Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of Pax6 and Wls in rhombic lip compartmentation and cerebellar development Yeung, Joanna 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_february_yeung_joanna.pdf [ 10.51MB ]
Metadata
JSON: 24-1.0340490.json
JSON-LD: 24-1.0340490-ld.json
RDF/XML (Pretty): 24-1.0340490-rdf.xml
RDF/JSON: 24-1.0340490-rdf.json
Turtle: 24-1.0340490-turtle.txt
N-Triples: 24-1.0340490-rdf-ntriples.txt
Original Record: 24-1.0340490-source.json
Full Text
24-1.0340490-fulltext.txt
Citation
24-1.0340490.ris

Full Text

  THE ROLE OF PAX6 AND WLS IN RHOBMIC LIP COMPARTMENTATION AND CEREBELLAR DEVELOPMENT  by Joanna Yeung  B.Sc., Queen’s University, 2004 M.Sc., Queen’s University, 2008   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF    DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (MEDICAL GENETICS)    THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2016    © Joanna Yeung, 2016 ii  Abstract The transcription factor Pax6 is prominently expressed in the glutamatergic neurons during cerebellar development. When mutated, the Pax6-null Sey cerebellar granule cells (GC) are disorganized and foliation is disrupted. To elucidate the gene network regulated by Pax6 in cerebellar development, the Sey mutant transcriptome was analyzed and differentially expressed genes were identified. In this thesis, I examine some of these genes and their role in cerebellar development, as well as the relationship of these molecules with Pax6.  Wntless (Wls) is up-regulated in the Sey cerebellum. Wls expression is restricted to the interior face of the rhombic lip (iRL) in normal cerebellar development. Whereas in the Sey cerebellum, Wls-expressing cells expand into the EGL, indicating that Pax6 normally suppresses Wls expression. Furthermore, examination of Wls and other rhombic lip (RL) markers in the wildtype embryos demonstrates that the RL is dynamically demarcated into four molecularly distinct compartments.   Conversely, Tbr1 and Tbr2 are down-regulated in the Sey cerebellum. These are cell markers of cerebellar nuclei (CN) neurons and unipolar brush cells (UBCs), respectively. The absence of CN neurons and UBCs in the Sey mutant are revealed using standard immunohistochemistry and Nissl staining. Cell death analysis demonstrates that there is enhanced cell death in Sey mutant CN neuron progenitors, GCs and UBCs. Cell proliferation analysis also shows a reduction in the Sey RL progenitor pool during the genesis of UBCs and GCs.   To elucidate the requirement of Wls in cerebellar development, I examine the conditional Wls knockout (Wls-cKO) in which Wls is ablated in the RL during mid-gestation. Ectopic Pax6-expressing cells are found in the Wls-cKO RL indicating that Wls normally suppresses Pax6. The Wls-cKO cerebellum displays a smaller vermis and foliation defects. Granule cells are disorganized and UBCs are missing from the mutant cerebellum. The lack of Wls also affected cells of the VZ-lineage such as Purkinje cells and interneurons.  This thesis provides novel insights into the molecular network underpinning cerebellar development, in particular the requirement of Pax6 and Wls. This work also reveals the spatial compartments in the developing RL that are defined by Pax6, Wls and other molecular markers.   iii  Preface A version of Chapter 2 has been published [Yeung J, Ha TJ, Swanson DJ, Choi K, Tong Y, Goldowitz D (2014). Wls provides a new compartmental view of the rhombic lip in mouse cerebellar development. The Journal of Neuroscience 34:12527-12537]. I was responsible for the design of research, data collection, data analysis, making of all illustrations and figures, and manuscript composition. Ha TJ was involved in the design of ISH experiment. Swanson DJ was involved in data analysis and manuscript edits. Choi K was involved in conducting the ISH experiment. Tong Y was involved in the design of anti-WlsN antibody. Goldowitz D was the supervisory author on this project and involved in the design of research, data analysis and manuscript edits.  A version of Chapter 3 has been published [Yeung J, Ha TJ, Swanson DJ, Goldowitz D (2016). A novel and multivalent role of Pax6 in cerebellar development. The Journal of Neuroscience 36:9057-9069]. I was responsible for the design of research, data collection, data analysis, making of all illustrations and figures, and manuscript composition. Ha TJ was involved in data analysis related to the Pax6 transcriptome microarray. Swanson DJ was involved in making of experimental chimeras and manuscript edits. Goldowitz D was the supervisory author on this project and involved in the design of research, data analysis and manuscript edits.  I was responsible for the design of research, data collection, data analysis, making of all illustrations and figures, and the manuscript composition of Chapter 4. Goldowitz D was the supervisory author on this project and involved in the design of research, data analysis and manuscript edits.         iv  Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of Contents ......................................................................................................................... iv List of Tables ................................................................................................................................ ix List of Figures ................................................................................................................................ x List of Abbreviations ................................................................................................................. xiii Acknowledgements .................................................................................................................... xiv Chapter 1 : Introduction .............................................................................................................. 1 1.1. Cerebellar development overview ....................................................................................... 1 1.1.1. Cerebellar primordium and isthmic organizer .............................................................. 1 1.1.2. Cerebellar germinal zones ............................................................................................. 5 1.1.3. Glutamatergic lineages originate from the rhombic lip ................................................ 8 1.1.4. GABA-ergic lineages originate from the ventricular zone ......................................... 17 1.2. Pax6 regulatory gene network ........................................................................................... 19 1.3. Pax6 and the developmental genetics of the cerebellum ................................................... 21 1.3.1. Wls and Pax6 are expressed in distinct compartments in the rhombic lip .................. 21 1.3.2. The role of Pax6 in the development of cerebellar nuclear neurons and unipolar brush cells ....................................................................................................................................... 22 1.3.3. The role of Wls in cerebellar neurogenesis and lamination ........................................ 23 Chapter 2 : Wls provides a new compartmental view of the rhombic lip in mouse cerebellar development ................................................................................................................................. 25 2.1. Introduction ........................................................................................................................ 25 2.2. Results ................................................................................................................................ 26 v  2.2.1. Expression profile of Wls in the embryonic cerebellum ............................................ 26 2.2.2. Expression of the -gal reporter in WlsLacZ/+ mice ..................................................... 29 2.2.3. Expression of Wls is complementary to, and independent of, Atoh1 expression in the RL ......................................................................................................................................... 31 2.2.4. Expression of Wls is complementary to, and negatively regulated by, Pax6 in the RL............................................................................................................................................... 35 2.2.5. Expression of Wls in relation to markers of the rhombic lip ...................................... 39 2.3. Discussion .......................................................................................................................... 42 2.3.1. Wls and other cell markers define four molecular distinct compartments ................. 43 2.3.2. Wls is independent of Atoh1 in the rhombic lip ......................................................... 45 2.3.3. Wls is negatively regulated by Pax6 in the cerebellum .............................................. 46 2.3.4. Conclusion .................................................................................................................. 47 2.4. Materials and methods ....................................................................................................... 48 2.4.1. Mouse strains and husbandry ...................................................................................... 48 2.4.2. BrdU labeling .............................................................................................................. 49 2.4.3. Tissue preparation and histology ................................................................................ 49 2.4.4. In situ hybridization .................................................................................................... 50 2.4.5. Immunohistochemistry ............................................................................................... 50 2.4.6. Detection of -gal activity .......................................................................................... 51 2.4.7. Microscopy ................................................................................................................. 51 Chapter 3 : A novel and multivalent role of Pax6 in cerebellar development ...................... 52 3.1. Introduction ........................................................................................................................ 52 3.2. Results ................................................................................................................................ 53 3.2.1. Characterization of the absence of Tbr1+ CN neurons in the Sey cerebellum ............ 53 3.2.2. Reduction of Lmx1a+ cells in the NTZ of the Sey cerebellum ................................... 57 vi  3.2.3. Cytoarchitecture of the Sey cerebellum indicates the loss of CN neurons ................. 59 3.2.4. Increased cell death in the CN neuron progenitors of Sey cerebellum ....................... 61 3.2.5. Chimera analysis revealed that Pax6 is an extrinsic factor that controls the survival of CN neurons ........................................................................................................................... 64 3.2.6. Characterization of the reduction of Tbr2+ UBCs in the Pax6-null cerebellum ......... 67 3.2.7. Reduction of Lmx1a+ cells in the Sey cerebellum ...................................................... 69 3.2.8. Cytoarchitecture of the Sey cerebellum indicates the loss of UBCs ........................... 71 3.2.9. Increased cell death and decreased cell production in the UBC germinal zone of the Sey cerebellum ...................................................................................................................... 71 3.3. Discussion .......................................................................................................................... 72 3.3.1. The role of Pax6 in glutamatergic CN neuron development ...................................... 73 3.3.2. The role of Pax6 in UBC development ....................................................................... 74 3.3.3. Revising the role of Pax6 in granule cell development .............................................. 74 3.3.4. A spatial role of Pax6 in the development of RL derivatives ..................................... 75 3.3.5. Pax6 and the molecular underpinnings of cerebellar development ............................ 75 3.3.6. Pax6 and the RL-lineage progenitor pool ................................................................... 77 3.3.7. Conclusion .................................................................................................................. 78 3.4. Materials and methods ....................................................................................................... 78 3.4.1. Mouse strains and husbandry ...................................................................................... 78 3.4.2. Experimental mouse chimeras .................................................................................... 79 3.4.3. Tissue preparation and histology ................................................................................ 80 3.4.4. Immunohistochemistry ............................................................................................... 80 3.4.5. Cell counts and BrdU analysis .................................................................................... 81 3.4.6. Microscopy ................................................................................................................. 81 Chapter 4 : Wls expression in the rhombic lip orchestrates the embryonic development of the mouse cerebellum ................................................................................................................. 83 vii  4.1. Introduction ........................................................................................................................ 83 4.2. Results ................................................................................................................................ 84 4.2.1. Wls is inactivated in the RL during mid-gestation by Nestin-Cre mediated recombination ....................................................................................................................... 84 4.2.2. Cerebellar morphology is altered in the Wls-cKO ...................................................... 85 4.2.3. Rhombic lip is altered morphologically and molecularly as a result of the loss of Wls expression ............................................................................................................................. 87 4.2.4. Organization of EGL is disrupted in the Wls-cKO ..................................................... 88 4.2.5. Wls-cKO displays ectopic granule cells in the cerebellar core ................................... 92 4.2.6. Wls-cKO exhibits extracerebellar Calbindin+ Purkinje cells in the inferior colliculus............................................................................................................................................... 93 4.2.7. Bergmann glia morphology is abnormal in the Wls-cKO cerebellum ........................ 94 4.2.8. Tbr2+ unipolar brush cells are significantly reduced in the Wls-cKO cerebellum ..... 97 4.2.9. Cerebellar nuclear neurons are not affected in the Wls-cKO ...................................... 98 4.3. Discussion .......................................................................................................................... 99 4.3.1. Wls expression in the RL provides Wnt signals to RL- and VZ-lineages ................ 100 4.3.2. Wls/Wnt signaling is required to drive differentiation in cerebellar development ... 101 4.3.3. Wls/Wnt signaling organizes the foliation of cerebellum during development ....... 102 4.3.4. Wls/Wnt signaling restricts Purkinje cells within the developing cerebellum ......... 103 4.3.5. Wls/Wnt signaling is critical for the proper placement of cells in cerebellar development ........................................................................................................................ 103 4.3.6. Wls/Wnt signaling regulates the progenitor pools in the RL .................................... 104 4.3.7. Conclusion ................................................................................................................ 105 4.4. Materials and methods ..................................................................................................... 105 4.4.1. Mouse strains and husbandry .................................................................................... 105 4.4.2. Tissue preparation and histology .............................................................................. 106 viii  4.4.3. Immunohistochemistry ............................................................................................. 106 4.4.4. Cell counts and areal analysis ................................................................................... 107 4.4.5. Microscopy ............................................................................................................... 107 Chapter 5 : Conclusion ............................................................................................................. 108 5.1. Overview of molecular control in cerebellar development.............................................. 108 5.1.1. Cerebellar rhombic lip is comprised of distinct molecular compartments ............... 108 5.1.2. Requirement of Pax6 in the development of cerebellar glutamatergic neurons ....... 112 5.1.3. Wls regulates multiple developmental processes in cerebellar development ........... 113 5.2. Future directions .............................................................................................................. 114 5.2.1. Is the Wls-positive domain a RL progenitor pool? ................................................... 114 5.2.2. How does Pax6 regulate different cellular functions in different rhombic lip-derivatives? ......................................................................................................................... 116 5.2.3. How is Wls related to Wnt signaling in the cerebellum? .......................................... 118 5.2.4. How does Pax6 and Wls interact? ............................................................................ 120 5.2.5. Relationship between Pax6 and autism ..................................................................... 122 5.2.6. Cerebellum and medulloblastoma............................................................................. 122 5.3. Concluding remarks ......................................................................................................... 124 References .................................................................................................................................. 125 Appendices ................................................................................................................................. 150 Appendix 1: Supplementary Figures ...................................................................................... 150    ix  List of Tables Table 5.1. Genes differentially expressed in the Pax6-null Sey cerebellum. ........................ 122   x  List of Figures Figure 1.1. Schematic illustration of the developing CNS of an E9.5 mouse embryo. ........... 5 Figure 1.2. Schematic illustration of the cerebellar germinal zones in an E10 embryo. ........ 8 Figure 1.3. Schematic illustration of the development of cerebellar glutamatergic neurons. ................................................................................................................................... 16 Figure 1.4. Schematic illustration of the development of cerebellar GABA-ergic neurons. 19 Figure 2.1. Wls expression is localized to the cerebellar rhombic lip during embryonic development. ............................................................................................................ 28 Figure 2.2. Expression of the -gal reporter protein in WlsLacZ/+ mice recapitulates the expression of endogenous Wls during cerebellar development. .......................... 30 Figure 2.3. Wls and -gal reporter protein are co-localized in the rhombic lip. .................. 31 Figure 2.4. The cerebellar rhombic lip is comprised of two molecular populations (Wls+/Lmx1a+/Atoh1- and Wls-/Lmx1a+/Atoh1+) during early development at E11.5. ........................................................................................................................ 33 Figure 2.5. The cerebellar rhombic lip progressively develops molecularly distinct populations during embryonic development identified by Wls and Atoh1 expression. ................................................................................................................ 34 Figure 2.6. Wls expression is unchanged in the Atoh1-null rhombic lip. ............................... 35 Figure 2.7. The E15.5 rhombic lip is comprised of three domains as shown by Wls- and Pax6-expressing cells. .............................................................................................. 36 Figure 2.8. Expansion of Wls expression domain in the Sey mutant cerebellum. ................ 38 Figure 2.9. The expression of Wls, Lmx1a and Tbr2 defines a distinct molecular domain within the E15.5 rhombic lip. ................................................................................. 41 Figure 2.10. The iRL and eRL have differential proliferative activity. ................................. 42 Figure 2.11. Summary schematic of molecularly distinct developmental compartments in the cerebellar rhombic lip. ...................................................................................... 45 Figure 2.12. A cellular and molecular model of the role of the Wls-positive domain in the cerebellar rhombic lip development. ..................................................................... 47 Figure 3.1. Transcription factors Pax6, Tbr1 and Lmx1a are expressed in the progenitors of CN neurons during cerebellar development. .................................................... 54 xi  Figure 3.2. The lack of Pax6 in the Sey mutant cerebellum results in the absence of RL-derived Tbr1+ CN neurons but no apparent loss of VZ-derived Irx3+ CN neurons. .................................................................................................................... 57 Figure 3.3. The lack of Pax6 in the Sey cerebellum results in the reduction of Lmx1a+ cells in the cerebellar nuclei. ........................................................................................... 58 Figure 3.4. Cytoarchitecture of the Sey cerebellum indicates the loss of CN neurons and UBCs. ........................................................................................................................ 60 Figure 3.5. CN neuron progenitors are generated in the Sey mutant cerebellum but exhibit enhanced cell death. ................................................................................................ 63 Figure 3.6. Experimental chimera analysis demonstrates that Pax6 can be cell-extrinsic for CN neuron survival. ................................................................................................ 66 Figure 3.7. The loss of Pax6 results in the absence of Tbr2+ cells from the medial Sey cerebellum. ............................................................................................................... 68 Figure 3.8. The loss of Pax6 results in a reduction of Lmx1a+ cells in the Sey cerebellum. . 70 Figure 3.9. Enhanced cell death and decreased neurogenesis leads to the reduction of UBCs in the Sey cerebellum. .............................................................................................. 72 Figure 3.10. A model molecular program underpinning the development of cerebellar glutamatergic neurons. ........................................................................................... 77 Figure 4.1. Wls is inactivated in the RL by Nestin-Cre mediated recombination during mid-gestation. ................................................................................................................... 85 Figure 4.2. The P0 Wls-cKO cerebellum displays rudimentary foliation and hypoplasia in vermis. ...................................................................................................................... 86 Figure 4.3. The rhombic lip of Wls-cKO cerebellum exhibits a size reduction and molecular alterations. ................................................................................................................ 88 Figure 4.4. Abnormalities in EGL organization displayed by the Wls-cKO cerebellum. .... 91 Figure 4.5. Ectopic granule cell clusters are found in the Wls-cKO cerebellar core. ........... 93 Figure 4.6. Extracerebellar Calbindin+ Purkinje cells are found in the inferior colliculus of the Wls-cKO brain. .................................................................................................. 94 Figure 4.7. Glial scaffold formed by Bergmann glial fibers is disrupted in the Wls-cKO cerebellum. ............................................................................................................... 96 xii  Figure 4.8. Wls-cKO cerebellum exhibits reductions in the number of Tbr2+ unipolar brush cells. ........................................................................................................................... 98 Figure 4.9. Development and number of Tbr1+ cerebellar nuclear neurons are not altered in the Wls-cKO cerebellum. .................................................................................... 99 Figure 5.1. Schematic illustration of distinct molecular compartments in the cerebellar RL and RL phenotypes in Atoh1, Pax6 and Wls mutants. ....................................... 111 Figure 5.2. Schematic model of the molecular regulation in cerebellar development. ....... 113   xiii  List of Abbreviations ASD  Autism spectrum disorder bHLH Basic helix-loop-helix BG Bergmann glial cKO Conditional knockout CN Cerebellar nuclear CP Choroid plexus E Embryonic day EGL External germinal layer eRL Exterior face of the rhombic lip GC/GCs Granule cell(s) IGL Internal granular layer IN Interneurons iRL Interior face of the rhombic lip IsO Isthmic organizer MHB Midbrain-hindbrain boundary NTZ Nuclear transitory zone Pax Paired Box PC/PCs Purkinje cell(s) r1 Rhombere 1 RL Rhombic lip Sey Small eye TM Tamoxifen UBC/UBCs Unipolar brush cell(s) VZ Ventricular zone Wls Wntless     xiv   Acknowledgements To a brilliant scientist and my inspiring supervisor, Dr. Dan Goldowitz, words cannot express my extreme gratitude and appreciation I have for you. Thank you for taking me in as your student, introducing the field of neuroscience to me and helping me to grow as a scientist, I will always remember your teachings and your enthusiasm in research. My heartfelt gratitude for the opportunity to have taken on this exciting project under your supervision and guidance, it is my most memorable adventure in the world of science research. Without your encouragement and patience over these years, this work would not have been possible.  To members of my advisory committee, Drs. Douglas Allan, Pamela Hoodless and Terrance Snutch, I am truly thankful for your supportive mentorship throughout the years and the invaluable advice on this project. Thank you for sharing your expertise and help this work advance.   To members of the Goldowitz lab, Douglas Swanson, Anna Poon, Matt Larouche, Thomas Ha, Gloria Mak, Sophie Tremblay, Janice Yoo, Peter Zhang, James Cairns, Emilie Theberge, Fernando Villegas, Julia Boyle, Derek Rains, Kunho Choi, Anita Sham and Pierre Zwiegers, thank you for the friendship and mentorship. Your support, care and encouragement mean so much to me during all these years. My special thanks to Dr. Douglas Swanson for your mentorship, for patiently training me in experimental techniques and providing constructive criticism on this work.  To my beloved family, my parents, brother and especially my husband, I am truly thankful for your love, understanding and support in pursuing a PhD and following my dream. Alan, thank you for always being here and get me through the tough time.  “Some trust in chariots and some in horses, but we trust in the name of the LORD our God.” (Psalm 20:7) To my Lord, my God, how blessed and how honor it is to be able to witness your mighty design and to learn about your greatness through this work. 1  Chapter 1 : Introduction The cerebellum, often known as the “little brain”, is a critical region that integrates incoming sensory information and coordinates motor outputs. This most anterior hindbrain structure makes up only one-tenth of the total brain volume and consists of relatively few neuronal cell types; however, it contains more than half of all neurons in the CNS. The cerebellar neurons are arranged in three distinctive cellular layers that gives the adult cerebellum its characteristic laminar structure. The outermost layer of the cerebellar cortex is the molecular layer: it has a low cellular density (largely comprised of stellate and basket cell interneurons) and is made up primarily of the parallel fibers of granule cells (GCs) and the dendrites of Purkinje cells (PCs). The next layer is the Purkinje cells layer and this layer is characterized by the large somata of PCs arranged in a monolayer along with the somata of Bergmann glia and candelabrum cells. The next layer contains the most numerous neurons in the cerebellum, the granule cells, which are densely packed in the internal granular layer (IGL) along with the Golgi cells, Lugaro cells and unipolar brush cells (UBCs). Beneath the cerebellar cortex is the cerebellar white matter that consists of three pairs of cerebellar nuclear (CN) neurons: from the lateral to medial these are the dentate, interposed and fastigial nuclei. During development, the cerebellar neurons arise from two distinct germinal zones, the inhibitory GABA-ergic neurons (PCs, interneurons, inhibitory CN neurons) are generated from the ventricular zone (VZ), while the excitatory glutamatergic neurons (GCs, UBCs and glutamatergic CN neurons) originate from the cerebellar rhombic lip (RL). Recent studies have started to elucidate the complex molecular regulatory networks underpinning the generation and the organization of these neurons during cerebellar development. My work focuses on the molecular machinery that defines the cerebellar rhombic lip and controls the development of the cerebellar neurons that emerge from this region.  1.1. Cerebellar development overview 1.1.1. Cerebellar primordium and isthmic organizer During early embryogenesis, the neural tube is divided into three primary brain vesicles along the anterior-to-posterior axis: prosencephalon (forebrain), mesencephalon (midbrain) and 2  rhombencephalon (hindbrain). The rhombencephalon is subdivided into 7 rhombomeres (r1-7) that are characterized by a series of morphological constrictions and bulges. Classically, the midbrain-hindbrain boundary (MHB) is defined by the physical constriction between mesencephalon and rhombomere 1, and the cerebellum has been thought to arise exclusively from the first rhombencephalic vesicle caudal to the MHB. Chick-quail chimera analysis provides a way to trace the progenitor cells from a certain brain vesicle into their final position in the mature brain. Hallonet and colleagues tested the origin of cerebellar tissues with chick-quail chimera and their findings challenged that original thought (Hallonet et al., 1990). By grafting the rhombencephalic or mesencephalic vesicle (as separated by the morphological constriction at MHB) into the same position of the host neural tube, the resultant cerebellum is always chimeric (Hallonet et al., 1990). This finding indicates that the morphological MHB does not correspond to the boundary between midbrain-hindbrain primordium, and cerebellum arises from the alar plate that spans the caudal mesencephalic vesicle to rostral rhombomere 2.  A marker of midbrain development, Otx2, provides molecular support for defining the boundary of the mesencephalon that is different from the morphological definition of the MHB. Millet et al (1996) found that Otx2 expression ends rostral to the MHB physical constriction in Hamburger-Hamilton stage (HH) 10 chick and in embryonic day (E) 9.5 mice. Interestingly, when tested using chick-quail chimeras, grafted Otx2-positive mesencephalic vesicles only give rise to midbrain structures in the host. Conversely, Otx2-negative mesencephalic and rhombencephalic vesicles grafted in the host develops exclusively cerebellar structures (Millet et al., 1996). Thus, these findings confirm the previous observation that the physical constriction at MHB is not a boundary of midbrain-hindbrain primordium. Furthermore, these findings redefined MHB and the origins of midbrain-hindbrain structure based on molecular marker expression. It is now accepted that the cerebellum arises from the Gbx2-positive, Otx2- and Hoxa2-negative rhombomere 1 (Wassarman et al., 1997; Wingate and Hatten, 1999). Beside territory specification, the complementary expression between anterior Otx2 domain and posterior Gbx2 domain plays a crucial role in setting up a signaling organizer at the MHB (Fig. 1.1), termed the isthmic organizer (IsO) (Millet et al., 1999; Broccoli et al., 1999). The isthmic organizer provides signals for the induction of the cerebellar and midbrain primordia from the r1 and the adjacent mesencephalon, respectively. It has been demonstrated that the IsO can induce ectopic midbrain-hindbrain structures from the surrounding tissues when it is transplanted to 3  other regions of the neural tube (Gardner and Barald, 1991; Bally-Cuif and Wassef, 1994); this suggests that the molecules emanating from the IsO provide instructions to midbrain-cerebellum specification. Secreted molecules such as Wnt1 and Fgf8 that are expressed at the IsO are good candidates for mediating fate specification, and both molecules have been studied extensively (Bally-Cuif et al., 1992).   In mouse, expression of Wnt1 at E8 in mice is broadly observed at the prospective midbrain, while Fgf8 is expressed in the prospective cerebellum. Later at E9.5 (Fig. 1.1), the expression domain of Wnt1 and Fgf8 is rapidly restricted to a narrow band rostral and caudal to the MHB, respectively (Wilkinson et al., 1987; Crossley and Martin, 1995). Examination of the loss of Wnt1 or Fgf8, as seen in Wnt1-null and Fgf8-null mice, demonstrates that the loss of either gene in the developing brain results in the deletion of midbrain and cerebellar structures (Thomas and Capecchi, 1990; McMahon and Bradley, 1990; Meyers et al., 1998). Misexpression of Wnt1 by in ovo electroporation in chick or by transgenic overexpression in mouse, however, is unable to induce ectopic midbrain/cerebellar structures in the forebrain or caudal hindbrain (Matsunaga et al., 2002; Panhuysen et al., 2004). This result indicates that Wnt1 is not the key organizing molecule that emanates from the IsO. In contrast, ectopic application of Fgf8 mimics the influence of IsO. For example, implantation of Fgf8-soaked beads in chick re-patterned the neural tube and induced ectopic midbrain and cerebellar structures at the diencephalon (Crossley et al., 1996; Martinez et al., 1999). These findings are further supported by in vivo studies in transgenic mice, which demonstrate that the misexpression of Fgf8 is sufficient to transform the caudal forebrain and hindbrain to a midbrain/cerebellar fate (Liu et al., 1999a). Thus, these studies identified that Fgf8 is the organizing molecule in the IsO.  The question is then: how is the expression of Fgf8 in the IsO induced and maintained? This appears to happen via a cross-regulatory loop involving Fgf8, Wnt1 and Lmx1b. Although it is known that Wnt1 alone cannot induce midbrain-cerebellar identity, it is required for the maintenance of Fgf8 expression at the IsO. This is illustrated by the work of Lee et al (1997) who studied Fgf8 expression in the Wnt1-null mouse and found that Fgf8 is expressed transiently at early embryogenesis but subsequently lost at the IsO. Thus, Wnt1 is not needed for the induction of Fgf8, but is required for the maintenance of Fgf8 expression once Fgf8 is induced at the IsO. In contrast, Fgf8 expression is absent from the IsO of the Lmx1b-null mutant, which suggests the requirement of Lmx1b in initiating Fgf8 in IsO (Guo et al., 2007). Interestingly, in 4  ovo electroporation of Lmx1b, ectopically expressing Lmx1b cells show repression of Fgf8 but Fgf8 is found to be induced in non-transfected neighboring cells (Matsunaga et al., 2002). This suggests that Lmx1b induces Fgf8 expression in a cell-extrinsic manner. Furthermore, Wnt1 is found to be induced by Lmx1b expression (Adams et al., 2000; Matsunaga et al., 2002), which in turn maintains the expression of Fgf8. Fgf8 induced at the IsO further maintains the expression of Lmx1b, as shown by the implantation of Fgf8-soaked beads that leads to the induction of ectopic Lmx1b expression (Adams et al., 2000). Altogether, these studies identify a cross-regulation between Wnt1, Fgf8 and Lmx1b, which is necessary for the proper establishment of the midbrain and cerebellar primordia. Beside the patterning activity played by Fgf8 and Wnt1 in the IsO, these two molecules are also essential to other developmental processes in the midbrain-hindbrain region. Conditional knockdown of Fgf8 in the MHB exhibited an increase in cell death in the MHB starting from E8.5, and this enhanced cell death resulted in the loss of midbrain and cerebellum structures in the Fgf8-cKO (Chi et al., 2003). This finding indicates that Fgf8 normally promotes cell survival in the midbrain-hindbrain region. On the other hand, Wnt1 is found to promote cell proliferation in the midbrain region (Panhuysen et al., 2004). This is illustrated by overexpressing Wnt1 in the MHB, which led to an increase in cell proliferation and an enlarged inferior colliculus, while the size of cerebellum had not changed (Panhuysen et al., 2004). 