Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Anti-inflammatory role of IDO and tryptophan metabolites Salimi Elizei, Sanam 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_november_salimielizei_sanam.pdf [ 37.7MB ]
Metadata
JSON: 24-1.0314175.json
JSON-LD: 24-1.0314175-ld.json
RDF/XML (Pretty): 24-1.0314175-rdf.xml
RDF/JSON: 24-1.0314175-rdf.json
Turtle: 24-1.0314175-turtle.txt
N-Triples: 24-1.0314175-rdf-ntriples.txt
Original Record: 24-1.0314175-source.json
Full Text
24-1.0314175-fulltext.txt
Citation
24-1.0314175.ris

Full Text

ANTI-INFLAMMATORY ROLE OF IDO AND TRYPTOPHAN METABOLITES by  Sanam Salimi Elizei  B.Sc., Alzahra University, Tehran, Iran, 2002  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENT FOR THE DEGREE OF  Doctor of Philosophy in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2016  ©Sanam Salimi Elizei 2016 ii   Abstract Inflammation is essential to the establishment of homeostasis following injury and inflammatory cell and the cytokine network associate with tissue repair. However, sometimes inflammation can cause further inflammation; it can become self-perpetuating. One of the many possibilities of prolonged secre-tion of cytokines and growth factor is autoimmunity and delay in wound closure. The current anti-inflammatory treatment modalities vary however their adverse effects are common. Here we asked the question of whether Kynurenine (Kyn), one of the tryptophan (Trp) metabolite, could modulate the inflammation by altering the profile of the key pro-inflammatory cytokines as well as the proliferation of immune cells. We showed that Kyn treatment significantly reduced some pro-inflammatory cytokines and chemokines such as IL-17, IL-2, CXCL-9 and CXCL-10 in ConA+ Kyn-treated splenocytes. To validate our findings in a wound healing model, we also showed that topical application of Kyn cream resulted in fewer infiltration of CD3+ T cells at wound site. Further, in this study we used kynurenic acid (KynA) instead of Kyn as KynA is the end product and safer metabolites in the kynurenine pathway. The empha-sis was given in evaluating the effect of KynA on expression of IL-17/IL-23 axis which has recently been identified to be very important in the immunopathogenesis of autoimmune diseases and inflammation such as psoriasis. Our findings have shown that KynA can modulate the frequency of IL-23 and IL-17 by DCs and CD4+ cells. Moreover, we showed that KynA suppresses the production of IL-23 in DCs through GPCR35 activation. We then evaluated the therapeutic use of intra-lesional injection of IDO-expressing fibroblasts, as a source of Kyn and KynA production in psoriasis, which is one of the most common re-current chronic inflammatory diseases of the skin. The findings of this work demonstrated that IDO-expressing cells significantly improved thickness, erythema, and scaling scores in skin psoriatic like con-dition. Moreover, IDO-expressing fibroblasts reduce infiltration of IL-17+ CD4+, IL-17+ γδ+ T cells, IL-23+-activated dendritic cells and granulocytes in skin psoriatic like condition. The findings presented in this thesis collectively prove the potent local immunosuppressive activity of IDO-expressing dermal fibroblast and tryptophan metabolites in skin inflammatory conditions. iii   Preface The work presented in this thesis has already been published in peer reviewed journals, or submitted and under review by peer-reviewed journals. As the first author of all of the publications shown below I was responsible for designing and performing the experiments, data analysis and manuscript preparation. Distribution of the work is as follows: Chapter 2: Complete and unmodified submission to the Wound Repair Regeneration, 2015 Jan;23(1):90-7. Sanam Salimi Elizei, Malihe-Sadat Poormasjedi-Meibod, Yunyuan Li, Reza B. Jalili, Aziz Ghahary. “Effects of Kyn on CD3+ and Macrophages in Wound Healing”. Sanam Salimi Elizei was the project lead and performed all the experiments, alone or in collaboration with the co-authors, in addition to writing the first draft of the manuscript and performing the subsequent revisions. Malihe-Sadat Poormasjedi-Meibod assisted with the qPCR, animal surgery in addition to manuscript editing. Yunyuan Li assisted with project design. Raza B. Jalili assisted with animal surgery and manuscript review. Aziz Ghahary supervised the project and assisted with manuscript review and editing. Chapter 3: Complete and unmodified submission to Journal. Sanam Salimi Elizei, Malihe-Sadat Poormasjedi-Meibod, Xia Wang, Maryam Kheirandish, Aziz Ghahary. “KynA Down Regulates IL-17/1L-23 Axis in vitro”. Sanam Salimi Elizei was the project lead and performed all the experiments, alone or in collaboration with the co-authors, in addition to writing the first draft of the manuscript and performing the subsequent revisions. Malihe-Sadat Poormasjedi-Meibod assisted with performing qPCR. Xia Wang assisted with animal handling. Maryam Kheirandish assisted with immunocytochemistry. Aziz Ghahary supervised the project and assisted with manuscript review and editing. Chapter 4: Complete and unmodified submission to Journal. Sanam Salimi Elizei, MohammadReza Pakyari, Mehraneh Ghoreishi, Ruhangiz Kilani, Sanaz Mahmoudi, Aziz Ghahary. “IDO Expressing Fibroblasts Suppress the Development of Imiquimod-Induced Psoriasis-Like Dermatitis”. In this work Sanam Salimi Elizei designed and performed all the experiments, alone or in collaboration with the co-authors. In addition she was responsible for writing the manuscript and performing the subsequent iv  revisions. Mehraneh Ghoreishi assisted with animal work. MohammadReza Pakyari assisted with immunostainings. Ruhangiz Taghi Kilani assisted with fibroblasts and IDO-expressing fibroblasts culturing. Aziz Ghahary supervised the project and assisted with manuscript review and editing. Dr. Aziz Ghahary was the Principle Investigator for the research project presented here. The financial support for this thesis was provided CIHR grants held by Dr. Ghahary, in addition to support from the WorkSafe BC. All methods and procedures, as well as the use of animals and tissue specimens obtained from animals and humans, are approved by both “Human and Animal Ethics Committee” of the University of British Columbia (Protocol numbers; H05-0103, A10-0147, and A10-1372).  v   Table of Contents Abstract ........................................................................................................................................................ ii	Preface ......................................................................................................................................................... iii	Table of Contents ........................................................................................................................................ v	List of Tables ............................................................................................................................................... ix	List of Figures .............................................................................................................................................. x	List of Abbreviations ................................................................................................................................. xii	Acknowledgments ..................................................................................................................................... xiv	Dedication .................................................................................................................................................. xv	Chapter 1. Introduction, Specific Aims, and Research Plans ................................................................. 1	1.1 Overview of inflammation .................................................................................................................. 1	1.2 Wound healing .................................................................................................................................... 1	1.3 Inflammation in wound healing .......................................................................................................... 3	1.4 Proliferation in wound healing ........................................................................................................... 4	1.5 Protein synthesis and wound contraction in wound healing ............................................................... 5	1.6 Remodeling in wound healing ............................................................................................................ 5	1.7 Role of T cells in wound healing ........................................................................................................ 6	1.8 Role of macrophages in wound healing .............................................................................................. 7	1.9 Immunoregulatory drugs for wound healing ...................................................................................... 8	1.9.1 Imiquimod 5% cream .................................................................................................................. 8	1.9.2 Recombinant TGF-β3 and mannose-6-phosphate ....................................................................... 8	1.9.3 Steroids ........................................................................................................................................ 8	1.9.4 IFN injections .............................................................................................................................. 9	1.9.5 Bleomycin .................................................................................................................................... 9	1.10 Psoriasis ............................................................................................................................................ 9	1.11 Psoriasis pathophysiology ............................................................................................................... 11	1.12 Role of Th17 and IL-17 in psoriasis ............................................................................................... 13	1.13 Role of dendritic cells in psoriasis .................................................................................................. 14	1.14 Treatment for psoriasis ................................................................................................................... 15	1.15 Traditional systemic therapies and side effects .............................................................................. 16	1.15.1 Psoralen and ultraviolet A ....................................................................................................... 17	1.15.2 UVB therapy ............................................................................................................................ 17	1.15.3 Methotrexate ............................................................................................................................ 17	vi  1.15.4 Cyclosporine ............................................................................................................................ 18	1.16 Biologic therapies and side effects ................................................................................................. 18	1.16.1 T cell inhibitor ......................................................................................................................... 19	1.16.2 TNF-α antagonists ................................................................................................................... 19	1.16.3 IL-17 antagonists ..................................................................................................................... 20	1.16.4 IL-12/23 antagonists ................................................................................................................ 20	1.17 Fibroblasts ....................................................................................................................................... 22	1.18 Immunoregulatory role of fibroblasts ............................................................................................. 22	1.19 Indoleamine 2,3-dioxygenase and tryptophan metabolites ............................................................. 23	1.20 Immunoregulatory role of IDO ....................................................................................................... 25	1.21 Tryptophan metabolites .................................................................................................................. 26	1.21.1 Kynurenine .............................................................................................................................. 26	1.21.2 Kynurenic acid ......................................................................................................................... 26	1.22 Hypothesis, objectives, and specific aims ...................................................................................... 27	1.22.1 Hypothesis ............................................................................................................................... 27	1.22.2 Objectives and specific aims ................................................................................................... 27	Chapter 2. Effects of Kyn on CD3+ and Macrophages in Wound Healing .......................................... 28	2.1 Introduction ....................................................................................................................................... 28	2.2 Materials and methods ...................................................................................................................... 29	2.2.1 Ethics statement ......................................................................................................................... 29	2.2.2 Cell culture ................................................................................................................................ 29	2.2.3 Cytokines and chemokines Proteome Profiler™ Antibody Array ............................................ 30	2.2.4 Quantitative analyses of cytokines expressed by kynurenine-treated splenocytes .................... 30	2.2.5 Detection of Th-17 cells in Kyn-treated splenocytes ................................................................ 31	2.2.6 Splenocyte proliferation assay ................................................................................................... 32	2.2.7 Wound creation and treatment scheme ...................................................................................... 32	2.2.8 Immune cells extraction and flow cytometry analysis .............................................................. 33	2.2.9 Statistical analysis ...................................................................................................................... 33	2.3 Results ............................................................................................................................................... 33	2.3.1 Kyn treatment modulates the production of cytokines and chemokines in splenocytes ........... 33	2.3.2 Inhibition of Th17 cells in response to Kyn treatment .............................................................. 37	2.3.3 Inhibitory effect of Kyn on skin wound infiltrated CD3+ T cells and macrophages ................. 39	2.4 Discussion ......................................................................................................................................... 42	vii  Chapter 3. Kynurenic Acid Down Regulates IL-17/1L-23 Axis in vitro ............................................... 45	3.1 Introduction ....................................................................................................................................... 45	3.2 Material and methods ........................................................................................................................ 47	3.2.1 Materials .................................................................................................................................... 47	3.2.2 Bone marrow preparation .......................................................................................................... 47	3.2.3 Dendritic cells isolation and culture .......................................................................................... 48	3.2.4 T cell isolation and culture ........................................................................................................ 48	3.2.5 Quantitative real-time PCR analysis .......................................................................................... 48	3.2.6 Flow cytometric analysis ........................................................................................................... 49	3.2.7 Determination of cAMP levels in DCs ...................................................................................... 50	3.2.8 Statistical analysis ...................................................................................................................... 51	3.2.9 Ethics statement ......................................................................................................................... 51	3.3 Results ............................................................................................................................................... 51	3.4 Discussion ......................................................................................................................................... 60	Chapter 4. IDO-expressing Fibroblasts Suppress the Development of Imiquimod-induced Psoriasis-like Dermatitis ....................................................................................................................................... 63	4.1 Introduction ....................................................................................................................................... 63	4.2 Material and methods ........................................................................................................................ 65	4.2.1 Preparation of IDO-expressing fibroblasts ................................................................................ 65	4.2.2 Mice and treatment .................................................................................................................... 65	4.2.3 Flow cytometry .......................................................................................................................... 66	4.2.4 Histological analyses and immunostainings .............................................................................. 66	4.3 Statistical analysis ............................................................................................................................. 67	4.4 Results ............................................................................................................................................... 67	4.4.1 Intra-lesional injection of IDO-expressing fibroblasts improves clinical appearance of psoriasis ........................................................................................................................................................ 67	4.4.2 Skin thickness reduces in psoriatic animal treated with IDO-expressing fibroblasts ................ 73	4.4.3 Intra-lesional injection of IDO-expressing fibroblasts reduces infiltration of granulocytes and macrophages ................................................................................................................................... 76	4.4.4 IDO-expressing fibroblasts result in decreased number of IL-17-producing cells in the skin, ear, and lymph nodes of IMQ-treated mice ................................................................................... 80	4.4.5 Decreased IL-17-producing cell infiltration by IDO cell therapy was associated with decreased IL-23-producing DCs frequency .................................................................................................... 85	viii  4.5 Conclusion ........................................................................................................................................ 87	Chapter 5. Conclusions and Suggestions for Future Research ............................................................. 91	5.1 Suggestions for future work .............................................................................................................. 95	Bibliography .............................................................................................................................................. 97  ix   List of Tables Table 1-1. Timeline of psoriasis pathophysiology development ............................................................ 11 Table 1-2. Biologic agents used in the treatment of psoriasis ................................................................ 21 Table 3-1. Summary of primer sequences  .............................................................................................. 31    x   List of Figures Figure 1-1. Wound healing phases in acute wounds  ............................................................................... 2 Figure 1-2. Inflammatory cell infiltration  ................................................................................................ 4 Figure 1-3. The histopathology of psoriasis  ........................................................................................... 12 Figure 1-4. Pathophysiology psoriasis  .................................................................................................... 13 Figure 1-5. The Kynurenine pathway of tryptophan degradation  ...................................................... 24 Figure 2-1. Proteome Profiler™ Antibody Array of splenocytes. ........................................................ 35 Figure 2-2. The pro-inflammatory cytokines and chemokines gene expression was quantified by qPCR analysis (*P < 0.01, n = 3)  ......................................................................................................... 36 Figure 2-3. Flow cytometry analysis of IL-17+ cells in splenocytes ....................................................... 38 Figure 2-4 A. Flow cytometry evaluation of infiltration of skin wound by CD3+ T cells and macrophages .......................................................................................................................................... 40 Figure 2-4 B. Flow cytometry evaluation of infiltration of skin wound by CD3+ T cells and macrophages .......................................................................................................................................... 41 Figure 3-1. The effect of different LPS concentrations on IL-23p19 gene expression in dendritic cells. ........................................................................................................................................................ 53 Figure 3-2. The effect of different concentrations of KynA on the gene expression of IL-23p19 in active dendritic cells .............................................................................................................................. 54 Figure 3-3. Flow cytometry analysis for the effect of KynA (100 µg/mL) on activated IL-23-producing dendritic cells ...................................................................................................................... 55 Figure 3-4. Flow cytometry analysis for the effect of KynA (100 µg/mL) on Th17 cells .................... 57 Figure 3-5 A. Analyzing the mechanism by which KynA suppress LPS-induced IL-23p19 production in DCs ................................................................................................................................. 59 Figure 3-5 B and C. Analyzing the mechanism by which KynA suppress LPS-induced IL-23p19 production in DCs ................................................................................................................................. 60 Figure 4-1 A. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream .................................................................................................................. 70 Figure 4-1 B and C. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream .............................................................................................. 71 Figure 4-1 D and E. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream .............................................................................................. 72 Figure 4-1 F and G. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream .............................................................................................. 73 xi  Figure 4-2 A and B. Epidermal thickness following cell therapy ......................................................... 75 Figure 4-2 C and D. Epidermal thickness following cell therapy ......................................................... 76 Figure 4-3 A-C. Frequency of CD11b+ Gr-1+ and CD11b+ F4-80+ cells in skin, ear, and lymph nodes after cell therapy ................................................................................................................................... 79 Figure 4-3 D-F. Frequency of CD11b+ Gr-1+ and CD11b+ F4-80+ cells in skin, ear, and lymph nodes after cell therapy ................................................................................................................................... 80 Figure 4-4 A. IDO-expressing fibroblasts improved infiltration of T cells in skin, ear, and lymph node of psoriatic mice ........................................................................................................................... 83 Figure 4-4 B-E. IDO-expressing fibroblasts improved infiltration of T cells in skin, ear, and lymph node of psoriatic mice ........................................................................................................................... 84 Figure 4-5. IDO-expressing fibroblasts improved infiltration of IL-17+ CD4+ T cells in skin, ear, and lymph node of psoriatic mice ............................................................................................................... 85 Figure 4-6. Flow cytometry analysis of the percentage of IL-23+ dendritic cells in skin, ear, and lymph nodes ........................................................................................................................................... 87 xii   List of Abbreviations ANOVA Analysis of variance APC  Antigen-presenting cell B6  C57BL/6 mice BB UVB Broadband ultraviolet B BM  Bone marrow c-DNA  Complementary DNA CsA  Cyclosporine CTLA-4 Cytotoxic T-lymphocyte specific antigen 4 ddH2O  De-ionized distilled water DC  Dendritic cell DMEM  Dulbecco’s Modified Eagle Medium DNA  Deoxyribonucleic acid EGF  Epidermal growth factor FACS  Fluorescence-activated cell sorting FBS  Fetal bovine serum Fib  Fibroblasts GAPDH Glycerol-3-phosphate dehydrogenase GPCR  G protein-coupled receptor H&E   Hematoxylin and eosin HCS  Hypertrophic scars ICAM-1 Intercellular adhesion molecule 1  IDO  Indoleamine 2,3-dioxygenase IFN-γ  Interferon-gamma IL  Interleukin xiii  LFA-3  Lymphocyte function-associated antigen-3 LC  Langerhans cell MTX  Methotrexate MP  Macrophage MHC  Major histocompatibility complex MMP  Matrix metalloproteinase m-RNA Messenger ribonucleic acid MTX  Methotrexate NAD  Nicotinamide adenine dinucleotide  NB UVB Narrowband ultraviolet B NK  Natural killer PBS  Phosphate buffered saline PDGF  Platelet derived growth factor Pso  Psoriasis PUVA  Psoralen and ultraviolet A q-PCR  Quantitative-polymerase chain reaction RBC  Red blood cell RNA  Ribonucleic acid SD  Standard deviation STAT  Signal transducer and activator of transcription TCR  T-cell receptor TGF-β  Transforming growth bactor-beta TIMP  Tissue inhibitors of metalloproteinase NF-α   Tumour necrosis factor  tRNA   Transfer RNA xiv   Acknowledgments I would like to express my deepest gratitude to Dr. Aziz Ghahary for being an exceptional mentor and supervisor during the course of this project.  I am also deeply and truly appreciative of the members of my doctoral advisory committee at the University of British Columbia to, Dr. Emma Guns and Dr. Lucy Marzban, for their valuable guidance, encouragement, support, and contributions.  I would like to extend heartfelt thanks to Dr. Ruhangiz Taghi Kilani, our senior research associate and lab manger for her compassion and acting like a mother for every member of the lab. My deep gratitude to Dr. Reza B. Jalili and Dr. Yunyuan Li for their kind support and encouragement during the past 5 years. I would also like to extend heartfelt thanks to my fellow graduate students in Dr. Ghahary’s research group: Malihe-Sadat Poormasjedi-Meibod, Dr. Azadeh Hosseini-Tabatabai, Dr. Layla Nabai, Dr. Ryan Hartwell, Dr. Saman Pakyari, Ali Farrokhi, and Dr. Yun Zhang. Their friendship, support, and wisdom have improved the quality of my work and life. I acknowledge the WorkSafe BC for supporting my research. Finally and most importantly, I would like to convey my heartfelt thanks to my parents who have endured the most difficult times to provide an exceptional life for their children, to my sisters who always stood by me.  My deepest thanks to my beloved daughter who is my most precious gift from God, Avin. xv   Dedication This work is dedicated to My mother, father and my sisters (Sahar & Nasim), who have given their unending love and exceptional support throughout my life. To Dr. Aziz Ghahary and Dr. Ruhi Kilani, who have been with me every step of the way. Even  when I doubled myself, they still believed in me. Without them I would not have been able to do this. To my aunt, Lili, who has always been there for me and mean so much to me. And my daughter “Avin” who is a real angel in my life.  1  Chapter 1.  