UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Arabidopsis MKK6 functions in parallel with MKK1 and MKK2 to negatively regulate plant immunity Gao, Fang 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_may_gao_fang.pdf [ 2.51MB ]
Metadata
JSON: 24-1.0344021.json
JSON-LD: 24-1.0344021-ld.json
RDF/XML (Pretty): 24-1.0344021-rdf.xml
RDF/JSON: 24-1.0344021-rdf.json
Turtle: 24-1.0344021-turtle.txt
N-Triples: 24-1.0344021-rdf-ntriples.txt
Original Record: 24-1.0344021-source.json
Full Text
24-1.0344021-fulltext.txt
Citation
24-1.0344021.ris

Full Text

      Arabidopsis MKK6 functions in parallel with MKK1 and MKK2 to negatively regulate plant immunity  by  Fang Gao  B.Sc., The University of British Columbia, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  The Faculty of Graduate and Postdoctoral Studies  (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   April 2017  © Fang Gao 2017   ii  Abstract As an early defense response, MAP kinase cascade activation plays important roles in transduction and amplification of signals upon pathogen perception in plants. The Arabidopsis MEKK1-MKK1/MKK2-MPK4 kinase cascade was previously shown to negatively regulate plant immunity. In this study, two suppressors of the mkk1 mkk2 double mutant – summ4-1D and summ4-2D have been identified and characterized. summ4-1D and summ4-2D contain mutations in the promoter region of MKK6, which leads to elevated expression of MKK6, causing suppression of the mkk1 mkk2 autoimmune phenotypes. However, the autoimmune phenotypes of mekk1 and mpk4 cannot be suppressed by summ4-1D. MKK6 interacts with MEKK1 and MPK4, and MPK4 activation is blocked in mkk1 mkk2, but is recovered in the summ4-1D mkk1 mkk2 triple mutant background. These results suggest that MKK6 functions in parallel with MKK1 and MKK2 to negatively regulate plant immunity.         iii  Preface  The work described in this thesis is the culmination of research from September 2014 to March 2017. Below is the manuscript (under revision) that comprises this thesis and the contribution made by the candidate.   Chapter 2 – Arabidopsis MKK6 functions in two parallel MAP kinase cascades that negatively regulate plant immunity was modified from a prepared manuscript: The work is done in collaboration with Kehui Lian. The candidate, Fang Gao, conducted the following experiments under the instruction of Yuelin Zhang: characterization of morphology and defense responses of summ4-1D mkk1 mkk2 and summ4-2D mkk1 mkk2; positional cloning of SUMM4; expression analysis of MKK6 in summ4 mutants; over-expression of MKK6 in mkk1 mkk2; MPK4 phosphorylation in  summ2-8 mkk1 mkk2 and summ4-1D mkk1 mkk2; characterization of summ4-1D mekk1 and summ4-1D mpk4 double mutants; in vivo interaction of MKK6 with MEKK1 and MPK4; subcellular localization of MKK6; characterization of summ4-1D anp2 anp3 triple mutant and characterization of anp2 anp3 eds1 triple mutant. Kehui Lian performed the following experiments: PR gene expression in mkk6 and CA-MPK4 mkk6; characterization of anp2 anp3, anp2 anp3 CA-MPK4, anp2 anp3 pad4-1 and anp2 anp3   summ2-8; Pto DC3000 hrcC-infection assay. Yuelin Zhang, Fang Gao and Kehui Lian prepared the manuscript.   iv  Table of Contents  Abstract ........................................................................................................................................................ ii Preface ......................................................................................................................................................... iii Table of Contents ....................................................................................................................................... iv List of Tables .............................................................................................................................................. vi List of Figures ............................................................................................................................................ vii List of Abbreviations ............................................................................................................................... viii Acknowledgements .................................................................................................................................... xi Chapter 1 Introduction ............................................................................................................................... 1 1.1 Plant Immunity ................................................................................................................................. 1 1.2 PAMP - triggered immunity (PTI) .................................................................................................. 2 1.2.1 PAMPs and PRRs ...................................................................................................................... 2 1.2.2 PTI defense responses ................................................................................................................ 2 1.3 Effector Triggered Immunity (ETI) ................................................................................................ 3 1.4 MAP kinases in Defense Responses ................................................................................................. 5 1.4.1 Roles of the MKK4/MKK5 – MPK3/MPK6 cascade .............................................................. 8 1.4.2 The MEKK1-MKK1/MKK2-MPK4 cascade .......................................................................... 8 1.4.3 The suppressor of mkk1 mkk2 (summ) mutants ...................................................................... 9 1.4.4 The Role of ANPs-MKK6-MPK4 cascade ............................................................................. 12 1.5 Research Objectives ........................................................................................................................ 12 Chapter 2 Arabidopsis MKK6 functions in two parallel MAP kinase cascades that negatively regulate plant immunity ........................................................................................................................... 13 2.1 Summary .......................................................................................................................................... 13 2.2 Introduction ..................................................................................................................................... 14 2.3 Results .............................................................................................................................................. 16 2.3.1 Characterization of summ4-1D mkk1 mkk2 ........................................................................... 16 2.3.2 Positional cloning of SUMM4 .................................................................................................. 18 2.3.3 The summ4-1D mutation results in elevated expression of MKK6 ....................................... 23 2.3.4 summ4-1D does not suppress the autoimmune phenotypes of mekk1 and mpk4 ................ 24 2.3.5 MKK6 interacts with MEKK1 and MPK4 ............................................................................ 25 2.3.6 Over-expression of MKK6 restores MAPK kinase activation in mkk1 mkk2 ...................... 25 2.3.7 PR1 and PR2 are constitutively expressed in mkk6 mutant plants ...................................... 29 v  2.3.8 Defense responses are constitutively activated in the anp2 anp3 double mutant ............... 32 2.3.9 The autoimmune phenotype of anp2 anp3 can be partially suppressed by the CA-MPK4 mutant ................................................................................................................................................ 34 2.3.10 Constitutive defense response activation in anp2 anp3 is independent of SUMM2 .......... 35 2.3.11 PAD4 and EDS1 are required for the autoimmune phenotype of anp2 anp3................... 35 2.3.12 summ4-1D partially suppresses the mutant phenotypes of anp2-2 anp3-3 ....................... 38 2.3.13 anp2-2 anp3-3 is more susceptible to Pseudomonas syringae pv. tomato DC3000 hrcC-... 39 2.3.14 MKK6 negatively regulates anthocyanin accumulation ...................................................... 41 2.4 Discussion......................................................................................................................................... 42 2.5 Methods ............................................................................................................................................ 46 2.5.1 Plant Materials ......................................................................................................................... 46 2.5.2 Mutant Characterization ......................................................................................................... 46 2.5.3 Map-Based Cloning of SUMM4 .............................................................................................. 47 2.5.4 Split Luciferase Complementation Assay .............................................................................. 48 2.5.5 MAPK activation...................................................................................................................... 49 2.5.6 Subcellular localization of MKK6 .......................................................................................... 49 Chapter 3 Conclusions and Future Directions ....................................................................................... 51 References .................................................................................................................................................. 53 Appendix .................................................................................................................................................... 59      vi  List of Tables  Table 1. Primers used in this study. ........................................................................................................ 59    vii  List of Figures  Chapter 1 Figure 1.1. General scheme of a MAPK cascade...................................................................................... 6 Figure 1.2. MAPK cascade pathways activated upon pathogen infection in Arabidopsis. .................. 7 Figure 1.3. A working model for the roles of CRCK3 and SUMM2 in monitoring the integrity of the MEKK1-MKK1/2-MPK4 kinase cascade. .............................................................................................. 11  Chapter 2 Figure 2.1. Characterization of summ4-1D mkk1/2................................................................................ 17 Figure 2.2. Positional Cloning of SUMM4 .............................................................................................. 20 Figure 2.3. eFP browser view of MKK6 expression during Arabidopsis development. ...................... 21 Figure 2.4. Characterization of summ4-2D and transgenic lines over-expressing MKK6 in mkk1 mkk2. .......................................................................................................................................................... 22 Figure 2.5. summ4-1D does not suppress the autoimmune phenotypes of mekk1 and mpk4 and restores MPK4 activation in mkk1 mkk2 double mutant. ..................................................................... 27 Figure 2.6. Subcellular localization of MKK6-eYFP fusion protein. ................................................... 