Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Contribution of P/Q-type voltage-gated calcium channels to synaptic signaling in CA1 neurons of wildtype… Kass, Jennifer 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_november_kass_jennifer.pdf [ 1.48MB ]
Metadata
JSON: 24-1.0357193.json
JSON-LD: 24-1.0357193-ld.json
RDF/XML (Pretty): 24-1.0357193-rdf.xml
RDF/JSON: 24-1.0357193-rdf.json
Turtle: 24-1.0357193-turtle.txt
N-Triples: 24-1.0357193-rdf-ntriples.txt
Original Record: 24-1.0357193-source.json
Full Text
24-1.0357193-fulltext.txt
Citation
24-1.0357193.ris

Full Text

 CONTRIBUTION OF P/Q-TYPE VOLTAGE-GATED CALCIUM CHANNELS TO SYNAPTIC SIGNALING IN CA1 NEURONS OF WILDTYPE AND FAMILIAL HEMIPLEGIC MIGRAINE TYPE-1 MICE by Jennifer Kass  B.Sc. (Hons), Simon Fraser University, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Neuroscience)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  October 2017  © Jennifer Kass, 2017  ii  Abstract  P/Q-type voltage-gated calcium channels are essential for Ca2+ influx and neurotransmitter release in hippocampal synaptic transmission.  Through alternative splicing, the exclusion or inclusion of the NP splice variant determines the classification of the P-type or Q-type channels, respectively, which differ in their sensitivity to the peptide toxin ω-Agatoxin IVA (Aga-IVA).  Familial hemiplegic migraine type-1 (FHM-1) is an autosomal dominant subtype of migraine caused by gain-of-function missense mutations in the CaV2.1 subunit of P/Q-type channels.  The S218L FHM-1 mutation is associated with a particularly severe clinical syndrome which includes ataxia, generalized seizures and fatal cerebral edema, and causes a hyperpolarizing shift in channel activation resulting in an increased proportion of P/Q-type channels being open at the resting membrane potential and is predicted to increase glutamate release.  Increased sensitivity of Aga-IVA has been observed in synaptic signaling in CA1 hippocampal neurons of a S218L FHM-1 mouse model although the underlying mechanism is not known.  Here, performing subunit and splice-variant specific quantitative real-time PCR on mouse hippocampal regions, I demonstrate that CaV channel subunits and P/Q-type splice variants are not differentially expressed between WT and S218L mice.  Using whole-cell patch-clamp electrophysiology on CA1 neurons in mouse brain slices, I further show that the contribution of P/Q-, N- and R-type channels to excitatory miniature release in WT and S218L mice is highly variable.  Examining the contribution of P/Q-type channels to evoked release, I show that P/Q-type channels are an important contributor towards the rate of excitatory spontaneous action potential evoked release in WT neurons.  Further, that WT CA1 neurons exhibit a large unitary EPSC response evoked by paired-pulse stimulation and was reduced when P/Q-type channels were blocked.  In contrast, EPSC amplitude in S218L neurons tended to be iii  smaller compared to EPSC amplitudes from WT although this effect was not consistent.  Together, these data suggest that in CA1 neurons P/Q-type channels are predominant in evoked synaptic transmission in WT neurons and that the S218L mutation appears to cause decreased action potential evoked Ca2+ influx. Further investigation is required to determine whether other VGCCs act to compensate evoked release in S218L neurons.                    iv  Lay Summary  Ca2+ influx mediated by P/Q-type voltage-gated calcium channels (VGCCs) are essential for neurotransmitter release in hippocampal synaptic transmission.  Familial hemiplegic migraine type-1 (FHM-1) is caused by gain-of-function missense mutations in P/Q-type channels.  The S218L FHM-1 mutation is associated with a particularly severe clinical syndrome which includes ataxia, generalized seizures and fatal cerebral edema, and is predicted to increase glutamate release causing enhanced excitatory neurotransmission.  The goal of this study was to determine the contribution of P/Q-type channels and the impact of the S218L mutation in two modes of neurotransmitter release, miniature and evoked release.  The results show that the contribution of P/Q-, N- and R-type channels to miniature release in wildtype (WT) and S218L hippocampal neurons is highly variable.  In contrast, P/Q-type channels consistently contribute to evoked release in WT neurons but is variable in S218L neurons suggesting that other VGCCs may act to compensate evoked release in S218L neurons.            v  Preface  The design of this research project was a joint effort between myself and Drs. Terry Snutch, Stuart Cain and John Tyson. Dr. John Tyson designed the qPCR probes for the CaV2.1 (P/Q-type) splice variants, for the qPCR experiments used in Chapter 2.  I performed all experiments and analysis of the data. I also wrote this thesis including generating all figures and tables.  The dissections of hippocampal tissues used for the qPCR experiments presented in Chapter 2 were done following UBC Animal Care Committee protocols (Animal Care Certificate # A16-0127)               vi  Table of Contents Abstract ........................................................................................................................................ ii Lay Summary .............................................................................................................................. iv  Preface .......................................................................................................................................... v Table of Contents......................................................................................................................... vi List of Tables ................................................................................................................................ x List of Figures.............................................................................................................................. xi List of Abbreviations ................................................................................................................ xiii Acknowledgements .................................................................................................................. xvii Dedication................................................................................................................................. xviii Chapter 1: INTRODUCTION .................................................................................................... 1 1.1 Voltage-gated calcium channels .................................................................................. 1 1.1.1 VGCC subunits ............................................................................................. 6 1.1.2 VGCC subtypes ............................................................................................ 6 1.2. Physiological importance of P/Q-type channels at the synapse ................................. 7 1.2.1 Physiological importance of the hippocampus ............................................. 9 1.2.2 Contribution of P/Q-, N- and R-type channels at CA3-CA1 synapses ....... 11 1.3 Primary modes of neurotransmitter release ............................................................... 12 1.3.1 Spontaneous miniature release .................................................................... 13 1.3.2 Physiological functions of miniature release .............................................. 14 1.3.3 Role of Ca2+ in miniature release ................................................................ 15 1.4 Synaptic vesicle pools in neurotransmitter release .................................................... 16 1.4.1 Vesicle pools in miniature release .............................................................. 19 vii  1.5 Familial Hemiplegic Migraine .................................................................................. 19 1.5.1 Familial Hemiplegic Migraine Type-1........................................................ 21 1.5.2 Consequence of the S218L mutation on P/Q-type channels ...................... 22 1.5.3 The role of cortical spreading depression in the pathophysiology of FHM-1............................................................................................................................. 24  1.6 Alternative Splicing ................................................................................................... 24 1.6.1 Alternative of CaV2.1 (P/Q-type) channels ................................................. 26 1.7 Consequences of the S218L mutation concerning calcium dependent facilitation ... 31 1.8 Thesis hypotheses and project significance ............................................................... 33 1.8.1 Hypotheses .................................................................................................. 33 1.8.2 Significance of project ................................................................................ 33 Chapter 2: CaV SUBUNITS ARE NOT DIFFERENTIALLY EXPRESSED IN THE HIPPOCAMPUS......................................................................................................................... 35 2.1 Introduction ................................................................................................................ 35 2.2 Methods....................................................................................................................... 35 2.2.1 Dissections, RNA isolation and cDNA generation ..................................... 36 2.2.2 Quantitative real-time PCR procedure and probes ..................................... 37 2.2.3 Analysis of qPCR data ................................................................................ 38 2.3 Results ........................................................................................................................ 38 2.3.1 CaV α1, α2δ, and β subunit transcripts are not differentially expressed between WT and S218L mice............................................................................... 38  2.3.2 CaV2.1 splice-variant transcripts are not differentially expressed between WT and S218L mice............................................................................................. 41  2.4 Discussion ................................................................................................................. 42 viii  Chapter 3: CONTRIBUTION OF P/Q-, N- AND R-TYPE CHANNELS TO MINIATURE RELEASE IN CA1 NEURONS IN WT AND S218L MICE.................................................. 44 3.1 Introduction ................................................................................................................ 44 3.2 Methods....................................................................................................................... 45 3.2.1 Animals ....................................................................................................... 45 3.2.2 Acute Brain Slice Preparation ..................................................................... 45 3.2.3 Acute Brain Slice Electrophysiology........................................................... 45 3.2.4 Toxins ......................................................................................................... 46 3.2.5 Data Analysis .............................................................................................. 47 3.3 Results ........................................................................................................................ 47 3.3.1 mEPSC amplitude is increased in CA1 neurons from S218L compared to wildtype mice........................................................................................................ 47  3.3.2 Blockade of P-, Q-, N- and R-type channels has differential effects on mEPSC inter-event interval ................................................................................. 49  3.3.3 Decreased mEPSC inter-event interval observed after specific VGCC blockade is unlikely due to other VGCCs increasing their contribution to miniature release................................................................................................... 52  3.4 Discussion ...................................................................................................... 54  Chapter 4: CONTRIBUTION OF P/Q-TYPE CHANNELS TO EVOKED SYNAPTIC ACTIVITY IN CA1 NEURONS IN WT AND S218L MICE................................................. 62  4.1 Introduction ................................................................................................................ 62 4.2 Methods....................................................................................................................... 63 4.2.1 Animals ....................................................................................................... 63 4.2.2 Acute Brain Slice Preparation ..................................................................... 63 4.2.3 Acute Brain Slice Electrophysiology........................................................... 64 4.2.4 Toxins ......................................................................................................... 65 ix  4.2.5 Data Analysis .............................................................................................. 65 4.3 Results ........................................................................................................................ 66 4.3.1 sAPEPSC amplitude is increased in WT CA1 neurons ................................ 66  4.3.2 P/Q-type channels contribute to spontaneous action potential evoked synaptic activity in WT and S218L mice ............................................................. 68  4.3.3 P/Q-type channels contribution to evoked synaptic activity in WT and S218L mice .......................................................................................................... 69  4.4 Discussion .................................................................................................................. 73 Chapter 5: DISCUSSION ......................................................................................................... 76 5.1 Main findings ............................................................................................................. 76 5.2 Potential physiological relevance of findings ............................................................ 79 5.3 Potential limitations ................................................................................................... 83 5.4 Future directions ........................................................................................................ 84 5.5 Conclusions ................................................................................................................ 87 References ....................................................................................................................................88           x  List of Tables  Table 1-1 Subunit composition, function and diseases of VGCC subtypes ................................. 5  Table 1-2 Summary of mEPSC amplitude and frequency in WT and S218L strain neurons ..... 24  Table 2-1: Sequences for qPCR probes. ...................................................................................... 37                                        xi  List of Figures  Figure 1.1 Proposed subunit composition and transmembrane topology of VGCC subunits ...... 2  Figure 1.2 Molecular model of the active zone protein complex and its relation to the synaptic vesicle fusion machinery, VGCCs, and synaptic cell-adhesion molecules .................................. 9     Figure 1.3 Schematic diagram of connections within the hippocampus ..................................... 10  Figure 1.4 The three primary modes of neurotransmitter release: synchronous release, asynchronous release, and miniature release ............................................................................... 13  Figure 1.5 Presynaptic determinants of synaptic strength ........................................................... 17  Figure 1.6 Vesicle pool release dynamics and terminology ........................................................ 18  Figure 1.7 Functional roles of proteins encoded by genes involved in FHM at a CNS glutamatergic synapse .................................................................................................................. 20  Figure 1.8 Types of Alternative Splicing Events ......................................................................... 26    Figure 1.9 Sites of alternative splicing in the α1A subunit of P/Q-type channels in rat and human CNS .............................................................................................................................................. 27    Figure 2.1 P/Q-type channels are not differentially expressed between WT and S218L mice in the hippocampus .......................................................................................................................... 39  Figure 2.2 CaV α2δ subunits are not differentially expressed between WT and S218L mice in the hippocampus ................................................................................................................................ 40  Figure 2.3 CaV β subunits are not differentially expressed between WT and S218L mice in the hippocampus ................................................................................................................................ 40  Figure 2.4 The –NP splice variant is not differentially expressed between WT and S218L mice in the hippocampus .......................................................................................................................... 41  Figure 3.1 mEPSC amplitude is increased in S218L CA1 neurons compared to WT neurons ... 48  Figure 3.2 Blockade of P-type channel decreases mEPSC inter-event interval in S218L .......... 50    Figure 3.3 Blockade of P/Q-type channels increases mEPSC inter-event interval in WT........... 50    Figure 3.4 Blockade of N-type channels decreases mEPSC inter-event interval in WT.............. 51    Figure 3.5 Blockade of R-type channels decreases mEPSC inter-event interval in WT and S218L............................................................................................................................................ 52   xii  Figure 3.6 Blockade of P/Q-type channels occludes the decrease in inter-event interval when N-type channels are blocked in WT ................................................................................................. 53   Figure 3.7 N-type channels may be compensating for P-type channel block in S218L neurons  54  Figure 4.1 sAPEPSC amplitude is decreased in S218L CA1 neurons .......................................... 67    Figure 4.2 P/Q-type channels contribute to spontaneous action potential evoked synaptic activity in WT and S218L neurons ........................................................................................................... 68  Figure 4.3 P/Q-type channels contribute to evoked synaptic activity in WT and S218L CA1 neurons ......................................................................................................................................... 70  Figure 4.4 Synaptic transmission is decreased at 10 Hz stimulation when P/Q-type channels are blocked in WT and S218L mice .................................................................................................. 72                                xiii  List of Abbreviations  aCSF   artificial cerebral spinal fluid  ADP  afterdepolarization  Aga-IVA  ω-Agatoxin-IVA   AP  action potential   ANOVA  Analysis of variance  AS  Alternative splicing  ASD  Autism Spectrum Disorders   ATP   Adenosine triphosphate  BDNF  brain-derived neurotrophic factor    Ca2+   calcium ion  CaSs  Ca2+ sensor proteins  CaV   voltage-gated calcium channel  CaM  calmodulin  CBD  calmodulin binding domain  cDNA   complementary DNA  CDF   calcium-dependent facilitation  CDI   calcium-dependent inactivation  CNS   Central Nervous System  CO2   Carbon dioxide  Cq   Quantification cycle  CSD  Cortical spreading depression  DAG  diacylglycerol   xiv  DHP  dihydropyridine  DNA   Deoxyribonucleic acid  EC   excitation-contraction   EGTA  Ethylene Glycol-bis(2-aminoethylether)-N,N,N’,N’-Tetraacetic Acid  EPSPs  excitatory post synaptic potentials   EPSCs  excitatory post synaptic currents  eEPSCs evoked EPSCs   FHM   Familial hemiplegic migraine type   FHM-1  Familial hemiplegic migraine type 1  GAPDH  Glyceraldehyde 3-phosphate dehydrogenase  GPCR  G-protein coupled receptor   GPI  glycophosphatidylinositol   GVIA   ω-conotoxin GVIA  HEK   Human Embryonic Kidney  HEPES  4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid  HVA   High voltage-activated  LTP  long term potentiation   LVA   Low voltage-activated  mEPSCs miniature excitatory post synaptic currents   mPSCs  miniature postsynaptic currents   mL   milliliter  mM   millimolar  mm   millimeter  xv  mOsm/kg  milliosmole per kilogram  mRNA  messenger RNA  ms   millisecond  mV   millivolt  N   number of “release-ready” vesicles  nM   nanomolar  nm  nanometer  NMDA N-methyl-D-aspartate  NP   Asparagine, Proline  P  Postnatal day  PKA  cAMP-dependent protein kinase   PKC  Protein kinase C    pA   picoampere  PF-PC  parallel fiber-to-Purkinje cell   Pr   release probability   PCR   polymerase chain reaction  pre-mRNA  precursor mRNA  qPCR   quantitative real-time PCR  RNA   ribonucleic acid  RP  recycling pool   RRP   readily releasable pool   RtP   resting pool   s  second  xvi  sucrose-aCSF sucrose-artificial cerebral spinal fluid   SEM   standard error of the mean  sAPPSCs  spontaneous action potential evoked postsynaptic currents  sAPEPSCs  spontaneous action potential evoked excitatory postsynaptic currents  SD   Spreading depression   SSTR   Serine, Serine, Threonine, Arginine  TrkB  tyrosine kinase B   TRP  total recycling pool   TTX  tetrodotoxin   VGCC  voltage-gated calcium channel                              xvii  Acknowledgements  Thank you to Dr. Terry Snutch for supervising my studies and for his guidance, feedback, advice and encouragement. I also thank my committee members Drs. Brian MacVicar and Yu Tian Wang for their valuable feedback. Thanks to all past and present Snutch Lab members.  Thank you to Dr. Stuart Cain for his help in the electrophysiological experiments including understanding of electrophysiological theories, protocol design, troubleshooting and the analysis used in my electrophysiology experiments.  Thank you to Dr. John Tyson for designing the CaV2.1 (P/Q-type) splice variant probes used in my experiments and for his help in the qPCR experiments and their analysis. Thank you to Lucy Yang and Ray Gopaul for all of their work in maintaining the animal colonies used in these experiments.  Additional thanks to Lucy Yang for working with me to feel more comfortable and confident handling mice. Thank you to Karen Jones for answering my questions and especially for the endless hours of genotyping involved for these experiments.   Thank you to my wonderful family and friends for their endless support and encouragement throughout this process. To my friends in Neuroscience that I’ve been lucky enough to make along the way, thank you for your friendship, advice and help throughout this journey. Lastly, I thank you, the reader, for your interest in my work.           xviii  Dedication  Dedicated to all my extended family, for everyone’s constant support, advice and encouragement.                                       1  Chapter 1: INTRODUCTION  Calcium ions (Ca2+) impact nearly every aspect of cellular physiology including having numerous regulatory functions (Clapham, 2007).  Voltage-gated Ca2+ channels (VGCCs) are a highly conserved family of ion channels in which channel opening results in Ca2+ influx along its electrochemical gradient (Simms and Zamponi, 2014). The entry of Ca2+ into cells serves dual roles by directly affecting membrane potential to regulate excitability, and also mediating an abundance of down-stream effector proteins and signaling pathways to regulate physiological functions such as cell growth and differentiation, muscle contraction, neurotransmitter and hormone release, DNA transcription, cell motility and apoptosis (Clapham, 2007; Tyson and Snutch, 2012). Combinatorial inclusion of splice-variants also adds complexity to the repertoire of possible VGCCs (Tyson and Snutch, 2012).  