Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Engineering a pro-apoptotic BCG strain to improve efficacy of the current tuberculosis vaccine Lau, Ting Ting Alice 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_may_lau_tingtingalice.pdf [ 2.69MB ]
Metadata
JSON: 24-1.0342968.json
JSON-LD: 24-1.0342968-ld.json
RDF/XML (Pretty): 24-1.0342968-rdf.xml
RDF/JSON: 24-1.0342968-rdf.json
Turtle: 24-1.0342968-turtle.txt
N-Triples: 24-1.0342968-rdf-ntriples.txt
Original Record: 24-1.0342968-source.json
Full Text
24-1.0342968-fulltext.txt
Citation
24-1.0342968.ris

Full Text

  ENGINEERING A PRO-APOPTOTIC BCG STRAIN TO IMPROVE EFFICACY OF THE CURRENT TUBERCULOSIS VACCINE  by  Ting Ting Alice Lau  B.Sc., The University of British Columbia, 2010   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in The Faculty of Graduate and Postdoctoral Studies  (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  February 2017 © Ting Ting Alice Lau, 2017    ii ABSTRACT Bacillus Calmette-Guérin (BCG), introduced almost 100 years ago, is the only vaccine designed to prevent tuberculosis (TB). BCG effectively protects newborns from meningeal TB yet fails to prevent adult pulmonary TB. In fact, TB kills 1.3 million people annually in areas where BCG vaccination is widely practiced. Thus, more efficient TB vaccines are urgently needed. We and others have shown that BCG possesses the same virulence traits of Mycobacterium tuberculosis, in particular attenuation of essential macrophage functions such as phagosome maturation and antigen presentation. One of these studies revealed that defect in antigen presentation is largely due to down-regulation of the macrophage’s cysteine protease cathepsin S (CatS), which leads to prevention of MHC II molecule maturation and proper antigen presentation. Recent studies also suggested a potential role for cysteine proteases in the regulation of apoptosis, a key cellular process used by the macrophage to i) contain and process ingested bacteria and ii) facilitate cross-talk antigen presentation between the macrophage and dendritic cells.  To reverse the phenotype of vaccine-mediated macrophage attenuation, we engineered a novel BCG strain that expresses and secretes active CatS (rBCG-CatS). Since caspase-3 plays a central role in the execution of apoptosis, we also constructed a BCG strain that secrets an active form of caspase-3 (rBCG-C3). Macrophages infected with either recombinant strain elicited a pro-apoptotic phenotype as indicated by increased levels of annexin V surface staining, PARP degradation, and caspase-3 cleavage compared to parental BCG. Furthermore, macrophage transcriptomic  iii profiling revealed that rBCG-CatS up-regulates key pro-apoptotic genes and down-regulates anti-apoptotic genes, which were further confirmed by RT-qPCR analyses. Consistent with these findings, mice vaccinated with rBCG-CatS or rBCG-C3 showed increased antigen-specific CD4+ and CD8+ T-cell responses, as well as enhanced cytokine production and proliferation upon ex vivo re-stimulation. Of particular note, immunogenicity responses from mice vaccinated with rBCG-C3 exceeded the effects observed with rBCG-CatS, demonstrating that induction of apoptosis is key to achieving high immunogenicity of TB vaccines. Collectively, we have shown that by modifying BCG we can promote key host traits that confer high potential in improving efficacy of the TB vaccine.      iv PREFACE Design of all research, data analysis, and manuscript preparation were completed with the assistance of Dr. Zakaria Hmama.  All experiments were designed and performed by the author with the following exception in Section 4: Figures 18 and 19 were generated by Dr. Vijender Singh.  Parts of this thesis have been accepted for publication in a peer-reviewed journal: Lau, A., Singh, V., Soualhine, H., & Hmama, Z. (2017). A pro-apoptotic recombinant BCG strain expressing cathepsin S to improve efficacy of the current tuberculosis vaccine.   In this study, I designed and performed all experiments except Figure 1 and Table 1, which were performed by Soualhine, H. The mouse immunogenicity experiments were designed with the assistance of Singh, V. I wrote the manuscript with assistance from Hmama, Z. This published work is located in Sections 3 and 6.1.  Important molecular biology tools used during my PhD studies were generated during a pre-doctoral training I performed in Dr. Hmama’s laboratory and were published in 2009:  Sun, J.*, Lau, A.*, Wang, X., Liao, T.Y. A., Zoubeidi, A., & Hmama, Z. (2009). A broad-range of recombination cloning vectors in mycobacteria. Plasmid. 62(3):158-65. In this study, I contributed to the design of and performed the experiments related to cloning of most of the entry and destination vectors. Sun, J. contributed to the development of work  v shown in Figures 1, 2 and 5. Wang, X. and Liao, T.Y. A. contributed to the development of the work shown in Figures 3 and 4. The manuscript was written by Sun, J. and Hmama, Z. I edited the material and method section as well as the result and discussion sections. Reprinted with permission from Elsevier. *Co-first authors with equal contributions.  I will briefly refer to it in the Materials and Methods Section 2.4.2.  All animal experiments were performed in accordance with the UBC Animal Care Committee guidelines under the following protocols: A11-0247 and A16-0041.   vi TABLE OF CONTENTS ABSTRACT .............................................................................................................................. ii PREFACE ................................................................................................................................ iv TABLE OF CONTENTS ......................................................................................................... vi LIST OF TABLES .................................................................................................................... x LIST OF FIGURES ................................................................................................................. xi LIST OF ABBREVIATIONS ................................................................................................ xiii ACKNOWLEDGEMENTS ................................................................................................... xix CHAPTER 1: INTRODUCTION ............................................................................................. 1 1.1 Tuberculosis .................................................................................................................... 1 1.1.1 Scope and global impact of the disease .................................................................... 1 1.1.2 Mtb Life cycle, TB diagnosis, and treatment ........................................................... 2 1.1.3 Current vaccine, its shortcomings, and proposed solutions ...................................... 8 1.2 Apoptosis ....................................................................................................................... 11 1.2.1 Overview ................................................................................................................ 11 1.2.2 Key players and pathways ...................................................................................... 11 1.2.3 Dysregulated apoptosis and pathology ................................................................... 14 1.2.4 Role of apoptosis in TB pathogenesis .................................................................... 15 1.2.5 Role of apoptosis in TB immunity ......................................................................... 17 1.3 Caspase-3 ...................................................................................................................... 18 1.3.1 Caspase-3 processing and activation ...................................................................... 18 1.3.2 Execution of apoptosis by caspase-3 ...................................................................... 19  vii 1.4 Cathepsin S .................................................................................................................... 20 1.4.1 Overview of cysteine cathepsins ............................................................................ 20 1.4.2 Overview of MHC presentation pathway ............................................................... 21 1.4.3 Role of CatS in MHC II maturation ....................................................................... 25 1.4.4 Lysosomal pathway of apoptosis ............................................................................ 27 1.5 Aim of study .................................................................................................................. 29 CHAPTER 2: MATERIALS AND METHODS .................................................................... 31 2.1 Reagents and chemicals ................................................................................................ 31 2.2 Antibodies ..................................................................................................................... 31 2.3 Cell culture .................................................................................................................... 32 2.3.1 Cell line maintenance and propagation .................................................................. 32 2.3.2 BMDM culturing .................................................................................................... 32 2.3.3 Infection .................................................................................................................. 33 2.4 Bacteria.......................................................................................................................... 33 2.4.1 Mycobacterial strains and growth conditions ......................................................... 33 2.4.2 Construction of mycobacterial Destination Vectors ............................................... 33 2.4.3 rBCG-CatS and rBCG-C3 constructions ................................................................ 35 2.4.4 Mycobacteria transformation .................................................................................. 36 2.4.5 Mycobacteria expression ........................................................................................ 36 2.5 Microarray and RT-qPCR study ................................................................................... 36 2.6 Apoptosis analysis ......................................................................................................... 38 2.6.1 Annexin V microscopy ........................................................................................... 38 2.6.2 Flow cytometry ....................................................................................................... 39  viii 2.6.3 Western analysis ..................................................................................................... 39 2.7 Murine immunogenicity studies .................................................................................... 40 2.7.1 Mouse immunization and splenocyte harvesting.................................................... 40 2.7.2 Tetramer staining .................................................................................................... 40 2.7.3 CFSE cell proliferation assay ................................................................................. 41 2.7.4 Intracellular cytokine staining ................................................................................ 41 2.8 Statistical analyses......................................................................................................... 42 CHAPTER 3: RECOMBINANT BCG EXPRESSING CATHEPSIN S IMPROVES HOST CELL APOPTOSIS AND VACCINE IMMUNOGENICITY ............................................... 43 3.1 Background ................................................................................................................... 43 3.2 Global macrophage transcriptome profiles in response to BCG expressing Cathepsin S ............................................................................................................................................. 44 3.3 Chromosomal expression of human active CatS in BCG ............................................. 46 3.4 rBCG-CatS induces the expression of macrophage pro-apoptotic genes ..................... 48 3.5 Recombinant Cathepsin S protein induces active-caspase 3 ......................................... 51 3.6 BCG prevents macrophage apoptosis while rBCG-CatS induces it ............................. 52 3.7 CatS expression in BCG improves its immunogenicity ................................................ 56 CHAPTER 4: RECOMBINANT BCG EXPRESSING CASPASE-3 FURTHER IMPROVES VACCINE IMMUNOGENICITY .......................................................................................... 64 4.1 Background ................................................................................................................... 64 4.2 Characterization of rBCG-C3........................................................................................ 64 4.3 Human and murine cell lines infected with rBCG-C3 showed increased level of apoptosis .............................................................................................................................. 66  ix 4.4 Improved immunogenicity of rBCG-C3 infected mice ................................................. 68 CHAPTER 5: DISCUSSION .................................................................................................. 76 5.1 Expression of CatS in BCG converts it into a more immunogenic vaccine ................. 76 5.2 Proposed mechanism of cathepsin S promoting apoptosis ........................................... 80 5.3 Benefits of a recombinant BCG strain expressing executioner caspase ....................... 81 CHAPTER 6: CONCLUSION AND FUTURE DIRECTIONS ............................................ 85 6.1 Conclusion ..................................................................................................................... 85 6.2 Future directions ............................................................................................................ 85 REFERENCES ....................................................................................................................... 87     x LIST OF TABLES Table 1. List of primers used in RT-qPCR study.................................................................... 38 Table 2. Macrophage transcriptome in response to rBCG-hcs ............................................... 46      xi LIST OF FIGURES Figure 1. The life cycle of Mtb. ................................................................................................ 4 Figure 2. Overview of apoptosis pathways ............................................................................. 12 Figure 3. Model of the MHC alpha/beta hetero-dimer associated with Ii chain..................... 23 Figure 4. Invariant chain degradation. .................................................................................... 24 Figure 5. The MHC II presentation pathway. ......................................................................... 25 Figure 6.  Microarray analysis of macrophage transcriptome in response to BCG and rBCG-hcs .................................................................................................................................... 45 Figure 7. Construction and characterization of recombinant BCG expressing CatS .............. 48 Figure 8. Expression level of select apoptosis genes in RAW 264.7 cells infected with BCG or rBCG-CatS .................................................................................................................. 50 Figure 9. CatS-coated beads induce active caspase-3 expression in RAW 264.7 .................. 52 Figure 10. BCG does not induce activate caspase-3 in the cell .............................................. 53 Figure 17. BCG inhibits caspase-3 activation in the presence of staurosporine in RAW 264.7 cells .................................................................................................................................. 54 Figure 12. rBCG-CatS induces cellular apoptosis .................................................................. 56 Figure 13. Ag85+ CD4+ T-cells generated in C57BL/6 mice immunized with rBCG-CatS. . 58 Figure 14. CD4+ T-cells proliferation upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. .......................................................................................... 59  xii Figure 15. Intracellular cytokine expression of IFN upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. .................................................................. 60 Figure 16. Intracellular cytokine expression of TNF upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. .................................................................. 61 Figure 17. Intracellular cytokine expression of IL-2 upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. .................................................................. 63 Figure 18. Construction and characterization of recombinant BCG expressing active caspase-3 ....................................................................................................................................... 65 Figure 19. rBCG-C3 induces cellular apoptosis in vitro......................................................... 67 Figure 20. Immunogenicity studies in C57BL/6 mice ............................................................ 69 Figure 21. Immunogenicity rBCG-CatS vs rBCG-C3 ............................................................ 73 Figure 22. Schematic of BCG surface decoration approach ................................................... 84       xiii LIST OF ABBREVIATIONS  AATF  apoptosis antagonizing transcriptional factor AF  Alexa Fluor Ag85A antigen 85 A Ag85B antigen 85 B AIDS acquired immune deficiency syndrome Akt1 RAC-alpha serine/threonine-protein kinase ALPS  autoimmune lymphoproliferative syndrome ANOVA analysis of variance Apaf-1  apoptosis protease activating factor APC  antigen presenting cell BAD Bcl2-associated agonist of cell death Bak Bcl-2 homologous antagonist/killer Bax Bcl-2-associated X protein BCG  Bacillus Calmette-Guérin  Bcl-2 B-cell lymphoma 2 Bcl-XL B-cell lymphoma-extra large Bid BH3 interacting-domain death agonist Bim Bcl-2-like protein 11 BMDM  bone marrow derived macrophage BMRC  British Medical Research Council BMT  bone marrow transplantation BSA bovine serum albumin   xiv C3  caspase-3 CAD  caspase-activated DNAse Cat  cathepsin CatS  cathepsin S CatX cathepsin X CCR7 C-C chemokine receptor type 7 CD62L L-selectin CFSE carboxyfluorescein succinimidyl ester  CIAP calf intestine alkaline phosphatase CLIP  class II-associated Ii peptide ConA concavalin A cTEC  cortical thymic epithelial cell CTL  cytotoxic T-lymphocyte DAP  death-associated protein DAPI 4',6-diamidino-2-phenylindole DC dendritic cell DISC  death-inducing signaling complex DLI  donor lymphocyte infusion DMEM Dulbecco's Modified Eagle Medium DST drug susceptibility test EDTA ethylenediaminetetraacetic acid EGTA ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid eIF2alpha  eukaryotic initiation factor-2alpha  xv ELISA  enzyme-linked immunosorbent assay ER  endoplasmic reticulum ESAT6 6 kDa early secretory antigenic target  FACS fluorescence-activated cell sorting FADD Fas-Associated protein with Death Domain FasL  Fas ligand FasR  Fas receptor FCS  fetal calf serum GFP green fluorescent protein GOI gene of interest H2O2  hydrogen peroxide hcs human cathepsin S HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV human immunodeficiency virus HLA-DM human leukocyte antigen DM hly  listeriolysin HlyA  hemolysin A HSP heat shock protein IAP  inhibitor of apoptosis ICAD  inhibitor of CAD IFN  interferon-gamma IGRA  interferon gamma release assay Ii chain  invariant chain  xvi IL interleukin LB  Luria-Bertani media LCM  L-cell conditioned media LLO Listeriolysin O LLOMe  L-leucyl-L-leucine methyl ester LMP low molecular weight polypeptide M6PR  mannose-6-phosphate receptor Mcl-1 myeloid cell leukemia 1 MDR  multi-drug resistant MHC major histocompatibility complex MMP  mitochondrial membrane permeabilization MOI multiplicity of infection MPT  mitochondrial permeability transition Mtb  Mycobacterium tuberculosis NAAT  nucleic acid amplification test NDI  N-dodecylimidazole Nef  negative regulatory factor NF-B nuclear factor kappa-light-chain-enhancer of activated B cells NIAID  National Institute of Allergy and Infectious Diseases NIH National Institutes of Health NTM non-tuberculouse mycobacteria nuoG  NADH ubiquinone oxidoreductase chain G OADC  oleic acid albumin dextrose catalase complex  xvii PARP  poly(ADP-ribose) polymerase PBS phosphate-buffered saline  PE  phycoerythrin PERK  double-stranded RNA-activated protein kinase-like ER kinase PFA paraformaldehyde PKC protein kinase C delta PMA phorbol 12-myristate 13-acetate PMSF phenylmethane sulfonyl fluoride  PS  phosphatidylserine Puma p53 upregulated modulator of apoptosis rBCG recombinant BCG ROS  reactive oxygen species RPMI Roswell Park Memorial Institute medium RT-qPCR reverse transcription quantitative polymerase chain reaction SCID  severe combined immunodeficient SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SOD  superoxide dismutase STAT signal transducer and activator of transcription TAP transporter associated with antigen processing TB tuberculosis TBS-T tris-buffered saline tween Tcm central memory T-cell  xviii TEC  thymic epithelial cell Tem effector memory T-cell Th1  T-helper 1 cell TMB 3,3',5,5'-Tetramethylbenzidine TNF  tumor necrosis factor TNF  tumor necrosis factor alpha TNFR1  tumor necrosis factor receptor 1 TNFR2 tumor necrosis factor receptor 2 TRAIL TNF-related apoptosis-inducing ligand TST  tuberculin skin test ureC  urease C WBL  whole (BCG) bacterial lysate WHO  World Health Organization XDR  extensively-drug resistant XIAP  X-chromosome-linked inhibitor of apoptosis        xix ACKNOWLEDGEMENTS  The work of this thesis could not have been accomplished without the unyielding support, guidance, and expertise from my supervisor Dr. Zakaria Hmama. He introduced me to the world of scientific research, and was there during every step of the journey to watch me grow.   I am grateful for my committee members, Dr. Yossef Av-Gay and Dr. Vincent Duronio, who have provided me with insightful ideas and comments for my work throughout the years.   I would like to thank all the past and present members of the Hmama lab, with special thanks to Dr. Vijender Singh for his intellectual inputs. I also appreciate all the friends I have acquired throughout my research journey, and of course all the friends who have remained by my side on this long and winding road.  I would like to acknowledge the financial support from TB Vets, Canadian Institute of Health Research (CIHR), BC Lungs Association, and the University of British Columbia.  Lastly, but perhaps most importantly, I must thank my parents and my husband for their unconditional love and support. Without them by my side, this doctoral degree would not have been possible.  1 CHAPTER 1: INTRODUCTION 1.1 Tuberculosis  1.1.1 Scope and global impact of the disease  Tuberculosis (TB), originally known as “consumption”, an antique term used to describe wasting away of the body, is a disease characterized by a chronic cough with blood-containing sputum, chest pain, fever, night sweats, and weight loss [1]. It was not until 1882, when German physician Robert Koch discovered the causative tubercle bacillus, Mycobacterium tuberculosis (Mtb), that the name “tuberculosis” began to be used [2].  