28 Figure 2.7.  Expression of PR genes in mkk6-2 and CA-MPK4 mkk6-2. ............................................... 31 Figure 2.8. PR1 and PR2 expression levels in WT and mkk6-3. ............................................................ 32 Figure 2.9. Characterization of the anp2-2 anp3-3 double mutant. ...................................................... 33 Figure 2.10. CA-MPK4 partially blocks the constitutive defense responses in anp2-2 anp3-3. .......... 35 Figure 2.11. Constitutive defense responses in anp2-2 anp3-3 are independent of SUMM2 but dependent on PAD4. .................................................................................................................................. 37 Figure 2.12. Suppression of anp2-2 anp3-3 mutant phenotypes by summ4-1D. .................................. 39 Figure 2.13.  Growth of Pto DC3000 hrcC- in wild type, anp2-2, anp3-3, and anp2-2 anp3-3. ........... 40 Figure 2.14. Expression levels of MYB75 in wild type and mkk6-2, and accumulation of anthocyanin in wild type, mkk6-2, mekk1 summ2-8 and mpk4-3 summ2-8 seedlings. ............................................... 42 Figure 2.15. A working model for the roles of MKK6 in plant immunity. .......................................... 43   viii  List of Abbreviations   ANPs Arabidopsis Nucleus-and Phragmoplast- localized kinase 1 related protein kinases ASR3 Arabidopsis SH4-related 3 AvrB an avirulence protein from Pseudomonas syringae AvrRpm1 an avirulence protein from Pseudomonas syringae AvrRpt2 an avirulence protein from Pseudomonas syringae AvrPto an avirulence protein from Pseudomonas syringae AvrPtoB an avirulence protein from Pseudomonas syringae BAK1 BRI1-Associated Kinase 1 BiFC Bimolecular Fluorescence Complementation  BIK1 Botrytis-Induced Kinase 1 BRI1 Brassinosteroid-Insensitive 1 CA Constitutively active CaMV 35S promoter a very strong constitutive promoter from Cauliflower mosaic virus CC Coiled-coil CERK1 Chitin Elicitor Receptor Kinase 1 CFU Colony-Forming Units Co-IP Co-Immunoprecipitation Col-0 an Arabidopsis ecotype; it’s referred to as wild type in this thesis DNA Deoxyribonucleic acid E.coli Escherichia coli EDS1 Enhanced Disease Susceptibility 1 EFR EF-Tu Receptor EF-Tu bacterial translation elongation factor Tu ER ERECTA – a Receptor Protein Kinase EMS Ethyl Methanesulfonate; a chemical mutagen ix  ETI Effector-triggered immunity flg22 flagellin conserved domain of 22 amino acids FLS2 Flagellin-Sensitive 2 H.a.Noco2 Hyaloperonospora arabidopsidis Noco2 HopAI1 an avirulence protein from Psudomonas syringae LRR Leucine-rich repeat MAPK/MPK Mitogen-Activated Protein Kinase MAP2K/MKK MAP kinase kinase MAP3K/MEKK MAP kinase kinase kinase NACK1 NPK1-activating kinesin-like protein 1 NB Nucleotide Binding NDR1 Non-race-specific Disease Resistance 1 NPK1 Nucleus-and Phragmoplast-localized kinase 1 NQK1 a MAP2K in tobacco; orthologue of AtMKK6 NRK1 a MAPK in tobacco; downstream of NPK1 and NQK1 PAD Phytoalexin Deficient PAMP Pathogen-Associated Molecular Pattern PAT1 Protein associated with topoisomerase I PCR Polymerase Chain Reaction PR Pathogenesis-Related  PRR Pattern Recognition Receptor PBL27 PBS1-Like 27 PBS1 AvrPphB Susceptible 1 PTI PAMP-triggered immunity Pto Pseudomonas syringae pv tomato R protein Resistance protein RIN4 RPM1-Interacting Protein 4 x  RLCK Receptor-Like Cytoplasmic Kinase RLK Receptor-Like Kinase RNA Ribonucleic acid ROS Reactive Oxygen Species RPM1 Resistance to Pseudomonas syringae pv Maculicola RPS2 Resistance to Pseudomonas syringae 2 SA Salicylic acid SUMM Suppressor of mkk1 mkk2 TIR Toll Interleukin-1 Receptor YODA an Arabidopsis MAPKKK   xi  Acknowledgements  I am very grateful to have completed the project under the supervision of Dr. Yuelin Zhang, who is a very responsible supervisor and provided me with a solid project plan and many suggestions for various experiments. His advice and supervision have helped me complete this project well.  I would like to thank my committee members, Yuelin Zhang, Xin Li and Ljerka Kunst, for their support and suggestions throughout the Master’s program. I would like to thank all of Zhang lab and Li lab members for all the support and advice they had given which helped me progress with my project. I would like thank Tongjun Sun, a member of Zhang lab, who has helped me with many experiments, given me useful advice from his experience. I would like to thank Kaeli Johnson and Xin Li (University of British Columbia) for discussion and editing of the manuscript, Jean Colcombet (Université Evry Val d’Essonne) for the CA-MPK4 transgenic line and Yan Li (National Institute of Biological Sciences, Beijing) for genome sequence analysis. We are grateful for the financial support from Natural Sciences and Engineering Research Council (NSERC) of Canada and Canada Foundation for Innovation (CFI). Lastly, I would like to thank my family and friends who have supported me throughout my graduate school life at UBC.          1  Chapter 1 Introduction 1.1 Plant Immunity Plants live in an environment full of microbes in nature. While some microorganisms can be beneficial for plant growth, others can impair plant growth and cause diseases in plants. There are different types of plant pathogens such as bacteria, fungi, oomycetes, and viruses. Plant pathogens can be classified as biotrophs that can only grow in living plant tissues, and necrotrophs, which will kill the plant host during colonization1. Despite lacking mobile defender cells or an adaptive immune system like in animals, plants can establish innate immune responses that are highly specific and well-regulated 2.  The first line of plant defense against pathogens is natural barriers such as the plant cell wall. If pathogens can overcome these barriers through entry from wounds or natural openings like stomata and the water pore hydathodes, or by penetrating into the cells directly by hyphae (Fungi) or stylet (Nematodes), a two-layered immune response will be triggered in plants. The first layer is the pathogen-associated molecular patterns (PAMP) - triggered immunity (PTI), which begins with the recognition of PAMPs by pattern recognition receptors (PRRs) on plasma membranes of plant cells. Activation of PTI triggers rapid defense responses to restrict spread of the pathogen. The second layer of immunity is effector- triggered immunity, also known as ETI, which is activated when an effector molecule from a pathogen is recognized by a plant resistance (R) protein 1, 2.  Plant defense responses are under tight regulation to prevent autoimmunity. Without biotic stress introduced by the pathogens, energy is mostly used for growth and development 2. Autoimmune 2  mutants often display dwarf stature as increased resources are allocated for immune responses rather than for growth.  1.2 PAMP - triggered immunity (PTI) 1.2.1 PAMPs and PRRs Plants can recognize conserved features of pathogens (PAMPs) to activate PTI using PRRs on the plasma membrane of plant cells. These receptors can be Receptor-Like Kinases (RLKs) or Receptor-Like Proteins (RLPs) 1. Examples of some common PAMPs and the corresponding plant receptors include bacterial flagellin peptide flg22 and the plant RLK, FLAGELLIN-SENSITIVE 2 (FLS2); bacterial elongation factor (EF-Tu) and the plant RLK, EF-TU RECEPTOR (EFR); fungal chitin molecules and CHITIN ELICITOR RECEPTOR KINASE 1 (CERK1) 3.  1.2.2 PTI defense responses  A variety of defense responses including calcium ion influx, activation of mitogen-activated protein (MAP) kinase cascades, callose deposition, oxidative burst, and defense gene   expression 4 . Activation of MAP kinase cascades upon PAMP perception serves as an effective means to transduce and amplify the signal from the upstream stimuli to activate other responses in the cell. Callose deposition helps strengthen the cell wall to prevent further invasion of pathogens at the infection site. Production of Reactive Oxygen Species (ROS), such as superoxide, hydrogen peroxide and hydroxyl radicals, is effective against pathogens in decreasing their virulence. ROS can also serve as signaling molecules for plant defense responses as well as for growth and development processes 4. One function of ROS is to induce 3  cross-linking of components of the plant cell wall, such as glycoproteins, lignin and suberin. ROS can also induce programmed cell death (PCD), which helps to prevent the spread of biotrophic pathogens 4. There are multiple components required to trigger these PTI responses. For example, FLS2 functions together with two proteins, the LRR RLK, BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1), and the Receptor-like cytoplasmic kinase (RLCK) - BOTRYTIS-INDUCED KINASE1 (BIK1) to transduce defense signal upon PAMP perception. The signal transduction is initiated by association of FLS2 and BAK1 upon flg22 perception, followed by rapid phosphorylation of BIK1 subsequent trans-phosphorylation of FLS2 and BAK1. BIK1 also interacts with EFR and CERK1, suggesting that it functions in multiple PAMP signaling pathways 5. Some other RLCKs also interact and function together with the PRRs FLS2, EFR and CERK1. For example, PCRK1 and PCRK2, two members in the same RLCK subfamily of BIK1, were shown to associate with FLS2. They also function as positive regulators of Salicylic acid (SA) biosynthesis 6. Another RLCK, PBL27, interacts with CERK1, and is involved in chitin-induced immune responses 7.  1.3 Effector Triggered Immunity (ETI) During evolution, successful pathogens have developed capabilities to overcome the basal resistance of plants by suppressing PTI. For example, bacterial pathogens can secrete effector molecules into the plant cell through Type III secretion system 8. These effectors interfere with plant basal defense by mimicking or inhibiting certain cellular functions. One well-studied 4  example of effector of bacteria is AvrPtoB. Its C-terminus can fold into an active E3 ligase to mediate degradation of host proteins, which results in inhibition of programmed cell death 9.  To defend against pathogens with abilities to overcome PTI, plants have evolved a second layer of plant immunity triggered by pathogen effectors, known as effector-triggered immunity (ETI). When pathogens secrete effectors into the plant cell, plant resistance R proteins recognize specific effectors and activate a range of stronger defense responses, which often lead to localized programmed cell death known as hypersensitive response (HR). HR is believed to function as a measure to isolate and prevent further spreading of the pathogen 1. Most R proteins belongs to the NB-LRR protein family, which have a common structure of a nucleotide-binding site (NB) domain in the middle and a leucine-rich repeat (LRR) domain at the C-terminus 2.  