VGCCs are critical for brain function, and genetic mutations caused by inappropriate expression or dysfunctions results in several neurological disorders including migraine, pain, epilepsy and ataxia (Lorenzon and Beam, 2000).   1.1 Voltage-gated calcium channels Voltage-gated Ca2+ channels (VGCCs) are the primary contributor of depolarization-induced Ca2+ entry into cells (Simms and Zamponi, 2014).  Under normal resting conditions, the intracellular concentration of free Ca2+ is in the 100 nM range due to the action of Ca2+-buffering proteins and the sequestration of Ca2+ into intracellular stores (Clapham 2007).   Rapid increases in localized intracellular Ca2+ concentrations mediated by VGCCs increases the intracellular Ca2+ concentration into the micromolar range depolarizing cells, and also serves as a second messenger initiating a wide range of Ca2+-dependent processes (Simms and Zamponi, 2014). 2  VGCCs are classified into two main categories; high voltage activated (HVA) channels which open from resting potential in response to membrane depolarizations generally to thresholds positive to approximately -40 mV, and low voltage-activated (LVA) channels that activate near resting membrane potentials with thresholds generally in the range of -70 mV. (Armstrong and Matteson 1985, Bean 1985).  HVA channels are heteromultimeric protein complexes formed by the assembly of a pore-forming α1 subunit which is the largest subunit, and the ancillary α2δ, β, and γ subunits. In contrast, functional LVA channels lack the ancillary subunits (Figure 1.1) (Catterall 2005).   Figure 1.1 Proposed subunit composition and transmembrane topology of VGCC subunits.  HVA channels are heteromultimers composed of a pore-forming CaVα1 subunit that co-assembles with ancillary CaVα2δ, CaVβ and possibly CaVγ subunits, plus calmodulin (CaM), which has been omitted for simplicity; LVA channels function as CaVα1 subunit monomers. The α1 subunit consists of four major transmembrane domains (I–IV) that are connected by cytoplasmic linkers. Each domain contains of six membrane-spanning helices and a re-entrant pore loop (shown in green).  The fourth transmembrane segment in each domain contains positively charged amino acids in every third position and forms the voltage sensor.  Key protein 3  interaction sites with the α1 subunit are indicated by numbers: (1) N-terminal calmodulin association site in L-type channels, (2) β subunit interaction domain in all HVA channels, (3) Synaptic protein interaction (synprint) site present in CaV2 channels, (4) PreIQ-IQ and IQ motifs in CaV1 and CaV2 channels that associate with calmodulin, (5) Scaffolding protein interaction sites in CaV2 channels. The α2δ subunit is attached to the extracellular leaflet of the plasma membrane via a GPI anchor. The β subunit contains conserved interacting GK and SH3 domains that are separated by regions that are more variable among different β-subunit isoforms. The γ subunit contains four membrane-spanning helices.  (Figure adapted from Simms BA, Zamponi GW (2014) Neuronal voltage-gated Ca2+ channels: structure, function, and dysfunction. Neuron 82(1):24-45.)  1.1.1 VGCC subunits The α1 subunit is the key determinant of VGCC subtype and contains the conduction pore, the voltage sensing and gating apparatus, and most of the known sites of channel regulation by second messengers, drugs, and toxins (Simms and Zamponi, 2014).  There are ten CaVα1 subunits which all share common architecture and topology organized into four homologous domains (I-IV) (Catterall, 2011).  Each domain consists of six transmembrane α-helical segments (S1-S6), and a membrane-associated P loop between S5 and S6.  Segments S1-S4 function as the voltage sensor module with the positively charged S4 segment being especially important for voltage dependent activation, while segments S5 and S6 and the membrane re-entrant P loop between them forms the permeation pathway (Simms and Zamponi).  Each of the P loop regions contains highly conserved negatively charged amino acid residues that cooperate to form a pore highly selective for permeant cations such as Ca2+, barium and strontium (Ellinor et al., 1995), and that also interact with non-permeant divalent ions such as cadmium (Lansman et al., 1986).  Intracellular loops of various length between segments and domains show the greatest sequence variation among α1 subunits and contain important sites for second messenger regulation of channel function, and for protein-protein interactions with regulatory elements such as G proteins and protein kinases (Zamponi et al., 1997) 4  The α2δ subunits are extrinsic membrane glycoproteins with several glycosylation sites and hydrophobic sequences (Dolphin, 2013).  There are four main types of α2δ subunits (α2δ1–α2δ4) each encoded by a single gene (Dolphin, 2013).  The α2δ pre-polypeptide is post-translationally cleaved into α2 and δ subunits that are then linked via a disulfide bond and attached to the extracellular leaflet of the plasma membrane via a glycophosphatidylinositol (GPI) membrane anchor, to yield the mature form of the α2δ subunit (Davies et al., 2010).  The α2δ subunits enhance the cell surface expression of α1 subunits, and also have small and less well-defined effects on the kinetics and voltage dependence of gating (Kadurin et al., 2012). There are four known CaVβ subunits (β1–β4) (Buraei and Yang, 2010).  The β subunits are cytosolic hydrophilic proteins of 50-65 kDa that contain conserved GK and SH3 domains, and associates with the HVA α1 subunit in the domain I-II linker (Pragnell et al., 1994; Van Petegem et al., 2004).  The β subunits greatly enhances cell surface expression of HVA α1 subunits through increased trafficking to the cell surface, and also affect the kinetics and voltage dependences of activation and inactivation (Brice and Dolphin, 1999; Buraei and Yang, 2010). The γ subunits are glycoproteins with four transmembrane segments and have been reported to be components of the skeletal muscle L-type VGCC complex (Sharp and Campbell, 1989; Arikkath and Campbell, 2003).  As many as seven potential γ isoforms have been identified in neuronal tissue albeit their functional role is least well defined (Chu et al., 2001; Rousset et al., 2001).        5  Ca2+ current type Channel name α1 subunit Gene name Specific blockers Physiological function Inherited diseases L CaV1.1    CaV 1.2          CaV 1.3       CaV 1.4  α1S    α1C          α1D       α1F CACNA1S    CACNA1C          CACNA1D       CACNA1F DHPs, Nimodipine, Nifedipine (for all L-types) EC coupling in skeletal muscle, regulation of transcription  EC coupling in cardiac and smooth muscle, endocrine secretion, neuronal Ca2+ transients in cell bodies and dendrites, regulation of enzyme activity, regulation of transcription  Endocrine secretion, cardiac pace-making, neuronal Ca2+ transients in cell bodies and dendrites, auditory transduction  Visual transduction    Hypokalemic periodic paralysis   Cardiac arrhythmia with developmental abnormalities, Timothy syndrome and autism spectrum disorders (ASD)      Incomplete X-linked congenital stationary night blindness  P/Q           N    R CaV 2.1           CaV 2.2    CaV2.3  α1A           α1B    α1E CACNA1A           CACNA1B    CACNA1E Aga-IVA          GVIA   SNX-482 Ni2+ (low μM concentration)  Neurotransmitter release, Dendritic Ca2+ transients,          Neurotransmitter release, Dendritic Ca2+ transients,   Neurotransmitter release, Dendritic Ca2+ transients,  Familial hemiplegic migraine type 1 (FHM1), Episodic ataxia type-2 (EA-2), spinocerebellar ataxia-6 (SCA6), episodic and progressive ataxia  T CaV 3.1  CaV 3.2    CaV 3.3  α1G  α1H    α1I CACNA1G  CACNA1H    CACNA1I Ni2+ (high μM concentration),   Ni2+ (low μM concentration),   Ni2+ (high μM concentration),  Pacemaking and repetitive firing  Pacemaking and repetitive firing     ASD, child hood absence epilepsy, idiopathic generalized epilepsy Table 1-1 Subunit composition, function and diseases of VGCC subtypes.  There are ten 6  types of VGCCs encoded by different genes and can be divided into three family groupings: CaV1, CaV2 and CaV3. Each family contains multiple members that can differ in physiological functions and functional properties such as voltage-dependence, kinetics, modulation, expression and pharmacology. Abbreviations: DHP, dihydropyridine; Aga-IVA, ω-Agatoxin IVA a peptide isolated from the venom of the American funnel web spider Agelenopsis aperta; GVIA,            ω-conotoxin GVIA from the cone snail Conus geographus; SNX-482, a synthetic version of a peptide toxin from the tarantula Hysterocrates gigas.  1.1.2 VGCC subtypes Mammalian α1 subunits derive from ten different genes organized into three major subfamily groupings based upon sequence homology, termed CaV1, CaV2, and CaV3 (Snutch and Reiner, 1992).  The subfamily groupings differ in expression patterns, voltage-dependence, kinetics, conductance, and pharmacological properties (Table 1-1) (Ertel et al., 2000).  Members of the CaV1 channel family encode for three neuronal L-type channels, termed CaV1.2, CaV1.3, and CaV1.4, and an isoform specific for skeletal muscle, CaV1.1 which underlies excitation-contraction (EC) (Mikami et al., 1998).  L-type channels are HVA, display slow voltage-dependent gating characteristics and are sensitive to a number of different DHP antagonists and agonists (Randall and Tsien, 1995).   The CaV2 channel family consists of three members, CaV2.1, CaV2.2 and CaV2.3.  Through alternative splicing, the exclusion or inclusion of the NP splice variant determines the classification of the P-type or Q-type CaV2.1 (P/Q-type) channel, respectively (Bourinet et al., 1999).  P- and Q-type channels differ in their sensitivity to the peptide toxin Aga-IVA with the P-type isoform having a significantly higher sensitivity compared to the Q-type isoform (Bourinet et al., 1999). CaV2.2 channels conduct N-type current (Williams et al., 1992) and are selectively blocked by the cone snail toxin Ctx-GVIA (GVIA).  CaV2.3 channels conduct R-type current and are inhibited by SNX-482, a peptide from Hyristocrates Gigas tarantula venom (Soong et al., 1993; Bourinet et al., 2001).  P/Q- and N-type VGCCs have intermediate voltage 7  dependence and rate of inactivation, which are more negative and faster than L-type channels but more positive and slower than T-type currents.  In contrast, R-type channels activate at more negative potentials and with slower gating kinetics (Soong et al., 1993; Li et al., 2007). The CaV3 channels (CaV3.1, CaV3.2, and CaV3.3) are LVA channels and designated T-type channels (Perez-Reyes et al., 1998).  T-type channels can be distinguished by their sensitivity to nickel, and their relative resistance to block by cadmium ions which blocks all HVA channels in the low micromolar range (Nowycky et al., 1985).  In comparison to HVA channels, T-type channels activate at more negative membrane potentials, inactivate rapidly, deactivate slowly, and have smaller single channel conductance (Carbone and Lux, 1984).  1.2 Physiological importance of P/Q-type channels at the synapse  Synapses are intercellular interfaces between presynaptic and postsynaptic cells, (Südhof, 2012).  Morphologically, synapses resemble an intercellular junction with precisely opposed pre- and postsynaptic specializations that contain electron-dense material on their plasma membranes (Gray, 1963).  Neurons communicate with each other primarily through fast chemical synapses.  In this mode of neurotransmission, called synchronous release (Figure 1.4), an action potential (AP) generated near the cell body propagates down the axon and activates presynaptic VGCCs triggering the rapid fusion of synaptic vesicles and release of neurotransmitter into the synaptic cleft, which is ultimately detected by receptors on the postsynaptic cell (Zucker and Regehr, 2002).  Ca2+ entering through P/Q- and N-type channels in response to an AP are the main contributor of the presynaptic Ca2+ current responsible for initiating synaptic transmission at fast conventional synapses (Catterall and Few, 2008).  R-type channels also contribute to the presynaptic Ca2+ currents, although its contribution appears to be smaller and more variable (Li et al., 2007).  P/Q-type channels are predominant at most synapses formed by neurons of the 8  mammalian central nervous system (Olivera 1994; Dunlap, 1995).  N-type channels are important at synapses in the peripheral nervous system, and at some central synapses including a subset of inhibitory interneurons on the hippocampus (Poncer et al., 1997).   Exocytosis of synaptic vesicles is restricted to the section of the presynaptic plasma membrane containing the electron-dense material, which is termed the “active zone” (Couteaux and Pecot-Dechavassine, 1970).  Ca2+-triggered synaptic vesicle exocytosis depends on the assembly of the SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) complex, which must be in close proximity to VGCCs to receive the Ca2+ signal (Figure 1.2) (Catterall and Few, 2008).  The predominant presynaptic t-SNARE proteins required for fusion of synaptic vesicles with the presynaptic plasma membrane are syntaxin-1 and SNAP-25 on the plasma membrane, and synaptobrevin 2 (also called VAMP2) on the synaptic vesicle (Sollner et al., 1993).  SNARE proteins and the synaptic vesicle form a tight complex with their α-helical SNARE motifs bridging the membranes to fuse (Südhof and Rothman, 2008).  Munc18-1 is the main S/M protein at vertebrate synapses where it engages in multiple interactions with syntaxin-1 and with SNARE complexes (Weber et al., 1998).   In many cases, these fusion proteins directly interact with the intracellular domains of presynaptic VGCCs channels, more specifically in the synprint site (Figure 1), placing VGCCs in close proximity to synaptic vesicles (Rettig et al., 1996; Simms and Zamponi, 2014.  Both P/Q- and N-type channels co-localize densely with syntaxin-1 at presynaptic terminals (Westenbroek et al., 1995).  Maturation into a release-ready SNARE complex also requires a Ca2+ sensor, the synaptotagmins, providing Ca2+-dependent regulation of the fusion machinery (Catterall and Few, 2011).  Synaptotagmins-1, -2, -3, and -9 are believed to serve as the Ca2+ sensors for fast synchronous neurotransmitter release (Südhof, 2004). 9   Figure 1.2 Molecular model of the active zone protein complex and its relation to the synaptic vesicle fusion machinery, VGCCs, and synaptic cell-adhesion molecules.  Interactions between active zone proteins as well as the core fusion proteins are depicted schematically. (Figure adapted from Südhof T (2012) The Presynaptic Active Zone. Neuron 75(1):11-25.)  1.2.1 Physiological importance of the hippocampus.  The hippocampus is a subcortical limbic structure located in the temporal cortex that is closely related to stress adaptation and classically known to be involved in memory, learned behavior, and seizure activity (Malecki et al., 2013).  The hippocampus has also been implicated in pain processing, anxiety and stress regulation (Leuner et al., 2010; Malecki et al., 2013). The hippocampus shows an impressive capacity for structural reorganization, and remains structurally plastic throughout life (Leuner et al., 2010).    The hippocampus is widely implicated in spatial memory (i.e. the association of particular spatial locations within an environment with events or outcomes) (Bannerman et al., 2014).  It has been suggested that associative memories are stored as changes in the strength of the synaptic connections between neurons (Hebb, 1949). The discovery that high-frequency 10  stimulation of an input pathway can produce long lasting changes in synaptic efficacy gave rise to long term potentiation (LTP) becoming the dominant experimental model of the cellular mechanisms of learning (Bliss and Lomo, 1973).  The notion that LTP (or an LTP-like mechanism) in the hippocampus supports associative spatial memory formation (that is, associating particular spatial locations within a cognitive map with particular events, outcomes or stimuli) has been widely accepted (Martin et al., 2000).   Figure 1.3 Schematic diagram of connections within the hippocampus. (A) Neuronal inputs enter the hippocampus through the perforant path (1) which synapse with dendrites of dentate granule cells and also with apical dendrites of CA3 pyramidal cells.  Dentate granule cells project via mossy fibres (2) to CA3 pyramidal neurons.  CA3 pyramidal neurons project via the Schaffer collaterals (3) to CA1 pyramidal neurons, which in turn have connections (4) to the subiculum.  In the evoked experiments in this thesis, Schaffer collaterals were stimulated and patch clamp recordings were made from the CA1 soma.  (B) CA1 pyramidal neuron structure and domains of synaptic input.  (Figure (A) adapted from Rolls ET (2010) Attractor Networks. Wiley Interdiscip Rev Cogn Sci 1(1):119-134. Figure (B) adapted from Spruston N (2008) Pyramidal neurons; dendritic structure and synaptic integration. Nat Rev Neurosci 9:206-221.    11  1.2.2 Contribution of P/Q-, N- and R-type channels at CA3-CA1 synapses  CA1 neurons receive input on the apical tuft from the entorhinal cortex through the perforant pathway and from the thalamic nucleus reuniens, while basal and proximal dendrites receive input from CA3 neurons through Schaffer collateral axons (Amaral and Lavenex, 2007).  CA3 neurons distant to CA1 project primarily to apical dendrites while CA3 neurons that are closer to CA1 project primarily to basal dendrites, although the functional significance of this anatomical arrangement remains unknown (Ishizuka et al., 1990; Li et al., 1994).  Pyramidal neurons are covered with thousands of dendritic spines that constitute the postsynaptic site for excitatory glutamatergic synapses (Spruston, 2008).  Ca2+ imaging data has indicated that Ca2+ currents through P/Q-type channels contributes ~50% of the total Ca2+ influx, and Ca2+ currents through N-type channels contributes to ~35% of the total presynaptic Ca2+ entry at hippocampal CA3-CA1 Schaffer collateral terminals (Qian and Noebels, 2000, 2001).  Proportional to their contribution to presynaptic Ca2+ entry, P/Q- and N-type channels also both substantially contribute to neurotransmitter release at this synapse.  The contribution to synaptic transmission determined by recording extracellular field excitatory post synaptic potentials (EPSPs) from wildtype (WT) adult mice (age 5-9 months) in the presence of 1 μM Ctx-GVIA, and subsequent exposure to 2 μM ω-Conotoxin MVIIC (MVIIC) which blocks N- and P/Q- type channels, determined that N-type channels contribute ~35% of synaptic transmission and P/Q-type channels contribute to ~40% of synaptic transmission (Qian and Noebels, 2000).  It has also been found that N- and Q-type channels (rather than P-type channels) are predominant in mediating synaptic transmission at the CA3-CA1 synapse, and has been suggested that cooperation may occur among multiple types of VGCCs in the control of transmitter release and that may be advantageous for precise regulation of the strength- or 12  frequency-dependence of synaptic function (Wheeler et al., 1994).  The contribution of R-type channel determined by recording excitatory post synaptic currents (EPSCs) from CA3 neurons have found that blockade of R-type channels by both SNX-482 and low concentrations of NiCl2 reduced EPSC amplitude ~50% (Gasparini et al., 2001).  However, this finding was not consistent as low concentrations of NiCl2 failed to modify field EPSPs evoked in CA1 neurons by Schaffer collateral stimulation (Oliet et al., 1997).  R-type channels have also been found to be important in generating the afterdepolarization (ADP) which follows after an action potential, and in many cells, contributing to intrinsic burst firing (Metz et al., 2005).  1.3 Primary modes of neurotransmitter release  The three primary modes of neurotransmitter release are synchronous release, asynchronous release and spontaneous miniature release (referred to as miniature release).  Synchronous release is action potential mediated, and is the component of fast synaptic transmission with most vesicle fusion and neurotransmitter release occurring within hundreds of microseconds after an action potential invades a presynaptic bouton (Figure 1.4) (Sabatini and Regehr, 1996). At most synapses, synchronous release accounts for almost all (>90%) release at low-frequency stimulation (Atluri and Regehr, 1998).  Asynchronous release persists for tens of milliseconds to tens of seconds after an action potential or series of action potentials (Atluri and Regehr, 1998).  This discussion will focus on miniature release, which occurs in the absence of presynaptic depolarization from an action potential.  The release rate for miniature release is approximately 10-3 s-1, which is much slower compared to synchronous rates which can be as high as 1 vesicle per 500 us, or >103 s-1 (Figure 1.4) (Kaeser and Regehr, 2014).  However, it is difficult to relate spontaneous release to evoked release, which may involve additional regulatory 13  elements, different Ca2+ sensors and Ca2+ independent components, and may involve a separate vesicle pool (Kaeser and Regehr, 2014).   Figure 1.4 The three primary modes of neurotransmitter release: synchronous release, asynchronous release, and miniature release.  Different types of synaptic transmission are illustrated with simulated data. (a) Stimulation (arrowhead) evokes synchronous and asynchronous release. (b) Sponanteous (miniature) release is shown on a much slower time scale.  The inset shows a miniature postsynaptic current on an expanded timescale.  Abbreviations: mPSC, miniature PSC; PSC, postsynaptic current. (Figure adapted from Kaeser PS, Regehr WG (2014) Molecular mechanisms for synchronous, asynchronous, and spontaneous neurotransmitter release. Annu Rev Physiol 79:333-363.)  1.3.1 Spontaneous miniature release A measure of miniature release is provided by spontaneous synaptic currents recorded in the presence of tetrodotoxin (TTX) to block voltage-gated Na+ channels and prevent action potentials (Kaeser and Regehr, 2014).  The resulting synaptic currents are referred to as miniature postsynaptic currents (mPSCs).  Synaptic currents measured in the absence of TTX consisting of a combination of spontaneous vesicle fusion and fusion driven by the spontaneous firing of presynaptic cells and are called spontaneous action potential evoked postsynaptic 14  currents (sAPPSCs), although little is currently known about the synaptic mechanisms mediating this type of release (Kaeser and Regehr, 2014). The average quantal size (amplitude) is the response of the postsynaptic membrane to a single quantum of transmitter, and the average event frequency is thought to represent the product of the number of release sites and the properties of release (Figure 1.4) (Kaeser and Regehr, 2014).    1.3.2 Physiological functions of miniature release At glutamatergic synapses, several functional roles for miniature glutamate release have been proposed in regulating dendritic protein synthesis and in homeostatic plasticity. In hippocampal slice cultures, miniature glutamate release acts as a trophic factor to prevent the loss of dendritic spines by activating AMPA (α-amino-3-hydroxy-5- methyl-4-isoxazolepropionic acid) receptors (McKinney et al., 2009).  Miniature release also restricts the diffusion of GluR1 AMPA receptors at active synapses, regulating the number and type of AMPA receptors present at synapses in cultured hippocampal neurons (Ehlers et al., 2007). In cultured hippocampal pyramidal cells, miniature glutamate release activates receptors and tonically suppresses local protein synthesis in dendrites adjusting synaptic strength (Sutton et al., 2006).  In cultured hippocampal neurons, high-level spontaneous axonal glutamate release can signal at long range to NMDA (N-methyl-D-aspartate) receptors on developing dendrites prior to synapse formation and axodendritic contact, indicating an important role for early miniature release in the growth and formation of dendritic arbors (Andreae et al., 2015).     15  1.3.3 Role of Ca2+ in miniature release  Components of miniature release may be Ca2+-dependent or -independent, and can depend on either bulk cytosolic Ca2+ or high local Ca2+ concentrations.  Synchronous release is steeply dependent on Ca2+ (n ~ 4) (Neher and Sakaba, 2008).  However, miniature release rates are much less steeply dependent on extracellular Ca2+ (n ~ 0.3-1.5), although this finding has been difficult to interpret (Kaeser and Regehr, 2014).  