Introduction, Specific Aims, and Research Plans 1.1 Overview of inflammation Inflammation is a basic process whereby tissues of the body respond to injury. It is a protective strategy evolved in higher organisms in response to 1) pathogens such as bacteria, viruses, or fungi; 2) external injuries such as scrapes or foreign objects; 3) chemicals or radiation; and 4) diseases (1). The first known definition of the clinical symptoms of inflammation was from the Roman doctor Cornelius Celsus in the 1st century AD (2); these signs indicate an acute inflammation: redness, heat, swelling, pain, and loss of function (3). In response to a stimulant, inflammation is usually initiated within minutes in any host with a functional innate immune system. As innate immune system is the major contributor to inflammation, immune cells such as macrophages, dendritic cells, mast cells, neutrophils, and lymphocytes play important roles in inflammatory responses and their activation, leading to the production of a variety of inflammatory mediators, including chemokines and cytokines (4). Apart from immune cells, non-immune cells such as epithelial cells, endothelial cells, and fibroblasts also contribute to inflammatory processes (1). A successful acute inflammatory response results in the elimination of the infectious agents followed by a resolution and repair phase.  Whatever the cause of the inflammatory response, its “purpose” is to remove or sequester the source of the disturbance and restore tissue homeostasis. If the abnormal conditions are transient, then a successful acute inflammatory response returns the system to the basal homeostatic set points. If, by contrast, the abnormal conditions are sustained, then an ongoing inflammatory state shifts the system to progressive or persistent inflammation. One of the many possibilities of progressive inflammation is autoimmunity such as psoriasis (5), type 2 diabetes (6), and cancer (7) and also delay in wound closure, which increases the probability of developing dermal fibrotic conditions such as hypertrophic scars (8).  1.2 Wound healing A wound is defined as damage or disruption to normal anatomical structure and function. This can range from a simple break in the epithelial integrity of the skin or it can be deeper, extending into 2  subcutaneous tissue with damage to other structures such as tendons, muscles, vessels, nerves, parenchymal organs, and even bone (9). Normal wound healing is a dynamic and complex process involving a series of coordinated events including (1) inflammation, (2) cellular migration and proliferation, (3) protein synthesis and wound contraction, and (4) remodeling (10). Wound healing begins at the moment of injury and involves both resident and migratory cell populations, extracellular matrix, and the action of soluble mediators. A completely healed wound is defined as one that has been returned to a normal anatomical structure, function, and appearance of the tissue within a reasonable period of time. Most wounds are usually the result of simple injuries. However, some wounds do not heal in a timely and orderly manner resulting in chronic non-healing wounds (Figure 1-1) (11).  Figure 1-1. Wound healing phases in acute wounds (12) 3  1.3 Inflammation in wound healing Immediately following injury, innate immune cells at the site of injury initiate an inflammatory response (13). Mast cells (14), dendritic cells, macrophages (15), and γδ T cells (16) are part of the innate immune cells within the skin. In the skin, keratinocytes are often considered a part of the immune sentinel system as well, as this cell type can quickly respond to stimuli and produce several pro-inflammatory mediators (17). Following tissue injury and innate immune cell activation, the early inflammatory phase is marked by neutrophil infiltration. After neutrophil infiltration, the macrophage population within the wound begins to increase (18). In vitro studies suggest that macrophages readily appear at two different phenotypes that are dependent upon the method of activation. Classically activated macrophages or the M1 phenotype are pro-inflammatory cells that produce an array of pro-inflammatory cytokines. Alternatively, activated macrophages or the M2 phenotype are anti-inflammatory and support proliferation by producing growth factors (19). T lymphocytes arrive in the wound after neutrophils and macrophages about day 7 after injury. Their presence is at its peak during the late proliferative/early remodeling phase (Figure 1-2) (20). Within the first hour following injury, innate immune cells such as keratinocytes and macrophages produce inflammatory mediators. Further these mediators trigger vascular responses, proliferation and remodeling phase (21).   4   Figure 1-2. Inflammatory cell infiltration (8)  1.4 Proliferation in wound healing Approximately 24 hours after the initiation of cellular migration, basal cells at the wound edge and in the appendages, begin to migrate (22). The migration of epithelial cells continues until overlap is achieved with other epithelial cells migrating from different directions. At that point, “contact inhibition” results in cessation of cellular migration. The processes of cellular migration and proliferation occur under the control of various cytokines, including EGF (23,24), TGF-α, PDGF and keratinocyte growth factor (25). Some of these cytokines are derived from inflammatory cells and others derived from the epithelial cells. Cellular migration may also require the secretion of MMPs to penetrate scab (26). When contact inhibition is achieved, hemidesmosomes reform between the cells and basement membrane (27).  5  1.5 Protein synthesis and wound contraction in wound healing In 1971 Gabbiani et al. showed that contraction is characterized by a predominance of myofibroblasts, modified fibroblasts, at the wound periphery (28). The defining characteristics of myofibroblasts include actin-rich microfilaments in the cytoplasm, a multi-lobulated nucleus and abundant rough endoplasmic reticulum that can only be discerned by electron microscopy. Myofibroblasts appear 4 to 6 days after initial injury and are commonly seen in the wound during the ensuing 2 to 3 weeks. Their disappearance is via apoptosis. However, more recent work with collagen lattices has suggested that fibroblasts in the central portion of the wound may be more critical to the contraction process (29). Now it is clear that the process of wound contraction is cell mediated and does not require collagen synthesis. TGF-β and possibly other cytokines are involved in the wound contraction process (30).  1.6 Remodeling in wound healing Scar remodeling begins approximately 21 days after injury. The rate of collagen synthesis diminishes and reaches coincidence with the rate of collagen breakdown. The downregulation of collagen synthesis is mediated by interferon-ϒ (IFNϒ) (31), TNF-α (32), and collagen matrix itself (33). Matrix metalloproteinases (MMPs) are intimately involved in the breakdown of collagen molecules that occurs actively during the remodeling process. The MMPs have been alluded to previously and are involved in many aspects of the healing process. MMPs represent a family of at least 25 enzymes that break down different extracellular matrices (34,35). They are produced by a variety of cell types, and different cells generally synthesize different enzymes. The MMP activity within tissues is modulated by tissue inhibitors of metalloproteinase (TIMPs) (36). The balance between MMPs and TIMPs within tissues is critical to enzyme activity and is regulated by cytokines including TGF-β, PDGF and IL-1 (37). The nature of the wound matrix changes with scar remodeling. Immature scar contains a disorganized array of fine collagen fibers which is gradually replaced by thicker fibers arranged in an orientation paralleling skin stresses. As the nature of the collagen matrix changes, it becomes less cellular through apoptosis of cells involved in 6  the healing process. Besides, the ratio of type I to type III collagen changes. Normal skin shows a basketlike weave pattern that is never completely reproduced with scar remodeling. Wound strength 1 week after injury is 3% of normal dermis. After 3 weeks, when the remodeling phase begins to predominate, the wound will have only approximately 20% the strength of normal dermis. At 3 months, however, the wound will have 80% the strength of normal dermis, with the significant increase in strength resulting from the contribution of remodeling. Remodeling will continue for up to 2 years after a wound is created, although scars never regain the strength of normal dermis (38). 1.7 Role of T cells in wound healing T cells play a crucial role in the wound healing process. The removal of circulating T lymphocytes inhibits the healing cascade (39). Seventy to eighty percent of normal peripheral blood lymphocytes are mature T lymphocytes. B cells contribute to the remaining 10% to 15% and have not been found to play any role in wound healing (40). Typically, both CD4 and CD8 positive T cells are present in maximal concentrations 5 to 10 days after injury under the influence of IL-2 and various other immunomodulatory factors (41). T cells, especially CD4+ T cells, are important sources of cytokines including IL-1, IL-2, TNF-α and TGF-β (40). Among other functions, these factors regulate the process of T cell proliferation and differentiation in an autocrine fashion. T cells are also the primary effectors of cell-mediated immunity and subsets of T cells mature into cytotoxic cells capable of lysing virus-infected and foreign cells (42). The infiltration of T-lymphocytes in the early wound, particularly CD4+ T helper-2 (Th2) cells has been strongly linked to fibrogenesis (43). By contrast, a T helper-1 (Th1) response leads to reduced fibrogenesis (43). Th2 cells produce various cytokines including IL-4, IL-5, IL-6, IL-10, IL-13, and IL-21, by which they activate and direct other immune cells to engage in the wound healing process. In burn patients hypertrophic scar formation was found to be associated with a polarized Th2 response together with increased serum levels of IL-4, IL-6, and IL-10 and decreased levels of IFN-γ and IL-12 as compared with healthy control patients (44). The Th1 response includes production of IFN-γ which increases levels of IL-12 by macrophages but also promotes and preserves the Th1 response by increasing 7  the production of IFN-γ via auto-regulation and inhibiting the production of Th2-derived IL-4 (44). Although some attempts have been made to decrease collagen deposition by promoting a Th1 response, its effect is disputable (45). Many studies have shown that inflammatory cells such as T cells are all absent in scarless fetal wounds (46) and then the switch to healing with scar formation is marked by the presence of these inflammatory cells (47). 1.8 Role of macrophages in wound healing The role of the macrophage is complex in that this multi-purpose cell is involved in many aspects of healing through the cytokines and immunomodulatory factors it produces. Macrophage-produced cytokines are involved in angiogenesis, fibroblast migration and proliferation, collagen production (33), and wound contraction. It seems that one of the most important functions of macrophages in wound healing is to accelerate the regression of the inflammatory response via the elimination of neutrophils (48). TGF-β, IL-1, insulin-like growth factor-1 (IGF-1), FGF-2, and PDGF are several of the more critical macrophage-derived cytokines. Macrophages can secrete PDGF, FGF-2, TNF-α, and IL-1 (49) also release nitric oxide, which may serve an antimicrobial function as well as other functions during the healing process (50). The inhibition of nitric oxide release has been found to impair wound healing in an in vivo mouse model (51). Hypertrophic scar formation is principally associated with overexpression of TGF-β1 and TGF-β2 by macrophages, whereas TGF-β3 was shown to have anti-fibrotic properties (52,53). TGF-β is thought to promote fibrosis by mediating the transition of resident mesenchymal cells (including epithelial cells) into collagen-producing myofibroblasts and subsequent activation of (myo)fibroblasts (54). Additionally, TGF-β also reduces the collagenase-mediated degradation of the wound matrix (55). However, non-scarring fetal wounds show reduced expression of TGF-β and higher expression of fibromodulin, and TGF-β binding proteinas compared with adult wounds (56,57). The production of IL-10, an anti-inflammatory cytokine that deactivates macrophages, is critical for scarless fetal repair, since wounds of fetal mice lacking IL-10 heal with marked inflammation and scarring (58). 8  1.9 Immunoregulatory drugs for wound healing  Multiple studies on hypertrophic scar formation have led to a plethora of therapeutic strategies to prevent or attenuate keloid and hypertrophic scar formation; here we focused on immunoregulatory treatments.  1.9.1 Imiquimod 5% cream Imiquimod 5% cream, a topical immune-response modifier, is approved for the treatment of genital warts and basal cell carcinoma (59,60). Imiquimod stimulates interferon, a proinflammatory cytokine which increases collagen breakdown (61). However, as imiquimod has been shown to induce psoriasis-like skin inflammation (62), additional studies with a larger sample size and longer follow-up are necessary to determine the role of imiquimod 5% cream in hypertrophic scar therapy. 1.9.2 Recombinant TGF-β3 and mannose-6-phosphate After Ferguson et al. (63) showed the prophylactic effects of TGF-β3 on skin scarring, interest in the TGF-β family increased. Also, in March 2009, the company Renovo reported the results of a double-blind, placebo-controlled, randomized phase 2 efficacy trial on 195 male and female subjects to investigate the safety and efficacy of inhibition by TGF-β1 and -β2 using two doses of mannose-6-phosphate (64). Although both were judged to be effective by lay observers and by clinicians, the use of these costly and painful injectable medicines for treatment of wounds in humans is undesirable.   1.9.3 Steroids Steroids comprise a group of compounds that have a backbone structure of a steroid nucleus (involving four fused carbon rings) and are derived from cholesterol (65). Steroid injections have been shown to induce the regression of hypertrophic scars by attenuating the inflammatory process, reducing collagen, and reducing fibroblast proliferation (66). Corticosteroids are natural steroids that consist of two main families, glucocorticoids and mineralocorticoids. Glucocorticoids were initially described in the 1930s and were amongst the first steroids to be discovered. They act to reduce the increased expression of inflammatory promoters such as cytokines, adhesion molecules, and inflammatory enzymes such as 9  cyclooxygenase (COX-2) thereby combat inflammatory states (67). However, the adverse effects that may occur with corticosteroids include adrenal suppression, raised blood pressure, glaucoma, cataract formation, increased susceptibility to infection, itching, skin atrophy and bruising (68).  1.9.4 IFN injections IFN therapy, which has potential therapeutic benefit in the treatment of abnormal scars, is based on the effect of IFN in decreasing the synthesis of collagen types I and III (69). Hypertrophic scars injected three times weekly with IFN-α showed significant mean rates of improvement and sustained reduced serum TGF-β levels (70). Unfortunately, IFN is an expensive form of therapy with common adverse effects including flu-like symptoms and pain on injection site (71). 1.9.5 Bleomycin Bleomycin sulfate was found to directly inhibit collagen synthesis via decreased stimulation by TGF-β1; it was first investigated in mid-1990s as a scar-reducing agent (72). Studies revealed significant improvement in hypertrophic scar height and pliability as well as reduction in erythema, pruritus and pain. However, development of hyperpigmentation and dermal atrophy may occasionally occur with bleomycin treatment (73). 1.10 Psoriasis The word “psoriasis” is derived from the Greek word “psora”, which means “itch” or “scurf” or “rash”, although most patients suffering from the condition do not complain of itching (74). Psoriasis is an immune-mediated chronic inflammatory skin disorder characterized by raised cutaneous plaques with scaling and variable erythema (74–76). Several factors, such as genetic predisposition, environmental issues, and immunologically mediated inflammation, and several modifying factors including obesity, trauma, infection, and possible deficiency of the active forms of vitamin D3, are thought to be responsible for the development of psoriasis (77). However, the initial cause of psoriasis was attributed to multiple sources ranging from divine power to racial association (78) and unknown infectious organisms (79). Later, psoriasis was described as primarily and essentially an epidermal problem independent of 10  immunologic aspect (80). Efficacy of the cytotoxic drugs, such as methotrexate, in the late 1960s paved the road for ideas about the role of the immune system in psoriasis (81,82). Histopathologic examination of psoriatic lesions was the initial hypothesis of describing the pathological cellular immune response in psoriasis (83,84). Soon thereafter, the discovery of a soluble factor that played an important role in keratinocyte proliferation helped to form the cytokine-based theory for the induction/maintenance of the inflammatory and proliferative cascades of psoriatic lesions (85). Subsequently, immunophenotyping of psoriatic lesions showed mixed T cell populations (CD4 and CD8) and Langerhans cells distinct from normal skin (86). Increased levels of IFN-γ, TNF-α, and IL-12, in the serum and lesions of psoriasis patients labeled this as a Th1-mediated disease (87). The Th1-derived cytokines produced by these infiltrating Th1 cells further upregulates keratinocyte chemokine production and supports dermal DC myeloid type (CD 1c+) activation. Thereafter, in 2004, the presence of abundant IL-23+ dendritic cells as well as elevated mRNA expression for both subunits of IL-23 (IL-23p19 and IL-23p40) in psoriatic lesions were confirmed, which supported the role of IL-23 in the pathogenesis of psoriasis (88,89). In the presence of IL-1β and IL-6, IL-23 helps in the development of Th17 cells, leading to the possibility that Th17 and Th1 act in synergy to produce psoriatic inflammation (74,90). However, studies in knockout animal models (IL-17 knockout mice) as well as human experimental data indicated that Th17 and its signature cytokine IL-17 have a critical role in the pathogenesis of psoriatic disease. Th17 cells have been identified from the dermal extracts of psoriatic lesions (91,92). In response to this cytokine activation, keratinocytes and other cells produce a plethora of immune mediators that induce and amplify inflammatory responses in the skin (93) (Table 1-1).      11  Ancient times Divine power to racial association 1920s Unknown infectious organism 1950s An epidermal problem 1960s Cytotoxic drugs indicate the role of the immune system in psoriasis 1970s Cellular inflammatory reactions 1980s The cytokine-based theory CD4 and CD8 roles in pathogenesis of psoriasis 1990s Th1 role in psoriasis 2003–2007 IL-12 and IL-23 2009 Th17 role in psoriasis  Table 1-1. Timeline of psoriasis pathophysiology development  1.11 Psoriasis pathophysiology Psoriasis has a defining appearance (94). Typical histologic features of psoriasis include (1) epidermal hyperplasia (acanthosis) with (2) elongated rete ridges, (3) parakeratosis, and (4) leukocytic infiltration of the dermis and epidermis (75,95,96). Plaques include infiltrating T cells (mainly Th cells) and dendritic cells in the dermis as well as cytotoxic T cells and neutrophil in the epidermis (76,97,98). Keratinocyte proliferation is strongly enhanced, resulting in marked thickening of the epidermis and the epidermal rete becoming very elongated, forming long thin downward projections into the dermis (Figure 1-3). Disturbed keratinocyte differentiation results in a diminished thickness of the stratum granulosum of the epidermis and an irregular and thickened stratum corneum (hyperkeratosis) with retention of nuclei within corneocytes (parakeratosis). The granular layer of the epidermis, in which terminal differentiation begins, is greatly reduced or absent in psoriatic lesions. Psoriatic plaques have surface scale, which is caused by aberrant terminal differentiation of keratinocytes (failure of psoriatic corneocytes) (Figure 1-3). 12   Figure 1-3. The histopathology of psoriasis (99)  Infiltrating inflammatory cells in psoriatic lesions consist of macrophages, neutrophils, and lymphocytes distinct from other inflammatory skin diseases. T cells are found in the epidermis, as are elevated numbers of mononuclear cells and foci forming neutrophils. In addition, the dermis shows an increased infiltration of mononuclear leukocytes, T cells and DCs (100,101). Th17 cells are thought to be recruited to the skin by expression of CCL20, the ligand for CCR6, and then locally stabilized by IL-23. Since both IL-17 and IFN-γ cause keratinocytes and antigen-presenting cells (APCs) to produce more IL-1, IL-23, and CCL20, a positive feedback loop causing keratinocyte proliferation is established (Figure 1-4) (102). 13   Figure 1-4. Pathophysiology psoriasis (102)  1.12 Role of Th17 and IL-17 in psoriasis Although the existence of IL-17 as a product of activated CD4+ T cells has been known for more than 10 years, only recently the existence of Th17 as a distinct subset of T lymphocytes has been recognized (103–105). Like other CD4+ T cell lineages, their development is controlled by a combination of cytokines that initiate a program of transcription factor expression. The cytokines that instruct Th17 cell lineage development likely include IL-6, IL-21, IL-23, and IL-1β (106–109), with a potential synergistic role for TGF-β (110–112) via its ability to suppress Th1 cell lineage commitment (113). Cytokine-driven activation of the signal transducer and activator of transcription (STAT) 3 pathway is an essential step in Th17 cell differentiation (112), ultimately leading to expression of their lineage-defining transcription factor: retinoid orphan receptor (ROR) C2 (106,114). Th17 lymphocytes also produce 14  cytokines different from IL-17, such as IL-21 and IL-22, which contribute to the activation of mononuclear and/or resident cells and therefore may induce and/or maintain a chronic inflammatory process. However, because of their unique ability to recruit neutrophils, the main protective function of Th17 cells appears to be the clearance of extracellular pathogens including fungi (115) as confirmed by the demonstration in humans of Candida albicans-specific IL-22-producing lymphocytes (116). Th17 lymphocytes produce the distinctive cytokines IL-17A and IL-17F. The IL-17 family of cytokines comprises five members designated IL-17A–F (117). IL-17F shares 50% homology with IL-17A. IL-17A can combine with IL-17F to form a heterodimer and both can form homodimers (118). The other IL-17 family members, IL-17B, IL-17C, and IL-17D, are produced by a non-T-cell source. IL-17A is the most potent member of the IL-17 family and has numerous targets, including keratinocytes, endothelial cells, chondrocytes, fibroblasts and monocytes (119). Human IL-17 was cloned in the year 1995 (120). IL-17 induces the stromal cells to secrete cytokines, which are involved in inflammatory and hematopoietic processes (104). IL-17 also stimulates osteoclast formation and bone resorption (121) and plays a role in the production of a granulocyte–macrophage colony stimulating factor and macrophage inflammatory. The role of IL-17A in psoriasis was elucidated by studies documenting higher serum and lesional levels of IL-17A in psoriasis patients when compared with controls (122). One of these studies described a correlation between IL-17A levels and severity of disease; generalized pustular psoriasis patients with more severe disease were observed to have the highest serum levels of IL-17A (122). Clinical studies that block IL-17A demonstrate its importance in psoriasis pathogenesis (123). 1.13 Role of dendritic cells in psoriasis  Dendritic cells (DCs) are antigen-presenting cells (APCs) that can present antigen to and activate naive T cells and in so doing initiate an immune response (124). DCs are a heterogeneous group of bone marrow (BM)-derived hematopoietic cells. DC subsets can be classified by various parameters and at different levels including localization, phenotype, gene expression profile and specialized function. Historically, the broadest division was made between DCs resident in lymphoid organs and migratory 15  DCs that exist in all non-lymphoid tissues and can be detected migrating through the lymphatics to draining lymph nodes (125). DCs reside at peripheral sites in immature state. Upon exposure to antigen and pro-inflammatory cytokines, e.g. IL-1β and TNF-α, or microbial products, e.g. endotoxin, they take up antigen and migrate to draining lymph nodes (126). The antigen is processed to peptides that are presented on class I or class II major histocompatibility complex (MHC) molecules to T cells (127). DCs secrete IL-23, which is a cytokine that drives autoimmune diseases including psoriasis (128). IL-23, a heterodimer cytokine in the IL-12 family, is composed of IL-12p40 and IL-23p19 subunits (129). Cytokines IL-12 and IL-23 are both produced by monocytes but they promote two distinct T-cell subsets. In contrast to the role of IL-12 in inducing IFN-γ-producing Th1 cells, IL-23 drives the expansion of a novel T-cell population, Th17 (105,130,131). Initial studies on mice showed that the presence of IL-23 helps in the development of Th17 cells (130,131). However, subsequent studies showed that the IL-23 receptor is only expressed on activated T cells (132,133) and naive T cells cannot be converted to Th17 cells in the presence of IL-23. In a mouse model, the presence of transforming growth factor β (TGF-β) and IL-6 promotes Th17 differentiation (134–136) and IL-23 can upregulate IL-17 in the memory T cells (130). Treatment with anti-IL-12/23p40 or anti-IL-23p19 antibodies markedly lowered transcript levels of IL-17 cytokine (137). Langerhans cells (LCs) are a subset of skin-resident DCs that form a dense network in the epidermis (138,139). Recent studies have demonstrated that the LCs that produce IL-23 have an important role in psoriasis-like skin inflammation (140). IL-23 is overexpressed in psoriatic lesions (88) and it has recently been shown that intradermal injections of IL-23 in mice provoke a skin phenotype resembling psoriasis. Specifically, injection of IL-23 upregulates pro-inflammatory cytokines and induces KC proliferation leading to epidermal hyperplasia (141,142).  1.14 Treatment for psoriasis In the past decade, understanding of the pathophysiology of psoriasis has changed from that of an epidermal keratinocyte disease to a T-cell-mediated disease to now being considered a systemic inflammatory disease with an evident role for the immune system (143). Choice of treatment for psoriasis 16  depends on many factors including the extent of disease, its effect on a patient’s life, and the patient’s perception of his/her illness. There are multiple therapeutic options for the treatment of moderate to severe psoriasis. The process of choosing among potential treatment options requires both the physician and the patient to weigh the benefits of individual modalities against their potential risks. Traditional systemic therapies that are used to treat moderate to severe psoriasis include methotrexate (MTX), cyclosporine (CsA), psoralen and ultraviolet A (PUVA), and narrowband and broadband ultraviolet B (UVB). In different chronic inflammation and autoimmune diseases there is an increase in production of pro-inflammatory cytokines by the immune system. Pro-inflammatory cytokines have an important role in both maintaining health and participating in disease manifestations (144). The success of biological modern treatment options for psoriasis and other autoimmune diseases also proves the pivotal role of pro-inflammatory cytokines in the disease pathophysiology (145). For severe psoriasis, we now have biological therapies which have been approved only during the past 10 years. 1.15 Traditional systemic therapies and side effects As an incurable disease, the main goal of psoriasis treatment would be to clear the skin lesions and prevent their recurrence while providing patients with a better health-related quality of life. However, the choice of treatment depends on the severity and extent of the skin lesion exposure. Conventional treatments for psoriasis include topical or systemic therapies. Topical treatments include corticosteroids, the most common drug prescribed for patients with mild to moderate psoriasis or phototherapy. However, these treatments have variable efficacies and in the long term can have severe side effects associated with them. Systemic treatments are used when patients are refractory to topical treatments and phototherapy, when skin lesion exposure is too extensive, or in patients with significant impairments in quality of life. Often combined with topical therapies, systemic therapies include methotrexate and cyclosporine. These agents are associated with high toxicity and adverse effects, thus requiring an intermittent use and close monitoring throughout treatment. 17  1.15.1 Psoralen and ultraviolet A  Since its initial development in 1974, oral methoxsalen photochemotherapy (PUVA) has been used widely as a very effective means of inducing remission of psoriasis (146). However, the risk of skin cancer associated with PUVA therapy has been most extensively investigated by Stern et al. (147). It has also been shown that PUVA induces abnormal melanocytic proliferations and abnormal changes to the skin and nails (148). The carcinogenic mechanism of PUVA has not been elucidated but evidence suggests that PUVA has both mutagenic and immunologic effects (149). 1.15.2 UVB therapy  UVB therapy can be divided into two separate modalities. Broadband therapy (BB UVB) involves a wider spectrum of UVB wavelengths and has been available for more than 80 years. The newer narrowband UVB (NB UVB), which emits near monochromatic radiation at 311 nm, has been shown to be superior to broadband phototherapy for psoriasis (150). UVB is generally accepted to be a safer therapeutic modality than PUVA in terms of malignant potential, as exemplified in a PUVA follow-up study (151). Data obtained from several controlled studies have demonstrated that NB UVB is more effective for psoriasis than BB UVB (152). However, there is still a lack of information on statistics including P-values, methods of randomization and power calculations. Moreover, in some of these studies NB UVB was combined with topical steroids. However, NB UVB has not been yet fully assessed as monotherapy (153).  