Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effect of human fecal extracts on Campylobacter jejuni gene expression and pathogenesis Liu, Martha 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2017_february_liu_martha.pdf [ 1.45MB ]
Metadata
JSON: 24-1.0340575.json
JSON-LD: 24-1.0340575-ld.json
RDF/XML (Pretty): 24-1.0340575-rdf.xml
RDF/JSON: 24-1.0340575-rdf.json
Turtle: 24-1.0340575-turtle.txt
N-Triples: 24-1.0340575-rdf-ntriples.txt
Original Record: 24-1.0340575-source.json
Full Text
24-1.0340575-fulltext.txt
Citation
24-1.0340575.ris

Full Text

  Effect of human fecal extracts on Campylobacter jejuni gene expression and pathogenesis  by  Martha Liu B.Sc., The University of British Columbia, 2006   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in The Faculty of Graduate and Postdoctoral Studies (Microbiology and Immunology)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2016  © Martha Liu, 2016  ii  Abstract Campylobacter jejuni (C. jejuni), a zoonotic commensal that is pathogenic in humans, is one of the most common bacterial causes of food borne illness worldwide. To assess how C. jejuni responds to the metabolome of a commensal host (chickens) versus a disease susceptible host (humans), differences in gene expression was evaluated after C. jejuni exposure to cell-free extracts prepared from chicken cecal and human fecal matter. RNA sequencing identified 12 genes with >2 fold difference in expression when C. jejuni was exposed to human fecal extracts in comparison to chicken cecal extract. 10 of these genes appear to be involved in iron uptake, of which 7 (CJJ81176_1649 to 1655) were part of one iron uptake system. This system likely acquires chelated iron not recognized by other iron uptake systems since measurement of total iron content showed that human fecal extracts contained ~4.5X more iron than chicken cecal extract. Homologs of the CJJ81176_1649 to 1655 proteins were identified in alpha, epsilon and gamma proteobacteria, and mapping of the homologous proteins to representative bacterial genomes showed that gene order and operon structure were well preserved for homologs of the entire CJJ81176_1649 to 1655 gene cluster. The widespread prevalence of the entire gene cluster putatively suggests that the proteins encoded by CJJ81176_1649 to 1655 represent a complete iron uptake system. The CJJ81176_1649 iron transporter and the p19 (CJJ81176_1650) periplasmic iron binding proteins have been previously characterized, but the downstream genes have not been directly studied and functions are predicted by homology. Deletion of CJJ81176_1651 to 1655 and the overlapping CJJ81176_1656 gene in this study rendered C. jejuni more sensitive to iron depletion than wild type, comparable to that of the p19 mutant. Furthermore, this iron uptake system appears to be involved in adaptation to low pH, but at the cost of increased sensitivity to hydrogen peroxide stress. This work demonstrates that the heretofore understudied, but widely conserved, CJJ81176_1649 to 1656 iron uptake system may be involved in host colonization by uptake of chelated iron more abundantly present in the human intestinal environment than that of the chicken cecum.  iii  Preface  This thesis represents work conducted at the University of British Columbia in the department of Microbiology and Immunology by Dr. Erin Gaynor and Martha Liu. Dr. Erin Gaynor initially conceptualized the project and provided project guidance. I designed the project, obtained ethics approval, performed extract preparation, completed C. jejuni testing, prepared purified RNA, and created and characterized the deletion and complementation mutants.  Ethics approval for collection of human fecal material was granted by the UBC Clinical Research Ethics Board (CREB) under application H14-00859 - “Effect of human intestinal metabolites on Campylobacter jejuni gene expression and pathogenesis”. The chicken cecal samples were supplied by Dr. Neil Ambrose of Sunrise Poultry Processors Ltd, and human fecal samples were donated by volunteers. Chicken cecal sample collection and processing was performed by me with the help of the Gaynor Lab. RNA sequencing was performed by the Wellcome Trust Sanger Institute (WTSI) in Hinxton, Cambridge UK. The WTSI sequencing group prepared and sequenced the RNA samples. I analyzed the RNA sequencing data with the help and training of Dr. Christine Boinett in Dr. Julian Parkhill’s research group at the WTSI. Inductively coupled plasma mass spectrometry (ICP-MS) was performed by Mariko Ikehata at the lab of Dr. Michael Murphy at UBC. This research is currently not published; however a manuscript based on data and writing in the thesis is planned.    iv  Table of contents   Abstract ......................................................................................................................................................... ii Preface ......................................................................................................................................................... iii Table of contents ......................................................................................................................................... iv List of tables ................................................................................................................................................. vi List of figures ............................................................................................................................................... vii List of abbreviations ................................................................................................................................... viii Acknowledgements ...................................................................................................................................... ix Dedication ..................................................................................................................................................... x 1 Introduction .......................................................................................................................................... 1 1.1 Campylobacter jejuni .................................................................................................................... 1 1.1.1 General background ................................................................................................................. 1 1.1.2 C. jejuni growth and stress response ........................................................................................ 2 1.1.3 Biofilm formation ..................................................................................................................... 3 1.1.4 C. jejuni metabolism ................................................................................................................. 4 1.2 C. jejuni host colonization ............................................................................................................. 5 1.2.1 Colonization in chickens ........................................................................................................... 5 1.2.2 Pathogenesis in humans ........................................................................................................... 6 1.2.3 Virulence factors ...................................................................................................................... 7 1.3 Fecal microbiome and metabolome ............................................................................................. 8 1.3.1 Human large intestine and chicken cecal microbiome ............................................................ 8 1.3.2 Intestinal metabolome ............................................................................................................. 9 1.4 Objective of the present study ................................................................................................... 10 2 Methods .............................................................................................................................................. 12 2.1 Ethics statement ......................................................................................................................... 12 2.2 Bacterial strains and growth conditions ..................................................................................... 12 2.3 Chicken cecal sample collection.................................................................................................. 13 2.4 Human fecal sample collection ................................................................................................... 13 2.5 Extract preparation ..................................................................................................................... 14 2.6 Biofilm assay ............................................................................................................................... 14 2.7 RNA extraction and sequencing .................................................................................................. 15 v  2.8 RNA sequencing data analysis .................................................................................................... 16 2.9 Inductively coupled mass spectrometry (ICP-MS) ...................................................................... 16 2.10 Assessment of protein domains .................................................................................................. 17 2.11 Homology screening ................................................................................................................... 17 2.12 Creating the ∆1651-1656 deletion mutants ............................................................................... 17 2.13 Creating the 1651-1656C complement ....................................................................................... 19 2.14 Iron depletion and supplementation .......................................................................................... 19 2.15 Hydrogen peroxide testing ......................................................................................................... 20 2.16 Acid stress testing ....................................................................................................................... 20 2.17 Antibiotic screening .................................................................................................................... 20 2.18 Statistics ...................................................................................................................................... 21 3 Results ................................................................................................................................................. 22 3.1 C. jejuni response to human fecal and chicken cecal extracts .................................................... 22 3.2 RNA sequence results .................................................................................................................. 24 3.3 CJJ81176_1649 to 1656 ............................................................................................................... 28 3.4 Homologs of CJJ81176_1651 to 1655 are widely distributed among multiple classes of proteobacteria ............................................................................................................................. 30 3.5 Human fecal extracts contain more iron than chicken cecal extract .......................................... 33 3.6 CJJ81176_1651 to 1656 are involved in iron acquisition ............................................................ 34 3.7 The ∆1651-1656 and ∆p19 mutant strains are more sensitive to low pH but are more resistant to hydrogen peroxide stresses ..................................................................................... 35 3.8 The ∆1651-1656 and ∆p19 mutants lose streptomycin tolerance under iron limiting conditions .................................................................................................................................... 37 4 Discussion ............................................................................................................................................ 40 4.1 C. jejuni response to extracts ...................................................................................................... 41 4.2 C. jejuni RNA sequencing results and iron uptake ...................................................................... 42 4.3 The CJJ81176_1649 to 1656 iron uptake system ........................................................................ 44 5 Conclusion and future directions ........................................................................................................ 49 References .................................................................................................................................................. 51 Appendices .................................................................................................................................................. 60 Appendix A: Homolog list of the Cjj81176_1649 to 1656 cluster in other proteobacteria ................... 60 Appendix B: Proposed method for creating single deletion mutants of CJJ81176_1651 to 1656 genes ............................................................................................................................................. 62  vi  List of tables  Table 1. List of primers used in this study. ................................................................................................. 18 Table 2. Grouping of conditions for calculation of fold change .................................................................. 25 Table 3. C. jejuni genes showing > 2 fold difference in expression after 20 minute and 5 hour exposure to media containing human fecal extract versus media containing chicken cecal extract ............................................................................................................................................ 26 Table 4. C. jejuni genes showing > 2 fold difference in expression after 20 minute and 5 hour exposure to media containing extract versus media only ............................................................. 27     vii  List of figures  Figure 1. Response of C. jejuni to extracts .................................................................................................. 23 Figure 2. The CJJ81176_1649 to 1656 gene cluster. ................................................................................... 29 Figure 3. Homologs of the CJJ81176_1649 to 1656 genes in Proteobacteria ............................................ 32 Figure 4. ICP-MS results .............................................................................................................................. 33 Figure 5. Growth in iron supplemented and iron depleted media ............................................................. 35 Figure 6. C. jejuni survival in low pH and H2O2 stress in MH and iron supplemented MH ......................... 36 Figure 7. Antibiotic susceptibility testing .................................................................................................... 38 Figure 8. Putative model of the CJJ81176_1649 to 1656 iron transport system........................................ 46     viii  List of abbreviations  bp Base pairs cfu Colony forming units Cia Campylobacter invasion antigens CJJ Campylobacter jejuni subspecies jejuni. Acronym used as prefix to denote gene number/locus tag/protein (e.g. CJJ81176_1649) Cm Chloramphenicol CmR Chloramphenicol resistance cassette CP Chicken pooled cecal extract DFO Desferroxamine H1 to H11 Human fecal sample identifiers HCl Hydrochloric acid HP1 Human fecal extracts, pool 1 HP2 Human fecal extracts, pool 2 HP3 Human fecal extracts, pool 3 ICP-MS Inductively coupled plasma mass spectrometry Ig Immunoglobulin Km Kanamycin KmR Kanamycin resistance cassette LB Lysogeny Broth - Luria MH Mueller-Hinton MIC Minimum inhibitory concentration OD600 Optical Density at 600nm Padj Adjusted p-value of the fold-change calculation as determined by DESeq2 PBMC Peripheral blood mononuclear cells pRRC C. jejuni integrative plasmid containing a Chloramphenicol resistance marker rpm Revolutions per minute SCFA Short chain fatty acid T Trimethoprim TCA Tricarboxylic acid or citric acid V Vancomycin   ix  Acknowledgements  I would like to acknowledge and thank my supervisor Dr. Erin Gaynor for her full support of this project, her scientific guidance and also for allowing me the freedom to explore. I thank the Wellcome Trust Sanger Institute for performing RNA sequencing services, I thank Dr. Julian Parkhill and his lab for hosting my bioinformatics training on site, especially Dr. Christine Boinett who mentored my analysis of the RNA sequencing data. I am grateful to Dr. Charles Thompson and Dr. William Mohn for agreeing to become members of my thesis committee, for their critical evaluation of my progress, and for providing constructive criticism, questions, and suggestions during all stages of this project. I am particularly grateful to Dr. Michael Murphy and Dr. Anson Chan for scientific expertise, enlightening suggestions, and invaluable support. Also, I thank the past and present members of the Gaynor lab as well as Dr. Jan Burian for scientific discussions, sound advice, and keeping me on track.  I acknowledge Dr. Neil Ambrose and Sunrise Poultry Processors ltd. for supplying chicken samples, and the many volunteers for their timely sample donations. Without their contributions this project could not have been initiated.   I acknowledge the financial contributions of the Canadian Institute for Health Research (CIHR) Canada Graduate Scholarship for supporting this work, the Wellcome Trust Sanger Institute for supporting RNA sequencing services, and the CIHR Michael Smith Foreign Study Supplement for funding my travel to the UK to train at the Wellcome Trust Sanger Institute.     