Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Compositional changes of the grape berry (Vitis vinifera L.) cuticle during fruit development in response… Dimopoulos, Nicolas 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_february_dimopoulos_nicolas.pdf [ 10.39MB ]
Metadata
JSON: 24-1.0362313.json
JSON-LD: 24-1.0362313-ld.json
RDF/XML (Pretty): 24-1.0362313-rdf.xml
RDF/JSON: 24-1.0362313-rdf.json
Turtle: 24-1.0362313-turtle.txt
N-Triples: 24-1.0362313-rdf-ntriples.txt
Original Record: 24-1.0362313-source.json
Full Text
24-1.0362313-fulltext.txt
Citation
24-1.0362313.ris

Full Text

Compositional Changes of the Grape Berry (Vitis vinifera L.) Cuticle during Fruit Development in Response to Water Deficit Stress  by  Nicolas Dimopoulos  B.Sc., University of Victoria, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Plant Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2017 © Nicolas Dimopoulos, 2017    ii Abstract The cuticle is a layer found on the surface of plant aerial parts mostly composed of cutin polymer and aliphatic waxes, and provides protection from biotic and abiotic environmental stresses. In fruits, cuticular waxes are also rich in triterpenoids. The cuticular waxes of the grapevine (Vitis vinifera L.) berry and the related biosynthetic pathways are poorly characterized. It is not understood how the berry cuticle responds to water deficit (WD) stress, a stress that commonly occurs in vineyards. We hypothesized that under severe WD stress, the cuticular aliphatic wax biosynthetic pathway of developing grape berries would be upregulated, resulting in an increased wax load in the fruit’s cuticle and a decrease in the transpiration rate through the berry cuticle. Candidate genes for the cuticular wax biosynthetic pathway were identified by phylogenetic analyses and surveys of publicly available grapevine transcriptomic datasets. Analyses of these transcriptomes also showed that a number of wax-related genes are significantly upregulated in response to WD stress, and are also modulated by other environmental stresses. A greenhouse experiment was performed in order to test the impact of water deficit on wax composition, expression of candidate biosynthetic genes, and water transpiration in Merlot grapes.  A significant increase in aliphatic wax and a decrease in the ratio of triterpenoids:aliphatic wax was observed under WD stress. The increase in aliphatic wax was due to an upregulation of the aliphatic wax biosynthetic pathway, with an increase in expression seen in fatty acid elongation, the alkane forming, and the alcohol forming genes. The transpiration rate of the berry was not significantly affected by WD; however, a marginally significant (P = 0.051) reduction of the rate was observed in WD berries. The study also revealed that cuticular aliphatic wax composition changed over the course of berry development, with very long chain (VLC)-aldehydes and VLC-primary alcohols predominating before veraison (the onset of berry ripening), and VLC-fatty acids and wax esters mainly accumulating after veraison.   iii Lay Summary  The cuticle is a layer found on the surface of plant aerial tissues, which provides protection to environmental stresses. Most importantly the cuticle acts as a barrier to water loss and water uptake by the plant tissue, and will be modified in response to stress. Drought stress is very common in viticulture, and it is not understood how the grapevine (Vitis vinifera L.) berry's cuticle respond to it. This research identified putative grapevine genes involved in cuticular wax biosynthesis and tested if the berry cuticle changed in response to drought stress. It was found that cuticular wax biosynthesis was upregulated in response to drought, leading to an increased amount of wax found on the berry cuticle, causing a marginal reduction in water transpiration through the berry cuticle.   iv Preface Differential expression analysis of RNA-seq datasets was performed by Dr. Darren Wong (Castellarin Lab, University of British Columbia).  Duplication data of grapevine homologs of cuticular related genes was provided by Dr. Darren Wong (Castellarin Lab, University of British Columbia).  GC-MS program used for wax analysis was designed by Lina Madilao (Wine Research Centre, University of British Columbia) and wax samples were run on the GC-MS by her.  All other work presented in this thesis represents original, unpublished and independent work conducted by the author, Nicolas Dimopoulos.   v Table of Contents Abstract .......................................................................................................................................... ii	Lay Summary ............................................................................................................................... iii	Preface ........................................................................................................................................... iv	Table of Contents .......................................................................................................................... v	List of Tables ............................................................................................................................... vii	List of Figures ............................................................................................................................. viii	Abbreviations ................................................................................................................................ x	Acknowledgements ...................................................................................................................... xi	Dedication .................................................................................................................................... xii	Chapter 1: Introduction ............................................................................................................... 1	Section 1.1	 The grapevine (Vitis vinifera L.) biology .................................................................... 1	Section 1.1.1	 The grapevine genome ............................................................................................... 1	Section 1.1.2	 Grape berry development ........................................................................................... 1	Section 1.1.3	 Impact of water deficit stress on berry development and composition ...................... 5	Section 1.2	 The plant cuticle ........................................................................................................... 6	Section 1.2.1 Cuticular Wax biosynthetic pathway ............................................................................. 7	Section 1.2.2	 Regulation of the cuticular wax biosynthetic pathway ............................................ 12	Section 1.2.3	 Cuticular wax in response to water deficit stress ..................................................... 15	Section 1.3 The grape berry cuticle ..................................................................................................... 15	Section 1.3.1	 The composition of grape berry cuticular wax ........................................................ 15	Section 1.3.2 Oleanolic acid biosynthesis .......................................................................................... 16	Section 1.3.3 Cuticular wax changes during grape berry development ............................................. 17	Section 1.4	 Rationale for the study ............................................................................................... 19	Section 1.5	 Objectives of the study ............................................................................................... 20	Chapter 2: Materials & Methods .............................................................................................. 22	Section 2.1	 Genomic analysis to identify candidate cuticular wax genes in grapevine ........... 22	Section 2.1.1	 Searching for candidate biosynthetic genes ............................................................. 22	Section 2.1.2	 Searching for transcription factors related to grapevine cuticular wax biosynthesis25	Section 2.2	 In silico analysis of RNA-seq data to characterize expression of candidate genes among grapevine tissues and berry development, during under biotic and abiotic stresses. ........ 27	Section 2.2.1	 Data processing ........................................................................................................ 27	Section 2.2.2	 Transcript abundance and differential expression analysis ...................................... 28	Section 2.3	  Biological greenhouse experiment: Assessing the impact of water deficit stress on cuticular wax composition ................................................................................................................... 31	Section 2.3.1	 Experimental design ................................................................................................. 31	Section 2.3.2	 Physiological measurements .................................................................................... 32	Section 2.3.2	 Berry and leaf sampling ........................................................................................... 33	Section 2.3.3	 Cuticular wax extraction and quantification ............................................................ 35	Section 2.3.4	 RNA sampling and RT-qPCR gene expression analysis ......................................... 36	Section 2.3.5	 Transpiration experiment to measure rate of water loss through cuticle ................. 38	Section 2.3.7 Statistical Analysis ....................................................................................................... 39	Chapter 3: Results ....................................................................................................................... 40	Section 3.1	 Genomic Analysis to identify candidate cuticular wax genes in grapevine .......... 40	Section 3.1.1	 BLASTp search results ............................................................................................ 40	Section 3.1.2	 Phylogenetic trees .................................................................................................... 43	 vi Section 3.2	 In-silico expression analysis of candidate genes ...................................................... 54	Section 3.2.1	 Expression levels of candidate genes in grapevine tissues ...................................... 54	Section 3.2.2	 Differential expression of cuticular aliphatic wax biosynthetic candidate genes .... 58	Section 3.2.3	 Differential expression of oleanolic acid biosynthetic genes during berry development and under biotic and abiotic stresses. ........................................................................... 61	Section 3.2.4	 Expression of cuticular wax related transcription factors ........................................ 64	Section 3.2.5	 Selection of candidate genes to analyze in the biological experiment ..................... 65	Section 3.3	 Grapevine physiology and wax composition under water deficit stress ................ 67	Section 3.3.1	 Grapevine and berry physiology .............................................................................. 67	Section 3.3.2	 Berry cuticular wax composition during development and under water deficit stress   .................................................................................................................................. 67	Section 3.3.3	 Leaf cuticular wax composition under water deficit stress ...................................... 76	Section 3.3.4	 Gene expression in berry skin .................................................................................. 80	Section 3.3.4 Transpiration rate through the berry cuticle ................................................................. 85	Chapter 4: Discussion ................................................................................................................. 87	Section 4.1	 Identification of the likeliest functional homologs ................................................... 87	Section 4.1.1	 PAS2 functional homologs ...................................................................................... 87	Section 4.1.2	 KCR1 functional homologs ..................................................................................... 87	Section 4.1.3	 CER10 functional homologs .................................................................................... 88	Section 4.1.4	 CER2 and CER2-LIKE functional homologs .......................................................... 88	Section 4.1.5	 CER6 functional homologs ...................................................................................... 88	Section 4.1.6	 CER1 and CER3 functional homologs .................................................................... 89	Section 4.1.7	 CER4 functional homologs ...................................................................................... 90	Section 4.1.8	 WSD1 functional homologs ..................................................................................... 91	Section 4.1.9	 BAS functional homologs ........................................................................................ 92	Section 4.1.10	 CYP716A functional homologs .............................................................................. 92	Section 4.2	 The Merlot grape berry cuticle ................................................................................. 93	Section 4.2.1	 Merlot grape berry cuticular wax composition ........................................................ 93	Section 4.2.2 Distribution of carbon chain lengths of aliphatic waxes .............................................. 94	Section 4.2.3	 Changes in cuticular wax composition during normal grape berry development .... 95	Section 4.2.4	 Merlot grapevine leaf cuticular wax composition .................................................... 96	Section 4.3	 Changes in the berry cuticular wax composition due to water deficit stress ........ 98	Section 4.3.1	 Transcriptomic data indicate that cuticular wax pathway gene expression is modulated in response to WD stress .................................................................................................. 98	Section 4.3.2	 WD effect on grape berry cuticular aliphatic wax ................................................... 98	Section 4.3.4	 WD effect on the expression of the cuticular wax related transcription factor genes in grape berry skin ............................................................................................................................ 101	Section 4.3.5	 WD effect on grape berry triterpenoid content ...................................................... 102	Section 4.3.6	 Water Transpiration through the berry cuticle ....................................................... 102	Section 4.4	 Oleanolic acid is likely most important during early berry development for disease resistance ................................................................................................................................ 104	Section 4.5	 A working hypothesis — berry cuticular aliphatic wax biosynthesis is regulated by ABA and ethylene during berry development ............................................................................ 106	Chapter 5:	 Conclusion ......................................................................................................... 108	Section 5.1	 Changes in grape berry cuticular wax composition and accumulation in response to water deficit stress .......................................................................................................................... 108	Section 5.2	 Relevance ................................................................................................................... 110	Section 5.3	 Future research ......................................................................................................... 110	References .................................................................................................................................. 112	Appendix .................................................................................................................................... 124	   vii List of Tables Table 2.1.1 Filtered BLASTp results cutoff for building phylogenetic trees ....................................... 24 Table 2.1.2 List of biosynthetic and regulatory cuticular related characterized genes ......................... 26 Table 2.2.1 List of RNA-seq datasets used for analyzing expression levels and differential expression patterns of homolog genes ........................................................................................................................... 30 Table 3.1.1 Number of putative grapevine homolog genes putatively involved in cuticular wax biosynthesis  ............................................................................................................................................ 40 Table 3.1.2 Putative grapevine homologs involved in regulation of cuticular wax biosynthesis ......... 42 Appendix Table 2.3.1 Primer sequences for RT-qPCR .................................................................. 124-126     viii List of Figures Figure 1.1 General trends of grapevine (Vitis vinifera L) growth and development  ............................ 4 Figure 1.2 The cuticular aliphatic wax biosynthetic pathway ............................................................. 11 Figure 1.3 The oleanolic acid biosynthetic pathway ........................................................................... 17 Figure 1.4 Close up of Merlot grape berry epicuticular waxes ........................................................... 18 Figure 2.1.1 Flow chart for identifying candidate cuticular related biosynthetic homolog genes ......... 24 Figure 2.1.2 Flow chart for identifying candidate cuticular related regulatory homolog genes ............ 25 Figure 2.2.1 Flowchart for processing RNA-seq datasets ...................................................................... 29 Figure 2.3.1 Merlot grapevine plants at the UBC Horticultural greenhouse .......................................... 32 Figure 2.3.2 Sampling schedule for the water deficit greenhouse experiment ....................................... 33 Figure 2.3.3 Berry harvesting during the water deficit greenhouse experiment .................................... 34 Figure 2.3.4 Sizes of leaves sampled during the water deficit greenhouse experiment ......................... 35 Figure 2.3.5 Desiccation chamber used for transpiration experiments .................................................. 38 Figure 3.1.1 Phylogenetic tree of PAS2 homologs ................................................................................ 45 Figure 3.1.2 Phylogenetic tree of KCR1 homologs ................................................................................ 46 Figure 3.1.3 Phylogenetic tree of CER10 homologs .............................................................................. 47 Figure 3.1.4 Phylogenetic tree of CER2 and CER2-LIKEs homologs .................................................. 48 Figure 3.1.5 Phylogenetic tree of CER6 homologs ................................................................................ 49 Figure 3.1.6 Phylogenetic tree of CER1 and CER3 homologs .............................................................. 50 Figure 3.1.7 Phylogenetic tree of CER4 homologs ................................................................................ 51 Figure 3.1.8 Phylogenetic tree of WSD1 homologs ............................................................................... 52 Figure 3.1.9 Phylogenetic tree of CYP716A12 homologs ..................................................................... 53 Figure 3.2.1 Heatmap of expression values of grapevine homologs of cuticular aliphatic wax biosynthetic genes ........................................................................................................................................ 56 Figure 3.2.2 Heatmap of expression values of grapevine homologs of oleanolic acid biosynthetic genes  ............................................................................................................................................ 57 Figure 3.2.3 Heatmap of differential expression of grapevine homologs of cuticular aliphatic wax biosynthetic genes ........................................................................................................................................ 62 Figure 3.2.4 Heatmap of differential expression of grapevine homologs of oleanolic acid biosynthetic genes  ............................................................................................................................................ 63 Figure 3.2.5 Heatmap of expression values and differential expression of grapevine homologs of cuticular regulatory genes ............................................................................................................................ 66 Figure 3.3.1 Grape berry leaf water potential, weight, and soluble solids during the water deficit experiment  ............................................................................................................................................ 69 Figure 3.3.2 General cuticular composition of grape berries during the water deficit experiment ........ 70  ix Figure 3.3.3 Composition of grape berry cuticular very long chain fatty acids during the water deficit experiment  ............................................................................................................................................ 71 Figure 3.3.4 Composition of grape berry cuticular very long chain primary alcohols and of wax esters during the water deficit experiment ............................................................................................................. 73 Figure 3.3.5 Composition of grape berry cuticular very long chain primary aldehydes and of alkanes during the water deficit experiment ............................................................................................................. 75 Figure 3.3.6 Composition of grape berry cuticular triterpenoids during the water deficit experiment .. 76 Figure 3.3.7 General cuticular composition of grape leaves during the water deficit experiment ......... 78 Figure 3.3.8 Composition of grape leaf cuticular aliphatic waxes during the water deficit experiment 79 Figure 3.3.9 Relative expression of genes involved in fatty acid elongation in the cuticular aliphatic wax biosynthetic pathway during the water deficit experiment .................................................................. 82 Figure 3.3.10 Relative expression of genes involved in alcohol and alkane forming branches of the cuticular aliphatic wax biosynthetic pathway during the water deficit experiment ..................................... 83 Figure 3.3.11 Relative expression of genes involved in fatty acid elongation in the cuticular aliphatic wax biosynthetic pathway during the water deficit experiment .................................................................. 84 Figure 3.3.12 Transpiration rates through the berry cuticle during the water deficit experiment ............ 86 Appendix Figure 3.2.1 Types of duplication of grapevine homologs of cuticle related genes  ............... 127    x Abbreviations  ABA Abscisic acid AD Aldehyde decarbonylase  BAS β-amyrin synthase  CER10 An ECR CER2 BAHD acyltransferase CER2-LIKE1 BAHD acyltransferase CER2-LIKE2 BAHD acyltransferase CER4 Fatty acyl-CoA reductase  CER6 A KCS CT Control DAA Days after anthesis DDBJ DNA data bank of Japan  DE Differential Expression ECR Enoyl-CoA reductase  ER Endoplasmic reticulum FAAR fatty acyl-acyl carrier protein reductase FAE Fatty acid elongase complex FPKM Fragments per kilobase of transcript per million mapped reads  HCD β-hydroxyacyl-CoA dehydratase  IPP Isopentenyl diphosphate  KCR β-ketoacyl-CoA reductase  KCR1 A KCR KCS Ketoacyl-CoA synthase  LACS Long-chain acyl-coenzyme A synthase LWP Leaf water potential MAH1 Midchain alkane hydroxylase  MEV Mevalonate pathway  OA Oleanolic acid PAS2 An HCD PGDD Plant genome duplication database RPKM Reads per kilobase of transcript per million mapped reads  TF Transcription factor VLC Very long chain VLCFA Very long chain fatty acid VLCPA Very long chain primary alcohol WD Water deficit WSD1 Wax ester synthase/acyl-CoA:diacylglycerol acyltransferase       xi Acknowledgements  I would like to thank my supervisor, Dr. Simone Diego Castellarin, for his dedicated mentorship and support over the course of my degree. Thank you for giving me the opportunity to work on such an interesting project, and for spending the time to teach me the skills needed to be a good scientist.  I would like to thank members of the Castellarin lab who aided me in this endeavour. Thank you to Dr. Darren Wong for introducing me and teaching me to the field of transcriptomics, and guiding me in my in silico analyses. Thank you to Rodrigo Lopez Gutierrez for helping me with the transcriptomic analyses and to Ricco Tindjau for his dedicated help in sampling during water deficit greenhouse experiment and conducting RT-qPCR.  Thank you to my collaborators Drs. Tegan Haslam and Ljerka Kunst who introduced me to plant cuticular waxes and helped guide me in my wax analyses, and to Lina Madilao who aided me with processing the GC-MS samples.  Thank you to Melina Biron, for her help in setting up the greenhouse experiment and in keeping the plants alive.  I would like to thank my friends I have made at UBC during my studies. Thank you, Stephanie Cheung, Jay Martiniuk, Savrina Manhas, and Eugene Kovalenko for all for your support and joyful times we all had together.  Thank you to my family, to my parents Nikitas Dimopoulos and Véronique Piton, to my brothers Alexandros and Stéfane Dimopoulos, and to Nikole Texidor for your continued support. Last but not least, I thank my partner, Haley Amson, for being by my side, supporting me, and being my biggest cheerleader.      xii     Dedication  To shining a light in all the dimly lit places.           1 Chapter 1: Introduction Section 1.1 The grapevine (Vitis vinifera L.) biology Section 1.1.1 The grapevine genome   The domesticated grapevine (Vitis vinifera L.) is a perennial hermaphroditic dicotyledonous plant. The Vitis genus encompasses approximately 60 species, with the majority originating from North America. The cultivated grapevine, Vitis vinifera, originates from Eurasia and appeared approximately 65 million years ago (This et al., 2006). Domestication of the plant occurred originally in the Caucasus about 8000 years ago and the present-day population consists of around 10000 varieties (This et al., 2006). The sequenced grapevine genome was derived from the PN40024, a highly homozygous (93% of alleles) genotype. This genotype, originally derived from Pinot Noir, has been bred close to full homozygosity by successive selfing. The haploid genome contains 19 chromosomes, is 487Mb in size, and has not gone through any recent genome duplication events (Jaillon et al., 2007). This study revealed the contribution of three ancestral genomes to the grapevine haploid content and that grapevine originates from a ‘palaeo-hexaploid’ organism.   Section 1.1.2 Grape berry development  Grapevine (Vitis vinifera L.) is a perennial plant in which two consecutive seasons are required for fruit development. In the first year, flower primordia are formed in the bud, and in the second year the bud shoots and develops flowers and fruit. After pollination, fruit sets and the grape berry experiences a double-sigmoidal growth pattern which can be separated into three stages (Robinson et al., 2000). Hormonal levels and environmental conditions strongly affect the plant’s fertility and fruit development.   2 Stage I – Green growth  The first stage of development lasts for 6-9 weeks after fertilization. During this period the new green berry experiences rapid cell division and expansion of seed and pericarp tissues (Robinson et al., 2000). The green seed embryo produces and releases auxins, gibberellins and cytokinins into the berry tissue to drive cell division, expansion and tissue differentiation, while abscisic acid (ABA) is imported from the mother plant to promote embryo development. During green growth, ABA levels are initially high and decrease with development, while auxin levels increase (Kuhn et al., 2014). During this period, the berry is green with high firmness, low sugar content, and high acid content (Castellarin et al., 2016). Berry growth stops at the end of stage I as it enters the lag phase of stage II. Stage II – Lag phase  The berry experiences no growth during the 1-6 week long period of lag phase as cell division and cell expansion cease (Robinson et al., 2000). During this time auxin levels peak to act as a ripening inhibitor, and then decrease near the end of the lag phase. ABA levels start to increase near the end of this stage due to the influx from the mother plant and from endogenous berry production. The increased levels of ABA block gibberellin production and lead to seed maturation. A fleeting increase in ethylene occurs near the end of stage two (Kuhn et al., 2014), and in combination with ABA and brassinosteroids, induces changes in gene expression and in cell walls (Castellarin et al., 2016). Stage III – Ripening  The onset of ripening, called veraison, is the transition period between stages II and III and occurs asynchronously in the berries over a period of 7-10 days as they enter a new phase of growth by cell expansion (Robinson et al., 2000). Major changes in gene expression, berry physiology and composition are initiated with veraison and continue until the berry has fully ripened. Disassembly of mesocarp cell walls leads to berry softening, and water importation into  3 the berry occurs through the phloem and not through the xylem as before veraison. Anthocyanins (in red grape varieties) and other flavonoids accumulate as the berry changes colour, and organic acids and chlorophyll are degraded as chloroplasts are turned into chromoplasts (Fanciullino et al., 2014). Sugars (glucose and fructose) are imported into the berry and ABA is synthesized in the berry tissues, with the two interacting in a positive feedback loop to promote each other’s rapid accumulation (Kuhn et al., 2014).  