5   Figure 1.1. Schematic illustration of the developing CNS of an E9.5 mouse embryo.  The neural tube is divided into brain vesicles along the anterior-to-posterior axis: telencephalon (Tel), diencephalon (Di), mesencephalon (Mes) and rhombomere (Rho). The neural epithelia that give rise to future midbrain-hindbrain structures are defined by the expression of specific marker Gbx2 and Otx2. The interaction between these two molecules set up a signaling center, the isthmic organizer (IsO). Wnt1 and Fgf8 are expressed at the IsO.  1.1.2. Cerebellar germinal zones  The established cerebellar primordium provides the platform for the next step of cerebellar development, which involves the generation of different neuronal cell types from specific germinal zones starting from E10 (Fig. 1.2). The cerebellum is unique in the CNS as cerebellar neurons arise from two anatomically and molecularly distinct neuroepithelial regions: the ventricular zone and the rhombic lip.  The ventricular zone (VZ) is located on the dorsal edge of the fourth ventricle and is the neuroepithelium from whence all cerebellar GABA-ergic neurons originate, including the small 6  GABA-ergic nuclear neurons, Purkinje cells and interneurons (Fig. 1.2) (Hoshino et al., 2005; Pascual et al., 2007). Posterior to the VZ is the cerebellar rhombic lip (RL), which gives rise to all glutamatergic neurons of the cerebellum, consisting of the large cerebellar nuclear (CN) neurons, granule cells (GCs) and unipolar brush cells (UBCs) (Wang et al., 2005; Machold and Fishell, 2005). The cerebellar germinal zones are specified by the non-overlapping expression of two basic helix-loop-helix (bHLH) transcription factors: the rhombic lip is positive for Atoh1 expression (Akazawa et al., 1995), whereas the ventricular zone is positive for Ptf1a expression (Hoshino et al., 2005).  The expression of Atoh1 does not only pattern the cerebellar primordium, but has been demonstrated to be required and sufficient for specifying glutamatergic identities. Initially, it was thought that only the external germinal layer (EGL) and the granule cells that arise from this region are missing in the Atoh1-null mutant (Ben-Arie et al., 1997). Subsequently, three independent studies revealed the requirement of Atoh1 in the generation of the other glutamatergic neurons in the cerebellum. By genetic fate-mapping the Atoh1-expressed cells, Machold and Fishell (Machold and Fishell, 2005) demonstrated that glutamatergic CN neurons are also derived from the Atoh1+ RL-lineage, and overturning the earlier belief that all CN neurons arise from the VZ. Examination of the Atoh1-null mutant provided additional evidence that Atoh1 is essential for the generation of glutamatergic CN neurons and UBCs, as both these cell types are absent from the Atoh1-null cerebellum (Wang et al., 2005; Machold and Fishell, 2005; Englund et al., 2006). Thus, studies of the Atoh1-null demonstrated that the production of all glutamatergic cerebellar neurons require Atoh1. Recently, Yamada and others have tested whether Atoh1 is sufficient for specification of glutamatergic neuronal fate (Yamada et al., 2014). They used Ptf1aAtoh1 transgenic mice in which Atoh1 expression is driven under the Ptf1a promoter yielding the overexpression of Atoh1 in the VZ. The ectopic expression of Atoh1 results in the production of glutamatergic neurons from the VZ (Yamada et al., 2014), and their findings indicate that Atoh1 alone is sufficient to generate glutamatergic neurons in the cerebellum. In an analogous manner to the cell fate specification role of Atoh1 in the RL, Ptf1a expression specifies GABA-ergic identities in the VZ-derived progenitors. The loss of Ptf1a, as in the null mutant cerebelless mouse, results in the absence of all cerebellar GABA-ergic neurons (Hoshino et al., 2005), suggesting that Ptf1a is necessary for the generation of GABA-7  ergic lineages. Like Atoh1 in glutamatergic fate specification, Ptf1a is also found to be sufficient for specification of GABA-ergic neuronal fate (Yamada et al., 2014). The ectopic expression of Ptf1a in the cerebellar RL was accomplished by either a knock-in transgenic mouse Atoh1Ptf1a (expression of Ptf1a is driven under the influence of the Atoh1 promoter) or by in utero electroporation of Ptf1a. In both cases, the misexpression of Ptf1a in the RL yielded cells that expressed cell markers of VZ-derivatives, indicating that the Ptf1a-expressing RL cells are conveyed to VZ-lineage identities despite the origin of the cells (Yamada et al., 2014). In addition to the role of GABA-ergic fate specification, expression of Ptf1a also prevents the VZ-derived cells from acquiring other cell fates that are normally generated from neighboring neuroepithelia. This is demonstrated by the genetic fate mapping analyses of the Pft1a-null mutant. These studies found that cerebellar Ptf1a-lineage cells aberrantly adopt the fates of granule cells and extracerebellar neurons in the absence of Ptf1a; these neurons normally arise from the adjacent Atoh1+ RL and the Ascl1+/Ptf1a- domain, respectively (Pascual et al., 2007; Millen et al., 2014). Thus, these findings indicate that Ptf1a expression in the cerebellum functions to define the boundary of the VZ from the more ventral Ascl1+ domain and the dorsal Atoh1+ RL (Fig. 1.2).  What sets the boundary between the Atoh1- and Ptf1a-expression domains? One possible mechanism is their mutual suppression. This is demonstrated by an electroporation experiment that ectopically introduced Atoh1 in the VZ and resulted in the reduction of Ptf1a-expressing cells in the VZ (Yamada et al., 2014). Similarly, when Ptf1a is ectopically expressed in the cerebellum there is a loss of Atoh1-expressing cells (Yamada et al., 2014). Furthermore, in the Ptf1a-null mutant, Atoh1 is found ectopically expressed in the VZ (Yamada et al., 2014) and in the cells resident in the EGL that originated from the VZ (Pascual et al., 2007). These findings further indicate that Ptf1a normally inhibits the expression of Atoh1 in VZ and VZ-lineages. In contrast, ectopic Ptf1a expression is not observed in Atoh1-null (Yamada et al., 2014), which suggests that other molecules are regulating Ptf1a expression in the RL.  In conclusion, these studies illustrate that Atoh1 and Ptf1a are the fate determinants of glutamatergic and GABA-ergic cerebellar neurons, respectively; and have a dynamic interaction in establishing the early germinal zones of the cerebellum.  8   Figure 1.2. Schematic illustration of the cerebellar germinal zones in an E10 embryo.  Cerebellar neurons arise from two molecularly and spatially distinct germinal zones: the ventricular zone (VZ) and rhombic lip (RL). The Ptf1a-expressing VZ gives rise to GABAergic cerebellar nuclear (CN) neurons, Purkinje cells (PC) and inhibitory interneurons (IN). The Atoh1-expressing RL produces glutamatergic CN neurons, granule cells (GC) and unipolar brush cells (UBC). The expression of Ptf1a prevents the progenitors from acquiring the identity of RL-lineages, as well as the identity of extracerebellar neurons that is arise from the adjacent Ascl1-positive, Ptf1a-negative domain. Mb, midbrain; Rp, roof plate.  1.1.3. Glutamatergic lineages originate from the rhombic lip   The genetically inducible fate mapping technique does not only identify the Atoh1-expressing RL cells as the origin of all cerebellar glutamatergic neurons, but also reveals that neurogenesis from the RL is arranged in a temporal sequence. By inducing cre-mediated recombination with Tamoxifen (TM) at various embryonic ages in the Atoh1-CreERT2 reporter mouse line and examining the adult brain, Machold and Fishell (2005) marked Atoh1-expressing cells born at particular embryonic time points and surviving into the adult cerebellum. Their fate 9  mapping experiments found that the first neurons generated at E10-E12 from the RL are the glutamatergic CN neurons, followed by the granule cells that are produced at E12.5-E17 in a rostral to caudal sequence (Machold and Fishell, 2005). Later Englund et al., by using an organotypic slice cuture system, determined that UBCs also originate from the RL and a cell birthdating analysis found that UBCs arise from the RL at E15.5-E17.5 (Englund et al., 2006) (see Fig. 1.3A).   In the next sections, the development and molecular cascade that regulates the development of each cerebellar glutamatergic neuron will be described in greater depth.  1.1.3.1. Molecular regulation of cerebellar nuclear neuron development  Starting at E10 in the cerebellum, progenitors of the glutamatergic CN neurons expressed Atoh1 (see schematic illustration in Fig. 1.3B). From the RL, these Atoh1+ CN neuron progenitors migrate tangentially through the subpial stream and during migration the cells also begin to express the transcription factor Pax6 (Fink et al., 2006). The CN neuron progenitors then transiently populate the nuclear transitory zone (NTZ) at E12-E15. As CN neuron progenitors enter the NTZ, the cells downregulate Pax6 expression and upregulate Tbr2 and Tbr1 expression, with Tbr2 expression seemingly preceding that of Tbr1 and then rapidly downregulating in the NTZ (Fink et al., 2006). Short survival BrdU birthdating analysis indicates that Tbr1-expressing CN neurons in NTZ are post-mitotic (Fink et al., 2006). At around E15.5, the glutamatergic CN neurons aggregated at NTZ begin to descend into the developing cerebellar core beneath the Purkinje cell layer, as illustrated by the Atoh1-reporter mouse (Wang et al., 2005) or by marking the CN neurons with Tbr1 antibody (Fink et al., 2006). In the postnatal cerebellum, the CN neurons are found in four subdivisions based on medial-lateral and anterio-posterior positioning: 1) the medial fastigial, 2) anterior interposed (emboliform), 3) posterior interposed (globose) and 4) lateral dentate nuclei. Only Tbr1 expression is maintained in the postnatal medial fastigial nuclei (Fink et al., 2006; Chung et al., 2009).  Of the aforementioned molecules involved in CN neuron development, Atoh1 is indispensable for the generation of glutamatergic CN neurons, as NTZ and Tbr1+ CN neurons are missing in Atoh1-null mutant (Wang et al., 2005; Fink et al., 2006). On the other hand, Tbr1 is not crucial for CN neuron production as shown by the Tbr1-null mutant mice that does not 10  lose CN neurons, but instead exhibits severe disorganization of the CN neurons, especially the medial fastigial nuclei (Fink et al., 2006). These findings suggest that Tbr1 plays a role in CN neuron placement but not neurogenesis. The role of Tbr2 in CN neuron development has not been illuminated through the loss-of-function approach due to early embryonic lethality of the Tbr2-null mutant mouse (Russ et al., 2000). The role of Pax6 in the development of CN neuron has not been described although the cerebellum is present but diminished in size with rudimentary foliation in the neonatal Pax6-null mutant (Engelkamp et al., 1999). Reelin expression is observed along the subpial stream at the time progenitors of CN neuron migrate from RL to NTZ, however, CN neurons in the reeler mutant mice migrate properly to NTZ during development (Fink et al., 2006), suggesting that other molecules regulate the migration of CN neurons. Other molecules that are found to be expressed in the NTZ or subpial stream are Lmx1a, Lhx2/9 and Meis1, 2, and their function in the development of CN neurons is not clear (Morales and Hatten, 2006; Chizhikov et al., 2010).   1.1.3.2. Molecular regulation of cerebellar granule cell development  Starting at E12.5 and up to E17, Atoh1-expressing progenitors in the cerebellar RL will give rise to granule cells, with early born GC progenitors designated to the anterior position in the granule layer, and GC of more posterior regions born successively later (Machold and Fishell, 2005). Like the CN neuron progenitors, fate mapping experiments show that the GC progenitors rapidly exit the RL following the onset of Atoh1 expression and these Atoh1+ GC progenitors then migrate tangentially to form the EGL that covers the entire cerebellar surface (Machold and Fishell, 2005) (see schematic illustration in Fig. 1.3B). One unique feature of granule cell development is that GC progenitors are produced from two germinal zones, first in the RL and then in the EGL. The proliferative GC progenitors emanate from the RL and remain mitotically active in the EGL, and these GC progenitors undergo predominately symmetric division to exponentially expand the GC progenitor population between E15 to P15 (Espinosa and Luo, 2008). Proliferation of GC progenitors in the EGL is driven by the Sonic hedgehog (Shh) secreted by the Purkinje cells underlying the EGL (Dahmane and Ruiz-i-Altaba, 1999). While in the RL and EGL, the migrating and proliferating Atoh1+ GC progenitors coexpress several other markers such as Pax6, Meis1, Zic1/2 and Barhl1 (Engelkamp et al., 1999; Aruga et al., 2002; Li 11  et al., 2004; Morales and Hatten, 2006). The mitotic activity of the GC progenitors ceases at around P15, and the EGL can be divided into two zones based on the cytomorphological observations (Altman and Bayer, 1997): 1) the superficial zone that consists of round and dense proliferative GCs and 2) the inner zone that comprised of elongated post-mitotic GCs that are more loosely packed. At the molecular level, post-mitotic GCs cease Atoh1 expression (Akazawa et al., 1995). The GCs in the inner zone differentiate and extend processes into the molecular layer, then migrate radially along the Bergmann glial (BG) processes to the internal granular layer (IGL) (Altman and Bayer, 1997; Komuro and Yacubova, 2003). During maturation and inward migration, the GCs express cell markers such as NeuroD1, Unc5h3 and Pax6 (Stoykova and Gruss, 1994; Ackerman et al., 1997; Miyata et al., 1999). Pax6 expression is further maintained by the GCs in the adult cerebellum (Stoykova and Gruss, 1994).  The genesis of GCs requires Atoh1, such that when Atoh1 is absent, as in the Atoh1-null mice, the mutant cerebellum lacks granule cells and fails to form EGL (Ben-Arie et al., 1997; Wang et al., 2005). In the Atoh1-null cerebellum, the RL is found to be smaller compared to wildtype littermates during the genesis of GCs (Ben-Arie et al., 1997; Jensen et al., 2004). Jensen and colleagues further described two germinal epithelia in the RL based on their cytomorphological characteristics (Jensen et al., 2004). The interior face of the RL (iRL) is adjacent to the fourth ventricle and is characterized by a columnar organization of cells. The exterior face of the RL (eRL) is continuous with the EGL and is characterized by cell organized tangentially like the cells in EGL. Based on this definition of the RL epithelium, these authors identified that the eRL, and the progenitor cells normally found in this region, is absent in the Atoh1-null, which lead to a smaller RL observed (Jensen et al., 2004). These results indicate that the loss of GC in Atoh1-null is a result of the failure to produce GC progenitors from the germinal epithelium.  In the EGL, granule cell proliferation is driven primarily by Shh signaling (Dahmane and Ruiz-i-Altaba, 1999). Shh is expressed and secreted by Purkinje cells starting at E17.5, whereas the granule cell progenitors express the receptor of Shh, Patched 1 (Ptch1) (Dahmane and Ruiz-i-Altaba, 1999; Lewis et al., 2004). The binding of Shh to Ptch1 releases Smoothened (Smo), the signal transducer of the Shh pathway, from inhibition and becomes phosphorylated. Phosphorylated Smo in turn regulates the expression of Shh target genes through Gli transcription factors. In addition to GC genesis, Atoh1 also regulates the Shh-dependent 12  proliferation of GC progenitors. When Atoh1 is conditionally deleted from GC progenitors in the P3 cerebellum, the EGL at P6 is much thinner and depleted of mitotically active GC precursors (Flora et al., 2009), which indicates a role for Atoh1 in the proliferation of GC progenitors. Furthermore, when proliferative capacity of GC progenitors is tested in vitro with the presence of Shh, the downregulation of Atoh1 expression in GC progenitors, either by BMP treatment (Bmp2 or Bmp4) or conditional knockout (cKO), resulting in decreased cell proliferation and reduced expression of Shh target genes, such as Gli1 and Cyclin D2 (Zhao et al., 2008; Flora et al., 2009). Gli2 is the main transcriptional effector of the Shh pathway and is found to be downregulated in the GC progenitors isolated from Atoh1-condition knockout (Flora et al., 2009). The authors demonstrated that Atoh1 binds the E-box in the Gli2 intron and promotes Gli2 expression, their findings indicate that Atoh1 promotes Shh signaling by activating the expression of Gli2 (Flora et al., 2009) (see Fig. 1.3C). These findings illustrate that expression of Atoh1 is required in the GC progenitors to be responsive to the Shh-mediated proliferation. The Zic family members are also implicated in GC proliferation, as the lack of Zic1 or combined loss of Zic1/2 or Zic1/4, all result in reduced proliferating GCs in the EGL (Aruga et al., 1998; Aruga et al., 2002; Blank et al., 2011). Blank and colleagues observed in the Zic1/4 compound mutant that there was a decreased expression of Shh target genes; further indicating the effect on GC proliferation by modulating the Shh pathway (Blank et al., 2011).   While Atoh1 is not expressed in GCs undergoing radial migration, Atoh1 may be indirectly involved in GC migration by regulating Barhl1 expression (Fig. 1.3C). Barhl1 is a member of the Bar family of transcription factors with an E-box in the 3’ region that is bound by Atoh1 (Kawauchi and Saito, 2008). Atoh1 and Barhl1 are coexpressed in the RL and GC progenitors (Kawauchi and Saito, 2008), moreover, their interaction is demonstrated by the induction of ectopic Barhl1 following Atoh1 transfection (Kawauchi and Saito, 2008), and Barhl1 expression is reduced in the Atoh1-null cerebellum (Chellappa et al., 2008). In the Barhl1-null cerebellum, post-mitotic GCs are observed to exhibit delay in radial migration and a subset of GCs fail to migrate and remain on the surface of the adult cerebellum (Li et al., 2004). These results indicate that Barhl1 is involved in the initiation of GC radial migration.   Pax6 is another prominent marker of GCs. It is expressed throughout the life history of the GC. The Pax6-null small eye mutant (Sey) cerebellum exhibits several abnormalities such as smaller cerebellar vermis, the lack of foliation and thickening of EGL at the hemisphere 13  (Engelkamp et al., 1999; Swanson et al., 2005). In the initial study of the Sey mutant, Engelkamp and colleagues observed a disorganization of the superficial and inner zone of the EGL, in which the post-mitotic GCs in the E18.5 Sey cerebellum fail to organize into the inner, premigratory zone of the EGL (Engelkamp et al., 1999). In addition, these authors found in the Sey EGL explant cultures that mutant cells lack neuronal processes (Engelkamp et al., 1999). The findings from this initial study suggests a role of Pax6 in GC migration (Fig. 1.3C). To further investigate the requirement of Pax6 in GC migration, Swanson and Goldowitz examined the Pax6-null GCs using experimental chimeric mouse that made up of wildtype and Sey mutant cells (Swanson and Goldowitz, 2011). The use of Sey chimera provides a unique opportunity to examine in-vivo the migration of mutant GCs in wildtype environment and vice versa. Analysis of chimera enabled the authors to distinguish whether the GC migration defect of Pax6-null is due to the intrinsic requirement of Pax6 in GC, or extrinsic interaction with the Pax6-null environment, or both. Moreover, since the Sey mutant is neonatal lethal at P0, the use of Sey chimera allows for the examination of Sey GCs postnatally. The authors found in the postnatal chimera that the Sey GCs cannot migrate into the IGL, while the wildtype cells successfully colonize the IGL in the same cerebellum (Swanson and Goldowitz, 2011). This finding indicates that Pax6 is required intrinsically in GCs for migration. Consistent with rat, the Sey mutant EGL cells co-cultured with wildtype cells do not extend neurites despite the presence of wildtype radial fibers (Yamasaki et al., 2001). GCs of the Sey mutant rat also fail to form parallel fiber and leading process as shown with Dil labeling and explant culture of EGL, respectively (Yamasaki et al., 2001). Together, these studies demonstrate that Pax6 function is indispensable from the proper radial migration of GC.  In their characterization of GC phenotypes in the Sey mutant, Engelkamp and colleagues also found that GCs expand ectopically outside of the cerebellum, into the inferior colliculus (Engelkamp et al., 1999). Interestingly, this phenotype resembles that of the Unc5h3-null mutant (Ackerman et al., 1997; Goldowitz et al., 2000), and indeed, Unc5h3 expression is missing in the GCs of the Sey cerebellum (Engelkamp et al., 1999), which indicates this aspect of GC migration defect is a result of the disrupted Pax6-dependent Unc5h3 expression in the GCs.   Differentiation of GCs starts around the time GCs enter the inner EGL, and the timing of GC differentiation is found to be coordinated by the expression of Atoh1 and NeuroD1 (Helms et al., 2001). NeuroD1 is expressed by the post-mitotic GCs in the inner EGL and IGL, and is 14  suggested to be an early marker of GC differentiation (Miyata et al., 1999). When NeuroD1 is absent from GCs during development, mitotic GC progenitors are found scattered across the EGL, the ML is also missing in the mutant (Pan et al., 2009). Furthermore, there is an increased cell death in the NeuroD1-null GCs which eventually eliminates GCs in the affected lobules (Miyata et al., 1999; Pan et al., 2009). Expression of NeuroD1 is positively regulated by Atoh1, as NeuroD1 expression is lost in the Atoh1-null cerebellum (Ha et al., 2012), whereas Atoh1-overexpression enhanced NeuroD1 transcription (Helms et al., 2001). In fact, NeuroD1 is found to be a direct target of Atoh1 in the GC progenitors (Klisch et al., 2011) (Fig. 1.3C). Interestingly, Atoh1 is negatively regulated by the expression of NeuroD1. As Pan and colleagues showed that in normal cerebellar development, Atoh1 is rapidly downregulated when NeuroD1 is expressed in the post-mitotic GCs localized to the inner EGL, whereas Atoh1 expression is maintained in these cells in the NeuroD1 conditional knockout mice (Pan et al., 2009). Thus, NeuroD1 provides negative feedback to Atoh1 expression, which is crucial to promote GC differentiation. In addition, NeuroD1 is found to be down-regulated in the Sey cerebellum in the study of Pax6 regulatory transcription, which suggests that Pax6 also positively regulates NeuroD1 expression (Ha et al., 2012). Altogether, findings from these studies begin to reveal the complex molecular interaction between Atoh1, Pax6, NeuroD1 and many other genes underpinning the development of cerebellar GCs.   1.1.3.3. Molecular regulation of unipolar brush cell development  The genesis of unipolar brush cells takes place between E15.5 to E17.5 as determined by birthdating analysis (Englund et al., 2006). These authors, by ablating the RL from an embryonic cerebellum in an organotypic slice culture experiment, showed that the number of UBCs is reduced (Englund et al., 2006). This result suggests that either RL produces UBCs, or RL provides signals to germinal zone outside RL to produce UBCs. To test whether the RL contains progenitors of UBC, these authors labeled the RL cells with GFP expression, and in the organotypic slice culture replaced the ablated RL (from a non-GFP cerebellum) with this GFP+ RL (Englund et al., 2006). When the co-cultured cerebellar slice was examined at later time points, GFP+ UBCs were found in the developing cerebellar core, thus confirming that UBCs originate from the RL (Englund et al., 2006).  15  Like other RL-derivatives, Atoh1 is expressed in UBC progenitors as the cells arise from the RL (Englund et al., 2006). The UBC progenitors, at this time, also co-express Pax6, Tbr2 and Lmx1a (Englund et al., 2006; Yeung et al., 2014). Tbr2 is known as the UBC-specific marker as Tbr2 marks UBCs from birth to maturity (Englund et al., 2006). During the genesis of UBC at 15.5, Tbr2+ UBC progenitors appear as a stream of cells that reside at the interface of the exterior and interior face of the RL (Yeung et al., 2014). Unlike the other Atoh1-derived RL-lineages, newly generated UBC progenitors do not leave the RL immediately but remain in the RL region for a few days before they disperse into the cerebellar core (Englund et al., 2006). Within the RL region, the UBC progenitors become post-mitotic and downregulate Atoh1 expression (Englund et al., 2006). At around birth (E18.5 to P0), UBCs emerge from the RL into the cerebellar core (Englund et al., 2006).   Like CN neurons and GCs, Atoh1 is required for the genesis of UBCs. Interestingly, in the cerebellum of the Atoh1-null embryos a small number of Tbr2+ cells (27% of Tbr2+ in wildtype littermate) was detected at E14.5, which is gradually decrease to 10% (of Tbr2+ cells in wildtype) at E19.5 (Englund et al., 2006). The incomplete loss of Tbr2+ cells in the Atoh1-null may suggest that there is some compensation to the loss of Atoh1 in generating UBCs from the RL, or that some UBCs are derived from germinal zone outside the Atoh1+ RL. On the other hand, the gradual loss of the remaining Tbr2+ cell in the Atoh1-null would suggest that survival of UBCs requires the action of Atoh1 downstream genes. Tbr2 may be involved in the migration and differentiation of UBCs, as shown in the Tbr2 conditional knockout where cells of the Tbr2-lineage are still present in the cerebellum but fail to migrate and to express the expected molecular signature (R. Hevner, personal communication). The role of Pax6 and Lmx1a in the development of UBCs is not clear. UBCs are present in Lmx1a-null dreher mutant, indicating that Lmx1a do not play a role in genesis of UBC, however, whether the UBCs in the dreher mutant exhibits normal migration or differentiation is unknown (Chizhikov et al., 2010).   16   Figure 1.3. Schematic illustration of the development of cerebellar glutamatergic neurons.  (A) The temporal sequence of neurogenesis from the rhombic lip. (B) The gene expression profiles of each neuron type at different embryonic stages. (C) Development of granule cells is regulated by different molecules. Interactions between these molecules form a regulatory network that coordinate different developmental processes. CP, choroid plexus; EGL, external germinal layer; NTZ, nuclear transitory zone; RL, rhombic lip; VZ, ventricular zone. 17  1.1.4. GABA-ergic lineages originate from the ventricular zone  The Pft1a+ ventricular zone that gives rise to all cerebellar GABA-ergic neurons also expresses Ascl1 (Kim et al., 2008). The Ptf1a+/Ascl+ VZ is molecularly distinct from the more ventrally located domain that expresses Ascl1 but not Ptf1a, which is shown to give rise to extracerebellar neurons (Millen et al., 2014) (see Fig. 1.2). The genetic fate mapping analyses of Ascl1-expressing cells delineated the temporal sequence of neurogenesis from the VZ (Kim et al., 2008; Sudarov et al., 2011) (see Fig. 1.4A). The first wave of neurogenesis from the VZ includes the GABA-ergic CN neurons that are born at around E10.5 to E11.5, Purkinje cells are born at the same time but genesis lasts until E13.5 (Hashimoto and Mikoshiba, 2003; Kim et al., 2008; Sudarov et al., 2011). The second wave of neurogenesis from the VZ begins at E13.5 and continues up to postnatal age around P7 which generates inhibitory interneurons (Leto et al., 2006; Sudarov et al., 2011). It was also observed that interneurons are produced in a temporal sequence that correlates with an inside-to-outside position in the cerebellum: Golgi cells in the IGL born first, follow by basket cells that localized to the inner molecular layer, and the stellate cells in the outer molecular layer born last (Sudarov et al., 2011).      How is neuronal diversity achieved when progenitors of different neurons arise from the VZ at the same time? One mechanism is the compartmentation of the VZ into molecularly distinct sub-territories, each gives rise to different cell types. From the expression analysis of proneural genes in the embryonic cerebellum, Zordan and other described the differential expression of Ngn1 and Ngn2 within the Ptf1a+/Ascl1+ VZ, that identifies two territories (see schematic illustration in Fig. 1.4B): an anterior domain of Ngn1-/Ngn2+/Ptf1a+/Ascl1+ and a posterior Ngn1+/Ngn2+/Ptf1a+/Ascl1+ expressing domain (Zordan et al., 2008). Genetic fate mapping of the Ngn1 or Ngn2-expressing cells revealed different cell fates are generated from each lineage. The Ngn1+ progenitors give rise to Purkinje cells and interneurons, but not GABA-ergic CN neurons (Lundell et al., 2009; Obana et al., 2015). In contrast, Ngn2+ progenitors are primarily fated to become Purkinje cells, GABA-ergic CN neurons and interneurons populating the dorsal cochlear nucleus, but not Golgi cells, basket cells and stellate cells in the cerebellar cortex (Florio et al., 2012). Thus, these findings illustrated the existence of spatial compartment in the VZ, as defined by different molecular expression patterns, as the underlying mechanism that generates diversity of GABA-ergic cerebellar neurons. 18   In a recent study, Seto and colleagues identified a molecular control of temporal identity transition in the VZ that regulates the production of early born PCs verse the later born interneurons (Seto et al., 2014). This group examined the expression of two transcription factors: Gsx1 and Olig2, and tested the interaction between these molecules in the VZ (see schematic illustration in Fig. 1.4C). Both transcription factors are expressed in the Pft1a domain, Gsx1 is expressed in the cells of the ventral Ptf1a+ domain and Olig2 is dorsally expressed, and the two expression domains are mutually exclusive. Moreover, the Gsx1 and Olig2 domains display a dynamic change during development, such that Gsx1 expands dorsally over time and supersedes the Olig2 expression domain. By ectopically expressing Gsx1 in the VZ, the authors demonstrated that Gsx1 suppressed Olig2 expression and induced interneuron identity, rather than a Purkinje cell identity, in the cells with ectopic Gsx1 expression. In contrast, ectopic expression of Olig2 did not suppress Gsx1 but inhibited the progenitors from differentiating to interneurons. Thus, the findings in this study suggest that Gsx1 promotes the switch to interneuron identity while Olig2 function acts as a brake for the temporal identity transition in the VZ (Seto et al., 2014).   19   Figure 1.4. Schematic illustration of the development of cerebellar GABA-ergic neurons.  (A) The temporal sequence of neurogenesis from the ventricular zone. (B) The VZ is divided into two molecularly and spatially distinct compartments that each gives rise to different set of neurons. (C) The VZ also exhibits a temporal identity transition, in which the expression domains in the VZ change over time to produce different neurons. CP, choroid plexus; RL, rhombic lip; VZ, ventricular zone.  1.2. Pax6 regulatory gene network Pax6 is a member of the paired box (PAX) gene family with two highly conserved DNA-binding domains: a bipartite paired domain and a paired-type homeobox domain (Walther and Gruss, 1991). Pax6 is predominately expressed during embryogenesis in the brain, eye, olfactory system and pancreas (Walther and Gruss, 1991), and is implicated in the development of these systems. The first Pax6 mutant phenotype described in mice was a small to absent eye, where homozygotes exhibit lack of eyes and the heterozygotes have reduced eye size (Hogan et al., 1986), which earned the mutant the “Small Eye” (Sey) name. As Pax6 is highly conserved in evolution, the loss of Pax6 homologues in other species was also found to lead to eye phenotypes. For example, in the eyeless Drosophila mutant there is a lack of eye while in human it is manifested as aniridia (Quiring et al., 1994). By studying these models, it is clear that Pax6 regulates a complex network of genes that control eye development from tissue patterning to 20  differentiation [for review, see (Shaham et al., 2012)]. Thus, it is accepted that Pax6 is the master gene for eye development (Gehring, 1996).  Likewise, in the human and mouse brain, homozygous (or compound heterozygous) mutations in Pax6 results in phenotypes such as smaller cortex and disruption of cortical lamination (Schmahl et al., 1993a; Schmidt-Sidor et al., 2009), which suggests that the development of forebrain is interrupted in the loss-of-Pax6 function. Studies of the Pax6 mutant cortex have identified the role of Pax6 in regulating multiple developmental processes including dorsal-ventral specification, neurogenesis, progenitor proliferation and cell migration (Toresson et al., 2000; Englund et al., 2005; Quinn et al., 2007). The Pax6 mutant cerebellum also exhibits phenotypes including smaller vermis, lack of foliation and thicker EGL (Engelkamp et al., 1999). While GC developmental defects in Sey mutant cerebellum have been examined extensively, studies on the other cell types in the Sey cerebellum is scarce.  To understand Pax6 function in cerebellar development, our laboratory employs a molecular genetic approach. Since Pax6 is a transcription factor, we can gain insight in the requirement of Pax6 by identifying its downstream effector genes. To this end, we determined the gene expression profiles of the E13.5, E15.5 and E18.5 wildtype and Sey mutant cerebellum. By comparing the cerebellar gene expression profiles of the wildtype and Sey mutant, we identified a list of genes that are differentially expressed in the mutant cerebellum (Ha et al., 2012). In the list of Pax6-regulated genes, some genes were previously shown to be downregulated in the Sey mutant cerebellum such as Reelin (Swanson et al., 2005). The analysis also revealed novel interactions between Pax6 and genes that are known to be involved in granule cell development such as NeuroD1 (Pan et al., 2009). Interestingly, genes that are expressed by CN neurons and UBCs but not granule cells, for instance Tbr1 and Tbr2 (Eomes) (Fink et al., 2006; Englund et al., 2006), were also identified in the Pax6 differential transcriptome analysis. The findings of the differential expression of Tbr1 and Tbr2 indicates that Pax6 may also play a crucial role in the development of other RL-derivatives. The Pax6 cerebellar transcriptome analysis also identified novel genes that have not been implicated in cerebellar development, such as Wntless (Wls), Ostf1 and Cplx2. These findings prompted us to expand our study of the Pax6-null mutant cerebellar and to further examine the role of some of these genes in cerebellar development, as well as their interaction with Pax6 in the cerebellum. 21  In the following sections, I will describe studies on the role of Pax6 and related genes in cerebellar development, and focus my attention on three genes that were differentially expressed in the Sey cerebellum: Tbr1, Tbr2 and Wls.  1.3. Pax6 and the developmental genetics of the cerebellum  1.3.1. Wls and Pax6 are expressed in distinct compartments in the rhombic lip In the telencephalon, Pax6 is expressed in a dorsal domain in the pallium (progenitor domain of cerebral cortex) which is complementary to the ventrally-expressed Gsh2 in the subpallium (progenitor domain of striatum) (Toresson et al., 2000). The complementary expression of Pax6 and Gsh2 is critical in specification of dorso-ventral identity by establishing the pallial-subpallial boundary that prevent progenitors from mixing. Moreover, Pax6 specifies the cortical fate of dorsal progenitor cells by regulating the expression of pallial markers such as Ngn1 and Ngn2 (Toresson et al., 2000). On the other hand, Gsh2 regulates a distinct set of subpallial markers including Dlx1, Dlx2 and Mash1 that specify a ventral, striatal fate (Toresson et al., 2000). It was observed that in the Pax6-null mutant telencephalon, Gsh2 expression expanded into the former Pax6 territory, and the progenitors in the pallium ectopically expressed the ventral markers Dlx and Mash1 (Toresson et al., 2000). Conversely, in the Gsh2-null mutant, Pax6 as well as the dorsal marker Ngn2 are ectopically expressed in the subpallium; the mis-expression conveys a cortical identity to the ventral progenitors (Toresson et al., 2000). These findings illustrate the cross-inhibition between Pax6 and an opposing gene (e.g. Gsh2 in telencephalon) in establishing neurogenic territories in the neuroepithelium.   