Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of caspase-2 in the progression of Huntington disease in the YAC128 mouse Carroll, Jeffrey Bryan 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2010_fall_carroll_jeffrey.pdf [ 19.21MB ]
Metadata
JSON: 24-1.0343315.json
JSON-LD: 24-1.0343315-ld.json
RDF/XML (Pretty): 24-1.0343315-rdf.xml
RDF/JSON: 24-1.0343315-rdf.json
Turtle: 24-1.0343315-turtle.txt
N-Triples: 24-1.0343315-rdf-ntriples.txt
Original Record: 24-1.0343315-source.json
Full Text
24-1.0343315-fulltext.txt
Citation
24-1.0343315.ris

Full Text

The Role of Caspase-2 in the Progression of Huntington Disease in the YAC128 mouse by Jeffrey Bryan Carroll  B.Sc., University of British Columbia, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Neuroscience)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August, 2010  © Jeffrey Bryan Carroll, 2010  ii  Abstract Huntington Disease (HD) is a neurodegenerative disorder caused by expansion of a poly-glutamine tract in the huntingtin (htt) protein. Poly-glutamine (polyQ) expansion of huntingtin leads to inevitable onset of affective, cognitive, motor symptoms and eventual death. Loss of neurons in specific regions of the brain underlies the development of symptoms in HD, and this loss has been shown to involve activation of caspase enzymes. The genetically faithful YAC128 mouse model of HD is an excellent system for the analysis of moderators of pathology, as a large suite of affective, cognitive, motor and neuropathological measures have been validated. We have applied advanced magnetic resonance imaging (MRI) techniques to the YAC128 mouse to define the natural history of neuropathology with great precision. This precision enables the understanding that pathology in the YAC128 is spatiotemporally dynamic, and establishes a toolkit of cross-sectional pathology markers with fidelity to the human disease. Caspase-2 (casp2) is a cysteinyl protease that has been implicated in the pathology of neurodegenerative conditions including excitotoxicity, ischemia, Alzheimer’s and Huntington disease. However, no interventional in vivo evidence unequivocally links casp2 to HD pathology. Casp2-/- mice are available to study the role played by casp2 in HD pathology. Careful longitudinal characterization of phenotypes in the casp2-/mice is crucial for understanding the limitations of therapies targeting this enzyme, as well as deeper understanding the biology of casp2. We have therefore examined a number of parameters in aging mice, and discovered a large number of undocumented alterations, primarily metabolic in nature. Casp2-/- mice fail to gain fat mass due to altered basal metabolism and feeding behavior. They also have pathological alterations in the liver and hypothalamus that may underlie these changes.  iii We have used mice lacking casp2 bred to the YAC128 model of HD to investigate the role played by caspase-2 in HD pathology. Mice lacking casp2 are protected from a number of behavioral and cognitive phenotypes of HD, while the neuropathology observed is unaltered by expression of casp2. This suggests a novel role for casp2 in neuronal function.  iv  Preface Work from this thesis has resulted in abstracts and manuscripts in press and in preparation, listed in appendix C. This work is the result of a broad investigation into the caspase-2-/- and YAC128 mice, and so a traditional format was chosen to enable me to describe a wide array of experiments, without adherence to manuscript structure. I planned all the included experiments with oversight from my supervisor, Michael Hayden. I chose the statistical methods, analyzed the data and composed the abstracts, manuscripts and thesis resulting from these experiments. In some cases, work from this thesis was presented in manuscripts written by others, in collaboration with my supervisor and myself. Much of this work was conducted in close collaboration with others. Dr. Rona Graham made the initial observation of accumulation of cleaved caspase-2 in the brain, described in figure 5.2. The Gas chromatography-mass spectrometry (GC-MS) analysis of human and mouse plasma was conducted by the lab of Dr. Dieter Lütjohann (University of Bonn). The magnetic resonance imaging (MRI) and atlas creation was done by Dr. Jason Lerch at the Mouse Imaging Centre (SickKids, University of Toronto). The calorimetry measurements with the casp2-/- mice were conducted in the lab of Dr. William T. Gibson (University of British Columbia). The antisense oligonucleotide targeting caspase-2 was generated at Isis Pharmaceuticals (Carlsbad, CA), as was the antibody recognizing ASOs. Technical support was crucial for the completion of this study. The perfusions required were conduced by Dr. Nagat Bissada. Dr. Li-ping Cao assisted with MEF and neuronal cultures and excitotoxicity assays. Dr. Wei-ning Zhang assisted with conducting blinded behavioral experiments. Dr. Sonia Franciosi and Amanda Spreeuw assisted with stereological methods.  v  Table of Contents Abstract......................................................................................................................... ii Preface ......................................................................................................................... iv Table of Contents ......................................................................................................... v List of Tables ................................................................................................................ ix List of Figures ............................................................................................................... x List of Abbreviations.................................................................................................xiii Acknowledgements ................................................................................................... xv Dedication................................................................................................................. xvii 1. Introduction........................................................................................................... 1 1.1.  Huntington disease (HD)............................................................................................................................ 1  1.1.1.  Description and prevalence .............................................................................................................. 1  1.1.2.  Genetics.................................................................................................................................................. 1  1.1.3.  The huntingtin gene – genomic arrangement and conserved domains ............................... 2  1.1.4.  The htt protein – distribution and essentiality.............................................................................. 3  1.1.5.  The htt protein – biological roles ..................................................................................................... 4  1.1.6.  Neuropathology................................................................................................................................... 7  1.1.7.  Pathology – motor symptoms ........................................................................................................12  1.1.8.  Pathology – psychiatric and cognitive symptoms.....................................................................13  1.2.  Caspases .........................................................................................................................................................14  1.2.1.  Description and history ....................................................................................................................14  1.2.2.  Structural features and activation mechanisms........................................................................15  1.2.3.  Apoptotic caspase knockout mice.................................................................................................18  1.3.  Caspases in neurodegeneration............................................................................................................20  1.3.1.  Apoptosis in neurodegeneration – observational evidence ...................................................20  1.3.2.  Htt and caspases – cleavage...........................................................................................................20  vi 1.3.3.  Htt and caspases – in vitro caspase resistance...........................................................................21  1.3.4.  Htt and caspases – in vivo caspase resistance............................................................................22  1.3.5.  Tau and caspases...............................................................................................................................25  1.3.6.  APP and caspases ..............................................................................................................................25  1.3.7.  Presenilins and caspases..................................................................................................................27  1.3.8.  Other neurodegenerative disease proteins and caspases (SMBA, DRPLA, SCA2,3,7.........27  1.4.  Caspase-2.......................................................................................................................................................29  1.5.  Caspase-2 Short Form ...............................................................................................................................31  1.6.  Caspase-2 Activation .................................................................................................................................32  1.7.  Thesis Objectives.........................................................................................................................................34  1.7.1.  Specific objective 1 – To expand the phenotypic repertoire of the YAC128 mice...............34  1.7.2.  Specific objective 2 – To determine whether loss of caspase-2 causes phenotypic  alterations in mice. ...........................................................................................................................................35 1.7.3.  Specific objective 3 – To determine if loss of caspase-2 can influence the progression of  HD in the YAC128 mice. ...................................................................................................................................35  2. Materials and Methods .......................................................................................37 2.1.  Mice and breeding......................................................................................................................................37  2.2.  Pathology, including MRI .........................................................................................................................37  2.3.  Primary mouse embryonic fibroblasts and etoposide stress......................................................38  2.4.  Quantitative Real-time Quantitative PCR (QRT-PCR), caspase-2 short/long ratios .............38  2.5.  Protein isolation, western blotting and antibodies........................................................................39  2.6.  Caspase activity assays..............................................................................................................................39  2.7.  Immunohistochemistry and stereology .............................................................................................40  2.8.  Primary neuron cultures ...........................................................................................................................41  2.9.  Excitotoxicity induction ............................................................................................................................42  2.10.  Cell viability and toxicity........................................................................................................................42  2.11.  Antisense oligonucleotide transfection...........................................................................................43  2.12.  Plasma lipid assays...................................................................................................................................43  2.13.  Behavioral assays......................................................................................................................................44  2.14.  Body weight and composition ............................................................................................................46  2.15.  Indirect calorimetry .................................................................................................................................46  2.16.  Statistics.......................................................................................................................................................46  vii 3. Novel Tool Development ....................................................................................49 3.1.  MRI Techniques in a pre-clinical trial setting ....................................................................................49  3.1.1.  MRI of the YAC128 mice ...................................................................................................................50  3.1.2.  Comparison of MRI in YAC128 mice and human HD patients ...............................................68  3.1.3.  Comparison of MRI and stereological techniques.....................................................................70  3.2.  Plasma cholesterol pathology................................................................................................................73  3.2.1.  Mouse plasma ....................................................................................................................................74  3.2.2.  Human plasma...................................................................................................................................76  4. Characterization of Casp2-/- Mice......................................................................80 4.1.  Cellular phenotypes...................................................................................................................................80  4.1.1.  Verification of knockdown ..............................................................................................................80  4.1.2.  Caspase-2 (casp2) -/- and +/+ mouse embryonic fibroblasts (MEFs) – post-etoposide and  staurosporine .....................................................................................................................................................81 4.1.3. 4.2.  Caspase-2-/- and +/+ MEFs – post-etoposide caspase activation ........................................83  Physiological phenotypes........................................................................................................................86  4.2.1.  Body weight ........................................................................................................................................86  4.2.2.  Feeding phenotypes..........................................................................................................................89  4.2.3.  Longitudinal spontaneous activity ...............................................................................................91  4.3.  Pathological phenotypes .........................................................................................................................96  4.3.1.  Plasma alterations ............................................................................................................................96  4.3.2.  Hepatic phenotypes ..........................................................................................................................98  4.3.3.  Peripheral satiety signals .................................................................................................................99  4.3.4.  Central phenotypes ........................................................................................................................ 100  4.4.  Casp2 short/long ratios in development and disease................................................................ 102  4.4.1.  Casp2 short/long ratios in the developing CNS....................................................................... 102  4.4.2.  Caspase-2 short/long ratios in stressed cells............................................................................ 104  4.4.3.  Caspase-2 short/long ratios in the YAC128 mice.................................................................... 105  5. Casp2-/- x YAC128 .............................................................................................107 5.1.  Casp2 mRNA .............................................................................................................................................. 107  5.2.  Casp2 activation ....................................................................................................................................... 110  5.3.  Excitotoxicity ............................................................................................................................................. 112  5.4.  Antisense oligonucleotide treatment in primary neurons ....................................................... 115  viii 5.5.  Post-casp2 ASO excitotoxicity............................................................................................................. 120  5.6.  Behavioral phenotypes .......................................................................................................................... 121  5.6.1.  Accelerating rotorod learning ..................................................................................................... 121  5.6.2.  Longitudinal accelerating rotorod ............................................................................................. 122  5.6.3.  Cognitive tests – swimming T-maze .......................................................................................... 123  5.6.4.  Cognitive tests – pre-pulse inhibition ........................................................................................ 126  5.7.  Pathological phenotypes ...................................................................................................................... 127  5.7.1.  Plasma pathology – circulating lipids ....................................................................................... 128  5.7.2.  Tissue atrophy phenotypes – testes and forebrain weight................................................... 128  5.7.3.  Central phenotypes – EM48 nuclear translocation ................................................................ 129  5.7.4.  Central phenotypes – MRI............................................................................................................. 130  6. Discussion ..........................................................................................................137 6.1.  MRI................................................................................................................................................................. 138  6.2.  Plasma cholesterol pathology............................................................................................................. 144  6.3.  Caspase-2 knockout phenotypes....................................................................................................... 145  6.4.  Caspase-2-/- x YAC128 mouse ............................................................................................................ 148  6.5.  Future Directions...................................................................................................................................... 153  6.5.1.  MRI...................................................................................................................................................... 153  6.5.2.  Plasma cholesterol ......................................................................................................................... 153  6.5.3.  Antisense oligonucleotides........................................................................................................... 154  6.5.4.  Caspase-2 assays ............................................................................................................................ 155  6.5.5.  Caspase-2 transcripts .................................................................................................................... 158  References ................................................................................................................160 Appendix A – Structure Volumes in Aging WT and YAC128 Mice ........................192 Appendix B – Structure Volumes in Casp2-/- x YAC128 Mice ...............................201 Appendix C – List of Publications...........................................................................205 Appendix D – Ethics Certificates .............................................................................208 1.1.  THE UNIVERSITY OF BRITISH COLUMBIA ......................................................................................... 208  1.1.  THE UNIVERSITY OF BRITISH COLUMBIA ......................................................................................... 210  ix  List of Tables Table 1.1 – Major mouse models of HD...........................................................................................................22 Table 1.2 - Summary of caspase resistant “CR” lines described in (Graham et al., 2006a). ...........24 Table 1.3 – 5 of 9 Proteins whose mutation causes a poly-glutamine expansion disease are subject to caspase-mediated cleavage.................................................................................................27 Table 1.4 – Neural phenotypes in the casp2-/- mice (Bergeron et al., 1998). ....................................30 Table 3.1 - Grouping of central structures into gray, white and ventricular categories. ...............52 Table 3.2 - Diversity of neuropathological alterations in the YAC128 mice.......................................68 Table 3.3 - Comparison of YAC128 mouse and human HD patient striatal MRI results.................69  x  List of Figures Figure 1.1 - HEAT/PEST domain structure of the huntingtin protein. .................................................. 2 Figure 1.2 - Neuropathological sequelae in Huntington Disease. ........................................................... 8 Figure 1.3 – Simplified functional anatomy of the basal ganglia...........................................................12 Figure 1.4 - Mammalian caspases, reprinted from Ho and Hawkins with permission (Ho and Hawkins, 2005). ..............................................................................................................................................15 Figure 1.5 - Caspase zymogen and mature enzyme structure................................................................16 Figure 1.6 – “Initiator” vs. “effector” caspase activation. ...........................................................................17 Figure 3.1 - Longitudinal total brain volume changes with age and is reduced in the YAC128 mice....................................................................................................................................................................51 Figure 3.2 - Longitudinal changes in gray and white matter volumes in the aging brain............53 Figure 3.3 – Normalized white and gray matter proportions in the WT and YAC128 mice. ........55 Figure 3.4 - The white/gray matter ratio increases with aging and is reduced in YAC128 mice 56 Figure 3.5 – Progressive increases in the absolute and proportional ventricular volume in the YAC128 mice...................................................................................................................................................57 Figure 3.6 - The volume of the striatum is dynamic and reduced in the YAC128 mice. ...............59 Figure 3.7 - Basal changes in globus pallidus (GP) volume in the YAC128 mice ..............................61 Figure 3.8 - Transiently increased cortical volume in the frontal lobe of the YAC128 mice.........63 Figure 3.9 - Normal relative hippocampal volume in the YAC128 mice..............................................65 Figure 3.10 - Progressively increased cerebellar volume in aging YAC128 mice.............................68 Figure 3.11 - Brain weight and total brain volume, as determined by MRI, are highly correlated. .............................................................................................................................................................................70 Figure 3.12 - Direct comparison of MRI and stereology using 8-month-old YAC128 striata .......71 Figure 3.13 - Stereology confirms loss of striatal volume in YAC128 mice between 1-3 months of age.................................................................................................................................................................72 Figure 3.14 – Plasma cholesterol is progressively altered in YAC18 and YAC128 mice.................75 Figure 3.15 - Plasma cholesterol and lanosterol are reduced in the YAC128 and increased in the YAC18 mice at 12 months of age. ...........................................................................................................76 Figure 3.16 - Plasma cholesterol and lanosterol are not altered in human HD. ...............................77 Figure 3.17 - Plasma cholestanol is increased in HD...................................................................................78 Figure 3.18 - Plasma plant sterols are altered in HD ...................................................................................79  xi Figure 4.1 - Absent casp2 protein expression in casp2-/- genotyped embryos. ..............................81 Figure 4.2 - Casp2-/- MEF’s have normal toxic responses to a range of doses of staurosporine and etoposide. ...............................................................................................................................................83 Figure 4.3 – Reduced caspase activity in cells post-treatment with etoposide................................85 Figure 4.4 – Casp2-/- mice fail to gain weight during aging....................................................................87 Figure 4.5 – Male casp2-/- mice have decreased body fat to lean mass ratios, relative to caspase-2+/+ littermates ...........................................................................................................................88 Figure 4.6 – Casp2-/- mice eat less food than casp2+/+ littermates.....................................................90 Figure 4.7 – Reduced dark-cycle RER validates feeding behavior changes in the casp2-/- mice.. .............................................................................................................................................................................91 Figure 4.8 - Progressively increased spontaneous activity in the casp2-/- mice. ............................92 Figure 4.9 – Long-term total activity is normal in casp2-/- mice............................................................94 Figure 4.10 - Energy expenditure per gram of lean mass is significantly reduced in the casp2-/mice....................................................................................................................................................................95 Figure 4.11 – Reduced resting energy expenditure in the casp2-/- mice. ..........................................96 Figure 4.12 - Progressive plasma cholesterol reductions in the casp2-/- mice.................................97 Figure 4.13 –Casp2-/- mice have progressively increased hepatic nuclear area..............................99 Figure 4.14 – Peripheral satiety signals are normal in casp2-/- mice................................................. 100 Figure 4.15 – Casp2-/- mice have reduced hypothalamic volume and hypothalamic neuronal counts............................................................................................................................................................. 101 Figure 4.16 - Casp2 S/L specific primers....................................................................................................... 102 Figure 4.17 - Casp2S/L ratios in vitro and in vivo ...................................................................................... 103 Figure 4.18 – The casp2S/L ratio is dynamic in the aging striatum, with a peak of casp2S expression between 4-12 weeks of age............................................................................................. 104 Figure 4.19 – The casp2S/L ratio is reduced in YAC128 striatal neurons and is responsive to NMDA stress................................................................................................................................................. 105 Figure 4.20 - Casp2S/L ratio in the striatum of aging WT and YAC128 mice. ................................. 106 Figure 5.1 - Casp2 mRNA levels in YAC128 mice and human HD patients...................................... 109 Figure 5.2 – Increased accumulation of cleaved, active, casp2 in the striatum of aging mice. 111 Figure 5.3 - Casp2-/- Medium spiny neurons are protected from NMDA-induced excitotoxicity. .......................................................................................................................................................................... 113 Figure 5.4 – Cleavage αII-Spectrin of during excitotoxicity is reduced in casp2-/- mice............ 114  xii Figure 5.5 - Exogenous casp2 cleaves αII-Spectrin but produces a larger band than NMDA treatment of neurons ............................................................................................................................... 115 Figure 5.6 – Mouse casp2 ASO development, courtesy of Isis Pharmaceuticals. .......................... 117 Figure 5.7 – Treatment of primary medium spiny neurons with anti-casp2 ASO results in significant reductions in casp2 levels ................................................................................................. 118 Figure 5.8 - Immunological localization of casp2 ASOs in medium spiny neurons (MSNs) in culture ............................................................................................................................................................ 119 Figure 5.9 - Casp2 Antisense Oligonucleotides (ASOs) protect striatal neurons from excitotoxicity ............................................................................................................................................... 120 Figure 5.10 - Casp2-/-;YAC128 mice are protected from learning deficits on the rotorod task. .......................................................................................................................................................................... 122 Figure 5.11 - Casp2-/-;YAC128 mice are protected from deficits on the accelerating rotorod task. ................................................................................................................................................................. 123 Figure 5.12 - Casp2-/-;YAC128 mice are protected from deficits during the reversal phase of the swimming t-maze. ..................................................................................................................................... 124 Figure 5.13 - Casp2-/-;YAC128 mice commit less arm re-entry errors than YAC128 mice......... 125 Figure 5.14 - Baseline startle response does not differ in casp2-/-, YAC128 or casp2-/-;YAC128 mice................................................................................................................................................................. 126 Figure 5.15 - Casp2-/-;YAC128 mice are protected from pre-pulse inhibition defects ............... 127 Figure 5.16 – Reduced circulating cholesterol and phospholipids in the casp2-/- and YAC128 mice................................................................................................................................................................. 128 Figure 5.17 – Forebrain and testicular atrophy is not rescued in casp2-/-;YAC128 mice........... 129 Figure 5.18 - Normal accumulation of nuclear EM48 immunoreactivity in the casp2-/-;YAC128 mice................................................................................................................................................................. 130 Figure 5.19 - Global patterns of pathology are basally worsened in the casp2-/- mice ............. 132 Figure 5.20 – YAC128 mice have alterations in specific structure volumes, as a % of total brain volume, which are not rescued by ablation of casp2. .................................................................. 135 Figure 6.1 - Neural circuitry in the hypothalamus regulating food intake. ..................................... 147 Figure 6.2 - Example of huntingtin silencing in primary neurons in vitro by anti-huntingtin ASOs................................................................................................................................................................ 155 Figure 6.3 - Cartoon of combinatorial capture of active caspases...................................................... 157 Figure 6.4 - Pilot demonstration of combinatorial caspase ELISA detection.................................. 158  xiii  List of Abbreviations 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoAR) AD (Alzheimer’s Disease) Adenosine-5'-triphosphate (ATP) Antisense Oligonucleotides (ASOs) ALS (Amyotrophic lateral sclerosis) Analysis of variance (ANOVA) APP (Amyloid precursor protein) BDNF (Brain derived neurotrophic factor) CAG (Cytosine, Adenine, and Guanine) CARD (Caspase recruitment domain) Caspase-2 (casp2) Caspase-6 (casp6) Caspase-6 Resistant (C6R) Central Nervous System (CNS) DED (Death effector domain) DNA (Deoxynucleic acid) DRPLA (dentatorubral-pallidoluysian atrophy) DTI (Diffusion tensor imaging) fMRI (Functional magnetic resonance imaging) GABA (γ-Aminobutyric acid)  xiv HD (Huntington Disease) HEAT (Huntingtin, elongation factor 3 (EF3), protein phosphatase 2A (PP2A)) Linear mixed effects (LME) MEF (Mouse embryonic fibroblast) MRI (Magnetic resonance imaging) mRNA (Messenger ribonucleic acid) MSNs (Medium spiny neurons) PEST (Proline, glutamate, serine, threonine) PET (Positron emission tomography) PolyQ (poly-glutamine) QRTPCR (Quantitative real time polymerase chain reaction) SBMA (Spinal Bulbar Muscular Atrophy) SCA (Spinocerebellar ataxia) TUNEL (Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling) Yeast Artificial Chromosome 128 (YAC128)  xv  Acknowledgements This work, and much else, exists because Michael Hayden had the vision and courage to allow an HD-affected researcher work in his lab. Were it not for his original acceptance, and unflinching support in the time since, I would not be working in science and would never have completed this thesis. I have had excellent and sympathetic advice from a number of people during the course of my PhD. For this, I would like to thank the members of my supervisory committee – Weihong Song, Wolfram Tetzlaff and Cheryl Wellington. The presence of Alaa el-Husseini as a committee member and mentor is sorely missed. A number of other scientists have, at key times, helped me with much needed advice. I’d like to thank Lynn Raymond, Peter Reiner and in particular Allan Tobin for helping keep me focused on completing this thesis. The members of the Hayden lab are an inspiring group of people, in many and diverse ways. Over the course of my PhD, I have probably learned the most from many hours of discussion with Rona Graham, Mahmoud Pouladi, Dagmar Ehrnhoefer, Roshni Singaraja, Simon Warby and other members of the Hayden lab. These conversations were sometimes heated, sometimes perplexing but always thought provoking, and I value them immensely. This work would have been impossible without the tireless technical support provided by Daisy Cao, Nagat Bissada, Wei-ning Zhang, Rachelle Dar Santos and Lisa Bertram. I have also had the great fortune to work with collaborators whose passion for their work has enabled mine to grow beyond its original scope. Jason Lerch and Mark Henkelman of the Mouse Imaging centre have been responsive, helpful and very productive scientific collaborators. It has also been a great pleasure to work with Marta Valenza and Elena Cattaneo of the University of Milan in an attempt to understand the role played by cholesterol in HD pathogenesis.  xvi Last, but certainly not least, I would like to thank my family. My wife, Megan, has made immense sacrifices so I could complete this work. Her flexibility and understanding made this work possible, I never could have done it without her. My brother and sisters are my foundation, and their support thorough this interesting time has meant the world to me. Finally, my babies Billie Frances and Elijah Louis remind me every day why I’m working, and what really matters.  xvii  Dedication  In loving memory of my mother Cindy Carroll and my Grandad Louis Carroll  1  1. Introduction 1.1. Huntington disease (HD) 1.1.1. Description and prevalence Huntington Disease is a hereditary neurodegenerative disorder affecting between 0.110/10,000 individuals worldwide (Harper, 1992). Since being succinctly described by George Huntington in 1872 (Huntington, 1872), much progress has been made towards understanding the etiology and pathology of HD. In the nearly 140 years since it’s formal description, however, there has been no improvement in the prognosis of HD; given sufficient lifespan every individual born with a HD mutation will die of the disease. 1.1.2. Genetics The mutation underlying HD was described to be an expansion in a cytosine-adenineguanine (CAG)-tract in the HTT gene in 1993 (Group, 1993). The CAG-tract in HTT codes for a series of glutamines near the N-terminus of the huntingtin (htt) protein and CAG repeats ≥ 36 cause HD (Kremer et al., 1994b; Langbehn et al., 2004). The median CAG repeat length is 18 in non-disease alleles and 44 in expanded alleles (Kremer et al., 1994a). There is a strong inverse correlation between mean CAG repeat length and the age at which patients begin to show clinically identifiable symptoms (Andrew et al., 1993). Expanded HTT alleles are generationally unstable, demonstrating a propensity to expand, particularly upon paternal transmission (Bird et al., 1974; Group, 1993; Myers et al., 1982; Ranen et al., 1995). This instability leads to the phenomenon known as ‘anticipation’, in which subsequent generations of HD patients tend to have earlier ages of onset than their predecessors. HD, along with 8 other conditions, is referred to as a “poly-glutamine (polyQ)” disease to distinguish its causal coding CAG-expansion mutation. PolyQ diseases are part of a  2 larger family of human diseases caused by expansion of repetitive elements in the human genome (Gatchel and Zoghbi, 2005). Although the causal mutation in each polyQ disease is the same, their presentation, symptoms and pathology are unique. How a single type of mutation leads to tissue specific pathology is an important, unanswered, question in polyQ disease biology. 1.1.3. The huntingtin gene – genomic arrangement and conserved domains The HTT gene is large, comprising 67 exons across 180 kilobases of genomic DNA (Ambrose et al., 1994). Two transcripts have been identified (Ambrose et al., 1994; Lin et al., 1993), differing in the length of their poly-adenosine tail. Expression of the transcript per se is insufficient to cause pathology (Goldberg et al., 1996a), in contrast to other repeat diseases, such as myotonic dystrophy type I (Mahadevan et al., 1992), in which RNA is the toxic gene product. Upon determination, the primary sequence of the HTT gene yielded very little functional insight due to its lack of homology with any known gene (Group, 1993). Despite its large size, the only recognizable amino acid motifs in the HTT coding sequence were the glutamine tract, followed by a polyproline tract near the 5’ end of the gene.  Figure 1.1 - HEAT/PEST domain structure of the huntingtin protein. Adapted from (Warby et al., 2008) with permission. Human htt is 3144 amino acids long, and contains a number of blocks of repeated degenerate HEAT motifs. Several proteolytic susceptibility (PEST) domains are also found in the htt sequence, suggesting a role for proteolysis in htt processing.  In 1995 Andrade and Bork (Andrade and Bork, 1995) defined a repeated structural motif of 37-43 amino acids present in huntingtin which they termed “HEAT” (huntingtin, elongation factor 3, the regulatory A subunit of protein phophatase 2A,  3 TOR1) repeats. They speculated that these repeats may mediate protein-protein interactions. Further experimental and bioinformatic work (Li et al., 2006; Palidwor et al., 2009; Seong et al., 2009; Takano and Gusella, 2002) has verified that htt is largely comprised of HEAT repeats and that these HEAT repeats are interspersed with proteolytic susceptibility (PEST) domains (Warby et al., 2008). PEST sequences are rich in the four amino acids from which they derive their name (proline, glutamic acid, serine and threonine) and have been shown to regulate protein half-life via proteolytic processing (Rogers et al., 1986). 1.1.4. The htt protein – distribution and essentiality Htt expression is fairly ubiquitous across tissue types, with highest levels found in the testes and brain (Trottier et al., 1995). In the brain, htt expression is predominantly cytoplasmic and highest in neurons (Bhide et al., 1996; Difiglia et al., 1995; Persichetti et al., 1995; Sharp et al., 1995). Brain htt is preferentially associated with vesicles (Difiglia et al., 1995) and neurites (Trottier et al., 1995), suggesting a potential role for htt in vesicular trafficking. No obvious association exists between htt expression levels and pathology, at the tissue or cellular level. Mice nullizygous for the mouse HTT gene homologue hdh (hdh-/-) die early in embryogenesis (Duyao et al., 1995; Nasir et al., 1995; Zeitlin et al., 1995). The fact that hdh-/- mice do not recapitulate features of HD (i.e. progressive neuropathology) supports the idea that a toxic gain of function(s) of mutant htt leads to disease, rather than a loss of function(s). While htt has crucial roles in embryonic development, neural differentiation and maturation in hdh-/- embryonic stem cells is normal (Metzler et al., 1999). However, adult inactivation of hdh in the brain and testes leads to progressive loss of cells in these tissues (Dragatsis et al., 2000). Thus, htt possess functions required for maintenance of cellular viability in the brain and testes in the adult animal. While a complete loss of function role for htt in HD pathogenesis is unlikely, based on developmental phenotypes, partial loss of support roles could contribute to HD (Cattaneo et al., 2005).  4 Mouse models expressing full-length, CAG-expanded, HTT or hdh crossed to hdh-/mice allow the analysis of the ability of polyQ-expanded htt to rescue lethal knockout phenotypes. “Knock-in” mice expressing normal levels of murine hdh with a chimeric human 150 CAG repeat expansion do not display the loss of viability observed in the hdh-/- mice (White et al., 1997). Transgenic expression of mutant forms of human HTT containing 46, 72 (Hodgson et al., 1999) or 128 CAG repeats (Van Raamsdonk et al., 2005c) are also capable of rescuing embryonic lethality in the hdh-/- mice. These mice demonstrate that CAG-expanded htt is capable of fulfilling its normal roles during development. More recent work has demonstrated that loss of murine htt does subtly exacerbate some HD phenotypes in model mice, supporting a contribution of loss of function phenotypes to HD (Leavitt et al., 2001; Van Raamsdonk et al., 2005c). Integration of this evidence suggests that HD is caused by a toxic gain of function of the polyQ-expanded htt protein, most likely aggravated by a concomitant loss of wild type htt function in the brain and tests. 1.1.5. The htt protein – biological roles The large size and novelty of the HD sequence has made identifying its cellular functions complex. Since 1993, a large body of evidence from animal and cellular models has emerged regarding the normal biological role of the htt protein. Interacting partner studies have also been conducted, in an attempt to understand the function of htt by analysis of associated proteins (Harjes and Wanker, 2003; Li and Li, 2004). Many of the proposed functions for htt and its interactors cluster together in categories, particularly transcription, trafficking and endocytosis, synaptic function and cell death. 1.1.5.1.  Transcription  A number of mRNA transcripts studied with in situ hybridization in post-mortem human HD brains show altered expression. These transcripts include crucial neuropeptide (e.g. enkephalin and substance P (Augood et al., 1996)) and neurotransmitter receptor (e.g. dopamine 1 and 2 (Augood et al., 1997)) genes. The development of mouse models of HD, in conjunction with microarray technology,  5 allowed more comprehensive analysis of transcriptional changes. Studies have described significant alterations of transcript levels in cell (Sipione et al., 2002; Wyttenbach et al., 2001) and mouse models of HD (Chan et al., 2002; Kuhn et al., 2007; Luthi-Carter et al., 2000), as well as patient material (Borovecki et al., 2005; Hodges et al., 2006). The initial description of the htt protein included the observation that proteins with poly-glutamine and –proline tracts commonly bind DNA directly (Group, 1993). Htt was subsequently shown to directly bind DNA and modulate transcription, a function which is altered upon CAG expansion (Benn et al., 2008). In addition to this direct effect, htt binds a number of proteins involved in transcriptional regulation including p53 (Steffan et al., 2000), CBP (Nucifora et al., 2001; Steffan et al., 2000), Sp1(Dunah et al., 2002), TAFII130 (Dunah et al., 2002), SREBP1 (Valenza et al., 2005), REST/NRSF (Zuccato et al., 2003), NF-kB (Takano and Gusella, 2002) and the polycomb repressive complex 2 (Seong et al., 2009). Many of the htt/transcription-factor binding interactions are altered in the face of CAG expansion, suggesting that altered transcription as a consequence of polyQ expansion may underlie HD pathology. 1.1.5.2.  Endocytosis and trafficking  Htt associates with vesicular structures in vitro and in vivo (Difiglia et al., 1995; Gutekunst et al., 1995; Sharp et al., 1995). Htt is also actively transported along with vesicular structures (Block-Galarza et al., 1997), and forms a complex with binding partners HAP1, p150Glued and dynactin which mediates vesicular transport along microtubules (Gauthier et al., 2004). Interruption of this complex by CAG-expansion results in impaired trafficking of brain derived neurotrophic factor (BDNF) containing vesicles (Gauthier et al., 2004). BDNF levels in affected tissues from HD patients and mice are decreased (Zuccato et al., 2001), and elimination of BDNF transcription in the forebrain causes mouse phenotypes which closely mimic HD pathology (Baquet et al., 2004; Strand et al., 2007), suggesting that improper BDNF vesicle trafficking may contribute to the pathogenesis of HD. However, human genetic data suggests that a BDNF variant with known functional effects does not affect the age of onset of HD,  6 countering the centrality of BDNF support to the development of HD pathogenesis (Di Maria et al., 2006; Kishikawa et al., 2006). PolyQ-expansion in htt has also been proposed to generally interfere with fast axonal transport in recombinant (Szebenyi et al., 2003) and Drosophila (Gunawardena et al., 2003; Lee et al., 2004) model systems. Whether mutant htt’s interference with vesicular transport is specific to BDNFcontaining vesicles or more broadly affecting fast axonal transport is an open and active area of research. 1.1.5.3.  Apoptosis  Apoptosis is a regulated form of developmental and pathologic cell death, involving specific morphological, biochemical and molecular processes that leads to orderly clearance of unwanted or damaged cells. During regulated cell death, genomic DNA is cleaved into oligonucleosomal-sized pieces (Wyllie, 1980) and this cleavage can be detected to stain apoptotic cells. The most widely used labeling method is terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining (Gavrieli et al., 1992). This technique was used to establish that TUNEL+, putatively apoptotic, neurons are present in the brain of deceased HD patients (Dragunow et al., 1995; Portera-Cailliau et al., 1995; Thomas et al., 1995). In addition to this HD patient data, the developing ectoderm of hdh-/- mice displays increased apoptosis, relative to wild type mice (Zeitlin et al., 1995). Furthermore, adult inactivation of hdh in the brain leads to apoptotic cell death in the striatum and cortex, suggesting that wild type htt plays a role in the regulation of cell death pathways (Dragatsis et al., 2000). Primary peripheral cells from HD patients display a reduced apoptotic threshold (Sawa et al., 1999), suggesting that mutant htt may positively regulate apoptosis in multiple cell types. Stable clonal cell culture systems and transgenic mouse models have validated the idea that wild type htt protects neurons from apoptosis, while mutant htt induces it (Leavitt et al., 2006; Rigamonti et al., 2000; Rigamonti et al., 2001; Zhang et al., 2006). The simplest model implied by this biphasic relationship is that a normal function of wild type htt is to inhibit apoptosis, and this function is compromised in the face of CAG expansion.  7 Countering this loss of function model of htt regulation of apoptosis, exogenous expression of long (79), but not short (35) pure poly-glutamine fragments causes apoptosis by recruitment and activation of caspase-8 (Sánchez et al., 1999). Caspase-8 is also activated by a protein known as hippi, whose binding to caspase-8 is sensitive to the polyQ length of htt expressed in trans. PolyQ-expansion of htt results in increased levels of free hippi, which is consequently available to bind and activate caspase-8, thus lowering the apoptotic threshold (Gervais et al., 2002). These activities of expanded polyQ are consistent with a toxic gain of function, rather than a loss of function, mechanism of apoptotic regulation in HD. 1.1.6. Neuropathology 1.1.6.1.  Description  The most profoundly affected tissue in HD is the striatum, the input module of the basal ganglia, which is comprised of the caudate nucleus and the putamen. In a classic study from 1985 JP Vonsattel and colleagues used the extent of striatal degeneration in 163 HD patient brains to establish a grading scale for HD pathology (Vonsattel et al., 1985). This scale extends from ‘0’, where no neuronal loss is observed, to ‘4’, where neurons of the striatum are virtually absent (Figure 1.2). The gradient of pathology suggested by this cross-sectional histochemical analysis is medial-dorsal-rostral to lateral-ventral-caudal (Vonsattel et al., 1985)(Figure 1.2). This anatomical gradient is layered onto a neurochemical gradient, as the loss of neurons is not homogenous throughout the striatum, with relative sparing of interneurons (Ferrante et al., 1985). This inhomogeneity suggests that some neurochemical or neuroanatomical  8 susceptibility, specific to striatal projection neurons, may underlie their loss in HD.  Figure 1.2 - Neuropathological sequelae in Huntington Disease. Top left – diagram of the paired human striatum, which includes the caudate and the putamen. Top right – gradient of human striatal neuropathology according to Vonsattel et al. (Vonsattel et al., 1985) where dark indicates early pathology and light indicates later pathology. Bottom – summary of striatal pathology in HD. Loss of striatal volume, as detected by magnetic resonance imaging (MRI), precedes clinical diagnosis and overt neuroanatomical alterations and occurs during the “pre-symptomatic” phase of HD. Disease progression is associated with increasingly severe basal ganglia atrophy.  Alterations of all major classes of glial cells are also a feature of HD. Progressive reactive astrocytosis precedes overt neuronal loss in the basal ganglia and cortex of HD patients (Borthwick et al., 1985; Selkoe et al., 1982; Stevens et al., 1988; Tellez-Nagel et al., 1974; Vonsattel et al., 1985). Reactive gliosis has also been observed in affected tissues of full-length mouse models of HD (Lin et al., 2001a; Reddy et al., 1998). Microglial activation has been observed both histochemically (Sapp et al., 2001; Singhrao et al., 1999), as well as with radioactive positron emission tomography (PET)  9 ligands in pre-symptomatic HD mutation carriers (Tai et al., 2007). The density of oligodendrocytes in the striatum of HD patients (Myers et al., 1991) and asymptomatic HD mutation carriers (Gómez-Tortosa et al., 2001) is higher than control subjects, a phenotype that is non-progressive and proposed to be developmental in etiology. What emerges is the view that microglia and astrocytes proliferate and activate during the course of HD, while oligodendrocytes are basally increased. 