TB has been documented as far back as 3500 BC by ancient Egyptians, where osseous changes were found in the spines of mummies, indicated spinal TB infection [3]. Scourging through Europe and North America during the 18th and 19th centuries, the TB epidemic claimed up to 1,000 lives per 100,000 people per year [4]. Initially a romanticized condition among the arts [5], TB later developed a stigma associated with poverty and fear of transmission, that often caused delays in seeking treatment [6]. The discovery of streptomycin in 1944, along with massive BCG vaccination and the development of improved public health regimen, significantly reduced the global burden of TB disease. Unfortunately, this victory was quickly crushed with the rise of drug-resistant Mtb strains in the 1980s, which made TB again out control, especially in developing countries. Such a dramatic situation urged the World Health Organization (WHO) to declare TB a global health emergency in 1993 and, as of today, TB remains the number one killer in infectious diseases by a single pathogen worldwide [1]. In 2014, 9.6 million people developed TB disease and 1.5 million perished from it [1]. Although >95% of TB mortality occurs in low to  2 middle income countries, a growing concern stems from TB being the leading killer among HIV-positive people worldwide [1]. In fact, having a compromised immune system drives up the risk of developing TB by 20-30-fold to the point that 1 in 3 deaths from AIDS is due to Mtb co-infection [1].   On the other hand, the HIV population contributes significantly to the spread of drug-resistant TB to the general population [7]. Multi-drug resistant (MDR) TB is defined by resistance to at least isoniazid and rifampicin [8]. In addition, resistance to any fluoroquinolone and at least one of three second-line drugs (i.e. amikacin, kanamycin, or capreomycin) is deemed to be extensively-drug resistant (XDR) [9]. Global burden of MDR-TB was estimated to be 5% of the total number of TB cases [1].  Out of these MDR-TB cases, approximately 9% develop XDR-TB, as reported by 100 countries [1].   1.1.2 Mtb life cycle, TB diagnosis, and treatment  TB is highly contagious; an infection can be established from as little as a single bacterium [10]. The bacilli are expelled as droplet nuclei into the environment by an individual with active disease, and these droplets are small enough to remain airborne for several hours to be inhaled by the next unsuspecting person [10]. Inhaled bacteria are phagocytized by alveolar macrophages, which triggers a local pro-inflammatory response and allows the infected cells to invade the subtending epithelium (Fig. 1). It takes 8-12 days post-infection before resident lung dendritic cells (DCs) become activated and migrate to the lung’s draining lymph nodes and activate naïve T-cells [11]. 14-17 days post-infection, antigen-specific Th1 cells are then able to arrive in the lungs [11]. During this time, Mtb is free to grow and modulate the environment to establish itself in a suitable niche [12].  3 Activated macrophages signal for the recruitment of fresh mononuclear cells from nearby blood vessels, providing new grounds for the spread of infection [10]. The infection quickly becomes extensively vascularized (within a few days) [13], and starts to form the hallmark TB structure, the granuloma [10]. Over the next few weeks, lymphocytes are recruited to the structure but are segregated by a fibrous cuff of extracellular matrix material, which encases the macrophages that have differentiated into epithelioid cells, multi-nucleated giant cells and foam cells filled with lipid droplets [10,13]. When the granuloma is presented in this “balanced state”, the disease is contained and considered inactive. Many factors in an individual’s life can trigger the onset of active TB. The progression of disease is characterized by a loss of vascularization [10], and an increase in foamy macrophages that leads to an accumulation of caseous debris in the granuloma center [14], which later becomes hypoxic [15] and necrotic [10]. The ultimate fate of the granuloma is rupture and collapse into the lungs and escape of viable bacilli into the airway, spreading the infection via productive coughs [10].    4 Figure 1. The life cycle of Mtb. The bacillus is inhaled into the airway and taken up by alveolar macrophages, triggering pro-inflammatory signals that recruit lymphocytes and promote vascularization. The granuloma is formed and maintained when the individual is not in an active form of disease. However, when the structure collapses, infectious bacilli are released into the airway and active TB ensues. Russel DG et al. Nat Immunol. 2009. 10(9):943-948. Reprinted with permission from Nature Publishing Group.   5 Diagnosis of patients with active TB disease typically involves assessment of clinical symptoms in combination with molecular and culture-based laboratory tests [16]. Clinical symptoms of TB disease are defined by a persistent and productive cough, fever, night sweats, and weight loss [16,17]. In addition to manifestation of disease symptoms, proper clinical diagnosis of active TB would include (1) chest radiography, (2) sputum smear microscopy, (3) mycobacterial culture and phenotypic drug susceptibility tests (DST), and (4) nucleic acid amplification tests (NAAT) [17]. Chest radiography is often the first tool used to examine an individual suspected of having active TB, but this method is limited by a sensitivity of only 70-80% and a poor specificity of 60-70% [17]. Complicating this further, there is very poor agreement among readers on the interpretation of the X-rays, leading to uncertainties in the diagnosis of active disease [17,18]. Despite this, chest radiography remains an important part of TB diagnosis, but requires follow-up microbiological tests for confirmation.  In this regard, sputum smear microscopy is the most widely used method to test for active TB, due to its high speed, low cost, and ability to identify highly infectious TB patients [17,19,20]. This method is dependent on the type of specimen, patient population, choice of stain, and experience of the microbiologist, thus resulting in a sensitivity of 20-80% that is highly variable [17,21-23]. Furthermore, in low TB incidence countries, a positive smear could be confounded by non-tuberculous mycobacteria (NTM) [17]. Nevertheless, in many low-resource, TB endemic countries, sputum smear microscopy is often the sole method of TB diagnosis used to supplement clinical symptoms [16].  6 Given the deficiencies of sputum smear microscopy, high-resource countries including Canada subjects the same specimen to culturing regardless of the sputum smear results [17]. Mycobacterial culture methods are the current gold standard for detection of active TB, and are considered to be the most sensitive [17,19,20]. Depending on the culture method (i.e. solid or liquid media) and number of bacteria in the inoculum, culture results typically take between 2-8 weeks [17]. While occasionally false positives are observed, it is often due to cross-contaminations in the laboratory. However, in such cases, longer than usual detection time and/or fewer colonies would raise suspicions and further tests would be conducted to confirm results [17]. Beyond the definitive diagnosis of active TB, culturing can also provide valuable information on species identification, drug-susceptibility, and enables use of the culture for further molecular work [17,20].  In addition to culture-based diagnosis of active TB, molecular tests are now available to produce a much faster result than conventional culture methods.  Indeed, Nucleic Acid Amplification Tests (NAAT), which utilizes the polymerase chain reaction (PCR) technique are used to quickly diagnose TB and to detect drug resistance [17]. While the commercial NAATs have high sensitivity to detect TB (>95%), this is limited to sputum smear-positive samples, as sensitivity drops to 50%-70% in smear-negative/culture-positive samples and extrapulmonary specimens [17,24-26]. Therefore, a negative NAAT result should not be used to rule out the possibility of active TB [17]. Moreover, NAATs require sophisticated laboratory infrastructure and highly skilled technicians, as any contaminating DNA at the test site would compromise the results [17]. The mycobacterial culture (phenotypic DST) and the NAAT (genotypic) methods are further used in conjunction for the diagnosis of drug-resistant TB [17,19,27-29].  DST of  7 mycobacterial cultures provides phenotypic results within 4-14 days and 4-21 days for first- and second-line drugs, respectively [27,28]. Genotypic methods such as NAATs are used to detect mutations associated with drug resistance. While commercially available NAATs (line-probe assays and the Xpert MTB/RIF test) are quick and relatively specific and sensitive, they are only useful for detection of resistance to rifampicin and isoniazid [17]. Thus, culture DST is recommended to confirm drug-resistance TB diagnosis. Immune-based methods for diagnosis of TB include serological tests, tuberculin skin test (TST), and interferon gamma (IFN) release assays (IGRAs) [17]. However, the use of serological tests is strongly discouraged by the WHO, as they are unreliable and expensive [17,30-32]. Similarly, the use of TST and IGRAs are also not recommended for diagnosis of active TB, as neither can differentiate between latent TB infection (LTBI) and active TB [17,33]. However, these immunodiagnostic tools can serve as indicators for pediatric tuberculosis, but only in conjunction with other standard TB diagnosis methods discussed above [17]. When the first TB patient was successfully treated by streptomycin monotherapy in 1944 [34], the world thought that Mtb had met its demise. In 1948, the British Medical Research Council (BMRC) conducted the first large-scale clinical trial for the use of streptomycin in TB patients and concluded that streptomycin monotherapy was efficacious and significantly reduced immediate morality [35,36]. However, in the same year, Crofton and Mitchison reported the first streptomycin resistance in Mtb [37]. Over the next few decades, new drugs have been introduced and different combinations of drugs for treatment have been extensively analyzed [36]. This led to the current antibiotic regimen for TB, which is a combination of four drugs (rifampin, isoniazid, pyrazinamide, ethambutol or  8 streptomycin) for 6 months. While a chemotherapy regimen is in place, the long treatment duration and unpleasant side effects result in compliance issues, which continues to contribute to the emergence of drug-resistance Mtb strains [38]. In addition, Mtb is also prone to spontaneous mutations that occur at predictable rates [39]. This is compounded by the fact that only a few new antibiotics have entered the market in recent decades, due to the declining interest in TB drug development by major pharmaceutical companies [40]. For all of the reasons above, many investigators believe that vaccination would be the most effective and cost-conscious preventive method to control TB globally [41]. Unfortunately, the current and only TB vaccine available, Bacillus Calmette-Guérin (BCG) has a limited efficacy and needs to be replaced or urgently improved. 1.1.3 Current vaccine, its shortcomings, and proposed solutions One of the most widely administered vaccines worldwide [42], BCG was first isolated in 1921 by continuous in vitro passaging of the bovine TB bacillus, M. bovis, until it has lost its virulence in calves and guinea pigs [42]. While BCG has proven itself worthy in preventing disseminated diseases, especially miliary and meningeal TB in children [43], its efficacy in pulmonary TB is highly variable [44,45]. There are 3 main hypotheses to why BCG has variable efficacy. (1) BCG has become overly attenuated through repeated passaging in culture and modern preparations are inadequate in sustaining its potency [46], (2) unless vaccinated at birth, exposure of infants to environmental strains of mycobacteria could lead to tolerance [47-49], and (3) clearance of BCG in some populations may occur prior to development of a protective immune response [10]. In addition, and perhaps most importantly, the problem lies in BCG’s ability to mimic virulent mycobacterial strains in  9 blocking essential functions of antigen presenting cells (APC), such as phagolysosome fusion [50-52], antigen presentation [53,54] and its inability to induce apoptosis [55,56]. To further complicate the issue, the BCG we use to vaccinate against TB, is in fact inclusive of many substrains [57]. With genomic approaches, it was discovered that the substrains are different from each other, despite having been evolved from the same original BCG used in 1921 [57]. Currently, there are five main strains being used worldwide accounting for more than 90% of vaccinations – the Pasteur 1173 P2, the Danish 1331, the Glaxo 1077 (derived from the Danish strain and therefore grouped as one main strain), the Tokyo 172-1, the Russian BCG-I, and the Moreau RDJ strains [58]. While these differences certainly translate to variable adversity, their efficacy in vaccinated individuals remain hotly debated [58-60]. Horwitz et al. conducted a study comparing the efficacy of different BCG strains in the guinea pig model of pulmonary TB [59]. Specifically, they took timeline into account and compared evolutionarily early strains and evolutionarily late strains. The study concludes that late strains are not less potent than early strains, and denied that strain variability is a major contributing factor to BCG vaccine trial outcomes [59]. In contrast, Zhang et al. correlated that strain virulence is proportional to protective efficacy, at least in the murine model [60]. In addition to genetic differences between strains, the genetic differences within some strains can lead to major differences in the characteristics of the BCG vaccine produced from different manufacturer, and in some cases, even between batches from a single manufacturer [61]. Therefore, it is important for researchers to take into account the particular strain and characteristics of that strain they are working with, while attempting to improve the vaccine.  10 Since the realization that the BCG vaccine urgently requires an upgrade, there have been many proposals on improvement strategies, or perhaps how it may be replaced entirely. In general, the vaccines in working can be divided into three groups – (1) prophylactic, (2) post-exposure, and (3) therapeutic [62]. Within the prophylactic category, efforts have been focused on creating a recombinant BCG (rBCG), or an attenuated Mtb strain obtained through deletion of genes in metabolic pathways required for survival or full virulence [63-65], or using viral delivery systems encoding Mtb antigens or protein subunits [66-70]. In order to overcome the limitations of BCG, some investigators have exerted efforts towards novel rBCG strains that allow for increased antigen release into the cytosol from its phagosomal milieu [71,72]. Others opted for subunit vaccines based upon immune-dominant antigen delivery using viral vectors dedicated to boost the effect of BCG [73,74]. This strategy is known as the prime-boost strategy [73,74]. Improvement of BCG is attempted by introducing strongly immunogenic and specific Mtb antigens, or by over-expressing those already made by BCG, aiming to broaden the immune response [75,76]. Currently, only one recombinant BCG vaccine is prevailing in clinical trials (phase IIa) – the VPM1002 vaccine, developed at the Max Planck Institute for Infection Biology in Berlin, Germany. This live rBCG is an urease negative strain (ureC gene deletion) expressing listeriolysin O (LLO) (encoded by hly gene) from Listeria monocytogenes [71,72].  LLO is expected to perforate BCG phagosome, thereby allowing leakage of antigens into the cytoplasm and induction of apoptosis (by a mechanism yet to be identified) [77,78], whereas the absence of ureC allows pronounced acidification of the phagosome and thus creating the optimum biological pH for LLO activity [79-81]. This  11 paves the way to strategies that promote exposure of immunogenic antigens to lymphocytes along with apoptosis induction. 1.2 Apoptosis 1.2.1 Overview  Apoptosis, derived from the Greek meaning of “falling off,” as leaves often do from a tree [82], describes a fundamental cellular process known as “programmed cell death”. This process occurs in multicellular organisms in a highly organized and energy-dependent fashion [83]. Apoptotic cells are morphologically characterized by membrane blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, and maintenance of an intact plasma membrane until late stages of the process [84]. This is in contrast to necrosis, which is a disorganized process that ends in traumatic cell death due to acute cellular injury. Necrosis is morphologically identified with cytoplasmic swelling, mechanical rupture of the plasma membrane, dilation of cytoplasmic organelles, and moderate chromatin condensation [84]. Apoptosis is highly organized and is essential in an organism’s lifecycle. It is a vital process involved in embryonic development, normal cell turnover, and proper development and functioning of the immune system [83]. For example, during embryogenesis, fingers and toes are formed once the cells in-between undergo apoptosis, and roughly 50-70 billion cells die due to apoptosis in a human adult on a daily basis [85,86].  1.2.2 Key players and pathways  Apoptosis is widely known to be initiated through one of three pathways: the Intrinsic, Extrinsic, or the Perforin/Granzyme pathways (Fig. 2). While all pathways (except granzyme A) converge at the executioner caspase, caspase-3, each is initiated by different stimuli. The  12 intrinsic pathway, as the name suggests, occurs due to internal injury to the cell (e.g. cell stress). The extrinsic and perforin/granzyme pathways happen due to external stimuli such as kill signals from other cells (e.g. cytotoxic T-lymphocytes) or extracellular insults. When all 3 pathways converge at the execution step (caspase-3 activation), this results in DNA fragmentation, cross-linking of protein and protein degradation, formation of apoptotic bodies, and expression of ligands to signal for engulfment by phagocytic cells [83].  Figure 2. Overview of apoptosis pathways. This illustration summarizes the key players and sequence of events involved in each of the 3 apoptosis pathways, and the morphological changes that follows. Elmore S. Toxicol Pathol. 2007. 35:495-516. Reprinted with permission from SAGE Publications.    Intrinsic pathway. Previously exclusively considered to be the cell’s powerhouse, the mitochondrion was discovered to have a second function in the 1990s – the control of cell death [87]. The intrinsic pathway is initiated by intracellular signals that act either in a positive or negative fashion [83]. Negative stimuli involve the loss of apoptotic suppression;  13 for example, via the unavailability of growth factors, hormones and cytokines [83]. Positive stimuli include insults to the cell such as radiation, toxins, hypoxia, and viral infections [83]. Ultimately both stimuli result in the mitochondria losing structural integrity, leading to an opening of the mitochondrial permeability transition (MPT) pore, and therefore pro-apoptotic proteins that are normally sequestered in the intermembrane space get released into the cytosol [83,88]. Mitochondrial permeability is controlled by the symphony of pro- and anti-apoptotic Bcl-2 family proteins [89]. The pro-apoptotic members Bax and Bak form pores in the mitochondrial outer membrane [90]. This action is opposed by anti-apoptotic members including Bcl-2, Bcl-XL, and Mcl-1 [90]. Bax and Bak activities can also be mediated by the truncated, active version of Bid, called t-Bid [90]. T-Bid can be produced by a number of proteases, but also by caspase-8, therefore creating a cross-talk between extrinsic and intrinsic pathway [90]. One of the proteins released from the mitochondrion is cytochrome c, which then forms the “apoptosome” by recruiting apoptosis protease activating factor (Apaf-1) and procaspase-9 [91,92]. Procaspase-9 gets activated by dimerization and leads to caspase-3 activation.  Extrinsic pathway. The extrinsic pathway requires transmembrane receptor-mediated interactions [83]. These death receptors are members of the tumor necrosis factor (TNF) receptor gene superfamily [93]. Members of this family have cysteine-rich extracellular domains and a cytoplasmic domain that contains the “death domain” [94]. The death domain transduces extracellular information to the inside of the cell to initiate apoptosis. The best studied receptor-ligand pairs are FasL/FasR and TNF/TNFR1 [83]. Signal transduction begins with clustering of the receptors upon binding with the homo-trimers of the ligands on the cell surface [83]. When the death domains on the intracellular face of the receptors are  14 aggregated, cytoplasmic adapter proteins containing corresponding death domains are recruited [83]. This results in the recruitment of FADD, which then associates with procaspase-8 via dimerization of the death effector domain [83]. Here, a death-inducing signaling complex (DISC) is formed and procaspase-8 becomes activated via auto-catalytic activities [95]. Similar to the intrinsic pathway, activated caspase-8 proceeds to recruit and activate caspase-3.  Perforin/Granzyme pathway. The perforin/granzyme pathway induces apoptosis via granzyme A or granzyme B [83]. This pathway is used by cytotoxic T-lymphocytes (CTLs) to kill tumor or viral-infected cells [83]. CTL first secretes the transmembrane pore-forming molecule perforin into the target cell [96], then the serine proteases granzyme A and B are injected into the cell to exert their functions [83]. While granzyme B can cleave procaspase-10 at aspartate residues to aid in its activation, it can also directly activate caspase-3 [83]. Granzyme A, on the other hand, is completely caspase-independent. Granzyme A cleaves the nucleosome assembly protein SET, which normally inhibits NM23-H1, a DNAse, thereby promoting DNA nicking and ultimately DNA degradation [83,97]. 1.2.3 Dysregulated apoptosis and pathology  Dysregulation of apoptosis is implicated in a wide variety of diseases. Excessive apoptosis could lead to neurodegenerative diseases and ischemic damage; whereas insufficient apoptosis could give rise to inflammatory diseases, autoimmune disorders and many types of cancer [83]. Insufficient apoptosis.  Cancer occurs when there is an inadequate level of apoptosis, whether due to over-proliferation of cells and/or decreased removal of cells [83]. Tumor cells  15 resist apoptosis by expressing anti-apoptotic proteins (e.g. Bcl-2) or by down-regulating or mutating pro-apoptotic proteins (e.g. Bax) [83]. They can also evade killing by immune cells by down-regulating their Fas receptors [83], expressing non-functioning Fas receptors [98], or secreting soluble Fas receptors to sequester the Fas ligands [99]. Aside from cancer, another disease afflicted by insufficient apoptosis is autoimmune lymphoproliferative syndrome (ALPS) [100], which is a collection of diseases that include hemolytic anemia, immune-mediated thrombocytopenia, and autoimmune neutropenia [83]. These diseases occur due to insufficient apoptosis of auto-aggressive T-cells, or over-proliferation of B-cells that results in excessive immunoglobulin production, both leading to autoimmunity [83].  