Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigations into the mechanisms involved in baculovirus nucleocapsid egress Biswas, Siddhartha 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_september_biswas_siddhartha.pdf [ 4.85MB ]
Metadata
JSON: 24-1.0349032.json
JSON-LD: 24-1.0349032-ld.json
RDF/XML (Pretty): 24-1.0349032-rdf.xml
RDF/JSON: 24-1.0349032-rdf.json
Turtle: 24-1.0349032-turtle.txt
N-Triples: 24-1.0349032-rdf-ntriples.txt
Original Record: 24-1.0349032-source.json
Full Text
24-1.0349032-fulltext.txt
Citation
24-1.0349032.ris

Full Text

  INVESTIGATIONS INTO THE MECHANISMS INVOLVED IN BACULOVIRUS NUCLEOCAPSID EGRESS by Siddhartha Biswas B.Sc. University of Delhi, New Delhi, India, 2008 M.Sc. University of Calcutta, Kolkata, India, 2010   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral studies (PLANT SCIENCE) The University of British Columbia (Vancouver) July 2017 © Siddhartha Biswas, 2017 ii  Abstract The mechanism of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) nucleocapsid egress from the nucleus to the plasma membrane leading to the formation of budded virus (BV) is not known. AC141 is a nucleocapsid protein and has been shown to be associated with β-tubulin. We hypothesized that nucleocapsid proteins associate with the lepidopteran microtubule and kinesin-1 during egress. Kinesin-1 is a motor protein that moves along the microtubules and carries cargo. Experiments showed that nucleocapsid proteins associate with kinesin-1 during infection. Downregulation of kinesin-1 by siRNA results in reduced BV production. These studies support that AcMNPV utilizes kinesin-1 and microtubules for nucleocapsid transport and BV production. GP64 (integral membrane protein) and ME53 associate at the plasma membrane and are believed to be at budding foci of nucleocapsids. AC141 was shown to associate with the ME53-GP64 complex at the plasma membrane and potentially facilitates the budding of nucleocapsids. The interaction between AC141, GP64, ME53 may enhance the cellular relocation of ME53.  AcMNPV-encoded viral ubiquitin (vUbi) and AC141 (a predicted E3 ubiquitin ligase) have been shown to be required for efficient BV production. We hypothesized that vUbi interacts with AC141 and this interaction is required for BV production. Deletion of both ac141 and vubi restricted the infection to a single cell. AC141 was ubiquitinated by either vUbi or cellular Ubi and this interaction was required for optimal BV production. Virion fractionation showed that a nucleocapsid protein of 100 kDa, potentially AC66, is specifically ubiquitinated with vUbi in BV iii  and but not in occlusion derived virus (ODV). These data suggest ubiquitination of nucleocapsid protein acts as a signal that determines how a nucleocapsid is directed to become a BV or ODV. Polyubiquitin chains are formed by the internal lysines present within the ubiquitin and serve as a signal for various cellular pathways. Mutations of lysines to arginine showed that vUbi is involved in cellular processes mediated by K6 and K27 polyubiquitin chains.  The collective results of this study provide significant new data on the role of viral and host proteins and the mechanism by which baculovirus nucleocapsids egress from the nucleus to form BV. iv  Lay Summary Baculoviruses are insect-specific viruses used extensively for environmentally safe, organic control of pest insects and as a tool for producing proteins for pharmaceuticals. Baculoviruses produce virions called budded virus (BV) which causes a systemic spread to host tissues and is critical for killing insects. This study investigated the molecular mechanisms required for the production of BV. In the cell nucleus the viral genome is packaged in a protein coat called a nucleocapsid that has to exit the cell, by traversing through the cytoplasm and budding out from the plasma membrane, forming BV. This study showed for the first time that cellular microtubule motor proteins called kinesin-1 are required for BV production. In addition, ubiquitination, a universal cellular process, was shown to tag nucleocapsids and may be the molecular signal determining if a nucleocapsid exits a cell. Overall, the results of this thesis have enhanced understanding of the baculovirus life cycle. v  Preface The research work of this thesis was conducted at the Summerland Research and Development Center, Agriculture and Agri-Food Canada, Summerland, BC, Canada under the Co-supervision of Dr. David Theilmann and Dr. James Kronstad (Michael Smith Laboratories, UBC). A list of manuscripts that are either published or in preparation from chapters is mentioned below. The contribution of the candidate in each chapter is mentioned below. Chapter 1. Introduction The candidate wrote the chapter and Dr. David Theilmann provided editorial support. Chapter 2. Material and Methods The candidate wrote the chapter and Dr. David Theilmann provided the editorial support. The candidate and Dr. David Theilmann designed the experiments and the candidate performed the experiments. Some of the knockout and repaired viruses were made by Leslie G. Willis (member of Dr. David Theilmann lab) which will be mentioned in detail in the preface to chapter 5. In addition former lab members Dr. Minggang Fang, Dr. Yingchao Nie and Dr. Xiaojiang Dai made some knockout and repaired viruses which were used in chapter 5. Dr. Jondavid de Jong, former laboratory member of Dr. Peter J Krell, provided the ME53-related knockout and repaired viruses and will be mentioned in the preface Chapter 4. vi  Chapter 3. Trichoplusia ni kinesin-1associates with AcMNPV nucleocapsids  was modified from the manuscript: Biswas, S., Blissard, G. W. and Theilmann, D. A. (2016). Trichoplusia ni kinesin-1 associates with Autographica californica multiple nucleopolyedrovirus nucleocapsid proteins and is required for the budded virus production. J Virol. 2016 Jan 13;90(7):3480-95. doi: 10.1128/JVI.02912-15. The candidate and Dr. David Theilmann designed the experiments and the candidate performed all the experiments. Dr. Gary Blissard provided the mRNA sequences of T. ni kinesin-1 heavy chain and kinesin-1 light chain. The candidate and Dr. David Theilmann analysed the data Dr. David Theilmann supervised the work. The candidate wrote the manuscript; Dr. Gary Blissard and Dr. David Theilmann provided editorial support. Chapter 4. AC141 is part of the ME53 and GP64 budding foci. A version of this chapter is under preparation to be submitted as a scientific manuscript. The candidate and Dr. David Theilmann designed the experiments and the candidate performed the experiments. Dr. Jondavid de Jong provided me53KO, me53+vp39KO, me53+gp64KO, me53KO-HA-ME53 and me53KO-ME53:GFP viruses. Dr. Yang Liu did the initial experiment of co-immunoprecipitation between HA-ME53 and AC141. Dr. Peter Krell helped in the experimental strategy and editorial support for the manuscript preparation. Anticipated author list: Biswas, S., Willis, L.G., Liu, Y., de Jong J., Krell, P.J. and Theilmann, D.A. Chapter 5. AC141 interacts with vUbi and the role of vUbi in nucelocapsid egress . vii  A version of this chapter is under preparation to be submitted as a scientific manuscript. The candidate and Dr. David Theilmann designed the research and the candidate performed co-immunoprecipitation, confocal, mass spectrometry and virus preparation experiments. Leslie Willis made the vubiKO, ac141+vubi2xKO, 2xKO-HA-ac141+Myc-vUbi viruses. Dr. Minggang Fang and Dr. Yingchao Nie made the vp80KO and ac66KO viruses. Anticipated author list Biswas, S, Willis, L.G., Fang, M., Nie, Y., Dai, X.and Theilmann, D.A. Chapter 6. Functional analysis of the lysine residues of AcMNPV viral ubiquitin. The candidate and Dr. David Theilmann designed the research and the candidate made the vUbi lysine mutations. The candidate performed the Western blot, time course and proteasome inhibition assays.  Chapter 7. General discussion and future perspectives. The candidate wrote the chapter and Dr. David Theilmann provided editorial support. viii  Table of Contents Abstract ................................................................................................................................. ii Lay Summary ....................................................................................................................... iv Preface ................................................................................................................................... v Table of Contents................................................................................................................ viii List of Tables ....................................................................................................................... xii List of Figures ..................................................................................................................... xiii List of Abbreviations .......................................................................................................... xvi Acknowledgments............................................................................................................. xviii Chapter 1 Introduction.......................................................................................................... 1 1.1 Baculoviruses .........................................................................................................1 1.2 Baculovirus replication cycle  ..................................................................................5 1.2.1 Baculovirus entry into midgut epithelial cells ...........................................5 1.2.2 Baculovirus entry by BV .........................................................................6 1.2.3 Nucleocapsid cytoplasmic transport and entry into the nucleus  .................9 1.2.4 Baculovirus early gene transcription ...................................................... 10 1.2.5 Expression of baculovirus late and very late genes ................................. 11 1.2.6 Baculovirus genome replication ............................................................ 12 1.3 AcMNPV nucleocapsids egress mechanisms  ......................................................... 13 1.3.1 The role of viral proteins in the nucleocapsid egress mechanism............. 16 1.4 Role of cellular proteins in virus capsid egress mechanisms  ................................... 22 1.4.1 Structure and function of kinesin-1 ........................................................ 22 1.4.2 The ubiquitin system and characteristics of E3 ubiquitin ligases ............. 28 1.5 Research objectives .............................................................................................. 35 1.5.1 Interaction of AC141 with lepidopteran kinesin-1 and its requirement for BV production................................................................................. 36 1.5.2 Role of AC141 in the formation of ME53 and GP64 foci at the plasma membrane............................................................................................. 38 1.5.3 Interaction of AC141 with vUbi and its role in nucleocapsid egress  ........ 38 Chapter 2 Materials and methods ....................................................................................... 40 2.1 Cell lines and polyclonal stable cell lines ............................................................... 40 2.1.1 Cell lines .............................................................................................. 40 2.1.2 Construction of polyclonal stable cell lines expressing T. ni kinesin-1 KLC and KHC...................................................................................... 40 ix  2.2 Viruses……………………………………………………………………………… 42 2.2.1 Construction of ac141KO, me53KO and repaired viruses ....................... 45 2.2.2 Construction of VP39-3xmCherry virus................................................. 45 2.2.3 Construction of vubi knockout, ac141+vubi double knockout and repaired viruses..................................................................................... 46 2.2.4 Construction of ac66 knockout, vp80 knockout and repaired viruses....... 50 2.2.5 Site-directed mutagenesis ...................................................................... 52 2.3 Co-immunoprecipitation of protein complexes  ...................................................... 54 2.4 Confocal microscopy and co-localization analysis  ................................................. 55 2.5 Cell culture techniques.......................................................................................... 57 2.5.1 Transfection of ME53:GFP, HA-AC141 and GP64 expressing plasmid into Sf9 cells......................................................................................... 58 2.5.2 siRNA mediated knockdown of T. ni KLC............................................. 58 2.5.3 MG132 treatment of Sf9 cells ................................................................ 60 2.5.4 Time course analysis of virus infection in bacmid transfected or virus infected cells for analysis of BV production and viral protein synthesis  .. 60 2.6 Generation of polyclonal antibodies ...................................................................... 61 2.7 Western blot analysis ............................................................................................ 61 2.8 Yeast two-hybrid analysis ..................................................................................... 62 2.9 Purification of BV and ODV and fractionation into envelope and nucleocapsid fractions ………………………………………………………………………….... 63 2.10 Mass Spectrometric analysis and detection of the viral and cellular ubiquitinated proteins ………………………………………………………………………….... 65 Chapter 3 Trichoplusia ni kinesin-1 associates with AcMNPV nucleocapsids .................... 67  3.1 Introduction ........................................................................................................... 67 3.2 Results ………………………………………………………………………….... 71 3.2.1 Co-immunoprecipitation of HA-AC141 and T. ni KLC .......................... 71 3.2.2 Cloning of T. ni kinesin-1 and generation of stable Tn5b1 cells expressing tagged KHC and KLC .......................................................... 73 3.2.3 Co-immunoprecipitation of HA-tagged KLC or KHC and AC141 .......... 76 3.2.4 Co-localization analysis of T. ni KLC or KHC with AC141.................... 80 3.2.5 Co-localization studies of KLC or KHC, with AC141 and microtubules ......................................................................................... 86 x  3.2.6 siRNA down-regulation of KLC and impact on BV production .............. 88 3.2.7 Association of the nucleocapsid proteins VP39, BV/ODV-C42 and FP25 with kinesin-1 KLC...................................................................... 94 3.2.8 Association of VP39-3xmCherry nucleocapsids with microtubules ......... 96 3.3 Discussion…………………………………………………………………………. 105 Chapter 4 AC141 co-localizes with ME53 and GP64 foci at the plasma membrane  ......... 111 4.1 Introduction........................................................................................................ 111 4.2 Results …………………………………………………………………………. 114 4.2.1 Co-immunoprecipitation of AC141, HA-ME53, GP64 and VP39 ......... 114 4.2.2 Co-localization analysis of AC141, GP64 and ME53:GFP ................... 117 4.2.3 Scatter plot and surface modelling analysis of co-localization of AC141, ME53:GFP and GP64............................................................. 118 4.2.4 Co-localization of individual nucleocapsids (VP39-3xmCherry expressing virus) with AC141, GP64 and ME53:GFP at the budding complex sites ...................................................................................... 122 4.2.5 Relocalization of ME53:GFP in cells co-transfected with plasmids expressing  GP64 and AC141 .............................................................. 125 4.2.6 Group I alphabaculovirus encodes a conserved PPEF/Y motif. ............. 131 4.2.7 Mutation analysis of the ME53 PPEF/Y Motif and effect on BV production .......................................................................................... 131 4.3 Discussion…………………………………………………………………………. 136 Chapter 5 AC141, a potential E3 ubiquitin ligase, interacts with viral ubiquitin and AC66 to facilitate nucleocapsid egress .......................................................................... 141 5.1 Introduction........................................................................................................ 141 5.2 Results…………………………………………………………………………….. 146 5.2.1 Comparison of the RING motifs of AC141 with other viral and cellular E3 ligases ............................................................................... 146 5.2.2 Analysis of ac141 and vubi single and double knockouts on BV production .......................................................................................... 150 5.2.3 Co-immunprecipitation of AC141 and vUbi......................................... 154 5.2.4 Mass spectrometric analysis of proteins co-immunoprecipitated with HA-AC141 to identify potential substrates and viral-ubiquitination sites.................................................................................................... 156 5.2.5 Mutational analysis of AC141 K87 vUbi ubiquitination site to determine effect on BV production ...................................................... 161 xi  5.2.6 Western blot analysis of purified BV and ODV for viral and cellular ubiquitinated proteins.......................................................................... 163 5.2.7 MS analysis of purified BV and ODV for potential viral-ubiquitinated peptides .............................................................................................. 165 5.2.8 Co-immunoprecipitation analysis of Myc-vUbi with AC66 or VP80..... 167 5.2.9 MS analysis of the viral proteins immunoprecipitated  by AC66-HA .... 172 5.2.10 Co-immunoprecipitaton of AC141 with AC66 or VP80 ....................... 175 5.2.11 Localization of AC66-HA and co-localization of AC66-HA with Myc-vUbi and AC141 ................................................................................. 177 5.3 Discussion…………………………………………………………………………. 180 Chapter 6 Functional analysis of the lysine residues of AcMNPV viral ubiquitin  ............ 187 6.1 Introduction........................................................................................................ 187 6.2 Results…………………………………………………………………………….. 191 6.2.1 Alignment of viral ubiquitin homologs encoded by alpha and betabaculoviruses................................................................................ 191 6.2.2 Analysis of BV production by viruses expressing vUbi mutants  ........... 194 6.2.3 Phenotypic effect of viral ubiquitin lysine residue mutations  ................ 196 6.2.4 The role of vUbi in the 26S proteasome mediated degradative pathway 198 6.3 Discussion…………………………………………………………………………. 201 Chapter 7 Conclusions and future perspectives ................................................................ 205 7.1 Nucleocapsids utilize host microtubules and not actin for movement through the     cytoplasm during egress...................................................................................... 206 7.1.1 Future directions to elucidate the AcMNPV nucleocapsid interaction with microtubules ............................................................................... 212 7.2 Possible role of AC141 at the plasma membrane during budding.......................... 213 7.2.1 Future directions to determine the mechanism of budding of nucleocapsids at the plasma membrane  ................................................ 216 7.3 Viral-ubiquitination of virion proteins as a potential signal to label nucleocapsids for  egress from the nucleus to form BV .................................................................... 217 7.3.1 Future directions to elucidate the role of AC66 in egress of nucleocapsids from nucleus................................................................. 219 7.4 Concluding remarks............................................................................................ 219 References.......................................................................................................................... 224 Appendix: .......................................................................................................................... 246 xii  List of Tables Table 2.1 List of primers used for the study of interaction between nucleocapsid proteins and T.ni kinesin-1 .........................................................................................................................44 Table 2.2 List of primers for the study of AC141 and vUbi interaction and role vUbi in nucleocapsid egress ................................................................................................................49 Table 3.1  Yeast two hybrid screening for direct interaction of KHC and KLC with AC141 or VP39.................................................................................................................................... 104 Table 5.1  List of most the prominent AcMNPV proteins that co-immunoprecipitated with HA-AC141 and identified by mass spectrometry. ......................................................................... 158 Table 5.2 List of the most prominent cellular proteins that co-immunoprecipitated with HA-AC141 as identified by mass spectrometry.  ........................................................................... 159 Table 5.3 Ubiquitinated peptides modified at K87 of AC141 and the quantification values. ..... 160 Table 5.4 List of the most prominent AcMNPV proteins in the region of 85-110 kDa of purified BV  and identified by mass spectrometry. .............................................................................. 166 Table 5.5  List of the most prominent AcMNPV proteins that co-immunoprecipitated with AC66-HA and analyzed by mass spectrometry. ..................................................................... 173 Table 5.6 List of the most prominent host proteins Spodoptera frugiperda that co-immunoprecipitated with AC66-HA. ..................................................................................... 174   xiii  List of Figures Figure 1.1 Alphabaculovirus lifecycle. ..................................................................................... 7 Figure 1.2 Comparison of the structure and proteins of the alphabaculovirus virions BV and ODV. .....................................................................................................................................15 Figure 1.3 Gene locations of ac141 and me53; predicted domain structure of AC141.  ...............19 Figure 1.4 Structure of kinesin-1 heavy chain and light chain.  ..................................................24 Figure 1.5 Ubiquitination of substrates by E1, E2 and E3 enzymes. ..........................................29 Figure 3.1Co-immunoprecipitation of HA-AC141 and untagged T. ni KLC in Tn5B1 infected cells. ......................................................................................................................................72 Figure 3.2 Constructs used to generate stable cell lines expressing T. ni KHC and KLC that contain epitope tags or EGFP fusions. .....................................................................................74 Figure 3.3 Co-immunoprecipitation of AC141 with C- or N-HA-KLC or C- or N-HA-KHC expressed in stably transformed cells. ......................................................................................77 Figure 3.4 Co-localization analysis of HA-AC141 and T. ni Myc- KLC at 20, 24 and 48 hpi. ....82 Figure 3.5 Co-localization analysis of HA-AC141 and T. ni Myc-KHC at 20, 24 and 48 hpi.  ....84 Figure 3.6 Co-localization analysis of AC141, KLC- or KHC-EGFP and microtubules. ............87 Figure 3.7 siRNA downregulation of T. ni HA-KLC expression and the impact on AcMNPV BV production.  .............................................................................................................................92 Figure 3.8 Association of the nucleocapsid proteins VP39, FP25, and BV/ODV-C42 with C-HA-KLC or N-HA-KLC................................................................................................................95 xiv  Figure 3.9 Co-localization of VP39-3xmCherry nucleocapsids with microtubules during entry and egress. .............................................................................................................................98 Figure 3.10 Analysis of a Tn5B1 nucleus cells infected with VP39-3xmCherry virus. ............. 100 Figure 4.1 Recombinant viruses used to study the interaction of AC141 with ME53, GP64 and VP39.................................................................................................................................... 115 Figure 4.2 Co-immunoprecipitation of AC141, HA-ME53, GP64 and VP39. .......................... 116 Figure 4.3 Co-localization of AC141 with ME53:GFP and GP64.  .......................................... 119 Figure 4.4 Co-localization analysis of AC141 with ME53:GFP and GP64 using scatterplots and surface modelling.  ................................................................................................................ 120 Figure 4.5 Co-localization of VP39-3xmcherry labelled nucleocapsids with GP64, ME53:GFP and AC141 at the cellular periphery.  ..................................................................................... 123 Figure 4.6 Co-localization of HA-AC141, ME53:GFP and GP64 in plasmid transfected cells treated with or without Triton X-100. .................................................................................... 129 Figure 4.7 Comparison of of alpha- and betabaculoviruses ME53 and conservation of a PPEF/Y motif.  ................................................................................................................................... 133 Figure 4.8 Construction of ME53:GFP PPEF mutant viruses and analysis of BV production.  .. 134 Figure 5.1 Alignment of the AC141RING domain sequence and structural comparison between v-Ubi and c-Ubi. ................................................................................................................... 148 Figure 5.2 Construction of ac141 and vubi single (1x KO) and double knockout (2x KO) viruses. ............................................................................................................................................ 151 Figure 5.3 Time course analysis of BV production by ac141 and vUbi single and double gene KOs. .................................................................................................................................... 153 xv  Figure 5.4  Co-immunoprecipitation of HA-AC141 and Myc-vUbi on pulling down HA-AC141. ............................................................................................................................................ 155 Figure 5.5 Figure 5.5 Effect of AC141 K87 mutations on BV production.  .............................. 162 Figure 5.6 Western blot analyses of the isolated BV and ODV for viral ubiquitinated proteins. ............................................................................................................................................ 164 Figure 5.7 Schematic diagram ac66 and vp80 KO and repaired bacmids. ................................ 169 Figure 5.8 Co-immunoprecipitation analysis of AC66-HA or VP80-HA with Myc-vUbi. ........ 170 Figure 5.9 Co-immunoprecipitation analysis of AC66-HA or VP80-HA with AC141.............. 176 Figure 5.10 Co-localization analysis of AC66-HA with AC141 and Myc-vUbi and co-localization analysis of AC141 and Myc-vUbi.  ...................................................................... 179 Figure 6.1 Alignment of alpha- and betabaculovirus viral ubiquitin.  ....................................... 192 Figure 6.2 Schematic maps of vubi KO and lysine mutant viruses. ......................................... 193 Figure 6.3 Time course analysis of  BV production from Sf9 cells infected with viruses expressing vUbi lysine mutations. ......................................................................................... 195 Figure 6.4 Expression of vUbi tagged proteins in Sf9 cells infected with vubi lysine mutant viruses ................................................................................................................................. 197 Figure 6.5 Effect of blocking 26S proteasome proteolysis by MG132 on the expression of vUbi conjugated proteins. .............................................................................................................. 200 Figure 7.1 Association of the nucleocapsid proteins FP25 and BV/ODV-C42 with N-Myc-KLC. ............................................................................................................................................ 209 Figure 7.2 Hypothetical model for nucleocapsid egress and BV formation. ............................. 222 xvi  List of Abbreviations ALG   Apoptosis-linked gene Alix   ALG-2-interacting protein X AMP   Adenosine monophosphate Arp2/3   Actin related protein 2 & 3 ASFV   African swine fever Virus ATP   Adenosine triphosphate BEVS    Baculovirus based expression vector system bp   Base pair BV    Budded virus CAT   Chloramphenicol acetyltransferase CEV   cell-associated enveloped virus CRE   Cyclic-AMP (cAMP) response elements CSLM   Confocal Laser Scanning Microscope DAPI   4’, 6’-diamidino-2-phenylindole DBP   DNA binding protein DmKLC  Drosophila melanogaster kinesin light chain DNA    Deoxyribonucleic acid DTT   Dithiothreitol DUB   Deubiquitinating enzymes E    Early  EDTA   Ethylenediaminetetraacetic acid EEV   extracellular enveloped virus EGFP   Enhanced green fluorescent protein EGT    Ecdysteroid UDP–glucosyltransferase EGTA   Ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid ERAD   Endoplasmic reticulum associated degradation ESCRT  Endosomal sorting complex required for transport FLIM    Fluorescence Lifetime Imaging Microscopy F-protein  Fusion protein FRET   Fluorescence Resonance Energy Transfer GP64     GP64   Glycoprotein 64 GV    Granulovirus HBV   Hepatitis B virus HCMV  Human cytomegalovirus HECT   Homologus to E6AP C-terminus HEPES  4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid] HIV   Human immunodeficiency virus HPV   Human papillomavirus HRP   Horse radish peroxidase hrs   Homologous repeats HSV-1   Herpes Simplex Virus-1 xvii  IAP   Inhibitor of apoptosis IE    Immediate early IEV   Intracellular enveloped virus IMV   Intracellular mature virus IPTG   Isopropyl β-D-1-thiogalactopyranoside KHC    Kinesin heavy chain KLC    Kinesin light chain L    Late LEF   Late expression factor MAPs   Microtubule associated proteins MNPV   Multiple nucleopolyhedrovirus MRS   Multi-functional regulatory sequence MS   Mass spectrometric MVB   Mutivesicular bodies NPC   Nuclear pore complex OBs    Occlusion bodies ODV    Occlusion derived virus ORF   Open reading frame PAGE   Polyacrylamide gel electrophoresis PCR   Polymerase chain reaction PIF    per os infectivity factor PSB   Protein sample buffer RBR   RING-Between-Ring RING RING   Really interesting new gene RNA   Ribonucleic acid SDS   Sodium dodecyl sulfate SNPV    Single nucleopolyhedrovirus SOB   Super optimal broth SOC   SOB with catabolite repression  TBST   Tris buffer saline and Tween20 TCA   tricholoroacetic acid TE   Tris-EDTA TEM   Transmission electron microscopy TPR   Tetratricopeptide repeats TSG   tumor susceptibility gene USP   Ubiquitin-specific proteases VL    Very late VLF   Very Late Factor VPS    Vacuolar sorting protein WASP   Wiskott-Alderich syndrome protein WB   Western blot xviii  Acknowledgments First of all I would like to thank my supervisor Dr. David Theilmann for providing me the excellent opportunity to pursue research in his lab. I deeply appreciate all his support and guidance. His high level of patience and outstanding mentorship has made my journey greatly valuable and enjoyable, and I am indebted to him for his contributions to the experimental discussions and preparation of manuscripts. I also would like to thank Jane Theilmann for her constant support and making me a part her family. I would like to thank my co-supervisor Dr. James Kronstad and committee members Dr. Peter Krell and Dr. Nelly Panté for their valuable and critical suggestions, feedback and contributions. I would like to thank Dr. Janet Chantler and Dr. Thibault Mayor, my external examiners for the comprehensive exam for their contribution. I also would like to thank Dr. Mahesh Upadhyaya, my graduate advisor, Dragan Lia Maria and Shelly Small from the Plant Science program, Faculty of Land and Food systems for their valuable contributions.  A special thanks to Dr. Peter Krell because the ME53 project would not have been possible without your able guidance and I truly enjoyed our interactions. I must also acknowledge former lab members from Dr. Krell group including Dr. Jondavid de Jong and Dr. Yang Liu for providing me with the viruses, plasmids as well as helpful suggestions.  My special thanks to Dr. D’Ann Rochon for her special warmth and support both scientifically and personally. I also would like to thank other scientists at the Summerland Research and xix  Development Center (SuRDC)-Dr. Hélén Sanfaҫon, Dr. Guss Bakkerren and Dr. Yu Xiang for their support and contributions. Many thanks to Michael Weis for his excellent help with transmission electron microscopy and confocal microscopy.  My special thanks to Les Willis for all the help in the lab and for being with me in all situations and supporting me throughout my Ph.D. It is commendable the way you have organised the lab, making it such a pleasant place to work. I am also thankful to Joan Chisolm for her wonderful friendship and helpful suggestions with the lab techniques. I will always remember the Saturday night movies with you, Joan and Benazir.  I would also like to thank all my present and past lab members including Ajay, Rahul, Nadia, Zhenpu, Caitlin and Mel for their support. I also would like to thank present and past members of the Summerland Research Station; Basudev Ghoshal, Kankana Ghoshal, Ron, Rob, Melanie, Sudarshan, Murali, Dinesh, Ana, Hala, Vinay Panwar, Krin, Sushma and Rajita.   I would like to thank Benazir from the bottom of my heart for all the valuable suggestions and constant support throughout my career. This whole journey would not have been possible without you and you have been more than a friend to me. I appreciate all your efforts in difficult phases of my life and would like to acknowledge for constantly believing in me.  I would like to thank my father Subhash Chandra Biswas and mother late Shovana Biswas for their constant support throughout my life, and for providing me with unconditional love. You both have been special to me and will always be. I have always looked up to the both of you and xx  am so proud to have such loving and caring parents. Lastly I would like to thank all my immediate relatives and close friends for always supporting and encouraging me.            xxi    To my parents  “Miss you maa”    1  Chapter 1  Introduction   1This study investigates nucleocapsid egress mechanisms from nucleus to the plasma membrane of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) which includes crossing the nuclear envelope, transport through the cytoplasm and budding out from the plasma membrane. In this introduction I will give a brief overview of the baculovirus life cycle, what is currently known about egress mechanisms and the role of baculovirus and host proteins in these processes. 1.1 Baculoviruses The insect virus family Baculoviridae consists of four genera namely Alphabaculovirus, Betabaculovirus, Gammabaculovirus and Deltabaculovirus. Alpha- and betabaculoviruses infect primarily Lepidoptera; gamma- and deltabaculoviruses infect Hymenoptera and Diptera respectively (1). Baculoviruses are unusual among eukaryotic viruses as they produce two virion phenotypes, occlusion derived virus (ODV) and budded virus (BV). ODV is required for oral infectivity and inter-host transmission whereas BV is required for systemic infection within a single host. ODV consists of one or more rod-shaped nucleocapsids enclosed within an envelope. The envelope is either   2  derived within the nucleus or in the nuclear-cytoplasmic environment. Alpha-, delta- and gammabaculovirus ODVs derive the envelope from the inner nuclear membrane whereas the betabaculovirus ODVs obtain their envelope in a nuclear-cytoplasmic milieu. ODV become occluded in crystalline-like protein matrix, composed of polyhedrin, to form occlusion bodies (OBs) which serves to stabilize and protect the virions in the environment. OBs of alphabaculoviruses, gammabaculoviruses and deltabaculoviruses are polyhedral in shape whereas betabaculovirus OBs are ovicylindrical. Alphabaculovirus OBs contain multiple ODV which may each contain a single nucleocapsid (single nucleopolyhedrovirus: SNPV) or multiple nucleocapsids (multiple nucleopolyhedrovirus: MNPV) per envelope. Betabaculovirus OBs contain only a single ODV, which contain a single nucleocapsid per envelope. Though it is not recognized taxonomically, alphabaculovirus are often subdivided into Group I and Group II based on genome comparison and the phylogenetic analysis of specific genes such as the BV envelope glycoprotein GP64 (2).  BV typically contain a single nucleocapsid and derive their envelope by budding from the plasma membrane, which incorporates a viral envelope fusion protein that is required for the infection of other tissues in the host by receptor mediated endocytosis (3). The ODV and BV differ in their efficiencies of infection for different tissues; ODV are specialized to infect midgut epithelial cells and BV are utilized for infecting multiple tissues and they   3  have been shown to be up to 1,000 fold more efficient in infecting cultured cells than ODV (4). Baculoviruses naturally control insect populations in various ecosystems. For example Lymantria dispar MNPV (LdMNPV) and Orgyia pseudotsugata MNPV (OpMNPV) control the large outbreak populations of gypsy moth and Douglas fir tussock moth, respectively (5). Baculoviruses have been used extensively as biopesticides including Anticarsia gemmatalis MNPV (AgMNPV) which has been used on 2 million hectares per year of soybean crops to control the velvet bean caterpillar (a pest of soybeans) in Brazil (6), Cydia pomonella granulovirus (CpGV), which is used against codling moth a worldwide pest of apples in North America and Europe (7), and Helicoverpa armigera NPV (HearNPV), which is used against the cotton bollworm, a pest of cotton mostly in China (8). The use of baculovirus as a pesticide can have some limitations because of attributes such as slow speed of kill and limited host range (9). Attempts to overcome the speed of kill have been addressed by genetic modifications (8, 10). For example, by 4 dpi, 90% of T. ni larvae fed OBs containing a virus that expressed an insect-specific mite paralytic neurotoxin were killed or incapacitated compared to only 10% for WT virus (11). Gene deletions can also improve the pesticide properties of baculoviruses. For example, AcMNPV encodes and expresses (ecdysteroid UDP–glucosyltransferase (EGT), which catalyzes the transfer of glucose from UDP-glucose to ecdysteroids which are insect molting hormones (12). Expression of EGT can therefore prevent the host from   4  molting  and prolonging the length of time an insect will feed after infection (12). Deletion of egt gene reduced feeding time period resulting in earlier mortality as compared to  WT virus, improving the pesticide characteristics (9).  Over the last 30 years the baculovirus expression vector (BEV) system  has developed into one of the most highly used tools for the production of proteins by the biotechnology and pharmaceutical industries as well research communities (13, 14). BEVs have been very successful because of the very high levels of production and post-translational modification processes are similar to higher eukaryotes (14, 15). This allows the proteins to get folded properly, post translationally processed and trafficked to their native locations. Recently several studies have investigated the use of baculovirus BV as a gene therapy expression vector in mammalian cell lines as well as in animal model systems. The advantages of using baculovirus BV is that very large DNA sequences can be delivered into the mammalian cells but the virus is unable to replicate (13-16). Baculoviruses have also been an excellent model system for understanding the molecular biology of large DNA virus replication and how they interact with their hosts. I will provide a brief overview of the baculovirus replication cycle emphasizing the most highly studied baculovirus and subject of this thesis, AcMNPV.   5  1.2 Baculovirus replication cycle 1.2.1 Baculovirus entry into midgut epithelial cells  The insect gut is composed of three sections, the foregut, midgut and the hindgut. In Lepidoptera midgut, pH varies from neutral to very high alkaline conditions. The pH remains around 7 during entry and exit of the midgut but varies from 10 to 12 near the central region of the midgut. AcMNPV in vivo infection starts with the ingestion of OBs from contaminated foods. When the OBs reach the high alkaline midgut, the polyhedrin matrix dissolves and releases ODV. The OBs are surrounded by polyhedral envelope which is composed of primarily polysaccharides and proteins that are degraded by proteinases present in the midgut of the insect (17) (Figure 1.1). Once ODVs are released into the midgut they need to cross the peritrophic membrane before they can reach the midgut epithelial cells. Some baculoviruses such as Mamestra configurata NPV (MacoNPV) encode proteins called enhancins (metalloproteinases) which cause selective degradation of host peritrophic membrane proteins to increase infectivity of the virion (18, 19). AcMNPV does not encode a recognizable enhancin but is nevertheless able to cross the peritrophic membrane, suggesting an alternate mechanisms or proteins may be involved (20, 21).    6  After crossing the peritrophic membrane, ODV bind to and enter a midgut epithelial cell which is facilitated by a number of baculovirus-encoded ODV-specific envelope proteins. These proteins are required for binding to specific cell receptors of midgut epithelial cells. These proteins are called per os infectivity factors (PIFs) which are PIF0 (P74, Ac138) (22), PIF1 (Ac119), PIF2 (Ac22) (23), PIF3 (Ac115) (24), PIF4 (Ac96) (25), PIF5 (ODV-E56, Ac148) (26), PIF6 (Ac68) (27) and PIF7 (P95, Ac83) (28, 29). PIF1, PIF2, PIF3 and PIF4 form a stable core complex on the surface of the ODV; AC83 and P74 is loosely associated with that complex (30, 31). Associated with the complex but are not required for its formation is PIF0, -5, -6, and -7. AC83 associates with both the nucleocapsid and the envelope and is required to recruit the core complex to ODV envelopes (29). Interestingly, ac83 also appears to contain a cis-acting element that is required for the packaging of DNA into nucleocapsids (32). After binding to midgut cells via the PIF complex, the ODV envelope fuses with the epithelial cell membrane, releasing the nucleocapsids into the cell cytoplasm. 1.2.2 Baculovirus entry by BV Group I alphabaculovirus BVs contain a single protein required for cell binding which is the fusion glycoprotein called GP64. In Group II alphabaculoviruses, betabaculoviruses and deltabaculoviruses, F-protein is the fusion glycoprotein.    7    Figure 1.1 Alphabaculovirus lifecycle. Infection starts with the oral ingestion of OBs which releases ODVs in the midgut of the insect. ODVs fuse to the midgut epithelial cells and release nucleocapsids into the cytoplasm. Host actin polymerisation drives the nucleocapsids towards the nucleus. New progeny nucleocapsids are made in the virogenic stroma and nucleocapsids escape the nucleus and bud from the plasma membrane to form BV. In the late stages of infection, nucleocapsids are retained inside the nucleus to form ODV, which become occluded to form OBs. OBs are released into the environment upon cell lysis and tissue degradation.   