Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Enhancement of oncolytic herpes simplex type 1 virotherapy Delwar, Zahid M. 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2017_february_delwar_zahid.pdf [ 4.54MB ]
Metadata
JSON: 24-1.0340475.json
JSON-LD: 24-1.0340475-ld.json
RDF/XML (Pretty): 24-1.0340475-rdf.xml
RDF/JSON: 24-1.0340475-rdf.json
Turtle: 24-1.0340475-turtle.txt
N-Triples: 24-1.0340475-rdf-ntriples.txt
Original Record: 24-1.0340475-source.json
Full Text
24-1.0340475-fulltext.txt
Citation
24-1.0340475.ris

Full Text

   ENHANCEMENT OF ONCOLYTIC HERPES SIMPLEX TYPE 1 VIROTHERAPY  by  Zahid M Delwar  M.Sc., Linkoping University, Sweden, 2010   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2016  ©Zahid M Delwar, 2016  ii  Abstract Despite excellent safety data, antitumor efficacy of the oncolytic herpes simplex virus type 1 (oHSV-1) in glioblastoma (GBM) patients is not satisfactory. A major enhancement of the oncolytic activity of the oHSV-1 is necessary to eradicate the GBM in clinics. To enhance the efficacy and tumour specificity, we first developed a GBM specific triple regulated oHSV-1 amplicon system (SU4-124 HSV-1). Translational regulation was achieved by incorporating five copies of microRNA 124 target sequences into the 3’UTR of the ICP4 gene. Additionally, a 5'UTR of rat fibroblast growth factor -2 was added in front of the viral ICP4 gene open reading frame.  The SU4-124 HSV-1 demonstrated enhanced tumour specificity and stronger anti-tumour efficacy compared to the tumour non specific CMV- ICP4 HSV-1 in both in-vitro and in-vivo GBM models. We then examined the effect of a potent STAT inhibitor, which is the key regulator of interferon (IFN) response, nifuroxazide (NF), a prescription anti-diarrheal drug, on the oHSV-1 efficacy. This was done with the aim of reinforcing the anti-tumour efficacy of oHSV-1 and developing an effective combination therapy. Here, we found that NF synergistically augments the anti-tumour efficacy of oHSV-1 by regulating the anti-apoptotic properties of HSV-1 in various tumour cells. Moreover, our data demonstrated that STAT1/3 activation mediated the underlying cellular mechanism of this novel combination. To further improve the efficacy of oHSV-1, possible barriers in the microenvironment of GBM need to be identified. Since previous clinical GBM have documented an abundance of microglia /macrophages, we first investigated the interaction of oHSV-1 and microglia/macrophages in in-vitro and in-vivo GBM models. We found evidence that microglia/macrophages suppress oHSV-1 in glioma mass by generating a physical barrier to the dissemination of oHSV-1. We also observed that the deficiencies in viral replication in microglial cells are associated with the STAT1/3-mediated silence of particular viral genes. We found that an oxindole/imidazole derivative, C16, can aid the viral replication in microglia/macrophages and dramatically increase the therapeutic efficacy of oHSV-1 in GBM animal model. In conclusion, this project outlines possible ways to overcome the barriers involved in oHSV-1 therapy to successfully eradicate clinical GBM.  iii  Preface The manuscripts reported in this thesis are based on my work performed toward the completion of my Ph.D. program, which is either published or submitted for publication or in preparation now.   A version of Chapter 2 has been published and reproduces under Creative Commons Attribution 3.0 License (Copyright @ 2016 Impact Journals). Tumour-specific triple-regulated oncolytic herpes virus to target glioma. Zahid M. Delwar, Guoyu Liu, Yvonne Kuo, Cleo Lee, Luke Bu,3, Paul S. Rennie, William W. Jia. Oncotarget. 2016 May 10;7(19):28658-69. Most of the in-vitro and in-vivo experiments were performed by myself. Data were interpreted and analyzed by myself. Tissue DNA extraction and qPCR were carried out by Yvonne Kuo and myself. miRNA 124, 143 and 145 expression pattern in mouse and human tissues were performed by Dr. Cleo Lee. Technical support was provided by Guoyu Liu and Luke Bu. The manuscript was written by myself with the help of Dr. William Jia. Conception, design, and revision of the manuscript were performed by Dr. Paul S. Rennie and Dr. William Jia. The study was supervised by Dr. William Jia.  A version of Chapter 3 has been submitted for publication. Zahid M. Delwar,  Justin Lardizabal, Yvonne Kuo, Erin Kwa, Gabriel Fung, Honglin Luo, William W. Jia. An antibiotic drug, nifuroxazide synergistically enhances anti-tumour effect of oncolytic herpes simplex virus. Most of the in-vitro and in-vivo experiments were performed by myself. Data were interpreted and analyzed by myself. Technical support for synergy analysis was provided by Justin Lardizabal. Western blot analysis was performed by myself and Yvonne Kuo. Cell death analysis was conducted by myself, Erin Kwa, Dr. Gabriel Fung and Dr. Honglin Luo. The manuscript was written by myself and revision was done by Dr. William Jia. The study was supervised by Dr. William Jia. A version of Chapter 4 will be submitted for publication. Zahid M Delwar, Yvonne Kuo, Yan Hua Wen, William Jia. Microglia/macrophages mediated inhibition of oncolytic virotherapy is STAT1/3 dependent. Most of the in-vitro and in-vivo experiments were performed by myself. Data were interpreted and analyzed by myself. Immunostaining iv  was carried out by myself and Yvonne Kuo. The manuscript was written by myself and revision was done by Dr. William Jia. The study was supervised by Dr. William Jia. A review article is published, based on recent progress on oncolytic virotherapy, including knowledge gained from this project, which is reproduced with permission from ©Nature Publishing Group. Zahid Delwar, Kaixin Zhang, Paul S. Rennie & William Jia. Oncolytic virotherapy for urological cancers. Nature Review Urology. 2016 Jun;13(6):334-52  A collaborative work with Dr. Aziz Gahary was also published. Yunyuan Li,Hans Adomat,Emma Tomlinson Guns,Payman Hojabrpour,Vincent Duronio,Terry-Ann Curran,Reza Baradar Jalili, William Jia, Zahid Delwar,Yun Zhang,Sanam Salimi Elizei, Aziz Ghahary. Identification of a Hematopoietic Cell Dedifferentiation-Inducing Factor. Journal of Cellular Physiology. 2016 Jun;231(6):1350-63           v  Table of contents Abstract .......................................................................................................................... ii Preface .......................................................................................................................... iii Table of contents........................................................................................................... v List of figures ................................................................................................................ x Acknowledgements ..................................................................................................... xii Dedication ................................................................................................................... xiii  1 Introduction ................................................................................................................ 1  1.1 Glioma ............................................................................................................ 1   1.1.1 Treatment of glioma ............................................................................ 1  1.2 Oncolytic Virotherapy ..................................................................................... 2   1.2.1 General mechanisms of virotherapy ................................................... 3   1.2.2 Herpes Simplex Virus ......................................................................... 4                               1.2.2.1 Herpes simplex virus Type 1 structure ................................ 5                               1.2.2.2 Herpes simplex virus Type 1 life cycle ................................ 5                               1.2.2.3 Oncolytic potential of HSV-1 ............................................... 7                                          1.2.2.4 ICP34.5 and ICP6 deletion mutants of oHSV-1 ................... 7  1.3 Challenges of OV ........................................................................................... 8   1.3.1 Tumour selectivity without compromising viral replication efficiency... 8   1.3.2 Intratumoural barriers ......................................................................... 9   1.3.3 Anti-viral immune response ................................................................ 9  1.4 Strategies to increase the efficacy of oncolytic virotherapy .......................... 11 1.4.1 Increasing effectiveness and reducing off-target effects by enhancing tumour specificity ......................................................... 11  1.4.1.1 Transcriptional regulation .................................................. 11  1.4.1.2 Translational regulations ................................................... 12               1.4.1.2.1 5’UTR mediated translational targeting ................ 12                  1.4.1.2.2 MicroRNA mediated translational targeting .......... 13  1.4.1.3 Targeting virus tropism for tumour specificity .................... 13 vi   1.4.2 Enhance the efficacy of OV by combining with chemotherapy or immune modulator compounds ..................................................... 13     1.4.3 Overcome microglia/macrophage-mediated intratumoural barrier .. 14  1.4.3.1 Microglia/macrophage polarization .................................... 15  1.4.3.2 Microglia/macrophage in glioma ........................................ 16  1.5 Objective and aims ....................................................................................... 18  2 Tumour-specific triple-regulated oncolytic herpes virus to target glioma .......... 20  2.1 Introduction ................................................................................................... 20  2.2 Materials and methods ................................................................................. 23   2.2.1 Cell culture ........................................................................................ 23   2.2.2 Plasmid constructs............................................................................ 23   2.2.3 Amplicon virus preparation ............................................................... 24   2.2.4 Virus replication assay ...................................................................... 24   2.2.5 Precursor miRNA transfection .......................................................... 24   2.2.6 Luciferase reporter assay ................................................................. 24   2.2.7 Real time PCR .................................................................................. 25   2.2.8 Cytotoxicity assay ............................................................................. 25   2.2.9 Western blots .................................................................................... 25   2.2.10 Immunohistochemistry .................................................................... 26   2.2.11 Intracranial virus toxicity assay ....................................................... 27   2.2.12 β-galactosidase staining ................................................................. 27   2.2.13 U87 xenograft mouse model ........................................................... 27   2.2.14 Statistical analysis .......................................................................... 28  2.3 Results.......................................................................................................... 28  2.3.1 Survivin and eIF4E are overexpressed in glioma cells, but           downregulated in normal neuronal cells................................................... 28   2.3.2 Micro RNA 124 expression is low in glioma cells .............................. 29   2.3.3 miR124 prevented the replication of miRNA regulated virus ............ 30 vii    2.3.4 miRNA regulation does not hinder HSV-1 antitumour efficacy ......... 32  2.3.5 Survivin promoter, miRNA 124 and 5’UTR triple-regulated amplicon virus (SU4-124 HSV-1) have a strong antitumour effect on glioma cells . 33  2.3.6 Triple-tumour-specific regulation significantly increases tumour specificity ................................................................................................. 34   2.3.7 SU4-124 HSV-1 virus reduces neuronal toxicity in vivo .................... 35  2.3.8 Tumour-specific triple-regulation enhances the antitumour effect without affecting normal organs in vivo .................................................... 36              2.3.9 Effect of the amplicon and helper ratio on tumour-specific growth.... 38  2.4 Discussion .................................................................................................... 39  3 An antibiotic drug, nifuroxazide synergistically enhances anti-tumour effect of oncolytic herpes simplex virus ....................................................................... 41  3.1 Introduction ................................................................................................... 41  3.2 Materials and methods ................................................................................. 42   3.2.1 Cells, viruses and reagents .............................................................. 42   3.2.2 Western blots .................................................................................... 43   3.2.3 Cytotoxicity assay ............................................................................. 43   3.2.4 qPCR array ....................................................................................... 44   3.2.5 U87 xenograft mouse model ............................................................. 44   3.2.6 CT26 xenograft mouse model .......................................................... 44   3.2.7 Tissue RNA extraction and real time quantitative PCR ..................... 45   3.2.8 Tissue DNA extraction and quantitative PCR ................................... 45   3.2.9 Statistical analysis ............................................................................ 46  3.3 Results.......................................................................................................... 46  3.3.1 NF significantly enhances the anti-proliferative effect of oHSV-1 in an synergistic fashion ................................................................................... 46  3.3.2 The NF and oHSV-1 combination inhibits STAT activity both in vitro and in vivo ................................................................................................ 51   3.3.3 The NF effect on HSV-1 immediate early gene expression .............. 54   3.3.4 NF overcomes the anti-apoptotic effect of oHSV-1 ........................... 55 viii   3.3.5 NF enhances both the anti-tumour effect and the safety of oHSV-1 in vivo .......................................................................................................... 55  3.4 Discussion .................................................................................................... 58  4 Microglia/macrophages mediated inhibition of oncolytic virotherapy is STAT1/3 dependent  ........................................................................................................ 61  4.1 Introduction ................................................................................................... 61  4.2 Materials and methods ................................................................................. 63   4.2.1 Microglia isolation and culture .......................................................... 63   4.2.2 Cell culture ........................................................................................ 64   4.2.3 Virus replication assay ...................................................................... 64   4.2.4 Drugs and reagents effect on virus replication .................................. 64   4.2.5 Western blots .................................................................................... 65   4.2.6 RNA extraction and RT-PCR ............................................................ 65   4.2.7 β-galactosidase staining ................................................................... 66  4.2.8 iNOS (Inducible Nitric Oxide Synthase) inhibition effect on oHSV-1 growth ...................................................................................................... 66   4.2.9 Phagocytosis assay .......................................................................... 67   4.2.10 Cell conditioned medium collection & treatment ............................. 67   4.2.11 Cell proliferation assay ................................................................... 68   4.2.12 U87 xenograft model ...................................................................... 68   4.2.13 Tissue DNA extraction & qPCR ...................................................... 68   4.2.14 Immunohistochemistry .................................................................... 69   4.2.15 Statistical analysis .......................................................................... 69  4.3 Results.......................................................................................................... 70  4.3.1 Presence of microglia hinders the oncolytic efficacy of oHSV-1 against U87 cells  ................................................................................................. 70   4.3.2 oHSV-1 triggers M1 polarization of microglia .................................... 72  4.3.3 Nitric oxide (NO) and other microglia secreted products have no noticeable effect on oHSV-1 replication ................................................... 73   4.3.4 Microglia uptake oHSV-1 via phagocytosis ....................................... 74 ix    4.3.5 oHSV-1 infection induces microglia cell death .................................. 76  4.3.6 Microglia forms a replicative barrier to prevent oHSV-1   dissemination ........................................................................................... 76   4.3.7 oHSV-1 gene expression profiling in BV2 microglia cells ................. 78   4.3.8 C16 overcomes microglia-mediated oHSV-1 replication barrier ....... 79   4.3.9 Tissue-specific C16 effect on oHSV-1 replication ............................. 81  4.3.10 C16 rescue oHSV-1 in microglial cells by inhibiting STAT 1 and 3 activities ................................................................................................... 82   4.3.11 Cell type specific eIF2α phosphorylation inhibitory effect of C16 . 84  4.3.12 C16 selectively facilitates oHSV-1 replication in glioma xenograft by overcoming barriers of tumour-associated macrophage .......................... 84   4.3.13 Anti-tumour effect of C16 ................................................................ 86   4.3.14 C16 significantly improve human glioma xenograft regression ....... 87   4.3.15 Schematic diagram of microglia effect on oHSV-1 efficacy ............ 88  4.4 Discussion .................................................................................................... 89  5 Conclusions and future directions ......................................................................... 93  5.1 oHSV-1 tumour specificity ............................................................................ 93  5.2 Cytotoxicity of oHSV-1 infection ................................................................... 94  5.3 Tumour microenvironment effect on oHSV-1 ................................................ 97  5.4 Conclusions ................................................................................................ 100  Bibliography .............................................................................................................. 102        x  List of figures Chapter 1 Figure 1.1 Oncolytic virus (OV). ...................................................................................... 2 Figure 1.2 HSV virion structure. ...................................................................................... 5 Figure 1.3 Herpes Simplex Virus replication cycle .......................................................... 6 Figure 1.4 Functions and phenotypes of ‘M1’ and ‘M2’ polarisation states of      macrophages ................................................................................................................ 16 Figure 1.5 Glioma-microglia crosstalk ........................................................................... 18 Chapter 2 Figure 2.1 Schematic diagram of cancer-specific triple-regulated HSV-1 amplicon virus (SU4-124 HSV-1) .......................................................................................................... 22 Figure 2.2 Survivin and eIF4E expression in different cells ........................................... 29 Figure 2.3 miRNA 124 expression levels in different cells ............................................. 30 Figure 2.4 miRNA 124 prevents CMV-124T HSV-1 virus replication ............................ 31 Figure 2.5 Replication & cytotoxicity of miRNA124 targeted amplicon virus ................. 32 Figure 2.6 Antiproliferative effect of SU4-124 HSV-1 .................................................... 33 Figure 2.7 Triple regulation significantly augments tumour specificity ........................... 34 Figure 2.8 Intracranially injected virus toxicity in vivo .................................................... 35 Figure 2.9 SU4-124 HSV-1 significantly augments the antitumour effect without increasing viral spread to other organs ......................................................................... 37 Figure 2.10 Amplicon and helper ratio combination ...................................................... 38 Chapter 3 Figure 3.1 NF significantly enhances the cytotoxicity of oHSV-1 and provides an synergistic anti-tumour effect in combination ................................................................ 50 Figure 3.2 STAT inhibition by the NF and oHSV-1 combination .................................... 53 Figure 3.3 NF effect on ICP27 and ICP4 gene expression ............................................ 54 Figure 3.4 PCR array of the NF and oHSV-1 combination in tumour cells .................... 55 xi  Figure 3.5 Enhanced anti-tumour effect of the NF and oHSV-1 combination in-vivo .... 57 Chapter 4 Figure 4.1 Presence of microglia in GBM culture suppresses growth and oncolytic capacity of oHSV-1........................................................................................................ 71 Figure 4.2 oHSV-1 effect on microglia polarization ....................................................... 72 Figure 4.3 Effect of microglia secreted products on oHSV-1 efficacy ............................ 73 Figure 4.4 oHSV-1 and microglia phagocytosis ............................................................ 75 Figure 4.5 oHSV-1 effect on microglia cell proliferation................................................. 76 Figure 4.6 oHSV-1s are capable of infecting microglias, but they are unable to   replicate ......................................................................................................................... 77 Figure 4.7 oHSV-1 gene expression in microglia cells .................................................. 78 Figure 4.8 Mechanism of oHSV-1 gene expression blockade in microglia cells ............ 80 Figure 4.9 Effect of C16 on oHSV-1 replication in tumour and nontumour cell types .... 81 Figure 4.10 C16 inhibits STAT 1 and 3 phosphorylation ............................................... 83 Figure 4.11 eIF2α phosphorylation inhibition effect of C16 in various cell types infected with oHSV-1 .................................................................................................................. 84 Figure 4.12 C16 triggers oHSV-1 protein expression in microglia/macrophages and enhances virus concentration in glioblastoma in-vivo ................................................... 86 Figure 4.13 Anti-tumour effect of C16 in-vitro ................................................................ 86 Figure 4.14 C16 increases oncolytic efficacy of oHSV-1 in-vivo ................................... 87 Figure 4.15 Schematic diagram of microglia barrier on oHSV-1 therapy ...................... 88 Chapter 5 Figure 5.1 Schematic diagram of apoptosis regulation in oHSV-1 permissive and nonpermissive cells ....................................................................................................... 96 Figure 5.2 Balanced approach of the present study to enhance oHSV-1 efficacy without compromising the safety ............................................................................................. 100   xii  Acknowledgements First and foremost, I would like to express my profound gratitude and indebtedness to my supervisor Dr. William Jia for his patience, motivation, and immense knowledge, and being a perennial source of inspiration in all through my Ph.D. study. His guidance helped me a lot to conduct my research and writing this thesis. I could not have imagined having a better mentor for my Ph.D. study. Besides my supervisor, I am also very much grateful to the rest of my supervisory committee:  Dr. Paul Rennie, Dr. Honglin Luo and Dr. Christopher Ong, for their patient hearing, insightful comments, encouragement and constructive criticism, which helped me throughout the entire work to complete the study successfully. I thank my fellow labmates, particularly, Dr. Si Zhang, Mr. Justin Lardizabal, Mr. Luke Bu and Ms. Guoyu Liu for their kind help and guidance during my lab work. Last but not the least, I would like to thank my family for their continuous support and inspiration.             xiii             To my parents  1  1 Introduction 1.1 Glioma Glioma is one of the most common primary brain tumours 1,2  that is rapidly growing and therapy-resistant 3. Prognosis for high-grade glioma patients is very poor 4,5 and the median survival is only 14.6 months after receiving all the currently available treatments 1. A new effective therapeutic approach is therefore urgently needed. 1.1.1 Treatment of glioma Radiation and chemotherapy following maximal surgical resections are the current treatment for newly diagnosed high-grade glioma patients 6,7. Very few effective chemotherapeutic agents are available to treat glioblastoma. In addition, most of the chemotherapeutic agents show only marginal clinical benefit 4,5. Chemotherapeutic treatment of glioma is mainly temozolomide (TMZ) based 3, which is an alkylating chemotherapeutic drug 4,5. TMZ arrests the cell cycle by methylates guanine group in the DNA and therefore, resulting O-6-methylguanine mispairs with thymine upon DNA replication. However, many patients fail to respond to TMZ due to inherent or acquired resistance 3,8,9. The DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT) over-expression is considered as a key mechanism of TMZ resistance. MGMT repairs the lesion by removing the methyl group from guanine to a cysteine residue prior to the formation of the mismatch 10. Resistance to cytotoxic agents remains the greatest barrier to the successful treatment of glioma 3. In addition, chemotherapeutic agents induce premature senescence in cancer cells which re-enter the cell cycle and lead to cancer relapse after treatment 11-15.    2  1.2 Oncolytic Virotherapy Oncolytic virotherapy has emerged as a promising anti-cancer therapeutic approach recently. The first oncolytic virus T-VEC (herpes virus-based oncolytic virus) was approved last year (2015) by a combined FDA advisory panel for treating melanoma 16,17. This is a landmark for the success of oncolytic virotherapy and extends its clinical use to other types of cancer. Oncolytic virotherapy uses replication-competent viruses to specifically destroys cancer cells through oncolysis: a killing mechanism characterized by the lysis of cancer cells through the course of virus replication 18. As oncolytic viruses (OVs) can kill cancer cells via a mechanism distinct from the killing effects of conventional chemotherapy and radiotherapy, OVs are potentially ideal to kill cancer cells that are non-responsive to conventional treatment.        Figure 1.1 Oncolytic virus (OV). OV replicates and kills malignant cells by cell lysis, while unable to replicate in non malignant cells. 3  1.2.1 General mechanisms of virotherapy  The tumour-destructive mechanism of OVs lies in their capability to replicate through a lytic cycle, which results in lysis of the cancer cell and release of viral progeny to infect neighbouring cells. Moreover, OVs also commence antitumour immune responses, which overcome the immunosuppressive environment of tumours 19. Excellent safety and promising therapeutic efficacy of oncolytic virotherapy have already shown against various tumours in preclinical animal models and a number of clinical trials 20-27. Oncolytic virus’ tumour-destruction capability may not be reduced or influenced by cellular mechanisms that contribute to tumour’s resistance to conventional treatments, such as chemotherapy 28,29. In fact, many cellular mechanisms responsible for resistance to conventional therapies enhance the replication of OVs. These mechanisms include enhanced oncogene expression (such as RAS genes) 30, increased DNA repair activity 31, anti-apoptotic activity 32 and augmented function of survival and proliferation pathways, such as protein kinase B (Akt) 33 and nuclear factor κB (NF-κB) 34. Crucially, the same mechanisms are also featuring of late-stage cancers, making virotherapy a potentially perfect treatment candidate to target cells that have acquired resistance to conventional therapies.  