x  Dedication       To Science, for being so darn intriguing and confounding both at the same time.  And to my family, for trying so hard to understand what I studied.   1 Introduction 1.1 Campylobacter jejuni  1.1.1 General background Campylobacter spp. are Gram-negative helical epsilon proteobacteria and are considered to be one of the most common causes of food-borne gastroenteritis worldwide in both developed and developing nations [1, 2]. In 2010, Campylobacter species caused an estimated 96 million illnesses worldwide [2]. The majority of human Campylobacter infections are caused by two Campylobacter species: C. jejuni (88%) and C. coli (9%) [3]. In Canada, C. jejuni was ranked as the top bacterial cause of foodborne illness between 2000 and 2010 [4]. In the United States, C. jejuni caused 1,088 hospitalizations and 9 deaths in 2014 alone [3].  C. jejuni zoonotically colonizes the digestive tracts of livestock, domestic and wild animals without causing disease [5, 6]. The incidence of C. jejuni colonization in livestock animals such as poultry, pigs and cattle can be as high as 90% [7, 8]. The incidence in domestic pets such as dogs and cats is generally lower and ranges between 4% - 25% [6, 9, 10]. The prevalence of C. jejuni in multiple environments may be caused by spreading through wild birds such as crows, pigeons, ducks and other small birds where incidence rates for C. jejuni has been observed to be as high as 40% [9, 11].  C. jejuni infection in humans is often associated with sporadic cases or localized outbreaks caused by ingestion of contaminated meat, particularly chicken, drinking contaminated unpasteurized milk or water, and improper animal handling [1, 12, 13]. Accidental ingestion with as little as a few hundred bacterial cells can cause severely debilitating disease in humans ranging from mild to bloody diarrhea, nausea, and vomiting [14]. The disease is generally self-limiting and does not require treatment other than rehydration; however immunocompromised people, people over the age of 60, and those with other illnesses may require hospitalization [15]. People showing severe symptoms are generally treated 2  with fluoroquinolone (e.g. ciprofloxacin) or macrolide (e.g. erythromycin) antibiotics. However, increasing rates of resistance to these antibiotics are being reported and represents a major public health concern [16].  1.1.2 C. jejuni growth and stress response C. jejuni is thermotolerant and grows optimally between 37°C and 42°C in a capnophilic environment consisting of > 6% CO2, and is commonly grown microaerobically (12% CO2, 6% O2) in the laboratory. These growth conditions are found in the microaerobic/anaerobic intestinal environment of C. jejuni hosts, where body temperatures range from 37°C in humans, ~38°C to 40°C in cows, cats, dogs, and pigs, and 41° to 43°C in chickens [17].  During transition from host to host, C. jejuni encounters cooler, aerobic environmental conditions and variable osmotic pressures. While C. jejuni does not grow under aerobic conditions or at temperatures lower than 30°C, it is capable of maintaining measureable viability for up to several weeks [18-20]. C. jejuni is sensitive to high osmotic pressure, and shows reduced growth rate in media containing 1% w/v sodium chloride (NaCl) and does not grow at all in media containing > 2% w/v NaCl [19, 21, 22].  Upon infection of a new host, C. jejuni must survive the acidic stomach transit and high bile concentrations of the stomach and small intestine. C. jejuni survives for a short time (< 60 minutes) in media at pH <3, maintains viability in media at pH 4, and grows in media at pH >5 [20, 23]. C. jejuni is also able to survive in media containing up to 5% w/v bile, or containing up to 1% of the bile salt sodium deoxycholate [24, 25]. These studies indicated that while C. jejuni growth is limited outside of the host intestinal environment, it is able to tolerate and survive in a wide variety of stresses encountered during host transition. Transcriptomic characterization of C. jejuni responses to heat shock, acid, oxidative, osmotic and nitrosative stresses have shown moderate overlap in gene regulation. C. jejuni responded to heat shock at 42°C by changing the expression of a large number of genes, the most highly and rapidly upregulated 3  of which included genes encoding chaperones and heat shock proteins such as groEL, groES, dnaK, dnaJ, and hspR [26]. C. jejuni exposed to acid stress showed increased expression of heat shock genes such as hrcA, dnaK, groES, and groEL, oxidative response genes such as katA and perR, and genes involved in iron acquisition [27]. In two studies, the most highly upregulated genes upon acid stress were iron uptake genes, particularly of the iron uptake system encoding the p19 periplasmic protein [28, 29]. C. jejuni grown in the absence and presence of iron and then exposed to hydrogen peroxide stress showed differential expression of 25 and 26 genes respectively, 11 of which were common in both iron conditions [30]. Interestingly, oxidative stress genes such as ahpC, katA and sodB, the heat shock responsive gene grpE, and the iron responsive gene p19 only showed comparatively higher expression under hydrogen peroxide stress when iron was present, however this was expected to be a result of already high expression of these genes when cells are grown under iron restricted conditions. C. jejuni exposed to high osmotic stress increased expression of heat shock (e.g. hrcA,  dnaK, groEL) and oxidative stress genes (sodB and katA), as well as various other genes involved in amino acid and ATP synthesis [21]. C. jejuni exposed to nitric oxide stress led to increased expression of genes in the nitric oxide regulon (e.g. nssR, cgb, and ctb), heat shock genes such as hrcA, grpE, and dnaK, oxidative stress genes such as trxA and trxB, and multiple iron responsive genes, the most highly upregulated of which was p19 [31]. These studies demonstrated that C. jejuni relies heavily on the heat shock, oxidative, and iron responsive response systems in order to adapt to different types of stresses during host transition. 1.1.3 Biofilm formation Despite the sensitivity of C. jejuni to oxygenated environmental conditions, it is still commonly found in watersheds, on meat, and on the surfaces of produce [32, 33]. The prevalence of C. jejuni is in part attributed to its ability to form and survive within biofilms, which are able to protect C. jejuni from environmental stresses. In the lab, C. jejuni is able to form monospecies biofilms at the liquid air interface on multiple types of surfaces such as animal tissue, plastic, glass and stainless steel [34-36]. 4  Some studies have shown that biofilm formation in C. jejuni is enhanced under aerobic or low nutrient stress [35, 37, 38], which supports biofilm formation as a stress survival mechanism. C. jejuni monospecies biofilms are chemically simple and unstructured [34], and consist of a mixture of extracellular DNA, proteins, lipids, and polysaccharides [39-41]. In nature, however, biofilms often consist of a mix of bacteria. Multiple studies have found that C. jejuni is better able to survive environmental stresses when grown in biofilms with other bacteria such as Pseudomonas aeruginosa, Staphylococcus aureus, and Salmonella enterica [34, 42]. In these systems, scattered clumps of C. jejuni could be found within the biofilm structure, but C. jejuni was never the major constituent of the biofilm. It is likely that C. jejuni benefits from the structured shelter of the biofilm matrix and reduced oxygen environment created by these other aerobic bacteria [42]. As a result, C. jejuni residing in biofilms may be better able to survive environmental stresses and therefore enhance its chances of host infection and colonization. 1.1.4 C. jejuni metabolism  C. jejuni typically relies on uptake of amino acids, short chain fatty acids (SCFA), and citric acid (TCA) cycle intermediates as nutrients for growth. Most acutely, C. jejuni is known to use the amino acids serine, aspartate, glutamate, and proline, and the SCFAs acetate and lactate as sole carbon sources [43, 44]. The metabolism of such amino acids and SCFAs generates pyruvate, fumarate and oxaloacetate that are fed into the TCA cycle for energy production. C. jejuni can also directly import TCA cycle intermediates such as 2-oxoglutarate, succinate, fumarate, and malate using the KgtP, DcuA and DcuB transporters [43, 44]. C. jejuni is considered largely asaccharolytic because it does not encode transporters for common sugars like glucose and galactose, nor does it possess key glycolytic enzymes for carbohydrate metabolism [43]. However, approximately half of C. jejuni isolates are able to chemotax towards, bind, transport, and utilize fucose, a sugar found in food, mucin and cells, which may provide a growth and colonization advantage [45-47].  5  C. jejuni requires trace metals and micronutrients such as iron, molybdate, tungstate, copper, zinc, cobalt and nickel for cellular metabolism and host colonization. Iron is required for formation of iron-sulfur complexes, which are necessary for the function of key enzymes in C. jejuni growth [43]. Molybdate and tungstate are required for several key enzymes in C. jejuni respiration, including nitrate reductase, sulphite oxidase, SN oxide reductase, and formate dehydrogenase [48]. Bacteria also possesses many other metalloproteins which require magnesium, copper, zinc, nickel and other trace metals for protein stability or catalytic activity; however, these metalloproteins are not well characterized in C. jejuni [43, 49, 50].  1.2 C. jejuni host colonization 1.2.1 Colonization in chickens The most common reservoir of Campylobacter is in poultry, particularly chickens. Chicks are hatched free of Campylobacter and remain Campylobacter free for the first few weeks likely due to the presence of maternal anti-Campylobacter antibodies [51, 52]. Chickens are exposed to Campylobacter through numerous avenues including contact with contaminated livestock, humans, wild birds, and pests, ingesting contaminated water or feed, or being exposed to contaminated bedding, water and air [53, 54]. Upon infection, C. jejuni colonize chickens ceca to concentrations as high as 1010 cfu/g cecal material without causing pathology [5, 55]. However, chickens do appear to mount an anti-Campylobacter immune response, and culturable Campylobacter has been found in various chicken organs including the spleen, lymph nodes, and liver without obvious damage to the host [55, 56].  Furthermore, the strength of the chicken immune response to C. jejuni does not appear to impact cecal colonization [55]. The high colonization rates and high tolerance that chickens have for C. jejuni make them one of the most common sources for human infection. 6  1.2.2 Pathogenesis in humans Human infection can occur after ingestion of a few hundred C. jejuni cells. In one study, 5 out of 10 volunteers were infected after ingestion of 800 cells, and 6 out of 10 were infected after ingestion of 8000 cells [14].  However, the infective dose can vary depending on the C. jejuni strain. Additional experimental infection in human volunteers showed that increasing the infectious dose results in higher incidence of colonization, reduced time for disease progression, and increasing disease severity [57]. While some people remain asymptomatic upon exposure to Campylobacter colonization, many infected people show symptoms of Campylobacteriosis which include mild to severe diarrhea, bloody stool, nausea, vomiting, and malaise which can start as early as 17 hours after ingestion and last from days to weeks [4, 57, 58]. During this time, the intestinal tract, particularly the ileum and colon, is colonized by Campylobacter and there is an increase in inflammatory cytokines (particularly Interferon-γ) produced by peripheral blood mononuclear cells (PBMCs) [59]. After infection, humans develop an antibody mediated immune response where there is an increase in serum C. jejuni specific IgG, IgM, and IgA as early as a week after infection [57, 58]. However, any protective immunity to C. jejuni is short lived as re-challenge with the same strain of C. jejuni as early as 1-2 months after the initial infection often resulted in reinfection and disease progression [58, 59]. Long term sequelae have also been linked to C. jejuni infection. C. jejuni infection may lead to development of chronic inflammatory bowel diseases, such as Crohn’s disease and ulcerative colitis, as well as colorectal cancer [60]. While the root cause is still unknown, these effects may be a result of dysregulation of the intestinal microbiome and host immune responses. C. jejuni has also been linked to the development of autoimmune inflammatory demyelination diseases such as Guillain-Barrè and Miller-Fisher syndromes, where antibodies against C. jejuni lipooligosaccharides also cross-react with and attack the structurally similar moieties present on human gangliosides [61]. Because of these 7  possible sequelae experimental infection of C. jejuni in humans has been rare and uses strains that do not synthesize the ganglioside mimics [62].  1.2.3 Virulence factors Despite extensive study, one of the most enigmatic questions is still why C. jejuni causes disease in humans but not in other animals (e.g. chickens). C. jejuni possesses a multitude of factors which allow host colonization such as a polar flagella, secreted Campylobacter invasion antigens (Cia), helical cell shape, and cell surface adhesins, [63, 64]. The polar flagella enable motility, chemotaxis, and secretion of Cia into host cells. Multiple Cia proteins (e.g. CiaB, CiaC, CiaD, and CiaI) have been identified that are involved in host cell invasion and intracellular survival [65-69]. The helical shape allows efficient burrowing through viscous mucosa [70]. Cell surface adhesins such as CadF and FlpA bind fibronectin and allow attachment and invasion of host cells [65, 71]. Compromising these factors reduces the ability of C. jejuni to colonize intestinal epithelial cells in vitro and live chicks in vivo, however none have been directly correlated with onset or severity of diarrheal symptoms in humans.  C. jejuni also has a cytolethal distending toxin system (CdtA, CdtB, and CdtC) that impacts host cell division [72]. However, the complete CdtABC system is not present in all C. jejuni strains [73-75] with prevalence ranging from 39% to 89% depending on the species from which the C. jejuni was isolated. Furthermore, the presence of CdtABC did not correlate well with disease severity in humans [73]. The relatively small ~1.6 Mb sequenced genome lacks many of the virulence traits that are known to be important for bacterial pathogenesis such as pathogenicity islands and Type III secretion systems. However the best annotated C. jejuni genome (that for strain NCTC 11168) still contains a large number of unannotated genes (782/1572; 50% of the genome), and 192 genes (12% of the genome) are still designated with “hypothetical protein” with no known homology. Therefore, additional as yet unidentified virulence factors may be present that contribute to human pathogenesis.    8  1.3 Fecal microbiome and metabolome 1.3.1 Human large intestine and chicken cecal microbiome The healthy human gut microbiome is mainly composed of two bacterial phyla, the Bacteroidetes and Firmicutes [76]. While the phylum level composition and abundance is relatively stable between individuals, the genus and species level compositions are highly variable both over time and across different human populations [77]. Efforts to identify a core human microbiome have been unsuccessful due to this high variability; however, some bacterial species, such as Escherichia coli, Faecalibacterium prausnitzii, Roseburia intestinalis, and Bacteroides uniformis are commonly found in the majority of human samples [77].  Similar to the human gut microbiome, the cecal microbiome of boiler hens consist mostly of members from the Firmicutes, Bacteroidetes, and Proteobacteria phyla, and members of the genera Clostridia, Lactobacillus, Faecalibacterium, Ruminococcus, and Bacteroides are commonly identified [78-81]. However, the cecal microbiome composition and abundance at the genus level are also variable within and between studies. The chicken cecal microbiome is affected by multiple factors, including but not limited to chicken age, genotype, geographic location, feed composition (protein, fat and fiber levels), farming practice (cage vs. free-range, and clean vs. reused litter), and C. jejuni infection [78, 79, 81, 82].  While the bacterial genus and species identities of microbiota differ widely between populations , it has been suggested that the core functional profile of the microbiome remains relatively consistent between individuals of the same species [77]. In silico functional characterization of biochemical pathways putatively encoded by the human gut microbiome reveals that it is likely able to perform a large array of metabolic processes [83]. These bioinformatic studies suggest that the human microbiome encodes multiple pathways for amino acid metabolism, carbohydrate metabolism, lipid metabolism, and short chain fatty acid (SCFA) production (e.g. formate, acetate, propionate, butyrate etc.). The 9  microbiome also encodes numerous likely biosynthesis pathways for secondary metabolite and vitamin production, as well as degradation pathways for cellulose, bile, and halogenated aromatic compounds [83]. The intermediates and products of these metabolic processes would contribute to the diversity of extracellular metabolites that are utilized both by the microbiota as well as the host.  