In the cerebellum, the VZ consists of similar dynamic spatial compartments, marked by the expression of Olig2 and Gsx1, which specify VZ progenitors to a Purkinje cell and interneuron fate, respectively (Seto et al., 2014). Similar spatial compartments, however, have not been described in the RL. To examine if Pax6 plays a similar role in compartmentation in the cerebellum, I study the expression of Pax6 and other RL genes. One interesting preliminary observation is that the expression of Wls is complementary (ie, largely non-overlapping) to the Pax6 expression domain in the RL. Moreover, Wls expression is upregulated in the Sey mutant 22  cerebellum as revealed by our analysis of the Pax6 transcriptome (Ha et al., 2012), suggesting that Wls and Pax6 domains may interact in the RL like Pax6 and Gsh2 in the telencephalon.  In Chapter 2, I test the idea of spatial compartments in the RL during cerebellar development by examining the expression of several RL markers. The findings from this study describe four molecularly distinct compartments in the RL during cerebellar development. Furthermore, I elucidate the interaction between these molecules by studying the effect of knocking down these markers, one at a time, in mutant mice. This set of experiments, for the first time, confirm the existence of molecularly and spatially distinct compartments in the RL, and propose a model of how these compartments may regulate neuronal diversity in the cerebellum.   1.3.2. The role of Pax6 in the development of cerebellar nuclear neurons and unipolar brush cells  In the developing cortex and olfactory bulb, Tbr1 and Tbr2 are part of the transcriptional cascade downstream of Pax6, which controls the genesis of glutamatergic neurons (Englund et al., 2005; Imamura and Greer, 2013). For instance, in corticogenesis, Pax6 is expressed by the radial glia, the progenitors that divide at the ventricular surface to produce the intermediate progenitor cell (IPC). Tbr2 is then expressed in the IPC that downregulated Pax6 expression (Englund et al., 2005), and Tbr1 is expressed when these progenitor cells become post-mitotic cortical neurons (Hevner et al., 2001). Thus, these markers are expressed in the cortical neurons in a sequential order of Pax6, Tbr2 and Tbr1. Pax6 is also found to positively regulate the expression of Tbr1 and Tbr2 in the cortical neurons. It is found in the gene expression profiles of Pax6-overexpressing cortex that Tbr1 and Tbr2 are upregulated; on the other hand, Tbr1 and Tbr2 are downregulated in the Sey mutant (Quinn et al., 2007; Holm et al., 2007; Sansom et al., 2009).   How is Pax6 related to Tbr1 and Tbr2 in the cerebellum? Expression of Tbr1 and Tbr2 has been characterized previously in the progenitors of CN neurons and UBCs (Englund et al., 2006; Fink et al., 2006). Our Pax6-transcriptome analysis showed that in the wildtype cerebellum, Tbr1 and Tbr2 are highly expressed at E13.5 and E18.5, respectively, coinciding with the genesis of CN neurons and UBCs. In contrast, the Pax6-null transcriptome displayed a downregulation of Tbr1 and Tbr2 expression at all embryonic ages examined (Ha et al., 2012). 23  This observation indicated that in the cerebellum, Tbr1 and Tbr2 expression is Pax6-dependent. This raises the possibility that Pax6, by regulating Tbr1 and Tbr2 expression, may also play a role in the development of CN neurons and UBCs. In Chapter 3, I examine the CN neurons and UBCs in the Sey mutant cerebellum to determine the role of Pax6 in the development of these neurons. To this end, I first investigate the cellular nature of the downregulation of Tbr1 and Tbr2 in the Sey cerebellum. This allows me to identify novel CN neuron and UBC phenotypes in the Sey mutant. By closely examining the developmental processes of CN neurons and UBCs in the Sey mutant, and by the use of experimental Pax6 chimeras, I further illuminated the requirement of Pax6 in the development of these neurons. This study recognized the previously unidentified multivalent role of Pax6 in cerebellar development.  1.3.3. The role of Wls in cerebellar neurogenesis and lamination Wls (previously known as GPR177, Sprinter, Evi or 5031439A09Rik) is an evolutionary conserved transmembrane protein found in metazoa from Drosophila to human (Goodman et al., 2006; Banziger et al., 2006; Bartscherer et al., 2006). First reported by studies in Drosophila, Wls was found to mediate the intracellular trafficking of Wnt molecules between the Golgi apparatus and cell membrane of Wnt-producing cells (Banziger et al., 2006). The analysis of Wls mutant flies revealed an impaired Wnt signaling despite that cells were able to produce Wnt molecules. However, Wnt molecules were accumulated in the Wls-null Wnt-producing cells, indicating that these cells fail to secrete Wnt molecules (Bartscherer et al., 2006; Banziger et al., 2006; Goodman et al., 2006). These findings demonstrated that Wls, by regulating the secretion of Wnt molecules, plays an indispensable role in Wnt signaling and Wnt-dependent developmental processes. In mouse, Wnt signaling mediated by Wnt3, is crucial in the establishment of the anterior-posterior axis and primitive streak during early embryonic development (Liu et al., 1999b). Inactivation of Wls impairs secretion of Wnt3 and Wnt signaling, thus the embryo fails to form the primitive streak during early embryogenesis, as a results, the Wls-null mutant embryos die at around E10.5 (Fu et al., 2009).  During cerebellar development, Wls is expressed at the IsO and RL. It is known from the 24  studies of Wnt1-null mutant that Wnt1 in the IsO plays a key role in midbrain-hindbrain development (Thomas and Capecchi, 1990; McMahon and Bradley, 1990). The requirement of Wls in the IsO has been studied independently by two groups, both used conditional knockout approach to circumvent the early embryonic lethality in the Wls-null (Carpenter et al., 2010; Fu et al., 2011). To target Wls deletion at the IsO, both groups used Wnt1-cre to drive Wls inactivation in the Wls-floxed mice. The resulting Wls conditional knockout embryos exhibit a loss of midbrain-hindbrain structure, resembling the Wnt1-null mutant phenotypes (McMahon and Bradley, 1990; Carpenter et al., 2010; Fu et al., 2011). Although Wnt1 production in the Wls conditional knockout is unaffected, Wnt signaling is abolished at the midbrain-hindbrain region (Carpenter et al., 2010; Fu et al., 2011). These results indicate that Wls plays a role in midbrain-hindbrain patterning by regulating the secretion of Wnt1 at the IsO. However, since the establishment of cerebellar primordium is disrupted in this conditional Wls knockout, the Wls function in RL development remains unclear.  In Chapter 4, I examine the role of Wls in the RL using a genetic knockout approach. In order to circumvent the issues associated with the early requirement of Wls at the primitive streak and IsO, I use the Nestin-cre mice (Tronche et al., 1999) to inactivate Wls in the RL at midgestation. Wls expression in the cells of the RL is abolished in this conditional knockout and the Wls-cKO mouse exhibits a severely malformed cerebellum. By closely examining different cerebellar cell types in the Wls-cKO across development, I identify the cerebellar developmental processes that are abnormal in the absence of Wls in the RL. This work illustrates the critical role of Wls in cerebellar development.    25  Chapter 2 : Wls provides a new compartmental view of the rhombic lip in mouse cerebellar development 2.1. Introduction Tissue patterning by gene expression is an important developmental process in the generation of different structures and specific cell types in multicellular organisms. In the developing vertebrate CNS, the midbrain and cerebellar primordia are specified by the opposing expression of Otx2 and Gbx2, which patterns the developing neural plate and positions the isthmic organizer (IsO) at the midbrain-hindbrain boundary (Broccoli et al., 1999; Millet et al., 1999). Subsequently, expression of Atoh1 and Ptf1a specify two distinct germinal zones in the cerebellar anlage, the rhombic lip (RL) and the ventricular zone, respectively (Ben-Arie et al., 1997; Hoshino et al., 2005; Pascual et al., 2007; Yamada et al., 2014). The Atoh1+ rhombic lip gives rise to the glutamatergic lineages including the large cerebellar nuclear (CN) neurons, granule cells, and unipolar brush cells (UBCs); while the Ptf1a+ ventricular zone gives rise to GABAergic lineages such as the GABAergic nuclear neurons, Purkinje cells and interneurons.  An important molecule in the development of the main glutamatergic cell to emanate from the rhombic lip, the cerebellar granule cell, is Pax6, a paired-domain transcription factor (Engelkamp et al., 1999; Swanson et al., 2005). Pax6 expression marks the Atoh1+ cells that arise from the RL and the granule cell progenitors (Stoykova and Gruss, 1994). The loss of Pax6, as in the Small Eye mutant (Sey) mouse, results in the disruption of cerebellar foliation and the organization of the external germinal layer (EGL) (Engelkamp et al., 1999; Swanson et al., 2005; Swanson and Goldowitz, 2011). To identify Pax6-related genes that are presumably causal for the granule cell mutant phenotype, our group studied the transcriptional network regulated by Pax6 where we measured the whole genome transcriptome of Sey mutant and wildtype cerebella at different development stages (Ha et al., 2012). By comparing the transcriptomes between Sey mutant and wildtype cerebella, we identified genes that are differentially regulated in the developing cerebellum in the loss of Pax6. One of the genes that exhibited an up-regulation in the Sey mutant cerebellum is Wntless (Wls, also known as GPR177). Wls is a highly conserved, multipass transmembrane molecule. Studies in Drosophila have indicated a role for Wls in promoting Wnt molecule secretion 26  (Banziger et al., 2006; Bartscherer et al., 2006). A recent study in the mouse has demonstrated the requirement of Wls in body axis establishment (Fu et al., 2009). However, the role of Wls in cerebellar development remains unknown. The microarray analysis of transcript expression shows that in the wildtype cerebellum, Wls is highly expressed during early development and diminished over time. However, in the Sey mutant, cerebellar expression of Wls is found to be upregulated at the time when expression normally decreases in the wildtype cerebellum.   In this study, we describe Wls as a novel molecular marker of the rhombic lip that joins four other cell markers (Atoh1, Pax6, Lmx1a and Tbr2) in identifying four molecularly distinct compartments in the developing rhombic lip. Atoh1-null and Sey mutants are used to test the interaction between Wls, Atoh1 and Pax6. We find that Wls expression is independent of Atoh1 influence in the RL while Wls expression is negatively regulated by Pax6.   2.2. Results 2.2.1. Expression profile of Wls in the embryonic cerebellum  To elucidate the role Wls plays in cerebellar development, we first determined the expression profile of Wls in cerebellum during embryonic development. In situ hybridization was performed on sectioned brain tissues collected from E13.5, E15.5 and E18.5 wildtype embryos. Expression of Wls transcript is localized predominately to the cerebellar rhombic lip throughout these embryonic stages (Fig. 2.1A-C, arrows). Contiguous with the cerebellar RL, the choroid plexus epithelium of the fourth ventricle and the lower RL of the hindbrain are also found to express Wls. At the midbrain-hindbrain boundary, the isthmic organizer region, Wls transcript is also detected at all embryonic stages examined (Fig. 2.1A, asterisk). Cells in the ventricular zone are also positive, particularly at E15.5. Staining is less evident in the ventricular zone at E13.5 and 18.5. Wls transcript is found to be lightly expressed in the meninges and roof plate over the cerebellum.  To further characterize Wls in the developing cerebellum, we examined the expression of Wls protein using immunohistochemistry with two antibodies that recognize either the N-terminal or the C-terminal amino acid of the Wls peptide. Wls protein expression is detected in the cerebellum at all developmental stages examined (E13.5, E15.5 and E18.5; Fig. 2.1D-F). Expression is localized to the cerebellar RL, choroid plexus, lower RL, IsO region as well as the 27  meninges and roof plate over the cerebellum. The expression patterns are identical between the two antibodies used for Wls protein detection (See Appendix 1, Supplementary Fig. 1). This pattern of immunostaining is identical to the expression profile of the Wls transcript. These results demonstrate that Wls has a very restricted expression domain in the developing cerebellum. In the adult, the only expression of Wls, which is light, is found in the Purkinje cells (Supplementary Fig. 2).  28   Figure 2.1. Wls expression is localized to the cerebellar rhombic lip during embryonic development. Expression of Wls transcript and protein in the cerebellum, across embryonic development, is revealed by in situ hybridization (A, B, C) and immunohistochemistry (D, E, F) analyses on wildtype brain tissues collected at E13.5, E15.5 and E18.5. Wls expression is localized predominately to the cerebellar rhombic lip at all ages examined (arrows). Wls is also expressed at the isthmic organizer region (asterisks in A and D), in the cells of the choroid plexus of the fourth ventricle, and in the meninges over the cerebellum and roof plate. Abbreviations: CP, choroid plexus; EGL, external germinal layer; ISO, isthmic organizer; RL, rhombic lip; VZ, ventricular zone. Scale bars represent 100m. 29  2.2.2. Expression of the -gal reporter in WlsLacZ/+ mice  To further elucidate the expression pattern of Wls, we used a -galactosidase (-gal) reporter mouse strain (see Materials & Methods section). Mice heterozygous for the knock-in allele appear normal and are fertile, homozygous WlsLacZ/LacZ, however, is early embryonic lethal. Embryos ranging from E10.5 to E18.5 were harvested from heterozygote × wildtype matings. Tissues from heterozygote and wildtype embryos were processed for X-gal staining. The presence of -gal reporter activity is readily detected with X-gal staining in whole-mount and sectioned tissues of heterozygous embryos, while staining is absent, as would be expected, from wildtype tissues (Fig. 2.2, Supplementary Fig. 3). At the early embryonic stage, E10.5, a strong dorsal midline expression of the reporter protein is detected in the developing brain, including the telencephalon, diencephalon, mesencephalon and the rhombencephalon (Fig. 2.2A-B). Also noticeable at this early stage is a broad expression at the hindbrain roof plate that gives rise to the future choroid plexus (Fig. 2.2A). Examination at the cellular level reveals that in the early developing cerebellum, expression of the reporter protein is seen in the cells of the roof plate and the developing choroid plexus (E11.5, Fig. 2.2C). At later stages of embryonic development, X-gal staining is largely restricted to cells in the cerebellar RL and the choroid plexus (Fig. 2.2D-F), the IsO region (Fig. 2.2E, black asterisk), as well as the meninges. The embryonic expression pattern of the reporter protein recapitulates endogenous Wls expression in the cerebellum (Fig. 2.1). There are a few -gal-positive cells in the subpial stream from E11.5 to E14.5, but found to be Wls-immunonegative on the adjacent sections (compare arrowhead in Fig. 2.2D to white arrow in Supplementary Fig. 4). It is common for -gal to have a longer perdurance compare to the protein of interest, thus this observation would suggest that these -gal+/Wls- cells are from the Wls-lineage that has downregulated Wls expression. At the cellular level, Wls immunostaining indicates that the protein is localized in the cytoplasm (Fig. 2.3, left). Staining for -gal reporter protein with -gal antibody also shows a cytoplasmic localization and staining appears punctate (Fig. 2.3, middle). The double-labeling for -gal and Wls protein (using the antibody against the C-terminus) in heterozygous embryos illustrates colocalization in the cells of the cerebellar RL (Fig. 2.3, right). When labeled with the Wls antibody that recognizes the N-terminus of the Wls protein, the staining of Wls appears punctate and is perfectly colocalized with the -gal staining (Supplementary Fig. 5). These 30  findings corroborate the notion that each of these three visualization techniques provides a faithful rendition of Wls expression in the developing cerebellum. Most importantly, these three approaches identify the Wls-positive cells as largely localized to the interior face of the RL (iRL), while cells of the exterior face of the RL (eRL) are Wls-negative (Fig. 2.3; regions separated by dashed line). Furthermore, these findings validate the use of this transgene reporter model to study Wls expression.  Figure 2.2. Expression of the -gal reporter protein in WlsLacZ/+ mice recapitulates the expression of endogenous Wls during cerebellar development.  The WlsLacZ/+ reporter strain carries a transgene that expresses the -gal protein under the control of the endogenous Wls 5’ region. Sections of WlsLacZ/+ embryos and brain tissues were stained for -gal activity. (A) Expression of the -gal protein is observed in the central nervous system as early as E10.5, at the developing forebrain, midbrain, hindbrain and the roof plate (asterisks). (B) A strong midline expression is observed in these developing brain regions. The embryos are positioned to provide a view from the posterior (looking at the roof of the 4th Ventricle) in Bi and from the anterior (looking at the telencephalic vesicles) in Bii. (C-F) Expression of the -gal reporter protein in the developing cerebellum is localized to the upper rhombic lip (arrows in C-F), isthmic organizer region (black asterisk in E), choroid plexus and the meninges over the cerebellum and roof plate. A cohort of cells positive for β-gal but Wls-immunonegative is observed at the cerebellar surface subpial stream (arrowhead in D). Abbreviations: CP, choroid plexus; HB, hindbrain; MB, midbrain; RP, roof plate; RL, rhombic lip. Scale bars represent 100m. 31   Figure 2.3. Wls and -gal reporter protein are co-localized in the rhombic lip.  Immunohistochemistry was performed on brain tissues of E15.5 WlsLacZ/+ embryos, using anti--gal antibody and an antibody that targets the c-terminus of Wls (absent in the truncated reporter protein). Expression of endogenous Wls is localized predominately to the iRL (red fluorescence, left panel), whereas the eRL is Wls-negative. The -gal reporter is expressed at the same region in the iRL (green punctate fluorescence, middle panel). Double-labeling shows the expression of Wls and -gal protein are co-localized in the cytoplasm of the iRL cells (merged image, right panel). Abbreviations: CP, choroid plexus; eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip. Scale bar represents 50m.  2.2.3. Expression of Wls is complementary to, and independent of, Atoh1 expression in the RL  Atoh1 is the master control gene that defines the cerebellar RL and is critical for the generation of RL derivatives. The novel finding that Wls is expressed in the RL prompted us to ask whether Wls is a member of the Atoh1 molecular cascade. As a first step, we compared the anatomical expression of Wls with Atoh1 in the wildtype RL. Atoh1 is expressed in the RL as early as E9.5 and in the RL-derivatives during embryonic development (Machold and Fishell, 2005; Wang et al., 2005). By using the Atoh1LacZ/+ reporter mouse [-gal reporter protein expression driven under Atoh1 locus; (Ben-Arie et al., 2000)], we found that during early development (E11.5), Wls expression in the RL is largely complementary to the Atoh1-expressing cells that are located at the surface of the emerging cerebellar anlagen (Fig. 2.4A). In the E13.5 cerebellum, Wls is expressed throughout the RL (Fig. 2.5A), and the overlap of expression of Atoh1 (-gal positive; Fig. 2.5B) and Wls occurs in columns oriented in the 32  anterior-to-posterior domain (Fig. 2.5C, bounded by the dotted line). In the E15.5 cerebellum, Atoh1 and Wls expression domains further segregate, where the expression of Wls is localized predominately to the iRL (Fig. 2.5D) and Atoh1 expression to the eRL (Fig. 2.5E), with only a few cells coexpressing Wls and Atoh1 in the RL (Fig. 2.5F, arrow). At the E15.5 time point the Wls-positive cells end abruptly at the presumed dorsal border of the RL (Fig. 2.5D) while Atoh1-positive cells are seen to be continuous with the forming EGL (Fig. 2.5F). By E18.5, Wls expression is restricted to the diminishing RL and completely segregated from the Atoh1-expressing cells in the EGL (Fig. 2.5G-I). Thus, Wls is largely expressed in different cells than those that express Atoh1.  Given the differential cellular localization of Atoh1 and Wls, we hypothesized that these two molecules play independent roles in the life of the RL. To test this hypothesis, we examined the Atoh1-null mutant to determine whether the fate of Wls-expressing cells was altered in the knockout. At E15.5, the EGL and eRL are absent in the Atoh1-null as previously reported (Ben-Arie et al., 2000; Jensen et al., 2004; Wang et al., 2005), and the cerebellar RL appears much smaller in the mutant cerebellum compared to that of the wildtype. Surprisingly, Wls expression appears unaltered in the RL, choroid plexus and IsO region of the Atoh1-null cerebellum (Fig. 2.6; Supplementary Fig. 6). This Wls-positive domain in the Atoh1-null mutant maps onto the cytoarchitectonics of the cells of the iRL [i.e. in columnar arrays as noted by Jensen et al (Jensen et al., 2004)]. Interestingly, there is now coexpression of Wls and Atoh1 in many cells of the iRL. This coexpression is only seen in a limited number of cells in the wildtype RL (compare Fig. 2.5F with Fig. 2.6, Right Panel). The finding of a lack of alterations of Wls immunoreactivity in the Atoh1-null is consistent with the transcript level of Wls in the Atoh1-null cerebellum (Ha et al., 2012). These results demonstrate that the Wls expressing domain in the RL is independent of the regulation of Atoh1. 33   Figure 2.4. The cerebellar rhombic lip is comprised of two molecular populations (Wls+/Lmx1a+/Atoh1- and Wls-/Lmx1a+/Atoh1+) during early development at E11.5.  Immunocytochemical demonstration of expression of Wls (A, red fluorescence, left panel) and Lmx1a (B-C, red fluorescence, left panel) and Math 1 (A-B, green fluorescence, as seen in Atoh1LacZ/+ mice). Atoh1 is expressed in cells that are at the surface of the cerebellar anlagen, and non-overlapping with Wls (A) and Lmx1a (B) expression in the RL. There is intermixing of Wls+ cells and Atoh1+ cells at the boundary of the two expression domains (A, right panel); a minimal number of cells shows co-expression of Lmx1a and Atoh1. (C) Examination of Lmx1a-positive (red fluorescence, left panel) and Wls-positive cells (green fluorescence, middle panel) reveals Wls and Lmx1a are largely co-expressed in the cells of RL and choroid plexus at early cerebellar development. Abbreviations: CP, choroid plexus; RL, rhombic lip. Scale bar represents 50m.  34   Figure 2.5. The cerebellar rhombic lip progressively develops molecularly distinct populations during embryonic development identified by Wls and Atoh1 expression.  The expression of Wls and Atoh1 was studied in Atoh1LacZ/+ mice which express a -gal reporter protein under control of the Atoh1 locus. Immunolabeling for Wls (red fluorescence, left panel) and -gal (green fluorescence, middle panel) proteins is shown at E13.5 (A-C, top), E15.5 (D-F, middle) and E18.5 (G-I, bottom). At E13.5, Wls is expressed throughout the rhombic lip (A) and Atoh1 is strongly expressed in the emerging EGL and exhibits columns of expression in the rhombic lip (B). The overlap of Wls and Atoh1 expression domains in the cerebellar rhombic lip is shown in (C, bounded by dotted line) where a subset of Atoh1-positive cells is also Wls-positive at this early stage. Later at E15.5, Wls expression is localized predominately to the iRL (D), whereas Atoh1 expression is localized to the eRL and EGL (E). Expression at this time is largely non-overlapping with only a few cells (arrow in F) co-expressing Wls and Atoh1 at the rhombic lip. At E18.5, the Wls-positive population found in the rhombic lip (G) is completely segregated from the Atoh1-positive population in the EGL (H). Abbreviations: CP, choroid plexus; EGL, external germinal layer; eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip; VZ, ventricular zone. Scale bars represent 50m. 35   Figure 2.6. Wls expression is unchanged in the Atoh1-null rhombic lip.  The expression of Wls (red fluorescence, left panel) and the -gal reporter protein of Atoh1 (green fluorescence, middle panel) are examined in the Atoh1LacZ/LacZ null mutant cerebellum at E15.5. Atoh1-null mutant cerebella lack EGL and RL-derivatives. Nevertheless, Wls expression remains unaffected in the Atoh1-null cerebellum, and is detected in the remaining cells of RL that are arranged in columnar arrays which cytoarchitecturally resemble the cells of the iRL. The merging of images of Wls and Atoh1 expression demonstrates, in the right panel, the co-expression of Wls and Atoh1 in many cells of the iRL. This co-expression is only seen in a limited number of cells in the wildtype RL (see Figure 5F). Abbreviations: CP, choroid plexus; M, meninges; VZ, ventricular zone. Scale bar represents 50 m.   2.2.4. Expression of Wls is complementary to, and negatively regulated by, Pax6 in the RL   Pax6 expression is eliminated from the Atoh1-null cerebellum and therefore considered to be downstream of Atoh1 in the RL (Wang et al., 2005; Fink et al., 2006; Englund et al., 2006). On the other hand, Wls expression is independent of Atoh1, as shown above. Thus, we hypothesized that Pax6 and Wls are also independently expressed. However, we observed an upregulation of Wls transcript in the Pax6-null cerebellum in our previous Pax6 transcriptome analysis, which suggests the hypothesis that Wls expression is regulated by Pax6 (Ha et al., 2012). To examine these hypotheses, we first compared the anatomical expression of Wls with Pax6 in the wildtype RL. Immunohistochemical analysis revealed three configurations of Pax6-positive and Wls-positive cells in the E15.5 RL (Fig. 2.7). First, in the eRL, as with Atoh1, there are strongly positive Pax6 cells that do not express Wls. A second population is found of low-expressing Pax6 cells in the iRL which strongly express Wls. Finally, there is a set of cells in the 36  most distal part of the RL that does not express Pax6, but strongly expresses Wls (Fig. 2.7, arrow). At E18.5, the cells in the iRL now co-express Wls and Pax6, in contrast to the exclusionary relationship between Wls and Atoh1at the same time point (Fig. 2.5I; Supplementary Fig. 7).  Figure 2.7. The E15.5 rhombic lip is comprised of three domains as shown by Wls- and Pax6-expressing cells.  The E15.5 rhombic lip was immunostained for Pax6 (red fluorescence, middle panel) and Wls (green fluorescence, left panel) in E15.5 WlsLacZ/+ embryos. Staining reveals that the iRL contains cells that robustly express Wls but are also lightly positive for Pax6. The eRL contains cells that robustly express Pax6 but are also lightly positive for Wls. There is also a population of cells that exclusively express Wls at the RL (white arrow, right panel). At the boundary of eRL and iRL, a population of cells is found negative for Wls and Wls reporter expression (compare white arrowhead to black arrowhead). Abbreviations: eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip. Scale bar represents 50m.   A more direct test of the above hypotheses would be to examine the expression of Wls in the loss-of-Pax6 expression, as in the Sey cerebellum. We find that Wls transcript expression in the Sey cerebellum is upregulated as early as E15.5 by 1.35-fold (p = 0.002) and 2.15-fold (p = 3.21x10-5) at E18.5 (Ha et al., 2012). There are two possibilities that could explain these molecular findings: 1) There is an upregulation of Wls in Wls-positive cells in the mutant cerebellum which would imply that Pax6 normally exerts control (i.e. suppression) on the expression level of Wls in the iRL and, the absence of Pax6 releases the suppression and results 37  in a higher expression of Wls in the same number of cells. 2) A second possibility is that Wls expression expands into domains not normally occupied by Wls-expressing cells, suggesting that Pax6 suppresses Wls expression in the Pax6-expressing cells. To assess these non-exclusionary possibilities, we examined the expression of Wls in the Sey mutant cerebellum by in situ hybridization and immunohistochemistry. At E13.5 there are no apparent differences in the expression of Wls in wildtype and Sey mutant cerebella (Fig. 2.8). However, at E15.5 we observed a striking expansion of the Wls expression domain beyond the cerebellar RL into the nascent EGL in the Sey mutant cerebellum (Fig. 2.8, E15.5). This exuberant expression of Wls is maintained at E18.5 in the Sey mutant cerebellum, at a time when wildtype Wls is on the wane (Fig. 2.8). Furthermore, the expanded expression of Wls in the Sey mutant is specific to the EGL as the isthmus expression is unaltered. In wildtype and heterozygous Sey embryos, cerebellar morphology and Wls expression patterns are indistinguishable (Supplementary Fig. 8). The study of the Sey mutant cerebellum indicates that Wls expression is normally negatively regulated by the expression of Pax6 in the cells of the EGL.  38   Figure 2.8. Expansion of Wls expression domain in the Sey mutant cerebellum.  Expression of Wls was examined with in situ hybridization and immunohistochemistry in Sey mutant and wildtype cerebellar across embryonic development. At E13.5 (upper panel), Wls expression is restricted to the rhombic lip (black arrowheads) in wildtype and Sey cerebella. A striking expansion of the Wls expression domain in the Sey mutant cerebellar is found at E15.5 and E18.5. At E15.5 (middle panel), expression of Wls has expanded beyond the rhombic lip (black arrowheads) into the nascent EGL in the Sey mutant (red arrows). This up-regulation of Wls expression is maintained at E18.5 (lower panel) in the Sey cerebellum (red arrows), when Wls expression has markedly decreased in the wildtype rhombic lip (the rhombic lip is identified by black arrowheads in the wildtype and mutant cerebella). Scale bars represent 100 m. 39  2.2.5. Expression of Wls in relation to markers of the rhombic lip  In this study, we find evidence that the RL is actively patterned by gene expression. We show that Wls is expressed in the iRL and complementary to Atoh1 and Pax6 expression in the eRL. Furthermore, we demonstrate that the Wls-expression domain arises independent of Atoh1, but Wls is restricted to the iRL by the negative regulation of Pax6 in the eRL. To further characterize the different molecular domains in the RL, we examined the expression of Wls in relation to two additional markers of the cells in RL, Lmx1a and Tbr2.  Lmx1a is a roof plate marker that is expressed in the RL and choroid plexus in the developing hindbrain (Chizhikov et al., 2006). Expression of Lmx1a is observed in the fourth ventricle choroid plexus throughout embryonic development. During cerebellar development Lmx1a marks the CN neuron precursors at E13.5 that migrate to the nuclear transitory zone [NTZ; (Chizhikov et al., 2010)]. Lmx1a is also expressed in the UBCs that are found in the RL during E15.5 to E18.5 (Chizhikov et al., 2010). The relationship between the Lmx1a and Wls expression domains is dynamic during cerebellar development. Early at E11.5, expression of Wls and Lmx1a overlap in the roof plate (Fig. 2.4C). Lmx1a expression is largely complementary to that of Atoh1; with an intermixing of Lmx1a-positive and Atoh1-positive cells at the border of the expression domain of each molecule, the number of cells co-expressed Atoh1 and Lmx1a is minimal (Fig. 2.4B). At E15.5, Lmx1a is weakly expressed in the iRL that contains Wls+ cells. However, a stream of cells with strong Lmx1a expression is detected at the interface of iRL and eRL (Fig. 2.9A, bounded by the yellow dotted line), and these cells are Wls negative. It is worth noting that these cells are devoid of -gal expression (Figs. 2.7, 2.9, white arrowheads) in contrast to the Pax6-positive cells in the eRL which still maintain a weak expression of -gal (Figs. 2.7, 2.9, black arrowheads). At E18.5, expression of Lmx1a is excluded from the Wls-positive cells in the iRL (Supplementary Fig. 9).   Tbr2 has been demonstrated to be a marker of UBCs and NTZ cells in the developing cerebellum (Englund et al., 2006; Fink et al., 2006). Tbr2 is not expressed in cells of the RL until E15.5. At this time Tbr2 is strongly expressed in a subset of cells that are localized to the interface between the iRL and eRL (Fig. 2.9B, bounded by the yellow dotted line). At E15.5, these Tbr2+ cells are negative for Wls expression and also devoid of -gal expression (Fig. 2.9B, white arrowhead), similar to the observation of Lmx1a expression at the same age (compare to 40  Fig. 2.9A, white arrowhead). Expression of Tbr2 remained complementary to Wls+ iRL at E18.5 (Supplementary Fig. 10). With the identification of cell populations with different molecular identities in the RL, i.e. Wls+ cells in the iRL and Atoh1+ and Pax6+ in the eRL, we wondered if there were any cellular phenotypic differences that distinguished these cells. We examined cell death and cell proliferation in these two populations. Cell death is limited in the RL and displayed no obvious differences (Supplementary Fig. 11). To assess cell proliferation, we pulse labeled embryos with BrdU at E15.5. The proliferative population of cells, as demonstrated with BrdU immunohistochemistry, appeared to be fewer in the iRL compared with eRL (Fig. 2.10A). To quantify whether the proliferative activity of Wls-positive cells in the iRL was reduced when compared to eRL cells, a labeling index was calculated for the iRL and eRL cell populations. In the E15.5 cerebella, proliferative index is significantly higher in the eRL (39.9%) compared with that in the iRL (28.0%) (Fig. 2.10B, C). These results suggest that the molecularly distinct cell populations in the iRL and eRL are also phenotypically different. 41   Figure 2.9. The expression of Wls, Lmx1a and Tbr2 defines a distinct molecular domain within the E15.5 rhombic lip.  (A) The E15.5 rhombic lip was immunostained for Lmx1a (red fluorescence, middle panel) and Wls (green fluorescence, left panel) in E15.5 WlsLacZ/+ embryos. Staining reveals that there is a cohort of Lmx1a-positive cells that exist between the Wls and Pax6 populations of cells. These cells are not only immunonegative for Wls, but also very low in Wls reporter protein expression (bounded by yellow dotted line and white arrowhead in left panel) as compared to the Wls-negative cells in the adjacent eRL (black arrowhead in left panel). (B) The E15.5 rhombic lip was immunostained for Tbr2 (red fluorescence, middle panel) and Wls (green fluorescence, left panel) in E15.5 WlsLacZ/+ embryos. Cells positive for Tbr2 (bounded by yellow dotted line) are negative for Wls and Wls reporter expression (compare white arrowhead to black arrowhead). Abbreviations: eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip. Scale bar represents 50m.  42   Figure 2.10. The iRL and eRL have differential proliferative activity.  