However, OVs mediated tumour regression is a complex process that involves the activities of several mechanisms. Viral oncolysis was considered to be the most important factor of tumour regression. OVs eradicate malignant cells through lytic replication, which eventually results in lysis of the infected cells. Most viruses penetrate the cells through cell surface receptors and instantly initiate expression of viral genes. Moreover, viruses already carry some viral proteins. The virus takes control of the cellular machinery and halts production of cellular macromolecules to express its own genes for its replication. Some viral proteins are also directly cytotoxic and provoke apoptosis or necrosis of the host cells. In the infected cells, copies of the viral genome are amplified, followed by packaging of the viral progeny and discharge into the extracellular space via cell lysis, or infecting the neighbouring cells through fusion of cell membranes. Propagation of viruses among tumour cells and repetitive replication cycles can result in regression of the tumour.  4  Moreover, tumour-associated vasculature destruction by virotherapy may also play a major role in tumour destruction. In some cases, tumour-associated cells, such as stromal and endothelial cells within the tumour mass are eliminated by the viruses 35. This process can hinder the tumour microenvironment, contributing to tumour regression activity. For example, oncolytic vaccinia has been demonstrated to get rid of tumour-supporting vasculature which escalates tumour regression 35.  Host immune response has traditionally been considered to obstruct oncolytic effectiveness, as host antiviral immunity usually prevents viral replication. However, virus infection provoked immune responses have now been recognized as a crucial factor contributing to tumour destruction. Despite suppressed immune system in many cancer patients, viral infection activates both innate and adaptive immune responses in the host. Infected tumours can become inflamed and release cytokines to activate immune cells to attack infected cells. Also, virus-mediated cell lysis can discharge cellular proteins into the extracellular space that leads the presentation of specific tumour antigens that are usually intracellular 36,37. Accordingly, natural killer cells, macrophages, and T cells can attack tumour cells that are usually hidden or not recognised by the immune system. 1.2.2 Herpes Simplex Virus Herpes simplex virus (HSV) belongs to the subfamily Alphaherpesvirinae in the Herpesviridae family. HSV is a large, double-stranded DNA viruses and it contains two closely related viruses: Herpes simplex virus Type 1 (HSV-1) and Herpes simplex virus Type 2 (HSV-2). HSV-1 is normally associated with oral lesions which are known as cold sores, and HSV-2 mostly causes genital lesions 38,39. HSV-1 is widely distributed among human population, and around 2/3 of the adult human are seropositive for HSV 40. 5  1.2.2.1 Herpes simplex virus Type 1 structure HSV-1 contains the following four structural components: 1) core that contains the double-stranded viral DNA, 2) an icosahedral capsid, 3) a tegument that contains additional viral proteins, and 4) an outer membrane envelope studded with viral glycoprotein spikes 39.    Taylor TJ, et al. Frontiers in bioscience 2002;7:752-64 This figure is reproduced with permission from ©Frontiers in Bioscience Figure 1.2 HSV virion structure. The HSV virion is comprised of (a) the double stranded DNA, (b) icosahedral capsid; (c) tegument layer; and (d) an envelope. EM picture of the virion structural components (right panel).  1.2.2.2 Herpes simplex virus Type 1 life cycle HSV-1 genome size is 152kb that encodes approximately 84 genes. HSV-1 genome is categorized into three parts: immediate early (IE), early (E) and late (L) genes 39. HSV-1 enters the cell by receptor-mediated endocytosis process. VP16 tegument protein activates the expression of IE (ICP0, ICP4, ICP22, ICP27 & ICP47) genes, followed by 6  E genes that encode enzymes and DNA replication protein, and finally, late genes encode structural proteins of progeny virus 39.     Taylor TJ, et al. Frontiers in bioscience 2002;7:752-64. This figure is reproduced with permission from ©Frontiers in Bioscience  Figure 1.3 Herpes Simplex Virus replication cycle.The stages of HSV infection and replication are: (1) Binding with receptor and membrane fusion; (2) Viral nucleocapsid and tegument release into the cell cytoplasm and then transport of the nucleocapsid to the nuclear pore; (3) Viral DNA release into the nucleus; (4) Viral immediate early (IE) and early (E) genes transcription and translation; (5) Synthesis of viral DNA; (6) Viral late (L) genes transcription and translation; (7) Assembly of the capsid and DNA packaging; and (8) egress of progeny virions.  7  1.2.2.3 Oncolytic potential of HSV-1 Genetically engineered HSV-1 vectors are promising therapeutic agents to treat various cancers as they have the capability to replicate specifically in and lyse tumour cells while sparing non malignant cells 41,42. Oncolytic herpes simplex virus type-1 (oHSV-1) has been investigated for more than a decade in laboratories and clinical trials for the treatment of various types of cancer including glioblastoma 43. HSV-1 has several advantages for using as an oncolytic virus: 1) HSV-1 is genetically very stable, 2) Its large genome size allows enhanced capacity for insertion of foreign genes, 3) It is easy to attain high titer and highly infectious, 4) clinical virology is well characterized and efficient anti-herpes agents are available such as acyclovir and ganciclovir. Therefore, the virus has been engineered to restrict its replication only in tumour cells and lyse tumour cells without harming non-tumour cells 41,42,44. 1.2.2.4 ICP34.5 and ICP6 deletion mutants of oHSV-1 In the 20th century, wild-type HSV-1 was found to slow down tumour growth. Then 70 years later, mutated viruses were among the first OVs, investigated in pre-clinical studies for their anti-tumour properties 45. Viral gene deletion or mutation is the most common approaches to making the HSV-1 tumour specific. Potential oncolytic properties of the genetically mutated HSV-1 was first revealed by the thymidine kinase (TK) mutated HSV-1 46.  HrR3 is an oncolytic HSV-1 47,48, with a mutation /deletion of ICP6 gene encoding the viral ribonucleotide reductase (RR)  47 and this is one of the early stage oHSV-1s that was investigated in glioblastoma preclinical studies 49. Ribonucleotide reductase (RR) is essential for the synthesis of deoxyribonucleotides, which is needed for viral DNA synthesis and replication. Increased expression of mammalian RR is found in most of the rapidly dividing cells, and RR deletion mutants (HrR3) efficiently replicate only in the cells that compensate for the loss of ICP6 by expressing the mammalian complement of RR 50.  8  G207 is a double gene mutated oHSV-1 that lacks neurovirulence γ34.5 and ICP6 gene 51-53. G207 was among the first to be safely administered to patients with recurrent malignant glioma. HSV-1 infection triggers the activation of protein kinase R (PKR) which is one of the pivotal cellular defenses against viral infection. Activation of PKR leads to phosphorylation of eIF-2α, thereby shutting down protein synthesis in the normal host cell. HSV-1 has the countermeasure against PKR and γ34.5 restores protein synthesis by activating protein phosphatase-1 which thereby dephosphorylates and restores eIF-2α function. Due to some genetic mutations, activation of PKR is less pronounced in malignant cells and deletion of viral 34.5 gene makes the virus non-replicable in non malignant cells 45. This is the most widely evaluated oHSV-1 in the glioma clinical trials 54,55 and series of clinical studies demonstrate the safety profile of G207, but its oncolytic efficacy needs to be improved 56.  1.3 Challenges of OV Preclinical in-vitro studies in some laboratories have shown that oHSV-1 could eliminate glioma cells within a short period. This was further supported in immunodeficient glioma xenograft models where intratumoural inoculation of oHSV-1 could eliminate the tumour 57,58. However, although excellent safety shown by several clinical trials, oHSV-1’s therapeutic efficacy requires considerable improvements 59-61. To be successful in clinics, oHSV-1 needs to overcome some challenges including:  1.3.1 Tumour selectivity without compromising viral replication efficiency Maximizing oncolytic activity of an oncolytic virus without compromising safety for non malignant cells is a major challenge. High specificity for cancer cells is the central concern when designing OVs. Viral gene deletion to enhance safety and tumour specificity often comes with the price of losing strong oncolytic virulence 62,63. A common approach to reduce oHSV-1’s neurovirulence is to delete the ICP34.5 gene, 9  which significantly attenuates the viral replication efficiency 62,64. GBM is highly invasive and infiltrate to surrounding brain parenchyma 65. So, a highly glioma-specific oncolytic virus is required to eradicate glioma cells successfully without harming surrounding non-tumour cells.  1.3.2 Intratumoural barriers Often, oncolytic virus treatments are highly effective in animal tumour models but not in clinical trials. In addition to many other differences, established tumours in patients are highly heterogeneous in comparison with those in animal models, containing significant amounts of non-tumour cells, such as stromal cells, infiltrating immune cells and endothelial cells in blood vessels. Viruses are large and often heavily charged particles that do not diffuse as easily in tissues as small molecules. Hence, biological dissemination, in contrast to purely physical diffusion, is necessary for the virus to spread throughout the entire tumour. As OVs by definition can only replicate in cancerous cells, tumour-associated non malignant cells are physical barriers within the tumour against dissemination of the progenitor virus or virus progeny released from infected tumour cells66. Glioma tumour mass also consists of numerous non-cancerous cells including various types of immune cells 67 that block the virus spread 68. Clinical observations support this notion that replicating adenovirus resulted in better overall response rates than a non-replicating adenovirus, although both viruses expressed immune-system-stimulating factors 69,70.    1.3.3 Anti-viral immune response  Immune responses have been noted in numerous studies both in animal models and patients. Virus-targeted antibodies were readily detectable in patients receiving OVs 69,71-73 which might contribute to the attenuation of subsequently administrated virus doses 69,72. The capability of the host’s immune response to inhibit the effectiveness of OVs has been recognised for a long time. For OVs that are common in normal human populations, pre-existing antibodies and adaptive immune responses in addition to 10  innate immune response can effectively block virus activity. This might be particularly true if the viruses are strongly immunogenic and are delivered systemically since the viruses may encounter strong neutralising antibodies in the blood.  However, the effect of the immune response on virus dissemination is time-dependent and dose-dependent. Initial innate immune responses carried by macrophages 68 and NK cells 74 start almost instantly after virus inoculation 75, either by intratumoural injection or by systemic delivery, and this is followed by adaptive responses including induction of neutralizing antibodies and cytotoxic T-cells 76. The anti-viral immune response may take some time to reach a full stop on viral dissemination. However, the antiviral immune response is also an important mechanism underlying oncolytic-virus-induced antitumour activity. All patients showed dose-related increases in IL-6 and IL-10 blood levels when treated with adenovirus CG7870 77. Some patients had increased serum levels of IFN-γ and IL-8 after treatment with coxsackievirus CVA2178. Several experiments with various OVs including HSV-1, adenovirus, parvovirus H-1, NDV, and VSV have shown that intratumoural virus injection induced increased tumour infiltration of various immune cells. It includes antigen-presenting dendritic cells, macrophages and tumour-specific CD4+ and CD8+ T cells 79-81. Interestingly, tumour-specific lymphocyte infiltration also occurred in distant tumours that were not infected by the therapeutic viruses such as HSV-1, NDV and adenovirus 36,82,83. In patients with prostate cancer, histological analysis of biopsy samples prepared upon prostatectomy following intratumoural reovirus injections demonstrated a substantial CD8+ T cell infiltration within the reovirus-injected areas 84. In addition, in the CG0070 adenovirus trial, no correlation between administered virus dose and clinical efficacy was observed, suggesting that virus-mediated oncolysis was not a dominant cause for the observed tumour regressions in this case 69. The virally induced strong immune response may help to kill cancer cells. However, the immune response can also eliminate the virus to attenuate its antitumour cell lysis. A balanced approach with carefully designed dosing schedule may help to obtain the optimised clinical outcome. 11  1.4 Strategies to increase the efficacy of oncolytic virotherapy Strategies to overcome the obstacles of successful oncolytic virotherapy include increasing effectiveness as well as reducing adverse and off-target effects. For example regulating and restricting viral gene transcription and translation to target tissues, enhancement of the oncolytic activity of the viruses themselves, a combination of gene therapy with oncolysis, a mix of virotherapy with chemotherapy or radiotherapy, combining or arming OVs with immune-modulator factors and removing the intratumoural barriers.  1.4.1 Increasing effectiveness and reducing off-target effects by enhancing tumour specificity Different strategies have been utilized to obtain the tumour selectivity of the OVs 85. Viral gene attenuation or deletion is a common approach to reduce viral replication in non-tumour cells to reduce toxicity 62,64 . Tumour specific promoter driven viral gene expression is a useful transcriptional regulatory method to restrict virus replication in tumour cells, but this approach still results in basal-level expression of the controlled gene in non-target tissue 86. Restricting expression on a translational level, in addition to transcriptional regulation, is another strategy to improve tissue specificity 87,88. Attenuating viral tropism is another strategy to achieve tumour specificity by altering virus entry mediator gene(s).  1.4.1.1 Transcriptional regulation Tumour cell specific promoter driven expression of an essential viral gene is a very common strategy 89. This approach has been proven as a good strategy to target a particular cell type and use of a cell-specific promoter can considerably restrict viral gene expression to the desired cell 90. Most viruses depend on expression of certain essential viral genes for their replication; thus, manipulating the transcriptional control of these genes can be another strategy to ensure tumour specificity. For example, for 12  HSV-1, putting ICP4, which is essential for virus replication, under the control of a tumour specific promoter can restrict lytic replication of HSV-1 to tumour cells 91.  1.4.1.2 Translational regulations Tumour specific translational regulation of an oncolytic virus has been proven as another useful strategy to enhance tumour specificity and safety without compromising viral oncolytic virulence 87,88,92,93. 1.4.1.2.1 5’UTR mediated translational targeting Eukaryotic translation initiation factor 4E (eIF4E) binds at 5-terminal, 7-methylguanosine-containing cap of an mRNA, thereby deliver that mRNA to the eIF4F, which is a translation initiation complex that composed of eIF4E, eIF4G (scaffolding protein), and eIF4A (RNA helicase). In normal cellular conditions, eIF-4E is bound by the inhibitory 4EBPs and 4EBPs sequester eIF-4E from interaction with eIF-4G 94. Upon mitogenic stimulation, the 4EBPs become phosphorylated and dislodged from eIF-4E, thereby liberating eIF-4E to enable eIF-4E to deliver mRNAs to the eIF-4F complex. The eIF4F complex then scans through the 5' untranslated region (UTR) of the mRNA and expose the translation initiation codon by unwinding mRNA secondary structure to and trigger ribosome engagement to facilitate the translation of that mRNA 94,95. The eif4e level is low in most non malignant cells, but high in almost all cancer cells 42,96-99. The differential expression pattern of eif4e in tumour and non malignant cells providing an opportunity for cell-specific control 87. Translation of many growth factors, such as FGF-2, is widely dependent on cellular levels of eIF-4E, owing to the complex structure of their 5’ untranslated region (5’UTR). FGF-2 5’UTR insertion in front of the coding area of UL54, restrict its corresponding protein ICP27 expression only in tumour cells, which have high levels of eIF 4E 87. 13  1.4.1.2.2 MicroRNA mediated translational targeting A further approach to regulating viral gene expression involves the use of microRNAs (miRNAs) 92,93,100. miRNA is a class of small noncoding RNA with 21 - 22 nucleotides in length. miRNA is involved in the silencing of protein translation through complementary interaction with 3’ untranslated region (3’UTR) of messenger RNA (mRNA) 101,102. It plays a vital role to maintain a proper balance of various processes, including proliferation, differentiation, and cell death. They have been found to be involved in different diseases, including cancer. Several miRNAs are expressed differentially in various cell types, and some occur in lower levels in cancer cells than in non malignant cells 103. Loss of tumour suppressive miRNAs increases translation of target oncogenes. On the other hand, upregulation of oncogenic miRNAs repress the translation of target tumour suppressor genes 104,105. Several miRNAs, such as miR124 106, miR128 107, Let7 108  are known to be upregulated in neuronal cells. Among them, miR124 is one of the most well known overexpressing micro-RNA in the CNS 109,110 and it has been found to be downregulated in glioma cells 103,106,111. 1.4.1.3 Targeting virus tropism for tumour specificity Antibodies against the cell surface markers can be incorporated into their envelope or capsid to alter the tropism of the virus 112. A previous study reported that trastuzumab (a monoclonal antibody that binds with HER2) coated lentivirus accumulated in the HER2-overexpressing solid and circulating tumours112,113. Tumour-specific oHSV-1 infection can also be achieved by engineering virus glycoproteins such as gD and gB, through recognition of tumour-specific receptor which is mostly expressed in tumour cells100,114.   1.4.2 Enhance the efficacy of OV by combining with chemotherapy or immune modulator compounds Recent clinical trials have shown that combining OVs with chemotherapy or radiation therapy improve the anticancer efficacy 115-120. Similarly, several animal studies had also demonstrated enhanced anti-tumour efficacy or synergistic effects when oncolytic virus 14  treatment was combined with radiation, chemotherapeutic agents or immune inhibitory chemical compounds 121-124. The combination of ICP34.5 encoding gene mutated HSV-1 with the alkylating agent temozolomide, the microtubule stabilizer paclitaxel or radiotherapy showed increased 125,126 or strongly synergistic 127,128 anti-tumour effects in various tumour models. DNA repair and DNA damage-inducible protein GADD34 is the cellular homologue of ICP34.5 and chemotherapy-mediated DNA damage inducible GADD34 can complement ICP34.5 deletion mutants for enhanced viral replication 129,130. Not only oHSV-1, but similar combinational effect were also tested for many other OVs in various types of cancers 119,131-135. Reovirus, which is another emerging oncolytic virus, also provides synergistic anti-tumour effect with docetaxel, probably through accelerated apoptosis triggered by prolonged mitotic arrest 120,136. Mechanisms underlying the improved combinational antitumour efficacy can be varied. In some occasions, viral infection or replication enhances the anti-tumour effectiveness of the chemotherapy 129,130 and sometimes, chemotherapy or chemical compound increases viral replication 137. Adenovirus and doxorubicin combination increase viral replication in soft-tissue sarcomas 137. Cyclophosphamide which is an anti-cancer chemotherapeutic, as well as an immune suppressor, has been found to increase antitumour efficacy in combination with various OVs 68,138-147. The chemotherapeutic role of cyclophosphamide enhances tumour cell killing, while immune suppressive effect help to reduce anti-viral immune response against the oncolytic virus 148. Moreover, peritumoural inflammation caused by the chemotherapy or radiotherapy-mediated necrotic or apoptotic cancer cells might change the peritumoural microenvironment of immunity that may further improve anti-tumour effect of virally induced tumour vaccination 149. Thus, a carefully scheduled combination of chemotherapy and virotherapy may generate better anti-tumour efficacy 150 1.4.3 Overcome microglia/macrophage-mediated intratumoural barrier Microglia is the tissue-resident macrophages of the brain, which is a type of mononuclear phagocytes that include peripheral tissue macrophages, CNS-associated 15  macrophages, dendritic cells and monocyte-derived cells 151,152. They are innate immune cells and have diverse functions including chemotaxis, phagocytosis, antigen presentation, cytokine production and neurobiological function that consists of neural development and the maintenance of neuronal cell operating in both healthy and pathological contexts. Microglia contributes to both CNS damage and repair. Roles and phenotypes of microglia depend on the microenvironmental conditions, which can selectively determine the role of microglia 152. Some studies suggest that microglia plays a profound role in the glioma growth and invasiveness 67,153,154. Moreover, in the OV context, evidence suggest that activity of macrophages significantly affect the outcome of oncolytic virotherapy 155. On the other side, oncolytic adenovirus and HSV have been found to enhance the infiltration of macrophages in glioma models 156,157  1.4.3.1 Microglia/macrophage polarization There are two functional categories of microglia/ macrophage: M1 (classically activated macrophages) and M2 (alternatively activated macrophages) 158. Functional states of these two types of macrophage differ regarding activating signals, cytokine/chemokine production, receptor expression, and biological effects. Activated M1 polarized macrophages produce high levels of pro-inflammatory cytokines, such as IL-12, and oxidative metabolites, such as nitric oxide (NO) 159 and at the same time display elevated expression levels of MHC class II and co-stimulatory molecules CD80 and CD86, which have been used as a marker to detect M1 polarized macrophages 160.   16   Jakeman PG, et al. Current opinion in pharmacology. 2015; 24:23-29 The figure is reproduced with permission from ©Elsevier Figure 1.4 Functions and phenotypes of ‘M1’ and ‘M2’ polarisation states of macrophages155.  On the other hand, M2 macrophages induce tissue remodeling, angiogenesis, and repair and produce anti-inflammatory cytokines, such as IL-10, and decreased the level of NO production to suppress immune reactions 161. CD163, CD204, and CD206 are the common markers to distinguish M2 phenotype of the macrophage162. 1.4.3.2 Microglia/macrophage in glioma The presence of high numbers of microglia /macrophages has been extensively documented in GBMs and other tumours153. Microglia/macrophages are the most common non-tumour cellular infiltrates in GBM 153,154,163-166 whereas mean  microglia/macrophages content is around 30-40% (range:5-78%) of total tumour 17  mass167,168.  The abundance of microglia /macrophages also depends on the malignancy stage of the brain tumour 165,167. Moreover, the source of microglia/macrophages were further verified in rodent GBM model, microglia/macrophages contribute up to 46% of the tumour’s cellular mass in rodent GBM, where up to 34% originated from microglia (CD45-/CD11b+ cells) that exist in the brain since embryonic development. The remaining 12% originated from blood-derived macrophages (identified as CD45+/CD11b+ cells) 169.  Regardless of the origin of tumour-associated macrophages (TAMs) in the GBM microenvironment, a large body of work suggested that tumour cells can communicate with TAMs 163. The initial communication is triggered by glioma cells, which release a wave of chemoattractants to attract the robust infiltration of TAMs into the tumour mass. The potent TAM chemoattractants include the monocyte chemotactic protein (MCP)-1, MCP-3, cytokine-stimulating factor (CSF), granulocyte-colony stimulating factor (G-CSF), and many others. Importantly, the chemoattractants are shown to act both ways, where they are released not only by glioma cells to drive TAM infiltration, but also by TAMs to promote glioma growth and metastasis 163,164. Adding to this complexity, it is shown that glioma cells release cytokines that suppress the proinflammatory nature of TAMs. Among these cytokines include anti-inflammatory cytokines IL-10, IL-4, TGF-beta and prostaglandin E2 170-172. In response, TAMs acquire a distinct inactive phenotype similar to inactivated “M2” or myeloid-derived suppressor cells (MDSCs); a phenotype thought to favor the tumour’s evasion from the host immune system 173,174.    18   Li W et al. Neuro-oncology. 2012;14(8):958-78 The figure is reproduced with permission from ©Oxford University Press  Figure 1.5 Glioma-microglia crosstalk. Glioma and microglial interaction skewed for the glioma growth and invasiveness. The immunosuppressive microenvironment created by glioma-secreted molecules such asTGF-b, FasL, and IL-10 polarizes glioma-infiltrating microglia toward the M2 phenotype. Glioma (red) generates chemotactic factors, such as MCP-1, that stimulate the recruitment and proliferation of microglia. In turn, microglia (purple) enhance glioma angiogenesis and invasion 158. 1.5 Objective and aims  For more than a decade, oHSV-1 has been tested in clinical trials for patients with various types of cancer including glioblastoma 54,55,115,116,175-178. Clinical trials of oHSV-1 have confirmed the safety of oHSV-1 administration to the human brain 55, but, the therapeutic efficacy of oHSV-1 to treat one of the most therapeutic refractory tumours like glioblastoma remains unsatisfactory. Factors that could obstruct the anti-glioblastoma efficacy of oHSV-1 includes: (a) reduced potency of oHSV-1 due to deletion or attenuation of viral genes for achieving tumour specificity, (b) suboptimal anti-tumour efficacy due to cellular responses in infected tumour cells and (c) tumour infiltrated non-tumour or immune cell responses which could hinder oHSV-1 replication and promote its clearance. The main hypothesis is that a tissue-specific oHSV-1 can enhance the anti-tumour efficacy of the oHSV-1 therapy, which can be further improved 19  by sensitizing the oHSV-1 mediated cytotoxicity and by blocking the response of tumour associated microglia/macrophages with a cytotoxic or immune modulator compound. We focused on two aspects of oncolytic virotherapy to overcome the obstacles and enhance the anti-tumour therapeutic efficacy. (I) Viral aspect: improving viral oncolysis potential; (II) Cellular aspect: a) sensitizing tumour cells to oncolytic virus cytotoxicity and b) overcoming tumour infiltrated non-tumour cell barrier.   Specific aim 1, construct a highly tumour specific replication efficient oHSV-1 amplicon system by utilizing transcriptional and translational regulator without deleting any viral gene. Specific aim 2, sensitize the tumour cells by a potential chemical mediator or chemotherapeutic drug to stimulate oHSV-1 mediated cytotoxicity.  