UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of gingival fibroblast gene expression by leukocyte and platelet rich fibrin Barona Intriago, Maria Fernanda 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_september_barona_maria.pdf [ 38.35MB ]
Metadata
JSON: 24-1.0354392.json
JSON-LD: 24-1.0354392-ld.json
RDF/XML (Pretty): 24-1.0354392-rdf.xml
RDF/JSON: 24-1.0354392-rdf.json
Turtle: 24-1.0354392-turtle.txt
N-Triples: 24-1.0354392-rdf-ntriples.txt
Original Record: 24-1.0354392-source.json
Full Text
24-1.0354392-fulltext.txt
Citation
24-1.0354392.ris

Full Text

 REGULATION OF GINGIVAL FIBROBLAST GENE EXPRESSION BY LEUKOCYTE AND PLATELET RICH FIBRIN  by  MARIA FERNANDA BARONA INTRIAGO  DDS, Catholic University of Guayaquil, Ecuador 2012  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Craniofacial Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2017  © Maria Fernanda Barona Intriago, 2017   ii Abstract   Objectives: Leukocyte and Platelet-Rich Fibrin (L-PRF), a new clinically used blood product, is rich in leukocytes and platelets embedded in a high-density fibrin network. L-PRF has shown some clinical promise to promote gingival wound healing. In gingival surgeries where L-PRF is being used, it will be in direct contact with human gingival fibroblasts (HGFs) of the surgical flap. However, little is known about the combined effects of the growth factors and cells present in L-PRF on HGFs. We hypothesized that L-PRF regulates expression of key wound healing genes in HGFs. Thus, our aim was to investigate the effects of soluble biological factors released from L-PRF on HGF gene expression.   Methods: L-PRF membranes were produced from blood samples of six volunteer donors using standard clinical protocol. The membranes were placed into upper compartments of transwell plate inserts (0.4 µm pore size) with confluent layers of HGFs at the bottom of the wells. Thus, only soluble mediators were able to influence HGF gene expression. HGFs with the L-PRF membranes in the wells were incubated for 48h followed by isolation of total RNA for real-time quantitative PCR of wound healing related genes. The levels of selected proteins produced by the cells were analyzed using Western blotting.    Results: Among the 86 genes studied, the expression of 35 genes (41%) was significantly regulated by the L-PRF membranes in HGFs. Replicate membranes from the same donor or between different donors produced similar responses, with membranes from different individuals varying somewhat in magnitude of the response. Among the most regulated genes, matrix  iii metalloproteinase-1 (MMP-1) and MMP-3 showed several-fold increase by L-PRF-treatment, both at the mRNA and protein level. Angiogenesis related genes, VEGF-α and FGF-2 showed also significant up-regulation in HGFs by the L-PRF-treatment.    Conclusions: The results demonstrate that the L-PRF membranes have a strong and a specific regulatory effect on HGFs that may modulate several aspects of wound healing.     iv Lay Summary   The aim of this thesis was to investigate the effects of particular blood components found in a concentrated blood product on gum healing. Different laboratory methods were used to assess changes in gene and protein production following exposure to the blood product.   It was found that the production of genes related with gum healing increased as a result of the blood product. Therefore, we concluded that our blood product has a strong effect on gum healing.     v Preface   This dissertation is an original intellectual product of the author, Fernanda Barona. University of British Columbia’s Research Ethics Board [certificate number H1501881] approved all experimental methods. Dr. Jiarui Bi and Dr. Fernanda Barona performed all experimental manipulation, blood collection and prepared the samples for RT-qPCR and Western blotting. Fernanda Barona prepared the corresponding statistical analysis and Dr. Jiarui Bi prepared the corresponding figures.    vi Table of Contents  Abstract .......................................................................................................................................... ii	Lay Summary ............................................................................................................................... iv	Preface .............................................................................................................................................v	Table of Contents ......................................................................................................................... vi	List of Tables .............................................................................................................................. viii	List of Figures ............................................................................................................................... ix	List of Abbreviations .....................................................................................................................x	Acknowledgements .................................................................................................................... xiii	Dedication ................................................................................................................................... xiv	Chapter 1: Introduction ................................................................................................................1	Chapter 2: Function of Gingival Fibroblasts ..............................................................................2	Chapter 3: Wound Healing ...........................................................................................................5	3.1	 Clotting and Inflammation .............................................................................................. 6	3.2	 Re-epithelialization and Granulation Tissue Formation ................................................. 9	3.3	 Angiogenesis and Remodeling ..................................................................................... 11	Chapter 4: Platelet Concentrates ...............................................................................................14	4.1	 History........................................................................................................................... 14	4.2	 Classification ................................................................................................................. 15	4.3	 Differences Between P-PRP and L-PRF ....................................................................... 19	Chapter 5: L-PRF ........................................................................................................................21	5.1	 Preparation and Handling ............................................................................................. 21	 vii 5.2	 Structure and Content ................................................................................................... 25	5.2.1 Cytokines Present in L-PRF Preparations ....................................................................... 26	5.2.2 Current Clinical Use ........................................................................................................ 28	Chapter 6: Aim of the Study .......................................................................................................31	Chapter 7: Material and Methods ..............................................................................................32	Chapter 8: Results ........................................................................................................................38	Chapter 9: Discussion ..................................................................................................................46	Chapter 10: Conclusions .............................................................................................................51	Bibliography .................................................................................................................................52	Appendices ....................................................................................................................................60	  viii List of Tables Table 8.1. L-PRF Effect in Gene Response .................................................................................. 38	  ix List of Figures  Figure 5.1: L-PRF Preparation and Handling.. ............................................................................. 22	Figure 5.2: L-PRF Membranes.. ................................................................................................... 24	Figure 5.3: L-PRF Box and Its Components. ............................................................................... 25	Figure 7.1:  L-PRF Membrane Preparation .................................................................................. 33	Figure 7.2: L-PRF in Tranwells. ................................................................................................... 34	Figure 8.1: The Effect L-PRF on Human Gingival Fibroblast Gene Expression ......................... 39	Figure 8.2 The Effect of L-PRF on The Expression of MMP-1 and -3 Protein Levels in Human Gingival Fibroblasts (HGFs)......................................................................................................... 42	Figure 8.3. Dose and Time Dependency of L-PRF-Mediated Regulation of Human Gingival Fibroblasts (HGF) Genes. ............................................................................................................. 44	Figure 8.4. Effect of L-PRF on Type I Collagen. ......................................................................... 45	  x List of Abbreviations  A-PRF: advanced-platelet rich fibrin ALG9: asparagine-linked glycosylation 9 ALP: alkaline phosphatase  B2M: beta-2-microglobulin BMSC: bone mesenchymal stem cells CAF: coronally advanced flap CTGF: connective tissue growth factor CX43: Connexin 43  CXCL12: C-X-C motif chemokine ligand 12  DMEM: Dulbecco’s Modified Eagle’s Medium DNA: Deoxyribonucleic acid ECM: extracellular matrix EDA: extra domain-A fibronectin EDB: extra domain-B fibronectin EGF: epidermal growth factor EGR3: early growth response protein 3  FBS: Fetal bovine serum FGF: fibroblast growth factor FGGs: free gingival grafts  FMLP: N-formyl-methionyl-leucyl-phenylalanine GAPDH: glyceraldehydes-3-phosphate dehydrogenase  xi GBR: guided bone regeneration HSP47: heat shock protein 47 IGF: insulin-like growth factor IL-1: interleukin-1 IL-1ß: interleukin-1ß IL-2: interleukin-2 IL-4: interleukin-4 IL-6: interleukin-6 KGF: keratinocyte growth factor L-PRF: leukocyte platelet rich fibrin L-PRP: leukocyte platelet-rich plasma LOX: lysyl oxidase MMP-1: matrix-metalloproteinase-1 MMP-13: matrix-metalloproteinase-13 MMP-3: matrix-metalloproteinase-3 MMP: matrix-metalloproteinase MSC: mesenchymal stem cells NAB1: Nuclear polyadenylated RNA-binding protein -1 NAB2: Nuclear polyadenylated RNA-binding protein -2 OFD: open flap debridement P-PRF: pure platelet-rich fibrin P-PRP: pure platelet-rich plasma PBS: Phosphate-buffered saline  xii PDGF: platelet-derived growth factor PRF: platelet-rich fibrin PRP: platelet-rich plasma PTX: pentoxifylline RBC: red blood cell RNA: ribonucleic acid RT-PCR: reverse transcriptase-polymerase chain reaction S-PRF: standard platelet rich fibrin TGF-ß1: transforming growth factor- ß 1 TGF-a: transforming growth factor- a TIMP-2: Tissue inhibitor of metalloproteinase-2 TIMP: Tissue inhibitor of metalloproteinase TNF- ß: tumor necrosis factor - ß TSP: thrombospondin-1  VEGF: vascular endothelial growth factor  xiii Acknowledgements   I would like to express my sincere gratitude to my supervisor, Dr. Hannu Larjava, for his continuing support, guidance and patience during my studies. I would also like to thank Dr. Lari Häkkinen who has been very supportive and helpful.  I am very thankful for Dr. Jiarui Bi for all his help and suggestions throughout the past years especially in the laboratory.  I would like to than my friends who were kind enough to be volunteers for this project. And lastly, to my family, and my dear boyfriend… for always encourage me to give the best of myself.                xiv Dedication   To God, my dear family and beloved fiancé for all their support through these years. 1 Chapter 1: Introduction   Leukocyte and platelet rich fibrin (L-PRF) is widely used in dental clinical settings with favorable results reported from case reports suggesting that L-PRF could improve palatal wound healing, periodontal regeneration and healing of extraction sockets1-3.  In many of these procedures, L-PRF is placed below gingival flaps. Therefore, the L-PRF membrane will be in direct contact with the gingival fibroblast residing in the connective tissue of the raised flap. Little is known about the effects of the combined growth factors and cells present in L-PRF membranes on gingival fibroblasts. Gingival fibroblasts are unique cells that have special characteristics and may contribute to scarless wound healing. The present study was designed, therefore, to investigate the effects of L-PRF membranes on gingival fibroblasts.    2 Chapter 2: Function of Gingival Fibroblasts   Fibroblasts are the most popular cells in connective tissues. They participate in regulating several functions like tissue development, organogenesis, hemostasis and maintenance. They also play important roles in various physiological and pathological situations including wound healing, inflammation, fibrosis and cancer4.  Gingival fibroblasts have been described before in the literature as having an unique phenotype that shows inter-individual variation5. For example, different tissue donors-related factors (age, sex, genetic factors, etc.) may results in qualitative and quantitative changes in fibroblasts subsets gingival tissue. In addition, other factors like local tissue niche, use of medication, injury or pathological processes, or epigenetic factors may cause variability in fibroblast phenotype between different people.  Culturing fibroblasts in vitro will further increase this heterogeneity as significant selection of fibroblast subtypes may happen and also other cell types may be present that share properties with fibroblasts6. Nevertheless, different studies have shown that human gingival fibroblasts despite the phenotypic variation have overall a high regeneration potential, fetal like phenotype and can regulate inflammation. Due to these properties, gingival fibroblasts may have therapeutic potential7,8. Gingival fibroblasts originate from neural crest and maintain stem cell-like properties such capacity to differentiate to different mesenchymal lineages9,10. In three-dimensional tissue culture, gingival fibroblasts show significantly different gene expression profile from skin fibroblasts11. One of the major differences is that gingival cells express very low level of CD26 that is highly expressed in skin fibroblasts that have a profibrotic phenotype. Compared to skin, oral mucosal gingiva heals faster and with reduced scar formation that may relate to the presence of profibrotic, CD26- 3 expressing cells in the skin wounds11. Gingival fibroblasts have the capacity to reorganize and remodel ECM that is important for tissue maintenance and wound healing. Interestingly, studies reporting on collagen contraction show ambiguous results between gingival and skin fibroblasts12,13. However, gingival fibroblasts contract and degrade a fibrin lattice faster than dermal fibroblasts due to an increased expression of fibrinolytic tissue plasminogen activator13.  