1.15.3 Methotrexate  MTX is a structural analogue of folic acid that inhibits the activity of dihydrofolate reductase thereby preventing DNA synthesis and in psoriasis reduces the rate of epidermal proliferation (154). Low dose MTX has been used as an effective treatment to suppress the hyperimmune state of autoimmune diseases such as severe psoriasis for decades. In psoriasis patients, the association of lymphoma formation with MTX therapy is not as clear. However, compared with the general population, methotrexate-treated rheumatoid arthritis patients have an increased incidence of melanoma, non-Hodgkin’s lymphoma, and 18  lung cancer (155). Several potentially life threatening toxicities of MTX include renal and bone marrow toxicity and hepatotoxicity. Renal function impairment results in sustained serum level of MTX that can result in bone marrow toxicity (156). Most of the current understanding of the hepatotoxic potential of MTX comes from its use in psoriasis. The exact mechanism of hepatotoxicity is still unclear. Therefore, before initiating therapy with MTX, patients should have a through history and physical exam, reviewing alcohol intake, possible exposure to hepatitis B or C, and family history of liver disease (157,158). 1.15.4 Cyclosporine  CsA, a calcineurin inhibitor, blocks production of IL-2 by activated CD4+ T cells, thereby hindering the inflammatory process central to psoriasis for which CsA has been effectively used for more than two decades (159,160). In transplant patients, long-term treatment with CsA is associated with serious side effects, including risk of lymphoma, internal malignancies, skin cancers, and infections (161,162). A long-term cohort study of 1252 patients with severe psoriasis who were taking CsA showed the standardized incidence ratio of malignancy to be 2.1 as compared with the general population (161).  1.16 Biologic therapies and side effects Multiple new drugs are under investigation for the treatment of psoriasis targeting different extracellular and intracellular immune processes. In the past several years, biological therapies have appeared as good options for the treatment of moderate to severe psoriasis with proven efficacy and safety profiles. Biologic therapies fall into two main groups aimed either at specific inflammatory mediators such as TNF-α, ILs 12 and 23 or more generally at T cells. The main concern about these and other biological agents is the effects of long-term chronic immunosuppression, which has the potential to increase infection and the risk of cancer. Moreover, the biologics are not only costly but also require repeated injections and some patients experience a loss of therapeutic effect (i.e. tacaphylaxis). Furthermore, antibodies against most of the pro-inflammatory cytokines produced by activated T cells cause the suppression of all other immune responses that need activation of T cells and their cytokines. 19  Therefore, we may need to find therapeutic agents that affect only pathological immune reactions and do not suppress protective cellular immunity (Table 1-2).  1.16.1 T cell inhibitor One of the methods of treating psoriasis has been targeting T cells either via inhibition of binding of lymphocyte function-associated antigen-3 (LFA-3) to CD2 (e.g. with alefacept) or via blocking the CD11a chain of LFA-1 and inhibition of cell adhesion (e.g. with efalizumab). However, in Europe, alefacept was never approved and efalizumab was withdrawn because of serious side effects (163). Alefacept is a fusion protein that contains the extracellular domain of LFA-3 and binds to the surface co-stimulatory molecule CD2. The main cell types expressing CD2 are T cells and natural killer (NK) cells but a small population of circulating CD14+ DCs is also CD2+. The main early hypotheses of alefacept’s mechanism of action involved the bridging of T cells and NK cells by binding CD2 and the Fc receptor (FcR) respectively, leading to T-cell apoptosis (164).  Efalizumab is an agent that was designed to interfere with T-cell adhesion and co-stimulation. It is effective in a subset of patients with severe psoriasis, although like other therapies, it often requires long-term treatment to maintain disease control. It is a humanized murine monoclonal antibody that targets CD11a, which forms a heterodimer with the β2 integrin CD18 to form LFA-1. The CD11a/CD18 molecule is selectively expressed by T cells and binds to intercellular adhesion molecules 1 (ICAM-1) and 2. This interaction permits T-cell adhesion to ICAM+ DCs during the initial generation of immune responses in lymph nodes and is important in the skin during T-cell migration from the blood into the dermis, local DC-activation of T cells, and T-cell entry into the epidermis. Administration of efalizumab induces a peripheral leukocytosis, which is probably due to blockade of the LFA-1/ICAM-1 interaction between T cells and endothelial cells (165).  1.16.2 TNF-α antagonists In psoriasis, activated CD4-positive helper T cells interact with CD8-positive suppressor T cells, dendritic cells, and keratinocytes, resulting in production of Th1-associated proinflammatory cytokines, 20  the most important of which is the tumour necrosis factor (TNF-α) (166). The introduction of TNF-α inhibitors resulted in a breakthrough in the management of moderate-to-severe psoriasis (167). At present, there are two FDA-approved agents for psoriasis (etanercept and infliximab) and one agent in late-phase trials (adalimumab). Etanercept is a dimeric fusion protein that binds to and blocks the effects of TNF-α (168). Infliximab is a chimeric mono-clonal antibody targeting soluble and membrane-bound TNF-α (169). Adalimumab is the first fully human recombinant IgG1 monoclonal antibody with specificity for human TNF-α (170). Since IL-17 can act synergistically with TNF-α to induce keratinocytes to express inflammatory proteins, it is possible that anti-TNF-α acts in part by inhibiting Th17 cell-driven inflammation (171). The relationship between lymphoma and TNF-α blockers has been documented in a few case reports focusing on psoriasis patients (172–174). 1.16.3 IL-17 antagonists Targeting IL-17 alone with secukinumab or ixekizumab, both fully human neutralizing antibodies to IL-17A, is also effective in treating psoriasis, confirming that this is likely a major pathogenic cytokine in this skin disease (175,176). Thus, it is important to discuss the potential side effects of IL-17 blockade based on evidence from pre-clinical mouse models and humans. Mice deficient in IL-17RA display an increased susceptibility to pathogens such as Candida albicans, pneumoniae, Bacteroides fragilis and Toxoplasmosis gondii (177). In humans, chronic mucocutaneous candidiasis (CMC), a persistent or recurrent fungal infection of the skin and GI tract with C. albicans, has been associated with impaired IL-17 immunity. These findings illustrate the importance of IL-17 in regulating mucocutaneous immunity and the need to monitor patients treated with anti-IL-17 agents for potential signs of infection.  1.16.4 IL-12/23 antagonists IL-12 and IL-23 are heterodimeric pleiotropic cytokines each consisting of two subunits that are named according to their size. The 40 kDa p40 subunit is common to both cytokines, while the second subunit of IL-12 is the 35 kDa p35 subunit and the second distinct subunit of IL-23 is the 19 kDa p19 subunit (178). IL-12 is produced by macrophages and B cells and has been shown to have multiple effects 21  on T cells and NK cells, whereas IL-23 is essential for Th17 lymphocyte differentiation (179). Only results from trials of two inhibitors of the p40 subunit inhibitors ustekinumab and briakinumab (i.e. inhibitors of both IL-12 and IL-23) have been published to date (180,181). Ustekinumab is approved in Canada, Europe, and the USA for the treatment of moderate-to-severe plaque psoriasis. Briakinumab is another human anti-IL-12/23 monoclonal antibody (181). However, safety concerns regarding a possible association of major adverse cardiovascular events with the use of briakinumab led to discontinuation of its development in the USA and Europe in 2011 (182). One of the goals in increasing safety of using these antibodies is allowing for normal IL-12-mediated Th1 response while conferring the same efficacy as with p40 antibodies. IL-12 is required in the immune response to intracellular pathogens because of its role in the production of INF-gamma from T cells and NK cells (183). Currently, several inhibitors targeting the unique IL-23 p19 subunit such as tildakizumab and guselkumab are under investigation in clinical trials. Based on expanding knowledge of psoriasis pathophysiology this interesting target looks promising but to date no results from these trials have been published in peer-reviewed journals. Drug Mechanism of action Efalizumab Fusion protein composed of LFA-3 fused to human IgG1, binds to CD2 receptors on T cells Alefacept Monoclonal antibody (IgG1) that binds CD11a, a subunit of LFA-1 Etanercept Human receptor-fusion protein consisting of the TNF-α receptor and protein of IgG1 Infiximab Human–mouse (chimeric) antibody that binds to and inhibits TNF-α Adalimumab Human IgG1 monoclonal antibody directed against TNF-α Secukinumab Human IgG1k monoclonal antibody directed against IL-17 Ixeekizzumab Humanized monoclonal antibody directed against IL-17A Ustekinumab Human IgG1 directed against p40 subunit of IL-12 and IL-23 Briakinumab Human monoclonal antibody directed against p40 subunit of IL-12 and IL-23 Tildakizumab Anti-interleukin-23p19 monoclonal antibody Guselkumab Anti-interleukin-23p19 monoclonal antibody  Table 1-2. Biologic agents used in the treatment of psoriasis 22  As stated, all means of treatment strategies currently used for psoriatic patients are unsatisfactory. Although the recent discovery of the importance of interfering with the IL-23/IL-17 axis for treatment of systemic psoriasis is promising, there is still a significant concern regarding the development of adverse events while using any anti-cytokines therapy. As such, there is a need for a novel approach through which psoriasis can be efficiently treated or prevented. 1.17 Fibroblasts  Fibroblasts are multi-potent cells of mesodermal origin. They are involved in forming and controlling the size of the extracellular matrix (ECM) that is composed of structural proteins, glycosaminoglycans and glycoproteins, adhesive molecules, and various cytokines (growth factors, notably fibroblast growth factors (FGFs), interleukins-IL, interferons-IFN, etc.), prostaglandins, and leukotrienes (184). Additionally, they participate in the repair process by differentiating into myofibroblasts (184). The fibroblasts make up a large portion of the cellular mass ranging from 40% to over 60% of the total body cell population. These cells are important for the structural support that they give and are found in all tissues in the body (185). 1.18 Immunoregulatory role of fibroblasts Fibroblasts can function as antigen-presenting cells in different tissues (186). It has been shown that culturing fibroblasts with IFN-γ induced MHC class II expression and make these cells capable of processing soluble protein for presentation to CD4+ T cells (187). Moreover, IFN-γ induces the production of indoleamine 2,3-dioxygenase (IDO) in fibroblasts (188). Upregulation of IDO and tryptophan catabolism augments antiparasitic or antimicrobial activity by depleting inter- and intra-cellular pools of essential amino acid tryptophan, and that contributes to defense against bacterial infection (189). Fibroblasts can modulate the immune system (190). Previously it has been shown that fibroblasts can interact with the immune system as alternative APCs either activating or downregulation T cells (191) and mediating anti-proliferative effects on lymphocytes (192). Co-culture of normal fibroblasts with resting or naive CD4+ T cells led to development of cells with a Treg phenotype that 23  expressed CTLA-4, IL-10 and TGB-β (190). As Jalili et al. showed fibroblasts can express important co-inhibitory molecules programmed cell death ligands 1 and 2 (PD-L1, PD-L1) (193). PD-Ls are transmembrane proteins that play a major role in suppressing the immune responses in cancer (194), allo-transplantation (195) and autoimmune disease (196).  1.19 Indoleamine 2,3-dioxygenase and tryptophan metabolites The kynurenine (Kyn) pathway (Figure 1-5) is the main route of tryptophan metabolism in the body and over 90% of dietary tryptophan (Trp) is metabolized through this pathway (197). Tryptophan is an essential amino acid used for serotonin, an important neurotransmitter. Kyn is an intermediate metabolite in its catabolism along the Kyn pathway. Mature IDO is a 42 kDa monomeric protein containing heme as its sole prosthetic group. Once synthesized, the IDO holoenzyme catalyzes the oxidative cleavage of the pyrrole ring of tryptophan to generate N-formyl-kynurenine, which then is rapidly degraded to form a series of metabolites named Kyn and finally nicotinamide adenine dinucleotide (NAD) (198).  24  Figure 1-5. The Kynurenine pathway of tryptophan degradation (199)  IDO is expressed intracellularly in a constitutive or inducible manner in different cells and tissues. IDO is constitutively expressed only in the lower gastrointestinal tract (200). Interferon-gamma (IFN-γ) is a potent inducer of IDO expression in placenta (201), macrophages (189), dendritic cells (202), 25  cultured fibroblasts (203) and many cancer cell lines (204). IDO in mice and humans is encoded by a single gene, termed Indo, with 10 exons spread over ~1.5 kbp of DNA located on the short arm of chromosome 8 (8p12–8p11) (205). There is more than 60% homology between human and mouse IDO (206). Gene transcription, in general, occurs in response to inflammatory mediators, most prominently IFN-γ or toll-like receptor ligation (e.g. through lipopolysaccharide) (207). 1.20 Immunoregulatory role of IDO IDO was first discovered in rabbit intestines in 1967 (208). In 1998, Munn and Mellor proposed that IDO plays an important role in natural immunoregulation during pregnancy. They demonstrated that inhibition of the enzyme resulted in spontaneous abortion in a pregnant animal model (209). Considerable evidence now supports the importance of the immunoregulatory function of IDO including studies of mammalian pregnancy (209,210), tumor resistance (211–213), chronic infections (214–216) and autoimmune diseases (217). Two theories have been proposed to explain how tryptophan catabolism facilitates tolerance. One theory postulates that the IDO enzyme by tryptophan breakdown suppresses certain immune cells likely by pro-apoptotic mechanisms (218,219). This was first suggested by the observation that some effects of IDO on T cells are reversed by the addition of excess tryptophan (220,221). Recently, the stress-responsive kinase general control nonderepressible 2 (GCN2) has been identified as a signaling molecule that enables T cells to sense and respond to stress conditions created by IDO (222,223). GCN2 contains a regulatory domain that binds the uncharged form of transfer RNA (tRNA). Amino acid insufficiency causes a rise in uncharged tRNA, which activates the GCN2 kinase domain and initiates downstream signaling (224). Activation of the GCN2 kinase pathway, which has been termed the integrated stress response, can trigger cell cycle arrest, differentiation, compensatory adaptation, or apoptosis, depending on the cell type and the initiating stress (225,226). The other theory posits that tryptophan metabolites have immunoregulatory/anti-inflammatory roles (219). 26  1.21 Tryptophan metabolites 1.21.1 Kynurenine Trp metabolites, such as Kyn, dampen inflammation by selective apoptosis induction in Th1 but not Th2 cells via caspase-8 activation (227), impairment of memory T-cells formation (228), and inhibition of cell proliferation in T lymphocytes, B-cells, and NK cells (219). In addition, recent observations pointed to the pivotal role of Kyn in suppressing the immunogenicity of the dendritic cells and induction of differentiation of regulatory T-cells (229). Regardless of extensive research about pathophysiological effects of kynurenines, the signaling pathway associated with these molecules was elucidated only recently. Our group previously showed that Kyn is a potent anti-inflammatory factor for a mixture of immune cells relevant to those found in the wound healing process and it can suppress the key pro-inflammatory cytokine IL-17 (230).  1.21.2 Kynurenic acid Kynurenic acid (KynA) was considered one of the numerous tryptophan metabolites present in mammalian urines and it was named “acid in dog urines” by Liebeg in the second half of the 19th century (231). It has been documented that KynA has a positive influence on a number of pathologies in the gastrointestinal tract, such as ulcer obstruction or colitis (232). The sources of KynA in the gastrointestinal tract are not known. However, it seems that it was either produced from tryptophan or delivered with food (232). Low and medium concentrations of KynA stimulate growth of certain probiotics, whereas KynA in high concentrations possesses antibacterial properties (233,234). KynA, being a selective ligand of the G protein-coupled receptors (GPCR35), is involved in the modulation of the immune response because this receptor is expressed mainly on cells connected with the immune system (235). Under the influence exerted by KYNA on this receptor, the synthesis of pro-inflammatory cytokines (interleukin 1α (IL-1α), tumor necrosis factor α (TNF-α), and less often anti-inflammatory ones (IL-4)) in different cells is depressed (236,237).  27  1.22 Hypothesis, objectives, and specific aims 1.22.1 Hypothesis We hypothesize that indoleamine 2,3-dioxygenase (IDO) expressing dermal fibroblast and tryptophan metabolites inhibit T cell response that would result in improving inflammation in skin inflammatory conditions. 1.22.2 Objectives and specific aims Objective 1: To evaluate the effect of Kyn on modulation of the key pro-inflammatory cytokines in vitro and in vivo Specific aim 1: To investigate the effect of Kyn on the pro-inflammatory phenotype of immune cells in an in vitro model Specific aim 2: To investigate the effect of Kyn cream on modulating inflammatory cells in a wound healing animal model Objective 2: To evaluate the anti-inflammatory effect of KynA on DCc/T cells interaction in an in vitro model Specific aim 1: To investigate the effect of KynA on modulation of IL-17/IL-23 axis in vitro Specific aim 2: To investigate the mechanism by which KynA induces suppression in IL-17/IL-23 axis Objective 3: To validate therapeutic use of intra-lesional injection of IDO-expressing fibroblasts in improving the experimental psoriasis model Specific aim 1: To investigate whether intra-lesional injection of IDO-expressing fibroblasts improves local psoriasis. Specific aim 2: To investigate whether intra-lesional injection of IDO-expressing fibroblasts reduces infiltration of immune cells into psoriatic lesions of local psoriasis 28  Chapter 2.  Effects of Kyn on CD3+ and Macrophages in Wound Healing 2.1 Introduction  As in all other organs, wound healing in the skin is a dynamic process involving tissue response to different types of insults. This process involves a continuous sequence of signals and responses in which platelets, fibroblasts, epithelial, endothelial, and immune cells come together outside of their usual domains in order to coordinate the very complex process of tissue repair. These signals, mainly growth factors and cytokines, orchestrate the initiation, continuation, and termination of wound healing (238,239).  During the inflammatory phase of wound healing, polymorphonuclear neutrophils, macrophages, and T cells infiltrate the wound site where they release many different wound healing modulating factors such as inflammatory cytokines and chemokines (240). However, prolonged inflammation, which is defined as persistent inflammatory response, occurs with large numbers of infiltrated and proliferating immune cells including lymphocytes. If it happens, this causes a delay in wound closure which in turn increases the probability of developing dermal fibrotic conditions such as keloid and hypertrophic scars (241). Although many different immunoregulatory drugs such as imiquimod 5% cream, steroids, bleomycin, IFN injections, and recombinant TGF-β3 are frequently used, the adverse effects are common. Imiquimod has been shown to induce psoriasis-like skin inflammation (62) and using corticosteroids induce adrenal suppression, raised pressure, glaucoma, cataract formation, increased susceptibility to infection, itching, skin atrophy and bruising (68). Bleomycin may develop hyperpigmentation and dermal atrophy (73). IFN injection is an expensive form of therapy and its adverse effects include flu-like symptoms and pain on injection (71). Moreover, the use of these injectable medicines for treatment of human wounds is undesirable. As controlling inflammation in cutaneous tissue repair modulates the outcome of the healing response (242), in our previous studies we found that wounds that received indoleamine, 2, 3 deoxygenate (IDO) genetically modified dermal fibroblasts healed more quickly than the controls (243,244). IDO is the rate-limiting enzyme in tryptophan catabolism that converts tryptophan 29  to Kynurenine (Kyn) and Kyn acid (203). Further studies found that the environment generated from IDO-expressing skin cells can suppress inflammatory cell proliferation and induce some subsets of T lymphocyte apoptotic death (245). We also reported that Kyn treatment not only markedly increases the expression of MMP-1 and MMP-3 through activation of the MEK-ERK1/2 MAPK signaling pathway but also significantly suppresses the expression of type I collagen in primary dermal fibroblasts (246). As Kyn is a small molecule with a molecular weight of less than 0.2 kDa and potential therapeutic value, here we asked the question of whether Kyn can also modulate inflammation by altering the profile of key pro-inflammatory cytokines as well as the proliferation of immune cells. To address this question, a series of experiments were conducted and showed that some of the key cytokines and chemokines at the protein and gene levels are reduced in response to Kyn treatment in mouse splenocytes. In Particular, the emphasis was given to IL-17, which is the signature of pro-inflammatory Th-17 cells. Our finding showed that the expression of IL-17 and the number of Th-17 cells significantly decreased in splenocytes populations treated with Kyn. An in vivo study revealed a significant reduction in infiltration of CD3+ cells but not macrophages in wounds treated with Kyn. 2.2 Materials and methods 2.2.1 Ethics statement All methods and procedures as well as the use of animals and tissue specimens derived from animals are approved by Animal Ethics Committees of The University of British Columbia. Care and maintenance of all animals used in this study were in accordance with the principles of laboratory animal care and the guidelines of the institutional Animal Policy and Welfare Committee at The University of British Columbia. 2.2.2 Cell culture The male C57BL/6 mouse spleens were obtained and gently pressed against 40 µm nylon mesh to pass through and release splenocytes into culture medium. Splenocytes were washed and cultured in RPMI-1640 medium supplemented with 10% FBS, 0.1 U/mL penicillin, and 0.1 mg/mL streptomycin in 30  96-well flat-bottom plates (1 × 105 cell/well) and maintained in a 37°C humidified incubator containing 5% CO2. Spleens in each experimental unit derive from an individual animal. 2.2.3 Cytokines and chemokines Proteome Profiler™ Antibody Array ConA (5 µg/mL) activated splenocytes were treated with either vehicle (control) or 100 µg/mL Kyn for 48 hours. Conditioned medium from each set was collected and subjected to the mouse cytokine array panel A (Proteome Profiler™) (R&D Systems, Minneapolis, MN, USA). The membrane was designed to detect 40 different cytokines and chemokines. The protein array was carried out and analyzed according to the manufacturer’s instructions. Positive controls were located in duplicate in the upper left-hand corner, lower left-hand corner and lower right-hand corner of each array kit. Data were captured by exposure to X-ray film (Genesee Scientific, Belgium). Arrays were scanned into a computer and optical density measurements were obtained with ImageJ 64 software (Research Service Branch, national Institutes of Health). 2.2.4 Quantitative analyses of cytokines expressed by kynurenine-treated splenocytes ConA-activated splenocytes were cultured in either RPMI or RPMI containing Kyn (100 µg/mL). After 24 hours of incubation, cells were harvested and total RNA was extracted using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). RNA (5 µg) was then transcribed into cDNA using the Superscript II First Strand cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). q-PCR was then performed on an Applied Biosystems 7500 PCR machine using fast start universal SYBR Green Master (Rox). The list of primers used in this study is provided in Table 3-1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene and 2-ΔΔCT method was used to calculate the gene expression fold change relative to that of the control.     31    Primer Sequence Gene Forward Reverse IL-1ra 5'CTTTACCTTCATCCGCTCTGAGA3' 5'TCTAGTGTTGTGCAGAGGAACCA3' CXCL-10 5'GGATGGCTGTCCTAGCTCTG3' 5'TGAGCTAGGGAGGACAAGGA3' CXCL-1 5'TGGGATTCACCTCAAGAACA3' 5'TTTCTGAACCAAGGGAGCTT3' CXCL-9 5'TTGGGCATCATCTTCCTGG3' 5'GAGGTCTTTGAGGGATTTGTAGTGG3' CCL-2 5'CTTCTGGGCCTGCTGTTCA3' 5'CCAGCCTACTCATTGGGATCA3' CCL-3 5'TGAATGCCTGAGAGTCTTGG3' 5'TTGGCAGCAAACAGCTTAT3' CCL-4 5'TTCTGTGCTCCAGGGTTCTC3' 5'CGGGAGGTGTAAGAGAAACAG3' CXCL-2 5'CGCCCAGACAGAAGTCATAG3' 5'TCCTCCTTTCCAGGTCAGTTA3' CCL-5 5'ATCTTGCAGTCGTGTTTGTCA3' 5'TTCTTGAACCCACTTCTTCTCTG3' CCL-12 5'ACATGAAGATTTCCACACTTCTATGC3' 5'CAGCCAATACCTGAGGACTGATG3' IL-17 5’GCTCCAGAAGGCCCTCAGA3’ 5’AGCTTTCCCTCCGCATTGA3’ 1L-2 5’CCTGAGCAGGATGGAGAATTACA3’ 5’TCCAGAACATGCCGCAGAG3’ GAPHD 5’ GACAAGCTTCCCGTTCTCAG3’ 5’ CAATGACCCCTTCATTGACC3’   Table 3-1. Summary of primer sequences   IL-1ra (interleukin-1 receptor antagonist), CXCL-10 (C-X-C motif chemokine 10), CXCL-1 (Chemokine (C-X-C motif) ligand 1), CXCL-9 (chemokine (C-X-C motif) ligand 9), CCL-2 (chemokine (C-C motif) ligand 2), CCL-3 (chemokine (C-C motif) ligand 3), CCL-4 (chemokine (C-C motif) ligand 4), CXCL-2 (C-X-C motif chemokine 2), CCL-5 (chemokine (C-C motif) ligand 5), CCL-12 (chemokine (C-C motif) ligand 12), IL-17 (interleukin-17), IL-2 (interleukin-2), GAPDH (glyceraldehyde-3-phosphate dehydrogenase)  2.2.5 Detection of Th-17 cells in Kyn-treated splenocytes Activated and inactivated isolated splenocytes were either left untreated or treated with 100 µg/mL Kyn for 48 hours. After harvesting, the cells were stained for cell membrane CD4+ according to 32  the manufacturer’s recommendations. In the next step, the cells were fixed and permeabilized using a fixation-permeabilization buffer (eBioscience, San Diego, CA, USA) and incubated for 45 min at 4°C. Cells were then washed once with permeabilization buffer (eBioscience, San Diego, CA, USA), and anti-mouse IL-17 (0.5 µg per 100 µL) was added (eBioscience, San Diego, CA, USA). The percentage of IL-17 positive cells was then detected and analyzed by a BD Accuri™ C6 Flow Cytometer. Gates on physical parameters and cychrome staining were integrated for the measurement of both cell surface CD4+ and intracellular cytokine (IL-17) staining. A total of 50,000 events were recorded for each assay. 2.2.6 Splenocyte proliferation assay For cell proliferation assay, splenocytes were either stimulated with Concanavalin A (ConA) (5 µg/mL) or left un-stimulated and then treated with four different concentrations (0, 50, 100, 150 µg/mL) of Kyn for 48 and 96 hour. Cell proliferation was evaluated by XTT-(f 2, 3-bis (2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide inner salt) based assay according to the manufacturer’s instructions (Biological Industries, Israel Beit Haemek LTD). The absorbance at 450 nm (OD450) was determined for each well using an automated microplate reader (BioTek Instruments, Inc., Winoosky, VT, USA). 2.2.7 Wound creation and treatment scheme For the in vivo studies, twelve 6- to 8-week-old male C57BL/6 mice each weighing 25–30 g were housed in plastic cages with a stainless steel grid cover containing groups of four animals per cage in an environmentally controlled room (temperature, 24 ± 2°C; humidity, 55 ± 5%, 12-hour light/dark cycle) with free access to food and water for at least 2 weeks. Mice were kept under inhalation anesthesia using isoflurane during the following procedures. Three full thickness wounds (4 mm in diameter) were created on the dorsal surface of mice following the hair removal done using an electric hair clipper and nair hair removal cream. To evaluate the effect of Kyn on infiltrated immune cells, a set of experiments was performed by evaluating total infiltrated T cells and macrophages on day 3, 6, and 10 post wounding. A total of 0.1 mL of Kyn cream with a concentration of 500 µg/mL was applied once a day. The control 33  wounds received daily treatment with an equal amount of cream alone. The wounds with no treatment were used as another control. 2.2.8 Immune cells extraction and flow cytometry analysis Mice were euthanized on day 3, 6, and 10, and wound areas were excised with a 6 mm in diameter punch. The tissue samples were then minced thoroughly in PBS, the mixture of homogenate were filtered through a 4 mm cell strainer and the cell suspension was used for identifying different infiltrated CD3+ cells and macrophages using flow cytometry. To perform surface staining, 1 × 106 cells were stained for 30 min at room temperature in 1% FBS in PBS containing the following antibodies: PE-conjugated anti-CD3 (eBiosciences) for T cells, PE-conjugated anti-CD11b (eBiosciences) for macrophages. The cell preparations were analyzed by a BD Accuri™ C6 Flow Cytometer, gates on physical parameters. A total of 50,000 events were recorded for each assay. 