Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcriptional regulation by the Hippo signaling pathway in the liver Wang, Evan Yifan 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_november_wang_evanyifan.pdf [ 2.94MB ]
Metadata
JSON: 24-1.0357248.json
JSON-LD: 24-1.0357248-ld.json
RDF/XML (Pretty): 24-1.0357248-rdf.xml
RDF/JSON: 24-1.0357248-rdf.json
Turtle: 24-1.0357248-turtle.txt
N-Triples: 24-1.0357248-rdf-ntriples.txt
Original Record: 24-1.0357248-source.json
Full Text
24-1.0357248-fulltext.txt
Citation
24-1.0357248.ris

Full Text

TRANSCRIPTIONAL REGULATION BY THE HIPPO SIGNALING PATHWAY  IN THE LIVER  by  Evan Yifan Wang B.Sc., The University of British Columbia, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Cell and Developmental Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  October 2017  © Evan Yifan Wang, 2017 ii  Abstract Development and maintenance of the hepatic phenotype is a tightly controlled process regulated by both master regulatory transcription factors and signaling pathways. Perturbations in these transcriptional networks are frequently seen in diseases such as liver cancer. The Hippo signaling pathway has been implicated in regulation of liver size and dysregulation of this pathway contributes to tumorigenesis. The primary mechanism of action of the Hippo pathway is to inhibit nuclear localization of the transcriptional co-regulator YAP, and thereby preventing YAP from binding to the TEAD family of transcription factors. Although it has been established that YAP plays a role in promoting cell proliferation, how it regulates its transcriptional targets in the liver have yet to be well-characterized.   In this study, I show that YAP-overexpression in the adult mouse liver results in a shift from a mature hepatocyte to a hepatic progenitor-like gene expression pattern. Comparison of differentially expressed genes by RNA-seq revealed downregulation of hepatocyte metabolism genes and re-expression of hepatoblast genes, including Glypican-3 (Gpc3). Analysis of ChIP-seq data from both mouse liver and the human hepatoma cell line, HepG2, identified putative Gpc3 enhancers regulated by TEAD and HNF4a. I interrogated these regions using luciferase assays and identified important TEAD and HNF4a binding motifs necessary for transcriptional regulation. In addition, pathway analysis identified enrichment of the ERBB signaling pathway in the YAP-overexpressing liver. Examination of individual ERBB receptors identified upregulation of Her2 (Erbb2), which is normally enriched in hepatoblasts compared to hepatocytes. Analysis of HepG2 ChIP-seq data revealed a TEAD peak at the HER2 promoter. Using luciferase assays, I identified an important TEAD binding site contributing to transcriptional activity. Functionally, I found YAP to regulate EGF-induced HepG2 cell proliferation and PI3K-AKT signaling.   This work explored novel mechanisms of gene regulation by YAP in the liver., I found that YAP activation results in re-expression of hepatic progenitor genes such as Gpc3 and Her2. Furthermore, I found the ERBB signaling pathway to be an important growth mediator downstream of YAP.  iii  Lay Summary The liver is a vital organ of the human body, performing hundreds of different functions including blood sugar regulation and blood detoxification. Inactivation of the Hippo signaling pathway causes liver enlargement and eventually cancer. How this process occurs is unknown. In this thesis, I show that overexpression of the Hippo pathway effector protein YAP in the mouse liver causes changes in expression of thousands of genes. Genes involved in embryonic liver development are turned on while genes important for adult liver function are disrupted. I focus on how YAP regulates two genes, Gpc3 and Her2. This study expands on our knowledge of how the Hippo pathway maintains normal liver homeostasis. iv  Preface Research contained within this thesis was developed by Evan Yifan Wang under the supervision of Dr. Pamela Hoodless and carried out at the Terry Fox Laboratory in the BC Cancer Agency. Experiments in Chapter 3.1 including hepatocyte purification and RNA extraction were performed with assistance from Drs. Shu-Huei Tsai and Avinash Thakur. RNA integrity analysis and RNA-seq library construction and sequencing were performed by Ryan Vander Werff at the UBC Biomedical Research Centre. Experiments in Chapter 3.3 including immunoblot analyses were performed with assistance from Dr. Jung-Chien Cheng and Yuyin Yi. All other experiments were performed by Evan Yifan Wang. All research performed was approved by the UBC BC Cancer Agency Research Ethics Board (“Epigenetic Modifications Regulating Hepatocellular Carcinoma and Hepatocyte Differentiation” - H13-01273). The use of biohazardous material was approved by the UBC Biosafety Committee (“Characterization of early mammalian development” - B14-0054). Mice were bred and maintained in the Modified Barrier Facility at the BC Cancer Agency. All animal protocols were approved by the UBC Animal Care and Ethics Committee (“Organogenesis in mouse development”, “Breeding – Organogenesis in mouse development” - A12-0305, A12-0297, A16-0324, and A16-0305). v  Table of Contents Abstract...........................................................................................................................................ii Lay Summary ................................................................................................................................iii Preface............................................................................................................................................iv Table of Contents ...........................................................................................................................v List of Tables ...............................................................................................................................viii List of Figures................................................................................................................................ix List of Abbreviations .....................................................................................................................x Acknowledgements  .......................................................................................................................xi Chapter 1: Introduction ................................................................................................................1 1.1 Liver structure, function, and development .................................................................... 1 1.1.1 The Liver: structure and function................................................................................ 1 1.1.2 Liver cancer overview................................................................................................. 2 1.1.3 Regulation of liver development by signaling pathways and transcription factors  .... 3 1.1.4 HNF4a and FOXA2: master regulators of the hepatic phenotype  .............................. 5 1.2 The Hippo signaling pathway ......................................................................................... 6 1.2.1 Identification of the Hippo pathway in Drosophila  .................................................... 6 1.2.2 Evolutionary conservation of the Hippo pathway in mammals  .................................. 6 1.2.3 The Hippo pathway regulates liver growth and development .................................... 9 1.2.4 Upstream regulation of the Hippo pathway ................................................................ 9 1.2.5 Downstream mediators of the Hippo pathway.......................................................... 11 1.3 Thesis objectives ........................................................................................................... 13 Chapter 2: Materials and Methods ............................................................................................15 vi  2.1 Mice and tissue dissection............................................................................................. 15 2.2 RNA isolation ............................................................................................................... 15 2.3 qRT-PCR....................................................................................................................... 16 2.4 RNA-seq........................................................................................................................ 16 2.5 Bioinformatic analysis .................................................................................................. 16 2.6 Cell culture and reagents............................................................................................... 17 2.7 siRNA knockdown ........................................................................................................ 17 2.8 Cloning and mutagenesis .............................................................................................. 17 2.9 Luciferase assays........................................................................................................... 18 2.10 ChIP-qPCR ................................................................................................................... 18 2.11 Western blots................................................................................................................. 19 2.12 MTT assay..................................................................................................................... 19 2.13 Statistics ........................................................................................................................ 19 Chapter 3: Results........................................................................................................................20 3.1 RNA-seq analysis of YAP-OE liver ............................................................................. 20 3.1.1 Methodology and analysis of YAP-OE liver RNA-seq data .................................... 20 3.1.2 YAP-OE disrupts liver metabolism and promotes cell proliferation ........................ 22 3.1.3 YAP-OE upregulates hepatoblast and cholangiocyte genes ..................................... 26 3.2 Transcriptional regulation of Gpc3 by YAP-TEAD and HNF4a ................................. 28 3.2.1 Gpc3 is upregulated in YAP-OE hepatocytes........................................................... 28 3.2.2 Identification of putative human GPC3 enhancers ................................................... 31 3.2.3 Identification of putative mouse Gpc3 enhancers..................................................... 33 3.2.4 Gpc3-E1 and Gpc3-E2 are dependent on TEAD and HNF4a .................................. 36 vii  3.3 YAP regulates liver proliferation through transcriptional activation of HER2 ............ 39 3.3.1 Her2 is upregulated in YAP-OE hepatocytes ........................................................... 39 3.3.2 YAP and TEAD regulate HER2 in HepG2 cells  ...................................................... 42 3.3.3 YAP and TEAD regulate the HER2 promoter in HepG2 cells ................................. 44 3.3.4 YAP and TEAD regulate the mouse Her2 promoter ................................................ 47 3.3.5 YAP regulates EGF-induced AKT-signaling and proliferation................................ 50 Chapter 4: Discussion ..................................................................................................................54 4.1 The effect of YAP-OE on the liver transcriptome ........................................................ 54 4.2 Gpc3 as a potential YAP target gene ............................................................................ 56 4.3 The role of HER2 signaling in liver cancer .................................................................. 58 4.4 Conclusion .................................................................................................................... 61 References .....................................................................................................................................62 Appendices ....................................................................................................................................72 Appendix A Top 20 +DOX upregulated genes. ........................................................................ 72 Appendix B Top 20 +DOX downregulated genes.  ................................................................... 73 Appendix C Primers used for qRT-PCR................................................................................... 74 Appendix D Primers used for ChIP-qPCR. .............................................................................. 75 Appendix E Primers used for luciferase vector cloning and mutagenesis.  ............................... 76 Appendix F Antibodies used for Western blot and ChIP-qPCR............................................... 77 Appendix G RNA-seq and ChIP-seq libraries analysed. .......................................................... 78 Appendix H Downregulation of HNF4a in YAP-OE liver....................................................... 79  viii  List of Tables Table 3.1 Top 10 GO Upregulated Biological Processes.  ............................................................ 24 Table 3.2 Top 10 GO Downregulated Biological Processes.  ....................................................... 24 Table 3.3 Selected GSEA Upregulated Gene Sets. ....................................................................... 25 Table 3.4 Selected GSEA Downregulated Gene Sets. .................................................................. 25  ix  List of Figures Figure 1.1 Structure of the adult liver.  ............................................................................................ 2 Figure 1.2 The mammalian Hippo signaling pathway.  ................................................................... 8 Figure 3.1 RNA-seq analysis of YAP-overexpression in the mouse liver.  .................................. 21 Figure 3.2 YAP-OE alters expression of thousands of genes.  ...................................................... 23 Figure 3.3 YAP-OE upregulates hepatoblast and cholangiocyte-specific genes.......................... 27 Figure 3.4 YAP upregulates the oncofetal gene Gpc3. ................................................................. 30 Figure 3.5 Co-localization of FOXA2, HNF4a, and TEAD at the GPC3 locus.  .......................... 32 Figure 3.6 Identification of Gpc3 regulatory regions.  .................................................................. 34 Figure 3.7 Gpc3 enhancers contain TEAD and HNF4a motifs.  ................................................... 35 Figure 3.8 Gpc3 enhancer transcriptional activity is dependent on TEAD and HNF4a............... 37 Figure 3.9 Proposed model by which YAP-TEAD and HNF4a regulate Gpc3 expression.  ........ 38 Figure 3.10 YAP upregulates the ERBB pathway.  ....................................................................... 41 Figure 3.11 YAP transcriptionally upregulates HER2.  ................................................................ 43 Figure 3.12 TEAD4 ChIP peaks at the human HER2 promoter.  .................................................. 45 Figure 3.13 YAP and TEAD activate the human HER2 promoter.  .............................................. 46 Figure 3.14 Her2 is an embryonic liver-enriched gene................................................................. 48 Figure 3.15 YAP and TEAD activate the mouse Her2 promoter.  ................................................ 49 Figure 3.16 YAP regulates EGF-induced proliferation and AKT activation.  .............................. 52 Figure 3.17 Proposed model by which YAP regulates ERBB signaling to promote liver growth........................................................................................................................................................ 53  x  List of Abbreviations AFP – alpha fetoprotein AKT – protein kinase B ALB –  albumin BMP – bone morphogenetic protein ChIP –  chromatin immunoprecipitation CK – cytokeratin DN – dominant negative DOX –  doxycycline E –  embryonic day ECM –  extracellular matrix EGF –  epidermal growth factor EGFR –  epidermal growth factor receptor ERK –  extracellular signal-regulated kinases ES –  enrichment score FDR –  false discovery rate FGF –  fibroblast growth factor FOX – forkhead box  FPKM –  fragments per kilobase of transcript per million mapped reads GO –  gene ontology GPC3 –  glypican-3 GSEA –  gene set enrichment analysis HBx –  hepatitis B x HCC –  hepatocellular carcinoma HER2 –  human epidermal growth factor receptor 2 or ERBB2 HGF –  hepatocyte growth factor HNF –  hepatocyte nuclear factor MTT –  4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide NES –  normalized enrichment score OE –  overexpression PCR –  polymerase chain reaction PI3K –  phosphoinositol 3-kinase qPCR –  quantitative PCR TAZ – transcriptional co-activator with PDZ-binding motif TGFb – transforming growth factor beta TSS – transcription start site WT –  wildtype YAP –  yes-associated protein  xi  Acknowledgements This thesis could not have been completed without the considerable support I have received over many years. Dr. Pamela Hoodless has been a wonderful supervisor and mentor to me. Since offering me the opportunity to join her lab, she has been generous with her time and energy. I am grateful of my supervisory committee, Drs. Dixie Mager and Brad Hoffman, for taking an interest in me and my work. I thank Drs. Calvin Roskelley and Peter Stirling for attending my thesis examination. My lab mates and colleagues at the Terry Fox Laboratory make up a supportive work environment. Thank you to all the past and present Hoodless lab members for both assisting me with experiments and making my time at the lab enjoyable. Finally, thank you to my parents and sister for being especially supportive during my time in graduate studies.  