Extracellular Ca2+ levels can influence miniature release by changing bulk Ca2+ levels either by decreasing Ca2+ entry though Ca2+ -permeable channels, by changing the reversal potential of the Na+/Ca2+ exchanger, or by stimulating the Ca2+-sensing receptor, a G-protein coupled receptor (GPCR) present in nerve terminals (Vyleta and Smith, 2011).  Extracellular Ca2+ levels can change the local Ca2+ concentration near VGCCs that open stochastically at rest, and may alter the number of VGCCs that open by changing the surface charge and thereby the voltage dependence of channel opening (Frankenhauser and Hodgkin, 1957).  The Ca2+ chelator BAPTA reduces miniature release by 95% at cultured hippocampal synapses (Xu et al., 2009).  At rat cultured hippocampal synapses, acute blockade of P/Q- and N-type VGCCs with Aga-IVA and, Ctx-GVIA, respectively, decreased the frequency of miniature excitatory post synaptic currents (mEPSCs) by 27.7 ± 3.7%, while acute blockade of R-type channels with SNX-482 decreased mEPSC frequency by 23.1 ± 5.7%, consistent with the hypothesis that spontaneous VGCC openings triggers exocytosis (Ermolyuk et al., 2014).  However, in some cases a large fraction of the mEPSC appears to be independent of Ca2+.  For example, blockade of VGCCs did not alter miniature inhibitory or excitatory transmission onto CA3 pyramidal cells (Scanziani et al., 1992) or miniature release from cultured cortical cells (Vyleta and Smith, 2011), and left 50-70% of miniature release intact from inhibitory inputs onto hippocampal granule cells (Goswami et al., 16  2012).  These experiments establish that at hippocampal synapses miniature release is Ca2+-dependent and may depend on VGCCs as the Ca2+ source, however a large fraction of miniature release is also Ca2+-independent. 1.4 Synaptic vesicle pools in neurotransmitter release  Vesicle pools are involved in a variety of presynaptic mechanisms that support the regulation of synaptic strength, which is defined as the response that is produced in a target cell by the synapses of a neuron on initial stimulation (Atwood and Karunanithi, 2002), and presynaptic plasticity (Alabi and Tsien, 2012).  Vesicle pools are relevant to presynaptic physiology particularly with regard to release probability (Pr) and presynaptic determinants of synaptic strength (illustrated in Figure 1.5) (Alabi and Tsien, 2012).  Synaptic strength can be parsed into two key parameters: the size of the readily releasable pool (RRP), and Pr which is a measure of synaptic reliability and quantifies the likelihood that at least one vesicle in that pool will undergo exocytosis when an AP fires (Ariel et al., 2013).  Most synapses in the central nervous system (CNS) are relatively unreliable, with Pr < 0.3 on average in hippocampal terminals (Murthy et al., 1997).  At CNS synapses, Pr  varies widely between synaptic boutons in a manner that correlates with the number of “release-ready” vesicles (N) (Dobrunz and Stevens 1997; Murthy et al., 2001).  The “N” release-ready vesicles and the average probability of fusion (Pves) establish the quantal content of the response to an AP and together reflect the presynaptic contributions that set synaptic strength (Allen and Stevens 1994).  Synaptic strength can be significantly altered in the setting of activity-dependent changes in Pr, notably during periods of synaptic plasticity and homeostasis (Schneggenburger et al., 2002).  These changes in synaptic strength may have mechanistic origins in alterations to all vesicle pools (Murthy et al., 2001). 17    Figure 1.5 Presynaptic determinants of synaptic strength. Schematic illustrates several hypothetical mechanisms, (a) The number of release sites (active zones) at individual synapses (b) The number and type  of VGCCs at individual active zones (c) Differences in the size of synaptic vesicles which generate correspondingly different quantal units (d) The effectiveness of individual VGCCs to cause vesicle fusion depending on the spacing between the VGCC and vesicle (e) Synaptic vesicles that are primed and available for release are more numerous at some synapses (f) Qualitative and quantitative differences in presynaptic proteins impart different properties to the Ca2+ sensing receptors, therefore affecting the probability of vesicular fusion after Ca2+ entry.  (Figure adapted from Atwood HL, Karunanithi S (2002) Diversification of synaptic strength: presynaptic elements. Nat Rev Neurosci 3(7):497-516.)  A three-pool model for the nomenclature of synaptic vesicle pools has been proposed by Alabi and Tsien, based on the model created by Rizzoli and Betz (Figure 1.6) (Rizzoli and Betz, 2005; Alabi and Tsien, 2012).  In a mature neuronal preparation, the class of “release-ready” vesicles are named the RRP.  RRP vesicles have the highest probability of fusion at the active zone which accounts for their particularly weighty contribution to synaptic strength (Dobrunz and Stevens 1997).  In hippocampal terminals, relatively few synaptic vesicles have RRP status, and the vesicles in the RRP fuse after only a couple seconds at 10-40 Hz stimulation (Alabi and Tsien, 2012).  Estimates suggest that ~10% - 20% of the RRP is immediately available for 18  release (Moulder and Mennerick 2005), working out to ~1 vesicle for hippocampal terminals, and consistent with observations that hippocampal synapses typically contain a single active zone corresponding to ~1 release site (Schikorski and Stevens 1997).  After the RRP has been depleted, any continued release occurs from a secondary releasable pool called the recycling pool (RP).  RP vesicles repopulate vacancies within the RRP, thus requiring additional transitions to become release-ready and are often rate-limiting during persistent activity (Harata et al., 2001).  All of the vesicles capable of undergoing release, the RRP and RP, are together grouped into a total recycling pool (TRP).  However, the TRP only represents a fraction of the estimated ~100-200 (Schikorski and Stevens 1997) to ~500 (Harris and Sultan 1995) of the morphologically identified vesicles in hippocampal terminals.  The remaining fraction of vesicles is designated the resting pool (RtP), and is a set of vesicles that remain unreleased even after prolonged stimulation that causes a saturating degree of vesicular turnover (Harata et al., 2001).  In three-pool model, vesicle pools are accessed in sequential order; the RRP is immediately available for release and thus the first to be released and depleted, the RP replenishes the RRP during “physiological” patterns of stimulation, and the RtP is only released during intense, often “unphysiological” stimulus patterns (Figure 1.6) (Alabi and Tsien, 2012).  19  Figure 1.6 Vesicle pool release dynamics and terminology. (A) Schematic of vesicle pools from hippocampal terminals.  The reserve pool consists of ~180 vesicles, the recycling pool consists of ~17- ~20 vesicles, and the RRP consists of ~5- ~8 vesicles.  (B) (left panel) an alternative three-pool model (Rizzoli and Betz, 2005), and (B) (right panel) a proposed unifying scheme for vesicle pool terminology (Alabi and Tsien, 2012) (Figure adapted from Rizzoli SO and Betz WJ (2005) Synaptic vesicle pools. Nat Rev Neurosci 6:57-69, and Alabi AA and Tsien RW (2012) Synaptic Vesicle Pools and Dynamics. Cold Spring Harb Perspect Biol 4(8):a013680. doi: 10.1101/cshperspect.a013680.    1.4.1 Vesicle pools in miniature release It has been proposed that the RtP may be a source of vesicles released during miniature events, however there is a lack of consensus on this subject (Alabi and Tsien 2012).  Using various cross-depletion strategies and spectrally separable fluorescent probes to monitor vesicle fusion during evoked or miniature release, Kavalali and colleagues have proposed a model wherein miniature release signals to a distinct complement of postsynaptic receptors (Atasoy et al., 2008) and is derived from a limited pool of vesicles reluctant to fuse during evoked activity, the RtP (Chung et al., 2010).  However, using similar methods, Klingauf and colleagues found that miniature and evoked release share an overlapping set of vesicles (Groemer and Klingauf 2007), an idea that has been reinforced by Rizzoli and colleagues in multiple preparations (Wilhelm et al., 2010).    1.5 Familial Hemiplegic Migraine   Familial hemiplegic migraine (FHM) is a rare autosomal dominant heterogeneous disorder characterized by migraine with aura that involves motor weakness, and having at least one affected first- or second-degree relative (Kazemi et al., 2007).  Patients with hemiplegic migraine have complex aura symptoms that, in addition to motor aura, can include any of the aura symptoms of migraine (visual, sensory or aphasia, accompanied by headache) with aura or basilar-type migraine (Russell and Ducros, 2011).  The clinical manifestations of hemiplegic 20  migraine range from attacks with short-duration hemiparesis, to more severe forms with prolonged hemiparesis, recurrent coma, cerebellar ataxia, nystagmus, epilepsy and transient blindness (Ducros et al., 2001).  Genetic studies have identified mutations in genes that encode proteins involved in transportation of ions causing neuronal hyper excitability.  Mutations in the genes CACNA1A encoding the pore-forming α1A (CaV2.1) channel, ATP1A2 encoding the catalytic α2 subunit of a glial and neuronal sodium–potassium pump, and SCN1A encoding the pore-forming α1 subunit of neuronal NaV1.1 voltage-gated sodium channels all cause the familial hemiplegic migraine phenotype (Russell and Ducros, 2011).  The familial forms of hemiplegic migraine caused by these mutations are referred to as FHM-1, FHM-2, and FHM-3, respectively.  Most FHM mutations are missense mutations.  The SCNA1 gene is also known to be involved in epilepsy (Escayg et al., 2004).  The functional roles of FHM mutations on neuronal excitability is described in Figure 1.7.   Figure 1.7 Functional roles of proteins encoded by genes involved in FHM at a CNS glutamatergic synapse.  A presynaptic neuron receives input from an inhibitory GABAergic interneuron. An astrocyte is shown next to the synaptic cleft. CaV2.1 channels are located in the 21  presynaptic terminal of both excitatory and inhibitory neurons. FHM-1 mutations lead to disruption in the balance of cortical neurotransmission with increased probability of excitatory glutamate release, while leaving inhibitory GABAergic circuits unaltered. Na+–K+ ATPase pumps are expressed at the surface of glial cells. Normal pumps remove K+ from the synaptic cleft to limit neuronal excitability and maintain a Na+ gradient across the cell membrane, which drives uptake of glutamate from the cleft by transporters such as EAAT1. FHM-2 mutations result in mutated Na+–K+ ATPase pumps impairing glial reuptake of K+ and glutamate causing slow recovery from neuronal excitation. NaV1.1 voltage-gated Na+ channels are mainly expressed on inhibitory interneurons, where they initiate and propagate action potentials. FHM-3 mutations lead to impairments in NaV1.1 voltage-gated Na+ channels and are predicted to affect the inhibitory activities of GABAergic interneurons. Thus, dysfunction of the three ion transporters results in increased concentrations of glutamate and K+ in the synaptic cleft, and may render the brain more susceptible to cortical spreading depression. (Adapted from Russell MB and Ducros A (2002) Sporadic and familial hemiplegic migraine: pathophysiological mechanisms, clinical characteristic, diagnosis and management. The Lancet Neurology 10(5):457-470.)  1.5.1 Familial Hemiplegic Migraine type-1  Familial hemiplegic migraine type-1 (FHM-1) is an autosomal dominant subtype of migraine with aura characterized by transient hemiplegia during the aura phase (Headache Classification Subcommittee of the International Headache Society 2004).  Different aura signs and symptoms can coexist and transform into each other (e.g. sensory, motor, or visual aura), and resolve in the order they appear (Thomsen et al., 2002).  FHM-1 is caused by gain-of-function missense mutations in the CACNA1A gene encoding the pore-forming α1A (CaV2.1) subunit of P/Q-type channels (Pietrobon, 2010).  The S218L FHM-1 mutation is associated with a particularly severe clinical syndrome which can include cerebellar symptoms such as ataxia and nystagmus, generalized seizures, coma, stupor and sometimes fatal cerebral edema triggered by minor head trauma (Kors et al., 2001; Hadjikhani, 2007; Eikermann-Haerter et al., 2011).  Clinically, ~20% of FHM patients carrying the S218L mutation develop seizures during attacks (Thomsen et al., 2002).      22   1.5.2 Consequence of the S218L mutation on P/Q-type channels  FHM-1 mutations in P/Q-type channels result in a gain-of-function phenotype, mainly due to a shift in channel activation to hyperpolarizing potentials (Pietrobon, 2010).  The S218L mutation in particular causes a large shift to lower voltages of activation resulting in a fraction of mutant CaV2.1 channels being open at the resting membrane potential (-50 to -60 mV) wherein WT channels remain closed (Tottene et al., 2002).  This shift results in increased channel open probability and increased action potential-evoked Ca2+ influx in cortical neurons (Tottene et al., 2005).    Functionally, mutant channels stay open longer, and presumably allow more Ca2+ to enter the presynaptic terminal resulting in enhanced glutamate release (due to increased probability of glutamate release), causing enhanced excitatory neurotransmission (Vecchia et al., 2015).  This is believed to disrupt a finely tuned balance between excitation and inhibition in neuronal circuits resulting in a persistent state of hyper-excitability and increased susceptibility to cortical spreading depression (Vecchia et al., 2015).     1.5.3 The role of cortical spreading depression in the pathophysiology of FHM-1     Cortical spreading depression (CSD) is widely viewed as the neurophysiological correlate of migraine aura (Pietrobon, 2003).  Spreading depression (SD) is an intense wave of neuronal and glial depolarization originating in the cortex that spreads (2-3 mm/min) by way of gray matter contiguity regardless of functional divisions (Leão, 1944; Kazemi et al., 2007). SD is characterized by massive K+ efflux, Ca2+ influx and glutamate release, which are believed to depolarize adjacent neurons and glia thereby facilitating its spread (Eikermann-Haerter et al., 2011).  Further underlying SD is a massive redistribution of ions; K+ and H+ are released while Na+, Ca2+ and Cl− enter cells together with water causing cells to swell and the volume of the 23  extracellular compartment to be reduced (Nicholson et al., 1981; Somjen et al, 2011).  SD is also accompanied by an increase in glucose utilization and O2 consumption (Somjen et al, 2011).   A key manifestation of migraines including FHM-1 is the recurrence of attacks of unilateral and often severe headaches due to activation and sensitization of trigeminal sensory afferents that innervate the meninges and their large blood vessels (Pietrobon, 2003).  Although mechanisms of the primary brain dysfunction leading to the onset of a migraine attack, increased CSD susceptibility, and episodic activation of the trigeminovascular pain pathway remain largely unknown, increasing evidence supports the notion that CSD may activate trigeminal nociception and activate headache mechanisms, although this remains controversial (Pietrobon, 2003).  Subcortical spread of CSD does not propagate beyond the cortex in WT mice, is limited to the striatum in FHM-1 mouse models with the less severe R192Q mutation, and propagates bi-directionally between the cortex, hippocampus and thalamus in S218L mice (Eikermann-Haerter et al., 2011; Cain et al., 2017).  Enhanced subcortical susceptibility facilitating SD propagation has been suggested as a potential mechanism to explain hemiplegia, seizures, and coma in FHM-1 patients with the S218L mutation (Eikermann-Haerter et al., 2011).  Mutant mouse models with either the R192Q or S218L mutations show increased susceptibility to CSD, a lower threshold for induction of experimental CSD and a higher velocity of CSD propagation compared with wild-type (WT) mice (van den Maagdenberg et al., 2004).  Mice with the S218L mutation also show a larger facilitation of induction and propagation of experimental CSD compared to mice with the R192Q mutation (Eikermann-Haerter et al., 2012).  Experimentally induced CSD induces pure hemiplegia in R192Q mutant mice, while S218L mutants may additionally develop coma and often fatal seizures (Eikermann-Haerter et al., 2009).   24    Amplitude Frequency  WT S218L WT S218L Reference Mouse calyx of Held brain slice WT and S218L (P11-P15) -     mEPSC amplitude is similar between WT and S218L (WT: 47.3 ± 5.8 pA, n=21, and S218L: 49.4 ± 5.1 pA, n=14)   -    Frequency is significantly higher in the S218L compared with WT (WT: 1.6 ± 0.3 Hz vs S218L: 7.1±1.5 Hz)  -     After 30 min of pre-incubation with EGTA-AM (200 nM), frequency is reduced in both WT and S218L (WT: 0.9 ± 0.2 Hz, S218L 3.73 ± 0.9 Hz)  -   Frequency is unaffected by 200 nM Aga-IVA in the WT, but frequency is strongly reduced in S218L, reaching WT values (WT: 1.7 ± 0.3 Hz, S218L: 1.7 ± 0.4 Hz)   Di Guilmi et al., 2014 Mouse barrel cortex brain slice (S218L), layer 2/3 pyramidal cells (P16-P18) N/A -    mEPSC frequency is significantly reduced after application of 400 nM AgaIVA in S218L (30% ± 4%)   Vecchia et al., 2015 Cultured WT rat hippocampal neurons No effect on amplitude after simultaneous application of 250 nM Aga-IVA and 5 μM GVIA -     Simultaneous application of 250 nM Aga-IVA and 5 μM GVIA decreased mEPSC frequency (in WT) by 27.7 ± 3.7%, SNX-482 reduced mEPSC frequency to a similar extent (23.1 ± 5.7%) Ermolyuk et al., 2013 Table 1-2 Summary of mEPSC amplitude and frequency in WT and S218L strain neurons.  1.6 Alternative splicing  Alternative splicing (AS) is a mechanism which further expands the diversity of P/Q-type channels concerning both structural and functional aspects (Tyson and Snutch, 2013).  AS is a 25  crucial regulatory step in the process of gene expression in which non-coding intron regions are removed from precursor messenger RNA (pre-RNA) and exons are ligated to form mature mRNA, which can then be translated into protein.  The combinatorial inclusion of different exons to form mRNA results in the generation of different isoforms from a single gene (Keren et al., 2010).  Removal of introns occurs through splice-site recognition by a large ribonucleoprotein complex called the spliceosome, which is composed of more than 50 components (Chen and Manley, 2009).  Activity of the spliceosome is regulated at different levels, often in a tissue- or developmental stage- specific manner.  At a basic level, regulation includes recognition of splice-sites by the spliceosome (Keren et al., 2009).  Additional regulatory levels include environmental changes affecting splice site choice as well as other factors affecting transcription by RNA polymerase II and nucleosome occupancy (Keren et al., 2009, Schwartz et al., 2009).  26  Figure 1.8 Types of Alternative Splicing Events.  Schematic summary of known alternative splicing events. Mature mRNA transcripts may result from a combination of splicing events. Constitutive exons are shown in blue, and alternatively spliced regions in purple.  Introns are represented by solid lines, and dashed lines indicate splicing options. (a) Exon skipping: A cassette exon is spliced out of the transcript together with flanking introns. (b) and (c) Alternative 3’ splice site and (b) 5’ splice site (c) selection: two or more splice sites are recognized at the end of an exon.  (d) Intron retention: an intron remains in a mature mRNA transcript.  Rarer and complex events also include (e) mutually exclusive exons, (f) alternative promoter usage, and (g) alternative polyadenylation.  (From Keren H, Lev-Maor G, Ast G (2010) Nat Rev Genet. 11(5):345-355.)  As shown in Figure 1.8, multiple types of AS events can occur and are classified into four main subgroups (Figure 1.4).  The most common AS event is exon skipping wherein a cassette exon is spliced out of the transcript together with its flanking introns.  Exon skipping accounts for nearly 40% of events in higher eukaryotes but is rarer in lower eukaryotes.  The second and third types are 3’ and 5’ alternative splice site selection, which occurs when two or more splice sites are recognized at the end of an exon.  A fourth type is intron retention, in which an intron is still present in the mature mRNA transcript (Kim et al., 2007).  Less frequent events also include mutually exclusive exons, alternative promoter usage, and alternative polyadenylation (Keren et al., 2009).  Of note, all of the various types of AS events have been documented in studies of AS in cloned VGCCs (Tyson and Snutch, 2013).  1.6.1 Alternative splicing of Cav2.1 (P/Q-type) channels The CaV2.1 (α1A) subunit is extensively spliced in both humans and rodents with multiple splice variants having been identified in the CNS (Figure 1.9) (Soong et al., 2002).  The human CACNA1A gene consists of 49 exons (Veneziano et al., 2009) and AS at even a few exon boundaries can yield an exponential number of potential variants.  Of note, splicing at a subset of loci has been observed to result in functional P/Q-type channel variants with altered pharmacological, kinetic and modulatory properties (Bourinet et al., 1999; Hans et al., 1999; 27  Krovetz et al., 2000), as well as distinct functional effects related to disease (Zhuchenko et al., 1997; Adams et al., 2009).  Additionally, variants can exhibit differential tissue and developmental expression patterns (Soong et al., 2002; Chauduri et al., 2004).  Seven loci in the α1A subunit where AS occurs has been detected by a transcript scanning approach (Soong et al., 2002).             Figure 1.9 Sites of alternative splicing in the α1A subunit of P/Q-type channels in rat and human CNS.  The schematic shows the location of alternative splice variants that have been identified in the α1A subunit of P/Q-type channels. in either human or rat CNS samples. (1) Insertion of either +VG (10), +G (Δ10A), or no insertion of either amino acid (Δ10B). (2) Inclusion (+16/+17) or exclusion (-16/-17) of exons 16 and 17. (3) Inclusion (+SSTR) or exclusion (-SSTR) of four amino acids (SSTR). (4) Inclusion (+NP) or exclusion (-NP) of exon 31. (5) Mutual exclusion of exons 37a or 37b resulting in the EFa or EFb isoform of the EF-hand motif, respectively. (6) Inclusion or exclusion of exons 43 and 44 (±43/±44). (7) Full length translation of C-terminus (+47) or inclusion of an in-frame stop codon resulting in a shorter C-terminus (Δ47). (Soong et al., 2002; Snutch lab unpublished data)  28   The first locus is at the beginning of exon 10 (10/Δ10A/Δ10B) in the domain I–II intracellular loop.  There can be insertion of valine and glycine (+VG; 10), insertion of glycine alone (+G, Δ10A), or no insertion of either amino acid (-; Δ10B) (Soong et al., 2002).   In a cDNA library of α1A subunits derived from human cerebellum, the +VG variant was found at approximately 17% abundance, with the +G and “-” variants comprising the remaining ~83% (Soong et al., 2002).  Rat analogs of this loci were previously identified by the Snutch lab with the valine insertion shown to slow the kinetics of inactivation and to alter both G-protein-dependent inhibition and PKC-dependent upregulation (Bourinet et al., 1999) A second locus is in the S6 segment of domain II wherein exons 16 and 17 can either be included (+16/+17) or excluded (-16/-17).  While the -16/-17 variant was detected during the transcript scanning method, only the +16/-17 was detected in the α1A cDNA library derived from human cerebellum (Soong et al., 2002).  Deletion of exons 16 and 17 would remove half the P-loop and the entire S6 segment of domain II, most likely producing a non-functional channel (Soong et al., 2002). The +SSTR variant, which encodes the insertion of four amino acids (Serine, Serine, Threonine, Arginine) into the domain III S3-S4 linker, has been identified more recently (Allen et al., 2010; Snutch Lab, unpublished data). The +SSTR splice variant has been found to be predominantly expressed in the brainstem, reticular thalamus and spinal cord (Snutch lab, unpublished data).  Whole-cell patch-clamp electrophysiology on human embryonic kidney (HEK) 293 cells has shown that channels with the +SSTR variant exhibits faster activation kinetics, a ~5 mV hyperpolarizing shift in the voltage-dependence of activation and inactivation, and in response to increasing durations of action potential waveforms (APWs) the charge 29  transference is significantly less sensitive to APW broadening, compared to channels with ΔSSTR (Snutch lab, unpublished data).  