Cell proliferative activity in the iRL and eRL was studied with pulse-BrdU labeling and quantitative assessment at E15.5. (A) The E15.5 RL is double-labeled for Wls (red fluorescence) and BrdU (green fluorescence), and proliferative cells were observed in both the Wls+ iRL and Wls- eRL. (B) Proliferative indices are calculated for the iRL and eRL cell populations (n=4 embryos), and proliferation activity is significantly different between the two populations of cells. Error bars represent SE. *, P<0.0001, student’s t-test. (C) Cell counts of total DAPI-positive cells and BrdU-positive cells in iRL and eRL (n=4 embryos). Abbreviations: eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip. Scale bar represents 50 m.  2.3. Discussion  The rhombic lip refers to the proliferative neuroepithelium along the dorsal alar plate (His, 1891). The RL can be further separated into two domains: the cerebellar RL that arises from rhombomere 1 and gives rise to cells in the cerebellum, and the lower RL that arises from rhombomere 2-8 and generates the precerebellar nuclei of the hindbrain (Rodriguez and Dymecki, 2000; Ray and Dymecki, 2009). Studies have shown that precursor cells emerge from the cerebellar RL to form the adjacent EGL, and classically believed to be specified exclusively to a granule cell lineage (Hatten and Heintz, 1995; Alder et al., 1996). More recently, genetic lineage tracing of RL cells marked by Atoh1 and Wnt1 gene expression, identified that the CN neurons and UBCs also arise from the RL (Wang et al., 2005; Machold and Fishell, 2005; 43  Englund et al., 2006; Hagan and Zervas, 2012). Interestingly, Altman and Bayer (Altman and Bayer, 1997) made the observation that the RL is comprised of two cytologically distinct epithelial faces, providing the possible morphogenetic basis for multiple cell types arising from the RL.   2.3.1. Wls and other cell markers define four molecular distinct compartments In the present studies, we describe a novel rhombic lip marker, Wls, which marks a cell population in the iRL that is found to be molecularly and cellularly distinct to the complementary Atoh1-positive eRL cell populations. Our finding of the Wls+/Atoh1- population indicates molecular heterogeneity in the RL. Recent studies have also noted molecularly heterogeneous populations of cells in the RL, defined by Lmx1a+/Atoh1- and Wnt1+/Atoh1- expression (Chizhikov et al., 2010; Cheng et al., 2012; Hagan and Zervas, 2012). To further examine the ideas of RL compartmentation, we performed the expression of a panel of five RL markers (Wls, Atoh1, Pax6, Lmx1a and Tbr2) at early and later developmental time points. Our results reveal a more complex compartmentation in the RL compared to previous studies (Chizhikov et al., 2010; Cheng et al., 2012; Hagan and Zervas, 2012), and define four molecularly distinct compartments in the RL (see summary schematic; Fig. 2.11). These compartments are defined by: (1) Wls-positive cells in the roof plate and the distal tip of the RL from E11-18 (Fig. 2.11, pink region). These cells only express low levels of Atoh1 and Lmx1a, and are negative for Pax6 and Tbr2. (2) Strong expression of Wls in cells of the interior face of the RL, a cytoarchitecturally distinct region characterized by a columnar-arrangement of cells [(Altman and Bayer, 1997); Fig. 2.11, green region]. This compartment becomes apparent at around E13.5 with a strong Wls expression and an intermixing of Atoh1+ cells, and a low level of Pax6 and Lmx1a expression. At E15.5, these cells are found to be largely Atoh1 negative and are Atoh1-independent [(Jensen et al., 2004) and the current paper]. As development progresses (e.g., by E18.5), these Wls+ cells are completely segregated from the Atoh1 expressing cells. (3) Strong expression of Atoh1 and Pax6 is seen in cells at the exterior face of the RL (Fig. 2.11, yellow region) as early as E13.5. These molecules are also expressed in cells that continue into the EGL. Expression of Wls is down-regulated in this compartment at all developmental times, although the cells in this 44  compartment are likely of Wls-lineage as suggested by the presence of Wls-reporter protein noted in the Results section. (4) Cells with the molecular signature of Tbr2+/Lmx1a+/Pax6+/Wls- are found between the iRL and eRL regions at E15.5 and later (Fig. 2.11, blue region). It is noteworthy that cells in this compartment do not show any Wls-reporter expression (compared to the low level of reporter expression in cells of the adjacent eRL). Cells in this compartment may arise from a non-Wls-lineage or from Wls-expressing cells that have extinguished previous Wls expression.  In the RL, how do the compartments we define in this study relate to the generation of specific cell types from the rhombic lip? It has been demonstrated that CN neurons arise from the Atoh1+ RL at E10.5-12.5 (Machold and Fishell, 2005). At this time the RL is demarcated by Wls and Atoh1 into two compartments, Wls+/Atoh1- and Wls-/Atoh1+ (yellow and pink zones in Fig. 2.11). A third molecule, Lmx1a, is largely expressed in Wls+ cells, and a few Atoh1+ cells at the compartment boundary. It is found that Lmx1a-lineage does not contribute to CN neurons (Chizhikov et al., 2010). Therefore, the domain that gives rise to CN neurons maps to the compartment identified in this study by Atoh1+/Wls-/Lmx1a- at E11.5 (yellow compartment in Fig. 2.11). Granule cell progenitors arise later from the RL starting at E12.5 (Machold and Fishell, 2005) and have strong expression of Atoh1 (Machold and Fishell, 2005) and Pax6 (Engelkamp et al., 1999) but not Lmx1a (Chizhikov et al., 2010) in the EGL, which aligns with the eRL in Fig. 2.11 at E13.5-15.5. This is supported by the observation that in the Atoh1-null RL, the yellow compartment is absent and so is granule cell production [(Wang et al., 2005) and current findings]. The origins of UBCs co-incide with the blue region in Fig. 2.11 defined by Tbr2+/Lmx1a+/Pax6+/Wls- at E15.5-18.5 (Englund et al., 2006; Chizhikov et al., 2010). Thus, our gene mapping in combination with mutant analyses define four distinct, molecularly-defined compartments in the developing rhombic lip. 45   Figure 2.11. Summary schematic of molecularly distinct developmental compartments in the cerebellar rhombic lip.  Four compartments marked by differential molecular expression in the RL evolve over developmental time in the mouse cerebellum. The pink region represents the population of Wls-positive cells in the roof plate and the distal tip of the RL found in the E11-18 cerebellum. This region is devoid of Pax6 and Tbr2 expression. The yellow region is defined by strong expression of Atoh1. At E11, this region is largely Atoh1-positive with a few cells that co-express Lmx1a. By E13 and onward, this region is marked by strong Atoh1 and Pax6 expression. Wls is down-regulated in this region but Wls reporter expression is detected. The green region is characterized by strong Wls expression and weak expression of Atoh1 and Pax6. This region becomes apparent as early as E13, and clearly segregates from the yellow region by E15. The blue region defines a population of cells marked by the molecular signature of Tbr2+/Lmx1a+/Pax6+/Wls-, that is found in the RL from E15 and later. This region is devoid of Wls-reporter expression. Abbreviations: CP, choroid plexus; EGL, external germinal layer; eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip; RL, rhombic lip; RP, roof plate.  2.3.2. Wls is independent of Atoh1 in the rhombic lip In this work we examine the interaction between Atoh1 and Wls in the RL using the Atoh1-null mutant, and find the presence of Wls-expressing cells in the Atoh1-null RL which indicates that the Wls+ domain is independent of Atoh1 regulation. Given that Atoh1 is required and sufficient in generating cerebellar glutamatergic neurons from the neuroepithelium (Wang et al., 2005; Yamada et al., 2014) and that all glutamatergic RL-derivatives are lost in the absence of Atoh1: Does our finding imply that Wls+ domain is dispensable in the generation of cerebellar cell types? Interestingly, we observed a weak expression of the Wls-reporter protein in some cells in the adjacent Atoh1+ eRL, the subpial stream and the EGL, which may indicate that the Atoh1+ RL cells are of Wls-lineage. Genetic fate mapping study has shown that RL cells that express Atoh1 rapidly migrate out of the RL (Machold and Fishell, 2005), which opens the question of the source of progenitors that feed into the Atoh1+ population. Our observation could 46  suggest that Wls+ cells give rise to the Atoh1+ RL cells and replenish the cells that exit the RL once Atoh1 expression is switched on. Thus, the Wls+ domain in the iRL may serve as the reservoir of precursors for the Atoh1+ RL cells (see Fig. 2.12A). In line with this, a recent study has found that -catenin, the key mediator of Wnt signaling and downstream of Wls, activates in vitro expression of Atoh1 in neural progenitor cells (Shi et al., 2010). By a similar mechanism, Wls may induce Atoh1 expression in the cells of the RL through the activation of Wnt signaling. Thus, the in vitro observation and our present data raise the possibility that Wls is upstream of Atoh1 and that the Wls+ domain provides both the cells and the signal for the Atoh1-progenitor population. Further support for this idea comes from our observation that Atoh1-reporter expression is found in Wls-expressing cells in the iRL of the Atoh1-null cerebellum. A possible explanation for this observation is that Wls in the iRL induces Atoh1 reporter expression in the iRL cells, but without actual Atoh1expression, the cells are not instructed to migrate from the iRL.   2.3.3. Wls is negatively regulated by Pax6 in the cerebellum We also examined the interaction between Pax6 and Wls in the RL using the Sey mutant, and found evidence that Pax6 negatively regulates Wls. In the Sey mutant we observed an expansion of Wls expression into the eRL and the EGL, areas that normally express Pax6 and are devoid of Wls-positive cells, suggesting that Wls is normally restricted to the iRL by the suppressive action of Pax6. This idea is supported by our Pax6 transcriptome analysis (www.cbgrits.org) where we found a down-regulation of Wnt antagonists such as Dkk3 and Sfrp2 in the absence of Pax6, indicating that Pax6 exerts suppression on Wnt signaling through the action of Wnt inhibitors. One possible function for Pax6 suppression of Wls is to control the expression level of Wls downstream genes. As discussed above, Wls may activate Atoh1 expression in the RL. In the loss of Pax6 suppression ectopic Wls expression in the eRL and EGL is found, and we would expect an up-regulation of Atoh1 expression as a result. This is consistent with our Pax6 transcriptome analysis (www.cbgrits.org) that we observed a significant increase of Atoh1 expression at E18.5. Furthermore, it has been demonstrated that a balanced level of Atoh1 expression is required for proper granule cell differentiation (Helms et al., 2001), thus Pax6 can provide a negative feedback control on the Atoh1 expression through Wls, which is required for the proper development of granule cells (see Fig. 2.12B). 47   Figure 2.12. A cellular and molecular model of the role of the Wls-positive domain in the cerebellar rhombic lip development.  (A) Cellular. The Wls+ iRL serves as a reservoir for RL progenitors that will migrate out of the RL through the eRL when these cells turn on Atoh1 expression. (B) Molecular. The molecular interaction between Wls (green), Atoh1 (blue), and Pax6 (red) in the RL progenitors is proposed based upon experimental results in this paper and some informed conjecture. Cells in the iRL express Wls, which activates the expression of Atoh1 through the action of β-catenin. Expression of Atoh1 in these cells specifies a RL cell fate and instructs the cells to migrate to the adjacent eRL. In the eRL, these Atoh1-positive RL progenitors express Pax6. In turn, Pax6 represses the expression of Wls in these RL progenitor cells, providing a negative regulation on Wls and promotes Atoh1 expression, in order for the progenitor cells to differentiate appropriately. Abbreviations: CP, choroid plexus; eRL, exterior face of the rhombic lip; iRL, interior face of the rhombic lip; VZ, ventricular zone.   2.3.4. Conclusion  In conclusion, our current work identifies the existence of molecular heterogeneity in the RL, and uncovers dynamic interactions between the novel RL molecule, Wls, and Atoh1 and Pax6. These interactions may serve to establish a molecular cascade that controls the specification of RL-derivatives. We also describe four molecularly distinct compartments that evolve during embryonic development, and each may represent the developmental domain that gives rise to different RL-derivatives in the cerebellum. Interestingly, molecular heterogeneity has recently been observed in the granule neurons of the postnatal cerebellum, where a novel population of granule cell progenitors of Nestin+/Atoh1- is identified in the EGL, and has been demonstrated to have an increased tumorigenic potential (Li et al., 2013). Our current work provides insight into the origin of molecular heterogeneity in the cerebellum, lineage tracing of 48  these molecules will improve our understanding of cerebellar development and potential disorders which arise from molecular discrete progenitor cells.  2.4. Materials and methods 2.4.1. Mouse strains and husbandry ES cells heterozygous for a WlsLacZ reporter allele were obtained from BayGenomics gene trap mutation project (Cell line: RRJ545, RRID:IMSR_MMRRC:003140). This cell line is characterized by a -geo gene-trap vector integrated in the intron between exon 9th and 10th of the endogenous Wls sequence. The resulting knock-in allele encodes a fusion protein between a truncated Wls and a -gal reporter protein, and transcription is controlled under the native Wls 5’ region.  To generate the Wls-LacZ reporter animals (WlsGt(RRJ545)Byg, hereafter referred to as WlsLacZ) , ES cells were injected into C57BL/6J blastocysts to create chimeras for germline transmission, and chimeras were bred to C57BL/6J mice to obtain WlsLacZ heterozygotes. Ear notches were collected at weaning and ear DNA was prepared by digestion with Proteinase K in 1× PCR tissue homogenization buffer at 55°C incubation overnight, followed by a Proteinase K inactivation step at 95°C for 10 minutes. PCR genotyping was performed using forward primer specific to the wildtype Wls sequence (Wls-F1: atgcaccacatacacaactgg), reverse primers specific to the wildtype Wls sequence (Wls-R1: caggtcatgaggctgtcaat) and to the LacZ insertion sequence (LacZ: ggttgcggtggtgatataaa) that amplifies DNA fragments of 126bp and 80bp for the wildtype and WlsLacZ alleles, respectively. Primer concentrations for multiplex PCR genotyping were 575nM (Wls-F1), 288nM (Wls-R1) and 575nM (LacZ). PCR reactions contained a final concentration of 185M dNTPs, 1.8mM MgCl2 and 1 unit of Taq DNA polymerase. Cycling conditions were: first denaturation step at 94°C for 2 minutes, 35 cycles of denaturation at 94°C for 30 sec, hybridization at 60°C for 45 sec and elongation at 72°C for 1 minute, and end with a final elongation step at 72°C for 6 minutes. PCR product was applied to TBE agarose gel for analysis.  The Pax6-null mutant strain, Pax6Sey (obtained from Robert Grainger and Marilyn Fisher, University of Virginia), was used in the study of Wls expression. The strain was bred, phenotyped and genotyped as previously described (Swanson et al., 2005).  49  The Atoh1-lacZ reporter strain (Atoh1tm2Hzo and hereafter referred to as Atoh1LacZ; obtained from Huda Zoghbi, Baylor College of Medicine) was used in the study of rhombic lip marker expression and Atoh1-KO experiments. The Atoh1 genotype was determined by PCR according to protocol previously described (Jensen et al., 2002). Experimental wildtype Wls+/+ and WlsLacZ/+ heterozygous mice were generated by intercrossing WlsLacZ/+ mice or outcrossing carriers to ICR mice. No phenotypic differences were noted between embryos generated by either approach. Mice of wildtype Pax6, Pax6 mutants, wildtype Atoh1 and Atoh1LacZ/LacZ mutants were generated by heterozygote matings. The morning of the day that a vaginal plug was detected was designated as embryonic day 0.5 (E0.5). All studies were conducted according to the protocols approved by IACUC and CCAC at the University of Tennessee HSC and the University of British Columbia. 2.4.2. BrdU labeling  To examine cell proliferation in the cerebellar rhombic lip, timed pregnant females were injected intraperitoneally with 5-bromo-deoxyuridine (BrdU, Sigma, B5002; 50µg/g body weight) 1 hour before the collection of embryos. Tissue was processed and sectioned as described below. To quantify the number of BrdU+ cells in the cerebellar rhombic lip, approximately 50 sections that were equally distributed across the full cerebellum, right and left sides inclusive, were analyzed. Proliferative index was determined based on the proportion of BrdU-positive cells relative to the total number of cells, which is determined by DAPI-positive staining, in each region (iRL or eRL). 2.4.3. Tissue preparation and histology  Embryos of either sex harvested between E10.5 to E16.5 were fixed by immersion in 4% paraformaldehyde in 0.1M phosphate buffer (PB, pH 7.4) for 1 hour at 4°C. Embryos harvested at E18.5 were perfused with 4% paraformaldehyde in 0.1M PB, brain tissues were isolated and further fixed in 4% paraformaldehyde in 0.1M PB for 1 hour at room temperature. For tissues to be sectioned, fixed tissues were rinsed with PBS, followed by cryoprotection with 30% sucrose/PBS overnight at 4°C before embedding in OCT compound. Tissues were sagittally sectioned at 12m for immunohistochemistry or 16m for in situ hybridization, cryosections were mounted on SuperfrostTM slides (Fisher), air dried at room temperature and stored at -80C 50  until used. For whole-mount -galactosidase staining, fixed tissues were rinsed twice with PBS and finished with one PBS-T wash (0.1M PBS with 0.1% Triton X-100) prior to staining. In all cases, observations were based on a minimum of 3 embryos to a maximum of 8 embryos per experiment.  2.4.4. In situ hybridization  Sense and antisense riboprobes corresponding to the cDNA fragment of Wls (position 371 to 1487 in NM026582.3) were generated and labeled with digoxygenin (DIG)-UTP. Wls cDNA was generated from a cDNA library obtained from E15.5 and P0 mouse brain generated with a cDNA synthesis kit (Invitrogen) with the use of the forward (GCAGTACCCTACACGGCAAT) and reverse (GGCTAGACTGCTTCCCACTG) primers. The resultant Wls cDNA was cloned into the pGEM-T vector, and was used to generate cDNA templates for the sense and antisense riboprobes, with the primers M13F or M13R and the aforementioned forward or reverse primers. Prior to hybridization, sections were acetylated with acetic anhydride in 0.1M triethanolamine at pH 8.0 and dehydrated with graded concentrations of ethanol. Sections were incubated with cDNA probe in Ultra-hybridization buffer (Ambion) at 55C overnight in a humid chamber. After hybridization, the slides were washed and rinsed descending concentrations of salt: 4× SSC, 2× SSC, 1× SSC and 0.5× SSC at 55°C, and then incubated with an anti-Dig antibody (Roche) for 2 hours at room temperature at a concentration of 1:300. After washing, slides were colorized with NTP/BICP (Roche) and mounted with 1.5% gelatin containing 15% glycerol. 2.4.5. Immunohistochemistry  Tissue sections were rehydrated to PBS. For brightfield immunohistochemistry, endogenous peroxidase activity was inhibited by treating the sections with 1% H2O2 in PBS followed by a PBS-T rinse. Sections were incubated at room temperature for 20 minutes with blocking solution (1% BSA and 5% normal serum in PBS-T), and subsequently incubated at room temperature overnight with primary antibodies in a humid chamber. Following PBS-T washes, the sections were incubated with biotinylated secondary antibodies (at 1:200, Vector Laboratories, Burlingame, CA) and processed for PAP immunohistochemistry using the ABC Kit (Vector Laboratories) according to the manufacturer’s protocol. Slides were dehydrated and 51  coverslips were applied. For immunofluorescence, secondary antibodies labeled with fluorochrome were used to recognize the primary antibodies. The slides were counterstained and mounted with Vectashield mounting media with DAPI (Vector Laboratories). Primary antibodies used were as follows: rabbit anti-WlsN (1:500, YenZym antibodies), rabbit anti-WlsC (1:1000, initially a gift from Richard Lang, University of Cincinnati; then purchased from Seven Hills Bioreagents, WLAB-177), rabbit anti-Pax6 (1:200, Covance Research Products Inc, PRB-278P-100, RRID:AB_10092959), rabbit anti-LMX-1 (1:2000, EMD Millipore, AB10533, RRID:AB_10805970), rabbit anti-Tbr2 (1:600, Millipore, Ab2283, RRID:AB_10806889), mouse anti-BrdU (1:200, Becton Dickinson, 347580, RRID:AB_400326) and chicken anti--gal (1:10000, Abcam, Ab9361, RRID:AB_307210).  2.4.6. Detection of -gal activity  To detect -gal activity in the WlsLacZ/+ reporter mice, 4% paraformaldehyde-fixed embryos or cryosections were incubated in an X-gal reaction buffer (containing 5mM potassium ferricyonide, 5mM potassium ferrocyonide, 2mM MgCl2, 0.02% Nonidet P-40, 0.01% sodium deoxycholate in 0.1M PBS-T, and 1mg/ml 5’-Bromo-4-chloro-3-indolyl--D-galactoside (X-gal, Invitrogen, 15520-018) dissolved in DMSO) at 37C overnight in a humid chamber. After incubation, tissues were rinsed with PBS. Cryosections processed for X-gal activity were counterstained with neutral red.  2.4.7. Microscopy  Analysis and photomicroscopy was performed with a Zeiss Axiovert 200M microscope with the Axiocam/Axiovision hardware-software components (Carl Zeiss). Confocal microscopy was performed using an Olympus FV500 confocal laser scanning microscope and the Fluoview image capture and analysis software.     52  Chapter 3 : A novel and multivalent role of Pax6 in cerebellar development  3.1. Introduction The paired box transcription factor Pax6 has been shown to have a fundamental role in the development of several CNS structures in which it is expressed during development. The absence of Pax6 results in the loss of progenitor and cell type mis-specifications (Quinn et al., 2007; Ericson et al., 1997; Toresson et al., 2000). One brain region that has early and compartmental expression of Pax6, but has escaped the detection of a seminal role in development is the cerebellum. However, in our recent work with Pax6 we have identified a transition of molecular identity in the Pax6-null cerebellum (Yeung et al., 2014), which prompted a re-examination of Pax6 and early development of the cerebellum. In the cerebellum, Pax6 is expressed early-on in the cells of the RL that give rise to neurons of the glutamatergic lineages including the CN neurons, granule cells (GCs) and UBCs. Compared to the crucial control exerted by Pax6 in other CNS regions, Pax6 only seems to play a modulatory, later developmental role in cerebellar development. For example, the loss of Pax6 has been reported to result in the aberrant organization of the external granular cell layer and foliation in the cerebellum (Engelkamp et al., 1999; Swanson et al., 2005; Swanson and Goldowitz, 2011). The influence of Pax6 on the CN neurons and UBCs, however, has not been reported. We previously assessed the whole genome transcriptomic profile of the cerebellum in the absence of Pax6 during embryonic development (Ha et al., 2012). Comparison of the transcriptome profiles from Pax6-null (Sey) mutant and wildtype cerebella revealed a significant decrease in the expression of Tbr1 and Tbr2 (Eomes) in the Sey cerebellum (Ha et al., 2012; Ha et al., 2015), transcription factors important for the development of CN neurons and UBCs, respectively (Fink et al., 2006; Englund et al., 2006). These data also suggested that a closer examination of cells in the glutamatergic lineage should be explored in the Pax6-null mutant cerebellum.  Here we report two dramatic phenotypes in the Pax6 knockout mouse cerebellum: loss of glutamatergic CN neurons and UBCs. The loss of these cells seems largely attributable to 53  enhanced cell death in RL-derived CN progenitors, enhanced cell death and decreased neurogenesis in the UBCs. Our data reveal a previously unreported requirement for Pax6 in the survival and generation of glutamatergic CN neurons and UBCs in the developing cerebellum. These findings support a revised view of the molecular program that underpins cerebellar development.  3.2. Results 3.2.1. Characterization of the absence of Tbr1+ CN neurons in the Sey cerebellum Glutamatergic CN neurons are generated from the RL between E10.5 to 12.5 (Machold and Fishell, 2005; Fink et al., 2006). Pax6, Tbr1 and Lmx1a are expressed in glutamatergic CN neuron progenitors during development. Our time series cerebellar gene expression microarray dataset (available at cbgrits.org) reveals that during cerebellar development, transcription of Pax6 is expressed throughout the course of embryonic and neonatal stages (Fig. 3.1A), while the expression of Tbr1 peaks at E14 (Fig. 3.1A). Transcription levels of Lmx1a also peak at E13 and 14 (Fig. 3.1B) [RIKEN, (Arner et al., 2015)]. Our immunohistochemical analysis shows that Pax6 is expressed in the newly generated CN neuron progenitors in the RL and expression persists as these cells migrate tangentially along the subpial stream (Fig. 3.1C). Between E13 and E15, CN neuron progenitors that entered the nuclear transitory zone (NTZ) express Tbr1 and Lmx1a, but not Pax6 (Fig. 3.1D, E).  54   Figure 3.1. Transcription factors Pax6, Tbr1 and Lmx1a are expressed in the progenitors of CN neurons during cerebellar development.  (A) The whole cerebellum transcription profile of Pax6 and Tbr1 during cerebellar development based upon CbGRiTS data. Y-axis log2 transformed and followed by a 2Z+8 Z-score stabilized intensity value for microarray dataset. (B) The cerebellum transcription profile of Lmx1a during cerebellar development based upon RIKEN FANTOM5 data. The Y-axis shows expression level in tags per million (TPM). (C-E) In the E13.5 cerebellum, immunohistochemistry reveals that Pax6 (C) is expressed in the cells of the subpial stream which houses newly generated CN neuron progenitors. Once the progenitors enter the NTZ, Pax6 is downregulated and now these CN neuron progenitors express Tbr1 (D) and Lmx1a (E). NTZ, nuclear transitory zone; RL, rhombic lip; SS, subpial stream; VZ, ventricular zone. Error bars represent SE. Scale bars: 100µm.  Our Pax6 transcriptome analysis reveals a significant reduction in Tbr1 transcript in the Sey cerebellum during development (Ha et al., 2012; Ha et al., 2015). At E13.5, there is a 7.89-fold reduction in Tbr1 transcript in the Sey cerebellum (Fig. 3.2A). Tbr1-immunolabeling in the E13.5 wildtype cerebellum detected expression in the CN neurons that entered the NTZ (Fig. 3.2B, left). By contrast, this Tbr1+ population is absent from the NTZ of the Sey cerebellum (Fig. 3.2B, right). Quantitative analysis of Tbr1+ cells in the NTZ indicated an elimination of Tbr1+ cells from the E13.5 mutant cerebellum. At E15.5 when Tbr1+ cells are localized to the NTZ in wildtype cerebellum, 97.4% Tbr1+ cells are missing in the Sey cerebellum (Fig. 3.2C, red arrows; 55  P = 3.7×10-05). By E18.5 in the wildtype cerebellum, the CN neurons have descended into the cerebellar core and Tbr1 expression is localized to the CN neurons at the medial level (i.e., fastigial nucleus; Fig. 3.2D). In contrast, Tbr1+ cells are not detected in the E18.5 Sey cerebellum (Fig. 3.2D). At all ages examined, there is no significant difference in the number and location of Tbr1+ cells in the cerebellum with one copy of Pax6 (i.e., Pax6+/Sey) compared to the wildtype cerebellum (Fig. 3.2E). GABA-ergic CN neurons that arise from ventricular zone (VZ) around the same time migrate radially to enter the NTZ and express Irx3 (Morales and Hatten, 2006). To determine whether GABA-ergic CN neurons are also affected by the absence of Pax6, we examined Irx3+ cells in the wildtype and Sey mutant cerebellum. In the E11.5 wildtype cerebellum, Irx3+ cells are seen at their origins in the VZ and migrating through the cerebellar core. By E13.5, the Irx3+ CN neurons reach the NTZ. By E15.5 the Irx3+ cells descend into the cerebellar core and are located more laterally than the glutamatergic Tbr1+ CN neurons. At these timepoints, the expression of Irx3 is indistinguishable between the wildtype and Sey mutant cerebellum (Fig. 3.2F). This finding indicates that the production and development of GABA-ergic CN neurons is not affected by the absence of Pax6.  56   57  Figure 3.2. The lack of Pax6 in the Sey mutant cerebellum results in the absence of RL-derived Tbr1+ CN neurons but no apparent loss of VZ-derived Irx3+ CN neurons.  (A) The transcription profile from CbGRiTS of Tbr1 in the wildtype and Sey cerebellum at E13, 15 and 18. The Sey cerebellum has a significant reduction in Tbr1 transcript at E13 and 15. Y-axis log2 transformed and followed by a 2Z+8 Z-score stabilized intensity value for microarray dataset. (B-D) Immunohistochemistry reveals that Tbr1+ cells are absent in the Sey cerebellum. Cells immunopositive for Tbr1+ are observed in the NTZ of the wildtype cerebellum (white arrows) at E13.5 (B), E15.5 (C) and E18.5 (D), but this Tbr1+ cell population is absent in the Sey cerebellum (red arrows). A few Tbr1+ cells are observed in the lateral cerebellum of the E15.5 Sey mutant (C, blue arrowhead). These cells comprise only 2.7% (± 0.4%) of the total number of Tbr1+ cells in the wildtype cerebellum. (E) Immunohistochemistry of Tbr1 illustrates that the cerebellar expression of Tbr1 in heterozygous (Pax6Sey/+) at E13.5, 15.5 and 18.5 are not different from that of the wildtype littermates (compare white arrows in E with B-D). (F) Immunohistochemistry of Irx3 over developmental time reveals that these CN neuron populations are similar in the cerebellum of the wildtype (top) and Sey (bottom) mouse at E11.5, E13.5 and E15.5. At E11.5, the Irx3+ CN neurons are largely seen outside of the VZ. By E13.5, Irx3+ CN neurons have entered the NTZ. By E15.5, the Irx3+ CN neurons have started to colonize the cerebellar core. EGL, external germinal layer; NTZ, nuclear transitory zone; RL, rhombic lip; VZ, ventricular zone. Error bars represent SE. Scale bars: 100µm. 3.2.2. Reduction of Lmx1a+ cells in the NTZ of the Sey cerebellum  We examined Lmx1a expression in Sey cerebellum to test if the effect of the loss-of-Pax6 is a general elimination of glutamatergic CN neuron marker expression or is specific to elimination of Tbr1 expression in the CN neurons. Lmx1a+ cells in the Sey mutant are completely eliminated from the NTZ region at E13.5 (Fig. 3.3A) and reduced significantly at E15.5 (P = 4.68×10-4; Fig. 3.3B); similar to the aforementioned loss of Tbr1 expression in the absence of Pax6. In the E15.5 wildtype cerebellum, Lmx1a is also expressed in a set of cells dorsal to the NTZ, termed the c3 cells (Chizhikov et al., 2006). These c3 cells give rise to extracerebellar neurons and do not originate from the cerebellar RL (Millen et al., 2014). Expression of Lmx1a is unaffected in these cells in the Sey mutant (Fig. 3.3B, arrowheads), suggesting that Lmx1a expression is independent of Pax6. Thus, the effect of the Pax6-null on Lmx1a expression aligns with a specific loss of CN neurons. 58   Figure 3.3. The lack of Pax6 in the Sey cerebellum results in the reduction of Lmx1a+ cells in the cerebellar nuclei.  Lmx1a expression is observed in CN neuron progenitors that enter the NTZ of (A) E13.5 and (B) E15.5 wildtype cerebellum (white arrows). In the E13.5 and 15.5 Sey cerebellum, Lmx1a+ cells are largely absent (red arrows). The lateral aspects of the cerebellum highlight the C3 cells (B, white arrowheads in bottom panels) which are generated from the VZ and give rise to extracerebellar neurons. These cells also express Lmx1a and are not altered in the Sey mutant. VZ, ventricular zone. Scale bars: 100µm.  59  3.2.3. Cytoarchitecture of the Sey cerebellum indicates the loss of CN neurons  The altered expression of Tbr1 and Lmx1a in the Sey cerebellum could suggest that either the glutamatergic CN neurons are present but fail to express the proper markers in the absence of Pax6 expression, or that CN neurons are absence in the lack of Pax6 expression. To address this issue, we analyzed the cytoarchitecture of the wildtype and Sey cerebellum. In the wildtype cerebellum, nuclear neurons aggregate at the NTZ by E15.5 and can be readily visualized with cresyl violet staining (Fig. 3.4A, black arrow). In the Sey cerebellum, however, this nuclear mass is replaced by a fibrous and acellular matrix (Fig. 3.4B, red arrow). At E18.5, in the wildtype cerebellum, the CN cells from the NTZ occupy the deep portion of the cerebellum (Fig. 3.4C, black arrow). In the Sey cerebellum, however, there is no recognizable cellular aggregate in this region, suggesting the absence of CN neurons (Fig. 3.4D, red arrow). 60   Figure 3.4. Cytoarchitecture of the Sey cerebellum indicates the loss of CN neurons and UBCs.  (A) Cresyl violet staining reveals the aggregation of CN neurons at the NTZ in the E15.5 wildtype cerebellum (black arrow). (B) In contrast, this nuclear mass is replaced by a fibrous and acellular matrix in the Sey cerebellum (red arrow). (C) In the E18.5 cerebellum, the CN neurons have descended from the NTZ in the wildtype cerebellum (black arrow), while this nuclear mass is absent in the Sey cerebellum (red arrow in D). At the medial level, UBCs are found in the RL region of wildtype cerebellum (C, bounded by red dotted line), the same region is devoid of cells in the Sey cerebellum (D, bounded by red dotted line). UBC progenitors (bounded by red dotted lines) are found in wildtype (E) and Sey (F) lateral cerebella. Scale bars: 100µm.  61  3.2.4. Increased cell death in the CN neuron progenitors of Sey cerebellum  The absence of CN neurons in the Sey cerebellum could due to the lack of generation of CN neuron progenitors from the RL. To assess this possibility, we examined the earliest marker of CN neuron progenitors (ie, Atoh1) in the Sey cerebellum to determine if the CN neurons are initially generated in the mutant cerebellum. To do this, we crossed the Atoh1-reporter allele (Atoh1LacZ) into the Sey mutant. In the E11.5 wildtype cerebellum, CN neuron progenitors that arise from the RL and migrate along the subpial stream express Atoh1 as indicated by βgal-immunopositivity (Fig. 3.5A, arrows). Surprisingly, Atoh1+ cells are observed at the RL and subpial stream of the E11.5 Sey cerebellum (Fig. 3.5B, arrows). Quantitatively, the number of Atoh1+ cells in the Sey cerebellum is not significantly different from the wildtype (P = 0.31). This finding indicates that CN neuron progenitors are produced from the RL even in the absence of Pax6.  As the production of CN neuron progenitors is unaffected in the Sey cerebellum, the loss of CN neurons found later in the development could be a result of a change in cell fate, or enhanced cell death in the CN neuron progenitors. To determine if CN neuron progenitors have changed cell fate, we performed BrdU incorporation to mark the cells that are generated between E10.5 and E11.5, and analyze the fate of these cells at E15.5. In the E15.5 wildtype cerebellum, the majority of the BrdU+ cells are found in the NTZ, with a few BrdU+ cells scattered above the VZ, and the EGL is devoid of BrdU+ cells. In contrast, the Sey cerebellum lacks BrdU+ cells in the NTZ and no ectopic BrdU+ cells are detected. BrdU-labeled cells are observed in the rest of the mutant cerebellum as in the wildtype cerebellum. These findings suggest that CN neuron progenitors have not undergone cell fate change, but have disappeared from the Sey cerebellum. The alternative explanation of cell death in the CN neuron progenitors can be explored using activated caspase-3 immunopositivity as a marker for apoptosis in the developing cerebellum. In the E12.5 cerebellum of normal and mutant embryos, the numbers of cells that are caspase-3+ are not significantly different. However, starting from E13.5, and more obvious by E15.5, the Sey cerebellum exhibits significantly increased numbers of caspase-3+ cells. The majority of caspase-3+ cells in the E13.5 Sey cerebellum is localized to the anterior EGL, and few cells are found near the presumptive NTZ. At E15.5, the caspase-3+ cells are restricted to the 62  anterior EGL (Fig. 3.5D, arrowheads). Caspase-3+ cells are rarely observed in the wildtype cerebellum at any of the examined ages (Fig. 3.5C). Quantitatively, the number of caspase-3+ cells in the E13.5-18.5 Sey cerebellum is 4- to 28-fold higher than in the wildtype cerebellum, and the differences between Sey mutant and wildtype are significant (Fig. 3.5E). As caspase-3+ cells are found in the EGL, we sought to determine if these dying cells are granule cell or non-granule cells (i.e., likely CN neuron progenitors) using a granule cell marker, Insm1 (Duggan et al., 2008). At E13.5 and E15.5 in both wildtype and Sey cerebella, Insm1 is robustly expressed in the cells of the EGL, while CN neurons in the NTZ are immunonegative for Insm1 (Fig. 3.5F, G and Supplementary Fig. 12). Double-labeling of Insm1 and caspase-3 reveals that caspase-3 immunopositivity is present in both Insm1+ and Insm1- cells (Fig. 3.5H). However, in the E13.5 and E15.5 Sey cerebellum, 75.9% and 76.3%, respectively, of all caspase-3+ cells are negative for Insm1 expression, indicating that the majority of the dying cells are likely not granule cells (Fig. 3.5I).  63   Figure 3.5. CN neuron progenitors are generated in the Sey mutant cerebellum but exhibit enhanced cell death.  (A) In the E11.5 wildtype (Pax6+/+; Atoh1+/LacZ) cerebellum, CN neuron progenitors express Atoh1 when the cells emerge from the RL and during migration along the subpial stream (arrows). (B) A similar pattern of Atoh1-expressing cells is observed in the Sey mutant (Pax6sey/sey; Atoh1+/LacZ) cerebellum (arrows). (C-E) Cell death is assessed by immunolabeling for activated caspase-3 and quantified at E12.5 to 18.5 in wildtype and Sey cerebella. (C, D) The majority of cells undergoing cell death in the wildtype and Sey cerebellum are observed at the anterior of the EGL (arrowheads). There is a dramatic increase in caspase 3+ cells in the mutant EGL (D).  (E) The Sey cerebellum shows significantly higher numbers of anti-caspase-3+ cells than that in the wildtype at E13.5 and later (* P < 0.005). (F-H) Double-labeling with Insm1, a granule cell specific marker, and caspase-3 reveals that majority of the dying cells in the Sey cerebellum is non-granule cells. Granule cells robustly expressed Insm1 in the wildtype (F) and Sey (G) EGL. Highlighted area in (G) is show in (H) at higher magnification. (H) In the Sey EGL, majority of the caspase-3+ cells are Insm1-negative (blue arrows), few cells co-expressing Insm1 and caspase-3 (yellow arrows). (I) Proportion of caspase-3+ cells that are Insm1-positive (pink) or Insm1-negative (blue) in the E13.5 and E15.5 wildtype and Sey EGL. The Sey cerebellum exhibits a significantly increased number of total anti-caspase-3+ cells than the wildtype at both E13.5 and 15.5 (* P < 0.005). EGL, external germinal layer; RL, rhombic lip; SS, subpial stream; VZ, ventricular zone. Error bars represent SE. Scale bars: 100µm. 64  3.2.5. Chimera analysis revealed that Pax6 is an extrinsic factor that controls the survival of CN neurons   Our data indicates a requirement of Pax6 in the survival of CN neuron progenitors. Pax6 may act as a cell-intrinsic or a cell-extrinsic factor for the survival of CN neurons. To address this issue, we examined experimental chimeras from wildtype and Pax6-null embryos (i.e. Sey/Sey <-> +/+). The chimeric experiment affords the opportunity to determine how a wildtype environment impacts the survival of mutant cells and vice versa. If Pax6 acts as a cell-intrinsic factor for cell survival, we hypothesize that Pax6-null mutant cells do not give rise to CN neuron, and all CN neurons are wildtype in the chimeric cerebellum. On the other hand, if Pax6 is an extrinsic factor for cell survival, Pax6-null cells can give rise to CN neurons.   