The NB-LRR R protein are classified into two groups, the Coiled-Coil Nucleotide-binding leucine-rich repeat (CC-NB-LRR) R proteins and Toll interleukin 1 receptor Nucleotide-binding leucine-rich repeat (TIR-NB-LRR) R proteins, based on their N-terminal domains. NONRACE-SPECIFIC DISEASE RESISTANCE 1 (NDR1) is a signaling component downstream of many CC-NB-LRR R proteins. The ndr1 mutant cannot confer resistance to Pseudomonas syringae mediated by RPS2, RPS5 and RPM1, which all belongs to the CC-NB-LRR R protein group. On the other hand, two important signaling components, ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) and PHYTOALEXIN DEFICIENT 4 (PAD4), form a heterodimer and function downstream of most TIR-NB-LRR R proteins. They are required for resistance mediated by TIR-type R proteins, such as RPP1, RPP5 and RPS4. EDS1 and PAD4 are also required for the accumulation of the defense signaling molecule, SA10. Usually, the activity of R proteins is inhibited by intramolecular interactions between different domains of the R protein in the absence of pathogen attack. When plants are attacked by 5  pathogens, R proteins can be activated by pathogen effectors either directly or indirectly. Some R proteins can directly interact with effectors to activate downstream responses. However, the majority of R proteins that have been studied recognize effectors indirectly by detecting the effects of pathogen-targeted plant proteins. These R proteins can “guard” target proteins critical for plant immunity by binding to them. One of the most well-known example of “guardee” is RPM1-INTERACTING PROTEIN 4 (RIN4). RIN4 can interact with the R proteins RPM1 and RPS2, and is targeted by three P. syringae effectors - AvrRpm1, AvrB and AvrRpt2 2.  In some cases, the host proteins recognized by the R proteins do not have a function in basal defense. These proteins mimic the host defense components targeted by the pathogen effectors. They are called “decoys” instead of “guardees” 11. An example of a decoy is the pBs3 gene of pepper plants. The main role of the effector AvrBs3 from Xanthomonas campestris pv vesicatoria is to induce cell size by binding and activating the promoter of pUpa20, a master regulator of cell size in peppers. In resistant plants, AvrBs3 also activates the promoter of the Bs3 gene (pBs3), which encodes a flavin monooxygenase. pBs3 expression is not induced in the absence of AvrBs3, suggesting that it does not have a direct role in defense against pathogens that lack AvrBs3. Thus, pBs3 is a decoy of AvrBs3, whereas pUpa20 is a real operative target of AvrBs3 11.  1.4 MAP kinases in Defense Responses MAP kinases play important roles in plant defense responses and contribute to both PTI and ETI responses. MAP kinase cascades start with the activation of MAP kinase kinase kinases (MAPKKK, also called MEKK) in response to stimuli, which phosphorylate two Ser/Thr 6  residues in the activation loop (Ser/Thr-X3-5-Ser/Thr motif) of MAP kinase kinases (MAPKK or MKK). The activated MAPKKs subsequently activate downstream MAP kinases (MAPK or MPK) by phosphorylation of the Thr and Tyr residues in the Thr-X-Tyr (Figure 1.1). MAP kinase cascades act as signal transduction pathways downstream of the PRRs to facilitate the activation of defense responses. In Arabidopsis, there are 60 putative MAPKKKs, 10 MAPKKs and 20 MPKs 12.  Figure 1.1. General scheme of a MAPK cascade 13 Reprinted with permission from “Roman, E., et al. MAP kinase pathways as regulators of fungal virulence. Trends Microbiol 15(4): 181-190. (2007).” Copyright 2007 Elsevier. General scheme of a MAPK pathway. A stimulus is perceived at the plasma membrane through specific sensors or membrane receptors. The signal is then transferred by phosphorylation 7  through a two-component system and/or adaptor molecules (PAKs and GTPases) to the core component of the cascade, which is composed of at least a MAP kinase kinase kinase, a MAP kinase kinase and a MAP kinase. Upon phosphorylation, the MAP kinase is translocated to the nucleus where it phosphorylates a transcription factor (which might be part of a transcription factor complex, TFC) or a repressor molecule (regulatory molecule) that might relieve repression. As a consequence, the expression of the target gene(s) (TG) is switched on and an adaptive response occurs.   There are at least three MAP kinase cascades activated in Arabidopsis. One involves an unknown MEKK, followed by MKK4/5 and MPK3/6. Another is the MEKK1-MKK1/2-MPK4 cascade. Lastly, it’s the ANP2/3-MKK6-MPK4 cascade, recently identified to play important roles in plant immunity 12 (Figure 1.2).    Figure 1.2. MAPK cascade pathways activated upon pathogen infection in Arabidopsis 12, 14. 8  1.4.1 Roles of the MKK4/MKK5 – MPK3/MPK6 cascade Arabidopsis MPK3 and MPK6 are activated after PAMP treatment or pathogen infection. The MAPKKs MKK4 and MKK5 function upstream of MPK3/MPK6 15. The MAPKKK that functions upstream of MKK4/MKK5 and MPK3/MKK6 in plant immunity has yet to be determined. The MKK4/MKK5-MPK3/MPK6 cascade was shown to positively regulate the biosynthesis of camalexin, a major phytoalexin which has antimicrobial function. Furthermore, MPK3/MPK6 were found to regulate synthesis of ethylene and indole glucosinolates and their derivatives 16-18. Recently, MKK4/MKK5 and MPK3/MPK6 have also been found to be essential for stomatal immunity. Loss of function of MPK3 and MPK6, or their upstream MKK4 and MKK5 results in impaired stomatal closure through flg22 or pathogen Pseudomonas syringae pv tomato DC3000 induction 19. In addition to the roles in plant immunity, MKK4/MKK5-MPK3/MPK6 also form a cascade with the MAPKKK, YODA that functions in regulating localized cell proliferation 20. 1.4.2 The MEKK1-MKK1/MKK2-MPK4 cascade In Arabidopsis, the MEKK1-MKK1/MKK2-MPK4 kinase cascade was initially found to negatively regulate immune responses. The mekk1 and mpk4 single mutants display autoimmune phenotypes with spontaneous cell death and constitutive defense responses and show a dwarf plant morphology. MKK1 and MKK2 are closely related and functionally redundant. The mkk1 mkk2 double mutant displays similar autoimmune phenotypes as the mekk1 and mpk4 single mutants. The dwarf phenotype is most severe in the mekk1 mutant, while mkk1 mkk2 and mpk4 mutants were comparable in size, indicating other MKKs or MPKs may function downstream of MEKK121. 9  MEKK1 and MKK1/MKK2 have all been shown to be required for activation of MPK4 in response to flg22 treatment. The kinase activity of immunoprecipitated MPK4 was severely compromised in the mekk1 mutant as well as in the mkk1 mkk2 double mutant. When the kinase activity of MPK3/MPK6 were also tested, no reduction of kinase activity was observed in the mkk1 mkk2 background 21, 22. Bimolecular fluorescence complementation (BiFC) analysis showed MEKK1 interacts with MKK1 and MKK2 on the plasma membrane, whereas MPK4 and MKK1 and MKK2 interaction was observed in both the nucleus and the plasma membrane 21.  1.4.3 The suppressor of mkk1 mkk2 (summ) mutants In a suppressor screen to find regulatory proteins affecting the MEKK1-MKK1/MKK2-MPK4 kinase pathway, summ (suppressor of mkk1 mkk2) mutants were identified. These mutants were able to revert the autoimmune phenotype of mkk1 mkk2 double mutant and the summ mkk1 mkk2 triple mutants display a WT-like morphology (Figure 1.3).  Three SUMM genes have been characterized. SUMM1 encodes MEKK2, a MAPKKK closely related to MEKK1, SUMM2 encodes a CC-NB-LRR R protein, and SUMM3 encodes the CALMODULIN-BINDING RECEPTOR-LIKE CYTOPLASMIC KINASE 3 (CRCK3) 23-25.  Analysis of mekk1 summ2 and mkk1 mkk2 summ2 mutants revealed that they are more susceptible to virulent pathogens than summ2 single mutant, suggesting that the MEKK1-MKK1/MKK2-MPK4 kinase cascade is required for basal defense responses, SUMM2 most likely evolved to guard this kinase cascade from pathogen effectors such as HopAI1. MEKK2 functions as a positive regulator of resistance mediated by the R protein 23. MEKK2 has been shown to be a direct substrate of MPK4 and can be phosphorylated by MPK4. However, no direct protein-protein interaction was detected between SUMM2 and MPK4, MKK1/MKK2 or 10  MEKK1, suggesting that there are other intermediate regulatory proteins involved in activation of SUMM2-mediated defense responses 25.  Besides negative regulation of plant immunity, the MEKK1-MKK1/MKK2-MPK4 cascade also plays a role in positively regulating basal defense. This corresponds to the two-layer defense system in plants. ETI defense responses mediated by SUMM2 is normally negatively regulated, and it would not be activated as long as the first layer of defense, PTI has not been overcome by pathogens 25. The recently characterized SUMM3 is a substrate protein of MPK4. In wild‐type plants, CRCK3 is mostly phosphorylated by MPK4. SUMM2 directly interact with CRCK3 and probably can sense the change of CRCK3 induced by phosphorylation. When pathogen effectors such as HopAI1 are present, MPK4 kinase activity is suppressed, SUMM2 can sense the unphosphorylated form of CRCK3 and activate downstream defense responses (Figure 1.3). Since no direct protein-protein interaction was detected between MEKK2 and CRCK3, the mechanism of how MEKK2 regulates defense responses mediated by CRCK3 and SUMM2 is still not understood 24.  11   Figure 1.3. A working model for the roles of CRCK3 and SUMM2 in monitoring the integrity of the MEKK1-MKK1/2-MPK4 kinase cascade 24. Reprinted with permission from “Zhang, Z., et al. The NLR protein SUMM2 senses the disruption of an immune signaling MAP kinase cascade via CRCK3. EMBO Reports 18(2): 292- 302. (2016)”. Copyright 2016 John Wiley and Sons.  In wild type plants, phosphorylation of CRCK3 by MPK4 prevents CRCK3 from activating SUMM2. When the MAP kinase cascade is disrupted by pathogen effectors such as HopAI1, MPK4 is inactive and unable to phosphorylate CRCK3, which leads to activation of SUMM2 and downstream defense responses.  The identification of the other summ mutants in addition to summ1, summ2 and summ3 suggests that there are additional regulatory proteins functioning upstream or downstream of MEKK1-MKK1/MKK2-MPK4 kinase cascade to regulate SUMM2-mediated immunity. Genetic and functional analysis of these summ mutants should allow for discovery of additional components involved in regulation of SUMM2-mediated immune responses. 12  1.4.4 The Role of ANPs-MKK6-MPK4 cascade The NUCLEUS-PHRAGMOPLAST-LOCALIZED KINASE1 (NPK1) is a MAPKKK in tobacco. It forms a MAP kinase cascade with NQK1 and NRK1, and the NPK1-NQK1-NRK1 cascade has been shown to play a key role in regulating cytokinesis. The three genes in the ARABIDOPSIS NPK1-RELATED PROTEIN KINASES (ANP) family – ANP1, ANP2, and ANP3 were found to be orthologs of NPK1. TheArabidopsis anp1, anp2 and anp3 single knockout mutants have no obvious development phenotypes, but loss of function of all three ANP proteins results in lethality 26. The ANPs-MKK6-MPK4 kinase cascade in Arabidopsis has been shown to play a key role in regulating cytokinesis. The anp2 anp3 double mutant exhibits defects in cytokinesis, forming unusually large multinucleate cells with cell-wall stubs 26. The mkk6 mutant also displays phenotypes such as dwarfism, and unusually large cells that contain multiple nuclei and cell wall stubs in various organs, indicating cytokinesis defects 27. MKK6 can be activated by ANP1 and ANP3, shown by a phenotype rescue assay exploiting the osmosensing MAPK cascade in yeast. MPK4 can be strongly phosphorylated by MKK6, consistent shown in various protein phosphorylation assays, confirming that MPK4 is the downstream MPK of MKK6 27, 28.  1.5 Research Objectives  The research objectives of this thesis are first, to identify components downstream of the MEKK1-MKK1/MKK2-MPK4 cascade involved in negative regulation of plant immunity, and second, to characterize the roles and functions that the downstream components have in negative regulation of plant immunity.  