UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of immune receptor homeostasis : lessons from four MUSE proteins Huang, Shuai 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_huang_shuai.pdf [ 5.48MB ]
Metadata
JSON: 24-1.0308599.json
JSON-LD: 24-1.0308599-ld.json
RDF/XML (Pretty): 24-1.0308599-rdf.xml
RDF/JSON: 24-1.0308599-rdf.json
Turtle: 24-1.0308599-turtle.txt
N-Triples: 24-1.0308599-rdf-ntriples.txt
Original Record: 24-1.0308599-source.json
Full Text
24-1.0308599-fulltext.txt
Citation
24-1.0308599.ris

Full Text

  REGULATION OF IMMUNE RECEPTOR HOMEOSTASIS:  LESSONS FROM FOUR MUSE PROTEINS by  Shuai Huang  B.Sc., The Northwest A&F University, 2010 M.Sc., The University of British Columbia, 2013  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies  (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2016 © Shuai Huang, 2016 ii  Abstract Plants are sessile organisms and rely on their innate immune systems to defend against pathogens. Nucleotide-binding (NB) and leucine-rich repeat (LRR) domain-containing proteins (NLRs) serve as immune receptors in both plants and animals. It remains poorly understood how NLRs are activated and very few components downstream of NLR activation have been identified. Autoimmune mutants provide a powerful tool to study NLR-mediated immune pathways through genetic screens. To search for negative regulators of plant immunity, we performed a MUSE (MUTANT, SNC1-ENHANCING) screen in Arabidopsis thaliana, where 15 novel muse mutants were identified. My Ph.D. dissertation consists of the cloning and characterization of four muse mutants: muse10, muse12, muse13 and muse14.  muse10 and muse12 are alleles of Arabidopsis thaliana hsp90.3 and hsp90.2, respectively.  HSP90s are conserved molecular chaperones that play diverse roles. Previous studies have shown that HSP90s are positive regulators in NLR protein assembly. We found that they also exert negative roles in NLR protein turnover. Specific mutations in HSP90.3 lead to increased protein levels of multiples NLRs. Using an immunoprecipitation assay we also demonstrated that SNC1 is a client of HSP90.3.    MUSE13 and MUSE14 are both TRAF domain-containing proteins. TRAF domains are conserved in eukaryotes, and TRAF domain proteins are predominantly involved in protein ubiquitination or protein processing. MUSE13 and MUSE14 function redundantly in the negative regulation of protein turnover of two NLRs. We found that MUSE13 forms a protein complex with SCFCPR1 and NLRs, which suggests the existence of a plant type TRAFasome that modulates NLR homeostasis.  Overall, my study on these MUSE proteins provides insights into the regulation of plant NLR turnover, and broadens our knowledge of the tight control of the plant immune system. iii  Preface The work described in this thesis is the culmination of research from May 2013 through August 2016. Below is a list of published manuscripts that comprise this thesis and the contribution made by the candidate. Chapter 2 — HSP90s are Required for NLR Immune Receptor Accumulation in Arabidopsis thaliana was modified from the manuscript:  Huang, S., Monaghan, J., Zhong, X., Lin, L., Sun, T., Dong, O.X., and Li, X. (2014). HSP90s are required for NLR immune receptor accumulation in Arabidopsis. The Plant Journal 79(3), 427-439.  S.H. and X.L. designed the experiments and analyzed the data. S.H. performed most of the experiments. L.L., O.X.D. and J.M. contributed to the muse screen. X.Z. contributed to the construction of plasmids and infection assays. S.T. made the library for Solexa sequencing. S.H. and X.L. wrote the manuscript. All authors reviewed the manuscript. Chapter 3 — Two Redundant Plant TRAF Proteins Participate in NLR Immune Receptor Turnover was modified from the manuscript: Huang, S., Chen, X., Zhong, X., Li, M., Ao, K., Huang, J., & Li, X. (2016). Plant TRAF Proteins Regulate NLR Immune Receptor Turnover. Cell Host & Microbe, 19(2), 204-215.  S.H. and X.L. designed the experiments and analyzed the data. S.H. performed most of the experiments. X.C. initially mapped muse13-1. X.Z. contributed to the construction of plasmids and infection assays. J.H. carried out phylogenetic analysis and infection assays. K.A. contributed to infection assays. M.L. assisted with the confocal microscopy analysis. S.H. and X.L. wrote the manuscript. All authors reviewed the manuscript.  iv  Table of Contents Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iii Table of Contents ......................................................................................................................... iv List of Tables ............................................................................................................................... vii List of Figures ............................................................................................................................. viii List of Abbreviations .................................................................................................................... x Acknowledgements .................................................................................................................... xiv Dedication ................................................................................................................................... xvi Chapter 1 Introduction................................................................................................................. 1 1.1 A brief history of plant pathology ......................................................................................... 1 1.2 The plant immune system ..................................................................................................... 3 1.2.1 Physical barriers and chemical inhibitions ..................................................................... 3 1.2.2 PAMP-triggered immunity ............................................................................................. 3 1.2.3 Effector-triggered immunity ........................................................................................... 6 1.2.4 NLR activation ............................................................................................................... 8 1.2.5 NLR gene evolution...................................................................................................... 10 1.2.6 The snc1 autoimmune model ........................................................................................ 11 1.3 The muse forward genetic screen ........................................................................................ 14 1.4 Summary of novel Mutants, snc1-enhancing (MUSE) genes ............................................. 16 1.4.1 MUSE3 and MUSE6 are both involved in turnover regulation of NLRs .................... 16 1.4.1.1 MUSE3 .................................................................................................................. 16 1.4.1.2 MUSE6 .................................................................................................................. 17 1.4.2 MUSE4.......................................................................................................................... 18 1.4.3 MUSE5.......................................................................................................................... 18 1.4.4 MUSE9.......................................................................................................................... 19 1.4.5 MUSE15........................................................................................................................ 20 1.5 Thesis objectives ................................................................................................................. 21 Chapter 2 HSP90s are Required for NLR Immune Receptor Accumulation in Arabidopsis thaliana ......................................................................................................................................... 22 v  2.1 Summary ............................................................................................................................. 22 2.2 Introduction ......................................................................................................................... 23 2.3 Materials and methods ........................................................................................................ 25 2.3.1 Plant growth .................................................................................................................. 25 2.3.2 Ethyl methanesulfonate (EMS) mutagenesis and suppressor screen ............................ 25 2.3.3 Mapping and next-generation sequencing .................................................................... 26 2.3.4 Semi-quantitative RT-PCR ........................................................................................... 26 2.3.5 Pathogen assays ............................................................................................................ 27 2.3.6 Transgenic complementation ........................................................................................ 27 2.3.7 Protein extraction, co-immunoprecipitation and western blots .................................... 27 2.4 Results ................................................................................................................................. 29 2.4.1 The muse10 and muse12 mutants enhance snc1-mediated autoimmune phenotypes .. 29 2.4.2 MUSE10 is HSP90.3..................................................................................................... 30 2.4.3 MUSE12 is HSP90.2..................................................................................................... 34 2.4.4 HSP90s have diverse roles in plant immunity .............................................................. 36 2.4.5 HSP90.2 and HSP90.3 are required for accumulation of NLRs .................................. 41 2.4.6 HSP90.3 associates with SNC1 .................................................................................... 42 2.5 Discussion ........................................................................................................................... 48 Chapter 3 Two Redundant Plant TRAF Proteins Participate in NLR Immune Receptor Turnover  ..................................................................................................................................... 54 3.1 Summary ............................................................................................................................. 54 3.2 Introduction ......................................................................................................................... 55 3.3 Materials and methods ........................................................................................................ 57 3.3.1 Plant materials and growth conditions.......................................................................... 57 3.3.2 Ethyl methanesulfonate (EMS) mutagenesis, mutant screens, and positional cloning 57 3.3.3 Construction of plasmids and Arabidopsis transformation .......................................... 57 3.3.4 Hpa Noco2 infection and bacterial infection assays .................................................... 58 3.3.5 Gene expression analysis .............................................................................................. 