1  Chapter 1: Introduction  1.1 Liver structure, function, and development 1.1.1 The Liver: structure and function The liver is the body’s largest internal organ and the only internal organ with natural regenerative capability. It performs hundreds of vital metabolic, endocrine, and exocrine functions, including blood detoxification, glycogen storage, and synthesis of bile, cholesterol, and plasma proteins1–3. Hepatocytes are the main parenchymal cell type, comprising approximately 70% of the fully developed liver mass. The basic unit of the liver is the hexagonal liver lobule, and maintenance of this architecture is crucial for proper liver function. Cords of hepatocytes radiate inward from six portal triads, consisting of the hepatic artery, portal vein, and biliary duct, towards the central vein (Figure 1.1). Blood from the hepatic artery and portal vein is detoxified as it flows past hepatocytes in the sinusoids towards the central vein. During this time, hepatocytes secrete important hormones and plasma proteins into the blood. Hepatocytes secrete bile acids into the bile canaliculi which flows into the bile duct, eventually becoming stored in the gallbladder. Cholangiocytes, or biliary epithelial cells, line the bile ducts to control bile flow. Other liver cell types include structural endothelial cells that line the blood vessels, liver macrophages involved in immune response, and hepatic stellate cells involved in the fibrotic response following tissue injury.  2   Figure 1.1 Structure of the adult liver. Schematic representation of the adult liver structure. The portal triad consists of the bile duct, the hepatic vein, and the hepatic artery. Both oxygenated (red) deoxygenated (blue) blood flow past the hepatocytes towards the central vein. Bile (green) is secreted by the hepatocytes and flows into the bile duct, which is surrounded by cholangiocytes. Adapted from Gordillo et al.2.   1.1.2 Liver cancer overview The liver is exposed to a constant barrage of toxins on a daily basis. Chronic liver injury induces inflammation and fibrosis, which can eventually progress to liver cancer. Liver cancer is the second leading cause of cancer-related death and the sixth most frequent cancer worldwide4,5. Hepatocellular carcinoma (HCC) represents 90% of all liver cancers. Other factors known to cause liver cancer include alcoholism, and hepatitis B and C viral infection6. HCC is frequently detected at late stages and five-year survival rates are low. While preventative action can significantly reduce exposure to such risk factors, once injury has progressed to primary liver cancer, the main treatment options become surgical resection or liver transplantation. Thus, there is a need for understanding the molecular mechanisms that drive hepatocarcinogenesis to better develop targeted therapies.   It has become increasingly clear that many developmental signaling pathways are dysregulated in cancer. In HCC, there is frequent activation of the Wnt signaling pathway, which is active during normal liver development7. Genome-wide sequencing efforts have identified recurrent mutations in the Wnt pathway (30% of 928 HCCs), leading to accumulation of nuclear beta-3  catenin. Activating mutations in CTNNB1 are the most common, but other Wnt components are also mutated as seen from inactivating mutations in AXIN1, APC, and ZNRF38–10. The Hippo signaling pathway was first linked to the liver with the discovery that its effector YAP was frequently amplified in both mouse and human HCCs11. Since then, YAP activity has been extensively examined in human HCC patient samples. A significant proportion of human HCC samples (31-85%) exhibit nuclear YAP localization compared to control samples (0-28%)12. In HCC, there is frequent re-expression of liver progenitor genes, indicating that there may be a shift towards a more embryonic-like state. Expression of embryonic liver genes such as AFP, GPC3, and SALL4 are associated with poor prognosis and a more aggressive subtype of HCC13–15. Therefore, understanding how signaling pathways and transcription factors function in the context of normal liver development will give us insight into the development and progression of liver cancer.  1.1.3 Regulation of liver development by signaling pathways and transcription factors The mouse embryonic liver consists of bipotential hepatoblasts derived from the ventral foregut endoderm, and hematopoietic cells from the vascular regions of the embryo1,2,16. Hepatoblasts express high levels of AFP, but also express hepatocyte (ALB) and cholangiocyte (CK19) markers, albeit at low levels. Hepatoblasts proliferate when exposed to morphogens, including fibroblast growth factor (FGF), bone morphogenetic protein (BMP), hepatocyte growth factor (HGF), and Wnt ligands, secreted by surrounding portal mesenchymal cells, endothelial cells, and hematopoietic cells. Following a period of expansion, hepatoblasts begin to differentiate into hepatocytes and cholangiocytes. This process is tightly regulated by a network of signaling pathways.   Around embryonic day (E) 13.5, hepatoblasts located further from the portal vein gradually differentiate into hepatocytes. Hematopoietic cells release the cytokine oncostatin M (OSM), stimulating hepatocyte differentiation in a paracrine manner. Other signals that promote hepatocyte maturation include HGF and Wnt signaling. Hepatoblasts adjacent to the portal vein differentiate into immature cholangiocytes17. These early cholangiocytes form a monolayer of polarized cells surrounding the portal mesenchyme, termed the ductal plate. From E17 onwards, 4  the ductal plate undergoes a remodeling process. Hepatoblasts at the ductal plate form the parenchymal side of the duct, whereas cholangiocytes form the portal side of the duct, resulting in formation of a primitive ductal structure. The parenchymal hepatoblasts differentiate into cholangiocytes, culminating in a layer of cholangiocytes surrounding the biliary lumen. The ductal plate eventually regresses and the remaining cholangiocytes undergo apoptosis. The biliary ducts mature into the postnatal period and form the intrahepatic bile ducts. The Notch signaling pathway is an important regulator of cholangiocyte differentiation. Loss of Notch signaling results in defects in biliary specification and tubulogenesis18. Forced expression of the Notch2 intracellular domain in the embryonic liver results in the formation of additional bile ducts in periportal regions and ectopic bile ducts in lobular regions19. In addition, mutations in the Notch pathway members JAG1 and NOTCH2 cause Alagille syndrome20–22. These patients exhibit bile duct paucity due to defects in ductal plate remodeling. Transforming growth factor beta (TGFb) and Wnt signaling are also implicated in the regulation of cholangiocyte differentiation.   A subset of transcription factors are highly enriched in the liver and contribute to the regulation of genes required for both liver development and function1,2,23,24. This network of lineage-specifying transcription factors regulates each other’s expression and include members of the Hepatocyte Nuclear Factor (HNF) and Forkhead Box A (FOXA) families: HNF1a, HNF1b, FOXA2 (HNF3b), HNF4a (NR2A1), ONECUT1 (HNF6), and NR5A2. The transcription factors HNF1b, ONECUT1, and FOXA2 are required for hepatic specification and set up the initial network of transcription factors that regulate liver development25–27. HNF4a and C/EBP are upregulated in hepatoblasts in the parenchyma to promote hepatocyte differentiation and inhibit biliary transcription factor expression24,28. In contrast, hepatoblasts that go on to form cholangiocytes receive signals from the portal mesenchyme and express HNF1b, ONECUT1, and ONECUT2 to downregulate pro-hepatocyte transcription factors25,29. Other transcription factors involved in promoting cholangiocyte development include HHEX, FOXM1b, and SOX930–32. Thus, proper liver development involves a complex network of pro-cholangiocyte and pro-hepatocyte transcription factors that exhibit mutual antagonism.  5  1.1.4 HNF4a and FOXA2: master regulators of the hepatic phenotype  HNF4a was first identified as an orphan hormone nuclear receptor that bound the promoter of the liver-specific gene transthyretin (Ttr)33,34. Inactivating mutations in HNF4a cause a rare form of monogenic diabetes called maturity-onset diabetes of youth35. Hnf4a is a very well-conserved and essential developmental gene. Hnf4a-null mice die during embryogenesis at E6.5 from defects in gastrulation due to yolk sac abnormalities36. In the fetal liver, Hnf4a is first expressed at E9.037. While Hnf4a is not required for hepatic specification, it is necessary for proper organization of the liver architecture and maintenance of the hepatic phenotype38. In the adult, Hnf4a is most highly expressed in the liver, but is also detected in the kidney, intestine, pancreas, and colon39. Deletion of Hnf4a from the perinatal or adult liver results in hepatomegaly and steatosis40,41. Numerous genes involved in lipid metabolism are downregulated, and these mice eventually die from liver dysfunction. HNF4a is hypothesized to regulate thousands of different genes in both the embryonic and adult liver, as evident by thousands of differential DNA-binding sites occupied by HNF4a between embryonic and adult liver42. These studies indicate that HNF4a is a critical regulator of both hepatocyte differentiation and function.  The FOXA family of transcription factors contain a conserved winged-helix DNA-binding domain43. Like HNF4a, FOXA1 and FOXA2 were first identified as proteins bound to the Ttr promoter33,44,45. Foxa2 is detected early during development in the node and anterior primitive streak, and is critical for foregut endoderm and notochord development46. Expression continues in the definitive endoderm through organogenesis, and persists in the endoderm derivatives such as the liver and pancreas. Foxa2-null mice die by E11 due to severe defects throughout all three germ layers47,48. Interestingly, single deletion of Foxa1, Foxa2, or Foxa3 specifically in the endoderm using Foxa3-Cre does not affect liver development49–51. When Foxa1 and Foxa2 are both deleted from the endoderm, hepatic specification does not occur27. Thus, there is functional redundancy between the FOXA transcription factors. FOXA2 is also involved in regulating mature liver function, as deletion of Foxa2 in hepatocytes results in dysregulation of bile acid metabolism52. The FOXA transcription factors also play important roles as pioneer factors, binding to closed or hypoacetylated chromatin53.  6  1.2 The Hippo signaling pathway Liver growth continues well after birth until it reaches a predefined size. This phenomenon is also seen in partial hepatectomy patients, when the liver regeneration terminates once the liver has reached its previous size. Despite these observations, little is known about how organ size is regulated. The Hippo signaling pathway has been implicated in organ size control54. Various extracellular signals are integrated by the Hippo pathway to balance cell proliferation, apoptosis, and differentiation.   1.2.1 Identification of the Hippo pathway in Drosophila The major Hippo pathway components were first delineated in the fruit fly Drosophila melanogaster. Core members of the Hippo signaling pathway were discovered using genetic screens to identify tumor suppressor genes controlling tissue overgrowth. Initial studies identified the upstream serine/threonine kinase Warts (wts) as a major tumor suppressor kinase regulating overproliferation and anti-apoptosis55,56. Further screens identified Salvador (sav) as a scaffold protein interacting with Wts to regulate cell cycle exit and cell death57,58. The titular kinase of the pathway, the Ste-20 family protein kinase Hippo (hpo), was discovered to form a complex with Sav to regulate Wts kinase activity59–62. Like wts and sav mutants, hpo mutants were found to have a growth advantage compared to wildtype cells. Finally, the transcriptional co-regulator Yorkie (yki) was identified as the downstream effector of the Hippo pathway63. Yki nuclear localization is inhibited through phosphorylation by a complex containing Wts and Mob as tumor suppressor (mats)64. Nuclear Yki cannot bind DNA by itself as it does not have a DNA-binding domain. Instead, Yki must bind to the transcription factor Scalloped (sd) to directly regulate downstream gene expression65,66  1.2.2 Evolutionary conservation of the Hippo pathway in mammals While these core proteins defined the canonical Hippo pathway in Drosophila melanogaster, each component of the pathway were found to be evolutionarily conserved in the mammalian system67. Indeed, homologs of Hpo (MST/2), Sav (SAV1), Wts (LATS1/2), Mats (MOB1), Yki 7  (the paralogs YAP and TAZ), and Sd (TEAD1-4) regulate similar cellular processes related to proliferation and anti-apoptosis in mammalian cells68–73. Importantly, MST1/2, LATS1/2, MOB1, and YAP can functionally replace their Drosophila counterparts in vivo, suggesting a high degree of functional homology between Drosophila and human proteins. Although the existence of multiple homologs has made it more difficult to study the Hippo pathway in mammals, the placement of each protein in the pathway was found to be the same (Figure 1.2). That is, the kinases MST1/2 phosphorylate and activate LATS1/2 in conjunction with SAV1, resulting in the phosphorylation and inhibition of YAP and TAZ in conjunction with MOB1. Phosphorylation of YAP and TAZ result in cytoplasmic retention by the 14-3-3 proteins or ubiquitin-mediated degradation74,75. Like Yki, after nuclear translocation, YAP and TAZ will interact with partner transcription factors such as the TEADs, and activate downstream target genes involved in proliferation and survival. Thus, the main output of the pathway is the phosphorylation and localization status of YAP and TAZ. Overall, when the Hippo pathway is “ON”, YAP and TAZ are phosphorylated and cytoplasmic. When the Hippo pathway is “OFF”, YAP and TAZ are unphosphorylated and nuclear, and activate downstream target genes.   8    Figure 1.2 The mammalian Hippo signaling pathway. Representation of mammalian Hippo signaling components. Left: when the Hippo pathway is off, the kinases MST1/2 are unable to phosphorylate the kinases LATS1/2, resulting in unphosphorylated YAP and TAZ, which can translocate into the nucleus and bind to the TEAD family of transcription factors to activate target genes. Right: when the Hippo pathway is on, the kinases MST1/2 along with SAV1 phosphorylate LATS1/2 and the scaffolding protein MOB1, which in turn phosphorylates YAP and TAZ. Phosphorylated YAP and TAZ are retained in the cytoplasm by 14-3-3 proteins and are targeted for ubiquitin-mediated degradation.     9  1.2.3 The Hippo pathway regulates liver growth and development The Hippo pathway is essential for normal embryonic development. Knockout of Nf2 (upstream of MST1/2), Mst1, Mst2, Sav1, Lats2, Mob1, and Yap cause embryonic lethality at various time points76–81. The Hippo pathway is now known to regulate cellular homeostasis in many different tissues and cell types. To investigate the role of the Hippo pathway in the liver, mice with liver-specific inactivation of Hippo pathway components have been generated. Mice with conditional knockout of either Nf2, Mst1/2, Sav1, or Lats1/2 using the Alb-Cre system display increased YAP nuclear localization and develop progressive hepatomegaly82–88. The livers weigh up to three times more than wildtype livers due to excessive hepatocyte proliferation. Eventually these mice develop HCC. Mice with liver-specific transgenic YAP overexpression develop a similar phenotype. The mice develop enlarged livers within one week after YAP overexpression and tumors within 2-3 months71,89. The Hippo signaling pathway may be an important regulator of biliary duct development. Alb-Cre;Yapf/f mice have defects in bile duct tubulogenesis, resulting in bile duct paucity90. Deletion of Lats1/2 in the embryonic liver results in expansion of the ductal plate91. Mice die before weaning due to accumulation of immature cholangiocytes and a lack of functional mature hepatocytes. Both YAP and TAZ are responsible for ductal plate expansion. Additionally, HNF4a is downregulated in these mice, providing an explanation for impaired hepatocyte commitment. YAP is normally expressed in CK19+ ductal cells surrounding the portal vein in the adult liver92. This study identified members of the Notch pathway, important regulators of cholangiocyte differentiation, as YAP target genes. Finally, it is important to note that the commonly-used Alb-Cre system is better suited for studying later stages of liver development93, and thus the role of the Hippo signaling pathway during early hepatoblast differentiation is still unclear  1.2.4 Upstream regulation of the Hippo pathway The Hippo pathway is unique among signaling pathways in that no dedicated upstream receptor has yet been identified. Here, I briefly review how YAP/TAZ integrate multiple extracellular inputs, including physical cues, cellular stress, hormones, and growth factors to regulate cell growth. 10   Cells are in constant communication with their surrounding environment, which includes both the extracellular matrix (ECM) as well as neighbouring cells. Contact inhibition of proliferation is a property of normal epithelial cells in which cells will stop growing once they are in close proximity to other cells. This phenomenon can be observed in culture where cells will proliferate faster at lower density and cell to cell contact at high density causes growth inhibition. Cell to cell contact was first discovered to regulate YAP nuclear localization74. At low cell density, YAP is unphosphorylated and localized to the nucleus. At high cell density, YAP is phosphorylated by LATS1/2 and sequestered in the cytoplasm. Overexpression of YAP in adherent cell lines causes cells to overcome contact inhibition and continue proliferating even when confluent. At high confluence, NF2 is localized to cell junction complexes to promote LATS1/2 phosphorylation. The cell adhesion proteins alpha-catenin and E-cadherin promote YAP sequestration at tight and adherens junctions at the cell membrane94.   