This capability may be important in the context of this thesis, as the L-PRF membrane is made of polymerized fibrin. Gingival fibroblasts also secrete pro-angiogenic vascular endothelial growth factor (VEGF), CXCL12 (stromal cell-derived factor 1a), CXCL8 (IL-8) and stimulate endothelial cell growth in vitro14. Regarding VEGF, it is also released from the L-PRF membrane among several other growth factors, including PDGF and TGF-ß115. Therefore, it remains unknown how gingival fibroblasts would respond to L-PRF in terms of VEGF expression and angiogenesis.  Gingival fibroblasts are likely to react to the L-PRF membrane during the first two weeks of wound healing as it will be absorbed during that time16. This timing will coincide with inflammatory and early granulation tissue phases of wound healing. In oral mucosa wounds, the inflammatory response is generally faster and qualitatively different from skin wounds17.  Gingival fibroblast differs from their dermal counterparts in their response to soluble mediators related with inflammation. For instance, they produce high levels of some matrix metalloproteinases, which could activate or inhibit inflammatory mediators and their inhibitor18.  Furthermore, they are less receptive to stimulation of IL-1b expression by bacterial lipopolysaccharide19.  In summary, gingival fibroblasts possess unique phenotype that may contribute to scarless oral wound healing. The responses of gingival fibroblasts to L-PRF have not been fully  4 explored. In the present thesis, we will, therefore, investigate how these cells alter their expression of wound healing related genes in the presence of the L-PRF membranes from different individuals.  5 Chapter 3: Wound Healing Wound healing is one of the most important processes for the organism often presented in oral cavity, caused by either trauma or surgery. There are several steps involved during wound healing. Firstly, hemostasis starts with the release of epinephrine to attempt to minimize bleeding into the soft tissue. Platelets are the key cells in wound healing due to their essential role in hemostasis. In addition to their function in clotting, platelets are deployed to sites of injury or infection to modulate inflammatory processes through the secretion of growth factors, cytokines like PDGF, VEGF, TGF-ß1, and other inflammatory mediators that participate on healing.   During this innate immune response, inflammatory cells that have been recruited to the wound site to release more chemokines and cytokines, which modulate wound healing outcome20.  The second step is the inflammatory stage, in which leukocytes destroy bacteria and macrophages attempt to clean the wound of cellular debris and prevent infection. Macrophages seem to be particularly critical cells for wound repair due to their capacity for releasing Vascular Endothelial Growth factor (VEGF), Fibroblast Growth Factor (FGF), and Transforming Growth Factor-ß1 (TGF-ß1) that function among the most important regulators of tissue repair. Recent evidence suggests that wound macrophage populations shift over time and cells with different phenotypes coordinate different phases of wound healing. Coinciding the inflammatory stage, the re-epithelialization starts 48-72 hours after injury. Epithelial cells proliferate and migrate over the site to cover the denuded wound to seal the wound from external insults such as bacterial infection21. When the wound is sealed, angiogenesis and granulation tissue formation starts. Granulation tissue is rich in immature connective tissue and blood vessels and provides scaffold for complex cellular interactions resulting in the rise of myofibroblasts that produce the  6 bulk of the granulation tissue matrix. In the maturation stage, myofibroblasts disappear and the connective tissue will be reorganized and remodeled by the fibroblasts for mature tissue with high tensile strength.  3.1 Clotting and Inflammation  Hemostasis is the physiological process that preserves the fluidity of the blood and, after injury, minimize blood loss but nonetheless preserves tissue perfusion and stimulates the local repair process. Hence, hemostasis is a balance between clot formation and clot destruction and any alteration of this balance leads to either hyper-coagulation and thrombosis or hypocoagulation and hemorrhage. Blood clotting following extravasation is initiated by the surface activation of Hageman factor that leads to activation of the entire clotting cascade22.  Furthermore, blood clotting is enhanced by tissue pro-coagulant factors released form damaged cells, surface membrane coagulation factors and specific phospholipids expressed on activated platelets and endothelial cells23. Succeeding injury, the exposure of the sub endothelial tissue and types IV and V collagen will stimulate the binding and aggregation of platelets.  Following activation, platelets will secrete adhesive proteins such as fibronectin, fibrinogen, thrombospondin and von Will brand factor VIII that act as ligands for platelet aggregation24. In addition, platelets release other soluble mediators such as serotonin, platelet derived growth factor (PDGF), transforming growth factor -a (TGF-a), factor V, 1,2-hydroxy eicosanoid acid, platelet-activating factor and thromboxane A2, which promote vasoconstriction, additional platelet aggregation and release of other growth factors22. After activation, platelet will undergo structural and functional changes, such as acquiring a spherical shape with spinous pseudopod projections that promotes increased aggregation with other platelets. The activated platelets undertake a re-organization of their membrane phospholipids, which will allow the  7 interaction of clotting factors V and X22. This interaction will increase the production of thrombin, which catalyzes the formation of fibrin from fibrinogen and forms a meshwork around the aggregated platelets25. This platelet and fibrin-rich meshwork will act as a clot and fill in the wounded tissue, preventing further bleeding and bacterial infection.  Furthermore, this clot will act as a provisional matrix for cell migration. When L-PRF membranes are produced from donor’s blood, the clotting starts with Factor XII reacting with the negative surface of the collection vial. This leads to platelet activation and creation of fibrin as described above but under the influence of the centrifugation force (see below).  During wound healing or after injury, it is important that clot formation remain limited to the injured area. Several factors participate in termination of clotting including the production of prostacyclin that inhibits platelets aggregation, the binding of antithrombin to thrombin, and the production of protein C, which is an enzyme that degrades clotting factor V and VIII. In fibrinolysis, plasminogen is converted to plasmin by tissue plasminogen activator which process initiates clot lysis26-28.  The inflammatory phase of wound healing can be divided into early and late inflammatory phases. Early phase starts immediately upon tissue injury starting with the damage of blood vessels and the extravasation of blood components including circulating neutrophils that reach the wounded site to start the early inflammatory phase. Neutrophils clean the wounded area by phagocytosis, enzymatic and oxygen radical-mediated mechanisms. They are recruited to the wounded site by chemoattractants including fibrinopeptides, complement components C5a and C3a, bacterial products, leukotriene B4, PDGF, platelet activated factor and platelet factor 4. Several of these chemoattractants also support the adhesion of neutrophils to endothelial cells by increasing the expression of CD11/CD18 complex29. Influenced by concentration gradient of  8 chemoattractants, the neutrophils begin the process of diapedesis through the endothelial cells to the inflammation site. Neutrophil activation by chemoattractants also stimulate the release of collagenase and elastase, which further facilitate cell penetration through the blood vessel basement membranes22. Diapedesis is also enhanced by increased capillary permeability caused by numerous vasodilating agents such as serotonin, bradykinin, arachidonic acid metabolites and histamine. The early inflammatory phase usually lasts for about three days during which time neutrophils become trapped within the wound clot and dehydrated tissue. This eschar sloughs off during tissue repair. Whichever neutrophils remaining within sustainable tissue will be phagocytosed by macrophages during the late inflammatory phase30.  The late inflammatory phase lasts for 7 days overlapping with the early phase. Monocytes/macrophages are the leading cell type. There are two types of macrophages that both differentiate from blood monocytes, namely inflammatory M1 and reparative M2 macrophages31. Inflammatory macrophages (M1) are stimulated by TLR-ligands, IFN-g, TNF-a. They express high levels of TH1 pro-inflammatory cytokines (IL-2, IL23) and promote inflammation32. Reparative macrophages (M2) are stimulated by IL-4, IL-13, IL-10 and fibrillary collagen. Furthermore, they express high levels of TH2 cytokines and TGF-b, PDGF and VEG10. M2 macrophages also promote ECM accumulation, wound healing and may also contribute to fibrosis and scar formation. Transition and balance of pro-inflammatory macrophages to reparative macrophages will determine the tissue response after wounding. Macrophages arrive after the neutrophils and are attracted to the site by chemoattractants like collagen fibers, fibronectin, elastin, enzymatically active thrombin and TGF-b33,34. The transformation of monocytes into macrophages happens by interaction with the wound extracellular matrix22. The main function of M1 macrophages is to debride the tissue through phagocytosis. Phagocytosis is  9 stimulated by the communication of the macrophages with the extracellular matrix proteins through integrin receptors. M2 macrophages have important roles with growth factor and cytokine release. They are considered the major secretory cells producing many powerful cytokines such as colony stimulating factor-1, TNF-a, TGF-b, TGF-a, FGF, IL-1. These macrophage derived factors are necessary for the initiation of new tissue formation in wounds. By the release of soluble mediators, they regulate the phenotype and function of other mesenchymal and inflammatory cells20.  3.2 Re-epithelialization and Granulation Tissue Formation  Wound re-epithelialization happens within hours after injury. Migrating epithelial cells begin to migrate over the site to cover the denuded wound21. In the later stages of re-epithelialization, proliferation of the epithelial cells will occur to provide and increased number of cells to cover the wound21. The basal epithelial cells will respond to the wounding by dissolving their hemidesmosomal complexes that will release them from the basement membrane. Furthermore, the epithelial cells will lose intercellular desmosomal attachments and form peripheral cytoplasmatic actin filaments which will allow cell movement35,36. In order to migrate keratinocytes express matrix metalloproteinases (MMP’s) which have the capacity to degrade extracellular matrix components in order to facilitate migration below or through the clot. Other group of cells like macrophages, fibroblasts and epidermal cells can produce MMP’s which collaborate in the degradation of fibrin, fibronectin and collagen37. MMP’s plays an important role in re-epithelialization and several studies have shown that blocking MMP’s prevents keratinocytes migration. Furthermore, epithelial cells express urokinase-type plasminogen activator that activates plasmin to facilitate the degradation of the fibrin-fibronectin  10 clot38. The migration of epithelial cells through a provisional wound matrix composed mainly of fibrin, fibronectin, and vitronectin is highly regulated by integrin cell-surface receptors.  Integrins are cell-surface transmembrane ab heterodimers that are responsible for most cell-extracellular matrix interactions in keratinocytes17. They have several functions including regulation of cellular functions during development, differentiation and the immune response39.  During wound healing, there is a change in the expression of existing epithelial integrins to allow migration through a provisional wound matrix20. From underneath of the migrating keratinocytes, common basement membrane components such as collagen type IV and VII, heparan sulphate proteoglycan and laminin-1 are replaced by fibronectin, tenascin-C and laminin-540. Fibronectin is essential in the formation of the primary clot and for many cellular functions during re-epithelialization and granulation tissue formation. Cellular EDA fibronectin is expressed by migrating keratinocytes17. Laminin-5 provides migratory and stopping signals for migrating cells, depending on its proteolytic proccessing41. Finally, Tenascin-C is also expressed during re-epithelialization of wounds40. It is believed to function as modulation of cell adhesion during the migratory stage.  Granulation tissue formation will begin to form beneath the epithelium four days after injury to act as a temporary barrier against external environment22. Clinically this tissue bleeds easily and have a granular look 42. It is primarily composed by inflammatory cells mainly macrophages (see above), newly formed and sprouting blood vessels, fibroblasts and loose connective tissue. As mentioned above, M2 macrophages provide a continuous source of cytokines essential for fibroplasia and angiogenesis21. Fibroplasia is a mixture of fibroblasts and extracellular matrix (ECM). Fibroplasia stimulus arises from chemotactic, mitotic and modulatory effects of cytokines, which are mainly released from macrophages and platelets.  11  Fibroblasts themselves are also capable of producing cytokines and these cells respond in an autocrine manner43. Some of the key cytokines involved in fibroplasia include PDGF, TGF-a, TGF-b, connective tissue growth factor (CTGF), and basic fibroblast growth factor (b-FGF).   3.3 Angiogenesis and Remodeling  The process that involves formation of new blood vessels is angiogenesis, and is essential for the formation of granulation tissue. The migration and mitogenesis of the endothelial cells in conjunction with an appropriate extracellular matrix is needed for angiogenesis21. There are several molecules with angiogenic capacities including vascular endothelial growth factor (VEGF), TGF-b1, angiotropin, angiogenin, angiopoietin, interleukin-8, thrombospondin, and lactic acid22,44,45. All these molecules promote angiogenesis by stimulating the production of b-FGF or VEGF by macrophages or endothelial cells. Both molecules are important in the process of wound repair and granulation tissue formation46. In addition to these factors, the presence of an appropriate extracellular matrix is needed. Proliferating endothelial cells adjacent to and within wounds express fibronectin receptors47 and, therefore, a perivascular matrix rich in fibronectin may promote endothelial cell movement into the wound48. Sequence of events leading to angiogenesis have been hypothesized in the literature49. Tissue injury causes hypoxia leading to release of angiogenic factors such as bFGF and VEGF. The production of plasminogen activator from endothelial cells will convert plasminogen into plasmin. Afterwards, plasmin and activated collagenase will digest the basement membrane. This event will then allow endothelial cells to migrate into the wound and create new blood vessels.    