59 3.3.6 Plant total protein extraction, immunoblot analysis and immunoprecipitation assays . 59 3.3.7 Statistical analysis......................................................................................................... 61 vi  3.4 Results ................................................................................................................................. 61 3.4.1 Identification, characterization, and molecular cloning of muse13-1, a mutant isolated from a modified snc1 enhancer screen .................................................................................. 61 3.4.2 MUSE13 encodes a TRAF-like protein and functions redundantly with MUSE14 ..... 63 3.4.3 MUSE13 localizes in the cytosol and on the plasma membrane .................................. 74 3.4.4 The muse13-2 muse14-1 autoimmune phenotypes rely on SNC1 ................................ 78 3.4.5 MUSE13 is involved in NLR protein turnover ............................................................ 81 3.4.6 MUSE13 associates with CPR1 and multiple NLRs, and forms homo-oligomers ...... 89 3.5 Discussion ........................................................................................................................... 94 Chapter 4 Finding Highlights, Implications and Future Directions .................................... 100 4.1 Summary ........................................................................................................................... 100 4.2 Future directions ................................................................................................................ 101 References .................................................................................................................................. 103                vii  List of Tables Table 1.1 muse mutants investigated in this thesis ....................................................................... 15 Table 2.1 Primers used in this study  ........................................................................................... 47 Table 3.1 Mutations identified in the mapped muse13-1 region .................................................. 93   viii  List of Figures Figure 1.1 The plant immune system ............................................................................................. 4 Figure 1.2 The snc1 autoimmune model ...................................................................................... 12 Figure 1.3 The SCFCPR1 complex  ................................................................................................ 14 Figure 2.1 Morphological and immune phenotypes of the muse10 mos2 snc1 npr1 quadruple mutants .......................................................................................................................................... 31 Figure 2.2 Morphological and immune phenotypes of the muse12 mos2 snc1 npr1 quadruple mutant plants  ................................................................................................................................ 32 Figure 2.3 Map-based cloning of muse10 .................................................................................... 35 Figure 2.4 muse12 is an allele of hsp90.2 .................................................................................... 38 Figure 2.5 Single mutant analyses of hsp90.3 and hsp90.2 alleles .............................................. 39 Figure 2.6 Pst DC3000 hrcC infection assay on hsp90 alleles .................................................... 40 Figure 2.7 HSP90.2 and HSP90.3 are required for accumulation of NLRs ................................ 44 Figure 2.8 Knockout analysis of HSP90.1KO ............................................................................... 44 Figure 2.9 HSP90.3 plays distinct roles on different NLR proteins ............................................ 45 Figure 2.10 HSP90.3 associates with SNC1 in N. benthamiana ................................................. 46 Figure 3.1 Characterization and positional cloning of muse13-1 ................................................ 64 Figure 3.2 Both muse13-1 and muse13-2 enhance snc1 .............................................................. 66 Figure 3.3 Amino acid alignments of selected TRAF domains from eukaryotic organisms ....... 67 Figure 3.4 Threading analysis of the MUSE13 TRAF domain ................................................... 68 Figure 3.5 Phylogeny of gene families encoding TRAF domain-containing proteins in Arabidopsis ................................................................................................................................... 69 Figure 3.6 Knocking out AT5G43560 (MUSE14), but not AT5G52330, enhances snc1 ............. 70 Figure 3.7 Amino acid alignments of MUSE13 and MUSE14.................................................... 71 ix  Figure 3.8 Phylogenetic tree of predicted MUSE13 orthologs in higher plants .......................... 72 Figure 3.9 MUSE13 functions redundantly with MUSE14 ......................................................... 73 Figure 3.10 Subcellular localization of MUSE13-GFP ............................................................... 75 Figure 3.11 MUSE13-GFP co-localizes with plasma membrane and is absent from the nucleus....................................................................................................................................................... 76 Figure 3.12 MUSE13-GFP localization after Pst DC3000 (AvrRpt2) treatment ........................ 77 Figure 3.13  The autoimmunity of muse13-2 muse14-1 is not suppressed by selected PTI deficient mutants including bak1-4, bak1-5, agb1-2 or sobir1-12 ............................................... 78 Figure 3.14 The autoimmunity of muse13-2 muse14-1 partially depends on SNC1 ................... 80 Figure 3.15 Growth of Pst DC3000 (AvrRpm1) (A) and Pst DC3000 (AvrPphB) (B) on the indicated genotypes ....................................................................................................................... 81 Figure 3.16 MUSE13 is involved in protein turnover of SNC1 and RPS2 ................................. 85 Figure 3.17 MUSE13::MUSE13-FLAG-ZZ complements the autoimmune phenotypes of muse13-2 muse14-1 ...................................................................................................................... 86 Figure 3.18 Overexpression analysis of MUSE13 in Col-0 ......................................................... 87 Figure 3.19 Overexpression of MUSE13-GFP leads to decreased NLR protein levels .............. 88 Figure 3.20 MUSE13-GFP associates with CPR1-FLAG and SNC1 in planta .......................... 91 Figure 3.21 Immunoprecipitation of SNC1 by MUSE13-FLAG-ZZ in Arabidopsis .................. 92 Figure 3.22 MUSE13-GFP associates with RPS2-FLAG-ZZ in planta and it also self-associates........................................................................................................................................................ 92 Figure 3.23 Proposed model of MUSE13/14 function.   ............................................................. 99     x  List of Abbreviations AAA+ ATPases Associated with diverse cellular Activities ABRC Arabidopsis Biological Resource Center  Ac/N N-terminal acetylation   ADP adenosine diphosphate ADR1 Activated Disease Resistance 1 ADR1-L1 ADR1-like 1 ADR1-L2 ADR1-like 2 ARC Apaf-1, R proteins, CED-4 Arg/N N-terminal arginylation  ATP adenosine triphosphate ATR1 Arabidopsis thaliana recognized 1  ATXR7 Arabidopsis Trithorax-Related 7  Avr Avirulence gene product AvrL567 An avirulence gene from Melampsora lini AvrM An avirulence gene from Melampsora lini AvrPita An avirulence gene from Magnaporthe grisea  AvrPphB An avirulence gene from Pseudomonas syringae pv. tomato DC3000 AvrRpm1 An avirulence gene from Pseudomonas syringae pv. tomato DC3000 AvrRps4 An avirulence gene from Pseudomonas syringae pv. pisi AvrRpt2 An avirulence gene from Pseudomonas syringae pv. tomato DC3000 BAK1 BRI1-associated kinase 1  BAT2 HLA-B associated transcript 2  BGL2-GUS beta-glucuronidase BIK1 BAK1 interacting kinase 1 BLAST The Basic Local Alignment Search Tool BON1 BONZAI1 CAND1 Cullin-associated and neddylation-dissociated protein 1 CARD Caspase activation and recruitment domain CFU colony forming unit  CNL coiled-coil type NLR  COI1 coronatine-insensitive 1 Col-0  Columbia ecotype CPR1 constitutive expressor of PR genes 1 CRT3 calreticulin3 CUL1 Cullin1 dCAPs Derived Cleaved Amplified Polymorphic Sequences DN Dominant-negative E1 ubiquitin activating enzyme E2 ubiquitin conjugating enzyme xi  E3 ubiquitin ligase E4  ubiquitin E4 enzyme EDS1 Enhanced Disease Susceptibility 1  EFR EF-Tu receptor  EF-Tu elongation factor thermo unstable  EMS ethyl methanesulfonate  ERD2B ER retention defective 2B  ER-QC ER-quality control ETI effector-triggered immunity  FLS2 Flagellin-sensing 2  GFP green fluorescence protein G-patch glycine-rich RNA-binding domain GPI glycosylphosphatidyl-inositol  H3K4 trimethylation level of lysine 4 of histone 3  HNL Hydrolase-NB-LRR Hpa Hyaloperonospora arabidopsidis  HR hypersensitive response HSP heat shock protein  I-2  An R protein from tomato IPAF  ICE-protease activating factor KOW Kyrpides, Ouzounis and Woese RNA-binding domain Ler Landsberg erecta MAC MOS4-Associated Complex  MAPK mitogen-activated protein kinase  MATH meprin and TRAF-C homology Met methionine MLA10  An R protein from barley MOS Modifiers of snc1  MS Murashige and Skoog  MUSE mutant, snc1-enhancing  N. benthamiana Nicotiana benthamiana Naa15 auxiliary subunit of NatA 15 NAIP NLR apoptosis inhibitory protein NALP3  NACHT, LRR and PYD domains-containing protein 3 NatA N-terminal acetyltransferase A NatB N-terminal acetyltransferase B Nat N-terminal acetyltransferase  NB nucleotide binding NDR1 nonrace-specific disease resistance 1  NLR nucleotide-binding leucine-rich repeat  xii  NLRC4  NLR Family, CARD Domain Containing 4 NLR-ID  NLR with “integrated domain” NOD nucleotide-binding oligomerization domain NPR1  nonexpresser of PR gene 1 NRG1 N requirement gene 1 NRPC7 Nuclear RNA polymerase C, subunit 7 NTC Nineteen Complex  PAD4 PhytoAlexin Deficient 4  PAM presequence translocase-associated motor  PAMP pathogen-associated molecular pattern Pita An R protein from rice PK protein kinase  PM plasma membrane  PNL PK-NB-LRR  Pol DNA-dependent RNA polymerase PopP2  An avirulence gene from Ralstonia solanacearum PR Pathogenesis-Related  PRR Pattern-recognition receptor  Psm Pseudomonas syringae pv. maculicola Pst Pseudomonas syringae pv. tomato PTI PAMP-triggered immunity  R Resistance gene RAR1  Required for mla12 resistance 1 RbohD respiratory burst oxidase protein D RING  Really Interesting New Gene RLK receptor like kinase  RLP receptor like protein  ROS reactive oxygen species  RPM1 Resistance to Pseudomonas syringae pv. Maculicola 1 RPP1 Recognition of Peronospora parasitica 1 RPS2 Resistance to Pseudomonas syringae pv. tomato expressing avrRpt2 RPS4 Resistance to Pseudomonas syringae 4  RPS5 Resistance to Pseudomonas syringae 5 rRNA  ribosomal RNA Rx An R protein from potato SA salicylic acid SAG101 Senescence-Associated Gene 101  SCF Skp1-Cul1-F-box  SGT1  suppressor of G2 allele of skp1 siRNA small interfering RNA  xiii  SIZ1 E3 SUMO-protein ligase SNC1 suppressor of npr1-1, constitutive 1 STAND signal-transduction ATPases with numerous domains SWI/SNF  SWItch/Sucrose Non-Fermentable SYD SPLAYED T-DNA transfer DNA TIM23 translocase of the inner membrane 23 TIR1 transport inhibitor response 1 TLR Toll-like receptor  TMV tobacco mosaic virus  TNFR Tumor necrosis factor receptor  TNL Toll- Interleukin-1 type NLR  TRAF Tumor necrosis factor receptor-associated factor  tRNA transfer RNA TTSS type three secretion system UFD2  Ub fusion degradation 2 UGGT UDP-glucose glycoprotein glucosyltransferase WRKY  WRKY domain WT wild-type      xiv  Acknowledgements I would not have achieved to this point without many people. First and foremost, I would like to thank my graduate advisor Dr. Xin Li in the Department of Botany and Michael Smith Laboratories. She is an amazing mentor and among the most creative scientists in her field of perspective. I am tremendously grateful to have had the opportunity to work with her.             