4      Veraison30 60 90 1200DAAStage I Stage II Stage IIICell expansionCell division and expansionSugarsOrganic acidsAbscisic acidAuxinsEthyleneRelative AmountBerry WeightFigure 1.1. General trends during grapevine (Vitis vinifera L) growth and development according to the daysafter anthesis (DAA). Relative amounts of major developmental hormones (abscisic acid, auxins, ethylene),and metabolites (sugars, organic acids) in the berry during development are displayed. The rel ative berryweight during growth according to the different developmental stages shown, and changes in the berrypigmentation are shown. 5 Section 1.1.3 Impact of water deficit stress on berry development and composition  Grapevines are commonly grown in Mediterranean climates where they are often subjected to water deficit (WD) stress. Moderate WD stress occurs when leaf water potential (LWP) reaches between -1.2 to -1.5 MPa and severe stress is reached when it is below -1.5 MPa (Castellarin et al., 2007). Grapevines are drought tolerant, having evolved in that kind of climate, and can be classified based on their response to WD as being near isohydric (sensitive stomata close with mild stress) or near anisohydric (insensitive stomata remain open with mild stress) (Chaves et al., 2010).  Signaling of WD stress is mediated by direct water availability (e.g. cell dehydration) and the ABA-dependent signaling pathway. ABA is synthesized in parenchyma cells in vasculature tissues of roots, shoots and leaves where it induces a response locally, and in other tissues by way of being exported. The hormone regulates plant water balance through the modulation of the stomatal conductance and by inducing synthesis of dehydration tolerance proteins that activate osmotic stress tolerance. ABA also acts as an antagonist of auxin, inhibiting cell division (Chaves et al., 2010).  Though fruit growth is less sensitive than vegetative growth, WD strongly affects berry growth and metabolism. Berry growth is limited due to the inhibition of cell division and expansion when deficit is applied early during the season (stage I), and only due to cell expansion inhibition when deficit occurs during stages II and III (Chaves et al., 2010). Under prolonged WD stress, major changes in gene regulation throughout development are seen in the berry with the largest number of differentially expressed (DE) genes occurring after veraison (Savoi et al., 2016; Savoi et al., 2017). The signaling is mediated both through ABA-dependent and ABA-independent signaling pathways (Savoi et al., 2017), but not all grapevine varieties see an increase in ABA in the fruit (Deluc et al., 2009).   6 Sugar concentration might increase or decrease accordingly to the variety, the level of water deficit, and when water deficit is applied during berry development. Plant specialized metabolism is strongly affected, in particular the flavonoid and terpenoid pathways. It is common to see upregulation of flavonoid genes and increased synthesis of anthocyanins in red grape varieties (Castellarin et al., 2007; Savoi et al., 2017), and an increase of the expression of terpene synthase genes, consistent with an increase of monoterpene concentration in white grape varieties (Savoi et al., 2016). These are seen as beneficial qualities for wine making and, as such, WD stress during grape development is commonly applied by viticulturists (Gil et al., 2015).  Section 1.2 The plant cuticle  The cuticle is an ancient adaptation of the first land plants, it is a specialized lipidic modification of the plant cell walls that covers all aerial organs. It forms the main interface between the plant and the environment, protecting the plant from biotic and abiotic environmental stresses. Besides protecting the plant against water loss, pests and pathogens, the cuticle act as a screen against excessive UV light, as a self-cleaning surface, and a boundary for establishing separate organs (Yeats and Rose, 2013).  The cuticle is composed of several layers. The cuticle proper is made of cutin polymer that acts as a macromolecular scaffold and of intracuticular waxes that are intercalated with it. This layer is connected to the cell wall via the cuticular layer that is composed of cutin, wax and polysaccharides. Epicuticular wax is found deposited on the surface of the cuticle proper either as a film or as a layer of higher order crystals (Yeats and Rose, 2013).  The composition and thickness of the cuticle varies by species, organ and as well as during development. Cuticular waxes are composed of a family of very long chain (VLC) aliphatic compounds, and can also contain triterpenoids and minor metabolites like sterols and flavonoids. These compounds are produced by their respective biosynthetic pathways. A range  7 of VLC aliphatic compounds can be produced by plants and can include fatty acids, primary alcohols, acyl esters (wax esters), alkanes, aldehydes, secondary alcohols, and ketones. The length of these compounds can vary from C16 to C34, and up to C50 for wax esters (Bernard and Joubès, 2013).  Section 1.2.1 Cuticular Wax biosynthetic pathway Most of what is known of the biosynthesis of cuticular aliphatic waxes has been described in Arabidopsis since it was the main model organism used to characterize the pathway. The pathway starts with the de novo synthesis of C16 or C18 fatty acids in the plastids of epidermal cells. The fatty acids are then converted into CoA-thioesters by long-chain acyl-coenzyme A synthase (LACS) and then transferred to the endoplasmic reticulum (ER) by unknown means. In the ER, fatty acyl-CoA-thioesters are then used as substrates for both the cutin biosynthetic pathway and the cuticular aliphatic wax biosynthetic pathway (Figure 1.2) (Yeats and Rose, 2013).  Cutin biosynthesis The cutin biosynthetic pathway involves modification of the CoA-thioesters by a series of cytochrome enzymes (CYP86A4, CYP77A6) and an acyltransferase/phosphatase (GPAT6),  into cutin monomers, followed by exportation to the cuticle where cutin polymerization is completed by a cutin synthase (CD1) (Yeats and Rose, 2013).  Fatty acid elongation The first stage of cuticular aliphatic wax biosynthesis involves the elongation of the fatty acyl-CoA-thioesters by repetitive addition of two carbons by the multi-enzyme fatty acid elongase (FAE) complex. The result is the production of very long chain (VLC) fatty acids  8 ranging from C18 to C34 in length. The FAE complex is composed of a ketoacyl-CoA synthase (KCS), a β-ketoacyl-CoA reductase (KCR), a β-hydroxyacyl-CoA dehydratase (HCD), and a enoyl-CoA reductase (ECR). These four enzymes work in concert to catalyze the addition of malonyl-CoA to the acyl-CoA thioester through a series of four reactions: condensation, reduction, dehydration, and reduction, respectively (Haslam and Kunst, 2013a). The four genes responsible are CER6 (Fiebig et al., 2000) as the KCS, KCR1 (Beaudoin et al., 2009) as the KCR, PAS2 (Bach et al., 2008) as the HCD, and CER10 (Zheng et al., 2005) as the ECR. CER6 is a member of an expanded family of 21 KCS genes that can also function in the FAE complex. KCR1, CER10, and PAS2 have broad substrate specificities, whereas the KCS enzymes determine the substrate and tissues specificities of the FAE complex. CER6 is specific for cuticular wax production, while many of the other KCSs are involved in lipid production for other functions, such as the seed-specific KCS19 that is involved in production of storage lipids (Joubès et al., 2008). Extension of VLCFAs past C28 in length requires the involvement of a subfamily of BAHD acyltransferases named CER2-LIKEs that function together with CER6 to accommodate longer acyl-CoA thioesters (Haslam and Kunst, 2013a). CER2 extends VLCFA-CoA to C30 (Haslam et al., 2012), and CER2-LIKE1 and CER2-LIKE2  up to C34 in length (Haslam et al., 2015). The VLCFA-CoA thioesters are then used as substrates in the alcohol forming and alkane forming branches of the pathway for the production of diverse cuticular waxes. Otherwise VLCFA-CoA thioesters are converted into free fatty acids by an unknown mechanism, and that can be converted back into VLCFA-CoA thioesters by LACS.      9 Alcohol forming branch This branch of the pathway starts with an alcohol-forming fatty acyl-CoA reductase named CER4 (Rowland et al., 2006) that converts VLC acyl-CoA thioesters into VLC-primary alcohols. Wax ester synthesis is catalyzed by a wax ester synthase/acyl-CoA:diacylglycerol acyltransferase named WSD1 (Li et al., 2008) using VLC-primary alcohols and C16-C18 acyl-CoA as substrates.  Alkane forming branch The current model for alkane synthesis involves CER1 and CER3, unique proteins that are believed to be from a common lineage (Bernard et al., 2012). It is thought that alkane synthesis involves the reduction of VLC-acyl-CoA-thioesters by a fatty acyl-acyl carrier protein reductase (FAAR) into a VLC-aldehyde intermediate, which is then converted into an alkane by an aldehyde decarbonylase (AD). Both proteins appear to exhibit both functions, with CER3 being the FAAR and CER1 being the AD and both proteins having low activity of the other function. CER1 interacts with CER3 synergistically as a heterodimer to form VLC-alkanes, and also with cytochrome b5 (CYTb5) as a cofactor. There is evidence suggesting that if CER1 or CER3 is absent then the other one could work as a functional homodimer with reduced VLC-alkane forming activity (Bernard et al., 2012). VLC-aldehyde synthesis is not fully understood, and it is possible that CER3 is responsible by way of making excess intermediate VLC-aldehydes during VLC-alkane synthesis (Bernard et al., 2012; Bernard and Joubès, 2013).   A cytochrome P450 named midchain alkane hydroxylase (MAH1) is responsible for VLC-secondary alcohol and subsequent VLC-ketone synthesis starting with VLC-alkanes as substrate (Greer et al., 2007).    10 Wax transport  Not much is known about the transport of cuticular aliphatic waxes to the plant cuticle. It is currently understood that after synthesis in the ER, aliphatic waxes are transported to the plasma membrane by vesicle trafficking that is dependent on GLN1 at the golgi apparatus and ECH complex at the trans-golgi network (McFarlane et al., 2014). Once arrived at the plasma membrane, the waxes are then transported out the cell via ABC transporters (McFarlane et al., 2010), and then across the hydrophilic cell wall to the cuticle by extracellular lipid-transfer proteins (DeBono et al., 2009; Kim et al., 2012).  11    Figure 1.2. The cuticular aliphatic wax biosynthetic pathway. The fatty acid elongase (FAE) complex is responsiblefor synthesis of very long chain (VLC)-fatty acids; proteins involved are CER6, KCR1, PAS2, CER10, CER2,CER2-LIKE1, CER2-LIKE2. The alcohol forming branch includes CER4 and WSD1 proteins that produce VLC-primary alcohols and wax esters. The alkane forming branch includes CER1, CER3, and MAH1 proteins thatproduce VLC-alkanes, VLC-aldehydes, VLC-secondary alcohols, and VLC-ketones. Alipatic waxes are exported tothe cuticle by way of ABC transporters and possibly lipid transfer proteins.ERCytosplasmCell	WallPlasma	membraneCuticle	properLipid	Transfer	ProteinsEpicuticular	wax	crystalsIntracuticular	wax	and	cutinEndoplasmic	ReticulumPlastidC16-C18	acyl-CoAC16-C18	Fatty	acidWax	esterPrimary	alcoholCER4WSD1AldehydeAlkaneCER1CER3	heterodimer??MAH1MAH1Secondary	AlcoholKetoneLACS?Free	fatty	acidLACSABC	transportersCER2	CER2-LIKE1	&	2FAE:	KCS	(CER6),	KCR1,	PAS2,	CER10C20-C28	acyl-CoAC30	acyl-CoAC32-C34	acyl-CoACER2-LIKE1FAEMalonyl-CoACoA	+	CO2FAEMalonyl-CoACoA	+	CO2FAEMalonyl-CoACoA	+	CO2OHOOHOOHOOOS–CoAOCuticular	layerEpicuticular wax	crystals 12 Section 1.2.2 Regulation of the cuticular wax biosynthetic pathway  Cuticular development and environmental response is regulated by several classes of transcription factors (TFs) that include ethylene responsive factors, AP2 TFs with two AP2 domains, HD-Zip class IV TFs and MYB TFs (Borisjuk et al., 2014). There are additional proteins that affect the cuticle through protein and RNA degradation (Yeats and Rose, 2013). Ethylene responsive factors  Ethylene responsive factors of the AP2/ERF superfamily have been found to be important regulators of aliphatic wax biosynthesis during cuticle development. In Arabidopsis, WIN1/SHN1 and its two paralogs, SHN2 and SHN3, are found to be positive regulators of wax production. Upregulation of CER1, CER2 and KCS1 occurred when WIN1/SHN1 was overexpressed (Borisjuk et al., 2014). The TFs work in concert with other TFs, as WIN1/SHN1 target the same genes as MYB106 and MYB16, and is induced by these two TFs (Oshima et al., 2013). WAX PRODUCTION 1 (WPX1) and its homolog WPX2 are Medicago truncatula genes that belong in the same clade as WIN1/SHN1 and lead to increased wax accumulation when overexpressed in transgenic Arabidopsis (Zhang et al., 2007).  DEWAX is another AP2/ERF TF in Arabidopsis that regulates wax production, but unlike the previous ones described, it is a negative regulator of wax biosynthesis. Its expression follows the circadian rhythm, being upregulated at night, thus allowing wax production only during the day. DEWAX is proposed to be a major regulator of wax synthesis (Go et al., 2014).  VviERF045 is a grapevine AP2/ERF TF that is phylogenetically closely related to the WIN1/SHN1 clade.  It is highly expressed in berry skin and is induced at ripening. Its functional characterization revealed that it regulates the expression of grapevine putative homologs of CER1, CER2, CER2-LIKE, WSD1, MAH1 positively, and those of WIN1/SHN1 and SHN2 negatively (Leida et al., 2016).  13 AP2 transcription factors with two AP2 domains  WRINKLED TFs (WRI1, WRI3, WRI4) in Arabidopsis have been found to activate fatty acid biosynthesis during development, and are involved in positively regulating organ-specific (e.g. flowers and stems) cuticular wax biosynthesis (To et al., 2012; Park et al., 2016). HD-Zip class IV transcription factors A maize HD-Zip IV TF named OUTER CELL LAYER 1 (ZmOCL1) was demonstrated to regulate cuticle biosynthesis. Overexpression of the TF led to increased VLCFA and wax ester content by upregulating the expression of maize CER4 homologs (Javelle et al., 2010).  Building on the discovery of ZmOCL1’s role in cuticle development, it was discovered that a WW domain protein named CURLY FLAG LEAF 1 (CFL1) found in rice and Arabidopsis negatively regulates HDG1, an HD-Zip IV TF in Arabidopsis. In turn the cuticular biosynthetic genes BODYGUARD and KCS10 are negatively regulated (Wu et al., 2011). MYB transcription factors  A number of MYB TFs in Arabidopsis have been found to regulate cuticle development and several of them are involved in relaying signals of environmental stress to the wax biosynthetic pathway.  AtMYB96 (Seo et al., 2011) and AtMYB94 (Lee and Suh, 2015) have both been found to positively regulate wax biosynthesis by controlling the expression of genes such as KCS1, KCS2, CER1, WSD1. The two are upregulated in response to drought stress and exogenous ABA, leading to increased wax load and higher drought tolerance. They both work in an additive fashion in controlling wax biosynthesis (Lee et al., 2016). AtMYB41 is similarly strongly expressed by abiotic stresses that include drought, salinity, and exogenous ABA. Overexpression of AtMYB41 leads to changes in surface permeability (Cominelli et al., 2008), but rather than controlling cuticular aliphatic wax biosynthesis, AtMYB41 activates ectopic synthesis and deposition of suberin on epidermal tissues (Kosma et al., 2014).  14 AtMYB30 regulates the activation of VLCFA biosynthesis due to the hypersensitive response that is activated by pathogen attack (Raffaele et al., 2008). KCR1, CER10, PAS2, CER2, CER3, KCS1 and KCS2 are seen to be upregulated in response. BES1 acts synergistically with AtMYB30 to activate brassinosteroid induced gene expression which is implicated in plant pathogen response (Li et al., 2009). In contrast to the other MYB TFs described, AtMYB106 and AtMYB16 positively regulate wax biosynthesis during cuticle development in coordination with WIN1/SHN1. The two genes are redundant both in role and expression (Oshima et al., 2013). Other regulatory genes CER7 is a core subunit of the exosome that is involved in 3’-to-5’ decay of excess mRNA. The exosome, with CER7, positively regulates CER3 mRNA levels by eliminating excess transcripts that would otherwise result in production of small interfering RNA and triggering post-transcriptional gene silencing of CER3 (Lam et al., 2015; Zhao and Kunst, 2016). Arabidopsis cer9-deficient mutants exhibit significant increase in VLCFAs in the leaf cuticle and a decrease in permeability. This would indicate that CER9 is a negative regulator of cuticular wax biosynthesis through its putative role as an E3 ubiquitin ligase in the ER (Lu et al., 2012). Regulatory role of Abscisic acid in cuticle biosynthesis  ABA-dependent signaling is involved in regulating cuticle related TFs. The hormone negatively regulates DEWAX and HDG1, while positively regulating AtMYB16, AtMYB94, and AtMYB96. Overall ABA promotes cuticle formation, since the expression profile of cuticle related genes shows upregulation in similar fashions to exogenous ABA treatment and to drought stress (Cui et al., 2016). The gene upregulation due to ABA causes increased cuticular wax accumulation similar to the response to drought stress in Arabidopsis (Kosma et al., 2009). Pathogen and drought signaling pathways are distinct since cuticular genes are downregulated in response to pathogens, cell death, and reactive oxygen species. All of this indicates that there is a  15 cuticle specific branch in the ABA signaling pathway responsible for environmental stress response (Cui et al., 2016). Section 1.2.3 Cuticular wax in response to water deficit stress  Significant increases in wax content in response to WD stress have been observed in tobacco tree (Cameron, 2005), Arabidopsis (Kosma et al., 2009), and sesame (Kim et al., 2007) leaves. In all three cases alkanes were the dominant aliphatic wax in the cuticle and their significant increases were the major contributors to the overall increase in total aliphatic waxes. In the case of tobacco tree and Arabidopsis, leaves that developed during conditions of WD stress exhibited significant reductions in their transpiration rates. Supporting these changes in composition, it has been demonstrated by Seo et al (2011) that significant upregulation of cuticular wax biosynthetic genes (including KCS1, KCS2, KCS6, CER1, and WSD1) accompany major increase in wax content in Arabidopsis under WD stress.  Section 1.3 The grape berry cuticle Section 1.3.1 The composition of grape berry cuticular wax  Most fleshy fruits have abundant cuticular waxes that contain triterpenoids in addition to aliphatic waxes, with oleanolic acid (OA) and ursolic acid being the most common triterpenoids found. Triterpenoids are the single largest constituent group in the cuticular wax of many fleshy fruits (Lara et al., 2015). For example, ursolic acid makes up 60% of the cuticular wax of sweet cherry fruit (Peschel et al., 2007), and triterpenoid alcohols α-, β-, and δ-amyrin are major constituents in tomato cuticular wax (Kosma et al., 2010). The grape berry is like many other fruits, with the triterpenoid OA and its precursors being major cuticular wax components (Radler, 1965). However, the triterpenoid content varies greatly between grapevine varieties; it can be as low as 42% in the Muscat d’Alsace berries and as high as 80% as in Sylvaner berries (Pensec et al., 2014).   16  The only studies that have examined the composition of cuticular aliphatic wax on grape berries have been by Radler (1965) and Grncarevic and Radler (1971). Like with triterpenoids, aliphatic wax composition in cuticular wax of grape berries is variable among varieties, with VLC-primary alcohols usually being the most prominent ones. For example, Semillon berry cuticles contained 1% VLC-alkanes, 4% VLC-esters and VLC-aldehydes, 19% VLC-primary alcohols, 3% VLC -fatty acids, 65% OA and 5% unidentified waxes. In comparison, leaf wax composition is typically very low in triterpenoid content and much higher in aliphatic waxes. Mature Sultana leaf cuticles contained OA 2% VLC-alkanes, 11%  VLC-esters and VLC-aldehydes, 61% VLC -primary alcohols, 8% VLC-fatty acids, 1% OA and 3% unidentified waxes (Radler, 1965). The authors could not separate the VLC-esters and VLC-aldehydes fractions.  Section 1.3.2 Oleanolic acid biosynthesis Triterpenoid biosynthesis is separate from aliphatic wax biosynthesis since this class of lipids is based on isoprene subunits instead of fatty acid derivatives. The precursor for synthesis is 2,3-oxidosqualene (2,3-OS), which is produced from the cytosolic mevalonate pathway (MEV) using isopentenyl diphosphate (IPP). The cyclization of 2,3-OS serves as a branching point for the synthesis of varied triterpenoids. To produce OA, β-amyrin synthase BAS) cyclizes 2,3-OS into β-amyrin, afterwards a cytochrome P450 enzyme (CYP716A) oxidizes β-amyrin into erythrodiol and then finally into OA (Pollier and Goossens, 2012). The intermediate oleanolic aldehyde can be formed in the process (Pensec et al., 2014). Two grapevine homologs of CYP716A have been functionally characterized as being active in OA synthesis: CYP716A15 and CYP716A17 (Fukushima et al., 2011).  17  Section 1.3.3 Cuticular wax changes during grape berry development The total amount of chloroform extracted epicuticular waxes increases during early berry development and peaks before or at veraison (onset of ripening) (Rogiers et al., 2004; Pensec et al., 2014), where numerous physiological and biochemical changes occur, which includes changes to the cuticle. Like many other fleshy fruits (Lara et al., 2015), the extractable amount of waxes decreases substantially afterwards as the berry enters ripening stages (Pensec et al., 2014). The grape berry cuticle becomes thinner during ripening as the berry expands and wax production does not keep up with the increasing surface area (Rogiers et al., 2004). In addition, the composition of berry cuticular waxes changes with development. OA content decreases with IPPBASCYP716ACYP716AErythrodiolOleanolic acidß-amyrin2,3-oxidosqualeneFigure 1.3. Oleanolic acid biosynthetic pathway. BAS = ß-amyrin synthase, IPP = isopentenyl pyrophosphate,CYP716A = a cytochrome P450 enzyme. 18 ripening as the final reaction for OA synthesis appears to terminate at later developmental stages, and becomes diluted due to increasing content of OA precursors and aliphatic waxes (Pensec et al., 2014). On the surface of the cuticle, these aliphatic waxes form high order epicuticular wax crystals, while OA form a lower ordered amorphous phase that is interlaced in between the high-order crystals (Casado and Heredia, 1999).   The water transpiration rate through the cuticle of the berry decreases over the course of berry development. The rate is initially high in pre-veraison berries, and decreases substantially to 19 % of the original rate in post-veraison berries (Rogiers et al., 2004). Aliphatic waxes rather than OA are believed to be responsible for forming the barrier to water movement through cuticle (Grncarevic and Radler, 1971). When aliphatic waxes are removed with petroleum ether vapour from the berry while keeping OA wax intact, the transpiration rate increases substantially (Grncarevic and Radler, 1971). In addition, the efficacy of individual cuticular wax components at impeding transpiration through an artificial membrane showed that OA is not at all impermeable. In contrast aliphatic waxes are barriers to water transpiration; layers of pure VLC-A BFigure 1.4. Scanning electron microscope close-up of epicuticular waxes of a pre-veraison Merlot grape berryat 25 days after anthesis. Image A show epicuticular waxes in a high-ordered crystalline state, while in image Bthe waxes are in both high-ordered crystalline and low-ordered amorphous states. Both images were taken atdifferent magnifications, with image B being at a higher magnification.Photo credit: Dr. SimoneDiego CastellarinScale Scale 19 alkanes, VLC-aldehydes, VLC-alcohols, or VLC-fatty acids all substantially decreased the transpiration rate of the membrane (Grncarevic and Radler, 1971). The developmental changes of the berry cuticle are postulated to have protective roles against biotic stresses. It is known that pre-veraison berries are more resistant to bunch rot disease (Botrytis cinerea) than ripe ones; this resistance is believed to be due to the higher OA content, which has anti-fungal and anti-bacterial properties. A correlation has been observed between cuticular wax load and susceptibility to bunch rot disease, but has yet to be actually tested (Comménil, Brunet, & Audran, 1997).   Section 1.4 Rationale for the study Application of WD stress is a common viticultural technique used in wine grape production (Gil et al., 2015), because the stress modulates the biosynthesis of secondary metabolites important to wine quality, like anthocyanins (Castellarin et al., 2007). While the general pattern of development of the grape berry cuticle is known, there are several questions that are still left unanswered. Does the aliphatic wax composition change over development, and if it does in what way? How does the grape berry cuticle change in response to stresses, and specifically WD stress? Which genes are involved in cuticular wax production in grapevine? How are the cuticular aliphatic wax and oleanolic acid biosynthetic pathways regulated during berry development and under WD stress?   Results from the transcriptome analysis of developing Merlot grapes by Savoi et al. (2017) indicated upregulation of genes annotated as wax ester synthases of the cuticular aliphatic wax biosynthetic pathway when under WD stress. Coupled with the fact that plant leaves in other species have increased wax load and reduced transpiration rate when under WD stress (Cameron, 2005; Kosma et al., 2009), the transcriptomic results led us to explore how the grape berry cuticle reacts in response to WD stress.  20 Section 1.5 Objectives of the study  I hypothesize that when severe WD stress is applied to Merlot grapevines during berry development, the berry cuticle will be modified in response. I expect to see an upregulation of the cuticular aliphatic wax biosynthetic pathway that will result in an increased wax load in the fruit’s cuticle. The increased amount of wax will lead to a decrease in the transpiration rate through the berry cuticle. To test this hypothesis, the project had three main objectives:  Objective 1: Identification of candidate grapevine cuticular wax related genes  Very little is known regarding the identity of genes involved in cuticle synthesis in grapevine. My first objective was to perform genomic and phylogenetic analyses to assemble a list of candidate genes that encode enzymes of the cuticular aliphatic wax biosynthetic pathway, the oleanolic acid biosynthetic pathway, and associated regulatory genes in V. vinifera.  Objective 2: In silico analysis of expression profiles to identify candidate genes expressed in berry tissues under WD stresses  My second objective involves in silico analyses of publicly available RNA-seq datasets of V. vinifera to characterize the expression profile of candidate genes identified in objective 1. The datasets cover expression in different tissues, varieties, development stages, and under different biotic and abiotic stresses. By identifying which of these genes are expressed in berry tissues and whether they are modulated during development or stress, the list of candidate genes can be narrowed down further.     21 Objective 3: Biological experiment assessing the impact of water deficit stress on grape berry cuticular wax  My third objective is to assess the effect of prolonged WD stress on berry cuticular wax composition, expression profile of candidate biosynthetic and regulatory genes identified in objectives 1 and 2, and water loss through the berry cuticle. A biological experiment performed in a greenhouse, in which Merlot grapevines were grown under prolonged severe WD stress was conducted to fulfill this objective. Despite the focus of this project on the berry cuticle, leaf cuticular wax and its response to WD stress will also be investigated and compared with that of the grape berry.    22 Chapter 2: Materials & Methods Section 2.1 Genomic analysis to identify candidate cuticular wax genes in grapevine Section 2.1.1 Searching for candidate biosynthetic genes A series high of throughput BLASTp searches using the protein sequences of characterized cuticular wax biosynthetic genes was performed to identify candidate homolog genes in grapevine. Phylogenetic trees were then built to narrow down the list of candidate genes (Figure 2.1.1).  BLASTp searches were performed locally using the command line version of NCBI BLAST+ v2.3.  The first series of BLASTp searches used genes described in published literature as query sequences (Table 2.1.2), with their protein sequences obtained from the plant genome duplication database (PGDD) (Lee et al., 2013). The obtained sequences were then used to search (e-value cut-off: 1e-10) the translated transcriptome of the original organism (A. thaliana, M. truncatula, or V. vinifera) to identify all potential gene family members.  