12  The process of extracellular matrix remodeling, cell maturation, and cell apoptosis generate the last phase of wound healing known as tissue remodeling. This phase overlaps with granulation tissue formation, for example granulation tissue formation might be happening in the middle of the wound while tissue remodeling happens in the edges of it22. In late granulation tissue, resident fibroblasts and other cell types in the wound differentiate to myofibroblasts in the presence of fibronectin and TGF-b150. This phenotype is characterized by abundant cytoplasmic microfilament bundles of a-smooth muscle actin51. Approximately by two weeks 70% of fibroblasts in mature granulation tissue express a-smooth muscle actin51. Myofibroblasts are responsible for deposition remodeling of the main components of the wound extracellular matrix.  The attachment of myofibroblast to fibronectin and collagen by various integrins permit contraction by the myofibroblasts to be transmitted across the wound. Wound contraction by myofibroblast occurs between days seven and fourteen following injury and is stimulated by TGF-b and PDGF52. In the end of the healing, myofibroblasts are eliminated from wounds by apoptosis and replaced by resident fibroblasts in a process that is not well documented but may relate to local tissue environment and pericellular environment21,53. Collagen remodeling stimulated by TGF-b1 and tension occurs during the transition from granulation tissue to healed tissue or scar21. Tension mediated from the matrix seems to regulate the balance between production vs degradation. For instance, collagen gels under tension exhibit a relatively high protein synthesis rate54, while stress relaxation down-regulates collagen type I expression and up-regulates MMP-1 and MMP-13 expression55. Healing wounds will gain about 20% of its strength by the end of the third week of healing21. After this time, wound will accumulate collagen and increased tensile strength at a slower rate. Additional increase in tensile strength has more to do with collagen remodelling, formation of larger collagen bundles and alteration of  13 intermolecular cross-links rather than increased collagen deposition56. In the end, wound healing in the gingiva results almost perfect histological healing although it is not clear whether wounds in gingiva ever heal completely at molecular level57. In skin, however, deeper or wider wounds heal by scarring characterized by disorganized collagen in the extracellular matrix and hypercellularity with the presence of residual myofibroblasts.  14 Chapter 4: Platelet Concentrates  Platelets concentrates designated to reinforce the natural process of healing have been studied over three decades. These preparations have been promoted for surgical or wounded site in order to stimulate and improve healing58. The benefits of platelet concentrates are their autologous nature, easy collection, easy chair side preparation, and clinical application without potential risks associated with allogenic products. Currently, various preparations of platelet concentrates are being applied in sports medicine59, dental and maxillofacial surgery and veterinary medicine.   Platelet concentrates could be used either topical or as local infiltrations for many clinical purposes. They are obtained, mostly through centrifugation, after different processing of the donor’s blood sample. The main objective is to remove elements like red blood cells considered as not usable and to collect other elements like platelets, leukocytes, fibrinogen/fibrin and other forms of circulating cells. There is some confusion with the existing literature regarding the preparation and efficacy of these products. There are several techniques to produce platelet concentrates resulting in different final preparations. In addition, the unclear terminology to classify and describe the many different variations of platelet concentrates in publications makes it difficult to compare them to each other and determine the efficacy.  4.1 History  Platelet concentrates were initially termed as fibrin glues that improve skin wound healing in a rat model60. In 1978, new terms were proposed for the use of blood extracts such as “Platelet fibrinogen-thrombin mixtures” or “Gelatin Platelet”. These products comprised a consistent number of platelets inside the final fibrin preparation. The main idea was to strengthen  15 the fibrin gel and combine the healing properties of platelets and fibrin. These techniques were the first platelet rich gels that were used in several branches of medicine and in oral surgery61.  The field developed slowly until 1998 when platelet rich concentrates with growth factors were introduced to improve regeneration in medical fields62. Afterwards, several investigations were published on the topic and confusion about the terminology started to evolve. All these products where then called platelet rich plasma (PRP), without considering their true composition. Furthermore, another form of platelet concentrates was advanced in France and termed Platelet-Rich Fibrin (PRF), because of the robust fibrin gel polymerization of the preparation59. This technique had a completely different configuration than PRPs and it was named a “second-generation” platelet concentrate, while this term is perhaps not adequate taking into account the long history of evolution of the platelet concentrates. Later on, the second most important evolution of the terminology occurred. Platelet concentrates were additionally linked with different forms of circulating cells, especially leukocytes63,64. It is interesting to see how the evolution of these concentrates influenced research in this field. Evolving from interest about the unique fibrin matrix, later to the healing properties of the platelets and lastly to the influence of the growth factors and circulating cells for tissue regeneration63,64.   4.2 Classification  The current classification was described by Dohan. This classification separated the products following at least two key parameters, namely cell content and fibrin construction. Based on this classification, four families of platelet products were proposed; Pure Platelet Rich Plasma (P-PRP), Leuococyte and Platelet Rich Plasma (L-PRP), Pure Platelet Rich Fibrin (P-PRF) and Leucocyte and Platelet Rich Fibrin (L-PRF)59  16 Pure Platelet- Rich Plasma (P-PRP)   P-PRP products are preparations without leukocytes and with a low-density fibrin network after platelet activation. All these preparations can be used as liquid solutions or activated gel forms. Therefore, P-PRP can be injected65. Several procedures for preparation exist, predominantly using cell separators such as continuous flow plasmapheresis. This technique is preferred by several authors even though it is complicated to be used on a daily basis. The main advertised method of P-PRP is known under the commercial name PRGF26 [Plasma Rich in Growth Factors or EndoRet, Biotechnology Institute BTI]. P-PRP has been used in various clinical conditions, predominantly in sports medicine59. The literature on this technique, however, is somewhat biased as the promoting company has published most of the articles.  Another technique of P-PRP that was extensively sponsored for skin ulcers and is known under the commercial name: Vivostat PRF (Platelet-Rich Fibrin, Vivostat A/S, Alleroed, Denmark). The name is misleading as this technique is not a PRF as promoted by the company, instead a P-PRP product.  Leukocyte and Platelet Rich Plasma (L-PRP)  Leukocyte-and Platelet-Rich Plasma (L-PRP) products are formulations with leukocytes and platelets in low-density fibrin network. All the products of this family can be applied as liquid solutions or in an activated gel form59. This is the platelet concentrate family with the largest number of commercial systems with interesting results in different medical fields66. L-PRP has shown to improve acute nerve, muscle and cartilage injury caused by trauma by improving chemotaxis, angiogenesis and production of extracellular matrix67. Several automated protocols have been advanced in recent years. These protocols require the use of specific kits that  17 permit minimum handling of the blood samples and maximum standardization of the preparations. For example, Harvest Smart-PreP (Harvest Technologies, Plymouth, MA, USA) and Biomet GPS III (Biomet Inc., Warsaw, IN, USA) are two such commercial systems. Regarding the efficacy, most published investigations are case reports and further controlled studies are needed59.  Pure Platelet Rich Fibrin (P-PRF)  These are platelet rich preparations without leukocytes and with a high-density fibrin network. They only exist in a sturdily activated gel form, and cannot be injected or used like traditional fibrin glues. Nevertheless, due to their strong fibrin matrix, they can be utilized like a solid material for other applications. There is only one known commercial product in this family, called Fibrinet PRFM (Platelet-Rich Fibrin Matrix, Cascade Medical, Wayne, NJ, USA). The principal inconvenient of this technique remains its high cost and relative difficulty in contrast to the other types of P-PRF available.  Leukocyte and Platelet Rich Fibrin (L-PRF)  L-PRF preparations have a high concentration of leukocytes and platelets within a high-density fibrin network. These ones cannot be injected because L-PRF are composed of a membrane-like structure. L-PRF was developed by Choukroun and colleagues59and the technique consists of one-step centrifugation and no anticoagulants or blood activators are required, which is the key difference with other families59. The commercial Intra-spin L-PRF protocol has FDA approval (Intra-Lock Inc., Boca Raton, FL, USA). Differently to the other families, the production of this platelet concentrate chair-side in clinical setting is very simple.  18  This protocol remains the main platelet concentrate technique used in oral and maxillofacial surgery, because the L-PRF membranes and clots are very easy to combine with current surgical techniques. Some interesting results have been obtained with L-PRF applications in dentistry, sports medicine, orthopedics, however, vigorous randomized clinical trials are largely missing68.      19 4.3 Differences Between P-PRP and L-PRF  Unlike P-PRP, L-PRF is acquired by single centrifugation of venous blood by use of a specially programmed centrifuge. L-PRF includes autologous growth factors originated from platelets and a fibrin matrix. One of the most significant differences between L-PRF and most P-PRP preparations is that L-PRF manufacture does not require other reagents, i.e. no need of anticoagulant during blood harvesting or calcium chloride and thrombin for platelet activation and fibrin polymerization. In contrast, L-PRF itself gradually polymerizes during centrifugation similarly to natural polymerization in vivo. The polymerization is essential for correct three-dimensional (3D) organization of a fibrin network. L-PRF fibrin structure is advantageous for cytokine enmeshment and cellular migration and slowly releases platelet growth factors for at least 7–10 days69,70. The behavior of L-PRF membrane and P-PRP gel has been compared. These two products were placed in culture medium for 7 days and the growth factor release was compared58. L-PRF remained solid and intact for 7 days and continuously released growth factors (PDGF, VEGF, TGF-β1), while P-PRP gels released most of the growth factors during the first hours and completely dissolved in 3 days71.  The benefits of leukocytes of the L-PRF membrane remain debatable. Some authors proposed that they could have a negative effect due to the potential stimulation of the inflammatory process 58. However, other authors claim that that they play a key role in the healing and inflammation process58. For instance, Shär et al. (2015) described that VEGF is mainly produced by leukocytes and, therefore, without them less growth factors would be present72. Lundquist et al. (2013) investigated the effect of L-PRF on fibroblasts. The results showed a strong mitogenic effect of the human fibroblasts confirming the biological activity of  20 L-PRF. In addition, the investigators reported release of high levels of growth factors involved in angiogenesis (VEGF) as well as in re-epithelization (HGF), and cytokines (IL-8, IL-16)73.    21 Chapter 5: L-PRF  Choukroun developed L-PRF protocol in France for specific use in oral and maxillofacial surgery 74. Because L-PRF was the protocol used in this thesis work, it will be described in detail below.  5.1 Preparation and Handling  The L-PRF protocol is very simple, however, the membranes need to be prepared just prior to application75,76. To make the L-PRF membranes, a specific centrifuge is needed in addition to glass collection test tubes and blood collection armamentarium. There is some controversy about the speed of the centrifugation and the timing. In 2014, a study was conducted to compare the effect of the centrifugal force using protocols to produce standard platelet-rich fibrin (S-PRF) (2700 rpm, 12 minutes) and advanced platelet-rich fibrin (APRF) (1500 rpm, 14 minutes). Immunohistochemistry for monocytes, T and B -lymphocytes, neutrophilic granulocytes, CD34-positive stem cells, and platelets was performed on clots produced from four different human donors. Platelets were detected throughout the clot in both groups, although in the A-PRF group, more platelets were found in the distal part, away from the buffy coat (BC). Stem cells, T- and B-lymphocytes and monocytes were detected around the BC in both groups.  Decreasing the rpm while increasing the centrifugation time in the A-PRF group gave a greater presence of neutrophilic granulocytes in the distal part of the clot. In the S-PRF group, neutrophils were found mostly at the red blood cell (RBC)-BC interface. The clinical relevance of these differences remains unclear77.   22 Figure 5.1: L-PRF Preparation and Handling. (A) The L-PRF clot was produced in glass-coated plastic tubes. It contains the following layers: Upper plasma, middle contains the fibrin coat, lower is composed by RBCs, (B) Medifuge- Silfradent centrifuge.   A              B           Another study made a comparison between the different centrifugation forces used in the most popular machines available in the market, namely the original L-PRF centrifuge (Intra-Spin, Intra-Lock) and three other laboratory including Advanced platelet rich fibrin (APRF) (1500 rpm, 14 minutes), LW-UPD8 (LW Scientific) and Salvin 1310 (Salvin Dental). The author evaluated the level of mechanical vibrations during centrifugation and the impact of the centrifuge characteristics on the cell and fibrin architecture of a L-PRF membrane. The second objective of this article was to assess how changing some parameters of the L-PRF protocol may influence its biological behaviour78. The original L-PRF centrifuge (Intra-Spin) was the steadiest machine in all configurations and persisted below the threshold of resonance, revealed a strongly  23 polymerized thick fibrin matrix and the cell population seemed alive with a normal shape. The A-PRF, Salvin and LW PRF membranes presented a weaker polymerized fibrin gel and most of the visible cell bodies appeared damaged. Furthermore, a slow release of TGF-b2, PDGF, VEGF factors from original L-PRF membranes was significantly stronger (more than twice stronger, p<0.001) at all experimental times than the release from A-PRF membranes78.   