I would also like to thank the members of my thesis committee: Dr. James Kronstad, Dr. George Haughn, and Dr. Michel Roberge. I would like to thank them for their suggestions, help and time through my Ph.D. career.             I am indebted to all members of the Li lab for creating such a warm and extraordinarily enjoyable work environment. I would like to thank Dr. Yu Ti Cheng for coaching me during the early stage of my graduate study and Dr. Fang Xu for her limitless expertise in protein work. My fellows Xionghui Zhong, Jianhua Huang, Chipan Zhu and Kevin Ao; thank you for helping me get through all those hard times in my projects. I want to thank Dr. Kaeli Johnson for critical reading of my manuscripts. I also would like to thank Dr. Yan Huang, Dr. Oliver Xiaoou Dong,  Charles Copeland, Wanwan Liang, Zhongshou Wu and Paul Kapos for their suggestions to move my projects forward.             Without many people, none of this work will be possible. Dr. Jeff Dangl, Dr. Brian Staskawicz, Dr. Yuelin Zhang, Dr. Cyril Zipfel and Dr. Jane Parker are sincerely thanked for their generous sharing of materials. Dr. Jeff Dangl is specially thanked for his insightful and thoughtful discussions on our HSP90 manuscript. Yan Li is thanked for Solexa sequencing analysis. The Arabidopsis Biological Resource Center (ABRC) is thanked for providing T-DNA seeds. xv             This research was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Program, the Dewar Cooper Memorial Fund, and an overseas Ph.D. study scholarship from China Scholarship Council (CSC).            And finally, I would like to thank my wonderful family, my parents, my brother and my wife for their endless love, support and encourage.                    xvi  Dedication To my mother, Ruihua Wang.                      1  Chapter 1 Introduction 1.1 A brief history of plant pathology Humans depend on plants, which provide oxygen, shelter, food, fiber, medicine and more. In particular, more than 80% of the human diet, directly or indirectly, comes from plants. With a rapidly growing population, it is estimated that by 2050 there would be approximately 9.15 billion people on earth (Alexandratos and Bruinsma, 2012). It will be a huge challenge for agriculture to feed all the people on this planet.   Plants are sessile organisms that are constantly under the threat of numerous challenges, e.g. drought, flood, increasing temperature and plant pathogens etc. In North America, it is estimated that 10 to 15% of crop loss each year is due to plant diseases caused by fungi, bacteria and viruses. Research on plant-microbe interactions could therefore contribute to crop protection and solving the global food shortage problem. The study of plant pathology has a long history. Plant diseases were documented in the ancient Indian literature Vedas 1200 BC. For a long time, it was unclear how plants became diseased until, Anton de Bary, the father of plant pathology and mycology, demonstrated that Phytophthora infestans, an oomycete pathogen, is the cause of potato late blight, a devastating disease that lead to the Irish potato famine in the 1840s (Woodham-Smith and Davidson, 1991). Knowledge of plant resistance against pathogens was slowly gained in the following century. In the 1940s, Harold Henry Flor, a plant pathologist who studied flax rust fungus Melampsora lini, developed the gene-for-gene hypothesis to describe plant pathogen interactions (Flor, 1942, 1955). A uniform definition was later presented by Person, Samborski & Rohringer (Person et al., 1962):  2  “A gene-for-gene relationship exists when the presence of a gene in one population is contingent on the continued presence of a gene in another population, and where the interaction between the two genes leads to a single phenotypic expression by which the presence or absence of the relevant gene in either organism may be recognized.” In summary, during incompatible interactions where pathogen recognition leads to resistance, there is an Avirulence (Avr) gene in the pathogen that conditions pathogenicity, and there is a corresponding Resistance (R) gene in the host plant that conditions resistance. Over the centuries, crop breeders have been either consciously or unconsciously applying the gene-for-gene hypothesis to screen for disease-resistant traits (Flor, 1971). However, the molecular nature of Avr genes and R genes remained unknown. Pseudomonas syringae pv. glycinea causes bacterial blight disease on soybeans. Staskawicz et al. cloned AvrB from Pseudomonas syringae pv. glycinea that can be recognized by soybean R gene, Rpg1 (Staskawicz et al., 1987), which was the first molecular genetic proof of Flor’s gene-for-gene hypothesis in a bacterial-plant interactions. The molecular nature of the first sets of R gene products in different host species was uncovered later. For example, the first cloned maize R gene, HM1, encodes a toxin reductase that inactivates the HC toxin that is produced by the fungus Cochliobolus carbonum (Johal and Briggs, 1992). The first tomato R gene cloned encodes a serine-threonine protein kinase (Martin et al., 1993), whereas in both Arabidopsis and tobacco the first cloned R genes encode NLR proteins (Bent et al., 1994; Mindrinos et al., 1994; Whitham et al., 1994). NLRs serve as immune receptors in both plants and animals. Over the past 25 years, tremendous progress has been made in understanding these R gene products and their roles in plant immunity. But there is still a lot we do not know, which awaits future explorations. 3  1.2 The plant immune system 1.2.1 Physical barriers and chemical inhibitions Pathogenic microorganisms infect host plants for nutrition. To infect a host plant, pathogens that land on the plant surface must overcome the front line of the plant immune system, which is comprised of both physical and chemical barriers (Senthil-Kumar and Mysore, 2013). The cuticle layer and the cell wall serve as natural physical obstructions in all plants. The plant cell wall is primarily composed of polysaccharides that are crosslinked through diverse biochemical interactions (Vorwerk et al., 2004). The polysaccharide network resists pathogen penetration. In a screen searching for mutants that do not support the normal growth of a fungal pathogen Erysiphe cichoracearum, Vogel et al. identified mutations in a pectate lyase that led to altered polysaccharide composition (Vogel et al., 2002), which indicates the importance of the cell wall in resistance against this pathogen. Some pathogens are able to penetrate into the cell wall using turgor pressure or cell wall degrading enzymes (Howard and Valent, 1996; Juge, 2006). Once pathogens have access to the apoplastic space, they are confronted by another obstacle: antimicrobial metabolites. Plants constitutively produce chemical compounds that have antimicrobial activities (Lee et al., 2008; Cecchini et al., 2011). For example, the glucosinolate hydrolysis products were shown to be effective in inhibiting the growth of a wide range of phytopathogenic bacteria (Aires et al., 2009).  Such physical and chemical barriers are usually sufficient to prevent most pathogen infections. But attempted pathogen invasion can induce immune receptor-mediated plant defense. 1.2.2 PAMP-triggered immunity As shown in Figure 1.1, plants use both membrane and cytosolic receptors to detect molecules from the pathogens (Chisholm et al., 2006; Jones and Dangl, 2006; Dangl et al., 2013). Pattern-4  recognition receptors (PRRs) localized on the plasma membrane can detect conserved pathogen-associated molecular patterns (PAMPs) and constitute the first layer of plant immunity, which is referred to as PAMP-triggered immunity (PTI). Responses downstream of PTI include calcium influx across the plasma membrane, activation of the mitogen-activated protein kinase (MAPK) signaling cascades, production of reactive oxygen species (ROS) as well as transcriptional reprogramming (Schwessinger and Zipfel, 2008). There are two known classes of PRRs in plants: leucine-rich repeat receptor like kinases (RLKs) and receptor like proteins (RLPs), both are transmembrane proteins and RLPs lack the intracellular kinase domain (Zipfel, 2008). RLK-encoding genes represent one of the largest gene families and consist of over 600 members in Arabidopsis (Shiu and Bleecker, 2001). This is in contrast to the RLP family that has only 57 members (Wang et al., 2008). The best studied PRR examples are Flagellin-sensing 2 (FLS2) and EF-Tu receptor (EFR).  Figure 1.1 The current model of inducible plant immune responses. PRRs: Pattern-recognition receptors. PAMPs: pathogen-associated molecular patterns. TTSS: type three secretion system. Avr: avirulent. PM: plasma membrane. NLR: nucleotide binding-leucine-rich repeat. (Modified from Wiermer) 5  Flagellin-sensing 2 (FLS2) perceives a 22-amino-acid peptide, Flg22 (Zipfel et al., 2004). Flg22 is derived from bacteria flagellin, the main building block of flagellum required for bacterial mobility (Felix et al., 1999). FLS2 is a transmembrane protein that belongs to the RLK family in Arabidopsis thaliana (Chinchilla et al., 2006). Genetic and biochemical analyses have shown that the recognition of flg22 by FLS2 also requires another RLK, BRI1-associated kinase 1 (BAK1) (Chinchilla et al., 2007). BAK1 and FLS2 function as co-receptors for flg22 (Sun et al., 2013). Upon ligand binding, FLS2 and BAK1 heterodimerize and transphosphorylate each other (Schulze et al., 2010). Interestingly, BAK1 also serves as a co-receptor for the plant hormone brassinosteroid (Li and Chory, 1997; She et al., 2011), suggesting a dual role in both plant development and immune responses. The FLS2-BAK1 complex constitutively associates with the receptor-like cytoplasmic kinase BIK1 (BAK1 interacting kinase 1) (Lu et al., 2010). Upon PAMP recognition, BIK1 is rapidly phosphorylated and released from the FLS2 complex. BIK1 directly phosphorylates the NADPH oxidase RbohD (respiratory burst oxidase protein D) at specific sites, which are required for PAMP-induced ROS burst (Nuhse et al., 2007; Zhang et al., 2007; Kadota et al., 2014; Li et al., 2014). Another well-characterized PRR in Arabidopsis is the EF-Tu receptor (EFR), which recognizes the bacterial elongation factor thermo unstable (EF-Tu) (Zipfel et al., 2006). This recognition is evolutionarily recent since it is confined to the Brassicaceae family (Boller and He, 2009). Different from FLS2, the function of EFR likely relies on the ER-quality control (ER-QC) system. A forward genetic screen in Arabidopsis identified several components of the ER-QC system including calreticulin3 (CRT3), UDP-glucose glycoprotein glucosyltransferase (UGGT), and ER retention defective 2B (ERD2B) (Li et al., 2009). Mutations in CRT3, UGGT and ERD2B significantly compromised EFR function, probably by affecting the biogenesis of EFR. 6  Interestingly, none of the above three components seems to be involved in FLS2-mediated immune responses.  