Excessive apoptosis. Although caused by the human immunodeficiency virus (HIV), AIDS is an example of illness mediated by excessive apoptosis. The HIV Tat protein is thought to increase Fas receptor expression on the virus-infected CD4+ T-cell, and therefore upon engagement of the death receptors, result in excessive apoptosis via the extrinsic pathway [83]. The loss of CD4+ T-cells in AIDS patients attenuates their immune system and increases vulnerability to other illnesses. The neurodegenerative disease, Alzheimer’s, is thought to be caused by mutations that result in amyloid  protein to be deposited extracellularly in aggregated plaques. Amyloid  induces excessive apoptosis by causing oxidative stress or by triggering increased FasL expressions in neurons and glia [83].  1.2.4 Role of apoptosis in TB pathogenesis Apoptosis is an important cellular process that contributes to host defence strategies against intracellular infections, including viral, fungal, and bacterial pathogens [90]. In fact, virulent Mtb strains actively block host macrophage apoptosis to persist and replicate  16 intracellularly [101]. Conversely, increased apoptosis is observed in macrophages infected with avirulent Mtb strains [101]. Inhibition of host cell apoptosis has two benefits to the pathogen: (1) it preserves the protective niche for intracellular growth, and (2) reduces priming of adaptive immunity by limiting exposure of antigens. Whereas, host cell apoptosis removes the protective niche that harbours intracellular pathogens and also it encases bacterial antigens in apoptotic bodies [102]. These membrane-bound vesicles display “eat me” signals for non-infected bystander professional phagocytes to take up (efferocytosis), and thereafter, present to and activate lymphocytes [90]. This process thus forces the pathogen to have to re-establish itself in a new naïve host cell. Therefore, the outcome of TB infection in an individual depends on who wins the tug of war between establishing or inhibiting apoptosis, since in the early stages of infection, Mtb adopts a primarily intracellular lifestyle. Virulent Mtb evolved various strategies to block the host cell apoptosis mechanisms. For example, it has been found that the nuoG and secA2 genes in Mtb inhibit apoptosis. NuoG encodes a subunit of the multicomplex component type I NADH-dehydrogenase [103]. In a gain-of-function experiment, introduction of nuoG into non-pathogenic mycobacteria gave rise to the ability to inhibit apoptosis in human or mouse macrophages, and increased virulence in SCID mice [103]. Conversely, deletion of nuoG in Mtb led to more apoptosis and significantly reduced its virulence in mice [103]. SecA2 encodes a component of a virulence-associated protein secretion system in Mtb [64]. Mutations in the secA2 gene impairs secretion of superoxide dismutase and converts virulent Mtb (H37Rv) into a pro-apoptotic strain [64]. Mice infected with secA2 mutant therefore has increased priming of MHC I (CD8+) immunity [64] and vaccination of mice and guinea pigs with this strain induced protective immunity superior to BCG [64].   17 Virulent Mtb has also been found to inhibit apoptosis by interfering with TNF signaling and by upregulating expression of anti-apoptotic protein Mcl-1 [104-106]. Mtb can block TNF-mediated apoptosis [90] by inducing macrophage secretion of TNFR2 to sequester TNF [107]. Fas ligand expression is also down-regulated in Mtb-infected macrophages [90].  1.2.5 Role of apoptosis in TB immunity While efferocytosis of Mtb-infected apoptotic bodies by macrophage lightens the bacillary load, perhaps more importantly, is the efferocytosis by dendritic cells (DC). DC are professional APCs that are of utmost importance in mounting an adaptive immune response. Schaible et al. [55] isolated macrophage apoptotic bodies containing BCG, fed them to immature DC, and found that these DC efficiently activated antigen-specific T-cells including MHC I-restricted CD8+ T-cells. This suggests that macrophage apoptosis is beneficial to the host by promoting priming of adaptive immunity, and in particular by facilitating cross-priming of Mtb antigen to activate CTL [90]. Molloy et al. [108] reported that inducing apoptosis in BCG-infected macrophages using an exogenous drug decreased bacillary viability. The reverse is observed when macrophages were encouraged to undergo necrosis. Similarly, Fratazzi et al. [109] showed that if fresh, uninfected macrophages were added to cultures of M. avium (an avirulent, pro-apoptotic mycobacteria strain)-infected macrophages that were undergoing apoptosis, the result is also reduced bacterial viability. However, this phenomenon is not observed if the infected cells were undergoing necrosis [109]. More importantly, the killing of M. avium appears to be contact-dependent, suggesting that it is likely due to engulfment of apoptotic bodies of infected macrophages by naïve macrophages [109]. The same effect is observed in Mtb infections. Lee et al. [108] showed  18 that adding fresh macrophages to Mtb-infected macrophages undergoing apoptosis caused reduction to Mtb viability. Conversely, if macrophages were added to these cells when they were left to undergo necrosis (at a much later time point), Mtb growth was observed. This is likely due to the efferocytosis of apoptotic bodies from infected macrophages harboring Mtb overcoming the typical resistance to phagolysosomal fusion and delivering the pathogen to an acidified phagolysosome [90].  1.3 Caspase-3 1.3.1 Caspase-3 processing and activation  Caspases are classified as cysteine aspartate proteases, widely expressed in most cells in the inactive, proenzyme form [83]. Once activated, they can activate other pro-caspases via proteolytic cleavage, or can aggregate and auto-activate [83]. Both mechanisms result in a protease cascade that amplifies the apoptotic signaling pathway and lead to rapid cell death [83]. Caspases exert their proteolytic activity at aspartic residues, using specificity that is attributed by neighboring amino acids [83]. Ten major caspases have been identified to date, and are categorized into two groups for apoptosis: (1) initiators (caspase-2, -8, -9, -10), and (2) effectors or executioners (caspase-3, -6, -7) [108,110].  Pro-caspase-3 becomes activated when two cleaved monomers come together to form an active dimer [111]. Active caspase-3 recognizes a short cleavage motif (DXXD) and cleaves proteins containing this motif [112,113]. Although caspase-7 recognizes the same motif towards synthetic substrates, it is a functionally distinct protease from caspase-3, which is still regarded as the more important player in the final phase of apoptosis due to its substrate promiscuity [114,115]. Once caspase-3 is activated, there is no turning back from  19 programmed cell death. Therefore, the activity of caspase-3 is tightly controlled by a constant turnover rate, which ensures the threshold of this protease would not be reached unless an apoptosis stimulus is present [116]. In fact, in eukaryote cells, a sub-apoptotic level of caspase-3 is present independent of apoptosis. Besides merely being a cell death effector, caspase-3 can participate in fundamental cell processes such as proliferation, migration, and differentiation [117,118]. 1.3.2 Execution of apoptosis by caspase-3  Caspase-3, -6, and -7 activate cytoplasmic endonucleases, which degrade nuclear materials [83]. They also activate other proteases that degrade nuclear and cytoskeletal proteins [83]. However, caspase-3 is regarded as the most important executioner caspase. It specifically activates the endonuclease CAD (caspase-activated DNAse) by cleaving ICAD (the inhibitor of CAD). Cleaved ICAD releases CAD [119], which then is free to degrade chromosomal DNA in the nuclei and causes chromatin condensation [83]. Caspase-3 also causes cytoskeletal reorganization by cleavage of the actin binding protein gelsolin [83]. This causes cell disintegration into apoptotic bodies.   The ultimate goal of apoptosis is for apoptotic bodies to be cleaned up by nearby phagocytic cells. Caspase-3 is found to be one of the molecules involved in the regulation of phosphatidylserine (PS) externalization on oxidatively stressed erythrocytes [120]; although, caspase-independent PS exposure occurs in apoptotic primary T-lymphocytes [121]. Exposure of PS on apoptotic cells facilitate non-inflammatory phagocytic recognition by macrophages and fibroblasts and contributes to immune clean-ups [122].  20 1.4 Cathepsin S 1.4.1 Overview of cysteine cathepsins  Cysteine cathepsins are members of the papain-like cysteine proteases family [123]. They are widely distributed among living organisms, and have an uneven tissue-specific expression pattern [123]. There are 11 human cysteine cathepsins discovered based on different DNA sequences – Cathepsin B, C, F, H, K, L, O, S, V, X and W [124]. Cysteine cathepsins generally reside in the lysosome and require a reducing, slightly acidic environment for optimal activity [123]. The majority of cathepsins are ubiquitously expressed in human tissue, indicating that they function in normal cellular protein degradation and turnover; whereas cathepsins K, W, and S have a restricted cell- or tissue-specific distribution, therefore likely to have more specific roles. For example, cathepsin S (CatS) is predominately expressed in APCs, such as macrophages, DC and B cells [125].   Initially, cathepsins were thought to only reside and be active in lysosomes, therefore they were considered to be strict intracellular enzymes responsible for non-specific, bulk proteolysis in the endosomal/lysosomal compartments, where they simply degrade intra- and extracellular proteins [123]. It was later found that active cathepsins are also located in other cellular compartments, such as the nucleus, cytoplasm and plasma membrane [123]. For example, it has been shown that nuclear cathepsin L (CatL) plays a role in cell-cycle progression by proteolytic processing of histones [126,127]. Most cysteine cathepsins function best in slightly acidic pH and are usually unstable at neutral pH, as they will rapidly become irreversibly inactivated [123,128]. However, CatS is an exception, where it is stable at neutral or even slightly alkaline pH [129].  21  Lysosomal cathepsins are synthesized as pre-proenzymes [123]. It is comprised of an N’ terminal signal peptide, which gets cleaved during passage to the endoplasmic reticulum (ER) [123]. The pro-domain (propeptide) assists in the proper folding of the enzyme and targets it to the endosome/lysosome using a specific mannose-6-phosphate receptor (M6PR) pathway [123]. The pro-domain is also an inhibitor to its cognate cathepsin [123]. After removal of the pro-domain, the cathepsin is fully mature and active. Activation occurs at acidic pH and the propeptide dissociates from the enzyme surface [123].  Cysteine cathepsins exhibit broad specificity, cleaving their substrates preferentially after basic or hydrophobic residues [123]. Originally cysteine cathepsins were thought to only participate in terminal protein degradation during cell death, however, it is now well recognized that they contribute to a variety of physiological functions. For example, they take part in MHC II-mediated antigen presentation, bone remodeling, keratinocyte differentiation, and prohormone activations [123]. Altered cathepsin expression and activity levels could lead to various pathological conditions, such as neurological disorders, cardiovascular disease, obesity, inflammatory disease, and cancer [123]. Interestingly, polymorphism in the CatX gene was found to be associated with susceptibility to TB, possibly related to its hypothesized role in immune functions [130]. 1.4.2 Overview of MHC presentation pathway The process of antigen presentation requires T-lymphocyte to recognize antigens presented in the form of short peptides bound to a major histocompatibility complex (MHC) molecule on the surface of APC [131]. Depending on the origin of the antigen, the peptides would either be presented on MHC I or MHC II molecules. When the antigen is generated in  22 the cytosol, namely from intracellular pathogens or viral infections, the antigen is presented on MHC I. When the antigen is generated from the endosomal/lysosomal compartment, mostly due to endocytosis or phagocytosis by the APC, the antigen is presented on MHC II, to be recognized by CD4+ T-cells, whereas MHC I-antigen complex is detected by CD8+ T-cells.  The MHC I antigen presentation pathway begins with proteins being processed by the proteasome, using subunits encoded by the low molecular weight polypeptide (LMP) genes in the cytosol [132]. The resulting peptides are then translocated into the ER lumen via the transporter associated with antigen processing (TAP) [132]. In the ER, TAP has an additional role in peptide loading onto the MHC I heterodimers [132]. Since LMPs and TAPs are instrumental in the processing and loading of peptides onto MHC I, naturally, variability in these two molecules could lead to differential susceptibility to pathogens. Indeed, polymorphisms in the LMP and TAP genes are found to be associated with increased susceptibility to TB in a subpopulation in China [133].  Before the antigen can be loaded onto MHC II molecules, the MHC must first undergo a highly regulated maturation process. MHC II are assembled in the ER into a trimer, comprised of the alpha and beta heterodimer associated with the invariant (Ii) chain (Fig. 3) [134]. The Ii is a chaperone molecule that is a type II glycoprotein that promotes the proper folding and assembly of MHC alpha/beta heterodimer [135,136]. The alpha/beta heterodimer binds to Ii at a particular region called CLIP (class II-associated Ii peptide) in its peptide-binding groove [137]. Ii stabilizes the nascent MHC II heterodimer and prevents premature binding of polypeptides or partially folded proteins in ER [137]. Ii has an endosomal/lysosomal targeting motif at the cytoplasmic tail, to traffic the MHC II to  23 endosomes [138,139]. In order for the antigen to be mounted into the peptide-loading grove, the Ii chain must be degraded by lysosomal proteases in a step-wise fashion (Fig. 4). This degradation occurs in the late endosome/pre-lysosome stage [134]. When Ii is degraded into CLIP, the MHC II-like chaperone molecule HLA-DM exchanges CLIP with peptides derived from self or foreign protein antigens (Fig. 5). The MHC II-peptide complex then traffics to plasma membrane.  Figure 3. Model of the MHC alpha/beta hetero-dimer associated with Ii chain. The alpha/beta heterodimer is represented by the blue and purple colors. The Ii chain is represented by green color, where the red section is the CLIP peptide. Cresswell P. Cell. 1996. 84(4):505-7. Reprinted with permission from Elsevier.   24  Figure 4. Invariant chain degradation. The Ii chain is degraded in a step-fashion by multiple proteases before finally taking the form of CLIP peptide. Rudensky A and Beers C. Ernst Schering Res Found Workshop. 2006. (56):81-95. Reprinted with permission from Springer.   25  Figure 5. The MHC II presentation pathway. The MHC II alpha/beta heterodimer, along with the Ii chain assemble in the ER. The Ii chain contains a motif in its cytoplasmic tail that targets the complex to the endo/lysosomal pathway. In the endo/lysosome, the Ii is degraded into CLIP. With the aid of H-2M (HLA-DM) chaperon, the CLIP peptide is exchanged with peptides derived from internalized proteins. The MHC II-peptide complex then traffics to the cell surface. Rudensky A and Beers C. Ernst Schering Res Found Workshop. 2006. (56):81-95. Reprinted with permission from Springer.   1.4.3 Role of CatS in MHC II maturation Both CatS and CatL are required for late stage Ii processing in professional APCs, but in distinct cell types. They were initially thought to perform similar functions, however, it  26 was later discovered that they indeed have specific non-redundant roles. CatS and CatL are differentially expressed in APCs, including B cells, macrophages, DC, specialized thymic and intestinal epithelium cells [137]. CatS activity was found in B cells and DCs, while CatL activity was found in cortical thymic epithelial cells, whereas macrophages express both CatS and L [137].  Their non-redundant function was elucidated by CatS-deficient mouse experiments that showed B cells and DC contain MHC II-associated Ii degradation intermediates halted at p12 and p18 fragments [140,141]. Antigen presentation studies using MHC II-restricted T-cell hybridomas showed that they have diminished presentation of the majority of exogenous antigens tested when compared to wild-type mice. In CatL-deficient mice, however, B cells and DCs showed normal Ii degradation and MHC II antigen processing and presentation. In contrast, defect in CatL presented a substantial amount of MHC II on cortical thymic epithelial cells (cTECs) bound to p12 Ii fragments. Thus, CatL is important in Ii degradation in the thymic epithelium and purified cTECs [142,143], affecting positive selection of immature double-positive thymocytes.  In macrophages, CatS is the predominant enzyme that processes Ii, as CatL’s role in IFN stimulated macrophages are not detected [144]. In fact, it was found that CatL activity is down-regulated upon IFN stimulation by CatL-specific inhibitors [137]. Similar phenomenon has been observed in DC. This suggests that in a Th1-mediated immune response, which is dominated by IFN production, CatS is preferentially used in all bone marrow derived APCs in secondary lymphoid organs [137]. CatS is crucial in bone marrow-derived cells that induce immune response in the periphery [137], such as DC and  27 macrophages [123]. However, it is uncertain whether CatS simply degrades the Ii into smaller peptides or it performs a specific cleavage [123].  1.4.4 Lysosomal pathway of apoptosis Lysosomes and their proteases have always been associated with cell death. However, while their high potential of degradation was known to be involved in autophagy and necrosis, little was known about their role in apoptosis until the 1990s [145]. The first cathepsin to be linked to apoptosis was CatD, which was once thought to be the lone cathepsin among the lysosomal proteases [146]. We now know that cathepsins are important players in apoptosis; they may act on and activate cell death effector proteases such as granzymes, or directly act as cell death effectors [146]. During lysosome-mediated apoptosis, a critical step is the destabilization of the lysosomal membrane, causing the release of cathepsins into the cytosol. Lysosomal membrane can be disturbed by lysosomotropic agents such as L-leucyl-L-leucine methyl ester (LLOMe) [147], N-dodecylimidazole (NDI) [148], sphingosine [149], and the quinolone antibiotics ciprofloxacin and norfloxacin [150]. In terms of endogenous stimuli for lysosomal membrane permeabilization, sphingomyelin and reactive oxygen species (ROS) can destabilize the membrane [146]. Sphingomyelin can be converted to ceramide, and further to sphingosine. The accumulation of ceramide or sphingosine increases the permeability of the lysosomal membranes [146]. Ceramide can also specifically activate CatD [151] and lead to apoptosis in this manner. ROS destabilizes the lysosomal membranes by the peroxidation of membrane lipids [146]. Superoxide radicals (O2-) are further reduced to hydrogen peroxide (H2O2) by superoxide dismutase (SOD), and H2O2 is lysosome  28 permeable [146]. In the lysosome, the acidic pH and high iron content encourages a Fenton-type reaction and generates intralysosomal ROS, in particular the hydroxyl radical HO•. Since mitochondria are major generator of ROS and H2O2, these agents act as cross-talk between organelles. Furthermore, the signals could be amplified in lysosome through Fenton reactions of converting H2O2 to hydroxyl radicals. Unlike other cell types, CTLs do not possess conventional lysosomes, but their lytic granules serve as a lysosome-related organelle [152]. These granules contain perforin and granzymes renowned for CTL’s cytotoxicity. Perforin is synthesized as an inactive molecule and becomes active after proteolytic removal of the C-terminal peptide [153], most likely by cysteine cathepsins [153]. Granzymes are also synthesized as inactive zymogens and their activation require N-terminal dipeptide cleavage, mediated by CatC residing in the lytic granules [146]. In the case of granzyme B, activation is performed by CatH, and possibly by other proteases [154].  Unlike caspases, cathepsins are already active once exported from the lysosome into the cytosol [155]. The first and best-established cathepsin substrate is Bid [156-160], which was initially described as a caspase-8 substrate. Bid was found to be targeted by many proteases, as the activation site is located in a large unstructured loop called the bait loop [146]. It can be cleaved by caspase-8, granzyme B, calpains, and most of the cathepsins [146,156]. In cell-free systems, Bid was found to be cleaved by CatB, K, L, and H [157], and these reactions were confirmed in various cellular models [157,158]. However, Bid cleavage is not the only way cathepsins regulate apoptosis since cathepsin-mediated apoptosis still occurs in Bid-deficient mice [161]. Indeed, other cathepsin substrates were found to include the anti-apoptotic Bcl-2 family members Bcl-2, Bcl-XL, Mcl-1 and Bax [123,158,159]. Most  29 of them can be cleaved by multiple cathepsins except Bax, which was found to be cleaved only by CatD [158,162]. All of the above suggests that cathepsins act upstream of mitochondrial membrane permeabilization events, and executes apoptosis using the mitochondrial pathway [123]. However, X-chromosome-linked inhibitor of apoptosis (XIAP) is also degraded by cysteine cathepsins [158], suggesting that cathepsins can also act downstream of mitochondrial pathway and perhaps target other apoptosis inhibitors [146]. Furthermore, the finding that caspase-8 is directly activated by CatD during neutrophil apoptosis suggest that cathepsins may have the ability to act on caspases directly [163]. Due to extreme sensitivity of CTLs to the lysosomotropic agent LLOMe, the chemical was proposed as a therapeutic drug in transplant surgery since it targets the lytic granules and induces apoptosis in CTLs during allogenic bone marrow transplantation (currently in clinical trial) [146]. LLOMe can also be used for ex-vivo removal of perforin-positive T-cells from donor lymphocytes used to regenerate immune competence in patients receiving allogeneic bone marrow transplantation [146]. 1.5 Aim of study  The overall objective of this thesis is to engineer a highly immunogenic strain of BCG vaccine by making it more apoptosis-inducing via the introduction of genes that encode apoptosis-mediating factors.  BCG prevents host cell apoptosis even in the presence of potent apoptosis-stimulating agents. Preliminary work demonstrated that CatS exerts numerous physiological functions. Instead of a sole responsibility in the canonical function of invariant chain processing to mature MHC II molecules, CatS is likely to be also involved in the apoptosis pathway. Thus,  30 we decided to construct a recombinant BCG stably expressing CatS (rBCG-CatS) and used it to check whether this strain induces more apoptosis in infected host cells, and as a result achieve a greater immune response in the murine model when compared to BCG. Based upon these findings, and considering that macrophage apoptosis drives optimal adaptive immunity, we went one step further and generated a recombinant BCG strain expressing caspase-3, which is the major apoptosis executioner in cells.  