UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigating the synergistic antimicrobial effect of carvacrol and zinc oxide nanoparticles against… Windiasti, Gracia 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_february_windiasti_gracia.pdf [ 5.5MB ]
Metadata
JSON: 24-1.0340643.json
JSON-LD: 24-1.0340643-ld.json
RDF/XML (Pretty): 24-1.0340643-rdf.xml
RDF/JSON: 24-1.0340643-rdf.json
Turtle: 24-1.0340643-turtle.txt
N-Triples: 24-1.0340643-rdf-ntriples.txt
Original Record: 24-1.0340643-source.json
Full Text
24-1.0340643-fulltext.txt
Citation
24-1.0340643.ris

Full Text

INVESTIGATING THE SYNERGISTIC ANTIMICROBIAL EFFECT OF CARVACROL AND ZINC OXIDE NANOPARTICLES AGAINST CAMPYLOBACTER JEJUNI by  Gracia Windiasti  B.Sc., The University of British Columbia, 2015  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (FOOD SCIENCE)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2016  © Gracia Windiasti, 2016   ii Abstract  Foodborne illness is a growing concern world-wide, and Campylobacter in particular has been reported to cause approximately 145,000 foodborne illness cases every year in Canada. A recent annual report from the Canadian Integrated Program for Antimicrobial Resistance Surveillance reveals an increasing trend of antibiotic-resistant Campylobacter isolated from poultry sources across Canada. The large number of foodborne illnesses and emergence of the resistant strains of Campylobacter pose a serious threat in the agri-food industry. Hence, there is increasing urgency to find alternatives to conventional antimicrobials to reduce the prevalence of Campylobacter in the food supply chain while reducing the likelihood of resistance.  Combining antimicrobials is a potential intervention strategy to reduce the growth of pathogens by expanding the spectrum of antimicrobial activity. In this study, carvacrol and zinc oxide nanoparticles (ZnO NPs) were investigated in regards to their synergistic antimicrobial effect against C. jejuni. The combination of these two agents for treatment is based upon current evidence of their individual antimicrobial activity. The objectives of this thesis project were to (1) determine the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni, (2) investigate the macromolecular fingerprints and gene expression profile of C. jejuni after the combinational treatment, and (3) explain the potential mechanism of the synergistic antimicrobial effect. In this work, a macrobroth dilution method was used to test the antimicrobial effect of the compounds against C. jejuni. The macromolecular fingerprints of C. jejuni cells treated with carvacrol and ZnO NPs were investigated using confocal micro-Raman spectroscopy, whereas Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) was employed to study the   iii variation in bacterial gene expression after the antimicrobial treatment. The synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni was clearly demonstrated using the time-kill curve. The macromolecular fingerprints and gene expression profile revealed the role of carvacrol in the synergistic antimicrobial effect against C. jejuni.  The results of this study provide fundamental knowledge about bacterial stress in response to the synergistic antimicrobial effects. This antimicrobial combination may be utilized as an intervention strategy to reduce the prevalence of C. jejuni in agri-foods.     iv Preface  A part of the work in Chapter 4, investigation of gene expression profile of Campylobacter jejuni after treated by carvacrol and zinc oxide nanoparticles, was conducted with the assistance and guidance from Dr. Lina Ma, Research Associate in the Lu Laboratory at the University of British Columbia.  The rest of the work in this thesis project was completed by the author, Gracia Windiasti, under the guidance of supervisor, Dr. Xiaonan Lu. The committee member, Dr. Pascal Delaquis and Dr. Kingsley Amoako, provided additional advice and support for this research.  The work in this thesis has not been previously published.    v Table of Contents  Abstract .......................................................................................................................................... ii	Preface ........................................................................................................................................... iv	Table of Contents ...........................................................................................................................v	List of Tables ................................................................................................................................ ix	List of Figures .................................................................................................................................x	List of Abbreviations ................................................................................................................... xi	Acknowledgements .................................................................................................................... xiii	Dedication .....................................................................................................................................xv	Chapter 1: Introduction, literature review, and research objectives ........................................1	1.1	 Introduction ..................................................................................................................... 1	1.2	 Literature review ............................................................................................................. 2	1.2.1	 Campylobacter ........................................................................................................ 2	1.2.1.1	 History and taxonomy of Campylobacter ........................................................... 2	1.2.1.2	 Reservoirs and clinical infections caused by Campylobacter jejuni .................. 4	1.2.1.3	 Campylobacter jejuni: characteristics and growth requirements ........................ 6	1.2.1.4	 Pathogenicity and virulence of Campylobacter jejuni ........................................ 7	1.2.1.5	 Prevalence of Campylobacter jejuni in the agri-food system ............................. 8	1.2.2	 Carvacrol ................................................................................................................. 9	1.2.2.1	 Chemical structure of carvacrol .......................................................................... 9	1.2.2.2	 Regulation, application, and toxicity level ....................................................... 10	1.2.2.3	 Antimicrobial properties ................................................................................... 11	  vi 1.2.3	 Zinc oxide nanoparticles (ZnO NPs) .................................................................... 12	1.2.3.1	 Structure and properties .................................................................................... 12	1.2.3.2	 Regulation, application, and toxicity ................................................................ 13	1.2.3.3	 Antimicrobial properties ................................................................................... 15	1.3	 Research objectives ....................................................................................................... 16	1.4	 Hypotheses .................................................................................................................... 16	Chapter 2: Investigation of antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni .......................................................................................................19	2.1	 Introduction ................................................................................................................... 19	2.2	 Materials and methods .................................................................................................. 20	2.2.1	 Preparation of Campylobacter jejuni overnight culture ........................................ 20	2.2.2	 Antimicrobial susceptibility of Campylobacter jejuni against carvacrol ............. 21	2.2.3	 Antimicrobial susceptibility of Campylobacter jejuni against zinc oxide nanoparticles ......................................................................................................................... 22	2.2.4	 Synergistic antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni ............................................................................................................ 22	2.3	 Results and discussion .................................................................................................. 23	2.3.1	 Antimicrobial susceptibility of Campylobacter jejuni against carvacrol ............. 23	2.3.2	 Antimicrobial susceptibility of Campylobacter jejuni against zinc oxide nanoparticles ......................................................................................................................... 25	2.3.3	 Synergistic antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni ............................................................................................................ 26	2.4	 Conclusion .................................................................................................................... 27	  vii Chapter 3: Investigation of macromolecular fingerprints of Campylobacter jejuni after treatment with carvacrol and zinc oxide nanoparticles ...........................................................33	3.1	 Introduction ................................................................................................................... 33	3.2	 Materials and methods .................................................................................................. 35	3.2.1	 Sample preparation for Raman spectral collection ............................................... 35	3.2.2	 Confocal micro-Raman spectroscopy ................................................................... 35	3.2.3	 Raman spectral processing and chemometric analysis ......................................... 36	3.3	 Results and discussion .................................................................................................. 36	3.4	 Conclusion .................................................................................................................... 39	Chapter 4: Investigation of the gene expression profile of Campylobacter jejuni after treatment with carvacrol and zinc oxide nanoparticles ...........................................................43	4.1	 Introduction ................................................................................................................... 43	4.2	 Materials and methods .................................................................................................. 44	4.2.1	 Ribonucleic acid sample preparation .................................................................... 44	4.2.2	 Synthesis of complementary deoxyribonucleic acid (cDNA) .............................. 45	4.2.3	 Real-time quantitative polymerase chain reaction (RT-qPCR) ............................ 46	4.2.4	 Data analysis ......................................................................................................... 46	4.3	 Results and discussion .................................................................................................. 47	4.4	 Conclusion .................................................................................................................... 50	Chapter 5: The putative mechanism of the action of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni, conclusion, and future research ...............................................53	5.1	 The putative mechanism of the action of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni ................................................................................................................ 53	  viii 5.2	 Conclusion .................................................................................................................... 54	5.3	 Future research .............................................................................................................. 55	Bibliography .................................................................................................................................57	Appendix .......................................................................................................................................80	Appendix A Chapter 2 supplementary information .................................................................. 80	A.1	 The standard curve of Campylobacter jejuni strains used in the study .................... 80	Appendix B Chapter 5 supplementary information .................................................................. 81	B.1	 Scanning electron microscopy images of Campylobacter jejuni .............................. 81	   ix List of Tables  Table 1-1 The antimicrobial effect of carvacrol and potential antimicrobial mechanism against foodborne pathogens ..................................................................................................................... 17	Table 1-2 The antimicrobial effect of ZnO NPs and possible antimicrobial mechanism against foodborne pathogens ..................................................................................................................... 18	Table 2-1 Change of viable cells of C. jejuni treated with different carvacrol concentrations over 24 hours of treatment at 37°C in a microaerobic condition .......................................................... 28	Table 2-2 Change of viable cells of C. jejuni cells treated with different concentrations of ZnO NPs over 24 hours of treatment at 37°C in a microaerobic condition .......................................... 29	Table 2-3 Change of viable cells of C. jejuni treated with carvacrol, ZnO NPs, and mixtures of the compounds after 24 hours at 37°C in a microaerobic condition ............................................. 30	Table 4-1 List of the target genes, functions, and primers sequences .......................................... 51	   x List of Figures  Figure 1-1 The biosynthesis of carvacrol and thymol (Adapted from Nhu-Trang et al., 2006) ... 10	Figure 1-2 The crystal structures of ZnO: (A) rocksalt, (B) zinc blende, and (C) wurtzite. (Adapted from Morkoç and Özgür, 2009) .................................................................................... 13	Figure 2-1 Time-kill curve for a mixture of three strains of C. jejuni treated with (A) carvacrol or (B) ZnO NPs over 24 hours at 37°C with 10% CO2 ..................................................................... 31	Figure 2-2 Comparison of time-kill curves obtained with carvacrol, ZnO NPs, and mixtures of the compounds against C. jejuni over 24 hours at 37°C under 10% CO2. In this figure, C denotes carvacrol and Z denotes ZnO NPs. ............................................................................................... 32	Figure 3-1 Raman spectral fingerprints of C. jejuni strain F38011 treated with (A) 12.5 µg/ml ZnO NPs, (B) 20.25 µg/ml carvacrol, (C) combination of carvacrol and ZnO NPs, and (D) untreated cells from 550 to 1650 cm-1 .......................................................................................... 40	Figure 3-2 Three-dimensional principal component analysis (PCA) for the segregation of C. jejuni F38011 and treated with ZnO NPs, carvacrol, and combination of carvacrol and ZnO NPs using the wavenumber region of 550 to 1650 cm-1 ....................................................................... 41	Figure 3-3 The loading plot of (A) first-, (B) second-, and (C) third-principal component of the Raman spectra from 550 to 1650 cm-1 .......................................................................................... 42	Figure 4-1 Relative gene expression of untreated C. jejuni F38011 (control) versus treated C. jejuni F38011 cells after 15 minutes of treatment. ....................................................................... 52	Figure 5-1 The putative mechanism of stress response and inactivation of C. jejuni due to the synergistic antimicrobial effect of carvacrol and ZnO NPs .......................................................... 54	  xi List of Abbreviations  APS – Average Particle Size ATR – Adaptive Tolerance Response ATP – Adenosine Triphosphate cDNA – Complementary Deoxyribonucleic Acid CFU – Colony Forming Unit CIPARS – Canadian Integrated Program for Antimicrobial Resistance Surveillance  DMSO – Dimethyl Sulfoxide DNA – Deoxyribonucleic Acid  EAFUS – Everything Added to Food in the United States EFSA – European Food Safety Authority FCS – Food Contact Surfaces FDA – Food and Drugs Administration GBS – Guillain Barré Syndrome GMP – Good Manufacturing Practices GRAS – Generally Recognized as Safe LDPE – Low-Density Polyethylene LD50 – Lethal Dose to kill 50% of population MIC – Minimum Inhibitory Concentration MBC – Minimum Bactericidal Concentration NCBI – National Center for Biotechnology Information   xii NHP – Natural Health Product NNHPD – Natural and Non-Prescription Health Product Directorate NOEL – No Observed Effect Level PBS – Phosphate Buffered Saline PCA – Principal Component Analysis PC – Principal Component RNA – Ribonucleic acid rRNA – Ribosomal Ribonucleic acid ROS – Reactive Oxygen Species RT-qPCR – Real Time Quantitative Polymerase Chain Reaction SEM – Scanning Electron Microscopy VBNC – Viable but Non-Culturable v/v – Volume by Volume w/w – Weight by Weight ZnO NPs – Zinc Oxide Nanoparticles           xiii Acknowledgements  I, wholeheartedly, would like to express my sincere gratitude to my supervisor, Dr. Xiaonan Lu for his continuous guidance, encouragement, invaluable advice, profound thoughts, and financial support, as well as believing in my abilities throughout my Master of Science program. His immense passion for research and achievements are my greatest inspiration and motivation to work hard and use the time efficiently.  