2.2.9 Statistical analysis All data are reported as mean ± SD of three or more independent observations and analyzed with one-way t-test or one-way ANOVA followed by post hoc evaluation using Bonferroni correction for multiple comparisons. P values < 0.05 were considered statistically significant. 2.3 Results  2.3.1 Kyn treatment modulates the production of cytokines and chemokines in splenocytes As Kyn has been identified to be the most effective metabolite influencing the key extracellular matrix (ECM) components such as Type I collagen and MMP-1 in dermal fibroblasts (246), here we asked whether this metabolite influences the profile of cytokines and chemokines expressed by a mixture of immune cells. We selected splenocytes because similar to those seen at the wound sites immune cells in the spleen are a mix of populations of macrophages and B and T cells. ConA+-activated splenocytes received either vehicle (control) or 100 µg/mL of Kyn and after 48 hours the conditioned medium was collected and subjected to the Proteome Profiler™ described in the Materials and Methods section. The changes in these 12 proteins were identified by comparing the signals detected by the corresponding 34  antibodies shown in Figure 2-1A with the names of corresponding proteins shown in Figure 2-1B. The results shown in Figure 2-1C revealed a marked change in at least 12 out of 40 pro-inflammatory cytokines and chemokines tested in response to Kyn treatment of splenocytes compared with those of control. Analysis of these signals shown in Figure 2-1C determined almost two-fold decreases in expression of IL-1ra and CXCL2 and a greater than two-fold decrease in expression of IL-2, IL-17, CXCL10, CXCL1, CCL12, CXCL9, CCL4, CXCL2, and CCL5. Additionally, treating activated splenocytes with 100 µg/mL of Kyn resulted in an increase in the level of CCL2.    35   Figure 2-1. Proteome Profiler™ Antibody Array of splenocytes. (A) Signals identified by Proteome Profiler™ Antibody Array membrane. (B) Schematic shape of the Proteome Profiler™ Antibody Array membrane. (C) Activated splenocytes were left untreated (ConA) or treated with 100 µg/mL of Kyn (ConA+Kyn). The culture media were then exposed to Proteome Profiler™ Antibody Array membrane. The numbers located on panel A depict the protein names shown in panel C.  To confirm and quantify these data, real-time qPCR for those cytokines and chemokines which their levels have been changed by Kyn in splenocytes were conducted. As shown in Figure 2-2, the findings revealed that Kyn significantly reduces the expression of IL-2, IL-17, CXCL1, CCL12, and CXCL9 (P < 0.05) and CXCL10 and CCL5 (P < 0.05) (n = 3) as compared with those of their 36  corresponding controls. Consistent with protein array, using real-time qPCR we observed that Kyn reduces the expression of IL-2, IL-17, CXCL10, CXCL1, CCL12, and CXCL9. However, Kyn treatment increased the gene expression of IL-1ra and CXCL2 (P < 0.05, n = 3) as compared with control, and these results are opposite to what was displayed with Proteome Profiler™ Antibody Array assay. No significant effect was observed for CCL2 and CCL4 gene expression. The quantitative analysis indicates that Kyn influences the profile of cytokines and chemokines produced by activated immune cells.   Figure 2-2. The pro-inflammatory cytokines and chemokines gene expression in splenocytes was quantified by qPCR analysis (*P < 0.01, n = 3).  37  2.3.2 Inhibition of Th17 cells in response to Kyn treatment As IL-17 is one of the key pro-inflammatory cytokines in wound healing (247) and our Proteome Profiler™ Antibody Array and qPCR results revealed that Kyn in 100 µg/mL concentration significantly decreases the expression and production of IL-17 in splenocytes milieu, we wanted to see whether the number of Th17 cells in splenocytes is influenced with this treatment. In these experiments, ConA–- and ConA+-treated splenocytes received either nothing (control) or 100 µg/mL Kyn for 48 hours. Cells were then harvested and stained for anti-mouse cell membrane CD4 and anti-mouse intra-cellular IL-17. The results in Figure 2-3A and 2-3B show that the frequency of IL-17+ T cells in activated CD4+ splenocytes markedly increases compared with not activated splenocytes (6.4% ± 1.11%, 1.4% ± 0.06%) (P < 0.001, n = 3), and then the frequency of IL-17+ T cells significantly decreased (1.4% ± 0.29%, 1.6 ± 1.11%; P < 0.001, n = 3) in response to 100 µg/mL Kyn treatment as compared with activated splenocytes (Figure 2-3B).   38   Figure 2-3. Flow cytometry analysis of IL-17+ cells in splenocytes. (A) CD4+ and CD4+IL-17+ populations for untreated inactivated splenocytes as a control (Control), Kyn-treated inactivated splenocytes (Kyn), untreated activated splenocytes (ConA), and Kyn-treated activated splenocytes (ConA+Kyn). (B) The frequency of CD4+IL-17+ cells in CD4+ cell population (*P < 0.05, n = 3).  39  2.3.3 Inhibitory effect of Kyn on skin wound infiltrated CD3+ T cells and macrophages As the ultimate goal of this study is to use Kyn as an anti-inflammatory factor for treating wounds, here we have asked the question as to whether the number of two main immune cell types, CD3+ T cells and macrophages, infiltrated into an injury site is influanced by topical application of Kyn treatment. To achieve this, the presence of T cells and machrophages in Kyn-treated, cream only treated, and untreated wounds was evaluated by flow cytometry staining for CD3 (surface marker for all T cells) and CD11b+ (surface marker for macrophages) using a procedure described in the Materials and Methods. As anticipated, the results of FACS analysis shown in Figure 2-4 A and B revealed that upon wounding, the number of total infiltrated CD3+ cells and macrophages (CD11b+) significantly increased on day 3, peaked on day 6 and reduced on day 10 post wounding. Our findings show that daily application of Kyn significantly reduced the number of infiltreated CD3+ T cells at the wound site on day 3 (21.6 %± 13.4% vs. 505.3% ± 156.1%, P < 0.05, n = 3), 6 (74.8% ± 8.6% vs. 582.5% ± 243.8%, P < 0.05, n = 3) and 10 (41.9% ± 7.1% vs. 173.7% ± 47.6%, P < 0.05, n = 3) post wounding as compared with those of untreated wounds. Similarly, there were significant changes in the number of CD3+ cells in Kyn-treated wounds at day 3 (21.6% ± 13.4% vs. 493.0% ± 22.5%, P < 0.05, n = 3) and day 6 (74.8% ± 8.6% vs. 400.8% ± 14.0%, P < 0.05, n = 3) compared with cream only treated wounds. As shown in Figure 2-4 A and B, the number of CD3+ cells in the cream only treated wounds at day 3 (493.0% ± 22.5% vs. 505.3% ± 156.1%, P < 0.05, n = 3) and day 6 (400.8% ± 14.2% vs. 582.5% ± 243.8%, P < 0.05, n = 3) was similar to that found in untreated wounds. No difference was seen between the number of macrophages at day 3, 6, and 10 as compared with untreated and cream only treated wounds.   40   Figure 2-4 A. Flow cytometry evaluation of infiltration of skin wound by CD3+ T cells and macrophages. Kyn cream and cream alone were applied on mouse wounds. (A) CD3+ T cells infiltration into skin wound. Kyn tissue samples showed reduction in the number of infiltrated CD3+ T cells at day 3, 6, and 10 post wounding compare with untreated samples (*P < 0.05, n = 3). 41    Figure 2-4 B. Flow cytometry evaluation of infiltration of skin wound by CD3+ T cells and macrophages. Kyn cream and cream alone were applied on mouse wounds. (B) Macrophages infiltration into skin wound. Kyn tissue samples have no effect on reducing the number of infiltrated macrophages as compared with the untreated wound (*P < 0.05, n = 3). 42  2.4 Discussion We have recently proposed that indoleamine 2, 3-dioxygenase (IDO) can be used as a local immunosuppressive source not only to protect allogeneic skin substitute from rejection but also as wound coverage and a source of keratinocyte-derived anti-fibrogenic factor (248). During the course of developing a non-rejectable IDO-expressing skin substitute and its application as wound coverage in our fibrotic animal model, we found that IDO expression protects allogeneic engraftment through suppression of immune cells, mainly CD4+ and CD8+ cells, in both in vitro and in vivo systems (203,243). Interestingly, skin cells but not immune cells, were resistant to an IDO-induced low-tryptophan environment (249). The reason behind this approach is that recent findings revealed that the catabolism of tryptophan, an essential amino acid, by IDO is involved in immune tolerance (250).  During the course of these studies, we have realized that Kyn released from the IDO-expressing fibroblasts modulates the expression of key ECM components such as MMP-1, MMP-3, and collagen type I at the gene and protein levels (246). As persistency of the inflammatory phase in wound healing is associated with delay of healing and development of fibrotic conditions, here we have asked whether Kyn alters the pro-inflammatory cytokines and chemokines. To address these questions, splenocytes were chosen for treatment of Kyn because spleen cells consist of a mixture of macrophages and B and T cells and that is similar to those of infiltrated immune cells during the wound healing inflammatory phase (251). The concentration of Kyn used was based on the concentrations previously used to test the anti-fibrogenic effect of Kyn in vitro (50 and 100 µg/mL) and in vivo in rabbit ear fibrotic wounds (50 µg Kyn/100 µL) (246).  The use of Kyn for treatment of healing wounds has several advantages. First, as reported before, Kyn markedly suppresses the expression of collagen types I and III, while increasing the expression of MMP-1 and MMP-3 in dermal fibroblasts in vitro and in vivo (246). Second, data presented in this study showed that the production of at least 12 out of 40 pro-inflammatory key chemokines and cytokines released from ConA-activated splenocytes is significantly suppressed in response to Kyn treatment. Third, 43  as Kyn is present in human serum and its level is increased during the course of pregnancy in women (252,253), its topical application is considered to be safe. In fact, we have some evidence that even daily injection of Kyn in a mouse model does not compromise the safety of the recipient as evaluated by weight gain, the increase in liver enzymes, and blood counts. The significant finding of this study is that the majority of these 12 cytokines and chemokines, such as IL-17 (254), IL-2 (255), CXCL-1, CXCL-9, CXCL-10, CCL12, and CCL-5 (256), are pro-inflammatory cytokines, whose levels were markedly reduced in ConA+ Kyn-treated splenocyte-conditioned medium relative to those of only ConA-treated cells. It is known that Kyn interacts with AhR. Therefore, its anti-inflammatory effect for splenocytes seems to be due to its interaction AhR receptors. Furthermore, the results also showed an increase in both protein and gene expression of CCL2 in ConA+Kyn-treated splenocytes. CCL2 has a direct effect on angiogenesis (257,258) and it is believed that CCL2 stimulates angiogenesis through its chemoattractant effect on monocytes/macrophages that can release angiogenic molecules (259,260). This finding, therefore, suggests that Kyn might be accountable for the promotion of wound healing not only through reduction of pro-inflammatory cytokines and chemokines but also by stimulation of angiogenesis. When the expression of these genes in Kyn-treated splenocytes was evaluated by qPCR, with the exception of IL-1ra and CXCL2, whose level of gene expression increased, the expression of almost all other chemokines showed a marked reduction (Figure 2-1). These findings show consistency between data generated from qPCR and those of protein microarray. Th-17 cells are a subset of T helper cells producing interleukin 17 (IL-17), and their role is well recognized in development of autoimmunity (103,261). They are particularly suggested to play a key role in inflammation and tissue injury (262). Data generated from both the protein array of conditioned medium collected from the Kyn-treated splenocytes and the corresponding extracted RNA showed a marked reduction of IL-17 protein and gene expression, respectively. Further, we evaluated the number of 44  Th-17 cells in a mixture of splenocytes treated with 100 µg/mL of Kyn. The finding clearly showed a marked reduction (three-fold) in the number of IL-17 positive CD4+ T cells in response to Kyn treatment (Figure 2-3). This finding is consistent with those data obtained from the protein microarray and qPCR analysis. It is likely that, this is due to its interaction with cytosolic AhR (263,264). However, this needs to be verified. In skin repair, infiltrating leukocytes combating invading pathogens are also involved in tissue degradation and tissue formation. However, excessive or reduced infiltration of leukocytes into damaged tissue has effects on other cell migration, proliferation, differentiation, and quality of the healing response. One of the promising strategies to modulate tissue remodeling diseases such as healing disorders and various chronic inflammatory diseases is controlling inflammatory response in wound repair (242). To validate our findings in an animal wound healing model, here we showed that topical application of Kyn cream resulted in less infiltration of CD3+ T cells at the wound site during the inflammation phase (day 3 and 6 post wounding) (Figure 2-5) as compared to those of cream only and untreated wounds. The lower number of CD3+ cells at a wound site is likely to be due to Kyn inhibitory effects on activated infiltrated CD3+ cells at the wound site. Both innate and adaptive arms of the immune system are important regulators of the complex series of events that lead to wound healing (265). However, under similar experimental conditions, the number of macrophages was not significantly changed between treated and untreated wounds. This finding is consistent with our previous report indicating that Kyn has no influence on proliferation of macrophages in an in vivo model (266).  In summary, here we have provided compelling evidence that Kyn is a potent anti-inflammatory factor for a mixture of immune cells relevant to those found in the wound healing process. Kyn not only suppresses the key pro-inflammatory cytokines and chemokines such as IL-17 but also inhibits the proliferation of T cells in a wound healing model. As such, we propose that Kyn can be used as an anti-inflammatory factor for those wounds where healing is compromised by the prolonged persistency of inflammation. 45  Chapter 3.  Kynurenic Acid Down Regulates IL-17/1L-23 Axis in vitro 3.1 Introduction DCs, as key mediators of innate immunity, are involved in establishing central and periphery tolerance. As such DCs are integral in regulating the activation and suppression of the immune system (267). In addition to presenting antigen in the form of peptide-MHC (major histocompatibility) complex to T cell receptor (TCR) (268,269) and interaction of co-stimulatory molecules on DCs with their receptors on T cells (270,271), cytokines secreted by activated DCs serve as the third signal in T cell activation and differentiation into specific subset (272,273). Among different cytokines produced by DCs, it has been shown that IL-23 is a crucial cytokine that promotes the expansion and survival of Th17 cells. Since its discovery, IL-23 has been linked to the inflammatory pathogenesis of many autoimmune diseases (274). IL-23 is a heterodimer, composed of a 19-kD subunit (IL-23p19) linked to a 40-kD subunit (IL-12p40), which is shared with IL-12 (179) through disulfide band.  IL-23 receptor is differentially expressed on Th17 cells, but not on Th1, Th2 or Treg (275). Different studies utilizing an IL-23 receptor knockout revealed that in the absence of IL-23R, Th17 cells failed to maintain the Th17 effector program and exhibited reduced proliferation (275–277). IL-17 which is mainly produced by Th17 cells is a potent inflammatory cytokine (278) and it has been demonstrated that IL-17-producing Th17 are associated with autoimmunity (279) such as rheumatoid arthritis (280,281), systemic lupus erythematosus (282,283), multiple sclerosis (284), psoriasis (97,98), inflammatory bowel disease (285), and allergy and asthma (286,287). Recent discoveries have shown that certain autoimmune diseases are largely mediated by an upregulated IL-23/IL-17 response (274,288). These studies have demonstrated that the IL-23/1L-17 axis plays a crucial role in different autoimmune diseases (137,289–292). Ustekinumab, a new monoclonal antibody targeting the shared subunit IL-23/23p40, was the first biologic to be used in patients with psoriasis (293,294) Although other IL-12/23p40 inhibitors continue to demonstrate effectiveness in treating psoriasis, data supporting the positive role of IL-12 in immune defense suggests that undesirable side effects may result from blocking 46  this cytokine. Evidence from mouse models and preliminary data in human showed that rather specifically targeting IL-23p19 may be a safer treatment option (295). Generally, monoclonal antibodies are an effective and specific therapeutic approach, however their cost and high risk of side effects, most importantly, the rates of onset of tumor (296), rank them lower in preference when compared to chemical entity drugs. Early work exploring the immunomodulatory enzyme Indoleamine 2,3-dioxygenase demonstrated that not only does it play a key role in suppressing the maternal T-cell response against the fetus but also it has an immunoregulatory role during infections, pregnancies, autoimmunological processes, neoplasm growth and after organ transplantations (297–299). As IDO catabolizes tryptophan, an essential amino acid, it creates a localized environment deficient in tryptophan and rich in IDO metabolites, consequently preventing T cell activation and expansion (300). Additionally, the IDO metabolites, such as Kynurenic Acid (KynA), enhance this effect through pro-apoptotic mechanisms on activated T cells (301). KynA is of particular interest as a known neuroprotective agent that is selective for GPR35 receptors, NMDAR (antagonist) and is one of the final, end-stage products of the kynurenine pathway (302,303). KynA receptor, (GPCR35), is expressed mainly on cells connected with the immune system (235,304,305). Wang and his colleagues in 2006 demonstrated that, KynA induces GPCR35 and Gi/0 of G protein subunit that inhibits the production of cAMP from ATP. They also showed that GPCR35 can be detected on various subpopulation of immune cells, such as dendritic cells (235).  In this study, we conducted a series of experiments to investigate whether IL-17 and IL-23 proteins and their gene levels are modulated in response to KynA treatment. Our findings demonstrated that the expression of IL-23p19 by LPS-stimulated DCs was reduced in response to KynA. Furthermore, the expression of IL-17 and the number of Th-17 cells significantly decreased in CD4+ T cells treated with KynA. As IL-23p19 can be induced by elevated cAMP (306), here we showed that the activation of GPCR35 and reduction of cAMP by KynA is involved in suppression of LPS-induced IL-23p19. 47  3.2 Material and methods  3.2.1 Materials Lipopolysaccharide (LPS) from Escherichia Coli, Concanavalin A (ConA), Kynurenic acid (KynA), 3-isobutyl-1-methylxanthine (IBMX) and forskolin (FRSK) were purchased from Sigma-Aldrich (Oakville, Ontario, Canada). Methyl–5-[(tert-butylcarbamothioylhydrazinylidene) methyl]-1-(2,4-difluorophenyl) pyrazole-4-carboxylate (CID2745687 or CID) was from Santa Cruz Biotechnology (Dallas, Texas, USA). Tissue culture (RPMI-1640) and Fetal bovine serum (FBS) were obtained from Gibco-Life Technologies (Burlington, ON, Canada). Recombinant mouse Granulocyte-macrophage colony-stimulating factor (rmGM-CSF), eFleur-conjugated anti-mouse IL-17 Clone eBio17B7, FITC-conjugated anti-mouse CD4 Clone GK1.5, FITC-conjugated anti-mouse CD86 Clone GL1, eFleur-conjugated anti-mouse IL-23p19 Clone fc23cpg, fixation-permeabilization buffer and permeabilization buffer were from eBioscience (San Diego, CA, USA). Anti-PE-conjugated anti-mouse CD11c Clone N418, EasySep™ Mouse CD11c Positive Selection Kit II and EasySep™ Mouse Tcell Enrichment Kit were from Stemcell technologies (Vancouver, BC, Canada). Petri dishes were from 60 mm × 15 mm from VWR (Edmonton, Alberta, Canada). GeneJET RNA purification Kit was from Fisher Scientific (Ottawa, Ontario, Canada). Penicillin-Streptomycin (10,000 U/mL), Superscript III First Strand cDNA Synthesis Kit and TRIzol were from Invitrogen (Carlsbad, CA, USA).  3.2.2 Bone marrow preparation Femur and tibiae of 8-10 weeks old male C57BLr6 were removed and cleaned from the surrounding muscle tissue. Intact bones were then left in 70% ethanol for 2–5 min for disinfection and washed with phosphate-buffered saline (PBS). Then both ends were cut with scissors and the bone marrow (BM) flushed with RPMI-1640, using a syringe with a 0.45 mm diameter needle. After centrifugation and re-suspending cells in RPMI-1640, about 3 × 107 leukocytes were obtained per femur or tibia. 48  3.2.3 Dendritic cells isolation and culture Isolation of BM-DCs with rmGM-CSF was adapted from the previously reported method as follows (307). Briefly, Petri dishes 60 mm × 15 mm were used and cell culture medium, RPMI-1640, was supplemented with 10% FBS, 0.1 U/mL penicillin-streptomycin. At day 0, BM leukocytes were seeded at 2 × 106 per 60 mm dish in 6 mL medium containing 20 ng/mL rmGM-CSF. On days 3 and 6 culture supernatant from each dish was collected (3 mL), centrifuged, and the cell pellet was resuspended in 3 mL fresh RPMI-1640 containing 20 ng/mL rmGM-CSF and transferred back into the original dish. On days 8, 10 ng/mL rmGM-CSF was added to fresh medium and transferred back into the original dish. On day 10, cells were harvested and isolated using EasySep™ Mouse CD11c Positive Selection Kit II.  3.2.4 T cell isolation and culture  The male C57BL/6 mouse spleens were obtained from the developmental neurobiology research laboratory, department of ophthalmology and visual science, university of British Columbia, Vancouver, BC, Canada and gently pressed against 40 µm nylon mesh to pass and release splenocytes into culture medium. Splenocytes were washed and T cells were isolated using EasySep™ Mouse T Cell Enrichment Kit. T cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 0.1 U/mL penicillin-streptomycin and maintained in a 37°C humidified incubator containing 5% CO2.  3.2.5 Quantitative real-time PCR analysis  In order to evaluate the effective concentration of LPS on IL-23p19 gene expression, CD11c+ DCs were seeded at 2 × 106 cells per well on 48-well tissue culture plates and either stimulated with six different concentrations of LPS (100 and 500 ng/mL, 1, 2, 5, and 10 µg/mL) or left unstimulated (control). Total RNA was extracted, using GeneJET RNA purification Kit, at set time points of: 1, 2, 4, 6, 8, 12 and 24 hours. To investigate the effect of KynA on IL-23p19 gene expression, CD11c+ DCs were cultured on 48-well tissue culture plates (2 × 106 cells per well) and stimulated with LPS (5 µg/mL) as a positive control. Similarly, stimulated and unstimulated cells were cultured with different concentrations of KynA (25, 50, 100, and 150 µg/mL). Cells were harvested after 4 hours and total RNA was extracted 49  using Gene JET RNA purification Kit. ConA activated or inactivated isolated T cells were cultured in either RPMI-1640 or RPMI-1640 containing KynA (100 µg/mL). After 24 hours of incubation, cells were harvested and total RNA was extracted using TRIzol reagent according to the manufacturer’s instructions.  RNA (5 µg) was then transcribed into cDNA using the Superscript III First Strand cDNA Synthesis Kit. IL17 mRNA levels in isolated T cells and IL-23p19 mRNA levels in DCs were measured by Applied Biosystems 7500 qPCR machine using fast start universal SYBR green master mix (Rox). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 (small nuclear RNA, snRNA) were used as the house keeping gene for CD4+ T cells and DCs. 2-ΔΔCT method was used to calculate the gene expression fold change, relative to that of control.  The sequences of primers were: IL-23p19: 5’-TGCAGATGCACAGTACTCCA-3’, 5’-GCA-GCTTTGT-CACAGGTCAT-3’; IL-17: 5’-GCTCCAGAAGGCCCTCAGA-3’, 5’-AGCTTT-CCCTCCGCATTGA-3’; GAPDH: 5’-GACAAGCTTCCCGTTCTCAG-3’, 5’-CAATGACC-CCTTCATTGACC-3’; U6: 5’-CTCGCTTCGGCAG-CACA-3’, 5’-AACGCTTCACGAAT-TTGCGT-3’. 3.2.6 Flow cytometric analysis  In order to explore the effect of KynA on IL-23 production in DCs, CD11c+ DCs were seeded at 1 × 106 cells per well on 48-well tissue culture plates. DC’s were stimulated with LPS (5 µg/mL) as a positive control. Stimulated and unstimulated DCs were either left untreated or treated with 100 µg/mL KynA for 48 hours. To investigate the mechanism by which KynA reduces LPS-induced IL-23p19 production in DCs we inhibited GPCR35. For this purpose, CD11c+ DCs were cultured at 1 × 106 cells per well on 48-well tissue culture plates. Stimulated or unstimulated DCs were either incubated with 100 µg/mL of KynA or remained untreated. 3 µM of CID was added to another set of stimulated and unstimulated DCs, with or without 100 µg/mL KynA treatment. After harvesting cells, the cells were labeled by incubation for 30 minutes at 4°C with cell membrane PE-conjugated anti-mouse CD11c and FITC-conjugated anti-mouse CD86 according to the manufacturer’s recommendations. Cells were then 50  fixed and permeabilized using a fixation-permeabilization buffer (eBioscience, San Diego, USA), followed by intracellular staining using eFleur-conjugated anti-mouse IL-23p19.  For determining the effect of KynA on Th17 cells, as previously described (230), isolated T cells were cultured in 48-well flat-bottom plates (5 × 105 cell/well) and either stimulated with ConA (5 µg/mL) or left unstimulated. Activated and inactivated T cells were either left untreated or treated with 100 µg/mL KynA for 48 hours. After harvesting cells, the cells were stained for cell membrane FITC-conjugated anti-mouse CD4 diluted in PBS with 1% FBS according to the manufacturer’s recommendations. Cells were then fixed, permeabilized (as previous) and incubated for 45 minutes at room temperature. Cells were then washed once with permeabilization buffer and eFleur-conjugated anti-mouse IL-17 (0.5 µg/100 µL) was added. The percentage of CD4+IL-17+ cells, CD11c+ CD86+ IL-23+ cells were then detected and analyzed by Accuri C6 Flow Cytometer, gated on physical parameters and fluorochrome staining were integrated for the measurement of both cell surface and intracellular cytokine staining. A total of 50,000 events were recorded for each assay. 3.2.7 Determination of cAMP levels in DCs To study the signaling pathway involved in KynA inhibitory effect on LPS-induced IL-23p19 DCs, after ten days culturing, DCs were seeded and stimulated at 2 × 104 cell per well in 96-white clear bottom plate with 10 µM forskolin (FRSK) for 2 hours in the presence of 500 µM 3-isobutyl-1-methylxanthine bioultra (IBMX), a competitive nonselective phosphodiesterase inhibitor. GPCR35 antagonist, CID, was added 15 minutes prior to application of KynA. KynA at the concentration of 100 µg/mL was added and cells were incubated for 45 minutes at room temperature. The cAMP level was evaluated using cAMP-GloTM Max Assay (Promega, Wisconsin, USA). Briefly, after induction, the cells were lysed and cAMP was detected by the addition of cAMP Detection Solution, which contains PKA. The Kinase Reagent was then added to terminate the PKA reaction and detect the remaining ATP via a 51  luciferase reaction. Plates were read using a GloMax-Multi+Microplate Multimode Reader (Promega). Luminescence was correlated to the cAMP concentrations using a cAMP standard curve. 3.2.8 Statistical analysis All data are reported as mean ± SD of three or more independent observations. Data were analyzed with one-way t-test or one-way ANOVA followed by post hoc evaluation using Bonferroni correction for multiple comparisons. P values <0.01 were considered statistically significant. 3.2.9 Ethics statement All methods and procedures as well as the use of animals and tissue specimens derived from animals are approved by Animal Ethics Committees of the University of British Columbia. Care and maintenance of all animals used in this study were in accordance with the principles of laboratory animal care and the guidelines of the institutional Animal Policy and Welfare Committee at The University of British Columbia. 3.3 Results Optimal effective dose of LPS for the induction of strong IL-23p19 expression was first determined by scaling the dose of LPS added to cultured DCs at different time-points. The result showed no detectable level of IL-23p19 mRNA in LPS untreated DCs and this remained unchanged at low concentration of LPS (100 and 500 ng/mL) (Figure 3-1). However, as shown in Figure 3-1, LPS concentration greater than 1 µg/mL significantly increased the IL-23p19 mRNA expression as compared to that of control after 4 hours (LPS 1 µg/mL, 1.20 ± 0.01 fold; 2 µg/mL, 1.45 ± 0.11 fold; 5 µg/ml, 1.58 ± 0.13 fold; 10 µg/m, 1.48 ± 0.08 fold; P < 0.01, n = 3). IL-23p19 mRNA expression peaked after 4 hours and then dramatically decreased thereafter.  52   Figure 3-1. The effect of different LPS concentrations on IL-23p19 gene expression in dendritic cells. DCs treated with six different concentrations of LPS (100 and 500 ng/m, 1, 2, 5, and 10 µg/mL). Cells were collected for qPCR after 1 hour, 2, 4, 6, 8, 12 or 24 hours. The significant (P < 0.01) differences have been indicated by asterisks (*) (n = 3).  The effect of scaled-up dosing of KynA on IL-23-19 gene expression was assessed in stimulated DC’s. Here DCs were incubated with either nothing (control) or 5 µg/mL of LPS, a strong stimulus for IL-23p19 gene expression in DCs (1.48 ± 0.07 fold; P < 0.01, n = 3) in the presence of different concentrations of KynA. The result showed a marked decrease in IL-23p19 mRNA expression of 100 and 150 µg/mL of KynA stimulated DCs (0.99 ± 0.07 fold, 0.99 ± 0.11 fold; P < 0.01, n = 3) after 4 hours. However, no significant effect was observed when 25 and 50 µg/mL of KynA were used (Figure 3-2).  53   Figure 3-2. The effect of different concentrations of KynA on the gene expression of IL-23p19 in active dendritic cells. Stimulated (LPS 5 µg/mL) and unstimulated CD11c+ DCs were cultured with different concentrations of KynA (25, 50, 100 and 150 µg/mL). Cells were harvested after 4 hours. The significant (P < 0.01) differences have been indicated by asterisks (* ) (n = 3).  