Similar biochemical pathways have also been identified through functional characterization of the chicken microbiome in comparison to the human microbiome [81, 84]. However, due to the different intestinal structure (ceca vs. large intestine), digesta transit (shorter transit time in chickens), and different diet between human and chickens, chicken microbiota are believed to be more adapted to utilize simple sugars and peptides, and to produce greater concentrations of SCFAs than the human microbiome [85]. These differences in the functional profile of the chicken and human microbiomes may contribute to differences in levels of intestinal metabolites.   1.3.2 Intestinal metabolome Host intestinal systems are a complex mixture of food and food breakdown products, digestive products, the microbiome, and host defense systems. In addition, the microbiome also produces compounds which allow signalling and modulation of the community structure [86]. Thus, the non-cellular milieu of intestinal contents consists of a complex mix of thousands of metabolites [87-89]. These include metabolites from multiple classes such as lipids, amino acids, nucleotides, peptides, vitamins, carbohydrates and a large number of unnamed and unidentified molecules [90]. Some metabolites that are associated with bacterial metabolism include SCFAs (e.g. acetate, propionate, butyrate, and valerate), organic acids (e.g. benzoate, hippurate, phenylacetate, and phenylpropionate), and vitamins (B1, B2, B5, B8, B9, B12, niacin, and vitamin K) [91]. Metabolites associated with bacteria mediated transformation and breakdown include bile salt (e.g. cholate, deoxycholate, and hyocholate), polyphenol (e.g. hydroxycinnamic acids and flavonoids), lipids (e.g. glycerol), and various amino acids 10  [91]. Numerous fecal metabolomics studies comparing metabolite profiles after antibiotic treatment, and in association with intestinal pathologies such as inflammatory bowel disease, Chrone’s disease, and colorectal cancer have shown that the fecal metabolome is a dynamic system that may respond to and contribute to intestinal health [88, 91-94]. The impact this complex mixture of metabolites has on members of the commensal microbiome or pathogens has been poorly studied. In one recent study, exposure of Salmonella to mouse and human intestinal metabolites was shown to cause an increase in the expression of genes related to metabolism, motility and chemotaxis, and a reduction in expression of genes involved in host cell invasion relative to broth-grown bacteria [87]. This study highlighted that the intestinal metabolites modulate bacterial gene expression, and that bacteria change patterns of gene expression to better adapt to host environments.   1.4 Objective of the present study The sites of the highest levels of C. jejuni colonization in chicken and humans are the ceca and the human large intestine, respectively. The purpose of this study is to expose C. jejuni to sterile extract isolated from both of these locations in order to compare C. jejuni responses to the chemical composition of human vs. chicken intestinal environments. Human fecal extracts will be used as a proxy for the human large intestine metabolome in this study. It is hypothesized that C. jejuni exposed to human fecal extracts will respond by altering expression of genes specifically required for human colonization or pathogenesis. In order to do this sterile, cell-free extracts from adult human feces and chicken cecal material will be collected, and C. jejuni physiological responses and gene expression differences will be measured after exposure to the extracts from the zoonotic host (chickens) versus the disease susceptible host (humans). The objective is to identify genes which have not yet been associated with C. jejuni colonization or pathogenesis in humans. Results showed that one poorly characterized, but highly conserved, iron uptake system was 11  more highly expressed when C. jejuni was exposed to media containing extracts versus media alone, and especially in human fecal extracts in comparison to chicken cecal extract. A deletion mutation was created of the putative inner membrane and periplasmic components of this iron uptake system, and C. jejuni growth, iron uptake, stress response, and antibiotic resistance was characterized.    12  2 Methods 2.1 Ethics statement Written and informed consent was obtained from all human fecal sample donors as described in the ethics application H13-00859, which was approved by the University of British Columbia Clinical Research Ethics Board.  2.2 Bacterial strains and growth conditions Campylobacter jejuni jejuni strain 81176, originally isolated from a Campylobacteriosis outbreak in 1985 [13], was grown in Mueller-Hinton (MH; Oxoid) broth or agar (1.5% w/v). MH was supplemented with antibiotics where noted and appropriate: vancomycin (V; 10 µg/mL), trimethoprim (T; 5 µg/mL), kanamycin (Km; 50 µg/mL), and chloramphenicol (Cm; 20 µg/mL). Agar plates and standing cultures were incubated at 38°C under microaerobic and capnophilic conditions (12% CO2 and 6% O2 in N2) in a Sanyo tri-gas incubator (hereafter this growth condition - 12% CO2 and 6% O2 in N2 - is referred to only as “microaerobic” for simplicity). Shaking broth cultures were incubated microaerobically in airtight containers with the Oxoid CampyGen Atmosphere Generation System at 38°C and shaken at 200 rpm. Growth rate experiments were performed by inoculation of log phase cells from 15 – 18 hour overnight shaken cultures into fresh media at an OD600 of 0.005 unless otherwise stated. Cell growth was assessed by making 10X serial dilutions in MH, drop plating 10 µL onto MH plates, incubating the plates microaerobically at 38 °C for 22 to 30 hours, and enumerating the number of colonies at the dilution containing ~10 to 100 colonies. The limit of detection for this plate count method is 103 cfu/mL .  Escherichia coli strain DH5α (F– Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1; Invitrogen) was used for cloning. E. coli was grown aerobically at 37°C and shaken at 200rpm in lysogeny broth - Luria (LB; Sigma), or incubated aerobically at 37°C on 13  LB agar (1.5% w/v) supplemented with chloramphenicol (20 µg/mL) and kanamycin (50 µg/mL)  for selection. Deletion and complementation mutants of the CJJ81176_1651 to 1656 genes in C. jejuni 81176 are prepared as detailed below. A ∆p19 deletion and complement (p19C) were obtained from Dr. Anson Chan in Dr. Michael Murphy’s lab at the University of British Columbia [49].  2.3 Chicken cecal sample collection  Chicken gut pouches were obtained from Sunrise Poultry Processors Ltd in Surrey, British Columbia in Jan-2015. The samples were taken straight off the processing line where the unbroken gut sacks (crop to anus) were removed intact from the recently slaughtered chickens. The gut sacks were severed between the gizzard and the duodenum, and the portion containing the ceca was packed in individual bags and transported immediately to UBC on ice. Cecal material was extracted by making an incision at the distal tip of each cecal pouch and transferring the cecal material directly into pre-weighed 50 mL tubes. The material from both cecal pouches per chicken was pooled and weighed, and extract was prepared as per Section 2.5 within 20 hours receiving the samples.    2.4 Human fecal sample collection  Human fecal samples were collected from 11 volunteers between Nov-2014 to Apr-2015. All volunteers were healthy adults aged between 22 and 51 (Figure 1A). There was a total of 6 males and 5 females. Fecal samples were collected using containers provided by the specimen collection system (Fisher Scientific) and refrigerated within 20 minutes of collection. Each sample was given a study identifier (H1 to H11). Extract was prepared as per Section 2.5 within 8 hours of receiving the fecal samples. Fecal material was transferred into pre-weighed 50 mL tubes prior to extract preparation.  14  2.5 Extract preparation Chicken cecal and human fecal samples were weighed and diluted using sterile water at a ratio of 1:1 to 1:1.5 (w:v) depending on dryness and solidity of material in order to ensure consistency of final homogenate. 8-15 glass beads (4 mm diameter) were added to the material and the mixture was homogenized by vortexing at maximum speed. The homogenate was mixed by inversion at 4°C for 30 minutes. The tubes were centrifuged at 10,000g for 30 minutes and the supernatant was transferred to a new tube in order to separate out solids. Centrifuging was repeated 3X to 6X as necessary to remove solid materials and mucus. The resulting supernatant was filtered sequentially through 5 µm, 0.45 µm containing a 1 mm pre-filter, and 0.2 µm filters to sterilize. The sterile extract was frozen in 1 mL aliquots in a -20°C freezer. Samples were pooled as noted in Figure 1C. Some solid precipitate was observed in the human extracts after freeze thaw so the human fecal pools were filtered again through 0.2 µM filters. The pH of the extracts was measured using a pH meter (SB20, VWR). Sterility of pooled extracts were confirmed by no observable bacterial or fungal growth after inoculation of a drop of extract onto the surface of MH and LB plates and incubating them microaerobically at 38°C and aerobically at 37°C (respectively). Pooled extract was stored frozen at -20°C. 2.6 Biofilm assay Overnight log phase C. jejuni were inoculated at an OD of 0.02 into 1 mL of MH-TV or MH-TV containing 10% extract in borosilicate glass tubes. The cultures were incubated microaerobically at 38°C without agitation. At 12, 24 and 36 hours the tubes were removed from incubation and 20 µL of culture 2 mm below the surface was diluted and plated for planktonic cell count. The cultures were then stained by addition of 250 µL crystal violet (1% in ethanol) and incubated at room temperature for 10 to 15 minutes. The tubes were rinsed with H2O, dried overnight, and destained by adding 1.5 mL of destaining solution (30% methanol and 10% acetic acid in ethanol), vortexing the tube, and incubating for 24 hours. 15  The total amount of biofilm was quantified by measuring absorbance at 570nm using the Varioscan Flash Spectrophotometer (Thermo Scientific).  2.7 RNA extraction and sequencing  C. jejuni from 15 – 18 hour overnight cultures were inoculated into fresh MH-TV broth at an OD of 0.04 and incubated microaerobically shaking at 38°C for 4-5 hours in order to obtain optimal log growth. MH-TV + 30% extract was prepared by combining 0.5 mL of 2X MH-TV, 0.3 mL of extract (CP, HP1, HP2, or HP3), and 0.2 mL of sterile ultrapure H2O (0.5 mL for the control MH-TV condition). The standardized C. jejuni was inoculated into 24 well plates containing 1mL of either the control MH-TV or MH-TV containing extract at an OD of 0.25 for the 20 minute conditions and 0.06 for the 5 hour conditions in order to ensure comparable numbers of cells during harvest and RNA preparation. RNA was extracted from a total of 20 different conditions: C. jejuni 81176 exposed to 5 different media conditions (MH-TV, MH-TV + 30% CP, MH-TV + 30% HP1, MH-TV + 30% HP2, and MH-TV + 30% HP3), collected at 2 different incubation times (20 minute and 5 hour), and performed in duplicate on two different days. RNA from all samples was extracted by adding 0.1 mL of 10X stop solution (5% phenol in ethanol) to the 1 mL cultures to stop transcription. The cells were pelleted by centrifuging at 11,000 rpm for 5-10 minutes, washed once with 1X stop solution, and resuspended in 50 µL of 0.4 mg/mL lysozyme in TE (10 mM Tris pH8, 1 mM EDTA). The mixture was incubated for 5 minutes before 950 µL of TRizol reagent (Ambion) was added and the mixture was vortexed at maximum speed for 1 minute. 200 µL of molecular biology grade chloroform (Fisher) was added to the mixtures, manually shaken for 15 seconds, incubated at room temperature for 2 minutes, and then spun at 12000 rpm for 15 minutes at 4°C. The aqueous phase was added to an equal volume of 70% EtOH and vortexed briefly before transferring the samples into RNeasy Mini columns (Qiagen). 350 µL of the RW1 buffer was used to wash each column prior to on on-column DNAse treatment (Qiagen) with 80 µL of RNAse-free DNAse in RDD buffer for 30 minutes to 1 hr. Following the incubation, 350 µL of the RW1 buffer was added to the 16  column and spun at 12K rpm for 15 s. Manufacturer’s directions were used for the remaining steps as per the RNeasy Mini kit. RNA purity was verified by gel electrophoresis and measurement of A260/A280 using the ND-1000 NanoDrop Spectrophotometer. 2.8 RNA sequencing data analysis RNA samples were shipped to the Wellcome Trust Sanger Institute (WTSI) on dry ice. Sample preparation, RNA sequencing, mapping and annotation were performed at WTSI. Briefly, RNA purity was re-verified using the Agilent Bioanalyzer and samples were prepared for high throughput sequencing using the Illumina TruSeq sample preparation kit. The samples were run on the Illumina HiSeq 2500 system with >600 fold coverage. The raw Illumina reads were mapped and assembled onto the C. jejuni 81176 genome using the WTSI automated mapping and assembly pipeline. The resulting data reported the number of reads per gene for each of the 20 conditions. The mapped and annotated data was analyzed for fold change using the DESeq2 package in Rstudio. The raw read data was adjusted using the rlog transformation in order to compare genes with low read count. Differential gene expression was determined at 20 minute and 5 hour exposures for C. jejuni exposed to MH + human extract (HP1, HP2, and HP3) versus MH + chicken extract (CP) (i.e. human vs. chicken), and MH + extract (HP1, HP2, HP3, CP) versus MH alone (i.e. extract vs. MH) using the DESeq command.  2.9 Inductively coupled mass spectrometry (ICP-MS) 0.5 mL of each CP, HP1, HP2 and HP3 were added in duplicate into microcentrifuge tubes and dried overnight using a SpeedVac Concentrator (DNA 120; Thermo) at low power. Samples were tested at Dr. Michael Murphy’s lab (UBC, Microbiology and Immunology) using ICP-MS. Briefly samples were digested in 1% nitric acid and heated in a closed Savillex vessel using a hot plate. 100ppb scandium (Sc) and indium (In) were added as internal standards. ICP-MS was conducted using the Perkin Elmer NexIonTM 300D ICP-MS instrument.  17  2.10 Assessment of protein domains The Simple Modular Architecture Research Tool (SMART) in Genomic mode was used to determine protein domains, signal peptides, and PFAM domains for the amino acid sequences of CJJ81176_1649 to 1656 (http://smart.embl.de/) in Sep-2016. SMART uses SignalP v4.0 for detection of the presence of signal peptides, and TMHMM v2.0 for detection of transmembrane domains [95].  2.11 Homology screening Homologs of CJJ81176_1649 to 1656 were identified using the NCBI online database with the blastn and blastp suites. The list of homologs returned all Campylobacter results. To identify homologs in non-Campylobacter organisms, the “Campylobacter (taxid: 194)” group was excluded. The resulting lists were screened by assessment of the resulting score and homolog coverage. Where results showed multiple species for one genus, one organism was selected for additional inspection. The genome for the representative strains per species were downloaded from NCBI between Sep-2016 and Oct-2016 and visualized using Artemis. The genomic regions for homologs of CJJ81176_1649 to 1656 were identified by mapping the amino acid sequences from BLAST results to the selected organism and further inspection of the surrounding regions. Percent amino acid identity was determined by comparing the CJJ81176_1649 to 1656 protein sequences with the corresponding amino acid sequence for each organism using BLAST Needleman-Wunsch Global Align.  2.12 Creating the ∆1651-1656 deletion mutants The Cjj81176_1651 to 1656 deletion (∆1651-1656) was prepared using a modified Gibson assembly protocol with the NEBuilder HiFi DNA Assembly kit (NEB). 676 bases upstream of CJJ81176_1651 and 535 bases downstream of CJJ81176_1656 was PCR amplified using IProof DNA polymerase (BioRad) and primers ML1651u5’ and ML1651gu3’, and ML1655gd5’ and ML1655d3’ as shown in Table 1. Primers ML1651gu3’ and ML1655gd5’ were designed to have a complementary 18  overhang to allow attachment of the Km antibiotic cassette. The Km resistance cassette was amplified from the plasmid pRRK (obtained from J. Ketley) with IProof polymerase and primers MLkanRgu5’ and MLkanRgd3’. The three PCR fragments were purified using the DNA Clean & Concentrator Kit (Zymo Research) and annealed as per manufacturer’s directions (NEBuilder). The resulting annealed fragment was PCR amplified using primers ML1651u5’ and ML1655d3’ and purified. C. jejuni was naturally transformed using the PCR fragment. Briefly, 30 µL of the PCR DNA was mixed with a loop of C. jejuni cells from an overnight plate and incubated overnight on an MH plate before being spread plated onto MH-Km plates for selection. The genomic deletion was confirmed by PCR using primers ML1651u5’ and ML1655d3’. The deletion strain was stored at -80°C in MH + 40% glycerol.  Table 1. List of primers used in this study.   