Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Maintenance of transcription factor networks in mature neurons Keatings, Kathleen 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_february_keatings_kathleen.pdf [ 15.31MB ]
Metadata
JSON: 24-1.0340477.json
JSON-LD: 24-1.0340477-ld.json
RDF/XML (Pretty): 24-1.0340477-rdf.xml
RDF/JSON: 24-1.0340477-rdf.json
Turtle: 24-1.0340477-turtle.txt
N-Triples: 24-1.0340477-rdf-ntriples.txt
Original Record: 24-1.0340477-source.json
Full Text
24-1.0340477-fulltext.txt
Citation
24-1.0340477.ris

Full Text

	     MAINTENANCE OF TRANSCRIPTION FACTOR  NETWORKS IN MATURE NEURONS  by  KATHLEEN KEATINGS  B.Sc., The University of British Columbia, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Cell and Developmental Biology)    THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)    December 2016   © Kathleen Keatings 2016   	   ii	  ABSTRACT The lifelong identity and function of a neuron is dictated by the set of effector genes it expresses in its terminally differentiated state. Neuron-specific effector gene expression is established and maintained by networks of transcription factors. How elaborate cascades of transcription factors establish neuronal identities during development has been studied extensively; however, how transcription factor networks are maintained in mature neurons to maintain effector gene expression remains poorly understood. I used the well-characterized transcription factor networks in Drosophila Tv1 and Tv4 neurons to further understand how transcription factor networks are maintained in mature neurons. I focused on the transcription factors Apterous and Dimmed, and investigated the cis- and trans- regulatory transcriptional mechanisms that govern initiation and maintenance of their expression.  I previously identified a 756 bp genomic region (dimm.K1) upstream of dimmed that is sufficient to initiate and maintain reporter expression in Tv1 and Tv4 neurons. Here I characterized the trans-regulatory inputs of dimm.K1 reporter expression. I found that different transcriptional inputs are required for initiation vs. maintenance of dimm.K1 reporter expression. Further, inputs required for maintenance differ not only between cell subtypes (Tv1 vs. Tv4) but also between individual cells of the same subtype (Tv1 neurons in thoracic segments 1 and 3).   I also compared apterous initiation and maintenance. My previous work had identified a 3.845 kb genomic region (ap.K1) upstream of apterous that is sufficient to initiate, but not maintain, reporter expression in Tv1 and Tv4 neurons. In this thesis I show that the addition of a region with putative TRE activity to the ap.K1 initiation element is sufficient to add maintenance of reporter expression in Tv1 and Tv4 neurons.  Overall, I show that a variety of mechanisms can maintain the expression of transcription factors in mature neurons, and that these are different and more varied than the mechanisms of 	   iii	  initiation. Furthermore, for any single transcription factor, the initiation mechanisms that are shared by different cell subtypes can diverge into diverse cell-specific maintenance mechanisms.                	   iv	  PREFACE 	  All work was performed in Dr. Douglas Allan’s lab at UBC.  Dr. Douglas Allan and I conceived all experiments. Dr. Tianshun Lian cloned the putative ap enhancer transgene for Figure 18. Kate MacDonald, an undergraduate research assistant, established the transgenic line used in Figure 18. She also performed the dissections and assisted with the immunocytochemistry for Figure 18. I performed all other experiments and all data analysis.     	   v	  TABLE OF CONTENTS ABSTRACT .................................................................................................................................... ii PREFACE ...................................................................................................................................... iv TABLE OF CONTENTS…………………………………………………………………………v LIST OF TABLES ........................................................................................................................ vii LIST OF FIGURES ..................................................................................................................... viii LIST OF ABBREVIATIONS ........................................................................................................ ix ACKNOWLEDGEMENTS ............................................................................................................ x DEDICATION ................................................................................................................................. i 1. INTRODUCTION ....................................................................................................................... 1 1.1 Neuronal diversity ................................................................................................................. 1 1.2 Transcription factors and cis-regulatory modules ................................................................. 1 1.3 Neuronal specification and differentiation ............................................................................ 3 1.4 Neuronal maintenance ........................................................................................................... 4 1.5 Models for transcription factor maintenance ........................................................................ 5 1.5.1 Auto-regulation .............................................................................................................. 6 1.5.2 Cross-regulation ............................................................................................................. 6 1.5.3 Maintenance-dedicated transcription factors ................................................................. 7 1.5.4 Maintenance by Trithorax-group proteins ...................................................................... 7 1.6 Genomic organization of initiator and maintenance CRMs ................................................ 11 1.7 Drosophila Tv neurons as a model system ......................................................................... 11 1.8 Identification of CRMs that regulate expression of ap and dimm ....................................... 16 1.9 Thesis objectives ................................................................................................................. 21 1.9.1 Characterizing the role of dimm.K1 in the initiation and maintenance of dimm expression in Drosophila Tv1 and Tv4 neurons ................................................................... 21 1.9.2 Characterizing the cis-regulatory architecture that regulates initiation and maintenance of ap expression in Drosophila Tv1 and Tv4 neurons .......................................................... 21 2. MATERIALS AND METHODS .............................................................................................. 22 2.1 Fly strains ............................................................................................................................ 22 2.2 Transgene construction ....................................................................................................... 22 2.3 Fly transgenesis ................................................................................................................... 22 2.4 Fly husbandry ...................................................................................................................... 23 2.5 Antibodies ........................................................................................................................... 23 2.6 Immunocytochemistry ......................................................................................................... 24 2.7 Image and statistical analysis .............................................................................................. 24 3. RESULTS .................................................................................................................................. 27 3.1 All neurons of the VNC that express dimm.K1-nDsRed also express Dimm. .................... 27 3.2 dimm.K1 drives long-term reporter maintenance in Tv1 and Tv4 neurons. ....................... 29 3.3 dimm.K1 is necessary for dimm expression in Tv1 and Tv4 neurons. ................................ 32 3.4 Initiation of dimm.K1-nDsRed expression in Tv1 and Tv4 neurons is dependent upon the same transcription factors as initiation of Dimm. ..................................................................... 35 3.5 Dimm auto-regulates its own maintenance through dimm.K1, in Tv4 only ....................... 39 3.6 Maintenance of dimm.K1-nDsRed in Tv1 neurons ............................................................. 41 3.7 Maintenance of dimm.K1-nDsRed in Tv4 neurons. ............................................................ 45 3.8 ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons. .......................................... 50 	   vi	  3.9 Identification of a putative Tv1 and Tv4 ap maintenance CRM ......................................... 53 4. DISCUSSION ........................................................................................................................... 55 4.1 Summary of major findings ................................................................................................. 55 4.2 Biological relevance of our findings ................................................................................... 60 4.3 Considerations and limitations of data interpretation relevant to discussion of our data ... 62 4.4 Possible involvement of additional CRMs in dimm maintenance ....................................... 63 4.5 Future directions .................................................................................................................. 69 4.5.1 dimm ............................................................................................................................. 69 4.5.2 ap .................................................................................................................................. 72 5. CONCLUSIONS ....................................................................................................................... 75 BIBLIOGRAPHY ......................................................................................................................... 76 APPENDIX A. SUPPLEMENTARY TABLES AND FIGURES ................................................ 84 APPENDIX B: CHARACTERIZING THE CIS-REGULATORY ARCHITECTURE THAT REGULATES INITIATION AND MAINTENANCE OF EYES ABSENT EXPRESSION IN DROSOPHILA TV1 AND TV4 NEURONS  ............................................................................... 93 	  APPENDIX C: CONSTRUCTION OF dimm.K1-nDsRed……………………………………...95    	   vii	  LIST OF TABLES  Table 1. Primers used to generate putative ap enhancer transgene. .............................................. 26  Table 2. Quantification of anti-Dimm and dimm.K1-nDsRed intensities at A20 and A45, relative to A1. ............................................................................................................................................. 84 	  Table 3. Primers for PCR Amplification of dimm.K1. ………………………………………..95 	    	  viii	  LIST OF FIGURES  Figure 1. Transcription factor maintenance models. ....................................................................... 9 Figure 2. D. melanogaster Tv clusters. ......................................................................................... 14 Figure 3. Tv1 and Tv4 transcription factor networks. ................................................................... 15 Figure 4. apGal4-GMR42B11 drives UAS-nEGFP expression in Tv1 and Tv4 neurons at Stg17, but not A5. ................................................................................................................................................. 18 Figure 5. dimmGal4-GMR10G07 drives UAS-nEGFP expression in Tv1 and Tv4 neurons at Stg17 and A5. ................................................................................................................................................. 19 Figure 6. dimmDsRed-CI.2 drives reporter expression in Tv1 and Tv4 neurons at Stg17 and A5. .... 20 Figure 7. Co-localization of dimm.K1-nDsRed and anti-Dimm in the VNC. ............................... 28 Figure 8. dimm.K1-nDsRed and anti-Dimm at A1, A20 and A45. ............................................... 30 Figure 9. Quantification of dimm.K1-nDsRed and anti-Dimm intensities at A20 and A45, relative to A1. ............................................................................................................................................. 31 Figure 10. Co-expression of dimm.1141 and dimm.K1 reporters verifies that these overlapping regions both report initiation and maintenance in Tv1 and Tv4 neurons. ..................................... 33 Figure 11. dimm.1141 is necessary for dimm expression in Tv1 and Tv4 neurons. ..................... 34 Figure 12. Initiation of dimm.K1-nDsRed expression in Tv4 neurons. ......................................... 35 Figure 13. Dimm regulates maintenance of dimm.K1-nDsRed in Tv4, but not Tv1, neurons. ..... 40 Figure 14. Maintenance of dimm.K1-nDsRed in Tv1 neurons. ..................................................... 43 Figure 15. Maintenance of dimm.K1-nDsRed in Tv4 neurons. ..................................................... 47 Figure 16. Maintenance of dimm.K1 and Dimm. .......................................................................... 49 Figure 17. ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons. .................................. 51 Figure 18. Identification of a putative Tv1 and Tv4 ap maintenance CRM. ................................ 54 Figure 19. Maintenance of Tv1 and Tv4 subtype identities. ......................................................... 58 Figure 20. Possible involvement of other CRMs in dimm maintenance. ...................................... 66 Figure 21. If Eya acts as an activator of dimm expression, but a repressor of dimm.K1. ............. 67 Figure 22. If Sqz, Dac and BMP signaling affect maintenance of dimm.K1, but not dimm. ........ 68 Figure 23. Models for ap initiation and maintenance in Tv1 and Tv4 neurons. ........................... 74  Figure 24. Loss of dimm.K1-nDsRed expression in the Stg17 Tv1 neurons of ap mutants. ........ 85 Figure 25. Confirmation of successful Dimm knockdown in Tv1 and Tv4 neurons. ................... 86 Figure 26. Confirmation of successful Dimm over-expression in Tv1 and Tv4 neurons. ............ 87 Figure 27. Confirmation of successful transcription factor knock-down in adult Tv1 neurons. .. 88 Figure 28. Confirmation of successful transcription factor knock-down in adult Tv4 neurons. .. 90 Figure 29. Additional controls for adult-specific transcription factor knock-down experiments. 92 Figure 30. Proposed cis-regulatory architecture regulating initiation and maintenance of eya expression in Tv1 and Tv4 neurons. ............................................................................................. 93 	   ix	  LIST OF ABBREVIATIONS A1, A2, A5, A20, A45 Adult day 1, 2, 5, 20, 45 Ap Apterous Antp Antennapedia BMP Bone Morphogenetic Protein bp base pairs Cas Castor Col Collier CNS central nervous system CRM cis-regulatory module ctrl control Dac Dacshsund Dimm Dimmed Eya Eyes Absent GMC Ganglion Mother Cell Grh Grainyhead Hth Homothorax In initiation KD knockdown M maintenance nDsRed nuclear-localized Discosoma sp. red fluorescent protein nEGFP nuclear-localized enhanced green fluorescent protein Nplp1 Neuropeptide-like precursor 1 OE over-expression SEM standard error of the mean Stg17 stage 17 embryo Sqz Squeeze TF transcription factor Th1, Th2, Th3 thoracic segment 1,2,3 TRE/PRE Trithorax/Polycomb response element TrxG/PcG Trithorax/Polycomb-group UCSC University of California Santa Cruz VNC ventral nerve cord  	   x	  ACKNOWLEDGEMENTS I would like to thank my supervisor Dr. Douglas Allan, my committee members Dr. Don Moerman and Dr. Brad Hoffman, all members of the Allan lab (both past and present), Dr. Eric Jan, and Dr. Jacob Hodgson for their support and mentorship. I would also like to thank Dr. Stefan Thor for his advice and reagents. Finally I must thank the lovely Kate MacDonald, as working with her and watching her fall in love with science has been a major highlight of this experience.xi	  DEDICATION   For mom. 1 1. INTRODUCTION 	  1.1 Neuronal diversity Mature neurons display a high degree of morphological and functional diversity, which can ultimately be attributed to the differential expression of terminal differentiation genes between neuronal subtypes. Terminal differentiation genes, also referred to in this thesis as ‘effector’ genes, are genes expressed throughout the lifetime of a neuron that define its functionality. Thus effector genes include those that encode neuropeptides, ion channels, neurotransmitter biosynthetic enzymes, and synaptic adhesion molecules [1].  