The 25 experimental chimeras used in this analysis were generated from one embryo that came from a mating of heterozygous Pax6-null (Sey/+) mice and another embryo from a mating of wildtype mice (+GFP/+GFP). This combination should lead to about ¼ of the chimeras being of Sey/Sey genotype. We examined the chimeric embryos at E18.5, and three embryos had a cellular contribution from Pax6-null mutant embryos, and each of these embryos exhibited craniofacial defects characteristic of the Sey mutant. The quantitative analysis of percentage chimerism (see Materials and Methods) estimated that these embryos were comprised of 0.6%±0.1%, 9.9%±1.3% and 23%±1.7% wildtype cells. To determine the phenotype of CN/Tbr1+ cell loss in these chimeras, we examined the wildtype, Sey and chimeric cerebellum. In the wildtype cerebellum counts of Tbr1+ cells in the CN region averaged 817 per whole cerebellum, this was in comparison to only 43 Tbr1+ cells in the CN region of the Pax6-null cerebellum. However, in the 3 chimeras we counted 89, 167, and 178 Tbr1+ cells in the CN (Fig. 3.6A). Of interest, these numbers of Tbr1+ cells in the CN trended with the percentage of chimerism. In the cerebellar nuclear region of all three mutant chimeras, we found that Tbr1+ cells were both GFP-positive and GFP-negative (Fig. 3.6B-D). These data indicate that the Tbr1+ cells of the CN are of both wildtype and Pax6-null lineage. The cell-intrinsic hypothesis predicts that cell genotype linearly correlates with cell phenotype. This is testable by calculating the expected number of Tbr1+ cells based on the percentage chimerism, and comparing this to the observed number of Tbr1+ CN cells (e.g., in a 50/50 chimera we would expect 0.5×817 + 0.5×43 = 430 65  Tbr1+ cells). A chi-square test reveals that the actual numbers of Tbr1+ cell observed in these chimeric cerebella are significantly different from the expected numbers of Tbr1+ cell estimated (P-value = 1.18x10-14; Fig. 3.6A). Thus, we rejected the null hypothesis and accept the alternative hypothesis that Pax6 acts as an extrinsic factor on the survival of CN neurons. It is important to note that the 3 chimeras examined in this experiment were comprised of more than 75% mutant cells. Caution has to be taken when interpretations are solely drawn from high percentage mutant chimeras. For example, when the mutant phenotype in a high percentage chimera resembles the null mutant phenotype, it could be interpreted as an intrinsic requirement of the gene of interest. However, the gene of interest may actually act cell-extrinsically. In a high percentage mutant chimera, the small portion of wildtype cells do not provide a sufficient amount of extrinsic factor to rescue the mutant phenotype. In this case, low percentage chimeras would be useful in distinguishing the two possibilities. If the gene acts in a cell-intrinsic manner, the phenotype will only be seen exclusively in the mutant cells, while the wildtype cells behave normally in the low percentage mutant chimera. On the other hand, if the gene acts cell-extrinsically, wildtype cells could rescue the mutant phenotype in the mutant cells in the low percentage mutant chimeras. 66   Figure 3.6. Experimental chimera analysis demonstrates that Pax6 can be cell-extrinsic for CN neuron survival.  Experimental chimeras were examined at E18.5. Three embryos (H, I, and O) with cellular contributions from the Sey/Sey genotype are examined for the phenotype of CN neuron survival. (A) Quantitative analysis of the number of Tbr1+ cells in wildtype, Sey mutant and Sey chimeric cerebella. Expected numbers of Tbr1+ cells for each chimera is calculated from the percent chimerism and the Tbr1+ cell counts from wildtype and Sey cerebella. A chi-square test reveals that the observed numbers of Tbr1+ cell in the chimeric cerebella are significantly different from the expected numbers. (B) Cells positive for Tbr1 expression are localized to the medial part of the nuclear region (shown in box). Higher magnification of the area in the box is shown in (C, D). Co-staining with phenotype marker (Tbr1) and genotype marker (GFP) reveals that Tbr1+ cells in the chimeric cerebellum arise from both wildtype (C) (GFP+ and Tbr1+; arrows) and Sey/Sey mutant (GFP- and Tbr1+; arrowheads) genotypes. (D) This image more clearly shows the mutant Tbr1+ cells (arrowsheads) and wildtype Tbr1+ cells (arrows). CP, choroid plexus; EGL, external germinal layer. Error bars represent SE. Scale bars: 100µm. 67  3.2.6. Characterization of the reduction of Tbr2+ UBCs in the Pax6-null cerebellum The UBCs are RL derivatives generated at late embryonic times starting from E15, and the progenitors can be identified by Tbr2 expression (Fink et al., 2006). In the E15.5 wildtype cerebellum, the newly generated UBC precursors appear as a stream of Pax6+/Lmx1a+/Tbr2+ cells in the RL (Fig. 3.7A-C), and continue to express these molecules as the UBCs migrate into the cerebellar core at E18.5 (Figs. 3.7E, F and 3.8B, white arrows).   Our Pax6 transcriptome data reveals a down-regulation of Tbr2 expression in the Sey cerebellum throughout embryonic development, with a 3-fold reduction at E18.5 (Fig. 3.7D) (Ha et al., 2012). Immunolabeling for Tbr2 in the E18.5 Sey cerebellum reveals that Tbr2+ cells are completely absent from the medial cerebellar core (Fig. 3.7G), but some weak Tbr2-immunopositive cells are observed in the region of the RL at more lateral levels (Fig. 3.7H, white arrows). Quantitative analysis indicated an 86.9% loss of Tbr2+ cells from the E18.5 Sey cerebellum compared to the wildtype cerebellum (P = 7.71 × 10-5). 68   Figure 3.7. The loss of Pax6 results in the absence of Tbr2+ cells from the medial Sey cerebellum.  (A-C) In the normal E15.5 cerebellum, immunohistochemistry reveals that (A) Pax6, (B) Lmx1a and (C) Tbr2 label a stream of cells (within the dashed lines) that is found between the EGL and the interior face of the RL. (D) The transcription level of Tbr2 in the Sey cerebellum is significantly reduced at E15.5 and 18.5 as revealed by Pax6 transcriptome analysis from CbGRiTS. Y-axis log2 transformed and followed by a 2Z+8 Z-score stabilized intensity value for microarray dataset. (E, F) In the E18.5 wildtype cerebellum, expression of Tbr2 is observed in the UBCs moving out of the RL into the developing cerebellar core (arrows). (G) In contrast, Tbr2+ cells are absent from the RL and cerebellar core of the Sey cerebellum at medial levels. (H) Of note, some Tbr2-positive cells are observed more laterally in the Sey cerebellum (arrows). CP, choroid plexus; EGL, external germinal layer; RL, rhombic lip. Error bars represent SE. Scale bars: 100µm. 69  3.2.7. Reduction of Lmx1a+ cells in the Sey cerebellum  We determined the expression of Lmx1a in the wildtype and Pax6-null cerebellum at E15.5-18.5. In the E15.5 wildtype cerebellum, there are cells with strong Lmx1a staining in the area between the EGL and the cerebellar core (Fig. 3.8A, left panel, arrowheads). Such staining is absent in the Sey cerebellum (Fig. 3.8A, right panel). However, there are Lmx1a-positive cells, such as the late-born granule cell progenitors, that have similar staining profiles in the wildtype and Sey RL. Likewise, the denser Lmx1a staining of cells in the choroid plexus is similar between the wildtype and Sey brain (Fig. 3.8A). The Lmx1a positivity in the Sey mutant cerebellum supports the notion that Lmx1a expression is independent of Pax6.  At E18.5, Lmx1a in the wildtype cerebellum is expressed by the UBCs in the RL and those migrating into the cerebellar core (Fig. 3.8B, arrowheads).  In the Sey cerebellum, similar to the effect on the aforementioned Tbr2+ expression, Lmx1a+ cells are absent at the medial level, but can be observed at more lateral levels (Fig. 3.8B, bottom right panel, arrowheads). For the whole cerebellum at E18.5, there is a 63.7% diminution of Lmx1a+ cells in the Sey cerebellum compared with the wildtype (P = 4.56 × 10-3). These observations indicate a specific loss of Lmx1a in the UBC population of the Sey cerebellum. 70    Figure 3.8. The loss of Pax6 results in a reduction of Lmx1a+ cells in the Sey cerebellum.  (A) At E15.5, UBC progenitors with strong Lmx1a expression (white arrowheads, left panel) are missing in the Sey cerebellum (right panel). By contrast, cells with light Lmx1a expression, which are granule cell progenitors born about the same time as UBCs, have similar staining in cells of the wildtype and Sey RL. (B) At E18.5, cells with Lmx1a expression in the wildtype cerebellum (white arrowheads, left panel) are absent from the Sey medial cerebellar core (right panel). Lmx1a+ cells are seen in the wildtype, lateral cerebellum (white arrowheads, bottom left panel) which are also observed in lateral portions of the E18.5 Sey cerebellum (white arrowheads, bottom right panel). CP, choroid plexus; EGL, external germinal layer; RL, rhombic lip; VZ, ventricular zone. Scale bars: 100µm. 71  3.2.8. Cytoarchitecture of the Sey cerebellum indicates the loss of UBCs To determine if the loss of Tbr2- and Lmx1-expression is a deficiency in gene expression or the loss of UBCs in the Sey, we examined the cytoarchitecture of the RL region with cresyl violet staining. Medially, there is a dense population of cells in the wildtype RL region where UBCs are normally found, and this same region is devoid of cells in the Sey cerebellum (Fig. 3.4C, D, regions bounded by red dotted lines). As found with anti-Tbr2 and -Lmx1a immunostaining, CV staining revealed the presence of cells in the lateral RL regions of the Sey cerebellum (Fig. 3.4E, F, regions bounded by red dotted lines). These results confirm the loss of UBCs in the medial Sey RL.  3.2.9. Increased cell death and decreased cell production in the UBC germinal zone of the Sey cerebellum   The reduction of UBCs seen in the Sey cerebellum could be the result of an enhanced cell death and/or a reduced generation of UBCs. We compared the number of caspase-3+ cells between wildtype and Sey cerebellar during the genesis of UBCs at E15.5-18.5 (Fig. 3.9A). A moderate, and significant, increase in the number of caspase-3+ cells was found in the mutant RL at E16.5 (Fig. 3.9B).   To address whether a decrease in UBC production is contributing to the Sey mutant UBC phenotype, we analyzed cell production at the RL during the period of UBC neurogenesis by acute BrdU labeling. Interestingly, we find that the area of the Sey RL is 56% smaller than the wildtype RL at E16.5 (P = 1.44 × 10-5; Fig. 3.9C, D). Furthermore, the total number of BrdU+ cells in the RL is reduced by 51% in the Sey mutant (P = 1.39 × 10-4; Fig. 3.9C, E). The reduction of BrdU+ cells in the mutant RL is not a result of changes in cell proliferation as the labeling indices are similar between wildtype and Sey RL (Fig. 3.9F, in fact the Sey RL has a marginally higher labeling index than the wildtype RL). These data indicate that both enhanced cell death of UBCs and a markedly decreased pool of RL progenitors lead to the Sey mutant UBC phenotype.  72   Figure 3.9. Enhanced cell death and decreased neurogenesis leads to the reduction of UBCs in the Sey cerebellum.  (A) Activated caspase-3 immunopositivity indicates the absence of apoptotic cells in the E16.5 wildtype cerebellum while caspase-3+ cells are found in the RL of E16.5 Sey cerebellum (arrowhead). (B) Quantitative analysis of caspase-3 immunopositivity revealed a significant increase in cell death in the Sey cerebellar RL at E16.5 compare to the wildtype (* P < 0.005). (C) The RL (area bounded by dotted lines) of E16.5 wildtype and Sey cerebella demonstrates the mutant RL is significantly smaller (D) and has significantly fewer BrdU+ cells (E) compared to the wildtype (* P < 0.005). (F) Interestingly, the percent BrdU+ cell in the Sey RL is slightly higher than that in the wildtype. EGL, external germinal layer; RL, rhombic lip; VZ, ventricular zone. Error bars represent SE. Scale bars: 100µm.  3.3. Discussion  Pax6 is a prominent gene involved in the development of multiple CNS regions and sensory organs (Walther and Gruss, 1991). The Sey cortex exhibits a dramatic reduction in cortical neurogenesis and disruption of cortical lamination (Schmahl et al., 1993b; Quinn et al., 2007). However, in the cerebellum, although Pax6 is richly expressed in the cells of the RL 73  which produces the most numerous neuron in the brain – the granule cell – among other neurons of the glutamatergic lineage, there is only minor disorganization of the Sey EGL with foliation defects and no apparent GC loss (Engelkamp et al., 1999; Swanson et al., 2005). Pax6 is expressed sequentially by all RL-derivatives: the glutamatergic CN neurons, GCs and UBCs. The Sey phenotypes of CN neurons and UBCs have not been previously reported. Our findings identify major, and heretofore unreported, functions for Pax6 in the development of glutamatergic CN neurons and UBCs. This supports a more critical role for Pax6 in the molecular architecture of the developing cerebellum.  3.3.1. The role of Pax6 in glutamatergic CN neuron development  Expression of Pax6 marks the progenitors of glutamatergic CN neurons prior to the expression of cell specific markers, e.g. Tbr1, Tbr2 and Lmx1a, which are expressed when the cells enter the NTZ [current study and (Fink et al., 2006)]. In the Sey cerebellum, these downstream cell markers are absent and the NTZ is acellular, indicative of the loss of the CN neuron population. The finding of Atoh1+ CN neuron progenitors in the E11.5 Sey subpial stream indicates there is normal cell production. However, these Atoh1+ cells do not colonize the NTZ and we observed an increased number of caspase-3+ cells in the Insm1-negative, likely CN neuron, population of the Sey subpial stream/EGL. This finding indicates that the migration of CN neurons to the NTZ is disrupted in the Sey mutant and cell death seems to be a critical factor for the loss of CN neurons. Interestingly, our study of Sey chimeras demonstrates a cell extrinsic role in CN neuron survival in the mutant condition; that is, the presence of Pax6 wild-type cells rescues Pax6-null CN neurons.  Our observation that glutamatergic CN neurons exhibit cell death when Pax6 is removed points to a novel pathway mediated by Pax6 that promotes cell survival in the cerebellum. In other brain regions, Pax6 has been shown to regulate cell survival by controlling the expression of pro-apoptotic or anti-apoptotic factors. For example, Pax6 is required for the survival of cortical radial glial cells by downregulating the expression of neurotrophin receptor p75NTR, which is known for its pro-apoptotic activity (Nikoletopoulou et al., 2007). On the other hand, Pax6 promotes the survival of dopaminergic olfactory bulb neurons by upregulating the expression of crystalline αA, an anti-apoptotic molecule that inhibits the activation of caspase-3 74  (Ninkovic et al., 2010). In the cerebellum, our Pax6 transcriptome analysis identified a downregulation of Bcl2l13 and neurotrophin-3 (Ntf3) in the Sey mutant (Ha et al., 2012). Bcl2l13 is an anti-apoptotic molecule that protects mitochondrial membrane integrity, which in turn inhibits mitochondria-driven apoptosis (Jensen et al., 2014). Ntf3 is classically considered a pro-survival factor by binding the tyrosine kinase receptors (Maisonpierre et al., 1990; DiCicco-Bloom et al., 1993). Recently, the precursor form of Ntf3 has also been identified for its pro-apoptotic activity when binding to p75NTR (Shen et al., 2013).    3.3.2. The role of Pax6 in UBC development  The absence of Pax6 also impacts the late born UBCs. We found that during normal development, UBCs residing in the region between RL and EGL express Pax6, Tbr2 and Lmx1a. In the Pax6-null, Tbr2- and Lmx1a-expressing UBCs are completely absent from the medial Sey cerebellum, although a few Tbr2+/Lmx1a+ cells are observed in the lateral RL. During the time of UBC genesis, we detected a significant increase in the number of caspase-3+ cells in the Sey RL region, where UBCs are generated and reside prior to their dispersion into the cerebellar core; indicating that some UBC progenitors undergo cell death in the Pax6-null. However, the number of apoptotic cells in the Sey RL is insufficient to account for the Tbr2+ UBCs that are missing as cell death is only marginally increased at E16, and not different at E15, 17 and 18. In addition to cell death, we detected a deficit in cell production at the RL, the progenitor pool of RL-lineages, in the Sey cerebellum. The E16 Sey RL is half the size of the wildtype RL and consists of 50% less proliferating cells as demonstrated by BrdU analysis. Our data indicate that the major role for Pax6 in UBC development is the regulation of production with a minor role being in regulating cell death. 3.3.3. Revising the role of Pax6 in granule cell development Previous studies have shown that Pax6 regulates the migration and differentiation, and not the survival or production, of GCs (Engelkamp et al., 1999; Swanson et al., 2005; Swanson and Goldowitz, 2011). Our caspase-3 immunolabeling, however, revealed that some Insm1+ GCs in the Sey EGL underwent cell death during development. The discrepancy may lie in the different tissue processing and staining used between our study and that of Engelkamp et al.  75   The previous work found no effect of the Pax6-null mutation on GC proliferation in the EGL (Engelkamp et al., 1999). However, we do see a reduction in cell proliferation in the Sey RL at late embryogenesis. We have interpreted this as an effect on UBC genesis, however we cannot exclude the possibility that it also impacts the generation of late born GCs. In this manner, the Sey mutation may have an upstream impact on GC production.  3.3.4. A spatial role of Pax6 in the development of RL derivatives We find that Pax6 has a global effect on the spatial organization of RL-derived cerebellar neurons in a lateral-medial fashion. We had an inkling of the spatial effect of the Sey from our analysis of Pax6 experimental chimeras where we found that Pax6-null GCs are largely excluded from the medial cerebellum (Swanson and Goldowitz, 2011). Now we also find that medially located Tbr1+ CN neurons are found missing in the Sey mutant while the Irx3+ VZ-derived lateral CN populations are unaffected. In a similar manner, UBCs are largely absent from the Sey cerebellum with the exception of some Tbr2+ cells at the lateral cerebellar RL. These results suggest that there is a requirement of Pax6 function, direct or indirect, for the successful placement of cells in the medial cerebellum. The phenotypes could be due to a failure in the acquisition of a medial subtype identity or a failure in cell migration. In either case, it is now clear that novel functions of Pax6 in each of the glutamatergic neurons is both cell type- and spatially-specific.  3.3.5. Pax6 and the molecular underpinnings of cerebellar development  RL precursors express Pax6 and Atoh1 (Yeung et al., 2014). The knockout of Atoh1 results in the loss of Pax6 expression and eliminates all cerebellar glutamatergic neurons (Machold and Fishell, 2005; Englund et al., 2006; Fink et al., 2006). In contrast, our present work shows that the Pax6 knockout has no effect on the generation of Atoh1-expressing RL progenitors and eliminates only the CN neurons and medial UBCs. Thus, the extreme phenotype of the Atoh1-null would place Atoh1 upstream of Pax6. In this model (Fig. 3.10), Atoh1 is necessary for the cell fate specification of all RL-derived precursors (Yamada et al., 2014). In 76  this study, we find that Pax6 regulates granule cell survival and proliferation. Furthermore, the present work illuminates the key function Pax6 plays in the development of CN neurons and UBCs. In glutamatergic CN neuron development, Pax6 is upstream of Tbr1 and Tbr2. In the Pax6-null cerebellum there is a complete loss of Tbr1+ CN neurons, while the Tbr1-knockout only results in disorganized CN neurons without cell loss (Fink et al., 2006). Similarly, the Tbr2 conditional knockout has no apparent effect on CN neurons (R. Hevner, personal communication). For UBCs, Pax6 is similarly upstream of Tbr2 as illustrated by the conditional Tbr2-knockout which only demonstrates a mild migration defect (R. Hevner, personal communication) compared to the loss of the majority of UBCs in the Sey cerebellum.  77   Figure 3.10. A model molecular program underpinning the development of cerebellar glutamatergic neurons.  Expression of Atoh1 in the RL is required to specify progenitor cells to RL-lineages. Pax6 is subsequently expressed in all RL-derived glutamatergic neurons and regulates multiple developmental processes in these cell types. In the development of CN neurons, Pax6 regulates cell survival of progenitors. The present study identifies an enhanced cell death in the Pax6-null cerebellum that contributes to the loss of CN neurons. It is known that expression of Tbr1 regulates the migration of CN neurons and we find this is downstream to Pax6 function. In the development of UBCs, the survival and production of UBC progenitors require Pax6 function. Thus, in the Pax6-null mutant there is an enhanced cell death and reduction in UBC progenitor cells, which results in a reduction of UBCs. Tbr2 functions downstream to Pax6, and plays a role in UBCs migration. In the development of granule cells, the current findings suggest that Pax6 plays a role in cell survival and cell proliferation, in addition to cell differentiation and migration. Our current work also suggests an earlier function of Pax6 in regulating the replenishment of RL progenitor pool.  3.3.6. Pax6 and the RL-lineage progenitor pool The Sey mutant RL progenitor pool as manifested by BrdU incorporation, is dramatically reduced and this reduction is particularly evident by late embryogenesis. This finding suggests that Pax6 has a role in regulating the RL progenitor pool (see Fig. 3.10). In fact, early study found that Atoh1+ cells rapidly emigrate from the RL and withdraw from the RL progenitor pool 78  (Machold and Fishell, 2005). Based on our recent analysis of compartmentation in the RL, we speculated that another population of cells (those originating from the interior face of the RL; Wls+/Pax6+ cells) served to replenish the RL progenitor pool (Yeung et al., 2014). With Pax6 absent, a depletion of the neural progenitor pool has been described in the development of retina and cortex, as a result of precocious cell cycle exit (Farhy et al., 2013) or shorter cell cycle length (Estivill-Torrus et al., 2002). Interestingly from our CbGRiTS database (cbgrits.org), we find that the transcriptional levels of cyclins B1/2, which promote cell cycle progression, and p57 (or Cdkn1c), which induce cell cycle exit, are elevated in the Sey cerebellum, suggesting that both mechanisms may be perturbed in the cells of RL progenitor pool. Further investigation in cell cycle dynamics will elucidate the Pax6-dependent regulation in RL progenitor pool.   3.3.7. Conclusion This work reveals the novel and essential functions of Pax6 in neurogenesis of glutamatergic CN neurons and UBCs, and together with the revised Pax6 function in GC development, recognizes a more central role of Pax6 in generating the RL-lineages. Our work brings to light the multivalent role of Pax6 in cerebellar development, which has commonalities to the role of Pax6 in the genesis of eye and cortex. This new knowledge enhances our understanding of the molecules underpinning cerebellar development, and more importantly, the requirement of Pax6 in neurogenesis.  3.4. Materials and methods 3.4.1. Mouse strains and husbandry  The Pax6 mutant strain, Pax6Sey (originally obtained from Robert Grainger and Marilyn Fisher, University of Virginia), was bred as heterozygous pairs, phenotyped for eye sizes and presence of cataracts, and genotyped as previously described (Swanson et al., 2005). Experimental Pax6Sey/Sey embryos were generated by intercrossing Pax6Sey/+ mice.  The Atoh1-lacZ reporter strain, Atoh1β-Gal (obtained from Huda Zoghbi, Baylor College of Medicine), was genotyped by PCR according to the protocol previously described (Jensen et 79  al., 2002). Experimental, double heterozygous Pax6Sey/+; Atoh1β-Gal/+ embryos were generated from the matings between heterozygous Pax6Sey/+ and Atoh1β-Gal/+ mice.  The morning that a vaginal plug was detected was designated as embryonic day 0.5 (E0.5). All studies were conducted according to the protocols approved by Institutional Animal Care and Use Committee and Canadian Council on Animal Care at the University of Tennessee Health Science Center and the University of British Columbia. 3.4.2. Experimental mouse chimeras  Experimental mouse chimeras were generated as previously described (Goldowitz and Mullen, 1982; Goldowitz, 1989). The mutant component of the chimera was generated by a mating of heterozygous Sey mutants (Pax6Sey/+), which yielded Pax6+/+, Pax6Sey/+ and Pax6Sey/Sey embryos. To mark the wildtype cells of experimental chimeras we used FVB-GFP mice [FVB.Cg-Tg(CAG-EGFP)B5Nagy/J; The Jackson Laboratory, Bar Harbor, ME; Stock number: 003516]. Four- to eight-cell embryos from Pax6Sey/+ matings (Pax6+/+, Pax6Sey/+ or Pax6Sey/Sey) were cultured together with embryos from wildtype (GFP) matings overnight. After successful fusion, blastocyts were transplanted into the uterine horn of pseudo-pregnant host ICR females. Chimera embryos were collected on E18.5, and tail biopsies were taken for genotyping of the Pax6Sey component using a mutagenically separated PCR technique as previously described (Swanson et al., 2005). Embryos that were determined by PCR to carry the Pax6Sey allele, suggesting it is either Pax6Sey/+ or Pax6Sey/Sey chimera, were further examine for overt mutant phenotypes (i.e., loss of eye and olfactory bulb) to identify the Pax6Sey/Sey chimeras. It is, however, possible that by these methods we would have missed some mutant chimeras that had a very low contribution of Pax6Sey/Sey cells [i.e., <10%, as previous study (Swanson and Goldowitz, 2011) found that chimeras of 10% chimerism exhibit overt eye phenotype]. Tissue was processed and sectioned as described below.   Percent chimerism was estimated from expression of GFP fluorescence (wildtype cells) in various brain regions outside the cerebellum. For each chimeric brain, GFP expression from 13 to 16 coronal sections were analyzed and averaged.  CN neuron phenotype was assessed by counting Tbr1+ cells from 13 to 16 coronal sections across the full cerebellum, right and left sides inclusive. We determined the number of Tbr1+ CN neurons from the cerebellum of 2 wildtype Pax6+/+ <-> +/+ chimera, 3 heterozygous 80  Pax6Sey/+ <-> +/+ chimera, 3 mutant Pax6Sey/Sey <-> +/+ chimeras, and 4 mutant Pax6Sey/Sey embryos. The total number of Tbr1+ CN neurons in each cerebellum was calculated, and averages were taken for all groups of embryos. For the mutant chimeric cerebellum, the expected number of Tbr1+ cells was predicted based on the percent chimerism (of the wildtype and mutant genotypes) multiplied by the average cell counts from wildtype and mutant cerebellum (see text). Statistical significance between the expected and observed Tbr1+ cells in the mutant chimeric cerebellum was determined by chi-square test. 3.4.3. Tissue preparation and histology  All embryos were collected at every age from E11.5 to 18.5. Embryos harvested between E10.5 to E15.5 were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4) for 1 hour at 4°C. Embryos harvested at E16.5 or later were perfused with 4% paraformaldehyde in 0.1 M PB, the brain tissues were isolated and further fixed in 4% paraformaldehyde in 0.1 M PB for 1 hour at room temperature. Fixed tissues were rinsed with PBS, followed by cryoprotection with 30% sucrose/PBS overnight at 4°C before embedding in OCT compound. Tissues were sectioned at 12 M for immunohistochemistry and cryosections were mounted on SuperfrostTM slides (Fisher), air dried at room temperature, and stored at -80C until used. In all cases, observations were based on a minimum of 3 embryos per genotype per experiment.  3.4.4. Immunohistochemistry   Tissue sections were rehydrated to PBS. For brightfield immunohistochemistry endogenous peroxidase activity was inhibited by treating the sections with 1% H2O2 in PBS followed by PBS-T (0.1M PBS/0.1% Triton X-100) rinse. Sections were incubated at room temperature for 20 minutes with blocking solution (1% BSA and 5% normal serum in PBS-T) and subsequently incubated at room temperature overnight with primary antibodies in a humid chamber. Following PBS-T washes the sections were incubated with biotinylated secondary antibodies (at 1:200, Vector Laboratories, Burlingame, CA) and processed for PAP immunohistochemistry using the ABC Kit (Vector Laboratories) according to the manufacturer’s protocol. Slides were dehydrated and coverslips were applied. For immunofluorescence, secondary antibodies labeled with fluorochrome were used to recognize the primary antibodies. 81  The slides were coverslipped with FluorSave (Calbiochem, 345789). Primary antibodies used were as follows: chicken anti-β-GAL (1:10,000; Abcam, Ab9361, RRID:AB_307210), rat anti-BrdU (1:300, Abcam, Ab6326, RRID:AB_305426), rabbit-anti-active Caspase-3 (1:500; Abcam, Ab13847, RRID:AB_443014), rabbit anti-LMX-1 (1:2000; Millipore, AB10533, RRID:AB_10805970), guinea pig anti-INSM1 (1:1000; a gift from Shiqi Jia, Max-Delbrück-Center for Molecular Medicine); rabbit anti-IRX3 (1:8000; a gift from Tom Jessell, Columbia University), rabbit anti-PAX6 (1:200; Covance, PRB-278P, RRID:AB_291612), rabbit anti-TBR1 (1:800; Abcam, Ab31940, RRID:AB_2200219), rabbit-anti-TBR2 (1:800; Millipore, AB2283, RRID:AB_10806889).  3.4.5. Cell counts and BrdU analysis We estimated the numbers of CN neuron and UBCs by counting cells positive for the appropriate cell marker (Tbr1 for CN neurons, Tbr2 for UBCs, and Lmx1a for both). Every 10th section across the whole E11.5-16.5 cerebellum and the half E17.5 and 18.5 cerebellum were counted. The assessment of cell death in CN neuron progenitors was determined by counting anti- Caspase-3-positive cells in the NTZ, subpial stream and EGL of E12.5-18.5 cerebella. The assessment of cell death in UBCs was determined by counting anti-Caspase-3-positive cells in the RL (and immediately adjacent area) of E15.5-18.5 cerebella.  To examine cell proliferation at the RL during UBC neurogenesis, timed pregnant females were injected intraperitoneally with BrdU (Sigma, B5002; 50 µg/g body weight) 1 hour before the collection of embryos. To quantify the number of proliferating cells in the cerebellar RL, BrdU+ cells were counted in every 10th section across the whole E16.5 cerebellar RL.  To test the possibility of cell fate change, cells produced during the period of CN neuron genesis (E10.5 and E11.5) were labeled with BrdU, and BrdU-labeled cells were analysed with immunohistochemistry at E15.5. Timed pregnant females were injected intraperitoneally with BrdU (50 µg/g body weight) on E10.5 and E11.5, then embryos were collected on E15.5.  In all cases, observations were based on a minimum of 3 cerebella per genotype. Statistical significance between wildtype and mutant was determined by two-tailed t-test. 3.4.6. Microscopy Analysis and photomicroscopy was performed with a Zeiss Axiovert 200M microscope with the Axiocam/Axiovision hardware-software components (Carl Zeiss). Confocal microscopy 82  was performed using an Olympus FV500 confocal laser scanning microscope and the Fluoview image capture and analysis software.   83  Chapter 4 : Wls expression in the rhombic lip orchestrates the embryonic development of the mouse cerebellum 4.1. Introduction  Wls is a transmembrane protein that controls the secretion of Wnt molecules (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). During early embryogenesis, Wls is expressed at the isthmic organizer and mediates the secretion of Wnt1 (Fu et al., 2011), which patterns the neural tube and induces the development of cerebellar anlage from rhombomere 1 (McMahon and Bradley, 1990; Thomas and Capecchi, 1990). Deletion of Wls or Wnt1 from the ISO results in the loss of cerebellar structure (Thomas and Capecchi, 1990; McMahon and Bradley, 1990; Carpenter et al., 2010; Fu et al., 2011). Recently, we found that later in cerebellar development, Wls expression is localized to the interior face of the rhombic lip (iRL) and aids in parcelling the RL into four molecularly distinct compartments (Yeung et al., 2014). Furthermore, Wls expression is restricted to the iRL by the presence of Pax6 in the complementary exterior face of the RL (eRL) and external germinal layer (EGL), such that in the Pax6-null small eye (Sey) mutant, Wls expression expands into the eRL and EGL (Yeung et al., 2014). However, the requirement of Wls in the RL and how it interacts with Pax6 expression is unclear.   There are two challenges in studying Wls in cerebellar development: 1) the early embryonic lethality of the conventional Wls knockout (Yeung et al., 2014), due to the defect in primitive streak and mesoderm formation (Fu et al., 2009), and 2) when using a conditional knockout (cKO) one needs to choose a Cre-line that does not affect the ISO, as it is known that in a Wnt1-Cre cKO the cerebellar anlage never develops attesting to the critical involvement of the ISO in cerebellar development (Carpenter et al., 2010; Fu et al., 2011). One means to bypass both of these constraints in studying the role of Wls in RL and cerebellar development, is to create a cKO that has a later onset of deletion to permit further development and to dissociate the use of Wls in the ISO from the RL.   To circumvent the early requirement of Wls, we employed a Nestin-cre line to inactivate Wls in the cerebellum at mid-gestation. With this approach, we deleted Wls expression from the RL at E12.5 while the earlier expression at the ISO remains intact in the Wls-cKO. The Wls-cKO mutants die soon after birth and examination of the cerebellum at P0 reveals a profound 84  reduction in the size of the vermis with rudimentary foliation. The cerebellum of the Wls-cKO exhibits several cellular abnormalities, including: a) A smaller RL, b) ectopic clusters of granule cells in the lateral cerebellar core, c) EGL that has an uneven thickness and contains gaps devoid of granule cells, d) ectopic Purkinje cells (PCs) in the EGL gaps and the inferior colliculus, e) ectopic interneurons in the EGL gaps and the pial surface, f) an absence of Bergman glia fibers in the EGL, and g) a significant reduction in the number of unipolar brush cells (UBCs). Thus, our present findings illustrate crucial roles of Wls in the developing cerebellum.   4.2. Results 4.2.1. Wls is inactivated in the RL during mid-gestation by Nestin-Cre mediated recombination  To conditionally inactivate Wls in the RL at mid-gestation, we employed the Nestin-Cre line (Tronche et al., 1999) that has been characterized to drive Cre expression in nervous tissues starting at E10.5 (Graus-Porta et al., 2001). In the cerebellar RL, Nestin expression is found as early as E11.5 and co-localized in cells that also express Wls (Fig. 4.1A). We intercrossed Nes-Cre/+, WlsLacZ/+ to Wlsflox/flox mice to generate offspring of the Nes-Cre/+, WlsLacZ/flox cKO genotype (see Methods; Wls-cKO hereafter). When the Wls-cKO cerebellum is examined at E11.5, expression of Wls is still observed at the RL, choroid plexus (CP) and ISO (Fig. 4.1B). One day later, the E12.5 Wls-cKO cerebellum loses Wls expression in the cells of the RL while expression at the ISO and CP is unaltered (Fig. 4.1C). E12.5 is the time when the cerebellar primordium is established and glutamatergic neurons (i.e. granule cells and UBCs) arise from the RL. Furthermore, Wls expression in the Wls-cKO RL is lost at all timepoints examined after E12.5. These findings validate the use of this Wls-cKO to study the role of Wls in the RL.  By using the above mating scheme, we were able to obtain the expected ratio of Wls-cKO embryos (i.e., ¼ of all embryos). However, when we examined litters of P2 pups, no Wls-cKO mutants were present. In fact, dead pups were found at P0 and PCR genotyping identified all dead pups as Wls-cKO mutants. The neonatal Wls-cKO mutant pups lack milk in their stomach and appear dehydrated, and die within 6 hours after birth.  85   Figure 4.1. Wls is inactivated in the RL by Nestin-Cre mediated recombination during mid-gestation.  (A) Wls (red) and Nestin (green) co-expressed (yellow) in the RL cells of the E11.5 wildtype cerebellum. (B) Wls expression pattern in the RL is unaltered in the E11.5 control as compared to the Nestin-Cre Wls-cKO (yellow arrows). Insets show Wls+ cells in the ISO. (C) One day later at E12.5, expression of Wls is deleted from the Wls-cKO RL (white arrow) while expression in the CP and ISO (insets) remains unchanged. N=3 for all genotypes. Scale bars: 100 µm. 4.2.2. Cerebellar morphology is altered in the Wls-cKO  We assessed the P0 Wls-cKO cerebellum for changes resulting from the deletion of Wls in the RL during development. At P0, the control cerebellum displays four principal fissures (Fig. 4.2A, red asterisks) along the anterior-posterior axis that partitions the cerebellum into five cardinal lobes. The P0 Wls-cKO has only a rudimentary foliation pattern (Fig. 4.2B). The fissures in the Wls-cKO cerebellum are either missing [i.e., the indentation corresponding to the fissure is not found (Fig. 4.2B, pink asterisk)], shallow [i.e., the indentation is observed but is found to be decreased in depth (Fig. 4.2B, yellow asterisk)] or fused [i.e., the indentation is observed but the EGLs from the two adjacent lobes are not separated (Fig. 4.2B, green asterisks)].   The P0 Wls-cKO cerebellar vermis is markedly smaller than that of the control (compare Fig. 4.2A to 2B). In measures of cerebellar area across a half cerebellum (from medial to lateral), the Wls-cKO has an average reduction of 25% in area compared to that of the control littermate (Fig. 4.2C), and the reduction is significant (Fig. 4.2D, p = 2.34×10-2). To determine if there is a regional effect, the areal measurements from the medial and lateral sections are considered separately. These are calculated by dividing the half cerebellum into two equal parts (a medial part that contains the sections closest to midline and a lateral part that contains sections away from midline). The areal difference is statistically significant in the medial part of the cKO cerebellum (Fig. 4.2D, p = 1.2×10-2). On the other hand, the lateral cKO cerebellum does not significantly differ in area compared to the control (Fig. 4.2D, P = 0.12). Thus, there is a 86  cerebellar hypoplasia that is specific to the vermis of the Wls-cKO cerebellum. These phenotypes are reproducible between mutant cerebella examined (n=3).  Figure 4.2. The P0 Wls-cKO cerebellum displays rudimentary foliation and hypoplasia in vermis.  Sagittal sections showing the P0 cerebellar vermis of the (A) control and (B) Wls-cKO. (A) The four principal fissures (marked by red asterisks) are apparent in the P0 control cerebellum, and divide the cerebellum into five cardinal lobes along the anterior-posterior axis. The section showed is 180µm away from midline. (B)  In contrast, the Wls-cKO P0 cerebellum displays abnormal fissures including a shallow invagination (yellow asterisk), fused fissures (green asterisks) and a missing fissure (pink asterisk). Moreover, the area of the Wls-cKO cerebellar vermis (bounded in red line) is markedly smaller compared to that of the control littermate. The section is 420µm away from midline. (C) Quantitative areal analysis of sagittal sections is calculated across the medial to lateral half of the P0 cerebellum. The Wls-cKO cerebellum has an overall areal reduction across the half cerebellum. (D) Average cerebellar area of half cerebellum where medial and lateral portions are compared between control and Wls-cKO. The cerebellar area measured at the vermis is significantly reduced in the cKO (*, P < 0.05; student’s t-test), but not at the lateral hemisphere. Data represent mean ±s.e.m. N=3 for all genotypes. Scale bars: 100 µm. 87  4.2.3. Rhombic lip is altered morphologically and molecularly as a result of the loss of Wls expression  Wls expression in the RL has unique patterns during cerebellar development, in both the temporal and spatial domains (Yeung et al., 2014). Thus, we focused on examining the RL in the Wls-cKO. Morphologically, the size of the Wls-cKO RL appears slightly smaller than the control RL starting at E13.5 (Fig. 4.3A). This reduction in RL size becomes more apparent at E15.5 (Fig. 4.3B). To test if enhanced cell death is responsible for the size reduction in the Wls-cKO RL, cells undergoing apoptosis was determined by caspase-3-labeling. The number of caspase-3+ cells observed in the E12.5-15.5 Wls-cKO and control RL is limited and shows no differences between genotypes, indicating that the reduction of RL size is not due to enhanced cell death in the cKO (Supplementary Fig. 13).   In addition to diminished size, we observed a molecular alteration in the Wls-cKO RL. In control cerebellum by E15.5, the RL is demarcated by the expression of Wls and Pax6 in two molecular compartments, the iRL and eRL, respectively (Fig. 4.3B) (Yeung et al., 2014). In the Wls-cKO RL, however, the Wls-expressing cells in the iRL appears to be absent, while the full complement of Pax6+ cells is evident in the eRL (Fig. 4.3B). This finding indicates that the reduction of RL size in the Wls-cKO is likely due to disappearance of the iRL. In addition, the strong expression of Wls in the control RL marks a third compartment at the distal tip of the RL; which forms a clear boundary with the adjacent Pax6+ domain in the eRL (Fig. 4.3B, white arrow). While this region is still present in the Wls-cKO cerebellum, ectopic Pax6-expressing cells are found to cross the boundary into this region (Fig. 4.3B, yellow arrow). 88   Figure 4.3. The rhombic lip of Wls-cKO cerebellum exhibits a size reduction and molecular alterations.  (A) At E13.5, the Wls-cKO RL is smaller than the control RL (bounded by a red line). (B) At E15.5, the size reduction in the Wls-cKO RL becomes more apparent when compared to the control RL. Two molecular compartments, the iRL and eRL, can be identified in the control RL with Wls and Pax6 expression, respectively. In contrast, the iRL characterized by strong Wls expression in the control is missing in the Wls-cKO, while the Pax6-expressing eRL is still present. A third compartment is located at the distal tip of the RL and is characterized by intense Wls expression in the control. Pax6-expressing cells are excluded from this region (distal to the white arrow) in the control RL. However, in the Wls-cKO RL, some Pax6-expressing cells are found in this region (yellow arrow). N=3 for all genotypes. Scale bars: 100 µm.    4.2.4. Organization of EGL is disrupted in the Wls-cKO  Granule cells are the most numerous cell type in the cerebellum. They originate from the RL between E12.5-16.5. Granule cell progenitors (GCP) leave the RL and migrate tangentially over the cerebellar surface to constitute the EGL. Granule cells express Pax6 throughout cerebellar development (Walther and Gruss, 1991). Pax6-immunostaining shows that the E15.5 cerebellar anlage is covered by Pax6+ EGL in both the control and Wls-cKO embryos (Fig. 4.4A), and the morphology of the EGL in both genotypes shows no apparent differences at this early age.  89  When the cerebellum is examined at E16.5 and beyond, however, several GC abnormalities become apparent in the Wls-cKO cerebellum. One noticeable abnormality is the unusual appearance of acellular gaps found in the EGL of the E16.5 Wls-cKO cerebellum (Fig. 4.4B’ and B”, yellow arrows). These gaps are mostly located in the anterior half of the EGL in both the medial and lateral aspects of the cerebellum (Fig. 4.4B, asterisks). In the E17.5-P0 Wls-cKO cerebellum, these gaps are more obvious due to their increased size (Fig. 4.4C, asterisk). Furthermore, at E17.5-P0, Pax6-negative cells are found in the majority of the previously acellular gaps observed at E16.5 (Fig. 4.4C’, green arrows). To determine if the EGL gaps are a result of increased cell death in GCPs, we examined the number of dying cells with caspase-3 immunoreactivity in the E15.5 cerebellum, just before the gaps appear at E16.5. Very few caspase-3+ cells are found in the control or the Wls-cKO cerebellum and numbers of caspase-3+ cells are not different between the two genotypes (Supplementary Fig. 13).  To determine if these Pax6-negative cells are RL-derived neurons, we labeled the brains with Tbr1 for CN neurons and Tbr2 for UBCs. Immunohistochemical (IHC) analysis found no Tbr1- or Tbr2-positive cells in the gaps of the Wls-cKO EGL, indicating that the cells are not CN neurons or UBCs. To examine if these cells arise from the ventricular zone (VZ)-lineage, we used Calbindin expression to mark Purkinje cells and Pax2 expression to mark the later born interneurons. In E17.5 cKO cerebellum, IHC analysis reveals the presence of Calbindin+ cells in some of the gaps (Fig. 4.4C”, white arrow), and other gaps are occupied by a mixture of Calbindin+ cells and Pax2+ cells (Fig. 4.4C” and 4C”’, white arrows); and very rarely with only Pax2+ cells. In addition, some Calbindin+ or Pax2+ cells were found above the gaps and residing at the cerebellar pial surface (Fig. 4.4C” and 4C”’, red arrows). In the control cerebellum, Calbindin+ or Pax2+ cells are never found in the EGL or at the pial surface at any age examined. There are also changes in the composition of cell types in the EGL gaps over time. At E17.5, the gaps are mostly occupied by ectopic Calbindin+ cells. Later at E18.5 and P0, the majority of gaps are occupied by a mixture of Calbindin+ cells and Pax2+ cells. This pattern of cell colonization reflects the birthdates (Calbindin+ Purkinje cells arise from VZ at E10.5-E13.5, followed by Pax2+ interneurons which are born at E13.5-P7) of the respective cell types. In addition, the overall organization of the EGL is aberrant in the Wls-cKO cerebellum. In the P0 control cerebellum, the EGL is largely uniform and has a smooth contour across axes (Fig. 4.2A). In contrast, the P0 Wls-cKO cerebellum displays regions where the EGL is thicker 90  than usual and has ragged contours (Figs. 4.2B, 4B, 4C), as well as areas where there are gaps in the EGL as previously noted (Figs. 4.4B, 4C, white asterisks). Quantitative measure of EGL area reveals a reduction specific to the medial EGL in the Wls-cKO. At P0, the EGL area in the medial Wls-cKO cerebellum is significantly smaller compared to the control (P = 1.49×10-2), although the EGL area of the lateral cerebellum is not different between genotypes (Fig. 4.4D).     91   Figure 4.4. Abnormalities in EGL organization displayed by the Wls-cKO cerebellum.  (A) In the E15.5 control cerebellum, Pax6+ GCPs migrate from the RL and cover the cerebellar surface, forming the EGL. At this time, the EGL of control and cKO cerebella appears similar. At later developmental timepoints, however, gaps in the EGL are observed in the cKO cerebellum (asterisks in B, C). (B) At E16.5, these gaps (white asterisks) are mostly acellular (yellow arrows in B’ and B”). (C) One day later, at E17.5, Pax6-negative cells are found in these gaps (white asterisks in C, outlined in white dotted line and green arrow in C’). (C”, C”’) Immunohistochemistry on adjacent sections with Calbindin and Pax2 antibody reveals that the gaps (delineated in white dotted lines) are occupied by Calbindin+ cells (white arrow in C”) or Pax2+ cells (white arrow in C”’). Another striking feature of the ectopic Calbindin+ and Pax2+ cells is that the cells migrate out of the cerebellum and reside on the pial surface (red arrows in C” and C”’). (D) Quantitative analysis of EGL area across the half-cerebellum at P0. The cKO exhibits reduction in EGL area medially that is statistically significant (*, P <0.05; student’s t-test). Data represent mean ± s.e.m. N=3 for all genotypes. Scale bars: 100 µm.   92  4.2.5. Wls-cKO displays ectopic granule cells in the cerebellar core At E17.5 and older Wls-cKO cerebella, there are ectopic cell clusters found in the region above the ventricular zone of the lateral cerebellar core (Fig. 4.5, bounded in red boxes). We examined a panel of cell-specific markers (Tbr1, Tbr2, Pax2, Calbindin, and Pax6). These cells are immunonegative for Tbr1, Tbr2, Pax2 and Calbindin. However, these clusters are positive for Pax6 (Fig. 4.5A and 5A’). Thus, these ectopic cells are likely GCs. These cell clusters are also negative for NeuN, the neuronal differentiation marker (Mullen et al., 1992). When the P0 control cerebellum is immunolabeled for NeuN, GCs in the inner pre-migratory zone of the EGL are immunoreactive to anti-NeuN. In contrast, the ectopic Pax6+ clusters located in the cerebellar core, as well as the GCs in the pre-migratory zone of the EGL, are NeuN-negative (Fig. 4.5B and 5B’). To explore whether these ectopic GCs are postmitotic, we performed acute BrdU analysis. Immunostaining with anti-BrdU reveals that the ectopic cell clusters are mitotically active (Fig. 4.5C and 5C’). These findings indicate that the ectopic Pax6+ cell clusters in the Wls-cKO constitute a population of NeuN-negative and proliferating GCPs.   93   Figure 4.5. Ectopic granule cell clusters are found in the Wls-cKO cerebellar core.  (A) The Wls-cKO lateral cerebellum displays ectopic cell clusters in the cerebellar core (bounded in red box). The cell clusters are constituted by Pax6+ cells suggesting that the cells are likely granule cells. A’ shows the cell clusters at higher magnification. (B) While NeuN normally marks the migrating GC in the pre-migratory zone and IGL in the P0 control cerebellum, NeuN is absent in Pax6+ cells in the EGL and ectopic cells in the cerebellar core (bounded in red box; shown at higher magnification in B’) in the Wls-cKO cerebellar. (C) Proliferating cells are examined at E17.5 using an acute BrdU injection. BrdU+ cells are found in the ectopic Pax6+ cell cluster (bounded in red box; shown at higher magnification in C’). N=3 for all genotypes. Scale bars: 100 µm.    4.2.6. Wls-cKO exhibits extracerebellar Calbindin+ Purkinje cells in the inferior colliculus  The IHC analysis for Calbindin in the Wls-cKO cerebellum also revealed ectopic clusters of Calbindin+ cells located outside the cerebellum, in the inferior colliculus (Fig. 4.6A, bounded in red box; red arrows in 6A’). These extracerebellar Calbindin+ cells are first observed in the E16.5 Wls-cKO and this phenotype persists at the latest times examined, i.e., the P0 cKO brain. Such extracerebellar PCs are not seen in the control brain at any age studied. Examination of 94  adjacent sections with antibodies to Pax6, Pax2, Tbr1, and Tbr2 revealed no immunopositive cells in extracerebellar areas in the Wls-cKO cerebellum (Fig. 4.6B).    Figure 4.6. Extracerebellar Calbindin+ Purkinje cells are found in the inferior colliculus of the Wls-cKO brain.  (A) In the E17.5 Wls-cKO, we observe a cluster of Calbindin-immunoreactive cells (red arrows in A’) outside the cerebellum in the inferior colliculus. (B) The adjacent section to (A) is examined for Pax6-immunofluorescence to determine if any granule cells are also found in the ectopic territory (red arrows). We find Pax6+ cells in the cerebellar EGL, as expected, but no extracerebellar GCs are found in proximity to the ectopic PCs. N=3 for all genotypes. Scale bars: 100 µm.    4.2.7. Bergmann glia morphology is abnormal in the Wls-cKO cerebellum The defects in migration, foliation, and lamination exhibited by the Wls-cKO prompted us to examine the Bergmann glia cell (BGC) which has been implicated in the success of these developmental events. To examine the phenotype of BGC, Glast immunoreactivity was analyzed in the P0 cerebella. In the control EGL, Glast staining demonstrates the parallel array of BG fibers that are perpendicular to the cerebellar pial surface (Fig. 4.7A); the endfeet of the BG helps to form the glia limitans (Fig. 4.7A’, white arrows). In contrast, the glial scaffold formed by the BG fibers is largely missing in the Wls-cKO EGL (Fig. 4.7B) and the endfeet of the BG fail to make contact with the basement membrane as demonstrated by the lack of Glast staining in the EGL and at the pial surface (Fig. 4.7B’). Interestingly, there are areas in the anterior EGL 95  in the Wls-cKO cerebellum where Glast+ BG fibers are found spanning the EGL and reaching the pial surface (Fig. 4.7B, C, E, white arrows). These areas always coincide with the EGL gaps (Fig. 4.7B, bounded in red boxes, C, E) and occasionally associate with ectopic Calbindin+ and/or Pax2+ cells (Fig. 4.7D, F, red arrows). The BG fibers in these areas are thicker and exhibit irregular contours compared to the control fibers (Fig. 4.7C, E). Interestingly, we found that the ectopic GC clusters residing in the cerebellar core are devoid of Glast+ fibers in the Wls-cKO cerebellum (Fig. 4.7G, yellow arrows).  96    Figure 4.7. Glial scaffold formed by Bergmann glial fibers is disrupted in the Wls-cKO cerebellum.  (A) Immunofluorescence analysis of Glast-expressing glial in P0 control cerebellum demonstrates an elaborate glial scaffold formed by BG fibers spanning the EGL, and the endfeet of the BG form a continuous glial limitans at the pial surface (white arrows in A’). (B) In contrast, Glast immunoreactivity is largely absent from the EGL of Wls-cKO. Furthermore, Glast-positivity in the glial limitans is missing in the Wls-cKO cerebellum (B’). (C, E) However, in the Wls-cKO cerebellum where the EGL gaps are located, Glast+ BG fibers are found to span the gap and make contact with the pial surface (C and E, white arrows). The Glast+ BG fibers in these regions, however, are thicker and have irregular contours compared to the control. (D) BG fibers are found to be associated with Pax2+ in a gap (red arrow). (F) BG fibers are also found to be associated with Calbindin+ cells in other gaps (red arrow). (G) In the Wls-cKO, the ectopic GC clusters in the cerebellar core are negative for Glast+ fibers (yellow arrows). Higher magnification images of the ectopic cells highlighted by the yellow arrows are shown below. N=3 for all genotypes. Scale bars: 100 µm. 97  4.2.8. Tbr2+ unipolar brush cells are significantly reduced in the Wls-cKO cerebellum  Unipolar brush cells (UBCs) are a third set of RL-derived neurons that originate late embryonically (E15.5-18.5). UBCs leave the RL and disperse within the cerebellar core, before migrating to the IGL. UBCs can be identified by Tbr2 expression throughout development (Englund et al., 2005). In the P0 control cerebellum, Tbr2+ cells are seen in the cerebellar core and the region of the regressing RL (Fig. 4.8A, white arrows). In contrast, in the P0 Wls-cKO cerebellum, Tbr2+ cells are not detected near the regressing RL and only few cells are found in the cerebellar core (Fig. 4.8B, yellow arrow). Quantitative analysis of Tbr2+ cells in P0 cerebella reveals an 85% reduction in the Wls-cKO that is significantly different from the control (P = 1.43×10-4) (Fig. 4.8C). The reduction in Tbr2+ cells in the cKO is uniform across the half P0 cerebellum and does not exhibit a medial-to-lateral effect (Fig. 4.8D). However, using caspase-3 immunohistochemistry we could not detect any increases in cell death in the cKO cerebellum.  98   Figure 4.8. Wls-cKO cerebellum exhibits reductions in the number of Tbr2+ unipolar brush cells.  (A) Immunofluorescence of Tbr2-expressing cells in the P0 control cerebellum shows the existence of numerous Tbr2+ cells in the regions of the cerebellar core and the regressing RL (white arrows). (B) The Wls-cKO cerebellum, however, have far fewer Tbr2+ cells in both of these regions (yellow arrow). (C) Quantitative analysis of Tbr2+ cells in the P0 half-cerebellum reveals that the reduction in Tbr2+ cells in the Wls-cKO is statistically significant. (***, P <0.001. student’s t-test). (D) The number of Tbr2+ cells is reduced across the P0 Wls-cKO cerebellum compared to the control. Data represent mean ± s.e.m. N=3 for all genotypes. Scale bars: 100 µm.    4.2.9. Cerebellar nuclear neurons are not affected in the Wls-cKO  Cerebellar nuclear (CN) neurons are the first RL-derived neurons arising from the RL at E10-12, and these neurons can be identified by the cell specific marker Tbr1. At E13.5, these 99  cells form an aggregate in the nuclear transitory zone (NTZ) and express Tbr1 in the control cerebellum, and the same is observed in the Wls-cKO (Fig. 4.9A). Quantitative analysis of Tbr1+ cells in the P0 cerebellum shows that the number of Tbr1+ cells in the Wls-cKO is not significantly different (P = 0.61) from the control cerebellum (Fig. 4.9B).   Given that CN neurons arise before the deletion of Wls expression in the RL of the Wls-cKO (starting at E12.5), it is not surprising that this cell type does not show apparent phenotypes. Furthermore, this result indicates that CN neuron development does not need Wls at later developmental time points.  Figure 4.9. Development and number of Tbr1+ cerebellar nuclear neurons are not altered in the Wls-cKO cerebellum.  (A) At E13.5, CN neurons that enter the NTZ express the cell specific marker Tbr1. Immunofluorescent staining reveals similar Tbr1 expression pattern in control and Wls-cKO cerebella. (B) Quantitative analysis of Tbr1+ cell in the P0 cerebellum shows no significant different in control and cKO animals. Data represent mean ± s.e.m. N=3 for all genotypes. Scale bars: 100 µm.     4.3. Discussion The present study investigates the requirement of Wls in cerebellar development. During development, Wls expression at the isthmic organizer has been shown to be required for the induction of midbrain (MB) and cerebellar anlagen, and the absence of Wls from ISO results in the deletion of midbrain and hindbrain structures (Carpenter et al., 2010; Fu et al., 2011). The use of Nestin-cre to ablate Wls at mid-gestation leaves Wls expression in the ISO unaffected, and we show that Wls is specifically removed from RL cells beginning at E12.5. Thus, this conditional Wls-KO is suitable for the study of Wls in the RL. Here we report the abnormalities exhibited by the Wls-cKO cerebellum: 1) the cerebellum of the P0 Wls-cKO lacks foliation and 100  is 25% smaller compared to the control cerebellum; 2) the RL is anatomically and molecularly pathological; 3) the EGL is disorganized and displays gaps that are found to be initially acellular and filled in with Pax2+ interneurons and/or Calbindin+ PCs; 4) there are ectopic clusters of GCs found deep in cerebellar core; 5) there are ectopic PCs in inferior colliculus; 6) BGCs and their fibres are disorganized; 7) 85% of UBCs are missing in the Wls-cKO.   4.3.1. Wls expression in the RL provides Wnt signals to RL- and VZ-lineages Wls controls the secretion of all Wnt molecules from Wnt producing cells (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). The released Wnt molecules bind the receptors on recipient cells, and activate the transcription of target genes, which is mediated by the nuclear translocation of β-catenin, the downstream effector of Wnt signaling pathway. Previous studies have examined the knockout of β-catenin, in which Wnt signaling activity is abolished in the recipient cells to understand Wnt signalling (Chenn, 2008). The discovery of Wls as a key player that controls Wnt signaling in the producing cells (Goodman et al., 2006; Bartscherer et al., 2006; Banziger et al., 2006), thus upstream to β-catenin, provides a new approach to study the requirement of Wnt signaling in development.    Earlier work has examined the conditional knockout of β-catenin under the influence of Nestin-cre, which has been shown to eliminate Wnt signalling in the cerebellar RL (Schüller and Rowitch, 2007). The β-cateninNestin-cKO exhibits a hypoplasia of the cerebellar vermis, and differentiation abnormalities (manifested by enhanced TuJ1 and lack of NeuN expression) in cerebellar progenitor cells. The hypoplasia and lack of NeuN are also observed in our Wls-cKO, which utilizes the same Nestin-cre line (Tronche et al., 1999). While the β-cateninNestin-cKO eliminate the Wnt-responsive cells in the RL, our Wls-cKO eliminates Wnt secretion upstream of the action of β-catenin. The set of phenotypes shared between the two knockouts would suggest that the same set of cells (i.e., the RL cells) are affected. The findings from our cKO further suggests that the RL Wls domain is the source of Wnt molecules required to activate Wnt signaling in RL-lineages.  However, our Wls-cKO exhibits additional remarkable phenotypic abnormalities compared to what has been reported in the β-cateninNestin-cKO. The phenotypic differences are 101  likely due to the knockdown of Wls versus β-catenin in the RL cells since both cKOs used the Nestin-cre line. The β-cateninNestin-cKO abolishes Wnt signaling in the Nestin-expressing, Wnt-receptive cells. While our Wls-cKO inhibits the release of Wnt molecules that would abolish Wnt signaling in all receptive cells that includes Nestin-negative cells. In the cerebellum, the Nestin-negative cells would include cells outside of the RL, such as cells in the VZ. Thus, it is possible that cells from both VZ- and RL-lineages are affected in the Wls-cKO. This notion is supported by the observation of BGC abnormalities in the Wls-cKO that are not found in the β-cateninNestin-cKO. As BGCs originate from the VZ, the negative impact of the loss of Wnt signalling would presumably be present only in the Wls-cKO and not the β-cateninNestin-cKO cerebellum. Consistent with this idea, a previous study that deleted β-catenin in hGFAP-expressing glia cells found similar defects in BGC development (Wen et al., 2013). Furthermore, the present study and the β-cateninhGFAP-cKO (Wen et al., 2013) identified foliation defects that were not found in the β-cateninNestin-cKO cerebellum. Abnormal BGCs are often associated with foliation defects (Hoser et al., 2007; Ma et al., 2012). The similarity in foliation and BGC defects observed in the two studies indicates a requirement of Wnt signaling that includes cells of the VZ-lineage. Altogether, the present findings point to a crucial role that Wls plays in cerebellar development: Wls-domain in the RL is the source of Wnt molecules for cells of both the RL- and VZ-lineages.   4.3.2. Wls/Wnt signaling is required to drive differentiation in cerebellar development When Wnt molecules are secreted by the Wls expressing cells in the RL, the molecules activate Wnt signaling in the recipient cells of RL- and VZ-lineages. What developmental processes does Wnt signaling regulate downstream in these recipient cells?  During CNS development, Wnt signaling is implicated in cell proliferation in the cortex (Zechner et al., 2003). In the Wls-cKO cerebellum, however, we do not observe obvious changes in cell proliferation. As found in the β-cateninNestin-cKO and β-cateninhGFAP-cKO, we find that the loss of Wnt signaling in the cerebellum has no effects on cell proliferation (Schüller and Rowitch, 2007; Wen et al., 2013). The activation of Wnt signaling (by overexpressing β-catenin) also does not enhance cell proliferation in the cerebellum (Lorenz et al., 2011; Pei et al., 2012; Selvadurai and Mason, 2012; Poschl et al., 2013). In line with these findings, overexpressing 102  Wnt1 in the midbrain-hindbrain region has no effect on cell proliferation in the cerebellar primordium (Panhuysen et al., 2004). A consensus finding, then, is that Wnt signaling in the cerebellum does not regulate cell proliferation. In fact, Wnt-associated medulloblastoma has been suggested to originate from the dorsal hindbrain (Gibson et al., 2010). Wnt signaling has been shown to drive differentiation in embryonic stem cells and neuronal precursors (Hirabayashi et al., 2004; Munji et al., 2011; Davidson et al., 2012). In the Wls-cKO cerebellum, we observed an aberrant differentiation in GCs, as demonstrated by the lack of NeuN expression, which normally marks the mature GCs that reside in the inner EGL. The same phenotype is also reported in the β-cateninNestin-cKO (Schüller and Rowitch, 2007). Conversely, the activation of Wnt signaling in GCs results in the premature differentiation of GCs in the outer EGL, as manifested by the up-regulation of differentiation markers NeuN and TuJ1 (Lorenz et al., 2011). Thus, these results indicate that Wnt signaling regulates the expression of granule cell differentiation markers, which suggest that Wnt signaling may promote granule cell differentiation during cerebellar development. Future works that allow lineage tracing of the granule cells into later post-natal ages will help elucidate the requirement of Wnt signaling in other aspect of granule cell differentiation.  4.3.3. Wls/Wnt signaling organizes the foliation of cerebellum during development The neonatal Wls-cKO cerebellum displays rudimentary foliation, indicating a role of Wls/Wnt signaling in cerebellar foliation during development. Foliation requires the tight coordination between GCs, PCs and BGCs: 1. Increased proliferation of GCs results in the inward accumulation at the future fissures; 2. The PC layer folds inward at points where GCs accumulate; 3. BG fibers converge at the base of the fissure; 4. GC differentiates preferentially at the base of the emerging fissure (Sudarov and Joyner, 2007). Although we observed in the Wls-cKO normal accumulation of GCs and invagination of PC layer, BGCs fail to project fibers to the pial surface and glia limitans are not formed. The glial endfeet anchorage is crucial in cerebellar foliation, as demonstrated by the conditional knockout of β1-class integrins where the anchoring of glial endfeet to the basement membrane is impaired, results in fusion between adjacent folia (Graus-Porta et al., 2001). Furthermore, the disrupted organization of GCs at the 103  base of the fissure likely further impair the foliation process. These findings illustrate the role of Wls/Wnt signaling in organizing cells at the region of emerging fissure [also known as the anchoring centers (Sudarov and Joyner, 2007)].  4.3.4. Wls/Wnt signaling restricts Purkinje cells within the developing cerebellum In the inferior colliculus of the neonatal Wls-cKO, we observed ectopic Purkinje cells. Extracerebellar PCs in the inferior colliculus have been reported in the Atoh1-null, Unc5h3-null and Pax6-null mutants (Goldowitz et al., 2000; Jensen et al., 2002; Swanson et al., 2005). In the Atoh1-null and Atoh1 mutant chimeras, PCs expanded into the inferior colliculus when the anterior EGL is devoid of GCs, which suggests that the anterior GCs normally set the cerebellar boundary of PCs (Jensen et al., 2002; Jensen et al., 2004). The importance of anterior GCs in establishing the territorial boundaries of the cerebellum is also demonstrated in the Unc5h3-null and Pax6-null mutants. In the Unc5h3-null and Pax6-null mutants, extracerebellar PCs are accompanied by ectopic GCs (Goldowitz et al., 2000; Swanson et al., 2005). Using experimental mouse chimeras, it has been shown that the GCs are the primary target of Unc5h3 or Pax6 mutations, and extracerebellar PCs are a secondary defect downstream from GC ectopia (Goldowitz et al., 2000; Swanson et al., 2005). Extracerebellar PCs, however, are found in the Wls-cKO despite that GCs remain in the cerebellum. A possible explanation for this observation is that while anterior GCs is critical in establishing the anterior limit of cerebellar boundary, stop signals from the GCs are required for the placement of PCs. Our findings from the Wls-cKO would suggest that the stop signal is regulated downstream of Wnt signaling in the GCs.    4.3.5. Wls/Wnt signaling is critical for the proper placement of cells in cerebellar development Within the cerebellum, the Wls-cKO displays unique misplacements of multiple cell types: 1) Ectopic PCs in the EGL gaps and subpial surface, 2) Ectopic interneurons in the EGL gaps and subpial surface, and 3) Ectopic GC clusters in the cerebellar core. The BGC defects (i.e., lack of scaffold for cell migration) cannot account for these ectopias, as neither the β-104  cateninhGFAP-cKO cerebellum nor mutant cerebella with severe BG phenotypes exhibit these phenotypes (Qiu et al., 2010; Wen et al., 2013). This phenotype does not appear to be simply an effect secondary to the defects of GCs (i.e., the lack of stop signals from GCs) in the Wls-cKO. This is supported by the lack of ectopic interneurons and limited ectopic PCs in the midline observed in the Atoh1-null mutant, where GCs are completely absent (Jensen et al., 2002). These ectopias also cannot simply be due to the loss of Wnt-signaling in the GC, PC or interneurons as these ectopias are not seen in the β-cateninhGFAP-cKO nor the β-cateninNestin-cKO (Schüller and Rowitch, 2007; Wen et al., 2013). What would be a plausible role of Wls in the proper placement of multiple cell types in the cerebellum? It has been observed in neural cell lines and in the cerebellum that Wnt1 regulates the expression of adhesion molecules such as E-cadherin and αN-catenin (Bradley et al., 1993; Shimamura et al., 1994). Adhesion molecules regulate cell-cell interactions (Redies et al., 2011), and in mice, the loss of αN-catenin results in cerebellar hypoplasia (Park et al., 2002). The expression of adhesion molecules would be affected in our Wls-cKO as the secretion of Wnt molecules is inhibited, which would subsequently impair cell-cell interaction, cell migration and cell boundary formation in the developing cerebellum. In fact, such cell adhesion molecules may be the stop signals that do not permit extracerebellar Purkinje cells.  4.3.6. Wls/Wnt signaling regulates the progenitor pools in the RL Although the majority of cell types are present in the Wls-cKO cerebellum, the number of UBCs are highly reduced. Similarly in Atoh1-null and Pax6-null mutants, UBCs are found missing or reduced, respectively [(Englund et al., 2006) and our unpublished data]. Atoh1 is required to specify an RL fate (Yamada et al., 2014). Pax6 is found to regulate the generation of progenitors at the RL, as the Pax6-null mutant displays a smaller progenitor pool (fewer BrdU+ cells) in the RL at the genesis of the UBCs without significant increases in cell death (Yeung et al., 2016). As in the Pax6-null, we also observed a highly diminished RL at E15.5 in the Wls-cKO, suggesting that the UBC progenitor pool may be affected in the RL. In the cortex, Wnt signaling controls the progenitor pool by promoting cell cycle re-entry in the neural precursors (Chenn and Walsh, 2002). The loss of Wnt signaling in our Wls-cKO may lead to premature cell 105  cycle exit, thus, resulting in a reduced progenitor pool for the generation of UBCs at later stage of the development.   4.3.7. Conclusion  In this paper we identify the functional roles of a domain of the rhombic lip that is marked by Wls-positive cells. Relative to other, largely non-overlapping molecular markers of rhombic lip domains (Atoh1, Pax6 and Lmx1a), Wls+ cells are responsible for unique sets of phenotypes, particularly the cerebellar ectopias in the Wls-cKO, that speak to a novel role for Wls-cells in orchestrating the development of the early cerebellar anlage.  4.4. Materials and methods 4.4.1. Mouse strains and husbandry The Nestin-cre mouse strain (B6.Cg-Tg(Nes-cre)1Kln/J), Nes-Cre, was obtained from Jackson Laboratory, Bar Harbor, ME (Jax #003771). Animals were genotyped by standard PCR according to the protocol described by the Jackson Laboratory.   The floxed Wls mouse strain, Wlsflox, was a gift from Richard Lang, University of Cincinnati, and is available from Jackson Laboratory, Bar Harbor, ME (Jax # 012888). Animals were genotyped by standard PCR according to protocol previously described (Carpenter et al., 2010).   We previously generated the Wls-null allele mouse strain, WlsLacZ. The generation, breeding and genotyping protocols of this strain are described previously in detail (Yeung et al., 2014).  Experimental Wls-cKO (Nes-Cre/+, WlsLacZ/flox) mice were generated by the following mating schema: 1) Hemizygous Nes-Cre/+ mice were mated with heterozygous WlsLacZ/+ mice to generate the double heterozygous Nes-Cre/+, WlsLacZ/+ mice. 2) The double heterozygous Nes-Cre/+, WlsLacZ/+ mice were mated to homozygous Wlsflox/flox to generate the experimental control (+/+, Wlsflox/+) and cKO mice.  The morning that a vaginal plug was detected was designated as embryonic day 0.5 (E0.5). All studies were conducted in accord to the protocols approved by Institutional Animal 106  Care and Use Committee and Canadian Council on Animal Care at the University of British Columbia. 4.4.2. Tissue preparation and histology  Tissues were collected at each day from E11.5 to P0. Embryos harvested between E11.5 to E15.5 were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4) for 1 hour at 4°C. Embryos and animals harvested at E16.5 or later were perfused with 4% paraformaldehyde in 0.1 M PB, the brain isolated and further fixed in 4% paraformaldehyde in 0.1 M PB for 1 hour at room temperature. Fixed tissue was rinsed with PBS, followed by cryoprotection with 30% sucrose/PBS overnight at 4°C before embedding in OCT compound. Tissues were sectioned at 12 µM for immunohistochemistry and cryosections were mounted on SuperfrostTM slides (Fisher), air dried at room temperature, and stored at -80°C until used. In all cases, observations were based on a minimum of 3 brains per genotype per experiment.  