1.1.6.2.  Neuropathology – magnetic resonance imaging  Histological signs of striatal neuronal loss in HD begin after symptom onset (Vonsattel et al., 1985), but early magnetic resonance imaging (MRI) studies suggested that loss of caudate and putamen volume occurs early in the disease (Aylward et al., 1997; Bäckman et al., 1997; Harris et al., 1992; Lukes et al., 1983; Simmons et al., 1986). The etiology of the discrepancy between volume loss measured by MRI and neuronal loss measured by histological methods is as yet unclear. While striatal atrophy is early and pronounced in HD, other regions of the brain are clearly affected. Widespread loss of cortical volume has long been observed in postmortem HD patient brains (Dunlap, 1927). This atrophy has been observed in living patients with MRI (Bäckman et al., 1997; Rosas et al., 2003), which some authors have argued is not specific but a reflection of overall brain atrophy (Aylward et al., 1998). Arguing against the general atrophy hypothesis is the fact that cerebral volume loss occurs while cerebellar loss does not – leading to significantly altered cerebral/cerebellar ratios in HD patient brains (Dunlap, 1927; Rosas et al., 2003). Postimaging processing techniques allowing the measurement of regional cortical thickness clearly demonstrate that cortical atrophy is specific in HD (Rosas et al., 2002; Rosas et al., 2008). This atrophy is most pronounced in the sensorimotor cortex, and appears to progress with disease severity. Outside of the striatum, cortex and cerebellum, widespread volume loss has been described in many central tissues in HD using MRI (Rosas et al., 2003).  10 Cerebral atrophy in HD is not homogenous - preferential loss of white matter in the cerebrum HD was noted as early as 1927 (Dunlap, 1927). More recent segmentation of MRI-derived cerebral volumes into gray and white matter compartments confirms that white matter loss is more severe than gray in HD (Jernigan et al., 1991; Rosas et al., 2003), and that white matter degeneration rates are faster in HD than control brains (Hobbs et al., 2009a). No conclusive data exists to explain the preferential loss of white matter in HD, though axonal degeneration of projection neurons expressing mutant htt has been proposed to underlie neuritic retraction in HD mice (Li et al., 2001). Identification of pre-symptomatic mutation carriers after the discovery of the HTT gene in 1993 allowed investigations of neuroanatomy before the onset of motor symptoms. Cross-sectional analyses show that striatal volume reduction, as determined by MRI, precedes clinical onset by as much as 15 years (Aylward et al., 2004; Paulsen et al., 2008; van Oostrom et al., 2005). Longitudinal MRI of mutation carriers demonstrates progressive ventricular enlargement and caudate atrophy (Hobbs et al., 2010); the rate of which increases with disease burden (Hobbs et al., 2009b). Less restricted global analysis of brain volume changes using voxel based morphometry reveals regionally selective, escalating atrophy in both gray and white matter in HD mutation carriers (Hobbs et al., 2009a). Imaging based parameters are not intrinsically useful. They become meaningful only insomuch as they represent disease-related phenotypes of interest. Statistical analyses suggest that gross cerebral and striatal volumes are accurate predictors of cognitive performance in HD patients (Bäckman et al., 1997). Progressive cortical thickness changes in HD correlate with a number of relevant neuropsychiatric parameters, and variation in these changes is strongly correlated with the diversity of clinical presentations of HD (Rosas et al., 2008). These data suggest that imaging based biomarkers in humans are predictive of disease relevant behaviors. While the majority of brain volume changes observed in human HD are atrophic in nature, several transient increases in frontal gray matter volumes have been described.  11 Aylward et al (Aylward et al., 1998) observed a 5% increase in frontal gray matter in “mildly” affected HD patients, while a 10% loss as was observed in those “moderately” affected by symptoms. These changes did not reach statistical significance. Using a larger sample size and pre-symptomatic HD mutation carriers, Paulsen et al. (Paulsen et al., 2006) detected a significant 8% increase in cortical gray matter volume and a 7% decrease in cortical white matter. These cross-sectional analyses suggest that cortical gray matter in HD mutation carriers is transiently increased in volume, followed by eventual decrease. These dynamic fluctuations could be either pathological or developmental in etiology, necessitating studies in very young mutation carriers. Despite the lack of complete knowledge about the origins of MRI-detected brain atrophy, significant efforts exist to use them as a biomarker in HD drug trials (Aylward, 2007; Hobbs et al., 2009b; Hobbs et al., 2009c; Hobbs et al., 2010). 1.1.6.3.  Basal ganglia function  The basal ganglia are a group of subcortical structures, which have been traditionally conceived as controlling movement via two opposing/parallel pathways beginning in the striatum (Albin et al., 1989). The cellular composition of the striatum is relatively homogenous, with the large majority of cells being GABAergic projection “medium spiny neurons” (MSNs) (DiFiglia et al., 1976; Kemp and Powell, 1971). However, the net effect of activity in these networks is determined by whether so-called “direct” or “indirect” MSNs are activated (Figure 1.3). Direct pathway activation has a net excitatory effect in target areas via enhanced GABAergic drive to the internal segment of the globus pallidus, while indirect pathway activation has a net inhibitory effect due to the relaying of signals through the (GABAergic) neurons of the external segment of the globus pallidus (Albin et al., 1989).  12  Figure 1.3 – Simplified functional anatomy of the basal ganglia. The striatum receives focused glutamatergic input from the cortex and thalamus, and supplies GABAergic drive to either the internal or external segment of the globus pallidus (GP). The functional consequence of basal ganglia activation is dependent on which of the two segments of the globus pallidus is stimulated by striatal neurons.  An expanded version of the “direct/indirect” pathway model, known as the “focused attention model” has taken into account the likely simultaneous activation of direct and indirect pathway neurons (Mink, 1996). In this model, undesired cortical patterns are inhibited and desired patterns disinhibited via basal ganglia processing. The basal ganglia thus act to focus, refine and tune corticothalamic activity to external cues. 1.1.7. Pathology – motor symptoms The condition we now call Huntington Disease was referred to by George Huntington as “chorea”, from the Latin word meaning “dance” (Huntington, 1872). These jerky, dance-like movements remain the most diagnostic clinical feature of HD (1993). Other pathological hyperkinetic symptoms also occur in HD, including dystonia (Louis et al., 1999), myoclonus (Vogel et al., 1991) and tics (Becker et al., 2007).  13 In the described models of basal ganglia function, preferential loss of indirect pathway neurons would results in an altered balance of inhibitory/excitatory drive to target structures, with a net excitatory effect (Figure 1.3). In the early stages of HD, during which hyperkinetic movements are the most prominent motor feature, a preferential loss of indirect pathway neurons has been described (Deng et al., 2004; Reiner et al., 1988). As the disease progresses both direct and indirect pathway neurons are lost (Deng et al., 2004), which is consistent with the symptomatic transition to bradykinesia and rigidity late in the disease, potentially due to failure of the behavior-initiating direct pathway (Penney et al., 1990; Storey and Beal, 1993). 1.1.8. Pathology – psychiatric and cognitive symptoms While chorea is the most externally obvious feature of HD, cognitive and affective symptoms are a major source of disability in the disease. HD patients display “hyperactive” psychiatric features including agitation, irritability and anxiety (Litvan et al., 1998). These neuropsychiatric features are nearly universal, with 98% of HD patients exhibiting signs of one or more symptom (Paulsen et al., 2001). Interestingly, in patients with overt HD these neuropsychiatric features are not correlated with dementia or chorea, suggesting dissociation between psychiatric and motor aspects of the disease (Paulsen et al., 2001). Pre-symptomatic mutation carriers also report significantly higher rates of psychiatric symptoms, even as much as 10 years from estimated symptom onset (Duff et al., 2007). Animal models of HD have also been shown to show symptoms of anxiety and depressive phenotypes (Menalled et al., 2009; Pouladi et al., 2009; Southwell et al., 2009). Cognitively, HD patients have impaired memory (Butters et al., 1978; Caine et al., 1977) and progressive impairment in cognitive set shift-shifting tasks requiring intra- (Lange et al., 1995) and extra-dimensional shifts (Lawrence et al., 1996). Semantic fluency is impaired in HD patients (Randolph et al., 1993) as well as presymptomatic mutation carriers (Lawrence et al., 1998), suggesting cognitive defects precede overt motor onset. Mouse models of HD have again been shown to replicate this pathology, with described deficits in spatial learning (Murphy et al., 2000) motor learning (Trueman et  14 al., 2007; Van Raamsdonk et al., 2005e), cognitive set shifting (Brooks et al., 2006) and the demonstration of clear perseverative behaviors (Trueman et al., 2009; Van Raamsdonk et al., 2005e).  1.2. Caspases 1.2.1. Description and history Caspases are a family of cysteine proteases that cleave c-terminally to an obligate aspartate residue (“C-Asp”) (Alnemri et al., 1996). The prototypical family member is CED3, a Caenorhabditis elegans protein described by Robert Horvitz and colleagues as a crucial mediator of genetically programmed developmental cell death (“apoptosis”) in 1993 (Yuan et al., 1993). CED3 is highly homologous to mammalian interleukin-1ß converting enzyme (ICE), a cysteine protease responsible for maturation of the cytokine IL-1ß cloned and described in 1992 (Cerretti et al., 1992; Thornberry et al., 1992). This homology suggested that despite their divergent functional roles, CED3 and ICE’s proteolytic activities are crucial to their functions in cell death and innate immunity, respectively. 14 Mammalian caspase enzymes have been described since 1992. These enzymes play key roles in inflammation and cell death (Birge and Ucker, 2008; Kumar, 2007). Conceptually, caspases can be grouped on one of several axes, including their putative inflammatory or apoptotic role and the length and composition of their “pro-domain” (Figure 1.4). Although most work on caspases has focused on these two classes of function, emerging evidence suggests normal, physiological, roles for caspase activity outside of pathological contexts (Galluzzi et al., 2008).  15  Figure 1.4 - Mammalian caspases, reprinted from Ho and Hawkins with permission (Ho and Hawkins, 2005). Cloned mammalian caspases are classified as regulating inflammation or apoptosis. Apoptotic caspases are further subdivided based on the length of their pro-domain sequence (short/long). Long pro-domain apoptotic caspases are additionally classified by the domain composition of their pro-domain (CARD-domain containing or DEDdomain containing – see section 1.2.2).  1.2.2. Structural features and activation mechanisms By definition (Alnemri et al., 1996), caspases are synthesized as inactive zymogens consisting of a large and small subunit, preceded by an N-terminal pro-domain and interspersed with a small linker region (Figure 1.5). The N-terminal pro-domains are classified as “long” or “short” based on size and the inclusion of either a “caspase recruitment” (CARD) (Bouchier-Hayes and Martin, 2002) or “death effector domain” (DED) motif (Valmiki and Ramos, 2009). Long pro-domain containing caspases exist in solution as monomers (Ayala et al., 1994; Baliga et al., 2004; Boatright et al., 2003), whereas short pro-domain containing caspases are inactive dimers in solution (Boatright et al., 2003; Kang et al., 2002).  16  Figure 1.5 - Caspase zymogen and mature enzyme structure. Caspase zymogens are either monomers or homo-dimers of single chain peptides composed of a pro-domain, long (~20kD, “p20”) and short (~10kD, “p10”) domains. Upon maturation inter-subunit cleavage events result in mature forms comprised of 2 long and 2 short subunits.  Crystal structures of activated caspases-1 (Walker et al., 1994; Wilson et al., 1994) -3 (Rotonda et al., 1996) and -7 (Wei et al., 2000), indicate that the active species is comprised of two heterodimers each consisting of one large and one small subunit. The inter-subunit cleavage associated with activation causes dramatic changes in the active site of the enzyme (Chai et al., 2001), suggesting that the removal of the prodomain and cleavage of the caspase enzyme itself is required for activation of the enzymatic activity. Crystal structures of caspases-1 (Romanowski et al., 2004), -6 (Baumgartner et al., 2009) and -7 (Chai et al., 2001) demonstrate the existence of a latent, inactive, caspase conformation. Small molecules have been described that stabilize this latent conformation, resulting in enzymatic inhibition (Hardy et al., 2004; Scheer et al., 2006). Apoptotic caspases with short prodomains (-3, -6 and -7) are substrates for apoptotic caspases with long prodomains (e.g. -9) (Kuida et al., 1998; Li et al., 1997b; Slee et al., 1999). This suggests a two-step model of caspase activation in which long prodomain  17 (“initiator”) caspases are activated by apical signals and subsequently cleave and activate short prodomain (“executioner”) caspases. In agreement with this hypothesis, executioner caspases are responsible for the bulk of active proteolysis in apoptotic cells (Faleiro et al., 1997), while initiator caspase substrates are comparatively uncommon. This model requires, however, initial cleavage of the initiator caspase to begin the chain of amplification. Hints to the solution of this puzzle came in 1999, when it was shown that caspase-9, a long pro-domain apoptotic caspase, could be activated without proteolytic processing (Stennicke et al., 1999). Biochemical analyses subsequently demonstrated that initiator caspases-8 and -9 exist in solution as monomers, and achieve catalytic maturity upon dimerization, induced on “death adapter” scaffolds, whereas executioner caspases are dimers in solution that are activated by proteolytic processing (Boatright et al., 2003). More recent work has extended these findings to other long pro-domain caspases, including caspase-2 (Baliga et al., 2004; BouchierHayes et al., 2009) and caspase-12 (Yoneda et al., 2001).  Figure 1.6 – “Initiator” vs. “effector” caspase activation. Initiator caspases are latent monomers in solution, whose induced proximity on death-adapter scaffolds results in conformational changes leading to enzymatic  18 competence. Effector caspases exist as latent dimers in solution, and require inter-subunit cleavage, including removal of the prodomain, to undergo structural changes required for activation.  The dimerization of initiator caspases poses a puzzle to the cell – if the cytoplasmic concentration of monomer is sufficient for spontaneous dimerization, the cell risks unintentional initiation of apoptosis. However, if the concentration is too low, some active mechanism must be required to create a localized concentration sufficient to induce dimerization and activate apical caspases. Pioneering work by Xiaodong Wang and colleagues (Li et al., 1997b) demonstrated that in the case of caspase-9, a complex formed by Apaf-1, cytochrome-C and caspase-9 leads to its activation. This activation required proximity of caspase-9 monomers, but not cleavage. This activating complex became known as the “apoptosome”. Structural data later supplied direct evidence for the role played by dimerization in caspase-9 activation (Acehan et al., 2002; Yu et al., 2005). Analogous activating complexes, all relying on CARD or DED domain interactions between long-prodomain caspases and death adapter proteins, have been described for caspases-1 (Martinon et al., 2002), -2 (Tinel and Tschopp, 2004) and -8 (Medema et al., 1997). 1.2.3. Apoptotic caspase knockout mice In vivo validation of the importance of caspases during mammalian apoptosis awaited the creation of caspase knockout mice. The first description of an apoptotic caspase knockout came in 1996 when Kuida et al. (Kuida et al., 1996) published their findings in mice lacking caspase-3. While these mice are born at lower than expected Mendelian ratios, some individuals survive for 1-3 weeks. The most pronounced phenotype of the surviving mice is a dramatic increase in neuron cell number – leading to diversely disorganized cellular architecture. Fatality of caspase-3-/- mice was later found to be strain specific – matings of caspase-3+/- breeders on the 129X1/SvJ background produced no surviving caspase-3-/- pups, while matings in the C57BL/6J strain produced expected numbers of normal appearing caspase-3-/- mice (Leonard et al., 2002).  19 Caspase-7 and caspase-3 share nearly identical substrate preference (Thornberry et al., 1997), which led to the common idea that these enzymes were redundant. Indeed, caspase-7-/- mice were found to be grossly normal and have only subtle resistance to apoptosis (Lakhani et al., 2006). However, when caspase-7-/- mice are bred to the C57BL/6J caspase-3-/- mice, which are normal and viable (Leonard et al., 2002), no caspase-3-/-;caspase-7-/- mice are born (Lakhani et al., 2006). Furthermore, lack of caspase-3 and caspase-7 is additively protective against a variety of death-inducing stimuli in mouse embryonic fibroblasts (MEF’s) (Lakhani et al., 2006). This suggests that while caspases-3 and -7 are grossly redundant at the level of organismal survival, they have at least some unique functions; this idea was later validated biochemically (Walsh et al., 2008). Despite their partially independent roles, caspase-7 expression is a key regulator of the strain-specific fatality of caspase-3-/- mice (Houde et al., 2004). While knockout mice for the final effector apoptotic caspase, caspase-6, have mentioned in the literature, no description of their organismal phenotype has yet been published (Zheng et al., 2000). In 1998, descriptions of mice deficient in the initiator caspases-2 (Bergeron et al., 1998), -8 (Varfolomeev et al., 1998) and -9 (Kuida et al., 1998) were published. Knockout of caspases-8 and -9, canonical initiator caspases in the “intrinsic” and “extrinsic” pathways of apoptosis, respectively, leads to perinatal or in utero lethality. Caspase-2-/- mice, however, were born in expected Mendelian ratios and were grossly normal (discussed below) (Bergeron et al., 1998). In order to determine whether the mild phenotype of the caspase-2-/- mice was due to functional compensation by caspase-9, Marsden et al. created caspase-2-/-;caspase-9-/- mice, which displayed the normal developmental phenotypes and perinatal lethality of the caspase-9-/- mice. This suggests that caspase-9 is not masking phenotypes in the caspase-2-/- mice (Marsden et al., 2004).  20  1.3. Caspases in neurodegeneration 1.3.1. Apoptosis in neurodegeneration – observational evidence The detection of TUNEL+ cells were the first suggestion that apoptosis was occurring in the HD brain (Portera-Cailliau et al., 1995). As the mechanisms of apoptotic cell death were elucidated, additional evidence in the form of immunohistochemical staining for active caspases in the brains of Alzheimer’s disease patients has supported the role for apoptotic cell death in neurodegenerative disease (Albrecht et al., 2007; Gastard et al., 2003; Gervais et al., 1999; Guo et al., 2004; Rohn et al., 2001). As both the mediators of apoptotic cell death (cleaved caspases) and markers of their activity (TUNEL positivity) have been detected in neurodegenerative brains, it seems clear that this form of death is occurring. While it is clear that classically apoptotic mechanisms are at work in neurodegenerative disease, considerations of the kinetics of this form of death have raised intriguing questions. The cascade of events initiated by caspase activation is extremely rapid, due to positive feedback provided by effector caspase cleavage. The kinetics of cell death in neurodegeneration, however, are generally slow and constant (Clarke et al., 2000; Zhu et al., 2006). This discordance of kinetics suggests that either canonical pathways of apoptosis and caspase activation are incomplete, or that cell death in neurodegenerative disease is not strictly apoptotic. Many proteins that regulate the apoptotic threshold of cells are differentially regulated in neurons, including Apaf-1 (Johnson et al., 2007; Wright et al., 2004) and XIAP (Potts et al., 2003). This suggests that data on apoptotic pathways collected in peripheral or transformed cell lines may not apply directly to post-mitotic neurons, despite the activation of apoptotic players in cell death. 1.3.2. Htt and caspases – cleavage Interest in caspases and the realization that apoptotic cell death was likely occurring in HD patient brains led to the discovery, in 1996, that the htt protein itself was a substrate for caspase-3 (Goldberg et al., 1996b). Purified caspase-3, apoptotic cellular  21 extracts or endogenous processing in mammalian cells are all capable of producing specific fragments of htt (Goldberg et al., 1996b). Subsequent work demonstrated that, in vitro, caspases-1, -2, -3, -6, -7 and -8 were all capable of cleaving htt (Hermel et al., 2004; Wellington et al., 1998). The major proteolytic susceptibility sites for caspases were mapped to amino acids 513, 552 and 586, clustered in PEST domain 2 ((Wellington et al., 1998), Figure 1.1). Several caspases with very similar substrate preferences (-2, -3, -7) are capable of cleaving htt in vitro at amino acid 513 and 552 (Hermel et al., 2004), while caspase-6 is unique among tested caspases by cleaving htt at amino acid 586 (Wellington et al., 2000). Stable N-terminal fragments of htt have been observed in the brains of mice (Li et al., 2000) (Kim et al., 2001), as well as human HD patients (Kim et al., 2001; Mende-Mueller et al., 2001), suggesting that htt is subject to proteolysis in vivo. The development of antibodies reactive to the novel epitopes exposed by caspase cleavage of htt (“neoepitope” antibodies) allowed the direct, specific, detection of caspase fragments of htt in human brain (Wellington et al., 2002). These investigations demonstrated that htt cleavage at amino acid 552 occurs constitutively, and thus may be a normal part of htt’s processing. Caspase cleavage at aa513 was not observed in vivo using neoepitope antibodies, suggesting that cleavage of this site may not occur in vivo (Wellington et al., 2002). 1.3.3. Htt and caspases – in vitro caspase resistance Caspases are unique among endopeptidases in their exquisite recognition of their preferred substrates (Stennicke et al., 2000; Thornberry et al., 1997). This fact, coupled with specific mapping of the caspase recognition sites in htt, allowed non-cleavable “caspase resistant” forms of the protein to be created by mutagenesis of obligate aspartate residues in recognition sequences (Wellington et al., 2000). Cells expressing these caspase resistant htt proteins do not produce N-terminal fragments of when exposed to stress, as cells expressing normal htt do (Wellington et al., 2000).  22 When cells expressing poly-glutamine expanded htt are exposed to tamoxifen stress they undergo enhanced toxicity, relative to cells expressing htt with a wild type CAG repeat length (Wellington et al., 2000). This poly-glutamine specific toxicity is reversed in cells expressing caspase-resistant forms of poly-glutamine expanded htt (Wellington et al., 2000). Intriguingly, caspase resistant forms of poly-glutamine expanded htt produce less cellular toxicity than non-resistant forms with normal polyglutamine lengths. This suggests that poly-glutamine induced toxicity is not dominant in cells, but requires caspase cleavage to achieve “toxic competence”. 1.3.4. Htt and caspases – in vivo caspase resistance In vivo validation of the caspase resistant hypothesis awaited the creation of a number of lines transgenic mice. First, an animal model of HD in a genetically tractable species was required to establish the baseline effects of mutant htt toxicity. Initial HD mouse models were created using short fragments of htt, truncated before the caspase cleavage sites (Davies et al., 1997; Schilling et al., 1999). Eventually, full-length models were made using both knock-in (Lin et al., 2001b; Shelbourne et al., 1999; Wheeler et al., 2000) and transgenic (Hodgson et al., 1999) strategies (summarized in Table 1.1). Table 1.1 – Major mouse models of HD.  Model Name  R6/1  R6/2  N171  Transgene  Htt Length (AA’s,  Promoter,  Species  %)  length  Human  67, 2.13%  Endogenous,  (Davies et  1kb  al., 1997)  Endogenous,  (Davies et  1kb  al., 1997)  Prion  (Schilling et  Human  Human  67, 2.13%  171, 5.4%  Reference  al., 1999) YAC46, 72  YAC128  Human  Human  3144, 100%  3144, 100%  Endogenous,  (Hodgson et  25kb  al., 1999)  Endogenous,  (Slow et al.,  23 Model Name  Knockin –  Transgene  Htt Length (AA’s,  Promoter,  Species  %)  length  Mouse  3120, 100%  Wheeler/  Reference  25kb  2003a)  Endogenous  (Wheeler et  (knock-in)  al., 1999)  Endogenous  (Shelbourne  (knock-in)  et al., 1999)  Endogenous  (Lin et al.,  (knock-in)  2001b)  Tetracycline  (Yamamoto  “on”  et al., 2000)  Endogenous  (Gray et al.,  20kb  2008)  MacDonald Knockin –  Mouse  3120, 100%  Shelbourne/ Myers Knockin –  Mouse  3120, 100%  Lin/Detloff Inducible –  Human  67, 2.13%  Yamamoto BAC  Human  3144, 100%  Mice expressing human htt with 128 CAG repeats from endogenous promoters on a yeast artificial chromosome develop a number of motor, affective, cognitive and neuropathological symptoms of HD (Pouladi et al., 2009; Slow et al., 2003b; Van Raamsdonk et al., 2005e). These “YAC128” mice have since been used in a number of investigations into HD pathology and pre-clinical trials (Choi et al., 2009; Cowan et al., 2008; Fernandes et al., 2007; Graham et al., 2006a; Graham et al., 2006b; Graham et al., 2009; Guidetti et al., 2006; Joshi et al., 2009; Lawhorn et al., 2008; Lerch et al., 2008a; Lerch et al., 2008b; Menalled et al., 2009; Milnerwood and Raymond, 2007; Pouladi et al., 2009; Shehadeh et al., 2006; Slow et al., 2005; Tang et al., 2005; Tang et al., 2007; Valenza et al., 2007a; van Raamsdonk et al., 2005; Van Raamsdonk et al., 2005b; Van Raamsdonk et al., 2005c; Van Raamsdonk et al., 2005d; Van Raamsdonk et al., 2005e; Van Raamsdonk et al., 2006b; Van Raamsdonk et al., 2007a; Van Raamsdonk et al., 2007b; Zhang et al., 2008).  24 The yeast artificial chromosome used to create the YAC128 mice is amenable to sequence-specific mutation, allowing derivative strains of mice to be created and compared to the well-characterized parental strain. Graham et al. (Graham et al., 2006a) created six independent transgenic lines (in duplicate) bearing different combinations of caspase site mutations (Table 1.2) to study the effect of caspaseresistance on mutant htt toxicity in vivo. Table 1.2 - Summary of caspase resistant “CR” lines described in (Graham et al., 2006a).  Line Name  Caspase Sites Mutated  Pathology Summary, Relative to YAC128  C3R  513, 530*, 552  No Change  C6R  586, 589*  Rescue  CQR  513, 530*, 552, 586, 589*  Rescue  * “Silent” sites for caspase cleavage in vitro. Mice expressing poly-glutamine expanded htt mutated at amino acids 586 and 589 are completely resistant to all features of HD including behavioral, cognitive and neuropathological endpoints (Graham et al., 2006a; Pouladi et al., 2009). Both neurodegenerative and behavioral symptoms associated with HD in the regular YAC128 mice are completely restored in these “caspase-6 resistant” (C6R) mice. In vitro, htt is cleaved at aspartate 586, but not 589, by caspase-6 (Wellington et al., 2000). This evidence suggests that cleavage of htt at amino acid 586 is necessary for polyglutamine expanded htt to cause toxicity. A striking feature of the C6R mice is that their susceptibility to excitotoxicity – a widely used acute model of HD pathology – is not normalized, but improved relative to wild type mice. The mutation of a single caspase recognition site in the 3144 amino acids of htt’s coding sequence is therefore sufficient to convert a toxic molecule into a protective one. This state change highlights the centrality of caspase processing of htt to disease pathology. Further, it suggests that this processing is specific – blockade of the caspase-3 cleavage of htt had no effect on the YAC128 HD phenotype, despite the fact that this cleavage event  25 has been confirmed to occur in vivo (Wellington et al., 2002), and only 34 amino acids separate the dispensable 552 and critical 586 sites. 1.3.5. Tau and caspases Intracellular tangles are one of two neuropathologically diagnostic features of Alzheimer’s disease (Kidd, 1963). These tangles are comprised largely of the neuronal restricted, microtubule-associated, protein tau (Kosik et al., 1986; Nukina and Ihara, 1986), which is required for microtubule polymerization (Weingarten et al., 1975). Mutations in tau cause a neurodegenerative condition known as frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17, Pick’s disease), which is also associated with intracellular tau tangles (Hutton et al., 1998). Even before the protein component of intracellular tangles was known, Nukina and Ihara noted that they were subject to regular proteolysis into 10, 26 and 36kD fragments (Nukina and Ihara, 1985), suggesting that regulated tau cleavage and pathology are correlated. In vitro work (Canu et al., 1998; Fasulo et al., 2000), as well as analysis of post-mortem tissue with neo-epitope antibodies (Rohn et al., 2002), suggests that tau is cleaved by caspases. Multiple caspases are capable of cleaving tau at the Asp421 residue, freeing a truncated N-terminal form of tau associated with increased tangle formation and correlating with cognitive decline in human AD brains (Berry et al., 2003; Gamblin et al., 2003; Rissman et al., 2004). Of particular interest, in light of the rescue observed in the caspase-6 resistant YAC128 mice, caspase-6 is suggested to cleave tau near the N(Horowitz et al., 2004) and C- terminus (Guo et al., 2004). 1.3.6. APP and caspases The second pathological lesion associated with AD is extracellular “plaques” comprised predominantly of amyloidogenic fragments of the amyloid precursor protein (APP, (Kang et al., 1987)), especially the 40-42 amino acid “Aß” fragment. Mutations in APP underlie some forms of familial AD, highlighting the importance of APP to AD pathology (St George-Hyslop et al., 1987; Tanzi et al., 1987). The widely held  26 “amyloid” hypothesis of AD pathology suggests that deposition of Aß into extracellular plaques is the initiating event in AD pathology (Hardy and Selkoe, 2002). The APP protein is a substrate for caspases (Gervais et al., 1999; Weidemann et al., 1999), and a 31kD intracellular caspase fragment of APP is toxic to cells (Galvan et al., 2002). Transgenic AD model mice expressing a mutant form of APP that cause familial AD in humans display symptoms consistent with AD pathology, including plaque deposition, synapse loss and altered hippocampal electrophysiology (Hsia et al., 1999; Mucke et al., 2000). When the APP in these mice is further mutagenized at Asp664, the cleavage site required for creation of the 31kD fragment, they are completely rescued from described AD pathology (Galvan et al., 2006; Saganich et al., 2006). These “caspase resistant” APP mice demonstrate normal deposition of extracellular plaques, suggesting that these lesions are not causal, per se, of AD pathology in this model. This suggests that caspase cleavage of APP is an intermediate event between plaque formation and pathology. The parallels between protection from AD in this model by dissociation between causal mutation and pathology are strikingly similar to the dissociation between CAG-expansion and pathology in the “Caspase-6 resistant” YAC128 mice (Graham et al., 2006a). In each case, caspase cleavage of a neurodegenerative disease causing protein is required for manifestation of pathological signs of the disease. Additional interest in the interaction between APP and caspases was generated by the description of a novel axonal self-destruction program (Nikolaev et al., 2009). In developing neurons trophic factor deprivation leads to extracellular shedding of an Nterminal fragment of APP, which binds to death receptor 6 (DR6). This N-APP-DR6 interaction leads to the local cytoplasmic activation of caspase-6 in punctate foci in axons. Blocking caspase-6 with peptide inhibitors or small interfering RNA (siRNA) rescues axonal degeneration in an acute model. These data suggest that both intracellular (via the 31kD intracellular caspase fragment) and extracellular (via N-APPDR6) interactions between caspases and APP are capable of mediating cell death.  27 1.3.7. Presenilins and caspases The generation of amyloidogenic Aß from APP requires the sequential action of two proteases – the “beta” and “gamma” secretases. Mutations in the presenilin family of genes cause familial forms of Alzheimer’s disease (Sherrington et al., 1995), and these mutations increase production of Aß (Citron et al., 1997), leading to their identification as key members of the gamma-secretase complex. Both members of the presenilin family (PS1 and PS2) are cleaved by caspases during apoptosis, and their cleavage leads to altered patterns of Aß expression (Kim et al., 1997). Thus, in addition to tau, all three genes whose mutation is known to cause familial Alzheimer’s disease (PS1, PS2 and APP) are subject to caspase cleavage during apoptosis. 1.3.8. Other neurodegenerative disease proteins and caspases (SMBA, DRPLA, SCA2,3,7 Caspase cleavage is common to many, but not all, poly-glutamine (polyQ) expansion diseases (Table 1.3). Caspase sites have been mapped in 5 of 9 poly-Q expansion diseases and mutating caspase cleavage sites ameliorates cellular toxicity in several of these (e.g. htt (Wellington et al., 2000), atrophin-1 (Ellerby et al., 1999) and SCA7 (Young et al., 2007)). The lack of conserved domains (outside the expanded poly-Q tract) or functional similarity among these proteins is one of the mysteries of neurodegenerative disease biology (Gatchel and Zoghbi, 2005). The commonality of caspase cleavage in at least 5/9 diseases suggests that cleavage of poly-Q diseasecausing proteins is conserved to an unexpected degree, highlighting its potential importance. Table 1.3 – 5 of 9 Proteins whose mutation causes a poly-glutamine expansion disease are subject to caspase-mediated cleavage.  Disease  Protein  Caspase  Reference  Substrate?  Confirmed* cleavage sites  Spinobulbar  androgen  Yes  (Wellington et  146  28 Disease  Protein  Caspase  Reference  Substrate?  Confirmed* cleavage sites  muscular atrophy  receptor  (Kennedy disease)  (AR)  Huntington  htt  al., 1998)  Yes  disease Dentatorubral-  atrophin-1  Yes  (Wellington et  513, 530,  al., 1998)  552, 586  (Miyashita et  109  pallidoluysian  al., 1997;  atrophy (Haw River  Wellington et  syndrome)  al., 1998)  Spinocerebellar  ataxin-1  No  ataxin-2  No  ataxin-3  Yes  ataxia type 1 Spinocerebellar ataxia type 2 Spinocerebellar  (Berke et al.,  ataxia type 3  2004;  (Machado-Joseph  Wellington et  disease)  al., 1998)  Spinocerebellar  a1A-  ataxia type 6  voltagedependent calcium channel subunit  No  241/4/8  29 Disease  Protein  Caspase  Reference  Substrate?  Confirmed* cleavage sites  Spinocerebellar  ataxin-7  Yes  ataxia type 7  (Young et al.,  266, 344  2007)  Spinocerebellar  TATA  ataxia type 17  binding  No  (Wellington et al., 1998)  protein  1.4. Caspase-2 Caspase-2 (casp2) was initially cloned and identified as being enriched in the developing brain (Kumar et al., 1992). Subsequent work recognized this enzyme as a caspase, expressed in the adult brain, capable of causing cell death when transfected into neuronal and non-neuronal cells (Kumar et al., 1994). Activation of endogenous casp2 during apoptosis in cell lines confirmed its role as an apoptotic caspase (Harvey et al., 1996; Li et al., 1997a). Further studies suggested that casp2 is activated very early in apoptosis (Harvey et al., 1997), and that it associates with RAIDD, a putative scaffold for the transmission of pro-death signaling events to caspases (Duan and Dixit, 1997). These temporal and interaction data suggested a potential “initiator” role for casp2 in cell death. Shortly after its cloning, experiments utilizing antisense knockdown demonstrated that casp2 plays a role in serum-withdrawal induced death of differentiated (neuronal) PC12 cells (Troy et al., 1997). This protection was specific, as antisense did not protect cells from death induced by down-regulation of Cu2+/Zn2+!superoxide dismutase (SOD1), which kills cells via oxidative stress (Troy et al., 1996). This activation of casp2 was furthermore found to occur in primary sympathetic neurons, and not to require activation of caspase-3-like activities (Stefanis et al., 1998). Primary sympathetic neurons from casp2-/- mice, however, were found to be slightly more sensitive to  30 serum-withdrawal induced cell death; not less as would be predicted from the antisense experiments (Bergeron et al., 1998). In general, the initial characterization of casp2-/- mice demonstrated normal or slightly worsened neuronal phenotypes (Table 1.4). The authors speculate that this is due to inactivation of both the long, putatively pro-apoptotic, and short, anti-apoptotic, isoforms of casp2. Table 1.4 – Neural phenotypes in the casp2-/- mice (Bergeron et al., 1998).  Phenotype  Cell type  Effect of Casp2-/-  Cell numbers  Facial motor  Transiently decreased number of  neurons  neurons (E19.5-P0)  Cell death post-  Sympathetic  Decreased survival at 30 hours post-  NGF withdrawal  neurons (superior  withdrawal  cervical ganglia) Post-ischemic  No change in size. No processing of C2  infarct area Onset of motor  Earlier (99 days vs. 112 days)  symptoms in SOD(G93/A) ALS mouse Mortality in  Earlier (129 days vs. 140 days).  SOD(G93/A) ALS mouse  Despite the lack of compelling neuronal phenotypes in the casp2-/- mice, interest in its role in neurodegeneration was maintained by the fact that hippocampal neurons from casp2-/- mice, as well as heterologous cells after casp2 knockdown, are completely resistant to cell death induced by application of purified Aß(1-42) peptide (Troy et al., 2000). Additionally, other toxic forms of Aß (25-35) cause processing, suggesting  31 activation, of casp2 in cerebellar neuronal cultures (Allen et al., 2001). More recently, it has been demonstrated that treatment of primary hippocampal neurons with purified Aß(1-42) peptide creates conformationally competent casp2 (Tizon et al., 2010). Neurons undergoing ischemia and excitotoxic cell death have also been shown to activate casp2 in several paradigms. Striatal injections of malonate, an inhibitor of succinate dehyrodgenase, lead to lesions that are preceded by early proteolytic processing of casp2 (Schulz et al., 1998). Transient global retinal ischemia leads to neuronal death that is rescued by casp2 silencing by antisense (Singh et al., 2001). Retinal neuronal death is also induced by application of the excitotoxin pregnenolone sulfate, which requires casp2 (Cascio et al., 2002). Transient global ischemia leads to the death of vulnerable hippocampal neurons, which is associated with activation of casp2 (Niizuma et al., 2008). Hermel et al. established a major link between casp2 and HD pathogenesis in 2004 (Hermel et al., 2004). They demonstrated that total htt co-immunoprecipitates with casp2 in a polyQ-dependent manner – more casp2 was precipitated with polyQ expanded htt than with wild type htt. Furthermore, co-expression of dominant negative casp2 was sufficient to almost completely normalize the toxic effect of polyQ-expanded htt in primary neurons. Total casp2 protein levels are increased in vulnerable cells in HD patient brains. This data strongly suggested a role for casp2 in HD pathogenesis.  1.5. Caspase-2 Short Form Regulation of apoptosis is a complex organismal problem. Inappropriately low apoptotic thresholds would be dangerous for long-lived, post-mitotic, cells such as neurons. Whereas a threshold that was set too high could lead to the inappropriate maintenance of damaged cells and consequent neoplastic liabilities. The evolution of apoptotic regulation from Caenorhabditis elegans to mammals is accompanied by a marked increase in complexity; c. elegans, for example, expresses a single caspase enzyme (ced-3), while 13 mammalian enzymes have been cloned and described.  32 Analogous duplications have taken place at a number of levels of apoptotic regulation, allowing much finer regulation of apoptosis. One key mechanism of apoptotic regulation is the expression of apoptotic regulators with antagonistic effects on cell death. For example, apoptosis in c. elegans is antagonized by the expression of ced-9. The orthologous family of genes in mammals is the B-cell lymphoma-2 (Bcl-2) family, which encodes pro- (e.g. Bax, Bak) and anti(e.g. Bcl-2, Bcl-XL) apoptotic genes. The interaction of these genes enables more refined control of apoptosis. The casp2 locus expresses two isoforms, a short (casp2S) and long (casp2L) one. These transcripts have antagonistic effects on cell death – casp2S is anti-apoptotic, while casp2L is pro-apoptotic (Droin et al., 2001; Kumar et al., 1994). The casp2S/L ratio is increased by exposure to genotoxic stressors, such as the topoisomerase inhibitors etoposide and camptothecin (Solier et al., 2008). Casp2S is generated by the inclusion of exon 9, which encodes an early stop codon, while casp2L undergoes splicing between exons 8 and 10 (Logette et al., 2003). An ~100 base pair region in intron-9 termed “ln100” mediates inclusion of exon-9 (Coté et al., 2001) which is regulated by the tumor suppressor RBM5 (Fushimi et al., 2008). This active and complex regulation suggests some functional relevance of casp2 isoforms, though some authors have argued that the casp2S transcript is degraded by nonsense mediated decay and therefore short lived (Solier et al., 2005).  1.6. Caspase-2 Activation As an initiator caspase with a CARD-domain containing pro-domain, casp2 should be activated by induced proximity on a molecular scaffold (see 1.2.2). By analogy to casp9, whose activation mechanism is well characterized (Yu et al., 2005), casp2 should be recruited into a high molecular weight complex and become active via conformational changes induced by a binding partner(s). Indeed, casp2 has a known binding partner, RAIDD, that contains a death effector domain (DED, (Duan and Dixit, 1997). In line with these predictions, casp2 is recruited to novel high molecular weight  33 complexes and activated when casp2 expressing lysates are incubated at 37C (Read et al., 2002). The apparent final piece of the puzzle was the discovery of the protein p53-induced death domain containing protein (PIDD), which is induced by genotoxic stress (Lin et al., 2000). PIDD, RAIDD and casp2 were shown to form a high molecular weight structure dubbed the “PIDDosome” that activated casp2 (Tinel and Tschopp, 2004). Crystal structures have revealed the detailed structure of the PIDDosome, (Park et al., 2007). Recruitment of casp2 to the PIDDosome has been used as a marker for it’s activation in vivo (Niizuma et al., 2008). A parallel complex, dubbed the “DNA-PKcs PIDDosome” has also been described (Shi et al., 2009). This complex contains casp2, PIDD and DNA protein kinase (catalytic subunit), and is located in the nucleus. The DNA-PCcs PIDDosome is activated in response to genotoxic stress, and is required for accurate induction of the G2/S phase checkpoint after DNA damage, as well as efficient non-homologous end joining DNA repair. Intriguingly, casp2 has been shown to be a tumor suppressor in vivo, consistent with its role in DNA maintenance (Ho et al., 2009). These non-apoptotic roles suggest that the functions of casp2 may be broader than previously appreciated. A recent study has called into question the functional relevance PIDDosome formation. Mice lacking PIDD expression are not resistant to any tested form of apoptotic cell death (Manzl et al., 2009), and casp2 is effectively activated in cells from the mice. Casp2 still effectively traffics to the nucleus in PIDD-/- cells upon DNA damage. While casp2 processing after acute stress with etoposide or UV radiation was delayed, significant cleavage of casp2 occurred and was blocked in cells lacking casp3 and casp7. This suggests that the cleavage of casp2 observed in these acute paradigms is dependent on effector caspase cleavage of casp2, and is unlikely to be important for apoptotic responses. Most interestingly, casp2 is still recruited to high molecular weight complexes in PIDD-/- lysates, suggesting that additional binding partners remain to be identified that may contribute to the activation of casp2.  34  1.7. Thesis Objectives There is currently no treatment for HD. Proteases are excellent drug targets because as substrate-recognizing enzymes they have many constrained structural features, amenable to targeting by traditional small molecule approaches. Caspase-2 is a particularly interesting caspase from the point of view of therapeutic discovery because the knockout mice have a mild phenotype (Bergeron et al., 1998; O'Reilly et al., 2002) when compared to other caspase family member knockouts (Kuida et al., 1996). Caspase-2’s distinctive structure (Schweizer et al., 2007; Schweizer et al., 2003) and evolutionary uniqueness also make it an excellent target from the point of view of potential selectivity. In addition to this clear therapeutic relevance, the in vivo role played by caspase-2 is not well understood. The overall objective of this thesis is thus to: 1.7.1. Specific objective 1 – To expand the phenotypic repertoire of the YAC128 mice. Careful ascertainment of HD phenotypes in the YAC128 mouse is required to judge the efficacy of any intervention. More accurate and broader analysis of phenotypic changes in the YAC128 mouse expands our understanding of HD and identifies new endpoints for preclinical trials in mice. Furthermore, non-terminal endpoints that can be transferred from mouse studies to human clinical trials enable “biomarkers”, or outcome measures based on phenotypes besides survival and overt disease onset. Questions that will be addressed are: Can magnetic resonance imaging techniques enable earlier and/or more accurate determination of neurodegeneration in the YAC128 mice? What is the global natural history of neuropathological development in the YAC128 mice? Are there peripheral biomarkers of disease progression, relevant to caspase-2 biology, which are detectable in human and mouse serum?  35 1.7.2. Specific objective 2 – To determine whether loss of caspase-2 causes phenotypic alterations in mice. The original descriptions of the caspase-2-/- mice described a relatively normal developmental program (Bergeron et al., 1998; O'Reilly et al., 2002). Subsequent studies have referred to this ‘mild’ phenotype (Bonzon et al., 2006; Vakifahmetoglu et al., 2006). A number of aspects of these mice remain unexamined, helping to obscure the physiological functions of caspase-2. Ignorance of these important functions could furthermore have important consequences if a caspase-2 inhibitor was developed as a therapeutic agent for HD. Questions that will be addressed are: Do aging casp2-/- mice display previously undescribed phenotypes? Do phenotypes observed in casp2-/- mice cluster in biologically meaningful categories? 1.7.3. Specific objective 3 – To determine if loss of caspase-2 can influence the progression of HD in the YAC128 mice. Previous work has demonstrated that multiple caspases may be involved in the pathogenesis of HD, and that total caspase-2 protein levels are increased in human HD brains (Graham et al., 2006a; Hermel et al., 2004; Wellington et al., 1998; Wellington et al., 2002). The mechanism underlying increased caspase-2 expression in HD is unclear, as is the question of the amount of active enzyme. The broad phenotypic repertoire of the YAC128 mouse allows multifaceted investigation of HD phenotypes – previously described endpoints, in conjunction with the ones developed for this thesis, to allow detailed interrogation of the role played by caspase-2 in HD. Questions that will be addressed are: Is caspase-2 mRNA upregulated in HD? Is cleaved, active, caspase-2 increased in HD? What is the spatiotemporal pattern of this activation? Are caspase-2-/- neurons protected from excitotoxicity? Can tools be developed to selectively silence caspase-2 in populations of primary neurons in culture models of HD? Are caspase-2-/-;YAC128 mice protected from motor and cognitive signs and symptoms of  36 HD? Are caspase-2-/-;YAC128 mice protected from pathological signs and symptoms of HD?  37  2. Materials and Methods 2.1. Mice and breeding Caspase-2-/- mice (O'Reilly et al., 2002) were obtained on the C57Bl/6 strain, and backcrossed for at least 7 generations to the FVB/NJ strain before being used for experiments or bred to the YAC128 mouse. YAC128 mice (Slow et al., 2003a) were maintained on the FVB/NJ strain. Caspase-2+/-;YAC128+/- breeders were intercrossed and pups of appropriate genotypes selected from the resultant progeny, to ensure subject mice were littermates. Mice were genotyped and housed as previously described (Slow et al., 2003a), and all animal experiments were conducted in accordance protocols approved by the University of British Columbia Committee on Animal Care.  2.2. Pathology, including MRI Mice were terminally anesthetized by intraperitoneal injection of 2.5% avertin, and transcardially perfused with 30mL phosphate buffered saline (PBS), followed by 30mL 4% ice-cold paraformaldehyde in PBS. Testes were dissected out and weighed after fixation. Heads were removed and skin, lower jaws ears and cartilaginous nose tip dissected away. Skulls were post-fixed in 4% paraformaldehyde at 4C overnight. Skulls were soaked in PBS + 0.01% sodium azide for 5 days at room temperature with rotation. Skulls were then enhanced in PBS + 0.02% sodium azide with 2mM gadoteridol (Bracco Diagnostics Canada, Mississauga, ON). A 7.0 Tesla MRI scanner (Varian Inc., Palo Alto, CA) with a 6 cm inner bore diameter insert gradient set was used for all MRI scans. Parameters used for anatomical MRI scans were optimized for high efficiency and gray/white matter contrast: T2-weighted, 3D fast spin echo, with a TR of 325 ms, and TEs of 10 ms per echo for 6 echoes, four averages, field-of-view of 14 x 14 x 25 mm3 and matrix size of 432 x 432 x 780 giving an image with 0.032 mm isotropic voxels. Total imaging time for this MRI sequence is ~12 hours (Henkelman et al., 2006). Volumes were segmented into anatomical structures by alignment to a pre-existing  38 atlas (Collins et al., 1995; Dorr et al., 2008; Lerch et al., 2007). After imaging skulls were removed and brains weighed.  2.3. Primary mouse embryonic fibroblasts and etoposide stress Embryos were dissected from E12.5 pregnant caspase-2+/- females who had been bred with casp2+/- males. DNA was isolated from bodies post-dissection for genotyping. The spleen and liver were dissected from each embryo, and the head removed. Remaining tissues were minced into ~2mm pieces in 5mL of trypsin. After 15 minutes digestion at 37ºC, cell suspensions were dissociated by pipetting, media added (DME + 10% FBS), and collected by centrifugation (1000 RPM/5’). Cell pellets were resuspended in 10mL DME + 10% FBS and plated in 10cm dishes (“passage 0”). Experiments were done with genotype pairs of cells of the same passage number (always P0-P7). Etoposide stress was induced by diluting etoposide/DMSO (Sigma E1383) in MEF media to the indicated final concentration. 37ºC  2.4. Quantitative Real-time Quantitative PCR (QRT-PCR), caspase-2 short/long ratios Total RNA was extracted from dissected striata, frozen and stored at -80C using the RNeasy mini kit (Qiagen, 74104). cDNA was prepared using 250ng total RNA and the superscript-III first-strand synthesis kit with oligo-dT priming (Invitrogen, 11752-050). Primers used included mouse casp2 forward: 5’-GAATGAACCTTATCGGGCATAACT-3’ and reverse: 5’-GATGACGGGTGATAGTGTGAGACA-3’. Mouse actin forward: 5’ACGGCCAGGTCATCACTATTG-3’ and reverse: 5’-CAAGAAGGAAGGCTGGAAAAGA-3’. QRTPCR was conducted using SYBR Green PCR master mix (Applied Biosystems, 4309155) in the ABI7500 instrument (Applied Biosystems) using the absolute quantification standard curve method. Caspase-2 short/long transcript levels were done using cDNA prepared (as above) from neurons or isolated adult striata. PCR amplification was done with primers spanning the splice site in caspase-2: forward – 5’ATGCTAACTGTCCAAGTCTA3’ and reverse – 5’TCTCATCTTCATCAACTCC3’ (Bergeron et al., 1998). PCR products were run  39 on a 1.5% agarose gel and stained with ethidium bromide. Band intensity was determined using ImageJ software (NIH), and expressed as caspase-2S intensity/caspase-2L intensity for each individual mouse.  