Mechanical forces generated by the ECM or neighbouring cells regulate the Hippo pathway95. Cells change their shape at different densities and in response to different properties of the ECM. At low densities or when the ECM is stiff, cells are flat and stretched out, resulting in YAP activation96. At high densities or when the ECM is soft, cells are rounded and compact, and YAP is inactivated. Cell adhesion is important for cell survival and growth. Anchorage-dependent cells undergo anoikis when they detach from the ECM. A unique property of cancer cells is anchorage-independent growth, or the ability to escape anoikis and undergo metastasis. Cell attachment induces YAP nuclear localization, whereas cell detachment results in YAP inactivation97. This process involves reorganization of the actin cytoskeleton, activation of the Rho-GTPases, and formation of F-actin stress fibers. Interestingly, overexpression of the constitutively-active form of YAP induces anchorage-independent growth and blocks anoikis.  Nutrient availability and stress signals are important regulators of cell growth. Glucose metabolism is crucial for providing the energy needed by growing cells. Cellular ATP levels are sensed by the kinase AMPK98. During glucose starvation, LKB1 phosphorylates AMPK due to low cellular ATP levels. Activated AMPK phosphorylates TSC2, which in turn inhibits the 11  mTOR complex. In this way, energy-intensive cap-dependent protein translation is downregulated. Recently it was discovered that AMPK phosphorylates YAP, disrupting its interaction with TEAD and inhibiting YAP transcriptional ability99,100. AMPK also phosphorylates AMOT1, which in turn activates LATS1/2 and inhibits YAP activity in a parallel manner101. When energy stress is not an issue, YAP is nuclear and promotes transcription of miR-29c, which targets PTEN for degradation102. Loss of PTEN promotes PI3K-AKT-induced activation of mTOR, and promotion of protein translation important for cell growth.   Secreted factors, such as hormones and growth factors, stimulate cellular growth. These molecules bind to cell surface receptors, including the heterotrimeric G-protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs), to activate intracellular signal transduction cascades. Many hormones and growth factors are mitogenic and thus were hypothesized to affect the Hippo pathway. Serum starvation dephosphorylates YAP, whereas the addition of serum rapidly activates YAP103. Analysis of serum components identified the phospholipids lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) as potent activators of YAP. LPA and S1P bind to the Ga12/13 class of GPCRs to activate Rho GTPases, which inactivate LATS1/2 through actin cytoskeleton dynamics. The hormones epinephrine and glucagon had the opposite effect by binding to the Ga class of GPCRs and inactivating YAP104. Another study found that addition of the growth factor EGF abolished contact-inhibition in mammary epithelial cells105. By signaling through EGFR, EGF activated YAP in a PI3K-PDK1-dependent but AKT-independent manner to stimulate cell proliferation.  1.2.5 Downstream mediators of the Hippo pathway The Hippo signaling pathway ultimately converges upon the transcriptional co-regulators YAP and TAZ, which share many structural similarities. YAP and TAZ contain WW-motifs, which allow them to bind to proteins containing the PPxY motif106,107. Notably, this is where LATS1/2 bind. In addition, the AMOTs bind to this region and sequester YAP and TAZ in the cytoplasm. A phosphodegron site, an unstructured transcriptional activation domain, and a PDZ-binding domain are located at the C-terminal end. Phosphorylation of YAP at the serine 397 phosphodegron by b-TRCP targets YAP for ubiquitination and proteasome-mediated 12  degradation. YAP and TAZ do not have DNA-binding domains, and thus must bind to transcription factors that mediate their transcriptional output. Studies have shown that YAP and TAZ mainly use the TEAD family (TEAD1-4) of transcription factors to activate transcription of target genes74,108. The TEADs bind at the N-terminal of YAP and TAZ. TEAD binding to YAP can be abolished when serine 94 is mutated to alanine (YAPS94A), resulting in a dominant-negative form of YAP and disruption of YAP-induced gene induction73. Deletion of the DNA-binding domain in TEAD2 results in a dominant-negative form of TEAD (TEAD-DN) that is able to block endogenous activity of all four TEADs109. Overexpression of TEAD-DN in the mouse liver reverses hepatomegaly induced by YAP overexpression or deletion of Nf2. The same effect is seen when mice are injected with verteporfin, a small molecule that disrupts YAP from binding TEAD109. Other transcription factors including RUNX1/2, ERBB4, and SMADs have been reported to interact with YAP through the WW-motif, although these interactions are significantly weaker than YAP-TEAD73,110–112. A 14-3-3 interaction domain is located beside the TEAD-binding domain of YAP and TAZ. This region contains a phosphorylation site for LATS1/2, which when phosphorylated, allows 14-3-3 to bind and sequester YAP and TAZ in the cytoplasm. Mutation of serine 127 to alanine (YAPS127A) inhibits this process and results in a constitutively-active form of YAP.  As transcriptional co-regulators, YAP and TAZ can promote or repress transcription by recruiting different complexes to promoters and enhancers of target genes. YAP and TEAD mainly bind to intergenic regions in mammals. Studies in human cancer cell lines have demonstrated that YAP/TAZ-TEAD co-localize to distal enhancers to regulate target gene activation115,116. In contrast, studies in Drosophila wing disc have shown that Yki primarily localizes to promoter regions in the genome and directly interacts with chromatin-remodeling complexes113. Yki interacts with the Brahma complex, the ATPase subunit of the Drosophila SWI/SNF chromatin-remodeling complex, as well as subunits of the transcriptional co-activator Mediator complex. Both the Brahma complex and Mediator are required for Yki to promote transcription of target genes in Drosophila wing disc. Association of YAP and Mediator was found to be conserved in mammalian cells, as YAP can recruit Mediator to enhancers to regulate promoter-proximal RNA polymerase pause release118. In addition, Yki is able to increase local 13  H3K4me3 levels at the promoter of target genes by directly recruiting NcoA6, a subunit of the H3K4 histone methyltransferase complex114. TAZ is proposed to act as a transcriptional co-activator by recruiting the histone acetyltransferases p300 and PCAF to promoters181. While most studies have focused on the transcriptional co-activator abilities of YAP and TAZ, several recent studies have shown YAP and TAZ can also act as transcriptional co-repressors by recruitment of histone deacetylases to gene promoters. YAP interacts with the MTA1, GATAD2A, and CHD4 subunits of the ATP-dependent histone deacetylase and nucleosome-remodeling NuRD complex, while TAZ interacts with the CHD4, MTA1, and RBP46 subunits of the NuRD complex119,182.   1.3 Thesis objectives In summary, many facets of the Hippo signaling pathway have been studied in the past decade. We now have a good understanding of the core kinase cascade, and the interactions between each kinase. Upstream regulation of the Hippo pathway is complex, and the effect of many stimuli on the pathway are cell-type specific. Downstream mediators of the Hippo pathway are also being unravelled. Although studies have shown that YAP and TAZ mainly associate with the TEAD transcription factors, whether this is true in all cell types is an open question. In addition, there may be cell-type specific transcriptional co-factors required for regulation of target genes.   Hypothesis: I hypothesize that YAP activates genes enriched during embryonic liver development, and that YAP-overexpression in the adult liver will induce expression of embryonic liver genes.   Objective 1: Identify potential YAP target genes I have performed RNA-seq on YAP-overexpressing adult liver and compared the differentially expressed genes with our existing E14.5 hepatoblast and adult liver RNA-seq libraries. From this list of differentially expressed genes, I have chosen two genes for further study based on their expression and function, Glypican-3 (Gpc3) and Erbb2 (Her2). 14   Objective 2: Explore mechanisms of transcriptional regulation by YAP I have used luciferase assays to assess the effect of YAP/TEAD and HNF4a on two enhancers upstream of Gpc3.  Objective 3: Determine downstream mediators of cell growth regulated by YAP Due to the critical role of Her2 in cell proliferation, I have examined the role of YAP in regulating EGF-induced cell proliferation and signaling in liver cancer cells.    15  Chapter 2: Materials and Methods  2.1 Mice and tissue dissection Tetracycline- inducible YAP-overexpression (YAP-OE) mice were provided by Dr. Duojia Pan (UT Southwestern) and have been previously described as ApoE/rtTA-YAP mice71 . Mice were bred and maintained in the animal facility of the BC Cancer Research Centre. For all experiments, 8-12-week-old YAP-OE mice were fed 0.2 mg/ml doxycycline (Apotex) in 2.5% sucrose drinking water. All animal experiments were approved by the University of British Columbia Animal Care Committee. Hepatocytes were isolated using a modified low-speed centrifugation method120. Briefly, livers were perfused with a PBS and collagenase (STEMCELL Technologies) mixture through the inferior vena cava, minced with a razor blade, and passed through a 40 µm strainer. Hepatocytes were separated by low-speed centrifugation (50 g x 30 s) and washed 2x with PBS before RNA or protein extraction. Extracted cells were checked for albumin expression using immunofluorescence.  2.2 RNA isolation Cells were homogenized in TRIzol (Invitrogen) and incubated for 5 min at room temperature. Chloroform (EMD Millipore) was added at ⅕ the volume of Trizol before the samples were shaken for 20 s and incubated for 5 min at room temperature. The samples were centrifuged at 4 °C at 14000 rpm for 10 min. The upper aqueous phase was taken and RNA was precipitated by the addition of equal volume isopropanol (EMD Millipore). RNA was allowed to precipitate for 15 min at room temperature before being centrifuged at 4 °C at 14000 rpm for 10 min. The supernatant was discarded and the pellet was washed 2x with 70% ethanol before left to air dry 10 min at room temperature. The pellet was resuspended in DNase/RNase-free distilled water (Invitrogen). RNA quantity and quality were measured using the Nanodrop 1000 (Nanodrop Technologies). RNA was stored at -80 °C before further use.  16  2.3 qRT-PCR cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart Universal SYBR Green Master (Roche) on the StepOnePlus Real-Time PCR System (Applied Biosystems) according to manufacturer's instructions. Cycling conditions were 40x 95 °C for 15 s, 60 °C for 1 min, 72 °C for 1 min. All samples were assayed in duplicate or triplicate. Relative quantification was used for qPCR. Changes in gene expression were calculated using the 2-ΔΔCt method121 and shown as fold change over control. Expression levels were normalized to indicated housekeeping genes. Primers used for qRT-PCR are listed in Appendix C.  2.4 RNA-seq Total RNA from hepatocytes was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer's instructions. Sample quality control was performed using the 2100 Bioanalyzer (Agilent Technologies). Qualifying samples were prepared following the standard protocol for the TruSeq stranded mRNA library kit (Illumina) on the Illumina Neoprep automated nanofluidic library prep instrument. Triplicate libraries were sequenced on the Illumina NextSeq 500 with paired end 2x80bp reads at the Biomedical Research Centre (University of British Columbia, Vancouver). De-multiplexed read sequences were aligned to the UCSC mouse mm10 (GRCm38) reference sequence using TopHat2 splice junction mapper with Bowtie2122. Fragments per kilobase of exon per million reads (FPKM) were calculated using Cufflinks123. RNA-seq library mapping and processing details were generated using Basespace (Illumina).  2.5 Bioinformatic analysis RNA-seq gene expression values were compared for significance using Cuffdiff2123. In addition, genes were considered differentially expressed if expression was greater than or equal to 1 FPKM in -DOX or +DOX conditions, fold change greater than or equal to 2, and FDR less than 0.05. Gene Ontology enrichment analysis was performed using DAVID version 6.8124,125. All genes considered expressed (greater than or equal to 1 FPKM in either -DOX or +DOX RNA-seq libraries) were combined and used as the background gene list. Results were ranked by p-17  value. Gene set enrichment analysis was performed using GSEA version 2126. Rank scores for each gene was obtained by ranking all genes considered expressed by fold change, such that genes upregulated in +DOX samples had positive scores and downregulated genes had negative scores. The GSEA preranked method was used on the ranked gene list to identify enriched gene sets in the MSigDB collection. Results were ranked by FDR. Gene expression heatmaps were generated using TM4 MeV (mev.tm4.org). ChIP-seq and RNA-seq data were uploaded to the UCSC Genome Browser127. Screenshots of the Gpc3 and Her2 loci were taken from the UCSC Genome Browser. ChIP-seq data were uploaded to Cistrome128. Cistrome was used to calculate transcription factor peak overlap percentage and transcription factor motif enrichment. ChIP-seq and RNA-seq datasets analysed are listed in Appendix G.   2.6 Cell culture and reagents The HepG2 human liver cancer cell line was obtained from the American Type Culture Collection. Cells were cultured in Dulbecco's Modified Eagle Medium (STEMCELL Technologies) supplemented with 10% fetal bovine serum (STEMCELL Technologies), 5% glutamax (Gibco), and 1% penicillin/streptomycin (Thermo Fisher Scientific) maintained in a humidified incubator at 37 °C and 5% CO2. Recombinant human EGF was obtained from Sigma. Verteporfin was obtained from Selleckchem.  2.7 siRNA knockdown  For siRNA silencing of endogenous YAP, HepG2 cells were transfected with 50 nM ON-TARGETplus SMARTpool YAP siRNA (Dharmacon) using Lipofectamine RNAiMAX (Invitrogen). ON-TARGETplus Non-targeting Pool (Dharmacon) was used as the control.  2.8 Cloning and mutagenesis Gpc3 enhancers were amplified by PCR using indicated primers and cloned into the pGL3-Basic vector containing a minimal E1B promoter. Her2 promoters were amplified by PCR and cloned into the pGL4-Basic vector. TEAD and HNF4a binding motifs were deleted in the Gpc3 enhancer vectors, and TEAD binding motifs were deleted in the Her2 promoter vectors using 18  PCR-mediated mutagenesis. All vectors were confirmed by sequencing.  2.9 Luciferase assays Gpc3 enhancer or mutant enhancer luciferase constructs were co-transfected with pRL-TK in HepG2 cells. Her2 promoter or mutant promoter luciferase constructs were co-transfected with pRL-TK in HepG2 cells. The TEAD-DN expression vector109 was co-transfected with Her2 promoter reporters and pRL-TK in HepG2 cells. HepG2 cells were seeded in 24-well plates. Cells were co-transfected 2 days after seeding using Lipofectamine 3000 (Thermo Fisher Scientific). Cells were harvested 2 days following transfection and luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega). Data were normalized to pRL-TK to control for transfection efficiency and presented as firefly/Renilla luciferase activity. The TEAD-DN expression vector was provided by Dr. Duojia Pan (University of Texas Southwestern). Primers used for enhancer and promoter cloning and mutagenesis are listed in Appendix E.  2.10 ChIP-qPCR HepG2 cells were fixed in 1% formaldehyde for 10 minutes at room temperature, before 0.125M glycine was added and cells were incubated for another 5 minutes. Cells were lysed in ChIP cell lysis buffer for 10 minutes on ice. Nuclei were pelleted and lysed in ChIP Nuclear lysis buffer for 30 minutes on ice. Samples were sonicated in a water bath for 20 cycles of 30 seconds on, 30 seconds off. Chromatin was diluted with ChIP dilution buffer before incubation overnight at 4 °C with indicated antibodies. Protein A/G beads were added to samples and incubated for 4 h at 4 °C. Beads were washed with low salt buffer, high salt buffer, lithium chloride buffer, and TE buffer. Elution buffer was added and samples were incubated at room temperature for 15 minutes. Eluted samples were incubated with Proteinase K and RNase A (Invitrogen) and 0.192 NaCl overnight at 65 °C. DNA was extracted using phenol/chloroform purification and ethanol precipitation. Primers used for ChIP-qPCR are listed in Appendix D. Antibodies used for ChIP-qPCR are listed in Appendix F.  19  2.11 Western blots Cells were lysed with lysis buffer (Cell Signaling Technologies) and protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) with bovine serum albumin as the standard. Protein was denatured with beta-mercaptoethanol at 95 °C for 10 min. Equal amounts of cell lysate were loaded on SDS-PAGE gels and transferred onto PVDF membranes. Membranes were blocked in TBS with 5% skim milk for 1 h at room temperature, and then incubated with indicated antibodies overnight at 4 °C. Membranes were washed with TBS and incubated with indicated HRP-conjugated secondary antibodies for 1 h at room temperature. HRP activity was detected using Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific). Antibodies used for western blot are listed in Appendix F.  2.12 MTT assay HepG2 cells transfected with siRNA targeting YAP or a control for 24 h were seeded in 24-well plates. Cells were treated with 100 ng/mL EGF every 24 h for 72 h starting 1 day after seeding. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma) was added at 72 h to a concentration of 0.5 mg/mL and incubated for 4 h. The media was removed and DMSO was added to dissolve the crystals. A spectrophotometer microplate reader was used to determine absorbance values.  