As 100 µg/mL of KynA has been identified to be effective metabolite influencing the gene expression of IL-23p19 in LPS stimulated DCs, here we asked whether this metabolite influences the number of IL-23p19-producing DCs. The results in Figure 3-3A and B show that the frequency of IL-23p19+ DCs in stimulated DCs, markedly increased as compared to that of unstimulated DCs (3.3 ± 0.5%, 0.5 ± 0.4%; p < 0.05, n = 3). However, the increased frequency of IL-23p19+ DCs was then significantly decreased (0.5 ± 0.1%; P < 0.05, n = 3) in response to 100 µg/mL Kyn treatment as compared with stimulated DCs.   54   Figure 3-3. Flow cytometry analysis for the effect of KynA (100 µg/mL) on activated IL-23-producing dendritic cells. (A) CD11c+ DCs either stimulated with 5 µg/mL LPS or left unstimulated. Stimulated and unstimulated DCs were either left untreated or treated with 100 µg/mL KynA for 48 hours. (B) The frequency of CD11c+ CD86+ IL-23+ cells in CD11c+ DCs population. The significant (P < 0.01) differences have been indicated by asterisks (*) (n = 3).  55  Among many cytokines produced by DCs, it is widely accepted that IL-23 is crucial for the expansion and survival of Th17 cells. As KynA (100 µg/mL) significantly decreases the expression of IL-23p19 and the number of IL-23p19+ DCs, here, we wanted to know if KynA could secondarily reduce the number of Th17 cells as well. In the absence of KynA treatment, we found that IL-17+ T cells, in a population of activated T cells, markedly increased when compared to that of inactivated control (5.6 ± 0.56%, 1.4 ± 0.20%; p < 0.01, n = 3). In contrast, when the activated T cell population is exposed to KynA (100 µg/mL), the population of IL-17+ T cells was significantly decreased (4.0 ± 0.37%; P < 0.01, n = 3) (Figure 3-4A and B). Further, the reduction of IL-17+ cells was consistent with a significant reduction seen in IL-17 gene expression as compared to that of non-treated activated controls (7.9 ± 3.2, 25.5 ± 2.1; P < 0.01, n = 3) (Figure 3-4C).   56   Figure 3-4. Flow cytometry analysis for the effect of KynA (100 µg/mL) on Th17 cells. (A) CD4+ T cells were cultured and either stimulated with ConA (5 µg/mL) or left unstimulated. Activated and inactivated CD4+ T cells were either left untreated or treated with 100 µg/mL KynA for 48 hours. (B) The frequency of percent IL-17+ CD4+ cells in CD4+ cell population. (C) ConA-activated or inactivated isolated CD4+ T cells were cultured in either RPMI-1640 or RPMI-1640 containing KynA (100 µg/mL). 57  After 24 h of incubation, cells were harvested and total RNA was extracted. The significant (P < 0.01) differences have been indicated by asterisks (*) (n = 3).  Previous work has demonstrated that increased cAMP can induce IL-23p19 (304). As KynA interaction with GPCR35 (specifically the Gi/0 of G protein subunits) inhibits the conversion of cAMP from ATP, we hypothesized that by inhibiting cAMP, KynA can block the production of IL-23p19. To test this hypothesis, we have used FRSK as it has been widely used to increase cAMP in cells (308,309). As shown in Figure 3-5A, KynA (100 µg/mL) significantly reduced the FRSK-induced cAMP accumulation in DCs as compared with FRSK-treated DCs (68.3 ± 6.1%; P < 0.01, n = 3). We then determined the dose-dependent impaired production of cAMP by a GPCR35 inhibitor, CID. The results showed that CID suppresses the inhibitory effect of KynA on FRSK-induced cAMP formation in a dose-dependent manner in DCs. We further used 3 µM CID and assessed the inhibitory effect of KynA on the LPS-induced IL-23p19 production by flow cytometry analysis of CD11c+ IL-23p19+ DCs frequency. Our data showed that CID prevented the inhibitory effect of KynA on IL-23p19 production in DCs as compared to LPS-KynA-treated cells (2.7 ± 0.3%, 1.7 ± 0.1%; P < 0.01, n = 3) (Figure 3-5B and C).     58   Figure 3-5 A. Analyzing the mechanism by which KynA suppress LPS-induced IL-23p19 production in DCs. A: DCs were stimulated with 10 µM forskolin (FRSK) for 2 hours. GPCR35 competitive inhibitor, CID, was added 15 minutes prior to application of KynA. KynA at the concentration of 100 µg/mL was added, and cells were incubated for 45 minutes at room temperature. The significant (P < 0.01) differences have been indicated by asterisks (*) (n = 3).   59    Figure 3-5 B and C. Analyzing the mechanism by which KynA suppress LPS-induced IL-23p19 production in DCs. B, C: assessing the inhibitory effect of KynA on the LPS-induced IL-23p19 production by flow cytometry analysis of CD11c+ IL-23p19+ DCs frequency by 3 µM CID. The significant (P < 0.01) differences have been indicated by asterisks (*) (n = 3).    60  3.4 Discussion  IL-23 is a cytokine predominantly produced by activated dendritic cells (DC) found within peripheral tissues (skin, intestinal mucosa and lung) (310). The selective expression of IL-23 in inflamed intestine and psoriatic lesions suggests that targeting the IL-23 pathway may have the potential of a more specific therapeutic approach in modulating the immune system in these disease states. Toll- like receptor (TLR) signaling plays an important role in regulation of IL-23 production by myeloid-derived DCs. Different studies have confirmed that the in vitro and in vivo activation of TLRs leads to subsequent DC maturation and production of IL-23 (178). Some recent studies have used different concentrations of LPS to stimulate the maturation and IL-23 production in DCs (310–312). As there is a discrepancy in LPS concentrations used, here we first conducted a series of experiments to examine the effective concentration of LPS on IL-23p19 expression. The result showed that LPS at a concentration of 5 µg/mL strongly stimulates the expression of IL-23p19 in DCs. Although the immunoregulatory role of IDO and the IDO-pathway have been explored in depth, our central focus was to elucidate the potential role of KynA (a generally safe IDO-end-product) in suppressing inflammation related cytokines, specifically IL-23 production in DCs. Here we demonstrated for the first time that KynA, in a dose dependent manner, can block the expression of IL-23p19 in LPS-activated DCs. We also showed that an increased frequency of IL-23p19-producing DCs is significantly decreased in response to 100 µg/mL Kyn treatment. KynA, a known neuroprotectant, has shown to inhibit leukocyte activation in a canine model of intestinal inflammation (314). Furthermore KynA decreases the inflammatory activation and colonic motility in the early phase of acute experimental colitis in the rat (315). KynA is also able to attenuate LPS-induced tumor necrosis factor-α (TNF-α) secretion by mononuclear cells (316). Recent studies suggest that IL-17-producing T cells are responsible in pathophysiology of many diseases such as psoriasis (317), inflammatory bowel disease (IBD) (318), rheumatoid arthritis (281,319) and multiple sclerosis (284,320). As IL-23 plays a central role in the Th17 cells expansion (321), there is a developing interest among scientists to evaluate the involvement of the IL-23/IL-17 axis as a potential 61  target in these inflammatory diseases (322). The significant of this study is that, KynA not only has been identified to be effective metabolite influencing the gene expression of IL-23p19 in LPS stimulated DCs, it influences the number of IL-23p19-producing DCs, it also reduces the number of Th17 cells which is consistent with a significant reduction in IL-17 gene expression. Binding of extracellular ligands to GPCRs alters the conformation of the associated heterotrimeric Gα and Gβγ subunits and the initiating of cascade of cellular events. G protein classes are defined based on the sequence and function of their alpha subunits, which in mammals fall into several sub-types: G(S)α, G(Q)α, G(I)α and G(12)α (323,324). GPCR35 is predominately detected in immune cells such as DCs(235). Wang and et al, suggested that KynA regulating action in peripheral cells is through activation of GPR35 which couples to a Gi/o pathway. Gi/o subunit (Gαi or Gi/Go) is a heterotrimeric G protein subunit that suppresses the production of cAMP from ATP via inhibiting AC (325). Induction of IL-23p19 gene expression by LPS depends on the TLR4 and MyD88 pathway (326). Further, it has been shown that cAMP production also increases IL-23 (306). We used CID as a known GPCR35 competitive inhibitor to suppress the activation of AC and production of cAMP (327). Our result generated from blocking the GPCR35 on DCs (via CID) indicates that suppression of LPS-induced IL-23p19 by KynA is mediated through antagonist inhibition of GPCR35, thereby preventing AC activity and formation of cAMP. Uh and et al has previously investigated the role of MyD88 and its adaptor protein, TRIF, with respect to upregulation of cAMP (328). Although, our finding suggests that, IL-23p19 gene expression is stimulated through MyD88 activation, the inhibition of AC (as a secondary pathway) reduces total IL-23 production in stimulated DC’s. Among various subpopulations of immune cells, GPR35 was detected in CD14 monocytes, T cells, neutrophils, and dendritic cells, with lower expression in B cells, eosinophils, basophils, and platelets(235). As such, KynA may suppress the expression of IL-17 in Th17 cells through inhibition of GPCR35. In summary, KynA suppresses the production of IL-17 and IL-23 in vitro in CD4+ T cells and DCs, respectively. Further, we observed that inhibitory effect of KynA in production of IL-23 in DCs 62  occurs through GPCR35 activation. As such, KynA can potentially be used as an immunomodulatory agent in the treatment of some IL-23 and IL-17 related autoimmune diseases.  63  Chapter 4.  IDO-expressing Fibroblasts Suppress the Development of Imiquimod-induced Psoriasis-like Dermatitis 4.1 Introduction Psoriasis is one of the most common recurrent chronic inflammatory diseases of the skin, affecting 2–3% of the general population (93). This disease is an organ-specific autoimmune disease induced by an activated cellular immune system (74). Histologically, psoriasis has a defining appearance. There is marked thickening of the epidermis due to increased proliferation of keratinocytes (parakeratosis), decreased differentiation in the interfollicular epidermis, elongation of epidermal rete with thin downward projections into the dermis, increased angiogenesis and dermal infiltration of inflammatory cells, including T cells, granulocytes, macrophages and dendritic cells (DCs) (93). Triggering factors for disease manifestation include local traumas, infections, and reactions to various drugs (329). In the development of psoriasis, keratinocytes and immune cells interact with each other through the production of cytokines. Recent studies have demonstrated that the IL-23/Th17 pathway is linked to psoriasis (137). These data indicate that inflammatory myeloid dendritic cells expressing IL-23 initiate a set of signals that are crucial for development and maintenance of Th17 (90). The activated Th17 cells further secrete IL-17 and IL-22, which promote further recruitment of immune cells, keratinocyte proliferation, and sustained chronic inflammation (90,97,98). Medications that are used to treat moderate to severe psoriasis include 1) oral drugs such as methotrexate (an antimetabolite and anti-inflammatory), acitretin (a vitamin A derivative), apremilast (a small molecule modulator of cAMP), and cyclosporine (an immunosuppressant), 2) phototherapy, i.e. ultraviolet light treatment to the whole body, and 3) biologic therapies such as TNF inhibitors and IL-17 and IL12/23 inhibitors. In fact, there are now several drugs and biological monoclonal antibodies (LY-2439821, AMG-827, and AZ17) commercially available for different phases of human clinical trial that target IL-23/IL-17 axis (330,331). Although the use of these injectable medicines for treatment of systemic psoriasis is far more effective than other 64  treatments, their costs and high risk of side effects still make them undesirable. Reports from patients treated with IL-12 and/or IL-23 cytokine deficiency syndromes showed potential opportunistic infections such as salmonellosis and mycobacterial in these patients. These reports showed that immunity against these microorganisms appears to be dependent on the expression of IL-12 and/or IL-23 (332,333). As such, there is still a need to find a new strategy through which not only patchy but also generalized psoriasis can be treated without compromising the functionality of the immune system and causing any potential side effects.  Indoleamine 2,3-dioxygenase (IDO) is a cytosolic rate-limiting enzyme that breaks down tryptophan (Trp) (Figure 1-5); it is present in macrophages, dendritic cells, and trophoblast (334). Munn et al. showed that antigen-presenting cells (APCs) could regulate T cell activation through Trp catabolism (300). The expression of IDO by certain APCs in vivo allows them to suppress unwanted T cell response (207). We have also found that the environment generated from IDO-expressing skin cells can suppress inflammatory cell proliferation and induce some subsets of T lymphocyte apoptotic death but not of skin cells (243). These findings encouraged us to conduct a set of experiments to see whether injection of IDO-expressing fibroblasts can be used for treatment of psoriasis. For this study, we have used an imiquimod (IMQ) (Aldara cream) induced psoriatic-like skin lesion in a mouse model that has previously been employed as a model of psoriatic diseases (335). Disease has been induced by daily topical application of 20 mg/cm2 of IMQ (Aldara cream), a toll-like receptor (TLR) 7 and TLR8 ligand, on the skin of the back and the right ear for six consecutive days. Our findings revealed that critical factors associated with psoriasis, such as clinical appearance, skin erythema and scaling score, skin thickness, the number of infiltrated IL-17-producing T cells, and IL-23-producing dendritic cells, are significantly improved upon injecting IDO-expressing fibroblasts.  65  4.2 Material and methods 4.2.1 Preparation of IDO-expressing fibroblasts As described in our previous report (336), primary dermal fibroblasts from allogeneic C57Bl/6 mice were isolated from skin biopsies and then infected with Lenti-associated Virus (IDO-LAV) bearing the IDO-Red Cherry gene. We constructed this vector and used it to transduce fibroblasts; we previously showed a significant increase in the level of IDO protein by western blot analysis and IDO activity as evaluated by measuring the level of Kyn. In brief, mouse fibroblasts were seeded on flat-bottom cell culture plates and incubated with the IDO-AAV. Following verification of IDO expression and enzyme activity, these cells were used for Intra-lesional injection of IDO-expressing fibroblasts for localized and generalized psoriasis, respectively. 4.2.2 Mice and treatment At 8 to 10 weeks, female BALB/c mice were purchased from the Jackson Laboratory (Bar Harbor, ME). Mice received a daily topical dose of 55 mg of imiquimod (IMQ) cream (5%) (Aldara; 3M Pharmaceuticals, London, Ontario) on the shaved back and 5 mg on the right ear for 6 days to generate localized psoriasis. This dose was determined to induce psoriasis-like skin inflammation. At day 3 some mice were either left untreated or treated with intra-lesional injecting medium, 4 × 106 fibroblasts or 4 × 106 IDO-expressing fibroblasts on four spots at skin dorsal. As a result, mice were divided into five groups: normal, medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The lesions were photographed every other day. The presence of erythema and scaling of the back skin and ear were scored on a scale from 0 to 4 by a non-biased observer (0, none; 1, slight; 2, moderate; 3, marked; 4, very marked). Skin and ear thickness were measured every other day using digital calipers. Upon euthanizing at day 9, the size and weight of the auxiliary lymph node and spleen taken from psoriatic and treated mice were evaluated.  66  4.2.3 Flow cytometry Mice were euthanized on day 9 and dorsal skins, right ears, spleens, and lymph nodes were collected. Dorsal skins and right psoriatic ears were minced and left in Collagenase D (1 mg/mL) for 30 minutes. Samples were then gently pressed against 40 µm nylon mesh to pass through it and release cells into the culture medium. Spleen and lymph nodes were mined through 40 µm nylon mesh to obtain single-cell suspensions. Cells were stimulated in Cell Stimulation Cocktail (cocktail of phorbol 12-myristate 13-acetate (PMA), ionomycin, brefeldin A and monensin) (plus protein transport inhibitors) over night. To perform surface staining, 1 × 106 cells were stained for 30 minutes at room temperature in 1% FBS + PBS containing the following antibodies: PE-conjugated anti-CD4 for T cells; FITC-conjugated anti-γδ for T cells; eFleur-conjugated anti-IL-17 and FITC-conjugated anti-Gr-1 for granulocytes; APC-conjugated anti-F4-80 and PE-conjugated anti-CD11b for macrophages; and FITC-conjugated anti-CD11c PE-conjugated anti-CD86 and eFleur-conjugated anti-IL-23 for dendritic cells. In the next step, the cells were fixed and permeabilized using a fixation-permeabilization buffer and incubated for 45 minutes at 4°C. Cells were then washed once with permeabilization buffer followed by intracellular staining using eFleur-conjugated anti-mouse IL-17 (0.5 µg per 100 µL) and eFleur-conjugated anti-mouse IL-23 (0.5 µg per 100 µL). Cells were analyzed by a BD Accuri™ C6 Flow Cytometer, gates on physical parameters. A total of 20,000 events were recorded for each assay. All reagents were from eBioscience, San Diego, USA. 4.2.4 Histological analyses and immunostainings Back skins of mice were harvested at the endpoint of experiments, fixed in 10% buffered formalin solution, and embedded in paraffin. Sections (5 µm thickness) from tissue were stained with hematoxylin and eosin (H&E) and keratinocyte proliferation (parakeratosis) was analyzed by light microscopy. Single immunofluorescence staining for CD3 was done on5 µm thick sections of skin. Sections were rehydrated, and nonspecific binding was blocked. Sections were then incubated overnight 67  at 4°C with rabbit anti-CD3 primary antibodies (1:50 dilution; Abcam, Cambridge, MA). Sections were then washed and incubated with Rhodamine goat anti-rat IgG secondary antibody (Jackson ImmunoResearch, West Grove, PA) for 45 minutes. Finally, the slides were dehydrated and mounted in Permount (Fisherbrand).  4.3 Statistical analysis Data are reported as mean ± standard deviation for three or more independent sets of experiments. The statistical differences of mean values among treated and control groups were tested with one-way ANOVA followed by post hoc comparisons using the Bonferroni correction. P-values less than 0.05 were considered statistically significant. 4.4 Results  4.4.1 Intra-lesional injection of IDO-expressing fibroblasts improves clinical appearance of psoriasis Our findings using an Aldara-induced psoriatic mouse model showed that daily topical application of Aldara caused skin erythema as early as day 3 post Aldara application and it remained high up to day 9 (Figure 4-1A). However, intra-lesional injection of IDO-expressing fibroblast and to a lesser extent non-IDO-expressing fibroblast significantly improved psoriatic-induced erythema (Figure 4-1A). To visualize whether IDO-expressing fibroblast remained within the dermal environment, frozen sections from mice skin at day 9 were examined using fluorescence confocal microscopy (Figure 4-1B). It was also important to investigate if IDO-Red Cherry expressing cells migrate to local lymph nodes (auxiliary lymph node) and our results showed that some of the cells migrated to lymph nodes (Figure 4-1C). Upon termination on day 9, regional lymph nodes and spleens were taken and compared. The size and weight of the lymph nodes taken from psoriatic mice treated with intra-lesional injection of IDO (6.2 ± 0.8 mg vs. 15.3 ± 0.6 mg, n = 3, P < 0.01) and to a lesser extent non-IDO-expressing cells (11.7 ± 1.6 mg vs. 15.3 ± 0.6 mg, n = 3, P < 0.01) were markedly lower than those taken from the psoriatic mice (Figure 4-1D and E). No significant change was detected in the size and weight of treated and untreated psoriatic mice 68  spleen compared with psoriatic mice. Our data revealed that back skin and psoriatic ear erythema and silver scales scoring in those mice that received an intra-lesional injection of IDO-expressing fibroblasts were significantly less than those that received nothing, medium, or non-IDO-expressing fibroblasts (Figure 4-1F and G).                      69    Figure 4-1 A. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream. A) Daily topical application of Aldara causes skin erythema up to day 9; however, intra-lesional injection of IDO-expressing fibroblast and to a lesser extent non-IDO- expressing fibroblast significantly improved psoriatic-induced erythema (n = 3).           70   Figure 4-1 B and C. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream. B) Frozen sections of back skin of psoriatic mice injected with IDO-expressing fibroblast showing these cells remained within the dermal environment after 9 days. C) Frozen sections of lymph nodes showing migration of IDO-Red Cherry expressing cells to the lymph nodes (n = 3).         71     Figure 4-1 D and E. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream. D and E) The size and weights of the lymph nodes taken from psoriatic mice treated with intra-lesional injection of IDO and to a lesser extent non-IDO-expressing cells were markedly less than those taken from the psoriatic mice. The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).     72    Figure 4-1 F and G. Psoriasis-like skin inflammation induced in BALB/c mice by daily topical application of imiquimod (IMQ) cream. F and G) Back skin and psoriatic ear erythema and silver scales scoring in those mice that received intra-lesional injections of IDO-expressing fibroblasts were significantly less than in those that received nothing, medium, or non-IDO-expressing fibroblasts. Medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib) (n = 3).     73  4.4.2 Skin thickness reduces in psoriatic animal treated with IDO-expressing fibroblasts As shown in Figure 4-2A, the average of skin thickness of all mice, measured using a digital caliper, was 0.53 ± 0.04 mm at the start of the experiments, and daily application of Aldara cream significantly increased skin thickness at day 3 (0.69 ± 0.05 mm vs. 0.53 ± 0.04 mm, n = 20, P < 0.01). At day 6, i.e., 3 days after starting treatments, the thickness slightly decreased in mice receiving non-IDO (0.63 ± 0.06 mm vs. 0.69 ± 0.03 mm, n = 3, P > 0.05) or IDO-expressing fibroblasts (0.60 ± 0.05 mm vs. 0.69 ± 0.07 mm, n = 3, P > 0.05) as compared with day 3. Skin thickness in mice treated with intra-lesional injection of IDO-expressing fibroblasts (0.54 ± 0.05 mm vs. 0.69 ± 0.07 mm, n = 3, < 0.01) or non-IDO-expressing fibroblasts (0.54 ± 0.06 mm vs. 0.69 ± 0.03 mm, n = 3, P < 0.01) significantly decreased at day 9 compared with day 3 (Figure 4-2A). Similarly, the average of ear thickness of all mice treated with daily application of Aldara cream was significantly increased at day 3 compared with day 0 (11.12 ± 0.54 mm vs. 8.82 ± 0.57 mm, n = 20, P < 0.01) (Figure 4-2B). Our data showed no changes in ear thickness in mice with intra-lesional injection of IDO-expressing fibroblasts at day 6 (10.30 ± 0.58 mm vs. 11.00 ± 0.58 mm, n = 3, P > 0.05) and day 9 (10.30 ± 0.58 mm vs. 11.00 ± 0.58 mm, n = 3, P > 0.05) as compared with day 3 (Figure 4-2B). However, there was a marked increase in ear thickness in mice either left untreated (14.70 ± 0.58 mm vs. 12.00 ± 1.00 mm, n = 3, P < 0.01) or treated with injecting medium (14.33 ± 0.58 mm vs. 10.50 ± 0.00 mm, n = 3, P < 0.01) or non-IDO fibroblast (12.70 ± 1.1 mm vs. 11.00 ± 0.58 mm, n = 3, P < 0.01) at day 9 compared with day 3 (Figure 4-2B). The result of H&E staining of psoriatic skin lesion showed a significant increase in the thickness of the epidermal layer of mice left untreated (86.77 ± 16.82 µm vs. 11.61 ± 2.84 µm, n = 3, P < 0.01), treated with medium (61.72 ± 6.82 µm vs. 11.61 ± 2.84 µm, n = 3, P < 0.01), or treated with non-IDO fibroblast (69.19 ± 9.65 µm vs. 11.61 ± 2.84 µm, n = 3, P < 0.01) as compared with normal mice and a marked reduction in intra-lesional injected IDO-expressing fibroblasts as compared with normal mice (34.34 ± 10.42 µm vs. 11.61 ± 2.84 µm, n = 3, P < 0.01) (Figures 4-2C and D).   74   Figure 4-2 A and B. Epidermal thickness following cell therapy. A and B) Skin and ear thickness were measured every other day using a digital caliper. Skin thickness in mice treated with Intra-lesional injection of IDO-expressing fibroblasts or non-IDO-expressing fibroblasts significantly decreased at day 9 compared with day 3. There was a marked increase in ear thickness in mice either left untreated or treated with injecting medium or non-IDO fibroblast at day 9 as compared with day 3 (n = 3).           75   Figure 4-2 C and D. Epidermal thickness following cell therapy. C and D) The result of H&E staining of psoriatic skin lesions showed a significant increase in the thickness of epidermal layer of mice either left untreated or treated with medium or non-IDO fibroblast compared with normal mice, and a marked reduction in IL injected IDO-expressing fibroblasts compared with normal mice. Normal mice (Normal), Medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib) and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).   76  4.4.3 Intra-lesional injection of IDO-expressing fibroblasts reduces infiltration of granulocytes and macrophages It has been shown that monocytes and granulocytes numbers are predominant in the dermis and epidermis during the course of psoriasis inflammation (337). Granulocytes and macrophages can be identified as CD11b+ Gr-1+ and CD11b+ F4-80+ cells. Analysis of frequency of CD11b+ Gr-1+ cells in mice skin showed a marked increase in the number of these cells in untreated psoriatic mice (4.5 ± 0.3% vs. 0.9 ± 0.5%, n = 3, P < 0.01) and mice treated with Intra-lesional injection of either medium (4.2 ± 0.3% vs. 0.9 ± 0.5%, n = 3, P < 0.01) or non-IDO fibroblasts (3.9 ± 0.3% vs. 0.9 ± 0.5%, n = 3, P < 0.01) as compared with control (Figure 4-3A and B). The number of CD11b+ Gr-1+ cells significantly decreased in mice treated with psoriatic IDO-expressing fibroblasts as compared with untreated mice (2.5 ± 0.4% vs. 4.5 ± 0.3%, n = 3, P < 0.01) but not with normal mice (2.5 ± 0.4% vs. 0.9 ± 0.5%, n = 3, P < 0.01) (Figure 4-3A and B). Furthermore, our results showed that IMQ-induced psoriatic-like inflammation correlated with the significant increase in the number of granulocytes in ear skin (6.1 ± 0.8% vs. 3.1 ± 0.2%, n = 3, P < 0.01) and remained high in mice treated with Intra-lesional injection of medium (5.6 ± 1.0% vs. 3.1 ± 0.2%, n = 3, P < 0.01) and non-IDO fibroblasts compared with normal mice (4.3 ± 0.3% vs. 3.1 ± 0.2%, n = 3, P < 0.01). The number of these cells significantly decreased in the psoriatic ear of IDO-expressing fibroblasts treated mice compared with untreated mice (3.2 ± 0.4% vs. 6.1 ± 0.8%, n = 3, P < 0.01) (Figure 4-3A and C).  We noted that the number of CD11b+ F4-80+ macrophages increased in the skin of untreated psoriatic mice (11.3 ± 1.0% vs. 1.7 ± 0.8%, n = 3, P < 0.01), sham (9.1 ± 0.4% vs. 1.7 ± 0.8%, n = 3, P < 0.01) and non-IDO fibroblast injected groups (6.0 ± 0.8% vs. 1.7 ± 0.8%, n = 3, P < 0.01) compared with normal mice. In contrast, there was a considerable reduction in the number of these cells in IDO-expressing fibroblasts treated mice compared with untreated psoriatic mice (4.3 ± 0.1% vs. 11.3 ± 1.0%, n = 3, P < 0.01) (Figure 4-3D and E). Moreover, we measured the frequency of macrophages in the psoriatic ear, and our data showed that the number of CD11b+ F4-80+ macrophages significantly increased 77  in untreated psoriatic mice compared with normal mice (2.8 ± 0.1% vs. 0.7 ± 0.1%, n = 3, P < 0.01). A similar increase was found in sham (2.5 ± 0.2% vs. 0.7 ± 0.1%, n = 3, P < 0.01) and non-IDO fibroblast treated (2.6 ± 0.2% vs. 0.7 ± 0.1%, n = 3, P < 0.01) mice (Figure 4-3D and F). IDO cell therapy dramatically reduced the number of these cells in the ear as compared with untreated mice (0.8 ± 0.2% vs. 2.7 ± 0.1%, n = 3, P <0.01) (Figure 4-3D and F).                               78    Figure 4-3 A-C. Frequency of CD11b+ Gr-1+ and CD11b+ F4-80+ cells in skin, ear, and lymph nodes after cell therapy. Upon euthanizing mice on day 9, the dorsal skins, right ears, and lymph nodes were collected. A) Representative examples of granulocytes that were gated for CD11b and Gr-1. Topical application of IMQ increases percentages of skin (B) and ear (C) granulocytes. IDO-expressing fibroblast injected in skin locally decreased the percentage of granulocytes in skin (B) and psoriatic ear (C). No significant changes were detected in the percent of granulocytes in the lymph nodes of the psoriatic mouse model compared with the control mouse. The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).   79    Figure 4-3 D-F. Frequency of CD11b+ Gr-1+ and CD11b+ F4-80+ cells in skin, ear, and lymph nodes after cell therapy. D) Representative examples of macrophages that were gated for CD11b and F4-80. IDO-expressing fibroblast injected in the skin decreased the frequency of skin (E) and psoriatic ear (F) macrophages. No significant changes were detected in the percent of macrophages in lymph nodes and spleen of the psoriatic mouse model compared with the control mouse. Normal mice (Normal), medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).  