8  However gammabaculoviruses do not have homologs of either GP64 or F-protein (1, 33). AcMNPV-encoded GP64 mediates BV entry by receptor-mediated endocytosis and induces membrane fusion under low pH conditions (34). In addition to mediating entry into insect cells, GP64 can also mediate entry into a variety of vertebrate cells (34, 35). The structure of GP64 has been determined and it is a class III fusion protein, whereas the structure of F-protein closely resembles class I fusion proteins (36-38). GP64 mediated entry is facilitated by low pH conditions.. GP64 mediated entry into a mammalian cell line can be blocked if dynamin- or clathrin-dependent endocytosis or micropinocytosis are inhibited or if membrane cholesterol is depleted (39). Transfection of cells with a bacmid that has gp64 deleted results in a virus that is restricted to a single cell infection and is unable to spread from cell to cell (40, 41). AcMNPV and other Group I alphabaculoviruses encode GP64 and a F-protein homolog but the latter does not act as a functional fusion peptide and cannot rescue a  gp64 KO virus (42). Homologs of gp64 were thought to only be found in Group I alphabaculoviruses. Interestingly however, a recent publication has shown that a betabaculovirus Diatraea saccharalis GV genome encodes a GP64 homolog which can functionally replace the AcMNPV gp64 gene (43). Fusion of BV with the cell membrane mediated by GP64 or F-protein results in internalization and is followed by fusion of the envelope with late endosomes under lower pH conditions, releasing the nucleocapsid in the cytoplasm (34).   9  1.2.3 Nucleocapsid cytoplasmic transport and entry into the nucleus  After the release of nucleocapsids from either ODV or BV they associate with the cellular cytoskeleton and undergo motility driven by actin polymerisation (Figure 1.1). One of the key studies showing actin association was through the utilization of mCherry fluorescently tagged nucleocapsids and enhanced green fluorescent protein (EGFP) tagged actin (44). Baculovirus nucleocapsids are propelled through the cytoplasm on newly synthesized actin tails to interact with nuclear pore complexes (NPCs) (44-46). The AcMNPV nucleocapsid proteins P78/83 and BV/ODV C42 mediates the interaction with host actin polymerisation (47). P78/83 is a phosphoprotein located at the base of AcMNPV nucleocapsids and acts as a WASP (Wiskott-Alderich syndrome protein) like protein. P78/83 functions as a nucleation-promoting factor and activates G-actin polymerization by the host Arp2/3 (actin related protein 2 & 3) complex (48). BV/ODV-C42 (AC101) modulates the P78/83-Arp2/3 interaction which ensures nucleocapsid movement in the cytoplasm using host actin (47). Transport of nucleocapsids by actin polymerisation is followed by entry into the nucleus through the NPC. A recent study has shown that the entry of an AcMNPV nucleocapsid into the nucleus is implemented by a unique mechanism that has not been previously described. In general, viruses that replicate inside the nucleus disassemble at the cytoplasmic side of NPC and the genome is released into the nucleus (49). Alternatively, parvoviruses cause transient disruption of the nuclear envelope to permit capsid entry (49). AcMNPV nucleocapsids have been   10  shown by electron and fluorescence microscopy to dock at the NPC and then transverse through the NPC reaching the nucleus intact whereupon the genome is disassembled and the genome is released (44, 49, 50). AcMNPV nucleocapsids are very  large  with a diameter approaching the maximum size of cargo that can pass through a NPC (approximately 40 nm) which means the NPC must undergo large scale re-arrangement during nucleocapsid entry (50). Viruses usually interact with NPC components and exploit the nuclear import machinery for genome delivery (49). In contrast, during AcMNPV nucleocapsid entry, transport of nucleocapsids through the NPC is energy independent and does not require NPC proteins (51). Arp2/3  actin polymerisation activity essentially pushes the nucleocapsids through the NPC (51). This type of entry through the NPC has not been previously observed and represents another unique feature of baculovirus infections. 1.2.4 Baculovirus early gene transcription Baculovirus gene expression occurs in an ordered cascade that proceeds from immediate early (IE), early (E), late (L) and to very late (VL) stages. Baculovirus IE and E genes are transcribed by the host RNA polymerase II but the L and VL genes are transcribed by a baculovirus-encoded RNA polymerase. IE and E genes contain regulatory sequences which are similar to most eukaryotic RNA polymerase II promoters (52). Consensus sequences in some IE and E genes have been identified to include TATA boxes and   11  CAGT at the transcriptional initiation site (53). Other early gene upstream promoter elements have been identified including GATA and CACGTG motifs (54). Most baculoviruses also contain homologous repeat (hr) regions in their genome, for example in AcMNPV, hrs are present in eight locations with each hr being composed of repeated units of about 70 bp with an imperfect 30 bp palindrome near their center (55). The hr elements act as transcriptional enhancer elements when linked 5’ or 3’ to reporter genes (55, 56). In addition, the hr elements bind the major viral transcriptional activators of early genes, IE0 and IE1 (55, 57, 58). 1.2.5 Expression of baculovirus late and very late genes Transcription of early genes produces the necessary machinery which is need for viral DNA replication. After viral DNA replication initiates, there is a rapid amplification of viral DNA sequences which are used as a template for the transcription of late and very late genes by the viral encoded RNA polymerase. The viral late RNA polymerase consists of at least four viral proteins that include P47, late expression factor-4 (LEF-4), LEF-8, and LEF-9 (59-62). Expression of late genes initiates at the late promoter sequence (A/G/T)TAAG and does not require upstream regulatory sequences (63, 64).  Very late promoters possess a burst sequence in the untranslated region that is required for hyper expression (64, 65). This includes the hyper expression of polyhedrin, P6.9 and   12  p10. Both polyhedrin and p10 genes contain an A/T  rich sequence “burst” downstream of the late promoter sequence that also appears to be required for high level expression (64). VLF-1 is required for hyper expression and binds to the A/T rich burst sequence of polyhedrin and p10 (64, 66-69). In the very late stage of infection polyhedrin starts accumulating in the nucleus and gradually assembles into a lattice surrounding the ODV forming OBs. Each polyhedrin subunit first forms trimers, then associate into dodecamers which then arrange to form cube shaped crystals. P10 protein co-localizes with polyhedrin and assists in proper formation of polyhedra envelope. Deletion of P10 results in OBs that are fragile (70). OBs, which are the primary mode of baculovirus intra-host infection, are released into the environment upon lysis and liquefaction of the infected insect. 1.2.6 Baculovirus genome replication IE0 and IE1 in addition to binding to hr elements as transcriptional activators may also serve as origin binding proteins for assembly of the viral DNA replication complex (71). Viral DNA replication occurs in the nucleus in a region called the virogenic stroma (Figure 1.1). With the progression of viral infection, the size of the virogenic stroma increases and occupies a large proportion of the nucleus. Nine viral genes, including ie1 or ie0, DNA polymerase (dnapol), helicase (p143), lef-1, lef2, lef3, lef11, and DNA binding protein (dbp) are essential for transient viral DNA replication. The ubiquitin   13  ligase proteins PE38 and IE2 are not essential but can augment viral genome replication and are considered accessory factors (72-81). DNApol has 5’ to 3’ DNA polymerase activity but also has 3’ to 5’exonuclease activity (72, 73). The xonuclease activity provides viral genetic stability by correcting DNA polymerase errors. LEF1 acts as a primase and LEF2  acts as a primase associated factor (74). Primases are involved in DNA replication, which synthesizes a short RNA segment that is complementary to ssDNA. LEF3 is a single-stranded DNA binding protein that is also capable of unwinding DNA depending on the concentration and redox state (75, 76). Helicase moves directionally and unwinds DNA (79) and has both ATPase and helicase properties (80). DBP acts as a DNA binding protein capable of unwinding and annealing DNA (78). The function of LEF11 is unknown but deletion of this gene results in a virus that is unable to synthesize DNA and carry out late gene expression (81). 1.3 AcMNPV nucleocapsids egress mechanisms  BVs are formed during the late phase of infection when single nucleocapsids bud from the plasma membrane. BV enables the systemic spread of infection throughout the host with the resulting infection of most tissues. Nucleocapsids are synthesized inside the nucleus in the virogenic stroma. The nucleocapsids then migrate from the virogenic stroma to the inner nuclear envelope regions also known as the RING zone (82). Evidence has suggested that for AcMNPV the viral protein VP80 is responsible for the   14  movement of nucleocapsids from the stroma to the RING zone. Deletion of vp80 eliminates BV production and nucleocapsids are unable to move from virogenic stroma to the nuclear envelope regions (83). VP80 which contains a paramyosin like or myosin tail like domain, was shown to co-immunoprecipitate with actin and localize at the nuclear actin scaffolds (82). It was therefore hypothesized that VP80 may interact with myosin motors to enable transport of nucleocapsids along nuclear F-actin filaments from the stroma to the ring zone. The cellular cytoskeleton is used by many types of viruses to transport nucleocapsids to various cellular compartments and to the plasma membrane. Even though baculoviruses use actin for virus entry and transport to the nucleus it is not yet clear if actin is used for any part of the egress pathway from the nuclear periphery to the plasma membrane. The exact mechanism by which nucleocapsids egress from the nucleus is unknown. Transmission electron microscopy (TEM) analysis of nucleocapsid nuclear egress has shown that nuclear membrane cisternae and evaginations form containing nucleocapsids (84). The nuclear evaginations could be sites of budding of  nucleocapsids through the nuclear envelope since nucleocapsids surrounded by double membrane are observed in the cytoplasm (85). Virus encoded proteins may be required for nuclear envelope evagination but none have yet been identified. Several viral proteins have however been shown to be required for BV production without apparent effects on viral DNA replication or nucleocapsid formation and include AC66, GP41, ME53, GP41, FP25, vUbi, AC141and GP64. (86-88).    15     Figure 1.2 Comparison of the structure and proteins of the alphabaculovirus virions BV and ODV. Two forms of virions from baculovirus BV (left) and ODV (right). Proteins that are common to both are listed in the centre. BV and ODV proteins are listed on the left and right (Reprints with permission from ViralZone, SIB Swiss Institute of Bioinformatics).    16  1.3.1 The role of viral proteins in the nucleocapsid egress mechanism Upon deletion of AcMNPV ac66, BV production is reduced by more than 99% compared to WT virus and infection is restricted primarily to a single cell phenotype (87). TEM revealed that nucleocapsids appear normal and are filled with genomic DNA, similar to WT virus. In addition, TEM analysis also showed that nucleocapsids of an ac66 knockout virus are unable to efficiently egress from the nucleus (87). AC66 may also have other roles as ODV formation was also significantly reduced as well as OB production. AC66 might have some role in nucleation of polyhedrin to form OBs in the very late stage of the infection (87).   FP25 (AC61) is a BV associated protein that was originally identified because mutations within this gene caused a reduction in the production of OBs or “Few Polyhedra” (89). Subsequently it has also been shown that FP mutations also cause, depending on the cell line tested, a 2-5 fold increase in BV production as compared to WT virus (90-92). Homologs of FP25 are found in sequenced genomes of alpha-, beta- and gammabaculoviruses (93). Based on this data it was proposed that FP25 may be one of the proteins required for the switch of directing  nucleocapsids from BV to ODV production (92).   17  Gp41 (ac80) is a core gene that produces a protein which is modified with O-linked N-acetylglucosamine and is associated with both BV and ODV (93-95). It is also one of the few proteins which have been proposed to be a tegument protein which is located between the nucleocapsid and the envelope. Analysis of temperature sensitive mutants of GP41 have shown that it is required for  BV production and TEM pictures suggested nucleocapsids are unable to egress from the nucleus (88). Me53 (ac139) is an immediate early gene found in the lepidopteran alpha- and betabaculoviruses but not in the gamma- and deltabaculoviruses and expresses a protein that becomes associated with nucleocapsids (89, 93, 96). Deletion of me53 reduces the BV production by more than 1000 fold but does not (97, 98) affect viral DNA replication. Therefore it has been proposed that ME53 is required for egress of nucleocapsids from the nucleus to the plasma membrane. In support of this, ME53 has also been shown to form distinct foci at the cell plasma membrane where it co-localizes with the BV envelope fusion protein GP64 (96). The ME53-GP64 foci may represent viral budding sites. However ME53 may have additional functionality because during the late phase of infection ME53 translocate into the nucleus, mediated by a non-canonical nuclear translocation sequence (NTS) (97). GP64 is an envelope fusion protein (class III) and is present only in Group I alphabaculoviruses except for one newly discovered exception in a betabaculovirus (34,   18  36, 43). GP64 is required for the fusion of BV to plasma membrane to initiate infection. Deletion of gp64 does not affect viral genome replication but viruses are unable to bud out from cells resulting in a single cell infection phenotype (40, 41, 43). Structural and other functional details of GP64 have been previously described in section 1.2.2.  Homologs of viral ubiquitin (vUbi, AC35) are found in alpha- and betabaculoviruses but not in the gamma and delta baculoviruses (93).Vubi is expressed under both early and late promoter elements and is not required for viral replication (99-101). However a frame shift mutation in vubi was found to reduce BV production by 5-10 fold suggesting that it might be required for nucleocapsid egress (100). Mass spectrometric (MS) analyses have shown that vUbi is associated with both BV and ODV in AcMNPV and Helicoverpa armigera NPV (HearNPV)  where it is present as monomers as well as conjugated to virion-associated proteins (89, 94, 102). Both cUbi and vUbi are attached to the inner surface of the BV envelope by a phospholipid anchor (103). In vitro analyses have shown that vUbi is unable to support the eukaryotic proteasome degradative pathways suggesting its role in non-degradative pathways. Additionally, the transfer of vUbi from the cellular E2 conjugating enzymes to the substrate via cellular E3 ubiquitin ligase is an inefficient process compared to cUbi. It was therefore concluded that for efficient use of vUbi alternate E3 ubiquitin ligases are required (104). More recent studies have shown that Bombyx mori MNPV and HearNPV vUbi fused to EGFP, was distributed throughout the cell but was concentrated in the nucleus (105).    19    Figure 1.3 Gene locations of ac141 and me53; predicted domain structure of AC141. A. Ac141 and me53 gene location with respective own late (L) and early (E) promoters. Ac141 is a spliced gene and the 5’ orf contains exon1 of ie0. B. Three putative domains of AC141 at the N-terminus acidic domain I, acidic domain II, charged domain as shown. Two conserved domains at the C-terminus coiled-coil domain and RING domain.   20  AcMNPV ac141 which was originally called exon0, is a late gene that initiates from an ATAAG promoter sequence downstream from the ie0 transcription initiation site. The 5’-end of ac141 is part of exon1 of ie0 which, as described earlier, is expressed early in infection (Figure 1.3A). AC141 is a 261 amino acid protein that has a predicted size of 30.1kDa. AC141 has regions rich in acidic (acidic domain I and II) and charged amino acids (charged domain), plus two conserved domains, the coiled-coil leucine zipper and RING (really interesting new gene) (Figure 1.3B). Deletion of ac141 results in primarily a single cell phenotype and reduces BV production by over 99% (86). Analyses by TEM of cells transfected with bacmid containing an ac141 deletion showed that nucleocapsids are not able to escape the nucleus (86). Deletion and point mutation analysis revealed that all of the domains were required for BV production (84). It has been shown through co-immunoprecipitation, yeast 2-hybrid and point mutation analyses that AC141 forms dimers. The charged, acidic II and coiled coil domains are required for dimer formation. AC141 was also shown to interact with two viral proteins FP25 and BV/ODV-C42. The coiled-coil and charged domains are required for association with BV/ODV-C42, but only the coiled-coil domain was required for association with FP25 (84). The RING domain at the C-terminus does not have any role in dimer formation or association with FP25 and BV/ODV-C42. However, deletion and point mutation of the RING domain has shown that it is required for BV production (84). RING domains in other eukaryotic systems are nearly always associated with E3 ubiquitin ligases (106). The AC141 RING   21  motif is similar to the C3HC4 RING which co-ordinate zinc ions (Zn2+) in a cross brace structure (107). The consensus RING motif of AC141 and its homologs is C3C(Y/F)C4. This is different than most eukaryotic RING domains which have the consensus sequence of C3HC4. The AC141 RING domain has an additional cysteine and the histidine is replaced by tyrosine or phenylalanine (107). Point mutation of these AC141 specific amino acids results in loss of function indicating these amino acids are essential (X. Dai and D.A. Theilmann, unpublished results). No other eukaryotic RING motif has been identified that has an amino acid consensus sequence   like AC141 suggesting it represents a novel domain which may have unique properties. Recent studies have shown that AC141 associates with the cellular cytoskeleton protein β-tubulin. In addition, inhibitors of microtubules reduced BVs production by 85% (108). These results suggest that nucleocapsid egress requires the interaction of AC141 and microtubules directly or indirectly. Subsequent studies by Danquah et al. (109) have also shown by FRET-FLIM (Fluorescence resonance energy transfer- fluorescence lifetime imaging microscopy) that the Drosophila melanogaster kinesin-1 TPR (tetratricopeptide repeats) domain co-localizes with AC141 and the nucleocapsid major coat protein VP39 (109). These data therefore suggest that microtubule transport using kinesin-1 may play a role in baculovirus BV production.   22  1.4 Role of cellular proteins in virus capsid egress mechanisms Viruses utilize host proteins and hijack the host cellular pathways for egress mechanisms. One of my objectives was to determine the role of host kinesin-1 in AcMNPV nucleocapsid egress. Therefore I will provide an overview of the structure of kinesin-1 and examples of viruses that utilize microtubule transport system to enable egress from the cell. In addition, AC141 is a potential E3 ubiquitin ligase and I hypothesized that it might interact with vUbi to facilitate nucleocapsid egress. To understand the mechanism of interaction between E3-ubiquitin ligase and ubiquitin I will give a brief introduction of the cellular ubiquitination system and examples of viruses utilizing ubiquitination pathways for different purposes but emphasizing egress mechanisms.  1.4.1 Structure and function of kinesin-1 Members of the kinesin protein superfamily (also known as KIFs) have been shown to transport organelles, protein complexes and mRNA to specific destinations in a microtubule and ATP dependent manner (110, 111). In addition, kinesins also participate in chromosomal and spindle movements during mitosis and meiosis (112). Kinesin molecules generally favour anterograde transport, that is, from the nucleus to the plasma membrane. The number of KIFs can vary significantly depending on the organism. For example Homo sapiens, D. melanogaster, Caenorhabditis elegans and Saccharomyces   23  cerevisiae have 45, 23, 21 and 6 KIFs respectively (113). There are three major types of KIFs based upon the position of the motor domain which is required for movement along microtubules. They are named N-, C- or M-kinesin which contain the motor domain at N or, C terminus or middle location of the protein, respectively. Out of 45 kinesins in humans, there are 3 C-kinesin, 3 M-kinesin and 39 N-kinesin; two are monomeric and 37 are multimeric (110, 113).  From all these kinesins, kinesin-1 is mostly involved in cargo binding and cytoplasmic transport from the nucleus to the plasma membrane. Kinesin-1 is also known as conventional kinesin and it belongs to the KIF-5 superfamily which is a class N-1 kinesin. Conventional kinesin is a heterotetrameric protein containing two kinesin heavy chains (KHCs) and two kinesin light chains (KLCs). The kinesin-1 KHC contains three domains, the N-terminal catalytic core, the middle stalk domain and the C-terminal tail (Figure 1.4). The sequence of the N-terminus is highly conserved and contains two specific binding regions, one for microtubules and the other for ATP/ADP. Adjacent to the KHC motor domain is a stalk domain that contains a central region of five heptad repeats which extends towards the tail domain. The heptad repeats contain sites that bind cargo molecules (114, 115). The KLCs have two domains, the N-domain that binds to the KHC and the C-terminal domain which contains six TPR repeats which have also been shown to bind to cargo molecules (Figure 1.4). For a more extensive review of KIFs see Hirokawa et al. (110).   24   Figure 1.4 Structure of kinesin-1 heavy chain and light chain. Kinesin-1 is heterotetramer composed of two kinesin heavy chains (KHCs, orange) and two kinesin light chains (KLC, blue). KHC bind the cargo with heptad repeats at the C-terminal. The KLC C-terminus has TPR repeats which binds cargo. The KHC motor domain has binding sites for microtubules and ATP. [Reprinted with permission from (116)].   25  1.4.1.1 Virus utilization of kinesin based microtubule transport during egress Many DNA viruses during their egress have been shown to travel along the microtubules of the host cell with the help of microtubule associated proteins (MAPs). If nucleocapsids move along the microtubules it would require motor protein(s) such as kinesin or dynein to bind the nucleocapsids and transport them as cargo. Dynein generally performs retrograde transport, that is, towards the nucleus, while kinesin enables anterograde transport away from the nucleus. In the following paragraphs I will provide a brief overview of the viruses that have been shown to utilize host microtubule systems and involvement of motor proteins in virus particle trafficking.  During the course of vaccinia virus infection several forms of virions are produced; first intracellular mature virus (IMV), followed by intracellular enveloped virus (IEV), cell-associated enveloped virus (CEV) and extracellular enveloped virus (EEV). Extensive research has been done on the role of microtubules and associated motor proteins in transport of these different forms of vaccinia virus. Vaccinia virus utilizes microtubules for efficient IMV, IEV and CEV formation and drugs that interfere with microtubules affected their assembly (117, 118). Live cell imaging has shown that fluorescently labeled IEV particles move on microtubule structures from the site of assembly to the plasma membrane (119, 120). The vaccinia virus membrane protein A36R directly interacts with the TPR domain of KLC and is required for movement of IEV on   26  microtubules (120-123). The A36R protein has a short WD/E motif (bipartite tryptophan based kinesin-1 binding motif) that recruits kinesin-1 for transport of virus (124). Overexpression of GFP-tagged TPR domain of KLC2 or GFP-tagged first 330 amino acid of KHC1 inhibited the cytoplasmic distribution and EEV production (120, 125). Apart from A36R, two additional membrane proteins F12 and E2 are required for intracellular movement of virus (126, 127). F12 shares structural similarity with cellular KLC and also possesses a TPR domain and conserved WD motif for recruitment of kinesin-1 (128). F12 and E2 forms a complex that interacts with kinesin-1 motor protein components KLC1 and KLC2 isoforms and interaction is required for egress of virus (129). Ectromelia virus (family Poxviridae) also utilizes a similar strategy as vaccinia virus and requires microtubule network for egress (130).  Herpes simplex virus (HSV) interacts with kinesin motor proteins and dynein motor proteins to facilitate the egress of capsids (116). The inner tegument proteins of HSV-1 purified capsids associated with kinesin-1 and kinesin-2 along with dynein and dynactin complex (131). Capsids without tegument proteins showed no interaction with motor proteins. HSV-1 envelope protein pUS9 plays an important role in anterograde transport of capsids (132) and a basic amino region with pUS9 is required for binding kinesin-1 motor protein (133). Similarly, pseudorabies virus US9 protein interacts with kinesin-3 isoform during anterograde transport (134). Yeast two hybrid analyses showed that the HSV-1 tegument protein US11 interacts with KHC heptad repeats cargo-binding domain   27  (135). Kaposi’s sarcoma-associated herpesvirus ORF45 tegument protein interacts with a kinesin-2 isoform in yeast two hybrid analyses (136). siRNA mediated knockdown of kinesin-2 or depolymerisation of microtubule structure affected the egress of Kaposi’s sarcoma-associated herpesvirus capsids (136).  African swine fever virus associates with microtubule structures and depolymerisation drugs, such as colchicine and nocodazole affected the egress of mature virions (137). Kinesin-1 is recruited towards replication factories in the perinuclear regions and mature virions associated with kinesin-1 (137). RNA viruses like retrovirus have also been shown to interact with kinesin motor protein isoforms and are required for assembly (138). Gag protein associates with a kinesin-4 isoform which is required for the intracellular transport to the plasma membrane (139-141).  Microtubule transport systems are also involved in the entry and disassembly of viruses. During entry, adenovirus, herpesvirus and HIV recruits and interacts with dynein and dynactin complexes to move along microtubules for retrograde transport (116). For extensive details of utilisation of microtubule transport system during entry see the review by Döhner et al. 2005 (142). Kinesin-1 has been shown to mediate the disassembly of adenovirus capsids at the nuclear pore complex (143).   28  1.4.2 The ubiquitin system and characteristics of E3 ubiquitin ligases  Ubiquitination of proteins is an extensive cellular system of post-translational modification that can be utilized for many regulatory processes. The basic process is the covalent attachment of the small 77 amino acid protein ubiquitin to a lysine residue of a substrate protein. Ubiquitination of protein is performed by a series of three of enzymatic reactions (144, 145) (Figure 1.5). 1) The ubiquitin activating enzyme E1 forms a thiol ester linkage with the C-terminal glycine residue of ubiquitin in an ATP dependent process. 2) The second reaction is a transesterification where activated ubiquitin is transferred onto ubiquitin conjugating enzyme E2. 3) The final step of the ubiquitination system is the transfer of ubiquitin from E2 to the substrate via an isopeptide bond which is mediated by E3 ubiquitin ligase enzymes. The human genome is known to encode only two E1s, 40 E2s and approximately 600 E3s (146, 147). Three types of E3 ubiquitin ligases have been identified, and are homologs of the E6AP C-terminus (HECT) domain family, RING family and the RING-Between- RING (RBR) family (146). HECT E3 ligases bind to both E2s conjugated with ubiquitin and substrate simultaneously and form a transient thioester bond with ubiquitin. Ubiquitin is then transferred from the HECT E3 onto the substrate. RING E3 ligases catalyze the transfer of ubiquitin from E2 directly to the substrate. The E3 RING domain specifically binds E2s that are charged with ubiquitin. The RING domain with a consensus sequence of C3HC4 serves as a zinc ion coordination site.   29      Figure 1.5 Ubiquitination of substrates by E1, E2 and E3 enzymes. The ubiquitination of substrates starts with the conjugation of ubiquitin with E1 conjugating enzyme by an ATP-dependent process. Ubiquitin is then transferred onto the E2 activating enzyme. E3 ubiquitin ligase transfers the ubiquitin from E2 to the substrate. HECT E3 ligases get ubiquitinated and then transfers ubiquitin to the substrate. The  RING domain of E3 ligases in contrast directly transfer the ubiquitin to the substrate (Reprinted with permissions from Nature Publishing Group “Themes and variations on ubiquitylation” Allan M. Weissman 2001 (145)).   30  Another type of E3 ligase exists that has a U-box domain which is similar to the RING domain but lacks the consensus cysteine residues for zinc coordination (148, 149). According to a recent review Morreale et. al (146) U-box proteins are considered in the same class as RING E3 ligases. The RBR E3 ligases consist of three domains, RING1, In between RING (IBR) and RING2 (also called Rcat). RBR E3 ligase functions as ahybrid and employing both a RING and HECT like mechanism (150). RING1 recruits ubiquitin charged E2 (RING like mechanism), and a catalytic cysteine residue of RING2 links ubiquitin via a thioester linkage (HECT like mechanism) (146, 151). The IBR domain lacks any catalytic cysteine residue and ubiquitination activity but it links RING1 and RING2. Proteins that are targets of the ubiquitination system can have multiple forms of ubiquitin linked to substrate lysine residues. Some substrate proteins are ubiquitinated with one ubiquitin which is called monoubiquitination. Multi-ubiquitination occurs when multiple lysine residues on a substrate are ubiquitinated by ubiquitin monomers. Ubiquitin contains seven lysine residues (K6, K11, K27, K29, K33, K48, K63) which  can be utilized to attach other ubiquitin proteins to form polyubiquitin chains which are linked to substrate proteins (152). Polyubiquitin chains are formed between ubiquitin monomers by isopeptide bonds. Multi-ubiquitination occurs when more than one ubiquitin monomer is linked directly to a substrate at multiple sites. Two forms of polyubiquitin chains can be formed, one is homotypic polyubiquitination, and the other is heterotypic   31  polyubiquitination. Homotypic polyubiquitin chains are formed by ubiquitin moieties linked through single specific lysine residues. In hetero- or mixed polyubiquitin, the ubiquitin chain is linked through different lysines (153). The various types of ubiquitination determine different fates for substrate proteins. Generally, proteins tagged with polyubiquitin chains are targeted for proteasome mediated degradation whereas mono- or multiubiquitinated proteins are targeted for some form of cellular transport or trafficking (152, 154). K48 linked polyubiquitin chains are known to be the signal for the 26S mediated proteasome degradation of proteins. K63 linked polyubiquitin chains and mono- or multiubiquitinated proteins are signals for the trafficking of proteins via ESCRT (endosomal sorting complex required for transport) mediated pathways. The other homotypic polyubiquitin chains formed by K6, K11, K27, K29 and K33 are not very well studied. K6 and K11 linked poly ubiquitin chains are believed to be required for proteasome mediated degradation. K29 and K33 mediated polyubiquitin chains are required for the lysosomal degradation of  the proteins instead of proteasome mediated degradation (152).  1.4.2.1 Viruses utilizing the host ubiquitin system for egress Ubiquitination consists of ubiquitin, ubiquitin like proteins, E1, E2 and E3 enzymes, and deubiquitinases (DUBs). As the ubiquitination system is a signaling process in many cellular pathways, it is one of the favourite targets for viruses to usurp or modify for their   32  own benefit. Viruses re-direct the host ubiquitin system by either encoding ubiquitination enzymes or encoding an adapter protein that recruits ubiquitin system components. Almost every virus family has been known to hijack the host ubiquitin system to enable their entry, replication, immune invasion, and pertinent to this study, egress and budding (155). Below I provide a brief overview of the viruses that encodes either E3 ubiquitin ligase or adapter proteins to utilise the host ubiquitin system.  Herpes viruses encode an immediate early protein called ICP0 which is a RING domain protein and acts as an E3 ubiquitin ligase in vitro (156). ICP0 is a multifunctional protein which is required for evasion of the host immune system as a viral transactivator, and for regulation of lytic and latent infections (157). ICP0 utilizes the ubiquitin proteasome pathway to ubiquitinate a number of cellular proteins like p53, RNF8, NF-ĸB, catalytic subunit of DNA dependent protein kinase and degradation PML bodies (157). Roles of ICP0 have also been suggested in viral assembly and dismantling the microtubule structure (158).  Poxviruses encode a RING domain protein called P28 which is required for virus infection but its function is still unknown (159). P28 possess ubiquitin ligase activity and interacts with E2 conjugating enzymes to direct proteins for 26S proteasome degradation (160). Poxviruses have been known to hijack the host ubiquitin system for cell cycle regulation and evading innate immune mechanisms (155).    33  Baculoviruses encode a number of RING domain proteins like the AcMNPV IE2, PE38, IAP2, IAP1, ORF35 and CG30. (161). In vitro assays have shown that BmNPV IAP2, OpMNPV IAP3, PE38, and IE2 function as E3 ubiquitin ligase (161, 162). As previously indicated the AC141 atypical RING motif, C3C(Y/F)C4 is required for BV production which suggests that ubiquitination may be required (107). Baculoviruses are also unique as they are the only known virus family that encode a Ubiquitin and in addition it has been shown to be  required for efficient BV production (100). Examples of viruses that encode adapter proteins to recruit E3 ligases to hijack the ubiquitination system has been summarized in Randow et al. (163) and Gustin et al. (155). Human oncogenic papilloma virus and adenovirus encode proteins which recruit cellular E6AP E3 ligases and cullin-based E3 ligase for degradation of p53 (163). Viral adapter proteins have also been identified that target cellular proteins for degradation through the endoplasmic reticulum associated protein degradation (ERAD) pathway. Cytomegalovirus and HIV encoded adapter proteins induce the degradation of immune system components like MHC class I and CD4+ via ERAD pathway.  The role of adapter proteins has been extensively studied in recruiting the host ubiquitin system for viral budding in retroviruses, filoviruses, paramyxoviruses, rhabdoviruses and arenaviruses (155). The Gag or Matrix proteins of these viruses have a late budding domain (L-domain). The L-domains from these viruses have been characterized and it   34  was shown that different conserved amino acids are required for recruiting components of the ubiquitin system. The PPXY motif in the L-domain is required for recruitment of the Nedd4 protein family which are HECT ubiquitin ligases (164, 165). HIV L-domain contains the sequence PT/SAP which interacts with the tumor susceptibility gene 101 (tsg101). Tsg101 is an E2 conjugating enzyme and is a component of the ESCRT machinery which was shown to be required for HIV budding (166, 167).  ESCRT pathways consist of four multimeric complexes (0-III) and play a vital role in different cellular processes like mutivesicular biogenesis (MVB), cellular abscission and viral budding (168). Misfolded or damaged proteins are ubiquitinated which then enter into endosomes to form a vesicle. ESCRT pathway functions in close association with ubiquitin systems and ubiquitin serves as the signal for sorting of membrane proteins into multivesicular bodies (168). ESCRT 0-II components also contain ubiquitin binding domains that recognise ubiquitinated proteins for budding into MVB. Viruses have been shown to utilise the host ESCRT pathway for budding out of the cell. The general mechanism for the recruitment of ESCRT pathway is that a viral protein is ubiquitinated which acts as a recognition signal for ESCRT pathway components. During HIV infection the Gag protein is conjugated to ubiquitin which is necessary for recruitment of the ESCRT pathway (169).    35  DNA viruses have also been shown to utilise the host ubiquitination system via the ESCRT pathway (155). The release of infectious hepatitis B virus (HBV) is dependent on VPS pathways and host cellular mutivesicular bodies (MVB) (170-172). In addition, the core protein of HBV also has a PPXY L-domain (173). HSV-1 and human cytomegalovirus (HCMV) also utilize the host ESCRT pathway components for budding at the plasma membrane that also suggests utilisation of the host ubiquitin system (174-176). VPS4 AAA-ATPase is an important component of ESCRT-III which is recruited at the HIV budding sites during membrane scission and detachment (177). During baculovirus infection the cellular VPS4 is also required for the efficient entry and egress of the baculovirus AcMNPV suggesting the possible role of ESCRT pathway (178). 1.5 Research objectives Egress mechanisms of enveloped DNA and RNA viruses have been studied extensively. A lot of past research has been done on the utilization of host microtubules and microtubule associated proteins in mammalian DNA viruses. Similarly the utilization of the ubiquitin system by mammalian DNA and RNA viruses has been extensively studied. The egress mechanism of the baculovirus AcMNPV nucleocapsids is not well studied and there are many unanswered questions. This thesis is focused on different aspects of AcMNPV nucleocapsid egress with an emphasis on the function and role of AC141   36  which is known to be required for nucleocapsid egress. I addressed the following questions: 1) Does host kinesin-1 interact with nucleocapsid proteins and is kinesin-1 required for nucleocapsid egress and BV production? 2) Does AC141 interact and co-localize with ME53 during viral egress? 3) Does AC141 interact with viral ubiquitin and is the interaction required for BV production? 4) What is the role of conserved lysine residues of viral ubiquitin during AcMNPV infection? The specific objectives of my thesis and a short summary of the results are mentioned below: 1.5.1 Interaction of AC141 with lepidopteran kinesin-1 and its requirement for BV production In two key processes of the AcMNPV replication cycle, nucleocapsids are transported through the cell. These include: a) transport of nucleocapsids to the nucleus after virion attachment to a host cell by either BV or ODV, and b) egress of newly produced   37  nucleocapsids from the nucleus and budding from the plasma membrane. Prior studies have shown that the transport of nucleocapsids to the nucleus involves the polymerization of actin to propel nucleocapsids to nuclear pores and entry into the nucleus. For spread of infection, progeny viruses must rapidly exit the infected cells but the mechanisms by which newly synthesized AcMNPV nucleocapsids escape the nucleus and traverse the cytoplasm to the plasma membrane are unknown. In Chapter 3 of this study I hypothesized that the nucleocapsid associated protein AC141 interacts with lepidopteran kinesin-1 motor proteins and are transported as cargo on microtubules to the plasma membrane. To address this hypothesis I generated stable cell lines expressing epitope tagged Trichoplusia ni (T.ni) kinesin-1 KHC and KLC which were used to analyze kinesin-1 interactions with AC141 and nucleocapsid proteins using co-immunoprecipitation, co-localization, RNAi, fluorescently labelled nucleocapsids and yeast 2-hyrbrid. Utilizing these methodologies I was able to show that kinesin-1 interacts with AC141 and other nucleocapsid proteins and co-localize in infected cells along with microtubules. In addition, the data showed that kinesin-1 mediated transport has a direct role in the production of BV further supporting my conclusion that microtubule transport is required for AcMNPV nucleocapsid transport.    38  1.5.2 Role of AC141 in the  formation of ME53 and GP64 foci at the plasma membrane  The budding of nucleocapsids through the plasma membrane is a critical step for enabling a systemic infection. To understand the molecular mechanisms of budding, one of the first steps is to identify the proteins that interact in the budding complex at the plasma membrane. In chapter 4 I hypothesized that AC141 interacts with the GP64-ME53 budding foci region to facilitate BV formation. Association of AC141 with the budding foci was analysed by co-IP, co-localization and surface modelling. The results suggest that AC141 associates with budding foci proteins and might be required for the budding complex formation with GP64 and ME53 at the plasma membrane. 1.5.3 Interaction of AC141 with vUbi and its role in nucleocapsid egress  During baculovirus infection one of the critical steps is the egress of nucleocapsids from the nucleus, and anterograde movement through the cytoplasm and budding through the plasma membrane to form BV. AcMNPV encoded AC141 has a RING motif which is required for the egress of nucleocapsids from the nucleus. AcMNPV encoded vUbi is also required for BV production. I investigated the possible interaction of AC141 and vUbi using a series of recombinant viruses and co-immunoprecipitation and MS analyses. Experimental approaches were used to identify viral-ubiquitinated proteins specifically   39  and possible substrates of AC141. To enable elucidation of the role vUbi in nucleocapsid egress BV and ODV were purified from infected cells with the virus expressing Myc-vUbi. Western blot analysis from purified virions showed differential viral-ubiquitination patterns between BV and ODV. Viral ubiquitination of nucleocapsid proteins therefore has the potential of being the signal involved in determining if a nucleocapsid is directed to become a BV or ODV.   40  Chapter 2  Materials and methods   22.1 Cell lines and polyclonal stable cell lines  2.1.1 Cell lines Spodoptera frugiperda  IPLB-Sf21-AE clonal isolate 9 (Sf9) and Trichoplusia ni BTI-Tn5B1-4 (Tn5B1) cells were maintained in Grace’s insect media supplemented with L-Glutamine, 3.33 g/L lactalbumin hydrolysate, 3.33 g/L yeastolate (Gibco Life Technologies) and  further supplemented with 10% fetal bovine serum at 27oC. Polyclonal, stably transformed cell lines were maintained in the same media conditions but with zeocin (250 µg/L). 