2.13 Statistics Results are presented as mean ± SEM from a minimum of three independent experiments unless otherwise indicated. Two-sample Student’s t-test was used for qPCR data on dCT values. Multiple comparisons were performed using either one-way or two-way ANOVA and followed by Tukey’s multiple comparison test for luciferase assays, Western blot quantification, and cell proliferation assays. p<0.05 were considered statistically significant.  20  Chapter 3: Results  3.1 RNA-seq analysis of YAP-OE liver 3.1.1 Methodology and analysis of YAP-OE liver RNA-seq data To investigate the function of YAP in the liver, we obtained a transgenic YAP-overexpression (YAP-OE) mouse71. Using this model, human YAP is overexpressed in the mouse liver upon treatment with doxycycline (DOX), resulting in a dramatic increase in liver size and weight. Long-term YAP-overexpression induces tumorigenesis71. We have previously shown that YAP-OE induces changes in HNF4a and FOXA2 DNA-binding, shifting occupancy from adult liver to embryonic liver enhancers42. We therefore hypothesized that YAP-OE would also shift the adult liver to a hepatic progenitor- like state, with re-expression of hepatoblast genes. Although the majority of the liver is comprised of hepatocytes, there are still 30% non-hepatocyte cells. To specifically determine the effect of YAP in hepatocytes, we enriched for the hepatocyte fraction (see Materials and Methods). Immunofluorescence was performed on the hepatocyte fraction to examine co-localization of the hepatocyte-enriched protein albumin to check for hepatocyte purity. RNA-seq was performed on YAP-OE hepatocytes to determine the effect of YAP-OE on the adult liver transcriptome and to identify downstream YAP target genes (Figure 3.1). Hepatocytes were isolated from a group of three mice treated with doxycycline (+DOX) for seven days and a group of three control (-DOX) mice. RNA-seq libraries were generated from -DOX and +DOX hepatocytes. RNA-seq data was then analysed using the Tuxedo Suite protocol, consisting of TopHat2, Bowtie2, and Cufflinks. The gene FPKMs (fragments per kilobase of transcript per million mapped reads) calculated by Cufflinks were the average of the triplicate libraries. Finally, differential gene expression between -DOX and +DOX hepatocytes was determined using Cuffdiff2. Genes were considered differentially expressed if expression was greater than or equal to 1 FPKM in either -DOX or +DOX conditions, fold change greater than or equal to 2, and had a false discovery rate (FDR) of less than 0.05 (see Materials and Methods).  21   Figure 3.1 RNA-seq analysis of YAP-overexpression in the mouse liver. Schematic illustrating the experimental design used to determine the effect of YAP-overexpression in the liver.           22  3.1.2 YAP-OE disrupts liver metabolism and promotes cell proliferation In total, 1291 genes were upregulated and 1601 genes were downregulated in +DOX hepatocytes (Figure 3.2). The top 20 upregulated and downregulated genes are listed in Appendices A and B. Gene ontology (GO) analysis was performed using DAVID to determine the categories of genes that were perturbed. Upregulated genes were involved in cell adhesion, cell migration, and cell proliferation (Table 3.1). Downregulated genes were involved in oxidation reduction and many types of liver-associated metabolic processes, such as cholesterol, fatty acid, and steroid metabolism (Table 3.2). To investigate specific downstream pathways that were affected by YAP-OE, I performed Gene Set Enrichment Analysis (GSEA) on the YAP-OE RNA-seq data. GSEA tests whether genes from pre-defined gene sets are over-represented on either end of the ranked gene list as opposed to randomly distributed throughout. I applied GSEA to the YAP-OE RNA-seq data to identify both up-regulated and down-regulated pathways from the Molecular Signatures Database (MSigDB v5.2) collection of annotated gene lists. YAP-OE resulted in upregulation of E2F and Myc target genes, as well as the ERBB signaling pathway, all of which are known to induce cell cycle progression and proliferation129–131 (Table 3.3). In addition, genes previously found to be upregulated in HCC were enriched, including genes belonging to the proliferation subclass132. Genes downregulated in response to YAP-OE were enriched in HNF4a target genes and genes commonly downregulated in HCC (Table 3.4). Consistent with GO results, multiple types of metabolic genes were downregulated, including bile acid, xenobiotic, and fatty acid enzymes. These results suggest that YAP-OE disrupts hepatocyte metabolism and upregulates pathways promoting cell proliferation.  23   Figure 3.2 YAP-OE alters expression of thousands of genes. Gene expression values (in log2 FPKM) for doxycycline-treated (+DOX) and untreated (-DOX) livers. Significantly upregulated and downregulated genes are represented in red (see Materials and Methods).24  Table 3.1 Top 10 GO Upregulated Biological Processes.  GO Accession Biological processes upregulated Fold Enrichment Adjusted p-value GO:0007155 Cell adhesion 2.81 2.0E-15 GO:0006954 Inflammatory response 2.20 3.3E-04 GO:0030335 Positive regulation of cell migration 2.33 3.9E-04 GO:0007229 Integrin-mediated signaling pathway 3.12 2.7E-03 GO:0010628 Positive regulation of gene expression 1.89 4.4E-03 GO:0007049 Cell cycle 1.62 3.8E-03 GO:0010759 Positive regulation of macrophage chemotaxis 6.92 3.8E-03 GO:0007186 G-protein coupled receptor signaling pathway 2.04 4.2E-03 GO:0002523 Leukocyte migration involved in inflammatory response 7.38 7.4E-03 GO:0030198 Extracellular matrix organization 2.72 7.5E-03  Table 3.2 Top 10 GO Downregulated Biological Processes. GO Accession Biological processes upregulated Fold Enrichment Adjusted p-value GO:0055114 Oxidation-reduction process 2.23 2.0E-20 GO:0006629 Lipid metabolic process 2.27 9.0E-13 GO:0008202 Steroid metabolic process 4.17 9.0E-13 GO:0019373 Epoxygenase P450 pathway 6.22 2.0E-10 GO:0006694 Steroid biosynthetic process 4.59 5.0E-10 GO:0008203 Cholesterol metabolic process 3.65 1.0E-09 GO:0006695 Cholesterol biosynthetic process 5.22 2.0E-07 GO:0016126 Sterol biosynthetic process 5.23 2.0E-06 GO:0006631 Fatty acid metabolic process 2.47 9.0E-06 GO:0001525 Angiogenesis 2.16 3.0E-05  25  Table 3.3 Selected GSEA Upregulated Gene Sets. Gene Set Collection Normalized enrichment score Adjusted p-value E2F targets Hallmark 2.19 0 Myc targets V1 Hallmark 1.59 2.3E-02 Cell cycle KEGG 1.91 1.1E-02 ERBB signaling pathway KEGG 1.80 3.4E-02 Chang Cycling Genes Curated 2.55 0 Chiang Liver Cancer Subclass Proliferation Up Curated 2.35 0 Whitfield Cell Cycle Literature Curated 2.26 0 Borlak Liver Cancer EGF Up Curated 2.22 0 Ishida E2F Targets Curated 2.15 0 Lee Liver Cancer MYC E2F1 UP Curated 2.05 1.0E-03 Lee Liver Cancer E2F1 UP Curated 2.03 1.0E-03 Cordenonsi YAP Conserved Signature Oncogenic signatures 2.26 0  Table 3.4 Selected GSEA Downregulated Gene Sets. Gene Set Collection Normalized enrichment score False discovery rate Bile Acid Metabolism Hallmark -2.07 0 Xenobiotic Metabolism Hallmark -1.90 1.6E-03 Fatty Acid Metabolism Hallmark -1.58 2.4E-02 Retinol Metabolism KEGG -2.09 0 PPAR Signaling Pathway KEGG -1.69 2.9E-02 Ohguchi Liver HNF4A Targets Down Curated -2.67 0 Chiang Liver Cancer Subclass Proliferation Down Curated -2.36 0 Hsiao Liver Specific Genes Curated -2.30 0 Cairo Hepatoblastoma Down Curated -2.26 0 Horton SREBF Targets Curated -2.14 4.3E-05 Lee Liver Cancer MYC E2F1 Down Curated -2.08 1.7E-04 Lee Liver Cancer E2F1 Down Curated -2.01 8.2E-04 26  3.1.3 YAP-OE upregulates hepatoblast and cholangiocyte genes Bipotential hepatoblasts can differentiate into hepatocytes or cholangiocytes. I examined the expression of genes known to be enriched in hepatocytes, cholangiocytes, and hepatoblasts (Figure 3.3). While expression of hepatocyte transcription factors including Hnf4a, Foxa2, and Cebpa remained relatively unchanged, hepatocyte-enriched genes such as G6pc, Apoa5, and Tat were significantly downregulated in +DOX hepatocytes. To determine if there was a reciprocal effect on hepatoblast-enriched genes, I examined the expression of well-known hepatoblast-specific genes. Afp, Gpc3, and Igf2 were significantly upregulated, while Bex2 and Dlk1 were not re-expressed. Interestingly, there was an increase in cholangiocyte-related genes. Key transcription factors involved in cholangiocyte differentiation, including Onecut1, Hnf1b, Sox4, and Sox9, were upregulated in +DOX hepatocytes. In addition, many members of the Notch signaling pathway, important in promoting cholangiocyte differentiation, were upregulated. I curated a list of commonly-used cholangiocyte markers from the literature. This set of cholangiocyte-enriched genes, including Krt7, Krt19, and Epcam, was also upregulated in +DOX hepatocytes. Taken together, these results suggest YAP-overexpression perturbs normal hepatocyte transcriptome and promotes expression of liver developmental genes.  27   Figure 3.3 YAP-OE upregulates hepatoblast and cholangiocyte-specific genes. Changes in gene expression (in log2 fold change) of select hepatocyte transcription factors (TFs), hepatocyte-enriched genes, cholangiocyte transcription factors, members of the Notch signaling pathway, cholangiocyte-enriched genes, and hepatoblast-enriched gene in YAP-OE hepatocytes. NS (not significant), *q<0.05, **q<0.01, ***q<0.001 from Cuffdiff2.    -15 -10 -5 0 5 10 15Dlk1Bex2Igf2Gpc3AfpSpp1EpcamKrt19Krt7Hey1Hes1Notch2Jag1Sox9Sox4Hnf1bOnecut1Sall4Nr2f2Cyp7a1Arg1Tdo2Pck1Apoa5Mbl2Slc10a1Cyp1a2TatSlc22a1F9G6pcA1bgHao1CebpaPparaFoxa2Foxa1Hnf4aLog2 Fold ChangeHepatocyte TFsHepatocyteCholangiocyteCholangiocyte TFsHepatoblastNotch***************************************************************************NSNSNSNSNSNSNSNSNS28  3.2 Transcriptional regulation of Gpc3 by YAP-TEAD and HNF4a 3.2.1 Gpc3 is upregulated in YAP-OE hepatocytes Glypican-3 (Gpc3), a heparan sulfate proteoglycan, was one of the highest upregulated genes in +DOX hepatocytes. Gpc3 is considered an oncofetal gene: highly expressed in the developing liver, not expressed in the adult liver, and re-expressed in HCC14. Gpc3 is hypothesized to modulate signaling pathways including Wnt and Hedgehog by enhancing or blocking receptor-ligand interactions133. In +DOX samples, Gpc3 was more highly expressed than the known YAP target genes Ctgf and Cyr61 (Figure 3.4a). I validated these results by qPCR in a separate set of YAP-OE hepatocytes, confirming that YAP overexpression increased the mRNA levels of Gpc3, Ctgf, and Cyr61 (Figure 3.4b). Examination of our previously published RNA-seq data revealed high expression of Gpc3 in E14.5 hepatoblasts and very low expression in the adult liver (Figure 3.4c). The expression of GPC3 in human cancer cell lines was determined using the BROAD Cancer Cell Line Encyclopedia (CCLE). GPC3 expression in liver cancer cell lines was third highest among the cancer cell lines, and the commonly used human liver hepatoma HepG2 cells had the highest expression of GPC3 among all cancer cell lines examined (Figure 3.4d). These results indicate support the idea that Gpc3 is a liver oncofetal gene, and that Gpc3 is highly upregulated in response to YAP induction in the adult mouse liver.  29  30  Figure 3.4 YAP upregulates the oncofetal gene Gpc3. (a) RNA-seq analysis of Gpc3, Ctgf, and Cyr61 (in log2 FPKM) in –DOX and +DOX hepatocytes. n=3 –DOX and +DOX livers. Values represent the mean and error bars represent the 95% confidence interval ***q<0.001 from Cuffdiff2. (b) qPCR validation of Gpc3, Ctgf, and Cyr61 mRNA expression (normalized to Gapdh) in –DOX and +DOX hepatocytes. n=3 –DOX and +DOX livers. Values represent the mean ± SEM. *p<0.05, **p<0.01 from two-sample Student’s t-test. (c) RNA-seq analysis of Gpc3 in E14.5 hepatoblasts and adult liver. (d) GPC3 expression in various human cancer cell lines grouped by cancer type and ranked by mean expression (log2 FPKM). Data obtained from the BROAD Cancer Cell Line Encyclopedia. The group consisting of liver cancer cell lines is indicated. 31  3.2.2 Identification of putative human GPC3 enhancers I was interested in the mechanism by which Gpc3 was transcriptionally upregulated in the YAP-OE liver. GPC3 is highly expressed in HepG2 cells, and publicly available ChIP-seq datasets are available from the ENCODE Consortium. Therefore, I examined the GPC3 locus on the UCSC genome browser for potential regulatory regions occupied by TEAD4, HNF4a, FOXA2, and the histone modifications histone 3 lysine 4 trimethylation (H3K4me3), histone 3 lysine 4 monomethylation (H3K4me1), and histone 3 lysine 27 acetylation (H3K27ac).   I used TEAD4 ChIP-seq data since there was no YAP ChIP-seq data available in the liver, and TEAD4 is the highest expressing member of the TEAD family in HepG2 cells, and is also upregulated in +DOX hepatocytes (data not shown). I also examined the presence of the master hepatic transcription factors HNF4a and FOXA2 as they regulate many liver-enriched genes, and we have also previously demonstrated they interact with TEAD2 and co-regulate a Sall4 enhancer134. Histone modification data can be used to locate potential regulatory regions in the genome, including promoters and enhancers135. Promoters are located near the transcriptional start site of genes and are especially enriched in H3K4me3 for transcriptionally active genes. H3K4me1 is found at both promoters and enhancers, while active enhancers are also enriched in H3K27ac136.  HNF4a, FOXA2, and TEAD4 co-localized to several locations within a 40-kb region upstream of GPC3 (Figure 3.5a and Figure 3.5b). These sites showed strong enrichment of the histone modifications H3K4me1 and H3K27ac, indicating they could be potential enhancers that regulate GPC3.  32   Figure 3.5 Co-localization of FOXA2, HNF4a, and TEAD at the GPC3 locus. (a) Tracks displaying FOXA2, HNF4a, TEAD4, H3K27ac, H3K4me1, and H3K4me3 signal in HepG2 cells at the GPC3 locus. Highlighted region contains multiple FOXA2, HNF4a, and TEAD4 ChIP-seq peaks in H3K27ac and H3K4me1-enriched regions. (b) Zoomed in view of (a).  33  3.2.3 Identification of putative mouse Gpc3 enhancers I also examined the mouse Gpc3 locus on the UCSC genome browser. As previously shown, Gpc3 is highly differentially expressed between mouse E14.5 hepatoblasts and adult liver. I examined our previously published ChIP-seq data for HNF4a, FOXA2, H3K4me1, H3K4me3, and H3K27ac, as well as RNA-seq for both E14.5 hepatoblasts and adult liver to determine how Gpc3 may be regulated in the mouse liver.  In E14.5 hepatoblasts, HNF4a and FOXA2 co-localized to several regions 25-kb upstream of Gpc3 and were enriched for H3K4me1 and H3K27ac (Figure 3.6). There was also H3K4me3 enrichment at the promoter, which mirrored the high RNA-seq signal. HNF4a and FOXA2 were absent at the same locations in the adult liver, and there was much lower H3K27ac enrichment. Interestingly, H3K4me1 remained present in the adult liver, indicating these putative enhancers may have shifted from an active to a poised state. The low H3K4me3 and RNA-seq signal reflects the low expression of Gpc3 in E.14.5 hepatoblasts. This data indicates the HNF4a and FOXA2 bound regions could be embryonic-specific enhancers that regulated Gpc3, resulting in its differential expression between hepatoblasts and adult liver.   There was no ChIP-seq data available for YAP or any of the TEADs in the mouse liver. As we have previously shown that TEAD2 may be a co-factor for HNF4a and FOXA2 at embryonic-specific enhancers, I assessed the presence of TEAD motifs near the HNF4a and FOXA2 peaks rather than the entire upstream region. TEAD motifs were located in two of the regions co-bound by HNF4a and FOXA2 and one region bound only by HNF4a (Figure 3.7a). Alignment of the sequences determined that both the HNF4a and TEAD motifs within the first enhancer (Gpc3-E1) were conserved between human and mouse, while only the HNF4a motif was conserved in the second enhancer (Gpc3-E2) (Figure 3.7b). I decided to test whether these two putative enhancers were functional, and if so, to determine the exact DNA binding sites conferring functionality.  34   Figure 3.6 Identification of Gpc3 regulatory regions. Tracks displaying FOXA2, HNF4a, H3K27ac, H3K4me1, H3K4me3, and RNA-seq signal in adult (top, green) and E14.5 embryonic liver (bottom, blue) at the Gpc3 locus. Co-localization of FOXA2 and HNF4a at Gpc3 enhancers 1 and 2 (Gpc3-E1, Gpc3-E2) is highlighted.                    35         Figure 3.7 Gpc3 enhancers contain TEAD and HNF4a motifs. (a) Gpc3 enhancer 1 (Gpc3-E1) and enhancer 2 (Gpc3-E2) DNA sequences with distance to Gpc3 transcriptional start site shown. Positions of identified TEAD and HNF4a motifs are indicated. (b) UCSC multi-alignment of the TEAD and HNF4a motifs in (a).    36  3.2.4 Gpc3-E1 and Gpc3-E2 are dependent on TEAD and HNF4a Luciferase assays were performed to determine the inherent transcriptional activity of the two putative enhancers. Gpc3-E1 and Gpc3-E2 were separately cloned into the pGL3-E1B luciferase vector, containing a minimal E1B promoter driving transcription of the luciferase reporter gene. The resultant enhancer vectors, Gpc3-E1, and Gpc3-E2, were transfected into human hepatoma HepG2 cells. Both Gpc3-E1 and Gpc3-E2 induced significantly higher luciferase activity compared to the control pGL3-E1B vector, indicating these two regions could promote transcription (Figure 3.8a).   Gpc3-E1 contains one TEAD motif and one HNF4a motif separated by 29bp. I generated two luciferase constructs with separate deletions of the TEAD and HNF4a motifs and performed luciferase assays. Transfection of either of these deletion vectors into HepG2 cells reduced the luciferase activity by 55%, as compared to the non-deletion control (Figure 3.8b). I next sought to determine if there was any interdependence between the HNF4a and TEAD binding motifs. I deleted the HNF4a and TEAD motifs on the same construct and performed luciferase assays with this vector. Interestingly, deleting both the HNF4a and TEAD motifs did not further reduce the luciferase activity when compared to the single deletion constructs. These results suggest that the HNF4a and TEAD motifs may be dependent upon each other and are responsible for 55% of transcriptional activity of Gpc3-E1, and that other yet unidentified binding sites in this region account for the remaining 45% of transcriptional ability.   