1.2.3 Effector-triggered immunity PTI is usually sufficient to block most pathogen invasions. However, successful pathogenic microbes can deliver effector molecules into host cells to perturb PTI responses. To recognize these effectors in an arms race, plants have evolved R proteins. Recognition of effectors by R proteins initiates the second layer of the plant immune system, which is referred to as effector-triggered immunity (ETI) (Jones and Dangl, 2006; Dangl et al., 2013). ETI often leads to the accumulation of the defense molecule salicylic acid (SA) and to a hypersensitive response (HR), a hallmark of R protein activation (Coll et al., 2011). HR is believed to restrict pathogen growth and protect the host plants from repeated pathogen invasion (Coll et al., 2011).  R proteins recognize effectors through either direct or indirect interactions. Direct recognition requires physical associations between R proteins and the corresponding effector molecules. For example, the Recognition of Peronospora parasitica 1 (RPP1) directly recognizes its cognate oomycete effector Arabidopsis thaliana recognized 1 (ATR1) (Krasileva et al., 2010; Steinbrenner et al., 2015). In flax, the L, and M proteins directly recognize their cognate effectors AvrL567 and AvrM, respectively (Dodds et al., 2006; Catanzariti et al., 2010). In rice, the R protein Pita directly associates with AvrPita, an effector from Magnaporthe grisea (Jia et al., 2000). The activities exerted by effectors on host target proteins can also be sensed indirectly by R proteins (van der Hoorn and Kamoun, 2008). The host proteins may be bona fide virulence targets that are guarded by R proteins (the guard model), or serve as a mimic (decoy proteins) for the direct targets (the decoy model). Emerging data suggest that R proteins can also function in pairs in addition to the “gene-for-gene” mode of action (Eitas and Dangl, 2010). 7  In plants, the cytosolic nucleotide-binding leucine-rich repeat (NLR)-type receptors represent the largest class of R proteins. Based on their N-termini, plant NLR proteins can be classified into two subgroups (Meyers et al., 2003). The Toll- Interleukin-1 type NLR (TNL) proteins constitute the first group. The other group consists of CC-NLR (CNL) proteins, which possess an N-terminal coiled-coil motif. Between the N-terminal domain and LRR is the nucleotide binding pocket consisting of  NB (nucleotide binding) and ARC (Apaf-1, R proteins, CED-4) domains (van der Biezen and Jones, 1998). Signaling downstream of NLR proteins depends on which structural type of R protein has been activated (Aarts et al., 1998). For example, Enhanced Disease Susceptibility 1 (EDS1) is required for signaling by many TNL proteins (Aarts et al., 1998), whereas Nonrace-Specific Disease Resistance 1 (NDR1) is required for signal transduction downstream of many CNL proteins.  EDS1 serves as a critical signaling protein in basal defense (immune responses plants elicit against virulent pathogens) and ETI responses mediated by TNLs (Wiermer et al., 2005). EDS1 is a lipase-like protein and forms mutually exclusive heterodimeric complexes with its interaction partner PhytoAlexin Deficient 4 (PAD4) or Senescence-Associated Gene 101 (SAG101) (Wagner et al., 2013). An N-terminal hydrophobic helix of EDS1 docks within similar binding pockets of PAD4 and SAG101 at the N-terminus. EDS1-SAG101 association occurs in the nucleus, which is distinct from EDS1-PAD4 complex detected in both cytoplasm and nucleus (Feys et al., 2005). Coordination between cytoplasmic and nuclear pools of EDS1 is required to elicit balanced immune responses (García et al., 2010; Heidrich et al., 2011). The function of NDR1 in plant immunity has remained an enigma since its discovery. NDR1 encodes a ~48 kDa protein that localizes to the plasma membrane (PM) via a glycosylphosphatidyl-inositol (GPI) anchor at the C-terminus (Coppinger et al., 2004). NDR1 is 8  required for resistance mediated by an array of CNLs, including RPM1, RPS2 and RPS5 (Century et al., 1995). NDR1 also possesses a partial requirement for the TNL RRS1-mediated immunity (Deslandes et al., 2002). NDR1 belongs to a gene family that consists of 29 members in Arabidopsis (Varet et al., 2002). Structural modeling predicts NDR1 to share homology with integrin proteins in mammals (Knepper et al., 2011), which are PM-localized receptors that play critical roles in adhesion signaling (Huveneers and Danen, 2009). NDR1 thus may play a role in plasma membrane-cell wall adhesions and fluid movement in immunity (Knepper et al., 2011). Recent studies revealed that NLRs with “integrated domains” or NLR-IDs are critical initiators of plant immune responses (Sarris et al., 2016). These “integrated domains” may serve as bait or decoy domains to defend against potential pathogens. For example, the Arabidopsis RRS1 and RPS4 (Resistance to Pseudomonas syringae 4) function as a pair, and confer resistance to both fungal and bacterial pathogens (Narusaka et al., 2009). The RRS1 and RPS4 genes are physically linked in an inverted tandem manner. RPS1 encodes a TNL with a C-terminal WRKY domain. Two bacterial effectors AvrRps4 or PopP2 directly target the WRKY “decoy” domain in RRS1, the activity of which activates RPS4, a TNL, to trigger immune responses (Sarris et al., 2015). Genome wide analysis has uncovered large number of NLR-IDs in flowering plants (Sarris et al., 2016), and this information could be deployed to generate durable disease resistant crops. 1.2.4 NLR activation  How NLR proteins are activated is not well-understood. The “bait-and-switch” model posits that the NB-ARC domain serves as a molecular switch to regulate NLR function (Tameling et al., 2006; Collier and Moffett, 2009). The NB-ARC domain coordinates nucleotide binding activity. This model suggests that the ADP-bound states are associated with NLR 9  inactivation, while the ATP-bound states are associated with protein activation. For example, mutations in the NB-ARC domain of the tomato NLR I-2 compromise ATP hydrolysis and result in autoactivation of the receptor (Tameling et al., 2006). For potato Rx, the NB domain alone is able to induce immune responses (Rairdan et al., 2008). NLR proteins are also believed to be kept in autoinhibited states by LRR domains through intramolecular interactions in the absence of pathogens (Collier and Moffett, 2009). For example, overexpression of both TIR or CC domain alone can trigger cell death (Feys et al., 2005; Collier and Moffett, 2009). Recognition of effector molecules or ligands could release the autoinhibition and lead to the activation of NLRs. This could be achieved by either modification or removal of the target protein, or causing a conformational change. Studies on flax L6 and L7, two TNLs, suggest that NLRs may exist in an equilibrium between active and inactive states (Bernoux et al., 2016). An effector molecule, in contrast to binding to inactive receptors, more preferentially binds to active receptors and stabilizes that conformation.  Crystal structure analysis of mammalian NLRC4 revealed that the C-terminal LRR domain sequesters NLRC4 in an autoinhibited monomeric form through interaction with the NB domain (Hu et al., 2013). A mutant version of NLRC4 lacking the LRR domain constitutively activates immune responses. Upon recognition of bacterial pathogens by the NLR apoptosis inhibitory proteins (NAIPs) activates NLRC4 and the formation of an NAIP-NLRC4 inflammasome. Once activated, NLRC4 undergoes self-propagation to form a wheel-like structure (Hu et al., 2015; Zhang et al., 2015). Such oligomerization likely is also required for plant NLR activation. For example, the flax L6 and barley MLA10 self-associates through the TIR and CC domain, respectively (Bernoux et al., 2011; Maekawa et al., 2011b). The Arabidopsis RPS5 self-associates through the NB-ARC domains (Ade et al., 2007).  10  In addition to homo-oligomerization, “helper” NLRs may also be involved in NLR activation, based on genetic observations. The Arabidopsis ADR1 (Activated Disease Resistance 1) family proteins are required for immune responses mediated by multiple NLRs (Bonardi et al., 2011; Dong et al., 2016). The tobacco NRG1 (N requirement gene 1) is required for the function of N, which recognizes tobacco mosaic virus (TMV) (Peart et al., 2005). 1.2.5 NLR gene evolution NLR genes in both plants and vertebrates belong to the STAND (signal-transduction ATPases with numerous domains) P-loop ATPases of the AAA+ (ATPases Associated with diverse cellular Activities) superfamily (Leipe et al., 2004). NLRs represent one of the largest and massively expanded gene families in plants, with hundreds of copies occurring in angiosperm species (Clark et al., 2007; Shao et al., 2016). For example, in Arabidopsis there are about 150 NLR genes, and in rice there are around 460 NLRs (Meyers et al., 2003; Li et al., 2010a). This is in contrast to the vertebrate NLRs, which only consist of around 20 members (Lange et al., 2011).  NLR genes are also found in the ancient plant species including a moss Physcomitrella patens and a liverwort Marchantia polymorpha but not in an algae Chlamydomonas reinhardtii (Xue et al., 2012; Yue et al., 2012). In Physcomitrella patens, there are around 25 NLRs, while around 40 in Marchantia polymorpha. Interestingly, two noncanonical classes NLRs are found in these two species. The first class is found in Physcomitrella patens containing a protein kinase (PK) domain at the N-terminus forming a PK-NB-LRR (PNL). The second class is identified in Marchantia polymorpha that has an N-terminal α/β-hydrolase domain forming a Hydrolase-NB-LRR (HNL). In phylogeny, the PNL and HNL classes of NLRs seem to be closer to TNLs, suggesting that the CNL class might be more divergent (Xue et al., 2012). The co-expression of both TNLs and CNLs in Physcomitrella patens and the absence of NLRs in Chlamydomonas 11  reinhardtii suggest that NLRs may appear very early in the history of land plants (Jacob et al., 2013). Interestingly, the building blocks of NLRs, such as TIR, NB, LRR domains are found in eubacteria and archaebacterial (Yue et al., 2012), indicating that they already existed before the divergence of eukaryotes and prokaryotes (Jacob et al., 2013). The fusion of these domains may happen after plants moved from water to land. 1.2.6 The snc1 autoimmune model Although tremendous progress has been made over the past two decades, some fundamental questions still remain unanswered: (1) How are plant NLR proteins activated? What is the biochemical mechanism underling NLR activation? (2) What are the downstream components of NLR signaling pathways? And (3) how is protein homeostasis of plant NLRs dynamically regulated? We sought to understand the above questions by studying an autoimmune model snc1 (suppressor of npr1-1, constitutive 1) (Li et al., 2001; Zhang et al., 2003). The mutant snc1 constitutively activates immune responses even in the absence of a pathogen due to a point mutation in a TNL-coding gene (Figure 1.2). The snc1 mutant plants exhibit stunted growth, curly dark-colored leaves, constitutive expression of Pathogenesis-Related (PR) genes, accumulation of SA and enhanced disease resistance to the virulent oomycete pathogen Hyaloperonospora arabidopsidis (Hpa) Noco2 and the bacterial pathogen Pseudomonas syringae pv. maculicola (Psm) ES4326 (Li et al., 2001; Zhang et al., 2003). A unique feature of the snc1 mutant is that its plant size is inversely-correlated with its immune responses (Figure 1.2C). The stronger the defense, the smaller the plants will be and vice versa. This feature renders snc1 a powerful tool to dissect plant immune pathways using genetic screens by simply examining plant size. A good example is represented by our previous Modifiers of snc1 (MOS) 12  forward genetic screens (Johnson et al., 2013). The MOS screen was performed to identify mutants that can revert the snc1 dwarfism to wild type (WT). Characterization of these MOS genes that act as positive regulators has revealed many molecular events required for SNC1 function (Johnson et al., 2012). However, how SNC1 is negatively regulated to fine tune the positive immune responses remains unclear.  