Specific aim 3, overcome the tumour-associated cellular barrier of oHSV-1 in tumour mass. For specific aim 1, we demonstrated that the tumour specificity can be achieved by regulating an essential viral gene transcriptionally and translationally in an amplicon HSV-1 viral system without deleting any viral genes. For specific aim 2, we showed that a clinically available antibiotic drug used for a decade, nifuroxazide, sensitizes viral cytotoxicity in tumour mass by up-regulating apoptotic genes to boost the antitumour effect of oHSV-1 synergistically. For specific aim 3, we showed that microglia/macrophages are potential barriers to oHSV-1 dissemination in gliomas. We further revealed that an oxindole/imidazole derivative; C16 is capable of overcoming this obstacle to allowing viral replication in those noncancerous cells, which significantly enhances oHSV-1 therapeutic efficacy in glioblastomas in-vivo.   20  2 Tumour-specific triple-regulated oncolytic herpes virus to target glioma*  2.1 Introduction Glioblastoma multiforme (GBM) is the most common and aggressive primary brain tumour 65,179,180. With the best possible treatment, GBM patients survive for only 12 to 15 months 179. The current treatment for GBM is limited to surgical resection of the tumour, followed by radiation and chemotherapy 180.  Oncolytic virus (OV) therapy has recently emerged as a promising antitumour therapeutic mainly because its tumour specificity can selectively replicate in tumour cells while sparing normal cells 18. Among the different OVs, oncolytic herpes simplex virus type 1 (oHSV-1) has emerged as one of the most promising OV candidates due to its well-known pathology in humans, extensively researched virology, well-characterized viral genome and its 150kb genome allowing ample space to integrate different transgenes and permitting of specific antiviral therapy as a safety measure 181,182. The efficacy and safety of oHSV-1 has been widely investigated and tested in preclinical and clinical glioma models 181.  Viral oncolysis is an important feature of OV since it allows the virus to disseminate inside the tumour mass and to release tumour antigens associated with lytic destruction of tumour cells 183. This mechanism provides OV therapy with the unique ability to provoke an anti-tumour immune response compared to other tumour vaccines 184. However, acquiring viruses with a high level of lytic activity while maintaining tumour specificity has always been a challenge. Viral oncolysis is an important feature of OV since it allows the virus to disseminate inside the tumour mass and to release tumour antigens associated with lytic destruction of tumour cells 183.  ____________________ *A version of this chapter has been published. Zahid M. Delwar, Guoyu Liu, Yvonne Kuo, Cleo Lee, Luke Bu , Paul S. Rennie, William W. Jia. Tumour-specific triple-regulated oncolytic herpes virus to target glioma. Oncotarget. 2016 May 10;7(19):28658-69.  21  This mechanism provides OV therapy with the unique ability to provoke an anti-tumour immune response compared to other tumour vaccines 184. However, acquiring viruses with a high level of lytic activity while maintaining tumour specificity has always been a challenge. For most oncolytic DNA viruses, the price of tumour specificity is often attenuated viral activity 63. For instance, in the case of oHSV-1, a common approach to reduce its neurovirulence is to delete the ICP34.5 gene, which significantly attenuates the viral replication efficiency 62,64   HSV-1 virus replication starts with the expression of immediate early genes, which initiate a cascade of viral gene expression ending in completion of the viral life cycle. Among the 5 essential genes, ICP4 and ICP27 are absolutely required for viral replication and disabling either one or the other results in a non-replicable virus. Previously, It has been reported that either ICP4 or ICP27 can be transcriptionally and/or translationally regulated without deleting any other viral genes allowing it to retain tumour specificity in a prostate cancer model 185,186. In the present study, we further tested an amplicon/oHSV-completed system in which the ICP4 gene is controlled by glioma-specific transcriptional, post-transcriptional and translational triple-regulation in a glioma model.    22    Figure 2.1 Schematic diagram of cancer-specific triple-regulated HSV-1 amplicon virus (SU4-124 HSV-1). The ICP4 promoter was replaced with the survivin promoter. The 5'UTR of rat fibroblast growth factor -2, and 5 copies of the microRNA 124 target sequence 3’UTR were introduced into the ICP4 gene   For this virus, the ICP4 gene is transcriptionally controlled by a survivin promoter, which is an anti apoptotic protein and vastly present in malignant cells 187, it is an ideal tumour-specific promoter for transcriptionally target tumour cells 188-191. Survivin expression is up-regulated in most malignancies, and it is also played a major role in the oncogenesis and progression of malignant brain tumours 192. It prevents caspase 9 and obstructs apoptotic pathway 193,194. Survivin favours cancer survival by multiple functions including cytoprotection, inhibition of cell death, and cell-cycle regulation 195. In addition, an FGF 5’ UTR region and a 3’UTR containing the target sequence for miR124 are added to regulate expression of ICP4 for tumour-specific translation (Figure 2.1). Our results showed that this oHSV has enhanced tumour specificity in glioma model.   23  2.2 Materials and methods 2.2.1 Cell culture  Human glioma cell lines (U87, U373, SF188, SF126, SF210), a rat glioma cell line (9L), human embryonic kidney cells (293FT) and a monkey kidney cell line (vero) and 7B (ICP4 and ICP27 expressing cells) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and a 1% antibiotic mixture (penicillin and streptomycin). The human cortical neuron cell line (HCN-2) used was purchased from ATCC (Manassas, USA) and maintained in DMEM medium containing 4 mM L-glutamine, 4500 mg/L glucose, 1 mM sodium pyruvate, and 1500 mg/L sodium bicarbonate (ATCC, USA), supplemented with 10% fetal bovine serum. Primary rat neurons were cultured in neurobasal medium supplemented with B27 and 5mM glutamax (Invitrogen, Canada). Human fibroblast (HFF) cells were maintained in MEM (Invitrogen, Canada) medium supplemented with 10% fatal bovine serum. All cultures were maintained at 37oC in 5% CO2. 2.2.2 Plasmid constructs  CMV-ICP4 HSV-1 amplicon plasmid construction was described by Cleo et al. 90 . CMV-124T HSV-1 plasmid was constructed by inserting five tandem copies of miRNA 124 complementary sequences (5’-CTCGAGCGGTTAATTAACGGGCATTCACCGCG TGCCTTACGATGGCATTCACCGCGTGCCTTAGATCGGCATTCACCGCGTGCCTTAGTCAGGCATTCACCGCGTGCCTTAGTCAGGCATTCACCGCGTGCCTTAGCTATCGATGCAGT-3’) into the 3’ end of the ICP4 gene before the poly A signal in CMV-ICP4 HSV-1 plasmid . SU4-124 HSV-1 plasmid was constructed by replacing the CMV promoter of CMV-124T HSV-1 plasmid with a 268 bp survivin promoter 196, upstream to a rat FGF 5’UTR (Figure 2.1) 185 . All plasmids were constructed using a previously described protocol 90,185,186 .  24  2.2.3 Amplicon virus preparation To prepare the amplicon viruses, corresponding plasmids were transfected into Vero or U87 cells by using Lipofectamine 2000 transfection reagent (Invitrogen, Canada) according to the manufacturer's instructions. After 48 hours, transfected cells were superinfected with helper (3galΔ3) virus at MOI-2. At 4 to 5 days post superinfection, amplicon viruses were harvested and amplified on SF188 glioma cells. Helper virus was amplified on 7B cells. Viruses were then subjected to titration on Vero and 7B cells to measure the concentration of amplicon and helper respectively, as described previously 90,186.  2.2.4 Virus replication assay  Cells plated on a 24-well plate were infected with the viruses at a multiplicity of infection (MOI) of 0.1 or 1. Virus infection and treatment were carried out in DMEM supplemented with 10% FBS and 1% antibiotics. At 2-3 days post-infection, viruses were harvested and freeze thawed three times and then titrated in triplicate on Vero cells by a standard plaque assay on 12-well plates.  2.2.5 Precursor miRNA transfection 293FT cells were co-transfected with amplicon plasmid (CMV-ICP4 HSV-1 or CMV-124T HSV-1) at a concentration of 200 ng and precursor miRNA (control pre- miRNA or pre-miR 124) at a concentration of 20, 50 or 200 nmol using Lipofectamine 2000 transfection reagent (Invitrogen, Canada) according to the manufacturer's instructions.  2.2.6 Luciferase reporter assay 293FT cells were co-transfected with survivin luciferin reporter plasmid (1.2 µg) and CMV-LacZ reporter plasmid (0.3 µg) using Lipofectamine 2000 transfection reagent (Invitrogen, Canada) according to the manufacturer's instructions. Total protein was 25  extracted at 24 hours post transfection and subjected to luciferase and β-galactosidase detection using a luciferase assay kit (Promega, Canada) and a β-galactosidase enzyme assay kit (Promega, Canada) respectively, according to the manufacturer's instructions.  2.2.7 Real time PCR Total genomic DNA from tumours and various organs were extracted using an EZNA tissue DNA kit (Omega bio-tek). The viral ICP27 copy number was obtained by quantitative real time PCR (Quantstudio 6 Flex qPCR apparatus, Applied Biosystems) using 5’-GTCTGGCGGACATTAAGGACA-3’ (forward) and 5’-TGGCCAGAATGACAAACACG-3’ (reverse) primers. β-actin was used as an endogenous control. 10 ng of DNA were added to a 25 µl master mix of SYBR green (Invitrogen, Canada) supplemented with forward and reverse primers. miRNA 124 in HCN-2, HFF and glioma cells was detected with a miScript PCR Starter kit and an miR124 miScript Primer Assay, following the manufacturer’s protocol (Qiagen, Canada).  2.2.8 Cytotoxicity assay Cells were seeded in a 96-well plate at a density of 1 X 104 and allowed to settle overnight. They were then treated with vehicle only or viruses with different MOIs. Cell viability was measured after 2 or 3 days of treatment by means of an MTT assay (Sigma, Canada) according to the manufacturer's instructions. In brief, cells were incubated with MTT solution for 3 hours at 37oC and then incubated with lysis buffer overnight. The next day, cell viability was measured at 595 nm by using a plate reader (Envision 2103 Multilabel Reader, Perkin Elmer). 2.2.9 Western blots  Total protein was extracted from cultured cells by using sample buffer (125 mM Tris-HCL, 50% glycerol, 4% bromophenol blue and 5% 2-mercaptoethanol). Proteins were 26  boiled in a heat block for 5 minutes, subjected to SDS-PAGE (8% gel), transferred to nitrocellulose membranes and then blocked in 5% nonfat milk (Bio-Rad)  in TBS-Tween 20 (TBS-T) for 1 hour at room temperature. The membranes were then incubated overnight at 4oC with either anti-eIF4E antibody (1:1000; Cell Signalling, Danvers, MA), anti-ICP4 antibody (1:750; Abcam, Cambridge, MA), anti-ICP27 antibody (1:1000; Abcam, Cambridge, MA) or anti-β-actin antibody (1:1000; Cell Signaling, Danvers, MA). Then next day, the membranes were washed with TBS-T three times and incubated with the corresponding secondary antibodies (1:3000; Perkim Elmer, Boston, MA) for 1 hour at room temperature. After washing three times with TBS-T, membranes were visualized using ECL reagent (Perkim Elmer, Boston, MA) and a VersaDoc imaging system (Bio-Rad) and band densities were then measured using ImageJ software (NIH, Bethesda, MD). 2.2.10 Immunohistochemistry Harvested tissues were fixed with 4% paraformaldehyde for 24 hours and then incubated with 30% sucrose for 72 hours. Tissues were then embedded in OCT (Sakura Tissue-Tek), sectioned (20 um) using a cryostat (Leica CM 3050 S), prepared on Fisherbrand™ Superfrost™ Plus microscope slides (Fisher Scientific, Canada) and stored at -80C. During immunostaining, frozen sections were washed with PBS, and incubated with 3% albumin bovine serum (ABS) dissolved in PBS containing 0.1% Triton X-100 for one hour to block unspecific binding. Cells were then incubated overnight with either anti-ICP4 antibody (1:200; Abcam, Cambridge, MA) or anti-ICP27 antibody (1:200; Abcam, Cambridge, MA) diluted in PBS containing 0.1% Triton X-100  solution at 4ºC. The next day after washing 3 times with PBS, sections were incubated with goat anti-mouse IgG Alexa Fluor 488 secondary antibody (1:500; Invitrogen, Canada) for one hour at room temperature. After incubation with secondary antibody, sections were washed 3 times with PBS and mounted with Dapi Fluoromount G (Electron Microscopy Sciences). Sections were then visualized and imaged using a confocal microscope (Olympus, Canada). 27  2.2.11 Intracranial virus toxicity assay Female C57BL6 mice were purchased from Harlan Laboratories. CMV-ICP4 HSV-1 or SU4-124 HSV-1 viruses were injected intracranially using a stereotactic frame. Animals were monitored on a daily basis to record any sign of toxicity. At 15 days after the virus injection, the animals were euthanized by CO2 asphyxiation. Then the virus-treated brain tissues were harvested and subjected to cryostat sectioning.  2.2.12 β-galactosidase staining Frozen-fixed tissue sections were washed twice with PBS and then incubated with 1mg/ml X-Gal solution (Sigma, Canada) diluted with X-Gal staining solution (5mM K3Fe, 5mM K4Fe and 2mM MgCl2) at 37oC overnight. Cells were then counterstained with 1% eosin. Stained cells were visualized and imaged by using a light microscope.  2.2.13 U87 xenograft mouse model Female athymic nude mice were purchased from Harlan laboratories. 2.5X10^6 human glioma U87 cells in 100 ul of PBS containing 0.75 mg Basement Membrane Extract (VWR, Canada)  were subcutaneously implanted into the left flank. When the tumour size reached ~100 mm3, mice were administered a single dose of 3galΔ3, or CMV-ICP4 HSV-1 or SU4-124 HSV-1 virus by intratumoural injection. Tumour volume was measured at different time points using calipers (Height X Length X Wide/2). At the end of the experiment, mice were euthanized by CO2 asphyxiation and tumours as well as several organs (brain, stomach, intestine, liver) were harvested. All in-vivo experimental procedures were approved by the UBC Animal Care Committee and performed according to the guidelines of the Canadian Council on Animal Care.  28  2.2.14 Statistical analysis  Statistical analysis was performed by using Microsoft Excel and a significance P˂0.001, P˂0.01, or P˂0.05 was determined using a 2 tailed Student’s t-test. All data are expressed as means ± SD or ± SE. 2.3 Results 2.3.1 Survivin and eIF4E are overexpressed in glioma cells, but downregulated in normal neuronal cells  Survivin been reported to be upregulated in many cancers, including gliomas 197-203. A survivin luciferase reporter assay in rat neurons and various glioma cells confirmed overexpression of the gene in glioma cells (Figure 2.2A). Upregulation of survivin transcription in glioma cells was also observed by qRT-PCR (data not shown). Since the ICP4 gene was also translationally regulated by the FGF gene 5’ UTR, which requires a high level of eukaryotic translation initiation factor 4 (eIF4E) for successful translation, we performed western blot analysis to measure the eIF4E level in normal neurons and various glioma cells. Our results demonstrated the significantly increased eIF4E expression in glioma cells (Figure 2.2B), which is consistent with previous results by many other laboratories which showed that eIF4E is overexpressed in many cancers as well as in astrocytic tumours 94,97,204.   29    Figure 2.2 Survivin and eIF4E expression in different cells. (A) The indicated cells were transfected with survivin luciferase and CMV-LacZ reporter plasmids. Total protein was extracted 24 hours post-transfection and subjected to a luciferase and lacZ assay. (B) Total protein was extracted from the indicated cells and subjected to western blot analysis to measure eIF4E and β-actin expression. Data are presented as means ± SD   2.3.2 Micro RNA 124 expression is low in glioma cells  To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124 expression profiles in a different glioma and normal cells. PCR analysis demonstrated that the mature miR124 level was significantly high in human cortical neurons (HCN-2) compared with human glioma U87 and SF188 cells (Figure 2.3).      30   Figure 2.3 miRNA 124 expression levels in different cells. miR124 expression levels in the indicated gliomas and non malignant cells were detected by qRT-PCR. Data are presented as means ± S.D.   2.3.3 miR124 prevented the replication of miRNA regulated virus To evaluate the specificity of the miR124-regulated ICP4 expression, 293FT cells were co-transfected with different concentrations (20 ng, 50 ng and 200 ng) of miR124 precursor and CMV-124T plasmid. Significantly downregulated ICP4 expression was observed in the presence of miR124 precursor (Figure 2.4A). Moreover, replication of CMV-124T HSV-1 in which the ICP4 gene is controlled by a 3’UTR region with an miR124 target, drastically decreased in miR124 precursor-transfected cells (Figure 2.4B). Furthermore, infection with CMV-124T HSV-1 showed that the ICP4 expression was significantly higher in glioma cells (U87, SF188 and 9L) than in primary cultured neurons. (Figure 2.4C).   31    Figure 2.4 miRNA 124 prevents CMV-124T HSV-1 virus replication. (A) 293FT cells were co-transfected with amplicon plasmid (CMV-ICP4 HSV-1 or CMV-124T HSV-1) and control precursor miRNA or pre-miR 124 at a concentration of 20, 50 or 200 nmol. Total protein was extracted at 48 hours post-transfection. βactin and ICP4 protein levels were measured by western blot analysis.  (B) 293FT cells were transfected with pre-con or pre-miRNA 124. Cells were superinfected with CMV-124T virus at MOI -1 after 48 hours of transfection. Viruses were harvested at 24 and 48 hours post-infection and titrated in Vero cells. Data are presented as means ± S.D. (* P<0.05, ** P<0.01 vs the 32  corresponding control or virus from CMV-ICP4 HSV-1 treated cells) (C) 124 micro RNA targeted ICP4 protein expression in the indicated cells. Cells were infected with CMV-124 virus at an MOI of 1. Total protein was extracted after 24 hours of treatment. ICP4 expression was measured by western blotting (* P<0.05, ** P<0.01 vs neurons).   2.3.4 miRNA regulation does not hinder HSV-1 antitumour efficacy  To determine whether incorporation of the miRNA 124 target sequence in the 3’UTR region of the ICP4 gene would hamper HSV-1 oncolytic activity, we evaluated the replication and cytotoxicity of the CMV-124T virus using a panel of glioma cell lines. A single-step virus growth assay (Figure 2.5A) and MTT cell proliferation assay (Figure 2.5B) demonstrated that all glioma cell lines are sensitive to CMV-124T virus oncolysis.        Figure 2.5 Replication & cytotoxicity of miRNA124 targeted amplicon virus. (A) The indicated cells were infected with CMV-124T HSV-1 at MOI- 0.1. Viruses were harvested at 24 and 48 hours post-infection and titrated in Vero cells. Data are presented on a logarithmic scale (B) The indicated cells were infected with CMV-124T HSV-1 at the indicated MOIs. After 48 hours of infection, cytotoxicity was measured by an MTT assay.   33  2.3.5 Survivin promoter, miRNA 124 and 5’UTR triple-regulated amplicon virus (SU4-124 HSV-1) have a strong antitumour effect on glioma cells  Since a high level of miR124 may not only be restricted to neural cells 109,205, additional measurement of tumour-specific controls is required to prevent virulence toward non-neural cells. To that end, we further tested an HSV-1 vector, SU4-124 HSV-1, of which the ICP4 gene is controlled by the survivin promoter and FGF 5’UTR in addition to the miR124 target in the 3’ regions. To evaluate the antitumour effect, different glioma cells were treated with  of the SU4-124 HSV-1 virus, different glioma cells were treated with a non-tumour-specific HSV-1 in which the ICP4 gene was driven by a generic CMV promoter (CMV-ICP4 HSV-1), (Figure 2.6A) or with  SU4-124 HSV-1 for 48 hours (Figure 2.6B). Inhibitory concentration 50% (IC50) values of SU4-124 HSV-1 against 9L, SF188 and U87 glioma cells were around MOI- 0.1, MOI- 0.1 and MOI- 0.05 respectively, while those of CMV-ICP4 HSV-1 against the above cells were approximately MOI-0.02, MOI- 0.1 and MOI- 0.05, respectively.       Figure 2.6 Antiproliferative effect of SU4-124 HSV-1. The indicated cells were infected with either CMV-ICP4 HSV-1 (A) or SU4-124 HSV-1 (B) at the indicated MOIs. Cytotoxicity was measured at 48 hours post-infection by an MTT assay.  34  2.3.6 Triple-tumour-specific regulation significantly increases tumour specificity Since the mechanism involved in the glioma specificity of SU4-124 HSV-1 virus depends on glioma-specific expression of the essential viral gene ICP4, we investigated the ICP4 expression level of SU4-124 HSV-1 in normal neurons and glioma cells, as compared with the control CMV-ICP4 HSV-1 virus by western blotting. The ratio of ICP4 expression of glioma cells vs. normal neurons was significantly higher for SU4-124 HSV-1 than that for CMV-ICP4 HSV-1 (Figure 2.7A). Furthermore, to verify the tumour-specific growth of SU4-124 HSV-1, we evaluated the growth of the SU4-124 HSV-1 and CMV-ICP4 HSV-1 viruses in neurons and various glioma cells. For SU4-124 HSV-1, the ratios of tumour to neurons in viral replication were 16.7, 51.4 and 157 fold higher than those of CMV-ICP4 HSV-1 virus for U87, SF188 and 9L, respectively (Figure 2.7B).      Figure 2.7 Triple regulation significantly augments tumour specificity. (A) Neurons and different glioma cells were infected with CMV-ICP4 HSV-1 or SU4-124 HSV-1 viruses at an MOI of 1. Total protein was collected 6 hours post infection. ICP4 expression was detected by western blotting. (B) Neurons and different glioma cells were infected with either CMV-ICP4 HSV-1 or SU4-124 HSV-1 at an MOI of 1.  Viruses 35  were harvested at 48 hours post-infection and titrated on Vero cells. Data are presented as means ± S.D., * P<0.05 vs corresponding CMV-ICP4 treatment.    2.3.7 SU4-124 HSV-1 virus reduces neuronal toxicity in vivo   To study the neuronal toxicity of the SU4-124 HSV-1 virus, CMV-ICP4 HSV-1 or SU4-124 HSV-1 (2.8X10^5 PFU) were intracranially  injected into the brain of C57BL6 mice. Immunostaining for immediate-early viral proteins and virally expressed reporter gene LacZ in the brain showed reduced viral activity in SU4-124 HSV-1-injected mouse brains compared with CMV-ICP4 HSV-1-injected brains (Figure 2.8A and B).      Figure 2.8 Intracranially injected virus toxicity in vivo. 2.8X10^5 PFU/ml CMV-ICP4 HSV-1 or SU4-124 HSV-1 amplicon viruses were injected intracranially into C57BL6 mice. Brain tissue was collected at day 15 post-virus injection. (A) Viral ICP4 and ICP27 expressions were determined by immunohistochemistry of the indicated virus injected brain tissue embedded in OCT and cut into 20-µm sections. (B) Frozen tissue sections were subjected to X-Gal solutions overnight to detect the helper virus.  36  2.3.8 Tumour-specific triple-regulation enhances the antitumour effect without affecting normal organs in vivo  To evaluate the antitumour efficacy of the SU4-124 HSV-1 virus, subcutaneously implanted U87 tumours were treated with either SU4-124 HSV-1 (2.4X10^7 PFU helper : 6X10^6 PFU amplicon) or CMV-ICP4 HSV-1 (2.4X10^7 PFU helper : 6X10^6 PFU amplicon), or with ICP4- helper virus (2.4X10^7 PFU helper) only by intratumoural injection.  Both CMV-ICP4 HSV-1 and SU4-124 HSV-1 caused significant tumour regression at 8 days post injection (Figure 2.9A). Animals were euthanized at day 8 post virus injection (day 17 post tumour implantation) to harvest the tumour and to determine copy number of viral genome by qPCR in the tumour to confirm lytic viral replication inside of the tumours (Figure 2.9B). Meanwhile, SU4-124 HSV-1 injected tumours showed 2.25 fold greater regression than CMV-ICP4 HSV-1 injected mice at day 8 post virus injection (Figure 2.9A). In addition, a 12.1-fold increase in viral genome copies was seen in SU4-124 HSV-1-injected tumours compared to those injected with CMV-ICP4 HSV-1 (Figure 2.9B).   37   Figure 2.9 SU4-124 HSV-1 significantly augments the antitumour effect without increasing viral spread to other organs. Mice subcutaneously bearing the U87 tumour were intratumourally injected with tumour nonspecific CMV-ICP4 HSV-1 (n=5; 2.4X10^7 PFU helper : 6X10^6 PFU amplicon) or tumour-specific SU4-124 HSV-1 (n=5; 2.4X10^7 PFU helper : 6X10^6 PFU amplicon) or ICP4-- 3galΔ3   (n=5; 2.4X10^7 PFU helper only) at a 4:1 helper : amplicon ratio. (A) The tumour volumes were measured using calipers [(height X length X Width)/2)]. Data are presented as means ± S.E, * P<0.001, SU4124 vs helper virus treatment. (B) Total genomic DNA was extracted from the different harvested organs of the indicated mice treated with virus (n=2). Viral genomic DNA (ICP27) was detected by qPCR and normalized to β-actin.   38  2.3.9 Effect of the amplicon and helper ratio on tumour-specific growth  Since amplicon virus is a combination of helper virus and the amplicon, we evaluated the replication of different amplicon and helper ratio combinations in neurons and U87 cells. We observed a 54, 14.3, 18.2 and 10.7 fold decrease in the titer of neurons compared to U87 cells at an amplicon : helper ratio of 1:4, 1:10, 1:25 and 1:50,  respectively.   Figure 2.10 Amplicon and helper ratio combination. Neurons and U87 cells were infected using the indicated amplicon and helper (MOI-1) ratio of SU4-124 HSV-1, were harvested at 72 hours post-infection and were then titered on Vero cells.     39  2.4 Discussion In this study, we developed a triple-regulated oncolytic amplicon viral system that generates tumour-specific oncolysis with a replication-defective helper virus. Reduced toxicity and the enhanced oncolytic potency compared to the wild type virus were also observed.    Certain microRNAs are differentially expressed in tumour and nontumour cells 206. We previously showed that inclusion of miRNA 143 and 145 target sequences into the 3’UTR of a HSV-1 essential gene restricted viral replication in prostate cancer cells 186. In the present study, we confirmed that the miRNA 124 level is very high in normal brain cells compared to glioma cells as reported in several previous studies 106,207,208. Therefore, miRNA 124 may be a better choice for targeting GBM than miRNA 143 & 145. Here, we also observed that miRNA 124-targeted oHSV-1 (CMV-124T HSV-1) expresses ICP4 in various glioma cells but not in normal neuronal cells. In addition, CMV-124T HSV-1 virus-replication-mediated oncolysis was observed in a panel of glioma cells. However, the virus replication and ICP4 protein expression was completely abolished in the presence of precursor miRNA 124.   Since enhanced tumour specificity often comes at a price, namely reduced viral oncolytic activity 62,63, we attempted to circumvent this disadvantage by using a tumour specific promoter that is highly expressed in glioma cells. Interestingly, the survivin promoter gave rise to transcriptional activity that was higher than CMV and even higher than the native HSV-1 ICP4 promoter. Our results showed that combined with 5’UTR and 3’UTR miR124 translational regulators, survivin promoter-driven ICP4 expression was higher in tumour cells.  Oncolytic virotherapy is mainly used to specifically deplete tumour cells with replication capable viruses through oncolysis: a cell killing mechanism characterized by the lysis of tumour cells through the course of virus replication 18. However, it has been accepted that there are probably two major mechanisms for the anti-tumour effects by OVs. One is by virally induced cell killing through cell lysis 18 and apoptosis209; the other is virally 40  induced host immune response 210.  In the present study, athymic nude mice were used to develop human glioma mouse model 211, which lacks T-lymphocytes but the innate immune system is partially functional 212. However, SU4-124 HSV-1 caused tumour regression is likely due to viral lysis and other virally induced direct cell death as the nonreplicable helper virus, which may stimulate similar innate immune response equally effective as the replicable HSV-1 213, did not show the same efficacy in tumour regression. Agreeable to this notion, it seems that the tumour regression was related to the efficiency of intratumoural viral replication as the CMV-ICP4 HSV-1 virus that had less viral replication rate in the tumour also showed less efficacy in tumour regression compared to that of SU4-124 HSV-1. Another feature of this study was that we used an amplicon expressing the essential viral gene to supplement a defective helper HSV-1 for oncolytic viral replication. Considering that HSV-1 may establish latency in the brain after treating the glioma, an amplicon dependent oncolytic virus system may be safer clinically than conventional oncolytic HSV-1 since the amplicons are plasmid constructs that are unlikely to persist in cells, which renders replication and reactivation of the helper virus virtually impossible. A potential concern in using an amplicon-supplemented oHSV system is the need to maintain a consistent ratio of helper to amplicon. This was solved in our study by using an essential viral gene carried by the amplicon to supplement the helper virus. Our study showed that, with this design, the ratio of amplicon to helper is always kept below 1 (Figure 2.10), which means that the pure helper virus can always be used to dilute the mixture and maintain a consistent ratio.  