Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Novel approaches for TB vaccine and treatments : improving BCG vaccine and ‎identification of a potential… Liao, Ting Yu Angela 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_november_liao_tingyuangela.pdf [ 4.58MB ]
Metadata
JSON: 24-1.0314168.json
JSON-LD: 24-1.0314168-ld.json
RDF/XML (Pretty): 24-1.0314168-rdf.xml
RDF/JSON: 24-1.0314168-rdf.json
Turtle: 24-1.0314168-turtle.txt
N-Triples: 24-1.0314168-rdf-ntriples.txt
Original Record: 24-1.0314168-source.json
Full Text
24-1.0314168-fulltext.txt
Citation
24-1.0314168.ris

Full Text

Novel approaches for TB vaccine and treatments: Improving BCG vaccine and identification of a potential new drug target  by  Ting Yu Angela Liao  B.Sc., The University of British Columbia, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2016  © Ting Yu Angela Liao, 2016   ii Abstract   Current strategies of TB control include vaccination as a preventive approach and drug-based treatment as post-exposure therapy. In my PhD studies, I aimed to contribute in both directions: improving the current BCG vaccine and identifying and characterizing novel TB drug targets. I developed a novel non-genetic approach for the rapid display of exogenous proteins on mycobacterial cell surfaces as an alternative to DNA-based gene expression for upgrading BCG. A monomeric form of avidin that had the feature of reversible binding to biotin was chosen to generate avidin fusion proteins for surface decoration of biotinylated BCG. Avidin-tagged proteins bound to BCG surface reproducibly and stably with no effect on BCG growth. Thereafter, chimeric proteins corresponding to ovalbumin (OVA) and the M. tuberculosis (M.tb) specific ESAT6 antigen were generated and tested for their immunogenicity in vaccinated mice. BCG-OVA induced an immune response similar to that induced by BCG expressing the same surrogate antigen genetically. Furthermore, BCG decorated with ESAT6 successfully induced the expansion of specific T cell responses in vivo. This technology, therefore, can effectively replace traditional transformation of BCG with antigen-encoding genes and provide a novel platform for rapid evaluation of immunogenic proteins with broad applications in vaccine development.   Mycobacterial lipoamide dehydrogenase (LpdC) is involved in the aberrant and prolonged retention of host protein coronin-1A (COR1A) on the phagosomal membrane, which contributes significantly to the inhibition of phagosome maturation, leading to intracellular persistence of M.tb. I constructed and utilized recombinant LpdC protein and DLpdC M.tb mutant to characterize LpdC and   iii investigate potential mechanisms of LpdC-COR1A retention. DLpdC M.tb showed a decreased growth rate in standard media, induced phagolysosome fusion, and survived less than wild-type M.tb inside macrophages. I also found that LpdC interacted with a series of phosphoinositides (PIPs) and surprisingly aided in the induction of ROS production, which added to the multi-functionality of LpdC. From these studies, I have further characterized mycobacterial LpdC with regard to its role in M.tb persistence and paved ways for further investigations into LpdC’s potential as a novel drug target candidate.        iv Preface Parts of this thesis have been published in peer-reviewed journals listed below:  A version of chapter 3 has been published. [Ting-Yu Angela Liao], Alice Lau, Sunil Joseph, Vesa Hytonen, and Zakaria Hmama (2015). Improving the immunogenicity of the Mycobacterium bovis BCG vaccine by non-genetic bacterial surface decoration using the avidin-biotin system. PLoS ONE. 10(12): e0145833. I designed and conducted most of the experiments, analyzed all the data, and wrote the manuscript. Dr. Zakaria Hmama assisted in writing and editing the manuscript. Dr. Sunil Joseph performed the electron microscopy experiments for Figure 9B. Alice Lau performed the confocal experiments for Figure 10. Dr. Vesa Hytonen designed and made the avidin monomer.   Chapter 4 is based on work conducted in our laboratory. I was responsible for conducting all experiments except for Figure 18B, C, D and Figure 20, which were conducted by Dr. Alex Yuen.   All animals were maintained in accordance with protocols approved by the Animal Care and Use Committees at the University of British Columbia. Experiments were approved by the Animal Care and Use Committees and performed according to the Canadian Council on Animal Care Guidelines. The animal assurance welfare number is A11-0247.      v Table of Contents  Abstract	..................................................................................................................................	ii	Preface	...................................................................................................................................	iv	Table	of	Contents	....................................................................................................................	v	List	of	Tables	...........................................................................................................................	x	List	of	Figures	.........................................................................................................................	xi	List	of	Abbreviations	.............................................................................................................	xiv	Acknowledgements	.............................................................................................................	xvii	Chapter	1:	Introduction	..........................................................................................................	1	1.1	 Tuberculosis	........................................................................................................................	1	1.1.1	 History	of	TB	and	Current	Strategies	of	TB	Control:	Preventative	(Vaccines)	and	Post-exposure	(Drug	Therapies)	Measures	..................................................................................................	1	1.1.2	 TB	Drug	Resistance	.................................................................................................................	4	1.1.3	 Potential	New	TB	Vaccines	.....................................................................................................	6	1.1.3.1	 Different	Vaccine	Strategies	........................................................................................................	7	1.1.3.1.1	 Live	M.tb	.................................................................................................................................	7	1.1.3.1.2	 Subunit	Vaccines	.....................................................................................................................	8	1.1.3.1.3	 Adjuvant/Protein	Systems	.......................................................................................................	9	1.1.3.2	 Pre	vs	Post-Exposure	Vaccines	...................................................................................................	10	1.1.4	 New	TB	Drugs	.......................................................................................................................	14	  vi 1.2	 Molecular	Mechanism	of	M.tb	Persistence	........................................................................	16	1.2.1	 TB	Infection	Cycle	.................................................................................................................	16	1.2.2	 Host	Immune	Response	to	TB	through	Phagosome	Maturation	..........................................	17	1.2.2.1	 Phagosome	Maturation	and	Adaptive	Immunity	.......................................................................	18	1.2.2.2	 M.tb	Evasion	of	the	Immune	System:	Blocking	of	Phagosome	Maturation	..............................	20	1.2.2.2.1	 Mycobacteria	Factors	Implicated	in	Phagosome	Maturation	Arrest	....................................	20	1.2.2.3	 Host	COR1A	and	Phagosome	Maturation	..................................................................................	24	1.2.2.4	 LpdC	...........................................................................................................................................	26	1.3	 Project	Goals	.....................................................................................................................	28	Chapter	2:	Material	and	Methods	..........................................................................................	29	2.1	 Commercial	Reagents	........................................................................................................	29	2.2	 Antibodies	.........................................................................................................................	30	2.3	 Mycobacteria	Strains	.........................................................................................................	30	2.3.1	 Bacterial	Preparations	for	Infection	.....................................................................................	31	2.3.2	 Mycobacterial	Lysis	...............................................................................................................	31	2.3.3	 Transformation	of	Mycobacteria	..........................................................................................	32	2.4	 Cell	Culture	and	Infection	of	Macrophages	.........................................................................	32	2.4.1	 Cell	Line	Maintenance	..........................................................................................................	32	2.4.2	 Macrophages	Infection	.........................................................................................................	33	2.5	 Cloning:	Expression	and	Purification	Proteins	....................................................................	33	2.5.1	 Preparation	of	Avi-proteins	..................................................................................................	33	2.6	 Biotinylation	of	BCG	Surface	and	Surface	Decoration	with	Avi-proteins	.............................	35	2.7	 Lyophilization	of	Bacteria	...................................................................................................	35	2.8	 Fluorescence	Microscopy	...................................................................................................	36	  vii 2.9	 Immunogold	Staining	and	Electron	Microscopy	..................................................................	36	2.10	 Animal	Immunization	and	Organ	Processing	......................................................................	37	2.11	 I-	A	Tetramer	Staining	........................................................................................................	37	2.12	 Intracellular	Cytokine	Staining	(ICS)	...................................................................................	38	2.13	 Phagocytosis	Assays	...........................................................................................................	38	2.14	 Mycobacterial	Survival	Assays	...........................................................................................	39	2.14.1	 Bioluminescence	Assay	.........................................................................................................	39	2.14.2	 Colony-Forming	Unit	(CFU)	Assay	.........................................................................................	39	2.15	 Preparation	of	Recombinant	LpdC	Protein	.........................................................................	39	2.16	 Coating	Latex	Beads	with	Proteins	.....................................................................................	40	2.17	 Confocal	Microscopy	and	Flow	Cytometry-based	Phagosome	Analyses	..............................	40	2.18	 Binding	of	LpdC	to	PIPs	and	Other	lipids	in	vitro:	Protein	Lipid	Overlay	Assay	and	Lipid	Coated	Beads	.................................................................................................................................	42	2.19	 Competitive	Inhibition	of	LpdC	and	P47phox	.....................................................................	43	2.20	 Generation	of	ΔLpdCM.tb	..................................................................................................	43	2.21	 Reactive	Oxygen	Species	(ROS)	Detection	Assay	................................................................	44	2.22	 PLC-	COR1A	Co-immunoprecipitation	.................................................................................	44	2.23	 PLC	Phosphorylation	(Activation)	.......................................................................................	45	2.24	 Calcium	Measurements	.....................................................................................................	46	2.25	 Statistical	Analysis	.............................................................................................................	47	Chapter	3:	Improving	BCG	Immunogenicity	via	Surface	Decoration	using	the	Avidin-biotin	System	..................................................................................................................................	48	3.1	 Background	........................................................................................................................	48	  viii 3.2	 Results	...............................................................................................................................	50	3.2.1	 Generation	of	Plasmids	Expressing	Monomeric	Avidin	Fusion	Proteins	..............................	50	3.2.2	 Biotin	Bound	Efficiently	to	BCG	Cell	Surface	.........................................................................	52	3.2.3	 Biotinylation	of	BCG	does	not	affect	its	Growth	...................................................................	54	3.2.4	 Surface	Decoration	of	BCG	is	Efficient,	Stable	and	does	not	Affect	Phagocytosis	and	Intracellular	Trafficking	inside	Macrophages.	....................................................................................	56	3.2.5	 Avidin	Fusion	Antigens	Co-localize	with	MHC	Molecules	.....................................................	60	3.2.6	 Biotinylated	BCG	Surface	Decorated	with	Surrogate	Avi-OVA	was	Fully	Immunogenic	.......	63	3.2.7	 Evaluation	of	the	Immunogenicity	of	Biot-BCG	Decorated	with	ESAT6	...............................	69	3.3	 Discussion	..........................................................................................................................	72	Chapter	4:	Lipoamide	Dehydrogenase	(LpdC)	and	M.tb	Persistence	in	Macrophages	.............	80	4.1	 Background	........................................................................................................................	80	4.2	 Hypothesis	1:	LpdC	Interferes	with	Phagosome	Maturation	through	Retaining	COR1A	on	the	Phagosome	Membrane	via	Binding	to	Cholesterol.	........................................................................	81	4.2.1	 Construction	of	Recombinant	LpdC	protein	and	LpdC’s	Role	in	Phagolysosome	Fusion	Arrest	.............................................................................................................................................	81	4.2.2	 LpdC	does	not	Bind	to	Cholesterol	but	Instead	to	PIPs	........................................................	87	4.2.3	 Hypothesis:	LpdC	Binding	to	PI3,4P2	Interferes	with	NADPH	Oxidase	(NOX2)	Assembly	....	89	4.2.4	 Does	LpdC	Compete	with	p47phox	for	Binding	to	PI3,4P2?	.................................................	90	4.2.5	 Generation	of	LpdC	M.tb	Mutant	.........................................................................................	94	4.2.6	 LpdC	is	Important	for	M.tb’s	Growth	and	its	Survival	in	Macrophages	................................	95	4.2.7	 ΔLpdCM.tb	Fails	to	Block	Phagosome	Maturation	...............................................................	99	4.2.8	 P47phox	Recruitment	to	ΔLpdCM.tb	Phagosome	and	ROS	Production	.............................	102	  ix 4.3	 Hypothesis	2:	LpdC	Retains	COR1A	on	the	Phagosome	Membrane	via	Interference	with	PLC	Mediated	Hydrolysis	of	PI4,5P2.	...................................................................................................	105	4.3.1	 Subcellular	Localization	of	PLC	in	Infected	Macrophage	....................................................	107	4.3.2	 LpdC	Effects	on	PLCγ2-COR1A	Interactions	and	PLCγ2	Activation	.....................................	108	4.3.3	 LpdC	and	Calcium	Signaling	................................................................................................	110	4.4	 Discussion	........................................................................................................................	114	4.4.1	 LpdC,	PIPs	and	ROS	Production	..........................................................................................	114	4.4.2	 LpdC,	Virulence,	Drug	Target	Potential	..............................................................................	117	4.4.3	 LpdC,	COR1A	and	Ca2+	........................................................................................................	120	4.4.4	 Summary	.............................................................................................................................	125	Chapter	5:	Final	Conclusion	and	Future	Directions	...............................................................	126	Bibliography	........................................................................................................................	129	Appendices	.........................................................................................................................	149	Appendix	A	..................................................................................................................................	149	A.1	 DNA	and	protein	sequence	of	OVA	derived	antigen	peptide	.............................................	149	A.2	 Mutant	monomeric	avidin	sequence	..................................................................................	150	A.3	 OVA	levels	in	BCG	genetically	expressing	OVA	vs	BCG	surface	decorated	with	Avi-OVA	...	151	A.4	 Flow	cytometry	gating	strategy	and	death	cell	exclusion	...................................................	152	A.5	 Peptide	sequence	alignment	of	M.tb/BCG	LpdC	and	M.	smegmatis	LpdC	.........................	153	   x List of Tables  Table 1. Current drugs for TB treatment ........................................................................................ 4	Table 2. Overview of selected current TB vaccines in different stages of clinical development . 14	Table 3. List of primers used in this study .................................................................................... 34	   xi List of Figures  Figure 1. Different types of TB vaccines ........................................................................................ 7	Figure 2. Composition of TB Granuloma ..................................................................................... 17	Figure 3. Secreted mycobacterial proteins and factors and their interaction with host effectors of phagosome maturation .................................................................................................................. 21	Figure 4. M.tb LpdC is a central member of a 3 enzyme complex ............................................... 26	Figure 5. Construction of a recombination cloning plasmid for the production of avidin fusion proteins .......................................................................................................................................... 51	Figure 6. Efficiency of BCG biotinylation ................................................................................... 54	Figure 7. Biotinylation of BCG surface did not affect its growth or its survival in the macrophage....................................................................................................................................................... 55	Figure 8. mAvidin-OVA binding to Biot-BCG, its stability and phagocytosis ............................ 57	Figure 9. Avi-OVA detached from BCG surface and crossed the phagosomal membrane toward the cytosol ..................................................................................................................................... 60	Figure 10. Avidin-fusion antigen co-localized with MHC class II and class I molecules ............ 62	Figure 11. In vivo CD4+ T cell response to OVA-decorated BCG ............................................... 66	Figure 12. Frequencies of T cells releasing cytokines in response to Avi-OVA coated BCG-immunization ................................................................................................................................ 68	Figure 13. In vivo CD4+ T cell response to ESAT6-decorated BCG and frequencies of T cells releasing cytokines in response to ESAT6 .................................................................................... 71	Figure 14. Schematic summary of BCG surface decoration approach ......................................... 78	Figure 15. LpdC from M.tb but not from M. smegmatis, inhibited phagolysosome fusion ......... 83	  xii Figure 16. LpdC from M.tb inhibited phagolysosome fusion ....................................................... 84	Figure 17. LpdC from M.tb retained COR1A on phagosome membrane ..................................... 86	Figure 18. Protein lipid overlay assays with recombinant LpdC .................................................. 88	Figure 19. Model of LpdC interference with NOX2 assembly and activation ............................. 90	Figure 20. LpdC blocked p47phox interaction with PI3,4P2 ....................................................... 91	Figure 21. BCG infection did not stop recruitment of p47phox to the phagosome membrane .... 92	Figure 22. LpdC did not stop recruitment of p47phox to the phagosome membrane .................. 93	Figure 23. Generation and characterization of ΔLpdCM.tb .......................................................... 95	Figure 24. Growth curves of ΔLpdCM.tb in standing and rolling culture .................................... 97	Figure 25. ΔLpdCM.tb had decreased intracellular survival ........................................................ 98	Figure 26. Phagosomes containing ΔLpdCM.tb mycobacteria fused with lysosomes ................. 99	Figure 27. Phagosomes containing ΔLpdCM.tb mycobacteria did not retain COR1A on their surface ......................................................................................................................................... 101	Figure 28. ΔLpdCM.tb continued to recruit p47phox to its phagosomal membrane .................. 104	Figure 29. M.tb LpdC induced oxidative burst ........................................................................... 105	Figure 30. Model of abnormal retention of COR1A by LpdC ................................................... 107	Figure 31. Phagosomes containing BCG showed subcellular localization of PLC and COR1A during BCG infection .................................................................................................................. 108	Figure 32. PLCγ2-COR1A interaction was not affected by infection with live or killed BCG . 109	Figure 33. BCG infection did not affect PLCγ2 activation ........................................................ 110	Figure 34. Intracellular Ca2+ response to the presence of LpdC ................................................. 113	Figure 35. Model of M.tb inhibition of macrophage phagosome maturation by inhibiting Ca2+ increase and activation of sphingosine kinase ............................................................................ 121	  xiii Figure 36. Model of M.tb inhibition of macrophage phagosome maturation by Ca2+ and role of COR1A ....................................................................................................................................... 123	Figure 37. Revised model of abnormal retention of COR1A by LpdC ...................................... 124	   xiv List of Abbreviations APC antigen presenting cells ADP Adenosine diphosphate ATP Adenosine triphosphate BCG Mycobacterium bovis bacillus Calmette-Guérin  BCKADH branched chain alpha keto acid dehydrogenase  BMDM bone marrow derived macrophages BSA bovine serum albumin Ca2+ calcium CAM calmodulin CD cluster of differentiation CFU colony forming units COR1A coronin-1A DAG diacylglycerol DC dendritic cells DMEM Dulbecco's modified Eagle’s medium DMSO dimethyl sulfoxide DTT dithiothreitol ECL enhanced chemiluminescence EDTA ethylenediaminetetraacetic acid EEA1 endosomal antigen 1  EM electron microscopy FACS fluorescence-activated cell sorting FBS fetal bovine serum FCS fetal calf serum  FITC fluorescein isothiocyanate FSC forward-scattered light GAP GTPase activating protein GFP green fluorescent protein GST Glutathione S-Transferase HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid His Histidine HIV human immunodeficiency virus  hVPS Human Vacuolar Protein Sorting Protein hVPS33B Human Vacuolar Protein Sorting Protein 33B hVPS34 Human Vacuolar Protein Sorting Protein 34 ICS intracellular cyotokine staining  IFN-g Interferon-Gamma   xv IgG Immunoglubin G IL-17 Interleukin 17 IP3 inositol triphosphate  IPTG Isopropyl-β-D-Thio-Galactoside Kd dissociation constant kDA kiloDalton KO knockout LAM lipoarabinomannan LB Luria-Bertani LpdC lipoamide dehydrogenase LPS lipopolysaccharide M. smegmatis Mycobacterium smegmatis M.tb Mycobacterium tuberculosis  ManLAM Mannosylated LAM mAvidin monomeric avidin  MDR-TB multi-drug resistant TB MES 2-(N-morpholino)ethanesulfonic acid  MHC I Major Histocompatibility Complex Class I MHC II Major Histocompatibility Complex Class II  min minute MOI multiplicity of infection  NaCl Sodium Chloride NADPH nicotinamide adenine dinucleotide phosphate-oxidase  NDK nucleoside diphosphate kinase  NDP Nucleoside-diphosphate NO nitric oxide NOX2 NADPH oxidase complex  NTP Nucleoside-triphosphate OADC Oleic Acid Dextrose Catalase Complex  ORF open reading frame OVA ovalbumin PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction  PDH pyruvate dehydrogenase  PFA paraformaldehyde PH Domain Pleckstrin Homology Domain PI3P phosphatidylinositol 3-phosphate  PIPs phosphoinositides   xvi PknG Protein Kinase G  PLC phospholipase C PLO protein lipid overlay PMSF phenylmethylsulfonyl fluoride PNR/P peroxynitrite reductase/peroxidase  PtpA protein-tyrosine phosphatase A RNS reactive nitrogen species ROS reactive oxygen species rpm revolutions per minute RPMI Roswell Park Memorial Institute SapM secreted acid phosphatase of M. tuberculosis SCID severe combined immunodeficient SDS Sodium Dodecyl Sulphate SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis SSC side-scattered light TB Tuberculosis TBST Tris-Buffered Saline and Tween 20 TH1 response T helper cell response TNF-α Tumor Necrosis Factor-Alpha V-ATPase Vacuolar H+-ATPase VPS vacuole protein sorting  WT Wild-Type  XDR-TB Extremely drug resistant TB     xvii Acknowledgements  I would like to thank my supervisor Dr. Zakaria Hmama for all his guidance and support. Without him the work in this thesis would not be possible. I would also like to thank my committee members Dr. Yossef Av-Gay and Dr. Rachel Fernandaz for their valuable feedback and expertise throughout my PHD studies.   I also would like to thank all the past and present members of Hmama lab. Dr. Jim Sun, Dr. Sunil Joseph, Dr. Vijender Singh, Dr. Alex Yuen for their advice and insight. Thanks to Amina Talal for technical support and Alice Lau for all the help and fun with experiments and everyday life. Thanks to Katherine Wang, Justin Tang and Falene Chai for technical assistance. Thanks to Jeffrey Helm and Marilyn Robertson for administrative support and equipment maintenance. Thanks to all the labs and colleagues in the Immunity and Infection Research Centre (IIRC) and Jack Bell Research Centre who have provided me with countless reagents, use of their equipment and technical support, especially Dr. Horacio Bach, Dr. Yossef Av-Gay, Dr. Neil Reiner, Dr. Vincent Duronio and Dr. Ted Steiner. Special thanks to all the fellow building mates, office mates and lunch room buddies for their friendship and helpful discussion, especially Melissa Richard, Xingji Zheng and Mary Ko.   I would also like to thank my loving parents Michael Liao and Nancy Sheu, my sister Evelyn Liao, my fiancée Charlie Lin and all my friends for their enduring support and encouragement throughout my degree.  I acknowledge financial support from UBC and Faculty of Graduate Studies.    1 Chapter 1: Introduction  1.1 Tuberculosis 1.1.1 History of TB and Current Strategies of TB Control: Preventative (Vaccines) and Post-exposure (Drug Therapies) Measures  Tuberculosis (TB) is a serious infectious disease that has plagued humans since ancient history. TB was originally called “consumption”, since patients became “consumed” and withered away. In the 1800s, Robert Koch was able to isolate the bacillus responsible for consumption, which was named Mycobacterium tuberculosis (M.tb). Since then, the disease has been renamed “tuberculosis”. Early treatment of TB consisted of isolation, bed rest, plenty of sunlight, and fresh air.   