A fourth splice locus near the beginning of exon 32 affects the domain IV S3–S4 extracellular loop.  Here, there can be an optional insertion of the dipeptide Asparagine-Proline (+NP; +31*) or exclusion of Asparagine-Proline (-NP; -31*).  Alternative splicing at this site is significant as the exclusion or inclusion of NP determines the classification of the P-type or Q-type channels, respectively (Bourinet et al., 1999).  P-type channels were originally described in cerebellar Purkinje cells (Llinas et al., 1989) while Q-type channels were first described in cerebellar granule cells (Zhang et al., 1993; Randall et al., 1995).  Notably, native P- and Q-type channels differ in their sensitivity to Aga-IVA with P-type channels having a significantly higher sensitivity (Kd ~2 nM) compared to Q-type channels (Kd >100 nM).  The correlation of Aga-IVA pharmacological profiles with the inclusion or exclusion of NP, (Q- and P-type isoforms, respectively) was first described in transfected HEK 293 cells (Bourinet et al., 1999).  The insertion of NP also shifts the voltage-dependence of activation to more positive potentials (~6 mV), and causes faster inactivation kinetics (Bourinet et al., 1999, Hans et al., 1999).  Examination of regional expression in rat brain showed that transcripts of α1A +NP (P-type) and -NP (Q-type) were expressed at approximately equal levels in the hippocampus, while most α1A transcripts in the cerebellum were -NP (P-type) (Bourinet et al., 1999).  Contrastingly, a cDNA library of α1A transcripts derived from human cerebellum showed ~ 5% -NP and ~95% +NP (Soong et al., 2002). A fifth splice locus affects the proximal end of the P/Q-type channel C-terminus.  Here, mutually exclusive splicing results in channels possessing either of two versions of an EF-hand motif resulting from the inclusion of exon 37a (EFa; 37a) or 37b (EFb, 37b).  This motif is 30  functionally important as the EF-hand contains Ca2+ binding sites important for Ca2+ -dependent regulation of P/Q-type channels (Chaudhuri et al., 2004).  EF-hand variation selectively acts as a molecular switch for Ca2+ -dependent facilitation (CDF), an activity dependent enhancement of channel opening, while leaving Ca2+ -dependent inactivation (CDI), a process of channel inactivation unaffected (Chaudhuri et al., 2004). In effect, splice regulation of the EF-hand isoform switches P/Q-type channel Ca2+-dependent responsiveness between a preference for local versus global Ca2+.  The presence of the EFa-hand motif permits both CDF, which is modulated by local Ca2+ influx through single channels, and CDI, which is preferentially driven by global Ca2+ through many Ca2+ channels (Chaudhuri et al., 2004).  The presence of the EFb-hand motif greatly suppresses CDF but leaves CDI unaffected (Chaudhuri et al., 2004).  In rodent whole brain, EFb motif expression is predominant in early development, with a major switch to EFa expression occurring 1-2 weeks after birth (Chaudhuri et al., 2005).  A similar developmental switch was also seen in cerebellum in which early postnatal samples predominantly expressed Efb, while in rats age 1 month to 30 months predominantly expressed EFa (Chang et al., 2007).  Interestingly, the data from rodents contrasts with data from human cerebellar tissues.  Here, a switch was found to occur from predominantly EFa expression in human cerebellum from males between 16 to 30 years of age, to predominantly EFb expression after 40 years of age, while cerebellum samples from females showed mostly EFb expression at ages between 24 and 93 years old (Chang et al., 2007).   A sixth splice locus occurs downstream of the calmodulin binding domain (CBD).  Exons 43 and 44 can occur in four combinations: +/-43/+-44.  Omitting exon 44 has been observed to diminish voltage-dependent inactivation (Krovetz et al., 2000), although another group did not observe this effect (Soong et al., 2002).  31  A seventh locus of splicing affects the distal end of the P/Q-type channel C-terminus.  The inclusion of the pentanucleotide GGCAG at the beginning of exon 47 allows for in-frame translation of exon 47 to produce a long version of the C-terminus (+47).  Exclusion of GGCAG in exon 47 causes a frameshift leading to stop codon termination near the beginning of exon 47 (Δ47) and a resulting in a shorter C-terminal tail (Soong et al., 2002).  P/Q-type channels with the Δ47 variant have been shown to exhibit a faster rate of recovery from inactivation and less accumulation of inactivation during tonic depolarizations compared to +47 variant channels (Adams et al., 2009).    1.7 Consequences of the S218L mutation concerning calcium-dependent facilitation   Short-term facilitation of synaptic release is a type of synaptic enhancement observed as a multi-component increase in synaptic efficacy, i.e. an increased amplitude of individual PSCs in response to repetitive action potentials on the timescale of hundreds of milliseconds (Fisher et al., 1997; Zucker and Regehr, 2002). Facilitation is presynaptic in origin, and involves an increase in the number of transmitter quanta released by an AP without a change in quantal size or postsynaptic effectiveness (Fisher et al., 1997).  The underlying mechanism has historically been attributed to the residual Ca2+ hypothesis in which enhanced vesicle release resulting from the accumulation of intracellular Ca2+ in presynaptic terminals during repetitive APs (Adams et al., 2010).  The buildup of residual Ca2+ enhances binding to sensor proteins that directly mediate vesicle fusion and transmitter release (Zucker and Regehr, 2002)  In contrast, many synapses also show decreased synaptic strength in response to periods of elevated activity and has also been attributed to a presynaptic mechanism involving a decline in PSC amplitude during repeated stimulation (Zucker and Regehr, 2002).  Here, the most 32  widespread mechanism appears to result from a presynaptic decrease in the release of neurotransmitter that likely reflects a depletion of the RRP (Debanne et al., 1996).  Postsynaptic properties such as desensitization of ligand-gated receptors may also contribute towards postsynaptic cells becoming less sensitive to neurotransmitter (Zucker and Regehr, 2002).   CDF and CDI of P/Q-type channels are mediated through neuronal Ca2+ sensor proteins (CaSs) that bind the carboxyl terminus of P/Q-type α1A subunits and induce short-term synaptic facilitation and rapid synaptic depression, respectively (Chaudhuri et al., 2007).  Calmodulin (CaM)-mediated CDF and CDI are robust forms of modulation in which CaM interacts with the P/Q-type carboxyl terminus in a dual regulatory process; CDF is mediated by a local increase in Ca2+ and CDI through a global increase in Ca2+ (Tsujimoto et al., 2002; Chaudhuri et al., 2007).  It has been shown that P/Q-type channels at cerebellar parallel fiber-to-Purkinje cell synapses (PF-PC) from S218L knock-in mice are in a basally facilitated state compared to that of WT mice (Adams et al., 2010).  Further, the constitutively facilitated state precludes CaM-mediated CDF as basally increased presynaptic Ca2+ results in enhanced transmitter release during action potentials at PF boutons in S218L mice relative to unfacilitated P/Q-type channels from WT mice (Adams et al., 2010). Additionally, the alteration of CDF in S218L mutant P/Q-type channels was found to correlate with reduced short-term synaptic facilitation (Adams et al., 2010).          33  1.8 Thesis hypotheses and project significance   1.8.1 Hypotheses  Recent data from the Snutch lab has shown that CA1 neurons from S218L mice exhibit a higher sensitivity to Aga-IVA during sAP-mediated neurotransmitter release which consists of a combination of spontaneous vesicle fusion and fusion driven by the spontaneous firing of presynaptic cells, and during evoked release.   1 I hypothesize that an altered expression of the ratio -NP to +NP in P/Q-type splice variants and/or of overall CaV2.1 expression occurs between WT and S218L mice and underlies the differing sensitivity of CA1 neuron sAPEPSCs to Aga-IVA.  To test this hypothesis, I will utilize qRT-PCR on dissected hippocampal regions from S218L and WT in order to examine the splice-variant composition of CaV2.1 transcripts. 2 As an alternative mechanism, I hypothesize that the altered sensitivity of CA1 synaptic signalling to Aga-IVA in S218L mice is due to increased basal Ca2+ influx, or enhanced coupling of P/Q-type channels to the synaptic release machinery involved in spontaneous action potential evoked neurotransmitter release and miniature release.   To test this hypothesis, I will utilize acute hippocampal slices to examine CA1 synaptic signalling between S218L and WT strains. A pharmacological approach using subtype specific Ca2+ channel blockers will be employed to dissect the relative contributions of P-, Q-, N- and R-type channels towards miniature neurotransmitter release.   1.8.2 Significance of project   The contribution of high voltage-activated CaV2.1 (P/Q-type) channels is well defined for synchronous neurotransmitter release in the hippocampus, however their role towards miniature neurotransmitter release is less clear.  P/Q-type channels from FHM-1 knock-in mice exhibit an 34  overall gain-of-function synaptic phenotype and represent an interesting model system in which to study hippocampal miniature neurotransmitter release.   Furthermore, understanding the contribution of P/Q-type channels towards different modes of neurotransmitter release may aid in understanding the mechanism of action of drugs targeting the P/Q-type channel in treatment of FHM-1. For example, pregabalin, a small-molecule drug used clinically in the treatment of neuropathic pain and partial seizures binds to the α2δ1/2 subunits of HVA VGCCs.  It has been found that pregabalin (500 µM) effectively suppresses both sAP and evoked synaptic activity in WT and CA1 neurons but not in S218L CA1 neurons (Cain et al., 2017).  The authors suggest that pregabalin may provide an effective preventative treatment to limit the subcortical progression of migraine in non–FHM-1 migraineurs and in milder forms of FHM-1 (Cain et al., 2017).  This finding highlights the need to understand mechanisms underlying differences observed in synaptic signaling in more severe forms of FHM-1            35  Chapter 2: CaV SUBUNITS ARE NOT DIFFERENTIALLY EXPRESSED IN THE HIPPOCAMPUS 2.1 Introduction The α1 subunits of VGCCs differ in their expression patterns, voltage-dependences of activation and inactivation, kinetics, conductance’s and pharmacological properties (Ertel et al., 2000).  Alternative splicing further expands the diversity of VGCCs in both structural and functional aspects (Soong et al., 2002).  P/Q-type channels are critical for synaptic transmission in CA1 neurons and altered alternative splicing and/or altered channel expression could significantly affect channel contributions to synaptic transmission.  Q-type channels have been shown to play a greater role in glutamatergic transmission at the CA3-CA1 synapse compared to P-type channels (Wheeler et al., 1994).  Native P- and Q-type channels differ in their sensitivity to Aga-IVA with the P-type isoform being significantly more sensitive, and the exclusion or inclusion of the NP splice variant is the major distinguishing characteristic for the classification of the P-type or Q-type channel, respectively (Bourinet et al., 1999).   The auxiliary α2δ and β subunits affect the targeting and expression of VGCC α1 subunits at the plasma membrane.  α2δ subunit co-expression enhances whole cell currents via increased cell surface expression of α1 subunits (Kadurin et al., 2012) and β subunit co-expression both greatly enhances cell surface expression of α1 subunits through increased trafficking to the cell surface and also plays a role in the surface targeting of α2δ subunits (Buraei and Yang, 2010).  Co-immunoprecipitation studies from rat brain have demonstrated that the β3 and β4 subunits account for the greatest association with native α1A subunits although α1A can also associate with β1b and β2 (Liu et al., 1996).  The β subunits directly bind to 1 subunits in the domain I-II cytoplasmic linker region (Pragnell et al., 1994). 36  I hypothesized that an altered expression of the ratio -NP to +NP in P/Q-type splice variants and/or overall CaV2.1 expression may be present in S218L mice and underlie the differing sensitivity of CA1 neuron sAPEPSCs to Aga-IVA.  However, altered expression of α2δ and β subunits could also influence the total levels either the P-type or Q-type variants.  To test this hypothesis, I performed qPCR on CA1, CA3, and dentate gyrus regions dissected from WT and S218L mice, using probes specific for CaV2.1, α2δ, and β subunits, and all known CaV2.1 splice variants.  Overall, I found that expression of all VGCC subunits and splice variants tested was similar between CA1, CA3, and dentate gyrus, and between WT and S218L mice, thus is unlikely to underlie the increased sAPEPSCs sensitivity to Aga-IVA observed in CA1 neurons in S218L mice.  2.2 Methods  2.2.1 Dissections, RNA isolation and cDNA generation  CA1, CA3, and dentate gyrus were dissected from ~500 μM thick acute brain slices, cut in the horizontal plane from three WT mice and three S218L mice, age postnatal day (P)20-P30 (male and female).  Each dissected tissue sample was immediately homogenized by vortexing in 250 μL of TRI Reagent Solution (Ambion: AM9738), until no chunks of tissue were visible.  Samples were then stored at -80oC until total RNA was extracted using the MagMax-96 for Microarrays Kit (Ambion; AM1839).  cDNA was generated using the Applied BiosystemsTM High Capacity cDNA Reverse transcription Kit.  A 2720 Thermal Cycler (Applied Biosystems) was used to perform cDNA synthesis and the procedure was 25oC for 10 min, 37oC for 120 min and 85oC for 5 seconds. cDNA samples were stored at -20oC in Tris-EDTA buffer until further use.  37  2.2.2 Quantitative real-time PCR procedures and probes Quantitative real-time PCR (qPCR) reactions were performed in triplicate using KAPA PROBE FAST qPCR Master Mix (2x) (KAPA Biosystems; KM4702) in hard-shell 384 well PCR plates (Bio-Rad Laboratories; HSP3802).  All qPCR probes contained FAM at the 3’ end, BkFQ quencher at the 5’ end, and a ZEN quencher between the 9th and 10th base.  CaV2.1 splice variant qPCR probes were designed by Dr. John Tyson and synthesized by Integrated DNA Technologies (Tables 2-1).  The qPCR probes for the CaV α1, α2δ and β subunits were synthesized by ThermoFisher Scientific, and the sequences of the probes are not provided.   The C1000 Touch Thermal Cycler Touch TM Real-Time (PCR Detection) System (Bio-Rad) was used for detection, and the protocol was 95oC for 3 minutes, (95oC for 15 seconds, 60oC for 45 seconds) x 40.  Variant Forward Primer Reverse Primer Probe sequence Exon 9 GAAGACAACAGCAGATTGAACG CGCAAGAATCACCTCTT CTCAATGGATACATGGAGTGGATCTCAAA Exon 9 del GAAGACAACAGCAGATTGAACG CGCAAGAATCACCTCTG CTCAATGGATACATGGAGTGGATCTCAAA Exon 10 ins GAGGCACCCTTTTGATGGAG AGACGCGATGTCAGCCAG CTACTCTGAAGAAAAGCAAGACAGACCTGC Exon 10 del GAGGCACCCTTTTGATGCTC AGACGCGATGTCAGCCAG CTACTCTGAAGAAAAGCAAGACAGACCTGC Exon 10 ins GAGGCACCCTTTTGATGTTG AGACGCGATGTCAGCCAG CTACTCTGAAGAAAAGCAAGACAGACCTGC  -SSTR GGACTTCATAGTGGTCAGTGG GACTTAATGGTGTTAATGTCC CTTTGCCTTCACTGGCAATAGCAAAGG +SSTR GGACTTCATAGTGGTCAGTGG GACTTAATGGTGTTAATGTCC TGCCTTCACTGGCAATAGCAAAGGAAA -NP GTCACCGAGTTTGGGAATAAC AGGAGTTTGATGAGTCTGGC ACCTGAGCTTTCTCCGCCTCTTC 38  Table 2-1 Sequences of qPCR probes used for P/Q-type splice variants.  2.2.3 Analysis of qPCR data        Quantification cycle (Cq) values were obtained using the Bio-Rad CFX Manager version 3.1 (Bio-Rad Laboratories) and were normalized to GAPDH expression. The amounts of each subunit or splice-variant were averaged between the triplicates, and the averaged values used to calculate the average between the three different animals to generate Figures 2.1, 2.2, 2.3, and 2.4 showing the averaged values ± standard deviation. 2.3 Results  2.3.1 CaV α1, α2δ, and β subunit transcripts are not differentially expressed between WT and S218L mice.  To generate expression profiles of CaV subunits, qPCR was performed using probes for all CaV α1, α2δ, and β subunits and total RNA isolated from CA1, CA3 and dentate gyrus from both WT and S218L mice.  Figure 2.1 shows the normalized expression levels of all ten Cav α1 +NP CAGCATCACAGACATCCTCG AGGAGTTTGATGAGTCTGGC ACCGAGTTTGGGAATCCGAATAACTTCATC EFb TGGGCAGAGTATGACCCTG TCTCTTGTAAGCCACTCTGG TATCAGATGCTGAGACACATGTCCCCG Efa TGGGCAGAGTATGACCCTG TCTCTTGCAAGCAACCCTAT CATGTACAGTTTATTGCGAGTAATATCGCCCC 44 CATGGAAGGCCAGACCAGG AGGCTGAGCGCTTCATGG CGGCCACGTGGAAATGACCTCAGT -44 AGACAGCGAACACTACCTCC GCTGGTATCAGAGATGGCTG ATGGAAGGCCAGACCAGGGC Exon 46, 47 GACACACAGACAGGGCAG GGCGAGTAGGACACAAGC TCTACGTCCGGCACCAGCA Exon 47, 5 bp del CACGACACACAGACAGTAG GGCGAGTAGGACACAAGC TCTACGTCCGGCACCAGCA Exon 47, 8 bp del CACGACACACAGACAGTTC GGCGAGTAGGACACAAGC TCTACGTCCGGCACCAGCA 39  subunits, with expression of CaV2.1 being approximately equal to CaV2.2, and CaV2.3 being the highest expressed in the three hippocampal regions.  Figure 2.2 shows the expression levels of the four CaV α2δ subunits, with expression of α2δ1 and α2δ3 being the highest and with significantly lower levels of the α2δ2 and α2δ4 subunits.  Figure 2.3 shows the expression of all four CaV β subunits, with expression of β3 being the highest expressed.  Overall, the expression of all CaV subunits was similar between CA1, CA3, and dentate gyrus, and between WT and S218L mice, and notably, expression of CaV2.1 was not different between WT and S218L mice.   Figure 2.1 P/Q-type channels are not differentially expressed between WT and S218L mice in the hippocampus. Averaged Cq values were acquired in triplicates from qPCR performed using subtype specific probes and normalized to GAPDH Cq values to obtain the amount of each subunit in the CA1 (blue), CA3 (orange), and dentate gyrus (grey).  The top graph shows expression levels from WT mice (N=3) and the bottom graph shows expression levels from S218L mice (N=3).   40   Figure 2.2 CaV α2δ subunits are not differentially expressed between WT and S218L mice in the hippocampus. Averaged Cq values were acquired in triplicates from qPCR performed using subtype specific probes and normalized to GAPDH Cq values to obtain the amount of each subunits in the CA1 (blue), CA3 (orange), and dentate gyrus (grey).  The top graph shows expression levels from WT mice (N=3) and the bottom graph shows expression levels from S218L mice (N=3).    Figure 2.3 CaV β subunits are not differentially expressed between WT and S218L mice in the hippocampus. Averaged Cq values were acquired in triplicates from qPCR performed using subtype specific probes and normalized to GAPDH Cq values to obtain the amount of each subunit in the CA1 (blue), CA3 (orange), and dentate gyrus (grey).  The top graph shows 41  expression levels from WT mice (N=3) and the bottom graph shows expression levels from S218L mice (N=3).  2.3.2 CaV2.1 splice-variant transcripts are not differentially expressed between WT and S218L mice.  To determine whether the ratio of –NP to +NP splice variants was altered in S218L mice compared to WT in CA1, I also performed qPCR using probes for all known CaV2.1 splice variants.  Figure 2.4 shows expression of the CaV2.1 splice variants.  Notably, expression of the –NP and +NP variants is not different between WT and S218L mice, and further that expression of all splice variants are similar between CA1, CA3, and dentate gyrus, and between WT and S218L mice.  Figure 2.4 The –NP splice variant is not differentially expressed between WT and S218L mice in the hippocampus. Averaged Cq values were acquired in triplicates from qPCR performed using splice variant specific probes and normalized to GAPDH Cq values to obtain the amount of each variant in the CA1 (blue), CA3 (orange), and dentate gyrus (grey).  The top graph shows expression levels from WT mice (N=3) and the bottom graph shows expression levels from S218L mice (N=3).   42  2.4 Discussion Performing qPCR using probes specific for all VGCC α1, α2δ and β subunits, and CaV2.1 splice-variant specific probes, I found that expression is similar between the CA1, CA3, and dentate gyrus regions, and is also similar between WT and S218L mice.    The +NP variant was found to be expressed at higher levels compared to –NP in both WT and S218L mice (Figure 2.4).  This result is consistent with previous observations that Q-type channels have a greater contribution to synaptic transmission compared to P-type channels at CA3-CA1 synapses, as determined by channel block by Aga-IVA (Wheeler et al., 1994). The data presented here suggest that the increased expression of Q-type (+NP) channels may account for this pharmacological effect.           β subunits are crucial for the functional expression of CaV2 channels by allowing proper trafficking to the plasma membrane (Pragnell et al., 1994).  A highly conserved interaction among β subunits is a high affinity interaction site between the α1 interaction domain (AID) in the domain I-II cytoplasmic linker of HVA α1 subunits and a β interaction domain (BID) on  subunits (Walker et al., 1999).  Co-expression of α2δ subunits also increases the surface expression of various HVA α1 subunit/β subunit combinations (Kadurin et al., 2012).  Interestingly, β3 transcripts were found to be the highest expressed β-subunit in CA1, CA3, and dentate gyrus (Figure 2.3).  Structurally, the β3 subunit lacks two secondary interaction sites found in β4, located between the amino-terminal cytoplasmic domain of α1A and the carboxyl terminus of β4 (Walker et al., 1999).  Coexpression of β4 in Xenopus oocytes produces a smaller hyperpolarizing shift in the voltage dependence of activation of the P/Q-type channel compared with β3 (not exhibiting this interaction). Replacing the amino terminus of the P/Q-type α1A subunit with that of the N-type α1B subunit abolishes this difference (Walker et al., 1999).  This 43  suggests that a larger hyperpolarizing shift in channel activation is specific to P/Q-type channels in the hippocampus.  Functionally, this may allow P/Q-type channels to activate at more negative membrane potentials, increasing Ca2+ influx into presynaptic terminals at hyperpolarized potentials.                   44  Chapter 3: CONTRIBUTION OF P/Q-, N- AND R-TYPE CHANNELS TO MINIATURE RELEASE IN CA1 NEURONS IN WT AND S218L MICE 3.1 Introduction P/Q-type channels in mice with the S218L mutation display a hyperpolarizing shift in channel activation, causing increased basal Ca2+ influx at resting membrane potentials compared to WT.  Testing the contribution of increased Ca2+ influx through P/Q-type channels with the S218L mutation on the rate of miniature release in calyx of Held synapses showed that the frequency of mEPSCs was unaffected in WT but increased in S218L mice compared to WT (Di Guilmi et al., 2014).  Application of 200 nM Aga-IVA to block both P- and Q-type channels decreased mEPSC frequency in S218L mice to WT levels, indicating that increased mEPSC frequency in the S218L depends on basal Ca2+ influx through mutated P/Q-type channels (Di Guilmi et al., 2014).  In another study, the frequency of mEPSCs recorded from layer 2/3 cortical pyramidal neurons from S218L mice decreased by ~30% after application of 400 nM Aga-IVA supporting the conclusion that a fraction of mutant P/Q-type channels open at resting membrane potential in cortical excitatory presynaptic terminals (Vecchia et al., 2015).  The Snutch lab has recently shown that CA1 neurons from S218L mice exhibit a higher sensitivity to Aga-IVA during sAP -mediated neurotransmitter release (S. Cain and YM. Zhang, unpublished).  However, it remains to be determined what underlies the increased the increased sensitivity to Aga-IVA in CA1 neurons from S218L mice.  I hypothesized that the altered Aga-IVA sensitivity of CA1 synaptic signalling in S218L mice may be due to enhanced basal Ca2+ influx through mutant P/Q-type channels at resting membrane potentials. Here, I report the contribution of presynaptic P/Q-, N- and R-type channels to miniature release by recording mEPSCs in CA1 neurons of WT and S218L mice.  Analysis of the inter-45  event interval (inverse of frequency), showed that mEPSC frequency was not increased in S218L mice, and that application of 200 nM Aga-IVA to CA1 neurons of S218L mice did not increase inter-event interval (decrease frequency).  