard error.     Table D.30 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Spartan' apples after 14 weeks in commercial controlled atmosphere storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 11.8 ± 1.6 a 46.7 ± 3.3 a P. fluorescens 1-112 1.7 ± 0.5 bc 6.7 ± 1.7 bc P. fluorescens 2-28 2.3 ± 1.1 bc 6.7 ± 3.3 bc P. fluorescens 4-6 4.5 ± 1.0 b 16.7 ± 4.4 b BioSave® 0.7 ± 0.7 bc 3.3 ± 3.3 bc Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.    202 Table D.31 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Spartan' apples after 11 weeks in commercial controlled atmosphere storage at 0°C, 2016-17.*       P. expansum Treatment LDa (mm) DIa (%) Control 13.5 ± 0.8 a 62.0 ± 1.5 a P. fluorescens 1-112 4.5 ± 0.9 b 23.3 ± 1.7 abc P. fluorescens 2-28 3.0 ± 2.7 b 15.0 ± 12.6 bc P. fluorescens 4-6 4.7 ± 1.1 b 28.3 ± 6.0 abc BioSave® 3.6 ± 0.5 b 30.0 ± 2.9 ab Scholar® 0.1 ± 0.1 b 1.7 ± 1.7 c aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.     Table D.32 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of postharvest fungal pathogens, Botrytis cinerea, Mucor piriformis, and Penicillium expansum, on 'Ambrosia' apples after 15 weeks in commercial controlled atmosphere storage at 0°C, 2014-15.*       B. cinerea M. piriformis P. expansumb Treatment LDa (mm) DIa (%) LDa (mm) DIa (%) LDa (mm) DIa (%) Control 77.1 ± 0.0 a 100.00 ± 0.0 a 40.3 ± 0.9 ab 53.3 ± 1.7 a 7.7 ± 0.0 10.0 ± 0.0 P. fluorescens 1-112 44.3 ± 3.8 b 61.7 ± 6.0 b 15.6 ± 4.6 bc 21.7 ± 7.3 ab 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 2-28 44.2 ± 3.4 b 58.3 ± 4.4 b 34.6 ± 6.0 ab 48.3 ± 10.1 a 0.0 ± 0.0 0.0 ± 0.0 P. fluorescens 4-6 47.1 ± 9.4 b 66.7 ± 10.1 b 47.8 ± 4.7 a 63.3 ± 6.7 a 2.8 ± 2.5 5.0 ± 2.9 BioSave® 33.9 ± 6.8 b 61.7 ± 9.3 b 41.1 ± 7.4 ab 61.7 ± 13.0 a 0.0 ± 0.0 0.0 ± 0.0 Scholar® 0.0 ± 0.0 c 0.0 ± 0.0 c 2.8 ± 2.8 c 5.3 ± 5.3 b 0.0 ± 0.0 0.0 ± 0.0 aLD= Lesion diameter. DI= Disease incidence. bDisease incidence in control fruit was very low, so no analyses were performed on this data set. *Each value represents the mean of three replicates of 10 apples each ± standard error.     203 Table D.33 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Ambrosia' apples after 10 weeks in commercial controlled atmosphere storage at 0°C, 2015-16.*       P. expansum Treatment LDa (mm) DIa (%) Control 22.1 ± 0.9 a 85.0 ± 2.9 a P. fluorescens 1-112 7.9 ± 1.7 bc 39.2 ± 6.8 bc P. fluorescens 2-28 10.2 ± 1.7 b 63.3 ± 6.0 ab P. fluorescens 4-6 5.5 ± 1.5 bc 23.3 ± 4.4 c BioSave® 2.8 ± 0.4 cd 21.7 ± 7.3 c Scholar® 0.0 ± 0.0 d 0.0 ± 0.0 d aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.     Table D.34 Effect of Pseudomonas fluorescens isolates 1-112, 2-28 and 4-6, BioSave® (Pseudomonas syringae) and Scholar® (fludioxonil) on the control of the postharvest fungal pathogen Penicillium expansum on 'Ambrosia' apples after 11 weeks in commercial controlled atmosphere storage at 0°C, 2016-17.*       P. expansum Treatment LDa (mm) DIa (%) Control 10.2 ± 0.2 a 28.3 ± 1.7 a P. fluorescens 1-112 9.3 ± 3.4 a 26.7 ± 8.8 a P. fluorescens 2-28 15.1 ± 0.6 a 50.0 ± 2.9 a P. fluorescens 4-6 11.3 ± 1.3 a 33.3 ± 4.4 a BioSave® 6.8 ± 2.5 ab 38.3 ± 8.8 a Scholar® 0.1 ± 0.1 b 1.7 ± 1.7 b aLD= Lesion diameter. DI= Disease incidence. *Each value represents the mean of three replicates of 10 apples each ± standard error.  Note these data have been excluded from the thesis due to extremely low disease incidence in the control fruit (in comparison to 2015-16).     204 Table D.35 Effect of cell-free supernatant produced by P. fluorescens, isolates 1-112, 2-28 and 4-6, on the spore germination of P. expansum after 72 h incubation at 20°C.   CFU Control 14.7 ± 1.3 aa 1-112 23.7 ± 6.1 a 2-28 9.7 ± 3.0 a 4-6 10.7 ± 2.9 a aCFU are the mean of 6 replicates from two independent experiments ± standard error. Means followed by a common letter are not significantly different according to Tukey's test (P < 0.05).  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0364036/manifest

Comment

Related Items