To combat this major infectious disease, both preventative measures through administration of vaccines and therapeutic approaches through drug treatments are needed. It is generally accepted that protective vaccination is the best and most cost-effective option to prevent the spread of infectious diseases. The first and only vaccine for TB is Mycobacterium bovis bacillus Calmette-Guérin (BCG). It was generated in the early 1900s and first used on humans in 1921. BCG is a live attenuated vaccine that is given annually to about 100 million newborns worldwide with proven safety and efficacy records in the protection against severe meningitis and other disseminated TB diseases (Rodrigues, Diwan, & Wheeler, 1993). BCG attenuation, relative to M. bovis and M.tb, is due in particular to the loss of a large segment of DNA (size 10.7kbp) called region of difference 1 (RD1), which encodes for an important secretion machinery for virulence factors such as ESAT6/CFP10.  BCG is widely used in the   2 world, and over 3 billion people have been vaccinated in the past 80 years. Unfortunately, its effectiveness wanes over time, and it fails to protect against pulmonary TB in adults, the most prevalent form of the disease (Colditz et al., 1994; Fine, 1989). Currently, there is limited scientific explanation for the low efficacy of BCG, although some field observations suggest that variation of BCG strains used, exposure to various environmental mycobacteria prior to vaccination, and innate population genetic differences might be major reasons for the lack of long-term adaptive immunity. Currently, there is a great global effort towards developing novel TB vaccines using different strategies such as recombinant BCG, attenuated M.tb strains, recombinant viral-vectored systems, and combination of protein/adjuvants (these strategies will be reviewed in section 1.1.3). Among these strategies, upgrading BCG to improve its efficacy while maintaining its level of safety is considered the most reasonable approach to develop relatively rapidly an efficient TB vaccine (Kamath et al., 2005). If successful, it would be transformational for public health with huge benefits across society, especially in developing countries.   TB is a highly contagious disease; therefore, it is important to efficiently treat TB patients in order to stop its spread within the community. The first TB drug treatment started in 1943 with the discovery of streptomycin, and a series of antibiotics and chemotherapy were introduced during the next 2 decades with great success in treating TB: isoniazid in 1951, cycloserine and pyrazinamide in 1952, ethionamide in 1956, rifampin in 1957, and ethambutol in 1962. Thus, it was commonly thought that TB could soon be eradicated (Myers, 1963). However, this was not the case, since resistance soon followed, with outbreaks of multi-drug resistant TB occurring in the 80s coinciding with the epidemic of AIDS. The global rise in TB rates led to a renewed   3 interest in TB research, and prevention and multi-drug treatment strategies were introduced to counteract TB spread (Keshavjee & Farmer, 2012). The WHO recommended a six-month combination of four first-line drugs (isoniazid, rifampin, pyrazinamide, and ethambutol, Table 1) for treatment of first-time infected patients. The success rate of the WHO multi-drug therapy is about 85% for new cases. However, non-adherence (non-compliance) to the WHO treatment guidelines caused emergence of drug resistant M.tb strains and increases in disease complications.  Depending on the drug resistance status of the infected individual, different regimes can be assigned. For example, the WHO recommended treating multi-drug resistant TB (MDR-TB) with second-line anti-TB drugs (Table 1) for ~ 2 years. However, this treatment regimen came with drawbacks such as a much lower treatment success rate and much higher cost (Drug resistance in TB will be reviewed in section 1.1.2).   Despite major efforts to reduce the global TB burden, a recent WHO report (2015) indicated that there were an estimated 6 million new TB cases in 2014 with 1.5 million TB deaths worldwide, including in countries with advanced health systems such as Thailand, Russia, and the United States of America (Lewandowski, 2015).  This situation places TB alongside HIV as the leading cause of death worldwide.  Even more troubling is the emergence of new strains of totally drug-resistant TB, for which there are no treatment options (Udwadia, Amale, Ajbani, & Rodrigues, 2011). On the other hand, the increasing rate of co-infection with HIV (Harries et al., 2016) is also largely contributing to the spread of all forms of TB (Basu & Galvani, 2008; Moro et al., 1998), thus adding more complexity to TB control globally. Given that an untreated TB patient can infect up to 15 contacts in a year (Lewandowski, 2015), in the near future, the speed   4 of spread of TB will largely surpass treatment success rates, and TB may again become an incurable disease.  Group1 (First line drugs) Group2 (Second line drugs) Group 3 (Quinolones) Group 4 (Oral second-line drugs) Isoniazid Kanamycin Levofloxacin Cycloserin Rifampin Amikacin Moxifloxacin Prothionamide Ethambutol Capremycin Ofloxacin p-aminosalicylic acid Pyrazinamide   terizidone Streptomycin   thionamide http://www.tbfacts.org/tb-drugs/   Table 1. Current drugs for TB treatment  1.1.2 TB Drug Resistance The rise of multi-drug resistant (MDR), extensively drug-resistant (XDR) and even totally drug-resistant (TDR) TB represents a serious global threat with an estimated 480,000 drug-resistant TB cases per year (Lewandowski, 2015). MDR-TB is defined as resistance to at least the two first-line drugs isoniazid and rifampicin, and XDR is defined as MDR-TB plus resistance to fluoroquinolone and at least one more second-line drug (Table 1) (Janssen et al., 2012). The increasing cases of MDR and XDR-TB creates a huge health burden since treatment duration needs to be increased and drugs that are more toxic and more expensive have to be used. The cost to treat one drug-susceptible TB patient ranges from USD $100 to $500; however, the   5 cost to treat one MDR-TB patient is typically USD $5,000 to $10,000 in lower income countries and up to $50,000 in higher income countries with an average of $6,000 per patient. For XDR-TB, the average cost is $25,000 per patient, four times greater than MDR-TB. This causes a huge financial drain especially to countries with high TB burden (Lewandowski, 2015; Pooran, Pieterson, Davids, Theron, & Dheda, 2013).   The rise of multi-drug resistant TB can be attributed to several reasons. First, intrinsic properties of M.tb that provide innate antibiotics resistance include the composition of mycobacterial cell wall, which is waxy and impermeable and limits drug penetration to reach its target (Nguyen & Pieters, 2009); the slow growth of M.tb (time generation ~ 24 h), which makes antibiotics targeting growth and replication hard to take effect; and M.tb’s internal defense to neutralize activities of antibiotics, including upregulation of antimicrobial efflux pumps (K. N. Adams et al., 2011), mycothiol (a scavenging agent) production (Rawat et al., 2002), and a fast spontaneous mutation rate (Fogel, 2015). Second, without fully understanding the interaction between host, pathogens, and drugs, host factors such as immunosuppression in patients co-infected with HIV and patients undergoing other drug treatments may predispose people to TB drug resistance. The third and arguably the top reason is improper drug dosage and schedule, false-positive or inaccurate screening tests, lack of patient compliance during the long course of treatment, and inadequate treatment due to complication with HIV or infection with XDR M.tb strains. The WHO reports showed that the implementation of Directly Observed Treatment Short Course (DOTS), which was part of the “stop TB” strategy implemented between 2006 and 2015, had been helpful in some places for increasing drug compliance. However, novel therapeutics to treat drug-resistant TB and HIV-TB co-infected cases are still needed, ideally with shorter   6 treatment time periods and minimal drug-related side effects. On the other hand, the arrival of novel efficient vaccines would reduce significantly disease development in TB infected peoples and thus the use of costly and less tolerable drugs.   1.1.3 Potential New TB Vaccines Advances in TB research for the last decade culminated in the development of 15 promising vaccine candidates going through different phases of clinical trials. Various strategies have been proposed and include protein adjuvant systems, viral vectored technologies, live recombinant BCG delivering selected immunogenic proteins, and attenuated M.tb strains. These vaccine candidates also differ in their target population (newborns or adults) and time of administration (pre-exposure or post-exposure to M.tb). Route of vaccine delivery are also increasingly recognized by the TB vaccine community to be important in improving BCG vaccine; thus, other than the default intradermal delivery of BCG vaccine, aerosol and oral delivery of vaccines are also being considered. The goal is to prevent new TB infections and stop the transmission from infected individuals or to help cure an active disease (Kaufmann et al., 2014) (Fig. 1).     7  Figure 1. Different types of TB vaccines Current TB vaccine candidates can be classified into 3 categories: pre-exposure, post-exposure, or therapeutic vaccines, based on when the vaccine is administered and to whom it is delivered. Pre-exposure vaccines are given to newborns to prevent TB infection. Post-exposure vaccines are given to already infected individuals to prevent active TB disease. Therapeutic vaccines are given to patients with active TB disease. Image reprinted with permission from Elsevier; The Lancet Respiratory Medicine (Kaufmann et al., 2014).  1.1.3.1 Different Vaccine Strategies 1.1.3.1.1 Live M.tb One mode of vaccine strategy is attenuation of live M.tb via inactivation of at least two key virulent genes (according to the WHO guidelines) while maintaining its ability to induce a strong immune response (Franco-Paredes, Rouphael, del Rio, & Santos-Preciado, 2006). One example is MTBVAC, which is a double deletion mutant of M.tb without phoP, which is a   8 transcription factor in M.tb involved in virulence, and fadD26, which  encodes a critical enzyme in the biosynthesis of phthiocerol dimycocerosates (DIM) (Leung, 2005). Live M.tb vaccines allow for continuous antigenic stimulation, which induces excellent immune response. Live attenuated M.tb vaccines still face major safety concerns related to an unknown degree of unpredictability. Indeed, there is a rare but possible chance of the attenuated M.tb reverting back to virulence.   1.1.3.1.2 Subunit Vaccines Another vaccine strategy is the delivery of specific antigens either as recombinant proteins, naked encoding DNA, or live viral vectored vaccines. These are called subunit vaccines that boost BCG immunization by inducing an immune response to immunodominant antigens. The rationale behind prime boost vaccines is that repeated boost immunization with the same specific M.tb antigens would induce strong and more efficient CD4+ and CD8+ T cell responses. In fact, BCG not only lacks the RD1 section but also lacks around 100 genes compared to M.tb (Brosch et al., 2007), which encode for some important immunodominant antigens. M.tb-derived subunit vaccines are delivered by viral carriers such as replication deficient variants of vaccinia virus (modified vaccinia Ankara, MVA) and adenovirus. These viral vectors have been shown to be safe, immunogenic, and able to stimulate both CD4+ and CD8+ T cells (Kaufmann, 2010). However, since up to 20% of people living in Africa produce anti-Ad35 antibodies, the use of adenovirus-based vaccines will face some limitations. Also, the extent of the immune response in terms of memory cell production could be limited. One vaccine in this category is AdHu5Ag85A, which is a recombinant human type 5 adenovirus (AdHu5)–vectored vaccine expressing Ag85A. It has been shown to be safe and immunogenic in healthy adults in phase I clinical trials and can   9 be administered as both replacement or prime-boost vaccine  (Smaill et al., 2013).  Another representative vaccine of this category is MVA carrying Ag85A (MVA85A), a popular mycobacterial antigen that is conserved in all mycobacterial species, which induces strong CD4+ T cells proliferation and IFN-g production (Launois et al., 1994). MVA85A showed great promise and was shown to be able to significantly boost anti-mycobacterial immunity in humans. Unfortunately, phase II clinical trial was completed, and although MVA85A was considered safe and immunogenic, no efficacy against M.tb was detected in infants (Ndiaye et al., 2015) or in adults (Ndiaye et al., 2015). Failure to induce protective immunity is probably related to the mode of MVA85A delivery (intradermal) and thus, future use of this vaccine will focus on delivering MVA85A by an alternate route (aerosol) or usage in combination with other viral vectored vaccines (Ndiaye et al., 2015).   1.1.3.1.3 Adjuvant/Protein Systems Adjuvants/protein systems represent another TB vaccine strategy. Adjuvants are substances that enhance and induce a stronger immune response when used in combination with immunodominant antigens. For example, IC31 adjuvant is composed of antibacterial peptides that have immunostimulatory effects, which activate TLR9, increase antigen uptake by APC, and slow antigen release (Karen Lingnau, Karin Riedlb, 2007). It also induces CD4+ T cells and stimulates cytokine production, which improves memory immune responses. Vaccine candidates that utilize this strategy includes H4/IC31, which is a combination of IC31 with Ag85B/TB10.4 fusion protein (Billeskov, Elvang, Andersen, & Dietrich, 2012); H1/IC31, which includes antigens Ag85B and ESAT6 (van Dissel et al., 2011), and H56/IC31, which comprises Ag85B,   10 ESAT6, and Rv2660c. Adjuvants have been safely used in vaccines for decades and have been shown to improve immune response to vaccines.  1.1.3.2 Pre vs Post-Exposure Vaccines As previously stated, vaccines can also be divided into categories according to the time of administration. As indicated by their names, pre-exposure vaccines are developed for people who have never been exposed to M.tb, so generally for newborns. The purpose of pre-exposure vaccine is to prevent M.tb infection in the first place; therefore, it is not useful for people who have already been exposed to M.tb. These vaccines can be replacement of BCG such as VPM1002 or MTBVAC. VPM1002 is a live recombinant BCG vaccine modified to express listerolysin gene from Listeria monocytogenes. This, along with the deletion of urease C, allows for phagosome acidification and facilitates perforation of phagosomal membrane to allow the escape of antigens to induce cell apoptosis and antigen cross priming (Grode et al., 2005). MTBVAC is a live M.tb vaccine with two genes phoP and fadD26 deleted, as discussed in section 1.1.3.1.1 above. Another category of pre-exposure vaccines includes boost vaccines for the BCG-vaccinated population. The most advanced vaccines for this category are MVA85A, a modified vaccinia Ankara vector expressing mycobacterial Ag85A, and H4:IC31, which is a combination of IC31 adjuvant with mycobacterial antigens Ag85B and TB10.4; both MVA85A and H4:IC31 were described in more detail above, section 1.1.3.1.2 and 1.1.3.1.3.   Post-exposure vaccines are dedicated to individuals with suspected or confirmed latent TB infection (mostly adolescents and adults) to prevent development of active TB disease. These vaccines are designed to boost prior BCG immunization. Most advanced candidate vaccines in   11 this category are MVA85A, AERAS 402 (adenovirus (ad35) expressing mycobacterial antigens Ag85A, Ag85B, and TB10.4), and adjuvanted subunit vaccines such as M72 (M.tb antigens MTB32A and MTB39A fusion in adjuvant AS01) and H56 (subunit vaccine containing Ag85B, ESAT6, and Rv2660c adjuvanted with IC31). These vaccines aim to stimulate CD4+ and/or CD8+ T cells, which produce TH1 type cytokines that activate macrophages/phagocytes and induce anti-mycobacterial activities (Franco-Paredes et al., 2006).  Therapeutic vaccines are a variation of the above and are designed for people who currently have active TB, especially those infected with drug-resistant TB or co-infected with HIV. They are delivered in conjunction with antibiotic therapy. This category includes killed whole M. vaccae organisms and RUT1, which is constituted of detoxified M.tb liposomal fragments (Leung, 2005; Kaufmann et al., 2014).   Selected vaccines discussed above are summarized in Table 2. These new TB vaccines, currently at different stages of development, are promising. However, in the case of subunit vaccines, most of them focus on a few immunodominant antigens such as Ag85A, TB10.4, and ESAT6 to boost immunity. A greater variety of additional immunogenic proteins needs to be characterized and assessed, and new methods of delivery of these proteins are needed to improve our chances of developing a successful TB vaccine.     12 Vaccine name  Class Type of Vaccine Phase of clinical development VPM1002 (rBCG∆ureC:hly) Live BCG with listeriolysin, without Urease Replacement vaccine that improves antigenicity by perforation of phagosome membrane (Grode et al., 2005). IIa MTBVAC (rMTB∆PhoP∆FadD26) Live M.tb with two genes (phoP and fadD26)  deleted  Replacement vaccine. PhoP is a TF that controls ESAT6 secretion and production of cell wall lipids. FadD26 controls synthesis of lipid DIM. (Aguilo et al., 2016) II MVA85A (MVA expressing Rv3804 /Ag85A) Modified vaccinia Ankara vector expressing Ag85A  Prime boost with BCG (Ndiaye et al., 2015) II AdHu5Ag85A Recombinant human type 5 adenovirus vectored vaccine expressing Ag85A Can be both replacement or prime boost with BCG (Smaill et al., 2013) I   13 Vaccine name  Class Type of Vaccine Phase of clinical development AERAS402 Adenovirus (ad35) expressing Ag85A, Ag85B and TB10.4. Prime boost with BCG (Abel et al., 2010) I H4/IC31 Adjuvant vaccine expressing Ag85B and TB10.4, adjuvanted with IC31.  Booster vaccine to BCG containing fusion of AG85B and TB10.4 adjuvated with IC31, which is a TLR9 agonist and an antimicrobial peptide. (Billeskov et al., 2012), IIa RUT1/ mycobacterium vaccae Liposomal fragments of M.tb/whole killed mycobacteria Therapeutic vaccine II and III M72 Adjuvant vaccine expressing mycobacterial MTB32A and MTB39A with adjuvant AS01E Post-exposure vaccine IIb   14 Vaccine name  Class Type of Vaccine Phase of clinical development H1/H56/IC31 Subunit vaccine containing adjuvant IC31 with mycobacterial antigens Ag85B, ESAT6 (H1) and additional Rv2660c for H56. Could be preventive, post-exposure, or therapeutic vaccine (van Dissel et al., 2011) IIa  Table 2. Overview of selected current TB vaccines in different stages of clinical development  1.1.4 New TB Drugs Most drugs currently used to treat TB were discovered between the 1940s and 1970s. However, the emergence and spread of drug-resistant TB and the increasing rates of TB HIV co-infections spurred extensive research towards development of new TB drugs. Such an effort culminated in a pipeline of 15 new potential drugs. (www.newtbdrugs.org)   New TB drugs under development can be roughly divided into three categories: new drugs, drugs that are licensed for other diseases “repurposed” for TB, and current TB drugs that are re-evaluated to optimize their efficacy. These new drugs mostly aim to either decrease time   15 of treatment, which would also curb development of drug-resistance, or improve the outcome of drug-resistant TB (Janssen et al., 2012; Yew & Koh, 2016).   The mechanisms of action of some of the potential drugs being developed include inhibiting cell wall biosynthesis (e.g. SQ109, Delamanid, PA-824) and inhibiting DNA replication/transcription (Moxifloxacin, Gatifloxacin) (Janssen et al., 2012). Further understanding of the pathogenesis of TB is still needed to identify new drug targets since drugs with novel mechanisms of action are important to ensure effectiveness against the various types of MDR-TB (Bald & Koul, 2015).   Ever since the whole genome of TB was sequenced in 1998 (Cole et al., 1998), there has been great advances in understanding the molecular biology of M.tb. Alongside advances in computer modelling and development of techniques such as gene knockdown/knockout, these advances have allowed for faster screening of new drugs and better in vitro and in vivo validation of potential drug targets. A drug target is anything within a living organism (e.g. proteins and nucleic acid) that when bound to a specific chemical (drug) loses its function/effects. There is no clear consensus on the best method for discovering new drugs. M.tb whole cell screening is a popular example, which tests compound libraries for their ability to inhibit bacterial growth (Bald & Koul, 2015). This method uses high throughput screening (HTS), which is a method using automation (usually robotics) to rapidly assess large compound libraries to identify active compounds that modulate a particular biomolecular pathway. The challenge of this technique is that it is non-target specific, and the mechanism of action of the drug is not known (Bald & Koul, 2015). These methods are highly hypothetical and still require further testing to confirm that the   16 interactions are true. It is a good starting point, but I believe that understanding molecular mechanisms of M.tb interactions with the host cell is equally important for discovering biologically-relevant targets for drug discovery. Identifying mycobacterial virulence factors and further understanding M.tb persistence is therefore very important for rational design of drugs based on known mechanism of action.    1.2 Molecular Mechanism of M.tb Persistence To truly combat and be able to control TB, we need to enhance our understanding and knowledge of how M.tb interacts with the host immune system and persists/survives inside the host. Below is a brief overview of the TB infection cycle and host immune response to TB, with an emphasis on macrophage phagosome maturation, which is what I am most interested in.   1.2.1 TB Infection Cycle M.tb enters the human host through inhalation of aerosol droplets. It travels to the lung where it is primarily phagocytosed by alveolar macrophages. M.tb infection of macrophages eventually leads to granuloma formation, a complex structure of different cells types surrounding infected macrophages. Granuloma consists of recruited non-infected macrophages, monocytes, neutrophils, and foamy macrophages, all surrounded by lymphocytes recruited in response to cytokines released by infected/activated macrophages (Fig. 2). At this stage, M.tb is considered to be contained, and infected individuals can stay “active disease free” for decades, as bacteria lie dormant inside the granuloma. In about 10% of infected individuals, the granuloma eventually becomes disrupted, and M.tb re-activates and replicates massively, leading to active   17 TB. This scenario occurs in the aging population but much more in immunocompromised individuals and in individuals living in poor nutrition conditions (D. G. Russell, Cardona, Kim, Allain, & Altare, 2009; Silva Miranda, Breiman, Allain, Deknuydt, & Altare, 2012).    Figure 2. Composition of TB Granuloma TB Granuloma is characterized by M.tb infected macrophages surrounded by activated foamy macrophages, neutrophils, T cells, B cells, and abundant blood vessels. Image reprinted with permission from Nature Publishing Group; Nature Reviews Microbiology (Dartois, 2014).  1.2.2 Host Immune Response to TB through Phagosome Maturation M.tb is a very successful intracellular pathogen that is able to deploy a variety of strategies to resist the host’s anti-microbial mechanisms to persist and replicate within the hostile environment inside macrophages. These strategies include blocking phagosome fusion with lysosomes by arresting key steps in phagosome maturation and thereafter escaping into cytosol (van der Wel et al., 2007). M.tb is capable of modulating phagosomal pH, stopping ROS production, resisting oxidative stress, interfering with autophagy, and finally entering into a phase of dormancy. For my study, I have focused on the ability of M.tb to cause phagolysosome   18 fusion arrest since I believe targeting mycobacterial mechanisms for intracellular persistence are most likely to contribute to the control of TB disease.  1.2.2.1 Phagosome Maturation and Adaptive Immunity Normally, when a foreign entity is captured by the macrophage, it ends up in a cell surface derived vacuole called phagosome, which later undergoes a complex maturation process resulting in its neutralization and destruction. Phagosome maturation is generally divided into three successive stages: early, intermediate, and late phagosomes, and it is associated with a series of fusion, fission, and trafficking events regulated by various protein effectors. During this process, the phagosome acquires various enzymes including hydrolases, recruits and assembles the NADPH oxidase complex, and undergoes acidification. Finally, late phagosome fuses with lysosomes to form a phagolysosome that brings ingested pathogens in contact with a deadly arsenal of lethal effectors.   Early phagosome is mildly acidic with a pH of 6.1-6.5, and its membrane is characterized by the presence of early endosomal antigen 1 (EEA1), Rab5 GTPase, proton pumping vacuolar H+ ATPase (V-ATPase), and phosphatidylinositol 3-phosphate (PI3P). The small GTPase Rab5 interacts with various effectors such as VPS34, which is a PI3K that converts PI into PI3P. PI3P is important in recruiting EEA1, which directly associates with Rab5 and tethers early endosomes to other vesicles and interacts with SNARE proteins required for membrane fusion. PI3P is also required for phagosomal recruitment and assembly of the NADPH oxidase complex (NOX2). NOX2 generates superoxide that can be converted into ROS (reactive oxygen species) such as hydrogen peroxide, and superoxide can also interact with nitric oxide (NO) to produce   19 RNS (reactive nitrogen species) such as peroxynitrite. ROS and RNS are important microbicidal agents against intracellular pathogens (Flannagan, Cosío, & Grinstein, 2009). Rab5 eventually is exchanged/replaced with Rab7 GTPase through a Class C vacuole protein sorting (VPS) HOPS tethering complex, which interacts with Rab5 and coordinates the exchange of Rab5 with Rab7 (Rink, Ghigo, Kalaidzidis, & Zerial, 2005). The presence of Rab7 along with more recruitment of V-ATPase and hydrolases are characteristic markers for the late phagosome. At this stage, the phagosomal pH drops to 5.5-6.0 and ultimately the phagosome fuses with lysosomes to form the phagolysosome. Further accumulation of the V-ATPase decreases the luminal pH to 4.5, which along with the elevated content of hydrolytic enzymes such as lysozyme helps to mediate complete killing of living entities.   Pathogen killing and processing generates antigens that initiate the adaptive immune response. Processed antigens are loaded on MHC class II molecules and exported to the cell surface for presentation to CD4+ T cells (Miceli & Parnes, 1991). Activated CD4+ T cells can then secrete cytokines like IFN-g and TNF-α to activate recruited macrophages and improve significantly their antimicrobial activities (Rohde, Yates, Purdy, & Russell, 2007). Thus, the phagosome maturation process is important for both intracellular killing (innate immunity) and induction of specific T cell responses (adaptive immunity).   CD8+ T cells are also important in the host immune response by inducing the killing of the infected cells. They are activated through pathogens escaping the phagosome compartment to the cytosol where they are degraded by proteasomes and directly loaded onto MHC class I molecules (Miceli & Parnes, 1991). Another pathway for T cell stimulation by infected   20 macrophages is antigen cross-priming (Winau et al., 2006), which results from macrophage apoptosis and shedding of apoptotic vesicles carrying bacterial degradation products that are taken up by nearby antigen presenting cells (APCs) such as dendritic cells (DCs). Although the expansion of CD4+ and CD8+ T cells producing cytokines IFN-g and TNF-α (TH1 response) are considered central for the control of M.tb infection (Weiner & Kaufmann, 2014), a role for IL-17 producing TH17 cells has been discovered in recent years, showing that IL-17 can induce neutrophilic inflammation, tissue damage, and accelerated pathogen clearance. IL-17 potentially contributes to TB control though its exact mechanism is still unclear (Lyadova & Panteleev, 2015).    1.2.2.2 M.tb Evasion of the Immune System: Blocking of Phagosome Maturation The ability to escape macrophage killing via inhibition of phagosome maturation plays important roles in M.tb’s success in evading the host immune response (Hart, Armstrong, Brown, & Draper, 1972).   