L-PRF Membrane  The main advantages in L-PRF preparation are the non-existence of anticoagulant suggests the activation in a few minutes of most platelets of the blood sample in contact with the tube walls and the initiation of the coagulation cascades. After centrifugation, the upper part of the tube will contain acellular plasma, the middle part has the fibrin membrane and cells and the lower part contains the red blood clot. The main disadvantage of this technique is that it requires quick handling (transferring the blood tube to the centrifuge). Due to the lack of anticoagulant, the blood samples start to coagulate almost immediately upon contact with the tube glass. If the transferring of the blood tube to the centrifuge is overly long, fibrin will polymerize in a diffuse way in the tube, producing membranes with inconsistent quality79. The membrane and blood clot are extracted from the tube followed by removal of the blood clot (Figure 3.2). Discussion has been ongoing on which was an adequate way to conserve the L-PRF membrane when prepared, because storing them under compression for too long would increase an early release of growth factors and the shrinkage of the fibrin network and could also dehydrate and damage the leukocyte content. This issue is concerning when considering that many clinicians using L-PRF do not comprehend that L-PRF is a living clinical component. One option to conserve the L-PRF clot is to store it in its centrifugation tube. If the serum has not been removed from the clot, the  24 growth factor content remains stable80. It is a good way to gain 5-15 minutes, however, it is not a long-term solution, because with extended time the L-PRF membranes blend with the red blood clot base, leading to an unusable material. A second option is to keep the clots in a sterile metal cup and to press them into membranes with a sterile metal spoon and keep them in a wet serum environment. The disadvantage of this technique is that is not easy to handle when numerous L-PRF membranes are produced.  Figure 5.2: L-PRF membranes. (A) L-PRF and blood clot after removal from tube. (B) L-PRF membranes after removal of the clot. A          B       In 2007, a new instrument for the preparation and standardization of L-PRF membranes were developed, namely the L-PRF Box (Process, Nice, France). This metallic box (Figure 3.3) was designed to produce membranes of constant thickness that remain hydrated for several hours and to retrieve the serum exudate expressed from the fibrin clots which is rich in the proteins vitronectin and fibronectin76. The L-PRF membranes are then positioned on the grid in the L-PRF Box® (Process Ltd., Nice, France), and covered with the compressor lid. This result is an inexpensive autologous fibrin membrane in approximately one minute. The L-PRF Box also  25 contains compression wells to produce L-PRF products for filling cavities (such as extraction sockets)69.  Figure 5.3: L-PRF Box and its Components.                 5.2 Structure and Content   L-PRF is a firm fibrin-based dense biomaterial with a three-dimensional architecture containing 95% of the platelets and 50% of the leukocytes from the initial blood harvest81.  Dohan et al. 2010, evaluated the cell composition and three-dimensional organization of the L-PRF membranes and determined the influence of different collection tubes (glass-coated plastic tubes or dry glass) and compression procedures (forcible or soft) on the final L-PRF-membrane architecture. Roughly 97% of the platelets and 50% of the leukocytes were maintained in the L-PRF membranes showing a specific three-dimensional distribution and mature fibrin network.  There was no significant difference in the L-PRF architecture between groups using the different collection tubes and compression techniques81.    26 5.2.1 Cytokines Present in L-PRF Preparations  L-PRF membranes contain several cytokines and growth factors that will be released when the membranes gradually dissolve in vivo. Fibroblasts and other cells in the gingival wounds will be, therefore, exposed to these mediators that may significantly regulate their functions. Some of these factors are released from platelets during activation while others come from leucocytes present in the L-PRF.  Among pro-inflammatory cytokines, IL-1b, IL-6 and TNF-a are present in the L-PRF products. IL-1ß is likely derived from neutrophils present in the L-PRF82. It is a key mediator of inflammation control. Its role in normal wound repair is, however, somewhat unclear. IL-1 receptor knockout mice have normal skin wound closure but less fibrosis83,84. Interestingly, oral wound healing seems to require IL-1 signaling for protection from bacterial insults84. Interleukin 6 (IL-6) is another leucocyte-derived pro-inflammatory cytokine present in L-PRF. Its functions related to IL-1b and TNF-a circuit that could stimulate and constitutes a major amplification pathway for signals transmitted to immune cells.  Furthermore, IL-6 will support the reaction chains leading to inflammation, destruction and remodeling. Interestingly,  IL-6 promotes proliferation of fibroblasts20. In addition, IL-6 appears to have positive effects on wound healing as it promotes keratinocyte migration, macrophage infiltration and angiogenesis85.             TNF-a is yet another cytokine released from leucocytes in the L-PRF. TNF-a activates monocytes and stimulates the remodeling capacities of fibroblasts86. Moreover, it promotes phagocytosis and neutrophil cytotoxicity and modulates the expression of key pro-inflammatory mediators such as IL-1b and IL-687. Furthermore, promotes or stimulate proliferation of fibroblasts and suppresses myofibroblasts differentiation20. (Table 3.2.1) TNF-a seems to  27 promote early wound healing as mice treated with anti-TNF-a antibody have delayed wound closure, and inflammatory cell and fibroblast density88.             IL-4 is also released from the L-PRF. It serves as pleiotropic cytokine that stimulates ECM synthesis in fibroblast and inhibits stimulation of MMP-1 and MMP-3 by IL-1b. In fact, it counteracts many transduction pathways from IL-1b mediated signals89. In healing wounds, topical application of IL-4 accelerates wound healing90 (Table 3.2.1)  L-PRF membranes also contain several growth factors and cytokines that are believed to be beneficial for wound healing. Many of these factors are released from platelets during their activation. TGF-β1 is released and activated during platelet activation. It serves as a crucial cytokine for surveillance of inflammation as it keeps inflammation under control91. TGF-ß1 stimulates chemotaxis of fibroblasts and increases their integrin and matrix production92. It also reduces matrix breakdown by reducing collagenase activity and increasing TIMP expression91.  As mentioned above, TGF-ß1 is a key cytokine required for myofibroblast differentiation93. Excessive or prolonged TGF-ß1expression is associated with fibrotic scars93. In addition to TGF-ß1, L-PRF membranes release PDGF, FGF and IGF-1 that also promote fibroblast migration, proliferation and ECM synthesis20. All these growth factors released from platelets have been also tested for periodontal wound healing and PDGF has shown sufficient evidence of efficacy for commercialization20.  L-PRF also contains factors such as VEGF and FGF that promote angiogenesis, a crucial process for wound repair 94 . FGF also promotes migration and proliferation of fibroblasts and their ECM and collagenase synthesis20,95. (Table 3.2.1)   28  L-PRF releasate seems to stimulate osteoblast proliferation, matrix production and differentiation96. Less is known about effects of L-PRF on fibroblasts, particularly on gingival fibroblasts. A few studies suggest that L-PRF has positive effect on fibroblast proliferation. In this thesis, we will explore in more detail how L-PRF modulates the expression of wound healing related genes in gingival fibroblasts.   5.2.2 Current Clinical Use  Oral Applications  a. Direct sinus floor elevation procedures  The use of L-PRF has been widely described in the literature, for instance an animal study compared the potentials of L-PRF-mixed with Bio-Oss® and Tisseel®-mixed Bio-Oss® to improve bone regeneration in a canine sinus model97. The mean osseointegration rate was 43.5 ± 12.4% and new bone formation rate 41.8 ± 5.9% in the L-PRF/Bio-Oss® composite sites. In the Tisseel®/Bio-Oss® composite sites they were 30.7 ± 7.9% and 31.3 ± 6.4%. There were statistically significant differences between the groups. The findings from this study suggest that when L-PRF is used as an adjunct to Bio-Oss® particles for bone augmentation in the maxillary sinus, bone formation in the graft sites is significantly greater than when Tisseel® is used98.  Another study evaluated the effects of L-PRF on post-operative complications after direct sinus elevation procedure. They concluded that L-PRF and allogenous bone graft in combination with L-PRF membrane does not significantly improve postoperative complications following direct sinus lifting99. However, using L-PRF may promote better soft tissue healing and less post-operative pain after extractions100. A recent systematic review found that the benefits of using L- 29 PRF in sinus lifts is controversial. Some studies have shown no difference in amount of vital bone or residual bone, whereas, other studies have shown faster healing.  However, due to the lack of standardization, further RCTs with longer follow ups are needed101.  b. Protection and stabilization of graft materials during ridge augmentation procedures and socket preservation.  L-PRF could aid as a resorbable membrane for guided bone regeneration (GBR), blocking the premature migration of epithelial cells into bone defect and providing a space that allows the migration of mesenchymal stem cells and facilitate the underlying blood clot to mature into lamellar mineralized bone. However, L-PRF membranes dissolve rather rapidly. In a recent study a comparison of treatment outcome after extraction of impacted third molars with and without the application of L-PRF was performed. It was concluded that L-PRF reduces the severity of immediate postoperative sequelae, decreases preoperative pocket depth and had more bone density after 3 months but this aspect was not statistically different92. In a recent systematic review, it was concluded that using L-PRF as an adjunct for ridge preservation warrants further randomized clinical trials101.   d. For root coverage with single and multiple teeth recession.  The effect of L-PRF and coronally advanced flap (CAF) has been compared with CAF only. In this meta-analysis, no significant differences were found in term of recession depth reduction or keratinized tissue width gain after 6 months. However less side effects such as pain, swelling and hypersensitivity were associated with L-PRF group68.   30 e.  Regenerative procedures in treatment of 3-walled osseous defect and furcations.  In a recent meta-analysis, it was concluded that L-PRF vs open flap debridement (OFD) showed a statistical significant difference in favor of OFD+L-PRF in terms of pocket depth reduction, clinical attachment gains and amount of bone fill68.  f. To enhance palatal wound healing after free gingival graft.  It has been proposed that L-PRF enhances wound healing due to its stimulatory effect on angiogenesis and epithelialization. Therefore, this material has been used to enhance palatal donor side wound healing after harvesting free gingival grafts. In a recent study, 18 patients were treated with free gingival grafts (FGGs). L-PRF was applied on the donor site of 10 patients and in the other 18 patents only periodontal pack was applied. Sites where L-PRF was used showed faster wound closure and lesser morbidity than the control group102.      31 Chapter 6: Aim of the Study   L-PRF has shown some clinical promise in case studies for instance improving palatal wound healing, improving periodontal regeneration and facilitating faster socket healing1-3 and has been, therefore, adopted to clinical use because of it is easy to produce in one step centrifugation process. Little is known about the effects of the combined growth factors and cells present in L-PRF membranes on gingival fibroblasts. In many surgical procedures, L-PRF membranes will be placed underneath surgical flaps facing gingival fibroblasts. The aim of this study was, therefore, to investigate the effects of soluble biological factors released from L-PRF on expression of wound healing related genes in gingival fibroblast. Hypothesis: 1. Soluble factors released from L-PRF regulates the expression of wound healing related genes in gingival fibroblast 2. The effect of soluble factors from L-PRF on fibroblast gene expression are time- and dose-dependent 3. Soluble factors from L-PRF regulate collagen gel contraction in vitro    32 Chapter 7: Material and Methods  Cell Culture:  Normal human gingival fibroblasts (HGFs)14. They were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Life Technologies, Grand Island, NY, USA) supplemented with 23 mM sodium bicarbonate, 20 mM HEPES, 1% antibiotics (50 µg/ml streptomycin sulfate, 100 U/ml penicillin; Gibco) and 10% heat-inactivated fetal bovine serum (FBS; Gibco).   Human Blood Samples:   The Clinical Research Ethics Board at the University of British Columbia reviewed and approved all procedures involving human tissue donors [certificate number H1501881]. Informed written consent was obtained from the patients providing the blood samples per the Helsinki Declaration (1975). Peripheral venous blood (4 vials 9ml each) was collected from 6 healthy volunteers (appendix b) by venipuncture with using a 21 x three quarter gauge butterfly vacuette needle.  L-PRF:  To prepare L-PRF, 9 mL of blood was collected in 10-mL polyethylene tubes (Vacuette test tubes), coated with silica micro particles and immediately centrifuged at variable rpm from 2400-3000 rpm for 12 minutes at room temperature using a table centrifuge specifically designed for this application (Silfradent Medifuge MF200) (Figure 7.1). This centrifuge device uses a program with the following characteristics: 2,700 rpm 2 min, 2,400 rpm 4 min, 2,700 rpm 4 min,  33 and 3,000 rpm 3 min. After centrifugation, the L-PRF membrane and blood clot was removed from the tube. The red blood component (RBC) was discarded with scissors leaving approximately 1-2 mm of the RBC remaining. Figure 7.1:  L-PRF Membrane Preparation: (A): L-PRF in the tube. (B): L-PRF clot. (C): Removal of RBC. (D): L-PRF membrane A         B            C       D      Treatment of Fibroblasts with L-PRF  HGFs were seeded in 6-well plates in their normal growth medium (2x105 cells per well) for 48 h. The cell layer was then rinsed with phosphate buffered saline (PBS) twice. Transwell inserts (Costar; 0.4 µm pore size, Pittston, PA, USA) were then placed into the culture wells.  Freshly isolated L-PRF membranes were placed into the inserts and filled with FBS-free culture medium. The pore size (0.4 µm) allows soluble agents from the L-PRF to pass but prevents cellular migration. Control cultures contained the transwells without the membranes.  Cultures were continued for 48 h followed by RNA isolation for real-time quantitative polymerase chain reaction (RT-qPCR; protocol details described below). To study the effect of L-PRF on protein expression in HGF, the L-PRF membranes were removed after 48 h, followed with rinsing the cell layer with PBS twice. The cultures were kept for another 24 h in DMEM  34 medium without serum. Medium and cell layer proteins were then subjected to Western blotting (protocol details described below). Figure 7.2: L-PRF in Tranwells: (A) L-PRF membranes were place on the transwell insert, that separated the membranes from fibroblasts;(B) Schematic figure of L-PRF and HGFs inside the transwell.    