4.4.3. Immunohistochemistry   Tissue sections were rehydrated in PBS. For brightfield immunohistochemistry endogenous peroxidase activity was inhibited by treating the sections with 1% H2O2 in PBS followed by PBS-T (0.1M PBS/0.1% Triton X-100) rinse. Sections were incubated at room temperature for 20 minutes with blocking solution (1% BSA and 5% normal serum in PBS-T) and subsequently incubated at room temperature overnight with primary antibodies in a humid chamber. Following PBS-T washes the sections were incubated with biotinylated secondary antibodies (at 1:200, Vector Laboratories, Burlingame, CA) and processed for PAP immunohistochemistry using the ABC Kit (Vector Laboratories) according to the manufacturer’s protocol. Slides were dehydrated and coverslips were applied. For immunofluorescence, secondary antibodies labeled with fluorochrome were used to recognize the primary antibodies. The slides were coverslipped with FluorSave (Calbiochem, 345789). Primary antibodies used were as follows: chicken anti-β-GAL (1:10,000; Abcam, Ab9361), rat anti-BrdU (1:300, Abcam, Ab6326), rabbit anti-CALBINDIN (1:1000, Millipore, AB1778), rabbit-anti-active CASPASE-3 (1:500; Abcam, Ab13847), Guinea pig anti-GLAST (1:1000, Millipore, AB1782), mouse anti-NEUN (1:200, Millipore, MAB377), mouse anti-NESTIN (1:100, Millipore, MAB353), rabbit anti-PAX2 (1:200, Invitrogen, 71-6000) rabbit anti-PAX6 (1:200; Covance, PRB-278P), rabbit 107  anti-TBR1 (1:800; Abcam, Ab31940), rabbit-anti-TBR2 (1:800; Millipore, AB2283), rabbit anti-WLS (1:1000, Seven Hills Bioreagents, WLAB-177).  4.4.4. Cell counts and areal analysis We estimated the numbers of CN neuron and UBCs by counting cells positive for the appropriate cell marker (Tbr1 for CN neurons, Tbr2 for UBCs). Cerebellar area and EGL area measures were taken from every 10th section across the half P0 cerebellum with the aid of the Axiocam/Axiovision hardware-software components (Carl Zeiss). In all cases, final numbers were based on a minimum of 3 cerebella per genotype. Statistical significance between control and cKO was determined by two-tailed student’s t-test. 4.4.5. Microscopy Imaging for analysis and photomicroscopy were performed using a Zeiss Axiovert 200M microscope with the Axiocam/Axiovision hardware-software components (Carl Zeiss).    108  Chapter 5 : Conclusion 5.1. Overview of molecular control in cerebellar development The present work aims to elucidate the molecular machinery that controls the development of cerebellum. To this end, I focused on one of the prominent transcription factors, Pax6, and its regulatory network in the cerebellum, which involves molecules such as Wls, Tbr1 and Tbr2. The study of these molecules using knockout mice has revealed the requirements of Pax6 and Wls in cerebellar neurogenesis and lamination. Furthermore, the characterization of the expression of these molecules throughout cerebellar development, in both temporal and spatial aspects, and the examination of the interaction between these molecules, has illuminated a complex patterning and molecular control in the rhombic lip. In the following sections, I will integrate findings from the current work, and provide an overview of the molecular control of cerebellar development.  5.1.1. Cerebellar rhombic lip is comprised of distinct molecular compartments  My characterization of Wls expression in the developing cerebellum has found that Wls-expressing cells are localized to a restricted area within the rhombic lip. This observation prompted me to further investigate the Wls domain in relationship to other known markers of the rhombic lip, such as Atoh1, Pax6 and Lmx1a. In Chapter 2, I performed a set of immunohistochemical analyses to examine the developmental expression pattern of these molecules, and found that these molecules have distinct expression patterns in the rhombic lip of the developing cerebellum. Most importantly, this expression study has identified four molecular compartments in the RL (Summarized in Fig. 5.1A).  The rhombic lip has been classically defined by Atoh1 expression (Ben-Arie et al., 1997). The present study, however, revealed that Atoh1 expression does not label the entire RL but is localized to the epithelial face of the RL that is continuous with the subpial stream and EGL (see Yellow region in Fig. 5.1A) [Chapter 2 and (Yeung et al., 2014)]. This epithelial face is referred to as the exterior face of the RL (eRL) for its subpial position (Altman and Bayer, 1997). Besides 109  Atoh1, cells in the eRL are found to also express Pax6 and INSM1, the RL-lineages specific and granule cell-specific markers, respectively (Chapter 2 and 3). In fact, the eRL is found missing in the Atoh1-null mutant that losses all cerebellar glutamatergic neurons (Ben-Arie et al., 1997; Jensen et al., 2004; Yeung et al., 2014). Thus, previous findings and the current studies indicate that the eRL is Atoh1-dependent, and is made up of cells specified to enter into a RL-lineage and become glutamatergic neurons (i.e. CN neurons and granule cells) (Jensen et al., 2004; Yeung et al., 2014).  Expression of Atoh1 also marks the compartment immediately dorsal to the eRL (see Blue region in Fig. 5.1A). This compartment arises in the RL at E15.5 and expands in size throughout the late embryonic period [Chapter 2 and (Yeung et al., 2014)]. Cells in this compartment are also characterized by a strong expression of Tbr2, Lmx1a and Pax6. The molecules expressed by these cells suggested an UBC identity (Englund et al., 2006). A birthdating analysis performed on the Tbr2+ cells that are born between E15.5-17.5 found that the newly generated Tbr2+ cells remain in the RL for 1-2 days before colonizing the internal granular layer by P10 (Englund et al., 2006). Thus the size expansion of this compartment between E15-P0 reflects the migration route taken by UBCs during development. Furthermore, this compartment is found diminished in mutant cerebella that exhibit a lack or reduction of UBC generation, for example the Atoh1-null, Sey mutant and Wls-cKO [Chapter 3 and 4, (Englund et al., 2006), summarized in Fig. 5.1]. Altogether, the findings indicate that this compartment is a transitory zone colonized by UBCs before the cells migrate through the white matter to the final position at IGL.  The epithelial face on the dorsal side of the RL facing the fourth ventricle is referred as the interior face of the RL (iRL; see Green region in Fig. 5.1A) (Altman and Bayer, 1997). In Chapter 2, I show that the iRL is defined by the strong expression of Wls. I also demonstrate in Chapter 4 that the iRL is Wls-dependent as it is absent in the Wls-cKO (Summarized in Fig. 5.1D). In contrast to the adjacent eRL and UBC transitory zone, the iRL exhibits a different proliferation index and expresses a very low level or absence of Atoh1, Pax6, Lmx1a and Tbr2 (Yeung et al., 2014). Furthermore, the iRL is unaffected in the Atoh1-null that lacks the production of all RL-derivatives [Chapter 2 and (Yeung et al., 2014)]. Thus, unlike eRL and UBC transitory zone, the iRL is not occupied by cells that have committed to a RL-lineage fate. However, the Wls-expressing iRL is found to be crucial for cerebellar development. Chapter 4 110  describes the analysis of Wls-cKO cerebellum, where I observe a disorganization of GCs, manifested by the gaps in EGL and GC ectopia, and a lack of UBCs. These findings indicate that the iRL is important for the development of some glutamatergic RL-lineages in the cerebellum. Interestingly, the GABA-ergic VZ-lineages are also found to be impacted in the Wls-cKO, as manifested by the ectopic PCs and interneurons, as well as aberrant glial cells. Thus, the study of the Wls-cKO illustrates the requirement of iRL in the development of both cerebellar glutamatergic and GABA-ergic neurons. The distal region of the RL is continuous with the roof plate/choroid plexus of the fourth ventricle (distal RL; see Pink region in Fig. 5.1A). In Chapter 2 I show that the distal RL is characterized by Wls and Lmx1a expression, but devoid of Atoh1 and Pax6 expression. However, unlike the iRL, the distal RL is present in the Wls-cKO, despites that the compartment is normally colonized by cells with strong Wls expression (Chapter 4).    In conclusion, these data illustrate the presence of compartments within the cerebellar rhombic lip that are dynamically demarcated by Pax6, Wls, Atoh1, Lmx1a and Tbr2. The observations that these compartments exhibit different cellular properties may shed light on the mechanism underlying the production of neuronal diversity. 111   Figure 5.1. Schematic illustration of distinct molecular compartments in the cerebellar RL and RL phenotypes in Atoh1, Pax6 and Wls mutants.  (A) Wildtype RL at E15.5 displays four molecular distinct compartments, the distal RL, iRL, UBC transitory zone and eRL. (B) The Atoh1-null RL lacks eRL, EGL and UBC transitory zone. (C) The Sey mutant RL exhibits a smaller RL starting at E16.5 and a disrupted UBC transitory zone at the medial RL. (D) The Wls-cKO lacks iRL and UBC transitory zone.   112  5.1.2. Requirement of Pax6 in the development of cerebellar glutamatergic neurons  Beyond the rhombic lip, Pax6 expression continues to label the RL-derivatives: the glutamatergic CN neurons, granule cells and unipolar brush cells (Engelkamp et al., 1999; Englund et al., 2006; Fink et al., 2006). The requirement of Pax6 in granule cell development has been studied extensively (Schmahl et al., 1993a; Engelkamp et al., 1999; Yamasaki et al., 2001; Swanson and Goldowitz, 2011), but the role that Pax6 plays in the other RL-derivatives is not known.   Our Pax6 cerebellar transcriptome analysis found that the cell specific markers for CN neurons and UBCs, Tbr1 and Tbr2, respectively, are downregulated in the Pax6-null mice. As demonstrated in Chapter 3, these two cell types are indeed missing from the Sey cerebellum. I observed that in the Sey cerebellum, the CN neuron progenitors fail to colonize the NTZ and exhibit a significant level of cell death (Chapter 3). This result illustrates the requirement of Pax6 in promoting cell survival in CN neurons. On the other hand, cell proliferation at the RL is highly reduced during the neurogenesis of UBCs (Chapter 3), which indicates a role of Pax6 in regulating the progenitor pool at the RL. In addition, cell death analysis in the present study found that some granule cell progenitors in the Sey cerebellum are undergoing apoptosis, and that cell proliferation at the RL is affected during late granule cell production (Chapter 3). These studies reveal two additional roles for Pax6 in granule cell development: promoting cell survival and regulating progenitor production at the RL.  These studies illustrate the critical roles that Pax6 plays in the development of all cerebellar glutamatergic neurons. Based on these current findings, a revised model of molecular control recognizes a more central role of Pax6 in cerebellar development (Fig. 5.2).  113   Figure 5.2. Schematic model of the molecular regulation in cerebellar development.  Atoh1 is expressed in the RL and all RL-lineages, it is known for its role in specifying RL-cell fate. Subsequently, all RL-lineages expressed Pax6 during development. The present study recognized the critical and multivalent role of Pax6 plays downstream of Atoh1 in the development in all glutamatergic neurons. Expression of Wls is restricted to the iRL in the developing cerebellum. The studies of Sey and Wls-cKO mutants illustrated the reciprocal repressive interaction between Pax6 and Wls: Pax6 suppresses Wls in the EGL while Wls suppresses Pax6 in the distal RL. Study of the Wls-cKO also suggested that Wls is important for RL progenitor pool replenishment, RL-lineages development and VZ-lineages organization.  5.1.3. Wls regulates multiple developmental processes in cerebellar development  Wls expression is highly localized to the interior face and the distal tip of the rhombic lip during cerebellar development. In Chapter 2, however, we observed that in the absence of Pax6, i.e., the Sey cerebellum, Wls expression expands beyond the rhombic lip into the nascent EGL 114  (Yeung et al., 2014). These observations suggest that Wls expression is normally restricted to the rhombic lip under tight molecular control during cerebellar development.  To elucidate the role of the Wls expressing cells in the rhombic lip, I examined the Wls conditional knockout and the phenotypes are described in Chapter 4. The earliest phenotype in the Wls-cKO is the lack of Wls expressing cells starting at E12.5, and then the reduction in iRL size observed around E13.5. Subsequently, the lack of Wls expression at the RL affects the development of the RL-derived granule cells and UBCs. Organization of granule cells is highly disrupted as manifested by gaps in the EGL and ectopic granule cell clusters in the cerebellar white matter. The population of UBCs is diminished in the Wls-cKO. Surprisingly, despite the highly restricted expression of Wls in the RL, the VZ-lineages in the Wls-cKO are also affected. Ectopic Purkinje cells are observed at the inferior colliculus, EGL and the cerebellar subpial surface. Interneurons are also ectopically found in the EGL and cerebellar subpial surface. Aberrant Bergmann glia fibers are observed in the Wls-cKO whose the endfeet fail to make contact with the cerebellar pial surface. Molecularly, I demonstrated in Chapter 2 that Wls expression expanded into the nascent EGL in the absence of Pax6. This finding in the Sey cerebellum indicates that Pax6 normally suppresses the expression of Wls. On the other hand, I found evidence in the Wls-cKO that Wls also suppresses the expression of Pax6 in the cerebellum. In the distal RL of wildtype cerebellum, Wls is strongly expressed while Pax6 expression is excluded from this region (Chapter 2), however, Pax6-positive cells colonized the distal RL in the Wls-cKO (Chapter 4). These results illustrate the reciprocal repressive regulation between Pax6 and Wls in the cerebellum (Fig. 5.2).   The studies of Wls-cKO reveals not only the multiple roles of Wls in the development of cerebellar neurons, but the findings also suggest a complex molecular control exerted by the rhombic lip on the adjacent germinal zones during development (Fig. 5.1 & 5.2).   5.2. Future directions 5.2.1. Is the Wls-positive domain a RL progenitor pool?   While the development of cerebellar neurons has largely been mapped out temporally, spatially and molecularly, an important question that remains is how are the RL progenitor cells replenished during development. The Atoh1 fate mapping study shows that Atoh1-expressing 115  progenitor cells are committed to leave the RL, and will not leave any Atoh1-positive cells in the RL to replenish the progenitor pool (Machold and Fishell, 2005). Thus, cells that replenish the supply of Atoh1-positive RL progenitors must arise from a nearby Atoh1-negative domain.  The Wls+/Atoh1- iRL identified in Chapter 2 may be the source of the RL progenitor cells. This hypothesis is based on several observations made in the present works. First of all, this domain is Atoh1-negative and spatially adjacent to the Atoh1-positive eRL and UBC transitory zone. It is also shown in the Atoh1-null cerebellum that the Wls+ iRL is unaffected, which may suggest Wls is upstream of Atoh1 in the RL lineages (Chapter 2). Furthermore, cells in the iRL co-expressed Nestin (Chapter 4), the marker of neural stem cells (Lendahl et al., 1990). As demonstrated with a BrdU assay, cells in the iRL are proliferative during development (Chapter 2). Interestingly, the study of Wls expression with βgal reporter found the presence of βgal+ cells in the subpial stream (Chapter 2). Given the longer persistence of the βgal protein, this observation would suggest that cells of the Wls-lineage feed into the Atoh1 RL progenitor pool. This idea can be addressed by gene tracing the Wls-expressing cell lineages in mice. In order to trace the Wls-expressing cell lineages, a transgenic allele that expresses Cre recombinase under the control of Wls will be constructed. When the Wls-cre allele is present with a floxed reporter allele (i.e., reporter gene flanked by a loxP-STOP-loxP sequence), Cre will remove the stop sequence and allow the reporter to permanently label the Wls-expressing cells and their progenies. Subsequently, the identity of the reporter-positive Wls-lineages can be analyzed with cell specific markers, for instance Atoh1 for RL-lineages, Tbr1 for CN neurons, Pax6 and Insm1 for granule cells, and Tbr2 for UBCs. The overlap between reporter-positive Wls-lineages and the aforementioned cell specific markers would support that Wls+ iRL contribute to the Atoh1 RL progenitor pool. Conversely, the absence of reporter-positive Wls-lineages in the Atoh1-positive progenitors would indicate that the Wls+ iRL do not produce RL-derivatives.  It is observed in the Wls-cKO cerebellum that RL-lineages (CN neurons and granule cells) are produced, but the size of iRL is diminished in size by E13.5 and the iRL is largely missing by E15.5, and the late born UBCs are significantly reduced in number (Chapter 4). If Wls+ iRL is the origin of the stem cell population that replenish the Atoh1 RL progenitor cells, what function of Wls would be suggested by the Wls-cKO RL phenotypes? The presence of RL-derivatives in the mutant would suggest that stem cells still exist in the absence of Wls. However, the subsequent depletion of cells in the mutant iRL would suggest that Wls normally play a role in 116  maintaining the stem cell pool, either by regulating cell death, cell cycle length or cell cycle exit. Enhanced cell death can be assessed by immunolabeling with anti-Caspase 3. To test if cell cycle is lengthened, cell cycle length can be analyzed with BrdU and iododeoxyuridine (IdU) double-labeling protocols as described in a previous study (Martynoga et al., 2005). Premature cell cycle exit can be determined by BrdU incorporation and double-labeling with proliferating cell markers such as PCNA or Ki67, as previously described (Farhy et al., 2013).   5.2.2. How does Pax6 regulate different cellular functions in different rhombic lip-derivatives? One intriguing finding from close examination of the Sey cerebellum is that Pax6 regulates different functions in the development of RL-lineages (Chapter 3). The diversity of Pax6 function could be attributed partly to the Pax6 isoforms that arise from alternative transcription and/or alternative splicing. The Pax6 gene has 16 exons spanning approximately 30kb, which encodes a 422 amino-acid protein that contains a 128 amino-acid bipartite paired domain (PD) and a 61 amino-acid homeodomain (HD). Four transcription start sites (P0, P1, Pα and P4) have been identified in the mouse Pax6 gene, and alternative transcription yields different peptides: protein derived from P0 and P1 promoters consists of both PD and HD, while transcripts derived from Pα and P4 promoters encode a truncated Pax6 variant that lacks the PD (Kammandel et al., 1999; Kleinjan et al., 2004). Another Pax6 isoform is generated by post-transcriptional alternative splicing of exon 5a, which has 14 amino-acid segment inserted into the PD that affects the DNA-binding property of the Pax6 paired domain (Epstein et al., 1994). It has been shown by functional analysis of the distinct binding domains (PD and HD) in Pax6, that the PD is crucial for neurogenesis and cell proliferation in the developing forebrain, while the HD only plays a minor role in molecular boundary formation (Haubst et al., 2004). Thus, expression of Pax6 could lead to different functions depending on the isoforms expressed. In fact, study of mRNA expression in the developing postnatal cerebellum has showed that alternative Pax6 isoforms are differentially expressed (Pal et al., 2011). Therefore, it is important to determine the Pax6 isoforms that are expressed during embryonic development to better understand the cell-specific Pax6 function in each of the RL-derivatives. To this end, the expression of Pax6 isoforms can be determined by quantitative RT-PCR. To measure the Pax6 isoforms expressed 117  by each RL-derivative, different progenitor can be obtained by laser capture microdissection (i.e., CN neuron progenitors in the E11 subpial stream, granule cell progenitors in the E15 EGL and UBCs in the E18 UBC transitory zone), mRNA can then be isolated from each cell type and the alternative Pax6 transcript analyzed with quantitative RT-PCR.  Pax6 has been found to interact with other molecules in regulating target gene expression. In lens development, the successful binding of Pax6 to the promoter of δ-crystallin requires the co-binding of Sox2, while Pax6 or Sox2 alone binds poorly to the promoter (Kamachi et al., 2001). A recent study of Pax6-bound promoters in neural progenitor cells revealed that some of these promoters also associate with Sox2 (Thakurela et al., 2016). Furthermore, the genes bound by Pax6 and Sox2 are regulated differently from the genes that are bound by either Pax6 and Sox2 alone (Thakurela et al., 2016). These findings indicate that the interaction of Pax6 and other transcription factors (or molecules) leads to the binding of alternative target genes, thus resulting in different functions of Pax6. In the cerebellum, Sox2 is strongly expressed in the VZ, RL and subpial stream at E11.5, but is absent from the EGL and RL at later ages, while still moderately expressed in the VZ beyond E13.5 (Allen Brain Atlas, http://developingmouse.brain-map.org). The cerebellar expression pattern of Sox2 would suggest that Pax6 may activate different transcripts in the RL and CN neuron progenitors (in which Pax6 and Sox2 are co-expressed) as compared to GC and UBC progenitors (which only express Pax6). Meis2 is another molecule that is found to form a complex with Pax6, together Pax6 and Meis2 bind the DCX promoter and promote neurogenesis in the adult subventricular zone (Agoston et al., 2014). In the developing cerebellum, Meis2 is only expressed in the CN neurons and completely absent from GC and UBCs (Allen Brain Atlas, http://developingmouse.brain-map.org), suggesting that Pax6 may exert different effects on these cell types by synergizing with different molecular partners. To explore the molecules that interact with Pax6 in the different RL-derivatives, co-immunoprecipitation can be used to detect Pax6-bound molecules from the E11.5 cerebellum (when a majority of Pax6-expressing cells are CN neuron progenitors), E14-15 cerebellum (GC progenitors) and E18.5 RL (UBCs).  Collectively, previous studies (Haubst et al., 2004; Thakurela et al., 2016) illustrate that variations in Pax6 function can arise from the expression of Pax6 isoforms and the interaction with molecular partners, as well as the combination of both. This highlights the need to elucidate 118  what other molecules regulate and interact with Pax6 in each RL-lineages in order to fully understand the molecular regulation of cerebellar development.   5.2.3. How is Wls related to Wnt signaling in the cerebellum? The discovery of Wls originated from Drosophila studies that aimed to identify gene involves in Wnt/Wingless (Wg) signaling (Bartscherer et al., 2006; Banziger et al., 2006). These studies showed that Wls mutant flies exhibit segment polarity and wing-margin phenotypes, which phenocopied other mutants of the Wg signaling pathway and suggests that Wls is a member of the Wnt/Wg signaling pathway (Bartscherer et al., 2006; Banziger et al., 2006). In addition, clonal analysis in wing imaginal discs found that Wg is retained in Wls mutant cells, indicating that Wls is required for Wg secretion in the Wg-producing cells without affecting Wg production (Bartscherer et al., 2006; Banziger et al., 2006). Furthermore, experiments in cultured cells showed that Wls mutations do not affect the secretion of Sonic hedgehog (Shh) (Banziger et al., 2006) or the expression of Hedgehog (Hh) target genes (Bartscherer et al., 2006), but abolished the secretion of Wnt1, Wnt3a and Wnt5a (Banziger et al., 2006), which demonstrated that Wls is specific for Wnt secretion. Similarly, in previous work with the Wls-null mouse a loss of primitive streak was found which resembles the phenotype in Wnt3-null mice (Liu et al., 1999b; Fu et al., 2011). The Wls-null embryos also showed an accumulation of Wnt3/3a and a lack of downstream gene expression, such as β-catenin and Axin2, suggesting that the deletion of Wls results in the failure of Wnt secretion and leads to the functional inactivation of Wnt signaling (Fu et al., 2011). Taken together, these findings indicate that the role of Wls in regulating Wnt secretion is highly conserved across species.  Given the role of Wls in Wnt secretion, the Wls-expressing domain in the RL may serve as a source of Wnts that act on adjacent epithelia (i.e., RL and VZ). Wnt/Wls expressing cells in signaling centers in cortex and midbrain, (ie, the cortical hem and isthmus, respectively) regulates the development of adjacent tissues (McMahon and Bradley, 1990; Thomas and Capecchi, 1990; Lee et al., 2000; Backman et al., 2005; Yu et al., 2010; Carpenter et al., 2010). Wnt3a expressed at the cortical hem is crucial in inducing hippocampus from the adjacent neuroepithelium, and is particularly needed for progenitor pool expansion through cell proliferation (Lee et al., 2000). While in the isthmus, the release of Wnt1 by Wls is required for 119  the induction of midbrain and cerebellum structures by patterning the adjacent mesencephalon and rhombomere 1 (Thomas and Capecchi, 1990; McMahon and Bradley, 1990; Carpenter et al., 2010). Interestingly, in the cerebellum, RL cells express Wnt1 (Hagan and Zervas, 2012), Wnt3a (Louvi et al., 2007) and Wnt2b (Allen Brain Atlas, http://developingmouse.brain-map.org) during embryonic development, but their function in cerebellar development remains unclear.  In the Wls-cKO cerebellum, I demonstrate that neurons arising from the VZ and RL are affected (Chapter 4). The Wls-cKO mutant phenotypes are similar to phenotypes exhibited by mutants with a deleted β-catenin gene (the main mediator of canonical Wnt signaling) in either the RL- or VZ-lineages,  (Schüller and Rowitch, 2007; Wen et al., 2013). These findings would suggest that both the VZ- and RL-derived cells receive Wnt signals secreted by the Wls-expressing iRL. To test this idea, it will first need to be determined whether the VZ- and/or RL-derived cells are Wnt responsive cells. To this end, Wnt reporter mice such as the BAT-gal or TOP-gal lines, in which expression of β-galactosidase is driven under the control of nuclear β-catenin and lymphoid enhancer factor/T cell factor (LEF/TCF) binding elements (DasGupta and Fuchs, 1999; Maretto et al., 2003), will be examined for reporter activity in the VZ- and RL-derived lineages. The presence of reporter activity in either or both lineages would indicate that Wnt normally acts on these cells and activates the canonical Wnt pathway (mediated through β-catenin). Conversely, the absence of reporter activity would suggest that either these cells are not responsive to Wnt, or the cells activate the non-canonical Wnt pathway upon receiving Wnt. Subsequently, to test whether the Wls-expressing iRL is the Wnt signaling center that acts on the adjacent epithelia (i.e., RL and VZ), the Wnt reporter mice will be crossed to the Wls-cKO mice to determine if the Wnt activity in Wnt responsive cells is abolished in the lack of Wls. As β-catenin is a transcriptional activator, it would be of great interest to determine what transcripts are activated downstream of Wnt signaling in the cerebellum. To this end, a transcriptome analysis can be performed on the wildtype and Wls-cKO cerebellum to identify genes that are regulated by Wnt signaling.   The Wls-cKO cerebellum, however, displays additional phenotypes such as the acellular gaps in the EGL and ectopic PCs/interneurons, which are not observed in the β-catenin mutants with the inactivated canonical Wnt signaling in VZ- or RL-lineages. This raises the possibility that Wls also acts through non-canonical β-catenin-independent Wnt signaling pathways in cerebellar development. One of these pathways is the Wnt/Planar cell polarity (PCP) pathway 120  that coordinates cell polarity within the plane of a tissue, and has been implicated in cell migratory events such as the migration of facial branchiomotor (FBM) neurons in mice and zebrafish (Tissir and Goffinet, 2013; Davey et al., 2016). The canonical Wnt and Wnt/PCP pathways are activated by different Wnt ligands (McNeill and Woodgett, 2010). Although the Wnt receptors Frizzled (Fz) and cytoplasmic adaptor Dishevelled (Dvl) are shared by both the canonical Wnt and Wnt/PCP pathways, activation of these pathways results in different outcomes. Activation of canonical Wnt pathway stabilizes β-catenin and promotes the transcription of downstream target genes. On the other hand, activation of Wnt/PCP pathway induces the inter- and intra-cellular interactions between core PCP proteins (e.g. Vangl, Fz and Dvl), and leads to the separate localization of two PCP complexes to the opposite sides of the cell (Yang and Mlodzik, 2015). This asymmetrical localization of PCP proteins establishes the planar polarity axis, and may facilitate directed cell migration. To determine if the Wnt/PCP pathway is involved in neuronal migration of the developing cerebellum, the subcellular localization of core PCP proteins within migrating neurons (e.g. granule cell progenitors in the EGL) will be examined. The localization of Vangl and Fz to opposite sides of the cells would suggest the involvement of the PCP pathway.   5.2.4. How does Pax6 and Wls interact?  The Sey mutant cerebellum displays an expansion of Wls-expression into the nascent EGL (Chapter 2).  Conversely, cells positive for Pax6 are ectopically found in the distal RL of the Wls-cKO mutant (Chapter 4). The aberrant expression patterns exhibited by each of the mutants indicate a reciprocal repressive interaction between Pax6 and Wls in the normal developing cerebellum. Reciprocal repressive interactions have been identified in other CNS regions such as the isthmus (Millet et al., 1999; Broccoli et al., 1999) and spinal cord (Ericson et al., 1997).  The present work is the first to describe such interactions in the cerebellum. Additional experiments will elucidate the nature of this novel reciprocal repressive interaction between Pax6 and Wls in cerebellar development.  One of the key questions to be addressed in understanding this reciprocal repressive interaction is how does Pax6 repress Wls or vice versa? During the development of cortex and eye, Pax6 is found to positively regulate the expression of secreted Frizzled-related proteins 121  (sFRP), Wnt signaling inhibitors (Kim et al., 2001; Machon et al., 2010). The other well characterized secreted Wnt inhibitors are the Dickkopf (Dkk) family proteins. These Dkk proteins have been demonstrated in cell culture to be positively regulated by Pax6 (Forsdahl et al., 2014). In fact, our Pax6 cerebellar transcriptome analysis (www.cbgrits.org) revealed that sFRP2 and Dkk3 transcripts are significantly down-regulated in the Sey mutant (Table 1). This suggests that in normal cerebellar development Pax6 actively suppresses Wnt signaling by up-regulating Wnt inhibitors. The suppression of Wnt activity in turn down-regulates Wls expression, as it has been shown that Wls is a downstream target of Wnt signaling (Fu et al., 2009). The idea of Pax6 regulation of Wnt signaling can be addressed by first examining the expression pattern of sFRP2 and Dkk3 in the wildtype and Sey cerebella. Subsequently, to test whether sFRP2 or Dkk3 suppresses Wls expression, sFRP2 or Dkk3 can be overexpressed using in utero electroporation into the Sey mutant cerebellum and examine the expression of Wls in the EGL. If overexpressing sFRP2 or Dkk3 results in the rescue (i.e., reduction) of Wls expression in the Sey EGL, the observation would provide support of the notion that sFRP2 and/or Dkk3 mediate the suppression of Wls by Pax6.  On the other hand, the regulation of Wls on Pax6 has not been studied. Early work that examined β-catenin in corticogenesis demonstrated, using chromatin immunoprecipitation (ChIP) and luciferase assay in vitro, that β-catenin binds to the Pax6 promoter and activates Pax6 transcription (Gan et al., 2014). These findings suggest that Wnt promotes Pax6 expression, while my work indicates that Wls suppresses Pax6 expression. These opposing results observed in the cerebellum and cortex might indicate that the regulatory mechanisms underlying the interaction between Pax6 and Wls (and Wnt signaling) are different in these two brain regions. One potential area of examination is the CCCTC binding factor (CTCF) zinc finger protein which has been demonstrated to bind the Pax6 promoter and suppress Pax6 transcription in cornea and embryonic stem cells (Li and Lu, 2005; Gao et al., 2011). Whether Wls and/or Wnt signaling regulates expression of CTCF in the cerebellar RL could be explored. I would first confirm whether CTCF is expressed in the wildtype cerebellum, and if so whether its expression is altered in the Wls-cKO cerebellum. If CTCF is regulated by Wls, then it would be of interest to determine if CTCF affects Pax6 expression. To look at this possibility, CTCF can be overexpressed in the RL cells of the Wls-cKO and one outcome to examine is the presence of ectopic Pax6 cells. 122   Table 5.1. Genes differentially expressed in the Pax6-null Sey cerebellum.   Fold change p-value Gene E13.5 E15.5 E18.5 E13.5 E15.5 E18.5 Sfrp2 -1.05 -1.47 -1.47 0.31 0.03 7.82x10-5 Dkk3 -1.19 -1.54 -1.66 0.02 6.34x10-3 1.56x10-4 Fold changes are normalized raw intensity values of the Sey mutant expression compared to wildtype expression; negative values indicate downregulation in mutant.  5.2.5. Relationship between Pax6 and autism  The cerebellum is well established for its role in motor coordination, and as expected, cerebellar malformations are often associated with motor dysfunctions. However, an increasing number of studies has focused on the association between cerebellar malformations and autism spectrum disorder (ASD) (Rogers et al., 2013; Becker and Stoodley, 2013). Clinically, ASD is found in a subset of children with cerebellar malformations, such as: Joubert syndrome, characterized by cerebellar vermis hypoplasia (Ozonoff et al., 1999); Dandy-Walker malformation, characterized by reduced cerebellar vermis size (Aldinger and Doherty, 2016) and tuberous sclerosis where some patients present with cerebellar lesions (Sundberg and Sahin, 2015). Anatomically, postmortem examination of ASD patients have found several cerebellar abnormalities including the reduction in number of Purkinje cells, granule cells or cerebellar nuclear cells (Rogers et al., 2013; Becker and Stoodley, 2013). Recently, a link between Pax6 and ASD has been suggested, as a novel Pax6 mutation has been identified in a family with familial aniridia and ASD (Davis et al., 2008). Furthermore, rats with a Pax6 mutation are observed to display abnormal social behaviors (Umeda et al., 2010). The Pax6 mutant phenotypes described in the present work will provide insights into the link between Pax6 and ASD.  5.2.6. Cerebellum and medulloblastoma  Medulloblastoma is the most common malignant pediatric brain tumor of the posterior fossa, and is thought to arise from granule cell precursors of the cerebellum. Recent advances in 123  gene expression profiling have led to the identification of subgroups that are characterized by unique genetic aberrations (Thompson et al., 2006), and current consensus classifies medulloblastoma into four main molecular subgroups: Wnt, Shh, Group 3, and Group 4 (Taylor et al., 2012). The Wnt subgroup is characterized by activated mutations in the canonical Wnt signaling pathway, which includes mutations in the APC and CTNNB1 genes (CTNNB1 encodes β-catenin) (Thompson et al., 2006). In addition to the assumed cerebellar origin, recent work has demonstrated that the Wnt subgroup can arise from cells of the dorsal brainstem, i.e., from outside the cerebellum (Gibson et al., 2010). Gibson and his group noted that signature genes of the Wnt subgroup medulloblastoma are predominately expressed in the lower rhombic lip and dorsal brainstem (Gibson et al., 2010). Furthermore, transgenic mouse models (Atoh1-Cre+/-; Ctnnb1+/lox(ex3) or Math1-cre; Catnblox(ex3)) with aberrant β-catenin activation in granule cell progenitors did not exhibit enhanced cell proliferation and did not develop tumors (Gibson et al., 2010; Pei et al., 2012). In contrast, medulloblastoma was found in a different mouse model (Blbp-Cre+/-; Ctnnb1+/lox(ex3)) that activated β-catenin in the dorsal brainstem (Gibson et al., 2010). In line with these findings, my work has found no changes in cell proliferation in the cerebellar granule cell progenitors when Wls is inactivated from the cerebellar rhombic lip. However, Wnt signaling may be indirectly involved in medulloblastomas that arise within the cerebellum by regulating Atoh1 expression. Atoh1 is found to be highly expressed in some cases of medulloblastoma, especially in the Shh subgroup (Salsano et al., 2004; Thompson et al., 2006). It has been reported that Atoh1 expression in granule cell progenitors maintains the mitogenic response to Shh signaling, and the loss of Atoh1 expression abolishes the Shh-induced cell proliferation and prevents medulloblastomas from arising (Flora et al., 2009; Ayrault et al., 2010). WNT3 had been shown to be able to downregulate Atoh1 expression in granule cell progenitors purified from postnatal cerebellum (Anne et al., 2013). Wnt signaling may downregulate Atoh1 (or Hath1, the human homolog of Atoh1) by targeting Atoh1 to degradation through the ubiquitin-proteasome pathway, as previously demonstrated in colon cancer cells (Tsuchiya et al., 2007). Thus, it would be of great interest to determine if mutations that inactivate Wnt signaling exist in the Shh subgroup of medulloblastoma. This information will be invaluable not only for the further stratification of molecular subtype, but for the development of diagnostic tools, clincial prognostication and even therapeutic intervention. However, given the requirement of Wls, and perhaps Wnt signaling, in early cerebellar development as reported in 124  my thesis, it is necessary to further delineate the role of Wnt signaling plays in different developmental stages.  