2.5. Protein isolation, western blotting and antibodies Cultured neurons were harvested by scraping into media with the bore of a 1mL syringe and pelleting at 3,000xG for 5 minutes. Pellets were resuspended in SDP+ buffer (50mM Tris pH = 8.0, 150mM NaCl, 1% Igepal, 40mM B-glycerophosphate, 10mM NaF, 1 x Roche complete protease inhibitor, 1mM NaOrthovanadate and 800uM PMSF). Cells were incubated on ice for 10 minutes and vortexed three times during incubation to ensure lysis. Debris was removed by centrifugation (15 minutes, 15,000xg, 4C) and supernatent retained. Protein concentration was determined by the DC protein assay (BioRad, 500-0111). 100ug of protein was denatured by heating to 70C in LDS sample buffer (Invitrogen, NP0008) run on a 4-12% Bis-Tris Gel (Invitrogen, NP0321BOX) and transferred to a Immobilon-PVDF-FL membrane. Primary antibodies were anti-GAPDH (clone 6C5, Millipore, used at 1:10,000) and anti-caspase-2 (clone 11B4, Alexis Biochemicals, used at 1:1000).  2.6. Caspase activity assays Protein was isolated and quantified (as above) from MEFs +/- 24-hours of etoposide or staurosporine stress. Lysates were diluted in lysis buffer to reach a concentration of 1ug/ul. 50ul of 2-X caspase reaction buffer (100mM HEPES, 200mM NaCl, 0.2% CHAPS, 2mM EDTA, 20% Glycerol, 10mM DTT (added fresh) pH=7.4) with 10mM z-DEVD-afc (“caspase-3” substrate) or z-VDVAD-afc (“caspase-2” substrate, Biomol, Plymouth Meeting, USA) was added to each well of a black 96-well Optiplate-96F (Perkin Elmer, Waltham, USA). 50ug of protein lysate was added to each well and the fluorescence intensity read every 10 minutes for 1 hour at 37ºC (excitation 400nm, emission 505nm) using an automated plate reader (POLARstar Omega, BMG Lab tech, Offenburg, Germany). Activity was expressed as fluorescence units at one hour / mg protein.  40  2.7. Immunohistochemistry and stereology Mouse brains were fixed with 3% paraformaldehyde (PFA)/0.15 % glutaraldehyde in PBS then cut using a vibratome. Coronal sections (25µm) were immunoassayed with antibody to activated casp2 or aggregated huntingtin (ab2551, Abcam, Cambridge, MA; MAB5374, EM48, Millipore, Billerica, MA). Peroxidase treatment was done using 1% phenylhydrazine in PBS then sections blocked using 5% NGS, 0.1% Tx-100 in PBS. Primary antibodies were diluted 1:500 (Active caspase-2 – Abcam ab2251), 1:1000 (NeuN – Chemicon MAB377) or 1:50 (EM48 – Chemicon MAB5374) in 5% NGS, 0.1% Tx100 in PBS. Biotinylated secondary antibodies (Vector) were used at 1:200 prior to signal amplification with an ABC Elite kit (Vector) and detection with DAB (Pierce). Amount of time in DAB (1mins) was strictly controlled for all sections. No staining was observed in a negative control without primary antibody. Photographs were taken on a light microscope (Zeiss) using 100X or 40X objective. For striatal stereology conducted after MRI, the fixed brains were removed from the skull and transferred to 30% sucrose in phosphate-buffered saline (pH 7.4, 0.1 M) for 2 days. Immediately prior to sectioning, brains were frozen on dry ice. Serial coronal sections (25 um) were cut on a cryostat microtome (HM 500 M, Microm Int. GmbH, Walldorf, Germany). Every eighth section was stained with an antibody reactive to NeuN, a marker of neuronal nuclei (Mullen et al., 1992). The area of the striatum was traced using Stereoinvestigator software (Microbrightfield) in each section between the anterior start of the crossing of the corpus callosum and the anterior start of the hippocampus. Striatal volumes were then calculated with Stereoinvestigator software. Hypothalamic stereology was conducted on sections stained with NeuN and cresyl violet. Sections mounted were between bregma -0.91mm and -2.31mm (van der Burg et al., 2008). “Hypothalamus” was defined as tissue from the ventral surface of the brain (omitting the white matter of the optic tract) to a dorsal line drawn between the joining of the cortex with the hypothalamus, omitting the fornix. Total neurons, identified by co-staining with cresyl violet and NeuN, were counted using the optical  41 dissector method in Stereoinvestigator software (Microbrightfield) and expressed as the total estimated neurons/hypothalamus. For liver immunohistochemistry, lobes of fresh liver were removed from animals and immersion fixed in 10% neural buffered formalin for 24 hours. Samples were embedded in paraffin and 5um sections cut and mounted to slides. Slides were stained with hematoxylin and eosin. Briefly, sections were deparaffinized in xylene, rehydrated in ethanol (100% to 70%, 5 minutes each), washed in distilled water, stained with hematoxylin solution (8 minutes), washed in water, washed in 95% alcohol, then counterstained with eosin-phloxine B (1 minute), cleared with xylene and coverslipped with xylene-based mounting media. For stereology, a complete transverse section of a lobe of liver was outlined using Stereoinvestigator software (Microbrightfield). A counting frame was defined as: square root(area of tissue/100), giving a frame of approximately 900um2, leading to the measurement of 200-300 hepatocytes/mouse which were evenly distributed throughout the tissue section. Cells were measured by using a 4-rayed fractionator probe in Stereoinvestigator software (Microbrightfield).  2.8. Primary neuron cultures Embryos were dissected from E15.5-E17.5 pregnant caspase-2+/- females who had been bred with casp2+/- males. Striatal tissue was isolated and cultured, essentially as described (Zeron et al., 2002). Briefly, striata were dissected into ice-cold divalentfree Hank’s Balanced Salt Solution (Invitrogen, 14025-134). Striatum was chopped into pieces and digested with 0.05% Trypsin-EDTA (Invitrogen, 25300-120) at 37ºC for 8 minutes. The digestion was halted by addition of complete neurobasal media (Invitrogen, 10888-022). Cells were resuspended in media and treated with DNAse I (Invitrogen, 18047-019). After titration through a 100ul pipette tip, cells are resuspended in neurobasal media with B27 supplement (Invitrogen, 17504-044), and counted. 1.7x10^5 cells/well were plated in 24-well plates pre-coated with poly-Dlysine (BD Biosciences, 354210). DNA was isolated from bodies post-dissection for  42 genotyping. Neurons were supplemented with 10% neurobasal media with B27 every 3-5 days.  2.9. Excitotoxicity induction On day 10 in vitro (DIV) neurons were treated by excitotoxic challenge with N-methylD-aspartate, after examination under phase microscope to establish cell health and maturation. Media was removed from all neurons from a single pup and pooled. Neurons were rinsed once in extra cellular solution (ECS) without magnesium (in mM: NaCl – 14; KCl – 0.54; CaCl2 – 0.13; HEPES 1; Glucose – 2.5). After aspiration, neurons were exposed to ECS stimulation buffer (in mM: ECS; MgCl2 – 0.1; NMDA – 100 or 500) at room temperature for 10 minutes. Mock treated (“0 mM” NMDA) were treated by incubation in ECS without magnesium in parallel with treated cells. After stimulation, ECS stimulation buffer was removed and neurons were washed once with ECS buffer without magnesium. After aspiration, exactly 0.75mL pooled media was added to each well and cells returned to 37ºC incubator.  2.10.  Cell viability and toxicity  24-hours after NMDA/etoposide/staurosporinte stimulation, MEF’s/neurons were removed from 37ºC incubator. 100ul of media was removed from each well to a black 96-well plate 75ul media was removed for LDH quantification, according to manufactures instructions (Roche Diagnostics, Indianapolis, IN, cytotoxicity detection kit). The remaining media on neurons was then aspirated, and 150ul 1:1 lysis reagent (Cell Titre Glo, Promega, Madison WI) and neurobasal media added. Cells were lysed on an orbital rotator at room temperature for 10 minutes, protected from the light. 100ul of reagent:media mixure were removed to a black walled 96-well plate (Thermo Scientific, Waltham, MA) and luminescence detected with a OMEGAstar plate reader (BMG Labtech, Offenburg, Germany). For LDH (toxicity) and ATP (viability) data, each wells raw value is normalized to mock-treated cells or neurons on the same plate, and expressed as a fraction of this value.  43  2.11.  Antisense oligonucleotide transfection  Neurons were fed with 100ul neurobasal media with B27 on day 3 in vitro (DIV3). For antisense oligonucleotide treatment, 20-mer oligonucleotides were added to supplementary media added on day 3. Oligonucleotides were synthesized as described (McKay et al., 1999) and are phosphorothioate-modified chimeric oligonucleotides composed of five 2′-O-(2-methoxy)ethyl modifications on both the 5′ and 3′ ends and 10 oligodeoxynucleotides in the center. Oligonucleotide sequences were identified by gene walking approaches (2008) and are 5’GAGGCCTCCGCCAGACTCAA-3’ (mouse caspase-2) and 5’-CCTTCCCTGAAGGTTCCTCC3’ (control, off-target). Neurons were treated on DIV10 with NMDA after visual inspection to ensure culture health. Conditioned media was removed from each well and pooled in a 50mL falcon tube. Neurons were washed 1 time with extracellular solution (ECS – in mM: 14 NaCl, 0.54 KCl, 0.13 CaCl2, 0.1 MgCl2, 1 HEPES, and 2.5 glucose, pH 7.35). This wash was replaced with either more ECS (“mock treatment”), or ECS-MgCl2 with 100/500uM NMDA and 30uM glycine, and the cells incubated at room temperature for exactly 10 minutes. Stimulation solution was removed; cells were washed one more time with ECS and exactly 750ul of conditioned media replaced to each well. Plates were replaced in 37ºC incubator overnight.  2.12.  Plasma lipid assays  Animals were fasted for 4 hours before plasma collection. Blood was collected in EDTA tubes (Sarstedt, Numbrecht) by puncture of the saphenous vein with a 22-gauge needle and held on ice. Plasma was isolated by centrifugation of blood at 4000 RPM, at 4C for 15 minutes. Clear plasma was transferred to a clean Eppendorf tube and kept at -80C until analysis. All human experiments were performed in accordance with the declaration of Helsinki and approved by University of British Columbia (UBC) Clinical Research Ethics Board. All subjects gave informed written consent. Human HD patients were recruited and  44 grouped based on the Huntington Disease total functional capacity score (Shoulson, 1981) into “early-“ (TFC 13-7) and “mid-“ (TFC 6-3) disease. Control subjects were unaffected spouses and partners of HD patients and siblings of HD patients who tested negative for the HD mutation. Blood was collected into EDTA tubes, maintained on ice, and plasma collected by fractionation of the blood by density gradient centrifugation. Enzymatic detection of plasma cholesterol was determined using the Infinity cholesterol reagent (Sigma). To measure cholesterol levels, 5ul plasma or multi-lipid calibrator solution (Wako Diagnostics, Osaka) was added to 200ul Infinity reagent. Absorbance at 490nm was used to calculate cholesterol levels, which were normalized to values obtained from calibrator solution. For gas-liquid chromatography-mass spectrometry (GC-MS) detection of cholesterol 50ug 5α-cholestane (Serva, Feinbiochemica GmbH, Heidelberg, Germany) and 1ug epicoprostanol (Sigma, Seelze, Germany) were added to 100ul plasma as internal standards. Sterols were extracted by cyclohexane after saponification and neutralization. The solvents were evaporated and the residual sterols were derivatized to trimethylsilyl (TMSi)-ethers by adding 1ml pyridine:hexamethyldisilazane:trimethylcholorsilane (9:3:1, v/v/v) and incubated for 1h at 64C. The solvents were evaporated under nitrogen at 65C. The residue was dissolved in 60uL n-decane. 50ul of the solution was transferred into a micro-vial for gas-liquid chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM) analysis of cholestanol, lanosterol and the phytosterols sitosterol, campesterol and brassicasterol (Lütjohann et al., 1995). 10uL was diluted with 90µL n-decane for analysis of cholesterol by gas-liquid chromatography-flame ionization detection (GCFID) (Lütjohann et al., 2002).  2.13.  Behavioral assays  Mice were single housed in microisolator cages with a 12h light/dark cycle. Mice were randomly coded and the experimenter was blind to genotype. Motor coordination and learning were examined using an accelerating rotorod (UGO Basile, Comerio, Italy). For training, naïve 4-month-old mice were given three trials of 2 minutes on a  45 fixed speed (18RPM) task per day for three days (9 trials total). The inter-trial interval was 2 hours. Mice falling from the rod were returned, to a maximum of 10 falls/trial. The time to first fall and total number of falls per trial were recorded. For longitudinal accelerating rotorod assessment 4-, 8- or 12-month-old mice were tested on a rod accelerating from 5 to 40 RPM over 300 seconds. Latency to fall from the rod was recorded. 3 trials in 1 day were averaged to give mean performance for each mouse at each age. Acoustic startle and prepulse inhibition (PPI) were measured in SR-LAB chambers (San Diego Instruments, San Diego, USA). Before use, the chambers used were calibrated using a vibrating standardization unit at 700V (San Diego Instruments, San Diego, USA). After a 5 minute acclimatization period mice were exposed to 100 50ms startle stimuli with intensities ranging from background level (70dB) to 120dB. Startle stimuli were presented in pseudorandomized order in 10 blocks of 10 trials, with a pseudorandomized 8-32 second intertrial interval. For the PPI task, the “pulse” was a 40ms 120dB stimulus. Eight blocks of trials were conducted – the first and last of which were a series of 6 pulse only trials. The first block was used to determine the average startle intensity. The subsequent 6 trial blocks consisted of 6 trials: 70dB (background) alone (“no-pulse”), 120dB for 40ms alone (“pulse”) and 4 pre-pulse trials with pre-pulse intensities of 72, 74, 78 and 86 dB (20ms duration, pre-pulse interval of 100ms). PPI was calculated as: [(First 120dB block response)-(PPI block response)]/(First 120dB block response). PPI stimuli were presented in pseudorandomized order with a 8-32 second intertrial interval. For the swimming T-maze + reversal task mice were tested in a white acrylic maze with arm dimensions 38 x 14cm (Van Raamsdonk et al., 2005e). The maze was filled with water and a platform (10 x 14cm) submerged below the water surface in one arm of the t-maze. Mice were released at the base of the stem of the T and learned to swim to the submerged platform – the time to platform, total number of arm entries and arm re-entries were recorded. For training, mice received 4 trials per day for 3 days (12  46 total trials) with a 45-minute intertrial interval. On the 5th day, the platform was switched to the opposite arm of the t-maze and mice were required to change strategies to find the platform in its new location. Mice received 4 trials with a 45 minute intertrial interval.  2.14.  Body weight and composition  Mice were weighed at 4, 8 and 12 months of age using a digital scale. Body composition was determined at 4 and 12 months of age using quantitative magnetic resonance (EchoMRI, Houston TX).  2.15.  Indirect calorimetry  At 4 and 12 months of age, indirect calorimetry was conducted for 115-120 hours (LabMaster Cages, TSE-Systems, Bad Homburg, Germany). Mice were acclimatized to calorimetry cages for 24 hours, and then energy and activity parameters were measured every 15 minutes. Activity measurements include: total, fine and stereotypic movements in the center and periphery of the chamber using X-, Y- and Zaxis infrared beams. Energy measurements include: food intake, water intake, energy expenditure, and respiratory exchange ratio were measured every 15 min for a total of 58 h. Resting energy expenditure was calculated by measuring energy expenditure in epochs of the dark phase during which total movement was in approximately the lowest quartile (less than 10 beam breaks/15 minutes).  2.16.  Statistics  Data are presented in the text as mean +/- standard error, unless otherwise noted. Group Differences For data with one independent variable an unpaired t-test or one-way ANOVA model was fitted and tested (as appropriate), followed by Newman-Keuls or Bonferroni posthoc tests. Data with two or more independent variables was analyzed by factorial (“two-way”) ANOVA. To control for repeated measurements in complete data sets (i.e.  47 rotorod training), in which no missing values were obtained, data were analyzed using repeated measures two-way ANOVA.  Lethal concentration 50 (LC50) calculation Fitting the log transform of the viability data to the equation while constraining “top” to 1.0 due to the normalization used, allows the estimation of LC50. Linear Random Intercept Mixed Effects Model When values were missing, data were analyzed by fitting a linear mixed effects (LME) model, followed by analysis of variance testing (Ware, 1985). The linear mixed effects model used is a linear random intercept model with covariates. This model is an extension of the standard linear regression model: yi =β0 + β1x1 + … βpxp + ei Where the response variable (yi) is estimated from the value of parameters (β0 …βp), specified independent variables (x1…xp) and an error term, ei, which is assumed to be normally distributed with a mean of 0: N(0,σ2e). In the random intercept mixed effects model, this is expanded to account for multiple sources of error: yij =β0 +β1xij + … βPxij + uj +eij Where i is the individual measured and j is the time point. Uj and eij are group and individual components of (normally distributed) error, respectively, and p is the number of parameters. Grouping repeatedly measured data by individual performance (i.e. a separate value of uj for each mouse) allows the global intercept (β0) of the regression line to vary for each mouse +/- uj. This strategy accounts for  48 correlated performance over time and allows unbiased estimation of the population parameters β0 …βp. The model for accelerating rotorod performance, for example, is: Rotorodij = β0 + β1Ageij + β2(YAC128 Genotypeij) + β3(Caspase-2 Genotypeij) + β4(Interactionij) + uj +eij With the estimated values of the parameters: β0 = 283.14, β1 = -9.75, β2 = -60.26, β3 = 10.29, β4 = 41.55 and uj = list of 119 values, one per mouse. Software T-tests, one- and two-way ANOVA’s and curve fitting were performed using Prism 4.0 software, and factorial ANOVA’s and linear mixed effects models were done using the R language and environment including the “nlme” linear mixed effects model package (Team, 2009). Multivariate graphs and density distribution plots were done using the “lattice” package in R.  49  3. Novel Tool Development The success of any pre-clinical trial depends critically on quantitative, disease-relevant, endpoints. Establishing and validating a large array of endpoints not only interrogates target biology comprehensively, but also gives the greatest insight into the efficacy of an intervention. In the context of the YAC128 mouse some treatments, such as ethylEPA (Van Raamsdonk et al., 2005d), provide symptomatic benefit without markedly improving pathological measures. Other compounds, such as cystamine (Van Raamsdonk et al., 2005a), do not affect behavioral signs and symptoms but are neuroprotective. This suggests that multiple pathways of pathology are operating to result in the phenotypes in the YAC128 model, and that measuring the broadest array of phenotypes is crucial to measuring the effect of a proposed therapy on each of these axes. Model expansion work in the current thesis focused on two major areas; first, the expansion of neuropathological analyses in the YAC128 mice using MRI. Secondly, plasma sterol measurements as a biomarker of huntingtin function were established in the YAC128 mice and compared to human patients.  3.1. MRI Techniques in a pre-clinical trial setting Non-invasive imaging of neuropathology in human HD patients shows great promise as a biomarker for drug development. A number of studies using diffusion tensor imaging (DTI), functional magnetic resonance imaging (fMRI) and positron emission tomography (PET) have demonstrated differences between HD patients and controls. It is structural magnetic resonance imaging (MRI), however, that has made the most progress towards adoption as a biomarker in human HD clinical trials (Hobbs et al., 2009c; Hobbs et al., 2010). The use of common endpoints in preclinical mouse work and HD human trials could accelerate the translation of preclinical work done in mice to human trails.  50 MRI furthermore has a number of advantages to traditional histological techniques such as stereology. MRI obtains images of the entire central nervous system, while histology is limited to pre-defined regions of interest. MRI can be conducted in either live animals or, as here, with fixed post-mortem tissue in situ in the skull, minimizing artifactual deformations of the brain caused by tissue processing. This native geometry allows the ascertainment of ventricular volume, which is challenging in sectioned tissues. Finally, the digital nature of MRI data allows sophisticated image processing and analysis, which is not limited to pre-defined phenotypes of interest. We therefore undertook longitudinal MRI of the YAC128 mice at 1, 3, 8 and 12 months of age. This span of ages covers the entire development of phenotypic features of HD, from the development and maturation of the CNS to middle age in the mouse. Unambiguous validation of these techniques, coupled with an understanding of their natural history will empower cross-sectional analyses of the casp2-/- x YAC128 mouse trial. 3.1.1. MRI of the YAC128 mice 3.1.1.1.  Whole brain  The first step in analyzing the natural history of neuropathology in the YAC128 mice is to establish the tissue composition and size of the entire brain. Previous global analyses have relied upon tissue weight, an accurate but limited measure (Slow et al., 2003a). Plots of total brain volume, determined from MRI images, show changes during aging, with subtle but significant decreases in the YAC128 mice (Figure 3.1). At one month of age, the YAC128 mice have normal brain volumes, suggesting the declines are progressive between 1 and 3 months of age, a time when mouse brains continue to grow (Maheswaran et al., 2009).  51  Brain Volume WT YAC128  *  500 450  350  ANOVA Summary Factor p-value Age < 0.0001 Genotype  0.0076  300  Interaction  0.20  12  8  3  400  1  Brain Volume (mm )  550  Age (Months)  Figure 3.1 - Longitudinal total brain volume changes with age and is reduced in the YAC128 mice. Total brain volume is dynamic during aging from 1-12 months of age, and is reduced in the YAC128 mice (Two-way ANOVA: Age Group: F(3,60)=56.13, p < 0.0001; Genotype: F(1,60)=7.63, p = 0.0076; Interaction: F(3,60)=1.58, p = 0.20). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 1 month = 7 WT mice and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  3.1.1.2.  Segmentation  High resolution MRI facilitates the construction of atlases, or average brain volumes for a set of mice (Chen et al., 2006; Dorr et al., 2008; Kovacević et al., 2005). These atlases filter out individual variability and improve resolution of neuroanatomical structures. Registering the scan of each mouse to a previously defined high-resolution anatomical atlas; it is possible to obtain volumetric data on a large number of individual structures for each mouse (Dorr et al., 2008). Novel atlases were created for YAC128 and WT mice at 1, 3, 8 and 12 months of age, as described (Chen et al., 2006; Kovacević et al., 2005), facilitating the development of a cross-sectional natural history of neuroanatomy in the YAC128 mice. Many of the CNS structures thus measured are comprised of predominantly either gray or white matter. Grouping structures into this type of scheme (Table 3.1) allows the analysis of the effect of YAC128 transgene expression on different brain components. This type of analysis is an important point of comparison  52 to human studies, which have reported alterations in white/gray matter ratios (Rosas et al., 2002; Rosas et al., 2003; Rosas et al., 2008) and vetntricular sizes (Dunlap, 1927; Hobbs et al., 2010; Rosas et al., 2003). Table 3.1 - Grouping of central structures into gray, white and ventricular categories.  Gray Matter Fundus of Striatum Medulla Striatum Globus Pallidus Pons Thalamus Olfactory Bulbs Corticalspinal Tract Pyramids Superior Olivary Complex Basal Forebrain Cerebral Cortex - Frontal Lobe Nucleus Accumbens Midbrain Cerebellar Cortex Stratum Granulosum of Hippocampus Amygdala Collicululs Superior Hypothalamus Dentate Gyurs of Hippocampus Subependymal Zone/Rhinocele Olfactory Tubercle Cuneate Nucleus Cerebral Cortex - Parito/Temporal Lobe Periaqueductal Grey Pre Para Subiculum Hippocampus Inferior Olivary Complex Mammillary Bodies Pontine Nucleus Cerebral Cortex - Entorhinal Cerebral Cortex - Occipital Lobe  White Matter Fasciculus retroflexus Facial Nerve Cranial Nerve 7 Anterior Commissure pars anterior Cerebellar Peduncle Superior Lateral Olfactory Tract Fimbria Ventral Tegmental Decussation Optic Tract Fornix Anterior Commissure pars posterior Cerebellar Peduncle Inferior Posterior Commissure Internal Capsule Medial Lemniscus Stria Terminalis Habenular Commissure Colliculus Inferior Mammillothalamic Tract Cerebral Peduncle Corpus Callosum Stria Medullaris Bed Nucleus of Stria Terminalis Arbor Vita of Cerebellum Cerebellar Peduncle Middle  Ventricles Lateral Ventricle Cerebral Aqueduct Fourth Ventricle Third Ventricle  In the human brain, gray matter volume peaks in late childhood and declines during aging (Bartzokis et al., 2001; Giedd et al., 1999). In the mouse brain, the total volume of gray and white matter structures progressively increases to 8 months of age, and then  53 declines, in agreement with total brain volume (compare figures Figure 3.2 and Figure 3.1). YAC128 mice have progressively reduced white and gray matter volumes, relative to WT mice.  Total Gray Matter Volume WT YAC128  *  400 350  ANOVA Summary Factor p-value Age < 0.0001  300  Genotype  0.012  Interaction  0.22  12  8  3  250  1  Gray Matter Volume(mm )  450  Age (Months)  90  WT YAC128  80  **  70 60  ANOVA Summary Factor p-value Age < 0.0001  50  Genotype  0.00098  Interaction  0.14  12  8  3  40  1  White Matter Volume(mm )  Total White Matter Volume  Age (Months)  Figure 3.2 - Longitudinal changes in gray and white matter volumes in the aging brain. Top – the volume comprised of primarily gray matter structures increases with age from 1-8 months and then decreases, and is reduced in the YAC128 mice (two-way ANOVA Age: F(3,60)=49.40, p < 0.0001; Genotype F(1,60)=6.77, p =0.012;  54 Interaction F(3,60)=1.51, p = 0.22). Bottom – the volume comprised of primarily white matter structures increases with age from 1-8 months and then decreases, and is reduced in the YAC128 mice (two-way ANOVA Age: F(3,60)=106.51, p < 0.0001; Genotype F(1,60)=12.03, p =0.00098; Interaction F(3,60)=1.87, p = 0.14). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  Normalization of gray and white matter structures to total brain volume provides an estimate of the proportion of the brain comprised by these structures. During aging, proportional gray matter volume in the mouse brain decreases, while white matter volume increases. While both absolute gray and white matter structure volumes are mildly decreased in the YAC128 mice (Figure 3.2), the relative volumes show different trends. The fraction of the brain comprised of gray matter is increased in the YAC128 mice, while the fraction comprised of white matter is decreased (Figure 3.3).  55  Proportional Gray Matter Volume Gray Matter (Fold Brain)  0.90  WT YAC128  0.88 0.86  ANOVA Summary Factor p-value Age < 0.0001  0.84  0.028  Interaction  0.24  12  8  3  1  0.82  Genotype  Age (Months)  Proportional White Matter Volume White Matter (Fold Brain)  0.18  WT YAC128  0.17 0.16 0.15  ANOVA Summary Factor p-value Age < 0.0001  0.14  0.011  Interaction  0.16  12  8  3  1  0.13  Genotype  Age (Months)  Figure 3.3 – Normalized white and gray matter proportions in the WT and YAC128 mice. Top – the proportional volume comprised of primarily gray matter structures decreases with aging and is reduced in the YAC128 mice (two-way ANOVA Age: F(3,60)=216.96, p < 0.0001; Genotype F(1,60)=5.10, p =0.028; Interaction F(3,60)=1.44, p = 0.24). Bottom – the proportional volume comprised of primarily white matter structures increases with aging and is reduced in YAC128 mice (two-way ANOVA Age: F(3,60)=198.84, p < 0.0001; Genotype F(1,60)=6.97, p =0.011; Interaction F(3,60)=1.76, p = 0.16). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 1 month = 7 WT mice  56 and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  Based on the proportional white and gray matter volumes, the ratio of white to gray matter structures increases during aging. YAC128 mice show mild reductions in this ratio, particularly at 12 months of age (Figure 3.4, two-way ANOVA Age: F(1,60)=201.07, p < 0.0001; Genotype F(1,60)=2.76, p =0.10; Interaction F(1,60)=1.75, p = 0.17). Cross-sectional analysis of the white/gray ratio at 12 months of age suggests that YAC128 mice have late-onset, progressively reduced white/gray matter volumes (unpaired two-tailed t-test t(13.9)=2.55, p = 0.023). This is in agreement with data from human HD patients, who display widespread preferential white matter loss (Rosas et al., 2002; Rosas et al., 2003; Rosas et al., 2008).  White Matter over Gray Matter WT YAC128  0.20 0.18  ANOVA Summary Factor p-value Age < 0.0001  0.16  Genotype  0.012  Interaction  0.17  12  8  3  0.14 1  White Matter / Gray Matter  0.22  Age (Months)  Figure 3.4 - The white/gray matter ratio increases with aging and is reduced in YAC128 mice. The ratio of white matter structures to gray matter structures increases with aging, and is reduced in YAC128 mice (two-way ANOVA Age: F(3.60)=199.77, p < 0.0001; Genotype F(1,60)=6.68, p =0.012; Interaction F(3,60)=1.75, p = 0.17). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  Ventricular volume is increased in HD patients, accompanying atrophy of the surrounding tissue (Dunlap, 1927; Hobbs et al., 2010; Rosas et al., 2003). The  57 ventricular contribution to brain volume increases between 1-12 months of age in mice (Figure 3.5). This increase in relative ventricular volume is progressively potentiated in the YAC128 mice (Figure 3.5).  Raw Ventricular Volume Ventricular Volume (mm )  6  WT YAC128  5 ANOVA Summary Factor p-value Age < 0.0001  4  0.28  Interaction  0.13  12  8  3  1  3  Genotype  Age (Months)  0.013 0.012  *  WT YAC128  *  0.011 0.010 ANOVA Summary Factor p-value Age < 0.0001  0.009 0.008  Genotype  0.0015  Interaction  0.20  12  8  3  0.007 1  Ventricular Volume (Fold Brain  Normalized Ventricular Volume  Age (Months)  Figure 3.5 – Progressive increases in the absolute and proportional ventricular volume in the YAC128 mice. Top – the volume comprised of ventricles increases with age from 1-8 months (two-way ANOVA Age: F(3,60)=93.53, p < 0.0001; Genotype F(1,60)=1.14, p =0.28; Interaction F(3,60)=1.96, p = 0.13). Bottom – the proportional volume  58 comprised of ventricles increases with age from 1-8 months, and the YAC128 mice have progressively increased relative ventricular volumes (two-way ANOVA Age: F(3,60)=57.59, p < 0.0001; Genotype F(1,60)=11.01, p =0.0015; Interaction F(3,60)=1.61, p = 0.20). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 1 month = 7 WT mice and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  3.1.1.3.  Specific structures  While global patterns of alteration are present in the HD brain, including loss of white matter and increasing ventricular volume (Figure 3.4, Figure 3.5), HD is a disease with a specific neuropathological signature. Localized loss of volume in the basal ganglia, particularly the striatum, has long been noted (Dunlap, 1927; Rosas et al., 2003; Vonsattel et al., 1985). Stereological investigations have established that YAC128 mice have specific atrophy and cell loss in the striatum, globus pallidus and cortex (Slow et al., 2003a; van Raamsdonk et al., 2005). The loss is not global, however, the hippocampus is relatively spared and the cerebellum is spared or slightly increased in volume in cross sectional analysis of YAC128 mice at 12 months of age (van Raamsdonk et al., 2005). These findings establish a benchmark for validation of MRI techniques as a neuropathological endpoint. In agreement with previous data, striatal volume is progressively decreased in YAC128 mice, in both absolute and relative terms (Figure 3.6). However, using MRI, losses of striatal volume in the YAC128 mice are detectable as early as 3 months of age, 6 months earlier than previously described.  59  Raw Striatal Volume  Striatal Volume (mm )  25  WT YAC128  * ***  20  * ANOVA Summary Factor p-value Age < 0.0001  15  < 0.0001  Interaction  0.066  12  8  3  1  10  Genotype  Age (Months)  0.050  WT YAC128  0.045 *  0.040  ANOVA Summary Factor p-value Age < 0.0001  0.035  Genotype  < 0.0001  Interaction  0.6  12  8  3  0.030 1  Striatal Volume (Fold Brain)  Normalized Striatal Volume  Age (Months)  Figure 3.6 - The volume of the striatum is dynamic and reduced in the YAC128 mice. Top – Striatal volume is dynamic in aging mice, and is reduced in the YAC128 mice (two-way ANOVA Age: F(3,60)=95.86, p < 0.0001; Genotype F(1,60)=32.26, p < 0.0001; Interaction F(3,60)=2.52, p = 0.066). Bottom – the proportional volume of the striatum is also dynamic and in the YAC128 mice (two-way ANOVA Age: F(3,60)=24.02, p < 0.0001; Genotype F(1,60)=18.86, p < 0.0001; Interaction F(3,60)=0.62, p = 0.60). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 1 month = 7 WT mice and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  60 The volume of the globus pallidus (GP), the output module of the basal ganglia, is significantly reduced in the YAC128 mice at 12 months of age (Figure 3.7, (van Raamsdonk et al., 2005)). However, in contrast to the progressive nature of striatal volume loss from 1-12 months, the GP shows basal reductions of volume in the YAC128 mice (Figure 3.7). These data suggest that even within the basal ganglia volume loss in is not uniform – the GP is basally reduced in volume while volume loss in the striatum is progressive. This suggests that these structures may be subject to different mechanisms of pathological tissue loss.  61  Raw GP Volume  GP Volume (mm )  4  WT YAC128 ***  3  ANOVA Summary Factor p-value Age < 0.0001  2  < 0.0001  Interaction  0.063  12  8  3  1  1  Genotype  Age (Months)  Normalized Globus Pallidus Volume GP Volume (Fold Brain)  0.008  WT YAC128  0.007 *  0.006 *  ANOVA Summary Factor p-value Age < 0.0001  0.005  < 0.0001  Interaction  0.031  12  8  3  1  0.004  Genotype  Age (Months)  Figure 3.7 - Basal changes in globus pallidus (GP) volume in the YAC128 mice. Top – Globus pallidus volume is reduced in YAC128 mice (two-way ANOVA Age: F(3,60)=246.97, p < 0.0001; Genotype F(1,60)=27.49, p < 0.0001; Interaction F(3,60)=2.57, p = 0.063). Bottom – the proportional volume of the GP is reduced in YAC128 mice (twoway ANOVA Age: F(3,60)=216.93, p < 0.0001; Genotype F(1,60)=18.64, p < 0.0001; Interaction F(3,60)=3.16, p = 0.031). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/greater than 1.5 * IQR from median). N, 1 month = 7 WT mice and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  62 Cortical volume is decreased in HD - a wide range of imaging studies have described cortical wasting (Aylward et al., 1998; Rosas et al., 2002; Rosas et al., 2003; Rosas et al., 2005; Rosas et al., 2008), as have stereological investigations in the YAC128 mice (van Raamsdonk et al., 2005). However, wasting may not be uniform across time. A single study of presymptomatic human mutation carriers has described increased cortical gray matter volumes (Paulsen et al., 2006). Our own investigations have established significant focal thickenings of the cortex of 8 months old YAC128 mice, particularly in the sensorimotor cortices (Lerch et al., 2008a; Lerch et al., 2008b). Longitudinal analysis demonstrates that while basal cortical volume is normal in the YAC128 mice, between 3-8 months of age the YAC128 mice have increased cortical volumes, which return to baseline (or lower) by 12 months (Figure 3.8). This transient thickening has clear parallels to the human condition, where transient increase in cortical volume precedes loss (Aylward et al., 1998; Paulsen et al., 2006).  63  55  WT YAC128  50 45 40  ANOVA Summary Factor p-value Age < 0.0001  35  Genotype  0.39  Interaction  0.36  12  8  3  30  1  Frontal Lobe Volume (mm )  Raw Frontal Lobe Volume  Age (Months)  0.11  WT YAC128  0.10 0.09  ANOVA Summary Factor p-value Age < 0.0001  0.08  Genotype  0.04  Interaction  0.27  12  8  3  0.07  1  Frontal Lobe Volume (Fold Brain)  Normalized Frontal Lobe Volume  Age (Months)  Figure 3.8 - Transiently increased cortical volume in the frontal lobe of the YAC128 mice. Top – Raw frontal lobe volume is dynamic across time, but is normal in YAC128 mice (two-way ANOVA Age: F(3,60)=46.94, p < 0.0001; Genotype F(1,60)=0.75, p = 0.39; Interaction F(3,60)=1.09, p = 0.36). Bottom – the proportional volume of the frontal lobe decreases over time, and is transiently increased in the YAC128 mice (two-way ANOVA Age: F(3,60)=52.26, p < 0.0001; Genotype F(1,60)=4.28, p = 0.04; Interaction F(3,60)=1.3, p = 0.27). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  64 The hippocampus is relatively spared in human HD (Rosas et al., 2003), and in the YAC128 mice at 12 months of age (van Raamsdonk et al., 2005). Longitudinal data suggests that the YAC128 mice have a transiently decreased hippocampal volume, which is normalized by 12 months of age. When normalized to brain volume, however, hippocampal volume is nearly identical in WT and YAC128 mice (Figure 3.9).  65  24  WT YAC128  22 20 18  ANOVA Summary Factor p-value Age < 0.0001  16  Genotype  0.02  Interaction  0.22  12  8  3  14 1  Hippocampus Volume (mm )  Raw Hippocampal Volume  Age (Months)  0.050  WT YAC128  0.045 ANOVA Summary Factor p-value Age 0.14  0.040  Genotype  0.64  Interaction  0.12  12  8  3  0.035 1  Hippocampal Volume (Fold Brain)  Normalized Hippocampal Volume  Age (Months)  Figure 3.9 - Normal relative hippocampal volume in the YAC128 mice. Top – Raw hippocampal volume is decreased in YAC128 mice (two-way ANOVA Age: F(3,60)=48.33, p < 0.0001; Genotype F(1,60)=5.04, p = 0.02; Interaction F(3,60)=1.51, p = 0.22). Bottom – the proportional volume of the hippocampus is normal in YAC128 mice, and does not vary over time (two-way ANOVA Age: F(3,60)=1.86, p = 0.14; Genotype F(1,60)=0.22, p = 0.64; Interaction F(3,60)=2.0, p = 0.12). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 1 month = 7 WT mice and 8 YAC128 mice. N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  66 The cerebellum is also relatively spared in HD (Dunlap, 1927; Rosas et al., 2003) and is normal or slightly increased in volume in 12-month-old YAC128 mice (van Raamsdonk et al., 2005). Because of it’s highly ramified and elaborate structure, the cerebellum is particularly difficult to measure using stereological techniques. The present longitudinal data are thus the first global assessment of cerebellar volume in the YAC128 mice. Raw cerebellar volumes are normal in the YAC128 mice, with a slight trend towards increase by 12 months of age (Figure 3.10, Top). However, the proportion of brain volume comprised of cerebellar structures is progressively increased in the YAC128 mice (Figure 3.10, Middle). This preservation of the cerebellum at wasting of the cerebral cortex has long been noted in post-mortem anatomical studies, and can be expressed as a ratio of the cerebral to cerebellar weight (Dunlap, 1927). The equivalent volumetric analysis shows a trend towards progressive decrease in the cerebral:cerebellar ratio in YAC128 mice (Figure 3.10, Bottom).  67  Raw Cerebellar Volume Cerebellar Volume (mm )  80  WT YAC128  70  ANOVA Summary Factor p-value Age < 0.0001  60 50  0.0007  Interaction  0.12  12  8  3  1  40  Genotype  Age (Months)  0.16 0.15 0.14  WT YAC128  **  *  0.13  ANOVA Summary Factor p-value Age 0.0013  0.12  Genotype  0.00048  Interaction  0.041  12  8  3  0.11 1  Cerebellar Volume (Fold Brain)  Normalized Cerebellar Volume  Age (Months)  2.6  WT YAC128  2.4 2.2  1.8  ANOVA Summary Factor p-value Age < 0.0001 Genotype  0.090  1.6  Interaction  0.37  Age (Months)  12  8  3  2.0  1  Cerebral Cortex / Cerebellum  Cerebral Cortex /Cerebellum Ratio  68 Figure 3.10 - Progressively increased cerebellar volume in aging YAC128 mice. Top – Raw cerebellar volume is normal in YAC128 mice (two-way ANOVA Age: F(3,60)=22.84, p < 0.0001; Genotype F(1,60)=0.0007, p = 0.98; Interaction F(3,60)=2.02, p = 0.12). Middle – the proportional volume of the cerebellum is progressively increased in YAC128 mice (two-way ANOVA Age: F(3,60)=5.96, p = 0.0013; Genotype F(1,60)=13.65, p = 0.00048; Interaction F(3,60)=2.92, p = 0.041). Bottom - The ratio between cerebral cortex and cerebellum volumes is decreased in the YAC128 mice (two-way ANOVA Age: F(3,60)=31.65, p < 0.0001; Genotype F(1,60)=2.97, p = 0.090; Interaction F(3,60)=1.08, p = 0.37). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, + = mean, dots = “outliers” (+/- greater than 1.5 * IQR from median). N, 3 month = 9 WT mice and 9 YAC128 mice. N, 8 month = 9 WT mice and 9 YAC128 mice. N, 12 month = 9 WT mice and 8 YAC128 mice.  These data demonstrate that the development of neuropathology in the YAC128 mice is dynamic (Table 3.2). Each structure has a distinct trajectory during development and disease progression, which is affected in unique ways by mutant huntingtin expression. Realistic appraisal of neuropathological changes thus requires a broad and deep investigation into structure volumes. Table 3.2 - Diversity of neuropathological alterations in the YAC128 mice.  Direction of change  Progressive?  Transient?  Tissue  Decreased relative volume  Yes  No  Striatum  Decreased relative volume  No  No  Globus Pallidus  Increased relative volume  Yes  No  Cerebellum  Increased relative volume  No  Yes  Frontal Cortex  Unchanged relative volume  No  No  Hippocampus  3.1.2. Comparison of MRI in YAC128 mice and human HD patients A crucial question about MRI in the preclinical setting is whether these studies correlate with data collected in human HD patients. A number of studies examining MRI in presymptomatic and symptomatic HD mutation carriers exist, allowing relatively direct comparisons to be made. Because of its unique vulnerability (Dunlap, 1927; Vonsattel et al., 1985), a number of MRI studies in human patients have focused on the striatum. Cross-sectional (Jernigan et al., 1991; Rosas et al., 2003) and longitudinal (Aylward et al., 1997; Hobbs et al., 2009a; Paulsen et al., 2008) analyses have demonstrated significant, specific, loss of volume in this structure in HD.  69 Striatal volume degeneration appears to begin as much as 15-20 years before unequivocal motor onset (Paulsen et al., 2008). Striatal volume loss is more severe in human HD patients than YAC128 mice (Table 3.3). However, the inherent variability of human trials dictates that the effect size of striatal volume loss in pre-symptomatic to early HD is comparable to 3-12 month old YAC128 mice (Table 3.3). The R6/2 mouse expresses exon-1 of huntingtin with a large CAG expansion, which results in the rapid onset of severe HD symptoms and early death (Davies et al., 1997). Published MRI data suggests these mice have striatal volume loss comparable to human patients by 3 months of age, with a very clear separation of transgenic and wild type animals (Zhang et al., 2009)(Table 3.3). However, stereological investigations demonstrate that the R6/2 mice have widespread, non-selective neuropathology (van Raamsdonk et al., 2005). Longitudinal in vivo MRI validates this lack of specificity – while the R6/2 mice have progressively reduced cortical and striatal volume, they also have constitutive increases in ventricular volume and reduced hippocampal and cerebellar volumes (Zhang et al., 2009). These data suggest that there is an inverse relationship between severity and specificity of disease symptoms in mice. Table 3.3 - Comparison of YAC128 mouse and human HD patient striatal MRI results. * Cohen’s D = (Control Mean – HD Mean) / Pooled Standard Deviation. ** Estimated volume at onset derived from graph.  Study  Population  Volume Decrease 13%  Effect size Cohen’s d* 0.88  Human, (Paulsen et al., 2006)  Presymptomatic  Human, (Hobbs et al., 2010)  At motor onset  1.9**  3 Months  24% (Caudate) 33% (Caudate) 40% (Putamen) 30%  Human, (Rosas et al., 2003)  Symptomatic  Human, (Rosas et al., 2003)  Symptomatic  R6/2 Mice, (Zhang et al., 2009) YAC128 Mice  1 Month  1.5%  0.48  YAC128 Mice  3 Months  3.2%  0.93  YAC128 Mice  8 Months  3.2%  0.88  YAC128 Mice  12 Months  4.4%  1.39  2.0 3.6 9.5  70 3.1.3. Comparison of MRI and stereological techniques There are several clear benefits to using MRI techniques to observe changes in transgenic mice. However, these techniques are only useful in so much as they replicate previously validated neuropathological endpoints. An important question in the use of imaging as a biomarker is how well volume loss measured by MRI translates to actual tissue atrophy as opposed to secondary or non-specific effects. These questions cannot be addressed in human patients, and so need to be rigorously studied in animal models. The simplest neuropathological feature of HD is loss of brain weight. This symptom has been universally observed in post-mortem tissue samples (Dunlap, 1927). Conceptually, brain weight is used as a proxy for total brain tissue at time of death. Total brain volume, as determined by MRI, could thus convey the same information. Using sample data from 12 month old mice, brain volume as determined by MRI and total brain weight are highly correlated (Figure 3.11, r2=0.70, F(1,15)=35.19, p < 0.0001). Brain volume is even more tightly correlated with forebrain weight; an endpoint widely used in the YAC128 mice (Slow et al., 2003a; Van Raamsdonk et al., 2005a; Van Raamsdonk et al., 2005d). This suggests that post-mortem brain volume is a useful biomarker for total brain weight.  Figure 3.11 - Brain weight and total brain volume, as determined by MRI, are highly correlated. Left - Postmortem brain weight is strongly correlated with brain volume, as determined by MRI (r2=0.70, F(1,15)=35.19, p < 0.0001). Right - Post-mortem forebrain weight is strongly correlated with brain volume, as determined by MRI  71 (r2=0.86, F(1,15)=95.49, p < 0.0001) Solid line = linear regression line. Dashed line = 95% confidence interval of regression.  Brain weight and total volume are coarse measures of neuropathology. HD results in a very specific pattern of neuropathological tissue loss in both human patients and accurate mouse models (Dunlap, 1927; Lerch et al., 2008b; Rosas et al., 2003; van Raamsdonk et al., 2005). Thus, direct comparison of measurements of key tissues is crucial for the validation of MRI as a tool. The striatum is the most profoundly affected tissue in HD, as well as in the YAC128 mouse (Slow et al., 2003a), making it the ideal tissue on which to focus. In order to examine the power of each technique, a time point (8 months) was chosen before previously observed striatal volume decreases (9 months). Striatal volumes derived from automated segmentation of MRI atlases were compared to volumes derived from stereology using the same brain. While both techniques show a trend towards decreased striatal volume at this time point (Figure 3.12 A and B), the effect was significant for the MRI data (one-tailed unpaired t-test t(13)=1.85, p = 0.043) and not for stereological data (one-tailed unpaired t-test t(13)=1.67, p = 0.059), due to reduced variability in the MRI data. This improvement was subtle, as revealed by sensitivity/specificity analysis (Figure 3.12 C).  Figure 3.12 - Direct comparison of MRI and stereology using 8-month-old YAC128 striata. A. Striatal volume, as determined by MRI, is reduced by 4%, an effect which is significant (one-tailed unpaired t-test t(13)=1.85, p = 0.043). B. Striatal volume, as determined by stereological techniques, is reduced by 9%, an effect which is not significant (one-tailed unpaired t-test t(13)=1.67, p = 0.059). Receiver-operator curve (ROC) comparison of MRI and  72 stereology for measuring striatal volumes. MRI area under curve = 0.75, Stereology area under curve = 0.71. N = 7 WT mice and 8 YAC128 mice. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  Thus, given a small difference to quantify, MRI techniques are slightly more sensitive than stereological ones (Figure 3.12 C). Most importantly, very similar trends are observed with both techniques, demonstrating that imaging is a valid biomarker for post-mortem histological analysis of striatal volume. In light of the unexpectedly early detection of striatal volume loss observed with MRI (page 58), we examined younger brains using stereological techniques. At 1 month of age the YAC128 mice have normal striatal volumes (WT = 10.83 mm3 +/- 0.40; YAC128 = 10.91mm3 +/-0.21; two-tailed unpaired t-test: t(14)=0.20, p = 0.85; Figure 3.13, panel A). By 3 months of age, the YAC128 mice have significant loss of striatal volume (WT = 13.65 mm3 +/- 0.27; YAC128 = 12.92mm3+/-0.23; two-tailed unpaired t-test: t(59)=2.05, p = 0.045; Figure 3.13, panel B). This closely replicates the changes observed with MRI, and confirms that YAC128 mice have earlier striatal volume loss than was previously appreciated (Slow et al., 2003a). The difference in absolute striatal volume measured by MRI and stereology is due to the omission of the extreme rostral and caudal aspects of the striatum during stereological measurements in order to follow anatomical landmarks.  Figure 3.13 - Stereology confirms loss of striatal volume in YAC128 mice between 1-3 months of age. A. Striatal volume does not differ between WT and YAC128 mice at 1 month of age (WT = 10.83 mm3 +/- 0.40; YAC128 = 10.91mm3 +/-0.21; two-tailed unpaired t-test: t(14)=0.20, p = 0.85). B. Striatal volume is significantly lower in  73 YAC128 mice at 3 months of age (WT = 13.65 mm3 +/- 0.27; YAC128 = 12.92mm3+/-0.23; two-tailed unpaired t-test: t(59)=2.05, p = 0.045). N = 7 WT and 9 YAC128 at 1 month of age and 32 WT mice and 29 YAC128 mice at 3 months of age. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  3.2. Plasma cholesterol pathology Biomarkers are objectively identifiable indications of disease progression that enable dynamic tracking of disease processes. Generally, biomarkers of neurological disease are based on parameters derived from imaging, behavioral or peripherally accessible biological samples (O'Keeffe et al., 2009). Clinically identifiable symptoms of HD may be poorly correlated with underlying disease progression – as in the case of neuropsychiatric symptoms, whose incidence does not correlate with chorea or dementia (Paulsen et al., 2001). Biomarkers unequivocally tied to pathological mechanisms would enable more powerful clinical trials. Faithful mouse models of HD facilitate the rapid investigation of a large number of potential biomarkers without the practical and ethical constraints of repeated measurements in human patients. Ideally, target-relevant biomarker investigations are a useful part of any interventional trial in HD mice. Casp2 has been described as a “lipid sensor”, under the regulatory control of the transcription factor sterol-response element binding protein 2 (SREBP2 (Logette et al., 2005)). In human cells in culture, casp2 expression negatively regulates lipogenic gene expression downstream of nuclear translocation of active SREBP2 (Logette et al., 2005). Conversely, expression of mutant huntingtin reduces the expression of a large number of cholesterol biosynthetic genes (Sipione et al., 2002), leading to reduced cholesterol in neurons and brain tissue from HD transgenic mice and human patients (Valenza et al., 2005). The mechanism underlying this deficit is impaired nuclear trafficking of active SREPB2 (Valenza et al., 2005). Because both mutant huntingtin and casp2 are proposed to impinge on cholesterol biosynthesis, we examined the use of plasma-based cholesterol measurements as a biomarker in the YAC128 mouse model of HD. Plasma cholesterol is readily available from both model mice and human patients, and thus may be a target-relevant marker of disease biology.  