Primer ID Description Primer Sequence Restriction SiteML1651u5' Upstream of CJJ81176-1651 GAACCGATTTTATGGCTTGG N/AML1651gu3'Upstream of CJJ81176-1651  with sticky ends to attach KmRGTCGACCTCGACTAGAACACTCGGAAAATCCGAGTGTAAAATCATTTTGGCGTGCCTGTGN/AMLkanRgu5' KmR with upstream sticky endGATTTTCCGAGTGTTCTAGTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGN/AMLkanRgd3' KmR with downstream sticky endATGGCACTTGAAAGGGAACTAGTGGATCCCGGCCTCAGGCACGCAAGCTTTTTAGACATCN/AML1655gd5'Downstream of CJJ81176_1655  with sticky ends to attach KmRGGGATCCACTAGTTCCCTTTCAAGTGCCATTGGGGAAATATATGGAGTGCCTGTGCTTAGN/AML1655d3' Downstream of CJJ81176-1655 CTCACTCTTACGCAAGCTAAG N/AML165116565' Upstream of gene CJJ81176-1651 CATTCTAGAGCCATGTTGATGAAGAAACAG XbaIML165116563' Downstream of gene CJJ81176-1656 CATTCTAGAGATGGAAGCTATGAGCTTTATGG XbaIFor Deletion MutantFor Complement19  2.13 Creating the 1651-1656C complement The CJJ81176_1651 to CJJ81176_1656 gene region was PCR amplified using IProof High Fidelity DNA Polymerase (BioRad) from C. jejuni 81176 using primers ML165116565’ and ML165116563’ (Table 1). The PCR product and plasmid pRRC, obtained from [96], was restriction digested using XbaI (NEB) and ligated overnight at 16°C using T4 DNA Ligase (NEB). The ligated product was incubated on ice with chemically competent E. coli DH5α for 20 minutes, heat shocked for 45s at 42°C, incubated at 37°C with LB for 1 hour, and then spread onto LB-Cm agar plate for colony selection after 24 hour incubation at 37°C. The presence of plasmid in the E. coli colonies was confirmed by colony PCR using primers ML165116565’ and ML165116563’, and the insertion was confirmed by sequencing. Plasmids were amplified from E. coli by inoculating 200 mL of LB with the transformed E. coli cells and incubating shaken at 37°C overnight. The plasmids were purified using the HiPure Plasmid Filter Midiprep Kit (Invitrogen) as per manufacturer’s instructions. The plasmids were transformed into C. jejuni Δ1651-1656 by incubating the cells with 15 µL of plasmid overnight on an MH plate incubated microaerobically at 38°C, then spread plating onto MH-Cm plates and incubating microaerobically at 38°C for 3 – 5 days. Complements were confirmed by preparing genomic DNA using the Promega DNA extraction kit and sequencing using primers ML165116565’ and ML165116563’. Complements were stored at -80°C in MH + 40% glycerol.  2.14 Iron depletion and supplementation Log phase 81176, ∆1651-1656, 1651-1656C, ∆ p19, and p19C from 15-18 hour overnight cultures were inoculated at 0.005 OD into 3 mL of control MH or MH containing 15 µM and 20 µM of the ferric iron chelator desferroxamine mesylate (DFO) or 100 µM of the supplement iron (III) citrate (Sigma). The cultures were incubated shaking microaerobically at 38°C. Cells were enumerated as described in Section 2.2 at 0, 12 and 24 hours in order to measure growth.  20  2.15 Hydrogen peroxide testing Log phase 81176, ∆1651-1656, 1651-1656C, ∆ p19, and p19C from 15-18 hour overnight cultures were inoculated at 0.005 OD into 3 mL of MH and incubated shaking microaerobically at 38°C.  After 6 hours growth, 3.7 µL of 3% H2O2 (Sigma) was added into the tubes for a final concentration of 1 mM H2O2 and returned to shaking incubation. Growth and survival were enumerated as described in Section 2.2 at 0, 6, 9, and 12 hours.  2.16 Acid stress testing Acidic MH was made by adding 1 mL of 1 N HCl into 20 mL of MH, and the pH was measured using a pH meter (SB20, VWR). Log phase 81176, ∆1651-1656, 1651-1656C, ∆ p19, and p19C from 15-18 hour overnight cultures were inoculated at 0.005 OD into 3 mL of MH at pH 5.07 and incubated shaking microaerobically at 38°C.  Growth was quantified as described in Section 2.2 at 0, 12, and 24 hours by plating for cell count.  2.17 Antibiotic screening Initial screening for minimum inhibitory concentration (MIC) was performed by preparing doubling dilutions of streptomycin, dihydrostreptomycin, apramycin, chloramphenicol, ampicillin, polymyxin B, ciprofloxacin, and erythromycin from 0.125 µg/mL to 128 µg/mL and adding 100 µL into a 96 well plate. 100 µL of log phase C. jejuni 81176 and ∆1651-1656 diluted to an OD600 of 0.04 was added to each plate and incubated for 48 hours at 38°C. The MIC was noted as the lowest antibiotic concentration at which no cell growth was visible. Additional growth measurements in the presence of streptomycin was performed for wildtype 81176, ∆1651-1656, 1651-1656C, ∆ p19, and p19C. Streptomycin was prepared in MH and MH + 100 µM iron(III) citrate at 32 µM, 16 µM, 8 µM, 4 µM, 2 µM, 1 µM, 0.5 µM, 0.25 µM, 0.125 µM, and 0.0625 µM. 100 µL of each dilution was added to the wells of a 96 well plate. Log phase 81176, ∆1651-1656, 1651-21  1656C, ∆ p19, and p19C from 15-18 hour overnight cultures were diluted in MH to an OD of 0.04 and 100 µL of the diluted cultures was added into the antibiotic plates. The final cell OD600 was 0.02 and the antibiotic concentrations were half of the prepared value. The plates were incubated at 38°C for 48 hours. The wells were mixed by pipetting and measured using the Varioscan Flash spectrophotometer OD600. 2.18 Statistics All data were analyzed and graphed using Microsoft Excel 2010 and Graphpad Prism 7. Statistical differences were calculated using Analysis of Variance (ANOVA) or the student’s T test as indicated.      22  3 Results 3.1 C. jejuni response to human fecal and chicken cecal extracts Sterile fecal extracts from 11 healthy human volunteers, 5 female and 6 male, were collected, homogenized with H2O, filter sterilized, and stored frozen at -20°C between Nov-2014 and Apr-2015 (Figure 1A). These samples were sequentially designated H1C, H2-H11. Media (MH-TV) + 30% extract was selected as the C. jejuni exposure condition based on preliminary optimization screening studies. This condition represented the highest percentage of extract that could be supplemented into MH media without impeding C. jejuni logarithmic growth (data not shown). Growth of C. jejuni exposed to MH + 30% of each human fecal extracts was measured at 12 and 24 hours to assess consistency of C. jejuni viability in the different human fecal extracts (Figure 1B). C. jejuni showed comparable growth in the presence of extracts H1 – H6 and in H10. Growth in the presence of H9 and H11 appeared slower after 12 hours and 24 hours, respectively, however showed comparable levels of growth to most extracts at other time points. Extract H7 was found to visibly hinder C. jejuni growth both at 12 and 24 hours of incubation, and extract H8 completely killed C. jejuni after a 12 hour exposure. The cause of the reduced viability in these two extracts is unknown, but they were excluded from the remainder of the testing. The remaining 9 human extract samples were combined into 3 fecal extract pools consisting of an equal volume of extracts from 3 donors per pool (HP1, HP2, and HP3; Figure 1C). Chicken cecal extract was prepared from cecal material collected from 35 boiler hens in Jan-2015, and samples were pooled to create the chicken pooled extract (CP). The pH of CP, HP1, HP2, and HP3 pooled extracts were measured to be 7.59, 7.55, 7.60, and 7.44 respectively. Logarithmic growth of C. jejuni in MH media containing no extract, 30% chicken extract, and 30% pooled human extract (HP1, HP2, and HP3) was comparable for the first 12 hours after inoculation, with doubling times for all conditions ranging between 1.9 and 2.2 hours (Figure 1D). After 12 hours, C. jejuni in MH showed a typical drop in viability.    23   Figure 1. Response of C. jejuni to extracts C. jejuni 81176 was exposed to human fecal and chicken cecal extract to evaluate viability, growth rate, and biofilm formation. (A) Sample ID (H= human, 1 – 11 = sequential collection number, C = third collection from this volunteer) with gender (F= female, M=male) and age information. (B) C. jejuni was screened for viability and growth in MH + 30% extract prepared from each human fecal sample. N.D. = Not Detected. Error bars represent standard deviation of 3 replicates. (C) The 35 chicken extracts were made into one pool and the 9 human extracts that best supported C. jejuni growth were assigned into 3 pools. (D) C. jejuni growth curve when exposed to MH, MH + 30% of the chicken pooled extract (CP), each of the 3 human pooled extracts (HP1, HP2, and HP3). (E) C. jejuni biofilm formation after 12, 24, and 36 hours as measured by the crystal violet assay (top) compared to the viable planktonic cell count in solution (bottom). Error bars represent standard deviation of 3 replicates. Statistical analysis for growth and biofilm formation was performed using the student’s t-test with Welch’s correction and compares MH + extract conditions (CP = red, HP1 = dark blue, HP2 = green, or HP3 = light blue) to the MH control (black) for each time point. P-value < 0.05 = *, p-value < 0.005 = **, p-value < 0.0005 = ***, p-value < 0.0001 = ****.   24  C. jejuni viability in MH containing both chicken and human fecal extracts remained significantly higher at 24 hours of growth before a drop in viability was observed at 36 hours. Biofilm formation in 10% extract was comparable to that seen in 30% extract (optimization data not shown), thus to conserve the limited volume of extract, 10% extract was used for the biofilm assay. Biofilm formation for C. jejuni exposed to 10% chicken cecal or human fecal extracts was comparable to or slightly higher than the control MH condition after 12 hours incubation, however was notably lower after 24 hours (Figure 1E). After 36 hours, biofilm formation was still lower for C. jejuni exposed to human fecal extracts. The reduction in biofilm formation for C. jejuni exposed to extract was not caused by differences in cell density, in fact, at 36 hours there was a higher number of planktonic cells in the cells exposed to HP2 and HP3.  3.2 RNA sequence results RNA was collected from C. jejuni exposed to MH only, MH + 30% CP, MH + 30% HP1, MH + 30% HP2, and MH + 30% HP3 after 20 minutes of exposure and after 5 hours of exposure for a total of 10 different conditions as shown in Table 2. This was performed twice to obtain duplicate replicates. The purpose of the short 20 minute exposure was to determine immediate, transient changes in transcriptional profile, and the long 5 hour exposure was to determine the adaptive homeostatic transcriptional profile. The differences in gene expression were calculated by grouping comparable treatments prior to assessment of fold change as shown in Table 2. For example, duplicates of C. jejuni exposed to MH + HP1, HP2 and HP3 extracts at 20 minutes (n=6) was used as one group for fold change comparative analysis.   Grouping similar treatment conditions allows greater statistical power to find differences in gene expression between biological conditions by increasing the n-number per comparative and taking into account the variation within each assessment group. Genes with fold change > 2 and a p-value <0.05 are shown for the two different evaluation conditions: 1) human fecal   25  Table 2. Grouping of conditions for calculation of fold change     extracts versus chicken cecal extract (i.e. human vs. chicken) in Table 3, and 2) MH containing extract vs. MH alone (i.e. extract vs. media) in Table 4.  Comparison of C. jejuni exposed to human fecal extracts versus chicken cecal extract showed 2 genes with higher expression for C. jejuni exposed to human fecal extracts after 20 minutes, and 12 genes with higher expression after 5 hours (Table 3). There were no genes showing reduced expression in media with human compared to chicken extracts. The 2 genes with higher expression in human extracts after 20 minutes (fdhT: 2.42 fold, and fdhU: 2.88 fold) were even more elevated at 5 hours (6.44 and 3.35 fold higher respectively). FdhTU is involved in formate dehydrogenase activity and contributes to the invasion and intracellular survival of C. jejuni in intestinal epithelial cells [97, 98]. The remaining 10 genes that were more highly expressed after 5 hours appeared to be involved in iron uptake and/or Extract vs. Media Human vs. ChickenMH onlyMH onlyMH + 30% CPMH + 30% CPMH + 30% HP1MH + 30% HP1MH + 30% HP2MH + 30% HP2MH + 30% HP3MH + 30% HP3MH onlyMH onlyMH + 30% CPMH + 30% CPMH + 30% HP1MH + 30% HP1MH + 30% HP2MH + 30% HP2MH + 30% HP3MH + 30% HP3Comparative Condition Groups20 Minutes5 HoursExposure TimeExposure Condition "Extract""Media""Media""Extract""Human""Chicken""Chicken""Human"Not UsedNot Used26  utilization. cfbpA, ceuB, and chuC, which were 2.78, 2.93, and 3.36 fold higher, are involved in uptake of chelated iron from transferrin, enterochelin, and haem respectively [99]. The remaining 7 genes (CJJ81176_1649, p19, CJJ81176_1651, CJJ81176_1652, CJJ81176_1653, CJJ81176_1654, and CJJ81176_1655) showed 2.51 to 2.85 fold higher expression and were consecutively organized. These genes encode a poorly studied iron uptake system that may recognize and transport iron bound by rhodotorulic acid, a fungal siderophore [99].   Table 3. C. jejuni genes showing > 2 fold difference in expression after 20 minute and 5 hour exposure to media containing human fecal extract versus media containing chicken cecal extract    Comparison of C. jejuni exposed to media with extracts (both human and chicken) vs. media alone showed 23 genes with higher expression and 18 genes with lower expression (Table 4). CJJ81176_0438 and 0439 displayed the highest increase in gene expression both at 20 minutes (4.50 and 4.42 fold higher) and 5 hours (11.83 and 12.08 fold higher). These genes encode oxidoreductases, and the homologous genes in C. jejuni strain 11168 (cj0414 and cj0415) were shown to be necessary for gluconate dehydrogenase (GADH) activity and optimal chick colonization [100]. Other genes that  FC* Padj** FC* Padj**CJJ81176_0211 cfbpA iron ABC transporter, periplasmic iron-binding protein 2.78 1.6E-02CJJ81176_1351 ceuB enterochelin ABC transporter, permease protein 2.93 1.6E-02CJJ81176_1492 fdhT membrane protein, putative 2.88 8.3E-03 6.44 1.3E-10CJJ81176_1493 fdgU conserved hypothetical protein 2.42 3.0E-02 3.35 9.0E-05CJJ81176_1603 chuC hemin ABC transporter, ATP-binding protein, putative 3.36 2.6E-02CJJ81176_1649 CJJ81176_1649 iron permease 2.71 3.4E-03CJJ81176_1650 p19 iron transporter 2.85 2.0E-03CJJ81176_1651 CJJ81176_1651 membrane protein 2.64 7.9E-03CJJ81176_1652 CJJ81176_1652 ABC transporter permease 2.71 7.9E-03CJJ81176_1653 CJJ81176_1653 membrane protein 2.68 7.9E-03CJJ81176_1654 CJJ81176_1654 GTPase 2.54 1.6E-02CJJ81176_1655 CJJ81176_1655 thioredoxin 2.51 3.6E-02* FC = Fold change** Padj = Adjusted p-value as output from the DESeq2 software20 Minute 5 HourGene DescriptionGene NameLocus Tag27  Table 4. C. jejuni genes showing > 2 fold difference in expression after 20 minute and 5 hour exposure to media containing extract versus media only    FC* Padj** FC* Padj**CJJ81176_0122 aspA aspartate ammonia-lyase 3.22 6.1E-08 2.53 4.6E-05CJJ81176_0123 dcuA anaerobic C4-dicarboxylate membrane transporter DcuA 2.94 2.8E-09 2.48 1.3E-06CJJ81176_0204 CJJ81176_0204 hypothetical protein 2.87 1.8E-12 4.44 4.0E-26CJJ81176_0438 CJJ81176_0438 putative oxidoreductase subunit 4.50 2.0E-54 11.83 8.6E-149CJJ81176_0439 CJJ81176_0439 oxidoreductase, putative 4.42 4.5E-28 12.08 2.7E-80CJJ81176_0440 CJJ81176_0440 conserved hypothetical protein 2.43 1.7E-11 2.15 1.1E-08CJJ81176_0697 dcuB anaerobic C4-dicarboxylate membrane transporter DcuB 2.09 3.5E-08 3.05 4.1E-19CJJ81176_0884 CJJ81176_0884 cytochrome c family protein, degenerate 2.06 2.5E-08 2.94 5.3E-19CJJ81176_0885 CJJ81176_0885 cytochrome C 2.39 5.3E-10 4.12 3.2E-27CJJ81176_1005 CJJ81176_1005 membrane protein, putative 2.07 1.1E-03CJJ81176_1389 CJJ81176_1389 DNA-binding protein 2.08 2.8E-05CJJ81176_1390 CJJ81176_1390 reactive intermediate/imine deaminase 2.38 3.9E-02CJJ81176_1391 CJJ81176_1391 C4-dicarboxylate ABC transporter 2.47 1.3E-02CJJ81176_1392 metC cystathionine beta-lyase 2.46 6.8E-03CJJ81176_1393 purB-2 adenylosuccinate lyase 2.19 2.6E-02CJJ81176_1570 CJJ81176_1570 hypothetical protein 2.39 8.6E-03CJJ81176_1649 CJJ81176_1649 iron permease 3.23 1.2E-04CJJ81176_1650 p19 iron transporter 3.80 1.0E-05CJJ81176_1651 CJJ81176_1651 membrane protein 2.94 9.1E-04CJJ81176_1652 CJJ81176_1652 ABC transporter permease 3.53 6.0E-05CJJ81176_1653 CJJ81176_1653 membrane protein 3.94 5.6E-06CJJ81176_1654 CJJ81176_1654 GTPase 4.28 1.1E-06CJJ81176_1655 CJJ81176_1655 thioredoxin 4.17 4.8E-06CJJ81176_0033 gltB glutamate synthase -2.07 5.1E-04CJJ81176_0035 gltD glutamate synthase subunit beta -2.12 8.3E-31CJJ81176_0109 CJJ81176_0109 methyl-accepting chemotaxis protein -2.37 1.1E-03CJJ81176_0266 herA hemerythrin -2.09 2.1E-02CJJ81176_0315 peb3 major antigenic peptide PEB3 -3.02 2.9E-06 -6.21 2.3E-17CJJ81176_0580 CJJ81176_0580 C4-dicarboxylate ABC transporter -3.42 5.8E-21CJJ81176_0581 CJJ81176_0581 amidohydrolase -2.01 3.0E-07CJJ81176_0685 CJJ81176_0685 Major facil itator superfamily transporter -2.93 1.8E-26CJJ81176_0912 CJJ81176_0912 amino acid carrier protein -2.50 1.9E-08CJJ81176_0941 CJJ81176_0941 sodium:alanine symporter -2.46 7.1E-07CJJ81176_0942 CJJ81176_0942 sodium:alanine symporter -2.56 9.8E-07CJJ81176_1006 CJJ81176_1006 hypothetical protein -2.31 1.4E-03CJJ81176_1184 CJJ81176_1184 hypothetical protein -2.47 3.6E-04CJJ81176_1185 CJJ81176_1185 hypothetical protein -2.61 9.4E-04CJJ81176_1356 CJJ81176_1356 plasmid stabilization system protein, RelE/ParE family -2.18 2.1E-02 -2.05 5.0E-02CJJ81176_1386 CJJ81176_1386 conserved hypothetical protein -2.57 4.4E-02CJJ81176_1656 CJJ81176_1656 thioredoxin -2.00 2.9E-02CJJ81176_1657 CJJ81176_1657 hypothetical protein -2.65 5.5E-31 -2.70 1.7E-32* FC = Fold change** Padj = Adjusted p-value as output from the DESeq2 softwareGenes with Decreased ExpressionLocus Tag Gene Name Gene Description20 Minute 5 HourGenes with Increased Expression28  showed higher expression either transiently and/or adaptively, encoded products responsible for uptake and utilization of food intermediates (aspA, dcuA, dcuB, CJJ81176_1389 to 1393), production of energy (CJJ81176_0884 and 0885), and again the CJJ81176_1649 to 1655 iron uptake system. Genes with reduced expression in the presence of extracts included peb3, which encodes the major antigenic peptide, ion transporters (CJJ81176_1685, 0941, 0942), and glutamate synthase genes (gltB and gltD). These changes suggest that C. jejuni is responding to metabolites present in extracts in order to reduce antigenicity, and to defend against increased osmotic stress. There were also multiple hypothetical proteins with no predicted function showing reduced expression in the presence of extracts. Interestingly CJJ81176_1656, a thioredoxin which overlaps with CJJ81176_1655, showed 2 fold lower expression after exposure to extracts. Since the upstream CJJ81176_1649 to 1655 genes showed 2.94 to 4.28 fold higher expression, this suggests that CJJ81176_1656 is regulated differently than the upstream genes despite having overlapping open reading frames (ORFs).  