13  Chapter 2 Arabidopsis MKK6 functions in two parallel MAP kinase cascades that negatively regulate plant immunity   2.1 Summary Arabidopsis MAP kinase 4 (MPK4) is a component of two independent MAP kinase cascades and functions in regulating development as well as plant defense. The MEKK1-MKK1/MKK2-MPK4 cascade inhibits the activation of defense responses mediated by the NB-LRR protein SUMM2, whereas the ANPs-MKK6-MPK4 cascade plays an essential role in cytokinesis. Here we report a novel role for MKK6 in regulating plant immune responses. A gain-of-function mutant of MKK6 identified from a suppressor screen of mkk1 mkk2 was found to suppress the autoimmune phenotypes in mkk1 mkk2 but not mekk1or mpk4. This suggests that MKK6 functions similarly to MKK1/MKK2 and works together with MEKK1 and MPK4 to inhibit the activation of SUMM2-mediated defense responses. Interestingly, loss of function of MKK6 or ANP2/ANP3 results in constitutive activation of plant defense responses. The autoimmune phenotypes in mkk6 and anp2 anp3 mutant plants can be largely suppressed by a constitutively active mpk4 mutant. Further analysis showed that constitutive defense response in anp2 anp3 is dependent upon the defense regulators PAD4 and EDS1, but not SUMM2, suggesting that the ANP2/ANP3-MKK6-MPK4 cascade negatively regulates a SUMM2-independent defense response pathway. Furthermore, mkk6 knockout mutant plants accumulate high levels of anthocyanin, suggesting that MKK6 is also involved in negative regulation of anthocyanin levels. This study shows that MKK6 has multiple functions in plant defense responses in addition to cytokinesis.  14  2.2 Introduction Plants have evolved different strategies to protect themselves against pathogen. PAMP- triggered immunity (PTI) acts as the frontline in the plant immune system. Pattern recognition receptors localized on the plasma membrane perceive conserved microbial components collectively known as PAMPs to activate downstream defense responses 3, 29. One of the well characterized PAMPs is bacterial flagellin 30, which is perceived by the receptor-like kinases FLAGELLIN SENSING 2 (FLS2) and BAK1 31-34. Together they recognize a conserved 22-amino acid epitope on bacterial flagellin called flg22. To subvert PTI, pathogens deliver effector proteins into plant cells. Plants have evolved resistance (R) proteins to recognize pathogen effector proteins either directly or indirectly, which leads to effector-triggered immunity (ETI) 1, 35. Most R genes encode intracellular nucleotide-binding (NB)–leucine-rich repeat (LRR) proteins 36.   In Arabidopsis, there are 20 mitogen-activated protein kinases (MAPKs), 10 MAPK kinases (MAPKKs) and about 60 MAPK kinase kinases (MAPKKKs) 37.  They work in combinations to form distinct MAP kinase cascades that play diverse roles in plant development and stress signaling 12, 38. Several MAP kinase cascades including Yoda-MKK4/MKK5-MPK3/MPK6, MEKK1-MKK1/MKK2-MPK4 and ANPs (Arabidopsis NPR1-related Protein Kinases)-MKK6-MPK4 have been studied extensively. Arabidopsis MKK4/MKK5 and MPK3/MPK6 function in regulating both development and defense against pathogens. They form a MAP kinase cascade with the MAPKKK Yoda to mediate signal transduction from upstream RLKs such as ER and BAK1 to the downstream transcription factors in stomata development 39, 40. In response to flg22 treatment, the MAP kinase cascade consisting of MKK4/MKK5, MPK3/MPK6 and an unknown MAPKKK are 15  activated 15. This kinase cascade has been shown to play a critical role in regulating the biosynthesis of ethylene and phytoalexins 16, 17. The MEKK1-MKK1/MKK2-MPK4 cascade is also activated following flg22 treatment 21, 41. Components of this kinase cascade were originally identified as negative regulators of plant immunity based on the autoimmune phenotypes in the mekk1, mkk1 mkk2 and mpk4 mutants 21, 22, 41-44. Further studies on the suppressor mutants of mkk1 mkk2 showed that autoimmunity in these mutants is caused by activation of the coiled-coil (CC)-NB-LRR protein SUMM2 25.  The autoimmune phenotypes in the mekk1, mkk1 mkk2 and mpk4 mutants are also dependent on MEKK2 23, 45, but the mechanism underlying this dependence is unclear. MPK4 was recently shown to phosphorylate the mRNA decay factor PAT1, and loss of function of PAT1 leads to activation SUMM2-dependent defense responses 46.  In the absence of SUMM2, mekk1 and mkk1 mkk2 mutant plants exhibit enhanced susceptibility to pathogens, suggesting that the MEKK1-MKK1/MKK2-MPK4 cascade functions in promoting basal resistance against pathogens 25. Consistently, MPK4 is required for the expression of approximately 50% of the genes induced by flg22 47. MPK4 also plays a role in the negative regulation of flg22-induced gene expression through phosphorylation of the transcriptional repressor ASR3 48. From a functional yeast screen, mutations that render Arabidopsis MAPKs constitutively active have been identified 49. The specificity toward known activators and substrates appears to be unchanged in the constitutively active mutants of MAPKs (CA-MPKs). CA-MPK4 transgenic plants accumulate less salicylic acid following pathogen infection and exhibit enhanced susceptibility to a number of pathogens 49. Interestingly, immunity specified by the Toll Interleukin-1 Receptor (TIR)-NB-LRR resistance proteins RPS4 and RPP4 were also found to be 16  compromised in CA-MPK4 transgenic plants, suggesting that constitutive activation of MPK4 inhibits resistance mediated by RPS4 and RPP4.  ANP1, ANP2 and ANP3 are three MAPKKKs closely related to NPK1, which is involved in the regulation of cytokinesis in tobacco 50. Single mutants of anp1, anp2 and anp3 appear wild type-like, whereas the anp2 anp3 double mutant displays abnormal cytokinesis 26. The anp1 anp2 anp3 triple mutant cannot be obtained because of lethality. In Arabidopsis, MKK6 and MPK4 function downstream of ANPs to regulate cytokinesis 27, 28, 51, 52. MKK6 interacts with MPK4 in yeast two-hybrid assay and phosphorylates MPK4 in vitro 27. Loss of the functions of MKK6 and MPK4 leads to severe defects in cytokinesis. In this study, we report that MKK6 functions together with MEKK1 and MPK4 to negatively regulate SUMM2-mediated immunity and the ANP2/ANP3-MKK6-MPK4 cascade plays a critical role in negative regulation of defense responses independent of SUMM2, thus establishing a novel role for MKK6 in regulating plant innate immune signaling.  2.3 Results 2.3.1 Characterization of summ4-1D mkk1 mkk2  From a suppressor screen of mkk1 mkk2 (mkk1/2) previously described 25, we identified the dominant summ4-1D mutation which suppresses the dwarf phenotype of mkk1/2 almost completely (Figure 2.1).   To determine whether the constitutive defense response induction in mkk1/2 is suppressed by summ4-1D, we examined the expression levels of defense marker genes Pathogenesis-Related 1 (PR1) and Pathogenesis-Related 2 (PR2) in summ4-1D mkk1/2. As shown in Figures 1B and 1C, constitutive expression of PR1 and PR2 in mkk1/2 is completely 17  suppressed in the summ4-1D mkk1/2 triple mutant. We further tested whether summ4-1D affects pathogen resistance in mkk1/2 by challenging summ4-1D mkk1/2 seedlings with the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2. As shown in Figure 2.1D, growth of H.a. Noco2 on summ4-1D mkk1/2 was much higher than on mkk1/2 . Taken together, these data demonstrate that the constitutively activated defense responses in mkk1/2 are suppressed by the summ4-1D mutation.  Figure 2.1. Characterization of summ4-1D mkk1/2   (A) Morphological phenotypes of three-week-old wild type (WT), mkk1/2 and summ4-1D mkk1 mkk2.  18  (B-C) Expression levels of PR1 (B) and PR2 (C) in WT, mkk1/2 and summ4-1D mkk1/2. Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements. (D) Growth of H. a. Noco2 on WT, mkk1/2 and summ4-1D mkk1/2. Error bars represent standard deviations from three replicates. Statistical differences among the samples are labelled with different letters (P < 0.01, one-way ANOVA, n=3).  2.3.2 Positional cloning of SUMM4 To map the summ4-1D mutation, summ4-1D mkk1/2 (which was generated in the Columbia-0 ecotype) was crossed with Landsberg erecta (Ler). Plants that are mkk1/2 homozygous in the F2 population were selected for linkage analysis. Crude mapping showed that the summ4-1D mutation is located between markers K19E20 and MMN10 on chromosome 5 (Figure 2.2). To identify the summ4-1D mutation, a genomic DNA library of summ4-1D mkk1/2 was prepared and sequenced using Illumina whole genome sequencing. Using single nucleotide polymorphisms identified from the sequence data and progeny of F2 plants homozygous for mkk1/2 and heterozygous for summ4-1D, we further narrowed the summ4-1D mutation to a region between markers 22.8 and 23.5 on chromosome 5 (Figure 2.2A). Only one mutation, a C to T substitution located in the promoter region of MKK6 (At5g56580), was identified in this region (Figure 2.2A).  To test whether the mutation can supress the mkk1/2 mutant phenotype, a genomic clone of MKK6 carrying the candidate summ4-1D mutation was transformed into plants homozygous for mkk1 and heterozygous for mkk2, as the mkk1/2 double mutant is seedling lethal. Transgenic plants homozygous for mkk1 and mkk2 were identified by PCR and they displayed wild type-like 19  morphology (Figure 2.2B). The elevated PR gene expression levels in mkk1/2 were also supressed in these transgenic lines (Figure 2.2C and 2.2D). These data suggest that the mutation in the promoter region of MKK6 is responsible for the suppression of the mkk1/2 mutant phenotypes in summ4-1D mkk1/2.   20   Figure 2.2. Positional Cloning of SUMM4 (A) Positional cloning of SUMM4. Markers 21.3, 22.8, 23.5 and 23.9 were based on SNPs between wild type and summ4-1D. (B) Morphology of three-week-old mkk1/2 plants expressing MKK6 driven by its native promoter containing the summ4-1D mutation. T2 plants of three independent transgenic lines are shown.  (C-D) Expression levels of PR1 (C) and PR2 (D) in WT, mkk1/2 and mkk1/2 transgenic lines expressing MKK6 with the summ4-1D mutation. Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements. (E) MKK6 expression levels in WT, mkk1/2, summ2-8 mkk1 mkk2, summ4-1D mkk1/2 and summ4-1D plants. Values were normalized relative to the expression of ACTIN1. Error bars 21  represent standard deviations from three measurements. Statistical differences among the samples are labelled with different letters (P < 0.01, one-way ANOVA, n=3).  Figure 2.3. eFP browser view of MKK6 expression during Arabidopsis development. eFP browser view of MKK6 gene expression during Arabidopsis development.  Expression strength coded by color: yellow = low, red = high.  Expression strength coded by color: yellow = low, red = high. The Arabidopsis eFP Browser is located at bar.utoronto.ca.  22    Figure 2.4. Characterization of summ4-2D and transgenic lines over-expressing MKK6 in mkk1 mkk2. 23  (A) Morphology of three-week-old Col (WT), mkk1/2, and summ4-2D mkk1/2. (B-C) Expression levels of PR1 (B) and PR2 (C) in WT, mkk1/2 and summ4-2D mkk1/2. Error bars represent standard deviations from three measurements. (D) Growth of H. a. Noco2 on WT, mkk1/2 and summ4-2D mkk1/2. Error bars represent standard deviations from three replicates. Statistical differences among the samples are labelled with different letters (P < 0.01, one-way ANOVA, n=3). (E) Morphology of three-week-old mkk1/2 plants expressing MKK6 driven by its native promoter containing the summ4-2D mutation. T2 plants of three independent transgenic lines are shown. (F) Morphology of three-week-old mkk1/2 plants expressing MKK6 driven by the 35S promoter. T2 plants of three independent transgenic lines are shown.  