80  4.4.4 IDO-expressing fibroblasts result in decreased number of IL-17-producing cells in the skin, ear, and lymph nodes of IMQ-treated mice Lesional psoriatic skin contains activated memory T lymphocytes that have a crucial role in the maintenance of epidermal hyperplasia. Here we asked whether Intra-lesional injection of IDO-expressing fibroblasts influences the number of CD3+ T cells. As shown in Figure 4-4A, the number of CD3+ cells infiltrated into psoriatic lesions that received Intra-lesional injections of IDO-expressing fibroblasts was significantly less than those that received either none or non-IDO-expressing cells. As the IL-23/IL-17 axis is a key psoriasis treatment target and infiltrated IL-17+ γδ+ T cells, IL-17+ CD4+ T cells, and IL-23+ CD11c+ dendritic cells are associated with psoriatic development, here we evaluated the presence of these cells in the psoriatic affected skin, ear, and lymph nodes. As shown in Figure 4-4B–4E, the number of γδ+ T cells expressing IL-17 dramatically increased in untreated psoriatic mice skin (11.6 ± 1.2% vs. 1.3 ± 0.3%, n = 3, P < 0.01), psoriatic ear (4.6 ± 0.6% vs. 1.3 ± 0.5%, n = 3, P < 0.01) and lymph nodes (9.1 ± 2.4% vs. 2.4 ± 0.6%, n = 3, P < 0.01) as compared with normal mice. Intra-lesional injection of neither medium (8.7 ± 0.6% vs. 1.3 ± 0.3%, n = 3, P < 0.01) nor non-IDO fibroblasts (11.2 ± 0.6% vs. 1.3 ± 0.3%, n = 3, P < 0.01) could reverse the frequency of these cells in psoriatic skin (Figure 4-4B and C). However, Intra-lesional injection of IDO-expressing fibroblast significantly reduced the number of these inflammatory cells in skin compared with untreated psoriatic mice (2.8 ± 0.3% vs. 11.6 ± 1.2%, n = 3, P < 0.01) (Figure 4-4B and C). No significant improvement was detected in the number of IL-17-producing γδ+ T cells in the psoriatic ear of sham mice as compared with the psoriatic ear of untreated mice (3.6 ± 0.5% vs. 4.6 ± 0.6%, n = 3, P > 0.05). However, Intra-lesional injection of IDO-expressing fibroblast (0.7 ± 0.2% vs. 4.6 ± 0.6%, n = 3, P < 0.01) and to a lesser extent non-IDO fibroblast (1.3 ± 0.4% vs. 4.6 ± 0.6%, n = 3, P < 0.01) significantly decreased the frequency of IL-17+ γδ+ T cells in the psoriatic ear as compared with untreated mice (Figure 4-4B and D). We further found that Intra-lesional injection of IDO-expressing fibroblast (3.7 ± 0.6% vs. 9.1 ± 2.4%, n = 3, P < 0.01), but not medium (8.5 ± 0.9% vs. 9.1 ± 2.4%, n = 3, P > 0.05) or non-IDO fibroblasts (6.1 ± 0.2% vs. 9.1 ± 2.4%, n = 3, P > 0.05), significantly 81  decreased the frequency of lymph node IL-17-producing γδ+ T cells compared with psoriatic untreated mice (Figure 4-4B and E). Our data in Figure 4-5A–5D revealed that daily application of Aldara cream markedly increased the number of IL-17-producing CD4+ T cells in the untreated psoriatic skin (6.9 ± 0.6% vs. 1.4 ± 0.2%, n = 3, P < 0.01), psoriatic ear (3.7 ± 0.3% vs. 1.2 ± 0.4%, n = 3, P < 0.01), and lymph nodes (8.2 ± 1.7% vs. 2.0 ± 0.1%, n = 3, P < 0.01) as compared with normal mice. The results as presented in Figure 4-5A–5D show that no significant changes were seen in the frequency of these cells in sham groups compared with psoriatic mice in skin (6.1 ± 1.0% vs. 6.9 ± 0.6%, n = 3, P > 0.05), ear (3.8 ± 0.4% vs. 3.7 ± 0.3%, n = 3, P > 0.05), and lymph nodes (8.2 ± 1.7% vs. 6.8 ± 0.5%, n = 3, P > 0.05). The number of these cells significantly decreased in IDO-expressing fibroblasts treated groups as compared with untreated mice both in skin (1.9 ± 0.3% vs. 6.9 ± 0.6%, n = 3, P < 0.01) and psoriatic ear (0.5 ± 0.2% vs. 3.7 ± 0.3%, n = 3, P < 0.01). Similarly, non-IDO fibroblasts injection significantly decreased the frequency of IL-17+ CD4+ T cells in skin (2.8 ± 0.4% vs. 6.9 ± 0.6%, n = 3, P < 0.01) and psoriatic ear (1.1 ± 0.3% vs. 3.7 ± 0.3%, n = 3, P < 0.01) (Figure 4-5A–5D). While the frequency of IL-17+ CD4+ T cells in lymph nodes was decreased to 3.3 ± 0.3% following injection of IDO-expressing fibroblasts as compared with untreated psoriatic mice (8.2 ± 1.7%, n = 3, P < 0.01), no significant change was found in the number of these cells in non-IDO fibroblasts injected mice as compared with untreated mice (5.2 ± 0.3% vs. 8.2 ± 1.7%, n = 3, P > 0.05) (Figure 4-5A and D).               82      Figure 4-4 A. IDO-expressing fibroblasts improved infiltration of T cells in skin, ear, and lymph node of psoriatic mice. A) Evaluating of the number of CD3 in skin sections. The number of CD3+ cells infiltrated into psoriatic lesions that received Intra-lesional injection of IDO-expressing fibroblasts was significantly less than those that received either none or non-IDO-expressing cells (n = 3).             83   Figure 4-4 B-E. IDO-expressing fibroblasts improved infiltration of T cells in skin, ear, and lymph node of psoriatic mice. B) Representative examples of ϒδ T cells that were gated for ϒδ. Flow cytometry analysis of the percent of ϒδ T cells in skin (C), the psoriatic ear (D), and lymph node (E). (C) Intra-lesional injection of neither medium nor non-IDO fibroblasts could reverse the frequency of these cells in psoriatic skin. However, Intra-lesional injection of IDO-expressing fibroblast significantly reduced the number of these inflammatory cells in skin compared with untreated psoriatic mice. (D) No significant improvement has been detected in the number of IL-17-producing γδ+ T cells in the psoriatic ear of sham mice compared with the psoriatic ear of untreated mice. However, Intra-lesional injection of IDO-expressing fibroblast and, to a lesser extent non-IDO fibroblast, significantly decreased the frequency of IL-17+ γδ+ T cells in the psoriatic ear compared with untreated mice. (E) Intra-lesional injection of IDO-expressing fibroblast but not medium or non-IDO fibroblasts significantly decreased the frequency of lymph node IL-17-producing γδ+ T cells compared with psoriatic untreated mice. Normal mice (Normal), medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).   84    Figure 4-5. IDO-expressing fibroblasts improved infiltration of IL-17+ CD4+ T cells in skin, ear, and lymph node of psoriatic mice. A) Representative examples of CD4 T cells that were gated for CD4. Flow cytometry analysis of the percent of CD4 T cell in skin (B), the psoriatic ear (C), and lymph node (D). (B) Aldara cream markedly increased the number of IL-17-producing CD4+ T cells in the untreated psoriatic skin compared with normal mice. No significant changes were seen in the frequency of these cells in sham groups compared with psoriatic mice. The number of these cells significantly decreased in non-IDO fibroblasts and IDO-expressing fibroblasts treated groups compared with untreated mice. (C) The number of IL-17-producing CD4+ T cells in the ears of untreated psoriatic mice increased compared with normal mice. The number of these cells significantly decreased in IDO-expressing fibroblasts treated groups compared with untreated mice. (D) While IL-17+CD4+ T cells frequency in lymph nodes decreased following IDO-expressing fibroblasts injection compared with untreated psoriatic mice, no significant change was found in the number of these cells in non-IDO fibroblasts injected mice compared with untreated mice. Normal mice (Normal), Medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3).  85  4.4.5 Decreased IL-17-producing cell infiltration by IDO cell therapy was associated with decreased IL-23-producing DCs frequency As IL-23 plays a central role in the Th17 cells expansion, we tested the effect of IDO cell therapy on the number of IL-23-producing DCs. The frequency of IL-23+ CD11c+ DCs showed a dramatic increase in psoriatic untreated mice skin (14.0 ± 0.5% vs. 0.6 ± 0.1%, n = 3, P < 0.01), ear (14.9 ± 2.6% vs. 1.1 ± 0.2%, n = 3, P < 0.01) and lymph nodes (2.4 ± 0.1% vs. 0.7 ± 0.2%, n = 3, P < 0.01) compared with normal (Figure 4-6A–6D). While medium injection in psoriatic skin had no considerable effect on reduction of the frequency of IL-23+ CD11c+ DCs in skin (11.5 ± 0.5% vs. 14.0 ± 0.5%, n = 3, P < 0.01), the number of these cells significantly decreased in non-IDO (11.0 ± 0.4% vs. 14.0 ± 0.5%, n = 3, P < 0.01) and IDO fibroblasts injected mice (7.6 ± 0.9% vs. 14.0 ± 0.5%, n = 3, P < 0.01) compared with untreated mice (Figure 4-6A and B). Our data in Figure 4-6A and 6C revealed that only IDO-expressing fibroblast injection markedly reduced the number of IL-23-producing DCs in ear as compared with untreated mice (9.2 ± 0.5% vs. 14.9 ± 2.6%, n = 3, P < 0.01). No significant change was found in sham (11.2 ± 0.8% vs. 14.9 ± 2.6%, n = 3, P > 0.05) and non-IDO fibroblasts treated groups (14.4 ± 1.0% vs. 14.9 ± 2.6%, n = 3, P > 0.05). Intra-lesional injection of IDO-expressing fibroblast (0.7 ± 0.3% vs. 2.4 ± 0.1%, n = 3, P < 0.01) and to a lesser extent non-IDO fibroblast (1.3 ± 0.3% vs. 2.4 ± 0.1%, n = 3, P < 0.01) significantly decreased the frequency of IL-23+ CD11c+ DCs in lymph nodes as compared with untreated mice (Figure 4-6A and 6D).  86   Figure 4-6. Flow cytometry analysis of the percentage of IL-23+ dendritic cells in skin, ear, and lymph nodes. A) Representative examples of DCs were gated for CD11c and CD86. Flow cytometry analysis of the percent of DCs in skin (B), the psoriatic ear (C), and lymph nodes (D). Topical IMQ in-creases percentages of IL-23-producing DCs in skin (B), ear (C), and lymph nodes (D). (B) The fre-quency of IL-23+ CD11c+ DCs showed a dramatic increase in psoriatic untreated mice skin compared with normal. While medium injection in psoriatic skin had little effect on reduction of the frequency of IL-23+ CD11c+ DCs in skin, the number of these cells significantly decreased in non-IDO and IDO fibro-blasts injected mice compared with untreated mice. (C) IDO-expressing fibroblast injection markedly reduced the number of IL-23-producing DCs in the ear compared with untreated mice. No significant change was found in sham and non-IDO fibroblasts treated groups. (D) Intra-lesional injection of IDO-expressing fibroblast and to a lesser extent, non-IDO fibroblast significantly decreased the frequency of IL-23+ CD11c+ DCs in lymph nodes compared with untreated mice. Normal mice (Normal), Medium injecting psoriatic mice (sham), untreated psoriatic mice (Pso.), non-IDO fibroblast injected psoriatic mice (Pso+Fib), and IDO-Red Cherry expressing fibroblast injected psoriatic mice (Pso+IDOFib). The significant differences have been indicated by asterisks (*) (P < 0.01) (n = 3). 87  4.5 Conclusion Our studies using an Aldara-induced psoriatic mouse model showed that daily topical application of Aldara causes skin erythema and silver scales as early as day 3 post-Aldara application and these remained high up to day 9 tested. Besides, the result of H & E staining of the psoriatic skin lesion showed a significant increase in the thickness of the epidermal layer. To study the pathophysiology and therapeutic efficacy of psoriasis, a relatively large number of psoriatic animal models have been developed. Most of these models are genetically engineered murine models. However, there are advantages and disadvantages for each of these models (338,339). Recent studies showed that topical application of 5% imiquimod (Aldara), a TLR7 and TLR8 ligand, causes a psoriasis-like skin inflammation (340). Topical application of imiquimod on the skin of mice induces inflammation with common features found in psoriatic skin (335) and there is now compelling evidence that Aldara-induced psoriatic features are similar to those seen in humans, including, clinically, hyperkeratosis, erythema, and scaling and, immunologically, neutrophil microabscesses and infiltration of ϒδ T cells and Th17 cells to the skin. In fact, not only the lesions phenotypically resemble those seen in humans, the histological characteristics and the mechanism of the IL-17/IL-23 axis being involved are similar to those in psoriatic patients (340,341).  Here we provide evidence to show that IDO cell therapy improves the psoriasis condition. Intra-lesional injection of IDO and, to a lesser extent, non-IDO-expressing cells significantly improved psoriatic-induced erythema and skin thickness scoring. The result of skin thickness measurements by digital calipers and H & E staining of the psoriatic skin lesion showed a significant reduction in the thickness of the epidermal layer in IL injected IDO-expressing cells. Although data from digital caliper measurements showed a marked reduction in skin thickness in mice that received an Intra-lesional injection of non-IDO fibroblasts, no significant changes were seen in results derived from H & E staining for skin thickness. This may be because the skinfold caliper is a device that measures the thickness of a fold of skin with its underlying layer of fat. Based on this evidence, it is possible that the skin thickness 88  reduction in non-IDO fibroblasts injected mice measured by digital caliper is due to the reduction in the skin’s underlying fat layer. Lymph nodes become inflamed or enlarged in various infections and autoimmune diseases. Here we showed that the size and weight of the lymph nodes taken from psoriatic mice treated with IP injection of IDO and to a lesser extent non-IDO-expressing cells were markedly less than those taken from the psoriatic mice. As interactions between T cells and antigen-presenting cells in the lymph nodes are crucial for initiating cell-mediated adaptive immune responses (342), many studies confirm the capacity of a fibroblast, as a non-professional antigen-presenting cells, in migrating to a lymph node (193). In our study, we also showed that IDO-Red Cherry expressing cells migrated to local lymph nodes.  Tonel et al. in 2010 showed a significant decrease in CD3+ T cells mainly in the epidermis of mice treated with anti-human IL-23 mAb in comparison with control mice (343). We also confirmed that the number of infiltrated CD3+ cells into psoriatic lesions that received an Intra-lesional injection of IDO-expressing cells was significantly less than those that received either none or non-IDO-expressing fibroblast cells. IL-23 stimulated dermal ϒδ T cell expansion. In psoriasis patients, ϒδ T cells were greatly increased in affected skin and produced large amounts of IL-17 (344). Here we evaluated the presence of these cells in the psoriatic affected skin. The number of ϒδ+ T cells expressing IL-17 in psoriatic affected skin and ear lesions and lymph nodes was significantly reduced upon Intra-lesional injection of IDO-expressing cells. Under the same experimental condition the number of CD4+ IL-17+ cells slightly increased in skin, ear, and regional lymph nodes in psoriatic lesions compared with the untreated control, and that was moderately reduced upon injection of IDO-expressing cells. Consistent with these findings, the number of CD11c+ DCs expressing IL-23+ markedly increased in psoriatic lesions and that was markedly reduced upon Intra-lesional injection of IDO on day 9 tested. Moreover, the number of antigen-presenting cells (F4-80+ CD11b+) within psoriatic skin samples significantly increased in Aldara-treated mice and was markedly suppressed in the mice treated with IDO-expressing cells. Interestingly, the number of granulocytes that are normally high in psoriatic lesions was significantly 89  reduced in response to Intra-lesional injection of IDO-expressing cells. In this study, we showed that non-IDO fibroblasts significantly reduce the infiltration of macrophages, CD4+ IL-17+ cells, and IL-23+ DCs but to a lesser extent than IDO-expressing fibroblasts.  The application of fibroblasts for treatment of autoimmune diseases might be a safer approach. Some studies demonstrated the antigen-presenting role and immunomodulatory effect of fibroblasts (190,345). Moreover, Jalili et al (193) found that fibroblasts can express important co-inhibitory molecules programmed cell death ligand 1 and 2 (PD-L1, PD-L1), which play a major role in suppressing the immune responses in cancer (194), allotransplantation (195), and autoimmune disease (196). However, we equipped fibroblasts with IDO by using the lentiviral transduction method in order to boost their immunomodulatory activity. IDO that breaks down Trp, the least essential amino acid available, is a cytosolic rate-limiting enzyme present in macrophages, dendritic cells, and trophoblast (346,347). It has been shown that Trp breakdown is necessary to maintain aspects of immune tolerance (250). Two theories have been proposed to explain how Trp catabolism facilitates tolerance. One posits that Trp breakdown suppresses immune cell proliferation by dramatically reducing the supply of this critical essential amino acid. The other postulates that downstream metabolites of Trp catabolism (such as KynA) act to suppress certain immune cells, probably by pro-apoptotic mechanisms (301). For this reason, in our previous in vitro study we demonstrated that KynA suppresses the production and gene expression of IL-17 and IL-23. Further, we observed that the inhibitory effect of KynA in production of IL-23 in DCs occurs through GPCR35 activation.  In conclusion, as stated before, all means of treatment strategies currently used for psoriatic patients are unsatisfactory. Although the recent discovery of the importance of interfering with the IL-23/ IL17 axis for treatment of systemic psoriasis is promising, there is still a significant concern regarding the development of adverse events while using any anti-cytokines therapy. Here, we demonstrated that our IDO cell therapy improved the disease condition in imiquimod-induced psoriasis-like dermatitis; 90  however, the possibility for the use of this treatment for the clinical psoriasis needs to be clarified in future. 91  Chapter 5.  Conclusions and Suggestions for Future Research Inflammation is one of the main elements of the innate immune system and is triggered as a local response to cellular injury. This inflammatory response is well known and is characterized by increased blood flow, capillary dilatation, leukocyte infiltration, and the production of chemical mediators that initiate the elimination of toxic agents and start the repair process of damaged tissues (348). The resolution of inflammation is an active process with cytokines and other anti-inflammatory mediators. It not only is a switch that turns off proinflammatory pathways but also involves cytokines and other chemical mediators (349). Numerous clinical and experimental studies confirm the pivotal role of inflammation during repair. To achieve proper tissue healing, the fine-tuned balance between a complex network of various leukocyte cell subsets and numerous pro- and anti-inflammatory mediators is crucial (350). However, inflammation can be either a friend or a foe: It is an essential part of our innate immune response, or it can be a chronic inflammatory condition. Chronic inflammation leads to chronic diseases and can impair the quality of healing.  Some studies showed that downstream metabolites of Trp catabolism (known as Kyns) possess an immunoregulatory role (301). Therefore, we conducted a series of experiments to study the anti-inflammatory effect of some tryptophan metabolites, such as Kyn and KynA, on modulating inflammation. The therapeutic use of Kyn and KynA is very attractive because Kyn and KynA are small molecules with molecular weights lower than 250 Da; therefore, they can easily penetrate through the epidermis. This property will eliminate the need for intra-lesional injection of the agents, which is required for IDO-expressing fibroblasts. Moreover, topical application of these medications will minimize side effects and enhance patient compliance. Kyn and KynA are non-toxic endogenous compounds that are naturally found in the body. As natural products, the regulatory process for introducing these agents to the clinic would be easier than for cell therapy. Kyn and KynA are stable for a long period of time at 4°C or at room temperature. The shelf life and stability of the drug are some of the main considerations in the manufacturing process and storage. Compared with many other anti-inflammatory drugs, Kyn and KynA 92  are inexpensive to either purchase or manufacture. We first assessed the immunoregulatory ability of Kyn, the first Trp metabolites. As discussed in Chapter 2, the expression of 12 pro-inflammatory cytokines and chemokines was modulated in Kyn-treated mouse splenocytes as compared with those of control. These findings were then evaluated by conducting a qPCR for the gene expression of these factors and showed a significant reduction in the gene expression of a majority of these cytokines and chemokines (IL-2, IL-17, CXCL10, CXCL1, CCL12, CXCL9, CCL4, CXCL2, and CCL5) in response to Kyn treatment. As Janis et al. showed, T cells are present in an injury site under the influence of IL-2 and various other immunomodulatory factors (41). T cells are important sources of cytokines, including IL-1, IL-2, TNF-α and TGF-β. Among other functions, these factors regulate the process of T cell proliferation and differentiation in an autocrine fashion. The infiltration of T-lymphocytes in the early wound, particularly CD4+ T helper-2 (Th2) cells, has been strongly linked to fibrogenesis (22,350). Therefore, we tested the anti-inflammatory effect of Kyn in infiltration of CD3+ T cells and macrophages in an animal wound model. For this reason dorsal surface wounds were generated in a mouse model, and wounds received daily topical application of either nothing (control), dermal cream (second control), or Kyn cream, using uninjured skin tissue as another control. The wounded tissues were harvested on days 3, 6, and 10 post-wounding. As anticipated, the results of FACS analysis revealed that upon wounding the number of total infiltrated CD3+ cells and macrophages (CD11b+) significantly increased on day 3, peaked on day 6, and were reduced on day 10 post-wounding. Interestingly, as compared with uninjured skin tissue and wounds treated with dermal cream alone, Kyn treatment significantly reduced the number of infiltrated CD3+ cells but not CD11b+ cells at the different time intervals examined. These findings collectively suggest that Kyn, as a small molecule, can potentially be used to overcome the difficulties associated with persistency of skin inflammatory conditions such as wound healing. In Chapter 2, we demonstrated that Kyn not only suppresses the key proinflammatory cytokines and chemokines such as IL-17. Many studies have shown that IL-17-producing T-cells are responsible for pathophysiology of many inflammatory diseases such as psoriasis (317), inflammatory bowel disease (IBD) (318), 93  rheumatoid arthritis (281,319) and multiple sclerosis (284,320). Moreover, it has been confirmed that IL-23 plays a central role in the Th17 cells expansion (321). Nowadays, there is a developing interest among scientists to evaluate the involvement of the IL-23/IL-17 axis as a potential target in these inflammatory diseases (322). In Chapter 3, the emphasis was on evaluating the effect of KynA on the expression of the IL-17/IL-23 axis in ConA- and LPS-activated splenocytes and dendritic cells, respectively. In this study KynA instead of Kyn was used because 1) KynA is the end product and cannot be converted with any other metabolites in the kynurenine pathway with unknown effect; 2) KynA is more stable and can be kept at room temperature for more than a year as compared with Kyn, which needs to be kept at 4oC for several weeks only; 3) KynA does not readily cross the blood brain barrier, and as such it would be safer to be used topically and systemically; and 4) the KynA receptor GPCR35 is expressed mainly on cells connected with the immune system. The result of flow cytometry demonstrated that the frequency of IL-23-producing DCs is reduced with 100 µg/mL of KynA as compared with that of LPS-stimulated DCs. Addition of 100 µg/mL of KynA to activated T cells significantly decreased the level of IL-17 mRNA and frequency of IL-17+ T cells as compared with that of activated T cells. To examine the mechanism of the suppressive role of KynA on IL-23/IL-17 in these cells, cells were treated with 3 µM G protein coupled receptor 35 (GPCR35) inhibitor (CID), for 60 min, and the result showed that the reduction of both adenylate cyclase (AC) and cyclic adenosine monophosphate (cAMP) by KynA is involved in suppression of LPS-induced IL-23p19. As GPCR35 is also detected on T cells, it is therefore concluded that KynA plays an important role in modulating the expression of IL-23 and IL-17 in DCs and Th17 cells through inhibiting GPCR35 and downregulation of both AC and cAMP. In the final phase of this thesis project, we used cell therapy for treatment of psoriasis by developing fibroblasts equipped with a potent immunomodulatory factor, IDO. Developing of this IDO-expressing cell was rationalized based on the fact that IDO plays an essential protective role during mammalian pregnancy by providing a low tryptophan / high kynurenine microenvironment in which maternal T cells cannot proliferate and attack semi-allogeneic fetus. Moreover, it is used as a source of 94  Kyn and KynA production. Psoriasis is a common chronic inflammatory condition of human skin characterized by cutaneous plaques with consistent scaling and variable erythema (338). A large number of new anti-inflammatory therapies are being investigated for psoriasis. In some cases, some immune cells or cytokines are being tested, while in others new pathways are being addressed and appear to be specific (as for IL-23/IL-17). Traditional systemic therapies for psoriasis, including methotrexate (MTX) and cyclosporine (CsA), have a well-documented array of toxicities (351). As dendritic cell-derived interleukin-23 and downstream products of Th17 cells, including interleukin-17A and interleukin-22, are of considerable importance in the pathogenesis of psoriasis (90), research in the past decade has led to the development of new, highly effective antibodies targeted against IL-23 and IL-17. However, one of the central safety issues surrounding the biologic therapies for the treatment of moderate to severe psoriasis is their potential to increase the risk of malignancy (296). Moreover, these biologics are not only costly, they also require repeated injections, and some patients experience a loss of therapeutic effect. Many patients experience decreased efficacy, either in the initial treatment period or as a loss over time following an initial response. One of the key factors thought to contribute to this lack of response is the potential for patients to develop antidrug antibodies, which may reduce the efficacy of biologic agents by occluding the cytokine-binding site (neutralizing antibodies) or by promoting rapid immunecomplex clearance (both neutralizing and non-neutralizing antibodies) (352). As such, there is still a need to find a new strategy through which not only patchy but also generalized psoriasis can be treated without compromising the functionality of the immune system and producing any potential side effects. As noted in Chapter 4, we were able to confirm that IDO-expressing fibroblasts can serve as a source of the local immunosuppression treatment for psoriasis. Our findings revealed that upon treating with IDO-expressing fibroblasts, erythema and scaling, which are clinical appearance factors associated with psoriasis (93), are significantly improved. The results show a significant reduction in the number of skin-infiltrated IL-17+ CD4+ T cells (1.9 ± 0.3% vs. 6.9 ± 0.6%, n = 3, P < 0.01), IL-17+ γδ+ T cells (2.8 ± 0.3% vs. 11.6 ± 1.2%, n = 3, P < 0.01), IL-23+-activated dendritic cells (7.6 ± 0.9% vs. 14.0 ± 0.5%, n = 3, P < 0.01), 95  macrophages (4.3 ± 0.1% vs. 11.3 ± 1.0%, n = 3, P < 0.01), and granulocytes (2.5± 0.4% vs. 4.5 ± 0.3%, n = 3, P < 0.01) in imiquimod-induced psoriasis-like dermatitis animals receiving intra-lesional injection of IDO-expressing dermal fibroblasts compared to untreated psoriatic mice. This finding suggests that IDO-expressing fibroblasts might be a potential immune modulatory treatment for psoriasis. As the greatest obstacle in the practical use of IDO-expressing skin substitute is the use of Adeno or lentiviral transduction methods, we would like to use IDO protein rather than IDO-expressing cells as a source of inflammation decrement. However this is not possible because IDO is a cytoplasmic enzyme that needs cellular cofactors for its activity and as such it is inactive outside of the cells.  5.1 Suggestions for Future Work This thesis has described the immunomodulatory effects of Trp metabolites, Kyn and KynA, on some inflammatory cytokines. In addition, the IDO-expressing fibroblasts has been used as an anti-inflammatory agent for psoriasis. Although our finding reduced immune cells infiltration in animal wound model and psoriasis, this research only demonstrates proof-of-principle, and these systems require further improvement. My suggestions for future research to improve these anti-fibrotic dressings are as follows: 1) In this study, the mouse has been used as the wound model to evaluate the anti-inflammatory effect of infiltration of immune cells. The mouse model is not the ideal fibrotic model. A red-Duroc pig can better mimic the wound healing process in humans; therefore, use of this animal model is suggested. 2) In this study, the focus was on the immunomodulatory effect of Kyn on some inflammatory cytokines and chemokines and infiltration of T cells and macrophages in an animal wound model. However, as KynA was found to be a safer agent as compared with Kyn, testing of the anti-inflammatory effect of KynA on infiltration of different immune cells in an animal wound model is suggested. 96  3) We conducted a series of experiments to test the immune-modulatory effect of IDO-expressing fibroblasts on improving psoriasis. However, as the greatest obstacle in the practical use of IDO-expressing fibroblasts is the use of Adeno or lentiviral transduction methods, we would like to use IDO protein rather than IDO-expressing cells as a source of inflammation decrement. This is not possible because IDO is a cytoplasmic enzyme that needs cellular cofactors for its activity and as such it is inactive outside of the cells. So it is suggested to perform a series of experiments to study the anti-inflammatory effect topical cream or oral Kyn or KynA on pathophysiology of psoriasis. 4) In this thesis, we used IDO-expressing fibroblast as a cell therapy for psoriasis. In our previous studies we showed that IDO-expressing skin cells, but not skin cells, could suppress inflammatory cell proliferation and induce some subsets of T lymphocyte apoptotic death. Local Kyn and KynA production through the Trp degradation pathway also has immunoregulatory/anti-inflammatory roles. There are, however, other mechanistic possibilities that require more investigation. For instance, there might be a tolerogenic interaction between injected fibroblasts and host immature antigen-presenting cells (APCs), resulting in polarization of these APCs toward a tolerogenic phenotype. 