1.2.2.2.1 Mycobacteria Factors Implicated in Phagosome Maturation Arrest How does M.tb stop phagosome maturation? Investigations into the abnormal distribution of host proteins on phagosomes containing mycobacteria have shown that there is prolonged retention of early endosomal markers such as Rab5 (instead of Rab7) that are normally cleared from the maturing phagosomal surface (Via et al., 1997) and diminished level of endosomal and lysosomal V-ATPase which contributes to the phagosome’s failure to acidify (Sturgill-Koszycki et al., 1994). Phagosomal PI3P and EEA1 are also reduced, which contributes to phagosome maturation arrest (Fratti, Chua, Vergne, & Deretic, 2003). Several mycobacterial proteins such as   21 SapM, PtpA, PknG, and NDK and other factors such as manLAM have been shown to act on the phagosome maturation pathway and prevent intracellular destruction of M.tb. (Fig. 3).     Figure 3. Secreted mycobacterial proteins and factors and their interaction with host effectors of phagosome maturation    22 This schematic illustrates a model of mycobacterial factors (labelled in green) and their interactions with macrophage effectors (labelled in purple) at different levels of phagosome maturation that lead to M.tb’s inhibition of phagosome maturation.   M.tb lipoglycan ManLAM is the mannose-capped version of lipoarabinomannan (LAM), an abundant glycolipid at the surface of M.tb. It acts by a direct insertion on the phagosome membrane and also exits the phagosome towards cytosol to prevent intracellular calcium increase in infected macrophages. Thus, ManLAM interferes with the calcium/calmodulin PI3K hVPS34 pathway that generates PI3P on the phagosome membrane. Phagosomal PI3P is important for recruitment of EEA1, which drives phagosome fusion with early and late endosomes. (Hestvik, Hmama, & Av-Gay, 2005; Welin, 2011).    SapM is a mycobacterial acid phosphatase that hydrolyzes membrane PI3P, which is essential in EEA1 recruitment to the phagosomal membrane (Briken, Porcelli, Besra, & Kremer, 2004; Puri, Reddy, & Tyagi, 2013). The concerted action of SapM and ManLAM is required for a maximal inhibition of PI3P accumulation at phagosome membrane and the subsequent inhibition of phagosome maturation. In fact, M.tb SapM mutant exhibits attenuated intracellular growth and enhanced phagosome maturation in macrophages (Puri et al., 2013).   PtpA is a secreted mycobacteria protein-tyrosine phosphatase that blocks phagosome acidification by binding to the subunit H of vacuolar H+ATPase (H+V-ATPase), which then excludes the ATPase from the phagosomal membrane (Wong, Bach, Sun, Hmama, & Av-Gay, 2011). It also blocks phagosome maturation by dephosphorylating and deactivating vacuolar   23 sorting protein VPS33B, which leads to inhibition of phagolysosome fusion (Bach, Papavinasasundaram, Wong, Hmama, & Av-Gay, 2008). PtpA also promotes mycobacterial survival by dephosphorylating host serine/threonine protein kinase GSK3alpha and arresting macrophage apoptosis (Poirier, Bach, & Av-Gay, 2014). M.tb PtpA knock out has reduced survival in THP.1 cells, increased fusion with lysosomes (Bach et al., 2008), and increased apoptosis of infected macrophages (Poirier et al., 2014).   Mycobacterial nucleoside diphosphate kinase (NDK) is a mycobacterial protein that catalyzes the reversible reactions of ATP + Nucleoside diphosphate (NDP) Û ADP + Nucleoside triphosphate (NTP) that generate NTP, which are important for bacterial growth, cell signaling,and virulence of M.tb (Chakrabarty, 1998). NDK has several moonlight activities as well as it can undergo autophosphorylation. NDK exhibits GAP activity toward Rho GTPases (Chakrabarty, 1998).  Our lab has shown that Ndk disrupts the normal function of host small GTPases Rab5 and Rab7, which are normally important in controlling phagolysosome fusion (Sun et al., 2010). NDK also disrupts GTPase rac1 and its downstream signaling, which impairs NADPH oxidase assembly and as a result, ROS production (Sun et al., 2013). NDK M.tb knock down has reduced survival in vitro and in vivo, increased phagolysosome fusion, and increased oxidative burst (Sun et al., 2010, 2013).   Mycobacterial Protein Kinase G (PknG) is a eukaryotic-like serine/threonine protein kinase that has been shown to be important in blocking BCG trafficking to lysosomes and survival in macrophages (Nguyen et al., 2005). PknG functions by phosphorylating a mycobacterial protein GarA, which is important in glutamate dehydrogenase in the TCA cycle   24 (Chao et al., 2010). Mutant M.tb PknG accumulates glutamate, inhibits phagolysosome fusion (Chao et al., 2010) and causes prolonged survival of infected SCID mice compared to infection with WT M.tb (Cowley et al., 2004).  1.2.2.3 Host COR1A and Phagosome Maturation Another important event associated with phagosome maturation arrest is the prolonged retention (~12 hours) of a host molecule coronin1A (COR1A) on the phagosomal membrane (Ferrari, Langen, Naito, & Pieters, 1999). This observation led to a series of studies on COR1A and phagosome maturation arrest.   COR1A is an actin binding protein that is expressed exclusively in leukocytes (Punwani et al., 2015). It was initially co-purified with phospholipase C (PLC) with unknown functions (Suzuki et al., 1995) and was shown to have 35% homology to the Dictyostelium coronin (de Hostos, Bradtke, Lottspeich, Guggenheim, & Gerisch, 1991). COR1A was initially thought to be only involved in actin-cytoskeletal rearrangement to facilitate macrophages functions such as phagocytosis, motility and micropinocytosis (de Hostos et al., 1991; Maniak, Rauchenberger, Albrecht, Murphy, & Gerisch, 1995). It was later found to have immunomodulation functions after being identified in a screen for mammalian host factors retained on mycobacterial phagosomes (Ferrari et al., 1999). There are conflicting studies on COR1A’s involvement in mycobacterial phagocytosis with some studies appearing to claim that COR1A is only important in actin-dependent processes such as phagocytosis (Yan, Ciano-oliveira, Grinstein, & Trimble, 2013; Yan, Collins, Grinstein, & Trimble, 2005; Schuller et al., 2001). Closer look at the experimental details showed that COR1A is not only involved in BCG uptake in macrophages,   25 but also in certain conditions, phagolysosome fusion arrest (Schuller et al., 2001). Also, there are studies showing that COR1A knock out macrophages and mice have no defect in macrophage phagocytosis (Jayachandran et al., 2007; Rangell et al., 2006), and that COR1A is directly involved in M.tb killing inside phagosomes (Combaluzier & Pieters, 2009). From these studies, I decided to focus on COR1A’s important role in M.tb pathogenesis, specifically in phagosome maturation.   Normally, COR1A is localized in the cytosol, and upon phagocytosis, it transiently translocates to the phagosome membrane and then dissociates soon after. With macrophages infected with live mycobacteria, there is an abnormal retention of COR1A on the phagosome membrane, and these phagosomes do not fuse with lysosomes, allowing intracellular survival of ingested bacteria. The precise mechanism of COR1A-dependent phagosome maturation arrest is still unknown. In this regard, our lab postulates that live mycobacteria likely secrete factors that interact physically with COR1A and retain it on the phagosomal membrane. From immunoprecipitation experiments, we were able to pull down a 50 kDa mycobacterial protein in complex with COR1A. This protein was identified by mass spectrometry to be encoded by the ORF Rv0462, mycobacterial lipoamide dehydrogenase (LpdC) (Deghmane et al., 2007). We found that interaction between COR1A and LpdC contributed to the blocking of phagosome maturation. Indeed, when overexpressing M.tb LpdC in the avirulant M. smegmetis (M. smeg), the latter was able to retain COR1A on its phagosomes, reproducing the phenotypes of phagosome maturation arrest with pathogenic mycobacteria. The mechanism of how LpdC and COR1A interaction contributes to the block of phagosome maturation arrest is still unknown and is a question this thesis attempts to answer.    26  1.2.2.4 LpdC Mycobacterial lipoamide dehydrogenase LpdC is the single functional Lpd in M.tb that catalyzes the NAD+-dependent oxidation of dihydrolipoyl cofactors (Argyrou & Blanchard, 2001): NADH + H+ + oxidized lipoamide Û NAD+ + dihydrolipoamide (reduced lipoamide)   LpdC is a key enzyme in mycobacterial metabolism and antioxidant defenses employed by at least three mycobacterial systems (Fig. 4): the pyruvate dehydrogenase (PDH), branched chain alpha keto acid dehydrogenase (BCKADH) (Tian et al., 2005) and peroxynitrite reductase/peroxidase (PNR/P) systems (Venugopal et al., 2011).    Figure 4. M.tb LpdC is a central member of a 3 enzyme complex    27 LpdC is part of a complex with PDH, BCKADH, and PNR/P to protect M.tb against reactive nitrogen and reactive oxygen species by participating in the peroxynitrite reductase/peroxidase (PNR/P) system. It is also directly involved in the pyruvate dehydrogenase (PDH) and branched chain alpha keto acid dehydrogenase (BCKADHC) systems. Thus, LpdC also plays an important role in M.tb metabolism. Image reprinted with permission from Elsevier; Cell Host & Microbe (Venugopal et al., 2011).  LpdC serves as enzyme 3 (E3) in the PDH complex, which is needed in M.tb persistence in a nutritionally diverse or limited environment, switching to the glyoxylate pathway in glucose limited environment where fatty acid acetyl-CoA is used to synthesize glucose (R Bryk, Lima, Erdjument-Bromage, Tempst, & Nathan, 2002). LpdC is also part of the branched chain alpha keto acid dehydrogenase (BCKADH) complex, which M.tb uses to metabolize branch chain of keto and amino acids into branch-chained fatty acids that could provide energy in starvation conditions. It also prevents excessive and toxic accumulation of pyruvate, branch chain amino acid, and branched chain keto acids. Furthermore, LpdC is directly involved in M.tb protection against reactive nitrogen and reactive oxygen intermediates by participating in the PNR/P system (Venugopal et al., 2011). The multiple functions of LpdC – i.e., its primary function in controlling important mycobacterial metabolic reactions needed for intracellular survival and its moonlighting function in arresting phagosome maturation via abnormal COR1A retention – make it an attractive drug target since targeting this protein can affect multiple pathways important for M.tb survival and virulence. Thus, further characterization of LpdC interaction with the macrophage’s effectors of innate immunity is needed, and this is the second objective of my thesis.      28 1.3 Project Goals  The overall objective of this thesis is to study two important aspects of TB control: vaccine and therapy. I believe that development of novel TB vaccines and drugs requires a detailed understanding of subcellular and molecular interactions between M.tb and host cells.  My first aim is to improve the current BCG vaccine through non-genetic modification of BCG bacterial surface with the hypothesis that surface modification of BCG with recombinant proteins is a faster and more versatile approach in upgrading BCG than genetic modification. I utilized surrogate antigen ovalbumin (OVA) to verify the validity of this system, and the M.tb specific antigen ESAT6 to show that this method can be used as an effective novel method for improving immunogenicity of the BCG vaccine.   The second aim is to study the role of the mycobacterial protein LpdC in M.tb survival and virulence in macrophages, which will provide a rational basis for the development of new drug strategies. Previous studies from our lab have shown that pathogenic mycobacteria secrete LpdC, which translocates to the phagosome membrane where it physically interacts with host protein COR1A by unknown mechanisms. The aim of my study is to further characterize LpdC especially with regards to the mechanism of LpdC-COR1A interaction and provide insight into the significance of LpdC’s role in TB pathogenesis. This thesis will attempt to add knowledge to the TB field in demonstrating that LpdC is a bona fide virulence factor and an attractive drug target.      29 Chapter 2: Material and Methods  2.1  Commercial Reagents Endotoxin-free RPMI 1640, DMEM, and miscellaneous culture reagents were purchased from StemCell Technologies (Vancouver, BC, Canada). Fetal calf serum (FCS) was purchased from Gibco Laboratories (Burlington, ON, Canada). Protease inhibitor mixture and PMSF were purchased from Sigma-Aldrich (St. Louis, MO). Sulfo-NHS SS biotin, FITC-conjugated streptavidin, PKH26 Fluorescent Cell Linker Kits and NDSB256 were purchased from Sigma-Aldrich. Phycoerythrin (PE)-conjugated I-Ab-OVA323-339 tetramer and PE-conjugated I-Ab-ESAT61-20 tetramer were purchased from MBL International (Woburn, MA). Phycoerythrin (PE)- conjugated I-Ab-Ag85B280-294 tetramer was acquired from NIH. 7-AAD was purchased from BD Pharmingen (San Jose, CA). Pierce crosslink magnetic IP/Co-IP kit, disuccinimidyl suberate (DSS), Pierce protein A/G magnetic beads, and Fluo4-AM were purchased from Thermo Fisher (Waltham, MA USA). Trypsin-EDTA, luminol, zymosan, lysozyme, glass beads, and glutathione-agarose beads were purchased from Sigma-Aldrich. DNAse was purchased from Fermentas. Protein A- agarose beads was purchaed from Bio-Rad laboratories (Hercules, CA). TALON polyhistidine-Tag purification resin was purchased from Clontech (Mountain View, CA). Aldehyde/sulfate latex beads (diameter, 4 µm) were obtained from Interfacial Dynamics (Portland, OR). CellMask Deep Red was obtained from Invitrogen (Burlington, Ontario, Canada).     30 2.2 Antibodies Alexa Fluor (AF) 647 conjugated rat anti-mouse CD4, AF647 rat anti-mouse CD8, AF647 rat anti-mouse IFN-g, AF647 rat anti-mouse I-A/I-E, PeCy7 rat anti-mouse CD4, PE rat anti-mouse CD8 Ab, and AF 647 rat anti-mouse H-2kb were purchased from BD Bioscience (Mississauga, ON, Canada). Rabbit polyclonal anti-avidin Ab was described previously (Laitinen et al., 2003). Ultra-small gold-conjugated goat anti-rabbit IgG was purchased from Electron Microscopy Sciences (Hatfield, PA). Rabbit anti-PLCγ2 and anti-p47phox antibodies were purchased from Santa Cruz Biotechnology (Texas, USA). Rabbit Phospho-PLCγ2 Tyr759 antibody was purchased from Cell Signaling (Danvers, MA, USA). M.tb CFP10 antibody and cy5-goat anti-rabbit IgG was purchased from Thermo Fisher (Waltham, MA USA). Polyclonal anti-LpdC antibodies were made in the lab with New Zealand white rabbits immunized with KLH conjugated synthetic peptide (LPNEDADVSKEIEKQ) corresponding to LpdC amino acids 207-220. Rabbit/mouse COR1A antibody was a gift from Dr. Toyoshima (National Institute of Health Science, Japan). Mouse anti-His tag antibody was purchased from Genescript (NJ, USA), and rabbit-anti-GST was from Sigma-Aldrich. HRPO-goat anti-mouse and HRPO-goat anti-rabbit antibodies were purchased from Bio-Rad (California, USA).   2.3 Mycobacteria Strains Wild-type BCG Pasteur was obtained from Dr. Richard Stokes (Department of Microbiology and Immunology, University of British Columbia). BCG-p19, a recombinant BCG strain overexpressing mycobacterial surface antigen 19-KDa lipoprotein (LpqH, Rv3763), was generated using our integrative pJAK1.A plasmid (selection marker, kanamycin) (Sun et al., 2009) encoding the full-length LpqH gene as described (Sun et al., 2009). BCG expressing   31 ovalbumin (OVA) surrogate antigen (BCG-p19-OVA) was engineered by transformation with pJAK1.A encoding fusion of LpqH with OVA polypeptide (amino acids 757-1035), which covers both H-2Kb-restricted (SIINFEKL) and I-Ab-restricted (KISQAVHAAHAEINEAG) epitopes (Dudani et al., 2002; M. S. Russell et al., 2007; Winau et al., 2006). The resulting plasmid was named pJAK1.A-19-OVA. dsRed-BCG (red fluorescent), Luc-BCG (expressing luciferase) and GFP-BCG (green fluorescent) were previously described (Sun et al., 2009). Wild-type BCG and its derivative strains were grown in Middlebrook 7H9 broth (BD Diagnostic Systems, Mississauga, ON, Canada) supplemented with 10% (v/v) OADC (oleic acid, albumin and dextrose solution; BD Diagnostic Systems) and 0.05% (v/v) Tween 80 (Sigma-Aldrich) at 37°C on a shaker platform at 50 rpm. Bacterial aliquots from exponentially growing culture and depleted from aggregates (3-5 x 108 CFU/ml) were stored at minus 80°C.   2.3.1 Bacterial Preparations for Infection For macrophage infection, bacteria in mid-log phase (OD= 0.5 ~ 1) were washed with Middlebrook 7H9 broth supplemented with 0.05% (v/v) Tween 80 (Sigma-Aldrich) and depleted from bacterial clumps by 8 passages through 25 gauge needles.  2.3.2  Mycobacterial Lysis Mycobacterial lysates were prepared by re-suspending bacteria pallet in 250µl mycobacterial lysis buffer (50mM Tris, 5mM EDTA, 0.6% SDS, 0.05% NaN3, 1mM PMSF, 1mM bacterial protease inhibitors). Bacteria were then mixed with 200mg of glass beads and shaken in a bead beater for 15 second intervals for 10 times. Lysates were then separated from insoluble fractions and cell debris by centrifugation at 12,000 x g, 30 min at 4°C.   32  2.3.3 Transformation of Mycobacteria Competent cells were prepared using mycobacteria grown to OD between 0.6 ~ 0.8, washed three times with sterile 10% glycerol and 0.05%Tween 80 and re-suspended in 1/10th of the original culture volume. 200µl of competent cells were then mixed with 1µg of DNA and transferred to an 0.2cm diameter electroporation cuvette (Bio-Rad, Hercules, CA) and electroporated with 2.5V, 25uF capacitance and 1,000 ohms resistance and allowed to recover in complete media overnight at 37°C. Cells were then plated on 7H10-OADC media with appropriate antibiotics and incubated at 37°C for 3 to 4 weeks.  2.4 Cell Culture and Infection of Macrophages 2.4.1 Cell Line Maintenance RAW 264.7 murine macrophage cell lines (American Type Culture Collection, Manassas, VA, USA) were maintained in 10 cm diameter culture dishes (Corning Inc., Corning, NY) in DMEM medium containing 5% FCS, 1% each of L-glutamine, HEPES, non-essential amino acids and penicillin and streptomycin. The human monocytic leukemia cell line THP-1 (American Type Culture Collection) was cultured in 125 cm2 tissue culture flasks (Corning Inc., Corning, NY) in RMPI 1640 medium supplemented with 10% FBS, 1% L-glutamine, penicillin and streptomycin.  BMA3.1A7, a mouse macrophage cell line derived from bone marrow was cultured in RPMI 1640 medium with 10% FBS.     33 2.4.2 Macrophages Infection RAW 264.7 cells were infected with mycobacteria in maintenance media without antibiotics at 37°C and 5% CO2. For THP-1 infection, bacteria were first opsonized with human AB+ serum in RPMI 1640, 30 min at 37°C, and then washed and re-suspended in RPMI media. Infected cells were then washed with media alone (or HBSS) to remove non-internalized bacteria and re-incubated at 37°C and 5% CO2 in maintenance media for defined periods of time.  2.5 Cloning: Expression and Purification Proteins Destination vector for protein expression in fusion with monomeric avidin (mAvidin), by means of recombination cloning, was prepared as follows: DNA sequence encoding triple mutant avidin (N17I, N54A and W110K) protein (Appendix A.1) was synthesized with 3’ and 5’ restriction sites NdeI and NotI respectively and subcloned into pDEST17 plasmid (Invitrogen) to obtain a novel Gateway cloning plasmid, p17-Avi, compatible with the one-step and restriction enzyme-free recombination Gateway cloning methodology.   2.5.1 Preparation of Avi-proteins Initially we produced mAvidin in fusion with OVA surrogate antigen (I-Ab- and H-2Kb-restricted epitopes).  DNA sequence corresponding to OVA polypeptide757-1035 (Appendix A.2) was PCR-amplified with 3’ and 5’ primers flanked with attB1 and attB2 sequences respectively (Table 3), using pUC57-OVA plasmid (GenScript) as template. The resulting PCR product was used for directional cloning into pDONR-221 using BP clonase (Invitrogen) to obtain pDONR-OVA. Thereafter, OVA DNA ORF was transferred into p17-Avi through site-specific in vitro recombination using the LR clonase (Invitrogen). The resulting plasmid, p17-Avi-OVA, was   34 transformed into E. coli BL21, and protein expression was induced with IPTG (0.1 M) for 3 h at 37°C. Bacteria were lysed, and 6xHis-Avi-OVA protein was purified from the inclusion bodies fraction using Ni-NTA columns (Qiagen, Toronto, Ontario, Canada). Eluted protein was refolded by gradual dilution (1:10) and rapid vortexing in Tris buffer (pH 7.5) containing 1mM DTT, 200mM NDSB256, 0.5mM T80, 500mM arginine and 200mM NaCl for 30 min at room temperature. Refolded protein was subjected to desalting and buffer exchange into PBS using Pierce protein concentrators (Thermo Fisher Scientific). Aggregates were removed by 30 min centrifugation (3,500 x g) at 4°C, and aliquots of soluble protein were stored at -20°C. The same strategy was used to express and refold mAvidin fusion with M.tb antigen ESAT6.  Primer DNA target Sequence Attb1-OVA Puc57-BCGOVA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTTGAGCAGCTTGAGAGTAT Attb2-OVA Puc57-BCGOVA GGGGACCACTTTGTACAAGAAAGCTGGGTGTTACCCTACCACCTCTCTGC Attb1-ESAT6 TB genomic DNA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGACAGAGCAGCAGTGGAA Attb2-ESAT6 TB genomic DNA GGGGACCACTTTGTACAAGAAAGCTGGGTGTCATGCGAACATCCCAGTGA Attb1 and Attb2 sequences are underlined Table 3. List of primers used in this study    35 2.6 Biotinylation of BCG Surface and Surface Decoration with Avi-proteins BCG was washed three times with cold PBS plus 0.1% Tween80 (PBS-T), and then re-suspended in PBS alone and labeled with various concentration of Sulfo-NHS SS biotin 30 min at room temperature. Labeled bacteria were washed twice with cold PBS-T to remove free biotin and re-suspended in PBS-T. To evaluate biotinylation efficiency, bacteria were labeled with streptavidin-FITC (1:100 dilution) for 20 min at room temperature, washed twice with PBS-T and subjected to FACS analysis.  Biotinylated bacteria were incubated with mAvidin fusion proteins (10µg/ml final in PBS-T) for 1 h at room temperature. Bacteria were then washed twice with PBS-T and stained with rabbit anti-avidin antibody (1:100 dilution) for 20 min at room temperature then FITC conjugated goat anti-rabbit IgG in the same conditions. Bacteria were washed twice with PBS-T and analyzed by FACS to evaluate the extent of surface decoration.  2.7 Lyophilization of Bacteria Bacteria were biotinylated and coated with Avi-OVA protein as described above. Bacterial aliquots (108) were washed and re-suspended in 0.5ml lyophilization media (25% Sauton medium, 75% H2O and 1.5% Na-glutamate), filled in Wheaton boroscilicate glass vials and transferred into a -80°C freezer over-night. Filled and frozen glass vials were lyophilized for 24 hours using a Novalyphe NL 500 freeze dryer (Savant Instruments, Holbrook, NY, USA). Dried samples were then stored at 4°C and reconstituted in PBS when needed.    36 2.8 Fluorescence Microscopy Coverslips were mounted on microscope slides and examined by digital confocal microscopy as described (Sun et al., 2013). In brief, treated or infected cells were first fixed in 2.5% PFA in PBS for 20 min at room temperate followed by 3 washes with PBS. Cells were then permeabilized in blocking/permeabilization buffer (0.1% triton X100, 3% BSA in PBS) for 20 min at room temperature. Specific antibody of interest was then used at 10µg/ml in permeabilization buffer for 20 min at room temperature followed by secondary antibody for 20 min. Cells were then washed 3 times with PBS, once with water, and mounted on slides in 10µl Flurosave (Calbiochem-Novabiochem, La Jolla, CA) to minimize fluorescence photobleaching. Slides were then examined by digital confocal microscopy using an Axioplan II epifluorescence microscope (Carl Zeiss Inc., Thornwood, NY) equipped with 63x/1.4 Plan-Apochromat objective (Carl Zeiss). Images were recorded using a CCD digital camera (Retiga EX, QImaging, Burnaby, BC, Canada) coupled to the AxioVision miscroscope software (Carl Zeiss).    2.9 Immunogold Staining and Electron Microscopy Immunogold staining was conducted at the EM Facility of the University of British Columbia (Vancouver, BC, Canada). In brief, BCG-infected macrophages were fixed with 4% PFA, embedded in 4% low melting point agarose, and dehydrated in ethanol.  Samples were then transferred to LR White resin. After polymerization at 50°C, 60 nm sections were cut with a Leica EM UC6 microtome (Leica Microsystems, Switzerland) and collected on nickel grids. Samples were labeled with avidin antibody then gold-conjugated F(ab')2 of ultra-small goat-anti-rabbit IgG. Sections were then washed in distilled water, stained in 2% glutaraldehyde, washed   37 again, air dried, and examined with Tecnai G2 200kV electron microscope (FEI Company, Hillsboro, OR).  2.10 Animal Immunization and Organ Processing Female C57BL/6 mice (I-Ab, H-2Kb, 5-6 week old) were obtained from Charles River Laboratories (Sherbrooke, QC, Canada) and were housed under specific pathogen-free conditions in the animal biosafety level II facilities of the Jack Bell Research Centre (Vancouver, BC, Canada). Mice were immunized subcutaneously in the scruff of the neck with wild-type BCG or its derivatives (1 x 106 bacteria in 100 µl endotoxin-free PBS). Control mice received 100µl PBS alone. Mice were euthanized 20 days post-immunization by CO2 inhalation followed by cervical dislocation, and spleens were excised and transferred into RPMI. Spleens were mashed through 70µm Falcon cell strainer (Thermo Fisher) with a 5ml syringe plunger and washed with 5 ml RPMI.  Single cell suspensions were then centrifuged (800 x g, 3 min) and red blood cells was depleted by EasyStep mouse biotin positive selection kit (StemCell, Vancouver BC Canada) with biotin-Ter119/Erythroid cells antibody.  Cells were centrifuged, re-suspended in 10 ml complete RPMI (10% FCS, 1% L-glutamine, 1% penicillin, 1% streptomycin and 50µM 2-ME) and counted.  2.11 I- A Tetramer Staining To determine the frequency of antigen-specific CD4+ T cells, splenocytes from control and immunized mice (~20 x 106 cells) were stained in binding buffer (PBS with 2% FCS and 0.1% NaN3) with PE-conjugated I-Ab-OVA323-339 tetramers (1/12.5 dilution) or PE-conjugated I-Ab-ESAT61-20 tetramer (1/25 dilution) for 1 h at 37°C followed by the addition of AF647 CD4   38 antibody (1:25) and 7-AAD (to detect dead cells) for 20 min at room temperature. Samples were then analyzed by flow cytometry using a BD FACSCalibur flow cytometer (BD Biosciences). Gating method for quantification of tetramer positive lymphocytes is described in Appendix A.4. Total splenocytes were defined by the SSC/FSC dot blot (region R1), live cells (R2) by exclusion of the 7-AAD positive events and CD4 or CD8 subsets (R3) by gating AF647 positive events respectively. A total of 500,000 events were acquired in R3 region to determine the frequencies of tetramer positive events, shown in the R4 region.   2.12 Intracellular Cytokine Staining (ICS) Approximately 1 × 107 splenocytes were cultured in 4 ml of complete RPMI medium in six-well plates with or without recombinant OVA or ESAT6 (10µg/ml) for 16 h. Cells were then treated with Brefeldin A (BD Pharmingen) for an additional 5 h, washed with PBS and subjected to ICS as follows: cell samples were first stained with PE-CD8 or PE-Cy7-CD4 antibody, fixed, and permeabilized using Cytofix/Cytoperm kit (BD Pharmingen) according to the manufacturer’s instructions. Cells were then washed and labeled with AF647-conjugated IFN-g antibody for 20 min at room temperature. Cells were washed and subjected to FACS analysis as described above.  2.13 Phagocytosis Assays RAW 264.7 cells were exposed to beads coated with LpdC or BSA protein at MOI 5:1 or dsRed-BCG decorated with Avi-OVA or untreated dsRed-BCG (control) at MOI 20:1. After an incubation period of 24 hours at 37°C, cells were extensively washed and partially attached, and non-ingested particles were removed by trypsin treatment as described (Sendide et al., 2005).   39 Samples were then fixed and analyzed by FACS, and then fluorescence histograms, which reflected the extent of phagocytosis, were constructed.  2.14 Mycobacterial Survival Assays 2.14.1 Bioluminescence Assay To evaluate bacterial intracellular survival, RAW 264.7 cells were infected with Biot-BCG-Luc or untreated BCG-Luc (control) and incubated at 37°C over a 48 hour period. Cell monolayers were washed and then lysed with 0.025 % SDS to release ingested bacteria. Bioluminescence production, indicative of bacterial viability, was measured using Bright-GloTM Luciferase assay system (Promega, Madison, WI) and a Turner Biosystem luminometer (Model TD-20/20, Promega) as described (Snewin et al., 1999).  