Since CJJ81176_1649 to 1655 was more highly expressed in extracts vs. MH, and even more highly elevated in human fecal extracts in comparison to chicken cecal extract, the focus of the remainder of this thesis is to further characterize this iron uptake system.   3.3 CJJ81176_1649 to 1656 The gene architecture of CJJ81176_1649 to 1656, as well as the genes upstream and downstream of this cluster, is shown in Figure 2. The amino acid sequences of the proteins encoded in this cluster were analyzed using the EMBL software Simple Modular Architecture Research Tool (SMART) to locate conserved domains and features Figure 2B. CJJ81176_1649, an FTR1 family iron permease, encodes an N-terminal signal peptide, 7 transmembrane regions, and the FTR1 iron transport domain.  P19 has been previously characterized as a copper binding periplasmic iron transport protein [49]. CJJ81176_1651 to 1654 have not yet been studied in detail but are hypothesized to encode the putative inner membrane  29   Figure 2. The CJJ81176_1649 to 1656 gene cluster.  The genomic architecture of the CJJ81176_1649 to 1656 genes and the domain homologies of the encoded protein products are shown to scale. (A) Top: the wildtype CJJ81176_1649 to 1656 locus including the upstream and downstream gene as well as the 16s rRNA region. Middle: the mutant ∆1651-1656 was made by deletion of all CJJ81176_1651 to 1656 genes and insertion of a kanamycin resistance cassette (KmR). Bottom: the entire CJJ81176_1651 to 1656 gene cluster was inserted into a non-coding region between the 16s rRNA and the tRNA-Ala to generate the complement 1651-1656C. The complement also contained a chloramphenicol resistance marker (CmR) under its native promoter (Pcm) (B) The presence of predicted signal peptides (yellow box), transmembrane domains (light blue box), and PFAM domains (vertical and horizontal white stripes), as well as the predicted PFAM domain functions are outlined for each gene in the CJJ81176_1649 to 1656 cluster.  portion of this iron uptake system [99]. CJJ81176_1651 was not predicted to have a signal peptide but possesses multiple N-terminal transmembrane domains, and a C-terminal YHS domain which may be involved in metal binding and is most commonly associated with copper. CJJ81176_1652 and 1653 are predicted permeases that contain 4 predicted transmembrane regions and the MacB_PCD and FtsX PFAM domains which are found in the periplasmic ABC transporters. CJJ81176_1654 is a cytoplasmic ATPase, which hydrolyzes ATP to generate energy for this iron uptake system. Finally, CJJ81176_1655 and 1656 are thioredoxins, and the presence of N-terminal signal peptides suggest that they are 30  transported into the periplasm. CJJ81176_1649 and p19 have been previously studied [49], therefore the main focus of this study was to characterize the remainder of the gene cluster, CJJ81176_1651 to 1656. A deletion of the CJJ81176_1651 to 1656 region in the wild type 81176 strain background was created by deletion/insertion with a Kanamycin (Km) resistance gene and was designated as Δ1651-1656 (Figure 2A). A complemented strain, marked with a Chloramphenicol (Cm) resistance gene and designated as 1651-1656C, was made by recombination of the CJJ81176_1651 to 1656 genes into an rRNA spacer region of the C. jejuni 81176 Δ1651-1656 deletion strain. The p19 deletion mutant (designated as Δp19) and complement (designated as p19C) were obtained from Dr. Anson Chan and Dr. Michael Murphy [49], and were tested side by side with Δ1651-1656 to compare observed responses.   3.4 Homologs of CJJ81176_1651 to 1655 are widely distributed among multiple classes of proteobacteria  Homologs of the Cjj81176_1649 to 1655 genes were previously reported to be conserved within in the Campylobacter genus and in a few non-Campylobacter species such as Yersinia pestis and some E. coli plasmids [101]. A BLAST search using the amino acid sequences of CJJ81176_1649 to 1655 showed that homologs of these proteins are more widely conserved than previously reported and is found in multiple members of alpha, gamma, and epsilon proteobacteria (Figure 3A and Appendix A). A list of 13 different genera from the 3 different bacterial classes identified to contain homologs C. jejuni CJJ81176_1649 to 1656 is presented in Figure 3. The list is not exhaustive, and, with the exception of the Campylobacter genus, shows only a single representative species per genus. However, it should be noted that homologs were observed to be present in many, if not most, of the species in each bacterial genus. A thorough bioinformatics approach will be required in order to characterize the distribution of this iron uptake system in all bacteria.   31  Further inspection showed that the amino acid identities for protein homologs of CJJ81176_1649 to 1655 in different proteobacteria classes varied between 25% and 100% (Figure 3B). The periplasmic iron binding protein P19 and the ATPase CJJ81176_1654 appeared to be the most well conserved between different proteobacteria with >50% amino acid identity. This suggests that the structures or active sites on p19 and the ATPase are more important for protein function. Mapping the genomic locations of the identified homologous proteins revealed that the order, length, orientation and gaps between genes in the cluster were also conserved between different proteobacteria classes. Interestingly, homologs were not genomically coded for Escherichia, Klebsiella, or Shigella, however plasmids containing the homologs are frequently associated with these organisms. Furthermore, homologs of the CJJ81176_1649 to 1655 proteins and corresponding gene cluster were found encoded in the genome of S. enterica T000240, but not in other Salmonella species, due to integration of a plasmid into the T000240 genome [102]. The highly conserved nature of this iron uptake system found in the genome and plasmids of multiple classes of proteobacteria suggest that the genes work in combination for iron transport and that they form one interdependent system.  The last gene in the cluster, CJJ81176_1656, had homologs in epsilonproteobacteria but not alpha or gamma proteobacteria. C. fetus and R.rubrum did not appear to encode an eighth gene, whereas gammaproteobacteria appeared to encode either a cytochrome or a hypothetical protein as the last gene in the cluster. This suggested that the last gene, a thioredoxin for most epsilonproteobacteria, may not be critical for the function of this iron uptake system, or is perhaps more important for the epsilon class than the other proteobacteria shown.    32   Figure 3. Homologs of the CJJ81176_1649 to 1656 genes in Proteobacteria Homologs of the CJJ81176_1649 to 1656 genes were found in multiple members of the epsilon, alpha, and gamma proteobacteria. (A) The homologous gene clusters found in representative organisms from each genus are shown to scale. The key is shown below and to the left of the cluster diagrams. Genes with the same color represent homologs. (B) The % amino acid identity for each gene in comparison to CJJ81176_1649 to 1656. Black = epsilonproteobacteria, red = alphaproteobacteria, and blue = gammaproteobacteria. The % amino acid identities for all 9 gammaproteobacteria homologs are graphed but they overlap.  33   Figure 4. ICP-MS results  The amount of iron (A), silver (B), nickel (C), and cobalt (D) measured in parts per billion (ppb) present in the pooled chicken extract (CP) and the pooled human fecal extracts (HP1, HP2, and HP3). Error bars represent the standard deviation of 2 duplicate tests. The significance was calculated by ANOVA. P-value < 0.001 = ***, p-value < 0.0001 = ****.  3.5 Human fecal extracts contain more iron than chicken cecal extract The increased expression of CJJ81176_1649 to 1655 iron uptake genes when C. jejuni was exposed to human fecal extracts versus chicken cecal extract suggested that 1) there was less total iron in the human extracts, and/or that 2) there was more total iron, but it was sequestered by a chelator recognized specifically by this iron uptake system. Inductively coupled plasma pass spectrometry (ICP-MS) was used to test the total transition metals including iron concentration present in the extracts alone.  The chicken pooled cecal extract and 3 human pooled fecal extracts were measured in duplicate. An analysis of variance showed that the amount of multiple metals in chicken cecal and human fecal extracts was significantly different: F (3, 4) = 82.61, p = 0.0005 for iron, F(3, 4) = 66.07, p = 0.0007 for silver, F (3, 4) = 1206, p < 0.0001 for nickel, and F (3, 4) = 1064, p < 0.0001 for cobalt. Interestingly, the human pooled fecal extracts contained more than 4 times more iron than the chicken cecal extract 34  (Figure 4A). This suggested that the Cjj81176_1649 to 1656 system is involved in transport of chelated iron more abundantly found in human intestinal systems. Human fecal extracts also contained significant higher concentrations of silver (Ag) and lower cobalt (Co) and nickel (Ni) than chicken cecal extract (Figure 4B – D). These differences are likely caused by differences in diet and environmental exposure between chicken and humans, however the impact this that different concentrations of these trace elements would have on the intestinal microbiome and C. jejuni physiology is currently unknown. 3.6 CJJ81176_1651 to 1656 are involved in iron acquisition To test if CJJ81176_1651 to 1656 is involved in iron acquisition, ∆1651-1656 was grown in iron supplemented and iron depleted media to compare the growth kinetics with that of the Δp19 mutant, which is involved in iron uptake [49]. The Δp19 and ∆1651-1656 mutants both exhibited slower growth rates in log phase than wildtype 81176 or the corresponding complements in MH medium (Figure 5A), but were able to achieve comparable maximum cell density after 32 hours. The p19C and 1651-1656C complements showed wildtype growth kinetics in MH. The growth rate for each mutant could be restored to wildtype and complement levels by supplementation of MH medium with 100 µM iron(III) citrate (Figure 5B).  Depletion of iron with 15 µM and 20 µM desferroxamine (DFO), an iron chelator, resulted in reduced cell growth for the Δp19 and ∆1651-1656 mutants compared to wildtype and complements (Figure 5C and D). Furthermore, after 24 hours of incubation in iron depleted media, Δp19 and ∆1651-1656 showed reduced viability in comparison to wildtype and complemented strains. These growth kinetics suggest that the ∆1651-1656 mutants were compromised in their ability to uptake and/or utilize iron present in the media. The iron sensitive growth of the ∆1651-1656 deletion strain is consistent with previously reported Δp19 results showing that p19 is required for optimal growth and survival upon iron restriction [49].  35   Figure 5. Growth in iron supplemented and iron depleted media Growth of C. jejuni 81176 wildtype, ∆1651-1656, 1651-1656C, ∆p19, and p19C was measured in MH medium (A), iron supplemented MH containing 100 µM iron(III) citrate (B), and iron depleted MH containing 15 µM (C) and 20 µM desferroxamine (DFO) (D). Growth was tested by plate count at 0, 12, 24 and 32 hours after inoculation. Error bars represent standard deviation of 3 replicates. Statistical comparison of ∆1651-1656 and ∆p19 vs. the wildtype control was performed using the student’s t-test with Welch’s correction where indicated. P-value < 0.0001 = ****.   3.7 The ∆1651-1656 and ∆p19 mutant strains are more sensitive to low pH but are more resistant to hydrogen peroxide stresses  To determine whether p19 and CJJ81176_1651 to 1656 is directly involved in resistance to different types of environmental stress, the mutants were exposed to low pH (pH 5.07) and hydrogen peroxide (1.0 mM) stresses. The Δp19 and ∆1651-1656 mutants showed reduced growth in MH at pH 5.07 in comparison to MH at neutral pH, while the wildtype and complements were unaffected by low pH (Figure 6A, B and C). This reduced tolerance was observed in both regular MH media and MH containing 100 µM iron(III) citrate, which shows that the difference in response was not a result of  36   Figure 6. C. jejuni survival in low pH and H2O2 stress in MH and iron supplemented MH  The growth and survival of C. jejuni 81176 wildtype, ∆1651-1656, 1651-1656C, ∆p19, and p19C during exposure to acid (pH = 5.07) (A, B and C) and H2O2 (1mM) (D and E) stresses. (A) Comparison of C. jejuni growth with and without acidic stress after 24 hour incubation. (B and C) C. jejuni growth profile in pH 5.07 in unsupplemented MH (B) and MH supplemented with iron (III) citrate (C). (D and E) C. jejuni survival after exposure to hydrogen peroxide stress after 6 hours growth in MH alone (D) or MH supplemented with iron (III) citrate. The limit of detection for plate count measurements is 103. Error bars represent the standard deviation of 3 replicates. Statistical comparison of ∆1651-1656 and ∆p19 to the wildtype 81176 was performed using the student’s t-test with Welch’s correction. P-value < 0.0001 = ****. 37  slower growth rate due to iron limitation. Interestingly, Δp19 appeared to be able to tolerate the low pH up until 9 hours after exposure in both MH and iron supplemented MH but showed reduced cell growth after long term exposure. The reduced growth of Δp19 and ∆1651-1656 to low pH media shows that this system is involved in acid tolerance.  Exposure of Δp19 and ∆1651-1656 to 1 mM hydrogen peroxide showed that the mutants were more resistant to oxidative stress than wildtype or complements (Figure 6C and D). Δp19 and ∆1651-1656 remained viable 3 hours after addition of 1 mM H2O2 into log phase growing cells and had even higher cell concentration after 6 hours, whereas the cell counts for wildtype and corresponding complements dropped below the level of detection and remained undetectable for the remainder of the experiment. The resistance to oxidative cell death was observed for both cells grown in either unsupplemented MH or MH supplemented with 100 µM iron (III) citrate, which suggests that resistance to H2O2 is not caused by a slower growth rate or iron availability.  3.8 The ∆1651-1656 and ∆p19 mutants lose streptomycin tolerance under iron limiting conditions The ∆1651-1656 mutant was screened for susceptibility to multiple classes of antimicrobial compounds, including aminoglycoside, amphenicol, beta lactam, cationic peptide, fluoroquinolone, and macrolide antibiotics (Figure 7A). Only 2-fold or no difference in minimum inhibitory concentration (MIC) was observed for all classes except aminoglycoside antibiotics. For instance, the MIC of ∆1651-1656 was 8 times lower than that of the wildtype for streptomycin (2 µg/mL vs.16 µg/mL respectively), and 4 times lower than that of the wildtype for the chemically similar dihydrostreptomycin (2 µg/mL vs. 8 µg/mL).  Measurement of cell density showed that wildtype C. jejuni and complemented strains exhibited a bimodal growth phenotype in the presence of doubling dilutions of streptomycin in both MH alone and MH supplemented with 100 µM iron(III) citrate (Figure 7B). Growth of wildtype and complements  38   Figure 7. Antibiotic susceptibility testing Antibiotic susceptibility of C. jejuni wildtype, deletion and complemented strains was measured by assessment of growth in the presence of doubling dilutions of antibiotics. (A) The minimum inhibitory concentration observed for C. jejuni 81176 and ∆1651-1656 grown in multiple classes of antibiotics. Cell growth in doubling dilutions of streptomycin was measured for C. jejuni 81176 wildtype, ∆1651-1656, 1651-1656C, ∆p19, and p19C when grown in MH (B) and MH supplemented with 100 µM iron(III) citrate. Error bars represent the standard deviation of 3 replicates.   exhibited a dramatic reduction as streptomycin concentration increased from 0.13 µg/mL to 1 µg/mL, however, C. jejuni still grew as streptomycin concentrations increased from 1 µg/mL to 8 µg/mL. There even appeared to be more growth at 4 µg/mL in comparison to 1 µg/mL streptomycin in both iron limiting and iron supplemented media. This tolerance was not observed for Δp19 or ∆1651-1656, which demonstrated a continuous reduction in growth as streptomycin concentration increased from 0.13 µg/mL to 2 µg/mL. Growth of Δp19 and ∆1651-1656 was not observed in MH containing ≥2 µg/mL 39  streptomycin. However, supplementation of MH with 100 µM iron(III) citrate restored the tolerance of Δp19 and ∆1651-1656 to 2-8 µg/mL streptomycin. These results suggest that the CJJ81176_1649 to 1656 iron uptake system may be involved in C. jejuni tolerance of aminoglycoside antibiotic stress, especially streptomycin, under low iron conditions.      40  4 Discussion In order to infect any host, C. jejuni must survive in the intestinal environment, which consists of food breakdown products, the resident microbiome, and a variety of host defenses. These are complex systems, and there have been many attempts to study the impact of individual components (e.g. bile, pH, oxidative stresses, etc.) on C. jejuni responses [25, 27, 31]. These studies have given us an insight on how C. jejuni copes with various stresses in isolation, but the results for individual stressors are difficult to translate for a complex intestinal system. There have also been attempts to study C. jejuni gene expression inside the chicken intestinal environment in comparison to in-vitro lab grown cells [103]. However, the genes showing the greatest change were responsible for adaptation to the vastly different oxidative environments. The recent success in mapping Salmonella gene expression changes during exposure to human intestinal metabolites [87] inspired us to use fecal extract as a method to directly compare the chemical composition of the human vs. chicken intestinal environments in a laboratory controlled setting. In this way, multiple exposure conditions could be controlled such as media richness, temperature, pH, and oxygen concentration, as well as C. jejuni growth phase and length of exposure to extract.  