I would also like to thank my committee members, Dr. Pascal Delaquis and Dr. Kingsley Amoako, who have been providing advice and support throughout this research project. Their advice and support enrich the entire story of this research project.  I am also very grateful to have met and known the research associate, other graduate and doctoral students in the Lu Laboratory, Yaxi Hu, Dr. Lina Ma, Mohammed Hakeem, Jinsong Feng, Shaolong Feng, Jiaqi Li, and Luyao Ma, for their invaluable input, technical support, and countless inspiring discussion related to my project. I also thank my buddy, Jenny Tian for her support and positive words throughout this ride. Without them, I would have not been able to complete the experiment within one year.  My sincere gratitude goes to my beloved parents and sister who continuously provide moral and financial support throughout completing my study. I would like to thank them for their unconditional love, trust, encouragement, and patience for me. Their endless love and support   xiv are the core motivation for me to dream big, always learn, explore, and sail away from the safe harbor.   Lastly, I would like to express my heartfelt gratitude and acknowledge my best friend, Jossy Sandjaja who never stops believing in my full potential and always reminds me “the sky is the limit”. I thank him for driving and accompanying me to school on the weekends and late-night and bringing out the best in me. His wisdom and emotional support are extremely valuable throughout my journey.   xv Dedication   I dedicate this thesis to my beloved parents for their unconditional love, heartfelt prayers, and endless support. They are my backbone and the greatest blessing in my life.   1 Chapter 1: Introduction, literature review, and research objectives  1.1 Introduction According to the World Health Organization, there were 582 million cases of foodborne illness in 2010 caused by  contaminated foods (Kirk et al., 2015). Amongst many foodborne pathogens, Campylobacter spp. was the 2nd leading foodborne pathogen and was responsible for 96 million cases of foodborne illness in 2010 (Kirk et al., 2015). This number only accounts for reported and diagnosed cases, but there may be many under-reported and un-diagnosed cases as well. In Canada, Campylobacter is responsible for over 145,000 cases of foodborne illness each year (Thomas and Murray, 2014). A recent report from FoodNet Canada 2014 indicated the prevalence of Campylobacter in chicken breast meat and suggested that the incidence of contamination was relatively constant from year to year (Public Health Agency of Canada, 2015). In 2014, almost half of the chicken breasts sampled in Canada tested positive for Campylobacter. In the United States, Campylobacter is included as a top five foodborne pathogen and it contributes to an estimated 12% of the total economic burden of foodborne illness and over 845,024 domestic incidences (Hoffman et al., 2015). The Centers for Disease Control and Prevention in the United States (2016) reported a 13% increase in domestic Campylobacter cases in 2013 compared to 2006 – 2008. Although Campylobacter may seem to be fragile in relation to its highly specific growth conditions, this microorganism has unique abilities to thrive in the food production environment, causing mild to life-threatening infections. Aside from foodborne illness rates, the recent annual report of the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) 2013 revealed an increasing trend of antibiotic-resistance in Campylobacter strains isolated from poultry across Canadian   2 provinces (Agunos et al., 2015). According to CIPARS, there was a 10% increase in ciprofloxacin-resistant Campylobacter isolated from poultry within the period of 2010 to 2013 (Agunos et al., 2015). The National Antimicrobial Resistance Monitoring System in the United States (2015) reported that 22% of Campylobacter strains isolated from chicken slaughter houses were resistant to ciprofloxacin, a common antibiotic used in poultry production. The emergence of resistant Campylobacter strains to common antibiotics is alarming, and poses a serious threat to the agri-food industry and public health.  Finding an alternative to conventional antibiotics is one of many possible intervention strategies to reduce the prevalence of resistant strains of C. jejuni in the agri-food system. The scientific community has been studying many alternatives to conventional antibiotics, such as bacteriophage, probiotics, and different compounds with antimicrobial properties (e.g. metals, nanoparticles, peptides, and essential oils). This study highlights the combination of two antimicrobials with different properties.  1.2 Literature review  1.2.1 Campylobacter  1.2.1.1 History and taxonomy of Campylobacter Campylobacter was first discovered in 1886 when Theodore Escherich observed a bacterium in a colon of an infant who died from cholera infantum (Altekruse et al., 1999; Butzler, 2004). This discovery was not well received by the scientific community due to the unsuccessful attempt at isolating the bacterium. In 1913, Campylobacter was isolated from the   3 tissues of aborted sheep and misidentified as Vibrio fetus by MacFayden and Stockman (Altekruse et al., 1999). This was the first successful and inadvertent attempt to isolate Campylobacter, which established Campylobacter as an animal pathogen (Crushell et al., 2004). Jones and colleagues (1931) reported an infection in calves due to a Campylobacter-like bacterium and misidentified it as Vibrio jejuni. However, the isolation of the bacterium was again unsuccessful. Doyle (1944) described a similar type of V. jejuni isolated from an infection in swine and identified the bacterium as V. coli.  The first human infection and outbreak of Campylobacter was reported in 1938 when 357 prison inmates in the United States contracted campylobacteriosis by the consumption of contaminated milk (Butzler, 2004; Miller and Mandrell, 2005). Campylobacter was reported to be the causative agent of the outbreak, but again misidentified as Vibrio (Levy, 1946). The second reported human infection involved pregnant women and the agent was misidentified as V. fetus by Vinzent and colleagues in 1947 (Butzler, 2004). King (1957) described the biochemical and serological features of V. fetus and its association with abortion in infected pregnant women and animals. Campylobacter was eventually isolated from blood and stool specimens from a patient suffering from hemorrhagic enteritis by Dekeyser and colleagues (1972), and the isolate was identified as Campylobacter jejuni (Butzler et al., 1973). Prior to 1963, Campylobacter was misidentified as Vibrio spp. and grouped under the Vibrio genus due to similar cell morphology, immunological tests, and growth conditions to V. cholera (On, 2005; Smith and Taylor, 1919). Sébald and Véron (1963) determined that the result of the oxidative-fermentative test and G+C nucleotide ratio in V. fetus and V. bubulus were different from other Vibrio-like microorganisms. Unlike other Vibrio species, V. fetus and V. bubulus did not ferment glucose; hence Sébald and Véron (1963) proposed to re-classify these   4 Vibrio-like bacteria under the genus Campylobacter into C. fetus and C. bubulus. The classification of Campylobacter spp. was then widely accepted after the development of more comprehensive biochemical and immunological tests proposed by Véron and Chatelain (1973). Since then, many isolates of Vibrio-like microorganisms were re-classified as Campylobacters, such as C. coli and C. jejuni. The advancement of selective media and genomic technology resulted in the reassignment of some Campylobacter spp. to different genera, such as Arcobacter, Helicobacter, Dehalospirillum, and Sulfurospirillium (Goodwin et al., 1989a,b; Vandamme et al., 1991; Vandamme and Goossens, 1992a, b). These genera are all from the family of Campylobacteraceae. As of 2015, the genus Campylobacter comprises 26 species and 10 subspecies (Public Health England, 2015).   1.2.1.2 Reservoirs and clinical infections caused by Campylobacter jejuni Most of the Campylobacter species isolated from enterocolitic patients since 1977 have been identified as either C. jejuni or C. coli. The advancement of culturing methods for Campylobacter using selective media enabled scientists to conduct routine diagnostic testing on human and animal specimens, and enabled further investigation of common sources and transmission routes. In the mid-1980’s, infection reports collected worldwide revealed that C. jejuni isolated from human infections were similar to those isolated from poultry, pigs, and sheep (Butzler, 2004). Since then, C. jejuni has been recognized as a zoonotic pathogen. One species (C. jejuni) is responsible for the majority of infections and outbreaks (>90%). The remaining 5-10% of outbreaks are caused by other species, such as C. coli (Scharff, 2012). On a side note, Man (2011) emphasized the importance of studying emerging   5 Campylobacter species, such as C. lari, C. fetus, and C. upsaliensis, but their rate of infection and risk to human health remains unknown. C. jejuni is transmitted through the fecal-oral route and its common reservoirs are domesticated animals, such as poultry, pigs, and cattle (Butzler, 2004; Epps et al., 2013). C. jejuni is a commensal microorganism in the gut of cattle (Cox et al., 2010) and also the predominant species found in the gastrointestinal tract of poultry and pigs (Cox et al., 2010) and other avian species (Hermans et al., 2011; Sahin et al., 2015).  C. jejuni is the most prominent species identified in human campylobacteriosis cases. C. jejuni infections in humans’ results in acute diarrhea and inflammation of the digestive tract. The infectious dose of C. jejuni ranges from 500 to 104 cells, depending upon the nature of the host. The symptoms of campylobacteriosis in humans typically develop within 2 to 5 days (Butzler, 2004; Crushell et al., 2004). Immunocompromised populations are more prone to infection than healthy individuals. Some cases of C. jejuni infection can lead to serious illnesses, such as bacteraemia, Guillain-Baré Syndrome (GBS), and Miller-Fisher Syndrome (Butzler, 2004; Crushell et al., 2004; Epps et al., 2013). GBS and other neurodegenerative or paralytic conditions occur in roughly 0.1% of cases and can lead to a lifetime disabilities (Kaldor and Speed, 1984; Rhodes and Tattersfield, 1982). In these cases, both the strain of C. jejuni and host conditions can play major roles in the incidence of GBS (Crushell et al., 2004; Nachamkin et al., 1998). Taken together, these factors make C. jejuni infections and treatment options an important subject to investigate.     6 1.2.1.3 Campylobacter jejuni: characteristics and growth requirements C. jejuni was first characterized in early 1970 when Dekeyser and colleagues were able to develop a filtration method to isolate the bacterium from fecal specimens of diarrhea patients (Butzler, 2004). C. jejuni is a non-spore forming, Gram-negative, S-shaped bacterial rod, ranging in size from 0.5- to 4.0-µm long and 0.2- to 0.9-µm wide (Cox et al., 2010). A single flagellum at either one or both ends of the cell aids in motility.  Based upon its growth characteristics, C. jejuni is considered a microaerophile (Kelly, 2008), requiring specific concentrations of CO2 (3-10%), O2 (3-5%), and N2 (80-85%) in order to multiply and perform relevant metabolic activities (Kelly, 2008). Moreover, Doyle and Roman (1982) demonstrated that temperature and pH affected the growth and survival rate of C. jejuni. The optimal growth temperature for C. jejuni is 42°C; however, it can also grow over temperature range of 30 to 42°C (Kelly, 2008; Stintzi, 2003). Hazeleger and colleagues (1998) demonstrated that temperatures below 30°C resulted in suppression of growth and the cells were unable to propagate (Boucher et al., 1994; Hazeleger et al., 1998). Cellular respiration products and ATP production has been observed at temperatures as low as 4°C, leading to the conclusion that C. jejuni is “viable but non-culturable” (VBNC) at these temperatures (Hazeleger et al., 1998; Larazo et al., 1999; Rollins and Colwell, 1986). In the laboratory setting, the optimum pH for C. jejuni growth ranges from 6.5 – 7.5 and pH of less than 4.9 or greater than 9.0 inhibits growth (Chaveerach et al., 2003; Doyle and Roman, 1982). Depending upon the strain and other environmental conditions, C. jejuni is able to survive below pH 4.9 (Axelsson-Olsson et al., 2010; Gill and Harris 1983; Shaheen et al., 2006) by developing an adaptive tolerance response (ATR) to harsh conditions (Murphy et al., 2003a,b; Reid et al., 2008; Ma et al., 2009).    7  Unlike other Gram-negative bacteria (i.e. Escherichia coli and Salmonella), C. jejuni utilizes organic acids (Vegge et al., 2009), amino acids (Guccione et al., 2008; Leach et al., 1997; Wright et al., 2009) and the intermediates of the citric acid cycle (Velayudhan and Kelly, 2002) for its metabolic activities. C. jejuni is a non-saccharolytic bacterium and several genotypic studies have confirmed the lack of genes responsible for the metabolism of carbohydrates (Gundogdu et al., 2007; Hofreuter et al., 2006; Parkhill et al., 2000). Likewise, the phenotypic study conducted by Line and colleagues (2010) confirmed the inability of C. jejuni to catabolize sugar molecules. However, a novel pathway for carbohydrate metabolism has been observed in C. jejuni (Muraoka and Zhang, 2011; Stahl et al., 2011).  1.2.1.4 Pathogenicity and virulence of Campylobacter jejuni Although C. jejuni is a microaerophile and considered fragile in an oxygenated environment, the unique ability of this microbe to survive in the environment and infect humans is complex and yet to be fully understood. The pathogenicity and virulence factors of C. jejuni are mainly related to its motility, cell adherence, and production of bacterial toxins (Young et al., 2007). Several studies have highlighted the importance of flagella in attachment, invasion, and infection by C. jejuni, and movement towards the attachment site of the host cell (Young et al., 2007). Wassenar and Blaser (1999) showed the failure of aflagellated C. jejuni mutants to attach to host cells in vitro. Similarly, Yao and others (1994) conducted an in vivo study and validated the inability of aflagellated C. jejuni mutants to invade eukaryotic cells (e.g., INT 407 cells).     8 1.2.1.5 Prevalence of Campylobacter jejuni in the agri-food system As aforementioned, C. jejuni is a commensal bacterium in the gastrointestinal tract of poultry and pigs. As few as 35 cells of C. jejuni can initiate the colonization process in the chicken gut (Stern et al., 1988). C. jejuni cells are able to multiply and predominantly colonize the cecum of broilers at levels of up to 106 to 109 colony forming units per gram (CFU/g) within 24 hours. Recent evidence suggests that the presence of amoebas was a critical component for the survival mechanism of C. jejuni in the gastrointestinal tract of broilers (Axelsson-Olsson et al., 2010; Snelling et al., 2008). The survival mechanisms of C. jejuni in the gastrointestinal tract of broilers are continuously under investigation due to the complexity and multifactorial nature of the process (Newell, 2002).  Due to its ubiquitous nature, the transmission of C. jejuni to the chicken is likely occurs in the farm environment (Agunos et al., 2014; Newell et al., 2003; Sahin et al., 2002).  Although feed and water are not the initial sources of C. jejuni, they can be contaminated by the farm environment thereby facilitating the wide spread of C. jejuni among chicken flocks (van de Giessen et al., 1998; Zimmer et al., 2003). In the case of poultry products, the mishandling of poultry carcasses in the slaughterhouse can increase the probability of cross-contamination between raw and finished product through food contact surfaces (FCS). Although processing methods (i.e. freezing, chilling, and drying) may inactivate C. jejuni, appropriate product handling and effective sanitation methods of both FCS and non-FCS need to be enforced in the processing environment. Note that C. jejuni cells have been shown to remain viable and switch to different physiological processes under harsh environmental conditions. For instance, C. jejuni was reported to form a   9 dual-species biofilm along with Pseudomonas aeruginosa as one of its survival modes (Culotti and Packman, 2015). With respect to foodborne illness outbreaks, human infections with C. jejuni are normally due to the consumption of raw or undercooked poultry products, contaminated fresh produce and water, and unpasteurized milk (Mandrell and Miller, 2006). Most foodborne outbreaks related to C. jejuni are sporadic because campylobacteriosis is usually a self-limiting disease. Hence, there may be numerous unreported cases (Mandrell and Miller, 2006).   1.2.2 Carvacrol  1.2.2.1 Chemical structure of carvacrol Carvacrol (C10H14O), 5-isopropyl-2-methylphenol is a monoterpenoid phenolic compound that is the major constituent of oregano (Origanum vulgare) (De Falco et al., 2013; Friedman et al., 2002) and thyme (Thymus vulgaris) essential oil (Fachini-Queiroz et al., 2012). Carvacrol content may differ among essential oil products depending upon plant geographical location, harvest time, part of plants used for extraction (i.e. stem or leaves), and plant health (Schmidt, 2010). From the perspective of biosynthesis, p-cymene is the natural precursor of carvacrol and thymol in the plant. The hydroxylation of p-cymene results in the formation of carvacrol and thymol, depending upon which carbon on the benzene rings receives the hydroxyl group (Figure 1-1).   