2.14.2 Colony-Forming Unit (CFU) Assay RAW 264.7 cells were infected with M.tb strains at MOI of 10:1 and washed 2 hour post infection to remove extracellular bacteria. Thereafter, cells were washed and lysed in 0.025% SDS at 24, 48 and 72 hour time points. Serial dilutions of recovered M.tb were then plated on 7H10-10% OADC plates with appropriate antibiotics and CFU counts were performed after a 4-week period of incubation at 37°C.   2.15 Preparation of Recombinant LpdC Protein Full length ORF encoding LpdC was amplified with attB adapters and transferred into pDONR221 by BP reaction and into pD17 by LR reaction. Competent E.coli BL21 was transformed with pD17-M.tb or M. smeg LpdC, and selected positive clones were transferred to   40 LB media with ampicillin. His-tag fusion recombinant LpdC was expressed by growing to an OD of 0.8 at 37°C, and expression was induced with 0.2mM IPTG at room temperature overnight. After centrifugation, bacteria were re-suspended in PBS containing 0.1mM PMSF, 1mg/ml lysozyme for 30min and lysed by sonication. Bacterial lysate was centrifuged at 15,000 rpm for 45 min, and supernatant was loaded on TALON polyhistidine-Tag purification resin and eluted in 250mM imidazole. Eluted protein was then dialyzed and buffer exchanged with PBS. Aliquots were prepared and stored at -80°C.  2.16 Coating Latex Beads with Proteins Four µm latex beads were coated with proteins according to manufacturer’s protocol (Interfacial Dynamics Corporation). In brief, 108 beads were washed twice with 25mM MES buffer (pH 5.8) and re-suspended in 500µl MES buffer with 200µg/ml protein and incubated at room temperature overnight on a shaker. Beads were then washed 3 times with PBS and re-suspended in PBS and kept in 4°C until use. Protein coating was verified prior to experiment by running a small sample on gel and probing with specific antibody on western blots. Alternatively, protein coating was verified by FACS analysis of immunostained beads. Latex beads were labelled with PKH26 (Sigma) by incubation for 10min at 37°C in 1:500 PKH.   2.17 Confocal Microscopy and Flow Cytometry-based Phagosome Analyses For confocal microscopy, 3 x 105 macrophage cells were seeded on coverslips in 24 well plate and for FACS analyses 2 x 106 cells were seeded in 6 well plate. Cells were then allowed to adhere overnight at 37°C. To label lysosomes, macrophages were incubated with fluorescent-  41 labelled dextran (500µg/ml) at 37°C overnight then washed and chased in dextran free media for 2 hours before infection. To label phagosomal membranes, macrophage cell surface was labelled with 0.2µg/ml CM-red at 37°C for 5 min, washed and then infected immediately with live or dead BCG-DsRed or BCG-GFP at MOI 10:1; or protein coated 4µm latex beads at MOI 5:1 for 1~ 4 hours at 37°C. Dead bacteria were prepared by overnight culture at 37°C in the presence of 100µg/ml amikacin.  For confocal microscopy, cells were washed and then fixed in 2.5% PFA for 30 min at room temperature. Fixed samples were then permeabilized, stained with antibodies of interest, and visualized by microscopy as described in section 2.8.   For FACS phagosome assays, infected cells were washed, trypsinized to remove surface attached, non-ingested particles, and re-suspended in 1ml phagosome extraction buffer (20mM HEPES buffer, pH 7.4 containing 0.25% sucrose, 0.1% BSA, and 0.1% NaN3) supplemented with 0.5mM EGTA and 5µg/ml cytochalasin D. Crude phagosome preparations were obtained by passing cells 8 times through 22 gauge needles followed by lysate centrifugation 2 min at 500 rpm to remove nuclei and debris. Supernatants containing phagosomes were transferred into new tubes and centrifuged for 5min at 3,000 rpm. Phagosome pallets were then stained with 200µg/ml p47phox antibody (Santa Cruz SC14075) followed by staining with FITC-anti rabbit IgG. Preparation were then fixed with 2% PFA and examined by flow cytometry.     42 2.18 Binding of LpdC to PIPs and Other lipids in vitro: Protein Lipid Overlay Assay and Lipid Coated Beads LpdC binding to cholesterol, PIPs, and other lipids was tested in protein lipid overlay assay as previously described (Dowler, Kular, & Alessi, 2002). Lipid membranes were either pre-spotted and purchased from Echelon Bioscience (UT, USA) or home-made according to published protocol (Dowler et al., 2002). In short, lyophilized lipids (Sigma-Aldrich) were reconstituted to 1mM stock in 1:1 solution of methanol and chloroform. Lipid stocks were then diluted in a 2:1:0.8 solution of methanol:chloroform:water to 6~ 8 concentrations ranging between 1 to 500µM. One µl of each lipid was then spotted onto Hybond-C extra membrane strips yielding 1 to 500 pmol per spot. Membranes were dried at room temperature for 1 hour then blocked with 3% BSA in TBST for 1 hour at room temperature. Membrane strips where then incubated with 10µg/ml His-tagged recombinant LpdC in blocking buffer overnight at 4°C, washed and probed with anti-His tag Ab followed by HRPO-goat anti-mouse IgG. LpdC binding was then visualised by incubation with Pierce ECL Western Blotting Substrate (Thermo Fisher).  For lipid coated bead assays, 100µl of packed streptavidin beads slurry (Sigma-Aldrich) were washed with buffer (10mM HEPES, 150mM NaCl, 0.25% Nonidet P-40) then re-suspended in 10µl of 100µM biotinylated lipids and incubated 2 hours at 4°C. Beads were then washed and incubated with 1~10µg LpdC for 3 hours at 4°C. Samples were washed, eluted with Laemmli sample buffer (BioRad) and subjected to SDS-PAGE and western blotting with LpdC antibody. Membranes were revealed with AlexaFluor (AF) 680 goat anti-rabbit IgG and analyzed with the Odyssey Imaging system (LI-COR Biotechnology, NE, USA).    43  2.19 Competitive Inhibition of LpdC and P47phox Membranes spotted with PI3,4P2 lipid were prepared as described above (section 2.18). Lipid membranes were blocked with 3% BSA in TBS-T for one hour at room temperature then incubated with 10µg/ml LpdC for 1 hour at room temperature. Membranes were then washed and incubated with GST-tagged p47phox for another hour. Membranes were then washed and probed with rabbit anti-GST and AF680 goat anti-rabbit IgG and analyzed with odyssey imager.   2.20 Generation of ΔLpdCM.tb ΔLpdCM.tb was generated using previously published procedures of gene disruption with a selectable marker, such hygromycin (Bardarov et al., 2002). Flanking regions upstream and downstream of LpdC were PCR amplified and cloned into a plasmid with hygromycin resistant gene. This plasmid is called AES: allelic exchange substrate. The AES contains a lambda cos site which allows the AES to be packaged into lambda phage head. The AES was then cloned into a temperature sensitive shuttle phasmid to generate specialized transducing mycobacteriophage. The lambda phage was then transduced into E. Coli, which was then subjected to plasmid purification using miniprep (Qiagen) to obtain the mycobacteriophage genome plus AES. The temperature sensitive (ts) mutation in the mycobacteriophage genome permits replication at permissive temperature of 30°C but prevents replication at non-permissive temperature of 37°C. Transduction at 37°C resulted in highly efficient delivery of the recombination substrate to bacteria. We were then able to transform M. smegmatis with the plasmid at the permissive temperature of 30°C for mass production of mycobacteriophage packaged shuttle plasmids. The obtained phages were then transduced at the non-permissive temperate of 37°C into M.tb or   44 BCG. At this temperature, phage replication is restricted, and allelic exchange occurrs as a result of double crossover between homologous DNA arms flanking the disrupted gene.   Deletion of LpdC was confirmed by southern and western blots. ΔLpdCM.tb complemented with M.tb LpdC or M. smegmatis (Smeg) LpdC were generated by transforming ΔLpdCM.tb with plasmids pmv361-TB LpdC or pmv361-Smeg LpdC with kanamycin resistance. The success of transformation was verified by mycobacterial lysis and western blotting.   2.21 Reactive Oxygen Species (ROS) Detection Assay RAW cells (1 x 105) were washed and re-suspended in 100µl DMEM without phenol red and dispensed in 96 well white-bottomed plate (Corning Inc., Corning, NY). Cells were then pulsed with 50µM luminol and stimulated with bacteria (MOI 10:1) or 2mg/ml zymosan (positive control). ROS production was measured in a Tropix TR717 microplate luminometer (Applied Biosystems, Bedford, MA) at 37°C and at 50 seconds intervals over 45 min time periods.   2.22 PLC- COR1A Co-immunoprecipitation Protein A/G magnetic beads were mixed with 5µg of PLCγ2 antibody in conjugation buffer (20mM sodium phosphate, 0.15M NaCl, pH 7.5). Bound antibodies were then cross-linked to the beads by the addition of DSS (final concentration 20µM) to the conjugated beads for 30 min at room temperature. Reaction was quenched with 50mM Tris for 15 min at room   45 temperature. Non-crosslinked free antibodies were removed with 200µl of elution buffer (0.1 M glycine, pH 2.5). Beads were then washed twice with lysis/wash buffer.   BCG was prepared as described above in section 2.3.1. RAW cells (approximately 20 million cells) were infected with live or killed BCG (MOI 10:1) for 20 min at room temperature, then 2 hours at 37°C. Cells were then washed and processed according to previously published method (Mueller et al., 2008) with some modifications. In brief, infected RAW cells were washed twice with PBS and lysed with iced-cold lysis buffer (pH 7.6, 50 mM Tris HCl, pH 7.5, 150 mM NaCl, 5mM EDTA, 10% glycerol, 1% Triton X-100, 0.05% digitonin, 1mM PMSF, mammalian protease inhibitors and phosphatase inhibitors activated sodium orthovandate and NaF) for 20 min on ice. Nuclei and unbroken cells were sedimented by centrifuging at 3,000 x g for 30 min at 4°C. Supernatants were then transferred to a new tube. 500µg of lysate were pre-cleared with 25µl of magnetic protein A beads at 4°C for 30 min. Supernatants were then mixed with PLCγ2 antibody-beads or control IgG-beads for 2 hours at 4°C on a rotator. The beads were then washed twice with lysis/wash buffer, once with water, and eluted with 50µl of elution buffer for 5 min in room temperature. Elution buffer was neutralized by addition of 5µl of 1M Tris, pH 9.5. Eluted samples were then subjected to SDS-PAGE and western blotting with COR1A antibody to check for efficient immunoprecipitation.   2.23 PLC Phosphorylation (Activation) To test for PLC phosphorylation, 20 million RAW cells were either infected with live or dead BCG or stimulated with 100 ng/µl LPS (positive control) for 20 min at 37°C. Cells were   46 then washed with PBS, lifted and re-suspended in iced cold digitonin lysis buffer (pH 7.6, 50 mM Tris HCl, pH 7.5, 150mM NaCl, 5mM EDTA, 10% glycerol, 1% Triton X-100, 0.05% digitonin, 1mM PMSF, mammalian protease inhibitors and phosphatase inhibitors activated sodium orthovandate and NaF) and incubated on ice for 20 min. Lysates were then centrifuged for 30 min at 3, 000 x g at 4°C. After protein estimation, 800µg aliquots were subjected to SDS-PAGE and western blotting with phospho-PLCγ2 antibody.      2.24 Calcium Measurements To evaluate calcium mobilization, 5 x 105 THP1 cells were washed and re-suspended in HBSS without calcium and loaded with 1.5µM Fluo4-AM (Thermo Fisher) for 30 min at 37°C in FACS buffer (PBS plus 1% FCS). Cells were then washed 3 times and re-suspended in FACS buffer. Latex beads coated with BSA or recombinant LpdC, as described above, were opsonized with 20% AB+ human serum in RPMI for 30 min at 37°C and used for infection. Baseline calcium was acquired for 30 seconds followed by the addition of coated beads or ionomycin (positive control for an additional 5 min. Calcium increase/fluxes were measured and recorded continuously by FACS.   To measure calcium flux using a fluorescence microplate reader, Fluo4-AM loaded THP.1 cells were distributed in black well and clear bottom 96 well plates (PerkinElmer viewplate 96 F TC 6005182) in calcium free buffer and read in Tecan infinite F500 microplate reader (Tecan, Switzerland) at 37°C (excitation/emission, 494/506 nm) at 30 seconds intervals for 10 min.     47 2.25 Statistical Analysis Data are expressed as mean ± SEM. To analyze statistical differences between two groups, unpaired Student’s t-test was employed. To analyze differences among more than two groups, one-way ANOVA and Tukey’s post-test for multiple comparisons were performed. P<0.05 was considered significant and represented by the symbol *. *P<0.05; **P<0.01; ***P<0.001.  48 Chapter 3: Improving BCG Immunogenicity via Surface Decoration using the Avidin-biotin System  3.1 Background  Current strategies to improve BCG are based on introducing recombinant genetic material to over-express BCG antigens not expressed sufficiently during infection (Horwitz & Harth, 2003) or M.tb-specific antigens that are absent in BCG (Indesmith et al., 2003). Other approaches aim to complement BCG with gene encoding co-factors that potentiate antigen presentation function (Grode et al., 2005). Genetic engineering holds great potential for developing novel and efficient BCG-derived TB vaccines. However, this great promise is facing many barriers to the routine use of recombinant BCG strains for large-scale vaccinations. Major limitations include the uncertain level of safety and low efficiency of expression vectors (Bastos, Borsuk, Seixas, & Dellagostin, 2009; Mederle et al., 2002). This raises the question of whether an alternate approach of vaccine improvement can be achieved by complementing BCG with exogenous proteins of interest, rather than nucleic acids.   As mentioned in section 1.1.3, there is an urgent need for new TB vaccines, and the response to this emergency has resulted in a large pipeline of vaccines currently in clinical trials. Unfortunately, many of them are on hold, either for lack of strong evidence for efficacy or because they do not meet the level of safety required for use in human. We believe that improving current BCG is one of the best options based upon its excellent safety record over decades of use. To overcome the limitation of genetic manipulation we proposed the alternative   49 of reversible display of proteins of interest (antigens or immunostimulants) on bacterial cell surface that would allow broad manipulations of BCG to achieve maximal efficacy. To this end, we made use of the high-affinity interaction of streptavidin with biotin, which offered the possibility to attach avidin fusion proteins on the surface of bacteria that have been modified with biotin. Streptavidin and biotin interaction has extremely high affinity (Kd = 10−15 M) and once formed, is very stable and can usually only be disrupted under denaturing conditions (Singh et al., 2003). However, for this approach to serve as an alternative to gene transfer methods, it should allow for long-term but reversible display of proteins, and the process of bacterial surface biotinylation and decoration with exogenous proteins should not compromise either the phenotype of the bacterium or the properties of the proteins displayed at its surface. We tested this approach using a fusion protein consisting of an ovalbumin (OVA) antigen domain and a new version of low affinity monomeric avidin (Kd = 10−7 M) to ensure for slow release of the antigen from the surface of biotinylated BCG once ingested by antigen presenting cells. The use of monomeric avidin also prevented unwanted bacterial aggregation. The choice of OVA antigen was to develop a proof of concept study using widely available and easy to use research tools to study immune response to this popular surrogate antigen (Oizumi, Strbo, Pahwa, Deyev, & Podack, 2007; Sharif-Paghaleh et al., 2014). M.tb specific antigen ESAT6 was then chosen for surface display on BCG and tested in vitro for efficient ingestion by antigen presenting cells and for induction of a specific T cell response in vivo. I aim to prove that this novel method of BCG surface decoration can provide an efficient alternative for gene transfer approaches with broad applications in vaccine development and in cellular mycobacteriology research.    50 3.2 Results 3.2.1 Generation of Plasmids Expressing Monomeric Avidin Fusion Proteins Initially, we used a mutant version of chicken avidin (N54A and W110K) provided by collaborator Dr. Vesa Hytonen. These mutations converted homotetrameric avidin, which bound four molecules of biotin into a monomeric form (mAvidin) (Laitinen et al., 2003). mAvidin binding affinity for biotin decreased from Kd  10−15 M to Kd  10−7 M and was reversible (Laitinen et al., 2003). In this study, we designed a more elaborated version of mAvidin by adding an additional mutation (N17I) in order to prevent N-linked glycosylation, which would minimize undesired non-specific binding of glycosylated avidin to cells and tissues. These new features of mAvidin perfectly suited our purpose of transient and specific display of individual chimeric molecules on the surface of biotinylated BCG without inducing their aggregation.   To produce mAvidin fusion proteins, we generated a novel expression plasmid compatible with the Gateway methodology for rapid and efficient, restriction enzyme-free, recombination cloning of gene of interests in frame with mAvidin (Fig. 5). DNA sequence encoding mutant mAvidin was subcloned into pDEST17 plasmid as described in the Material and Method section, and nucleotide sequence analysis confirmed the expected insertion of mAvidin between the "CTC" and "GAA" (133-134bp, i.e., between the 6-histidine encoding sequence and the pDEST17 recombination site Attr1). The resulting destination plasmid was named “p17-Avi”.   51  Figure 5. Construction of a recombination cloning plasmid for the production of avidin fusion proteins   52 (A) A gene segment encoding for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide252-345 and ESAT6 DNA sequences terminated with attB sites were cloned into pDONR221 via BP Clonase reaction. Thereafter, OVA and ESAT6 genes were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E. coli BL21 was transformed with p17-Avi plasmids and and recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA252-345 are 26.8 and 27.3 kDa respectively.  To test the expression efficiency of p17-Avi, DNA sequence corresponding to OVA252-345 peptide was constructed by PCR amplification using gene-specific primers flanked with Attb adapters (Table 3) and cloned into Gateway pDONR-221 (Invitrogen) as recommended by the manufacturer. Genes of interest were then transferred into p17-Avi by means of LR Clonase reaction (Fig. 5A).  Fusion proteins were expressed in E. coli, then purified and refolded as described in the Material and Method section. We also used a similar cloning strategy to express ESAT6. SDS-PAGE analyses (Fig. 5B) showed single bands of Avi-OVA252-345 and Avi-ESAT6 proteins, which migrated toward the expected molecular weight position of mAvidin fusion proteins. Thereafter, mAvidin-OVA252-345 (Avi-OVA) was used as a surrogate antigen to test the efficiency of biotin-avidin based decoration of BCG with exogenous antigens.   3.2.2 Biotin Bound Efficiently to BCG Cell Surface To examine the efficiency of BCG surface biotinylation, we labeled bacteria expressing red fluorescence (dsRed-BCG) with various concentrations (0-1mM) of Sulfo-NHS-SS-Biotin and measured the relative abundance of bound biotin by staining with FITC-conjugated streptavidin and FACS analyses. The use of fluorescent bacteria allowed for discriminating true   53 bacteria from small-size contaminating particles that were present in most FACS running buffers and coincided with dots corresponding to BCG particles in SSC vs FSC displays (Fig. 6A). Fluorescent histograms deducted from FACS analyses showed a direct relationship between Sulfo-NHS-SS-Biotin concentration and the level of biotin detected on the bacterial surface (Fig. 6B). A total shift of fluorescence histogram (i.e. ~100% positive events) was observed in bacterial samples labeled with 0.5mM biotin, and this concentration was used to generate biotinylated (Biot)-BCG throughout this study.     54 Figure 6. Efficiency of BCG biotinylation (A) Side scattered light (SSC) and Fluorescence laser two (FL2) parameters and dsRed (red fluorescent)-BCG were used to allow for proper gating of true bacteria during FACS analyses. (B) dsRed-BCG was biotinylated with various concentration of NHS-SS-biotin for 30 min at room temperature, then labeled with FITC-streptavidin and analyzed by FACS. Results are presented as histograms of green fluorescence intensity and the insert graph represents the mean ± SEM of mean fluorescence intensities (MFI) deducted from 3 independent experiments. *P<0.05; **P<0.01; ***P<0.001.   3.2.3 Biotinylation of BCG does not affect its Growth We next examined the effect of bacterial surface modification, as result of biotinylation, on the growth kinetics in culture media. The result obtained showed that Biot-BCG displayed a growth profile similar to that of control untreated bacteria, over a 8-day period (Fig. 7A).  On the other hand, we took advantage of our BCG strain expressing luciferase (BCG-Luc) (Sun et al., 2009) to examine Biot-BCG survival in the macrophage. Luminescence signals recorded (Fig. 7B) showed that biotinylated and control bacteria displayed similar profiles of gradual viability decrease within the macrophage. Taken together, these data clearly demonstrated that surface modification with biotin is compatible with bacterial growth and more importantly, did not increase BCG persistence in the macrophage, which would be interpreted as a conversion into a virulent bacterium.   55  Figure 7. Biotinylation of BCG surface did not affect its growth or its survival in the macrophage (A) Biot-BCG and control unlabeled wild-type BCG were grown in complete 7H9 media, and replication was monitored over an 8-day period. The results are expressed as growth curves, i.e., mean absorbance at 600nm as function of time ± SEM from 3 independent experiments.  (B) Macrophages were infected with Biot-BCG-Luc or control unlabeled BCG-Luc for the indicated time periods, and then cell lysates were prepared and assayed for bioluminescence to detect viable bacteria. Results are expressed as mean relative light units (RLU) ± SEM from 3 independent experiments.     56 3.2.4 Surface Decoration of BCG is Efficient, Stable and does not Affect Phagocytosis and Intracellular Trafficking inside Macrophages. Initial experiments examined the extent and success of Biot-BCG surface decoration with exogenous proteins. Biot-dsRed-BCG and control non-biotinylated bacteria were exposed to OVA antigen peptide (Avi-OVA, 10 µg/ml) for 1 h at room temperature. Bacteria were then washed, and bound OVA was detected with rabbit anti-avidin antibody. FACS analyses showed a minimal binding of OVA peptide to non-biotinylated bacteria (MFI= 8.31 ± 0.42, Fig. 8A, top panel). In contrast, significant levels of OVA peptide were detected on the surface of Biot-BCG as reflected by total shift of fluorescence histograms corresponding to Avi-OVA coated Biot-BCG (MFI= 54.67 ± 4.98) relative to control uncoated bacteria (MFI = 5.92 ± 0.22, Fig. 8A, lower panel).  These data demonstrated the efficiency and specificity of mAvidin fusion protein binding to the surface of biotinylated bacteria.   57  Figure 8. mAvidin-OVA binding to Biot-BCG, its stability and phagocytosis    58 (A) Biot-dsRed-BCG and control non-biotinylated dsRed-BCG were mixed with Avi-OVA at room temperature for 1 h and the extent of OVA binding was evaluated by surface staining with rabbit anti-avidin antibody and FITC- goat anti-rabbit IgG (FL1).  Sample were washed and analyzed by FACS. Results are presented as histograms of green fluorescence intensity, and values are mean ± SEM of MFI of Biot-BCG-AviOVA binding obtained from three independent experiments. (B) Lyophilized Biot-BCG coated with Avi-OVA and freshly made Avi-OVA-Biot-BCG were labeled and analyzed by FACS as described in A. Data shown are representative of three independent experiments, and values are mean ± SEM of MFI of Biot-BCG-AviOVA binding obtained from three independent experiments. (C) RAW macrophages were infected with Avi-OVA-Biot-dsRed-BCG or dsRed-BCG for 24 h at 37°C. Samples were washed, treated with trypsin, fixed, and analyzed by FACS. Results are expressed as red fluorescence histograms, which reflect the extent of phagocytosis. Values indicate average percentage ± SEM of cells ingesting BCG obtained from three independent experiments.   Since conventional BCG vaccines are formulated as dried powders, we examined whether freeze-drying affected the stability of upgraded BCG with the biotin-avidin approach described above. To do so, aliquots of biotinylated bacteria coated with Avi-OVA were lyophilized as described in the Material and Method section then compared to freshly made bacterial preparations for surface display of Avi-OVA. FACS data (Fig. 8B) showed that lyophilized bacteria, reconstituted one month later, retained substantial levels of avidin-OVA on its surface (MFI= 38.3 ± 3.6) compared to levels detected on fresh Avi-OVA-BCG preparations (MFI= 47.9 ± 8.3). This test demonstrated that surface decoration of BCG with exogenous protein is stable and reproducible.  Next, we used RAW264.7 cells and red-fluorescent bacteria to verify whether surface modification of BCG with biotin and Avi-OVA peptide bound to it interfered with its entry into host macrophages. Phagocytosis assays were performed as described in the Material and Method   59 section. BCG uptake by macrophages was quantified by FACS, and fluorescence histograms shown in Fig. 8C indicated that BCG surface modification had a minor inhibitory effect on its uptake and ingestion by the macrophage (22.5 ± 1.57% red fluorescent cells), compared to the level of uptake of control unlabeled BCG wild type (24.47 ± 1.18% red fluorescent cells).   To examine the fate of OVA-decorated BCG ingested by the macrophage, adherent RAW cells on cover slips were infected as described above and subjected to intracellular staining with rabbit anti-avidin antibody and FITC-conjugated anti-rabbit IgG. Thereafter, cover slips were mounted on microscope slides and examined by digital confocal microscopy as described (Sun et al., 2010). Results obtained (Fig. 9A) showed a substantial and diffused green fluorescent signal far distant from ingested BCG particles. Thereafter, we performed immunogold staining and EM analyses, which clearly demonstrated that OVA antigen detached from BCG surface and effectively crossed the phagosomal membrane toward the cytosol (Fig. 9B).       60 Figure 9. Avi-OVA detached from BCG surface and crossed the phagosomal membrane toward the cytosol  (A) Adherent RAW cells on cover slips were infected with OVA-decorated dsRed-BCG for 24 h at 37°C and then fixed/permeabilized and stained with rabbit anti-avidin antibody and FITC- goat anti-rabbit IgG. Sample were mounted on microscope slides and analyzed by digital confocal microscopy. Red signal indicates the position of BCG and green signal reflects the localization of Avi-OVA. Dotted line indicates the macrophage cell boundary and the bottom right panel is a 4 X magnification of the insert shown in left panel. (B) Thin sections of BCG-AviOVA infected RAW cells were fixed with paraformaldehyde and incubated sequentially with anti-avidin antibody and gold-conjugated goat anti-rabbit IgG to visualize Avi-OVA and examined with an electron microscope. Magnification of 12,000x were shown. The arrowheads indicate Avi-OVA dissociated from BCG surface and exported beyond the phagosome membrane. The images shown are representatives of two independent experiments.   Taken together, these data indicated that BCG surface decoration with exogenous protein did not affect interaction of bacterial ligands with specific macrophage surface receptors involved in phagocytosis and that once it enters into macrophages, BCG surface decorated with antigens was able to export its surface cargo towards other cell compartments.  3.2.5 Avidin Fusion Antigens Co-localize with MHC Molecules BMA3.1A7, a mouse macrophage cell line commonly used to study antigen presentation (English et al., 2009) was infected with GFP-BCG surface decorated with Avi-OVA and subjected to intracellular staining for OVA peptide and I-A. Confocal images obtained (Fig. 10A) show that Avi-OVA co-localizes with I-A molecules, suggesting that avidin fusion antigen molecules dissociated from the surface of biotinylated bacteria and translocated to compartments specialized for antigen processing and loading into MHC class II molecules. On the other hand, intracellular staining for H-2kb showed abundant co-localization of class I molecules and OVA   61 peptide within BCG phagosomes (Fig. 10B), suggestive of potential presentation of OVA antigen to CD8+ T cells by the macrophage. These findings are consistent with previous studies showing that phagosomes are competent organelles for antigen cross-presentation (Houde et al., 2003). Taken together, these data clearly demonstrated that once ingested by the macrophage, modified bacteria were capable of delivering their surface antigen cargo to the antigen presentation machinery.   