A B     RT-qPCR:  RT-qPCR was performed as previously described103. Total RNA was extracted from cells grown in 6-well plates using NucleoSpin RNA II kit according to the manufacturer’s protocol (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and assessed for purity by RNA/DNA Calculator (GeneQuant Pro, Amersham Biosciences, Little Chalfont, Buckinghamshire, UK). RNA integrity was further assessed by electrophoresis using a denaturing agarose gel containing formaldehyde, followed by staining of RNA with 0.5 µg/ml of ethidium bromide in 0.1 M ammonium acetate for 30 min. Gels were assessed for integrity of 18S and 28S rRNAs bands (1.9 kb and 5 kb, respectively). Samples with A260/280 ratio approximately 2.0, and approximately 2.1 ratio of 28S/18S rRNA, were used for the study. 1.0 µg of total RNA was reverse-transcribed using high-capacity cDNA reverse transcription kits (Applied Biosystems, Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instructions. The cDNA was synthesized using Mastercycler gradient 5331  35 Reverse-Transcriptase PCR Instrument (Eppendorf AG, Hamburg, Germany) with the program: 1 cycle at 25°C for 10 min, 1 cycle at 37°C for 120 min and 85°C for 5 min to heat-inactivate the reverse transcriptase. The primers used for real-time PCR are listed in (Appendix A). All primers were designed on the boundaries of exons and analyzed by BLASTn software (http://blast.ncbi.nlm.nih.gov/Blast.cgi) for their specificity. The primers were designed to yield a target sequence that was 60–150 base pairs long with a GC content between 40–70%.  The efficiency of the target amplification was optimized (which includes annealing temperature, primer and sample concentration) up to 95% for each primer set using a 10-fold dilution series of cDNA while standard curves were made. For the reaction, cDNA from each sample was diluted to a concentration (1 ng/ml) such that the Ct values were well within the range of their standard curves, and 5 µl of diluted cDNA was mixed with 10 µl of 2 X iQ SYBR Green I Supermix (Bio-Rad), and 5 p-moles of primers, for a final volume of 20 µl. Real-time PCR amplification was performed on the CFX96 System (Bio-Rad) using the following program: 1 cycle at 95°C for 30s, 40 cycles at 95°C for 10s, 60°C for 24s, and reaction completion with reading plate and a melt curve analysis from 65°C to 95°C, 5s for each 0.5°C. Amplification reactions were conducted using asparagine-linked glycosylation 9 (ALG9), glyceraldehydes-3-phosphate dehydrogenase (GAPDH) and beta-2-microglobulin (B2M) as reference genes. For every experiment, both of two reference genes with the M-value below 0.5 were used. Non-transcribed RNA samples were used as a negative control. The PCR reactions were performed in triplicate for each sample. The data was analyzed and is presented based on the comparative Ct method (CFX Manager Software Version 2.1, Bio-Rad).  36 L-PRF Releasate  In a set of experiments, agents released from the L-PRF membranes into the serum-free culture medium without the presence of fibroblasts were produced (called L-PRF releasate). For these experiments, L-PRF membranes were prepared as described above. Each L-PRF membrane was placed in 35 mm cell culture dish with 2 ml serum-free DMEM for 48 h. The medium was collected followed by centrifugation at 108 g for 10 min. The supernatant was collected as the L-PRF releasate.   Collagen I Gel Contraction Assay  To test the effect of L-PRF on human gingival fibroblasts ECM remodeling, collagen I gel contraction assay was used. To create gingival fibroblast inoculated collagen gels, 600 μl of collagen I solution (PureCol type I bovine collagen solution; Advanced BioMatrix, San Diego, CA, USA) was mixed with 20% (V/V) 5X DMEM (Sigma) containing 2.5% 100 mM NaHCO3 and 1% FBS (Gibco), and adjusted to neutral pH. HGFs (2x105 cells per 0.33 cm2 dish) homogeneously mixed with 0.5 ml of neutralized collagen mixture and incubated for 2 h during which time the solution elated. Then sterile needle was then used to detach the solid gels from the walls of the wells. FBS-free medium (1%) was added into each well with or without L-PRF releasate (5 mg protein/ml). The photos were taken for recording the gel size on day 0, 3 and 7.  The sizes of gels were then quantified based on the areas measured by ImageJ software.  Statistical analysis  Experiments were repeated separately at least three times. The mean of the six donors was calculated and Student’s t-test for paired comparisons was performed to compare the control  37 versus test. Statistical analysis for RT-qPCR data (performed in triplicates) was done using log2-transformed data104. One-way ANOVA followed by Tukey’s post hoc test for multiple comparisons was performed. Statistical significance was set at p<0.05 and required a minimum of 1.5-fold change. The data in the figures is presented represent either as box blots (Figure 8.1.) when data is obtained from six donors (mean of three replicate measurements per each donor were used), or as the mean ± SEM when single donor data is presented with replicate measurements.  38 Chapter 8: Results  L-PRF Modulates Gene Expression in Human Gingival Fibroblasts  To investigate how L-PRF regulates the expression of wound healing related genes in HGFs (appendix A), and whether there are variations in regulating function of L-PRF between different blood donors, L-PRFs were made from six healthy donors. Among 86 genes encoding extracellular matrix (ECM) proteins, matrix metalloproteinases, myofibroblast- and angiogenesis-associated proteins, transforming growth factors, cytokines, connexin, basement membrane and neural crest differentiation-associated proteins, 35 genes (40.6%) showed significantly (p<0.05) altered expression in all samples from six blood donors (Table 8.1).  Sixteen genes (18%) showed no change in expression or inconsistent results between six donors. Several genes tested (N=35; 41%) showed low or non-detectable expression in both treated (in all individuals tested) and control samples. Table 8.1. L-PRF Effect in Gene Response EFFECT NO. GENES CONSISTENT 35 Collagen	 I,	 EDA-FN,	 EDB-Fn,	 Fibrillin-1,	 Tenascin-C,	 Periostin,	 CCN-1,	 a-sma,	 a-11	integrin,	cadherin-2,	cadherin011,	mm-1,	mmp-3,	TIMP-2,	cathepsin-k,	Lumican,	,	VEGF-a,	FGF-2,	CXCL12,	TGF-b1,	TGF-b2,	TGF-b3,	TGF-bR1,	TGF-bR2,	TGF-bR3,	EGR3,	NAB1,	IL-1b,	IL-8,	Ki67,	IL-6,	HGF,	FGF-7 NO	 CHANGE/	INCONSISTENT 16 Emilin-2,	BGN,	DCN,	P311,	EGR1,	NMMIIA,	b-Actin,	r-Actin,	MMP2,	TIMP-1,	-3,	-4,	Cx45,	Collagen	IV,	Slug,	FBN LOW	 EXPRESSION/	UNDETECTABLE 35 Collagen	III,	Elastin,	Emilin-1,	Emilin-3,	THBS1,	THBS2,	SPARC1,	TNX,	Osteopontin,	CCN2,	CCN3,	FMOD,	ASPN,	SMAD7,	Cthrc-1,	EGR2,	NMMIIB,	MMP-7,	-9,	-10,	-11,	-12,	-13,	-14,	IL-1	 a,	 HB-EGF,	 GM-CSF,	 TNF-a,	 Collagen	 VII,	 Laminin-1	 a1,	 Laminin-5	 b3,	 FOXD3,	Twist1,	SNAIL,	Nestin2 TOTAL 86     39  Figure 8.1: The Effect L-PRF on Human Gingival Fibroblast Gene Expression. Expression of significantly regulated human gingival fibroblast genes (35 of 86 genes tested) was grouped by function and presented for both control- and L-PRF-treated samples. The control (HGF + FBS-free DMEM medium) was set as 1; (A) extracellular matrix related genes; (B) matricellular protein genes; (C) myofibroblast- and cell contractility-associated genes; (D) matrix-metalloproteinase-1 and -3, TIMP-2 and cathepsin k; (E) TGF-b signaling-related genes; (F) angiogenesis-related genes; (G) Interleukines, Ki67, HGF and FGF-7 genes. Results show box blots displaying the distribution of data from six donors (Minimum, maximum, median, first quartile, third quartile; *P < 0.05, **P < 0.01, ***P < 0.001).                       40  Among the assessed genes, we first tested mRNA expression of the major fibroblast matrix proteins because of their key functions in wound healing (total 24 genes tested). Seven of these genes (29.2%) were specifically regulated by L-PRF. Collagen type I mRNA was significantly down-regulated by L-PRF, whereas the extra domain-A fibronectin (EDA-FN) and the extra domain-B fibronectin (EDB-FN) genes were up-regulated by 2- to 3.5-fold by L-PRF.  Furthermore, fibrillin-1 was significantly down-regulated by L-PRF (Fig. 8.1A). Among matricellular proteins, tenascin-C was up-regulated significantly by L-PRF, whereas periostin was significantly down-regulated by L-PRF (Fig. 8.1B). Connective tissue growth factor 1 (CCN1) was modestly up-regulated by L-PRF (Fig. 8.1B).    To investigate the effect of L-PRF on HGF differentiation to myofibroblasts, we analyzed the expression of eight myofibroblast- and cell contractility-associated genes. Half of these showed (50%) significantly changes by L-PRF treatment. Expression of alpha-smooth muscle actin (a-SMA), a11 integrin and cadherin-11 showed significant down-regulation by L-PRF treatment while the expression of cadherin-2 showed up-regulation by about 2-fold by L-PRF (Fig. 8.1C). Matrix remodeling is an important part in wound healing, during which MMPs play a crucial role in ECM degradation18. MMPs are also known to regulate inflammation. Therefore, we investigated the effect of L-PRF on the expression of 14 matrix metalloproteinase (MMP) related genes in HGFs. Both MMP-1 and MMP-3 showed significantly up-regulation by L-PRF treatment (Fig. 1D). Other MMPs showed no change, or the expression was below the detecton level in HGFs by RT-qPCR (data not shown). In tissue inhibitors of metalloproteinase (TIMP) genes, only TIMP-2 was down-regulated significantly by L-PRF (Fig. 8.1D).   41  We tested cathepsin K that plays an important role in intracellular ECM degradation. Cathepsin K, was significantly down-regulated by L-PRF (Fig. 8.1E).   During wound healing, blood vessel formation and regression is important105. Therefore, the effect of L-PRF treatment on gene expression of vascular endothelial growth factor-A (VEGF-A), fibroblast growth factor-2 (FGF-2), and C-X-C motif chemokine ligand 12 (CXCL12) was investigated. All of these genes showed significant changes in HGFs by L-PRF (Fig. 6.1F). VEGF-A and FGF-2 were up-regulated by L-PRF significantly while CXCL12 was significantly down-regulated by L-PRF (Fig. 8.1F).   Transforming growth factor-β (TGF-β) signaling is a key regulator of inflammation and a key regulator to number of key factors in wound healing106,107. Total 14 TGF-β signaling related genes were tested, and 9 of these showed significant differences between control and L-PRF treatment (Fig. 1H). Expression of Nuclear polyadenylated RNA-binding protein (NAB1) was significantly up-regulated by L-PRF in HGFs, however, all the other genes showed significant down-regulation by L-PRF, including TGF-β1-3, TGF-β receptor (TGF-βR) 1-3, early growth response protein 3 (EGR3) and NAB2 (Fig. 8.1H).   Cytokines and chemokines play important roles during wound healing108. In this group, three cytokines were significantly up-regulated by L-PRF, including IL-1β, IL-6 and IL-8 (Fig. 8.1I). For chemokines, both HGF and FGF-7 were significantly down-regulated by L-PRF (Fig. 8.1I). For the other genes, Ki67 which is considered as cell proliferation marker109 was significantly up-regulated by L-PRF (Fig. 8.1I). However, there was no regulation of basement membrane related genes by L-PRF in HGFs.  42 L-PRF Stimulates MMP-1 and -3 Protein Production in Human Gingival Fibroblasts  MMP-1 and -3 were among the genes with multi-fold regulation with L-PRF treatment.  To verify whether these gene expression changes were translated to the target proteins, we used Western blotting to analyze the protein level of MMP-1 and -3 in HGFs with or without L-PRF treatment. The treatment with L-PRF significantly increased the accumulation of MMP-1 and MMP-3 in the cell culture media (Fig. 8.2A). The protein levels of MMP-1 and MMP-3 in cell layer were also increased, but did not reach statistical significance (Fig. 8.2B, C). Figure 8.2 The Effect of L-PRF on The Expression of MMP-1 and -3 Protein Levels in Human Gingival Fibroblasts (HGFs). (A) HGFs were treated with FBS-DMEM (control) or L-PRF membrane for 48 hours, rinsed and cultured for another 24 h without the L-PRF membrane. Protein abundance of MMP-1and MMP-3 in the HGF conditioned medium or in the cell layer was measured by Western blotting. β-actin was used as a loading control. (B) MMP-1 protein levels relative to the loading control were quantified. (C) MMP-3 protein levels relative to the loading control were quantified. Results show mean ± SEM from triplicate experiments (*P < 0.05, **P < 0.01, ***P < 0.001).    43 L-PRF Releasate Regulates Gingival Fibroblasts Dose-/Time-Dependently  Having demonstrated that L-PRF regulates expression at multiple genes and proteins in HGFs, we assessed whether these differences were also induced by the L-PRF releasate. About 10 mg proteins were released from a single L-PRF membrane in 48h into medium (data not shown). Then we used different concentrations (dilutions) of the L-PRF releasate to treat the HGFs for 48 h, following by RNA isolation and RT-qPCR. Collagen type I, MMP-1, MMP-3 and VEGF-a, were tested again as the target genes. Collagen type I showed dose-dependent down-regulation by treatments with the L-PRF releasate while the expression of MMP-1, MMP-3 and VEGF-a all showed dose-dependent up-regulation by L-PRF releasate treatments, indicating that regulation of gene expression by L-PRF membranes is mediated by soluble factors in one-way communication without feedback regulation by fibroblasts (Fig. 8.3A-C).  Using the releasate, we then tested regulation of selected genes in a time course experiment to find out the dynamics of the regulation of different genes. Expression of collagen type I was decreased slowly by L-PRF releasate and reached the lowest expression at 48 h (Fig. 3D). However, the expression of VEGF-a started to increase significantly already at 6 h by the L-PRF and reached the peak of expression at 12 h and then leveled until the end of the experiment at 72 h (Fig. 8.3D). Similarly, up-regulation of MMP-3 expression by L-PRF started from early time point and reached the peak at 48 h (Fig. 8.3E). Up-regulation of MMP-1 expression by L-PRF peaked at 12 h and then declined although remained higher than the control to the end of the experiment (Fig. 8.3E). Up-regulation of IL-6 and IL-8 gene expression peaked at 12h and then declined to the basal level by 48-72 h (Fig. 8.3F).  Clearly, the dynamics of regulation seems to be different for type I collagen compared to the others, perhaps requiring the expression of secondary mediators.  44 Figure 8.3. Dose and Time Dependency of L-PRF-mediated Regulation of Human Gingival Fibroblasts (HGF) Genes. (A) Effects of different concentrations of the L-PRF releasate on the regulation of type I collagen gene expression; (B) Effects of different concentrations of the L-PRF releasate on the regulation of MMP-1 and VEGFa gene expression (C) Effects of different concentrations of the L-PRF releasate on the regulation of MMP-3 gene expression (D-F) Dynamics (time-course) of the L-PRF releasate-mediated gene regulation in HGFs (Type I collagen, VEGFa, IL-6 and IL-8). Results show the mean ± SEM from triplicate experiments (*P < 0.05, **P < 0.01, ***P < 0.001).   