74 3.2.1. Mouse plasma Based on the reduction of cholesterol synthesis in the brain of HD model mice and patients (Valenza et al., 2005), we measured plasma cholesterol in young and old YAC128 mice. As additional controls, we measured plasma cholesterol in YAC18 mice, which overexpress wild type human huntingtin at equivalent levels to YAC128 mice (Hodgson et al., 1999). This control is required to focus specifically on the effects of huntingtin mutation, rather than huntingtin expression levels. Huntingtin is highly expressed in the liver (Hoogeveen et al., 1993; Sharp et al., 1995), and our motivating hypothesis was that if a mutant huntingtin impairs SREBP translocation in the brain (Valenza et al., 2005), it may also do so in the periphery. Plasma cholesterol measurements in fasted animals are an excellent biomarker for hepatic cholesterol synthesis, because the bulk of non-dietary cholesterol derives from this source. YAC128, littermate WT and YAC18 mice have equivalent fasted cholesterol at 2 months of age (Figure 3.14, panel A), a time of minimal neuropathological (page 70) or clinical symptom burden (Slow et al., 2003a; Van Raamsdonk et al., 2005e). By 11 months of age, after the development of pathology in the YAC128 mice, plasma cholesterol in the the YAC128 is significantly reduced (Figure 3.14, panel B). Importantly, the YAC18 mice have significantly higher plasma cholesterol than WT mice (Figure 3.14, panel B), supporting the idea that regulation of cholesterol biosynthesis is a function of wild type huntingtin, and that reductions observed in the YAC128 mice are due specifically to CAG expansion.  75  Figure 3.14 – Plasma cholesterol is progressively altered in YAC18 and YAC128 mice. A. Plasma cholesterol levels do not differ between genotypes at 2 months of age (one-way ANOVA F(2,22)=0.087, p=0.92). N = 7 YAC128, 11 WT and 5 YAC18 mice. B. By 11 months of age the YAC128 mice show a trend to decreased levels, relative to WT, and YAC18 mice show an increase (one-way ANOVA F(2,33)=13.34, p < 0.0001). N = 10 YAC128, 17 WT and 7 YAC18 mice. *** Indicates p < 0.0001 Newman-Keuls multiple comparison test. Horizontal bars indicate quartiles.  As a validation of the observed plasma cholesterol measurements, we turned to gaschromatography/mass-spectrometry (GC-MS). GC-MS techniques have been successfully used to measure small amounts of a diverse array of sterols in biological samples(Bretillon et al., 2000; Lütjohann et al., 1995; Yu et al., 2002). Careful quantification of sterol species can provide insight into organismal metabolism. Levels of cholestanol and plant sterols, for example, are used as biomarkers of cholesterol absorption from the diet (Miettinen, 1989; Miettinen et al., 1998; Nissinen et al., 2008; Silbernagel et al., 2008). Lathosterol and other precursors of cholesterol serve as biomarkers for cholesterol biosynthesis, which occurs primarily in the liver (Nissinen et al., 2008). GC-MS analysis of plasma samples validates the reduction in YAC128 plasma cholesterol, and the increase in YAC18 plasma cholesterol (Figure 3.15, panel A). Plasma levels of lanosterol, a key intermediate of the cholesterol biosynthetic pathway, show the same pattern as cholesterol levels – mildly reduced in the YAC128 mice and increased in the YAC18 mice (Figure 3.15, panel B).  76  Figure 3.15 - Plasma cholesterol and lanosterol are reduced in the YAC128 and increased in the YAC18 mice at 12 months of age. A. Cholesterol levels are decreased in the plasma of YAC128 mice, relative to WT mice and YAC18 mice (YAC128 = 150mg/dl +/- 4.4, WT = 174.1mg/dl +/- 6.45, YAC18 = 228.9mg/dl +/- 11.25; one-way ANOVA genotype: F(2,32)=26.33, p < 0.0001). B. Lanosterol levels are decreased in the plasma of YAC128 mice, relative to WT mice and YAC18 mice (YAC128 = 16.14ug/dl +/- 2.5, WT = 22.83 ug/dl +/- 2.35, YAC18 = 29.35 /dl +/4.06; one-way ANOVA genotype: F(2,32)=4.68, p = 0.017). N = 11 YAC128, 14 WT and 8 YAC18 mice. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. *, *** = p < 0.05 and p < 0.0001, respectively, in Newman-Keuls post-hoc test.  The correlation between cholesterol and lanosterol levels supports the hypothesis that YA128 mice have lower rates of hepatic cholesterol biosynthesis while the YAC18 mice have higher rates. 3.2.2. Human plasma To examine the clinical relevance of the observed plasma cholesterol alterations in the YAC128 and YAC18 mice (Figure 3.14, Figure 3.15), we analyzed sterol levels in plasma from non-fasted human controls, early- and mid- stage human HD patients. As animal plasma was collected from fasted animals, this would be the ideal control, but fasted human samples were unavailable to us, due to the sample collection protocol. HD patient plasma cholesterol and lanosterol levels were normal, when compared to controls (Figure 3.16). This suggests that either human patients do not have an alteration in their cholesterol biosynthetic rate, or that behavioral or species differences obscure these alterations.  77  Figure 3.16 - Plasma cholesterol and lanosterol are not altered in human HD. A. Plasma cholesterol levels are unchanged in human HD patient plasma (Control = 181.7mg/dl +/- 12.2; Early HD = 210.8 mg/dl +/- 14.02; Late HD = 202.2 mg/dl +/- 9.12; one-way ANOVA F(2,28)=1.55, p = 0.23). B. Plasma lanosterol levels are unchanged in human HD patient plasma (Control = 16.6 mg/dl +/- 1.3; Early HD = 18.23 mg/dl +/- 2; Late HD = 19.3 mg/dl +/2.39; one-way ANOVA F(2,28)=0.45, p = 0.64). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. * = p < 0.05 in Newman-Keuls post-hoc test.  In an attempt to discriminate between a behavioral or biological basis for the observed species differences, we examined cholestanol levels in human patient plasma. Cholestanol is a relatively low-abundance cholesterol derivative whose levels are inversely correlated with cholesterol biosynthesis (Miettinen, 1989; Nissinen et al., 2008). Because of this strong inverse correlation, cholestanol (and cholestanol/cholesterol ratios) have been used in clinical settings as surrogate markers of cholesterol absorption from the diet (Miettinen et al., 1998). Plasma cholestanol levels, and ratios to cholesterol, are increased in human HD patient plasma (Figure 3.17). This suggests that human HD patients are absorbing a greater percentage of their circulating sterols from the diet.  78  Figure 3.17 - Plasma cholestanol is increased in HD. A. Absolute cholestanol levels are increased in human HD patient plasma (Control = 0.22 mg/dl +/- 0.019; Early HD = 0.28 mg/dl +/- 0.023; Late HD = 0.34 mg/dl +/- 0.023; one-way ANOVA F(2,28)=7.99, p = 0.0020). B. Cholestanol/Cholesterol ratios are increased in human HD patient plasma (Control = 0.00125 +/- 0.00015; Early HD = 0.00133 +/- 0.00013; Late HD = 0.00168 +/- 0.00007; one-way ANOVA F(2,28)=4.06, p = 0.029). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. * = p < 0.05 in Newman-Keuls post-hoc test.  As an additional validation of the increased cholesterol absorption in human HD patients, we examined phytosterol levels. Phytosterols are a class of sterols synthesized exclusively in plants, whose plasma levels are thus necessarily derived from the diet (Miettinen, 1989). If more cholesterol is being absorbed from the diet, plasma phytosterols will increase. Three different phytosterols (sitosterol, campesterol and brassicasterol) are significantly increased in HD patient plasma (Figure 3.18 panels A, B and C, respectively). These data confirm that HD patients are absorbing a greater percentage of dietary cholesterol than controls, and may explain how HD patients are maintaining normal levels of plasma cholesterol despite hypothesized deficiencies in cholesterol biosynthesis.  79  Figure 3.18 - Plasma plant sterols are altered in HD. A. Plasma sitosterol levels are increased in human HD patient plasma (Control = 0.183 mg/dl +/- 0.023; Early HD = 0.26 mg/dl +/- 0.036; Mid HD = 0.31 mg/dl +/- 0.037; one-way ANOVA F(2,28)=3.6, p = 0.040). B. Plasma campesterol levels are increased in human HD patient plasma (Control = 0.27 mg/dl +/- 0.027; Early HD = 0.44 mg/dl +/- 0.065; Mid HD = 0.53 mg/dl +/- 0.072; one-way ANOVA F(2,28)=4.97, p = 0.015). C. Plasma brassicasterol levels are increased in human HD patient plasma (Control = 12.45 ug/dl +/- 1.74; Early HD = 29.46 ug/dl +/- 4.55; Mid HD = 29.46 ug/dl +/- 3.56; one-way ANOVA F(2,28)=4.97, p = 0.015). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. * = p < 0.05 in Newman-Keuls post-hoc test. *, ** = p < 0.05 and p < 0.01, respectively, in Newman-Keuls post-hoc test.  80  4. Characterization of Casp2-/- Mice Casp2-/- mice are grossly normal, breed normally and have only subtly altered apoptotic responses (Bergeron et al., 1998; O'Reilly et al., 2002). This generally normal development suggests that casp2 expression during development is either redundant, or dispensable. A single published study has described enhancement of aging traits in the casp2-/- mice, including reduced body fat and skeletal mass at extremely old ages (29 months, (Zhang et al., 2007). However, data in a number of paradigms is missing – there is no published information on the normal behavior or metabolism of the casp2/- mice, for example. Several paradigms of neurodegeneration have been investigated in the casp2-/- mice, including SOD1(G93A) overexpression to model familial amyotrophic lateral sclerosis and permanent focal ischemia. In both cases, casp2-/- mouse responses were found to be comparable to wild type mice, or slightly worse (Bergeron et al., 1998). SOD1(G93A) expression is extremely toxic – mean mortality is approximately 140 days (Bergeron et al., 1998), and permanent focal ischemia is also an acute stressor. Expression of mutant full-length human huntingtin, by contrast, results in a slowly progressive phenotype in mice (Slow et al., 2003a; Van Raamsdonk et al., 2005e), which requires analysis over a year of life. This suggests that analysis of longitudinal phenotypes of interest requires careful attention to underlying phenotypes in the casp2-/- mice. A major goal of the current study is to understand the biological implications of absence of casp2 during the first year of life, in order to empower longitudinal Huntington Disease studies.  4.1. Cellular phenotypes 4.1.1. Verification of knockdown As a preliminary step, we investigated the expression of casp2 in mice genotyped as casp2-/- using described methods (O'Reilly et al., 2002). Using embryonic (E16.5)  81 cortex, because of its high expression, we analyzed casp2 protein levels in pups genotyped as casp2-/- and casp2+/+. Using a well-characterized specific monoclonal anti-casp2 antibody (O'Reilly et al., 2002), we find that casp2-/- embryos do not express casp2, while casp2+/+ littermates show strong expression (Figure 4.1).  Figure 4.1 - Absent casp2 protein expression in casp2-/- genotyped embryos. Cortices from E16.5 embryos resulting from casp2+/- x casp2+/- timed pregnancies were examined by western blot after being genotyped by PCR. Mice predicted to lack casp2 by genotype were verified to lack the predominant ~48kD band corresponding to the casp2 proform.  4.1.2. Caspase-2 (casp2) -/- and +/+ mouse embryonic fibroblasts (MEFs) – post-etoposide and staurosporine Conflicting roles have been ascribed to casp2 during cell death in vitro. Death induced by the DNA-damaging agent etoposide has been described to involve casp2 (Lassus et al., 2002; Robertson et al., 2002). Careful single-dose experiments using initiator caspase trapping (Tu et al., 2006) and MEFs (Ho et al., 2008), however, have suggested that casp2 is not required for this type of cell death. The role played by casp2 in etoposide-induced cell death has been suggested to be dose specific, mediating effects of 10uM, but not 25uM, etoposide on Jurkat T-cell lymphocytes (Robertson et al., 2002). Published data suggesting casp2 is not involved in this form of cell death in Jurkat T-cells (Tu et al., 2006) and primary MEFs (Ho et al., 2008) relied upon higher  82 doses (50µM and 40µM, respectively), warranting caution in interpreting the present data in the literature. In light of this controversy, we have relied upon viability and toxicity assays to examine the response of primary casp2+/+ and -/- MEFs (MEFs) to etoposide-induced toxicity. Exposure of MEFs to a range of concentrations of etoposide results in significant loss of viability and trends towards increased toxicity (Figure 4.2, panel A and B). No differences are observed between casp2-/- and +/+ cells at any dose in either toxicity or viability measurements (LC50 = 75.58 ± 1.4µM, irrespective of genotype). Casp2 cleavage is observed rapidly after treatment with staurosporine (O'Reilly et al., 2002), a broad-spectrum kinase inhibitor. Staurosporine induction of apoptosis was used to define casp2-mediated cleavage of Golgin-160, one of a small number of validated casp2 substrates (Mancini et al., 2000), suggesting this form of stress may be relevant to casp2 biology. At 1µM staurosporine induces cell death irrespective of casp2 expression(Ho et al., 2008; Tu et al., 2006), however this dose is approximately 100-fold the LC50. The expression of casp2 had no influence on MEFs viability and toxicity after 24-hours of a range of staurosporine concentrations (Figure 4.2, panel C and D; LC50 = 8.12 ± 1.19 nM). This is in agreement with published data using much higher doses (Bergeron et al., 1998; Ho et al., 2008; Tu et al., 2006), and suggests that caspase-2 does not play a rate-limiting role in this acutely induced form of cell death.  83  Figure 4.2 - Casp2-/- MEF’s have normal toxic responses to a range of doses of staurosporine and etoposide. A. WT and casp2-/- littermate MEF’s lose viability equivalently after exposure to a range of doses of etoposide (Twoway ANOVA - Genotype: F(1,30)=0.07, p = 0.7913; Etoposide: F(4,30)=55.1, p < 0.001; Interaction: F(4,30)=0.19, p=0.9433) B. A trend towards increased toxicity is observed, with no significant effect of genotype (Two-way ANOVA - Genotype: F(1,30)=0.92, p = 0.34; Etoposide: F(4,30)=2.35, p = 0.076; Interaction: F(4,30)=0.20, p=0.93) C. WT and casp2-/- MEF’s also lose viability normally after exposure to staurosporine (Two-way ANOVA - Genotype: F(1,36)=0.54, p = 0.47; Staurosporine: F(4,36)=147.6, p < 0.001; Interaction: F(4,36)=0.12, p=0.99) D. Staurosporine exposure to MEF’s results in toxicity, with no significant effect of genotype observed (Two-way ANOVA - Genotype: F(1,36)=1.63, p = 0.21; Staurosporine: F(4,36)=17.62, p < 0.0001; Interaction: F(4,36)=0.24, p=0.94). Error bars = standard error. N = 4 independent experiments per stressor.  4.1.3. Caspase-2-/- and +/+ MEFs – post-etoposide caspase activation Despite the equivalent toxicity resulting from application of potent toxins to casp2+/+ and -/- cells, the mechanism of cell death could differ between genotypes in important ways. In order to begin to understand the mechanisms underlying etoposide-induced cell death, we conducted caspase activity assays in parallel with the viability and toxicity assays described above.  84 Combinatorial analysis of caspase recognition site preference (Talanian et al., 1997; Thornberry et al., 1997) has led to the development of idealized caspase substrates linked to florescent moieties, as well as chemically modified peptides serving as irreversible inhibitors. Casp2 is unique among caspases in that it has a penta- rather than a tetra-peptide substrate preference - Val-Asp-Val-Ala-Asp (VDVAD) (Schweizer et al., 2003; Talanian et al., 1997). Casp3, the primary effector caspase of apoptosis, has a preference for DEVD (Asp-Glu-Val-Asp) though it cleaves promiscuously, and is in fact a more efficient processor of VDVAD than casp2 on an equimolar basis (McStay et al., 2008). Despite the fact that a lack of selectivity was apparent with these idealized substrates from their description (Talanian et al., 1997), a large number of studies have continued to use them as “specific” caspase inhibitors and substrates (Guo et al., 2002; Lin et al., 2004; Robertson et al., 2002; Upton et al., 2008). This is particularly problematic in the case of casp2, whose intrinsic enzymatic activity is significantly lower than effector caspases (Talanian et al., 1997). Recent biochemical evidence has conclusively demonstrated that these molecules are not selective amongst purified caspases (McStay et al., 2008; Pereira and Song, 2008), however data from knockout tissues and caspase activity assays after etoposide stress has not been described. This data is required to make informed decisions about the usefulness of caspase activity assays in cells and tissues.  85  Figure 4.3 – Reduced caspase activity in cells post-treatment with etoposide. A. Etoposide induces VDVADase (“caspase-2”) activity in MEF’s, with higher inductions in casp2+/+ cells (Two-way ANOVA - Genotype: F(1,16)=5.12, p = 0.0378; Etoposide: F(3,16)=13.46, p = 0.001; Interaction: F(3,16)=1.55, p=0.2412). B. Etoposide also induces DEVDase (“caspase-3”) activity in cells, with higher induction in casp2+/+ cells (Two-way ANOVA - Genotype: F(1,16)=5.97, p = 0.0265; Etoposide: F(3,16)=19.14, p < 0.001; Interaction: F(3,16)=2.14, p=0.1348). C. High correlation between VDVADase and DEVDase activity in MEFs exposed to a range of doses of etoposide. The linear correlation between the two activities has an R2 of 0.99, and the slope is significantly non-zero (F(1,22)=1541, p < 0.0001). Solid line = linear regression, dotted line = 95% confidence interval of linear regression. * = Indicates p < 0.05 Bonferroni post-hoc test. N = 3 independent experiments.  After exposure to etoposide, VDVADase activity is induced in MEFs in a dosedependent fashion (Figure 4.3, panel A), with casp2-/- cells showing lower levels of VDVADase cleavage, as expected (Two-way ANOVA - Genotype: F(1,16)=5.12, p = 0.0378; Etoposide: F(3,16)=13.46, p = 0.001; Interaction: F(3,16)=1.55, p=0.2412). Despite significant reduction, the remaining signal in the casp2-/- cells suggests that this substrate is not a useful tool to examine casp2 activity levels in cells. DEVDase activity, a putative marker of caspase-3 activity, shows very similar trends in response to etoposide to VDVADase activity (Figure 4.3, panel B; Two-way ANOVA - Genotype:  86 F(1,16)=5.97, p = 0.0265; Etoposide: F(3,16)=19.14, p < 0.001; Interaction: F(3,16)=2.14, p=0.1348). Correlation of these two activities in each cell population studied verifies the very close relationship between the two signals (Figure 4.3, panel C), and suggests that significant overlap of the signals for casp2 and casp3 in acutely apoptotic cells. This validates observations made with purified caspases (McStay et al., 2008), and suggests these reagents are not useful to uniquely identify caspase activities in cells and tissues.  4.2. Physiological phenotypes Despite the more than 10 years since their creation, no behavioral experiments have been published using the casp2-/- mice. To analyze the potency and drugability of casp2 as a drug target in Huntington Disease, we require the broadest possible number of behavioral endpoints. Basal alteration in any of these endpoints in casp2-/mice could confound interpretation of rescue of HD phenotypes. We therefore undertook longitudinal observation of the casp2-/- mice in an attempt to delineate any previously undescribed behavioral, metabolic or pathological phenotypes. 4.2.1. Body weight A single study has described the body fat composition of aged (24-26 month old) casps2-/- mice in the context of aging, without discussing overall body weight (Zhang et al., 2007). We therefore longitudinally examined the body weight of casp2-/- mice. At 12 months of age, female casp2-/- mice weigh approximately 8% less than WT mice (Figure 4.4, panel A) males weigh 17% less (Figure 4.4, panel B). After gender normalization and pooling, casp2-/- mice weigh 12% less than WT littermates by 12 months of age (Figure 4.4, panel C).  87  A.  Female Body Weight  Body Weight (g)  40  WT Casp2-/-  30 20 10  12  8  4  0 Age (Months)  B.  **  **  12  Body Weight (g)  50  8  Male Body Weight  40  WT Casp2-/-  30 20 10  4  0 Age (Months)  C.  Pooled Body Weight  Body Weight, fold WT  1.50  WT Casp2-/-  1.25 **  1.00 0.75  12  8  4  0.50 Age (Months)  Figure 4.4 – Casp2-/- mice fail to gain weight during aging. A. Female casp2-/- mice fail to gain weight between 4-12 months of age (linear mixed effect model age: F(1,54)=88.94, p < 0.0001; genotype: F(1,28)=0.22, p = 0.64; Interaction: F(1,54)=6.22, p = 0.016). B. Male casp2-/- mice are basally thinner than WT mice and fail to gain weight between 4-12 months of age(linear mixed effect model age: F(1,49)=185.03, p < 0.0001; genotype: F(1,28)=18.07, p < 0.0001; Interaction: F(1,49)=14.88, p < 0.0001). C. Pooled, gender normalized, body weight also suggests casp2-/mice gain less weight between 4-12 months of age than casp2+/+ mice (linear mixed effects model genotype: F(1,57)=7.91, p = 0.0067; Age: F(2,103)=130.26, p < 0.0001; Interaction: F(2,103)=9.83, p < 0.0001). N = 33 casp2+/+ mice (16 female, 17 male), 27 casp2-/- mice (14 female, 13 male). ** indicates p < 0.01 in post-two-way ANOVA Bonferroni post-hoc test.  88 To better understand the etiology of the observed weight loss, we analyzed body composition of male mice using whole-body magnetic resonance spectroscopy (MRS). This technique provides data on the relative contributions of fat and lean mass to body composition (Mystkowski et al., 2000). These data demonstrate that male casp2/- mice have consistently reduced body fat ratios at 4 and 12 months of age (Figure 4.5), so this phenotype should not be considered a sign of accelerated aging as has previously been stated (Zhang et al., 2007), but rather reflects an alteration in the metabolism, physiology or activity of the casp2-/- mice that is present from as early as 4 months of age and does not change between 4-12 months of age.  Figure 4.5 – Male casp2-/- mice have decreased body fat to lean mass ratios, relative to caspase-2+/+ littermates. A. Lean body mass is not altered in 4 or 12 month old casp2-/- mice (Two-way ANOVA - Genotype: F(1,12)=0.59, p = 0.46; Age: F(1,12)=0.86, p = 0.37; Interaction: F(1,12)=0.32, p=0.58). B. Fat body mass is decreased in casp2-/- mice, and not affected by aging (Two-way ANOVA - Genotype: F(1,12)=9.42, p = 0.0097; Age: F(1,12)=0.60, p = 0.45; Interaction: F(1,12)=0.059, p=0.81). C. The pooled body fat:lean mass ratio is decreased in the casp2-/- mice (Two-way ANOVA - Genotype: F(1,12)=5.67, p = 0.034; Age: F(1,12)=0.95, p = 0.35; Interaction: F(1,12)=0.063, p=0.81). Horizontal bars = quartiles. + = Mean. N = 4 mice/genotype/age.  89 4.2.2. Feeding phenotypes Indirect calorimetry allows the simultaneous detection of a number of metabolic parameters in single mice over a multiple-day time scale. In order to gain insight into the body fat alterations observed (Figure 4.4, Figure 4.5), we performed indirect calorimetry on casp2-/- mice for 115-120 hours, encompassing multiple light/dark cycles, at 4 and 12 months of age. We recorded energy production (kcal/hour), food consumption, water consumption, respiratory exchange and activity levels. Analysis of feeding behavior in the casp2-/- mice reveals cumulative food intake is reduced (Figure 4.6, panel A). This reduction in absolute food intake persists after normalization for lean body mass. Quantitative consideration of total food eaten demonstrates that casp2-/- mice eat less food than wild type littermates (Figure 4.6, panel B; WT = 26.58 +/- 1.72g, casp2-/- = 20.27 +/- 1.24g; two tailed unpaired t-test t(13)=2.90, p = 0.013). Analysis of the variation of eating across time suggests that the casp2-/- mice specifically eat less during the dark phase of the light cycle – the normal active phase for nocturnal mice (Figure 4.6, panel C; two-way ANOVA dark/light F(1,28)=14.11, p = 0.0008; genotype F(1,28)=9.14, p = 0.0053; Interaction F(1,28)=14.25, p = 0.0008).  90  A.  B.  Dark  Light  WT Casp2-/-  20 10 0  Ca  sp  2-  W  /-  T  15  *  30  Genotype  C.  10  25  Food Consumed (g)  5  0  ***  20 15 10 5  400  500  Time Period (x 15 Minutes)  Da  300  t  200  gh  100  rk  0 0  Li  Cumulative Food Eaten (g)  20  40  Total Food Consumption (g)  WT Casp2-/-  Light Cycle  Figure 4.6 – Casp2-/- mice eat less food than casp2+/+ littermates. A. Casp2-/- mice at 4 and 12 months of age eat less food than WT mice (ages pooled after analysis for age effects). Gray rectangles = dark phases of light cycle, Light/dark gray polygons = genotype average +/- standard deviation. B. Total food eaten in 125 hours is reduced in the casp2-/- mice (two tailed unpaired t-test t(13)=2.90, p = 0.013). C. Total food eaten is reduced specifically in the dark phase of the light cycle. N = 8 WT and 8 casp2-/- mice. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  Analysis of the respiratory exchange ratio (RER) allows investigation of the relative contribution of carbohydrates and fats to energy production. The RER is the ratio of exhaled CO2 to inhaled O2. This ratio varies based upon the primary metabolic fuel – fatty acid oxidation requires more O2 per mole of ATP production compared to carbohydrate catabolism. A ratio of ~0.7 indicates that primarily fat is being oxidized for energy, while ratios ~1.0 indicate carbohydrate consumption. As an extension of the food weight data in Figure 4.6, we examined the RER during the light and dark phase in the casp2-/- and +/+ mice. In the WT mice, clear shifts in the RER between light and dark cycle indicate a switch to carbohydrate consumption during the dark (active) phase (Figure 4.7). This switch to carbohydrate metabolism is distinctly less pronounced in the casp2-/- mice at both ages, suggesting continued oxidation of fat stores as energy. These data biochemically validate the observed decrease in food consumption in the dark phase in the casp2-/- mice (Figure 4.6).  91  Figure 4.7 – Reduced dark-cycle RER validates feeding behavior changes in the casp2-/- mice. During the light cycle (left), a density plot of the RER for both genotypes is described by a broad distribution between 0.7-1.0, which becomes a much narrower distribution near 1.0 during the dark cycle (right) in the WT mice, reflecting active feeding on carbohydrate-rich chow. This shift is muted in the casp2-/- mice at both 4 and 12 months of age. Light/dark gray dots on bottom = raw data, light/gray lines = kernel density curves for RER values for each genotype.  4.2.3. Longitudinal spontaneous activity To establish the baseline activity levels in the casp2-/- mice, spontaneous activity was measured. This is a short-term test, and measures spontaneous activity in a large, open, chamber during one hour. Because the apparatus is unfamiliar, measurements reflect spontaneous activity levels in a novel environment, and are thus conditioned by arousal caused by transfer. Casp2-/- mice are progressively hyperactive in this measure of activity levels (Figure 4.8, time ambulatory linear mixed-effects Age: F(1,695)=0.0061, p = 0.94; C2: F(1,21)=17.13, p = 0.0005; Interaction: F(1,695)=6.15, p = 0.0134). The magnitude of hyperactivity in the casp2-/- mice progresses from 123%  92 WT levels at 4 months of age to 163% at 12 months of age (Figure 4.8) suggesting progressivity in this phenotype. While time ambulatory is the simplest measure of activity levels, a number of phenotypes are detectable using spontaneous activity chambers. Analysis of other endpoints, such as jump counts, show similar genotype trends to the time ambulatory (jump counts linear mixed-effects Age: F(1,695)=11.81, p = 0.0006; C2: F(1,21)=9.94, p = 0.0048; C2:Age: F(1,695)=1.60, p = 0.21).  Figure 4.8 - Progressively increased spontaneous activity in the casp2-/- mice. Spontaneous activity during 60 minutes of time in an open field chamber reveals progressive hyperactivity in the casp2-/- mice. (Linear mixed-  93 effects Age: F(1,695)=0.0061, p = 0.94; C2: F(1,21)=17.13, p = 0.0005; C2:Age: F(1,695)=6.15, p = 0.0134). Error bars = standard error. N = 10 WT mice, 13 casp2-/- mice.  Increased activity in spontaneous activity measurements suggests that casp2-/- mice have either altered activity patterns, increased transfer arousal upon introduction to this novel environment or some other alteration resulting in hyperactivity or anxiety. Indirect calorimetry, recorded over ~120 hours, provides a way to examine these potential causes. In this experiment, mice are transferred to a novel home-cage style cage fitted into the calorimetry apparatus. Activity measurements can be made continuously in this environment. At 4 and 12 months of age casp2-/- mice have normal total activity patterns during this multi-day observation, after an approximately 24-hour familiarization period (Figure 4.9, top). Separate analysis of the familiarization period shows strikingly increased activity levels, reflecting transfer arousal, but no genotype differences (Figure 4.9, bottom). This suggests that differences besides transfer arousal and total activity levels must underlie the increased spontaneous activity observed in Figure 4.8. The key difference between the experiments is the nature of the testing chamber – the spontaneous activity chambers are unfamiliar 27.3 cm2 empty plastic boxes, while the calorimetry analyses are done in home cage sized chambers of 30 cm x 20 cm with a lid. These results suggest that some novel aspect of transfer to a larger open arena leads to increased hyperactivity in the casp2-/- mice.  94 Dark Light  Post- familiarization 2000  C2+/+ &ïï  1500  1000  0  100  200  300  400  500  Familiarization  C2 +/+ &ïï  6000  8000  10000  Time Period (x 15 Minutes)  0  2000  4000  Total Beam Breaks/15 Minutes  500  0  20  40  60  80  Time Period (x 15 Minutes)  Figure 4.9 – Long-term total activity is normal in casp2-/- mice. Top - Total activity levels are unchanged in casp2-/- mice after a familiarization period – 4 and 12-month-old mice were pooled after examination for age effects. Clear increases in activity are observable during the dark phase of the light cycle while all mice studied stop moving significantly in the light cycle. Bottom – transfer arousal leads to increased activity in the early time periods in the calorimetry experiment (note change in scale), but no genotype difference is observed. Black/gray line = genotype average. N = 8 casp2+/+ mice, 7 casp2-/- mice.  In light of the decreased food intake and normal long-term activity levels in the casp2/- mice, we next examined energy expenditure in the mice. Some phenotypic difference must account for the altered body weight observed, and measuring energy expenditure allows accurate determination of the metabolic state of individual mice.  95 In order to correct for the smaller body size of the casp2-/- mice, energy measurements were normalized to grams of lean mass. Energy expenditure, per gram of lean mass, is significantly reduced in the casp2-/- mice (Figure 4.10), particularly during the (active) dark cycle.  Figure 4.10 - Energy expenditure per gram of lean mass is significantly reduced in the casp2-/- mice. Left – Energy/Lean mass by time period, black line/dots = WT average/data; dark gray line/dots = casp2-/- average/data. Right – Energy/lean mass by light cycle shows significant reductions in energy output in casp2-/- mice (Linear mixed-effects Dark/Light: F(1,6551)=1997.17, p < 0.0001; C2: F(1,13)=3.96, p = 0.068; Interaction: F(1,6551)=149.69, p < 0.0001). N = 8 casp2+/+ mice, 7 casp2-/- mice. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  Because casp2-/- mice eat less and weigh less than casp2+/+ littermates (Figure 4.6, Figure 4.4), reduced energy expenditure (Figure 4.10) could simply reflect the lower energy cost of moving a smaller body around the home cage and the “thermic effect” of food digestion (Westerterp, 2004). In order to determine whether the mice have a basal metabolic alteration, we examined the resting energy expenditure. Resting energy expenditure was calculated from epochs of the dark phase in which the movement of the mice was in the lowest quartile of activity levels. This reflects the  96 energy expenditure of the mice during the active phase of their light/dark cycle during periods in which they are not moving. Casp2-/- mice have reduced resting energy expenditure (Figure 4.11, linear mixed effects model genotype F(1,13)=7.09, p 0.0195), supporting the existence of a basal reduction in metabolic output in these mice.  Figure 4.11 – Reduced resting energy expenditure in the casp2-/- mice. Energy expenditure is reduced by 21% in casp2-/- mice during inactive epochs of the dark cycle (WT = 0.017 kcal/hr/gram lean mass; casp2-/- = 0.13 kcal/hr/gram lean mass; linear mixed effects model F(1,13)=7.09, p = 0.0195). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  4.3. Pathological phenotypes 4.3.1. Plasma alterations Reduced cholesterol biosynthesis is a symptom of overexpression of mutant huntingtin in mice (page 73)(Valenza et al., 2007b), and casp2 has been proposed to provide negative feedback to the cholesterol biosynthetic pathway (Logette et al., 2005). In order to determine whether the cholesterol biosynthetic rate is increased in  97 the plasma of casp2-/- mice, we measured plasma cholesterol at 2, 4 and 12 months of age. Casp2-/- mice have normal levels of plasma cholesterol at 2-4 months of age, but significantly reduced plasma cholesterol at 12 months of age (Figure 4.12 A), suggesting that the proposed role for casp2 in regulating SREBP-responsive genes is redundant or dispensable in mice. In light of these unexpected late reductions in cholesterol biosynthesis, we analyzed the hepatic transcript levels of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCoAR). HMG-CoAR catalyzes the rate-limiting step in cholesterol biosynthesis and levels of this enzyme are tightly regulated in response to supplies of cholesterol (Goldstein and Brown, 1990). HMG-CoAR levels are significantly increased in the liver of the casp2-/- mice (WT = 0.91 +/- 0.08; Casp2-/- = 1.50 +/- 0.16 casp2/actin mRNA; ; two-tailed unpaired t-test t(15)=3.47, p = 0.0034; Figure 4.12 B), despite reduced circulating levels of cholesterol. This suggests that the liver of casp2-/- mice may be trying to compensate for reduced plasma cholesterol by upregulating hepatic biosynthesis, but deficiencies in efflux or transport are resulting in lowered plasma cholesterol.  Figure 4.12 - Progressive plasma cholesterol reductions in the casp2-/- mice. A. Plasma cholesterol is reduced at 12-months of age in the casp2-/- mice (two-way ANOVA age F(2,48)=0.12.66, p<0.001, genotype F(1,48)=1.86, p=0.18, interaction F(2,48) = 6.5, p=0.0033). N = 14, 4 and 8 WT mice and 10, 6 and 9 YAC128 mice at 4, 8, 12 months. Total N = 54. B. Hepatic transcript levels of HMG-CoA reductase are increased at 12 months of age in the casp2-/- mice (WT = 0.91 +/- 0.08; Casp2-/- = 1.50 +/- 0.16; two-tailed unpaired t-test t(15)=3.47, p = 0.0034). N for RNA experiment: WT = 9 mice, casp2-/- 8 mice. ** Indicates p < 0.01 Bonferroni multiple comparison test or t-test. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  98 4.3.2. Hepatic phenotypes Because hepatic function is central to both feeding behavior and plasma cholesterol synthesis, we examined hepatic structure in aging casp2-/- and WT mice. Early descriptions suggested undetectable casp2 expression in the liver (Bergeron et al., 1998), however more recent work has shown clear casp2 active fragment by western blot in hepatocytes (Zheng et al., 2000). Microscopic examination of the liver revealed clear changes in the hepatocytes of casp2-/- mice (Figure 4.13 panel A). There is large variation of nulear size in the casp2-/- animals, with a pronounced accumulation of large, irregularly shaped, nuclei. Examination of the distribution of hepatic nuclear sizes suggests that the distribution of nuclear area is not normal, particularly in older mice, with a distinct bimodal distribution in the casp2-/- mice (Figure 4.13 panel B). Accumulation of polyploid hepatocytes is a feature of aging in both humans (SWARTZ, 1956; Watanabe and Tanaka, 1982) and rodents (DL, 1990; Engelmann et al., 1981), and ploidy closely correlates with nuclear area (Watanabe et al., 1978). These data demonstrate that casp2-/- livers accumulate large, likely polyploid, nuclei much more rapidly than WT mice, and is consistent with a report from aged mice suggesting enhanced aging in the casp2-/- liver (Zhang et al., 2007). While metabolic alterations observed (Figure 4.6, Figure 4.10, Figure 4.11) are not progressive from 4-12 months, the increase in aberrant hepatocytes and plasma cholesterol are (Figure 4.13,Figure 4.12). The natural history of these phenotypes suggests that metabolic changes precede, and potentially underlie, the hepatic and plasma cholesterol phenotypes.  99  Figure 4.13 –Casp2-/- mice have progressively increased hepatic nuclear area. A. Micrograph of 5um liver sections from 12 month old casp2-/- and casp2+/+ mice stained with hematoxylin and eosin stain. Hepatic nuclei in the casp2-/- mice are irregularly shaped and vary greatly in size. B. Density estimates of the size of hepatic nuclei at 4 and 12 months of age demonstrate the non-normal distribution of nuclear areas in older casp2-/- mice. The distribution of nuclear areas in the casp2-/- mice is distinctly bi-modal, suggesting the accumulation of distinct population of large nuclei.  4.3.3. Peripheral satiety signals Feeding behavior is regulated by a complex network of central and peripheral mediators (Crowley et al., 2002). Peripheral satiety signals are interpreted regulated both peripheral and central factors leading to appetite stimulation or suppression. Blood glucose is a key regulator of feeding behavior, and alterations in glucose levels may explain the altered feeding behavior observed in the casp2-/- mice (MAYER, 1955). Fasting glucose levels in 12 month old casp2-/- mice are equivalent to those of  100 WT mice, suggesting that the systems regulating circulating glucose levels are normal (Figure 4.14A, unpaired t-test t(10)=1.28, p= 0.23). Leptin, produced primarily by adipocytes, is a powerful negative regulator of feeding behavior (Zhang et al., 1994). Leptin levels in fasted casp2-/- mice are equivalent to WT levels, when normalized to body weight (to control for reduced fat mass, Figure 4.14B; unpaired t-test t(10) = 1.28, p = 0.23). Thus, leptin and glucose signaling is unaltered in the casp2-/- mice, and peripheral alterations in networks regulating their production are unlikely to regulate the reduced feeding observed in the casp2-/- mice.  Fasting Leptin Levels (12 Months) 0.5 0.4 0.3 0.2 0.1  T  Genotype  2Ca  Ca  sp  sp  2-  W  /-  0.0  /-  Leptin (ng/ml)/Body Weight (g)  9 8 7 6 5 4 3 2 1 0  B.  W  Fasting Glucose (12 Months)  T  Fasting Glucose (mM)  A.  Genotype  Figure 4.14 – Peripheral satiety signals are normal in casp2-/- mice. A. Plasma glucose is normal in 4-hour fasted 12-month old casp2-/- mice (unpaired t-test t(10)=1.28, p = 0.23). B. Plasma leptin, normalized to body weight, is normal in 4-hour fasted 12-month old casp2-/- mice (unpaired t-test t(13)=0.017, p = 0.99). N for glucose experiment: WT = 5 mice, casp2-/- = 7 mice. N for leptin experiment: WT = 9 mice, casp2-/- = 9 mice. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median, IQR + = mean.  4.3.4. Central phenotypes In order to discover any central nervous system correlates of the observed metabolic alterations, we examined volumes derived from magnetic resonance imaging (page 49) of 12-month old WT and casp2-/- mice. Overall brain volumes do not differ between WT and casp2-/- mice (WT = 446.39 mm3 +/- 5.24; casp2-/- = 446.39 +/- 5.83; unpaired t-test t(15.3)=0.59, p = 0.56). Despite normal overall brain size, several  101 specific structures are decreased in volume in the casp2-/- mice (Appendix B – Structure Volumes in Casp2-/- x YAC128). Of particular interest in light of the metabolic alterations observed, the hypothalamus is significantly reduced as a percentage of total brain volume in the 12 month old casp2-/- mice (two-tailed unpaired t-test t(16)=4.37, p=0.0005). Stereology was performed counting total numbers of neurons in the hypothalamus to determine whether the altered volume observed was due to loss of cells. Total hypothalamic neurons are reduced in 12 month old casp2-/- mice (WT = 4.03x105 +/- 0.26x105 neurons/hypothalamus, casp2-/= 3.11x105 +/- 0.24x105 neurons/hypothalamus; two-tailed unpaired t-test t(13)=2.54, p=0.025). These data demonstrate that casp2-/- mice have specific hypothalamic atrophy at a time when they also show alterations in important metabolic phenotypes.  Figure 4.15 – Casp2-/- mice have reduced hypothalamic volume and hypothalamic neuronal counts. A. Relative hypothalamic volumes in the casp2-/- mice are significantly reduced relative to controls (two-tailed unpaired t-test t(16)=4.37, p=0.0005). N = 9 WT, 9 casp2-/- mice. B. The number of total hypothalamic neurons is also reduced in casp2-/- mice (two-tailed unpaired t-test t(13)=2.54, p=0.0246). N = 8 WT, 7 casp2-/- mice. Horizontal bars indicate quartiles, + indicates mean.  102  4.4. Casp2 short/long ratios in development and disease If casp2 is important to the development of HD pathology (Hermel et al., 2004), and casp2S/L ratios affect the function of casp2, it is possible that these ratios are an important component of pathology in HD. In light of the controversy surrounding the function of the casp2S transcript (see 1.5), the first question that must be addressed is whether significant amounts of casp2S transcript are present in cells and tissues of interest. Secondly, if alterations in the casp2S/L ratio mediate involvement of casp2 in HD pathology, we would predict alterations in these levels during or preceding the development of signs and symptoms of HD. 4.4.1. Casp2 short/long ratios in the developing CNS The inclusion of exon 9 in the casp2S transcript allows the specific amplification of casp2 isoforms from complementary DNA (cDNA) made from total cellular RNA. Polymerase chain reaction (PCR) with primers in exons 8 and 10 results in two PCR products - one of 167bp (casp2L) and another of 228bp (casp2S) (Bergeron et al., 1998)(Figure 4.16). This strategy results in clear separation of the PCR products produced by each transcript, and allows an estimation of their relative abundance (Figure 4.16).  Figure 4.16 - Casp2 S/L specific primers. Left – schematic of casp2 genomic organization. Vertical magenta bars = exons, dashed lines = introns. Primers used for total (exon 7) isoform specific (exons 8 and 10) PCR amplification are indicated. Right – sample agarose gel of isoform specific casp2 PCR using cDNA derived from primary striatal neurons after 10 days in vitro.  In immortalized peripheral cell lines the casp2S transcript is quickly degraded by nonsense-mediated decay (Solier et al., 2005). These cells do not recapitulate the relevant situation for the study of neurodegeneration, and a single experiment has  103 suggested more casp2S transcript is present in the brain (Bergeron et al., 1998). To investigate the role played by the casp2S/L ratio in HD we measured it in striatal neurons in culture and dissected striata from wild type mice because these are the cells and tissues uniquely susceptible to pathology. Striatal neurons in culture express significant amounts of casp2S, with a casp2S/L ratio of 0.4 (Figure 4.17) – significantly higher than the reported expression in peripheral cell lines (Solier et al., 2005). In striata dissected from 3 month old WT animals, the casp2S/L ratio is increased to 1.8, a 4.5-fold increase relative to primary neurons (Figure 4.17, t(5)=5.33, p=0.0031). These data demonstrate that casp2S levels are increased in neurons, relative to other cell types and that these levels are higher still in 3-month-old intact striata.  Figure 4.17 - Casp2S/L ratios in vitro and in vivo. A. - The casp2S/L ratio is increased in intact striatum from 3 month old WT animals, compared to embryonic striatal neurons after 10 days of differentiation (t(5) = 5.334, p = 0.0031). B – Sample casp2S/L products from striatal neurons and striata used for quantification.  To gain a more detailed understanding of the natural history of the casp2S/L ratios, striatal cDNA was prepared from mice between 2-72 weeks of age. Isoform specific PCR, followed by quantification of band intensity, demonstrates that the casp2S/L ratio is transiently increased in the striatum between 4-12 weeks of age, before decreasing to a constant level near ~2 (Figure 4.18). This natural history confirms that casp2S levels are high in the mature striatum and furthermore that the casp2S/L ratio is dynamically regulated during development and maturation.  104  Figure 4.18 – The casp2S/L ratio is dynamic in the aging striatum, with a peak of casp2S expression between 4-12 weeks of age. The effect of time is significant in this analysis (one-way ANOVA time: F(7,38)=5.82, p = 0.0002). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  4.4.2. Caspase-2 short/long ratios in stressed cells In order to directly assay the dynamism of the casp2S/L ratio in neurons, we used excitotoxic stress. Excitotoxicity is a process of cell death induced by over-activation of glutamate receptors, which is specifically potentiated in neurons expressing mutant huntingtin (Graham et al., 2009; Milnerwood et al., 2010). Enhanced susceptibility to excitotoxicity has been proposed to underlie the selective vulnerability of striatal neurons to death in HD (Fan and Raymond, 2007). Striatal neurons die via apoptotic mechanisms when challenged with 500uM Nmethyl-D-aspartate (NMDA) after 10 days of in vitro differentiation (Shehadeh et al., 2006; Zeron et al., 2002). This excitotoxic induction of apoptosis is specifically exacerbated in neurons derived from the YAC128 mice (Shehadeh et al., 2006; Zeron et al., 2002). Treatment of WT and YAC128 striatal neurons with NMDA dramatically reduces the casp2S/L ratio (Figure 4.19, two-way ANOVA effect of NMDA: F(3,28)=13.3, p < 0.0001). Neurons from YAC128 mice show enhanced toxicity in response to this type of stress (Shehadeh et al., 2006), and also have reduced casp2S/L ratios (Figure 4.19, two-way ANOVA effect of genotype: F(1,28)=32.68, p < 0.0001). So the cellular casp2S/L ratio is responsive to stressors known to selectively affect mutant htt  105 expressing cells, and the resting casp2S/L level in YAC128 neurons is lower than WT levels.  Figure 4.19 – The casp2S/L ratio is reduced in YAC128 striatal neurons and is responsive to NMDA stress. (Two-way ANOVA Genotype: F(1,28)=32.68, p < 0.0001; NMDA: F(3,28)=13.30, p < 0.0001; Interaction: F(3,28)=0.40, p = 0.75). Whiskers = range, rectangle = interquartile range (IQR), dot = median. Insert – sample agarose gel showing the pre- and post-500uM NMDA casp2S/L ratio in WT neurons.  4.4.3. Caspase-2 short/long ratios in the YAC128 mice To directly test the hypothesis that altered casp2S/L ratios underlie selective vulnerability to cell death in the striatum in HD, we measured transcript levels in the striatum of aging WT and YAC128 mice. Because YAC128 mice develop specific striatal pathology and significant behavioral impairments between 6-12 months of age (Slow et al., 2003a; Van Raamsdonk et al., 2005e), we measured casp2S/L ratios between 3-18  106 months of age. No alteration in the casp2S/L ratio was detected in YAC128 striatum compared to WT striatum during this time frame (Figure 4.20, two-way ANOVA genotype: F(1,37)=0.029, p = 0.87). This demonstrates that while altered casp2S/L ratios are correlated with vulnerability to excitotoxic death in vitro, altered casp2S/L ratios in the striatum do not cause pathological changes in the YAC128 mice between 3-18 months of age.  Figure 4.20 - Casp2S/L ratio in the striatum of aging WT and YAC128 mice. Levels of casp2S/L were constant between 3-18 months of age in WT and YAC128 mice, and do not differ between genotypes (Two-way ANOVA Genotype: F(1,37)=0.029, p = 0.87; Age: F(4,37)=2,17, p = 0.091; Interaction: F(4,37)=2.33, p = 0.074). N = 3-8 mice/genotype/age, 47 mice total. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median.  107  5. Casp2-/- x YAC128 While casp2 cleavage of htt at amino acid 552 is unlikely to underlie HD pathology (Graham et al., 2006a), co-transfection of dominant negative casp2 rescues striatal neurons from cell death induced by mutant huntingtin expression (Hermel et al., 2004). This in vitro data suggests a functional link between casp2 and the toxic effects of mutant huntingtin in neurons. Furthermore, casp2 protein accumulates in vulnerable cells in HD mouse and human patient brains (Hermel et al., 2004). These data suggest a role for casp2 in the pathogenesis of HD, but conclusive in vivo evidence is lacking. In light of the absence of specific inhibitors for casp2 (McStay et al., 2008), we have utilized sequence based (and therefore specific) tools to analyze the role played by casp2 in HD pathogenesis. In vitro, we have adapted antisense oligonucleotides (ASOs) targeting casp2 for use in primary striatal neurons. This facilitates the specific post-natal silencing of casp2 in the cell population most vulnerable to death in HD. This tool has enabled us to examine the role played by casp2 in the excitotoxic cell death of primary striatal neurons. This form of cell death, while acute, is strongly linked to the regionally specific cell death in HD (Fan and Raymond, 2007). In vivo, we have taken advantage of existing mice lacking casp2 (casp2-/-) (Bergeron et al., 1998; O'Reilly et al., 2002). By breeding these mice to the YAC128 model of HD we can interrogate the role played by casp2 in the development of a large array of signs and symptoms of HD (Graham et al., 2006a; Slow et al., 2003a; van Raamsdonk et al., 2005; Van Raamsdonk et al., 2005e; Van Raamsdonk et al., 2007a).  5.1. Casp2 mRNA Casp2 mRNA has been reported to increase in a mouse model of HD, as well as in neurons deprived of BDNF (Hermel et al., 2004). We thus undertook an analysis of casp2 mRNA levels in the striatum of aging wild type (WT) and YAC128 mice. No effect of genotype on casp2 mRNA levels is seen from 3-12 months of age (two-way ANOVA genotype: F(1,27)=0.02, p=0.89; age: F(3,27)=28.4, p<0.0001; Interaction: F(3,27)=1.30,  108 p=0.29), a period in which motor and cognitive symptoms of HD develop (Slow et al., 2003a; Van Raamsdonk et al., 2005e). Human control and early stage HD patient mRNA transcript levels are available in public databases for multiple CNS regions (Hodges et al., 2006). Casp2 levels are not altered in any of these regions in HD patients (Figure 5.1 panel B). To examine the validity of the dataset mRNA levels of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoAR) were examined. Previous studies have established that HMG-CoAR mRNA is decreased in human HD tissue (Valenza et al., 2005), which is also observed in the current dataset, validating its biological relevance (Figure 5.1 panel C).  109  Figure 5.1 - Casp2 mRNA levels in YAC128 mice and human HD patients. A. Casp2 and actin mRNA was amplified from cDNA representing total striatal mRNA at 3, 6, 9 and 12 months of age. No genotype differences were observed between WT and YAC128 mice overall, or at any individual time point (two-way ANOVA genotype: F(1,27)=0.02, p=0.89; age: F(3,27)=28.4, p<0.0001; Interaction: F(3,27)=1.30, p=0.29). N= 3-5 mice per genotype per timepoint (35 mice total). Error bars indicate SEM. B-C. Casp2 mRNA levels in 4 CNS regions were extracted from publically available microarray databases, originally described in (Hodges et al., 2006). Casp2 mRNA is not elevated  110 in HD in any tissue examined. HMG-CoA Reductase, a gene previously shown to be downregulated in human HD (Valenza et al., 2005), is significantly decreased in this data set in affected tissues. “BA” = Brodmann area. P-values for t-tests, corrected for multiple comparisons, indicated above each genotype comparison.  5.2. Casp2 activation Mature forms of the protein dimer, not the mRNA, enact Casp2’s enzymatic functions. In order to directly assay the activation state of casp2 in vivo a commercially available neo-epitope antibody was used. AB2251 (Abcam, Cambridge, MA) is a neo-epitope antibody raised to an internal cleavage site of casp2 required for efficient activation (Baliga et al., 2004). Active casp2 immunoreactivity accumulates in the cell bodies of aging striatal neurons in WT and YAC128 mice (Figure 5.2 panel C). In two independently created lines of casp6-resistant YAC128 (C6R) mice a dramatic reduction in immunoreactivity is seen (Figure 5.2 panel C). As C6R mice are protected from all described symptoms of HD (Graham et al., 2006a; Pouladi et al., 2009), this staining demonstrates a correlation between HD symptoms and active casp2 immunoreactivity.  111  Figure 5.2 – Increased accumulation of cleaved, active, casp2 in the striatum of aging mice. A. Schematic of casp2 activation indicating internal sites cleaved during maturation and the neo-epitope recognized by the active casp2 antibody. Prodomain is indicated by “CARD” (caspase recruitment domain), while the large and small subunits are represented by “p19” and “p12”, respectively. B. Cartoon coronal section of mouse brain indicating approximate area of photomicrographs (black box). C. Representative micrographs of striatal sections stained with active casp2 antibody at 3, 9, 12 and 18 months of age. Four lines of mice are shown including two independently created casp6 resistant YAC128 lines.  