Effector gene expression is established and maintained by networks of transcription factors [2,3]. How elaborate cascades of transcription factors direct neuronal differentiation and establish effector gene expression profiles during development has been the subject of many studies [4-9]; however, the mechanisms by which transcription factor networks are maintained over the lifetime of mature neurons to maintain effector gene expression remain poorly understood. The work presented in this thesis uses the well-characterized transcription factor networks of Drosophila Tv1 and Tv4 neurons to address this problem.  1.2 Transcription factors and cis-regulatory modules In accordance with the central dogma of molecular biology, genes encoded by DNA are transcribed into messenger RNAs, which are then translated into proteins. This flow of genetic information comes full circle with the production of transcription factors. Transcription factors are proteins that influence the rates at which genes are transcribed, by either sequence-specific DNA binding or by interacting with DNA-bound factors. Transcription factors that bind DNA associate with sequence motifs of 6-12 base pairs (bp) (cis-elements) that can be clustered into areas spanning tens to thousands of nucleotide base pairs within non-coding regions of the  2 genome. Clusters of cis-elements are termed ‘cis-regulatory modules’ (CRMs). CRMs act as platforms for the recruitment of specific transcription factors that act combinatorially to regulate the spatiotemporal transcription of specific genes. CRMs are considered to be modular, in that genes typically have multiple CRMs, and each CRM recruits different combinations of transcription factors in order to generate specific spatial and temporal domains of gene expression. The effect of transcription factor complexes at CRMs can be to promote transcription (the transcription factor is considered an activator and the CRM is considered an enhancer), or to reduce transcription (the transcription factor is considered a repressor and the CRM is considered a silencer). Furthermore, whether cis- or trans- regulatory elements/factors act as enhancers/activators or silencers/repressors can be context-dependent; activity can be modulated by the presence of different interacting partners in different cell types and at different stages of development [10-14]. CRM-bound transcription factor complexes accomplish regulation of transcription initiation and/or elongation by either direct physical association with the basal transcription machinery (RNA Polymerase II and associated factors), and/or indirect association with the basal transcription machinery through the Mediator complex and/or through the recruitment of chromatin remodeling factors that govern DNA accessibility at the locus. Unlike promoters, CRMs can be located large distances from the transcription start sites of the genes they regulate and can function irrespective of orientation, and irrespective of their location 5’ or 3’ of the gene. Interactions between CRM-bound transcription factor complexes and promoters that are separated by large spans of the genome are facilitated by chromosome looping [15-17].  It should also be appreciated that non-coding RNAs (ncRNAs), including those transcribed from enhancer regions (eRNAs), have been shown to regulate transcription. There is evidence to support their involvement both in the formation of chromosome loops that facilitate enhancer-promoter interactions and in the recruitment of transcription factors and chromatin  3 modifying/remodeling complexes, however these mechanisms are not considered further in this study [18-23].   1.3 Neuronal specification and differentiation Through the process of development, complex multicellular organisms are generated from a single cell. Essentially all cells in an organism have the same genome, with few exceptions; therefore it is the specific set of genes expressed in a cell that provides its unique identity and function within an organism. The terminally differentiated identity of a cell is established by the iterative refinement of gene expression profiles in the cells of its developmental lineage. How transcription factor cascades drive this process is described below, using the development of the Drosophila Ventral Nerve Cord (VNC) as an example. A sheet of neuroectodermal cells located in the ventrolateral region of the Drosophila embryo gives rise to the VNC. These cells are patterned by the region-specific expression of ‘spatial selector’ transcription factors along the anterior-posterior and dorsal-ventral axes. As neuronal progenitor cells, called neuroblasts, emerge from this neuroectodermal sheet, the specific combination of spatial selectors expressed by each neuroblast combinatorially defines its identity and begins to establish its competence to generate specific types of neurons and glia. Neuroblasts then undergo a series of asymmetric divisions. At each division, another neuroblast and a second cell known as a ganglion mother cell (GMC) are generated. The GMC then divides once to generate two cells that can be either neuronal or glial. Throughout neuroblast lineage progression over multiple divisions, a second set of transcription factors known as ‘temporal selectors’ function to alter the competence of the neuroblast to generate different neuronal subtypes over time. These temporal selectors are expressed briefly (1-4 divisions) and sequentially. Temporal selectors integrate with spatial selectors, and together they lead to the generation of a great diversity of specific neuronal subtypes, by establishing diverse transcription  4 factor profiles in young post-mitotic neurons. In the post-mitotic neurons, the activities of specific combinations of these transcription factors ultimately leads to the expression of sets of transcription factors known as ‘terminal selectors’. Terminal selectors initiate the expression of effector genes and thereby complete the establishment of a neuron’s terminally differentiated state [8,24].   1.4 Neuronal maintenance Neurons are particularly interesting from the perspective of long-term maintenance, because they are non-dividing cells that only exhibit a low rate of replacement in some adult nervous systems that is mostly restricted to particular regions [25-27]. Also, they are highly diverse, and the unique identity and function of a given neuron must be maintained throughout the life of an organism, notwithstanding the homeostatic changes in gene expression that many neurons undergo throughout life to tune gene expression to specific physiological demands [28]. It had historically been considered that, following the generation of neuronal subtypes and the initiation of effector gene expression, mature neurons become passively ‘locked-in’ to their differentiated states, a concept described by Blau and Baltimore (1991) [29]. More recent work has demonstrated, however, that the differentiated states of neurons must be actively maintained. More specifically, several examples across multiple model organisms illustrate the persistent requirement of developmental transcription factors for the maintenance of effector gene expression and thus neuronal identity and function [2,3]. In C. elegans, certain developmental transcription factors are required to maintain the cellular identities of their respective neurons: Unc-42 in ASH sensory neurons, Unc-3 in cholinergic motor neurons, Ast-1 and Ceh-43 in dopaminergic neurons [30-33]. In Drosophila, a combination of seven developmental transcription factors is required to initiate and maintain olfactory receptor expression in olfactory neurons; developmental transcription factors also ensure that the expression of distinct types of  5 rhodopsin genes remains restricted to specific photoreceptor neurons and that neuropeptide expression is maintained in Tv1 and Tv4 neurons [34-36]. In mice, developmental transcription factors are required to maintain neurotransmitter identities in serotonergic (Pet-1, Lmx1b), dopaminergic (Nurr1), and noradrenergic (Hand2, Phox2) neurons [37-41].  This concept has proven applicable to other cell types too as loss of the developmental transcription factors Pax5 or Foxa1 and Foxa2, for example, results in the de-differentiation of B cells and β-cells respectively [42-44].  1.5 Models for transcription factor maintenance It is generally the terminal selectors that persist in mature neurons. Importantly, several lines of evidence have found that upstream transcription factors in the developmental cascade are often not expressed beyond the developmental period. In C. elegans AWA olfactory neurons, the Odr-7 maintains cell identity in the absence of its initiating input Lin-11 [45]. In Drosophila Tv1 and Tv4 neurons terminal selector networks maintain effector gene expression in the absence of their numerous initiating inputs [36]. In adult mouse serotonergic neurons the terminal selector Pet-1 maintains cell identity in the absence of its initiating input Gata-2 [46]. Thus, in order to achieve a better understanding of how neuronal identity is maintained, we must examine how the transcription factors, that persist in adulthood, are maintained in the absence of the developmental inputs that initiated their expression. Current models for how transcription factors and transcription factor networks are maintained in mature neurons include (1) auto-regulation, (2) cross-regulation, (3) regulation by maintenance-dedicated transcription factors and (4) maintenance by Trithorax Group (TrxG) proteins (Figure 1).   6 1.5.1 Auto-regulation Auto-regulation (Figure 1B), whereby a transcription factor takes over the regulation of its own expression once initiated, is a simple and well-supported mechanism for transcription factor maintenance in the absence of developmental inputs. In C. elegans, the transcription factors that maintain the identities of various neuronal subtypes, such as Mec-3 in touch sensory neurons, Che-1 in ASE neurons, Odr-7 in AWA sensory neurons and Ttx-3 and Ceh-10 in cholinergic AIY interneurons, are all maintained through auto-regulation [45,47-49]. In mice the transcription factor Pet-1 auto-regulates in serotonergic neurons [38].   1.5.2 Cross-regulation Cross-regulatory models (Figure 1C) involve transcription factors of a network taking over the regulation of each other’s expression after development. Maintenance of Ttx-3 and Ceh-10 expression in the cholinergic AIY interneurons of C. elegans illustrates a simple example of cross-regulation and a situation in which auto-regulatory and cross-regulatory models intersect; auto-regulation of Ttx-3 and Ceh-10 is mediated by the cooperative binding of these two transcription factors at each locus [49]. An assessment of transcription factor occupancy at various transcription factor loci and developmental stages in mouse hepatocytes suggests that intricate cross-regulatory interactions are established after development. This extensive cross-regulation provides redundancy and helps explain why certain transcription factors, which are pertinent to the regulation of other transcription factors in their networks during development, are less important for maintaining expression of these transcription factors in mature cells [50]. Since certain transcription factors are not as imperative to the regulation of cell identity features in mature dopaminergic and serotonergic neurons as they are during development, the acquisition of complex cross-regulatory relationships within the transcription factor networks of mature neurons has been proposed as one explanation for such findings [2].   7 1.5.3 Maintenance-dedicated transcription factors In models supporting a role for maintenance-dedicated transcription factors, transcription factors that were not present during the initiation of gene expression function thereafter in order to maintain gene expression (Figure 1D). In C. elegans ASE chemosensory neurons, Che-1, which is important for initiation and maintenance of effector gene expression, also initiates expression of the maintenance-dedicated transcription factor Ceh-36. Che-1 and Ceh-36 then collaborate to maintain the expression of effector genes [48]. Although this example provides evidence of a role for maintenance-dedicated transcription factors in sustaining effector gene expression, the concept could certainly be applied to the maintenance of transcription factor networks.  1.5.4 Maintenance by Trithorax-group proteins Roles for Trithorax- and Polycomb-group (TrxG/PcG) proteins were first described with regard to Drosophila homeobox-family homeotic genes, which encode transcription factors that establish the Drosophila body plan along the anterior-posterior axis in the developing embryo. The transcription factors that establish the expression patterns of these homeobox genes are only expressed very transiently and TrxG/PcG proteins function to organize the chromatin environments of homeobox genes into “on” or “off” states, such that the appropriate expression patterns are maintained after the transcription factors that established the expression patterns are no longer present.  TrxG complexes function to open local chromatin environments and thereby facilitate gene transcription. Conversely, PcG complexes facilitate tight packing of chromatin structures and thus serve to repress gene transcription. In Drosophila, multiple transcription factors have been implicated in the recruitment of TrxG or PcG members to CRMs known as Trithorax/Polycomb response elements (TRE/PREs). Importantly, TRE/PRE activities are dependent upon the spatiotemporal activities of the initiating CRMs with which they are paired,  8 and thus whether they participate in the maintenance of an active or repressed state is dependent upon the context-specific transcriptional states of the genes with which they are associated [51-57]. The roles of TrxG/PcG proteins are well-conserved to mammals; however, mammalian TRE/PREs are not well-defined [58]. Important in the context of this thesis is the fact that a role for TrxG/PcG proteins in maintaining transcription factor expression in long-lived post-mitotic cells such as neurons has not been established (Figure 1E).  Although section 3.9 of this thesis work investigates the requirement of a cis-regulatory region with putative TRE activity in the maintenance of transcription factor expression in mature neurons, the biochemical mechanisms of TrxG/PcG recruitment and function will not be addressed. These mechanisms are an active area of study and the reader is directed to recent reviews in order to appreciate the progress that has been made so far in elucidating their complexities [55,56,59,60].  Although each of the transcription factor maintenance models under consideration here have been discussed separately above, it is important to consider that various combinations of these strategies may be employed to maintain any single transcription factor network.   9  Figure 1.     10 Figure 1. Transcription factor maintenance models. (A) Representations of hypothetical transcription factor networks directing initiation and maintenance of cell identity. The purple circle, pink triangle and orange star represent terminal selectors that regulate initiation and maintenance of effector gene expression. The blue square and green hexagon represent upstream transcription factors that initiate terminal selector expression but are not present after development. (B-E) Proposed models for how the transcription factors that persist in mature neurons are maintained in the absence of their initiating inputs. (B) Auto-regulation, whereby each transcription factor maintains its own expression. (C) Cross-regulation, whereby the transcription factors maintain each other’s expression. (D) Stabilization of the network by maintenance-dedicated transcription factors (TFs) (brown oval). For simplicity the maintenance-dedicated transcription factor is shown to auto-regulate here, although other mechanisms could certainly be proposed. (E) Maintenance by TrxG proteins. TrxG proteins maintain open chromatin environments at each transcription factor gene locus. 	     