Figure 1.2 The snc1 autoimmune model. (A) Growth of Col-0 and snc1 autoimmune mutant (top) and immunoblot analysis of SNC1 protein levels in Col-0 and snc1 using an α-SNC1 antibody (bottom; Li et al., 2010). Bar = 1 cm. (B and C) Disease symptoms of plants infected with a bacteria pathogen (Psm ES4326) and an oomycete pathogen (Hpa Noco2) (Photo credit: Dr. Marcel Wiermer). (D) A diagram showing the inverse relationship between plant size and defense responses of snc1 mutant. (E) Chemical structure of salicylic acid (SA). (F) PR1 gene expression in WT and snc1. ACT1 is a loading control. Using an endogenous SNC1 antibody, Cheng et al. observed that the autoimmune phenotype of snc1 is due to increased SNC1 protein level (Figure 1.2A and Cheng et al., 2011). Thus, to maintain SNC1 protein homeostasis and to avoid autoimmunity, SNC1 protein levels are under tight negative control. Post-translationally, the Skp1-Cul1-F-box (SCF) E3 ligase CPR1 (Constitutive Expresser of Pathogenesis Related Genes 1) targets SNC1 for ubiquitin-α-SNC1 13  mediated protein degradation through the 26S proteasome (Cheng et al., 2011). This study revealed an important role for ubiquitination in maintaining NLR homeostasis.  The general role of the ubiquitin-proteasome pathway is to conjugate ubiquitin moieties to the Lysine (Lys) residues of the substrates and target them for the 26S proteasome-mediated degradation (Smalle and Vierstra, 2004). The eukaryotic 26S proteasome is a megadalton protein complex consisted of more than 30 subunits that degrades most proteins in the cytosol and nucleus (Voges et al., 1999). The proteasome contains a barrel-shaped 20S proteolytic core complex and one or two 19S regulatory particle capped at each end of the core (Groll and Huber, 2003). The lid of the regulatory complex recognizes ubiquitinated substrates and delivers them to the catalytic core for degradation. Dysfunction of proteasome subunits has been linked to diverse human diseases, such as Alzheimer’s disease, Parkinson’s disease and Huntington’s disease (Paul, 2008). The ubiquitination of substrate proteins is a stepwise enzyme-catalyzed reaction that depends on three types of enzymes: the E1 ubiquitin activating enzyme, the E2 ubiquitin conjugating enzyme and the E3 ubiquitin ligase (Trujillo and Shirasu, 2010), with the E3 ligases determining the substrate specificity. There are over 1,500 E3 ligases in the Arabidopsis genome and almost half of them belong to the F-box gene superfamily (Gagne et al., 2002; Mazzucotelli et al., 2006). The F-box type E3 ligases play diverse roles in plant growth, development and responses to environmental stresses. For example, several F-box proteins have been identified to function as receptors or co-receptors for plant hormone auxin (TIR1), jasmonate acid (COI1) and strigolactone (MAX2) (Dharmasiri et al., 2005; Katsir et al., 2008; Sheard et al., 2010; Yao et al., 2016).  14  In addition to the well-documented roles in hormone signaling, F-box proteins have also been implicated in floral development (Samach et al., 1999), circadian clock (Somers et al., 2000), photomorphogenesis (Dieterle et al., 2001) and plant defenses (Kim and Delaney, 2002; Gou et al., 2009; Gou et al., 2012). Our previous study on SCFCPR1 highlights the importance of F-box E3 ligases in the regulation of plant NLR proteins.  Interestingly, in addition to SNC1, CPR1 also targets another CNL protein, RPS2, for degradation. Thus, CPR1 plays an important negative role in the regulation of protein levels of SNC1 and RPS2. Figure 1.3 illustrates our current understanding of the SCFCPR1 complex. Besides CPR1, some other components are required for the efficient degradation of NLR proteins in vivo, including SRFR1 (Suppressor of rps4-RLD1), SGT1 (Suppressor of G2 allele of skp1) and an E4 ligase (Azevedo et al., 2006; Li et al., 2010c; Huang et al., 2014b). We hypothesize that additional negative regulators might also be required for SNC1-mediated immunity.   Figure 1.3 The SCFCPR1 complex. Sequential ubiquitination of NLR proteins through the E1, E2 and E3 enzymes leads to the degradation of NLRs by the 26S proteasome. Rbx1: RING box protein 1. CUL1: Cullin 1. Skp1: S-Phase Kinase-Associated Protein 1.  1.3 The muse forward genetic screen To isolate novel negative regulators of immunity, our lab performed a mutant, snc1-enhancing (muse) forward genetic screen to search for mutants that can enhance snc1-mediated immune responses (Huang et al., 2013). The screen was conducted in the mos2 snc1 npr1 and mos4 snc1 15  genetic backgrounds. MOS2 contains one G-patch (glycine-rich) domain and two KOW (Kyrpides, Ouzounis and Woese) motifs, which are predicted RNA binding domains (Kyrpides et al., 1996; Aravind and Koonin, 1999) that may function in RNA processing (Zhang et al., 2005). MOS4 encodes a key component of a nuclear complex called the MOS4-Associated Complex (MAC), which shares homology with the spliceosome-associated Nineteen Complex (NTC) in yeast and humans. The MAC complex functions in proper splicing of NLR genes (Monaghan et al., 2009; Xu et al., 2012). Introducing the mos mutations in the snc1 background enabled the isolation of mutants with subtle phenotypes and at the same time avoided lethality due to severe dwarfism. My thesis study mainly focused on the isolation and characterization of other muse mutants identified from the mos2 snc1 npr1 background.  From the MUSE screen, I identified alleles of known negative regulators of resistance such as bon1, cpr1, siz1, and a gain-of-function snc1 allele (Table 1.1 and Huang et al., 2013). A total of 15 muse mutants harboring mutations in novel genes were later cloned. Characterization of these MUSE genes has revealed complex regulations of snc1-mediated immunity. I will first describe the MUSE genes that were previously characterized by others in my lab, including their possible connections to regulating immunity.   Table 1.1 muse mutants investigated in this thesis. Mutant Gene Mutation Mutation site AA change Ref 1316 SNC1 G2482 to A 4th exon N710 to D Li et al., 2001; Huang et al., 2013 170 BON1 G2317 to A 12th exon G397 to R Hua et al., 2001 lk40 BON1 G1669 to A 8th intron \ Hua et al., 2001 lk14 CPR1 G790 to A 1st exon D264 to N Clarke et al., 2001 lk76 SIZ1 G4109 to A 15th exon Stop codon Lee et al., 2007  Mutants are labelled in lab code. AA, amino acid. 16  1.4 Summary of novel Mutants, snc1-enhancing (MUSE) genes 1.4.1 MUSE3 and MUSE6 are both involved in turnover regulation of NLRs 1.4.1.1 MUSE3 MUSE3 was cloned from the mos4 snc1 background (Huang et al., 2013). It encodes a ubiquitin conjugating E4 enzyme. E4 enzymes are conserved from yeast to humans and facilitate the formation of polyubiquitin chains on ubiquitin-conjugated substrates (Koegl et al., 1999). The yeast UFD2 represents the first identified class of E4 enzymes that contain a conserved C-terminal ~70 amino acids, termed the U-box domain, which is also present in MUSE3 (Koegl et al., 1999; Huang et al., 2013). The U-box domain is structurally similar to the RING-finger motif commonly found in E3 ligases (Aravind and Koonin, 1999). In Arabidopsis, MUSE3 is a single copy gene, the loss of which causes slight growth defects and enhanced resistance to virulent pathogens (Huang et al., 2013). Genetic complementation showed that the Arabidopsis MUSE3 can fully rescue the growth defect of the yeast ufd2Δ at 37 ̊C, which suggests that MUSE3 is orthologous to the yeast UFD2 and MUSE3, and may also be involved in polyubiquitin chain elongation (Huang et al., 2013).  Biochemical assays showed that in muse3 knockout plants the protein level of two NLRs, SNC1 and RPS2, was increased, while MUSE3 overexpression promotes the degradation of these two NLRs mediated by CPR1 through the 26S proteasome. When transiently expressed in Nicotiana benthamiana, MUSE3 directly associates with SNC1 but not with RPS2 or CPR1. When MUSE3 and RPS2 were co-expressed in N. benthamiana, MUSE3 facilitates the formation of polyubiquitin chains on RPS2, which was not observed for SNC1 on immunoblots. This phenomenon suggests that additional components are needed for the formation of polyubiquitin chains on SNC1, or that the polyubiquitinated form of SNC1 was too transient or 17  unstable to be detected. This study provides the first functional study of a plant E4 enzyme and its role in plant immunity.  1.4.1.2 MUSE6 Plant NLRs are under tight negative control to avoid autoimmunity. However, the mechanism is not well understood. Xu et al. uncovered that N-terminal acetylation plays a crucial role in plant NLR protein turnover to maintain their homeostasis (Xu et al., 2015). Protein lifespans range from minutes to days. The N-end rule pathway regulates the half-life of a protein based on its N-terminal residues (Varshavsky, 2011). There are two types of N-end rule pathways as part of the ubiquitin system in eukaryotes: the N-terminal acetylation pathway (Ac/N) and the N-terminal arginylation (Arg/N) pathway. In humans, more than 80% of human proteins are targets of the Ac/N pathway. N-terminal acetyltransferases (Nats) catalyze the N-α-terminal acetylation and contribute to the Ac/N pathway in eukaryotes.  Mass spectrometry (MS) analysis revealed that SNC1 undergoes translational alternative initiation resulting in protein isoforms with distinct N-termini (Xu et al., 2015). The first isoform contains two methionines (Met) followed by an aspartate (MMD form) at the N-terminus, while the second isoform only contains one Met at the N-terminus (MD form). MUSE6, the Arabidopsis ortholog of the yeast Naa15, the auxiliary subunit of NatA, acetylates the first Met of SNC1 (MMD form) and leads to the degradation of SNC1. In contrast, NatB acetylates the second Met of SNC1 (MD form) and stabilizes the protein.  