62  Figure 10. Avidin-fusion antigen co-localized with MHC class II and class I molecules  Adherent BMA cells were infected with OVA decorated GFP-BCG for 4 h and then stimulated with IFN-γ for 24 h. Cells were then fixed/permeabilized and stained with rabbit anti-avidin antibody, Alexa 594 anti-rabbit IgG and either Alexa 647 rat anti-mouse I-A (A) or Alexa 647 rat anti-mouse H-2kb (B). Samples were mounted on microscope slides and analyzed by digital confocal microscopy. Green signal indicates the position of BCG-GFP and red signal reflects the localization of Avi-OVA. Blue signal indicates the position of MHC class II or class I   63 molecules. Dotted line indicates area of interest. Arrowheads indicated Avi-OVA colocalization with MHC molecules. Images shown are representatives of two independent experiments.  3.2.6 Biotinylated BCG Surface Decorated with Surrogate Avi-OVA was Fully Immunogenic Results presented above clearly demonstrate the effectiveness and robustness of avidin/biotin-mediated protein surface display developed in this study. In particular, the findings of intracellular trafficking of exogenous antigens dissociated from BCG surface suggest that they join compartments specialized in antigen processing and presentation to T cells. Since our ultimate objective is to improve BCG vaccine efficacy via surface display of immunodominant antigens, we judged essential to examine whether BCG decorated with surrogate antigen OVA is able to induce a specific immune response in vivo. To do so, B6 mice were immunized with wild-type BCG or BCG-Avi-OVA or PBS alone (control). Animals were euthanized 20 days later to perform ex-vivo experiments. We also examined whether immunogenicity of antigen surface decorated BCG was comparable to that of BCG genetically engineered to express a similar antigen. Thus, mice were immunized with BCG transformed with plasmid expressing OVA757-1035 in fusion with the 19 kDa surface lipoprotein (BCG-p19-OVA) and BCG-p19-Avi-OVA, which corresponded to BCG expressing p19 alone and surface decorated with Avi-OVA. The amount of OVA present on BCG-p19-OVA and BCG surface decorated with Avi-OVA were comparable (Appendix A.3). To determine the frequency of OVA-specific CD4+ T cells, splenocytes were labeled with PE-conjugated I-Ab-OVA323-339 tetramers (FL2) and AF647 CD4 (FL4) then analyzed by flow cytometry as described in the Material and Methods section, and in Appendix A.4. Tetramer technology is an effective tool used to identify antigen-specific T cells   64 by flow cytometry. Normally, antigens are loaded onto MHC molecules, which can then be presented and recognized by antigen-specific T cells; however, the affinity of MHC molecules and specific T cell receptors (TCR) is weak, and the complex has a short half-life, so the interactions have been historically hard to detect in a functional assay. The MHC tetramer approach solves this problem by having 4 molecules of MHC/antigen complex instead of one, thereby greatly increasing the avidity of the interaction. MHC tetramer is capable of interacting with more than one copy of the TCR on the T cell surface, resulting in much better detection of antigen-specific T cell response and expansion. By using this technology, I was able to detect antigen-specific CD4+ T cell response to BCG decorated with surrogate antigen OVA.   FL4 vs FL2 dot plots showed a significantly larger proportion of tetramer positive events in the panel corresponding to animals immunized with wild-type BCG-Avi-OVA (0.305 ± 0.055%) compared to almost no positive events in those corresponding to animals receiving BCG wild-type or PBS (0.087 ± 0.002% and 0.024 ± 0.003% respectively) (Fig. 11A and also Fig. 11C, left graph, which indicate absolute numbers of tetramer positive cells). On the other hand, OVA-specific CD4+ T cell responses to BCG-p19-Avi-OVA (tetramer positive events = 0.275 ± 0.055%) were similar to those induced by BCG-p19-OVA (0.228 ± 0.038%) and not significantly different from those corresponding to control wild-type BCG-Avi-OVA (Fig. 11A and Fig. 11C, left graph). These findings indicated that a significant expansion of OVA specific CD4+ T cells occurred in vaccinated animals and that the degree of immunogenicity of OVA surface coated BCG was comparable to that of BCG genetically expressing similar OVA epitope. Besides I-Ab-OVA323-339 tetramer staining, splenocyte samples were also subjected to staining with PE-conjugated I-Ab-Ag85B280-294 tetramers to detect Ag85B-specific CD4+ T cells in the   65 treatment groups listed above. Results obtained (Fig. 11B) indicated that there were no significant differences in the frequencies and absolute numbers (Fig. 11C, right graph) of Ag85B-specific CD4+ T cells between untreated wild-type BCG and surface modified BCG preparations via the avidin-biotin system or plasmid transformation.  These findings clearly demonstrated that surface biotinylation and addition of exogenous antigens to BCG surface did not impact the immune response to its native antigens.    66  Figure 11. In vivo CD4+ T cell response to OVA-decorated BCG  C57BL/6 mice were injected subcutaneously with BCG surface decorated with OVA, unmodified BCG wild-type, PBS (control), BCG genetically transformed to express OVA (BCG-p19-OVA) or transformed with control plasmid and surface decorated with Avi-OVA (BCG-p19-AviOVA). After a 20-day period, splenocytes were prepared from the spleens of euthanized animals and stained with PE-conjugated I-Ab-OVA323-339 tetramers (A) or PE-conjugated I-Ab-Ag85B280-294 tetramer (B), followed by AF647-CD4 antibody and 7-AAD. Samples were then analyzed by   67 FACS.  Results are expressed as two-parameter dot plots that show the average frequencies ± SEM of tetramer positive events in the CD4+ population from two animals/group. Data shown are representative of three independent experiments. The data in graphs (C) are expressed as mean value ± SEM of the absolute number (in a total of 500,000 events) of OVA tetramer specific CD4+ cells in (left graph) or Ag85B Tetramer specific CD4+ T cells (right graph) from two animals/group and three independent experiments. *P<0.05; **P<0.01; ***P<0.001.   IFN-g is known to play an important role in the protective response against intracellular pathogens, including mycobacteria (Flynn et al., 1993). Therefore, to further visualize specific T cell responses to OVA-decorated BCG, we performed ICS experiments to determine the frequencies of OVA-specific T cells releasing cytokines in immunized animals. Splenocytes were pulsed ex vivo with recombinant OVA and subjected to CD4 (FL3) immunostaining along with IFN-g (FL4) as described in the Material and Methods section. Data deducted from FACS analyses showed similar level of OVA-specific IFN-g releasing CD4+ T cells in animals immunized with BCG WT-Avi-OVA, BCG-p19-OVA and BCG-p19-Avi-OVA. In fact, the average frequencies of IFN-g positive and CD4 positive events (0.305 ± 0.055%, 0.153 ± 0.078% and 0.265 ± 0.025% respectively) were significantly higher than those obtained in response to wild-type BCG (0.012 ± 0.004%) (Fig. 12A). These data were consistent with the absolute numbers of IFN-g positive and CD4 positive events (Fig. 12C, left graph).   68  Figure 12. Frequencies of T cells releasing cytokines in response to Avi-OVA coated BCG-immunization Splenocytes from immunized mice with PBS, BCG Wild-type, BCG WT surface decorated with Avi-OVA, BCG-p19-OVA and BCG-p19-AviOVA were stimulated with recombinant OVA protein for 16 h followed by a 5 h-period treatment with Brefeldin A. Cells were then washed and stained first with PE-Cy7 anti-CD4 (A) or PE anti- CD8 antibody (B) then AF647 anti-IFN-g antibody. Cells were then washed and analyzed by FACS. Results are expressed as two-parameter dot plots to show the average frequencies ± SEM of IFN-g producing cell subsets in   69 CD4+ and CD8+ populations from two animals/group. Data shown are representative of three independent experiments. The data in graphs (C) are expressed as the mean of absolute number ± SEM of IFN-g releasing CD4+ T cells (left graph) or IFN-g releasing CD8+ T cells (right graph) from two animals/group and three independent experiments. *P<0.05; **P<0.01; ***P<0.001.  Given that CD8+ T cell responses efficiently contribute to TB immunity (Behar, 2013), we extended our ICS experiments to include analyses of cytokine releasing CD8+ T cell in response to OVA antigen by double immunostaining of splenocytes for CD8 and IFN-g. Frequency (Fig. 12B) and absolute number (Fig. 12C, right graph) data revealed a significant expansion of IFN-g producing CD8+ T cells in splenocytes isolated from mice immunized with Avi-OVA-coated wild-type BCG (0.150 ± 0.020%) relative to data deducted from mice inoculated with untreated BCG (0.024 ± 0.002%). More importantly, CD8+ T cell response in splenocytes isolated from BCG-p19-OVA immunized animals (0.230 ± 0.110%) was significantly lower than those observed in splenocytes from BCG-p19-Avi-OVA inoculated mice (0.440 ± 0.050%). These differences were consistent with the absolute numbers of cytokine releasing CD8+ T cell shown in Fig. 11C, right graph. Taken together, these data demonstrated that BCG transformation with antigen-encoding nucleic acids could be effectively replaced by biotin/avidin mediated antigen surface display methodology.  3.2.7 Evaluation of the Immunogenicity of Biot-BCG Decorated with ESAT6 Experiments using the surrogate antigen OVA clearly demonstrated the efficiency of surface decorated BCG to induce specific immune response in vivo. To validate this approach for M.tb specific proteins, we examined mouse immune response to BCG surface decorated with the   70 early-secreted M.tb antigen ESAT6, which is a major immunodominant antigen not expressed in BCG (Indesmith et al., 2003) and have been previously shown to induce protective T cell response against virulent M.tb (Chatterjee et al., 2011). Data from tetramer staining with PE-conjugated I-Ab-ESAT61-20 tetramer (Fig. 13A) showed that splenocytes from BCG-Avi-ESAT6 immunized mice contained a substantial ESAT6 specific CD4+ T cell subset (0.187 ± 0.032% tetramer positive events) relative to the background value (0.052 ± 0.004%) obtained from splenocytes from wild-type BCG immunized mice. This was also shown in the absolute number of ESAT6 specific CD4+ T cell numbers (Fig. 13B). On the other hand, ICS showed significant expansion of IFN-g producing CD4+ T cells in response to ESAT6 antigen in splenocytes isolated from BCG-Avi-ESAT6 (0.156 ± 0.067%) compared to BCG WT (0.028 ± 0.006%) vaccinated animals (Fig. 13C, top panel and Fig. 12D, left graph). Furthermore, the frequencies of IFN-g producing CD8+ T cells in BCG-Avi-ESAT6 immunized mice were significantly greater than in mice immunized with wild-type BCG (Fig. 13C, bottom panel and Fig. 13D, right graph). Mice immunized with BCG coated with Avi-ESAT6 were able to induce 0.705 ± 0.065% ESAT6 specific IFN-g producing CD8+ T cells compared to 0.024 ± 0.006% in BCG WT immunized mice. Taken together, these data showed that BCG surface coated with M.tb specific protein, ESAT6, was able to successfully induce specific ESAT6 immune response in vivo and improve immunogenicity of BCG.  These additional data strongly supported the approach of upgrading BCG by means of surface display of protective M.tb antigens.   71  Figure 13. In vivo CD4+ T cell response to ESAT6-decorated BCG and frequencies of T cells releasing cytokines in response to ESAT6 C57BL/6 mice were immunized with PBS, BCG WT alone or BCG WT surface decorated with Avi-ESAT6 as described in Fig. 7. (A) Splenocytes from immunized animals were stained with PE-conjugated I-Ab-ESAT61-20 tetramers followed by AF647-CD4 antibody and 7-AAD. Samples were then analyzed by FACS.  Results are expressed as two-parameter dot plots that show the average frequencies ± SEM of tetramer positive events in the CD4+ population from two animals/group. Data shown are representative of three independent experiments. The data in graphs (B) are expressed as mean values of the absolute number ± SEM of IFN-g releasing CD4+ T cells (left graph) or IFN-g releasing CD8+T cells (right graph) from two animals/group and three independent experiments. (C) Splenocytes from immunized animals were stimulated with recombinant ESAT6 protein then stained and analyzed   72 by FACS as described in Fig. 8. Results are expressed as two-parameter dot plots to show the average frequencies ± SEM of IFN-g producing cell subsets in CD4+ (upper panel) and CD8+ (lower panel) populations from two animals/group. Data shown are representative of three independent experiments. (D) Each column in graph represents the mean of absolute number± SEM of IFN-g releasing CD4+ (Left graph) or CD8+T cells (right graph) from two animals/group and three independent experiments. *P<0.05; **P<0.01; ***P<0.001.  3.3 Discussion Today, an effective TB vaccine is more urgently needed than ever in order to reverse the current worrisome burden of a global TB epidemic, especially with the exacerbation of the disease during the last 2 decades by the wide spread of drug-resistant TB and co-infection with HIV. In this regard, I believe improving and building on the success of the current BCG vaccine is one of the best preventive approaches to stop the spread of TB. The success of this would be transformational for public health with benefits across society, especially in developing countries. BCG has so far been given to more than 3 billion people with rare serious adverse outcomes (Fine, 1995); therefore, genetic reshaping is being considered as a reasonable approach to further improve its efficacy. This strategy is currently being used extensively for expression of exogenous antigen proteins or proteins with defined immunological properties in BCG (Bastos et al., 2009; da Costa, Nogueira, Kipnis, & Junqueira-Kipnis, 2014), but only a few recombinant BCG vaccines are currently being seriously considered for clinical trials (Bastos et al., 2009). Although the use of conventional gene transfer via plasmid-mediated transformation holds great promise for the development of TB vaccines, a series of difficulties remain to be overcome in order to speed up the development of alternative versions of recombinant BCG strains.     73 Replicative plasmids have been successfully used to express high levels of heterologous genes in BCG (Labidi, David, & Roulland-Dussoix, 1985). However, their stability during bacterial culture wanes with time (Al-Zarouni & Dale, 2002), which is a drawback to mass production of recombinant vaccines. To solve this issue, a new optimal solution of utilization of frozen stocks has been used. On the other hand, the use of integrative vectors, although more stable than replicative plasmids (Mederle et al., 2002), leads to limited levels of protein expression. Thus, optimization of BCG as a vehicle for live recombinant vaccines requires development of alternative strategies for efficient antigen expression.  We reasoned that a method that allows for rapid and reversible display of exogenous proteins on the cell surface might offer a viable alternative to gene transfer approaches. In this regard, we report here an effective method based on the biotin-avidin system to achieve stable and efficient display of exogenous proteins to add either specific antigens or specific functional properties to bacterial cell surface expected to efficiently improve BCG immunogenicity.  Our data demonstrated that BCG cell surface could be easily modified with biotin for rapid display of exogenous avidin fusion proteins without detectable change in bacterial viability, uptake, and internalization by host macrophages.  The procedure was performed in a short period of time (~ 2 h) and resulted in the immediate presence of functional proteins on the cell surface without the time lag (3 to 6 months) required for transformation and selection of positive clones and their characterization.  Bacteria decorated with surrogate OVA antigen and ESAT6 were efficiently ingested by antigen presenting cells in vitro. Thereafter, the use of advanced FACS-based exploratory assays, which included MHC tetramer technology and ICS allowed us to objectively evaluate the T-cell axis and Th1 cytokine, particularly IFN-γ detection, in animals immunized   74 with modified BCG preparations. We clearly demonstrated that surface-decorated bacteria were as immunogenic as BCG genetically engineered to express similar antigens.   Avidin binding to biotin is the strongest non-covalent interaction known in nature (Kd 10−15 M) (Green, 1990), and this tight binding is one of the most general tools for biological research (Howarth, Takao, Hayashi, & Ting, 2005). In recent years, it has been extensively developed and approved for many therapeutic applications, including cancer treatments (Lesch, Kaikkonen, Pikkarainen, & Yla-Herttuala, 2010; Paganelli et al., 2006). In an attempt to adapt the properties of avidin for our purpose, i.e., a form of avidin that binds reversibly to biotin, we applied a triple site-directed mutagenesis (N54A, W110K and N17I) to wild-type avidin, which converted homotetrameric avidin into a non-glycosylated form of monomeric avidin, which has a significantly reduced affinity to biotin (Kd 10−7 M) and thus binds reversibly to biotin. This novel form of avidin was used to develop a novel plasmid (p17-Avi) for rapid expression of protein of interest using the Gateway recombination cloning method. Of note, p17-Avi would also be useful for rapid expression of many human or mouse mAvidin chimera molecules from ORFs (cytokines, apoptosis inducers or transcription factors) already subcloned in Entry vectors compatible with recombination cloning (http://orf.invitrogen.com). This modified mAvidin was chosen over a version of monomeric streptavidin (mSA) (Demonte, Drake, Lim, Gulick, & Park, 2013) which was designed based on streptavidin and rhizavidin sequences and had a Kd of 10−9 M. With preliminary testing, mAvidin chimera protein bound to biotinylated bacteria at a higher efficiency compared to mSA chimera protein. We focused this study based on mAvidin, but monomeric streptavidin would also be a possibility for other applications.     75  It is well known that naturally occurring anti-avidin antibodies are common in humans and laboratory animals (Bubb et al., 1993). Thus, one may think these antibodies would hamper the use of avidin for therapeutic purposes. However, this is not the case since detailed clinical studies demonstrated that the safety and efficacy of avidin were not significantly affected by its immunogenicity (Petronzelli et al., 2010). In this regards, it is important to note that conversion of tetrameric avidin into monomers is associated with a significant decrease of its immunogenicity (Bigini et al., 2014). Low affinity monomeric avidin has the advantage to circumvent two additional and major drawbacks. First, monomeric avidin prevents aggregation, which would result in large bacterial clumps useless for vaccine purposes. Second, reversible binding allows for transient surface display of molecules of interest on BCG surface. Thus, once ingested by the host cell, cellular mechanisms of the phagocytic cells are able to detach from the surface of modified bacteria their cargo and deliver it intracellularly. Finally, non-glycosylated monoavidin could also be an attractive system for production of large quantities of avidin chimera molecules in eukaryotic systems like yeast or transgenic plants (Cummings et al., 2014; Kolotilin et al., 2014).   Large-scale production of this technology requires a large amount of recombinant proteins to be made, which could be expensive and might not be feasible for a replacement BCG vaccine for third-world countries, but it is not entirely impossible with the improvement of technology. Our method also offers other exciting possible uses such as the ability to analyze and evaluate immunogenicity of newly developed vaccine candidates in a rapid and accurate way, both in vitro and in vivo. The primary goal of novel TB vaccines is to induce TH1 type cells such as CD4+ and CD8+ T cells that play important roles in protection against TB. The avidin-biotin   76 system developed in this study offers a very useful tool to assess these T cells responses as seen in our experiment showing the expansion of specific T cells secreting cytokines in response to BCG surface decorated with the well-documented ESAT-6 antigen. This indicated that our novel and timely technology of rapidly displaying recombinant proteins/antigens on BCG surface represented a great tool to evaluate rapidly and accurately the protective efficacy of many immunogenic proteins (e.g. secreted specific M.tb proteins) thought to induce protective TB immunity with broad applications in vaccine development. Such knowledge can then be translated to the development of efficient vaccines.   Many current TB vaccines candidates, as described above, focus on introducing immunodominant antigens such as Ag85A/B, ESAT6, and CFP10 to boost immunity. However, ESAT6 and CFP10 are not recommended for vaccine development since they are used as biomarkers for diagnostic tests to distinguish between the vaccine strain BCG and M.tb (Van-Lume et al., 2010). Ag85A/B are secreted by all BCG strains (de Bruyn et al., 1987; Denis et al., 1998) so there is no reason to further overload BCG with Ag85A and B antigens. M.tb specific and protective antigens TB10.4 and VAPB47 genes are present in the genome of BCG but no proteins are detectable (Billeskov, Vingsbo-Lundberg, Andersen, & Dietrich, 2007; Mollenkopf et al., 2004); therefore, over-expression of these antigens on BCG using our method of surface display of protein of interest would be the next step to induce optimal host immune response against TB.   Another advantage of this method is the possibility to adjust the amount of chimeric proteins on the cell surface by varying the concentration of recombinant avidin fusion proteins,   77 allowing simultaneous display of several antigens/proteins of interest on the bacterial cell surface in order to maximize the effectiveness of vaccine. Many studies, including from our laboratory, have shown that BCG interferes with important macrophage functions associated with phagosome maturation arrest (Deghmane et al., 2007; Soualhine et al., 2007) including decreased antigen presentation (Soualhine et al., 2007). Therefore, the release of avidin fusion protein from the surface of ingested bacteria and its trafficking within the cytosol open up many other possibilities to further improve BCG. Indeed, one possibility would be to label BCG surface with a combination of antigens of interest and constitutively active effectors known to accelerate phagosome biogenesis.   In conclusion, our study provides strong data to support proof-of-concept for a novel strategy aimed at optimizing BCG for vaccinal purposes (Fig. 14).  It is based on rapid, reproducible, and reversible surface decoration with one or multiple proteins of interest via binding of avidin chimeric proteins to biotinylated bacteria capable of delivering their cargo inside antigen-presenting cells in vivo. Overall, this study revealed the enormous potential of the avidin-biotin mediated surface display of antigen system in TB vaccine development, showing that this system could successfully replace traditional BCG transformation with antigen-encoding plasmids, and giving new insights for other therapeutic applications.     78  Figure 14. Schematic summary of BCG surface decoration approach   79 BCG is first surface biotinylated with hydrosoluble biotin then exposed to mAvidin chimeric proteins for reversible surface decoration with antigens. Modified BCG is then inoculated into animals where it is expected to deliver antigens to induce specific T cell responses. Mouse picture was taken by one of the contributor to this work.      80 Chapter 4: Lipoamide Dehydrogenase (LpdC) and M.tb Persistence in Macrophages  4.1 Background  One of the very important strategies used by M.tb to persist in macrophages is prevention of phagosome maturation. Previous studies have shown that COR1A retention on phagosome membrane correlates with phagosome maturation arrest (Ferrari, Langen, Naito, & Pieters, 1999) and that physical interaction between mycobacterial LpdC and COR1A is important for abnormal retention of COR1A on phagosomal membrane (Deghmane et al., 2007). Therefore, characterizing the mechanism of LpdC-COR1A interaction is important for a better understanding of TB pathogenesis and for proposing LpdC as a novel drug target. Elucidating the mechanism of COR1A retention on phagosome membrane is therefore the goal of this project.   LpdC-COR1A interaction was shown to be dependent on cholesterol (Deghmane et al., 2007) which was consistent with other studies showing that cholesterol is essential for phagocytosis of mycobacteria, and cholesterol-enriched domains were required for COR1A retention on the phagosome (Gatfield & Pieters, 2000). We therefore hypothesized that mycobacterial LpdC interferes with phagosome maturation through retaining COR1A on the phagosome membrane via binding to cholesterol. A second hypothesis for LpdC-COR1A retention based on LpdC disrupting a phospholipase C (PLC) mediated hydrolysis of membrane PI4,5P2 pathway will be discussed and investigated in section 4.3. In brief, COR1A is normally   81 anchored to the membrane by PI4,5P2 and upon PLC activation that hydrolyzes PI4,5P2, it is released from the membrane. I hypothesize that LpdC interferes with this process which leads to abnormal retention of COR1A on cell membrane-derived phagosome.  4.2 Hypothesis 1: LpdC Interferes with Phagosome Maturation through Retaining COR1A on the Phagosome Membrane via Binding to Cholesterol. 4.2.1 Construction of Recombinant LpdC protein and LpdC’s Role in Phagolysosome Fusion Arrest Previous studies on LpdC-COR1A interaction was done with either cell lysate or bacteria expressing LpdC. In order to further study the LpdC-COR1A interaction, we first constructed and purified recombinant LpdC proteins using recombinant cloning techniques based on the Invitrogen Gateway system (Life Technologies) as described in the Material and Methods section. In brief, M.tb LpdC and M. smeg LpdC sequence with flanking attb adapters were PCR amplified from M.tb genomic DNA or M. smeg genomic DNA, and the final plasmid was transformed into E.coli for expression and purification of recombinant LpdC protein (Fig. 15A). M. smegmatis is a fast growing non-pathogenic mycobacterial species. M.tb LpdC and BCG LpdC have 100% identity while M. smeg LpdC has 85% sequence similarity to M.tb LpdC (Appendix A.5). It has been previously shown that M. smeg is unable to retain COR1A on its phagosome membrane and over-expressing M.tb LpdC on M. smeg leads to COR1A retention on its phagosome, similar to phagosomes containing BCG LpdC (Deghmane et al., 2007).   With the recombinant LpdC proteins, we wanted to confirm that phagosomal retention of COR1A observed in live and killed BCG (Deghmane et al., 2007) was indeed dependent on   82 LpdC and not other mycobacterial factors. To do so, we examined whether infecting macrophages with latex beads coated with M.tb LpdC blocked phagosome maturation and retained COR1A compared to macrophages infected with M. smeg LpdC or BSA coated beads. RAW 264.7 macrophage cells were loaded with FITC-dextran to label the lysosome then infected with protein-coated beads. COR1A localization was detected by intracellular staining with specific antibody. Samples were examined by confocal microscopy, and results in Fig. 15B showed that control beads (coated with BSA) and beads coated with M. smeg LpdC co-localized with dextran and excluded COR1A, meaning it had fused with lysosomes and undergone normal phagosome maturation. In contrast, beads coated with M.tb LpdC stopped phagosome maturation (exclusion of dextran) and had abnormal retention of COR1A, consistent with what was previously seen in macrophages infected with live and killed BCG (Ferrari et al., 1999) and M. smeg and M. smeg expressing M.tb LpdC (Deghmane et al., 2007).   83  Figure 15. LpdC from M.tb but not from M. smegmatis, inhibited phagolysosome fusion  (A) Gel picture of purified recombinant his-tagged-M.tb LpdC and M. smeg protein purified from E.coli. Expected size: 49kDA. (B) Adherent macrophages were loaded with FITC-dextran (green fluorescence) to label lysosomes. Cells were then exposed to latex beads coated with either M.tb LpdC, M. smeg LpdC or BSA (control) at 37°C for 4 h. Unbound beads were removed by multiple washes, and cells were fixed/permeabilized and stained for   84 intracellular COR1A (red fluorescence). Coverslips were mounted on microscope slides and examined by digital confocal microscopy. Arrows indicate the position of protein coated beads.   Next, we performed quantitative analyses of COR1A retention and phagolysosome fusion by a FACS-based method.  