Thus, this study has shown for the first time that a triple-regulated ICP4 gene expressed from an amplicon can be used to supplement a replication-defective HSV-1 to reduce toxicity and enhance oncolysis to destroy glioma.    41  3 An antibiotic drug, nifuroxazide synergistically enhances anti-tumour effect of oncolytic herpes simplex virus* 3.1 Introduction Genetically engineered OVs (OVs) can selectively destroy tumour cells while sparing non malignant cells 52,214,215. Oncolytic viral therapy has recently emerged as a promising new class of antitumour therapeutics216. A herpes virus-based oncolytic virus (T-Vec) has successfully completed a first phase III clinical trial in North America and has been approved by the FDA for the treatment of melanoma. 16,17. Recently, however, combinations of OVs and cytotoxic compounds has proven very effective in enhancing the anti-tumour therapeutic efficacy 123,217. Finding new uses for existing drugs can bypass the expensive and time consuming drug discovery process218. In search for an effective compound to enhance the efficacy of oHSV-1, we tested here the combinational anti-tumour efficacy of oHSV-1 and a nitrofuran antibiotic, nifuroxazide (NF), a drug which has been used in clinics for decades to treat diarrhoea219,220. NF has recently been found to exert anti-tumour activity against melanomas and breast cancers by directly inhibiting the signal transducer and activator of transcription 3 (STAT-3) 221-223. STAT3 is widely known for its oncogenic function 224 which can be activated by various stimuli including Janus family kinases (JAK), interleukin-6 receptor (IL-6R/gp130), growth factor receptors including EGFR and platelet-derived growth factor receptors (PDGFR), Abl family kinases, and Src family kinases226.  STAT3 activation increases tumour cell proliferation, survival and invasion, and at the same time, also suppresses anti-tumour immunity224. NF inhibits activation of STAT3 by downregulating upstream Janus kinase 2 (JAK2) and tyrosine kinase 2 (TYK2) 221.  _____________________ *A version of this chapter has been submitted for publication. Zahid M. Delwar,  Justin Lardizabal, Yvonne Kuo, Erin Kwa, Gabriel Fung, Honglin Luo, William W. Jia. An antibiotic drug, nifuroxazide synergistically enhances anti-tumour effect of oncolytic herpes simplex virus.  42   Along with STAT3, NF also inhibits STAT1 and STAT5 221. STAT1 is a key regulator of interferon (IFN) signalling and has anti mycobacterial and antiviral activity 224,227. Type I or type II IFN initially activates Janus kinases (Jak1, Jak2, and Tyk2) that in turn, phosphorylate STAT1 at Tyr701. Upon activation by IFN gamma, phosphorylated STAT1 forms homodimers and initiates the transcription of IFN stimulated genes (ISG) by binding to the gamma-IFN–activated sequence (GAS) 227. However, STAT1 forms heterodimers with STAT2 and IRF9 and binds to IFN-stimulated response elements (ISRE) in promoters of ISGs227. STAT1 signaling is usually considered to be a pro-death and tumour-suppressive pathway. However, recent evidence has suggested that STAT1 activation is associated with a resistance of various tumour cells to chemotherapeutic drugs 227-231. Since both STAT1 and STAT3 activation is associated with tumour growth and STAT1 plays an important role in the cellular antiviral effect, we hypothesized that NF and oHSV-1 combination could be jointly utilized to enhance viral oncolysis by inhibiting STAT1 and to enhance the antitumour effect by inhibiting STAT 1/3. We studied the effect of NF on oHSV-1 anti-tumour efficacy, and we report here that nifuroxazide synergistically enhanced oHSV-1 anti-tumour efficacy both in-vitro and in-vivo. We also demonstrated that the synergistic antitumour effect of this novel combination is the result of NF mediated STAT inhibition which leads to sensitizing to apoptosis in oHSV-1 infected cells. 3.2 Materials and methods 3.2.1 Cells, viruses and reagents Human glioma cells (U87), mouse breast cancer cells (4T1), mouse colon cancer cells (CT26), and African green monkey kidney cells (Vero) were obtained from the American Type Cell Collection. All cells were maintained in DMEM supplemented with 10% fetal bovine serum (Life Technologies, Carlsbad, CA, USA) and a 1% antibiotic mixture 43  (penicillin and streptomycin). Culture conditions were maintained at 37oC in 5% CO2. Nifuroxazide was obtained from Millipore, Canada. Ribonucleotide reductase (RR) deficient oHSV-1, HrR3 41,47-49,232,233, which contains the LacZ gene incorporated into the RR large subunit (ICP6) was a gift of Dr. S Weller, Department of Microbiology, University of Connecticut Health Center, CT, USA. A γ34.5 gene deleted HSV-1, VG34.5-12TR was kindly provided by Virogin Biotech, BC, Canada.     3.2.2 Western blots  Total protein was extracted from cultured cells or harvested tissues by using sample buffer (125 mM Tris-HCL, 50% glycerol, 4% bromophenol blue and 5% 2-mercaptoethanol). Proteins were heated at 100ºC for 5 minutes, subjected to SDS-PAGE (8% - 10% gel), then transferred to nitrocellulose membranes and blocked with 5% nonfat milk (Bio-Rad)  in TBS-Tween 20 (TBS-T) for 1 hour at room temperature. The membranes were then incubated overnight at 4oC with anti phospho pSTAT1 (Tyr701) 1:1000; anti phospho pSTAT3 (Tyr705) 1:1000; anti STAT1 1:1000 ; anti STAT3 1:1000 ; or anti-β-actin 1:1000; all from Cell Signaling, Danvers, MA. After overnight incubation with the primary antibody, the membranes were washed three times with TBS-T and incubated with the following secondary antibodies (1:3000; Perkin Elmer, Boston, MA) for 1 hour at room temperature. After washing three times, membranes were visualized using ECL reagent  (Perkin Elmer, Boston, MA) and a VersaDoc imaging system (Bio-Rad), and band densities were measured using ImageJ software (NIH, Bethesda, MD). 3.2.3 Cytotoxicity assay Cells were plated in a 96-well plate at a density of 1 X 104. The next day, they were treated with vehicle only, with viruses with different MOIs, with different doses of NF or a combination of NF and viruses for 48 or 72 hours. Cell viability was then measured by an MTT assay (Sigma, Canada) according to the manufacturer's directions. In brief, cells were incubated with MTT solution at 37oC for 3 hours, and they were then 44  incubated with lysis buffer overnight. Cell viability was measured at 595 nm using a plate reader (Envision 2103 Multilabel Reader, Perkin Elmer). 3.2.4 qPCR array U87 cells were treated with 25 µM NF or 3.12 MOI HrR3 virus alone or in combination for 24 hours. Total RNA was extracted by using a miRNeasy Mini Kit (Qiagen, Canada) and gene expression profiling was determined by using a RT² Profiler™ PCR Array human IL6/STAT3 Signaling Pathway Plus kit (Qiagen, Canada), following the manufacturer‘s protocol. 3.2.5 U87 xenograft mouse model Female athymic nude mice were obtained from Harlan Laboratories, Canada. Human glioma U87 (2.5X10^6) cells were subcutaneously implanted into the left flank. Mice began receiving intraperitoneal injection of vehicle or different NF doses when the tumour size reached ~100 mm3. At 48 hours after the initial NF administration, mice were administered an intratumoural injection of a single dose of HrR3 (1X10^6 PFU) virus or vehicle. The HrR3 virus or vehicle injected mice were then intraperitoneally (IP) administered vehicle or different NF doses. An intraperitoneal injection of vehicle or NF was administered twice a week. At day 10 post treatment, mice were euthanized by CO2 asphyxiation and tumours were harvested.  3.2.6 CT26 xenograft mouse model Mouse colon CT26 (2X10^6) cells were subcutaneously implanted into the flank of female BALB/c mice (Harlan Laboratories, Canada). Mice began receiving intraperitoneal injection of vehicle or 50mg/kg NF when the tumour size reached ~100 mm3, These injections were continued on a daily basis. Three days after initial the NF treatment, tumours were intratumourally injected with a single dose of HrR3 virus (n=5; 2X10^7 PFU) or vehicle with peritoneal daily injections of 50mg/kg NF alone or in 45  combination with HrR3 virus. Tumours and specific organs were harvested at 23 days after tumour implantation. Tumour volumes were measured using a caliper (height X length X width/2). All in-vivo experimental procedures were approved by the UBC Animal Care Committee and carreid out according to the guidelines of the Canadian Council on Animal Care.  3.2.7 Tissue RNA extraction and real time quantitative PCR Total RNA from the harvested tumours were isolated with an miRNeasy Mini Kit (Qiagen, Canada). 1µg RNA was then subjected to genomic DNA elimination and reverse transcription using an RT² First Strand kit (Qiagen, Canada). cDNAs were then amplified using RT² SYBR® Green qPCR Master Mix following the manufacturer’s protocol. Amplification of cDNA was performed with the following primers. β-actin:5'-ACGAGGCCCAGAGCAAGAG-3'(forward) and 5'-TCTCCATGTCGTCCCAGTTG-3' (reverse), Fas: 5'-ATGCACACTCTGCGATGAAG-3'(forward) and 5'-CAGTGTTCACAGCCAGGAGA-3'(reverse), BCL2:5'-CTCGTCGCTACCGTCGTGACTTCG-3' (forward) and 5'-CAGATGCCGGTTCAGG TACTCAGTC-3' (reverse), BAX-2 5'-AAGCTGAGCGAGTGTCTCCGGCG-3' (forward) and 5'-GCCACAAAGATGGTCACTGTCTGCC-3' (reverse). Results were expressed as the fold change over the untreated control (2-ΔΔCT ) and β-actin was used as a loading control.  3.2.8 Tissue DNA extraction and quantitative PCR Using an EZNA tissue DNA kit (Omega Bioteck) total DNA was extracted from harvested tumours and different organs of a CT26 xenograft. Extracted DNAs were subjected to qPCR analysis using Syber Green Master Mix (Invitrogen, Canada) supplemented with ICP27 primers: 5'-GTCTGGCGGACATTAAGGACA-3' (forward) and 5'-TGGCCAGAATGACAAACACG-3' (reverse); β-actin primers: 5'-ACGAGGCCCAGAGCAAGAG-3' (forward)  and 5'-TCTCCATGTCGTCCCAGTTG-3' (reverse). Amplification was carried out using a QuantStudieo 6 Flex qPCR system 46  (Applied Biosystems, Canada). Results were expressed as 2-ΔΔCT and β-actin was used as a loading control.  3.2.9 Statistical analysis  Statistical analysis was conducted by using Microsoft Excel and significance P˂0.001, or P˂0.01, or P˂0.05 was determined using Student’s t-test. All data were expressed as means ± SD or ± SE. 3.3 Results 3.3.1 NF significantly enhances the anti-proliferative effect of oHSV-1 in an synergistic fashion We first evaluated the cytotoxic effect of the each agent on different types of tumour cells. An MTT cell proliferation assay revealed that inhibitory concentration 50% (IC50) values of NF after 48 hours of treatment directed against glioma (U87), colon cancer (CT26) and breast cancer (4T1) cells were around 75 µM, 12.5 µM and 20 µM, respectively (Figure 3.1A), while those of HrR3 viruses were approximately MOI-12.5, MOI-2 and MOI-10 (Figure 3.1B). A similar anti-proliferative effect was obtained with wild-type HSV-1 (KOS) when used to target the above cells (Figure 3.1C).  To evaluate the combinational anti-tumour effect of the NF and oHSV-1, U87, CT26 and 4T1 tumour cells were treated with NF or oHSV-1 (HrR3) alone or in combination. The MTT cell proliferation assay revealed that 6.25 µM NF alone only killed approximately 10% of human glioma U87 cells, and HrR3 alone at an MOI of 1.56 killed approximately 30 % of cells, whereas the combination of NF and HrR3 depleted 65% of the cells within 72 hours (Figure 3.1D).  Moreover, a combination of 12.5 µM NF and 3.12 MOI HrR3 increased the anti-proliferative effect 2.6 fold and 2.25 fold compared to NF or HrR3 alone in U87 cells, respectively (Figure 3.1D). A similar enhanced anti-proliferative 47  effect of the combinational treatment was observed in mouse colon cancer CT26 cells (Figure 3.1E), mouse breast cancer 4T1 cells (Figure 3.1F) and mouse lung cancer LL2 cells (data not shown) at 48 hours post-treatment.  To determine whether the increased cytotoxicity with the NF and HrR3 combination was due to synergy, we analyzed the data with CompuSyn software (Ting-Chao Chou, New York, U.S.A.) and found that 10% to 80%, 10% to 90% and 10% to 90% of the fractions affected by this combination demonstrated synergy in U87 cells, CT26 cells and 4T1 cells, respectively (Figure 3.1G). To determine whether the cytotoxic effect of NF with HSV-1 is virus strain specific, we measured the anti-proliferative effect of NF using the wild-type HSV-1 (KOS) on different types of cancer cells. A similar synergistic anti-tumour effect was observed with the NF-KOS combination in U87, CT26 and 4T1 cells (Figure 3.1H). An ICP34.5- mutated oHSV-1 (VG34.5-12TR) that has the same viral backbone as T-Vec and is sensitive to cellular PKR activity 234,235, also showed a synergistic anti-tumour effect in combination with NF (Figure 3.1I). Therefore, the effect of combining NF and HSV-1 was not strain specific. Finally, we calculated the dose reduction index (DRI) of the NF and HrR3 combination in various affected fractions and found it to be highest mostly with  HrR3 in U87, CT26 and 4T1 cells (Figure 3.1J).  48   49   50    Figure 3.1 NF significantly enhances the cytotoxicity of oHSV-1 and provides an synergistic anti-tumour effect in combination. A-C, Cancer cells were treated with the indicated doses of NF or two different HSV-1 strains, HrR3 or wild-type (KOS), for 48 hours. Samples were run in quadruplicate and the results are expressed as mean ±SD . Cell proliferation was measured by an MTT assay. D-F, U87 (D), CT26 (E) and 4T1 (F) cells were treated with either the indicated doses of NF or HrR3 (oHSV-1) or a combination. NF was applied first, the indicated viral doses were then added and cells were incubated for 72 hours (D) or 48 hours (E and F). Cytotoxicity was measured by means of an MTT assay. Experiments were performed in quadruplicate and  results are expressed as mean ± S.D. Statistically significant differences are indicated by P<0.05, P<0.01 or P<0.001 . G-I, cells were treated with varying doses of NF or the indicated viruses (HrR3 or KOS or VG34.5-12TR) alone or in combination with NF for 48 hours. Cell viability was measured by an MTT assay and samples were run in quadruplicate and data are means ± S.D. Combination index (CI) values were calculated using Chou-Talalay analysis and plotted against the affected fraction (Fa). CI of < 1, CI = 1 and CI > 1 represent synergistic, additive and antagonistic effect, respectively. The dose reduction index (DRI) was calculated for the NF and HrR3 virus combination in the indicated affected fractions (J).  51  3.3.2 The NF and oHSV-1 combination inhibits STAT activity both in vitro and in vivo NF is known to be an inhibitor of STAT1 and STAT3 221. Therefore, to evaluate the underlying molecular mechanism of the anti-tumour effect of the NF and oHSV-1 combination, we first examined the STAT1 and STAT3 status of U87 (Figure 3.2A) and CT26 (Figure 3.2B) cells after an overnight treatment with NF and OVs. Interestingly, levels of both STAT1 and STAT3 phosphorylation in these cells were significantly increased after HrR3 virus infection. On the other hand, NF caused a dose dependent inhibition of phosphorylation of STAT1/3. More interestingly, NF effectively suppressed HrR3 induced upregulation of STAT1/3 phosphorylation in both U87 (Figure 3.2A) and CT26 (Figure 3.2B) cells. To our surprise, despite the fact that HrR3 infection elevated STAT1/3 phosphorylation in U87 cells, a combination of high doses of NF and HrR3 (NF 50µM and HrR3 6.25 MOI) reduced STAT1/3 phosphorylation to a level even below that seen with NF alone (Figure 3.2A).  To confirm further that NF is able to inhibit STAT activation in vivo, subcutaneously implanted U87 tumours were treated with either HrR3 alone or in combination with 50mg/kg NF or 100mg/kg NF. Expression levels of phosphorylated STAT1/3 in harvested tumour tissues were measured by western blotting. Although we were not able to detect pSTAT1 in the tumour tissue, it was evident that STAT3 phosphorylation was increased in the tumour mass treated with HrR3 alone. Again, the virally induced upregulation of pSTAT3 was dose dependently inhibited by the combination of the virus with i.p. injected NF (Figure 3.2C).   52       53    Figure 3.2 STAT inhibition by the NF and oHSV-1 combination. A and B, U87 cells (A) or CT26 cells (B) were treated with the indicated concentrations of HrR3 or NF or a combination. Total protein was extracted after 24 hours and subjected to western blot analysis. Band intensity was measured using Image J software and normalized to β-actin.  Samples were run in triplicate and data are as means ± S.E. Statistically significant differences are indicated by P<0.05 or P<0.01. C, Mice subcutaneously bearing U87 tumours were intratumourally injected with a single dose of HrR3 virus (1X10^6 PFU) and/or peritoneally injected doses of NF as indicated. Tumours were harvested on day 10 post treatment and total protein was extracted from a mouse of each treatment group and subjected to western blot analysis in triplicate. Results are reported as  means ± S.E. 54  3.3.3 The NF effect on HSV-1 immediate early gene expression We then asked whether STAT1/3 inhibition by NF has any effect on viral immediate early gene expression. NF mediated blocking of viral ICP27 expression was evident in tumour cells, whereas ICP4 level was unchanged. Interestingly, similar to 24 hours of treatment, phosphorylation inhibition of STAT-3 was also observed after six hours of NF treatment, but phosphorylation level of STAT1 was unchanged (Figure 3.3).    Figure 3.3 NF effect on ICP27 and ICP4 gene expression. U87 cells were treated with HrR3 viruses with an MOI of 1 alone or in combination with indicated concentrations of NF for six hours. Total protein was extracted and subjected to western blot analysis Samples were run in triplicate and data are the means ± S.D. 55  3.3.4 NF overcomes the anti-apoptotic effect of oHSV-1 Next, we performed a qPCR array analysis of cells treated with either HrR3 or NF alone or a combination of the two. Our data indicate that most cellular death inducing genes such as CDKN1A, MAPK14, CASP4, FAS, BAX etc are suppressed by the oHSV-1 and their expression is upregulated by the addition of NF (Figure 3.4).      Figure 3.4 PCR array of the NF and oHSV-1 combination in tumour cells. U87 cells were treated with 3.12 MOI of HrR3 or 25 uM of NF alone or a combination for 24 hours. Extracted RNA was then subjected to a qRT-PCR array. The clustergram shows the gene expression levels.   3.3.5 NF enhances both the anti-tumour effect and the safety of oHSV-1 in vivo To evaluate the in vivo anti-tumour effect of the oHSV-1/NF combination, subcutaneously implanted CT26 tumours were treated with either 2X10^7 PFU HrR3 alone, 50mg/kg NF alone or both. Significantly increased tumour regression was seen with the combination compared to treatment with NF or HrR3 alone. At day 23 after 56  tumour implantation, 2.2 fold and 1.9 fold greater tumour regression was seen in the NF plus oHSV-1 treated mice compared to mice treated with oHSV-1 alone or NF alone, respectively (Figure 3.5A).  We then asked whether combination with NF would compromise the safety of oHSV-1. We first isolated the total DNA from the tumour, brain, liver and gastrointestinal tract (GT) and subjected it to qPCR analysis to measure the amount of viral DNA. As expected, similarly high levels of HSV-1 DNA were detected in the HrR3 treated tumours with or without NF. Interestingly, while levels of the viral DNA were almost undetectable in the liver and GT with or without NF, a remarkable level was detected in the brains of animals treated with HrR3 alone but the level was nearly 10 fold less when the virus was combined with NF (Figure 3.5B). Among 5 mice treated with HrR3 (2X10^7 PFU) alone, one mouse was euthanized due to virus related toxicity. No toxicity was observed in mice treated with the NF and HrR3 combination. Furthermore, when two mice were injected intratumourally with a high dose of HrR3 (1X10^8 PFU) in a preliminary experiment, both mice showed signs of severe HSV-1 toxicity (paralysis of the hind leg or immobility) and were terminated immediately. On the other hand, HSV-1 had no toxic effect on mice treated with HrR3 at the same high dose when given in combination with NF (data not shown).  To confirm that NF upregulates pro-apoptotic genes in vivo, we measured the expression ratios of BAX to BCL2 in the tumours by means of qRT-PCR. A decreased BAX\BCL2 ratio was observed in tumours treated with HrR3 alone compared to untreated tumours. The ratio was significantly increased when the virus was combined with NF (Figure 3.5C). In addition, Fas was also downregulated by oHSV-1 but increased in amount by combining with NF (Figure 3.5D).. These data indicated that NF promoted apoptosis in oHSV-1 infected tumours.   57   Figure 3.5 Enhanced anti-tumour effect of the NF and oHSV-1 combination in-vivo. A, BALB/C mice subcutaneously bearing a CT26 (colon cancer) tumour were intratumourally injected with a single dose of HrR3 virus (2X10^7 PFU) or vehicle and given daily peritoneal injections of 50mg/kg NF alone or in combination with HrR3 virus (5 mice in each group). Tumours and indicated organs were harvested at 23 days after tumour implantation. Tumours size were measured using calipers (length X height X width /2). Data are the means ± S.E. and statistically significance differences between treatment with the NF and oHSV-1 combination, NF alone, and oHSV-1 alone are indicated by the p value, * P<0.05. B, total genomic DNA was extracted from the harvested tumours and other organs (n=2). Viral DNA (ICP27) was detected by qPCR and normalized to β-actin . Samples were run in quadruplicate and data are the averages of 2 mice ±S.E. C-D, total genomic RNA was extracted from the harvested tumours and subjected to qRT-PCR analysis. Samples were run in quadruplicate and normalized to β-actin. Data are the means (±S.E.) of the fold change difference over the untreated control (2ΔΔCT) of two mice from each treatment group.  58  3.4 Discussion Oncolytic virus (OV) in combination with chemotherapeutics or immune modulators has been found to be effective in enhancing therapeutic potency 217,236-241. In addition, recent clinical trials also demonstrated that OV exerts an enhanced therapeutic effect when used in combination with chemotherapy 242. Therefore, combinational therapy is believed to be a promising approach for enhancing the therapeutic efficacy of OV. In this report, we confirmed the cytotoxicity of NF in gliomas and in colon and breast cancer cells, a finding that is in agreement with previously reported results using melanoma and breast cancer models 221,222,243,244. Furthermore, we demonstrated a strong synergistic anti-tumour effect with the NF and oHSV-1 combination in various tumour models both in vitro and in vivo.  The synergy observed was probably independent of an ICP6 deficiency in HrR3 since wild-type HSV-1 (KOS) combined with NF also demonstrated synergistic cytotoxicity. Similar synergy was also seen in a γ35.5 deleted oHSV-1 (VG34.5-12TR) which is similar to T-Vec, the first OV drug approved by the FDA16,17. Since NF has been clinically used as a prescription drug for decades220,245, our findings are easily translatable to clinical application and may augment the therapeutic efficacy of T-Vec.  Our data indicated the reduced expression of pro-apoptotic genes in oHSV-1 infected tumour cells. The apoptotic pathway is frequently activated as an inherent defense against viral infections246,247 and viruses are known to be able to counteract the cellular apoptotic mechanism to elongate the life of infected cells to support the viral replication248-250. HSV-1 induces apoptosis at an early stage of infection, but the progression of infection leads to the production of anti-apoptotic viral proteins by early and late herpes virus genes, which thereby block apoptosis246. The anti-apoptotic function of oHSV-1 was evident from the reduced expression of BAX, CDKN1A, MAPK14, CASP4 and FAS in oHSV-1 infected tumour cells. BAX is widely known for its apoptosis inducing role251. CDKN1A is a CDK interacting protein which inhibits cell cycle progression 252. MAPK14 is a stress activated protein kinase that suppresses cell proliferation253. Caspase 4 induces apoptosis by stimulating ER stress254. Cell death 59  surface receptor Fas activated by the Fas ligand results in the induction of apoptosis255. Similar to our finding, Elise et al. also observed a blockade of Fas mediated apoptosis by HSV-1256. Strikingly, expression of these genes was rescued by NF in oHSV-1 infected tumour cells. It is not clear whether the pro-apoptotic effect of NF is related to its inhibition of STAT1/3 activity. However, this may explain the reduced viral toxicity and viral proliferation in normal tissues such as the brain as systemically delivered NF may strengthen the anti-viral defense of normal organs by promoting the death of infected cells.  The mechanism responsible for the effect of NF on oHSV-1 infected tumour cells may be more complicated. The anti-cancer synergy might be the “net” effect of various factors involved in anti-viral and anti-cancer mechanisms. NF was reported to be a potent inhibitor of STAT1 and STAT3 phosphorylation, which may be associated with its anti-tumour activity221. Interestingly, considerable upregulation of STAT1/STAT3 phosphorylation was observed after infection with oHSV-1. Since STAT1 is widely known as an immune stimulatory factor257 which promotes cellular resistance to bacterial and viral infections 224,227, elevation of STAT activation after oHSV-1 infection therefore might indicate a cellular defence reaction to the viral infection. Activation of STAT1 after viral infection may be mediated by interferons (IFNs) that are released following the infection and inhibit HSV-1 replication 258. On the other hand, STAT signalling is suppressed by a suppressor of cytokine signalling (SOCS) that blocks STAT1 activation259,260. We found that NF completely abolished the oHSV-1 upregulated phosphorylation of STAT1 and STAT3 in infected tumour cells. In addition, our data also demonstrated that a combination of NF and HrR3 upregulated SOCS-3 expression in tumour cells. Thus, one may speculate that reduction of phosphorylated STAT-1 may enhance oHSV-1 replication in these cells. However, NF at doses that inhibited STAT phosphorylation could not enhance oHSV-1 replication in tumour cells (data not shown), indicating that the mechanism of this synergistic interaction is independent of viral replication. Failure to enhance oHSV-1 replication by NF might be related to decreased  STAT3 activity since activation of STAT3 was previously reported to increase oHSV-1 replication261. In addition, STAT3 is known for its oncogenic function 60  and has been a target for anti-cancer drugs 224. Inhibition of STAT3 induces apoptosis 262,263 and autophagy mediated cell death 262. What is surprising is that NF dose-dependently downregulated STAT3 phosphorylation and that this inhibition was even more effective in combination with HrR3 in tumour cells.  Since we did not find significant differences in virus titers in HrR3 infected tumours with or without NF treatment, it appears that the anti-viral and pro-viral effects of NF are nearly balanced, resulting in no net effect on viral replication. However, the anti-tumour effect of NF inducing STAT inhibition and pro-apoptotic activity may contribute to sensitizing the tumour to viral induced cytotoxicity, which may cause the synergistic anti-tumour outcome both in vitro and in vivo. Nevertheless, these results demonstrate that nifuroxazide, a clinically used anti-diarrheal drug, can not only synergistically increase the anti-tumour effect of the oncolytic virotherapy but also can enhance the safety of the virus in normal tissues. Given that NF is a prescription drug already in clinical use and that the synergy occurs between NF and VG34.5-12TR, a T-VEC like oHSV-1 that has been recently approved, our findings may be very translatable to potential application in virotherapy in a clinical setting.       61  4 Microglia/macrophages mediated inhibition of oncolytic virotherapy is STAT1/3 dependent * 4.1 Introduction OVs (OVs) have been a therapeutic arsenal to specifically destroy cancer cells through oncolysis: a killing mechanism characterized by cancer cell lysis through the course of lytic virus replication18. In addition to the direct cell killing by the virus, it has been demonstrated that virally induced immune response plays a pivotal role in OV therapy210. As OVs can kill cancer cells via a mechanism distinct from the killing effects of conventional chemotherapy and radiotherapy, OVs are potentially ideal for treating cancers that are non-responsive to conventional treatment. Among the various OVs, herpes simplex virus type 1 based OVs are the farthest advanced. A herpes virus-based OV (T-Vec) was recently approved by FDA for the treatment of melanoma after a successful completion of the clinical trials in North America.16,17  Glioblastoma multiforme (GBM) is a treatment-refractory brain tumour with a poor prognosis 264. The most investigated oncolytic HSV-1 (oHSV-1) to treat GBM are mutant HSV-1s with deletions in viral gene ICP6 47-49 or neurovirulent γ34.5 or both 41,51-53. Despite excellent safety profile, the clinical efficacy of many oHSV-1s has been disappointing 55,265. This may largely attribute to host anti-viral immune responses that inhibit effective replication and intratumoural dissemination of OVs after delivery 68,266-268.  