In addition to SNC1, NatA likely also acetylates the first Met of another NLR protein, RPM1, and contributes to RPM1 degradation. The NatA mutant naa15-1 accumulates more RPM1 protein and is more resistant to bacterial pathogen Pst AvrRpm1. Since RPM1 starts with MA at its N-terminus, it is not likely a target of NatB. Indeed, the NatB mutant plants did not 18  show any detectable difference in response to Pst AvrRpm1 compared with WT plants. The antagonistic regulation of SNC1 by these two Nats may provide flexibility to the target protein in response to both intrinsic and external stimuli. 1.4.2 MUSE4 DNA-dependent RNA polymerases (Pols) play critical roles in transcription. There are three common Pols (Pols I, II and III) present in all eukaryotes, each possessing distinct roles (Cramer et al., 2008). Plants also have two additional Pols, Pol IV and Pol V that are involved in small interference RNA (siRNA) biogenesis (Haag and Pikaard, 2011). Since knockout mutations in Pols are usually lethal, functional studies of plant Pols are lacking. Johnson et al. identified a partial loss-of-function plant Pol III subunit mutant, muse4/nrpc7-1, which is viable (Johnson et al., 2016). The nrpc7-1 mutation alters the expression of U6 snRNA, 5S rRNA and a number of tRNAs transcribed by Pol III. In addition, the alternative splicing pattern of SNC1 is also altered by the nrpc7-1 mutation in the mos4 snc1 background, which might be the major cause of the snc1 enhancing phenotype. Interestingly, the nrpc7-1 single mutant plants did not show altered immune responses. Since Pol III plays a general role in the generation of several types of RNA molecules, the nrpc7-1 mutant exhibited pleiotropic phenotypes including dwarf growth statue, stunted roots and siliques and serrated leaves.  1.4.3 MUSE5 Mitochondria are double membraned organelles that are likely derived from proteobacteria (Lister et al., 2005). They contain more than 1,000 different proteins, most of which are synthesized in the cytosol and imported into the organelle across one or two membranes. The TIM23 (translocase of the inner membrane 23) complex residing on the mitochondria inner 19  membrane mediates the translocation of precursor proteins into the matrix, a process also requiring the presequence translocase-associated motor (PAM). PAM is comprised of the mitochondrial HSP70 and several other co-chaperone proteins (van der Laan et al., 2010), the function of which is not well understood in plants. From the mos4 snc1 background, an Arabidopsis ortholog of the yeast PAM16, MUSE5, was identified to play a negative role in plant immunity (Huang et al., 2013).  The yeast pam16 knockout strain is lethal, suggesting PAM16 is required for cell viability (Frazier et al., 2004). A partial loss-of-function strain pam16-1 is sensitive to high temperature and show growth defects at 37 ̊C but normal at 30 ̊C. Transforming an Arabidopsis copy of AtPAM16 can fully rescue the growth defects of the yeast pam16-1. Interestingly, a copy of the yeast PAM16 can also complement the Atpam16-1/muse5-1 mos4 snc1 triple mutant, indicating that PAM16 is functionally conserved among eukaryotes (Huang et al., 2014). The Arabidopsis pam16 single mutant plants exhibit enhanced disease resistance and accumulate higher level of ROS level compared with wild type plants. It is possible that MUSE5/AtPAM16 negatively regulates immunity through repressing ROS production. However, the targets of AtPAM16 remain unknown.  1.4.4 MUSE9 The Li lab previously identified MOS1 and MOS9 as positive regulators of SNC1 at the chromatin level (Li et al., 2010b; Xia et al., 2013). MOS1 encodes a HLA-B Associated Transcript 2 (BAT2) domain-containing protein that may be involved in the DNA methylation of the upstream region of SNC1 through chromatin remodeling. MOS9 associates with the histone methyl transferase Arabidopsis Trithorax-Related 7 (ATXR7). Both MOS9 and ATXR7 contribute to the expression regulation of SNC1 and the trimethylation level of lysine 4 of 20  histone 3 (H3K4) in the SNC1 promoter region. From the muse screen, a chromatin remodeling protein MUSE9, was isolated that negatively regulates snc1-mediated immunity (Johnson et al., 2015). MUSE9 encodes the SWI/SNF (SWItch/Sucrose Non-Fermentable) chromatin remodeler SYD (SPLAYED), an ATPase subunit of chromatin-remodeling complexes (Wagner and Meyerowitz, 2002). The muse9/syd-10 mutant displays WT-like resistance against the bacterial pathogen Psm ES4326 but increased SNC1 transcript level. This study suggests that SYD may act antagonistically to MOS1 and MOS9 to repress SNC1-mediated immunity at the chromatin level.  1.4.5 MUSE15 The “helper” NLR ADR1 family has three members, including ADR1, ADR1-L1 (ADR1-like 1) and ADR1-L2 (Bonardi et al., 2011). Our lab identified muse15, an allele of adr1-L1 (Dong et al., 2016). Loss of ADR1-L1 enhances the autoimmune phenotypes of several mutants including snc1, cpr1, bal1 and lsd1. In contrast, loss of either adr1 or adr1-L2 can suppress snc1, suggesting unequal redundancy among the ADR1 family members. Notably, the adr1 adr1-L1 adr1-L2 (adr1 triple) triple mutant completely suppresses snc1. The discrepancy between adr1-L1 and adr1 triple could be explained by the fact that ADR1 and ADR1-L2 may overcompensate for the loss of ADR1-L1. Indeed, in the adr1-L1 background the transcript levels of both ADR1 and ADR1-L2 are upregulated. These data raise the possibility that ADR1-L1 might be a negative regulator of ADR1 and ADR1-L2 at the transcriptional level. Such overcompensation reveals intricate and dynamic regulation of sensor NLR activation by helper NLRs, and will be of great interest for further investigation. 21  1.5 Thesis objectives As more negative regulators were hypothesized to function in the NLR degradation pathway, we carried out a MUSE forward genetic screen to search for them. The MUSE genetic screen has uncovered 15 snc1 enhancers. This dissertation aims to pursue the following objectives: (1) Characterize the immune phenotypes of four muse mutants including muse10, muse12, muse13 and muse14. A combination of gene expression analyses and pathogen infection assays will be used. (2) Determine the molecular lesions of these mutants and perform functional studies of the corresponding genes in plant immunity. (3) Uncover novel components or pathways involved in the negative regulation of SNC1-dependent and/or –independent pathways. By investigating the roles of MUSE10, MUSE12, MUSE13 and MUSE14, we gained more understanding of the turnover of plant NLRs.          22  Chapter 2 HSP90s are Required for NLR Immune Receptor Accumulation in Arabidopsis thaliana 1    2.1 Summary Heat shock proteins (HSPs) serve as molecular chaperones for diverse client proteins in many biological processes. In plant immunity, cytosolic HSP90s participate in immune receptor complex assembly, stability control and/or activation. In this study, we report that in addition to the well-established positive roles certain HSP90 isoforms play in plant immunity, HSP90s are also involved in the turnover of immune receptors. Point mutations in two HSP90 genes, HSP90.2 and HSP90.3, were identified from a forward-genetic screen designed to isolate mutants with enhanced disease resistance. We found that specific mutations in HSP90.2 and HSP90.3 lead to the accumulation of cytosolic immune receptors including SNC1, RPS2 and RPS4. HSP90s may assist SGT1 in the formation of SCF E3 ubiquitin ligase complexes that target immune receptors for degradation. Such regulation is critical for maintaining appropriate immune receptor protein levels to avoid autoimmunity.      1 A version of this chapter has been published. Huang, S., Monaghan, J., Zhong, X., Lin, L., Sun, T., Dong, O.X., and Li, X. (2014). HSP90s are required for NLR immune receptor accumulation in Arabidopsis. The Plant Journal 79(3), 427-439. 23  2.2 Introduction Plants utilize different mechanisms to protect themselves against diseases caused by multiple pests. Cytosolic nucleotide-binding, leucine-rich repeat receptor (NLR)-type R proteins mediate defense against many microbial pathogens (Chisholm et al., 2006; Jones and Dangl, 2006; Dangl et al., 2013). The majority of plant NLR proteins contain either a Toll-Interleukin-1 Receptor-like (TIR) or a coiled-coil (CC) domain at their N-terminus, a central nucleotide-binding (NB) domain, and a C-terminal leucine-rich repeat (LRR) domain (Maekawa et al., 2011a). Remarkably, although they evolved independently, animal immune receptors share many of these domain features (Ausubel, 2005). Heat shock proteins (HSPs) are highly conserved and abundant proteins that accumulate in response to biotic and abiotic stresses and serve as molecular chaperones for diverse client proteins. For example, HSP90 associates with many co-chaperones and co-factors to form large protein complexes that facilitate proper folding and/or maturation of client proteins. Analysis of large-scale HSP protein interaction networks suggests that a major function of these molecular chaperones is to promote and maintain proper protein complex assembly (Zhao et al., 2005). In mammalian cells, the HSP90 chaperone machinery has been reported to be responsible for the activation and stabilization of over 200 client proteins (Wandinger et al., 2008; Makhnevych and Houry, 2012) , thereby assisting many important signaling events and cellular processes.  As in animals, plant HSP90s localize to different cellular compartments. In Arabidopsis, there are four partially redundant cytosolic HSP90s (HSP90.1, HSP90.2, HSP90.3 and HSP90.4) (Hubert et al., 2009), one chloroplast-localized HSP90 (HSP90.5), one mitochondrial HSP90 (HSP90.6), and one endoplasmic reticulum-localized HSP90 (HSP90.7) (Krishna and Gloor, 2001; Hubert et al., 2003). Data arising from mutant studies revealed that HSP90s play diverse 24  roles in plant biology, including immunity, light signaling, chloroplast biology, and general growth and development (Shirasu, 2009; Kadota and Shirasu, 2012). These functions are likely realised through protein complex assembly and/or stability control of a wide-range of HSP90 client proteins during different signaling processes.  In response to pathogen infection, HSP90 interacts with the Nod-like immune receptors NALP3 and IPAF in human cells (Mayor et al., 2007), and also modulates the activities of plant NLR resistance (R) proteins including MLA, RPM1, RPS2, RPS4, I2 and N, together with co-chaperones RAR1 and SGT1 (Shirasu et al., 1999; Hubert et al., 2003; Takahashi et al., 2003; Liu et al., 2004; Zhang et al., 2004; de la Fuente van Bentem et al., 2005). Plants without functional HSP90s or their co-chaperone RAR1 exhibit reduced R protein mediated immunity (Muskett et al., 2002), and lower accumulation of immune receptors including MLA1 and MLA6 (Bieri et al., 2004), Rx (Lu et al., 2003; Botër et al., 2007), RPM1 (Hubert et al., 2003), RPS5 (Holt et al., 2005), Mi-1 and I-2 (Van Ooijen et al., 2010), suggesting that these chaperones are critical for NLR stability and immune receptor complex formation. A similar observation was made with human Nod-like receptors, which also utilize the HSP90-SGT1 chaperone complex to maintain appropriate levels in the cell (Hahn, 2005; da Silva Correia et al., 2007; Mayor et al., 2007).  