Gpc3-E2 contains two TEAD motifs and one HNF4a motif within a 61bp region. The two TEAD motifs, referred to as TEAD-1 and TEAD-2, are separated by 31bp, whereas TEAD-2 and the HNF4a motif are separated by 5bp. I generated three luciferase constructs with separate deletions of the TEAD and HNF4a motifs. Deletion of TEAD-1 or HNF4a almost completely abolished luciferase activity, whereas deletion of TEAD-2 only slightly reduced luciferase activity in HepG2 cells (Figure 3.8c). These results indicate that Gpc3-E2 transcriptional activity is dependent on the TEAD-1 and HNF4a binding sites, and that these binding sites account for almost all of the transcriptional activity of Gpc3-E2.   37   Figure 3.8 Gpc3 enhancer transcriptional activity is dependent on TEAD and HNF4a. (a) Gpc3 enhancer 1 (Gpc3-E1) and 2 (Gpc3-E2) were cloned into the pGL3-E1B luciferase construct. Relative luciferase activity of control (pGL3-E1B), Gpc3-E1, or Gpc3-E2 luciferase constructs transfected into HepG2 cells. (b) Relative luciferase activity of pGL3-E1B, Gpc3-E1, or Gpc3-E1 carrying a deletion in the TEAD motifs (ΔTEAD), the HNF4a motif (ΔHNF4a), or in both the TEAD and HNF4a motifs (ΔTEADΔHNF4a) constructs transfected in HepG2 cells. (c) Relative luciferase activity of pGL3-E1B, Gpc3-E2, or Gpc3-E2 carrying a deletion in the TEAD motifs (ΔTEAD-1, ΔTEAD-2) or in the HNF4a motif (ΔHNF4a) constructs transfected in HepG2 cells. Cells were co-transfected with a Renilla internal control for transfection efficiency. Data are expressed as relative Firefly/Renilla luciferase activity. n=4 independent experiments. Values represent the mean ± SEM. NS (not significant), **p<0.01, ***p<0.001, ****p<0.0001 from one-way ANOVA with Tukey’s multiple comparison test. 38  Overall, these results suggest that Gpc3-E1 and Gpc3-E2 are regulatory regions that can promote transcription. Furthermore, my results identify specific HNF4a and TEAD binding motifs responsible for their transcriptional ability (Figure 3.9).       Figure 3.9 Proposed model by which YAP-TEAD and HNF4a regulate Gpc3 expression. When the Hippo signaling pathway is inactive and YAP is localized to the nucleus, embryonic liver genes including Gpc3 are activated. Gpc3 is regulated by at least two upstream enhancers. Enhancer 1 is responsive to HNF4a, TEAD-YAP, and at least one other unknown transcription factor. Enhancer 2 is responsive to HNF4a and TEAD-YAP.      39  3.3 YAP regulates liver proliferation through transcriptional activation of HER2 3.3.1 Her2 is upregulated in YAP-OE hepatocytes Overexpression of YAP in the adult liver causes hepatomegaly due to hyperplasia rather than hypertrophy, and thus the Hippo pathway is thought to regulate cell proliferation and apoptosis71. Previous studies have identified YAP target genes that contribute to proliferation, including Ctgf, Birc5, and the microRNA family miR-2971,102. However, the variability in induction of these genes across mouse models and cell lines suggests that YAP regulates different sets of growth-promoting genes across different cell types.   The ERBB signaling pathway, a well-known growth-promoting pathway, was among the up-regulated pathways identified by GSEA (Figure 3.10a). The ERBB family consists of four receptor tyrosine kinases commonly known as EGFR (ERBB1), HER2 (ERBB2), HER3 (ERBB3), and HER4 (ERBB4), with each receptor structurally related to the epidermal growth factor receptor (EGFR). ERBB receptors are transmembrane proteins, with an extracellular domain containing the ligand-binding site and an intracellular tyrosine kinase domain131. ERBB receptors are activated upon binding to the EGF (epidermal growth factor) family of secreted ligands137,138. Upon ligand binding, the receptors undergo homo- or heterodimerization and autophosphorylation, resulting in activation of downstream signaling cascades including ERK1/2 and PI3K-AKT139. Ultimately, the downstream processes converge upon transcription of pro-growth and pro-survival genes. Not all EGF-family ligands can bind to every receptor. While no ligand has yet been identified to bind HER2, activation of HER2 can be achieved through heterodimerization with each of the other ERBB receptors; HER2 is the preferential dimerization partner among ERBB family receptors140. On the other hand, while HER3 is capable of binding ligands, HER3 has very low intrinsic kinase activity141,142. Therefore, similar to HER2, HER3 has to heterodimerize with another receptor to efficiently activate downstream signaling.  To determine how YAP impacts the ERBB pathway, I first examined the expression of individual ERBB receptors in the YAP-OE RNA-seq data. Of the four receptors, there was a significant increase in Her2 mRNA levels in +DOX hepatocytes (Figure 3.10b). Egfr, the most 40  highly expressed ERBB family member in hepatocytes, also increased in +DOX hepatocytes but was not statistically significant (q=0.053). Her3 expression did not change, and the overall expression of Her4 was very low in both conditions. To validate the Her2 RNA-seq data, I measured the expression of Her2 mRNA by qPCR in a separate set of +DOX hepatocytes. Overexpression of YAP indeed increased the mRNA level of Her2 (Figure 3.10c). To determine if the change in mRNA corresponded with a change in protein levels, I performed Western blots on hepatocyte lysates. Overexpression of YAP was observed in +DOX hepatocytes, as well as an increase in the well-known YAP target gene, CTGF (Figure 3.10d). Furthermore, there was a slight increase in HER2 protein levels in +DOX hepatocytes, mirroring the increase in Her2 mRNA. These results indicate YAP may regulate the expression of Her2 in the mouse liver.    41   Figure 3.10 YAP upregulates the ERBB pathway. (a) Gene set enrichment analysis (GSEA) of RNA-seq data from –DOX and +DOX hepatocytes identifies upregulation of the ERBB gene signature. NES, normalized enrichment score; FDR, false-discovery rate. Gene sets were obtained from the Molecular Signatures Database. (b) RNA-seq analysis of ERBB family members Egfr, Her2, Her3, and Her4 in –DOX and +DOX hepatocytes. n=3 –DOX and +DOX livers. Values represent mean and error bars represent 95% confidence intervals. NS (not significant) q>0.05, *q<0.05, ***q<0.001 obtained from CuffDiff2. (c) qPCR validation of Her2 mRNA expression (normalized to Gapdh) in –DOX and +DOX hepatocytes. n=3 –DOX and +DOX livers. Values represent the mean ± SEM. *p<0.05, two-tailed Student’s t-test. (d) Western blot analysis of YAP, CTGF, HER2, and AKT in –DOX and +DOX hepatocytes. AKT serves as the loading control.    42  3.3.2 YAP and TEAD regulate HER2 in HepG2 cells YAP and HER2 are abundantly expressed at both the mRNA and protein level in HepG2 cells143. In addition, HepG2 cells express the TEAD family of transcription factors, the main binding partners of YAP. These conditions make HepG2 cells a suitable choice for both knockdown studies and luciferase assays to manipulate the relationship between each factor. Knockdown of YAP using siRNA reduced the levels of YAP mRNA and protein in HepG2 cells compared to cells treated with control siRNA (Figure 3.11a, 3.11b). While there was a significant reduction in HER2 at both the mRNA and protein levels, there was no significant effect on EGFR. This suggests that YAP transcriptionally regulates HER2 in HepG2 cells. I next asked whether YAP requires the TEADs to regulate HER2 expression. Verteporfin, a benzoporphyrin derivative, has previously been shown to disrupt YAP-TEAD interactions and transcriptional activity without affecting YAP and TEAD expression levels109. In addition, treatment of YAP-overexpressing mice with verteporfin greatly diminished the YAP-induced liver enlargement, indicating that verteporfin is able to reduce the pro-proliferative activity of YAP-TEAD109. Therefore, I treated HepG2 cells with different concentrations of verteporfin to assess its effect on HER2 and EGFR. Treatment with verteporfin reduced HER2, but not EGFR protein levels (Figure 3.11c). Taken together, these results indicate that HER2, and not EGFR, is regulated by a YAP-TEAD transcriptional complex in HepG2 cells.   43   Figure 3.11 YAP transcriptionally upregulates HER2. (a) YAP, HER2, and EGFR mRNA expression as measured by qPCR (normalized to GAPDH) in HepG2 cells transfected with control siRNA (siCtrl) or YAP siRNA (siYAP) for 72 hours. n=6 independent experiments. (b) Left: Western blot analysis of YAP, HER2, EGFR, and α-Tubulin in HepG2 cells transfected with control siRNA (siCtrl) or YAP siRNA (siYAP) for 48 and 72 hours. Right: Quantification of total HER2 and EGFR as a fraction of α-Tubulin. Western blots are representative of 4 independent experiments. NS (not significant) p>0.05, *p<0.05, **p<0.01, ****p<0.0001 from two-tailed Student’s t-test. (c) Western blots for EGFR, HER2, and α-Tubulin in HepG2 cells treated with DMSO (Ctrl) or verteporfin at indicated dosages for 72 hours. Western blots are representative of 4 independent experiments. Values represent the mean ± SEM. **p<0.01 from one-way ANOVA with Tukey’s multiple comparison test. 44  3.3.3 YAP and TEAD regulate the HER2 promoter in HepG2 cells To understand the mechanism by which YAP regulates HER2, the HER2 locus was examined for regulatory regions potentially responsive to YAP and TEAD. I assessed publicly available HepG2 ChIP-seq data to find potential TEAD binding sites at the HER2 locus. While several TEAD4 peaks were located at the HER2 locus, one peak was specifically located at the promoter of the major HER2 transcript (Figure 3.12). This region contains the TEAD motif, suggesting TEAD may directly bind to the HER2 promoter. Thus, I chose to test this region of DNA in subsequent luciferase assays.  To determine if TEAD could regulate the HepG2 HER2 promoter, I cloned a 273bp region containing the TEAD4 ChIP-seq peak and TEAD motif into the pGL4-Basic luciferase vector. This promoter-less vector contains a multiple cloning site in front of the luciferase gene. The resultant hHer2P vector induced a 25-fold greater luciferase activity compared to the control pGL4-Basic vector when transfected into HepG2 cells (Figure 3.13a). I next sought to determine if the transcriptional activity displayed in HepG2 cells was dependent on TEAD. Co-transfection of hHer2P and a TEAD-DN plasmid109 decreased the luciferase activity by 40% compared to co-transfection with a pcDNA3 control plasmid. To determine if the identified TEAD motif was an important binding site for transcriptional activity, I deleted the TEAD motif in the hHer2P vector. The resulting hHer2PΔT construct was transfected into HepG2 cells and luciferase induction was compared to the hHer2P construct. Removing the TEAD motif reduced the luciferase activity by 40% compared to the non-deletion control (Figure 3.13b). These results indicate that TEAD binding is responsible for approximately 40% of the transcriptional activity of the hHer2P. To validate the TEAD4 ChIP-seq data and determine if YAP is also present at the TEAD4 binding site, I performed ChIP-qPCR for TEAD4 and YAP in HepG2 cells. Both TEAD4 and YAP were enriched at the HER2 promoter, indicating that both YAP and TEAD are present and regulate HER2 (Figure 3.13c).    45   Figure 3.12 TEAD4 ChIP peaks at the human HER2 promoter. Tracks displaying TEAD4, H3K27ac, H3K4me1, and H3K4me3 ChIP-seq signal in HepG2 cells at the HER2 locus (RefSeq NM_004448). Track heights are indicated. The region of the HER2 promoter containing the TEAD motif is highlighted. Sequence alignments show conservation of the TEAD motif.   46   Figure 3.13 YAP and TEAD activate the human HER2 promoter. (a) The human HER2 promoter containing the TEAD motif was cloned into pGL4-Basic luciferase construct. Relative luciferase activity of control (pGL4-Basic) or HER2 promoter (hHer2P) luciferase constructs transfected into HepG2 cells along with control (pcDNA3) or TEAD dominant-negative (TEAD-DN) vectors. Values represent the mean ± SEM. *p<0.05, ***p<0.001 from two-way ANOVA with Tukey’s multiple comparison test.  (b) Luciferase assays using control (pGL4-Basic), HER2 promoter (hHer2P), or HER2 promoter carrying a deletion in the TEAD motif (hHer2PΔT) luciferase constructs were performed in HepG2 cells. Cells were co-transfected with a Renilla internal control for transfection efficiency. Data are expressed as relative Firefly/Renilla luciferase activity. n=3 independent experiments. Values represent the mean ± SEM. *p<0.05, ***p<0.001 from one-way ANOVA with Tukey’s multiple comparison test. (c) ChIP-qPCR analysis of YAP and TEAD4 enrichment at the HER2 promoter in HepG2 cells. CTGF, CYR61, and ANKRD1 promoters serve as positive control regions. HOXA9 promoter serves as the negative control region. Data are representative of 2 independent experiments. 47  3.3.4 YAP and TEAD regulate the mouse Her2 promoter While these experiments suggest YAP and TEAD regulate HER2 transcription in HepG2 cells at the promoter, whether the same is true in the mouse liver is unknown. I next examined our mouse liver ChIP-seq and RNA-seq data to determine if YAP-TEAD may regulate Her2 in a similar fashion in the mouse liver. There was higher H3K4me3 at the Her2 promoter region in E14.5 hepatoblasts compared to the adult liver (Figure 3.14a), mirroring its mRNA expression (Figure 3.14b). Because no TEAD ChIP-seq data is available in the mouse liver, I assessed the Her2 promoter region for TEAD motifs. The mouse Her2 promoter region contained three TEAD motifs. I cloned a 1169bp region containing the three motifs into the pGL4-Basic vector. Transfection of this mHer2P vector into HepG2 cells resulted in approximately 25-fold induction of luciferase activity when compared to the control pGL4-Basic vector (Figure 3.15a). Co-transfection of mHer2P with the TEAD dominant-negative expression plasmid resulted in a 40% decrease in luciferase activity. I then deleted each TEAD motif separately to determine which site contributed to transcriptional activity. The resulting deletion constructs mHer2PΔT1, mHer2PΔT2, and mHer2PΔT3 were transfected into HepG2 cells and luciferase activity was compared to the non-deletion construct control. Only deletion of the third TEAD motif (mHer2PΔT3) reduced the luciferase activity by approximately 40%, indicating that this is a functional TEAD binding site (Figure 3.15b). These results suggest that YAP-TEAD transcriptionally regulate the mouse Her2 promoter.   48   Figure 3.14 Her2 is an embryonic liver-enriched gene. (a) Tracks displaying FOXA2, HNF4a, H3K27ac, H3K4me1, H3K4me3 ChIP-seq and RNA-seq signal in adult (top, green) and E14.5 embryonic liver (bottom, blue) at the mouse Her2 locus. The region of the Her2 promoter containing 3 TEAD motifs (TEAD-1, TEAD-2, TEAD-3) is highlighted. (b) RNA-seq analysis of Her2 in E14.5 hepatoblasts and adult liver.   49   Figure 3.15 YAP and TEAD activate the mouse Her2 promoter. (a) The mouse Her2 promoter containing the TEAD motifs was cloned into the pGL4-Basic luciferase construct. Relative luciferase activity of control (pGL4-Basic) or Her2 promoter (mHer2P) luciferase constructs were transfected into HepG2 cells along with control (pcDNA3) or TEAD dominant-negative (TEAD-DN) vectors. Values represent the mean ± SEM. **p<0.01, ****p<0.0001 from two-way ANOVA with Tukey’s multiple comparison test. (b) Luciferase assays using control (pGL4-Basic), Her2 promoter (mHer2P), or Her2 promoter carrying a deletion in each of the TEAD motifs (mHer2PΔT1, mHer2PΔT2, mHer2PΔT3) luciferase constructs were performed in HepG2 cells. Cells were co-transfected with a Renilla internal control for transfection efficiency. Data are expressed as relative Firefly/Renilla luciferase activity. n=3 independent experiments. Values represent the mean ± SEM. *p<0.05, ***p<0.001 from one-way ANOVA with Tukey’s multiple comparison test.         50  3.3.5 YAP regulates EGF-induced AKT-signaling and proliferation Transcriptional regulation of Her2 by YAP raises the possibility that YAP may be important in regulating ERBB-mediated cellular functions in the liver, including cell proliferation. As previously mentioned, HER2 cannot be directly activated by a ligand; HER2 must heterodimerize with another ERBB receptor to induce downstream signaling. EGF is a ligand capable of activating HER2 through EGFR-HER2 dimerization. Both EGFR and HER2 are expressed in HepG2 cells, making it a suitable system for EGF-induced HER2 activation. In addition, EGF induces HepG2 cell proliferation through the PI3K-AKT signaling pathway144. Therefore, I hypothesized that YAP regulates EGF-induced cell proliferation and PI3K-AKT signaling.  First, I tested if EGF could indeed activate HER2-mediated AKT signaling. Following serum starvation, HepG2 cells were treated with EGF for 10, 30, and 60 minutes. Both HER2 and AKT were activated as indicated by the substantial increase in their phosphorylated forms (Figure 3.16a). Knockdown of HER2 significantly decreased the amount of phosphorylated AKT, indicating that HER2 was necessary for EGF-induced AKT activation (Figure 3.16b). Importantly, knockdown of YAP also significantly diminished the effect of EGF on AKT activation (Figure 3.16c). These results suggest that YAP may regulate EGF-induced AKT activation through HER2.  To determine if YAP plays a role in EGF-induced cell proliferation, I performed MTT (3-(4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide) assays. MTT assay is a method of measuring cell proliferation. Mitochondrial enzymes convert the MTT dye into water-insoluble purple formazan crystals, which is then solubilized using DMSO. The resulting solution is measured by a spectrophotometer. Therefore, the concentration of purple formazan in solution indicates how many live cells were in the well. HepG2 cells transfected with either siRNA targeting YAP or control siRNA for 48 hours were treated with EGF daily for 96 hours. Knockdown of YAP significantly reduced the proliferative effect of EGF on HepG2 cells, indicating that YAP regulates EGF-induced cell proliferation (Figure 3.16d).  