In the second series of BLASTp searches, identified sequences from the first series of searches were used as queries for the identification of protein homologs (e-value cut-off 1e-10) in six economically important species (grapevine, barley, apple, poplar, tomato, maize) and Arabidopsis. The searches in seven species were performed in order to increase the confidence level of the branches in the generated phylogenetic trees built later on. Translated transcriptomes came from the PGDD (Lee et al., 2013). For grapevine, the grapevine 12X V1 translated transcriptome was used (Vitulo et al., 2014). Multi-sequence alignments of the resulting protein sequences were performed using ClustalW in MEGA6 (Tamura et al., 2013) with default settings. Phylogenetic trees were then created in MEGA6 using the most-likelihood method with the JTT model (Hall, 2013) using default settings and 1000 bootstrap replicates. Sequences were removed from the alignment and subsequent tree if they prevented tree construction due to no common sites being present for  23 calculating distance between sequences. Selecting sequences for removal from the tree ended up generally following protein length size cutoffs described in Table 2.1.1. Applying protein length size thresholds did not significantly change the tree topology (data not shown). Phylogenetic tree branches were condensed if bootstrap values were below 50%. Grapevine genes that segregated within the same clade as the original characterized gene were deemed the most likely candidates for genes encoding enzymes involved in cuticular aliphatic wax or oleanolic acid biosynthesis in grapevine. Candidate cuticular wax genes were named with the Vvi suffix, the most closely related characterized gene, and a gene copy number in ascending order of the locus id when more than one homolog gene was present in the clade with an Arabidopsis gene. WSD1 and CER6 in Arabidopsis belong to large expanded gene families, their grapevine homologs were named VviWSD and VviKCS, respectively, with a gene copy number indicated at the end. Duplication data of the homologs of cuticular aliphatic wax biosynthetic genes (Appendix Figure 3.2.1) were originally produced for Wong et al. (2016b), and were provided by Dr. Darren Wong.   24    	 	 Dropout	rate	Gene	Name	 Protein	size	cutoff	 All	sequences	 Grapevine	sequences	CER2;	CER2-LIKE1;	CER2-LIKE2	 Kept	all	 57/57	 8/8	PAS2	 Kept	all	 20/20	 2/2	CER10	 X	>	50%	 38/43	 5/6	CER1;	CER3	 X	>	70%	 43/73	 9/11	KCR1	 84.5%	<	X	<	120%	 81/110	 11/16	CER6	 50%	<	X	<	120%	 196/229	 25/27	CER4	 X	>	65%	 51/74	 4/8	WSD1	 X	>	41%	 54/81	 11/18	CYP716A	 X	>	65%	 61/85	 12/22	BAS	 75%	<	X	<	120%	 85/168	 17/51	  Homolog Homolog HomologBLASTpBLASTp BLASTp BLASTpPotential homologs in diverse speciesProtein sequence of a characterized biosynthetic geneFilter sequences by sizeMEGA6MEGA6Aligned sequencesPhylogenetic TreesList of candidate biosynthetic homologs in grapevineSearch translated transcriptome of species the characterized gene is from to find all potential gene family membersSearch translated transcriptome of diverse species to find all potential homologs, including: Arabidopsis, barley, apple, poplar, maize, tomato, grapevineGrapevine sequences clustering in same clade as original characterized gene are assumed to be most likely functional homologsFigure 2.1.1. Flow chart for steps in identifying candidate genes in grapevine encodingcuticular wax biosynthetic enzymes. White background are processing steps, shadedbackground are data.Table 2.1.1. BLASTp results were filtered when constructing phylogenetic trees. Protein sequence sizes when compared to the original query sequences that fell within the stated cutoffs indicated below were kept for tree construction.  25 Section 2.1.2 Searching for transcription factors related to grapevine cuticular wax biosynthesis To identify candidate transcription factors (TFs) in grapevine, a BLASTp search using the protein sequences of characterized TFs (Table 2.1.2) involved in cuticular wax biosynthesis (Bernard and Joubès, 2013; Yeats and Rose, 2013; Borisjuk et al., 2014) as query sequences in the grapevine 12X V1 translated transcriptome (Vitulo et al., 2014) was carried out. The top 1-3 search hits were considered the most likely candidate genes. The results were then cross-referenced with the published literature to assign them their given annotated names (Licausi et al., 2010; Leida et al., 2016; Wong et al., 2016b; Li et al., 2017) and check their proposed functional annotation (Grimplet et al., 2012) (Figure 2.1.2.).                   Protein sequence of characterized regulatory geneBLASTpCross-reference with literatureFilter for top resultsList of candidate regulatory homologs in grapevineSearch in grapevine 12X translated transcriptomeFigure 2.1.2. Flow chart for steps inidentifying candidate regulatory genesinvolved in regulating cuticular waxbiosynthesis. White background areprocessing steps, shaded background aredata. 26 Table 2.1.2. List of genes that have been demonstrated to be involved in cuticular wax biosynthesis, oleanolic acid biosynthesis, and transcription factors involved in the regulation cuticular wax. The protein sequences of these genes were used as query sequences for BLASTp searches in grapevine and other plant genomes.         Gene Name Pathway Locus ID Species Reference CER6 Aliphatic wax At1g68530 A. thaliana (Fiebig et al., 2000) KCR1 Aliphatic wax At1g67730 A. thaliana (Beaudoin et al., 2009) PAS2 Aliphatic wax At5g10480 A. thaliana (Bach et al., 2008) CER10 Aliphatic wax At3g55360 A. thaliana (Zheng et al., 2005) CER2 Aliphatic wax At4g24510 A. thaliana (Haslam et al. 2012) CER2-LIKE1 Aliphatic wax At4g13840 A. thaliana (Haslam et al. 2015) CER2-LIKE2 Aliphatic wax At3g23840 A. thaliana (Haslam et al. 2015) CER1 Aliphatic wax At1g02205 A. thaliana (Bernard et al., 2012) CER3 Aliphatic wax At5g57800 A. thaliana (Bernard et al., 2012) CER4  Aliphatic wax At4g33790 A. thaliana (Rowland et al., 2006) WSD1 Aliphatic wax At5g37300 A. thaliana (Li et al., 2008) MAH1 Aliphatic wax At1g57750 A. thaliana (Greer et al., 2007) BAS Oleanolic Acid At1g78950 A. thaliana (Shibuya et al., 2009) CYP716A12 Oleanolic Acid MTR_8g100135 M. truncatula (Fukushima et al., 2011) CYP716A15 Oleanolic Acid - V. vinifera (Fukushima et al., 2011) CYP716A17 Oleanolic Acid - V. vinifera (Fukushima et al., 2011) MYB96 Transcription Factor At5g62470 A. thaliana (Seo et al., 2011)  MYB94 Transcription Factor At3g47600 A. thaliana (Lee et al., 2016) MYB30 Transcription Factor At3g28910 A. thaliana (Raffaele et al., 2008) MYB41 Transcription Factor At4g28110 A. thaliana (Cominelli et al., 2008) CER7 Transcription Factor At3g60500 A. thaliana (Lam et al., 2015) SHN1/WIN1 Transcription Factor At1g15360 A. thaliana (Kannangara et al., 2007) SHN2 Transcription Factor At5g11190 A. thaliana (Shi et al., 2011) SHN3 Transcription Factor At5g25390 A. thaliana (Shi et al., 2011) CER9 Transcription Factor At4g34100 A. thaliana (Lu et al., 2012) MYB106 Transcription Factor At3g01140 A. thaliana (Oshima et al., 2013) MYB16 Transcription Factor At5g15310 A. thaliana (Oshima et al., 2013) CFL1 Transcription Factor Os02g31140 O. sativa (Wu et al., 2011) HDG1 Transcription Factor At3g61150 A. thaliana (Wu et al., 2011) WPX1 Transcription Factor AEX93412 M. truncatula (Zhang et al., 2005) WPX2 Transcription Factor AEX93413 M. truncatula (Zhang et al., 2007) WRI1 Transcription Factor At3g54320 A. thaliana (To et al., 2012) WRI3 Transcription Factor At1g16060 A. thaliana (To et al., 2012) WRI4 Transcription Factor At1g79700 A. thaliana (Park et al., 2016) ZmOCL1 Transcription Factor GRMZM2G026643 Z. mays (Javelle et al., 2010) VviERF045 Transcription Factor VIT_04s0008g06000 V. vinifera (Leida et al., 2016) BES1 Transcription Factor At1g19350 A. thaliana (Li et al., 2009) DEWAX Transcription Factor At5g61590 A. thaliana (Go et al., 2014)  27 Section 2.2 In silico analysis of RNA-seq data to characterize expression of candidate genes among grapevine tissues and berry development, during under biotic and abiotic stresses. Section 2.2.1 Data processing The transcriptomic analysis involved in silico analysis of 10 single-end and paired end RNA-seq datasets from in-house (Savoi et al., 2016; Savoi et al., 2017) sources and publicly available sources obtained from the DNA data bank of Japan (DDBJ) service (Mashima et al., 2016). Datasets examined different grapevine tissues, different varieties, under different biotic and abiotic environmental stresses, and at different developmental stages. In-house datasets examined and DDBJ datasets are described in Table 2.2.1. Since the datasets came from different experiments and were processed by the original authors with different methods, all raw data were reprocessed using the same pipeline of analysis (Figure 2.2.1.). Raw reads were downloaded in fastq format using the SRA toolkit fastq-dump. Single-end and paired-end Illumina datasets were first processed by trimming for read quality and removal of adapter sequences using Trimmomaticv0.36 (Bolger et al., 2014) with the following settings: LEADING: 3, TRAILING: 3, SLIDINGWINDOW: 4:15, MINLEN: 40, AVGQUAL: 20. Trimmed reads were then aligned to the 12X V1 grapevine genome (Vitulo et al., 2014) using HISAT2v2.04 (Kim et al., 2015) with default settings. A minimum read length of 40 bases had been used for trimming Illumina datasets, ABI SOLiD reverse-end reads were all shorter than the minimum length and were discarded. Thus, the remaining forward-end reads of ABI SOLiD datasets were treated as single-end. PASSv2.30 aligner (Campagna et al., 2009) was then used for quality trimming and alignment to the 12X V1 grapevine genome with the following settings: -p 1111111001111111, -check_block 5000, -csfastq, -flc 1, -seeds_steps 3, -fid 90, -b, - 28 l, -fle 40.  Read count summarization was then performed on all the aligned reads with the grapevine V1 annotation using featureCounts (Liao et al., 2014) on default settings.  Section 2.2.2 Transcript abundance and differential expression analysis Transcript abundance was calculated with edgeR-glm (Robinson and Smyth, 2008) and expressed in terms of Log2 of reads per kilobase of transcript per million mapped reads (RPKM) for single-end datasets or fragments per kilobase of transcript per million mapped reads (FPKM) for paired-end datasets. Differential expression (DE) analysis was performed on the RNA-seq datasets using edgeR-glm and expressed in terms of Log2(fold-change), with significance being determined if the false discovery rate was < 0.05. DE comparisons were made between developmental stages and between environmental stress treatments and controls. Genes showing strong expression in berry skin tissue, and/or differential expression under environmental stresses were identified as putative genes involved in the biosynthesis of cuticular waxes in grapevine berry and were chosen for RT-qPCR in section 2.3.4.  29   Raw sequence readsPASSAligned readsRaw countsFeatureCountsedgeR-glmLog2(RPKM/FPKM) Log2FC of DE genesTrimmed sequence readsTrimmomaticHISAT2Illumina dataset alignmentABI SOLiDdataset alignmentCount summarizationDifferential expression analysisTranscript abundanceFigure 2.2.1. Flow chart for steps in processing RNA-seq datasets. Whitebackground are processing steps, shaded background are data. 30 Table 2.2.1. List of RNA-seq studies downloaded from the DNA data bank of Japan that were reprocessed to calculate transcript abundance and differential expression. Accession Description Study Type Tissue/organ type Single or paired -end Technology Reference SRP070855 Tocai friulano, water deficit Abiotic Stress Whole berry Single-end Illumina   (Savoi et al., 2016) SRP059734 Effect of Night/Day cycle, temperature, stages of development Abiotic Stress Berry skin and flesh Paired-end Illumina   (Rienth et al., 2016) SRP055458 Thompson seedless, gibberellic acid and shade treatments Abiotic Stress Inflorescence Paired-end Illumina   N/A SRP032792 Rootstock M4 under water deficit, or salt stress Abiotic Stress Root, Leaf Paired-end ABI_SOLID N/A SRP057200 Semillon berries under Botrytis infection Biotic Stress Berry skin and flesh Single-end Illumina   (Blanco-Ulate et al., 2015) SRP049306 5 Italian cultivars, development Development Whole berry Single-end Illumina   (Palumbo et al., 2014) SRP046456 7 cultivars, late development Development Whole berry Single-end Illumina   N/A SRP067690 Cabernet Sauvignon, development Development Berry skin Paired-end Illumina   N/A SRP041212 Vitis vinifera and Vitis sylvestris, flower development  Development Flower Single-end Illumina   (Ramos et al., 2014) SRP065417 Summer Black, leaf development Development Leaf Single-end Illumina   (Pervaiz et al., 2016)                 31 Section 2.3  Biological greenhouse experiment: Assessing the impact of water deficit stress on cuticular wax composition Section 2.3.1 Experimental design A greenhouse experiment was carried out from May to August 2016 using two-year old own-rooted Merlot grapevines grown in 7.5 L pots. Environmental light was supplemented by Phillips Green Power LED top lighting (spectra: deep red, medium blue, white lights) during the early phases of the experiment until the 2nd of June in order to guarantee a minimum of 140 µmol/m2/s of PAR at the table surface for 16 hours a day.  Two irrigation treatments were applied, starting on the 13th of May at 30 days after anthesis (DAA) until the last sampling on the 3rd of August at 111 DAA. Treatments consisted of Control (CT) plants that were watered on a daily basis to maintain a leaf water potential above -0.8 MPa (Castellarin et al., 2007), and Water Deficit (WD) stress plants that were watered as needed to maintain an average leaf water potential around -1.6 to -1.8 MPa (this leaf water potential relates to severe water deficit for grapevines).  Five biological replicates were considered for each irrigation treatment and each biological replicate consisted of three vines with 1-3 developing clusters, for a total of 30 vines. In the greenhouse, the plants were spaced approximately 50 cm apart, and organized into three lanes, with each row alternating between CT and WD replicate. Secondary growth was trimmed from the plants throughout the experiment to maintain constant total leaf areas. Lastly, all other growing conditions were kept consistent regardless of the treatment and were based on the standard growing practices at the UBC Horticulture Greenhouse (Figure 2.3.1.).   32   Section 2.3.2 Physiological measurements Leaf water potential was measured at 2pm with a Scholander pressure chamber (PMS Instrument Company) according to Castellarin et al. (2007). A range of two to six fully expanded leaves per treatment were measured weekly.  Berry development was tracked by regularly measuring berry weight, and total soluble solids (°Brix). Berry soluble solids were measured from the juice of berries collected for wax and RNA analyses (see description of the sampling below) with a digital refractometer (Sper Scientific).      Figure 2.3.1. Merlot grapevine plants at the UBC Horticultural Greenhouse that were used for biologicalexperiment. Plants were positioned as shown with lights overhead. 33 Section 2.3.2 Berry and leaf sampling A set of six berries was collected from each biological replicate (two berries from each vine) at 27 DAA (pre-treatment), 41 DAA (green berries), 68 DAA (mid-veraison), 82 and 96 DAA (ripening), and 111 DAA (harvest) in order to analyze berry cuticular wax (red arrows in Figure 2.3.2.). Another set of six berries was collected at the same developmental stages from each biological replicate (two berries per vine) for performing gene expression analysis. Finally, a third set of 20 randomly selected berries from each treatment was also sampled for measuring the rate of water transpiration at 28 DAA (pre-treatment), 48 DAA (green berries), 75 DAA (late-veraison), 97 DAA (ripening), and 111 DAA (harvest) (blue arrows in Figure 2.3.2.).    In order to achive little to no disturbance of the cuticular wax layer and avoid wiping of waxes from the berry surface during the sampling, berries were held with tweezers through the pedicel and carefully trimmed off the cluster with a pair of scissors. The berries for wax extraction and measuring transpiration rates were then placed in 40 ml wide mouth glass test tubes, while those for gene expression analysis were placed in zip-lock bags. Sample sets  for  Figure 2.3.2. Sampling schedule for the greenhouse trial. Developmental stages are expressed as days afteranthesis (DAA).Red arrows indicate sampling points for berry skin RNA and berry cuticular wax collection.Blue arrows indicate sampling points for measuring berry t ranspiration rates. Leaf collection is represented bythe green arrow. Evolution of berry size and color is represented, but is not based on measured values.Mid-veraisonTreatment startTreatment end30 60 90 1200DAASampling 34 transpiration analyses were collected at different dates than those for wax and RNA analyses as time requirements for sampling and processing made it impossible to do all on the same day.  At 44 DAA, leaf samples of three sizes/maturity classes were harvested for wax and RNA analyses (green arrow in Figure 2.3.2): young leaves (1-4 nodes from shoot apex, <4 cm major vein length, average leaf area 14 cm2, light green, many visible hairs), intermediate leaves (5-7 nodes from shoot apex, 4-7 cm major vein length, average leaf area 47 cm2, slightly darker green, few visible hairs), and mature leaves (10-15 nodes from shoot apex, 9-15 cm major vein length, average leaf area 156 cm2, dark green, no visible hairs). Sampling was performed using tweezers and scissors with little disturbance to the cuticle with leaves placed in plastic boxes for transportation.   Figure 2.3.3. Berry harvesting for cuticular wax, measuring transpiration rateand gene expression analysis. 35   Section 2.3.3 Cuticular wax extraction and quantification Berry samples were brought to the laboratory just after sampling for wax extraction, which used an adapted version of the protocol described in Haslam et al. (2012) and in Haslam and Kunst (2013). Pictures of the grape berries and leaves were taken before extraction, and their dimensions measured using the GIMPv2.8.4 graphics editor. Width and height were measured and an average radius was calculated for each berry, from which the surface area was calculated with A=4πr2. Total leaf area was measured, accounting for both sides of the leaf, by selecting an area around it and counting the pixel area. The total surface area of a replicate was equal to the added surface areas of all the berries or leaves in the replicate.   Grape berries were each submerged for 30 seconds with gentle swirling in 10 ml of chloroform with 10 µg of tetracosane as an internal standard. One chloroform bath for each replicate was performed using 40 ml wide mouth glass test tubes. Samples were then transferred to 11 ml glass screw cap tubes, dried using N2 gas feed and heat block (45˚C), and finally stored at -30 ˚C until ready for further processing. Leaf samples were processed using the same method, but using a glass petri dish instead for the chloroform bath. Figure 2.3.4. Young (left), intermediate (middle), and mature (right) leaves used in leaf tissue sampling forcuticular wax and RNA extractions. The bottom two lobes of the mature leaf were removed. 36 Dried wax samples were resuspended in 930 µl of chloroform, after which 100 µl of the sample was aliquoted into an Agilent 250 µl vial insert and placed into an Agilent 2 ml wide opening screw top vial. Samples where then dried under N2 gas feed and heat block. Afterwards, 10 µl of pyridine and 10 µl of BSTFA + TMCS (99:1) were added to the aliquots and baked at 80˚C for one hour. Samples were finally ready for GC-MS analysis after drying under N2 gas feed and heat block, and then resuspended in 50 µl of chloroform. For GC-MS analysis, a sample volume of 1 µl was injected into an Agilent Technologies 6890N (G1530N) GC using an Agilent Technologies J&W DB-1ms column (122-0132) with 30 m length, 250 µm diameter, and 0.25 µm film thickness. The GC used a pulsed splitless mode with a constant gas flow of helium and the following program: 45˚C for 2 min; ramp 45 ˚C/min to 210 ˚C; hold 1 min; ramp 5 ˚C/min to 340 ˚C; hold 24 min. The separated peaks were detected using an Agilent Technologies 5975 inert XL Mass Selective detector. The GC-MS data was analyzed with Agilent Technologies MSD ChemStation E.01.01.335. Separated peaks were identified by comparing their fragmentation patterns to the Wiley Chemical Compound Library W9N08.L, and were quantified relative to the tetracosane internal standard. Cuticular wax composition of each sample was then expressed in terms of wax (µg) per tissue surface area (cm2) extracted.  Section 2.3.4 RNA sampling and RT-qPCR gene expression analysis After collection, whole berries and leaf tissues for RNA extraction were snap frozen and stored at -80˚C. Before extraction, berry skins were peeled and dropped in liquid nitrogen to keep them frozen. Berry skin and leaf samples were then ground into a fine powder in liquid nitrogen using a mortar and pestle (Wong et al., 2016a).  Total RNA was extracted from approximately 50 mg of powdered skin or leaf tissue using Sigma Aldrich Spectrum™ Plant Total RNA Kit with the standard extraction protocol. RNA  37 quality was verified by loading a 2 µl sample into a 1% agarose TAE gel and running at 80-100 volts to clearly separate the bands. RNA purity was assessed by the relative intensity of the 28s and 18s bands, and lack of smearing from degraded RNA. RNA was then quantified using a Nanodrop (Thermo Scientific™ ND-1000 Spectrophotometer). Aliquots of 1 µg of RNA were digested with Thermo Scientific™ DNASE I to remove gDNA, and cDNA was synthesized with Thermo Scientific™ RevertAid First Strand cDNA Synthesis Kit. Primers for candidate grapevine wax biosynthetic and TF genes (Table 2.1.2) were designed using IDT PrimerQuest Tool (www.idtdna.com/primerquest) and NCBI Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The primers were then verified that they targeted unique sites by BLASTn of the 12X grapevine genome (http://genomes.cribi.unipd.it/grape/blast/blast.php). Refer to Appendix Table 2.3.1 for primer sequences. For qPCR, cDNA samples were diluted (1:20 in milli-Q water) and their dilutions calibrated using the CT value for VviAP47 (VIT_02s0012g00910), the housekeeping gene that was used as reference (Savoi et al., 2017), in order to have similar VviAP47 CT values between samples. Relative expression of candidate genes to VviAP47 was measured by qPCR (Applied Biosystems 7500 Real Time PCR System; Life Technologies 7500 Software v2.0.6) using the 2-ΔCT method (Savoi et al., 2017). qPCR conditions were 50 ˚C for 2minutes; 95 ˚C for 2 minutes; 40X (95 ˚C for 15 seconds; 60 ˚C for 1 minute); 95 ˚C for 15 seconds; 60 ˚C for 1 minute; 95 ˚C for 30 seconds; 60 ˚C for 15 seconds; melting curve for 15 minutes. Annealing temperature was 60 ˚C for all the primer pairs tested.    38 Section 2.3.5 Transpiration experiment to measure rate of water loss through cuticle The surface area dimensions and weight of the grapes (20 berries per treatment) were measured as described above. Berries were handled with care in order to minimally disturb the cuticular wax surface, and were placed in a sealed desiccation chamber with their cut pedicels sealed with Vaseline. Sealing with Vaseline was compared to paraffin wax and was determined to be equally effective (data not shown). There, the berries were left to dehydrate in the dark at constant temperature (23 ˚C) and relative humidity (32%) over the course of 7 to 9 days, with their weights measured daily (Rogiers, Hatfield, Jaudzems, White, & Keller, 2004). Relative humidity was maintained with a saturated solution of MgCl2. The rate of water loss was then expressed in terms of water weight (g) per berry skin surface area (cm2) per hour (h) as in Rogiers et al. (2004).     Figure 2.3.5. Desiccation chamber with MgCl2 saturated solutionused for conducting transpiration experiments. 39 Section 2.3.7 Statistical Analysis  Two-sample Student’s t-test in Microsoft Excel v15.40 was used to determine statistical significance (*p-value<0.05; **p-value<0.01; ***p-value<0.001) between treatments (CT versus WD) at each time point for cuticular wax concentration, gene relative expression values, and transpiration rates of individual berries. A Univariate Repeated Measures ANOVA test was performed with JMP v9 to analyze the effect of the irrigation treatments (CT and WD) on water transpiration across the cuticle.    40 Chapter 3: Results Section 3.1 Genomic Analysis to identify candidate cuticular wax genes in grapevine Section 3.1.1 BLASTp search results  From the BLASTp searches, a total of 96 putative homologs involved in cuticular aliphatic wax biosynthesis and a total of 73 putative homologs involved in oleanolic acid biosynthesis were identified (Table 3.1.1). Filtering sequences for protein size and compatibility for building phylogenetic trees reduced the number to 75 and 29 homologs for cuticular aliphatic wax and oleanolic acid biosynthesis, respectively. Several genes shared the same BLASTp results, making it difficult to determine the likeliest functional homolog solely based on the BLASTp results.  This was the case for CER2, CER2-LIKE1, and CER2-LIKE2, for CER1 and CER3, and for CP716A12, CYP716A15, and CYP716A17.    Table 3.1.1. Number of putative homolog genes in the grapevine (Vitis viniferaL.) genome involved in cuticular wax biosynthesis. Query prot ein sequences ofcharact erized genes were used as search queries for BLASTp search in grapevinetranslated transcriptome. Sequence hits that were too small or long for sequencealignment were filtered out. Phylogenetic trees were construct ed with homologsfrom Arabidopsis, grapevine, tomato, poplar, apple, barley, and maize.Gene Name Pathway BLASTpresultsSize filterPhylogenetic Tree filterCER6 Aliphatic wax 27 25 25KCR1 Aliphatic wax 16 11 5PAS2 Aliphatic wax 2 2 2CER10 Aliphatic wax 6 5 3CER2 Aliphatic wax8 81CER2-LIKE1 Aliphatic wax 1CER2-LIKE2 Aliphatic waxCER1 Aliphatic wax 11 9 6CER3 Aliphatic wax 3CER4 Aliphatic wax 8 4 4WSD1 Aliphatic wax 18 11 9bAS Oleanolic Acid 51 17 17CYP716A12 Oleanolic Acid22 12 12CYP716A15 Oleanolic AcidCYP716A17 Oleanolic Acid 41 The top 1-3 BLASTp results were taken as the likeliest grapevine functional homologs that correspond to transcription factors involved in cuticular aliphatic wax biosynthesis (Table 3.1.2). All of the resulting MYB (Wong et al., 2016b) and homeodomain (Li et al., 2017) genes, and most of the AP2/ERF (Licausi et al., 2013; Leida et al., 2016) genes from the search had already been annotated, thus, their names were maintained. Several TFs shared the same BLASTp results: MYB16 and MYB106; MYB30, MYB94, and MYB96; SHN1/WIN1, SHN2 and SHN3; HG1 and ZMOCL1; WPX1 and WPX2; WRI1, WRI2, and WRI3. The BLASTp results were also cross-referenced with Grimplet et al. (2012), to find the predicted functional annotations for those genes (Table 3.1.2). The major classifications were MYB domain protein, AP2/ERF transcription factor, brassinosteroid signaling positive regulator, E3 ubiquitin protein ligase, and exosome complex component. 42  Query gene(s) BLASTp result locus ID Top BLASTp homolog Annotated name Functional annotation (Grimplet et al., 2012) CER9 VIT_03s0063g00080 CER9   E3 ubiquitin-protein ligase MARCH6 VIT_07s0031g00230     E3 ubiquitin-protein ligase MARCH6 CER7 VIT_04s0008g06260     Exosome complex component RRP42 VIT_18s0072g00870   Exosome complex component RRP45 VIT_18s0072g00880 CER7   Exosome complex component RRP45 MYB16; MYB106 VIT_01s0026g02770   VviMYB140 (Wong et al., 2016b) Myb domain protein 106 VIT_14s0108g01080 MYB16; MYB106 VviMYB141 (Wong et al., 2016b) Myb domain protein 106 VIT_17s0000g06410   VviMYB142 (Wong et al., 2016b) MYB transcription factor MIXTA-like 2 MYB30; MYB94;  MYB96 VIT_08s0056g00800   VviMYB60  (Wong et al., 2016b) Myb domain protein 60 VIT_14s0108g00830 MYB30 VviMYB30B (Wong et al., 2016b) Myb domain protein 94 VIT_17s0000g06190 MYB94; MYB96  VviMYB30A (Wong et al., 2016b) Myb domain protein 94 MYB41 VIT_12s0134g00570 MYB41 VviMYB144 (Wong et al., 2016b) Myb domain protein 41 VIT_19s0014g03820  VviMYB145 (Wong et al., 2016b) Myb domain protein 102 VIT_00s0203g00070   VviMYB143 (Wong et al., 2016b) Myb domain protein 102 SHN1/WIN1; SHN2; SHN3 VIT_09s0002g06750 SHN1/WIN1 VviEFR042 (Leida et al., 2016) ERF/AP2 transcription factor sub B-6 SHINE VIT_04s0008g05440 SHN2 VviERF044 (Leida et al., 2016) Ethylene-responsive transcription factor SHINE 3 VIT_11s0016g05340 SHN3 VviERF043 (Licausi et al., 2010) Ethylene-responsive transcription factor SHINE 3 HDG1; ZmOCL1 VIT_12s0059g02310 HDG1; ZmOCL1 VvHB44 (Li et al 2017) PDF2 (protodermal factor2) VIT_15s0048g02000  VvHB53 (Li et al 2017) Homeodomain GLABROUS1 VIT_16s0100g00670   VvHB55 (Li et al 2017) Homeodomain GLABROUS1 CFL1 VIT_01s0146g00400 CFL1   Humj1 VviERF045 VIT_04s0008g06000 VviERF045 VviERF045 (Leida et al., 2016) Ethylene-responsive transcription factor ERF003 WPX1; WPX2 VIT_00s0662g00030     Ethylene-responsive transcription factor related to APETALA2 4 VIT_00s0662g00040   Ethylene-responsive transcription factor related to APETALA2 4 VIT_18s0001g05250 WPX1; WPX2 VviERF004 (Licausi et al., 2010) DREB sub A-6 of ERF/AP2 transcription factor (RAP2.4) WRI1; WRI3; WRI4 VIT_01s0026g01690 WRI1 VviAP2-08 (Licausi et al., 2010) Ethylene-responsive transcription factor WRINKLED 1 VIT_09s0018g01650  VviAP2-06 (Licausi et al., 2010) Wrinkled1 (AP2/ERBP) VIT_14s0108g00050  VviAP2-02 (Licausi et al., 2010) Ethylene-responsive transcription factor WRINKLED 1 VIT_11s0037g00870 WRI3; WRI4 VviAP2-01 (Licausi et al., 2010) AP2-like ethylene-responsive transcription factor DEWAX VIT_16s0013g01000 DEWAX VviERF084 (Licausi et al., 2010) Ethylene-responsive transcription factor ERF105 VIT_16s0013g01090  VviERF089 (Licausi et al., 2010) Ethylene-responsive transcription factor ERF105 VIT_16s0013g01060   VviERF108 (Licausi et al., 2010) Ethylene-responsive transcription factor ERF105 BES1 VIT_18s0001g12010 BES1   Brassinosteroid signaling positive regulator (BZR1) VIT_04s0023g01250   Brassinosteroid signaling positive regulator (BZR1) VIT_10s0003g01790     BES1/BZR1 homolog protein 4 Table 3.1.2. Putative homolog genes in the grapevine (Vitis vinifera L.) genome involved in regulating cuticular wax biosynthesis. Query protein sequences of characterized genes were used as search queries for BLASTp search in grapevine translated transcriptome. The top one to three results were selected as most probable candidates, with some results being in common between different query sequences.  