10          Figure 1-1 The biosynthesis of carvacrol and thymol (Adapted from Nhu-Trang et al., 2006)  1.2.2.2 Regulation, application, and toxicity level The application of carvacrol in food products as a flavouring is approved under Everything Added to Food in the United States (EAFUS) status by the Food and Drugs Administration (FDA). The addition of carvacrol to food products must meet the criteria and serve the purpose of food additives. The European Food Safety Authority (EFSA) also approves the use of carvacrol as a food flavouring and feed additive with a maximum dose of 5 mg/kg of feed (EFSA, 2012). On the other hand, the application of carvacrol is approved and regulated under the Natural and Non-Prescription Health Products Directorate (NNHPD) in Canada as a flavour enhancer and for topical application (i.e. fragrance and skin ointment) under certain circumstances (Health Canada, 2016a). For instance, carvacrol can be used as a non-medicinal ingredient (i.e. flavour enhancer) as long as the daily usage level does not exceed 0.23 µg/kg body weight (Health Canada, 2016a). If the daily usage of carvacrol exceeds 0.23 µg/kg body   11 weight, product prescription may be required, as it is no longer considered as a Natural Health Product (NHP). The upper limit dosage of carvacrol for topical application is 0.5% (w/w) (Health Canada, 2016a). According to Jenner and others (1964), the LD50 value of carvacrol was 810 mg/kg body weight in rats, which was considered low toxicity level. Cytotoxicity effects were not observed in human cells at a maximum tested concentration of 90 µg/ml (Fachini-Queiroz et al., 2012). Currently, there is no standard and clear assessment of the recommended maximum dosage for human cells and/or the no-observed-effect-level (NOEL) of pure carvacrol.   1.2.2.3 Antimicrobial properties Interestingly, carvacrol has been widely known to exhibit antimicrobial effects against planktonic and sessile cells of many foodborne pathogenic bacteria, such as Salmonella spp. (Knowles et al., 2005; Rattanachaikunsopon and Phumkhachorn, 2010), C. jejuni (van Alphen et al., 2012), vegetative cells of Bacillus cereus (Ultee et al., 2002), Escherichia coli O157:H7 (Burt et al., 2007), and Listeria monocytogenes (Guevara et al., 2015; Perez-Conesa et al., 2011). In addition, carvacrol has also been reported to act as antiviral, antioxidant (Jayakumar et al., 2012), antiparasitic (Lei et al., 2010), and antifungal agent (Ahmad et al., 2011; Dalleau et al., 2008).  The antimicrobial effect of carvacrol has been reported to inactivate both Gram-positive and Gram-negative bacteria (Ait-Ouazzou et al., 2012). Several studies were performed to determine the mechanism of action of carvacrol against pathogenic bacteria (Ultee et al., 2002; Veldhuizen et al., 2006). Ultee et al., (2002) implied that the hydrophobic nature of carvacrol allowed it to disrupt the permeability of cell membranes and negatively affect the cell’s ion   12 gradient. Ultee and others (2002) observed the importance of the hydroxyl group in carvacrol structure by comparing the antimicrobial effect of carvacrol and cymene against vegetative cells of Bacillus cereus. The hydroxyl group of carvacrol acted as a delocalized electron system that disrupted the cell membrane potential, proton motive force system, and electron transport chain; hence it decreased the production of intracellular ATP (Ultee et al., 2002). Nonetheless, the benzene ring structure of carvacrol was also important to its antimicrobial activities (Veldhuizen et al., 2006). Table 1-1 summarizes the antimicrobial effect and potential mechanism of carvacrol action against both Gram-negative and Gram-positive bacteria.  1.2.3 Zinc oxide nanoparticles (ZnO NPs)  1.2.3.1 Structure and properties ZnO is an inorganic compound, insoluble in water, and semiconductor of electricity that possesses electrochemical-coupling, pyroelectricity, and piezoelectricity properties (Wang, 2004). It has relatively high ionic binding activity with an isoelectric point of approximately 9.5; thus solubility at biological pH values is relatively low in comparison to other organic compounds (Wang, 2004). The strong ionic bond between Zn2+ and O2- resulted in a high stability when it was subjected to high temperature and pressure (Sirelkhatim et al., 2015). ZnO has a symmetrical tetrahedral structure from a combination of Zn2+ surrounded by four O2- ions (Wang, 2004). When forming a crystal matrix, ZnO tends to pack its tetrahedral structure in a cube, forming a wurtzite, rocksalt, and zinc blende crystal structure (Figure 1-2) (Morkoç and Özgür, 2009). Zincite wurtzite crystal is the mineral form of ZnO that is found naturally on earth, and it is the most thermodynamically stable crystal form of ZnO (Morkoç and Özgür, 2009). The   13 unique crystal structures of ZnO and its properties result in many industrial applications, such as pharmaceuticals, cosmetics, agriculture, and electronics (Kolodziejczak-Radzimska and Jesionowski, 2014). Regarding pharmaceutical and cosmetics uses, ZnO is applied and well-known for its use in the sunscreen, facial powders, and body lotion products.       Figure 1-2 The crystal structures of ZnO: (A) rocksalt, (B) zinc blende, and (C) wurtzite. (Adapted from Morkoç and Özgür, 2009)  The size of nano ZnO ranges from 1 to 100 nm and the crystal morphology varies depending upon synthesis method (Jalal et al., 2010; Ma et al., 2013; Ramani et al., 2012). The shape of ZnO NPs is related to the surface area, which affects the general properties of ZnO NPs, including its antimicrobial activity (Sirelkhatim et al., 2015). Tong and colleagues (2013) suggests that large surface area can increase the antimicrobial activity of ZnO NPs due to exposure of the polar surface plane of ZnO NPs to the negatively charged bacterial cell membrane.     1.2.3.2 Regulation, application, and toxicity With respect to agricultural applications, ZnO is considered a generally recognized as safe (GRAS) food additive by FDA in the United States (21CFR182.8991). As a food additive,   14 good manufacturing practices (GMP) must be applied when adding ZnO in the foods destined for human consumption. The application of nanoparticles or nanomaterials of ZnO is evaluated on a case-by-case basis by the FDA (Zhong and Shah, 2012). In Canada, ZnO is approved for use either as medicinal or a non-medicinal ingredient under the NNHPD. When ZnO is used as a mineral, it is considered as a Natural Health Product (Health Canada, 2016b). As a non-medicinal ingredient, ZnO is approved for use as a color additive and filler for topical applications. Currently, nanotechnology (i.e. nanoparticles and nanomaterials) in foods is regulated under the Novel Food Product regulation. Health Canada requires an evaluation of the application, rationale for usage, toxicological data, and a risk assessment of the novel food product(s).  In Europe, ZnO is listed as E6 food additive for animal feeds (EFSA, 2015). A recent report published by the EFSA also highlighted the approval of nano ZnO for use in FCS material (i.e. film or plastic of the food packaging). The EFSA also indicated that nano ZnO did not migrate out of its medium, but the soluble ionic form (Zn2+) might. Emamifar and others (2011) demonstrated low levels of migration of Zn2+ ions from low-density polyethylene (LDPE) packaging into orange juice. Based upon this evaluation, the EFSA recommends 25 mg/person per day as the upper limit of ZnO NPs intakes (EFSA, 2016). Current evidence evaluating the toxicology of ZnO NPs in mammalian cells is controversial. Several studies observed cytotoxic effects towards mammalian cells (Heng et al., 2010; Wang et al., 2006; Wang et al., 2008); however, most of these toxicological studies were conducted in vitro with direct addition of ZnO NPs to the cells. Additionally, these studies did not evaluate different exposure routes of ZnO NPs and their potential biotransformation before   15 being absorbed by the cells (Espitia et al., 2012). Controversially, cytotoxic effects were not observed in other in vitro studies (Colon et al., 2006; Noyhnek et al., 2010; Reddy et al., 2007). Despite the controversy, the toxicity of ZnO NPs in mammalian cells was determined to be a function of size, shape, and concentration (Hyun-Joo et al., 2011). Further studies may need to consider and evaluate the properties of ZnO NPs, as well as its soluble ionic form while interpreting the toxicological data. Nonetheless, the ZnO NPs supplementation studies on domestic animals demonstrated beneficial effects on their immune systems (Sahoo et al., 2014) and for increasing milk production (Rajendran et al., 2013).   1.2.3.3 Antimicrobial properties The antimicrobial properties of ZnO NPs are associated with their specific high-surface-area-to-volume ratio, size of particles, and shape. Several studies have reported the antimicrobial effects of ZnO NPs against many foodborne pathogens, such as E. coli O157:H7 (Liu et al., 2009), C. jejuni (Xie et al., 2011; Lu et al., 2012), P. aeruginosa (Feris et al., 2010), Salmonella spp. (Jin and Gurtler, 2010), and Staphylococcus aureus (Navale et al., 2015). Addition of ZnO NPs has been reported to generate reactive oxygen species (ROS), causing an oxidative stress to bacterial cells (Feris et al., 2010; Kumar et al., 2011). Others have put forth the claim that ZnO NPs may cause electrostatic disruption of the outer membrane and interrupt ion of normal cell membrane functionality, resulting in the leakage of intracellular materials (Liu et al., 2009). Furthermore, the solubility of Zn2+ may potentially affect metabolic activity and inhibit the growth of bacterial cells (Song et al., 2010). Table 1-2 summarizes the potential mechanisms responsible for the antimicrobial effect of ZnO NPs against both Gram-positive and Gram-negative bacteria.   16  1.3 Research objectives The prevalence of Campylobacter particularly in poultry production, the numbers of foodborne illness caused by Campylobacter, and the emergence of antibiotic-resistant Campylobacter pose a serious threat to the health and wellbeing of our agri-food system. Therefore, there is a need to find an alternative to conventional antibiotics that can reduce the prevalence of Campylobacter in the food supply chain while eliminating the risk of antibiotic resistance. The primary objective of this thesis project was to investigate the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni. The macromolecular fingerprints and gene expression profile of C. jejuni treated with the single and combined antimicrobial agents were investigated and discussed in this thesis project. Based upon data collected, a possible mechanism of action for carvacrol and ZnO NPs against C. jejuni was established from this study.  1.4 Hypotheses  Several hypotheses were tested in this thesis project: 1. The combined treatment of carvacrol and ZnO NPs show a synergistic antimicrobial effect against C. jejuni at 37°C with 10% CO2 over 24 hours of incubation. 2. The macromolecular fingerprints of C. jejuni cells exposed to carvacrol and ZnO NPs are significantly different than those observed with either agent alone. 3. The gene expression profile of C. jejuni cells exposed to carvacrol and ZnO NPs are significantly different than those observed with either agent alone.    17 Table 1-1 The antimicrobial effect of carvacrol and potential antimicrobial mechanism against foodborne pathogens Target microorganisms Potential mechanism from the findings References C. jejuni Disruption of flagellar function motility and invasion of epithelial cells van Alphen et al., 2012 E. coli O157:H7 Disruption of flagellar synthesis, motility, and induction of heat-shock proteins Burt et al., 2007 Bacillus cereus (vegetative cells) Decreased membrane potential, disruption of proton motive force and electron transport chain, and depletion of the ATP pool Ultee et al., 1999; Ultee et al., 2002 S. Typhimurium Disintegration of cell membrane by increasing membrane permeability Lambert et al., 2001 L. monocytogenes Damage to outer cell and cytoplasmic membranes by targeting phospholipid structure at pH = 7 and protein structure at pH = 4 Ait-Ouazzou et al., 2012      18 Table 1-2 The antimicrobial effect of ZnO NPs and possible antimicrobial mechanism against foodborne pathogens  Target microorganisms Potential mechanism from the findings References C. jejuni Induced up-regulation of oxidative stress genes (katA and ahpC) and stress response genes (dnaK), causing morphological change to coccoid form, and damaging membrane integrity Xie et al., 2011 E. coli O157:H7 Electrostatic interaction, membrane damage, and leakage of intracellular materials Liu et al., 2009 P. aeruginosa Electrostatic interaction and oxidative stress response and disruption of membrane integrity Feris et al., 2010 S. aureus and S. Typhimurium Oxidative stress by the generation of ROS Navale et al., 2015   19 Chapter 2: Investigation of antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni  2.1 Introduction  Prior to investigating the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni, the determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of each compound need to be investigated. MIC is defined as the minimum concentration of an antimicrobial agent that can inhibit the growth of a particular microorganism under defined conditions over 24 hours (Koneman and Allen, 1997). MBC refers to the minimum concentration that is required to achieve a bactericidal effect of ≥99.9% cell death (Doern, 2014; Koneman and Allen, 1997). To investigate the antimicrobial effect of two or more antimicrobials in combination, several methods have been proposed, including the checkerboard assay, the fractional inhibitory concentration index, and time-kill curve (Koneman and Allen, 1997). In this project, the time-kill curve was employed to investigate the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni. Although the time-kill curve method is more laborious and time-consuming compared to other methods, this method provides a dynamic observation of the bactericidal effect of the antimicrobial agents (Doern 2014; Koneman and Allen, 1997). When combining two or more antimicrobials, there are three possible responses: additive (or indifferent), antagonistic, and synergistic. The additive antimicrobial effect refers to an equal response of the antimicrobial combination to that achieved with single antimicrobials added together (Koneman and Allen, 1997; Pillai et al., 2005). In other words, the response of   20 antimicrobial combination is autonomous. The antagonistic antimicrobial effect is observed when the response achieved with antimicrobial combination is less than the response of either single antimicrobial (Koneman and Allen, 1997; Pillai et al., 2005). The definition of synergistic antimicrobial effect is slightly different depending upon the selected method. Using the time-kill curve method, the synergistic antimicrobial effect is observed when the treatment of two or more compounds result in a minimum of a 2-log (100-fold) decrease in growth of a particular microorganism under specified conditions compared to the treatment of the most active single antimicrobial agent (Koneman and Allen, 1997; Pillai et al., 2005). In other words, the combined treatment of two or more compounds should result in at least 3-log growth inhibition of the targeted microorganism if the most active single antimicrobial agent inhibit the growth of the microorganism by 1-log unit.  2.2 Materials and methods  2.2.1 Preparation of Campylobacter jejuni overnight culture A mixture of three C. jejuni strains was used to test antimicrobial susceptibility, including strain ATCC 33560 and two clinical isolates (i.e., F38011 and human clinical 10). Each strain was cultured individually on Mueller-Hinton agar (Difco, New Jersey, USA) supplemented with 5% defibrinated sheep blood (Quad Five, Montana, USA) and incubated at 37°C for 48 hours under 10% CO2. C. jejuni colonies of each strain were inoculated into 7 ml Mueller-Hinton broth (pH = 7) (Difco, New Jersey, USA) and incubated for 18 hours at 37°C under 10% CO2 with shaking. After an overnight incubation period, each culture was adjusted to OD600nm = ~0.3 (1 × 109   21 CFU/ml) and mixed in an equal volumes. Refer to Appendix A.1 for the adjustment of cell numbers. The bacterial mixture was then diluted to ~1 × 108 CFU/ml.  2.2.2 Antimicrobial susceptibility of Campylobacter jejuni against carvacrol The macrodilution broth method adopted from the Clinical Laboratory & Standard Institute (2006) and Nature Protocols (Wiegand et al., 2008) was conducted with minor modifications. Carvacrol (purity, ≥98%; Food Chemical Codex, Food Grade) was purchased from Sigma Aldrich (Density = 0.976 g/ml; molecular weight = 150.22 g/mol). One hundred microliters of carvacrol was dissolved in 900 µl of dimethyl sulfoxide (DMSO) (Fisher Bioreagents, purity >99%) in two 1:10 (v/v) serial dilutions. From the last dilution series, carvacrol was diluted to 1 mg/ml in Mueller-Hinton broth. Six concentrations of carvacrol were prepared from the 1 mg/ml working solution to make up a final concentration of 13.5 µg/ml, 18 µg/ml, 20.25 µg/ml, 27 µg/ml, 40.5 µg/ml, and 54 µg/ml respectively, accounting for the addition of the C. jejuni cocktail. Two control groups were prepared without the addition of carvacrol, which were Mueller-Hinton broth alone and with 0.54% (v/v) DMSO. The total volume of the samples was 2 ml. Treatment and control samples were incubated at 37°C under 10% CO2 with shaking for 0, 4, 8, 12, and 24 hours. At each time point, each sample was mixed thoroughly, serially diluted in sterile 1× phosphate buffered saline (PBS) (pH = 7.4), and plated on Mueller-Hinton agar supplemented with 5% defibrinated sheep blood. Enumeration of the viable cells was performed after 48 hours of incubation at 37°C under 10% CO2. The experiment was conducted in duplicate and repeated three times.    