11 1.6 Genomic organization of initiator and maintenance CRMs The models discussed above address possible transcription factor maintenance mechanisms at the trans-regulatory level. In order to further our understanding of these mechanisms, however, we must also consider how the corresponding CRMs are organized within the genome.  If we are to assume that different sets of transcription factors are involved in initiating and maintaining gene expression, then this evokes a mechanism whereby distinct CRMs may be postulated. Indeed, identification of differences in the CRMs that are necessary and sufficient for initiation and maintenance provides a useful experimental tool to demonstrate that differences between initiation and maintenance mechanisms actually exist. More specifically, for a given transcription factor gene, we may consider whether the genomic regions of initiation and maintenance are contained within a single experimentally-definable CRM region (either at the exact same motifs or at closely spaced but separable motifs that may be difficult to discriminate without identifying distinct trans-acting mechanisms), or whether initiation and maintenance are mediated through experimentally-separable CRMs (and thus a distinct mechanism is evident). All trans-regulatory maintenance models discussed above could be compatible with each of these scenarios. Let us consider, for example, two cases of transcription factor maintenance by auto-regulation: the transcription factor BMP-2 auto-regulates through one of the CRMs involved in the initiation of its expression in mouse osteoblasts, whereas the transcription factor Pit-1 auto-regulates through a distinct maintenance-dedicated CRM in mouse pituitary cells [61,62].  1.7 Drosophila Tv neurons as a model system This thesis uses Tv1 and Tv4 neurons as a model. These neurons are members of bilateral clusters of four neurons (the Tv neuron clusters) in each thoracic segment (Th1-3) of the D.  12 melanogaster ventral nerve cord (VNC). Tv1 and Tv4 neurons are of particular interest due to their highly specific expression of the effector neuropeptide genes Neuropeptide-like precursor 1 (Nplp1) and FMRF-amide (FMRFa), respectively. Expression of these neuropeptides is initiated during late embryonic stages and thereafter maintained throughout larval, pupal and adult life (Figure 2) [36]. Many groups have used expression of these neuropeptides as markers of the terminally differentiated identities of Tv1 and Tv4 neurons [63,64].   With these neuropeptide genes as terminal fate markers, the transcription factor cascades that specify Tv1 and Tv4 neurons and initiate the expression of these neuropeptides have become well-defined. In Tv1 neurons, the spatial selectors Antennapedia (Antp) and Homothorax (Hth) and the temporal selector Castor (Cas) initiate expression of the terminal selector Collier (Col) in post-mitotic neurons. Col, in turn, initiates the expression of the terminal selectors Apterous (Ap), Eyes absent (Eya) and Dimmed (Dimm). Ap and Eya also contribute to Dimm initiation. Col, Ap, Eya and Dimm initiate expression of Nplp1 (Figure 3A). In Tv4 neurons, the spatial selectors Antp and Hth, and the temporal selector Cas, initiate the expression of Col. Antp and Hth also initiate the expression of Dachshund (Dac), and Cas also initiates the expression of the temporal selector Grh, and the expression of Nab and Squeeze (Sqz). A series of regulatory interactions establishes the terminal selector network, which consists of Ap, Eya, Dimm, Dac and Sqz. Ap, Eya, Dimm, Dac and Sqz all initiate the expression of FMRFa. A target derived Bone Morphogenetic Protein (BMP) signal is also required to initiate the expression of FMRFa (Figure 3B) [63,65-69].  Work in our lab by Eade et al. (2012) contributed to the body of literature describing the requirement of developmental transcription factors for active maintenance of mature neuronal identities.  Using immunocytochemistry and adult-specific RNAi knock-down, Eade et al. demonstrated that the Tv1 and Tv4 terminal selector networks persist in mature neurons and are  13 required to actively maintain neuropeptide expression. Most of the transcription factors that initiated expression of the terminal selectors, however, are not expressed after development. In adult Tv1 neurons, Antp and Cas are no longer expressed. Col, Ap, Dimm and Eya expression are maintained and all are required to maintain Nplp1. However, although Col is necessary to initiate Ap, Eya and Dimm, it is not required to maintain them (Figure 3C). In adult Tv4 neurons, Antp, Hth, Cas, Nab, Grh and Col are no longer expressed, but Ap, Eya, Dimm, Dac and Sqz are maintained, and in combination with BMP signaling, all maintain FMRFa (Figure 3D). It is not resolved how the transcription factors that persist in adult Tv1 and Tv4 neurons are maintained, as only Dimm has been shown to have persistent input from Ap (in Tv1 and Tv4) and Eya (in Tv1) from initiation through to maintenance (Figure 3C,D) [36,70].  The work performed for this thesis aimed to further our understanding of how the Tv1 and Tv4 terminal selector networks are maintained in the absence of their initiating inputs.    14  Figure 2. D. melanogaster Tv clusters. The D. melanogaster central nervous system (CNS) contains six clusters of Tv neurons situated with bilateral symmetry in the three thoracic segments (Th1-3) of the VNC. These clusters consist of Tv1, Tv2, Tv3 and Tv4 neurons. The Tv1 and Tv4 neurons express the neuropeptides Nplp1 and FMRFa, respectively. Expression of these neuropeptides is initiated during late embryonic stages and is maintained throughout life. (Adapted from the “Atlas of Drosophila Development” by Volker Hartenstein)     15     Figure 3. Tv1 and Tv4 transcription factor networks. Transcription factors and regulatory relationships specific to development are shown in blue; those that exist both during development and in adult neurons are shown in black.     16 1.8 Identification of CRMs that regulate expression of ap and dimm During my undergraduate research in the Allan lab, I took the first step towards elucidating the mechanisms that govern maintenance of transcription factor networks in mature  Tv1 and Tv4 neurons. The aim was to identify CRMs responsible for initiation and/or maintenance of each transcription factor in the Tv1 and Tv4 transcription factor networks. To accomplish this, we performed a screen using D. melanogaster GAL4 lines generated by the Rubin group at Janelia Farms Research Institute [71]. These GAL4 lines report on the activity of 2-4 kb genomic fragments taken from intergenic and intronic regions (putative enhancer regions) of many D. melanogaster genes, including the transcription factor genes we are interested in. We screened all GAL4 lines driven from candidate CRM regions around each transcription factor by crossing them to UAS-nEGFP and testing for expression in Tv1 and Tv4 neurons. We dissected VNCs from late stage 17 embryos (Stg17) to test initiation activity and from day five adults (A5) to test maintenance activity. For ap we identified a 3.845 kb genomic fragment upstream of ap (apGal4-GMR42B11) that drove UAS-nEGFP expression in Tv1 and Tv4 neurons at Stg17, but not at A5 (Figure 4). This fragment will be named ap.K1 hereafter. For dimm we identified a 2.908 kb genomic fragment upstream of dimm (dimmGal4-GMR10G07) that drove UAS-nEGFP expression in Tv1 and Tv4 neurons at both Stg17 and A5 (Figure 5). These data suggested that we had identified a CRM region sufficient for initiation of ap in Tv1 and Tv4 neurons, but not maintenance, and also a CRM region sufficient for both initiation and maintenance of dimm expression in Tv1 and Tv4 neurons. Appendix B summarizes progress that has been made on eya CRMs. To more precisely define the location of the CRM(s) within the dimmGal4-GMR10G07 genomic fragment that is responsible for Tv1 and Tv4 expression, we used evolutionary conservation data available on the University of California Santa Cruz (UCSC) Genome Browser as a guide [72]. We reasoned that genomic regions that exhibit high evolutionary conservation  17 are more likely to be functionally relevant [72]. The region encompassed by dimmGal4-GMR10G07 contains three prominent conservation islands. The most downstream conservation island (CI.3) is also encompassed by the Janelia Gal4 line dimmGal4-GMR10D10, which we knew from our screen does not drive reporter expression in Tv1 or Tv4 neurons at Stg17 or A5; thus, we focused our attention on the two upstream conservation islands (CI.1 and CI.2) (Figure 6A). The regions encompassed by each of these two conservation islands were placed upstream of a DsRed fluorescent reporter gene. Each of these constructs was then integrated into the attP40 site on the second chromosome of the D. melanogaster genome by integrase-based transgenesis [73] (Appendix C). Only dimmDsRed-CI.2 exhibited reporter expression in Tv1 and Tv4 neurons at Stg17 and A5, suggesting that it encompasses the CRM(s) responsible for the expression pattern driven by dimmGal4-GMR10G07 (Figure 6B-C). Hereafter, dimmDsRed-CI.2 is referred to as dimm.K1-nDsRed.  Guided by our identification of ap.K1 and dimm.K1, the overall objective of this thesis work was to further our understanding of the cis- and trans-regulatory architecture that regulate initiation and maintenance of ap and dimm expression in Drosophila Tv1 and Tv4 neurons. 18  Figure 4. apGal4-GMR42B11 drives UAS-nGFP expression in Tv1 and Tv4 neurons at Stg17, but not A5. (A) A UCSC genome browser view of the ap locus. The ap gene is indicated with a blue arrow. The tiling black rectangles represent the 2-4 kb genomic regions we tested for reporter expression at Stg17 and A5. The red rectangle is apGal4-GMR42B11. (B-C) VNCs of apGal4-GMR42B11/UAS-nEGFP animals were dissected at Stg17 to test initiation activity and A5 to test maintenance activity. Dissected tissue was immunocytochemically stained with anti-Eya to visualize the Tv clusters and anti-Nplp1 and anti-FMRFa to visualize the Tv1 and Tv4 neurons respectively. apGal4-GMR42B11 drove expression of UAS-nEGFP in all Tv1 (arrow heads) and Tv4 (arrows) neurons at Stg17 (B-B’’’), but did not drive expression in any Tv1 or Tv4 neurons at A5 (C-C’’’).    19  Figure 5. dimmGal4-GMR10G07 drives UAS-nEGFP expression in Tv1 and Tv4 neurons at Stg17 and A5. (A) A UCSC genome browser view of the dimm locus. The dimm gene is indicated with a blue arrow. The tiling black rectangles represent the 2-4 kb genomic regions we tested for reporter expression at Stg17 and A5. The red rectangle is dimmGal4-GMR10G07. (B-C) VNCs of dimmGal4-GMR10G07/UAS-nEGFP animals were dissected at Stg17 to test initiation activity and A5 to test maintenance activity. dimmGal4-GMR10G07 drove expression of UAS-nEGFP in all Tv1 (arrow heads) and Tv4 (arrows) neurons at both Stg17 (B-B’’’) and A5 (C-C’’’). Since dimm is only expressed in the neuropeptidergic Tv1 and Tv4 neurons of each Tv cluster, the specificity of reporter gene expression to Tv1 and Tv4 advocates for the fidelity of the regulatory region.   20     Figure 6. dimmDsRed-CI.2 drives reporter expression in Tv1 and Tv4 neurons at Stg17 and A5. (A) A UCSC genome browser view of the genomic region encompassed by dimmGal4-GMR10G07. The limits of the three prominent conservation islands in this region are shown with blue dashed lines. The most downstream conservation island (3) is also encompassed by the Janelia GAL4 line dimmGal4-GMR10D10 (red arrow) which we knew from our screen does not drive reporter expression in Tv1 or Tv4 neurons at Stg17 or A5; thus, we focused our attention on the two upstream conservation islands (CI.1 and CI.2, pink rectangles). Only CI.2 (pink arrow) drove reporter expression in Tv1 and Tv4 neurons at Stg17 (B-B’’’) and A5 (C-C’’’). This suggests that CI.2 encompasses the CRM(s) responsible for the expression pattern driven by dimmGal4-GMR10G07. 	     21 1.9 Thesis objectives 1.9.1 Characterizing the role of dimm.K1 in the initiation and maintenance of dimm expression in Drosophila Tv1 and Tv4 neurons We aimed to test the hypothesis that dimm.K1 encompasses the CRM(s) regulating initiation and maintenance of dimm expression. More specifically we aimed to: (1) Confirm the fidelity of dimm.K1 as a true dimm enhancer that is sufficient to drive reporter activity in a Dimm-specific expression pattern throughout the VNC. (2) Assess the necessity of dimm.K1 for dimm expression in Tv1 and Tv4 neurons. (3) Compare regulation of dimm.K1-nDsRed and Dimm protein by known Tv1 and Tv4 terminal selectors at initiation and maintenance stages.  1.9.2 Characterizing the cis-regulatory architecture that regulates initiation and maintenance of ap expression in Drosophila Tv1 and Tv4 neurons To further characterize the cis-regulatory architecture that regulates initiation and maintenance of ap expression in Drosophila Tv1 and Tv4 neurons we aimed to: (1) Assess the necessity of ap.K1 for ap expression in Tv1 and Tv4 neurons. (2) Identify the CRM(s) required to maintain ap expression.    22 2. MATERIALS AND METHODS 2.1 Fly strains apterousmd544 (apGal4) and apP44 [74]; eyaCli-IID [75]; eyaD1 [76]; dac3 [77]; Df(2L)Exel7066 (DacDf) (Bloomington, IN); sqzIE [65]; witA12 and witB11 [78]; tubP>Gal80TS (temperature sensitive GAL80 under control of the Drosophila tubulin 84B promoter) [79]; UAS-nEGFP (nuclear localized EGFP); UAS-dicer2 [80]; UAS-dimm [81]; UAS-tkvΔGSK [GS-box and kinase domain deletion, referred to here as UAS-tkvDN][82]; UAS-witΔΙ [intracellular domain deletion, referred to here as UAS-witDN] [83]; coldsRNAi #24E [63]; apdsRNAi 8376R-2 and dacdsRNAi 4952R-2 and sqzdsRNAi 5557R-2 (NIG-FLY); dimmdsRNAi GD44470 (VDRC); eyadsRNAi JF03160 and hthdsRNAi JF02733 (TRiP); w1118 . Alleles were maintained over fluorescently tagged (GFP) balancer chromosomes and GFP was selected against as necessary to acquire animals of the appropriate genotypes.   2.2 Transgene construction Empty pThunderbird EGFP vector was generated from Tv-nEYFP and from EGFP sequence within pHstinger [84,85]. Putative ap enhancer regions were amplified from genomic DNA using the primers listed in Table 1. Assembled genomic regions consisting of the putative ap initiation and maintenance elements were joined by SOE PCR. Assembled regions were digested with BglII and Acc65I and ligated into BglII and Acc65I digested pThunderbird EGFP empty vector.  2.3 Fly transgenesis All transgenesis was performed by Rainbow Transgenic Flies Inc. (Camarillo, CA, USA). Single copies of each transgene were individually and unidirectionally integrated into the  23 attPVK00033 site on the third chromosome of the D. melanogaster genome using phiC31 integrase-based transgenesis [73].   2.4 Fly husbandry Flies were maintained on standard cornmeal food preserved with methylparaben, antibiotics (tetracycline and streptomycin OR tetracycline and ampicillin) and sodium potassium tartrate. All experiments were performed in stable environment rooms with temperatures of 18°C, 25°C or 29°C and 70% humidity. Flies were grown and maintained at 25°C (unless used for temporal induction protocols; see below). Embryos were grown on grape plates supplemented with yeast paste and dechorionated using 50% bleach. Late stage 17 embryos with mouth hooks and air filled trachea were selected for dissection. For adults, vials were cleared as progeny began to eclose. A1s were collected 24 hours later and maintained until the ages indicated in sections 3.1-3.3 and 3.8-3.9.  For temporal genetic manipulations (transcription factor over-expression or dsRNAi-mediated transcription factor knockdown), we used the TARGET system [79]. We crossed a screener fly (apGAL4, dimm.K1-nDsRed/[CyOAG] ; tubP>Gal80TS, UAS-nEGFP/[TM3SerAG]) to either a control fly (w1118  or UAS-dicer2)  or an experimental fly genotype (UAS-transgene or UAS-dicer {;;} UAS-dsRNAi). Progeny were grown from embryonic stages at 18°C to prevent GAL4 activation. Vials were cleared as progeny began to eclose. A1 adults were collected 24 hours later and placed at 29°C for induction times optimized by Eade et al. [36]. 