Therefore, the working hypothesis of the thesis is: a pro-apoptotic recombinant BCG will induce host cell apoptosis and therefore elicit greater immune response in the murine model. Overall, this thesis has provided significant insight into creating a highly immunogenic BCG vaccine via promoting macrophage apoptosis. We have shown that macrophage apoptosis connects one of the missing links between innate and adaptive immunity, since apoptosis overcomes the antigen presentation hurdle that BCG vaccination imposes. By demonstrating that a pro-apoptotic BCG improves immunogenicity, this work helps pave the way for a more efficacious TB vaccine to prevent this deadly disease.    31 CHAPTER 2: MATERIALS AND METHODS 2.1 Reagents and chemicals Cell culture media (RPMI 1640 and DMEM) and miscellaneous culture reagents were purchased from StemCell Technologies (Vancouver, BC, Canada). Fetal calf serum (FCS) was purchased from Gibco Laboratories (Burlington, ON, Canada). PMA, mammalian protease inhibitor, and PMSF were purchased from Sigma-Aldrich (St. Louis, MO). Oleic acid albumin dextrose catalase complex (OADC), 7H9 and 7H10 agar culture media were from Difco Laboratories (Detroit, MI). Chloramphenicol was purchased from Sigma-Aldrich and kanamycin, hygromycin and zeocin were from Invitrogen (Burlington, ON, Canada). IL-2 ELISA standard and antibodies were purchased from Peprotech (Quebec, ON, Canada). Calf intestine alkaline phosphatase (CIAP) was purchased from Fermentas (Burlington, ON, Canada). BP and LR clonases, reading frame cassettes (attR1-cm-ccdB-attR2), and ccdB Survival T1 E. coli were from Invitrogen. Luria–Bertani (LB) broth and LB agar were from Fisher Scientific (Pittsburgh, PA). Plasmid purification Miniprep kit was from Qiagen (Mississauga, ON, Canada). Staurosporine was purchased from Sigma-Aldrich and were used at 100 nM. Four μm surfactant-free white sulfonate latex beads were purchased from Interfacial Dynamics Corp (Portland, OR). Phycoerythrin (PE)-conjugated I-Ab-P25 (Ag85B:240-254) tetramers were obtained from NIH Tetramer Core Facility (Atlanta, GA). CellTraceTM carboxyfluorescein succinimidyl ester (CFSE) cell proliferation kit and Alexa Fluor (AF) 488 conjugated annexin V were purchased from Invitrogen. 2.2 Antibodies Rabbit polyclonal anti-human CatS antibody was purchased from Millipore (Billerica, MA). Caspase-3, cleaved caspase-3, and PARP antibodies were purchased from Cell  32 Signaling (Danvers, MA). Rabbit anti-actin antibody was purchased from Santa Cruz. Dylight 680-conjugated goat anti-rabbit IgG (H+L) antibody was purchased from Thermo Fischer Scientific (Burlington, ON, Canada). and AF647 goat anti-rabbit were purchased from Invitrogen. AF647 rat anti-mouse CD4, AF647 rat anti-mouse CD8, PE-Cy7 rat anti-mouse CD4, PE rat anti-mouse CD8, AF647 rat anti-mouse IFN, and AF647 rat anti-mouse TNF antibodies were purchased from BD Bioscience (Mississauga, ON, Canada). AF647 rat anti-mouse IL-2 antibody was from Biolegend (San Diego, CA). 2.3 Cell culture 2.3.1 Cell line maintenance and propagation  RAW 264.7 macrophages (American Type Culture Collection, Manassas, VA) were maintained at 37°C and 5% CO2 using 10 cm diameter culture dishes (Corning Inc., Corning, NY) at a density of ~105 per cm2 in DMEM supplemented with 10% FCS and 1% each of L-glutamine, penicillin and streptomycin, HEPES, non-essential amino acids (100x solution, StemCell). The pro-monocytic THP-1 cell line (American Type Culture Collection) was PMA-differentiated into adherent macrophage-like cells as described [164].  2.3.2 BMDM culturing BMDM (bone marrow derived macrophages) were harvested from femurs of female C57BL/6 mice (I-Ab, H-2Kb, 5-6 week old). Mice were obtained from Charles River Laboratories (Sherbrooke, QC, Canada) and were housed under specific pathogen-free conditions in the animal biosafety level II facilities of the Jack Bell Research Centre (Vancouver, BC, Canada). Bone marrow derived cells were cultured and differentiated into macrophages using complete RPMI media supplemented with 10% L-cell Conditioned  33 Media (LCM). BMDM maturation occurs at day 7 post-harvest and cells were detached from culture dishes using (non-enzymatic) cell dissociation solution from Sigma-Aldrich.  2.3.3 Infection Macrophage monolayers at the appropriate cell density (2 x 105 per cm2) were exposed to bacteria or beads at listed multiplicity of infections (MOIs) for 3-4 h at 37°C to allow for full internalization and then non-ingested particles were removed by washing extensively with culture media. Unless otherwise specified, infected cells were re-incubated for overnight in fresh culture media. 2.4 Bacteria 2.4.1 Mycobacterial strains and growth conditions M. bovis BCG (Pasteur 1173P2) was obtained from Dr. Richard Stokes (Department of Microbiology and Immunology, University of British Columbia). BCG expressing GFP was generated as described in Sun et al. [165]. rBCG-CatS and –C3 was obtained by electroporation of competent bacteria with integrative plasmid pJAK1.A-CatS or pJAK1.A-C3 as described in section 2.4.2, respectively. Parental and recombinant BCG strains were grown in Middlebrook 7H9 broth supplemented with 10% (v/v) OADC, 0.2% (v/v) glycerol and 0.05% (v/v) Tween 80 (Sigma-Aldrich) at 37°C on a shaker platform at 50 rpm, and appropriate antibiotics were added where applicable. 2.4.2 Construction of mycobacterial Destination Vectors During my pre-doctoral training in Dr. Hmama’s laboratory, I generated the following recombination-compatible, mycobacterial vectors that have proved to be essential tools to my PhD research.   34 This work was published in: Sun, J.*, Lau, A.*, Wang, X., Liao, T.Y. A., Zoubeidi, A., & Hmama, Z. (2009). A broad-range of recombination cloning vectors in mycobacteria. Plasmid. 62(3):158-65. Reprinted with modifications with permission from Elsevier.  pMV261 and pMV361 vectors were linearized by the blunt cut restriction enzyme PvuII within their multicloning sites. The vectors were then treated with CIAP for 30 min at 37°C, followed by inactivation at 85°C for 15 min to dephosphorylate the 5’ end in order to prevent self-ligation. The linearized vectors were then ligated with the appropriate blunt reading frame cassette (attR1–cm– ccdB–attR2) with T4 DNA ligase overnight at 16°C. The ligated product was then transformed into ccdB Survival T1 E. coli, and positive clones in the correct orientation of the cassette were screened by PCR using specific primers. Recombination-compatible Destination Vectors pMV261 and pMV361 were renamed to be pJAK2.A and pJAK1.A, respectively. BP reactions were performed for cloning of PCR products (GOI) into Entry Vectors, which is necessary for the eventual cloning of the segment into Destination Vectors. The attP entry plasmid pDONR221/Zeo (150 ng) was mixed with 1–3 L of each purified PCR product in reactions (10 L) that contained 2 L BP Clonase in 25 mM Tris–HCl, pH 7.5, 22 mM NaCl, 5 mM EDTA, 5 mM spermidine HCl, 1 mg/mL BSA. After 2 h incubation at 25°C, proteinase K (2 g in 1 L) was added, and each reaction was incubated at 37°C for 10 min. Aliquots (2 L) of each reaction were transformed into E. coli TOP10 and plated on zeocin LB plates (50 g/mL). Positive clones were screened by colony PCR and the subsequent mini-prepped DNA were subjected to Sanger sequencing.   35 The GOI in positive Entry Vector clones utilizes the LR reaction for transference into mycobacterial Destination Vectors. Aliquots containing 150 ng of each miniprep DNA of Entry clones were incubated with 150 ng of the appropriate Destination Vector in 10 L reactions containing 2 L of LR Clonase, 50 mM of Tris–HCl, pH 7.5, 50 mM of NaCl, 0.25 mM of EDTA, 2.5 mM of spermidine HCl, and 0.2 mg/ mL of BSA. Then proteinase K (2 g in 1 L) was added, and reactions were incubated at 37°C for 10 min. Aliquots (2 L) of each reaction were transformed into E. coli TOP10 and plated on kanamycin (50 g/mL) LB plates. Positive clones were screened by colony PCR and Sanger sequencing.  2.4.3 rBCG-CatS and rBCG-C3 constructions pJAK1.A-CatS (Fig. 7A) was constructed as follows: the active site domain of human CatS (position 115-331 according to Uniprot accession #P25774) was synthesized by GenScript (Piscataway, NJ) to be flanked with the E. coli hemolysin A nucleotide sequence (hlyA) on both sides. In addition, the mycobacterial Ag85B (fbpB) signal sequence and the first 33 nucleotide base pairs of its mature protein is placed upstream of the hlyA sequence, where downstream of the hlyA is completed with extra spacer sequences. The synthesized gene flanked with attB1 and attB2 adapters was cloned in entry vector pDONR221/Zeo, then in destination vector in frame with the Hsp 60 promoter using our Gateway-compatible vector pJAK1.A as described in Sun et al. [165] and Section 2.4.2. pJAK1.A-C3 (Fig. 14A) was constructed by replacing the CatS segment in pJAK1.A-CatS, with a synthesized DNA segment encoding for reverse (active) caspase-3 as described in Srinivasula et al. [166].  36 2.4.4 Mycobacteria transformation Competent BCG (400 L) were mixed with 1 g of DNA and transferred to an electroporation cuvette of 0.2 cm diameter (Bio-Rad, Hercules, CA). Bacteria were electroporated with 2.5 V, and allowed to recover in 7H9 supplemented with 10% OADC in the absence of antibiotics for overnight. Bacteria were then plated on 7H10–OADC in the presence of appropriate antibiotic.  2.4.5 Mycobacteria expression rBCG-CatS and –C3 was verified for CatS or caspase-3 expression, respectively, by growing the bacterial culture to mid-log phase. Cultures were normalized using optical density at 600 nm and ~109 bacteria were used per strain. After washing thrice with PBS + 0.05% Tween 80, cell pellets were suspended in 62.5 mM Tris at pH 6.8, 6 M urea, 10% glycerol, 2% SDS, 5% beta-mercaptoethanol and bromophenol blue at 65°C for 30 min to recover bacterial surface proteins. Cells were pelleted again and supernatants were boiled and resolved on a 15% SDS-PAGE gel. Proteins were then transferred onto nitrocellulose membrane using the semi-dry method at constant 200 mAmp for 35 min. Membranes were blocked using TBS-T + 3% skim milk powder and probed with anti-CatS or anti-caspase-3 antibody at 1:1000 for overnight at 4°C. Blot was developed on the Odyssey Clx from Li-Cor (Lincoln, NE) using goat anti-rabbit IgG (H+L) conjugated with DyLight 680. 2.5 Microarray and RT-qPCR study PMA-differentiated THP-1 cells were left untreated (control) or infected at MOI 20 with BCG or BCG transformed with an episomal plasmid pSMT3 expressing human CatS (rBCG-hcs) [167]. Total RNA was isolated at 6 h post-infection, then 10 g of each RNA  37 sample were first reverse transcribed into cDNA prior to hybridization with the cDNA derived from an universal RNA (Stratagene, La Jolla, CA) and hybridized on Operon’s Human Genome OpArray™ version 4 slides. cDNA indirect labelling was carried out using Genisphere’s Array 350 Expression Array Detection Kit (Genisphere Inc. Hatfield, PA). Analysis of the DNA microarray data was performed with the GenePix Autoloader 200AL (Molecular Devices, Sunnyvale, CA), ImaGene (BioDiscovery, El Segundo, CA) and GeneSpring GX (Agilent Technologies, Santa Clara, CA) softwares. RAW 264.7 cells were infected with either BCG or rBCG-CatS at MOI 20 for 6 h prior to RNA isolation using RNeasy Mini Kit from Qiagen (Mississauga, ON, Canada). cDNA synthesis was performed using EasyScript cDNA Synthesis Kit from ABM Inc (Richmond, BC, Canada). RT-qPCR was performed using gene-specific primers listed in Table 1, with EvaGreen qPCR MasterMix from ABM Inc. The reactions were performed on the StepOnePlus system (Thermo Fisher Scientific, Burlington, ON, Canada), using standard qPCR reaction parameters (enzyme activation: 95°C, 10 min; denaturation: 95°C, 15 sec; annealing/extension: 60°C, 60 sec).    38 Target gene Primer set       AATF Fw: 5’ CCAGGGTGATTGACAGGTTTG 3’   Rv: 5’ CCAGTTTTCTAATGCTACCCACT 3’  BAD Fw: 5’ CCCAGAGTTTGAGCCGAGTG 3’   Rv: 5’ CCCATCCCTTCGTCGTCCT 3’  Bcl-2 Fw: 5’ GGTGGGGTCATGTGTGTGG 3’   Rv: 5’ CGGTTCAGGTACTCAGTCATCC 3’  DAP Fw: 5’ AATGCGAATTGTGCAGAAACAC 3’  Rv: 5’ GGGCTTTCCCATTCCTGGTC 3’  Mcl-1 Fw: 5’ GTGCCTTTGTGGCTAAACACT 3’   Rv: 5’ AGTCCCGTTTTGTCCTTACGA 3’  Puma Fw: 5’ GACCTCAACGCACAGTACGAG 3’    Rv: 5’ AGGAGTCCCATGATGAGATTGT 3’   Table 1. List of primers used in RT-qPCR study. 2.6 Apoptosis analysis 2.6.1 Annexin V microscopy To perform annexin V staining, adherent cells on cover slips were washed twice in binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2 at pH 7.5) and surface stained with AF488-annexin V at 1:20 for 30 min. Cells were then washed in binding buffer and cover slips were mounted on microscope slides in ProLong Gold anti-fade plus DAPI (Thermo Fisher Scientific) to minimize photo-bleaching. Thereafter, slides were examined by digital confocal microscopy using an Axioplan II epifluorescence microscope (Carl Zeiss Inc., Thornwood, NY) equipped with 10x Plan-Apochromat objective (Carl Zeiss Inc.). Images were recorded using a CCD digital camera (Retiga EX, Q Imaging, Burnaby, BC, Canada) coupled to the AxioVision software (Carl Zeiss Inc.).   39 2.6.2 Flow cytometry Levels of cleaved caspase-3 were measured by a flow cytometry assay. Adherent macrophages were lifted from the culture plate, fixed with 4% PFA and permeabilized with 0.2% Triton X-100 in 1x PBS buffer. Cells were then blocked with 0.1% Triton X-100 and 2% BSA in 1x PBS and stained for 1 h with cleaved caspase-3 antibody (1:250) in FACS buffer (2% FCS in 1x PBS) then with AF647 goat anti-rabbit antibody at 1:1000 for 30 min. Cells so treated were washed and suspended in FACS buffer then analyzed with a BD FACSCalibur flow cytometer. 2.6.3 Western blot analysis Cells were washed thrice with cold 1x PBS after infection and lysed using cell extraction buffer (10 mM Tris at pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, 1% Triton X-100, 10% glycerol, 0.1% SDS, 0.5% deoxycholate, 1% mammalian protease inhibitor and 1 mM PMSF). Cell lysate concentrations were determined and normalized using DC protein assay from Bio-Rad (Hercules, CA). Lysates were resolved and transferred into membranes as described above. For caspase-3, membranes were blocked using TBS-T + 5% milk and probed with caspase-3 and actin antibodies at 1:1000 for overnight. For PARP, membranes were blocked using TBS-T + 2% BSA and probed with PARP antibody at 1:1000 for overnight. Blots were developed on the Odyssey Clx from Li-Cor using DyLight 680-conjugated goat anti-rabbit IgG.  40 2.7 Murine immunogenicity studies  2.7.1 Mouse immunization and splenocyte harvesting Four to six weeks old C57BL/6 female mice were obtained from Charles River Laboratories and housed under specific pathogen-free conditions in the animal biosafety level II facilities of the Jack Bell Research Centre. All animals were handled in compliance to protocols approved by the Animal Care and Use Committees at the University of British Columbia. Mice were immunized subcutaneously in the neck scruff with 106 BCG strains in 100 L PBS. 3 mice were used per treatment group. Bacteria were passed 10 times through 27G½ needles to obtain single cell suspensions prior to immunization. Mice were sacrificed 3-4 weeks post-infection by CO2 asphyxiation and spleens were excised. Single spleen cells were obtained by crushing the spleens between 2 frosted glasses and passed through 70 μm cell strainers into RPMI media supplemented with 50 μM beta-mercaptoethanol. Red blood cells were depleted using EasySep mouse biotin positive selection kit using biotin-Ter119/Erythroid cells antibody (StemCell). Splenocytes were cultured in RPMI supplemented with 10% FCS and 1% each of L-glutamine, penicillin and streptomycin, HEPES, non-essential amino acids (100x solution, StemCell), and 50 μM beta-mercaptoethanol. 2.7.2 Tetramer staining Splenocyte samples (4 x 107) were stained with PE-conjugated I-Ab-P25 (Ag85B240-254) tetramers (1:25 in FACS buffer) for 3 h at 37°C, then washed and stained with AF647-conjugated anti-CD4 antibody at 1:50 for 30 min at RT. Cells were washed and fixed with 2% PFA in FACS buffer then analyzed with a BD FACSCalibur flow cytometer. The  41 frequencies of tetramer positive cells were determined in gated half-million CD4 positive events as described in Liao et al [168]. 2.7.3 CFSE cell proliferation assay Splenocytes (2 x 107) were suspended in warm PBS and stained with CFSE at 5 μM for 7.5 min at RT. Cells were then washed thrice with PBS + 10% FCS and suspended in complete RPMI media in the presence of 10 ug/mL BCG whole bacterial lysate (WBL) or 1 μg/mL concavalin A, which is a strong inducer of T-cell division commonly used as positive control. After a 96 h incubation at 37°C, cells were harvested and stained with AF647 conjugated anti-CD4 or anti-CD8 antibody (1:100) for 30 min at RT. Samples were then washed, fixed with 2% PFA then analyzed by flow cytometry. CFSE signal was measured in gated 105 positive CD4+or CD8+ events. 2.7.4 Intracellular cytokine staining Splenocyte samples (3 x 107) were stimulated with BCG WBL (10 μg/mL) or 50 ng/mL PMA + 1 μg/mL ionomycin (positive control) and incubated in complete RPMI media for overnight. Thereafter, Brefeldin A (BD Pharmingen) was added at 1:1000 and cells were re-incubated in 37°C for an additional 4 h time period. Cells were then harvested and stained with PE-Cy7 anti-CD4 or PE anti-CD8 antibodies (1:50) at RT for 30 min. Cells were then fixed with 4% PFA and permeabilized with 5% (w/v) saponin in 100 mM HEPES and 10% FCS. Thereafter, cells so treated were divided in 3 aliquots and stained with specific antibodies to IFNγ (1:50), TNFα (1:50), and IL-2 (1:50) for 45 min at RT. Cells were then washed, suspended in FACS buffer and analyzed by flow cytometry. The frequencies of cytokine positive cells were determined in gated 5 x 105 positive CD4+or CD8+ events.  42 2.7.5 IL-2 ELISA  200 L supernatants were retrieved from the intracellular cytokine staining culture plate (Section 2.7.4) after an overnight incubation with BCG WBL and before the addition of Brefeldin A. Supernatants were spun down and residual cells were discarded. Sandwich ELISA using TMB substrate (BD Bioscience) was performed according to manufacturer’s protocol (Peprotech).  2.8 Statistical analyses To analyze differences of more than two groups, ordinary one-way ANOVA was utilized. P<0.05 was considered statistically significant and represented by the symbol *. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; ns = not significant.    43 CHAPTER 3: RECOMBINANT BCG EXPRESSING CATHEPSIN S IMPROVES HOST CELL APOPTOSIS AND VACCINE IMMUNOGENICITY 3.1 Background Apoptosis is an important cellular process that acts as a host defence strategy against intracellular infections, including viral, fungal, and bacterial pathogens [90]. Macrophages infected with mycobacteria that undergo apoptosis, not only remove the protective niche that harbours these intracellular bacteria, but also encase bacterial antigens in apoptotic bodies [102]. These membrane-bound vesicles display “eat me” signals for non-infected bystander dendritic cells (DC) to take up, and thereafter, present to and activate lymphocytes [90]. Thus, it is believed that the inhibitory effect of BCG on host cell apoptosis may hinder its efficacy [169,170].  In order to overcome the limitations of BCG, some investigators focused their efforts towards novel recombinant BCG (rBCG) strains that allow for increased antigen release into the cytosol from its phagosomal confines [71,72]. Others opted for subunit vaccines using viral-vectors expressing immune-dominant antigens dedicated to boost the effect of BCG, also known as the prime-boost strategy [73,74]. Previous work from our laboratory showed that BCG down-regulates mature MHC II surface expression and demonstrated that this phenotype can be reversed by complementing the bacterium with recombinant human CatS [164,167]. While the canonical role of this cysteine protease is its essential involvement in maturation of MHC II molecule via processing of the invariant (Ii) chain [171], like other members in the cathepsin family, CatS may also play a role in apoptosis [158]. Indeed, we demonstrated that in addition to its role in antigen processing, CatS is a key regulator of macrophage apoptosis. We showed that macrophages infected with BCG expressing CatS  44 (rBCG-CatS) have altered expression of key genes involved in the apoptotic pathway. This effect is more directly illustrated by the introduction of CatS-coated latex beads to the macrophages, which directly induce apoptosis. Most importantly, rBCG-CatS improves immunogenicity in murine model of infection, as indicated by increased antigen-specific T-cell expression and cytokine production. Taken together, rBCG-CatS may hold a novel and promising future in vaccine development in TB research. 3.2 Global macrophage transcriptome profiles in response to BCG expressing Cathepsin S In a previous study, we showed that BCG inhibits CatS expression in the macrophage [164]. To reverse this phenotype, we used the episomal plasmid pSMT3 to express the active domain of human CatS in BCG and obtained a novel vaccine, rBCG-hcs, capable of delivering active CatS within the macrophage [167]. Unlike parental BCG, rBCG-hcs was capable of inducing phagolysosome fusion and surface expression of mature (antigen-loaded) MHC II molecules in primary and THP-1 derived macrophages [167]. To further characterize rBCG-hcs, we sought to obtain a global picture of cell function changes it might induce in the macrophage. Thus, we applied the DNA microarray technology to examine gene expression changes in infected macrophages relative to untreated cells. The results obtained showed a marked difference in gene expression profiles in rBCG-hcs infected cells compared to BCG-infected macrophages (Figs. 6A and B). In a total of 1328 genes there were 884 differentially expressed genes in response to rBCG-hcs and BCG (Fig. 6C). Of these, 320 genes were up-regulated and 331 were repressed in rBCG-hcs-infected macrophages (Fig. 6C).    45          Figure 6.  Microarray analysis of macrophage transcriptome in response to BCG and rBCG-hcs. PMA-differentiated THP-1 cells were left untreated (control) or infected with BCG or rBCG-hcs. Total RNA was isolated at 6 h post-infection then 10 g of each RNA sample were first reverse transcribed into cDNA prior to hybridization with the cDNA derived from an universal RNA and hybridized on Operon’s Human Genome OpArray™ version 4 slides. cDNA indirect labelling was carried out using Genisphere’s Array 350 Expression Array Detection Kit. Analysis of the DNA microarray data is performed through the use of GenePix Autoloader 200AL, ImaGene and GeneSpring GX softwares. (A) Represents the tree of hybridization with reds representing increases and green decreases in gene expressions relative to the universal RNA. (B) Represents the scatter plot of normalized intensities of rBCG-hcs against BCG-infected cells. (C) Represents the Venn diagram of differential gene expression between BCG-infected cells and rBCG-hcs-infected THP-1 cells hybridized against control cells. The normalized ratios are divided for each set of comparison.   