22 2.2.3 Antimicrobial susceptibility of Campylobacter jejuni against zinc oxide nanoparticles ZnO NanoArc ZN-0605 was purchased from Alfa Aesar, Thermo Fisher Scientific Chemicals, Inc. (surface area of 12 – 24 m2/g, average particle size (APS) of 40 – 100 nm). A stock solution of 1 mg/ml ZnO NPs was prepared in Mueller-Hinton broth. A 1:10 (v/v) dilution was performed to develop a working solution of 0.1 mg/ml from which three concentrations of ZnO NPs were prepared, again accounting for the addition of the C. jejuni cell cocktail to make up a final concentration of 12.5 µg/ml, 25 µg/ml, and 50 µg/ml. Mueller-Hinton broth without ZnO NPs was prepared as a control. The total volume of the samples was 2 ml. The samples were incubated at 37°C under 10% CO2 with shaking for 0, 4, 8, 12 and 24 hours. At each time point, each sample was mixed thoroughly, serially diluted in sterile 1× PBS (pH = 7.4), and plated on Mueller-Hinton agar supplemented with 5% defibrinated sheep blood. Enumeration of the viable cells was performed after 48 hours of incubation at 37°C under 10% CO2. The experiment was conducted in duplicate and repeated three times.   2.2.4 Synergistic antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni The time-kill curve method adapted from Koneman and Allen (1997) was used to test the synergistic antimicrobial effect of ZnO NPs and carvacrol against C. jejuni. Working solutions of ZnO NPs (0.1 mg/ml) and carvacrol (1 mg/ml) were prepared separately in Mueller-Hinton broth. Two concentration combinations of carvacrol:ZnO NPs were prepared with the addition of a ~1 × 108 CFU/ml (OD600 = ~0.03) C. jejuni cocktail to make up a final concentrations of 18:12.5 µg/ml and 20.25:12.5 µg/ml. Positive control groups were prepared with the addition of   23 either carvacrol or ZnO NPs at the same concentration used in the combination. A negative control was prepared without the addition of carvacrol and (or) ZnO NPs to the C. jejuni cocktail. The total volume of the samples was 2 ml. The treatment and control groups were incubated at 37°C under 10% CO2 with shaking condition for 0, 8, 12, and 24 hours. At each time point, each sample was mixed thoroughly, serially diluted in sterile PBS, and plated on Mueller-Hinton agar plate supplemented with 5% defibrinated sheep blood. Enumeration of the viable cells was performed after 48 hours of incubation at 37°C under 10% CO2. The experiment was conducted in duplicate and repeated three times.   2.3 Results and discussion  2.3.1 Antimicrobial susceptibility of Campylobacter jejuni against carvacrol In this study, six concentrations of carvacrol ranging from 13.5 to 54 µg/ml were investigated for their antimicrobial effects against a mixture of three strains of C. jejuni. The positive control is shown as 0 µg/ml, which refers to the C. jejuni culture in Mueller-Hinton broth without the addition of carvacrol and/or DMSO (Figure 2.1). The negative control contained 0.54% (v/v) DMSO because this was the upper limit of DMSO in the carvacrol solution. The growth of C. jejuni in the control increased from ~108 to ~109 CFU/ml over 24 hours at 37°C under 10% CO2. There was no significant difference (P > 0.05) in the cell population between positive and negative control, indicating that 0.54% (v/v) DMSO did not have antimicrobial effects against C. jejuni. In other words, ≤0.54% (v/v) DMSO was not a confounding factor and it did not interfere with the effect of carvacrol in the assay. Several authors have reported that ≤1% (v/v) DMSO does not affect the visible growth of both Gram-  24 positive and Gram-negative bacteria (Basch and Gadebusch 1968; Nostro et al., 2000; Wadhwani et al, 2008).  The interaction between concentration of carvacrol and treatment time contributed to variable growth inhibition of C. jejuni over 24 hours. A concentration of 13.5 µg/ml carvacrol alone did not significantly inhibit the growth of C. jejuni over 24 hours (P > 0.05). Increasing the carvacrol concentration to 18 µg/ml resulted in inhibition of C. jejuni (Figure 2-1A). Growth of C. jejuni was inhibited for 12 hours and increased by 1-log unit after treatment with18 µg/ml carvacrol (P < 0.05). Although there was a slight decrease in C. jejuni cells treated with 20.25 µg/ml carvacrol over the first 8 and 12 hours, this treatment did not significantly (P > 0.05) lower the cell population over the full course of the experiment (Table 2-1). After 12 hours of incubation, carvacrol may be depleted in the liquid medium, resulting in a slight increase in C. jejuni cells. Also, it is possible that cells recovered from sub-lethal injuries and resumed growth. Depletion of carvacrol may also have occurred due to its volatility and the thermal-labile nature of carvacrol’s underlying terpenoid structure. Terpenoids undergo thermal degradation (McGraw et al., 1999; Turek and Stintzing, 2013) and structural re-arrangement with prolonged high-temperature incubation (Turek and Stintzing, 2013).  Based upon the growth and statistical analysis in Table 2-1 and Figure 2-1A, the MIC of carvacrol ranged from 18 to 27 µg/ml and the MBC of carvacrol was 27 µg/ml. As mentioned earlier, the growth of C. jejuni cells treated with 18 µg/ml carvacrol was inhibited, and 18 µg/ml was included in the MIC range of carvacrol. Higher concentration of carvacrol, (27 µg/ml) led to bactericidal effect and prevented growth of C. jejuni for 24 hours of incubation (P < 0.05). Exposure to ≥ 27 µg/ml carvacrol resulted in an 8-log CFU/ml killing effect against C. jejuni cells over 24 hours of incubation.    25  Several authors have reported that carvacrol was effective to cause bacteriostatic and bactericidal effect to C. jejuni in vitro (Johny et al., 2010; van Alphen et al., 2012) and in vivo (Arsi et al., 2014). The antimicrobial effects of carvacrol observed from this study were in agreement with these in vitro studies (Johny et al., 2010; Lambert et al., 2001; van Alphen et al., 2012), even though the measured MIC and MBC values were slightly different. This difference could be due to initial amount of culture, type of media, and treatment condition applied in the study.   2.3.2 Antimicrobial susceptibility of Campylobacter jejuni against zinc oxide nanoparticles  Three concentrations of ZnO NPs (12.5, 25, and 50 µg/ml) were investigated for their antimicrobial effects against the C. jejuni cocktail. The positive control was shown as 0 µg/ml in Figure 2-1B, referring to no addition of ZnO NPs. The untreated cells of C. jejuni were able to grow to approximately 8 × 109 CFU/ml. In this experiment, the growth of C. jejuni was affected by the interaction of treatment time and different concentrations of ZnO NPs. Growth of C. jejuni treated was unaffected by 12.5 µg/ml ZnO NPs. When the concentration of ZnO NPs was increased two-fold (25 µg/ml), the maximum population achieved was ~1 log CFU/ml lower than in control (Figure 2-1B). Cell population was significantly lowered by 3 log CFU/ml after 8 hours of exposure to 50 µg/ml ZnO NPs. As shown in Figure 2-1B, the cell population was lowered by ~7 log CFU/ml after 24 hours (P < 0.05). Based upon this observation, the MIC of ZnO NPs ranged from 25 to 50 µg/ml and the MBC of ZnO NPs was 50 µg/ml.   26 ZnO NPs have been shown to inhibit the growth of Gram-negative pathogenic bacteria, such as E. coli O157:H7 (Liu et al., 2009), P. aeruginosa (Azam et al., 2012), S. Typhimurium (Navale et al., 20015), and C. jejuni (Xie et al., 2011; Lu et al., 2012). The results of the current study demonstrated similar antimicrobial activity of ZnO NPs against C. jejuni. MIC values were in the same range as those reported by Xie and others (2011).  2.3.3 Synergistic antimicrobial effect of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni  The concentrations selected for each antimicrobial agent was based on prior susceptibility testing. The negative controls contained no carvacrol or ZnO NPs (Figure 2-2). The interaction between the factors treatment and time was significant (P < 0.05), implying that both factors contributed to the inhibition of C. jejuni (Table 2-3). Both concentrations of carvacrol and ZnO NPs exerted synergistic antimicrobial effect against C. jejuni over 24 hours of incubation. The first combination consisted of 20.25 µg/ml carvacrol : 12.5 µg/ml ZnO NPs and the second 18 µg/ml carvacrol : 12.5 µg/ml ZnO NPs. Both combinations exerted bactericidal effect and lowered C. jejuni cell population by ~8 log CFU/ml over 24 hours (P < 0.05). The first combination inhibited the growth of C. jejuni by an approximately 2.25-log unit within 8 hours of treatment, which was more than 100-fold cells growth inhibition than the single treatment. Similarly, the second combination treatment lowered the maximum cell population approximately 1.44 log CFU/ml within 8 hours of treatment, which was over a 2-log growth inhibition compared to the single antimicrobial treatment. When the exposure time was increased to 24 hours, both combinations resulted in the killing-effect (Figure 2-2). In contrast, the single   27 treatment exerted bacteriostatic effect and prevented the growth of cells. These results were thus indicative of a synergistic antimicrobial effect along with exposure time.   Synergy between essential oils or component of essential oils and metal oxide nanoparticles against bacteria cells was observed previously (Behzad and Sani 2016; Biasi-Garbin et al., 2015; Ghosh et al., 2013; Krychowiak et al., 2014; Scandorieiro et al., 2016). Most of these studies utilized the time-kill curve method as well to observe the synergistic antimicrobial effect and all emphasized that treatment and exposure time contribute to the synergistic antimicrobial effect. Similar to this work, Scandorieiro and colleagues (2016) observed bactericidal effect against both Gram-positive and Gram-negative multi-drug resistant bacterial over a 7-hour-incubation period when treated with sub-inhibitory concentrations of oregano essential oil and silver nanoparticles (Ag NPs).  2.4 Conclusion Treatment with carvacrol or ZnO NPs alone was observed to inhibit the growth of C. jejuni cells depending upon the concentration and treatment time. Treatment with 18 µg/ml and 20.25 µg/ml carvacrol showed bacteriostatic effect, whereas treatment with 12.5 µg/ml ZnO NPs did not show inhibition effect against C. jejuni. The combination of carvacrol (18 or 20.25 µg/ml) and ZnO NPs (12.5 µg/ml) showed synergistic antimicrobial effects against C. jejuni within 8 hours of treatment. These combinations showed bactericidal effect against C. jejuni and lowered the maximum cell population by at least more than 100-fold compared to treatment with either carvacrol or ZnO NPs. To the best of our knowledge, this study was the first one to observe the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni cells in vitro.  28  Table 2-1 Change of viable cells of C. jejuni treated with different carvacrol concentrations over 24 hours of treatment at 37°C in a microaerobic condition Carvacrol concentration (µg/ml) Change of viable cells (log10 CFU/ml) 4 hours 8 hours 12 hours 24 hours 0 -0.81 ± 0.05JKL -1.40 ± 0.14LMN -1.73 ± 0.17N -1.42 ± 0.09MN 0 [0.54% (v/v) DMSO] -0.64 ± 0.20IJK -1.64 ± 0.14MN -1.75 ± 0.08N -1.80 ± 0.09N 13.5 -0.28 ± 0.10GHIJ -0.52 ± 0.26HIJK -1.08 ± 0.39KLM -1.39 ± 0.23LMN 18 -0.04 ± 0.13GH -0.14 ± 0.49GHI -0.20 ± 0.69GHI -1.09 ± 0.17KLM 20.25 -0.01 ± 0.13GH 0.92 ± 0.28F 1.09 ± 0.15F 0.17 ± 0.30G 27 0.85 ± 0.27F 3.07 ± 0.31D 4.47 ± 0.16B 8.05 ± 0.16A 40.5 1.35 ± 0.38F 3.82 ± 0.21C 4.74 ± 0.08B 8.04 ± 0.08A 54 2.10 ± 0.14E 4.21 ± 0.21BC 8.03 ± 0.08A 8.03 ± 0.08A Change of viable cells count was calculated as difference between viable cells (log10 CFU/ml) at 0 hour and at 4, 8, 12, or 24 hours per treatment and; results are shown as mean ± standard deviation (n=3); treatment, incubation time, and interaction were significant (P < 0.05); superscript letters (A-N) show the significant differences between treatments and incubation time (P < 0.05).    29   Table 2-2 Change of viable cells of C. jejuni cells treated with different concentrations of ZnO NPs over 24 hours of treatment at 37°C in a microaerobic condition ZnO NPs concentration (µg/ml) Change of viable cells (log10 CFU/ml) 4 hours 8 hours 12 hours 24 hours 0 -0.81 ± 0.05EFG -1.36 ± 0.11FG -1.73 ± 0.17G -1.47 ± 0.15FG 12.5 -0.64 ± 0.18EF -0.76 ± 0.36EFG -1.46 ± 0.05FG -1.27 ± 0.32FG 25 0.07 ± 0.05DE 0.53 ± 0.44D 0.47 ± 0.60D 0.53 ± 0.69D 50 0.40 ± 0.28D 2.78 ± 1.44C 3.99 ± 0.34B 7.67 ± 0.16A Change of viable cells count was calculated as difference between viable cells (log10 CFU/ml) at 0 hour and at 4, 8, 12, or 24 hours per treatment and; results are shown as mean ± standard deviation (n=3); treatment, incubation time, and interaction were significant (P < 0.05); superscript letters (A-G) show the significant differences between treatments and incubation time (P < 0.05).     30  Table 2-3 Change of viable cells of C. jejuni treated with carvacrol, ZnO NPs, and mixtures of the compounds after 24 hours at 37°C in a microaerobic condition Change of viable cells count was calculated as difference between viable cells (log10 CFU/ml) at 0 hour and at 8, 12, or 24 hours per treatment and; results are shown as mean ± standard deviation (n=3); treatment, incubation time, and interaction were significant (P < 0.05); superscript letters (A-H) show the significant differences between treatments and incubation time (P < 0.05). Concentration (µg/ml) Change of viable cells (log10 CFU/ml) Carvacrol ZnO NPs 8 hours 12 hours 24 hours 0 0 -1.20 ± 0.09H -1.49 ± 0.14H -1.49 ± 0.37H 20.25 0 0.24 ± 0.51G -0.02 ± 0.37G 1.13 ± 0.20EF 18 0 -1.26 ± 0.91C -0.95 ± 0.18H 0.45 ± 0.44FG 0 12.5 -1.25 ± 0.12H -1.54 ± 0.21H -1.31 ± 0.20H 20.25 12.5 2.25 ± 0.35C 3.19 ± 0.33B 8.01 ± 0.08A 18 12.5 1.44 ± 0.68DE 1.73 ± 0.82BC 7.95 ± 0.06A 31                                           Figure 2-1 Time-kill curve for a mixture of three strains of C. jejuni treated with (A) carvacrol or (B) ZnO NPs over 24 hours at 37°C with 10% CO2    B A 32                Figure 2-2 Comparison of time-kill curves obtained with carvacrol, ZnO NPs, and mixtures of the compounds against C. jejuni over 24 hours at 37°C under 10% CO2. In this figure, C denotes carvacrol and Z denotes ZnO NPs.        33  Chapter 3: Investigation of macromolecular fingerprints of Campylobacter jejuni after treatment with carvacrol and zinc oxide nanoparticles  3.1 Introduction Raman spectroscopy was selected to investigate the effects of single or combined antimicrobial treatment on the macromolecular fingerprints of C. jejuni. The macromolecular fingerprints of C. jejuni cells can provide details in regards to changes in the chemical composition of bacterial cell membranes and cell walls after antimicrobial treatment. Raman spectroscopy is considered as a vibrational spectroscopic technique because it measures the Raman scattering effect of molecules. The principle of Raman scattering effect was first discovered by Sir Chandrasekhara Venkata Raman and Kariamanickam Srinivasa Krishnan in 1928 (Ferraro et al., 2003). This discovery led to the development of the Raman spectroscopic instrumentation. The Raman scattering effect describes difference in energy between scattered photons and the incident light beam (Banwell and McCash, 1994). When incident light collides with a molecule, photons are scattered in several different ways, depending upon its interaction with the electrons of the molecule. The collision of incident light and molecule causes the electrons to enter into an unstable excited state, which gives off a photon upon returning to its ground state, resulting in elastic scattering of photons. In this case, the energy of the scattered photons is equal to the energy of the incident light. This scattering is also referred to as Rayleigh scattering (Banwell and McCash, 1994). However, there are molecules that do not return to their ground state, but remain in a slightly higher energy state, resulting in the inelastic scattering of photons. 34  When inelastic scattering occurs, the energy of the scattered photons is no longer equal to the energy of the incident light. The energy of the scattered photons is either higher or lower than the energy of incident light. This concept is known as the Raman scattering effect (Banwell and McCash, 1994). During the collision process, some molecules do not return to their ground state because of the changes in their polarizability as a result of an induced-dipole moment (Ferraro et al., 2003). This phenomenon offers an advantage when studying the molecular properties of a compound. By using Raman spectroscopy, the information about the manners and types of vibrational modes of the molecules can be collected by measuring the difference between the energy of the scattered photons and the incident light (Ferraro et al., 2003).  