Effect of L-PRF Releasate on Collagen Gel Contraction  Next, to find out how soluble factors from L-PRF regulate fibroblast functions in 3-dimensional environment in the presence of 1% serum, we conducted an assay that measure fibroblast collagen gel contraction with or without L-PRF releasate treatment. The cells were seeded with type I collagen to create the gel structure, and regular cell culture medium without FBS was added to incubate the cells. Comparing to initial gel size on day 0, both the control and  45 L-PRF releasate treatments showed promotion of collagen gel contraction on both day 3 and 7 time points (Fig. 8.4B). However, on day 3, L-PRF releasate treatment showed significantly more contraction comparing to control.  Figure 8.4. Effect of L-PRF on Type I Collagen. (A) Cell media were treated with control medium (1%FBS+DMEM) or 50% L-PRF in the same medium. By day 3, L-PRF releasate treatment showed significantly enhanced initial gel contraction compared to control. (B) Collagen I contraction relative to the initial gel size was quantified. Results show mean ± SEM from triplicate experiments (*P < 0.05, **P < 0.01, ***P < 0.001).       46 Chapter 9: Discussion  Platelet-rich concentrates have been progressively used to enhanced wound healing by providing additional growth factors at the injury site. These concentrates contain a mixture of anabolic factors derived from platelets and catabolic factors derived from leukocytes. Their concentrations, however, fluctuate among many different preparation systems. Several studies have shown L-PRF growth factor concentration, release kinetics77.  Randomized clinical trials using significant population size to demonstrate efficacy for the L-RF in soft and hard tissue grafting are still missing.   Nevertheless, L-PRF has shown some clinical promise in case studies and has been, therefore, adopted to clinical use because of it is easy to produce in one step centrifugation process. Little is known about the effects of the combined growth factors and cells present in L-PRF membranes on gingival fibroblasts.  In the present study, we demonstrate that L-PRF has a significant effect on human gingival fibroblast gene expression and may promote events in early wound healing.  In our study, seven of the major fibroblast matrix proteins were specifically regulated by L-PRF. Collagen type I mRNA was significantly down-regulated by L-PRF, whereas the extra domain-A fibronectin (EDA-FN) and the extra domain-B fibronectin (EDB-FN) genes were up-regulated by 2- to 3.5-fold by L-PRF (Fig. 1A).  EDA and EDB are fibronectins involved in cell adhesion to the ECM, fibroblast migration and possibly regulation of growth factor responses and granulation tissue angiogenesis110,111. Tenascin-C was up-regulated significantly by L-PRF, whereas the expression of periostin and lumican was significantly down-regulated by L-PRF (Fig. 1B). Connective tissue growth factor 1 (CCN1) was modestly but significantly up-regulated by L-PRF treatment (Fig. 1B). Tenascin-C is an anti-adhesive protein that modulates cell  47 adhesion to the ECM, apparently allowing development of dynamic cell adhesions (like activation of β 1 integrins ) necessary for migration112. Connective tissue growth factor 1 (CCN1) plays a role in fibroblasts response to growth factors, such as TGF-β 1, or to cellular stress and hypoxia during granulation tissue formation113,114.   These results suggest that L-PRF seen to positively regulate the expression of matrix molecules that are associated with early wound matrix (FN, TN). However, L-PRF appeared at the same time down regulate the expression of genes that are highly expressed at later stages at wound healing (granulation tissue formation) such as type I collagen, lumican and periostin20,115.  Consistent with promotion of early wound healing, L-PRF treatment significantly down-regulated the expression of genes related to myofibroblast differentiation.  For instance, alpha-smooth muscle actin (a-SMA) expression is related with wound contraction, a11 Integrin is a fibroblast receptor to interact directly with collagen and cadherin-2 and 11 are important during myogenic differentiation. They promote myoblast differentiation, and increase wound contraction to promote wound closure116. The later may promote fibrosis by facilitating the differentiation of resident tissue fibroblasts into myofibroblasts117.  Promotion of genes involved in expression of early wound matrix, inhibition of myofibroblast differentiation, intracellular matrix degradation and stimulation of expression of certain MMPs, all support the notion that L-PRF treatment would indeed positively regulate early wound healing in fibroblasts. Among 14 matrix metalloproteinase (MMP) in HGFs tested, MMP-1 and MMP-3 showed significant up-regulation by L-PRF. MMPs are involved in matrix degradation or modulation of inflammation via activation/deactivation of inflammatory mediators118. However, upregulation of MMPs in early phases has been described in scar-less  48 wound healing. For instance, fetal skin wound healing that does not produce scars has increased levels of MMPs relative to TIMPs compared to scar-forming adult skin119. Unpublished data from our laboratory also showed significant and early up-regulation of MMP-1 and -3 in scarless gingival wound healing (data not shown). Collectively these observations suggest that certain MMPs may play a significant role in regulation of functions other than matrix degradation, likely activating and deactivating cytokines and chemokines120. Obviously, MMP activity in later stages of wound healing is associated with matrix degradation/re-modeling. Interestingly, expression of catepsin K was significantly down-regulated by L-PRF treatment. Catepsin K plays an important role in extracellular matrix turn-over but also associates with fibrotic wounds.  Again, prevention of excessive matrix degradation in early wound could be positive for optimal healing. Recently, targeting catepsin K to improve diabetic wound healing has been proposed121.  Formation of a new blood supply is critical to wound healing, VEGF and FGF-2 are potent angiogenic factors that play a role in the regulation of initiation and formation of new vascular structures. CXCL12 plays a role in the inflammatory response by recruiting lymphocytes and promoting angiogenesis. In our results, VEGF-A and FGF-2 were up-regulated by L-PRF significantly meanwhile CXCL12 was significantly down-regulated by L-PRF. In general, the function of CXCL12 may not relate to early wound healing as previous studies that have shown that there is no expression of CXCL12 at protein level at the first five days after wounding122. In addition, suppressing connexin 43 has been related to faster healing but also down-regulation of CXCL12 in early stages gingival wound healing123. In general, these results suggest an overall positive effect in early blood vessel formation by the L-PRF.  49  TGF-β family members play a complex role in regulating wound inflammation, cell migration, differentiation and matrix production. A total 14 TGF-β signaling related genes were tested, and 9 of these showed significant differences between control and L-PRF treatment.  Expression of nuclear polyadenylated RNA-binding protein (NAB1) showed significant up-regulation by L-PRF, while all the other genes showed significant down-regulation by L-PRF, including TGF-β1-3, TGF-β receptor (TGF-βR) 1-3, early growth response protein 3 (EGR3) and NAB2. One of many important functions of the TGF- β signaling is to positively regulate myofibroblasts differentiation and matrix production. Consistent with our other results, suppressing of myofibroblast function early in the wounds maybe also beneficial for early healing. Previously, release of TGF-1β from the L-PRF membranes has been reported 72. It is possible that soluble TGF- β 1 released from the L-PRF membranes suppressed expression of fibroblast own TGF-ß1 expression using a negative feedback loop.   Cytokines and chemokines play important roles during wound healing108. Although IL-1ß generally promotes inflammation, its role in normal wound repair is more complex. As discussed above, IL-1 receptor knockout mice have normal skin wound closure but less fibrosis83,84. Normal IL-1 signaling seems to be beneficial for oral wound healing due to protection from bacterial insults84. Interestingly, IL-6 is another pro-inflammatory cytokine that may have positive effects in wound healing. It has been reported to promote proliferation of fibroblasts20.  In addition, IL-6 also promotes keratinocyte migration, macrophage infiltration and angiogenesis85. IL-8 may also promote wound healing by increasing keratinocyte proliferation and migration while reducing wound contraction124. Overall, L-PRF appeared also to increase fibroblast proliferation based on significant upregulation of Ki67 expression confirming findings from a previous study94.  50  The only functional experiment performed for the study was collagen gel contraction assay that showed transient stimulation of gel contraction by L-PRF. This early effect could be regulated by soluble TGF-ß1 released from the L-PRF membrane as it serves as a strong promoter of collagen gel contraction125. More functional studies such as cell migration and others are required before the relevance of gene expression changes caused by L-PRF can be confirmed. Thus, the main limitation of our study is that it is an in vitro study focusing on regulation at limited number of gingival fibroblasts genes. In vivo, both soluble factors released from the L-PRF as well as proteins produced under the influence of L-PRF jointly regulate healing outcomes that are further modulated by other factors present at the wound environment.  However, in vitro studies remain an important step toward the understanding of the L-PRF effects in vivo.   In summary, L-PRF appears to promote expression of genes in gingival fibroblasts that are associated with promotion of early wound healing while suppressing those linked to myofibroblast differentiation and function.  51 Chapter 10: Conclusions    The results demonstrate that the L-PRF membranes have a strong and a specific regulatory effect on gingival fibroblasts that may modulate early phases of wound healing. Further in vitro studies and randomized clinical trials should be conducted with a greater population to confirm its effect in wound healing.      52 Bibliography  1. Jain V, Triveni MG, Kumar ABT, Mehta DS. Role of platelet-rich-fibrin in enhancing palatal wound healing after free graft. Contemporary Clinical Dentistry. 2012;3(Suppl 2):S240-243. 2. P A, Patil P, Kumar RV, Kripal K. Role and Efficacy of L-PRFmatrix in the Regeneration of Periodontal Defect: A New Perspective. Journal of Clinical and Diagnostic Research : JCDR. 2014;8(12):Zd03-05. 3. Marenzi G, Riccitiello F, Tia M, di Lauro A, Sammartino G. Influence of Leukocyte- and Platelet-Rich Fibrin (L-PRF) in the Healing of Simple Postextraction Sockets: A Split-Mouth Study. BioMed Research International. 2015;2015. 4. Haniffa MA, Collin MP, Buckley CD, Dazzi F. Mesenchymal stem cells: the fibroblasts' new clothes? Haematologica. 2009;94(2):258-263. 5. Irwin CR, Picardo M, Ellis I, et al. Inter- and intra-site heterogeneity in the expression of fetal-like phenotypic characteristics by gingival fibroblasts: potential significance for wound healing. Journal of Cell Science. 1994;107 ( Pt 5):1333-1346. 6. Sorrell JM, Caplan AI. Fibroblast heterogeneity: more than skin deep. Journal of Cell Science. 2004;117(Pt 5):667-675. 7. Bordin S, Page RC, Narayanan AS. Heterogeneity of normal human diploid fibroblasts: isolation and characterization of one phenotype. Science. 1984;223(4632):171-173. 8. Lekic PC, Pender N, McCulloch CA. Is fibroblast heterogeneity relevant to the health, diseases, and treatments of periodontal tissues? Critical Reviews in Oral Biology & Medicine. 1997;8(3):253-268. 9. Fournier BP, Ferre FC, Couty L, et al. Multipotent progenitor cells in gingival connective tissue. Tissue engineering Part A. 2010;16(9):2891-2899. 10. Fournier BP, Larjava H, Hakkinen L. Gingiva as a source of stem cells with therapeutic potential. Stem cells and development. 2013;22(24):3157-3177. 11. Mah W, Jiang G, Olver D, et al. Elevated CD26 Expression by Skin Fibroblasts Distinguishes a Profibrotic Phenotype Involved in Scar Formation Compared to Gingival Fibroblasts. Am J Pathol. 2017;187(8):1717-1735. 12. Irwin CR, Myrillas T, Smyth M, Doogan J, Rice C, Schor SL. Regulation of fibroblast-induced collagen gel contraction by interleukin-1beta. Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology. 1998;27(6):255-259. 13. Lorimier S, Hornebeck W, Godeau G, et al. Morphometric studies of collagen and fibrin lattices contracted by human gingival fibroblasts; comparison with dermal fibroblasts. Journal of dental research. 1998;77(9):1717-1729. 14. Hakkinen L, Larjava H. Characterization of fibroblast clones from periodontal granulation tissue in vitro. Journal of dental research. 1992;71(12):1901-1907. 15. Mah W, Jiang G, Olver D, et al. Human Gingival Fibroblasts Display a Non-Fibrotic Phenotype Distinct from Skin Fibroblasts in Three-Dimensional Cultures. PLoS ONE. 2014;9(3). 16. Choukroun J, Diss A, Simonpieri A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part IV: clinical effects on tissue healing. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 2006;101(3):e56-60.  53 17. Hakkinen L, Uitto VJ, Larjava H. Cell biology of gingival wound healing. Periodontology 2000. 2000;24:127-152. 18. Dufour A, Overall CM. Missing the target: matrix metalloproteinase antitargets in inflammation and cancer. Trends in pharmacological sciences. 2013;34(4):233-242. 19. Tardif F, Ross G, Rouabhia M. Gingival and dermal fibroblasts produce interleukin-1 beta converting enzyme and interleukin-1 beta but not interleukin-18 even after stimulation with lipopolysaccharide. Journal of cellular physiology. 2004;198(1):125-132. 20. Larjava H. Oral Wound Healing: Cell Biology and Clinical Management. John Wiley & Sons; 2012:1st edition, pp. 1-9. 21. Singer AJ, Clark RA. Cutaneous wound healing. The New England Journal of Medicine. 1999;341(10):738-746. 22. Clark R. Overview and General considerations, in The Molecular and Cellular Biology of Wound Repair. In: R. ClarK E, ed. New York: Plenum Press; 1996:3-50. 23. Furie B, Furie BC. The molecular basis of blood coagulation. Cell. 1988;53(4):505-518. 24. Savage B, Shattil SJ, Ruggeri ZM. Modulation of platelet function through adhesion receptors. A dual role for glycoprotein IIb-IIIa (integrin alpha IIb beta 3) mediated by fibrinogen and glycoprotein Ib-von Willebrand factor. The Journal of Biological Chemistry. 1992;267(16):11300-11306. 25. Szpaderska AM, Egozi EI, Gamelli RL, DiPietro LA. The effect of thrombocytopenia on dermal wound healing. Journal of Investigative Dermatology. 2003;120(6):1130-1137. 26. Stern D, Nawroth P, Marcum J, et al. Interaction of antithrombin III with bovine aortic segments. Role of heparin in binding and enhanced anticoagulant activity. The Journal of Clinical Investigation. 1985;75(1):272-279. 27. Loskutoff DJ, Edgington TE. Synthesis of a fibrinolytic activator and inhibitor by endothelial cells. Proceedings of The National Academy of Sciences U S A. 1977;74(9):3903-3907. 28. Moncada S, Gryglewski R, Bunting S, Vane JR. An enzyme isolated from arteries transforms prostaglandin endoperoxides to an unstable substance that inhibits platelet aggregation. Nature. 1976;263(5579):663-665. 29. Smith RP, Lackie JM, Wilkinson PC. The effects of chemotactic factors on the adhesiveness of rabbit neutrophil granulocytes. Experimental Cell Research. 