Interestingly, the molecular function of the co-chaperone SGT1 seems more complex. In plants, SGT1 is needed for the maintenance of steady-state levels of NLRs including Rx and N (Azevedo et al., 2006; Mestre and Baulcombe, 2006; Botër et al., 2007), while in humans it is required for inflammasome activity rather than receptor stability (da Silva Correia et al., 2007; Mayor et al., 2007). SGT1 not only performs a positive role in regulating plant NLR activity, but also serves a negative function in controlling the turnover of NLRs such as RPM1, RPS5, and 25  SNC1 as these NLR proteins accumulate to abnormally high levels in sgt1b mutant plants (Holt et al., 2005; Li et al., 2010c). The multi-functionality of SGT1 may reflect a diverse client base involving different protein complexes assembled during immune responses.   Previous studies have shown that alteration or reduction in HSP90 chaperone activities leads to increased susceptibility to pathogens in Arabidopsis (Hubert et al., 2003; Lu et al., 2003; Holt et al., 2005; Hubert et al., 2009; Bao et al., 2014a), indicating that HSP90 is required for NLR protein complex assembly, stability, and/or activation. In this study, we report that in addition to the well-studied positive roles that HSP90 isoforms play in plant immune responses, HSP90s are also involved in the turnover control of NLRs. Such regulation is crucial for the maintenance of appropriate NLR protein levels to avoid over-accumulation that may lead to autoimmune responses.   2.3 Materials and methods 2.3.1 Plant growth  Arabidopsis seeds were surface-sterilized and stratified at 4°C for 48 h. Seeds were sown on sterilized soil and grown under ambient environment (16 h light/ 8 h dark, 22°C) in a growth room. 2.3.2 Ethyl methanesulfonate (EMS) mutagenesis and suppressor screen  The mos2 snc1 npr1 seeds were treated with 20 mM EMS for 16 h with gentle shaking. The mutagenized M1 seeds were sown on half-strength Murashige and Skoog (MS) medium. For the primary screen, approximately 5,000 M1 plants were transplanted to soil and self-fertilized. About 80,000 M2 seeds representing 4,000 M1 plants were screened for snc1-like morphology. About 30,000 M2 seeds from the rest 1,000 M1 plants were planted on 1/2 MS medium and stained for pBGL2-GUS, a defense reporter gene in the background. muse10 was identified from 26  the morphology screen, while muse12 was isolated from the GUS screen. For the secondary screen, putative mutants were further analyzed using assays including PR gene expression and Hpa Noco2 infection.  2.3.3 Mapping and next-generation sequencing For map-based cloning, homozygous muse10 mos2 snc1 npr1 was crossed with Ler. Thirty F2 plants from self-fertilized F1 plants exhibiting snc1-like or smaller-than-snc1 morphology were used for crude mapping. For fine mapping, about five hundred F3 plants generated from F2 plants heterozygous for muse10, wild-type for mos2 and homozygous for snc1 were used. After the muse10 mutation was narrowed down between markers MBG8 (22.3 Mb) and MUA2 (23.3 Mb) on Chromosome 5, next-generation re-sequencing was performed to identify mutations within the muse10 flanked region. Plants homozygous for both snc1 and muse10 from seven individual mapping lines were pooled. About 10 g tissue were collected nuclear genomic DNA was extracted. The purified DNA was sequenced using Illumina whole-genome re-sequencing as previously described (Huang et al., 2013). The mutation in AT5G56010 was confirmed by Sanger sequencing using AT5G56010-seg-F and AT5G56010-seg-R (Table 2.1). 2.3.4 Semi-quantitative RT-PCR Plants were grown on 1/2 MS for two weeks. About 0.1 g of whole plant tissue was collected and RNA was extracted using an Ambion kit (Invitrogen). RNA was reverse transcribed to cDNA using Superscript II reverse transcriptase (Invitrogen). PCR amplification was performed using equal amount cDNA sample as template. Primers for PR1, PR2, ACTIN1, and SNC1 have been described previously (Zhang et al., 2003).  27  2.3.5 Pathogen assays Ten-day-old soil-grown seedlings were surface-sprayed with Hpa Noco2 (propagated weekly on Col-0 plants) at a concentration of 120,000 spores/mL water. Plants were then incubated for 7 days in a humid growth chamber (12 h light/ 12 h dark, 16°C) before the number of Hpa Noco2 spores were quantified using a haemocytometer.  Four-week-old soil-grown plants were used for bacterial infection assays. A bacterial suspension was pelleted from rich media and resuspended in 10 mM MgCl2. Bacterial solution at indicated concentration was pressure-infiltrated into the underside of Arabidopsis leaves with a needless syringe. Leaf punches were collected at Day 0 and Day 3 and ground in a 1.5 mL tube containing 10 mM MgCl2. Bacteria were serially diluted and plated on LB plates containing antibiotics and incubated at 28°C for two days before colony forming units (cfu) were counted.  2.3.6 Transgenic complementation A PCR fragment of the full-length genomic AT5G56010 DNA containing 1,367 bp of genomic region before the start codon but without a stop codon was amplified using AT5G56010-KpnI-F and AT5G56010-PstI-R (Table 2.1) from Col-0 or muse10 mos2 snc1 npr1 plants and cloned into the KpnI and PstI sites of pCambia1305-HA vector to generate pHSP90.3::HSP90.3-HA and pHSP90.3::HSP90.3muse10-HA constructs. A similar PCR fragment amplified using AT5G56010-KpnI-F and AT5G56010-PstI-R2 (Table 2.1) but including the stop codon was used to generate the pHSP90.3::HSP90.3 construct. The constructs were stably transformed by Agrobacterium tumefaciens into Arabidopsis using the floral dip method (Clough and Bent, 1998).  2.3.7 Protein extraction, co-immunoprecipitation and western blots The co-IP experiments were performed as previously described (Moffett et al., 2002). Briefly, Agrobacterium containing the binary vector pCambia1300 or pCambia1305 expressing the target 28  genes were cultured in liquid LB media containing 50µg/mL kanamycin at 28 ºC (225 rpm / min) overnight. The bacteria (1:50 dilution) was then transferred to new media (10.5 g/L K2HPO4, 4.5 g/L KH2PO4, 0.5 g/L NaCitrate, 1.0 g/L (NH4)2SO4, 0.2% glucose, 0.5% glycerol, 1 mM MgSO4, 50 µM acetosyringone, and 10 mM N-morpholino-ethanesulfonic acid (MES) pH 5.6), 50 µg/mL kanamycin) and cultured at 28 ºC (225 rpm / min) for another 12-14 hours. Cells were then harvested by centrifugation at 4000 rpm for 10 min and re-suspended in MS buffer (4.4 g/L MS, 10 mM MES, 150 µM acetosyringone). For infiltration, each bacterial strain was diluted to a final concentration of OD600 = 0.2. Four-week-old N. benthamiana leaves were used in this study. For co-immunoprecipitation, about 3 g of leave tissues were collected at 36 h post infiltration (hpi) and ground into fine power in liquid nitrogen using a pre-chilled mortar and pestle. All the following procedures were carried out at 4°C. The powder was further homogenized in 6 mL  extraction buffer (10% glycerol, 25 mM Tris-HCl pH7.5, 150 mM NaCl, 2% w/v PVPP, 1 mM EDTA, 10 mM DTT, 1 mM PMSF and 1x protease inhibitor cocktail (Sigma)) by further grinding in 4°C cold room. The sample was then spinned down (15000 rpm, 10 min). Supernatant was collected into 1.5 mL tubes and NP40 (Nonidet P-40 Substitute) was added to a final concentration of 0.15%. Then 20 µL protein A beads was added to pre-clear the sample by gentle rotation for 30 min. Protein A beads were then pelleted down by centrifugation (8000 rpm, 1 min). Supernatant was collected into a new set of 1.5 mL tubes. The tagged proteins were immunoprecipitated using anti-FLAG beads by gentle rotation for 3 h. Then the anti-FLAG beads were pelleted by centrifugation (8000 rpm, 1 min) and washed for 8 times using extraction buffer containing 0.15% NP40. About 100 µl of 250 µg/ml 3xFLAG peptides were then used to elute the proteins bound to the beads. Crude extracts and immunoprecipitated 29  proteins were boiled in sodium dodecyl sulfate (SDS) loading buffer for 7 min and detected by western blot using the corresponding antibodies. 2.4 Results 2.4.1 The muse10 and muse12 mutants enhance snc1-mediated autoimmune phenotypes The Arabidopsis mutant suppressor of npr1, constitutive 1 (snc1) contains a gain-of-function mutation in the TIR-NB-LRR protein SNC1 (Li et al., 2001; Zhang et al., 2003). This mutation enhances the stability of SNC1 and results in the induction of defense pathways regardless of pathogen presence (Cheng et al., 2011). In addition to its autoimmune phenotypes, snc1 plants also exhibit dwarf morphology as a consequence of constitutive activation of defense responses. As the defense outputs of snc1 are inversely-correlated with the size of the mutant plants (Li et al., 2001; Zhang et al., 2003), this unique mutant has been a valuable tool to transform difficult immune phenotypes into more obvious plant size and morphological characteristics, enabling rapid genetic screening. Indeed, our past work on snc1 suppressing modifier of snc1 (mos) mutants identified an array of loci required for NLR-mediated immunity (reviewed in Johnson et al. 2013).  Although NLRs are under tight negative regulation to avoid autoimmunity, only a handful of proteins involved in this process have been studied.  To identify negative regulators of NLR protein mediated immunity, we performed a snc1 enhancer screen using both mos2 snc1 npr1 and mos4 snc1 backgrounds (Huang et al., 2013) to search for mutants that restore or enhance snc1-like morphology and constitutive defense responses despite the suppressive effects of mos2 or mos4. As MOS2 and MOS4 are involved in RNA-processing and contribute to proper splicing of SNC1 (Zhang et al., 2005; Palma et al., 2007; Xu et al., 2012), loss of this regulation in mos2 or mos4 mutants suppresses the constitutive immune responses observed in snc1 plants. 30  Our screen resulted in the isolation of over 10 mutant, snc1 enhancer (muse) mutants (Huang et al., 2013), including muse10 and muse12 which were isolated in the mos2 snc1 npr1 background. Quadruple muse10 mos2 snc1 npr1 plants were much smaller than control mos2 snc1 npr1 and exhibited snc1-like dwarfed stature and curled leaf morphology (Figure 2.1a). As mos2 completely suppresses the high PR gene expression in snc1 (Zhang et al., 2005), we examined whether the muse10 mutation affects PR gene expression in mos2 snc1 npr1. Consistent with the alteration of mos2 snc1 npr1 morphology by muse10, the muse10 mos2 snc1 npr1 plants exhibited increased PR1 and PR2 expression compared to the triple mutant parent (Figure 2.1b). The snc1 mutant exhibits enhanced disease resistance against the virulent oomycete pathogen Hyaloperonospora arabidopsidis (Hpa) Noco2, which is suppressed in mos2 snc1 npr1. To test whether muse10 alters the disease resistance in mos2 snc1 npr1, we challenged muse10 mos2 snc1 npr1 plants with Hpa Noco2. The quadruple mutant plants displayed enhanced disease resistance compared to the triple mutant control, however they were not as resistant as snc1 (Figure 2.1c). Similar snc1-restorative phenotypes were observed in another mutant from our collection, muse12 mos2 snc1 npr1 (Figure 2.2). Taken together, these data indicate that both muse10 and muse12 restore autoimmunity of snc1 in the mos2 snc1 npr1 background. 