2.1.2 Construction of polyclonal stable cell lines expressing T. ni kinesin-1 KLC and KHC 2.1.2.1 Cloning of T. ni kinesin-1 KLC and KHC The T. ni kinesin-1 KHC and KLC sequences were initially determined from a transcriptome analysis of T.ni Tnms42 cells (179). To clone KLC and KHC cDNA, total   41  RNA from Tn5b1 cells was isolated using Trizol Reagent (Ambion). The cDNAs of KLC and KHC were PCR amplified from total RNA by using SuperScript III Reverse transcriptase-RT (Invitrogen Life Technologies) and primer pairs (Table 2.1) 2267-2268 and 2271-2272 were used for amplification of KLC and KHC cDNA respectively. Following cDNA amplification, KLC and KHC ORF specific nested primers containing restriction enzyme sites for directional cloning were used to amplify the ORF sequence. Nested primers used for amplification of KLC and KHC ORF were 2269 and 2270, and 2273 and 2274 (Table 2.1) respectively. Amplified products were cloned directly into the p2ZOp-2E insect eukaryotic expression vector which places the gene under the control of the constitutive OpMNPV ie2 promoter (180, 181). Both clones were confirmed through restriction enzyme digestion and complete sequencing. T. ni KLC and KHC cloned into p2ZOp-2E vector were tagged with HA or Myc epitope tag coding sequences at both the N- and C- terminus by inverse PCR. Primer pairs 2350-2351, 2352-2353, 2358-2359 and 2360-2361 were used for C-HA and N-HA, C-Myc and N-Myc tagging of KLC respectively (Table 2.1). Primer pairs 2338-2339, 2340-2341, 2346-2347, and 2348-2349 were used for C-HA-KHC, N-HA-KHC, C-Myc-KHC and N-Myc tagging of KHC respectively (Table 2.1). Enhanced GFP (EGFP) fusion of C-terminal HA-tagged KLC and KHC constructs were made using Gibson Assembly (New England Biolabs). The EGFP was PCR amplified from pFAcT-GFP (107) using primers 2380 and 2381, each primer having a 15 nucleotide overhang homologous to the ends of   42  C-HA-KLC that was amplified using primers 2374 and 2375 (Table 2.1). A similar strategy was used to construct the KHC C-terminal EGFP fusion. Primers 2407 and 2408 were used for PCR amplification of EGFP from pFAcT-GFP and primers 2405 and 2406 were used for PCR amplification of C-HA-KHC (Table 2.1). All the tagged and fusion constructs were confirmed through restriction enzyme digestion, sequencing and Western blotting. 2.1.2.2 Construction of polyclonal stable cell lines  Stable cell lines were generated as previously described (180). Briefly, plasmid DNA (1µg) of Myc- or HA-tagged, or EGFP fusion of KLC and KHC expression constructs were transfected into Tn5B1 cells. The transfected cells were allowed to grow for 48 hours under normal media conditions. After 48 hpt normal media was removed and replaced with media containing zeocin (1 mg/ml). The cultures were maintained for two weeks for selection of stable transformed cells. The concentration of zeocin was reduced to 500 µg/ml for culture amplification. Subsequent passes were done with media with reduced zeocin (250 µg/ml) (181). 2.2 Viruses Wild-type ( WT virus) virus was AcMNPV strain E2 which was isolated as previously described (182, 183). The AcMNPV bacmid, bMON14272 was used to generate the   43  knockout (KO) viruses by recombination in E. coli as previously described using the lambda red recombinase system (184). The desired open reading frame (ORF) was deleted by replacement with a drug resistance gene to either chloramphenicol or zeocin by recombination. The chloramphenicol resistance gene (chloramphenicol acetyltransferase or cat) recombination cassette (42) and zeocin resistance gene under EM7 promoter (107) was PCR amplified with primers for the flanking regions for recombination. The PCR product was gel purified and transformed into bMON14272 containing E. coli BW25113/pKD46 electrocompetent cells (184). The recombinant cells were selected on medium containing kanamycin (50 g/ml) and zeocin (30 g/ml) or chloramphenicol (17 g/ml). The KO bacmids were transformed into E. coli DH10B cells containing a helper plasmid (pMON7124) that encodes a Tn7 transposase (185). The transfer vector pFAcT-GFP (107) or pFAcT which contains polyhedrin under the control of its own promoter, gentamycin and ampicillin drug resistance genes and a multiple cloning site for desired gene insertion. The plasmid pFAcT-GFP was used to transform E. coli DH10B cells containing one of the KO bacmids and the helper plasmid (pMON7124) which encodes the Tn7 transposase (185).     44   Table 2.1 List of primers used for the study of interaction between nucleocapsid proteins and T.ni kinesin-1 Primer no.  Sequence 5’ to 3’ Primer no.  Sequence 5’ to 3’ 2267 ACAGTATTACATAATAGCCGCAT 2349 GATCAGCTTCTGCTCCATTTTGGTACCAAGCTTTAAA 2268 TCAAGGTTTAACGGTTAGCAA 2405 TGAGAATTCTGGATCCTCTAGAGCGGCCATC 2269 TCGGTACCATAATGTCGAAGACTTTGAACGCCTACAGAATAA 2406 GGCGTAGTCGGGCACGTCGTAGG 2270 TTGGATCCCTACTGGTGCGGCGCATTGCTCCCAGTGTTGATG 2407 GTGCCCGACTACGCCGTGAGCAAGGGCGAGGAG 2271 GTAGCCCAAATGATTAAGCCTA 2408 GATCCAGAATTCTCACTTGTACAGCTCGTCCAT 2272 CCGACATTTTGATATTGCTGT 2374 TAGGGATCCTCTAGAGCGGCCATCGATAT 2273 TCGAATTCTCAACTCTCATCTCGGGCGCCAACAATAAT 2375 GGCGTAGTCGGGCACGTCGTAGGGGTACT 2274 TTGGTACCAAAATGGCAGCTGATCGTGAGATT 2380 GTGCCCGACTACGCCGTGAGCAAGGGCGAGGAG 2350 CCCGACTACGCCTAGGGATCCTCTAGAGCGGCCAT 2381 TCTAGAGGATCCCTACTTGTACAGCTCGTCCAT 2351 CACGTCGTAGGGGTACTGGTGCGGCGCATTGCTCCCAGTG 2445 AAGAGATCGAATTAGCTATGGCAGCTGATCGTGAGATTG 2352 GCCCGACTACGCCTCGAAGACTTTGAACGCCTACA 2446 TATAGGGCTCTAGAGACTCTCATCTCGGGCGCCAACAATA 2353 ACGTCGTAGGGGTACATTATGGTACCAAGCTTTAAAT 2447 AAGAGATCGAATTAGCTATGTCGAAGACTTTGAACGCCTA 2358 TCTCCGAGGAGGACCTGTAGGGATCCTCTAGAGCGGCCAT 2448 TATAGGGCTCTAGAGCTGGTGCGGCGCATTGCTCCCAGTG 2359 TCAGCTTCTGCTCCTGGTGCGGCGCATTGCTCCCAGTG 2449 TGACTGTATCGCCGGCTATGGCAGCTGATCGTGAGATTG 2360 TCCGAGGAGGACCTGTCGAAGACTTTGAACGCCTACA 2450 TATAGGGCTCTAGAGACTCTCATCTCGGGCGCCAACAATA 2361 GATCAGCTTCTGCTCCATTATGGTACCAAGCTTTAAAT 2451 TGACTGTATCGCCGGCTATGTCGAAGACTTTGAACGCCTA 2338 TGCCCGACTACGCCTGAGAATTCTGGATCCTCTAG 2452 TATAGGGCTCTAGAGCTGGTGCGGCGCATTGCTCCCAGTG 2339 CGTCGTAGGGGTAACTCTCATCTCGGGCGCCAACAATA 2453 AAGAGATCGAATTAGCTGGCTACGAGATCCCGGCGCGGCTG 2340 GTGCCCGACTACGCCGCAGCTGATCGTGAGATTGC 2454 TGACTGTATCGCCGGCTGGCTACGAGATCCCGGCGCGGCTG 2341 GTCGTAGGGGTACATTTTGGTACCAAGCTTTAAAT 2457 AAGAGATCGAATTAGCTGGTGGTTCATTAGCTCAAAAGCA 2346 TCCGAGGAGGACCTGTGAGAATTCTGGATCCTCTA 2458 TGACTGTATCGCCGGCTGGTGGTTCATTAGCTCAAAAGCA 2347 GATCAGCTTCTGCTCACTCTCATCTCGGGCGCCAACA 2461 AAGAGATCGAATTAGCTATGGCGCTAGTGCCCGTGGGTATGG 2348 TCCGAGGAGGACCTGGCAGCTGATCGTGAGATTG 2462 TATAGGGCTCTAGAGGACGGCTATTCCTCCACCTGCTTCG     45  Cells were transformed with 0.2 g each of the transfer vectors and incubated at 37oC for 4 h in 1 ml of super optimal broth with catabolic repression (SOC) medium and plated onto agar medium containing zeocin (30 g/ml) or chloramphenicol (17 g/ml), kanamycin (50 g/ml), gentamicin (7 g/ml), tetracycline (10 g/ml), X-Gal (100 g/ml) and IPTG (40 g/ml). Plates were incubated at 37oC for a minimum of 48 h, and white colonies resistant to kanamycin, gentamicin, and zeocin or chloramphenicol were selected and streaked onto new plates to confirm the phenotype.  2.2.1 Construction of ac141KO, me53KO and repaired viruses  Virus expressing HA tagged AC141 (EXON0), which is ac141KO-HA-AC141 was described as exon0 KO-HA-EXON0 (86). The methodology used in generating me53KO-HA-ME53 and me53KO-ME53:GFP repaired viruses used in this study have been described previously (96, 98, 186).  2.2.2 Construction of VP39-3xmCherry virus The AcMNPV VP39-3xmCherry virus was constructed by amplifying VP39-3xmCherry by PCR from the WOBCAT vector (a gift from Dr. Matthew D. Welch) (44) and inserted into the transfer vector pFAcT as a SacI and PstI restriction endonuclease fragment using standard cloning methods (187) generating the transfer vector pFAcT-VP39-3mCherry.   46  The pFAcT-VP39-3mCherry was used to insert VP39-3xmCherry into the polyhedrin locus of the bacmid bMON14272 by Tn7-mediated transposition as previously described (185).  2.2.3 Construction of vubi knockout, ac141+vubi double knockout and repaired viruses The vubi open reading frame (ORF) is close to ac34 and the late promoter sequence of ac34 is within the vubi ORF (188). Upon deletion of vubi the late promoter sequence for ac34 was re-introduced in the primers used to amplify the chloramphenicol resistance gene. The primer sequence to amplify the cat gene was based on previous published sequences (42, 184). The cat gene was PCR amplified using the plasmid pKD3 as template with primer pair 746-747 (Table 2.2). The underlined region in the primer sequence 746 is the core late promoter sequence for ac34. The PCR product was gel purified and transformed into bMON14272 containing E. coli BW25113/pKD46 electrocompetent cells (184). The recombinant cells were selected and correct insertion of the cat gene in the vubi locus was confirmed by primer pairs 763-764 and 765-766 which confirmed recombination into the correct locus (Table 2.2).  The ac141 and vubi double knockout AcMNPV bacmid was generated by using a similar strategy as mentioned above (184). The ac141 ORF was knocked out using a 2.9kbp   47  EcoRI-HindIII restriction fragment from the previously described plasmid vector pAc-exon0-KO (107). The restriction fragment contained the 483bp zeocin resistant gene under the control of EM7 promoter, 1,547 bp of 5′ and 543 bp of 3′ ac141 flanking sequences. The 5′ flanking sequence contained 142 bp of the 5′ ORF of ac141 which contains the splice site of ie0 and the 3’ flanking sequence  the promoter of downstream ac142 (107). The restriction fragment was transformed into E. coli BW25113/pKD46 competent cells containing the vubiKO bacmid. The recombinant cells were selected and correct insertion of the zeocin resistant gene in the ac141 locus was confirmed with primer pairs as previously described (107). The double gene knockout bacmid containing the desired recombination was selected, the resulting virus named ac141+vubi2xKO.  The transfer vector pFAcT-GFP which contains polyhedrin and enhanced green fluorescence protein (GFP) was used to repair the ac141, vubi, and ac141+vubi knockout bacmids. These plasmids were pFAcT-GFP- Myc-vubi, pFAcT-GFP-HA-ac141, and pFAcT-GFP-HA-ac141+Myc-vubi. To construct the pFAcT-GFP-Myc-vubi the vubi sequence was amplified with the primer pair 1833-1834 containing AgeI and XbaI sites. The primers would also insert the Myc epitope tag (EQKLISEEDL) coding sequence after the second codon of vubi  (189) and the vubi polyA signal at the 3’end.  The amplified 320 bp fragment was digested with AgeI–XbaI and ligated to similarly digested vector which contained the ac141 late promoter. The resulting plasmid, pMyc-  48  vubi, was digested with XhoI-XbaI which generated a 395 bp fragment (ac141 late promoter + Myc-vubi + vubi polyA) and inserted into pFact-GFP digested XhoI-XbaI site to generate pFAcT-GFP-Myc-vubi. The pFAcT-GFP-HA-ac141 plasmid has been previously described (107). The pFAcT-GFP-HA-ac141+Myc-vubi plasmid was constructed as follows, Myc-vubi  along with the ac141promoter and the vubi polyA signal was amplified by PCR using pFAcT-GFP-Myc-vubi as a template with the primer pair 1834-1835 which contained PstI and XhoI sites. The fragment was digested with PstI-XbaI and cloned into pFAcT-GFP-HA-ac141 also digested with PstI-XbaI (107) to generate the plasmid pFAcT-GFP-HA-ac141+Myc-vubi. The plasmids pFAcT-GFP , pFAcT-GFP-Myc-vubi, pFAcT-GFP-HA-ac141, or pFAcT-GFP-HA-ac141+Myc-vubi bacmid were used to transform E. coli DH10B cells containing one of the knock out bacmids and the helper plasmid (pMON7124) which encodes the Tn7 transposase as described previously (185). Genotype was verified by PCR. Seven repaired bacmids were generated which were called ac141KO, vubiKO, ac141+vubi2xKO, vubiKO-Myc-vubi, 2xKO-HA-ac141+Myc, 2xKO-HA-ac141, and 2xKO-Myc-vubi.     49   Table 2.2 List of primers for the study of AC141 and vUbi interaction and role vUbi in nucleocapsid egress Primer No. Primer Sequence 5’ to 3’ Primer No. Primer Sequence 5’ to 3’ 2587 GCTTTTTTTATTACTATGATCAAT 1313 GCAACTGTGACGCCATAG 2588 GATTCTCTATTCTATGCTTGTACA 1239 CTGACCGACGCCGACCAA 2589 CCTTTTTTTATTACTATGATCAAT 1629 GCGTCTAGATGCTTTGTTTCTTTCGTATT 2590 CATTCTCTATTCTATGCTTGTACA 1630 GCGGCGGCCGCTTAGGCGTAGTCGGGCACGTCGTAGGGGTATTCGACGTTTGGTTGAAC 746 CAAGGGCGCATTCACAGCAACCGTTGTCATTTATAAGTAAACTTATCTAAGTGTAGGCTGGAGCTGCTTC 1695 GCGCTGCAGGTACCTGTTTGATAAACTC 747 CAAGATACAAATATGTCAGATTAAATAAAAAACTTTTATGTATATTTAATGATATGAATATCCTCCTTAG 1696 GCGTCTAGATTAGGCGTAGTCGGGCACGTCGTAGGGGTATATAACATTGTAGTTTGCGTT 763 TGTGAATAAAGGCCGGATAAAACT 2513 GGACATTGACGGGCAAAACCATTA 764 CCCATTAGCGGCAGCAGGAAA 2514 TGATGAATATAAGATCTTCTTCAG 765 GTCGGCGTGCGTGTAACAAAGT 2515 GGACCATTACCGCCGAAACGGAAC 766 CAAGGCGACAAGGTGCTGATGC 2516 TGCCCGTCAATGTTTTGATGAATA 792 CCTTAATTAAGCTTTAAGCACGCAACTCTAGGATCCCGC 2517 GGCAAAAAATTGCCGATAAAGAAG 793 TTGGTACCGGTGTTGCGTTGCCCGTTATCAATTACT 2518 TAAGATCGGCCACCGTCTCT 1833 ACACCGGTAAAATGCAAG AACAAAAACTTATTTCTGAAGAAGATCTTATATTCATCAAAACAT 2519 GGATTGCCGATAAAGAAGGTGTGC 1834 GG TCTAGAAATAAAAAACTTTTATGTATATTTA 2520 TTTGCTTAAGATCGGCCACCGT 1835 CCCTGCAGATCAATTGTG 2521 GGGAAGGTGTGCCCGTAGATCAAC 1266 CGGATTTCGCCGGCCGAGATATCAACACGTTGACGCACAACATCAACTACTTCGGATCTCTGCAGCAC3 2522 TATCGGCAATTTTTTGCTTAAGA 1267 TTGTCGCGACTTGAGACAATTCATTTTTAGTTGCAGTTAATTCATTTACATCGAGGTCGACCCCCCTG 2523 GGCAACTGGAAGATTCCAAAACTA 1268 CGCGCACTGTACACGATT 2524 TGCCCGCAAAGATAAGTCTTTGT 1014 CCGATATACTATGCCGATGATT 2525 GGACTATGGCCGATTACAATATTC 1310 GAAGAGTGTTATGTTAAAATTGATAGACTATTTAAAGAGAGCATTAAAAATTCGGATCTCTGCAGCAC 2526 TGGAATCTTCCAGTTGTTTG 1311 TTATATAACATTGTAGTTTGCGTTCATCAACATTATTAGTCTTTGCAAATTCGAGGTCGACCCCCCTG 2527 GGGAATCTACTCTTCACATGGTGT 1312 GCCGCGGGTAACAT 2528 TCTGAATATTGTAATCGGCCATAG 2538 GCTGGGAACAAGTTTGAAGG 2539 T CTCGGGCGGCACAAAATAT 2540 GGGAACAAGTTTGAAGGTT 2541 CACAAAATATCCATCTTTTCTG 2542 AACAAGTTTGAAGGTTTGCC 2543 AAAATATCCATCTTTTCTGTTGAC 2544 ACGGGAACAAGTTTGAAGGTTT 2545 ACTCGGGCGGCACAAAATAT 2591 GGAGATCTAAGATGAACCGTTTTTTTCGAGAG 2592 GGCTGCAGTTACTTGTACAGCTCGTCCAT 2593 GGAGATCTAAGATGTACCCCTACGACGTGCCCGA 2594 GGCTGCAGTTATTTATACGATGTCCTGCACGCTG 2579 GGAGATCTAAGATGGTAAGCGCTATTGTTTTA 2580 GGCTGCAGTTAATATTGTCTATTACGGTTTCTAATC   50  2.2.4 Construction of ac66 knockout, vp80 knockout and repaired viruses  Ac66 was deleted from the AcMNPV bacmid, bMON14272 using recombination in E. coli as described above. The 5’ terminus of the ac66 ORF contains the late promoter sequence of the adjacent dnapol and the 3’ terminus contains the polyA region of the adjacent lef3. Therefore 270 bp of the ac66 5’ terminus and 880 bp of the 3’ terminus were retained. The zeocin resistance gene was PCR amplified from p2ZeoKS with the primer pair 1266 and 1267 (Table 2.2) which contain ac66 homologous sequences. The PCR amplified 625 bp fragment contains zeocin resistance gene under the EM7 promoter and the ac66 flanking sequence for recombination. The amplified PCR product was transformed into electrocompetent E.coli BW25113/pKD46 electrocompetent and recombinants were selected as described above. The correct ac66 deletion and insertion of the zeocin resistance gene was confirmed with PCR by using the primer pair 1268 and 1014 (Table 2.2). The deletion bacmid was called ac66KO. The vp80 ORF was deleted using the same method. Due to regulatory sequences of upstream genes 473 bp in the 5’ terminus of vp80 ORF was retained but the remaining ORF sequences were deleted. The zeocin resistant gene was PCR amplified from p2ZeoKS with primer pair 1310 and 1311 which also contains the vp80 homologous sequences for recombination. Correct insertion of the zeocin resistance gene was   51  confirmed with primer pairs 1312 and 1014, 1313and 1239 (Table 2.2). The deletion bacmid was called vp80KO To generate a C-terminal HA- epitope tagged clone of ac66, the ac66 late promoter and ORF were PCR amplified from the AcMNPV genome with primer pair 1629-1630 having a 5’ XbaI and 3’ NotI site. The HA-epitope nucleotide sequence was contained in the 3’ primer 1630 (Table 2.2). The PCR product was digested with XbaI and NotI and inserted into pFAcT-GFP-Tnie1PA digested with the same restriction enzymes resulting in clone pFAcT-GFP-AC66-HA. The ac66KO bacmid was repaired with pFAcT-GFP-AC66-HA by Tn7 mediated transposition as described above to generate ac66KO-ac66-HA repaired virus. Similarly, C-terminal HA- epitope tagged clone of vp80, the vp80 late promoter and ORF were PCR amplified from the AcMNPV genome with primer pair 1695-1696 which contain PstI and  with XbaI sites respectively. The HA-epitope nucleotide sequence was contained in the 3’ primer 1696. The PCR product was digested with PstI and XbaI and inserted into pFAcT-GFP-Tnie1PA digested with same restriction enzymes. The resulting clone was named pFAcT-GFP-VP80-HA. The vp80KO bacmid was either repaired with pFAcT-GFP-VP80-HA by Tn7 mediated transposition to generate vp80KO-vp80-HA repaired virus.   52  2.2.5 Site-directed mutagenesis  Site directed mutagenesis were generated by inverse PCR on different templates with primer pairs that contained the mutated nucleotide sequences. The PCR product was gel purified followed by ligation and transformed into DH5α cells. Positive constructs were selected on the basis of drug selection with zeocin (30 µg/mL) or ampicillin (100 µg/mL). The constructs were further confirmed by restriction enzyme digestion and sequencing. The desired mutated plasmid was digested with restriction enzymes and cloned into pFAcT-GFP or pFAcT. These pFAcT constructs were used to repair the knockout bacmids by Tn7 mediated transposition as described earlier. 2.2.5.1 Mutation of ME53:GFP PPEF motif  The potential me53 L-domain encoding the PPEF (proline-proline-glutamate-phenylalanine) motif was mutated by PCR site directed mutagenesis using pBSK-ME53:GFP (96) as a template using the methods described above. Mutation of the sequence encoding amino acids PPEF to PPEA was carried out with primer pair 2538-2539; amino acids PPEF to PPEY with primer pair 2540-2541; deletion of the PPEF encoding sequence with primer pair 2542-2543; and deletion of the VPPEFG encoding sequence was with primer pair 2544-2545. The resulting plasmids were digested with SacI and XhoI and the restriction fragment cloned into SacI and XhoI digested pFAcT   53  (96). The me53KO virus was repaired with pFAcT-ME53:GFP mutants as described above and the repaired viruses were named ME53:GFP-PPEA, ME53:GFP-PPEY, ME53:GFP-PPEF del, ME53:GFP-VPPEFG del.  2.2.5.2 Mutation in ubiquitination site of AC141 (K87) The potential ubiquitinated lysine 87 of AC141 was mutated to an arginine or an alanine by inverse PCR. The PCR template was a previously constructed plasmid p2Zeo-HA-Acexon0. Site-directed mutagenesis was carried out by standard PCR procedures using the primer pair 2587-2588 for K87R (AAACGC) and  primer pair 2589-2590 for K87A (AAAGCC). A 1.4 kbp XhoI-XbaI fragment excised from mutagenized p2Zeo-HA-Acexon0 was cloned into XhoI+XbaI digested pFAcT-GFP to produce pFAcT-HA-ac141-K87R, pFAcT-HA-ac141-K87A. These clones were used to repair the bacmid ac141KO, using the method described above, to generate the viruses ac141KO-HA-ac141-K87R and ac141KO-HA-ac141-K87A. 2.2.5.3 Mutation of conserved lysine residues of vUbi  Mutation of each lysine codon in vubi was performed by PCR site directed mutagenesis as described above using the plasmid p2Zeo-Myc-vUbi as a template. The K6R, K11R, K27R, K29R, K33R, K48R, K54R and K63R mutations were amplified with the primers pairs 2513-2514, 2515-2516, 2517-2518, 2519-2520, 2521-2522, 2523-2524, 2525-2526   54  and 2527-2528 respectively (Table 2.2). Similar to the previous approach of generating pFAcT-GFP-Myc-vUbi, all the lysine mutated plasmids were digested with XhoI-XbaI and inserted into XhoI-XbaI digested pFAcT-GFP. The resulting plasmids were named pFAcT-GFP-K6R, pFAcT-tGFP-K11R, pFAcT-GFP-K27R, pFAcT-GFPK29R, pFAcT-GFP-K33R, pFAcT-GFP-K48R, pFAcT-GFP-K54R and pFAcT-GFP-K63R. The vubiKO virus was repaired with the pFAcT-GFP-Myc-vUbi-mutations as described above. The repaired viruses were named Myc-vUbiK6R, Myc-vUbiK11R, Myc-vUbiK27R, Myc-vUbiK29R, Myc-vUbiK33R, Myc-vUbiK48R, Myc-vUbiK54R and Myc-vUbiK63R. 2.3 Co-immunoprecipitation of protein complexes Sf9 or Tn5B1 or polyclonal HA-tagged KLC and KHC stably transformed cells (5.0 x107) were infected with the respective viruses at an MOI of 10. Infected cells were harvested at 24 hours pi (hpi) and resuspended in 1.25-1.5 ml of either HEPES Lysis buffer (15 mM HEPES pH 7.6, 10 mM KCl, 0.1 mM EDTA, 0.5 mM EGTA 1mM DTT and 1% protease inhibitor cocktail (Invitrogen)) or EBC lysis buffer (50 mM Tris-HCl pH8.0, 120 mM NaCl, 0.5% Nonidet P-40, 0.2 mm sodium orthovanadate, 1% sodium fluoride and 1% protease inhibitor cocktail). The lysates were passed through a French Press twice at 1000 lb/in2 and centrifuged at 6000 x g for 20 minutes at 4oC. Lysates were incubated with either EZview Red Anti-HA Affinity Gel conjugated with anti-HA   55  monoclonal antibody (Sigma-Aldrich) or polyclonal AC141 antibody 6 µg diluted in 200 µl 1x phosphate buffered saline (PBS; NaCl 136.6 mM, KCl 2.7  mM, Na2HPO4 10 mM, KH2PO4 1.8 mM). The mixture was incubated overnight at 4oC on a rotor wheel. The AC141 antibody and lysate mixer was further incubated with Protein G Dynabeads (Invitrogen) at 4oC on a rotor wheel for 2 h. Red affinity beads or Dynabeads bound to lysate were washed three to five times with either NETN wash buffer (20 mM Tris-HCl pH8.0, 1 mM EDTA, 0.5% NP-40 and 150 mM NaCl) or TBS wash buffer (50 mM HEPES pH7.6, 150 mM or 500 mM NaCl and 0.1% TritonX). The beads were eluted with 180 µl of elution buffer (100 mM glycine-HCl pH2.2) and pH was raised with 1.5M Tris-HCl pH8.8 to a final pH of 8. The eluent volume was vacuum concentrated to 60 µl and mixed with 20 µl of 4X protein sample buffer (PSB; 277.8 mM Tris-HCl pH6.8, 44.4% v/v glycerol, DS, 0.02% bromophenol blue, 4% β-mercaptoethanol, 1% protease inhibitor cocktail Sigma-Aldrich). The sample was boiled for 10 min and subjected to SDS-polyacrylamide gel electrophoresis (PAGE) using Mini-PROTEAN TGX Stain Free Gels (Bio-Rad) and proteins were examined by Western blotting. 2.4 Confocal microscopy and co-localization analysis Sf9, Tn5B1 cells or stably transformed Tn5B1 polyclonal cells were plated on sterile coverslips and allowed to settle overnight as previously described (190). Cells were infected with virus at an MOI of 2 to 20 depending on the experiment. At different times   56  post infection cells were fixed (100 mM HEPES, 5 mM MgCl2, 5 mM EGTA pH6.9 and 1.5 or 4% formaldehyde) for 45 minutes. If required cells were permeabilised with 0.01% Triton-X-100 solution in 1 x PBS for 15 minutes. Cells were first blocked with Image iT FX Signal Enhancer solution (Molecular Probes) for 30 minutes followed by blocking (2% BSA in 1 x PBS) for an additional 30 minutes. Cells were incubated with primary antibodies in blocking buffer for 1 hour. After primary antibody incubation cells were washed 3 times with blocking buffer for 10 minutes each. Cells were incubated with secondary antibodies for 1 hour in blocking buffer. Following secondary antibody incubation, cells were washed 3x in blocking buffer and coverslips were mounted with Prolong Gold anti-fade Reagent (Molecular Probes) with or without DAPI (4’, 6’-diamidino-2-phenylindole). The primary antibodies included  mouse monoclonal anti c-Myc-9E10 (1:50, Santa Cruz Biotechnology), rabbit polyclonal anti-HA (1:200, Abcam), rabbit polyclonal anti-FP25 (1:1000), rabbit polyclonal anti-BV/ODV-C42 (1:1000), rabbit polyclonal AC141 (1:500), mouse anti-β-tubulin (1:500) mouse monoclonal anti-GP64-V5 (1:50) and mouse monoclonal anti-GP64-V1 (1:50) (191, 192). The secondary antibodies used were goat anti-mouse Alexa-635 (1:500, Molecular Probes), Goat anti rabbit Alexa-488 (1:500, Molecular Probes), Goat anti rabbit Alexa-647 (1:500, Molecular Probes) and Goat anti mouse Alexa-405 (1:500, Molecular Probes). All the images were acquired  using a Leica TCS SP8 or Leica-DM IRE2 confocal laser scanning microscope (CLSM) using a 63X Oil immersion lens. Samples were sequentially excited at 488-nm for Alexa-488 or EGFP, 633-nm for Alexa-647, or Alexa 635, 405 nm for   57  DAPI or Alexa-405, 587 nm for mCherry. Z-stack sequential images 329 nm apart were used to construct 3D confocal images. Confocal images were analyzed using Leica software (LAS-AS or LAS-X) and deconvolution of images was performed using Huygens Suite v14.1.0. Surface rendering and 3D models were created with Imaris software (v7.3.3). NIH ImageJ software was used for calculating and evaluating the Pearson’s correlation (Rr) values and Overlap coefficient (R). 2.5 Cell culture techniques Plasmid DNA or bacmid DNA or siRNA were transfected into1x106 to 2x106 Tn5B1 or Sf9 cells by a liposome mediated method. Lipofection reagents were made in our laboratory based on Campbell et al. (193). The cells were incubated with liposomes containing the desired DNA or RNA for 4 hours. Following incubation, the liposomes were removed, washed and replaced with Grace’s insect media. At different times post transfection, the media was collected to assay the BV production. The cells were washed three times with 1X PBS and pelleted at 3000 rpm for 5 minutes. The cell pallet was mixed with 1X protein sample buffer as mentioned earlier and passed through a 1mL syringe. The sample was boiled at 100oC for 10 minutes and loaded on to SDS PAGE.    58  2.5.1 Transfection of ME53:GFP, HA-AC141 and GP64 expressing plasmid into Sf9 cells Me53:GFP and ha-ac141 was cloned into insect eukaryotic expression vector p2ZOp-2E which places the gene under the control of the constitutive Orgyia pseudotsugata MNPV IE2 promoter (180, 181). The me53:GFP ORF was amplified from pblueme53:GFP:40 (96) using the primer pair 2591-2592 with a BglII and PstI sites respectively. The ha-ac141 ORF was amplified from p2Zeo-HA-AC141(86) using the primer pair 2593-2594 containing BglII and PstI sites respectively. The GP64 ORF was amplified from pAcGP64 (194) using primer pair 2579-2580 containing BglII and PstI sites respectively and cloned into the pIE1hr+  expression vector (195).  2.5.2 siRNA mediated knockdown of T. ni KLC  The stealth siRNAs against T. ni KLC were designed using Block-iT RNAi Designer (Life Technologies). The KLC siRNAs were 5’-CAGGAAGAGCAUCGAUGCUAUUGAA-3’ starting at nucleotide position 198 and 5’-CAAGUACAAGGAAGCAGAGACACUA-3’ starting at nucleotide position 1191 relative to the start of the KLC ORF. The negative control non-specific siRNA sequences were also designed by Block-iT RNAi Designer and were 5’-CAGGAGACUACGUAGUAUCUAGGAA-3’ and 5’-  59  CAAACAGGAGAAGACAGAACGUCUA-3’. The KLC or control siRNAs were simultaneously transfected into either C-terminal or N-terminal HA-tag KLC polyclonal stable cell lines. Polyclonal stable cell lines were plated at 1x106 cells per well in a six well tissue culture plate. Cells were transfected with final concentration of 5 nM of each siRNA using lipofectin (193) for 4 hours at 27oC in the absence of any antibiotics. Similar conditions were maintained for cells transfected with negative control siRNA. After a 4 h transfection, cells were briefly washed 3x with TC100 media and replaced with TC100 plus zeocin (250 g/ml). At 24 and 48 hpt cells were harvested, washed twice with 1x PBS and cells were lysed in 1x PSB. Samples were separated on SDS-PAGE and down regulation of N- or C-HA- KLC was determined by Western blotting. The bands were quantified using Image Lab 5.1 (Bio-Rad). In N- and C-HA-KLC knockdown and infection experiments, cell lines were transfected with either the siRNA or negative control siRNA using the same protocol as mentioned above. At different times post-transfection media was removed and cells were infected with ac141KO-HA-AC141 at an MOI 5 and incubated for 1 hour. Cells were washed briefly 3x with TC100 media and replaced with TC100 plus zeocin (250 g/ml). At 24 hpi, culture supernatants were collected to determine the BV titre by TCID50 end-point dilution assay (196) and cells were harvested for Western blot analysis.    60  2.5.3 MG132 treatment of Sf9 cells  Sf9 cells (1x 106) were infected with WT virus, vubiKO-Myc-vUbi or vubiKO-Myc-vUbiK6R at an MOI of 5. At 12 hpi cells were washed three times with medium and replaces with medium containing MG132 (at 100 μM and 250 μM) in DMSO to block proteasome protein degradation. Cells were harvested at 12 hours post MG132 treatment (equivalent to 24 hpi). Control cells were treated with medium containing DMSO without MG132. Western blot analysis of total protein was done to determine if there was an accumulation of cellular or viral ubiquitinated proteins after MG132 treatment. 2.5.4 Time course analysis of virus infection in bacmid transfected or virus infected cells for analysis of BV production and viral protein synthesis Sf9 cells were seeded into 6 well plates (2.0  106 cells per 35-mm diameter well) and were transfected with 1.0 µg of each BACmid or infected with BV at an MOI of 5 or 10.For measuring BV production, the culture medium was harvested at various times post transfection and centrifuged at 3,000 g for 5 min to pellet cell debris. BV production was determined by the 50% tissue culture infective dose (TCID50) endpoint dilution assay or by droplet digital PCR (29, 86). For time course analysis of AC141 protein expression at the designated times post infection, 5  104 cells equivalents were analyzed by SDS-PAGE and Western blotting.   61  2.6 Generation of polyclonal antibodies   Peptide specific polyclonal antibody against T. ni KLC (amino acid 179-194) and AC141 (amino acid 215-229) were generated in rabbits by Pacific Immunology Inc. 2.7 Western blot analysis  SDS-PAGE separated proteins were electro-transferred on to Millipore Immobilon membrane using Bio-Rad transfer apparatus as recommended using the manufacturer’s protocol. Membranes were blocked for 1 hour in blocking solution (5% Skim Milk in Tris buffered saline and Tween-20 [TBST; 50 mM Tris, 150 mM NaCl and 0.5% Tween-20]) followed by 1 hour incubation with primary antibody. The following primary antibodies were used: mouse monoclonal anti-HA-HRP (1:5000, Invitrogen], rabbit polyclonal anti T.ni KLC (1:500), rabbit polyclonal anti-AC141 (1:2500), mouse monoclonal anti-VP39 (1:3000), rabbit polyclonal anti-FP25 (1:5000), rabbit polyclonal anti-BV/ODV-C42 (1:5000), mouse monoclonal anti-Myc (1:200, Santa Cruz), mouse monoclonal anti-HA (1:1000, Covance) mouse monoclonal anti-EGFP (1:5000) and mouse monoclonal anti-β-tubulin (1:1000, ExBio). The following secondary antibodies conjugated to horse radish peroxidase were used: Rabbit anti-mouse (1:10000) and goat anti-rabbit (1:15000) (Jackson ImmunoResearch Laboratories Inc.). Bound antibodies were detected by incubation with peroxidase-conjugated secondary antibody and detected   62  with Western-Lightening Plus ECL Enhanced Chemiluminescence System (Perkin-Elmer). Membranes were imaged in Bio-Rad Chemidoc MP Imaging System. 2.8 Yeast two-hybrid analysis  Saccharomyces cerevisiae strain YRG-2 (Stratagene) was used for yeast two-hybrid analysis as previously described (86). Genes of interest were cloned by PCR amplification followed by restriction digestion and ligation into the binding domain bait vector pBD-Gal4-Cam or the activation domain prey vector pAD-Gal4-2.1(Stratagene). The T.ni KLC was cloned into both the activation domain by using the following primers 2447-2448 (Table 2.1) and into binding domain using the primers 2451-2452 (Table 2.1). Similarly T.ni KHC was cloned into activation and binding domain vectors using the primers 2445-2446 and 2449-2450 (Table 2.1). The TPR domain of KLC and the Stalk/Tail domain of KHC which have been known to interact with cargo were cloned into activation and binding domain vectors, pAD-GAL4 2.1 and pBD-GAL4 Cam, using the primer combinations, 2453- 2448, 2454- 2452, 2457- 2446, and 2458- 2450 respectively (Table 2.1). AcMNPV VP39 was cloned into activation domain using the primers 2461- 2462. The clones pAD-AC141, pBD-∆AC141 (37 amino acid deletion N-terminal mutant of AC141) and pBD-VP39 have been previously described (84, 86). Competent YRG2 yeast cells were transformed with 200 ng of the desired plasmids followed by heat shock in Tris-EDTA-lithium acetate-polyethylene glycol-dimethyl   63  sulphoxide solution (86). Double transformants were screened for growth on minimal SD base medium plates lacking the two amino acids leucine and tryptophan to ensure the presence of both bait and prey vectors. The screened colonies were further tested for positive interaction by growth on minimal SD base medium plates lacking the three amino acids leucine, tryptophan and histidine.  2.9 Purification of BV and ODV and fractionation into envelope and nucleocapsid fractions  Sf9 (2.0 x 108) cells were infected with vUbiKOMyc-vUbi virus at MOI of 0.1 and cells were harvested at 7 days pi. Infected cells were pelleted at 3000 rpm to separate the medium containing BV and the cell pellet containing ODV. BV containing medium (90 ml) was centrifuged at 8000 g in a Beckman JA12 rotor to pellet cell debris. The BV in the cell debri free supernatant was pelleted by centrifugation at 100,000 g (21,000 rpm) in a Beckman SW28 rotor at 4oC. Pelleted BV was resuspended in 400 µl of 0.1x Tris-EDTA (TE) buffer with 1% protease inhibitor cocktail described above. The resuspended BV was loaded onto a continuous sucrose density gradient 25-60% and centrifuged at 100,000 g (24000 rpm) in a Beckman SW41 rotor at 4oC for 1.5 hr. The BV band was collected and diluted with an equal volume of 0.1x TE. Diluted purified BV was centrifuged at 100,000 g (24000 rpm) in a Beckman SW41 rotor in 4oC for 30 min to   64  pellet the BV. Purified BV protein concentration was determined by the Bradford assay (197).  The cell pellet containing OBs was washed twice with 5 ml of sterile distilled water to remove any trace medium. The cell pellet was resuspended in 2 ml 2% TritonX-100 (V/V) and incubated at 370C for 1 hour. Following TritonX-100 treatment, cells were treated with 10% deoxycholate (1/5th of the final volume) and kept at 37oC for 1 hour. The OBs containing the cell debris were pelleted at 3000 rpm for 1 min. The rest of the OBs were freed from the cell debris by treatment with 0.1% SDS and vortexed for 10 min. The OBs free of cell debris were resuspended in 100 µl dH2O. ODVs were released from OBs by incubation with alkaline dissolution buffer (0.002 M EDTA; 0.2 M Na2CO3, 0.34 M NaCl and pH 10.8) for 30 min. Dissolution of OBs were checked by microscopy. The reaction was neutralized with 20 µl 1.0 M Tris-HCl pH 7.2. Remaining cell debris and insoluble material were pelleted for 5 min at 3000 rpm. ODVs in the supernatant were loaded onto a step sucrose gradient (30-60%). The gradient was centrifuged at 100,000 g (24000 rpm) in a Beckman SW41 rotor at 4oC for 1.5 hr. The multiple ODV bands were collected and diluted with two volumes of 0.1X TE. The diluted ODV was pelleted by centrifugation at 55000 g (18000 rpm) in a Beckman SW41 rotor at 4oC for 1 hr. Purified ODV concentration was determined by the Bradford assay.    65  Fractionation of BV and ODV into nucleocapsid and envelope was done according to Braunagel et al. (198) and Fang et al (86). Purified BV or ODV (250 µg) was incubated for 30 min at room temperature with 1% NP40 in 10 mM Tris-HCl pH 8.5 in a 250 µl reaction volume. NP40 treated BV and ODV were layered onto 30% glycerol (W/V) cushions -10 mM Tris-HCl pH 8. The step gradient was centrifuged at 150,000 g (34000 rpm) in a Beckman SW60 rotor at 4oC for 1 hour. The envelope fraction proteins from the top of the cushion were recovered by tricholoroacetic acid (TCA) precipitation. The nucleocapsid pellet from BV and ODV were resuspended in 10 mM Tris-HCl pH 7.4. For TCA protein precipitation, 25 volumes of 100% TCA stock was added to the protein sample and incubated at 4oC for 10 min. The protein precipitate was pelleted at 14000 rpm for 5 min followed by a cold acetone wash. After two washes with acetone; the pellet was dried 95oC for 5 min to remove any residual acetone. 2.10 Mass Spectrometric analysis and detection of the viral and cellular ubiquitinated proteins  Purified BV, ODV or co-immunoprecipitated samples were analyzed by mass spectrometry using the University of British Columbia's Centre for High-Throughput Biology. The samples were loaded onto SDS-PAGE and excised gel pieces were digested with trypsin followed by extraction. Experimental and control samples were differentially labelled with formaldehyde isotopologues followed by liquid chromatography-tandem   66  mass spectrometry analysis. MS/MS data was searched against FASTA databases created from proteins associated with Sf9 cells (http://www.ncbi.nlm.nih.gov/genome/?term=Sf9) and AcMNPV from Uniprot using MaxQuant (http://www.nature.com/nbt/journal/v26/n12/full/nbt.1511.html). To identify tryptic peptide the MS data was analyzed by  MASCOT (199).The C-terminus of vUbi is Gly-Gly-Tyr compared to cUbi which is Gly-Gly. Normally any amino acid extensions on ubiquitin-like proteins are cleaved to Gly-Gly by isopepitdase (200). However, to determine if vUbi was covalently linked to substrate proteins via Gly-Gly-Tyr linkage the  tryptic peptide MS data was analyzed by MASCOT (199). Tryptic peptides ubiquitinated by uncleaved vUbi would differ in molecular weight by a Tyr compared to  Gly-Gly ubiquitination. The false discovery rate which was used as a threshold for discovery was 1% at both the peptide and protein levels (199).    67  Chapter 3  Trichoplusia ni kinesin-1 associates with AcMNPV nucleocapsids1   33.1 Introduction The baculovirus AcMNPV is an enveloped virus containing a large double stranded circular DNA genome of approximately 134 kbp that encodes approximately 156 proteins. During the course of AcMNPV infection nucleocapsids assemble in the nuclei of infected cells and subsequently produce two forms of virions, BV and occlusion derived virus ODV. A BV is typically formed from a single nucleocapsid that egresses from the nucleus, traverses the cytoplasm and obtains an envelope by budding from the plasma membrane. ODVs are formed in the nucleus when single or multiple nucleocapsids get surrounded by a membrane that is derived from the nuclear envelope (201). BV facilitates systemic cell to cell spread of the infection within the host insect, whereas ODV become incorporated into polyhedral occlusion bodies which are liberated                                               1  A version of this chapter has been published. Biswas S, Blissard GW, Theilmann DA. (2016) Trichoplusia ni kinesin-1associates with Autographica californica multiple nucleopolyhedrovirus proteins and is required for the BV production. Journal of Virology. 2016 Jan 13;90(7):3480-95. doi: 10.1128/JVI.02912-15.   68  from the nucleus when the host insect dies and disintegrates. Occlusion bodies containing ODV mediate environmental transmission of the virus between hosts (202). Proteomic and other analyses have identified many BV proteins that are required for nucleocapsid structure, or are associated with the nucleocapsid, or are envelope proteins (89). One of the nucleocapsid associated proteins is the 261 amino acid AC141 (or EXON0) which is expressed at late times post-infection (pi) and is required for BV production (84, 86, 107). The deletion of ac141 reduces BV production by 99.99% and electron micrographs have shown that in cells infected with ac141 knockout virus nucleocapsids are not able to escape from the nucleus (86). AC141 contains a RING domain and a leucine zipper domain (required for dimerization) and regions of acidic and charged amino acids (84). Immunolocalization of AC141 has also shown that in addition to being associated with purified nucleocapsids it is found concentrated near the inner nuclear membrane as well as the plasma membrane (86). During systemic infection of a host insect, or in cell culture, AcMNPV BV utilizes the major envelope fusion glycoprotein GP64 for binding and entry (40, 41). After cell entry via receptor mediated endocytosis, nucleocapsids induce host F-actin polymerisation which drives them toward the nucleus and nuclear pores (44-46, 203). Upon entering the nucleus, the viral genome is released from the nucleocapsid and this is followed by viral early transcription, DNA replication and late transcription, all of which are required for   69  the production of new progeny nucleocapsids. Nucleocapsids are produced in a region of the infected cell nucleus called the virogenic stroma. Data suggests that nucleocapsid transport from the stroma to the nuclear periphery requires host nuclear F-actin (48, 82, 204). Nucleocapsids escape from the nucleus possibly by a budding type process (85, 86). Nucleocapsids then traverse the cytoplasm to the viral budding sites on the plasma membrane, from which BVs are released. The mechanism by which nucleocapsids are transported through the cytoplasm to the plasma membrane is not known. More recently it has been suggested that nucleocapsids associate with microtubules to facilitate trafficking through the cytoplasm (109, 205). AcMNPV AC141, which is required for BV production, interacts with β-tubulin suggesting microtubules are involved. In support of this, depolymerisation of microtubules reduces BV production substantially (109, 205). In addition, FRET-FLIM analysis has shown that both AC141 and VP39 (major capsid protein) interact with the TPR domain of Drosophila melanogaster kinesin-1 light chain (DmKLC) (109). The kinesin superfamily (KIF) are a class of motor proteins which are known to carry cargo like membranous organelles and other macromolecules anteriorly along microtubules (110). Kinesin-1, also known as conventional kinesin, belongs to the KIF5 family which is a heterotetrameric protein comprising of two KHCs and two KLCs. KHC’s contain an N-terminal motor domain which drives movement along microtubules by hydrolysing ATP. Adjacent to the motor domain is a coiled-coil stalk domain followed by C-terminal globular tail domain (206). KLC is comprised of N-terminal heptad repeats and six C-terminal TPR motifs (207, 208). The heptad repeats of   70  KLC interact with the stalk domain of KHC. The TPR motifs and the stalk/tail domain of KHC are also known to bind cargo (111, 207, 209). DNA viruses, such as ASFV, vaccinia virus and HSV-1 are known to associate with the microtubule transport system and kinesin-1 as cargo for both nucleocapsid entry and egress (116, 117, 122, 123, 128, 129, 131, 135, 137, 138, 142, 143, 210-213).  As indicated above prior studies indicate that microtubules and kinesin-1 are potentially required for the egress of AcMNPV BV. In the current study, we examined whether the native lepidopteran host cell kinesin-1 interacts with viral proteins, and if it is required for nucleocapsid transport and BV production. We show that the nucleocapsid proteins AC141 VP39 (major capsid protein), BV/ODV-C42 and FP25 associate with kinesin-1. The results of this study provide further evidence that kinesin-1 and microtubule transport are required for AcMNPV nucleocapsid egress and BV production.      71  3.2 Results 3.2.1 Co-immunoprecipitation of HA-AC141 and T. ni KLC  AC141, which is required for BV production, interacts with lepidopteran β-tubulin and the TPR domain of D. melanogaster  kinesin-1(205). This suggested that baculovirus nucleocapsids may be transported using the kinesin-1 microtubule transport system (86, 109). To further investigate this association co-immunoprecipitation experiments were performed to determine if AC141 interacts with T. ni kinesin-1 in AcMNPV infected cells. Tn5b1 cells were infected with a virus expressing HA tagged AC141 (ac141KO-HA-ac141) or with AcMNPV-E2 wildtype virus (WT virus) virus as control. Protein complexes were immunoprecipitated with anti-HA-beads and eluted proteins were subjected to Western blot analysis using a T.ni KLC specific antibody (Figure 3.1). The results showed that T.ni KLC specifically co-immunoprecipitates with HA-AC141 but was not detected in the eluent of cells infected with WT virus. This result provides the first evidence that the AcMNPV viral protein AC141 associates with T. ni host kinesin-1. Reciprocal pull down assay was not possible because of the low sensitivity of the polyclonal KLC antibody.     