Upon closer inspection of functional pathway of interest for us, we found that genes associated with phagosome maturation and antigen presentation pathways are significantly up-regulated in cells infected with rBCG-hcs while down-modulated in response to BCG (Table 2), consistent with our previous findings [167]. More interestingly and in contrast to BCG, rBCG-hcs induced the expression of pro-apoptotic genes and repressed those Up	in	rBCG-hcsUp			in	WT	BCGNormalized rBCG-hcssignalNormalized BCG signalBUpDownBCG//Control rBCG-hcs//Control138 219 32095 225 331CA 46 associated with cell death inhibition. For instance, rBCG-hcs induced 85.37-fold increase in death-associated protein (DAP) while BCG induced 52.43-fold increase in apoptosis antagonizing transcription factor (AATF). Systematic Name Fold changes between: BCG and Control rBCG-hcs and BCG Lysosomal pathway   APG5 autophagy 5-like -43.478 114.500 ATPase, H+ transporting, lysosomal, V1 subunit G isoform 2 -1.761 3.987 ATPase, H+ transporting, lysosomal, V0 subunit D isoform 1 -125.000 56.900 ATPase, H+ transporting, lysosomal, V0 subunit A isoform 1 -14.706 88.700 RAB7B, member RAS oncogene family 1.000 187.300 Proteasome (prosome, macropain) 26S subunit -5.525 5.206 Sortilin-related VPS10 domain containing receptor 2 -23.256 28.900 Cell death   Apoptosis antagonizing transcription factor 52.433 -1.776 Apoptosis inhibitor 5 1.866 -2.660 BCL2-antagonist of cell death 4.238 -10.101 BCL2-binding component 3 -1.490 11.310 BCL2-like 11 (apoptosis facilitator) 1.551 6.008 BCL2-binding component 3 -1.490 11.310 BCL2-like 14 (apoptosis facilitator) -3.175 4.906 Caspase 2, apoptosis-related cysteine protease -11.364 3.407 Caspase 3, apoptosis-related cysteine protease 1.968 10.549 Caspase 6, apoptosis-related cysteine protease 1.873 8.140 Caspase recruitment domain family, member 10 -2.924 2.571 Death-associated protein 3 -3.125 16.417 Death-associated protein -1.416 85.367 Fas (TNF receptor superfamily, member 6) -2.212 6.455 Proapoptotic caspase adaptor protein -1.761 12.076 Programmed cell death 1 ligand 2 1.299 2.326 Programmed cell death 6 interacting protein -1.186 6.778 Tumor necrosis factor (ligand) superfamily, member 11 2.534 11.672 Tumor necrosis factor receptor superfamily, member 10a -27.778 14.058 Ag presentation   Major histocompatibility complex, class II, DR beta 3 1.093 2.191 Major histocompatibility complex, class II, DR beta 4 3.791 4.271 Major histocompatibility complex, class II, DR beta 5 -1.258 6.135 Table 2. Macrophage transcriptome in response to rBCG-hcs. The values (averages of 2  47 independent experiments) represent fold changes in gene expression in THP-1 cells infected with BCG relative to control non-infected cells (BCG and control) and fold changes in gene expression of cells infected with rBCG-hcs relative to cells infected with BCG (rBCG-hcs and BCG). The red color represents increases and green decreases in gene expression, where white represents no significant changes.  3.3 Chromosomal expression of human active CatS in BCG  Due to the unstable nature of episomal vector backbones [172,173] and perhaps the choice of heterologous gene of interest [174], we have deemed the previous construct a potential liability especially for immunogenic studies in mice, which require stable expression of exogenous proteins in recombinant bacteria. Therefore, we opted for the integrative vector pJAK1.A to allow for chromosomal expression of CatS in BCG. Thus, pJAK1.A carrying a DNA segment corresponding to CatS active domain fused to the signal sequence of mycobacterial protein Ag85B (Fig. 7A) was electroporated into competent BCG organisms to obtain a novel recombinant strain referred to as “rBCG-CatS”. Selected transformant clones were grown and subjected to Western blot analyses of cell surface-associated proteins and results obtained showed conclusively the expression of substantial levels of CatS in rBCG-CatS (Fig. 7B). This novel recombinant strain was used to confirm key data obtained with rBCG-hcs and to develop the current study.    Hsp 60 attR1 attR2fbpB-SS fbpB hlyA CatS hlyA spacerA  48  Figure 7. Construction and characterization of recombinant BCG expressing CatS. (A) Schematic of the CatS vector construct. Gene segment consisting of the mycobacterial Ag85B (fbpB) signal sequence and a portion of the mature Ag85B, together with the E. coli hemolysin A (hlyA) sequences and the human active Cathepsin S are synthesized. This segment is outfitted with attB1 and attB2, and was cloned using recombination technology into the pJAK1.A vector. (B) Characterization of rBCG-CatS. Western blot analysis of engineered rBCG-CatS strain demonstrating expression of CatS on the bacterial surface.   3.4 rBCG-CatS induces the expression of macrophage pro-apoptotic genes Since apoptosis is an important cellular trait providing a link between innate and adaptive immunity in infected macrophages [55,175], we analyzed the expression level of 3 selected pro-apoptotic genes by reverse transcription quantitative PCR (RT-qPCR), BAD, DAP, and Puma; and 3 genes associated with apoptosis inhibition, AATF, Bcl-2, and Mcl-1. Consistent with the microarray findings, RT-qPCR data (Fig. 8) showed that expression level of anti-apoptotic genes is significantly higher in macrophages infected with BCG relative to those infected with rBCG-CatS. In particular, BCG-infected cells showed ~200-fold increase in the expression level of Mcl-1, when compared with cells infected with rBCG-CatS. In contrast, pro-apoptotic genes were highly expressed in cells infected with rBCG-CatS; most notably in DAP, where the fold increase was ~4-fold compared to BCG-infected cells. These BActive CatSP191426 MW 49 RT-qPCR data suggest that the novel rBCG-CatS would likely induce macrophage apoptosis and by doing so, improves antigen presentation.  50  Figure 8. Expression level of select apoptosis genes in RAW 264.7 cells infected with BCG or rBCG-CatS. Total RNA was isolated post overnight infection, and 1 g of each Anti-apoptosis Pro-apoptosis 51 RNA sample was first reverse transcribed into cDNA, prior to RT-qPCR with gene-specific primers. ΔΔCT method was used for data analysis and the relative quantification was calculated using uninfected RAW 264.7 cells as point of reference. Statistical values were analyzed using one-way ANOVA with data obtained from 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; ns = not significant.   3.5 Recombinant Cathepsin S protein induces active-caspase 3 Prior to examining the effect of rBCG-CatS on macrophage apoptosis, we first examined whether CatS activity is directly regulating it. Thus, macrophages were infected with latex beads coated with recombinant CatS protein or BSA for overnight then levels of active caspase-3 were determined by intracellular staining with specific antibodies and flow analyses. Results obtained showed that compared to cells exposed to BSA-coated beads, those ingested CatS-beads presented a marked increase in level of cellular apoptosis, as evidenced by the significant shift of fluorescent histograms corresponding to the amounts of cleaved caspase-3 (Fig. 9A), which reflects 28.8 ± 4.83% increase in apoptotic cells (Fig. 9B). These data are consistent with previous findings that IFNγ-induced apoptosis in lung epithelial cells is largely mediated by CatS [176].  ASTP BSA CatSCell countActive caspase-349.63% ± 10.32 0.55% ± 0.32 28.80%± 4.83 52  Figure 9. CatS-coated beads induce active caspase-3 expression in RAW 264.7. Latex beads were coated with recombinant CatS protein or BSA for 3 h at RT, internalized by RAW 264.7 macrophages, and stained intracellularly with active caspase-3-specific antibody after an overnight incubation. Staurosporine (STP) is use to induce active capase-3 expression in the positive control. Results are presented as (A) histogram and (B) bar graph of active caspase-3-positive events relative to untreated cells.  3.6 BCG prevents macrophage apoptosis while rBCG-CatS induces it Prior to demonstrating that CatS delivery by BCG would reproduce data obtained with coated beads, we first sought to clarify the effect of BCG on macrophage apoptosis, as it was previously reported to be a poor inducer [177]. This time we performed Western blot analysis of cleaved caspase-3 levels and were unable to detect even a minor change in response to various BCG MOIs (Fig. 10). Taken one step further, we found that actually BCG actively prevents macrophage apoptosis response to powerful cell death inducers such as staurosporine (Fig. 11).  BBSASTPCatS020406080% Active caspase-3 53  Figure 10. BCG does not induce active caspase-3 in the cell. RAW 264.7 macrophages were infected with BCG at different MOIs for overnight. Cells were then harvested and lysed; cell lysates were resolved on gel electrophoresis and probed with caspase-3 antibody. Staurosporine (STP) is use to induce active capase-3 expression in the positive control.   ActinCaspase-3Active caspase-335 kDa17 kDa42 kDaCell countSTP12.63% ± 0.33BCG + STPBCG3.53% ± 0.361.27% ± 0.26Active caspase-3A 54  Figure 11. BCG inhibits caspase-3 activation in the presence of staurosporine in RAW 264.7 cells. Cells were infected with BCG at MOI 20 for overnight, then 25 nM staurosporine was added to the culture media for an additional overnight incubation. Cells were then lifted and stained for intracellular active caspase-3. Results are presented as (A) histogram and (B) bar graph of active caspase-3-positive events relative to untreated cells.  Thus one might suggest that our recombinant BCG is unlikely to activate the process of apoptosis since it would also block the effect of CatS that it delivers into macrophages. To exclude this possibility, BMDM were infected with rBCG-CatS or BCG and subjected to apoptosis analyses. Flow cytometry data showed ~1.5-fold increase in cleaved caspase-3 in cells infected with rBCG-CatS relative to those infected with BCG (Fig. 12A). Similarly, images from fluorescent microscopy examination of cell membrane integrity showed substantial levels of annexin V-positive cells in response to rBCG-CatS infection (Fig. 12B). In normal viable cells, phosphatidylserine (PS) is located on the cytoplasmic side of the cell membrane, retained there via an active process. When the cell undergoes apoptosis, the retention is lost and PS is exposed to the extracellular environment, allowing detection by annexin V. Taking together, these data indicate that if overnight exposure to BCG blocks staurosporine-induced apoptosis, the recombinant BCG is not able to oppose the effect of BCGBCG + STPSTP051015% Active caspase-3B 55 instantaneous CatS delivery occurring during infection. Therefore, pro-apoptotic rBCG-CatS holds potential in reversing macrophage function defects caused by infection with conventional BCG.     ACell countActive caspase-3 Sample MFI — Untreated cells 12.2 — BCG 17.1 — rBCG-CatS 23.3  56   Figure 12. rBCG-CatS induces cellular apoptosis. (A) Cells were infected at MOI 20 for 24 h prior to fixation/permeabilization and intracellular staining for active caspase-3. Flow analyses showed increased apoptosis in rBCG-CatS-infected BMDM relative to those infected with BCG. (B) RAW 264.7 cells were infected at MOI 20 with BCG strains expressing GFP for 24 h prior to staining with AF568-conjugated annexin V. Confocal microscopy images showed abundant annexin V-positive events (indicative of cells undergoing apoptosis) in rBCG-CatS-infected cells relative to those infected with BCG.   3.7 CatS expression in BCG improves its immunogenicity  The findings that BCG expressing CatS induces phagosome maturation and antigen presentation in macrophages [167], along with my demonstration of the pro-apoptotic feature, suggest that rBCG-CatS would be more immunogenic compared to the parental strain. To test this hypothesis, C57BL/6 mice were subcutaneously vaccinated with BCG strains and sacrificed 4 weeks later to analyse specific in vivo immune response to BCG antigens. Single splenocytes were prepared and subjected to staining with MHC II-restricted PE-conjugated I-Ab-P25 tetramers and flow analyses to determine the frequency of antigen 85B-specific CD4+ BCGAnnexin VDAPIBCG 9.6% ± 2.5rBCG-CatS34.0% ± 4.3Untreated cells6.4% ± 0.4B 57 T-cells. P25 is known to be a dominantly recognized epitope in mice during mycobacterial infection [178] and was shown to be recognized following BCG vaccination [179]. Results obtained (Fig. 13) shows a large expansion (~2-fold increase) of P25-specific CD4+ T-cells in rBCG-CatS vaccinated mice, compared to those injected with BCG. The degree of clonal expansion of antigen-specific CD4+ T-cells was also explored by a proliferation assay using ex vivo re-stimulation of CFSE-stained splenocytes with whole BCG lysate (WBL) (Fig. 14). Stimulated cells were allowed to proliferate for 96 h prior to flow cytometry quantification of CFSE signal decrease in gated CD4+ T-cells, indicative of cell divisions. Dot plots presented in Fig. 14A showed a near 2-fold expansion of re-stimulated CD4+ T-cells isolated from mice inoculated with rBCG-CatS, relative to those isolated from animal injected with PBS. Whereas a minor proliferation was observed in cells isolated from BCG vaccinated mice. In other experiments we determined the frequencies of cytokine-producing cells in response to ex vivo re-stimulation by means of intracellular staining for cytokines and flow analyses. Results obtained (Fig. 15) showed that 1.65% ± 0.40 CD4+ T-cells from rBCG-CatS-immunized animals produced IFNγ, compared to only 0.43% ± 0.24 in splenocytes isolated from mice vaccinated with BCG. Similarly, a higher number (1.39% ± 0.14%) of TNFα producing CD4+ T-cells was observed in cells isolated from rBCG-CatS-immunized animals compared to TNFα positive events (0.87% ± 0.046) in the BCG group (Fig. 16). As well, levels of IL-2 producing CD4+ T-cells (Fig. 17) was significantly higher (0.73% ± 0.15%) in rBCG-CatS group relative to the BCG group (0.37% ± 0.036). The role of CD8+ T-cells in TB immunity is not negligible [180-182] and therefore we also quantified cytokine-producing cells in this subset within WBL-re-stimulated splenocytes. Flow data showed that the frequencies of IFNγ-, TNFα-, and IL-2-producing CD8+ T-cells (1.45%, 0.81%, 0.27%,  58 respectively) are noticeably higher in cells isolated from rBCG-CatS-vaccinated mice than those from the BCG group (1.08%, 0.46%, 0.15%, respectively).   Figure 13. Ag85+ CD4+ T-cells generated in C57BL/6 mice immunized with rBCG-CatS. rBCG-CatS group showed improved tetramer staining of Ag85-specific CD4+ T-cells compared to BCG group, as shown in (A) 2-panel dot plots displaying the average frequencies of Ag85-positive cells  SD in the CD4+ population. Data shown here are representative of 3 independent experiments. The data expressed in bar graph in (B) displays the average frequencies of Ag85-positive cells in the CD4+ population, with their statistical significance. **P<0.01; ns = not significant.  I-Ab-P25 (Ag85B:240-254)CD4APBS0.31%±0.086BCG0.45%±0.14 0.88%±0.06rBCG-CatSB 59   Figure 14. CD4+ T-cells proliferation upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. rBCG-CatS group showed improved CD4+ T-cell proliferation compared to BCG group, as demonstrated by (A) 2-panel dot plots displaying the average frequencies of CFSE-signal  SD in the CD4+ population. Data shown here are representative of 3 independent experiments. The data expressed in bar graph in (B) displays the average frequencies of CFSE-diluted cells in the CD4+ population, with their statistical significance.  ***P<0.001; ns = not significant.  CFSECD4APBS3.81%±0.76WT4.35%±0.58CatS8.24%±0.68B 60   Figure 15. Intracellular cytokine expression of IFN upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. rBCG-CatS group showed improved IFN production in CD4+ and CD8+ T-cell compared to BCG group, as demonstrated by (A) 2-panel dot plots displaying the average frequencies of cytokine-producing cells  SD in the CD4+ population, and the average frequencies in the CD8+ population. The CD4+ data shown here are representative of 3 independent experiments, and the CD8+ data shown are representative of 2 independent experiments. The data expressed in bar graph in (B) displays the average frequencies of cytokine-producing cells in the CD4+ population, with their IFNγCD4CD8PBS BCG rBCG-CatS0.055%±0.020 0.43%±0.24 1.65%±0.40PBS0.069%BCG1.08%rBCG-CatS1.45%AB 61 statistical significance (left panel). **P<0.01; ns = not significant. The right panel displays the average frequencies of cytokine-producing cells in the CD8+ population from an average of 2 independent experiments.    Figure 16. Intracellular cytokine expression of TNF upon ex vivo re-stimulation from TNFαCD4CD8PBS WT CatS0.17%±0.11 0.87%±0.046 1.39%±0.14PBS WT CatS0.42% 0.46% 0.81%AB 62 C57BL/6 mice immunized with rBCG-CatS. rBCG-CatS group showed improved TNF production in CD4+ and CD8+ T-cell compared to BCG group, as demonstrated by (A) 2-panel dot plots displaying the average frequencies of cytokine-producing cells  SD in the CD4+ population, and the average frequencies in the CD8+ population. The CD4+ data shown here are representative of 3 independent experiments, and the CD8+ data shown are representative of 2 independent experiments. The data expressed in bar graph in (B) displays the average frequencies of cytokine-producing cells in the CD4+ population, with their statistical significance (left panel). **P<0.01, ***P<0.001. The right panel displays the average frequencies of cytokine-producing cells in the CD8+ population from an average of 2 independent experiments.   IL-2CD4CD8PBS WT CatS0.12%±0.097 0.37%±0.036 0.73%±0.15PBS WT CatS0.045% 0.046% 0.078%A 63  Figure 17. Intracellular cytokine expression of IL-2 upon ex vivo re-stimulation from C57BL/6 mice immunized with rBCG-CatS. rBCG-CatS group showed improved IL-2 production in CD4+ and CD8+ T-cell compared to BCG group, as demonstrated by (A) 2-panel dot plots displaying the average frequencies of cytokine-producing cells  SD in the CD4+ population, and the average frequencies in the CD8+ population. The CD4+ data shown here are representative of 3 independent experiments, and the CD8+ data shown are representative of 2 independent experiments. The data expressed in bar graph in (B) displays the average frequencies of cytokine-producing cells in the CD4+ population, with their statistical significance (left panel). *P<0.05; ns = not significant. The right panel displays the average frequencies of cytokine-producing cells in the CD8+ population from an average of 2 independent experiments.  Taken together, our data clearly demonstrate that CatS expression in BCG improves significantly its immunogenicity in terms of induction of specific cytokine secreting CD4+ and CD8+ T-cells.    B 64 CHAPTER 4: RECOMBINANT BCG EXPRESSING CASPASE-3 FURTHER IMPROVES VACCINE IMMUNOGENICITY 4.1 Background  The improved apoptosis and increased murine immunogenicity achieved by rBCG-CatS has inspired us to take on a more direct approach – to engineer a rBCG that expresses active caspase-3 (rBCG-C3). While CatS likely acts on players in the apoptotic pathway that ultimately lead to the activation of caspase-3, having a rBCG that expresses the executioner caspase might prove beneficial in the kinetics of immune response. Gartner et al. has engineered a tuberculosis DNA vaccine that expresses caspase-3 as part of the construct and demonstrated heightened immune response in the mice [183]. However, given the limited Mtb antigen sequences that a DNA construct could carry along with caspase-3, we decided to express caspase-3 in live BCG to allow presentation of a plethora of bacterial antigens to the lymphocytes, aiming to induce a more robust immunity. 4.2 Characterization of rBCG-C3  Given the success of the rBCG-CatS construct in terms of active expression and secretion, we have decided to utilize the same cloning strategy for rBCG expressing caspase-3. Since caspase-3 is normally synthesized as an inactive zymogen in the cell, in order to create a vector that expresses constitutively active caspase-3, we followed the footsteps of Srinivasula et al. [166] and constructed the gene in the “reverse caspase-3” manner. In short, the large and small subunit of caspase-3 sequence is reversed, and completed with a linker sequence in between [166]. This results in spontaneous folding of the molecule and produces an active protein [166]. Using the recombination-based vector, pJAK1.A, caspase-3 was  65 synthesized in place of Cathepsin S alongside with the signal sequence of mycobacterial protein Ag85B and the E. coli alpha-hemolysin secretion cassette to aid secretion [184] (Fig. 18A).   To validate expression and secretion of caspase-3 once transformed into BCG, cell wall proteins were dissociated and subjected to Western blotting for caspase-3. Fig. 18B shows the presence of caspase-3 in rBCG, whereas the absence is seen in BCG and BCG with vector control.     Figure 18. Construction and characterization of recombinant BCG expressing active caspase-3. (A) Schematic of the caspase-3 vector construct. Gene segment consisting of the mycobacterial Ag85B (fbpB) signal sequence and a portion of the mature Ag85B, together with the E. coli hemolysin A (hlyA) sequences and caspase-3 are synthesized. This segment is outfitted with attB1 and attB2, and was cloned using recombination technology into the pJAK1.A vector. (B) Characterization of rBCG-C3. Western blot analysis of engineered Hsp 60 attR1 attR2fbpB-SS fbpB hlyA C3 hlyA spacerActive Caspase-3Hsp65Caspase-3BA  66 rBCG-C3 strain demonstrating presence of C3 on the bacterial surface. Recombinant BCG expressing vector control is denoted as E361. Hsp65 is probed as the loading control.  4.3 Human and murine cell lines infected with rBCG-C3 showed increased level of apoptosis  Since rBCG-C3 expresses caspase-3, examining the level of active caspase-3 in infected macrophages to gauge its level of apoptosis would be inconclusive. Thus, THP-1 cells were infected with rBCG-C3 and the level of apoptosis was evaluated by examining the degree of PARP cleavage. Full length PARP, or poly(ADP-ribose) polymerase, is a protein involved in DNA repair [185]. During apoptosis, PARP is cleaved by caspase-3 and thus rendered inactive and cell death proceeds [185]. Western blot analysis showed that while cell infected with BCG and BCG carrying vector control showed similar level of PARP cleavage to that observed in uninfected cells, a higher amount of cleaved PARP was detected in rBCG-C3-infected cells, suggesting that rBCG-C3 is pro-apoptotic (Fig. 19A). The pro-apoptotic potential of rBCG-C3 was further confirmed by epifluorescent microscopy of annexin V staining (Fig. 19B). Indeed, RAW cells infected with rBCG-C3 showed massive green fluorescence events, indicating heightened levels of phosphatidylserine surface expression. Taking together, these experiments demonstrated that rBCG-C3 is effective in inducing host cell apoptosis.  67   Figure 19. rBCG-C3 induces cellular apoptosis in vitro. (A) THP-1 cells were infected with rBCG-C3 at MOI 20 for 48 h. Cells were then harvested and cell lysates were prepared and subjected to SDS-PAGE and Western blotting with PARP antibody. (B) RAW 264.7 were infected with BCG strains expressing dsRed on an episomal vector (MOI 20), for 48 h Active PARPPARP AUninfectedBCGrBCG-E361rBCG-C3BCG-dsRed Annexin-V Merged R/GB 68 prior to staining with AF488-conjugated annexin V and confocal microscopy analyses. Macrophages infected with rBCG-C3 show increased annexin V staining, indicating the levels of PS, on the cell surface.   4.4 Improved immunogenicity of rBCG-C3 infected mice  Similar to rBCG-CatS, rBCG-C3 was subjected to immunogenicity studies to elucidate the link between apoptosis and adaptive immunity. Female 4-6 weeks old C57BL/6 mice were injected subcutaneously at the neck scruff with 106 bacteria and were sacrificed at 3-4 weeks post-infection to examine the induced immune response in the spleen. Ag85B-specific MHC II-restricted tetramer staining showed that a larger expansion of CD4+ specific T-cells (approximately 3.5-fold increase) occurred in mice vaccinated with rBCG-C3 relative to T-cell expansion in mice inoculated with BCG (Fig. 20A). Increase in adaptive immunity is undeniably confirmed by the level of T-cell proliferation after ex vivo re-stimulation with BCG WBL since CFSE-dilution experiments (Fig. 20B) showed substantial levels of CD4+ and CD8+ cell proliferation in rBCG-C3 test group (4.5- and 6.5- fold increase, respectively) when compared to the BCG test group.  