43 Section 3.1.2 Phylogenetic trees  Using the filtered BLASTp results, phylogenetic trees were constructed to further narrow the number of probable grapevine cuticular aliphatic wax and oleanolic acid biosynthetic genes to 59 and 29 respectively (Table 3.1.1). Two grapevine sequences, named VviPAS2-1 and VviPAS2-2 are in the PAS2 phylogenetic tree (Figure 3.1.1), with both being equally distant to PAS2. However, the Arabidopsis sequence At5g59770 (not characterized as an aliphatic wax gene) is more closely related to VviPAS2-2 than VviPAS2-1. As opposed to all the other trees, phylogenetic trees for KCR1 (Figure 3.1.2) and CER6 (Figure 3.1.5) were created using only Arabidopsis and grapevine sequences in order to attain higher bootstrap values and better resolution of the branches.  A single clade in Figure 3.1.2 contains KCR1, KCR2, and 5 grapevine homologs that have been named VviKCR1-1 through -5. VviKCR1-1 is the grapevine gene most closely related to KCR1, with the remaining four grapevine sequences being equally more distantly related from KCR1. The phylogenetic tree for CER10 sequences (Figure 3.1.3) separated into two branches, with one containing CER10 and 3 grapevine homologs that have been named VviCER10-1 through -3. These grapevine sequences are equidistant from CER10. A single phylogenetic tree was built for CER2, CER2-LIKE1, and CER2-LIKE2 and their filtered BLASTp results (Figure 3.1.4). A clade can be formed containing all three of the characterized sequences, and two grapevine homologs. One grapevine sequence is closest in distance to CER2 and has been named VviCER2, the second one is of equal distance from all three characterized sequences and has been named VviCER2-LIKE. All 25 grapevine homologs are equally distant to CER 6 (Figure 3.1.5) and are named VviKCS1 through VviKCS25. A number of grapevine sequences are found in the same clades as  44 the KCS subfamilies identified in Joubès et al. (2008). VviKCS5 is most closely related to At2g26640 in the ζ subfamily. VviKCS18 is related to At1g01120 in the δ subfamily. VviKCS4 and VviKCS12 are related to At2g26250 and At3g52160 respectively, which are part of the ε subfamily. VviKCS3 and VviKCS23 are equally related to At1g19440 in the α subfamily. VviKCS14 and VviKCS13 are related to At1g71160 and At5g49070 respectively in the η subfamily. Lastly in the θ subfamily, VviKCS15 is most closely related to Atg04530, At1g07720 and At2g28630 are both equally most closely related to VviKCS7, followed by VviKCS1, and finally VviKCS22 is equally most distantly related to all the other members of the subfamily.  CER1 and CER3 shared the same BLASTp results, and a single phylogenetic tree (Figure 3.1.6) was built for them. The tree separates into two branches, with one branch containing a clade with CER1 and 6 grapevine homologs that are of equal distance from it. The other branch contains a clade with CER3 and three grapevine homologs that are of equal distance from it. The grapevine CER1 and CER3 homologs have been named VviCER1-1 through -6 and VviCER3-1 through -3.  The CER4 phylogenetic tree (Figure 3.1.7) contains a clade with most of the tree’s sequences residing in it, where all sequences are equally distant to CER4. This tree was not able to narrow the number of probable grapevine candidate homologs, and the four genes have been named VviCER4-1 through -4.  The phylogenetic tree for WSD1 (Figure 3.1.8) separates into three major clades. Nine of the 11 grapevine homologs reside in the same clade as WSD1 and all other Arabidopsis sequences in the tree. These grapevine sequences are all equally distant to WSD1 and have been named VviWSD1 through VviWSD9. The grapevine sequences residing outside the selected clade have been named WSD1 homolog 1 and WSD1 homolog 2.   45    Phylogenetic trees for BAS (not shown) and CYP716A (Figure 3.1.9) genes were not able to narrow the number of putative grapevine homologs, with 17 and 12 putative homologs remaining, respectively.    Figure 3.1.1. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the PAS2 gene. The tree with the highest loglikelihood (-1642.9765) is shown. The percentage of trees in which the associated taxa clustered together isshown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristicsearch were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated usinga JTT model. The analysis involved 20 amino acid sequences. All positions containing gaps and missing datawere eliminated. There were a total of 74 positions in the final dataset. Evolutionary analyses were conducted inMEGA6. ← and * highlight the characteri zed Arabidopsis sequences that were used as BLASTp queri es andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. MDP0000155416 pt  Potri.001G235400 sl  Solyc11g073130.1 VIT 06s0004g04130.t01 at  AT5G59770 hv  MLOC 62418 zm  GRMZM2G035202 VIT 00s0313g00040.t01 at  AT5G10480 pt  Potri.007G010900 zm  GRMZM2G151087 zm  GRMZM2G181266 sl  Solyc04g014370.2 sl  Solyc11g010590.1 MDP0000130010 MDP0000225180 MDP0000337353 MDP0000216315 MDP0000294616 MDP000022938294677494PAS2**VviPAS2-1VviPAS2-2 46          Figure 3.1.2. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the KCR1 gene. The tree with the highest loglikelihood (-7572.2094) is shown. The percentage of trees in which the associated taxa clustered together isshown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristicsearch were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated usinga JTT model. The analysis involved 34 amino acid sequences. All positions containing gaps and missing datawere eliminated. There were a total of 164 positions in the final dataset. Evolutionary analyses were conductedin MEGA6.← and * highlight the characterized Arabidopsis sequences that were used as BLASTp queries andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. VIT 06s0004g05430.t01 VIT 08s0007g00900.t01 VIT 13s0019g02130.t01 at  AT2G29290 at  AT2G29350 at  AT5G06060 at  AT2G17845 at  AT1G49670 VIT 06s0080g00990.t01 at  AT1G24360 VIT 01s0010g02670.t01 VIT 17s0000g01840.t01 at  AT1G10310 VIT 12s0035g01780.t01 at  AT1G24470 at  AT1G67730 VIT 01s0137g00180.t01 VIT 01s0137g00070.t01 VIT 01s0137g00160.t01 VIT 01s0137g00130.t01 VIT 01s0137g00170.t01 at  AT5G65205 VIT 07s0031g01250.t01 at  AT5G10050 at  AT3G03330 VIT 04s0023g00860.t01 VIT 18s0001g06750.t01 VIT 01s0146g00070.t01 at  AT5G50700 at  AT5G50600 at  AT5G50690 at  AT5G50590 at  AT3G47360 at  AT3G47350100100998710099991009910010099757410010058628750KCR1******KCR2*********VviKCR1-2VviKCR1-3VviKCR1-1VviKCR1-4VviKCR1-5 47   Figure 3.1.3. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the CER10 gene. The tree with the highest loglikelihood (-12.1677) is shown. The percentage of trees in which the associ ated taxa clustered together is shownnext to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristic searchwere obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using a JTTmodel. The analysis involved 38 amino acid sequences. All positions containing gaps and missing data wereeliminated. There were a total of 1 positions in the final dataset. Evolutionary analyses were conducted inMEGA6. ← and * highlight the characteri zed Arabidopsis sequences that were used as BLASTp queri es andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. zm  GRMZM2G481843 zm  GRMZM5G860072 zm  GRMZM2G394968 zm  GRMZM2G105855 zm  GRMZM2G073929 VIT 19s0014g00080.t01 VIT 13s0067g01830.t01 VIT 13s0019g01260.t01 sl  Solyc11g006300.1 sl  Solyc11g006290.1 sl  Solyc11g006270.1 sl  Solyc05g054490.2 pt  Potri.010G245300 pt  Potri.010G245200 pt  Potri.010G204400 pt  Potri.008G055400 pt  Potri.008G013100 pt  Potri.008G012800 pt  Potri.008G012700 MDP0000722934 MDP0000555908 MDP0000275694 MDP0000238910 MDP0000062802 hv  MLOC 68045 hv  MLOC 59964 at  AT5G16010 at  AT3G55360 MDP0000256647 MDP0000321260 VIT 13s0067g01730.t01 zm  GRMZM2G449033 at  AT2G38050 pt  Potri.005G047800 pt  Potri.016G110600 pt  Potri.T122200 sl  Solyc10g086500.1 VIT 08s0007g01760.t01999999CER10*****VviCER10-1VviCER10-3VviCER10-2 48  Figure 3.1.4. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of CER2, CER2-LIKE1 and CER2-LIKE2 genes.The tree with the highest log likelihood (-10602.1895) is shown. The percentage of trees in which the associatedtaxa clustered together is shown next to the branches, with branches below 50 percent condensed together.Initial tree(s) for the heuristic search were obtained by applying the Neighbor-Joining method to a matrix ofpairwise distances estimated using a JTT model. The analysis involved 57 amino acid sequences. All positionscontaining gaps and missing data were eliminated. There were a total of 143 positions in the final dataset.Evolutionary analyses were conducted in MEGA6. ← and * highlight the characteri zed Arabidopsis sequencesthat were used as BLASTp queri es and grapevine (Vitis vinifera L) sequences respectively. Bold black bracketsdenote clades that contain the characterized Arabidopsis sequences, and genes that are most closely rel ated andare the likeliest functionally related homologs. pt  Potri.005G028100 pt  Potri.005G028000 pt  Potri.018G105500 pt  Potri.018G105400 pt  Potri.018G104700 pt  Potri.018G104800 sl  Solyc07g005760.2 zm  GRMZM2G035584 zm  GRMZM2G158083 at  AT5G48930 VIT 09s0018g01190.t01 sl  Solyc03g117600.2 pt  Potri.003G183900 pt  Potri.001G042900 VIT 11s0037g00570.t01 pt  Potri.006G165200 pt  Potri.014G166600 at  AT3G48720 VIT 17s0000g00950.t01 pt  Potri.019G126400 zm  GRMZM2G152969 zm  GRMZM2G005046 VIT 02s0087g00470.t01 MDP0000212465 pt  Potri.001G127600 sl  Solyc06g051320.2 MDP0000271527 at  AT3G30280 MDP0000671808 sl  Solyc08g078030.2 hv  MLOC 51967 zm  GRMZM2G128564 VIT 14s0030g01950.t01 MDP0000242697 pt  Potri.013G039900 pt  Potri.013G039700 pt  Potri.005G052200 MDP0000129763 VIT 04s0008g04800.t01 at  AT4G29250 zm  GRMZM2G098239 zm  GRMZM2G315767 at  AT4G13840 at  AT3G23840 pt  Potri.001G319200 MDP0000478556 MDP0000698860 VIT 05s0029g00480.t01 sl  Solyc09g092270.2 at  AT4G24510 sl  Solyc12g087980.1 VIT 18s0001g07640.t01 pt  Potri.005G153600 MDP0000275850 MDP0000137138 MDP0000377710 MDP00004810659910099100100100100100100986350929810073549810071100977010073715383687698100619860687899695197CER2-LIKE1CER2-LIKE2CER2********VviCER2VviCER2-LIKE 49  Figure 3.1.5. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the CER6 gene. The tree with the highest loglikelihood (-11462.5260) is shown. The percentage of trees in which the associated taxa clustered together isshown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristicsearch were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated usinga JTT model. The analysis involved 46 amino acid sequences. All positions containing gaps and missing datawere eliminated. There were a total of 236 positions in the final dataset. Evolutionary analyses were conductedin MEGA6.← and * highlight the characterized Arabidopsis sequences that were used as BLASTp queries andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. Coloured boxes indicate KCS subclasses as described by Joubes et al (2008).* VIT 07s0141g00060.t01 VIT 07s0141g00070.t01 VIT 07s0141g00030.t01 VIT 07s0141g00090.t01 at  AT1G04220 at  AT5G43760 VIT 05s0020g04540.t01 at  AT2G26640 VIT 04s0008g04710.t01 at  AT3G10280 at  AT2G46720 VIT 15s0048g02720.t01 at  AT1G01120 VIT 04s0008g02250.t01 at  AT2G26250 VIT 09s0070g00300.t01 at  AT3G52160 at  AT2G15090 at  AT4G34250 at  AT4G34520 at  AT2G16280 at  AT4G34510 at  AT1G19440 VIT 03s0063g02640.t01 VIT 18s0001g12550.t01 VIT 19s0015g02000.t01 at  AT1G71160 VIT 12s0034g01840.t01 at  AT5G49070 VIT 10s0042g01230.t01 VIT 16s0022g01570.t01 VIT 16s0022g01580.t01 VIT 16s0022g02190.t01 VIT 18s0001g02720.t01 at  AT5G04530 VIT 13s0067g03890.t01 VIT 00s0317g00160.t01 VIT 06s0004g04000.t01 at  AT1G07720 at  AT2G28630 at  AT1G25450 at  AT1G68530 VIT 01s0011g03490.t01 VIT 19s0093g00440.t01 VIT 14s0006g02990.t01 VIT 15s0021g02170.t01100729910097100838582971001001009999999993998964718070899875856568*****CER6****CER60***************ζζδεβαηθγVviKCS5VviKCS18VviKCS4VviKCS12VviKCS3VviKCS23VviKCS14VviKCS13VviKCS15VviKCS7VviKCS1VviKCS22VviKCS2VviKCS6VviKCS8VviKCS9VviKCS10VviKCS11VviKCS16VviKCS17VviKCS19VviKCS21VviKCS20VviKCS25VviKCS24 50  Figure 3.1.6. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of CER1 and CER3 genes. The tree with thehighest log likelihood (-13811.0350) is shown. The percentage of trees in which the associated taxa clusteredtogether is shown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for theheuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distancesestimated using a JTT model. The analysis involved 43 amino acid sequences. All positions containing gaps andmissing data were eliminated. There were a total of 361 positions in the final dataset. Evolutionary analyseswere conducted in MEGA6. ← and * highlight the characteri zed Arabidopsis sequences that were used asBLASTp queries and grapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote clades thatcontain the characterized Arabidopsis sequences, and genes that are most closely relat ed and are the likeliestfunctionally related homologs.** MDP0000054178 MDP0000077392 MDP0000516853 MDP0000461409 MDP0000069348 pt  Potri.014G180300 pt  Potri.014G152900 pt  Potri.014G152300 pt  Potri.014G152600 VIT 15s0021g00060.t01 VIT 15s0021g00050.t01 VIT 15s0021g00040.t01 VIT 15s0045g01520.t01 VIT 15s0021g00010.t01 VIT 15s0045g01590.t01 at  AT1G02190 at  AT2G37700 sl  Solyc03g065250.2 sl  Solyc08g044260.2 sl  Solyc01g088400.2 sl  Solyc01g088430.2 sl  Solyc12g100270.1 at  AT1G02205 hv  MLOC 11693 zm  GRMZM2G066578 zm  GRMZM2G075255 hv  MLOC 51499 zm  GRMZM2G099097 hv  MLOC 63893 zm  GRMZM2G029912 hv  MLOC 64491 zm  GRMZM2G083526 hv  MLOC 70751 zm  GRMZM2G114642 VIT 09s0018g01340.t01 VIT 09s0018g01360.t01 sl  Solyc03g117800.2 VIT 11s0037g01210.t01 MDP0000165547 at  AT5G57800 sl  Solyc07g006300.2 pt  Potri.006G177500 pt  Potri.018G0994001008710010090100545589995910010010010092989810067991005997991009268998797925594CER1CER3*******VviCER1-1VviCER1-2VviCER1-4VviCER1-3VviCER1-5VviCER1-6VviCER3-1VviCER3-2VviCER3-3 51  Figure 3.1.7. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the CER4 gene. The tree with the highest loglikelihood (-4050.8825) is shown. The percentage of trees in which the associated taxa clustered together isshown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristicsearch were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated usinga JTT model. The analysis involved 51 amino acid sequences. All positions containing gaps and missing datawere eliminated. There were a total of 69 positions in the final dataset. Evolutionary analyses were conducted inMEGA6. ← and * highlight the characteri zed Arabidopsis sequences that were used as BLASTp queri es andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. pt  Potri.006G196500 pt  Potri.016G062200 VIT 08s0007g07100.t01 at  AT3G11980 sl  Solyc03g051960.2 VIT 05s0124g00300.t01 pt  Potri.016G031600 at  AT3G56700 sl  Solyc09g009570.1 sl  Solyc09g005940.2 sl  Solyc09g009580.2 zm  GRMZM2G120987 hv  MLOC 11135 hv  MLOC 13613 zm  GRMZM2G480516 hv  MLOC 18417 zm  GRMZM2G036217 zm  GRMZM2G319345 hv  MLOC 50470 zm  GRMZM2G120938 hv  MLOC 58983 hv  MLOC 56515 hv  MLOC 9841 sl  Solyc01g104200.2 sl  Solyc11g067170.1 sl  Solyc11g067180.1 sl  Solyc06g074410.2 at  AT5G22420 at  AT3G44560 at  AT3G44550 at  AT3G44540 at  AT5G22500 pt  Potri.004G185000 pt  Potri.009G144900 sl  Solyc11g067190.1 VIT 06s0080g00120.t01 sl  Solyc06g074390.2 at  AT4G33790 pt  Potri.004G185100 pt  Potri.009G145000 VIT 06s0080g00110.t01 MDP0000258393 MDP0000192471 MDP0000185343 MDP0000185345 pt  Potri.019G075200 pt  Potri.019G075300 MDP0000295734 MDP0000490833 MDP0000261499 MDP000030951798958599517171929782777251698074548070907856CER4****VviCER4-1VviCER4-2VviCER4-4VviCER4-3 52  Figure 3.1.8. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the WSD1 gene. The tree with the highest loglikelihood (-4625.1050) is shown. The percentage of trees in which the associated taxa clustered together isshown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for the heuristicsearch were obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated usinga JTT model. The analysis involved 58 amino acid sequences. All positions containing gaps and missing datawere eliminated. There were a total of 65 positions in the final dataset. Evolutionary analyses were conducted inMEGA6. ← and * highlight the characteri zed Arabidopsis sequences that were used as BLASTp queri es andgrapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote cl ades that contain thecharact erized Arabidopsis sequences, and genes that are most closely related and are the likeliest functionallyrelated homologs. at  AT5G12420 at  AT5G16350 at  AT5G22490 at  AT5G53380 at  AT5G53390 at  AT2G38995 at  AT5G37300 pt  Potri.012G014200 at  AT3G49210 at  AT3G49190 at  AT3G49200 hv  MLOC 74286 zm  GRMZM2G077375 hv  MLOC 73162 hv  MLOC 57805 hv  MLOC 60394 MDP0000120935 MDP0000273229 sl  Solyc10g009430.2 pt  Potri.019G070900 pt  Potri.T076800 pt  Potri.019G071000 pt  Potri.T170200 pt  Potri.014G098900 VIT 16s0098g00380.t01 sl  Solyc01g011430.2 VIT 15s0046g00480.t01 VIT 15s0046g00490.t01 VIT 15s0046g00510.t01 VIT 15s0046g00520.t01 VIT 15s0046g00590.t01 VIT 15s0046g00660.t01 VIT 15s0046g00700.t01 VIT 15s0046g00710.t01 at  AT1G72110 sl  Solyc03g083380.2 sl  Solyc01g095960.2 VIT 03s0063g00120.t01 pt  Potri.001G304600 sl  Solyc01g107900.2 MDP0000262955 MDP0000253706 MDP0000318270 MDP0000256715 MDP0000294279 MDP0000438977 pt  Potri.007G139600 pt  Potri.017G010300 sl  Solyc07g053890.2 pt  Potri.017G010700 pt  Potri.017G011700 sl  Solyc12g010590.1 VIT 12s0028g03480.t01 pt  Potri.013G085100 pt  Potri.017G010500 MDP0000316874 MDP0000195773 MDP0000235068951009692979610010080809510098996866956497897278917150WSD1***********VviWSD1VviWSD2VviWSD3VviWSD4VviWSD7VviWSD5VviWSD6VviWSD8VviWSD9WSD1 homolog 1WSD1 homolog 2 53   pt  Potri.018G134000 pt  Potri.T167900 pt  Potri.T168000 pt  Potri.018G134300 pt  Potri.018G134700 pt  Potri.018G135100 at  AT5G36110 at  AT5G36140 pt  Potri.018G149300 pt  Potri.006G085500 VIT 04s0008g02960.t01 mt  Medtr8g100135 sl  Solyc05g021390.2 sl  Solyc07g042880.1 VIT 11s0065g00130.t01 VIT 11s0065g00040.t01 VIT 18s0072g00580.t01 MDP0000478473 MDP0000196008 MDP0000147638 MDP0000254498 MDP0000142244 pt  Potri.007G002400 VIT 11s0065g00630.t01 pt  Potri.012G115300 MDP0000240660 MDP0000286068 MDP0000934840 pt  Potri.013G106200 pt  Potri.019G080500 pt  Potri.013G106100 pt  Potri.019G078600 sl  Solyc06g065420.1 sl  Solyc06g065430.2 VIT 18s0041g01500.t01 VIT 18s0041g01800.t01 VIT 15s0024g01830.t01 VIT 18s0041g01580.t01 VIT 18s0041g01590.t01 VIT 18s0041g01810.t01 MDP0000252963 MDP0000941269 pt  Potri.001G003100 pt  Potri.001G002800 pt  Potri.001G003000 sl  Solyc11g056670.1 mt  Medtr8g089190 MDP0000199164 sl  Solyc02g069600.2 pt  Potri.001G440200 VIT 10s0092g00070.t01 pt  Potri.011G155600 MDP0000318069 MDP0000911067 MDP0000427970 MDP0000130449 MDP0000229468 MDP0000440922 MDP0000118943 MDP0000146221 MDP00003129839896949699778583759999989999987965799466568080627785938453675762CYP716A12************Figure 3.1.9. Molecular phylogenetic analysis by Maximum Likelihood method based on the JTT matrix-basedmodel with 1000 bootstrap permutations for putative homlogs of the CYP716A12 protein. The tree with thehighest log likelihood (-5020.7444) is shown. The percentage of trees in which the associat ed taxa clusteredtogether is shown next to the branches, with branches below 50 percent condensed together. Initial tree(s) for theheuristic search were obtained by applying the Neighbor-Joining method to a matrix of pairwise distancesestimated using a JTT model. The analysis involved 61 amino acid sequences. All positions containing gaps andmissing data were eliminated. There were a total of 79 positions in the final dataset. Evolutionary analyses wereconducted in MEGA6. ← and * highlight the characterized M. truncatula sequence that was used as BLASTpqueries and grapevine (Vitis vinifera L) sequences respectively. Bold black brackets denote clades that containthe characterized CYP716A12 M. truncatula sequence, and genes that are most closely related and are thelikeliest functionally related homologs. 54 Section 3.2 In-silico expression analysis of candidate genes  The expression levels and differential expression (DE) patterns of the genes identified from the phylogenetic analysis were examined in order to further narrow the list to the likeliest functionally relevant homologs. The expression levels among several organs and berry developmental stages, as well as the DE patterns among berry developmental stages, and under biotic and abiotic stresses were analyzed.  Section 3.2.1 Expression levels of candidate genes in grapevine tissues  The general expression patterns of cuticular aliphatic wax (Figure 3.2.1.) and oleanolic acid (Figure 3.2.2) were examined in root, leaf, inflorescence, flower, and berry tissues of grapevine. The genes in figures 3.2.1 and 3.2.3 are ordered according to which part of the cuticular aliphatic wax biosynthetic pathway they belong to. From top to bottom: fatty acid elongation (PAS2, KCR1, CER10, CER2, CER2-LIKE, CER6), alkane forming branch (CER3, CER1), and alcohol forming branch (CER4, WSD1).  VviPAS2-1 showed strong consistent expression in all tissues, while VviPAS2-2 showed weaker expression in all tissues. Among VviKCR1 genes, only VviKCR1-1 showed strong consistent expression in all tissues, the other genes showed very little expression in tissues. All VviCER10 genes showed expression, with VviCER10-1 being strong and consistent in all tissues. The other two genes had comparable expression in leaf tissue to VviCER10-1, but were much weaker in expression in other tissues.   VviCER2 and VviCER2-LIKE were expressed in all tissues except for root. The expression for these two genes was higher early in development, and decreased later on. VviCER2 was much stronger in expression in leaf tissue than VviCER2-LIKE, which was only weakly expressed in mature leaves.  VviKCS genes either showed little to no expression in most or all tissues, or were strongly  55 expressed in most or all tissues, including VviKCS3, 4, 5, 6, 7, 11, 15, 16, 18, 22, and 23.  Only VviCER3-3 showed strong consistent expression in grapevine tissues. None of the VviCER1 genes showed expression in berry or leaf tissue, with some low expression in inflorescences and flowers.  VviCER4 genes showed no expression in berry tissue. VviCER4-1 showed higher expression in flower bud tissue, as did VviCER4-3 which also had expression in leaf and strong expression root tissues.  Among wax synthase genes, VviWSD1, VviWSD2, and WSD1 homolog 1 had strong expression which increased with development in berry tissues. VviWSD2 and WSD1 homolog 1 also exhibited strong expression in leaf tissues.  Of the putative grapevine BAS homologs, four of them showed expression in berry tissue, with VIT_09s0054g01220 having the highest expression in berry skin compared to all other tissues and BAS homologs tested. Two CYP716A (VIT_11s0065g00040 and VIT_11s0065g00130) homologs showed consistent expression in tissues, with VIT_11s0065g00130 being expressed in all tissues and showing very strong expression in berry tissue, which decreased with development.   56 M4_Root_T0_NotStressedX2Weeks_YoungLeafX5Weeks_MediumLeafX7Weeks_LargeLeafX10Weeks_MatureLeafSativa_Hermphrodite_Stage_BSativa_Hermphrodite_Stage_DSativa_Hermphrodite_Stage_GSativa_Hermphrodite_Stage_HInflorescence_Control_3dpbInflorescence_Control_5dpbInflorescence_Control_7dpbBarbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestC.Sauvignon_Control_Brix20C.Sauvignon_Control_Brix22C.Sauvignon_Control_Brix24C.Sauvignon_Control_Brix26Skin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38VIT_16s0098g00380VIT_15s0046g00710VIT_15s0046g00700VIT_15s0046g00660VIT_15s0046g00590VIT_15s0046g00520VIT_15s0046g00510VIT_15s0046g00490VIT_15s0046g00480VIT_12s0028g03480VIT_03s0063g00120VIT_08s0007g07100VIT_06s0080g00120VIT_06s0080g00110VIT_05s0124g00300VIT_15s0045g01590VIT_15s0045g01520VIT_15s0021g00060VIT_15s0021g00050VIT_15s0021g00040VIT_15s0021g00010VIT_11s0037g01210VIT_09s0018g01360VIT_09s0018g01340VIT_19s0093g00440VIT_19s0015g02000VIT_18s0001g12550VIT_18s0001g02720VIT_16s0022g02190VIT_16s0022g01580VIT_16s0022g01570VIT_15s0048g02720VIT_15s0021g02170VIT_14s0006g02990VIT_13s0067g03890VIT_12s0034g01840VIT_10s0042g01230VIT_09s0070g00300VIT_07s0141g00090VIT_07s0141g00070VIT_07s0141g00060VIT_07s0141g00030VIT_06s0004g04000VIT_05s0020g04540VIT_04s0008g04710VIT_04s0008g02250VIT_03s0063g02640VIT_01s0011g03490VIT_00s0317g00160VIT_18s0001g07640VIT_05s0029g00480VIT_19s0014g00080VIT_13s0067g01830VIT_13s0019g01260VIT_01s0137g00180VIT_01s0137g00170VIT_01s0137g00160VIT_01s0137g00130VIT_01s0137g00070VIT_06s0004g04130VIT_00s0313g000400 4 8ValueLocus ID Given AnnotatedNameVIT_00s0313g0004 VviPAS2-1 ††VIT_06s0004g0413 VviPAS2-2 ††VIT_01s0137g0007 VviKCR1-2VIT_01s0137g0013 VviKCR1-3VIT_01s0137g0016 VviKCR1-4VIT_01s0137g0017 VviKCR1-5VIT_01s0137g0018 VviKCR1-1 ††VIT_13s0019g0 26 VviCER10-1 ††VIT_13s0067g0183 VviCER10-2VIT_19s0014g0008 VviCER10-3VIT_05s0029g0048 VviCER2-LIKE ††VIT_18s0001g0764 VviCER2 ††VIT_00s0317g0016 VviKCS1VIT_01s0011g0349 VviKCS2VIT_03s0063g0264 VviKCS3 †VIT_04s0008g0225 VviKCS4 ††VIT_04s0008g0471 VviKCS5 †VIT_05s0020g0454 VviKCS6 ††VIT_06s0004g0400 VviKCS7 †VIT_07s0141g0003 VviKCS8VIT_07s0141g0006 VviKCS9VIT_07s0141g0007 VviKCS10VIT_07s0141g0009 VviKCS11 ††VIT_09s0070g0030 VviKCS12VIT_10s0042g01 3 VviKCS13VIT_12s0034g0184 VviKCS14VIT_13s0067g0389 VviKCS15 ††VIT_14s0006g0299 VviKCS16 ††VIT_15s0021g0 7 VviKCS17VIT_15s0048g0272 VviKCS18 ††VIT_16s0022g0157 VviKCS19VIT_16s0022g0158 VviKCS20VIT_16s0022g0 19 VviKCS21VIT_18s0001g0272 VviKCS22 †VIT_18s0001g12550 VviKCS23 †VIT_19s0015g0200 VviKCS24VIT_19s0093g0044 VviKCS25VIT_09s0018g0 34 VviCER3-1VIT_09s0018g0 36 VviCER3-2VIT_11s0037g0121 VviCER3-3 ††VIT_15s0021g0001 VviCER1-1VIT_15s0021g0004 VviCER1-2 ††VIT_15s0021g0005 VviCER1-3 ††VIT_15s0021g0006 VviCER1-4VIT_15s0045g01 2 VviCER1-5 †VIT_15s0045g01 9 VviCER1-6 †VIT_05s0124g0030 VviCER4-1VIT_06s0080g0011 VviCER4-2 ††VIT_06s0080g0012 VviCER4-3 ††VIT_08s0007g0710 VviCER4-4VIT_03s0063g0012 WSD1 homolog 1 ††VIT_12s0028g0348 WSD1 homolog 2 †VIT_15s0046g0048 VviWSD1 ††VIT_15s0046g0049 VviWSD2 ††VIT_15s0046g0051 VviWSD3VIT_15s0046g0052 VviWSD4VIT_15s0046g0059 VviWSD5VIT_15s0046g00 6 VviWSD6VIT_15s0046g0070 VviWSD7 †VIT_15s0046g0071 VviWSD8 †VIT_16s0098g0038 VviWSD9Days post bloom3 5 7 20 22 24 26Berry Brix˚Berry MaturityGreenSofteningRipeningHarvestPea sizeTouchingSofteningHarvestBerry MaturityBudBud OpeningInflorescenceDifferentialtionFlower OpeningYoungMediumLargeMatureLeaf SizeM4_Root_T0_NotStressedX2Weeks_YoungLeafX5Weeks_MediumLeafX7Weeks_LargeLeafX10Weeks_MatureLeafSativa_Hermphrodite_Stage_BSativa_Hermphrodite_Stage_DSativa_Hermphrodite_Stage_GSativa_Hermphrodite_Stage_HInflorescence_Control_3dpbInflorescence_Control_5dpbInflorescence_Control_7dpbBarbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestC.Sauvignon_Control_Brix20C.Sauvignon_Control_Brix22C.Sauvignon_Control_Brix24C.Sauvignon_Control_Brix26Skin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38VIT_16s0098g00380VIT_15s0046g00710VIT_15s0046g00700VIT_15s0046g00660VIT_15s0046g00590VIT_15s0046g00520VIT_15s0046g00510VIT_15s0046g00490VIT_15s0046g00480VIT_12s0028g03480VIT_03s0063g00120VIT_08s0007g07100VIT_06s0080g00120VIT_06s0080g00110VIT_05s0124g00300VIT_15s0045g01590VIT_15s0045g01520VIT_15s0021g00060VIT_15s0021g00050VIT_15s0021g00040VIT_15s0021g00010VIT_11s0037g01210VIT_09s0018g01360VIT_09s0018g01340VIT_19s0093g00440VIT_19s0015g02000VIT_18s0001g12550VIT_18s0001g02720VIT_16s0022g02190VIT_16s0022g01580VIT_16s0022g01570VIT_15s0048g02720VIT_15s0021g02170VIT_14s0006g02990VIT_13s0067g03890VIT_12s0034g01840VIT_10s0042g01230VIT_09s0070g00300VIT_07s0141g00090VIT_07s0141g00070VIT_07s0141g00060VIT_07s0141g00030VIT_06s0004g04000VIT_05s0020g04540VIT_04s0008g04710VIT_04s0008g02250VIT_03s0063g02640VIT_01s0011g03490VIT_00s0317g00160VIT_18s0001g07640VIT_05s0029g00480VIT_19s0014g00080VIT_13s0067g01830VIT_13s0019g01260VIT_01s0137g00180VIT_01s0137g00170VIT_01s0137g00160VIT_01s0137g00130VIT_01s0137g00070VIT_06s0004g04130VIT_00s0313g000400 4 8ValueLog2(RPKM/FPKM+1)* Single-end∆ Paired-endFigure 3.2.1. Heatmap of the relative expression in terms of log2(rpkm+1) or log2(fpkm+1) of filtered grapevine(Viti vinifera L) putative h mologs involved in cuticular aliphatic wax biosynthesis. RNA-seq datasets wereretrieved from the DNA data bank of Japan and reprocessed. The datasets cover development in root, leaf, flower,inflo escence, whole berry, and berry skin tissues.Top BLASTp homologGene of Interest†   qPCR primers designed†† qPCR primers designed and used in biological experiment 57       M4_Root_T0_NotStressedX2Weeks_YoungLeafX5Weeks_MediumLeafX7Weeks_LargeLeafX10Weeks_MatureLeafSativa_Hermphrodite_Stage_BSativa_Hermphrodite_Stage_DSativa_Hermphrodite_Stage_GSativa_Hermphrodite_Stage_HInflorescence_Control_3dpbInflorescence_Control_5dpbInflorescence_Control_7dpbBarbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestC.Sauvignon_Control_Brix20C.Sauvignon_Control_Brix22C.Sauvignon_Control_Brix24C.Sauvignon_Control_Brix26Skin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38VIT_18s0072g00580VIT_18s0041g01810VIT_18s0041g01800VIT_18s0041g01590VIT_18s0041g01580VIT_18s0041g01500VIT_15s0024g01830VIT_11s0065g00630VIT_11s0065g00130VIT_11s0065g00040VIT_10s0092g00070VIT_04s0008g02960VIT_11s0065g00640VIT_11s0065g00030VIT_10s0003g03660VIT_10s0003g03650VIT_10s0003g03530VIT_10s0003g03520VIT_09s0054g01550VIT_09s0054g01520VIT_09s0054g01410VIT_09s0054g01390VIT_09s0054g01230VIT_09s0054g01220VIT_09s0054g01210VIT_09s0054g01180VIT_09s0054g01120VIT_09s0054g01110VIT_09s0018g006300 4Value Days post bloom3 5 7 20 22 24 26Berry Brix˚Berry MaturityGreenSofteningRipeningHarvestPea sizeTouchingSofteningHarvestBerry MaturityBudBud OpeningInflorescenceDifferentialtionFlower OpeningYoungMediumLargeMatureLeaf SizeFigure 3.2.2. Heatmap of the relative expression in terms of log2(rpkm+1) or log2(fpkm+1) of filteredgrapevine (Vitis vinifera L) putative homologs involved in oleanolic acid biosynthesis. RNA-seqdatasets we e retrieved from the DNA data bank of Japan and reprocessed. The datasets coverdevelopment in ro t, leaf, flower, inflorescence, whole berry, and berry skin tissues.M4_Root_T0_NotStressedX2Weeks_YoungLeafX5Weeks_MediumLeafX7Weeks_LargeLeafX10Weeks_MatureLeafSativa_Hermphrodite_Stage_BSativa_Hermphrodite_Stage_DSativa_Hermphrodite_Stage_GSativa_Hermphrodite_Stage_HInflorescence_Control_3dpbInflorescence_Control_5dpbInflorescence_Control_7dpbBarbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestC.Sauvignon_Control_Brix20C.Sauvignon_Control_Brix22C.Sauvignon_Control_Brix24C.Sauvignon_Control_Brix26Skin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38VIT_18s0072g00580VIT_18s0041g01810VIT_18s0041g01800VIT_18s0041g01590VIT_18s0041g01580VIT_18s0041g01500VIT_15s0024g01830VIT_11s0065g00630VIT_11s0065g00130VIT_11s0065g00040VIT_10s0092g00070VIT_04s0008g02960VIT_11s0065g00640VIT_11s0065g00030VIT_10s0003g03660VIT_10s0003g03650VIT_10s0003g03530VIT_10s0003g03520VIT_09s0054g01550VIT_09s0054g01520VIT_09s0054g01410VIT_09s0054g01390VIT_09s0054g01230VIT_09s0054g01220VIT_09s0054g01210VIT_09s0054g01180VIT_09s0054g01120VIT_09s0054g01110VIT_09s0018g006300 4ValueLog2(RPKM/FPKM+1)* Single-end∆ Paired-endLocus ID Gene FamilyVIT_09s0018g00630BASVIT_09s0054g01110VIT_09s0054g01120VIT_09s0054g01180VIT_09s0054g01210 †VIT_09s0054g01220 ††VIT_09s0054g01230 †VIT_09s0054g01390VIT_09s0054g01410VIT_09s0054g01 20VIT_09s0054g01 50VIT_10s00 3g03520VIT_10s00 3g035 0VIT_10s00 3g03650 †VIT_10s00 3g03660VIT_11s0065g00030VIT_11s0065g00 40VIT_04s0008g02960CYP716AVIT_10s0092g00070VIT_11s0065g00040VIT_11s0065g00130 ††VIT_11s0065g00 30VIT_15s0024g01830VIT_18s0041g01500VIT_18s0041g01580VIT_18s0041g01590VIT_18s0041g01800VIT_18s0041g018 0VIT_18s0072g00580Top BLASTp homologGene of Interest†   qPCR primers designed†† qPCR primers designed and used in biological experiment 58 Section 3.2.2 Differential expression of cuticular aliphatic wax biosynthetic candidate genes Differential expression during berry development  During development of Cabernet Sauvignon berry skin, the general trend observed for genes involved in fatty acid elongation was increased expression early in development, which then plateaued or decreased with maturity (Figure 3.2.3). Both VviPAS2-1 and VviPAS2-2 exhibited down regulation from berry softening to ripening, while VviKCR1-1 was upregulated going from green berry to berry softening. VviCER10-1 did not change in expression through development, while VviCER2 and VviCER2-LIKE were upregulated from green berry to berry softening, and then downregulated afterwards. Several VviKCS genes that showed strong expression were differentially expressed during development. VviKCS4 was downregulated from green berry to berry softening. VviKCS7 was upregulated from green berry to berry softening and then downregulated until harvest. Similarly, VviKCS15 was upregulated from berry softening to ripening, and then downregulated until harvest. Lastly, VviKCS11 was upregulated from berry softening to berry ripening.   