2.5 Antibodies Primary Antibodies: guinea pig anti-Col (1:1000, gift from Adrian Moore, RIKEN, Japan); mouse anti-Dac (1:10; Mab 2 – 3) and mouse anti-Eya (1:10; clone 10H6) (Developmental Studies Hybridoma Bank, Iowa U, Iowa); guinea pig anti-Dimm (1:1000) and rabbit anti-FMRFa (1:4000) and chicken anti-Nplp1 (1:1000) (gifts from S. Thor, Linkoping U,  24 Sweden). Secondary Antibodies: donkey anti-chicken Alexa 647, Alexa 488, Alexa 405 and donkey anti-guinea pig Alexa 647 and donkey anti-mouse Alexa 488, Alexa 647 and donkey anti-rabbit Alexa 405, Alexa 488, Alexa 647 (all 1:100, Invitrogen, Carlsbad, USA); donkey anti-mouse Cy3 (1:100, Jackson Immunoresearch, West Grobe, USA).  2.6 Immunocytochemistry VNCs were dissected in ice-cold phosphate-buffered saline (PBS) and then fixed in ice-cold 4% formaldehyde diluted in 0.1% PBT (PBS containing 0.1% Triton X-100) for 30 minutes. Tissue was washed with 0.3% PBT (PB3T) and then incubated in PB3T containing 5% Donkey Serum (PB3T-DS). Transcription factor primary antibodies were incubated overnight at 4°C. Neuropeptide primary antibodies were incubated for two hours at room temperature. Tissue was washed with PB3T and then incubated in PB3T-DS. Secondary antibodies were incubated for two hours at room temperature. Tissue was washed with PB3T and then mounted in Vectashield (Vector). All antibodies were diluted in PB3T-DS. Control and experimental genotypes were dissected at the same time and mounted in the same well in order to ensure that time to fixation was normalized between genotypes and that the treatment of all tissue was identical.   2.7 Image and statistical analysis All images were acquired with Olympus FV1000 confocal microscopes. In embryos, Tv neurons from all thoracic segments were analyzed. In adults, only Tv neurons from Th1 and Th3 were analyzed; a second Tv neuron begins expressing FMRFa at pupal stages in Th2, which makes it difficult to unambiguously distinguish the Tv4 neuron. Images of control and experimental samples for any given experiment were acquired with identical settings and within the same imaging session. To confirm any instances of undetectable expression in experimental  25 animals, images were also captured at settings of maximum sensitivity. For comparison of fluorescence intensities, mean pixel intensity for each neuron was measured from summed Z-projection in Image J (US National Institutes of Health). Each measurement was corrected for background fluorescence and expressed as the percentage of the mean of control for each experiment. All statistical analyses and graphs were generated using Prism 5 software (Graphpad). Data is presented as Mean +/- SEM. Two-tailed t-tests were used to determine statistical significance. Differences between groups were considered to be statistically significant when p<0.05. Body segment specific responses of dimm.K1 reporter to genetic perturbations were observed, thus all quantified reporter intensities have been reported separately for Th1, Th2 and Th3 neurons.   26 For the construction of ap.K1.M ap.K1 Forward  ATACTTAGATCTGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCTAAAGCGGTCCTAGTATACCCGGATACC ap.K1 Reverse  TTCCTATACTTTCTAGAGAATAGGAACTTCGGTCGGAACCTTTTGTTCCTATACCC ap.M Forward  GACCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATGACAGTTCTTATTGGAAGCAGGC ap.M Reverse  TCGCGGGGTACCCCTGTTTCTGTGTCGATTCTCCTTC SOE PCR Forward ap.K1 Forward  SOE PCR Reverse ap.M Reverse   Table 1. Primers used to generate putative ap enhancer transgene. Restriction digestion sites are highlighted in red, FRT sites are italicized and over-lapping regions engineered for SOE PCRs are underlined.    27 3. RESULTS 3.1 All neurons of the VNC that express dimm.K1-nDsRed also express Dimm. In addition to initiating and maintaining reporter expression in Tv1 and Tv4 neurons (Figure 6), dimm.K1 also drives reporter expression in other cells of the VNC at Stg17 and A5. This is consistent with the fact that Dimm is expressed in many additional VNC neuropeptidergic cells [86]. We tested whether dimm.K1 reporter activity is restricted to Dimm-expressing neurons, in order to assess the fidelity of dimm.K1 as a true dimm enhancer. Stg17 and A5 dimm.K1-nDsRed VNCs were stained with anti-Dimm and co-localization between dimm.K1 reporter and Dimm was assessed. We found that in all Stg17 (n=5) and A5 (n=5) VNCs observed, every neuron that expressed dimm.K1-nDsRed also expressed Dimm (Figure 7). Thus, we conclude that dimm.K1 encompasses a true dimm enhancer that does not generate ectopic activity when isolated into a reporter transgene.        28  Figure 7. Co-localization of dimm.K1-nDsRed and anti-Dimm in the VNC. In all Stg17 and A5 VNCs observed, every neuron that expressed dimm.K1-nDsRed also expressed Dimm. Notably, not all Dimm-expressing neurons co-express dimm.K1-nDsRed. This is likely due to the fact that other dimm enhancer regions control dimm expression in those neurons. (A) A single Z-slice through the Stg17 CNS (outlined in white) that is representative of dimm.K1-nDsRed and anti-Dimm overlap. The area within the white rectangular box is shown at higher magnification in A’-A’’’. (B) A full Z-projection of the entire A5 VNC (outlined in white). A single Z-slice in the dorsal region of the VNC within the white rectangular box is shown at higher magnification in B’-B’’’.          29 3.2 dimm.K1 drives long-term reporter maintenance in Tv1 and Tv4 neurons. We assessed the sufficiency of dimm.K1 to drive life-long maintenance of reporter expression in adult Tv1 and Tv4 neurons. dimm.K1 reporter intensities were assessed in A20 and A45 animals using A1 intensities as a reference point. The intensities of anti-Dimm were assessed simultaneously in order to distinguish between potential decreases in dimm.K1 reporter intensities that could suggest a decrease in the sufficiency of dimm.K1 to drive gene expression, and those that correlate with changes in the expression of Dimm itself. Both Dimm and dimm.K1 reporter were expressed robustly at A1, A20 and A45 (Figure 8) and dimm.K1 reporter intensity was maintained in all neurons (Figure 9).     30  Figure 8. dimm.K1-nDsRed and anti-Dimm at A1, A20 and A45. Intensities of anti-Dimm and dimm.K1 reporter were assessed in A20 and A45 animals, using A1 as a reference point. Tissue was stained with anti-Eya and anti-Dimm. Both dimm.K1-nDsRed and Dimm continue to be expressed robustly in Tv1 and Tv4 neurons (white arrows) at A20 (B-B''') and A45 (D-D''').      31  Figure 9. Quantification of dimm.K1-nDsRed and anti-Dimm intensities at A20 and A45, relative to A1. The intensities of dimm.K1-nDsRed and anti-Dimm at A20 and A45, relative to A1. Relative intensities are presented as the % mean of A1 expression levels +/- SEM. Student's two-tailed t-tests were used to compare each type of neuron (Tv1-Th1, Tv1-Th3, Tv4-Th1 and Tv4-Th3) between the two ages indicated (*=p<0.05). Intensities of anti-Dimm are shown in green and dimm.K1-nDsRed intensities are shown in pink. Detailed statistics are provided in Table 2 (Appendix A). The intensity of dimm.K1 reporter is maintained in all Tv1 and Tv4 neurons.     32 3.3 dimm.K1 is necessary for dimm expression in Tv1 and Tv4 neurons. The Thor lab generated a line (dimmΔ1141) in which the genomic region encompassing endogenous dimm.K1 is deleted (Figure 10A), and also a transgenic line (dimm.1141-nEGFP) that reports expression driven by the deleted fragment. They found that embryonic Tv1 neurons fail to express Dimm protein in the deletion mutant and that the reporter generates expression in embryonic Tv1 neurons (unpublished personal communication). In order to verify that their reporter also initiates expression in Tv4 neurons, and maintains expression in Tv1 and Tv4 neurons, we generated a fly line combining both dimm reporters (dimm.K1-nDsRed/+ ; dimm.1141-nEGFP/+) and dissected these animals at Stg17 to test initiation and at A5 to test maintenance. Reporter expression was driven by both dimm.K1 and dimm.1141 in all Tv1 and Tv4 neurons at Stg17 (n=27) (Figure 10B) and A5 (n=31) (Figure 10C). We then tested whether dimm.K1/dimm.1141 is necessary for dimm initiation in Tv4 neurons; w1118 (control) and dimmΔ1141 VNCs were dissected at Stg17 and we found that Dimm was robustly expressed in all w1118 Tv4 neurons (n=44) (Figure 11A) but could not be detected in any dimmΔ1141 Tv4 neurons (n=54) (Figure 11B). Thus, dimm.1141 is indeed necessary to initiate dimm expression in Tv4 neurons.   We also dissected w1118 (control) and dimmΔ1141 VNCs at A5. All w1118  Tv1 (n=31) and Tv4 (n=34) neurons exhibited robust Dimm expression (Figure 11C), but Dimm was not detected in any dimmΔ1141 Tv1 (n=59) or Tv4 (n=62) neurons (Figure 11D).        33  Figure 10. Co-expression of dimm.1141 and dimm.K1 reporters verifies that these overlapping regions both report initiation and maintenance in Tv1 and Tv4 neurons. (A) A UCSC genome browser comparison of the genomic regions encompassed by dimm.K1 (pink) and dimm.1141 (light green). Both encompass the same well-conserved island (dark green peaks) likely to contain all regulatory information pertinent to initiation and maintenance of reporter expression in Tv1 and Tv4 neurons. (B-C) To confirm that dimm.1141 is sufficient to initiate and maintain reporter expression in Tv1 and Tv4 neurons, VNCs of dimm.K1-nDsRed/ + ; dimm.1141-nEGFP/+ animals were dissected at Stg17 (initiation) and A5 (maintenance). The Tv clusters were identified using anti-Eya, and we found that dimm.K1 and dimm.1141 reporters consistently co-localize in two neurons of each Tv cluster (white arrows) at both Stg17 (B-B’’’) and A5 (C-C’’’), indicating that, like dimm.K1, dimm.1141 is sufficient to initiate and maintain reporter expression in Tv1 and Tv4 neurons.   34  Figure 11. dimm.1141 is necessary for dimm expression in Tv1 and Tv4 neurons. (A-B) Stg17 w1118 (control) and dimmΔ1141 VNCs were stained with anti-Eya to visualize the Tv clusters, anti-Nplp1 to visualize the Tv1 neurons and anti-FMRFa to visualize the Tv4 neurons, and anti-Dimm. Dimm expression was robust in all control Tv1 (arrow heads) and Tv4 (arrows) neurons (A-A’’’), but could not be detected in any dimmΔ1141 Tv clusters (B-B’’’). (C-D) At A5 Dimm expression was robust in all control Tv1 (arrow heads) and Tv4 (arrows) neurons (C-C’’’), but could not be detected in any dimmΔ1141 Tv clusters (D-D’’’). Thus, dimm.K1/dimm1141 is necessary for dimm expression in Tv1 and Tv4 neurons.   35 3.4 Initiation of dimm.K1-nDsRed expression in Tv1 and Tv4 neurons is dependent upon the same transcription factors as initiation of Dimm. 	   In order to test the utility of the dimm.K1-nDsRed reporter as a valid dimm reporter and also as a primary CRM for dimm, we tested whether its expression in Stg17 Tv1 and Tv4 neurons is dependent upon input from the same known transcription factors as Dimm itself. The Thor lab is studying dimm initiation in Tv1, so we restricted our quantitative analysis to Tv4 neurons. We did, however, make qualitative observations regarding Tv1 that facilitate the interpretation of results presented in upcoming sections.  In addition to Dimm, the Tv4 terminal selector network consists of Ap, Eya, Dac, Sqz and pMad (BMP signalling). Whereas all of these transcription factors contribute to FMRFa initiation, only Ap and Eya contribute to Dimm initiation (Figure 12A) [63, 65-67, 69]. To test inputs required for dimm.K1-nDsRed expression, the reporter was placed in mutant backgrounds for all Tv4 terminal selectors, and the intensity of dimm.K1 reporter relative to controls was quantified at Stg17. In ap mutants, Tv4 dimm.K1 reporter intensity was severely reduced to 10% (Th1), 22% (Th2) and 29% (Th3) of controls; p<0.0001 for all (Figure 12B). In eya mutants dimm.K1 reporter was not detectable in any thoracic segments of the VNC (Figure 12F). No significant decrease in dimm.K1 reporter intensity was observed in the Tv4 neurons of dac, sqz or wit (BMP) mutants relative to controls (Figure 12C-E). The only unexpected finding was the significant up-regulation (to 134%; p=0.02) of dimm.K1 reporter intensity in Th3 of dac mutants (Figure 12C).  Overall these data are consistent with previous data showing that Dimm protein expression in Tv4 neurons is Ap and Eya dependent (summarized in Figure 12A). We also observed a total loss of dimm.K1-nDsRed expression in Stg17 Tv1 neurons of ap and eya mutants (Figure 24, Figure 12F), equivalent to data showing that Dimm expression in Tv1 neurons is Ap and Eya dependent [63]. Thus Ap and Eya are required to initiate expression of  36 dimm.K1-nDsRed in both Tv1 and Tv4 neurons (summarized in Figure 12G). We conclude that initiation of dimm expression in Tv1 and Tv4 neurons occurs through the activity of Ap and Eya at the dimm.K1 CRM. 	      37     Figure 12.   38  Figure 12. Initiation of dimm.K1-nDsRed expression in Tv4 neurons. (A) The Tv4 terminal selector initiation network defined previously. Only Ap and Eya contribute to Dimm initiation. (B-F) Tv4 dimm.K1-nDsRed  activity was examined in all transcription factor mutant backgrounds. (B-E) The intensity of dimm.K1 reporter relative to controls (ctrl) was quantified in Tv4 neurons and the relative intensities are presented as the % mean of control expression levels +/- SEM. Student's two-tailed t-tests were used to compare control and experimental populations (*=p<0.05). Ap and Eya are required for dimm.K1 reporter activity in Tv4 neurons, whereas Dac, Sqz and BMP signalling are not. The asterisks in F mark the posterior limit of the VNC’s thoracic segments. (G) A summary of our findings confirming that initiation of dimm.K1-nDsRed expression requires Ap and Eya, just as previously found for Dimm protein. Genotypes. Control: dimm.K1-nDsRed/dimm.K1-nDsRed. Experimentals: (B) apGal4, dimm.K1-nDsRed/apP44, dimm.K1-nDsRed (C) dac3, dimm.K1-nDsRed/ Df(2L)Exel7066(DacDf), dimm.K1-nDsRed (D) dimm.K1-nDsRed/dimm.K1-nDsRed ; sqzIE/sqzIE (E) dimm.K1-nDsRed/dimm.K1-nDsRed ; witA12/ witB11 (F) eyaCli-IID, dimm.K1-nDsRed /eyaD1, dimm.K1-nDsRed. 	     39 3.5 Dimm auto-regulates its own maintenance through dimm.K1, in Tv4 only Eade et al. demonstrated differences in the transcription factors that initiate and maintain Dimm in Tv1 and Tv4 neurons. Ap, Eya and Col all initiate Dimm. In Tv1 neurons, only Ap and Eya maintain Dimm. In Tv4 neurons, only Ap regulates Dimm maintenance (Figure 3) [36]. We undertook an analysis of the transcription factors that maintain dimm.K1 reporter activity in Tv1 and Tv4 neurons. First, we explored the mechanism of auto-regulation.  The TARGET system was used to knockdown (dimmdsRNAi) Dimm from A1 onwards in Tv1 and Tv4 neurons, after normal development [79]. Successful knockdown of Dimm was confirmed by anti-Dimm immunocytochemistry (Figure 25). Induction of dimmdsRNAi  at A1 had distinct effects in Tv1 and Tv4 neurons by A10. In Tv1, no significant effect on dimm-K1 reporter intensity was observed (Figure 13A). However, in Tv4, dimm-K1 reporter intensity was reduced to 40% (p<0.0001) in Th1 and 71% (p=0.0006) in Th3 (Figure 13B). We wished to test the sufficiency of Dimm for auto-maintenance, to verify this apparent Tv4-specific effect. Using the TARGET system we overexpressed Dimm (UAS-Dimm) in Tv1 and Tv4 neurons from A1 onwards; successful over-expression of Dimm was confirmed by immunocytochemistry (Figure 26). We observed increased dimm-K1 reporter intensity in Tv4 neurons to 150% (p<0.0005) of control levels, but no effect on dimm-K1 reporter intensity in Tv1 neurons (Figure 13C,D).  Thus, by loss and gain of function tests, we confirm that dimm auto-maintenance through dimm.K1 only occurs in Tv4 neurons.     	     40  Figure 13. Dimm regulates maintenance of dimm.K1-nDsRed in Tv4, but not Tv1, neurons. The TARGET system was used to knockdown (dimmdsRNAi) or over-express (UAS-dimm) Dimm in Tv1 and Tv4 neurons, at A1. Intensity of dimm.K1 reporter relative to controls was quantified. Relative intensities are presented as the % mean of control expression levels +/- SEM. Student's two-tailed t-tests were used to compare control and experimental populations (*=p<0.05). Loss or gain of Dimm expression only affected dimm.K1 reporter activity in Tv4 neurons; our data indicates that loss of Dimm reduces dimm.K1 reporter activity and excess Dimm increases dimm.K1 reporter activity. We conclude that Dimm becomes auto-regulatory in Tv4 neurons. Genotypes in A and B: Ctrl (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/+), Dimm knockdown (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/rev4, UAS-dimmdsRNAi ; tubP>Gal80TS, UAS-nEGFP/+) Genotypes in C and D: Ctrl (apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP), Dimm over-expression (apGal4, dimm.K1-nDsRed/UAS-dimm ; tubP>Gal80TS , UAS-nEGFP).   