51        52  Figure 3.16 YAP regulates EGF-induced proliferation and AKT activation. (a) Left: Western blot analysis of p-HER2 (Tyr1248), HER2, p-AKT (Ser473), and AKT in HepG2 cells treated with PBS (Ctrl) or 100 ng/mL EGF for indicated durations. Right: Quantifications of p-HER2 and p-AKT as fractions to total HER2 and AKT. Western blots are representative of 4 independent experiments. *p<0.05, **p<0.01 from two-tailed Student’s t-test (b) Left: Western blot analysis of HER2, p-AKT (Ser473), AKT, and α-Tubulin in HepG2 cells transfected with control siRNA (siCtrl) or HER2 siRNA (siHER2) for 48 hours and then treated with PBS (Ctrl) or 100 ng/mL EGF for 30 min. Right: Quantification of p-AKT as a fraction to total AKT. Western blots are representative of 4 independent experiments. (c) Left: Western blots analysis for YAP, HER2, p-AKT (Ser473), and α-Tubulin in HepG2 cells transfected with control siRNA (siCtrl) or HER2 siRNA (siHER2) for 48 hours and then treated with or without 100 ng/mL EGF for 30 min. Right: Quantification of p-AKT as a fraction to total AKT. Western blots are representative of 3 independent experiments. (d) Cell proliferation as measured by the MTT assay. HepG2 cells were transfected with control siRNA (siCtrl) or YAP siRNA (siYAP) for 48 hours and then treated with or without 100 ng/mL EGF every 24 hours for 96 hours. n=3 independent experiments. Values represent the mean ± SEM. NS (not significant), p>0.05, *p<0.05, **p<0.01, ****p<0.0001 from two-way ANOVA with Tukey’s multiple comparison test.               53  Overall, these results indicate that the downstream Hippo signaling pathway effector YAP and transcription factor TEAD directly regulate transcription of the ERBB family receptor HER2 in the liver, resulting in increased HER2-mediated downstream signaling and cell proliferation (Fig 3.17).  Figure 3.17 Proposed model by which YAP regulates ERBB signaling to promote liver growth. During periods of liver growth, such as liver development and cancer, the Hippo signaling pathway is off and YAP is localized to the nucleus. YAP and TEAD directly regulate the transcription of HER2 by binding to its promoter, resulting in increased HER2 expression. Increased HER2-EGFR pathway activation leads to activation of downstream PI3K-AKT signaling, and cell proliferation.   54  Chapter 4: Discussion 4.1 The effect of YAP-OE on the liver transcriptome Here I have identified key transcriptional targets regulated by the Hippo signaling pathway in the liver. RNA-seq analysis of the YAP-overexpressing liver identified widespread changes in gene expression, with almost 3000 differentially expressed genes. Importantly, YAP-OE upregulated major cellular processes related to proliferation and cell cycle and downregulated many metabolic pathways important for hepatocyte function. Both embryonic liver genes and cholangiocyte markers were re-expressed, whereas metabolic genes enriched in the adult liver were downregulated. Thus, my data supports the notion that the Hippo signaling pathway is important for maintaining hepatocyte identity in the adult liver.   Given the profound increase in liver size upon overexpression of YAP, it was not surprising that GO analysis identified upregulation of cellular proliferation and cell cycle genes. Organized hepatic architecture is essential for proper hepatocyte function. Histological analysis confirmed hepatocyte hyperplasia rather than hypertrophy in the YAP-OE livers. Additional examination revealed disorganization of the hepatocyte cords and areas of necrosis, possibly due to excessive hepatocyte proliferation. Indeed, promotion of cell proliferation is one of the most well-known functions of YAP and has been observed in multiple tissues, including liver, intestine, and cardiomyocytes71,89,145–147.   Strikingly, most of the major downregulated processes were metabolic pathways. Mature hepatocytes are involved in various aspects of metabolism, including bile acid, cholesterol, fatty acid, and glucose metabolism3. Disruption of these vital metabolic processes can result in liver failure. Measuring serum albumin, aspartate transaminase, alanine transaminase, and alkaline phosphatase levels would confirm liver dysfunction. Key transcriptional regulators of lipid and bile acid metabolism including Ppara and Nr1h4 were downregulated in the YAP-OE liver, whereas Hnf4a expression did not change. A recent study revealed that YAP and HNF4a expression were negatively correlated in human HCC samples, and that YAP and HNF4a negatively regulated each other's expression in liver cancer cell lines148. Overexpression of YAP 55  only slightly decreased HNF4a mRNA level, but instead induced degradation at the protein level via the ubiquitin proteasome pathway in HepG2 cells. Another potential mechanism by which YAP negatively regulates HNF4a transcription is by recruiting the Chd4 repressor to the Hnf4a promoter as demonstrated in the AML12 mouse hepatocyte cell line91. HNF4a protein is also decreased in the embryonic liver of the Alb-Cre driven Lats1/2 double-knockout mice. Finally, Hnf4a mRNA did not change after one week of overexpression of the constitutively-active form of YAP in the mouse liver, but was instead downregulated at two weeks post-induction92. I also examined HNF4a at the protein level in YAP-OE livers and found decreased HNF4a levels in two out of three +DOX livers (Appendix H). My data supports the idea that YAP does not immediately affect Hnf4a mRNA expression, but more work will be needed to determine if YAP can negatively affect HNF4a post-transcriptionally. Examining HNF4a mRNA and protein levels at different time points will be required to uncover the temporal effects of YAP-OE on HNF4a, and whether the downregulation of metabolism genes is a direct effect of YAP or instead a secondary effect due to loss of the metabolic regulator Hnf4a.   YAP is highly expressed in undifferentiated progenitor cells in various tissues, including neural stem cells, skeletal muscle satellite cells, and intestinal stem cells. YAP overexpression in the neural tube reduces neural differentiation and promotes proliferation of neural progenitor cells149. In skeletal muscle, YAP blocks the myogenic differentiation program and promotes proliferation of myoblasts150. Overexpression of YAP in the intestine results in downregulation of intestinal differentiation markers and expansion of intestinal progenitor cells89. Whether YAP also affects liver cell fate is unclear. There was re-expression of both embryonic hepatoblast-enriched genes, such as Gpc3 and Afp, and cholangiocyte markers, including Krt19, and Epcam after YAP induction. Transcription factors involved in cholangiocyte differentiation, including Hnf1b, Sox4, and Sox9 were also upregulated. In addition, there was upregulation of the Notch signaling pathway, which is known to promote cholangiocyte development. While many of these genes are used to mark cholangiocytes, a major confounding factor is that many of the genes regulating cholangiocyte development and function are also expressed in hepatoblasts. For example, Krt19, a commonly used cholangiocyte or ductal marker, is also expressed in early hepatoblasts and is upregulated as hepatoblasts differentiate into cholangiocytes. Therefore, while my data suggests 56  certain liver developmental genes are turned on, I cannot determine if YAP promotes dedifferentiation to hepatic progenitor cells or direct transdifferentiation to cholangiocytes. Analysis of more time points during YAP induction and comparison to newly-generated RNA-seq data during embryonic liver development, and generation of cholangiocyte transcriptomic data may help address this question.  4.2 Gpc3 as a potential YAP target gene I have investigated how YAP transcriptionally regulates downstream genes, using Gpc3 as an example. Gpc3 was one of the highest upregulated genes in the YAP-OE liver. I identified putative enhancers upstream of Gpc3 in HepG2 bound by the transcription factors HNF4a, FOXA2, TEAD4, and marked by the histone modifications H3K4me1 and H3K27ac. HNF4a and FOXA2 ChIP-seq peaks were also found upstream of Gpc3 in our mouse hepatoblast ChIP-seq data, and contained TEAD motifs. Importantly, in the adult liver Gpc3 is not expressed, and the HNF4a and FOXA2 peaks are also absent, suggesting that these enhancers regulate Gpc3 expression. I examined the function of two mouse Gpc3 enhancers using luciferase assays and determined key HNF4a and TEAD binding sites necessary for enhancer activity.  Gpc3 belongs to the glypican family of heparan sulfate proteoglycans151. Glypicans are bound to the plasma membrane, allowing them to interact with cell surface receptors and ligands of various signaling pathways, including the Wnt pathway. Gpc3 has important roles in both embryonic development and cancer. Gpc3 is considered an oncofetal gene. Oncofetal genes are expressed during normal embryonic development, downregulated in adult tissue, and re-expressed during cancer. Our data suggests Gpc3 is highly expressed in both the mouse endoderm and in hepatoblasts, and is undetectable in the adult liver. Gpc3 knockout mice exhibit perinatal death, developmental overgrowth, and defects in the kidneys and lungs152. Interestingly, there was no observed defect in the embryonic liver, despite the high expression of Gpc3 in hepatoblasts. GPC3 is considered a biomarker for HCC14. GPC3 is highly expressed in HCCs compared to normal liver, cirrhotic liver, or benign lesions. Both the mRNA and protein levels of Gpc3 are more frequently expressed in HCCs compared to AFP, the most commonly used 57  marker for HCC153,154. In addition, GPC3 expression is correlated with poor prognosis in HCC. Antibodies targeting GPC3 are currently being tested in HCC clinical trials155,156. Despite these findings, the functional role of GPC3 is still unclear. Gpc3 expression is associated with HCC, and while the YAP-OE mice can eventually develop HCC71, I have shown that Gpc3 is expressed only a few days after YAP induction. In addition, Gpc3 is re-expressed in the livers of other Hippo mutant mouse models157. Therefore, Gpc3 does not seem to be solely expressed in HCC, but perhaps in rapidly proliferating livers as well. Whether Gpc3 promotes or suppresses liver growth may be context dependent. While studies using liver cancer cells have indicated that Gpc3 promotes proliferation158,159, GPC3-overexpression mice display suppressed liver regeneration following partial hepatectomy160,161. Therefore, it will be interesting to investigate the functional role of Gpc3 in the YAP-OE liver to determine if it is promoting or attempting to suppress liver growth.  The Gpc3 promoter is transcriptionally regulated by c-Myc in HCC cells lines, and by Zhx2 and Afr2 in the mouse liver162,163. While Myc was upregulated in the YAP-OE liver, there was no change in Zhx2 or Afr2 expression (data not shown). Instead, my studies focused on two mouse Gpc3 enhancers, and revealed transcriptional dependency on both HNF4a and TEAD binding sites. For Gpc3-E1, deletion of HNF4a and TEAD motifs alone and in combination decreased the transcriptional output by 55%, suggesting that transcriptional ability was dependent on both HNF4a and TEAD binding sites. Deletion of FOXA2 motifs will be necessary to determine if FOXA2 or other unidentified transcription factors are responsible for the remaining 45% of transcription.  In addition, truncation of the enhancer at different positions can narrow down the DNA sequences responsible for the remaining transcriptional activity. Gpc3-E2 contained a HNF4a motif and two TEAD motifs. Deletion of either HNF4a or TEAD-1 abolished luciferase activity, whereas deletion of TEAD-2 only slightly reduced luciferase activity (although not statistically significant). TEAD-2 and HNF4a motifs are only separated by 5bp. One possibility is that that HNF4a requires this neighbouring DNA sequence to stabilize binding to its own motif, and that deleting the TEAD-2 motif may therefore have impacted HNF4a binding. Another possibility is that HNF4a requires TEAD to bind to the adjacent motif. These hypotheses can be tested using the Gpc3 enhancers for in vitro binding assays such as EMSA, to 58  determine if there is any cooperative or competitive interaction between the proteins in vitro.  Another possibility is that by deleting rather than mutating the HNF4a motif, the neighbouring DNA sequences may have been shifted and thus the position of proteins involved in the transcriptional complex may also have been affected. To mitigate this concern, more subtle approaches can also be used, such as mutating individual nucleotides in the motifs rather than deleting the entire sequence. Position effect can also be tested by increasing the distance between the HNF4a and TEAD-2 motifs by inserting DNA spacers. Interestingly, a recent study showed HNF4a and TEAD interact in HepG2 cells148. Further studies will be necessary to determine if HNF4a-TEAD and YAP-TEAD regulate distinct set of genes, or if all three proteins work together.   GPC3 is highly expressed in liver cancer cell lines, including HepG2 cells, and knockdown of GPC3 inhibits HCC cell proliferation159. My preliminary data shows that knockdown of YAP in HepG2 cells does not affect GPC3 mRNA or protein expression (data not shown). Future work will focus on knocking down HNF4a and the TEADs to access their role in the regulation of GPC3. Both of the Hippo pathway effector homologs YAP and TAZ are expressed in HepG2 cells, and there may be functional redundancy between them to regulate GPC3 expression. Knocking down each component singly and in combination may answer this question. Of note, it was recently reported that some cancer cell lines compensate for loss of YAP or TAZ by upregulation of the other homolog164. However, HepG2 was not one of the affected cell lines.   4.3 The role of HER2 signaling in liver cancer The last section of my thesis identified the receptor tyrosine kinase Her2 as a YAP target gene. Her2 is upregulated in the YAP-OE liver and is transcriptionally regulated by YAP in HepG2 cells. Using luciferase assays, I have identified TEAD binding sites important for Her2 promoter regulation. In addition, I have demonstrated that YAP regulates EGF-induced HCC cell proliferation and AKT signaling.   59  The ERBB family of receptors has been extensively studied due to their critical role in both normal development and cancer pathogenesis131. The ERBB receptors bind various growth factors important for development and normal cell homeostasis, resulting in activation of signals involving PI3K-AKT and RAS-RAF-MEK-ERK cascades. Ultimately, genes are activated to promote cell growth, survival, migration, and many other processes. Her2-null mice display embryonic lethality at E11 due to defects in cardiac trabeculae and the nervous system165, whereas Egfr-null mice display strain-specific embryonic lethality and postnatal lethality due to defects in a variety of tissues166.   Of the ERBB receptors, HER2 status is particularly important in breast cancer. HER2 is amplified and overexpressed in 30% of breast cancers and is a predictor of survival and time to relapse167. Whether HER2 also plays an important role in liver cancer, and how HER2 may be regulated in the liver has not been thoroughly examined. Several studies have found that HER2 is associated with hepatitis- infected liver cancer. HER2 expression was upregulated in HCC, but more strongly in hepatitis B x (HBx) antigen-associated HCC168. There was higher HER2 expression in HBx-infected HCC cell lines compared to non-infected HCC cell lines. It is interesting to note that YAP is also strongly expressed and display nuclear localization in human hepatitis-associated HCC samples, and is expressed higher in the hepatitis B-infected HepG2 cell line compared to normal HepG2 cells169,170. HBx has been shown to positively regulate YAP expression in liver cancer via the CREB transcription factor169. Whether YAP is responsible for elevated HER2 levels in HBx-associated HCC cells would be interesting to explore.  The Ets family of transcription factors, YB-1, and AP-2 are important regulators of HER2 expression in breast cancer cells171–175. Knockdown of YAP only decreased HER2 mRNA and protein levels by 40% in HepG2 cells. Indeed, deletion of the TEAD binding motif in both the human and mouse HER2 promoters also decreased luciferase activity by 40%. The region I had cloned for the luciferase assays contains the Ets motif, as well as the AP2 motif. Whether these binding sites contribute to the other 60% of luciferase activity can be examined by deleting or mutating their respective motifs. It was interesting that luciferase activity was only affected by deletion of the TEAD motif closest to the mouse Her2 TSS. To determine if the distance plays a 60  role in transcriptional activity, the enhancer can be flipped around and tested to see if there is any change in luciferase activity.  There was also a putative enhancer slightly upstream of the human HER2 promoter enriched for TEAD4, HNF4a, and FOXA2 in HepG2 cells. This is particularly interesting, as there were no HNF4a or FOXA2 peaks located at the Her2 locus in our mouse liver ChIP-seq data. The regulatory ability of this region will be determined in future work. The regulatory role of HNF4a on HER2 will also be assessed using knockdown assays. While my results show that HER2 is regulated by YAP in the liver, whether this regulation is liver-specific is not known. I did not come across any references to HER2 regulation by YAP in any other cellular context. It would be interesting to see how far this regulation extends, especially to the other HER2-expressing cell lines, such as the various breast cancer cell lines, or the HER2-expressing lung cancer cell line A549.  