72      Figure 3.1Co-immunoprecipitation of HA-AC141 and untagged T. ni KLC in Tn5B1 infected cells. Tn5B1 cells infected with ac141KO-HA-AC141 (HA) or  WT virus, harvested at 24 hpi, and cell lysates were  co-immunoprecipitated with anti-HA beads. Input and eluents were analyzed by Western blot and probed with anti-HA mouse monoclonal antibody or a rabbit polyclonal anti-T. ni KLC antibody. In input lanes 0.25% of total lysate was loaded for both blots. For the eluent blots, 4% of the total eluent was loaded for the anti-HA blot (top), and 25% of the total eluent was loaded for anti-T. ni KLC blot (bottom).   73  3.2.2 Cloning of T. ni kinesin-1 and generation of stable Tn5b1 cells expressing tagged KHC and KLC   To enable a more detailed analysis of the interaction between kinesin-1 and AcMNPV nucleocapsid proteins, transformed cell lines were developed expressing tagged forms of KLC or KHC under control of the OpMNPV ie2 promoter. The sequence of KHC and KLC of T. ni kinesin-1 was originally identified by a high throughput RNA-seq analysis of T. ni cells (179). The cDNAs were cloned and constructs were made that tagged KHC and KLC at both the N- and C-terminus with either the HA or Myc epitope tag (Figure 3.2A). Proteins were tagged, at either the N- or C-termini to control for any possible steric hindrance caused by the epitope tag. Additional KHC and KLC constructs were made that were tagged at the C-terminus with both the HA epitope tag and EGFP. Each of these constructs was used to generate stably transformed Tn5b1 polyclonal cell lines. Transformed cell lines were named by the expressed protein and location of the attached tag or fusion protein (Figure 3.2A). The stable expression of tagged KHC or KLC of kinesin-1 was confirmed by Western blot (Figure 3.2B). Comparison of the expression of both endogenous KLC and tagged KLC was analyzed in the KLC stable cell lines (Figure 3.2C).    74   Figure 3.2 Constructs used to generate stable cell lines expressing T. ni KHC and KLC that contain epitope tags or EGFP fusions. A) Figure shows schematic diagrams of the expressed KHC or KLC proteins in the stable cell lines indicated on the right. Each protein was tagged at either the N- or C-terminus with a Myc-tag (grey), HA-tag (black) or EGFP fusion (green). The relative location of the motor, stalk and tail domains in KHC and the heptad repeat and TPR domains in KLC are also indicated. B) Total protein from polyclonal stably transformed cells was subjected to SDS-PAGE and the expression   75  of tagged KLC and KHC were analyzed by Western blotting. The HA-, Myc-tag and EGFP-fusion were detected by the corresponding antibodies indicated below each blot. C) Total protein from tagged KLC polyclonal stable cell lines were subjected to SDS-PAGE and expression of endogenous KLC and engineered KLC were analyzed by Western blot with polyclonal antibody against T.ni KLC. Lower panel shows the loading control which is the same blot probed with anti-actin antibody.      76  3.2.3 Co-immunoprecipitation of HA-tagged KLC or KHC and AC141 To further confirm the association of AC141 and T. ni kinesin-1, stable cell lines expressing tagged forms of KLC or KHC were used. Initially stable cell lines expressing C-HA-KLC or N-HA-KLC (Figure 3.2) were infected with WT virus. Protein complexes were pulled down with either polyclonal AC141 antibody or with pre-immune serum as control. The results showed that on immunoprecipitation with anti-AC141, both C-HA-KLC and N-HA-KLC were co-immunoprecipitated. Neither C-HA-KLC nor N-HA-KLC was co-immunoprecipitated with the control pre-immune serum (Figure 3.3A). The same eluents from cell lines expressing C-HA-KLC or N-HA-KLC but not those from control samples also specifically eluted β-tubulin when AC141 was pulled down (Figure 3.3A) further providing evidence for the association between AC141, KLC and β-tubulin. The co-immunoprecipitation of AC141 and β-tubulin was previously shown using recombinant virus expressing HA-tagged AC141 (205). The current experiments confirmed these results using WT virus infected cells and anti-AC141 polyclonal antisera. Reciprocal co-immunoprecipitations were performed using C-HA-KLC and N-HA-KLC cell lines infected with WT virus, and immunoprecipitated using anti-HA beads (Figure 3.3B). As a control Tn5b1 cells were infected with WT virus. Immunoprecipitated complexes were analyzed by Western blot and probed with anti-AC141. The results showed equal levels of AC141 in input lanes of both Tn5b1 and C-HA-KLC or N-HA-KLC infected cell lines    77   Figure 3.3 Co-immunoprecipitation of AC141 with C- or N-HA-KLC or C- or N-HA-KHC expressed in stably transformed cells. Cells were infected with WT virus and harvested at 24 hpi; co- immunoprecipitated protein complexes were subjected to western blotting and probed with the antibodies shown on the left. Input lanes were loaded with 0.25% of total input for every blot. A) C- or N-HA-KLC cell lines   78     infected with WT virus and protein complexes were co-immunoprecipitated with anti-AC141 rabbit polyclonal antibody or the control pre-immune serum. Eluent lanes contain 4% of total eluent for the AC141 blot and 25% of total eluent for HA-tagged KLC and β-tubulin blots. B) C-HA-KLC, N-HA-KLC or the control Tn5B1 cells infected with WT virus and protein complexes were co-immunoprecipitated with anti-HA beads. Eluent lanes contain 4% of the total eluent for the C- or N-HA-KLC blots, and 25% of the total eluent for the AC141 blot. C) C-HA-KHC, N-HA-KHC cell lines or Tn5B1 cells were infected with WT virus and protein complexes were co-immunoprecipitated with anti-HA beads. Eluent lanes contain 4% of the total eluent for the C- or N-HA-KHC blot and 25% of the total eluent for the AC141 blot. Actin (B) or β-tubulin (C) was used as a loading control (not shown).   79  however co-immunoprecipitation of AC141 was observed only in the C-HA-KLC and N-HA-KLC cell lines (Figure 3.3B). The reciprocal co-immunoprecipitation of HA-KLC and AC141 further confirms the association of KLC and AC141.  Kinesin-1 is a tetramer of 2 KLC and 2 KHC molecules. Therefore if AC141 is associated with kinesin-1, both KHC and KLC should be co-immunoprecipitated with AC141. Therefore to confirm the association of kinesin-1 with AC141, co-immunoprecipitation experiments were performed with C- and N-terminal HA-tagged KHC cell lines as was done with KLC. C-HA-KHC, N-HA-KHC cell lines and Tn5b1 cells as a control, were infected with WT virus and protein complexes were immunoprecipitated with anti-HA beads and analyzed by Western blots. As shown for KLC the results showed that HA-KHC was immunoprecipitated only in the C-HA-KHC and N-HA-KHC cell lines (Figure 3.3C). AC141 is detected in the input of C-HA-KHC, N-HA-KHC and Tn5b1 infected cells. However, AC141 was specifically co-immunoprecipitated in only C-HA-KHC and N-HA-KHC cell lines (Figure 3.3C). The co-immunoprecipitation of AC141 with T. ni KLC and KHC confirms that kinesin-1 potentially interacts with either free AC141 or with a protein complex that contains AC141. Since AC141 is a nucleocapsid associated protein, the protein complex could include viral nucleocapsids.   80  3.2.4 Co-localization analysis of T. ni KLC or KHC with AC141 The co-immunoprecipitation experiments showed that AC141, which is a nucleocapsid protein required for viral budding associates with kinesin-1. To further investigate this association and to identify where in the cell the interactions occur, co-localization experiments in infected cells were performed using confocal microscopy. For these experiments N-Myc-KLC cells were infected with ac141KO-HA-ac141 and analysed at 20hpi, 24hpi and 48hpi (Figure 3.4). As previously reported, HA-AC141 (Green signal; Figure 3.4A) was concentrated at the cellular periphery and outside the virogenic stroma closer to the nuclear envelope (86). N-Myc-KLC (Red Signal) was ubiquitously expressed in the cytoplasm with very low levels in the nucleus. Co-localization analysis of HA-AC141 and N-Myc-KLC at different time points showed that they co-localize in the cytoplasm and predominately near the plasma membrane (Figure 3.4A Merged, Yellow signal). Inside the nucleus, HA-AC141 does not significantly co-localize with N -Myc-KLC (Figure 3.4A). As a control, Tn5b1 cells were infected with WT virus and staining and imaging conditions were kept the same (Figure 3.4A). Negligible background fluorescence for both HA-AC141 and N-Myc-KLC was observed. The Pearson’s coefficient (Rr) and overlap coefficient (R) values were also calculated at 30 different region of interests (ROIs) to measure the efficiency and quantification of co-localization. The Rr values for the co-localization of HA-AC141 and N-Myc-KLC were between 0.64-0.79 and R values were between 0.91-0.96 suggesting a strong co-  81  localization between the two proteins (Figure 3.4B). These experiments were repeated with the C-Myc-KLC cell line and similar co-localization patterns and co-localization coefficient values were observed with HA-AC141 and C-Myc-KLC (Figure 3.4C & D). To confirm the association of AC141 with kinesin-1 it was necessary to determine if AC141 also co-localizes with KHC. Therefore N-Myc-KHC cell lines were infected with ac141KO-HA-ac141 and fixed and stained at 20, 24 and 48 hpi (Figure 3.5A). As expected HA-AC141 (Green signal) shows nuclear and cytoplasmic localization being concentrated around the virogenic stroma and the cellular periphery, respectively, at different time points. The localization pattern of N -Myc-KHC (Red signal) was similar to the KLC results and was observed throughout the cytoplasm. The merged fields showed regions of co-localized HA-AC141 and N -Myc-KHC (yellow) towards the cellular periphery at each time point. The nuclear HA-AC141 did not co-localize with N- Myc-KHC at 20, 24 and 48 hpi. Control Tn5b1 cells infected with WT virus, had negligible background fluorescence for HA-AC141, N-Myc-KHC (Figure 3.5A). The Rr values were between 0.76-0.90 and R values were from 0.95-0.96 which represents a very strong co-localization or association between HA-AC141 and N-Myc-KHC (Figure 3.5B). These experiments were repeated with the C-Myc-KHC cell line and similar co-localization patterns and co-localization coefficient values were observed with HA-AC141 and C-Myc-KHC (Figure 3.5C & D).   82   Figure 3.4 Co-localization analysis of HA-AC141 and T. ni Myc- KLC at 20, 24 and 48 hpi.   83  A) & C) N-Myc-KLC and C-Myc-KLC cell lines were infected with ac141KO-HA-ac141 and fixed at 20, 24 and 48 hpi. Nuclei were stained with DAPI (blue) and HA-AC141 was detected with rabbit polyclonal anti-HA and goat anti-rabbit immunoglobulin antibodies conjugated with Alexa488 (green). N-Myc-KLC and C-Myc-KLC was detected with mouse monoclonal anti-Myc and goat anti-mouse immunoglobulin antibodies conjugated with Alexa635 (red). B) & D) The Rr and R values were calculated at 30 ROI from 5 different cells for each time point for N-Myc-KLC or C-Myc-KLC and HA-AC141.   84   Figure 3.5 Co-localization analysis of HA-AC141 and T. ni Myc-KHC at 20, 24 and 48 hpi.   85  A) & C) N-Myc-KHC and C-Myc-KHC cell lines were infected with ac141KO-HA-AC141 and fixed at 20, 24 and 48 hpi. Nuclei were stained with DAPI (blue), HA-AC141 was detected with rabbit polyclonal anti-HA and goat anti-rabbit immunoglobulin antibodies conjugated with Alexa488 (green). N-Myc-KHC and C-Myc-KHC was detected with mouse monoclonal anti-Myc and goat anti-mouse immunoglobulin antibodies conjugated with Alexa635 (red). B) and D) The Rr and R values were calculated at 30 ROI from 5 different cells for each time points for N-Myc-KHC or C-Myc-KHC and HA-AC141.            86  3.2.5 Co-localization studies of KLC or KHC, with AC141 and microtubules  The above results show that the kinesin-1 proteins KLC and KHC associate with AC141 at the cellular periphery. As kinesin-1 is used to transport cargo along microtubules we wanted to determine if KHC or KLC and AC141co-localize with microtubules. For these experiments KLC-EGFP and KHC-EGFP stable cells were infected with WT virus and fixed at 24 hpi and analyzed for co-localization of KLC or KHC with AC141 and β-tubulin (microtubules). As was observed with the Myc tagged proteins (Figure 3.4 and Figure 3.5) both KLC-EGFP and KHC-EGFP localized throughout the cytoplasm (Figure 3.6A and B). Microtubules, detected using a β-tubulin antibody are localized throughout the cytoplasm but concentrated towards the cellular periphery similar to what has been previously observed (205, 214). Co-localization of the green fluorescence of KHC-EGFP or KLC-EGFP with cyan staining of β-tubulin results in blue pixels in the merged image which is observed mainly at the cellular periphery where the microtubules are most concentrated. The AC141 staining shown in red (Figure 3.6A, B) co-localized with KHC-EGFP or KLC-EGFP primarily at the cellular periphery (yellow) as was observed for Myc-tagged KLC or KHC cell lines and  HA-AC141 (Figure 3.4 and Figure 3.5). Co-localization of AC141 (red) with β-tubulin (cyan) and KHC-EGFP or KLC-EGFP (green) results in pink pixels. Distinct pink pixels in both the single confocal plane and the z-stack are observed at the cellular periphery at the plasma membrane (Figure 3.6A, B). These z-stack images including the enlarged images give a clear view of the microtubule    87   Figure 3.6 Co-localization analysis of AC141, KLC- or KHC-EGFP and microtubules. A) KLC-EGFP or B) KHC-EGFP cells were infected with WT virus at MOI 10 and cells were fixed at 24 hpi. AC141 was detected with rabbit polyclonal anti-AC141 and goat anti-rabbit immunoglobulin antibodies conjugated to alexa647 (red). β-tubulin was detected with anti-β-tubulin mouse monoclonal and goat anti-mouse  immunoglobulin antibodies conjugated to alexa405 (cyan). KLC- or KHC-EGFP is shown as green. Co-localization of β-tubulin with KLC- or KHC-EGFP gives blue pixels and all three proteins results in pink pixels. Top panel (A and B) shows a single 2D images and bottom panel shows a 3D representation of a merged z-stack of the same cells in the top panel.   88   structures and the co-localization with KLC-EGFP or KHC-EGFP. The greatest degree of co-localization of all three proteins is observed at the cellular periphery adjacent to the plasma membrane. On the cell surface there are numerous bulges which are potential viral budding sites. Similar bulged regions were observed through time lapse microscopy in infected Sf21 cells at 18-22 hpi (215). The bulges have predominately either KLC or KHC, and AC141 but only limited β-tubulin. The majority of co-localization of all three proteins occurs below the bulges. These results suggest that AC141, kinesin-1 and microtubules co-localize at the peripheral regions of the cytoplasm near the plasma membrane and potential viral budding sites. 3.2.6 siRNA down-regulation of KLC and impact on BV production   Co-immunoprecipitation and co-localization studies indicate that microtubules and kinesin-1 are potentially involved in the transport of nucleocapsids to the viral budding sites at the cell plasma membrane. If this is correct, down-regulation of kinesin-1 should decrease BV production. We therefore used siRNA to down-regulate cellular KLC of kinesin-1.  To confirm down-regulation of KLC by siRNA, N-HA-KLC polyclonal stable cell lines were transfected with either siRNAs specific for KLC or control siRNA and expression levels were analysed by Western blot. The results showed significant down regulation of   89  N-HA-KLC at 24 and 48 hpt with the target siRNA, compared to untreated cells or cells transfected with non-specific siRNA (Figure 3.7A). The expression levels of N-HA-KLC relative to untreated cells (100%), in siRNA treated cells was only 4%  and 1% of the untreated at 24 hpt and 48 hpt, respectively. Non-specific siRNA were observed to decrease N-HA-KLC at 24 hpt but levels had nearly fully recovered by 48 hpt. Downregulation of N-HA-KLC and C-HA-KLC by siRNA had no impact on cell viability or growth rate (data not shown). These results showed that KLC could be down-regulated by siRNA in Tn5B1 cells and could be used to assay impacts on BV production.  To assess the impact of the down-regulation of KLC on BV production N-HA-KLC stable cell lines were transfected with specific or non-specific siRNA followed by infection with ac141KO- HA-AC141. Cells and media were harvested at 24 hpi and 28, 36, 48, or 72 hpt. Cells were analyzed for N-HA-KLC and HA-AC141 expression (Figure 3.7B) and the medium was analysed for BV production (Figure 3.7C). Down-regulation of N-HA-KLC was observed by Western blot in siRNA treated cells at 36, 48 and 72 hpt. Down-regulation of N-HA-KLC had no effect on the expression level of the late gene HA-AC141 which shows there was no effect on the early stages of virus infection such as the initiation of viral DNA replication. However, the BV titer showed a statistically significant reduction of 81.1%, 77.5% and 63.9% for siRNA treated cells as compared to untreated cells at 36, 48 and 72 hpt respectively (Figure 3.77C). For the 28 hpt samples,   90  siRNA treated cells showed a decrease in BV production of 48.5% compared to untreated cells. But the decrease is non-significant when compared to the non-specific siRNA treated cells. The BV titer did not change significantly for cells treated with negative control siRNA at any time points. The same experiment was performed on the C-HA-KLC stable cell line and similar trends were obtained showing BV titres were reduced after treatment with KLC siRNA (Figure 3.7D-F).     91     92   Figure 3.7 siRNA downregulation of T. ni HA-KLC expression and the impact on AcMNPV BV production.   93  A) & D) N-HA-KLC and C-HA-KLC cell lines were transfected with two KLC siRNAs (siRNA) or two non-specific control siRNAs (control siRNA) or mock transfected (mock)). At 24 and 48 hpt cells were harvested and total cell lysates were subjected to Western blots and probed with anti-HA to detect the expression of  N-HA-KLC. Actin was detected with an anti-actin antibody as a loading control. The percentage above each lane shows the levels of N-HA-KLC relative to untreated mock cells, which was given a value of 100%. Levels were determined using NIH Image v5.1. B) & E) The N-HA-KLC and C-HA-KLC cell line were transfected with KLC specific siRNA (+), non-specific control siRNA (-) or untreated mock (*). At 4, 12, 24 and 48 hours post siRNA transfection, the cells were infected with ac141KO-HA-AC141 at MOI 5. Supernatants and cells were harvested at 24 hpi. Total cell lysates of infected cells were subjected to Western blots and probed with anti-HA to analyze expression levels of N-HA-KLC and HA-AC141. Membranes were re-probed for actin as a loading control. C) & F) BV levels in supernatants were determined by end point dilution assay and are represented as percentage of untreated control which was given a value of 100%. BV titres are the average of two biological replicates each with two technical replicates.          94  3.2.7 Association of the nucleocapsid proteins VP39, BV/ODV-C42 and FP25 with kinesin-1 KLC  The above data suggest that AC141 and kinesin-1 associate with each other. Therefore, if kinesin-1 associates with nucleocapsid-associated AC141, then co-immunoprecipitation of kinesin-1 should also pull down other nucleocapsid proteins. We therefore performed additional co-immunoprecipitation experiments using cell lines C-HA-KLC, N-HA-KLC, and Tn5b1 infected with WT virus. Recovered co-immunoprecipitated protein complexes were analysed by Western blot for the nucleocapsid associated proteins VP39, BV/ODV-C42 and FP25 (Figure 3.8). The results showed N- and C-HA-KLC in the input and also in the eluent from C-HA-KLC, N-HA-KLC stable cells but not Tn5b1 cells as expected. The other nucleocapsid proteins VP39, BV/ODV-C42 and FP25 were also detected in all cell lines. Analysis of the eluent showed that all three nucleocapsid proteins were specifically co-immunoprecipitated from the infected C-HA-KLC and N-HA-KLC expressing cells (Figure 3.8). VP39, BV/ODV-C42 and FP25 were not co-immunoprecipitated from Tn5B1 cells that do not contain HA tagged KLC. These results would suggest that co-immunoprecipitation of kinesin-1 is immunoprecipitating nucleocapsids.    95   Figure 3.8 Association of the nucleocapsid proteins VP39, FP25, and BV/ODV-C42 with C-HA-KLC or N-HA-KLC. Co-immunoprecipitation analysis of VP39, FP25, and BV/ODV-C42 with N- or C-HA-KLC. Tn5B1 and C- or N-HA-KLC cells were infected with WT virus at an MOI=10 and the cells were harvested at 24 hpi, protein complexes were co-immunoprecipitated with anti-HA beads and analyzed by Western blot probed with the antibodies indicated on the left. The VP39 and BV/ODV-C42 blots were re-probed with anti-β-tubulin as a loading control. The input lanes contained 0.25% of the total lysate and eluent lanes contained 25% of the total eluent.   96  3.2.8  Association of VP39-3xmCherry nucleocapsids with microtubules  Previous studies have shown that co-expression of  WT virus VP39 with a VP39 fused with three copies of the mCherry fluorescent protein (VP39-3xmCherry) could be used to tag and identify individual nucleocapsids being actively transported on actin filaments during virus entry (44). Therefore, we compared localization of nucleocapsids tagged with VP39-3xmCherry with that of microtubules. We examined co-localization during entry (0.5 hpi) and during egress (24 hpi) (Figure 3.9A). At 0.5 hpi nucleocapsids (red foci) are easily observed in the cytoplasm as has been previously reported (44) but the majority do not co-localize (white pixels, right lower panel) with microtubules. In contrast, during egress (24 hpi) the majority of VP39-3xmCherry-tagged nucleocapsids co-localize with microtubules (white pixels). To quantify co-localization with microtubules during entry and egress, the total number of nucleocapsids in the cytoplasm during entry (0.25 and 0.5 hpi) and egress (20 and 24 hpi) was calculated (Figure 3.9B). During entry, only 10.7% of the tagged nucleocapsids co-localized with microtubules. However, in dramatic contrast approximately 79.3% of the nucleocapsids co-localized with microtubules during egress.  By 30 hpi the vast majority of the VP39-3xmCherry is observed inside the nucleus where it forms filamentous bands which can clearly be seen in the maximum-intensity z-projections (Figure 3.9C). Potentially similar nuclear filamentous structures have   97  previously been observed in cells infected with a virus expressing a VP39 fused to EGFP (216). The thicker part of these structures are found surrounding the virogenic stroma with the thinner filaments permeating the stroma in the regions of low nucleic acid density as detected by DAPI. This is more clearly seen in a 3-dimentional surface rendering of the nucleus (Figure 3.10). The thin filaments of VP39-3xmCherry correlate with the nucleocapsid assembly sites within the virogenic stroma. The thick bands, on the outside would therefore appear to be regions of nucleocapsid concentration and ODV assembly once they are transported from the virogenic stroma (see electron micrographs of the WT virus infected nucleus (Figure 3.10D, E). Far fewer cytoplasmic nucleocapsids were observed at 30 hpi but most remain associated with microtubules (arrows, Figure 3.9C).    98   Figure 3.9 Co-localization of VP39-3xmCherry nucleocapsids with microtubules during entry and egress.   99  A) Tn5B1 cells infected with VP39-3xmCherry showing mCherry labelled nucleocapsids (red) during entry at 0.5 hpi (top panels) and during egress at 24 hpi (bottom panels).Scale bar 5 μm. Each panel is a z-stack maximum projection of 6-7 sections that encompasses the entire fluorescence of each NC. The microtubules were detected with mouse monoclonal antibody against β-tubulin and corresponding secondary antibody goat anti-mouse immunoglobulin antibodies conjugated with alexa488 (green). The nucleus is stained with DAPI (blue). The enlarged region (center panel) shows potential regions of co-localization by the presence of yellow pixels (white arrows). White pixels (right panels) show regions of maximum co-localization as determined by Pearson’s coefficients of overlap (Leica confocal LAS X software). DAPI staining is not shown in the enlarged images. B) Comparison of the average percentage of cytoplasmic VP39-3xmCherry nucleocapsids (NCs) that co-localize with MTs at 0.25 and 0.5 hpi and 20 and 24 hpi. Each bar of the graph represents nucleocapsids from a total of 10 cells. Error bars represent standard error of the mean. C)  Confocal microscopy of Tn5b1 cells infected with VP39-3xmCherry virus at MOI 10 and fixed at 30 hpi. The image is a z-stack maximum projection through the entire cell showing the extensive ribbon structure of nucleocapsids through the nuclear virogenic stroma. Arrows in enlarged panels 1 and 2 show the location of cytoplasmic nucleocapsids. Staining of microtubules and the nucleus is the same as described in the legend panel A.        100   Figure 3.10 Analysis of a Tn5B1 nucleus cells infected with VP39-3xmCherry virus.   101  A-C show a cross section through a three-dimensional rendering of the nucleus of a representative Tn5b1 cell infected with VP39-3xmCherry virus. A) Surface rendering of the outside of the DAPI stained nucleus. B) Surface rendering of regions of VP39-3xmCherry within the nucleus. C) Merged image of A and B plus the central virogenic stroma (lighter blue) also stained by DAPI. Note the regions of VP39-3xmCherry infiltrating the virogenic stroma and the dense regions surrounding the stroma. Images A-C were generated using Imaris Software. D) Electron micrograph cross section of a Tn5B1 cell infected with WT virus showing the equivalent regions shown in C including the virogenic stroma (S), the regions of single nucleocapsid assembly within the stromal spaces (NC) and the regions of ODV assembly surrounding the virogenic stroma. E) Enlarged region of the area shown by the white box in D. Scale bar = 2 m       102  Yeast 2-hybrid analysis of the nucleocapsid proteins AC141 or VP39 with KLC or KHC  Danquah et al. (109) reported that AC141 and VP39 interacts directly with TPR motif of KLC of D. melanogaster by FRET-FLIM analysis. Therefore to further examine the association of nucleocapsid proteins with T. ni kinesin-1 molecules we used the yeast 2-hybrid system to determine whether there was a direct interaction between AC141 or VP39 with KLC or KHC. A similar approach was used to show that the vaccinia virus A36R membrane protein interacts directly with the TPR domain of KLC and US11 protein of HSV interacts directly with Stalk/Tail domain of KHC (122, 135). The combinations of the bait and prey constructs used and the results of the interactions are shown in Table 3.1. AC141 and KLC fusion with the binding domain showed auto-transactivation. Previous analysis has shown that deletion of the first 37 amino acids eliminates auto activation and this construct was used in the yeast 2-hybrid bait vector (∆AC141) (84). In addition to full length T.ni KLC or T.ni KHC the TPR domain of KLC and Stalk/Tail domain of KHC was cloned into both activation and binding domains. The overall results showed no direct interaction of KLC, KHC or their TPR or Stalk/Tail domains with either AC141 or VP39. Yeast 2-hybrid analysis using FP25 and BV/ODV-C42 fused to the binding domain also did not show any interaction with KHC or KLC (data not shown). The positive control T. ni KHC and KLC showed direct interaction between these two molecules and confirmed that these clones are of the KIF5B family   103  and combine to form kinesin-1. Thus, while co-localization and co-immunoprecipitation experiments showed association of AC141 and kinesin-1, analysis of direct interactions by Y2H experiments did not demonstrate direct interactions. This suggests that either other nucleocapsid proteins are involved in kinesin-1 interaction or cargo adapter proteins are required. It is also possible that nucleocapsid proteins might have a different conformation when they are part of a mature nucleocapsid. Expression of proteins utilizing a yeast two hybrid system always has the limitation of expressing the protein by itself, not in a nucleocapsid, and therefore may have a different conformation.     104  Table 3.1  Yeast two hybrid screening for direct interaction of KHC and KLC with AC141 or VP39    pBD Constructs    pAD Constructs Growth of Colonies on:   Leu & Trp    deficient Leu, Trp & His deficient Empty a Empty + - KHC b KLC + + KLC c Empty + + KHC Empty - - KLC AC141 + + TPR AC141 + - AC141 KLC + - AC141 TPR + - KLC VP39 + + TPR VP39 + - VP39 KLC + - VP39 TPR + - KHC AC141 + - Stalk/Tail AC141 + - AC141 KHC + - AC141 Stalk/Tail + - KHC VP39 + - Stalk/Tail VP39 + - VP39 KHC + - VP39 Stalk/Tail + - a Negative control, b Positive control, c auto-transactivation, + Growth, - no Growth     105  3.3 Discussion AcMNPV and other alphabaculoviruses are known to use actin polymerisation and de-polymerisation during entry to transport nucleocapsids to the nucleus upon infection by either BV or ODV (44, 217). However, the egress mechanism by which nucleocapsids escape the nucleus and migrate to the plasma membrane and bud to form BV remains to be resolved. Previous studies have shown that the AcMNPV protein AC141, a nucleocapsid associated protein, is required specifically for BV production. In addition, it was found that AC141 co-immunoprecipitated β-tubulin and co-localized with microtubules. Recently it was also shown that AC141 appeared to interact directly with the D. melanogaster kinesin-1 KLC TPR domain (109, 205). These prior studies therefore suggested that AcMNPV utilizes kinesin-1 motor proteins and microtubules for nucleocapsid transport during egress, in contrast to actin polymerization that is used during entry. In the current study, we further investigated this model by examining whether AC141 and other nucleocapsid proteins interact with kinesin-1 from the natural host T. ni, and we asked directly whether kinesin-1 was necessary for BV production. Our results show the close association of AcMNPV nucleocapsid proteins with T. ni kinesin-1 and microtubules and that kinesin-1 is required for BV production.  To analyze the interaction of nucleocapsid or nucleocapsid proteins with T. ni kinesin-1 and its component proteins KLC and KHC a multifaceted approach was taken. This   106  included cloning the T. ni kinesin-1 KLC and KHC genes, co-immunoprecipitation analysis, co-localization by fluorescence microscopy, siRNA inhibition, and yeast two hybrid analysis. We showed that HA-AC141 specifically co-immunoprecipitated host T. ni KLC (Figure 3.1). In reciprocal pull-down experiments, we found that WT virus AC141 specifically pulled down N- or C-HA-KLC by co-immunoprecipitation. Conversely, each of the tagged kinesin-1 molecules i.e., HA-tagged KLC and KHC, specifically pulled down WT virus AC141 (Figure 3.3). AC141 is a nucleocapsid associated protein but it is also present throughout the cytoplasm and is concentrated towards the cellular periphery regions (86). Therefore to determine if co-immunoprecipitation was pulling down nucleocapsids, immunoprecipitated complexes were analysed for the presence of other nucleocapsid proteins. We found that the major capsid protein VP39, as well as the capsid associated proteins BV/ODV-C42 and FP25 were specifically co-immunoprecipitated with HA-tagged KLC (Figure 3.8). Thus, these results support the conclusion that AcMNPV nucleocapsids associate with T.ni kinesin-1. The association of AC141 with KLC and KHC was further analyzed by fluorescence confocal microscopy and it was observed that HA-AC141 co-localized with Myc-tagged KLC and KHC mainly in the cellular periphery regions near the plasma membrane (Figure 3.4 and Figure 3.5). Analysis within these co-localized regions show high   107  Pearson’s overlap coefficients indicating that there is significant synchrony in intensity in areas of overlap and therefore strongly suggesting a functional co-localization. We further confirmed that the regions of co-localization between AC141 and KLC or KHC at the cellular periphery also co-localize with β-tubulin (Figure 3.6). It was previously shown, using fluorescence microscopy, that a virus expressing VP39 capsid protein fused to the fluorescent protein mCherry (VP39-3xmCherry) could be used to detect individual nucleocapsids interacting with actin filaments during virus entry (44). In this study, we used the VP39-3xmCherry construct to examine nucleocapsid association with microtubules during entry and egress (Figure 3.9). The results indicated that during entry and transport by actin, co-localization of nucleocapsids with microtubules was very limited, as expected. However during egress, the majority of nucleocapsids co-localized with microtubules. This result further supports the conclusion that kinesin-1 is involved in the transport of nucleocapsids along microtubules during egress.  VP39-3xmCherry was present at a high level in the nucleus at late times pi (Figure 3.9C). Intriguingly, the distribution in the nucleus shows distinct filamentous band structures permeating and surrounding the virogenic stroma suggesting that distinct sites of nucleocapsid and ODV assembly are separate from that of viral DNA replication (Figure 3.10). Compared with the extremely high levels of VP39-3xmCherry observed in the   108  nucleus (where nucleocapsid assembly occurs), the levels of VP39-3xmCherry associated with individual nucleocapsids in the cytoplasm appears much lower, as expected.  The co-immunoprecipitation and co-localization studies described here, in combination with previously published data (109, 205), suggests that nucleocapsids are transported by kinesin-1 on microtubules, prior to the final assembly and budding of BV at the plasma membrane. We further tested this model by performing siRNA experiments in which kinesin-1 was down-regulated. If kinesin-1 is involved in nucleocapsid transport to the plasma membrane, the down regulation of kinesin-1 should reduce the production of BV. Our results showed a clear reduction of BV production under these conditions (Figure 3.7C & F). Similar strategies involving siRNA down regulation of KLC, or use of a dominant negative mutant of KLC, have been used to show kinesin-1 KLC involvement in virion transport and processing of ASFV and adenovirus (137, 143). The current experiments represent the first direct demonstration of the importance of microtubule motor proteins in the production of baculovirus BV. Danquah et al. reported (109) that AC141 and VP39 but not ORF1629, directly interact by a FRET-FLIM analysis with the D. melanogaster KLC TPR motif. Our co-immunoprecipitation,  co-localization and siRNA results using the kinesin-1 KLC and KHC from the natural host T. ni   are consistent with the previous results and provide substantial evidence that these interactions are relevant in the naturally infected host. It is   109  of interest also that in a yeast 2-hybrid analysis, AC141 and VP39 failed to show any direct interactions with KLC and KHC (Table 3.1). It is possible that AC141 or VP39 need to be associated with the exported nucleocapsid to interact with kinesin-1 which would account for the negative result in the yeast 2-hybrid analysis. Alternatively, other nucleocapsid, nucleocapsid-associated proteins (89) or one or more cellular cargo adaptor proteins (110) may be required for directly interacting with kinesin-1. If AC141 or VP39 binds cellular adaptor protein which binds the TPR motif, that could explain the previous FRET-FLIM results (109). Specific viral proteins that bind kinesin-1 directly have been identified in vaccinia virus (A36R) and HSV-1 (US11), both of which utilize microtubules for anterograde transport (122, 135). Both US11 and A36R were shown to bind directly to KHC or KLC, respectively, as bacterially expressed proteins or by yeast 2-hybrid analysis. The results of this study show that kinesin-1 is involved in BV production and that AcMNPV nucleocapsid proteins are found in a complex with kinesin-1. However, it remains to be determined which viral protein is directly mediating this interaction. In conclusion, the cumulative data from this and prior studies indicate that anterograde transport of AcMNPV nucleocapsids utilizes the microtubule transport system. Because in this virus, viral entry is mediated by actin polymerization for retrograde transport (44, 45, 204), it is interesting that the virus takes advantage of two quite separate systems for trafficking nucleocapsids through the cytosol, to and from the nucleus. This difference in   110  trafficking is perhaps not surprising as AcMNPV also uses quite disparate mechanisms to enter and exit the nucleus. While incoming AcMNPV nucleocapsids interact with and are transported through nuclear pores (50), newly synthesized progeny nucleocapsids exit the nucleus not through the nuclear pore, but by budding through the nuclear envelope (85, 202). Indeed, enveloped nucleocapsids have been observed by EM in the cytoplasm of infected cells (85) and these envelopes are presumably derived from the nuclear membrane(s). Based on EM data, it was also speculated that these envelopes were rapidly lost (85). It is possible that microtubules are involved in transporting both the enveloped and non-enveloped nucleocapsids upon exit from the nucleus. Microtubule transport has a distinct advantage over actin transport due to its well-characterized directionality (142, 211). However, it is clear that additional studies will be necessary before we can fully understand the complex interactions that regulate and mediate nucleocapsid trafficking during viral entry and egress.   111  Chapter 4  AC141 co-localizes with ME53 and GP64 foci at the plasma membrane2   44.1 Introduction The baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) contains a large circular  134 kbp DNA genome encoding 156 proteins (218). During AcMNPV infection two forms of virions are produced, budded virus (BV) and occlusion derived virus (ODV). Nucleocapsids for both BV and ODV are synthesized inside the nucleus. During the late phase of infection nucleocapsids destined to become BV egress from the nucleus, traverse through the cytoplasm and bud from the plasma membrane. During the very late phase of infection, nucleocapsids are retained inside the nucleus to form ODV.BVs are responsible for rapid systemic spread of the infection within the host, whereas ODV are required for intra-host transmission and oral infection. Only a few genes of AcMNPV have been shown to be specifically required for efficient BV production and include gp64, ac141, me53, vubi, ac66, vp80 and gp41 (41, 82, 87, 88,                                               2 A version of this chapter will be submitted for the publication. Biswas S, Willis LG, Liu Y, de Jong J, Krell PJ, Theilmann DA. AC141 is a part of the budding foci of GP64 and ME53 at the plasma membrane    112  98, 100, 107).The proteins encoded from these genes are required at different stages of the BV synthesis pathway, including, egress from the nucleus, transit through the cytoplasm and budding from the plasma membrane. Ac141 (or exon0) is a late gene that encodes a nucleocapsid protein and on deletion reduces the BV production by more than 99% (86, 107). Electron micrographs have shown that in cells infected with an ac141 deletion virus nucleocapsids accumulate inside the nucleus (86). After egress from the nucleus nucleocapsids traverse though the cytoplasm possibly by utilizing the host microtubule transport system (109, 205, 219). In the final stage of nucleocapsid egress, they bud out from the GP64 containing regions at the plasma membrane to form BV (40). AcMNPV GP64 is an envelope glycoprotein and forms homotrimers and spans the plasma membrane of infected cells with its transmembrane domain (40, 220). Deletion of gp64 results in a virus that its unable to produce any infectious BV (41). AcMNPV me53 is expressed from immediate-early to very late times post-infection and is regulated by both early and late gene promoters. Deletion of me53 results in more than a 1000 fold reduction in BV production indicating that, like ac141 and gp64, it is also critical for this pathway (98). The functional domains of ME53 are not clearly defined but it does contain a nuclear translocation sequence required for nuclear localization during the early phase of infection (97). ME53 has been found to be associated with nucleocapsids and co-localizes with GP64 at the cellular periphery forming foci that are hypothesized sites for nucleocapsid budding (96). In the absence of infection, ME53   113  shows predominantly cytoplasmic localization and does not co-localize with GP64 to form foci at the plasma membrane. Therefore additional viral factors are required for the ME53 to co-localize with GP64. However, it is known that nucleocapsid formation is not required for the ME53 and GP64 budding foci to form (96).  As indicated above, deletion of either ac141 or me53 result in a similar phenotypic effect, that is, a greater than 99% reduction in BV production. However, both proteins have distinct cellular localization patterns. AC141 localizes in both the nucleus and cytoplasm but concentrates at both the nuclear and cytoplasmic peripheries forming a kind of double ring structure in infected cells (86). In contrast ME53 is evenly distributed in both the nucleus and the cytoplasm. Due to the similar deletion phenotype it is possible plasma membrane localized AC141 may be required for the formation or function of the ME53-GP64 nucleocapsid budding foci. In this report we analyzed the association of AC141 with both ME53 and GP64. Co-immunoprecipitation assays and confocal microscopy co-localization analyses showed that AC141 is a part of the budding complex formed with ME53 and GP64 at the plasma membrane. The results of this study provide further insights into the mechanisms by which nucleocapsids bud from the plasma membrane.     114  4.2 Results 4.2.1 Co-immunoprecipitation of AC141, HA-ME53, GP64 and VP39  Previous studies by confocal microscopy showed that ME53, GP64 and VP39 co-localize at the plasma membrane to form what appear to be budding foci (96). To determine if AC141 is a part of that complex and to further investigate this association of the proteins, co-immunoprecipitation experiments were performed. Sf9 and Tn5b1 cells were infected with me53KO-HA-ME53 (Figure 4.1) which expresses ME53 tagged at the N-terminus with the HA epitope. Protein complexes were pulled down with either AC141 polyclonal antibody or preimmune serum as a control and the co-immunoprecipitated protein complexes were analyzed by Western blot (Figure 4.2). The results showed that HA-M53, GP64 and VP39 specifically co-immunoprecipitated with AC141 but not with the preimmune serum control in both Sf9 and Tn5B1 cells (Figure 4.2A). To confirm these interactions reciprocal co-immunoprecipitation analyses were done on protein extracts isolated from Sf9 and Tn5b1 cells infected with either me53KO-HA-ME3 or WT virus. Protein complexes were pulled down with anti-HA beads and analysed by Western blot. The results showed that AC141, GP64 and VP39 co-immunoprecipitated from Sf9 and Tn5B1 cells infected with me53KO-HA-ME3 but not with WT virus which expresses an ME53 without an HA tag (Figure 4.2B). Co-immunoprecipitation data    115   Figure 4.1 Recombinant viruses used to study the interaction of AC141 with ME53, GP64 and VP39. The me53KO backbone has been constructed previously (98). The KO backbone was repaired with C-terminal HA-tag of ME53 (98) and C-terminal fusion of EGFP with ME53 (96). VP39 was fused with three copies of mCherry and inserted into the bMON14272 AcMNPV bacmid (219). The resulting bacmid expressed both native VP39 as well as VP39-3xmCherry.   116   Figure 4.2 Co-immunoprecipitation of AC141, HA-ME53, GP64 and VP39. A. Sf9 cells or Tn5B1 cells were infected with me53KO-HA-ME53which expresses HA-tagged ME53 and cells were harvested at 24hpi. Total cell lysates were immunoprecipitated with either AC141 polyclonal antibody or pre-immune serum as a control. Blots were probed with respective antibodies listed to the left. B. Sf9 cells or Tn5B1 cells were infected with either me53KO-HA-ME53 or WT virus which expresses ME53 without a HA tag, and cell lysates were harvested at 24 hpi. Total cell lysates were immunoprecipitated with anti-HA beads and probed with antibodies listed to the left. For every blot (A and B) input lanes were loaded with 0.25% of the total input and eluent lanes were loaded with 25% of the total volume.     