2.3.3 The summ4-1D mutation results in elevated expression of MKK6  Analysis of the expression pattern of MKK6 using the eFP Browser 53 showed that MKK6 is expressed at high levels in the shoot apex as well as at early stages of embryo development, floral development and formation of siliques (Figure 2.3). In contrast, MKK6 is expressed in leaf tissue at low levels.  Since the summ4-1D mutation is in the promoter region of MKK6, we tested whether the expression level of MKK6 is affected. As shown in Figure 2.2E, the summ4-1D mkk1/2 triple mutant has much higher expression of MKK6 than wild type and mkk1/2. To make sure the increased MKK6 expression level is not caused by the suppression of the autoimmune phenotype in summ4-1D mkk1/2, we also quantified MKK6 expression level in summ2-8 mkk1/2 and found that summ2-8 does not affect the expression of MKK6 in mkk1/2.  The summ4-1D single mutant has wild type-like morphology and no obvious developmental defects. In the summ4-1D single mutant, the expression level of MKK6 is also dramatically increased compared to wild type, suggesting that the summ4-1D mutation causes increased MKK6 expression. 24  From the mkk1 mkk2 suppressor screen, we also identified a second allele of summ4 designated as summ4-2D. summ4-2D mkk1 mkk2 displayed wild type-morphology (Figure 2.4A) and the constitutive expression of PR1 and PR2 observed in mkk1 mkk2 is largely suppressed in the triple mutant (Figure 2.4B and 2.4C). summ4-2D was mapped to the same region as summ4-1D and found to also carry a mutation in the promoter region of MKK6 (Figure 2.2A). In the summ4-2D mutant plants, the expression level of MKK6 is also considerably higher than in wild type (Figure 2.4D). When a genomic clone of MKK6 carrying the summ4-2D mutation was transformed into mkk1 mkk2, the dwarf morphology of mkk1 mkk2 was suppressed (Figure 2.4E). Similarly, when a construct expressing MKK6 under the cauliflower mosaic virus 35S promoter was transformed into mkk1 mkk2, the dwarf morphology of mkk1 mkk2 was also suppressed (Figure 2.4F). These data suggest that suppression of mkk1 mkk2 by summ4-1D and summ4-2D was caused by over-expression of MKK6. 2.3.4 summ4-1D does not suppress the autoimmune phenotypes of mekk1 and mpk4  Since MEKK1 functions upstream of MKK1/MKK2, we crossed summ4-1D into mekk1-1 to test whether the mekk1 mutant phenotype can be suppressed by summ4-1D. As shown in Figure 2.5, summ4-1D mekk1-1 has similar dwarf morphology as mekk1-1. The expression levels of PR1 and PR2 in the double mutant are also comparable to those in mekk1-1 (Figure 2.5B and 2.5C), suggesting that summ4-1D cannot supress the constitutively induced defense responses in  mekk1-1. We also generated the summ4-1D mpk4-3 double mutant to test whether the mpk4 mutant phenotype can be suppressed by summ4-1D. Morphologically the summ4-1D mpk4-3 double mutant is indistinguishable from mpk4-3 (Figure 2.5D). Analysis of the expression levels of PR1 and PR2 in summ4-1D mpk4-3 showed that they are also similar to those in mpk4-3 (Figure 2.5E 25  and 5F), indicating that the autoimmune phenotypes associated with mpk4-3 cannot be suppressed by the summ4-1D mutation. 2.3.5 MKK6 interacts with MEKK1 and MPK4  To test whether MKK6 interacts with MEKK1 and MPK4, split luciferase complementation assays were conducted using constructs expressing MKK6 fused to the C-terminal domain of luciferase (MKK6CLuc) and MEKK1 and MPK4 fused to the N-terminal domain of luciferase (MEKK1NLuc and MPK4NLuc) under a 35S promoter.  If MKK6 associates with MEKK1 or MPK4, a functional luciferase complex would be formed. Consistent with a previous report that MPK4 interacts with MKK6 in bimolecular fluorescence complementation assays, strong luciferase activity was observed when MKK6CLuc and MPK4NLuc were co-expressed in Nicotiana (N.) benthamiana (Figure 2.5G). Luciferase activity was also observed when MKK6CLuc and MEKK1NLuc were co-expressed in N. benthamiana, although at lower levels (Figure 2.5G). These data suggest that MKK6 interacts with both MEKK1 and MPK4 in planta. Previously MKK1 and MKK2 were shown to interact with MEKK1 and MPK4 on the plasma membrane21. In Arabidopsis mesophyll protoplasts, the MKK6-eYFP fusion protein was also localized to the plasma membrane (Figure 2.6). 2.3.6 Over-expression of MKK6 restores MAPK kinase activation in mkk1 mkk2 To test whether the summ4-1D mutation restores MAPK kinase activation in mkk1 mkk2, we analyzed flg22-induced activation of MAPK kinases in summ4-1D mkk1 mkk2 by western blot analysis using the anti-phospho-p44/42-ERK antibody. Following flg22 treatment, three immuno-reactive bands corresponding to activated MAPKs can be detected in wild type samples. The top and middle bands represent phosphorylated MPK6 and MPK3 respectively, whereas the low band contains mostly phosphorylated MPK4 and a small amount of phosphorylated MPK1, 26  MPK11 and MPK13 54, 55. Consistent with that MKK1 and MKK2 are required for activation of MPK4 by flg22 21, 41, there is almost no phosphorylated MPKs detected at the position of the third band in the flg22-treated summ2-8 mkk1 mkk2 (Figure 2.5H). In contrast, phosphorylated MPKs were detected at the position of the third band in the flg22-treated summ4-1D mkk1 mkk2 (Figure 2.5H), suggesting that increased expression of MKK6 in summ4-1D leads to restoration of MPK4 activation by flg22.  27   Figure 2.5. summ4-1D does not suppress the autoimmune phenotypes of mekk1 and mpk4 and restores MPK4 activation in mkk1 mkk2 double mutant. (A) Morphology of three-week-old WT, summ4-1D, mekk1-1 and summ4-1D mekk1-1 plants. 28  (B-C) Expression levels of PR1 (B) and PR2 (C) in WT, mekk1-1 and summ4-1D mekk1-1. Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements. (D) Morphology of three-week-old WT, summ4-1D, mpk4-3 and summ4-1D mpk4-3 plants. (E-F) Expression levels of PR1 (E) and PR2 (F) in WT, mekk1-1 and summ4-1D mekk1-1. Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements. (G) Interactions between MKK6 and MEKK1 or MPK4. Luciferase activities from split luciferase complementation assays represented in Relative Light Units (RLU). Error bars represent standard deviations from eight replicates. Statistical differences among the samples are labelled with different letters (P < 0.05, one-way ANOVA, n=8). (H) MAPK activation in wild type (WT), summ2-8 mkk1/2 and summ4-1D mkk1/2. Plants were sprayed with 100 µM flg22. Samples were harvested at 0 and 15min after flg22 treatment. MAPKs activation was detected by immunoblots using anti-ERK antibody (Cell signaling; #4370S).  Figure 2.6. Subcellular localization of MKK6-eYFP fusion protein.  Arabidopsis protoplasts were transfected with a construct for expressing the MKK6-eYFP fusion protein under the 35S promoter. Images were captured at around 20 h post-transfection.  Scale bar = 10 μm  29  2.3.7 PR1 and PR2 are constitutively expressed in mkk6 mutant plants T-DNA insertion mutants of MKK6 exhibit severe dwarf morphology 27. To identify genes that are differentially expressed in wild type and mkk6 loss-of-function mutant plants, we carried out RNA-sequencing analysis on wild type and mkk6-2 plants. Compared to wild type, 632 genes were found to have increased expression and 210 genes were found to have reduced expression in mkk6-2. Gene ontology (GO) analysis of biological functions of the genes differentially expressed in mkk6-2 showed that genes responsive to biotic stress are significantly enriched (Figure 2.7A). Both PR1 and PR2 are among genes with increased expression levels in mkk6-2 identified by RNA-sequencing. Quantitative RT-PCR analysis confirmed that both PR1 and PR2 are constitutive expressed in mkk6-2 (Figure 2.7B and 2.7C). Similarly, mkk6-3 also has elevated PR gene expression (Figure 2.8). To determine whether constitutive activation of defense gene expression is caused by reduced MPK4 activity, we crossed mkk6-2 with a transgenic line expressing the MPK4D198G/E202 (CA-MPK4) mutant that is constitutively active and obtained the mkk6-2 MPK4-CA double mutant. The mkk6-2 MPK4-CA double mutant was found to have wild type morphology (Figure 2.7D). As shown in Figure 2.7E and 2.7F, constitutive expression of PR1 and PR2 in mkk6-2 is largely blocked by the MPK4-CA transgene, suggesting that MPK4 functions downstream of MKK6 in regulating plant defense responses. 30  31   Figure 2.7.  Expression of PR genes in mkk6-2 and CA-MPK4 mkk6-2.   (A) GO analysis of the biological functions of genes differentially expressed in mkk6-2 compared to wild type. Differentially expressed genes in the mkk6-2 mutant were analyzed using GO term analysis. Top 10 significant GO terms ranked by enrichment scores are shown. Blue bars represent significant GO terms of upregulated genes, while red bars represent significant GO terms of downregulated genes. (B-C) PR1 (B) and PR2 (C) expression levels in WT and mkk6-2.  (D) Morphology of three-week-old WT, mkk6-2 and CA-MPK4 mkk6-2 plants. (E-F) PR1 (E) and PR2 (F) expression levels in WT, mkk6-2 and CA-MPK4 mkk6-2.  Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements. 32   Figure 2.8. PR1 and PR2 expression levels in WT and mkk6-3.  Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements.  2.3.8 Defense responses are constitutively activated in the anp2 anp3 double mutant ANPs have previously been shown to interact with MKK6 and function upstream of MKK6 in regulating cytokinesis 26-28, 52. Microarray analysis showed that PR1 and PR2 are up-regulated in the anp2-1 anp3-1 double mutant (Wassilewskija background) 26. To determine whether ANP2 and ANP3 are involved in the negative regulation of plant immunity, we assayed defense responses in the anp2-2 anp3-3 double mutant (Col-0 background). Compared to wild type and the anp2-2 and anp3-3 single mutants, the anp2-2 anp3-3 double mutant exhibits dwarf morphology (Figure 2.9A). Both PR1 and PR2 are constitutively expressed in the anp2-2 anp3-3 double mutant, but not in the anp2-2 and anp3-3 single mutants (Figure 2.9B and 2.9C). To test whether anp2-2 anp3-3 exhibits enhanced pathogen resistance, double mutant plants were challenged with the virulent oomycete pathogen H. a. Noco2. As shown in Figure 2.9D, H. a. Noco2 growth is greatly reduced in the anp2-2 anp3-3 double mutant compared to the wild type 33  and the single mutants, suggesting that ANP2 and ANP3 function redundantly in negative regulation of plant defense responses.  Figure 2.9. Characterization of the anp2-2 anp3-3 double mutant.  (A) Morphology of three-week-old WT, anp2-2, anp3-3 and anp2-2 anp3-3 plants. (B-C) PR1 (B) and PR2 (C) expression levels in WT, anp2-2, anp3-3 and anp2-2 anp3-3.  (D) H. a. Noco2 growth on WT, anp2-2, anp3-3 and anp2-2 anp3-3. Statistical differences among the samples are labelled with different letters (P <0.01, one-way ANOVA, n=3)  34  2.3.9 The autoimmune phenotype of anp2 anp3 can be partially suppressed by the CA-MPK4 mutant To test whether the autoimmunity observed in anp2-2 anp3-3 is due to reduced activity of MPK4, the anp2-2 anp3-3 double mutant was crossed with a transgenic line expressing the CA-MPK4 mutant to obtain the anp2 anp3 CA-MPK4 triple mutant. As shown in Figure 2.10, the dwarf morphology of anp2-2 anp3-3 is partially suppressed by CA-MPK4. Analysis of PR gene expression showed that the expression levels of both PR1 and PR2 are also lower in the anp2 anp3 CA-MPK4 triple mutant (Figure 2.10B and 2.10C). In addition, growth of H. a. Noco2 is much higher in the triple mutant than in the anp2-2 anp3-3 double mutant (Figure 2.10D). These data suggest that ANP2/ANP3 function upstream of MPK4 in a defense signaling pathway.  