Clinical GBM tumour bed is highly heterogenetic at the cellular level. Most importantly, a significant portion of cells in the GBM tumour mass are non-tumourous 163, which by definition is resistant to replication of OVs.    _____________________ *A version of this chapter will be submitted for publication. Zahid M Delwar, Yvonne Kuo, Yan Hua Wen, William Jia. Microglia/macrophages mediated inhibition of oncolytic virotherapy is STAT1/3 dependent.   62  Among all types of cellular infiltrates, microglia/macrophages as important innate immune cells are the most common ones in GBM 153,163-165, whereas mean microglia/macrophages content is around 40% (range:5-78%) of total tumour mass 167,168. Badie and Schartner have further verified the source of microglia/macrophages in rodent GBM model. They showed that microglia/macrophages contribute up to 46% of the tumour’s cellular mass in rodent GBM, where up to 34% originated from microglia (CD45-/CD11b+ cells) that exist in the brain since embryonic development. The remaining 12% originated from blood-derived macrophages (identified as CD45+/CD11b+ cells) 169.  GBM associated microglia/macrophages play an important role in tumour progression 153,154,163,164. There is a positive correlation between the number of microglia /macrophages and malignancy of brain tumours. Malignant gliomas like glioblastomas and anaplastic gliomas showed the largest number of a mixed cell population containing microglia /macrophages and low malignancy glial tumours contain fewer microglial cell 165. Regardless of the origin of macrophages in the GBM microenvironment, a large body of work suggested that tumour cells communicate with macrophages163. Importantly, the communication is shown to act both ways, where glioma cells attract macrophage infiltration, but also macrophages promote glioma growth and metastasis 163,164.  The abundance of the microglia/macrophages in human GBM may be partially responsible for the poor efficacy of OVs. A previous study found that chemical ablation of microglia/ macrophages subsequently enhances the antitumour effect of oHSV-1 in glioma-bearing rodent model 269. While it has been accepted that the microglia/macrophages are a part of innate anti-viral immune responses, details of the interaction between the macrophage/microglia and OV-infected glioma cells has not been systemically investigated. As the most predominant non-tumour cells in GBM, a better understanding of this interaction is essential for the development of novel strategies for oncolytic virotherapy against GBM. This report addresses the mechanism and effect of microglia/ macrophages in response to oHSV-1 infected human 63  glioblastoma cells. We hypothesized that, by modifying the cellular activity of glioma associated microglia/macrophages, we might enhance the efficacy of oHSV-1 for the treatment of GBM. Indeed, we found that the presence of microglia/ macrophages is sufficient to hinder oHSV-1 replication in glioma cells. Our findings suggest that microglia impedes the dissemination of oHSV-1 among glioma cells mainly by uptaking oHSV-1. Furthermore, while the uptaken oHSV-1 fails to replicate in microglia/ macrophages, some viral carried genes can still be expressed. We further found that phosphorylation of STAT-1 and 3 are critical for inhibition of viral replication in microglia/macrophages. We then discovered that C16, an oxindole/imidazole derivative 270 selectively inhibits the phosphorylation of STAT-1 and 3 to allow viral replication in tumour-associated macrophages that increased viral dissemination and tumour destruction in a subcutaneous mouse glioma model. 4.2 Materials and methods 4.2.1 Microglia isolation and culture  E18 Sprague-Dawley rat was obtained from Charles River Laboratories (Charles River, Wilmington, MA).  Rat primary microglia isolation and culture was conducted according to the standard protocol 271. In brief, cortices were isolated from day 18 embryonic E18 Sprague Dawley rat brain. After 30 minutes incubation in trypsin/EDTA (Invitrogen, Canada), harvested tissue was washed with culture medium and minced in the presence of Dnase I (Invitrogen, Canada). Then the cell suspension was centrifuged, resuspended in fresh culture medium and plated on 10 cm culture dishes in high confluence. Microglia cells were grown in Dulbecco’s modified eagle’s medium (Sigma, Canada) supplemented with 10% fatal bovine serum (Invitrogen, Canada), 1% antibiotics (penicillin and streptomycin) and maintained at 37oC in 5% CO2. Culture medium was changed in every 3-4 days. After 7-10 days, microglias were harvested by gently rocking the plate for a couple of times. Finally, microglias floating in the 64  supernatant were plated in poly-L-lysine coated plate. Cell purity was routinely tested by immunocytochemistry staining for ITGAM (1:200; ProSci Incorporated, CA) which is a microglia specific integrin protein.  4.2.2 Cell culture U87 (human GBM) cells and Vero (African green monkey kidney) cells were obtained from American Type Culture Collection (ATCC, Manassas, VA). BV2 (Mouse microglia) cells were kindly provided by Dr. Stephanie Booth, Department of Medical Microbiology and Infectious Diseases, University of Manitoba. All cells were maintained in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% fatal bovine serum and 1% antibiotics (penicillin and streptomycin). All cells were maintained at 37oC in 5% CO2.  4.2.3 Virus replication assay G207 virus was obtained from NeuroVir Therapeut Inc, San Diego, CA. U87 (5X10^4) cells alone or with the indicated number of microglia cells in co-culture were incubated overnight with culture medium (DMEM with 10% FBS and 1% antibiotic). Next day, cells were infected with G207 virus at a multiplicity of infection (MOI) of 1. Viruses were harvested after 2-4 days post-infection. After three times freeze-thaw cycles, viruses were titrated on Vero cells by a standard plaque assay on 12-well plates by triplicates.  4.2.4 Drugs and reagents effect on virus replication U87 (5X104) alone or U87 + microglia co-culture (5X104 + 5X104) or BV2 microglia cells (5X104) alone were seeded into a 24-well plate. After overnight incubation for allowing the cells to attach, cells were pretreated with indicated concentration of NFkB inhibitor, Bay-11 (Santa Cruz, Canada) or indicated concentration of Imidazolo-oxindole derivative C16 (Milipore, Canada) or vehicle for 1-2 hours. Then cells were infected with oHSV-1 (G2O7 or HrR3) virus at an MOI of 1 in the presence of chemical inhibitors for 65  another two days. Therefore, viruses were harvested and titrated in Vero cells by plaque forming assay in 12-well plates by triplicates. 4.2.5 Western blots Total protein was harvested with sample buffer (125 mM Tris-HCL, 50% Glycerol, 4% Bromophenol blue and 5% 2-mercaptoethanol) and boiled for 5 minutes. Protein samples were subjected to SDS-PAGE (8% gel), transferred to nitrocellulose membranes and blocked with 5% nonfat milk (Bio Rad)  in TBS-Tween 20 (TBS-T) for 1 hour at room temperature. The membranes were then incubated with primary antibody (anti β-actin 1:1000; Cell Signalling, Danvers, MA or anti STAT1 1:1000; Cell Signalling, Danvers, MA or anti STAT3 1:1000; Cell Signalling, Danvers, MA or  anti phospho STAT1 (Tyr701) 1:1000; Cell Signalling, Danvers, MA or anti phospho STAT3 (Tyr705) 1:1500; Cell Signalling, Danvers, MA or anti phosphor-eIF2α (ser51) 1:1000; Cell Signalling, Danvers, MA or anti ICP27 1:1000 ; Abcam, Cambridge, MA or anti ICP4 1:750; Abcam, Cambridge, MA) for overnight at 4oC. Next day, membranes were washed with TBS-T for three times and incubated with the corresponding secondary antibody (1:3000; Perkim Elmer, Boston, MA) for an hour at room temperature. Membranes were washed with TBS-T for three times before visualization using ECL reagent (Perkim Elmer, Boston, MA) and VersaDoc imaging system (Bio-Rad). Band density was measured by using ImageJ software (NIH, Bethesda, MD). 4.2.6 RNA extraction and RT-PCR U87 and BV2 microglia cells were infected with oHSV-1 at an MOI of 1. Total RNA was isolated 24 hours post-infection from BV2 or U87 cells using Triazol reagent (invitrogen, Canada). RT-PCR was performed by using one-step real time PCR using KAPA SYBR® FAST One-Step qRT-PCR Universal (D-MARK Biosciences, Canada) following the manufacturer’s protocol. cDNA was amplified with the following primers. ICP4: 5'-GGCCTGCTTCCGGATCTC-3' (forward) and 5'-GGTGATGAAGGAGCTGCTGTT-3' (reverse) ; ICP27: 5'-GTCTGGCGGACATTAAGGACA-3' (forward) and 5'-66  TGGCCAGAATGACAAACACG-3' (reverse) ; β-actin: 5'-ACGAGGCCCAGAGCAAGAG-3' (forward)  and 5'-TCTCCATGTCGTCCCAGTTG-3' (reverse) ; ICP8: 5'-GCGCCCCATGGTCGTGTT-3' (forward) and 5'-CTCCGCCGCCGAGGTTC-3' (reverse); GC: 5'-GCCGCCGCCTACTACCC-3' (forward) and  5'-GCTGCCGCGACTGTGATG-3' (reverse);  VP5: 5' - TGAACCCCAGCCCCAGAAACC 3' (forward) and 5' - CGAGTAAACCATGTTAAGGACC 3' (reverse). Results were expressed as 2-ΔΔCT.  4.2.7 β-galactosidase staining Cells plated into a 8-well chamber slides were infected with G207 virus and mock infected cells were considered as control. After 24 hours of post-infection, cells were fixed by 0.5% glutaraldehyde solution. Fixed cells were washed twice with PBS and then incubated with 1mg/ml X-gal solution (Sigma, Canada) diluted with X-gal staining solution (5mM K3Fe, 5mM K4Fe and 2mM MgCl2) at 37oC for one hour. Stained cells were then visualized and imaged by using a light microscope.  4.2.8 iNOS (Inducible Nitric Oxide Synthase) inhibition effect on oHSV-1 growth  U87 (5X104) alone or U87 + microglia co-culture (5X104 + 5X104 ) were seeded into  a 24-well plate. After overnight incubation for allowing the cells to attach, cells were pretreated with indicated concentrations of aminoguanidine hydrochloride (Tocris Bioscience, Canada) or vehicle for 24 hours. Then cells were infected with G207 virus at an MOI of 1. One hour postinfection, cells were again treated with aminoguanidine hydrochloride for another three days. After three days post-infection, viruses were harvested and titrated on vero cells by plaque forming assay in 12-well plates by triplicates. 67  4.2.9 Phagocytosis assay  Phagocytosis assay was performed according to the manufacturer protocol (Phagocytosis assay kit, Cayman Chemical, MI). Briefly, microglia cells were infected with G207 or vehicle at an MOI of 1 and 10% latex beads-rabbit IgG-FITC solution was added to each well of a 24-well plate with the virus treatment or 1-hour post-infection after washing with PBS for three times. After 24 hours of treatment, cells were incubated with trypan blue solution for two minutes to quench non-specific staining. After two times washing, cells were lysed by using 1X lysis reagent (Promega, Madison, WI). Fluorescence intensity was measured in a plate reader (Envision 2103 Multilabel reader, Perkin Elmer) using an excitation of 485 nm and an emission of 535 nm.  Virus and IgG latex beads interaction were detected by co-incubating either vehicle or 1% or 10% or 20% of IgG latex beads and G207 (MOI:1). After 24 hours of co-incubation, cells were incubated overnight with 1mg/ml X-gal solution (Sigma, Canada) for LacZ staining. Cells were counterstained with dapi to quantify the total number of cells in each microscopic field. Stained cells were then visualized and imaged by using a light microscope (magnification 20X). LacZ positive cells and dapi stained cells are manually quantified. Data are represented as the ratio of the number of LacZ positive cells and the total number of cells in each image (n=5). 4.2.10 Cell conditioned medium collection & treatment  For collecting the cell conditioned medium U87 (5X104) or microglia (5X104) or U87 + microglia co-culture (5X104 + 5X104 ) were incubated in cell culture medium for 24 hours in a 24 well plate. To check the effect of cell conditioned medium on G207 growth, previously collected conditioned medium (50%) were added into U87 (5X104 ) cells (seeded on a 24-well plate) and then infected with G207. Viruses were harvested three days post-infection and titrated by plaque assay in vero cells.   68  4.2.11 Cell proliferation assay Cells were seeded in a 96-well plate at a density of 1 X 104 (U87). After overnight incubation, cells were treated with only vehicle or indicated MOI of viruses or indicated concentration of drugs or reagents. After 2 to 3 days of treatment, cell viability was measured by means of MTT assay (Sigma, Canada) following manufacturer's instruction. In brief, cells were incubated with MTT solution for 3 hours at 37oC and then incubate with lysis buffer for. Cell viability was measured at 595 nm by using a plate reader (Envision 2103 Multilabel reader, Perkin Elmer). 4.2.12 U87 xenograft model 5 to 6 weeks old female athymic nude mice were obtained from Harlon laboratories. Human glioma U87 cells were implanted subcutaneously into the lower flank. When tumour size reached ~75 to 100 mm3, vehicle or C16 5mg/kg was administered intraperitoneally (IP). 2 days (Figure 4.6) or 4 days (Figure 4.7) of initial C16 administration, vehicle or oHSV-1 were injected intratumourally. Tumour volume was measured by using a caliper (Height X Length X Wide/2). At the end of the experiment, mice were euthanized by using CO2 asphyxiation, All in-vivo experimental procedures were approved by the UBC animal care committee and performed according to the guidelines of the Canadian Council on Animal Care. 4.2.13  Tissue DNA extraction & qPCR DNA were extracted from 4% paraformaldehyde fixed tumour tissues by using an EZNA tissue DNA kit (Omega bioteck). Extracted DNAs were subjected to qPCR analysis using Syber green master mix (Invitrogen, Canada) supplemented with ICP27 primers: 5'-GTCTGGCGGACATTAAGGACA-3' (forward) and 5'-TGGCCAGAATGACAAACACG-3' (reverse); β-actin primenrs: 5'-ACGAGGCCCAGAGCAAGAG-3' (forward)  and 5'-TCTCCATGTCGTCCCAGTTG-3' (reverse). Amplification was done using Quantstudieo 6 Flex qPCR machine (Applied biosystems, Canada).  69  4.2.14 Immunohistochemistry  Harvested tumours were subjected to cryostat sectioning after fixed for 24 hours with 4% paraformaldehyde. Tissues were fixed for 24 hours with 4% paraformaldehyde, followed by 72 hours incubation with 30% sucrose. Tissues were then embedded in OCT (Sakura tissue tek), sectioned (20 um) using a cryostat (Leica CM 3050 S) and placed on Fisherbrand™ Superfrost™ Plus microscope Slides (Fisher Scientific, Canada). Slides were then washed with PBS, permeabilized with 0.125% Triton X-100 for 5 minutes and incubated with 5% goat serum (SantaCruz, Canada) for an hour to block unspecific binding. Cells were then incubated overnight with either anti-HSV-1 antibody (1:50; Abcam, Cambridge, MA) or anti F4/80 antibodies (1:50; Abcam, Cambridge, MA) at 4ºC temperature. Following day, after three washing, sections were incubated with either goat anti-rabbit IgG Alexa Fluor 488 or goat anti-rat IgG Alexa Fluor 568 secondary antibody (1:500; Invitrogen, Canada) for an hour at room temperature. After three times washing, sections were then mounted with Dapi fluromount G (Electron Microscopy Sciences) and visualized and imaged by using a confocal microscope (Olympus, Canada). 4.2.15 Statistical analysis Statistical analysis was performed by SPSS 18 or Microsoft Excel, and significance (P˂0.05) was determined by using independent-samples T test or a significance P˂0.001, P˂0.01, or P˂0.05 was determined using a two tailed Student’s t-test respectively. Data are expressed as mean ± SD or ± SE.    70  4.3 Results 4.3.1 Presence of microglia hinders the oncolytic efficacy of oHSV-1 against U87 cells Efficiency of G207 replication in U87 cells was determined by one step viral growth assay (Figure 4.1A). G207 anti-proliferative effect was evaluated by means of an MTT assay. A dose-dependent antiproliferative effect was observed and the IC50 was observed for G207 at MOI=1 after 72 hours of infection (Figure 4.1B). Our results confirmed that G207 can effectively replicate and lyse U87 cells. We then measured G207 growth in U87 cells in the presence of different numbers of microglia. The addition of microglia cells in U87 culture inhibited G207 replication in a “dose” dependent manner. G207 replication was reduced by 50% and almost 100% by addition of 6.25x10^3 and 1x10^5 microglia cells in U87 (5X10^4) cultures, respectively (Figure 4.1C). To further confirm that microglia-mediated oHSV-1 growth suppression is not strain-specific, we tested different HSV-1 strains, including HrR3 (ICP6 mutated), b17-TK (a TK- mutant) and KOS (wild type) in this experiment. We observed similar viral replication inhibition among all HSV-1 strains tested (Figure 4.1D).   71    Figure 4.1 Presence of microglia in GBM culture suppresses growth and oncolytic capacity of oHSV-1. The growth of G207 in U87 cells was determined by single step growth assay (A). The cytotoxic effect of G207 was measured by the MTT cell proliferation assay at three days post-infection in U87 cells (B). To study the effect of microglia on G207 growth in U87 (5X10^4) cells alone and also in U87 (5X10^4) in combination with different numbers of primary rat microglia (MG) cells, the cells were infected with G207 at a multiplicity of infection (MOI) of 1 (C). U87 (5X10^4) cells alone and U87 (5X10^4) + MG (5X10^4) co-culture were infected at an MOI of 1 with ICP6 gene-mutated oHSV-1 HrR3, TK-deleted oHSV-1 b17-TK, or wild-type HSV-1 KOS (D). Virus replication efficiency was determined using single step virus growth assay at four days post-infection. Data are reported as means ± S.D.     72  4.3.2 oHSV-1 triggers M1 polarization of microglia  Since M1 polarized (activated) microglia is characterized by high level of inducible nitric oxide synthase  (iNOS) 272, our results demonstrated that G207 treatment significantly upregulated iNOS expression in the microglial cells with or without U87 cells either by co-culturing (Figure 4.2A) or using U87 conditioned medium (Figure 4.2B).    Figure 4.2 oHSV-1 effect on microglia polarization. A, Microglia (MG) or microglia and U87 co-culture (M+U) were immunostained for iNOS after 24 hours treatment with G207 at an MOI of 3 (right panel) or lipopolysaccharide (LPS) (Middle panel) or mock preparation (Left panel). B, Microglia (MG_G207) or microglia incubated with U87 conditioned medium (MG+U87 co_G207) was infected with G207 virus, mock treated microglia (MG) cells were used as a control. Total protein was extracted at 24 hours post-infection. The iNOS and β-actin expression was determined by western blot analysis (B). Band density of iNOS was normalized to β-acting (means ± SD).     73  4.3.3 Nitric oxide (NO) and other microglia secreted products have no noticeable effect on oHSV-1 replication  Data demonstrated that Deta-No had no antiviral effect against G207 up to 100 uM. Although higher concentrations (such as 500 µM) of Deta-No can suppress G207 replication in U87 cells (Figure 4.3A), it may attribute to the cytotoxicity of the compound, as cell proliferation assay indicated that 500 µM  & 1000 µM of Deta-No alone killed 50% and 75% cells, respectively (Figure 4.3B). Moreover, no difference in viral production was found between aminoguanidine-treated and vehicle treated microglia/U87 co-cultures (Figure 4.3C). In addition, no inhibition of oHSV-1 (G2O7) replication in glioma cells were observed by the microglia or microglia+glioma co-culture conditioned medium (Figure 4.3D).    Figure 4.3 Effect of microglia secreted products on oHSV-1 efficacy. A and B, U87 cells were treated with indicated concentrations of Deta-No (an NO donor) in combination with G207 at an MOI of 1 for 48 hours. Harvested virus was then titrated by qPCR to determine viral ICP4 DNA copy number (A). MTT assay determined indicated 74  concentration of deta-No effect on U87 cell proliferation after 48 hours of treatment (B). C, U87 or U87 + microglia co-culture (U+M) cells were pre-treated with different concentrations of aminoguanidine hydrochloride (AG), an inhibitor of iNOS or vehicle for 24 hours. Then cells were treated with G207 for another three days in the presence of AG or vehicle. Virus titers were determined by plaque assay on vero cells. D, Conditioned medium was collected from U87, Microglia (MG) and co-culture (U+M) cell culture supernatants. U87 cells were infected with G207 at an MOI of 1 with above mentioned conditioned mediums. Viruses were harvested 72 hours post-infection and titrated on vero cells.   4.3.4 Microglia uptake oHSV-1 via phagocytosis  The capacity of primary cultured microglia to engulf the beads by phagocytosis was significantly reduced in the presence of G207 (Figure 4.4A). On the other hand, latex beads reduced number of G207 “infected” primary cultured microglial cells in a concentration-dependent fashion (Figure 4.4B). One possible explanation is that G207 and IgG latex beads may compete for phagocytosis. Thus, it seems that oHSV-1 enter the microglia via the same phagocytotic mechanism as IgG beads. To further verify that microglia and igG latex beads are competing, we performed a similar experiment in  BV2 microglia cells. Similarly, co-incubation with G207 caused decreased phagocytotic uptake of IgG latex beads in BV2 microglia cells as well (Figure 4.4C). Interestingly, when BV2 cells were pre-treated with G207, the uptake of IgG latex beads was significantly increased, suggesting that virus may stimulate the phagocytic activity of the BV2 cells (Figure 4.4D).   75   Figure 4.4 oHSV-1 and microglia phagocytosis. A and B, microglia cells were infected with a mock or indicated MOI of oHSV-1 (G207) virus in the presence of 10% latex beads-rabbit IgG-FITC solution. Phagocytosis was measured by fluorescence plate reader after 24 hours of incubation (A). Microglia cells were incubated with G207 at an MOI of 1 with vehicle or indicated concentration of latex beads IgG-FITC solution. Cells were stained with β-galactosidase after 24 hours of treatment to study the virus entry. LacZ positive cells were quantified from 5 randomly selected fields by using a light microscope (means ± SD) (B). C and D, similar experiments were conducted on BV2 microglial cell line. BV2 microglia cells were infected with mock preparation or indicated MOI of G2O7, co-incubated with 10% latex beads-rabbit IgG-FITC solution (C) or 1 hour post-infected cells were washed three times with PBS and then incubated with 10% latex beads-rabbit IgG-FITC solution (D). After 24 hours of treatment, the degree of phagocytosis was measured by fluorescence plate reader.   76  4.3.5 oHSV-1 infection induces microglia cell death To determine the fate of the oHSV-1 infected microglia cells, we performed MTT cell prolifeartion assay. Data demonstreated that oHSV-1 inhibits the survival of microglia cells (Figure 4.5).     Figure 4.5 oHSV-1 effect on microglia cell proliferation. BV2 microglia cells were seeded in a 96-well plate at a density of 1 X 104. The next day, they were treated with vehicle only, with oHSV-1 (G2O7) viruses with different MOIs for 48 hours. Cell viability was then measured using an MTT assay.  4.3.6 Microglia forms a replicative barrier to prevent oHSV-1 dissemination We next asked whether oHSV-1 can infect and replicate in microglia cells. Both rodent primary cultured microglial cells and BV2 microglia infected with G207 showed LacZ 77  staining, indicating that the virus can enter the cell and express the reporter gene carried by the virus273 (Figure 4.6A). Concentration-dependent HSV-1 infection in microglia cells was also observed by GFP expressing UL5354 virus, an ICP27- HSV-1 that is replication deficient but expresses GFP reporter gene as well (data not shown).  However, growth assay of G207 in primary cultured rat microglia cells (Figure 4.6B I) and BV2 cells (Figure 4.6B II) demonstrated that G207 failed to produce its progeny in microglia cells (Figure 4.6B). These results suggest that microglia internalized the viruses but did not allow viral replication.    Figure 4.6 oHSV-1s are capable of infecting microglias, but they are unable to replicate. Rat primary microglia (MG) or BV2 microglia cells were infected with G207 virus at an MOI of 3 or mock preparations. To detect viral reporter gene expression, cells were stained for β-galactosidase (arrow) after 24 hours of infection (A). MG or BV2 microglia cells were infected with G207 at an MOI of 1 to study the replication capacity of G207. Viruses were harvested at 24 hours, 48 hours, and 72 hours post-infection and then titrated on Vero cells (B).   78  4.3.7 oHSV-1 gene expression profiling in BV2 microglia cells To reveal the mechanism by which the HSV-1 replication is prevented in microglial cells, we measured transcript levels of a panel of viral genes in glioma (U87) and microglia (BV2) cells. The viral genes included ICP4, ICP27, ICP8, VP5 and Glycoprotein C (gC), representing immediate early, early and late genes, respectively. Quantitative RT-PCR results showed that transcription of ICP27, ICP8, VP5 and gC but not ICP4 were significantly suppressed in BV2 cells compared to U87 cells (Figure 4.7).      Figure 4.7 oHSV-1 gene expression in microglia cells. The mRNA levels of different genes of the G207 virus (ICP4, ICP27, ICP8, VP5 and GC) were detected by RT-qPCR. Ratios of the relative mRNA level (2-ΔΔCT) of G207 infected BV2 and U87 cells (BV2/U87) are presented.  79  4.3.8 C16 overcomes microglia-mediated oHSV-1 replication barrier To understand the events of intracellular signaling in G207 stimulated microglia, we have further tested effects of a PKR inhibitor (C16), an NFkappaB inhibitor (Bay11) and an iNOS inhibitor (Aminoguanidine hydrochloride) on G207 replication in BV2 cells. Treatment with 1 & 10 µM C16 significantly enhanced the replication by 9 times and 8 times, respectively (Figure 4.8Ai). However, Bay11 and aminoguanidine hydrochloride had no effect on oHSV-1 replication in BV2 cells (Figure 4.8Aii and iii). In agreement to that, C16 but not Bay11 nor aminoguanidine hydrochloride upregulated expression of ICP4 and ICP27 by 1.8 and 25-fold, respectively (Figure 4.8B). To verify that C16 mediated viral gene transcriptional augmentation is not due to the double deletions in ICP34.5 and ICP6 in G207, we then checked the effect of C16 on wild type (KOS), and ICP6 mutated (HrR3) HSV-1 infected BV2 cells. C16 treatment also upregulated ICP27 expression in KOS and HrR3 infected BV2 cells (Figure 4.8C). Finally, we asked whether C16 can overcome the microglia-mediated suppression of viral replication in glioma cells. As shown in Figure 4.8D, G207 viral replication increased by 33% in the glioma-microglia co-cultures treated with C16.     80    Figure 4.8 Mechanism of oHSV-1 gene expression blockade in microglia cells. BV2 cells were pre-treated with the indicated chemical compounds for 1-2 hours and then infected with oHSV-1 at an MOI of 1 (A-D). The viruses were harvested after 48 hours of oHSV-1 (G207) and indicated chemical inhibitors treatment (A and D). Total proteins were harvested from microglia cells infected with G2O7 (B), HrR3, or KOS (C) at 24 hours post treatment with either 1µM of C16 (B and C) or 1µM of Bay11 (B) or 100µM of AG (B). ICP27, ICP4 & β-actin expression was measured by western blot assay (B and C). U87 and MG co-culture were pretreated with 0.5 µM of C16 for 1 hour. After 48 hours of treatment with oHSV-1 (G207) and C16, viruses were harvested and titrated by plaque-forming assay on vero cells (D).  81  4.3.9 Cell type-specific C16 effect on oHSV-1 replication To determine the C16 effect on the replication of oHSV-1 in tumour and normal brain cells, we performed oHSV-1 replication assay in glioma and astrocytes. Virus growth assay revealed that oHSV-1 replication was reduced in astrocytes, while unchanged in U87 glioma cells (Figure 4.9).     Figure 4.9 Effect of C16 on oHSV-1 replication in tumour and nontumour cell types. The indicated cells were pre-treated with vehicle or 1uM C16 for 2 hours before infecting them with oHSV-1 (G207) at an MOI of 1. Viruses were harvested after 24 hours of infection and titrated on Vero cells.     82  4.3.10 C16 rescue oHSV-1 in microglial cells by inhibiting STAT 1 and 3 activities As a part of an effort to understand the mechanism of C16 on facilitating viral replication in microglia/macrophages, we first looked activity of PKR pathway by measuring the level of phosphorylated eIF2α in G207 infected BV2 cells since C16 was reported as a PKR inhibitor. To our surprise, there was no change in phosphorylated eIF2α regardless of the ICP34.5 status of the virus (Figure 4.10). We then examined activities of STAT1 and STAT3 in BV2 cells with and without G207 infection.  