RAW macrophage cells were loaded with FITC-dextran to label lysosomes and stained with CellMask-Red to stain the cell surface and therefore fluorescent membrane-derived phagosomes. Cells so treated were infected with M.tb LpdC or BSA coated beads for 2 hours, and then phagosomes were prepared as described in the Material and Methods section. FACS analyses (Fig. 16) showed that phagosomes containing M.tb LpdC beads co-localized significantly less with FITC-dextran (MFI = 11 ± 1.27) compared to phagosomes containing BSA beads (MFI = 21.75 ± 3.35), indicating that M.tb LpdC inhibited twice as much phagosome lysosome fusion compared to BSA beads.   Figure 16. LpdC from M.tb inhibited phagolysosome fusion Adherent RAW cells were loaded with FITC-dextran to label lysosomes and stained with CM red to label phagosomes. The cells were then exposed to latex beads (labeled with PKH26) coated with either M.tb LpdC or   85 BSA (control) at 37°C for 4 hours. Unbound beads were removed by multiple washes, and phagosomes were extracted and examined by flow cytometry to examine levels of fusion with lysosomes. Results are presented as histograms of green fluorescence intensity reflecting presence of lysosomal compartment and the insert graph represents the mean ± SEM of MFI deducted from 3 independent experiments.   To demonstrate that phagolysosome fusion arrest correlated with COR1A retention, phagosomes containing LpdC or BSA coated beads were stained to detect the amount of COR1A retained on the phagosomal surface. The results obtained (Fig. 17A) showed significant co-localization of COR1A with LpdC beads (MFI = 16.05 ± 0.5) relative to BSA beads (MFI= 10.05 ± 0.35). These data demonstrated that LpdC was indeed contributing to phagolysosome fusion arrest and surface retention of COR1A. Levels of macrophage uptake of LpdC and BSA coated beads were similar (Fig. 17B), which ruled out the possibility that these results were skewed by different rates of phagocytosis.    86  Figure 17. LpdC from M.tb retained COR1A on phagosome membrane  (A) Adherent RAW cells were stained with CM red to label the phagosomes, then infected with latex beads coated with either M.tb LpdC or BSA (control) at 37°C for 4 hours. Unbound beads were removed by multiple washes, and phagosomes were extracted, stained for intracellular COR1A, and analyzed in flow cytometry. Results are presented as histograms of green fluorescence intensity and the insert graph represents the mean ± SEM of MFI deducted from 3 independent experiments. (B) Whole RAW cells infected with latex beads were analyzed by flow cytometry to show levels of bead uptake by macrophages.     87 4.2.2 LpdC does not Bind to Cholesterol but Instead to PIPs Previous studies provided evidence suggesting that LpdC binding to COR1A may be dependent on the presence of cholesterol (Deghmane et al., 2007). To verify this hypothesis, I examined direct binding of recombinant His-tagged LpdC to cholesterol using protein lipid overlay (PLO) assay as described in the Material and Methods section. In short, membranes spotted with cholesterol and various other lipids were incubated with LpdC protein, and the extent of LpdC binding was detected with blotting with His-tag antibody and visualized with chemiluminescence. Repeated PLO assay showed consistently that, surprisingly, LpdC did not bind to cholesterol but instead bound to a series of PIPs (Fig. 18A). This is very exciting since PIPs regulate many cell signalling pathways (Yeung, Ozdamar, Paroutis, & Grinstein, 2006) and LpdC binding to PIPs could provide further insight into its effects on macrophage function. Thus, to further investigate LpdC binding to PIPs, membranes were spotted with an array of different lipids and used for PLO assays. We found that LpdC bound most strongly to PI3,4P2 and PI4,5P2 (Fig. 18B). These observations were confirmed with lipid-bead pull down assays (Fig. 18C). To determine which of these PIPs bound to LpdC the most strongly, we repeated PLO assays with varying concentrations of PIPs and clearly showed that LpdC bound most strongly to PI3,4P2 (Fig. 18D). Therefore, we focused our efforts on the significance of LpdC binding to PI3,4P2 with regard to macrophage function attenuation by M.tb.     88  Figure 18. Protein lipid overlay assays with recombinant LpdC Echelon Inc. membranes spotted with 100 pmol of (A) various lipids or (B) PIPs or (D) increasing quantities of PIPs (1.5 to 100 pmol) were incubated with recombinant His-tagged LpdC (10µg/ml) overnight at 4°C. Membranes were   89 then washed and probed with anti-His mouse antibody followed by HRPO-goat anti-mouse IgG. LpdC binding to lipids was revealed by ECL. Results shown are representative of three independent experiments. (C) Streptavidin beads conjugated to biotinylated lipids were incubated with recombinant LpdC proteins then washed, eluted and subjected to SDS-PAGE and western blotting with anti-LpdC antibody. Results shown are representative of three independent experiments.  4.2.3 Hypothesis: LpdC Binding to PI3,4P2 Interferes with NADPH Oxidase (NOX2) Assembly PI3,4P2 is a minor phospholipid component of the cell membrane that plays many important roles in the cell, most notably during NOX2 assembly. NOX2 consists of a membrane-bound cytochrome b558 complex, composed of p22phox and gp91phox subunits and cytosolic factors that comprises p40phox, p47phox, p67phox, and rac1 GTPase. The phox subunits compartmentalized in the cytosol are under an inactive form in order to prevent unwanted production of reactive oxygen species (ROS) in resting cells. Upon phagocyte activation, cytosolic NOX2 subunits translocate to the phagosomal membrane and undergo conformational changes, which make their PX domain accessible to phospholipids. Specifically, the p47phox PX domain would bind to PI3,4P2 on the phagosome membrane and facilitate the assembly and activation of NOX2 complex for superoxide anion production (Fig. 19A) (Ueyama et al., 2007). Since LpdC binds strongly to PI3,4P2, we hypothesized that LpdC may interfere with p47phox binding to its cognate phospholipid and therefore stop NOX2 assembly and ultimately ROS production (Fig. 19B).    90  Figure 19. Model of LpdC interference with NOX2 assembly and activation (A) Model of interactions between NOX2 p47phox, p67phox, and p40phox subunits. NOX2 consists of a membrane-bound b558 complex that is composed of p22phox and gp91phox subunits and the cytosolic factors p40phox, p47phox, p67phox and, rac1 GTPase. In resting macrophages, the phox subunits are located in the cytosol, and upon activation their PX domains become accessible, allowing for translocation to the phagosome membrane via binding to membrane phospholipids. (B) p47phox (PX domain) binding to PI3,4P2 facilitates the assembly and activation of NOX2. We hypothesize that LpdC interferes with PI3,4P2-p47phox interactions. Images are adapted and reprinted with permission from American Society of Cell Biology (Ueyama et al., 2007).  4.2.4 Does LpdC Compete with p47phox for Binding to PI3,4P2? Current model for NOX2 assembly (Ueyama et al., 2007, Fig. 19) suggest that phagosomal recruitment of p47phox occurs via interaction with membrane PI3,4P2. Therefore, we hypothesized that LpdC may compete with p47phox PX domain for binding to PI3,4P2, leading to defective NOX2 assembly/activation. To verify this hypothesis, a range of PI3,4P2   91 concentrations were spotted on nitrocellulose membrane and incubated with p47phox protein in the absence or presence of recombinant LpdC. p47phox binding to PI3,4P2 lipid was then revealed by blotting with anti-GST antibody. Results in Fig. 20 showed decreased p47phox binding to membranes that were pre-incubated with recombinant LpdC, indicating that LpdC effectively interferes with p47phox binding to PI3,4P2.   Figure 20. LpdC blocked p47phox interaction with PI3,4P2  Nitrocellulose membrane were spotted with various concentration of PI3,4P2. Membranes were either incubated with recombinant LpdC (right) or blocking buffer (left). Membranes were then incubated with GST-p47phox protein, washed and probed with anti-GST antibody, and visualized by ECL. Results shown are representative of 4 independent experiments.   Thereafter, we examined to what extent mycobacterial LpdC inhibited recruitment of p47phox to mycobacterial phagosomes. We first infected RAW macrophages on cover slips with live (capable of secreting LpdC) or dead BCG (non-secreting), and then performed intracellular staining for p47phox. Confocal analyses (Fig. 21) showed similar levels of p47phox recruitment to live- and killed-BCG containing phagosomes.    92  Figure 21. BCG infection did not stop recruitment of p47phox to the phagosome membrane  Adherent RAW cells on coverslips were infected with (A) live or (B) killed GFP-BCG for 2 hours at 37°C and then fixed/permeablized and stained with rabbit anti-p47phox antibody and cy5-goat anti-rabbit IgG. Samples were mounted on microscope slides and analyzed by digital confocal microscopy. Green signal indicates the position of BCG, and blue signal reflects the localization of p47phox on phagosome membrane. Arrows indicate BCG inside macrophage phagosomes. Result shown are representative of 3 independent experiments.   To validate these qualitative data, we performed quantitative FACS-based analyses of purified phagosomes (1 to 3 hour post-infection) and found no significant differences between levels of p47phox recruitment to isolated live- and killed-BCG phagosomes (Fig. 22A). To eliminate the possibility of limited secreted LpdC molecules competing with more abundant p47phox, we repeated FACS phagosome analyses using cells ingesting beads coated with an abundant amount of recombinant LpdC or BSA proteins (control). Results obtained (Fig. 22B)   93 were comparable to those obtained with bacterial particles, i.e., there was no difference between levels of p47phox recruitment to LpdC and BSA bead phagosomes.   Figure 22. LpdC did not stop recruitment of p47phox to the phagosome membrane Phagosomes were extracted from RAW cells infected with (A) live or killed BCG or (B) LpdC or BSA coated latex beads, stained with rabbit anti-p47phox antibody and FITC-goat anti-rabbit IgG, and analyzed by flow cytometry. The data shown are expressed as average MFI values deducted from 2 independent experiments.     94 4.2.5 Generation of LpdC M.tb Mutant In order to further examine the role of LpdC in M.tb virulence, we decided to generate a LpdC mutant M.tb strain which could be used to evaluate directly the effects of LpdC on NOX2 assembly. We first attempted to partially knock down LpdC by means of anti-sense strategies, however, the LpdC protein level in M.tb transformed with plasmid expressing LpdC anti-sense mRNA was similar to that observed in control strains. Therefore, we decided to pursue complete replacement of the LpdC gene in M.tb. LpdC was thought to be an essential gene for growth that could be disrupted only if the bacterium was first complemented with plasmid over-expressing LpdC (Venugopal et al., 2011). However, I used an alternative strategy using a specialized transducing mycobacteriophage described in the Material and Methods section to replace LpdC with a hygromycin cassette without prior complementation, showing that LpdC is, in fact, not an essential gene for bacterial growth in vitro. Gene replacement was confirmed by southern blot (Fig. 23A) and western blot (Fig. 23B) analyses. We also prepared ΔLpdCM.tb complemented with integrative plasmid pmv361 carrying M.tb or M. smegmatis (Smeg) LpdC genes. As expected, M.tb complementation restored LpdC expression to normal levels (Fig. 23B) which is consistent with previous studies (Venugopal et al., 2011).   95  Figure 23. Generation and characterization of ΔLpdCM.tb  (A) ΔLpdCM.tb was generated by a hygromycin-gene replacement method that used a specialized transducing mycobacteriophage. Insert shows southern blot verification of LpdC gene replacement: SacI digested genomic DNA samples were separated on agarose gel then transferred onto nylon membrane, denatured, and hybridized with DIG-labelled DNA probe. Expected sizes for Sac I fragments isolated form wild-type (H37Rv) and ΔLpdCM.tb were 1.27 Kb and, 2.25 Kb respectively. (B) Wild-type M.tb, ΔLpdCM.tb and ΔLpdCM.tb transformed with pmv361-TB LpdC or pmv361-Smeg LpdC and wild-type BCG were lysed as described in the Material and Methods section, subjected to SDS-PAGE and western blot with anti-LpdC and anti-CFP10 antibodies, and visualized by ECL. Expected LpdC and CFP10 sizes were 49 kDa and 10 kDa respectively.   4.2.6 LpdC is Important for M.tb’s Growth and its Survival in Macrophages To characterize the phenotype of ΔLpdCM.tb, we grew it along with wild-type M.tb and ΔLpdCM.tb complemented strains in standard media (7H9GT 10% OADC) at 37°C either in standing flasks (Fig. 24A) or in rolling tubes (Fig. 24B). In both conditions, ΔLpdCM.tb showed a significant decrease of growth rate compared to wild-type M.tb. However rolling culture   96 showed a greater reduction (~ 90%) in ΔLpdCM.tb growth and this could be explained by LpdC’s primary role in M.tb metabolism. In fact, LpdC participates in the PDH complex that converted pyruvate into acetyl-CoA, leading to the TCA cycle, which is dependent on the presence of oxygen. So, in rolling culture, with abundant oxygenation, pyruvate was constantly being generated, leading to the need for LpdC’s functions. Therefore, without LpdC, growth was attenuated. On the other hand, with the lack of oxygen in standing culture, M.tb possibly switched to an anaerobic respiration pathway; thus, LpdC’s absence was not as crucial as in an oxygenated environment, leading to higher growth. As expected, complementation with either M.tb or Smeg LpdC restored the growth to levels comparable to that of wild-type M.tb. Our findings are consistent with previous work showing that M.tb mutant without LpdC has attenuated growth compared to wild-type M.tb (Venugopal et al., 2011).    97  Figure 24. Growth curves of ΔLpdCM.tb in standing and rolling culture  H37Rv, ΔLpdCM.tb and ΔLpdCM.tb complemented strains were grown in complete 7H9 media with appropriate antibiotics at 37°C in (A) standing culture and (B) rolling culture. The results are expressed as growth curves, i.e. absorbance at 600nm as a function of time. Results shown are mean ± SEM of OD600 deducted from 3 independent experiments.   Next, we assessed the role of LpdC in M.tb ability to survive and persist intracellularly. In brief, RAW macrophages were infected with H37Rv, ΔLpdCM.tb and ΔLpdCM.tb complemented strains. At 2, 24, 48, 72 hour post-infection, cells were washed and lysed in 0.025% SDS, and serial dilutions of recovered bacteria were then plated. CFU counts were   98 performed after 4-week incubation at 37°C. At 72 hour post-infection, ΔLpdCM.tb showed significantly decreased intracellular survival rates (33 ± 33CFU/ml) compared to wild-type M.tb (6.6 x104 ± 4.2 x102 CFU/ml) (Fig. 25). Complementing ΔLpdCM.tb with M.tb LpdC gene rescued this effect. However, although complementation with Smeg LpdC restored growth, it did not restore intracellular survival, consistent with our observations that recombinant Smeg LpdC was unable to retain COR1A on the phagosomal membrane and did not block fusion with lysosomes (Fig. 15B) and also consistent with the earlier observation that non-pathogenic mycobacteria do not survive in macrophages (Via et al., 1998). Other M.tb mutants such as ΔptpA M.tb (Wong et al., 2011) and ΔSapM M.tb (Puri et al., 2013) also shows decreased survival rate compared to wild-type M.tb, which suggests that M.tb LpdC along with ptpA and SapM are important for M.tb intracellular survival.   Figure 25. ΔLpdCM.tb had decreased intracellular survival  RAW macrophages were infected with H37Rv, ΔLpdCM.tb and ΔLpdCM.tb complemented strains (MOI of 10:1). At 2, 24, 48, 72 hours post-infection, cells were washed and lysed in 0.025% SDS. Serial dilutions of recovered bacteria were then plated on complete 7H10 media. CFU counts were performed after 4-week incubation at 37°C. Results shown are mean CFU/ml ± SEM from 3 independent experiments.    99 4.2.7 ΔLpdCM.tb Fails to Block Phagosome Maturation With the availability of M.tb lacking LpdC, I wanted to see to what extent LpdC contributed to phagosome maturation arrest. Macrophages were loaded with Texas red-dextran to label lysosomes and then infected for 4 hours with wild-type M.tb, ΔLpdCM.tb and the complemented strains and then subjected to confocal microscopy. Wild-type M.tb as well ΔLpdCM.tb::MtbLpdC excluded red fluorescent signal from their phagosomes, indicative of phagolysosome fusion arrest, and this was expected (Fig. 26). In contrast, phagosomes containing either ΔLpdCM.tb or ΔLpdCM.tb::SmegLpdC were able to fuse with dextran-loaded phagosomes, suggestive of successful phagolysosome fusion.   Figure 26. Phagosomes containing ΔLpdCM.tb mycobacteria fused with lysosomes   100 Adherent RAW macrophages were loaded with TexasRed-dextran to label lysosomes (red fluorescence) then exposed to the indicated bacteria (labeled to express green fluorescence). At 4 hours post-phagocytosis, cells were fixed and examined by digital confocal microscopy. Results shown are representative of 3 independent experiments.  On the other hand, phagosomes containing wild-type M.tb and ΔLpdCM.tb::M.tbLpdC retained COR1A on their surfaces, and ΔLpdCM.tb and ΔLpdCM.tb::SmegLpdC phagosomes excluded COR1A (Fig. 27), consistent with the phagolysosome fusion data and data collected from studies with LpdC coated beads (Fig. 15B). Taken together, these data clearly demonstrated that LpdC contributed significantly to the arrest of phagosome maturation and intracellular survival of pathogenic M.tb. They also confirmed preliminary data obtained earlier with surrogate pathogen BCG (Deghmane et al. 2007).    101  Figure 27. Phagosomes containing ΔLpdCM.tb mycobacteria did not retain COR1A on their surface  Adherent RAW cells were infected with the indicated fluorescent bacteria and at 4 hours post-phagocytosis. The cells were fixed/permeabilized and stained for COR1A. Confocal microscopy results shown are representative of 3 independent experiments.    102 4.2.8 P47phox Recruitment to ΔLpdCM.tb Phagosome and ROS Production With a well-characterized ΔLpdCM.tb strain in hand, I decided to re-examine whether LpdC interferes with phagosomal recruitment of p47phox and if so, whether it also interferes with ROS production.  Macrophages were infected with ΔLpdCM.tb and complemented M.tb strains and examined for phagosomal levels of p47phox by confocal microscopy and FACS analyses. Confocal images (Fig. 28A) showed that phagosomes were normally recruiting p47phox regardless of the M.tb strain (wild-type M.tb, ΔLpdCM.tb , ΔLpdCM.tb::M.tbLpdC and ΔLpdC M.tb::SmegLpdC) used to infect macrophages. Similarly, quantitative analyses of isolated phagosomes by FACS showed no significant differences in the level of p47phox on phagosomes containing M.tb strains tested (Fig. 28B). These observations were consistent with data obtained with phagosomes containing BCG and LpdC coated latex beads (Fig. 21 and 22) and suggested that LpdC binding to PI3,4P2 observed in cell-free systems (Fig. 18) does not translate into a capacity to prevent phagosomal recruitment of p47phox. One explanation for these findings is that LpdC does not occupy all PI3,4P2 molecules on the phagosome membrane, leaving a sufficient number of molecules for p47phox recruitment. Alternatively, p47phox might have a higher binding affinity to PI3,4P2 and therefore cannot be displaced by LpdC.    103    104 Figure 28. ΔLpdCM.tb continued to recruit p47phox to its phagosomal membrane  (A) RAW cells were infected with H37Rv, ΔLpdCM.tb and ΔLpdCM.tb complemented strains for 2 hours at 37°C then stained with rabbit anti-p47phox antibody. Samples were mounted on microscope slides and analyzed by digital confocal microscopy. Green signal indicates the position of bacteria and red signal reflects the localization of p47phox on phagosome membranes. Results shown are representative of 3 independent experiments. (B) Phagosomes were extracted from RAW cells infected with H37Rv, ΔLpdCM.tb and ΔLpdCM.tb complemented strains for 2 hours at 37°C then stained with p47phox antibody and analyzed by flow cytometry. The data shown are expressed as average MFI values deducted from 2 independent experiments.  The finding that LpdC did not interfere with phagosomal recruitment of p47phox suggested that it would not interfere with NOX2-dependent ROS production either. To verify this assumption, we examined ROS production in infected macrophages using luminol-dependent chemiluminescence (CL), which detected the NADPH products superoxide, hydrogen peroxide, and hydroxyl radical (Kim et al., 2004). Results of time-course production of CL over a period of ~ 45 min showed that macrophages exposed to wild-type M.tb clearly produced much more ROS than macrophages exposed to ΔLpdCM.tb (Fig. 29). On the other hand, we found that complementation of ΔLpdCM.tb with either M.tb or Smeg LpdC restored their capacity to induce ROS production only partially, relative to wild-type M.tb. Therefore, it appeared that LpdC did not interfere with NOX-2 assembly and function but rather promoted NOX-2 dependent production of ROS, despite its critical role in phagosome maturation arrest and M.tb intracellular survival. I will provide some possible explanations to these unexpected and interesting observations in the discussion section.    105  Figure 29. M.tb LpdC induced oxidative burst RAW cells were seeded on 96 well plates with DMEM without phenol red then exposed to indicated bacterial strains or zymosan (positive control). Luminol was added, and chemiluminescence was immediately recorded as function of time for 45 min. Results shown are representative of 3 independent experiments.   4.3 Hypothesis 2: LpdC Retains COR1A on the Phagosome Membrane via Interference with PLC Mediated Hydrolysis of PI4,5P2. While investigating whether LpdC-COR1A retention was dependent on cholesterol, which we showed was not the case, we came across a new model of COR1A dissociation from the internal surface of cell membrane in T cells (Tsujita et al., 2010). According to this model (Fig. 30A), COR1A is anchored to the cytosolic face of the cell membrane by PI4,5P2, and upon appropriate cell stimulation, PLCγ1 gets activated and hydrolyses PI4,5P2, leading to COR1A release from the cell membrane. Consistent with this model, other studies have shown that PLCγ1 is physically associated with COR1A allowing for adequate positioning of PLC for COR1A release via PI4,5P2 hydrolysis. Based upon these findings, I decided to investigate whether abnormal retention of COR1A on cell membrane-derived phagosome was due to LpdC   106 interference with PLCγ1-dependent hydrolysis of PI4,5P2. Specifically, I hypothesized that during mycobacterial infection, LpdC either disrupts PLCγ1-COR1A association or inhibits PLC activation, thereby causing abnormal retention of COR1A on the phagosomal membrane (Fig. 30B).    107 Figure 30. Model of abnormal retention of COR1A by LpdC  (A) Current model of spatial and temporal regulation of COR1A suggests that macrophage stimulation activates PLC which hydrolyzes PI4,5P2 leading to COR1A detachment from the phagosome membrane. Image reprinted and adapted with permission from American Society for Biochemistry and Molecular Biology (Tsujita et al., 2010). (B) We hypothesize that following M.tb phagocytosis, secreted LpdC crosses phagosome membrane and binds to COR1A. This binding blocks PLC activation and/or interaction with COR1A leading to COR1A retention on the phagosome membrane.  4.3.1 Subcellular Localization of PLC in Infected Macrophage Since PLCγ1 accumulates in the cytosol and translocates to the cell membrane upon cell activation (Fukami, Inanobe, Kanemaru, & Nakamura, 2010), we hypothesized that secreted LpdC binding to COR1A in infected macrophages would block COR1A-dependent membrane recruitment of PLCγ1. First, I examined PLCγ1 distribution in infected macrophages but was unable to detect it either by intracellular staining or western blotting. Thereafter, I realized that while the PLCγ1 isoform was abundant in T cells, its expression was very low in macrophages, which predominately expressed the PLCγ2 isoform (Sundler, 2002). We then focused on PLCγ2 isoform, assuming that it would promote COR1A release in macrophages. We examined whether PLCγ2 and COR1A interacted physically in RAW cells by pull down assays with PLCγ2 antibody and showed for the first time that PLCγ2 isoform bound to COR1A in macrophages. Thus, membrane recruitment of PLCγ2, via binding to COR1A, and its subsequent activation is also likely regulating macrophage Ca2+ homeostasis as the by-product of PI4,5P2 hydrolysis, IP3, induces Ca2+ release from intracellular stores (Mueller et al., 2008) After showing that PLCγ2 binding to COR1A occurred in macrophages, we infected RAW cells with wild-type BCG and proceeded with PLCγ2 and COR1A intracellular staining   108 and confocal analyses. Unexpectedly, we found COR1A surrounding BCG phagosomes remains associated with PLCγ2 (Fig. 31). While these data suggest that LpdC does not affect PLCγ2 translocation to phagosomal membrane, we cannot exclude the possibility of its interference with PLCγ2 binding to COR1A.    Figure 31. Phagosomes containing BCG showed subcellular localization of PLC and COR1A during BCG infection RAW macrophages were infected with DAPI-labeled BCG (blue fluorescence) and at 2 hours post-phagocytosis, cells were fixed/permeabilized and double stained with COR1A (red) and PLC (green) antibodies. Cells were then examined by digital confocal microscopy.   4.3.2 LpdC Effects on PLCγ2-COR1A Interactions and PLCγ2 Activation To verify whether LpdC interferes with PLCγ2 binding to COR1A, we infected macrophages with live (LpdC-secreting) and killed (non-secreting, control) BCG and performed pull-down assays with lysates from infected macrophages and PLCγ2 antibody as described in the Material and Methods section. As expected IP results showed an association between COR1A and PLCγ2 in the positive control (LPS-stimulated cells) (Fig. 32). COR1A-PLCγ2 association was also seen to some extent in untreated cells. However, no apparent effect on   109 COR1A-PLCγ2 interaction was seen in cells infected with live or killed BCG, suggesting that LpdC does not interfere with COR1A-mediated membrane recruitment of PLCγ2.    Figure 32. PLCγ2-COR1A interaction was not affected by infection with live or killed BCG RAW cells were activated with LPS (positive control) or infected with live or killed BCG for 2 hours. Cells were then lysed, and the interaction of PLC and COR1A was determined by immunoprecipitation as described in the Material and Methods section. Total PLC was probed to show equal protein loading between lanes. Arrow indicates position of COR1A, which shows physical interaction of PLCγ2 with COR1A. Western blot image shown is a representative of 4 independent experiments.   The data shown above suggested that if LpdC inhibits PLCγ2-mediated COR1A release, it might do so via inhibition of PLCγ2 activation (phosphorylation), which is required for PI4,5P2 hydrolysis. To verify this hypothesis, macrophages were infected with live or killed BCG, and lysates were prepared and subjected to SDS-PAGE and western blotting with anti-  110 phospho-PLCγ2 antibody as described in the Material and Methods section. Results obtained (Fig. 33) showed that the level of PLCγ2 phosphorylation in cells infected with live BCG was similar to that detected in control cells infected with killed BCG or stimulated with LPS, indicating that LpdC does not affect PLCγ2 activation.    Figure 33. BCG infection did not affect PLCγ2 activation  RAW cells alone, activated by LPS, or infected by live or dead BCG were lysed according to the Material and Methods section. Lysates were run on 8% gel and probed with antibody to P-PLCγ2 Ab. Results shown are representative of 4 independent experiments.   