Together, these data suggest that the presynaptic arrangement of VGCCs at the synapse likely is a larger contributing factor to the rate of miniature release in CA1 neurons than the gain-of-function phenotype of the P/Q-type channel caused by the S218L mutation.  3.2 Methods 3.2.1 Animals WT and transgenic S218L littermates P20–P30 male and female mice were used in all experiments and were genotyped as previously described (van den Maagdenburg et al., 2004). 3.2.2 Acute Brain Slice Preparation Mice were deeply anesthetized using isoflurane [5% in oxygen (vol/vol)] and then quickly sacrificed by decapitation. Brains were removed rapidly and transferred to ice-cold sucrose-artificial cerebral spinal fluid (sucrose-aCSF) containing 214 mM sucrose, 26 mM NaHCO3, 1.25 mM NaH2PO4, 11 mM glucose, 2.5 mM KCl, 0.5 mM CaCl2, 6 mM MgCl2, bubbled with 95% O2: 5% CO2.  Each brain was glued to a cutting chamber in a vibrating microtome (VT 1200; Leica) which was filled with ice-cold sucrose-aCSF.  3.2.3 Acute Brain Slice Electrophysiology Horizontal brain slices (~350 μm thick) were cut from the level of the ventral hippocampus.  Slices were incubated at 33–35 °C in aCSF containing 126 mM NaCl, 2.5 mM KCl, 26 mM NaHCO3, 1.5mM NaH2PO4, 2 mM CaCl2, 2 mM MgCl2, 10 mM glucose bubbled 46  with 95% O2: 5% CO2.  Slices were transferred to a recording chamber super-fused with aCSF additionally containing 1 μM TTX, and were maintained at 33–35 °C.  CA1 neurons were visualized using a DIC microscope and infrared camera, and were visually identified by their location, morphology, and orientation.  The whole-cell patch-clamp electrophysiology technique was performed to record mEPSCs.  The internal pipette solution contained 120 mM potassium-gluconate, 10 mM HEPES, 1 mM MgCl2, 1 mM CaCl2, 11 mM KCl, 11 mM EGTA, 4 mM Mg-ATP, 0.5 mM Na-GTP, and 0.2 mM picrotoxin (pH 7.3 adjusted with KOH and osmolality 290 mOsm/kg adjusted with D-mannitol).  The recording chamber was grounded with an Ag/AgCl pellet.  Recordings were done using a Multiclamp 700B amplifier and pClamp software version 10 (Molecular Devices). To evaluate mEPSCs, in voltage clamp mode cells were held at a membrane potential of −70 mV during a 60-s gap-free recording. Data acquisition was sampled at 20 kHz and filtered at 2.4 kHz.  Series resistance was compensated to 70%.   3.2.4 Toxins  Pharmacological dissection of the Ca2+ current components contributing to mEPSCs was performed using the peptide toxins: Aga-IVA, Ctx-GVIA, and SNX-482 (Alomone Labs).  Aga-IVA was reconstituted in sterile nanopure water to a stock concentration of 50 mM and then diluted in aCSF for a working concentration of 50 nM Aga-IVA to block P-type channels and to 200 nM Aga IVA to block both P-type and Q-type channels.  Ctx-GVIA was reconstituted in sterile nanopure water to a stock concentration of 1 mM and then diluted 1000X in aCSF for a working concentration of 1 μM Ctx -GVIA to block N-type channels.  SNX-482 was reconstituted in sterile nanopure water to a stock concentration of 500 μM and then diluted 47  1000X in aCSF for a working concentration of 500 nM SNX-482 to block R-type channels.  For each experiment, after a control mEPSC recording, a toxin of interest was circulated through the perfusion system for 10 min before mEPSCs were recorded again to determine the contribution of a given channel.  A single toxin was used on each cell unless otherwise stated.  3.2.5 Data Analysis Electrophysiological data analysis was performed using Clampfit (v9; Molecular Devices).  mEPSC amplitudes and inter-event intervals were calculated by creating an appropriate template for detection in Clampfit.  Graphing and statistical analyses were performed using Origin (v8.6; OriginLab).  Statistical significance was calculated using Student’s two-sample t test (paired where relevant). One-way ANOVA with Tukey’s post hoc test was used for multiple comparisons. Cumulative distributions were compared using the Kolmogorov–Smirnov test. Data are plotted as mean ± SE.   3.3 Results  3.3.1 mEPSC amplitude is increased in CA1 neurons from S218L compared to wildtype mice Increased mEPSC frequency in S218L mice has been shown to depend on increased basal Ca2+ influx through mutated P/Q-type channels at the resting membrane potential (Di Guilmi et al., 2014; Vecchia et al., 2015), however it has not been tested if this phenomenon also occurs in the hippocampus.  Here, I tested the consequences of the S218L in mutation in CA1 neurons on miniature release in order to investigate whether this mechanism could explain the increased sensitivity to Aga-IVA observed in CA1 neurons from S218L mice during evoked and sAP neurotransmitter release previously observed in the Snutch lab.  Whole cell patch clamp electrophysiology was performed using a voltage clamp protocol to record mEPSCs in CA1 48  neurons in the presence of 1 μM TTX.  Mean amplitude was larger in S218L neurons whereas no difference was observed in the mean inter-event interval between WT and S218L mice (Figure 3.1).   Figure 3.1 mEPSC amplitude is increased in S218L CA1 neurons compared to WT.  (A) Comparison of mean mEPSC amplitude between WT and S218L recorded from CA1 neurons.  (B) Comparison of mean mEPSC inter-event interval between WT and S218L recorded from CA1 neurons. *P<0.05, two-sample t-test (between strains) (C) Cumulative probability analysis of mEPSC amplitude and (D) inter-event interval. *P<0.01, Kolmogorov-Smirnov Test.    3.3.2 Blockade of P-, Q-, N- and R-type channels has differential effects on mEPSC inter-event interval  To investigate the contribution of Ca2+ influx through WT and S218L P/Q-type channels on the rate of miniature release in CA1 neurons, mEPSC inter-event interval was measured in the presence of the P/Q-type specific channel blocker Aga-IVA.  50 nM Aga-IVA was used to block the P-type channel and 200 nM Aga IVA was used to block P- and Q-type channels.  Ctx-GVIA (1 μM) and SNX-482  (500 nM) were also used to determine the contributions of N- and 49  R-type VGCCs (respectively) to the rate of miniature release.  Surprisingly, in S218L blockade of the P-type channel decreased inter-event interval (Figure 3.2) and in WT, blockade of the N-type channel decreased inter-event interval (Figure 3.4).  Blockade of P and Q-type channels increased inter-event interval in WT, but not in S218L (Figure 3.3).  Given that blockade of the P-type channel in WT did not affect mEPSC inter-event interval, and Q-type channels are expressed at higher levels than P-type channels (in WT and S218L, Figure 2.4), this suggests that Q-type channels have a greater contribution to miniature release compared to P-type channels at these synapses.  Blockade of the R-type channel increased inter-event interval in WT and S218L (Figure 3.5), also consistent with the finding by Ermolyuk and colleagues that R-type channels play a greater role in miniature release than either N- or P/Q-type channels, (Ermolyuk et al., 2013).  Figure 3.2 Blockade of P-type channels decreases mEPSC inter-event interval in S218L neurons.  (A) Representative current traces taken from 60-s voltage-clamp recordings at the CA1 soma showing the effect of 50 nM Aga-IVA on mEPSCs.  (B) Mean data for the effect of 50 nM Aga-IVA on mEPSC amplitude (WT: n = 6 cells, 6 animals; S218L n = 5 cells, 3 animals) *P<0.05 and (C) mEPSC inter-event interval (WT: n = 5 cells, 5 animals; S218L n = 5 cells, 3 animals) *P<0.05 two-sample t-test (control versus 50 nM Aga-IVA) (D) Cumulative 50  probability analysis of mEPSC amplitude *P<0.01 and (E) inter-event interval *P<0.01, Kolmogorov-Smirnov Test.     Figure 3.3 Blockade of P/Q-type channels increases mEPSC inter-event interval in WT.  (A) Representative current traces taken from 60-s voltage-clamp recordings at the CA1 soma showing the effect of 200 nM Aga-IVA on mEPSCs.  (B) Mean data for the effect of 200 nM Aga-IVA on mEPSC amplitude (WT: n = 9 cells, 9 animals; S218L n = 3 cells, 3 animals) *P<0.05 and (C) mEPSC inter-event interval (WT: n = 9 cells, 9 animals; S218L n = 5 cells, 4 animals) *P<0.05, two-sample t-test (control versus 200 nM Aga-IVA). (D) Cumulative probability analysis of mEPSC amplitude *P<0.01 and (E) inter-event interval *P<0.01, Kolmogorov-Smirnov Test.   51    Figure 3.4 Blockade of N-type channels decreases mEPSC inter-event interval in WT.          (A) Representative current traces taken from 60-s voltage-clamp recordings at the CA1 soma showing the effect of 1 μM Ctx-GVIA on mEPSCs.  (B) Mean data for the effect of 1 μM Ctx-GVIA on mEPSC amplitude (WT: n = 7 cells, 6 animals; S218L n = 5 cells, 5 animals) *P<0.05 and (C) mEPSC inter-event interval (WT: n = 7 cells, 6 animals; S218L n = 4 cells, 4 animals) *P<0.05, two-sample t-test (control versus 1 μM Ctx-GVIA). (D) Cumulative probability analysis of mEPSC amplitude *P<0.01 and (E) inter-event interval *P<0.01, Kolmogorov-Smirnov Test.      52   Figure 3.5 Blockade of R-type channels decreases mEPSC inter-event interval in WT and S218L.  (A) Representative current traces taken from 60-s voltage-clamp recordings at the CA1 soma showing the effect of 500 nM SNX-482 on mEPSCs.  (B) Mean data for the effect of 500 nM SNX-482 on mEPSC amplitude (WT: n = 6 cells, 6 animals; S218L n = 3 cells, 3 animals) *P<0.05 and (C) mEPSC inter-event interval (WT: n = 6 cells, 6 animals; S218L n = 5 cells, 5 animals) *P<0.05, two-sample t-test (control versus 500 nM SNX-482). (D) Cumulative probability analysis of mEPSC amplitude *P<0.01 and (E) inter-event interval *P<0.01, Kolmogorov-Smirnov Test.    3.3.3 Decreased mEPSC inter-event interval observed after specific VGCC blockade is unlikely due to other VGCCs increasing their contribution to miniature release.   I hypothesized that the decrease in inter-event interval observed when N-type channels are blocked in WT may be due to increased P/Q-type channel contribution to miniature release.  To test this, I first applied 200 nM Aga-IVA to block P/Q-type channels, then Ctx-GVIA and SNX sequentially to the same cell.  If P/Q-type channels had an increased contribution, when they are blocked first then mEPSC inter-event interval should not decrease after Ctx-GVIA is applied.  As shown in Figure 3.6B the inter-event interval did not decrease after Ctx-GVIA thus supporting this hypothesis (Figure 3.6B). 53      Figure 3.6 Blockade of P/Q-type channels occludes the decrease in inter-event interval when N-type channels are blocked in WT.  (A) Mean data for the effect of 1 μM GVIA on mEPSC inter-event interval (WT: n = 7 cells, 6 animals) *P<0.05. (B) Mean data for the effect of 200 nM Aga-IVA, 1 μM GVIA, and 500 nM SNX-482 applied sequentially on the same cell (WT: n = 3 cells, 3 animals), on mEPSC inter-event interval. *P<0.05, two-sample t-test (control versus 1 μM Ctx-GVIA), one-way ANOVA with Tukey’s post hoc test (between toxins).   I further hypothesized that the decrease in inter-event interval observed when P-type channels are blocked in S218L may be due to an increased contribution of N-type channels to miniature release.  To test this, I applied 1 μM Ctx-GVIA and 50 nM Aga IVA sequentially on the same cell, and also in reverse order.  If N-type channels were increasing their contribution, when N-type channels are blocked first mEPSC inter-event interval should not decrease after P-type channels are blocked.  From this data, the hypothesis is supported (Figure 3.7A), however, the result is somewhat conflicting.  If P-type channels were blocked first, I would expect to see an increase in inter-event interval back to WT levels when N-type channels are blocked, but the inter-event interval is not increased (Figure 3.7B).       54   Figure 3.7 N-type channels may be compensating for P-type channel block in S218L neurons.  (A) Mean data for the effect of 50 nM Aga IVA on mEPSC inter-event interval (WT: n = 5 cells, 5 animals; S218L n = 5 cells, 3 animals) *P<0.05.  (B) Mean data for the effect of 1 μM GVIA and 50 nM Aga IVA applied sequentially, on mEPSC inter-event interval (S218L n = 4 cells, 4 animals. *P<0.05, one-way ANOVA with Tukey’s post hoc test (between toxins) (C) Mean data for the effect of 50 nM Aga IVA and 1 μM GVIA applied sequentially, on mEPSC inter-event interval (S218L n = 5 cells, 5 animals) *P<0.05, one-way ANOVA with Tukey’s post hoc test (between toxins).   3.4 Discussion  The results show that for CA1 neurons, mean mEPSC amplitude but not frequency is increased in S218L mice compared to WT, indicating a gain-of-function phenotype.  mEPSC inter-event interval in CA1 neurons from S218L mice did not increase after 200 nM Aga IVA, which was unexpected, suggesting that in CA1 neurons mEPSC frequency in the S218L does not depend on increased basal Ca2+ influx through mutant P/Q-type channels at the resting membrane potential.  These observations are in sharp contrast those reported for the calyx of Held and the cortex.  Also notable, mEPSC frequency appears variable in CA1 neurons, and the contribution of P/Q- N- and R-type channels to miniature release in CA1 neurons of both WT and S218L mice appears highly variable.   55  A hyperpolarizing shift in activation is a common feature of FHM-1 Ca2+ channel mutations causing a gain-of-function phenotype (van den Maagdenberg et al., 2004; Tottene et al., 2005, 2009).  In the calyx of Held, the S218L mutation causes a hyperpolarizing shift of ∼13 mV, resulting in increased basal Ca2+ influx at resting membrane potentials leading to higher presynaptic Ca2+ concentration, increased frequency of miniature release, and increased Pr in slice recordings and in vivo.  Although increased frequency of miniature release was not observed here, the increased amplitude is consistent with the S218L mutation causing a gain-of-function phenotype in CA1 neurons.  The difference in mEPSC frequency observed between CA1 neurons and the calyx of Held may be due to differences in the presynaptic spatial arrangement of VGCCs, as the physical distance between presynaptic VGCCs and the Ca2+ sensors that trigger exocytosis of neurotransmitter-containing vesicles is a key determinant of the signaling properties of synapse (Eggerman et al., 2011).  Presynaptic factors contributing to miniature release 1. Subcellular distribution of P/Q- N- and R-type channels at the synapse   Several presynaptic factors may account for the differences in miniature release observed between the current results and those observed at the calyx of Held synapse.  For example, the presynaptic arrangement of P/Q- and N-type channels of SC-CA1 synapses is in sharp contrast to the juvenile calyx of Held.  In the calyx of Held, the physical distance between presynaptic VGCCs and Ca2+ sensors triggering exocytosis is a key determinant of the efficacy and speed of synaptic transmission (Wu et al., 1999; Neher and Sakaba, 2008).  It has been suggested that in the developing calyx of Held, synaptic vesicles reside 30–300 nm from neighboring VGCC clusters (Meinrenken et al., 2002), and that the coupling distance between vesicles and 56  VGCCs becomes shorter as the animal matures (Fedchyshyn and Wang, 2005).  Co-labeling experiments at the calyx of Held have shown that a substantial fraction of N- and R-type channels are located distant from release sites, which would decrease their efficacy to trigger release (Wu et al., 1999).  Indeed, although the more distant N- and R-type channels contribute to Ca2+ influx into terminals, they may not directly contribute to rapid release (Wu et al., 1999). In a study of mice age P14-P21 the SC-CA1 synapses exhibited release from individual vesicles generally triggered by a single VGCC and that only few functional VGCCs were distributed in the active zone and at variable distances to neighboring neurotransmitter vesicles (Scimemi and Diamond, 2012). Using morphologically realistic Monte Carlo simulations, the authors showed that this arrangement leads to a widely heterogeneous distribution of release probability across the vesicles docked at the active zone, and that depletion of the vesicles closest to VGCC could account for the Ca2+-dependence of short-term plasticity at these synapses (Scimemi and Diamond, 2012).  The authors suggested that the relative arrangement of VGCCs and vesicles contributes to the heterogeneity of release probability within and across synapses and also to vesicle depletion at smaller central synapses with low average release probabilities (Scimemi and Diamond, 2012).   2. Developmental Switching of presynaptic VGCCs In the calyx of Held, presynaptic VGCCs undergo developmental switching during the early postnatal period (Iwasaki and Takahashi, 1998).  Pharmacological dissection of the Ca2+ currents contributing to EPSCs have shown that at the early postnatal period (P4-P9), rat auditory brainstem synaptic transmission is mediated by P/Q- and N-type channels as well as a small fraction insensitive to Aga-IVA and Ctx-GVIA (blocked by 100 μM Cd2+) (Iwasaki and 57  Takahashi, 1998).  After P10, the Ctx-GVIA sensitive fraction, and the fraction insensitive to GVIA and Aga-IVA became undetectable (Iwasaki and Takahashi, 1998) and by P13 the presynaptic Ca2+ current is predominantly mediated by P/Q-type channels (Iwasaki et al, 2000).    Iwasaki and colleagues suggested that the developmental decline of sensitivity of synaptic currents to Ctx-GVIA is caused by the disappearance of presynaptic N-type Ca2+ channels and replacement with P/Q-type channels, rather than decoupling of presynaptic N-type channels from the exocytotic release machinery (Iwasaki et al., 2000).  The authors further suggested that channel type-specific sorting mechanisms rather than the regulation of de novo synthesis may underlie the developmental switch, and that the disappearance of N- and R-type channels changes the spatiotemporal profile of the presynaptic Ca2+ channel domain towards more synchronous release (Iwasaki et al., 2000).  In the calyx of Held study by Di Guilmi and colleagues (2014) mice were between age P11-P15 wherein presynaptic Ca2+ currents are predominantly mediated by P/Q-type channels thus S218L mutant P/Q-type channels would have a significant impact on basal Ca2+ levels. In cultured hippocampal neurons (in culture for 10-15 days), pharmacological dissection of Ca2+ currents contributing to EPSCs showed that immature excitatory hippocampal synapses predominantly utilize N-type channels in neurotransmitter release (Scholz and Miller, 1995).  During the first 1-3 weeks postnatal, synapses shifted to utilize both N- and Q-type channels, with Q-type channels predominating at more mature synapses (Scholz and Miller 1995).  Evidence for the participation of the Q-type as opposed to P-type was obtained by measuring the blocking actions of Aga-IVA and MVIIC (Scholz and Miller, 1995).  Although to my knowledge the developmental shift of VGCCs in the hippocampus has not been studied in rodent brain slices, this finding supports the results here showing a greater contribution of Q-type channels to 58  miniature release in CA1 neurons from WT mice.  In WT CA1 neurons, blockade of P- and Q-type channels increased inter-event interval, while blockade of P-type channels did not affect miniature release, demonstrating a greater role for Q-type channels in miniature release.    A developmental loss of N-type channels during postnatal development does not appear to occur to the same extent in the cortex.  At P10, Ctx-GVIA blocked EPSCs by approximately 42%, which remained similar until P40, wherein the remaining fraction of EPSCs after Ctx-GVIA was almost completely blocked by Aga-IVA (Iwasaki et al., 2000). As such, both N-type and P/Q-type Ca2+channels contribute to synaptic transmission in the cortex.    3. Spatiotemporal profile of Ca2+ signaling in the hippocampus Characterization of the composition of calcium channels in cultured mouse hippocampal neurons using FM dye release from presynaptic boutons induced by high potassium membrane depolarization followed by individual application of Aga-IVA and Ctx-GVIA, has shown that ~85% of synapses contain both N- and P/Q- type channels while ~15% depend exclusively on P/Q-type channels (Nimmervoll et al., 2013).  Highlighting the specialized contribution of N- and P/Q-type VGCCs to neurotransmitter release, at mouse hippocampal mossy fiber-CA3 synapses, Ca2+ entry through P/Q-type VGCCs controls synchronous glutamate release by promoting the recruitment of additional release sites through spatially homogenous Ca2+ elevations, while N-type channels control a limited number of release sites through highly localized Ca2+ elevations and also support short-term facilitation by enhancing multi-vesicular release (Chamberland et al., 2017).  Interestingly, Ca2+ entering through N-type channels is less important than Ca2+ from P/Q-type channels for short-term facilitation which is consistent with the notion of microdomain signaling by P/Q-type channels in which P/Q-type channels have 59  access to more release sites (Vyleta and Jonas 2014).  Together, these findings demonstrate that both N- and P/Q-type channels substantially contribute to the spatiotemporal profile of the presynaptic Ca2+ channel domain in the hippocampus.  4. Ca2+-independent miniature release  The decrease in inter-event interval in response to blocking P-type channels in S218L and the N-type channel in WT was unexpected.  To my knowledge, in CA1 neurons a decrease in mEPSC inter-event interval in response to blockade of N-type channels in WT or P-type channels in S218L has not been previously described.  Given that sequential blockade of P- and N-type channels in S218L, or P/Q- and N-type channels in the WT, did not cause an additive increase in inter-event interval, this suggests that channels do not compensate and/or increase their respective contributions to miniature release, and further that the channels do not act independently at non-overlapping populations of release sites (Wheeler et al., 1994).  It is possible that the decrease in mEPSC inter-event interval may be mediated by a Ca2+-independent mechanism, either through cAMP-dependent protein kinase (PKA), Protein kinase C (PKC) or through brain-derived neurotrophic factor (BDNF). PKA is a well-known regulator of hippocampal synaptic transmission and can be activated during neuronal activity after increases in cAMP either through the action of neuromodulators on GPCRs or by activation of Ca2+-dependent adenylyl cyclases (Piedras-Renteria et al., 2004).  Forskolin is a direct stimulator of adenylate cyclase and at WT hippocampal synapses causes a sharp increase in both mEPSC frequency (Chen et al., 2003; Piedras-Renteria et al., 2004) and sAPEPSC frequency, without alteration in amplitude (Chen et al., 2003).  PKC activation also enhances synaptic transmission in the hippocampus.  Phorbol 60  esters mimic the endogenous activator of PKC, diacylglycerol (DAG), causing increased mEPSC frequency and sAPEPSC frequency, without alteration in amplitude (Chen et al., 2003).  Additionally, phorbol esters and DAG can bind to the C1 domain of the active zone protein Munc13 essential for priming synaptic vesicles, dramatically increasing neurotransmitter release (Rhee et al., 2002; Südhof, 2012).   It has been demonstrated that forskolin occludes the effects of phorbol ester on mEPSCs in human dentate gyrus granule cells, which implies that PKA and PKC share a common signaling pathway.  It is possible that blockade of P-type channels in S218L may specifically recruit the activation of PKA and/or PKC through an unknown mechanism, causing a net effect of decreased mEPSC inter-event interval. Another molecule known to increase mEPSC frequency in the hippocampus BDNF through tyrosine kinase B (TrkB) receptor activation.  It has been demonstrated that BDNF specifically increases the number of docked vesicles at active zones of excitatory synapses on CA1 dendritic spines enhancing quantal neurotransmitter release, with only a small increase in active zone size (Tyler and Pozzo-Miller, 2010).  BDNF increased the frequency, but not the amplitude, of AMPA receptor-mediated mEPSCs recorded from CA1 neurons (Tyler and Pozzo-Miller, 2010) In conclusion, several presynaptic factors may be contributing factors to the rate of miniature release in CA1 neurons and thus account for the difference in mEPSC frequency observed between CA1 neurons and at the calyx of Held synapse.  Differences in the rate of miniature release between the synapses are likely due to differences in the presynaptic spatial arrangement of VGCCs at synapses, as the physical distance between presynaptic VGCCs and the Ca2+ sensors is a major contributor triggering exocytosis.  