Numerous studies have employed Raman spectroscopy to study bacterial stress and sub-lethal injuries as a result of treatment by conventional and natural antimicrobials. Assmann and colleagues (2015) utilized Raman spectroscopy to study the antimicrobial effect of vancomycin against Enterococcus faecalis and identified the differences between the untreated and treated cells using a cluster analysis model. In another study, Raman spectroscopy was employed to investigate the sub-inhibitory effects of amikacin and it was able to detect the different biochemical changes between treated cells with different concentrations of amikacin versus the untreated cells (López-Díez et al., 2005). Feng and colleagues (2014) utilized Raman spectroscopy to study the mode of action of garlic-derived compounds against Cronobacter sakazakii, an opportunistic pathogen found in dry infant formula. These studies have successfully applied Raman spectroscopy to evaluate biochemical variations between the treated and untreated bacterial cells.   35  3.2 Materials and methods  3.2.1 Sample preparation for Raman spectral collection C. jejuni strain F38011 was treated with carvacrol and ZnO NPs, either alone or in combination.  Treatments preparation and incubation conditions were the same as in the antimicrobial susceptibility experiment. Following 6 hours of incubation, 1 ml of each treatment was transferred to a 1.5-ml microcentrifuge tube. Samples were centrifuged at 13,000 ×g for 2 minutes for the collection of bacterial pellets. The supernatant was removed and cell pellets were washed twice with 500 µl sterile distilled deionized water to ensure minimal treatment residues. Cell pellets were then re-suspended in 10 µl of water to reach at least OD600nm = ~0.3. Bacterial samples (1µl) were transferred onto a gold-coated microarray chip (Thermo Scientific Inc., Waltham, MA). Samples on the chip were air-dried for 10 minutes before collection of Raman spectra. Each experiment was repeated in triplicate.  3.2.2 Confocal micro-Raman spectroscopy  To determine the macromolecular fingerprints of C. jejuni under the stressed and sub-lethal condition, a confocal micro-Raman spectroscopic system was used. The system includes a Leica microscope (Leica Biosystems Inc., Germany) and a Raman spectroscopic platform (Renishaw, United Kingdom). A near-infrared laser (λ = 785 nm) was used for spectral collection. Each bacterial sample prepared on the gold-coated microarray chip was placed under a standard stage of the microscope and observed using a 50× objective lens. Raman spectra of bacterial samples were collected using a 300 mW incident laser with 10-s exposure time at wavenumbers 400-3000 cm-1. Raman spectral features were collected from 5 random locations per sample cell; samples 36  were tested in triplicate. In total, 15 spectra were collected per sample. Data was collected using WiRE v.3.0 software (Renishaw, Gloucestershire, United Kingdom)   3.2.3 Raman spectral processing and chemometric analysis The Raman spectra were evaluated in the region of 550-1650 cm-1. The baseline of each spectrum collected was corrected with a fifth-order polynomial fitting, followed by a five-point boxcar smoothing using Vancouver Raman Algorithm software (The University of British Columbia). Processed spectra were normalized to the intensity at 1450 cm-1 using OMNIC v.8.2 Software (Thermo Scientific Inc., Waltham, MA). Multivariate statistical analysis was then employed to analyze the spectral data. Specifically, a principal component analysis (PCA) model was constructed using MATLAB R2016a software (MathWorks, United States) with in-house programs and codes.  3.3 Results and discussion Raman spectroscopy was utilized to determine chemical variations in bacterial cells after 6 hours of antimicrobial treatment. Sampling time points were selected based on the time-kill curve data shown in Figure 2-2, when the growth of C. jejuni cells were inhibited by 1 log CFU/ml with the combined treatment of carvacrol and ZnO NPs and the synergistic antimicrobial effect was observed. The amount of bacterial cells sampled at 6 hours was estimated to be at least 107 CFU/ml, which might have contained a mixture of healthy, dead, and injured bacterial cells.   Raman spectra for each sample were normalized based upon the prominent band at 1450 cm-1, assigned to the deformation of C-H functional groups in lipids and carbohydrates 37  (Movasaghi et al., 2007). The raw Raman spectra of the four bacterial samples appeared similar based upon visual judgement. However, several minor variations were observed in raw Raman spectra at 725, 785, 1080, and 1575 cm-1. The bands at 725, 785, and 1575 cm-1 are associated with the ring-breathing modes of DNA/RNA bases, such as adenine, cytosine, guanine, thymine, and uracil (Movasaghi et al., 2007). These bands in the spectra of C. jejuni cells treated with carvacrol or the combined treatment had a lower intensity than that in the spectra of C. jejuni cells treated with ZnO NPs only, and the untreated cells. This suggests that genetic materials in the cells are potentially being damaged or disrupted due to carvacrol alone. Furthermore, the intensity of the band at 1080 cm-1 from the spectra of C. jejuni cells treated with carvacrol or the combination treatment also appeared to be lower than that of the spectra of C. jejuni cells treated with ZnO NPs and untreated cells. This band is related to phospholipids or phosphate vibrations of the phosphodiester groups in nucleic acids (Movasaghi et al., 2007). The lipid bilayer structure of the bacterial cell membrane is comprised of approximately 40% phospholipids and the cell membrane is the first line of defence of the bacterial cells against antimicrobials. The lower intensity of the Raman spectral feature suggests that there may be changes in the phospholipid structure of the outer cell membrane which again can be primarily attributed to carvacrol. A similar observation was identified in a study conducted by Ait-Ouazzou and colleagues (2013), in which the assigned peak of 1080 cm-1 was different for the carvacrol-treated cells versus untreated cells. Ait-Ouazzou and colleagues (2013) implied that the phospholipids structure of the outer bacterial cell membrane was most likely affected by carvacrol treatment at neutral pH.  Other prominent bands appeared on each of the Raman spectrum of C. jejuni cells were assigned to 825, 850, 1004, and 1034 cm-1. The bands at 825 and 850 cm-1 are attributed to 38  phosphodiester and single bond stretching of amino acids and polysaccharides, respectively (Movasaghi et al., 2007). Bands at 1004 and 1034 cm-1 are normally shown in the spectra of most bacterial cells, which are associated with phenylalanine in the cell membrane (Movasaghi et al., 2007; Schuster et al., 2000). A three-dimensional PCA model was then constructed and showed that three tight clusters were formed using Raman spectra derived from the four C. jejuni samples. The first principal component (PC1) accounted for 55.4% of the total explained variance in the separation, while the PC2 (15.7%) and PC3 (8.5%) still attribute to some variations. The PCA model accounts for the variance of both wavenumbers and intensity of the Raman spectra, which are attributed to different functional groups and their concentration, respectively. Untreated cells and cells treated with ZnO NPs overlapped significantly with each other and they were clearly separated from the clusters of C. jejuni cells treated with carvacrol or the combinational treatment (Figure 3-2). This clustering analysis implied that carvacrol had more of a role in the synergistic antimicrobial effect against C. jejuni than ZnO NPs. The absolute coefficients in the loading plot showed the wavenumbers that contributed to the variances in the Raman spectroscopic-based PCA model (Figure 3-3). According to PC1, PC2, and PC3 on the loading plot, the wavenumbers 725, 785, 1004, 1080-1090, 1215-1242, 1478, and 1572-1578 cm-1 contributed most to the variances that segregate the C. jejuni samples into three clusters. These wavenumbers are associated with the changes in the nucleic acids (725, 785, 1572-1578 cm-1), carbohydrates (1082 cm-1), lipids (1080 and 1083-1090 cm-1), and proteins (1004, 1215-1242, and 1478 cm-1) of the bacterial cells (Movasaghi et al., 2007; Talari et al., 2015). The vibrational modes in the lipid structures may be associated with phospholipids (1,080 cm-1), C-C or PO2- stretch (1087 – 1090 cm-1), and C-C vibration in the acyl backbone in 39  the lipid structure (1081 and 1087 cm-1) on the outer membrane of C. jejuni (Schuster et al., 2000; Movasaghi et al., 2007; Talari et al., 2015). The protein bands are associated with the phenylalanine (1004 cm-1), amide III, C-N, and C=N=C stretching (1215-1242 and 1478 cm-1) (Movasaghi et al., 2007) that are potentially contributing to the outer membrane as glycosylated extracellular proteins and capsular lipopolysaccharide of C. jejuni (Moran et al., 1991).  3.4 Conclusion The macromolecular fingerprints of C. jejuni cells treated with the combined treatment of 20.25 µg/ml of carvacrol and 12.5 µg/ml of ZnO NPs were different from the cells treated with the 12.5 µg/ml ZnO NPs alone and the untreated cells. The cells treated with the combined treatment could not be segregated from the cells treated with 20.25 µg/ml carvacrol. Based upon the macromolecular fingerprints, the majority of the synergistic antimicrobial effect against C. jejuni can be attributed to carvacrol. Based on altered band patterns, carvacrol most likely disrupts genetic material and causes changes to the phospholipids of the outer cell membrane. Therefore, the mechanism of the synergistic antimicrobial effect of carvacrol and ZnO NPs potentially includes both internal and external cellular damage.  40  Figure 3-1 Raman spectral fingerprints of C. jejuni strain F38011 treated with (A) 12.5 µg/ml ZnO NPs, (B) 20.25 µg/ml carvacrol, (C) combination of carvacrol and ZnO NPs, and (D) untreated cells from 550 to 1650 cm-1 A B C D 41           Figure 3-2 Three-dimensional principal component analysis (PCA) for the segregation of C. jejuni F38011 and treated with ZnO NPs, carvacrol, and combination of carvacrol and ZnO NPs using the wavenumber region of 550 to 1650 cm-1    42   Figure 3-3 The loading plot of (A) first-, (B) second-, and (C) third-principal component of the Raman spectra from 550 to 1650 cm-143  Chapter 4: Investigation of the gene expression profile of Campylobacter jejuni after treatment with carvacrol and zinc oxide nanoparticles  4.1 Introduction Real-Time Quantitative PCR (RT-qPCR) allows us to see a specific region of nucleic acids in a particular sample being amplified in real time. In conventional PCR, the first process is the denaturation of double stranded DNA where a high temperature is used to dissociate double stranded DNA into single stranded DNA. The second step is called “annealing”, where a specific primer binds to the specific region of a template DNA. Finally, the polymerase continues the process by adding the subsequent sequences of DNA template in the direction of 3’ to 5’, resulting in amplicons as the PCR products. In the RT-qPCR, hydrolysis probe (e.g. Taqman polymerase) and double-stranded DNA-intercalating dye (e.g. SYBR Green I dye), are the two common assays used to detect and quantify the amount of amplicons (Arya et al., 2005; Navarro et al., 2015).  The hydrolysis probe assay utilizes a single stranded DNA probe that is attached to the fluorescence molecule at a terminal base and quencher molecule at the other terminal base to generate fluorescence signals. When both molecules are attached onto the probe, the quencher absorbs the fluorescence as long as they are in close proximity to each other. In the annealing step, both primer and probe attach onto their complementary sites on the DNA template strand. As aforementioned, the polymerase will add complementary nucleotides; however, it also has a 3’-5’ exonuclease activity engineered into it. This additional feature digests the double stranded DNA sites, replaces it with the new nucleotides, and breaks down the oligonucleotide probe. This causes a release of the fluorophore and quencher into solution. As a result, the fluorophore 44  is no longer quenched, allowing fluorescence to occur when excited with the appropriate incident light. For each amplification process of a single stranded DNA, a fluorescence molecule is released from its neighbouring quencher. Therefore, the fluorescence intensity is equivalent to the number of amplicons produced.  Conversely, the SYBR Green I dye does not require a sequence-specific probe design. During the denaturation process in PCR, the SYBR Green I dye cannot bind tightly to the single strand of DNA, resulting in a very low and negligible fluorescence signal. The annealing and polymerization steps of PCR results in generation of double-stranded DNA to which the SYBR Green I dye tightly intercalates along DNA’s minor grove. When the SYBR Green I dye binds to the double stranded DNA, it produces a strong fluorescent signal that is detected in the qPCR instrument. This fluorescence signal is equivalent to the number of amplicons produced during the PCR reaction. Note that SYBR Green dye I can bind to any double stranded DNA, including non-specific amplicons (i.e. primer dimers). Post amplification process, a melting curve (fluorescence reported versus temperature) is generated to ensure the specificity of the assay. In this study, the SYBR Green I dye RT-qPCR assay was utilized to determine the relative quantity of target gene expression in C. jejuni after treatment with carvacrol and ZnO NPs, either alone or in combination.   4.2 Materials and methods  4.2.1 Ribonucleic acid sample preparation C. jejuni strain F38011 was treated with carvacrol, ZnO NPs, and a combination of carvacrol and ZnO NPs tested previously. C. jejuni strain F38011 overnight culture was adjusted to OD600nm = 45  ~0.3 (~109 CFU/ml) and diluted to ~1 × 107 CFU/ml in Mueller-Hinton broth. This culture was then incubated at 37°C with 10% CO2 for 4 hours to obtain 1 × 108 CFU/ml. At this point, the antimicrobial treatments were then introduced to the C. jejuni culture and incubated for 15 minutes. The treatment preparation and incubation conditions were the same as the antimicrobial susceptibility experiments. A positive control of C. jejuni cells treated with 6.25 µg/ml of tetracycline was prepared using Mueller-Hinton broth as the solvent. After 15 minutes of incubation, 1 ml of each treatment was transferred to a 1.5-ml microcentrifuge tube. The bacterial samples were centrifuged at 12,000 ×g for 2 minutes to collect bacterial cell pellets. The supernatant was discarded and the bacterial cell pellets were washed twice using 500 µl of sterile distilled deionized water to ensure minimal residues of treatment. The total RNA was extracted from each sample using a GENEzol TriRNA Pure Kit GZX050 from Geneaid Biotech Ltd., New Taipei City, Taiwan. The procedure of RNA extraction followed the protocol, which was provided by the kit with some modification. Nanodrop1000 spectrophotometer (Thermofisher, Massachusetts, USA) was utilized to quantify the amount and quality of the RNA after extraction. RNA samples were run on a 1.5% agarose gel to confirm the RNA quality as well.     4.2.2 Synthesis of complementary deoxyribonucleic acid (cDNA) Synthesis of cDNA was carried out using a Superscript VILO cDNA Synthesis kit (Invitrogen, California, USA). The amount of RNA was standardized to ~500 ng copies for generating the first-strand of cDNA. Each 20-µl reaction mixture contained 4 µl of 5× VILO Reaction Mix, 2 µl 10× SuperScript Enzyme Mix, ~2 µl of RNA sample, and ~12 µl of DNA/RNAse free water. Each sample tube was mixed gently and kept in an ice bath. The cDNA synthesis program was 46  25°C for 10 minutes, 42°C for 60 minutes, and then terminated at 85°C for 5 minutes. The cDNA samples were kept at 4°C for further usage.   4.2.3 Real-time quantitative polymerase chain reaction (RT-qPCR) The cDNA samples were diluted to a ratio of 1:500 (v/v) in DNA/RNAse free water. RT-qPCR reagent used was from Applied Biosystems Power SYBR Green PCR Master Mix (Thermofisher, Massachusetts, USA) and the instrument used was a ABI Prism 7000 Fast Instrument (Life Technologies, California, USA). Primer3-BLAST software (NCBI, Maryland, USA) was utilized to design the forward and reverse primers. Table 3-1 shows a complete list of the sequence of primers. Each 25-µl of reaction contained 12.5 µl of 2× SYBR Green PCR Master Mix, 0.5 µM of each primer, 2 µl of DNA template, and 10.4 µl of nuclease-free water. The amplification program was 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The melting curve stage was performed continuously at 95°C for 30 seconds and 60°C for 15 seconds. The experiment was prepared in triplicate and repeated at least for three times.  4.2.4 Data analysis The rpoA gene served as a reference gene for data normalization. The relative quantity of gene expression data was analyzed using a comparative threshold cycle (2-∆∆CT) method, where CT is the critical threshold cycle value for the amplified gene. The following expression was applied to analyze the data: ∆∆CT = ∆CT(treated sample) - ∆CT(untreated sample) and ∆CT = CT(target gene) - CT(rpoA). The result was analyzed using a two-tailed t-test to compare the pair means 47  between the treatment with α value of 0.05 with at least equal to or greater than 2-fold change in the relative gene expression.  