DE (Figure 3.2.3) was also observed amongst genes of the alkane and alcohol forming pathways during development. VviCER3-3 did not change, but VviCER1-2 and VviCER1-3 decreased with development, while VviCER1-6 was upregulated. No change was observed for VviCER4-2, while VviCER4-3 was observed to be downregulated going from green berry to berry softening. Wax synthase genes WSD1 homolog 1, VviWSD1, VviWSD2 were upregulated with berry skin development.     59 Differential expression in response to high temperature stress In response to high temperature stress (Figure 3.2.3), a mixture of upregulation and downregulation was observed among cuticular wax candidate homolog genes. VviPAS2-1 was downregulated while VviPAS2-2 was upregulated. VviKCR1-1 was downregulated at early green berry stage, while VviCER10-1 showed no change in expression. VviCER2 showed upregulation at the early green stage and then downregulation at late green stage, whereas VviCER2-LIKE exhibited downregulation at the early green stage and then upregulation at ripening. Among highly expressed KCS genes, downregulation under high temperature stress was observed for VviKCS3, 4, 6, and 22, while VviKCS5 and VviKCS11 were upregulated. Lastly, VviKCS15 experienced decreased expression in the green stages, followed by upregulation at ripening.  Of genes involved in the alkane forming branch, VviCER3-3 remained unaffected, while VviCER1-2 and VviCER1-3 were downregulated, and VviCER1-6 was upregulated. VviCER4-2 of the alcohol forming branch was upregulated in early development, then became downregulated at ripening, VviCER4-3 was not affected. WSD1 homolog 1 and VviWSD2 were upregulated in response to high temperature stress, but VviWSD1 was downregulated. Differential expression in response to water deficit stress  Most changes in expression in response to water deficit stress resulted in upregulation of aliphatic wax candidate homolog genes (Figure 3.2.3). VviPAS2-1, VviPAS2-2, VviKCR1-1, and VviCER10-1 were unaffected by the stress. VviCER2 and VviCER2-LIKE were upregulated in Merlot berries, but VviCER2 was downregulated in Tocai friulano berries. Two strongly expressed KCS genes were upregulated by water deficit stress: VviKCS15 (both in Merlot and Tocai friulano) and VviKCS22 (only on Merlot). In Merlot, VviCER3-3, VviCER1-3, VviCER1-5, VviCER4-3 and WSD1 homolog 1 were unaffected, while VviCER1-2 was downregulated, and  60 VviCER1-6, VviCER4-2, VviWSD1 VviWSD2, WSD1 homolog 2, and VviWSD8 were upregulated. VviWSD2 and VviWSD8 were upregulated in Tocai friulano. Differential expression in response to Botrytis infection Botrytis infection of the berry did impact the expression of cuticular wax genes in berries. VviPAS2-1, VviPAS2-2, VviKCR1-1 were downregulated, VviCER10-1 was unaffected, and VviCER2 and VviCER2-LIKE were upregulated. VviKCS7 was upregulated, while VviKCS15 and VViKCS22 were downregulated. Alkane and alcohol forming pathway candidate homolog genes VviCER3-3, VviCER1-2, VviCER1-3, VviCER1-5, VviCER1-6, and VviCER4-3 were unaffected by Botrytis infection. VviCER4-2 though was upregulated, and VviWSD1, VviWSD2, and WSD1 homolog 2 were downregulated by the infection.             61 Section 3.2.3 Differential expression of oleanolic acid biosynthetic genes during berry development and under biotic and abiotic stresses. There were four putative BAS homologs showing expression in berry tissue. DE analysis showed that VIT_09s0054g01220 (top BLASTp homolog and homolog of highest expression in berry skin) was downregulated with the progression of berry development from green berries to harvest (Figure 3.2.4). VIT_09s0054g01210 and VIT_09s0054g01230 were upregulated from green berry to berry softening, and then were downregulated. The last one, VIT_11s0065g00640, showed no change in expression. The two top BLASTp grapevine candidate homolog genes for CYP716A and showed strong expression in berry skin, VIT_11s0065g00040 and VIT_11s0065g00130, both decreased in expression with berry development.  BAS grapevine homologs VIT_09s0054g01210, VIT_09s0054g01220, and VIT_09s0054g01230, and both CYP716A homologs VIT_11s0065g00040 and VIT_11s0065g00130 decrease in expression in response to high temperature and water deficit stresses. In response to Botrytis infection, VIT_11s0065g00640 was downregulated, while VIT_11s0065g00130 was upregulated.  62 Locus ID Given AnnotatedNameVIT_00s0313g00040 VviPAS2-1 ††VIT_06s0004g04130 VviPAS2-2 ††VIT_01s0137g00070 VviKCR1-2VIT_01s0137g00130 VviKCR1-3VIT_01s0137g00160 VviKCR1-4VIT_01s0137g00170 VviKCR1-5VIT_01s0137g00180 VviKCR1-1 ††VIT_13s0019g01260 VviCER10-1 ††VIT_13s0067g01830 VviCER10-2VIT_19s0014g00080 VviCER10-3VIT_05s0029g00480 VviCER2-LIKE ††VIT_18s0001g07640 VviCER2 ††VIT_00s0317g00160 VviKCS1VIT_01s0011g03490 VviKCS2VIT_03s0063g02640 VviKCS3 †VIT_04s0008g02250 VviKCS4 ††VIT_04s0008g04710 VviKCS5 †VIT_05s0020g04540 VviKCS6 ††VIT_06s0004g04000 VviKCS7 †VIT_07s0141g00030 VviKCS8VIT_07s0141g00060 VviKCS9VIT_07s0141g00070 VviKCS10VIT_07s0141g00090 VviKCS11 ††VIT_09s0070g00300 VviKCS12VIT_10s0042g01230 VviKCS13VIT_12s0034g01840 VviKCS14VIT_13s0067g03890 VviKCS15 ††VIT_14s0006g02990 VviKCS16 ††VIT_15s0021g02170 VviKCS17VIT_15s0048g02720 VviKCS18 ††VIT_16s0022g01570 VviKCS19VIT_16s0022g01580 VviKCS20VIT_16s0022g02190 VviKCS21VIT_18s0001g02720 VviKCS22 †VIT_18s0001g12550 VviKCS23 †VIT_19s0015g02000 VviKCS24VIT_19s0093g00440 VviKCS25VIT_09s0018g01340 VviCER3-1VIT_09s0018g01360 VviCER3-2VIT_11s0037g01210 VviCER3-3 ††VIT_15s0021g00010 VviCER1-1VIT_15s0021g00040 VviCER1-2 ††VIT_15s0021g00050 VviCER1-3 ††VIT_15s0021g00060 VviCER1-4VIT_15s0045g01520 VviCER1-5 †VIT_15s0045g01590 VviCER1-6 †VIT_05s0124g00300 VviCER4-1VIT_06s0080g00110 VviCER4-2 ††VIT_06s0080g00120 VviCER4-3 ††VIT_08s0007g07100 VviCER4-4VIT_03s0063g00120 WSD1 homolog 1 ††VIT_12s0028g03480 WSD1 homolog 2 †VIT_15s0046g00480 VviWSD1 ††VIT_15s0046g00490 VviWSD2 ††VIT_15s0046g00510 VviWSD3VIT_15s0046g00520 VviWSD4VIT_15s0046g00590 VviWSD5VIT_15s0046g00660 VviWSD6VIT_15s0046g00700 VviWSD7 †VIT_15s0046g00710 VviWSD8 †VIT_16s0098g00380 VviWSD9Skin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VviWSD9VviWSD8VviWSD7VviWSDVviWSD5VviWSD4VviWSD3VviWSD2VviWSD1WSD1_homolog_2WSD1_homolog_1VviCER1−6VviCER1−5VviCER1−4VviCER1−3VviCER1−2VviCER1−1VviCER3−3VviCER3−2VviCER3−1VviKCS25VviKCS24VviKCS23VviKCS22VviKCS21VviKCS20VviKCS 9VviKCS 8VviKCS17VviKCS16VviKCS15VviKCS14VviKCS 3VviKCS12VviKCS11VviKCS10VviKCS9VviKCS8VviKCS7VviKCS6VviKCS5VviKCS4VviKCS3VviKCS2VviKCS1VviCER4−4VviCER4−3VviCER4−2VviCER4−1VviCER2VviCER2−LIKEVviCER10−3VviCER10−2VviCER10−VviKCR1−1VviKCR1−5VviKCR1−4VviKCR1−3VviKCR1−2VviPAS2−2VviPAS2−1−5 5Value41 68 93 26 53 67 81 106InfectionStage1   2   3Days After Anthesiscv. Tocai* cv. Merlot*Whole BerryWater Deficit Stress Botrytis Infectioncv. Semillon*High Temperature StressDay NightSkin and FleshSkin and Fleshcv. Pinot Meunier ∆DevelopmentEarly greenLate greenEarly veraisonLate veraisonRipeningEarly greenLate greenRipeningBerry Skincv. C. Sauvignon∆Gene of Interest†   qPCR primers designed†† qPCR primers designed and used in biological experimentFigure 3.2.3. Heatmap of differential expression in terms of log2fold-change (FDR<0.05) of filteredgrapevine (Vitis vinifera L) putative homologs involved in cuticular aliphatic wax biosynthesis ingrape berry tissues during development and under abiotic and biotic stresses. RNA-seq datasets wereretrieved from the DNA data bank of Japan and reprocessed.Log2 Fold-Change* Single-end∆ Paired-endSkin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VviWSD9VviWSD8VviWSD7VviWSD6VviWSD5VviWSD4VviWSD3VviWSD2VviWSD1WSD1_homolog_2WSD1_homolog_1VviCER1−6VviCER1−5VviCER1−4VviCER1−3VviCER1−2VviCER1−1VviCER3−3VviCER3−2VviCER3−1VviKCS25VviKCS24VviKCS23VviKCS22VviKCS21VviKCS20VviKCS19VviKCS18VviKCS17VviKCS16VviKCS15VviKCS14VviKCS13VviKCS12VviKCS11VviKCS10VviKCS9VviKCS8VviKCS7VviKCS6VviKCS5VviKCS4VviKCS3VviKCS2VviKCS1VviCER4−4VviCER4−3VviCER4−2VviCER4−1VviCER2VviCER2−LIKEVviCER10−3VviCER10−2VviCER10−1VviKCR1−1VviKCR1−5VviKCR1−4VviKCR1−3VviKCR1−2VviPAS2−2VviPAS2−1−5 0 5ValueTop BLASTp homolog 63     Locus ID Gene FamilyVIT_09s0018g00630BASVIT_09s0054g01110VIT_09s0054g01120VIT_09s0054g01180VIT_09s0054g01210 †VIT_09s0054g01220 ††VIT_09s0054g01230 †VIT_09s0054g01390VIT_09s0054g01410VIT_09s0054g01520VIT_09s0054g01550VIT_10s0003g03520VIT_10s0003g03530VIT_10s0003g03650 †VIT_10s0003g03660VIT_11s0065g00030VIT_11s0065g00640VIT_04s0008g02960CYP716AVIT_10s0092g00070VIT_11s0065g00040VIT_11s0065g00130 ††VIT_11s0065g00630VIT_15s0024g01830VIT_18s0041g01500VIT_18s0041g01580VIT_18s0041g01590VIT_18s0041g01800VIT_18s0041g01810VIT_18s0072g00580Skin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Skin_CabernetSauvignon_EL.33.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VIT_18s0 72g00580VIT_18s004 g01810VIT_18s0041g01800VIT_18s0041g01590VIT_18s0041g01580VIT_18s0041g01500VIT_15s0024g01830VIT_11s0 5g00630VIT_11s0 65g00130VIT_11s0 65g00040VIT_10s0 92g00070VIT_ 4s0008g02960VIT_11s0 5g00640VIT_11s0 65g00030VIT_1 s0003g03660VIT_1 s0003g03650VIT_1 s000 g03530VIT_1 s0003g03520VIT_ 9s00 4g01550VIT_ 9s00 4g01520VIT_ 9s0054g01410VIT_ 9s0054g01390VIT_ 9s0054g01230VIT_ 9s0054g01220VIT_ 9s0054g01210VIT_ 9s0054g01180VIT_ 9s0054g01120VIT_ 9s0054g01110VIT_ 9s0 18g00630−5 5Value41 68 93 26 53 67 81 106InfectionStage1   2   3Days After Anthesiscv. Tocai* cv. Merlot*Whole BerryWater Deficit Stress Botrytis Infectioncv. Semillon*High Temperature StressDay NightSkin and FleshSkin and Fleshcv. Pinot Meunier ∆DevelopmentEarly greenLate greenEarly veraisonLate veraisonRipeningEarly greenLate greenRipeningBerry Skincv. C. Sauvignon∆Figure 3.2.4. Heatmap of differential expression in terms of log2fold-change (FDR<0.05) offiltered grapevine (Vitis vinifera L) putative homologs involved in oleanolic acid biosynthesis ingrape berry tissues during development and under abiotic and biotic stresses. RNA-seq datasetswere retrieved from the DNA data bank of Japan and reprocessed.Gene of Interest†   qPCR primers designed†† qPCR primers designed and used in biological experimentTop BLASTp homologLog2 Fold-Change* Single-end∆ Paired-endSkin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Skin_CabernetSauvignon_EL.33.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VIT_18s0072g00580VIT_18s0041g01810VIT_18s0041g01800VIT_18s0041g01590VIT_18s0041g01580VIT_18s0041g01500VIT_15s0024g01830VIT_11s0065g00630VIT_11s0065g00130VIT_11s0065g00040VIT_10s0092g00070VIT_04s0008g02960VIT_11s0065g00640VIT_11s0065g00030VIT_10s0003g03660VIT_10s0003g03650VIT_10s0003g03530VIT_10s0003g03520VIT_09s0054g01550VIT_09s0054g01520VIT_09s0054g01410VIT_09s0054g01390VIT_09s0054g01230VIT_09s0054g01220VIT_09s0054g01210VIT_09s0054g01180VIT_09s0054g01120VIT_09s0054g01110VIT_09s0018g00630−5 0 5Value 64 Section 3.2.4 Expression of cuticular wax related transcription factors  A large number of candidate transcription factor genes identified in the BLASTp searches had strong expression in berry skin tissue. Only VviMYB140, VviMYB142, VviMYB144 (MYB41 homolog), VviAP2-01, VviAP2-02, VviAP2-08, and VIT18s0001g12010 (BES1 homolog) were not expressed. During berry skin development, the majority of candidate transcription factor genes were downregulated with skin maturation. Of note, VviERF045 and VviMYB30B (MYB30 homolog) were upregulated with development.  Under high temperature stress, the majority of the genes were unaffected or downregulated. Upregulation was observed for VviMYB141 (MYB16, MYB106 homolog) early in green berries, and also for VviERF084 (DEWAX homolog) in green and late veraison berries. VviMYB30B and VviMYB30A (MYB96, MYB94 homolog) were downregulated, and VviERF045 expression was both up- and down-regulated during berry development. The top three homologs for WPX1 and WXP2 were all upregulated under heat stress.  Fewer transcription factors were affected by water deficit stress compared to heat stress, with the majority affected being upregulated. In Tocai friulano berries, VviERF045 and VviMYB30B were upregulated at 41DAA and downregulated at 93DAA respectively. VviMYB30A was unaffected by water deficit stress. Other upregulated TFs were VIT_10s0003g01790 (BES1 homolog), VvHB44, VviMYB145, VviERF004, VviAP2-06, VviAP2-01. Other downregulated TFs were VvHB55, and VviERF044.  Botrytis infection determined the down-regulation of the majority of DE genes (VIT_10s0003g01790, CFL1, VviMYB145, VviAP2-08, VviAP2-01 were upregulated; VIT_07s0031g00230 –  CER9 homolog, VvHB44, VvHB53, VviMYB141, VviMYB60, VviERF044, VviERF004, VviAP2-06 were downregulated), including of note VviERF045.   65 Section 3.2.5 Selection of candidate genes to analyze in the biological experiment Candidate genes putatively involved in the biosynthesis and regulation of cuticular waxes to be tested in the biological experiment were selected based on the proximity in the phylogenetic tree to characterized Arabidopsis genes (for structural genes) and top BLASTp results (for the transcription factors), expression of the gene in grapevine berry, and modulation of the gene by biotic and abiotic stresses. Selected genes are indicated with “††” in Figure 3.2.1 – 3.2.4 and in Appendix Table 2.3.1. In total, 22 structural genes and 6 transcription factors were tested in the biological experiment. Additional genes were identified as potential cuticular wax genes in other grapevine tissues; these genes are indicated with “†” in Figure 3.2.1 – 3.2.4 and in Appendix Table 2.3.1. Primers were designed for genes indicated with “††”, and “†”. 66  Locus IDTop homologLiterature AnnotationVIT_04s0023g01250VIT_10s0003g01790VIT_18s0001g12010 BES1VIT_04s0008g06260VIT_18s0072g00870VIT_18s0072g00880 CER7VIT_03s0063g00080 CER9 ††VIT_07s0031g00230VIT_01s0146g00400 CFL1VIT_12s0059g02310 HDG1; ZmOCL1 VvHB44 VIT_15s0048g02000 VvHB53 VIT_16s0100g00670 VvHB55 VIT_01s0026g02770 VviMYB140 VIT_14s0108g01080 MYB16; MYB106VviMYB141 VIT_17s0000g06410 VviMYB142 VIT_08s0056g00800 VviMYB60  VIT_14s0108g00830 MYB30 VviMYB30B ††VIT_17s0000g06190 MYB96; MYB94 VviMYB30A ††VIT_00s0203g00070 VviMYB143 VIT_12s0134g00570 MYB41 VviMYB144 ††VIT_19s0014g03820 VviMYB145 VIT_04s0008g05440 SHN2 VviERF044 VIT_09s0002g06750 SHN1/WIN1 VviEFR042 VIT_11s0016g05340 SHN3 VviERF043 VIT_04s0008g06000 VviERF045 VviERF045 ††VIT_00s0662g00030VIT_00s0662g00040VIT_18s0001g05250 WPX1; WPX2 VviERF004 VIT_01s0026g01690 WRI1 VviAP2-08 VIT_09s0018g01650 VviAP2-06 VIT_11s0037g00870 VviAP2-02 VIT_14s0108g00050 WRI3; WRI4 VviAP2-01 VIT_16s0013g01000 DEWAX VviERF084 ††VIT_16s0013g01060 VviERF089 VIT_16s0013g01090 VviERF108 * Single-end∆ Paired-end41 68 93 26 53 67 81 106InfectionStage1   2   3Days After Anthesiscv. Tocai* cv. Merlot*Whole BerryWater Deficit Stress Botrytis Infectioncv. Semillon*High Temperature StressDay NightSkin and FleshSkin and Fleshcv. Pinot Meunier ∆DevelopmentEarly greenLate greenEarly veraisonLate veraisonRipeningEarly greenLate greenRipeningBerry Skincv. C. Sauvignon∆Softening–GreenRipening–SofteningHarvest–RipeningHarvest–GreenGreenSofteningRipeningHarvestSkin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Skin_CabernetSauvignon_EL.33.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VIT_16s0 3g01090VIT_16s0 3g01060VIT_16s0 3g01000VIT_14s01 8g00050VIT_11s0 37g00870VIT_09s0 8g01650VIT_01s0 26g01690VIT_18s0 01g05250VIT_00s0662g00040VIT_00s0662g00030VIT_04s0 08g06000VIT_1 s0 16g05340VIT_09s0 02g06750VIT_04s0 08g05440VIT_19s0 14g03820VIT_12s0134g00570VIT_0 s02 3g00070VIT_17s0 00g06190VIT_14s01 8g00830VIT_08s0 56g00800VIT_17s0 00g06410VIT_14s0108g01080VIT_01s0 6g02770VIT_16s01 0g00670VIT_15s0 48g02000VIT_12s0 59g02310VIT_01s0146g00400VIT_07s0 31g00230VIT_03s0 63g00080VIT_18s0 72g00880VIT_18s0 72g00870VIT_04s0 08g06260VIT_18s0001g12010VIT_1 s0 03g01790VIT_04s0 23g01250−5 5ValueSkin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38Barbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestVIT_16s0013g01090VIT_16s0013g01060VIT_16s0013g01000VIT_14s0108g00050VIT_11s0037g00870VIT_09s0018g01650VIT_01s0026g01690VIT_18s0001g05250VIT_00s0662g00040VIT_00s0662g00030VIT_04s0008g06000VIT_11s0016g05340VIT_09s0002g06750VIT_04s0008g05440VIT_19s0014g03820VIT_12s0134g00570VIT_00s0203g00070VIT_17s0000g06190VIT_14s0108g00830VIT_08s0056g00800VIT_17s0000g06410VIT_14s0108g01080VIT_01s0026g02770VIT_16s0100g00670VIT_15s0048g02000VIT_12s0059g02310VIT_01s0146g00400VIT_07s0031g00230VIT_03s0063g00080VIT_18s0072g00880VIT_18s0072g00870VIT_04s0008g06260VIT_18s0001g12010VIT_10s0003g01790VIT_04s0023g012500 6ValueFigure 3.2.5. Heatmap of the relativeexpression in terms of log2(rpkm+1) orlog2(fpkm+1) during grape (Vitis viniferaL) berry development, and of differentialexpression in terms of log2fold-change(FDR<0.05) under the conditions of berrydevelopment, abiotic, and biotic stresses.Genes examined are grapevine putativetranscription factor homologs involved inregulating cuticular aliphatic waxbiosynthesis. RNA-seq datasets wereretrieved from the DNA database of Japanand reprocessed.Top BLASTp homologGene of Interest†† qPCR primers designed and used in biological experimentLog2 Fold-ChangeSkin_C.Sauvignon_EL.33Skin_C.Sauvignon_EL.34Skin_C.Sauvignon_EL.35Skin_C.Sauvignon_EL.38Barbera_Pea_sizeBarbera_Berries_touchingBarbera_Berries_softeningBarbera_HarvestVIT_16s0013g01090VIT_16s0013g01060VIT_16s0013g01000VIT_14s0108g00050VIT_11s0037g00870VIT_09s0018g01650VIT_01s0026g01690VIT_18s0001g05250VIT_00s0662g00040VIT_00s0662g00030VIT_04s0008g06000VIT_11s0016g05340VIT_09s0002g06750VIT_04s0008g05440VIT_19s0014g03820VIT_12s0134g00570VIT_00s0203g00070VIT_17s0000g06190VIT_14s0108g00830VIT_08s0056g00800VIT_17s0000g06410VIT_14s0108g01080VIT_01s0026g02770VIT_16s0100g00670VIT_15s0048g02000VIT_12s0059g02310VIT_01s0146g00400VIT_07s0031g00230VIT_03s0063g00080VIT_18s0072g00880VIT_18s0072g00870VIT_04s0008g06260VIT_18s0001g12010VIT_10s0003g0 790VIT_04s0023g012500 2 4 6 8ValueLog2(RPKM/FPKM+1)Skin_CabernetSauvignon_EL.33.34Skin_CabernetSauvignon_EL.34.35Skin_CabernetSauvignon_EL.35.38Skin_CabernetSauvignon_EL.33.38Day_EGGDay_LGGDay_EVDay_LVDay_RNight_EGGNight_LGGNight_RBerry_WD41DAABerry_WD68DAABerry_WD93DAAMerlot_26DAA_WDMerlot_53DAA_WDMerlot_67DAA_WDMerlot_81DAA_WDMerlot_106DAA_WDB.ci_S1B.ci_S2B.ci_S3VIT_16s0013g01090VIT_16s0013g01060VIT_16s0013g01000VIT_14s0108g00050VIT_11s0037g00870VIT_09s0018g01650VIT_01s0026g01690VIT_18s0001g05250VIT_00s0662g00040VIT_00s0662g00030VIT_04s0008g06000VIT_11s0016g05340VIT_09s0002g06750VIT_04s0008g05440VIT_19s0014g03820VIT_12s0134g00570VIT_00s0203g00070VIT_17s0000g06190VIT_14s0108g00830VIT_08s0056g00800VIT_17s0000g06410VIT_14s0108g01080VIT_01s0026g02770VIT_16s0100g00670VIT_15s0048g02000VIT_12s0059g02310VIT_01s0146g00400VIT_07s0031g00230VIT_03s0063g00080VIT_18s0072g00880VIT_18s0072g00870VIT_04s0008g06260VIT_18s0001g12010VIT_10s0003g01790VIT_04s0023g01250−5 0 5Value 67 Section 3.3 Grapevine physiology and wax composition under water deficit stress Section 3.3.1 Grapevine and berry physiology   Berries developing under well-irrigated (control = CT) and deficit-irrigated (water deficit = WD) treatments exhibited significant differences in physiology (Figure 3.3.1). Leaf water potential of WD plants was significantly lower than CT plants from 37 days after anthesis (DAA) to the end of the experiment. Berry weight and soluble solid concentration increased as berries developed. Mid-veraison, the point during the onset of berry ripening where half the berries have started changing colour, was recorded at 68DAA. This point marked the beginning of a strong increase in sugars as berries transitioned from green to red. When compared to CT, WD berries had significantly lower weight throughout the experiment starting at 42 DAA, and significantly higher concentration of soluble solids, that indicates sugar concentration in fruit juice, at 42, 96, and 111 DAA.  Section 3.3.2 Berry cuticular wax composition during development and under water deficit stress  When considering the total amounts of aliphatic waxes (Figure 3.3.2 A), very long chain primary alcohols and aldehydes were high in amount (µg/cm2) early in berry development (41 DAA) and decreased as berries ripened (after 68 DAA). In contrast, very long chain fatty acid (VLCFA) and wax ester amount increased as berries developed and ripened. Lastly, alkane amount remained relatively stable throughout berry development and ripening. Amount of total wax esters was significantly increased on WD berry surfaces compared to CT berries at 41, 68 (in green berries), 82, 96, and 111 DAA. Alkanes were significantly higher in amount in WD berries at 68 DAA (in red berries), while fatty acid, primary alcohol and aldehyde amounts were significantly higher on WD berries at 111 DAA.   68 The amount of total triterpenoids (Figure 3.3.2 B) was highest at 41 DAA, which then decreased for the rest of berry development with no significant differences between treatment. The total amount of aliphatic waxes (Figure 3.3.2 C) followed a similar trend of peaking at 41 DAA and then decreasing later in berry development. A significant increase in total aliphatic waxes was observed for WD berries at 82 and 111 DAA. When the ratio of total triterpenoids/total aliphatic waxes was calculated (Figure 3.3.2 D) a clear trend was observed where the ratio was highest at 27 DAA and steadily decreased with development to stabilize starting at 82 DAA. The ratio was significantly lower in WD berries at 41, 82 and 111 DAA.  69  5.0e+001.0e+011.5e+012.0e+0125 50 75 100Days After AnthesisSoluble Solids (Brix)−2.0e+00−1.5e+00−1.0e+00−5.0e−0125 50 75 100Days After AnthesisLeaf Water Potential (MPa)******************************4.0e−018.0e−011.2e+001.6e+0025 50 75 100Days After AnthesisBerry Weight (g)*********************4.0e−018.0e−011.2e+001.6e+0025 50 75 100Days After AnthesisBerry Weight at Samplings (g)TreatmentCTWD*,P<0.05  **,P<0.01  ***,P<0.001ABCFigure 3.3.1. Leaf water potential (A), berry growth (B), and berry soluble solids (C) in grapevines (Vitisvinifera L) exposed to two irrigation treatments: well-irrigated (Control = CT) and deficit irrigated (WaterDeficit = WD). Error bars represent ± S.E. and significant differences between treatments were det erminedby Two-Sample t-Test. The black vertical line represents the start of the deficit irrigation treatment, shadedbackground indicate when veraison occurred. The points at 68 and 69 days aft er anthesis (DAA) in B andC represent green berries at 68 DAA and red berries at 68 DAA, respectively. 70   27Green41Green68Green68Red82Red96Red111Red0.0e+002.5e+005.0e+007.5e+001.0e+01Total Major TriterpenoidsWax Amount (µg/cm^2)DAA and Berry Colour27Green41Green68Green68Red82Red96Red111Red0.0e+001.0e+002.0e+003.0e+00AlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterAlcoholAldehydeAlkaneFatty_acidWax_esterTotal Aliphatic WaxesWax Amount (µg/cm^2)DAA and Berry ColourAB27Green41Green68Green68Red82Red96Red111Red0.0e+005.0e−011.0e+001.5e+002.0e+00Triterpenoids/Aliphatic WaxesRatioDAA and Berry Colour27Green41Green68Green68Red82Red96Red111Red0.0e+002.0e+004.0e+006.0e+008.0e+00Total Aliphatic WaxesWax Amount (µg/cm^2)DAA and Berry ColourC D*** *******,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.2. Cuticular wax composition in berries at27, 41, 68, 82, 96, and 111 days after anthesis (DAA)of grapevines (Vitis vinifera L) exposed to twoirrigation treatments: well-irrigated (Control = CT) anddeficit irrigated (Water Deficit = WD). At 68 DAA,green berries were separated from red berries. Errorbars represent ± S.E. and significant differencesbetween treatments were determined by Two-Sample t-Test. Aliphatic waxes (A) are produced by thecuticular wax biosynthetic pathway. Triterpenoid waxes(B) are produced by oleanolic acid pathway. The sumof total aliphatic waxes (C) and the ratio oftriterpenoids/aliphatic waxes (D) found in the berrycuticle.Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_GalatTuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_GalatTuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_GalatTuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD* ****** 71  Examination of berry cuticular wax was continued by having each class of aliphatic wax compounds broken down into their individual molecular species.   All very long chain fatty acids (VLCFAs) (Figure 3.3.3) followed a general trend of increasing in amount as berries developed, though there were significant differences in composition between treatments. VLCFA C32 amount was significantly lower in green WD berries at 68 DAA. The amounts were significantly higher in WD samples for C26 and C28 VLCFA at 82 and 111 DAA, C22 VLCFA at 96 and 111 DAA, and C20 VLCFA at 111 DAA.   Amounts for all the very long chain primary alcohols (VLCPA), except for C30 VLCPA, were highest at 41 DAA and then decreased with berry maturity (Figure 3.3.4 A). The C30 primary alcohol in contrast, remained r low in amount until a sudden increase in green berries at 68 DAA, before slightly decreasing and stabilizing with remaining berry maturation. All significant differences observed between irrigation treatments for these compounds consisted in 27Green41Green68Green68Red82Red96Red111Red0.0e+002.0e−014.0e−016.0e−01C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32Very Long Chain Fatty AcidsWax Amount (µg/cm^2)DAA and Berry Colour*,P<0.05  **,P<0.01  ***,P<0.001****** *******Figure 3.3.3. Cuticular wax composition in berries at 27, 41, 68, 82, 96, and 111 daysafter anthesis (DAA) of grapevines (Vitis vinifera L) exposed to two irrigationtreatments: well-irrigated (Control = CT) and deficit irrigated (Water Deficit = WD). At68 DAA, green berries were separat ed from red berries. Error bars represent ± S.E. andsignificant differences between treatments were determined by Two-Sample t-Test.Compound classes are produced by different parts of the cuticular wax biosyntheticpathway, with very long chain fatty acids made by the fatty acid elongase complex.Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseE ythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD 72 higher amounts on WD berries: C22 VLCPA at 41 DAA, and C22, C24, C26, and C28 VLCPA at 111 DAA.  Wax ester amounts consistently increased as berries developed from 27 to 111 DAA (Figure 3.3.4 B). C42, C44, C46, C48, and C50 wax esters were significantly higher in amount on WD berry skins in green berries at 68 DAA, at 82, 96, and 111 DAA. In addition, C44 and C46 wax esters were significantly higher in WD samples at 41 DAA, and C46 wax ester was also higher in red WD berries at 68 DAA.  73     27Green41Green68Green68Red82Red96Red111Red0.0e+001.0e−012.0e−013.0e−01C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50C42C44C45C46C47C48C49C50Wax EstersWax Amount (µg/cm^2)DAA and Berry Colour27Green41Green68Green68Red82Red96Red111Red0.0e+003.0e−016.0e−019.0e−01C22C24C26C28C30C22C24C26C28C30C22C24C26C28C30C22C24C26C28C30C22C24C26C28C30C22C24C26C28C30C22C24C26C28C30Very Long Chain Primary AlcoholsWax Amount (µg/cm^2)DAA and Berry ColourAB*,P<0.05  **,P<0.01  ***,P<0.001* ****** ** * **************** *************************Figure 3.3.4. Cuticular wax composition in berries at 27, 41, 68, 82, 96, and 111 daysafter anthesis (DAA) of grapevines (Vitis vinifera L) exposed to two irrigationtreatments: well-irrigated (Control = CT) and deficit irrigated (Water Deficit = WD). At68 DAA, green berries were separat ed from red berries. Error bars represent ± S.E. andsignificant differences between treatments were determined by Two-Sample t-Test.Compound classes are produced by different parts of the cuticular wax biosyntheticpathway, with primary alcohols (A) and wax esters (B) made by the alcohol formingbranch.Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_es erPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD 74 The amount of very long chain aldehydes (Figure 3.3.5 A) peaked at 41 DAA and then decreased as berries matured. Significant increases in amount were observed in green WD berries at 68 DAA for C24 very long chain aldehydes, and then at 111 DAA for C24, C26 and C28 very long chain aldehydes.  The amount for cuticular alkanes increased to a peak in green berries at 68 DAA, and then stabilized through the rest of berry development (Figure 3.3.5 B). The amounts were significantly increased on WD berry skins for C21 and C23 alkanes on green berries at 68 DAA, C23 and C25 alkanes on red berries at 68 DAA, and for C23 alkane at 96 DAA. The amounts of triterpenoid cuticular waxes (Figure 3.3.6) were highest at 41 DAA, and then decreased to remain stable at lower amounts for the rest of berry development. Oleanolic acid amount was significantly higher in WD samples in green berries at 68 DAA, and at 96 and 111 DAA. Oleanolic aldehyde was significantly decreased in amount at 96 DAA by WD.   75     27Green41Green68Green68Red82Red96Red111Red0.0e+003.0e−016.0e−019.0e−011.2e+00C24C26C28C30C24C26C28C30C24C26C28C30C24C26C28C30C24C26C28C30C24C26C28C30C24C26C28C30Very Long Chain AldehydesWax Amount (µg/cm^2)DAA and Berry Colour27Green41Green68Green68Red82Red96Red111Red0.0e+003.0e−026.0e−029.0e−02C21C23C25C27C29C31C21C23C25C27C29C31C21C23C25C27C29C31C21C23C25C27C29C31C21C23C25C27C29C31C21C23C25C27C29C31C21C23C25C27C29C31AlkanesWax Amount (µg/cm^2)DAA and Berry ColourAB*,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.5. Cuticular wax composition in berries at 27, 41, 68, 82, 96, and 111 daysafter anthesis (DAA) of grapevines (Vitis vinifera L) exposed to two irrigationtreatments: well-irrigated (Control = CT) and deficit irrigated (Water Deficit = WD). At68 DAA, green berries were separat ed from red berries. Error bars represent ± S.E. andsignificant differences between treatments were determined by Two-Sample t-Test.Compound classes are produced by different parts of the cuticular wax biosyntheticpathway, with aldehydes (A) and alkanes (B) are made by the alkane forming branch.**********Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD 76   Section 3.3.3 Leaf cuticular wax composition under water deficit stress  Overall cuticular wax amount of leaves (Figure 3.3.7) decreased as the leaf matured. Leaf cuticular wax contained compounds absent from berry cuticular wax: ethyl esters, phenylmethyl esters, phenylethyl esters, sugars, and miscellaneous (β-tocopherol, stigmasterol). Triterpenoid amount remained stable during leaf development, and overall cuticular aliphatic waxes decreased in amount as leaves matured. Among aliphatic waxes, alkanes and primary alcohols were the most abundant classes of compounds. Significant differences between treatments were observed in mature leaves, where there were higher amounts of alkanes and miscellaneous compounds in WD samples, and phenylmethyl esters were lower.  27Green41Green68Green68Red82Red96Red111Red0.0e+002.0e+004.0e+006.0e+00B_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeB_amyrinErythrodiolOleanolic_acidOleanolic_aldehydeTriterpenoidsWax Amount (µg/cm^2)DAA and Berry Colour*****,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.6. Cuticular wax composition in berries at 27, 41, 68, 82, 96, and 111 daysafter anthesis (DAA) of grapevines (Vitis vinifera L) exposed to two irrigationtreatments: well-irrigated (Control = CT) and deficit irrigated (Water Deficit = WD). At68 DAA, green berries were separat ed from red berries. Error bars represent ± S.E. andsignificant differences between treatments were determined by Two-Sample t-Test.Compound classes are produced by different pathways, triterpenoids are made by theoleanolic acid pathway.Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD 77  Significant differences were observed in the composition of aliphatic wax classes by individual compounds. VLCFA (Figure 3.3.8 A) amount decreased in mature leaves compared to young and intermediate leaves, with C28 VLCFA being significantly lower in amount in mature WD leaves.  Very long chain primary alcohol (VLCPA) amount decreased in mature leaves compared to young and intermediate leaves (Figure 3.3.8 B). Significant differences in the amount were observed between treatments: C25, C27, C32 VLCPA were increased by WD in young leaves, C32 VLCPA were decreased by WD in intermediate leaves, and C30 VLCPA were increased by WD in mature leaves.  Wax ester (Figure 3.3.8 C) amount decreased substantially from young to mature leaves with C40, C48, and C50 wax esters being completely absent in mature CT and WD leaves. C40 and C42 wax esters were significantly lower in amount WD than CT leaves.  Alkane amount decreased from young to mature leaves, with C27 and C29 alkanes being the most abundant (Figure 3.3.8 D). Significantly higher amounts in WD samples were observed for C31 alkanes in young leaves, and C27, C29, and C31 in mature leaves.  Overall, very long chain aldehyde amounts increased from young to mature leaves, with C28 very long chain aldehydes significantly increased in the amount by WD in intermediate and mature leaves, and the compound being absent in all sizes of CT leaves (Figure 3.3.8 E).    78   012012012AldehydesAlkanesEthyl_EstersFatty_Acids MiscPhenylethyl_EstersPhenylmethyl_EstersPrimary_AlcoholsSugarsTriterpenoidsWax_EstersWax Amount (µg/cm^2)****YoungMatureIntermediateLeaf DevelopmentLarge Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD*,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.7. Total cuticular wax co position in leaves of grapevines (Vitis viniferaL) exposed to two irrigat on treatments: well-irrigated (Control = CT) and deficitirrigated (Water Deficit = WD). Waxes were sampled from young, intermediate, andmature leaves which were small (avg. 14 cm2), medium (avg. 47 cm2), large (avg. 156cm2) sized respectively. Error bars represent ± S.E. and significant differencesbetween treatments were determined by Two-Sample t-Test. Fatty acids, primaryalcohols, wax esters, alkanes and aldehydes by the alkane forming branch are madeby the cuticular biosynthetic pathway, triperpenoids are made by the oleanolic acidpathway. 79       0.0e+002.0e−014.0e−01C22C23C24C25C26C27C28C30C32C33C22C23C24C25C26C27C28C30C32C33C22C23C24C25C26C27C28C30C32C33Very Long Chain Primary Alcohols0.0e+001.0e−022.0e−023.0e−024.0e−025.0e−02C21C24C26C28C30C21C24C26C28C30C21C24C26C28C30Very Long Chain Aldehydes0.0e+002.5e−025.0e−027.5e−02C40C42C44C45C46C47C48C49C50C40C42C44C45C46C47C48C49C50C40C42C44C45C46C47C48C49C50Wax EstersWax Amount (µg/cm^2)**********Figure 3.3.8. Cuticular wax composition in leavesof grapevines (Vitis vinifera L) exposed to twoirrigation treatments: well-irrigated (Control = CT)and deficit irrigat ed (Water Defi cit = WD). Waxeswere sampled from young, intermediate, and matureleaves which were small (avg. 14 cm2), medium(avg. 47 cm2), large (avg. 156 cm2) sizedrespectively. Error bars represent ± S.E. andsignificant differences between treatments weredetermined by Two-Sample t-Test. Compoundclasses are produced by different parts of thecuticular wax biosynthetic pathway. Fatty acids (A)are made by the fatty acid elongase complex,primary alcohols (B) and wax esters (C) by thealcohol forming branch, and alkanes (D) andaldehydes (E) by the alkane forming branch.Large Medium Small0.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.90.00.30.60.9AldehydeAlkaneCarboxylic_acidEthyl_esterMiscPhenylethyl_esterPhenylmethyl_esterPrimary_alcoholSugarTriterpenoidWax_esterB_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.B_AmyrinB_Amyrin_2_unknowb_TocopherolC1820C122C324C526C728C930C132C340C244C546C748C950D_FructoseD_Galat_TuranoseErythrodiolLupe lOA_PrecursrOleanolic_AcidStigmasterolUnknown_1Unknown_22.63.9Unknown_26.29.5Unknown_31.Carbon Chain Lengthµg/cm^2 TreatmentCTWD*,P<0.05  **,P<0.01  ***,P<0.001Leaf Development0.0e+001.0e−012.0e−013.0e−01C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32C18C20C22C24C26C28C30C32Very Long Chain Fatty Acids0.0e+003.0e−016.0e−019.0e−01C21C23C25C26C27C28C29C31C21C23C25C26C27C28C29C31C21C23C25C26C27C28C29C31Alkanes* ** * **Young MatureIntermediate Young MatureIntermediateABCDE 80 Section 3.3.4 Gene expression in berry skin  Relative expression of genes involved in cuticular wax biosynthetic pathway, oleanolic acid biosynthetic pathway, and related regulatory genes was measured against VviAP47 (VIT_02s0012g00910) by RT-qPCR. All genes involved in fatty acid elongation (Figure 3.3.9), except VviKCS11 (VIT_07s0141g00090), showed a pattern of higher expression early in berry development (41 DAA), and lower expression at the end of berry development (96 and 111 DAA). In contrast, VviKCS11 showed lower expression at 41DAA, which then increased in later development at 96 and 111 DAA. Relative expression of VviCER10-1 (VIT_13s0019g01260) was significantly higher in WD berry skin at 41 and 96 DAA. VviCER2 (VIT_18s0001g07640) and VviKCS11 showed significantly higher expression in WD berry skin only at 41 DAA. VviKCS6 (VIT_05s0020g04540) and VviKCS15 (VIT_13s0067g03890) saw significant increase in expression in WD berry skin at 41 DAA, and then significant decrease in expression in green WD berry skin at 68 DAA. WD also upregulated the expression of VviKCS16 (VIT_14s0006g02990) and VviKCR1-1 (VIT_01s0137g00180) at 41 DAA, and VviKCS4 (VIT_04s0008g02250) and VviPAS2-1 (VIT_00s0313g00040) at both 41 DAA and green berries at 68 DAA. There were no significant differences in expression between treatments for VviCER2-LIKE (VIT_05s0029g00480), CER6-9 (VIT_15s0048g02720), and VviPAS2-2 (VIT_06s0004g04130). The pattern of gene expression of the alcohol forming branch changed among genes (Figure 3.3.10 A). VviCER4-2 (VIT_06s0080g00110) generally decreased in expression with berry development. A general decrease during development but with a transient peak of expression in red berries at veraison was observed for VviCER4-3 (VIT_06s0080g00120). WSD1 genes were generally expressed to higher levels after veraison, with peaks of expression that varied accordingly to the homolog and the treatment considered. WD affected the expression of  81 VviCER4-3, WSD1 homolog 1 (VIT_03s0063g00120), VviWSD1 (VIT_15s0046g00480), VviWSD2 (VIT_15s0046g00490). VviCER4-3 was significantly increased in expression in WD berry skin at 41 DAA. All three WSD1 putative homologs had significantly higher expression in WD berry skin at specific times; VviWSD1 was significantly upregulated at 41 DAA, and WSD1 homolog 1 and VviWSD2 at both 41 and 96 DAA. Among the genes of the alkane forming pathway, VviCER1-2 (VIT_15s0021g00040) and VviCER1-3 (VIT_15s0021g00050) were expressed at lower levels than VviCER3-3 (VIT_11s0037g01210), which decreased in expression during berry development (Figure 3.3.10 B). Significantly higher expression was seen in WD berries than in CT ones for VviCER1-3 at 96 DAA and for VviCER3-3 at 41 DAA. VviCER1-2 was not differentially expressed between treatments. A general trend of high expression early in berry development (27, 41 DAA) and then lower expression in late development (96, 111 DAA) was observed across the regulatory genes tested (Figure 3.3.11 A). VviERF045 (VIT_04s0008g06000) was an exception to the trend, as it increased in expression with berry development until 96 DAA, before decreasing at 111 DAA. WD increased the expression of VviMYB30A (VIT_17s0000g06190) at 41 and 96 DAA, and decreased the expression of VviERF084 (VIT_16s0013g01000) at 96 DAA. VviERF045, VviMYB144 (VIT_12s0134g00570), VviMYB30B (VIT_14s0108g00830), and VviCER9 (VIT_03s0063g00080) were not differentially expressed between treatments.   Genes involved in oleanolic acid biosynthesis (Figure 3.3.11 B) had higher expression early in berry development (27, 41 DAA), and decreased as berries matured (96, 111 DAA). VviBAS (VIT_09s0054g01220) showed significantly lower expression in WD samples at 41DAA and in red berries at 68 DAA. CYP716A17 (VIT_11s0065g00130) expression was not different between treatments.   82    VviCER10-1VIT_13s0019g01260VviCER2VIT_18s0001g07640VviCER2−LIKEVIT_05s0029g00480VviKCS4VIT_04s0008g02250VviKCS6VIT_05s0020g04540VviKCS11VIT_07s0141g00090VviKCS15VIT_13s0067g03890VviKCS16VIT_14s0006g02990VviKCS18VIT_15s0048g02720VviKCR1-1VIT_01s0137g00180VviPAS2−1VIT_00s0313g00040VviPAS2−2VIT_06s0004g041301.0e+002.0e+000.0e+001.0e−012.0e−013.0e−014.0e−015.0e−010.0e+002.0e−014.0e−012.5e+005.0e+007.5e+001.0e+011.2e+010.0e+001.0e+002.0e+003.0e+004.0e+001.0e+002.0e+000.0e+002.5e+005.0e+007.5e+001.0e+011.2e+010.0e+005.0e+001.0e+011.5e+012.5e−015.0e−017.5e−010.0e+001.0e+002.0e+003.0e+004.0e+005.0e+000.0e+001.0e+002.0e+003.0e+004.0e+000.0e+005.0e−021.0e−011.5e−012.0e−012.5e−01Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111**** ******** * ***Relative Expression1Small2Medium3Large0.000.010.020.030.040.05C21C24C26C28C30C21C24C26C28C30C21C24C26C28C30Very Long Chain Aldehydesµg/cm^2 TreatmentControlWD*,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.9. Expression of wax related genes in berry skins of grapevines (Vitis viniferaL) exposed to two irrigation treatments: well-irrigated (Control = CT) and defi cit irrigated(Water Defi cit = WD). Error bars represent ± S.E. and significant differences betweentreatments were determined by Two-Sample t-Test. Genes presented are involved in fattyacid elongation in the biosynthetic cuticular wax pathway.Berry Colour and DAA 83  VviCER1−2VIT_15s0021g00040VviCER1−3VIT_15s0021g00050VviCER3-3VIT_11s0037g012100.0e+001.0e−042.0e−043.0e−044.0e−040.0e+003.0e−046.0e−049.0e−041.2e−030.0e+002.5e+005.0e+007.5e+001.0e+01Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111VviCER4-2VIT_06s0080g00110VviCER4−3VIT_06s0080g00120WSD1 homolog 1 VIT_03s0063g00120VviWSD1VIT_15s0046g00480VviWSD2VIT_15s0046g004900.0e+002.0e−044.0e−046.0e−048.0e−040.0e+001.0e−032.0e−033.0e−032.5e−015.0e−017.5e−011.0e+000.0e+001.0e+002.0e+003.0e+004.0e+000.0e+002.5e+005.0e+007.5e+00Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111*************BARelative ExpressionRelative ExpressionFigure 3.3.10. Expression of wax related genes in berry skins of grapevines (Vitis vinifera L) exposed totwo irrigation treatments: well-irrigated (Control = CT) and deficit irrigated (Water Deficit = WD).Error bars represent ± S.E. and significant differences between treatments were determined by Two-Sample t-Test. Genes are grouped by role in the biosynthetic cuticular wax pathway: alcohol formingbranch (A), alkane forming branch (B).Berry Colour and DAABerry Colour and DAA1Small2Medium3Large0.000.010.020.030.040.05C21C24C26C28C30C21C24C26C28C30C21C24C26C28C30Very Long Chain Aldehydesµg/cm^2 TreatmentControlWD*,P<0.05  **,P<0.01  ***,P<0.001 84     VviBASVIT_09s0054g01220CYP716A17 VIT_11s0065g001300.0e+001.0e−012.0e−013.0e−010.0e+002.0e+014.0e+016.0e+01Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111VviCER9VIT_03s0063g00080VviERF084VIT_16s0013g01000VviMYB30BVIT_14s0108g00830VviMYB144VIT_12s0134g00570VviMYB30AVIT_17s0000g06190VviERF045VIT_04s0008g060002.5e−015.0e−017.5e−011.0e+000.0e+003.0e−026.0e−029.0e−021.2e−010.0e+003.0e−046.0e−049.0e−040.0e+001.0e−032.0e−033.0e−034.0e−035.0e−011.0e+001.5e+000.0e+001.0e+002.0e+003.0e+004.0e+005.0e+00Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111Green_27Green_41Green_68Red_68Red_96Red_111BA* ******Relative ExpressionRelative Expression1Small2Medium3Large0.000.010.020.030.040.05C21C24C26C28C30C21C24C26C28C30C21C24C26C28C30Very Long Chain Aldehydesµg/cm^2 TreatmentControlWD*,P<0.05  **,P<0.01  ***,P<0.001Figure 3.3.11. Expression of wax related genes inberry skins of grapevines (Vitis vinifera L)exposed to two irrigation treatments: well-irrigated (Control = CT) and deficit irrigated(Water Deficit = WD). Error bars represent ± S.E.and significant differences between treatmentswere determined by Two-Sample t -Test. Genesare grouped by rol e in the biosynthetic cuticularwax pathway: putative regulatory genes (A),oleanolic acid biosynthesis (B).Berry Colour and DAABerry Colour and DAA 85 Section 3.3.4 Transpiration rate through the berry cuticle  The rate of water transpiration through the cuticle decreased as berries developed to remain stable from 97 DAA to the end of the experiment (Figure 3.3.12). There were no significant differences in the average rate of water transpiration (mg cm-2 h-1) through the berry cuticle between treatments at any developmental stage tested. Though there was a near significant decrease (p-value=0.0663) in the rate of water transpiration for WD berries at 111 DAA.  In addition, when the cumulative amount of water lost per skin area (mg cm-2) at each measurement time (hours from T0) within each experiment (developmental stage: 48, 75, 97, 111 DAA) was considered, no significant differences between treatments were seen. Yet, a near significant decrease (p-value=0.0515) in amount of water lost by WD berries was also seen at 111 DAA.     86  0204060800 50 100 150 200 250HoursWater Lost (mg/cm^2)48 DAA0204060800 50 100 150 200 250HoursWater Lost (mg/cm^2)97 DAA0204060800 50 100 150 200 250HoursWater Lost (mg/cm^2)27 DAA0204060800 50 100 150 200 250HoursWater Lost (mg/cm^2)75 DAA0204060800 50 100 150 200 250HoursWater Lost (mg/cm^2)111 DAA*,P<0.05  **,P<0.01  ***,P<0.0014.0e−018.0e−011.2e+001.6e+0025 50 75 100Days After AnthesisBerry Weight at Samplings (g)TreatmentCTWDFigure 3.3.12. Rates of water transpiration of the whole berry at different stages ofdevelopment (27, 48, 75, 97, 111 DAA) in grapevines (Vitis vinifera L) exposed to twoirrigation treatments: well-irrigated (Control = CT) and deficit irrigat ed (Water Deficit= WD). Error bars represent ± .E., significant differences between treatments for therate of water transpiration at each developmental stage were det ermined by Two-Sample t-Tests. Significant differences in the cumulative amount of water lost for eachdevelopmental stage were determined by Univariate Repeated Measures ANOVA(U.R.M. ANOVA). In the Table, the average transpiration rate and the significancevalue of the t-Test at each developmental stage are reported.P-value0.18040.0001***0.9157TreatmentTimeTreatment:TimeTwo-way ANOVAP-value0.97460.0001***0.9998TreatmentTimeTreatment:TimeU.R.M. ANOVAP-value0.76530.0001***0.9001TreatmentTimeTreatment:TimeU.R.M. ANOVAP-value0.05150.0001***0.2457TreatmentTimeTreatment:TimeU.R.M. ANOVADAAH2O Transpiration Rate(mg cm-2 hour-1)P-valueControl Water Deficit27 0.73748 0.4033 0.3889 0.313775 0.2216 0.2207 0.987797 0.1945 0.1970 0.7219111 0.2100 0.1970 0.0663 87 Chapter 4: Discussion Section 4.1 Identification of the likeliest functional homologs Section 4.1.1 PAS2 functional homologs  The BLASTp search had resulted in two grapevine homologs. VviPAS2-1 is the likeliest functional homolog of PAS2. This gene is the top BLASTp homolog, and has much stronger and consistent expression in grapevine tissues than VviPAS2-2. Phylogenetically (Figure 3.1.1), VviPAS2-1 is equally related to PAS2 and At5g59779, an Arabidopsis homolog of PAS2 that does not have the same function (Bach et al., 2008), while VviPAS2-2 is closest to At5g59779. Thus, by deduction VviPAS2-1 is more likely the functional PAS2 homolog in grapevine.  Section 4.1.2 KCR1 functional homologs  The highlighted clade in the KCR1 phylogenetic tree (Figure 3.1.2) contains KCR1, KCR2 and five grapevine homologs. KCR2 is a non-functional homolog of KCR1 in Arabidopsis (Beaudoin et al., 2009), and its positioning at the base of the clade does not help with differentiating which grapevine homolog is likely functional. VviKCR1-1 is the likeliest functional homolog since it is top BLASTp homolog, the most closely related gene to KCR1 in the tree, and it is the only grapevine homolog that is strongly expressed in all tissues (Figure 3.2.1). VviKCR1-1 is basal in the clade of KCR1 and grapevine KCR1-like genes (Figure 3.1.2), and these grapevine genes which are in a tandem duplicate cluster (Appendix 3.2.1). VviKCR1-1 shows expression in most organ types, but the other KCR1 genes in grapevine show expression limited to particular organ types.  In particular, VviKCR1-2 is expression only in roots and later stages of flower development, whereas VviKCR-3 and VviKCR-4 are only expressed in early stages of flower development.  The non-overlapping expression pattern between VviKCR1-2 compared with VviKCR-3 and VviKCR-4 is indicative of expression subfunctionalization.  88 Section 4.1.3 CER10 functional homologs  The top BLASTp homolog, VviCER10-1, is the most likely functional homolog since it is strongly and consistently expressed in all epidermal tissues (Figure 3.2.3). The other two homologs on the other hand show weak or no expression in flowers and berry tissue, but do show expression in the leaf, making them less likely to be functionally relevant. Section 4.1.4 CER2 and CER2-LIKE functional homologs  There is strong evidence to support the assertion that VviCER2 and VviCER2-LIKE are the likeliest functional homologs of CER2, CER2-LIKE1 and CER2-LIKE2. The phylogenetic tree (Figure 3.1.4) provides strong confidence with its separation into different clades and high bootstrap values. Both of the grapevine homologs are expressed in berry and leaf tissues where aliphatic waxes of length greater than C28 are present.  Section 4.1.5 CER6 functional homologs  CER6 is part of the expanded KCS family of 21 genes that is split into eight subclasses (Joubès et al., 2008). The KCS family in grapevine is similar in size with 25 members, of which 12 of them are closely related to six of the Arabidopsis subfamilies (Figure 3.1.5). It is not possible from the phylogenetic tree to narrow the number of likeliest candidates for functional equivalency to CER6 since no grapevine sequences clustered in the same clade as the γ subfamily.  Like with Arabidopsis, the family in grapevine is highly redundant, with 11 homologs expressed in most or all tissues surveyed (Figure 3.2.1). The list of functionally relevant homologs cannot be narrowed further with the given data from this study. As with Arabidopsis, this brings up the same question of the reason for the large amount of redundancy (Haslam and Kunst, 2013a). There could be several different reasons for the redundancy: the VviKCS genes  89 could have different substrate specificities, or have been sub-functionalized to be expressed at different developmental stages or to respond to different environmental stresses. There is some evidence for the last possible explanation. VviKCS11 was upregulated as berry skin development progressed while VviKCS4, 7, and 15 were downregulated later in berry skin development. Specific homologs did respond to certain environmental stresses differently. VviKCS15 and 22 were upregulated and downregulated in response to WD stress and Botrytis infection respectively, while VviKCS7 was upregulated by Botrytis infection (Figure 3.2.3).  Section 4.1.6 CER1 and CER3 functional homologs  It was expected to see that CER1 and CER3 have common BLASTp results and to form two distinct clades in their phylogenetic tree (Figure 3.1.6), as they both derive from a common origin (Bernard et al., 2012). VviCER3-3 is the likeliest functional homolog of CER3 since it is the only one consistently and strongly expressed in grapevine tissues, especially in berry skin.  None of theVviCER1 homologs were highly expressed in berry tissue, making it difficult to discern which one(s) is responsible for alkane synthesis. Thus, it was decided to choose the top BLASTp homolog, VviCER1-3, and one of its tandem duplicates, VviCER1-2 (Appendix Figure 3.2.1), to measure expression in our water deficit (WD) experiment. VviCER1-4 is another tandem duplicate of VviCER1-3, but was not chosen since the resulting protein is four times larger than CER1, and therefore is likely not functionally relevant.  Since VviCER1s are expressed at a very low level, it can be inferred that little to no alkane content should be found in grapevine cuticular wax, since alkane synthesis is catalyzed by a heterodimer formed by CER1 and CER3 (Bernard et al., 2012).   90 Section 4.1.7 CER4 functional homologs Determining which VviCER4 homolog is functionally relevant proved to be difficult, as the phylogenetic tree (Figure 3.1.7) did not help narrow down the list of homologs and that all of the grapevine homologs showed very low expression in berry tissues (Figure 3.2.1). Though the top BLASTp homolog, VviCER4-3, did show expression in root, leaf and bud tissues. This was a strange case where very long chain primary alcohols (VLCPAs) were present in large quantities in berry skin (figure 3.3.2 A) and leaf (figure 3.3.7) tissues, despite very low expression of any VviCER4-type genes, which encode the enzyme for VLCPA production. A possible explanation was that the V1 annotation was missing additional VviCER4 homologs. A BLASTp search of the more recent V2 annotation and a tBLASTn search directly in the 12X grapevine genome were conducted to find any additional genes. These searches did not yield any new results. Another possibility tested was that the functional VviCER4 homolog is absent from the 12X grapevine genome, which is derived from the inbred homozygous grapevine line PN40024, but is found in other grapevine varieties. Such an idea is conceivable since Da Silva et al. (2013) were able to discover an additional 2866 non-annotated protein coding genes in the Tannat genome. As such, tBLASTn searches were conducted of the Tannat (Da Silva et al., 2013) and Merlot (Wong et al., 2016a) de novo assembled transcriptomes. The searches resulted in no new VviCER4 homologs. Failing at finding any expressed VviCER4 homologs, two other possibilities could explain the conundrum seen. VviCER4’s role in the cuticular wax biosynthetic pathway has been taken over by a phylogenetically unrelated gene, or the enzyme activity of the VviCER4 homolog(s) is extremely high and its role in the biosynthetic pathway can be kept with low gene expression. The first possibility seems more likely, since cuticular waxes are not present in root tissue, the expression of VviCER4-3 in root tissue and lack of expression in berry skin tissue would imply that the gene has a role distinct from cuticular wax biosynthesis.  91 In any case, based on the given data, VviCER4-3 and VviCER4-2 are assumed to be the most likely functional homologs. VviCER4-3 is the top BLASTp homolog and showed expression in some tissues. VviCER4-3 is a tandem duplicate of VviCER4-2 (Appendix Figure 3.2.1) and both enzymes are the same size as CER4 (490 versus 493 residues in size). VviCER4-1 and VviCER4-4 are neither expressed in berry or leaf tissue and their proteins are 571 and 632 residues in size, making it less likely that they are functionally relevant.  Section 4.1.8 WSD1 functional homologs  In Arabidopsis, WSD1 is a member of an expanded family of 11 wax ester synthase homologs (Li et al., 2008), the homologous family in grapevine is of similar size, with nine sequences residing in the same clade (Figure 3.1.7). As is the case in Arabidopsis, not all gene members may be involved in cuticular wax biosynthesis, as some may be involved in other functions such as TAG biosynthesis in seeds. In the tissues surveyed (Figure 3.2.1), VviWSD1, VviWSD2 (tandem duplicates of one another [Appendix Figure 3.2.1]), and the more distantly related WSD1 homolog 1 demonstrated strong expression in berry skin, with the genes being upregulated with later berry development. The pattern of expression of these three genes matches the pattern of wax ester accumulation in the berry cuticle later in development (Figure 3.3.2), and therefore are the likely relevant wax ester synthases in grapevine. It is interesting to note that the top BLASTp homolog (VviWSD9) is not expressed in grapevine tissues. This appears to be an example of gene duplication making a gene non-essential through redundancy and allowing it to mutate and become non-functional, a common fate in expanded gene families (Lynch and Conery, 2000).    92 Section 4.1.9 BAS functional homologs  β-amyrin synthase (BAS) is part of a large family of oxidosqualene cyclases, for which the BLASTp search found 17 family members in grapevine. The phylogenetic tree (data not shown) could not provide any resolution for narrowing down the functional homolog. The most likely functional candidates are VIT_09s0054g01210, VIT_09s0054g01220, and VIT_09s0054g01230 as all three were expressed in berry skin (Figure 3.2.2). The strong expression of VIT_09s0054g01220 (top BLASTp homolog) and its downregulation with berry skin development corresponds to the decrease of oleanolic acid (OA) content in berry skin with berry development. Thus VIT_09s0054g01220 is the most likely functional grapevine homolog. There is a possibility that there is a tissue sub-functionalization among grapevine homologs. While VIT_09s0054g01220 is expressed in berry skin, it is much weaker in expression in leaf tissue (which also has OA), while VIT_10s0003g03530 and VIT_10s0003g03650 are more strongly expressed in leaf tissue.  Section 4.1.10 CYP716A functional homologs  Fukushima et al. (2011) had functionally characterized three cytochrome P450 enzymes involved in OA biosynthesis: CYP716A12 (M. truncatula), CYP716A15 and CYP716A17 (Vitis vinifera). CYP716A12 was used as the basis for the BLASTp search, which yielded 12 grapevine homologs, and the phylogenetic tree could not narrow down the list of candidates. When examining the expression and DE pattern (Figure 3.2.2, Figure 3.2.4), the results revealed that three homologs showed expression in berry skin: VIT_11s0065g00040, VIT_11s0065g00130, and VIT_18s0072g00580; with VIT_11s0065g00130 (the top BLASTp homolog) being the only one showing expression in leaf tissue. The three genes are closely related, as they are found in the same clade in the phylogenetic tree (Figure 3.1.9). The down regulation of VIT_11s0065g00130 with berry development, and its very strong expression in  93 berry and leaf tissues correlate with the OA content of berry skin and leaves. Thus, VIT_11s0065g00130 is the likely functional homolog responsible for OA biosynthesis.  