A review of extraction methods showed that aqueous solutions (H2O, PBS, and saline), organic solvents (acetonitrile and ethyl acetate), and alcohol solutions (ethanol and methanol) have been used to extract sterile metabolites from feces [66, 67, 74]. Numerous aqueous and organic solvents and extraction techniques were screened in order to find a suitable extract condition. Initial trials showed that organic solvents extracted non-polar materials and oils from feces which did not dissolve readily in medium (data not shown). One additional consideration was that exposure to then removal of the organic and alcohol solutions from the extracts using the speedvac may denature active compounds. Therefore, aqueous solutions were chosen in order to preserve the activity of as many proteins and enzymes in the fecal extracts as possible. Fecal extraction was tested with PBS during initial trials, but 41  the salts present in PBS caused slower cell growth during initial viability testing in comparison to media alone (data not shown). This was not completely unexpected, since previous research showed that C. jejuni is sensitive to high osmotic stress [19, 21]. Therefore, sterile H2O was chosen as the solvent for fecal extraction. In doing so, it is important to point out that H2O extracts aqueous compounds from fecal material and that non-polar, organic, or hydrophobic compounds may not be represented. Since mucus and mucin homogenize readily in H2O, but notably not in alcohols or organic solvents with lower density, the samples were very viscous and difficult to filter sterilize.  4.1 C. jejuni response to extracts For this study, healthy human volunteers were defined as people who did not have chronic gastrointestinal disorders (such as inflammatory bowel disease, Celiac disease, Crohn’s disease, or intestinal cancer), who were not taking drugs that may impact the intestinal microbiome (such as antibiotics or immune modifying drugs), and who had not had an episode of diarrhea within 5 days prior to donation. These exclusionary criteria were implemented to reduce variables that would disrupt the intestinal microbiome, or introduce drugs or antibodies that may kill C. jejuni in extract. Despite these restrictions, C. jejuni growth was visibly reduced in the presence of extract H7 and completely killed upon incubation with extract H8. The cause is unknown; however, may have resulted from diet, presence of anti-Campylobacter antibodies due to previous exposure, intestinal dysregulation, or any number of other factors. For example wine has been shown to have anti-Campylobacter activity [104], and beer has been shown to have anti-microbial activity [105]. This study did not control the diet in human volunteers; however, diet criteria may need to be a consideration for future studies involving bacterial responses to fecal extract. Previously published work on Salmonella exposed to fecal extracts showed that cells exposed to extracts had the same logarithmic growth rate compared to the control condition without extract, but that the final concentration of cells in extract were lower than the control [87]. In this study, exposure of 42  C. jejuni to extracts did not impact C. jejuni logarithmic growth rate or maximum cell density (Figure 1D),  however it allowed for a longer growth stationary phase and impaired long-term biofilm formation (Fig. 1D and E). The difference between the responses to extracts for S. enterica in the Antunes et.al. study [87] and C. jejuni in this study may have been caused at least in part by the different solvents used for extract preparation (ethyl acetate vs. water), which would have extracted different subsets of metabolites. The prolonged cell viability of wild type C. jejuni during stationary growth in the presence of extracts versus MH alone in this study may likewise have been caused by any of multiple factors, including (1) introduction of additional nutrients present in the extracts, (2) cell survival signals present in the extracts, and/or (3) triggering of general stress response(s). A reduction in biofilm formation for C. jejuni exposed to chicken cecal and human fecal extracts was also observed after 24 and 36 hours. It is currently unknown whether this represents active repression of C. jejuni biofilm formation by metabolites in the extracts, or passive repression due to introduction of additional nutrients which increased the richness of the media. Various studies have shown that C. jejuni forms better biofilms under nutrient limitation, and that biofilm formation is less abundant in rich media such as Brucella or Bolton broth [106]. The reduced long term biofilm formation in the presence of extracts may also represent elevated biofilm dispersion. The total biofilm quantified for C. jejuni in extracts at 12 hours was comparable or higher than the MH control, and showed comparable or lower planktonic cell concentration but the trend was reversed after 24 hours.   4.2 C. jejuni RNA sequencing results and iron uptake Iron is an essential micronutrient for survival, and many living organisms produce high affinity iron chelating proteins in order to bind and uptake iron, as well as to sequester it for personal use using chelator specific iron uptake systems. Animals produce and secrete high affinity iron binding proteins such as haemoglobin, transferrin, lactoferrin and ferritin, and bacteria and fungi produce siderophores such as enterobactin and rhodotorulic acid. C. jejuni does not encode nor secrete its own siderophores, 43  but possesses at least 5 different systems that recognize and uptake iron from chelators produced by other organisms or the environment [99]. These systems transport iron from enterobactin (CfrA, ceuBCDE), haem (chuABCDZ), lactoferrin/transferrin (ctuA, cfbpABC, chaN), rhodotorulic acid (CJJ81176_1649 to 1655), and ferrous ions (feoB) and are under the direct regulation of the Fur repressor [99, 107]. Interestingly of the 12 genes showing higher expression in human extracts vs. chicken extract, 10 were involved in iron transport: cfbpA, ceuB, chuC, and CJJ81176_1649 to 1655. CfbpA encodes the periplasmic iron binding protein for the ferri-transferrin uptake system, ceuB encodes the periplasmic permease for the ferri-enterochelin uptake system, and chuC encodes part of the ABC transporter system for the haem uptake system. None of the other components of these iron uptake systems showed higher expression in human fecal extracts vs. chicken cecal extract. The only iron uptake system where all putative members showed higher expression was the CJJ81176_1649 to 1655 system, consisting of an iron transporter (CJJ81176_1649), the periplasmic protein (CJJ81176_1650; p19), the putative inner membrane transporter proteins (CJJ81176_1651 to 1654), and a periplasmic thioredoxin (CJJ81176_1655). The specificity of increased expression of the CJJ81176_1649 to 1655, suggested that rather than a global response to low iron availability, the CJJ81176_1649 to 1655 system was specifically upregulated to obtain iron from a source that was more abundant in human fecal versus chicken cecal extracts. This was supported by measurement of the total iron present in human fecal and chicken cecal extracts, which showed that rather than having less iron, there was ~4.5x more total iron present in human fecal extracts. Furthermore previous transcriptomic study which showed that C. jejuni under general iron limitation nonspecifically increased expression of 27 genes involved in iron uptake, which included the majority of known members of the haem uptake system (chuABCDZ), ferri-transferrins uptake system (ctuA, cfbpA, cfbpC), enterobactin uptake system (cfrA and ceuE), Cj1658 to Cj1663 (homologs of CJJ81176_1649 to CJJ81176_1654), and outer membrane energy transduction systems for iron transport (exbB1-exbD1, exbB2-esbD2, tonB1, TonB2, and tonB3) [108].    44  It is possible that the extra iron may be chelated to exogenous siderophore(s) which are recognized and utilized by the C. jejuni CJJ81176_1649 to 1655 iron uptake system. It was claimed in 2008 that the CJJ81176_1649 to 1656  iron uptake system recognizes iron associated with rhodotorulic acid, a fungal siderophore, but the data for that assertion have not yet been published [109]. Furthermore, an iron competition study showed that C. jejuni, C. coli and C. laridis were unable to grow using rhodotorulic acid [110]. However, in the unlikely possibility that rhodotorulic acid is recognized, this would suggest that there is a large community of yeasts and other fungi within the host intestinal microbiome, particularly in humans, which may contribute to pathogen success.  Upon assessment of genes more highly expressed in the presence of extracts vs. media alone, CJJ81176_1649 to 1655 genes again showed higher expression but not genes associated with other iron uptake systems. This selectively higher expression of CJJ81176_1649 to 1655 suggests a Fur independent upregulation of this iron uptake system. Other genes showing higher expression in extract vs. media alone appeared to be mainly responsible for allowing transport of food intermediates into the cell, energy production, and metabolism, which is likely a response to the additional nutrients added by the extracts [111]. This transcriptional response also supports the hypothesis that the prolonged cell viability during logarithmic growth when C. jejuni was exposed to extracts vs. in MH alone was due to the introduction of additional nutrients from extract. 4.3 The CJJ81176_1649 to 1656 iron uptake system Inspection of the CJJ81176_1649 to 1655 genes revealed an additional thioredoxin-encoding gene, CJJ81176_1656, which overlapped with CJJ81176_1655 by 35 base pairs. Unlike CJJ81176_1649 to 1655, CJJ81176_1656 was not more highly expressed in human fecal extracts vs. chicken cecal extract, and even showed a slight reduction in expression in extract vs. media alone. The amino acid sequence of CJJ81176_1656 has low similarity to that of the CJJ81176_1655 thioredoxin so is unlikely a gene duplication of CJJ81176_1655. It is unknown how this gene benefits the CJJ81176_1649 to 1655 iron 45  uptake system or how it is regulated differently than the upstream genes given the overlapping open reading frames (ORF). However, thioredoxins are necessary for oxidative protein folding, which is critical for maintaining protein stability and function, so there may be an advantage to having 2 periplasmic thioredoxins [112].  While homologs of the CJJ81176_1649 to 1656 gene cluster were previously known to be conserved in C. jejuni, other Campylobacter species [109], and in Yersinia pestis, there has been minimal in depth study of these genes [101]. This thesis represents the first study identifying a high prevalence of homologs of the entire CJJ81176_1649 to 1655 iron uptake cluster in multiple classes of alpha, gamma and epsilon proteobacteria.  CJJ81176_1656, the last gene in the cluster, is conserved in epsilonproteobacteria but not in alpha or gamma proteobacteria. The high conservation of the entire gene cluster, with the exception of the last gene, in multiple classes of proteobacteria suggests that CJJ81176_1649 to 1655 represents a complete iron transport system. A model of the iron uptake system is shown in Figure 8 based on the protein domains identified in Section 3.3.  The bacteria encoding this iron uptake system are found in widely different niches, which hints that this iron uptake system is important for iron acquisition under a variety of different conditions. For example, the alpha-proteobacterium R. rubrum is a phototrophic bacterium found in aquatic environments, the epsilon-proteobacterium S. multivorans is an anaerobic bacterium found in soils and water that have been polluted with chlorinated  compounds, and the gamma-proteobacterium P. multocida is a zoonotic bacterium that colonizes the respiratory tract of wild and domesticated animals  [113-115]. Since data supporting that CJJ81176_1649 to 1656 recognizes and uptakes iron bound to rhodotorulic acid has not yet been published, it is currently difficult to assess why this iron uptake system is so widely conserved in bacteria living in these diverse environments.  The observation that C. jejuni increased expression of this entire set of genes upon exposure to fecal extract, and even more so for human fecal extracts vs. chicken cecal extract, suggests that this iron 46  uptake system may be important in host colonization. Furthermore, while it appears that the CJJ81176_1649 to 1656 cluster is not commonly genomically encoded in sequenced Escherichia, Salmonella, Klebsiella, or Shigella, plasmids containing the entire iron uptake cluster has been associated with each of these pathogens. Since plasmid encoded complete iron uptake systems are relatively rare, the presence of this system may provide these pathogenic organisms an advantage for host colonization [116].     Figure 8. Putative model of the CJJ81176_1649 to 1656 iron transport system Iron is transported into the periplasmic space either by diffusion through outer membrane porins or through recognition of a siderophore via a yet unidentified outer membrane iron transporter. Iron inside the periplasmic space is recognized by the p19 homodimer, and pumped into the cytoplasm through CJJ81176_1649 coupled to the CJJ81176_1651-1654 inner membrane proteins. Copper ions bound to p19 and the YHS domain of the membrane protein CJJ81176_1651 likely aids in iron redox. The acid resistance provided by this iron uptake system could be caused by ATP dependent pumping of H+ into the periplasmic space by the CJJ81176_1652 and 1653 permeases and the CJJ81176_1654 ATPase. The periplasmic thioredoxins prevent oxidative damage, are involved in protein refolding during iron transport, and may aid in iron redox.  47  Two transcriptomic studies have shown that p19 and the downstream genes of this iron uptake system (CJJ81176_1651 to 1655) have increased expression when C. jejuni are exposed to acid stress [28, 29]. Consistent with these observations, deletion of the CJJ81176_1651 to 1656 genes resulted in a mutant that was unable to grow in media at a pH 5.07 even when iron was supplemented in the form of iron (III) citrate. While numerous transcriptomic and proteomic analyses have characterized the global changes in gene expression and changes in protein profiles when C. jejuni is exposed to low pH, mechanism(s) of acid tolerance in C. jejuni are still unknown. In contrast, E. coli has multiple well characterized mechanisms to adapt to acid stress, including strengthening the outer membrane, blocking outer membrane porins to prevent diffusion of H+ ions, stabilizing cytoplasmic proteins, protecting DNA from damage, consuming H+ in the cytoplasm, and transporting H+ out of the cell using antiporters [117].  It is unknown how the CJJ81176_1649 to 1656 membrane-associated iron transport system fits in with these previously described acid resistance mechanisms, however one possible method is through active ATP dependent transport of H+ from the cytoplasm into the periplasmic space via the inner membrane permeases. The transcriptomic profiles for C. jejuni upon exposure to either iron limitation or oxidative stress have consistently shown that they both induce a subset of genes related to both response systems, which suggests that they are closely linked together for stress tolerance [30, 118]. Therefore, it was surprising that deletion of either the periplasmic protein p19 or the putative inner membrane transporters and thioredoxins (CJJ81176_1651 to 1656) resulted in significantly increased tolerance to hydrogen peroxide stress. Perhaps the deletion of this iron uptake system caused cellular stress that resulted in elevated baseline expression of genes related to oxidative stress tolerance. This would be consistent with the previously reported elevation of oxidative stress genes (katA, sodB, and ahpC) in C. jejuni under iron limiting conditions [30]. However, the same resistance to hydrogen peroxide stress was observed even when the media was supplemented with iron (III) citrate, which should have alleviated 48  the low iron stress for deletion mutants since they are able to grow at wildtype rates. However, it may also be possible that the increased resistance to H2O2 stress is solely due to the deletion of the CJJ81176_1655 and CJJ81176_1656 periplasmic thioredoxins. In E. coli, deletion mutants of two thioredoxins (trxA and trxC) were more resistant to H2O2 stress than the wildtype control hypothetically due to higher sensitivity of the oxidative stress response system in mutants versus wildtype [119].  Another hypothesis is that deletion of iron binding proteins reduced conversion of hydrogen peroxide into free radicals via the Fenton reaction (Fe2+ + H2O2 → Fe3+ + HO• + OH−, and Fe3+ + H2O2 → Fe2+ + HOO• + H+) which may result in protein and DNA damage. In either case analysis of genes responsible for hydrogen peroxide resistance such as katA and sodB may reveal whether the deletion mutants have higher cytoplasmic resistance to sudden addition of hydrogen peroxide, or whether the presence of the CJJ81176_1649 to 1655 system somehow renders the cells more sensitive to oxidative damage.  