4.3 Results and discussion  The investigation of the gene expression profile of C. jejuni F38011 cells involved a quantitative analysis of relative gene expression pattern between the pairs of treatment groups. Twelve target genes were selected and grouped into four categories based upon the functional class of each gene. These four categories include genes responsible for housekeeping, oxidative stress defense, general stress response, and pathogenicity (e.g., adherence and virulence). The relative expression of these 12 target genes was compared to the expression of the reference gene (i.e., rpoA). Ritz and others (2009) validated that the transcription level of rpoA in C. jejuni was relatively constant either under normal physiological conditions or stressed conditions (Ritz et al., 2009). This reference gene is responsible for synthesizing the alpha subunit of RNA polymerase which is required for initiating transcription in the cells. Therefore, rpoA gene is a suitable reference gene to study the stress response profile of C. jejuni.  The results in Figure 4-1 showed that the gene expression of untreated C. jejuni cells was essentially the same as the C. jejuni cells treated with 0.54% (v/v) DMSO (P < 0.05). Therefore, 0.54% (v/v) DMSO was not considered as a confounding factor when examining the subsequent data.  In contrast, the expression of thiC, katA, sodB, dnaK, mreB, cmeC, and clpA of C. jejuni cells treated with 6.25 µg/ml of tetracycline was significantly down-regulated by 2-fold (P < 0.05) compared to the untreated C. jejuni cells and other treatment groups. The susceptible break-point of tetracycline was ≤ 4 µg/ml (FDA 2010; CIPARS 2013) and therefore a slightly higher concentration of the susceptible break-point was selected as the positive control treatment.  48  This gene expression profile suggests that C. jejuni F38011 might have a different stress response when treated with 6.25 µg/ml tetracycline. Tetracycline may have a different mechanism of action compared to carvacrol. Therefore, most of the stress response genes (dnaK, mreB, cmeC, clpA) were affected in a different direction than the cells treated with carvacrol alone or the combinational treatment.   In the current study, the general stress response genes (dnaK, grpE, and groEL) were 4.7 to 5.4-fold up-regulated in C. jejuni cells (P < 0.05) treated with 20.25 µg/ml carvacrol and the combination of 20.25-µg/ml carvacrol with 12.5 µg/ml ZnO NPs. However, the level of dnaK and grpE expression between the cells treated with carvacrol and the combinational treatment were not significantly different (P > 0.05). Although the level of groEL expression was statistically different (P < 0.05), there was only 1-fold change in groEL expression level between these treatments, and thus the difference was not relevant in this situation. These targeted genes (dnaK, grpE, and groEL) are mostly associated with the global stress response and the synthesis of heat-shock proteins (DnaK, GrpE, and GroEL), which are critical to assisting the cells in preventing degradation, or aggregation of proteins, as well as maintaining cytosolic activity in the Gram-negative bacteria (Arsène et al., 2000; Hayes and Dice, 1996; Mayhew et al., 1996). The up-regulation of dnaK, grpE and groEL indicates an increasing production of heat-shock proteins, indicating the C. jejuni cells were experiencing stressful conditions (Garbe, 1992).  Reid and colleagues (2008) demonstrated that dnaK, grpE, and groEL were highly up-regulated in response to an acidic environment. These general stress response genes were also induced in C. jejuni cells under starving conditions (Klančnik et al., 2006). A recent study of the synergistic antimicrobial effect of carvacrol and cinnamaldehyde against Acinetobacter 49  baumannii observed similar up-regulation of dnaK and groEL in the cells treated with the combined treatment and carvacrol alone (Montagu et al., 2016). Similarly, Burt and colleagues (2007) observed a high level of GroEL protein production in E. coli cells treated with carvacrol. Both A. baumannii and E. coli are opportunistic Gram-negative pathogenic bacteria that share similar genetic profiles of 16S rRNA to C. jejuni. That aside, the up-regulation of dnaK, grpE and groEL may indicate that carvacrol treatment induces stress conditions to C. jejuni cells. The misfolding and/or disaggregation of protein on the outer membrane of the cells might possibly occur in the C. jejuni cells treated with the combinational treatment and carvacrol alone.   Conversely, none of the oxidative stress response genes were significantly changed for C. jejuni cells treated with 12.5 µg/ml ZnO NPs, 20.25 µg/ml carvacrol and the combination of antimicrobials (P > 0.05). This conflicts with the results of another study which showed high expression levels of katA and ahpC in C. jejuni cells treated with ZnO NPs (Xie et al., 2011). The conflicted result may be due to the difference in the applied concentration and the shapes of the ZnO NPs used to treat C. jejuni cells, the selected strain of C. jejuni, different primers sequence for katA and ahpC, and the use of a different RT-qPCR assay (SYBR Green versus TaqMan). Xie and others (2011) treated C. jejuni cells with 0.1 mg/ml of ZnO NPs for the gene expression analysis, which was approximately 10 times higher than the concentration used in our current study. The treatment of 12.5 µg/ml ZnO NPs did not result in a killing-effect against C. jejuni cells, whereas 1 mg/ml ZnO NPs resulted in a lethal-effect to C. jejuni cells. The shape and surface area of ZnO NPs also contribute to the antimicrobial activity against pathogenic bacteria (Ma et al., 2013; Stanković et al., 2013; Talebian et al., 2013). Xie and colleagues (2011) used larger surface area (35 m2/g) of ZnO NPs and smaller size of nanoparticles (~30 nm) than the surface area (12 – 24 m2/g) and size (40 – 100nm) of this study. As aforementioned, the 50  shape of ZnO NPs depends on the synthesis process of nanoparticles (Jalal et al., 2010; Ramani et al., 2012). This study purchased a commercial ZnO NPs powder, thus the shape and synthesis process of ZnO NPs was proprietary. One pitfall of the RT-qPCR technique is that it does not provide a whole genomic profile that includes all possible genes of C. jejuni. It might be possible that the target genes responsible for the stress response of C. jejuni cells against ZnO NPs were not covered in this study. For instance, the putative zinc transporter genes of C. jejuni (ZnuABC and ZnuT) may have a role in the stress response profile of C. jejuni treated with ZnO NPs; however, these putative genes were not included due to unclear characterization of zinc metabolism in C. jejuni (Stahl et al., 2012). Further analysis using whole transcriptome shotgun sequencing (RNA-seq) may provide a comprehensive understanding of the whole transcriptional level of C. jejuni cells after treatment with the combinational antimicrobial treatment versus the single antimicrobial treatment.  4.4 Conclusion  The expression levels of the general stress response genes, dnaK, grpE, and groEL were highly up-regulated in the gene expression profile of C. jejuni cells after treatment with carvacrol alone and the combination of 20.25 µg/ml carvacrol and 12.5 µg/ml ZnO NPs. None of the targeted genes had altered expression levels in C. jejuni cells treated with ZnO NPs alone. Based upon this gene expression profile, carvacrol may play a major role in the putative mechanism of the action of the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni by inducing the expression level of heat-shock related-genes.    51  Table 4-1 List of the target genes, functions, and primers sequences Function Gene Primer Primer Sequence (5’- 3’) Reference Housekeeping          RNA polymerase A,      initiation of transcription rpoA F CGAGCTTGCTTTGATGAGTG Ritz et al., 2009 R AGTTCCCACAGGAAAACCTA      Involved in thiamin      biosynthesis pathway thiC F TTATCTTTGGGCGATGCTTT Ritz et al., 2009 R CATCCCAAGCCCTTTGAGTA Oxidative stress          Catalase, defence      against hydrogen peroxide katA F CAAACAGCTATGATAATAGCC Haddad et al., 2012 R GGAGCATATCTTTGTGCTACG      Superoxide dismutase,      defence against superoxide sodB F TGGCGGTTCATGTCAAAGTA Xie et al., 2011 R ACCAAAACCATCCTGAACCA      Alkyl hydroxyperoxide      reductase, defence      against hydroperoxides ahpC F CGTTCTTGCTTGATGCTGAT This study R CAGGACAAACTTCACCATGC General stress response          Chaperone, chaperonin,      heat shock protein dnaK F CGGTATGCCACAAATCGAAG Xie et al., 2011 R GCTAAGTCCGCTTGAACCTG     Rod-shape determinant mreB F GAGCCTTCTGTTGTGGCAGTT Xie et al., 2011 R AGCGGATCATTTTTTCAGTCAT      Multidrug efflux pump cmeC F CAAGCTGCTGCTCAATTAGG This study R TCGATTGCTTGGAGCATTTA      ATP-dependent ClpAP      protease, abnormal      protein degradation clpA F GGCTCATCCTGATTTAAGCAA This study R ACCAAGCTCATTGCTTTCTTT      Chaperone, chaperonin,      heat shock protein grpE F GTGCAAACGCTGAATTTGA This study R TCATCTTGGCATTCGACATT     Chaperonin, heat-shock      protein groEL F TATGGGCGCTTCACTTGTAA This study R CCTCGATAGGATTTGCACCT Virulence          Adhesion fibronectin      binding protein cadF F TTCTATGGTTTAGCAGGTGGAG Koolman et al., 2016 R TTACACCCGCGCCATAAT      Formation and      expression of flagellin flaA F GTTGCTCATCCATCGCTTTA This study R TGGCGATAGCAGATTCTTTG  52     Figure 4-1 Relative gene expression of untreated C. jejuni F38011 (control) versus treated C. jejuni F38011 cells after 15 minutes of treatment. Data were analyzed using the comparative critical threshold (∆∆CT) method. A ratio greater than one (>1) indicates up-regulation of gene expression and a ratio below one (<1) indicates down-regulation. *Targeted gene of the treatment was significantly different than the control (P < 0.05) 53  Chapter 5: The putative mechanism of the action of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni, conclusion, and future research  5.1 The putative mechanism of the action of carvacrol and zinc oxide nanoparticles against Campylobacter jejuni Figure 5-1 shows the putative mechanism of action of carvacrol and ZnO NPs against C. jejuni over 24 hours. This putative mechanism is derived from the summary of macromolecular fingerprints and gene expression profile of C. jejuni cells after the combined treatment, as well as scanning electron microscopy (SEM) observations (Figure B.1). Within 15 minutes, the expression level of the general response genes (dnaK, grpE, and groEL) significantly increased. Over 6 hours of treatment carvacrol may contribute to chemical changes in C. jejuni cells, which was indicated by segregation on the PCA model and Raman spectral features. Carvacrol may affect phospholipids structure on the outer cell membrane and disrupt the DNA/RNA-base materials in C. jejuni cells. Additionally, the SEM images (Figure B.1) reveal that leakage of intracellular material may occur in cells after 6 hours of treatment. ZnO NPs were observed to attach onto the surface of C. jejuni cells, which potentially induced a morphological change (Figure B.1). In this case, ZnO NPs were hypothesized to amplify the killing-effect of carvacrol against C. jejuni between 6 to 24 hours of incubation by damaging the outer cell membrane, resulting in bacterial inactivation. The synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni was observed within 8 hours of treatment based upon the time-kill curve and it became more evident with a prolonged incubation time of 24 hours. In the current study, the role of ZnO NPs was not well observed in the macromolecular fingerprints and gene expression profile of C. jejuni possibly due to potentially low or non-54  inhibitory concentration of ZnO NPs tested and limited sampling of the time-points. The ZnO NPs concentrations used for treatment in the current study were very low, which may make it difficult to resolve their effects on the macromolecular fingerprints and gene expression profiles. Several studies had shown that ZnO NPs induce morphological changes on the cell surface, increased membrane permeability, and elevated oxidative stress (Xie et al., 2011; Liu et al., 2009).  Figure 5-1 The putative mechanism of stress response and inactivation of C. jejuni due to the synergistic antimicrobial effect of carvacrol and ZnO NPs   5.2 Conclusion In this thesis project, the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni was demonstrated for the first time using the time-kill curve. The putative mode of action of carvacrol and ZnO NPs was developed for the first time based upon the macromolecular fingerprints and gene expression profiles that were observed. The macromolecular fingerprints of C. jejuni cells treated with the combined treatment could be 55  segregated from the cells treated with ZnO NPs and the untreated cells, but clustered together with the cells treated with carvacrol alone. A similar pattern was also observed in the gene expression profile, in which gene expression of C. jejuni cells treated with carvacrol had similar up-regulation of dnaK, groEL, and grpE as cells subjected to the combined treatment. Based upon the macromolecular fingerprints and gene expression profiles, carvacrol was likely to be the major contributor to antimicrobial activity and the synergistic effect. Further studies on physiological and morphological aspects may be conducted to evaluate the role of ZnO NPs in the inactivation of C. jejuni.  The results from this study provide fundamental knowledge to understand bacterial inactivation and stress response consequent to synergistic antimicrobial treatment with an essential oil and metal oxide nanoparticles. This antimicrobial combination may potentially be utilized as an intervention strategy to reduce the prevalence of C. jejuni in the environment and the agri-food system as a whole.   5.3 Future research The current study adopted the time-kill curve to evaluate the synergistic antimicrobial effect of two compounds. Future studies may need to adopt different methods (e.g., checkboard assay) and compare the results to provide a more comprehensive evaluation of the synergism. Future work should also investigate the morphological and physiological aspects of C. jejuni cells under the stress of an antimicrobial agent, as well as its phenotypic characteristics, to generate a comprehensive overview of the possible mechanism of the action of these two antimicrobial agents. Understanding the multilayer mechanism of the presentation of bacterial 56  stress due to a synergistic effect of two antimicrobials is important to develop the most effective and beneficial intervention strategies to inactivate C. jejuni. Note that this study documented the synergistic antimicrobial effect of carvacrol and ZnO NPs against C. jejuni in vitro. In a real situation, the most effective delivery system for these two antimicrobials with different properties and natures would need to be considered before conducting an in vivo study. Perhaps a nano-emulsion of carvacrol coated with ZnO NPs may be worth investigation as a delivery system for the in vivo study in the hope of using these antimicrobials for application in food packaging materials and food contact surfaces.   57  Bibliography  Agunos, A., Waddell, L., Leger, D., Taboada, E., 2014. A systematic review characterizing on farm sources of Campylobacter spp. for broiler chickens. PLoS One. 9, e104905  Agunos, A., Avery, B., Deckert, A., Finley, R., Gow, S., Parmley, J., 2015. Antimicrobial Resistance. In Public Health Agency of Canada (ed), Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) Annual Report 2013. ISSN: 1925-9859  Ahmad, A., Khan, A., Akhtar, F., Yousuf, S., Xess., I., Khan, L. A., Manzoor, N., 2011. Fungicidal acitivity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur. J. Clin. Microbiol. Infect. Dis. 30, 41-50  Ait-Ouazzou, A., Espina, L., Gelaw, T. K., de Lamo-Castellvi, S., Pagan, R., Garcia-Gonzalo, D., 2012. New insights in mechanisms of bacterial inactivation by carvacrol. J. Appl. Microbiol. 114, 173-185  Altekruse, S.F., Stern, N.J., Fields, P.I., Swerdlow, D.L., 1999. Campylobacter jejuni—an emerging foodborne pathogen. Emerg. Infect. Dis. 5, 28–35. doi:10.3201/eid0501.990104  Arsène, F., Tomoyasu T., Bukau, B., 2000. The heat shock response of Escherichia coli. Int. J. Food Microbiol. 55, 3-9  Arsi, K., Donoghue, A. M., Venkitanarayanan, K., Kollanoor-Johny, A., Fanatico, A. C., 2014. The efficacy of the natural plant extracts, thymol and carvacrol against Campylobacter colonization in broiler chickens. J. Food Safety. 34, 321-325  Arya, M., Shergill, I. S., Williamson, M., Gommersall, L., Arya, N., Patel, H. R. H., 2005. Basic principles of real-time quantitative PCR. Expert Rev. Mol. Diagn. 5(2), 209-219   58  Assmann, C., Kirchhoff, J., Beleites, C., Hey, J., Kostudis, S., Pfister, W., Schlattmann, P., Popp, J., Neugebauer, U., 2015. Identification of vancomycin interaction with Enteroccocus faecalis within 30 min of interaction time using Raman spectroscopy. Anal. Bioanal. Chem. 407, 8343-8352  Axelsson-Olsson, D., Svensson, L., Olofsson, J., Salomon, P., Waldenström, J., Ellström, P., Olsen, B., 2010. Increase in acid tolerance of Campylobacter jejuni through coincubation with Amoebae. Appl. Environ. Microbiol. 76(13), 4194-4200  Azam, A., Ahmed, A. S., Oves, M., Khan, M. S., Habib, S. S., Memic, A., 2012. Antimicrobial activity of metal oxide nanoparticles against Gram-positive and Gram-negative bacteria: a comparative study. Intl. J. Nanomedicine. 7, 6003-6009  Banwell, C. N., McCash, E. M., 1994. Fundamentals of Molecular Spectroscopy, fourth ed. McGraw-Hill Book Company, Berkshire  Basch, H., Gadebusch, H. H., 1968. In vitro antimicrobial activity of dimethylsulfoxide. Appl. Microbiol. 