CYP716A15 and CYP726A17 annotation issue  The locus IDs that Fukushima et al. (2011) provided for CYP716A17 and CYP716A15 are incorrect, the authors gave their annotations to be GSVIVT01032218001 and GSVIVT01032223001 (12X V0 annotation system), respectively. These two annotations correspond to VIT_11s0065g00040 (functionally annotated as a CYP7016A12), and VIT_11s0065g00080 (functionally annotated as a 178 a.a. transcription factor), respectively (Grimplet et al., 2012). CYP716A15 is a 480 a.a. protein and the given gene annotation does not match at all. Furthermore, a BLASTp search of the V1 translated transcriptome does not yield a perfect match for CYP716A15, making the true gene identity a mystery.  On the other hand, CYP716A17 is a 100% match for VIT_11s0065g00130 instead of VIT_11s0065g00040. Based on the functional characterization of the CYP716A17 protein in Fukushima et al. (2011), and the expression pattern of VIT_11s0065g00130 in berry skin (Figures 3.2.2, 3.2.4, and 3.3.11 B), it is proposed that VIT_11s0065g00130 should be named VviCYP716A17 and that it is the actual characterized gene for OA biosynthesis.  Section 4.2 The Merlot grape berry cuticle Section 4.2.1 Merlot grape berry cuticular wax composition  The Merlot grape berry wax cuticle (Figure 3.3.2) is similar to other fleshy fruit cuticles, where triterpenoids (oleanolic and ursolic acids are most common in other fruits) make up a large portion of the cuticular wax (Lara et al., 2015). Compared to other surveyed grapevine varieties, the aliphatic wax composition of Merlot grape berry is similar, with VLCPAs, very long chain fatty acids (VLCFAs), and aldehydes being the most prominent aliphatic waxes, and a  94 very low alkane content (Radler, 1965). Total triterpenoid content of Merlot cuticular wax was around 68% in early green stages and decreased to about 50% at berry harvest. This means Merlot sits in the middle of the surveyed range of triterpenoid content (40-80%) in berry cuticular wax (Pensec et al., 2014). The decrease in total wax amount and triterpenoid content observed during berry maturation is typical of grape berries (Commenil et al., 1997; Pensec et al., 2014), and is common, though not universal, among other fruit species. By contrast, tomato cuticles continue to progressively accumulate triterpenoids during the whole time of fruit development (Lara et al., 2015).  Grapevine would make a good model organism to study fruit cuticle development, in addition to tomato. The species is a genetically diverse, well characterized perennial in which the fruit skins are easily peeled and contain abundant cuticular wax. However, long term seedling to fruit requirements, and recalcitrance to transformation make grapevine a possible but not ideal model for functional characterization of candidate genes involved in berry wax production.  Section 4.2.2 Distribution of carbon chain lengths of aliphatic waxes  Carbon chain lengths of VLCPA, VLCFA, and aldehydes in leaf and berry skin cuticular waxes ranged from C18 to C32, with C24, C26, and C28 being the most abundant. For alkanes, they ranged from C21 to C31 with C23, C25, and C27 being the most abundant (Figures 3.3.3, 3.3.4, and 3.3.5). This distribution in carbon chain length is very similar to what was seen in other grape varieties’ cuticular waxes (Radler, 1965). The distribution of abundance has a bell curve shape which is seen in wax profiles of other species (Cameron, 2005; Kim et al., 2007; Kosma et al., 2009).   95 Section 4.2.3 Changes in cuticular wax composition during normal grape berry development Veraison is the key stage for shift in cuticular wax biosynthetic pathway  VLCPAs and aldehydes were at their highest amount at 41 days after anthesis (DAA), while wax esters and VLCFAs were at their lowest level at 27 DAA. A shift in berry cuticular wax composition occurred at veraison (68 DAA), at which point earlier trends reversed. After veraison (i.e., during berry ripening), VLCPA and aldehyde amounts were at their lowest, and VLCFA and wax ester amounts were at their highest level (Figure 3.3.2 A).  The shift in wax composition suggests major shifts in the expression of cuticular wax biosynthetic genes occurring at veraison, which was observed. The majority of fatty acid elongation genes (Figure 3.3.9), VviCER3-3, VviCER4-2, and VviCER4-3 (Figure 3.3.10) decreased in expression, while at the same time VviKCS11, WSD1 homolog1, VviWSD1, and VviWSD2 increased in expression. Thus, veraison is a pivotal phenological stage in the regulation of the cuticular aliphatic wax biosynthetic pathway. It is not surprising since major changes in gene expression in numerous pathways occur at veraison (Wong et al., 2016a).  VviERF045 is likely a key regulatory gene driving the shift in cuticular wax at veraison  VviERF045 has been proposed to be a key regulatory gene in berry ripening (Palumbo et al., 2014), and been demonstrated to positively regulate VviWSD2 and negatively regulate VviCER2-LIKE, VviERF042 (SNH1/WIN1 homolog), and VviERF044 (SHN2 homolog) (Leida et al., 2016). Among the regulatory genes tested, VviERF045 was the only one upregulated with berry ripening, its expression pattern corresponded with the upregulation of WSD1 homologs and downregulation of other biosynthetic genes (Figures 3.3.9, 3.3.10, and 3.3.11). Thus, expression evidence supports the assertion that VviERF045 has an important role in regulating the shift in cuticular wax biosynthesis that occurs at veraison.  96 Berry cuticular wax structure is fully developed several weeks before harvest  The amount of all aliphatic waxes, except for wax esters, decreased from 82 DAA onwards in CT berries (Figure 3.3.2 A, C), which would indicate that biosynthesis and accumulation of aliphatic waxes decreased dramatically during normal unstressed berry development from 82 DAA onwards. Wax concentrations and the ratio of triterpenoids:aliphatic waxes stabilized or decreased slightly (Figure 3.3.2 D) as berries reached their final size (Figure 3.3.1 B). It would then be expected that the cuticular wax pathway was turned off from 82 DAA onwards as the CT berry cuticle reached maturity. This is exactly what was seen for the majority of the biosynthetic genes (Figures 3.3.9-11). In addition, berry transpiration rate remained stable after 75 DAA (Figure 3.3.12), suggesting that cuticle physiology has stopped changing and had completed development.  Section 4.2.4 Merlot grapevine leaf cuticular wax composition  Merlot grapevine leaves (Figure 3.3.7) had a much different cuticular wax profile from berries. In young leaves alkanes were the major components of aliphatic wax and VLCPA were the second major components of aliphatic wax. Triterpenoids were a minor component of leaf cuticular wax. This composition is very similar to grapevine leaves of other varieties (Radler, 1965), as well as leaves of other species, where alkanes and VLCPAs are major cuticular wax components (Cameron, 2005; Kosma et al., 2009).  The evolution of cuticular wax composition of maturing leaves is different from that of cuticular wax on developing berries. The aliphatic wax load on leaves decreases with leaf development, while triterpenoid load stays stable. This leads to the triterpenoid:aliphatic wax ratio to increase with leaf development, a stark contrast to berries. Like with berries though, aliphatic wax composition changes with development. In young leaves, alkanes are the dominant wax followed by VLCPAs, but in mature leaves the VLCPAs are the dominant wax followed by  97 alkanes.  A significant increase in alkane wax on mature leaves in response to WD stress suggests that VviCER1s and VviCER3-3 of the alkane forming branch in the aliphatic wax biosynthetic pathway are upregulated in leaves. Both CER1 and CER3 are needed for alkane biosynthesis.  Such differing cuticular wax composition between berry skin and leaf tissues would indicate that the cuticular aliphatic wax and oleanolic acid biosynthesis should be regulated differently between these organs and tissues.    98 Section 4.3 Changes in the berry cuticular wax composition due to water deficit stress Section 4.3.1 Transcriptomic data indicate that cuticular wax pathway gene expression is modulated in response to WD stress  Transcriptomic data from previous WD experiments indicated that Tocai friulano, and especially Merlot grape berry cuticular wax-related genes were differentially expressed under stress. In Merlot, the differential expression (DE) pattern indicated general upregulation of the genes of the cuticular aliphatic wax biosynthetic pathway and downregulation of OA biosynthetic genes. Based on the DE pattern, we would expect to see wax composition to contain increased content of VLCFAs since VviCER2 homologs and two strongly expressed VviKCS homologs, that are involved in fatty acid elongation, were upregulated. From the alcohol forming branch of the pathway, we would expect to see increased amounts of VLCPA and wax esters as VviCER4-2, VviWS1, and VviWSD2 were upregulated (Figure 3.2.3). Both VviBAS (VIT_09s0054g0122) and VviCYP716A17 (VIT_11s_0065g00130) were downregulated, which should result in decreased amounts of β-amyrin, OA, and their intermediate compounds (Figure 3.2.4).   Section 4.3.2 WD effect on grape berry cuticular aliphatic wax  In this experiment, WD plants experienced prolonged water deficit stress as opposed to early (pre-veraison) or late (post-veraison) WD since differences in LWP were consistently significant from 37 DAA onward. Making a distinction in the type of WD stress that was applied is important since the timing of the application can affect grape berry development differently (Castellarin et al., 2007). The applied stress resulted in WD berries being smaller with higher total soluble solids (i.e. sugar) (Figure 3.3.1), typical traits of WD stressed berries (Castellarin et al., 2007).  A significant increase in total aliphatic wax amount and a significant decrease in the ratio  99 in total triterpenoids:total aliphatic waxes due to WD stress was seen throughout most of berry development (Figure 3.3.2). The increased aliphatic wax content was significant post-veraison at 82 and 111 DAA and the decreased total triterpenoids:total aliphatic wax ratio was significant at 41, 82, and 111 DAA. When examining the aliphatic wax composition at harvest (111 DAA), VLCFA, VLCPA, aldehydes, and wax esters were significantly increased in amount under water deficit stress. Remarkably, wax esters were significantly increased by WD treatment throughout most of berry development.  The significant increases in content suggest that major parts of the cuticular aliphatic wax biosynthetic pathway were upregulated in response to WD stress, including fatty acid elongation (FAE), the alcohol forming branch, and the undiscovered mechanism responsible for aldehyde synthesis in the alkane forming branch. It is unlikely that the decreased surface area of WD berries had a significant impact at increasing the concentration of cuticular waxes on the berry surface. If it did, we would expect to see significant increases in amount for all cuticular waxes, and an unchanged ratio of total triterpenoids:total aliphatic waxes between treatments. This was not the case, as the ratio was significantly lower and some cuticular waxes were not significantly increased in amount in WD berries, for example, alkanes (Figure 3.3.5 B), β-amyrin, and erythrodiol (Figure 3.3.6) at 96 and 111 DAA.  The case of the FAE  Significant increases in VLCFA content in response to WD stress (Figure 3.3.3) would indicate that the FAE was upregulated, yet the DE of FAE components was somewhat contradictory. VviCER10-1, VviCER2, VviKCS6, 11, and 15 were upregulated while VviKCR1-1, VviPAS2-1, VviKCS4, and 16 were downregulated. The results would suggest that FAE activity was increased and that the availability of one of the components was rate limiting, that likely  100 being VviCER10-1, which was upregulated both pre- and post-veraison. The expression results bring up the question as to why would VviPAS2-1 and VviKCR1-1 be downregulated, especially since they do not likely have redundant homologs to compensate for the decreased expression (Figure 3.3.9).  The alkane forming branch  The very high aldehyde amount and the very low alkane amount in berry wax (Figure 3.3.5) was coupled with strong expression of VviCER3-3 and very low expression of VviCER1-3 (Figure 3.3.10 B). In leaves, alkane content was very high and aldehyde amount was very low (Figure 3.3.8) with strong expression of both VviCER3-3 and VviCER1-3 (data not shown). Coupled with VviCER3-3’s strong consistent expression in all aerial tissues in the transcriptomic data (Figure 3.2.1), it appears that grape berry tissue controlled the activity of the CER1/CER3 heterodimer and alkane production by modulating the expression of CER1 genes. High amounts of aldehyde and low amounts of alkanes seen in berry wax was may be due to VviCER3-3 forming a homodimer that would have strong fatty acyl-acyl carrier protein reductase (FAAR) activity and low aldehyde decarbonylase (AD) activity as proposed in Bernard et al. (2012). Subsequently, an overproduction of aldehyde intermediates and a deficiency in alkanes would occur in berry wax as AD activity would be a rate limiting step. Upregulation of VviCER1-3 and VviCER3-3 was observed during WD stress in grape berries (Figure 3.3.11 B), but did not yield significant increases in alkane content other than at veraison (when neither genes were upregulated). The lack of increase in alkane amount was probably due to VviCER1-3 expression levels being still very low even when upregulated. It can be speculated an upregulation of VviCER3-3 would lead to an increase of CER3 homodimers in the berry skin. The resulting increase in FAAR activity would lead to increased aldehyde amounts in berry cuticular wax, which is what is seen.  101 Alcohol forming branch  The upregulation of VviCER4-3 (Figure 3.3.10 A) coincided with the increase (though not statistically significant) in VLCPA content at 41DAA (Figure 3.3.4 A), but expression pattern of the gene supports the notion that another gene is responsible for VLCPA synthesis. The expression level of VviCER4-3 was already low in berry tissue and was completely off at 96 and 111 DAA, while at 111 DAA there was a significant increase in VLCPA amount due to WD stress. This indicates that VLCPA synthesis and accumulation continued while VviCER4-3 was off, hence another gene must have been responsible for VLCPA synthesis during the ripening stages.  The increasing expression during development starting at veraison of wax ester synthase genes WSD1 homolog 1, VviWSD1, and VviWSD2 (Figure 3.3.10 A) matched the accumulation of wax esters later in berry development (Figure 3.3.4 B). Wax esters were the most significantly increased aliphatic wax, increasing by a total of 280% at harvest time (111DAA) compared to wax ester content of CT berries. The upregulation of the three genes before and after veraison matched all the instances where wax esters amounts were significantly increased during berry development.  Section 4.3.4 WD effect on the expression of the cuticular wax related transcription factor genes in grape berry skin  ABA signaling is positively involved in and promotes cuticle formation in Arabidopsis. It positively regulates MYB16, MYB94, and MYB96 and negatively regulates DEWAX transcription factors that have direct effect on the expression cuticular aliphatic wax biosynthetic genes. Cuticular wax related genes are similarly upregulated in response to ABA and to drought stress (Cui et al., 2016). Both exogenous application of ABA and drought stress also cause similar increase in Arabidopsis leaf cuticular wax content and decrease in leaf transpiration  102 (Kosma et al., 2009).  In grapevine, ABA signaling is used to mediate osmotic stress (e.g. WD stress) and the increase in ABA concentration in plant tissues, including berries, induces the upregulation of ABA-related genes (Deluc et al., 2009). A significant upregulation of VviMYB30B (MYB96 homolog) was seen at 41 and 96 DAA, and a significant downregulation of VviERF084 (DEWAX homolog) was observed at 96 DAA (Figure 3.3.11 A). Barring measuring ABA levels to confirm, it is likely that the changes in biosynthesis and cuticular wax content we have seen are a result of by an ABA-mediated drought response.  Section 4.3.5 WD effect on grape berry triterpenoid content  In contrast to aliphatic waxes, there were no significant increases in total triterpenoid amount due to WD stress (Figure 3.3.2 B). Yet, when examining the abundance of the individual compounds, a significant increase of OA was observed at veraison and late in berry ripening (Figure 3.3.6). This difference would suggest an increase in expression of the OA biosynthetic genes, which is in contrast to the downregulation observed in the Merlot under WD stress transcriptomic data. When measured, VviBAS was downregulated and VviCYP716A17 was unaffected (Figure 3.3.11 B). This leaves the possibility that the increased OA content is due to other functional homologous genes being upregulated, such as CYP716A15 (Fukushima et al., 2011).  Section 4.3.6 Water Transpiration through the berry cuticle  The results for the berry transpiration experiments were somewhat ambiguous. No significant differences between the average rates of water loss of the two treatments, or in cumulative amount of water lost were found (Figure 3.3.12). Yet, near significant decreases in the rate of water transpiration and the cumulative amount of water lost were seen for WD berries  103 at 111 DAA, which coincides with the largest significant increase in aliphatic wax content and significant decrease in the ratio of triterpenoid:aliphatic wax in WD berries at 111 DAA. Experiments dealing with response to WD stress in Arabidopsis (Kosma et al., 2009) and tobacco tree (Cameron, 2005) leaves saw a decrease in rate of water loss accompanying an increase of cuticular aliphatic wax amount. Therefore, it would be reasonable to expect a decrease in rate of transpiration in WD stressed berries. From the transpiration data, it is not possible to state that the changes in cuticular wax have a biologically significant effect on berry transpiration.  Cuticular aliphatic waxes have been demonstrated to impede water transpiration through an artificial membrane and are responsible for forming the water impermeable barrier on grape berries, whereas oleanolic acid does not contribute to any berry cuticular impermeability (Grncarevic and Radler, 1971; Casado and Heredia, 1999). WD stressed berries had significantly higher amounts of cuticular aliphatic waxes, and the ratio of triterpenoids:aliphatic waxes was significantly lower. The evidence strongly indicates that WD berries should have experienced a significantly lower transpiration rate, but as mentioned before, this resulted in a near significant reduction in transpiration rate and cumulative water lost at harvest time (111 DAA). Since it is debatable that the possible change in berry transpiration in response to WD is biologically significant, it brings to question as to the biological role of the increased wax content in WD berry cuticles. Possible explanations could be that the berry response is part of a systemic response of all plant aerial tissues to WD stress, where cuticular wax load is increased to reduce transpiration rates, regardless if the change in wax load is effective or not. Another explanation could be that the change in wax load has a different biological role than expected, possibly protecting the berry cuticle against an unaccounted environmental stress, such as higher light conditions on the more exposed WD berry.   The majority of the variables affecting water transpiration through the cuticle were  104 controlled for in these experiments in order to have a high certainty that any water loss was through the cuticle. Water loss through berry stomata should be negligible since they are found at a much lower density than on leaves and seal shortly after anthesis by cuticular wax (Palliotti and Cartechini, 2001). The berries were kept in the dark during the transpiration experiments to keep stomata closed in case they were still open. Water loss through the cut pedicel was eliminated by sealing the wound with Vaseline, which is as effective as paraffin wax (data not shown). The significant difference in total soluble solids between treatments should not have a major effect on water transpiration because of the large vapour pressure gradient due to the low relative humidity (32%) inside the desiccation chamber.  The transpiration rates of individual berries were variable, which could affect the precision of calculating statistical significant differences. The source of this variability could be due to the imperfections of the cuticular wax surface due to handling and touching of the berries to each other, or the natural variability in wax composition between berries. Other than measuring the real-time gas exchange rate (Shirazi and Cameron, 1993), it is difficult to make improvements to increase the precision of the transpiration experiments.  Section 4.4 Oleanolic acid is likely most important during early berry development for disease resistance  High amounts of OA (Figure 3.3.2 B) and high expression of its biosynthetic genes (VviBAS and VviCYP716A17) early in development that quickly decreased from veraison onwards confirms that OA accumulation occurs pre-veraison (Pensec et al., 2014). We have shown that the ratio of triterpenoids:aliphatic wax goes from high to low with berry development (Figure 3.3.2 D). OA does not contribute to the impermeability of the berry cuticle (Grncarevic and Radler, 1971), supported with the fact that during berry development the transpiration rate decreased (Figure 3.3.12) and stabilized as the ratio of triterpenoids:aliphatic waxes decreased  105 and stabilized.  Resistance to Botrytis cinerea infection is highest in young green berries and decreases substantially after veraison, which has been correlated with the decrease in wax density/surface area during development (Commenil et al., 1997). B. cinerea can produce a series of esterases, lipases, and cutinases that can help hydrolyze the cuticle (van Kan, 2006). Commenil, Brunet, & Audran (1997) did not find any differences in total wax content between different varieties of varying B. cinerea susceptibility. OA has antimicrobial properties and varies greatly in amount in the berry cuticle of different grapevine varieties (Pensec et al., 2014). It is likely that the OA amount and the ratio of OA:aliphatic waxes are crucial for conveying resistance and that their decrease during development would correlate with the decrease in resistance observed (Pensec et al., 2014).  Seeing that cuticular aliphatic wax biosynthesis changes in response to WD stress, it is reasonable to infer that cuticular wax accumulation would respond to different stresses, including to B. cinerea infection. During infection, changes in gene regulation would indicate subsequent changes in cuticular wax composition. VviERF045 was downregulated, which would decrease the expression of the cuticular aliphatic wax pathway later in development (Figure 3.2.5). The majority of differentially expressed cuticular aliphatic wax genes were downregulated under B. cinerea infection, which should lead to an overall decrease in aliphatic wax content in berry cuticles (Figure 3.2.3). At the same time, VviCYP716A17 was upregulated, which should lead to an increase in OA content. Thus, the gene regulation response to B. cinerea infection supports the notion that OA content and OA:aliphatic wax ratio are important to infection resistance.  A study to explore the role OA in disease resistance would need to examine the response of berry cuticular wax content to B. cinerea infection in relation to the extent of pathogen resistance of different grapevine varieties.   106 Section 4.5 A working hypothesis — berry cuticular aliphatic wax biosynthesis is regulated by ABA and ethylene during berry development  The grape berry is a non-climacteric fruit, where development is hormonally controlled by auxin and ABA, the latter being a key hormone for initiating ripening (Kuhn et al., 2014). Ethylene is now also believed to play a role in initiating ripening. The grape berry passes through three stages of development. During stage I, ABA concentration decreases after fruit set, which coincides with increases in auxin. As the berry enters stage II of development, auxin levels peak and then decrease while ABA levels start to increase shortly before veraison. As the berry transitions through veraison into stage III of development, a fleeting increase in ethylene occurs and ABA continues to increase into the ripening stage (Kuhn et al., 2014).  The expression pattern of cuticular aliphatic wax biosynthetic genes and wax compositional data indicate that there are two periods of increased wax production during berry development. The first period occurs during stage I (at 27 and 41 DAA), when most genes were at their highest expression levels. These genes included VviMYB30A (MYB96 homolog) and VviMYB30B (MYB30 homolog). As the berry progressed through stage II, genes were downregulated in green berries at 68DAA and then experienced an increase in expression once berries transitioned through veraison and became red at 68 DAA. At the same time during veraison, VviERF045 and genes regulated by it (e.g. wax ester synthase genes) experienced an upregulation and consistent high expression until harvest. This is in contrast to the majority of the other genes that were highly expressed early in development and turned off late in ripening after 96 DAA.   When the expression of the wax biosynthetic pathway genes is overlaid with the predicted hormonal levels in the berry during development, a pattern appears and a working hypothesis can be made about the regulation of the berry cuticular wax deposition.  ABA has been demonstrated to positively regulate cuticular aliphatic wax in other  107 organisms (Kosma et al., 2009; Cui et al., 2016), and it appears that ABA and ethylene are key regulators of cuticular aliphatic wax biosynthesis in grape berries. High ABA levels, mediated through VviMYB30A and VviMYB30B, in stage I of berry development initiate the first major biosynthesis period of cuticular aliphatic wax. As berries progress and enter stage II, ABA levels have decreased and wax biosynthesis has followed suit. With the commencement of veraison, ABA levels increase, causing an upregulation in gene expression and the start of the second period of wax biosynthesis. At the same time, the momentary increase in ethylene initiates the action of VviERF045, which modulates the reactivation of the wax biosynthetic pathway genes to focus production towards VLCFAs and wax esters.  In response to WD stress, regulation of the wax biosynthetic pathway is mediated by modulating ABA levels in the berry. ABA levels are increased in response to WD stress, causing an upregulation of the pathway genes, and subsequent increased cuticular wax production. If this hypothesis is accurate, it can be predicted that grapevine varieties that do not experience an increase in ABA levels in berries due to WD stress (Deluc et al., 2009), would not experience an increased wax load.        108 Chapter 5: Conclusion Section 5.1 Changes in grape berry cuticular wax composition and accumulation in response to water deficit stress  This thesis presents the characterization of the grape berry cuticular wax during fruit development in response to water deficit (WD) stress. The results partially support the initial hypothesis: the cuticular aliphatic wax biosynthetic genes are transcriptionally upregulated in grape berry under water deficit stress, resulting in increased cuticular wax load, but it is ambiguous if this results in a significant decrease of the berry’s transpiration rate.  Since the cuticular aliphatic wax biosynthetic genes have not been characterized in grapevine, the first portion of the thesis involved identifying grapevine homologs to Arabidopsis cuticular aliphatic wax biosynthetic genes. This then allowed us to study their expression in relation to wax accumulation in the grape berry and in response to water deficit stress. The putative genes for oleanolic acid (OA) biosynthesis were also identified since this triterpenoid is a prominent compound in berry cuticular wax. A series of BLASTp searches, followed by phylogenetic analyses and the survey of publicly available RNA-seq datasets produced a list of 22 most likely grapevine homologs that encode enzymes of the two wax biosynthetic pathways.  The second portion of the research dealt with testing the hypothesis mentioned above by growing Merlot grape berries under water deficit stress. This work involved analyses of cuticular wax composition, expression of cuticular wax related biosynthetic and regulatory genes, and transpiration through the cuticle. The total aliphatic wax content was significantly greater in berries exposed to water deficit from veraison; however, a significant increase in wax esters was observed throughout berry development. The ratio of triterpenoids:aliphatic waxes in the berry cuticle was significantly lower under water deficit stress. Upregulation of the cuticular wax biosynthetic genes was observed for grapevine homologs associated with fatty acid elongation, the alkane forming branch, and the alcohol forming branch. Putative regulatory genes were also  109 differentially expressed, with the one associated with conveying WD stress signals being upregulated. Finally, marginally significant decreases in the berry transpiration rate and amount of water lost through transpiration were observed in WD berries at harvest. Whether the increase in aliphatic wax content and the decrease in the ratio of triterpenoid:aliphatic wax observed in the berry under WD stress is a mechanism to reduce berry transpiration or has other biological functions remains to be clarified.  