41 3.6 Maintenance of dimm.K1-nDsRed in Tv1 neurons Col, Ap, Eya and Dimm all initiate and maintain Nplp1 in Tv1 neurons, but only Ap and Eya (and not Col) continue to regulate expression of Dimm in adult Tv1 neurons (Figure 14A) [36]. We assessed whether maintenance of dimm.K1-nDsRed in Tv1 neurons is regulated by these same transcription factors. Using the TARGET system we knocked down Ap, Col and Eya in adult Tv1 neurons at A1. Successful knockdown of each transcription factor was confirmed by immunocytochemistry (Figure 27). Knockdown of Ap (apdsRNAi) reduced dimm.K1 reporter intenisty to 60% (p=0.0014) of control levels in Th1, but had no effect in Th3 neurons by A20 (Figure 14B). Knockdown of Col (coldsRNAi) had no significant effect on dimm.K1 reporter intensity by A10 (Figure 14C). Knockdown of Eya (eyadsRNAi) increased dimm.K1 reporter intensity to 190% (p<0.0025) of control levels by A20 (Figure 14D). Recent work identified a role for Hth in Tv neuron development [68]. Prior to this thesis work, we had found that Hth continues to be expressed in adult Tv1 neurons, but that knockdown of Hth (hthdsRNAi) at A1 had no obvious effect on Nplp1 immunoreactivity by A15, suggesting that Hth does not regulate maintenance of Nplp1 or the Tv1 terminal selectors that are required for Nplp1 maintenance (data not shown). We addressed the role of Hth in the maintenance of Tv1 identity and the maintenance of Dimm expression more rigorously by quantifying the effects of its knockdown on Nplp1 immunoreactivity, Dimm immunoreactivity and dimm.K1 reporter intensity. Hth knockdown had no significant effect on Nplp1 immunoreactivity (Figure 14E). Intriguingly, however, anti-Dimm intensity increased to 146% (p=0.0096) of control levels in Th1 neurons, and dimm.K1 reporter intensity increased to 1781% (p<0.0001) in Th1 and 330% (p<0.0001) in Th3 (Figures 14F,G).   42 A summary of these findings is provided in Figure 14H, which illustrates the roles of each Tv1 terminal selector in the maintenance of dimm.K1 reporter activity and Dimm protein levels.                             43      Figure 14.   44  Figure 14. Maintenance of dimm.K1-nDsRed in Tv1 neurons. (A) The previously defined Tv1 adult terminal selector network. Gray dotted arrows: regulatory relationships specific to initiation. Black arrows: regulatory relationships that exist at initiation and maintenance. (B-D) The TARGET system was used to knockdown Ap, Col and Eya from A1 onwards and the intensity of dimm.K1 reporter relative to controls was quantified. Ap knockdown only decreased dimm.K1 reporter activity in Th1, Col knockdown had no effect on dimm.K1 reporter activity and Eya knockdown up-regulated dimm.K1 reporter activity in Th1 and Th3. (E-G) The TARGET system was used to knockdown Hth from A1 onwards. Hth knockdown had no effect on Nplp1 immunoreactivity, but up-regulated Dimm immunoreactivity in Th1 and upregulated dimm.K1 reporter activity in Th1 and Th3. For all data, relative intensities are presented as the % mean of control expression levels +/- SEM. Student's two-tailed t-tests were used to compare control and experimental populations (* = p<0.05). (H) A summary of terminal selector maintenance function, highlighting our findings that a transcription factor’s role can be body-segment specific, and can differ for dimm.K1 and Dimm protein maintenance. Black arrows represent regulatory relationships that exist both during development and in adult neurons. Blue arrows represent maintenance-specific relationships. Genotypes: Ctrl (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/+), Ap KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-apdsRNAi), Col KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-coldsRNAi), Eya KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-eyadsRNAi), Hth KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-hthdsRNAi).   	     45 3.7 Maintenance of dimm.K1-nDsRed in Tv4 neurons. Eade et al. (2012) demonstrated that Ap, Eya, Dimm, Dac, Sqz and BMP signaling all maintain FMRFa in the adult, and also that although Ap and Eya both initiate Dimm, only Ap maintains Dimm (Figure 15A) [36]. Here we assessed how these data on Dimm protein compare to dimm.K1-nDsRed maintenance in adults. As above, we knocked down Ap, Eya, Dac, Sqz and BMP signalling and quantified the intensity dimm.K1 reporter relative to controls. Successful knockdown of each transcription factor was confirmed by immunocytochemistry (Figure 28). Ap knockdown reduced dimm.K1 reporter intensity to 20% (p<0.0001) of controls by A20 (Figure 15B).  Knockdown of BMP signaling (tkvDN ; witDN) reduced dimm.K1 reporter intensity to 19% in Th1 (p=0.0001) and 15% in Th3 (p=0.0096) by A10. (Figure 15C). Dac knockdown (dacdsRNAi) reduced dimm.K1 reporter intensity to 49% in Th1 (p=0.0032) and 65% in Th3 (p=0.0030) by A10. (Figure 15D). Eya knockdown reduced dimm.K1 reporter intensity to 25% (p<0.0003) of control levels by A20 (Figure 15E). Sqz knockdown (sqzdsRNAi) reduced dimm.K1 reporter intensity to 54% in Th1 (p=0.0001) and 74% in Th3 (p=0.0037) by A15 (Figure 15F).  Since knockdown of every terminal selector resulted in a decrease in dimm.K1 reporter intensity in Tv4 neurons, we wished to help eliminate concerns of non-specific effects. We confirmed that adult-specific expression of coldsRNAi had no effect on dimm.K1 reporter intensity in Tv4 neurons by A10. We also confirmed that knockdown of Tv4 specific regulators, such as BMP signalling, did not decrease reporter expression in Tv1 neurons. Further, we confirmed differences between dimm.K1-nDsRed and Dimm responses to genetic perturbation in the same neurons. Following Eya knock-down we simultaneously measured anti-Dimm and dimm.K1 reporter intensities; the effects on dimm.K1 reporter intensities are presented in Figures 14D and 15E, and the effects on anti-Dimm intensities were consistent with previously published work (Figure 29) [36].  A summary of these findings is provided in Figure 15G, which illustrates the roles of each Tv4 terminal selector in the maintenance of dimm.K1 reporter activity and Dimm protein  46 levels. In addition, a comprehensive summary of all adult Tv1 and Tv4 findings is provided in Figure 16.    47   	   	   Figure 15.  48 Figure 15. Maintenance of dimm.K1-nDsRed in Tv4 neurons. (A) The previously identified Tv4 adult terminal selector network. Gray dotted arrows: regulatory relationships specific to initiation. Black arrows: regulatory relationships that exist at initiation and maintenance. (B-F) Knockdown of terminal selectors and quantification of dimm.K1 reporter intensities relative to controls. Relative intensities are presented as the % mean of control expression levels +/- SEM. Student's two-tailed t-tests were used to compare control and experimental populations (* = p<0.05). (G) A summary of terminal selector maintenance function. Black arrows represent regulatory relationships that exist both during development and in adult neurons. Blue arrows represent maintenance-specific relationships. Adult-specific genetic perturbations can have different consequences for dimm.K1-nDsRed than they do for Dimm. Genotypes: Ctrls (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/+ and apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS,UAS-nEGFP/+), Ap KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/UAS-apdsRNAi), BMP KD (apGal4, dimm.K1-nDsRed/UAS-tkvDN ; tubP>Gal80TS, UAS-nEGFP/UAS-witDN), Dac KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/dac3, UAS-dacdsRNAi ; tubP>Gal80TS, UAS-nEGFP/+), Eya KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/UAS-eyadsRNAi), Sqz KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/UAS-sqzdsRNAi). 	     49  Figure 16. Maintenance of dimm.K1 and Dimm. A comprehensive summary of how known terminal selectors regulate maintenance of dimm.K1-nDsRed and Dimm protein in Tv1 and Tv4 neurons. Black arrows: regulatory relationships that exist at both initiation and maintenance. Blue arrows: regulatory relationships that exist at maintenance only.      50 3.8 ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons. Prior to this thesis work we had identified ap.K1, a ~3.8 kb region of genomic DNA upstream of ap that is sufficient to initiate, but not maintain, reporter expression in Tv1 and Tv4 neurons. The Thor lab generated a line (apΔS) in which a genomic region overlapping with endogenous ap.K1 is deleted (Figure 17A). A reliable Ap antibody was not available, so they demonstrated that this region is necessary to initiate ap expression in Tv1 neurons by showing that Stg17 deletion mutants exhibit a reduction in Nplp1 expression that phenocopies ap mutants (unpublished personal communication). We tested whether the ap.K1/ap.S CRM region is necessary for ap initiation in Tv4 neurons.  We dissected w1118 (control) and apΔS VNCs at Stg17 and found that anti-FMRFa intensity in apΔS  Tv4 neurons (n=35) was reduced to 33% of controls (n=36); p<0.0001. Since this result also phenocopies ap mutants, we conclude that ap.K1/ap.S is necessary to initiate ap expression in Tv4 neurons [85]. We also confirmed the Nplp1 phenotype, observing that all (n=36) w1118 Tv1 neurons exhibited robust anti-Nplp1, whereas only 30% (n=36) of apΔS Tv1 neurons exhibited anti-Nplp1 immunoreactivity, and this was severely reduced compared to wild-type (Figure 17B-D). We also assessed neuropeptide expression in w1118 (control) and apΔS Tv1 and Tv4 neurons at A2 (apΔS animals do not survive to A5). All (n=40) w1118 Tv1 neurons exhibited robust anti-Nplp1, whereas only 27% (n=40) of apΔS Tv1 neurons exhibited Nplp1 immunoreactivity, and this was severely reduced compared to wild-type. Similarly, but not as dramatically, the intensity of FMRFa immunoreactivity in apΔS Tv4 neurons (n=26) was reduced to 56% of controls (n=30); p<0.0001 (Figure 17E-G).     51    Figure 17.     52 Figure 17. ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons. (A) A UCSC genome browser comparison of the genomic regions encompassed by ap.K1 (pink) and ap.S (blue). (B) A representative Stg17 w1118  (control) Tv cluster. (C) A representative Stg17 apΔS Tv cluster. (D) At Stg17 anti-FMRFa intensity in apΔS Tv4 neurons was reduced to 33% of controls and only 30% of apΔS Tv1 neurons were positive for anti-Nplp1. (E) A representative A2 w1118  Tv cluster. (F) A representative A2 apΔS Tv cluster. (G) At Stg17 anti-FMRFa intensity in apΔS Tv4 neurons (n=35) was reduced to 56% of controls and only 27% of apΔS Tv1 neurons were positive for anti-Nplp1. Relative intensities are presented as the % mean of control expression levels +/- SEM. Student's two-tailed t-tests were used to compare control and experimental populations (*=p<0.05). 	     53 3.9 Identification of a putative Tv1 and Tv4 ap maintenance CRM Ap’s expression pattern in the Drosophila larval imaginal wing disc is crucial to proper development of the adult wing. Importantly, Ap is expressed exclusively in the dorsal compartment of this tissue, and several lines of evidence support a model in which PcG proteins are recruited to a TRE/PRE proximal to the ap promoter in order to suppress ap expression in the ventral compartment [87-90]. Bieli et al. (2015) demonstrated that ap expression in the dorsal compartment is initiated and refined by two CRMs located upstream of ap, and that the TRE/PRE proximal to the ap promoter works synergistically with these two elements to maintain ap expression as the wing disc continues to develop [91]. They further demonstrated that the maintenance function of the TRE/PRE is dependent upon TrxG proteins. Thus, ultimately, these data support a model in which the TRE/PRE proximal to the ap promoter acts as a PRE in the ventral compartment of the wing disc, where it recruits PcG proteins to keep ap expression off, and as a TRE in the dorsal compartment, where it recruits TrxG proteins to keep ap expression on. We tested whether the TRE/PRE-encompassing region further characterized by Bieli et al. maintains ap expression in Tv1 and Tv4 neurons as it does in the dorsal compartment of the imaginal wing disc. We placed ap.K1 and the putative maintenance element (M) upstream of a nuclear-localized EGFP encoding reporter gene and integrated this construct into the third chromosome of the D. melanogaster genome. ap.K1.M-nEGFP VNCs were dissected at Stg17 to test initiation and A5 to test maintenance. We found that ap.K1.M drove reporter expression in Tv1 and Tv4 neurons at both Stg17 and A5 (Figure 18). Thus the addition of the M element adds a maintenance function to the ap.K1 CRM, indicating that M is a functional maintenance element.    54     Figure 18. Identification of a putative Tv1 and Tv4 ap maintenance CRM. (A) A UCSC genome browser view of the ap locus. The ap gene is indicated with a blue arrow. The red rectangule represents ap.K1 and the black rectangle represents the putative maintenance element. (B-D) We dissected ap.K1.M-nEGFP VNCs at Stg17 to test initiation and A5 to test maintenance. Tissue was stained with anti-Eya to visualize the Tv clusters, anti-Nplp1 to visualize the Tv1 neurons, and anti-FMRFa to visualize the Tv4 neurons. Reporter expression was driven in all Tv1 (arrow heads) and Tv4 (arrows) neurons at both Stg17 (B-B’’’) and A5 (C-C’’’ and D-D’’’).	     55 4. DISCUSSION  4.1 Summary of major findings Prior to this thesis work we had identified dimm.K1, a 756 bp region of genomic DNA upstream of dimm that is sufficient to initiate and maintain reporter expression in all Tv1 and Tv4 neurons. We had also identified ap.K1, a ~3.8 kb region of genomic DNA upstream of ap that is sufficient to initiate, but not maintain, reporter expression in Tv1 and Tv4 neurons (see Section 1.8). The major findings of this thesis work include: • dimm.K1 is necessary for dimm expression in Tv1 and Tv4 neurons (Figure 11). • The transcriptional initiation of dimm.K1 matches that found for Dimm protein, and is the same for all Tv1 and Tv4 neurons (Figure 12). • The transcriptional regulation of dimm.K1 maintenance differs between Tv1 and Tv4 neurons. Further, we find that different transcriptional inputs are required for maintenance of dimm.K1 in Tv1 neurons of different body segments. Furthermore, we find the dimm.K1 reporter and Dimm protein show differences in their responses to the loss of specific transcriptional inputs in adult neurons (Figure 16).  • ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons (Figure 17).  • We identified a genomic region that, when added to the ap.K1 CRM, is sufficient to drive maintenance of reporter activity in Tv1 and Tv4 neurons. This maintenance element region is proximal to the ap promoter and has previously been described to have TRE/PRE activity in another ap-expressing tissue (Figure 18).    56 These findings lead us to the following major conclusions (Figure 19): 1) Initiation and maintenance mechanisms can be very distinct for terminal selector transcription factors.  2) Various maintenance mechanisms can be employed to maintain the expression of different transcription factors within a single network. 3) The maintenance mechanisms for a single transcription factor can differ between cell subtypes, and also exhibit difference between individual neurons of a single subtype.  With reference to Figure 19, the specific findings (A) through (D) show that the common mechanism of dimm.K1 initiation in Tv1 and Tv4 neurons diverges into a variety of distinct maintenance mechanisms that differ between cell subtypes, and even between neurons of the same subtype. (E) shows that mechanisms of ap initiation and maintenance are generated from distinct CRMs, emphasizing that initiation and maintenance mechanisms are distinct. Our findings can also be discussed with regard to the existing models of transcription factor maintenance (Figure 1). In Tv4 neurons, maintenance of dimm.K1 is dependent on persistent input from Ap and Eya, auto-regulation (Figure 1B) and cross-regulation (Figure 1C) by Sqz, Dac and BMP signaling. In Th1 Tv1 neurons, maintenance of dimm.K1 is dependent on persistent input from Ap. Maintenance of dimm.K1 in Th3 Tv1 neurons is dependent upon unknown inputs; this could suggest that unidentified maintenance-dedicated transcription factors (Figure 1D) (or unidentified developmental transcription factors) maintain dimm.K1 expression in Th3 Tv1 neurons. The putative ap maintenance element that is sufficient to maintain reporter expression in Tv1 and Tv4 neurons when added to ap.K1 encompasses a region that functions as a TRE in the dorsal compartment of the developing Drosophila imaginal wing disc. The putative TRE function of this region has yet to be investigated in Tv1 and Tv4 neurons, but cumulatively the evidence suggests that ap expression may be maintained by TrxG proteins in Tv1 and Tv4  57 neurons (Figure 1E). Therefore, various combinations of possible maintenance strategies are employed in the Tv1 and Tv4 transcription factor networks. Furthermore, we have found that the specific configurations of these strategies can exhibit a high degree of cell-specificity.    