16(12), 1953-1954  Behzad, J., Sani, A. M., 2016. Antimicrobial effect of nanofluid including zinc oxide (ZnO) nanoparticles and Trachyspremum copticum essential oils on foodborne pathogens. Biotechnol. Ind. J. 12(6), 101  Biasi-Garbin, R. P., Otaguiri, E. S., Morey, A. T., da Silva, M. F., Morguette, A. E. B. Lancheros, C. A. C., Kian, D., Perugini, M. R.E., Nakazato, G., Duran, N., Nakamura, C. V., Yamauchi, L. M., Yamada-Ogatta, S. F., 2015. Effect of eugenol against Streptococcus agalactiae and synergistic interaction biologically produced silver nanoparticles. J. Evid. Based Complementary Altern. Med. 2015, 861497   59  Boucher S. N., Slater, E. R., Chamberlain, A. H., Adams, M. R., 1994. Production and viability of coccoid forms of Campylobacter jejuni. J. Appl. Bacteriol. 77(3), 303-307  Burt, S. A., van der Zee, R. Koets, A. P., de Graaff, A. M., van Knapen, F., Gaastra, W., Haagsman, H. P., Veldhuizen, E. J. A., 2007. Carvacrol induces heat shock protein 60 and inhibits synthesis of flagellin in Escherichia coli O157:H7. Appl. Environ. Microbiol. 73(14), 484-490  Butzler, J. P., Dekeyser, P., Detrain, M., Dehaen, F., 1973. Related vibrio in stools. J. Pediatr. 82, 493–495  Butzler, J. P., 2004. Campylobacter, from obscurity to celebrity. Clin. Microbiol. Infect. 10, 868–876. doi:10.1111/j.1469-0691.2004.00983.x  Centers for Disease Control and Prevention. 2016. FoodNet 2013 Annual Report. Retrieve from: http://www.cdc.gov/foodnet/reports/annual-reports-2013.html  Chaveerach, P., ter Huurne, A. A. H. M., Lipman, L. J. A., van Knapen, F., 2003. Survival and resuscitation of ten strains of Campylobacter jejuni and Campylobacter coli under acid conditions. Appl. Environ. Microbiol. 69(1), 711-714  Clinical and Laboratory Standards Institute. 2006. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline. M45-A. Clinical and Laboratory Standards Institute, Wayne, PA  Colon, G., Ward, B. C., Webster, T. J., 2006. Increased osteoblast and decreased Staphylococcus epidermidis functions on nanophase ZnO and TiO2. J. Biomed. Mater. Res. A. 78A(3), 595-604   60  Cox, N. A., Richardson, L. J., Musgrove, M. T., 2010. Campylobacter jejuni and other Campylobacters. In: Juneja, V. K., Sofos, J. N. (Ed.), Pathogens and Toxins in Foods: Challenge and Interventions. ASM Press, Washington  Crushell, E., Harty, S., Sharif, F., Bourke, B., 2004. Enteric Campylobacter: Purging Its Secrets? Pediatr. Res. 55, 3–12. doi:10.1203/01.PDR.0000099794.06260.71  Culotti, A., Packman, A. I., 2015. Pseudomonas aeruginosa facilitates Campylobacter jejuni growth in biofilms under oxic flow conditions. FEMS Microbiol. Ecol. 91(12), fiv136  Dalleau, S., Cateau, E., Berges, T., Berieaud, J. M., Imbert, C., 2008. In vitro activity of terpenes against Candida biofilms. Int. J. Antimicrob. Ag. 31, 572-576  De Falco, E., Mancini, E., Roscigno, G., Mignola, E., Taglialatela-Scafati, O., Senatore, F., 2013. Chemical Composition and Biological Activity of Essential Oils of Origanum vulgare L. subsp. vulgare L. under Different Growth Conditions. Molecules. 18, 14948–14960. doi:10.3390/molecules181214948  Dekeyser, P., Gossuin-Detrain, M., Butzler, J. P., Sternon, J., 1972. Acute enteritis due to a related vibrio: first positive stool cultures. J. Infect. Dis. 125, 390–392  Doern, C. D., 2014. When does 2 plus 2 equal 5? A review of antimicrobial synergy testing. J. Clin. Microbiol. 52(12), 4124-4128  Doyle L. P., 1944. A vibrio associated with swine dysentery. Am. J. Vet. Res. 5, 3–5  Doyle, M.P., Roman, D.J., 1982. Response of Campylobacter jejuni to Sodium Chloride. Appl. Environ. Microbiol. 43, 561–565.  61  EAFUS: A Food Additive Database. Centre for Food Safety and Applied Nutrition, U.S. Food and Drug Administration: Washington, DC, USA, 2006  EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP); Scientific Opinion on the safety and efficacy of phenol derivatives containing ring-alkyl, ring-alkoxy and side-chains with an oxygenated functional group (chemical group 25) when used as flavourings for all species. EFSA Journal 2012;10(2):2573. doi:10.2903/j.efsa.2012.2573  EFSA FEEDAP Panel (EFSA Panel on Additives and Products or Substances used in Animal Feed). 2015. Scientific Opinion on the safety and efficacy of zinc compounds (E6) as feed additives for all animal species (zinc acetate, dihydrate; zinc chloride, anhydrous; zinc oxide; zinc sulphate, heptahydrate; zinc sulphate, monohydrate; zinc chelate of amino acids, hydrate; zinc chelate of glycine, hydrate), based on a dossier submitted by FEFANA asbl. EFSA Journal 2015; 13(4):4058  EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids). 2016. Scientific opinion on the safety assessment of the substance zinc oxide, nanoparticles, for use in food contact materials. EFSA Journal 2016;14(3):4408  Emamifar, A., Kadivar, M., Shahedi, M., Soleimanian-Zad, S., 2011. Effect of nanocomposite packaging containing Ag and ZnO on inactivation of Lactobacillus plantarum in orange juice. Food Control. 22(3-4), 408-413  Epps, S.V.R., Harvey, R.B., Hume, M.E., Phillips, T.D., Anderson, R.C., Nisbet, D.J., 2013. Foodborne Campylobacter: Infections, metabolism, pathogenesis and reservoirs. Int. J. Environ. Res. Public Health. 10, 6292–6304. Doi:10.3390/ijerph10126292  62  Espitia, P. J. P., Soares, N. F. F., Coimbra, J. S. R., Andrade, N. J., Cruz, R. S., Medeiros, E. A. A., 2012. Zinc oxide nanoparticles: synthesis, antimicrobial activity and food packaging applications. Food. Bioprocess. Technol. 5, 1477-1464  Fachini-Queiroz, F.C., Kummer, R., Estevão-Silva, C.F., Carvalho, M.D.D.B., Cunha, J.M., Grespan, R., Bersani-Amado, C.A., Cuman, R.K.N., 2012. Effects of thymol and carvacrol, constituents of Thymus vulgaris L. essential oil, on the inflammatory response. Evidence-based Complement. Altern. Med. 2012. doi:10.1155/2012/657026  FDA. National antimicrobial resistance monitoring system – Enteric Bacteria (NARMS): 2010 Executive report. Rockville, MD: U.S. Department of Health and Human Services, Food and Drug Administration, 2012  Feng, S., Eucker, T.P., Holly, M.K., Konkel, M.E., Lu, X., Wang, S., 2014. Investigating the responses of Cronobacter sakazakii to garlic-drived organosulfur compounds: A systematic study of pathogenic-bacterium injury by use of high-throughput whole-transcriptome sequencing and confocal micro-raman spectroscopy. Appl. Environ. Microbiol. 80, 959–971. doi:10.1128/AEM.03460-13  Ferraro, J. R., Nakamoto, K., Brown, C. W., 2003. Introductory Raman Spectroscopy, second ed. Academic Press, California  Feris, K., Otto, C., Tinker, J., Wingett, D., Punnoose, A., Thurbert, A., Kongara, M., Sabetian, M., Quinn, B., Hanna, C., Pink., D., 2010. Electrostatic interactions affect nanoparticle mediated toxicity to Gram-negative bacterium Pseudomonas aeruginosa PAO1. Langmuir. 26(6), 4429-4436  Friedman, M., Henika, P.R., Mandrell, R.E., 2002. Bactericidal activities of plant essential oils and some of their isolated constituents against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. J. Food Prot. 65, 1545–1560.  63  Garbe, T. R., 1992. Heat shock proteins and infection: interactions of pathogen and host. Experientia. 48, 635-639. doi: 10.1007/BF02118308  Ghosh, I. N., Patil, S. D., Sharma, T. K., Srivastava, S. K., Pathania, R., Navani, N. K., 2013. Synergistic action of cinnamaldehyde with silver nanoparticles against spore-forming bacteria: a case for judicious use of silver nanoparticles for antibacterial applications. Int. J. Nanomedicine, 8, 4721-4731  Gill, C. O., Harris, L. M., 1983. Limiting conditions of temperature and pH for growth of “Thermophilic” Campylobacters on solid media. J. Food Prot.  46(9), 767-768  Goodwin, C. S., Armstrong, J.A., Chilvers, T., Peters, M., Collins, M. D., Sly, L., McConnell, W., Harper, W. E. S., 1989a. Transfer of Campylobacter pylori and Campylobacter mustelae to Helicobacter gen. nov. as Helicobacter pylori comb. nov. and Helicobacter musteale comb. nov respectively. Int. J. Syst. Bacteriol. 39, 397-405  Goodwin, C. S., McConnell, W., McCulloch, R. K., McCullough C., Hill, R., Bronsdon, M. A., Kasper, G., 1989b. Cellular fatty acid composition of Campylobacter pylori from primates and ferrets compared with of other campylobacters. J. Clin. Microbiol. 27, 938-943  Guccione, E., Leon-Kempis Mdel, R., Pearson, B. M., Hitchin, E., Mulholland, F., van Diemen, P. M., Stevens, M. P., Kelly, D. J., 2008. Amino acid-dependent growth of Campylobacter jejuni: key roles for aspartase (AspA) under microaerobic and oxygen limited conditions and identification of AspB (Cj0762), essential for growth on glutamate. Mol. Microbiol. 69(1), 77-93.  Guevara, L., Antolinos, V., Palop, A., Periago, P.M., 2015. Impact of Moderate Heat, Carvacrol, and Thymol Treatments on the Viability, Injury, and Stress Response of Listeria monocytogenes. Biomed Res. Int. 2015. doi:10.1155/2015/548930 64   Gundogdu, O., Bentley, S. D., Holden, M. T., Parkhill, J., Dorrell, N., Wren, B. W., 2007. Re annotation and re-analysis of the Campylobacter jejuni NCTC11168 genome sequence. BMC Genomics. 8, 162-170  Haddad, N., Tresse, O., Rivoal, K., Chevret, D., Nonglaton, Q., Burns, C. M., Prévost, H., Cappelier, J. M., 2012. Polynucleotide phosphorylase has an impact on cell biology of Campylobacter jejuni. Front. Cell. Infect Microbiol. 2, 30. doi: 10.3389/fcimb.2012.00030  Hayes, S. A., Dice, J. F., 1996. Mini-review: Roles of molecular chaperones in protein degradation. J. Cell Biol. 132, 255-258  Hazeleger, W. C., Wouters, J. A., Rombouts, F. M., Abee, T., 1998. Physiological activity of Campylobacter jejuni far below the minimal growth temperature. Appl. Environ. Microbiol. 64(10), 3917-3922  Health Canada, 2016a. Natural Health Products Ingredients Database: carvacrol. Retrieve from: http://webprod.hc-sc.gc.ca/nhpid-bdipsn/ingredReq.do?id=2004&lang=eng  Health Canada, 2016b. Natural Health Product Ingredients Database: zinc oxide. Retrieve from:   http://webprod.hc-sc.gc.ca/nhpid-bdipsn/ingredReq.do?id=2845&lang=eng  Heng, B. C., Zhao, X., Xiong, S., Woei Ng, K., Yin-Chiang Boey, F., Say-Chye Loo, J., 2010. Toxicity of zinc oxide (ZnO) nanoparticles on human bronchial epithelial cells  (BEAS-2B) is accentuated by oxidative stress. Food and Chem. Toxicol. 48(6), 1762-1766  65  Hermans, D., Deun, K. V., Martel, A., Immerseel, F. V., Messens, W., Heyndrickx, M., Haesebrouck, F., Pasmans, F., 2011. Colonization factors of Campylobacter jejuni in the chicken gut. Vet. Res. 42(82), 1-14  Hoffman, S., Maculloch, B., Batz, M. 2015. Economic burden of major foodborne illness acquired in the United States. Retrieve from: www.ers.usda.gov/publications/eib economic-information-bulletin/eib140  Hofreuter D., Tsai J., Watson R. O., Novik V., Altman B., Benitez M., Clark C., Perbost C., Jarvie T., Du L., Galán J. E., 2006. Unique features of a highly pathogenic Campylobacter jejuni strain. Infect. Immun. 74, 4694–470710  Hyun-Joo, C., Sung-Wook, C., Sanghoon, K., Hyang-Sook, C., 2011. Effect of particle size of zinc oxides on cytotoxicity and cell permeability in Caco-2 cells. Int. J. Food Sci. Nutr. 16, 174-178  Jalal, R., Goharshadi, E. K., Abareshi, M., Moosavi, M., Yousefi, A., Nancarrow, P., 2010. ZnO nanofluids: green synthesis, characterization, and antibacterial activity. Mater. Chem. Phys. 121(1), 198–201  Jayakumar, S., Madankumar, A., Asokkumar, S., Raghunandhakumar, S., Gokula D. K., Kamarai, S., Diyya, M. G., J., Devaki, T., 2012. Potential preventive effect of carvacrol against diethylnitrosamine-induced hepatocellular carcinoma in rats. Mol. Cell. Biochem. 360, 51-60  Jenner, P.M., Hagan, E.C., Taylor, J.M., Cook, E.L., Fitzhugh, O.G., 1964. Food flavourings and compounds of related structure I. Acute oral toxicity. Food Cosmet. Toxicol. 2, 327–343. doi:10.1016/S0015-6264(64)80192-9    66  Jin, T., Gurtler, J. B., 2010. Inactivation of Salmonella in liquid egg albumen by antimicrobial bottle coatings infused with allyl isothiocyanate, nisin and zinc oxide nanoparticles. J. Appl. Microbiol. 110, 704-712  Johny, A. K., Darre, M. J., Donoghue, A. M., Donoghue, D. J., Venkitanarayanan, K., 2010. Antibacterial effect of trans-cinnamaldehyde, eugenol, carvarol, and thymol on Salmonella Enteritidis and Campylobacter jejuni in chicken cecal contents in vitro. J. Appl. Poult. Res. 19, 237-244  Jones, F.S., Orcutt, M., Little, R. B., 1931. Vibrios (Vibrio jejuni, n. Sp.) associated with intestinal disorders of cows and calves. J. Exp. Med. 53, 853–863  Kaldor, J., Speed, B. R., 1984. Guillain-Barré syndrome and Campylobacter jejuni: a serological study. BMJ. 288, 1867-1870  Kelly, D. J. 2008. Complexity and versatility in the physiology and metabolism of Campylobacter jejuni. In: Nachamkin, I., Szymanski, C. M., Blaser, M. J. (Ed.), Campylobacter. American Society for Microbiology, Washington  King, E. O., 1957. Human infections with Vibrio fetus and a closely related vibrio. J. Infect. Dis. 101(2), 119-128  Kirk, M.D., Pires, S.M., Black, R.E., Caipo, M., Crump, J.A., Devleesschauwer, B., Dopfer, D., Fazil, A., Fischer-Walker, C.L., Hald, T., Hall, A.J., Keddy, K.H., Lake, R.J., Lanata, C.F., Torgerson, P.R., Havelaar, A.H., Angulo, F.J., 2015. World Health Organization Estimates of the Global and Regional Disease Burden of 22 Foodborne Bacterial, Protozoal, and Viral Diseases, 2010: A Data Synthesis. PLoS Med. 12, 1–21. doi:10.1371/journal.pmed.1001921   67  Klančnik, A., Botteldoom, N., Herman, L., Mozina, S. S., 2006. Survival and stress induced expression of groEL and rpoD of Campylobacter jejuni from different growth phases. Intl. J. Food Microbiol. 112(3), 200-207  Knowles, J.R., Roller, S., Murray, D.B., Naidu, A.S., 2005. Antimicrobial action of carvacrol at different stages of dual-species biofilm development by Staphylococcus aureus and Salmonella enterica serovar Typhimurium. Appl Env. Microbiol. 71, 797–803. doi:10.1128/AEM.71.2.797-803.2005  Kolodziejczak-Radzimska, A., Jesionowski, T., 2014. Zinc oxide-From synthesis to Application: A Review. Materials. 7, 2833-2881  Koolman, L., Whyte, P., Burgess, C., Bolton, D., 2016. Virulence gene expression, adhesion and invasion of Campylobacter jejuni exposed to oxidative stress (H2O2). Int. J. Food Microbiol. 220, 33-38  Koneman E. W., Allen, S. D. 1997. Antimicrobial susceptibility testing, p. 785-856. In Color atlas and textbook of diagnostic microbiology, fifth ed. Lippincott, Pennsylvania   Krychowiak, M., Grinholc, M., Banasiuk, R., Krauze-Baranowska, M., Glod, D., Kawiak, A., Krolicka, A., 2014. Combination of silver nanoparticles and Drosera binata extract as a possible alternative for antibiotic treatment of burn wound infections caused by resistant Staphylococcus aureus. PLoS ONE, 9(12), e115727  Kumar, A., Pandey, A. K., Singh, S. S., Shanker, R., Dhawan, A., 2011. Engineered ZnO and TiO2 nanoparticles induce oxidative stress and DNA damage leading to reduced viability of Escherichia coli. Free Radic. Biol. and Med. 51, 1872-1881  68  Lambert, R. J. W., Skandamis, P. N., Coote, P. J., Nychas, G. J. E., 2001. A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J. Appl. Microbiol. 91, 453-462  Larazo, B., Carcamo J., Audicana, A., Perales, I., Fernandez-Astorga, A., 1999. Viability and DNA maintenance in nonculturable spiral Campylobacter jejuni cells after long-term exposure to low temperatures. Appl. Environ. Microbiol. 65(10), 4677-4681  Leach, S., Harvey, P., Wali, R., 1997. Changes with growth rate in the membrane lipid composition of and amino acid utilization by continuous cultures of Campylobacter jejuni. J. Appl. Microbiol. 82(5), 631-40  Lei, J., Leser, M., Enan, E., 2010. Nematicidal activity of two monoterpenoids and SER-2 tyramine receptor of Caenorhabditis elegans. Biochem. Pharmacol. 79, 1062-1071  Levy, A. J., 1946. A gastro-enteritis outbreak probably due to a bovine strain of Vibrio. Yale J. Biol. Med. 18, 243-258  Line, J. E., Hiett, K. L., Guard-Bouldin, J., Seal, B. S., 2010. Differential carbon source utilization by Campylobacter jejuni 11168 in response to growth temperature variation. J. Microbiol. Methods. 80(2), 198-202  Liu, Y., He, L., Mustapha, A., Li, H., Hu, Z. Q., Lin, M., 2009. Antibacterial activities of zinc oxide nanoparticles against Escherichia coli O157:H7. J. Appl. Microbiol. 107, 1193-1201  López-Díez, E. C., Winder, C. L., Ashton, L., Currie, F., Goodacre, R., 2004. Monitoring the mode of action of antibiotics using Raman spectroscopy: investigating subinhibitory effects of amikacin on Pseudomonas aeruginosa. Anal. Chem. 77, 2901-2906  69  Lu, X., Weakley, A. T., Aston, D. E., Rasco, B. A., Wang, S., Konkel, M. E., 2012. Examination of nanoparticle inactivation of Campylobacter jejuni biofilms using infrared and Raman spectroscopies. J. Appl. Microbiol. 113, 952-963  Ma, Y., Hanning, I., Slavik, M., 2009. Stress-induced adaptive tolerance response and virulence gene expression in Campylobacter jejuni. J. Food Safety. 29(1), 126-143  Ma, J., Liu, J., Bao, Y., Zhu, Z., Wang, X., Zhang, J., 2013. Synthesis of large-scale uniform mulberry-like ZnO particles with microwave hydrothermal method and its antibacterial property. Ceram. Int. 39(3), 2803–2810  Man, S.M., 2011. The clinical importance of emerging Campylobacter species. Nat. Rev. Gastroenterol. Hepatol. 8, 669–685. doi:10.1038/nrgastro.2011.191  Mandrell, R. E., Miller, W. G. 2006. Campylobacter. In: Motarjemi, Y., Adams, M. (Ed.), Emerging Foodborne Pathogens. Woodhead Publishing Limited, Cambridge  Mayhew, M., Da Silva, A. C., Martin, J., Erdjument-Bromage, H., Tempst, P., Hartl, F. U., 1996. Protein folding in the central cavity of the GroEL-GroES chaperonin complex. Nature. 379, 420-426. doi: 10.1038/379420a0  McGraw, G.W., Hemingway, R. W., Ingram, L. L. Jr., Canady, C. S., McGraw, W. B., 1999. Thermal degradation of terpenes: camphene, ∆3-carene, limonene, and α-terpinene. Environ. Sci. Technol. 