Lastly, it was observed that wildtype C. jejuni exhibited a bimodal streptomycin sensitivity phenotype. This bimodal antibiotic sensitivity has not been previously observed for C. jejuni, however, since most studies only assess MICs by visual observation, it is likely that this behavior is present but has been overlooked. Deletion of p19 and CJJ81176_1651 to 1656 showed that the growth tolerance for media containing 2 µg/mL to 8 µg/mL streptomycin was abolished only in the iron limited MH condition and not in MH supplemented with iron (III) citrate. It is unknown how this iron transport system may increase sensitivity of C. jejuni to streptomycin under iron limitation, but suggests that cellular iron concentration may play a role. In one study, iron restriction synergistically enhanced killing of E. coli with ampicillin, cefotaxime, chloramphenicol, methicillin and vancomycin antibiotics, and iron supplementation eliminated the synergistic effects [120]. The mechanism proposed by Wiuff et.al. was that iron limitation caused increased levels of iron sequestered per cell, which led to higher oxidative stress in E. coli, especially when treated with antibiotics. Whether or not this is the case in C. jejuni remains to be tested.    49  5 Conclusion and future directions This work demonstrated that the CJJ81176_1649 to 1656 system, which is found in multiple classes of proteobacteria, was the only C. jejuni iron uptake system where all putative members were more highly expressed upon exposure to human fecal and chicken cecal extract. Importantly, this system was even more highly expressed in human fecal extracts in comparison to chicken cecal extract, which suggested it may be especially important for human colonization. However, this iron uptake system has not been studied in detail partly because of limited knowledge of homologs in other organisms and because, despite being widely encoded in multiple plasmids, it is not encoded on the genomes of the more well-studied bacteria such as Escherichia, Salmonella, or Shigella spp. The deletion of CJJ81176_1651 to 1656 in this study is the first time that the putative inner membrane transporters of this iron uptake system have been analyzed in any organism. Results showed that CJJ81176_1651 to 1656 is required for optimal growth under iron limiting conditions comparable to what has been previously reported for p19, and that the CJJ81176_1649 to 1656 system is required for acid stress tolerance. This study opens the door to further evaluation of this iron uptake system, and much more work is required to understand the structures, interactions, and mechanisms behind how iron is transported and how this system is involved in acid tolerance. One outstanding task is to experimentally identify what siderophore(s) are recognized by this iron uptake system, and/or test whether Rhodotorulic acid is the substrate. Individual gene deletions will also be needed to understand the role of each of the 8 members of this iron uptake cluster. A plan for making the individual deletions is included in Appendix B. Evaluation of specific domains, such as the YHS metal binding domain of the inner membrane protein CJJ81176_1651, will aid in understanding the processes involved in iron transport.  Better understanding of this iron uptake system will increase our understanding of C. jejuni physiology, and will lead to an 50  overall increased knowledge for why this iron uptake system is so widely conserved in multiple classes of proteobacteria.   51  References  1. Kaakoush NO, Castano-Rodriguez N, Mitchell HM, Man SIM: Global Epidemiology of Campylobacter Infection. Clinical Microbiology Reviews 2015, 28(3):687-720. 2. Kirk MD, Pires SM, Black RE, Caipo M, Crump JA, Devleesschauwer B, Dopfer D, Fazil A, Fischer-Walker CL, Hald T et al: World Health Organization Estimates of the Global and Regional Disease Burden of 22 Foodborne Bacterial, Protozoal, and Viral Diseases, 2010: A Data Synthesis. Plos Med 2015, 12(12). 3. CDC: Foodborne Diseases Active Surveillance Network (FoodNet): FoodNet Surveillance Report for 2014 (Final Report). In. Atlanta, Georgia: U.S. Department of Health and Human Services; 2014. 4. Thomas MK, Murray R, Flockhart L, Pintar K, Pollari F, Fazil A, Nesbitt A, Marshall B: Estimates of the Burden of Foodborne Illness in Canada for 30 Specified Pathogens and Unspecified Agents, Circa 2006. Foodborne Pathog Dis 2013, 10(7):639-648. 5. Bahrndorff S, Garcia AB, Vigre H, Nauta M, Heegaard PMH, Madsen M, Hoorfar J, Hald B: Intestinal colonization of broiler chickens by Campylobacter spp. in an experimental infection study. Epidemiology and Infection 2015, 143(11):2381-2389. 6. Pintar KDM, Christidis T, Thomas MK, Anderson M, Nesbitt A, Keithlin J, Marshall B, Pollari F: A Systematic Review and Meta-Analysis of the Campylobacter spp. Prevalence and Concentration in Household Pets and Petting Zoo Animals for Use in Exposure Assessments. Plos One 2015, 10(12). 7. Colles FM, McCarthy ND, Bliss CM, Layton R, Maiden MC: The long-term dynamics of Campylobacter colonizing a free-range broiler breeder flock: an observational study. Environ Microbiol 2015, 17(4):938-946. 8. Wright SL, Carver DK, Siletzky RM, Romine S, Morrow WE, Kathariou S: Longitudinal study of prevalence of Campylobacter jejuni and Campylobacter coli from turkeys and swine grown in close proximity. J Food Prot 2008, 71(9):1791-1796. 9. Mohan V: Faeco-prevalence of Campylobacter jejuni in urban wild birds and pets in New Zealand. BMC Res Notes 2015, 8:1. 10. Andrzejewska M, Szczepanska B, Klawe JJ, Spica D, Chudzinska M: Prevalence of Campylobacter jejuni and Campylobacter coli species in cats and dogs from Bydgoszcz (Poland) region. Pol J Vet Sci 2013, 16(1):115-120. 11. Ramonaite S, Novoslavskij A, Zakariene G, Aksomaitiene J, Malakauskas M: High Prevalence and Genetic Diversity of Campylobacter jejuni in Wild Crows and Pigeons. Curr Microbiol 2015, 71(5):559-565. 52  12. Moffatt CR, Greig A, Valcanis M, Gao W, Seemann T, Howden BP, Kirk MD: A large outbreak of Campylobacter jejuni infection in a university college caused by chicken liver pate, Australia, 2013. Epidemiol Infect 2016, 144(14):2971-2978. 13. Korlath JA, Osterholm MT, Judy LA, Forfang JC, Robinson RA: A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J Infect Dis 1985, 152(3):592-596. 14. Black RE, Levine MM, Clements ML, Hughes TP, Blaser MJ: Experimental Campylobacter-Jejuni Infection in Humans. Journal of Infectious Diseases 1988, 157(3):472-479. 15. Harvala H, Rosendal T, Lahti E, Engvall EO, Brytting M, Wallensten A, Lindberg A: Epidemiology of Campylobacter jejuni infections in Sweden, November 2011-October 2012: is the severity of infection associated with C. jejuni sequence type? Infect Ecol Epidemiol 2016, 6:31079. 16. Cha W, Mosci R, Wengert SL, Singh P, Newton DW, Salimnia H, Lephart P, Khalife W, Mansfield LS, Rudrik JT et al: Antimicrobial Susceptibility Profiles of Human Campylobacter jejuni Isolates and Association with Phylogenetic Lineages. Front Microbiol 2016, 7:589. 17. Robertshaw D: Temperature Regulation and Thermal Environment, in Dukes' Physiology of Domestic Animals, vol. 12: Cornell University; 2004. 18. Buswell CM, Herlihy YM, Lawrence LM, McGuiggan JT, Marsh PD, Keevil CW, Leach SA: Extended survival and persistence of Campylobacter spp. in water and aquatic biofilms and their detection by immunofluorescent-antibody and -rRNA staining. Appl Environ Microbiol 1998, 64(2):733-741. 19. Doyle MP, Roman DJ: Response of Campylobacter-Jejuni to Sodium-Chloride. Appl Environ Microb 1982, 43(3):561-565. 20. Blaser MJ, Hardesty HL, Powers B, Wang WLL: Survival of Campylobacter-Fetus Subsp Jejuni in Biological Milieus. J Clin Microbiol 1980, 11(4):309-313. 21. Cameron A, Frirdich E, Huynh S, Parker CT, Gaynor EC: Hyperosmotic stress response of Campylobacter jejuni. J Bacteriol 2012, 194(22):6116-6130. 22. Silva J, Leite D, Fernandes M, Mena C, Gibbs PA, Teixeira P: Campylobacter spp. as a foodborne pathogen: a review. Frontiers in Microbiology 2011, 2. 23. Rotimi VO, Egwari L, Akande B: Acidity and intestinal bacteria: an in-vitro assessment of the bactericidal activity of hydrochloric acid on intestinal pathogens. Afr J Med Med Sci 1990, 19(4):275-280. 24. Raphael BH, Pereira S, Flom GA, Zhang Q, Ketley JM, Konkel ME: The Campylobacter jejuni response regulator, CbrR, modulates sodium deoxycholate resistance and chicken colonization. J Bacteriol 2005, 187(11):3662-3670. 25. Fox EM, Raftery M, Goodchild A, Mendz GL: Campylobacter jejuni response to ox-bile stress. Fems Immunology and Medical Microbiology 2007, 49(1):165-172. 53  26. Stintzi A: Gene expression profile of Campylobacter jejuni in response to growth temperature variation. Journal of Bacteriology 2003, 185(6):2009-2016. 27. Reid AN, Pandey R, Palyada K, Naikare H, Stintzi A: Identification of Campylobacter jejuni genes involved in the response to acidic pH and stomach transit. Appl Environ Microbiol 2008, 74(5):1583-1597. 28. Varsaki A, Murphy C, Barczynska A, Jordan K, Carroll C: The acid adaptive tolerance response in Campylobacter jejuni induces a global response, as suggested by proteomics and microarrays. Microb Biotechnol 2015, 8(6):974-988. 29. Birk T, Wik MT, Lametsch R, Knochel S: Acid stress response and protein induction in Campylobacter jejuni isolates with different acid tolerance. BMC Microbiol 2012, 12:174. 30. Palyada K, Sun YQ, Flint A, Butcher J, Naikare H, Stintzi A: Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni. Bmc Genomics 2009, 10. 31. Monk CE, Pearson BM, Mulholland F, Smith HK, Poole RK: Oxygen- and NssR-dependent globin expression and enhanced iron acquisition in the response of campylobacter to nitrosative stress. J Biol Chem 2008, 283(42):28413-28425. 32. Maal-Bared R, Bartlett KH, Bowie WR, Hall ER: Campylobacter spp. distribution in biofilms on different surfaces in an agricultural watershed (Elk Creek, British Columbia): Using biofilms to monitor for Campylobacter. Int J Hyg Envir Heal 2012, 215(3):270-278. 33. Huang HS, Brooks BW, Lowman R, Carrillo CD: Campylobacter species in animal, food, and environmental sources, and relevant testing programs in Canada. Can J Microbiol 2015, 61(10):701-721. 34. Feng J, Lamour G, Xue R, Mirvakliki MN, Hatzikiriakos SG, Xu J, Li H, Wang S, Lu X: Chemical, physical and morphological properties of bacterial biofilms affect survival of encased Campylobacter jejuni F38011 under aerobic stress. Int J Food Microbiol 2016, 238:172-182. 35. Teh AH, Lee SM, Dykes GA: The Influence of Prior Modes of Growth, Temperature, Medium, and Substrate Surface on Biofilm Formation by Antibiotic-Resistant Campylobacter jejuni. Curr Microbiol 2016, 73(6):859-866. 36. Haddock G, Mullin M, MacCallum A, Sherry A, Tetley L, Watson E, Dagleish M, Smith DG, Everest P: Campylobacter jejuni 81-176 forms distinct microcolonies on in vitro-infected human small intestinal tissue prior to biofilm formation. Microbiology 2010, 156(Pt 10):3079-3084. 37. Pascoe B, Meric G, Murray S, Yahara K, Mageiros L, Bowen R, Jones NH, Jeeves RE, Lappin-Scott HM, Asakura H et al: Enhanced biofilm formation and multi-host transmission evolve from divergent genetic backgrounds in Campylobacter jejuni. Environ Microbiol 2015, 17(11):4779-4789. 38. Reuter M, Mallett A, Pearson BM, van Vliet AHM: Biofilm Formation by Campylobacter jejuni Is Increased under Aerobic Conditions. Appl Environ Microb 2010, 76(7):2122-2128. 54  39. Turonova H, Neu TR, Ulbrich P, Pazlarova J, Tresse O: The biofilm matrix of Campylobacter jejuni determined by fluorescence lectin-binding analysis. Biofouling 2016, 32(5):597-608. 40. Brown HL, Hanman K, Reuter M, Betts RP, van Vliet AH: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment. Front Microbiol 2015, 6:699. 41. Svensson SL, Pryjma M, Gaynor EC: Flagella-Mediated Adhesion and Extracellular DNA Release Contribute to Biofilm Formation and Stress Tolerance of Campylobacter jejuni. Plos One 2014, 9(8). 42. Culotti A, Packman AI: Pseudomonas aeruginosa facilitates Campylobacter jejuni growth in biofilms under oxic flow conditions. FEMS Microbiol Ecol 2015, 91(12). 43. Stahl M, Butcher J, Stintzi A: Nutrient acquisition and metabolism by Campylobacter jejuni. Front Cell Infect Mi 2012, 2. 44. Hofreuter D: Defining the metabolic requirements for the growth and colonization capacity of Campylobacter jejuni. Front Cell Infect Microbiol 2014, 4:137. 45. Dwivedi R, Nothaft H, Garber J, Kin LX, Stahl M, Flint A, van Vliet AHM, Stintzi A, Szymanski CM: L-fucose influences chemotaxis and biofilm formation in Campylobacter jejuni. Mol Microbiol 2016, 101(4):575-589. 46. Ruiz-Palacios GM, Cervantes LE, Ramos P, Chavez-Munguia B, Newburg DS: Campylobacter jejuni binds intestinal H(O) antigen (Fuc alpha 1, 2Gal beta 1, 4GlcNAc), and fucosyloligosaccharides of human milk inhibit its binding and infection. Journal of Biological Chemistry 2003, 278(16):14112-14120. 47. Muraoka WT, Zhang QJ: Phenotypic and Genotypic Evidence for L-Fucose Utilization by Campylobacter jejuni. Journal of Bacteriology 2011, 193(5):1065-1075. 48. Taveirne ME, Sikes ML, Olson JW: Molybdenum and tungsten in Campylobacter jejuni: their physiological role and identification of separate transporters regulated by a single ModE-like protein. Mol Microbiol 2009, 74(3):758-771. 49. Chan ACK, Doukov TI, Scofield M, Tom-Yew SAL, Ramin AB, MacKichan JK, Gaynor EC, Murphy MEP: Structure and Function of P19, a High-Affinity Iron Transporter of the Human Pathogen Campylobacter jejuni. J Mol Biol 2010, 401(4):590-604. 50. Andreini C, Bertini I, Cavallaro G, Holliday GL, Thornton JM: Metal ions in biological catalysis: from enzyme databases to general principles. J Biol Inorg Chem 2008, 13(8):1205-1218. 51. Evans SJ, Sayers AR: A longitudinal study of campylobacter infection of broiler flocks in Great Britain. Prev Vet Med 2000, 46(3):209-223. 52. Sahin O, Luo N, Huang S, Zhang Q: Effect of Campylobacter-specific maternal antibodies on Campylobacter jejuni colonization in young chickens. Appl Environ Microbiol 2003, 69(9):5372-5379. 55  53. Agunos A, Waddell L, Leger D, Taboada E: A systematic review characterizing on-farm sources of Campylobacter spp. for broiler chickens. PLoS One 2014, 9(8):e104905. 54. Bull SA, Allen VM, Domingue G, Jorgensen F, Frost JA, Ure R, Whyte R, Tinker D, Corry JEL, Gillard-King J et al: Sources of Campylobacter spp. colonizing housed broiler flocks during rearing. Appl Environ Microb 2006, 72(1):645-652. 55. Pielsticker C, Glunder G, Aung YH, Rautenschlein S: Colonization pattern of C. jejuni isolates of human and avian origin and differences in the induction of immune responses in chicken. Vet Immunol Immunopathol 2016, 169:1-9. 56. Vaezirad MM, Keestra-Gounder AM, de Zoete MR, Koene MG, Wagenaar JA, van Putten JP: Invasive behavior of Campylobacter jejuni in immunosuppressed chicken. Virulence 2016:1-13. 57. Tribble DR, Baqar S, Scott DA, Oplinger ML, Trespalacios F, Rollins D, Walker RI, Clements JD, Walz S, Gibbs P et al: Assessment of the duration of protection in Campylobacter jejuni experimental infection in humans. Infect Immun 2010, 78(4):1750-1759. 58. Kirkpatrick BD, Lyon CE, Porter CK, Maue AC, Guerry P, Pierce KK, Carmolli MP, Riddle MS, Larsson CJ, Hawk D et al: Lack of Homologous Protection Against Campylobacter jejuni CG8421 in a Human Challenge Model. Clin Infect Dis 2013, 57(8):1106-1113. 59. Fimlaid KA, Lindow JC, Tribble DR, Bunn JY, Maue AC, Kirkpatrick BD: Peripheral CD4+ T cell cytokine responses following human challenge and re-challenge with Campylobacter jejuni. PLoS One 2014, 9(11):e112513. 60. Kalischuk LD, Buret AG: A role for Campylobacter jejuni-induced enteritis in inflammatory bowel disease? Am J Physiol Gastrointest Liver Physiol 2010, 298(1):G1-9. 61. Heikema AP, Islam Z, Horst-Kreft D, Huizinga R, Jacobs BC, Wagenaar JA, Poly F, Guerry P, van Belkum A, Parker CT et al: Campylobacter jejuni capsular genotypes are related to Guillain-Barre syndrome. Clin Microbiol Infect 2015, 21(9):852 e851-859. 62. Poly F, Read TD, Chen YH, Monteiro MA, Serichantalergs O, Pootong P, Bodhidatta L, Mason CJ, Rockabrand D, Baqar S et al: Characterization of Two Campylobacter jejuni Strains for Use in Volunteer Experimental-Infection Studies. Infection and Immunity 2008, 76(12):5655-5667. 63. Dasti JI, Tareen AM, Lugert R, Zautner AE, Gross U: Campylobacter jejuni: A brief overview on pathogenicity-associated factors and disease-mediating mechanisms. Int J Med Microbiol 2010, 300(4):205-211. 64. Bolton DJ: Campylobacter virulence and survival factors. Food Microbiol 2015, 48:99-108. 65. Eucker TP, Konkel ME: The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell Microbiol 2012, 14(2):226-238. 66. Christensen JE, Pacheco SA, Konkel ME: Identification of a Campylobacter jejuni-secreted protein required for maximal invasion of host cells. Mol Microbiol 2009, 73(4):650-662. 56  67. Konkel ME, Kim BJ, Rivera-Amill V, Garvis SG: Bacterial secreted proteins are required for the internalization of Campylobacter jejuni into cultured mammalian cells. Mol Microbiol 1999, 32(4):691-701. 68. Buelow DR, Christensen JE, Neal-McKinney JM, Konkel ME: Campylobacter jejuni survival within human epithelial cells is enhanced by the secreted protein CiaI. Mol Microbiol 2011, 80(5):1296-1312. 69. Samuelson DR, Eucker TP, Bell JA, Dybas L, Mansfield LS, Konkel ME: The Campylobacter jejuni CiaD effector protein activates MAP kinase signaling pathways and is required for the development of disease. Cell Commun Signal 2013, 11. 70. Stahl M, Frirdich E, Vermeulen J, Badayeva Y, Li X, Vallance BA, Gaynor EC: The helical shape of Campylobacter jejuni promotes in vivo pathogenesis by aiding its transit through intestinal mucus and colonization of crypts. Infect Immun 2016. 71. Larson CL, Samuelson DR, Eucker TP, O'Loughlin JL, Konkel ME: The fibronectin-binding motif within FlpA facilitates Campylobacter jejuni adherence to host cell and activation of host cell signaling. Emerg Microbes Infec 2013, 2. 72. Whitehouse CA, Balbo PB, Pesci EC, Cottle DL, Mirabito PM, Pickett CL: Campylobacter jejuni cytolethal distending toxin causes a G2-phase cell cycle block. Infect Immun 1998, 66(5):1934-1940. 73. Mortensen NP, Schiellerup P, Boisen N, Klein BM, Locht H, Abuoun M, Newell D, Krogfelt KA: The role of Campylobacter jejuni cytolethal distending toxin in gastroenteritis: toxin detection, antibody production, and clinical outcome. Apmis 2011, 119(9):626-634. 