35  Figure 2.10. CA-MPK4 partially blocks the constitutive defense responses in anp2-2 anp3-3.  (A) Morphology of three-week-old WT, anp2-2 anp3-3 and CA-MPK4 anp2-2 anp3-3 plants.  (B-C) PR1 (B) and PR2 (C) expression levels in WT, anp2-2 anp3-3 and CA-MPK4 anp2-2 anp3-3.  (D) H. a. Noco2 growth on WT, anp2-2 anp3-3 and CA-MPK4 anp2-2 anp3-3. Statistical differences among the samples are labelled with different letters (P <0.01, one-way ANOVA, n=3).  2.3.10 Constitutive defense response activation in anp2 anp3 is independent of SUMM2 As constitutive defense responses in mpk4 are largely dependent on SUMM2, we tested whether the SUMM2-dependent defense pathway is activated in anp2 anp3.  The anp2-2 anp3-3 summ2-8 triple mutant was obtained by crossing summ2-8 into anp2-2 anp3-3. As shown in Figure 2.11, summ2-8 has no effects on the morphology of anp2-2 anp3-3. In addition, summ2-8 has no effect on the expression of PR genes (Figure 2.11B and 2.11C) or resistance to H. a. Noco2 (Figure 2.11D), suggesting that the autoimmune phenotype of anp2 anp3 is independent of SUMM2.  2.3.11 PAD4 and EDS1 are required for the autoimmune phenotype of anp2 anp3   Constitutive activation of MPK4 was previously shown to compromise effector-triggered immunity specified by the TIR-NB-LRR resistance proteins RPS4 and RPP4. To test whether resistance mediated by TIR-NB-LRR proteins is activated in anp2 anp3, we crossed loss of function mutants of PAD4 and EDS1, which is required for resistance mediated by TIR-NB-LRR proteins56, 57, into anp2-2 anp3-3. As shown in Figure 2.11E, the pad4-1 mutation partially suppresses the dwarf morphology of anp2-2 anp3-3. Elevated expression levels of PR1 and PR2 36  in anp2-2 anp3-3 are largely suppressed in the anp2-2 anp3-3 pad4-1 triple mutant (Figure 2.11F and 2.11G). Furthermore, the enhanced resistance to H. a. Noco2 in anp2 anp3 is also abolished in the anp2 anp3 pad4-3 triple mutant (Figure 2.11H). Similarly, the dwarf morphology is also suppressed by eds1-2 (Figure 2.11I).  These data suggest that the autoimmune phenotype of anp2-2 anp3-3 is dependent on PAD4 and EDS1.   37     Figure 2.11. Constitutive defense responses in anp2-2 anp3-3 are independent of SUMM2 but dependent on PAD4.  (A) Morphology of three-week-old WT, anp2-2 anp3-3 and summ2-8 anp2-2 anp3-3.  38  (B-C) PR1 (B) and PR2 (C) expression levels in WT, anp2-2 anp3-3 and summ2-8 anp2-2  anp3-3.  (D) H. a. Noco2 growth on WT, anp2-2 anp3-3 and summ2-8 anp2-2 anp3-3. Statistical differences among the samples are labelled with different letters (P <0.01, one-way ANOVA, n=3). (E) Morphology of three-week-old WT, anp2-2 anp3-3 and pad4-1 anp2-2 anp3-3.  (F-G) PR1 (F) and PR2 (G) expression levels in WT, anp2-2 anp3-3 and pad4-1 anp2-2 anp3-3.  (H) H. a. Noco2 growth on WT, anp2-2 anp3-3 and pad4-1 anp2-2 anp3-3. Statistical differences are labelled with different letters (P <0.01, one-way ANOVA, n=3) (I) Morphology of three-week-old WT, anp2-2 anp3-3 and anp2-2 anp3-3 eds1-2.  2.3.12 summ4-1D partially suppresses the mutant phenotypes of anp2-2 anp3-3   To test whether increased expression of MKK6 affects the mutant phenotypes of anp2-2 anp3-3, we crossed summ4-1D with anp2-2 anp3-3 and generated the summ4-1D anp2-2 anp3-3 triple mutant. As shown in Figure 2.12, the dwarf morphology of anp2-2 anp3-3 is largely suppressed in the triple mutant (Figure 2.12A). However, the expression of PR1 and PR2 in anp2-2 anp3-3 is only modestly affected by summ4-1D (Figure 2.12B and 2.12C). 39   Figure 2.12. Suppression of anp2-2 anp3-3 mutant phenotypes by summ4-1D.   (A) Morphology of WT, summ4-1D, anp2-2 anp3-3 and summ4-1D anp2-2 anp3-3 triple mutant. Photos were taken from three-week-old soil grown plants. (B and C) Gene expression levels of PR1 (B) and PR2 (C) in WT, summ4-1D, anp2-2 anp3-3 and summ4-1D anp2-2 anp3-3. Values were normalized relative to the expression of ACTIN1. Error bars represent standard deviations from three measurements.  2.3.13 anp2-2 anp3-3 is more susceptible to Pseudomonas syringae pv. tomato DC3000 hrcC-  To test whether PTI is affected by the loss of the function of ANP2 and ANP3, the single anp2-2 and anp3-3 mutants as well as the double  anp2-2 anp3-3 mutant were infiltrated with 40  Pseudomonas syringae pv. tomato (Pto) DC3000 hrcC-, a bacterial strain deficient in the delivery of type III effectors that is often used to assess PTI. As shown in Figure 2.13, growth of Pto DC3000 hrcC- is comparable in anp2-2, anp3-3 and wild type, but much higher in the anp2-2 anp3-3 double mutant, suggesting that ANP2 and ANP3 function redundantly in the positive regulation of PTI.   Figure 2.13.  Growth of Pto DC3000 hrcC- in wild type, anp2-2, anp3-3, and anp2-2 anp3-3.  Plants were infiltrated with Pto DC3000 hrcC- (OD600 = 0.2). Bacterial growth was measured at day 0 and day 3 by taking leaf discs within the inoculated area. Statistical differences are labelled with different letters (P <0.01, one-way ANOVA, n=8).  41  2.3.14 MKK6 negatively regulates anthocyanin accumulation One of the genes with increased expression in mkk6-2 identified by RNA-sequencing encodes the MYB75, which functions as a key positive regulator in anthocyanin biosynthesis58. mkk6-2 but not mekk1 and mpk4 mutant plants are typically purple when mature. We therefore tested whether MKK6 is involved in regulating anthocyanin biosynthesis. Quantitative RT-PCR analysis confirmed that MYB75 transcript level is considerably higher in mkk6-2 compared to wild type (Figure 2.14A). Next we analyzed anthocyanin levels in mkk6-2 following treatment with sucrose, which has been reported as an effective inducer of anthocyanin production in Arabidopsis seedlings 59 and this induction is reversed by treatment with PAMPs 60. As shown in Figure 2.14B, a high concentration of sucrose induces increased accumulation of anthocyanin in wild type seedlings and addition of flg22 to the media blocks the induction. In contrast, mkk6-2 mutant seedlings accumulate high levels of anthocyanin when grown on media with either low or high concentrations of sucrose and addition of flg22 in the media does not suppress the accumulation of anthocyanin in mkk6-2, suggesting that MKK6 negatively regulates anthocyanin levels. We also tested whether induction of anthocyanin accumulation by sucrose is affected by loss of the functions of MEKK1 and MPK4. Because mekk1 and mpk4 mutants are extremely dwarf and difficult to work with, we quantified anthocyanin levels in mekk1-1 summ2-8 and mpk4-3 summ2-8. As shown in Figure 15B, mekk1-1 summ2-8 and mpk4-3 summ2-8 accumulated comparable levels of anthocyanin as wild type under both low and high concentrations of sucrose conditions. Similar to wild type, induction of anthocyanin accumulation in mekk1-1 summ2-8 and mpk4-3 summ2-8 by sucrose is also suppressed by flg22. 42   Figure 2.14. Expression levels of MYB75 in wild type and mkk6-2, and accumulation of anthocyanin in wild type, mkk6-2, mekk1 summ2-8 and mpk4-3 summ2-8 seedlings. Low sucrose media contains 10 mM of sucrose and high sucrose media contains 100 mM of sucrose. PAMP treatment was carried out by including 100 nM of flg22 in the high sucrose media. Error bars represent standard deviations from three measurements.  2.4 Discussion Despite the fact that MEKK1 and MKK1/MKK2 function in the same MAP kinase pathway, the mutant phenotypes of mekk1 and mkk1/2 are not identical 12. mekk1 knockout mutant plants are much smaller than the mkk1/2 double knockout mutants, suggesting that one or more MKKs may have overlapping functions  with MKK1/MKK2. In this study, we have shown that MKK6 interacts with MEKK1 and MPK4 in split-luciferase assays, and elevated expression of MKK6 in the summ4-1D mutant suppresses the autoimmune phenotypes of mkk1/2, but not those 43  associated with the mekk1 and mpk4 loss-of-function mutations. These data suggest that MKK6 functions in parallel with MKK1/MKK2 to transduce signals from MEKK1 to MPK4 (Figure 2.15).  Figure 2.15. A working model for the roles of MKK6 in plant immunity. MKK6 functions in parallel with MKK1 and MKK2 to form a MAPK cascade to prevent activation of SUMM2-mediated immunity. MKK6 also functions together with ANP2/ANP3 and MPK4 in a separate MAPK cascade that negatively regulates a EDS1/PAD4-dependent defense pathway.  Arabidopsis ANPs and MKK6 have previously been shown to function together with MPK4 to regulate cytokinesis 26-28, 52. Our data suggest that ANP2/ANP3 and MKK6 also play important roles in plant immunity. anp2 anp3 and mkk6 mutant plants constitutively express PR genes and exhibit enhanced pathogen resistance. These autoimmune phenotypes can be suppressed by a 44  constitutively active MPK4 mutant protein, suggesting that ANP2/ANP3 and MKK6 function together with MPK4 in a MAP kinases cascade to negatively regulate plant defense. Arabidopsis has 60 predicted MAPKKKs, but only 10 MKKs and 20 MAPKs 37, suggesting that some of the MKKs and MAPKs may have multiple functions and can form distinct MAP kinase cascades with different MAPKKKs to regulate different biological processes. This is supported by the diverse roles of MKK4/MKK5 and MPK3/MPK6 in plant defense as well as in development 38. Our study revealed that MKK6 also has multiple functions. In addition to its role in cytokinesis, MKK6 is involved in two MAPK kinase cascades that negatively regulate plant immunity. Furthermore, MKK6 also plays a role in regulating anthocyanin levels.  In contrast to mkk6-2, loss of function of either MEKK1 or MPK4 does not seem to affect anthocyanin accumulation, suggesting that they either do not function together with MKK6 in regulating anthocyanin levels or there are additional functionally redundant MAPKKKs and MPKs involved in the process. A crosstalk between PAMP signalling and abiotic stress-induced flavonoid accumulation has been described in a wide range of plant- microbe interactions, PAMP treatment has been shown to inhibit sucrose-induced anthocyanin production 60. Since flg22 treatment does not affect elevated anthocyanin levels in mkk6-2, it is possible that MKK6 may function as a critical signaling component in PAMP-induced suppression of anthocyanin production in plants under stressed conditions. Both the MEKK1-MKK1/MKK2-MPK4 and ANPs-MKK6-MPK4 cascades lead to activation of MPK4. Mutations in summ2 supress the autoimmune phenotypes of mekk1 and mkk1 mkk2, but not anp2 anp3, suggesting that these two MAP kinase cascades function independently in the negative regulation of plant immunity. This is consistent with the observation that the mutant phenotypes of mekk1 and mkk1 mkk2 are completely dependent on SUMM2, whereas the 45  constitutive defense responses in mpk4 can only be partially blocked by mutations in summ2 25. It is unclear why two kinase cascades both leading to activation of MPK4 cannot compensate each other. Previously it was shown that MEKK1 interacts with MKK1 and MKK2 on the plasma membrane 21, whereas the ANPs-MKK6-MPK4 cascade functions in regulating cytokinesis in the nucleus 27, 28, 51, 52. It is possible that the MEKK1-MKK1/MKK2-MPK4 and ANPs-MKK6-MPK4 cascades are active in different subcellular locations to prevent constitutive activation of immune responses.    