33, 4029–33  Miller, W. G., Mandrell, R. E. 2005. Prevalence of Campylobacter in the food and water supply. In: Ketley, J. M., Konkel, M. E. (Ed.), Campylobacter molecular and cellular biology. Horizon Bioscience, Norfolk   70  Montagu, A., Joly-Guillou, M.L., Rossines, E., Cayon, J., Kempf, M., Saulnier, P., 2016. Stress conditions induced by carvacrol and cinnamaldehyde on Acinetobacter baumannii. Front. Microbiol. 7, 1–9. doi:10.3389/fmicb.2016.01133  Morkoç, H., Özgur, U., 2009. Zinc oxide: fundamentals, materials, and device technology, first ed. WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim  Moran, A. P., Rietschel, E. T., Kosunen, T. U., Zahringer, U., 1991. Chemical characterization of Campylobacter jejuni lipopolysaccharides containing N-Acetylneuraminic Acid and 2,3-Diamino-2,3-Dideoxy-D-Glucose. J. Bacteriol. 173(2), 618-626  Movasaghi, Z., Rehman, S., Rehman, I. U., 2007. Raman spectroscopy of biological tissues. Appl. Spectrosc. Rev. 42(5), 493-541  Muraoka, W. T., Zhang, Q., 2011. Phenotypic and genotypic evidence for L-fucose utilization by Campylobacter jejuni. J. Bacteriol. 193(5), 1065-75  Murphy, C., Carroll, C., Jordan, K. N., 2003a. Induction of an adaptive tolerance response in the foodborne pathogen, Campylobacter jejuni. FEMS Microbiol. Lett. 233, 89-93  Murphy, C., Carroll, C., Jordan, K. N., 2003b. Identification of a novel stress resistance mechanism in Campylobacter jejuni. J. Appl. Microbiol. 95, 704-708  Nachamkin, I., Allos, B. M., Ho, T., 1998. Campylobacter species and Guillain-Barré syndrome. Clin. Microbiol. Rev., 11(3), 555-567  National Antimicrobial Resistance Monitoring System. 2015. NARMS Integrated Report: 2012 2013. Retrieve from: http://www.fda.gov/downloads/AnimalVeterinary/SafetyHealth/ AntimicrobialResistance/NationalAntimicrobialResistanceMonitoringSystem/UCM453398.pdf 71   Navale, G. R., Thirpuranthaka, M., Late, D. J., Shinde, S. S., 2015. Antimicrobial activity of ZnO nanoparticles against pathogenic bacteria and fungi. JSM Nanotechnol. Nanomed. 3(1), 1-9  Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J., 2015. Real-time PCR detection chemistry. Clin. Chim. Acta. 439, 231-250  Newell, D. G., 2002. The ecology of Campylobacter jejuni in avian and human hosts and in the environment. Int. J. Infect Dis. 6, 3S16-3S21  Newell, D. G., Fearnley C., 2003. Sources of Campylobacter colonization in broiler chickens. Appl. Environ. Microbiol. 69, 4343-4351  Nhu-Trang, T. T., Casabianca, H., Grenier-Loustalot, M. F., 2006. Deuterium/hydrogen ratio analysis of thymol, carvacrol, γ-terpinene and p-cymene in thyme, savory and oregano essential oils by gas chromatography–pyrolysis–isotope ratio mass spectrometry. J. Chromatogr. A 1132, 219–227. doi:10.1016/j.chroma.2006.07.088  Nostro, A. M., Germano, P., Angelo, V. D., Mariko, A., Cannatelli, A., 2000. Extraction methods and bioautography for evaluation of medicinal plant antimicrobial activity. Lett. Appl. Microbiol. 30, 379-384  Noyhnek, G. J., Antignac, E., Re, T., Toutain, H., 2010. Safety assessment of personal care products/cosmetics and their ingredients. Toxicol. Appl. Pharmacol. 243(2), 239–259  On, S. L. W. 2005. Taxonomy, phylogeny, and methods for the identification of Campylobacter species. In: Ketley, J. M., Konkel, M. E. (Ed.), Campylobacter molecular and cellular biology. Horizon Bioscience, Norfolk  72  Parkhill, J., Wren, B. W., Mungall, K., Ketley, J. M., Churcher, C., Basham, D., Chillingworth, T., Davies, R. M., Feltwell, T. Holroyd, S., Jagels, K., Karlyshev, A. V., Moule, S., Pallen, M. J., Penn, C. W., Quail, M. A., Rajandream, M. A., Rutherford, K. M., van Vliet, A. H., Whitehead, S., Barrell, B. G., 2000. Nature. 403(6770), 665-668  Perez-Conesa, D., Cao, J., Chen, L., McLandsborough, L., Weiss, J., 2011. Inactivation of Listeria monocytogenes and Escherichia coli O157:H7 biofilms by micelle-encapsulated eugenol and carvacrol. J. Food Prot. 74, 55-62  Pillai, S. K., Moellering Jr., R. C., Eliopoulos, G. M., 2005. Antimicrobial combinations. In: Lorian, V. (Ed.), Antibiotics in Laboratory Medicine. Wolters Kluwer Health, Pennsylvania  Public Health Agency of Canada. 2015. FoodNet Canada 2014 short report. Retrieve from: http://www.phac-aspc.gc.ca/foodnetcanada/report-rapport-2014-eng.php  Public Health England. 2015. Identification of Campylobacter species. UK Standards for Microbiology Investigations. ID 23 Issue 3. https://www.gov.uk/uk-standards-formicrobiology-investigations-smi-quality-and-consistency-in-clinical-laboratories  Rajendran, D., Kumar, G., Ramakrishnan, S., Thomas, K. S., 2013. Enhancing the milk production and immunity in Holstein Friesian crossbred cow by supplementing novel nano zinc oxide. Res. J. Biotechnol. 8, 11e7  Ramani, M., Ponnusamy, S., Muthamizhchelvan, C., 2012. From zinc oxide nanoparticles to microflowers: a study of growth kinetics and biocidal activity. Matter. Sci. Eng. C 32(8), 2381–2389  73  Rattanachaikunsopon, P., Phumkhachorn, P., 2010. In vitro study of synergistic antimicrobial effect of carvacrol and cymene on drug resistant Salmonella typhi. Afr. J. Microbiol. Res. 3(12), 978-980  Reddy, K. M., Feris, K., Bell, J., Wingett, D. G., Hanley, C., Punnoose, A., 2007. Selective toxicity of zinc oxide nanoparticles to prokaryotic and eukaryotic systems. Appl. Phys. Lett. 90(213902), 213902-1-213902-3  Reid, A. N., Pandey, R., Palyada, K., Naikare, H., Stintzi, A., 2008. Identification of Campylobacter jejuni genes involved in the response to acidic pH and stomach transit. Appl. Environ. Microbiol. 74(5), 1583-1597  Rhodes, K. M. Tattersfield, A. E., 1982. Guillain-Barré syndrome associated with Campylobacter infection. BMJ. 285, 173-174  Ritz, M., Garenaux, A., Berge, M., Federighi, M., 2009. Determination of rpoA as the most suitable internal control to study stress response in C. jejuni by RT-qPCR and application to oxidative stress. J. Microbiol. Methods. 76, 196–200. doi:10.1016/j.mimet.2008.10.014  Rollins, D. M., Colwell, R. R., 1986. Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl. Environ. Microbiol. 52(3), 531-538  Sahin, O., Morishita, T., Zhang, Q., 2002. Campylobacter colonization in poultry: sources of infection and modes of transmission. Anim. Health Res. Rev. 3, 95-105  Sahin, O., Kassem, I.I., Shen, Z., Lin, J., Rajashekara, G., 2015. Campylobacter in Poultry: Ecology and Potential Interventions. Avian Dis. 59, 185-200   74  Sahoo, A., Swain, R. K., Mishra, S. K., 2014. Effect of inorganic, organic and nano zinc supplemented diets on bioavailability and immunity status of broilers. Int. J. Adv. Res. 2, 828e37  Scandorieiro, S., de Camargo, L. C., Lancheros, C. A. C., Yamada-Ogatta, S. F., Nakamura, C. V., de Oliveira, A. G., Andrade, C. G.T. J., Duran, N., Nakazato, G., Kobayashi, R. K. T., 2016. Synergistic and additive effect of oregano essential oil and biological silver nanoparticles against multridrug-resistant bacterial strains. Front. Microbiol. 7, 760  Scharff, R. L., 2012. Economic burden from health losses due to foodborne illness in the United States. J. Food Prot. 75, 123-131  Schmidt, E., 2010. Production of essential oils. In: Baᶊer, K.H., Buchbauer, G. (Ed.), Handbook of essential oils: Science, technology, and applications. CRC Press, Florida  Schuster, K. C., Urlau, E., Gapes, J. R., 2000. Single-cell analysis of bacteria by Raman microscopy: spectral information on the chemical composition of cells and on the heterogeneity in a culture. J. Microbiol. Methods. 42, 29-38  Sébald, M., Véron, M., 1963. DNA base content and classification of vibrios. Ann. Inst. Pasteur. 105, 897-910  Shaheen, B. W., Miller, M. E., Oyarzabal, O. A., 2006. In vitro survival at low pH and acid adaption response of Campylobacter jejuni and Campylobacter coli. J. Food Safety. 27: 326-343  Sirelkhatim, A., Mahmud, S., Seeni, A., Kaus, N. H. M., Ann, L. C., Bakhori, S. K. M., Hasan, H., Mohaman, D., 2015. Review on zinc oxide nanoparticles: antibacterial activity and toxicity mechanism. Nano-Micro Lett. 7, 219-242  75  Smith, T., Taylor, M. S., 1919. Some morphological and biological characters of the spirilla (Vibrio fetus, N. Sp.) associated with disease of the fetal membranes in cattle. J. Exp. Med. 30, 299-312  Snelling, W. J., Stern, N. J., Lowery, C. J., Moore, J. E., Gibbons, E., Baker, C. Dooley, J. S. G., 2008. Colonization of broilers by Campylobacter jejuni internalized within Acanthamoeba castellanii. Arch. Microbiol. 189, 175–179  Song, W., Zhang, J., Guo, J., Zhang, J., Ding, F., Li, L., Sun, Z. ,2010. Role of the dissolved zinc ion and reactive oxygen species in cyto- toxicity of ZnO nanoparticles. Toxicol. Lett. 199(3), 389–397  Stahl, M., Friis L. M., Nothaft H., Liu X., Li J., Szymanski C. M., Stintzi A., 2011. L-fucose utilization provides Campylobacter jejuni with a competitive advantage. Proc. Natl. Acad. Sci. 108, 7194–719910  Stahl, M., Butcher, J., Stintzi, A., 2012. Nutrient acquisition and metabolism by Campylobacter jejuni. Front. Cell Infect. Microbiol. 2, 5.doi: 10.3389/fcimb.2012.00005   Stanković, A., Dimitrijević, S., Uskoković, D., 2013. Influence of size scale and morphology on antibacterial properties of ZnO powders hydrothermally synthesized using different surface stabilizing agents. Colloids Surf. B 102, 21–28   Stern, N. J. Bailey, J. S., Blankenship, L. C., Cox, N. A., McHan, F., 1988. Colonization characteristics of Campylobacter jejuni in chick ceca. Avian Dis., 32, 330-334  Stintzi, A., 2003. Gene expression profile of Campylobacter jejuni in response to growth temperature variation. J. Bacteriol. 185(6), 2009-2016  76  Talari A.C.S., Movasaghi Z., Rehman S., Rehman I.U., 2015. Raman spectroscopy of biological tissues. Appl. Spectrosc. Rev. 50, 46-111  Talebian, N., Amininezhad, S. M., Doudi, M., 2013. Controllable synthesis of ZnO nanoparticles and their morphology-dependent antibacterial and optical properties. J. Photochem. Photobiol. 120, 66–73  Teixeira, B., Marques, A., Ramos, C., Serrano, C., Matos, O., Neng, N. R., Nogueira, J. M. F., Saraiva, J. A., Nunes, M. L., 2013. Chemical composition and bioactivity of different oregano (Origanum vulgare) extracts and essential oil. J. Sci. Food Agr. 93, 2707-2714  Thomas, M. K., Murray, R. 2014. Estimating the burden of foodborne illness in Canada. Canada Communicable Disease Report CCDR, 40, August 14. Retrieve from: http://www.phac-aspc.gc.ca/publicat/ccdr-rmtc/14vol40/dr-rm40-14/dr-rm40-14-comm-eng.php#footnotei  Tong, G. X., Du, F. F., Liang, Y., Hu, Q., Wu, R. N., Guan, J. G., Hu, X., 2013. Polymorphous ZnO complex architectures: selective synthesis, mechanism, surface area and Zn-polar plane-codetermining antibacterial activity. J. Mater. Chem. B1(4), 454-463  Turek, C., Stintzing, F.C., 2013. Stability of Essential Oils: A Review. Compr. Rev. Food Sci. Food Safety. 12, 40–53. doi:10.1111/1541-4337.12006  Ultee, A., Kets, E. P. W., Smid, E. J., 1999. Mechanisms of action of carvacrol on the food-borne pathogen Bacillus cereus. Appl. Environ. Microbiol. 65, 4604-4610  Ultee, A., Bennik, M.H.J., Moezelaar, R., 2002. The phenolic hydroxyl group of carvacrol is essential for action against the food-borne pathogen Bacillus cereus. Appl. Environ. Microbiol. 68, 1561–1568. doi:10.1128/AEM.68.4.1561-1568.2002   77  van Alphen, L.B., Burt, S.A., Veenendaal, A.K., Bleumink-Pluym, N.M., van Putten, J.P., 2012. The natural antimicrobial carvacrol inhibits Campylobacter jejuni motility and infection of epithelial cells. PLoS One 7, e45343. doi:10.1371/journal.pone.0045343  van de Giessen, A. W., Tilburg, J. J., Ritmeester, W. S., Van der, P. J., 1998. Reduction of Campylobacter infections in broiler flocks by application of hygiene measures. Epidemiol. Infect. 121, 57-66  Vandamme, P., De Ley, J., 1991. Proposal for a new family, Campylobacteriaceae. Int. J. Syst. Bacteriol. 41, 451-455  Vandamme, P. Goossens, H., 1992a. Taxonomy of Campylobacter, Arcobacter, and Helicobacter: a review. Zbl. Bakteriol. 276, 447-472  Vandamme, P., Vancanneyt, M., Pot, B., 1992b. Polyphasic taxonomic study of the emended genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an aerotolerant bacterium isolated from veterinary specimens. Int. J. Syst. Bacteriol. 42, 451-455  Vegge, C. S., Brøndsted, L., Li Y. P., Bang, D. D., Ingmer, H., 2009. Energy taxis drives Campylobacter jejuni toward the most favorable conditions for growth. Appl. Environ. Microbiol. 75(16), 5308-5314  Velayudhan, J., Kelly, D. J., 2002. Analysis of gluconeogenic and anaplerotic enzymes in Campylobacter jejuni: an essential role for phosphoenolpyruvate carboxykinase. Microbiology. 148(3), 685-94  Veldhuizen, E. J. A., Tjeerdsma-van Bokhoven, J. L. M., Zweijtzer, C., Burt, S. A., Haagsman, H. P., 2006. Structural requirements for the antimicrobial activitiy of carvacrol. J. Agr. Food Chem. 54, 1874-1879 78   Véron, M., Chatelain, R., 1973. Taxonomic study of the genus Campylobacter Sébald and Véron and designation of the neotype strain for the type species, Campylobacter fetus (Smith and Taylor) Sébald and Véron. Int. J. Sys. Bacteriol. 23, 122-134  Vinzent, R., Duma, J., Picard, N., 1947. Septicemie grave au cours de la grossesse, due a un vibrion. Bull. Acad. Natl. Med. 131, 90–92  Wadhwani, T., Desai, K., Patel, D., Lawani, D., Bahaley, P., Joshi, P., Kothari V., 2008. Effect of various solvents on bacterial growth in context of determining MIC of various antimicrobials. Internet J. Microbiol. 7(1), 1-6  Wang, Z. L., 2004. Zinc oxide nanostructures: growth, properties and applications. J. Phys. Condens. Matter. 16, 829-858  Wang, B., Feng, W. Y., Wang, T. C., Jia, G., Wang, M., Shi, J. W., Zhang, F., Zhao, Y. L., Chai, Z. F., 2006. Acute toxicity of nano-and micro-scale zinc powder in healthy adult mice. Toxicol. Lett. 161, 115e23  Wang, B., Feng, W., Wang, M.,Wang, T., Gu, Y., Zhu, M., Ouyang, H., Shi, J., Zhang, F., Zhao, Y., Chai, Z., Wang, H., Wang, J., 2008. Acute toxicological impact of nano- and submicro-scaled zinc oxide powder on healthy adult mice. J. Nanopart. Res. 10, 263e76  Wassenaar, T. M., Blaser, M. J., 1999. Pathophysiology of Campylobacter jejuni infections of humans. Microb. Infect. 1, 1023-1033  Wiegand, I., Hilpert, K., Hancock, R. E. W., 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat. Protoc. 3(2), 163-175  79  Wright, J. A., Grant, A. J., Hurd, D., Harrison, M., Guccione, E. J., Kelly, D. J., Maskell, D. J., 2009. Metabolite and transcriptome analysis of Campylobacter jejuni in vitro growth reveals a stationary-phase physiological switch. Microbiology. 155, 80–9410  Xie, Y., He, Y., Irwin, P. L., Jin, T., Shi, X., 2011. Antibacterial activity and mechanism of action of zinc oxide nanoparticles against Campylobacter jejuni. Appl. Environ. Microbiol. 77(7), 2325-2331  Yao, R., Burr, D. H., Doig, P., Trust, T. J., Niu, H., Guerry, P., 1994. Isolation of motile and non motile insertional mutants of Campylobacter jejuni: the role of motility in adherence and invasion of eukaryotic cells. Mol. Microbiol. 14, 883-893  Young, K.T., Davis, L.M., Dirita, V.J., 2007. Campylobacter jejuni: molecular biology and pathogenesis. Nat. Rev. Microbiol. 5, 665–679. doi:10.1038/nrmicro1718  Zhong, Q., Shah, B. 2012. Improving food sensory and nutritional quality through nanostructure engineering. In: Huang, Q. (Ed.), Nanotechnology in the food, beverage, and nutraceutical industries. Woodhead Publishing Limited, Cambridge  Zimmer, M. Barnhart, H., Idris, U., Lee, M. D., 2003. Detection of Campylobacter jejuni strains in the water lines of a commercial broiler house and their relationship to the strains that colonized the chickens. Avian Dis. 47, 101-107 80  Appendix  Appendix A  Chapter 2 supplementary information  A.1 The standard curve of Campylobacter jejuni strains used in the study              Figure A.1 Standard curve of the growth of Campylobacter jejuni strain (A) human clinical isolate 10, (B) ATCC 33560, and (C) F38011 in Mueller-Hinton broth incubated at 37°C in a microaerobic condition   81  Appendix B  Chapter 5 supplementary information  B.1 Scanning electron microscopy images of Campylobacter jejuni  The preparation of the C. jejuni strain F38011culture and antimicrobial treatment followed the procedure in section 2.2.1 and 2.2.4, respectively. C. jejuni strain F38011 was treated with the combinational concentration of carvacrol (20.25 µg/ml) and ZnO NPs (12.5 µg/ml), carvacrol alone, and ZnO NPs alone. After 6 hours of antimicrobial treatment, the cell pellets were collected by centrifugation. The cell pellets were rinsed for three times with phosphate buffer and fixed with 2.5% glutaraldehyde in 0.1 mol-1 phosphate buffer (pH = 7.35) overnight at room temperature. The fixed bacterial cells were then rinsed with sterile water and dehydrated in a series of 25%, 50%, 70%, 60%, 90% ethanol (10 minutes each). Next, the cells were further dehydrated twice with 100% ethanol (15 minutes each) and freeze-dried immediately in a Christ Alpha 1-4 lyophilizer (Christ, Osterode, Germany). Then, the samples were mounted onto the SEM stubs and sputter coated with a thin layer of gold. The coated samples were observed under a FEI Nova200 NanoLab scanning electron microscope (FEI, Hillsboro, USA) using an accelerating voltage of 5 kV.  82                 Figure B.1 Scanning electron microscopy (SEM) images of C. jejuni strain F38011 revealed cellular leakage and damage when (B) treated with the combinational of carvacrol (20.25 µg/ml) and ZnO NPs (12.5 µg/ml) compared to the (A) untreated cells. The morphological change of C. jejuni strain F38011 cells was observed when the cells was treated with (C) carvacrol (20.25 µg/ml), and (D) treated with ZnO NPs (12.5 µg/ml). 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0340643/manifest

Comment

Related Items