G207 upregulates phosphorylation of STAT1 (Tyr701) and STAT3 (Tyr705) in BV2 cells (Figure 4.10A), which is significantly suppressed by C16.  Interestingly, the overall expression level of STAT1 but not STAT3 was upregulated in G2O7 infected microglial cells, and that was also reduced after C16 treatment. The C16 caused inhibition in STAT1/3 phosphorylation was also confirmed in LPS treated BV2 cells (Figure 4.10B).    83    Figure 4.10 C16 inhibits STAT 1 and 3 phosphorylation. BV2 cells were pre-treated with vehicle or C16 (1uM) for 2 hours and then incubated with vehicle or oHSV-1 (G2O7) at an MOI of 1 or with the oHSV-1 and C16 combination for 24 hours (A). BV2 cells were treated with either vehicle or LPS (1µg/ml) alone or a combination of LPS (1µg/ml) and C16 (1µM) for 24 hours (B).Total protein was harvested and subjected to western blot assay. β-actin expression was used for loading control (means ± SE).     β-actin STAT-1 STAT-3 pSTAT-3 peIF2a pSTAT-1 Vehicle C16 oHSV-1 oHSV-1+C16    P<0.05     P<0.01  A B Vehicle LPS LPS-C16    P<0.05     P<0.01  β-actin pSTAT3 pSTAT1 84  4.3.11 Cell type specific eIF2α phosphorylation inhibitory effect of C16 Since C16 is knoiwn for its PKR inhibitory function, therefore we evaluated its effect on eIF2α phosphorylation in oHSV-1 infected cells. We observed that eIF2α phosphorylation was inhibited in oHSV-1 infected astrocytes, but its level was unchanged in U87 and BV2 cells (Figure 4.11).    Figure 4.11 eIF2α phosphorylation inhibition effect of C16 in various cell types infected with oHSV-1. The indicated cells were pre-treated with vehicle or 1uM C16 for 2 hours before infecting them with G207 at an MOI of 1. Total protein was extracted at 24 hours post-treatment and subjected to western blot analysis.  4.3.12 C16 selectively facilitates oHSV-1 replication in glioma xenograft by overcoming barriers of tumour-associated macrophage  To demonstrate that the above effect by C16 can be translated into the enhanced efficacy of intratumoural replication of oHSV in vivo, C16 was i.p. injected into the animals bearing subcutaneously implanted U87 tumours that received G207 intratumourally.  Administration of C16 significantly enhanced oHSV-1 titer in the tumour 85  mass (Figure 4.12A). Immunohistochemistry analysis demonstrated increased number of cells harboring replicating HSV-1 in animals co-treated with oHSV-1 and 5mg/kg C16 compared to those treated with oHSV-1 alone. Furthermore, numerous cells with co-localization of HSV-1 and macrophage markers (F4/80) were seen in animals co-treated with oHSV-1 and C16 but not oHSV-1 alone, indicating increased viral replication in the macrophages after C16 treatment (Figure 4.12B).      86  Figure 4.12 C16 triggers oHSV-1 protein expression in microglia/macrophages and enhances virus concentration in glioblastoma in-vivo. U87 xenograft mice were treated with vehicle or 5mg/kg of C16 with or without 6X10^6 PFU oHSV-1 (G207) viruses (n=2). Two doses of G207 or vehicle and 4 doses (in every 3 or 4 days) of C16 were administered in total. Tumours were harvested at day 13 post treatment. Total genomic DNA was extracted from the harvested tumours (n=2), and viral DNA (ICP27) was measured by qPCR (normalized to β-actin). Data shown are regarding relative 2-ΔΔCT value ± SE (A). Infiltrated macrophages (F4/80) and replicable viruses were detected in U87 tumours when they were subjected to immunostaining (B).   4.3.13 Anti-tumour effect of C16 As we observed potent STAT3 inhibitory effect by C16, which is well known for its oncogenic function, we then asked if C16 can prevent the survival of tumour cells. Cytotoxic effect of C16 was observed in various types of tumour cells (Figure 4.13).   Figure 4.13 Anti-tumour effect of C16 in-vitro. Cells were treated with indicated concentration of C16 for 72 hours. Cytotoxicity was measured by an MTT assay. Data are presented as means ± S.D. 87  4.3.14 C16 significantly improve human glioma xenograft regression Finally, we asked whether C16 mediated facilitation in oHSV-1 replication in the tumour is capable of augmenting the anti-tumour oncolysis. Indeed, tumour sizes in animals treated with C16 (5 mg/kg) and the oHSV-1 combination were 9.3 fold, 8.2 fold and six fold smaller than those treated with vehicle, C16 alone and oHSV-1 alone, respectively (Figure 4.14A). Furthermore, virus copy numbers measured by qPCR in the liver, brain and gastrointestinal showed no difference among all groups, demonstrating that viral replication was restricted only in the tumours without spreading to the normal organs (Figure 4.14B). Kaplan-Meier analysis showed the increased survival of the C16 and oHSV-1 combination treatment compared to other groups (Figure 4.14C).    88  Figure 4.14 C16 increases oncolytic efficacy of oHSV-1 in-vivo. U87 xenograft mice were treated with vehicle or 5mg/kg of C16 with or without a single dose of 1X10^8 PFU oHSV-1 (HrR3) viruses (n=5). Multiple doses of vehicle or C16 were injected intraperitoneally (IP) on alternate days. Tumour volume was measured by using a caliper (Height X Length X Wide/2) (A). In the results, * represents significant (P≤ 0.05) tumour regression by oHSV-1 and C16 combination vs. vehicle or individual C16 or individual oHSV-1 treatment (± SE).  Survival of the animals was represented using Kaplan-Meier survival analysis (B). Tumours and other organs were harvested once the animals reached the endpoint, and total genomic DNA was extracted from the harvested organs (n=3). Viral DNA (ICP27) was measured using qPCR (normalized to β-actin). Data shown are relative 2-ΔΔCT value ± SE (C).   4.3.15 Schematic diagram of microglia effect on oHSV-1 efficacy    Figure 4.15 Schematic diagram of microglia barrier on oHSV-1 therapy.  89  4.4 Discussion In this study, we demonstrated that the presence of microglia/macrophages impedes oHSV-1 oncolytic replication in GBM cells. This finding is consistent with the previous reports that inhibition of innate immune response enhances efficacy68,266-268,269 of OVs. Another very recent study by Han et al. reported that a single dose of TGFβ helped to overcome the innate immune resistance mediated by microglia/macrophages and NK cells274 and thereby enhanced the anti-tumour efficacy of oHSV-1. Interestingly, we observed that after oHSV is taken up by microglia/macrophages, some viral genes such as ICP4 and virally carried exogenous genes such as lacZ reporter can still be expressed albeit viral replication would not be permitted. These findings suggest that HSV-1 can potentially target microglia/macrophages to express the therapeutic gene(s) that modify the tumour microenvironment.    Our gene expression profiling in microglia cells infected by oHSV-1 demonstrated that expression of immediate early ICP27 gene, early ICP8 and late VP5 and gC gene belonging to HSV-1 are significantly decreased in microglia cells. Down-regulation of the early and late genes such as ICP8275 and gC276 might be the result of the silence of the immediate early gene ICP27 that is required for viral DNA synthesis and late gene expression 275,277. However, the silence of ICP27 may be a necessary but not sufficient condition to block HSV replication in microglia since restoring ICP27 expression by transfecting an exogenous copy of ICP27 could not rescue the viral replication (Data not shown).  Focusing on the interaction between oHSV-1 and microglia, we then asked how the underlying molecular mechanism of microglia/macrophage-mediated inhibition of viral gene expression operated. It is well known that the interferon-inducible, dsRNA-dependent protein kinase, PKR, plays a key role in the innate immunity response to viral infection 278. After infection with HSV-1, normal host cells activate PKR thereby shutting down protein synthesis through inactivating eukaryotic initiation factor-2 (eIF-2α) via increased phosphorylation. It has also been known that γ34.5 of HSV-1 counteracts PKR and IFNs-mediated antiviral effect 279 by recruiting the cellular protein phosphatase 90  1α, which reverses the PKR-mediated phosphorylation of eIF2α 279,280. Originally, we thought that inhibition of viral protein synthesis might be attributed to eIF2α mediated blockage of protein synthesis, which led to our tests using the oxindole/imidazole derivative C16, a known PKR inhibitor270,281. However, subsequent results indicated that activation of PKR is unlikely to be the mechanism behind the blockage of viral replication in microglia/macrophages for the following reasons: 1) the inhibition of viral gene expression occurred at transcriptional level; 2) C16 enhanced viral replication in all viral strains tested regardless of their γ34.5 status62,64. Thirdly, in agreement with previous studies, we also observed inhibition of eIF-2α phosphorylation by C16 in primary astrocytes270,281; however, no change was seen in microglia and glioma cells, suggesting a possible cell-type specificity of C16 on PKR inhibition. Instead, we found that C16 significantly inhibited phosphorylation of STAT1/3 in oHSV-1-infected microglia/macrophages and thereby rescued the replication of oHSV-1. More interestingly, we found that inhibition of STAT1/3 phosphorylation by C16 was only evident in oHSV-infected cells. Previously, C16 was reported to inhibit three dormant host fucosyltransferase genes (FUT3, FUT5, and FUT6) expression in wild type HSV-1 infected human diploid embryonic lung fibroblasts, which thereby stimulated HSV-1-induced expression of sialyl Lewis X independently to PKR stimulated translation inhibition. Interestingly, they also observed that C16 treatment in HSV-1 infected cell reduced IL6 production which is one of the main cytokine to activate STAT signaling. STAT blockade effect of C16 observed in our study might be the outcome of C16 mediated inhibition of IL6225. STATs are well known for their anti-mycobacterial and antiviral effect 224,227,282. Among different members of the STAT family, STAT1 is the most known for regulating antiviral interferon  (IFN) signaling cascade283,282 and interferon has in turn been reported to inhibit HSV-1258. As expected, elevated STAT1 phosphorylation was observed in oHSV-1-infected microglia/macrophages that might be the consequence of cellular defence to the viral infection.  91  Similar to the action of STAT1, the phosphorylation level of STAT3 was also upregulated in oHSV-1-infected microglia/macrophages. STAT3 is another member of the STAT family which is known for its oncogenic function, tumour cell proliferation, survival and invasion 224. Inhibition of STAT-3 activation induces cell death mediated by apoptosis 262,263 and autophagy 262. The role of STAT3 in HSV-1 infection is not clearly understood. A previous study by Okemoto et al. demonstrated a positive correlation between STAT3 and oHSV-1 replication in glioma cells261. There have been no studies on for the role of STAT3 in antiviral function of microglia/macrophages. Our data demonstrated enhanced oHSV-1 replication in microglia/macrophages upon C16-mediated inhibition of STAT1 and STAT3. However, C16-mediated virus replication enhancement was only evident in microglia/macrophages and not in astrocytes or glioma cells. In agreement with our findings, functions of both STAT1 and STAT3 were reported to be cell-type specific284,285. Shin et al. have demonstrated that HSV-1-mediated countermeasures against IFN are ineffective in monocytes285. Apparently, the STAT1 pathway is more functional in monocytes and macrophages. Since ICP27 plays a vital role in countermeasures to cellular IFN response279,286, silencing ICP27 by STAT1/3 may render HSV-1 ineffective in evading the intracellular antiviral mechanism within microglia/macrophages.   Our in vivo data in U87 human glioma xenograft model also confirmed that C16 rescued the oHSV-1 gene expression in tumour-infiltrated macrophages and augmented oHSV-1 viral load in tumours. Moreover, we observed that the effect of C16 on enhanced viral replication in macrophages was restricted to tumours; no viral replication was detectable outside of tumour tissue by sensitive PCR method. It remains to be confirmed whether the selective facilitation of oHSV-1 oncolysis by C16 was due to locally delivered virus or attributable to the difference between normal microglia/macrophages and tumour-associated macrophages/microglia.   Unfortunately, we were not able to distinguish the roles of STAT1 and STAT3 in blocking viral replication in those cells due to lack of a highly selective agent. 92  Nevertheless, our results suggest that activation of STAT1/3 is sufficient to inhibit viral replication of oHSV-1 even when the PKR-eIF2α axis remains active in microglia/macrophages. Furthermore, since STAT3 has been a target for cancer treatment and our data demonstrates that C16 inhibits the proliferation of various types of cancer cells, inhibition of STAT3 activity by C16 may significantly facilitate oHSV-1-induced tumour regression and enhance viral dissemination in tumour mass.  In summary, our present study suggests that anti-tumour efficacy of oHSV-1 is partially determined by the amount of non-tumourous cells in the tumour mass, especially microglia/macrophages that uptake the viruses but do not permit viral replication (Figure 4.15). This is mainly due to upregulated STAT1/3 phosphorylation that may be independent of PKR activation. However, we found that some viral and exogenous genes carried by oHSV-1 and uptaken by the microglia/macrophages can still be expressed. This suggests that the tumour-associated microglia/macrophages may be utilized for expressing virally carried therapeutic genes. More importantly, we discovered that C16 is a strong phosphorylation inhibitor of STAT1/3 that can selectively restore viral replication in microglia/macrophages to allow enhanced intratumoural viral production and dissemination. Inhibition of STAT3 phosphorylation by C16 may further suppress tumour growth. The combination effects of the above dramatically increase anti-tumour efficacy of the oncolytic virus. Our research has provided strong evidence that C16 is an excellent candidate for clinical application in combination with oncolytic virotherapy on account of its capacity to significantly augment the anti-tumour efficacy of oHSV-1.       93  5 Conclusions and future directions Among the various types of viruses, oncolytic herpes simplex type-1 is probably the most advanced oncolytic virus in the clinic as it is the first oncolytic virus approved by the USA FDA. Despite the tremendous recent progress of oHSV-1, the efficacy of the oHSV-1 in treating glioma remains to be improved in the clinics 55,85. Ensuring the safety of virotherapy is of the highest importance, but the importance of enhancing viral oncolytic antitumour activity is equally critical for OV’s success in the clinic 274,287. Here, we have demonstrated that, to boost the antitumour efficacy of oncolytic herpes virotherapy, three strategies are possible: (1) engineering the virus transcriptionally and translationally for tumour-specific replication to enhance tumour targeting without compromising viral oncolytic activity (Chapter 2), (2) enhancing virus-mediated cytotoxicity by counteracting virally induced anti-apoptotic mechanisms. (Chapter 3), and (3) facilitating intratumoural virus dissemination by overcoming the barriers formed by tumours associated microglia/macrophages (Chapter 4). 5.1 oHSV-1 tumour specificity Viral gene deletion is a common approach for achieving tumour specificity 63. Attaining tumour specificity by attenuating or deleting viral gene(s) sometimes compromises the lytic activity of the virus that results significantly reduced therapeutic efficacy 62,64. To circumvent this disadvantage, various tumour-specific transcriptional targets have been utilized previously to attain tumour specificity 90,288. Choosing a perfect tumour-specific promoter to transcriptionally regulate OVs is often tricky since the promoter needs to be not only upregulated in tumour cells but also completely silent in normal cells. The survivin promoter 197-203 is a good choice to regulate OVs transcriptionally. However, low-level promoter activity may still result in virus replication in non-tumour cells 90 to cause unwanted toxicity. Single transcriptional regulation by a tumour-specific cellular promoter also may not be sufficient to completely inhibit the replication in normal cells, 94  as it has been shown that some HSV-1 immediate early gene, such as ICP0, can upregulate the activity of cellular promoters that are supposed to be silent 289. Thus, multiple tumour-specific regulations might be another approach to overcome off target replication of OVs. The combination of transcriptional and translational targeting strategy has been reported successful to enhance OV’s tumour specificity 185. Previously, Cleo et al., demonstrated that inclusion of miRNA 143 or 145 target sequences into the 3’UTR of an HSV-1 essential gene limit viral replication in prostate cancer cells 186. We also applied this mechanism in addition to the transcriptional regulation by utilizing the differential expression pattern of eukaryotic translation initiation factor 4 (eIF4E) and micro RNA 124 94,97,204 in tumour and non-tumour cells. In a very recent study, Zhang et al., of our group, reported that targeting multiple miRNAs significantly improves the tumour specificity of oHSV-1 compared to single miRNA target 290. However, my study only investigated miRNA 124, the addition of another or multiple miRNAs might further enhance the safety feature of our oHSV-1. Since we only regulated ICP4 291,292 gene expression, and it has been reported previously by Cleo et al., that low-level expression of ICP4 can still support virus replication in normal cells 90, another replication-essential gene such as ICP27 could ensure extra safety to treat glioblastoma. 5.2 Cytotoxicity of oHSV-1 infection The interaction between the host and HSV-1 is very complex, and both sides want to take control of the cellular machinery. Since virus replication and life cycle depend on the host cellular machinery, HSV-1 changes the host cellular process for maintaining efficient replication 293. On the other hand, cellular defense mechanism fight against the viral infection 294. Among various cellular armors, interferon (IFN) is the first line of defense against viral infection 282,295. Even though many studies have demonstrated HSV-1 mediated induction of IFN production 296, it is not clearly understood whether IFN is capable of blocking the virus infection, as several studies have reported that HSV-1 is 95  skilled to countermeasure IFN response 285,297. However, both classes of IFN, Type 1 (IFNα and IFNβ) and Type 2 (IFNγ) were found essential to defend HSV-1 infection 298. Type 1 can be produced by most of the cell types, while type 2 is only produced by a few types of immune cells, such as natural killer cells, CD4+T helper 1 (Th1) cell, CD8+T cells 282, and macrophages299. In fact, the differential pattern of IFN response in various cell types 296 might explain the cell type-specific HSV-1 countermeasures to IFN response 285. HSV-1 response to offset type 1 IFN has been reported to be elicited by HSV-1 virion host shut-off protein 300. On the contrary, HSV-1 response against type 2 IFN seems ineffective, since type 2 IFN producing monocytes/macrophages were nonpermissive to HSV-1 infection 285. Along with others, we observed that oHSV-1 efficiently replicate and lyse various tumour cells, while it fails to replicate in microglia and macrophages. Further investigations are required to verify the effect of type 2 IFN on HSV-1 for those tumour-associated immune cells. In the context of the virus-host interaction, inducing apoptosis in the virus-infected cells is another intrinsic cellular defense to limit virus spread246,247,301, which is mainly provoked by IFN 302. In response, HSV-1 encodes several genes, primarily driven by immediate early ICP27 and ICP4 303-305, to prevent the apoptosis as a method to counteract cellular defense 246,248,249,306. Our study also suggests the critical role of ICP27 in the anti-apoptotic function of HSV-1. First, we found ICP27 and not ICP4 was downregulated in nonpermissive microglia/macrophages (Figure 4.8), and those infected microglia/macrophages died after the infection without producing viral progeny (Figure 4.5). On the other hand, ICP27 is highly expressed in HSV-1 permissive tumour cells and downregulated ICP27 expression in NF-treated tumour cells is also associated with increased apoptosis (Figure 3.3). Again, no change in the level of ICP4 expression was observed in the NF-treated cells. Thus, it seems that the anti-apoptotic mechanism of HSV-1 requires ICP27 in both permissive and nonpermissive cells. The above findings demonstrated that whether ICP27 is expressed or not, it is determined by the host cells. In tumour cells, ICP27 is highly expressed, and HSV-1 replication is permitted. In microglia/macrophages, where the HSV-1 replication is not 96  permitted, the ICP27 is silenced although expression of ICP4, another essential viral transcriptional factor is still expressed normally. Moreover, we found that the activity STAT1/3 may determine ICP27 expression in a cell-type specific fashion. In HSV-1 permissive tumour cells, inhibiting phosphorylation of STAT1/3 suppresses the ICP27 expression that facilities apoptosis of the infected cells. In microglia/macrophages, on the other hand, inhibiting phosphorylation of STAT1/3 resulted in the expression of the ICP27 and turned nonpermissive cells into permissive for HSV-1 replication.     Figure 5.1 Schematic diagram of apoptosis regulation in oHSV-1 permissive and nonpermissive cells.   IFN signaling cascade is primarily regulated by the signal transducer and activator of transcription (STAT) 283. The STAT family consist of STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, and STAT6 224. Among them, STAT1, STAT2, STAT4, and STAT6 have immunoregulatory functions 224. Our demonstration of significantly enhanced 97  STAT1/3 activity following oHSV-1 infection in both microglia and glioma cells might be a common consequence of host-virus interactions. STAT1 plays a key role in cellular defense against virus infection 282,283, possibly explaining the increased activation of STAT1 after the oHSV-1 infection. On the other hand, STAT3 has received keen interest in anti-cancer research due to its anti-apoptotic function 224. Since pSTAT3 has been reported to deactivate innate immune cells 307,308 and plays a major role to prevent apoptosis, enhanced activation of STAT3 observed in the virus-infected cells might be a part of the anti-apoptosis strategy by HSV-1 to block host defense mechanism. Moreover, a recent study demonstrated that oHSV-1 replication is positively correlated with STAT3 activity 261, which supports the notion that activation of STAT3 may facilitate HSV-1 replication. The differential effects of STAT1 and 3 in HSV-1 replication as well as the cell type dependence, remain to be studied in more details. Moreover, an STAT3-specific inhibitor “Stattic” and STAT upstream JAK1 and JAK2 inhibitor “Ruxolitinib” (data not shown) also showed synergistic enhancement with oHSV-1, which confirmed our findings. However, further studies are needed to specify the targets in the JAK-STAT signalling pathway responsible for this synergy. Other STAT inhibitors may be investigated for their uses in improving the efficacy of oncolytic virotherapy. Also, since STAT is involved in cellular anti-viral mechanism for many viruses, STAT inhibition mediated therapeutic enhancement can be useful in other oncolytic virus settings. 5.3 Tumour microenvironment effect on oHSV-1 Since virus-mediated cell lysis 309 is one of the major mechanisms for the antitumour effects by OVs, numerous oncolytic virus tropism/replication enhancing molecules have been studied to stimulate its therapeutic efficacy 112. As the oHSV-1 infection stimulates the activation of innate immune cells (Figure 4.2), a significant portion of these molecules are considered as immune inhibitory molecules, which suppress the anti-viral cellular response to allow better viral replication 310-314. Our data is supported by a few 98  very recent studies that ablation of microglia/macrophages subsequently enhances the antitumour effect of oHSV-1 in the glioma bearing rodent model 269,274,312. Among various cells in heterogeneous 309 clinical GBM tumour bed, microglia/macrophages are the most abundant non-tumour cells 168,315, whose number can be further increased by following the oHSV-1 infection54. Moreover, they not only play an important role to restrict HSV-1 316,317, but also stimulate GBM growth and invasiveness 318-320. Altogether, suppressing microglia/macrophages in GBM may be especially useful for depleting tumour cells by oncolytic virotherapy successfully. However, the mechanism of microglia/macrophages and HSV-1 interaction is not completely understood. Since microglia/macrophages release a wide array of pro-inflammatory mediators, including nitrogen intermediates, cytokines, and chemokines in response to pathogen stimulation 321, one may expect that those factors released by microglia can be inhibitory to viral replication 322. Surprisingly, we could not observe any effect of microglia conditioned medium (Figure 4.3) on oHSV-1 replication. One possible explanation is that the concentration of pro-inflammatory mediators in our condition medium may not be high enough to cause direct suppression of the virus as observed by others 312. Since we do not know the concentrations of those factors released by microglia in vivo, we cannot rule out the possible anti-viral effect of these pro-inflammatory mediators released by the microglia in the tumour mass. We found that the microglia phagocytosis pathway (Figure 4.4) plays a major role in clearance of oHSV-1 323,324. After phagosome-lysosome fusion, it is likely that lysosome constituents are inactivated and eventually degrade virus particles 324. However, many pathogens such as Salmonella typhimurium, Legionella pneumophila, and Mycobacterium tuberculosis may survive inside of phagosome 325. Double-stranded DNA acanthamoeba polyphaga mimivirus has also been reported to be internalized by macrophages and subsequently replicated inside the macrophage 326. Previous studies indicated that HSV-1 gains entry into corneal fibroblasts 327 and ocular cells 328 through phagocytosis-like uptake, involved with plasma membrane protrusions to internalization and rearrangement of the actin cytoskeleton to traffic the virions in large phagosome-99  like vesicles 327. Our finding that microglia/ macrophage generate a physical barrier for the dissemination of oHSV-1 in glioma mass may be useful to understand the mechanism of their interaction. Our study only investigates the oHVS-1 interaction with microglia/macrophages; further study of oHSV-1 interaction with other GBM-associated cells may shed light on the implication of GBM microenvironment for oHSV-1 antitumour efficacy. Other innate immune cells such as NK and DC also prevent HSV-1 infection 309, and it has been recently reported that TGFβ-mediated inhibition of microglia/macrophages and/or NK cells could enhance oHSV-1 replication in glioblastoma 274. Regarding adaptive immunity, CD8+T cells play a major role in preventing HSV-1 viral spread310, and its effect on the oHSV-1 anti tumour efficacy need to be evaluated. In contrast to inhibiting anti-viral response, several studies were reported to make use of the virally stimulated host immune response 210. For example, many OVs are armed with releasable factors to stimulate an immune response, two of them are in advanced clinical development stages, the HSV-1 based talimogene laherparepvec 17 and the vaccinia virus based JX-594 329; both of them carry a GMCSF transgene to stimulate immunity in tumour microenvironment 112. Though it is expected that stimulation of immune response could prevent oncolytic virus dissemination in the tumour mass but, stimulated immune response might contribute to depleting tumour cells as well. On the other hand, too much pro-viral effect might cause a safety concern. So, a balance between the pro and anti-viral approaches would be necessary to enhance oncolytic viral therapeutic efficacy without compromising the safety (Figure 5.2). 100    Figure 5.2 Balanced approach of the present study to enhance oHSV-1 efficacy without compromising the safety.  