The mechanism of how the ANP2/ANP3-MKK6-MPK4 cascade negatively regulates plant immunity is unknown. Previously it was shown that expression of a constitutively active MPK4 leads to compromised pathogen resistance mediated by TIR-NB-LRR proteins 49. The autoimmune phenotype of anp2 anp3 is dependent on EDS1 and PAD4, which are critical positive regulators of TIR-NB-LRR protein mediated resistance 56, 57. It is possible that activation of MPK4 through the ANP2/ANP3-MKK6-MPK4 cascade is required for its functions in negative regulation of immunity mediated by one or more TIR-NB-LRR proteins. Meanwhile, ANPs have been shown to function as positive regulators of elicitor-triggered defense responses and protection against the necrotrophic fungus Botrytis cinerea 61. Increased growth of Pto DC3000 hrcC- in the anp2-2 anp3-3 double mutant also supports a positive role of ANP2 and ANP3 in PTI. It is likely that components of the ANP2/ANP3-MKK6-MPK4 cascade are targeted by certain pathogens and plants have evolved resistance proteins to sense disruption of this kinase cascade. Similar to protection of the MEKK1-MKK1/ MKK2-MPK4 cascade by the NB-LRR protein SUMM2 25, loss of function of ANP2/ANP3, MKK6 or MPK4 likely results in activation of immunity mediated by as-yet unknown resistance proteins. 46  2.5 Methods 2.5.1 Plant Materials  The summ4-1D mkk1/2 triple mutant was isolated from an EMS mutagenized M2 population of mkk1/2 25. mkk1/2, mpk4-3, mekk1-1, summ2-8, summ2-8 mkk1/2, mkk6-2, mkk6-3,  pad4-1 and the CA-MPK4 transgenic  line were described previously 21, 22, 25, 27, 43, 49, 56. The summ4-1D single mutant was isolated through backcrossing the triple mutant summ4-1D mkk1/2 to wild type Col-0 plants. The summ4-1D mekk1-1 double mutant was obtained by crossing summ4-1D mkk1/2 with mekk1-1. The summ4-1D mpk4-3 double mutant was obtained by crossing summ4-1D mkk1/2 with mpk4-3. The anp2-2 anp3-3 double mutant was obtained by crossing anp2-2 (Salk_144973) and anp3-3 (Salk_081990) obtained from the Arabidopsis Biological Resource Center. The anp2-2 anp3-3 CA-MPK4, anp2-2 anp3-3 summ2-8 and anp2-2 anp3-3 pad4-1 triple mutants were obtained by crossing anp2-2 anp3-3 with CA-MPK4CA, summ2-8 and pad4-1, respectively. Plants were grown at 23oC under 16 hr light/8 hr dark on soil or ½ Murashige and Skoog (MS) media. 2.5.2 Mutant Characterization To determine gene expression levels, RNA was extracted from two-week-old seedlings grown on ½ MS media using EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, Canada). Genomic DNA contamination was removed by treatment with RQ1 RNase-Free DNase (Promega). Reverse Transcription was carried out using M-MuLV reverse transcriptase (New England Biolabs). Real-time PCR was performed using SYBR Premix Ex Taq II (Takara). Each experiment was repeated with three independent RNA samples. Primers of PR1, PR2 and ACTIN1 used for RT-PCR were previously described (Sun et al., 2015). Primers used for MKK6 expression are listed in Supplemental Table 1. 47   H. a. Noco2 infection was performed on two-week-old seedlings. The seedlings were sprayed with spore suspensions at a concentration of 50 000 spores per ml water. The plants were covered with a clear dome and kept at 18°C under 12 h light/12 h dark cycles in a growth chamber. Samples were collected seven days later and spores on the plants were resuspended in water and counted using a hemocytometer. Infection results were scored as previously   described 62. For anthocyanin analysis, seeds were germinated in 0.1% agar solution for two days under light at 23oC before being transferred onto ½ MS plates containing high (100 mM sucrose) or low ( 10 mM sucrose) levels of sucrose. For flg22 treatment, 100nM of flg22 was added to the high sucrose media. Seedlings were grown at 23oC under continuous light for nine days before sample collection. Anthocyanin content was determined as previously described (Nakata & Takagi, 2014). Seedlings were homogenized and extracted for 24 hours at 4oC using extraction buffer (45% methanol 5% acetic acid) proportioned to tissue fresh weight. The samples were then centrifuged at 13,000 rpm for 10 min and the absorbance of the supernatant was measured at 530 and 657 nm. Relative anthocyanin concentrations were calculated with the formula [A530 - (0.25 x A657)]. The relative anthocyanin amount was defined as the product of relative anthocyanin concentration and extraction solution volume. One anthocyanin unit equals one absorbance unit [A530 - (0.25 x A657)] in 1 mL of extraction solution. 2.5.3 Map-Based Cloning of SUMM4 For crude mapping of summ4-1D, the summ4-1D mkk1/2 triple mutant was crossed with Landsberg erecta (Ler). F2 plants homozygous for mkk1/2 were selected for linkage analysis. summ4-1D mkk1/2 was also crossed with wild type Col-0 plants to obtain the summ4-1D single 48  mutant. Plants homozygous for mkk1/2 and heterozygous for summ4-1D were also identified in the F2 generation and their progeny were used for fine mapping of summ4-1D. Markers for fine mapping were designed based on single nucleotide polymorphisms (SNPs) identified by sequencing the genome of summ4-1D mkk1/2 using Illumina sequencing. All primer sequences are listed in Appendix Table 1. For testing whether the summ4-1D mutation is responsible for the suppression of the mkk1/2 mutant phenotype, the SUMM4 gene including the mutation in the promoter region, approximately 1kb upstream of ATG, was amplified from the genomic DNA of summ4-1D mkk1/2 by PCR using primers MKK6-BamHI-F and MKK6-PstI-R. The DNA fragment was cloned into a modified pCambia1305 vector to express MKK6 under the mutant version of its native promoter. The construct was transformed into plants homozygous for mkk1 and heterozygous for mkk2 by the floral dipping method 63. Transgenic plants homozygous for mkk1 mkk2 were identified by PCR in the T1 generation. 2.5.4 Split Luciferase Complementation Assay For testing interactions between MKK6 and MEKK1 or MPK4, cDNA of MKK6 was amplified by PCR using primers MKK6-cLuc-F and MKK6-cLuc-R and cloned into pCamiba 1300 CLuc 64 to express MKK6CLuc under a 35S promoter. cDNA fragments of MEKK1 and MPK4 were excised from pMEKK1-YCE and pMPK4-YCE  21 and cloned into pCamiba 1300 NLuc 64 to express MEKK1NLuc and MPK4NLuc under a 35S promoter. 30-day-old tobacco leaves were infiltrated with Agrobacteria (OD600 = 0.2) carrying constructs expressing MKK6CLuc and MEKK1NLuc or MKK6CLuc and MPK4NLuc, along with the negative controls. Luciferase activity was measured using a plate reader. Plants were kept at 23oC under 16 hr light/8 hr dark condition for two days before assaying for luciferase activities. 49  2.5.5 MAPK activation To detect PAMP-induced MAPK phosphorylation in the different genotypes – WT(Col), summ2-8 mkk1/2 and summ4-1D mkk1/2, twelve-day-old plants grown on 1/2 MS medium plates were sprayed with 100nM flg22. Samples were collected 0 and 15 min after flg22 treatment. Total protein was extracted from ground transgenic Arabidopsis seedlings with protein extraction buffer (50 mM HEPES [pH 7.5], 150 mM KCl, 1 mM EDTA, 0.5% Trition-X 100, 1 mM DTT, proteinase inhibitor cocktail). Supernatants were collected by centrifugation at 13,000 rpm for 15 min. Total protein was separated in SDS-PAGE gel and MAPKs activation were detected by immunoblots using anti-phospho-p44/42-ERK antibody (Cell signaling; #4370S). 2.5.6 Subcellular localization of MKK6 WT(Col) Arabidopsis mesophyll protoplasts were isolated and transfected with pCambia1300-35S-MKK6-eYFP-3HA construct using a protocol described by Yoo et al. (Yoo et al., 2007). A Nikon ECLIPSE 80i confocal microscope was used to take the YFP fluorescence images of the protoplast expressing MKK6-eYFP fusion protein. 2.5.7 RNA-Seq and GO analysis RNA was prepared from 100mg of 12-day-old Arabidopsis seedlings grown on ½ MS media, using the RNeasy Plant Mini Kit from Qiagen. Library construction and RNA sequencing were performed by the RNA-sequencing service of the Beijing Genomics Institute. Sequencing, which was done using the BGISEQ-500 sequencing system featuring combinatorial Probe-Anchor Synthesis and improved DNA Nanoballs technology, produced an average of around 23 million raw reads per sample. After filtering low quality sequences, clean reads were mapped to reference using HISAT/Bowtie2 tools. The average genome mapping ratio was 97.78%. Gene expression was quantified using the RSEM software package. Samples were grouped by 50  genotype and differentially expressed genes were found using the Noiseq method using a cutoff criteria of foldchange ≥ 2 and diverge probability ≥ 0.8. The resulting genes were analyzed using the PANTHER classification system (www.pantherdb.org) to determine enriched Biological process GO terms.                51  Chapter 3 Conclusions and Future Directions My thesis work showed that MKK6 is a multi-functional protein with important roles in the regulation of plant immunity. It functions in two MAPK cascades to negatively regulate plant defense response. First, MKK6 functions in parallel with MKK1/MKK2 in the MEKK1-MKK1/MKK2-MPK4 cascade to negatively regulate plant immunity mediated by CRCK3 and SUMM2. MKK6 can interact and phosphorylate MPK4, and MEKK1 is required for activation of MPK4 by MKK6. In addition, MKK6 also functions in the ANP2/3-MKK6-MPK4 cascade to negatively regulate defense responses. The constitutive defense responses in anp2 anp3 is dependent on EDS1 and PAD4, suggesting that the ANP2/3-MKK6-MPK4 cascade negatively regulates immunity mediated by a TIR-NB-LRR R protein(s). Suppression of the constitutive defense phenotype in anp2 anp3 by a gain-of-function mutation in MKK6 supports the idea that MKK6 functions downstream of ANP2/3 in the process. Currently it is unknown which TIR-NB-LRR R protein is activated when the ANP2/3-MKK6-MPK4 kinase cascade is compromised. To identify downstream signaling components required for constitutively activated defense responses in anp2 anp3, a suppressor screen of anp2 anp3 has been carried out by Kehui Lian in our lab. A large number of suppressor mutants with WT-like morphology have been isolated. Some of these mutants may contain mutations in the TIR-NB-LRR R proteins which function downstream of the ANP2/3-MKK6-MPK4 kinase cascade. Further characterization of these suppressor mutants and identification of the mutant genes through positional cloning will improve our understanding of how the ANP2/3-MKK6-MPK4 cascade regulates plant immunity. Although MEKK1, MKK1/MKK2 and MPK4 function in the same kinase cascade, the dwarf morphology of mpk4 knock out mutant plants is not as dramatic as that in the mekk1 knockout 52  mutants. Most likely there are other MPKs downstream of MEKK1 and MKK1/MKK2/MKK6 that function in parallel with MPK4 to negatively regulate defense responses. To identify these MPKs downstream of MKK1/MKK2/MKK6, constitutive active versions of candidate MPKs in the same subfamily as MPK4 such as MPK11 and MPK13 have been transformed into the mkk1 mkk2 and anp2 anp3 background to test whether they can suppress the dwarf morphology of mkk1 mkk2 and anp2 anp3. Further characterization of suppression of defense phenotypes will be carried out to confirm the roles of these MPKs in regulation of plant defense downstream of MKK1/MKK2/MKK6. In addition to its roles in regulating plant immunity and cytokinesis, MKK6 is also involved in the negative regulation of anthocyanin accumulation. Whereas mkk6-2 has increased accumulation of anthocyanin, mekk1-1 summ2-8 and mpk4-3 summ2-8 accumulate comparable levels of anthocyanin as wild type when grown on both low and high concentrations of sucrose, suggesting that MEKK1 and MPK4 are either not involved, or they function redundantly with other MEKKs and MPKs in regulating anthocyanin levels. It will be interesting to identify the MEKKs and MPKs that function together with MKK6 in the negative regulation of anthocyanin accumulation.        