97   Bibliography 1.  Ahmed AU. An overview of inflammation: Mechanism and consequences. Front Biol China. 2011;6(4):274–81.  2.  Medzhitov R. Inflammation 2010: New Adventures of an Old Flame. Cell. 2010;140(6):771–6.  3.  Medzhitov R. Origin and physiological roles of inflammation. Nature. 2008. p. 428–35.  4.  Akira S, Uematsu S, Takeuchi O. Pathogen Recognition and Innate Immunity. Cell. 2006;124(4):783–801.  5.  Hamminga EA, van der Lely AJ, Neumann HAM, Thio HB. Chronic inflammation in psoriasis and obesity: Implications for therapy. Med Hypotheses. 2006;67(4):768–73.  6.  Leiherer A, M??ndlein A, Drexel H. Phytochemicals and their impact on adipose tissue inflammation and diabetes. Vascul Pharmacol. Elsevier Inc.; 2013;58(1-2):3–20.  7.  Grivennikov SI, Greten FR, Karin M. Immunity, Inflammation, and Cancer. Cell. Elsevier Inc.; 2010;140(6):883–99.  8.  Turabelidze A, Dipietro LA. Inflammation and Wound Healing. Endod Top. 2012;24:26–38.  9.  Wells SA. Wound healing: biologic features and approaches to maximize healing trajectories. Curr Probl Surg. 2009;46(3):189.  10.  Harding KG, Morris HL, Patel GK. Science, medicine, and the future, Healing chronic woundsHealing chronic wounds. BMJ  Br Med J. 2002;324(7330):160–3.  11.  Broughton G, Janis JE, Attinger CE. The basic science of wound healing. Plast Reconstr Surg. 2006;117(7 Suppl):12S – 34S.  12.  Li J, Chen J, Kirsner R. Pathophysiology of acute wound healing. Clin Dermatol. 2007;25(1):9–18.  13.  Shaw TJ, Martin P. Wound repair at a glance. J Cell Sci. 2009;122(Pt 18):3209–13.  14.  Noli C, Miolo A. The mast cell in wound healing. Vet Dermatol. 2001;12(6):303–13.  15.  Cumberbatch M, Dearman RJ, Griffiths CE, Kimber I. Langerhans cell migration. Clin Exp Dermatol. 2000;25:413–8.  16.  Jameson J, Ugarte K, Chen N, Yachi P, Fuchs E, Havran WL, et al. A Role for Skin y8 T Cells in Wound Repair. Am Assoc Adv Sci. 2002;296(5568):747–9.  17.  Kupper T, Fuhlbrigge R. Immune surveillance in the skin: mechanisms and clinical consequences. Nat Rev Immunol. 2004;4(3):211–22.  18.  Martinez FO, Gordon S, Locati M, Mantovani A. Transcriptional Profiling of the Human Monocyte-to-Macrophage Differentiation and Polarization: New Molecules and Patterns of Gene Expression. J Immunol. 2006;177:7303–11.  98  19.  Ploeger DT, Hosper NA, Schipper M, Koerts JA, de Rond S, Bank RA. Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal fibroblasts. Cell Commun Signal. 2013;11(1):29.  20.  Chen L, Mehta ND, Zhao Y, Dipietro LA. Absence of CD4 or CD8 lymphocytes changes infiltration of inflammatory cells and profiles of cytokine expression in skin wounds, but does not impair healing. Exp Dermatol. 2014;23(3):189–94.  21.  Behm B, Babilas P, Landthaler M, Schreml S. Cytokines, chemokines and growth factors in wound healing. J Eur Acad Dermatol Venereol. 2012;26(7):812–20.  22.  Martin P, Nunan R. Cellular and molecular mechanisms of repair in acute and chronic wound healing. Br J Dermatol. 2015;173(2):370–8.  23.  Nanney LB, Magid M, Stoscheck CM, King LE. Comparison of epidermal growth factor binding and receptor distribution in normal human epidermis and epidermal appendages. J Invest Dermatol. Elsevier Masson SAS; 1984;83(5):385–93.  24.  Niall M, Ryan GB, O’Brien BM. The effect of epidermal growth factor on wound healing in mice. J Surg Res. 1982;33(2):164–9.  25.  Werner S, Peters KG, Longaker MT, Fuller-Pace F, Banda MJ, Williams LT. Large induction of keratinocyte growth factor expression in the dermis during wound healing. Proc Natl Acad Sci U S A. 1992;89(15):6896–900.  26.  Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol. 2007;8(3):221–33.  27.  Litjens SHM, de Pereda JM, Sonnenberg A. Current insights into the formation and breakdown of hemidesmosomes. Trends Cell Biol. 2006;16(7):376–83.  28.  Gabbiani G, Hirschel BJ, Ryan GB, Statkov PR, Majno G. Granulation tissue as a contractile organ. A study of structure and function. J Exp Med. 1972;135(4):719–34.  29.  Metz CN. Fibrocytes: A unique cell population implicated in wound healing. Cell Mol Life Sci. 2003;60(7):1342–50.  30.  Clark RAF, Nielsen LD, Welch MP, McPherson JM. Collagen Matrices Attenuate the Collagen-Synthetic Response of Cultured Fibroblasts To Tgf-Beta. J Cell Sci. 1995;108:1251–61.  31.  Granstein RD, Murphy GF, Margolis RJ, Byrne MH, Amento EP. Gamma-interferon inhibits collagen synthesis in vivo in the mouse. J Clin Invest. 1987;79(4):1254–8.  32.  Buck M, Houglum K, Chojkier M. Tumor necrosis factor-alpha inhibits collagen alpha1(I) gene expression and wound healing in a murine model of cachexia. Am J Pathol. 1996;149(1):195–204.  33.  McDougall S, Dallon J, Sherratt J, Maini P. Fibroblast migration and collagen deposition during 99  dermal wound healing: mathematical modelling and clinical implications. Philos Trans A Math Phys Eng Sci. 2006;364(1843):1385–405.  34.  Parks WC. Matrix metalloproteinases in repair. Wound Repair Regen. 1999;7(6):423–32.  35.  Birkedal-Hansen H, Yamada S, Windsor J, Pollard AH, Lyons G, Stetler-Stevenson W, et al. Matrix Metalloproteinases. Curr Protoc Cell Biol. Elsevier Inc.; 2001;181(6):1895–9.  36.  Brew K, Dinakarpandian D, Nagase H. Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Acta. 2000;1477(1-2):267–83.  37.  Circolo A, Welgus HG, Pierce GF, Kramer J, Strunk RC. Differential regulation of the expression of proteinases/antiproteinases in fibroblasts. Effects of interleukin-1 and platelet-derived growth factor. J Biol Chem. 1991;266(19):12283–8.  38.  Velnar T, Bailey T, Smrkolj V. The wound healing process: an overview of the cellular and molecular mechanisms. J Int Med Res. 2009;37(5):1528–42.  39.  Peterson JM, Barbul A, Breslin RJ, Wasserkrug HL, Efron G. Significance of T-lymphocytes in wound healing. Surgery. 1987;102(2):300–5.  40.  Martin CW, Muir IFK. The role of lymphocytes in wound healing. British Journal of Plastic Surgery. 1990. p. 655–62.  41.  Janis JE, Harrison B. Wound Healing: Part I. Basic Science. Plast Reconstr Surg. 2014;133(2):199e – 207e.  42.  Abbas Abul K., Lichtman; AH, Pillai S. Cellular and Molecular Immunology. Elsevier. 2014. 544 p.  43.  Wynn T a. Fibrotic disease and the T(H)1/T(H)2 paradigm. Nat Rev Immunol. 2004;4(8):583–94.  44.  Tredget EE, Yang L, Delehanty M, Shankowsky H, Scott PG. Polarized Th2 cytokine production in patients with hypertrophic scar following thermal injury. J Interferon Cytokine Res. 2006;26(3):179–89.  45.  Hasegawa T, Nakao A, Sumiyoshi K, Tsuboi R, Ogawa H. IFN-?? fails to antagonize fibrotic effect of TGF-?? on keloid-derived dermal fibroblasts. J Dermatol Sci. 2003;32(1):19–24.  46.  Adolph VR, DiSanto SK, Bleacher JC, Dillon PW, Krummel TM. The potential role of the lymphocyte in fetal wound healing. J Pediatr Surg. 1993;28(10):1316–20.  47.  Beanes SR, Hu F-Y, Soo C, Dang CMH, Urata M, Ting K, et al. Confocal microscopic analysis of scarless repair in the fetal rat: defining the transition. Plast Reconstr Surg. 2002;109(1):160–70.  48.  Meszaros AJ, Reichner JS, Albina JE. Macrophage-induced neutrophil apoptosis. J Immunol. 2000;165(1):435–41.  49.  Wahl SM, Hunt DA, Wakefield LM, McCartney-Francis N, Wahl LM, Roberts AB, et al. 100  Transforming growth factor type beta induces monocyte chemotaxis and growth factor production. Proc Natl Acad Sci U S A. 1987;84(16):5788–92.  50.  Malawista SE, Montgomery RR, Van Blaricom G. Evidence for reactive nitrogen intermediates in killing of staphylococci by human neutrophil cytoplasts. A new microbicidal pathway for polymorphonuclear leukocytes. J Clin Invest. 1992;90(2):631–6.  51.  Antry UDT, Ross STSG, Asserkrug HALW, Arbul ADB. Nitric Oxide Regulates Wound Healing 1. J Surg Res. 1996;240:237–40.  52.  Shah M, Foreman DM, Ferguson MW. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J Cell Sci. 1995;108 ( Pt 3:985–1002.  53.  Wang R, Ghahary A, Shen Q, Scott PG, Roy K, Tredget EE. Hypertrophic scar tissues and fibroblasts produce more transforming growth factor-beta1 mRNA and protein than normal skin and cells. Wound Repair Regen. 2000;8(2):128–37.  54.  Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest. 2003;112(12):1776–84.  55.  Overall CM, Wrana JL, Sodek J. Transforming growth factor-B regulation of collagenase, 72 KDA-progelatinase, timp and PAI-1 expression in rat bone cell populations and human fibroblasts. Connect Tissue res. 1989;20(April 2016):289–94.  56.  Soo C, Hu FY, Zhang X, Wang Y, Beanes SR, Lorenz HP, et al. Differential expression of fibromodulin, a transforming growth factor-beta modulator, in fetal skin development and scarless repair. Am J Pathol. 2000;157(2):423–33.  57.  Sullivan KM, Lorenz HP, Meuli M, Lin RY, Adzick NS. A model of scarless human fetal wound repair is deficient in transforming growth factor beta. J Pediatr Surg. 1995;30(2):198–202; discussion 202–3.  58.  Liechty KW, Kim HB, Adzick NS, Crombleholme TM. Fetal wound repair results in scar formation in interleukin-10-deficient mice in a syngeneic murine model of scarless fetal wound repair. J Pediatr Surg. 2000;35(6):866–72; discussion 872–3.  59.  Vun Y, Siller G. Use of 5% imiquimod cream in the treatment of facial basal cell carcinoma: A 3-year retrospective follow-up study. Australas J Dermatol. 2006;47(3):169–71.  60.  Harwood CA, Perrett CM, Brown VL, Leigh IM, Mcgregor JM, Proby CM. Imiquimod cream 5% for recalcitrant cutaneous warts in immunosuppressed individuals. Br J Dermatol. 2005;152(1):122–9.  61.  Reactions Weekly. Imiquimod: Hypertrophic scars and first report of keloid scars: 2 case reports. 101  Springer Int Publ. 2015;1567(1):9954.  62.  Vinter H, Iversen L, Steiniche T, Kragballe K, Johansen C. Aldara(®) -induced skin inflammation: studies of patients with psoriasis. Br J Dermatol. 2015;172(2):345–53.  63.  Ferguson MW, Duncan J, Bond J, Bush J, Durani P, So K, et al. Prophylactic administration of avotermin for improvement of skin scarring: three double-blind, placebo-controlled, phase I/II studies. Lancet. Elsevier Ltd; 2009;373(9671):1264–74.  64.  U.S. National Institutes of Health. Juvidex (Mannose-6-Phosphate) in Accelerating the Healing of Split Thickness Skin Graft Donor Sites, ClinicalTrials.gov, Identifier: NCT00664352. ClinicalTrials.gov, Identifier: NCT00664352. 2009.  65.  Jalali M, Bayat  a. Current use of steroids in management of abnormal raised skin scars. Surgeon. 2007;5(3):175–80.  66.  Spauwen P, Kon M, Niessen F, Schalkwijk J. On the Nature of Hypertrophic Scars and Keloids. Plast Reconstr Surg. 1999;104(5).  67.  Karin M. New twists in gene regulation by glucocorticoid receptor: Is DNA binding dispensable? Cell. 1998;93(4):487–90.  68.  Sweetman S. Martindale : the complete drug reference. Pharmaceutical Press. 2006.  69.  Jimenez SA, Freundlich B, Rosenbloom J. Selective inhibition of human diploid fibroblast collagen synthesis by interferons. J Clin Invest. 1984;74(3):1112–6.  70.  Tredget EE, Shankowsky HA, Pannu R, Nedelec B, Iwashina T, Ghahary A, et al. Transforming growth factor-beta in thermally injured patients with hypertrophic scars: effects of interferon alpha-2b. Plast Reconstr Surg. 1998;102(5).  71.  Leventhal D, Furr M, Reiter D. Treatment of Keloids and Hypertrophic Scars: A Meta-analysis and Review of the Literature. Arch Facial Plast Surg. 2006;8(6):362–8.  72.  España A, Solano T, Quintanilla E. Bleomycin in the treatment of keloids and hypertrophic scars by multiple needle punctures. Dermatologic Surg. 2001;27(1):23–7.  73.  Saray Y, Güleç T. Treatment of keloids and hypertrophic scars with dermojet injections of bleomycin: A preliminary study. Int J Dermatol. 2005;44(9):777–84.  74.  Al-shobaili H a, Qureshi MG. Pathophysiology of Psoriasis : Current Concepts. 2013.  75.  Krueger JG, Bowcock A. Psoriasis pathophysiology: current concepts of pathogenesis. Ann Rheum Dis. 2005;64 Suppl 2(suppl_2):ii30–6.  76.  Garcia-Valladares I, Espinoza LR. Psoriasis pathophysiology. Immunotherapy. 2010;2(4):444–5.  77.  Griffiths CEM, Barker JNWN. Pathogenesis and clinical features of psoriasis. Lancet (London, England). 2007;370(9583):263–71.  102  78.  Balmanno Squire. The etiology of psoriasis. Br Med J. 1873;1(632):1873.  79.  Heaney JH. The etiology and treatment of psoriasis. Br Med J. 2(3493):1136–7.  80.  Ingram JT. The approach to psoriasis. Br Med J. 1953;2(4836):591–4.  81.  JOSEPH W L, BERNARD G G, VICTOR D N, EDWIN T W. Immunologic Response of Patients With Psoriasis. Arch Dermatol. 1965;91:607–10.  82.  Kaplan MM. Methotrexate and psoriasis. Arch Dermatol. 1967;95(1):1.  83.  Krueger GG, Jederberg WW, Ogden BE, Reese DL. Inflammatory and Immune Cell Function in Psoriasis: II. Monocyte Function, Lymphokine Production. J Invest Dermatol. 1978;71(3):195–201.  84.  Braun-Falco O, Christophers E. Structural aspects of initial psoriatic lesions. Arch Dermatological Res. 1974;251(2):95–110.  85.  Krueger GG, Jederberg WW. Alteration of HeLa Cell Growth Equilibrium by Supernatants of Peripheral Blood Mononuclear Cells from Normal and Psoriatic Subjects. J Invest Dermatol. Elsevier Masson SAS; 1980;74(3):148–53.  86.  Bos JD, Hulsebosch HJ, Krieg SR, Bakker PM, Cormane RH. Immunocompetent cells in psoriasis - In situ immunophenotyping by monoclonal antibodies. Arch Dermatol Res. 1983;275(3):181–9.  87.  Lew W, Bowcock AM, Krueger JG. Psoriasis vulgaris: Cutaneous lymphoid tissue supports T-cell activation and “Type 1” inflammatory gene expression. Trends Immunol. 2004;25(6):295–305.  88.  Lee E, Trepicchio WL, Oestreicher JL, Pittman D, Wang F, Chamian F, et al. Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris. J Exp Med. 2004;199(1):125–30.  89.  Lillis J V, Guo C-S, Lee JJ, Blauvelt A. Increased IL-23 Expression in Palmoplantar Psoriasis and Hyperkeratotic Hand Dermatitis. Arch Dermatol. 2010;146(8):918–9.  90.  Di Cesare A, Di Meglio P, Nestle FO. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J Invest Dermatol. Nature Publishing Group; 2009;129(6):1339–50.  91.  Harper EG, Guo C, Rizzo H, Lillis J V, Kurtz SE, Skorcheva I, et al. Th17 cytokines stimulate CCL20 expression in keratinocytes in vitro and in vivo: implications for psoriasis pathogenesis. J Invest Dermatol. 2009;129(9):2175–83.  92.  Raychaudhuri SP. Role of IL-17 in psoriasis and psoriatic arthritis. Clinical Reviews in Allergy and Immunology. 2013. p. 183–93.  93.  Lowes M a, Bowcock AM, Krueger JG. Pathogenesis and therapy of psoriasis. Nature. 2007;445(7130):866–73.  94.  Krueger JG. The immunologic basis for the treatment of psoriasis with new biologic agents. J Am 103  Acad Dermatol. 2002;46(1):1–23.  95.  Lowes MA, Bowcock AM, Krueger JG. Pathogenesis and therapy of psoriasis. Nature. 2007;445(7130):866–73.  96.  Nickoloff BJ, Nestle FO. Science in medicine Recent insights into the immunopathogenesis of psoriasis provide new therapeutic opportunities. J Clin Invest. 2004;113(12):1664–75.  97.  Malakouti M, Brown GE, Wang E, Koo J, Levin EC. The role of IL-17 in psoriasis. J Dermatolog Treat. 2014;6634(415):1–4.  98.  Lowes M a, Kikuchi T, Fuentes-Duculan J, Cardinale I, Zaba LC, Haider AS, et al. Psoriasis vulgaris lesions contain discrete populations of Th1 and Th17 T cells. J Invest Dermatol. 2008;128(5):1207–11.  99.  http://natreatment.com/facts-psoriasis/.  100.  Bovenschen HJ, Seyger MMB, Van De Kerkhof PCM. Plaque psoriasis vs. atopic dermatitis and lichen planus: A comparison for lesional T-cell subsets, epidermal proliferation and differentiation. Br J Dermatol. 2005;153(1):72–8.  101.  Clark R a. Skin-resident T cells: the ups and downs of on site immunity. J Invest Dermatol. Elsevier Masson SAS; 2010;130(2):362–70.  102.  Di Meglio P, Nestle FO. The role of IL-23 in the immunopathogenesis of psoriasis. F1000 Biol Rep. 2010;2(May):1–5.  103.  Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005;6(11):1123–32.  104.  Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, et al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. 2005;201(2):233–40.  105.  Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang Y-H, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005;6(11):1133–41.  106.  Acosta-Rodriguez E V, Napolitani G, Lanzavecchia A, Sallusto F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol. 2007;8(9):942–9.  107.  Chen Z, O’Shea JJ. Regulation of IL-17 production in human lymphocytes. Cytokine. 2008;41(2):71–8.  108.  Evans HG, Suddason T, Jackson I, Taams LS, Lord GM. Optimal induction of T helper 17 cells in humans requires T cell receptor ligation in the context of Toll-like receptor-activated monocytes. 104  Proc Natl Acad Sci U S A. 2007;104(43):17034–9.  109.  Wilson NJ, Boniface K, Chan JR, McKenzie BS, Blumenschein WM, Mattson JD, et al. Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat Immunol. 2007;8(9):950–7.  110.  Manel N, Unutmaz D, Littman DR. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat Immunol. 2008;9(6):641–9.  111.  Volpe E, Servant N, Zollinger R, Bogiatzi SI, Hupé P, Barillot E, et al. A critical function for transforming growth factor-beta, interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses. Nat Immunol. 2008;9(6):650–7.  112.  Yang XO, Panopoulos AD, Nurieva R, Seon HC, Wang D, Watowich SS, et al. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J Biol Chem. 2007;282(13):9358–63.  113.  Santarlasci V, Maggi L, Capone M, Frosali F, Querci V, De Palma R, et al. TGF-β indirectly favors the development of human Th17 cells by inhibiting Th1 cells. Eur J Immunol. 2009;39(1):207–15.  114.  Crome SQ, Wang AY, Kang CY, Levings MK. The role of retinoic acid-related orphan receptor variant 2 and IL-17 in the development and function of human CD4+ T cells. Eur J Immunol. 2009;39(6):1480–93.  115.  Dubin PJ, Kolls JK. Th17 cytokines and mucosal immunity. Immunol Rev. 2008;226(1):160–71.  116.  Liu Y, Yang B, Zhou M, Li L, Zhou H, Zhang J, et al. Memory IL-22-producing CD4+ T cells specific for Candida albicans are present in humans. Eur J Immunol. 2009;39(6):1472–9.  117.  Kolls JK, Linde A. Interleukin-17 Family Members. Immunity. 2004;21:467–76.  118.  Yao Z, Painter SL, Fanslow WC, Ulrich D, Macduff BM, Spriggs MK, et al. Human IL-17: A Novel Cytokine Derived from T Cells. J Immunol. 1995;155:5483–6.  119.  Martin DA, Towne JE, Kricorian G, Klekotka P, Gudjonsson JE, Krueger JG, et al. The emerging role of IL-17 in the pathogenesis of psoriasis: preclinical and clinical findings. J Invest Dermatol. 2013;133(1):17–26.  120.  Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, et al. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med. 2001;194(4):519–27.  121.  Aggarwal S, Ghilardi N, Xie MH, De Sauvage FJ, Gurney AL. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem. 105  2003;278(3):1910–4.  122.  Yilmaz SB, Cicek N, Coskun M, Yegin O, Alpsoy E. Serum and tissue levels of IL-17 in different clinical subtypes of psoriasis. Arch Dermatol Res. 2012;304(6):465–9.  123.  Krueger JG, Fretzin S, Su??rez-Fari??as M, Haslett PA, Phipps KM, Cameron GS, et al. IL-17A is essential for cell activation and inflammatory gene circuits in subjects with psoriasis. J Allergy Clin Immunol. 2012;130(1).  124.  Steinman RM. the Dendritic Cell System. Annu Rev Immunol. 1991;9:271–96.  125.  Schlitzer A, McGovern N, Ginhoux F. Dendritic cells and monocyte-derived cells: Two complementary and integrated functional systems. Semin Cell Dev Biol. Elsevier Ltd; 2015;41:9–22.  126.  Banchereau JFB. Immunobiology of Dendritic Cells. Annu Rev Immunol. 2000;18(Figure 1):767–811.  127.  Carbone FR, Kurts C, Bennett SRM, Miller JFAP, Heath WR. Cross-presentation: a general mechanism for CTL immunity and tolerance. Immunol Today. 1998;19(8):368–73.  128.  Cargill M, Schrodi SJ, Chang M, Garcia VE, Brandon R, Callis KP, et al. A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 2007;80(2):273–90.  129.  Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, et al. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 2000;13(5):715–25.  130.  Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGF-β in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006;24(2):179–89.  131.  Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO, et al. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 2006;441(7090):231–4.  132.  Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGFβ in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006;24(2):179–89.  133.  Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 2002;168(11):5699–708.  134.  Sutton C, Brereton C, Keogh B, Mills KHG, Lavelle EC. A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med. 106  2006;203(7):1685–91.  135.  Nakae S, Iwakura Y, Suto H, Galli SJ. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17. J Leukoc Biol. 2007;81(5):1258–68.  136.  Xu L, Kitani A, Fuss I, Strober W. Cutting Edge: Regulatory T Cells Induce T Cells or Are Self-Induced to Become Th17 Cells in the Absence of Exogenous TGF-. J Immunol Ref J Immunol Clevel Heal Sci Libr Oct Clevel Heal Sci Libr. 2007;178(8):6725–9.  137.  Nakajima K, Kanda T, Takaishi M, Shiga T, Miyoshi K, Nakajima H, et al. Distinct roles of IL-23 and IL-17 in the development of psoriasis-like lesions in a mouse model. J Immunol. 2011;186(7):4481–9.  138.  Romani N, Clausen BE, Stoitzner P. Langerhans cells and more: langerin-expressing dendritic cell subsets in the skin. Immunol Rev. 2010;234(1):120–41.  139.  Egawa G, Kabashima K. Skin as a Peripheral Lymphoid Organ: Revisiting the Concept of Skin-Associated Lymphoid Tissues. J Invest Dermatol. Elsevier Masson SAS; 2011;131(11):2178–85.  140.  Yoshiki R, Kabashima K, Honda T, Nakamizo S, Sawada Y, Sugita K, et al. IL-23 from Langerhans Cells Is Required for the Development of Imiquimod-Induced Psoriasis-Like Dermatitis by Induction of IL-17A-Producing γδ T Cells. J Invest Dermatol. Elsevier Masson SAS; 2014;134(7):1912–21.  141.  Chan JR, Blumenschein W, Murphy E, Diveu C, Wiekowski M, Abbondanzo S, et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis. J Exp Med. 2006;203(12):2577–87.  142.  Lindroos J, Svensson L, Norsgaard H, Lovato P, Moller K, Hagedorn PH, et al. IL-23-mediated epidermal hyperplasia is dependent on IL-6. J Invest Dermatol. Elsevier Masson SAS; 2011;131(5):1110–8.  143.  Nestle FO, Kaplan DH, Barker J. Psoriasis. N Engl J Med. 2009;361(5):396–509.  144.  Feldmann M, Brennan FM, Maini R. Cytokines in autoimmune disorders. Int Rev Immunol. 1998;17(1-4):217–28.  145.  Castelo-Soccio L, Van Voorhees AS. Long-term efficacy of biologics in dermatology. Dermatol Ther. 2009;22(1):22–33.  146.  Wolff K, TB F, JA P, al  et. PHotochemotherapy for psoriasis with orally administered methoxsalen. Arch Dermatol. 1976;112(7):943–50.  147.  Stern RS, Liebman EJ, Väkevä L. Oral psoralen and ultraviolet-A light (PUVA) treatment of psoriasis and persistent risk of nonmelanoma skin cancer. PUVA Follow-up Study. J Natl Cancer Inst. 1998;90(17):1278–84.  107  148.  Cox NH, Jones SK, Downey DJ, Tuyp EJ, Jay JL, Moseley H, et al. Cutaneous and ocular side-effects of oral photochemotherapy: Results of an 8-year follow-up study. Br J Dermatol. 1987;116(2):145–52.  149.  Morison WL, Baughman RD, Day RM, Forbes PD, Hoenigsmann H, Krueger GG, et al. Consensus workshop on the toxic effects of long-term PUVA therapy. Arch Dermatol. 1998;134(5):595–8.  150.  van WH, De LFHB, Young E, van  der LJC. A new development in UVB phototherapy of psoriasis. Br J Dermatol. 1988;119(1):11–9.  151.  Weischer M, Blum A, Eberhard F, Röcken M, Berneburg M. No evidence for increased skin cancer risk in psoriasis patients treated with broadband or narrowband UVB phototherapy: A first retrospective study. Acta Derm Venereol. 2004;84(5):370–4.  152.  Dawe R.S. A quantitative review of studies comparing the efficacy of narrow-band and broad-band ultraviolet B for psoriasis. Br J Dermatol. 2003;149(3):669–72.  153.  Gambichler T, Breuckmann F, Boms S, Altmeyer P, Kreuter A. Narrowband UVB phototherapy in skin conditions beyond psoriasis. J Am Acad Dermatol. 2005;52(4):660–70.  154.  Stern RS, Zierler S, Parrish JA. Methotrexate used for psoriasis and the risk of noncutaneous or cutaneous malignancy. Cancer. 1982;50(5):869–72.  155.  Buchbinder R, Barber M, Heuzenroeder L, Wluka AE, Giles G, Hall S, et al. Incidence of melanoma and other malignancies among rheumatoid arthritis patients treated with methotrexate. Arthritis Care Res. 2008;59(6):794–9.  156.  Preet Singh Y, Aggarwal A, Misra R, Agarwal V. Low-dose methotrexate-induced pancytopenia. Clin Rheumatol. 2007;26(1):84–7.  157.  Weinstein G, Roenigk H, Maibach H, Cosmides J, Halprin K, Millard M, et al. Psoriasis-Liver-Methotrexate Interactions. Arch Dermatol. 1973;108(1):36–42.  158.  Nyfors A. Liver biopsies from psoriatics related to methotrexate therapy. 3. Findings in post-methotrexate liver biopsies from 160 psoriatics. Acta Pathol Microbiol Scand A. 1977;85(4):511–8.  159.  Griffiths CEM, Powles A V, Leonard JN, Fry L, Baker BS, Valdimarsson H. Clearance of psoriasis with low dose cyclospon. Br Med J (Clinical Res Ed. 1986;293(6554):1098–9.  160.  Ellis CN, Gorsulowsky DC, Hamilton TA, Billings JK, Brown MD, Headington JT, et al. Cyclosporine improves psoriasis in a double-blind study. Jama. 1986;256(22):3110–6.  161.  Paul CF, Ho VC, McGeown C, Christophers E, Schmidtmann B, Guillaume JC, et al. Risk of malignancies in psoriasis patients treated with cyclosporine: A 5 y cohort study. J Invest Dermatol. 108  2003;120(2):211–6.  162.  Kurki PT. Safety aspects of the long term cyclosporin A therapy. Scand J Rheumatol Suppl. 1992;95:35–8.  163.  Seminara NM, Gelfand JM. Assessing Long-Term Drug Safety: Lessons (Re) Learned from Raptiva. Seminars in Cutaneous Medicine and Surgery. 2010. p. 16–9.  164.  Ellis CN, Krueger GG. TREATMENT OF CHRONIC PLAQUE PSORIASIS BY SELECTIVE TARGETING OF MEMORY EFFECTOR T LYMPHOCYTES. N Engl J Med. 2001;345(4):248–55.  165.  Vugmeyster Y, Kikuchi T, Lowes MA, Chamian F, Kagen M, Gilleaudeau P, et al. Efalizumab (anti-CD11a)-induced increase in peripheral blood leukocytes in psoriasis patients is preferentially mediated by altered trafficking of memory CD8+ T cells into lesional skin. Clin Immunol. 2004;113(1):38–46.  166.  Ettehadi P, Greaves MW, Wallach D, Aderka D, Camp RD. Elevated tumour necrosis factor-alpha (TNF-alpha) biological activity in psoriatic skin lesions. Clin Exp Immunol. 1994;96(1):146–51.  167.  Krueger G, Callis K. Potential of tumor necrosis factor inhibitors in psoriasis and psoriatic arthritis. Arch Dermatol. 2004;140(2):218–25.  168.  Scheinfeld N. A comprehensive review and evaluation of the side effects of the tumor necrosis factor alpha blockers etanercept, infliximab and adalimumab. J Dermatolog Treat. 2004;15(5):280–94.  169.  Chaudhari U, Romano P, Mulcahy LD, Dooley LT, Baker DG, Gottlieb AB. Efficacy and safety of infliximab monotherapy for plaque-type psoriasis: A randomised trial. Lancet. 2001;357(9271):1842–7.  170.  Mease PJ. Adalimumab: an anti-TNF agent for the treatment of psoriatic arthritis. Expert Opin Biol Ther. 2005;5(11):1491–504.  171.  Chiricozzi A, Guttman-Yassky E, Suárez-Fariñas M, Nograles KE, Tian S, Cardinale I, et al. Integrative responses to IL-17 and TNF-α in human keratinocytes account for key inflammatory pathogenic circuits in psoriasis. J Invest Dermatol. 2011;131(3):677–87.  172.  Bongartz T, Sutton AJ, Sweeting MJ, Buchan I, Matteson EL, Montori V. Anti-TNF Antibody Therapy in Rheumatoid Arthritis and the Risk. J Am Med Assoc Med Assoc. 2006;295(19).  173.  Girard C, Guillot B, Bessis D. Gastric MALT lymphoma in a patient receiving infliximab for psoriasis. Br J Dermatol. 2008;159(2):497–8.  174.  Brown SL, Greene MH, Gershon SK, Edwards ET, Braun MM. Tumor necrosis factor antagonist therapy and lymphoma development: Twenty-six cases reported to the Food and Drug 109  Administration. Arthritis Rheum. 2002;46(12):3151–8.  175.  Hueber W, Patel DD, Dryja T, Wright AM, Koroleva I, Bruin G, et al. Effects of AIN457, a fully human antibody to interleukin-17A, on psoriasis, rheumatoid arthritis, and uveitis. Sci Transl Med. 2010;2(52):52ra72.  176.  Cameron G, Ph D, Li L, Edson-heredia E, Braun D, Ph D, et al. Anti–Interleukin-17 Monoclonal Antibody Ixekizumab in Psoriasis. N Engl J Med. 2012;367(3):274–5.  177.  Cypowyj S, Picard C, Mar??di L, Casanova JL, Puel A. Immunity to infection in IL-17-deficient mice and humans. Eur J Immunol. 2012;42(9):2246–54.  178.  Roses RE, Xu S, Xu M, Koldovsky U, Koski G, Czerniecki BJ. Differential production of IL-23 and IL-12 by myeloid-derived dendritic cells in response to TLR agonists. J Immunol. 2008;181(7):5120–7.  179.  Vignali D a a, Kuchroo VK. IL-12 family cytokines: immunological playmakers. Nat Immunol. 2012 Aug;13(8):722–8.  180.  Griffiths CEM, Strober BE, van de Kerkhof P, Ho V, Fidelus-Gort R, Yeilding N, et al. Comparison of ustekinumab and etanercept for moderate-to-severe psoriasis. N Engl J Med. 2010;362(2):118–28.  181.  Reich K, Langley RG, Papp K a., Ortonne J-P, Unnebrink K, Kaul M, et al. A 52-Week Trial Comparing Briakinumab with Methotrexate in Patients with Psoriasis. N Engl J Med. 2011;365(17):1586–96.  182.  Langley RG, Papp K, Gottlieb AB, Krueger GG, Gordon KB, Williams D, et al. Safety results from a pooled analysis of randomized, controlled phase II and III clinical trials and interim data from an open-label extension trial of the interleukin-12/23 monoclonal antibody, briakinumab, in moderate to severe psoriasis. J Eur Acad Dermatology Venereol. 2013;27(10):1252–61.  183.  Gately MK, Renzetti LM, Magram J, Stern  a S, Adorini L, Gubler U, et al. The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses. Annu Rev Immunol. 1998;16:495–521.  184.  McGrath JA, Eady RAJ, Pope FM. Rook’s Textbook of Dermatology. Rook’s Textbook of Dermatology. 2004. 45-128 p.  185.  Souders CA, Bowers SLK, Baudino TA. Cardiac fibroblast: The renaissance cell. Circ Res. 2009;105(12):1164–76.  186.  Kündig TM, Bachmann MF, Dipaolo C, Simard JJL, Battegay M, Lother H, et al. Fibroblasts as Efficient Antigen-Presenting Cells in Lymphoid Organs. Science (80- ). 1995;268(5215):1343–7.  187.  Boots AM, Wimmers-Bertens AJ, Rijnders AW. Antigen-presenting capacity of rheumatoid 110  synovial fibroblasts. Immunology. 1994;82(2):268–74.  188.  Ito M, Ogawa K, Takeuchi K, Nakada A, Heishi M, Suto H, et al. Gene expression of enzymes for tryptophan degradation pathway is upregulated in the skin lesions of patients with atopic dermatitis or psoriasis. J Dermatol Sci. 2004;36(3):157–64.  189.  