Besides T-cell proliferation, functional read-outs were also examined by intracellular cytokine staining of ex vivo re-stimulated splenocytes. While tetramer staining only identifies a small set of T-cells with a single MHC-peptide specificity, intracellular cytokine staining reveals the sum total of T-cell response to the whole BCG bacterium. Compared to BCG test group, the results showed a substantial increase in the frequencies of IFN producing cells in both CD4+ (9-fold increase) and CD8+ (6-fold increase) subsets in rBCG-C3 samples (Fig. 20C). To a lesser degree, increases in the frequency of TNF producing CD4+ and CD8+ cells in rBCG-C3 samples were 1.5-fold and 2.3-fold, respectively, compared to BCG  69 samples. Secreted IL-2 levels were also examined as a means to evaluate antigen-specific T-cell proliferation upon ex vivo re-stimulation and the results (Fig. 20D) showed that rBCG-C3 splenocyte samples secreted 2.7-fold more IL-2 than the BCG sample.  In summary, improved immunogenicity in vivo can be achieved using caspase-3 expressing BCG to enhance host cell apoptosis. This is illustrated by the increase in MHC-antigen specific CD4+ T-cells, ex vivo CD4+ and CD8+ T-cell expansion, and functional production of various cytokines.  Figure 20. Immunogenicity studies in C57BL/6 mice.  (A) Tetramer staining showing Ag85-specific CD4+ T-cell response. rBCG-C3 shows increased number of Ag85B-specific CD4+ T-cells compared to BCG group. Values shown in the 2-panel dot plots are representative of 2 independent experiments (3 mice per experiment). CD4 IAb-P25 (Ag85B:240-254) 100101102103104FL4-H100101102103104FL2-H0.04BCGPBS rBCG-C3A 70  (B) CD4+ T-cell proliferation upon ex vivo re-stimulation with BCG whole bacterial lysate. rBCG-C3 showed increased level of CD4+ T-cell proliferation upon ex vivo re-stimulation, compared to BCG group. Values shown in the 2-panel dot plots are representative of 2 independent experiments (3 mice per experiment).  CFSE CD4BCGPBS rBCG-C3100101102103104FL1-H100101102103104FL3-H0.52100101102103104FL1-H100101102103104FL3-H0.6100101102103104FL1-H100101102103104FL3-H2.75100101102103104FL1-H100101102103104FL4-H0.53100101102103104FL1-H100101102103104FL4-H0.73100101102103104FL1-H100101102103104FL4-H4.72CD8B 71   (C) Intracellular cytokine expression shows functional CD4+ and CD8+ T-cells. Ex vivo re-stimulation with BCG whole bacterial lysate revealed that mice infected with rBCG-C3 has PBS BCG rBCG-C3CD4 IFNγ100101102103104FL3-H100101102103104FL4-H0.032100101102103104FL3-H100101102103104FL4-H0.073100101102103104FL3-H100101102103104FL4-H0.67100101102103104FL3-H100101102103104FL4-H0.092100101102103104FL3-H100101102103104FL4-H0.13TNFαCPBS BCG rBCG-C3CD8 IFNγTNFα 100101102103104FL2-H100101102103104FL4-H0.66100101102103104FL2-H100101102103104FL4-H0.08100101102103104FL2-H100101102103104FL4-H0.11100101102103104FL2-H100101102103104FL4-H0.18100101102103104FL2-H100101102103104FL4-H0.099100101102103104FL2-H100101102103104FL4-H0.12 72 heightened intracellular IFN and TNF cytokine production. Values shown in the 2-panel dot plots are representative of 2 independent experiments (3 mice per experiment).   (D) Culture supernatant was retrieved from splenocytes stimulated with BCG whole bacterial lysate after an overnight incubation period and was subjected to IL-2 ELISA analysis. The assay shows that mice infected with rBCG-C3 has noticeably higher levels of IL-2 secretion compared to those infected with BCG. The data expressed displays the averages of triplicate wells, where the bar graphs are representative of 2 independent experiments (3 mice per experiment).  Since both rBCG-CatS and rBCG-C3 improves macrophage apoptosis and induce a strong immune response in vivo, one would like to know whether one strain is more potent than the other. Comparative immunogenicity studies were performed and the results obtained (Fig. 21A) showed that while rBCG-CatS still induces a higher (1.4-fold increase) Ag85B-specific CD4+ T-cell expansion in the mouse, relative to BCG, animal response was further improved (3-fold increase) in mice immunized with rBCG-C3.  PBSWTC30500100015002000IL-2 (pg/mL)D 73 A similar trend can be observed in cytokine production during ex vivo re-stimulation between the two recombinant BCG strains (Fig. 21B). rBCG-CatS was able to elicit more IFN and TNF producing T-cells, compared to BCG. The only exception being the frequencies of TNF-producing cells in the CD8+subsets, which are identical. However, frequencies of cytokine-producing cells in the rBCG-C3 test group were consistently higher. Most notably, and relative to BCG, we observed a 7-fold increase in IFN producing CD8+ T-cells in the rBCG-C3 test group and only 1.6-fold increase in the rBCG-CatS group. Similarly, ELISA data (Fig. 21C) showed that, relative to BCG, rBCG-C3 induces 3-fold increase in levels of IL-2 secretion whereas nearly 1.5-fold increase was observed in response to rBCG-CatS.   Figure 21. Comparative immunogenicity studies of rBCG-CatS vs rBCG-C3. (A) Tetramer staining of Ag85-specific CD4+ T-cell response. rBCG-C3 shows increased number of Ag85B-specific CD4+ T-cells compared to rBCG-CatS group. 3 mice were used in each treatment group.    100101102103104APC-A100101102103104PE-A0.019I-Ab-P25 (Ag85B:240-254) CD4 BCGPBS rBCG-CatS rBCG-C3A 74   (B) Intracellular cytokine staining shows functional CD4+ and CD8+ T-cells. Ex vivo re-stimulation with BCG whole bacterial lysate revealed that mice infected with rBCG-C3 has heightened intracellular IFN and TNF cytokine production compared to the rBCG-CatS group. 3 mice were used in each treatment group.  CD4 100101102103104PE-Cy7-A100101102103104APC-A0.053100101102103104PE-Cy7-A100101102103104APC-A0.19100101102103104PE-Cy7-A100101102103104APC-A0.36100101102103104PE-Cy7-A100101102103104APC-A0.05IFNγTNFα 100101102103104PE-Cy7-A100101102103104APC-A11.000.30BCGPBS rBCG-CatS rBCG-C3B100101102103104PE-A100101102103104APC-A0.03CD8 100101102103104PE-A100101102103104APC-A0.01100101102103104PE-A100101102103104APC-A0.016100101102103104PE-A100101102103104APC-A0.016BCGPBS rBCG-CatS rBCG-C3IFNγTNFα 0.10 75  (C) Culture supernatant was retrieved from splenocytes stimulated with BCG WBL after an overnight incubation period and subjected to IL-2 ELISA analysis. The assay shows that mice infected with rBCG-C3 has noticeably higher levels of IL-2 secretion compared to those infected with rBCG-CatS and with BCG. 3 mice were used in each treatment group.  Taken together, this comparative study revealed a superior animal immune response to rBCG-C3 relative to rBCG-CatS, albeit both recombinant strains are more immunogenic than BCG.    PBSWTCatS C30500100015002000IL-2 (pg/mL)C 76 CHAPTER 5: DISCUSSION 5.1 Expression of CatS in BCG converts it into a more immunogenic vaccine Since the Geneva consensus that the 100-year old BCG vaccine has a limited efficacy in preventing TB disease [186], many investigators proposed novel and attractive strategies on how this vaccine may be improved, or perhaps replaced entirely. With regards to live vaccines, research efforts focused on creating viral delivery systems for selected Mtb antigens, genetically improved BCG strains and attenuated Mtb strains [42]. Although live weakened Mtb strains were found to induce protective TB immunity in animal models [187], there were legitimate skepticisms about their safety, especially for immunocompromised individuals [188]. BCG has proved to be safe, with more than 3 billion doses administered and a very low incidence rate of serious side effects. Therefore, improving its efficacy while maintaining its level of safety is being considered as the best option to develop an effective TB vaccine by many investigators [170,186,189]. One of the most promising reshaped BCG strain developed so far is AERAS-422, which over-expresses Ag85B, Ag85A and VAPB47 (Rv3407) along with perfringolysin – a cytolysin secreted by Clostridium perfringens – as an endosome escape mechanism enabling translocation of mycobacterial antigens into the cytoplasm [190]. Unfortunately, this vaccine was dropped from clinical development because of serious adverse events associated with perfringolysin [191]. Thus, currently, only the previously developed VPM1002 vaccine is prevailing in clinical trials (phase IIa). VPM1002 (or rBCGΔureC::hly) was designed to increase the efficacy of BCG by enhancing the CD8+ response to TB. rBCGΔureC::hly derives from a Urease C-deficient mutant BCG (BCGΔureC) strain [71] engineered to secrete listeriolysin (Hly). The goal is to induce an acidic  77 environment within the host cell under which Hly (a major virulence factor of Listeria monocytogenes) is hyper active. Similar to perfringolysin, Hly forms pores in the phagosomal membrane allowing for enhanced MHC I antigen cross-presentations [71,192]. Although VPM1002 successfully passed safety criterion in phase I clinical trial [72], one cannot exclude the possibility of similar side effects observed with AERAS-422 while undergoing final confirmation of safety and efficacy. Therefore, there is an obvious need to develop additional elaborated BCG vaccines. Many studies, including from our laboratory, demonstrated that BCG, although attenuated relative to the parental M. bovis, has retained the capabilities to block phagosome maturation and antigen presentation [50,53,164,193]. This would explain, at least in part, its low protective efficacy. In particular, we found that BCG is able to down-regulate MHC II-dependent antigen presentation via IL-10-dependent inhibition of CatS expression [164], and this phenotype is reversed when infecting macrophages with BCG expressing CatS [167]. These exciting findings opened up a great opportunity for TB vaccine development. Prior to further investigation of the CatS approach for a vaccinal purpose, we first examined global macrophage transcriptome in response to our first version of BCG expressing CatS (rBCG-hcs). The transcriptome profiles obtained identified several genes that are differentially expressed by rBCG-hcs-infected macrophages compared to infection with BCG. These microarray data revealed for the first time important functional properties of CatS that far exceed a simple contribution to Ii chain degradation [194] and uncover a yet unsuspected transcription factor-like activity regulating macrophage gene expression. This is reminiscent of Goulet et al. [126] findings that cathepsin L, a closely related lysosomal  78 protease to CatS, is capable of trafficking to the nucleus of NIH3T3 cells to cleave latent transcription factors, releasing active factors to initiate nuclear signaling.  A striking finding that emerged from microarray analyses was the complete reversal in the expression of genes related to cell death in macrophages infected with rBCG-hcs. Building upon these findings we generated a BCG strain expressing CatS (rBCG-CatS) and attempted to further investigate apoptosis response to BCG. We found that BCG not only lacks the property to induce apoptosis, as previously reported [55], but also actively blocks apoptosis induction by powerful pharmacological agents such as staurosporine. In contrast, rBCG-CatS proved to be a great inducer of apoptosis, which is an important macrophage feature, associated with the ability to initiate an effective immune response [55,192,195]. The ability of cathepsins to induce cellular apoptosis has been reported earlier [157]. More specifically, Zheng et al. found that IFNγ-induced apoptosis in epithelial cells is mediated by CatS and suggested that CatS might be responsible for the pathogenesis of IFN-induced alveolar remodeling and emphysema [176]. While this assumption raises a safety concern about human vaccination with rBCG-CatS, no external signs of side effects were observed during our animal studies and detailed organ necropsy of rBCG-CatS-vaccinated animals did not reveal any macroscopic sign of toxicity. It should also be noted that CatS expression and activation is a predicted response to IFN-stimulated APC [171], and that IFN production is a gold standard marker for effective anti-TB immunity [196,197].  Thus our approach, i.e. secretion of active CatS by the vaccine, would only partially mimic a natural physiological response to IFN.   79 The major parameter used to assess the immunogenicity of novel TB vaccines is the in vivo expansion of specific T-cells in response to immune-dominant antigens carried by the vaccine. This test is currently being greatly facilitated with the availability of MHC tetramer reagents, which allow direct measurements of antigen-specific T-cell numbers in vaccinated animals. Remarkably, as per tetramer staining, mouse immunization with the pro-apoptotic rBCG-CatS induced a large expansion (~3-fold increase) of Ag85B-specific CD4+ T-cells in rBCG-CatS, compared to vaccination with BCG. Furthermore, ex vivo re-stimulation of spleen cells with BCG antigens showed that proliferating CD4+ T-cells from animals vaccinated with rBCG-CatS have the potential to secrete higher levels of a plethora of intracellular cytokines – IFNγ, TNFα, and IL-2, which is generally recognized as strong correlates with the protective potential of induced T-cells in vaccinated animals and humans [42]. While CD4+ T-cells are known to be essential for TB immunity, a number of investigators have investigated the role of CD8+ T-cells and found that CD4+ T-cells effectively control low-dose infections, which correspond to early stages of infection, but CD8+ T-cells possess a unique activity that makes them essential during high-bacterial burdens at late stages of infection [198]. Similar to CD4+, CD8+ T-cells have been shown to function mainly by producing IFNγ and by targeting infected cells for cytolysis [199,200]. However, BCG was shown to be insufficient in stimulating a robust CD8+ T-cell response [201] and more precise studies showed that mycobacterial antigen peptide recognition by MHC I-restricted T-cells is mediated by a TAP1-independent mechanism [202]. Interestingly, CatS has been shown to play an important role in generating peptides for a TAP1-independent pathway that is blocked in macrophage isolated from TAP−/−Cat S−/− mice, but reversed when  80 cells were complemented with recombinant CatS [203]. Therefore, as CatS is inhibited in macrophages infected with BCG, the TAP-independent antigen cross-presentation is probably attenuated in these cells as well. In this study, we took matters one step further, and quantified cytokine-producing cells in the CD8+ T-cell subset. We found that the frequencies of IFNγ-, TNFα-, and IL-2-producing CD8+ T-cells are noticeably higher in cells isolated from rBCG-CatS-vaccinated mice than those from the BCG group, thus providing additional evidence for the importance of CatS in reshaping conventional BCG.  5.2 Proposed mechanism of cathepsin S promoting apoptosis  While CatB was shown to cleave procaspase-1 and -11 directly, it was not involved in apoptosis [204]. Indeed, in terms of cleavage of procaspases involved in apoptosis, cathepsins cleave neither the executioner caspases (caspase-3 or -7), nor the initiator caspases (caspase-8 or -9) [156]. This suggests that cathepsins play a role in apoptosis signaling independent of direct cleavage of caspases. Indeed, the first molecule discovered in a cell free lysate study to be cleaved by cathepsins is Bid [156]. It was found that cathepsin-cleaved Bid was able to punctuate mitochondrial membrane and cause cytochrome c release and subsequent caspase activation [156]. This finding was confirmed in various cell lines, including MCF-7, HaCaT, SH-SY5Y, Caco-2, and HepG2 cells [158]. In vitro experiments show that cathepsins (including CatS) cleaves and thereby inactivates anti-apoptotic molecules Bcl-2, Bcl-xL, and Mcl-1 [158]. The major inhibitor of caspases, XIAP, which regulates apoptosis downstream of mitochondria, is also a major cathepsin target, found in cell lines SH-SY5Y and CaCo-2 [158]. Evidence of potential involvement of CatS in apoptosis was provided by cell-free system studies showing that CatS cleaves recombinant Bcl-2, Bak, Mcl-1 and XIAP [158].   81  When Zheng et al. showed that CatS is involved in epithelial cell apoptosis, and is a critical event in the pathogenesis of IFN-induced alveolar remodeling and emphysema [176], they found that CatS induces increased mRNA level in extrinsic and intrinsic apoptosis genes (i.e. Fas, FasL, TNF, TRAIL, Bak, Bid, Bim, caspase-3, -6, -8, -9, and PKC). Thus, CatS may be involved in apoptosis at the transcriptomic level. For example, in Fig. 8 we showed that cells infected with BCG expressed more apoptosis antagonizing transcription factor (AATF), while those infected with rBCG-CatS have diminished levels. AATF is induced by PERK-eIF2α signaling in response to ER stress, and then AATF transcriptionally activates the Akt1 gene through STAT-3, which sustains Akt1 activation and promotes cell survival [205]. CatS appears to be actively acting on the expression of AATF at the transcription level, to promote apoptosis in the cell.  5.3 Benefits of a recombinant BCG strain expressing executioner caspase   Currently, a caspase-3 vaccine against tuberculosis has been described in Gartner et al., in the form of a DNA vaccine [183]. In attempt to increase cross-presentation through apoptosis, this vaccine co-expressed secreted Ag85A and catalytically active caspase-3. This pro-apoptotic vaccine was shown to induce rapid apoptosis in HEK293T cells. Furthermore, in the murine model, vaccination triggered more Ag85A-specific IFN producing splenocytes, and more efficient IL-2 and IFN-producing memory cells in spleen and lungs after Mtb challenge. The addition of caspase-3 in a DNA vector, compared to vector carrying Ag85A alone, lowered lung bacteria burden, increased median survival time, thus increased protection after Mtb infection.  82  Compared to Gartner’s work, our rBCG-C3 also induced apoptosis, produced more Ag-specific T-cell response in the spleen, and more cytokine-producing T-cells upon re-stimulation. This is in concordance of the concept that a pro-apoptosis vaccine enhances antigen availability for processing and presentation by APCs. However, as we are using live attenuated vaccine, we would be able to generate a broader antigenic response, whereas the DNA vaccine is restricted to Ag85A-specific antigen presentations. Our work demonstrated a rBCG expressing C3 is able to generate a response to a wide range of BCG antigens, as shown by significant T-cell proliferation during ex vivo re-stimulation with total BCG antigens.  However, while comparing the function of rBCG-CatS and –C3, it was unexpected that rBCG-C3 would induce a stronger immune response than rBCG-CatS. This expectation is due to the fact that, in addition to induction of apoptosis, CatS also promotes MHC II maturation. One possibility to explain these discrepancies is that unlike caspase-3, CatS is not an executioner in the apoptosis pathway that promises the definitive fate of undergoing cell death.  5.4 Stability of endogenously expressed CatS and C3 in BCG While it is promising that rBCG-C3 showed more effect in murine immunogenicity model compared to rBCG-CatS, we are still facing the hurdle of plasmid instability in BCG strains expressing foreign genes. Indeed, others have also observed the variable instability of hsp60 promoter plasmids [173,174,206]. The stability of heterologous gene expression in BCG seems to be at least in part, dependent on the genetic compatibility between the expression cassette within the plasmid and the mycobacteria [206]. The PAN sequence, which  83 is a weak promoter derived from M. paratuberculosis [207], has been used for numerous foreign protein expression – namely, the -galactosidase of E. coli [208], the Gp63 surface antigen of Leishmania [209], and the Nef antigen of Simian Immunodeficiency Virus [210]. Indeed, it is known that expressing heterologous proteins in rBCG poses a metabolic stress and can result in mutations in the hsp60 promoter, due to recombination between host and plasmid [211]. In other words, not every antigen is necessarily expressed or tolerated by BCG. Therefore, we propose to solve the gene stability issue by a non-genetic manipulation method. In this context, I contributed significantly to a recent study in our laboratory by Liao et al. [168] that showed a promising method of decorating the surface of BCG with immunogenic proteins (Fig. 22). It is based on expression of proteins of interest in fusion with a mutant version of monomeric avidin protein using Gateway cloning described earlier. The resulting chimeric protein is able to bind reversibly to biotin. Upon BCG surface biotinylation, we can rapidly decorate the bacterial surface with avidin fusion protein. This method was proven to be stable and reproducible when tested with a surrogate ovalbumin antigen and mycobacterial protein ESAT6. Modification to the bacterial surface does not affect its growth in culture media, the survival within host cell, nor interfere with antigen presentation and loading onto MHC molecules. Furthermore, it was found that surface decorated BCG induced similar immune response as those genetically expressing the same antigen. This method opens the possibility of generating a rBCG strain that present CatS and C3 proteins, individually or in combination, which might further enhance the efficacy of BCG. To further improve the vaccine, one could also present one or multiple immuno-dominant mycobacterial proteins on a plasmid, which should be stable given its  84 homogeneous origin. This combination could be synergistic in effect, as the CatS molecule aids mature MHC II surface expression and apoptosis, while the apoptotic property is further optimized by the addition of C3. Any other addition of Mtb immuno-dominant antigen that is absent in BCG would be highly beneficial to development of vaccine immunity.  Figure 22. Schematic of BCG surface decoration approach. BCG surface is first biotinylated with hydrosoluble biotin, then exposed to purified avidin-fusion proteins. Due to the natural affinity of biotin-avidin, BCG can now be surface decorated with the antigen of interest. Adapted from Liao TY et al. PLoS ONE. 2015. 10(12):e0145833. Reprinted with permission from PLoS.    85 CHAPTER 6: CONCLUSION AND FUTURE DIRECTIONS 6.1 Conclusion  The work in this thesis describes recombinant BCG strains that improved immunological response in the murine model via their pro-apoptotic ability. Canonically described as the protease that participates in MHC II maturation process, CatS was first discovered in our laboratory to be inhibited via a IL-10-dependent mechanism in the presence of BCG. Besides its role in antigen processing, it was elucidated from a microarray study that it participates in other cellular functions such as antigen presentation, phagosome maturation and apoptosis. Thus, we showed that cells infected with rBCG-CatS produced increased levels of apoptosis and induced a higher immune response in the mouse. With apoptosis in mind, we engineered a more direct approach – another strain of pro-apoptotic rBCG strain that expresses caspase-3, which reproduced the properties of rBCG-CatS but was shown to be more immunogenic. Based on work thus far, this project has the potential to diverge into pro-apoptotic BCG strains as promising TB vaccine candidates. 