5.4 Conclusions Even though a herpes-based oncolytic virus is currently available in the USA, pharmacies as a prescription drug to treat melanoma 16,17, its efficacy needs to be greatly improved to successfully treat other types of solid and metastatic tumours in clinics. To this end, this project successfully demonstrated possible ways to overcome the barriers of oncolytic virotherapy. Our data demonstrated the use of a novel transcriptional and translational triple regulated oncolytic amplicon oHSV-1 system without deleting any viral gene that not only increases tumour specificity but also significantly induces antitumour efficacy to eradicate glioblastoma successfully. To further enhance the antitumour property, we identified that a prescription antibiotics, nifuroxazide sensitizes oHSV-1 anti-proliferation effect by overcoming virus-mediated anti-apoptotic effect. Finally, we showed that an oxindole/imidazole derivative, C16 rescues oHSV-1 from microglia/macrophages mediated physical barrier in glioblastoma 101  by blocking the STAT activity of those nonpermissive immune cells. Eventually, this project provides a guideline for improving the therapeutic efficacy of oncolytic herpes virotherapy to make it more therapeutically effective in clinics without compromising the safety.                           102  Bibliography  1 Marumoto, T. & Saya, H. Molecular Biology of Glioma. Glioma 746, 2-11 (2012). 2 Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine 352, 987-996 (2005). 3 Sarkaria, J. N. et al. Mechanisms of chemoresistance to alkylating agents in malignant glioma. Clinical Cancer Research 14, 2900-2908 (2008). 4 Gunther, W., Pawlak, E., Damasceno, R., Arnold, H. & Terzis, A. J. Temozolomide induces apoptosis and senescence in glioma cells cultured as multicellular spheroids. British journal of cancer 88, 463-469 (2003). 5 Zhang, J., Stevens, M. F. G., Laughton, C. A., Madhusudan, S. & Bradshaw, T. D. Acquired resistance to temozolomide in glioma cell lines: molecular mechanisms and potential translational applications. Oncology 78, 103-114 (2010). 6 Advani, S. J. et al. Increased oncolytic efficacy for high-grade gliomas by optimal integration of ionizing radiation into the replicative cycle of HSV-1. Gene therapy 18, 1098-1102 (2011). 7 Bay, J. O. et al. Does high•dose carmustine increase overall survival in supratentorial high•grade malignant glioma? An EBMT retrospective study. International journal of cancer 120, 1782-1786 (2007). 8 Sarkaria J.N. et al. Mechanisms of chemoresistance to alkylating agents in malignant glioma. Clinical Cancer Research 14, 2900-2908 (2008). 9 Chen, C. H., Chang, Y. J., Ku, M. S. B., Chung, K. T. & Yang, J. T. Enhancement of temozolomide-induced apoptosis by valproic acid in human glioma cell lines through redox regulation. Journal of molecular medicine 89, 303-315 (2011). 10 Jiang, G. et al. A novel approach to overcome temozolomide resistance in glioma and melanoma: Inactivation of MGMT by gene therapy. Biochemical and Biophysical Research Communications (2011). 103  11 Back, J. H. et al. Cancer cell survival following DNA damage-mediated premature senescence is regulated by mammalian target of rapamycin (mTOR)-dependent inhibition of sirtuin 1. Journal of Biological Chemistry (2011). 12 Delwar, Z. M., Avramidis, D., Siden, Å., Cruz, M. H. & Yakisich, J. S. Depletion of drug-surviving glioma cells by a second phase treatment with low concentration of salinomycin. Drugs and Therapy Studies 1, e7 (2011). 13 Sabisz, M. & Skladanowski, A. Cancer stem cells and escape from drug-induced premature senescence in human lung tumor cells: implications for drug resistance and in vitro drug screening models. Cell cycle (Georgetown, Tex.) 8, 3208 (2009). 14 Chang, B. D. et al. A senescence-like phenotype distinguishes tumor cells that undergo terminal proliferation arrest after exposure to anticancer agents. Cancer research 59, 3761 (1999). 15 Collado, M. & Serrano, M. Senescence in tumours: evidence from mice and humans. Nature Reviews Cancer 10, 51-57 (2010). 16 Sheridan, C. Amgen announces oncolytic virus shrinks tumors. Nature biotechnology 31, 471-472 (2013). 17 Andtbacka, R. H. et al. Talimogene laherparepvec improves durable response rate in patients with advanced melanoma. Journal of Clinical Oncology, JCO. 2014.2058. 3377 (2015). 18 Parato, K. A., Senger, D., Forsyth, P. A. & Bell, J. C. Recent progress in the battle between oncolytic viruses and tumours. Nature Reviews Cancer 5, 965-976 (2005). 19 Benencia, F. & Coukos, G. Biological therapy with oncolytic herpesvirus. Advances in experimental medicine and biology 622, 221-233 (2008). 20 Alain, T. et al. The oncolytic effect in vivo of reovirus on tumour cells that have survived reovirus cell killing in vitro. Br J Cancer 95, 1020-1027 (2006). 21 Breitbach, C. J. et al. Targeted inflammation during oncolytic virus therapy severely compromises tumor blood flow. Molecular therapy : the journal of the American Society of Gene Therapy 15, 1686-1693 (2007). 104  22 Aghi, M. K., Liu, T. C., Rabkin, S. & Martuza, R. L. Hypoxia enhances the replication of oncolytic herpes simplex virus. Molecular therapy : the journal of the American Society of Gene Therapy 17, 51-56 (2009). 23 Hotte, S. J. et al. An optimized clinical regimen for the oncolytic virus PV701. Clinical cancer research : an official journal of the American Association for Cancer Research 13, 977-985 (2007). 24 Allen, C. et al. Interleukin-13 displaying retargeted oncolytic measles virus strains have significant activity against gliomas with improved specificity. Molecular therapy : the journal of the American Society of Gene Therapy 16, 1556-1564 (2008). 25 Smith, B. F. et al. Administration of a conditionally replicative oncolytic canine adenovirus in normal dogs. Cancer Biother Radiopharm 21, 601-606 (2006). 26 Alonso, M. M. et al. Combination of the oncolytic adenovirus ICOVIR-5 with chemotherapy provides enhanced anti-glioma effect in vivo. Cancer gene therapy 14, 756-761 (2007). 27 Carpenter, A. et al. Effects of ammonium tetrathiomolybdate, an oncolytic/angiolytic drug on the viability and proliferation of endothelial and tumor cells. Inflamm Res 56, 515-519 (2007). 28 Wodarz, D. Use of oncolytic viruses for the eradication of drug-resistant cancer cells. J R Soc Interface 6, 179-186 (2009). 29 Cripe, T. P., Wang, P. Y., Marcato, P., Mahller, Y. Y. & Lee, P. W. Targeting cancer-initiating cells with oncolytic viruses. Molecular therapy : the journal of the American Society of Gene Therapy 17, 1677-1682 (2009). 30 Norman, K. L., Farassati, F. & Lee, P. W. Oncolytic viruses and cancer therapy. Cytokine Growth Factor Rev 12, 271-282 (2001).  105  31 Lilley, C. E., Carson, C. T., Muotri, A. R., Gage, F. H. & Weitzman, M. D. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc Natl Acad Sci U S A 102, 5844-5849 (2005). 32 Morton, E. R. & Blaho, J. A. Herpes simplex virus blocks Fas-mediated apoptosis independent of viral activation of NF-kappaB in human epithelial HEp-2 cells. J Interferon Cytokine Res 27, 365-376, doi:10.1089/jir.2006.0143 (2007). 33 Esfandiarei, M. et al. Protein kinase B/Akt regulates coxsackievirus B3 replication through a mechanism which is not caspase dependent. Journal of virology 78, 4289-4298 (2004). 34 Gregory, D., Hargett, D., Holmes, D., Money, E. & Bachenheimer, S. L. Efficient replication by herpes simplex virus type 1 involves activation of the IkappaB kinase-IkappaB-p65 pathway. Journal of virology 78 (2004). 35 Breitbach, C. J. et al. Oncolytic vaccinia virus disrupts tumor-associated vasculature in humans. Cancer research 73, 1265-1275 (2013). 36 Benencia, F., Courreges, M. C., Fraser, N. W. & Coukos, G. Herpes virus oncolytic therapy reverses tumor immune dysfunction and facilitates tumor antigen presentation. Cancer biology & therapy 7 (2008). 37 Schulz, O. et al. Toll-like receptor 3 promotes cross-priming to virus-infected cells. Nature 433, 887-892 (2005). 38 Hodge, R. V. & Field, H. J. Antiviral agents for herpes simplex virus. Adv Pharmacol 67, 1-38 (2013). 39 Taylor, T., Brockman, M., McNamee, E. & Knipe, D. Herpes simplex virus. Frontiers in bioscience: a journal and virtual library 7, d752-764 (2002). 40 Wollmann, G., Ozduman, K. & van den Pol, A. N. Oncolytic Virus Therapy of Glioblastoma Multiforme–Concepts and Candidates. Cancer journal (Sudbury, Mass.) 18, 69 (2012).  106  41 Varghese, S. & Rabkin, S. D. Oncolytic herpes simplex virus vectors for cancer virotherapy. Cancer gene therapy 9, 967-978 (2002). 42 Lee, C. Y. F. et al. Transcriptional and translational dual-regulated oncolytic herpes simplex virus type 1 for targeting prostate tumors. Molecular Therapy 18, 929-935 (2010). 43 Ning, J. & Wakimoto, H. Oncolytic herpes simplex virus-based strategies: toward a breakthrough in glioblastoma therapy.  (2014). 44 Agarwalla, P. K. & Aghi, M. K. Oncolytic herpes simplex virus engineering and preparation. Methods in molecular biology (Clifton, NJ) 797, 1-19 (2012). 45 Kaur, B., Chiocca, E. A. & Cripe, T. P. Oncolytic HSV-1 virotherapy: clinical experience and opportunities for progress. Current pharmaceutical biotechnology 13, 1842 (2012). 46 Martuza, R. L., Malick, A., Markert, J. M., Ruffner, K. L. & Coen, D. M. Experimental therapy of human glioma by means of a genetically engineered virus mutant. Science 252, 854-856 (1991). 47 Goldstein, D. J. & Weller, S. K. Herpes simplex virus type 1-induced ribonucleotide reductase activity is dispensable for virus growth and DNA synthesis: isolation and characterization of an ICP6 lacZ insertion mutant. Journal of virology 62, 196-205 (1988). 48 YOON, S. S. et al. An oncolytic herpes simplex virus type 1 selectively destroys diffuse liver metastases from colon carcinoma. The FASEB Journal 14, 301-311 (2000). 49 Mineta, T., Rabkin, S. D. & Martuza, R. L. Treatment of malignant gliomas using ganciclovir-hypersensitive, ribonucleotide reductase-deficient herpes simplex viral mutant. Cancer Research 54, 3963-3966 (1994). 50 Aghi, M., Visted, T., Depinho, R. & Chiocca, E. Oncolytic herpes virus with defective ICP6 specifically replicates in quiescent cells with homozygous genetic mutations in p16. Oncogene 27, 4249-4254 (2008).  107  51 Kanai, R. et al. Oncolytic Virus-Mediated Manipulation of DNA Damage Responses: Synergy With Chemotherapy in Killing Glioblastoma Stem Cells. Journal of the National Cancer Institute 104, 42-55 (2012). 52 Mineta, T., Rabkin, S. D., Yazaki, T., Hunter, W. D. & Martuza, R. L. Attenuated multi–mutated herpes simplex virus–1 for the treatment of malignant gliomas. Nature medicine 1, 938-943 (1995). 53 Kooby, D. A. et al. Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207). The FASEB journal 13, 1325-1334 (1999). 54 Markert, J. M. et al. Phase Ib trial of mutant herpes simplex virus G207 inoculated pre-and post-tumor resection for recurrent GBM. Molecular Therapy 17, 199-207 (2009). 55 Markert, J. et al. Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene therapy 7, 867-874 (2000). 56 Markert, J. M. et al. Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene therapy 7, 867-874 (2000). 57 Mineta, T., Rabkin, S. D., Yazaki, T., Hunter, W. D. & Martuza, R. L. Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nature medicine 1, 938-943 (1995). 58 Yazaki, T., Manz, H. J., Rabkin, S. D. & Martuza, R. L. Treatment of human malignant meningiomas by G207, a replication-competent multimutated herpes simplex virus 1. Cancer research 55, 4752 (1995). 59 Kim, J. H. et al. Systemic armed oncolytic and immunologic therapy for cancer with JX-594, a targeted poxvirus expressing GM-CSF. Molecular therapy 14, 361-370 (2006).  108  60 Kirn, D. H., Wang, Y., Le Boeuf, F., Bell, J. & Thorne, S. H. Targeting of interferon-beta to produce a specific, multi-mechanistic oncolytic vaccinia virus. PLoS medicine 4, e353 (2007). 61 Liu, T. C., Hwang, T. H., Bell, J. C. & Kirn, D. H. Translation of targeted oncolytic virotherapeutics from the lab into the clinic, and back again: a high-value iterative loop. Molecular Therapy 16, 1006-1008 (2008). 62 Wakimoto, H. et al. Human glioblastoma–derived cancer stem cells: establishment of invasive glioma models and treatment with oncolytic herpes simplex virus vectors. Cancer research 69, 3472-3481 (2009). 63 Wong, J., Lee, C., Zhang, K., S Rennie, P. & Jia, W. Targeted oncolytic herpes simplex viruses for aggressive cancers. Current pharmaceutical biotechnology 13, 1786-1794 (2012). 64 Todo, T., Martuza, R. L., Rabkin, S. D. & Johnson, P. A. Oncolytic herpes simplex virus vector with enhanced MHC class I presentation and tumor cell killing. Proceedings of the National Academy of Sciences 98, 6396-6401 (2001). 65 Omuro, A. & DeAngelis, L. M. Glioblastoma and other malignant gliomas: a clinical review. Jama 310, 1842-1850 (2013). 66 Delwar, Z., Wong, J. W. J. & Jia, W. W. Potency of oncolytic herpers virotherapy is hindered by microglia barrrier in glioblastoma multiforme in-vitro. 7th International Oncolytic Viruses Meeting Poster #65 (2013). 67 Charles, N. A., Holland, E. C., Gilbertson, R., Glass, R. & Kettenmann, H. The brain tumor microenvironment. Glia 60, 502-514 (2012). 68 Fulci, G. et al. Cyclophosphamide enhances glioma virotherapy by inhibiting innate immune responses. Proceedings of the National Academy of Sciences 103, 12873-12878 (2006). 69 Burke, J. M. et al. A first in human phase 1 study of CG0070, a GM-CSF expressing oncolytic adenovirus, for the treatment of nonmuscle invasive bladder cancer. J Urol 188, 2391-2397 (2012). 109  70 Dinney, C. P. et al. Phase I trial of intravesical recombinant adenovirus mediated interferon-alpha2b formulated in Syn3 for Bacillus Calmette-Guerin failures in nonmuscle invasive bladder cancer. J Urol 190, 850-856 (2013). 71 Small, E. J. et al. A phase I trial of intravenous CG7870, a replication-selective, prostate-specific antigen-targeted oncolytic adenovirus, for the treatment of hormone-refractory, metastatic prostate cancer. Molecular therapy : the journal of the American Society of Gene Therapy 14, 107-117 (2006). 72 Ramesh, N. et al. CG0070, a conditionally replicating granulocyte macrophage colony-stimulating factor--armed oncolytic adenovirus for the treatment of bladdercancer. Clinical cancer research : an official journal of the American Association for Cancer Research 12, 305-313 (2006). 73 Pandha, H. et al. Oncolytic immunotherapy for the treatment of Non-Muscle Invasive Bladder Cancer using intravesical Coxsackievirus A21: Phase I/II CANON study. 9th International conference on oncolytic virus therapeutics 2015, P-5 (2015). 74 Waldhauer, I. & Steinle, A. NK cells and cancer immunosurveillance. Oncogene 27, 5932-5943 (2008). 75 Breitbach, C. J. et al. Targeted inflammation during oncolytic virus therapy severely compromises tumor blood flow. Molecular Therapy 15, 1686-1693 (2007). 76 Prestwich, R. J. et al. The case of oncolytic viruses versus the immune system: waiting on the judgment of Solomon. Human gene therapy 20, 1119-1132 (2009). 77 Small, E. J. et al. A Phase I Trial of Intravenous CG7870, a Replication-Selective, Prostate-Specific Antigen–Targeted Oncolytic Adenovirus, for the Treatment of Hormone-Refractory, Metastatic Prostate Cancer. Molecular Therapy 14, 107-117 (2006). 78 Shafren, D. et al. Combination of a novel oncolytic immunotherapeutic agent, CAVATAK (coxsackievirus A21) and immune-checkpoint blockade significantly 110  reduces tumor growth and improves survival in an immune competent mouse melanoma model. Journal for immunotherapy of cancer 2, P125 (2014). 79 de Gruijl, T. D., Janssen, A. B. & van Beusechem, V. W. Arming oncolytic viruses to leverage antitumor immunity. Expert Opin Biol Ther 15 (2015). 80 Woller, N., Gurlevik, E., Ureche, C. I., Schumacher, A. & Kuhnel, F. Oncolytic viruses as anticancer vaccines. Front Oncol 4, 188, doi:10.3389/fonc.2014.00188 (2014). 81 Pol, J. et al. Trial Watch:: Oncolytic viruses for cancer therapy. Oncoimmunology 3, e28694 (2014). 82 Zamarin, D. et al. Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci Transl Med 6, 226ra232 (2014). 83 Jiang, H. et al. Delta-24-RGD oncolytic adenovirus elicits anti-glioma immunity in an immunocompetent mouse model. PLoS One 9, e97407 (2014). 84 Thirukkumaran, C. M. et al. Oncolytic viral therapy for prostate cancer: efficacy of reovirus as a biological therapeutic. Cancer research 70, 2435-2444 (2010). 85 Liu, T.-C., Galanis, E. & Kirn, D. Clinical trial results with oncolytic virotherapy: a century of promise, a decade of progress. Nature clinical practice Oncology 4, 101-117 (2007). 86 Yang, C. T. et al. Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells. Gene therapy 10, 1494-1502 (2003). 87 Lee, C. Y. et al. Transcriptional and translational dual-regulated oncolytic herpes simplex virus type 1 for targeting prostate tumors. Molecular therapy : the journal of the American Society of Gene Therapy 18, 929-935 (2010). 88 Lee, C. Y., Rennie, P. S. & Jia, W. W. MicroRNA regulation of oncolytic herpes simplex virus-1 for selective killing of prostate cancer cells. Clinical cancer 111  research : an official journal of the American Association for Cancer Research 15, 5126-5135 (2009). 89 Zhu, Z. B. et al. Survivin promoter-based conditionally replicative adenoviruses target cholangiocarcinoma. International journal of oncology 29, 1319-1329 (2006). 90 Lee, C. Y., Bu, L., Rennie, P. & Jia, W. W. An HSV-1 amplicon system for prostate-specific expression of ICP4 to complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells. Cancer gene therapy 14, 652-660 (2007). 91 Lee, C. Y., Bu, L. X., Rennie, P. S. & Jia, W. W. An HSV-1 amplicon system for prostate-specific expression of ICP4 to complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells. Cancer gene therapy 14, 652-660 (2007). 92 Leber, M. F. et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy 19, 1097-1106 (2011). 93 Fu, X., Rivera, A., Tao, L., De Geest, B. & Zhang, X. Construction of an oncolytic herpes simplex virus that precisely targets hepatocellular carcinoma cells. Molecular Therapy 20, 339-346 (2012). 94 Graff, J. R., Konicek, B. W., Carter, J. H. & Marcusson, E. G. Targeting the eukaryotic translation initiation factor 4E for cancer therapy. Cancer research 68, 631-634 (2008). 95 De Benedetti, A. & Graff, J. R. eIF-4E expression and its role in malignancies and metastases. Oncogene 23, 3189-3199 (2004). 96 Fan, S. et al. Phosphorylated eukaryotic translation initiation factor 4 (eIF4E) is elevated in human cancer tissues. Cancer biology & therapy 8, 1463-1469, doi:8960 [pii] (2009). 97 De Benedetti, A. & Harris, A. L. eIF4E expression in tumors: its possible role in progression of malignancies. The international journal of biochemistry & cell biology 31, 59-72 (1999). 112   98 Van Der Velden, A. W. & Thomas, A. A. M. The role of the 5'untranslated region of an mRNA in translation regulation during development. The international journal of biochemistry & cell biology 31, 87-106 (1999). 99 Zimmer, S. G., DeBenedetti, A. & Graff, J. R. Translational control of malignancy: the mRNA cap-binding protein, eIF-4E, as a central regulator of tumor formation, growth, invasion and metastasis. Anticancer research 20, 1343-1351 (2000). 100 Mazzacurati, L. et al. Use of miRNA response sequences to block off-target replication and increase the safety of an unattenuated, glioblastoma-targeted oncolytic HSV. Molecular Therapy 23, 99-107 (2015). 101 Mishima, Y. et al. Translational inhibition by deadenylation-independent mechanisms is central to microRNA-mediated silencing in zebrafish. Proceedings of the National Academy of Sciences 109, 1104-1109 (2012). 102 Turner, J. D. et al. The many roles of microRNAs in brain tumor biology. Neurosurgical focus 28, 3 (2010). 103 Karsy, M., Arslan, E. & Moy, F. Current progress on understanding microRNAs in glioblastoma multiforme. Genes & cancer 3, 3-15 (2012). 104 Kasinski, A. L. & Slack, F. J. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy. Nature Reviews Cancer 11, 849-864 (2011). 105 Medina, P. P. & Slack, F. J. microRNAs and cancer. Cell cycle 7, 2485-2492 (2008). 106 Silber, J. et al. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC medicine 6, 14 (2008). 107 Smirnova, L. et al. Regulation of miRNA expression during neural cell specification. European Journal of Neuroscience 21, 1469-1477 (2005). 108 Rybak, A. et al. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nature cell biology 10, 987-993 (2008). 113  109 Lagos-Quintana, M. et al. Identification of tissue-specific microRNAs from mouse. Current Biology 12, 735-739 (2002). 110 Kapsimali, M. et al. MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol 8, R173 (2007). 111 Fowler, A. et al. miR-124a is frequently down-regulated in glioblastoma and is involved in migration and invasion. European Journal of Cancer 47, 953-963 (2011). 112 Delwar, Z., Zhang, K., Rennie, P. S. & Jia, W. Oncolytic virotherapy for urological cancers. Nature Reviews Urology 13, 334-352 (2016).  113 Conner, J., Braidwood, L. & Brown, S. A strategy for systemic delivery of the oncolytic herpes virus HSV1716: redirected tropism by antibody-binding sites incorporated on the virion surface as a glycoprotein D fusion protein. Gene therapy 15, 1579-1592 (2008). 114 Uchida, H. et al. Effective treatment of an orthotopic xenograft model of human glioblastoma using an EGFR-retargeted oncolytic herpes simplex virus. Molecular Therapy 21, 561-569 (2013). 115 Russell, S. J., Peng, K.-W. & Bell, J. C. Oncolytic virotherapy. Nature biotechnology 30, 658-670 (2012). 116 Harrington, K. J. et al. Phase I/II study of oncolytic HSVGM-CSF in combination with radiotherapy and cisplatin in untreated stage III/IV squamous cell cancer of the head and neck. Clinical Cancer Research 16, 4005-4015 (2010). 117 Eager, R. & Nemunaitis, J. Clinical development directions in oncolytic viral therapy. Cancer gene therapy 18, 305-317 (2011). 118 Heo, J. et al. Sequential therapy with JX-594, a targeted oncolytic poxvirus, followed by sorafenib in hepatocellular carcinoma: preclinical and clinical demonstration of combination efficacy. Molecular Therapy 19, 1170-1179 (2011). 119 Nguyen, A., Ho, L. & Wan, Y. Chemotherapy and Oncolytic Virotherapy: Advanced Tactics in the War against Cancer. Front Oncol 4, 145, doi:10.3389/fonc.2014.00145 (2014). 114  120 Heinemann, L. et al. Synergistic effects of oncolytic reovirus and docetaxel chemotherapy in prostate cancer. BMC Cancer 11, 221 (2011). 121 Advani, S. J. et al. Preferential replication of systemically delivered oncolytic vaccinia virus in focally irradiated glioma xenografts. Clinical cancer research : an official journal of the American Association for Cancer Research 18, 2579-2590 (2012). 122 Bolyard, C. et al. Doxorubicin synergizes with 34.5 ENVE to enhance antitumor efficacy against metastatic ovarian cancer. Clinical Cancer Research 20, 6479-6494 (2014). 123 Ottolino-Perry, K., Diallo, J.-S., Lichty, B. D., Bell, J. C. & McCart, J. A. Intelligent design: combination therapy with oncolytic viruses. Molecular Therapy 18, 251-263 (2010). 124 Aghi, M., Rabkin, S. & Martuza, R. L. Effect of chemotherapy-induced DNA repair on oncolytic herpes simplex viral replication. J Natl Cancer Inst 98, 38-50 (2006). 125 Bazan-Peregrino, M., Arvanitis, C. D., Rifai, B., Seymour, L. W. & Coussios, C. C. Ultrasound-induced cavitation enhances the delivery and therapeutic efficacy of an oncolytic virus in an in vitro model. Journal of controlled release : official journal of the Controlled Release Society 157, 235-242 (2012). 126 Advani, S. J. et al. Increased oncolytic efficacy for high-grade gliomas by optimal integration of ionizing radiation into the replicative cycle of HSV-1. Gene therapy 18, 1098-1102 (2011). 127 Aghi, M., Rabkin, S. & Martuza, R. L. Oncolytic herpes simplex virus mutants exhibit enhanced replication in glioma cells evading temozolomide chemotherapy through deoxyribonucleic acid repair. Clin Neurosurg 53, 65-76 (2006). 128 Lin, S. F. et al. Synergy of a herpes oncolytic virus and paclitaxel for anaplastic thyroid cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 14, 1519-1528 (2008). 115  129 Bennett, J. J. et al. Up-regulation of GADD34 mediates the synergistic anticancer activity of mitomycin C and a gamma134.5 deleted oncolytic herpes virus (G207). FASEB J 18, 1001-1003 (2004). 130 Kanai, R. et al. Effect of gamma34.5 deletions on oncolytic herpes simplex virus activity in brain tumors. Journal of virology 86, 4420-4431 (2012). 131 Wennier, S. T., Liu, J. & McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Curr Pharm Biotechnol 13, 1817-1833 (2012). 132 Touchefeu, Y., Vassaux, G. & Harrington, K. J. Oncolytic viruses in radiation oncology. Radiother Oncol 99, 262-270 (2011). 133 Ottolino-Perry, K., Diallo, J. S., Lichty, B. D., Bell, J. C. & McCart, J. A. Intelligent design: combination therapy with oncolytic viruses. Molecular therapy : the journal of the American Society of Gene Therapy 18, 251-263 (2010). 134 Harrington, K. J. et al. Phase I/II study of oncolytic HSV GM-CSF in combination with radiotherapy and cisplatin in untreated stage III/IV squamous cell cancer of the head and neck. Clinical cancer research : an official journal of the American Association for Cancer Research 16, 4005-4015 (2010). 135 Harrington, K. J., Melcher, A., Vassaux, G., Pandha, H. S. & Vile, R. G. Exploiting synergies between radiation and oncolytic viruses. Current opinion in molecular therapeutics 10, 362-370 (2008). 136 Sei, S. et al. Synergistic antitumor activity of oncolytic reovirus and chemotherapeutic agents in non-small cell lung cancer cells. Mol Cancer 8, 47 (2009). 137 Siurala, M. et al. Oncolytic adenovirus and doxorubicin-based chemotherapy results in synergistic antitumor activity against soft-tissue sarcoma. International journal of cancer. Journal international du cancer (2014). 138 Cerullo, V. et al. Immunological effects of low-dose cyclophosphamide in cancer patients treated with oncolytic adenovirus. Molecular therapy : the journal of the American Society of Gene Therapy 19, 1737-1746 (2011). 116  139 Currier, M. A. et al. Efficacy and safety of the oncolytic herpes simplex virus rRp450 alone and combined with cyclophosphamide. Molecular therapy : the journal of the American Society of Gene Therapy 16, 879-885 (2008).  140 Di Paolo, N. C. et al. Effect of adenovirus-mediated heat shock protein expression and oncolysis in combination with low-dose cyclophosphamide treatment on antitumor immune responses. Cancer research 66, 960-969 (2006). 141 Eiselein, J. E., Biggs, M. W. & Walton, J. R. Treatment of transplanted murine tumors with an oncolytic virus and cyclophosphamide. Cancer research 38, 3817-3822 (1978). 142 Hasegawa, N. et al. Cyclophosphamide enhances antitumor efficacy of oncolytic adenovirus expressing uracil phosphoribosyltransferase (UPRT) in immunocompetent Syrian hamsters. International journal of cancer. Journal international du cancer 133, 1479-1488 (2013). 143 Hofmann, E., Weibel, S. & Szalay, A. A. Combination treatment with oncolytic Vaccinia virus and cyclophosphamide results in synergistic antitumor effects in human lung adenocarcinoma bearing mice. Journal of translational medicine 12, 197 (2014). 144 Kambara, H., Saeki, Y. & Chiocca, E. A. Cyclophosphamide allows for in vivo dose reduction of a potent oncolytic virus. Cancer research 65 (2005). 145 Lamfers, M. L. et al. Cyclophosphamide increases transgene expression mediated by an oncolytic adenovirus in glioma-bearing mice monitored by bioluminescence imaging. Molecular therapy : the journal of the American Society of Gene Therapy 14, 779-788 (2006). 146 Lun, X. Q. et al. Efficacy of systemically administered oncolytic vaccinia virotherapy for malignant gliomas is enhanced by combination therapy with rapamycin or cyclophosphamide. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 2777-2788 (2009). 117  147 Qiao, J. et al. Cyclophosphamide facilitates antitumor efficacy against subcutaneous tumors following intravenous delivery of reovirus. Clinical cancer research : an official journal of the American Association for Cancer Research 14, 259-269 (2008). 148 Kolb, E. A. et al. A phase I trial and viral clearance study of reovirus (Reolysin) in children with relapsed or refractory extra‐ cranial solid tumors: A Children's Oncology Group Phase I Consortium report. Pediatric blood & cancer 62, 751-758 (2015). 149 Uhlman, M. A., Bing, M. T. & Lubaroff, D. M. Prostate cancer vaccines in combination with additional treatment modalities. Immunol Res 59, 236-242 (2014). 150 Kottke, T. et al. Precise scheduling of chemotherapy primes VEGF-producing tumors for successful systemic oncolytic virotherapy. Molecular therapy : the journal of the American Society of Gene Therapy 19, 1802-1812 (2011). 151 Prinz, M. & Priller, J. Microglia and brain macrophages in the molecular age: from origin to neuropsychiatric disease. Nature Reviews Neuroscience 15, 300-312 (2014). 152 Michell-Robinson, M. A. et al. Roles of microglia in brain development, tissue maintenance and repair. Brain 138, 1138-1159 (2015). 153 Watters, J. J., Schartner, J. M. & Badie, B. Microglia function in brain tumors. Journal of neuroscience research 81, 447-455 (2005). 154 Graeber, M. B., Scheithauer, B. W. & Kreutzberg, G. W. Microglia in brain tumors. Glia 40, 252-259 (2002). 155 Jakeman, P. G., Hills, T. E., Fisher, K. D. & Seymour, L. W. Macrophages and their interactions with oncolytic viruses. Current opinion in pharmacology 24, 23-29 (2015). 