74. Ghunaim H, Behnke JM, Aigha I, Sharma A, Doiphode SH, Deshmukh A, Abu-Madi MM: Analysis of Resistance to Antimicrobials and Presence of Virulence/Stress Response Genes in Campylobacter Isolates from Patients with Severe Diarrhoea. Plos One 2015, 10(3). 75. Findik A, Ica T, Onuk EE, Percin D, Kevenk TO, Ciftci A: Molecular typing and cdt genes prevalence of Campylobacter jejuni isolates from various sources. Trop Anim Health Pro 2011, 43(3):711-719. 76. Bull MJ, Plummer NT: Part 1: The Human Gut Microbiome in Health and Disease. Integr Med (Encinitas) 2014, 13(6):17-22. 77. Lozupone CA, Stombaugh JI, Gordon JI, Jansson JK, Knight R: Diversity, stability and resilience of the human gut microbiota. Nature 2012, 489(7415):220-230. 78. Han Z, Willer T, Pielsticker C, Gerzova L, Rychlik I, Rautenschlein S: Differences in host breed and diet influence colonization by Campylobacter jejuni and induction of local immune responses in chicken. Gut Pathog 2016, 8:56. 79. Han Z, Pielsticker C, Gerzova L, Rychlik I, Rautenschlein S: The influence of age on Campylobacter jejuni infection in chicken. Dev Comp Immunol 2016, 62:58-71. 57  80. Wang LL, Lilburn M, Yu ZT: Intestinal Microbiota of Broiler Chickens As Affected by Litter Management Regimens. Frontiers in Microbiology 2016, 7. 81. Mancabelli L, Ferrario C, Milani C, Mangifesta M, Turroni F, Duranti S, Lugli GA, Viappiani A, Ossiprandi MC, van Sinderen D et al: Insights into the biodiversity of the gut microbiota of broiler chickens. Environ Microbiol 2016. 82. Xu Y, Yang H, Zhang L, Su Y, Shi D, Xiao H, Tian Y: High-throughput sequencing technology to reveal the composition and function of cecal microbiota in Dagu chicken. BMC Microbiol 2016, 16(1):259. 83. Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F, Yamada T et al: A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010, 464(7285):59-65. 84. Ballou AL, Ali RA, Mendoza MA, Ellis JC, Hassan HM, Croom WJ, Koci MD: Development of the Chick Microbiome: How Early Exposure Influences Future Microbial Diversity. Front Vet Sci 2016, 3:2. 85. Pan D, Yu Z: Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes 2014, 5(1):108-119. 86. Matsumoto M, Kibe R, Ooga T, Aiba Y, Kurihara S, Sawaki E, Koga Y, Benno Y: Impact of Intestinal Microbiota on Intestinal Luminal Metabolome. Sci Rep-Uk 2012, 2. 87. Antunes LC, McDonald JA, Schroeter K, Carlucci C, Ferreira RB, Wang M, Yurist-Doutsch S, Hira G, Jacobson K, Davies J et al: Antivirulence activity of the human gut metabolome. MBio 2014, 5(4):e01183-01114. 88. Antunes LC, Han J, Ferreira RB, Lolic P, Borchers CH, Finlay BB: Effect of antibiotic treatment on the intestinal metabolome. Antimicrob Agents Chemother 2011, 55(4):1494-1503. 89. Wishart D, et. al: The Human Fecal Metabolome. Publication in progress, http://www.fecalmetabolome.ca/.Accessed Nov-2013. 90. Loftfield E, Vogtmann E, Sampson JN, Moore SC, Nelson H, Knight R, Chia N, Sinha R: Comparison of Collection Methods for Fecal Samples for Discovery Metabolomics in Epidemiologic Studies. Cancer Epidemiol Biomarkers Prev 2016, 25(11):1483-1490. 91. Vernocchi P, Del Chierico F, Putignani L: Gut Microbiota Profiling: Metabolomics Based Approach to Unravel Compounds Affecting Human Health. Front Microbiol 2016, 7:1144. 92. Storr M, Vogel HJ, Schicho R: Metabolomics: is it useful for inflammatory bowel diseases? Curr Opin Gastroen 2013, 29(4):378-383. 93. Sinha R, Ahn J, Sampson JN, Shi JX, Yu GQ, Xiong XQ, Hayes RB, Goedert JJ: Fecal Microbiota, Fecal Metabolome, and Colorectal Cancer Interrelations. Plos One 2016, 11(3). 94. Jansson J, Willing B, Lucio M, Fekete A, Dicksved J, Halfvarson J, Tysk C, Schmitt-Kopplin P: Metabolomics Reveals Metabolic Biomarkers of Crohn's Disease. Plos One 2009, 4(7). 58  95. Letunic I, Doerks T, Bork P: SMART: recent updates, new developments and status in 2015. Nucleic Acids Res 2015, 43(Database issue):D257-260. 96. Karlyshev AV, Wren BW: Development and application of an insertional system for gene delivery and expression in Campylobacter jejuni. Appl Environ Microbiol 2005, 71(7):4004-4013. 97. Pryjma M, Apel D, Huynh S, Parker CT, Gaynor EC: FdhTU-modulated formate dehydrogenase expression and electron donor availability enhance recovery of Campylobacter jejuni following host cell infection. J Bacteriol 2012, 194(15):3803-3813. 98. Shaw FL, Mulholland F, Le Gall G, Porcelli I, Hart DJ, Pearson BM, van Vliet AHM: Selenium-Dependent Biogenesis of Formate Dehydrogenase in Campylobacter jejuni Is Controlled by the fdhTU Accessory Genes. Journal of Bacteriology 2012, 194(15):3814-3823. 99. Miller CE, Williams PH, Ketley JM: Pumping iron: mechanisms for iron uptake by Campylobacter. Microbiology 2009, 155(Pt 10):3157-3165. 100. Pajaniappan M, Hall JE, Cawthraw SA, Newell DG, Gaynor EC, Fields JA, Rathbun KM, Agee WA, Burns CM, Hall SJ et al: A temperature-regulated Campylobacter jejuni gluconate dehydrogenase is involved in respiration-dependent energy conservation and chicken colonization. Mol Microbiol 2008, 68(2):474-491. 101. Fetherston JD, Mier I, Jr., Truszczynska H, Perry RD: The Yfe and Feo transporters are involved in microaerobic growth and virulence of Yersinia pestis in bubonic plague. Infect Immun 2012, 80(11):3880-3891. 102. Izumiya H, Sekizuka T, Nakaya H, Taguchi M, Oguchi A, Ichikawa N, Nishiko R, Yamazaki S, Fujita N, Watanabe H et al: Whole-Genome Analysis of Salmonella enterica Serovar Typhimurium T000240 Reveals the Acquisition of a Genomic Island Involved in Multidrug Resistance via IS1 Derivatives on the Chromosome. Antimicrob Agents Ch 2011, 55(2):623-630. 103. Taveirne ME, Theriot CM, Livny J, DiRita VJ: The complete Campylobacter jejuni transcriptome during colonization of a natural host determined by RNAseq. PLoS One 2013, 8(8):e73586. 104. Isohanni P, Alter T, Saris P, Lyhs U: Wines as possible meat marinade ingredients possess antimicrobial potential against Campylobacter. Poultry Sci 2010, 89(12):2704-2710. 105. Silha D, Vytrasova J, Benova B, Mot'kova P: Effect of Selected Types of Beer on Bacteria of the Genus Arcobacter. Curr Microbiol 2013, 66(4):368-373. 106. Reeser RJ, Medler RT, Billington SJ, Jost BH, Joens LA: Characterization of Campylobacter jejuni biofilms under defined growth conditions. Appl Environ Microb 2007, 73(6):1908-1913. 107. Butcher J, Handley RA, van Vliet AHM, Stintzi A: Refined analysis of the Campylobacter jejuni iron-dependent/independent Fur- and PerR-transcriptomes. Bmc Genomics 2015, 16. 108. Holmes K, Mulholland F, Pearson BM, Pin C, McNicholl-Kennedy J, Ketley JM, Wells JM: Campylobacter jejuni gene expression in response to iron limitation and the role of Fur. Microbiology 2005, 151(Pt 1):243-257. 59  109. Stintzi A vVA, Ketley JM: Iron Metabolism, Transport, and Regulation. In: Campylobacter Third Edition. Edited by 'Nachamkin I SC, and Blaser MJ'. Washington, DC: ASM Press; 2008: 591 - 610. 110. Baig BH, Wachsmuth IK, Morris GK: Utilization of exogenous siderophores by Campylobacter species. J Clin Microbiol 1986, 23(3):431-433. 111. Stahl M, Butcher J, Stintzi A: Nutrient acquisition and metabolism by Campylobacter jejuni. Front Cell Infect Microbiol 2012, 2:5. 112. Zeller T, Klug G: Thioredoxins in bacteria: functions in oxidative stress response and regulation of thioredoxin genes. Naturwissenschaften 2006, 93(6):259-266. 113. Reslewic S, Zhou S, Place M, Zhang Y, Briska A, Goldstein S, Churas C, Runnheim R, Forrest D, Lim A et al: Whole-genome shotgun optical mapping of Rhodospirillum rubrum. Appl Environ Microbiol 2005, 71(9):5511-5522. 114. Luijten ML, de Weert J, Smidt H, Boschker HT, de Vos WM, Schraa G, Stams AJ: Description of Sulfurospirillum halorespirans sp. nov., an anaerobic, tetrachloroethene-respiring bacterium, and transfer of Dehalospirillum multivorans to the genus Sulfurospirillum as Sulfurospirillum multivorans comb. nov. Int J Syst Evol Microbiol 2003, 53(Pt 3):787-793. 115. Scholzmuramatsu H, Neumann A, Messmer M, Moore E, Diekert G: Isolation and Characterization of Dehalospirillum Multivorans Gen-Nov, Sp-Nov, a Tetrachloroethene-Utilizing, Strictly Anaerobic Bacterium. Arch Microbiol 1995, 163(1):48-56. 116. Di Lorenzo M, Stork M: Plasmid-Encoded Iron Uptake Systems. Microbiol Spectr 2014, 2(6). 117. Kanjee U, Houry WA: Mechanisms of acid resistance in Escherichia coli. Annu Rev Microbiol 2013, 67:65-81. 118. Butcher J, Stintzi A: The transcriptional landscape of Campylobacter jejuni under iron replete and iron limited growth conditions. PLoS One 2013, 8(11):e79475. 119. Ritz D, Patel H, Doan B, Zheng M, Aring;slund F, Storz G, Beckwith J: Thioredoxin 2 is involved in the oxidative stress response in Escherichia coli. Journal of Biological Chemistry 2000, 275(4):2505-2512. 120. Wiuff C, Zappala RM, Regoes RR, Garner KN, Baquero F, Levin BR: Phenotypic tolerance: Antibiotic enrichment of noninherited resistance in bacterial populations. Antimicrob Agents Ch 2005, 49(4):1483-1494.     60  Appendices Appendix A: Homolog list of the Cjj81176_1649 to 1656 cluster in other proteobacteria  Class OrganismOrder in clusterGene ID Annotated Protein ProductGene Length (# base pairs)% amino acid identity to C. jejuni  81176 proteins1 CJJ81176_1649 FTR1 fami ly i ron permease 2091 Reference for 1st protein2 CJJ81176_1650 hypothetica l  protein 540 Reference for 2nd protein3 CJJ81176_1651 hypothetica l  protein 1404 Reference for 3rd protein4 CJJ81176_1652 ABC transporter, permease protein 1290 Reference for 4th protein5 CJJ81176_1653 ABC transporter, permease protein 1119 Reference for 5th protein6 CJJ81176_1654 ABC transporter, ATP-binding protein 651 Reference for 6th protein7 CJJ81176_1655 thi redoxin,-l ike protein 489 Reference for 7th protein8 CJJ81176_1656 thioredoxin fami ly protein 504 Reference for 8th protein1 Cj1658 putative i ron permease 2091 982 p19 periplasmic protein p19 540 1003 Cj1660 putative integra l  membrane protein 1404 974 Cj1661 poss ible ABC transport system permease 1293 985 Cj1662 putative integra l  membrane protein 1119 986 Cj1663 putative ABC transport system ATP-binding protein 654 1007 Cj1664 putative periplasmic thi redoxin 489 998 Cj1665 putative l ipoprotein thi redoxin 504 991 YSS_RS00485 i ron permease 2091 942 YSS_RS00480 i ron transporter 540 1003 YSS_RS00475 membrane protein 1404 864 YSS_RS00470 ABC transporter permease 1290 915 YSS_RS00465 membrane protein 1119 876 YSS_RS00460 GTPase 648 917 YSS_RS00455 thioredoxin 489 778 YSS_RS00450 thioredoxin 504 831 CFF8240_RS02595 i ron permease FTR1 fami ly 1914 392 CFF8240_RS02600 i ron transporter 522 653 CFF8240_RS02605 membrane protein 1365 374 CFF8240_RS02610 ABC transporter permease 1245 525 CFF8240_RS02615 multidrug ABC transporter substrate-binding protein 1131 406 CFF8240_RS02620 GTPase 663 617 CFF8240_RS02625 hypothetica l  protein 498 251 CLA_RS05835 i ron permease 2079 632 CLA_RS05830 ferri rhodotorul ic acid transporter, periplasmic binding protein 522 753 CLA_RS05825 hypothetica l  protein 1422 474 CLA_RS05820 ABC transporter permease 1293 585 CLA_RS05815 membrane protein 1116 616 CLA_RS05810 ABC transporter ATP-binding protein 657 757 CLA_RS05805 l ipoprotein thioredoxin 492 448 CLA_RS05800 thioredoxin 498 461 SMUL_2708 Ftr1/P19 i ron uptake system permease FtrI 1917 402 SMUL_2709 Ftr1/P19 i ron uptake system periplasmic protein p19 534 583 SMUL_2710 membrane protein 1413 374 SMUL_2711 macrol ide exporter ABC transport permease 1278 505 SMUL_2712 macrol ide exporter ABC transport permease 1164 456 SMUL_2713 macrol ide exporter ABC transport ATPase 663 657 SMUL_2714+2715 thioredoxin 484 338 SMUL_2716 putative l ipoprotein thioredoxin 504 291 WS1566 conserved hypothetica l  protein-high-affini ty Fe2+/Pb2+ permease 1926 402 WS1564 periplasmic protein-probably involved in high-affini ty Fe2+ transport 531 623 WS1562 integra l  membrane protein 1410 384 WS1561 ABC transport permease protein 1275 525 WS1560 integra l  membrane protein-Permease Component 1146 456 WS1559 ABC transport protein 651 657 WS1558 thi redoxin 483 358 WS1557 hypothetica l  protein 498 291 Rru_A2809 i ron permease FTR1 1983 312 Rru_A2808 hypothetica l  protein 531 563 Rru_A2807 hypothetica l  protein 1470 284 Rru_A2806 hypothetica l  protein 1290 375 Rru_A2805 hypothetica l  protein 1182 316 Rru_A2804 ABC transporter 732 547 Rru_A2803 thioredoxin 519 25AlphaproteobacteriaRhodospirillum rubrum ATCC 11170EpsilonproteobacteriaCampylobacter jejuni 81176Campylobacter jejuni 11168Campylobacter coli RM4661Campylobacter fetus 82-40 Campylobacter lari RM2100Sulfurospirillum multivorans DSM 12446Wolinella succinogenes DSM 174061     Class OrganismOrder in clusterGene ID Annotated Protein ProductGene Length (# base pairs)% amino acid identity to C. jejuni  81176 proteins1 PM_RS02335 i ron permease 1905 332 PM_RS02330 i ron transporter 522 593 PM_RS02325 membrane protein 1398 284 PM_RS02320 ABC transporter permease 1323 375 PM_RS02315 membrane protein 1140 336 PM_RS02310 ABC transporter ATP-binding protein 696 577 PM_RS02305 protein ResA 501 268 PM_RS02300 cytochrome553 (soluble cytochrome f) 303 None (Reference for 8th gene)1 AANUM_1503 high-affini ty Fe2+/Pb2+ permease 1908 332 AANUM_1502 periplasmic protein 522 583 AANUM_1501 integra l  membrane protein 1431 294 AANUM_1500 membrane protein 1326 365 AANUM_1499 efflux ABC transporter, permease protein 1140 346 AANUM_1498 macrol ide export ATP-binding/permease protein MacB 672 617 AANUM_1497 redoxin fami ly protein 492 268 AANUM_1496 cytochrome c-553 312 None (47% to PM_RS02300 )1 PARA_17390 unnamed protein product 1905 322 PARA_17400 unnamed protein product 522 573 PARA_17410 unnamed protein product 1395 294 PARA_17420 unnamed protein product 1341 395 PARA_17430 unnamed protein product 1134 356 PARA_17440 predicted transporter subunit: ATP-binding component of ABC superfami ly 672 587 PARA_17450 unnamed protein product 480 328 PARA_17460 unnamed protein product 324 None (38% to PM_RS02300 )1 YPO1941 hypothetica l  protein 1920 312 YPO1942 hypothetica l  protein 528 573 YPO1943 hypothetica l  protein 1410 274 YPO1944 hypothetica l  protein 1293 365 YPO1945 hypothetica l  protein 1164 316 YPO1946 ABC transporter ATP-binding protein 714 547 YPO1947 thioredoxin 498 308 YPO1948 cytochrome 312 None (36% to PM_RS02300 )1 CKO_RS08730 i ron permease 1941 322 CKO_RS08725 i ron transporter 528 553 CKO_RS08720 hypothetica l  protein 1380 284 CKO_RS08715 ABC transporter permease 1284 365 CKO_RS08710 ABC transporter permease 1131 316 CKO_RS08705 ABC transporter ATP-binding protein 696 587 CKO_RS08700 thioredoxin 486 258 CKO_RS08695 hypothetica l  protein 486 None (Reference for 8th gene)1 STMDT12_C39040 high-affini ty Fe2+/Pb2+ permease 1887 312 STMDT12_C39030 hypothetica l  protein 528 553 STMDT12_C39020 high affini ty Fe+2 binding protein membrane component 1380 284 STMDT12_C39010 high affini ty Fe+2 binding protein permease component 1284 365 STMDT12_C39000 hypothetica l  protein 1131 316 STMDT12_C38990 putative ABC transporter system ATP-binding component 696 587 STMDT12_C38980 hypothetica l  protein 486 258 STMDT12_C38970 hypothetica l  protein 486 None (100% to CKO_RS08695 )1 efeU  ferrous  i ron permease 1941 322  tpd  pathogen-speci fic membrane antigen 528 553 ECVR50_B068 putative membrane protein 1380 284 ECVR50_B067 putative integra l  membrane protein 1284 365 ECVR50_B066 putative integra l  membrane protein 1131 316 ECVR50_B065  ABC transporter ATP-binding protein 696 587 ECVR50_B064  thioredoxin-fami ly protein 486 258 ECVR50_B063  Sigma-70, region 4 486 None (100% to CKO_RS08695 )1 AOG75827.1 hypothetica l  protein 1887 312  AOG75828.1  hypothetica l  protein 528 553 AOG75829.1  hypothetica l  protein 1380 284 AOG75830.1  hypothetica l  protein 1284 365 AOG75831.1  hypothetica l  protein 1131 316 AOG75832.1  hypothetica l  protein 696 587  AOG75833.1  hypothetica l  protein 486 258 AOG75834.1  hypothetica l  protein 486 None (100% to CKO_RS08695 )1 AMQ11474.1  high-affini ty Fe2+/Pb2+ permease 1854 312 AMQ11349.1 periplasmic protein p19 involved in high-affini ty Fe2+ transport 528 553  AMQ11350.1  Fe2+ ABC transporter2C substrate binding protein 1380 284  AMQ11351.1  cel l  divis ion protein FtsX 1284 365  AMQ11352.1 Fe2+ ABC transporter2C permease protein 2 1131 316 AMQ11353.1 Fe2+ ABC transporter2C ATP-binding subunit 696 587  AMQ11354.1  putative periplasmic thioredoxin 486 258 AMQ11475.1  hypothetica l  protein 486 None (100% to CKO_RS08695 )GammaproteobacteriaPasteurella multocida Pm70Aggregatibacter actinomycetemcomitans NUM4039Haemophilus parainfluenzae T3T1Yersinia pestis CO92Citrobacter koseri ATCC BAA-895Salmonella enterica serovar Typhimurium T000240Escherichia coli VR50 plasmid pVR50BKlebsiella pneumoniae B2 plasmid pB2-A/CShigella dysenteriae 80-547 plasmid p80-54762  Appendix B: Proposed method for creating single deletion mutants of CJJ81176_1651 to 1656 genes   This is the proposed method for creating individual deletions of CJJ81176_1651 to 1656 genes. Deletion insertion of a resistance marker directly into the chromosomally encoded operon may disrupt downstream gene expression, so a selective complementation strategy was designed. Based on the results of this thesis, complementation of the whole CJJ81176_1651 to 1656 cluster restores wildtype phenotype as shown in Section 3. Therefore, evaluation of complements missing one gene will show whether all components of this iron uptake system is required for function. Selective deletion can be performed by amplification and ligation of the required upstream and downstream genes, then inserting the single deletion complement into the rRNA region of the C. jejuni genome. The * indicates the original location of the deleted gene. KmR = Kanamycin resistance cassette. CmR = Chloramphenicol resistance cassette. Pcm¬ = Chloramphenicol resistance gene promoter.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0340575/manifest

Comment

Related Items