Other presynaptic factors that may account for the observed differences include developmental switching of presynaptic VGCC 61  types, the spatiotemporal profile of Ca2+ signaling in the hippocampus, and Ca2+-independent miniature release.                  62  CHAPTER 4: CONTRIBUTION OF P/Q-TYPE CHANNELS TO EVOKED SYNAPTIC ACTIVITY IN CA1 NEURONS IN WT AND S218L MICE 4.1 Introduction The large hyperpolarizing shift in channel activation observed in S218L mice is accompanied by a gain-of-function of transmitter release, demonstrating relevance for glutamatergic transmission (Di Guilmi et al., 2014; Vecchia et al., 2015).  In addition to increased basal Ca2+ and increased levels of miniature transmitter release that have been observed at the calyx of Held synapse, these biophysical changes include faster recovery from synaptic depression and enhanced synaptic strength despite smaller action-potential-elicited Ca2+ currents (Di Guilmi et al., 2014).  The gain-of-function synaptic phenotype has been proposed to explain the misbalance between excitation and inhibition in neuronal circuits resulting in a persistent hyper-excitability state (Di Guilmi et al., 2014; Vecchia et al., 2015). The increased amplitude of evoked EPSCs (eEPSCs) observed in the calyx of Held from S218L mice is evidence for increased Pr and increased synaptic strength (Di Guilmi et al., 2014).  The authors suggest that increased basal Ca2+ concentration is responsible for the increased amplitude in the eEPSCs (Di Guilmi et al., 2014).  Changes in the size of the RRP were not observed in the S218L, suggesting that increased EPSC amplitude is caused by an increase in the Pr of vesicles in the RRP and that the effect of increased basal Ca2+ concentration outweighs the reduction in AP-induced Ca2+ influx (Di Guilmi et al., 2014). CDF of presynaptic Ca2+ currents at the calyx of Held is characterized by a small hyperpolarizing shift in the voltage dependence of activation (Borst and Sakmann, 1998), however in S218L mice this shift is occluded by the much larger shift induced by the mutation (Di Guilmi et al., 2014). Relative to unfacilitated P/Q-type channels from WT mice, P/Q-type 63  channels from S218L knock-in mice are in a basally facilitated state precluding CaM-mediated CDF and basally increasing presynaptic Ca2+ influx and transmitter release during action potentials (Adams et al., 2010).  Given the impact of S218L P/Q-type channels on synaptic facilitation, the S218L mouse model was an interesting model to study different modes of transmitter release in CA1 neurons. Recent data from the Snutch lab has showed that CA1 neurons from S218L mice exhibit a higher sensitivity to Aga-IVA during evoked neurotransmitter release.  As an extension of the hypothesis in section 3.1, I hypothesized that the altered sensitivity of CA1 synaptic signalling to Aga-IVA in S218L mice may result from enhanced coupling of P/Q-type channels to the RRP.  To test this hypothesis, I tested the contribution of P/Q-type channels to both spontaneous action potential evoked release and evoked release. Paired-pulse eEPSCs were recorded to test the functional consequences of altered presynaptic Ca2+ currents in the S218L mutant on evoked release.  To test the frequency dependence of synaptic transmission, evoked release was triggered by trains of 10 Hz frequency stimulation.   4.2 Methods 4.2.1 Animals WT and transgenic S218L littermates postnatal day (P)20–P30 male and female mice were used in all experiments and were genotyped as previously described (van den Maagdenburg et al., 2004). 4.2.2 Acute Brain Slice Preparation Mice were deeply anesthetized using isoflurane [5% in oxygen (vol/vol)] and sacrificed by decapitation. The brains were removed rapidly and transferred to ice-cold sucrose-artificial 64  cerebral spinal fluid (sucrose-aCSF) containing 214 mM sucrose, 26 mM NaHCO3, 1.25 mM NaH2PO4, 11 mM glucose, 2.5 mM KCl, 0.5 mM CaCl2, 6 mM MgCl2, bubbled with 95% O2: 5% CO2.  The brain was glued to a cutting chamber in a vibrating microtome (VT 1200; Leica), which was filled with ice-cold sucrose-aCSF.  4.2.3 Acute Brain Slice Electrophysiology Horizontal brain slices (350 μm thick) were cut from the level of the ventral hippocampus.  Slices were incubated at 33–35 °C in aCSF containing 126 mM NaCl, 2.5 mM KCl, 26 mM NaHCO3, 1.5mM NaH2PO4, 2 mM CaCl2, 2 mM MgCl2, 10 mM glucose bubbled with 95% O2: 5% CO2.  Slices were transferred to a recording chamber super-fused with aCSF additionally containing 100 μM picrotoxin, and were maintained at 33–35 °C.  CA1 neurons were visualized using a DIC microscope and infrared camera, and were visually identified by their location, morphology, and orientation.  The whole-cell patch-clamp electrophysiology technique was performed to record eEPSCs.  The internal pipette solution contained 120 mM potassium-gluconate, 10 mM HEPES, 1 mM MgCl2, 1 mM CaCl2, 11 mM KCl, 11 mM EGTA, 4 mM Mg-ATP, 0.5 mM Na-GTP, and 0.2 mM picrotoxin (pH 7.3 adjusted with KOH and osmolality 290 mOsm/kg adjusted with D-mannitol).  The recording chamber was grounded with an Ag/AgCl pellet.  Recordings were done using a Multiclamp 700B amplifier and pClamp software version 10 (Molecular Devices). To evaluate sAPEPSCs, in voltage clamp mode cells were held at a membrane potential of −50 mV during a 60-s gap-free recording. Data acquisition was sampled at 20 kHz and filtered at 2.4 kHz.  Series resistance was compensated to 70%.  To evaluate paired-pulse eEPSCs and 10 Hz frequency eEPSCs, stimulation was delivered via a concentric electrode placed in the CA3 Schaffer collaterals using a S48 square-pulse stimulator (Grass Technologies).  A stimulation 65  voltage was selected for each cell that was marginally subthreshold for the maximal amplitude response.  Although the stimulation voltage varied from cell to cell, the same stimulation voltage was used to elicit eEPSCs before and after toxin in the same cell.  Each eEPSC stimulation protocol was applied four times (30-s intersweep interval), and the mean for each eEPSC response was taken to minimize variability between cells.  For paired-pulse eEPSCs, stimulation was applied at 15 pulses per second with a 70-ms interpulse interval.  For 10 Hz stimulation, stimulation was applied with a 92-ms interpulse interval for 1-s.    4.2.4 Toxins  Pharmacological dissection of the Ca2+ current components in was performed using the peptide toxin Aga-IVA.  Aga-IVA was reconstituted in sterile nanopure water as described in section 3.2.3, for a stock concentration of 50 mM, and a diluted 1000X in aCSF for a working concentration of 200 nM Aga-IVA to block the Q-type channel. After a control eEPSC recording, 200 nM Aga-IVA was circulated through the perfusion system for 10 minutes before eEPSCs were recorded again to determine the contribution of the P/Q-type channel.  A single toxin was used on each cell.  4.2.5 Data Analysis Electrophysiological data analysis was performed using Clampfit (v9; Molecular Devices).  eEPSC amplitude and inter-event interval was detected by creating an appropriate template for detection in Clampfit.  Graphing and statistical analyses were performed using Origin (v8.6; OriginLab). Statistical significance was calculated using Student’s two-sample t test (paired where relevant). One-way ANOVA with Tukey’s post hoc test was used for multiple 66  comparisons. Cumulative distributions were compared using the Kolmogorov–Smirnov test. Data are plotted as mean ± SE.  4.3 Results  4.3.1 sAPEPSC amplitude is decreased in S218L CA1 neurons.  Various gain-of-function phenomena in the FHM1 S218L mouse model have been reported (van den Maagdenberg et al., 2004; Tottene et al., 2005; Vecchia et al., 2015).  Here, I studied the consequences of the S218L mutation in P/Q-type channels on spontaneous action potential evoked release and evoked release in CA1 neurons.  Whole cell patch clamp electrophysiology was performed using a voltage clamp protocol to record sAPEPSCs, and eEPSCs at different stimulation frequencies in CA1 neurons of WT and S218L mice. Aga-IVA (200 nM) was applied to determine the contribution of P/Q- type channels on evoked synaptic activity in WT and S218L neurons.    Unexpectedly, sAPEPSC amplitude was decreased and inter-event interval was increased (frequency was decreased) in S218L neurons compared to WT neurons (Figure 4.1).  This result contrasts with the results comparing miniature release in which mEPSC amplitude was increased in S218L compared to WT neurons, but that mEPSC inter-event interval was not different between WT and S218L (Figure 3.1).  I conclude that this result indicates that the contribution of sAP release is larger than the contribution of miniature release in both WT and S218L CA1 neurons.  67   Figure 4.1 sAPEPSC amplitude is decreased in S218L CA1 neurons.  (A) Comparison of mean sAPEPSC amplitude recorded from CA1 neurons in WT and S218L mice.  (B) Comparison of mean sAPEPSC inter-event interval between WT and S218L CA1 neurons. WT: n = 6 cells, 6 animals; S218L n = 6 cells, 5 animals for amplitude and inter-event interval) *P<0.05, two-sample t-test (between strains) (C) Cumulative probability analysis of sAPEPSC amplitude and (D) inter-event interval.  *P<0.01, Kolmogorov-Smirnov Test.    4.3.2 P/Q-type channels contribute to spontaneous action potential evoked synaptic activity in WT and S218L mice.  To investigate the contribution of P/Q-type channel-mediated Ca2+ influx on the rate of sAP release in CA1 neurons, sAPEPSC inter-event interval was measured in the presence of Aga-IVA (200 nM).  Unexpectedly, blockade of P/Q-type channels increased inter-event interval (decreased frequency) in WT but did not change the inter-event interval in S218L neurons.  This is in apparent contrast to the results previously observed in the Snutch lab, in which inter-event interval increased in S218L neurons but not WT neurons after P/Q-type channel blockade, but is in agreement with results in Figure 3.3 showing that blockade of P/Q-type channels increased the mEPSC inter-event interval in WT but did not affect the inter-event interval in S218L CA1 68  neurons (Figure 3.3).  I interpret these results to indicate that in CA1 neurons from S218L mice the contribution of P/Q-type channels to the basal Ca2+ influx involved in the presynaptic mechanisms mediating the frequency of sAP neurotransmitter release is similar to the basal Ca2+ influx mediating the frequency of miniature release. This also suggests the possibility that the presynaptic mechanisms mediating sAP and miniature release may be similar between WT and S218L mice.   Figure 4.2 P/Q-type channels contribute to spontaneous action potential evoked synaptic activity in WT and S218L neurons.  (A) Representative current traces taken from 60-s voltage-clamp recordings at the CA1 soma showing the effect of 200 nM Aga-IVA on sAPEPSCs.  (B) Mean data for the effect of 200 nM Aga-IVA on sAPEPSC amplitude (WT: n = 5 cells, 5 animals; S218L n = 5 cells, 5 animals) *P<0.05 and (C) sAPEPSC inter-event interval (WT: n = 5 cells, 5 animals; S218L n = 5 cells, 4 animals) *P<0.05, two-sample t-test (control versus 200 nM Aga-IVA) (D) Cumulative probability analysis of sAPEPSC amplitude *P<0.01 and (E) inter-event interval *P<0.01, Kolmogorov-Smirnov Test.   Unexpectedly, compared to WT sAPEPSC amplitude was found to be decreased in S218L but increased to approximately WT levels when P/Q-type channels were blocked.  Conversely, in WT neurons sAPEPSC amplitude decreased after blockade of P/Q-type channels.  These data contrast with the blockade of P/Q-type channels concerning miniature release wherein 200 nM 69  Aga-IVA did not affect mEPSC amplitude in either WT or S218L neurons (Figure 3.3).  This suggests the possibility that in WT neurons P/Q-type channels contribute to the mechanisms mediating the amplitude of sAP events but that in S218L neurons, compensation of other VGCCs may cause an increased amplitude of sAP events. Presynaptic versus postsynaptic contribution to synaptic activity may also be differentially modulated between WT and S218L.  These results are also consistent with the notion that the mechanisms mediating the amplitude of events in sAP and miniature release differentially involve P/Q-type channels and/or are strain-specific.   4.3.3 P/Q-type channels contribute to evoked synaptic activity in WT and S218L mice.  To test the functional consequences of the S218L mutation on evoked release in CA1 neurons, I recorded paired-pulse eEPSCs in CA1 neurons via a concentric electrode placed in the CA3 Schaffer collaterals using a S48 square-pulse stimulator (Figure 4.3 A).  WT mice consistently exhibited a large unitary eEPSC response that increased in amplitude with increasing stimulation voltage.  In contrast, S218L neurons showed a range of EPSC responses that trended to being smaller compared to eEPSC amplitudes from WT (Figure 4.3B-C) and with amplitudes that did not increase with increasing stimulation voltage.  This effect was observed in three out of five cells.  This effect is consistent with the finding that AP-induced presynaptic Ca2+ current is reduced in the calyx of Held of S218L mice (Di Guilmi et al., 2014).  While mean eEPSC amplitude tended to be smaller in S218L neurons than in WT neurons, not all S218L neurons showed this effect.   Two out of five neurons showed larger eEPSC amplitudes that increased with increasing stimulation voltage, similar to the trend seen in WT neurons.  This finding was unexpected, and may suggest that other VGCCs may be compensating in S218L 70  mice depending on the VGCCs present at the synapse and/or the presynaptic configuration of synaptic VGCCs.             Figure 4.3 P/Q-type channels contribute to evoked synaptic activity in WT and S218L CA1 neurons. (A) Schematic of slice preparation used in whole-cell current-clamp recordings in CA1 neurons with paired (1-ms pulse, 70-ms interval) stimulation applied to CA3 axons. (B) eEPSC traces showing evoked paired-pulse synaptic currents observed from WT and (C) S218L mice (black, control; red, 200 nM Aga-IVA) (D) Mean data for eEPSC amplitude in response to 200-nM Aga-IVA (WT: n = 5 cells, 5 animals; S218L n = 5 cells, 4 animals) *P<0.05, paired-sample t-test (control versus 200 nM Aga-IVA) (E) Paired-pulse ratio of EPSC amplitude from the WT and S218L CA1 neurons. *P<0.05, paired-sample t-test (control versus 200 nM Aga-IVA) (The schematic in (A) was used with permission from Cain SM, Bohnet B, LeDue J, Yung AC, Garcia E, Tyson JR, Alles SR, Han H, van den Maagdenburg AM, Kozlowski P, MacVicar BA, Snutch TP (2017) In vivo imaging reveals that pregabalin inhibits cortical spreading depression and propagation to subcortical brain structures. Proc Natl Acad Sci U S A 114(9):2401-2406.)   71   Compensation of other VGCCs appears to be unlikely in WT neurons as blockade of P/Q-type channels with 200 nM Aga-IVA consistently reduced evoked quantal release (Figure 4.3B).  Decreased eEPSC amplitude was observed in all five WT neurons, with one neuron showing abolished evoked quantal release (Figure 4.3B, left).   In S218L neurons, as with the variability of EPSC amplitude, the contribution of P/Q-type channels was also variable.  In one neuron, 200 nM Aga-IVA abolished evoked quantal release (Figure 4.3C, left), while in two neurons blockade of P/Q-type channels decreased EPSC amplitude to a much smaller extent or did not decrease EPSC amplitude, and in two neurons Aga-IVA decreased EPSC amplitude ~50%.  Of note, a significant difference in the paired-pulse ratio comparing amplitude before and after Aga-IVA was in WT or S218L was not observed (Figure 4.3E), indicating the effect of 200 nM Aga-IVA is not presynaptic.  However, the paired pulse ratio comparing the control amplitude was increased in S218L compared to WT, indicating increased CDF in S218L neurons.  To test the frequency dependence of synaptic transmission, evoked release was triggered by trains of 10 Hz stimulation.  In WT CA1 neurons, eEPSCs initially showed facilitation but this did not appear to be the case at later pulses.  Blockade of P/Q-type channels in WT neurons decreased eEPSC amplitudes at all pulses (Figure 4.4A).  In S218L neurons, EPSCs initially showed facilitation but this was also variable at later pulses.  When S218L P/Q-type channels were blocked, eEPSCs also decreased at all pulses although to a lesser extent compared to WT.  A comparison of normalized EPSCs between WT and S218L neurons showed that facilitation appears to be similar between WT and S218L neurons, and was not found to be statistically significant.  72   Figure 4.4 Synaptic transmission is decreased at 10 Hz stimulation when P/Q-type channels are blocked in WT and S218L mice. (A) Mean data for EPSC amplitudes recorded at the CA1 soma during a 1-ms pulse, 92-ms interval stimulation at 10 Hz applied to CA3 axons (schematic shown in Figure 4.3A) in WT (n = 5 cells, 5 animals) and (B) S218L (n = 5 cells, 4 animals). (C) Comparison of the control trace between WT and S218L.  EPSC amplitude was normalized to the amplitude of the first pulse of the control and plotted as mean ± SEM as a function of the pulse number.  *P<0.05, one-way ANOVA with Tukey’s post hoc test (control versus 200 nM Aga-IVA, and between strains).              73  4.4 Discussion  Overall, the data reveal that features of CA1 evoked synaptic activity are affected by the S218L FHM-1 mutation.  In CA1 neurons, sAPEPSC amplitude is increased in WT compared to S218L, while inter-event interval is increased in S218L compared to WT.  Blockade of P/Q-type channels increased sAP inter-event interval in WT but did not change in S218L neurons.  Unexpectedly, blockade of P/Q-type channels decreased sAP EPSC amplitude in WT but increased sAP EPSC amplitude in S218L neurons to WT levels.  WT neurons consistently exhibited a large unitary EPSC response when evoked by paired-pulse stimulation that increased in amplitude with increasing stimulation voltage and that was reduced when P/Q-type channels were blocked.  In contrast, EPSC amplitude in S218L neurons tended to be smaller consistent with reduced AP-evoked Ca2+ influx; e.g., with amplitude not increasing with increasing stimulation voltage and evoked release strongly reduced when P/Q-type channels were blocked.  However, this effect was not consistent in all cells from S218L mice, and may indicate that other VGCCs compensate in S218L neurons as the contribution of P/Q-type channels to evoked release after 200 nM Aga-IVA was variable.  The S218L mutation occludes CDF of P/Q-type channels affecting the Ca2+-dependent regulation of P/Q-type channels.  At the PF-PC synapse, this occlusion of CDF likely renders P/Q-type channels in a basally facilitated state resulting in enhanced Ca2+ influx during evoked short APs through mutated channels in PF boutons relative to WT channels, and resulting in reduced short-term synaptic facilitation as measured by EPSPs using extracellular field recordings (Adams et al., 2010).  Increased AP evoked Ca2+ influx has also been observed in cultured cortical neurons from S218L mice (Vecchia et al., 2015).  At the calyx of Held synapse, CDF of the presynaptic Ca2+ current is characterized by a small hyperpolarizing shift in its 74  voltage dependence of activation (Borst and Sakmann, 1998) and this shift is occluded by the much larger hyperpolarizing shift caused by the S218L mutation (Di Guilmi et al., 2014) in agreement with the findings from PF-PC synapses.  In contrast, in CA1 neurons the S218L mutation caused reduced AP-evoked Ca2+ currents.  The Ca2+ sensor that is responsible the CDF of P/Q-type channels has a relatively high affinity for Ca2+ and increased basal Ca2+ influx through mutated P/Q-type channels may also contribute to mutated channels being in a facilitated state (Di Guilmi et al., 2014).  It has been suggested that the facilitated state induced by the S218L mutation reflects a state of enhanced open-channel probability (Adams et al., 2010).  The findings here from CA3-CA1 synapses show that EPSC amplitude in S218L neurons tends to be smaller compared to EPSC amplitudes from WT (Figure 4.3C), and that amplitude tends not to increase with increasing stimulation voltage.  This is consistent with decreased AP-elicited Ca2+ influx as seen in the calyx of Held.  However, this phenotype was not consistent across all cells from S218L mice and may represent differential compensation by other VGCCs.  Of note, the paired-pulse ratio (PPR; the size of the second pulse relative to the first) was not reduced as observed at PF-PC synapses, which is not consistent with a reduction in CDF (Adams et al., 2010).  Additionally, following ten 92-ms stimulations at 10 Hz, the S218L mutation did not decrease successive eEPSCs relative to the first pulse.  This suggests that CDF may not be a contributing and necessary component of synaptic plasticity in presynaptic terminals of CA1 neurons (Adams et al., 2010).  These results suggest that the biophysical properties of the S218L mutation might have different effects on synaptic activity based upon the types of presynaptic VGCCs, the presynaptic arrangement of VGCCs, and/or the contribution of VGCCs to evoked or miniature release. 75   The effect of 200 nM Aga-IVA on sAP release was unexpected.  Blockade of P/Q-type channels decreased sAPEPSC amplitude in WT and increased amplitude in S218L neurons, while inter-event interval increased (frequency decreased) in WT but did not change in S218L neurons.  This result is similar to findings from a recent study examining the effect of pregabalin on excitatory neurotransmission.  Pregabalin binds to the α2δ subunit of HVA channels, acutely inhibits calcium currents (Uchitel et al., 2010), chronically suppresses trafficking of channels (Bauer et al., 2010) and shows greater specificity for P/Q-type channels over N- and L-type channels (Dooley et al., 2002).  When recording sAPEPSCs, pregabalin (500 µM) decreased amplitude and increased inter-event interval in WT, while increasing amplitude and decreasing the inter-event interval in S218L (Cain et al., 2017).  A lower pregabalin concentration (100 µM) did not affect amplitude or inter-event interval in WT neurons but increased amplitude and inter-event interval in S218L neurons.  In contrast to my results, 500 µM pregabalin reduced the amplitude of eEPSPs in WT but not in S218L neurons, while 100 µM pregabalin did not affect the amplitude of eEPSPs in WT or S218L neurons (Cain et al., 2017). It has been suggested that strain-specific inhibition of evoked synaptic function may provide a molecular mechanism as to why pregabalin does not suppress the invasion of SD in the hippocampus in S218L mice (Cain et al., 2017).           76  Chapter 5: DISCUSSION  5.1 Main findings  The S218L FHM-1 mutation in P/Q-type channels results in a gain-of-function phenotype, mainly due to a leftward shift in channel activation resulting in an increased fraction of P/Q-type channels open at resting membrane potentials (Tottene et al., 2002).  Mutant channels stay open longer, and presumably allow more Ca2+ to enter presynaptic terminals resulting in enhanced glutamate release causing enhanced excitatory neurotransmission (Vecchia et al., 2015). The S218L mutation is associated with a particularly severe clinical syndrome which can include ataxia, nystagmus, generalized seizures, coma, stupor and sometimes fatal cerebral edema triggered by minor head trauma (Kors et al., 2001; Hadjikhani, 2007; Eikermann-Haerter et al., 2011).  Prior to this study, data from the Snutch lab had shown that CA1 neurons from S218L mice exhibited a higher sensitivity to Aga-IVA during sAP neurotransmitter release.  However, the underlying mechanism for this sensitivity to Aga-IVA in CA1 neurons was unknown.  Similarly, it was unknown whether the rate of miniature release in CA1 neurons from S218L mice depends on increased basal Ca2+ influx through mutated P/Q-type channels at resting potentials.  The main goal of this project was to investigate mechanisms underlying sensitivity to Aga-IVA in CA1 neurons of S218L mice.  My initial hypothesis was that the altered sensitivity of CA1 synaptic signalling to Aga-IVA in S218L mice may be due to altered expression in the ratio of the CaV2.1 –NP variant to +NP variant.  Alternatively, I hypothesized that the altered sensitivity may be due to either increased basal Ca2+ influx through mutated P/Q-type channels or enhanced coupling of P/Q-type channels to the synaptic release machinery involved in evoked release, spontaneous action potential evoked neurotransmitter release and 77  miniature release.  