4.3.3 LpdC and Calcium Signaling Since LpdC did not affect PLCγ2 interaction with COR1A or its activation, we hypothesized that LpdC retained COR1A on the phagosome surface by somehow inhibiting PLCγ2 mediated PI4,5P2 hydrolysis. In this case, LpdC would indirectly disrupt the generation of inositol triphosphate (IP3) and diacylglycerol (DAG). IP3 is a small soluble molecule that diffuses through cytoplasm, bind to the ER and induce the Ca2+ release into the cytosol (Fukami   111 et al., 2010; Patterson et al., 2002). The rise of intracellular Ca2+ (iCa2+) initiates a cascade of signalling events associated with phagosome maturation. In fact, Ca2+ increase activates a calmodulin (CAM)-calmodulin kinase II (CamKII)-VPS34 pathway that leads to phagosomal recruitment of maturation effector EEA1 (Kusner, 2005). M.tb and BCG have both been shown to inhibit the CAM-CaMKII-VPS34 pathway by blocking Ca2+ release from the ER stores (Liu, Stenger, Tang, & Modlin, 2007; Thompson et al., 2005). Since LpdC-mediated abnormal retention of COR1A is also associated with phagosome maturation arrest, there is an opportunity here to establish a link between a possible LpdC inhibition of PLCγ2 mediated IP3 production through PI4,5P2 hydrolysis and the blocking of IP3-dependent Ca2+ release from ER stores. Since it was nearly impossible to measure IP3 levels in cell extracts, I decided to examine the level of iCa2+ as an indirect evaluation of PLCγ2 mediated IP3 production. For this purpose, we chose the monocytic THP.1 cell line for its non-adherent property, as RAW cells required lifting and did not respond well to our positive control, ionomycin. THP.1 cells were loaded with Fluo4-AM dye, which exhibited fluorescence increase upon binding to Ca2+. Cell fluorescence was measured by flow cytometry for 30 seconds to establish baseline levels of iCa2+ prior to activation with either ionomycin or protein coated beads. iCa2+ increase was then measured continuously for an additional 5 min. If LpdC interfered with PI4,5P2 hydrolysis, we would see an absence of iCa2+ increase in cells ingesting LpdC-beads relative to those ingesting BSA-beads. Calcium profiles deduced from FACS analyses (Fig. 34A) showed that cells induced with ionomycin achieved a high iCa2+ increase. They also showed a moderate increase of iCa2+ in response to ingestion of BSA-beads. However, and unexpectedly, iCa2+ level was not reduced in cells ingesting LpdC-beads relative to those ingesting BSA-beads (Fig. 34B). Measurements of iCa2+ were repeated using a fluorescence microplate reader that offered several advantages over   112 flow cytometry. It had the ability to read multiple samples in one 96 well plate at the optimal 37°C temperature. Multiple reads of the samples could also be done allowing for statistically accurate data. Results obtained with this method yielded similar iCa2+ measurements to those obtained by flow cytometry (Fig. 34C). We therefore cannot conclude that the mechanism of LpdC-COR1A retention is related to LpdC interference with PLC hydrolysis of PI4,5P2.     113  Figure 34. Intracellular Ca2+ response to the presence of LpdC  THP.1 cells were loaded with Fluo4-AM and Ca2+ production (fluorescence signal) was recorded in real-time by (A) and (B) flow cytometry or (C) fluorescence microplate reader for 5~10 minutes after the addition of ionomycin   114 (positive control) or protein coated beads (indicated by position of arrow). Results shown are representative of 4 independent experiments.   4.4 Discussion We have characterized LpdC and investigated its role in M.tb pathogenesis, specifically in retaining COR1A on the phagosome, which leads to its maturation arrest and intracellular survival of M.tb. Understanding the mechanism of COR1A-LpdC interaction is therefore highly relevant to understanding the molecular basis of TB pathogenesis.   4.4.1 LpdC, PIPs and ROS Production We examined whether LpdC interacted with COR1A and retained it on the surface by forming a bridge with cholesterol. However, instead of binding to cholesterol, we found that LpdC bound to various PIPs. PIPs is a collective term for phosphorylated derivatives of phosphatidylinositol (PI) which anchor themselves to the cytoplasmic side of membranes and recruit specific downstream effector proteins (Yeung et al., 2006). They also regulate different vesicular trafficking pathways, and pathogenic bacteria employ different strategies to interfere with the host PI metabolism. For example, Legionella pneumophila produces PI binding proteins that use PIs as membrane anchors (Weber, Ragaz, Reus, Nyfeler, & Hilbi, 2006), and Shigela flexneri produces PI metabolizing enzymes that directly modulate host cell PI levels (Niebuhr et al., 2002). Since LpdC also binds to PIs, it is possible that it hijacks host PIPs, allowing M.tb to take advantage of subsequent dysfunctional signalling in the macrophage. Analysis of LpdC amino acid sequence did not reveal any known lipid-binding site to PIPs (such as PH, PX, and FYVE domains), so   115 LpdC could be interacting with PIPs through novel binding sites, which could be potential drug targets.   Further investigations on LpdC binding affinity to various PIPs revealed a strong binding to PI3,4P2, an important docking molecule for the recruitment of NOX2 subunit p47phox to the phagosomal membrane. We therefore investigated whether LpdC disrupted NOX2 assembly and activation through competitive inhibition of p47phox binding to PI3,4P2. Detailed investigation of this hypothesis showed that LpdC did not affect p47phox recruitment to the phagosome membrane and rather induced macrophage ROS response to mycobacterial infection. Other than the explanations that p47phox had a higher binding affinity to PI3,4P2 than LpdC or that LpdC did not occupy all PI3,4P2 molecules on the phagosomal membrane, another possibility was the timing of NOX2 assembly and activation vs LpdC secretion. NOX2 assembly/activation started upon phagosome closure, and LpdC secretion and trafficking towards the other side of the phagosomal membrane could be reaching its maximum while ROS production had already occurred.    Increased ROS production in response to wild-type M.tb relative to the mutant lacking LpdC was a puzzling observation but consistent with a previous report (Cirillo et al., 2009) showing that mouse alveolar macrophages produced substantial levels of ROS in response to M.tb. These observations should be viewed within the context of ROS’s controversial role in anti-microbial defenses. Some studies showed that ROS production was a central defense mechanism against M.tb, while others argued that ROS had a limited role in controlling M.tb infection. For instance, it had been shown that there was no direct killing effect for induced ROS   116 in M.tb-infected neutrophils, while neutrophils and macrophages from CGD (chronic granulomatous disease) patients who lacked ROS production capabilities were more susceptible to mycobacterial infection (Fazal, 1997). Furthermore, other studies showed that macrophages lacking active NOX2 failed to restrict intracellular growth of M.tb (L. B. Adams, Dinauer, Morgenstern, & Krahenbuhl, 1997; Cooper et al., 2000), but another study found no difference in M.tb persistence between wild-type and NOX2 deficient mice (Jung, LaCourse, Ryan, & North, 2002). Recently, it has been suggested that ROS might not be effective for direct mycobacterial killing but instead initiate important signalling pathways leading to production of TNF-α and IFN-γ, induction of autophagy or apoptosis, and granuloma formation (Deffert, Cachat, & Krause, 2014). Overall, it appears that ROS contributes very little to bacterial killing which, at least in part, is attributed to M.tb strategies to detoxify ROS through a variety of antioxidant mechanisms, such as superoxide dismutase (SOD) SodA and SodC, and catalase-peroxidases KatG. These M.tb effectors deactivate ROS by converting hydrogen peroxide to water and oxygen (Kumar et al., 2011). M.tb can also produce and use mycothiols to detoxify ROS (Kumar et al., 2011). Defects in these mycobacterial anti-oxidant proteins lead to higher susceptibility of M.tb to ROS (Ng, Cox, Sousa, MacMicking, & McKinney, 2004; Piddington et al., 2001; Rawat et al., 2002). While ROS may not control directly mycobacterial persistence, they may induce stress, leading to a phenotype of M.tb dormancy until favourable conditions arise.   Another possibility for our observation of higher macrophage ROS production in response to wild-type M.tb, relative to infection with DLpdC M.tb, is that macrophages use LpdC to boost ROS production not only to neutralize M.tb but also to initiate signalling leading to apoptosis, which helps contain the bacterium and initiate antigen cross-presentation to CD8+ T   117 cells (Simon, 2000; Winau et al., 2006). In this regard, generating ROS and also NOS at high concentrations is currently regarded as a potential therapy for TB (Bald & Koul, 2015). Thus, recombinant LpdC can be proposed as a ROS inducer and immunostimulant to supplement vaccines.   4.4.2 LpdC, Virulence, Drug Target Potential LpdC is an important mycobacterial protein that participates in at least three different M.tb pathways for metabolism and plays a role in activating antioxidant defenses (Venugopal et al., 2011). LpdC also plays important roles in phagosome maturation arrest (Deghmane et al., 2007); however, whether LpdC is a virulence factor and whether it is suitable for drug targeting requires further investigation. Virulence factors are widely defined as molecules that enable the pathogen to infect, persist, and establish an infection in its host. There are no exact guidelines or criteria for how a gene is considered to be a virulence factor. One common strategy currently used to define a virulence factor is testing whether disruption of the corresponding gene attenuates the organism to some extent in vitro and in vivo; however, there are housekeeping genes that may be essential for M.tb survival but have no effect on virulence. Therefore, I am not only evaluating LpdC in growth and survival but also in the context of its role in pathogenicity/virulence specifically in its disruption of the phagosome maturation pathway. Drug targets, as we have previously defined, are mostly protein/nucleic acid within a living organism that when bound to a specific chemical (drug) lose their function/effects. I evaluated LpdC’s drug target potential by looking at whether knocking out the gene attenuates M.tb growth, survival and virulence and whether a specific drug/chemical has been found to be able to interfere with LpdC’s function.    118  While I was able to generate LpdC knockout M.tb and showed that it is not an essential gene for growth per se, I also demonstrated that LpdC is essential for reducing bacterial growth by 90% and reducing survival of bacteria inside macrophages, which are phenotypes consistent with Venugopal’s group’s LpdC mutant. Meanwhile, the subcellular mechanisms of its contribution to virulence were still open for investigation. Interestingly, Venugopal’s group showed, that ΔLpdCM.tb was more attenuated than DlaT mutant M.tb (component of PNR/P and PDH systems) and PdhC mutant M.tb (component of BCKADH complex), which suggested that LpdC might exert other functions contributing to M.tb’s virulence. I believe this could be LpdC’s role in phagosome maturation involving COR1A retention. Preliminary studies in our lab (Deghmane et al., 2007) showed that complementation of the non-pathogenic M. smegmatis with M.tb LpdC led to a recombinant bacterium that induced abnormal phagosomal retention of COR1A and survived better within macrophages. In my work, I took advantage of my DLpdC M.tb strain to demonstrate clearly LpdC’s role in phagosome maturation arrest and intracellular persistence. DLpdC M.tb had a much lower survival rate inside macrophages and induced much higher phagolysosome fusion compared to wild-type M.tb. In particular, I demonstrated the uniqueness of M.tb LpdC compared to LpdC from M. smegmatis. In fact, while DLpdC M.tb complementation with Smeg LpdC allowed the bacterium to resume normal growth in culture media, the rescued bacterium was unable to retain COR1A on its phagosome surface. Also, Smeg LpdC complemented DLpdC M.tb had a significantly lower survival rate inside macrophages compared to mutant complemented with M.tb LpdC, which showed that M.tb LpdC but not M. smeg LpdC was important in M.tb virulence. Another interesting fact is that mutant DLpdC M.tb along with several other mycobacterial knockdown/knockout strains (such as NDK   119 AS BCG (Sun et al., 2013) and DSapM M.tb (Puri, Reddy, & Tyagi, 2013)), all exhibited similar phenotypes of attenuated survival in macrophages and increases in phagolysosome fusion. It is therefore possible that phagolysosome fusion could be influenced by bacterial growth, with higher bacterial survival/growth inside macrophages be linked to a block in phagolysosome fusion.   The fact that there is a human Lpd homolog, which has pro-oxidant roles (Vaubel, Rustin, & Isaya, 2011), does not make mycobacterial LpdC an unfavourable drug target. Indeed, mycobacterial LpdC bears only 36% similarity to human Lpd, allowing for the design of compound inhibitors specific to mycobacterial LpdC. Thus, high throughput screening permitted the design of two highly specific inhibitors to Lpd’s NAD+ dependent reduction of lipoamide to dihydrolipoamide, triazaspirodimethoxybenzyols (Ruslana Bryk et al., 2010) and Sulfonamide SL827 (Ruslana Bryk et al., 2013). Both compounds are potent inhibitors, highly selective for M.tb LpdC. Unfortunately, these inhibitors had no detectable effect on the intracellular growth of M.tb. Thus, new drug designs need to take into consideration a better understanding of LpdC interaction with host cell effectors. Finding specific domains in LpdC such as its domain of interaction with COR1A and PIPs would also be helpful for specific drug design to interfere with its macrophage attenuation functions and not just housekeeping functions. Therefore, with LpdC’s multiple important roles in M.tb metabolism and macrophage function attenuation, we propose LpdC as a strong candidate virulence factor and with further investigation, a potential novel drug target.     120 4.4.3 LpdC, COR1A and Ca2+ While investigating the second hypothesis that COR1A is retained on the phagosome membrane through LpdC’s interference with PLC mediate hydrolysis, I measured the downstream effector Ca2+ with the expectation that the presence of LpdC should stop intracellular increase of Ca2+. We were unable to see a difference in intracellular Ca2+ increase with LpdC protein compared to control (BSA protein); however, I found controversies on the importance of Ca2+ in TB infection in the literature.    It is known that Ca2+ is an important regulator of signalling pathways and plays significant roles in M.tb pathogenesis. Kusner’s group found that macrophage infection with live M.tb blocks iCa2+ elevation, which leads to inhibition of sphingosine kinase (SK) and Ca2+/calmodulin dependent protein kinase II (CaMKII) (Kusner, 2005b; Malik, Denning, & Kusner, 2000 and Fig. 35). In contrast, infection with killed M.tb activates SK, which translocates from the cytosol to the phagosome membrane and phosphorylates sphingosine into sphingosine-1-phosphate (S1P), leading to Ca2+ release from the ER (Fig. 35A). Cytosolic Ca2+ binds to calmodulin and results in the translocation of Ca2+-camodulin complex from the cytosol to the phagosome membrane, which then activates CamKII. Active CamKII recruits and activates class III PI3K vps34 that catalyzes the formation of PI3P on phagosomes, which then recruit EEA1 and promote fusion with lysosome. Live M.tb inhibits activation of SK, stops cytosolic Ca2+ elevation, and consequently inhibits phagosome maturation (Fig. 35B).   121  Figure 35. Model of M.tb inhibition of macrophage phagosome maturation by inhibiting Ca2+ increase and activation of sphingosine kinase  (A) Live M.tb inhibits stimulation and activation of sphingosine kinase (SK) which normally would catalyze the phosphorylation of sphingosine-1-phosphate (S1P) that induces intracellular release of Ca2+ from the ER. The lack of Ca2+ increase inhibits phagosome-lysosome fusion.  (B) Intracellular Ca2+ increase is followed by Ca2+ binding to calmodulin (CaM). Ca2+-CaM complex translocates to phagosomal membrane where it phosphorylates and activates calmodulin kinase II (CaMKII) which then recruits PI3kinase hVPS34 resulting in PI3P production. EEA1 binds to PI3P, which is important in promoting phagolysosome fusion. Live M.tb blocks Ca2+ production leading to   122 phagosome maturation arrest and intracellular survival within macrophages. Image reprinted with permission from Elsevier; Clinical Immunology. (Kusner, 2005)  COR1A has been linked to the calcium modulation model with studies showing that COR1A-dependent membrane recruitment and activation of PLC leads to PI4,5P2 hydrolysis into DAG and IP3 and then IP3-dependent iCa2+ elevation (Tsujita et al., 2010, Mueller et al., 2010 and Fig. 36A). Within this expanded model, Pieters’ group introduced, for the first time, Ca2+ dependent calcineurin and showed an opposite effect of mycobacterial infection with regards to iCa2+ modulation. These authors found that iCa2+ actually increased in response to infection with live BCG, and suggested that BCG blocked phagosome maturation by mechanisms dependent on COR1A sequestration of calcineurin, which normally promoted phagolysosme fusion (Pieters, Müller, & Jayachandran, 2013 and Fig. 36B). However, the mechanism of COR1A recruitment and the mechanism of calcineuin prevention of lysosomal delivery of mycobacteria are still unknown. Therefore, the contribution of iCa2+ in macrophage response to M.tb infection is still unclear and needs to be further investigated. A possible reason for these discrepancies about the role of iCa2+ could be the different strains of organisms used in these studies. Pieters’s group used BCG as the model organism, and Kusner’s group used M.tb.    123  Figure 36. Model of M.tb inhibition of macrophage phagosome maturation by Ca2+ and role of COR1A  (A) COR1A is required for Ca2+ signaling in T cells. (B) Live M.tb infection recruits and retains COR1A on the phagosome membrane, which activates Ca2+ dependent phosphatase calcineurin. Activated calcineurin blocks phagolysosome fusion by unknown mechanisms. Image reprinted and adapted with permission from Nature Publishing Group; Nature Reviews Immunology (Pieters et al., 2013).    124  In my study, macrophage infection with live or killed BCG did not affect recruitment or activation of PLC, while LpdC and COR1A formed a physical complex that remained attached to the phagosomal membrane. This suggested that LpdC did not interfere with PLC mediated release of COR1A from PI4,5P2. Thus, phagocytosis of mycobacterium could induce normal recruitment and activation of PLC on the phagosome membrane, releasing COR1A from PI4,5P2 and increasing iCa2+ while COR1A-LpdC complex remained attached to the phagosome via LpdC interaction with free PI4,5P2 (Fig. 37).   Figure 37. Revised model of abnormal retention of COR1A by LpdC  Phagocytosis of mycobacterium induces normal recruitment of PLC to the membrane, releasing COR1A from PI4,5P2 and increasing Ca2+; however, the simultaneous binding of LpdC to PI4,5P2 and COR1A maintains COR1A attachment to the phagosomal membrane.      125 4.4.4 Summary In my thesis, I built upon our lab’s preliminary data generated with surrogate organism BCG on mycobacterial LpdC’s role in mycobacterial persistence in host macrophages (Deghmane et al., 2007). I generated recombinant LpdC protein and LpdC mutant M.tb, and with these invaluable tools, I confirmed LpdC’s role in COR1A retention and phagosome maturation arrest, characterized its importance in M.tb growth and survival, found its binding to PIPs in vitro which could be involved in TB pathogenesis, and investigated possible mechanisms for LpdC-COR1A retention. LpdC binding to PIPs in cell free systems did not translate into blocking p47phox recruitment or ROS production; this is not to say its binding to PIPs is not important, but that observations in cell free system are not always a mirror image of in vivo scenarios. My study contributes to the field of TB not only in characterizing LpdC and phagosome maturation, but also in characterizing host-pathogen interactions with the observation that M.tb unexpectedly induces ROS production and that PLCγ2 and COR1A physically interact in macrophages. To the best of my knowledge, this interaction has never been shown before. Therefore, LpdC is an important candidate virulence factor, and further work is required to fully understand this intriguing protein.    126 Chapter 5: Final Conclusion and Future Directions  M.tb is a successful and complex pathogen that utilizes many strategies to survive and persist in its host. Efforts to eradicate the TB disease have had limited success even with major advances in the knowledge of the pathogen and the disease and increased interest in improving preventive and therapeutic approaches. TB now ranks alongside HIV as the leading cause of death world-wide (Lewandowski, 2015). Therefore, a better understanding of the basics of TB pathogenesis is still needed to pave the road for the development of convincing vaccines and drugs. As a PhD student, I wanted to learn more about TB pathogenesis and contribute as much as I can to the field of TB control strategies.    My contribution to vaccine development has culminated in the introduction of a novel non-genetic bacterial surface decoration system that can not only facilitate improvement of the current vaccine BCG but also be used to screen relatively rapidly virtually any potential antigen or immunostimulant hard to express genetically in BCG.  Some future directions include introducing other immunodominant antigens such as TB10.4 and VAPB47 in fusion with monomeric avidin then surface-displayed on BCG, and varying the concentration of recombinant avidin fusion proteins to allow simultaneous display of several antigens of interest to induce optimal host immune response against TB and to maximize the effectiveness of vaccine. Ultimately, protective efficacy studies using different forms of modified BCG preparations shall be developed to highlight the advantages of non-genetic upgrading of the current BCG vaccine.    127   My interest in novel drug targets has directed me towards the study of a very intriguing and challenging mycobacterial protein, LpdC. I have been able to further characterize LpdC interaction with host macrophage effectors during M.tb infection, especially in the context of phagosome maturation and intracellular persistence. I have provided significant insight into M.tb molecular mechanism of persistence with regard to this protein and added to the knowledge of this multi-functional protein role in TB pathogenesis. The complete elucidation of the mechanisms underlying LpdC mediated M.tb virulence will perhaps lead to efficient therapeutics for TB disease.  In this context, future studies towards elucidating mechanisms of LpdC-COR1A retention on phagosome membrane, in particular identifying key domains in LpdC involved in binding to COR1A or PIPs, may lead to the proposal of potential drug targets. Also, the significance of LpdC binding to PIPs can be further investigated as it has the potential to affect many cell signalling pathways regulating critical macrophage functions. To uncover gene expression networks possibly altered by LpdC, gene microarrays can be done to produce detailed analyses of transcript profiles and to identify genes and pathways that are modulated when this virulence factor traffics within macrophages. This could reveal further important deactivating mechanisms of LpdC.   Generating LpdC mutant strains and genetically manipulating mycobacteria have been critical to expand my studies on LpdC. These are difficult processes because there is a very limited number of vectors that fit my purposes, and existing plasmids suffer from a lack of flexibility. Therefore, I have contributed significantly to the development of a mycobacterial gateway cloning system for rapid one-step restriction enzyme-free cloning of mycobacterial and   128 foreign genes and successfully generated BCG expressing DsRed, Luciferase, and GFP (Sun et al., 2009), which have been used throughout this thesis.   Furthermore, while surveying TB literature, I have come across many contradictory studies on important macrophage effectors and functions such as COR1A, ROS production and Ca2+. I have reviewed and critically analyzed these publications along with my results to add new knowledge and contribute to resolving the many discrepancies in the TB field.     129 Bibliography Abel, B., Tameris, M., Mansoor, N., Gelderbloem, S., Hughes, J., Abrahams, D., & Hanekom, W. A. (2010). The novel tuberculosis vaccine, AERAS-402, induces robust and polyfunctional CD4+and CD8+ T cells in adults. American Journal of Respiratory and Critical Care Medicine, 181(12), 1407–1417.  Adams, K. N., Takaki, K., Connolly, L. E., Wiedenhoft, H., Winglee, K., Humbert, O., & Ramakrishnan, L. (2011). Drug tolerance in replicating mycobacteria mediated by a macrophage-induced efflux mechanism. Cell, 145(1), 39–53.  Adams, L. B., Dinauer, M. C., Morgenstern, D. E., & Krahenbuhl, J. L. (1997). Comparison of the roles of reactive oxygen and nitrogen intermediates in the host response to Mycobacterium tuberculosis using transgenic mice. Tubercle and Lung Disease : The Official Journal of the International Union against Tuberculosis and Lung Disease, 78(5-6), 237–246. Aguilo, N., Uranga, S., Marinova, D., Monzon, M., Badiola, J., & Martin, C. (2016). MTBVAC vaccine is safe, immunogenic and confers protective efficacy against Mycobacterium tuberculosis in newborn mice. Tuberculosis, 96, 71–74.  Al-Zarouni, M., & Dale, J. W. (2002). Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis, 82(6), 283–291.  Argyrou, A., & Blanchard, J. S. (2001). Mycobacterium tuberculosis lipoamide dehydrogenase is encoded by Rv0462 and not by the lpdA or lpdB genes. Biochemistry, 40(38), 11353–11363.    130 Bach, H., Papavinasasundaram, K. G., Wong, D., Hmama, Z., & Av-Gay, Y. (2008). Mycobacterium tuberculosis virulence is mediated by PtpA dephosphorylation of human vacuolar protein sorting 33B. Cell Host & Microbe, 3(5), 316–22.  Bald, D., & Koul, A. (2015). The Tuberculosis Drug Discovery and Development Pipeline and Emerging Drug Targets. Cold Spring Harbor Laboratory Press, 1–7.  Bardarov, S., Bardarov Jr, S., Pavelka Jr, M. S., Sambandamurthy, V., Larsen, M., Tufariello, J., & Jacobs Jr, W. R. (2002). Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology (Reading, England), 148(Pt 10), 3007–17. Bastos, R. G., Borsuk, S., Seixas, F. K., & Dellagostin, O. A. (2009). Recombinant Mycobacterium bovis BCG. Vaccine, 27(47), 6495–6503.  Basu, S., & Galvani, A. P. (2008). The transmission and control of XDR TB in South Africa: an operations research and mathematical modelling approach. Epidemiology and Infection, 136(12), 1585–1598.  Behar, S. M. (2013). Antigen-specific CD8(+) T cells and protective immunity to tuberculosis. Advances in Experimental Medicine and Biology, 783, 141–163. Bigini, P., Previdi, S., Casarin, E., Silvestri, D., Violatto, M. B., Facchin, S., & Morpurgo, M. (2014). In vivo fate of avidin-nucleic acid nanoassemblies as multifunctional diagnostic tools. ACS Nano, 8(1), 175–187. Billeskov, R., Vingsbo-Lundberg, C., Andersen, P., & Dietrich, J. (2007). Induction of CD8 T cells against a novel epitope in TB10.4: correlation with mycobacterial virulence and the presence of a functional region of difference-1. Journal of Immunology (Baltimore, Md.: 1950), 179(6), 3973–3981.    131 Billeskov, R., Elvang, T. T., Andersen, P. L., & Dietrich, J. (2012). The HyVac4 subunit vaccine efficiently boosts BCG-primed anti-mycobacterial protective immunity. PloS One, 7(6), e39909.  Briken, V., Porcelli, S. a, Besra, G. S., & Kremer, L. (2004). Mycobacterial lipoarabinomannan and related lipoglycans: from biogenesis to modulation of the immune response. Molecular Microbiology, 53(2), 391–403.  Brosch, R., Gordon, S. V, Garnier, T., Eiglmeier, K., Frigui, W., Valenti, P., & Cole, S. T. (2007). Genome plasticity of BCG and impact on vaccine efficacy. Proceedings of the National Academy of Sciences of the United States of America, 104(13), 5596–5601.  Bryk, R., Arango, N., Maksymiuk, C., Balakrishnan, A., Wu, Y. T., Wong, C. H., & Nathan, C. (2013). Lipoamide channel-binding sulfonamides selectively inhibit mycobacterial lipoamide dehydrogenase. Biochemistry, 52(51), 9375–9384.  Bryk, R., Arango, N., Venugopal, A., Warren, J. D., Park, Y.-H., Patel, M. S., & Nathan, C. (2010). Triazaspirodimethoxybenzoyls as selective inhibitors of mycobacterial lipoamide dehydrogenase . Biochemistry, 49(8), 1616–27.  Bryk, R., Lima, C. D., Erdjument-Bromage, H., Tempst, P., & Nathan, C. (2002). Metabolic enzymes of mycobacteria linked to antioxidant defense by a thioredoxin-like protein. Science, 295(5557), 1073–1077.  Bubb, M. O., Green, F., Conradie, J. D., Tchernyshev, B., Bayer, E. A., & Wilchek, M. (1993). Natural antibodies to avidin in human serum. Immunology Letters, 35(3), 277–280. Chakrabarty, A. M. (1998). Nucleoside diphosphate kinase: role in bacterial growth, virulence, cell signalling and polysaccharide synthesis. Molecular Microbiology, 28(5), 875–882. Chao, J., Wong, D., Zheng, X., Poirier, V., Bach, H., Hmama, Z., & Av-Gay, Y. (2010). Protein   132 kinase and phosphatase signaling in Mycobacterium tuberculosis physiology and pathogenesis. Biochimica et Biophysica Acta - Proteins and Proteomics, 1804(3), 620–627.  Chatterjee, S., Dwivedi, V. P., Singh, Y., Siddiqui, I., Sharma, P., Kaer, L. Van, & Das, G. (2011). Early secreted antigen ESAT-6 of Mycobacterium tuberculosis promotes protective T helper 17 cell responses in a toll-like receptor-2-dependent manner. PLoS Pathogens, 7(11), e1002378. Cirillo, S. L. G., Subbian, S., Chen, B., Weisbrod, T. R., Jr, W. R. J., Cirillo, J. D., & Cirillo, J. D. (2009). Protection of Mycobacterium tuberculosis from reactive oxygen species conferred by the mel2 locus impacts persistence and dissemination. Infection and Immunity, 77(6), 2557–2567.  