1979;122(1):169-177. 30. Newman SL, Henson JE, Henson PM. Phagocytosis of senescent neutrophils by human monocyte-derived macrophages and rabbit inflammatory macrophages. The Journal of Experimental Medicine. 1982;156(2):430-442. 31. Mak K, Manji A, Gallant-Behm C, et al. Scarless healing of oral mucosa is characterized by faster resolution of inflammation and control of myofibroblast action compared to skin wounds in the red Duroc pig model. Journal of dermatological science. 2009;56(3):168-180. 32. Wang N, Liang H, Zen K. Molecular Mechanisms That Influence the Macrophage M1–M2 Polarization Balance. Frontiers in Immunology. 2014;5. 33. Senior RM, Griffin GL, Mecham RP. Chemotactic activity of elastin-derived peptides. The Journal of Clinical Investigation. 1980;66(4):859-862. 34. Wahl SM, Hunt DA, Wakefield LM, et al. Transforming growth factor type beta induces monocyte chemotaxis and growth factor production. Proceedings of The National Academy of Sciences U S A. 1987;84(16):5788-5792.  54 35. Gabbiani G, Chaponnier C, Huttner I. Cytoplasmic filaments and gap junctions in epithelial cells and myofibroblasts during wound healing. The Journal of Cell Biology. 1978;76(3):561-568. 36. Goliger JA, Paul DL. Wounding alters epidermal connexin expression and gap junction-mediated intercellular communication. Molecular Biology of The Cell. 1995;6(11):1491-1501. 37. Steffensen B, Hakkinen L, Larjava H. Proteolytic events of wound-healing--coordinated interactions among matrix metalloproteinases (MMPs), integrins, and extracellular matrix molecules. Critical Reviews in Oral Biology & Medicine. 2001;12(5):373-398. 38. Bugge TH, Kombrinck KW, Flick MJ, Daugherty CC, Danton MJ, Degen JL. Loss of fibrinogen rescues mice from the pleiotropic effects of plasminogen deficiency. Cell. 1996;87(4):709-719. 39. Giancotti FG, Ruoslahti E. Integrin signaling. Science. 1999;285(5430):1028-1032. 40. Hakkinen L, Hildebrand HC, Berndt A, Kosmehl H, Larjava H. Immunolocalization of tenascin-C, alpha9 integrin subunit, and alphavbeta6 integrin during wound healing in human oral mucosa. Journal of Histochemistry & Cytochemistry. 2000;48(7):985-998. 41. Goldfinger LE, Hopkinson SB, deHart GW, Collawn S, Couchman JR, Jones JC. The alpha3 laminin subunit, alpha6beta4 and alpha3beta1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin. Journal of Cell Science. 1999;112 ( Pt 16):2615-2629. 42. Clark RA. Regulation of fibroplasia in cutaneous wound repair. The American Journal of the Medical Sciences. 1993;306(1):42-48. 43. Sporn MB, Roberts AB. Peptide growth factors and inflammation, tissue repair, and cancer. The Journal of Clinical Investigation. 1986;78(2):329-332. 44. Folkman J, D'Amore PA. Blood vessel formation: what is its molecular basis? Cell. 1996;87(7):1153-1155. 45. Risau W. Mechanisms of angiogenesis. Nature. 1997;386(6626):671-674. 46. Nissen NN, Polverini PJ, Koch AE, Volin MV, Gamelli RL, DiPietro LA. Vascular endothelial growth factor mediates angiogenic activity during the proliferative phase of wound healing. The American Journal of Pathology. 1998;152(6):1445-1452. 47. Brooks PC, Clark RA, Cheresh DA. Requirement of vascular integrin alpha v beta 3 for angiogenesis. Science. 1994;264(5158):569-571. 48. Pintucci G, Bikfalvi A, Klein S, Rifkin DB. Angiogenesis and the fibrinolytic system. Seminars in Thrombosis and Hemostasis.  1996;22(6):517-524. 49. Bauer SM, Bauer RJ, Velazquez OC. Angiogenesis, vasculogenesis, and induction of healing in chronic wounds. Vascular and endovascular surgery. 2005;39(4):293-306. 50. Darby IA, Laverdet B, Bonté F, Desmoulière A. Fibroblasts and myofibroblasts in wound healing. Clinical, Cosmetic and Investigational Dermatology. 2014;7:301-311. 51. Darby I, Skalli O, Gabbiani G. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Laboratory Investigation. 1990;63(1):21-29. 52. Clark RA, Folkvord JM, Hart CE, Murray MJ, McPherson JM. Platelet isoforms of platelet-derived growth factor stimulate fibroblasts to contract collagen matrices. The Journal of Clinical Investigation. 1989;84(3):1036-1040. 53. Desmouliere A, Redard M, Darby I, Gabbiani G. Apoptosis mediates the decrease in cellularity during the transition between granulation tissue and scar. The American Journal of Pathology. 1995;146(1):56-66.  55 54. Mochitate K, Pawelek P, Grinnell F. Stress relaxation of contracted collagen gels: disruption of actin filament bundles, release of cell surface fibronectin, and down-regulation of DNA and protein synthesis. Experimental Cell Research. 1991;193(1):198-207. 55. Riikonen T, Westermarck J, Koivisto L, Broberg A, Kahari VM, Heino J. Integrin alpha 2 beta 1 is a positive regulator of collagenase (MMP-1) and collagen alpha 1(I) gene expression. The Journal of Biological Chemistry. 1995;270(22):13548-13552. 56. Bailey AJ, Sims TJ, Le L, bazin S. Collagen polymorphism in experimental granulation tissue. Biochemical and Biophysical Research Communications. 1975;66(4):1160-1165. 57. Smith P, Cáceres M, Martínez C, Oyarzún A, Martínez J. Gingival Wound Healing: An Essential Response Disturbed by Aging? Journal of dental research. 2015;94(3):395-402. 58. Cieslik-Bielecka A, Dohan Ehrenfest DM, Lubkowska A, Bielecki T. Microbicidal properties of Leukocyte- and Platelet-Rich Plasma/Fibrin (L-PRP/L-PRF): new perspectives. Journal of biological regulators and homeostatic agents. 2012;26(2 Suppl 1):43S-52S. 59. Dohan Ehrenfest DM, Andia I, Zumstein MA, Zhang CQ, Pinto NR, Bielecki T. Classification of platelet concentrates (Platelet-Rich Plasma-PRP, Platelet-Rich Fibrin-PRF) for topical and infiltrative use in orthopedic and sports medicine: current consensus, clinical implications and perspectives. Muscles, ligaments and tendons journal. 2014;4(1):3-9. 60. Kletter G, Matras H, Dinges HP. [Partial gluing in extra-intracranial microvascular anastomoses (author's transl)]. Wiener klinische Wochenschrift. 1978;90(12):415-419. 61. Rosenthal AR, Egbert PR, Harbury C, Hopkins JL, Rubenstein E. Use of Platelet-Fibrinogen-Thrombin Mixture to Seal Experimental Penetrating Corneal Wounds. Graefe's Archive for Clinical and Experimental Ophthalmology. 1978;207(2):111-115. 62. Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE, Georgeff KR. Platelet-rich plasma: Growth factor enhancement for bone grafts. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 1998;85(6):638-646. 63. Dohan Ehrenfest DM BT, Del Corso M, Inchingolo F,, G. S. Shedding light in the controversial terminology for platelet-rich products: platelet-rich plasma (PRP), plateletrich fibrin (PRF), platelet-leukocyte gel (PLG), preparation rich in growth factors (PRGF), classification and commercialism. Journal of Biomedical Materials Research Part A. 2010;95:1280-1282. 64. Ehrenfest DMD, Bielecki T, Jimbo R, et al. Do the Fibrin Architecture and Leukocyte Content Influence the Growth Factor Release of Platelet Concentrates? An Evidence-based Answer Comparing a Pure Platelet-Rich Plasma (P-PRP) Gel and a Leukocyte- and Platelet-Rich Fibrin (L-PRF). Current Pharmaceutical Biotechnology. 2012;13(7):1145-1152. 65. Dohan Ehrenfest DM, Rasmusson L, Albrektsson T. Classification of platelet concentrates: from pure platelet-rich plasma (P-PRP) to leucocyte- and platelet-rich fibrin (L-PRF). Trends in biotechnology. 2009;27(3):158-167. 66. Anitua E, Sanchez M, Orive G, Andia I. The potential impact of the preparation rich in growth factors (PRGF) in different medical fields. Biomaterials. 2007;28(31):4551-4560. 67. Yuan T, Guo SC, Han P, Zhang CQ, Zeng BF. Applications of leukocyte- and platelet-rich plasma (L-PRP) in trauma surgery. Current Pharmaceutical Biotechnology. 2012;13(7):1173-1184.  56 68. Castro AB, Meschi N, Temmerman A, et al. Regenerative potential of leucocyte- and platelet-rich fibrin. Part A: intra-bony defects, furcation defects and periodontal plastic surgery. A systematic review and meta-analysis. Journal of clinical periodontology. 2017;44(1):67-82. 69. Dohan Ehrenfest DM, de Peppo GM, Doglioli P, Sammartino G. Slow release of growth factors and thrombospondin-1 in Choukroun's platelet-rich fibrin (PRF): a gold standard to achieve for all surgical platelet concentrates technologies. Growth factors. 2009;27(1):63-69. 70. Honda H, Tamai N, Naka N, Yoshikawa H, Myoui A. Bone tissue engineering with bone marrow-derived stromal cells integrated with concentrated growth factor in Rattus norvegicus calvaria defect model. Journal of artificial organs : the official journal of the Japanese Society for Artificial Organs. 2013;16(3):305-315. 71. Zumstein MA, Berger S, Schober M, et al. Leukocyte- and platelet-rich fibrin (L-PRF) for long-term delivery of growth factor in rotator cuff repair: review, preliminary results and future directions. Current Pharmaceutical Biotechnology. 2012;13(7):1196-1206. 72. Schar MO, Diaz-Romero J, Kohl S, Zumstein MA, Nesic D. Platelet-rich concentrates differentially release growth factors and induce cell migration in vitro. Clinical orthopaedics and related research. 2015;473(5):1635-1643. 73. Lundquist R, Holmstrom K, Clausen C, Jorgensen B, Karlsmark T. Characteristics of an autologous leukocyte and platelet-rich fibrin patch intended for the treatment of recalcitrant wounds. Wound Repair and Regeneration. 2013;21(1):66-76. 74. Shah R, M GT, Thomas R, Mehta DS. An Update on the Protocols and Biologic Actions of Platelet Rich Fibrin in Dentistry. The European journal of prosthodontics and restorative dentistry. 2017;25(2):64-72. 75. Dohan DM, Choukroun J, Diss A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-related biologic features. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 2006;101(3):e45-50. 76. Toffler M, Toscano N, Holtzclaw D, Del Corso M, Ehrenfest D. Introducing Choukroun’s Platelet Rich Fibrin (PRF) to the Reconstructive Surgery Milieu. Journal of Implant and Advanced Clinical Dentistry Continuing Education.  2009;Vol. 1(No. 6). 77. Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology. 2014;40(6):679-689. 78. Dohan Ehrenfest DM, Pinto NR, Pereda A, et al. The impact of the centrifuge characteristics and centrifugation protocols on the cells, growth factors, and fibrin architecture of a leukocyte- and platelet-rich fibrin (L-PRF) clot and membrane. Platelets. 2017:1-14. 79. Vinayak S. Platelet-Rich Fibrin as a Biofuel for Tissue Regeneration. ISRN Biomaterials. 2013;Volume 2013, Article ID 627367, 6 pages. 80. Dohan Ehrenfest DM. How to optimize the preparation of leukocyte- and platelet-rich fibrin (L-PRF, Choukroun's technique) clots and membranes: introducing the PRF Box. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 2010;110(3):275-278; author reply 278-280. 81. Dohan Ehrenfest DM, Del Corso M, Diss A, Mouhyi J, Charrier JB. Three-dimensional architecture and cell composition of a Choukroun's platelet-rich fibrin clot and membrane. Journal of periodontology. 2010;81(4):546-555.  57 82. Dohan DM, Choukroun J, Diss A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part III: leucocyte activation: a new feature for platelet concentrates? Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 2006;101(3):e51-55. 83. Thomay AA, Daley JM, Sabo E, et al. Disruption of interleukin-1 signaling improves the quality of wound healing. The American Journal of Pathology. 2009;174(6):2129-2136. 84. Graves DT, Nooh N, Gillen T, et al. IL-1 plays a critical role in oral, but not dermal, wound healing. Journal of immunology (Baltimore, Md : 1950). 2001;167(9):5316-5320. 85. McFarland-Mancini MM, Funk HM, Paluch AM, et al. Differences in wound healing in mice with deficiency of IL-6 versus IL-6 receptor. Journal of immunology (Baltimore, Md : 1950). 2010;184(12):7219-7228. 86. Rapala K. The effect of tumor necrosis factor-alpha on wound healing. An experimental study. Annales chirurgiae et gynaecologiae Supplementum. 1996;211:1-53. 87. Aggarwal BB. Signalling pathways of the TNF superfamily: a double-edged sword. Nature reviews Immunology. 2003;3(9):745-756. 88. Ritsu M, Kawakami K, Kanno E, et al. Critical role of tumor necrosis factor-α in the early process of wound healing in skin. Journal of Dermatology & Dermatologic Surgery.21(1):14-19 89. Chambers M, Kirkpatrick G, Evans M, Gorski G, Foster S, Borghaei RC. IL-4 inhibition of IL-1 induced Matrix Metalloproteinase-3 (MMP-3) expression in human fibroblasts involves decreased AP-1 activation via negative crosstalk involving of Jun N-terminal Kinase (JNK). Experimental Cell Research. 2013;319(10):1398-1408. 90. Salmon-Ehr V, Ramont L, Godeau G, et al. Implication of interleukin-4 in wound healing. Laboratory Investigation. 2000;80(8):1337-1343. 91. Penn JW, Grobbelaar AO, Rolfe KJ. The role of the TGF-β family in wound healing, burns and scarring: a review. International Journal of Burns and Trauma. 2012;2(1):18-28. 92. Kumar N, Prasad K, Ramanujam L, K R, Dexith J, Chauhan A. Evaluation of treatment outcome after impacted mandibular third molar surgery with the use of autologous platelet-rich fibrin: a randomized controlled clinical study. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial Surgeons. 2015;73(6):1042-1049. 93. Midgley AC, Rogers M, Hallett MB, et al. Transforming growth factor-beta1 (TGF-beta1)-stimulated fibroblast to myofibroblast differentiation is mediated by hyaluronan (HA)-facilitated epidermal growth factor receptor (EGFR) and CD44 co-localization in lipid rafts. Journal of Biological Chemistry. 2013;288(21):14824-14838. 94. Roy S, Driggs J, Elgharably H, et al. Platelet Rich Fibrin Matrix Improves Wound Angiogenesis via Inducing Endothelial Cell Proliferation. Wound Repair Regen. 2011;19(6):753-766. 95. Bicknell R. The realisation of targeted antitumour therapy. British Journal of Cancer. 2005;92(Suppl 1):S2-5. 96. Dohan DM, Choukroun J, Diss A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part I: technological concepts and evolution. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics. 2006;101(3):e37-44. 97. Wu CL, Lee SS, Tsai CH, Lu KH, Zhao JH, Chang YC. Platelet-rich fibrin increases cell attachment, proliferation and collagen-related protein expression of human osteoblasts. Australian dental journal. 2012;57(2):207-212.  58 98. Xuan F, Lee CU, Son JS, Jeong SM, Choi BH. A comparative study of the regenerative effect of sinus bone grafting with platelet-rich fibrin-mixed Bio-Oss(R) and commercial fibrin-mixed Bio-Oss(R): an experimental study. Journal of cranio-maxillo-facial surgery : official publication of the European Association for Cranio-Maxillo-Facial Surgery. 2014;42(4):e47-50. 99. Gurler G, Delilbasi C. Effects of leukocyte-platelet rich fibrin on postoperative complications of direct sinus lifting. Minerva stomatologica. 2016;65(4):207-212. 100. Singh A, Kohli M, Gupta N. Platelet rich fibrin: a novel approach for osseous regeneration. Journal of Maxillofacial and Oral Surgery  2012;11(4):430-434. 101. Castro AB, Meschi N, Temmerman A, et al. Regenerative potential of leucocyte- and platelet-rich fibrin. Part B: sinus floor elevation, alveolar ridge preservation and implant therapy. A systematic review. Journal of clinical periodontology. 2017;44(2):225-234. 102. El Bagdadi K, Kubesch A, Yu X, et al. Reduction of relative centrifugal forces increases growth factor release within solid platelet-rich-fibrin (PRF)-based matrices: a proof of concept of LSCC (low speed centrifugation concept). European journal of trauma and emergency surgery : official publication of the European Trauma Society. 2017. 103. Bi J, Koivisto L, Owen G, et al. Epithelial Microvesicles Promote an Inflammatory Phenotype in Fibroblasts. Journal of dental research. 