Although my findings suggest that S218L neurons may not show increased sensitivity to Aga-IVA, more experiments are required to determine this.  My first objective was to generate an expression profile of CaV α1, α2δ, and β subunits and CaV2.1 splice variants in CA1, CA3, and dentate gyrus regions in WT and S218L mice.  This was to determine whether distinct hippocampal regions showed altered expression of subunits and/or splice variants that would explain the increased sensitivity to Aga-IVA observed in S218L CA1 neurons.  Performing subunit-specific, and splice variant-specific quantitative real-time PCR on CA1, CA3 and dentate gyrus regions from WT and S218L mice, I found that CaV α1, α2δ, and β subunits are not differentially expressed between hippocampal regions, or between WT and S218L mice.  Of note, the inclusion or exclusion of the NP splice variant in CaV2.1 is the key determining factor of P/Q-type channel sensitivity to Aga-IVA (Bourinet et al., 1999) although the ratio of –NP/+NP was not differentially expressed between WT and S218L mice. My second objective was to determine whether the rate of miniature release in CA1 neurons from S218L mice depends upon increased basal Ca2+ influx through mutated P/Q-type channels at resting potentials.  Increased basal Ca2+ influx through mutated P/Q-type channels has been shown to increase the rate of miniature release in S218L mice (Di Guilmi et al., 2014).  I found that in CA1 neurons, mean mEPSC amplitude but not frequency increased in S218L compared to WT neurons, indicating a gain-of-function phenotype.  Unexpectedly, mEPSC inter-event interval in CA1 neurons from S218L mice did not increase after 200 nM Aga-IVA, suggesting that in CA1 neurons the presynaptic configuration of VGCCs at the synapse is likely a greater contributing factor to the frequency of miniature release, compared to increased basal Ca2+ influx through mutated P/Q-type channels at resting membrane potentials.  I also found that 78  mEPSC inter-event event interval decreased (frequency increased) after blockade of the P-type channel in the S218L, and after blockade of the N-type channel in WT, and that the decrease in inter-event interval is not due to other presynaptic VGCCs potentially increasing their contribution to miniature release. A third objective was to determine the contribution of P/Q-type channels towards spontaneous action potential evoked release, and evoked release.  Paired-pulse eEPSCs were recorded to test the functional consequence of the changes in altered presynaptic Ca2+ currents in the S218L mutant on evoked release.  To test the frequency dependence of synaptic transmission in CA1 neurons, evoked release was triggered by trains 10 Hz frequency stimulation.  sAPEPSC amplitude was found to be increased in WT neurons compared to S218L, while inter-event interval was increased in S218L compared to WT.  Blockade of P/Q-type channels increased sAP inter-event interval in WT but did not change in S218L neurons, and increased sAP EPSC amplitude to WT levels.  Blockade of P/Q-type channels decreased sAP EPSC amplitude in WT, but increased sAP EPSC amplitude in S218L neurons to WT levels.  WT neurons consistently showed a larger unitary EPSC response when evoked by paired-pulse stimulation and that increased in amplitude with increasing stimulation voltage, and EPSC amplitude was reduced when P/Q-type channels were blocked.  In contrast, EPSC amplitude in S218L neurons tended to be smaller compared to EPSC amplitudes from WT consistent with reduced AP-evoked Ca2+ influx, and evoked release was reduced when P/Q-type channels were blocked by 200 nM Aga-IVA.  However, this effect was not consistent in all cells from S218L mice, and suggests that other VGCCs may be compensating in S218L neurons.  My results also suggest that P/Q-channels may not be more tightly coupled to the RRP in CA1 neurons in S218L mice compared to WT, although this result is not conclusive and more experiments are required (see section 5.3). 79  5.2 Potential physiological relevance of findings The contrast in mEPSC frequency and the contribution of P/Q-type channels to miniature release observed in the S218L between CA1 neurons and the calyx of Held provides further support that the presynaptic spatial arrangement of synaptic VGCCs and the physical distance between presynaptic VGCCs and the Ca2+ sensors that trigger exocytosis of neurotransmitter-containing vesicles, are key determinants of the signaling properties of synapse.  Other presynaptic factors that may contribute to the variability in mEPSC frequency observed in WT and S218L mice between CA1 neurons and the calyx of Held include developmental switching of presynaptic VGCCs and Ca2+ independent miniature release. I find that mEPSC amplitude is increased in S218L compared to WT in CA1 neurons, with no difference in inter-event interval between the two strains. This contrasts with that for the calyx of Held, but is consistent with a gain-of-function phenotype observed in FHM-1 mutations.  Blockade of P/Q-type channels increased inter-event interval in WT but did not affect the inter-event interval in S218L CA1 neurons.  The overall increase in mEPSC amplitude observed in S218L mice may be presynaptic and/or postsynaptic in origin, and may be either intersynaptic or intrasynaptic.  Presynaptically, amplitude is affected by: (a) multivesicular release, (b) the number and type of VGCCs at individual active zones, (c) differences in the size of synaptic vesicles which generate correspondingly different quantal units, (d) the effectiveness of individual VGCCs to cause vesicle fusion depending on the spacing between the VGCC and vesicle, and (e) the relative number of synaptic vesicles that are primed and available for release (Atwood and Karunanithi, 2002).  Postsynaptically, amplitude is thought to provide a measure of the number of receptors in the postsynaptic density (Raghasvachari and Lisman, 2004; Kaeser and Regehr, 2014).  In contrast, sAPEPSC amplitude was increased in WT compared to S218L 80  neurons, while there was no difference in inter-event interval between the two strains.  Blockade of P/Q-type channels increased sAP inter-event interval in WT but did not change the inter-event interval in S218L neurons, and had inverse effects on sAP EPSC amplitude.  Blockade of P/Q-type channels decreased sAP EPSC amplitude in WT, increased sAP EPSC amplitude in S218L neurons to WT levels, and increased the inter-event interval in WT but did not change in S218L neurons, together suggesting that P/Q-type channels do not contribute to the rate of sAP or miniature release in S218L neurons.  The amplitude of miniature postsynaptic currents is variable and three sources of synaptic variability have been proposed to explain differences in the size and shape (Franks et al., 2003).  One source of variability is stochastic fluctuation in the number of activated postsynaptic receptors (“channel noise”), a second source is variations of glutamate concentration in the synaptic cleft (Δq), and a third source is differences in the potency of vesicles released from different locations on the active zone [release-location dependence (RLD)] (Franks et al., 2003).  Using Monte Carlo simulations of single glutamatergic synapses, it has been found that the dominant source of variability is from Δq (58% of total variance), while RLD also accounts for a significant amount of variability (36%) (Franks et al., 2003).  Simulations also showed that potency of release sites decreased with a length constant of ~100 nm, and that receptors were not activated by release events >300 nm away, which is consistent with the observation that single active zones are rarely >300 nm (Franks et al., 2003).  It has also been found that quantal size depends more strongly on the density of postsynaptic channels than their number, which has important implications for synaptic strength (Raghavashari and Lisman, 2004).  Given that mEPSC amplitude is increased in S218L compared to WT, while mEPSC amplitude was not 81  different between WT and S218L in the calyx of Held, Δq and RLD are likely important factors in miniature release in CA1 neurons of S218L mice. Differences in the contribution of P/Q-type channels to miniature, sAP, and evoked release also highlight strain specific differences in synaptic signaling in the hippocampus.  Pregabalin inhibits vesicle trafficking in hippocampal neurons reducing the RRP (Holz, 2006) and attenuating vesicle release (Micheva et al., 2006).  500 µM pregabalin inhibited sAP and evoked synaptic activity in WT but not S218L CA1 neurons suggesting that strain/mutation-specific inhibition of evoked synaptic function affects the invasion of SD into the hippocampus in S218L mice (Cain et al., 2017).  My results demonstrate that P/Q-type channels contribute presynaptically in WT, and potentially postsynaptically to sAP release in WT and S218L, and make a large contribution to evoked release in WT and S218L neurons.  Differences in the contributions of P/Q-type channels between WT and S218L may arise from differences in presynaptic strength (highlighted in Figure 1.5).  My results provide further support for strain specific roles of P/Q-type channels in synaptic activity between WT and S218L channels. Previous studies have found that spreading depression is limited to the cortex in WT but can invade subcortical structures such as the striatum, hippocampus and occasionally thalamus in S218L mice (Eikermann-Haerter et al., 2011; Cain et al., 2017).  S218L mice exhibit a lower SD threshold in vivo and increased cortical SD conduction velocity compared to WT, and that pregabalin slows the speed of SD in S218L but not WT mice (Cain et al., 2017).  Cortical synapses expressing P/Q-type channels with the S218L mutation display enhanced excitatory, but not inhibitory, neurotransmission (Vecchia et al., 2014).  It has been suggested that SD threshold is not linked directly to synaptic activity but rather to enhanced basal neuronal excitability in the cortex (Cain et al., 2017).  Pregabalin also differentially prevents subcortical 82  invasion of SD in FHM 1 mice strains, and strain-specific inhibition of evoked synaptic function has been suggested to provide a molecular mechanism for pregabalin to suppress the invasion of the hippocampus in R192Q mice but not in S218L mice (Cain et al., 2017).  Further studies in the contribution of P/Q-type channels in different modes of neurotransmitter release, and factors underlying miniature release, would be useful towards elucidating how drugs targeting P/Q-type channels might impact neurotransmission in patients with the severe form of FHM-1. Field electrical stimulation and confocal imaging of the vesicular turnover marker FM1-43 from presynaptic boutons at cultured cortical terminals has been used to compare release rates between synapses (Prange and Murphy, 1999).  A comparison of loading FM1-43 into vesicle pools of synaptic boutons either by a large number of AP-inducing field stimuli in the presence of FM1-43 to allow complete endocytosis (the control population), or by loading FM1-43 using elevated external Ca2+ and TTX to facilitate miniature activity, showed that synapses with higher rates of miniature release activity exhibit significantly enhanced evoked release probabilities compared with controls (Prange and Murphy, 1999).  It has been suggested that this is most likely caused by differences in release probability, that co-regulation of miniature synaptic activity and AP-evoked release probability exists at presynaptic terminals, and that the frequency of miniature synaptic activity can be used as an indicator for the efficacy of evoked release (Prange and Murphy, 1999).  Furthermore, the degree of miniature synaptic activity is correlated with vesicle pool size (Prange and Murphy, 1999).  Although my results show that the rate of miniature release and sAP release are both variable at the CA3-CA1 synapse, a correlation between miniature synaptic activity and evoked release cannot be ruled out. The hippocampus is a subcortical limbic structure closely related to stress adaptation and classically known to be involved in memory, learned behavior and seizure activity, and recently 83  also implicated as being involved in pain processing (Malecki et al., 2013).  Hippocampal dysfunction may be associated with amnesia, limbic disturbances such as dysphoria and yawning, and fluid retention during a migraine attack (Malecki et al., 2013).  Cognitive and memory deficits have been reported in families with FHM-1, and also in small and large cohorts of common forms of migraine with and without aura (Dilekoz et al., 2015). FHM-1 gain-of-function mutations have been shown to enhance hippocampal excitatory transmission and LTP, even though learning and memory are paradoxically impaired (Dileokz et al., 2015).  It has been suggested that abnormally enhanced plasticity can be as detrimental to efficient learning as reduced plasticity, potentially highlighting how enhanced neuronal excitability may impact cognitive function (Dilekoz et al., 2011).  Migraine attacks can be viewed as repeated stressors with physiological and/or emotional stressors provoking intermittent attacks, and alterations in hippocampal structure and neurotransmission may play an important role in the pathophysiology of FHM-1 (Malecki et al., 2013).    5.3 Potential limitations   The qRT-PCR technique utilized here analyzed a population of cells from the dissected tissue thus the exact proportions of CaV channel subunits and splice variants may not generalize to individual cells.  Additionally, copy number analysis was not performed on the qPCR probes to correct for probe efficiency, thus expression levels of CaV channel subunits and splice variants cannot be directly compared.    Miniature release can be highly variable as CA1 neurons receive inputs to the distal tufts from the entorhinal cortex through the perforant pathway and from the thalamus while the remainder of the dendrite receives input from CA3 through the Schaffer collateral axons 84  (Spruston, 2008).  CA3 neurons closer to CA1 project primarily to apical dendrites while CA3 neurons that are closer to CA1 project primarily to basal dendrites (Spruston, 2008).  The amplitude and frequency of mEPSC events could also be influenced by the inputs CA1 neuron receive and the presynaptic arrangement of VGCCs from the input neurons.  Additionally, the CA3-CA1 synapse is a more homogenous synapse when recording evoked EPSCs rather than mEPSCs as synaptic inputs are primarily from CA3 neurons.  Additionally, this study only focused on electrophysiological recordings and the contribution of P/Q- N- and R-type channel to excitatory miniature neurotransmission.  Differences in various synaptic proteins may also contribute to differences in miniature release in CA1 neurons between WT and S218L mice.  5.4 Future Directions  In investigating the increased sensitivity to Aga-IVA previously observed in S218L CA1 neurons in the Snutch lab, an important set of future experiments consist of determining the exact contributions of P-, N- and R-type channels in sAP release and evoked release.  Given that blockade of P/Q-type channels did not abolish paired-pulse EPSCs in all WT or in S218L neurons, it is important to determine the contribution of N- and R-type channels in evoked synaptic transmission in order to determine whether other VGCCs compensate for release. Additionally, as Q-type channels have been shown to be predominant in supporting hippocampal synaptic transmission (Wheeler et al., 1994) it would be relevant to determine the specific contribution of P-type channels in both WT and S218L mice, to determine if S218L neurons show increased insensitivity to P-type channel block (by 50 nM Aga-IVA) compared to WT neurons.   85   The physical distance between presynaptic VGCCs and Ca2+ sensors of exocytosis is a key determinant of the efficacy of synaptic transmission (Neher and Sakaba, 2008). Using the Ca2+-chelating buffer EGTA may determine whether P/Q-type channels are more tightly coupled to synaptic vesicles in CA1 neurons of S218L mice, providing a mechanism for the increased sensitivity to Aga-IVA.  EGTA (10 mM) exhibits slower binding kinetics that cannot intercept Ca2+ from VGCCs in the immediate vicinity of synaptic vesicles but can capture Ca2+ from more distant VGCCs (Wang et al., 2009).  If primed vesicles are more tightly coupled to P/Q-type channels in CA1 neurons of S218L mice, it would be more difficult for EGTA to intercept Ca2+ as it diffuses from the channel mouth to Ca2+ sensors (Fedchychyn and Wang, 2005).  This experiment in combination with the respective toxin, would also determine the relative roles of P-, Q-, N- and R-type channels in “microdomain” signaling involving cooperative action of loosely coupled channels to synaptic vesicles, and “nanodomain” signaling in which opening of fewer tightly coupled channels effectively induces a fusion event at CA3-CA1 synapses (Fedchychyn and Wang, 2009).  Nanodomain coupling (<100 nm) between VGCCs and the Ca2+ sensors of exocytosis (Eggermann and Jonas, 2012) increases release probability, reduces synaptic delay and sharpens the time course of quantal release (Goswarmi et al., 2013). Microdomain coupling (>100 nm) (Eggermann and Jonas, 2012) may enable presynaptic forms of synaptic plasticity (Ahmed and Siegelbaum, 2009).  Spatial tightening improves release efficiency (Fedchychyn and Wang, 2005) and it is important to determine the relative contributions of VGCCs at hippocampal synapses with S218L P/Q-type channels.   The data here suggest that P/Q- and R-type channels both act as a Ca2+ source in miniature release although a large component appears to be Ca2+-independent.  Future experiments could examine the Ca2+-dependence in miniature release.  For example, to 86  investigate whether mEPSCs depend upon extracellular Ca2+, the extracellular Ca2+ concentration in the aCSF could be reduced from 2 mM to 0.2 mM.  Alternatively, to test if VGCCs are a primary source of the Ca2+ influx driving miniature release is to alter the presynaptic resting potential, which would affect the probability of presynaptic VGCCs opening (Awatramani et al., 2005).  To test this, the extracellular K+ concentration in the aCSF could be manipulated which would change the presynaptic membrane potential (Goswarmi et al., 2013).  If VGCCs are a primary source of the Ca2+ influx driving miniature release, decreasing extracellular K+ would decrease the frequency of mEPSCs as this would hyperpolarize the membrane potential and decrease the probability of channel opening (Goswarmi et al., 2013).  Increasing the extracellular K+ would increase the frequency of mEPSCs as this would depolarize the membrane and increase the probability of channel opening (Goswarmi et al., 2013).   In addition, future experiments could address whether the increased sensitivity to Aga-IVA results from synaptic vesicles in S218L neurons being in a more fusogenic state compared to WT CA1 neurons.  To test this, transmitter release would be induced by a subsaturating hypertonic stimulation (250 mM sucrose) and compared with release induced by a saturating stimulus (500 mM sucrose) (Grauel et al., 2016).  If release rates are identical, this would indicate that there is no difference in vesicle fusogenicity (Grauel et al., 2016).  Hypertonic sucrose solutions cause fusion and release of synaptic vesicles from the same RRP as APs, but act via a Ca2+-independent stimulus as hypertonic sucrose induced EPSCs are not changed when intracellular Ca2+ is buffered by BAPTA or when Ca2+ influx through VGCCs is blocked by cadmium (Alabi and Tsien, 2012)  Changes in the kinetics of synaptic responses to hypertonicity-induced fusion of synaptic vesicles may be interpreted as changes in the intrinsic 87  ‘release willingness’ or ‘fusogenicity’ of synaptic vesicles, which may represent an inverse measure for the activation energy for synaptic vesicle fusion (Schotten et al., 2015).   5.5 Conclusions   Here, I have shown that CaV subunits and P/Q-type splice variants are not differentially expressed between WT and S218L mice. Further, in contrast to the calyx of Held synapse that in CA1 neurons the contribution of P/Q-, N- and R-type channels to miniature release is highly variable in WT and S218L mice.  This suggests that the CA1 presynaptic spatial arrangement of VGCCs is a key determinant for miniature release and likely has a greater contribution towards miniature release than the gain-of-function introduced by the S218L mutation.  P/Q-type channels make a large contribution to the rate of sAP release in WT but not S218L CA1 neurons.  P/Q-type channels also have a large contribution towards evoked release in WT and S218L neurons, although the contribution of P/Q-type channels appears more variable in S218L and may suggest that other VGCCs are compensating in evoked release.  Additionally, EPSC amplitude tended to be much smaller in S218L neurons compared to WT neurons, suggesting that S218L CA1 neurons have reduced AP-evoked Ca2+ influx.  These results suggest that S218L neurons may not show increased sensitivity to Aga-IVA compared to WT, although future experiments are required to clarify this hypothesis.          88  References  Adams PJ, Garcia E, David LS, Mulatz KJ, Spacey SD, Snutch TP (2009) Cav2.1 P/Q-type calcium channel alternative splicing affects the functional impact of familial hemiplegic migraine mutations. Channels 3(2):110-121. Adams  PJ, Rungta  RL, Garcia  E, van den Maagdenberg  AM, MacVicar  BA, Snutch  TP. (2010) Contribution of calcium-dependent facilitation to synaptic plasticity revealed by migraine mutations in the P/Q-type calcium channel. Proc Natl Acad Sci U S qqqqqqA107:18694–18699. Alabi AA, Tsien RW. Synaptic Vesicle Pools and Dynamics. Cold Spring Harb Perspect Biol  4(8):a013680. doi:10.1101/cshperspect.a013680. Allen C, Stevens CF (1994) An evaluation of causes for unreliability of synaptic transmission.  Proc Natl Acad Sci 91:10380–10383.  Allen SE, Darnell RB, Lipscombe D (2010) The neuronal splicing factor Nova controls alternative splicing in N-type and P-type Cav2 calcium channels. Channels 4(6): 483-489. Amaral D, Lavenex P (2006) Hippocampal Neuroanatomy. In: Andersen P, Morris R, Amaral,  D, Bliss T, and O’Keefe J, Eds., The Hippocampus Book, Oxford University Press,  Oxford, 37-115. Andreae LC, Burrone J (2015) Spontaneous Neurotransmitter Release Shapes Dendritic Arbors  via Long-Range Activation of NMDA Receptors. Cell Reports 10(6):873-882 Ariel P, Hoppa MB, Ryan TA (2012) Intrinsic variability in Pv, RRP size, Ca2+ channel  repertoire, and presynaptic potentiation in individual synaptic boutons. Frontiers in  Synaptic Neuroscience 4:9. doi:10.3389/fnsyn.2012.00009. Arikkath J, Campbell KP (2003) Auxillary subunits: essential components of the voltage gated   calcium channel complex. Curr Opin Neurobiol 13:298-307. Armstrong CM and Matteson DR (1985) Two distinct populations of calcium channels in a clonal line of pituitary cells. Science 227(4682): 65-67. Atasoy D, Ertunc M, Moulder KL, Blackwell J, Chung C, Su J, Kavalali ET (2008) Spontaneous   and evoked glutamate release activates two populations of NMDA receptors with limited   overlap. J Neurosci 28: 10151–10166.  Atluri PP, Regehr WG. 1998. Delayed release of neurotransmitter from cerebellar granule cells. J  Neurosci 18:8214-8227. Atwood HL, Karunanithi S. Diversification of synaptic strength: presynaptic elements. Nat Rev  Neurosci 3(7):497-516. Awatramani GB, Price GD, Trussell LO (2005) Modulation of transmitter release by presynaptic resting potential and background calcium levels. Neuron 48(1):109-21. Bannerman DM, Sprengel R, Sanderson DJ, McHugh SB, Rawlins JN, Monyer H, Seeburg PH   (2014) Hippocampal synaptic plasticity, spatial memory and anxiety. Nat Rev Neurosci   181-192.  Bean BP (1985) Two kinds of calcium channels in canine atrial cells. Differences in kinetics, selectivity and pharmacology. J Gen Physiol 86:65-67. Bliss TV, Lomo T (1973) Long-lasting potentiation of synaptic transmission in the dentate area  of the anaesthetized rabbit following stimulation of the performant path. J Physiol  232:331-356. 