Colditz, G. A., Brewer, T. F., Berkey, C. S., Wilson, M. E., Burdick, E., Fineberg, H. V, & Mosteller, F. (1994). Efficacy of BCG vaccine in the prevention of tuberculosis. Meta-analysis of the published literature. JAMA, 271(9), 698–702. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., & Barrell, B. G. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 393(6685), 537–544.  Combaluzier, B., & Pieters, J. (2009). Chemotaxis and phagocytosis in neutrophils is independent of coronin 1. Journal of Immunology (Baltimore, Md. : 1950), 182(5), 2745–2752.  Cooper, A. M., Segal, B. H., Frank, A. a, Holland, S. M., Orme, I. M., & Orme, I. a N. M. (2000). Transient Loss of Resistance to Pulmonary Tuberculosis in p47 phox − / − Mice Transient Loss of Resistance to Pulmonary Tuberculosis. Infection and Immunity, 68(3), 1231–1234.    133 Cowley, S., Ko, M., Pick, N., Chow, R., Downing, K. J., Gordhan, B. G., & Av-Gay, Y. (2004). The Mycobacterium tuberculosis protein serine/threonine kinase PknG is linked to cellular glutamate/glutamine levels and is important for growth in vivo. Molecular Microbiology, 52(6), 1691–702.  Cummings, J. F., Guerrero, M. L., Moon, J. E., Waterman, P., Nielsen, R. K., Jefferson, S., & for Molecular Biotechnology Study Group, F. U. S. A. C. (2014). Safety and immunogenicity of a plant-produced recombinant monomer hemagglutinin-based influenza vaccine derived from influenza A (H1N1)pdm09 virus: a Phase 1 dose-escalation study in healthy adults. Vaccine, 32(19), 2251–2259. da Costa, A. C., Nogueira, S. V., Kipnis, A., & Junqueira-Kipnis, A. P. (2014). Recombinant BCG: innovations on an old vaccine. Scope of BCG strains and strategies to improve long-lasting memory. Frontiers in Immunology, 5. de Bruyn, J., Huygen, K., Bosmans, R., Fauville, M., Lippens, R., Van Vooren, J. P., & Harboe, M. (1987). Purification, characterization and identification of a 32 kDa protein antigen of Mycobacterium bovis BCG. Microbial Pathogenesis, 2(5), 351–366.  de Hostos, E. L., Bradtke, B., Lottspeich, F., Guggenheim, R., & Gerisch, G. (1991). Coronin, an actin binding protein of Dictyostelium discoideum localized to cell surface projections, has sequence similarities to G protein beta subunits. EMBO J, 10(13), 4097–4104. Deffert, C., Cachat, J., & Krause, K.-H. (2014). Phagocyte NADPH oxidase, chronic granulomatous disease and mycobacterial infections. Cellular Microbiology, 16(July), 1–27.  Deghmane, A.-E. E., Soulhine, H., Bach, H., Sendide, K., Itoh, S., Tam, A., & Hmama, Z. (2007). Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation. Journal of Cell Science, 120(19), 3489–3489.    134 Demonte, D., Drake, E. J., Lim, K. H., Gulick, A. M., & Park, S. (2013). Structure-based engineering of streptavidin monomer with a reduced biotin dissociation rate. Proteins: Structure, Function and Bioinformatics, 81(9), 1621–1633.  Denis, O., Tanghe, A., Palfliet, K., Jurion, F., van den Berg, T. P., Vanonckelen, A., & Huygen, K. (1998). Vaccination with plasmid DNA encoding mycobacterial antigen 85A stimulates a CD4+ and CD8+ T-cell epitopic repertoire broader than that stimulated by Mycobacterium tuberculosis H37Rv infection. Infection and Immunity, 66(4), 1527–1533. Dowler, S., Kular, G., & Alessi, D. R. (2002). Protein Lipid Overlay Assay. Pharmacia, 2002(April), 1–10.  Dudani, R., Chapdelaine, Y., Faassen, H. H., Smith, D. K., Shen, H., Krishnan, L., & Sad, S. (2002). Multiple mechanisms compensate to enhance tumor-protective CD8(+) T cell response in the long-term despite poor CD8(+) T cell priming initially: comparison between an acute versus a chronic intracellular bacterium expressing a model antigen. Journal of Immunology, 168(11), 5737–5745. English, L., Chemali, M., Duron, J., Rondeau, C., Laplante, A., Gingras, D., & Desjardins, M. (2009). Autophagy enhances the presentation of endogenous viral antigens on MHC class I molecules during HSV-1 infection. Nature Immunology, 10(5), 480–487. Fazal, N. (1997). The role of reactive oxygen species (ROS) in the effector mechanisms of human antimycobacterial immunity. Biochemistry and Molecular Biology International, 43(2), 399–408. Ferrari, G., Langen, H., Naito, M., & Pieters, J. (1999). A coat protein on phagosomes involved in the intracellular survival of mycobacteria. Cell, 97(4), 435–47.  Fine, P. E. (1989). The BCG story: lessons from the past and implications for the future. Reviews   135 of Infectious Diseases, 11 Suppl 2, S353–9. Fine, P. E. (1995). Variation in protection by BCG: implications of and for heterologous immunity. Lancet, 346(8986), 1339–1345. Flannagan, R. S., Cosío, G., & Grinstein, S. (2009). Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nature Reviews. Microbiology, 7(5), 355–66.  Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., & Bloom, B. R. (1993). An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. The Journal of Experimental Medicine, 178(6), 2249–2254. Fogel, N. (2015). Tuberculosis: A disease without boundaries. Tuberculosis, 95(5), 5–9.  Franco-Paredes, C., Rouphael, N., del Rio, C., & Santos-Preciado, J. I. (2006). Vaccination strategies to prevent tuberculosis in the new millennium: from BCG to new vaccine candidates. International Journal of Infectious Diseases : IJID : Official Publication of the International Society for Infectious Diseases, 10(2), 93–102.  Fratti, R. A., Chua, J., Vergne, I., & Deretic, V. (2003). Mycobacterium tuberculosis glycosylated phosphatidylinositol causes phagosome maturation arrest. Proceedings of the National Academy of Sciences of the United States of America, 100(9), 5437–5442. Fukami, K., Inanobe, S., Kanemaru, K., & Nakamura, Y. (2010). Phospholipase C is a key enzyme regulating intracellular calcium and modulating the phosphoinositide balance. Progress in Lipid Research, 49(4), 429–37.  Gatfield, J., & Pieters, J. (2000). Essential Role for Cholesterol in Entry of Mycobacteria into Macrophages. Science, 288(5471), 1647–1651.  Green, N. M. (1990). Avidin and streptavidin. Methods in Enzymology, 184, 51–67. Grode, L., Seiler, P., Baumann, S., Hess, J., Brinkmann, V., Eddine, A. N., & Kaufmann, S. H.   136 (2005). Increased vaccine efficacy against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin. The Journal of Clinical Investigation, 115(9), 2472–2479. Harries, A. D., Zachariah, R., Corbett, E. L., Lawn, S. D., Santos-Filho, E. T., Chimzizi, R., & De Cock, K. M. (2016). The HIV-associated tuberculosis epidemic;when will we act? The Lancet, 375(9729), 1906–1919.  Hart, P. D., Armstrong, J. A., Brown, C. A., & Draper, P. (1972). Ultrastructural study of the behavior of macrophages toward parasitic mycobacteria. Infection and Immunity, 5(5), 803–807. Hestvik, A. L. K., Hmama, Z., & Av-Gay, Y. (2005). Mycobacterial manipulation of the host cell. FEMS Microbiology Reviews, 29(5), 1041–50.  Horwitz, M. A., & Harth, G. (2003). A new vaccine against tuberculosis affords greater survival after challenge than the current vaccine in the guinea pig model of pulmonary tuberculosis. Infection and Immunity, 71(4), 1672–1679. Houde, M., Bertholet, S., Gagnon, E., Brunet, S., Goyette, G., Laplante, A., & Desjardins, M. (2003). Phagosomes are competent organelles for antigen cross-presentation. Nature, 425(6956), 402–406. Howarth, M., Takao, K., Hayashi, Y., & Ting, A. Y. (2005). Targeting quantum dots to surface proteins in living cells with biotin ligase. Proceedings of the National Academy of Sciences of the United States of America, 102(21), 7583–7588. Indesmith, L. I. S. a L., Oe, C. H. M., Arionneau, S. E. M., Uvoen, N. A. R., Iang, X. I. J., Indblad, L. A. L., & Baric, R. (2003). Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nat Med, 9(5), 548–553.    137 Janssen, S., Jayachandran, R., Khathi, L., Zinsstag, J., Grobusch, M. P., & Pieters, J. (2012). Exploring prospects of novel drugs for tuberculosis. Drug Design, Development and Therapy, 6, 217–224.  Jayachandran, R., Sundaramurthy, V., Combaluzier, B., Mueller, P., Korf, H., Huygen, K., & Pieters, J. (2007). Survival of Mycobacteria in Macrophages Is Mediated by Coronin 1-Dependent Activation of Calcineurin. Cell, 130(1), 37–50.  Jung, Y.-J. J., LaCourse, R., Ryan, L., & North, R. J. (2002). Virulent but not avirulent Mycobacterium tuberculosis can evade the growth inhibitory action of a T helper 1-dependent, nitric oxide Synthase 2-independent defense in mice. The Journal of Experimental Medicine, 196(7), 991–998.  Kamath, A. T., Fruth, U., Brennan, M. J., Dobbelaer, R., Hubrechts, P., Ho, M. M., & Lambert, P.-H. (2005). New live mycobacterial vaccines: the Geneva consensus on essential steps towards  clinical development. Vaccine, 23(29), 3753–3761.  Karen Lingnau, Karin Riedlb, A. von G. (2007). IC31 and IC30, novel types of vaccine adjuvant based on peptide delivery systems. Expert Review of Vaccines, 6(5), 741–746. Kaufmann, S. H. E. (2010). Future Vaccination Strategies against Tuberculosis: Thinking outside the Box. Immunity, 33(4), 567–77.  Kaufmann, S. H. E., Lange, C., Rao, M., Balaji, K. N., Lotze, M., Schito, M., & Maeurer, M. (2014). Progress in tuberculosis vaccine development and host-directed therapies—a state of the art review. The Lancet Respiratory Medicine, 2(4), 301–320.  Keshavjee, S., & Farmer, P. E. (2012). Tuberculosis, Drug Resistance, and the History of Modern Medicine. New England Journal of Medicine, 367(10), 931–936.  Kim, J. I. J. S., Diebold, B. A., Lee, J. Y., & Park, J. B. (2004). Rho is involved in superoxide   138 formation during phagocytosis of opsonized zymosans. Journal of Biological Chemistry, 279(20), 21589–21597.  Kolotilin, I., Topp, E., Cox, E., Devriendt, B., Conrad, U., Joensuu, J., & Menassa, R. (2014). Plant-based solutions for veterinary immunotherapeutics and prophylactics. Veterinary Research, 45, 114–117. Kumar, A., Farhana, A., Guidry, L., Saini, V., Hondalus, M., & Steyn, A. J. C. (2011). Redox homeostasis in mycobacteria: the key to tuberculosis control? Expert Reviews in Molecular Medicine, 13(December), 1–25.  Kusner, D. J. (2005). Mechanisms of mycobacterial persistence in tuberculosis. Clinical Immunology (Orlando, Fla.), 114(3), 239–247.  Labidi, A., David, H. L., & Roulland-Dussoix, D. (1985). Restriction endonuclease mapping and cloning of Mycobacterium fortuitum var. fortuitum plasmid pAL5000. Annales de l’Institut Pasteur.Microbiologie, 136B(2), 209–215. Laitinen, O. H., Nordlund, H. R., Hytonen, V. P., Uotila, S. T. H., Marttila, A. T., Savolainen, J., & Kulomaa, M. S. (2003). Rational design of an active avidin monomer. The Journal of Biological Chemistry, 278(6), 4010–4.  Launois, P., DeLeys, R., M’Bayame N'Diaye Niang, Drowart, A., Andrien, M., Dierckx, P., & Huygen, K. (1994). T-cell-epitope mapping of the major secreted mycobacterial antigen Ag85A in tuberculosis and leprosy. Infection and Immunity, 62(9), 3679–3687. Lesch, H. P., Kaikkonen, M. U., Pikkarainen, J. T., & Yla-Herttuala, S. (2010). Avidin-biotin technology in targeted therapy. Expert Opinion on Drug Delivery, 7(5), 551–564. Leung, A. K. C. (2005). Novel Vaccination Strategies. Journal of the National Medical Association, 97(8), 1183–1184.    139 Lewandowski, C. M. (2015). WHO Glocal tuberculosis report 2015. The effects of brief mindfulness intervention on acute pain experience: An examination of individual difference (Vol. 1).  Liu, P. T., Stenger, S., Tang, D. H., & Modlin, R. L. (2007). Cutting edge: vitamin D-mediated human antimicrobial activity against Mycobacterium tuberculosis is dependent on the induction of cathelicidin. Journal of Immunology (Baltimore, Md. : 1950), 179(4), 2060–3.  Lyadova, I. V., & Panteleev, A. V. (2015). Th1 and Th17 Cells in Tuberculosis: Protection, Pathology, and Biomarkers. Mediators of Inflammation, 2015.  Malik, Z. a, Denning, G. M., & Kusner, D. J. (2000). Inhibition of Ca(2+) signaling by Mycobacterium tuberculosis is associated with reduced phagosome-lysosome fusion and increased survival within human macrophages. The Journal of Experimental Medicine, 191(2), 287–302.  Maniak, M., Rauchenberger, R., Albrecht, R., Murphy, J., & Gerisch, G. (1995). Coronin involved in phagocytosis: Dynamics of particle-induced relocalization visualized by a green fluorescent protein tag. Cell, 83(6), 915–924. Mederle, I., Bourguin, I., Ensergueix, D., Badell, E., Moniz-Peireira, J., Gicquel, B., & Winter, N. (2002). Plasmidic versus insertional cloning of heterologous genes in Mycobacterium bovis BCG: impact on in vivo antigen persistence and immune responses. Infection and Immunity, 70(1), 303–314. Miceli, M. C., & Parnes, J. R. (1991). The roles of CD4 and CD8 in T cell activation. Seminars in Immunology, 3(3), 133–141. Mollenkopf, H. J., Grode, L., Mattow, J., Stein, M., Mann, P., Knapp, B., & Kaufmann, S. H. E. (2004). Application of mycobacterial proteomics to vaccine design: improved protection by   140 Mycobacterium bovis BCG prime-Rv3407 DNA boost vaccination against tuberculosis. Infection and Immunity, 72(11), 6471–6479.  Moro, M. L., Gori, A., Errante, I., Infuso, A., Franzetti, F., Sodano, L., & Iemoli, E. (1998). An outbreak of multidrug-resistant tuberculosis involving HIV-infected patients of two hospitals in Milan, Italy. Italian Multidrug-Resistant Tuberculosis Outbreak Study Group. AIDS (London, England), 12(9), 1095–1102. Mueller, P., Massner, J., Jayachandran, R., Combaluzier, B., Albrecht, I., Gatfield, J., & Pieters, J. (2008). Regulation of T cell survival through coronin-1-mediated generation of inositol-1,4,5-trisphosphate and calcium mobilization after T cell receptor triggering. Nature Immunology, 9(4), 424–31.  Myers, J. (1963). Can Tuberculosis be eradicated? Dis Chest, 43, 327–9. Ndiaye, B. P., Thienemann, F., Ota, M., Landry, B. S., Camara, M., Dièye, S., & McShane, H. (2015). Safety, immunogenicity, and efficacy of the candidate tuberculosis vaccine MVA85A in healthy adults infected with HIV-1: A randomised, placebo-controlled, phase 2 trial. The Lancet Respiratory Medicine, 3(3), 190–200.  Ng, V. H., Cox, J. S., Sousa, A. O., MacMicking, J. D., & McKinney, J. D. (2004). Role of KatG catalase-peroxidase in mycobacterial pathogenesis: countering the phagocyte oxidative burst. Molecular Microbiology, 52(5), 1291–1302.  Nguyen, L., & Pieters, J. (2009). Mycobacterial subversion of chemotherapeutic reagents and host defense tactics: challenges in tuberculosis drug development. Annual Review of Pharmacology and Toxicology, 49, 427–53.  Nguyen, L., Walburger, A., Houben, E., Koul, A., Muller, S., Morbitzer, M., & Pieters, J. (2005). Role of Protein Kinase G in Growth and Glutamine Metabolism of Mycobacterium bovis   141 BCG Role of Protein Kinase G in Growth and Glutamine Metabolism of Mycobacterium bovis BCG. Journal Of Bacteriology, 187(16), 5852.  Niebuhr, K., Giuriato, S., Pedron, T., Philpott, D. J., Gaits, F., Sable, J., & Payrastre, B. (2002). Conversion of PtdIns(4,5)P(2) into PtdIns(5)P by the S.flexneri effector IpgD reorganizes host cell morphology. The EMBO Journal, 21(19), 5069–5078.  Oizumi, S., Strbo, N., Pahwa, S., Deyev, V., & Podack, E. R. (2007). Molecular and cellular requirements for enhanced antigen cross-presentation to CD8 cytotoxic T lymphocytes. Journal of Immunology (Baltimore, Md.: 1950), 179(4), 2310–2317. Paganelli, G., Bartolomei, M., Grana, C., Ferrari, M., Rocca, P., & Chinol, M. (2006). Radioimmunotherapy of brain tumor. Neurological Research, 28(5), 518–522. Patterson, R. L., van Rossum, D. B., Ford, D. L., Hurt, K. J., Bae, S. S., Suh, P. G., & Gill, D. L. (2002). Phospholipase C-gamma is required for agonist-induced Ca2+ entry. Cell, 111(4), 529–541.  Petronzelli, F., Pelliccia, A., Anastasi, A. M., Lindstedt, R., Manganello, S., Ferrari, L. E., & Santis, R. De. (2010). Therapeutic use of avidin is not hampered by antiavidin antibodies in humans. Cancer Biotherapy & Radiopharmaceuticals, 25(5), 563–570. Piddington, D. L., Fang, F. C., Laessig, T., Cooper, A. M., Orme, I. M., & Buchmeier, N. A. (2001). Cu,Zn superoxide dismutase of Mycobacterium tuberculosis contributes to survival  in activated macrophages that are generating an oxidative burst. Infection and Immunity, 69(8), 4980–4987.  Pieters, J., Müller, P., & Jayachandran, R. (2013). On guard: coronin proteins in innate and adaptive immunity. Nature Reviews. Immunology, 13(7), 510–8.  Poirier, V., Bach, H., & Av-Gay, Y. (2014). Mycobacterium tuberculosis promotes anti-  142 apoptotic activity of the macrophage by PtpA protein-dependent dephosphorylation of host GSK3. Journal of Biological Chemistry, 289(42), 29376–29385.  Pooran, A., Pieterson, E., Davids, M., Theron, G., & Dheda, K. (2013). What is the Cost of Diagnosis and Management of Drug Resistant Tuberculosis in South Africa? PLoS ONE, 8(1).  Punwani, D., Pelz, B., Yu, J., Arva, N. C., Schafernak, K., Kondratowicz, K., & Puck, J. M. (2015). Coronin-1A: Immune Deficiency in Humans and Mice. Journal of Clinical Immunology, 35(2), 100–107.  Puri, R. V., Reddy, P. V., & Tyagi, A. K. (2013). Secreted Acid Phosphatase (SapM) of Mycobacterium tuberculosis Is Indispensable for Arresting Phagosomal Maturation and Growth of the Pathogen in Guinea Pig Tissues. PLoS ONE, 8(7).  Rangell, L., Danilenko, D. M., Chan, A. C., Foger, N., Rangell, L., Danilenko, D. M., & Chan, A. C. (2006). Requirement for coronin 1 in T lymphocyte trafficking and cellular homeostasis. Science, 313(5788), 839–842.  Rawat, M., Newton, G. L., Ko, M., Martinez, G. J., Fahey, R. C., & Av-Gay, Y. (2002). Mycothiol-deficient Mycobacterium smegmatis mutants are hypersensitive to alkylating agents, free radicals, and antibiotics. Antimicrobial Agents and Chemotherapy, 46(11), 3348–3355. Rink, J., Ghigo, E., Kalaidzidis, Y., & Zerial, M. (2005). Rab conversion as a mechanism of progression from early to late endosomes. Cell, 122(5), 735–749.  Rodrigues, L. C., Diwan, V. K., & Wheeler, J. G. (1993). Protective effect of BCG against tuberculous meningitis and miliary tuberculosis: a meta-analysis. International Journal of Epidemiology, 22(6), 1154–1158.   143 Rohde, K., Yates, R. M., Purdy, G. E., & Russell, D. G. (2007). Mycobacterium tuberculosis and the environment within the phagosome. Immunological Reviews, 219, 37–54.  Russell, D. G., Cardona, P.-J. J., Kim, M.-J. J., Allain, S., & Altare, F. (2009). Foamy macrophages and the progression of the human tuberculosis granuloma. Nature Immunology, 10(9), 943–948.  Russell, M. S., Iskandar, M., Mykytczuk, O. L., Nash, J. H., Krishnan, L., & Sad, S. (2007). A reduced antigen load in vivo, rather than weak inflammation, causes a substantial delay in CD8+ T cell priming against Mycobacterium bovis (bacillus Calmette-Guerin). J Immunol, 179(1), 211–220. Schuller, S., Neefjes, J., Ottenhoff, T., Thole, J., Young, D., Schüller, S., & Young, D. (2001). Coronin is involved in uptake of Mycobacterium bovis BCG in human macrophages but not in phagosome maintenance. Cellular Microbiology, 3(12), 785–93.  Sendide, K., Reiner, N. E., Lee, J. S., Bourgoin, S., Talal, A., & Hmama, Z. (2005). Cross-talk between CD14 and complement receptor 3 promotes phagocytosis of mycobacteria: regulation by phosphatidylinositol 3-kinase and cytohesin-1. Journal of Immunology, 174(7), 4210–4219. Sharif-Paghaleh, E., Leech, J., Sunassee, K., Ali, N., Sagoo, P., Lechler, R. I., & Mullen, G. E. (2014). Monitoring the efficacy of dendritic cell vaccination by early detection of (99m) Tc-HMPAO-labelled CD4(+) T cells. European Journal of Immunology, 44(7), 2188–2191. Silva Miranda, M., Breiman, A., Allain, S., Deknuydt, F., & Altare, F. (2012). The tuberculous granuloma: An unsuccessful host defence mechanism providing a safety shelter for the bacteria? Clinical and Developmental Immunology, 2012.  Simon, H. (2000). Role of reactive oxygen species ( ROS ) in apoptosis induction, 415–418.   144 Singh, N. P., Yolcu, E. S., Taylor, D. D., Gercel-taylor, C., Metzinger, D. S., Dreisbach, S. K., & Shirwan, H. (2003). A Novel Approach to Cancer Immunotherapy : Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity A Novel Approach to Cancer Immunotherapy : Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity 1, 4067–4073. Smaill, F., Jeyanathan, M., Smieja, M., Medina, M. F., Thanthrige-don, N., Zganiacz, A., & Xing, Z. (2013). A Human Type 5 Adenovirus – Based Tuberculosis Vaccine Induces Robust T Cell Responses in Humans Despite Preexisting Anti-Adenovirus Immunity, 5(205). Snewin, V. a, Gares, M. P., Gaora, P. O., Hasan, Z., Brown, I. N., & Young, D. B. (1999). Assessment of immunity to mycobacterial infection with luciferase reporter constructs. Infection and Immunity, 67(9), 4586–93.  Soualhine, H., Deghmane, A. E., Sun, J., Mak, K., Talal, A., Av-Gay, Y., & Hmama, Z. (2007). Mycobacterium bovis bacillus Calmette-Guerin secreting active cathepsin S stimulates expression of mature MHC class II molecules and antigen presentation in human macrophages. Journal of Immunology (Baltimore, Md.: 1950), 179(8), 5137–5145. Sturgill-Koszycki, S., Schlesinger, P. H., Chakraborty, P., Haddix, P. L., Collins, H. L., Fok, A. K., & Russell, D. G. (1994). Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science, 263(5147), 678–681. Sun, J., Lau, A., Wang, X., Liao, T.-Y. Y. A., Zoubeidi, A., & Hmama, Z. (2009). A broad-range of recombination cloning vectors in mycobacteria. Plasmid, 62(3), 158–65.  Sun, J., Singh, V., Lau, A., Stokes, R. W., Obregn-Henao, A., Orme, I. M., & Hmama, Z. (2013). Mycobacterium tuberculosis Nucleoside Diphosphate Kinase Inactivates Small GTPases   145 Leading to Evasion of Innate Immunity. PLoS Pathogens, 9(7), 1–14.  Sun, J., Wang, X., Lau, A., Liao, T.-Y. Y. A., Bucci, C., & Hmama, Z. (2010). Mycobacterial nucleoside diphosphate kinase blocks phagosome maturation in murine RAW 264.7 macrophages. PloS One, 5(1), e8769.  Sundler, R. (2002). Regulation of phospholipase C-g2 via phosphatidylinositol 3-kinase in macrophages Go, 14, 169–173. Suzuki, K., Nishihata, J., Arai, Y., Honma, N., Yamamoto, K., Irimura, T., & Toyoshima, S. (1995). Molecular cloning of a novel actin-binding protein, p57, with a WD repeat and a leucine zipper motif. FEBS Letters, 364(3), 283–288. Thompson, C. R., Iyer, S. S., Melrose, N., VanOosten, R., Johnson, K., Pitson, S. M., & Kusner, D. J. (2005). Sphingosine Kinase 1 (SK1) Is Recruited to Nascent Phagosomes in Human Macrophages: Inhibition of SK1 Translocation by Mycobacterium tuberculosis. J Immunol, 174(6), 3551–3561.  Tian, J., Bryk, R., Shi, S., Erdjument-Bromage, H., Tempst, P., & Nathan, C. (2005). Mycobacterium tuberculosis appears to lack alpha-ketoglutarate dehydrogenase and encodes pyruvate dehydrogenase in widely separated genes. Molecular Microbiology, 57(3), 859–868.  Tsujita, K., Itoh, T., Kondo, A., Oyama, M., Kozuka-Hata, H., Irino, Y., & Takenawa, T. (2010). Proteome of acidic phospholipid-binding proteins: spatial and temporal regulation of Coronin 1A by phosphoinositides. The Journal of Biological Chemistry, 285(9), 6781–9.  Udwadia, Z. F., Amale, R. A., Ajbani, K. K., & Rodrigues, C. (2011). Totally Drug-Resistant Tuberculosis in India. Clinical Infectious Diseases .  Ueyama, T., Tatsuno, T., Kawasaki, T., Tsujibe, S., Shirai, Y., Sumimoto, H., & Saito, N.   146 (2007). A Regulated Adaptor Function of p40 phox : Distinct p67 phox Membrane Targeting by p40 phox and by p47 phox. Molecular Biology of the Cell, 18(February), 441– 454.  van der Wel, N., Hava, D., Houben, D., Fluitsma, D., van Zon, M., Pierson, J., & Peters, P. J. (2007). M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell, 129(7), 1287–98.  Van Dissel, J. T., Soonawala, D., Joosten, S. a, Prins, C., Arend, S. M., Bang, P., & Andersen, P. (2011). Ag85B-ESAT-6 adjuvanted with IC31® promotes strong and long-lived Mycobacterium tuberculosis specific T cell responses in volunteers with previous BCG vaccination or tuberculosis infection. Vaccine, 29(11), 2100–9.  Van-Lume, D. S. M., Souza, J. R. De, Cabral, M. M. L., Rego, J. C., Balbino, V., Saad, M. H., & Montenegro, S. M. L. (2010). Immunological diagnosis of tuberculosis based on recombinant antigens ESAT-6 and CFP-10 in children from an endemic area in northeast Brazil. Scandinavian Journal of Immunology, 72(5), 460–468.  Vaubel, R. A., Rustin, P., & Isaya, G. (2011). Mutations in the dimer interface of dihydrolipoamide dehydrogenase promote site-specific oxidative damages in yeast and human cells. Journal of Biological Chemistry, 286(46), 40232–40245.  Venugopal, A., Bryk, R., Shi, S., Rhee, K., Rath, P., Schnappinger, D., & Nathan, C. (2011). Virulence of Mycobacterium tuberculosis depends on lipoamide dehydrogenase, a member of three multienzyme complexes. Cell Host & Microbe, 9(1), 21–31.  Via, L. E., Deretic, D., Ulmer, R. J., Hibler, N. S., Huber, L. A., & Deretic, V. (1997). Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. Journal of Biological Chemistry, 272(20), 13326–13331.   147 Via, L. E., Fratti, R. a, McFalone, M., Pagan-Ramos, E., Deretic, D., & Deretic, V. (1998). Effects of cytokines on mycobacterial phagosome maturation. Journal of Cell Science, 111, 897–905. Weber, S. S., Ragaz, C., Reus, K., Nyfeler, Y., & Hilbi, H. (2006). Legionella pneumophila exploits PI(4)P to anchor secreted effector proteins to the replicative vacuole. PLoS Pathogens, 2(5), e46.  Weiner, J., & Kaufmann, S. H. E. (2014). Recent advances towards tuberculosis control : vaccines and biomarkers, 467–480.  Welin, A. (2011). Survival strategies of Mycobacterium tuberculosis inside the human macrophage. Winau, F., Weber, S., Sad, S., de Diego, J., Hoops, S. L., Breiden, B., & Schaible, U. E. (2006). Apoptotic vesicles crossprime CD8 T cells and protect against tuberculosis. Immunity, 24(1), 105–117.  Wong, D., Bach, H., Sun, J., Hmama, Z., & Av-Gay, Y. (2011). Mycobacterium tuberculosis protein tyrosine phosphatase (PtpA) excludes host vacuolar-H+-ATPase to inhibit phagosome acidification. Proceedings of the National Academy of Sciences of the United States of America, 108(48), 19371–19376. Yan, M., Ciano-oliveira, C. Di, Grinstein, S., & Trimble, W. S. (2013). Coronin Function Is Required for Chemotaxis and Phagocytosis in Human Neutrophils. J Immunol, 178(9), 5769-78. Yan, M., Collins, R. F., Grinstein, S., & Trimble, W. S. (2005). Coronin-1 Function Is Required for Phagosome Formation. Molecular Biology of the Cell, 7(July), 3077–3087.  Yeung, T., Ozdamar, B., Paroutis, P., & Grinstein, S. (2006). Lipid metabolism and dynamics   148 during phagocytosis. Current Opinion in Cell Biology, 18(4), 429–37.  Yew, W. W., & Koh, W. (2016). Emerging strategies for the treatment of pulmonary tuberculosis : promise and limitations ? Korean J Intern Med, 31(1), 15–29.    149 Appendices Appendix A   A.1 DNA and protein sequence of OVA derived antigen peptide  A. DNA sequence shows partial sequence of the OVA gene encoding for a 92 amino acid polypeptide (757-1035) that covers both MHC class I-restricted (SIINFEKL) and MHC class II-restricted (KISQAVHAAHAEINEAG) OVA epitopes. The two epitopes are underlined. B. Protein sequence of OVA showing both MHC class I-restricted (SIINFEKL) and MHC class II-restricted (KISQAVHAAHAEINEAG) OVA epitopes (underlined).    150 A.2 Mutant monomeric avidin sequence  A. DNA sequence showing the three mutations (N17I, N54A & W110K) introduced in wild-type avidin to obtain a monomeric avidin. B.  Protein sequence of triple mutant avidin.     151 A.3 OVA levels in BCG genetically expressing OVA vs BCG surface decorated with Avi-OVA BCG 261-p19-OVA and BCG 261-p19 decorated with Avi-OVA were fixed and stained with mouse anti-OVA antibody and the level of OVA on cell surface was revealed with FITC-anti-mouse IgG. Samples were then analyzed by FACS. Results are presented as MFI indexes, which correspond to the Ratios: MFIs deducted from OVA expressing BCG 261-p19/ MFI corresponding to control BCG-p19 alone.      152 A.4 Flow cytometry gating strategy and death cell exclusion  Splenocytes acquired on FACSCalibur flow cytometer were gated on a SSC/FSC (region R1). Live cell (7-AAD negative) were gated in region R2. Total CD4+ (or CD8+) T cells were gated in region R3 to determine frequencies of tetramer positive events (R4).    153 A.5 Peptide sequence alignment of M.tb/BCG LpdC and M. smegmatis LpdC  The LpdC sequences were aligned using ClustalW algorithm (http://www.genome.jp/tools/clustalw/) . The accession numbers of sequences used for this alignment are Rv0462 (TubercuList) and MSMEG0903 (SmegmaList).   '*' indicates positions which have a single, fully conserved residue ':' indicates that one of the following 'strong' groups is fully conserved: '.' indicates that one of the following 'weaker' groups is fully conserved:                  STA                  CSA                  NEQK                  ATV                  NHQK                  SAG                  NDEQ                  STNK                  QHRK                  STPA   154                  MILV                  SGND                  MILF                  SNDEQK                  HY                  NDEQHK                  FYW                  NEQHRK                   FVLIM                   HFY  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0314168/manifest

Comment

Related Items