112  5.3. Excitotoxicity Excitotoxicity refers to the neuronal cell death caused by over activation of excitatory amino acids including glutamate (LUCAS and NEWHOUSE, 1957; Olney, 1969) and related compounds such as N-methyl-D-aspartate (NMDA) (Kerwin et al., 1980). Excitotoxic lesioning of the mammalian CNS results in biochemical changes that resemble HD pathology in that they are axon sparing, and result in the specific death of medium spiny neurons (Beal et al., 1986; Coyle and Schwarcz, 1976; Mcgeer and McGeer, 1976; Schwarcz et al., 1983). Excitotoxicity is amenable to study in vitro using dissociated primary neurons (Choi, 1987; Choi et al., 1987). Striatal neurons derived from transgenic mice expressing mutant human huntingtin show hypersensitivity to excitotoxic stress, including NMDA-induced excitotoxicity in vitro (Leavitt et al., 2006; Shehadeh et al., 2006; Zeron et al., 2002; Zeron et al., 2004). The correlation between excitotoxic hypersensitivity and HD symptoms in mice suggests that interventions that protect striatal neurons from excitotoxicity may protect mice from HD. Primary embryonic striatal neuronal cultures derived from casp2-/- mice appear normal under phase microscope and no correlation was observed between casp2 genotype and overt culture success. While baseline viability (cellular ATP) and toxicity (media LDH) assays do not differ between genotypes, the change induced in these parameters by toxic doses of NMDA does (Figure 5.3). Loss of viability is significantly ameliorated in casp2-/- striatal neurons (Figure 5.3 panel A, two-way ANOVA treatment: F(2,95)=217.3, p<0.0001; genotype: F(1,95)=24.48, p<0.0001; Interaction: F(2,95)=6.24, p=0.0028). Significant protection is observed at both 100uM (casp2+/+ viability = 51.89 ± 2.87%, casp2-/- viability = 67.28 ± 3.19%) and 500uM NMDA (casp2+/+ viability = 49.19 ± 2.64%, casp2-/- viability = 62.36 ± 2.28%). Casp2-/cultures are also protected from toxicity (Figure 5.3 panel B, two-way ANOVA treatment: F(2,104)=26.36, p<0.0001; genotype: F(1,104)=5.32, p<0.0001; Interaction: F(2,104)=1.6, p=0.21). Protection was observed at both 100uM (casp2+/+ toxicity = 118.66 ± 2.15%, casp2-/- toxicity = 113.04 ± 1.78%) and 500uM NMDA (casp2+/+ toxicity = 120.87 ± 2.69%, casp2-/- toxicity = 112.19 ± 2.99%).  113  Figure 5.3 - Casp2-/- Medium spiny neurons are protected from NMDA-induced excitotoxicity. A. Striatal neurons were isolated and cultured from E16.5 pregnant casp2± mothers. Neurons were challenged on DIV10 with 0, 100 or 500uM NMDA. Cell viability was measuring using the CellTitre-Glo assay, as described. Casp2-/- neurons were significantly protected from loss of viability (two-way ANOVA treatment: F(2,95)=217.3, p<0.0001; genotype: F(1,95)=24.48, p<0.0001; Interaction: F(2,95)=6.24, p=0.0028). B. Casp2-/- neurons are protected from loss of membrane viability, as assayed by LDH leakage into media, two-way ANOVA treatment: F(2,104)=26.36, p<0.0001; genotype: F(1,104)=5.32, p<0.0001; Interaction: F(2,104)=1.6, p=0.21). N independent cultures = 14 casp2+/+ and 21 casp2-/- mice. *, *** Indicate p<0.05 and p<0.001 for Bonferroni post-hoc tests between genotypes. Error bars indicate SEM.  Casp2 has a small number of validated proteolytic substrates, in common with other initiator caspases. Proposed substrates include huntingtin (Hermel et al., 2004; Wellington et al., 1998; Wellington et al., 2002), golgin-160 (Mancini et al., 2000) and αII-Spectrin (Rotter et al., 2004). In vivo evidence from humans and mice suggests that  114 huntingtin cleavage at amino acid 552, a proposed casp2 recognition site, occurs normally (Wellington et al., 2002). Furthermore, abrogation of this cleavage event is not associated with rescue from pathology in a mouse model of HD (Graham et al., 2006a), suggesting other substrates might be mediating protective effects of casp2 abrogation. In light of the importance of spectrin cleavage for neuronal function, we examined this phenotype in primary embryonic striatal neurons derived from casp2-/mice. In WT mice, full-length (240kD) αII-Spectrin is almost completely depleted by treatment with 500uM NMDA (Figure 5.4 panel A, top, average reduction of 90%). In casp2-/- neurons the induced depletion is significantly reduced (Figure 5.4 panel A, bottom, average reduction of 16%; Figure 5.4 panel B, unpaired two-tailed t-test t(10)=13.56, p < 0.0001).  Figure 5.4 – Cleavage αII-Spectrin of during excitotoxicity is reduced in casp2-/- mice. A. αII-Spectrin is cleaved into a predominant ~150kD band after exposure of striatal neurons to 500uM NMDA. Representative western blots are shown for casp2+/+ (panel A, top) and casp2-/- (panel A, bottom) neurons. B. Induced αIIspectrin cleavage was estimated by quantifying full-length band intensity in 500uM NMDA treated neurons divided by full-length band intensity in 0uM NMDA treated neurons (unpaired two-tailed t-test 2(10)=13.56, p < 0.0001). N = 6 casp2+/+ cultures, 6 casp2-/- cultures. Horizontal bars = quartiles.  Casp2 cleaves human αII-Spectrin in vitro at aspartate-1185, resulting in an approximately 150kD C-terminal fragment (Rotter et al., 2004). αII-Spectrin is also a substrate for µ- and m- calpain at tyrosine-1167 (Harris and Morrow, 1988). Cleavage at this calpain site downstream of NMDA-receptor activity is well characterized both in vitro (Faddis et al., 1997) and in vivo (Vanderklish et al., 2000). In order to determine  115 whether the predominant ~150kD product observed after NMDA (Figure 5.4) is due to direct casp2 cleavage of αII-Spectrin, we exogenously cleaved neuronal lysate with purified casp2 enzyme. Exogenous cleavage with purified casp2 results in a cleavage fragment that is slightly, but robustly, larger than the fragment produced by NMDA stimulation of striatal neurons (Figure 5.5). This is consistent with the predicted molecular weight of the casp2-cleaved αII-Spectrin fragment, which is ~1.0kD larger than the calpain fragment (human inter-cleavage site sequence = 1177GMMPRDETD1185. This suggests that observed alteration in αII-Spectrin cleavage in casp2-/- neurons (Figure 5.4) most likely results from altered NMDAR currents or proximate signaling, rather than downstream apoptotic cleavage of αII-Spectrin.  Figure 5.5 - Exogenous casp2 cleaves αII-Spectrin but produces a larger band than NMDA treatment of neurons. Left lane – lysate from primary striatal neurons with no NMDA treatment shows minimal cleavage of αIISpectrin. Middle lane – lysate from parallel cultures treated with 500uM NMDA induces robust cleavage, revealing a predominant ~150kD band. Right lane – lysate from primary striatal neurons treated exogenously with purified casp2 enzyme results in a cleavage fragment that is slightly larger than the one induced by NMDA-treatment.  5.4. Antisense oligonucleotide treatment in primary neurons HD is a neurodegenerative disease, with most pronounced pathology in the striatum and cortex. These facts dictate that the ideal cellular model system to investigate pathways of mutant htt-induced toxicity is neurons, preferably derived from the striatum or cortex. A number of neuronal cell line models of HD have been created (Li et al., 1999; Sipione et al., 2002; Wang et al., 1999; Wyttenbach et al., 2000), which have  116 produced insights into mechanisms of polyQ-induced toxicity. They share some common limitations, however, including transgenic expression of fragments of huntingtin from non-native promoters. Furthermore, none of these cell lines is postmitotic, which is a major confound when modeling non-cycling neurons. Primary neurons circumvent these complications, and if created from accurate transgenic rodent models these cells can provide the best possible model of cellular vulnerability in HD. While primary neurons are an excellent system for acutely modeling HD, some limitations exist. Neurons, particularly those from smaller anatomical regions such as the striatum, are limited in number and difficult to isolate and culture successfully. Because they are post-mitotic, they are not self-renewing and need to be established from animals for each experiment. Neurons are also difficult to transfect with exogenous nucleic acids, which limits the scope of experiments that can be conducted. Post-natal silencing of genes with small interfering RNA (siRNA) or antisense oligonucleotides (ASOs) is a powerful tool enabling the analysis of loss of function phenotypes. Delivery of these reagents to primary neurons has remained challenging, however, with low transfection efficiencies achieved. These low transfection efficiencies require that downstream analyses be single-cell based, and require unambiguous labeling of targeted neurons to identify transfected cells, which generally necessitates co-delivery of plasmids encoding marker proteins. In an attempt to develop a system to study the effects of reductions of casp2 levels in neurons, we have used antisense oligonucleotides (ASOs) targeting this gene (Figure 5.6). ASOs have a proven ability to silence target genes in neurons in vivo (Smith et al., 2006), as well as a track record of advancement to successful human clinical use (de Smet et al., 1999). ASOs are single stranded, chemically modified, oligonucleotides with specific sequence complementarity to the gene of interest (Bennett and Swayze, 2010). The most advanced form of ASOs comprises a “gapmer” structure of ~5 nucleotides of backbone modified deoxynucleotide, ~10 nucleotides of unmodified oligodeoxynucleotide (DNA), followed by ~5 nucleotides of backbone modified  117 deoxynucleotide (“5-10-5 gapmer”). This gapmer structure facilitates high-affinity binding to target RNA, while enabling maximal cleavage of the ASO:RNA hybrid by RNAseH, the catalytic silencing mechanism invoked by ASO treatment (Lima and Crooke, 1997). 2’-O-methoxyethyl (2’-MOE) modification of the carbohydrate moiety of the backbone nucleotides 1-5 and 16-20 of ASOs leads to increased potency, stability and pharmacokinetics (Manoharan, 1999). Effective sequences for silencing by ASOs can be determined empirically, using a “gene-walking” approach. In this approach, a large number of unique ASOs with identical chemistry, but varied target sequences within a gene of interest, are generated. Target mRNA levels are quantified after transfection of cells with ASOs, in order to estimate potency. This approach led to the development of a 2’-MOE 5-10-5 gapmer ASO targeting mouse casp2 with a base sequence of 5’GAGGCCTCCGCCAGACTCAA-3’ (Figure 5.6).  #!!"  '&!"  '%!"  Control  '$!"  Lead Oligo  '#!"  '!!"  &!"  %!"  $!"  #!"  !"  Anti-casp2 Antisense Oligonucleotides  Figure 5.6 – Mouse casp2 ASO development, courtesy of Isis Pharmaceuticals. 2’-MOE 5-10-5 gapmer ASOs targeting murine casp2 were synthesized and transfected using electroporation into 3T3-L1 cells at 150nM concentration. Casp2 mRNA was quantified and an oligo with the sequence 5’-GAGGCCTCCGCCAGACTCAA-3’ was found to reduce casp2 mRNA 68%.  Based on the success of 2’-MOE 5-10-5 ASOs in silencing targets in neurons in vivo (Smith et al., 2006), we investigated their potency in cultured primary striatal neurons. Cultured striatal neurons have been widely used as cellular models of HD, as these cells are uniquely vulnerable to HD pathology (Graham et al., 2006a; Shehadeh et al.,  118 2006; Zeron et al., 2002; Zeron et al., 2004). Striatal neurons were transfected after three days in vitro (DIV3) with 2uM ASO targeting either casp2, or an “off-target” control ASO with no complementarity in the mouse genome. Transfection was done using either lipid-based transfection reagent (Fugene, Roche) or simple bath application in diluted neurobasal media. Application of 2uM ASO on DIV3 results in an approximately 40% reduction in casp2 protein levels on DIV10 (7 days of treatment, Figure 5.7 panel A), demonstrating that neurons are amenable to transfection with ASOs with or without transfection reagent. As a validation of the protein data, mouse casp2 mRNA was quantified from striatal neurons bath treated from DIV3-10 with 2uM casp2 or control ASO. Treatment with casp2 ASO results in a robust, specific, 59% (+/4%) reduction of casp2 mRNA (Figure 5.7, panel B). This demonstrates that neurons are capable of uptake of ASO directly from media, without the need for transfection reagent, as has been seen transiently in primary hepatocytes (Bennett, 2008).  Figure 5.7 – Treatment of primary medium spiny neurons with anti-casp2 ASO results in significant reductions in casp2 levels. Primary striatal neurons were treated on DIV3 with 2uM off-target or casp2 ASO. A) Western blots demonstrate an ~40% reduction in casp2 protein on DIV10 when treated with casp2 ASO, and transfection reagent is not required. B) QRTPCR analysis of casp2 levels in striatal neurons treated for 7 days with 2uM ASO demonstrates a 59% reduction in casp2 mRNA levels (one way ANOVA, treatment: F(2,17)=12.14, p = 0.0007). ** Indicates p < 0.01 Bonferroni post-hoc test. Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. N = 6 independent treatments/condition.  119 While knockdown in primary striatal neurons is effective (Figure 5.7), it is unclear if the knockdown is homogenous across the treated population of cells. In an attempt to address this question we utilized a polyclonal antibody reactive to ASOs (Isis Pharmaceuticals). Primary striatal neurons stained with this antibody show somatic punctate accumulations of reactivity (Figure 5.8, top left). Mock treated neurons show no such signal (Figure 5.8, top right). Higher magnification studies in neurons suggest that punctate accumulations of ASO reactivity are intracellular and generally have a perinuclear distribution (Figure 5.8, bottom). The observed knockdown (Figure 5.7) of casp2 thus most likely occurs homogenously in treated neuronal cultures.  Figure 5.8 - Immunological localization of casp2 ASOs in medium spiny neurons (MSNs) in culture. Top – Primary striatal neurons were treated on DIV3 with either 2uM (left) or 0uM (right) ASO. After fixation on DIV10, the neurons were stained with a polyclonal antibody reactive to ASOs (green) and counter-stained with DAPI (blue). Most neurons in the treated culture show accumulated immunoreactivity, which is not observed in the mock treated condition. Bottom – striatal neurons were treated with 2uM casp2 ASO from DIV3-10 and stained with antibodies to beta-tubulin (red) and ASO (green). The ASO immunoreactivity clusters in punctate, primarily perinuclear, spots that co-stain with beta-tubulin.  120  5.5. Post-casp2 ASO excitotoxicity While protection observed in casp2-/- striatal neurons response to NMDA is robust, it is not possible to remove confounds of developmental contributions to cell death pathways, which can be considerable (Troy et al., 2001). To circumvent this problem, primary embryonic striatal neurons from wild type (WT) FVB/N mice were treated with antisense oligonucleotides (page 115) targeting casp2. Neurons treated with 500uM NMDA after 7 days of casp2 ASO treatment are significantly protected from NMDAinduced loss of viability (Figure 5.9 panel C, casp2 ASO treated neurons lose 42% viability compared to 61% loss in control ASO, one-way ANOVA casp2 levels F(2,42)=7.18, p = 0.0022). The protection afforded to casp2 ASO treated neurons is intermediate between casp2+/+ and casp2-/- neurons, as would be predicted from incomplete knockdown (Figure 5.9 panel D, one-way ANOVA casp2 levels F(2,42)=7.18, p = 0.0022). These data support the validity of the protection observed in the casp2-/- neurons, and reinforce the idea that absence of casp2 is associated with changes that affect responses to NMDA.  Figure 5.9 - Casp2 Antisense Oligonucleotides (ASOs) protect striatal neurons from excitotoxicity. Wild type MSNs were treated from DIV3-DIV10 with 2uM of the indicated ASO. A. ASO-treated neurons were exposed to 500uM NMDA on DIV10 and viability normalized to off-target (control) ASO-treated neurons. Treatment with caspase-2 ASOs protects neurons from loss of viability (one-way ANOVA treatment: F(2,21)=17.45, p<0.0001). N = 9 untreated cultures, 6 control treated cultures, 9 casp2 ASO treated cultures, total N = 24. D. Viability after 500uM NMDA in casp2 ASO treated MSNs is intermediate between wild type MSNs and casp2-/- MSNs (one-way ANOVA casp2 levels F(2,42)=7.18, p = 0.0022). N = 9 untreated cultures, 6 control treated cultures, 9 casp2 ASO treated  121 cultures, 9 casp2 -/- cultures, total N = 33. Mean = “+”, horizontal bars = quartiles. **, *** Indicate p<0.01 and p<0.001 for Bonferroni post-hoc tests between genotypes/treatments.  5.6. Behavioral phenotypes In light of the protection of casp2-/- neurons from excitotoxicity, YAC128 mice were bred to a casp2-/- background. Littermates of all four relevant genotypes (WT, YAC128, Casp2-/-, Casp2-/-;YAC128) were tested on a number of previously validated behavioral (Slow et al., 2003a; Van Raamsdonk et al., 2005e) endpoints at 4, 8 and 12 months of age. Neuropathological techniques using MRI, developed in the course of this thesis, were used to analyze potential rescue in casp2-/- mice. 5.6.1. Accelerating rotorod learning Naïve YAC128 mice have progressive learning deficits during training on the rotorod task (Van Raamsdonk et al., 2005e). We trained mice at 4 months on a 2 minute 18 RPM rotorod task (Figure 5.10). Mice falling off the rotorod during training were returned to the rod, to a maximum of 10 falls. The time of the first fall (Figure 5.10 panels A and B) and total number of falls per trial (Figure 5.10 panels A and B) were recorded for 9 trials over three days. Comparing WT and casp2-/- mice suggests that absence of casp2 does not affect this task (Figure 5.10 panel A, two-way repeated measures ANOVA genotype: F(1,472)=0.55, p=0.46; Figure 5.10 panel C, two-way repeated measures ANOVA genotype: F(1,472)=0.69, p=0.41). YAC128 mice fall earlier and more often during rotorod training, which is significantly ameliorated in casp2-/;YAC128 mice (Figure 5.10 panel B, two-way repeated measures ANOVA genotype: F(1,400)=5.44, p=0.024; Figure 5.10 panel D, two-way repeated measures ANOVA genotype: F(1,400)=2.95, p=0.09). The mean of the time to first fall across all 9 trials is 68% of WT levels in the YAC128 mice, but 94% WT levels in the C2-/-;YAC128 mice, suggesting that C2-/-;YAC128 mice are performing at essentially normal levels on this motor learning task.  122  Figure 5.10 - Casp2-/-;YAC128 mice are protected from learning deficits on the rotorod task. A. YAC128 mice fall earlier than WT mice during the rotorod training task, while casp2-/-;YAC128 mice do not (linear mixed effects model trial: F(1,903)=576.52, p < 0.0001; YAC128 F(1,109)=7.74, p = 0.0064, casp2 F(1,109)=1.43, p = 0.23; YAC128/casp2 interaction F(1,109)=5.36, p = 0.0225). B. Examination of the number of falls/trial also demonstrates impairment in the YAC128 mice, which is ameliorated in casp2-/-;YAC128 mice (linear mixed effects model trial: F(1,903)=500.82, p < 0.0001; YAC128 F(1,109)=9.47, p = 0.0026, casp2 F(1,109)=1.09, p = 0.29; YAC128/casp2 interaction F(1,109)=3.97, p = 0.0488). Data represent mean ± SEM. N = 33 casp2+/+ mice, 28 casp2 -/- mice, 28 YAC128 mice and 24 YAC128;casp2-/- mice.  5.6.2. Longitudinal accelerating rotorod YAC128 mice have been repeatedly shown to have deficits on the accelerating rotorod task (Graham et al., 2006a; Slow et al., 2003a; Van Raamsdonk et al., 2005e). This task requires both motor coordination and cognitive flexibility due to the changing speed of the rod during the 5-minute trial. YAC128 mice in the current study show clear deficits on the accelerating rotorod, which is significantly ameliorated in the casp2-/;YAC128 mice (Figure 5.11, linear mixed effects model age: F(1,211)=191.42, p < 0.0001; YAC128 F(1,109)=22.32, p < 0.0001, casp2 F(1,109)=1.10, p = 0.30; YAC128/casp2 interaction F(1,109)=5.68, p = 0.019). By 12 months of age, YAC128 rotorod performance is reduced by 39%, while casp2-/-;YAC128 show virtually normal performance with a 2% reduction in time on the rod.  123  Figure 5.11 - Casp2-/-;YAC128 mice are protected from deficits on the accelerating rotorod task. Mice were tested on an accelerating rotorod (5-40RPM) at 4, 8 and 12 months. Each mouse performed 3 5-minute trials and the mean of three trials recorded. Casp2-/- mice are unaffected on this task, compared to WT littermates while YAC128;casp2-/- perform significantly better than YAC128 mice (linear mixed effects model age: F(1,211)=191.42, p < 0.0001; YAC128 F(1,109)=22.32, p < 0.0001, casp2 F(1,109)=1.10, p = 0.30; YAC128/casp2 interaction F(1,109)=5.68, p = 0.019). Data represent mean ± SEM. N = 33 WT mice, 28 YAC128 mice, 28 casp2-/- mice and 24 YAC128;casp2-/- mice.  5.6.3. Cognitive tests – swimming T-maze Loss of cognitive flexibility is a cardinal feature of HD in human patients (Duff et al., 2007; Lawrence et al., 1996; Lawrence et al., 1998; Paulsen et al., 2001). YAC128 mice have also been shown to have cognitive and affective alterations including depressive behavior (Pouladi et al., 2009), increased anxiety (Menalled et al., 2009; Southwell et al., 2009) and deficits on the reversal phase of a swimming T-maze task (Van Raamsdonk et al., 2005e). Because of its dissociability from weight gain effects, we chose a swimming T-maze task for the present study. In this task (Figure 5.12, panel A, (Van Raamsdonk et al., 2005e)), mice are trained to swim in a specific direction to arrive at a submerged, invisible, platform. Mice rapidly acquire this task, irrespective of genotype (Figure 5.12 panel B, left, two-way repeated measures ANOVA genotype: F(3,638)=0.56, p=0.642). On day 5, trial 1, of the task the submerged platform is switched to the opposite arm of the maze (Figure 5.12, panel A). Genotype  124 significantly affects this phase of the test (Figure 5.12 panel B, right, two-way repeated measures ANOVA, genotype: F(3,147)=2.90, p=0.0427). Analysis of the first postreversal trial suggests that YAC128 mice are take longer to reach the submerged platform on this trial than do other mice, while casp2-/-;YAC128 mice perform similarly to WT mice (WT = 13.40 ± 2.72, YAC128 = 19.53 ± 4.33, casp2-/- = 10.80 ± 1.92, casp2-/-;YAC128 mice =10.86 ± 2.48 seconds, Bonferroni t=3.205, p<0.01).  Figure 5.12 - Casp2-/-;YAC128 mice are protected from deficits during the reversal phase of the swimming tmaze. A. Cartoon schematic of apparatus used for swimming T-maze test. B. Mice were trained in a swimming Tmaze to find a submerged platform in one arm of the maze. Acquisition time of the platform location does not differ between genotypes during the first 12 trials (two-way repeated measures ANOVA genotype: F(3,638)=0.56, p=0.642). On trial 1 of day 4 the platform was switched to the opposite arm of the T-maze. Time to the platform in  125 its new location differed by genotype across the 4 trials (two-way repeated measures ANOVA, genotype: F(3,147)=2.90, p=0.0427). YAC128 mice take significantly longer to reach the platform on the first trial than YAC128;casp2-/- mice (19.5 seconds vs. 10.86 seconds, Bonferroni t=3.205, p<0.01). Data represent mean ± SEM. N = 33 WT mice, 28 YAC128 mice, 28 casp2-/- mice and 24 YAC128;casp2-/- mice. * Indicates p<0.05 for Bonferroni post-hoc tests between genotypes. Y-axes have been separated to improve visibility.  To examine the etiology of the increased time to platform during the reversal phase, the number of arm re-entries was examined. Animals were scored based upon the number of times they re-entered the previously correct arm of the maze before eventually discovering the new platform location. YAC128 mice re-enter the previously correct arm significantly more than casp2-/-;YAC128 mice (Figure 5.13, twotailed unpaired t-test with Welch’s correction, t(31)=2.26, p = 0.031). This perseverative behavior is reminiscent of phenotypes observed in human HD patients, and suggests that the casp2-/-;YAC128 mice are significantly protected from this loss of flexibility.  Figure 5.13 - Casp2-/-;YAC128 mice commit less arm re-entry errors than YAC128 mice. Increased time to platform in the YAC128 mice in the swimming T-maze was primarily due to increased perseveration. YAC128 mice re-entered the previously correct arm more frequently than YAC128;casp2-/- mice (two-tailed unpaired t-test with Welch’s correction, t(31)=2.26, p = 0.031). Each replicate is shown. N = 28 YAC128 mice and 24 YAC128;casp2-/mice.  126 5.6.4. Cognitive tests – pre-pulse inhibition Pre-pulse inhibition (PPI) refers to the tendency of startle responses to decrease when preceded by lower intensity “warning” stimuli (Braff et al., 2001). As a phenotype, PPI is interesting because it is altered in multiple human diseases, and is furthermore conserved from invertebrates to humans. Human HD patients display altered PPI (Swerdlow et al., 1995), as do YAC128 mice (Van Raamsdonk et al., 2005e). As a prelude to PPI experiments, we examined startle responses to auditory stimuli between 75-120dB. No effects of genotype was observed, while intensity had a significant effect, despite being presented in a randomized order (Figure 5.14, repeated measures two-way ANOVA intensity: F(9,351)=24.67, p < 0.0001; genotype: F(3,39)=0.24, p = 0.87; interaction: F(27,351)=0.41, p = 1.0).  Figure 5.14 - Baseline startle response does not differ in casp2-/-, YAC128 or casp2-/-;YAC128 mice. Startle amplitude was measured in response to 75-120dB stimuli, presented in a randomized manner. No effect of genotype was observed, while intensity had a significant effect (repeated measures two-way ANOVA intensity: F(9,351)=24.67, p < 0.0001; genotype: F(3,39)=0.24, p = 0.87; interaction: F(27,351)=0.41, p = 1.0). N = 7 WT mice, 12 YAC128 mice, 9 casp2-/- mice and 12 YAC128;casp2-/- mice.  On the day following startle measurements, mice were tested in a randomized PPI paradigm with warning tones of 2, 4 or 16dB above background noise levels. YAC128 mice show deficits in PPI, which is ameliorated in casp2-/-;YAC128 mice (Figure 5.15,  127 one-way ANOVA 2dB: F(3,36)=4.49, p=0.0089; 4dB: F(3,38)=3.10,p=0.04; 16dB F(3,34)=2.25,p=0.01). While genotype has a significant effect at all three intensities, the variance explained by genotype is inversely proportional to pre-pulse intensity, suggesting that YAC128 mice may be selectively impaired at lower intensities.  Figure 5.15 - Casp2-/-;YAC128 mice are protected from pre-pulse inhibition defects. One day following startle testing (Figure 5.14) mice were tested in a PPI paradigm with a pre-pulse tone at 2 (A), 4 (B) or 16 (C) dB above background noise. Lower intensity pre-pulses led to more obvious deficits in the YAC128 mice (one-way ANOVA 2dB: F(3,36)=4.49, p=0.0089; 4dB: F(3,38)=3.10,p=0.04; 16dB F(3,34)=2.25,p=0.01). * indicates p < 0.05 NewmanKeuls multiple comparison test. Mean = “+”, horizontal bars = quartiles. N = 7 WT mice, 12 YAC128 mice, 9 casp2-/mice and 12 YAC128;casp2-/- mice.  5.7. Pathological phenotypes Pathological atrophy in human HD patients (Vonsattel et al., 1985), as well as YAC128 mice (Slow et al., 2003a; van Raamsdonk et al., 2005; Van Raamsdonk et al., 2007b), is tissue specific. In the YAC128 mice the only major organs that are decreased in weight are the testes and the brain (Van Raamsdonk et al., 2006a), suggesting these tissues are selectively vulnerable to mutant huntingtin induced toxicity. We thus examined brain and testes weight, as well as CNS structure volumes using novel MRI tools (page 49). In light of the specific reduction of circulating sterols we further examined circulating lipid levels.  128 5.7.1. Plasma pathology – circulating lipids YAC128 mice have specific reductions in circulating sterols (see 3.2.1). In order to examine the effect of casp2 ablation on this phenotype, we measured plasma cholesterol and phospholipid levels at 12 months of age. Recapitulating earlier results, we verified that YAC128 mice have reduced plasma cholesterol (Figure 5.16, panel A), as well as phospholipids, which are also regulated by SREBP’s (Horton et al., 2003; Figure 5.16, panel B). The casp2-/- mice also had reductions in circulating cholesterol and phospholipids. The lipid levels in the casp2-/-;YAC128 mice were similar to casp2/- or YAC128 mice, suggesting that the absence of casp2 does not rescue the molecular phenotype underlying reduced lipid levels.  200 100 0  *  400  **  ***  300 200 100 0  T W  Genotype (N)  YA C1 28 (9 ) Ca sp 2/Ca (1 sp 8) 2/-; YA C1 28 (1 4)  ***  (2 0)  300  ***  T  ***  Plasma Phospholipids - 12 Months 500  W  400  B. Plasma Phospholipids (mg/dl)  Plasma Cholesterol - 12 Months  (2 2) YA C1 28 (1 1) Ca sp 2/Ca (1 sp 7) 2/-; YA C1 28 (1 4)  Plasma Cholesterol (mg/dl)  A.  Genotype (N)  Figure 5.16 – Reduced circulating cholesterol and phospholipids in the casp2-/- and YAC128 mice. A. Circulating cholesterol is reduced in the YAC128 mice and the casp2-/- mice, with no exacerbation of the phenotype in the double mutant mice (one-way ANOVA F=14.0, p < 0.0001). B. Circulating phospholipids are also decreased in both YAC128 and casp2-/- mice with no observed alteration of the phenotype in the casp2-/-;YAC128 mice (one way ANOVA F=9.28, p < 0.0001). Mean = “+”, horizontal bars = quartiles, isolated circles = outliers. N = 6 WT mice, 8 YAC128 mice, 1 casp2-/- mice and 7 YAC128;casp2-/- mice.  5.7.2. Tissue atrophy phenotypes – testes and forebrain weight Previous examinations of the YAC128 mice have demonstrated specific brain and tests atrophy at 12 months of age (Slow et al., 2003a; Van Raamsdonk et al., 2006a).  129 Testicular atrophy was observed in the male YAC128 mice in the current study, which is not rescued in the casp2-/-;YAC128 mice (Figure 5.17 panel A, WT = 0.080 ± 0.0015, YAC128 = 0.070 ± 0.0025, casp2-/- = 0.090 ± 0.0018, casp2-/-;YAC128 = 0.064 ± 0.0041 grams, two-way ANOVA YAC128: F(1,18)=5.70, p=0.028; C2: F(1,18)=0.10, p=0.75, Interaction: F(1,18)=1.19, p=0.30). Brain atrophy in the YAC128 mice is regionally specific; the forebrain shows progressive loss while the cerebellum is relatively spared (Slow et al., 2003a). Absence of casp2 does not affect this phenotype (Forebrain: Figure 5.17 panel B, WT = 0.3057 ± 0.0043, YAC128 = 0.2957 ± 0.0047, casp2-/- = 0.3014 ± 0.0039, casp2-/-;YAC128 = 0.2941 ± 0.0035 grams, two-way ANOVA YAC128: F(1,39)=4.50, p=0.04; C2: F(1,39)=0.43, p=0.52, Interaction: F(1,39)=.10, p=.75)  Figure 5.17 – Forebrain and testicular atrophy is not rescued in casp2-/-;YAC128 mice. A. Forebrains were fixed by perfusion with 4% paraformaldehyde and dissected. Forebrain weight is decreased in YAC128 mice, and not rescued in casp2-/-;YAC128 mice (two-way ANOVA YAC128: F(1,39)=4.50, p=0.04; C2: F(1,39)=0.43, p=0.52, Interaction: F(1,39)=.10, p=.75). B. Testes were fixed by perfusion with 4% paraformaldehyde and dissected. Testicular weight is decreased in YAC128 mice, and not rescued in casp2-/-;YAC128 mice (two-way ANOVA YAC128: F(1,18)=5.70, p=0.028; C2: F(1,18)=0.10, p=0.75, Interaction: F(1,18)=1.19, p=0.30). F- and p-values for two-way ANOVA indicated. Mean = “+”, horizontal bars = quartiles, isolated circles = outliers. N = 6 WT mice, 8 YAC128 mice, 1 casp2-/- mice and 7 YAC128;casp2-/- mice.  5.7.3. Central phenotypes – EM48 nuclear translocation Although wild type huntingtin is a primarily cytoplasmic protein (Difiglia et al., 1995) a role for nuclear mutant huntingtin has been proposed based on in vitro and in vivo studies (Li et al., 1999; Peters et al., 1999). Caspase-6 resistant (C6R) mice, which are  130 protected from all described symptoms of HD, show delayed nuclear accumulation of mutant huntingtin, relative to YAC128 mice (Graham et al., 2006a). In light of the reduced casp2 activation in the C6R mice (Figure 5.2), we examined whether casp2-/mice were protected from this phenotype. The EM48 antibody selectively reacts with aggregated species of mutant huntingtin (Gutekunst et al., 1999; Wheeler et al., 2000). Specific nuclear accumulation of EM48-immunoreactivity during aging has been seen in both knock-in (Wheeler et al., 2000) and YAC128 (van Raamsdonk et al., 2005) mice. Casp2-/-;YAC128 mice demonstrate normal accumulation of nuclear EM48 immunoreactivity between 4-12 months of age (Figure 5.18, 8 month data shown).  Figure 5.18 - Normal accumulation of nuclear EM48 immunoreactivity in the casp2-/-;YAC128 mice. Intense nuclear EM48 immunoreactivity accumulates in the YAC128 and casp2-/-;YAC128 mice between 4-12 months of age. No staining is observed in WT or casp2-/- mice at any time point (data not shown), suggesting that the recognized epitope is mutant human huntingtin. No differences in onset or intensity are observed in the casp2-/;YAC128 mice.  5.7.4. Central phenotypes – MRI The development of sensitive magnetic resonance imaging (MRI) techniques allows comparison of CNS structure volumes across genotypes, as well as the establishment of more global pathological endpoints (page 49)(Dorr et al., 2008; Lerch et al., 2008b). Application of these techniques to the casp2-/- x YAC128 mice allows refined analysis of the observed central nervous system atrophy in the YAC128 mice.  131 Analysis of global patterns of change in the brains of casp2-/- x YAC128 brains demonstrates the robustness of changes induced by expression of mutant huntingtin, while highlighting basal alterations in the brains of casp2-/- mice. Ventricular volume, shown earlier to be increased in the YAC128 mice (Figure 3.5), is not increased in this group of YAC128 mice. Casp2 mice do show ventricular enlargement, irrespective of YAC128 transgene expression (Figure 5.19, left; two-way ANOVA YAC: F(1,39)=0.71, p = 0.41; C2 F(1,39)=6.41, p =0.015; Interaction F(1,38)=0.58, p = 0.45). The white over gray matter volume ratio (Figure 3.4) is decreased in the group of YAC128 mice, however, casp2-/- mice have a basal reduction in this parameter that is not affected by YAC128 expression (Figure 5.19, left; two-way ANOVA YAC: F(1,39)=2.20, p = 0.14; C2 F(1,39)=1.82, p =0.18; Interaction F(1,38)=2.45, p = 0.13). Examination of only the casp2+/+ mice validates that this measure is reduced by expression of the YAC128 transgene (WT vs. YAC128 two tailed unpaired t-test t(11.17)=2.33, p = 0.040). Each of these global parameters suggests that the casp2-/- mice have basal central alterations, and in neither case do they rescue the changes observed in the YAC128 mice.  132  Figure 5.19 - Global patterns of pathology are basally worsened in the casp2-/- mice. Left – ventricular volume is not increased in YAC128 mice, but is increased in the casp2-/- mice (two-way ANOVA YAC: F(1,39)=2.20, p = 0.14; C2 F(1,39)=1.82, p =0.18; Interaction F(1,38)=2.45, p = 0.13). Right – white over gray matter ratios are also basally decreased in the casp2-/- mice, to levels comparable with YAC128-induced pathology (two-way ANOVA YAC: F(1,39)=2.20, p = 0.14; C2 F(1,39)=1.82, p =0.18; Interaction F(1,38)=2.45, p = 0.13). Whiskers = range, rectangle = interquartile range (IQR), IQR bar = median. N = 9 WT, 11 YAC128, 9 casp2-/- and 14 casp2-/-;YAC128 mice.  While global analyses can be informative, the YAC128 mice have specific neuropathology, which is the target of the current intervention. As expected, the YAC128 mice display atrophy of specific structures including the striatum and globus pallidus (Figure 5.20A and B). Neither structure’s volume is rescued in the casp2-/;YAC128 mice, and in fact the volume of the globus pallidus is significantly worsened in the casp2-/-;YAC128 vs. the YAC128 mice (striatum - two-way ANOVA YAC: F(1,39)=8.58, p = 0.0056; C2 F(1,39)=1.49, p =0.23; Interaction F(1,38)=0.61, p = 0.44 ; globus pallidus - two-way ANOVA YAC: F(1,39)=12.42, p = 0.0011; C2 F(1,39)=15.30, p =0.00036; Interaction F(1,38)=0.54, p = 0.46). This demonstrates that ablation of casp2  133 is not associated with rescue of basal ganglia atrophy in HD, and may in fact slightly worsen this phenotype. Previous stereological (Slow et al., 2003a; van Raamsdonk et al., 2005) and MRI (Figure 3.9, Figure 3.10) studies of the YAC128 mice have described relative sparing of the hippocampus and trends towards hypertrophy in the cerebellum. Detection of total brain volume with MRI enables the relative values of tissues to be compared. The relative volumes of the hippocampus and the cerebellum are increased in the YAC128 mice, which is again not rescued in the casp2-/-;YAC128 mice. The hippocampal volume of the casp2-/- mice is slightly smaller than the casp2+/+ mice, irrespective of YAC128 genotype (hippocampus - two-way ANOVA YAC: F(1,39)=7.16, p = 0.011; C2 F(1,39)=6.93, p =0.012; Interaction F(1,38)=0.0076, p = 0.93; cerebellum - two-way ANOVA YAC: F(1,39)=22.11, p < 0.0001; C2 F(1,39)=1.28, p =0.27; Interaction F(1,38)=0.21, p = 0.64). These data validate the relative preservation of some tissues in HD, and reinforce the lack of rescue provided by ablation of casp2. They furthermore highlight the difficulty in interpreting the effect of one intervention – YAC128 transgene expression – while also intervening on another level – ablation of casp2-/-. Because casp2 ablation has independent phenotypic effects, parsing the cause of each effect is difficult. One approach to solve the problem is to use more complex endpoints that take into account multiple aspects of pathology. We have established a “compound pathology” score that combines several aspects of HD neuropathology. First, all effects are scaled by subtracting each individual value from its grand mean and dividing by the root mean square. This has the effect of centering the grand average on 0 while mainlining relative variance. Several of these values can be combined Compound Pathology = (Ventricular Volume) - (White/Gray Ratio) - (Cerebellar Volume) – (Striatal Volume) This is subject to the criticism that it “double-counts” pathology, but provides the benefit of ascertaining the average, scaled, effect of transgene expression on multiple  134 endpoints. Because this average is comprised of multiple phenotypes, single specific variations are unlikely to have an obscuring effect on rescue. This score provides a simple snapshot of HD-relevant pathology, whose rescue should be observable as a significant interaction term in an ANOVA with factors of YAC128 expression and level of treatment. In this case, YAC128 pathology is very clear, and the lack of rescue by casp2 ablation is obvious (Figure 0.1E; two-way ANOVA YAC: F(1,39)=20.40, p < 0.0001; C2 F(1,39)=3.25, p =0.079; Interaction F(1,38)=0.029, p = 0.87). While several central structures show specific alteration in the casp2-/- mice, as discussed (page 100), no major gray matter structure affected by YAC128 expression are rescued in the casp2-/;YAC128 mice (Appendix B – Structure Volumes in Casp2-/- x YAC128). Thus, while ablation of casp2 produces clear phenotypes in normal and YAC128 mice, it does not rescue the specific pathological tissue loss observed.  135  Figure 5.20 - YAC128 mice have alterations in specific structure volumes, as a % of total brain volume, which are not rescued by ablation of casp2. A. Striatum (two-way ANOVA YAC: F(1,39)=8.58, p = 0.0056; C2  136 F(1,39)=1.49, p =0.23; Interaction F(1,38)=0.61, p = 0.44 ). B. Globus pallidus (two-way ANOVA YAC: F(1,39)=12.42, p = 0.0011; C2 F(1,39)=15.30, p =0.00036; Interaction F(1,38)=0.54, p = 0.46). C. Hippocampus - two-way ANOVA YAC: F(1,39)=7.16, p = 0.011; C2 F(1,39)=6.93, p =0.012; Interaction F(1,38)=0.0076, p = 0.93. D. Cerebellum - two-way ANOVA YAC: F(1,39)=22.11, p < 0.0001; C2 F(1,39)=1.28, p =0.27; Interaction F(1,38)=0.21, p = 0.64. E. Compound pathology score (two-way ANOVA YAC: F(1,39)=20.40, p < 0.0001; C2 F(1,39)=3.25, p =0.079; Interaction F(1,38)=0.029, p = 0.87). Mean = “+”, horizontal bars = quartiles, isolated circles = outliers. N = 9 WT, 11 YAC128, 9 casp2-/- and 14 casp2-/-;YAC128 mice.  137  6. Discussion This thesis was focused on the primary goal of elucidating the contribution of casp2 to HD pathogenesis. In addition, novel aspects of HD-related pathology have been described in the YAC128 mouse, empowering deeper investigation into the pathogenesis of HD. First, a MRI-based natural history of the development of neuropathology established the broadest described picture of HD-induced neurodegeneration in a faithful genetic model of the disease. Secondly, plasma based measurements of sterol metabolism were shown to be altered in the YAC128 mice. These observations in the mice empowered human investigations that revealed novel disease-related phenotypes. Careful consideration of phenotypes in mice lacking casp2 revealed new insights into casp2 biology – a number of metabolic alterations in the mice suggest that casp2 plays an unappreciated role in the regulation of feeding behavior. These findings demonstrate that a deep understanding of the phenotypes of knockout mice is required to properly interpret the function of targeted genes, and that phenotypes may occur in unexpected paradigms. The establishment of YAC128 mice lacking casp2 enabled investigation into rescue provided by casp2 inhibition. Casp2-/;YAC128 mice were found to be protected from many behavioral, but not neuropathological, signs and symptoms of HD, highlighting an unappreciated role for casp2 in neuronal function. A number of future studies are suggested by the present study. First - the search for tools capable of post-natal silencing of casp2 in primary neurons led to the observation that antisense oligonucleotides (ASOs) are potent and effective tools for use in these cells. This technology has potentially broad application, including screening for molecules that silence neurodegenerative disease causing proteins. A limitation of the casp2-/- x YAC128 study is the lack selective caspase activity assays, and some suggestions are offered for their creation. Finally, we have conclusively  138 demonstrated that the short isoform of casp2 is upregulated in the brain, which may have important biological implications.  6.1. MRI Structural MRI is the imaging modality closest to application as a biomarker in human HD clinical trials (Hobbs et al., 2009c; Hobbs et al., 2010). The non-invasive, wholebrain types of analyses enabled by MRI make it the ideal tool with which to probe CNS changes – assuming these changes are tightly linked to pathology of interest. Detailed investigations into symptomatic and pre-symptomatic HD mutation carriers have demonstrated clear correlations between symptom development and MRIdetected CNS volume loss (Paulsen et al., 2008; Rosas et al., 2006; Rosas et al., 2008). Different analytic approaches have bee proposed – some favor focus on specific, disease-related structure volumes, such as the caudate or putamen (Aylward et al., 2004; Aylward, 2007). Other investigators favor a global approach based on voxel based morphometric techniques that detect volume changes irrespective of tissue boundaries (Hobbs et al., 2009a). We have used high-resolution MRI and atlas based image analysis techniques to investigate the natural history of neuropathology in the YAC128 mice. This is an important step, as similar techniques are being used in human clinical trials for HD (Hobbs et al., 2010), and their application in the preclinical setting enables the direct comparison of human and mouse data. A major advantage of MRI approaches to quantification of neuropathology is the global nature of the data generated. Rather than obtaining data on a single, predefined, region of interest the entire CNS is captured. This has enabled us to examine the broad patterns of post-natal CNS maturation as well as the development of pathology in the YAC128 mice. A number of parameters measured have never been examined in a HD model organism – including critical ratios such as global white to gray matter ratios. Preferential loss of white matter has been widely described in human HD (Dunlap, 1927; Rosas et al., 2009; Rosas et al., 2005; Rosas et al., 2006), in agreement with the idea of “die-back” of myelinated axons preceding overt neuronal loss in the disease (Han et al., 2010). YAC128 mice have reduced white and gray  139 matter volumes, in concordance with the overall loss of brain volume (Figure 3.1, Figure 3.4). Normalization of these values to total brain volume reveals interesting differences, however – increased relative gray matter and decreased relative white matter, which is also observable as a reduced white/gray matter ratio beginning between 1 and 3 months of age. These data suggest that central white matter is preferentially lost in the YAC128 mice, in agreement with human observations HD (Dunlap, 1927; Rosas et al., 2009; Rosas et al., 2005; Rosas et al., 2006). This finding has important clinical consequences – many HD studies use the death of non-neuronal cells as an endpoint. Imaging data suggests, however, that the most vulnerable constituent of the CNS is not neurons per se, but rather their projections and connections, and that overt cell death may be a later endpoint. Increased total ventricular volume has long been noted in post-mortem analyses of human HD brains (Dunlap, 1927). MRI-based investigations into both symptomatic and pre-symptomatic carriers of the HD mutation supports the idea of increased ventricular volume as a sensitive biomarker for the atrophy of surrounding tissue (Hobbs et al., 2010; Paulsen et al., 2006). Processing of tissue by removal from the skull and sectioning is associated with the induction of artifacts that preclude using ventricular space as an endpoint in histological trials. Detailed comparison of ventricular volumes obtained by MRI and stereological methods in the R6/2 HD model mice demonstrate that ventricles are uniquely deformed during tissue processing (Zhang et al., 2010). We find that total ventricular size is increased in the YAC128 mice, again beginning between 1 and 3 months of age (Figure 3.5), validating the idea that CNS atrophy is associated with detectible ventricular enlargement. Analysis of the volume of individual structures in the YAC128 mice demonstrates a spatiotemporally dynamic pattern of degeneration. Basal ganglia structures are decreased in volume, as predicted (Figure 3.6,Figure 3.7), but the onset of these changes is significantly earlier than expected (Slow et al., 2003a). Striatal volume, the most widely studied endpoint in MRI studies (Slow et al., 2003a; Van Raamsdonk et al., 2005a; Van Raamsdonk et al., 2005c; Van Raamsdonk et al., 2005d; Van Raamsdonk et  140 al., 2005e; Van Raamsdonk et al., 2006b; Van Raamsdonk et al., 2007a), is decreased in the YAC128 mice between 1-3 months of age, and remains decreased until 12 months of age. This loss of striatal volume persists after normalization for total brain size, unlike relatively spared structures such as the hippocampus. The hippocampus is smaller in the YAC128 mice at some time points, but its relative volume is unchanged (Figure 3.9). This consideration of relative volumes reinforces the uniquely vulnerable nature of the striatum to pathological tissue loss in HD. This finding is in agreement with human studies, which have described striatal volume loss many years before clinical onset of HD (Hobbs et al., 2010; Paulsen et al., 2008). These striatal changes are occurring in the early adulthood of the mice, nicely paralleling the changes observed in human HD patients. Why is the striatum uniquely affected in HD? Imaging data from aging studies suggests that even in the absence of CAG expansion in the HTT gene, the volume of the striatum shrinks faster than the brain as a whole (Gunning-Dixon et al., 1998; Jernigan et al., 2001; Matochik et al., 2004; Murphy et al., 1992; Walhovd et al., 2005). Long-term studies in aging primates validate this finding, and further suggest that caloric restriction is associated with specific rescue of atrophy in the putamen (Colman et al., 2009). This diet-sensitive atrophy of striatal tissue suggests some link between metabolic state and long-term striatal maintenance. In agreement with this idea, systemic administration of the mitochondrial respiratory chain inhibitor 3nitorpropionic acid causes specific striatal damage (Hamilton and Gould, 1987) – suggesting that of all the tissues in the body the striatum is the most metabolically tenuous. HD patients have widespread metabolic alterations (Petersén and Björkqvist, 2006) and weight loss despite adequate caloric intake is a prominent feature of the disease (Morales et al., 1989). Expansion of the CAG repeat in HTT, even within the non-pathogenic range, leads to reduced cellular ATP/ADP ratios, implying energetic deficits that are strongly responsive to CAG expansion (Seong et al., 2005). Fibroblasts from mice engineered to express murine hdh with no CAG repeats show increased ATP/ADP ratios, confirming the inverse relationship between the polyQ size in htt and  141 cellular energy levels (Clabough and Zeitlin, 2006). These data suggest that a metabolic compromise due to expression of mutant huntingtin may lead to lack of sufficient metabolic support, and that striatal neurons are uniquely sensitive to metabolic compromise. The progression of specific neuropathology, in this model, may simply reflect the metabolic robustness of the underlying tissues. If a metabolic threshold exists (measured in ATP concentration, or reducing potential etc.), below which cells die, this threshold would necessarily vary from cell type to cell type. This variation would impose a gradient of vulnerability to metabolic stress onto every cell in the body. A state change, such as reduced metabolic efficiency, would then place each cell under a small, constant, risk of dropping below this metabolic threshold. In this model of disease progression, symptoms would emerge when sufficient damage has occurred to a population of cells that their impairment became clinically obvious. This model is consistent with more diffuse pathology present in late HD, as well as with the idea that the kinetics of cell loss in HD are constant over time (Clarke et al., 2000). This is subtly different than the idea of accumulating damage leading to exponential kinetics implied by such hypotheses as oxidative damage (Clarke et al., 2001). Data from our MRI investigation makes predictions within the framework of this “metabolic compromise” hypothesis. The onset of atrophy implied by MRI results suggests the order of sensitivity to metabolic stress is: Globus Pallidus ~ Striatum > Thalamus > Cerebellum. This makes the testable prediction that neurons from these structures should be sensitive to metabolic stress in corresponding order. Outside the basal ganglia, the present study highlights widespread CNS changes in the YAC128 mice. The frontal cortex is transiently increased in volume (Figure 3.8), which we have shown to be due to increased thickness of this structure (Lerch et al., 2008a). This finding was predicted by human studies (Aylward et al., 1998; Paulsen et al., 2006), though the etiology of increased cortical thickness in HD remains obscure. It has been suggested that this change may be developmental in origin in humans  142 (Paulsen et al., 2006), though conclusive data is lacking for this hypothesis, owing to the difficulty in identifying and scanning sufficiently young HD mutation carriers. The present mouse data suggest that this cortical thickening in is truly transient in nature – 1- and 12-month-old YAC128 mice do not show large alterations in frontal-cortical volume, while between 3-8 months the structure is larger (and thicker) in YAC128 mice. This natural history argues for a dynamic, postnatal, etiology for this transient thickening. Cerebellar volume is also of great interest in HD, because relative sparing of the cerebellum has been noted (Dunlap, 1927; Rosas et al., 2003). Our global voxel based morphometry investigations have shown focal enlargements in the cerebellum in 8month-old YAC128 mice (Lerch et al., 2008b) and stereological analyses have demonstrated trends towards increased cerebellar volume in YAC128 mice at 12 months of age (van Raamsdonk et al., 2005). The natural history provided here suggests mild hypertrophy of the cerebellum in the YAC128 mice, which is pronounced and progressive when expressed as a fractional volume of the brain. This is the clearest described mouse analog to the long noted preservation of cerebellar volume in human HD patients. The global nature of our analyses has also allowed us to very carefully quantify the ratio of total cerebral and cerebellar volume (Figure 3.10), which is progressively reduced in the YAC128 mice – again in agreement with human observations (Dunlap, 1927; Rosas et al., 2003). Within the CNS, the cerebellum expresses the highest levels of mutant huntingtin (Li et al., 1993; Strong et al., 1993). Despite this high expression, the cerebellum is uniquely insensitive to mutant huntingtin’s toxic effects. This suggests that a useful line of investigation would be to directly compare striatal and cerebellar neuronal responses to mutant huntingtin expression. Neurodevelopment does not end with birth. A large portion of CNS maturation occurs postnatally, for many years in the case of humans (Lenroot and Giedd, 2006). We find changes in the neuroanatomy of the murine CNS continues throughout our natural history (1-12 months of age, Figure 3.1, Figure 3.3). The relative contribution of white  143 matter is robustly increased throughout this time period (Figure 3.3). Overall brain volume, as well as the volume of many individual structures, increases to a peak around 8 months of age, before declining by 12 months of age. This monotonic curve is reminiscent of the development of the human nervous system, in which gray matter volume peaks in total volume in late childhood before slowly declining throughout adult life (Giedd et al., 1999; Gogtay et al., 2004). Cortical white matter is relatively preserved in human longitudinal MRI studies (Giedd et al., 1999), explaining how the ratio of white to gray matter declines with aging. Because many of the most robust changes induced by expression of the YAC128 transgene occur between 1-3 months of age, we are forced to address the question of neurodevelopment versus neuropathology. Striatal volume, for example, is normal in the YAC128 mice at 1 month of age (Figure 3.6). By 3 months of age the YAC128 mice have significantly smaller striata than WT mice, however the absolute striatal volume does not peak until 8 months of age. This overlay of developmental enlargement and pathological loss is thus difficult to explain as purely “neuropathological”. In human HD mutation carriers, it has become clear that striatal volume is abnormal many years before clinical onset (Hobbs et al., 2010; Paulsen et al., 2008), suggesting that the unexpectedly early striatal volume detection in the YAC128 mice is actually an accurate modeling of the human condition. What is happening in the developing mouse CNS during this critical window? Neurogenesis occurs primarily in utero, while gliogenesis occurs during late embryogenesis and the early post-natal period (Das, 1977). Myelination of CNS axons occurs during a critical period between birth and roughly 3 months of age. This process requires intense levels of localized lipid biosynthesis, which drop off to low levels after it is complete (Dietschy and Turley, 2004). In light of the cholesterol biosynthetic alterations observed in human HD, as well as the YAC128 mice, it is tempting to speculate that reduced concentrations of lipid species during this critical window may contribute to this phenotype. Our own investigations into sterol concentrations in the brain of 2-month-old YAC128 mice have shown that brain levels  144 of lathosterol are significantly reduced (Valenza et al., 2007a). Lathosterol is a crucial intermediate of cholesterol and its levels are used as a proxy for cholesterol biosynthesis. This reduced biosynthetic rate could result in insufficient levels of cholesterol for CNS myelination, causing or contributing to the neuroanatomical changes observed between 1-3 months of age. An easily tested prediction of this model is that YAC128 mice exposed to HMG-CoAR inhibitors (such as statins) from birth to 3 months of age would develop more pronounced neuropathology in the same structures observed here. MRI in a mouse model of HD has thus been shown to be an extremely powerful tool. Potent endpoints have been developed for the scoring of preclinical trials, and novel biological understanding about the natural history and specificity of neuropathological changes in HD has been produced.  