89  Bourinet E, Soong TW, Sutton K, Slaymaker S, Mathews E, Monteil A, Zamponi GW, Nargeot J and Snutch TP (1999) Splicing of α1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci 2(5): 407-415. Brice NL, Dolphin AC. Differential plasma membrane targeting of voltage-dependent calcium    channel subunits expressed in a polarized epithelial cell line. J Physiol 515:685-694. Bauer CS, Rahman W, Tran-Van-Minh A, Lujan R, Dickenson AH, Dolphin AC (2010)  The anti-allodynic α2δ ligand pregabalin inhibits the trafficking of the calcium channel α2δ-1 subunit to presynaptic terminals in vivo. Biochem Soc Trans 38(2):525–528. Buraei Z, Yang J (2010) The β subunit of voltage-gated Ca2+ channels. J Physiol Rev 90:1461- 1506. Cain SM, Bohnet B, LeDue J, Yung AC, Garcia E, Tyson JR, Alles SR, Han H, van den  Maagdenburg AM, Kozlowski P, MacVicar BA, Snutch TP (2017) In vivo imaging  reveals that pregabalin inhibits cortical spreading depression and propagation to  subcortical brain structures. Proc Natl Acad Sci U S A 114(9):2401-2406. Catterall WA, Perez-Reyes E, Snutch TP, Striessnig J (2005) International Union of Pharmacology. XLVIII. Nomenclature and Structure-Function Relationships of Voltage Gated Calcium Channels. Pharmacol Rev 57:411-425. Catterall WA, Few AP (2008) Calcium channel regulation and presynaptic plasticity. Neuron. qqqqqq59(6):882-901. Catterall WA (2010) Ion channel voltage sensors: structure, function and pathophysiology. Neuron. 67:915-928. Catterall WA (2011) Voltage-Gated Calcium Channels. Cold Spring Harb Perspect Biol. qqqqqq3(8):a003947. doi: 10.1101/cshperspect.a003947. Carbone E, Lyx HD (1994) A low voltage activated, fully inactivating Ca2+ channel in vertebrate   sensory neurons. Nature 310(5977):501-502.  Clapham DE (2007) Calcium Signaling. Cell 131(6):1047-1048. Chamberland S, Evstratova A, Toth K (2017) Short-Term Facilitation at a Detonator Synapse  Requires the Distinct Contribution of Multiple Types of Voltage-Gated Calcium  Channels. J Neurosci 37(19):4913-4927. Chang SY, Yong TF, Yu CY, Liang MC, Pletnikova O, Troncoso J, Burgunder JM, Soong TW (2007) Age and gender-dependent alternative splicing of P/Q-type calcium channel EF-hand. Neuroscience 145: 1026-1036. Chaudhuri D, Alseikhan BA, Chang SY, Soong TW, Yue DT (2005) Developmental Activation of Calmodulin-Dependent Facilitation of Cerebellar P-Type Ca2+ Current. J Neurosci 25(36): 8282-8294. Chaudhuri D, Chang SY, DeMaria CD, Alvania RS, Soong TW, Yue DT (2004) Alternative Splicing as a Molecular Switch for Ca2+/Calmodulin-Dependent Facilitation of P/Q-Type Ca2+ Channels. J Neurosci 24(28): 6334-6342. Chaudhuri D, Issa JB and Yue DT (2007) Elementary Mechanisms Producing Facilitation of Cav2.1 (P/Q-type) Channels. J Gen Physiol 129(5): 385-401. Chen HX, Roper SN (2003) PKA and PKC Enhance Excitatory Synaptic Transmission in Human Dentate Gyrus. J Neurophysiol 89(5):2482-2488  Chen M, Manley JL (2009) Mechanisms of alternative splicing regulation:insights from molecular and genomics approaches. Nat Rev Mol Cell Biol 10(11):741-754. Chu PJ, Robertson HM, Best PM (2001) Calcium channel gamma subunits provide insights into  the evolution of the gene family. Gene 280:37-48. 90  Chung C, Barylko B, Leitz J, Liu X, Kavalali ET (2010) Acute dynamin inhibition dissects  synaptic vesicle recycling pathways that drive spontaneous and evoked  neurotransmission. J Neurosci 30: 1363–1376.  Couteaux R, Pecot-Dechavassine M (1970). L’Ouverture des vesicules synaptiques au niveau  des ‘zones actives.’ Septieme Congres International de Microscopie Electronique  (Grenoble, France) 709–710.  Davies A, Kadurin I, Alvarez-Laviada A, Douglas L, Nieto-Rostro M, Bauer CS, Pratt WS, Dolphin AC (2010) The α2δ subunits of voltage-gated calcium channels form GPI- anchored proteins, a posttranslational modification essential for function. Proc Natl Acad   Sci 107: 1654-1659. Debanne D, Guerineau NC, Gahwiler BH, Thompson SM (1996) Paired-pulse facilitation and depression at unitary synapses in rat hippocampus: quantal fluctuation affects subsequent release. J Physiol 491:163-176. Di Guilmi MN, Wang T, Inchauspe CG, Forsyth ID, Ferrari MD, van den Maagdenberg AMJM,  Borst JGG, Uchitel OD (2014) Synaptic Gain-of-Function Effects of Mutant Cav2.1 Channels in a Mouse Model of Familial Hemiplegic Migraine Are Due to Increased Basal [Ca2+]I. J Neurosci 24(21) 7047-7058. Dobrunz LE, Stevens CF (1997) Heterogeneity of release probability, facilitation, and depletion   at central synapses. Neuron 18: 995–1008.  Dolphin AC (2013) The α2δ subunits of voltage-gated calcium channels. Biochim Biophys Acta qqqqqq1828:1541-1549. Dooley DJ, Donovan CM, Meder WP, Whetzel SZ (2002) Preferential action of gabapentin and  pregabalin at P/Q-type voltage-sensitive calcium channels: Inhibition of K+-evoked [3H]-  norepinephrine release from rat neocortical slices. Synapse 45(3):171–190. Ducros A, Denier C, Joutel A, Cecillion M, Lescoat C, Vahedi K, Darcel F, Vicaut E, Bousser  MG, Tournier-Lasserve E (2001) The clinical Spectrum of Familial Hemiplegic Migraine  Associated with Mutations in a Neuronal Calcium Channel. N Engl J Med 345(1):17-24. Dunlap K, Luebke JI, Turner TJ (1995) Exocytotic Ca2+ channels in mammalian central neurons.   Trends Neurosci 18:89-98. Ishizuka N, Weber J, Amaral D (1990) Organization of intrahippocampal projections originating   from CA3 pyramidal cells in the rat. J Comp Neurol 295:580-623. Eggermann E, Bucurencie I, Goswami SP, Jonas P (2011) Nanodomain coupling between  Ca2+ channels and sensors of exocytosis at fast mammalian synapses. Nat Rev Neurosci 13(1):7-21. Eggermann E, Jonas P (2011) How the 'slow' Ca2+ buffer parvalbumin affects transmitter release in nanodomain-coupling regimes. Nat Neurosci. 15(1):20-2. Ehlers MD, Heine M, Groc L, Lee MC, Choquet D (2007) Diffusional trapping of GluR1 AMPA   receptors by input-specific synaptic activity. Neuron 54:447–60 Eikermann-Haerter K, Dilekoz E, Kudo C, Savitz SI, Waeber C, Baum MJ, Merrari MD, van den Maagdenberg AM, Moskowitz-MA, Ayata C (2009) Genetic and hormonal factors modulate spreading depression and transient hemiparesis in mouse models of familial  hemiplegic migraine type 1. J Clin Invest 119(1):99-109. Eikermann-Haerter K, Yuzawa I, Qin T, Wang Y, Baek K, Kim YR, Hoffmann U, Dilekoz E, Waeber C, Ferrari MD, van den Maagdenberg AM, Moskowitz MA, Ayata C (2011)  Enhanced Subcortical Spreading Depression in Familial Hemiplegic Migraine Type 1  Mutant Mice. J Neurosci 31(15): 5755-5763. 91  Ellinor PT, Yang J, Sather WA, Zhang JF, Tsien RW (1995) Ca2+ channel selectivity at a single locus for high-affinity Ca2+ interactions. Neuron 15:1121-1132. Ermolyuk YS, Alder FG, Surges R, Pavlov IY, Timofeeva Y, Kullman DM, Volynski KE. Differential triggering of spontaneous glutamate release by P/Q-, N-, and R-type Ca2+ channels.   Nat Neurosci 16(12):1754-1763. Ertel EA, Campbell KP, Harpold MM, Hofmann F, Mori Y, Perez-Reyes E, Schwartz A, Snutch TP, Tanabe T, Birnbaumer L, Tsien RW, Catterall WA (2000) Nomenclature of Voltage-Gated Calcium Channels. Neuron 25: 533-535. Escayg A, MacDonald B T, Meisler M H. et al Mutations of SCN1A, encoding a neuronal   sodium channel, in two families with GEFS+2. Nat Genet 4:343–345 Fedchyshyn MJ, Wang LY (2005) Developmental transformation of the release modality at the calyx of Held synapse. J Neurosci 25:4131–4140. Fisher SA, Fischer TM, Carew TJ (1997) Multiple overlapping processes underlying short-term synaptic enhancement. Trends Neurosci 20:170-77. Frankenhaeuser B, Hodgkin AL (1957) The action of calcium on the electrical properties of   squid axons. J Physiol. 137:218–44  Gasparini CF, Sutherland HG, Griffiths LR. (2013) Studies on the Pathophysiology and Genetic   Basis of Migraine. Curr Genomics 14(5): 300-315.  Goswami SP, Bucurenciu I, Jonas P (2012) Miniature IPSCs in hippocampal granule cells are   triggered by voltage-gated Ca2+ channels via microdomain coupling. J Neurosci  s32:14294–304. Gray EG (1963) Electron microscopy of presynaptic organelles of the spinal cord. J Anat  97:101-106. Groemer TW, Klingauf J (2007) Synaptic vesicles recycling spontaneously and during activity   belong to the same vesicle pool. Nat Neurosci 10: 145–147 Harata N, Ryan TA, Smith SJ, Buchanan J, Tsien RW 2001b. Visualizing recycling synaptic   vesicles in hippocampal neurons by FM 1–43 photoconversion. Proc Natl Acad  Sci 98:12748–12753 Hans M, Urrutia A, Deal C, Brust PF, Stauderman K, Ellis SB, Harpold MM, Johnson EC Williams ME. (1999b). Structural Elements in Domain IV that Influence Biophysical and Pharmacological Properties of Human α1A-Containing High-Voltage-Activated Calcium Channels. Biophysical Journal 76: 1384-1400. Harris KM, Sultan P (1995) Variation in the number, location and size of synaptic vesicles   provides an anatomical basis for the nonuniform probability of release at hippocampal  CA1 synapses. Neuropharmacol 34: 1387–1395. Headache Classification Subcommittee of the International Headache Society (2004) The  International Classification of Headache Disorders: 2nd edition. Cephalalgia 24 Suppl  1:9-160. Hebb DO (1949) The Organization of Behavior. John Wiley & Sons. Holz RW (2006) Pharmacology meets vesicular trafficking at a central nervous system synapse: Pregabalin effects on synaptic vesicle cycling in hippocampal neurons. Mol Pharmacol 70(2):444–446. Iwasaki S, Takahashi T (1998) Developmental changes in calcium channel types mediating  synaptic transmission in rat auditory brainstem. J Physiol 509(2):419-423. Iwasaki S, Momiyama A, Uchitel OD, Takahashi T (2000) Developmental Changes in Calcium Channel Types Mediating Central Synaptic Transmission. J Neurosci 19(2)726-736. 92  Kadurin I, Alvarex-Laviada A, Ng SF, Walker-Gray R, D’Arco M, Fadel MG, Pratt WS,  Dolphin AC (2012) Calcium currents are enhanced by α2δ-1 lacking its membrane anchor. J Biol Chem. 287(40):33554-33566.  Kaeser PS, Regehr WG (2014) Molecular Mechanisms for Synchronous, Asynchronous, and  Spontaneous Neurotransmitter Release. Ann rev physiol 76:333-363. Kazemi H, Speckmann EJ, Gorji A (2014) Familial Hemiplegic Migraine and Spreading    Depression. Iran J Child Neurol 8(3): 6-11.  Keren H, Lev-Maor G, Ast G (2010) Alternative splicing and evolution: diversification, exon definition and function. Nat Rev Genet 11(5):345-355. Kim E, Magen A, Ast G (2007) Different levels of alternative splicing among eukaryotes. Nucleic Acids Res 35(1):125-131. Kors EE, Terwindt GM, Vermeulen FL, Fitzsimons RB, Jardine PE, Heywood P, Love S, van  den Maagdenberg AM, Haan J, Frants RR, Ferrari MD (2001) Delayed cerebral edema  and fatal coma after minor head trauma: role of the CACNA1A calcium channel subunit  gene and relationship with familial hemiplegic migraine. Ann Neurol. 49(6):753-60. Krovetz HS, Helton TD, Crews AL, Horne WA. (2000). C-Terminal Alternative Splicing Changes the Gating Properties of a Human Spinal Cord Calcium Channel α1A Subunit. J Neurosci 20(20): 7564-7570. McKinney RA, Capogna M, Durr R, Gahwiler BH, Thompson SM (1999) Miniature synaptic   events maintain dendritic spines via AMPA receptor activation. Nat Neurosci 2:44–49  Mikami A, Imoto K, Tanabe T, Niidome T, Mori Y, Takeshima H, Narumiya S, Numa S (1989)  Primary structure and functional expression of the cardiac dihydropyridine-sensitive  calcium channel. Nature 340:230-233. Micheva KD, Taylor CP, Smith SJ (2006) Pregabalin reduces the release of synaptic vesicles from cultured hippocampal neurons. Mol Pharmacol 70(2):467–476. Lansman JB, Hess P, Tsien RW (1986) Blockade of current through single channels by Cd2+, qqqqqqMg2+ and Ca2+. J Gen Physiol 88:321-347. Li L, Bischofberger J, Jonas P (2007) Differential gating and recruitment of P/Q- N- and R-type   Ca2+ channels in hippocampal mossy fiber boutons. J Neurosci 27:13420-13429. Li XG, Somogyi P, Ylinen A, Buzsaki G (1994) J Comp Neurol 339:181-208. Leão AAP (1944) Spreading depression of activity in cerebral cortex. J Neurophysiol 7: 359– 390. Leuner B, Gould E (2010) Structural Plasticity and Hippocampal Function. Annu Rev Psychol  61:110-C3. Lorenzon NM and Beam KG (2000) Calcium channelopathies. Kidney International 57: 794- 802. Maleki N, Bercerra L, Borsook D (2012) Migraine: Maladaptive Brain Responses to Stress.  Headache 52(Suppl 2):102-106. Martin SJ, Grimwood PD, Mosrris RG (2000) Synaptic plasticity and memory: an evaluation of  the hypothesis. Annu Rev Neurosci 23:649-711. Metz AE, Jarsky T, Martina M, Spruston N (2005) R-type calcium channels contribute to  afterdepolarization and bursting in hippocampal CA1 pyramidal neurons. J Neurosci  25(24):5763-5773. Meinrenken CJ, Borst JG, Sakmann B (2002) Calcium secretion coupling at calyx of held  governed by nonuniform channel-vesicle topography. J Neurosci 22:1648–1667.  93  Moulder KL, Mennerick S (2005) Reluctant vesicles contribute to the total readily releasable  pool in glutamatergic hippocampal neurons. J Neurosci 25: 3842–3850Murthy VN, Sejnowski TJ, Stevens CF (1997) Heterogeneous release properties of visualized   individual hippocampal synapses. Neuron 18: 599–612.  Murthy VN, Schikorski T, Stevens CF, Zhu Y (2001) Inactivity produces increases in  neurotransmitter release and synapse size. Neuron 32: 673–682.  Oliet SH, Malenka RC, Nicoll RA (1997) Two distinct forms of long-term depression coexist in   CA1 hippocampal pyramidal cells. Neuron 18(6):969-982. Olivera BM, Cruz LJ, de Santon V, LeCheminant GW. Griffin D, Zeikus R, McIntosh JM,  Calyean R, Varga J, Gray WR. Rivier J (1987) Neuronal calcium channel antagonists.  Discrimination between calcium channel subtypes using omega-conotoxin from Conus  magus venom. Biochem 26:2086-2090. Neher E, Sakaba T (2008) Multiple roles of calcium ions in the regulation of neurotransmitter   release. Neuron 59:861–72.                 Nicholson C, Kraig RP (1981) The behavior of extracellular ions during spreading depression. In: Zeuthen T (Ed.), The Application of Ion-Selective Microelectrodes.  Elsevier/ North Holland Biomedical Press, Amsterdam pp. 217-238          Nimmervoll B, Flucher BE, Obermair GJ (2013) Dominance of P/Q-type calcium channels in depolarization-induced presynaptic FM dye release in cultured hippocampal neurons.  Neuroscience 253:330-340.                 Nowycky MC, Fox AP, Tsien RW (1985) Three types of neuronal calcium channels with  different calcium agonist sensitivity. Nature 316:440-443.                  Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Reez M,  Lee JH (1998) Molecular characterization of a neuronal low-voltage-activated T-type  calcium channel. 391:896-900.                  Piedras-Renteria ES, Pyle JL, Diehn M, Glickfield LL, Harata NC, Cao Y, Kavalali ET, Brown PO, Tsien RW (2004) Presynaptic homeostasis at CNS nerve terminals compensates for  lack of a key Ca2+ entry pathway. Proc Natl Acad Sci USA 101(10):3609-3614. Pietrobon D, Striessnig J (2003) Neurobiology of migraine. Nat Rev Neurosci 4:386–398 Pietrobon D (2010) Cav2.1 channelopathies. Pflugers Arch 460(2): 375-393.                        Poncer JC, McKinney RA Cahwiler BH, Thompson SM. Either N- or P-type calcium channels   mediate GABA release at distinct hippocampal inhibitory synapses. Neuron 18:463- 472.                           Pragnell M, DeWaard M, Mori Y, Tanabe T, Snutch TP, Campbell KP (1994) Calcium channel Qian J, Noebels JL (2000) Presynaptic Ca2+ influx at a mouse central synapse with Ca2+ channel  subunit mutations. J Neurosci 20(1):163-170.                 Qian J, Noebels JL Presynaptic Ca2+ channels and neurotransmitter release at the terminal of a   mouse cortical neuron. J Neurosci 21(11):3721-3728.                       Randall A, Tsien RW (1995) Pharmacological Dissection of Multiple Types of Ca2+ Channel Currents in Rat Cerebellar Granule Neurons. J Neurosci15(4):2995-3012.    Rhee, JS, Betz, A, Pyott S, Reim K, Varoqueaux F, Augustin I, Hesse D, Südhof TC, Takahashi, M, Rosenmund C, Brose N (2002) Phorbol ester- and diacylglycerol-induced  augmentation of neurotransmitter release from hippocampal neurons is mediated by Munc13s and not by PKCs. Cell 108:121–133.                         Rousset M, Cens T, Restituito S, Barrer C, Black JL, McEnery MW, Charnet PJ. Functional   roles of gamma2, gamma3 and gamma4, three new Ca2+ channel subunits in P/Q-type 94    Ca2+ channel expressed in Xenopus oocytes. J Physiol 532:583-593.        Simms BA, Zamponi GW (2014) Neuronal Voltage-Gated Calcium Channels: Structure, Function, and Dysfunction. Neuron 82: 24-45.                         Sharp AH, Campbell KP, Characterization of the 1,4-dihydropyridine receptor using subunit- specific polyclonal antibodies.  Evidence for a 32,000-Da subunit. J Biol Chem  264:2816-2825.                          Somjen GG (2001) Mechanisms of spreading depression and hypoxic spreading depression-like  depolarization Somjen GG. Physiol Rev 81(3):1065–1096. Stevens CF, Williams JH (2007) Discharge of the readily releasable pool with action potentials  at hippocampal synapses. J Neurophysiol 98: 3221–3229.  Südhof TC (2012) The Presynaptic Active Zone. Neuron 75(1):11-25. Snutch TP, Reiner PB (1992) Ca2+ channels: diversity of form and function. Curr Opin  Neurobiol 2(3):247-253. Rettig J, Sheng ZH, Kim DK, Hodson CD, Snutch TP and Catterall WA (1996) Isoform- specific interaction of the α1A subunits of brain Ca2+ channels with the presynaptic proteins syntaxin and SNAP-25. Proc. Natl. Acad. Sci. 93: 7363-7368. Russell MB, Ducros A (2011) Sporadic and familial hemiplegic migraine: pathophysiological   mechanisms, clinical characteristics, diagnosis, and management. Lancet Neurol    10(5):457-470. Rizzoli SO, Betz WJ (2005) Synaptic vesicle pools. Nat Rev Neurosci 6: 57–69.  Sabatini BL, Regehr WG (1996) Timing of neurotransmission at fast synapses in the mammalian   brain. Nature 384:170–72  Schikorski T, Stevens CF (1997) Quantitative ultrastructural analysis of hippocampal excitatory   synapses. J Neurosci 17: 5858–5867.      Schneggenburger R, Sakaba T, Neher E (2002) Vesicle pools and short-term synaptic  depression: Lessons from a large synapse. Trends Neurosci 25: 206–212.  Scholz KP, Miller RJ (1995) Developmental changes in presynaptic calcium channels coupled to   glutamate release in cultured rat hippocampal neurons. J Neurosci 15(6):4612-4617. Scimemi A, Diamond JS (2012) The number and organization of Ca2+ channels in the active zone shapes neurotransmitter release from Schaffer collateral synapses. J Neurosci 32(50):18157-18176.  Scanziani M, Capogna M, Gähwiler BH, Thompson SM (1992) Presynaptic inhibition of  miniature excitatory synaptic currents by baclofen and adenosine in the hippocampus  9(5):919-927. Schwartz S, Meshorer E, Ast G (2009) Chromatin organization marks exon-intron structure. Nat Struct Mol Biol 16(9):990-995. Schotten S, Meijer M, Walter AM, Huson V, Mamer L, Kalogreades L, ter Veer M, Ruiter M, Brose N, Rosenmund C, Sorensen JB, Verhage M, Corneslisse LN (2015) Additive effects on the energy barrier for synaptic vesicle fusion cause supralinear effects on the vesicle fusion  rate. elife 4: e05531. Sollner T, Whiteheart SW, Brunner M, Erdiument-Bromage H, Geromano S, Tempst P, Rothman JE (1993) SNAP receptors implicated in vesicle targeting and fusion. Nature  362:297-298. Soong TW, Stea A, Hodson CD, Dubel SJ, Vincent SR, Snutch TP (1993) Structure and  functional expression of a member of the low voltage-activated calcium channel family.  Science 260(5111):1133-1136. 95  Soong TW, DeMaria CD, Alvania RS, Zweifel LS, Liang MC, Mittman S, Agnew WS, Yue DT (2002) Systemic Identification of Splice Variants in Human P/Q-Type Channel α12.1 Subunits: Implications for Current Density and Ca2+-Dependent Inactivation. J Neurosci 22(23):10142-10152. Spruston N (2008) Pyramidal neurons: dendritic structure and synaptic integration. Nat Rev   Neurosci 9(3):206-221. Sutton MA, Ito HT, Cressy P, Kempf C, Woo JC, Schuman EM (2006) Miniature  neurotransmission stabilizes synaptic function via tonic suppression of local dendritic  protein synthesis. Cell 125:785–99  Südhof TC, Rothman JE (2009) Membrane fusion: grappling with SNARE and SM proteins.  Science 323:474-477. Südhof TC (2012) The Presynaptic Active Zone. Neuron 75(1):11-25. Thomsen LL, Eriksen MK, Roemer SF, Andersen I, Olesen J, Russell MB (2002) A population- based study of familial hemiplegic migraine suggests revised diagnostic criteria. Brain  125(Pt 6):1379-1391. Tottene A, Fellin T, Pagnutti S, Luvisetto S, Striessnig J, Fletcher C and Pietrobon D (2002) Familial hemiplegic migraine mutations increase Ca2+ influx through single human   Cav2.1 channels and decrease maximal Cav2.1 current density in neurons. Proc Natl   Acad Sci U S A 99:13284-13289. Tottene A, Pivotto F, Fellin T, Cesetti T, van den Maagdenberg AMJM and Pietrobon D (2005) Specific Kinetic Alterations of Human Cav2.1 Calcium Channels Produced by Mutation   S218L Causing Familial Hemiplegic Migraine and Delayed Cerebral Edema and Coma after Minor Head Trauma. J Biol Chem 280(18): 17678-17686. Tsujimoto T, Jeromin A, Saitoh N, Roder JC, Takahashi T (2002) Neuronal calcium sensor 1 and  activity-dependent facilitation of P/Q-type calcium currents at presynaptic nerve  terminals. Science 295:2276-2279. Tyler WJ, Pozzo-Miller LD (2001) BDNF Enhances Quantal Neurotransmitter Release and  Increases the Number of Docked Vesicles at the Active Zones of Hippocampal Excitatory  Synapses. J Neurosci 21(12):4249-4258. Tyson JR, Snutch TP (2013) Molecular nature of voltage-gated calcium channels: structure and species comparison. Wiley Interdiscip Rev Membr Transp Signal 2(5)181-206. Uchitel OD, Di Guilmi MN, Urbano FJ, Gonzalez-Inchauspe C (2010) Acute modulation of  calcium currents and synaptic transmission by gabapentinoids. Channels  (Austin) 4(6):490–496. Van den Maagdenberg AM, Pietrobon D, Pizzorusso T, Kaja S, Broos LA, Cesetti T, van den Ven RC, Tottene A, van der Kaa J, Plomp JJ, Frants RR, Ferrari MD (2004) A Cacna1a knockin  migraine mouse model with increased susceptibility to cortical spreading depression.  Neuron 41(5):701–710. Van Petegem F, Clark KA, Chatelain FC, Minor DL (2004) Nature 429:671-675.  Zamponi GW, Bourinet E, Nelson D, Nargeot J, Snutch TP (1997) Nature 385:442 446. Vincent M, Hadjikhani N (2007) The Cerebellum and Migraine. Headache 47(6): 820-833. Vecchia D, Tottene A, van den Maagdenburg AM, Pietrobon D (2015) Abnormal cortical  synaptic transmission in Cav2.1 knockin mice with the S218L missense mutation which  causes a severe familial hemiplegic migraine syndrome in humans. Front Cell Neurosci  9:8. doi: 10.3389/fncel.2015.00008. eCollection  2015. 96  Veneziano L, Guida S, Mantuano E, Bernard P, Tarantino P, Boccone L, Hisama FM, Carrera P, Jodice C, Frontali M (2009) Newly characterized 3’ and 3’ regions of CACNA1A gene harbours mutations associated with Familial Hemiplegic Migraine and Episodic Ataxia. J Neurol Sci 276(1-2):31-7.  Vyleta NP, Smith SM (2011) Spontaneous glutamate release is independent of calcium influx   and tonically activated by the calcium-sensing receptor. J Neurosci. 31:4593–606.          Vyleta NP, Jonas P (2014) Short-Term Facilitation at a Detonator Synapse Requires the Distinct  Contribution of Multiple Types of Voltage-Gated Calcium Channels. Science 242(6171):665-670.                      Walker D, Bichet D, Geib S, Mori E, Cornet V, Snutch TP, Mori Yasuo, De Waard Michel (1999) A New β Subtype-specific Interaction in α1ASubunit Controls P/Q-type Ca2+ Channel Activation. J Biol Chem 274: 12383-12390.                     Wilhelm BG, Groemer TW, Rizzoli SO (2010) The same synaptic vesicles drive active and   spontaneous release. Nat Neurosci 13: 1454–1456.  Weber T, Zemelman BV, McNew JA, Westermann B, Gmachl M, Parlati F, Söllner TH,  Rothman JE (1998) SNAREpins: minimal machinery for membrane fusion. Cell 92:759– 72.                             Wheeler DB, Randall A, Tsien RW (1994) Roles of N-type and Q-type Ca2+ channels in  supporting hippocampal synaptic transmission. Science 264.5155:p107. Williams ME, Brust MM (1992) Structure and functional expression of an omega- conotoxin-sensitive human N-type calcium channel. Science 257:389-395. Westenbroek RE, Sakurai R, Elliot EM, Hell JW, Starr TVB, Snutch TP and Catterall WA. (1995). Immunochemical Identification and Subcellular Distribution of the α1A Subunits of Brain Calcium Channels.  J Neurosci 15(10): 6403-6418. Wu LG, Westenbroek RE, Borst JG, Catterall WA, Sakmann B (1999) Calcium channel types  with distinct presynaptic localization couple differentially to transmitter release in single  calyx-type synapses. J Neurosci 19:726–736.  Xu J, Pang ZP, Shin OH, Südhof TC (2009) Synaptotagmin-1 functions as a Ca2+ sensor for  spontaneous release. Nat Neurosci. 12:759-766. Zucker RS, Regehr WG (2002) Short-term synaptic plasticity. Annu Rev Physiol 64-355- 405.        

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0357193/manifest

Comment

Related Items