156 Parker, J. N. et al. Engineered herpes simplex virus expressing IL-12 in the treatment of experimental murine brain tumors. Proceedings of the National Academy of Sciences 97, 2208-2213 (2000). 118   157 Kleijn, A. et al. The in vivo therapeutic efficacy of the oncolytic adenovirus Delta24-RGD is mediated by tumor-specific immunity. PloS one 9, e97495 (2014). 158 Li, W. & Graeber, M. B. The molecular profile of microglia under the influence of glioma. Neuro-oncology, nos116 (2012). 159 MacMicking, J., Xie, Q.-w. & Nathan, C. Nitric oxide and macrophage function. Annual review of immunology 15, 323-350 (1997). 160 Boehm, U., Klamp, T., Groot, M. & Howard, J. Cellular responses to interferon-γ. Annual review of immunology 15, 749-795 (1997). 161 Gordon, S. Alternative activation of macrophages. Nature reviews immunology 3, 23-35 (2003). 162 Kaku, Y. et al. M2 macrophage marker CD163, CD204 and CD206 expression on alveolar macrophages in the lung of patients with chronic obstructive pulmonary. European Respiratory Journal 44, P1481 (2014). 163 Charles, N. A., Holland, E. C., Gilbertson, R., Glass, R. & Kettenmann, H. The brain tumor microenvironment. Glia 59, 1169-1180 (2011). 164 Li, W. & Graeber, M. B. The molecular profile of microglia under the influence of glioma. Neuro-oncology 14, 958-978 (2012). 165 Roggendorf, W., Strupp, S. & Paulus, W. Distribution and characterization of microglia/macrophages in human brain tumors. Acta neuropathologica 92, 288-293 (1996). 166 Zhu, X., Fujita, M., Snyder, L. A. & Okada, H. Systemic delivery of neutralizing antibody targeting CCL2 for glioma therapy. Journal of neuro-oncology 104, 83-92 (2011). 167 Morantz, R. A., Wood, G. W., Foster, M., Clark, M. & Gollahon, K. Macrophages in experimental and human brain tumors. Journal of neurosurgery 50, 305-311 (1979). 119  168 Wood, G. W. & Morantz, R. A. Immunohistologic evaluation of the lymphoreticular infiltrate of human central nervous system tumors. Journal of the National Cancer Institute 62, 485-491 (1979). 169 Badie, B. & Schartner, J. M. Flow cytometric characterization of tumor-associated macrophages in experimental gliomas. Neurosurgery 46, 957-962 (2000). 170 Suzumura, A., Sawada, M., Yamamoto, H. & Marunouchi, T. Transforming growth factor-beta suppresses activation and proliferation of microglia in vitro. The Journal of Immunology 151, 2150-2158 (1993). 171 Pollard, J. W. Tumour-educated macrophages promote tumour progression and metastasis. Nature Reviews Cancer 4, 71-78 (2004). 172 Sica, A., Schioppa, T., Mantovani, A. & Allavena, P. Tumour-associated macrophages are a distinct M2 polarised population promoting tumour progression: potential targets of anti-cancer therapy. European Journal of Cancer 42, 717-727 (2006). 173 Komohara, Y., Ohnishi, K., Kuratsu, J. & Takeya, M. Possible involvement of the M2 anti‐ inflammatory macrophage phenotype in growth of human gliomas. The Journal of pathology 216, 15-24 (2008). 174 Kohanbash, G. & Okada, H. Myeloid-derived suppressor Cells (MDSCs) in gliomas and glioma-development. Immunological Investigations 41, 658-679 (2012). 175 Hu, J. C. et al. A phase I study of OncoVEXGM-CSF, a second-generation oncolytic herpes simplex virus expressing granulocyte macrophage colony-stimulating factor. Clinical Cancer Research 12, 6737-6747 (2006). 176 Kaufman, H. L. et al. Local and distant immunity induced by intralesional vaccination with an oncolytic herpes virus encoding GM-CSF in patients with stage IIIc and IV melanoma. Annals of surgical oncology 17, 718-730 (2010). 177 Senzer, N. N. et al. Phase II clinical trial of a granulocyte-macrophage colony-stimulating factor–encoding, second-generation oncolytic herpesvirus in patients with unresectable metastatic melanoma. Journal of Clinical Oncology 27, 5763-5771 (2009). 120  178 Fong, Y. et al. A herpes oncolytic virus can be delivered via the vasculature to produce biologic changes in human colorectal cancer. Molecular Therapy 17, 389-394 (2009). 179 Wen, P. Y. & Kesari, S. Malignant gliomas in adults. New England Journal of Medicine 359, 492-507 (2008). 180 Zhang, X., Zhang, W., Cao, W.-D., Cheng, G. & Zhang, Y.-Q. Glioblastoma multiforme: Molecular characterization and current treatment strategy (Review). Experimental and therapeutic medicine 3, 9-14 (2012). 181 Smith, T. T., Roth, J. C., Friedman, G. K. & Gillespie, G. Y. Oncolytic viral therapy: targeting cancer stem cells. Oncolytic virotherapy 2014, 21 (2014). 182 Campadelli‐ Fiume, G. et al. Rethinking herpes simplex virus: the way to oncolytic agents. Reviews in medical virology 21, 213-226 (2011). 183 Todo, T. et al. Systemic antitumor immunity in experimental brain tumor therapy using a multimutated, replication-competent herpes simplex virus. Human gene therapy 10, 2741-2755 (1999). 184 Chiocca, E. A. Oncolytic viruses. Nature Reviews Cancer 2, 938-950 (2002). 185 Lee, C. Y. et al. Transcriptional and translational dual-regulated oncolytic herpes simplex virus type 1 for targeting prostate tumors. Molecular Therapy 18, 929-935 (2010). 186 Lee, C. Y., Rennie, P. S. & Jia, W. W. MicroRNA regulation of oncolytic herpes simplex virus-1 for selective killing of prostate cancer cells. Clinical Cancer Research 15, 5126-5135 (2009). 187 Fukuda, S. & Pelus, L. M. Survivin, a cancer target with an emerging role in normal adult tissues. Molecular cancer therapeutics 5, 1087-1098 (2006). 188 Zhu, Z. B. et al. Transcriptional targeting of tumors with a novel tumor-specific survivin promoter. Cancer gene therapy 11, 256-262 (2004). 189 Li, B. et al. A survivin‐ mediated oncolytic adenovirus induces non‐ apoptotic cell death in lung cancer cells and shows antitumoral potential in vivo. The journal of gene medicine 8, 1232-1242 (2006). 121  190 Ulasov, I. V. et al. Oncolytic adenoviral vectors which employ the survivin promoter induce glioma oncolysis via a process of beclin-dependent autophagy. International journal of oncology 34, 729-742 (2009). 191 Van Houdt, W. J. et al. The human survivin promoter: a novel transcriptional targeting strategy for treatment of glioma. Journal of neurosurgery 104, 583-592 (2006). 192 Ulasov, I. V. et al. Oncolytic adenoviral vectors which employ the survivin promoter induce glioma oncolysis via a process of beclin-dependent autophagy. International journal of oncology 34, 729 (2009). 193 Kanwar, J. R., Kamalapuram, S. K. & Kanwar, R. K. Targeting survivin in cancer: patent review. Expert opinion on therapeutic patents 20, 1723-1737 (2010). 194 Lu, B. et al. Survivin as a therapeutic target for radiation sensitization in lung cancer. Cancer research 64, 2840 (2004). 195 Kanwar, R. K., A Cheung, C. H., Chang, J. Y. & Kanwar, J. R. Recent advances in anti-survivin treatments for cancer. Current medicinal chemistry 17, 1509-1515 (2010). 196 Xu, R. et al. Sp1 and Sp3 regulate basal transcription of the survivin gene. Biochemical and biophysical research communications 356, 286-292 (2007). 197 Kato, J. et al. Expression of survivin in esophageal cancer: correlation with the prognosis and response to chemotherapy. International journal of cancer 95, 92-95 (2001). 198 Ambrosini, G., Adida, C. & Altieri, D. C. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nature medicine 3, 917-921 (1997). 199 Chakravarti, A. et al. Quantitatively determined survivin expression levels are of prognostic value in human gliomas. Journal of Clinical Oncology 20, 1063-1068 (2002). 200 Tu, S. P. et al. Suppression of survivin expression inhibits in vivo tumorigenicity and angiogenesis in gastric cancer. Cancer research 63, 7724-7732 (2003). 201 Zhen, H. N. et al. Survivin expression and its relation with proliferation, apoptosis, and angiogenesis in brain gliomas. Cancer 104, 2775-2783 (2005). 122  202 Kajiwara, Y. et al. Expression of survivin in astrocytic tumors. Cancer 97, 1077-1083 (2003). 203 Xie, D. et al. Expression of cytoplasmic and nuclear Survivin in primary and secondary human glioblastoma. British journal of cancer 94, 108-114 (2006). 204 Gu, X., Jones, L., Lowery-Norberg, M. & Fowler, M. Expression of eukaryotic initiation factor 4E in astrocytic tumors. Applied Immunohistochemistry & Molecular Morphology 13, 178-183 (2005). 205 Ponomarev, E. D., Veremeyko, T., Barteneva, N., Krichevsky, A. M. & Weiner, H. L. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-[alpha]-PU. 1 pathway. Nature medicine 17, 64-70 (2011). 206 Medina, P. P. & Slack, F. J. microRNAs and cancer: an overview. Cell cycle 7, 2485-2492 (2008). 207 Godlewski, J., Newton, H., Chiocca, E. & Lawler, S. MicroRNAs and glioblastoma; the stem cell connection. Cell Death & Differentiation 17, 221-228 (2010). 208 Skalsky, R. L. & Cullen, B. R. Reduced expression of brain-enriched microRNAs in glioblastomas permits targeted regulation of a cell death gene. PloS one 6, e24248 (2011). 209 Huang, C. et al. Demonstration of different modes of cell death upon herpes simplex virus 1 infection in different types of oral cells. Acta Virol 49, 7-15 (2005). 210 Fukuhara, H. & Todo, T. Oncolytic herpes simplex virus type 1 and host immune responses. Current cancer drug targets 7, 149-155 (2007). 211 Kyriazis, A. A. & Kyriazis, A. P. Preferential sites of growth of human tumors in nude mice following subcutaneous transplantation. Cancer research 40, 4509-4511 (1980). 212 Belizário, J. E. Immunodeficient mouse models: an overview. Open Immunol J 2, 79-85 (2009). 123  213 Zeier, Z. et al. A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system. Journal of neurovirology 15, 411-424 (2009). 214 Bischoff, J. R. et al. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-376 (1996). 215 Coffey, M. C., Strong, J. E., Forsyth, P. A. & Lee, P. W. Reovirus therapy of tumors with activated Ras pathway. Science 282, 1332-1334 (1998). 216 Kaufman, H. L., Kohlhapp, F. J. & Zloza, A. Oncolytic viruses: a new class of immunotherapy drugs. Nature Reviews Drug Discovery 14, 642-662 (2015). 217 Aghi, M., Rabkin, S. & Martuza, R. L. Effect of chemotherapy-induced DNA repair on oncolytic herpes simplex viral replication. Journal of the National Cancer Institute 98, 38-50 (2006). 218 Verma, U. et al. New uses for old drugs: Novel therapeutic options. Indian Journal of Pharmacology 37, 279 (2005). 219 Dodin, A. & Guillou, M. Sensitivity of diarrhea organisms to nifuroxazide. Bulletin de la Société de pathologie exotique et de ses filiales 77, 295 (1984). 220 Bulbulović-Telalbasić, S. [Effects of nifuroxazide (Ercefuryl), trimethoprim-sulfamethoxazole and bactisubtil in acute diarrhea]. Medicinski arhiv 45, 105-107 (1990). 221 Nelson, E. A. et al. Nifuroxazide inhibits survival of multiple myeloma cells by directly inhibiting STAT3. Blood 112, 5095-5102 (2008). 222 Yang, F. et al. Nifuroxazide induces apoptosis and impairs pulmonary metastasis in breast cancer model. Cell death & disease 6, e1701 (2015). 223 Zhu, Y. et al. Nifuroxazide exerts potent anti-tumor and anti-metastasis activity in melanoma. Scientific Reports 6, 20253 (2016). 224 O'Shea, J. J., Holland, S. M. & Staudt, L. M. JAKs and STATs in immunity, immunodeficiency, and cancer. New England Journal of Medicine 368, 161-170 (2013). 225 Nordén R1, Nyström K, Olofsson S.Activation of host antiviral RNA-sensing factors necessary for herpes simplex virus type 1-activated transcription of host 124  cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent expression of sLe(x) in virus-infected cells. Glycobiology 7, 776-88 (2009) 226 Kim, J. E., Patel, M., Ruzevick, J., Jackson, C. M. & Lim, M. STAT3 activation in glioblastoma: biochemical and therapeutic implications. Cancers 6, 376-395 (2014). 227 Khodarev, N. N., Roizman, B. & Weichselbaum, R. R. Molecular pathways: interferon/stat1 pathway: role in the tumor resistance to genotoxic stress and aggressive growth. Clinical Cancer Research 18, 3015-3021 (2012). 228 Rickardson, L. et al. Identification of molecular mechanisms for cellular drug resistance by combining drug activity and gene expression profiles. British journal of cancer 93, 483-492 (2005). 229 Roberts, D. et al. Identification of genes associated with platinum drug sensitivity and resistance in human ovarian cancer cells. British journal of cancer 92, 1149-1158 (2005). 230 Stronach, E. A. et al. HDAC4-regulated STAT1 activation mediates platinum resistance in ovarian cancer. Cancer research 71, 4412-4422 (2011). 231 Patterson, S. et al. Novel role of Stat1 in the development of docetaxel resistance in prostate tumor cells. Oncogene 25, 6113-6122 (2006). 232 Coen, D. M., Goldstein, D. J. & Weller, S. K. Herpes simplex virus ribonucleotide reductase mutants are hypersensitive to acyclovir. Antimicrobial agents and chemotherapy 33, 1395-1399 (1989). 233 Ikeda, K. et al. Oncolytic virus therapy of multiple tumors in the brain requires suppression of innate and elicited antiviral responses. Nature medicine 5, 881-887 (1999). 234 Chou, J., Chen, J.-J., Gross, M. & Roizman, B. Association of a M (r) 90,000 phosphoprotein with protein kinase PKR in cells exhibiting enhanced phosphorylation of translation initiation factor eIF-2 alpha and premature shutoff of protein synthesis after infection with gamma 134.5-mutants of herpes simplex virus 1. Proceedings of the National Academy of Sciences 92, 10516-10520 (1995). 125  235 He, B., Gross, M. & Roizman, B. The γ134. 5 protein of herpes simplex virus 1 complexes with protein phosphatase 1α to dephosphorylate the α subunit of the eukaryotic translation initiation factor 2 and preclude the shutoff of protein synthesis by double-stranded RNA-activated protein kinase. Proceedings of the National Academy of Sciences 94, 843-848 (1997). 236 Lin, S.-F. et al. Synergy of a herpes oncolytic virus and paclitaxel for anaplastic thyroid cancer. Clinical Cancer Research 14, 1519-1528 (2008). 237 Chahlavi, A., Todo, T., Martuza, R. L. & Rabkin, S. D. Replication-competent herpes simplex virus vector G207 and cisplatin combination therapy for head and neck squamous cell carcinoma. Neoplasia 1, 162-169 (1999). 238 Toyoizumi, T. et al. Combined therapy with chemotherapeutic agents and herpes simplex virus type 1 ICP34. 5 mutant (HSV-1716) in human non-small cell lung cancer. Human gene therapy 10, 3013-3029 (1999). 239 Nawa, A. et al. Oncolytic viral therapy for human ovarian cancer using a novel replication-competent herpes simplex virus type I mutant in a mouse model. Gynecologic oncology 91, 81-88 (2003). 240 Cinatl, J. et al. Potent oncolytic activity of multimutated herpes simplex virus G207 in combination with vincristine against human rhabdomyosarcoma. Cancer research 63, 1508-1514 (2003). 241 Bennett, J. J. et al. Up-regulation of GADD34 mediates the synergistic anticancer activity of mitomycin C and a γ134. 5 deleted oncolytic herpes virus (G207). The FASEB journal 18, 1001-1003 (2004). 242 Nguyen, A., Ho, L. & Wan, Y. Chemotherapy and oncolytic virotherapy: advanced tactics in the war against cancer. Harnessing Oncolytic Virus-mediated Antitumor Immunity, 101 (2015). 243 Walker, S. R., Xiang, M. & Frank, D. A. Distinct roles of STAT3 and STAT5 in the pathogenesis and targeted therapy of breast cancer. Molecular and cellular endocrinology 382, 616-621 (2014). 244 Zhu, Y. et al. Nifuroxazide exerts potent anti-tumor and anti-metastasis activity in melanoma. Scientific reports 6 (2016). 126  245 Meuris, B. Observational study of travelers' diarrhea. Journal of travel medicine 2, 11-15 (1995). 246 Nguyen, M. L. & Blaho, J. A. Cellular players in the herpes simplex virus dependent apoptosis balancing act. Viruses 1, 965-978 (2009). 247 Koyama, A. H., Adachi, A. & Irie, H. Physiological significance of apoptosis during animal virus infection. International reviews of immunology 22, 341-359 (2003). 248 Cassens, U. et al. Viral modulation of cell death by inhibition of caspases. Archivum immunologiae et therapiae experimentalis 51, 19-27 (2003). 249 Gillet, G. & Brun, G. Viral inhibition of apoptosis. Trends in microbiology 4, 312-317 (1996). 250 Boya, P. et al. Viral proteins targeting mitochondria: controlling cell death. Biochimica et Biophysica Acta (BBA)-Bioenergetics 1659, 178-189 (2004). 251 Pawlowski, J. & Kraft, A. S. Bax-induced apoptotic cell death. Proceedings of the National Academy of Sciences 97, 529-531 (2000). 252 Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K. & Elledge, S. J. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75, 805-816 (1993). 253 Hui, L. et al. p38α suppresses normal and cancer cell proliferation by antagonizing the JNK–c-Jun pathway. Nature genetics 39, 741-749 (2007). 254 Mao, Z. G. et al. TRAIL-induced apoptosis of human melanoma cells involves activation of caspase-4. Apoptosis 15, 1211-1222 (2010). 255 Waring, P. & Müllbacher, A. Cell death induced by the Fas/Fas ligand pathway and its role in pathology. Immunology and cell biology 77, 312-317 (1999). 256 Morton, E. R. & Blaho, J. A. Herpes simplex virus blocks Fas-mediated apoptosis independent of viral activation of NF-κB in human epithelial HEp-2 cells. Journal of Interferon & Cytokine Research 27, 365-376 (2007). 257 Horvath, C. M. & Darnell, J. The antiviral state induced by alpha interferon and gamma interferon requires transcriptionally active Stat1 protein. Journal of virology 70, 647-650 (1996). 127  258 Mikloska, Z. & Cunningham, A. L. Alpha and gamma interferons inhibit herpes simplex virus type 1 infection and spread in epidermal cells after axonal transmission. Journal of virology 75, 11821-11826 (2001). 259 Croker, B. A., Kiu, H. & Nicholson, S. E. in Seminars in cell & developmental biology.  414-422 (Elsevier). 260 Yasukawa, H. et al. The JAK‐ binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. The EMBO journal 18, 1309-1320 (1999). 261 Okemoto, K. et al. STAT3 activation promotes oncolytic HSV1 replication in glioma cells. PloS one 8, e71932 (2013). 262 Guo, S. et al. Isocryptotanshinone, a STAT3 inhibitor, induces apoptosis and pro-death autophagy in A549 lung cancer cells. Journal of drug targeting, 1-28 (2016). 263 Aoki, Y., Feldman, G. M. & Tosato, G. Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma. Blood 101, 1535-1542 (2003). 264 Zhang, J., Stevens, M. F., Laughton, C. A., Madhusudan, S. & Bradshaw, T. D. Acquired resistance to temozolomide in glioma cell lines: molecular mechanisms and potential translational applications. Oncology 78, 103-114 (2010). 265 Liu, T.-C., Galanis, E. & Kirn, D. Clinical trial results with oncolytic virotherapy: a century of promise, a decade of progress. Nature clinical practice. Oncology 4, 101 (2007). 266 Lamfers, M. L. et al. Cyclophosphamide increases transgene expression mediated by an oncolytic adenovirus in glioma-bearing mice monitored by bioluminescence imaging. Molecular Therapy 14, 779-788 (2004). 267 Wakimoto, H., Fulci, G., Tyminski, E. & Chiocca, E. A. Altered expression of antiviral cytokine mRNAs associated with cyclophosphamide's enhancement of viral oncolysis. Gene therapy 11, 214-223 (2004). 128  268 Friedman, A., Tian, J. P., Fulci, G., Chiocca, E. A. & Wang, J. Glioma virotherapy: effects of innate immune suppression and increased viral replication capacity. Cancer research 66, 2314-2319 (2006). 269 Fulci, G. et al. Depletion of peripheral macrophages and brain microglia increases brain tumor titers of oncolytic viruses. Cancer research 67, 9398-9406 (2007). 270 Ingrand, S. et al. The oxindole/imidazole derivative C16 reduces in vivo brain PKR activation. FEBS letters 581, 4473-4478 (2007). 271 Ni, M. & Aschner, M. Neonatal rat primary microglia: isolation, culturing, and selected applications. Current Protocols in Toxicology, 12.17. 11-12.17. 16 (2010). 272 Eubank, T. D. et al. GM-CSF inhibits breast cancer growth and metastasis by invoking an anti-angiogenic program in tumor-educated macrophages. Cancer research 69, 2133 (2009). 273 Shukla, D., Dal Canto, M. C., Rowe, C. L. & Spear, P. G. Striking similarity of murine nectin-1α to human nectin-1α (HveC) in sequence and activity as a glycoprotein D receptor for alphaherpesvirus entry. Journal of virology 74, 11773-11781 (2000). 274 Han, J. et al. TGFβ Treatment Enhances Glioblastoma Virotherapy by Inhibiting the Innate Immune Response. Cancer research 75, 5273-5282 (2015). 275 Rice, S. & Knipe, D. Gene-specific transactivation by herpes simplex virus type 1 alpha protein ICP27. Journal of virology 62, 3814-3823 (1988). 276 Jean, S., LeVan, K. M., Song, B., Levine, M. & Knipe, D. M. Herpes simplex virus 1 ICP27 is required for transcription of two viral late (γ2) genes in infected cells. Virology 283, 273-284 (2001). 277 Sacks, W. R., Greene, C. C., Aschman, D. P. & Schaffer, P. A. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. Journal of virology 55, 796-805 (1985). 278 Cole, J. L. Activation of PKR: an open and shut case? Trends in biochemical sciences 32, 57-62 (2007). 129  279 Melchjorsen, J., Matikainen, S. & Paludan, S. R. Activation and evasion of innate antiviral immunity by herpes simplex virus. Viruses 1, 737-759 (2009). 280 Peters, G. A., Khoo, D., Mohr, I. & Sen, G. C. Inhibition of PACT-mediated activation of PKR by the herpes simplex virus type 1 Us11 protein. Journal of virology 76, 11054-11064 (2002). 281 Bose, A. et al. Modulation of tau phosphorylation by the kinase PKR: implications in Alzheimer's disease. Brain Pathology 21, 189-200 (2011). 282 Katze, M. G., He, Y. & Gale, M. Viruses and interferon: a fight for supremacy. Nature Reviews Immunology 2, 675-687 (2002). 283 García-Sastre, A. & Biron, C. A. Type 1 interferons and the virus-host relationship: a lesson in detente. Science 312, 879-882 (2006). 284 Hutchins, A. P. et al. Distinct transcriptional regulatory modules underlie STAT3’s cell type-independent and cell type-specific functions. Nucleic acids research 41, 2155-2170 (2013). 285 Yokota, S.-i. et al. Herpes simplex virus type 1 suppresses the interferon signaling pathway by inhibiting phosphorylation of STATs and janus kinases during an early infection stage. Virology 286, 119-124 (2001). 286 Melchjorsen, J., Siren, J., Julkunen, I., Paludan, S. R. & Matikainen, S. Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-κB and IRF-3. Journal of General Virology 87, 1099-1108 (2006). 287 Esaki, S., Rabkin, S. D., Martuza, R. L. & Wakimoto, H. Transient fasting enhances replication of oncolytic herpes simplex virus in glioblastoma. American journal of cancer research 6, 300 (2016). 288 Huang, T., Savontaus, M., Shinozaki, K., Sauter, B. & Woo, S. Telomerase-dependent oncolytic adenovirus for cancer treatment. Gene therapy 10, 1241-1247 (2003). 130  289 Yang, C. et al. Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells. Gene therapy 10, 1494-1502 (2003). 290 Zhang, K. et al. Intravesical treatment of advanced urothelial bladder cancers with oncolytic HSV-1 co-regulated by differentially expressed microRNAs. Gene therapy (2016). 291 Michael, N., Spector, D., Mavromara-Nazos, P., Kristie, T. & Roizman, B. The DNA-binding properties of the major regulatory protein a4 of herpes simplex viruses. Science 239, 1531-1534 (1988). 292 Michael, N. & Roizman, B. Binding of the herpes simplex virus major regulatory protein to viral DNA. Proceedings of the National Academy of Sciences 86, 9808-9812 (1989). 293 Wysocka, J. & Herr, W. The herpes simplex virus VP16-induced complex: the makings of a regulatory switch. Trends in biochemical sciences 28, 294-304 (2003). 294 Smith, S. & Weller, S. K. HSV-I and the cellular DNA damage response. Future virology 10, 383-397 (2015). 295 Platanias, L. C. Mechanisms of type-I-and type-II-interferon-mediated signalling. Nature Reviews Immunology 5, 375-386 (2005). 296 Preston, C. M., Harman, A. N. & Nicholl, M. J. Activation of interferon response factor-3 in human cells infected with herpes simplex virus type 1 or human cytomegalovirus. Journal of virology 75, 8909-8916 (2001). 297 Paladino, P. & Mossman, K. L. Mechanisms employed by herpes simplex virus 1 to inhibit the interferon response. Journal of Interferon & Cytokine Research 29, 599-608 (2009). 298 Miiller, U. et al. Functional role of type I and type II interferons in antiviral defense. Science 264, 1918-1921 (1994). 299 Darwich, L. et al. Secretion of interferon‐ γSecretion of interferon I and type II interferon‐ cell level after costimulation with interleukin (IL)‐ 12 plus IL‐ 18. Immunology 126, 386-393 (2009). 131  300 Duerst, R. J. & Morrison, L. A. Herpes simplex virus 2 virion host shutoff protein interferes with type I interferon production and responsiveness. Virology 322, 158-167 (2004). 301 Barber, G. N. Host defense, viruses and apoptosis. Cell Death & Differentiation 8 (2001). 302 Tanaka, N. et al. Type I interferons are essential mediators of apoptotic death in virally infected cells. Genes to Cells 3, 29-37 (1998). 303 Munger, J. & Roizman, B. The US3 protein kinase of herpes simplex virus 1 mediates the posttranslational modification of BAD and prevents BAD-induced programmed cell death in the absence of other viral proteins. Proceedings of the National Academy of Sciences 98, 10410-10415 (2001). 304 Leopardi, R. & Roizman, B. The herpes simplex virus major regulatory protein ICP4 blocks apoptosis induced by the virus or by hyperthermia. Proceedings of the National Academy of Sciences 93, 9583-9587 (1996). 305 Aubert, M. & Blaho, J. A. The herpes simplex virus type 1 regulatory protein ICP27 is required for the prevention of apoptosis in infected human cells. Journal of virology 73, 2803-2813 (1999). 306 Uren, A. G. & Vaux, D. L. Viral inhibitors of apoptosis. Vitamins & Hormones 53, 175-193 (1997). 307 Lang, R. Tuning of macrophage responses by Stat3-inducing cytokines: molecular mechanisms and consequences in infection. Immunobiology 210, 63-76 (2005). 308 Takeda, K. et al. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10, 39-49 (1999). 309 Inda, M.-d.-M., Bonavia, R. & Seoane, J. Glioblastoma multiforme: a look inside its heterogeneous nature. Cancers 6, 226-239 (2014). 310 Chew, T., Taylor, K. E. & Mossman, K. L. Innate and adaptive immune responses to herpes simplex virus. Viruses 1, 979-1002 (2009). 132  311 Habu, S., Akamatsu, K., Tamaoki, N. & Okumura, K. In vivo significance of NK cell on resistance against virus (HSV-1) infections in mice. The Journal of Immunology 133, 2743-2747 (1984). 312 Meisen, W. H. et al. The impact of macrophage-and microglia-secreted TNFα on oncolytic HSV-1 therapy in the glioblastoma tumor microenvironment. Clinical Cancer Research 21, 3274-3285 (2015). 313 Otsuki, A. et al. Histone deacetylase inhibitors augment antitumor efficacy of herpes-based oncolytic viruses. Molecular Therapy 16, 1546-1555 (2008). 314 Law, B. K. Rapamycin: an anti-cancer immunosuppressant? Critical reviews in oncology/hematology 56, 47-60 (2005). 315 Morantz, R. A., Wood, G. W., Foster, M., Clark, M. & Gollahon, K. Macrophages in experimental and human brain tumors: part 2: studies of the macrophage content of human brain tumors. Journal of neurosurgery 50, 305-311 (1979). 316 Ellermann-Eriksen, S. Macrophages and cytokines in the early defence against herpes simplex virus. Virology journal 2, 1 (2005). 317 Cheng, H. et al. Role of macrophages in restricting herpes simplex virus type 1 growth after ocular infection. Investigative ophthalmology & visual science 41, 1402-1409 (2000). 318 Bettinger, I., Thanos, S. & Paulus, W. Microglia promote glioma migration. Acta neuropathologica 103, 351-355 (2002). 319 Markovic, D. S., Glass, R., Synowitz, M., van Rooijen, N. & Kettenmann, H. Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. Journal of Neuropathology & Experimental Neurology 64, 754-762 (2005). 320 Badie, B. & Schartner, J. Role of microglia in glioma biology. Microscopy research and technique 54, 106-113 (2001). 321 Mariani, M. M. & Kielian, T. Microglia in infectious diseases of the central nervous system. Journal of Neuroimmune Pharmacology 4, 448-461 (2009). 133  322 Meisen, W. H. et al. The impact of macrophage and microglia secreted TNFα on oncolytic HSV-1 therapy in the glioblastoma tumor microenvironment. Clinical Cancer Research, clincanres. 3118.2014 (2015). 323 Van Strijp, J. et al. Phagocytosis of herpes simplex virus by human granulocytes and monocytes. Archives of virology 104, 287-298 (1989). 324 Van Strijp, J. A. et al. Degradation of herpes simplex virions by human polymorphonuclear leukocytes and monocytes. Journal of general virology 71, 1205-1209 (1990). 325 Aderem, A. & Underhill, D. M. Mechanisms of phagocytosis in macrophages. Annual review of immunology 17, 593-623 (1999). 326 Ghigo, E. et al. Ameobal pathogen mimivirus infects macrophages through phagocytosis. PLoS pathogens 4, e1000087 (2008). 327 Clement, C. et al. A novel role for phagocytosis-like uptake in herpes simplex virus entry. The Journal of cell biology 174, 1009-1021 (2006). 328 Tiwari, V. & Shukla, D. Nonprofessional Phagocytosis Can Facilitate Herpesvirus Entry into Ocular Cells. Clinical and Developmental Immunology 2012 (2012). 329 Heo, J. et al. Randomized dose-finding clinical trial of oncolytic immunotherapeutic vaccinia JX-594 in liver cancer. Nature medicine 19, 329-336 (2013).         

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0340475/manifest

Comment

Related Items