HER2 is a well-known mediator of EGF-EGFR signaling. EGF, which activates HER2 via heterodimerization with EGFR, is a known mitogen that can stimulate hepatocyte and liver cancer cell proliferation. Patients with cirrhosis carrying a particular EGF gene single-nucleotide polymorphism have higher serum EGF levels and have a higher risk of developing HCC176. I found that addition of EGF to HepG2 cells stimulated cell proliferation and activated PI3K-AKT signaling, and that this process was dependent on YAP-regulated HER2 expression. YAP can regulate expression of ERBB family members and EGF family ligands in other cell types, including EGFR and its ligand Amphiregulin (AREG) in mammary epithelial cells, EGFR in esophageal cancer, and EGFR and HER3 in ovarian cancer177–180. These results suggest that YAP can promote cell proliferation through manipulation of ERBB signaling in an autocrine manner, and that targeting ERBB receptors may be a promising therapy in YAP-driven cancers.    My GSEA results supports previous studies linking dysregulated Hippo pathway signaling to overactivation of ERBB signaling. Overexpression of the constitutively-active form of YAP in the mouse liver increased expression of EGFR signaling components92. In addition, treatment of liver-specific Hippo pathway component Nf2-null mice with the EGFR inhibitor erlotinib decreased the liver/body weight ratio and reduced the size of HCC lesions83. Knockdown of YAP in HepG2 cells also did not significantly affect EGFR expression at either the mRNA or 61  protein level. However, given the stabilizing effect of HER2 on other ERBB receptor-mediated signaling, YAP may upregulate general ERBB-associated signaling and proliferation. Future work will determine if disruption of ERBB-signaling by using EGFR/HER2 inhibitors results in impaired liver growth in the YAP-OE mice.  4.4 Conclusion I have shown that overexpression of YAP in the adult liver causes dramatic downregulation of hepatocyte-enriched genes, and upregulation of certain developmental liver genes including Gpc3 and Her2. I have identified two enhancers upstream of Gpc3 and demonstrated that transcriptional activity is dependent on certain TEAD and HNF4a binding motifs. Finally, through transcriptional regulation of HER2, I have implicated YAP in regulation of EGF-induced proliferation and signaling in liver cancer cells. This work broadens our knowledge on downstream transcriptional targets of the Hippo signaling pathway in the liver.              62  References  1. Si-Tayeb, K., Lemaigre, F. P. & Duncan, S. a. Organogenesis and development of the liver. Dev. Cell 18, 175–89 (2010). 2. Gordillo, M., Evans, T. & Gouon-Evans, V. Orchestrating liver development. Development 142, 2094–2108 (2015). 3. Rui, L. Energy metabolism in the liver. Compr. Physiol. 4, 177–197 (2014). 4. Torre, L. A. et al. Global cancer statistics, 2012. CA. Cancer J. Clin. 65, 87–108 (2015). 5. Mortality, G. B. D. & Collaborators, D. Global , regional , and national age – sex specifi c all-cause and cause-specifi c mortality for 240 causes of death , 1990 – 2013 : a systematic analysis for the Global Burden of Disease Study 2013. Lancet 385, 117–171 (2014). 6. Association, E. Clinical Practice Guidelines EASL Clinical Practice Guidelines : Management of chronic hepatitis B virus infection Clinical Practice Guidelines. J. Hepatol. 57, 167–185 (2012). 7. Llovet, J. M., Villanueva, A., Lachenmayer, A. & Finn, R. S. Advances in targeted therapies for hepatocellular carcinoma in the genomic era. Nat. Rev. Clin. Oncol. 12, 408–424 (2015). 8. de La Coste, A. et al. Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc. Natl. Acad. Sci. U. S. A. 95, 8847–51 (1998). 9. Satoh, S. et al. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat. Genet. 24, 245–250 (2000). 10. Schulze, K. et al. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat. Genet. 47, 505–511 (2015). 11. Zender, L. et al. Identification and Validation of Oncogenes in Liver Cancer Using an Integrative Oncogenomic Approach. Cell 125, 1253–1267 (2006). 12. Nguyen, Q., Anders, R. A., Alpini, G. & Bai, H. Yes-associated protein in the liver: Regulation of hepatic development, repair, cell fate determination and tumorigenesis. Dig. Liver Dis. 47, 826–835 (2015). 13. Tandon, P. & Garcia-Tsao, G. Prognostic indicators in hepatocellular carcinoma: A systematic review of 72 studies. Liver Int. 29, 502–510 (2009). 14. Filmus, J. & Capurro, M. Glypican-3: A marker and a therapeutic target in hepatocellular carcinoma. FEBS J. 280, 2471–2476 (2013). 15. Yong, K. J. et al. Oncofetal gene SALL4 in aggressive hepatocellular carcinoma. N. Engl. J. Med. 368, 2266–76 (2013). 16. Crisan, M. & Dzierzak, E. The many faces of hematopoietic stem cell heterogeneity. Development 143, 4571–4581 (2016). 17. Lemaigre, F. P. Mechanisms of Liver Development: Concepts for Understanding Liver Disorders and Design of Novel Therapies. Gastroenterology 137, 62–79 (2009). 18. Geisler, F. et al. Liver-specific inactivation of Notch2, but not Notch1, compromises intrahepatic bile duct development in mice. Hepatology 48, 607–616 (2008). 19. Tchorz, J. S. et al. Notch2 signaling promotes biliary epithelial cell fate specification and tubulogenesis during bile duct development in mice. Hepatology 50, 871–879 (2009). 20. Li, L. et al. Alagille syndrome is caused by mutations in human Jagged1, which encodes a 63  ligand for Notch1. Nat. Genet. 16, 243–251 (1997). 21. Oda, T. et al. Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat. Genet. 16, 235–242 (1997). 22. McDaniell, R. et al. NOTCH2 Mutations Cause Alagille Syndrome, a Heterogeneous Disorder of the Notch Signaling Pathway. Am. J. Hum. Genet. 79, 169–173 (2006). 23. Odom, D. T. et al. Control of Pancreas and Liver Gene Expression by HNF Transcription Factors. Science 303, 1378–1381 (2004). 24. Kyrmizi, I. et al. Plasticity and expanding complexity of the hepatic transcription factor network during liver development. Genes Dev. 20, 2293–2305 (2006). 25. Lokmane, L. et al. Crucial role of vHNF1 in vertebrate hepatic specification. Development 135, 2777–86 (2008). 26. Margagliotti, S. et al. The Onecut transcription factors HNF-6/OC-1 and OC-2 regulate early liver expansion by controlling hepatoblast migration. Dev. Biol. 311, 579–589 (2007). 27. Lee, C. S., Friedman, J. R., Fulmer, J. T. & Kaestner, K. H. The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944–947 (2005). 28. Yamasaki, H. et al. Suppression of C/EBPalpha expression in periportal hepatoblasts may stimulate biliary cell differentiation through increased Hnf6 and Hnf1b expression. Development 133, 4233–43 (2006). 29. Clotman, F. et al. The onecut transcription factor HNF6 is required for normal development of the biliary tract. Development 129, 1819–28 (2002). 30. Hunter, M. P. et al. The homeobox gene Hhex is essential for proper hepatoblast differentiation and bile duct morphogenesis. Dev. Biol. 308, 355–367 (2007). 31. Krupczak-Hollis, K. et al. The mouse Forkhead Box m1 transcription factor is essential for hepatoblast mitosis and development of intrahepatic bile ducts and vessels during liver morphogenesis. Dev. Biol. 276, 74–88 (2004). 32. Antoniou, A. et al. Intrahepatic Bile Ducts Develop According to a New Mode of Tubulogenesis Regulated by the Transcription Factor SOX9. Gastroenterology 136, 2325–2333 (2009). 33. Costa, R. H., Grayson, D. R. & Darnell, J. E. Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and alpha 1-antitrypsin genes. Mol. Cell. Biol. 9, 1415–1425 (1989). 34. Sladek, F. M., Zhong, W. M., Lai, E. & Darnell, J. E. Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev 4, 2353–2365 (1990). 35. Yamagata, K. et al. Mutations in the hepatocyte nuclear factor-4a gene in maturity-onset diabetes of the young (MODY1). Nature 384, 458–460 (1996). 36. Chen, W. S. et al. Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 8, 2466–2477 (1994). 37. Li, J., Ning, G. & Duncan, S. A. Mammalian hepatocyte differentiation requires the transcription factor HNF-4?? Genes Dev. 14, 464–474 (2000). 38. Parviz, F. et al. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat. Genet. 34, 292–6 (2003). 39. Kanazawa, T., Konno, A., Hashimoto, Y. & Kon, Y. Expression of hepatocyte nuclear 64  factor 4?? in developing mice. J. Vet. Med. Ser. C Anat. Histol. Embryol. 38, 34–41 (2009). 40. Hayhurst, G. P. et al. Hepatocyte Nuclear Factor 4 α ( Nuclear Receptor 2A1 ) Is Essential for Maintenance of Hepatic Gene Expression and Lipid Homeostasis Hepatocyte Nuclear Factor 4 ␣ ( Nuclear Receptor 2A1 ) Is Essential for Maintenance of Hepatic Gene Expression and Lipid H. Mol. Cell. Biol. 21, 1393–1403 (2001). 41. Bonzo, J. A., Ferry, C. H., Matsubara, T., Kim, J.-H. & Gonzalez, F. J. Suppression of Hepatocyte Proliferation by Hepatocyte Nuclear Factor 4  in Adult Mice. J. Biol. Chem. 287, 7345–7356 (2012). 42. Alder, O. et al. Hippo Signaling Influences HNF4A and FOXA2 Enhancer Switching during Hepatocyte Differentiation. Cell Rep. 1–11 (2014). doi:10.1016/j.celrep.2014.08.046 43. Hannenhalli, S. & Kaestner, K. H. The evolution of Fox genes and their role in development and disease. Nat. Rev. Genet. 10, 233–240 (2009). 44. Lai, E. et al. HNF3A, a hepatocyte -enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev. 4, 1427–1436 (1990). 45. Lai, E., Prezioso, V. R., Tao, W., Chen, W. S. & Darnell, J. E. Hepatocyte nuclear factor 3a belongs to a family in mammals that is homologous to the Drosphilia homeotic gene fork head. Genes Dev. in press, 416–427 (1991). 46. Lee, C. S., Friedman, J. R., Fulmer, J. T. & Kaestner, K. H. The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944–7 (2005). 47. Ang, S. L. & Rossant, J. HNF-3β is essential for node and notochord formation in mouse development. Cell 78, 561–574 (1994). 48. Weinstein, D. C. et al. The winged-helix transcription factor HNF-3β is required for notochord development in the mouse embryo. Cell 78, 575–588 (1994). 49. Kaestner, K. H., Katz, J., Liu, Y., Drucker, D. J. & Schütz, G. Inactivation of the winged helix transcription factor HNF3a affects glucose homeostasis and islet glucagon gene expression in vivo. Genes Dev. 13, 495–504 (1999). 50. Shen, W., Scearce, L. M., Brestelli, J. E., Sund, N. J. & Kaestner, K. H. Foxa3 (Hepatocyte Nuclear Factor 3g is Required for the Regulation of Hepatic GLUT2 Expression and the Maintenance of Glucose Homeostasis during a Prolonged Fast. J. Biol. Chem. 276, 42812–42817 (2001). 51. Lee, C. S., Sund, N. J., Behr, R., Herrera, P. L. & Kaestner, K. H. Foxa2 is required for the differentiation of pancreatic α-cells. Dev. Biol. 278, 484–495 (2005). 52. Bochkis, I. M. et al. Hepatocyte-specific ablation of Foxa2 alters bile acid homeostasis and results in ER stress. Nat Med 14, 828–836 (2008). 53. Zaret, K. S. & Carroll, J. S. Pioneer transcription factors: establishing competence for gene expression. Genes Dev. 25, 2227–41 (2011). 54. Yu, F. X., Zhao, B. & Guan, K. L. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 163, 811–828 (2015). 55. Justice, R. W., Zilian, O., Woods, D. F., Noll, M. & Bryant, P. J. The Drosophila Tumor-Suppressor Gene Warts Encodes a Homolog of Human Myotonic-Dystrophy Kinase and Is Required for the Control of Cell-Shape and Proliferation. Genes Dev. 9, 534–546 (1995). 56. Xu, T., Wang, W., Zhang, S., Stewart, R. A. & Yu, W. Identifying tumor suppressors in 65  genetic mosaics: the Drosophila lats gene encodes a putative protein kinase. Development 121, 1053–63 (1995). 57. Tapon, N. et al. salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110, 467–478 (2002). 58. Kango-Singh, M. et al. Shar-pei mediates cell proliferation arrest during imaginal disc growth in Drosophila. Development 129, 5719–5730 (2002). 59. Wu, S., Huang, J., Dong, J. & Pan, D. hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts. Cell 114, 445–456 (2003). 60. Harvey, K. F., Pfleger, C. M. & Hariharan, I. K. The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis. Cell 114, 457–467 (2003). 61. Udan, R. S., Kango-Singh, M., Nolo, R., Tao, C. & Halder, G. Hippo promotes proliferation arrest and apoptosis in the Salvador/Warts pathway. Nat. Cell Biol. 5, 914–920 (2003). 62. Pantalacci, S., Tapon, N. & Léopold, P. The Salvador partner Hippo promotes apoptosis and cell-cycle exit in Drosophila. Nat. Cell Biol. 5, 921–927 (2003). 63. Huang, J., Wu, S., Barrera, J., Matthews, K. & Pan, D. The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila homolog of YAP. Cell 122, 421–434 (2005). 64. Wei, X., Shimizu, T. & Lai, Z.-C. Mob as tumor suppressor is activated by Hippo kinase for growth inhibition in Drosophila. EMBO J. 26, 1772–1781 (2007). 65. Wu, S., Liu, Y., Zheng, Y., Dong, J. & Pan, D. The TEAD/TEF family protein Scalloped mediates transcriptional output of the Hippo growth-regulatory pathway. Dev. Cell 14, 388–398 (2008). 66. Zhang, L. et al. The TEAD/TEF family of transcription factor Scalloped mediates Hippo signaling in organ size control. Dev. Cell 14, 377–387 (2008). 67. Pan, D. The hippo signaling pathway in development and cancer. Dev. Cell 19, 491–505 (2010). 68. Callus, B. A., Verhagen, A. M. & Vaux, D. L. Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation. FEBS J. 273, 4264–4276 (2006). 69. Praskova, M., Xia, F. & Avruch, J. MOBKL1A/MOBKL1B Phosphorylation by MST1 and MST2 Inhibits Cell Proliferation. Curr. Biol. 18, 311–321 (2008). 70. Chan, E. H. Y. et al. The Ste20-like kinase Mst2 activates the human large tumor suppressor kinase Lats1. Oncogene 24, 2076–2086 (2005). 71. Dong, J. et al. Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 130, 1120–33 (2007). 72. Lei, Q.-Y. et al. TAZ Promotes Cell Proliferation and Epithelial-Mesenchymal Transition and Is Inhibited by the Hippo Pathway. Mol. Cell. Biol. 28, 2426–2436 (2008). 73. Zhao, B. et al. TEAD mediates YAP-dependent gene induction and growth control TEAD mediates YAP-dependent gene induction and growth control. Genes Dev. 1962–1971 (2008). doi:10.1101/gad.1664408 74. Zhao, B. et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 21, 2747–2761 (2007). 75. Zhao, B., Li, L., Tumaneng, K., Wang, C. Y. & Guan, K. L. A coordinated 66  phosphorylation by Lats and CK1 regulates YAP stability through SCFβ-TRCP. Genes Dev. 24, 72–85 (2010). 76. McClatchey, A. I., Saotome, I., Ramesh, V., Gusella, J. F. & Jacks, T. The Nf2 tumor suppressor gene product is essential for extraembryonic development immediately prior to gastrulation. Genes Dev. 11, 1253–1265 (1997). 77. Oh, S. et al. Crucial Role for Mst1 and Mst2 Kinases in Early Embryonic Development of the Mouse. Mol. Cell. Biol. 29, 6309–6320 (2009). 78. Lee, J.-H. et al. A crucial role of WW45 in developing epithelial tissues in the mouse. EMBO J. 27, 1231–1242 (2008). 79. McPherson, J. P. et al. Lats2/Kpm is required for embryonic development, proliferation control and genomic integrity. EMBO J. 23, 3677–3688 (2004). 80. Nishio, M. et al. Cancer susceptibility and embryonic lethality in Mob1a / 1b double-mutant mice. J. Clin. Invest. 122, 4505–4518 (2012). 81. Morin-Kensicki, E. M. et al. Defects in Yolk Sac Vasculogenesis, Chorioallantoic Fusion, and Embryonic Axis Elongation in Mice with Targeted Disruption of Yap65. Mol. Cell. Biol. 26, 77–87 (2006). 82. Zhang, N. et al. Article The Merlin / NF2 Tumor Suppressor Functions through the YAP Oncoprotein to Regulate Tissue Homeostasis in Mammals. Dev. Cell 19, 27–38 (2010). 83. Benhamouche, S. et al. Nf2/Merlin controls progenitor homeostasis and tumorigenesis in the liver. Genes Dev. 24, 1718–1730 (2010). 84. Zhou, D. et al. Article Mst1 and Mst2 Maintain Hepatocyte Quiescence and Suppress Hepatocellular Carcinoma Development through Inactivation of the Yap1 Oncogene. Cancer Cell 16, 425–438 (2009). 85. Song, H. et al. Mammalian Mst1 and Mst2 kinases play essential roles in organ size control and tumor suppression. Proc. Natl. Acad. Sci. 107, (2010). 86. Lu, L. et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. 107, 1437–1442 (2010). 87. Lee, K.-P. et al. The Hippo-Salvador pathway restrains hepatic oval cell proliferation, liver size, and liver tumorigenesis. Proc. Natl. Acad. Sci. 107, 8248–8253 (2010). 88. Lee, D. et al. LATS-YAP/TAZ controls lineage specification by regulating TGFb signaling and Hnf4a expression during liver development. Nat. Commun. 7, 1–14 (2016). 89. Camargo, F. D. et al. YAP1 increases organ size and expands undifferentiated progenitor cells. Curr. Biol. 17, 2054–60 (2007). 90. Zhang, N. et al. Article The Merlin / NF2 Tumor Suppressor Functions through the YAP Oncoprotein to Regulate Tissue Homeostasis in Mammals. Dev. Cell 19, 27–38 (2010). 91. Lee, D. et al. LATS-YAP/TAZ controls lineage specification by regulating TGFb signaling and Hnf4a expression during liver development. Nat. Commun. 7, 1–14 (2016). 92. Yimlamai, D. et al. Hippo pathway activity influences liver cell fate. Cell 157, 1324–38 (2014). 93. Weisend, C. M., Kundert, J. A., Suvorova, E. S., Prigge, J. R. & Schmidt, E. E. Cre activity in fetal albCre mouse hepatocytes: Utility for developmental studies. Genesis 47, 789–792 (2009). 94. Zhao, B. et al. Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein. Genes Dev. 25, 51–63 (2011). 95. Halder, G., Dupont, S. & Piccolo, S. Transduction of mechanical and cytoskeletal cues by 67  YAP and TAZ. Nature reviews molecular cell biology 13, 591–600 (2012). 96. Dupont, S. et al. Role of YAP/TAZ in mechanotransduction. Nature 474, 179–183 (2011). 97. Zhao, B. et al. Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev. 26, 54–68 (2012). 98. Hardie, D. G., Ross, F. A. & Hawley, S. A. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 13, 251–262 (2012). 99. Mo, J.-S. et al. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat. Cell Biol. 17, 500–510 (2015). 100. Wang, W. et al. AMPK modulates Hippo pathway activity to regulate energy homeostasis. Nat. Cell Biol. 17, 490–499 (2015). 101. deRan, M. et al. Energy stress regulates Hippo-YAP signaling involving AMPK-mediated regulation of angiomotin- like 1 protein. Cell Rep. 9, 495–503 (2014). 