5.3. Concluding remarks The present study of Pax6 and its regulatory network has revealed several novel findings: 1) the molecular compartmentalization in rhombic lip during early cerebellar development demarcated by Pax6, Wls and other rhombic lip markers; 2) the requirement of Pax6 in the development of all glutamatergic neurons in the cerebellum; 3) the reciprocal repressive interaction between Pax6 and Wls; and 4) the requirement of Wls in development of RL- and VZ-lineages and the lamination of cerebellum.  These findings greatly enhance our knowledge of early events in cerebellar development and expand our understanding of the molecular regulation underpinning cerebellar development. The current work also uncovers the interaction between Pax6 and Wls in patterning the germinal zone during development. Furthermore, as Pax6 and Wls are co-expressed in other brain regions during development, it is hoped that this work will serve as guideposts to studies on the molecular bases of brain development.        125  References Ackerman SL, Kozak LP, Przyborski SA, Rund LA, Boyer BB, Knowles BB (1997) The mouse rostral cerebellar malformation gene encodes an UNC-5-like protein. Nature 386:838-842. Adams KA, Maida JM, Golden JA, Riddle RD (2000) The transcription factor Lmx1b maintains Wnt1 expression within the isthmic organizer. Development 127:1857-1867. Agoston Z, Heine P, Brill MS, Grebbin BM, Hau AC, Kallenborn-Gerhardt W, Schramm J, Gotz M, Schulte D (2014) Meis2 is a Pax6 co-factor in neurogenesis and dopaminergic periglomerular fate specification in the adult olfactory bulb. Development 141:28-38. Akazawa C, Ishibashi M, Shimizu C, Nakanishi S, Kageyama R (1995) A mammalian helix-loop-helix factor structurally related to the product of drosophila proneural gene atonal is a positive transcriptional regulator expressed in the developing nervous system. Journal of Biological Chemistry 270:8730-8738. Alder J, Cho NK, Hatten ME (1996) Embryonic precursor cells from the rhombic lip are specified to a cerebellar granule neuron identity. Neuron 17:389-399. Aldinger KA, Doherty D (2016) The genetics of cerebellar malformations. Semin Fetal Neonatal Med 21:321-332. Altman J, Bayer SA (1997) Development of the cerebellar system: In relation to its evolution, structure, and functions. Boca Raton: CRC Press. 126  Anne SL, Govek EE, Ayrault O, Kim JH, Zhu X, Murphy DA, Van Aelst L, Roussel MF, Hatten ME (2013) WNT3 inhibits cerebellar granule neuron progenitor proliferation and medulloblastoma formation via MAPK activation. PLoS One 8:e81769. Arner E et al (2015) Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells. Science . Aruga J, Inoue T, Hoshino J, Mikoshiba K (2002) Zic2 controls cerebellar development in cooperation with Zic1. The Journal of Neuroscience 22:218-225. Aruga J, Minowa O, Yaginuma H, Kuno J, Nagai T, Noda T, Mikoshiba K (1998) Mouse Zic1 is involved in cerebellar development. The Journal of Neuroscience 18:284-293. Ayrault O, Zhao H, Zindy F, Qu C, Sherr CJ, Roussel MF (2010) Atoh1 inhibits neuronal differentiation and collaborates with Gli1 to generate medulloblastoma-initiating cells. Cancer Res 70:5618-5627. Backman M, Machon O, Mygland L, van den Bout CJ, Zhong W, Taketo MM, Krauss S (2005) Effects of canonical wnt signaling on dorso-ventral specification of the mouse telencephalon. Dev Biol 279:155-168. Bally-Cuif L, Wassef M (1994) Ectopic induction and reorganization of wnt-1 expression in quail/chick chimeras. Development 120:3379-3394. Bally-Cuif L, Alvarado-Mallart RM, Darnell DK, Wassef M (1992) Relationship between wnt-1 and en-2 expression domains during early development of normal and ectopic met-mesencephalon. Development 115:999-1009. 127  Banziger C, Soldini D, Schutt C, Zipperlen P, Hausmann G, Basler K (2006) Wntless, a conserved membrane protein dedicated to the secretion of wnt proteins from signaling cells. Cell 125:509-522. Bartscherer K, Pelte N, Ingelfinger D, Boutros M (2006) Secretion of wnt ligands requires evi, a conserved transmembrane protein. Cell 125:523-533. Becker EBE, Stoodley CJ (2013) Chapter one - autism spectrum disorder and the cerebellum. Int Rev Neurobiol 113:1-34. Ben-Arie N, Hassan BA, Bermingham NA, Malicki DM, Armstrong D, Matzuk M, Bellen HJ, Zoghbi HY (2000) Functional conservation of atonal and Math1 in the CNS and PNS. Development 127:1039-1048. Ben-Arie N, Bellen HJ, Armstrong DL, McCall AE, Gordadze PR, Guo Q, Matzuk MM, Zoghbi HY (1997) Math1 is essential for genesis of cerebellar granule neurons. Nature 390:169-172. Blank MC, Grinberg I, Aryee E, Laliberte C, Chizhikov VV, Henkelman RM, Millen KJ (2011) Multiple developmental programs are altered by loss of Zic1 and Zic4 to cause dandy-walker malformation cerebellar pathogenesis. Development 138:1207-1216. Bradley RS, Cowin P, Brown AM (1993) Expression of wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion. The Journal of Cell Biology 123:1857-1865. Broccoli V, Boncinelli E, Wurst W (1999) The caudal limit of Otx2 expression positions the isthmic organizer. Nature 401:164-168. 128  Carpenter AC, Rao S, Wells JM, Campbell K, Lang RA (2010) Generation of mice with a conditional null allele for wntless. Genesis 48:554-558. Chellappa R, Li S, Pauley S, Jahan I, Jin K, Xiang M (2008) Barhl1 regulatory sequences required for cell-specific gene expression and autoregulation in the inner ear and central nervous system. Molecular and Cellular Biology 28:1905-1914. Cheng FY, Huang X, Sarangi A, Ketova T, Cooper MK, Litingtung Y, Chiang C (2012) Widespread contribution of Gdf7 lineage to cerebellar cell types and implications for hedgehog-driven medulloblastoma formation. PLoS One 7:e35541. Chenn A (2008) Wnt/beta-catenin signaling in cerebral cortical development. Organogenesis 4:76-80. Chenn A, Walsh CA (2002) Regulation of cerebral cortical size by control of cell cycle exit in neural precursors. Science 297:365-369. Chi CL, Martinez S, Wurst W, Martin GR (2003) The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development 130:2633-2644. Chizhikov VV, Lindgren AG, Currle DS, Rose MF, Monuki ES, Millen KJ (2006) The roof plate regulates cerebellar cell-type specification and proliferation. Development 133:2793-2804. Chizhikov VV, Lindgren AG, Mishima Y, Roberts RW, Aldinger KA, Miesegaes GR, Currle DS, Monuki ES, Millen KJ (2010) Lmx1a regulates fates and location of cells originating from the cerebellar rhombic lip and telencephalic cortical hem. Proc Natl Acad Sci U S A 107:10725-10730. 129  Chung SH, Marzban H, Hawkes R (2009) Compartmentation of the cerebellar nuclei of the mouse. Neuroscience 161:123-138. Crossley PH, Martin GR (1995) The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121:439-451. Crossley PH, Martinez S, Martin GR (1996) Midbrain development induced by FGF8 in the chick embryo. Nature 380:66-68. Dahmane N, Ruiz-i-Altaba A (1999) Sonic hedgehog regulates the growth and patterning of the cerebellum. Development 126:3089-3100. DasGupta R, Fuchs E (1999) Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126:4557-4568. Davey CF, Mathewson AW, Moens CB (2016) PCP signaling between migrating neurons and their planar-polarized neuroepithelial environment controls filopodial dynamics and directional migration. PLoS Genet 12:e1005934. Davidson KC, Adams AM, Goodson JM, McDonald CE, Potter JC, Berndt JD, Biechele TL, Taylor RJ, Moon RT (2012) Wnt/beta-catenin signaling promotes differentiation, not self-renewal, of human embryonic stem cells and is repressed by Oct4. Proc Natl Acad Sci U S A 109:4485-4490. Davis LK, Meyer KJ, Rudd DS, Librant AL, Epping EA, Sheffield VC, Wassink TH (2008) Pax6 3' deletion results in aniridia, autism and mental retardation. Hum Genet 123:371-378. 130  DiCicco-Bloom E, Friedman WJ, Black IB (1993) NT-3 stimulates sympathetic neuroblast proliferation by promoting precursor survival. Neuron 11:1101-1111. Duggan A, Madathany T, de Castro SCP, Gerrelli D, Guddati K, García-Añoveros J (2008) Transient expression of the conserved zinc finger gene INSM1 in progenitors and nascent neurons throughout embryonic and adult neurogenesis. J Comp Neurol 507:1497-1520. Engelkamp D, Rashbass P, Seawright A, van Heyningen V (1999) Role of Pax6 in development of the cerebellar system. Development 126:3585-3596. Englund C, Fink A, Lau C, Pham D, Daza RA, Bulfone A, Kowalczyk T, Hevner RF (2005) Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia, intermediate progenitor cells, and postmitotic neurons in developing neocortex. J Neurosci 25:247-251. Englund C, Kowalczyk T, Daza RAM, Dagan A, Lau C, Rose MF, Hevner RF (2006) Unipolar brush cells of the cerebellum are produced in the rhombic lip and migrate through developing white matter. J Neurosci 26:9184-9195. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, Maas RL (1994) Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes & Development 8:2022-2034. Ericson J, Rashbass P, Schedl A, Brenner-Morton S, Kawakami A, van Heyningen V, Jessell TM, Briscoe J (1997) Pax6 controls progenitor cell identity and neuronal fate in response to graded shh signaling. Cell 90:169-180. 131  Espinosa JS, Luo L (2008) Timing neurogenesis and differentiation: Insights from quantitative clonal analyses of cerebellar granule cells. The Journal of Neuroscience 28:2301-2312. Estivill-Torrus G, Pearson H, van Heyningen V, Price DJ, Rashbass P (2002) Pax6 is required to regulate the cell cycle and the rate of progression from symmetrical to asymmetrical division in mammalian cortical progenitors. Development 129:455-466. Farhy C, Elgart M, Shapira Z, Oron-Karni V, Yaron O, Menuchin Y, Rechavi G, Ashery-Padan R (2013) Pax6 is required for normal cell-cycle exit and the differentiation kinetics of retinal progenitor cells. PLoS One 8:e76489. Fink AJ, Englund C, Daza RA, Pham D, Lau C, Nivison M, Kowalczyk T, Hevner RF (2006) Development of the deep cerebellar nuclei: Transcription factors and cell migration from the rhombic lip. J Neurosci 26:3066-3076. Flora A, Klisch TJ, Schuster G, Zoghbi HY (2009) Deletion of Atoh1 disrupts sonic hedgehog signaling in the developing cerebellum and prevents medulloblastoma. Science 326:1424-1427. Florio M, Leto K, Muzio L, Tinterri A, Badaloni A, Croci L, Zordan P, Barili V, Albieri I, Guillemot F, Rossi F, Consalez GG (2012) Neurogenin 2 regulates progenitor cell-cycle progression and purkinje cell dendritogenesis in cerebellar development. Development 139:2308-2320. Forsdahl S, Kiselev Y, Hogseth R, Mjelle JE, Mikkola I (2014) Pax6 regulates the expression of Dkk3 in murine and human cell lines, and altered responses to wnt signaling are shown in FlpIn-3T3 cells stably expressing either the Pax6 or the Pax6(5a) isoform. PLoS One 9:e102559. 132  Fu J, Ivy Yu HM, Maruyama T, Mirando AJ, Hsu W (2011) Gpr177/mouse wntless is essential for wnt-mediated craniofacial and brain development. Dev Dyn 240:365-371. Fu J, Jiang M, Mirando AJ, Yu HM, Hsu W (2009) Reciprocal regulation of wnt and Gpr177/mouse wntless is required for embryonic axis formation. Proc Natl Acad Sci U S A 106:18598-18603. Gan Q, Lee A, Suzuki R, Yamagami T, Stokes A, Nguyen BC, Pleasure D, Wang J, Chen HW, Zhou CJ (2014) Pax6 mediates ss-catenin signaling for self-renewal and neurogenesis by neocortical radial glial stem cells. Stem Cells 32:45-58. Gao J, Wang J, Wang Y, Dai W, Lu L (2011) Regulation of Pax6 by CTCF during induction of mouse ES cell differentiation. PLoS One 6:e20954. Gardner CA, Barald KF (1991) The cellular environment controls the expression of engrailed-like protein in the cranial neuroepithelium of quail-chick chimeric embryos. Development 113:1037-1048. Gehring WJ (1996) The master control gene for morphogenesis and evolution of the eye. Genes Cells 1:11-15. Gibson P et al (2010) Subtypes of medulloblastoma have distinct developmental origins. Nature 468:1095-1099. Goldowitz D (1989) The weaver granuloprival phenotype is due to intrinsic action of the mutant locus in granule cells: Evidence from homozygous weaver chimeras. Neuron 2:1565-1575. 133  Goldowitz D, Mullen RJ (1982) Granule cell as a site of gene action in the weaver mouse cerebellum: Evidence from heterozygous mutant chimeras. J Neurosci 2:1474-1485. Goldowitz D, Hamre KM, Przyborski SA, Ackerman SL (2000) Granule cells and cerebellar boundaries: Analysis of Unc5h3 mutant chimeras. J Neurosci 20:4129-4137. Goodman RM, Thombre S, Firtina Z, Gray D, Betts D, Roebuck J, Spana EP, Selva EM (2006) Sprinter: A novel transmembrane protein required for wg secretion and signaling. Development 133:4901-4911. Graus-Porta D, Blaess S, Senften M, Littlewood-Evans A, Damsky C, Huang Z, Orban P, Klein R, Schittny JC, Müller U (2001) Β1-class integrins regulate the development of laminae and folia in the cerebral and cerebellar cortex. Neuron 31:367-379. Guo C, Qiu HY, Huang Y, Chen H, Yang RQ, Chen SD, Johnson RL, Chen ZF, Ding YQ (2007) Lmx1b is essential for Fgf8 and Wnt1 expression in the isthmic organizer during tectum and cerebellum development in mice. Development 134:317-325. Ha TJ, Swanson DJ, Kirova R, Yeung J, Choi K, Tong Y, Chesler EJ, Goldowitz D (2012) Genome-wide microarray comparison reveals downstream genes of Pax6 in the developing mouse cerebellum. Eur J Neurosci 36:2888-2898. Ha T, Swanson D, Larouche M, Glenn R, Weeden D, Zhang P, Hamre K, Langston M, Phillips C, Song M, Ouyang Z, Chesler E, Duvvurru S, Yordanova R, Cui Y, Campbell K, Ricker G, Phillips C, Homayouni R, Goldowitz D (2015) CbGRiTS: Cerebellar gene regulation in time and space. Dev Biol 397:18-30. 134  Hagan N, Zervas M (2012) Wnt1 expression temporally allocates upper rhombic lip progenitors and defines their terminal cell fate in the cerebellum. Mol Cell Neurosci 49:217-229. Hallonet ME, Teillet MA, Le Douarin NM (1990) A new approach to the development of the cerebellum provided by the quail-chick marker system. Development 108:19-31. Hashimoto M, Mikoshiba K (2003) Mediolateral compartmentalization of the cerebellum is determined on the "birth date" of purkinje cells. J Neurosci 23:11342-11351. Hatten ME, Heintz N (1995) Mechanisms of neural patterning and specification in the developing cerebellum. Annu Rev Neurosci 18:385-408. Haubst N, Berger J, Radjendirane V, Graw J, Favor J, Saunders GF, Stoykova A, Gotz M (2004) Molecular dissection of Pax6 function: The specific roles of the paired domain and homeodomain in brain development. Development 131:6131-6140. Helms AW, Gowan K, Abney A, Savage T, Johnson JE (2001) Overexpression of MATH1 disrupts the coordination of neural differentiation in cerebellum development. Mol Cell Neurosci 17:671-682. Hevner RF, Shi L, Justice N, Hsueh Y, Sheng M, Smiga S, Bulfone A, Goffinet AM, Campagnoni AT, Rubenstein JL (2001) Tbr1 regulates differentiation of the preplate and layer 6. Neuron 29:353-366. Hirabayashi Y, Itoh Y, Tabata H, Nakajima K, Akiyama T, Masuyama N, Gotoh Y (2004) The wnt/beta-catenin pathway directs neuronal differentiation of cortical neural precursor cells. Development 131:2791-2801. 135  His W (1891) Die entwicklung des menschlichen rautenhirns vom ende des ersten bis zum beginn des dritten monats. I. verlangertes mark. Bhandlungen Der Koniglicher Sachsischen Gesellschaft Der Wissenschaften, Mathematische-Physikalische Klasse 29:1-74. Hogan BLM, Horsburgh G, Cohen J, Hetherington CM, Fisher G, Lyon MF (1986) Small eyes (sey): A homozygous lethal mutation on chromosome 2 which affects the differentiation of both lens and nasal placodes in the mouse. Journal of Embryology and Experimental Morphology 97:95-110. Holm PC, Mader MT, Haubst N, Wizenmann A, Sigvardsson M, Götz M (2007) Loss- and gain-of-function analyses reveal targets of Pax6 in the developing mouse telencephalon. Molecular and Cellular Neuroscience 34:99-119. Hoser M, Baader SL, Bösl MR, Ihmer A, Wegner M, Sock E (2007) Prolonged glial expression of Sox4 in the CNS leads to architectural cerebellar defects and ataxia. The Journal of Neuroscience 27:5495-5505. Hoshino M, Nakamura S, Mori K, Kawauchi T, Terao M, Nishimura YV, Fukuda A, Fuse T, Matsuo N, Sone M, Watanabe M, Bito H, Terashima T, Wright CV, Kawaguchi Y, Nakao K, Nabeshima Y (2005) Ptf1a, a bHLH transcriptional gene, defines GABAergic neuronal fates in cerebellum. Neuron 47:201-213. Imamura F, Greer CA (2013) Pax6 regulates Tbr1 and Tbr2 expressions in olfactory bulb mitral cells. Mol Cell Neurosci 54:58-70. 136  Jensen P, Smeyne R, Goldowitz D (2004) Analysis of cerebellar development in math1 null embryos and chimeras. J Neurosci 24:2202-2211. Jensen P, Zoghbi HY, Goldowitz D (2002) Dissection of the cellular and molecular events that position cerebellar purkinje cells: A study of the math1Null-mutant mouse. J Neurosci 22:8110-8116. Jensen SA, Calvert AE, Volpert G, Kouri FM, Hurley LA, Luciano JP, Wu Y, Chalastanis A, Futerman AH, Stegh AH (2014) Bcl2L13 is a ceramide synthase inhibitor in glioblastoma. Proceedings of the National Academy of Sciences 111:5682-5687. Kamachi Y, Uchikawa M, Tanouchi A, Sekido R, Kondoh H (2001) Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation of lens development. Genes & Development 15:1272-1286. Kammandel B, Chowdhury K, Stoykova A, Aparicio S, Brenner S, Gruss P (1999) Distinctcis-essential modules direct the Time–Space pattern of thePax6Gene activity. Dev Biol 205:79-97. Kawauchi D, Saito T (2008) Transcriptional cascade from Math1 to Mbh1 and Mbh2 is required for cerebellar granule cell differentiation. Dev Biol 322:345-354. Kim AS, Anderson SA, Rubenstein JL, Lowenstein DH, Pleasure SJ (2001) Pax-6 regulates expression of SFRP-2 and wnt-7b in the developing CNS. J Neurosci 21:RC132. Kim EJ, Battiste J, Nakagawa Y, Johnson JE (2008) Ascl1 (Mash1) lineage cells contribute to discrete cell populations in CNS architecture. Mol Cell Neurosci 38:595-606. 137  Kleinjan DA, Seawright A, Childs AJ, van Heyningen V (2004) Conserved elements in Pax6 intron 7 involved in (auto)regulation and alternative transcription. Dev Biol 265:462-477. Klisch TJ, Xi Y, Flora A, Wang L, Li W, Zoghbi HY (2011) In vivo Atoh1 targetome reveals how a proneural transcription factor regulates cerebellar development. Proceedings of the National Academy of Sciences 108:3288-3293. Komuro H, Yacubova E (2003) Recent advances in cerebellar granule cell migration. Cell Mol Life Sci 60:1084-1098. Lee SM, Tole S, Grove E, McMahon AP (2000) A local wnt-3a signal is required for development of the mammalian hippocampus. Development 127:457-467. Lendahl U, Zimmerman LB, McKay RDG (1990) CNS stem cells express a new class of intermediate filament protein. Cell 60:585-595. Leto K, Carletti B, Williams IM, Magrassi L, Rossi F (2006) Different types of cerebellar GABAergic interneurons originate from a common pool of multipotent progenitor cells. J Neurosci 26:11682-11694. Lewis PM, Gritli-Linde A, Smeyne R, Kottmann A, McMahon AP (2004) Sonic hedgehog signaling is required for expansion of granule neuron precursors and patterning of the mouse cerebellum. Dev Biol 270:393-410. Li S, Qiu F, Xu A, Price SM, Xiang M (2004) Barhl1 regulates migration and survival of cerebellar granule cells by controlling expression of the neurotrophin-3 gene. J Neurosci 24:3104-3114. 138  Li T, Lu L (2005) Epidermal growth factor-induced proliferation requires down-regulation of Pax6 in corneal epithelial cells. Journal of Biological Chemistry 280:12988-12995. Liu A, Losos K, Joyner AL (1999a) FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development 126:4827-4838. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, Bradley A (1999b) Requirement for Wnt3 in vertebrate axis formation. Nat Genet 22:361-365. Lorenz A, Deutschmann M, Ahlfeld J, Prix C, Koch A, Smits R, Fodde R, Kretzschmar HA, Schuller U (2011) Severe alterations of cerebellar cortical development after constitutive activation of wnt signaling in granule neuron precursors. Mol Cell Biol 31:3326-3338. Louvi A, Yoshida M, Grove EA (2007) The derivatives of the Wnt3a lineage in the central nervous system. J Comp Neurol 504:550-569. Lundell TG, Zhou Q, Doughty ML (2009) Neurogenin1 expression in cell lineages of the cerebellar cortex in embryonic and postnatal mice. Developmental Dynamics 238:3310-3325. Ma S, Kwon HJ, Huang Z (2012) Ric-8a, a guanine nucleotide exchange factor for heterotrimeric G proteins, regulates bergmann glia-basement membrane adhesion during cerebellar foliation. The Journal of Neuroscience 32:14979-14993. Machold R, Fishell G (2005) Math1 is expressed in temporally discrete pools of cerebellar rhombic-lip neural progenitors. Neuron 48:17-24. 139  Machon O, Kreslova J, Ruzickova J, Vacik T, Klimova L, Fujimura N, Lachova J, Kozmik Z (2010) Lens morphogenesis is dependent on Pax6-mediated inhibition of the canonical wnt/beta-catenin signaling in the lens surface ectoderm. Genesis 48:86-95. Maisonpierre P, Belluscio L, Squinto S, Ip N, Furth M, Lindsay R, Yancopoulos G (1990) Neurotrophin-3: A neurotrophic factor related to NGF and BDNF. Science 247:1446-1451. Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB, Volpin D, Bressan GM, Piccolo S (2003) Mapping wnt/ß-catenin signaling during mouse development and in colorectal tumors. Proceedings of the National Academy of Sciences 100:3299-3304. Martinez S, Crossley PH, Cobos I, Rubenstein JL, Martin GR (1999) FGF8 induces formation of an ectopic isthmic organizer and isthmocerebellar development via a repressive effect on Otx2 expression. Development 126:1189-1200. Martynoga B, Morrison H, Price DJ, Mason JO (2005) Foxg1 is required for specification of ventral telencephalon and region-specific regulation of dorsal telencephalic precursor proliferation and apoptosis. Dev Biol 283:113-127. Matsunaga E, Katahira T, Nakamura H (2002) Role of Lmx1b and Wnt1 in mesencephalon and metencephalon development. Development 129:5269-5277. McMahon AP, Bradley A (1990) The wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62:1073-1085. McNeill H, Woodgett JR (2010) When pathways collide: Collaboration and connivance among signalling proteins in development. Nat Rev Mol Cell Biol 11:404-413. 140  Meyers EN, Lewandoski M, Martin GR (1998) An Fgf8 mutant allelic series generated by cre- and flp-mediated recombination. Nat Genet 18:136-141. Millen KJ, Steshina EY, Iskusnykh IY, Chizhikov VV (2014) Transformation of the cerebellum into more ventral brainstem fates causes cerebellar agenesis in the absence of Ptf1a function. Proceedings of the National Academy of Sciences 111:E1777-E1786. Millet S, Bloch-Gallego E, Simeone A, Alvarado-Mallart RM (1996) The caudal limit of Otx2 gene expression as a marker of the midbrain/hindbrain boundary: A study using in situ hybridisation and chick/quail homotopic grafts. Development 122:3785-3797. Millet S, Campbell K, Epstein DJ, Losos K, Harris E, Joyner AL (1999) A role for Gbx2 in repression of Otx2 and positioning the mid/hindbrain organizer. Nature 401:161-164. Miyata T, Maeda T, Lee JE (1999) NeuroD is required for differentiation of the granule cells in the cerebellum and hippocampus. Genes Dev 13:1647-1652. Morales D, Hatten ME (2006) Molecular markers of neuronal progenitors in the embryonic cerebellar anlage. J Neurosci 26:12226-12236. Mullen RJ, Buck CR, Smith AM (1992) NeuN, a neuronal specific nuclear protein in vertebrates. Development 116:201-211. Munji RN, Choe Y, Li G, Siegenthaler JA, Pleasure SJ (2011) Wnt signaling regulates neuronal differentiation of cortical intermediate progenitors. The Journal of Neuroscience 31:1676-1687. 141  Nikoletopoulou V, Plachta N, Allen ND, Pinto L, Gotz M, Barde YA (2007) Neurotrophin receptor-mediated death of misspecified neurons generated from embryonic stem cells lacking Pax6. Cell Stem Cell 1:529-540. Ninkovic J, Pinto L, Petricca S, Lepier A, Sun J, Rieger MA, Schroeder T, Cvekl A, Favor J, Gotz M (2010) The transcription factor Pax6 regulates survival of dopaminergic olfactory bulb neurons via crystallin alphaA. Neuron 68:682-694. Obana EA, Lundell TG, Yi KJ, Radomski KL, Zhou Q, Doughty ML (2015) Neurog1 genetic inducible fate mapping (GIFM) reveals the existence of complex spatiotemporal cyto-architectures in the developing cerebellum. Cerebellum 14:247-263. Ozonoff S, Williams BJ, Gale S, Miller JN (1999) Autism and autistic behavior in joubert syndrome. J Child Neurol 14:636-641. Pal S, Gupta R, Kim H, Wickramasinghe P, Baubet V, Showe LC, Dahmane N, Davuluri RV (2011) Alternative transcription exceeds alternative splicing in generating the transcriptome diversity of cerebellar development. Genome Research 21:1260-1272. Pan N, Jahan I, Lee JE, Fritzsch B (2009) Defects in the cerebella of conditional Neurod1 null mice correlate with effective tg(Atoh1-cre) recombination and granule cell requirements for Neurod1 for differentiation. Cell Tissue Res 337:407-428. Panhuysen M, Vogt Weisenhorn DM, Blanquet V, Brodski C, Heinzmann U, Beisker W, Wurst W (2004) Effects of Wnt1 signaling on proliferation in the developing mid-/hindbrain region. Mol Cell Neurosci 26:101-111. 142  Park C, Falls W, Finger JH, Longo-Guess CM, Ackerman SL (2002) Deletion in Catna2, encoding alpha N-catenin, causes cerebellar and hippocampal lamination defects and impaired startle modulation. Nat Genet 31:279-284. Pascual M, Abasolo I, Mingorance-Le Meur A, Martinez A, Del Rio JA, Wright CV, Real FX, Soriano E (2007) Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression. Proc Natl Acad Sci U S A 104:5193-5198. Pei Y, Brun SN, Markant SL, Lento W, Gibson P, Taketo MM, Giovannini M, Gilbertson RJ, Wechsler-Reya RJ (2012) WNT signaling increases proliferation and impairs differentiation of stem cells in the developing cerebellum. Development 139:1724-1733. Poschl J, Grammel D, Dorostkar MM, Kretzschmar HA, Schuller U (2013) Constitutive activation of beta-catenin in neural progenitors results in disrupted proliferation and migration of neurons within the central nervous system. Dev Biol 374:319-332. Qiu Z, Cang Y, Goff SP (2010) Abl family tyrosine kinases are essential for basement membrane integrity and cortical lamination in the cerebellum. The Journal of Neuroscience 30:14430-14439. Quinn JC, Molinek M, Martynoga BS, Zaki PA, Faedo A, Bulfone A, Hevner RF, West JD, Price DJ (2007) Pax6 controls cerebral cortical cell number by regulating exit from the cell cycle and specifies cortical cell identity by a cell autonomous mechanism. Dev Biol 302:50-65. Quiring R, Walldorf U, Kloter U, Gehring WJ (1994) Homology of the eyeless gene of drosophila to the small eye gene in mice and aniridia in humans. Science 265:785-789. 143  Ray RS, Dymecki SM (2009) Rautenlippe redux -- toward a unified view of the precerebellar rhombic lip. Curr Opin Cell Biol 21:741-747. Redies C, Neudert F, Lin J (2011) Cadherins in cerebellar development: Translation of embryonic patterning into mature functional compartmentalization. Cerebellum 10:393-408. Rodriguez CI, Dymecki SM (2000) Origin of the precerebellar system. Neuron 27:475-486. Rogers TD, McKimm E, Dickson PE, Goldowitz D, Blaha CD, Mittleman G (2013) Is autism a disease of the cerebellum? an integration of clinical and pre-clinical research. Front Syst Neurosci 7:15. Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, Barton SC, Surani MA, Ryan K, Nehls MC, Wilson V, Evans MJ (2000) Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature 404:95-99. Salsano E, Pollo B, Eoli M, Giordana MT, Finocchiaro G (2004) Expression of MATH1, a marker of cerebellar granule cell progenitors, identifies different medulloblastoma sub-types. Neurosci Lett 370:180-185. Sansom SN, Griffiths DS, Faedo A, Kleinjan DJ, Ruan Y, Smith J, van Heyningen V, Rubenstein JL, Livesey FJ (2009) The level of the transcription factor Pax6 is essential for controlling the balance between neural stem cell self-renewal and neurogenesis. PLoS Genet 5:e1000511. 144  Schmahl W, Knoedlseder M, Favor J, Davidson D (1993a) Defects of neuronal migration and the pathogenesis of cortical malformations are associated with small eye (sey) in the mouse, a point mutation at the pax-6-locus. Acta Neuropathol 86:126-135. Schmahl W, Knoedlseder M, Favor J, Davidson D (1993b) Defects of neuronal migration and the pathogenesis of cortical malformations are associated with small eye (sey) in the mouse, a point mutation at the pax-6-locus. Acta Neuropathol 86:126-135. Schmidt-Sidor B, Szymanska K, Williamson K, van Heyningen V, Roszkowski T, Wierzba-Bobrowicz T, Zaremba J (2009) Malformations of the brain in two fetuses with a compound heterozygosity for two PAX6 mutations. Folia Neuropathol 47:372-382. Schüller U, Rowitch DH (2007) Β-catenin function is required for cerebellar morphogenesis. Brain Res 1140:161-169. Selvadurai HJ, Mason JO (2012) Activation of wnt/beta-catenin signalling affects differentiation of cells arising from the cerebellar ventricular zone. PLoS One 7:e42572. Seto Y et al (2014) Temporal identity transition from purkinje cell progenitors to GABAergic interneuron progenitors in the cerebellum. Nat Commun 5:3337. Shaham O, Menuchin Y, Farhy C, Ashery-Padan R (2012) Pax6: A multi-level regulator of ocular development. Prog Retin Eye Res 31:351-376. Shen W, Zhu L, Lee S, Chung S, Gillies M (2013) Involvement of NT3 and P75NTR in photoreceptor degeneration following selective muller cell ablation. Journal of Neuroinflammation 10:137. 145  Shi F, Cheng Y, Wang XL, Edge ASB (2010) Β-catenin up-regulates Atoh1 expression in neural progenitor cells by interaction with an Atoh1 3′ enhancer. J Biol Chem 285:392-400. Shimamura K, Hirano S, McMahon AP, Takeichi M (1994) Wnt-1-dependent regulation of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain. Development 120:2225-2234. Stoykova A, Gruss P (1994) Roles of pax-genes in developing and adult brain as suggested by expression patterns. J Neurosci 14:1395-1412. Sudarov A, Joyner AL (2007) Cerebellum morphogenesis: The foliation pattern is orchestrated by multi-cellular anchoring centers. Neural Dev 2:26. Sudarov A, Turnbull RK, Kim EJ, Lebel-Potter M, Guillemot F, Joyner AL (2011) Ascl1 genetics reveals insights into cerebellum local circuit assembly. J Neurosci 31:11055-11069. Sundberg M, Sahin M (2015) Cerebellar development and autism spectrum disorder in tuberous sclerosis complex. J Child Neurol 30:1954-1962. Swanson DJ, Tong Y, Goldowitz D (2005) Disruption of cerebellar granule cell development in the Pax6 mutant, sey mouse. Brain Res Dev Brain Res 160:176-193. Swanson DJ, Goldowitz D (2011) Experimental sey mouse chimeras reveal the developmental deficiencies of Pax6-null granule cells in the postnatal cerebellum. Dev Biol 351:1-12. Taylor MD, Northcott PA, Korshunov A, Remke M, Cho YJ, Clifford SC, Eberhart CG, Parsons DW, Rutkowski S, Gajjar A, Ellison DW, Lichter P, Gilbertson RJ, Pomeroy SL, Kool M, 146  Pfister SM (2012) Molecular subgroups of medulloblastoma: The current consensus. Acta Neuropathol 123:465-472. Thakurela S, Tiwari N, Schick S, Garding A, Ivanek R, Berninger B, Tiwari VK (2016) Mapping gene regulatory circuitry of Pax6 during neurogenesis. Cell Discov 2:15045. Thomas KR, Capecchi MR (1990) Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346:847-850. Thompson MC, Fuller C, Hogg TL, Dalton J, Finkelstein D, Lau CC, Chintagumpala M, Adesina A, Ashley DM, Kellie SJ, Taylor MD, Curran T, Gajjar A, Gilbertson RJ (2006) Genomics identifies medulloblastoma subgroups that are enriched for specific genetic alterations. JCO 24:1924-1931. Tissir F, Goffinet AM (2013) Shaping the nervous system: Role of the core planar cell polarity genes. Nat Rev Neurosci 14:525-535. Toresson H, Potter SS, Campbell K (2000) Genetic control of dorsal-ventral identity in the telencephalon: Opposing roles for Pax6 and Gsh2. Development 127:4361-4371. Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, Bock R, Klein R, Schutz G (1999) Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet 23:99-103. Tsuchiya K, Nakamura T, Okamoto R, Kanai T, Watanabe M (2007) Reciprocal targeting of Hath1 and β-catenin by wnt glycogen synthase kinase 3β in human colon cancer. Gastroenterology 132:208-220. 147  Umeda T, Takashima N, Nakagawa R, Maekawa M, Ikegami S, Yoshikawa T, Kobayashi K, Okanoya K, Inokuchi K, Osumi N (2010) Evaluation of Pax6 mutant rat as a model for autism. PLoS One 5:e15500. Walther C, Gruss P (1991) Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113:1435-1449. Wang VY, Rose MF, Zoghbi HY (2005) Math1 expression redefines the rhombic lip derivatives and reveals novel lineages within the brainstem and cerebellum. Neuron 48:31-43. Wassarman KM, Lewandoski M, Campbell K, Joyner AL, Rubenstein JL, Martinez S, Martin GR (1997) Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development 124:2923-2934. Wen J, Yang HB, Zhou B, Lou HF, Duan S (2013) Beta-catenin is critical for cerebellar foliation and lamination. PLoS One 8:e64451. Wilkinson DG, Bailes JA, McMahon AP (1987) Expression of the proto-oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell 50:79-88. Wingate RJ, Hatten ME (1999) The role of the rhombic lip in avian cerebellum development. Development 126:4395-4404. Yamada M, Seto Y, Taya S, Owa T, Inoue YU, Inoue T, Kawaguchi Y, Nabeshima Y, Hoshino M (2014) Specification of spatial identities of cerebellar neuron progenitors by Ptf1a and Atoh1 for proper production of GABAergic and glutamatergic neurons. J Neurosci 34:4786-4800. 148  Yamasaki T, Kawaji K, Ono K, Bito H, Hirano T, Osumi N, Kengaku M (2001) Pax6 regulates granule cell polarization during parallel fiber formation in the developing cerebellum. Development 128:3133-3144. Yang Y, Mlodzik M (2015) Wnt-frizzled/planar cell polarity signaling: Cellular orientation by facing the wind (wnt). Annu Rev Cell Dev Biol 31:623-646. Yeung J, Ha TJ, Swanson DJ, Goldowitz D (2016) A novel and multivalent role of Pax6 in cerebellar development. The Journal of Neuroscience 36:9057-9069. Yeung J, Ha TJ, Swanson DJ, Choi K, Tong Y, Goldowitz D (2014) Wls provides a new compartmental view of the rhombic lip in mouse cerebellar development. The Journal of Neuroscience 34:12527-12537. Yu HM, Jin Y, Fu J, Hsu W (2010) Expression of Gpr177, a wnt trafficking regulator, in mouse embryogenesis. Dev Dyn 239:2102-2109. Zechner D, Fujita Y, Hülsken J, Müller T, Walther I, Taketo MM, Bryan Crenshaw E, Birchmeier W, Birchmeier C (2003) Β-catenin signals regulate cell growth and the balance between progenitor cell expansion and differentiation in the nervous system. Dev Biol 258:406-418. Zhao H, Ayrault O, Zindy F, Kim JH, Roussel MF (2008) Post-transcriptional down-regulation of Atoh1/Math1 by bone morphogenic proteins suppresses medulloblastoma development. Genes Dev 22:722-727. 149  Zordan P, Croci L, Hawkes R, Consalez GG (2008) Comparative analysis of proneural gene expression in the embryonic cerebellum. Dev Dyn 237:1726-1735.     150  Appendices Appendix 1: Supplementary Figures  Supplementary Figure 1. Antibodies against the N- or C-terminal of Wls yielded identical staining in the E15.5 mouse rhombic lip. Scale bars represent 100µm.  151   Supplementary Figure 2. Wls expression is found in the Purkinje cells in the adult (P38) cerebellum. Scale bars represent 100µm.  152   Supplementary Figure 3. The absence of X-gal staining from wildtype tissues in the E10.5 and E12.5 embryos.      Supplementary Figure 4. Wls expression in the E12.5 WlsLacZ/+ rhombic lip. White arrow indicates the Wls-negative cells in the subpial stream that are found positive for X-gal staining. Scale bars represent 100µm. 153   Supplementary Figure 5. Wls expression in the E15.5 WlsLacZ/+ rhombic lip detected with antibody against the N-terminal of Wls appears punctate and display perfect colocalization with Wls reporter β-gal staining. Scale bars represent 100µm.         Supplementary Figure 6. Wls is expressed in the rhombic lip, choroid plexus and isthmic organizer of E15.5 Atoh1-null (Atoh1LacZ/LacZ) embryo. Scale bars represent 100µm.     154   Supplementary Figure 7. The E18.5 interior face of the rhombic lip (white arrows) co-expressed Wls and Pax6. Scale bars represent 100µm.      Supplementary Figure 8. Cerebellar morphology and Wls expression patterns are indistinguishable between wildtype and heterozygous Sey embryos at E15.5 and E18.5. Scale bars represent 100µm.  155   Supplementary Figure 9. In the E18.5 rhombic lip, Wls-expression iRL is segregated from the Lmx1a-expressing cells. Scale bars represent 100µm.             Supplementary Figure 10. In the E18.5 rhombic lip, Wls-expression iRL is segregated from the Tbr2-expressing cells, staining performed on adjacent sections. Scale bars represent 100µm.    156   Supplementary Figure 11. Cell death is rarely observed in the E15.5 rhombic lip as indicated by the absence of caspase-3 staining. Scale bars represent 100µm.   Supplementary Figure 12. Expression of INSM1 (left panels) are absent from the E13.5 and E15.5 NTZ and CN neurons (right panels) as indicated by the Tbr1-staining on adjacent sections. Scale bars represent 100µm.  157    Supplementary Figure 13. Number of Caspase-3+ cell per section in the E12.5 to E16.5 Wls-cKO and control cerebella. N.S., Not significant. 012345E12.5 E13.5 E14.5 E15.5 E16.5Caspase-3+cell per sectionCaspase-3+ cells cKO ControlN.S. N.S. N.S. N.S. N.S. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0340490/manifest

Comment

Related Items