117  suggest that ME53, AC141, GP64 and VP39 associate with each other and might form a complex. 4.2.2 Co-localization analysis of AC141, GP64 and ME53:GFP  Co-immunoprecipitation analysis showed that AC141, ME53, and GP64 were interacting in infected cells. To determine where in the infected cells these interactions were occurring, confocal microscopy was performed to analyze the co-localization of AC141, ME53 and GP64. Sf9 and Tn5b1 cells were infected with me53KO-ME53:GFP which expresses a ME53-GFP fusion protein as previously described (Figure 4.1) (96). Infected cells were analyzed at 24 hpi and all three proteins showed their expected cellular localization in both Sf9 (Figure 4.3A) and Tn5B1 cells (Figure 4.3B). In the non-Triton X-100 treated cells, GP64 (blue) forms foci at the cellular periphery region, whereas ME53:GFP and AC141 are located in the cytoplasm and nucleus with a higher concentration at the plasma membrane (86, 186). As previously shown ME53:GFP co-localizes with GP64 foci at the plasma membrane  (96) (cyan pixels indicated by arrows, Figure 4.3A and B). Even though AC141 and ME53:GFP are located in both the nucleus and cytoplasm, co-localization is predominately observed at the plasma membrane (yellow pixels, Figure 4.3A and B). There is very limited co-localization of AC141 and ME53:GFP inside the nucleus. Similarly AC141 also co-localizes with GP64 at the plasma membrane (pink pixels, Figure 4.3A and B). Analysis of all three proteins shows   118  that they co-localize at the plasma membrane at the GP64 foci (white pixels, Figure 4.3A and B). 4.2.3 Scatter plot and surface modelling analysis of co-localization of AC141, ME53:GFP and GP64  Co-immunoprecipitation and confocal microscopy showed that AC141 is a part of the complex at the budding sites formed by GP64 and ME53:GFP. Whole cell co-localization analyses of the budding complex proteins were done by scatter plot analysis (Figure 4.4A). For the scatterplot analysis the pixels between the straight lines on the diagonal are the pixels that have the highest intensity co-localizing pixels and are shown in white in the merged image. The enlarged image shows the layered co-localization pattern between GP64 and ME53:GFP, ME53:GFP and AC141, or GP64 and AC141 (Figure 4.4A). In every combination, the highest intensity co-localization pixels are at the cellular periphery regions. No co-localization of AC141 and ME53:GFP above background was observed inside the nucleus. To further define the layered arrangement of these proteins surface modelling of the confocal image was performed and the images suggested that the arrangement of these three proteins is that AC141 is adjacent to ME53:GFP and ME53:GFP is adjacent to GP64 (Figure 4.4B).   119   Figure 4.3 Co-localization of AC141 with ME53:GFP and GP64. A) Sf9 or B) Tn5B1 cells were infected with me53KO-HA-ME53  and fixed at 24 hpi. In A) and B) the top row show whole cell and bottom row shows enlarged region indicated by white square in the top right panel. AC141 was detected with AC141 rabbit polyclonal antibody against and corresponding goat anti-rabbit immunoglobulin antibodies conjugated with Alexa647 shown in red. GP64 was detected with mouse monoclonal antibody (AcV1) and corresponding goat anti-mouse immunoglobulin antibodies conjugated with Alexa405 shown in cyan. ME53:GFP fluorescence is shown in green. Regions of co-localization are shown in either blue (GP64 and ME53:GFP), yellow (ME53:GFP and AC141) or white (GP64, ME53:GFP and AC141) pixels. Size bar 2 m   120   Figure 4.4 Co-localization analysis of AC141 with ME53:GFP and GP64 using scatterplots and surface modelling. A) Co-localization analyses on the confocal images were done through scatterplot using Leica LAS X software. Maximum intensity co-localized pixels were identified by optimising the background levels and threshold levels. The axis represent level of intensity for each channel. The pixels within the white lines of the scatterplots show   121  pixels that have the maximum colocalization and intensity above the threshold (curved white line), and correspond to the white regions on the images. B) The apparent layered arrangement of GP64, ME53:GFP and AC141 of confocal images 1 and 3 was rendered using surface modelling in images 2 and 4 (Imaris Software v3.3). White boxes in images 1 and 2 are the enlarged areas in image 3 and 4.   122  4.2.4 Co-localization of individual nucleocapsids (VP39-3xmCherry expressing virus) with AC141, GP64 and ME53:GFP at the budding complex sites  If the complex of GP64, ME53 and AC141 at the cellular periphery represent budding foci, nucleocapsids should interact with them during the budding process. To examine the association of nucleocapsids with the complex, confocal microscopy experiments were performed using a VP39-3xmCherry expressing virus. VP39-3xmCherry virus co-expresses the major nucleocapsid protein VP39 and VP39 fused with 3 copies of mCherry (Figure 4.1). With this construct, individual red fluorescent nucleocapsids can be detected in the cytoplasm during late times post-infection (44, 186). Sf9 cells were infected with VP39-3xmCherry virus and fixed at 24 hpi but not permeabilized with Triton X-100. Under these conditions, both GP64 and AC141 are detected only at or near the cell surface (Figure 4.5A and B). VP39-3xmCherry (red) has very high expression inside the nucleus where nucleocapsids are assembled but is also detected at much lower levels in the cytoplasm. Individual nucleocapsids were observed to co-localize with AC141, shown in yellow pixels, adjacent to GP64 at the cellular periphery (arrows in the enlarged images, Figure 4.5A). GP64 and VP39-3xmCherry nucleocapsids are also found to co-localize at the cellular periphery as indicated by the pink pixels (Figure 4.5A). To examine the co-localization of ME53:GFP and VP39-3XmCherry, Sf9    123   Figure 4.5 Co-localization of VP39-3xmcherry labelled nucleocapsids with GP64, ME53:GFP and AC141 at the cellular periphery.   124  A) Sf9 cells were infected with VP39-3xmCherry which expresses VP39 fused with 3XmCherry and produces fluorescently labeled nucleocapsids. Cells were fixed at 24 hpi and AC141 was detected with ac141 rabbit polyclonal antibody and corresponding goat anti-rabbit immunoglobulin antibodies conjugated to alexa647 shown in green. GP64 was detected with mouse monoclonal antibody AcV1, which is dependent on the tertiary structure of GP64 complexes at the cell surface, and corresponding goat anti-mouse alexa405. VP39-3xmCherry fluorescence is shown in red. B) Sf9 cells were co-infected with ME53:GFP and VP39-3xmCherry repaired viruses and fixed at 24 hpi. AC141 was detected with a rabbit polyclonal antibody and corresponding goat anti-rabbit immunoglobulin antibodies conjugated to alexa 405. ME53:GFP is shown in green and VP39-3xmCherry is shown in red. For both A) and B) cells were not treated with Triton X-100 and under these conditions both GP64 and AC141 are detected only at or near the cell surface. Size bar = 2 µm   125  cells were co-infected with a virus expressing ME53:GFP and the VP39-3xmCherry virus. AC141, ME53:GFP and VP39-3xmCherry are shown in blue, green and red respectively (Figure 4.5B). The enlarged images showed yellow pixels of co-localization between ME53:GFP and VP39-3xmCherry, and pink pixels of co-localization between AC141 and VP39-3xmCherry (Figure 4.5B). Together these images support the conclusion that nucleocapsids co-localize with AC141, ME53 and GP64 at the cellular periphery. 4.2.5 Relocalization of ME53:GFP in cells co-transfected with plasmids expressing  GP64 and AC141  Previous analysis has shown that localization of ME53 to plasma membrane foci requires GP64 but not VP39 in virus infected cells. However, in cells transfected with plasmids expressing ME53:GFP and GP64 no co-localization between the two proteins was observed  even though GP64-foci were formed at the plasma membrane (96). These data showed that other viral factors were required for ME53 and GP64 co-localization at the plasma membrane foci. Therefore, we tested the possibility that AC141 may be the factor that is required for the localization of ME53 to GP64-foci. To test this hypothesis Sf9 cells were transfected with plasmids expressing ME53:GFP, GP64 or HA-AC141 (Figure 4.6A). Transfected cells were fixed but not treated (Figure 4.6B) with Triton X-100 to detect GP64 and HA-AC141 only at or near the cellular periphery. GP64 localizes to the   126  plasma membrane when expressed by itself or in the presence of ME53:GFP,  HA-AC141 or both proteins. Plasmid expressed HA-AC141 was observed to have a completely different cellular localization in transfected cells as compared to infected cells. HA-AC141 showed a punctate pattern predominantly in the cytoplasm. The punctate localization of HA-AC141 showed no change in the presence of ME53:GFP, GP64 or both proteins. As expected, ME53:GFP when expressed by itself is predominantly cytoplasmic but also with some nuclear localization. Similarly, when expressed with HA-AC141, localization of ME53:GFP showed no change. But surprisingly, when co-transfected with GP64, ME53:GFP localization showed more cytoplasmic aggregation towards the cellular periphery. In addition, a few regions of co-localization of GP64 and ME53:GFP could also be detected at the cellular periphery regions (see Merged ME53:GFP+GP64+DAPI, Figure 4.6C). When co-transfected with both HA-AC141 and GP64, ME53:GFP appeared to localize primarily to the cellular periphery regions. In addition, there appeared to be increased co-localization between ME53:GFP and GP64 in the presence of HA-AC141 (compare Merged, ME53:GFP+GP64+DAPI and ME53:GFP+AC141+GP64, Fig 4.6C). Based on these observations Pearson’s coefficients (Rr) values for co-localization of ME53:GFP and GP64 were measured in the presence or absence of HA-AC141. Co-localization between ME53:GFP and GP64 were statistically higher in the presence of HA-AC141 compared to its absence (Figure 4.6F).    127  The transfection of Sf9 cells with plasmids expressing ME53:GFP, GP64 or HA-AC141 was repeated except that the fixed cells were permeabilised with Triton X-100 to detect intracellular GP64 and HA-AC141 as well as  ME53:GFP (Figure 4.6D). Under these conditions ME53:GFP and AC141 gave the same cellular localization as observed in Figure 4.6B. In contrast, GP64 localizes to the nuclear envelope region as well as the plasma membrane and to a lesser extent through the cytoplasm. The nuclear envelope localization of GP64 did not change when co-expressed with ME53:GFP, HA-AC141 or with both proteins (Figure 4.6D). ME53:GFP in the presence of GP64 or both HA-AC141 and GP64 predominantly localizes to the cellular periphery. The results from the plasmid transfections suggests that co-expression of ME53:GFP and GP64 results in enhanced localization of ME53:GFP to the cellular periphery (Figure 4.6E). Co-expression of ME53:GFP and GP64 and HA-AC141 appears to increase the co-localization of ME53:GFP and GP64. However, compared to the budding foci in infected cells the ME53:GFP and GP64 co-localization pattern is different in plasmid transfected cells even in the presence of AC141.Therefore this suggests that additional viral protein(s) other than AC141 are required for budding foci formation.     128     129   Figure 4.6 Co-localization of HA-AC141, ME53:GFP and GP64 in plasmid   130  transfected cells treated with or without Triton X-100. (A) Plasmid constructs for expression of GP64, ME53:GFP and AC141 each under the IE1-hr promoter. (B) Sf9 cells were transfected with plasmids expressing HA-AC141, ME53:GFP and GP64; fixed at 24 hpt. GP64 was detected with mouse monoclonal (AcV5) and corresponding goat anti-mouse immunoglobulin antibodies conjugated to alexa647 and shown in red. HA-AC141 was detected with a rabbit polyclonal antibody against HA and corresponding secondary antibody goat anti-rabbit immunoglobulin antibodies conjugated to alexa647, alexa488 or alexa405 shown in magenta. ME53:GFP expression is shown in green. Top panel shows the localization of GP64 by itself, in the presence of ME53:GFP or HA-AC141 and in the presence of both. Similarly the HA-AC141 and ME53:GFP panel shows the localization of these  proteins in the presence of other protein(s) or by itself. C) Co-localization of GP64+HA-AC141, HA-AC141+ME53:GFP,  ME53:GFP+GP64 and GP64+HA-AC141+ME53:GFP. (D) Sf9 cells were transfected with plasmids expressing HA-AC141, ME53:GFP and GP64 and fixed at 24 hpt followed by treatment with Triton-X100. The proteins were detected with antibodies as mentioned above and shown in same color combination. Localization of GP64, HA-AC141 and ME53:GFP panels are shown in the same combinations as previously mentioned. E) Co-localization GP64+HA-AC141, HA-AC141+ME53:GFP,  ME53:GFP+GP64 and GP64+HA-AC141+ME53:GFP. (F) Pearson’s coefficient (Rr) values for the co-localization were calculated from 30 regions of interests i.e. 6 cells 5 ROI per cell.      131  4.2.6 Group I alphabaculovirus encodes a conserved PPEF/Y motif.  The size of Group I alphabaculovirus ME53 homologs varies from 448-483 amino acids and share a variable degree of  similarity (97) whereas the ME53 homologs of Group II alphabaculoviruses and betabaculoviruses are shorter by approximately 100 amino acids at the N-terminus and range in size from 289-390 amino acid residues (Figure 4.7A) (97). Alignment of the Group I ME53 amino acid sequences revealed a conserved PPEY or PPEF motif in the extra 100 amino acid region at the N-terminus (Figure 4.7B). The PPEY (or PPXY) motif present in the matrix protein of filoviruses and rhabdoviruses is required for recruitment of the host WW domain containing Nedd4 E3 ubiquitin ligase. This interaction is required for recruitment of the proteins in the host ESCRT pathway which are required for viral budding and the membrane scission process (165, 221-226). Thus, I hypothesized that the PPEF/Y motif in ME53 is required for recruitment of the ESCRT pathway and may have a role in the efficient budding process of nucleocapsids. 4.2.7 Mutation analysis of the ME53 PPEF/Y Motif and effect on BV production To study the role of the AcMNPV ME53 PPEF the sequence was mutated and four viruses were generated (Figure 4.8A). The PPEF motif was mutated to PPEA and PPEY and two deletions were constructed that deleted PPEF and VPPEFG (Figure 4.8A). For   132  each of the mutant viruses BV production was determined at 24 and 48 hpi. According to the hypothesis that PPEF is required for interaction with the ESCRT pathway, deletion of PPEF or PPEF to PPEA, the BV production was predicted to decrease. However, none of the ME53 PPEF mutants showed any decrease in BV production compared to  WT virus at 24 or 48 hpi (Figure 4.8B). One mutation, PPEF to PPEA, showed a significant increase in BV production at 24 hpi but no difference was observed at 48 hpi (Figure 4.8B). The rationale for why this mutation appears to cause an early increase in BV production is not known. The overall results however, suggest the PPEF region, despite its conservation does not play a significant role in BV production. BV production was assayed only in Sf9 cells and it is possible that any impact of this motif may be host specific.     133   Figure 4.7 Comparison of of alpha- and betabaculoviruses ME53 and conservation of a PPEF/Y motif. A). Relative conservation of ME53 amino acids in alpha- and betabaculovirus. Group I viruses have approximately 80 additional amino acids at the N-terminus of ME53. Schematic is taken from Liu et. al (97). B) Conservation of PPEF or PPEY motif in the 100 extra amino acids region at the N-terminus of alphabaculovirus ME53. AcMNPV ME53 protein sequence was used as query to blast the translated nucleotide database of family Baculoviridae.    134   Figure 4.8 Construction of ME53:GFP PPEF mutant viruses and analysis of BV production.   135  A. Schematic diagram showing the construction of the ME53:GFP PPEF mutant viruses were generated using the ME53 knockout bacmid that was previously constructed (96). B. Sf9 cells were infected with either WT virus, ME53:GFP or ME53:GFP PPEF mutant viruses and media containing the BV was collected at 24 and 48 hpi. Budded virus titre was determined by end point dilution assay and values represent an average of two biological repeats and two technical repeats. Error bars represent Standard Error.        136  4.3 Discussion The mechanism by which AcMNPV nucleocapsids egress from the nucleus to budding sites at the plasma membrane remains unclear but a number of viral proteins have been shown to be required. This includes AC141, ME53 and the envelope glycoprotein GP64, which have all been shown to be specifically required for the production of BV. GP64 is the BV envelope viral glycoprotein and forms foci at the plasma membrane prior to nucleocapsid budding. ME53 co-localizes with GP64 at the plasma membrane potentially forming what appears to be a budding complex (96). However, the association of ME53 with GP64 requires other viral proteins since plasmid expressed GP64 and ME53 do not co-localize. In this study we further investigated the interaction of GP64 with ME53 and in addition we determined if AC141 associates with the complex and if it is required for the ME53-GP64 interaction. In this study, similar to what has been previously shown by confocal microscopy, ME53 and GP64 co-localize at specific foci at the plasma membrane of infected cells. The association of ME53 and GP64 was further confirmed by co-immunoprecipitation analysis that showed that GP64 and ME53 are pulled down specifically from infected cells. In infected cells, AC141 concentrates at both the nuclear and cytoplasmic periphery and associates with ME53:GFP and GP64 at the plasma membrane. In addition, the association of AC141, ME53, GP64 and the major nucleocapsid protein VP39 was   137  confirmed by co-immunoprecipitation. Individual nucleocapsids, which were fluorescently labeled with mCherry, co-localized with AC141, GP64 and ME53:GFP at the cellular periphery (Figure 4.5). These data support the conclusion that AC141 is associated with the ME53-GP64 budding complex that was previously identified in de Jong et al. (96). Detailed co-localization scatter plot analysis and surface modelling suggests a layered pattern arrangement of these three proteins with AC141 adjacent to ME53 and M53 is adjacent to GP64 which is at the cell surface (Figure 4.4). When ME53 and GP64 are co-expressed in uninfected cells they do not co-localize at the cell surface or any other cellular location (96). This result indicated that to form ME53-GP64 foci other viral proteins were required. To determine if AC141 affects the cellular localization of ME53 and GP64, each of these proteins were transiently expressed separately or in combination and their cellular distribution was determined by confocal microscopy. Surprisingly AC141 had a very different cellular localization when expressed in the absence of virus infection. Transiently expressed AC141 was predominately cytoplasmic and forms multiple cytoplasmic foci. This pattern is reminiscent of many other viral and cellular RING domain proteins which are known to be ubiquitin E3 ligases (227). No difference in the cellular distribution of AC141 was observed when co-transfected with either or both ME53 and GP64. Similarly, ME53 and GP64 showed no difference in cellular distribution when co-transfected with AC141. In contrast to what was previously reported (96), when ME53:GFP was co-expressed with   138  GP64 it was observed to be more concentrated towards the plasma membrane instead of being evenly distributed through the cytoplasm. Co-transfection of ME53 with GP64 and AC141 results in an even more pronounced concentration of ME53 at the plasma membrane and enhanced co-localization of GP64 and ME53. The change in localization of ME53:GFP when co-transfected with GP64 only differs from prior results (96). Possible reasons could be the use of different cell lines or different fixation protocol. Analysis of ME53, GP64 and AC141 in cells treated with Triton-X100 gave similar results, that is, ME53 shows greater concentration at the plasma membrane when co-expressed with GP64 and enhanced by AC141. In addition, ME53 and GP64 exhibit enhanced co-localization at the plasma membrane. Interestingly, in Triton X-100 treated cells, GP64 shows concentration adjacent to or within the nuclear envelope similar to what is observed at the plasma membrane in non-triton-X100 treated cells. The nuclear envelope association has been previously observed by other laboratories [(228), Dr. G. Blissard, personal communication] but it is unknown what role this localization plays in the baculovirus infection cycle. These data suggest that AC141 assists in the re-localization of ME53 towards the cellular periphery regions resulting in co-localization with GP64. In infected cells, as shown by co-immunoprecipitation and confocal microscopy, AC141 interacts with ME53 and GP64 either directly or indirectly and co-localizes mainly at the cellular periphery. It is possible that AC141 foci function as sites of ubiquitination of a host protein or ME53 that is   139  responsible for the enhanced re-localization of ME53 towards the cellular periphery when co-expressed with GP64. The lack of distinct budding foci at the plasma membrane in transfected cells suggests that additional viral proteins are required. Ubiquitination has been shown to be required for virus budding in other well studied enveloped DNA or RNA viruses such as herpesvirus retrovirus, influenza, and filovirus. The ESCRT pathway is required for release and budding of matured enveloped virions including baculoviruses (178, 229, 230). Tsg101 (Tumor susceptibility gene 101), is a ubiquitin conjugating E2 enzyme variant protein, is a component of ESCRT-I pathway sorting of the proteins for incorporation into vesicles, which has been shown to be required for budding of HIV (166, 167, 231-234). During HIV infection Gag protein is ubiquitinated and recruits Tsg101 (166, 169, 235). Ubiquitinated viral protein(s) may interact with ubiquitin binding components of the ESCRT pathway to enable assembly of baculovirus foci containing ME53 and GP64 to enable nucleocapsid budding (221). Structural proteins from retroviruses, filoviruses and rhabdoviruses also recruit ESCRT components via what are known as L (late-assembly) domains which contain P(T/S)AP or PPXY motifs  (165, 221, 223, 235-238). The L domains interact with ESCRT pathway VPS or HECT ubiquitin ligase enzymes and assist in virus budding. ME53 contains a PPXY motif N-terminal region which is rich in proline residues that is conserved in all alphabaculovirus ME53 homologues (97). However, mutation of the PPXY motif did not have any effect on BV production suggesting that HECT ubiquitin ligase might not be   140  required for the budding (Fig 4.8). Therefore AC141 as a potential E3 ubiquitin ligase may ubiquitinate viral proteins to recruit ESCRT pathway proteins to enable budding. The cellular VPS4 is an ATPase called AAA protein (ATPase associated with various cellular activities) which hydrolyze ATP and disassemble ESCRT-III and is required for the scission from the plasma membrane during the final stage of HIV budding (231) (239, 240). Recently it has been shown in AcMNPV-infected Sf9 cells, overexpression of a dominant negative form of S. frugiperda VPS4 reduces BV production by more than 90% (178). This result suggests that VPS4 may be playing a similar role in AcMNPV nucleocapsid budding as has been observed with HIV-1(237). Recruitment of AC141 with ME53 and GP64 may therefore involve the recruitment of cellular ESCRT components to enable virus budding. The results showed that AC141 associates with ME53, GP64 and VP39, also in addition AC141 is localized adjacent to ME53 and GP64 in the cellular periphery regions. ME53:GFP when co-expressed with GP64 and AC141, ME53:GFP localization was more concentrated towards the plasma membrane instead of being evenly distributed through the cytoplasm. In conclusion the results from this study showed that AC141 is a part of the ME53-GP64 budding foci and might assist in formation of budding complexes.    141  Chapter 5  AC141, a potential E3 ubiquitin ligase, interacts with viral ubiquitin and AC66 to facilitate nucleocapsid egress3   55.1 Introduction AcMNPV has a large double stranded DNA genome that is packaged into rod shaped nucleocapsids which are utilized to form two types of virions, BV and ODV. During the late stage of infection, nucleocapsids egress from the nucleus, traverse through the cytoplasm to the plasma membrane from which they bud to form BV. At the very late phase of infection some nucleocapsids are retained inside the nucleus to form ODV. BV obtain their envelope by budding from the plasma membrane whereas the ODV  envelope is derived from the inner nuclear membrane (201). BV mediates the systemic spread of the viral infection between insect tissues and cells, whereas, ODV are utilized for inter-host transmission and they are specifically required for initiating the infection of the insect by binding to the midgut epithelial cells. The mechanism by which nucleocapsids                                               3 A version of this chapter will be submitted for the publication. Biswas S, Willis LG, Fang M, Nie Y, Theilmann DA. Nucleocapsids derived from Autographa californica nucleopolyhedrovirus budded virus and occlusion derived virus are differentially modified by  viral ubiquitin.   142  are designated to become BV or ODV is unknown but some form of signalling to enable the differential trafficking is assumed to occur.  A wide variety of cellular processes are regulated by post-translational modifications of proteins by ubiquitin. The ubiquitination pathway initiates with a thiol-ester linkage between ubiquitin activating E1 enzymes and the C-terminal glycine of ubiquitin. The activated ubiquitin is transferred to a ubiquitin conjugating E2 enzyme. The transfer of ubiquitin from E2 to a substrate is catalyzed E3 ubiquitin ligases (106, 144, 147). Substrate specificity for ubiquitination is determined by the E3 ubiquitin ligases and that is why mammals have hundreds of E3 proteins but only approximately thirty-five E2s and two E1s (146, 147, 241). E3 enzymes are classified into three families according to their structure and function: 1) the homologous to E6AP C-terminus (HECT) domain family, 2) the really interesting new gene (RING) domain family and 3) the RING-between-RING (RBR) domain family (146, 241). Viruses utilise the host ubiquitination system at different stages of the infection cycle and are known to either encode their own E3 ubiquitin ligases or encode adapter protein(s) that recruit the cellular E3 ligases (155, 163).  AC141 (previously known as exon0) is a nucleocapsid associated protein, expressed at late times post infection (pi) and is specifically required for BV production (107). Deletion of ac141 reduces the BV production by more than 99.99%. Electron   143  micrographs of cells transfected with ac141 deleted bacmids show that nucleocapsids are not able to egress from the nucleus (86, 107). AC141 contains a C-terminal RING domain that is homologous to those found in E3 ubiquitin ligases and deletion analysis has shown it is required for optimal BV production (84). The predicted RING motif of AC141 is conserved among sequenced alphabaculovirus genomes which infect lepidoptera (107). The consensus sequence of the AC141 RING motif C3C(Y/F)C4 is different from the C3HC4 motif encoded by most other cellular or AcMNPV RING domain proteins (107). In the AC141 motif a tyrosine or phenylalanine replaces histidine and there is an additional conserved cysteine residue adjacent to the third cysteine. The RING motif binds two zinc atoms in a cross-brace finger configuration (242). Ubiquitin is a small 76 amino acid protein that is present in cells in either a free form or covalently attached to other proteins. Ubiquitin is linked to one lysine or to the multiple lysine residues of a substrate resulting in mono- or multi- ubiquitination respectively. Ubiquitin also has intrinsic lysine residues which can be used to form polyubiquitin chains (152, 243). Polyubiquitin chains linked to the various ubiquitin lysines required for different cellular processes. For example attachment of K48 polyubiquitin chains to substrate proteins is a signal for degradation via the 26S proteasome mediated pathway (152, 243, 244). K63 linked polyubiquitination of proteins is a signal for protein trafficking, or for a DNA damage response (243, 244). Baculoviruses are a unique group of viruses as they encode their own ubiquitin (vubi). AcMNPV vUbi is 77 amino acids   144  long and has 76% amino acid identity with cellular ubiquitin (cUbi) (99). All the cUbi lysine residues are conserved in vUbi. vUbi also has an extra lysine residue at position 54. During the AcMNPV life cycle, vubi is expressed as a late gene. Initial analysis of vUbi function showed that a frame shift mutation did not have any impact on virus replication but BV production was reduced 5-10 fold (100, 101). Biochemical analysis showed that cUbi and vUbi is attached to the inner side of the BV envelope via a phospholipid anchor (103). Biochemical in vitro analysis showed that vUbi, was less efficient than cUbi in supporting ATP-dependent proteolysis using mammalian E1, E2 and E3 enzymes. Analysis of the pathway showed that vUbi and cUbi were functionally indistinguishable in the E1 and E2 steps of ubiquitin conjugation. However, the rate of transfer by cellular E3 ubiquitin ligase of vUbi to a substrate was significantly lower than for cUbi (104). Thus the transfer of vUbi to a substrate might require a different E3 ligase or a different mechanism of interaction between E3 ligase and E2 conjugated with vUbi. The AcMNPV genome encodes a number of proteins that are predicted to be E3 ligases which all contain a classic cellular C3HC4 RING domain motifs and include, IE2, PE38, IAP1 and IAP2 (161, 245). IE2 and PE38 regulate gene expression, possibly through the ubiquitin pathway (246, 247). The AC141 RING domain, as indicated above, is different from that of cellular E3 proteins. As both AC141 and vUbi are required for BV production it was hypothesized that AC141 may be a ubiquitin E3 ligase that specifically utilizes vUbi and this interaction is required for optimal BV production. The results   145  described in this chapter show that AC141 and vUbi interact and both are required for optimal BV production. In addition, nucleocapsid proteins from BV were found to be differentially viral-ubiquitinated compared to nucleocapsids from ODV. We also show that the nucleocapsid protein AC66 associates with vUbi which could potentially  provide a mechanism by which nucleocapsids are designated for nuclear egress and subsequent BV formation.     146  5.2 Results 5.2.1 Comparison of the RING motifs of AC141 with other viral and cellular E3 ligases The consensus sequence of AC141 RING motif is C-X2-C-X14-C-C-X-Y/F-X2-C-X2-C-X13-15-C-X2-C which is conserved among all alphabaculoviruses and is different from other viral or host RING motifs (Figure 5.1A). Alignment with other baculovirus and eukaryotic RING motifs shows that the AC141 RING has an extra conserved cysteine residue adjacent to the third cysteine and histidine is replaced with tyrosine or phenylalanine (Figure 5.1A). The only other eukaryotic RING motifs that were identified to have a tyrosine or phenylalanine in place of histidine were found in the NOT4 protein family and a RING finger motif from a HPC protein found in Leishmania major. The NOT4 protein forms a complex with carbon catabolite repressor 4 (CCR4) and functions as a transcription regulator, and is involved in translational repression and protein quality control (248-250). Analysis of the NOT4 motifs suggested the tyrosine was not required and the cross brace RING structure utilized the conserved C4C4 amino acids (251-253). E2 hydrophobic residues bind the grove in the RING domain which is formed by alpha-helix and two zinc coordinating loops (254). The conserved cysteines along with other adjacent amino acids form the loops in the RING domain (254). The difference in these amino acids might also suggest specificities for particular E2s or E2s conjugated to vUbi.    147  AcMNPV vUbi has 75% amino acid identity with cellular Sf9 ubiquitin (Figure 5.1B). All the lysine residues that are required for the polyubiquitin chain formation are conserved (shown by black arrows Figure 5.1B). Homology modelling of vUbi using the known structure of cellular ubiquitin shows that the majority of the non-conserved amino acids are on a single face as previously predicted (104) (Figure 5.1C). The surface specificity suggests that vUbi interacts with different protein(s) on that surface which are different from cUbi. The structure of E3 ligase (RNF4) bound to E2 (UbcH5A) conjugated to ubiquitin reveals the amino acid residues in ubiquitin that interacts with E2 and E3 (242). The ubiquitin amino acids L8-11, L71, R72, I44, H68 and V70 either interacts with or are in close proximity toE2 and E3 residues (242). The E34 residue of ubiquitin forms a hydrogen bond with the histidine (zinc coordinating) of the RING and E34 along with G35 and I36 interacts with the RING domain amino acid side chains (242). All these ubiquitin amino acids except I36 are conserved in AcMNPV vUbi which might suggest a similar mechanism for transfer of vUbi from E2 to the substrate.  The unique structure of AC141 may permit the selective interaction with an E2 specifically charged with vUbi as opposed to cUbi. The crystal structure of the E3 ligase RNF4 in complex with an E2 and cellular ubiquitin has shown that the histidine of the RING motif forms a hydrogen bond with E34 of ubiquitin (242). AC141 has a tyrosine in place of histidine so this interaction may prevent or allow for alternate interactions that    148   Figure 5.1 Alignment of the AC141RING domain sequence and structural comparison between v-Ubi and c-Ubi.   149  Alignment of alphabaculovirus AC141 RING domains with selected RING domains from other baculovirus and eukaryote proteins. Amino acids that are identical in all RING domains are highlighted in yellow. The additional conserved cysteine found in AC141 and NOT4 related proteins is shown in green. The tyrosine or phenylalanine residues found in place of normal histidine are highlighted in cyan and red respectively. The eukaryotic consensus conserved histidine residues are highlighted in brown. The virus from which the AC141 comes or the name of the eukaryotic protein is shown the the left. The consensus AC141 and eukaryotic RING motifs are shown below the alignment. B. Alignment of AcMNPV vUbi and Sf9 cUbi. Identical amino acids are shown in magenta and differences in yellow. The conserved lysine residues are indicated with black arrows and the additional vUbi lysine residue K54 is marked with a red arrow. C. Homology model of vUbi based on the known structure of Homo sapiens cellular ubiquitin (1UBQ ). The left panel shows one surface of the predicted viral ubiquitin molecule and right panel shows the opposite surface. Identical amino acids are shown in magenta and differences in yellow and the C-terminal diglycine is shown in blue. Modelling was performed using Swiss-Model (https://swissmodel.expasy.org/).         150   would favour vUbi. In support of this the AC141 RING tyrosine is indispensable to its function and cannot be replaced (Dai and Theilmann, unpublished data). We therefore hypothesized that AC141 acts as a potential E3 ubiquitin ligase specifically interacting with an E2-vUbi and ubiquitinates substrates to enable the production of BV. 5.2.2 Analysis of ac141 and vubi single and double knockouts on BV production To study the interaction between AC141 and vUbi a series of single or double knockout viruses were constructed where ac141 or vubi genes were knocked out (KO) followed by repair with either one or both genes. The ac141 and vubi repair genes included either the C-terminal HA or the Myc epitope tags respectively. These viruses were named ac141KO, vubiKO, vubiKO-Myc-vubi, ac141+vubi2xKO, 2xKO-HA-ac141+Myc-vubi, 2xKO-HA-ac141 and 2xKO-Myc-vUbi (Figure 5.2). To determine and compare the impact of deleting either one or both ac141 and vubi genes, time course experiments were conducted to analyse the BV production. Cells were transfected with purified bacmids from above mentioned viruses and in addition a control transfection of a gp64 deletion virus which is unable to produce BV (40, 41, 43). BV production of 2xKO-HA-ac141+Myc-vubi and vubiKO-Myc-vubi were equivalent to WT virus at 24, 48, 72 and 96 hpt (Figure 5.3). The vubi knockout viruses, vubiKO and 2xKO-HA-ac141, had equivalent BV production and was only 0.26% of WT virus. The ac141 knockout viruses,    151   Figure 5.2 Construction of ac141 and vubi single (1x KO) and double knockout (2x KO) viruses.   152  The ac141 KO virus was generated by deleting the ac141 ORF and replacing it with the zeocin resistance gene under control of theEM7 promoter. Similarly the vubi KO virus was generated by replacing the vubi ORF with the chloramphenicol resistance gene. A double knockout virus was generated knocking out both ac141 and vubi with zeocin and chloramphenicol resistance genes respectively. The three KO viruses were repaired using pFAcT-GFP or pFAcT-GFP containing HA-ac141,  Myc-vubi or both genes. pFAcT-GFP contains the egfp marker gene as well as polyhedrin. The resulting viruses were ac141+vubi2xKO, 2xKO-HA-ac141+Myc-vubi, 2xKO-HA-ac141, 2xKO-Myc-vubi, ac141KO, ac141KO-HA-ac141, vubiKO, and vubiKO-Myc-vubi.     153   Figure 5.3 Time course analysis of BV production by ac141 and vUbi single and double gene KOs. BV production was determined at 12, 24, 48, 72 and 96 hpt. Sf9 cells were transfected with 2 g of bacmid DNA of each virus. The media containing the BV were collected at the different time points and assayed for BV production by 50% end point dilution assay (TCID50). Each data point represents a set of four biological repeats and error bars represent standard error.     154  ac141KO and 2xKO-Myc-vubi, had BV production was reduced to only 0.005% of WT virus which is similar to that described previously (86, 107). The double knockout virus ac141+vubi2xKO upon transfection did not produce any detectable BV as was found for the gp64KO virus phenotype. Therefore the cumulative effect of knocking out both vubi  and ac141  results in the complete elimination of even the small level of virus observed with the single gene KO viruses.  5.2.3 Co-immunprecipitation of AC141 and vUbi  The combined impact of deleting both ac141and vubi to eliminate BV production suggests they may be interacting. To study the possible association between AC141 and vUbi, co-immunoprecipitation experiments were performed. Sf9 cells were infected with virus 2xKO-HA-ac141+Myc-vubi expressing N-terminal HA-tagged AC141 (HA-AC141) and N-terminal Myc-tagged vUbi (Myc-vUbi). As a control Sf9 cells were infected with WT virus and vubiKO-Myc-vUbi which expresses only Myc-vUbi. Protein complexes were immunoprecipitated with anti-HA antibodies and eluted material was analyzed by Western blot. The input lanes showed that there is extensive ubiquitination of proteins with vUbi (Figure 5.4A). HA-AC141 specifically co-immunoprecipitated Myc-vUbi ubiquitinated proteins from 2xKO-HA-ac141+Myc-vubi virus infected cells and not from the control samples (Figure 5.4A). The Western blot identified two    155   Figure 5.4  Co-immunoprecipitation of HA-AC141 and Myc-vUbi on pulling down HA-AC141. A. Sf9 cells were infected with 2xKO-HA-ac141+Myc-vUbi, AcMNPV WT virus and Myc-vUbi. Infected cells were harvested at 24 hpi and total cell lysates were pulled down with HA-beads and subjected to Western blot analysis. Input lanes were loaded with 0.25% of the input and eluent lanes were loaded with 20% of the eluent. Blots were probed with antibodies indicated on the left respectively. B. Sf9 cells were infected with 2xKO-HA-ac141+Myc-vUbi, AcMNPV WT virus and ac141KO-HA-ac141. Infected cells were harvested and total cell lysates were pulled down with anti-Myc antibody bound to Protein-G beads. Input lanes were loaded with 0.25% of the total input and eluent lanes were loaded with 20% of the total eluent. Blots were probed with the antibodies indicated on the left respectively. C. Predicted ubiquitination site, K87 of AC141 showing its location in the potential substrate binding region of AC141.   156  prominent proteins of approximately 35 and 45 kDa along with other minor higher molecular weight proteins. These results showed that HA-AC141 associates either directly or in a complex with proteins that are viral-ubiquitinated. Reciprocal co-immunoprecipitation was also done to confirm the association of AC141 and Myc-vUbi. The input lane showed numerous proteins that are ubiquitinated with Myc-vUbi (Figure 5.4B). The viral ubiquitinated proteins were specifically pulled down with anti- Myc but HA-AC141 did not co-immunoprecipitate with Myc-vUbi. This would suggest that only a small fraction of Myc-vUbi might interact with HA-AC141. 5.2.4 Mass spectrometric analysis of proteins co-immunoprecipitated with HA-AC141 to identify potential substrates and viral-ubiquitination sites Mass spectrometry (MS) analysis on the co-immunoprecipitated material of HA-AC141 was done to identify the viral and host proteins that interact with AC141. MS analysis included the total pull down material and material gel purified from the region containing the prominent 35 and 45 kDa proteins (Figure 5.4A). Table 5.1and Table 5.2 show the list of viral or host proteins identified by MS to be pulled down with HA-AC141 with the corresponding number of peptides and percentage coverage. These proteins are potential substrates of HA-AC141 and the proteins marked with an asterisk are nucleocapsid proteins, or proteins that are known to be involved in nucleocapsid egress. The major viral nucleocapsid proteins were as expected, AC141 and in addition, VP80, GP41,   157  P78/83 and AC66. VP80 interacts with the F-actin cytoskeleton and is required for the movement of nucleocapsids from the virogenic stroma to the nuclear periphery regions (82). GP41 is a tegument protein and is required for the nucleocapsid egress from the nucleus for efficient BV production (88, 95). P78/83 (or ORF1629) is a nucleocapsid protein and is required for the nuclear actin assembly and is located at the base of the nucleocapsid (48, 255). AC66 is a nucleocapsid protein and is required for BV production. Deletion of ac66 results in nucleocapsids that do not egress from the nucleus (87, 89). Proteins specific to the 35 to 45 kDa region are shown in Table 5.1. The primary proteins identified were AC141, GP37, AC114 and AC51, but of these only AC141 is essential for BV production.  