58  Figure 19.   59 Figure 19. Maintenance of Tv1 and Tv4 subtype identities. Dashed lines represent initiation (In) and solid lines represent maintenance (M). Regulatory relationships common to both Th1 and Th3 neurons are shown in blue. Regulatory relationships specific to Th1 or Th3 neurons are shown in pink or orange respectively.  Key findings that contribute to the major conclusions of this thesis work include: (A) Auto-regulation maintains dimm.K1 expression in Tv4 neurons only. (B) Ap maintains dimm.K1 expression in Th1 and Th3 Tv4 neurons but only regulates dimm.K1 maintenance in Th1 Tv1 neurons. (C) Eya promotes initiation and maintenance of dimm.K1 in Tv4 neurons; in Tv1 neurons Eya promotes dimm.K1 at initiation but represses dimm.K1 at maintenance. (D) dimm.K1 maintenance is subject to cross-regulation by other known terminal selectors in Tv4 only. (E) The insufficiency of ap.K1 for maintenance makes it clear that differences between ap initiation and maintenance mechanisms exist.     60 4.2 Biological relevance of our findings Our results suggest that the strategies used to maintain ap expression are different from those used to maintain dimm expression. The expression of ap may be maintained by TrxG proteins that stably ‘lock-in’ an open chromatin environment at the ap locus. In contrast, dimm.K1 appears to require constant processing of various terminal selector inputs throughout life. Interestingly, dimm.K1 uses a maintenance strategy similar to those used by Nplp1 and FMRFa, and this observation may provide insight into the biological significance behind the use of different maintenance strategies. In the cases of Nplp1 and FMRFa, persistent dependence on multiple inputs may facilitate dynamic mechanisms of gene maintenance that can efficiently up- or down-regulate neuropeptide expression in response to environmental cues. In addition to its roles in the transcriptional regulation of Nplp1 and FMRFa, Dimm also regulates multiple genes involved in neuropeptide processing and secretory machinery biogenesis [92]. Thus, Dimm’s involvement at multiple levels of neuropeptide production and release may necessitate its use of a similarly dynamic strategy of gene maintenance. Ap, on the other hand, is a higher order transcription factor in the Tv1 and Tv4 networks and functions to maintain both terminal selector and neuropeptide expression. Thus, a stable ‘lock-in’ mechanism of ap maintenance by TrxG proteins may be more appropriate.   It is also worth emphasizing	  that	  the cell-specific maintenance mechanisms we have found are not stochastic. In other words, we have not found that Tv1 and Tv4 neurons use a common mechanism of dimm.K1 initiation and then randomly adopt one of many possible maintenance strategies. If this were the case, the differences we have shown would not have been detected. Ultimately, each cell-specific difference is deterministic and reproducible. The cell-specific gene regulatory mechanisms exhibited amongst Tv1 neurons of different body segments (Figure 14) is particularly striking, but is consistent with emerging concepts in the literature. There is growing appreciation for the fact that cell populations previously thought to  61 be homogeneous, due to the fact that they express a common set of effector genes, are actually heterogeneous when their characteristics are observed at higher resolution. High resolution, single-cell gene profiling approaches have been used to demonstrate heterogeneity at the level of transcriptomes and have been successful in defining cell types with more precision [93]. At the level of epigenomes, heterogeneity in cell populations can manifest as differences in the DNAse hyperaccessibility of particular loci or as differences in the organization of the genome, which is thought to have implications for cell-to-cell differences in enhancer-promoter communication patterns and thus gene regulatory mechanisms [94-97]. These studies highlight the power of our model system, which allows us to study Tv1 and Tv4 neurons at single-cell resolution in vivo, and reproducibly from one animal to the next; we are in an excellent position to contribute to these emerging concepts and to handle any implications that may arise from these studies.     62 4.3 Considerations and limitations of data interpretation relevant to discussion of our data The cell-specific mechanisms of dimm.K1 maintenance is an important finding. However, we must remember that our ultimate goal is to obtain a detailed understanding of how dimm is initiated and maintained, and thus an understanding of how dimm.K1 fits into this objective. There are two major considerations that emerged during this thesis work that do limit our interpretation of the data in this respect: 1) The response of dimm.K1 reporter activity to genetic perturbations was compared to the response of Dimm protein levels. The primary caveat here is that we wish to study how dimm.K1 regulates dimm transcription, and Dimm protein levels are not necessarily an accurate measure of this (due to possible post-transcriptional effects, such as transcript regulation and translational and/or post-translational regulation). Therefore, it is difficult to determine whether the discrepancies in our data regarding how adult-specific genetic perturbations affect dimm.K1 reporter activity and how they affect Dimm protein levels are due to a discrepancy between dimm.K1 and dimm transcriptional activities, or due to a discrepancy between the outcome of these perturbations on dimm transcriptional activity and Dimm protein levels. To resolve this we plan to knock a fluorescent reporter gene into the native dimm locus and compare the effects of genetic perturbations on dimm.K1 and transcription of the native dimm gene.  2) We are studying the transcriptional regulation of dimm.K1 outside of its endogenous locus. For decades we have learned a lot about enhancer biology from studying isolated regulatory regions in this way; nonetheless, given advancements in our understanding of chromatin heterogeneity and in how intra- and inter-chromosomal interactions within the three dimensional organization of the nucleus may influence transcription, we must be aware of the fact that these experiments could be limited by lack of appropriate context. However, dimm.K1 reporter activity is restricted to Dimm expressing neurons in the  63 VNC and regulation of dimm.K1 initiation matches regulation of Dimm initiation; these findings suggest that the dimm.K1 reporter transgene does indeed provide biologically relevant insight into the involvement of dimm.K1 in initiation and maintenance of dimm expression.	  	  4.4 Possible involvement of additional CRMs in dimm maintenance If we knock a fluorescent reporter gene into the native dimm locus and find that the response of this reporter gene to adult-specific genetic perturbations is equivalent to the response of Dimm protein levels, we will have to address the discrepancies that exist between dimm.K1 and dimm transcriptional activities in adult neurons. To explain these possible discrepancies it may be reasonable to propose that dimm.K1 acts in conjunction with other CRMs in order to maintain dimm expression (Figure 20).  Studies making use of chromosome conformation capture technologies have shown that promoters are often involved in complex regulatory interactions with multiple CRMs, and thus there is emerging appreciation for the idea that CRMs coalesce into regulatory ensembles in order to stabilize transcription from gene promoters [16, 98-100]. Given emerging evidence, I now consider the existence of additional CRMs involved in dimm maintenance to be a probable scenario; thus, I address below how we could approach such complexities, should it become necessary.  How promoters integrate information from multiple CRMs is not well understood, but we can gain some mechanistic insight from literature on ‘shadow enhancers’. Mike Levine and colleagues initially coined the term ‘shadow enhancer’ to describe redundant secondary enhancers that increase robustness of gene expression under adverse conditions, such as environmental stress and genetic perturbations. Use of the term has since evolved to more generally describe situations in which a gene is regulated by multiple distinct enhancers, each of which drives the same or similar expression patterns. Although examples of multiple separable  64 enhancers driving apparently redundant expression patterns for a single gene have existed for decades, new evidence suggests a variety of functional roles for such cis-regulatory arrangements [101]. It has been proposed, for example, that the temporally-specific dominance of one shadow enhancer over another is crucial to the refinement of gap gene expression patterns in the developing Drosophila embryo [102]. In another study particularly relevant to the findings presented in this thesis, computational models suggest that regulation of the Drosophila pair-rule gene even-skipped (eve) in a specific domain of the developing embryo is accomplished by the activities of two shadow enhancers. Importantly, each enhancer in this model uses different regulatory logic to generate the same expression pattern. Thus the effects of genetic perturbations on gene expression driven by each enhancer, and on endogenous gene expression, are different. A single transcription factor, for example, is proposed to have bifunctionality in its regulation of gene expression, acting as an activator through one of the enhancers and as a repressor through the other [11].  To illustrate how concepts from the above examples could explain some of our data, let us consider our observation that, in adult Tv1 neurons, Eya acts as an activator of Dimm expression, but a repressor of dimm.K1. Perhaps this is a situation in which more than one CRM is involved in regulating maintenance of dimm expression, and Eya has bifunctionality in that it acts as a repressor through dimm.K1 and an activator through an additional CRM.  If this additional CRM is dominant under steady-state conditions, this could explain why knock-down of Eya ultimately results in down-regulation of dimm expression (Figure 21). Let us also consider our observation in adult Tv4 neurons, that while knock-down of Ap results in reduced expression of both dimm.K1-nDsRed and Dimm, knock-down of other regulators such as Sqz, Dac and BMP signaling specifically affect maintenance of dimm.K1. Perhaps Ap regulates dimm maintenance through both dimm.K1 and an additional CRM, and this additional CRM can compensate to sustain wild-type levels of dimm under the genetic perturbations that specifically  65 affect maintenance of gene expression through dimm.K1 (Figure 22). These two examples have been highlighted to illustrate how one might go about thinking about such concepts. With so many unknowns, it is difficult to speculate further on what the cis-regulatory architecture involved in dimm maintenance might look like should these additional CRMs exist.    66    Figure 20. Possible involvement of other CRMs in dimm maintenance.  If the response of dimm transcription to adult-specific genetic perturbations is equivalent to the response of Dimm protein levels this could suggest that dimm.K1 encompasses the primary CRM(s) governing initiation of dimm expression, but that dimm.K1 acts in conjunction with other CRMs in a cell-specific manner in order to maintain dimm expression. Possible model: (A) Developmental transcription factors including Ap and Eya assemble on dimm.K1 (red) and interactions between dimm.K1 and the dimm (blue) promoter initiate gene expression in all Tv1 and Tv4 neurons. (B) Other regulatory regions (orange, green) (and corresponding transcription factors) coalesce to confer dynamic stability of gene expression.  	   67     Figure 21. If Eya acts as an activator of dimm expression, but a repressor of dimm.K1. Perhaps this is a situation in which more than one CRM is involved in regulating maintenance of dimm expression, and Eya has bifunctionality in that it acts as a repressor through dimm.K1 and an activator through an additional CRM.  If this additional CRM is dominant under steady-state conditions, this could explain why knockdown of Eya ultimately results in down-regulation of dimm expression.	     68     Figure 22. If Sqz, Dac and BMP signaling affect maintenance of dimm.K1, but not dimm. (A) Perhaps Ap regulates dimm maintenance through both dimm.K1 and an additional CRM, (B) and this additional CRM can compensate to sustain wild-type levels of dimm under the genetic perturbations that specifically affect maintenance of gene expression through dimm.K1. 	   69 4.5 Future directions 4.5.1 dimm 	  4.5.1.1 Immediate goals As discussed previously it will be important for us to knock a fluorescent reporter gene into the native dimm locus and compare the effects of genetic perturbations on dimm.K1 and transcription of the native dimm gene. To completely uncouple regulation of this reporter gene from that of Dimm protein, we plan to replace the endogenous dimm gene with the fluorescent reporter gene. Although Dimm is auto-regulatory, this should not affect the interpretation of our results, as we can use the fluorescent reporter gene as a heterozygote and the resulting decrease in Dimm dosage will be consistent between control and experimental genotypes. These experiments will resolve whether the discrepancies in our data regarding how adult-specific genetic perturbations affect dimm.K1 reporter activity and how they affect Dimm protein levels are due to a discrepancy between dimm.K1 and dimm transcriptional activities, or due to a discrepancy between the outcome of these perturbations on dimm transcription and Dimm protein levels.  Also, to unambiguously determine whether dimm.K1 is necessary for maintenance of dimm expression, we must assess Dimm expression following deletion of dimm.K1 specifically in adult neurons, after development. We are planning to FRT-flank the dimm.K1 enhancer (through CRISPR or homologous recombination strategies) for adult specific deletion of dimm.K1 through adult induction of Flp recombinase in Tv neurons. Such cis-FRT excision has proven very reliable and will be used to determine the requirement for dimm.K1 in maintaining dimm transcription [103].    70 4.5.1.2 Long-term goals We have only explored the role of known developmental Tv1 and Tv4 terminal selectors in the regulation of dimm maintenance, and at this point we do not know, for example, what factors are maintaining dimm.K1 reporter activity in Th3 Tv1 neurons (Figure 19). To identify additional trans-regulatory factors that regulate dimm maintenance we could employ a multi-step approach. First, we could observe the response of fluorescent Nplp1 and FMRFa transcriptional reporters to adult-specific RNAi knockdown of candidate factors. This approach would identify factors involved in maintaining neuropeptide expression and those involved in maintaining any of the terminal selectors. To identify factors that maintain dimm, we could observe the response of a fluorescent reporter gene driven from the native dimm locus to adult-specific knockdown of factors identified with the first approach. To pair factors that maintain dimm with their corresponding CRM(s) we could subsequently observe the response of fluorescent reporter genes driven by individual CRM(s) to adult-specific knockdown of factors shown to maintain dimm.   