6.2. Plasma cholesterol pathology Our investigations into the plasma cholesterol phenotype of YAC128 and YAC18 mice have provided novel insight into huntingtin function in vivo. Previous work has established that mutant huntingtin expression in the CNS is associated with reduced central synthesis of cholesterol (Sipione et al., 2002; Valenza et al., 2005). We have shown, for the first time, that this phenotype also occurs in the periphery of mice. Moreover, this phenotype is progressive between 2 and 12 months of age, a time of neuropathological development in the mice, suggesting that some processes occurring in the CNS have correlates in the periphery (Figure 3.14). While cholesterol biosynthesis is decreased in the liver of the YAC128 mice, we find that it is specifically increased in YAC18 mice that overexpress wild type human huntingtin (Figure 3.14). This finding demonstrates that cholesterol biosynthesis is a phenotype that is directly responsive to CAG expansion of huntingtin, rather than huntingtin levels which do not have coherent effects on cholesterol biosynthesis (Valenza et al., 2007a). This increase in cholesterol levels in the YAC18 mice appears to reflect increased synthesis, rather than altered half-life, because levels of the  145 cholesterol biosynthetic precursor lanosterol are also increased in the plasma. Because the liver synthesizes most of the circulating cholesterol in fasting animals (Dietschy et al., 1993), and is large and relatively homogenous, this observation provides a useful tool for dissecting huntingtin function. Liver lysates from young and old mice can be used in future as the base material for investigations into huntingtin function, and how this function is progressively compromised in the face of mutation. Our observations of reduced cholesterol biosynthesis in the YAC128 mice were not replicated in human HD patients, who have normal circulating levels of cholesterol and lanosterol (Figure 3.16). However, our investigation into sterol metabolism in patients has highlighted a striking and previously undocumented phenotype – human HD patients absorb fractionally more cholesterol from their diet than do controls. We base this conclusion on the correlated increases in cholestanol and plant sterols (phytosterols) in the plasma of HD patients (Figure 3.17, Figure 3.18). While confounded by possible dietary effects (Morales et al., 1989), the proportional increases in cholestanol/cholesterol suggest that HD patients are cholesterol “absorbers” rather than “synthesizers” (Miettinen, 1989; Miettinen et al., 1998; Nissinen et al., 2008). This absorptive difference may underlie the normal plasma cholesterol in HD patients – increased dietary absorption could be masking an underlying increased cholesterol demand. Future studies, potentially utilizing stable isotope labeling (Matthan and Lichtenstein, 2004), could explore the exact nature of sterol metabolism changes in HD patients.  6.3. Caspase-2 knockout phenotypes In many ways, knockout mice are the ideal pre-clinical tool. The complete absence of proteins of interest, thanks to genetic excision, provides a clean system for investigating the roles played by these genes. However, careful ascertainment of phenotypes is required to avoid complications by unexpected biological effects. Thanks to their critical role in development, caspase knockout mice have most rigorously been characterized in the embryonic and perinatal period (Bergeron et al., 1998; O'Reilly et al., 2002). Because the signs and symptoms of HD in the YAC128 mice  146 generally occur progressively over the first year of life (Slow et al., 2003a; Van Raamsdonk et al., 2005e), a longer-term approach to characterizing knockout phenotypes in the casp2-/- mice was required. Casp2-/- mice display a number of phenotypes which are previously undescribed. Body weight, for example, is progressively decreased in the casp2-/- mice (Figure 4.4). A single published manuscript has described reduced body fat mass in extremely old casp2-/- mice (Zhang et al., 2007), without description of total body weight. We find that body weight becomes significantly reduced in casp2-/- mice at later time points, particularly in male mice. This observation motivated a deeper analysis of metabolism in the casp2-/- mice. Magnetic resonance spectroscopy revealed that while body weight is nearly normal at 4 months of age, the body composition is already altered such that there is a significantly smaller component of body weight deriving from fat mass (Figure 4.5). These findings suggest that while casp2-/- mice fail to gain weight later in life, the underlying metabolic alteration may be basal. Indirect calorimetry validates the hypothesis that relatively young (4 month old) casp2-/- mice have abnormal metabolic functions. Casp2-/- mice eat less food (Figure 4.6, Figure 4.7) and have reduced total energy production (Figure 4.10) particularly during the dark (active) phase of the light cycle. These differences persist when normalized to lean body mass, the fraction of body mass that is responsible for the majority of caloric demand. Despite these reductions in food intake and energy output, the mice have normal long-term activity levels (Figure 4.9). More specific analysis of the basal metabolic rate, measured when the mice are inactive, supports the idea that casp2-/- mice basally produce less energy basally (Figure 4.11). Later onset alterations to the liver and plasma, including increased hepatocyte nuclear area, increased hepatic HMG-CoAR transcript levels (Figure 4.13) and reduced plasma cholesterol (Figure 4.12), may be consequences of these basal metabolic alterations. Examination of central phenotypes in the casp2-/- mice demonstrates that the hypothalamus is significantly reduced in relative volume in the casp2-/- mice (Figure  147 4.15). In agreement with the MRI data, the total number of hypothalamic neurons is also reduced in casp2-/- mice (Figure 4.15). The hypothalamus, in particular the arcuate nucleus and lateral hypothalamic area, play key roles in regulation of appetite and feeding via parallel pathways with opposing effects on feeding behavior ((Crowley et al., 2002), Figure 6.1A). Analysis of the specific regions of volume loss by MRI suggests these regions are specifically atrophic in casp2-/- mice (Figure 6.1B). The specific loss of volume and neurons suggests that hypothalamic alterations likely underlie the observed metabolic changes in casp2-/- mice, and that more detailed studies into the specific population of neurons lost could provide additional understanding of the role played by casp2 in the regulation of feeding behavior. The clear prediction from this thesis is that these alterations are associated with loss of volume and cell number in the hypothalamus, likely in the lateral hypothalamic area and arcuate nucleus. A.  B.  Lateral Hypothalamic Area  Ventricles Food Intake MCH  ORX  Inhibit Stimulate  Arcuate  Hypothalamus NPY  POMC  Body Fat Insulin/ Glucose  Lateral Hypothalamic Area  Lateral Hypothalamic Area  Leptin  Arcuate nucleus  Figure 6.1 - Neural circuitry in the hypothalamus regulating food intake. A. Cartoon of the processing of peripheral satiety signals. The arcurate nucleus of the hypothalamus contains clusters of neurons that regulate feeding in response to peripheral satiety signals such as leptin and insulin. Neurons expressing neuropeptide Y and agouti-related peptide (Agrp/NPY) are negatively regulated by satiety signals and have a positive effect on feeding behavior. Neurons expressing Pro-opiomelanocortin (POMC) and Cocaine and amphetamine regulated transcript (CART) have the inverse activity profile – they are activated by satiety signals and have a negative effect on feeding behavior (Crowley et al., 2002). These neurons project to, among other areas, the lateral hypothalamic area where neurons expressing pro-melanin concentrating hormone (MCH) and orexin (ORX) respond by releasing neuropeptides widely in the CNS. B. MRI of 12 month old casp2-/- brain in coronal section (orange image), overlaid with statistical maps of localized tissue volume changes. These changes occur primarily in the lateral hypothalamic area and arcuate nucleus, suggesting these regions are specifically affected in these mice.  148 Casp2-/- mice eat approximately 20% less than WT littermates, and consequently lose body fat mass (Figure 4.6). These mice are, in effect, calorie restricted. Caloric restriction occurs when animals consume less calories than ad libitum amounts, either via daily reduction (as here), or by intermittent fasting. In a diverse array of species, caloric restriction is associated with increased life span and protection from neurodegeneration (Mair and Dillin, 2008). While casp2-/- mice actually have slightly reduced lifespan, this may reflect other pathologies associated with the absence of casp2, such as the accumulation of oxidatively damaged proteins (Zhang et al., 2007). Caloric restriction has been shown to protect other HD model mice from the development of HD symptoms, though it differs from the present case in that the mice were also resistant to neuropathological features of HD (Duan et al., 2003). One possible mechanism underlying the discrepancy between behavioral and pathological rescue in casp2-/-;YAC128 mice is that behavioral symptoms are more susceptible to rescue via caloric restriction, while pathology is more resistant. All of the behavioral rescue observed in the casp2-/-;YAC128 mice occurred between 4-12 months of age (Figure 5.10, Figure 5.11, Figure 5.12, Figure 5.13, Figure 5.15). This time period is after the development of most pathology in the YAC128 mice, as detected by MRI (Figure 5.17, Figure 5.18, Error! Reference source not found.). If the benefits of caloric restriction induced by casp2-/- are late onset, or cumulative, they may occur too late to rescue pathological tissue loss, while providing symptomatic benefit via other means.  6.4. Caspase-2-/- x YAC128 mouse The primary finding of the current thesis is that casp2-/- neurons are resistant to excitotoxicity and casp2-/- mice are protected from behavioral and cognitive features of HD in the YAC128 model. Pathological phenotypes of HD including specific striatal volume loss, nuclear translocation of mutant huntingtin and testicular degeneration are not rescued in the casp-2-/- mice. Furthermore, cleaved caspase-2 accumulates in the brains of aging and YAC128 mice, but not caspase-6-resistant YAC128 mice.  149 This work expands our understanding of the activation of casp2 in HD. An earlier report suggested that transcriptional upregulation, secondary to BDNF loss, could explain increased casp2 levels in HD (Hermel et al., 2004). The data presented here do not support this hypothesis - human microarray data demonstrate that striatal casp2 levels are normal in early stage HD patients. Additionally, striatal casp2 mRNA levels in YAC128 HD mice are equivalent to WT levels during the development of HD behavioral changes. While we do not observe accumulation of casp2 mRNA, we do observe accumulation of cleaved casp2 immunoreactivity in the striatal neurons of aging WT and YAC128 mice. This accumulation is increased in the YAC128 mice, and abrogated in the caspase-6 resistant YAC128 mice, which are also protected from all described motor, cognitive and pathological features of HD (Graham et al., 2006a). Thus, the alteration of a single caspase recognition site in the huntingtin protein’s coding sequence is sufficient to alter caspase activity networks in aging and disease. It furthermore suggests a functional link between huntingtin cleavage at aa586 and subsequent casp2 activation. The causal link implied by reduced casp2 activation in C6R mice is that huntingtin proteolysis at aa586 by caspase-6 is “upstream” of casp2 activation, and that alteration of this single caspase recognition site is sufficient to alter this activation. C6R neurons are more resistant to excitotoxin-induced apoptosis than WT neurons, despite expressing CAG-expanded human huntingtin. The rank order of vulnerability excitotoxicity in neurons is YAC128>WT>C6R (Graham et al., 2006a), paralleling the caspase-2 activation patterns observed here. The idea that htt may regulate caspase activity is not without precedent – htt has been proposed to directly (Zhang et al., 2006) or indirectly (Rigamonti et al., 2000) inhibit caspase-3, potentially by affecting caspase-9 processing (Rigamonti et al., 2001). The current data suggest that htt plays an additional role in regulating casp2 activation after being cleaved by caspase-6.  150 Recent reports suggest that localized activation of caspase-6 in axons can lead to axonal degradation, but not overt cell death (Nikolaev et al., 2009). Caspase-6 activation and cleavage of substrates has also been observed in aging, mild cognitive impairment and Alzheimer’s disease (Albrecht et al., 2007; Guo et al., 2004). While the proform of caspase-6 lacks the CARD or DEATH domains that mediate dimerizationinduced activation of initiator caspases, caspase-6 has been reported to auto-activate in cells (Klaiman et al., 2009). In addition to the functional link between caspases-2 and -6 implied by the current study, among apoptotic caspases (-2,3,6,7,8,9,10), caspases-2 and -6 share a unique upregulation in the rat cortex during aging (Shimohama et al., 2001), suggesting that these caspases may play an unappreciated role in aging neurons. Caspase-2 upregulation and/or activation has been implicated in excitotoxicity following exposure of neurons to malonate (Schulz et al., 1998), kainic acid (Ferrer et al., 2000), and pregnenolone sulfate (Cascio et al., 2002). Several studies (Ferrer et al., 2000; Schulz et al., 1998) have noted dissociation between markers of apoptosis and caspase-2 activation in excitotoxic cell populations. Recent evidence demonstrates a Chk1-supressed apoptotic response to DNA-damage that is mediated by casp2 and bypasses normal apoptotic effectors such as p53, bcl-2 and caspase-3 (Sidi et al., 2008). In light of these concerns, and in order to avoid assumptions about mechanisms of casp2-mediated death, we have used simple viability and toxicity assays to examine casp2 -/- MSNs response to NMDA. This excitotoxic challenge has been well characterized (Graham et al., 2006a; Shehadeh et al., 2006) and rescue from excitotoxic death has been correlated with rescue of signs and symptoms of HD in vivo (Graham et al., 2006a). Casp2 -/- MSNs have a blunted response to NMDA-induced cell death, which is consistent with at least two independent hypotheses. First, if NMDA currents or proximal signaling events were reduced in casp2 -/- neurons, less death would result from this insult. Alternatively, casp2 could play a direct role in mediating excitotoxic cell death downstream of equivalent insults. We have examined cleavage of alpha-II-  151 spectrin to address which of these scenarios is likely. NMDA receptor stimulation leads to calcium influx, which results in the activation of calcium-sensitive calpains and subsequent cleavage of alpha-II-spectrin (Lynch and Baudry, 1987). This cleavage event has been rigorously characterized in vitro (del Cerro et al., 1994) and in vivo (Vanderklish et al., 2000), and is tightly linked to NMDA receptor function via intracellular calcium concentrations. Calpain activation and alpha-II-spectrin cleavage are chronically increased in the striatum of YAC128 mice, and calpain inhibition reduces mutant htt induced cell death in neurons (Cowan et al., 2008). This demonstrates that alpha-II-spectrin cleavage by calpain is a useful marker of NMDA receptor function, and is pathologically increased in HD. The striking reduction of calpain cleavage of alpha-II-spectrin in the casp2-/- neurons suggests that they have blunted NMDA receptor activation, or calcium influx after activation. This altered physiology may underlie the behavioral normalization observed in the casp2-/-;YAC128 mice. The concordance of the acute excitotoxic response with behavioral rescue in the YAC128 mice suggests that this assay may be predictive of neural function and physiology, rather than susceptibility to cell death and subsequent striatal volume loss. Casp2-/- mice are protected from motor and cognitive deficits seen in the YAC128 model of HD. Consistent with previous reports, we show that the YAC128 mice have deficits during the learning phase of the rotorod task at 4 months of age (Van Raamsdonk et al., 2005e). This learning deficit is completely reversed in the YAC128 mice lacking casp2, who are also protected from progressive motor impairment on the previously learned task. This demonstrates that casp2-/-;YAC128 mice are protected from both cognitive and motor aspects of this task. Data from the pre-pulse inhibition and swimming T-maze tasks presented here are consistent with the cognitive flexibility deficits previously observed in the YAC128 mice (Van Raamsdonk et al., 2005e). Both of these tasks were performed significantly better by casp2-/-;YAC128 mice, relative to YAC128 mice. This suggests that YAC128  152 mice lacking casp2 are better able to modify their behavior in response to environmental demands than normal YAC128 mice. Specific deficits in behavioral flexibility are a key feature of the cognitive defects observed in human HD patients (Lawrence et al., 1998; Sprengelmeyer et al., 1995), and improvement of these symptoms in casp2-/-;YAC128 mice supports the idea that casp2 inhibition may have impact on neural function, leading to symptomatic benefit. Despite their protection from behavioral and cognitive symptoms, the volume loss observed in the YAC128 mice in structures such as the striatum and thalamus is not ameliorated by the absence of casp2. Furthermore, nuclear translocation of mutant huntingtin fragments is unaffected in the striatum of YAC128 mice lacking casp2. In the periphery, pathological atrophy of the testes is also not ameliorated in casp2-/;YAC128 mice. The improved performance of the casp2-/-;YAC128 mice on behavioral tasks in the face of pathological tissue loss suggests that neuronal circuits mediating disease relevant behavior are capable of augmentation leading to symptomatic benefit. These experiments demonstrate that loss of volume, per se, is not sufficient to cause all motor and cognitive features of HD in mice. An additional goal of the current study was to objectively evaluate the usefulness of casp2 as a drug target in HD. Our data suggests that casp2 inhibitors are unlikely to rescue HD neuropathology but that casp2 inhibitors may have effects on neuronal function resulting in improved motor and cognitive phenotypes. The single mutation underlying HD has a large array of effects on cells, and if the mutant htt protein cannot be directly targeted for therapy, it may be necessary to target multiple aberrant processes to provide effective therapy for HD. The present study demonstrates that absence of casp2 from conception is associated with alleviation of motor and cognitive symptoms of HD in a mouse model. Previous work in the YAC128 mice has demonstrated that symptomatic treatment with cystamine can protect mice from pathological development without rescuing motor phenotypes (Van Raamsdonk et al., 2005b), while symptomatic treatment with  153 ethyl-EPA provides motor benefit without rescuing neuropathology (Van Raamsdonk et al., 2005d). This dissociability of pathological and behavioral symptoms highlights the potential need for different approaches to treatment at different stages of illness, and also for different signs and symptoms. The value of symptomatic therapy is clear; tetrabenazine, the only FDA-approved drug for HD, is used as an anti-chorea agent with no claim of disease modification (Group, 2006). Based on findings here, casp2 inhibition coupled with neuroprotective therapy may be an effective strategy to combat behavioral, cognitive and neuropathological features of HD.  6.5. Future Directions 6.5.1. MRI This thesis demonstrates the validity and power of MRI in the pre-clinical setting. Continued use will rely upon additional verification and alignment with historical data. Given that YAC128 mice exist who have been rescued from all known symptoms of HD (Graham et al., 2006a), it would be useful to examine their neuroanatomy in more detail using the MRI techniques described here. This in depth analysis could both further validate MRI, by showing neuropathological rescue in the C6R mice, as well as potentially reveal novel aspects of HD biology. For example, if there are regions of the brain that are altered by expression of the YAC128 transgene which are not rescued in the C6R mice, we can surmise that those regions are not required for phenotypic rescue. 6.5.2. Plasma cholesterol The plasma cholesterol findings here suggest that HD patients may be absorbing more cholesterol, at the expense of synthesis. The present data rely, however, on nonfasted patients and so may be confounded by dietary intake. In future experiments, already underway, the data from the present study should be compared to equivalent data collected from fasted patients and controls. If HD patients are maintaining normal cholesterol levels by absorbing fractionally more cholesterol from their diet, as we propose, they may have reduced circulating cholesterol in the fasted state. This  154 would verify the defect in cholesterol biosynthesis, presumably in the liver, and provide a novel biomarker of huntingtin function. 6.5.3. Antisense oligonucleotides In light of the potential compensatory upregulation of other caspases in the casp2-/knockout mice (Troy et al., 2001), we were concerned to find a suitable method for silencing of casp2 for validation of specific endpoints. Remaining faithful to the use of neurons for modeling HD confounds this strategy significantly, as neurons are notoriously resistant to transfection by exogenous nucleic acids (Krichevsky and Kosik, 2002; Ohki et al., 2001; Watanabe et al., 1999). The discovery that antisense oligonucleotides are capable of broadly silencing target genes in primary neuronal cultures represents a major technological advance. The use of ASOs targeting casp2 in our striatal excitotoxicity assay verifies and extends the rescue we observe in this assay from neurons lacking casp2 (Figure 5.3, Figure 5.7). We have been able to demonstrate a dose-dependent relationship between caspase-2 levels and toxicity in response to excitotoxicity, without having to rely on harsh transfection methods and single-cell based assays. Perhaps more importantly, the realization that primary neurons in culture are amenable to transfection with ASOs empowers an entire new class of analyses to be conducted in vitro. ASOs have been shown to be effective in neurons in vivo (Smith et al., 2006), and the current thesis provides a bridge between these whole animal studies and isolated neuronal studies. In the context of an autosomal dominant disorder like HD, an obvious therapeutic approach is post-natal silencing of the mutant gene (Denovan-Wright and Davidson, 2006; Smith et al., 2006). These approaches are being pursued in a number of in vivo studies, based on silencing data obtained in screens that are generally performed in peripheral, transformed, cell lines. The observation that primary neurons are capable of free-uptake of ASO enables the screening of ASOs in primary neurons (Figure 5.9), which are the actual therapeutic target. Efforts are underway to use the free-uptake observed here to screen for allele-  155 specific ASOs targeting only mutant huntingtin (Frank Bennett, Sue Freier, Isis Pharmaceuticals, personal communication), and preliminary data suggests that delivery of ASOs targeting huntingtin results in specific and nearly complete silencing in primary neurons (Figure 6.2).  Transgenic (Human) Htt  Endogenous (Murine) Htt  Figure 6.2 - Example of huntingtin silencing in primary neurons in vitro by anti-huntingtin ASOs. Control ASO has no effect on huntingtin levels, while ASO targeting both alleles eliminates expression of both transgenic and endogenous huntingtin. Human-specific htt ASO treatment eliminates transgenic, human, huntingtin while sparing murine levels.  6.5.4. Caspase-2 assays We have used a neo-epitope antibody to characterize the activation of caspase-2 in vivo (Figure 5.2). In vitro evidence demonstrates close correlations between cleavage at aa316 (recognized by this antibody) and caspase-2 enzymatic activity (Baliga et al., 2004). Use of this antibody is necessitated by the fact that enzymatic assays predicated on cleavage of idealized caspase substrates are known to be unspecific, particularly for caspase-2 (McStay et al., 2008). Our own investigations into etoposideinduced cell death (Figure 4.3) support this lack of specificity, as cells lacking caspase-2 sill effectively cleave zVDVAD-fmk, marketed and described in the literature as a caspase-2 substrate. The extremely high correlation between “caspase-2” and “caspase-3” like activities in these lysates suggests that caspase-3 activity most likely overwhelms specific measurement of caspase-2 in light of is abundance (Faleiro et al., 1997), high level of activity (Garcia-Calvo et al., 1999) and substrate promiscuity (McStay et al., 2008).  156 What is required to more specifically delineate the role played by caspase-2 in is a selective tool. Several approaches could be taken, including detection by binding to a specific binding partner designed by directed evolution that is specific for active caspase-2 (Schweizer et al., 2007). This binding protein has not been made widely available, however, and its specificity has not been demonstrated in vivo. Another approach would be to rely upon combinatorial specificity provided by two independent binding events. We have performed preliminary experiments using zVAD-fmk, an irreversible binder of active caspases (Garcia-Calvo et al., 1998) and the neo-epitope antibody (Abcam AB2251) used in this thesis (Figure 5.2). The concept is to capture conformationally active caspases with one molecular “handle”, in this case strepavidin-biotin-zVAD-fmk conjugate. After application of the biological sample (purified caspases in this case), the plate is probed with an antibody that is putatively specific for the active caspase of interest (Figure 6.3). Because zVAD-fmk binds to the active site of caspases (Garcia-Calvo et al., 1998) and this site is occluded in inactive caspases (Chai et al., 2001), only enzymatically competent caspases should be captured. The use of relatively specific immunological reagents for secondary detection provides an additional level of specificity.  157  Figure 6.3 - Cartoon of combinatorial capture of active caspases. Strepavidin coated plates are bound to biotin-zVAD before being exposed to biological samples containing active caspase enzyme. Bound enzyme is detected by specific anti-active-caspase antibodies.  This approach has been used in pilot experiments which demonstrate that capture of pure enzyme using this technique is possible, and sensitive to ~ 2 ng of added caspase (Figure 6.4). Detection with the active caspase-2 antibody (Abcam AB2251) results in signal from caspase-2 but not -6, whereas the use of an active caspase-6 antibody (Cell Signaling, #9761) results in signal from the addition of purified caspase-6, but not -2. Importantly, caspase-3 addition produced no signal from AB2251 or CS9761 detection (data not shown). However, application of this technique to lysates from cells challenged with acute stressors (eg. etoposide) known to activate caspases, results in no signal suggesting that the sensitivity of the detection methods is insufficient for use in the current format. These data demonstrate that combinatorial capture has the potential to markedly increase the accurate detection of active caspases, but that signal intensity is a limitation. Future efforts directed towards more sensitive detection methods (using time resolved fluorescence resonance energy transfer, for example), could enable the application of this technique to more realistic biological samples.  158  Figure 6.4 - Pilot demonstration of combinatorial caspase ELISA detection. Top – purified caspase-2 was captured on plates coated with streptavidin-biotin-zVAD-fmk. After washing, anti-active caspase-2 was applied and detected with an antibody specific for cleaved casp2 (AB2251). Signal strength correlates with addition of caspase2, but not -6. Bottom - purified caspase-6 was captured on plates coated with streptavidin-biotin-zVAD-fmk. After washing, anti-active caspase-2 was applied and detected with an antibody specific for cleaved casp6 (CS9761).  6.5.5. Caspase-2 transcripts Caspase-2 has a long and short isoform, which are described to be pro- and antiapoptotic, respectively (Wang et al., 1994). In peripheral and transformed cells, the short isoform is short-lived and consequently low abundance (Solier et al., 2005). However, it has been suggested (without quantification) that the brain may express more short transcript than other tissues, and that this may indicate a role in the CNS for caspase-2S (Bergeron et al., 1998). Data presented here demonstrate several novel features of the dynamics of the short form of caspase-2 in the CNS. First, caspase-2S transcript is more abundant in primary neurons in culture (Figure 4.17) than peripheral or transformed cells (Solier et al., 2005). Furthermore, the ratio of  159 caspase-2S/L is higher still in the mature CNS (Figure 4.18), suggesting an active regulation of this ratio in maturing neurons. The ratio between caspase-2S/L is under the control of the protein RBM5, whose binding to caspase-2 pre-mRNA results in the production of more pro-apoptotic caspase-2L (Fushimi et al., 2008). RBM5 regulates alternative splicing of multiple apoptotic genes with antagonistic effects on cell death (Bonnal et al., 2008), is highly expressed in the adult brain (Allen Brain Atlas Resources [Internet]. Seattle (WA): Allen Institute for Brain Science. © 2009. Available from: http://www.brain-map.org) and is expressed from a chromosomal location whose deletion is associated with poor outcome in neuroblastoma patients (Fischer et al., 2006). These facts warrant more detailed investigation of the role played by RBM5mediated regulation of caspase-2S/L levels in neuroblastoma, particularly in light of the recent demonstration that caspase-2 is a tumor suppressor gene (Ho et al., 2009). The caspase-2S/L ratio is basally lower in primary striatal neurons derived from YAC128 HD mice compared to wild type mice and caspase-2S/L ratios are dramatically reduced in response to excitotoxic stimulation (Figure 4.17). This demonstrates that in vitro the ratio of caspase-2S/L is sensitive to disease relevant stimuli, and is affected by expression of mutant huntingtin. However, in vivo, the caspase-2S/L ratio is normal in aging YAC128 mice, suggesting that alterations in the ratio do not underlie the development of HD pathology (Figure 4.18). The development of mice that express only one of the caspase-2 transcripts, or tools to modulate splicing between short and long isoforms will enable more specific investigations of the role played by each isoform of caspase-2.  160  References The World Federation of Neurology Research Group on Huntington's Disease. 1993. Presymptomatic testing for Huntington's disease: a world wide survey. Journal of Medical Genetics. 30, 1020-2. 2008. Antisense Drug Technology. Principles, Strategies, and Applications., Vol., CRC Press, Boca Raton, FL. Acehan, D., Jiang, X., Morgan, D.G., Heuser, J.E., Wang, X., Akey, C.W., 2002. Threedimensional structure of the apoptosome: implications for assembly, procaspase-9 binding, and activation. Mol Cell. 9, 423-32. Albin, R.L., Young, A.B., Penney, J.B., 1989. The functional anatomy of basal ganglia disorders. 12, 366-375. Albrecht, S., Bourdeau, M., Bennett, D., Mufson, E.J., Bhattacharjee, M., LeBlanc, A.C., 2007. Activation of caspase-6 in aging and mild cognitive impairment. Am J Pathol. 170, 1200-9. Allen, J.W., Eldadah, B.A., Huang, X., Knoblach, S.M., Faden, A.I., 2001. Multiple caspases are involved in beta-amyloid-induced neuronal apoptosis. J Neurosci Res. 65, 45-53. Alnemri, E.S., Livingston, D.J., Nicholson, D.W., Salvesen, G., Thornberry, N.A., Wong, W.W., Yuan, J., 1996. Human ICE/CED-3 protease nomenclature. Cell. 87, 171. Ambrose, C.M., Duyao, M.P., Barnes, G., Bates, G.P., Lin, C.S., Srinidhi, J., Baxendale, S., Hummerich, H., Lehrach, H., Altherr, M., 1994. Structure and expression of the Huntington's disease gene: evidence against simple inactivation due to an expanded CAG repeat. Somat Cell Mol Genet. 20, 27-38. Andrade, M.A., Bork, P., 1995. HEAT repeats in the Huntington's disease protein. Nat Genet. 11, 115-6. Andrew, S.E., Goldberg, Y.P., Kremer, B., Telenius, H., Theilmann, J., Adam, S., Starr, E., Squitieri, F., Lin, B., Kalchman, M.A., 1993. The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease. Nat Genet. 4, 398-403. Augood, S.J., Faull, R.L., Love, D.R., Emson, P.C., 1996. Reduction in enkephalin and substance P messenger RNA in the striatum of early grade Huntington's disease: a detailed cellular in situ hybridization study. Neuroscience. 72, 102336. Augood, S.J., Faull, R.L., Emson, P.C., 1997. Dopamine D1 and D2 receptor gene expression in the striatum in Huntington's disease. Ann Neurol. 42, 215-21. Ayala, J.M., Yamin, T.T., Egger, L.A., Chin, J., Kostura, M.J., Miller, D.K., 1994. IL-1 betaconverting enzyme is present in monocytic cells as an inactive 45-kDa precursor. J Immunol. 153, 2592-9.  161 Aylward, E.H., Li, Q., Stine, O.C., Ranen, N., Sherr, M., Barta, P.E., Bylsma, F.W., Pearlson, G.D., Ross, C.A., 1997. Longitudinal change in basal ganglia volume in patients with Huntington's disease. Neurology. 48, 394-9. Aylward, E.H., Anderson, N.B., Bylsma, F.W., Wagster, M.V., Barta, P.E., Sherr, M., Feeney, J., Davis, A., Rosenblatt, A., Pearlson, G.D., Ross, C.A., 1998. Frontal lobe volume in patients with Huntington's disease. Neurology. 50, 252-8. Aylward, E.H., Sparks, B.F., Field, K.M., Yallapragada, V., Shpritz, B.D., Rosenblatt, A., Brandt, J., Gourley, L.M., Liang, K., Zhou, H., Margolis, R.L., Ross, C.A., 2004. Onset and rate of striatal atrophy in preclinical Huntington disease. Neurology. 63, 6672. Aylward, E.H., 2007. Change in MRI striatal volumes as a biomarker in preclinical Huntington's disease. Brain Res Bull. 72, 152-8. Bäckman, L., Robins-Wahlin, T.B., Lundin, A., Ginovart, N., Farde, L., 1997. Cognitive deficits in Huntington's disease are predicted by dopaminergic PET markers and brain volumes. Brain. 120 ( Pt 12), 2207-17. Baliga, B.C., Read, S.H., Kumar, S., 2004. The biochemical mechanism of caspase-2 activation. Cell Death and Differentiation. 11, 1234-41. Baquet, Z.C., Gorski, J.A., Jones, K.R., 2004. Early striatal dendrite deficits followed by neuron loss with advanced age in the absence of anterograde cortical brainderived neurotrophic factor. J Neurosci. 24, 4250-8. Bartzokis, G., Beckson, M., Lu, P.H., Nuechterlein, K.H., Edwards, N., Mintz, J., 2001. Agerelated changes in frontal and temporal lobe volumes in men: a magnetic resonance imaging study. Archives of General Psychiatry. 58, 461-5. Baumgartner, R., Meder, G., Briand, C., Decock, A., D'Arcy, A., Hassiepen, U., Morse, R., Renatus, M., 2009. The crystal structure of caspase-6, a selective effector of axonal degeneration. Biochem J. Beal, M.F., Kowall, N.W., Ellison, D.W., Mazurek, M.F., Swartz, K.J., Martin, J.B., 1986. Replication of the neurochemical characteristics of Huntington's disease by quinolinic acid. Nature. 321, 168-71. Becker, N., Munhoz, R.P., Raskin, S., Werneck, L.C., Teive, H.A.G., 2007. Non-choreic movement disorders as initial manifestations of Huntington's disease. Arq Neuropsiquiatr. 65, 402-5. Benn, C.L., Sun, T., Sadri-Vakili, G., McFarland, K.N., DiRocco, D.P., Yohrling, G.J., Clark, T.W., Bouzou, B., Cha, J.-H.J., 2008. Huntingtin modulates transcription, occupies gene promoters in vivo, and binds directly to DNA in a polyglutamine-dependent manner. J Neurosci. 28, 10720-33. Bennett, C.F., 2008. Pharmacological Properties of 2'-O-Methoxyethyl-modified Oligonucleotides. Antisense Drug Technology. 273-303. Bennett, C.F., Swayze, E.E., 2010. RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu. Rev. Pharmacol. Toxicol. 50, 259-93. Bergeron, L., Perez, G.I., Macdonald, G., Shi, L., Sun, Y., Jurisicova, A., Varmuza, S., Latham, K.E., Flaws, J.A., Salter, J.C., Hara, H., Moskowitz, M.A., Li, E., Greenberg, A., Tilly, J.L., Yuan, J., 1998. Defects in regulation of apoptosis in caspase-2deficient mice. Genes Dev. 12, 1304-14.  162 Berke, S.J.S., Schmied, F.A.F., Brunt, E.R., Ellerby, L.M., Paulson, H.L., 2004. Caspasemediated proteolysis of the polyglutamine disease protein ataxin-3. J Neurochem. 89, 908-18. Berry, R.W., Abraha, A., Lagalwar, S., LaPointe, N., Gamblin, T.C., Cryns, V.L., Binder, L.I., 2003. Inhibition of tau polymerization by its carboxy-terminal caspase cleavage fragment. Biochemistry. 42, 8325-31. Bhide, P.G., Day, M., Sapp, E., Schwarz, C., Sheth, A., Kim, J., Young, A.B., Penney, J., Golden, J., Aronin, N., Difiglia, M., 1996. Expression of normal and mutant huntingtin in the developing brain. J Neurosci. 16, 5523-35. Bird, E.D., Caro, A.J., Pilling, J.B., 1974. A sex related factor in the inheritance of Huntington's chorea. Annals of Human Genetics. 37, 255-60. Birge, R.B., Ucker, D.S., 2008. Innate apoptotic immunity: the calming touch of death. Cell Death and Differentiation. 15, 1096-102. Block-Galarza, J., Chase, K.O., Sapp, E., Vaughn, K.T., Vallee, R.B., Difiglia, M., Aronin, N., 1997. Fast transport and retrograde movement of huntingtin and HAP 1 in axons. Neuroreport. 8, 2247-51. Boatright, K.M., Renatus, M., Scott, F.L., Sperandio, S., Shin, H., Pedersen, I.M., Ricci, J.E., Edris, W.A., Sutherlin, D.P., Green, D.R., Salvesen, G.S., 2003. A unified model for apical caspase activation. Mol Cell. 11, 529-41. Bonnal, S., Martínez, C., Förch, P., Bachi, A., Wilm, M., Valcárcel, J., 2008. RBM5/Luca15/H37 regulates Fas alternative splice site pairing after exon definition. Mol Cell. 32, 81-95. Bonzon, C., Bouchier-Hayes, L., Pagliari, L.J., Green, D.R., Newmeyer, D.D., 2006. Caspase-2-induced apoptosis requires bid cleavage: a physiological role for bid in heat shock-induced death. Mol Biol Cell. 17, 2150-7. Borovecki, F., Lovrecic, L., Zhou, J., Jeong, H., Then, F., Rosas, H.D., Hersch, S.M., Hogarth, P., Bouzou, B., Jensen, R.V., Krainc, D., 2005. Genome-wide expression profiling of human blood reveals biomarkers for Huntington's disease. Proc Natl Acad Sci USA. 102, 11023-8. Borthwick, N.M., Gordon, A., Yates, C.M., 1985. Increased proteins in post-mortem brain in a case of Pick's disease and in Huntington's disease. J Neurol Sci. 71, 377-86. Bouchier-Hayes, L., Martin, S.J., 2002. CARD games in apoptosis and immunity. EMBO Reports. 3, 616-21. Bouchier-Hayes, L., Oberst, A., McStay, G.P., Connell, S., Tait, S.W.G., Dillon, C.P., Flanagan, J.M., Beere, H.M., Green, D.R., 2009. Characterization of cytoplasmic caspase-2 activation by induced proximity. Mol Cell. 35, 830-40. Braff, D.L., Geyer, M.A., Swerdlow, N.R., 2001. Human studies of prepulse inhibition of startle: normal subjects, patient groups, and pharmacological studies. Psychopharmacology (Berl). 156, 234-58. Bretillon, L., Lütjohann, D., Ståhle, L., Widhe, T., Bindl, L., Eggertsen, G., Diczfalusy, U., Björkhem, I., 2000. Plasma levels of 24S-hydroxycholesterol reflect the balance between cerebral production and hepatic metabolism and are inversely related to body surface. J Lipid Res. 41, 840-5.  163 Brooks, S.P., Betteridge, H., Trueman, R.C., Jones, L., Dunnett, S.B., 2006. Selective extradimensional set shifting deficit in a knock-in mouse model of Huntington's disease. Brain Res Bull. 69, 452-7. Butters, N., Sax, D., Montgomery, K., Tarlow, S., 1978. Comparison of the neuropsychological deficits associated with early and advanced Huntington's disease. Archives of Neurology. 35, 585-9. Caine, E.D., Ebert, M.H., Weingartner, H., 1977. An outline for the analysis of dementia. The memory disorder of Huntingtons disease. Neurology. 27, 1087-92. Canu, N., Dus, L., Barbato, C., Ciotti, M.T., Brancolini, C., Rinaldi, A.M., Novak, M., Cattaneo, A., Bradbury, A., Calissano, P., 1998. Tau cleavage and dephosphorylation in cerebellar granule neurons undergoing apoptosis. J Neurosci. 18, 7061-74. Cascio, C., Guarneri, R., Russo, D., De Leo, G., Guarneri, M., Piccoli, F., Guarneri, P., 2002. A caspase-3-dependent pathway is predominantly activated by the excitotoxin pregnenolone sulfate and requires early and late cytochrome c release and cellspecific caspase-2 activation in the retinal cell death. J Neurochem. 83, 1358-71. Cattaneo, E., Zuccato, C., Tartari, M., 2005. Normal huntingtin function: an alternative approach to Huntington's disease. Nat Rev Neurosci. 6, 919-30. Cerretti, D.P., Kozlosky, C.J., Mosley, B., Nelson, N., Van Ness, K., Greenstreet, T.A., March, C.J., Kronheim, S.R., Druck, T., Cannizzaro, L.A., 1992. Molecular cloning of the interleukin-1 beta converting enzyme. Science. 256, 97-100. Chai, J., Wu, Q., Shiozaki, E., Srinivasula, S.M., Alnemri, E.S., Shi, Y., 2001. Crystal structure of a procaspase-7 zymogen: mechanisms of activation and substrate binding. Cell. 107, 399-407. Chan, E.Y.W., Luthi-Carter, R., Strand, A., Solano, S.M., Hanson, S.A., DeJohn, M.M., Kooperberg, C., Chase, K.O., DiFiglia, M., Young, A.B., Leavitt, B.R., Cha, J.-H.J., Aronin, N., Hayden, M.R., Olson, J.M., 2002. Increased huntingtin protein length reduces the number of polyglutamine-induced gene expression changes in mouse models of Huntington's disease. Hum Mol Genet. 11, 1939-51. Chen, X.J., Kovacevic, N., Lobaugh, N.J., Sled, J.G., Henkelman, R.M., Henderson, J.T., 2006. Neuroanatomical differences between mouse strains as shown by highresolution 3D MRI. Neuroimage. 29, 99-105. Choi, D.W., 1987. Ionic dependence of glutamate neurotoxicity. J Neurosci. 7, 369-79. Choi, D.W., Maulucci-Gedde, M., Kriegstein, A.R., 1987. Glutamate neurotoxicity in cortical cell culture. J Neurosci. 7, 357-68. Choi, Y., Lee, B., Cho, H., Reyes, I., Pu, X., Saido, T., Hoyt, K., Obrietan, K., 2009. CREB is a key regulator of striatal vulnerability in chemical and genetic models of Huntington's Disease. Neurobiol Dis. Citron, M., Westaway, D., Xia, W., Carlson, G., Diehl, T., Levesque, G., Johnson-Wood, K., Lee, M., Seubert, P., Davis, A., Kholodenko, D., Motter, R., Sherrington, R., Perry, B., Yao, H., Strome, R., Lieberburg, I., Rommens, J., Kim, S., Schenk, D., Fraser, P., St George Hyslop, P., Selkoe, D.J., 1997. Mutant presenilins of Alzheimer's disease increase production of 42-residue amyloid beta-protein in both transfected cells and transgenic mice. Nature Medicine. 3, 67-72.  164 Clabough, E.B.D., Zeitlin, S.O., 2006. Deletion of the triplet repeat encoding polyglutamine within the mouse Huntington's disease gene results in subtle behavioral/motor phenotypes in vivo and elevated levels of ATP with cellular senescence in vitro. Human Molecular Genetics. 15, 607-23. Clarke, G., Collins, R.A., Leavitt, B.R., Andrews, D.F., Hayden, M.R., Lumsden, C.J., McInnes, R.R., 2000. A one-hit model of cell death in inherited neuronal degenerations. Nature. 406, 195-9. Clarke, G., Lumsden, C.J., McInnes, R.R., 2001. Inherited neurodegenerative diseases: the one-hit model of neurodegeneration. Human Molecular Genetics. 10, 226975. Collins, D., Holmes, C., Peters, T., Evans, A., 1995. Automatic 3-D model-based neuroanatomical segmentation. Human Brain Mapping. 3, 190-208. Colman, R., Anderson, R., Johnson, S., Kastman, E., Kosmatka, K., Beasley, T., Allison, D., Cruzen, C., Simmons, H., Kemnitz, J., Weindruch, R., 2009. Caloric Restriction Delays Disease Onset and Mortality in Rhesus Monkeys. Science. 325, 201. Coté, J., Dupuis, S., Jiang, Z., Wu, J.Y., 2001. Caspase-2 pre-mRNA alternative splicing: Identification of an intronic element containing a decoy 3' acceptor site. Proc Natl Acad Sci USA. 98, 938-43. Cowan, C.M., Fan, M.M.Y., Fan, J., Shehadeh, J., Zhang, L.Y.J., Graham, R.K., Hayden, M.R., Raymond, L.A., 2008. Polyglutamine-Modulated Striatal Calpain Activity in YAC Transgenic Huntington Disease Mouse Model: Impact on NMDA Receptor Function and Toxicity. J Neurosci. 28, 12725-35. Coyle, J.T., Schwarcz, R., 1976. Lesion of striatal neurones with kainic acid provides a model for Huntington's chorea. Nature. 263, 244-6. Crowley, V.E.F., Yeo, G.S.H., O'rahilly, S., 2002. Obesity therapy: altering the energy intake-and-expenditure balance sheet. Nature Reviews Drug Discovery. 1, 27686. Das, G.D., 1977. Gliogenesis during embryonic development in the rat. Experientia. 33, 1648-9. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L., Bates, G.P., 1997. Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell. 90, 537-48. de Smet, M.D., Meenken, C.J., van den Horn, G.J., 1999. Fomivirsen - a phosphorothioate oligonucleotide for the treatment of CMV retinitis. Ocul Immunol Inflamm. 7, 189-98. del Cerro, S., Arai, A., Kessler, M., Bahr, B.A., Vanderklish, P., Rivera, S., Lynch, G., 1994. Stimulation of NMDA receptors activates calpain in cultured hippocampal slices. Neurosci Lett. 167, 149-52. Deng, Y.P., Albin, R.L., Penney, J.B., Young, A.B., Anderson, K.D., Reiner, A., 2004. Differential loss of striatal projection systems in Huntington's disease: a quantitative immunohistochemical study. J Chem Neuroanat. 27, 143-64. Denovan-Wright, E.M., Davidson, B.L., 2006. RNAi: a potential therapy for the dominantly inherited nucleotide repeat diseases. Gene Therapy. 13, 525-31.  165 Di Maria, E., Marasco, A., Tartari, M., Ciotti, P., Abbruzzese, G., Novelli, G., Bellone, E., Cattaneo, E., Mandich, P., 2006. No evidence of association between BDNF gene variants and age-at-onset of Huntington's disease. Neurobiology of Disease. 24, 274-9. Dietschy, J., Turley, S., 2004. Thematic review series: Brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal. J Lipid Res. 45, 1375. Dietschy, J.M., Turley, S.D., Spady, D.K., 1993. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res. 34, 1637-59. DiFiglia, M., Pasik, P., Pasik, T., 1976. A Golgi study of neuronal types in the neostriatum of monkeys. Brain Res. 114, 245-56. Difiglia, M., Sapp, E., Chase, K., Schwarz, C., Meloni, A., Young, C., Martin, E., Vonsattel, J.P., Carraway, R., Reeves, S.A., 1995. Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons. Neuron. 14, 1075-81. Dorr, A.E., Lerch, J.P., Spring, Kabani, N., Henkelman, R.M., 2008. High resolution threedimensional brain atlas using an average magnetic resonance image of 40 adult C57Bl/6J mice. Neuroimage. 42, 60-9. Dragatsis, I., Levine, M.S., Zeitlin, S., 2000. Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat Genet. 26, 300-6. Dragunow, M., Faull, R.L., Lawlor, P., Beilharz, E.J., Singleton, K., Walker, E.B., Mee, E., 1995. In situ evidence for DNA fragmentation in Huntington's disease striatum and Alzheimer's disease temporal lobes. Neuroreport. 6, 1053-7. Droin, N., Rébé, C., Bichat, F., Hammann, A., Bertrand, R., Solary, E., 2001. Modulation of apoptosis by procaspase-2 short isoform: selective inhibition of chromatin condensation, apoptotic body formation and phosphatidylserine externalization. Oncogene. 20, 260-9. Duan, H., Dixit, V.M., 1997. RAIDD is a new 'death' adaptor molecule. Nature. 385, 86-9. Duan, W., Guo, Z., Jiang, H., Ware, M., Li, X.-J., Mattson, M.P., 2003. Dietary restriction normalizes glucose metabolism and BDNF levels, slows disease progression, and increases survival in huntingtin mutant mice. Proc Natl Acad Sci USA. 100, 2911-6. Duff, K., Paulsen, J.S., Beglinger, L.J., Langbehn, D.R., Stout, J.C., Group, P.-H.I.o.t.H.S., 2007. Psychiatric symptoms in Huntington's disease before diagnosis: the predict-HD study. Biol Psychiatry. 62, 1341-6. Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.-M., Standaert, D.G., Hersch, S.M., Mouradian, M.M., Young, A.B., Tanese, N., Krainc, D., 2002. Sp1 and TAFII130 transcriptional activity disrupted in early Huntington's disease. Science. 296, 2238-43. Dunlap, C.B., 1927. Pathologic Changes in Huntington's Chorea with Special Reference to the Corpus Striatum. Archives of Neurology and Psychiatry. 18, 867-943. Duyao, M.P., Auerbach, A.B., Ryan, A., Persichetti, F., Barnes, G.T., McNeil, S.M., Ge, P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L., 1995. Inactivation of the mouse Huntington's disease gene homolog Hdh. Science. 269, 407-10.  166 Ellerby, L.M., Andrusiak, R.L., Wellington, C.L., Hackam, A.S., Propp, S.S., Wood, J.D., Sharp, A.H., Margolis, R.L., Ross, C.A., Salvesen, G.S., Hayden, M.R., Bredesen, D.E., 1999. Cleavage of atrophin-1 at caspase site aspartic acid 109 modulates cytotoxicity. J Biol Chem. 274, 8730-6. Engelmann, G.L., Richardson, A., Katz, A., Fierer, J.A., 1981. Age-related changes in isolated rat hepatocytes. Comparison of size, morphology, binucleation, and protein content. Mech Ageing Dev. 16, 385-95. Faddis, B.T., Hasbani, M.J., Goldberg, M.P., 1997. Calpain activation contributes to dendritic remodeling after brief excitotoxic injury in vitro. J Neurosci. 17, 951-9. Faleiro, L., Kobayashi, R., Fearnhead, H., Lazebnik, Y., 1997. Multiple species of CPP32 and Mch2 are the major active caspases present in apoptotic cells. EMBO J. 16, 2271-81. Fan, M.M.Y., Raymond, L.A., 2007. N-methyl-D-aspartate (NMDA) receptor function and excitotoxicity in Huntington's disease. Prog Neurobiol. 81, 272-93. Fasulo, L., Ugolini, G., Visintin, M., Bradbury, A., Brancolini, C., Verzillo, V., Novak, M., Cattaneo, A., 2000. The neuronal microtubule-associated protein tau is a substrate for caspase-3 and an effector of apoptosis. J Neurochem. 75, 624-33. Fernandes, H.B., Baimbridge, K.G., Church, J., Hayden, M.R., Raymond, L.A., 2007. Mitochondrial sensitivity and altered calcium handling underlie enhanced NMDA-induced apoptosis in YAC128 model of Huntington's disease. J Neurosci. 27, 13614-23. Ferrante, R.J., Kowall, N.W., Beal, M.F., Richardson, E.P., Bird, E.D., Martin, J.B., 1985. Selective sparing of a class of striatal neurons in Huntington's disease. Science. 230, 561-3. Ferrer, I., López, E., Blanco, R., Rivera, R., Krupinski, J., Martí, E., 2000. Differential c-Fos and caspase expression following kainic acid excitotoxicity. Acta Neuropathol. 