The MS analysis of AC141-coimmunprecipited proteins was also utilized to identify potential ubiquitination sites on co-immunoprecipitated proteins. Ubiquitinated peptides increase in mass by the terminal GG from ubiquitin. The C-terminus vUbi however, is GGY but it is believed that any C-terminal modified ubiquitin like molecules are trimmed by isopeptidases prior to any ubiquitin ligase event. It is known that ubiquitin even with one extra amino acid at the C-terminal is cleaved to make ubiquitin functional (256, 257). In case the tyrosine was not cleaved, peptides were also analysed for a GGY modification. Ubiquitinated peptides were observed only in the gel purified 30-50 kDa region and they were identified to originate from AC141. AC141 was found to be ubiquitinated at K87 (Table 5.3). Interestingly, two different mass shifted peptides from    158  Table 5.1  List of most the prominent AcMNPV proteins that co-immunoprecipitated with HA-AC141 and identified by mass spectrometry. AcMNPV protein  O RF No. of Peptides  Sequence Coverage (%)  Molar Mass (kDa) Modification site  (K) and type (GlyGly or GlyGlyTyr) Required for BV production (Yes/No/Unknown) and references HA-AC141 pull down Control  HA-AC141 pull down  Control  AC141 Ac-141 8 0 29.1 0 30.1 None Yes (86, 107) VP80 Ac-104 11 0 20.3 0 79.8 None Yes (82) VP39 Ac-89 8 0 28.8 0 38.9 None  Unknown (258) AC18 Ac-18 6 0 19 0 40.8 None No (259) AC142 Ac-142 6 0 14.9 0 55.4 None Yes (260) P78/83 Ac-9 5 0 11.8 0 60.7 None Yes (48, 261) GP41 Ac-80 5 0 19.3 0 45.3 None Yes (88) vUbi Ac-35 2 0 23.4 0 8.6 None Yes (100) AC66 Ac-66 2 0 2.8 0 93.9 None Yes (87)  AC141  Ac-141  19       7  61.3  22.6  30.1 K87-GlyGlyTyr & K87-GlyGly  Yes (86, 107) GP37 Ac-64 8 3 45 17.2 34.8 None Unknown (262) AC114 Ac-114 7 3 20.8 9.7 49.3 None Unknown ODV-EC27 Ac-144 6 3 49.7 27.6 33.52 None Unknown   159  Table 5.2 List of the most prominent cellular proteins that co-immunoprecipitated with HA-AC141 as identified by mass spectrometry. Name of the host protein (Spodoptera frugiperda) Reference Sequence ID No. of Peptides Experimental/ Control Sequence Coverage (%) Modification site (K) and type Nucleotide binding domain of Hsp70, actin super family and sugar kinase. XP_002138008.1  13/0 27.8 None CRE-CCT-8 protein (Chaperonin like super family) XP_003093105.1  13/0 28.6 None replication protein A1 NP_001036938.1  12/0 27.2 None PREDICTED: T -complex protein 1 subunit delta-like XP_003740901.1  12/0 35.5 None peroxisome assembly factor-2 (peroxisomal-type atpase 1), partial  XP_001647852.1  12/0 18.7 None AGAP006958-PA (Hsp90 protein) XP_308800.3  12/0 19.5 None elongation factor 1-alpha XP_003380597.1  11/0 35.6 None PREDICTED: prostaglandin reductase 1-like XP_004932225.1  11/0 27.2 None PREDICTED: Actin, cytoplasmic-like isoform 1 XP_002742029.1  10/0 42.7 None PREDICTED: glutathione S-transferase D7-like, partial XP_004930497.1  10/0 44.3 None GJ23842 (Unknown protein) XP_002053370.1  9/0 60.6 None ribosomal protein S3 NP_001037253.1  9/0 44.5 None PREDICTED: GMP synthase [glutamine-hydrolyzing]-like XP_005109065.1  9/0 24 None PREDICTED: lamin-C-like XP_004930078.1  8/0 20.4 None glycerol-3-phosphate dehydrogenase NP_001014994.1  8/0 53.6 None PREDICTED: prostaglandin reductase 1-like XP_004932223.1  8/0 27.5 None PREDICTED: dynamin-like 120 kDa protein, mitochondrial-like XP_003702505.1  7/0 33.5 None    160  Table 5.3 Ubiquitinated peptides modified at K87 of AC141 and the quantification values. Protein ID gi|700275693 Position of viral or cellular ubiquitination 87 Localization probability of  YGG/ GG 0.999 / 1.0 Posterior error probabilities and false discovery rate for YGG / GG 1.55999E-16 / 4.29E-75 TyrGlyGly (K) Probabilities  IENK(1)FFYYYDQCADIAKPDR TyrGlyGly (K) Score differences IENK(60.05)FFYYYDQCADIAK(60.05)PDR GlyGly (K) Probabilities IENK(1)FFYYYDQCADIAKPDR GlyGly (K) Score differences IENK(100.14)FFYYYDQCADIAK(100.14)PDR     161  the same AC141 sequence were identified, corresponding to a GGY and GG modification at K87. Proteins identified from total pull down eluent are highlighted in grey and proteins identified from 30-50 kDa gel section are highlighted in magenta. The K87 ubiquitination site is located in the potential substrate binding region of AC141 (Figure 5.4C). Our surprising result therefore suggests that vUbi might get attached to AC141 with a novel isopeptide linkage of tyrosine to lysine. Overall these results support our hypothesis and show that AC141 and vUbi interact during viral infection. 5.2.5 Mutational analysis of AC141 K87 vUbi ubiquitination site to determine effect on BV production Co-immunoprecipitation and MS results showed that AC141 interacts with vUbi and AC141 is ubiquitinated at K87. Auto-ubiquitination of E3 ubiquitin ligases can act as a regulatory mechanism and can result in either enhancing substrate ubiquitination or signaling its own degradation (263-267). To investigate the significance of the AC141 ubiquitination mutant viruses were generated that mutated the K87 of HA-AC141 to arginine (K87R) or alanine (K87A) (Figure 5.2). A time course of virus production was performed and showed that mutation of AC141 K87 to arginine or alanine altered temporal aspects of BV production (Figure 5.5). In WT virus infected cells, BV production initiates between 15 to 18 hpi with an exponential increase between 21-27 hpi.    162   Figure 5.5 Figure 5.5 Effect of AC141 K87 mutations on BV production. Sf9 cells were infected with WT virus, HA-AC141 and mutant viruses (K87R and K87A) at an MOI of 5 and BV production was determined at 1, 12, 15, 18, 21, 24, 27, 36, 42 and 48 hpi. The media containing the extracellular virus or BV were collected at each time point and assayed for viral genomes numbers by droplet digital PCR. Each data point shown represents a set of two biological repeats and two technical repeats each. Error bar represents standard error.     163  In comparison the K87R and the K87A viruses both initiated BV production at the same time as WT virus with an exponential increase between 18-24 hpi, 3 hours earlier than WT virus. Compared to WT virus both the mutant viruses produce nearly a log higher level of BV by 21 hpi. These results suggested that mutation of K87 to prevent AC141 ubiquitination, results in earlier BV production. 5.2.6 Western blot analysis of purified BV and ODV for viral and cellular ubiquitinated proteins If, as we hypothesized, vUbi is required to differentiate nucleocapsids destined for BV or ODV, potentially catalyzed by AC141 then the two forms of virions should be differentially ubiquitinated. To address this hypothesis, BV and ODV were purified from vubiKO-Myc-vUbi infected Sf9 cells by sucrose density gradient and separated into envelope and nucleocapsid fractions. Total and fractionated protein samples were analysed by Western blot. The results showed that BVs contained approximately 4 fold higher levels of vUbi than ODV (Figure 5.6A). In addition, fractionated samples showed that viral-ubiquitinated proteins were only in the nucleocapsid fraction. In the nucleocapsid fraction of BV but not in the ODV, there was a specific viral-ubiquitinated major band of approximately 100 kDa (Figure 5.6A). In addition to the viral-ubiquitinated 100 kDa major band (←), there are other minor bands (*) of approximately 57 kDa, 43 kDa, and 19 kDa that are detected upon long exposure (Figure 5.5A). To    164   Figure 5.6 Western blot analyses of the isolated BV and ODV for viral ubiquitinated proteins. BV and ODV were purified from Sf9 cells that were infected with vubiKO-Myc-vbi. Purified BV and ODV were fractionated into envelope (ENV) and nucleocapsid (NC) fractions and separted by SDS-PAGE and analyzed by Western blotting. The blots were probed with anti-Myc antibody to identify viral ubiquitinated proteins or anti-cellular ubiquitin antibody to identify proteins ubiquitinated by cellular and viral ubiquitin. Control blots to confirm the efficiency of fractionation are shown below using antibodies against the nucleocapsid protein VP39, the BV envelope protein GP64, and the ODV envelope protein PIF-1.   165   examine total ubiquitination levels in purified BV and ODV a duplicate Western blot was performed and probed with anti-cUbi which detects both cellular and viral ubiquitin (Figure 5.6B). The results showed that BV was 80 fold more ubiquitinated than ODV. Most of the cellular and viral ubiquitin detected with anti-cUbi is in the high molecular weight proteins of the nucleocapsid fraction of both BV and ODV. Unlike the Myc-vUbi blot, ubiquitin was also detected in the envelope fraction of BV but not ODV. The ubiquitin detected with anti-Ubi in the BV envelope must be predominately cellular in origin since no Myc-vUbi was detected in the BV envelope fraction (Figure 5.6A). To ensure correct fractionation of BV and ODV blots were probed with antibodies to the nucleocapsid protein VP39, BV envelope protein GP64 and the ODV envelope protein PIF-1 (Figure 5.6A&B). 5.2.7 MS analysis of purified BV and ODV for potential viral-ubiquitinated peptides Western blot analysis showed that an approximately 100 kDa protein was specifically ubiquitinated in BV and not ODV. To identify this protein MS analysis was performed to identify proteins in the 100 kDa band purified BV proteins from 85-110 kDa were isolated by PAGE and analysed by MS   The list of viral proteins from this region is shown in Table 5.4. There are very few viral BV structural proteins in this size range and the most prominent proteins were VP80, AC66 and F protein. However, no ubiquitination    166   Table 5.4 List of the most prominent AcMNPV proteins in the region of 85-110 kDa of purified BV  and identified by mass spectrometry. Name of the AcMNPV protein ORF Nucleocapsid or envelope proteins No. of Peptides Sequence Coverage (% ) Molecular Weight (kDa) Predicted modification site (K) and type (GlyGly or GlyGlyTyr)  Required for BV production (Yes/No/Unknown) and references VP80 Ac-104 Nucleocapsid 33 50.8 79.9 None Yes (82) AC66 Ac-66 Nucleocapsid 29 38.2 94 None Yes (87) F-protein Ac-23 Envelope 25 39 79.9  K237-GlyGly No  P94 Ac-134 Unknown 18 29 94.5  None No GP64 Ac-128 Envelope 16 29.4 60.6 K232-GlyGly & K299-GlyGly Yes (40, 41) P78/83 Ac-9 Nucleocapsid 14 31.5 60.7 None Yes (48, 268) Helicase Ac-95 Unknown 10 8.9 143  None No LEF3 Ac-67 Unknown 9 29.6 44.6 None No     167   sites were identified. F-protein is an envelope protein whereas AC66 and VP80 are both nucleocapsid proteins and it is therefore possible one of these two proteins is the viral-ubiquitinated 100 kDa protein detected in BV (Figure 5.6A). AC66 is required for nucleocapsid egress from the nucleus and VP80is required for movement of nucleocapsids from the virogenic stroma to nuclear periphery regions. These results suggested that AC66 or VP80 could be the potential substrate for viral ubiquitination in BV nucleocapsids. 5.2.8 Co-immunoprecipitation analysis of Myc-vUbi with AC66 or VP80 If AC66 or VP80 is ubiquitinated by Myc-vUbi then it should be possible to immunoprecipitate either protein using anti-Myc antibody. To enable this analysis two viruses were constructed that expressed HA tagged AC66 (ac66KO-ac66-HA) or VP80 (vp80KO-vp80-HA) (Figure 5.7). Each virus ac66KO-ac66-HA or vp80KO-vp80-HA was co-infected with vubiKO-Myc-vubi or WT virus (control virus with no epitope tag). At 24 hpi cells were harvested and supernatants were immunoprecipitated with anti-HA-beads (Figure 5.6). The input lanes showed the expression of VP80-HA, AC66-HA and Myc-vUbi tagged proteins (Figure 5.8A&B). Co-immunoprecipitation of proteins from VP80-HA and Myc-vUbi did not detect any vUbi conjugated proteins. In contrast, AC66-HA specifically co-immunoprecipitated a Myc-vUbi conjugated protein of approximately 100 kDa (Figure 5.8A). The co-immunoprecipitated band is of same size as the major   168  vUbi conjugated band from BV nucleocapsids (Figure 5.6A). This result indicated that AC66 is ubiquitinated by vUbi or interacts with a 100 kDa vUbi conjugated protein. If AC66 is the target then the HA-AC66 reactive proteins should co-migrate with the co-immunoprecipitated 100 kDa Myc-vUbi protein or be 7-10 kDa higher than the dominant cellular AC66 due to Myc-vUbi conjugation. Therefore ac66KO-ac66-HA was co-infected with and vubiKO-Myc-vubi or WT virus and cellular lysates were co-immunoprecipitated with anti-HA beads. The eluent material was separated on a 7.5% gel and probed for AC66-HA and Myc-vUbi to determine if they co-migrate (Figure 5.8B). The Myc-vUbi band was observed to migrate approximately 7-10 kDa higher than the primary AC66 protein which would agree with AC66 being monoubiquitinated. To determine if there were higher molecular weight species of AC66 that co-migrated with the Myc-Ubi band long exposures were obtained, but the signal from the primary AC66-HA band occluded all higher molecular weight species. This result suggested that if AC66 is ubiquitinated by vUbi it represents only a small proportion of the total cellular AC66. Therefore to increase the proportion of potentially Myc-vUbi conjugated AC66, we compared by Western blotting the migration of the Myc-Ubi proteins to that of the AC66-HA in purified BV and ODV isolated from Sf9 cells co-infected with ac66KO-ac66-HA and vubiKO-Myc-vubi (Figure 5.8C). The purified BV and ODV samples were run side by side on a high resolution 7.5% SDS-PAGE gel. The results showed that AC66-HA bands of higher molecular weight than its native molecular weight are present    169   Figure 5.7 Schematic diagram ac66 and vp80 KO and repaired bacmids. The ac66KO or vp80KO virus was generated by deleting the ac66 or vp80 ORF and replacing it with the zeocin resistance gene under control of the EM7 promoter. The ac66KO or vp80KO viruses were repaired respectively using pFAcT-GFP containing ac66 containing a C-terminal HA-tag or vp80containing C-terminal HA-tag. The viruses were named ac66KO-AC66-HA vp80KO-VP80-HA.   170   Figure 5.8 Co-immunoprecipitation analysis of AC66-HA or VP80-HA with Myc-vUbi. A. Sf9 cells were co-infected ac66KO-AC66-HA or vp80KO-VP80-HA with Myc-vUbi or acontrol with ac66KO-AC66-HA or vp80KO-VP80-HA and WT virus. Infected cells were harvested at 24 hpi and total cell lysates were pulled down with HA-beads. Input lanes were loaded with 0.25% of the total protein and eluent lanes were loaded with 15% of the total eluent. Blots were probed with the corresponding antibodies listed to the left. B. The ac66KO-AC66-HA and vubiKO- Myc-vUbi infected cell input and eluent materials from A. were separated on a 7.5% SDS-PAGE gel, blotted and the two halves   171  of the blot were probed with anti-HA (left) or anti-Myc (right) to determine if the detectable cellular forms of AC66 (94 kDa) co-migrate with the 100 kDa viral ubiquitinated bands. C. BV and ODV were purified from Sf9 cells infected with ac66KO-AC66-HA and vubiKO-Myc-vUbi and analyzed by Western blot 7.5% SDS-PAGE gel. The membrane was cut in half at the ladder. The two halves of the blot were probed with anti-HA (left) or anti-Myc (right) to determine if the higher molecular weight forms of BV or ODV AC66 co-migrate with the 100 kDa viral ubiquitinated bands. The 100 kDa viral ubiquitinated protein band and the same molecular weight AC66 band is marked with the double arrow.      172  in the BV samples but not in the ODV samples (Figure 5.8C). The higher molecular weight HA-AC66 bands co-migrate with the primary Myc-vUbi band from the BV samples. This result supports the conclusion that AC66 is the target for vUbi ubiquitination but only in BV. 5.2.9 MS analysis of the viral proteins immunoprecipitated  by AC66-HA MS analyses were done on co-immunoprecipitated material from AC66-HA to identify the viral and host proteins that interact with AC66 and to identify potential ubiquitination sites (Table 5.5and Table 5.6). In addition to AC66 a number viral proteins were identified that specifically co-immunoprecipitates with AC66-HA (Table 5.5). The MS data also indicated that AC66 associates with the nucleocapsid protein VP80, as well as GP37 which has been shown to be associated with BV. Interestingly, the Spodoptera litura NPV gp37 gene is expressed as a fusion protein with a ubiquitin homolog. Of particular note is that both AC141 and vUbi are specifically co-immunoprecipitated by AC66. This supports the previous data which indicates that AC66 is ubiquitinated by vUbi or is associated with proteins ubiquitinated by vUbi and that this activity is catalyzed by AC141. This was further supported by analysis of the MS data for potential ubiquitination sites in AC66 co-immunoprecipitated proteins. Two potential ubiquitination sites were identified on AC66, a high probability at K451 and a low probability site at K91.    173    Table 5.5  List of the most prominent AcMNPV proteins that co-immunoprecipitated with AC66-HA and analyzed by mass spectrometry. AcMNPV protein  O RF  No. of  peptides Sequence coverage (%) Molecular Weight (kDa) Modification site  (K) and type (GlyGly or GlyGlyTyr) Required for BV production (Yes/No/Unknown) and references AC66-HA pull down  Control   AC66-HA pull down  Control    AC66 Ac-66 24 4 35.5 8 93.97 K91-GlyGly (low probability) & K451-GlyGly Yes (87) AC141 Ac-141 2 0 8.4 0 30.11 None Yes (86, 107) vUbi Ac-35 2 0 37.7 0 8.65 None Yes (100) GP37 Ac-64 3 0 14.6 0 34.78 None Unknown (262) AC81 Ac-81 3 0 15 0 25.51 None Unknown  AC51 Ac-51 7 0 27 0 37.56 None Unknown  ODV-E66 Ac-46 4 0 7 0 79.09 None No (269) LEF9 Ac-62 3 0 10.3 0 59.32 None No AC109 Ac-109 2 0 6.4 0 44.80 None Yes (270-272) AC83 Ac-83 2 0 5.1 0 96.23 None Yes (28, 29) AC114 Ac-114 2 0 7.3 0 49.29 None Unknown AC132 Ac-132 6 1 43.4 5.9 25.136 None Unknown VP80 Ac-104 7 4 14.9 6.5 79.88 None Yes AC18 Ac-18 9 4 26.9 12.5 40.87 None No (259)   174   Table 5.6 List of the most prominent host proteins Spodoptera frugiperda that co-immunoprecipitated with AC66-HA. Name of the protein Protein ID No of peptides AC66-HA pull down / Control Sequence coverage (% ) AC66-HA pull down / Control Molecular Weight (kDa) Modification site (K) and type  PREDICTED: Lamin-C-like XP_004930078.1 31/19 64.4/37 49.9 None GH20077 (eIF-3c family) XP_001987240.1 13/5 17.6/7.8 100.85 None PREDICTED: dynamin-like 120 kDa protein, mitochondrial-like XP_003702505.1  12/5 15.8/6.6 113.7 None 40S ribosomal protein S3a NP_001037255.1 11/3 47.7/13.2 26.5 None PREDICTED: paraplegin-like XP_004933193.1 11/5 19.9/8.2 88.3 None PREDICTED: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial-like XP_004927924.1 8/3 28.7/11.5 46.22 None GD11704 (ATP synthase β subunit) XP_002082674.1 8/4 23.1/11.9 49.8 None ribosomal protein L18A NP_001037219.1 8/4 34.1/16.1 26.6 None     175  5.2.10 Co-immunoprecipitaton of AC141 with AC66 or VP80  As shown above MS analysis identified AC66 co-immunoprecipitates with AC141. We further analyzed this interaction by reciprocal co-immunoprecipitation and Western blot. Sf9 cells were infected with ac66KO-ac66-HA, vp80KO-vp80-HA and a control. Cell lysates were immunoprecipitated with anti-HA-beads and eluents were analysed by Western blotting and probed with a polyclonal antibody against AC141. The input lanes show expression of AC66-HA and VP80-HA as expected. AC141 is expressed primarily as a 30 kDa protein along with two minor high molecular weight species. The eluent results showed that AC66-HA co-immunoprecipitated the 30 kDa AC141 (Figure 5.9Ai). Surprisingly however, a protein of approximately 80-90 kDa that was immuno-reactive to the AC141 polyclonal antibody was also specifically co-immunoprecipitated (Figure 5.9A i). Reciprocal co-immunoprecipitation was also done to confirm the association between AC66-HA and AC141. Sf9 cells were infected with ac66KO-ac66-HA, vp80KO-vp80-HA and cell lysates were pulled down with either AC141 polyclonal antibody or preimmune serum as the control. Input lanes showed the expression of AC141, AC66-HA and VP80 in the corresponding lanes (Figure 5.9Bi and ii). AC66-HA, but not VP80-HA, specifically co-immunoprecipitated AC141. These results show that AC66-HA interacts with AC141 during the course of infection.    176   Figure 5.9 Co-immunoprecipitation analysis of AC66-HA or VP80-HA with AC141. Sf9 cells were infected with either (i) ac66KO-AC66-HA or (ii) vp80KO-VP80-HA or with WT virus as a control. Cells were harvested at 24 hpi and cell lysates were pulled down with A. anti-AC141 bound to protein G beads or B. anti-HA beads and subjected to Western blot analysis. Blots were probed with respective antibodies indicated to the left of each blot.   177  Therefore the higher molecular weight AC141 reactive protein specifically co-immunoprecipitated by AC66-HA could be polyubiquitinated or multiubiquitinated with 6-7 ubiquitin molecules. Neither the 30 or 90 kDa forms of AC141 were co-immunoprecipitated by VP80-HA which like AC66 is a nucleocapsid protein. This specific interaction suggests that AC66 is a substrate for the predicted ubiquitin ligase activity of AC141. 5.2.11 Localization of AC66-HA and co-localization of AC66-HA with Myc-vUbi and AC141 Our Western blotting, mass spectrometry and co-immunoprecipitation data suggested that AC66 is specifically ubiquitinated in BV nucleocapsids by vUbi and this process is mediated by AC141. To further analyze these interactions confocal microscopy was performed to determine the cellular localization of AC66-HA and determine if it co-localizes with Myc-vUbi and AC141. Sf9 cells were co-infected with ac66KO-ac66-HA and acvUbiKO-Myc-vUbi and fixed at 24 hpi and stained for AC66, vUbi or AC141. As shown, AC66-HA is localized predominantly inside the nucleus with the majority of the signal in the ring zone but it was also distributed evenly throughout the virogenic stroma (Figure 5.10 i). Small amounts of AC66 are also observed in the cytoplasm and at the plasma membrane. Myc-vUbi localized throughout the cell but was more concentrated inside the nucleus (Figure 5.10 ii). AC66-HA and Myc-vUbi exhibited limited co-  178  localization that was primarily in the ring zone (Figure 5.9 ii, AC66-HA+Myc-vUbi). AC141 showed distribution concentrated at both the nuclear and cytoplasmic periphery as shown previously (86). AC66-HA and AC141 showed co-localization but only within the RING zone at the nuclear periphery in the regions outside of the virogenic stroma (Figure 5.10 iii, AC66-HA+AC141 yellow pixels). We also analyzed the co-localization of HA-AC141 and Myc-vUbi where cells were infected with 2xKO-HA-ac141+Myc-vubi i. HA-AC141 and Myc-vUbi were observed to co-localize at both the nuclear and cytoplasmic periphery regions (Figure 5.10 iii, HA-AC141+Myc-vUbi, yellow pixels). From all these confocal images we showed that the three proteins AC141, Myc-vUbi and AC66-HA co-localize primarily in the RING zone of the nucleus outside the virogenic stroma. It is from this region that nucleocapsids either egress from the nucleus or are assembled into ODV.      179   Figure 5.10 Co-localization analysis of AC66-HA with AC141 and Myc-vUbi and co-localization analysis of AC141 and Myc-vUbi. Sf9 cells were infected with viruses expressing (i) AC66-HA, or (ii) AC66-HA and Myc-vUbi, or (iii) AC66-HA and HA-AC141 or (iv) HA-AC141 and Myc-vUbi. Infected cells were fixed at 24 hpi and subjected to incubation with corresponding antibodies indicated in each image. Regions of co-localization are shown in yellow.   180  5.3 Discussion AcMNPV encodes a predicted ubiquitin E3 ubiquitin ligase AC141 as well as a viral ubiquitin that has 74% similarity to cellular ubiquitin. Both of these proteins had previously been shown to be specifically required for the production of BV. Based on previous studies, we hypothesized that vUbi interacts with AC141 and this interaction is required for the development of BV. Our results supported this hypothesis and in addition identified a nucleocapsid protein; AC66 that is a potential substrate for AC141 and vUbi. AC141 is predicted to be a E3 ubiquitin ligase due to the conserved RING motif. The majority of eukaryotic RING domain E3 ubiquitin ligases contain a motif which is C-X2-C-X9-39-C-X1-3-H-X2-3-C-X2-C-X4-48-C-X2-C,  however, the AC141 RING consensus  is C-X2-Cys-X14-C-C-X-Y/F-X2-C-X2-C-X13-15-C-X2-C which differs from the eukaryotic RING domain (Figure 5.1) as it contains an extra cysteine residue adjacent to the third cysteine and the histidine residue is replaced with tyrosine or phenylalanine. All the other AcMNPV RING motif proteins such as PE38, IE2, IAP-1, or IAP-2 have RING motifs that are the same as the classic cellular motif. This suggests that AC141 may have unique functional differences which are required for BV production. Mutation of the extra C or the Y amino resulted in decreased BV production. In addition, the tyrosine could not be functionally replaced with a histidine (X. Dai and D. A. Theilmann, unpublished data). These data suggest that AC141 is structurally different from most E3 ubiquitin ligases   181  and could therefore be involved in a mechanistically different transfer of ubiquitin to a substrate. RING motifs are required for binding E2 conjugating enzymes that are charged with ubiquitin (242). AcMNPV encodes its own ubiquitin homolog and during infection cells will have both vUbi and cUbi in the cellular milieu. Previous in-vitro studies have shown that vUbi or cUbi do not show any difference in binding to cellular E2s (104). However, vUbi was 40% less efficient that cUbi in transfer to cellular E3 suggesting a viral ubiquitin ligase was required for efficient recognition of the E2-vUbi complexes. The linkage of ubiquitin and E2 is very flexible and can exist in different structural orientations (273). But upon binding of the E2-Ubi complex via the RING domain of E3, the bound ubiquitin becomes locked into the active site groove of E2 (242). This suggests that the RING domain and ubiquitin share a close interaction and forces the ubiquitin C-terminus into the active groove for catalysis. The13th amino acid after the C3HC4 of RNF4 is Y193and mediates the interaction with ubiquitin residues and restricts its flexibility (242). The AC141 RING domain is at the C-terminus and there are only 5 amino acids after the C3Y/FC4 but there is a tyrosine residue is present at the 4th amino acid after the consensus sequence. It is possible therefore that the structural differences of the AC141 RING motif which is required for E2 binding may selectively interact with vUbi conjugated enzymes.  We hypothesized that AC141 and vUbi may selectively interact to target specific substrates to enable efficient BV production. To test the hypothesis of AC141 and vUbi   182  interaction, single and double gene knockout viruses were constructed and examined for their impact on BV production. Deletion of vubi or ac141 resulted in BV production being reduced to 0.26% or 0.005% of WT virus, respectively (Figure 5.3). When both ac141 and vubi were deleted, BV production was completely eliminated suggesting cooperative interaction between AC141 and vUbi. Deletion of vubi had a significant but lesser impact than deleting ac141. As previous studies have shown that cUbi can be interchanged with vUbi in vitro ubiquitination assays (104) it is possible that cUbi can be utilized in place of vUbi in vivo, albeit less efficiently. E3 ubiquitin ligases are normally highly specific for their substrate (241), therefore deletion of ac141 would presumably result in the loss of substrate ubiquitination and therefore the dramatic drop in BV production. The very low levels of BV that are observed in the ac141 KO viruses (estimated to be <1.0 TCID50 per 500 transfected cells; Figure 5.4) could be explained by non-specific stochastic tagging of nucleocapsids by cellular or viral E3 ligases from the pool of vUbi present in an infected cell. Upon deletion of both ac141 and vubi, neither of the potential compensation mechanisms could occur, and therefore no virus would be produced, as was observed. To identify the potential substrates of AC141 that are viral ubiquitinated, co-immunoprecipitation followed by MS analysis was done. The nucleocapsid proteins that co-immunoprecipitated with AC141 are AC66, VP80, VP39 and P78/83 (Table 5.1). AC66 and VP80 have been shown to be required for nucleocapsid egress therefore these   183  two proteins could be the potential substrates of AC141 (82, 87). The co-immunoprecipitation results confirmed that AC141 associates specifically with AC66 but not with VP80 (Figure 5.9). MS analysis also identified the potential peptides that are modified by viral or cellular ubiquitin. Our data support the hypothesis made by Ke et. al. (87) that AC66 and AC141 interact inside the nucleus to facilitate nucleocapsid egress. It showed that AC141 itself gets ubiquitinated with viral or cellular ubiquitin within the potential substrate binding region. The self-ubiquitination of E3 ubiquitin ligases have been shown with other E3s resulting in auto-regulation through degradation by polyubiquitination or enhancing the ubiquitination of a substrate (263-267, 274). It is possible that ubiquitination of AC141 regulates its activity and potentially levels of BV production by acting as a switch mechanism.  Surprisingly, MS analysis showed a unique linkage of vUbi via the last tyrosine to the lysine 87 of AC141. Inactive variants of cellular ubiquitin exist that have extra amino acids at the C-terminus after the di-glycine. Cellular isopeptidases cleave any extra amino acids at the C-terminus resulting in functional ubiquitin (256, 257). VUbi has conserved residues for recognition by different DUBs. Most ubiquitin binding proteins bind the ubiquitin hydrophobic surface centered at I44 (275). The vUbi alignment with the cUbi shows the I44 patch is conserved (Figure 5.1). (257, 275).However, DUB binding domains have greater affinity for polyubiquitin or ubiquitin linked to a substrate over free ubiquitin (276). AcMNPV vUbi is encoded as a monomer whereas cUbi is expressed as a   184  linear fusion of multiple ubiquitin molecules or with ribosomal proteins (256). It is therefore possible that cellular DUBs have a lower affinity for vUbi and the C-terminal tyrosine may be inefficiently cleaved. This may account for the MS results showing that tyrosine forms an isopeptide bond with AC141 K87. If this is correct, the isopeptide bond between a non-glycine at the C-terminal of a ubiquitin molecule would be unique and surprising but further studies are required.  The envelope fraction from purified BV contained monomeric cUbi and high molecular weight cUbi-conjugates but did not contain any vUbi (Figure 5.6). In other viral systems cUbi has been shown to get associated with viral envelopes via the host ESCRT pathway (155, 169). Viruses either encode E3 ubiquitin ligases or encode adapter proteins that recruit other components of ESCRT to support the budding process from the plasma membrane. During baculovirus infection, ESCRT pathway components are required for BV production (178). If AcMNPV utilizes the host ESCRT components similarly to other viral systems it could account for the specific cUbi incorporation into the envelope or envelope proteins of BV.  We hypothesized that AcMNPV uses AC141 as a viral specific E3 ubiquitin ligase to differentially ubiquitinate nucleocapsids with vUbi to designate if they are to be used to form BV or ODV. We showed that a protein of approximately 100 kDa is specifically ubiquitinated in the BV nucleocapsids but not in the ODV nucleocapsids. Two of the   185  potential nucleocapsid proteins in that region are AC66 and VP80. AC66 specifically associates with a viral ubiquitinated protein of molecular weight 7-10 kDa larger than its native size (Figure 5.9). Purified BV contains a form of AC66 that co-migrates with the viral ubiquitinated 100 kDa protein. In infected cells the majority of the AC66 exists in its native form and a small percentage is ubiquitinated. This would be expected because  only approximately 2.3% of the viral genome is released to form the BV and 97.3% is retained inside the nucleus to form the ODV (277).  Other viral systems have been shown to use ubiquitination as a signal for the trafficking of nucleocapsids. During HSV-1 infection ubiquitination of a tegument protein called pUL36 is required for egress from the nucleus and subsequent transport in the cytoplasm and impacts virulence (278-280). Nuclear egress of HSV-1 capsids have been extensively studied and it’s known that capsids egress from the nuclear envelope by a budding mechanism (281). Capsid egress requires a nuclear envelopment complex composed of proteins pUL31 and pUL34  that mediate the primary envelopment into the perinuclear space and de-envelopment from the outer nuclear envelope (282). Several HSV encoded glycoproteins are associated with inner and outer nuclear envelope membranes and assist in budding of capsids from the nucleus (282). Although during AcMNPV infection, EM micrographs suggests that nucleocapsids egress from the nucleus by budding through the nuclear envelope but the hypothesis lacks proper evidence (85, 86). Our MS analysis showed that AC66 might associate with GP37 and AC141 might associate with GP37 and   186  GP41 (Table 5.1 and Table 5.5). Both GP37 and GP41 are baculovirus encoded glycoproteins where GP41 is required for nuclear egress and GP37 is associated with BV but the exact role of GP37 is unknown (88, 89). During egress of nucleocapsids from the nucleus, AC141, AC66, and the glycoproteins GP41 and GP37 might form a nuclear egress complex. The ubiquitination of AC66 might be the signal for the recognition of nucleocapsids with these glycoproteins. Confocal microscopy showed that AC141, AC66 and vUbi associates near the nuclear periphery regions (Figure 5.10) and might interact to facilitate nuclear egress. In addition, the N-terminus of AC66 has a conserved desmoplankin domain and proline rich residues (from 97-142 amino acid). Desmoplankin domain binds intermediate filaments and interacts with microtubule components (283, 284). The proline rich residues of pUL36 during HSV infection interacts with dynein motor protein (280). AC66 with its desmoplankin domain and proline rich residue might also interact with dynein motor proteins after egress from the nucleus. In summary we have shown that there is a differential ubiquitination pattern of nucleocapsids that egress from the nucleus to form BV compared to ODV. In addition, our data supports our hypothesis that AcMNPV AC141 is a viral specific E3 ubiquitin ligase and ubiquitinates nucleocapsid protein AC66 with vUbi for BV production. This ubiquitination event has the potential of being the signal that determines if a nucleocapsid is directed to become a BV or ODV which is a critical event of the baculovirus replication cycle.   187  Chapter 6  Functional analysis of the lysine residues of AcMNPV viral ubiquitin   66.1 Introduction Ubiquitin is a small protein composed of 76 amino acids and serves as a signal for posttranslational modification. Ubiquitin is attached to a substrate protein through enzymatic reactions mediated sequentially by three different enzymes. First, ubiquitin is attached to E1 activating enzyme through an ATP dependent process form a thiol ester linkage. The charged ubiquitin is then transferred onto an E2-conjugating enzyme. In the final step of the reaction ubiquitin is transferred from E2 to the substrate by E3 ubiquitin ligases (144, 145, 153). Ubiquitin is attached to the substrate through a covalent isopeptide linkage between the C-terminal glycine of ubiquitin and a lysine residue of the substrate. Cellular ubiquitin normally contain six lysine residues, K6, K11, K27, K33, K48 and K63, which can form a covalent bond with the last glycine residue of another ubiquitin to form a polyubiquitin chain. Polyubiquitinated substrates are generally destined for proteasome degradation. Substrate proteins can be mono-ubiquitinated or multi-ubiquitinated at different lysine residues which can serve as different posttranslational modification signals for promoting cellular processes such as trafficking, endocytosis and DNA repair (153, 243, 244). Different types of polyubiquitin   188  chains can also lead to different fates other than for proteasome degradation. Homotypic polyubiquitin chains have different structural topology from extended to compact conformations (153, 285). Polyubiquitin chains are formed with each of the ubiquitin lysine residues through a regulated mechanism mediated by E3-E2-substrate. K63 and K48 polyubiquitin chains have been extensively studied, and a K48 chains leads to degradation of proteins by the 26S proteasome. In contrast the K63 polyubiquitin chain can signal DNA repair and vesicle trafficking. K6 and K27 polyubiquitin chains are believed to be the signal for the mitochondrial damage and DNA damage responses (154). Other types of polyubiquitin chains such as K6, K11, K27, and K33 are called either unconventional or atypical chains and their functions are not well defined. But studies have shown that unconventional polyubiquitin chains also lead to proteasome mediated degradation.  AcMNPV is an enveloped virus with a large circular DNA genome which is packaged into rod shaped nucleocapsids. AcMNPV infection is biphasic where two forms of virions are produced. New progeny nucleocapsids are synthesized inside the nucleus and during the late phase of infection nucleocapsids egress from the nucleus, traverse through the cytoplasm and buds from the plasm membrane to form BV. During the very late phase of infection nucleocapsids accumulate inside the nucleus and obtain an envelope to form ODVs. ODVs are further occluded with a crystalline protein matrix of polyhedrin which form OBs. Baculoviruses are unusual as they are the only known virus to encode   189  its own ubiquitin and this is called vUbi. vUbi shares 75% amino acid identity with the cUbi (99, 104). All the lysine residues are conserved between vUbi and cUbi but vUbi has an extra lysine residue at K54. Frame shift mutation of the vUbi showed no effect on viral replication but reduced the BV production by 5-10 fold (100). This study has confirmed these results and shown that deletion of vUbi causes a 100 fold decrease in BV production (Chapter 5). Both vUbi and cUbi are anchored to the BV envelope by a phospholipid anchor linkage (103). In contrast, the results of this study have shown that only cUbi are found in BV envelopes (Chapter 5). In vitro analysis using cellular enzymes has shown that vUbi does not support proteolytic processes. In these assays E2 enzymes did not discriminate between cUbi and vUbi. However, vUbi was approximately 60% less efficient in cellular E3 mediated transfer to substrate proteins (104). In the previous chapter we investigated the role of vUbi in egress of AcMNPV nucleocapsids from the nucleus. However, Western blots also show that vUbi is utilized to ubiquitinate many proteins that are potentially both cellular and viral in origin that do not appear to be related to the egress processes of nucleocapsids (Chapter 5). Analysis of baculovirus genera has shown that vUbi is conserved in alpha- and betabaculoviruses but is not found in gamma-or deltabaculoviruses. In alphabaculovirus infections, including AcMNPV, nucleocapsids egress from the nucleus and bud from the plasma membrane to become BV. In contrast, during betabaculovirus infections  nucleocapsids do not egress from the nucleus since the nuclear envelope is degraded forming a nucleo-cytoplasmic   190  milieu (286). This suggests that for betabaculoviruses nucleocapsids may not need to be differentiated for ODV and BV formation. Therefore, in addition to signalling for nuclear egress and BV production vUbi likely has roles in the viral life cycle which may also be utilized during AcMNPV infection. As described above the role of ubiquitination has been shown to be dependent upon which lysine of ubiquitin is utilized for the formation of polyubiquitin chains. In this chapter a mutational analysis of vUbi lysine residues was performed to determine the possible pathways mediated whereby vUbi is being utilized. The results show that vUbi K6 and K27 appear to be utilized for ubiquitination of cellular and viral proteins, both of which are rarely utilized by cellular ubiquitin systems.      191  6.2 Results 6.2.1 Alignment of viral ubiquitin homologs encoded by alpha and betabaculoviruses Figure 6.1 shows two alignments of the known alpha- and betabaculovirus predicted ubiquitin sequences to identify genus specific sequence conservation as well as determining the conservation of lysine residues and known structural features. The alignment shows that of the seven cUbi lysines, six are conserved in all vUbis with  the exception of  K29 being replaced with a glutamine or an alanine in two viruses which are Antheraea pernyi NPV and Adoxophyes orana GV. AcMNPV vUbi has an additional lysine at K54 but it is not highly conserved in alphabaculoviruses and not present at all in beta baculoviruses. To date the majority of ubiquitin binding proteins, including E2 and E3 enzymes, have been shown to bind specific tertiary structures of cUbi, which include the isoleucine 44 (I44) patch and the aspartate 58 (D58) patch (Figure 6.1). The Ile44 patch is highly conserved in vUbi and differences that are observed are conservative changes. The AcMNPV vUbi Ile44 patch for example is 100% identical to the Ile44 patch on cUbi. In contrast the D58 patch has significant lack of conservation compared to cUbi, especially E20, R54, T55, and S57. The D58 patch interacts with the RUZ (Rabex-5 ubiquitin binding zinc finger) ubiquitin binding protein and it has been suggested that this region may be more specialized and less promiscuous than the Ile44 patch (287).    192   Figure 6.1 Alignment of alpha- and betabaculovirus viral ubiquitin. The figure shows the independent alignments of alpha- and betabaculovirus vUbi homologs. Identical amino acids are shown with yellow and non-identical amino acids are black. The amino acids that form the isoleucine (I44) and aspartic acid (D58) patches are highlighted by the red and blue bars respectively. The I44 and D58 patches have been previously determined to interact with ubiquitin binding proteins (288). The conserved lysine residues are indicated below the alignments by black arrows. K29 is not conserved and is indicated by a red arrow. Alignments were performed using the VectorNTI Align program.    193   Figure 6.2 Schematic maps of vubi KO and lysine mutant viruses. A. The vubiKO virus was generated by replacing vUbi with the chloramphenicol resistance marker. The KO viruses were repaired with polyhedrin and egfp in the polyhedrin locus to track virus cell to cell spread. The vubiKO virus was repaired with N-terminal Myc-tag vubior N-terminal Myc-tag vubi lysine residue mutants. B. The relative position of vUbi lysines are shown in green. Lysine residues mutated to arginine are shown in red.    194  Crystal structures of the RING domain E3 ligases bound to E2s and ubiquitin have been determined; amino acids of ubiquitin interaction have also been identified (242). Specifically cUbi E34, G35 and I36 interact with side chains of the RING domain. E34 and G35 are conserved in all the alphabaculoviruses and I36 has only conservative changes to valine. In betabaculoviruses E34 is conserved, G35 is not highly conserved and is substituted with serine in 6 of the 17 proteins (Figure 6.1). Overall the betabaculovirus vUbi is more highly conserved than alphabaculovirus vUbi. This suggests that alphabaculovirus vUbi’s may interact with a more divergent array of proteins compared to betabaculoviruses. 6.2.2 Analysis of BV production by viruses expressing vUbi mutants  To analyse the role of each lysine residues of vUbi eight recombinant viruses were constructed that had the WT virus vUbi deleted and replaced with a vUbi that had a lysine residue mutated to arginine (Figure 6.2A, B). Arginine was used to substitute each lysine as it has been previously shown that this conservative change in ubiquitin does not impact tertiary structure but the arginine is unable to form polyubiquitin chains (289). Each construct was viable and a titred stock of each virus was produced. As reported in Chapter 5, deletion of vubi results in a 100 fold drop in BV production. To determine if the vUbi lysine mutations had a similar impact, BV production was monitored in time course experiments and samples were collected at 18, 24 and 48 hpi. Results showed, as    195    Figure 6.3 Time course analysis of  BV production from Sf9 cells infected with viruses expressing vUbi lysine mutations. Sf9 cells were infected with WT virus, vubiKO, vubiKO -Myc-vUbi and vubiKO-Myc-vUbi lysine mutant viruses at an MOI of 10 and monitored for BV production at 18, 24 and 48 hpt. Titres were determined by digital droplet PCR. Each data shown represents a set of two biological repeats and two technical repeats.     