6.2 Future directions To further examine the BCG strains in vaccine development, the safety of these bacteria must be evaluated using the BALB/c SCID mice model, which are mice characterized by an inability to mount an adaptive immune response. With the rise of co-infection of TB and HIV, it is imperative for vaccine candidates to be safe and effective in both healthy and immunocompromised individuals. Once the candidates have been deemed safe, protective efficacy of these vaccine strains can be evaluated using experimental TB models such as the mouse and guinea pig.   86 Since the main reason for BCG’s failure in being a successful vaccine is its waning ability of sustaining immunological memory [42], future work should focus on deciphering whether rBCG-CatS or –C3 promotes effector (Tem) or central memory (Tcm). While Tem produces effector cytokines such as IFN, TNF, and IL-2, the production of IL-2 declines in their final stage of differentiation and fail to continue in proliferation. In contrast, Tcm expresses high levels of CD62L and CCR7, but most importantly, abundant levels of IL-2 [212,213]. It is the IL-2+ Tcm population that is instrumental in long-term containment of Mtb infection [214]. Therefore, it is paramount that in future experimental TB studies, one must examine the longevity of memory elicited by this recombinant BCG strain.  In order to overcome the plasmid instability problem, as well as for the ability to introduce both CatS and C3 into the bacterium, it would be beneficial to exploit the avidin-decorating system, which would deliver both molecules to antigen presenting cells at the same time.   Taken together, the work presented in this thesis showed that pro-apoptotic BCG strains hold promise to a more effective tuberculosis vaccine. Further work includes examining the safety and protective efficacy of these strains, and to toggle the relative proportion of CatS and C3 presented by the vaccine.    87 REFERENCES [1] World Health Organization. (March 2016). Tuberculosis Fact sheet N°104. 2016.  [2] Sakula, A. (1983). Robert Koch: centenary of the discovery of the tubercle bacillus, 1882. Can. Vet. J. 24, 127-31.  [3] Zink, A.R., Sola, C., Reischl, U., Grabner, W., Rastogi, N., Wolf, H., and Nerlich, A.G. (2003). Characterization of Mycobacterium tuberculosis complex DNAs from Egyptian mummies by spoligotyping. J. Clin. Microbiol. 41, 359-67.  [4] Daniel, T.M. (2006). The history of tuberculosis. Respir. Med. 100, 1862-70.  [5] Morens, D.M. (2002). At the deathbed of consumptive art. Emerg. Infect. Dis. 8, 1353-8.  [6] Kielstra, P. (30 June 2014). Ancient enemy, modern imperative: A time for greater action against tuberculosis. The Economist.  [7] Calver, A.D., Falmer, A.A., Murray, M., Strauss, O.J., Streicher, E.M., Hanekom, M., Liversage, T., Masibi, M., van Helden, P.D., Warren, R.M., and Victor, T.C. (2010). Emergence of increased resistance and extensively drug-resistant tuberculosis despite treatment adherence, South Africa. Emerg. Infect. Dis. 16, 264-71.  [8] Andrews, J.R., Shah, N.S., Gandhi, N., Moll, T., Friedland, G., and Tugela Ferry Care and Research (TF CARES) Collaboration. (2007). Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa. J. Infect. Dis. 196 Suppl 3, S482-90.  [9] Sotgiu, G., D'Ambrosio, L., Centis, R., Tiberi, S., Esposito, S., Dore, S., Spanevello, A., and Migliori, G.B. (2016). Carbapenems to Treat Multidrug and Extensively Drug-Resistant Tuberculosis: A Systematic Review. Int. J. Mol. Sci. 17, 373.  [10] Russell, D.G., Barry, C.E.,3rd, and Flynn, J.L. (2010). Tuberculosis: what we don't know can, and does, hurt us. Science 328, 852-6.  [11] O'Garra, A., Redford, P.S., McNab, F.W., Bloom, C.I., Wilkinson, R.J., and Berry, M.P. (2013). The immune response in tuberculosis. Annu. Rev. Immunol. 31, 475-527.  [12] Cooper, A.M. (2009). Cell-mediated immune responses in tuberculosis Annu. Rev. Immunol. 27, 393-422.  [13] Orme, I.M. and Basaraba, R.J. (2014). The formation of the granuloma in tuberculosis infection. Semin. Immunol. 26, 601-9.  [14] Russell, D.G., Cardona, P.J., Kim, M.J., Allain, S., and Altare, F. (2009). Foamy macrophages and the progression of the human tuberculosis granuloma. Nat. Immunol. 10,  88 943-8.  [15] Via, L.E., Lin, P.L., Ray, S.M., Carrillo, J., Allen, S.S., Eum, S.Y., Taylor, K., Klein, E., Manjunatha, U., Gonzales, J., Lee, E.G., Park, S.K., Raleigh, J.A., Cho, S.N., McMurray, D.N., Flynn, J.L., and Barry, C.E.,3rd. (2008). Tuberculous granulomas are hypoxic in guinea pigs, rabbits, and nonhuman primates. Infect. Immun. 76, 2333-40.  [16] Palomino, J.C. (2012). Current developments and future perspectives for TB diagnostics. Future Microbiol. 7, 59-71.  [17] Public Health Agency of Canada. (February 2014). Chapter 3: Diagnosis of Active Tuberculosis and Drug Resistance. Canadian Tuberculosis Standards.  [18] Frieden, T. (2004). Toman's Tuberculosis. Case detection, Treatment and Monitoring. Geneva: World Health Organization 2nd edition.  [19] [No authors listed]. (2000). Diagnostic Standards and Classification of Tuberculosis in Adults and Children. This official statement of the American Thoracic Society and the Centers for Disease Control and Prevention was adopted by the ATS Board of Directors, July 1999. This statement was endorsed by the Council of the Infectious Disease Society of America, September 1999. Am. J. Respir. Crit. Care Med. 161, 1376-95.  [20] [No authors listed]. (1990). American Thoracic Society. Diagnostic standards and classification of tuberculosis. Am. Rev. Respir. Dis. 142, 725-35.  [21] Karalliedde, S., Katugaha, L.P., and Uragoda, C.G. (1987). Tuberculin response of Sri Lankan children after BCG vaccination at birth. Tubercle 68, 33-8.  [22] Menzies, R. and Vissandjee, B. (1992). Effect of bacille Calmette-Guerin vaccination on tuberculin reactivity. Am. Rev. Respir. Dis. 145, 621-5.  [23] Comstock, G.W., Edwards, L.B., and Nabangxang, H. (1971). Tuberculin sensitivity eight to fifteen years after BCG vaccination. Am. Rev. Respir. Dis. 103, 572-5.  [24] Ling, D.I., Flores, L.L., Riley, L.W., and Pai, M. (2008). Commercial nucleic-acid amplification tests for diagnosis of pulmonary tuberculosis in respiratory specimens: meta-analysis and meta-regression. PLoS One 3, e1536.  [25] Sarmiento, O.L., Weigle, K.A., Alexander, J., Weber, D.J., and Miller, W.C. (2003). Assessment by meta-analysis of PCR for diagnosis of smear-negative pulmonary tuberculosis. J. Clin. Microbiol. 41, 3233-40.  [26] Pai, M., Flores, L.L., Hubbard, A., Riley, L.W., and Colford, J.M. Jr. (2004). Nucleic acid amplification tests in the diagnosis of tuberculous pleuritis: a systematic review and meta-analysis. BMC Infect. Dis. 4, 6.   89 [27] Association of Public Health Laboratories. (2009). Mycobacterium tuberculosis: assessing your laboratory, APHL, Silver Spring, MD.  [28] Clinical and Laboratory Standards Institute. (2011). Susceptibility testing of Mycobacteria, Nocardiae, and other aerobic actinomycetes; approved standard – 2nd edition., CLSI document M24-A2, Wayne, PA.  [29] Horne, D.J., Pinto, L.M., Arentz, M., Lin, S.Y., Desmond, E., Flores, L.L., Steingart, K.R., and Minion, J. (2013). Diagnostic accuracy and reproducibility of WHO-endorsed phenotypic drug susceptibility testing methods for first-line and second-line antituberculosis drugs. J. Clin. Microbiol. 51, 393-401.  [30] Steingart, K.R., Flores, L.L., Dendukuri, N., Schiller, I., Laal, S., Ramsay, A., Hopewell, P.C., and Pai, M. (2011). Commercial serological tests for the diagnosis of active pulmonary and extrapulmonary tuberculosis: an updated systematic review and meta-analysis. PLoS Med. 8, e1001062.  [31] Dowdy, D.W., Steingart, K.R., and Pai, M. (2011). Serological testing versus other strategies for diagnosis of active tuberculosis in India: a cost-effectiveness analysis. PLoS Med. 8, e1001074.  [32] World Health Organization. (2011). Policy statement: commercial serodiagnostic tests for diagnosis of tuberculosis. World Health Organization.  [33] Metcalfe, J.Z., Everett, C.K., Steingart, K.R., Cattamanchi, A., Huang, L., Hopewell, P.C., and Pai, M. (2011). Interferon-gamma release assays for active pulmonary tuberculosis diagnosis in adults in low- and middle-income countries: systematic review and meta-analysis. J. Infect. Dis. 204 Suppl 4, S1120-9.  [34] Keshavjee, S. and Farmer, P.E. (2012). Tuberculosis, drug resistance, and the history of modern medicine. N. Engl. J. Med. 367, 931-6.  [35] Streptomycin in TuberculosisTrialsCommittee. (1948). Streptomycin treatment of pulmonary tuberculosis. Br. Med. J. 2, 769-82.  [36] Mitchison, D. and Davies, G. (2012). The chemotherapy of tuberculosis: past, present and future. Int. J. Tuberc. Lung Dis. 16, 724-32.  [37] Crofton, J. and Mitchison, D.A. (1948). Streptomycin resistance in pulmonary tuberculosis. Br. Med. J. 2, 1009-15.  [38] Munro, S.A., Lewin, S.A., Smith, H.J., Engel, M.E., Fretheim, A., and Volmink, J. (2007). Patient adherence to tuberculosis treatment: a systematic review of qualitative research. PLoS Med. 4, e238.   90 [39] Gillespie, S.H. (2002). Evolution of drug resistance in Mycobacterium tuberculosis: clinical and molecular perspective. Antimicrob. Agents Chemother. 46, 267-74.  [40] Conly, J. and Johnston, B. (2005). Where are all the new antibiotics? The new antibiotic paradox. Can. J. Infect. Dis. Med. Microbiol. 16, 159-60.  [41] Tseng, C.L., Oxlade, O., Menzies, D., Aspler, A., and Schwartzman, K. (2011). Cost-effectiveness of novel vaccines for tuberculosis control: a decision analysis study. BMC Public Health 11, 55,2458-11-55.  [42] Andersen, P. and Kaufmann, S.H. (2014). Novel vaccination strategies against tuberculosis. Cold Spring Harb Perspect. Med. 4, 10.1101/cshperspect.a018523.  [43] Rodrigues, L.C., Diwan, V.K., and Wheeler, J.G. (1993). Protective effect of BCG against tuberculous meningitis and miliary tuberculosis: a meta-analysis. Int. J. Epidemiol. 22, 1154-8.  [44] Colditz, G.A., Brewer, T.F., Berkey, C.S., Wilson, M.E., Burdick, E., Fineberg, H.V., and Mosteller, F. (1994). Efficacy of BCG vaccine in the prevention of tuberculosis. Meta-analysis of the published literature. JAMA 271, 698-702.  [45] Fine, P.E. (1989). The BCG story: lessons from the past and implications for the future. Rev. Infect. Dis. 11 Suppl 2, S353-9.  [46] Behr, M.A. and Small, P.M. (1997). Has BCG attenuated to impotence? Nature 389, 133-4.  [47] Brandt, L., Feino Cunha, J., Weinreich Olsen, A., Chilima, B., Hirsch, P., Appelberg, R., and Andersen, P. (2002). Failure of the Mycobacterium bovis BCG vaccine: some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infect. Immun. 70, 672-8.  [48] Lozes, E., Denis, O., Drowart, A., Jurion, F., Palfliet, K., Vanonckelen, A., De Bruyn, J., De Cock, M., Van Vooren, J.P., and Huygen, K. (1997). Cross-reactive immune responses against Mycobacterium bovis BCG in mice infected with non-tuberculous mycobacteria belonging to the MAIS-Group. Scand. J. Immunol. 46, 16-26.  [49] Demangel, C., Garnier, T., Rosenkrands, I., and Cole, S.T. (2005). Differential effects of prior exposure to environmental mycobacteria on vaccination with Mycobacterium bovis BCG or a recombinant BCG strain expressing RD1 antigens. Infect. Immun. 73, 2190-6.  [50] Via, L.E., Deretic, D., Ulmer, R.J., Hibler, N.S., Huber, L.A., and Deretic, V. (1997). Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J. Biol. Chem. 272, 13326-31.   91 [51] Pieters, J. (2001). Entry and survival of pathogenic mycobacteria in macrophages. Microb. Infect. 3, 249-55.  [52] Roberts, E.A., Chua, J., Kyei, G.B., and Deretic, V. (2006). Higher order Rab programming in phagolysosome biogenesis. J. Cell Biol. 174, 923-9.  [53] Sendide, K., Deghmane, A.E., Reyrat, J.M., Talal, A., and Hmama, Z. (2004). Mycobacterium bovis BCG urease attenuates major histocompatibility complex class II trafficking to the macrophage cell surface. Infect. Immun. 72, 4200-9.  [54] Fulton, S.A., Reba, S.M., Pai, R.K., Pennini, M., Torres, M., Harding, C.V., and Boom, W.H. (2004). Inhibition of major histocompatibility complex II expression and antigen processing in murine alveolar macrophages by Mycobacterium bovis BCG and the 19-kilodalton mycobacterial lipoprotein. Infect. Immun. 72, 2101-10.  [55] Schaible, U.E., Winau, F., Sieling, P.A., Fischer, K., Collins, H.L., Hagens, K., Modlin, R.L., Brinkmann, V., and Kaufmann, S.H. (2003). Apoptosis facilitates antigen presentation to T lymphocytes through MHC-I and CD1 in tuberculosis. Nat. Med. 9, 1039-46.  [56] Rojas, M., Garcia, L.F., Nigou, J., Puzo, G., and Olivier, M. (2000). Mannosylated lipoarabinomannan antagonizes Mycobacterium tuberculosis-induced macrophage apoptosis by altering Ca+2-dependent cell signaling. J. Infect. Dis. 182, 240-51.  [57] Behr, M.A. (2002). BCG--different strains, different vaccines? Lancet Infect Dis. 2, 86-92.  [58] World Health Organization. (2012). Information Sheet: Observed rate of vaccine reactions - Bacille Calmette-Guérin (BCG) vaccine.  [59] Horwitz, M.A., Harth, G., Dillon, B.J., and Maslesa-Galic, S. (2009). Commonly administered BCG strains including an evolutionarily early strain and evolutionarily late strains of disparate genealogy induce comparable protective immunity against tuberculosis. Vaccine 27, 441-5.  [60] Zhang, L., Ru, H.W., Chen, F.Z., Jin, C.Y., Sun, R.F., Fan, X.Y., Guo, M., Mai, J.T., Xu, W.X., Lin, Q.X., and Liu, J. (2016). Variable Virulence and Efficacy of BCG Vaccine Strains in Mice and Correlation With Genome Polymorphisms. Mol. Ther. 24, 398-405.  [61] Shann, F. (2015). Editorial Commentary: Different Strains of Bacillus Calmette-Guerin Vaccine Have Very Different Effects on Tuberculosis and on Unrelated Infections. Clin. Infect. Dis. 61, 960-2.  [62] Orme, I.M. (2015). Tuberculosis Vaccine Types and Timings. Clin. Vaccine Immunol. 22, 249-57.   92 [63] Aguilar, D., Infante, E., Martin, C., Gormley, E., Gicquel, B., and Hernandez Pando, R. (2007). Immunological responses and protective immunity against tuberculosis conferred by vaccination of Balb/C mice with the attenuated Mycobacterium tuberculosis (phoP) SO2 strain. Clin. Exp. Immunol. 147, 330-8.  [64] Hinchey, J., Lee, S., Jeon, B.Y., Basaraba, R.J., Venkataswamy, M.M., Chen, B., Chan, J., Braunstein, M., Orme, I.M., Derrick, S.C., Morris, S.L., Jacobs, W.R.,Jr., and Porcelli, S.A. (2007). Enhanced priming of adaptive immunity by a proapoptotic mutant of Mycobacterium tuberculosis. J. Clin. Invest. 117, 2279-88.  [65] Waters, W.R., Palmer, M.V., Nonnecke, B.J., Thacker, T.C., Scherer, C.F., Estes, D.M., Jacobs, W.R.,Jr, Glatman-Freedman, A., and Larsen, M.H. (2007). Failure of a Mycobacterium tuberculosis DeltaRD1 DeltapanCD double deletion mutant in a neonatal calf aerosol M. bovis challenge model: comparisons to responses elicited by M. bovis bacille Calmette Guerin. Vaccine 25, 7832-40.  [66] Elvang, T., Christensen, J.P., Billeskov, R., Thi Kim Thanh Hoang, T., Holst, P., Thomsen, A.R., Andersen, P., and Dietrich, J. (2009). CD4 and CD8 T cell responses to the M. tuberculosis Ag85B-TB10.4 promoted by adjuvanted subunit, adenovector or heterologous prime boost vaccination. PLoS One 4, e5139.  [67] Tchilian, E.Z., Desel, C., Forbes, E.K., Bandermann, S., Sander, C.R., Hill, A.V., McShane, H., and Kaufmann, S.H. (2009). Immunogenicity and protective efficacy of prime-boost regimens with recombinant (delta)ureC hly+ Mycobacterium bovis BCG and modified vaccinia virus ankara expressing M. tuberculosis antigen 85A against murine tuberculosis. Infect. Immun. 77, 622-31.  [68] Vordermeier, H.M., Villarreal-Ramos, B., Cockle, P.J., McAulay, M., Rhodes, S.G., Thacker, T., Gilbert, S.C., McShane, H., Hill, A.V., Xing, Z., and Hewinson, R.G. (2009). Viral booster vaccines improve Mycobacterium bovis BCG-induced protection against bovine tuberculosis. Infect. Immun. 77, 3364-73.  [69] Reed, S.G., Coler, R.N., Dalemans, W., Tan, E.V., DeLa Cruz, E.C., Basaraba, R.J., Orme, I.M., Skeiky, Y.A., Alderson, M.R., Cowgill, K.D., Prieels, J.P., Abalos, R.M., Dubois, M.C., Cohen, J., Mettens, P., and Lobet, Y. (2009). Defined tuberculosis vaccine, Mtb72F/AS02A, evidence of protection in cynomolgus monkeys. Proc. Natl. Acad. Sci. U. S. A. 106, 2301-6.  [70] Wendel, C.S., Grant, M., Herrinton, L., Temple, L.K., Hornbrook, M.C., McMullen, C.K., Bulkley, J.E., Altschuler, A., and Krouse, R.S. (2014). Reliability and validity of a survey to measure bowel function and quality of life in long-term rectal cancer survivors. Qual. Life Res. 23, 2831-40.  [71] Grode, L., Seiler, P., Baumann, S., Hess, J., Brinkmann, V., Eddine, A.N., Mann, P., Goosmann, C., Bandermann, S., Smith, D., Bancroft, G.J., Reyrat, J.M., van Soolingen, D., Raupach, B., and Kaufmann, S.H. (2005). Increased vaccine efficacy against tuberculosis of  93 recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin. J. Clin. Invest. 115, 2472-9.  [72] Grode, L., Ganoza, C.A., Brohm, C., Weiner, J.,3rd, Eisele, B., and Kaufmann, S.H. (2013). Safety and immunogenicity of the recombinant BCG vaccine VPM1002 in a phase 1 open-label randomized clinical trial. Vaccine 31, 1340-8.  [73] Radosevic, K., Wieland, C.W., Rodriguez, A., Weverling, G.J., Mintardjo, R., Gillissen, G., Vogels, R., Skeiky, Y.A., Hone, D.M., Sadoff, J.C., van der Poll, T., Havenga, M., and Goudsmit, J. (2007). Protective immune responses to a recombinant adenovirus type 35 tuberculosis vaccine in two mouse strains: CD4 and CD8 T-cell epitope mapping and role of gamma interferon. Infect. Immun. 75, 4105-15.  [74] Abel, B., Tameris, M., Mansoor, N., Gelderbloem, S., Hughes, J., Abrahams, D., Makhethe, L., Erasmus, M., de Kock, M., van der Merwe, L., Hawkridge, A., Veldsman, A., Hatherill, M., Schirru, G., Pau, M.G., Hendriks, J., Weverling, G.J., Goudsmit, J., Sizemore, D., McClain, J.B., Goetz, M., Gearhart, J., Mahomed, H., Hussey, G.D., Sadoff, J.C., and Hanekom, W.A. (2010). The novel tuberculosis vaccine, AERAS-402, induces robust and polyfunctional CD4+ and CD8+ T cells in adults. Am. J. Respir. Crit. Care Med. 181, 1407-17.  [75] Horwitz, M.A. (2005). Recombinant BCG expressing Mycobacterium tuberculosis major extracellular proteins. Microbes Infect. 7, 947-54.  [76] Williams, A., Hatch, G.J., Clark, S.O., Gooch, K.E., Hatch, K.A., Hall, G.A., Huygen, K., Ottenhoff, T.H., Franken, K.L., Andersen, P., Doherty, T.M., Kaufmann, S.H., Grode, L., Seiler, P., Martin, C., Gicquel, B., Cole, S.T., Brodin, P., Pym, A.S., Dalemans, W., Cohen, J., Lobet, Y., Goonetilleke, N., McShane, H., Hill, A., Parish, T., Smith, D., Stoker, N.G., Lowrie, D.B., Kallenius, G., Svenson, S., Pawlowski, A., Blake, K., and Marsh, P.D. (2005). Evaluation of vaccines in the EU TB Vaccine Cluster using a guinea pig aerosol infection model of tuberculosis. Tuberculosis (Edinb) 85, 29-38.  [77] Mandal, M. and Lee, K.D. (2002). Listeriolysin O-liposome-mediated cytosolic delivery of macromolecule antigen in vivo: enhancement of antigen-specific cytotoxic T lymphocyte frequency, activity, and tumor protection. Biochim. Biophys. Acta 1563, 7-17.  [78] Kaufmann, S.H. (1993). Immunity to intracellular bacteria. Annu. Rev. Immunol. 11, 129-63.  [79] Palmer, M. (2001). The family of thiol-activated, cholesterol-binding cytolysins. Toxicon 39, 1681-9.  [80] Schaible, U.E., Sturgill-Koszycki, S., Schlesinger, P.H., and Russell, D.G. (1998). Cytokine activation leads to acidification and increases maturation of Mycobacterium avium-containing phagosomes in murine macrophages. J. Immunol. 160, 1290-6.   94 [81] Honer zu Bentrup, K. and Russell, D.G. (2001). Mycobacterial persistence: adaptation to a changing environment. Trends Microbiol. 9, 597-605.  [82] Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 26, 239-57.  [83] Elmore, S. (2007). Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495-516.  [84] Kroemer, G., El-Deiry, W.S., Golstein, P., Peter, M.E., Vaux, D., Vandenabeele, P., Zhivotovsky, B., Blagosklonny, M.V., Malorni, W., Knight, R.A., Piacentini, M., Nagata, S., Melino, G., and Nomenclature Committee on Cell Death. (2005). Classification of cell death: recommendations of the Nomenclature Committee on Cell Death. Cell Death Differ. 12 Suppl 2, 1463-7.  [85] Renehan, A.G., Booth, C., and Potten, C.S. (2001). What is apoptosis, and why is it important? BMJ 322, 1536-8.  [86] Reed, J.C. (2006). Drug insight: cancer therapy strategies based on restoration of endogenous cell death mechanisms. Nat. Clin. Pract. Oncol. 3, 388-98.  [87] Kroemer, G., Galluzzi, L., and Brenner, C. (2007). Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 87, 99-163.  [88] Saelens, X., Festjens, N., Vande Walle, L., van Gurp, M., van Loo, G., and Vandenabeele, P. (2004). Toxic proteins released from mitochondria in cell death. Oncogene 23, 2861-74.  [89] Youle, R.J. and Strasser, A. (2008). The BCL-2 protein family: opposing activities that mediate cell death. Nat. Rev. Mol. Cell Biol. 9, 47-59.  [90] Lee, J., Hartman, M., and Kornfeld, H. (2009). Macrophage apoptosis in tuberculosis. Yonsei medical journal 50, 1-11.  [91] Chinnaiyan, A.M. (1999). The apoptosome: heart and soul of the cell death machine. Neoplasia 1, 5-15.  [92] Hill, M.M., Adrain, C., Duriez, P.J., Creagh, E.M., and Martin, S.J. (2004). Analysis of the composition, assembly kinetics and activity of native Apaf-1 apoptosomes. EMBO J. 23, 2134-45.  [93] Locksley, R.M., Killeen, N., and Lenardo, M.J. (2001). The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487-501.   95 [94] Ashkenazi, A. and Dixit, V.M. (1998). Death receptors: signaling and modulation. Science 281, 1305-8.  [95] Kischkel, F.C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M., Krammer, P.H., and Peter, M.E. (1995). Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J. 14, 5579-88.  [96] Trapani, J.A. and Smyth, M.J. (2002). Functional significance of the perforin/granzyme cell death pathway. Nat. Rev. Immunol. 2, 735-47.  [97] Martinvalet, D., Zhu, P., and Lieberman, J. (2005). Granzyme A induces caspase-independent mitochondrial damage, a required first step for apoptosis. Immunity 22, 355-70.  [98] Elnemr, A., Ohta, T., Yachie, A., Kayahara, M., Kitagawa, H., Fujimura, T., Ninomiya, I., Fushida, S., Nishimura, G.I., Shimizu, K., and Miwa, K. (2001). Human pancreatic cancer cells disable function of Fas receptors at several levels in Fas signal transduction pathway. Int. J. Oncol. 18, 311-6.  [99] Cheng, J., Zhou, T., Liu, C., Shapiro, J.P., Brauer, M.J., Kiefer, M.C., Barr, P.J., and Mountz, J.D. (1994). Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science 263, 1759-62.  [100] Worth, A., Thrasher, A.J., and Gaspar, H.B. (2006). Autoimmune lymphoproliferative syndrome: molecular basis of disease and clinical phenotype. Br. J. Haematol. 133, 124-40.  [101] Keane, J., Remold, H.G., and Kornfeld, H. (2000). Virulent Mycobacterium tuberculosis strains evade apoptosis of infected alveolar macrophages. J. Immunol. 164, 2016-20.  [102] Fairbairn, I.P. (2004). Macrophage apoptosis in host immunity to mycobacterial infections. Biochem. Soc. Trans. 32, 496-8.  [103] Velmurugan, K., Chen, B., Miller, J.L., Azogue, S., Gurses, S., Hsu, T., Glickman, M., Jacobs, W.R.,Jr, Porcelli, S.A., and Briken, V. (2007). Mycobacterium tuberculosis nuoG is a virulence gene that inhibits apoptosis of infected host cells. PLoS Pathog. 3, e110.  [104] Spira, A., Carroll, J.D., Liu, G., Aziz, Z., Shah, V., Kornfeld, H., and Keane, J. (2003). Apoptosis genes in human alveolar macrophages infected with virulent or attenuated Mycobacterium tuberculosis: a pivotal role for tumor necrosis factor. Am. J. Respir. Cell Mol. Biol. 29, 545-51.  [105] Balcewicz-Sablinska, M.K., Keane, J., Kornfeld, H., and Remold, H.G. (1998). Pathogenic Mycobacterium tuberculosis evades apoptosis of host macrophages by release of TNF-R2, resulting in inactivation of TNF-alpha. J. Immunol. 161, 2636-41.   96 [106] Sly, L.M., Hingley-Wilson, S.M., Reiner, N.E., and McMaster, W.R. (2003). Survival of Mycobacterium tuberculosis in host macrophages involves resistance to apoptosis dependent upon induction of antiapoptotic Bcl-2 family member Mcl-1. J. Immunol. 170, 430-7.  [107] Fratazzi, C., Arbeit, R.D., Carini, C., Balcewicz-Sablinska, M.K., Keane, J., Kornfeld, H., and Remold, H.G. (1999). Macrophage apoptosis in mycobacterial infections. J. Leukoc. Biol. 66, 763-4.  [108] Molloy, A., Laochumroonvorapong, P., and Kaplan, G. (1994). Apoptosis, but not necrosis, of infected monocytes is coupled with killing of intracellular bacillus Calmette-Guerin. J. Exp. Med. 180, 1499-509.  [109] Fratazzi, C., Arbeit, R.D., Carini, C., and Remold, H.G. (1997). Programmed cell death of Mycobacterium avium serovar 4-infected human macrophages prevents the mycobacteria from spreading and induces mycobacterial growth inhibition by freshly added, uninfected macrophages. J. Immunol. 158, 4320-7.  [110] Cohen, G.M. (1997). Caspases: the executioners of apoptosis. Biochem. J. 326 (Pt 1), 1-16.  [111] Nunez, G., Benedict, M.A., Hu, Y., and Inohara, N. (1998). Caspases: the proteases of the apoptotic pathway. Oncogene 17, 3237-45.  [112] Fischer, U., Janicke, R.U., and Schulze-Osthoff, K. (2003). Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death Differ. 10, 76-100.  [113] Ju, W., Valencia, C.A., Pang, H., Ke, Y., Gao, W., Dong, B., and Liu, R. (2007). Proteome-wide identification of family member-specific natural substrate repertoire of caspases. Proc. Natl. Acad. Sci. U. S. A. 104, 14294-9.  [114] Walsh, J.G., Cullen, S.P., Sheridan, C., Luthi, A.U., Gerner, C., and Martin, S.J. (2008). Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc. Natl. Acad. Sci. U. S. A. 105, 12815-9.  [115] Lamkanfi, M. and Kanneganti, T.D. (2010). Caspase-7: a protease involved in apoptosis and inflammation. Int. J. Biochem. Cell Biol. 42, 21-4.  [116] Wall, D.M. and McCormick, B.A. (2014). Bacterial secreted effectors and caspase-3 interactions. Cell. Microbiol. 16, 1746-56.  [117] Boland, K., Flanagan, L., and Prehn, J.H. (2013). Paracrine control of tissue regeneration and cell proliferation by Caspase-3. Cell. Death Dis. 4, e725.   97 [118] Connolly, P.F., Jager, R., and Fearnhead, H.O. (2014). New roles for old enzymes: killer caspases as the engine of cell behavior changes. Front. Physiol. 5, 149.  [119] Sakahira, H., Enari, M., and Nagata, S. (1998). Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis. Nature 391, 96-9.  [120] Mandal, D., Mazumder, A., Das, P., Kundu, M., and Basu, J. (2005). Fas-, caspase 8-, and caspase 3-dependent signaling regulates the activity of the aminophospholipid translocase and phosphatidylserine externalization in human erythrocytes. J. Biol. Chem. 280, 39460-7.  [121] Ferraro-Peyret, C., Quemeneur, L., Flacher, M., Revillard, J.P., and Genestier, L. (2002). Caspase-independent phosphatidylserine exposure during apoptosis of primary T lymphocytes. J. Immunol. 169, 4805-10.  [122] Fadok, V.A., de Cathelineau, A., Daleke, D.L., Henson, P.M., and Bratton, D.L. (2001). Loss of phospholipid asymmetry and surface exposure of phosphatidylserine is required for phagocytosis of apoptotic cells by macrophages and fibroblasts. J. Biol. Chem. 276, 1071-7.  [123] Turk, V., Stoka, V., Vasiljeva, O., Renko, M., Sun, T., Turk, B., and Turk, D. (2012). Cysteine cathepsins: from structure, function and regulation to new frontiers. Biochim. Biophys. Acta 1824, 68-88.  [124] Rossi, A., Deveraux, Q., Turk, B., and Sali, A. (2004). Comprehensive search for cysteine cathepsins in the human genome. Biol. Chem. 385, 363-72.  [125] Hsing, L.C. and Rudensky, A.Y. (2005). The lysosomal cysteine proteases in MHC class II antigen presentation. Immunol. Rev. 207, 229-41.  [126] Goulet, B., Baruch, A., Moon, N.S., Poirier, M., Sansregret, L.L., Erickson, A., Bogyo, M., and Nepveu, A. (2004). A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/Cux transcription factor. Mol. Cell 14, 207-19.  [127] Duncan, E.M., Muratore-Schroeder, T.L., Cook, R.G., Garcia, B.A., Shabanowitz, J., Hunt, D.F., and Allis, C.D. (2008). Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation. Cell 135, 284-94.  [128] Turk, B., Bieth, J.G., Bjork, I., Dolenc, I., Turk, D., Cimerman, N., Kos, J., Colic, A., Stoka, V., and Turk, V. (1995). Regulation of the activity of lysosomal cysteine proteinases by pH-induced inactivation and/or endogenous protein inhibitors, cystatins. Biol. Chem. Hoppe Seyler 376, 225-30.  [129] Kirschke, H., Wiederanders, B., Bromme, D., and Rinne, A. (1989). Cathepsin S from bovine spleen. Purification, distribution, intracellular localization and action on proteins.  98 Biochem. J. 264, 467-73.  [130] Adams, L.A., Moller, M., Nebel, A., Schreiber, S., van der Merwe, L., van Helden, P.D., and Hoal, E.G. (2011). Polymorphisms in MC3R promoter and CTSZ 3'UTR are associated with tuberculosis susceptibility. Eur. J. Hum. Genet. 19, 676-81.  [131] Rudensky, A. and Beers, C. (2006). Lysosomal cysteine proteases and antigen presentation. Ernst Schering Res. Found. Workshop (56), 81-95.  [132] Hewitt, E.W. (2003). The MHC class I antigen presentation pathway: strategies for viral immune evasion. Immunology 110, 163-9.  [133] Wang, D., Zhou, Y., Ji, L., He, T., Lin, F., Lin, R., Lin, T., and Mo, Y. (2012). Association of LMP/TAP gene polymorphisms with tuberculosis susceptibility in Li population in China. PLoS One 7, e33051.  [134] Cresswell, P. (1994). Assembly, transport, and function of MHC class II molecules. Annu. Rev. Immunol. 12, 259-93.  [135] Anderson, M.S. and Miller, J. (1992). Invariant chain can function as a chaperone protein for class II major histocompatibility complex molecules. Proc. Natl. Acad. Sci. U. S. A. 89, 2282-6.  [136] Cresswell, P. (1996). Invariant chain structure and MHC class II function. Cell 84, 505-7.  [137] Rudensky, A. and Beers, C. (2006). Lysosomal cysteine proteases and antigen presentation. Ernst Schering Res. Found. Workshop (56), 81-95.  [138] Bakke, O. and Dobberstein, B. (1990). MHC class II-associated invariant chain contains a sorting signal for endosomal compartments. Cell 63, 707-16.  [139] Lotteau, V., Teyton, L., Peleraux, A., Nilsson, T., Karlsson, L., Schmid, S.L., Quaranta, V., and Peterson, P.A. (1990). Intracellular transport of class II MHC molecules directed by invariant chain. Nature 348, 600-5.  [140] Nakagawa, T.Y., Brissette, W.H., Lira, P.D., Griffiths, R.J., Petrushova, N., Stock, J., McNeish, J.D., Eastman, S.E., Howard, E.D., Clarke, S.R., Rosloniec, E.F., Elliott, E.A., and Rudensky, A.Y. (1999). Impaired invariant chain degradation and antigen presentation and diminished collagen-induced arthritis in cathepsin S null mice. Immunity 10, 207-17.  [141] Shi, G.P., Villadangos, J.A., Dranoff, G., Small, C., Gu, L., Haley, K.J., Riese, R., Ploegh, H.L., and Chapman, H.A. (1999). Cathepsin S required for normal MHC class II peptide loading and germinal center development. Immunity 10, 197-206.   99 [142] Benavides, F., Venables, A., Poetschke Klug, H., Glasscock, E., Rudensky, A., Gomez, M., Martin Palenzuela, N., Guenet, J.L., Richie, E.R., and Conti, C.J. (2001). The CD4 T cell-deficient mouse mutation nackt (nkt) involves a deletion in the cathepsin L (CtsI) gene. Immunogenetics 53, 233-42.  [143] Nakagawa, T., Roth, W., Wong, P., Nelson, A., Farr, A., Deussing, J., Villadangos, J.A., Ploegh, H., Peters, C., and Rudensky, A.Y. (1998). Cathepsin L: critical role in Ii degradation and CD4 T cell selection in the thymus. Science 280, 450-3.  [144] Beers, C., Honey, K., Fink, S., Forbush, K., and Rudensky, A. (2003). Differential regulation of cathepsin S and cathepsin L in interferon gamma-treated macrophages. J. Exp. Med. 197, 169-79.  [145] Deiss, L.P., Galinka, H., Berissi, H., Cohen, O., and Kimchi, A. (1996). Cathepsin D protease mediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha. EMBO J. 15, 3861-70.  [146] Stoka, V., Turk, V., and Turk, B. (2007). Lysosomal cysteine cathepsins: signaling pathways in apoptosis. Biol. Chem. 388, 555-60.  [147] Uchimoto, T., Nohara, H., Kamehara, R., Iwamura, M., Watanabe, N., and Kobayashi, Y. (1999). Mechanism of apoptosis induced by a lysosomotropic agent, L-Leucyl-L-Leucine methyl ester. Apoptosis 4, 357-62.  [148] Wilson, P.D., Firestone, R.A., and Lenard, J. (1987). The role of lysosomal enzymes in killing of mammalian cells by the lysosomotropic detergent N-dodecylimidazole. J. Cell Biol. 104, 1223-9.  [149] Kagedal, K., Zhao, M., Svensson, I., and Brunk, U.T. (2001). Sphingosine-induced apoptosis is dependent on lysosomal proteases. Biochem. J. 359, 335-43.  [150] Boya, P., Andreau, K., Poncet, D., Zamzami, N., Perfettini, J.L., Metivier, D., Ojcius, D.M., Jaattela, M., and Kroemer, G. (2003). Lysosomal membrane permeabilization induces cell death in a mitochondrion-dependent fashion. J. Exp. Med. 197, 1323-34.  [151] Heinrich, M., Wickel, M., Schneider-Brachert, W., Sandberg, C., Gahr, J., Schwandner, R., Weber, T., Saftig, P., Peters, C., Brunner, J., Kronke, M., and Schutze, S. (1999). Cathepsin D targeted by acid sphingomyelinase-derived ceramide. EMBO J. 18, 5252-63.  [152] Luzio, J.P., Pryor, P.R., and Bright, N.A. (2007). Lysosomes: fusion and function. Nat. Rev. Mol. Cell Biol. 8, 622-32.  [153] Konjar, S., Sutton, V.R., Hoves, S., Repnik, U., Yagita, H., Reinheckel, T., Peters, C., Turk, V., Turk, B., Trapani, J.A., and Kopitar-Jerala, N. (2010). Human and mouse perforin are processed in part through cleavage by the lysosomal cysteine proteinase cathepsin L.  100 Immunology 131, 257-67.  [154] D'Angelo, M.E., Bird, P.I., Peters, C., Reinheckel, T., Trapani, J.A., and Sutton, V.R. (2010). Cathepsin H is an additional convertase of pro-granzyme B. J. Biol. Chem. 285, 20514-9.  [155] Turk, B. and Stoka, V. (2007). Protease signalling in cell death: caspases versus cysteine cathepsins. FEBS Lett. 581, 2761-7.  [156] Stoka, V., Turk, B., Schendel, S.L., Kim, T.H., Cirman, T., Snipas, S.J., Ellerby, L.M., Bredesen, D., Freeze, H., Abrahamson, M., Bromme, D., Krajewski, S., Reed, J.C., Yin, X.M., Turk, V., and Salvesen, G.S. (2001). Lysosomal protease pathways to apoptosis. Cleavage of bid, not pro-caspases, is the most likely route. J. Biol. Chem. 276, 3149-57.  [157] Cirman, T., Oresic, K., Mazovec, G.D., Turk, V., Reed, J.C., Myers, R.M., Salvesen, G.S., and Turk, B. (2004). Selective disruption of lysosomes in HeLa cells triggers apoptosis mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins. J. Biol. Chem. 279, 3578-87.  [158] Droga-Mazovec, G., Bojic, L., Petelin, A., Ivanova, S., Romih, R., Repnik, U., Salvesen, G.S., Stoka, V., Turk, V., and Turk, B. (2008). Cysteine cathepsins trigger caspase-dependent cell death through cleavage of bid and antiapoptotic Bcl-2 homologues. J. Biol. Chem. 283, 19140-50.  [159] Blomgran, R., Zheng, L., and Stendahl, O. (2007). Cathepsin-cleaved Bid promotes apoptosis in human neutrophils via oxidative stress-induced lysosomal membrane permeabilization. J. Leukoc. Biol. 81, 1213-23.  [160] Heinrich, M., Neumeyer, J., Jakob, M., Hallas, C., Tchikov, V., Winoto-Morbach, S., Wickel, M., Schneider-Brachert, W., Trauzold, A., Hethke, A., and Schutze, S. (2004). Cathepsin D links TNF-induced acid sphingomyelinase to Bid-mediated caspase-9 and -3 activation. Cell Death Differ. 11, 550-63.  [161] Houseweart, M.K., Vilaythong, A., Yin, X.M., Turk, B., Noebels, J.L., and Myers, R.M. (2003). Apoptosis caused by cathepsins does not require Bid signaling in an in vivo model of progressive myoclonus epilepsy (EPM1). Cell Death Differ. 10, 1329-35.  [162] Roberg, K., Kagedal, K., and Ollinger, K. (2002). Microinjection of cathepsin d induces caspase-dependent apoptosis in fibroblasts. Am. J. Pathol. 161, 89-96.  [163] Conus, S., Perozzo, R., Reinheckel, T., Peters, C., Scapozza, L., Yousefi, S., and Simon, H.U. (2008). Caspase-8 is activated by cathepsin D initiating neutrophil apoptosis during the resolution of inflammation. J. Exp. Med. 205, 685-98.  [164] Sendide, K., Deghmane, A.E., Pechkovsky, D., Av-Gay, Y., Talal, A., and Hmama, Z. (2005). Mycobacterium bovis BCG attenuates surface expression of mature class II  101 molecules through IL-10-dependent inhibition of cathepsin S. J. Immunol. 175, 5324-32.  [165] Sun, J., Lau, A., Wang, X., Liao, T.Y., Zoubeidi, A., and Hmama, Z. (2009). A broad-range of recombination cloning vectors in mycobacteria. Plasmid 62, 158-65.  [166] Srinivasula, S.M., Ahmad, M., MacFarlane, M., Luo, Z., Huang, Z., Fernandes-Alnemri, T., and Alnemri, E.S. (1998). Generation of constitutively active recombinant caspases-3 and -6 by rearrangement of their subunits. J. Biol. Chem. 273, 10107-11.  [167] Soualhine, H., Deghmane, A.E., Sun, J., Mak, K., Talal, A., Av-Gay, Y., and Hmama, Z. (2007). Mycobacterium bovis bacillus Calmette-Guerin secreting active cathepsin S stimulates expression of mature MHC class II molecules and antigen presentation in human macrophages. J. Immunol. 179, 5137-45.  [168] Liao, T.Y., Lau, A., Joseph, S., Hytonen, V., and Hmama, Z. (2015). Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System. PLoS One 10, e0145833.  [169] Cayabyab, M.J., Macovei, L., and Campos-Neto, A. (2012). Current and novel approaches to vaccine development against tuberculosis. Front. Cell. Infect. Microbiol. 2, 154.  [170] da Costa, A.C., Nogueira, S.V., Kipnis, A., and Junqueira-Kipnis, A.P. (2014). Recombinant BCG: Innovations on an Old Vaccine. Scope of BCG Strains and Strategies to Improve Long-Lasting Memory. Front. Immunol. 5, 152.  [171] Riese, R.J., Wolf, P.R., Bromme, D., Natkin, L.R., Villadangos, J.A., Ploegh, H.L., and Chapman, H.A. (1996). Essential role for cathepsin S in MHC class II-associated invariant chain processing and peptide loading. Immunity 4, 357-66.  [172] Dennehy, M., Bourn, W., Steele, D., and Williamson, A.L. (2007). Evaluation of recombinant BCG expressing rotavirus VP6 as an anti-rotavirus vaccine. Vaccine 25, 3646-57.  [173] Carroll, P., Schreuder, L.J., Muwanguzi-Karugaba, J., Wiles, S., Robertson, B.D., Ripoll, J., Ward, T.H., Bancroft, G.J., Schaible, U.E., and Parish, T. (2010). Sensitive detection of gene expression in mycobacteria under replicating and non-replicating conditions using optimized far-red reporters. PLoS One 5, e9823.  [174] Al-Zarouni, M. and Dale, J.W. (2002). Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis (Edinb) 82, 283-91.  [175] Yrlid, U. and Wick, M.J. (2000). Salmonella-induced apoptosis of infected macrophages results in presentation of a bacteria-encoded antigen after uptake by bystander  102 dendritic cells. J. Exp. Med. 191, 613-24.  [176] Zheng, T., Kang, M.J., Crothers, K., Zhu, Z., Liu, W., Lee, C.G., Rabach, L.A., Chapman, H.A., Homer, R.J., Aldous, D., De Sanctis, G.T., Underwood, S., Graupe, M., Flavell, R.A., Schmidt, J.A., and Elias, J.A. (2005). Role of cathepsin S-dependent epithelial cell apoptosis in IFN-gamma-induced alveolar remodeling and pulmonary emphysema. J. Immunol. 174, 8106-15.  [177] Riendeau, C.J. and Kornfeld, H. (2003). THP-1 cell apoptosis in response to Mycobacterial infection. Infect. Immun. 71, 254-9.  [178] Kariyone, A., Higuchi, K., Yamamoto, S., Nagasaka-Kametaka, A., Harada, M., Takahashi, A., Harada, N., Ogasawara, K., and Takatsu, K. (1999). Identification of amino acid residues of the T-cell epitope of Mycobacterium tuberculosis alpha antigen critical for Vbeta11(+) Th1 cells. Infect. Immun. 67, 4312-9.  [179] Vogelzang, A., Perdomo, C., Zedler, U., Kuhlmann, S., Hurwitz, R., Gengenbacher, M., and Kaufmann, S.H. (2014). Central memory CD4+ T cells are responsible for the recombinant Bacillus Calmette-Guerin DeltaureC::hly vaccine's superior protection against tuberculosis. J. Infect. Dis. 210, 1928-37.  [180] Behar, S.M. (2013). Antigen-specific CD8(+) T cells and protective immunity to tuberculosis. Adv. Exp. Med. Biol. 783, 141-63.  [181] Woodworth, J.S. and Behar, S.M. (2006). Mycobacterium tuberculosis-specific CD8+ T cells and their role in immunity. Crit. Rev. Immunol. 26, 317-52.  [182] Smith, S.M. and Dockrell, H.M. (2000). Role of CD8 T cells in mycobacterial infections. Immunol. Cell Biol. 78, 325-33.  [183] Gartner, T., Romano, M., Suin, V., Kalai, M., Korf, H., De Baetselier, P., and Huygen, K. (2008). Immunogenicity and protective efficacy of a tuberculosis DNA vaccine co-expressing pro-apoptotic caspase-3. Vaccine 26, 1458-70.  [184] Gentschev, I., Mollenkopf, H., Sokolovic, Z., Hess, J., Kaufmann, S.H., and Goebel, W. (1996). Development of antigen-delivery systems, based on the Escherichia coli hemolysin secretion pathway. Gene 179, 133-40.  [185] Soldani, C. and Scovassi, A.I. (2002). Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis 7, 321-8.  [186] Kamath, A.T., Fruth, U., Brennan, M.J., Dobbelaer, R., Hubrechts, P., Ho, M.M., Mayner, R.E., Thole, J., Walker, K.B., Liu, M., Lambert, P.H., AERAS Global TB Vaccine Foundation, and World Health Organization. (2005). New live mycobacterial vaccines: the Geneva consensus on essential steps towards clinical development. Vaccine 23, 3753-61.   103 [187] Sambandamurthy, V.K. and Jacobs, W.R.,Jr. (2005). Live attenuated mutants of Mycobacterium tuberculosis as candidate vaccines against tuberculosis. Microbes Infect. 7, 955-61.  [188] Brennan, M.J. (2005). The tuberculosis vaccine challenge. Tuberculosis. (Edinb.) 85, 7-12.  [189] Scriba, T.J., Kaufmann, S.H., Henri Lambert, P., Sanicas, M., Martin, C., and Neyrolles, O. (2016). Vaccination Against Tuberculosis With Whole-Cell Mycobacterial Vaccines. J. Infect. Dis. 214, 659-64.  [190] Sun, R., Skeiky, Y.A., Izzo, A., Dheenadhayalan, V., Imam, Z., Penn, E., Stagliano, K., Haddock, S., Mueller, S., Fulkerson, J., Scanga, C., Grover, A., Derrick, S.C., Morris, S., Hone, D.M., Horwitz, M.A., Kaufmann, S.H., and Sadoff, J.C. (2009). Novel recombinant BCG expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-clinical characterization, safety and protection against challenge with Mycobacterium tuberculosis. Vaccine 27, 4412-23.  [191] Kaufmann, S.H. (2012). Tuberculosis vaccine development: strength lies in tenacity. Trends Immunol. 33, 373-9.  [192] Winau, F., Weber, S., Sad, S., de Diego, J., Hoops, S.L., Breiden, B., Sandhoff, K., Brinkmann, V., Kaufmann, S.H., and Schaible, U.E. (2006). Apoptotic vesicles crossprime CD8 T cells and protect against tuberculosis. Immunity 24, 105-17.  [193] Sun, J., Deghmane, A.E., Soualhine, H., Hong, T., Bucci, C., Solodkin, A., and Hmama, Z. (2007). Mycobacterium bovis BCG disrupts the interaction of Rab7 with RILP contributing to inhibition of phagosome maturation. J. Leukoc. Biol. 82, 1437-45.  [194] Bania, J., Gatti, E., Lelouard, H., David, A., Cappello, F., Weber, E., Camosseto, V., and Pierre, P. (2003). Human cathepsin S, but not cathepsin L, degrades efficiently MHC class II-associated invariant chain in nonprofessional APCs. Proc. Natl. Acad. Sci. U. S. A. 100, 6664-9.  [195] Joffre, O.P., Segura, E., Savina, A., and Amigorena, S. (2012). Cross-presentation by dendritic cells. Nat. Rev. Immunol. 12, 557-69.  [196] Flynn, J.L., Chan, J., Triebold, K.J., Dalton, D.K., Stewart, T.A., and Bloom, B.R. (1993). An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178, 2249-54.  [197] Cooper, A.M., Dalton, D.K., Stewart, T.A., Griffin, J.P., Russell, D.G., and Orme, I.M. (1993). Disseminated tuberculosis in interferon gamma gene-disrupted mice. J. Exp. Med. 178, 2243-7.   104 [198] Winslow, G.M., Cooper, A., Reiley, W., Chatterjee, M., and Woodland, D.L. (2008). Early T-cell responses in tuberculosis immunity. Immunol. Rev. 225, 284-99.  [199] Serbina, N.V., Liu, C.C., Scanga, C.A., and Flynn, J.L. (2000). CD8+ CTL from lungs of Mycobacterium tuberculosis-infected mice express perforin in vivo and lyse infected macrophages. J. Immunol. 165, 353-63.  [200] Kamath, A.B., Woodworth, J., Xiong, X., Taylor, C., Weng, Y., and Behar, S.M. (2004). Cytolytic CD8+ T cells recognizing CFP10 are recruited to the lung after Mycobacterium tuberculosis infection. J. Exp. Med. 200, 1479-89.  [201] Nasser Eddine, A. and Kaufmann, S.H. (2005). Improved protection by recombinant BCG. Microbes Infect. 7, 939-46.  [202] Neyrolles, O., Gould, K., Gares, M.P., Brett, S., Janssen, R., O'Gaora, P., Herrmann, J.L., Prevost, M.C., Perret, E., Thole, J.E., and Young, D. (2001). Lipoprotein access to MHC class I presentation during infection of murine macrophages with live mycobacteria. J. Immunol. 166, 447-57.  [203] Shen, L., Sigal, L.J., Boes, M., and Rock, K.L. (2004). Important role of cathepsin S in generating peptides for TAP-independent MHC class I crosspresentation in vivo. Immunity 21, 155-65.  [204] Pislar, A., Perisic Nanut, M., and Kos, J. (2015). Lysosomal cysteine peptidases - Molecules signaling tumor cell death and survival. Semin. Cancer Biol. 35, 168-79.  [205] Ishigaki, S., Fonseca, S.G., Oslowski, C.M., Jurczyk, A., Shearstone, J.R., Zhu, L.J., Permutt, M.A., Greiner, D.L., Bortell, R., and Urano, F. (2010). AATF mediates an antiapoptotic effect of the unfolded protein response through transcriptional regulation of AKT1. Cell Death Differ. 17, 774-86.  [206] Nascimento, D., Dellagostin, O., Hirata Junior, R., Pereira, G., Mattos-Guaraldi, A., and Armôa, G. (2013). Plasmid instability when the hsp60 gene promoter is used to express the protective non-toxic fragment B of the diphtheria toxin in recombinant BCG. Am J Mol Biol 3, 81-86.  [207] Medeiros, M.A., Dellagostin, O.A., Armoa, G.R., Degrave, W.M., De Mendonca-Lima, L., Lopes, M.Q., Costa, J.F., McFadden, J., and McIntosh, D. (2002). Comparative evaluation of Mycobacterium vaccae as a surrogate cloning host for use in the study of mycobacterial genetics. Microbiology 148, 1999-2009.  [208] Murray, A., Winter, N., Lagranderie, M., Hill, D.F., Rauzier, J., Timm, J., Leclerc, C., Moriarty, K.M., Gheorghiu, M., and Gicquel, B. (1992). Expression of Escherichia coli beta-galactosidase in Mycobacterium bovis BCG using an expression system isolated from Mycobacterium paratuberculosis which induced humoral and cellular immune responses.  105 Mol. Microbiol. 6, 3331-42.  [209] Abdelhak, S., Louzir, H., Timm, J., Blel, L., Benlasfar, Z., Lagranderie, M., Gheorghiu, M., Dellagi, K., and Gicquel, B. (1995). Recombinant BCG expressing the leishmania surface antigen Gp63 induces protective immunity against Leishmania major infection in BALB/c mice. Microbiology 141 (Pt 7), 1585-92.  [210] Winter, N., Lagranderie, M., Gangloff, S., Leclerc, C., Gheorghiu, M., and Gicquel, B. (1995). Recombinant BCG strains expressing the SIVmac251nef gene induce proliferative and CTL responses against nef synthetic peptides in mice. Vaccine 13, 471-8.  [211] Haeseleer, F. (1994). Structural instability of recombinant plasmids in mycobacteria. Res. Microbiol. 145, 683-7.  [212] Seder, R.A., Darrah, P.A., and Roederer, M. (2008). T-cell quality in memory and protection: implications for vaccine design. Nat. Rev. Immunol. 8, 247-58.  [213] Sallusto, F., Geginat, J., and Lanzavecchia, A. (2004). Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu. Rev. Immunol. 22, 745-63.  [214] Lindenstrom, T., Agger, E.M., Korsholm, K.S., Darrah, P.A., Aagaard, C., Seder, R.A., Rosenkrands, I., and Andersen, P. (2009). Tuberculosis subunit vaccination provides long-term protective immunity characterized by multifunctional CD4 memory T cells. J. Immunol. 182, 8047-55.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0342968/manifest

Comment

Related Items