99, 245-56. Fischer, M., Oberthuer, A., Brors, B., Kahlert, Y., Skowron, M., Voth, H., Warnat, P., Ernestus, K., Hero, B., Berthold, F., 2006. Differential expression of neuronal genes defines subtypes of disseminated neuroblastoma with favorable and unfavorable outcome. Clin Cancer Res. 12, 5118-28. Fushimi, K., Ray, P., Kar, A., Wang, L., Sutherland, L.C., Wu, J.Y., 2008. Up-regulation of the proapoptotic caspase 2 splicing isoform by a candidate tumor suppressor, RBM5. Proceedings of the National Academy of Sciences. 105, 15708-15713. Galluzzi, L., Joza, N., Tasdemir, E., Maiuri, M.C., Hengartner, M., Abrams, J.M., Tavernarakis, N., Penninger, J., Madeo, F., Kroemer, G., 2008. No death without life: vital functions of apoptotic effectors. Cell Death and Differentiation. 15, 1113-23. Galvan, V., Chen, S., Lu, D., Logvinova, A., Goldsmith, P., Koo, E.H., Bredesen, D.E., 2002. Caspase cleavage of members of the amyloid precursor family of proteins. J Neurochem. 82, 283-94. Galvan, V., Gorostiza, O.F., Banwait, S., Ataie, M., Logvinova, A.V., Sitaraman, S., Carlson, E., Sagi, S.A., Chevallier, N., Jin, K., Greenberg, D.A., Bredesen, D.E., 2006. Reversal of Alzheimer's-like pathology and behavior in human APP transgenic mice by mutation of Asp664. Proc Natl Acad Sci USA. 103, 7130-5.  167 Gamblin, T.C., Chen, F., Zambrano, A., Abraha, A., Lagalwar, S., Guillozet, A.L., Lu, M., Fu, Y., Garcia-Sierra, F., LaPointe, N., Miller, R., Berry, R.W., Binder, L.I., Cryns, V.L., 2003. Caspase cleavage of tau: linking amyloid and neurofibrillary tangles in Alzheimer's disease. Proc Natl Acad Sci USA. 100, 10032-7. Garcia-Calvo, M., Peterson, E.P., Leiting, B., Ruel, R., Nicholson, D.W., Thornberry, N.A., 1998. Inhibition of human caspases by peptide-based and macromolecular inhibitors. J Biol Chem. 273, 32608-13. Garcia-Calvo, M., Peterson, E.P., Rasper, D.M., Vaillancourt, J.P., Zamboni, R., Nicholson, D.W., Thornberry, N.A., 1999. Purification and catalytic properties of human caspase family members. Cell Death Differ. 6, 362-9. Gastard, M.C., Troncoso, J.C., Koliatsos, V.E., 2003. Caspase activation in the limbic cortex of subjects with early Alzheimer's disease. Ann Neurol. 54, 393-8. Gatchel, J., Zoghbi, H.Y., 2005. Diseases of unstable repeat expansion: mechanisms and common principles. Nature Reviews Genetics, Published online: 01 October 2005; | doi:10.1038/nrg1689 6, 743-55. Gauthier, L.R., Charrin, B.C., Borrell-Pagès, M., Dompierre, J.P., Rangone, H., Cordelières, F.P., De Mey, J., MacDonald, M.E., Lessmann, V., Humbert, S., Saudou, F., 2004. Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules. Cell. 118, 127-38. Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. The Journal of Cell Biology. 119, 493-501. Gervais, F.G., Xu, D., Robertson, G.S., Vaillancourt, J.P., Zhu, Y., Huang, J., LeBlanc, A., Smith, D., Rigby, M., Shearman, M.S., Clarke, E.E., Zheng, H., Van Der Ploeg, L.H., Ruffolo, S.C., Thornberry, N.A., Xanthoudakis, S., Zamboni, R.J., Roy, S., Nicholson, D.W., 1999. Involvement of caspases in proteolytic cleavage of Alzheimer's amyloid-beta precursor protein and amyloidogenic A beta peptide formation. Cell. 97, 395-406. Gervais, F.G., Singaraja, R., Xanthoudakis, S., Gutekunst, C.-A., Leavitt, B.R., Metzler, M., Hackam, A.S., Tam, J., Vaillancourt, J.P., Houtzager, V., Rasper, D.M., Roy, S., Hayden, M.R., Nicholson, D.W., 2002. Recruitment and activation of caspase-8 by the Huntingtin-interacting protein Hip-1 and a novel partner Hippi. Nat Cell Biol. 4, 95-105. Giedd, J.N., Blumenthal, J., Jeffries, N.O., Castellanos, F.X., Liu, H., Zijdenbos, A., Paus, T., Evans, A.C., Rapoport, J.L., 1999. Brain development during childhood and adolescence: a longitudinal MRI study. Nat Neurosci. 2, 861-3. Gogtay, N., Giedd, J.N., Lusk, L., Hayashi, K.M., Greenstein, D., Vaituzis, A.C., Nugent, T.F., Herman, D.H., Clasen, L.S., Toga, A.W., Rapoport, J.L., Thompson, P.M., 2004. Dynamic mapping of human cortical development during childhood through early adulthood. Proc Natl Acad Sci USA. 101, 8174-9. Goldberg, Y.P., Kalchman, M.A., Metzler, M., Nasir, J., Zeisler, J., Graham, R., Koide, H.B., O'kusky, J., Sharp, A.H., Ross, C.A., Jirik, F., Hayden, M.R., 1996a. Absence of disease phenotype and intergenerational stability of the CAG repeat in transgenic mice expressing the human Huntington disease transcript. Human Molecular Genetics. 5, 177-85.  168 Goldberg, Y.P., Nicholson, D.W., Rasper, D.M., Kalchman, M.A., Koide, H.B., Graham, R.K., Bromm, M., Kazemi-Esfarjani, P., Thornberry, N.A., Vaillancourt, J.P., Hayden, M.R., 1996b. Cleavage of huntingtin by apopain, a proapoptotic cysteine protease, is modulated by the polyglutamine tract. Nat Genet. 13, 442-9. Goldstein, J.L., Brown, M.S., 1990. Regulation of the mevalonate pathway. Nature. 343, 425-30. Gómez-Tortosa, E., MacDonald, M.E., Friend, J.C., Taylor, S.A., Weiler, L.J., Cupples, L.A., Srinidhi, J., Gusella, J.F., Bird, E.D., Vonsattel, J.P., Myers, R.H., 2001. Quantitative neuropathological changes in presymptomatic Huntington's disease. Ann Neurol. 49, 29-34. Graham, R.K., Deng, Y., Slow, E.J., Haigh, B., Bissada, N., Lu, G., Pearson, J., Shehadeh, J., Bertram, L., Murphy, Z., Warby, S.C., Doty, C.N., Roy, S., Wellington, C.L., Leavitt, B.R., Raymond, L.A., Nicholson, D.W., Hayden, M.R., 2006a. Cleavage at the caspase-6 site is required for neuronal dysfunction and degeneration due to mutant huntingtin. Cell. 125, 1179-91. Graham, R.K., Slow, E.J., Deng, Y., Bissada, N., Lu, G., Pearson, J., Shehadeh, J., Leavitt, B.R., Raymond, L.A., Hayden, M.R., 2006b. Levels of mutant huntingtin influence the phenotypic severity of Huntington disease in YAC128 mouse models. Neurobiol Dis. 21, 444-55. Graham, R.K., Pouladi, M.A., Joshi, P., Lu, G., Deng, Y., Wu, N.-P., Figueroa, B.E., Metzler, M., André, V.M., Slow, E.J., Raymond, L., Friedlander, R., Levine, M.S., Leavitt, B.R., Hayden, M.R., 2009. Differential susceptibility to excitotoxic stress in YAC128 mouse models of Huntington disease between initiation and progression of disease. J Neurosci. 29, 2193-204. Gray, M., Shirasaki, D.I., Cepeda, C., André, V.M., Wilburn, B., Lu, X.-H., Tao, J., Yamazaki, I., Li, S.-H., Sun, Y.E., Li, X.-J., Levine, M.S., Yang, X.W., 2008. Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in BACHD mice. J Neurosci. 28, 6182-95. Group, H.S., 2006. Tetrabenazine as antichorea therapy in Huntington disease: A randomized controlled trial. Neurology. 66, 366-372. Group, T.H.s.D.C.R., 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group. Cell. 72, 971-83. Guidetti, P., Bates, G.P., Graham, R.K., Hayden, M.R., Leavitt, B.R., MacDonald, M.E., Slow, E.J., Wheeler, V.C., Woodman, B., Schwarcz, R., 2006. Elevated brain 3hydroxykynurenine and quinolinate levels in Huntington disease mice. Neurobiol Dis. 23, 190-7. Gunawardena, S., Her, L.-S., Brusch, R.G., Laymon, R.A., Niesman, I.R., Gordesky-Gold, B., Sintasath, L., Bonini, N.M., Goldstein, L.S.B., 2003. Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron. 40, 25-40. Gunning-Dixon, F.M., Head, D., McQuain, J., Acker, J.D., Raz, N., 1998. Differential aging of the human striatum: a prospective MR imaging study. AJNR American journal of neuroradiology. 19, 1501-7.  169 Guo, H., Albrecht, S., Bourdeau, M., Petzke, T., Bergeron, C., LeBlanc, A.C., 2004. Active caspase-6 and caspase-6-cleaved tau in neuropil threads, neuritic plaques, and neurofibrillary tangles of Alzheimer's disease. Am J Pathol. 165, 523-31. Guo, Y., Srinivasula, S.M., Druilhe, A., Fernandes-Alnemri, T., Alnemri, E.S., 2002. Caspase-2 induces apoptosis by releasing proapoptotic proteins from mitochondria. J Biol Chem. 277, 13430-7. Gutekunst, C.A., Levey, A.I., Heilman, C.J., Whaley, W.L., Yi, H., Nash, N.R., Rees, H.D., Madden, J.J., Hersch, S.M., 1995. Identification and localization of huntingtin in brain and human lymphoblastoid cell lines with anti-fusion protein antibodies. Proc Natl Acad Sci USA. 92, 8710-4. Gutekunst, C.A., Li, S.H., Yi, H., Mulroy, J.S., Kuemmerle, S., Jones, R., Rye, D., Ferrante, R.J., Hersch, S.M., Li, X.J., 1999. Nuclear and neuropil aggregates in Huntington's disease: relationship to neuropathology. J Neurosci. 19, 2522-34. Hamilton, B.F., Gould, D.H., 1987. Nature and distribution of brain lesions in rats intoxicated with 3-nitropropionic acid: a type of hypoxic (energy deficient) brain damage. Acta Neuropathol. 72, 286-97. Han, I., You, Y., Kordower, J.H., Brady, S.T., Morfini, G.A., 2010. Differential vulnerability of neurons in Huntington's disease: The role of cell type-specific features. Journal of Neurochemistry. Hardy, J., Selkoe, D.J., 2002. The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science. 297, 353-6. Hardy, J., Lam, J., Nguyen, J., O'brien, T., Wells, J., 2004. Discovery of an allosteric site in the caspases. Proceedings of the National Academy of Sciences. 101, 12461. Harjes, P., Wanker, E.E., 2003. The hunt for huntingtin function: interaction partners tell many different stories. Trends Biochem Sci. 28, 425-33. Harper, P.S., 1992. The epidemiology of Huntington's disease. Hum Genet. 89, 365-76. Harris, A.S., Morrow, J.S., 1988. Proteolytic processing of human brain alpha spectrin (fodrin): identification of a hypersensitive site. J Neurosci. 8, 2640-51. Harris, G.J., Pearlson, G.D., Peyser, C.E., Aylward, E.H., Roberts, J., Barta, P.E., Chase, G.A., Folstein, S.E., 1992. Putamen volume reduction on magnetic resonance imaging exceeds caudate changes in mild Huntington's disease. Ann Neurol. 31, 69-75. Harvey, N.L., Trapani, J.A., Fernandes-Alnemri, T., Litwack, G., Alnemri, E.S., Kumar, S., 1996. Processing of the Nedd2 precursor by ICE-like proteases and granzyme B. Genes Cells. 1, 673-85. Harvey, N.L., Butt, A.J., Kumar, S., 1997. Functional activation of Nedd2/ICH-1 (caspase2) is an early process in apoptosis. J Biol Chem. 272, 13134-9. Henkelman, R.M., Baghdadi, L., Sled, J.G., 2006. Presentation of 3D isotropic imaging data for optimal viewing. Magnetic resonance in medicine : official journal of the Society of Magnetic Resonance in Medicine / Society of Magnetic Resonance in Medicine. 56, 1371-4. Hermel, E., Gafni, J., Propp, S.S., Leavitt, B.R., Wellington, C.L., Young, J.E., Hackam, A.S., Logvinova, A.V., Peel, A.L., Chen, S.F., Hook, V., Singaraja, R., Krajewski, S., Goldsmith, P.C., Ellerby, H.M., Hayden, M.R., Bredesen, D.E., Ellerby, L.M., 2004.  170 Specific caspase interactions and amplification are involved in selective neuronal vulnerability in Huntington's disease. Cell Death Differ. 11, 424-38. Ho, L., Read, S., Dorstyn, L., Lambrusco, L., Kumar, S., 2008. Caspase-2 is required for cell death induced by cytoskeletal disruption. Oncogene. Ho, L., Taylor, R., Dorstyn, L., Cakouros, D., Bouillet, P., Kumar, S., 2009. A tumor suppressor function for caspase-2. Proc Natl Acad Sci USA. Ho, P.-K., Hawkins, C.J., 2005. Mammalian initiator apoptotic caspases. FEBS J. 272, 5436-53. Hobbs, N., Henley, S., Ridgway, G., Wild, E., Barker, R., Scahill, R., Barnes, J., Fox, N., Tabrizi, S., 2009a. The Progression of Regional Atrophy in Premanifest and Early Huntington's Disease: A Longitudinal Voxel-Based Morphometry Study. J Neurol Neurosurg Psychiatr. Hobbs, N., Henley, S., Wild, E., Leung, K., Frost, C., Barker, R., Scahill, R., Barnes, J., Tabrizi, S., Fox, N., 2009b. Automated quantification of caudate atrophy by local registration of serial MRI: evaluation and application in Huntington's disease. Neuroimage. Hobbs, N.Z., Henley, S.M.D., Ridgway, G., Wild, E.J., Barker, R., Scahill, R.I., Barnes, J., Fox, N.C., Tabrizi, S., 2009c. The Progression of Regional Atrophy in Premanifest and Early Huntington's Disease: A Longitudinal Voxel-Based Morphometry Study. J Neurol Neurosurg Psychiatr. Hobbs, N.Z., Barnes, J., Frost, C., Henley, S.M.D., Wild, E.J., Macdonald, K., Barker, R.A., Scahill, R.I., Fox, N.C., Tabrizi, S.J., 2010. Onset and Progression of Pathologic Atrophy in Huntington Disease: A Longitudinal MR Imaging Study. American Journal of Neuroradiology. Hodges, A., Strand, A.D., Aragaki, A.K., Kuhn, A., Sengstag, T., Hughes, G., Elliston, L.A., Hartog, C., Goldstein, D.R., Thu, D., Hollingsworth, Z.R., Collin, F., Synek, B., Holmans, P.A., Young, A.B., Wexler, N.S., Delorenzi, M., Kooperberg, C., Augood, S.J., Faull, R.L.M., Olson, J.M., Jones, L., Luthi-Carter, R., 2006. Regional and cellular gene expression changes in human Huntington's disease brain. Hum Mol Genet. 15, 965-77. Hodgson, J.G., Agopyan, N., Gutekunst, C.A., Leavitt, B.R., LePiane, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon, K., Nasir, J., Jamot, L., Li, X.J., Stevens, M.E., Rosemond, E., Roder, J.C., Phillips, A.G., Rubin, E.M., Hersch, S.M., Hayden, M.R., 1999. A YAC mouse model for Huntington's disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron. 23, 181-92. Hoogeveen, A.T., Willemsen, R., Meyer, N., de Rooij, K.E., Roos, R.A., van Ommen, G.J., Galjaard, H., 1993. Characterization and localization of the Huntington disease gene product. Hum Mol Genet. 2, 2069-73. Horowitz, P.M., Patterson, K.R., Guillozet-Bongaarts, A.L., Reynolds, M.R., Carroll, C.A., Weintraub, S.T., Bennett, D.A., Cryns, V.L., Berry, R.W., Binder, L.I., 2004. Early Nterminal changes and caspase-6 cleavage of tau in Alzheimer's disease. J Neurosci. 24, 7895-902. Horton, J.D., Shah, N.A., Warrington, J.A., Anderson, N.N., Park, S.W., Brown, M.S., Goldstein, J.L., 2003. Combined analysis of oligonucleotide microarray data  171 from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci USA. 100, 12027-32. Houde, C., Banks, K.G., Coulombe, N., Rasper, D., Grimm, E., Roy, S., Simpson, E.M., Nicholson, D.W., 2004. Caspase-7 expanded function and intrinsic expression level underlies strain-specific brain phenotype of caspase-3-null mice. J Neurosci. 24, 9977-84. Hsia, A.Y., Masliah, E., McConlogue, L., Yu, G.Q., Tatsuno, G., Hu, K., Kholodenko, D., Malenka, R.C., Nicoll, R.A., Mucke, L., 1999. Plaque-independent disruption of neural circuits in Alzheimer's disease mouse models. Proc Natl Acad Sci USA. 96, 3228-33. Huntington, G., 1872. On chorea. Medical and Surgical Reporter: A Weekly Journal. 26, 317-321. Hutton, M., Lendon, C.L., Rizzu, P., Baker, M., Froelich, S., Houlden, H., Pickering-Brown, S., Chakraverty, S., Isaacs, A., Grover, A., Hackett, J., Adamson, J., Lincoln, S., Dickson, D., Davies, P., Petersen, R.C., Stevens, M., de Graaff, E., Wauters, E., van Baren, J., Hillebrand, M., Joosse, M., Kwon, J.M., Nowotny, P., Che, L.K., Norton, J., Morris, J.C., Reed, L.A., Trojanowski, J., Basun, H., Lannfelt, L., Neystat, M., Fahn, S., Dark, F., Tannenberg, T., Dodd, P.R., Hayward, N., Kwok, J.B., Schofield, P.R., Andreadis, A., Snowden, J., Craufurd, D., Neary, D., Owen, F., Oostra, B.A., Hardy, J., Goate, A., van Swieten, J., Mann, D., Lynch, T., Heutink, P., 1998. Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP17. Nature. 393, 702-5. Jernigan, T.L., Salmon, D.P., Butters, N., Hesselink, J.R., 1991. Cerebral structure on MRI, Part II: Specific changes in Alzheimer's and Huntington's diseases. Biol Psychiatry. 29, 68-81. Jernigan, T.L., Archibald, S.L., Fennema-Notestine, C., Gamst, A.C., Stout, J.C., Bonner, J., Hesselink, J.R., 2001. Effects of age on tissues and regions of the cerebrum and cerebellum. Neurobiol Aging. 22, 581-94. Johnson, C.E., Huang, Y.Y., Parrish, A.B., Smith, M.I., Vaughn, A.E., Zhang, Q., Wright, K.M., Van Dyke, T., Wechsler-Reya, R.J., Kornbluth, S., Deshmukh, M., 2007. Differential Apaf-1 levels allow cytochrome c to induce apoptosis in brain tumors but not in normal neural tissues. Proc Natl Acad Sci USA. 104, 20820-5. Joshi, P.R., Wu, N.-P., André, V.M., Cummings, D.M., Cepeda, C., Joyce, J.A., Carroll, J.B., Leavitt, B.R., Hayden, M.R., Levine, M.S., Bamford, N.S., 2009. Age-dependent alterations of corticostriatal activity in the YAC128 mouse model of Huntington disease. J Neurosci. 29, 2414-27. Kang, B.H., Ko, E., Kwon, O.-K., Choi, K.Y., 2002. The structure of procaspase 6 is similar to that of active mature caspase 6. Biochem J. 364, 629-34. Kang, J., Lemaire, H.G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschik, K.H., Multhaup, G., Beyreuther, K., Müller-Hill, B., 1987. The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature. 325, 7336. Kemp, J.M., Powell, T.P., 1971. The structure of the caudate nucleus of the cat: light and electron microscopy. Philos Trans R Soc Lond, B, Biol Sci. 262, 383-401.  172 Kerwin, R.W., Luscombe, G.P., Pycock, C.J., Sverakova, K., 1980. Behavioural and biochemical studies in rats with N-methyl-D-aspartic acid and kainic acid [proceedings]. British Journal of Pharmacology. 68, 174P-175P. Kidd, M., 1963. Paired Helical Filaments in Electron Microscopy of Alzheimer's Disease. Nature. 197, 192. Kim, T.W., Pettingell, W.H., Jung, Y.K., Kovacs, D.M., Tanzi, R.E., 1997. Alternative cleavage of Alzheimer-associated presenilins during apoptosis by a caspase-3 family protease. Science. 277, 373-6. Kim, Y.J., Yi, Y., Sapp, E., Wang, Y., Cuiffo, B., Kegel, K.B., Qin, Z.H., Aronin, N., DiFiglia, M., 2001. Caspase 3-cleaved N-terminal fragments of wild-type and mutant huntingtin are present in normal and Huntington's disease brains, associate with membranes, and undergo calpain-dependent proteolysis. Proc Natl Acad Sci USA. 98, 12784-9. Kishikawa, S., Li, J.-L., Gillis, T., Hakky, M.M., Warby, S., Hayden, M., MacDonald, M.E., Myers, R.H., Gusella, J.F., 2006. Brain-derived neurotrophic factor does not influence age at neurologic onset of Huntington's disease. Neurobiol Dis. 24, 280-5. Klaiman, G., Champagne, N., Leblanc, A., 2009. Self-activation of Caspase-6 in vitro and in vivo: Caspase-6 activation does not induce cell death in HEK293T cells. Biochim Biophys Acta. 1793, 592-601. Kosik, K.S., Joachim, C.L., Selkoe, D.J., 1986. Microtubule-associated protein tau (tau) is a major antigenic component of paired helical filaments in Alzheimer disease. Proc Natl Acad Sci USA. 83, 4044-8. Kovacević, N., Henderson, J.T., Chan, E., Lifshitz, N., Bishop, J., Evans, A.C., Henkelman, R.M., Chen, X.J., 2005. A three-dimensional MRI atlas of the mouse brain with estimates of the average and variability. Cereb Cortex. 15, 639-45. Kremer, B., Goldberg, P., Andrew, S., Theilmann, J., Telenius, H., Zeisler, J., Squitieri, F., Lin, B., Bassett, A., Almqvist, E., Bird, T., Hayden, M., 1994a. A Worldwide Study of the Huntington's Disease Mutation: The Sensitivity and Specificity of Measuring CAG Repeats. N Engl J Med. 330, 1401. Kremer, B., Goldberg, P., Andrew, S.E., Theilmann, J., Telenius, H., Zeisler, J., Squitieri, F., Lin, B., Bassett, A., Almqvist, E., 1994b. A worldwide study of the Huntington's disease mutation. The sensitivity and specificity of measuring CAG repeats. N Engl J Med. 330, 1401-6. Krichevsky, A.M., Kosik, K.S., 2002. RNAi functions in cultured mammalian neurons. Proc Natl Acad Sci USA. 99, 11926-9. Kuhn, A., Goldstein, D.R., Hodges, A., Strand, A.D., Sengstag, T., Kooperberg, C., Becanovic, K., Pouladi, M.A., Sathasivam, K., Cha, J.-H.J., Hannan, A.J., Hayden, M.R., Leavitt, B.R., Dunnett, S.B., Ferrante, R.J., Albin, R., Shelbourne, P., Delorenzi, M., Augood, S.J., Faull, R.L.M., Olson, J.M., Bates, G.P., Jones, L., LuthiCarter, R., 2007. Mutant huntingtin's effects on striatal gene expression in mice recapitulate changes observed in human Huntington's disease brain and do not differ with mutant huntingtin length or wild-type huntingtin dosage. Hum Mol Genet. 16, 1845-61.  173 Kuida, K., Zheng, T.S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P., Flavell, R.A., 1996. Decreased apoptosis in the brain and premature lethality in CPP32deficient mice. Nature. 384, 368-72. Kuida, K., Haydar, T.F., Kuan, C.Y., Gu, Y., Taya, C., Karasuyama, H., Su, M.S., Rakic, P., Flavell, R.A., 1998. Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell. 94, 325-37. Kumar, S., Tomooka, Y., Noda, M., 1992. Identification of a set of genes with developmentally down-regulated expression in the mouse brain. Biochem Biophys Res Commun. 185, 1155-61. Kumar, S., Kinoshita, M., Noda, M., Copeland, N.G., Jenkins, N.A., 1994. Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of the Caenorhabditis elegans cell death gene ced-3 and the mammalian IL-1 beta-converting enzyme. Genes Dev. 8, 1613-26. Kumar, S., 2007. Caspase function in programmed cell death. Cell Death Differ. 14, 3243. Lakhani, S.A., Masud, A., Kuida, K., Porter, G.A., Booth, C.J., Mehal, W.Z., Inayat, I., Flavell, R.A., 2006. Caspases 3 and 7: key mediators of mitochondrial events of apoptosis. Science. 311, 847-51. Langbehn, D.R., Brinkman, R.R., Falush, D., Paulsen, J.S., Hayden, M.R., Group, I.H.s.D.C., 2004. A new model for prediction of the age of onset and penetrance for Huntington's disease based on CAG length. Clin Genet. 65, 267-77. Lange, K.W., Sahakian, B.J., Quinn, N.P., Marsden, C.D., Robbins, T.W., 1995. Comparison of executive and visuospatial memory function in Huntington's disease and dementia of Alzheimer type matched for degree of dementia. J Neurol Neurosurg Psychiatr. 58, 598-606. Lassus, P., Opitz-Araya, X., Lazebnik, Y., 2002. Requirement for caspase-2 in stressinduced apoptosis before mitochondrial permeabilization. Science. 297, 13524. Lawhorn, C., Smith, D., Brown, L., 2008. Striosome-matrix pathology and motor deficits in the YAC128 mouse model of Huntington's disease. Neurobiol Dis. Lawrence, A.D., Sahakian, B.J., Hodges, J.R., Rosser, A.E., Lange, K.W., Robbins, T.W., 1996. Executive and mnemonic functions in early Huntington's disease. Brain. 119 ( Pt 5), 1633-45. Lawrence, A.D., Hodges, J.R., Rosser, A.E., Kershaw, A., ffrench-Constant, C., Rubinsztein, D.C., Robbins, T.W., Sahakian, B.J., 1998. Evidence for specific cognitive deficits in preclinical Huntington's disease. Brain. 121 ( Pt 7), 1329-41. Leavitt, B.R., Guttman, J.A., Hodgson, J.G., Kimel, G.H., Singaraja, R., Vogl, A.W., Hayden, M.R., 2001. Wild-type huntingtin reduces the cellular toxicity of mutant huntingtin in vivo. Am J Hum Genet. 68, 313-24. Leavitt, B.R., van Raamsdonk, J.M., Shehadeh, J., Fernandes, H., Murphy, Z., Graham, R.K., Wellington, C.L., Raymond, L.A., Hayden, M.R., 2006. Wild-type huntingtin protects neurons from excitotoxicity. J Neurochem. 96, 1121-9. Lee, W.-C.M., Yoshihara, M., Littleton, J.T., 2004. Cytoplasmic aggregates trap polyglutamine-containing proteins and block axonal transport in a Drosophila model of Huntington's disease. Proc Natl Acad Sci USA. 101, 3224-9.  174 Lenroot, R.K., Giedd, J.N., 2006. Brain development in children and adolescents: insights from anatomical magnetic resonance imaging. Neurosci Biobehav Rev. 30, 718-29. Leonard, J.R., Klocke, B.J., D'Sa, C., Flavell, R.A., Roth, K.A., 2002. Strain-dependent neurodevelopmental abnormalities in caspase-3-deficient mice. J Neuropathol Exp Neurol. 61, 673-7. Lerch, J., Yiu, A., Bohbot, V., Henkelman, R., Josselyn, S., Sled, J., 2007. Morris water maze training induces changes in brain shape detectable by MRI. Society for Neuroscience. 104530. Lerch, J.P., Carroll, J.B., Dorr, A., Spring, S., Evans, A.C., Hayden, M.R., Sled, J.G., Henkelman, R.M., 2008a. Cortical thickness measured from MRI in the YAC128 mouse model of Huntington's disease. Neuroimage. 41, 243-51. Lerch, J.P., Carroll, J.B., Spring, S., Bertram, L.N., Schwab, C., Hayden, M.R., Henkelman, R.M., 2008b. Automated deformation analysis in the YAC128 Huntington disease mouse model. Neuroimage. 39, 32-9. Li, H., Bergeron, L., Cryns, V., Pasternack, M.S., Zhu, H., Shi, L., Greenberg, A., Yuan, J., 1997a. Activation of caspase-2 in apoptosis. J Biol Chem. 272, 21010-7. Li, H., Li, S.H., Johnston, H., Shelbourne, P.F., Li, X.J., 2000. Amino-terminal fragments of mutant huntingtin show selective accumulation in striatal neurons and synaptic toxicity. Nat Genet. 25, 385-9. Li, H., Li, S.H., Yu, Z.X., Shelbourne, P., Li, X.J., 2001. Huntingtin aggregate-associated axonal degeneration is an early pathological event in Huntington's disease mice. Journal of Neuroscience. 21, 8473-81. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., Wang, X., 1997b. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell. 91, 479-89. Li, S.-H., Li, X.-J., 2004. Huntingtin-protein interactions and the pathogenesis of Huntington's disease. Trends Genet. 20, 146-54. Li, S.H., Schilling, G., Young, W.S., Li, X.J., Margolis, R.L., Stine, O.C., Wagster, M.V., Abbott, M.H., Franz, M.L., Ranen, N.G., 1993. Huntington's disease gene (IT15) is widely expressed in human and rat tissues. Neuron. 11, 985-93. Li, S.H., Cheng, A.L., Li, H., Li, X.J., 1999. Cellular defects and altered gene expression in PC12 cells stably expressing mutant huntingtin. J Neurosci. 19, 5159-72. Li, W., Serpell, L.C., Carter, W.J., Rubinsztein, D.C., Huntington, J.A., 2006. Expression and characterization of full-length human huntingtin, an elongated HEAT repeat protein. J Biol Chem. 281, 15916-22. Lima, W.F., Crooke, S.T., 1997. Binding affinity and specificity of Escherichia coli RNase H1: impact on the kinetics of catalysis of antisense oligonucleotide-RNA hybrids. Biochemistry. 36, 390-8. Lin, B., Rommens, J.M., Graham, R.K., Kalchman, M., MacDonald, H., Nasir, J., Delaney, A., Goldberg, Y.P., Hayden, M.R., 1993. Differential 3' polyadenylation of the Huntington disease gene results in two mRNA species with variable tissue expression. Hum Mol Genet. 2, 1541-5. Lin, C.-F., Chen, C.-L., Chang, W.-T., Jan, M.-S., Hsu, L.-J., Wu, R.-H., Tang, M.-J., Chang, W.-C., Lin, Y.-S., 2004. Sequential caspase-2 and caspase-8 activation upstream  175 of mitochondria during ceramideand etoposide-induced apoptosis. J Biol Chem. 279, 40755-61. Lin, C.-H., Tallaksen-Greene, S., Chien, W.-M., Cearley, J., Jackson, W., Crouse, A., Ren, S., Li, X.-J., Albin, R., Detloff, P., 2001a. Neurological abnormalities in a knock-in mouse model of Huntington's disease. Hum Mol Genet. 10, 137. Lin, C.H., Tallaksen-Greene, S., Chien, W.M., Cearley, J.A., Jackson, W.S., Crouse, A.B., Ren, S., Li, X.J., Albin, R.L., Detloff, P.J., 2001b. Neurological abnormalities in a knock-in mouse model of Huntington's disease. Human Molecular Genetics. 10, 137-44. Lin, Y., Ma, W., Benchimol, S., 2000. Pidd, a new death-domain-containing protein, is induced by p53 and promotes apoptosis. Nat Genet. 26, 122-7. Litvan, I., Paulsen, J.S., Mega, M.S., Cummings, J.L., 1998. Neuropsychiatric assessment of patients with hyperkinetic and hypokinetic movement disorders. Archives of Neurology. 55, 1313-9. Logette, E., Wotawa, A., Solier, S., Desoche, L., Solary, E., Corcos, L., 2003. The human caspase-2 gene: alternative promoters, pre-mRNA splicing and AUG usage direct isoform-specific expression. Oncogene. 22, 935-46. Logette, E., Le Jossic-Corcos, C., Masson, D., Solier, S., Sequeira-Legrand, A., Dugail, I., Lemaire-Ewing, S., Desoche, L., Solary, E., Corcos, L., 2005. Caspase-2, a novel lipid sensor under the control of sterol regulatory element binding protein 2. Mol Cell Biol. 25, 9621-31. Louis, E.D., Lee, P., Quinn, L., Marder, K., 1999. Dystonia in Huntington's disease: prevalence and clinical characteristics. Mov Disord. 14, 95-101. LUCAS, D.R., NEWHOUSE, J.P., 1957. The toxic effect of sodium L-glutamate on the inner layers of the retina. AMA Arch Ophthalmol. 58, 193-201. Lukes, S.A., Aminoff, M.J., Crooks, L., Kaufman, L., Mills, C., Newton, T.H., 1983. Nuclear magnetic resonance imaging in movement disorders. Ann Neurol. 13, 690-1. Luthi-Carter, Strand, A., Peters, N.L., Solano, S.M., Hollingsworth, Z.R., Menon, A.S., Frey, A.S., Spektor, B.S., Penney, E.B., Schilling, G., Ross, C.A., Borchelt, D.R., Tapscott, S.J., Young, A.B., Cha, J.H., Olson, J.M., 2000. Decreased expression of striatal signaling genes in a mouse model of Huntington's disease. Hum Mol Genet. 9, 1259-71. Lütjohann, D., Björkhem, I., Beil, U.F., Von Bergmann, K., 1995. Sterol absorption and sterol balance in phytosterolemia evaluated by deuterium-labeled sterols: effect of sitostanol treatment. J Lipid Res. 36, 1763-73. Lütjohann, D., Brzezinka, A., Barth, E., Abramowski, D., Staufenbiel, M., von Bergmann, K., Beyreuther, K., Multhaup, G., Bayer, T.A., 2002. Profile of cholesterol-related sterols in aged amyloid precursor protein transgenic mouse brain. J Lipid Res. 43, 1078-85. Lynch, G., Baudry, M., 1987. Brain spectrin, calpain and long-term changes in synaptic efficacy. Brain Res Bull. 18, 809-15. Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., Jansen, G., Neville, C., Narang, M., Barceló, J., O'Hoy, K., 1992. Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science. 255, 1253-5.  176 Maheswaran, S., Barjat, H., Rueckert, D., Bate, S.T., Howlett, D.R., Tilling, L., Smart, S.C., Pohlmann, A., Richardson, J.C., Hartkens, T., Hill, D.L.G., Upton, N., Hajnal, J.V., James, M.F., 2009. Longitudinal regional brain volume changes quantified in normal aging and Alzheimer's APP x PS1 mice using MRI. Brain Res. 1270, 19-32. Mair, W., Dillin, A., 2008. Aging and survival: the genetics of life span extension by dietary restriction. Annu Rev Biochem. 77, 727-54. Mancini, M., Machamer, C.E., Roy, S., Nicholson, D.W., Thornberry, N.A., Casciola-Rosen, L.A., Rosen, A., 2000. Caspase-2 is localized at the Golgi complex and cleaves golgin-160 during apoptosis. J Cell Biol. 149, 603-12. Manoharan, M., 1999. 2'-carbohydrate modifications in antisense oligonucleotide therapy: importance of conformation, configuration and conjugation. Biochim Biophys Acta. 1489, 117-30. Manzl, C., Krumschnabel, G., Bock, F., Sohm, B., Labi, V., Baumgartner, F., Logette, E., Tschopp, J., Villunger, A., 2009. Caspase-2 activation in the absence of PIDDosome formation. J Cell Biol. Marsden, V.S., Ekert, P.G., Van Delft, M., Vaux, D.L., Adams, J.M., Strasser, A., 2004. Bcl-2regulated apoptosis and cytochrome c release can occur independently of both caspase-2 and caspase-9. J Cell Biol. 165, 775-80. Martinon, F., Burns, K., Tschopp, J., 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Molecular cell. 10, 417-26. Matochik, J.A., Chefer, S.I., Lane, M.A., Roth, G.S., Mattison, J.A., London, E.D., Ingram, D.K., 2004. Age-related decline in striatal volume in rhesus monkeys: assessment of long-term calorie restriction. Neurobiol Aging. 25, 193-200. Matthan, N.R., Lichtenstein, A.H., 2004. Approaches to measuring cholesterol absorption in humans. Atherosclerosis. 174, 197-205. MAYER, J., 1955. Regulation of energy intake and the body weight: the glucostatic theory and the lipostatic hypothesis. Ann N Y Acad Sci. 63, 15-43. Mcgeer, E.G., McGeer, P.L., 1976. Duplication of biochemical changes of Huntington's chorea by intrastriatal injections of glutamic and kainic acids. Nature. 263, 5179. McKay, R.A., Miraglia, L.J., Cummins, L.L., Owens, S.R., Sasmor, H., Dean, N.M., 1999. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-alpha expression. J Biol Chem. 274, 171522. McStay, G.P., Salvesen, G.S., Green, D.R., 2008. Overlapping cleavage motif selectivity of caspases: implications for analysis of apoptotic pathways. Cell Death and Differentiation. 15, 322-31. Medema, J.P., Scaffidi, C., Kischkel, F.C., Shevchenko, A., Mann, M., Krammer, P.H., Peter, M.E., 1997. FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). The EMBO Journal. 16, 2794-804. Menalled, L., El-Khodor, B., Patry, M., Suarez-Farinas, M., Orenstein, S., Zahasky, B., Leahy, C., Wheeler, V., Yang, X., Macdonald, M., Morton, J., Bates, G., Leeds, J., Park, L., Howland, D., Signer, E., Tobin, A., Brunner, D., 2009. Systematic  177 behavioral evaluation of Huntington's disease transgenic and knock-in mouse models. Neurobiol Dis. Mende-Mueller, L.M., Toneff, T., Hwang, S.R., Chesselet, M.F., Hook, V.Y., 2001. Tissuespecific proteolysis of Huntingtin (htt) in human brain: evidence of enhanced levels of N- and C-terminal htt fragments in Huntington's disease striatum. J Neurosci. 21, 1830-7. Metzler, M., Chen, N., Helgason, C.D., Graham, R.K., Nichol, K., McCutcheon, K., Nasir, J., Humphries, R.K., Raymond, L.A., Hayden, M.R., 1999. Life without huntingtin: normal differentiation into functional neurons. J Neurochem. 72, 1009-18. Miettinen, T., 1989. Serum cholestanol and plant sterol levels in relation to cholesterol metabolism in middle-aged men. Metabolism. 38, 136-140. Miettinen, T., Gylling, H., Strandberg, T., Sarna, S., 1998. Baseline serum cholestanol as predictor of recurrent coronary events in subgroup of Scandinavian simvastatin survival study. BMJ. 316, 1127. Milnerwood, Raymond, 2007. Corticostriatal Synaptic Function in Mouse Models of Huntington's Disease: Early Effects of Huntingtin Repeat Length and Protein Load. J Physiol. Milnerwood, A.J., Gladding, C.M., Pouladi, M.A., Kaufman, A.M., Hines, R.M., Boyd, J.D., Ko, R.W.Y., Vasuta, O.C., Graham, R.K., Hayden, M.R., Murphy, T.H., Raymond, L.A., 2010. Early Increase in Extrasynaptic NMDA Receptor Signaling and Expression Contributes to Phenotype Onset in Huntington's Disease Mice. Neuron. 65, 178-190. Mink, J.W., 1996. The basal ganglia: focused selection and inhibition of competing motor programs. Prog Neurobiol. 50, 381-425. Miyashita, T., Okamura-Oho, Y., Mito, Y., Nagafuchi, S., Yamada, M., 1997. Dentatorubral pallidoluysian atrophy (DRPLA) protein is cleaved by caspase-3 during apoptosis. J Biol Chem. 272, 29238-42. Morales, L.M., Estévez, J., Suárez, H., Villalobos, R., Chacín de Bonilla, L., Bonilla, E., 1989. Nutritional evaluation of Huntington disease patients. Am J Clin Nutr. 50, 14550. Mucke, L., Masliah, E., Yu, G.Q., Mallory, M., Rockenstein, E.M., Tatsuno, G., Hu, K., Kholodenko, D., Johnson-Wood, K., McConlogue, L., 2000. High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J Neurosci. 20, 4050-8. Mullen, R.J., Buck, C.R., Smith, A.M., 1992. NeuN, a neuronal specific nuclear protein in vertebrates. Development. 116, 201-11. Murphy, D., Decarli, C., Schapiro, M., Rapoport, S., Horwitz, B., 1992. Age-Related Differences in Volumes of Subcortical Nuclei, Brain Matter, and Cerebrospinal Fluid in Healthy Men as Measured With Magnetic Resonance Imaging. Archives of Neurology. 49, 839. Murphy, K.P., Carter, R.J., Lione, L.A., Mangiarini, L., Mahal, A., Bates, G.P., Dunnett, S.B., Morton, A.J., 2000. Abnormal synaptic plasticity and impaired spatial cognition in mice transgenic for exon 1 of the human Huntington's disease mutation. J Neurosci. 20, 5115-23.  178 Myers, R.H., Madden, J.J., Teague, J.L., Falek, A., 1982. Factors related to onset age of Huntington disease. Am J Hum Genet. 34, 481-8. Myers, R.H., Vonsattel, J.P., Paskevich, P.A., Kiely, D.K., Stevens, T.J., Cupples, L.A., Richardson, E.P., Bird, E.D., 1991. Decreased neuronal and increased oligodendroglial densities in Huntington's disease caudate nucleus. J Neuropathol Exp Neurol. 50, 729-42. Mystkowski, P., Shankland, E., Schreyer, S.A., LeBoeuf, R.C., Schwartz, R.S., Cummings, D.E., Kushmerick, M., Schwartz, M.W., 2000. Validation of whole-body magnetic resonance spectroscopy as a tool to assess murine body composition. Int J Obes Relat Metab Disord. 24, 719-24. Nasir, J., Floresco, S.B., O'Kusky, J.R., Diewert, V.M., Richman, J.M., Zeisler, J., Borowski, A., Marth, J.D., Phillips, A.G., Hayden, M.R., 1995. Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell. 81, 811-23. Niizuma, K., Endo, H., Nito, C., Myer, D., Kim, G., Chan, P., 2008. The PIDDosome mediates delayed death of hippocampal CA1 neurons after transient global cerebral ischemia in rats. Proc Natl Acad Sci USA. Nikolaev, A., McLaughlin, T., O'Leary, D.D.M., Tessier-Lavigne, M., 2009. APP binds DR6 to trigger axon pruning and neuron death via distinct caspases. Nature. 457, 981-9. Nissinen, M.J., Gylling, H., Miettinen, T.A., 2008. Responses of surrogate markers of cholesterol absorption and synthesis to changes in cholesterol metabolism during various amounts of fat and cholesterol feeding among healthy men. Br J Nutr. 99, 370-8. Nucifora , F.C., Sasaki, M., Peters, M.F., Huang, H., Cooper, J.K., Yamada, M., Takahashi, H., Tsuji, S., Troncoso, J., Dawson, V.L., Dawson, T.M., Ross, C.A., 2001. Interference by huntingtin and atrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science. 291, 2423-8. Nukina, N., Ihara, Y., 1985. Proteolytic fragments of Alzheimer's paired helical filaments. J Biochem. 98, 1715-8. Nukina, N., Ihara, Y., 1986. One of the antigenic determinants of paired helical filaments is related to tau protein. J Biochem. 99, 1541-4. O'Keeffe, G.C., Michell, A.W., Barker, R.A., 2009. Biomarkers in Huntington's and Parkinson's Disease. Ann N Y Acad Sci. 1180, 97-110. O'Reilly, L.A., Ekert, P., Harvey, N., Marsden, V., Cullen, L., Vaux, D.L., Hacker, G., Magnusson, C., Pakusch, M., Cecconi, F., Kuida, K., Strasser, A., Huang, D.C.S., Kumar, S., 2002. Caspase-2 is not required for thymocyte or neuronal apoptosis even though cleavage of caspase-2 is dependent on both Apaf-1 and caspase9. Cell Death Differ. 9, 832-41. Ohki, E.C., Tilkins, M.L., Ciccarone, V.C., Price, P.J., 2001. Improving the transfection efficiency of post-mitotic neurons. J Neurosci Methods. 112, 95-9. Olney, J.W., 1969. Brain lesions, obesity, and other disturbances in mice treated with monosodium glutamate. Science. 164, 719-21. Palidwor, G.A., Shcherbinin, S., Huska, M.R., Rasko, T., Stelzl, U., Arumughan, A., Foulle, R., Porras, P., Sanchez-Pulido, L., Wanker, E.E., Andrade-Navarro, M.A., 2009.  179 Detection of alpha-rod protein repeats using a neural network and application to huntingtin. PLoS Comput Biol. 5, e1000304. Park, H.H., Logette, E., Raunser, S., Cuenin, S., Walz, T., Tschopp, J., Wu, H., 2007. Death domain assembly mechanism revealed by crystal structure of the oligomeric PIDDosome core complex. Cell. 128, 533-46. Paulsen, J.S., Ready, R.E., Hamilton, J.M., Mega, M.S., Cummings, J.L., 2001. Neuropsychiatric aspects of Huntington's disease. J Neurol Neurosurg Psychiatr. 71, 310-4. Paulsen, J.S., Magnotta, V.A., Mikos, A.E., Paulson, H.L., Penziner, E., Andreasen, N.C., Nopoulos, P.C., 2006. Brain structure in preclinical Huntington's disease. Biol Psychiatry. 59, 57-63. Paulsen, J.S., Langbehn, D.R., Stout, J.C., Aylward, E., Ross, C.A., Nance, M., Guttman, M., Johnson, S., Macdonald, M., Beglinger, L.J., Duff, K., Kayson, E., Biglan, K., Shoulson, I., Oakes, D., Hayden, M., Group, P.-H.I.a.C.o.t.H.S., 2008. Detection of Huntington's disease decades before diagnosis: the Predict-HD study. J Neurol Neurosurg Psychiatr. 79, 874-80. Penney, J.B., Young, A.B., Shoulson, I., Starosta-Rubenstein, S., Snodgrass, S.R., SanchezRamos, J., Ramos-Arroyo, M., Gomez, F., Penchaszadeh, G., Alvir, J., 1990. Huntington's disease in Venezuela: 7 years of follow-up on symptomatic and asymptomatic individuals. Mov Disord. 5, 93-9. Pereira, N.A., Song, Z., 2008. Some commonly used caspase substrates and inhibitors lack the specificity required to monitor individual caspase activity. Biochem Biophys Res Commun. 377, 873-7. Persichetti, F., Ambrose, C.M., Ge, P., McNeil, S.M., Srinidhi, J., Anderson, M.A., Jenkins, B., Barnes, G.T., Duyao, M.P., Kanaley, L., 1995. Normal and expanded Huntington's disease gene alleles produce distinguishable proteins due to translation across the CAG repeat. Mol Med. 1, 374-83. Peters, M.F., Nucifora, F.C., Kushi, J., Seaman, H.C., Cooper, J.K., Herring, W.J., Dawson, V.L., Dawson, T.M., Ross, C.A., 1999. Nuclear targeting of mutant Huntingtin increases toxicity. Mol Cell Neurosci. 14, 121-8. Petersén, A., Björkqvist, M., 2006. Hypothalamic-endocrine aspects in Huntington's disease. Eur J Neurosci. 24, 961-7. Portera-Cailliau, C., Hedreen, J.C., Price, D.L., Koliatsos, V.E., 1995. Evidence for apoptotic cell death in Huntington disease and excitotoxic animal models. J Neurosci. 15, 3775-87. Potts, P.R., Singh, S., Knezek, M., Thompson, C.B., Deshmukh, M., 2003. Critical function of endogenous XIAP in regulating caspase activation during sympathetic neuronal apoptosis. J Cell Biol. 163, 789-99. Pouladi, M.A., Graham, R.K., Karasinska, J.M., Xie, Y., Santos, R.D., Petersén, A., Hayden, M.R., 2009. Prevention of depressive behaviour in the YAC128 mouse model of Huntington disease by mutation at residue 586 of huntingtin. Brain. 132, 91932. Randolph, C., Braun, A.R., Goldberg, T.E., Chase, T.N., 1993. Semantic Fluency in Alzheimer's, Parkinson's, and Huntington's Disease: Dissociation of Storage and Retrieval Failures. Neuropsychology. 7, 82-88.  180 Ranen, N.G., Stine, O.C., Abbott, M.H., Sherr, M., Codori, A.M., Franz, M.L., Chao, N.I., Chung, A.S., Pleasant, N., Callahan, C., 1995. Anticipation and instability of IT-15 (CAG)n repeats in parent-offspring pairs with Huntington disease. Am J Hum Genet. 57, 593-602. Read, S.H., Baliga, B.C., Ekert, P.G., Vaux, D.L., Kumar, S., 2002. A novel Apaf-1independent putative caspase-2 activation complex. J Cell Biol. 159, 739-45. Reddy, P.H., Williams, M., Charles, V., Garrett, L., Pike-Buchanan, L., Whetsell, W.O., Miller, G., Tagle, D.A., 1998. Behavioural abnormalities and selective neuronal loss in HD transgenic mice expressing mutated full-length HD cDNA. Nat Genet. 20, 198-202. Reiner, A., Albin, R.L., Anderson, K.D., D'Amato, C.J., Penney, J.B., Young, A.B., 1988. Differential loss of striatal projection neurons in Huntington disease. Proc Natl Acad Sci USA. 85, 5733-7. Rigamonti, D., Bauer, J.H., De-Fraja, C., Conti, L., Sipione, S., Sciorati, C., Clementi, E., Hackam, A., Hayden, M.R., Li, Y., Cooper, J.K., Ross, C.A., Govoni, S., Vincenz, C., Cattaneo, E., 2000. Wild-type huntingtin protects from apoptosis upstream of caspase-3. J Neurosci. 20, 3705-13. Rigamonti, D., Sipione, S., Goffredo, D., Zuccato, C., Fossale, E., Cattaneo, E., 2001. Huntingtin's neuroprotective activity occurs via inhibition of procaspase-9 processing. J Biol Chem. 276, 14545-8. Rissman, R.A., Poon, W.W., Blurton-Jones, M., Oddo, S., Torp, R., Vitek, M.P., LaFerla, F.M., Rohn, T.T., Cotman, C.W., 2004. Caspase-cleavage of tau is an early event in Alzheimer disease tangle pathology. J Clin Invest. 114, 121-30. Robertson, J.D., Enoksson, M., Suomela, M., Zhivotovsky, B., Orrenius, S., 2002. Caspase2 acts upstream of mitochondria to promote cytochrome c release during etoposide-induced apoptosis. J Biol Chem. 277, 29803-9. Rogers, S., Wells, R., Rechsteiner, M., 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science. 234, 364-8. Rohn, T.T., Head, E., Nesse, W.H., Cotman, C.W., Cribbs, D.H., 2001. Activation of caspase-8 in the Alzheimer's disease brain. Neurobiol Dis. 8, 1006-16. Rohn, T.T., Rissman, R.A., Davis, M.C., Kim, Y.E., Cotman, C.W., Head, E., 2002. Caspase-9 activation and caspase cleavage of tau in the Alzheimer's disease brain. Neurobiol Dis. 11, 341-54. Romanowski, M.J., Scheer, J.M., O'Brien, T., McDowell, R.S., 2004. Crystal structures of a ligand-free and malonate-bound human caspase-1: implications for the mechanism of substrate binding. Structure. 12, 1361-71. Rosas, H., Lee, S., Bender, A., Zaleta, A., Vangel, M., Yu, P., Fischl, B., Pappu, V., Cha, J., Salat, D., Hersch, S., 2009. Altered White Matter Microstructure in the Corpus Callosum in Huntington's Disease: Implications for cortical "disconnection". NeuroImage. Rosas, H.D., Liu, A.K., Hersch, S., Glessner, M., Ferrante, R.J., Salat, D.H., van der Kouwe, A., Jenkins, B.G., Dale, A.M., Fischl, B., 2002. Regional and progressive thinning of the cortical ribbon in Huntington's disease. Neurology. 58, 695-701. Rosas, H.D., Koroshetz, W.J., Chen, Y.I., Skeuse, C., Vangel, M., Cudkowicz, M.E., Caplan, K., Marek, K., Seidman, L.J., Makris, N., Jenkins, B.G., Goldstein, J.M., 2003.  181 Evidence for more widespread cerebral pathology in early HD: an MRI-based morphometric analysis. Neurology. 60, 1615-20. Rosas, H.D., Hevelone, N.D., Zaleta, A.K., Greve, D.N., Salat, D.H., Fischl, B., 2005. Regional cortical thinning in preclinical Huntington disease and its relationship to cognition. Neurology. 65, 745-7. Rosas, H.D., Tuch, D.S., Hevelone, N.D., Zaleta, A.K., Vangel, M., Hersch, S.M., Salat, D.H., 2006. Diffusion tensor imaging in presymptomatic and early Huntington's disease: Selective white matter pathology and its relationship to clinical measures. Mov Disord. 21, 1317-25. Rosas, H.D., Salat, D.H., Lee, S.Y., Zaleta, A.K., Pappu, V., Fischl, B., Greve, D., Hevelone, N., Hersch, S.M., 2008. Cerebral cortex and the clinical expression of Huntington's disease: complexity and heterogeneity. Brain. 131, 1057-68. Rotonda, J., Nicholson, D.W., Fazil, K.M., Gallant, M., Gareau, Y., Labelle, M., Peterson, E.P., Rasper, D.M., Ruel, R., Vaillancourt, J.P., Thornberry, N.A., Becker, J.W., 1996. The three-dimensional structure of apopain/CPP32, a key mediator of apoptosis. Nat Struct Mol Biol. 3, 619-25. Rotter, B., Kroviarski, Y., Nicolas, G., Dhermy, D., Lecomte, M.-C., 2004. AlphaII-spectrin is an in vitro target for caspase-2, and its cleavage is regulated by calmodulin binding. Biochem J. 378, 161-8. Saganich, M.J., Schroeder, B.E., Galvan, V., Bredesen, D.E., Koo, E.H., Heinemann, S.F., 2006. Deficits in synaptic transmission and learning in amyloid precursor protein (APP) transgenic mice require C-terminal cleavage of APP. J Neurosci. 26, 13428-36. Sánchez, I., Xu, C.J., Juo, P., Kakizaka, A., Blenis, J., Yuan, J., 1999. Caspase-8 is required for cell death induced by expanded polyglutamine repeats. Neuron. 22, 623-33. Sapp, E., Kegel, K.B., Aronin, N., Hashikawa, T., Uchiyama, Y., Tohyama, K., Bhide, P.G., Vonsattel, J.P., Difiglia, M., 2001. Early and progressive accumulation of reactive microglia in the Huntington disease brain. J Neuropathol Exp Neurol. 60, 16172. Sawa, A., Wiegand, G.W., Cooper, J., Margolis, R.L., Sharp, A.H., Lawler, J.F., Greenamyre, J.T., Snyder, S.H., Ross, C.A., 1999. Increased apoptosis of Huntington disease lymphoblasts associated with repeat length-dependent mitochondrial depolarization. Nat Med. 5, 1194-8. Scheer, J.M., Romanowski, M.J., Wells, J.A., 2006. A common allosteric site and mechanism in caspases. Proc Natl Acad Sci USA. 103, 7595-600. Schilling, G., Becher, M.W., Sharp, A.H., Jinnah, H.A., Duan, K., Kotzuk, J.A., Slunt, H.H., Ratovitski, T., Cooper, J.K., Jenkins, N.A., Copeland, N.G., Price, D.L., Ross, C.A., Borchelt, D.R., 1999. Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Human Molecular Genetics. 8, 397-407. Schmucker, DL, 1990. Hepatocyte fine structure during maturation and senescence. Journal of electron microscopy technique. 14, 106-25. Schulz, J.B., Weller, M., Matthews, R.T., Heneka, M.T., Groscurth, P., Martinou, J.C., Lommatzsch, J., von Coelln, R., Wüllner, U., Löschmann, P.A., Beal, M.F.,  182 Dichgans, J., Klockgether, T., 1998. Extended therapeutic window for caspase inhibition and synergy with MK-801 in the treatment of cerebral histotoxic hypoxia. Cell Death Differ. 5, 847-57. Schwarcz, R., Whetsell, W.O., Mangano, R.M., 1983. Quinolinic acid: an endogenous metabolite that produces axon-sparing lesions in rat brain. Science. 219, 316-8. Schweizer, Roschitzki-Voser, Amstutz, Briand, Gulotti-Georgieva, Prenosil, Binz, Capitani, Baici, Plückthun, Grütter, 2007. Inhibition of Caspase-2 by a Designed Ankyrin Repeat Protein: Specificity, Structure, and Inhibition Mechanism. Structure. 15, 625-636. Schweizer, A., Briand, C., Grutter, M.G., 2003. Crystal structure of caspase-2, apical initiator of the intrinsic apoptotic pathway. J Biol Chem. 278, 42441-7. Selkoe, D.J., Salazar, F.J., Abraham, C., Kosik, K.S., 1982. Huntington's disease: changes in striatal proteins reflect astrocytic gliosis. Brain Res. 245, 117-25. Seong, I., Woda, J., Song, J., Lloret, A., Abeyrathne, P., Woo, C., Gregory, G., Lee, J., Wheeler, V., Walz, T., Kingston, R., Gusella, J., Conlon, R., Macdonald, M., 2009. Huntingtin facilitates polycomb repressive complex 2. Hum Mol Genet. Seong, I.S., Ivanova, E., Lee, J.-M., Choo, Y.S., Fossale, E., Anderson, M., Gusella, J.F., Laramie, J.M., Myers, R.H., Lesort, M., MacDonald, M.E., 2005. HD CAG repeat implicates a dominant property of huntingtin in mitochondrial energy metabolism. Human Molecular Genetics. 14, 2871-80. Sharp, A.H., Loev, S.J., Schilling, G., Li, S.H., Li, X.J., Bao, J., Wagster, M.V., Kotzuk, J.A., Steiner, J.P., Lo, A., 1995. Widespread expression of Huntington's disease gene (IT15) protein product. Neuron. 14, 1065-74. Shehadeh, J., Fernandes, H.B., Zeron Mullins, M.M., Graham, R.K., Leavitt, B.R., Hayden, M.R., Raymond, L.A., 2006. Striatal neuronal apoptosis is preferentially enhanced by NMDA receptor activation in YAC transgenic mouse model of Huntington disease. Neurobiol Dis. 21, 392-403. Shelbourne, P.F., Killeen, N., Hevner, R.F., Johnston, H.M., Tecott, L., Lewandoski, M., Ennis, M., Ramirez, L., Li, Z., Iannicola, C., Littman, D.R., Myers, R.M., 1999. A Huntington's disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural abnormalities in mice. Human Molecular Genetics. 8, 763-74. Sherrington, R., Rogaev, E.I., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., 1995. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature. 375, 754-60. Shi, M., Vivian, C.J., Lee, K.-J., Ge, C., Morotomi-Yano, K., Manzl, C., Bock, F., Sato, S., Tomomori-Sato, C., Zhu, R., Haug, J.S., Swanson, S.K., Washburn, M.P., Chen, D.J., Chen, B.P.C., Villunger, A., Florens, L., Du, C., 2009. DNA-PKcs-PIDDosome: a nuclear caspase-2-activating complex with role in G2/M checkpoint maintenance. Cell. 136, 508-20. Shimohama, S., Tanino, H., Fujimoto, S., 2001. Differential expression of rat brain caspase family proteins during development and aging. Biochem Biophys Res Commun. 289, 1063-6. Shoulson, I., 1981. Huntington disease: functional capacities in patients treated with neuroleptic and antidepressant drugs.. Neurology. 10, 1333-1335.  183 Sidi, S., Sanda, T., Kennedy, R.D., Hagen, A.T., Jette, C.A., Hoffmans, R., Pascual, J., Imamura, S., Kishi, S., Amatruda, J.F., Kanki, J.P., Green, D.R., D'Andrea, A.A., Look, A.T., 2008. Chk1 suppresses a caspase-2 apoptotic response to DNA damage that bypasses p53, Bcl-2, and caspase-3. Cell. 133, 864-77. Silbernagel, G., Fauler, G., Renner, W., Landl, E., Hoffmann, M., Winkelmann, B., Boehm, B., Marz, W., 2008. The relationships of cholesterol metabolism and plasma plant sterols with the severity of coronary artery disease. J Lipid Res. P800013JLR200v1. Simmons, J.T., Pastakia, B., Chase, T.N., Shults, C.W., 1986. Magnetic resonance imaging in Huntington disease. AJNR Am J Neuroradiol. 7, 25-8. Singh, M., Savitz, S.I., Hoque, R., Gupta, G., Roth, S., Rosenbaum, P.S., Rosenbaum, D.M., 2001. Cell-specific caspase expression by different neuronal phenotypes in transient retinal ischemia. J Neurochem. 77, 466-75. Singhrao, S.K., Neal, J.W., Morgan, B.P., Gasque, P., 1999. Increased complement biosynthesis by microglia and complement activation on neurons in Huntington's disease. Exp Neurol. 159, 362-76. Sipione, S., Rigamonti, D., Valenza, M., Zuccato, C., Conti, L., Pritchard, J., Kooperberg, C., Olson, J.M., Cattaneo, E., 2002. Early transcriptional profiles in huntingtininducible striatal cells by microarray analyses. Human Molecular Genetics. 11, 1953-65. Slee, E.A., Harte, M.T., Kluck, R.M., Wolf, B.B., Casiano, C.A., Newmeyer, D.D., Wang, H.G., Reed, J.C., Nicholson, D.W., Alnemri, E.S., Green, D.R., Martin, S.J., 1999. Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner. J Cell Biol. 144, 28192. Slow, E.J., van Raamsdonk, J., Rogers, D., Coleman, S.H., Graham, R.K., Deng, Y., Oh, R., Bissada, N., Hossain, S.M., Yang, Y.-Z., Li, X.-J., Simpson, E.M., Gutekunst, C.-A., Leavitt, B.R., Hayden, M.R., 2003a. Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. Hum Mol Genet. 12, 1555-67. Slow, E.J., van Raamsdonk, J., Rogers, D.A., Coleman, S.H., Graham, R.K., Deng, Y., Oh, R., Bissada, N., Hossain, S.M., Yang, Y., Li, X.J., Simpson, E.M., Gutekunst, C., Leavitt, B.R., Hayden, M.R., 2003b. Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. Hum Mol Genet. 12, 1555-67. Slow, E.J., Graham, R.K., Osmand, A.P., Devon, R.S., Lu, G., Deng, Y., Pearson, J., Vaid, K., Bissada, N., Wetzel, R., Leavitt, B.R., Hayden, M.R., 2005. Absence of behavioral abnormalities and neurodegeneration in vivo despite widespread neuronal huntingtin inclusions. Proc Natl Acad Sci USA. 102, 11402-7. Smith, R.A., Miller, T.M., Yamanaka, K., Monia, B.P., Condon, T.P., Hung, G., Lobsiger, C.S., Ward, C.M., McAlonis-Downes, M., Wei, H., Wancewicz, E.V., Bennett, C.F., Cleveland, D.W., 2006. Antisense oligonucleotide therapy for neurodegenerative disease. J Clin Invest. 116, 2290-6. Solier, S., Logette, E., Desoche, L., Solary, E., Corcos, L., 2005. Nonsense-mediated mRNA decay among human caspases: the caspase-2S putative protein is encoded by an extremely short-lived mRNA. Cell Death and Differentiation. 12, 687-9.  184 Solier, S., De Cian, M.-C., Bettaieb, A., Desoche, L., Solary, E., Corcos, L., 2008. PKC zeta controls DNA topoisomerase-dependent human caspase-2 pre-mRNA splicing. FEBS Lett. 582, 372-8. Southwell, A.L., Ko, J., Patterson, P.H., 2009. Intrabody gene therapy ameliorates motor, cognitive, and neuropathological symptoms in multiple mouse models of Huntington's disease. J Neurosci. 29, 13589-602. Sprengelmeyer, R., Lange, H., Hömberg, V., 1995. The pattern of attentional deficits in Huntington's disease. Brain. 118 ( Pt 1), 145-52. St George-Hyslop, P.H., Tanzi, R.E., Polinsky, R.J., Haines, J.L., Nee, L., Watkins, P.C., Myers, R.H., Feldman, R.G., Pollen, D., Drachman, D., 1987. The genetic defect causing familial Alzheimer's disease maps on chromosome 21. Science. 