We may also be interested in identifying the direct regulators of dimm CRM(s) and characterizing the sites at which they bind to exert initiation and/or maintenance activity. This may, for example, reveal closely associated but separable initiation and maintenance elements within regulatory regions such as dimm.K1. Electrophoretic mobility shift assays can be used to show the ability of transcription factors to bind directly in vitro. In vitro experiments can be complimented with in vivo studies; for example, the requirement for direct binding of maintenance-specific factors can be demonstrated by showing that deletions of their putative binding sites has no effect on initiation, but abrogates maintenance of reporter expression driven by dimm.K1. It would be difficult to use this approach, however, to assess the maintenance-specific requirement for direct binding sites of transcription factors such as Ap that regulate both initiation and maintenance of gene expression. If Ap binds at the same site to both initiate and maintain gene expression, to unambiguously demonstrate the necessity of that binding site for  71 maintenance the site would need to be disrupted specifically in adult neurons, which at this time is technically intractable. In such situations, a technique like DNA in situ hybridization-proximity ligation assay (DNA-ISH-PLA), which facilitates the detection of DNA-protein interactions in vivo, would be better suited to characterizing maintenance-specific binding configurations [104].  If further evidence suggests that dimm.K1 does indeed collaborate with other CRMs in a cell-specific manner in order to maintain dimm expression it will be important to identify these additional CRMs. In our first approach to identify CRMs involved in initiation and/or maintenance of dimm expression, we assessed the sufficiency of intergenic regions to drive reporter expression at Stg17 and A5 and no regions other than that encompassing dimm.K1 were sufficient to drive expression in Tv neurons at either stage. Initiation through dimm.K1, however, may be required for other CRMs to exert their maintenance-specific activities. Thus a necessity approach should be used to identify any maintenance-dedicated CRMs. CRISPR could be used to facilitate a tiling deletion analysis through an endogenous dimm locus in which a fluorescent reporter gene has been knocked in to replace the native dimm gene. The deletion of a maintenance-dedicated CRM should have no effect on initiation of dimm expression at Stg17, but result in the loss or downregulation of dimm expression in adult neurons. I recognize that this approach is limited by the fact that CRMs for a gene are not necessarily located within the closest intergenic regions, as long-range enhancers can be brought close to promoters through the complex organization of chromosomes in the nucleus. Thus, if necessary, we may wish to explore the use of chromosome conformation capture technologies as a means of identifying CRMs that interact with the dimm promoter. This alternative approach would require us to isolate our individual cells of interest. We could explore the use of laser capture microdissection for these purposes, as this strategy has been used successfully to isolate individual Drosophila neurons [105]. If we can establish a reliable system for isolating individual Tv1 and Tv4  72 neurons, techniques such as RNA-seq and ChIP-seq would also be open to us, and these approaches may facilitate our identification of novel dimm regulators and our characterization of transcription factor-CRM binding configurations (discussed above), respectively. It is important to recognize, however, that optimizing a system to isolate the Tv1 and Tv4 neurons and generating enough material for these approaches are not trivial tasks. Generating enough material should become less of a limitation over time, however, as single-cell applications of these technologies continue to improve	  [96,106-108].  4.5.2 ap 4.5.2.1 Immediate goals We have data suggesting that ap.K1 is necessary for ap expression in Tv1 and Tv4 neurons, using Nplp1 and FMRFa expression as indirect read-outs. A fly line in which endogenous ap has been GFP-tagged is now available and we have confirmed the fidelity of its expression pattern in the VNC at Stg17 and in adults [91, 110]. If we re-create the stable ap.K1 deletion in this ap-gfp background we can improve our necessity data by assessing a direct read-out of ap expression. Also, to unambiguously determine whether ap.K1 is necessary for maintenance of ap expression and thus distinguish between the possible models for ap maintenance presented in Figure 24, we must assess ap expression following deletion of ap.K1 specifically in adult neurons, after development. We are planning to FRT-flank the ap.K1 enhancer (through CRISPR or homologous recombination strategies) in an ap-gfp background for adult-specific deletion of ap.K1 through adult induction of Flp recombinase in Tv neurons.   4.5.2.2 Long-term goals We have made progress in characterizing the cis-regulatory architecture that governs initiation and maintenance of ap expression in Tv1 and Tv4 neurons. We have not investigated  73 further the trans-regulatory factors involved and how these trans-regulatory factors interact with the corresponding cis-regulatory architecture. To accomplish this we can perform a screen using the same approach that was discussed for dimm in section 4.5.1.2.        74   Figure 23. Models for ap initiation and maintenance in Tv1 and Tv4 neurons. (A) Developmental transcription factors act through ap.K1 to initiate gene expression and ‘activate’ the maintenance element (M). (B) Possible model for ap maintenance in which both ap.K1 and M are required to maintain ap expression. (C) Alternative model for ap maintenance in which M functions alone to maintain ap expression.   75 5. CONCLUSIONS We have made progress in understanding how transcription factor networks are maintained in mature neurons. Using Drosophila Tv1 and Tv4 neurons as a model, we have shown that various mechanisms, distinct from those used at initiation, can be employed to maintain terminal selectors in a network. Furthermore, we have shown that, for a single transcription factor, initiation mechanisms that are shared by different cell subtypes can diverge into cell-specific maintenance mechanisms that differ between cell subtypes, and also exhibit difference between individual neurons of a single subtype.               76  BIBLIOGRAPHY 	  1. Hobert O, Carrera I, Stefanakis N. The molecular and gene regulatory signature of a neuron. Trends in Neurosciences. 2010;33:435–445.  2. Holmberg J, Perlmann T. Maintaining differentiated cellular identity. Nat Rev Genet. 2012;13:1–11.  3. Deneris ES, Hobert O. Maintenance of postmitotic neuronal cell identity. Nat Neurosci. 2014;17:899–907.  4. Pearson BJ, Doe CQ. Specification of temporal identity in the developing nervous system. Annu Rev Cell Dev Biol. 2004;20:619–647.  5. Bertrand N, Castro DS, Guillemot F. Proneural genes and the specification of neural cell types. Nat Rev Neurosci. 2002;3:517–530.  6. Greig LC, Woodworth MB, Galazo MJ, Padmanabhan H, Macklis JD. Molecular logic of neocortical projection neuron specification, development and diversity. Nat Rev Neurosci. 2013;14:755–769.  7. Dasen JS, Jessell TM. Chapter 6 - Hox Networks and the Origins of Motor Neuron Diversity. 1st ed. Current Topics in Developmental Biology. 2009. pp. 169–200.  8. Allan DW, Thor S. Transcriptional selectors, masters, and combinatorial codes: regulatory principles of neural subtype specification. WIREs Dev Biol. 2015;4:505–528.  9. Thor S, Allan DW. Advances in Understanding the Generation and Specification of Unique Neuronal Sub-types from Drosophila Neuropeptidergic Neurons. Organogenetic Gene Networks. Cham: Springer International Publishing; 2016. pp. 57–93.  10. Spitz F, Furlong EEM. Transcription factors: from enhancer binding to developmental control. Nat Rev Genet. 2012;13:613–626.  11. Staller MV, Vincent BJ, Bragdon MDJ, Lydiard-Martin T, Wunderlich Z, Estrada J, et al. Shadow enhancers enable Hunchback bifunctionality in the Drosophila embryo. Proceedings of the National Academy of Sciences. 2015;112:785–790.  12. Jiang J, Cai H, Zhou Q, Levine M. Conversion of a dorsal-dependent silencer into an enhancer: evidence for dorsal corepressors. The EMBO Journal. 1993;12:3201–3209.  13. Bessis A, Champtiaux N, Chatelin L, Changeux JP. The neuron-restrictive silencer element: A dual enhancer/silencer crucial for patterned expression of a nicotinic receptor gene in the brain. Proceedings of the National Academy of Sciences. 1997;94:5906–5911.     77 14. Kallunki P, Edelman GM, Jones FS. The neural restrictive silencer element can act as both a repressor and enhancer of L1 cell adhesion molecule gene expression during postnatal development. Proceedings of the National Academy of Sciences. 1997;95:3233–3238.  15. Vernimmen D, Bickmore WA. The Hierarchy of Transcriptional Activation: From Enhancer to Promoter. Trends in Genetics. 2015;31:696–708.  16. Spitz F. Gene regulation at a distance: From remote enhancers to 3D regulatory ensembles. Seminars in Cell and Developmental Biology. 2016;57:57–67.  17. Plank JL, Dean A. Enhancer Function: Mechanistic and Genome-Wide Insights Come Together. Molecular Cell. 2014;55:5–14.  18. Gardini A, Shiekhattar R. The many faces of long noncoding RNAs. FEBS J. 2014;282: 1647–1657.  19. Hsieh CL, Fei T, Chen Y, Li T, Gao Y, Wang X, et al. Enhancer RNAs participate in androgen receptor-driven looping that selectively enhances gene activation. Proceedings of the National Academy of Sciences. 2014;111:7319–7324.  20. Tsai M-C, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, et al. Long noncoding RNA as modular scaffold of histone modification complexes. Science. 2010;329:689–693.  21. Li W, Notani D, Ma Q, Tanasa B, Nunez E, Chen AY, et al. Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature. 2013;498:516–520.  22. Rinn JL, Chang HY. Genome Regulation by Long Noncoding RNAs. Annu Rev Biochem. 2012;81:145–166.  23. Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, Kenzelmann-Broz D, et al. A Large Intergenic Noncoding RNA Induced by p53 Mediates Global Gene Repression in the p53 Response. Cell. 2010;142:409–419.  24. Skeath JB, Thor S. Genetic control of Drosophila nerve cord development. Curr Opin Neurobiol. 2003;13:8–15.  25. Paredes MF, Sorrells SF, Garcia-Verdugo JM, Alvarez-Buylla A. Brain size and limits to adult neurogenesis. J Comp Neurol. 2015;524:646–664.  26. Liu H, Song N. Molecular Mechanism of Adult Neurogenesis and its Association with Human Brain Diseases. J Cent Nerv Syst Dis. 2016;8:5–11.  27. Alunni A, Bally-Cuif L. A comparative view of regenerative neurogenesis in vertebrates. Development. 2016;143:741–753.  28. Cohen S, Greenberg ME. Communication Between the Synapse and the Nucleus in Neuronal Development, Plasticity, and Disease. Annu Rev Cell Dev Biol. 2008;24:183–209.   78 29. Blau HM, Baltimore D. Differentiation Requires Continuous Regulation. J Cell Biol. 1991;12:781–783.  30. Serrano-Saiz E, Poole RJ, Felton T, Zhang F, La Cruz De ED, Hobert O. Modular Control of Glutamatergic Neuronal Identity in C.elegans by Distinct Homeodomain Proteins. Cell. 2013;155:659–673.  31. Kratsios P, Stolfi A, Levine M, Hobert O. Coordinated regulation of cholinergic motor neuron traits through a conserved terminal selector gene. Nat Neurosci. 2011;15:205–214.  32. Doitsidou M, Flames N, Topalidou I, Abe N, Felton T, Remesal L, et al. A combinatorial regulatory signature controls terminal differentiation of the dopaminergic nervous system in C. elegans. Genes & Development. 2013;27:1391–1405.  33. Flames N, Hobert O. Gene regulatory logic of dopamine neuron differentiation. Nature. 2009;458:885–889.  34. Jafari S, Alkhori L, Schleiffer A, Brochtrup A, Hummel T, Alenius M. Combinatorial Activation and Repression by Seven Transcription Factors Specify Drosophila Odorant Receptor Expression. PLoS Biol. 2012;10:e1001280–12.  35. Hsiao H-Y, Jukam D, Johnston R, Desplan C. The neuronal transcription factor erect wing regulates specification and maintenance of Drosophila R8 photoreceptor subtypes. Developmental Biology. 2013;381:482–490.  36. Eade KT, Fancher HA, Ridyard MS, Allan DW. Developmental transcriptional networks are required to maintain neuronal subtype identity in the mature nervous system. Harris WA, editor. PLoS Genet. 2012;8:e1002501.  37. Song N-N, Xiu J-B, Huang Y, Chen J-Y, Zhang L, Gutknecht L, et al. Adult Raphe-Specific Deletion of Lmx1b Leads to Central Serotonin Deficiency. PLoS ONE. 2011;6:e15998–9.  38. Lui C, et al. Pet-1 is required across different stages of life to regulate serotonergic function. Nat Neurosci. 2010;13:1190–1198.  39. Kadkhodaei B, Alvarsson A, Schintu N, Ramskold D, Volakakis N, Joodmardi E, et al. Transcription factor Nurr1 maintains fiber integrity and nuclear-encoded mitochondrial gene expressionin dopamine neurons. Proceedings of the National Academy of Sciences. 2012;110:2360–2365.  40. Coppola E, d'Autreaux F, Rijli FM, Brunet JF. Ongoing roles of Phox2 homeodomain transcription factors during neuronal differentiation. Development. 2010;137:4211–4220.  41. Schmidt M, Lin S, Pape M, Ernsberger U, Stanke M, Kobayashi K, et al. The bHLH transcription factor Hand2 is essential for the maintenance of noradrenergic properties in differentiated sympathetic neurons. Developmental Biology. 2009;329:191–200.    79 42. Mikkola I, Heavey B, Horcher M, Busslinger M. Reversion of B Cell Commitment upon Loss of Pax5 Expression. Science. 2002;297:110–113.  43. Lin W, Metzakopian E, Mavromatakis YE, Gao N, Balaskas N, Sasaki H, et al. Foxa1 and Foxa2 function both upstream of and cooperatively with Lmx1a and Lmx1b in a feedforward loop promoting mesodiencephalic dopaminergic neuron development. Developmental Biology. 2009;333:386–396.  44. Gao N, Le Lay J, Qin W, Doliba N, Schug J, Fox AJ, et al. Foxa1 and Foxa2 Maintain the Metabolic and Secretory Features of the Mature β-Cell. Mol Endocrinol. 2010;24:1594–1604.  45. Sarafi-Reinach TR, Melkman T, Hobert O, Sengupta P. The lin-11 LIM homeobox gene specifies olfactory and chemosensory neuron fates in C. elegans. Development. 2001;128:3269–3281.  46. Deneris ES, Wyler SC. Serotonergic transcriptional networks and potential importance to mental health. Nat Neurosci. 2012;15:519–527.  47. Way JC, Chalfie M. The mec-3 gene of Caenorhabditis elegans requires its own product for maintained expression and is expressed in three neuronal cell types. Genes & Development. 1989;3:1823–1833.  48. Etchberger JF, Lorch A, Sleumer MC, Zapf R, Jones SJ, Marra MA, et al. The molecular signature and cis-regulatory architecture of a C. elegans gustatory neuron. Genes & Development. 2007;21:1653–1674.  49. Wenick AS, Hobert O. Genomic cis-Regulatory Architecture and trans-Acting Regulators of a Single Interneuron-Specific Gene Battery in C. elegans. Developmental Cell. 2004;6:757–770.  50. Kyrmizi I. Plasticity and expanding complexity of the hepatic transcription factor network during liver development. Genes & Development. 2006;20:2293–2305.  51. Simon J, Chiang A, Bender W, Shimell MJ, O'Connor M. Elements of the Drosophila bithorax complex that mediate repression by Polycomb group products. Developmental Biology. 1993;158:131–144. 52. Chan CS, Rastelli L, Pirrotta V. A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression. The EMBO Journal. 1994;13:2553–2564.  53. Cavalli G, Paro R. The Drosophila Fab-7 chromosomal element conveys epigenetic inheritance during mitosis and meiosis. Cell. 1998;93:505–518.  54. Pérez L, Barrio L, Cano D, Fiuza U-M, Muzzopappa M, Milán M. Enhancer-PRE communication contributes to the expansion of gene expression domains in proliferating primordia. Development. 2011;138:3125–3134.  55. Steffen PA, Ringrose L. What are memories made of? How Polycomb and Trithorax proteins mediate epigenetic memory. Nat Rev Mol Cell Biol. 2014;15:340–356.   80 56. van Kruijsbergen I, Hontelez S, Veenstra GJC. Recruiting polycomb to chromatin. International Journal of Biochemistry and Cell Biology. 2015;67:177–187.  57. Ringrose L, Paro R. Polycomb/Trithorax response elements and epigenetic memory of cell identity. Development. 2007;134:223–232.  58. Bauer M, Trupke J, Ringrose L. The quest for mammalian Polycomb response elements: are we there yet? Chromosoma. 2016;125:471-496.  59. Geisler SJ, Paro R. Trithorax and Polycomb group-dependent regulation: a tale of opposing activities. Development. 2015;142:2876–2887.  60. Schuettengruber B, Martinez AM, Iovino N, Cavalli G. Trithorax group proteins: switching genes on and keeping them active. Nat Rev Mol Cell Biol. 2011;12:799–814.  