196   expected, that vubiKO had BV production reduced to approximately 100 fold by 24 hpi and 10 fold at 48 hpi relative to WT virus (Figure 6.3). By 48 hpi all the vUbi lysine mutant viruses, except K27R, produced similar levels of BV to WT virus, though some differences were noted at 24 hpi. The K27R mutant showed an approximately 10 fold reduction in BV production at 24 hpi, but by 48 hpi levels were equivalent to WT virus. 6.2.3 Phenotypic effect of viral ubiquitin lysine residue mutations   All viruses expressed vUbi and showed a ladder of ubiquitinated proteins typical of vUbi blots (see chapter 5 and Figure 6.4). At 24 and 48 hpi K11R, K29R, K33R, K48R, K54R, and K63R showed little difference in ubiquitination relative to Myc-vUbi suggesting that there was no impact of these mutations. In contrast K6R and K27R both showed a higher level of accumulation of viral ubiquitinated proteins relative to Myc-vUbi and the other vUbi mutants. The higher levels of ubiquitinated proteins were detected at 24 and 48 hpi for K6R, but only at 48 hpi for K27R.      197   Figure 6.4 Expression of vUbi tagged proteins in Sf9 cells infected with vubi lysine mutant viruses . Western blot analysis of total protein from Sf9 cells infected with WT virus, vubiKO-Myc-vUbi and vubiKO-Myc-vUbi lysine mutant viruses (MOI=10). Cells were harvested at 24 and 48 hpi. The blots were probed with mouse anti-Myc monoclonal antibody. Loading control is shown by the TGX stained gel picture in the loading control panel.     198  6.2.4 The role of vUbi in the 26S proteasome mediated degradative pathway The accumulation of ubiquitinated proteins is often a response that is observed in eukaryotic cells when proteasome degradation is inhibited by the drug MG132 (289). The accumulation of ubiquitinated proteins by K6R and K27R could therefore be due to the inability of proteins not being degraded by the 26S proteasome. If viral ubiquitinated proteins are not degraded by the proteasome in Myc-vUbiK6R or Myc-vUbiK27R infected cells a similar phenotype should be observed when the 26S proteasome mediated pathway is blocked by MG132 drug treatment. To test this Sf9 cells were infected with WT virus, vubiKO-Myc-vUbi and Myc-vUbiK6R. At 12 hpi cells were treated with MG132 drug (at 100 μM and 250 μM, respectively) to block the 26S proteasome and cells were harvested at 12 hours post-treatment (equals 24 hpi). Western blot analysis of total protein was done to determine if there is an accumulation of cellular or viral ubiquitinated proteins (Figure 6.5). Analysis of cUbi shows that at 100 μM MG132 in WT virus, vubiKO-Myc-vUbi and Myc-vUbiK6R showed as expected that there was a significant accumulation of ubiquitinated proteins compared to control cells only treated with DMSO. At 250 μM MG132 accumulation of cellular ubiquitinated proteins is observed but levels are reduced compared to 100 μM. This suggests a potential toxicity to the cells at the higher MG132 levels (Figure 6.4). Analysis of viral ubiquitinated proteins under the same conditions gave contrary results. In control untreated cells, a significant accumulation of viral ubiquitinated proteins is observed in Myc-vUbiK6R infected cells   199  compared to vubiKO-Myc-vUbi infected cell, which is in agreement with previous results (Figure 6.4). Interestingly however, in 100 μM MG132 treated cells the level of viral ubiquitinated proteins decreases in both vubiKO-Myc-vUbi and Myc-vUbiK6R infected cells, the opposite of what was observed with cellular ubiquitinated proteins. At 250 μM  MG132 no vUbi  ubiquitinated proteins are detected indicating a complete blockage of viral gene expression at this concentration. This suggests that blocking the 26S proteasome pathway affects viral replication. To examine that possibility the samples were probed with antibodies to AC141 (late gene) which interacts with vUbi (Chapter 5) and IE1 which is essential for viral replication. The results showed that the levels of AC141and IE1 decreased upon MG132 treatment indicating that virus replication was being inhibited when the 26S proteasome pathway is blocked. In contrast no impact of the MG132 treatment was observed on the cellular protein, actin. These results show that the 26S proteasome functionality appears to be essential for enabling AcMNPV replication which appears be separate from the function of vUbi. However, due to the sensitivity of virus replication to MG132 treatment it cannot be used to determine if the accumulation of viral ubiquitinated proteins in Myc-vUbiK6R infected cells is due to blocking of polyubiquitin chains and subsequent proteasome degradation.    200   Figure 6.5 Effect of blocking 26S proteasome proteolysis by MG132 on the expression of vUbi conjugated proteins. Sf9 cells were infected with WT virus, vubiKO -Myc-vUbi and vubiKO-Myc-vUbiK6R at an MOI of 10. At 12 hpi infected cells were treated with 100 μM or 250 μM MG132 or DMSO as a control. At 12 hours post MG132 treatment (24 hpi) cells were harvested and subjected to Western blot analysis of A) cUbi or B) vUbi conjugated proteins.Expression of the viral proteins AC141 and IE1 plus the cellular protein actin as a loading control are shown below the vUbi blot. Antibodies used are shown to the left of each of the blots.   201  6.3 Discussion In this Chapter we examined the role of the conserved lysine residues of AcMNPV vUbi which shares 75% identity with cUbi. The use of specific lysines in ubiquitin for the formation of polyubiquitin chains is associated with specific cellular functionality. For example K48 polyubiquitin chain linked to protein generally leads to 26S proteasome mediated degradation of proteins whereas, K63 polyubiquitin chains is a signal for protein trafficking (243). Eight viruses were constructed that replaced the WT virus vubi with a mutant encoding vubi’s that had each individual lysine residues mutated to arginine (Figure 6.2A). As shown in this study (Chapter 5) and previous studies deletion of vubi results in a 10 fold drop in BV production (100). None of the lysine mutant viruses had as dramatic an effect on the BV production as the vubiKO virus (Figure 6.3). Only K27R showed a delay in BV production but reached WT virus levels by 48 hpi. This result therefore suggests that polyubiquitin chain formation is not required for vUbi support of BV formation. The vUbi that is associated with BV (see Chapter 5) therefore is likely to be monoubiquitin. Monoubiquitin is utilized as a signal to traffic macromolecules or vesicles and this would agree with the proposal that vUbi is being used as a signal to traffic nucleocapsids out of the nucleus for formation of BV. Western blot analysis show accumulation of viral-ubiquitinated proteins at late times post infection in cells infected with a virus expressing vUbi with a K6R or K27R mutation.   202  (Figure 6.2B). The accumulation of viral ubiquitinated proteins upon mutation of K6 and K27 could be an indicator that vUbi is being used as a signal for 26S mediated proteasome degradation of proteins. Blocking 26S proteasome with MG132 was unable to confirm this possibility as it inhibited both early and late viral gene expression (Figure 6.4B). In contrast, MG132 did cause host proteins ubiquitinated with cUbi to accumulate. These results agree with the previously published results i.e. blocking the 26S proteasome pathway affects the BmNPV early and late gene expression and BV production (290). In addition, it was observed that a much lower MG132 concentrations (5 µm) inhibited proteasome degradation in BmNPV infected BmN cells. In this study lower concentrations were not found to inhibit the 26S proteasome and concentrations similar to those reported for mammalian cells were needed (data not shown, (289)). The similar accumulation of ubiquitinated proteins upon mutation of K6 with R has been observed in an in vitro study with cellular ubiquitin (291). This study showed that K6 mutants acted as potent inhibitors of ATP-dependent proteolysis and caused enhanced susceptibility to oxidative stress. Although the role of vUbi in protein degradation is not confirmed, the results suggest that during AcMNPV vUbi utilizes K6 and K27 atypical polyubiquitin chains that are not normally used for signalling proteasome degradation. In addition, the vUbi polyubiquitin chains do not impact the BV and potentially highlight a function that might be common to both alpha- and betabaculovirus.   203   In general very little is known about the function of K6 or K27 polyubiquitin chains when attached to substrate proteins. Non-degradative roles of K6 and K27 polyubiquitin chains have been suggested because experiments have shown that following inhibition of the 26S proteasome no enrichment of K6 and K27 linked chains were found (154, 292). However, both K6 and K27 polyubiquitin chains have been shown to be involved in response to DNA damage (154, 289, 293, 294). Specifically, K6 polyubiquitin chains have been found to co-localize to sites of  DNA damage at the regions of double stranded breaks  and also with BRCA1 and the histone H2AX (289). AcMNPV virus replication induces a DNA damage response which is indicated by phosphorylation of the histone H2AX (295). Interestingly K27 polyubiquitin chains have also been shown to be associated with the DNA damage response, and associate with the E3 RING ligase RNF168 and to assemble K27 chains on histone H2AX (154). It was hypothesized that K27-linked chains may provide scaffolds for protein recruitment in the DNA damage response. Inhibition of the AcMNPV DNA damage response and H2AX phosphorylation resulted in a 10-100 fold decrease in BV production. It is therefore possible that vUbi K6 and K27 polyubiquitin chain conjugates may be part of AcMNPVs enhancement of the DNA damage response that supports virus replication and BV production.  In addition to influencing the DNA damage response, K6 linked linkages have also been reported to be involved in the cellular mitochondrial damage response (reviewed at (154)). Interestingly AcMNPV infections have been shown to induce mitochondrial   204  dysfunction and enhance autophagy (296). Therefore, K6 polyubiquitin chains may be utilized in a mechanism by which the virus controls mitochondria viability. It has been shown that conjugation of K6-linked with Parkin E3-ligase regulates mitochondrial damage which leads to autophagy (297). Associated with this process is DUB USP8 that regulates Parkin auto-ubiquitination and selectively removes K6 linked polyubiquitin (297). If deubiquitination of Parkin mediated by USP8 is inhibited by a ubiquitin K6R mutation, then Western blotting results have shown that cellular levels of Parkin E3 enzyme accumulate (297). This result is similar to the observations of this study and might also explain our results on mutation of K6R. That is, if DUBs are not able to bind K6R modified chains this would lead to an accumulation of proteins ubiquitinated by K6 linkages. The use of vUbi in the formation of K6 or K27 polyubiquitin chains may provide a new insights into their function and cellular pathways for which these atypical chains are utilized. Among viruses, only baculoviruses encode a ubiquitin homolog and to our knowledge this is the first demonstration of utilisation of atypical chains in the viral infection cycle.    205  Chapter 7  Conclusions and future perspectives   7During baculovirus infection progeny nucleocapsids are formed in the virogenic stroma and transported to the nuclear periphery. Nucleocapsids at the nuclear periphery either egress from the nucleus or are retained inside the nucleus. Nucleocapsids that are retained inside the nucleus obtain an envelope that is derived from the inner nuclear membrane to form ODV. Nucleocapsids that egress from the nucleus traverse through the cytoplasm to reach the plasma membrane from which they bud to form the BV. The molecular signals required for egress have not been well defined and the focus of this thesis has been to investigate the mechanisms by which nucleocapsid egress is accomplished. The specific questions I addressed included investigating the role of the microtubule motor protein, kinesin-1 in nucleocapsid transport (Chapter 3); determining if AC141 and ME53 were functionally associated during infection and interacted at viral budding sites with GP64 (Chapter 4);   determining the relationship of AC141and vUbi and their role in BV production (Chapter 5); and dissecting the role of vUbi lysines and their impact on BV production and virus infection (Chapter 6). Conclusions from these chapters and possible future directions will be discussed below. Knowledge concerning the molecular mechanisms of nucleocapsid egress and its utilization of host cellular machinery for BV production will enhance the understanding of baculovirus infection and pathology. Better   206  understanding of nucleocapsid egress can potentially lead to the improved use of baculoviruses for biocontrol, protein expression and as gene therapy vectors. 7.1 Nucleocapsids utilize host microtubules and not actin for movement through the cytoplasm during egress The results of Chapter 3 demonstrate that the nucleocapsid proteins AC141, VP39, BV/ODV C42 and FP25 associates with KHC and KLC, suggesting that kinesin-1 interacts with intact nucleocapsids. In addition, downregulation of KLC reduced BV production by more than 80% suggesting kinesin-1 and the host microtubule system is required for efficient BV production. One of the major questions that remains however is, how viral proteins and nucleocapsids are binding to kinesin-1. Previous FRET-FLIM analysis suggested VP39 and AC141 directly interact with the D. melanogaster KLC TPR domain. However, the yeast two hybrid data from this study indicates there is no direct interaction between AC141 or VP39 with lepidopteran KHC or KLC, which would suggest other nucleocapsid proteins or cargo adapter proteins are required. Adapter proteins have been identified in other DNA viruses that include vaccinia virus, ASFV and HSV-1 which all interact with kinesin-1 to enable egress from infected cells. The F12 KLC like protein encoded by vaccinia virus is responsible for recruitment of kinesin-1 to the cytoplasm of virion assembly (128, 129). F12 contains a tryptophan-aspartic Acid (WD) motif similar to that found in cellular kinesin-1 binding proteins. A second vaccinia   207  virus protein, A36R, also contains a WD motif and is reported to directly interact with the KLC TPR domain for anterograde transport but results have been contradictory (120, 122, 128). Bioinformatic analysis of the AcMNPV proteome did not identify any WD motifs (data not shown) but one of the many proteins with unknown function may serve a similar role. In Vero cells the ASFV viral capsid protein, p73, recruits kinesin-1, via the KLC TPR domain, to viral assembly sites in the perinuclear region and then utilizes it for virion anterograde transport to the plasma membrane (137).HSV-1, one of the most well studied viruses for anterograde microtubule transport, utilizes the virion protein US11 to bind directly to the kinesin-1 KHC heptad repeat (135, 298).  VP39 the major AcMNPV nucleocapsid protein, co-immunoprecipitated with kinesin-1 but did not show any interaction in yeast-2-hybrid assays (Chapter 3) suggesting other nucleocapsid proteins may be required. Based on the results of this study other potential nucleocapsid proteins that can be examined are FP25 and ODV/BV-C42 which also immunoprecipitated with kinesin1 proteins. I performed preliminary experiments with FP25 and ODV/BC-C42 to examine their relationship to kinesin-1. Confocal microscopy was used to examine co-localization of FP25 and BV/ODV-C42 with N-Myc-KLC (Figure 7.1 A and B). FP25 was found to be predominantly cytoplasmic as was previously reported (191) and co-localized with N-Myc-KLC at distinct regions in the cytoplasm but mainly towards the cellular periphery (Figure 7.1B). BV/ODV-C42 localized predominately outside the virogenic stroma in the nucleus. Lower levels are   208  observed in the stroma and the distribution was diffuse. BV/ODV-C42 was also observed in the cytoplasm at very low levels relative to nuclear levels. However, specific foci of BV/ODV-C42 were detected at the cellular plasma membrane, an observation that was reported previously (192). The intense foci of BV/ODV-C42 at the plasma membrane are reminiscent of the budding sites observed with ME53 and GP64 (Chapter 4; (96)). The BV/ODV-C42 foci did not show co-localization with N-Myc-KLC. However, co-localization was observed below the foci and throughout the cytoplasm (Arrows Figure 7.1B, Enlarged). It is possible that the BV/ODV-C42 foci at the plasma membrane represent nucleocapsids that have been delivered to budding sites and are no longer associated with microtubules and kinesin-1. These results support the possibility that FP25 and ODV/BV-C42 binds kinesin-1 but additional studies are required.   209   Figure 7.1 Association of the nucleocapsid proteins FP25 and BV/ODV-C42 with N-Myc-KLC. Co-localization at 24hpi of N-Myc-KLC with A) FP25 or B) BV/ODV-C42 in WT virus infected (MOI=10) N-Myc-KLC cells (see Chapter 3). FP25 was detected with rabbit polyclonal anti-FP25 and goat anti-rabbit alexa488 (green). B) BV/ODV-C42 was   210  detected with rabbit polyclonal anti-BV/ODV-C42 and goat anti rabbit alexa488 (green). The foci of BV/ODV-C42 that are co-localizing with N-Myc-KLC are shown with white arrows. N-Myc-KLC was detected with mouse monoclonal anti-Myc and goat anti-mouse alexa647 (red). Nuclei were detected using DAPI (blue).     211  Overall the data from my thesis and from prior studies (109, 205) indicate that anterograde transport of AcMNPV nucleocapsids utilizes the microtubule transport system. This is in contrast with viral entry, where it has been clearly demonstrated that AcMNPV BV nucleocapsids utilize very effectively actin polymerization for retrograde transport, propelling nucleocapsids to the NPC and enabling transit into the nucleus (44, 45, 50, 204). The question therefore arises why an alternate transport system is utilized for anterograde transport. Firstly, newly synthesized nucleocapsids do not exit the nucleus through the NPC but by transit through the nuclear envelope possibly by budding (85, 202). Once nucleocapsids have traversed the nuclear envelope, microtubule transport has the distinct advantage over actin transport due to its directionality (142, 211).However, if the P78/83-Arp2/3 complex is active on egressing nucleocapsids this activity would potentially compete with microtubule transport. This would be energetically wasteful and potentially fatal for the virus if nucleocapsids do not escape from the infected cell rapidly. It has recently been demonstrated that P78/83 has a multifunctional regulatory sequence near its N-terminus that serves as a degron, which enables, integration into nucleocapsids, and also interaction with BV/ODV-C42 (47). In order for P78/83 to polymerize actin it requires the association of BV/ODV-C42 which regulates active and inactive forms of P78/83 (261). It has been hypothesized by Li et al. (261) that BV/ODV-C42 may regulate P78/83 phosphorylation by coordinating interaction with kinases. It is therefore possible that the nucleocapsids that egress from the nucleus and traverse the plasma membrane could contain an inactive form of P78/83   212  and thus prevent actin polymerization from competing with microtubule-kinesin-1 transport. However, once the nucleocapsids reach the plasma membrane, it has been suggested that they need to interact with actin to provide the motive force for the budding process at the plasma membrane (44). For example vaccinia virus regulates the switch from microtubules to actin at the plasma membrane by phosphorylation events and recruitment of the SRC kinase (299). Activating P78/83 as nucleocapsids bud from the plasma membrane would also ensure that upon reinfection, BV will have a functioning actin polymerization complex upon entry for transport to the nucleus. Phosphorylation of P78/83 may therefore be playing a role in microtubule transport of AcMNPV nucleocapsids but further studies will be required to dissect this complex pathway. 7.1.1 Future directions to elucidate the AcMNPV nucleocapsid interaction with microtubules Chapter 3 has provided strong evidence that microtubules are required for AcMNPV nucleocapsid egress. However, further studies will need to be done to definitively identify viral proteins or domains that interact with kinesin-1 or alternatively to cargo adaptor molecules to enable microtubule transport. Prior studies with HSV-1 using live cell imaging have been able to show virions utilizing microtubules labeled with GFP for transport (300). A similar approach could be used with AcMNPV nucleocapsids expressing VP39-3xmCherry combined with cells expressing alpha- or betatubulin fused   213  to EGFP. Another approach could be to expand the yeast 2-hybrid screen using all viral proteins to identify the viral protein that interacts with kinesin-1.  7.2 Possible role of AC141 at the plasma membrane during budding The results from chapter 4 showed that AC141 is associated with the budding foci formed by GP64 and ME53 at the plasma membrane. In plasmid transfected cells ME53 and GP64 do not form foci (96). Therefore, it was hypothesized that AC141 might enable foci formation. Co-transfections with AC141 did result in a higher concentration of ME53 at the plasma membrane but specific foci with GP64 were not observed. Foci formation may therefore require additional viral proteins. However, AC141 alone in plasmid transfected cells had a punctate distribution that was primarily in the nucleus which is completely different from infected cells where it is concentrated at the inner-nuclear and plasma membranes. A punctate appearance is classic for a RING domain E3 ubiquitin ligase and is similar to AcMNPV IE2 and PE38 E3 ligases in infected cells. The co-immunoprecipitation and MS results from chapter 5 have shown that AC141 interacts with vUbi. It is possible therefore that AC141 interaction with vUbi is necessary for the ME53-GP64 foci at the plasma membrane. The role of AC141 with ME53-GP64 foci remains to be determined but several functions could be hypothesized. For example, ubiquitination of viral proteins has been shown to   214  be the signal to enable budding of viruses from the plasma membrane for DNA and RNA viruses. For example, the HIV Gag matrix protein is ubiquitinated and recruits host Tsg101, Alix and other components of the ESCRT pathway involved in the evagination and pinching off of the plasma membrane (169, 229). The association of AC141 at the budding site might serve a similar role and enable ubiquitination of target proteins at the plasma membrane recruiting components of the ESCRT pathway to enable nucleocapsid budding. In support of this model is the study by Li et al. (178) that the ESCRT pathway protein VPS4 is required for AcMNPV budding.  Both AC141 and ME53 are nucleocapsid proteins and both are required for BV production (86, 96). Deletion of the me53 gene results in reduced BV production without affecting the viral DNA replication and suggesting ME53 might be specially required for BV formation (98). Currently an important question for ME53 function is to determine at which step during infection ME53 is required for BV production. For example, it is known that deletion of ac141 results in nucleocapsids unable to exit the nucleus (86). Similarly deletion of gp64 restricts the virus infection to single cell infection and nucleocapsids accumulate at the plasma membrane (40, 41). I tried a different approach using confocal microscopy to analyze cells that had been transfected with ac141, gp64 and me53 knockout bacmids that were repaired with vp39-3xmCherry that enable the visualization of fluorescently labelled nucleocapsids. All three viruses do not produce BV (or only at extremely low levels). Cells were examined by confocal microscopy to   215  determine the localization of nucleocapsids but the results were inconclusive. VP39-3xmCherry was found to be diffuse throughout the cytoplasm and the nucleus for all constructs and no fluorescent nucleocapsids could be identified (data not shown). This surprising result shows that cells transfected by bacmids instead of using virion appear to result in cellular localization of VP39. The VP39 localization in transfected cells appears to be significantly different from what is observed in infected cells.  As indicated above ME53, GP64 and AC141 foci are speculated to be regions of nucleocapsid budding to form BV. However, no direct evidence of budding from these sites has been observed. To address this question I performed live-cell imaging in cells expressing VP39-mCherry and ME53:GFP. The intent was to capture images of budding nucleocapsids co-localizing with ME53:GFP. Initially cells were co-infected with the two viruses, one expressing VP39-3xmCherry and the other ME53:GFP, and live cells were examined by  confocal microscopy. Using this approach budding VP39-3xmCherry fluorescent nucleocapsids could be detected but not in cells expressing detectable levels of ME53:GFP. In a second approach cells were first transfected with a plasmid expressing ME53:GFP and at 48 hpt cells were infected with VP39-3xmCherry expressing virus followed by confocal microscopy. Surprisingly cells that expressed high levels of ME53:GFP showed low levels of VP39-3xmCherry expression and no fluorescent nucleocapsids were detected. These results suggest that generating a single   216  recombinant virus that expresses both VP39-3xmCherry and ME53:GFP might be able to provide sufficient expression of both proteins allowing for a more detailed analysis. 7.2.1 Future directions to determine the mechanism of budding of nucleocapsids at the plasma membrane  The analysis of GP64, ME53, AC141 indicated they colocalize at potential budding foci. Plasmid transfection experiments transiently expressing GP64, ME53, AC141 did not form foci. However, AC141 did appear to cause ME53 relocalization. Due to the interaction of AC141 and vUbi it is possible that vUbi is required for foci formation. To determine the possible role of vUbi in the formation of the budding complex, additional studies will need to be done that co-transfect plasmids expressing GP64, ME53, AC141 and vUbi. Similar experiments could be expanded to include a panel of expression plasmids representing all AcMNPV ORFs. Deletion of me53 results in almost complete reduction of BV but it is still not known at what egress step nucleocapsids are block. Electron microscopy of cells transfected with me53 deleted virus would be the most effective method to determine where nucleocapsids are located in the absence of ME53. The identification of a nuclear localization signal on ME53 suggests that this protein has roles both in the nucleus and at the plasma membrane (97).    217  7.3 Viral-ubiquitination of virion proteins as a potential signal to label nucleocapsids for egress from the nucleus to form BV The studies in Chapter 5 showed that AC66 was potentially the 100 kDa nucleocapsid protein that was ubiquitinated by vUbi in BV but not in ODV. We have therefore hypothesized that viral ubiquitination of AC66 could be the signal that determines if a nucleocapsid will be exported from the nucleus to become a BV. The concentration of AC141 in the RING zone of infected nuclei ((86) and Chapter 3, 4, 5) where newly assembled nucleocapsids accumulate would agree with this model. Interestingly, the ubiquitination of HSV-1 proteins have also been shown to play an important role for the egress of capsids from the nucleus and subsequent movement in the cytoplasm. The large HSV-1-1 tegument protein pUL36 (VP1/2) is required for egress from the nucleus and in addition required for cytoplasmic trafficking along the microtubules with dynein/dynactin complex (278, 279, 301-303). Recently it was found that a conserved ubiquitination site in pUL36 is critical for virulence and addition of ubiquitin is necessary for the persistent retrograde axonal transport (280). In addition to being a substrate for ubiquitination, pUL36 also acts as a deubiquitinase and these activities might be the molecular switch that regulates virus invasion of the nervous system (280). Hence a similar molecular switch mechanism could be hypothesized via ubiquitination of AC66 for egress of AcMNPV nucleocapsids from the nucleus. In addition, a proline rich sequence in the C-terminus of pUL36 was shown to interact with dynein/dynactin complex and required for   218  retrograde axon transport (303). AC66 also has proline rich sequences in the N-terminal region (amino acid 97-142) which might function similar to pUL36. AC66 also has a conserved N-terminal desmoplankin domain that is adjacent to the proline rich domain (87). Desmoplankin is a component of mature desmosomes and essential for maturation of adherent junctions where the C-terminus of desmoplankin interacts with intermediate filaments and can regulate microtubule reorganisation (283, 284, 304). As part of the reorganisation of microtubules, desmoplankins have also been shown to recruit microtubule-associated proteins Lis1, Nedl1, CLIP170 (304). LisI and Ndel1 interact with microtubules and with the help of CLIP170, this complex regulate dynein motor activity (305-308). It is possible that AC66 mediates the binding of nucleocapsids with dynein with its desmoplankin domain by recruiting the host dynein microtubule transport system. AC66 might also bind directly with the dynein/dynactin complex protein with the help of its proline rich domain in the N-terminus to couple nuclear egress and successive transport to the centrosomes and hand-off to kinesins for transport to the plasma membrane.  MS results of co-immunoprecipitation complexes indicated that AC66, vUbi and AC141 are interacting. Also associated with this complex is a 75-85 kDa protein that is detected with AC141 polyclonal antibody which is approximately 45 kDa larger than native AC141 (Figure 5.9). As our data showed that AC141 is ubiquitinated it would suggest that this high molecular band is poly- or multiubiquitinated AC141 that specifically   219  interacts with AC66. As both AC66 and AC141 have been shown to be required specifically for the egress of nucleocapsids from the nucleus (86, 87) these observation support the hypothesis that viral-ubiquitination is a potential signal for the nucleocapsids to become BV. 7.3.1 Future directions to elucidate the role of AC66 in egress of nucleocapsids from nucleus The results of this study have led to the hypothesis that AC141 mediates the transfer of vUbi from an E2 to AC66. In vitro ubiquitination analysis with purified AC141, vUbi and AC66 may enable direct examination of ubiquitination events involving these proteins. Ubiquitination of AC66 might be critical step for BV formation and mutation of the predicted ubiquitination sites may impact BV production. Deletion of the AC66 desmoplakin domain could provide more insight into the role of this conserved motif in BV production and possible additional roles in utilizing the cytoskeleton for nucleocapsid transport.  7.4 Concluding remarks Based on the cumulative results of this thesis a schematic model was developed for a possible mechanism of nucleocapsid nuclear egress and transport to the plasma   220  membrane to form BV (Figure 7.2). Nucleocapsids synthesized within virogenic stroma are transported to the nuclear periphery regions via VP80 (82). To identify nucleocapsids destined for BV and not ODV, nucleocapsid-associated AC66 gets ubiquitinated with viral ubiquitin potentially by AC141. Nucleocapsids that do not have AC66 ubiquitinated with vUbi are not able to egress from the nucleus and hence form ODV. After nucleocapsid egress from the nucleus, the desmoplankin domain of AC66 might associate with dynein/dynactin complex for retrograde transport to centrosomes.At centrosomes, other nucleocapsid proteins interact with kinesin-1 for anterograde movement to the plasma membrane (Figure 7.2). To enable budding at the plasma membrane, nucleocapsid associated BV/ODV-C42 activates P78/83 which can then induce actin polymerisation which causes the evaginations of the plasma membrane. AC141 present at the cellular periphery ubiquitinates a viral or host protein that recruits the host ESCRT pathway for final scission from the plasma membrane to form BV. In conclusion the results of this thesis has enhanced the knowledge of the baculovirus infection cycle with particular emphasis on the molecular mechanisms of nucleocapsid nuclear egress, nucleocapsid transport in the cytoplasm and nucleocapsid budding at the plasma membrane. Due to the environmental costs of chemical pesticides, there is increasing demand for safe and effective methods of insect control. As a result it is likely that the use of baculoviruses as biological pesticides for the control of insects will be expanding. Understanding how these viruses infect and kill their hosts may provide   221  critical insights that permit development of new and effective viral control agents. Most importantly, these studies have provided fundamental new insights into baculovirus life cycle.     222    Figure 7.2 Hypothetical model for nucleocapsid egress and BV formation. 1. Nucleocapsids are synthesized inside the virogenic stroma and AC66 being the structural protein is already with the nucleocapsid. 2. Nucleocapsids either bud out to form BV or stay inside the nucleus to form ODV 3. AC141 binds E2 loaded with vUbi and AC66 bound nucleocapsid as substrate. AC141 catalyze the transfer of vUbi to nucleocapsids associated AC66. 4. AC66 viral-ubiquitinated is the signal for   223  nucleocapsids egress from nucleus. 5. Nucleocapsid bud from the nuclear envelope by an unknown mechanism. 6. Desmoplakin domain of AC66 interacts with dynein and dynactin complex after egress from the nucleus for movement towards microtubule organising center (MTOC). 7. Nucleocapsid proteins interact with kinesin-1 motor protein for movement from MTOC toward cellular periphery. 8. Nucleocapsid is handed over to actin at the cellular periphery, where BV/ODV-C42 activates phosphoprotein P78/83 and induces actin polymerisation for budding. 9. Cellular periphery localized AC141 ubiquitinates a viral or host protein that recruits host ESCRT pathway for final scission of BV from the plasma membrane.    224  References  1. Jehle JA, Blissard GW, Bonning BC, Cory JS, Herniou EA, Rohrmann GF, Theilmann DA, Thiem SM, Vlak JM. 2006. On the classification and nomenclature of baculoviruses: A proposal for revision. Arch. Virol. 151:1257-1266. 2. de A. Zanotto PM, Kessing BD, Maruniak JE. 1993. Phylogenetic Interrelationships among Baculoviruses: Evolutionary Rates and Host Associations. J. Invet. Patho. 62:147-164. 3. Long G, Pan X, Kormelink R, Vlak JM. 2006. Functional entry of baculovirus into insect and mammalian cells is dependent on clathrin-mediated endocytosis. J. Virol. 80:8830-8833. 4. Volkman LE, Summers MD, Hsieh CH. 1976. Occluded and nonoccluded nuclear polyhedrosis virus grown in Trichoplusia ni: comparative neutralization comparative infectivity, and in vitro growth studies. J. Virol. 19:820-832. 5. Moscardi F. 1999. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44:257-289. 6. Oliveira JV, Wolff JL, Garcia-Maruniak A, Ribeiro BM, de Castro ME, de Souza ML, Moscardi F, Maruniak JE, Zanotto PM. 2006. Genome of the most widely used viral biopesticide: Anticarsia gemmatalis multiple nucleopolyhedrovirus. J. Gen. Virol. 87:3233-3250. 7. Lacey LA, Thomson D, Vincent C, Arthurs SP. 2008. Codling moth granulovirus: a comprehensive review. Biocontrol Science and Technology 18:639-663. 8. Sun X-l, Peng H-y. 2007. Recent advances in biological control of pest insects by using viruses in China. Virol. Sin. 22:158-162. 9. O'Reilly DR, Miller LK. 1991. Improvement of a Baculovirus Pesticide by Deletion of the EGT Gene. Nat Biotech 9:1086-1089. 10. Stewart LM, Hirst M, Lopez Ferber M, Merryweather AT, Cayley PJ, Possee RD. 1991. Construction of an improved baculovirus insecticide containing an insect-specific toxin gene. Nature 352:85-88. 11. Tomalski MD, Miller LK. 1991. Insect paralysis by baculovirus-mediated expression of a mite neurotoxin gene. Nature 352:82-85. 12. O'Reilly DR, Miller LK. 1989. A baculovirus blocks insect molting by producing ecdysteroid UDP-glucosyl transferase. Science 245:1110-1112. 13. Huser A, Hofmann C. 2003. Baculovirus vectors: novel mammalian cell gene-delivery vehicles and their applications. Am. J. Pharmacogenomics 3:53-63. 14. Felberbaum RS. 2015. The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors. Biotechnol J 10:702-714.   225  15. Kost TA, Condreay JP, Jarvis DL. 2005. Baculovirus as versatile vectors for protein expression in insect and mammalian cells. Nat. Biotechnol. 23:567-575. 16. Pieroni L, La Monica N. 2001. Towards the use of baculovirus as a gene therapy vector. Curr. Opin. Mol. Ther. 3:464-467. 17. Rubinstein R, Polson A. 1983. Midgut and viral associated proteases of Heliothis armigera. Intervirology 19:16-25. 18. Wang P, Granados RR. 1997. An intestinal mucin is the target substrate for a baculovirus enhancin. Proc. Natl. Acad. Sci. U. S. A. 94:6977-6982. 19. Toprak U, Harris S, Baldwin D, Theilmann D, Gillott C, Hegedus DD, Erlandson MA. 2012. Role of enhancin in Mamestra configurata nucleopolyhedrovirus virulence: selective degradation of host peritrophic matrix proteins. J. Gen. Virol. 93:744-753. 20. Washburn JO, Kirkpatrick BA, Volkman LE. 1995. Comparative pathogenesis of Autographa californica M nuclear polyhedrosis virus in larvae of Trichoplusia ni and Heliothis virescens. Virology 209:561-568. 21. Engelhard EK, Kam-Morgan LN, Washburn JO, Volkman LE. 1994. The insect tracheal system: a conduit for the systemic spread of Autographa californica M nuclear polyhedrosis virus. Proc. Natl. Acad. Sci. U. S. A. 91:3224-3227. 22. Faulkner P, Kuzio J, Williams GV, Wilson JA. 1997. Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. J. Gen. Virol. 78 ( Pt 12):3091-3100. 23. Pijlman GP, Pruijssers AJ, Vlak JM. 2003. Identification of pif-2, a third conserved baculovirus gene required for per os infection of insects. J. Gen. Virol. 84:2041-2049. 24. Ohkawa T, Washburn JO, Sitapara R, Sid E, Volkman LE. 2005. Specific binding of Autographa californica M nucleopolyhedrovirus occlusion-derived virus to midgut cells of Heliothis virescens larvae is mediated by products of pif genes Ac119 and Ac022 but not by Ac115. J. Virol. 79:15258-15264. 25. Fang M, Nie Y, Harris S, Erlandson MA, Theilmann DA. 2009. Autographa californica multiple nucleopolyhedrovirus core gene ac96 encodes a per Os infectivity factor (PIF-4). J. Virol. 83:12569-12578. 26. Harrison RL, Sparks WO, Bonning BC. 2010. Autographa californica multiple nucleopolyhedrovirus ODV-E56 envelope protein is required for oral infectivity and can be substituted functionally by Rachiplusia ou multiple nucleopolyhedrovirus ODV-E56. J. Gen. Virol. 91:1173-1182. 27. Nie Y, Fang M, Erlandson MA, Theilmann DA. 2012. Analysis of the Autographa californica multiple nucleopolyhedrovirus overlapping gene pair lef3 and ac68 reveals that AC68 is a per os infectivity factor and that LEF3 is critical, but not essential, for virus replication. J. Virol. 86:3985-3994.   226  28. Zhu S, Wang W, Wang Y, Yuan M, Yang K. 2013. The baculovirus core gene ac83 is required for nucleocapsid assembly and per os infectivity of Autographa californica nucleopolyhedrovirus. J. Virol. 87:10573-10586. 29. Javed MA, Biswas S, Willis LG, Harris S, Pritchard C, van Oers MM, Donly BC, Erlandson MA, Hegedus DD, Theilmann DA. 2017. Autographa californica Multiple Nucleopolyhedrovirus AC83 is a Per Os Infectivity Factor (PIF) Protein Required for Occlusion-Derived Virus (ODV) and Budded Virus Nucleocapsid Assembly as well as Assembly of the PIF Complex in ODV Envelopes. J. Virol 91. 30. Peng K, van Oers MM, Hu Z, van Lent JW, Vlak JM. 2010. Baculovirus per os infectivity factors form a complex on the surface of occlusion-derived virus. J. Virol. 84:9497-9504. 31. Peng K, van Lent JW, Boeren S, Fang M, Theilmann DA, Erlandson MA, Vlak JM, van Oers MM. 2012. Characterization of novel components of the baculovirus per os infectivity factor complex. J. Virol. 86:4981-4988. 32. Huang Z, Pan M, Zhu S, Zhang H, Wu W, Yuan M, Yang K. 2017. The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly. J. Virol. 91. 33. Herniou EA, Olszewski JA, Cory JS, O'Reilly DR. 2003. The genome sequence and evolution of baculoviruses. Annu. Rev. Entomol. 48:211-234. 34. Hefferon KL, Oomens AG, Monsma SA, Finnerty CM, Blissard GW.  1999. Host cell receptor binding by baculovirus GP64 and kinetics of virion entry. Virology 258:455-468. 35. Hofmann C, Sandig V, Jennings G, Rudolph M, Schlag P, Strauss M.  1995. Efficient gene transfer into human hepatocytes by baculovirus vectors. Proc. Natl. Acad. Sci. U. S. A. 92:10099-10103. 36. Garry CE, Garry RF. 2008. Proteomics computational analyses suggest that baculovirus GP64 superfamily proteins are class III penetrenes. Virol J. 5:28. 37. Westenberg M, Wang H, WF IJ, Goldbach RW, Vlak JM, Zuidema D. 2002. Furin is involved in baculovirus envelope fusion protein activation. J. Virol. 76:178-184. 38. Kadlec J, Loureiro S, Abrescia NG, Stuart DI, Jones IM. 2008. The postfusion structure of baculovirus gp64 supports a unified view of viral fusion machines. Nat. Struct. Mol. Biol. 15:1024-1030. 39. Kataoka C, Kaname Y, Taguwa S, Abe T, Fukuhara T, Tani H, Moriishi K, Matsuura Y. 2012. Baculovirus GP64-mediated entry into mammalian cells. J. Virol. 86:2610-2620. 40. Oomens AG, Blissard GW. 1999. Requirement for GP64 to drive efficient budding of Autographa californica multicapsid nucleopolyhedrovirus. Virology 254:297-314.   227  41. Monsma SA, Oomens AG, Blissard GW. 1996. The GP64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. J. Virol. 70:4607-4616. 42. Lung OY, Cruz-Alvarez M, Blissard GW. 2003. Ac23, an envelope fusion protein homolog in the baculovirus Autographa californica multicapsid nucleopolyhedrovirus, is a viral pathogenicity factor. J. Virol. 77:328-339. 43. Ardisson-Araujo DM, Melo FL, Clem RJ, Wolff JL, Ribeiro BM. 2015. A Betabaculovirus-Encoded gp64 Homolog Codes for a Functional Envelope Fusion Protein. J. Virol. 90:1668-1672. 44. Ohkawa T, Volkman LE, Welch MD. 2010. Actin-based motility drives baculovirus transit to the nucleus and cell surface. J. Cell Biol. 190:187-195. 45. Mueller J, Pfanzelter J, Winkler C, Narita A, Le Clainche C, Nemethova M, Carlier MF, Maeda Y, Welch MD, Ohkawa T, Schmeiser C, Resch GP, Small JV. 2014. Electron tomography and simulation of baculovirus actin comet tails support a tethered filament model of pathogen propulsion. PLoS Biol. 12:e1001765. 46. Lanier LM, Volkman LE. 1998. Actin binding and nucleation by Autographa california M nucleopolyhedrovirus. Virology 243:167-177. 47. Wang Y, Zhang Y, Han S, Hu X, Zhou Y, Mu J, Pei R, Wu C, Chen X.  2015. Identification of a Novel Regulatory Sequence of Actin Nucleation Promoting Factor Encoded by Autographa californica Multiple Nucleopolyhedrovirus. J. Biol. Chem. 290:9533-9541. 48. Goley ED, Ohkawa T, Mancuso J, Woodruff JB, D'Alessio JA, Cande WZ, Volkman LE, Welch MD. 2006. Dynamic nuclear actin assembly by Arp2/3 complex and a baculovirus WASP-like protein. Science 314:464-467. 49. Cohen S, Au S, Pante N. 2011. How viruses access the nucleus. Biochim. Biophys. Acta 1813:1634-1645. 50. Au S, Wu W, Pante N. 2013. Baculovirus nuclear import: open, nuclear pore complex (NPC) sesame. Viruses 5:1885-1900. 51. Au S, Wu W, Zhou L, Theilmann DA, Pante N. 2016. A new mechanism for nuclear import by actin-based propulsion used by a baculovirus nucleocapsid. J. Cell Sci. 129:2905-2911. 52. Hoopes RR, Jr., Rohrmann GF. 1991. In vitro transcription of baculovirus immediate early genes: accurate mRNA initiation by nuclear extracts from both insect and human cells. Proc. Natl. Acad. Sci. U. S. A. 88:4513-4517. 53. Blissard GW, Kogan PH, Wei R, Rohrmann GF. 1992. A synthetic early promoter from a baculovirus: roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription. Virology 190:783-793. 54. Shippam C, Wu X, Stewart S, Theilmann DA. 1997. Characterization of a unique OpMNPV-specific early gene not required for viral infection in tissue culture. Virology 227:447-459.   