2016;95(6):680-688. 104. Rieu I, Powers SJ. Real-time quantitative RT-PCR: design, calculations, and statistics. The Plant cell. 2009;21(4):1031-1033. 105. Johnson KE, Wilgus TA. Vascular Endothelial Growth Factor and Angiogenesis in the Regulation of Cutaneous Wound Repair. Advances in wound care. 2014;3(10):647-661. 106. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-[beta] family signalling. Nature. 2003;425(6958):577-584. 107. Werner S, Grose R. Regulation of wound healing by growth factors and cytokines. Physiological reviews. 2003;83(3):835-870. 108. Barrientos S, Stojadinovic O, Golinko MS, Brem H, Tomic-Canic M. Growth factors and cytokines in wound healing. Wound Repair and Regeneration. 2008;16(5):585-601. 109. Polley MYC, Leung SCY, McShane LM, et al. An International Ki67 Reproducibility Study. JNCI Journal of the National Cancer Institute. 2013;105(24):1897-1906. 110. Ghersi G, Dong H, Goldstein LA, et al. Regulation of fibroblast migration on collagenous matrix by a cell surface peptidase complex. The Journal of Biological Chemistry. 2002;277(32):29231-29241. 111. Wong JW, Gallant-Behm C, Wiebe C, et al. Wound healing in oral mucosa results in reduced scar formation as compared with skin: evidence from the red Duroc pig model and humans. Wound Repair and Regeneration. 2009;17(5):717-729. 112. Trebaul A, Chan EK, Midwood KS. Regulation of fibroblast migration by tenascin-C. Biochemical Society transactions. 2007;35(Pt 4):695-697. 113. Leask A, Abraham DJ. All in the CCN family: essential matricellular signaling modulators emerge from the bunker. Journal of Cell Science. 2006;119(Pt 23):4803-4810. 114. Kular L, Pakradouni J, Kitabgi P, Laurent M, Martinerie C. The CCN family: a new class of inflammation modulators? Biochimie. 2011;93(3):377-388. 115. Honardoust D, Eslami A, Larjava H, Hakkinen L. Localization of small leucine-rich proteoglycans and transforming growth factor-beta in human oral mucosal wound healing. Wound Repair and  Regeneration. 2008;16(6):814-823.  59 116. Borghi N, James Nelson W. Intercellular adhesion in morphogenesis: molecular and biophysical considerations. Current topics in developmental biology. 2009;89:1-32. 117. Whitfield ML, Finlay DR, Murray JI, et al. Systemic and cell type-specific gene expression patterns in scleroderma skin. Proceedings of the National Academy of Sciences U S A. 2003;100(21):12319-12324. 118. Sorsa T, Tjaderhane L, Konttinen YT, et al. Matrix metalloproteinases: contribution to pathogenesis, diagnosis and treatment of periodontal inflammation. Annals of medicine. 2006;38(5):306-321. 119. Dang CM, Beanes SR, Lee H, Zhang X, Soo C, Ting K. Scarless fetal wounds are associated with an increased matrix metalloproteinase-to-tissue-derived inhibitor of metalloproteinase ratio. Plastic and reconstructive surgery. 2003;111(7):2273-2285. 120. Overall CM, Kleifeld O. Validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nature Reviews Cancer. 2006;6(3):227-239. 121. Nair. Targeting Cathepsin K to Promoted Diabetic Wound Healing. FASEB Journal. 2017. 122. Florin L, Maas-Szabowski N, Werner S, Szabowski A, Angel P. Increased keratinocyte proliferation by JUN-dependent expression of PTN and SDF-1 in fibroblasts. Journal of Cell Science. 2005;118(Pt 9):1981-1989. 123. Tarzemany R, Jiang G, Larjava H, Häkkinen L. Expression and Function of Connexin 43 in Human Gingival Wound Healing and Fibroblasts. PLoS ONE. 2015;10(1). 124. Rennekampff HO, Hansbrough JF, Kiessig V, Dore C, Sticherling M, Schroder JM. Bioactive interleukin-8 is expressed in wounds and enhances wound healing. The Journal of surgical research. 2000;93(1):41-54. 125. Montesano R, Orci L. Transforming growth factor beta stimulates collagen-matrix contraction by fibroblasts: implications for wound healing. Proceedings of the National Academy of Sciences U S A. 1988;85(13):4894-4897.     60 Appendices Appendix A Gene Bank  Gene Primer sequence Orientation Location Amplicon (bp) Structural ECM Proteins BC036531 Collagen type I (alpha 1) AACCAAGGCTGCAACCTGGA          Forward 3951-3970 80 GGCTGAGTAGGGTACACGCAGG    Reverse 4030-4009 NM_000090 Collagen type III (alpha 1) CTCCTGGGATTAATGGTAGT  Forward 1271-1290 70 CCAGGAGCTCCAGGAAT Reverse 1340-1324 NM_000501 Elastin GGGTCCCTGGGGCCATTC  Forward 174-191   62 CAGGCCCCAGCGCTGGAT Reverse 236-219     NM_000138 Fibrillin-1 AGGAAACGGAGAAGCACAA  Forward 8577-8595 103 CTGTCTTCTCAACATCCCAA  Reverse 8679-8660   NM_007046 Emilin-1 CCTTCGACAGAGTCCTGCTCAA Forward 3162-3183 65 CGCTGTGAACACGCCTGTC Reverse 3226-3208 NM_032048 Emilin-2 GTGAACATGGCCACTGACTT Forward 3513-3532 87 GCCCTCAGAGTGTAGATACAG Reverse 3600-3580  NM_052846 Emilin-3 TCCCTTAGACGAGATCCTAAGCA Forward 962-984 72 TCTAGAAGCTGCACCTTGGTC Reverse 1033-1013  NM_212482  EDA-FN (EDA-fibronectin)  EDB-FN CACAGTCAGTGTGGTTGCCT Forward 5633-5652 68 65 CTGTGGACTGGGTTCCAATCA CAGTAGTTGCGGCAGGAGAA       Reverse 4168 4188       61 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) Matricellular Proteins NM_003246  Thrombospondin-1 CATCTTGTTCTGTGACATGTGG Forward 1513-1534 92  (THBS1) TTCACAGGGTTTCCCGTTC Reverse 1604-1586    NM_003247 Thrombospondin-2 TTGTGTTCAACCCAGACCA Forward 2989-3007 107  (THBS2) CAGGACACACATCATCAATATC Reverse 3096-3075     NM_003118 SPARC-1 ( Secreted protein acidic and rich in cysteine 1) AGCAAGAAGCCCTGCCTGA  Forward 164-182 101 TCCTACTTCCACCTGGACAGGATT Reverse 264-241     NM_002160 TNC (Tenascin-C) CAACCTGATGGGGAGATATGGGGA Forward 6769-6792 75 GAGTGTTCGTGGCCCTTCCAG Reverse 6846-6826      NM_019105 TNX (Tenascin-X) CCTGGAGCCAGACCATAAATACAAG Forward 6334-6358      57 CGCTGGCCACCGTGGAA Reverse 6390-6374 NM_000582 Osteopontin CAGTTGCAGCCTTCTCAG Forward 118-136 82 CTAGGAGGCAAAAGCAAATC Reverse 199-180  NM_006475 Periostin ACACGAGAAGAACGAATCAT   Forward 199-181 97 GTAACAATTTCTTCAGAGTTTCTTC Reverse 199-182 NM_001554 CCN1 CATGATGATCCAGTCCTGCAA Forward 199-185 86 TGTCATTGAACAGCCTGTAGAAG Reverse 199-186        62       Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) NM_001901 CCN2/CTGF (connective tissue growth factor) ATGATGTTCATCAAGACCTGTGCCTG Forward 199-183 80   CTTCCTGTAGTACAGGGATTCAAAGATGTC Reverse 199-184 NM_002514 CCN3 CTCAGATCTGGAGCCATGCGA  Forward 199-187 85     CGTGCAGATGCCAGTCTGGTTG  Reverse 199-188 Small Leucine-Rich Proteoglycans NM_001711 BGN (Biglycan) CTCAAGCTCCTCCAGGTGGTC Forward 1067-1087 93 CCGAAGCCCATGGGACAGAAGTC  Reverse 1151-1127      BT019800 DCN (Decorin)  CTGACACAACTCTGCTAGAC   Forward 242-261 97 GACAAGAATCAATGCGTGAAG Reverse 339-319   NM_002023 FMOD (Fibromodulin) CACAATGAGATCCAGGAAG Forward 761-779 85 TCCGAAGGTGGTTATAACTC  Reverse 845-826         BT006707  LUM (Lumican) TAGACAACAATAAGATCAGCAACA Forward 635-658 85 TTCGTTGTGAGATAAACGCAG Reverse 720-700         NM_017680  ASPN (Asporin) CCTCCAGATAATCTTCCTTCATTCTA Forward 1183-1213 81 CTTCATCTTTGGCACTGTTGG    Reverse 1244-1264  TGF-b Signaling NM_000660 TGF-β1 (Transforming Growth Factor-b1) CAACGAAATCTATGACAAGTTCAAGCAG Forward 1218-1245 76 CTTCTCGGAGCTCTGATGTG Reverse 1294-1275       63             Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) NM_003238 TGF-β2 (Transforming Growth Factor-b2) TGGTGAAAGCAGAGTTCAGAG Forward 1883-1903  140 CACAACTTTGCTGTCGATGTAG Reverse 2022-2001 NM_003239 TGF-β3 (Transforming Growth Factor-b3) ACACCAATTACTGCTTCCGCAA Forward 1161-1182 81 GCCTAGATCCTGTCGGAAGTC Reverse 1242-1220     NM_001130916 TGF-βR1 (TGF-β Receptor 1) GTGTATAGCTGAAATTGACTTAA Forward 286-308 99 TGATTGCAGCAATATGTTGTA Reverse 384-364 NM_003242 TGF-βR2 (TGF-β Receptor 2) CTGGTGAGACTTTCTTCATGTG Forward 768-789 127 CTGATGCCTGTCACTTGAAA Reverse 894-875 NM_001195683 TGF-βR3 (TGF-β Receptor 3) AGGAGGGACTTTAAGACTACTTC Forward 420~442 136 TCAGGGCAAAGATGGCAA Reverse 555~535 NM_001190823 SMAD7 ATTCCCAACTTCTTCTGGAG Forward 328-347 96 TGGACACAGTAGAGCCTC  Reverse 424-407 NM_138455 Cthrc-1 (Collagen triple helix containing-1) TGGAAGGACTTTGTGAAGGA Forward 689-708 104 AATTCCATCCAGTAGAAGCATC Reverse 793-772       NM_001142483 P311 CCTGGACTGAAGAGAGG  Forward 321-447    78 CAGACAAAGAGTTCTGGGTA Reverse 508-489   NM_001964  EGR1 (Early Growth Response  ACGTCTTGGTGCCTTTTGTG Forward 2663-2682  75 GAGGTGAGCATGTCC Reverse 2737-     64 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) NM_001136179 EGR2 (Early Growth Response 2) AGCTTTGCTCCCGTCTCTG Forward 469-487 88 AGCTGGCACCAGGGTACT Reverse 556-539             NM_004430 EGR3 (Early Growth Response 3) CGTTGGACAGCAATCTCTTC Forward 903-922 74 AATGGAGCCCATGTCGTTG Reverse 976-958 NM_005966 NAB1 (NGFI-A Binding Protein-1) CAAAGTCCCACTCATCAGAGA Forward 1930-1950   114 TCACAGCTATCTTGAATCTTCAG Reverse 2043-2020           NM_005967 NAB2 (NGFI-A Binding Protein-2) CACATCCCTGCTAAAGCTGAA Forward 1170-1190 111 ATGATGCTGTATTTGCGGATCT Reverse 1280-1259           Angiogenesis NM_001171630 VEGF-α (Vascular Endothelial Growth Factor-a) AGTGTGTGCCCACTGAGGA Forward 1316-1334    97 GTGCTGTAGGAAGCTCATCTC Reverse 1413-1393     NM_002006  FGF-2 (Fibroblast Growth Factor-2) AGTTGGTATGTGGCACTGAA Forward 831-850 75 GTATAGCTTTCTGCCCAGGTC                                  Reverse 886-906  NM_199168 CXCL12/SDF-1α (  C-X-C motif chemokine ligand 12 /  stromal cell-derived factor 1 alpha) TACAGATGCCCATGCCGA Forward 174-191        93 CTGAAGGGCACAGTTTGGAG Reverse 266~247     65 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) Myofibroblast- and Cell Contractility-Associated Genes NM_001613  α –SMA (α-Smooth Muscle Actin)  AGCGTGGCTATTCCTTCGT Forward 637-655 97 CTCATTTTCAAAGTCCAGAGCTACA Reverse 733-707 NM_001004439 a11 Integrin GAAGGCACCAACAAGAACGA Forward 1144-1163 60 AGGAAAAGCCCGTCTGTGA Reverse 1204-1186 NM_001792 Cadherin-2 TGAGGAGTCAGTGAAGGAG Forward 843-861 91 CTTCTGCCTTTGTAGGTGG Reverse 933-915 NM_001797 Cadherin-11 TTCCTTCGTGTTGTCATTTGTTG Forward 174-196 89 CTTCTTCACCCATTGGATACTTG Reverse 262-240 NM_002473  NMMIIA (Non-muscle Myosin IIA)  ACCGAGAAGATCAATCCATC Forward 722-741      81 AGATACTGGATGACCTTCTTG Reverse 803-783 NM_005964 NMMIIB (Non-muscle Myosin IIB) CCGTTTTACATAATCTGAAGGATC Forward 395-418 98 TTGGAAGATTCTTGTAAGGGTT Reverse 493-472 NM_001101 β-Actin AGGCCCAGAGCAAGAGA Forward 254-270  72 CAGTTGGTGACGATGCCG Reverse 320-303  NM_001614 ϒ-Actin GTCGCAATGGAAGAAGAGATCG Forward 134-155 85 AGCGTCGTCCCCAGCAAAA  Reverse 218-199 Intracellular ECM Degradation-Associated Genes NM_000396 CTSK (Cathepsin K) TCGACTATCGAAAGAAAGGATA  Forward 585-606  70 AAAGCCCAACAGGAA Reverse 655-637      66 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) MMPs and their Inhibitors NM_002421 MMP-1 (Matrix metalloproteinase 1) GCTAACAAATACTGGAGGTATGATG Forward 1250-1275 100 GTCATGTGCTATCATTTTGGGA Reverse 1304-1325     NM_001127891 MMP-2 (Matrix metalloproteinase 2) AGACATACATCTTTGCTGGAG Forward 1900-1920 88 ATCTGCGATGAGCTTGG Reverse 1988-1972     NM_001166308 MMP-3 (Matrix metalloproteinase 3) ATGATGAACAATGGACAAAGGA Forward 661-682 91 GAGTGAAAGAGACCCAGGGA Reverse 751-732  NM_214207 MMP-7 (Matrix metalloproteinase 7) TATGCTGCAACTCATGAAC Forward 722-740 82 CGTAGGTTGGATACATCAC Reverse 804-785       NM_004994 MMP-9 (Matrix metalloproteinase 9) CACTACTGTGCCTTTGAGTCC Reverse 1260~1243 63 CGATGGCGTCGAAGATGTT Forward 1531~1551 NM_002425 MMP-10 (Matrix metalloproteinase 10) TTATACACCAGATTTGCCAAGA Forward 394-415 56 TTCAGAGCTTTCTCAATGG Reverse 450-432    NM_005940 MMP-11 (Matrix metalloproteinase 11) CTATCCTCCAAAGCCATTGTAA Forward 2258-2179 106 CAACTGTGTTTAATGACAATCCTC Reverse 2254-2231 NM_002426 MMP-12 (Matrix metalloproteinase 12) GTATGATGAAAGGAGACAGATGAT Forward 1303-1326  166 TACGTTGGAGTAGGAAGTCAT Reverse 1469-1449 NM_002427 MMP-13 (Matrix metalloproteinase 13) CAGGAATTGGTGATAAAGTAGAT Forward 1302-1324 85 CTGTATTCAAACTGTATGGGTC   Reverse 1365-1386         67  Gene Bank  Gene  Primer Sequence  Orientation  Location  Amplicon (bp) NM_004995 MMP-14 (Matrix metalloproteinase 14) TCTCCCAGAGGGTCATTCAT Forward 1618-1637 70 TTCCAGTATTTGTTCCCCTTGTAG Reverse 1688-1665 NM_003254 TIMP-1 (Tissue inhibitor of metalloproteinase 1) CTGTGTCCCACCCCACC Forward 267-283 64 GAACTTGGCCCTGATGACGA Reverse 330-311      NM_003255  TIMP-2 (Tissue inhibitor of metalloproteinase 2) ACATTTATGGCAACCCTATCAA  Forward 481-502 70 TCAGGCCCTTTGAACATCTTTA Reverse 550-529      NM_000362 TIMP-3 (Tissue inhibitor of metalloproteinase 3) AGGACGCCTTCTGCAAC Forward 1281-1297 68 CTCCTTTACCAGCTTCTTCC Reverse 1348-1329 NM_003256 TIMP-4 (Tissue inhibitor of metalloproteinase 4) ACCTGTCCTTGGTGCAGA  Forward 927-944 80 TGTAGCAGGTGGTGATTTGG Reverse 1004-985 Connexin NM_000165 CX43 (connexin 43) ACTGTGGGTCTCAAAAATATGCTTA Forward 1026~1050 95 AGTAACCAGCTTGTACCCAG Reverse 1120~1101 NM_005497 CX45 (connexin 45) CTATAACATTGCTGTCAAACCAGA Forward 1141~1164 120 TCCTCATGGCTGCCATAC Reverse 1260~1243 Cytokines NM_000575 IL-1α (Interleukin-1 alpha) TGAAGACCAACCAGTGCTG Forward 1551~1569 135 CAAGTTTGGATGGGCAACTG Reverse 1686~1667           68 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) NM_000600 IL-6 (Interleukin-6) CAACCTGAACCTTCCAAAGATG Forward 380~401 119 TCT GGC TTG TTC CTC ACT AC Reverse 539~520 NM_000584 IL-8 (Interleukin-8) CAGAGGGTTGTGGAGAAGTT Forward 407~426 106 GCTTGAAGTTTCACTGGCA Reverse 513~493 NM_001945 HB-EGF (Heparin-binding EGF-like growth factor) GTACCATAGGAGAGGAGGTTATG Forward 830~852 132 TCACCTTGTGTCTTCTCAGAG Reverse 962~942 NM_001010932 HGF (Hepatocyte growth factor) ACCCTAATCAAAATAGATCCAGC Forward 310~332 130 GCTTTATCAAAAACAAAAGCCTTG Reverse 440~417 NM_002009 FGF-7/KGF (fibroblast growth factor 7 / Keratinocyte growth factor) CAAGGAAGGAAAACTCTATGC Forward 895~915 107 GTGTCCATTTAGCTGATGC Reverse 1001~983 NM_000758 GM-CSF (Granulocyte macrophage colony-stimulating factor) CAGGCATGGCAGAAGAA Forward 621~637 131 CGGTAAAACATCTTGAATAAATATGG Reverse 752~727 NM_000594 TNF-α (Tumor necrosis factor alpha) TGGGACAGTGACCTGGAC   Forward 1046~1063 138 TTC TGA GAC AGA GGC AACCT Reverse 1184~1165 NM_002417 Ki67 TTCGGAAGCAAATCTGATTGT TTGTTCATTGACCTTTGAGGA Forward Reverse 2145~2165 2255~2235 111  69 Gene Bank Gene Primer Sequence Orientation Location Amplicon (bp) Basement membrane NM_001845 Collagen type IV AATTCCAGGGCAGCCAG Forward 1460~1476 85 ATCCGTCTATATCACAGATGAGG Reverse 1545~1523 NM_000094 Collagen type VII TGGCAGCAGGGGAGAG Forward 7592-7607 86 CCCAGGATCACAGCTGAGT Reverse 7678-7660 NM_005559 Laminin-1 α1 TTGACCTTGGCAAAGGCA Forward 8424~8441 86 TAACATAGTCTGTCTTGACCGTG Reverse 8510~8488 NM_001017402 Laminin-5 β3 CTCCGAGCTTCATCTACCTG Forward 511~530 92 GGAGTCACACTTGCAGCA Reverse 603~586 Stem Cell Associated Genes NM_003068 Slug GACCCTGGTTGCTTCAAGGA Forward 762~781 72 TGTTGCAGTGAGGGCAAGAA Reverse 833~814 NM_ 012183 FOXD3 AGTGAAGCCGCCTTACTCGTACAT Forward 417~440 275 AGGAAGCTGCCGTTGTCGAACAT Reverse 692~670 NM_000474 Twist1 TGCAGCTATGTGGCTCACGA Forward 874~983 266 CCCACGCCCTGTTTCTTTGA Reverse 1140~1121 NM_005985 SNAIL TCGGAAGCCTAACTACAGCGA Forward 126~146 139 AGATGAGCATTGGCAGCGAG Reverse 265~246 NM_006617 Nestin2 CGGCTGCGGGCTACTGAAAAGT Forward 890~912 230 TTGGGGTCCTGAAAGCTGAGGGA Reverse 1122~1100        70        Gene Bank  Gene  Primer Sequence  Orientation  Location  Amplicon (bp) Housekeeping Genes NM_002046 GAPDH (glyceraldehydes-3-phosphate dehydrogenase) CTTTGTCAAGCTCATTTCCTGGTA Forward 1020-1043 70 GGCCATGAGGTCCACCA Reverse 1089-1073     NM_004048 B2M (beta-2-microglobulin) TGTCTTTCAGCAAGGACTGGTCTTTC Forward 281-306 92 ATGGTTCACACGGCAGGCATA Reverse 351-372     Appendix B Donors Information Donor Gender Age Medical condition 1 Female 27 Healthy NKDA 2 Male 28 Healthy NKDA 3 Female 37 Healthy NKDA 4 Female 38 Healthy NKDA 5 Male 31 Healthy NKDA 6 Male 37 Healthy NKDA  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0354392/manifest

Comment

Related Items