53  References  1 Jones, J. D. and J. L. Dangl. The plant immune system. Nature 444(7117): 323-329(2006).  2 Spoel, S. H. and X. Dong. How do plants achieve immunity? Defence without specialized immune cells. Nat Rev Immunol 12(2): 89-100.10.1038/nri3141 (2012).  3 Boller, T. and G. Felix. A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 60: 379-406(2009).  4 Lehmann, S., et al. Reactive oxygen species and plant resistance to fungal pathogens. Phytochemistry 112: 54-62.10.1016/j.phytochem.2014.08.027 (2015).  5 Lu, D., et al. A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proc Natl Acad Sci U S A 107(1): 496-501.10.1073/pnas.0909705107 (2010).  6 Kong, Q., et al. Two Redundant Receptor-Like Cytoplasmic Kinases Function Downstream of Pattern Recognition Receptors to Regulate Activation of SA Biosynthesis. Plant Physiol 171(2): 1344-1354.10.1104/pp.15.01954 (2016).  7 Yamada, K., et al. The Arabidopsis CERK1-associated kinase PBL27 connects chitin perception to MAPK activation. EMBO J 35(22): 2468-2483.10.15252/embj.201694248 (2016).  8 Chisholm, S. T., et al. Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124(4): 803-814.10.1016/j.cell.2006.02.008 (2006).  9 Janjusevic, R., et al. A bacterial inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase. Science 311(5758): 222-226.10.1126/science.1120131 (2006).  10 Aarts, N., et al. Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci U S A 95(17): 10306-10311(1998).  11 van der Hoorn, R. A. and S. Kamoun. From Guard to Decoy: a new model for perception of plant pathogen effectors. Plant Cell 20(8): 2009-2017.10.1105/tpc.108.060194 (2008).  54  12 Rodriguez, M. C., et al. Mitogen-activated protein kinase signaling in plants. Annu Rev Plant Biol 61: 621-649.10.1146/annurev-arplant-042809-112252 (2010).  13 Roman, E., et al. MAP kinase pathways as regulators of fungal virulence. Trends Microbiol 15(4): 181-190.10.1016/j.tim.2007.02.001 (2007).  14 Lian, K. (2016). Genetic Analysis of ANP2/3-MKK6-MPK4 Cascade in Plant Immunity University of British Columbia.  15 Asai, T., et al. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415(6875): 977-983.10.1038/415977a (2002).  16 Liu, Y. and S. Zhang. Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16(12): 3386-3399.10.1105/tpc.104.026609 (2004).  17 Ren, D., et al. A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proc Natl Acad Sci U S A 105(14): 5638-5643.10.1073/pnas.0711301105 (2008).  18 Xu, J., et al. Pathogen-Responsive MPK3 and MPK6 Reprogram the Biosynthesis of Indole Glucosinolates and Their Derivatives in Arabidopsis Immunity. Plant Cell 28(5): 1144-1162.10.1105/tpc.15.00871 (2016).  19 Su, J., et al. Regulation of Stomatal Immunity by Interdependent Functions of a Pathogen-responsive MPK3/MPK6 Cascade and Abscisic Acid. Plant Cell.10.1105/tpc.16.00577 (2017).  20 Meng, X., et al. A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation. Plant Cell 24(12): 4948-4960.10.1105/tpc.112.104695 (2012).  21 Gao, M., et al. MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res 18(12): 1190-1198(2008).  22 Ichimura, K., et al. MEKK1 is required for MPK4 activation and regulates tissue-specific and temperature-dependent cell death in Arabidopsis. J Biol Chem 281(48): 36969-36976(2006).  23 Kong, Q., et al. The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis. Plant Cell 24(5): 2225-2236.10.1105/tpc.112.097253 (2012). 55   24 Zhang, Z., et al. The NLR protein SUMM2 senses the disruption of an immune signaling MAP kinase cascade via CRCK3. EMBO Rep 18(2): 292-302.10.15252/embr.201642704 (2017).  25 Zhang, Z., et al. Disruption of PAMP-induced MAP kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2. Cell Host Microbe 11(3): 253-263.S1931-3128(12)00057-1 [pii]10.1016/j.chom.2012.01.015 (2012).  26 Krysan, P. J., et al. An Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell 14(5): 1109-1120(2002).  27 Takahashi, Y., et al. HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana. Plant Cell Physiol 51(10): 1766-1776(2010).  28 Kosetsu, K., et al. The MAP kinase MPK4 is required for cytokinesis in Arabidopsis thaliana. Plant Cell 22(11): 3778-3790(2010).  29 Monaghan, J. and C. Zipfel. Plant pattern recognition receptor complexes at the plasma membrane. Curr Opin Plant Biol 15(4): 349-357.10.1016/j.pbi.2012.05.006 (2012).  30 Felix, G., et al. Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. The Plant Journal 18(3): 265-276(1999).  31 Gomez-Gomez, L. and T. Boller. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell 5(6): 1003-1011(2000).  32 Chinchilla, D., et al. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448(7152): 497-500.10.1038/nature05999 (2007).  33 Heese, A., et al. The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proc Natl Acad Sci U S A 104(29): 12217-12222(2007).  34 Sun, Y., et al. Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex. Science 342(6158): 624-628.10.1126/science.1243825 (2013).  35 Cui, H., et al. Effector-triggered immunity: from pathogen perception to robust defense. Annu Rev Plant Biol 66: 487-511.10.1146/annurev-arplant-050213-040012 (2015).  56  36 Li, X., et al. NLRs in plants. Curr Opin Immunol 32: 114-121.10.1016/j.coi.2015.01.014 (2015).  37 MAPK-Group. Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci. 7(7): 301-308(2002).  38 Meng, X. and S. Zhang. MAPK cascades in plant disease resistance signaling. Annu Rev Phytopathol 51: 245-266.10.1146/annurev-phyto-082712-102314 (2013).  39 Bergmann, D. C. and F. D. Sack. Stomatal development. Annu Rev Plant Biol 58: 163-181.10.1146/annurev.arplant.58.032806.104023 (2007).  40 Meng, X., et al. Differential Function of Arabidopsis SERK Family Receptor-like Kinases in Stomatal Patterning. Curr Biol 25(18): 2361-2372.10.1016/j.cub.2015.07.068 (2015).  41 Qiu, J. L., et al. Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1. Plant Physiol 148(1): 212-222(2008).  42 Petersen, M., et al. Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103(7): 1111-1120(2000).  43 Nakagami, H., et al. A Mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J Biol Chem 281(50): 38697-38704(2006).  44 Suarez-Rodriguez, M. C., et al. MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. Plant Physiol 143(2): 661-669(2007).  45 Su, S. H., et al. Deletion of a tandem gene family in Arabidopsis: increased MEKK2 abundance triggers autoimmunity when the MEKK1-MKK1/2-MPK4 signaling cascade is disrupted. Plant Cell 25(5): 1895-1910.10.1105/tpc.113.112102 (2013).  46 Roux, M. E., et al. The mRNA decay factor PAT1 functions in a pathway including MAP kinase 4 and immune receptor SUMM2. EMBO J 34(5): 593-608.10.15252/embj.201488645 (2015).  47 Frei dit Frey, N., et al. Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences. Genome Biol 15(6): R87.10.1186/gb-2014-15-6-r87 (2014).  57  48 Li, B., et al. Phosphorylation of trihelix transcriptional repressor ASR3 by MAP KINASE4 negatively regulates Arabidopsis immunity. Plant Cell 27(3): 839-856.10.1105/tpc.114.134809 (2015).  49 Berriri, S., et al. Constitutively active mitogen-activated protein kinase versions reveal functions of Arabidopsis MPK4 in pathogen defense signaling. Plant Cell 24(10): 4281-4293.10.1105/tpc.112.101253 (2012).  50 Nishihama, R., et al. The NPK1 mitogen-activated protein kinase kinase kinase is a regulator of cell-plate formation in plant cytokinesis. Genes Dev 15(3): 352-363.10.1101/gad.863701 (2001).  51 Zeng, Q., et al. AtMPK4 is required for male-specific meiotic cytokinesis in Arabidopsis. Plant J 67(5): 895-906.10.1111/j.1365-313X.2011.04642.x (2011).  52 Beck, M., et al. Arabidopsis homologs of nucleus- and phragmoplast-localized kinase 2 and 3 and mitogen-activated protein kinase 4 are essential for microtubule organization. Plant Cell 22(3): 755-771(2010).  53 Toufighi, K., et al. The Botany Array Resource: e-Northerns, Expression Angling, and promoter analyses. Plant J 43(1): 153-163.10.1111/j.1365-313X.2005.02437.x (2005).  54 Bethke, G., et al. Activation of the Arabidopsis thaliana mitogen-activated protein kinase MPK11 by the flagellin-derived elicitor peptide, flg22. Mol Plant Microbe Interact 25(4): 471-480.10.1094/MPMI-11-11-0281 (2012).  55 Nitta, Y., et al. Identification of additional MAP kinases activated upon PAMP treatment. Plant Signal Behav 9(11): e976155.10.4161/15592324.2014.976155 (2014).  56 Glazebrook, J., et al. Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143(2): 973-982(1996).  57 Feys, B. J., et al. Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J 20(19): 5400-5411(2001).  58 Borevitz, J. O., et al. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12(12): 2383-2394(2000).  59 Tsukaya, H., et al. Sugar-Dependent Expression of the CHS-A Gene for Chalcone Synthase from Petunia in Transgenic Arabidopsis. Plant Physiol 97(4): 1414-1421(1991). 58   60 Saijo, Y., et al. Receptor quality control in the endoplasmic reticulum for plant innate immunity. EMBO J 28(21): 3439-3449.10.1038/emboj.2009.263 (2009).  61 Savatin, D. V., et al. The Arabidopsis NUCLEUS- AND PHRAGMOPLAST-LOCALIZED KINASE1-Related Protein Kinases Are Required for Elicitor-Induced Oxidative Burst and Immunity. Plant Physiol 165(3): 1188-1202.10.1104/pp.114.236901 (2014).  62 Bi, D., et al. Activation of plant immune responses by a gain-of-function mutation in an atypical receptor-like kinase. Plant Physiol 153(4): 1771-1779(2010).  63 Clough, S. J. and A. F. Bent. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16(6): 735-743(1998).  64 Chen, H., et al. Firefly luciferase complementation imaging assay for protein-protein interactions in plants. Plant Physiol 146(2): 368-376.10.1104/pp.107.111740 (2008).                 59  Appendix  Table 1. Primers used in this study. primer name SEQUENCE (5' TO 3') purpose At5g52640-WT-F  CAGCCTGAACTCTTCATAAG mapping summ4-1D At5g52640-MT-F  CAGCCTGAACTCTTCATAAA At5g52640-SNP-R  CCAAAGGTAGATAGGGTAAC At5G56460-SNP-WT-F  CTCGCTCTCTCTCTAAACAG At5G56460-SNP-MT-F  CTCGCTCTCTCTCTAAACAA At5G56460-SNP-R  GCTCAAATCTACACCAACAG At5g58270 23.5M SNP WT F GAGTAGAGTCATATATTGATCG At5g58270 23.5M SNP MT F GAGTAGAGTCATATATTGATCA At5g58270 23.5M SNP R CACCTTCCCGTTTTCCAGTA 103 5-23.9M WT SNP F CACATCTTTATGAAGGAAGAACG 103 5-23.9M MT SNP F CACATCTTTATGAAGGAAGAACA 103 5-23.9M SNP R  GATGGGCATGTCTCAGCAAT MKK6-BamHI-F  CGGGGATCCAGAAGCAGAAGCAGAATTGA cloning SUMM4 MKK6-PstI-R AAAACTGCAGATGGTTGGGTACATACTAGC mkk2 T-DNA F CCATCAGTTCCTTTGCAGAG mkk1/2 genotyping mkk2 T-DNA R GGTGTGAGTACCGTTATGAC mekk1-1 T-DNA F GATTATTCCACGAAACACCGCG mekk1-1 genotypying mekk1-1 T-DNA R AGAAATAGCCAAATCATCAGGACC Lba1 TGGTTCACGTAGTGGGCCATCG MPK4-3 WT-F CCTCGCAAGCCCGAAATGCC mpk4-3 genotyping MPK4-3 MT-F CCTCGCAAGCCCGAAATGCT MPK4-1930F/R ACCCATCTTCTCGATTCCTC MKK6-cLuc-F CGGGGTACCATGGTGAAGATCAAATCGAAC Split Luciferase assay MKK6-cLuc-R CGCGGATCCCTCTAAGGTAGTTAACAGGTG       

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0344021/manifest

Comment

Related Items