235, 885-90. Stefanis, L., Troy, C.M., Qi, H., Shelanski, M.L., Greene, L.A., 1998. Caspase-2 (Nedd-2) processing and death of trophic factor-deprived PC12 cells and sympathetic neurons occur independently of caspase-3 (CPP32)-like activity. J Neurosci. 18, 9204-15. Steffan, J.S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu, Y.Z., Gohler, H., Wanker, E.E., Bates, G.P., Housman, D.E., Thompson, L.M., 2000. The Huntington's disease protein interacts with p53 and CREB-binding protein and represses transcription. Proc Natl Acad Sci USA. 97, 6763-8. Stennicke, H.R., Deveraux, Q.L., Humke, E.W., Reed, J.C., Dixit, V.M., Salvesen, G.S., 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem. 274, 8359-62. Stennicke, H.R., Renatus, M., Meldal, M., Salvesen, G.S., 2000. Internally quenched fluorescent peptide substrates disclose the subsite preferences of human caspases 1, 3, 6, 7 and 8. Biochem J. 350 Pt 2, 563-8. Stevens, C.D., Altshuler, L.L., Bogerts, B., Falkai, P., 1988. Quantitative study of gliosis in schizophrenia and Huntington's chorea. Biol Psychiatry. 24, 697-700. Storey, E., Beal, M.F., 1993. Neurochemical substrates of rigidity and chorea in Huntington's disease. Brain. 116 ( Pt 5), 1201-22. Strand, A.D., Baquet, Z.C., Aragaki, A.K., Holmans, P., Yang, L., Cleren, C., Beal, M.F., Jones, L., Kooperberg, C., Olson, J.M., Jones, K.R., 2007. Expression profiling of Huntington's disease models suggests that brain-derived neurotrophic factor depletion plays a major role in striatal degeneration. J Neurosci. 27, 11758-68. Strong, T.V., Tagle, D.A., Valdes, J.M., Elmer, L.W., Boehm, K., Swaroop, M., Kaatz, K.W., Collins, F.S., Albin, R.L., 1993. Widespread expression of the human and rat Huntington's disease gene in brain and nonneural tissues. Nat Genet. 5, 259-65. Swartz, F.J., 1956. The development in the human liver of multiple desoxyribose nucleic acid (DNA) classes and their relationship to the age of the individual. Chromosoma. 8, 53-72. Swerdlow, N.R., Paulsen, J., Braff, D.L., Butters, N., Geyer, M.A., Swenson, M.R., 1995. Impaired prepulse inhibition of acoustic and tactile startle response in patients with Huntington's disease. J Neurol Neurosurg Psychiatr. 58, 192-200. Szebenyi, G., Morfini, G.A., Babcock, A., Gould, M., Selkoe, K., Stenoien, D.L., Young, M., Faber, P.W., MacDonald, M.E., McPhaul, M.J., Brady, S.T., 2003. Neuropathogenic  185 forms of huntingtin and androgen receptor inhibit fast axonal transport. Neuron. 40, 41-52. Tai, Y.F., Pavese, N., Gerhard, A., Tabrizi, S.J., Barker, R.A., Brooks, D.J., Piccini, P., 2007. Microglial activation in presymptomatic Huntington's disease gene carriers. Brain. 130, 1759-66. Takano, H., Gusella, J.F., 2002. The predominantly HEAT-like motif structure of huntingtin and its association and coincident nuclear entry with dorsal, an NFkB/Rel/dorsal family transcription factor. BMC neuroscience. 3, 15. Talanian, R.V., Quinlan, C., Trautz, S., Hackett, M.C., Mankovich, J.A., Banach, D., Ghayur, T., Brady, K.D., Wong, W.W., 1997. Substrate specificities of caspase family proteases. J Biol Chem. 272, 9677-82. Tang, T.-S., Slow, E., Lupu, V., Stavrovskaya, I.G., Sugimori, M., Llinás, R., Kristal, B.S., Hayden, M.R., Bezprozvanny, I., 2005. Disturbed Ca2+ signaling and apoptosis of medium spiny neurons in Huntington's disease. Proc Natl Acad Sci USA. 102, 2602-7. Tang, T.-S., Chen, X., Liu, J., Bezprozvanny, I., 2007. Dopaminergic signaling and striatal neurodegeneration in Huntington's disease. J Neurosci. 27, 7899-910. Tanzi, R.E., Gusella, J.F., Watkins, P.C., Bruns, G.A., St George-Hyslop, P., Van Keuren, M.L., Patterson, D., Pagan, S., Kurnit, D.M., Neve, R.L., 1987. Amyloid beta protein gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus. Science. 235, 880-4. Team, R.D.C., 2009. R: A Language and Environment for Statistical Computing. Tellez-Nagel, I., Johnson, A.B., Terry, R.D., 1974. Studies on brain biopsies of patients with Huntington's chorea. J Neuropathol Exp Neurol. 33, 308-32. Thomas, L.B., Gates, D.J., Richfield, E.K., O'Brien, T.F., Schweitzer, J.B., Steindler, D.A., 1995. DNA end labeling (TUNEL) in Huntington's disease and other neuropathological conditions. Exp Neurol. 133, 265-72. Thornberry, N.A., Bull, H.G., Calaycay, J.R., Chapman, K.T., Howard, A.D., Kostura, M.J., Miller, D.K., Molineaux, S.M., Weidner, J.R., Aunins, J., 1992. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature. 356, 768-74. Thornberry, N.A., Rano, T.A., Peterson, E.P., Rasper, D.M., Timkey, T., Garcia-Calvo, M., Houtzager, V.M., Nordstrom, P.A., Roy, S., Vaillancourt, J.P., Chapman, K.T., Nicholson, D.W., 1997. A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis. J Biol Chem. 272, 17907-11. Tinel, A., Tschopp, J., 2004. The PIDDosome, a protein complex implicated in activation of caspase-2 in response to genotoxic stress. Science. 304, 843-6. Tizon, B., Ribe, E.M., Mi, W., Troy, C.M., Levy, E., 2010. Cystatin C protects neuronal cells from amyloid-beta-induced toxicity. J Alzheimers Dis. 19, 885-94. Trottier, Y., Devys, D., Imbert, G., Saudou, F., An, I., Lutz, Y., Weber, C., Agid, Y., Hirsch, E.C., Mandel, J.L., 1995. Cellular localization of the Huntington's disease protein and discrimination of the normal and mutated form. Nat Genet. 10, 104-10.  186 Troy, C.M., Derossi, D., Prochiantz, A., Greene, L.A., Shelanski, M.L., 1996. Downregulation of Cu/Zn superoxide dismutase leads to cell death via the nitric oxide-peroxynitrite pathway. J Neurosci. 16, 253-61. Troy, C.M., Stefanis, L., Greene, L.A., Shelanski, M.L., 1997. Nedd2 is required for apoptosis after trophic factor withdrawal, but not superoxide dismutase (SOD1) downregulation, in sympathetic neurons and PC12 cells. J Neurosci. 17, 1911-8. Troy, C.M., Rabacchi, S.A., Friedman, W.J., Frappier, T.F., Brown, K., Shelanski, M.L., 2000. Caspase-2 mediates neuronal cell death induced by beta-amyloid. J Neurosci. 20, 1386-92. Troy, C.M., Rabacchi, S.A., Hohl, J.B., Angelastro, J.M., Greene, L.A., Shelanski, M.L., 2001. Death in the balance: alternative participation of the caspase-2 and -9 pathways in neuronal death induced by nerve growth factor deprivation. J Neurosci. 21, 5007-16. Trueman, R.C., Brooks, S.P., Jones, L., Dunnett, S.B., 2007. The operant serial implicit learning task reveals early onset motor learning deficits in the Hdh knock-in mouse model of Huntington's disease. Eur J Neurosci. 25, 551-8. Trueman, R.C., Brooks, S.P., Jones, L., Dunnett, S.B., 2009. Rule learning, visuospatial function and motor performance in the Hdh(Q92) knock-in mouse model of Huntington's disease. Behav Brain Res. 203, 215-22. Tu, S., McStay, G.P., Boucher, L.-M., Mak, T., Beere, H.M., Green, D.R., 2006. In situ trapping of activated initiator caspases reveals a role for caspase-2 in heat shock-induced apoptosis. Nat Cell Biol. 8, 72-7. Upton, J.-P., Austgen, K., Nishino, M., Coakley, K.M., Hagen, A., Han, D., Papa, F.R., Oakes, S.A., 2008. Caspase-2 cleavage of BID is a critical apoptotic signal downstream of endoplasmic reticulum stress. Mol Cell Biol. 28, 3943-51. Vakifahmetoglu, H., Olsson, M., Orrenius, S., Zhivotovsky, B., 2006. Functional connection between p53 and caspase-2 is essential for apoptosis induced by DNA damage. Oncogene. 25, 5683-92. Valenza, M., Rigamonti, D., Goffredo, D., Zuccato, C., Fenu, S., Jamot, L., Strand, A., Tarditi, A., Woodman, B., Racchi, M., Mariotti, C., Di Donato, S., Corsini, A., Bates, G., Pruss, R., Olson, J.M., Sipione, S., Tartari, M., Cattaneo, E., 2005. Dysfunction of the cholesterol biosynthetic pathway in Huntington's disease. J Neurosci. 25, 9932-9. Valenza, M., Carroll, J.B., Leoni, V., Bertram, L.N., Björkhem, I., Singaraja, R.R., Di Donato, S., Lutjohann, D., Hayden, M.R., Cattaneo, E., 2007a. Cholesterol biosynthesis pathway is disturbed in YAC128 mice and is modulated by huntingtin mutation. Hum Mol Genet. 16, 2187-98. Valenza, M., Leoni, V., Tarditi, A., Mariotti, C., Björkhem, I., Di Donato, S., Cattaneo, E., 2007b. Progressive dysfunction of the cholesterol biosynthesis pathway in the R6/2 mouse model of Huntington's disease. Neurobiol Dis. 28, 133-42. Valmiki, M.G., Ramos, J.W., 2009. Death effector domain-containing proteins. Cell Mol Life Sci. 66, 814-30. van der Burg, J.M.M., Bacos, K., Wood, N.I., Lindqvist, A., Wierup, N., Woodman, B., Wamsteeker, J.I., Smith, R., Deierborg, T., Kuhar, M.J., Bates, G.P., Mulder, H.,  187 Erlanson-Albertsson, C., Morton, A.J., Brundin, P., Petersén, A., Björkqvist, M., 2008. Increased metabolism in the R6/2 mouse model of Huntington's disease. Neurobiol Dis. 29, 41-51. van Oostrom, J.C.H., Maguire, R.P., Verschuuren-Bemelmans, C.C., Veenma-van der Duin, L., Pruim, J., Roos, R.A.C., Leenders, K.L., 2005. Striatal dopamine D2 receptors, metabolism, and volume in preclinical Huntington disease. Neurology. 65, 941-3. van Raamsdonk, J.M., Murphy, Z., Slow, E.J., Leavitt, B.R., Hayden, M.R., 2005. Selective degeneration and nuclear localization of mutant huntingtin in the YAC128 mouse model of Huntington disease. Human Molecular Genetics. 14, 3823-35. Van Raamsdonk, J.M., Pearson, J., Bailey, C.D., Rogers, D.A., Johnson, G.V., Hayden, M.R., Leavitt, B.R., 2005a. Cystamine treatment is neuroprotective in the YAC128 mouse model of Huntington disease. J Neurochem. 95, 210-20. Van Raamsdonk, J.M., Pearson, J., Bailey, C.D.C., Rogers, D.A., Johnson, G.V.W., Hayden, M.R., Leavitt, B.R., 2005b. Cystamine treatment is neuroprotective in the YAC128 mouse model of Huntington disease. J Neurochem. 95, 210-20. Van Raamsdonk, J.M., Pearson, J., Rogers, D.A., Bissada, N., Vogl, A.W., Hayden, M.R., Leavitt, B.R., 2005c. Loss of wild-type huntingtin influences motor dysfunction and survival in the YAC128 mouse model of Huntington disease. Hum Mol Genet. 14, 1379-92. Van Raamsdonk, J.M., Pearson, J., Rogers, D.A., Lu, G., Barakauskas, V.E., Barr, A.M., Honer, W.G., Hayden, M.R., Leavitt, B.R., 2005d. Ethyl-EPA treatment improves motor dysfunction, but not neurodegeneration in the YAC128 mouse model of Huntington disease. Exp Neurol. 196, 266-72. Van Raamsdonk, J.M., Pearson, J., Slow, E.J., Hossain, S.M., Leavitt, B.R., Hayden, M.R., 2005e. Cognitive dysfunction precedes neuropathology and motor abnormalities in the YAC128 mouse model of Huntington's disease. J Neurosci. 25, 4169-80. Van Raamsdonk, J.M., Gibson, W.T., Pearson, J., Murphy, Z., Lu, G., Leavitt, B.R., Hayden, M.R., 2006a. Body weight is modulated by levels of full-length huntingtin. Hum Mol Genet. 15, 1513-23. Van Raamsdonk, J.M., Pearson, J., Murphy, Z., Hayden, M.R., Leavitt, B.R., 2006b. Wildtype huntingtin ameliorates striatal neuronal atrophy but does not prevent other abnormalities in the YAC128 mouse model of Huntington disease. BMC neuroscience. 7, 80. Van Raamsdonk, J.M., Metzler, M., Slow, E., Pearson, J., Schwab, C., Carroll, J., Graham, R.K., Leavitt, B.R., Hayden, M.R., 2007a. Phenotypic abnormalities in the YAC128 mouse model of Huntington disease are penetrant on multiple genetic backgrounds and modulated by strain. Neurobiol Dis. 26, 189-200. Van Raamsdonk, J.M., Murphy, Z., Selva, D.M., Hamidizadeh, R., Pearson, J., Petersén, A., Björkqvist, M., Muir, C., Mackenzie, I.R., Hammond, G.L., Vogl, A.W., Hayden, M.R., Leavitt, B.R., 2007b. Testicular degeneration in Huntington disease. Neurobiol Dis. 26, 512-20.  188 Vanderklish, P.W., Krushel, L.A., Holst, B.H., Gally, J.A., Crossin, K.L., Edelman, G.M., 2000. Marking synaptic activity in dendritic spines with a calpain substrate exhibiting fluorescence resonance energy transfer. Proc Natl Acad Sci USA. 97, 2253-8. Varfolomeev, E.E., Schuchmann, M., Luria, V., Chiannilkulchai, N., Beckmann, J.S., Mett, I.L., Rebrikov, D., Brodianski, V.M., Kemper, O.C., Kollet, O., Lapidot, T., Soffer, D., Sobe, T., Avraham, K.B., Goncharov, T., Holtmann, H., Lonai, P., Wallach, D., 1998. Targeted disruption of the mouse Caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity. 9, 267-76. Vogel, C.M., Drury, I., Terry, L.C., Young, A.B., 1991. Myoclonus in adult Huntington's disease. Ann Neurol. 29, 213-5. Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D., Richardson, E.P., 1985. Neuropathological classification of Huntington's disease. J Neuropathol Exp Neurol. 44, 559-77. Walhovd, K.B., Fjell, A.M., Reinvang, I., Lundervold, A., Dale, A.M., Eilertsen, D.E., Quinn, B.T., Salat, D., Makris, N., Fischl, B., 2005. Effects of age on volumes of cortex, white matter and subcortical structures. Neurobiol Aging. 26, 1261-70; discussion 1275-8. Walker, N.P., Talanian, R.V., Brady, K.D., Dang, L.C., Bump, N.J., Ferenz, C.R., Franklin, S., Ghayur, T., Hackett, M.C., Hammill, L.D., 1994. Crystal structure of the cysteine protease interleukin-1 beta-converting enzyme: a (p20/p10)2 homodimer. Cell. 78, 343-52. Walsh, J.G., Cullen, S.P., Sheridan, C., Lüthi, A.U., Gerner, C., Martin, S.J., 2008. Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc Natl Acad Sci USA. 105, 12815-9. Wang, G.H., Mitsui, K., Kotliarova, S., Yamashita, A., Nagao, Y., Tokuhiro, S., Iwatsubo, T., Kanazawa, I., Nukina, N., 1999. Caspase activation during apoptotic cell death induced by expanded polyglutamine in N2a cells. Neuroreport. 10, 2435-8. Wang, L., Miura, M., Bergeron, L., Zhu, H., Yuan, J., 1994. Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death. Cell. 78, 739-50. Warby, S.C., Doty, C.N., Graham, R.K., Carroll, J.B., Yang, Y.-Z., Singaraja, R.R., Overall, C.M., Hayden, M.R., 2008. Activated caspase-6 and caspase-6-cleaved fragments of huntingtin specifically colocalize in the nucleus. Hum Mol Genet. 17, 2390404. Ware, J.H., 1985. Linear Models for the Analysis of Longitudinal Studies. The American Statistician. 39, 95-101. Watanabe, S.Y., Albsoul-Younes, A.M., Kawano, T., Itoh, H., Kaziro, Y., Nakajima, S., Nakajima, Y., 1999. Calcium phosphate-mediated transfection of primary cultured brain neurons using GFP expression as a marker: application for single neuron electrophysiology. Neurosci Res. 33, 71-8. Watanabe, T., Shimada, H., Tanaka, Y., 1978. Human hepatocytes and aging: a cytophotometrical analysis in 35 sudden-death cases. Virchows Arch B Cell Pathol. 27, 307-16.  189 Watanabe, T., Tanaka, Y., 1982. Age-related alterations in the size of human hepatocytes. A study of mononuclear and binucleate cells. Virchows Arch, B, Cell Pathol. 39, 9-20. Wei, Y., Fox, T., Chambers, S.P., Sintchak, J., Coll, J.T., Golec, J.M., Swenson, L., Wilson, K.P., Charifson, P.S., 2000. The structures of caspases-1, -3, -7 and -8 reveal the basis for substrate and inhibitor selectivity. Chemistry & Biology. 7, 423-32. Weidemann, A., Paliga, K., Dürrwang, U., Reinhard, F.B., Schuckert, O., Evin, G., Masters, C.L., 1999. Proteolytic processing of the Alzheimer's disease amyloid precursor protein within its cytoplasmic domain by caspase-like proteases. J Biol Chem. 274, 5823-9. Weingarten, M.D., Lockwood, A.H., Hwo, S.Y., Kirschner, M.W., 1975. A protein factor essential for microtubule assembly. Proc Natl Acad Sci USA. 72, 1858-62. Wellington, C.L., Ellerby, L.M., Hackam, A.S., Margolis, R.L., Trifiro, M.A., Singaraja, R., McCutcheon, K., Salvesen, G.S., Propp, S.S., Bromm, M., Rowland, K.J., Zhang, T., Rasper, D., Roy, S., Thornberry, N., Pinsky, L., Kakizuka, A., Ross, C.A., Nicholson, D.W., Bredesen, D.E., Hayden, M.R., 1998. Caspase cleavage of gene products associated with triplet expansion disorders generates truncated fragments containing the polyglutamine tract. J Biol Chem. 273, 9158-67. Wellington, C.L., Singaraja, R., Ellerby, L., Savill, J., Roy, S., Leavitt, B., Cattaneo, E., Hackam, A., Sharp, A., Thornberry, N., Nicholson, D.W., Bredesen, D.E., Hayden, M.R., 2000. Inhibiting caspase cleavage of huntingtin reduces toxicity and aggregate formation in neuronal and nonneuronal cells. J Biol Chem. 275, 19831-8. Wellington, C.L., Ellerby, L.M., Gutekunst, C.-A., Rogers, D., Warby, S., Graham, R.K., Loubser, O., van Raamsdonk, J., Singaraja, R., Yang, Y.-Z., Gafni, J., Bredesen, D., Hersch, S.M., Leavitt, B.R., Roy, S., Nicholson, D.W., Hayden, M.R., 2002. Caspase cleavage of mutant huntingtin precedes neurodegeneration in Huntington's disease. J Neurosci. 22, 7862-72. Westerterp, K.R., 2004. Diet induced thermogenesis. Nutrition & Metabolism 2004 1:5. 1, 5. Wheeler, V.C., Auerbach, W., White, J.K., Srinidhi, J., Auerbach, A., Ryan, A., Duyao, M.P., Vrbanac, V., Weaver, M., Gusella, J.F., Joyner, A.L., MacDonald, M.E., 1999. Length-dependent gametic CAG repeat instability in the Huntington's disease knock-in mouse. Hum Mol Genet. 8, 115-22. Wheeler, V.C., White, J.K., Gutekunst, C.A., Vrbanac, V., Weaver, M., Li, X.J., Li, S.H., Yi, H., Vonsattel, J.P., Gusella, J.F., Hersch, S., Auerbach, W., Joyner, A.L., MacDonald, M.E., 2000. Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice. Human Molecular Genetics. 9, 503-13. White, J.K., Auerbach, W., Duyao, M.P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L., MacDonald, M.E., 1997. Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nat Genet. 17, 404-10. Wilson, K.P., Black, J.A., Thomson, J.A., Kim, E.E., Griffith, J.P., Navia, M.A., Murcko, M.A., Chambers, S.P., Aldape, R.A., Raybuck, S.A., 1994. Structure and mechanism of interleukin-1 beta converting enzyme. Nature. 370, 270-5.  190 Wright, K.M., Linhoff, M.W., Potts, P.R., Deshmukh, M., 2004. Decreased apoptosome activity with neuronal differentiation sets the threshold for strict IAP regulation of apoptosis. J Cell Biol. 167, 303-13. Wyllie, A.H., 1980. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature. 284, 555-6. Wyttenbach, A., Carmichael, J., Swartz, J., Furlong, R.A., Narain, Y., Rankin, J., Rubinsztein, D.C., 2000. Effects of heat shock, heat shock protein 40 (HDJ-2), and proteasome inhibition on protein aggregation in cellular models of Huntington's disease. Proc Natl Acad Sci USA. 97, 2898-903. Wyttenbach, A., Swartz, J., Kita, H., Thykjaer, T., Carmichael, J., Bradley, J., Brown, R., Maxwell, M., Schapira, A., Orntoft, T.F., Kato, K., Rubinsztein, D.C., 2001. Polyglutamine expansions cause decreased CRE-mediated transcription and early gene expression changes prior to cell death in an inducible cell model of Huntington's disease. Hum Mol Genet. 10, 1829-45. Yamamoto, A., Lucas, J.J., Hen, R., 2000. Reversal of neuropathology and motor dysfunction in a conditional model of Huntington's disease. Cell. 101, 57-66. Yoneda, T., Imaizumi, K., Oono, K., Yui, D., Gomi, F., Katayama, T., Tohyama, M., 2001. Activation of caspase-12, an endoplastic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J Biol Chem. 276, 13935-40. Young, J.E., Gouw, L., Propp, S., Sopher, B.L., Taylor, J., Lin, A., Hermel, E., Logvinova, A., Chen, S.F., Chen, S., Bredesen, D.E., Truant, R., Ptacek, L.J., La Spada, A.R., Ellerby, L.M., 2007. Proteolytic cleavage of ataxin-7 by caspase-7 modulates cellular toxicity and transcriptional dysregulation. J Biol Chem. 282, 30150-60. Yu, L., Hammer, R.E., Li-Hawkins, J., Von Bergmann, K., Lutjohann, D., Cohen, J.C., Hobbs, H.H., 2002. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci USA. 99, 16237-42. Yu, X., Acehan, D., Ménétret, J.-F., Booth, C.R., Ludtke, S.J., Riedl, S.J., Shi, Y., Wang, X., Akey, C.W., 2005. A structure of the human apoptosome at 12.8 A resolution provides insights into this cell death platform. Structure. 13, 1725-35. Yuan, J., Shaham, S., Ledoux, S., Ellis, H.M., Horvitz, H.R., 1993. The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 betaconverting enzyme. Cell. 75, 641-52. Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E., Efstratiadis, A., 1995. Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington's disease gene homologue. Nat Genet. 11, 155-63. Zeron, M.M., Hansson, O., Chen, N., Wellington, C.L., Leavitt, B.R., Brundin, P., Hayden, M.R., Raymond, L.A., 2002. Increased sensitivity to N-methyl-D-aspartate receptor-mediated excitotoxicity in a mouse model of Huntington's disease. Neuron. 33, 849-60. Zeron, M.M., Fernandes, H.B., Krebs, C., Shehadeh, J., Wellington, C.L., Leavitt, B.R., Baimbridge, K.G., Hayden, M.R., Raymond, L.A., 2004. Potentiation of NMDA receptor-mediated excitotoxicity linked with intrinsic apoptotic pathway in YAC transgenic mouse model of Huntington's disease. Mol Cell Neurosci. 25, 469-79.  191 Zhang, H., Li, Q., Graham, R., Slow, E., Hayden, M., Bezprozvanny, I., 2008. Full length mutant huntingtin is required for altered Ca(2+) signaling and apoptosis of striatal neurons in the YAC mouse model of Huntington's disease. Neurobiol Dis. Zhang, J., Peng, Q., Li, Q., Jahanshad, N., Hou, Z., Jiang, M., Masuda, N., Langbehn, D., Miller, M., Mori, S., Ross, C., Duan, W., 2009. Longitudinal Characterization of Brain Atrophy of a Huntington Disease Mouse Model by Automated Morphological Analyses of Magnetic Resonance Images. Neuroimage. Zhang, J., Peng, Q., Li, Q., Jahanshad, N., Hou, Z., Jiang, M., Masuda, N., Langbehn, D.R., Miller, M.I., Mori, S., Ross, C.A., Duan, W., 2010. Longitudinal characterization of brain atrophy of a Huntington's disease mouse model by automated morphological analyses of magnetic resonance images. Neuroimage. 49, 234051. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature. 372, 425-32. Zhang, Y., Leavitt, B.R., van Raamsdonk, J.M., Dragatsis, I., Goldowitz, D., MacDonald, M.E., Hayden, M.R., Friedlander, R.M., 2006. Huntingtin inhibits caspase-3 activation. EMBO J. 25, 5896-906. Zhang, Y., Padalecki, S.S., Chaudhuri, A.R., De Waal, E., Goins, B.A., Grubbs, B., Ikeno, Y., Richardson, A., Mundy, G.R., Herman, B., 2007. Caspase-2 deficiency enhances aging-related traits in mice. Mech Ageing Dev. 128, 213-21. Zheng, T.S., Hunot, S., Kuida, K., Momoi, T., Srinivasan, A., Nicholson, D.W., Lazebnik, Y., Flavell, R.A., 2000. Deficiency in caspase-9 or caspase-3 induces compensatory caspase activation. Nat Med. 6, 1241-7. Zhu, X., Raina, A.K., Perry, G., Smith, M.A., 2006. Apoptosis in Alzheimer disease: a mathematical improbability. Current Alzheimer research. 3, 393-6. Zuccato, C., Ciammola, A., Rigamonti, D., Leavitt, B.R., Goffredo, D., Conti, L., MacDonald, M.E., Friedlander, R.M., Silani, V., Hayden, M.R., Timmusk, T., Sipione, S., Cattaneo, E., 2001. Loss of huntingtin-mediated BDNF gene transcription in Huntington's disease. Science. 293, 493-8. Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M., Conti, L., Cataudella, T., Leavitt, B.R., Hayden, M.R., Timmusk, T., Rigamonti, D., Cattaneo, E., 2003. Huntingtin interacts with REST/NRSF to modulate the transcription of NRSEcontrolled neuronal genes. Nat Genet. 35, 76-83.  192  Appendix A – Structure Volumes in aging WT and YAC128 mice Given is the mean raw structure volume, for each time point genotype. Also given are the t- and p-values for a unpaired two-tailed t-test analyzing the effect of transgene on the structure volume.  Structure  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  Amygdala Anterior Commissure pars anterior Anterior Commissure pars posterior Arbor Vita of Cerebellum  1  0.152  10.532  0.882  10.4636  10.4105  99%  1  0.492  8.777  0.635  1.3271  1.3071  98%  1  -0.718  10.095  0.489  0.3789  0.3887  103%  1  0.052  11.601  0.959  11.1476  11.1296  100%  Basal Forebrain Bed Nucleus of Stria Terminalis  1  0.509  8.016  0.625  4.5361  4.4448  98%  1  -0.425  8.917  0.681  1.0938  1.1096  101%  Cerebellar Cortex Cerebellar Peduncle Inferior Cerebellar Peduncle Middle  1  -0.145  11.033  0.887  50.7268  50.9785  100%  1  0.168  10.221  0.870  0.7495  0.7451  99%  1  -0.637  8.805  0.540  1.6190  1.6673  103%  1  0.421  12.883  0.681  0.9211  0.9130  99%  1  0.719  8.786  0.491  0.4455  0.4309  97%  1  -0.518  7.273  0.620  8.3732  8.5693  102%  1  0.013  8.250  0.990  37.7876  37.7724  100%  1  0.803  6.980  0.448  5.0503  4.7860  95%  1  -0.090  8.158  0.930  65.4632  65.6717  100%  Cerebral Peduncle  1  -0.024  8.248  0.981  1.9581  1.9600  100%  Colliculus Inferior  1  0.584  8.621  0.574  6.0318  5.9253  98%  Collicululs Superior  1  0.666  8.927  0.522  8.2416  8.1366  99%  Corpus Callosum Corticalspinal Tract Pyramids  1  0.195  11.019  0.849  15.9062  15.8267  100%  1  -0.720  10.525  0.487  0.9292  0.9585  103%  Cuneate Nucleus  1  -1.270  11.821  0.229  0.2748  0.2887  105%  Dentate Gyurs of  1  0.634  8.240  0.543  3.0313  2.9829  98%  Cerebellar Peduncle Superior Cerebral Aqueduct Cerebral Cortex Entorhinal Cerebral Cortex Frontal Lobe Cerebral Cortex Occipital Lobe Cerebral Cortex Parito/Temporal Lobe  193  Structure Hippocampus Facial Nerve Cranial Nerve 7 Fasciculus retroflexus  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  1  -0.277  12.687  0.786  0.2446  0.2470  101%  1  -0.931  10.902  0.372  0.2452  0.2495  102%  Fimbria  1  -0.334  10.244  0.745  2.4545  2.4749  101%  Fornix  1  0.343  7.455  0.741  0.5471  0.5390  99%  Fourth Ventricle  1  -0.702  12.108  0.496  0.3580  0.3666  102%  Fundus of Striatum  1  -1.472  12.783  0.165  0.1198  0.1294  108%  Globus Pallidus Habenular Commissure  1  2.419  11.777  0.033  2.1244  2.0050  94%  1  1.257  12.396  0.232  0.0407  0.0392  96%  Hippocampus  1  -0.433  9.339  0.675  16.7163  16.8725  101%  Hypothalamus Inferior Olivary Complex  1  0.661  7.218  0.529  8.1151  7.9148  98%  1  0.278  12.818  0.785  0.1400  0.1385  99%  Internal Capsule Interpedunclar Nucleus  1  -0.313  8.382  0.762  2.3479  2.3663  101%  1  1.131  12.357  0.279  0.2360  0.2285  97%  Lateral Olfactory Tract  1  -0.117  9.933  0.910  1.5958  1.6048  101%  Lateral Septum  1  -1.206  12.126  0.251  2.1928  2.2486  103%  Lateral Ventricle  1  -1.176  11.584  0.263  1.9611  2.0162  103%  Mammillary Bodies Mammilothalamic Tract Medial Lemniscus Medial Longitudinal Fasiculus  1  0.990  6.379  0.358  0.4250  0.3845  90%  1  -0.930  9.830  0.374  0.2176  0.2254  104%  1  -0.350  11.039  0.733  2.0199  2.0378  101%  Medial Septum  1  -0.662  8.622  0.525  1.0823  1.1135  103%  Medulla  1  -0.531  10.681  0.607  20.9875  21.3085  102%  Midbrain  1  -0.004  8.503  0.997  11.5940  11.5950  100%  Nucleus Accumbens  1  -1.162  9.945  0.272  3.2032  3.2896  103%  Olfactory Bulbs  1  0.641  9.192  0.537  22.5678  22.1577  98%  Olfactory Tubercle  1  0.575  7.036  0.583  3.3810  3.2279  95%  Optic Tract  1  -0.086  8.804  0.933  1.3168  1.3209  100%  Periaqueductal Grey  1  -0.053  9.510  0.959  3.7528  3.7576  100%  Pons  1  0.035  10.017  0.972  15.4316  15.4199  100%  Pontine Nucleus Posterior Commissure  1  -0.447  9.496  0.665  1.0044  1.0226  102%  1  -0.617  12.669  0.548  0.1346  0.1368  102%  Pre Para Subiculum  1  0.154  8.230  0.881  1.7417  1.7281  99%  Stratum Granulosum  1  0.996  8.845  0.346  0.7592  0.7424  98%  194  Structure of Hippocampus  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  Stria Medullaris  1  -0.715  9.717  0.491  0.6101  0.6208  102%  Stria Terminalis  1  0.109  9.683  0.915  0.6928  0.6907  100%  Striatum Subependymal Zone/Rhinocele  1  0.654  10.367  0.527  15.0321  14.7955  98%  1  -0.203  12.677  0.842  0.0724  0.0730  101%  Superior Olivary Complex  1  0.527  12.757  0.607  0.4784  0.4687  98%  Thalamus  1  0.453  11.004  0.660  13.3152  13.1972  99%  Third Ventricle Ventral Tegmental Decussation  1  1.077  11.486  0.304  0.7834  0.7577  97%  1  -0.270  11.936  0.791  0.1103  0.1114  101%  Amygdala Anterior Commissure pars anterior  3  2.242  11.798  0.045  12.3954  11.4029  92%  3  4.430  13.833  0.001  1.3871  1.2456  90%  3  2.165  13.225  0.049  0.4388  0.3960  90%  3  1.839  11.817  0.091  12.5191  11.7407  94%  Basal Forebrain Bed Nucleus of Stria Terminalis  3  1.456  15.991  0.165  5.7813  5.5795  97%  3  0.133  11.847  0.896  1.2113  1.2071  100%  Cerebellar Cortex Cerebellar Peduncle Inferior  3  1.360  9.672  0.205  55.6569  52.6496  95%  3  0.143  9.453  0.889  0.8531  0.8496  100%  3  1.079  15.976  0.297  2.2228  2.0813  94%  3  1.607  11.653  0.135  1.0551  0.9963  94%  3  -0.879  14.112  0.394  0.3879  0.3971  102%  3  2.543  12.776  0.025  8.0860  7.4781  92%  3  1.848  15.555  0.084  42.5833  40.6202  95%  Anterior Commissure pars posterior Arbor Vita of Cerebellum  Cerebellar Peduncle Middle Cerebellar Peduncle Superior Cerebral Aqueduct Cerebral Cortex Entorhinal Cerebral Cortex Frontal Lobe Cerebral Cortex Occipital Lobe  3  2.236  13.872  0.042  5.0035  4.4780  89%  Cerebral Cortex Parito/Temporal Lobe  3  2.727  13.652  0.017  75.0076  69.5663  93%  Cerebral Peduncle  3  2.057  11.930  0.062  2.4848  2.2903  92%  Colliculus Inferior  3  3.218  10.391  0.009  6.8012  6.2133  91%  Collicululs Superior  3  2.665  10.410  0.023  8.6359  8.1274  94%  Corpus Callosum Corticalspinal Tract Pyramids  3  2.678  11.358  0.021  19.3386  17.6713  91%  3  0.227  11.528  0.825  2.3216  2.2926  99%  Cuneate Nucleus Dentate Gyurs of Hippocampus  3  2.082  13.309  0.057  0.2478  0.2308  93%  3  2.019  15.423  0.061  3.1073  2.9211  94%  195  Structure Facial Nerve Cranial Nerve 7 Fasciculus retroflexus  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  3  1.659  15.974  0.117  0.2780  0.2611  94%  3  2.381  15.952  0.030  0.2646  0.2475  94%  Fimbria  3  2.444  10.069  0.034  2.9821  2.7636  93%  Fornix  3  0.881  14.283  0.393  0.6326  0.6161  97%  Fourth Ventricle  3  -0.309  14.951  0.761  0.3757  0.3784  101%  Fundus of Striatum  3  1.570  15.294  0.137  0.1431  0.1288  90%  Globus Pallidus Habenular Commissure  3  4.109  11.749  0.002  2.7069  2.4382  90%  3  1.612  12.309  0.132  0.0613  0.0557  91%  Hippocampus  3  1.843  14.613  0.086  19.0446  18.3587  96%  Hypothalamus Inferior Olivary Complex  3  1.286  13.925  0.219  8.9603  8.6287  96%  3  0.333  15.991  0.744  0.2920  0.2861  98%  Internal Capsule Interpedunclar Nucleus  3  2.913  11.457  0.014  2.8050  2.5874  92%  3  0.485  14.566  0.635  0.2496  0.2431  97%  Lateral Olfactory Tract  3  2.122  14.721  0.051  1.8566  1.6771  90%  Lateral Septum  3  1.039  13.489  0.317  2.7052  2.6227  97%  Lateral Ventricle  3  2.171  13.567  0.048  2.3760  2.2546  95%  Mammillary Bodies Mammilothalamic Tract Medial Lemniscus Medial Longitudinal Fasiculus  3  -0.083  15.541  0.935  0.4515  0.4566  101%  3  0.572  11.744  0.578  0.2506  0.2456  98%  3  2.245  9.745  0.049  2.9849  2.8015  94%  Medial Septum  3  0.485  14.246  0.635  1.3538  1.3330  98%  Medulla  3  1.041  9.983  0.323  25.8060  24.9945  97%  Midbrain  3  2.587  11.838  0.024  13.0033  12.2603  94%  Nucleus Accumbens  3  1.119  12.723  0.284  3.9002  3.7652  97%  Olfactory Bulbs  3  3.411  15.619  0.004  22.3723  20.6554  92%  Olfactory Tubercle  3  0.607  15.270  0.553  4.2349  4.0353  95%  Optic Tract  3  1.026  13.359  0.323  1.6878  1.6071  95%  Periaqueductal Grey  3  3.061  9.948  0.012  4.0545  3.7641  93%  Pons  3  1.875  13.549  0.083  18.3946  17.5876  96%  Pontine Nucleus Posterior Commissure  3  1.273  13.921  0.224  1.6288  1.5209  93%  3  1.432  12.864  0.176  0.1496  0.1399  94%  Pre Para Subiculum Stratum Granulosum of Hippocampus  3  1.251  14.712  0.230  1.8593  1.7503  94%  3  1.860  15.679  0.082  0.7469  0.7066  95%  196  Structure  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  Stria Medullaris  3  3.025  13.387  0.009  0.7673  0.7289  95%  Stria Terminalis  3  2.574  14.836  0.021  0.7509  0.6932  92%  Striatum Subependymal Zone/Rhinocele Superior Olivary Complex  3  6.722  15.806  0.000  18.7661  17.0415  91%  3  2.979  15.346  0.009  0.0703  0.0640  91%  3  -0.114  10.922  0.911  0.6999  0.7042  101%  Thalamus  3  3.368  15.041  0.004  15.8382  14.8299  94%  Third Ventricle Ventral Tegmental Decussation  3  0.108  15.828  0.915  0.8412  0.8388  100%  3  1.704  15.225  0.109  0.1241  0.1130  91%  Amygdala Anterior Commissure pars anterior  8  -0.081  14.973  0.936  12.7503  12.7806  100%  8  2.305  14.173  0.037  1.5952  1.4925  94%  8  1.354  12.089  0.200  0.5554  0.5341  96%  8  0.559  15.697  0.584  15.2205  15.0730  99%  Basal Forebrain Bed Nucleus of Stria Terminalis  8  0.352  15.934  0.729  6.3132  6.2816  99%  8  -0.546  15.356  0.593  1.3755  1.4019  102%  Cerebellar Cortex Cerebellar Peduncle Inferior Cerebellar Peduncle Middle Cerebellar Peduncle Superior  8  -1.348  15.944  0.197  59.1372  60.7228  103%  8  0.872  15.114  0.397  0.9020  0.8759  97%  8  -1.074  15.292  0.300  2.0507  2.1318  104%  8  0.157  10.193  0.878  1.2351  1.2264  99%  Cerebral Aqueduct Cerebral Cortex Entorhinal Cerebral Cortex Frontal Lobe Cerebral Cortex Occipital Lobe  8  -1.125  11.577  0.283  0.5479  0.6063  111%  8  1.463  15.812  0.163  8.1436  7.8452  96%  8  -0.461  15.974  0.651  43.5511  44.2349  102%  Anterior Commissure pars posterior Arbor Vita of Cerebellum  8  0.922  14.712  0.371  5.1263  4.9357  96%  Cerebral Cortex Parito/Temporal Lobe  8  0.034  15.835  0.974  74.8380  74.7546  100%  Cerebral Peduncle  8  0.634  15.882  0.535  2.7131  2.6948  99%  Colliculus Inferior  8  1.853  14.509  0.084  7.7533  7.3567  95%  Collicululs Superior  8  1.745  15.251  0.101  9.4122  9.1735  97%  Corpus Callosum Corticalspinal Tract Pyramids  8  0.913  15.809  0.375  21.3005  20.9292  98%  8  3.177  15.576  0.006  2.4446  2.1199  87%  Cuneate Nucleus Dentate Gyurs of Hippocampus Facial Nerve Cranial Nerve 7  8  0.858  15.529  0.404  0.2569  0.2329  91%  8  0.734  15.110  0.474  3.4751  3.4052  98%  8  1.307  15.779  0.210  0.3323  0.3101  93%  197  Structure Fasciculus retroflexus  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  8  2.740  15.292  0.015  0.3000  0.2812  94%  Fimbria  8  -1.026  15.208  0.321  3.7536  3.9208  104%  Fornix  8  -0.208  13.417  0.838  0.7210  0.7247  101%  Fourth Ventricle  8  2.060  13.736  0.059  0.4676  0.4084  87%  Fundus of Striatum  8  1.727  15.999  0.103  0.1769  0.1632  92%  Globus Pallidus Habenular Commissure  8  0.425  15.857  0.676  3.2868  3.2538  99%  8  -0.214  14.695  0.833  0.0807  0.0822  102%  Hippocampus  8  1.876  15.736  0.079  20.6716  19.6713  95%  Hypothalamus Inferior Olivary Complex  8  -0.030  15.831  0.976  9.4968  9.5027  100%  8  2.833  14.215  0.013  0.2798  0.2281  82%  Internal Capsule Interpedunclar Nucleus Lateral Olfactory Tract  8  0.873  15.237  0.396  3.1372  3.0741  98%  8  1.247  15.986  0.230  0.2686  0.2534  94%  8  0.622  14.425  0.543  1.6409  1.5983  97%  Lateral Septum  8  -1.187  15.867  0.253  2.9219  3.0209  103%  Lateral Ventricle  8  -1.475  15.924  0.160  2.8599  3.0971  108%  Mammillary Bodies Mammilothalamic Tract  8  0.879  15.985  0.392  0.4064  0.3764  93%  8  1.348  13.023  0.201  0.2832  0.2732  96%  Medial Lemniscus Medial Longitudinal Fasiculus  8  3.355  15.997  0.004  3.2545  2.7827  86%  Medial Septum  8  0.116  14.732  0.910  1.4349  1.4321  100%  Medulla  8  2.608  15.501  0.019  27.8634  24.1298  87%  Midbrain  8  0.352  11.912  0.731  15.0635  14.9464  99%  Nucleus Accumbens  8  0.554  14.849  0.588  4.2840  4.2214  99%  Olfactory Bulbs  8  2.329  15.757  0.034  24.1745  22.5564  93%  Olfactory Tubercle  8  2.112  15.650  0.051  3.6577  3.4003  93%  Optic Tract  8  -0.621  14.575  0.544  1.6948  1.7339  102%  Periaqueductal Grey  8  0.693  14.701  0.499  4.5391  4.4399  98%  Pons  8  2.232  10.154  0.049  20.8767  19.9484  96%  Pontine Nucleus Posterior Commissure  8  -0.964  13.310  0.352  1.2769  1.3781  108%  8  0.841  12.350  0.416  0.1824  0.1750  96%  Pre Para Subiculum Stratum Granulosum of Hippocampus  8  1.279  14.108  0.222  1.9228  1.8221  95%  8  0.688  15.983  0.502  0.9376  0.9095  97%  Stria Medullaris  8  0.306  15.830  0.764  0.8364  0.8322  100%  Stria Terminalis  8  1.097  14.362  0.291  0.9871  0.9643  98%  198  Structure  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  Striatum Subependymal Zone/Rhinocele Superior Olivary Complex  8  1.893  14.347  0.079  19.6708  18.6611  95%  8  1.947  14.562  0.071  0.0777  0.0718  92%  8  0.381  12.471  0.710  0.8527  0.8280  97%  Thalamus  8  2.081  12.601  0.058  17.4263  16.8441  97%  Third Ventricle Ventral Tegmental Decussation  8  -0.604  15.018  0.555  0.8915  0.9088  102%  8  0.731  15.994  0.476  0.1336  0.1291  97%  Amygdala Anterior Commissure pars anterior Anterior Commissure pars posterior Arbor Vita of Cerebellum  12  0.656  10.127  0.526  11.0961  10.9344  99%  12  1.322  11.259  0.212  1.4347  1.3817  96%  12  3.214  11.669  0.008  0.4933  0.4518  92%  12  0.364  11.662  0.722  12.5756  12.4704  99%  Basal Forebrain Bed Nucleus of Stria Terminalis  12  0.176  10.429  0.864  5.8043  5.7837  100%  12  -1.693  13.825  0.113  1.1707  1.2457  106%  Cerebellar Cortex Cerebellar Peduncle Inferior Cerebellar Peduncle Middle  12  -1.574  14.248  0.137  52.3307  54.3071  104%  12  0.572  11.691  0.578  0.9225  0.9080  98%  12  -0.439  14.916  0.667  2.9423  3.0017  102%  12  1.596  14.835  0.132  1.0475  1.0152  97%  12  -0.775  14.944  0.451  0.5465  0.5823  107%  12  0.576  10.768  0.577  6.8369  6.7455  99%  12  1.482  14.871  0.159  35.8320  34.9720  98%  12  0.232  14.557  0.820  4.1574  4.1273  99%  12  1.338  10.950  0.208  64.6731  62.8647  97%  Cerebral Peduncle  12  1.184  12.907  0.258  2.7180  2.6152  96%  Colliculus Inferior  12  1.735  14.112  0.104  7.0692  6.7861  96%  Collicululs Superior  12  1.915  13.548  0.077  8.6908  8.3886  97%  Corpus Callosum Corticalspinal Tract Pyramids  12  2.603  11.262  0.024  19.5808  18.5451  95%  12  1.769  14.615  0.098  2.3127  2.1783  94%  Cuneate Nucleus Dentate Gyurs of Hippocampus Facial Nerve Cranial Nerve 7  12  -0.243  12.294  0.812  0.2942  0.3009  102%  12  -0.922  11.569  0.376  3.1291  3.2039  102%  12  2.610  12.951  0.022  0.3145  0.2816  90%  12  0.480  12.221  0.640  0.2604  0.2575  99%  Cerebellar Peduncle Superior Cerebral Aqueduct Cerebral Cortex Entorhinal Cerebral Cortex Frontal Lobe Cerebral Cortex Occipital Lobe Cerebral Cortex Parito/Temporal Lobe  Fasciculus retroflexus  199  Structure  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  Fimbria  12  3.237  12.658  0.007  3.2921  3.0274  92%  Fornix  12  1.160  14.783  0.265  0.6424  0.6255  97%  Fourth Ventricle  12  -1.790  14.061  0.095  0.3946  0.4237  107%  Fundus of Striatum  12  0.842  14.989  0.413  0.1467  0.1411  96%  Globus Pallidus Habenular Commissure  12  3.055  10.099  0.012  2.8452  2.6988  95%  12  1.448  10.036  0.178  0.0744  0.0570  77%  Hippocampus  12  0.386  11.156  0.707  17.6252  17.4799  99%  Hypothalamus Inferior Olivary Complex  12  -0.163  14.400  0.872  8.4298  8.4535  100%  12  0.942  12.525  0.364  0.2839  0.2715  96%  Internal Capsule Interpedunclar Nucleus Lateral Olfactory Tract  12  2.291  11.771  0.041  2.8770  2.7176  94%  12  -0.426  10.671  0.679  0.2241  0.2289  102%  12  0.157  12.377  0.878  1.7255  1.7115  99%  Lateral Septum  12  -0.606  9.332  0.559  2.5304  2.5544  101%  Lateral Ventricle  12  -1.997  14.822  0.064  2.6327  2.7535  105%  Mammillary Bodies Mammilothalamic Tract Medial Lemniscus Medial Longitudinal Fasiculus  12  0.804  11.093  0.438  0.2790  0.2656  95%  12  2.623  14.381  0.020  0.2463  0.2265  92%  12  0.743  11.321  0.472  2.9212  2.8656  98%  Medial Septum  12  1.030  11.388  0.325  1.2358  1.2030  97%  Medulla  12  0.985  13.011  0.343  25.6479  25.1100  98%  Midbrain  12  0.784  12.549  0.448  12.8559  12.7189  99%  Nucleus Accumbens  12  0.753  14.794  0.463  3.5974  3.5318  98%  Olfactory Bulbs  12  1.918  9.611  0.085  22.5289  21.6024  96%  Olfactory Tubercle  12  0.426  14.777  0.676  3.7301  3.6230  97%  Optic Tract  12  2.302  13.156  0.038  1.6890  1.5396  91%  Periaqueductal Grey  12  1.584  14.998  0.134  3.9528  3.8346  97%  Pons  12  0.016  13.373  0.987  19.8194  19.8129  100%  Pontine Nucleus Posterior Commissure  12  0.074  13.250  0.942  1.7410  1.7358  100%  12  0.086  13.809  0.932  0.1473  0.1470  100%  Pre Para Subiculum Stratum Granulosum of Hippocampus  12  -0.214  11.761  0.834  1.5805  1.5918  101%  12  -0.991  14.038  0.338  0.8045  0.8290  103%  Stria Medullaris  12  0.297  14.615  0.770  0.7858  0.7812  99%  Stria Terminalis  12  2.158  11.467  0.053  0.8865  0.8386  95%  Striatum  12  3.647  12.476  0.003  16.7053  15.7010  94%  200  Structure Subependymal Zone/Rhinocele Superior Olivary Complex  Age (Months)  t-value  deg. freedom  p-value  WT Volume (mm3)  YAC128 Volume (mm3)  YAC128/WT (%)  12  0.007  13.241  0.995  0.0654  0.0654  100%  12  0.580  10.152  0.575  0.7188  0.7048  98%  Thalamus  12  2.388  12.528  0.033  14.7348  14.1282  96%  Third Ventricle Ventral Tegmental Decussation  12  -1.023  14.053  0.324  0.9387  0.9761  104%  12  1.487  14.304  0.159  0.1239  0.1172  95%  201  Appendix B – Structure Volumes in Casp2-/- x YAC128 Mice Given is the mean structure volume, as a percentage of total brain volume, for each genotype at 12 months of age. Also given are the F- and p-values for a factorial ANOVA analyzing the effect of each transgene on the structure volume. Casp2-/YAC128  Casp2-/-  ;YAC128  F-  p-  p-  p - YAC  Casp2  Interaction  1.0359  0.1431  0.4355  0.3151  6.8734  0.6681  0.0002  0.0124  0.4187  6.9266  0.9098  3.2497  0.0121  0.346  0.0792  0.029530  0.1102  0.9815  0.6387  0.7417  0.3279  0.429  0.014654  0.013907  5.3603  0.7219  3.3989  0.026  0.4007  0.0728  0.002922  0.002581  0.002732  0.3256  15.986  0.4833  0.5715  0.0003  0.4911  0.116428  0.121668  0.117612  0.123482  3.1274  0.7216  0.0524  0.0848  0.4008  0.8201  0.002009  0.001850  0.001898  0.001885  6.6454  0.3075  1.7486  0.0138  0.5824  0.1938  0.003906  0.003834  0.003598  0.003843  0.0194  1.1981  1.5583  0.89  0.2804  0.2194  0.002542  0.002479  0.002474  0.002419  11.5911  3.5818  0.1458  0.0015  0.0659  0.7046  0.001028  0.001025  0.001222  0.001154  0.414  4.3984  0.2991  0.5237  0.0425  0.5875  0.016848  0.017285  0.017239  0.017355  0.037  1.2804  1.7465  0.8486  0.2647  0.194  0.090340  0.090940  0.094137  0.092068  4.2511  4.6892  3.0505  0.0459  0.0365  0.0886  Structure  WT Mean  Mean  Mean  Mean  F - YAC  F - Casp2  Amygdala  0.028147  0.028289  0.028655  0.028356  2.233  0.6209  0.003830  0.003600  0.003595  0.003501  16.5663  0.001109  0.001100  0.001173  0.001091  Cerebellum  0.029881  0.029601  0.028569  Basal Forebrain  0.014435  0.014519  Stria Terminalis  0.002882  Cerebellar Cortex  Interaction  Anterior Commissure pars anterior  Anterior Commissure pars posterior  Arbor Vita of  Bed Nucleus of  Cerebellar Peduncle Inferior  Cerebellar Peduncle Middle  Cerebellar Peduncle Superior  Cerebral Aqueduct  Cerebral Cortex Entorhinal  Cerebral Cortex Frontal Lobe  202 Casp2-/YAC128  Casp2-/-  ;YAC128  WT Mean  Mean  Mean  Mean  p-  p-  p - YAC  Casp2  Interaction  0.010542  0.010891  0.010783  0.010791  0.0141  0.1225  1.9739  0.9062  0.7282  0.168  0.144882  0.147103  0.148320  0.148521  0.5566  1.8835  1.2239  0.4601  0.1778  0.2754  Peduncle  0.006459  0.006144  0.006085  0.006270  1.2587  0.2237  1.8939  0.2688  0.6389  0.1766  Colliculus Inferior  0.012610  0.012131  0.012324  0.012496  3.4881  0.3088  1.6186  0.0693  0.5816  0.2108  Superior  0.019181  0.019120  0.018756  0.018870  1.8023  1.4525  0.0106  0.1872  0.2354  0.9183  Corpus Callosum  0.043129  0.043221  0.043213  0.043130  0.8729  0.0037  0.2185  0.3559  0.9515  0.6427  Tract Pyramids  0.004743  0.004782  0.004893  0.004522  6.484  0.5712  5.089  0.0149  0.4543  0.0298  Cuneate Nucleus  0.000528  0.000488  0.000519  0.000536  0.5606  0.8811  0.9575  0.4585  0.3537  0.3339  0.007106  0.007464  0.007268  0.007433  1.5758  0.3704  2.0722  0.2168  0.5463  0.158  0.000720  0.000655  0.000674  0.000650  18.82  2.6375  1.5362  0.0001  0.1124  0.2226  retroflexus  0.000688  0.000650  0.000612  0.000589  30.3187  65.0882  0.1899  0  0  0.6654  Fimbria  0.007872  0.007639  0.008064  0.007758  10.8508  1.7854  0.5606  0.0021  0.1892  0.4585  Fornix  0.001649  0.001647  0.001647  0.001584  6.9579  1.9088  2.677  0.0119  0.175  0.1099  Fourth Ventricle  0.000809  0.000832  0.000881  0.000845  0.1901  0.6986  0.5529  0.6653  0.4084  0.4616  Striatum  0.000365  0.000343  0.000385  0.000344  17.995  1.5393  1.8803  0.0001  0.2221  0.1781  Globus Pallidus  0.007340  0.007161  0.007125  0.006843  12.9403  6.3634  0.808  0.0009  0.0158  0.3742  Commissure  0.000115  0.000131  0.000124  0.000147  4.1589  2.4432  0.0647  0.0482  0.1261  0.8006  Hippocampus  0.044412  0.045670  0.043332  0.044515  0.3335  2.8309  0.2298  0.5669  0.1005  0.6343  Hypothalamus  0.023355  0.023132  0.022250  0.022596  1.7376  6.2434  0.2647  0.1951  0.0168  0.6098  Structure  FF - YAC  F - Casp2  Interaction  Cerebral Cortex Occipital Lobe  Cerebral Cortex Parito/Temporal Lobe  Cerebral  Collicululs  Corticalspinal  Dentate Gyurs of Hippocampus  Facial Nerve Cranial Nerve 7  Fasciculus  Fundus of  Habenular  203 Casp2-/YAC128  Casp2-/-  ;YAC128  WT Mean  Mean  Mean  Mean  p-  p-  p - YAC  Casp2  Interaction  Complex  0.000328  0.000340  0.000342  0.000331  0.3195  0.006  1.1889  0.5752  0.9387  0.2822  Internal Capsule  0.006541  0.006413  0.006374  0.006286  4.999  1.6627  0.0339  0.0312  0.2048  0.8549  0.000713  0.000690  0.000655  0.000708  0.0122  0.2117  1.3729  0.9128  0.648  0.2484  Tract  0.004207  0.003840  0.004169  0.003754  11.2907  0.1789  0.1131  0.0018  0.6747  0.7384  Lateral Septum  0.006127  0.006291  0.006636  0.006685  0.006  12.6589  0.6981  0.9385  0.001  0.4085  Lateral Ventricle  0.005736  0.005729  0.006196  0.006832  0.5502  5.9831  0.6048  0.4627  0.0191  0.4415  0.001608  0.001532  0.001512  0.001565  0.2218  0.0582  0.4506  0.6403  0.8106  0.506  0.000610  0.000600  0.000582  0.000583  1.9064  3.0174  0.0193  0.1752  0.0903  0.8902  Fasiculus  0.007237  0.007304  0.007246  0.006888  4.9024  2.7495  3.4686  0.0327  0.1053  0.0701  Medial Septum  0.003382  0.003453  0.003352  0.003416  0.0026  0.361  0.2416  0.9598  0.5514  0.6258  Medulla  0.059839  0.059002  0.059612  0.057964  13.2613  0.8562  1.3473  0.0008  0.3605  0.2528  Midbrain  0.032129  0.031457  0.030447  0.030932  3.4047  6.6231  1.0923  0.0726  0.014  0.3024  Accumbens  0.009361  0.009442  0.009504  0.009273  3.6213  0.0259  2.706  0.0644  0.8729  0.108  Olfactory Bulbs  0.056530  0.054006  0.054379  0.053230  8.6112  1.7003  0.1366  0.0056  0.1999  0.7136  Tubercle  0.009328  0.009255  0.010536  0.010118  0.8652  6.5214  0.2869  0.358  0.0147  0.5953  Optic Tract  0.004198  0.003951  0.004400  0.004101  9.0456  2.6624  0.2202  0.0046  0.1108  0.6415  Grey  0.009186  0.009051  0.008880  0.009164  0.4568  0.1473  1.5803  0.5031  0.7032  0.2162  Pons  0.040959  0.039092  0.038571  0.038409  11.6023  6.59  1.4102  0.0015  0.0142  0.2422  Pontine Nucleus  0.002865  0.002722  0.002628  0.002827  0.0506  0.3404  6.1195  0.8232  0.563  0.0178  Structure  FF - YAC  F - Casp2  Interaction  Inferior Olivary  Interpedunclar Nucleus  Lateral Olfactory  Mammillary Bodies  Mammilothalamic Tract  Medial Lemniscus Medial Longitudinal  Nucleus  Olfactory  Periaqueductal  204 Casp2-/YAC128  Casp2-/-  ;YAC128  WT Mean  Mean  Mean  Mean  0.000347  0.000335  0.000347  0.000339  6.3617  0.2386  0.0001  0.0159  0.628  0.9933  0.004066  0.004282  0.004440  0.004252  0.3441  1.3329  3.3025  0.5609  0.2553  0.0769  Hippocampus  0.001821  0.001924  0.001783  0.001866  2.3833  1.6749  0.3409  0.1307  0.2032  0.5627  Stria Medullaris  0.001752  0.001695  0.001623  0.001680  0.6091  2.231  1.2775  0.4398  0.1433  0.2653  Stria Terminalis  0.001858  0.001844  0.001833  0.001777  4.6196  1.9124  0.9808  0.0379  0.1746  0.3281  Striatum  0.040043  0.039175  0.040884  0.039393  13.1434  1.1167  1.2082  0.0008  0.2971  0.2784  0.000225  0.000217  0.000203  0.000207  5.6453  0.085  2.795  0.0225  0.7721  0.1026  Complex  0.001965  0.001811  0.001877  0.001892  11.4102  2.7042  0.0943  0.0017  0.1081  0.7604  Thalamus  0.034721  0.033883  0.033896  0.033221  0.0031  3.79  1.243  0.9562  0.0588  0.2717  Third Ventricle  0.002152  0.002088  0.002174  0.002291  9.2944  3.0792  0.3794  0.0041  0.0872  0.5415  0.000277  0.000258  0.000259  0.000251  8.584  1.4855  0.6077  0.0056  0.2302  0.4403  Structure  FF - YAC  F - Casp2  Interaction  p - YAC  p-  p-  Casp2  Interaction  Posterior Commissure  Pre Para Subiculum  Stratum Granulosum of  Subependymal Zone/Rhinocele  Superior Olivary  Ventral Tegmental Decussation  205  Appendix C – List of Publications  Publications Lerch JP, Carroll JB*, Spring S, Bertram L, Schwab C, Hayden MR, Henkelman RM. Automated deformation analysis in the YAC128 Huntington disease mouse model. Neuroimage (2008) 39:32-39. Valenza M, Carroll JB*, Leoni V, Bertram LN, Bjorkhem I, Singaraja RR, Di Donato S, Lutjohann D, Hayden MR, Cattaneo E. Cholesterol biosynthesis pathway is disturbed in YAC128 mice and is modulated by huntingtin mutation. Hum Mol Genet (2007) 16(18):2187-98. * Equal Contribution. Manuscripts in preparation Carroll JB, Graham RK, Lerch JP, Cao LP, Ehrnhoefer DE, Hung G, Bissada N, Zhang WN, Henkelman RM, Hayden MR. Mice lacking caspase-2 are protected from excitotoxicity and behavioral phenotypes, but not pathology, in the YAC128 model of Huntington Disease. Under Review. Carroll JB, Lerch JP, Babich SL, Cao LP, Zhang WN, Henkelman RM, Gibson WT, Hayden MR. Caspase-2-/- mice have metabolic alterations. In preparation. Carroll JB, Lerch JP, Bissada N, Henkelman RM, Hayden MR. A natural history of the neuropathology of the YAC128 mouse. In preparation. Abstracts  206 Carroll JB, Graham RK, Cao LP, Zhang WN, Hayden MR. Interrogation of caspase-2 as a target in HD with the YAC128 mouse. CHDI, Annual general meeting. Palm Springs, CA, USA (February 2010). Carroll JB, Graham RK, Cao LP, Zhang WN, Hayden MR. Interrogation of caspase-2 as a target in HD with the YAC128 mouse. CHDI, Annual general meeting. Cannes, France (April 2009). Carroll JB, Bertram LN, Cao L, Hung G, Hayden MR. Towards caspase antisense therapeutics for Huntington Disease. CHDI, Annual general meeting. Cannes, France (April 2009). Carroll JB, Cao LP, Graham RK, Zhang WN, Hayden MR. Caspase-2 modulates excitotoxicity and behavioral phenotypes in the YAC128 model of Huntington Disease. Keystone Symposia – Neurodegenerative Diseases: New Molecular Mechanisms. Keystone, CO, USA (February 2009). Carroll JB, Cao L, Hayden MR. Caspase-2 plays a role in excitotoxic neuronal death. Gordon Research Conference - Cell Death: Molecules That Specify The Variety Of Cell Death Mechanisms. Lucca, Italy (July 2008). Carroll JB, Ehrnhoefer DE, Graham RK, Cao L, Hayden MR. Caspases -2 and -6 as drug targets in HD. Hereditary Disease Foundation, Bi-Annual Scientific Meeting. Cambridge, MA, USA (August 2008). Valneza M, Carroll JB, Leoni V, Donato S, Hayden MR, Cattaneo E. Exploring Cholesterol Dysfunction in HD Animal Models. Hereditary Disease Foundation, BiAnnual Scientific Meeting. Cambridge, MA, USA (August 2008). Lerch JP, Carroll JB, van Eede M, Hayden MR, Henkelmen RM. Progressive neuroanatomical changes in the YAC128 mouse model of Huntington’s Disease. International Society for Magnetic Resonance in Medicine, Annual Scientific Meeting. Toronto, ON, Canada (May 2008).  207 Carroll JB, Lerch JP, Pouladi M, Tsatskis S, Bertram LN, Henkelman RM, Hayden MR. High Resolution 3D MRI of YAC128 Huntington Disease Mouse Model Brain. Hereditary Disease Foundation, Bi-Annual Scientific Meeting. Cambridge, MA, USA (August 2006). Tsatskis S, Lerch JP, Carroll JB, Hayden MR, Henkelman RM. High-Resolution 3D MRI to Identify Neurodegeneration in a Huntington Disease Mouse Model Brain. International Society for Magnetic Resonance in Medicine, Annual Scientific Meeting. Seattle, WA, USA (May 2006).  208  Appendix D – Ethics Certificates 1.1. THE UNIVERSITY OF BRITISH COLUMBIA  ANIMAL CARE CERTIFICATE Application Number: A07-0106 Investigator or Course Director: Michael Hayden Department: Medical Genetics  Animals: Mice 129 100 Mice C57Bl/6 423 Mice FVB 50 Mice FVB 9000 Mice C57BL/6 200 Mice FVB 10  Start Date: March 15, 2007  Funding Sources:  Approval Date:  December 9, 2009  209 Funding Agency: Funding Title:  Funding Agency:  Funding Title:  Huntington's Disease Society of America  Proteolytic Cleavage and the Pathogenesis of Huntington Disease  High Q Foundation  TREAT-HD: Translational Research on Excitotoxicity to Accelerate Therapies for Huntington's Disease (Scientific Proof of Concept Studies)  The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies.  A copy of this certificate must be displayed in your animal facility.  Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, BC V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093  210  1.1. THE UNIVERSITY OF BRITISH COLUMBIA  ANIMAL CARE CERTIFICATE BREEDING PROGRAMS  Application Number: A07-0262 Investigator or Course Director: Michael Hayden Department: Medical Genetics  Animals: Mice BL/6 160 Mice FVB 50 Mice FVB 1400 Mice 129 100 Mice C57BL/6 200  Approval Date: January 18, 2010 Funding Sources:  Funding Agency: Funding Title:  High Q Foundation  HDSA Coalition for the Cure / TREAT HD  211  Funding Agency: Funding Title:  Canadian Institutes of Health Research (CIHR)  The use of YAC transgenic mice to explore the pathogenesis of HD.  The Animal Care Committee has examined and approved the use of animals for the above breeding program. This certificate is valid for one year from the above approval date provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies.  A copy of this certificate must be displayed in your animal facility.  Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, BC V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0343315/manifest

Comment

Related Items