228  55. Guarino LA, Gonzalez MA, Summers MD. 1986. Complete Sequence and Enhancer Function of the Homologous DNA Regions of Autographa californica Nuclear Polyhedrosis Virus. J. Virol. 60:224-229. 56. Theilmann DA, Stewart S. 1992. Tandemly repeated sequence at the 3' end of the IE-2 gene of the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus is an enhancer element. Virology 187:97-106. 57. Stewart TATA, Huijskens II, Willis LGWLG, Theilmann DATDA. 2005. The Autographa californica multiple nucleopolyhedrovirus ie0-ie1 gene complex is essential for wild-type virus replication, but either IE0 or IE1 can support virus growth. J. Virol. 79:4619-4629. 58. Huijskens I, Li L, Willis LG, Theilmann DA. 2004. Role of AcMNPV IE0 in baculovirus very late gene activation. Virology 323:120-130. 59. Fuchs LY, Woods MS, Weaver RF. 1983. Viral transcription during Autographa californica nuclear polyhedrosis vrus infection: a novel RNA polymerase induced in infected Spodoptera frugiperda cells. J. Virol. 48:641-646. 60. Miller LK, Jewell JE, Browne D. 1981. Baculovirus induction of a DNA polymerase. J. Virol. 40:305-308. 61. Huh NE, Weaver RF. 1990. Identifying the RNA polymerases that synthesize specific transcripts of the Autographa californica nuclear polyhedrosis virus. J. Gen. Virol. 71 ( Pt 1):195-201. 62. Guarino LA, Xu B, Jin J, Dong W. 1998. A virus-encoded RNA polymerase purified from baculovirus-infected cells. J. Virol. 72:7985-7991. 63. Morris TD, Miller LK. 1994. Mutational analysis of a baculovirus major late promoter. Gene 140:147-153. 64. Ooi BG, Rankin C, Miller LK. 1989. Downstream sequences augment transcription from the essential initiation site of a baculovirus polyhedrin gene. J. Mol. Biol. 210:721-736. 65. Rankin C, Ooi BG, Miller LK. 1988. Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70:39-49. 66. McLachlin JR, Miller LK. 1994. Identification and characterization of vlf-1, a baculovirus gene involved in very late gene expression. J. Virol. 68:7746-7756. 67. Mistretta TA, Guarino LA. 2005. Transcriptional activity of baculovirus very late factor 1. J. Virol. 79:1958-1960. 68. Yang S, Miller LK. 1998. Control of baculovirus polyhedrin gene expression by very late factor 1. Virology 248:131-138. 69. Yang S, Miller LK. 1998. Expression and mutational analysis of the baculovirus very late factor 1 (vlf-1) gene. Virology 245:99-109. 70. Vlak JM, Klinkenberg FA, Zaal KJ, Usmany M, Klinge -Roode EC, Geervliet JB, Roosien J, van Lent JW. 1988. Functional studies on the p10 gene of Autographa californica nuclear polyhedrosis virus using a recombinant   229  expressing a p10-beta-galactosidase fusion gene. J. Gen. Virol. 69 ( Pt 4):765-776. 71. Pearson M, Bjornson R, Pearson G, Rohrmann G. 1992. The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257:1382-1384. 72. McDougal VV, Guarino LA. 1999. Autographa californica nuclear polyhedrosis virus DNA polymerase: measurements of processivity and strand displacement. J. Virol. 73:4908-4918. 73. Tomalski MD, Wu JG, Miller LK. 1988. The location, sequence, transcription, and regulation of a baculovirus DNA polymerase gene. Virology 167:591-600. 74. Evans JT, Leisy DJ, Rohrmann GF. 1997. Characterization of the interaction between the baculovirus replication factors LEF-1 and LEF-2. J. Virol. 71:3114-3119. 75. Hang X, Dong W, Guarino LA. 1995. The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. J. Virol. 69:3924-3928. 76. Mikhailov VS, Okano K, Rohrmann GF. 2005. The redox state of the baculovirus single-stranded DNA-binding protein LEF-3 regulates its DNA binding, unwinding, and annealing activities. J. Biol. Chem. 280:29444-29453. 77. Mikhailov VS, Vanarsdall AL, Rohrmann GF. 2008. Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus. Virology 370:415-429. 78. Vanarsdall AL, Mikhailov VS, Rohrmann GF. 2007. Characterization of a baculovirus lacking the DBP (DNA-binding protein) gene. Virology 364:475-485. 79. McDougal VV, Guarino LA. 2000. The Autographa californica nuclear polyhedrosis virus p143 gene encodes a DNA helicase. J. Virol. 74:5273-5279. 80. McDougal VV, Guarino LA. 2001. DNA and ATP binding activities of the baculovirus DNA helicase P143. J. Virol. 75:7206-7209. 81. Lin G, Blissard GW. 2002. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. J. Virol. 76:2770-2779. 82. Marek M, Merten OW, Galibert L, Vlak JM, van Oers MM. 2011. Baculovirus VP80 protein and the F-actin cytoskeleton interact and connect the viral replication factory with the nuclear periphery. J. Virol. 85:5350-5362. 83. Marek M, van Oers MM, Devaraj FF, Vlak JM, Merten OW. 2011. Engineering of baculovirus vectors for the manufacture of virion-free biopharmaceuticals. Biotechnol. Bioeng. 108:1056-1067. 84. Fang M, Nie Y, Dai X, Theilmann DA. 2008. Identification of AcMNPV EXON0 (ac141) domains required for efficient production of budded virus, dimerization and association with BV/ODV-C42 and FP25. Virology 375:265-276.   230  85. Granados RR, Lawler KA. 1981. In vivo pathway of Autographa californica baculovirus invasion and infection. Virology 108:297-308. 86. Fang M, Dai X, Theilmann DA. 2007. Autographa californica multiple nucleopolyhedrovirus EXON0 (ORF141) is required for efficient egress of nucleocapsids from the nucleus. J. Virol. 81:9859-9869. 87. Ke J, Wang J, Deng R, Wang X. 2008. Autographa californica multiple nucleopolyhedrovirus ac66 is required for the efficient egress of nucleocapsids from the nucleus, general synthesis of preoccluded virions and occlusion body formation. Virology 374:421-431. 88. Olszewski J, Miller LK. 1997. A role for baculovirus GP41 in budded virus production. Virology 233:292-301. 89. Wang R, Deng F, Hou D, Zhao Y, Guo L, Wang H, Hu Z. 2010. Proteomics of the Autographa californica nucleopolyhedrovirus budded virions. J. Virol. 84:7233-7242. 90. Harrison RL, Jarvis DL, Summers MD. 1996. The role of the AcMNPV 25K gene, "FP25," in baculovirus polh and p10 expression. Virology 226:34-46. 91. Kelly BJ, Chapple SD, Allen C, Pritchard C, King LA, Possee RD.  2008. Extended budded virus formation and induction of apoptosis by an AcMNPV FP-25/p35 double mutant in Trichoplusia ni cells. Virus Res. 133:157-166. 92. Garretson TA, McCoy JC, Cheng XW. 2016. Baculovirus FP25K Localization: Role of the Coiled-Coil Domain. J. Virol. 90:9582-9597. 93. Garavaglia MJ, Miele SA, Iserte JA, Belaich MN, Ghiringhelli PD. 2012. The ac53, ac78, ac101, and ac103 genes are newly discovered core genes in the family Baculoviridae. J. Virol. 86:12069-12079. 94. Hou D, Zhang L, Deng F, Fang W, Wang R, Liu X, Guo L, Rayner S, Chen X, Wang H, Hu Z. 2013. Comparative proteomics reveal fundamental structural and functional differences between the two progeny phenotypes of a baculovirus. J. Virol. 87:829-839. 95. Whitford M, Faulkner P. 1992. A structural polypeptide of the baculovirus Autographa californica nuclear polyhedrosis virus contains O-linked N-acetylglucosamine. J. Virol. 66:3324-3329. 96. de Jong J, Theilmann DA, Arif BM, Krell PJ. 2011. Immediate-early protein ME53 forms foci and colocalizes with GP64 and the major capsid protein VP39 at the cell membranes of Autographa californica multiple nucleopolyhedrovirus-infected cells. J. Virol. 85:9696-9707. 97. Liu Y, de Jong J, Nagy E, Theilmann DA, Krell PJ. 2016. Nuclear Translocation Sequence and Region in Autographa californica Multiple Nucleopolyhedrovirus ME53 That Are Important for Optimal Baculovirus Production. J Virol 90:3953-3965.   231  98. de Jong J, Arif BM, Theilmann DA, Krell PJ. 2009. Autographa californica multiple nucleopolyhedrovirus me53 (ac140) is a nonessential gene required for efficient budded-virus production. J. Virol. 83:7440-7448. 99. Guarino LA. 1990. Identification of a viral gene encoding a ubiquitin-like protein. Proc. Natl. Acad. Sci. U. S. A. 87:409-413. 100. Reilly LM, Guarino LA. 1996. The viral ubiquitin gene of Autographa californica nuclear polyhedrosis virus is not essential for viral replication. Virology 218:243-247. 101. Lin XA, Chen Y, Xu WH, Yi YZ, Zhang ZF. 2008. Characterization of the Autographa californica nucleopolyhedrovirus ubiquitin gene promoter. Z. Naturforsch. C 63:277-283. 102. Braunagel SC, Russell WK, Rosas-Acosta G, Russell DH, Summers MD. 2003. Determination of the protein composition of the occlusion-derived virus of Autographa californica nucleopolyhedrovirus. Proc. Natl. Acad. Sci. U. S. A. 100:9797-9802. 103. Guarino LA, Smith G, Dong W. 1995. Ubiquitin is attached to membranes of baculovirus particles by a novel type of phospholipid anchor. Cell 80:301-309. 104. Haas AL, Katzung DJ, Reback PM, Guarino LA. 1996. Functional characterization of the ubiquitin variant encoded by the baculovirus Autographa californica. Biochemistry 35:5385-5394. 105. Guo ZJ, Zhu YM, Li GH, Chen KP, Zhang CX. 2011. Ubiquitins of Bombyx mori nucleopolyhedrovirus and Helicoverpa armigera nucleopolyhedrovirus show distinct subcellular localization in infected cells. Acta Virol. 55:101-106. 106. J VirolJackson PK, Eldridge AG, Freed E, Furstenthal L, Hsu JY, Kaiser BK, Reimann JD. 2000. The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol. 10:429-439. 107. Dai X, Stewart TM, Pathakamuri JA, Li Q, Theilmann DA. 2004. Autographa californica multiple nucleopolyhedrovirus exon0 (orf141), which encodes a RING finger protein, is required for efficient production of budded virus. J. Virol. 78:9633-9644. 108. Fang M, Nie Y, Theilmann DA. 2009. AcMNPV EXON0 (AC141) which is required for the efficient egress of budded virus nucleocapsids interacts with beta-tubulin. Virology 385:496-504. 109. Danquah JO, Botchway S, Jeshtadi A, King LA. 2012. Direct interaction of baculovirus capsid proteins VP39 and EXON0 with kinesin-1 in insect cells determined by fluorescence resonance energy transfer-fluorescence lifetime imaging microscopy. J. Virol. 86:844-853. 110. Hirokawa N, Noda Y, Tanaka Y, Niwa S. 2009. Kinesin superfamily motor proteins and intracellular transport. Nat. Rev. Mol. Cell Biol. 10:682-696. 111. Hirokawa N, Takemura R. 2005. Molecular motors and mechanisms of directional transport in neurons. Nat. Rev. Neurosci. 6:201-214.   232  112. Verhey KJ, Hammond JW. 2009. Traffic control: regulation of kinesin motors. Nat. Rev. Mol. Cell Biol. 10:765-777. 113. Miki H, Setou M, Kaneshiro K, Hirokawa N. 2001. All kinesin superfamily protein, KIF, genes in mouse and human. Proc. Natl. Acad. Sci. U. S. A. 98:7004-7011. 114. Sablin EP. 2000. Kinesins and microtubules: their structures and motor mechanisms. Curr. Opin. Cell Biol. 12:35-41. 115. Seiler S, Kirchner J, Horn C, Kallipolitou A, Woehlke G, Schliwa M.  2000. Cargo binding and regulatory sites in the tail of fungal conventional kinesin. Nat. Cell Biol. 2:333-338. 116. Dodding MP, Way M. 2011. Coupling viruses to dynein and kinesin-1. EMBO J. 30:3527-3539. 117. Hollinshead M, Rodger G, Van Eijl H, Law M, Hollinshead R, Vaux DJ, Smith GL. 2001. Vaccinia virus utilizes microtubules for movement to the cell surface. J. Cell Biol. 154:389-402. 118. Ploubidou A, Moreau V, Ashman K, Reckmann I, Gonzalez C, Way M.  2000. Vaccinia virus infection disrupts microtubule organization and centrosome function. EMBO J. 19:3932-3944. 119. Carter GC, Rodger G, Murphy BJ, Law M, Krauss O, Hollinshead M, Smith GL. 2003. Vaccinia virus cores are transported on microtubules. J. Gen. Virol. 84:2443-2458. 120. Rietdorf J, Ploubidou A, Reckmann I, Holmstrom A, Frischknecht F, Zettl M, Zimmermann T, Way M. 2001. Kinesin-dependent movement on microtubules precedes actin-based motility of vaccinia virus. Nat. Cell Biol. 3:992-1000. 121. Jeshtadi A, Burgos P, Stubbs CD, Parker AW, King LA, Skinner MA, Botchway SW. 2010. Interaction of poxvirus intracellular mature virion proteins with the TPR domain of kinesin light chain in live infected cells revealed by two-photon-induced fluorescence resonance energy transfer fluorescence lifetime imaging microscopy. J. Virol. 84:12886-12894. 122. Ward BM, Moss B. 2004. Vaccinia virus A36R membrane protein provides a direct link between intracellular enveloped virions and the microtubule motor kinesin. J. Virol. 78:2486-2493. 123. Ward BM, Moss B. 2001. Vaccinia virus intracellular movement is associated with microtubules and independent of actin tails. J. Virol. 75:11651-11663. 124. Dodding MP, Mitter R, Humphries AC, Way M. 2011. A kinesin-1 binding motif in vaccinia virus that is widespread throughout the human genome. EMBO J. 30:4523-4538. 125. Schepis A, Stauber T, Krijnse Locker J. 2007. Kinesin-1 plays multiple roles during the vaccinia virus life cycle. Cell. Microbiol. 9:1960-1973.   233  126. Dodding MP, Newsome TP, Collinson LM, Edwards C, Way M. 2009. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection. Cell. Microbiol. 11:808-824. 127. Johnston SC, Ward BM. 2009. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36. J. Virol. 83:1708-1717. 128. Morgan GW, Hollinshead M, Ferguson BJ, Murphy BJ, Carpentier DC, Smith GL. 2010. Vaccinia protein F12 has structural similarity to kinesin light chain and contains a motor binding motif required for virion export. PLoS Pathog. 6:e1000785. 129. Carpentier DC, Gao WN, Ewles H, Morgan GW, Smith GL. 2015. Vaccinia virus protein complex F12/E2 interacts with kinesin light chain isoform 2 to engage the kinesin-1 motor complex. PLoS Pathog. 11:e1004723. 130. Lynn H, Horsington J, Ter LK, Han S, Chew YL, Diefenbach RJ, Way M, Chaudhri G, Karupiah G, Newsome TP. 2012. Loss of cytoskeletal transport during egress critically attenuates ectromelia virus infection in vivo. J. Virol. 86:7427-7443. 131. Radtke K, Kieneke D, Wolfstein A, Michael K, Steffe n W, Scholz T, Karger A, Sodeik B. 2010. Plus- and minus-end directed microtubule motors bind simultaneously to herpes simplex virus capsids using different inner tegument structures. PLoS Pathog. 6:e1000991. 132. Miranda-Saksena M, Boadle RA, Diefenbach RJ, Cunningham AL. 2015. Dual Role of Herpes Simplex Virus 1 pUS9 in Virus Anterograde Axonal Transport and Final Assembly in Growth Cones in Distal Axons. J. Virol. 90:2653-2663. 133. Diefenbach RJ, Davis A, Miranda-Saksena M, Fernandez MA, Kelly BJ, Jones CA, LaVail JH, Xue J, Lai J, Cunningham AL. 2015. The Basic Domain of Herpes Simplex Virus 1 pUS9 Recruits Kinesin-1 To Facilitate Egress from Neurons. J. Virol. 90:2102-2111. 134. Kramer T, Greco TM, Taylor MP, Ambrosini AE, Cristea IM, Enquist LW.  2012. Kinesin-3 mediates axonal sorting and directional transport of alphaherpesvirus particles in neurons. Cell Host Microbe 12:806-814. 135. Diefenbach RJ, Miranda-Saksena M, Diefenbach E, Holland DJ, Boadle RA, Armati PJ, Cunningham AL. 2002. Herpes simplex virus tegument protein US11 interacts with conventional kinesin heavy chain. J. Virol. 76:3282-3291. 136. Sathish N, Zhu FX, Yuan Y. 2009. Kaposi's sarcoma-associated herpesvirus ORF45 interacts with kinesin-2 transporting viral capsid-tegument complexes along microtubules. PLoS Pathog. 5:e1000332. 137. Jouvenet N, Monaghan P, Way M, Wileman T. 2004. Transport of African swine fever virus from assembly sites to the plasma membrane is dependent on microtubules and conventional kinesin. J. Virol. 78:7990-8001.   234  138. Ward BM. 2011. The taking of the cytoskeleton one two three: how viruses utilize the cytoskeleton during egress. Virology 411:244-250. 139. Martinez NW, Xue X, Berro RG, Kreitzer G, Resh MD. 2008. Kinesin KIF4 regulates intracellular trafficking and stability of the human immunodeficiency virus type 1 Gag polyprotein. J. Virol. 82:9937-9950. 140. Tang Y, Winkler U, Freed EO, Torrey TA, Kim W, Li H, Goff SP, Morse HC, 3rd. 1999. Cellular motor protein KIF-4 associates with retroviral Gag. J. Virol. 73:10508-10513. 141. Kim W, Tang Y, Okada Y, Torrey TA, Chattopadhyay SK, Pfleiderer M, Falkner FG, Dorner F, Choi W, Hirokawa N, Morse HC, 3rd.  1998. Binding of murine leukemia virus Gag polyproteins to KIF4, a microtubule-based motor protein. J. Virol. 72:6898-6901. 142. Dohner K, Nagel CH, Sodeik B. 2005. Viral stop-and-go along microtubules: taking a ride with dynein and kinesins. Trends Microbiol. 13:320-327. 143. Strunze S, Engelke MF, Wang IH, Puntener D, Boucke K, Schleich S, Way M, Schoenenberger P, Burckhardt CJ, Greber UF. 2011. Kinesin-1-mediated capsid disassembly and disruption of the nuclear pore complex promote virus infection. Cell Host Microbe 10:210-223. 144. Fang S, Weissman AM. 2004. A field guide to ubiquitylation. Cell. Mol. Life Sci. 61:1546-1561. 145. Weissman AM. 2001. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell Biol. 2:169-178. 146. Morreale FE, Walden H. 2016. Types of Ubiquitin Ligases. Cell 165:248-248.e241. 147. Deshaies RJ, Joazeiro CA. 2009. RING domain E3 ubiquitin ligases. Annu. Rev. Biochem. 78:399-434. 148. Hatakeyama S, Yada M, Matsumoto M, Ishida N, Nakayama KI. 2001. U box proteins as a new family of ubiquitin-protein ligases. J. Biol. Chem. 276:33111-33120. 149. Patterson C. 2002. A new gun in town: the U box is a ubiquitin ligase domain. Sci. STKE 2002:pe4. 150. Smit JJ, Sixma TK. 2014. RBR E3-ligases at work. EMBO Rep 15:142-154. 151. Spratt DE, Walden H, Shaw GS. 2014. RBR E3 ubiquitin ligases: new structures, new insights, new questions. Biochem. J. 458:421-437. 152. Komander D. 2009. The emerging complexity of protein ubiquitination. Biochem. Soc. Trans. 37:937-953. 153. Husnjak K, Dikic I. 2012. Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annu. Rev. Biochem. 81:291-322. 154. Swatek KN, Komander D. 2016. Ubiquitin modifications. Cell Res. 26:399-422. 155. Gustin JK, Moses AV, Fruh K, Douglas JL. 2011. Viral takeover of the host ubiquitin system. Front Microbiol 2:161.   235  156. Boutell C, Sadis S, Everett RD. 2002. Herpes simplex virus type 1 immediate-early protein ICP0 and is isolated RING finger domain act as ubiquitin E3 ligases in vitro. J. Virol. 76:841-850. 157. Smith MC, Boutell C, Davido DJ. 2011. HSV-1 ICP0: paving the way for viral replication. Future Virol. 6:421-429. 158. Liu M, Schmidt EE, Halford WP. 2010. ICP0 dismantles microtubule networks in herpes simplex virus-infected cells. PLoS One 5:e10975. 159. Nerenberg BT, Taylor J, Bartee E, Gouveia K, Barry M, Fruh K.  2005. The poxviral RING protein p28 is a ubiquitin ligase that targets ubiquitin to viral replication factories. J. Virol. 79:597-601. 160. Huang J, Huang Q, Zhou X, Shen MM, Yen A, Yu SX, Dong G, Qu K, Huang P, Anderson EM, Daniel-Issakani S, Buller RM, Payan DG, Lu HH. 2004. The poxvirus p28 virulence factor is an E3 ubiquitin ligase. J. Biol. Chem. 279:54110-54116. 161. Imai N, Matsuda N, Tanaka K, Nakano A, Matsumoto S, Kang W. 2003. Ubiquitin ligase activities of Bombyx mori nucleopolyhedrovirus RING finger proteins. J. Virol. 77:923-930. 162. Green MC, Monser KP, Clem RJ. 2004. Ubiquitin protein ligase activity of the anti-apoptotic baculovirus protein Op-IAP3. Virus Res. 105:89-96. 163. Randow F, Lehner PJ. 2009. Viral avoidance and exploitation of the ubiquitin system. Nat. Cell Biol. 11:527-534. 164. Bruce MC, Kanelis V, Fouladkou F, Debonneville A, Staub O, Rotin D.  2008. Regulation of Nedd4-2 self-ubiquitination and stability by a PY motif located within its HECT-domain. Biochem. J. 415:155-163. 165. Martin-Serrano J, Eastman SW, Chung W, Bieniasz PD. 2005. HECT ubiquitin ligases link viral and cellular PPXY motifs to the vacuolar protein-sorting pathway. J. Cell Biol. 168:89-101. 166. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH, Wang HE, Wettstein DA, Stray KM, Cote M, Rich RL, Myszka DG, Sundquist WI. 2001. Tsg101 and the vacuolar protein sorting pathway are essential for HIV-1 budding. Cell 107:55-65. 167. VerPlank L, Bouamr F, LaGrassa TJ, Agresta B, Kikonyogo A, Leis J, Carter CA. 2001. Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55(Gag). Proc. Natl. Acad. Sci. U. S. A. 98:7724-7729. 168. Shields SB, Piper RC. 2011. How ubiquitin functions with ESCRTs. Traffic 12:1306-1317. 169. Sette P, Nagashima K, Piper RC, Bouamr F. 2013. Ubiquitin conjugation to Gag is essential for ESCRT-mediated HIV-1 budding. Retrovirology 10:79. 170. Kian Chua P, Lin MH, Shih C. 2006. Potent inhibition of human Hepatitis B virus replication by a host factor Vps4. Virology 354:1-6.   236  171. Lambert C, Doring T, Prange R. 2007. Hepatitis B virus maturation is sensitive to functional inhibition of ESCRT-III, Vps4, and gamma 2-adaptin. J. Virol. 81:9050-9060. 172. Watanabe T, Sorensen EM, Naito A, Schott M, Kim S, Ahlquist P. 2007. Involvement of host cellular multivesicular body functions in hepatitis B virus budding. Proc. Natl. Acad. Sci. U. S. A. 104:10205-10210. 173. Rost M, Mann S, Lambert C, Doring T, Thome N, Prange R. 2006. Gamma-adaptin, a novel ubiquitin-interacting adaptor, and Nedd4 ubiquitin ligase control hepatitis B virus maturation. J. Biol. Chem. 281:29297-29308. 174. Tandon R, AuCoin DP, Mocarski ES. 2009. Human cytomegalovirus exploits ESCRT machinery in the process of virion maturation. J. Virol. 83:10797-10807. 175. Crump CM, Yates C, Minson T. 2007. Herpes simplex virus type 1 cytoplasmic envelopment requires functional Vps4. J. Virol. 81:7380-7387. 176. Pawliczek T, Crump CM. 2009. Herpes simplex virus type 1 production requires a functional ESCRT-III complex but is independent of TSG101 and ALIX expression. J. Virol. 83:11254-11264. 177. Baumgartel V, Ivanchenko S, Dupont A, Sergeev M, Wiseman PW, Krausslich HG, Brauchle C, Muller B, Lamb DC. 2011. Live-cell visualization of dynamics of HIV budding site interactions with an ESCRT component. Nat. Cell Biol. 13:469-474. 178. Li Z, Blissard GW. 2012. Cellular VPS4 is required for efficient entry and egress of budded virions of Autographa californica multiple nucleopolyhedrovirus. J. Virol. 86:459-472. 179. Chen YR, Zhong S, Fei Z, Gao S, Zhang S, Li Z, Wang P, Blissard GW. 2014. Transcriptome responses of the host Trichoplusia ni to infection by the baculovirus Autographa californica multiple nucleopolyhedrovirus. J. Virol. 88:13781-13797. 180. Pfeifer TA, Guarna MM, Kwan EM, Lesnicki G, Theilmann DA, Grigliatti TA, Kilburn DG. 2001. Expression analysis of a modified factor X in stably transformed insect cell lines. Protein Expr. Purif. 23:233-241. 181. Pfeifer TA, Hegedus DD, Grigliatti TA, Theilmann DA. 1997. Baculovirus immediate-early promoter-mediated expression of the Zeocin resistance gene for use as a dominant selectable marker in dipteran and lepidopteran insect cell lines. Gene 188:183-190. 182. Smith GE, Summers MD. 1978. Analysis of baculovirus genomes with restriction endonucleases. Virology 89:517-527. 183. Smith GE, Summers MD. 1979. Restriction Maps of Five Autographa californica MNPV Variants, Trichoplusia ni MNPV, and Galleria mellonella MNPV DNAs with Endonucleases SmaI, KpnI, BamHI, SacI, XhoI, and EcoRI. J. Virol. 30:828-838.   237  184. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640-6645. 185. Luckow VA, Lee SC, Barry GF, Olins PO. 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67:4566-4579. 186. Biswas S, Blissard GW, Theilmann DA. 2016. Trichoplusia ni Kinesin-1 Associates with Autographa californica Multiple Nucleopolyhedrovirus Nucleocapsid Proteins and Is Required for Production of Budded Virus. J. Virol. 90:3480-3495. 187. Sambrook J, Russell DW. Molecular cloning a laboratory manual 3rd Edition. Cold Spring Harbor Laboratory Press 2001, 2100 pp. 188. Guarino LA, Smith MW. 1990. Nucleotide sequence and characterization of the 39K gene region of Autographa californica nuclear polyhedrosis virus. Virology 179:1-8. 189. Ellison MJ, Hochstrasser M. 1991. Epitope-tagged ubiquitin. A new probe for analyzing ubiquitin function. J. Biol. Chem. 266:21150-21157. 190. Carpentier DCJ, Griffiths CM, King LA. 2008. The baculovirus P10 protein of Autographa californica nucleopolyhedrovirus forms two distinct cytoskeletal-like structures and associates with polyhedral occlusion bodies during infection. Virology 371:278-291. 191. Braunagel SC, Burks JK, Rosas-Acosta G, Harrison RL, Ma H, Summers MD. 1999. Mutations within the Autographa californica nucleopolyhedrovirus FP25K gene decrease the accumulation of ODV-E66 and alter its intranuclear transport. J. Virol. 73:8559-8570. 192. Braunagel SC, Guidry PA, Rosas-Acosta G, Engelking L, Summers MD. 2001. Identification of BV/ODV-C42, an Autographa californica nucleopolyhedrovirus orf101-encoded structural protein detected in infected-cell complexes with ODV-EC27 and p78/83. J. Virol. 75:12331-12338. 193. Campbell MJ. 1995. Lipofection reagents prepared by a simple ethanol injection technique. Biotechniques 18:1027-1032. 194. Willis LG, Seipp R, Stewart TM, Erlandson MA, Theilmann DA. 2005. Sequence analysis of the complete genome of Trichoplusia ni single nucleopolyhedrovirus and the identification of a baculoviral photolyase gene. Virology 338:209-226. 195. Cartier JL, Hershberger PA, Friesen PD. 1994. Suppression of apoptosis in insect cells stably transfected with baculovirus p35: dominant interference by N-terminal sequences p35(1-76). J. Virol. 68:7728-7737. 196. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 27:493-497.   238  197. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 198. Braunagel SC, Summers MD. 1994. Autographa californica nuclear polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural proteins, antigens, lipid and fatty acid profiles. Virology 202:315-328. 199. Perkins DN, Pappin DJ, Creasy DM, Cottrell JS. 1999. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20:3551-3567. 200. Xu G, Jaffrey SR. 2013. Proteomic identification of protein ubiquitination events. Biotechnol. Genet. Eng. Rev. 29:73-109. 201. Braunagel SC, Summers MD. 2007. Molecular biology of the baculovirus occlusion-derived virus envelope. Curr. Drug Targets 8:1084-1095. 202. Rohrmann GF. 2013. Baculovirus Molecular Biology: Third Edition, Bethesda (MD). 203. Charlton CA, Volkman LE. 1993. Penetration of Autographa californica nuclear polyhedrosis virus nucleocapsids into IPLB Sf 21 cells induces actin cable formation. Virology 197:245-254. 204. Ohkawa T, Volkman LE. 1999. Nuclear F-actin is required for AcMNPV nucleocapsid morphogenesis. Virology 264:1-4. 205. Fang M, Nie Y, Theilmann DA. 2009. AcMNPV EXON0 (AC141) which is required for the efficient egress of budded virus nucleocapsids interacts with -tubulin. Virology 385:496-504. 206. Schnapp BJ. 2003. Trafficking of signaling modules by kinesin motors. J. Cell Sci. 116:2125-2135. 207. Gauger AK, Goldstein LS. 1993. The Drosophila kinesin light chain. Primary structure and interaction with kinesin heavy chain. J. Biol. Chem. 268:13657-13666. 208. Gindhart JG, Jr., Goldstein LS. 1996. Tetratrico peptide repeats are present in the kinesin light chain. Trends Biochem. Sci. 21:52-53. 209. Adio S, Reth J, Bathe F, Woehlke G. 2006. Review: regulation mechanisms of Kinesin-1. J. Muscle Res. Cell Motil. 27:153-160. 210. de Matos AP, Carvalho ZG. 1993. African swine fever virus interaction with microtubules. Biol. Cell. 78:229-234. 211. Greber UF, Way M. 2006. A superhighway to virus infection. Cell 124:741-754. 212. Diefenbach RJ, Miranda-Saksena M, Douglas MW, Cunningham AL. 2008. Transport and egress of herpes simplex virus in neurons. Rev. Med. Virol. 18:35-51. 213. Lukic Z, Dharan A, Fricke T, Diaz-Griffero F, Campbell EM. 2014. HIV-1 uncoating is facilitated by dynein and kinesin 1. J. Virol. 88:13613-13625.   239  214. Volkman LE, Zaal KJ. 1990. Autographa californica M nuclear polyhedrosis virus: microtubules and replication. Virology 175:292-302. 215. Manji GA, Friesen PD. 2001. Apoptosis in motion. An apical, P35-insensitive caspase mediates programmed cell death in insect cells. J. Biol. Chem. 276:16704-16710. 216. Mu J, van Lent JW, Smagghe G, Wang Y, Chen X, Vlak JM, van Oers MM.  2014. Live imaging of baculovirus infection of midgut epithelium cells: a functional assay of per os infectivity factors. J. Gen. Virol. 95:2531-2539. 217. Wang Q, Liang C, Song J, Chen X. 2007. HA2 from the Helicoverpa armigera nucleopolyhedrovirus: a WASP-related protein that activates Arp2/3-induced actin filament formation. Virus Res. 127:81-87. 218. Ayres MD, Howard SC, Kuzio J, Lopez-Ferber M, Possee RD. 1994. The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202:586-605. 219. Biswas S, Blissard GW, Theilmann DA. 2016. Trichoplusia ni kinesin-1 associates with AcMNPV nucleocapsid proteins and is required for the production of budded virus. J. Virol. 220. Oomens AG, Monsma SA, Blissard GW. 1995. The baculovirus GP64 envelope fusion protein: synthesis, oligomerization, and processing. Virology 209:592-603. 221. Welsch S, Muller B, Krausslich HG. 2007. More than one door - Budding of enveloped viruses through cellular membranes. FEBS Lett. 581:2089-2097. 222. Bieniasz PD. 2006. Late budding domains and host proteins in enveloped virus release. Virology 344:55-63. 223. Irie T, Licata JM, McGettigan JP, Schnell MJ, Harty RN. 2004. Budding of PPxY-containing rhabdoviruses is not dependent on host proteins TGS101 and VPS4A. J. Virol. 78:2657-2665. 224. Harty RN, Paragas J, Sudol M, Palese P. 1999. A proline-rich motif within the matrix protein of vesicular stomatitis virus and rabies virus interacts with WW domains of cellular proteins: implications for viral budding. J. Virol. 73:2921-2929. 225. Jasenosky LD, Neumann G, Lukashevich I, Kawaoka Y. 2001. Ebola virus VP40-induced particle formation and association with the lipid bilayer. J. Virol. 75:5205-5214. 226. Harty RN, Brown ME, Wang G, Huibregtse J, Hayes FP. 2000. A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding. Proc. Natl. Acad. Sci. U. S. A. 97:13871-13876. 227. Murges D, Quadt I, Schröer J, Knebel-Mörsdorf D. 2001. Dynamic nuclear localization of the baculovirus proteins IE2 and PE38 during the infection cycle: The promyelocytic leukemia protein colocalizes with IE2. Exp. Cell Res. 264:219-232.   240  228. Wang X, Chen J, Gao W, Ding M, Zhai Z. 1998. The envelope formation of AcMNPV and the location of envelope protein gp64 in host cell. Wei Sheng Wu Xue Bao 38:331-335. 229. Votteler J, Sundquist WI. 2013. Virus budding and the ESCRT pathway. Cell Host Microbe 14:232-241. 230. Hurley JH, Hanson PI. 2010. Membrane budding and scission by the ESCRT machinery: it's all in the neck. Nat. Rev. Mol. Cell Biol. 11:556-566. 231. Pornillos O, Garrus JE, Sundquist WI. 2002. Mechanisms of enveloped RNA virus budding. Trends Cell Biol. 12:569-579. 232. Demirov DG, Ono A, Orenstein JM, Freed EO. 2002. Overexpression of the N-terminal domain of TSG101 inhibits HIV-1 budding by blocking late domain function. Proc. Natl. Acad. Sci. U. S. A. 99:955-960. 233. Katzmann DJ, Babst M, Emr SD. 2001. Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 106:145-155. 234. Patnaik A, Chau V, Wills JW. 2000. Ubiquitin is part of the retrovirus budding machinery. Proc. Natl. Acad. Sci. U. S. A. 97:13069-13074. 235. Martin-Serrano J, Zang T, Bieniasz PD. 2001. HIV-1 and Ebola virus encode small peptide motifs that recruit Tsg101 to sites of particle assembly to facilitate egress. Nat. Med. 7:1313-1319. 236. Jasenosky LD, Kawaoka Y. 2004. Filovirus budding. Virus Res. 106:181-188. 237. Chen BJ, Lamb RA. 2008. Mechanisms for enveloped virus budding: can some viruses do without an ESCRT? Virology 372:221-232. 238. Harty RN, Brown ME, McGettigan JP, Wang G, Jayakar HR, Huibregtse JM, Whitt MA, Schnell MJ. 2001. Rhabdoviruses and the cellular ubiquitin-proteasome system: a budding interaction. J. Virol. 75:10623-10629. 239. Peel S, Macheboeuf P, Martinelli N, Weissenhorn W. 2011. Divergent pathways lead to ESCRT-III-catalyzed membrane fission. Trends Biochem. Sci. 36:199-210. 240. Stuchell-Brereton MD, Skalicky JJ, Kieffer C, Karren MA, Ghaffarian S, Sundquist WI. 2007. ESCRT-III recognition by VPS4 ATPases. Nature 449:740-744. 241. Ardley HC, Robinson PA. 2005. E3 ubiquitin ligases. Essays Biochem. 41:15-30. 242. Plechanovova A, Jaffray EG, Tatham MH, Naismith JH, Hay RT. 2012. Structure of a RING E3 ligase and ubiquitin-loaded E2 primed for catalysis. Nature 489:115-120. 243. Pickart CM, Fushman D. 2004. Polyubiquitin chains: polymeric protein signals. Curr. Opin. Chem. Biol. 8:610-616.   241  244. Sadowski M, Suryadinata R, Tan AR, Roesley SN, Sarcevic B. 2012. Protein monoubiquitination and polyubiquitination generate structural diversity to control distinct biological processes. IUBMB Life 64:136-142. 245. Green MC, Monser KP, Clem RJ. 2004. Ubiquitin protein ligase activity of the anti-apoptotic baculovirus protein Op-IAP3. Virus Res. 105:89-96. 246. Wu X, Stewart S, Theilmann DA. 1993. Alternative transcriptional initiation as a novel mechanism for regulating expression of a baculovirus trans activator. J. Virol. 67:5833-5842. 247. Yoo S, Guarino LA. 1994. The Autographa californica nuclear polyhedrosis virus ie2 gene encodes a transcriptional regulator. Virology 202:746-753. 248. Liu HY, Badarinarayana V, Audino DC, Rappsilber J, Mann M, Denis CL.  1998. The NOT proteins are part of the CCR4 transcriptional complex and affect gene expression both positively and negatively. EMBO J. 17:1096-1106. 249. Preissler S, Reuther J, Koch M, Scior A, Bruderek M, Frickey T, Deuerling E. 2015. Not4-dependent translational repression is important for cellular protein homeostasis in yeast. EMBO J. 34:1905-1924. 250. Halter D, Collart MA, Panasenko OO. 2014. The Not4 E3 ligase and CCR4 deadenylase play distinct roles in protein quality control. PLoS One 9:e86218. 251. Hanzawa H, de Ruwe MJ, Albert TK, van Der Vliet PC, Timmers HT, Boelens R. 2001. The structure of the C4C4 ring finger of human NOT4 reveals features distinct from those of C3HC4 RING fingers. J. Biol. Chem. 276:10185-10190. 252. Albert TK, Hanzawa H, Legtenberg YI, de Ruwe MJ, van den Heuvel FA, Collart MA, Boelens R, Timmers HT. 2002. Identification of a ubiquitin-protein ligase subunit within the CCR4-NOT transcription repressor complex. EMBO J. 21:355-364. 253. Albert TK, Lemaire M, van Berkum NL, Gentz R, Collart MA, Timmers HT. 2000. Isolation and characterization of human orthologs of yeast CCR4-NOT complex subunits. Nucleic Acids Res. 28:809-817. 254. Zheng N, Wang P, Jeffrey PD, Pavletich NP. 2000. Structure of a c-Cbl-UbcH7 complex: RING domain function in ubiquitin-protein ligases. Cell 102:533-539. 255. Vialard JE, Richardson CD. 1993. The 1,629-nucleotide open reading frame located downstream of the Autographa californica nuclear polyhedrosis virus polyhedrin gene encodes a nucleocapsid-associated phosphoprotein. J. Virol. 67:5859-5866. 256. Callis J. 2014. The ubiquitination machinery of the ubiquitin system. Arabidopsis Book 12:e0174. 257. Reyes-Turcu FE, Ventii KH, Wilkinson KD. 2009. Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annu. Rev. Biochem. 78:363-397.   242  258. Katsuma S, Kokusho R. 2017. A conserved glycine residue is required for proper functioning of a baculovirus VP39 protein. J. Virol. 259. Wang Y, Wu W, Li Z, Yuan M, Feng G, Yu Q, Yang K, Pang Y. 2007. ac18 is not essential for the propagation of Autographa californica multiple nucleopolyhedrovirus. Virology 367:71-81. 260. McCarthy CB, Dai X, Donly C, Theilmann DA. 2008. Autographa californica multiple nucleopolyhedrovirus ac142, a core gene that is essential for BV production and ODV envelopment. Virology 372:325-339. 261. Li K, Wang Y, Bai H, Wang Q, Song J, Zhou Y, Wu C, Chen X.  2010. The putative pocket protein binding site of Autographa californica nucleopolyhedrovirus BV/ODV-C42 is required for virus-induced nuclear actin polymerization. J. Virol. 84:7857-7868. 262. Cheng X, Krell P, Arif B. 2001. P34.8 (GP37) is not essential for baculovirus replication. J. Gen. Virol. 82:299-305. 263. Ranaweera RS, Yang X. 2013. Auto-ubiquitination of Mdm2 enhances its substrate ubiquitin ligase activity. J. Biol. Chem. 288:18939-18946. 264. Clegg HV, Itahana K, Zhang Y. 2008. Unlocking the Mdm2-p53 loop: ubiquitin is the key. Cell Cycle 7:287-292. 265. Chen A, Kleiman FE, Manley JL, Ouchi T, Pan ZQ. 2002. Autoubiquitination of the BRCA1*BARD1 RING ubiquitin ligase. J. Biol. Chem. 277:22085-22092. 266. Amemiya Y, Azmi P, Seth A. 2008. Autoubiquitination of BCA2 RING E3 ligase regulates its own stability and affects cell migration. Mol. Cancer Res. 6:1385-1396. 267. Yamauchi K, Wada K, Tanji K, Tanaka M, Kamitani T. 2008. Ubiquitination of E3 ubiquitin ligase TRIM5 alpha and its potential role. FEBS J 275:1540-1555. 268. Wang Y, Wang Q, Liang C, Song J, Li N, Shi H, Chen X. 2008. Autographa californica multiple nucleopolyhedrovirus nucleocapsid protein BV/ODV-C42 mediates the nuclear entry of P78/83. J. Virol. 82:4554-4561. 269. Xiang X, Chen L, Hu X, Yu S, Yang R, Wu X. 2011. Autographa californica multiple nucleopolyhedrovirus odv-e66 is an essential gene required for oral infectivity. Virus Res. 158:72-78. 270. Lehiy CJ, Wu W, Berretta MF, Passarelli AL. 2013. Autographa californica M nucleopolyhedrovirus open reading frame 109 affects infectious budded virus production and nucleocapsid envelopment in the nucleus of cells. Virology 435:442-452. 271. Fang M, Nie Y, Theilmann DA. 2009. Deletion of the AcMNPV core gene ac109 results in budded virions that are non-infectious. Virology 389:66-74. 272. Lin L, Wang J, Deng R, Ke J, Wu H, Wang X. 2009. ac109 is required for the nucleocapsid assembly of Autographa californica multiple nucleopolyhedrovirus. Virus Res. 144:130-135.   243  273. Pruneda JN, Stoll KE, Bolton LJ, Brzovic PS, Klevit RE. 2011. Ubiquitin in motion: structural studies of the ubiquitin-conjugating enzyme approximately ubiquitin conjugate. Biochemistry 50:1624-1633. 274. Quezada CM, Hicks SW, Galan JE, Stebbins CE. 2009. A family of Salmonella virulence factors functions as a distinct class of autoregulated E3 ubiquitin ligases. Proc. Natl. Acad. Sci. U. S. A. 106:4864-4869. 275. Reyes-Turcu FE, Horton JR, Mullally JE, Heroux A, Cheng X, Wilkinson KD. 2006. The ubiquitin binding domain ZnF UBP recognizes the C-terminal diglycine motif of unanchored ubiquitin. Cell 124:1197-1208. 276. Hurley JH, Lee S, Prag G. 2006. Ubiquitin-binding domains. Biochem. J. 399:361-372. 277. Rosinski M, Reid S, Nielsen LK. 2002. Kinetics of baculovirus replication and release using real-time quantitative polymerase chain reaction. Biotechnol. Bioeng. 77:476-480. 278. Luxton GW, Lee JI, Haverlock-Moyns S, Schober JM, Smith GA. 2006. The pseudorabies virus VP1/2 tegument protein is required for intracellular capsid transport. J. Virol. 80:201-209. 279. Leelawong M, Lee JI, Smith GA. 2012. Nuclear egress of pseudorabies virus capsids is enhanced by a subspecies of the large tegument protein that is lost upon cytoplasmic maturation. J. Virol. 86:6303-6314. 280. Huffmaster NJ, Sollars PJ, Richards AL, Pickard GE, Smith GA.  2015. Dynamic ubiquitination drives herpesvirus neuroinvasion. Proc. Natl. Acad. Sci. U. S. A. 112:12818-12823. 281. Mettenleiter TC. 2002. Herpesvirus assembly and egress. J. Virol. 76:1537-1547. 282. Johnson DC, Baines JD. 2011. Herpesviruses remodel host membranes for virus egress. Nat Rev Microbiol 9:382-394. 283. Hatsell S, Cowin P. 2001. Deconstructing desmoplakin. Nat. Cell Biol. 3:E270-272. 284. Sumigray KD, Lechler T. 2011. Control of cortical microtubule organization and desmosome stability by centrosomal proteins. Bioarchitecture 1:221-224. 285. Suryadinata R, Roesley SN, Yang G, Sarce vic B. 2014. Mechanisms of generating polyubiquitin chains of different topology. Cells 3:674-689. 286. Winstanley D, Crook NE. 1993. Replication of Cydia pomonella granulosis virus in cell cultures. J. Gen. Virol. 74 ( Pt 8):1599-1609. 287. Penengo L, Mapelli M, Murachelli AG, Confalonieri S, Magri L, Musacchio A, Di Fiore PP, Polo S, Schneider TR. 2006. Crystal structure of the ubiquitin binding domains of rabex-5 reveals two modes of interaction with ubiquitin. Cell 124:1183-1195. 288. Zuin A, Isasa M, Crosas B. 2014. Ubiquitin signaling: extreme conservation as a source of diversity. Cells 3:690-701.   244  289. Morris JR, Solomon E. 2004. BRCA1 : BARD1 induces the formation of conjugated ubiquitin structures, dependent on K6 of ubiquitin, in cells during DNA replication and repair. Hum. Mol. Genet. 13:807-817. 290. Katsuma S, Tsuchida A, Matsuda-Imai N, Kang W, Shimada T. 2011. Role of the ubiquitin-proteasome system in Bombyx mori nucleopolyhedrovirus infection. J. Gen. Virol. 92:699-705. 291. Shang F, Deng G, Liu Q, Guo W, Haas AL, Crosas B, Finley D, Taylor A. 2005. Lys6-modified ubiquitin inhibits ubiquitin-dependent protein degradation. J. Biol. Chem. 280:20365-20374. 292. Kim W, Bennett EJ, Huttlin EL, Guo A, Li J, Possemato A, Sowa ME, Rad R, Rush J, Comb MJ, Harper JW, Gygi SP. 2011. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol. Cell 44:325-340. 293. Wu-Baer F, Lagrazon K, Yuan W, Baer R. 2003. The BRCA1/BARD1 heterodimer assembles polyubiquitin chains through an unconventional linkage involving lysine residue K6 of ubiquitin. J. Biol. Chem. 278:34743-34746. 294. Elia AE, Boardman AP, Wang DC, Huttlin EL, Everley RA, Dephoure N, Zhou C, Koren I, Gygi SP, Elledge SJ. 2015. Quantitative Proteomic Atlas of Ubiquitination and Acetylation in the DNA Damage Response. Mol. Cell 59:867-881. 295. Huang N, Wu W, Yang K, Passarelli AL, Rohrmann GF, Clem RJ.  2011. Baculovirus infection induces a DNA damage response that is required for efficient viral replication. J. Virol. 85:12547-12556. 296. Wei W, Gai Z, Ai H, Wu W, Yang Y, Peng J, Hong H, Li Y, Liu K.  2012. Baculovirus infection triggers a shift from amino acid starvation-induced autophagy to apoptosis. PLoS One 7:e37457. 297. Durcan TM, Tang MY, Perusse JR, Dashti EA, Aguileta MA, McLelland GL, Gros P, Shaler TA, Faubert D, Coulombe B, Fon EA. 2014. USP8 regulates mitophagy by removing K6-linked ubiquitin conjugates from parkin. EMBO J. 33:2473-2491. 298. Benboudjema L, Mulvey M, Gao Y, Pimplikar SW, Mohr I. 2003. Association of the herpes simplex virus type 1 Us11 gene product with the cellular kinesin light-chain-related protein PAT1 results in the redistribution of both polypeptides. J. Virol. 77:9192-9203. 299. Newsome TP, Scaplehorn N, Way M. 2004. SRC mediates a switch from microtubule- to actin-based motility of vaccinia virus. Science 306:124-129. 300. Taylor MP, Kratchmarov R, Enquist LW. 2013. Live cell imaging of alphaherpes virus anterograde transport and spread. J Vis Exp. 301. Desai PJ. 2000. A null mutation in the UL36 gene of herpes simplex virus type 1 results in accumulation of unenveloped DNA-filled capsids in the cytoplasm of infected cells. J. Virol. 74:11608-11618.   245  302. Fuchs W, Klupp BG, Granzow H, Mettenleiter TC. 2004. Essential function of the pseudorabies virus UL36 gene product is independent of its interaction with the UL37 protein. J. Virol. 78:11879-11889. 303. Zaichick SV, Bohannon KP, Hughes A, Sollars PJ, Pickard GE, Smith GA.  2013. The herpesvirus VP1/2 protein is an effector of dynein-mediated capsid transport and neuroinvasion. Cell Host Microbe 13:193-203. 304. Sumigray KD, Chen H, Lechler T. 2011. Lis1 is essential for cortical microtubule organization and desmosome stability in the epidermis. J. Cell Biol. 194:631-642. 305. Guo J, Yang Z, Song W, Chen Q, Wang F, Zhang Q, Zhu X. 2006. Nudel contributes to microtubule anchoring at the mother centriole and is involved in both dynein-dependent and -independent centrosomal protein assembly. Mol. Biol. Cell 17:680-689. 306. McKenney RJ, Vershinin M, Kunwar A, Vallee RB, Gross SP. 2010. LIS1 and NudE induce a persistent dynein force-producing state. Cell 141:304-314. 307. Faulkner NE, Dujardin DL, Tai CY, Vaughan KT, O'Connell CB, Wang Y, Vallee RB. 2000. A role for the lissencephaly gene LIS1 in mitosis and cytoplasmic dynein function. Nat. Cell Biol. 2:784-791. 308. Coquelle FM, Caspi M, Cordelieres FP, Dompierre JP, Dujardin DL, Koifman C, Martin P, Hoogenraad CC, Akhmanova A, Galjart N, De Mey JR, Reiner O. 2002. LIS1, CLIP-170's key to the dynein/dynactin pathway. Mol. Cell. Biol. 22:3089-3102.      246  Appendix: Figure shows the AcMNPV genome map which is 133.9 kbp that encodes approximately 156 proteins. All the open reading frames (ORFs) are indicated by arrows. The genes that were studied in this thesis are marked in red arrows.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0349032/manifest

Comment

Related Items