102. Tumaneng, K. et al. YAP mediates crosstalk between the Hippo and PI(3)K–TOR pathways by suppressing PTEN via miR-29. Nat. Cell Biol. 14, 1322–1329 (2012). 103. Yu, F. X. et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150, 780–791 (2012). 104. Yu, F. et al. Protein kinase A activates the Hippo pathway to modulate cell proliferation and differentiation. Genes Dev. 1223–1232 (2013). doi:10.1101/gad.219402.113 105. Fan, R., Kim, N.-G. & Gumbiner, B. M. Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositide-dependent kinase-1. Proc. Natl. Acad. Sci. 110, 2569–2574 (2013). 106. Sudol, M. et al. Characterization of the mammalian YAP (Yes-associated protein) gene and its role in defining a novel protein module, the WW domain. Journal of Biological Chemistry 270, 14733–14741 (1995). 107. Kanai, F. et al. TAZ: A novel transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins. EMBO J. 19, 6778–6791 (2000). 108. Vassilev,  a, Kaneko, K. J., Shu, H., Zhao, Y. & DePamphilis, M. L. TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm. Genes Dev. 15, 1229–41 (2001). 109. Liu-Chittenden, Y. et al. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes Dev. 26, 1300–5 (2012). 110. Yagi, R., Chen, L. F., Shigesada, K., Murakami, Y. & Ito, Y. A WW domain-containing Yes-associated protein (YAP) is a novel transcriptional co-activator. EMBO J. 18, 2551–2562 (1999). 111. Komuro, A., Nagai, M., Navin, N. E. & Sudol, M. WW domain-containing protein YAP associates with ErbB-4 and acts as a co-transcriptional activator for the carboxyl-terminal fragment of ErbB-4 that translocates to the nucleus. J. Biol. Chem. 278, 33334–41 (2003). 112. Ferrigno, O. et al. Yes-associated protein (YAP65) interacts with Smad7 and potentiates its inhibitory activity against TGF-β/Smad signaling. Oncogene 21, 4879–4884 (2002). 113. Oh, H. et al. Genome-wide association of Yorkie with chromatin and chromatin-remodeling complexes. Cell Rep. 3, 309–18 (2013). 114. Oh, H. et al. Yorkie promotes transcription by recruiting a histone methyltransferase complex. Cell Rep. 8, 449–59 (2014). 115. Stein, C. et al. YAP1 Exerts Its Transcriptional Control via TEAD-Mediated Activation of Enhancers. PLoS Genet. 11, 1–28 (2015). 68  116. Cebola, I. et al. TEAD and YAP regulate the enhancer network of human embryonic pancreatic progenitors. Nat. Cell Biol. 17, 615–626 (2015). 117. Zanconato, F. et al. Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth. Nat. Cell Biol. 17, 1218–1227 (2015). 118. Galli, G. G. et al. YAP Drives Growth by Controlling Transcriptional Pause Release from Dynamic Enhancers. Mol. Cell 60, 328–337 (2015). 119. Kim, M., Kim, T., Johnson, R. L. & Lim, D. S. Transcriptional co-repressor function of the hippo pathway transducers YAP and TAZ. Cell Rep. 11, 270–282 (2015). 120. Kreamer, B. L. et al. Use of a low-speed, iso-density percoll centrifugation method to increase the viability of isolated rat hepatocyte preparations. In Vitro Cellular & Developmental Biology 22, 201–211 (1986). 121. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and. Methods 25, 402–408 (2001). 122. Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36 (2013). 123. Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562–578 (2012). 124. Huang, D. W., Sherman, B. T. & Lempicki, R. a. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57 (2009). 125. Huang, D. W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools : paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37, 1–13 (2009). 126. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545–50 (2005). 127. Kent, W., Sugnet, C. & Furey, T. The human genome browser at UCSC. Genome Res. 12, 996–1006 (2002). 128. Liu, T. et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, R83 (2011). 129. Dimova, D. K. & Dyson, N. J. The E2F transcriptional network: old acquaintances with new faces. Oncogene 24, 2810–2826 (2005). 130. Dang, C. V. MYC on the path to cancer. Cell 149, 22–35 (2012). 131. Hynes, N. E. & MacDonald, G. ErbB receptors and signaling pathways in cancer. Current Opinion in Cell Biology 21, 177–184 (2009). 132. Chiang, D. Y. et al. Focal gains of VEGFA and molecular classification of hepatocellular carcinoma. Cancer Res. 68, 6779–6788 (2008). 133. Filmus, J., Capurro, M. & Rast, J. Glypicans. Genome Biol. 9, 224 (2008). 134. Alder, O. et al. Hippo signaling influences HNF4A and FOXA2 enhancer switching during hepatocyte differentiation. Cell Rep. 9, 261–271 (2014). 135. Shen, Y. et al. A map of the cis-regulatory sequences in the mouse genome. Nature 488, 116–120 (2012). 136. Creyghton, M. P. et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. U. S. A. 107, 21931–6 (2010). 137. Cohen, S. PURIFICATION OF A NERVE-GROWTH PROMOTING PROTEIN FROM THE MOUSE SALIVARY GLAND AND ITS NEURO-CYTOTOXIC ANTISERUMe. 69  PNAS 46, 302–311 (1960). 138. Graus-Porta, D., Beerli, R. R., Daly, J. M. & Hynes, N. E. EebB-2, the preferred hereodimerization partner of all ErbB receptors, is a mediator of lateral signalling. EMBO J. 16, 1647–1655 (1997). 139. Yarden Y, S. M. No Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127–137 (2001). 140. Tzahar, E. et al. A hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation factor/neuregulin and epidermal growth factor. Mol. Cell. Biol. 16, 5276–5287 (1996). 141. Citri, A., Skaria, K. B. & Yarden, Y. The deaf and the dumb: The biology of ErbB-2 and ErbB-3. EGF Recept. Fam. Biol. Mech. Role Cancer 284, 57–68 (2003). 142. Shi, F., Telesco, S. E., Liu, Y., Radhakrishnan, R. & Lemmon, M. a. ErbB3/HER3 intracellular domain is competent to bind ATP and catalyze autophosphorylation. Proc. Natl. Acad. Sci. U. S. A. 107, 7692–7697 (2010). 143. Vernimmen, D., Gueders, M., Pisvin, S., Delvenne, P. & Winkler, R. Different mechanisms are implicated in ERBB2 gene overexpression in breast and in other cancers. Br. J. Cancer 89, 899–906 (2003). 144. Huang, P. et al. The role of EGF-EGFR signalling pathway in hepatocellular carcinoma inflammatory microenvironment. J. Cell. Mol. Med. 18, 218–230 (2014). 145. Ehmer, U. et al. Organ Size Control Is Dominant over Rb Family Inactivation to Restrict Proliferation InVivo. Cell Rep. 8, 371–381 (2014). 146. Heallen, T. et al. Hippo Pathway Inhibits Wnt Signaling to Restrain Cardiomyocyte Proliferation and Heart Size. Science (80-. ). 332, 458–461 (2011). 147. von Gise, A. et al. YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy. Proc. Natl. Acad. Sci. 109, 2394–2399 (2012). 148. Cai, W. Y. et al. Yes-associated protein/TEA domain family member and hepatocyte nuclear factor 4-alpha (HNF4??) repress reciprocally to regulate hepatocarcinogenesis in rats and mice. Hepatology 65, 1206–1221 (2017). 149. Cao, X. et al. YAP regulates neural progenitor cell number via the TEA domain transcription factor. Genes \& Dev. 22, 3320 (2008). 150. Judson, R. N. et al. The Hippo pathway member Yap plays a key role in influencing fate decisions in muscle satellite cells. J. Cell Sci. 125, 6009–6019 (2012). 151. Filmus, J., Capurro, M. & Rast, J. Glypicans. Genome Biol. 9, 224 (2008). 152. Cano-Gauci, D. F. & Filmus, J. Glypican-3-deficient Mice Exhibit Developmental Overgrowth and Some of the Abnormalities Typical of Simpson-Golabi-Behmel Syndrome. J. Cell Biol. 153. Capurro, M. et al. Glypican-3: A novel serum and histochemical marker for hepatocellular carcinoma. Gastroenterology 125, 89–97 (2003). 154. Hsu, H. C., Cheng, W. & Lai, P.-L. Cloning and expression of a developmentally regulated transcript MXR7 in hepatocellular carcinoma: biological significance and temporospatial distribution. Cancer Res. (1997). 155. Ikeda, M. et al. Japanese phase I study of Gc33, a humanized antibody against glypican-3 for advanced hepatocellular carcinoma. Cancer Sci. 105, (2014). 156. Abou-alfa, G. K. et al. Randomized phase II placebo controlled study of codrituzumab in 70  previously treated patients with advanced hepatocellular carcinoma. J. Hepatol. 65, 289–295 (2016). 157. Lu, L. et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. 107, 1437–1442 (2010). 158. Midorikawa, Y. et al. Glypican-3, overexpressed in hepatocellular carcinoma, modulates FGF2 and BMP-7 signaling. Int. J. Cancer 103, 455–465 (2003). 159. Capurro, M. I., Xiang, Y., Lobe, C. & Filmus, J. Glypican-3 Promotes the Growth of Hepatocellular Carcinoma by Stimulating Canonical Wnt Signaling Stimulating Canonical Wnt Signaling. 6245–6254 (2005). doi:10.1158/0008-5472.CAN-04-4244 160. Liu, B. et al. Investigation of the Role of Glypican 3 in Liver Regeneration and Hepatocyte Proliferation. Am. J. Pathol. 175, 717–724 (2009). 161. Liu, B. et al. Suppression of liver regeneration and hepatocyte proliferation in hepatocyte-targeted glypican 3 transgenic mice. Hepatology 52, 1060–1067 (2010). 162. Morford, L. A. et al. The oncofetal gene Glypican 3 is regulated in the postnatal liver by zinc fingers and homeoboxes 2 and in the regenerating liver by alpha-fetoprotein regulator 2. Hepatology 46, 1541–1547 (2007). 163. Li, L. et al. Oncogenic activation of glypican-3 by c-Myc in human hepatocellular carcinoma. Hepatology 56, 1380–1390 (2012). 164. Hayashi, H. et al. An Imbalance in TAZ and YAP Expression in Hepatocellular Carcinoma Confers Cancer Stem Cell-like Behaviors Contributing to Disease Progression. Cancer Res. 75, 4985–4997 (2015). 165. Lee, K.-F. et al. Requirement for neuregulin receptor erbB2 in neural and cardiac development. Nature 378, 394–398 (1995). 166. Threadgill, D. W. et al. Targeted Disruption of Mouse EGF Receptor : Effect of Genetic Background on Mutant Phenotype. Science (80-. ). (1995). 167. Slamon, D. J. et al. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science (80-. ). 235, 177–182 (1987). 168. Liu, J. et al. Increased expression of ErbB-2 in liver is associated with hepatitis B x antigen and shorter survival in patients with liver cancer. Int. J. Cancer 125, 1894–1901 (2009). 169. Zhang, T. et al. Hepatitis B virus X protein modulates oncogene yes-associated protein by CREB to promote growth of hepatoma cells. Hepatology 56, 2051–2059 (2012). 170. Wu, Y., Zhang, J., Zhang, H. & Zhai, Y. Hepatitis B virus X protein mediates yes-associated protein 1 upregulation in hepatocellular carcinoma. Oncol. Lett. 12, 1971–1974 (2016). 171. Scott, G. K. et al. Ets regulation of the erbB2 promoter. Oncogene 19, 6490–502 (2000). 172. Wu, J. et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res. 66, 4872–4879 (2006). 173. Bosher, J. M., Williams, T. & Hurst, H. C. The developmentally regulated transcription factor AP-2 is involved in c-erbB-2 overexpression in human mammary carcinoma. Proc. Natl. Acad. Sci. U. S. A. 92, 744–7 (1995). 174. Grooteclaes, M. et al. A new cis element is involved in the HER2 gene overexpression in human breast cancer cells. Cancer Res. 59, 2527–2531 (1999). 175. Nolens, G. et al. Ku proteins interact with activator protein-2 transcription factors and contribute to ERBB2 overexpression in breast cancer cell lines. Breast Cancer Res 11, 71  R83 (2009). 176. Tanabe, K. K. et al. Epidermal Growth Factor Gene Functional Polymorphism and the Risk of Hepatocellular Carcinoma in Patients With Cirrhosis. JAMA 299, 53–60 (2008). 177. Zhang, J. et al. YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway. Nat. Cell Biol. 11, 1444–1450 (2009). 178. Liu, Y. et al. YAP modulates TGF-β1-induced simultaneous apoptosis and EMT through upregulation of the EGF receptor. Sci. Rep. 7, 45523 (2017). 179. Song, S. et al. The hippo coactivator YAP1 mediates EGFR overexpression and confers chemoresistance in esophageal cancer. Clin. Cancer Res. 21, 2580–2590 (2015). 180. He, C. et al. YAP forms autocrine loops with the ERBB pathway to regulate ovarian cancer initiation and progression. Oncogene 1–15 (2015). doi:10.1038/onc.2015.52 181. Murakami, M. et al. A WW domain protein TAZ is a critical coactivator for TBX5, a transcription factor implicated in Holt-Oram syndrome. PNAS. 102, 18034-18039 (2005). 182. Valencia-Sama, I. et al. Hippo Component TAZ functions as a Co-repressor and Negatively Regulates Transcription through TEA Domain (TEAD) Transcription Factor. JBC. 290, 16906-16917 (2015).  72  Appendices  Appendix A  Top 20 +DOX upregulated genes. Gene Entrez -DOX +DOX Log2FC Q-value Enriched Fgfbp1 14181 0.01 217.26 14.41 0.000347  Psca 72373 0.01 178.48 14.12 0.000347  Spink4 20731 0.01 57.24 12.48 0.000347  Gpc3 14734 0.56 1102.61 10.95 0.000347 E14.5 Slc9a3 105243 0.01 9.25 9.85 0.000347  Krt4 16682 0.01 8.98 9.81 0.000347  Bex1 19716 0.01 8.47 9.73 0.000347 E14.5 Gpx2 14776 0.01 4.47 8.80 0.000347  Sftpd 20390 0.57 208.57 8.53 0.000347  Reg3b 18489 0.01 3.10 8.28 0.000347  Tceal5 331532 0.01 2.78 8.12 0.000347 E14.5 Guca2a 14915 0.01 2.75 8.10 0.000347  Rbp7 63954 0.01 2.71 8.08 0.000347  Spink3 20730 1.80 357.78 7.63 0.000347 E14.5 Pak6 214230 0.10 15.57 7.30 0.000347  Dmbt1 12945 2.75 418.67 7.25 0.000347  Krt19 16669 0.70 95.82 7.10 0.000347  Cx3cr1 13051 0.26 19.15 6.20 0.000347  Slc4a1 20533 0.12 8.83 6.15 0.000347 E14.5 Afp 11576 0.72 45.80 5.99 0.000347 E14.5         73  Appendix B  Top 20 +DOX downregulated genes. Gene Entrez -DOX +DOX Log2FC Q-value Enriched Cyp2a4 13086 1139.17 0.78 -10.51 0.000347 Adult Cyp2c29 13095 1101.56 2.33 -8.88 0.000347 Adult BC089597 216454 234.74 0.58 -8.65 0.000347 Adult Thrsp 21835 486.93 1.29 -8.56 0.000347 Adult Aspg 104816 88.75 0.29 -8.23 0.000347 Adult Ces3a 382053 484.82 1.78 -8.087 0.000347 Adult C4a 625018 42.77 0.16 -8.029 0.000347  Cyp17a1 13074 185.97 0.73 -7.99 0.000347 Adult Ces3b 13909 294.11 1.28 -7.84 0.000347 Adult Cyp2c40 13099 352.58 1.69 -7.70 0.000347 Adult Cyp2a5 13087 1524.45 7.38 -7.69 0.000347 Adult Cyp1a2 13077 446.31 2.20 -7.66 0.000347 Adult Apoa2 11807 27542.4 139.07 -7.63 0.000347 Adult Cyp2e1 13106 4150.03 26.34 -7.30 0.000347 Adult Cyp2c37 13096 483.26 3.24 -7.22 0.000347 Adult Cyp4a14 13119 34.44 0.24 -7.13 0.000347 Adult Serpina6 12401 563.09 4.09 -7.11 0.000347 Adult Upp2 76654 223.19 1.64 -7.09 0.000347 Adult Orm2 18406 115.87 0.87 -7.05 0.000347 Adult Slc22a27 171405 21.92 0.18 -6.95 0.000347 Adult           74  Appendix C  Primers used for qRT-PCR. Name Species Forward 5'to 3' Reverse 5' to 3' Yap Mouse TGGAGCAATTGCAGGTGTTTGAGG TAAGGCCACTCACTGTTGGCTTCT Gpc3 Mouse AGAAACCTTATCCAGCCGAAG AGTTCTTGTCCGTTCCAGC Ctgf Mouse GCGCCTGTTCTAAGACCTGT GGATGCACTTTTTGCCCTTCTTA Cyr61 Mouse AAGGGGTTGGAATGCAATTT TTTACAGTTGGGCTGGAAGC Her2 Mouse CGCTGCCCCAGTGGTGTGAAG GCAGCCTCGTTCGTCCAGGT Gapdh Mouse TTGTGGAAGGGCTCATGA GATGCAGGGATGATGTTC Yap Human TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT Gpc3 Human CCTTTGCTGGAATGGACAAG GCCCTTCATTTTCAGCTCAT Ctgf Human GCGTGTGCACCGCCAAAGAT CAGGGCTGGGCAGACGAACG Cyr61 Human AGCCTCGCATCCTATACAACC TTCTTTCACAAGGCGGCACTC Her2 Human AACTGCACCCACTCCTGTGT TGATGAGGATCCCAAAGACC Egfr Human GGTGCAGGAGAGGAGAACTGC GGTGGCACCAAAGCTGTATT Gapdh Human GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG        75  Appendix D  Primers used for ChIP-qPCR. Name Species Forward 5'to 3' Reverse 5' to 3' Ctgf Human TTTTCAGACGGAGGAATGCT GCCAATGAGCTGAATGGAGT Cyr61 Human CCAACCAGCATTCCTGAGAT GGAGCCCGCCTTTTATACG Ankrd1 Human CAACCTGGGAACCGAAGTAA CGATGTGATCACCACCAAAG Her2 Human AGTTGCCACTCCCAGACTTG GGGGAATCTCAGCTTCACAA Hoxa9 Human TGTACCACCACCATCACCAC CGGTTCAGGTTTAATGCCATA            76  Appendix E  Primers used for luciferase vector cloning and mutagenesis. Name Species Forward 5'to 3' Reverse 5' to 3' Gpc3-E1 Mouse CGACGCGTTATTGTGTTGTGCTCTACTCTCC CAAATGG CCGCTCGAGGGCAGCAGACATCCATGTGCTACAC Gpc3-E2 Mouse CGACGCGTCGTGTCCTTGATGCTCTGTTAT CCGCTCGAGCAGGGTGCAAGTTTCCAAATTC Gpc3-E1-mTEAD Mouse GCATGACAACGTTATGGACTAAGTTTCAGA TCTGAAACTTAGTCCATAACGTTGTCATGC Gpc3-E1-mHNF4a Mouse AGAGTCCTGGGTCCAACTTTCCTG CAGGAAAGTTGGACCCAGGACTCT Gpc3-E2-mTEAD1 Mouse CAAGAGAACACAAAACCGAGATCTGAAG CTTCAGATCTCGGTTTTGTGTTCTCTTG Gpc3-E2-mTEAD2 Mouse CAACTGGCTATTGACGAATAGAGCAAAG CTTTGCTCTATTCGTCAATAGCCAGTTG Gpc3-E2-mHNF4a Mouse TTCCCGAATAGAGATGTGTTTTGGGG CCCCAAAACACATCTCTATTCGGGAA mHer2P-F Mouse CGGGTACCTGCCTCTGATTGCATCTTGACC CCGGCTAGCCAACTTCACGCCGCACTTCC mHer2P-mTEAD1 Mouse GTTCTTTACTGGAAAAGTACCATCATCAG CTGATGATGGTACTTTTCCAGTAAAGAAC mHer2P-mTEAD2 Mouse GTTAGACATAACACTTCCCAGGCTG CAGCCTGGGAAGTGTTATGTCTAAC mHer2P-mTEAD3 Mouse CCAGTCTTGCTCAGTTGGAGG CCTCCAACTGAGCAAGACTGG hHer2P Human CCGGAGCTCGTCACCAGCCTCTGCATTTA CCGCTCGAGGGGAATCTCAGCTTCACAACT hHer2P-mTEAD Human ACTCCCAGACTTGTTCAGTTGGAGG CCTCCAACTGAACAAGTCTGGGAGT     77  Appendix F  Antibodies used for Western blot and ChIP-qPCR.  Western blot Antibody Company Catalogue Species YAP Cell Signaling Technology 12395 Mouse CTGF Santa Cruz Biotechnology sc-14939 Goat HER2 Cell Signaling Technology 2165 Rabbit HER2 (Phospho) Cell Signaling Technology 2247 Rabbit EGFR Cell Signaling Technology 2232 Rabbit Alpha-Tubulin Santa Cruz Biotechnology sc-23948 Mouse AKT Cell Signaling Technology 9272 Rabbit AKT (Phospho) Cell Signaling Technology 9271 Rabbit     ChIP-qPCR Antibody Company Catalogue Species YAP Novus Biologicals NB110-58358 Rabbit TEF-3 (TEAD4) Santa Cruz Biotechnology sc-101184 Mouse Normal Mouse IgG Santa Cruz Biotechnology sc-2025 Mouse Normal Rabbit IgG Santa Cruz Biotechnology sc-2027 Rabbit            78  Appendix G  RNA-seq and ChIP-seq libraries analysed. RNA-seq libraries  RNA-seq library Reference E14.5 hepatoblasts Alder O. et al. Cell Rep. 9, 261-271 (2014). Adult liver YAP-OE -DOX hepatocytes Unpublished YAP-OE +DOX hepatocytes ChIP-seq libraries  ChIP-seq library Tissue or cell type Reference HNF4a (GSM614632) HepG2 Schmidt D. et al. Genome Res. 20, 578-588 (2010). FOXA2 (GSM803403) Gertz J. et al. Mol Cell. 52, 25-36 (2013). TEAD4 (GSM1010875) H3K4me1 (GSM646361) Ernst J. et al. Nature. 473, 43-49 (2011). H3K4me3 (GSM646364) H3K27ac (GSM646356) HNF4a E14.5 hepatoblasts Alder O. et al. Cell Rep. 9, 261-271 (2014). FOXA2  H3K4me1 H3K4me3 H3K27ac Unpublished HNF4a Adult liver Alder O. et al. Cell Rep. 9, 261-271 (2014). FOXA2 H3K4me1 H3K4me3 H3K27ac Unpublished   79  Appendix H  Downregulation of HNF4a in YAP-OE liver. Western blot analysis of YAP, CTGF, EGFR, HNF4a, and AKT in –DOX and +DOX liver. AKT serves as the loading control. Each lane represents one biological replicate.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0357248/manifest

Comment

Related Items