61. Ghosh-Choudhury N, Ghosh Choudhury G, Harris MA, Wozney J, Mundy GR, Abboud SL, et al. Autoregulation of Mouse BMP-2 Gene Transcription Is Directed by the Proximal Promoter Element. Biochemical and Biophysical Research Communications. 2001;286:101–108.  62. DiMattia GE, Rhodes SJ, Krones A, Carrière C, O'Connell S, Kalla K, et al. The PIT-1 Gene Is Regulated by Distinct Early and Late Pituitary-Specific Enhancers. Developmental Biology. 1997;182:180–190.  63. Baumgardt M, Miguel-Aliaga I, Karlsson D, Ekman H, Thor S. Specification of Neuronal Identities by Feedforward Combinatorial Coding. PLoS Biol. 2007;5:37–14.  64. Benveniste RJ, Thor S, Thomas JB, Taghert PH. Cell type-specific regulation of the Drosophila FMRF-NH2 neuropeptide gene by Apterous, a LIM homeodomain transcription factor. Development. 1998;125:4757–4765.  65. Allan DW, St Pierre SE, Miguel-Aliaga I, Thor S. Specification of Neuropeptide Cell Identity by the Integration of Retrograde BMP Signaling and a Combinatorial Transcription Factor Code. Cell. 2003;113:73–86.  66. Miguel-Aliaga I, Allan DW, Thor S. Independent roles of the dachshund and eyes absent genes in BMP signaling, axon pathfinding and neuronal specification. Development. 2004;131:5837–5848.  67. Allan DW, Park D, St Pierre SE, Taghert PH, Thor S. Regulators acting in combinatorial codes also act independently in single differentiating neurons. Neuron. 2005;45:689–700.  68. Karlsson D, Baumgardt M, Thor S. Segment-specific neuronal subtype specification by the integration of anteroposterior and temporal cues. PLoS Biol. 2010;8:e1000368.  69. Baumgardt M, Karlsson D, Terriente J, DIaz-Benjumea FJ, Thor S. Neuronal Subtype Specification within a Lineage by Opposing Temporal Feed-Forward Loops. Cell. 2009;139: 969–982.    81 70. Eade KT, Allan DW. Neuronal Phenotype in the Mature Nervous System Is Maintained by Persistent Retrograde Bone Morphogenetic Protein Signaling. Journal of Neuroscience. 2009;29:3852–3864.  71. Jenett A, Rubin GM, Ngo T-TB, Shepherd D, Murphy C, Dionne H, et al. A GAL4-driver line resource for Drosophila neurobiology. Cell Reports. 2012;2:991–1001.  72. Speir ML, Zweig AS, Rosenbloom KR, Raney BJ, Paten B, Nejad P, et al. The UCSC Genome Browser database: 2016 update. Nucleic Acids Res. 2016;44:717–725.  73. Bischof J, Maeda RK, Hediger M, Karch F, Basler K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proceedings of the National Academy of Sciences. 2007;104:3312–3317.  74. O'Keefe DD, Thor S, Thomas JB. Function and specificity of LIM domains in Drosophila nervous system and wing development. Development. 1998;125:3915–3923.  75. Pignoni F, Hu B, Zavitz KH, Xiao J, Garrity PA, Zipursky SL. The eye-specification proteins So and Eya form a complex and regulate multiple steps in Drosophila eye development. Cell. 1997;91:881–891.  76. Bonini NM, Leiserson WM, Benzer S. Multiple roles of the eyes absent gene in Drosophila. Developmental Biology. 1998;196:42–57.  77. Mardon G, Solomon NM, Rubin GM. dachshund encodes a nuclear protein required for normal eye and leg development in Drosophila. Development. 1994;120:3473–3486.  78. Aberle H, Haghighi AP, Fetter RD, McCabe BD, Magalhães TR, Goodman CS. wishful thinking encodes a BMP type II receptor that regulates synaptic growth in Drosophila. Neuron. 2002;33:545–558.  79. McGuire SE, Mao Z, Davis RL. Spatiotemporal gene expression targeting with the TARGET and gene-switch systems in Drosophila. Sci STKE. 2004;220: pl6.  80. Dietzl G, Chen D, Schnorrer F, Su K-C, Barinova Y, Fellner M, et al. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature. 2007;448:151–156.  81. Hewes RS, Park D, Gauthier SA, Schaefer AM, Taghert PH. The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development. 2003;130:1771–1781.  82. Haerry TE, Khalsa O, O'Connor MB, Wharton KA. Synergistic signaling by two BMP ligands through the SAX and TKV receptors controls wing growth and patterning in Drosophila. Development. 1998;125:3977–3987.  83. McCabe BD, Marqués G, Haghighi AP, Fetter RD, Crotty ML, Haerry TE, et al. The BMP homolog Gbb provides a retrograde signal that regulates synaptic growth at the Drosophila neuromuscular junction. Neuron. 2003;39:241–254.    82 84. Barolo S, Carver LA, Posakony JW. GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. BioTechniques. 2000;29:726–728– 730– 732.  85. Berndt AJE, Tang JCY, Ridyard MS, Lian T, Keatings K, Allan DW. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons. PLoS Genet. 2015;11:e1005754–27.  86. Park D, Veenstra JA, Park JH, Taghert PH. Mapping peptidergic cells in Drosophila: where DIMM fits in. PLoS ONE. 2008;3:e1896.  87. Nègre N, Hennetin J, Sun LV, Lavrov S, Bellis M, White KP, et al. Chromosomal Distribution of PcG Proteins during Drosophila Development. PLoS Biol. 2006;4:e170–16.  88. Tolhuis B, Muijrers I, de Wit E, Teunissen H, Talhout W, van Steensel B, et al. Genome-wide profiling of PRC1 and PRC2 Polycomb chromatin binding in Drosophila melanogaster. Nat Genet. 2006;38:694–699.  89. Schwartz YB, Kahn TG, Nix DA, Li X-Y, Bourgon R, Biggin M, et al. Genome-wide analysis of Polycomb targets in Drosophila melanogaster. Nat Genet. 2006;38:700–705.  90. Oktaba K, Gutiérrez L, Gagneur J, Girardot C, Sengupta AK, Furlong EEM, et al. Dynamic Regulation by Polycomb Group Protein Complexes Controls Pattern Formation and the Cell Cycle in Drosophila. Developmental Cell. 2008;15:877–889.  91. Bieli D, Kanca O, Requena D, Hamaratoglu F, Gohl D, Schedl P, et al. Establishment of a Developmental Compartment Requires Interactions between Three Synergistic Cis-regulatory Modules. PLoS Genet. 2015;11:e1005376.  92. Hadžić T, Park D, Abruzzi KC, Yang L, Trigg JS, Rohs R, et al. Genome-wide features of neuroendocrine regulation in Drosophila by the basic helix-loop-helix transcription factor DIMMED. Nucleic Acids Res. 2015;43:2199–2215.  93. Poulin J-F, Zou J, Drouin-Ouellet J, Kim K-YA, Cicchetti F, Awatramani RB. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell Reports. 2014;9:930–943.  94. Buenrostro JD, Wu B, Litzenburger UM, Ruff D, Gonzales ML, Snyder MP, et al. Single-cell chromatin accessibility reveals principles of regulatory variation. Nature. 2015;523:486–490.  95. Kind J, Pagie L, de Vries SS, Nahidiazar L, Dey SS, Bienko M, et al. Genome-wide maps of nuclear lamina interactions in single human cells. Cell. 2015;163:134–147.  96. Golov AK, Razin SV, Gavrilov AA. Single-cell genome-wide studies give new insight into nongenetic cell-to-cell variability in animals. Histochemistry and Cell Biology. 2016;146:239–254.    83 97. Schwartzman O, Tanay A. Single-cell epigenomics: techniques and emerging applications. Nat Rev Genet. 2015;16:716–726.  98. Pombo A, Dillon N. Three-dimensional genome architecture: players and mechanisms. Nat Rev Mol Cell Biol. 2015;16:245–257.  99. Jin F, Li Y, Dixon JR, Selvaraj S, Ye Z, Lee AY, et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. 2013;503:290–294.  100. Mifsud B, Tavares-Cadete F, Young AN, Sugar R, Schoenfelder S, Ferreira L, et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nat Genet. 2015;47:598–606.  101. Barolo S. Shadow enhancers: frequently asked questions about distributed cis-regulatory information and enhancer redundancy. Bioessays. 2012;34:135–141.  102. El-Sherif E, Levine M. Shadow Enhancers Mediate Dynamic Shifts of Gap Gene Expression in the Drosophila Embryo. Curr Biol. 2016;26:1164–1169.  103. Frickenhaus M, Wagner M, Mallik M, Catinozzi M, Storkebaum E. Highly efficient cell-type-specific gene inactivation reveals a key function for the Drosophila FUS homolog cabeza in neurons. Sci Rep. Nature Publishing Group; 2015;5:9107.  104. Gomez D, Shankman LS, Nguyen AT, Owens GK. Detection of histone modifications at specific gene loci in single cells in histological sections. Nat Meth. 2013;10:171–177.  105. Iyer EPR, Cox DN. Laser Capture Microdissection of Drosophila Peripheral Neurons. JoVE. 2010;39:1–6.  106. Saliba A-E, Westermann AJ, Gorski SA, Vogel J. Single-cell RNA-seq: advances and future challenges. Nucleic Acids Res. 2014;42:8845–8860.  107. Rotem A, Ram O, Shoresh N, Sperling RA, Goren A, Weitz DA, et al. Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state. Nature Biotechnology. 2015:1–11.  108. Nagano T, Lubling Y, Stevens TJ, Schoenfelder S, Yaffe E, Dean W, et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 2013;502:59–64.  109. Ringrose L, Rehmsmeier M, Dura J-M, Paro R. Genome-Wide Prediction of Polycomb/Trithorax Response Elements in Drosophila melanogaster. Developmental Cell. 2003;5:759–771.  110.      Caussinus E, Kanca O, Affolter M. Fluorescent fusion protein knockout mediated by               anti-GFP nanobody. Nat Struct Mol Biol. 2011;19: 117–121.  111.     Barolo, S., Castro, B., and Posakony, J. W. New Drosophila transgenic reporters:              insulated P-element vectors expressing fast-maturing RFP. BioTechniques. 2004;36:             436-440,442 	     84  APPENDIX A. SUPPLEMENTARY TABLES AND FIGURES   Tv1 Tv4 Dimm dimm.K1-nDsRed Dimm dimm.K1-nDsRed Th1 Th3 Th1 Th3 Th1 Th3 Th1 Th3                  A20 A1 100.0 +/- 7.8% 100.0 +/- 6.6% 100.0  +/- 3.7% 100.0 +/- 8.5% 100.0 +/- 8.7% 100.0 +/- 6.6% 100.0 +/- 16.8% 100.0 +/- 9.7% A20 76.9 +/- 7.6% 78.3 +/- 8.3% 135.9 +/- 5.8% 150.2 +/- 10.7% 113.2 +/- 11.5% 120.4 +/- 8.7% 206.7 +/- 21.6% 330.8 +/- 34.7% P value 0.04 0.047 <0.0001 0.0008 0.4 0.07 0.0004 <0.0001                  A45 A1 100.0 +/- 13.1% 100.0 +/- 10.4% 100.0 +/- 5.9% 100.0 +/- 7.9% 100.0 +/- 7.0% 100.0 +/- 12.1% 100.0 +/- 5.2% 100.0 +/- 12.6% A45 95.7 +/- 11.0% 140.4 +/- 14.3% 186.4  +/- 9.1% 267.7 +/- 18.5% 167.2 +/- 11.2% 183.5 +/- 22.6% 637.8 +/- 84.1% 485.0 +/- 43.3% P value 0.8 0.03 <0.0001 <0.0001 0.0001 0.0041 0.0001 <0.0001 	  Table 2. Quantification of anti-Dimm and dimm.K1-nDsRed intensities at A20 and A45, relative to A1.  Relative intensities are presented as the % mean of A1 expression levels +/- SEM. Student's two-tailed t-tests were used to compare each type of neuron between the two ages indicated.   85 	  	   	   Figure 24. Loss of dimm.K1-nDsRed expression in the Stg17 Tv1 neurons of ap mutants. Representative Th3 Tv clusters are shown. Tissue was stained with anti-Eya to visualize the Tv clusters, anti-Nplp1 to visualize the Tv1 neurons and anti-FMRFa to visualize the Tv4 neurons. In controls, robust dimm.K1-nDsRed expression is exhibited in Tv1 (arrow heads) and Tv4 (arrows) neurons. In ap mutants, dimm.K1 reporter intensity is reduced in Tv4 neurons (quantified in Figure 12B) and lost in Tv1 neurons. Genotypes. Control: dimm.K1-nDsRed/dimm.K1-nDsRed. Experimental: apGal4, dimm.K1-nDsRed/apP44, dimm.K1-nDsRed 	   	   86  Figure 25. Confirmation of successful Dimm knockdown in Tv1 and Tv4 neurons. The TARGET system was used to knockdown (KD) (dimmdsRNAi) Dimm from A1 to A10 in Tv1 and Tv4 neurons, after normal development. Dimm immunoreactivity was lost from all Tv1 and Tv4 neurons in Dimm KD animals. Representative Th3 neurons are shown. Genotypes: Ctrl (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/+), Dimm KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/rev4, UAS-dimmdsRNAi ; tubP>Gal80TS, UAS-nEGFP/+).  	     87 	  Figure 26. Confirmation of successful Dimm over-expression in Tv1 and Tv4 neurons.  The TARGET system was used to over-express (OE) (UAS-dimm) Dimm from A1 to A5 in Tv1 and Tv4 neurons, after normal development. Dimm immunoreactivity was successfully increased in all Tv1 and Tv4 neurons in Dimm OE animals. Representative Th3 neurons are shown. Genotypes: Ctrl (apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP), Dimm OE (apGal4, dimm.K1-nDsRed/UAS-dimm ; tubP>Gal80TS , UAS-nEGFP).     88  Figure 27.   89 Figure 27. Confirmation of successful transcription factor knockdown in adult Tv1 neurons. The TARGET system was used to knockdown (KD) each Tv1 transcription factor after A1. Successful Ap KD was assessed indirectly through reduction of Nplp1 immunoreactivity. Genotypes: Ctrl (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS ,UAS-nEGFP/+), Ap KD (UAS-dicer2/Y ; apGal4,dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-apdsRNAi), Col KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS ,UAS-nEGFP/UAS-coldsRNAi), Eya KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-eyadsRNAi), Hth KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS , UAS-nEGFP/UAS-hthdsRNAi).   	     90  Figure 28.   91 Figure 28. Confirmation of successful transcription factor knock-down in adult Tv4 neurons. The TARGET system was used to knock-down (KD) each Tv4 transcription factor after A1. Representative Th3 neurons are shown. Successful Ap, BMP and Sqz KDs were assessed indirectly through reduction of FMRFa immunoreactivity. Genotypes: Ctrl (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/+), Ap KD (UAS-dicer2/Y ; apGal4, dimm.K1-nDsRed/+ ; tubP>Gal80TS, UAS-nEGFP/UAS-apdsRNAi), BMP KD (apGal4, dimm.K1-nDsRed/UAS-tkvDN ; tubP>Gal80TS,UAS-nEGFP/UAS-witDN), Dac KD (UAS-dicer2/Y ; apGal4,dimm.K1-nDsRed/dac3,UAS-dacdsRNAi ; tubP>Gal80TS,UAS-nEGFP/+), Eya KD (UAS-dicer2/Y ; apGal4,dimm.K1-nDsRed/+ ; tubP>Gal80TS,UAS-nEGFP/UAS-eyadsRNAi), Sqz KD (UAS-dicer2/Y ; apGal4,dimm.K1-nDsRed/+ ; tubP>Gal80TS,UAS-nEGFP/UAS-sqzdsRNAi).  92  Figure 29.  Additional controls for adult-specific transcription factor knockdown experiments.  (A) Knock-down of BMP signaling at A1 had no effect on dimm.K1 reporter activity in Tv1 neurons by A10. (B) Knockdown of Col at A1 had no effect on dimm.K1 reporter intensity in Tv4 neurons by A10. (C,D) Following Eya knockdown at A1 we simultaneously measured the response of anti-Dimm and dimm.K1 reporter intensities at A20; the effects on dimm.K1 reporter intensities are presented in Figures 14D and 15E, and the effects on anti-Dimm intensities were consistent with previously published work [36]. Results are also presented with Th1 and Th3 neurons pooled, as previously published.    93 APPENDIX B: CHARACTERIZING THE CIS-REGULATORY ARCHITECTURE THAT REGULATES INITIATION AND MAINTENANCE OF EYES ABSENT EXPRESSION IN DROSOPHILA TV1 AND TV4 NEURONS    Figure 30.    94 Figure 30. Proposed cis-regulatory architecture regulating initiation and maintenance of eya expression in Tv1 and Tv4 neurons.  (A) A UCSC genome browser view of the eya (blue arrow) locus. (B) A close-up view of the region outlined in red in A. The genomic regions encompassed by the Janelia GAL4 lines eyaGal4-GMR21A11 and eyaGal4-GMR21C02 are indicated with orange and purple arrows respectively. The genomic region encompassed by eyaDsRed-Tv1 is represented with a pink rectangle. (C) Proposed contributions of each of the regions 1, 2, 3 and 4 (limits denoted with blue dashed lines in B to initiation and maintenance of reporter expression in Tv1 and Tv4 neurons. (D) A summary of data supporting proposals in C.  The ability of the genomic regions eyaGal4-GMR21A11 , eyaGal4-GMR21C02 and eyaDsRed-Tv1  to drive reporter expression in Tv1 and Tv4 neurons was assessed at Stg17, A5 and third instar larvae (L3 – an intermediate developmental stage). 	  Region 4 in B encompasses a TRE/PRE identified by Ringrose et al. (2003) [109]. A role for this TRE/PRE in maintaining eya expression in Tv1 and Tv4 neurons has not yet been investigated.    95 APPENDIX C. CONSTRUCTION OF dimm.K1-nDsRed A nuclear localized DsRed reporter vector (pHStinger-nlsDsRed) was previously generated by SOE PCR to produce an amplicon containing the attB site from UASTattB, a MCS, a HSP70 minimal promoter, DsRed, a tra nuclear localization signal and the SV40-poly A sequences derived from the pHStinger vector. DsRed replaced the EGFP in the pHStinger sequence [73, 111]. The region encompassed by dimm.K1 was amplified from genomic DNA using the primers listed in Table 3. The PCR product was digested with AscI and XhoI and ligated into AscI and XhoI digested pHStinger-nlsDsRed vector. Transgenesis was performed by Genetic Services Inc. (Cambridge, MA). A single copy of the transgene was individually and unidirectionally integrated into the attP40 site on the second chromosome of the D. melanogaster genome using phiC31 integrase-based transgenesis [73].   Forward Primer Reverse Primer dimm.K1 GGCTGGCGCGCCGTTTTGGCGCGAATTTCTTT TCCGCTCGAGTTACATTTCGGTCGCATCTG  Table 3. Primers for PCR Amplification of dimm.K1.  AscI restriction digestion sites are depicted in red and XhoI restriction sites are depicted in blue. Preferred flanking nucleotides are depicted in bold.    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0340477/manifest

Comment

Related Items