Carlin JM, Borden EC, Sondel PM, Byrne GI. Interferon-induced indoleamine 2,3-dioxygenase activity in human mononuclear phagocytes. J Leukoc Biol. 1989;45(1):29–34.  190.  Pinchuk I V, Beswick EJ, Saada JI, Boya G, Schmitt D, Raju GS, et al. Human colonic myofibroblasts promote expansion of CD4+ CD25high Foxp3+ regulatory T cells. Gastroenterology. Elsevier Inc.; 2011;140(7):2019–30.  191.  Sarkhosh K, Tredget EE, Li Y, Kilani RT, Uludag H, Ghahary A. Proliferation of peripheral blood mononuclear cells is suppressed by the indoleamine 2,3-dioxygenase expression of interferon-gamma-treated skin cells in a co-culture system. Wound Repair Regen. 2003;11(5):337–45.  192.  Donnelly JJ, Xi MS, Rockey JH. A soluble product of human corneal fibroblasts inhibits lymphocyte activation. Enhancement by interferon-gamma. Experimental eye research. 1993. p. 157–65.  193.  Jalili RB, Zhang Y, Hosseini-Tabatabaei A, Kilani RT, Khosravi Maharlooei M, Li Y, et al. Fibroblast Cell-Based Therapy for Experimental Autoimmune Diabetes. PLoS One. 2016;11(1):e0146970.  194.  Topalian SL, Drake CG, Pardoll DM. Targeting the PD-1/B7-H1(PD-L1) pathway to activate anti-tumor immunity. Curr Opin Immunol. Elsevier Ltd; 2012;24(2):207–12.  195.  Sandner SE, Clarkson MR, Salama AD, Sanchez-Fueyo A, Domenig C, Habicht A, et al. Role of the programmed death-1 pathway in regulation of alloimmune responses in vivo. J Immunol. 2005;174(6):3408–15.  196.  Fife BT, Pauken KE. The role of the PD-1 pathway in autoimmunity and peripheral tolerance. Ann N Y Acad Sci. 2011;1217(1):45–59.  197.  Sainio EL, Pulkki K, Young SN. L-Tryptophan: Biochemical, nutritional and pharmacological aspects. Amino Acids. 1996. p. 21–47.  198.  Wolf H. The effect of hormones and vitamin B6 on urinary excretion of metabolites of the kynurenine pathway. Scandinavian journal of clinical and laboratory investigation. Supplementum. 1974. 1-186 p.  199.  Schwarcz R, Bruno JP, Muchowski PJ, Wu H-Q. Kynurenines in the Mammalian Brain: When Physiology Meets Pathology. Nature Reviews Neuroscience. 2012. p. 465–77.  200.  Yoshida R, Hayaishi O. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal 111  injection of bacterial lipopolysaccharide. Proc Natl Acad Sci U S A. 1978;75(8):3998–4000.  201.  von Rango U, Krusche CA, Beier HM, Classen-Linke I. Indoleamine-dioxygenase is expressed in human decidua at the time maternal tolerance is established. J Reprod Immunol. 2007;74(1-2):34–45.  202.  Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. J Immunol. 2000;164(7):3596–9.  203.  Taylor MW, Feng GS. Relationship between interferon-gamma, indoleamine 2,3-dioxygenase, and tryptophan catabolism. Faseb J. 1991;5(11):2516–22.  204.  Oku T, Imanishi J. Interferon : A Mediator of lndoleamine 2 , 3-Dioxygenase Poly ( l ) . Poly ( C ), and Pokeweed in Mouse Lung ’ induction by Mitogen interferon and dioxygenase , although treatment with poly ( 1 ). poly ( C ) and pokeweed increase in the serum interferon t. Arch Biochem Biophys. 1986;249(2):596–604.  205.  Burkin DJ, Kimbro KS, Barr BL, Jones C, Taylor MW, Gupta SL. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8. Genomics. 1993. p. 262–3.  206.  Akemi H-O, Osamu T, Ryotaro Y. Cloning and expression of a cDNA encoding mouse indoleamine 2 , 3-dioxygenase. Gene. 1991;105(2):221–7.  207.  Mellor AL, Munn DH. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol. 2004;4(10):762–74.  208.  Hayaishi Osamu, Yamamoto Shozo. Tryptophan Pyrrolase of Rabbit Intestine. J Biol Chem,. 1967;242(22):5260–6.  209.  Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, et al. Prevention of Allogeneic Fetal Rejection by Tryptophan Catabolism Published by : American Association for the Advancement of Science Stable URL : http://www.jstor.org/stable/2895505 Your use of the JSTOR archive indicates your acceptance of the Terms & Co. Science (80- ). 1998;281(5380):1191–3.  210.  Kudo Y, Boyd CAR. The physiology of immune evasion during pregnancy; the critical role of placental tryptophan metabolism and transport. Pflugers Arch Eur J Physiol. 2001;442(5):639–41.  211.  Gajewski T, Meng Y, Harlin H. Immune suppression in the tumor microenvironment. J Immunother. 2006;29(3):233–40.  212.  Munn DH, Sharma MD, Hou D, Baban B, Lee JR, Antonia SJ, et al. Expression of indoleamine 2 , 3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. J Clin Invest. 112  2004;114(2):280–90.  213.  Munn DH. Indoleamine 2, 3-dioxygenase and tumor-induced tolerance. Curr Opin Immunol. 2007;18(2):220–5.  214.  Silva NM, Rodrigues C V, Santoro MM, Reis LFL, Alvarez-leite JI, Ricardo T, et al. Expression of Indoleamine and Kynurenine Formation during In Vivo Infection with Toxoplasma gondii : Induction by Endogenous Gamma Interferon and Requirement of Interferon Regulatory Factor 1 Expression of Indoleamine 2 , 3-Dioxygenase , Tryptophan Degrad. Infect Immun. 2002;70(2):859–68.  215.  Sakash JB, Byrne GI, Lichtman A, Libby P. Cytokines induce indoleamine 2,3-dioxygenase expression in human atheroma-asociated cells: implications for persistent Chlamydophila pneumoniae infection. InfectImmun. 2002;70(0019-9567):3959–61.  216.  Adams O, Besken K, Oberdo C, Mackenzie CR, Takikawa O, Da W. Role of Indoleamine-2 , 3-Dioxygenase in Alpha / Beta and Gamma Interferon-Mediated Antiviral Effects against Herpes Simplex Virus Infections. Society. 2004;78(5):2632–6.  217.  Brown RR, Ozaki Y, Datta SP, Borden EC, Sondel PM, Malone DG. Implications of interferon-induced tryptophan catabolism in cancer, auto-immune diseases and AIDS. Adv Exp Med Biol. 1991;294:425–35.  218.  Terness P, Bauer TM, Röse L, Dufter C, Watzlik A, Simon H, et al. Inhibition of Allogeneic T Cell Proliferation by Indoleamine 2,3-Dioxygenase–expressing Dendritic Cells. J Exp Med. 2002;196(4):447–57.  219.  Frumento G, Rotondo R, Tonetti M, Damonte G, Benatti U, Ferrara GB. Tryptophan-derived catabolites are responsible for inhibition of T and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J Exp Med. 2002;196(4):459–68.  220.  Beatty WL, Belanger TA, Desai AA, Morrison RP, Byrne GI. Tryptophan depletion as a mechanism of gamma interferon-mediated chlamydial persistence. Infect Immun. 1994;62(9):3705–11.  221.  Swanson KA, Zheng Y, Heidler KM, Mizobuchi T, Wilkes DS. CDllc+ Cells Modulate Pulmonary Immune Responses by Production of Indoleamine 2,3-Dioxygenase. Am J Respir Cell Mol Biol. 2004;30(3):311–8.  222.  Fallarino F, Grohmann U, You S, Mcgrath BC, Cavener DR, Vacca C, et al. The Combined Effects of Trypptophan Starvation and Tryptophan Catabolites Down-Regulate T Cell Receptor -Chain and Induce a Regulatory Phenotype in Naive T Cells. J Immunol. 2006;176:6752–61.  223.  Munn DH, Sharma MD, Baban B, Harding HP, Zhang Y, Ron D, et al. GCN2 kinase in T cells 113  mediates proliferative arrest and anergy induction in response to indoleamine 2,3-dioxygenase. Immunity. 2005;22(5):633–42.  224.  Drevet JR. The antioxidant glutathione peroxidase family and spermatozoa: A complex story. Mol Cell Endocrinol. 2006;250(1-2):70–9.  225.  Anthony TG, McDaniel BJ, Byerley RL, McGrath BC, Cavener DB, McNurlan MA, et al. Preservation of liver protein synthesis during dietary leucine deprivation occurs at the expense of skeletal muscle mass in mice deleted for eIF2 kinase GCN2. J Biol Chem. 2004;279(35):36553–61.  226.  Crosby JS, Chefalo PJ, Yeh I, Ying S, London IM, Leboulch P, et al. Regulation of hemoglobin synthesis and proliferation of differentiating erythroid cells by heme-regulated eIF-2alpha kinase. Blood. 2000;96(9):3241–8.  227.  Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, et al. T cell apoptosis by tryptophan catabolism. Cell Death Differ. 2002;9(10):1069–77.  228.  Dai H, Dai Z. The role of tryptophan catabolism in acquisition and effector function of memory T cells. Curr Opin Organ Transplant. 2008;13(1):31–5.  229.  Mezrich JD, Fechner JH, ZhangB X, Johnson  rian P, William J. Burlingham Christopher A. Bradfield. An Interaction between Kynurenine and the Aryl Hydrocarbon Receptor Can Generate Regulatory T Cells. J Immunol. 2010;185(6):3190–8.  230.  Sanam SE, Malihe-Sadat P-M, Yunyuan L, Reza B. J, Aziz G. Effects of Kynurenine on CD3+ and Macrophages in Wound Healing. Wound Repair Regen. 2014;(Il):n/a – n/a.  231.  Moroni F, Cozzi A, Sili M, Mannaioni G. Kynurenic acid: A metabolite with multiple actions and multiple targets in brain and periphery. J Neural Transm. 2012;119(2):133–9.  232.  Turski MP, Turska M, Paluszkiewicz P, Parada-Turska J, Oxenkrug GF. Kynurenic Acid in the digestive system-new facts, new challenges. Int J Tryptophan Res. 2013;6:47–55.  233.  Kuc D, Rahnama M, Tomaszewski T, Rzeski W, Wejksza K, Urbanik-sypniewska T, et al. Kynurenic acid in human saliva – does it influence oral microflora ? Pharmacol Reports. 2006;58:393–8.  234.  Dolecka J, Urbanik-Sypniewska T, Skrzyd??o-Radoma??ska B, Parada-Turska J. Effect of kynurenic acid on the viability of probiotics in vitro. Pharmacol Reports. 2011;63(2):548–51.  235.  Wang J, Simonavicius N, Wu X, Swaminath G, Reagan J, Tian H, et al. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. J Biol Chem. 2006;281(31):22021–8.  236.  Kaszaki J, Pal??sthy Z, ??rczes D, R??cz A, Torday C, Varga G, et al. Kynurenic acid inhibits intestinal hypermotility and xanthine oxidase activity during experimental colon obstruction in 114  dogs. Neurogastroenterol Motil. 2008;20(1):53–62.  237.  Fallarini S, Magliulo L, Paoletti T, de Lalla C, Lombardi G. Expression of functional GPR35 in human iNKT cells. Biochem Biophys Res Commun. Elsevier Inc.; 2010;398(3):420–5.  238.  Birkedal-Hansen H. Role of matrix metalloproteinases in human periodontal diseases. J Periodontol. 1993;64(5 Suppl):474–84.  239.  Wu YS, Chen SN. Apoptotic cell: Linkage of inflammation and wound healing. Frontiers in Pharmacology. 2014.  240.  Greenhalgh DG. The role of growth factors in wound healing. J Trauma. 1996;41(1):159–67.  241.  Wynn TA. Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. Journal of Clinical Investigation. 2007. p. 524–9.  242.  Eming SA, Krieg T, Davidson JM. Inflammation in wound repair: molecular and cellular mechanisms. J Invest Dermatol. 2007;127(3):514–25.  243.  Li Y, Tredget EE, Ghaffari A, Lin X, Kilani RT, Ghahary A. Local expression of indoleamine 2,3-dioxygenase protects engraftment of xenogeneic skin substitute. J Invest Dermatol. 2006;126(1):128–36.  244.  Li Y, Tredget EE, Kilani RT, Iwashina T, Karami A, Lin X, et al. Expression of indoleamine 2,3-dioxygenase in dermal fibroblasts functions as a local immunosuppressive factor. J Invest Dermatol. 2004;122(4):953–64.  245.  Forouzandeh F, Jalili RB, Germain M, Duronio V, Ghahary  a. Differential immunosuppressive effect of indoleamine 2,3-dioxygenase (IDO) on primary human CD4+ and CD8+ T cells. Mol Cell Biochem. 2008;309(1-2):1–7.  246.  Li Y, Kilani RT, Rahmani-Neishaboor E, Jalili RB, Ghahary A. Kynurenine increases matrix metalloproteinase-1 and -3 expression in cultured dermal fibroblasts and improves scarring in vivo. J Invest Dermatol. 2014;134(3):643–50.  247.  Takamiya M, Biwasaka H, Saigusa K, Nakayashiki N, Aoki Y. Wound age estimation by simultaneous detection of 9 cytokines in human dermal wounds with a multiplex bead-based immunoassay: An estimative method using outsourced examinations. Leg Med. 2009;11(4):186–90.  248.  Chavez-Munoz C, Hartwell R, Jalili RB, Carr M, Kilani RT, Jafarnejad SM, et al. Application of an indoleamine 2,3-dioxygenase-expressing skin substitute improves scar formation in a fibrotic animal model. J Invest Dermatol. 2012;132(5):1501–5.  249.  Habibi D, Jalili RB, Forouzandeh F, Ong CJ, Ghahary A. High expression of IMPACT protein promotes resistance to indoleamine 2,3-dioxygenase-induced cell death. J Cell Physiol. 115  2010;225(1):196–205.  250.  Mellor AL, Munn DH. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol. 2004;4(10):762–74.  251.  Wilgus TA. Immune cells in the healing skin wound: Influential players at each stage of repair. Pharmacological Research. 2008. p. 112–6.  252.  Schröcksnadel H, Baier-Bitterlich G, Dapunt O, Wachter H, Fuchs D. Decreased plasma tryptophan in pregnancy. Obstet Gynecol. 1996;88(1):47–50.  253.  Fuchs D, Schröcksnadel H, Baier-Bitterlich G, Dapunt O, Wachter H. Activated cellular immunity and decreased serum tryptophan in healthy pregnancy. Adv Exp Med Biol. 1996;398:149–53.  254.  Miossec P, Kolls JK. Targeting IL-17 and TH17 cells in chronic inflammation. Nat Rev Drug Discov. 2012;11(10):763–76.  255.  Ju S Te, Sharma R, Gaskin F, Fu SM. IL-2 controls trafficking receptor gene expression and Th2 response for skin and lung inflammation. Clinical Immunology. 2012. p. 82–8.  256.  Gillitzer R, Goebeler M. Chemokines in cutaneous wound healing. J Leukoc Biol. 2001;69(4):513–21.  257.  Salcedo R, Ponce ML, Young H a, Wasserman K, Ward JM, Kleinman HK, et al. Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood. 2000;96(1):34–40.  258.  Stamatovic SM, Keep RF, Mostarica-Stojkovic M, Andjelkovic A V. CCL2 regulates angiogenesis via activation of Ets-1 transcription factor. J Immunol. 2006;177(4):2651–61.  259.  Isik FF, Rand RP, Gruss JS, Benjamin D, Alpers CE. Monocyte chemoattractant protein-1 mRNA expression in hemangiomas and vascular malformations. J Surg Res. 1996;61(1):71–6.  260.  Goede V, Brogelli L, Ziche M, Augustin HG. Induction of inflammatory angiogenesis by monocyte chemoattractant protein-1. Int J Cancer. 1999;82(5):765–70.  261.  Stockinger B, Veldhoen M. Differentiation and function of Th17 T cells. Current Opinion in Immunology. 2007. p. 281–6.  262.  Steinman L. A brief history of T(H)17, the first major revision in the T(H)1/T(H)2 hypothesis of T cell-mediated tissue damage. Nat Med. 2007;13(2):139–45.  263.  Nguyen NT, Kimura A, Nakahama T, Chinen I, Masuda K, Nohara K, et al. Aryl hydrocarbon receptor negatively regulates dendritic cell immunogenicity via a kynurenine-dependent mechanism. Proc Natl Acad Sci U S A. 2010;107(46):19961–6.  264.  Mezrich JD, Fechner JH, Zhang X, Johnson BP, Burlingham WJ, Bradfield C a. An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. J Immunol. 116  2010;185(6):3190–8.  265.  Strbo N, Yin N, Stojadinovic O. Innate and Adaptive Immune Responses in Wound Epithelialization. Adv Wound Care. 2014;3(7):492–501.  266.  Poormasjedi-Meibod MS, Jalili RB, Hosseini-Tabatabaei A, Hartwell R, Ghahary A. Immuno-Regulatory Function of Indoleamine 2,3 Dioxygenase through Modulation of Innate Immune Responses. PLoS One. 2013;8(8).  267.  Neill L, Tien AH, Rey-Ladino J, Helgason CD. SHIP-deficient mice provide insights into the regulation of dendritic cell development and function. Exp Hematol. 2007;35(4):627–39.  268.  Germain RN. MHC-dependent antigen processing and peptide presentation: Providing ligans for T lymphocyte activation. Cell. 1994;76:287–99.  269.  Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998 Mar 19;392(6673):245–52.  270.  Liu Y, Janeway CA. Cells that present both specific ligand and costimulatory activity are the most efficient inducers of clonal expansion of normal CD4 T cells. Proc Natl Acad Sci U S A. 1992;89(9):3845–9.  271.  Spoerri R, Reis e Sousa C, Nolte M., Joffre O. Inflammatory signals in dendritic cell activation and the induction of adaptive immunity. Immunological Reviews. 2009. p. 234–47.  272.  Zhu J, Paul WE. Peripheral CD4+ T-cell differentiation regulated by networks of cytokines and transcription factors. Immunol Rev. 2010;238(1):247–62.  273.  Lanzavecchia A, Sallusto F. Dynamics of T Lymphocyte Responses: Intermediates, Effectors, and Memory Cells. Science (80- ). 2010;290(5489):92–7.  274.  Kikly K, Liu L, Na S, Sedgwick JD. The IL-23/Th17 axis: therapeutic targets for autoimmune inflammation. Current Opinion in Immunology. 2006. p. 670–5.  275.  Awasthi A, Riol-Blanco L, Jäger A, Korn T, Pot C, Galileos G, et al. Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J Immunol. 2009;182(10):5904–8.  276.  Kyttaris VC, Zhang Z, Kuchroo VK, Oukka M, Tsokos GC. Cutting edge: IL-23 receptor deficiency prevents the development of lupus nephritis in C57BL/6-lpr/lpr mice. J Immunol. 2010;184(9):4605–9.  277.  McGeachy MJ, Chen Y, Tato CM, Laurence A, Joyce-Shaikh B, Blumenschein WM, et al. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17–producing effector T helper cells in vivo. Nat Immunol. 2009 Mar 1;10(3):314–24.  278.  Kolls JK, Lindén A. Interleukin-17 Family Members and Inflammation. Immunity. 2004 117  Oct;21(4):467–76.  279.  Maddur MS, Miossec P, Kaveri S V., Bayry J. Th17 cells: Biology, pathogenesis of autoimmune and inflammatory diseases, and therapeutic strategies. Am J Pathol. 2012 Jul;181(1):8–18.  280.  Shen H, Goodall JC, Hill Gaston JS. Frequency and phenotype of peripheral blood Th17 cells in ankylosing spondylitis and rheumatoid arthritis. Arthritis Rheum. 2009;60(6):1647–56.  281.  Lubberts E, Koenders MI, van den Berg WB. The role of T-cell interleukin-17 in conducting destructive arthritis: lessons from animal models. Arthritis Res Ther. 2005;7(1):29–37.  282.  Yang J, Chu Y, Yang X, Gao D, Zhu L, Yang X, et al. Th17 and natural treg cell population dynamics in systemic lupus erythematosus. Arthritis Rheum. 2009;60(5):1472–83.  283.  Doreau A, Belot A, Bastid J, Riche B, Trescol-Biemont M-C, Ranchin B, et al. Interleukin 17 acts in synergy with B cell-activating factor to influence B cell biology and the pathophysiology of systemic lupus erythematosus. Nat Immunol. Nature Publishing Group; 2009;10(7):778–85.  284.  Tzartos JS, Friese M a, Craner MJ, Palace J, Newcombe J, Esiri MM, et al. Interleukin-17 production in central nervous system-infiltrating T cells and glial cells is associated with active disease in multiple sclerosis. Am J Pathol. 2008;172(1):146–55.  285.  Zenewicz L a., Antov A, Flavell R a. CD4 T-cell differentiation and inflammatory bowel disease. Trends Mol Med. 2009;15(5):199–207.  286.  Wilke CM, Bishop K, Fox D, Zou W. Deciphering the role of Th17 cells in human disease. Trends Immunol. Elsevier Ltd; 2011;32(12):603–11.  287.  Cosmi L, Maggi L, Santarlasci V, Capone M, Cardilicchia E, Frosali F, et al. Identification of a novel subset of human circulating memory CD4+ T cells that produce both IL-17A and IL-4. J Allergy Clin Immunol. Elsevier Ltd; 2010;125(1-3):222–30.e4.  288.  Costa VS, Mattana TCC, da Silva MER. Unregulated IL-23/IL-17 immune response in autoimmune diseases. Diabetes Research and Clinical Practice. 2010. p. 222–6.  289.  Hazlett J, Stamp, LK; Merriman T, Highton J, Hessian P. IL-23R rs11209026 polymorphism modulates IL-17A expression in patients with rheumatoid arthritis. GENES Immun. 2011;13(3):282–7.  290.  Mok MY, Wu HJ, Lo Y, Lau CS. The relation of interleukin 17 (IL-17) and IL-23 to Th1/Th2 cytokines and disease activity in systemic lupus erythematosus. J Rheumatol. 2010;37(10):2046–52.  291.  Shen H, Xia L, Lu J, Xiao W. Interleukin-17 and interleukin-23 in patients with polymyositis and dermatomyositis. Scand J Rheumatol. 2011;40(3):217–20.  292.  Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, et al. IL-23 drives 118  a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. 2005;201(2):233–40.  293.  Wiekowski MT, Leach MW, Evans EW, Sullivan L, Chen SC, Vassileva G, et al. Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J Immunol. 2001;166:7563–70.  294.  Kimball AB, Gordon KB, Langley RG, Menter A, Chartash EK, Valdes J. Safety and efficacy of ABT-874, a fully human interleukin 12/23 monoclonal antibody, in the treatment of moderate to severe chronic plaque psoriasis: results of a randomized, placebo-controlled, phase 2 trial. Arch Dermatol. 2008;144(2):200–7.  295.  Levin A a., Gottlieb AB. Specific targeting of interleukin-23p19 as effective treatment for psoriasis. J Am Acad Dermatol. Elsevier Inc; 2014;70(3):555–61.  296.  Patel R V, Clark LN, Lebwohl M, Weinberg JM. Treatments for psoriasis and the risk of malignancy. J Am Acad Dermatol. Elsevier Inc; 2009;60(6):1001–17.  297.  Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, et al. Prevention of Allogeneic Fetal Rejection by Tryptophan Catabolism. Science (80- ). 1998;281(5380):1191–3.  298.  Mándi Y, Vécsei L. The kynurenine system and immunoregulation. J Neural Transm. 2012;119(2):197–209.  299.  Kudo Y, Boyd C a R, Sargent IL, Redman CWG. Tryptophan degradation by human placental indoleamine 2, 3-dioxygenase regulates lymphocyte proliferation. J Physiol. 2001;535(2001):207–15.  300.  Munn DH, Shafizadeh E, Attwood JT, Bondarev I, Pashine  a, Mellor  a L. Inhibition of T cell proliferation by macrophage tryptophan catabolism. J Exp Med. 1999;189(9):1363–72.  301.  Moffett JR, Namboodiri MA. Tryptophan and the immune response. Immunol Cell Biol. 2003;81(4):247–65.  302.  Małaczewska J, Siwicki AK, Wójcik RM, Kaczorek E, Turski WA. Effect of oral administration of kynurenic acid on the activity of the peripheral blood leukocytes in mice. Cent Eur J Immunol. 2014;1(1):6–13.  303.  Csáti A, Edvinsson L, Vécsei L, Toldi J, Fülöp F, Tajti J, et al. Kynurenic acid modulates experimentally induced inflammation in the trigeminal ganglion. J Headache Pain. The Journal of Headache and Pain; 2015;16(1):99.  304.  Fallarini S, Magliulo L, Paoletti T, de Lalla C, Lombardi G. Expression of functional GPR35 in human iNKT cells. Biochem Biophys Res Commun. Elsevier Inc.; 2010;398(3):420–5.  305.  Moroni F, Fossati S, Chiarugi A, Cozzi A. Kynurenic acid actions in brain and periphery. Int 119  Congr Ser. 2007;1304:305–13.  306.  Shi Q, Yin Z, Zhao B, Sun F, Yu H, Yin X, et al. PGE2 Elevates IL-23 Production in Human Dendritic Cells via a cAMP Dependent Pathway. Mediators Inflamm. 2015;2015:1–8.  307.  Lutz MB, Kukutsch N, Ogilvie  a L, Rössner S, Koch F, Romani N, et al. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods. 1999;223(1):77–92.  308.  Cozzi A, Attucci S, Peruginelli F, Marinozzi M, Luneia R, Pellicciari R, et al. Type 2 metabotropic glutamate (mGlu) receptors tonically inhibit transmitter release in rat caudate nucleus: in vivo studies with (2S,1’S,2'S,3'R)-2-(2'-carboxy-3'-phenylcyclopropyl)glycine, a new potent and selective antagonist. Eur J Neurosci. 1997;9(7):1350–5.  309.  Lombardi G, Alesiani M, Leonardi P, Cherici G, Pellicciari R, Moroni F. Pharmacological characterization of the metabotropic glutamate receptor inhibiting D-[3H]-aspartate output in rat striatum. Br J Pharmacol. 1993;110(4):1407–12.  310.  McKenzie BS, Kastelein RA, Cua DJ. Understanding the IL-23–IL-17 immune pathway. Trends Immunol. 2006;27(1):17–23.  311.  Kambayashi T, Wallin RP, Ljunggren HG. cAMP-elevating agents suppress dendritic cell function. J Leukoc Biol. 2001;70(6):903–10.  312.  Abdi K, Singh NJ, Matzinger P. Lipopolysaccharide-Activated Dendritic Cells: “Exhausted” or Alert and Waiting? J Immunol. 2012;188(12):5981–9.  313.  Chang J, Voorhees TJ, Liu Y, Zhao Y, Chang C-H. Interleukin-23 production in dendritic cells is negatively regulated by protein phosphatase 2A. Proc Natl Acad Sci U S A. 2010;107(18):8340–5.  314.  Kaszaki J, Palásthy Z, Erczes D, Rácz  a, Torday C, Varga G, et al. Kynurenic acid inhibits intestinal hypermotility and xanthine oxidase activity during experimental colon obstruction in dogs. Neurogastroenterol Motil. 2008;20(1):53–62.  315.  Varga G, Erces D, Fazekas B, Fülöp M, Kovács T, Kaszaki J, et al. N-Methyl-D-aspartate receptor antagonism decreases motility and inflammatory activation in the early phase of acute experimental colitis in the rat. Neurogastroenterol Motil. 2010;22(2):217–25, e68.  316.  Tiszlavicz Z, Németh B, Fülöp F, Vécsei L, Tápai K, Ocsovszky I, et al. Different inhibitory effects of kynurenic acid and a novel kynurenic acid analogue on tumour necrosis factor-α (TNF-α) production by mononuclear cells, HMGB1 production by monocytes and HNP1-3 secretion by neutrophils. Naunyn Schmiedebergs Arch Pharmacol. 2011;383(5):447–55.  317.  Lowes MA, Kikuchi T, Fuentes-Duculan J, Cardinale I, Zaba LC, Haider AS, et al. Psoriasis Vulgaris Lesions Contain Discrete Populations of Th1 and Th17 T Cells. J Invest Dermatol. 120  Elsevier Masson SAS; 2008;128(5):1207–11.  318.  Zenewicz L a, Antov A, Flavell R a. CD4 T-cell differentiation and inflammatory bowel disease. Trends Mol Med. 2009;15(5):199–207.  319.  Gleick PH, MacDonald GM. Roadmap for sustainable water resources in southwestern North America. Proc Natl Acad Sci U S A. 2010;107(50):21300–5.  320.  Carlson T, Kroenke M, Rao P, Lane TE, Segal B. The Th17-ELR+ CXC chemokine pathway is essential for the development of central nervous system autoimmune disease. J Exp Med. 2008;205(4):811–23.  321.  Chen Z, Laurence A, Kanno Y, Pacher-Zavisin M, Zhu B-M, Tato C, et al. Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells. Proc Natl Acad Sci U S A. 2006;103(21):8137–42.  322.  D’Elios MM, Del Prete G, Amedei A. Targeting IL-23 in human diseases. Expert Opin Ther Targets. 2010;14(7):759–74.  323.  Roberts DJ, Waelbroeck M. G protein activation by G protein coupled receptors: ternary complex formation or catalyzed reaction? Biochem Pharmacol. 2004;68(5):799–806.  324.  Preininger AM, Hamm HE. G protein signaling: insights from new structures. Sci STKE. 2010;2004(218):1–10.  325.  Birnbaumer L. Expansion of signal transduction by G proteins. Biochim Biophys Acta - Biomembr. 2007;1768(4):772–93.  326.  Liu W, Ouyang X, Yang J, Liu J, Li Q, Gu Y, et al. AP-1 activated by toll-like receptors regulates expression of IL-23 p19. J Biol Chem. 2009;284(36):24006–16.  327.  Zhao P, Sharir H, Kapur A, Cowan A, Geller EB, Adler MW, et al. Targeting of the orphan receptor GPR35 by pamoic acid: a potent activator of extracellular signal-regulated kinase and β-arrestin2 with antinociceptive activity. Mol Pharmacol. 2010;78(4):560–8.  328.  Uh A, Simmons CF, Bresee C, Khoury N, Gombart AF, Nicholson RC, et al. MyD88 and TRIF mediate the cyclic adenosine monophosphate (cAMP) induced corticotropin releasing hormone (CRH) expression in JEG3 choriocarcinoma cell line. Reprod Biol Endocrinol. 2009;7:74.  329.  Fitzpatrick TB, Wolff K, Goldsmith LA, Katz SI, Gilchrest BA, Paller AS, et al. Fitzpatrick’s dermatology in general medicine [electronic resource]. McGrawHills AccessMedicine Clinical library. 2008.  330.  Kurzeja M, Rudnicka L, Olszewska M. New interleukin-23 pathway inhibitors in dermatology: Ustekinumab, briakinumab, and secukinumab. Am J Clin Dermatol. 2011;12(2):113–25.  331.  Genovese MC, Van Den Bosch F, Roberson SA, Bojin S, Biagini IM, Ryan P, et al. LY2439821, a 121  humanized anti-interleukin-17 monoclonal antibody, in the treatment of patients with rheumatoid arthritis: A phase I randomized, double-blind, placebo-controlled, proof-of-concept study. Arthritis Rheum. 2010;62(4):929–39.  332.  Maclennan C, Fieschi C, Lammas DA, Picard C, Susan E, Sanal O, et al. Interleukin ( IL ) -12 and IL-23 Are Key Cytokines for Immunity against Salmonella in Humans. J Infect Dis. 2004;190(10):1755–7.  333.  Tzellos T, Kyrgidis A, Zouboulis CC. Re-evaluation of the risk for major adverse cardiovascular events in patients treated with anti-IL-12/23 biological agents for chronic plaque psoriasis: A meta-analysis of randomized controlled trials. J Eur Acad Dermatology Venereol. 2013;27(5):622–7.  334.  Hayaishi O. Utilization of superoxide anion by indoleamine oxygenase-catalyzed tryptophan and indoleamine oxidation. Adv Exp Med Biol. 1996;398:285–9.  335.  El Malki K, Karbach SH, Huppert J, Zayoud M, Reißig S, Schüler R, et al. An Alternative Pathway of Imiquimod-Induced Psoriasis-Like Skin Inflammation in the Absence of Interleukin-17 Receptor A Signaling. J Invest Dermatol. 2012;441–51.  336.  Jalili RB, Forouzandeh F, Rezakhanlou AM, Hartwell R, Medina A, Warnock GL, et al. Local expression of indoleamine 2,3 dioxygenase in syngeneic fibroblasts significantly prolongs survival of an engineered three-dimensional islet allograft. Diabetes. 2010 Sep;59(9):2219–27.  337.  Terhorst D, Chelbi R, Wohn C, Malosse C, Tamoutounour S, Jorquera A, et al. Dynamics and Transcriptomics of Skin Dendritic Cells and Macrophages in an Imiquimod-Induced, Biphasic Mouse Model of Psoriasis. J Immunol. 2015;195(10):4953–61.  338.  Danilenko DM. Review paper: preclinical models of psoriasis. Vet Pathol. 2008;45(4):563–75.  339.  Gudjonsson JE, Johnston A, Dyson M, Valdimarsson H, Elder JT. Mouse models of psoriasis. J Invest Dermatol. Elsevier Masson SAS; 2007;127(6):1292–308.  340.  van der Fits L, Mourits S, Voerman JS a, Kant M, Boon L, Laman JD, et al. Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis. J Immunol. 2009;182(9):5836–45.  341.  Flutter B, Nestle FO. TLRs to cytokines: Mechanistic insights from the imiquimod mouse model of psoriasis. Eur J Immunol. 2013;43(12):3138–46.  342.  Bousso P. T-cell activation by dendritic cells in the lymph node: lessons from the movies. Nat Rev. 2008;8(9):675–84.  343.  Tonel G, Conrad C, Laggner U, Di Meglio P, Grys K, McClanahan TK, et al. Cutting edge: A critical functional role for IL-23 in psoriasis. J Immunol. 2010;185(10):5688–91.  122  344.  Cai Y, Shen X, Ding C, Qi C, Li K, Li X, et al. Pivotal Role of Dermal IL-17-Producing ϒδ T Cells in Skin Inflammation. Immunity. 2011;35(4):596–610.  345.  Haniffa MA, Wang X, Holtick U, Rae M, Isaacs JD, Dickinson AM, et al. Adult Human Fibroblasts Are Potent Immunoregulatory Cells and Functionally Equivalent to Mesenchymal Stem Cells. J Immunol. 2007;179:1595–604.  346.  Detrick F. Enzymic formation of d-kynurenine from d-tryptophan. Arch Biochem Biophys. 1967;120(2):397–403.  347.  Hayaishi O. Utilization of superoxide anion by indoleamine oxygenase-catalyzed tryptophan and indoleamine oxidation. Adv Exp Med Biol. 1996;398:285–9.  348.  Barton GM. A calculated response: Control of inflammation by the innate immune system. J Clin Invest. 2008;118(2):413–20.  349.  Serhan CN, Savill J. Resolution of inflammation: the beginning programs the end. Nat Immunol. 2005;6(12):1191–7.  350.  Martin P, Leibovich SJ. Inflammatory cells during wound repair: The good, the bad and the ugly. Trends Cell Biol. 2005;15(11):599–607.  351.  Kelly JB, Foley P, Strober BE. Current and Future Oral Systemic Therapies for Psoriasis. Dermatol Clin. Elsevier Inc; 2015;33(1):91–109.  352.  Jullien D, Prinz JC, Nestle FO. Immunogenicity of biotherapy used in psoriasis: the science behind the scenes. J Invest Dermatol. 2015;135(1):31–8.     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0314175/manifest

Comment

Related Items