This thesis was also able to provide a characterization of the changes in of cuticular wax composition and of the regulation of associated putative biosynthetic and regulatory genes during berry development. Building upon the current knowledge that OA content is highest in early berry development and that total cuticular wax content decreases with berry growth we were able to demonstrate that: i) the cuticular aliphatic wax composition changes with development, with very long chain (VLC)-aldehydes and VLC-primary alcohols increasing in amount during early (green) stages of berry development, and VLC-fatty acids and wax esters increasing in amount during ripening (red berries); ii) the expression pattern of putative biosynthetic genes displays two peaks of high expression: one at the beginning of berry development and the second at veraison (the onset of ripening); iii) veraison identifies a shift in the expression of the aliphatic wax biosynthetic genes. Based on this new information generated in the course of my MSc thesis research, a new hypothesis can be put forward as to how berry cuticular aliphatic wax synthesis is regulated. The hormone abscisic acid (ABA) has been demonstrated to induce aliphatic wax synthesis and is implicated in activating wax synthesis in response to WD stress. In addition, ABA, auxins, and ethylene are important hormones in regulating the stages of grape berry development. ABA might be the major (positive) regulator of cuticular aliphatic wax biosynthesis in grape berries. The high levels of ABA occurring at the beginning of berry development (stage I), and at veraison continuing into stage III might induce the aliphatic wax biosynthesis during these  110 stages of berry development. In addition, ethylene might play an important role in modulating wax biosynthesis and inducing wax ester production since it peaks at veraison when a shift in wax composition and a significant increase in ester biosynthesis are observed.  Section 5.2 Relevance This body of work is important as it expands our knowledge in several areas. First, it provides a list of the most likely grapevine homologs involved in cuticular aliphatic wax biosynthesis, that will allow future grapevine studies to examine the expression and regulation of this biosynthetic pathway under diverse environmental conditions. Secondly, it greatly expands our knowledge of the grape cuticular wax production and its changes in the course of development. Thirdly, this is the first study examining the response of cuticular wax biosynthetic genes of any fleshy fruit under WD stress, one of the major threats in agriculture. Our results expand our understanding of how the cuticle responds to this abiotic stress in fruit crops. It demonstrates that fruit cuticles respond to WD stress in a similar fashion to that of leaves in other species, by upregulating the aliphatic wax biosynthetic pathway in order to increase the cuticular wax load and possibly decrease the transpiration rate.  Section 5.3 Future research Functional characterization of grapevine homologs  The thesis identified a number of grapevine homologs that putatively encode enzymes of the cuticular aliphatic wax biosynthetic pathway, but we did not functionally characterize them. Future work would involve further in silico analyses of the identified protein sequences in order to compare the motifs of the grapevine homologs with the ones of the Arabidopsis genes, followed by functional characterization of the top candidate genes by transforming Arabidopsis  111 or yeast knock-out mutants. Grapevine would not be the ideal organism to use since it is quite recalcitrant to transformation and would require several years before a berry phenotype could be observed.  Role of ABA in regulation of cuticle wax biosynthesis in berries  Two experiments can be performed to explore the role of ABA in regulating berry cuticular wax biosynthesis. The first experiment would involve characterizing the grape berry cuticular wax load and composition after the berry is exposed to exogenous ABA. The second experiment would compare the grape berry wax of grape varieties that experience an increase of endogenous ABA in the berry due to WD stress and those that do not. In addition to measuring cuticular wax content and gene expression of cuticular wax related genes, these studies would also measure ABA levels in the berries and the expression levels of genes involved in ABA-dependent WD signaling.  Exploring the role of berry cuticular wax composition in response to biotic stress  Triterpenoid content in berry cuticular wax has been demonstrated to vary greatly between grape varieties, and that the major triterpenoid produced in the berry wax, oleanolic acid, possesses antimicrobial properties. Yet there have not been any studies characterizing how OA levels and aliphatic wax composition affects disease resistance in grapes. This experiment would involve characterizing the berry cuticular wax content of a number of grapevine varieties that have varying resistance to pathogens such as Botrytis cinerea and powdery mildew (Erysiphe necator). Transcriptional data indicate that cuticular wax related genes are differentially expressed when the berry is infected by Botrytis (Blanco-Ulate et al., 2015). Thus, the experiment would include a characterization of berry cuticular wax and of gene expression of cuticular wax related genes when berries are under pathogen attack.  112 References Bach L, Michaelson L V, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin J-P, Miquel M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc Natl Acad Sci U S A 105: 14727–31 Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) Functional characterization of the Arabidopsis b-ketoacyl-coenzyme A reductase candidates of the fatty acid elongase. Plant Physiol 150: 1174–1191 Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure J-D, Haslam RP, Napier JA, Lessire R, Joubes J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell 24: 3106–3118 Bernard A, Joubès J (2013) Arabidopsis cuticular waxes: Advances in synthesis, export and regulation. Prog Lipid Res 52: 110–129 Blanco-Ulate B, Amrine KC, Collins TS, Rivero RM, Vicente AR, Morales-Cruz A, Doyle CL, Ye Z, Allen G, Heymann H, et al (2015) Developmental and metabolic plasticity of white-skinned grape berries in response to  Botrytis cinerea  during noble rot. Plant Physiol 169: pp.00852.2015 Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120 Borisjuk N, Hrmova M, Lopato S (2014) Transcriptional regulation of cuticle biosynthesis. Biotechnol Adv 32: 526–540 Cameron KD (2005) Increased accumulation of cuticular wax and expression of lipid transfer protein in response to periodic drying events in leaves of tree tobacco. Plant Physiol 140: 176–183  113 Campagna D, Albiero A, Bilardi A, Caniato E, Forcato C, Manavski S, Vitulo N, Valle G (2009) PASS: A program to align short sequences. Bioinformatics 25: 967–968 Casado CG, Heredia A (1999) Structure and dynamics of reconstituted cuticular waxes of grape berry cuticle (Vitis vinifera  L.). J Exp Bot 50: 175–182 Castellarin SD, Gambetta GA, Wada H, Krasnow MN, Cramer GR, Peterlunger E, Shackel KA, Matthews MA (2016) Characterization of major ripening events during softening in grape: Turgor, sugar accumulation, abscisic acid metabolism, colour development, and their relationship with growth. J Exp Bot 67: 709–722 Castellarin SD, Matthews MA, Di Gaspero G, Gambetta GA (2007) Water deficits accelerate ripening and induce changes in gene expression regulating flavonoid biosynthesis in grape berries. Planta 227: 101–112 Chaves MM, Zarrouk O, Francisco R, Costa JM, Santos T, Regalado AP, Rodrigues ML, Lopes CM (2010) Grapevine under deficit irrigation: hints from physiological and molecular data. Ann Bot 105: 661–676 Cominelli E, Sala T, Calvi D, Gusmaroli G, Tonelli C (2008) Over-expression of the Arabidopsis AtMYB41 gene alters cell expansion and leaf surface permeability. Plant J 53: 53–64 Commenil P, Brunet L, Audran J (1997) The development of the grape berry cuticle in relation to susceptibility to bunch rot disease. J Exp Bot 48: 1599–1607 Cui F, Brosché M, Lehtonen MT, Amiryousefi A, Xu E, Punkkinen M, Valkonen JPT, Fujii H, Overmyer K (2016) Dissecting abscisic acid signaling pathways involved in cuticle formation. Mol Plant 9: 926–938 DeBono A, Yeats TH, Rose JKC, Bird D, Jetter R, Kunst L, Samuels L (2009) Arabidopsis LTPG Is a Glycosylphosphatidylinositol-Anchored Lipid Transfer Protein Required for Export of Lipids to the Plant Surface. Plant Cell Online 21: 1230–1238  114 Deluc LG, Quilici DR, Decendit A, Grimplet J, Wheatley MD, Schlauch KA, Mérillon J-M, Cushman JC, Cramer GR (2009) Water deficit alters differentially metabolic pathways affecting important flavor and quality traits in grape berries of Cabernet Sauvignon and Chardonnay. BMC Genomics 10: 212 Fanciullino AL, Bidel LPR, Urban L (2014) Carotenoid responses to environmental stimuli: Integrating redox and carbon controls into a fruit model. Plant, Cell Environ 37: 273–289 Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant Cell 12: 2001–8 Fukushima EO, Seki H, Ohyama K, Ono E, Umemoto N, Mizutani M, Saito K, Muranaka T (2011) CYP716A subfamily members are multifunctional oxidases in triterpenoid biosynthesis. Plant Cell Physiol 52: 2050–2061 Gil M, Pascual O, Gómez-Alonso S, García-Romero E, Hermosín-Gutiérrez I, Zamora F, Canals JM (2015) Influence of berry size on red wine colour and composition. Aust J Grape Wine Res 21: 200–212 Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis Cuticular Wax Biosynthesis Is Negatively Regulated by the DEWAX Gene Encoding an AP2/ERF-Type Transcription Factor. Plant Cell 26: 1666–1680 Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653–667 Grimplet J, Van Hemert J, Carbonell-Bejerano P, Díaz-Riquelme J, Dickerson J, Fennell A, Pezzotti M, Martínez-Zapater JM (2012) Comparative analysis of grapevine whole-genome gene predictions, functional annotation, categorization and integration of the  115 predicted gene sequences. BMC Res Notes 5: 213 Grncarevic M, Radler F (1971) A review of the surface lipids of grapes and their importance in the drying process. Am J Enol Vitic 22: 80–86 Hall BG (2013) Building phylogenetic trees from molecular data with MEGA. Mol Biol Evol 30: 1229–1235 Haslam TM, Haslam R, Thoraval D, Pascal S, Delude C, Domergue F, Fernández AM, Beaudoin F, Napier JA, Kunst L, et al (2015) ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation. Plant Physiol 167: 682–692 Haslam TM, Kunst L (2013a) Extending the story of very-long-chain fatty acid elongation. Plant Sci 210: 93–107 Haslam TM, Kunst L (2013b) Wax analysis of stem and rosette leaves in  Arabidopsis thaliana . bioprotocols. doi: https://doi.org/10.21769/BioProtoc.782 Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths. Plant Physiol 160: 1164–74 Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, et al (2007) The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449: 463–467 Javelle M, Vernoud V, Depège-Fargeix N, Arnould C, Oursel D, Domergue F, Sarda X, Rogowsky PM (2010) Overexpression of the epidermis-specific homeodomain-leucine zipper IV transcription factor OUTER CELL LAYER1 in maize identifies target genes involved in lipid metabolism and cuticle biosynthesis. Plant Physiol 154: 273–286 Joubès J, Raffaele S, Bourdenx B, Garcia C, Laroche-Traineau J, Moreau P, Domergue F, Lessire R (2008) The VLCFA elongase gene family in Arabidopsis thaliana: Phylogenetic  116 analysis, 3D modelling and expression profiling. Plant Mol Biol 67: 547–566 van Kan JAL (2006) Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends Plant Sci 11: 247–253 Kannangara R, Branigan C, Liu Y, Penfield T, Rao V, Mouille G, Hofte H, Pauly M, Riechmann JL, Broun P (2007) The transcription factor WIN1/SHN1 regulates cutin biosynthesis in Arabidopsis thaliana. Plant Cell Online 19: 1278–1294 Kim D, Langmead B, Salzberg SL (2015) HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12: 357–60 Kim H, Lee SB, Kim HJ, Min MK, Hwang I, Suh MC (2012) Characterization of glycosylphosphatidylinositol-anchored lipid transfer protein 2 (LTPG2) and overlapping function between LTPG/LTPG1 and LTPG2 in cuticular wax export or accumulation in arabidopsis thaliana. Plant Cell Physiol 53: 1391–1403 Kim KS, Park SH, Jenks MA (2007) Changes in leaf cuticular waxes of sesame (Sesamum indicum L.) plants exposed to water deficit. J Plant Physiol 164: 1134–1143 Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lu S, Joubes J, Jenks MA (2009) The impact of water deficiency on leaf cuticle lipids of Arabidopsis. Plant Physiol 151: 1918–1929 Kosma DK, Murmu J, Razeq FM, Santos P, Bourgault R, Molina I, Rowland O (2014) AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types. Plant J 80: 216–229 Kosma DK, Parsons EP, Isaacson T, Lü S, Rose JKC, Jenks MA (2010) Fruit cuticle lipid composition during development in tomato ripening mutants. Physiol Plant 139: 107–117 Kuhn N, Guan L, Dai ZW, Wu BH, Lauvergeat V, Gom??s E, Li SH, Godoy F, Arce-Johnson P, Delrot S (2014) Berry ripening: Recently heard through the grapevine. J Exp Bot 65: 4543–4559  117 Lam P, Zhao L, Eveleigh N, Yu Y, Chen X, Kunst L (2015) The exosome and trans-acting small interfering RNAs regulate cuticular wax biosynthesis during Arabidopsis inflorescence stem development. Plant Physiol 167: 323–336 Lara I, Belge B, Goulao LF (2015) A focus on the biosynthesis and composition of cuticle in fruits. J Agric Food Chem 63: 4005–4019 Lee SB, Kim HU, Suh MC (2016) MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis. Plant Cell Physiol 57: 2300–2311 Lee SB, Suh MC (2015) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in arabidopsis. Plant Cell Physiol 56: 48–60 Lee TH, Tang H, Wang X, Paterson AH (2013) PGDD: A database of gene and genome duplication in plants. Nucleic Acids Res 41: 1–7 Leida C, Dal Rì A, Dalla Costa L, Gómez MD, Pompili V, Sonego P, Engelen K, Masuero D, Ríos G, Moser C (2016) Insights into the role of the berry-specific ethylene responsive factor VviERF045. Front Plant Sci 7: 1793 Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008) Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol acyltransferase WSD1 required for stem wax ester biosynthesis in Arabidopsis. Plant Physiol 148: 97–107 Li L, Yu X, Thompson A, Guo M, Yoshida S, Asami T, Chory J, Yin Y (2009) Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid-induced gene expression. Plant J 58: 275–286 Li Y, Zhu Y, Yao J, Zhang S, Wang L, Guo C, Van Nocker S, Wang X (2017) Genome-wide identification and expression analyses of the homeobox transcription factor family during ovule development in seedless and seeded grapes. Sci Rep 7: 1–16 Liao Y, Smyth GK, Shi W (2014) FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30: 923–930  118 Licausi F, Giorgi FM, Zenoni S, Osti F, Pezzotti M, Perata P (2010) Genomic and transcriptomic analysis of the AP2/ERF superfamily in Vitis vinifera. BMC Genomics 11: 719 Licausi F, Ohme-Takagi M, Perata P (2013) APETALA2/Ethylene Responsive Factor (AP2/ERF) transcription factors: Mediators of stress responses and developmental programs. New Phytol 639–649 Lu S, Zhao H, Des Marais DL, Parsons EP, Wen X, Xu X, Bangarusamy DK, Wang G, Rowland O, Juenger T, et al (2012) Arabidopsis ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status. Plant Physiol 159: 930–944 Lynch M, Conery JS (2000) The evolutionary fate and consequences of duplicate genes. Science (80- ) 290: 1151–1155 Mashima J, Kodama Y, Kosuge T, Fujisawa T, Katayama T, Nagasaki H, Okuda Y, Kaminuma E, Ogasawara O, Okubo K, et al (2016) DNA data bank of Japan (DDBJ) progress report. Nucleic Acids Res 44: D51–D57 McFarlane HE, Shin JJH, Bird DA, Samuels AL (2010) Arabidopsis ABCG Transporters, Which Are Required for Export of Diverse Cuticular Lipids, Dimerize in Different Combinations. Plant Cell 22: 3066–3075 McFarlane HE, Watanabe Y, Yang W, Huang Y, Ohlrogge J, Samuels AL (2014) Golgi- and Trans-Golgi Network-Mediated Vesicle Trafficking Is Required for Wax Secretion from Epidermal Cells. Plant Physiol 164: 1250–1260 Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri. Plant Cell 25: 1609–1624 Palliotti A, Cartechini A (2001) Developmental changes in gas exchange activity in flowers, berries, and tendrils of field-grown Cabernet Sauvignon. Am J Enol Vitic 52: 317–323  119 Palumbo MC, Zenoni S, Fasoli M, Massonnet M, Farina L, Castiglione F, Pezzotti M, Paci P (2014) Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development. Plant Cell Online 26: 4617–4635 Park CS, Go YS, Suh MC (2016) Cuticular wax biosynthesis is positively regulated by WRINKLED4, an AP2/ERF-type transcription factor, in Arabidopsis stems. Plant J 88: 257–270 Pensec F, Pa̧czkowski C, Grabarczyk M, Woźniak A, Bénard-Gellon M, Bertsch C, Chong J, Szakiel A (2014) Changes in the triterpenoid content of cuticular waxes during fruit ripening of eight grape (Vitis vinifera) cultivars grown in the upper rhine valley. J Agric Food Chem 62: 7998–8007 Pervaiz T, Haifeng J, Haider MS, Cheng Z, Cui M, Wang M, Cui L, Wang X, Fang J (2016) Transcriptomic analysis of grapevine (cv. Summer Black) leaf, using the illumina platform. PLoS One 11: 1–20 Peschel S, Franke R, Schreiber L, Knoche M (2007) Composition of the cuticle of developing sweet cherry fruit. Phytochemistry 68: 1017–1025 Pollier J, Goossens A (2012) Oleanolic acid. Phytochemistry 77: 10–15 Radler F (1965) The main constituents of the surface waxes of varieties and species of the genus Vitis. Am J Enol Vitic 16: 159–167 Raffaele S, Vailleau F, Leger A, Joubes J, Miersch O, Huard C, Blee E, Mongrand S, Domergue F, Roby D (2008) A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis. Plant Cell Online 20: 752–767 Ramos MJ, Coito J, Silva H, Cunha J, Costa MM, Rocheta M (2014) Flower development and sex specification in wild grapevine. BMC Genomics 15: 1095  120 Rienth M, Torregrosa L, Sarah G, Ardisson M, Brillouet J-M, Romieu C (2016) Temperature desynchronizes sugar and organic acid metabolism in ripening grapevine fruits and remodels their transcriptome. BMC Plant Biol 16: 164 Robinson MD, Smyth GK (2008) Small-sample estimation of negative binomial dispersion, with applications to SAGE data. Biostatistics 9: 321–332 Robinson S, Davies C, Simon P. Robinson CD (2000) Molecular biology of grape berry ripening. Aust J Grape Wine Res 6: 175–188 Rogiers SY, Hatfield JM, Gunta Jaudzems V, White RG, Keller M (2004) Grape berry cv. Shiraz epicuticular wax and transpiration during ripening and preharvest weight loss. Am J Enol Vitic 55: 121–127 Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol 142: 866–877 Savoi S, Wong DCJ, Arapitsas P, Miculan M, Bucchetti B, Peterlunger E, Fait A, Mattivi F, Castellarin SD (2016) Transcriptome and metabolite profiling reveals that prolonged drought modulates the phenylpropanoid and terpenoid pathway in white grapes (Vitis vinifera L.). BMC Plant Biol 16: 67 Savoi S, Wong DCJ, Degu A, Herrera JC, Bucchetti B, Peterlunger E, Fait A, Mattivi F, Castellarin SD (2017) Multi-omics and integrated network analyses reveal new insights into the systems relationships between metabolites, structural genes, and transcriptional regulators in developing grape berries (Vitis vinifera L.) exposed to water deficit. Front Plant Sci 8: 1–19 Seo PJ, Lee SB, Suh MC, Park M-J, Go YS, Park C-M (2011) The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 23: 1138–1152  121 Shi JX, Malitsky S, de Oliveira S, Branigan C, Franke RB, Schreiber L, Aharoni A (2011) SHINE transcription factors act redundantly to pattern the archetypal surface of arabidopsis flower organs. PLoS Genet. doi: 10.1371/journal.pgen.1001388 Shibuya M, Katsube Y, Otsuka M, Zhang H, Tansakul P, Xiang T, Ebizuka Y (2009) Identification of a product specific β-amyrin synthase from Arabidopsis thaliana. Plant Physiol Biochem 47: 26–30 Shirazi A, Cameron AC (1993) Measuring transpiration rates of tomato and other detached fruit. HortScience 28: 1035–1038 Da Silva C, Zamperin G, Ferrarini A, Minio A, Dal Molin A, Venturini L, Buson G, Tononi P, Avanzato C, Zago E, et al (2013) The high polyphenol content of grapevine cultivar tannat berries is conferred primarily by genes that are not shared with the reference genome. Plant Cell 25: 4777–4788 Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30: 2725–2729 This P, Lacombe T, Thomas MR (2006) Historical origins and genetic diversity of wine grapes. Trends Genet 22: 511–519 To A, Joubes J, Barthole G, Lecureuil A, Scagnelli A, Jasinski S, Lepiniec L, Baud S (2012) WRINKLED transcription factors orchestrate tissue-specific regulation of fatty acid biosynthesis in arabidopsis. Plant Cell 24: 5007–5023 Vitulo N, Forcato C, Carpinelli EC, Telatin A, Campagna D, D’Angelo M, Zimbello R, Corso M, Vannozzi A, Bonghi C, et al (2014) A deep survey of alternative splicing in grape reveals changes in the splicing machinery related to tissue, stress condition and genotype. BMC Plant Biol 14: 99 Wong DCJ, Lopez Gutierrez R, Dimopoulos N, Gambetta GA, Castellarin SD (2016a) Combined physiological, transcriptome, and cis-regulatory element analyses indicate that  122 key aspects of ripening, metabolism, and transcriptional program in grapes (Vitis vinifera L.) are differentially modulated accordingly to fruit size. BMC Genomics 17: 416 Wong DCJ, Schlechter R, Vannozzi A, Höll J, Hmmam I, Bogs J, Tornielli GB, Castellarin SD, Matus JT (2016b) A systems-oriented analysis of the grapevine R2R3-MYB transcription factor family uncovers new insights into the regulation of stilbene accumulation. DNA Res 23: 451–466 Wu R, Li S, He S, Wassmann F, Yu C, Qin G, Schreiber L, Qu L-J, Gu H (2011) CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis. Plant Cell Online 23: 3392–3411 Yeats TH, Rose JKC (2013) The formation and function of plant cuticles. Plant Physiol 163: 5–20 Zhang JY, Broeckling CD, Blancaflor EB, Sledge MK, Sumner LW, Wang ZY (2005) Overexpression of WXP1, a putative Medicago truncatula AP2 domain-containing transcription factor gene, increases cuticular wax accumulation and enhances drought tolerance in transgenic alfalfa (Medicago sativa). Plant J 42: 689–707 Zhang JY, Broeckling CD, Sumner LW, Wang ZY (2007) Heterologous expression of two <i>Medicago truncatula<i/> putative ERF transcription factor genes, WXP1 and WXP2, in Arabidopsis led to increased leaf wax accumulation and improved drought tolerance, but differential response in freezing tolerance. Plant Mol Biol 64: 265–278 Zhao L, Kunst L (2016) SUPERKILLER complex components are required for the RNA exosome-mediated control of cuticular wax biosynthesis in Arabidopsis inflorescence stems. Plant Physiol 171: 960–973 Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion  123 during plant morphogenesis. Plant Cell 17: 1467–81    124 Appendix Gene Family Primer name Grapevine_ID Forward Primer 5'->3'  sequence Reverse Primer 5'->3'  sequence Product Size CER1 VviCER1-2 VIT_15s0021g00040 GCAAAATGAGCCCATCAATA TGCCTAAACTCAACACTTTAACA 83 CER1 VviCER1-3 VIT_15s0021g00050 CGTCCTTTAATGATTCCCTCTT CATTCCAGATACTAGCACCAAA 79 CER1 VviCER1-5 VIT_15s0045g01520 CCAACATGGATTTCGTCCTTTA AAACACAAGTAGGTATTGAGTTTC 155 CER1 VviCER1-6 VIT_15s0045g01590 CCTCACCAAGGTTGCTTAT CATACTCATCCCCATGTGAT 83 CER10 VviCER10-1 VIT_13s0019g01260 CAACTTCACCGCTCTCTAATG ACCAACCCAAACCCAAAC 142 CER2 VviCER2 VIT_18s0001g07640 GAAGACGGTGTGTGAGAATG CCCAAACTGGCTTATGTCC 155 CER2-LIKE VviCER2-LIKE VIT_05s0029g00480 CGAAGCCAAGTGCGATAA CAACTCAGGACCGACGAT 100 CER3 VviCER3-3 VIT_11s0037g01210 GAGGGCATCAACAATCAAATAG GGTGCTTGTCAACAAAGAGG 133 CER4 VviCER4-2 VIT_06s0080g00110 GGGAAGAGATTTGGAGAGAAG CTGAGACATAAGCAGTGGATAC 180 CER4 VviCER4-3 VIT_06s0080g00120 CTTGCTATTCTTCGCCCTAC GATTCCTTCAACCCAACCT 72 CER6 VviKCS3 VIT_03s0063g02640 ACCTGCTTTAGGCTAGTTTG CACCCTCCAAGGAAATAATGA 86 CER6 VviKSC4 VIT_04s0008g02250  TCATACCCAACTGTTTCTTCC  CTTCTGTCATCAGCACCTTTA 130 CER6 VviKCS5 VIT_04s0008g04710  GGAAGATCGGAGTGTCTTTG   GAGGACCCAAGGTAGTGATA 84 CER6 VviKCS6 VIT_05s0020g04540  GCTAAAGGGAGGATCAGAAAG GACTGGGAACTCATCAATCTC 153 CER6 VviKCS7 VIT_06s0004g04000  GTTTCTTCTCCCTGTCTTCTAC GTAACACTCTTGGTCTCTCTTC 76 CER6 VviKCS11 VIT_07s0141g00090 GGAGCGATGAGATTGATGAG CAGCACCCATTACGAGTTTA 131 CER6 VviKCS15 VIT_13s0067g03890 CTCCAACGACGAAGCATATAA  TCCCAAAGCGAGATGATATTAC 188 CER6 VviKCS16 VIT_14s0006g02990  ATGGTAGGTGTTGTGATTGAG  CGAGGCTTGGACATAAAGTAG 149 CER6 VviKCS18 VIT_15s0048g02720 GAGAGAGAGAGATGGGTAGTATAG  CGGATGACGAGTCCTTAAAC 78 CER6 VviKCS22 VIT_18s0001g02720 CATCACATCAAACAACTCGC CTCAAAAGCAGTGGTGAAGT 135 CER6 VviKCS23 VIT_18s0001g12550 CTACAGAGCGTCAACCTAAAG TCATAAGAGGCACCAAACATAG 88 KCR1 VviKCR1-1 VIT_01s0137g00180 GGTTCAGGTGCTGCTATT CGATATACGCTTTTGTGGC 73 MAH1 MAH1-4 VIT_01s0137g00410 GCGTGGTTCTTCTGGTTAATA CTGACTTAGGTCTTCCTTGTTG 111 MAH1 MAH1-1 VIT_02s0025g03320 GGCAATCACCTATTCCATATACT CCATCTGCTGATAACCATCTT 99  125 Gene Family Primer name Grapevine_ID Forward Primer 5'->3'  sequence Reverse Primer 5'->3'  sequence Product Size MAH1 MAH1-2 VIT_07s0031g01680 GAATCACCAAATTGCGAGAAG CCGTCACATTTCAACCCTAT 91 MAH1 MAH1-3 VIT_08s0007g04530 GTCTCCCTCGTATGAAGATATAAAG GACCAGCATTGACCTTGTAA 149 MAH1 MAH1-5 VIT_11s0016g04810 TGCCCATCATCCAAGATTAC TAGTCCAGGTCAGCAGATT 100 PAS2 VviPAS2-1 VIT_00s0313g00040 CACTTCTAAGGCGTCTGTATC CCCGATTCTTTCAGAGTTGA 100 PAS2 VviPAS2-2 VIT_06s0004g04130 GCTTCTGTGCTATCCATTTCTA CCTTCACCTTCTCTTCTTTCC 103 WSD1 WSD1 homolog 1 VIT_03s0063g00120 CTGCTCCTGCCTGTTTATT CGATCTTTGATCCCAAGAAGT 157 WSD1 WSD1 homolog 2 VIT_12s0028g03480 CGGAGTCCTATGATGACTATTTC CCATAAAGGTCTGCTCTGTG 80 WSD1 VviWSD1 VIT_15s0046g00480 CAGGTTAAGGACGATGACAAA GAGGTCGGAGATGTAGTCTT 141 WSD1 VviWSD2 VIT_15s0046g00490 GAAGTTGGGTTTTCTGGTCA GGTGAGGATCGGGAACAAT 148 WSD1 VviWSD7 VIT_15s0046g00700  GGCTGTCCTTCTTCCTTTATC TTGAGGCATAGAACACTTCC 177 WSD1 VviWSD8 VIT_15s0046g00710 GCTGAAGGCAAGAAGAATAAAG GGATAAAGGGAGAAGGACATAG 189 BAS BAS-1 VIT_09s0054g01210 TGCCTCCTTCTCTCAGTAAT CTCTGTAGGGAAAGCATGAAA 98 BAS VviBAS VIT_09s0054g01220 TCATCACGTATGCTGCTAAGTA CACCATCATCCCTCTGTGAA 198 BAS BAS-3 VIT_09s0054g01230 GCAGAAGAGACAGCCACAA CTCCAGGGAATACAGTGTCAAG 169 BAS BAS-4 VIT_10s0003g03520 AGAAGAACTTGTCGGGGAAA CGGAAGCAATTTTAAGTGTCAC 121 CYP716A17 CYP716A17 VIT_11s0065g00130 GATGCCACATGAATGAAATGGA ATTTGCTCCTCGTAGACTT 148 BES1 BES1-2 VIT_04s0023g01250 ACCCTCTATTTGCCGTATCA TGCTACTGTCTGGAAACTCA 137 BES1 BES1-1 VIT_18s0001g12020 ACTTTGTAGCAGAAGGGATTAG CAGGAAATGCCAAGCAATATC 115 CER7 CER7 VIT_18s0072g00880 GAGAGGTTGAAGATGGAATCAG GTGTTCTCATCACTCCTGTTAG 110 CER9 CER9 VIT_03s0063g00080 TTGCGGACAACGATCAAA CAGGTCTAGGCAGTAAGAAATC 91 DEWAX VviERF084 VIT_16s0013g01000 AGAGAGCAAGCAGAGACTAA CATTAACGGACTGATCCCAAA 102 MYB106; MYB16 VviMYB140 VIT_01s0026g02770 GGACTCTGTGGGTAACAATAA GCAAGAGGTGATGAGAGAAA 77 MYB106; MYB16 VviMYB141 VIT_14s0108g01080 CTTCAGAGATGTGGCAAGAG GATTGTCTGTTCCTCCTGTAAA 99 MYB106; MYB16 VviMYB142 VIT_17s0000g06410 TAGCAACCCACTTACCAAATAG TGCGTTCTTTGAGTCACCATT 155  126 Gene Family Primer name Grapevine_ID Forward Primer 5'->3'  sequence Reverse Primer 5'->3'  sequence Product Size MYB30 VviMYB30B VIT_14s0108g00830 GACCACCTTGCTGTGATAAA GGACCATGTTCCTGGATATAAG 94 MYB41 VviMYB144 VIT_12s0134g00570 ATTCATCGTCCACCTTCATC AACTCTCGGGAATCTCAAAC 90 MYB96; MYB94 VviMYB30A VIT_17s0000g06190 ATCAGGAGGAGAAGACGATAA TCCGTTCTTTGAGGAAGATAAG 88 SHN2 VviERF044 VIT_04s0008g05440 TTCATCTCTCATCATCCATCAC CTTCTTAGTAGCAGACACCATC  99 SNH3 VviERF043 VIT_11s0016g05340 CGCCTCTATATCTTGTTGGATG CTCCTCTGAACTTCTTGGATTG 115 VviERF045 VviERF045 VIT_04s0008g06000 TTGAGGAGTTGCTTGACTATG GGAATACAGAGAGAGAAGAGGA 110 WAX1/SHN1 VviERF042 VIT_09s0002g06750 CAATATAGGAGTGTGGCAGAAG CGAAGTTGATGAAACCCAAT 152 WRI4 VviAP2-01 VIT_11s0037g00870 TCAAAGAGATGATGGAGATGAC ATGGGAGGTATGAACGAGTT 181  Appendix Table 2.3.1. Primer sequences of V. vinifera candidate genes involved in the cuticular wax biosynthetic pathway, Oleanolic acid biosynthetic pathway, and transcription factors involved in regulating cuticular wax biosynthesis.   127   Duplication Type Locus ID Given AnnotatedNameDispersed VIT_00s0313g00040 VviPAS2-1 ††Fatty Acid ElongationDispersed VIT_06s0004g04130 VviPAS2-2 ††Proximal VIT_01s0137g00070 VviKCR1-2Tandem VIT_01s0137g00130 VviKCR1-3Tandem VIT_01s0137g00160 VviKCR1-4Tandem VIT_01s0137g00170 VviKCR1-5Tandem VIT_01s0137g00180 VviKCR1-1 ††Dispersed VIT_13s0019g01260 VviCER10-1 ††Proximal VIT_13s0067g01830 VviCER10-2Dispersed VIT_19s0014g00080 VviCER10-3Dispersed VIT_05s0029g00480 VviCER2-LIKE ††Dispersed VIT_18s0001g07640 VviCER2 ††θ Dispersed VIT_00s0317g00160 VviKCS1WGD/Segmental VIT_01s0011g03490 VviKCS2α WGD/Segmental VIT_03s0063g02640 VviKCS3 †ε Dispersed VIT_04s0008g02250 VviKCS4 ††ζ Dispersed VIT_04s0008g04710 VviKCS5 †Dispersed VIT_05s0020g04540 VviKCS6 ††θ WGD/Segmental VIT_06s0004g04000 VviKCS7 †Proximal VIT_07s0141g00030 VviKCS8Tandem VIT_07s0141g00060 VviKCS9Tandem VIT_07s0141g00070 VviKCS10Proximal VIT_07s0141g00090 VviKCS11 ††ε Dispersed VIT_09s0070g00300 VviKCS12η Dispersed VIT_10s0042g01230 VviKCS13η Dispersed VIT_12s0034g01840 VviKCS14θ WGD/Segmental VIT_13s0067g03890 VviKCS15 ††WGD/Segmental VIT_14s0006g02990 VviKCS16 ††Dispersed VIT_15s0021g02170 VviKCS17δ Dispersed VIT_15s0048g02720 VviKCS18 ††Tandem VIT_16s0022g01570 VviKCS19Tandem VIT_16s0022g01580 VviKCS20Dispersed VIT_16s0022g02190 VviKCS21θ Dispersed VIT_18s0001g02720 VviKCS22 †α WGD/Segmental VIT_18s0001g12550 VviKCS23 †Dispersed VIT_19s0015g02000 VviKCS24Dispersed VIT_19s0093g00440 VviKCS25Proximal VIT_09s0018g01340 VviCER3-1 Alkane Forming BranchProximal VIT_09s0018g01360 VviCER3-2Dispersed VIT_11s0037g01210 VviCER3-3 ††Dispersed VIT_15s0021g00010 VviCER1-1Tandem VIT_15s0021g00040 VviCER1-2 ††Tandem VIT_15s0021g00050 VviCER1-3 ††Tandem VIT_15s0021g00060 VviCER1-4Tandem VIT_15s0045g01520 VviCER1-5 †Tandem VIT_15s0045g01590 VviCER1-6 †Tandem VIT_05s0124g00300 VviCER4-1Alcohol Forming BranchTandem VIT_06s0080g00110 VviCER4-2 ††Tandem VIT_06s0080g00120 VviCER4-3 ††Dispersed VIT_08s0007g07100 VviCER4-4Dispersed VIT_03s0063g00120 WSD1 homolog 1 ††Dispersed VIT_12s0028g03480 WSD1 homolog 2 †Tandem VIT_15s0046g00480 VviWSD1 ††Tandem VIT_15s0046g00490 VviWSD2 ††Tandem VIT_15s0046g00510 VviWSD3Tandem VIT_15s0046g00520 VviWSD4Proximal VIT_15s0046g00590 VviWSD5Proximal VIT_15s0046g00660 VviWSD6Tandem VIT_15s0046g00700 VviWSD7 †Tandem VIT_15s0046g00710 VviWSD8 †Dispersed VIT_16s0098g00380 VviWSD9KCS SubfamilyAppendix 3.2.1. Duplication typeof grapevine (Vitis vinifera L)putative homologs involved incuticular wax biosyntheticpathway.Tandem duplicate genesColinnear genesTop BLASTp homologGene of Interest†   qPCR primers designed†† qPCR primers designed and used in biological experiment

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0362313/manifest

Comment

Related Items