2.4.2 MUSE10 is HSP90.3 To identify the molecular lesion responsible for muse10, we combined classical mapping with next-generation sequencing as recently described for the muse5 locus (Huang et al., 2013). The muse10 mos2 snc1 npr1 mutant in the Columbia (Col-0) ecotype was crossed with Landsberg erecta (Ler) to generate a segregating F2 mapping population. Thirty F2 plants showing snc1-like or enhanced-snc1 morphology were used for linkage analysis. Crude mapping indicated that muse10 was linked to the bottom arm of Chromosome 5. For fine mapping, about five hundred 31  F3 plants were utilized from selected F2 progeny with genotypes that were heterozygous for muse10, wild-type for mos2 and homozygous for snc1. Homozygosity at MOS2 and snc1 loci prevented their interference on the sizes of the segregating F3 progeny. Through fine-mapping, the muse10 mutation was narrowed down to a 1 Mbp region flanked by markers MBG8 (22.3 Mbp) and MUA2 (23.3 Mbp) on Chromosome 5 (Figure 2.3a).    Figure 2.1 Morphological and immune phenotypes of the muse10 mos2 snc1 npr1 quadruple mutants. (a) Morphology of Col-0, snc1, mos2 snc1 npr1 and muse10 mos2 snc1 npr1 plants. Plants were grown on soil under long-day conditions (16 h light/8 h dark). The photograph was taken when plants were four weeks old. Scale bar is 1 cm.  (b) PR1 and PR2 gene expression in plants of the indicated genotypes. The amplification of PR1, PR2 and ACT1 are 32, 29 and 32 cycles, respectively. The RT-PCR products were analyzed by 1% agarose gel electrophoresis. ACT1 was used as loading control. The experiment was repeated three times with similar results. (c) Quantification of Hpa Noco2 growth. Two-week-old soil-grown seedlings were spray-inoculated with Hpa Noco2 at a concentration of 120,000 spores /mL of water. The number of conidia spores on leaf surface was quantified 7 d post inoculation (dpi). Bars represent means ± SD (n=5 with 4 plants each). Letters indicate statistical difference (p<0.05, Bonferroni post-test). The experiment was repeated three times with similar results. (a) (c) (b) a a b b 32                 Figure 2.2 Morphological and immune phenotypes of the muse12 mos2 snc1 npr1 quadruple mutant plants. (a) Morphology of Col-0, snc1, mos2 snc1 npr1 and muse12 mos2 snc1 npr1 plants. Plants were grown on soil under long-day condition (16 h light/8 h dark). The photograph was taken when plants were four weeks old.  (b) Semi-quantitative RT-PCR analysis of PR1 and PR2 gene expression in Col-0, snc1, mos2 snc1 npr1 and muse12 mos2 snc1 npr1 plants. (c) Growth of Hpa Noco2 on Col-0, snc1, mos2 snc1 npr1 and muse12 mos2 snc1 npr1 plants. Two-week-old soil-grown seedlings were spray-inoculated with Hpa Noco2 at a concentration of 120,000 spores /mL of water. The number of conidia spores on leaf surface was quantified 7 d post inoculation (dpi). Bars represent means ± SD (n=5 with 4 plants each). Letters indicate statistical difference (p<0.001, Bonferroni post-test). The experiment was repeated three times with similar results. To identify mutations within the flanked region, next-generation whole-genome re-sequencing was performed using genomic DNA extracted from pooled mapping lines that were homozygous for both snc1 and muse10. Comparison of the sequences in the muse10 flanked region identified four point mutations unique to muse10 (Figure 2.3b). These mutations were confirmed to be homozygous in the muse10 mos2 snc1 npr1 mutant and not present in the original snc1 mos2 npr1 mutant background by Sanger sequencing. Only two of them caused 33  non-synonymous transitions and therefore became our focus (Figure 2.3b).  These were S100F in AT5G56010 (HSP90.3) and G45S in AT5G56230 (PRA1).  To identify which mutation is responsible for the muse10 phenotype, we obtained T-DNA insertion alleles for both genes from the Arabidopsis Biological Resource Center (ABRC). SALK_013240 (hsp90.3-4) carries a T-DNA insertion in the third exon of HSP90.3, which largely abolished the expression of the gene (Figure 2.3c and 2.3d). Plants homozygous for hsp90.3-4 were smaller than wild-type and had curled leaves similar to snc1 (Figure 2.3e). SAIL_634_C04 (pra1-1) carries a T-DNA insertion in the only exon of PRA1, presumably truncating the encoded protein. We noted that the pra1-1 mutant plants appeared similar to wild-type (Figure 2.3e). When muse10 mos2 snc1 npr1 was crossed with hsp90.3-4, all F1 plants exhibited snc1-like morphology, indicating that muse10 failed to complement hsp90.3-4. The homozygous T-DNA lines of the pra1-1 and hsp90.3-4 mutants were then crossed with snc1 and double mutants were identified in the F2 by PCR-genotyping. Only hsp90.3-4, but not pra1-1, considerably enhanced the dwarfism of snc1 (Figure 2.3e). These data suggested to us that MUSE10 probably encodes HSP90.3. To confirm that MUSE10 is HSP90.3, we performed a transgenic complementation experiment. Since muse10 mos2 snc1 npr1 plants are partially sterile and difficult to transform, we obtained muse10 single mutants by back-crossing the quadruple mutant with Col-0 and genotyping the F2 using mutation-specific dCAPs primers (Table 2.1). The single muse10 mutant exhibits similar plant size as wild-type but has slightly curled leaves resembling those of snc1 and hsp90.3-4 (Figure 2.3f). When a wild-type copy of HSP90.3 driven by its native promoter was transformed into muse10 single mutant plants, it did not complement muse10 morphological phenotypes (Figure 34  2.3f). Since muse10 exhibited partial dominance in some segregating lines during map-based cloning, we hypothesized that muse10 might be a dominant-negative allele that cannot be complemented by a wild-type copy of the gene. Thus, a mutant copy of HSP90.3muse10 with a C-terminal HA-tag driven by the HSP90.3 native promoter was transformed into Col-0 and snc1. The HSP90.3muse10-HA transgene indeed conferred muse10-like morphology when transformed into Col-0, while it enhanced snc1 when transformed into snc1 (Fig 2.3g). These data suggest that muse10 encodes a loss-of-function dominant-negative allele of HSP90.3.  Interestingly, the exact same point mutation in muse10 was independently identified in an rpp4-1d suppressor screen (Bao et al., 2014a), where hsp90.3-1 plants exhibit attenuated RPP4-mediated immunity. Because the mutations are identical, we maintain the previous nomenclature and refer to our isolated allele as hsp90.3-1 as well.  2.4.3 MUSE12 is HSP90.2 Through a similar mapping procedure, we found that muse12 was linked to the bottom arm of Chromosome 5. As with muse10, we Illumina-sequenced bulked F3 segregants that were homozygous for both muse12 and snc1 from a cross between muse12 mos2 snc1 npr1 and Ler.  In this way, we identified two point mutations in At5g56030/HSP90.2 that were specific to the muse12 genome and not found in the parental genome (Figure 2.4a). Homozygosity of both mutations in the original muse12 mos2 snc1 npr1 mutant was confirmed by Sanger sequencing. These mutations cause two non-synonymous amino acid changes, R33H and D41N, in HSP90.2. To confirm that these mutations caused the muse12 phenotypes, we obtained previously identified alleles of hsp90.2 (Hubert et al., 2009), including hsp90.2-3, which contains a point mutation causing the transition D80N that probably affects ATP binding and has been shown to render HSP90.2 non-functional (Hubert et al., 2003). Additional alleles, hsp90.2-5 35   Figure 2.3 Map-based cloning of muse10. (a) Map position of muse10. Representative BAC clones are indicated.  (b) Mutations identified within the flanked muse 10 genomic region through whole-genome re-sequencing. (c) Gene structure of AT5G56010 and comparison of DNA sequences between HSP90.3 and muse10. The star indicates the muse10 mutation site. The positions of the muse10 mutation and the T-DNA insertion in SALK_013240 (hsp90.3-4) are indicated. Grey lines before start codon and after stop codon indicate 5’ and 3’ untranslated region, respectively. Dashed arrows indicate the position of primers used for semi-quantitative RT-PCR analysis. (d) Transcript level of AT5G56010 in Col-0, snc1, hsp90.3-1 and hsp90.3-4. Equal amount of cDNA was used for semi-quantitative RT-PCR analysis using primers indicated in Figure 2.3c.  (e) Morphology of Col-0, snc1, pra1-1, hsp90.3-4 and representative homozygous double mutant lines of snc1 pra1-1 and snc1 hsp90.3-4. Scale bar is 1 cm.  (f) Morphology of Col-0, snc1, muse10 and representative homozygous T3 transgenic lines with HSP90.3 (AT5G56010) driven by its native promoter transformed into hsp90.3-1. Photograph shows four-week-old soil-grown plants. Scale bar is 1cm. 36  (g) Morphology of Col-0, snc1, muse10 and representative homozygous T3 transgenic lines with HSP90.3muse10 driven by its native promoter with a C-terminal HA tag transformed into Col-0 and snc1. Photograph shows three-week-old soil-grown plants. Scale bar is 1cm. (SALK_058553, a null) and hsp90.2-8 (R337C), do not display as pronounced phenotypes as hsp90.2-3 (Hubert et al. 2003 and 2009) but were included as controls for our analysis (Figure 2.4b, 2.4c and 2.4d). When we analyzed double mutants with snc1 we found that only hsp90.2-3, but not the other alleles, drastically enhanced snc1 morphology (Figure 2.4e). From these data, we conclude that muse12 is also an allele of hsp90.2. We therefore refer to muse12 as hsp90.2-11. Since hsp90.2-3, hsp90.2-11 (muse12), hsp90.3-1 and hsp90.3-4 (muse10) all exhibit similar snc1-enhancing phenotypes (Figure 2.3 and 2.4), and double mutant of hsp90.1 KO and hsp90.2 is lethal (Hubert et al. 2009), we tested whether HSP90.3 and HSP90.1 are also redundant. Under our growth conditions, we were not able to isolate viable hsp90.1KO hsp90.3-4 double mutants. This suggests that similar to HSP90.2, HSP90.3 is also functionally redundant with HSP90.1. HSP90.2 and HSP90.3 probably play similar roles in mediating snc1-related phenotypes.  2.4.4 HSP90s have diverse roles in plant immunity To better understand the contribution of HSP90s in plant immunity, we characterized single mutants of hsp90.2 and hsp90.3 in more detail. We found that PR1 expression levels in both hsp90.3-1 and hsp90.3-4 alleles were higher than wild type plants (Figure 2.5a). Interestingly, PR2 expression in both alleles was comparable to that of WT plants (Figure 2.5a).  To further examine the immune responses of hsp90.3 alleles, we challenged hsp90.3 mutants with the virulent oomycete pathogen Hpa Noco2. We observed a 38% reduction of Hpa Noco2 sporulation on hsp90.3-1 seedlings, and a 83% reduction on the hsp90.3-4 seedlings (Figure 2.5b). However, intriguingly, both hsp90.3-1 and hsp90.3-4 plants showed enhanced disease susceptibility against the virulent bacterial pathogen Pseudomonas syringae pv. maculicola (Psm) ES4326 (Figure 2.5c). About ten-fold more bacterial growth was observed in the hsp90.3 alleles. 37  The different defense responses observed in these hsp90.3 alleles suggest that the role HSP90.3 plays during defense responses against Hpa Noco2 or the bacteria Psm ES4326 defence might be different. Alternatively, this may reflect differences in HSP90.3 during plant development and growth, as Hpa infections are typically performed on young seedlings in high humidity and lower temperature, while Psm infections are performed on adult plants at ambient temperature.  The hsp90.2-11 single mutant was obtained by backcrossing muse12 mos2 snc1 npr1 with Col-0 plants followed by mutation-specific genotyping using dCAPs primers.  Similar to other alleles of hsp90.2, single hsp90.2-11 mutants appeared to have a wild type-like morphology when grown on soil (Figure 2.4b). Although none of the hsp90.2 alleles exhibited obvious increased expression levels of PR1 and PR2, both hsp90.2-3 and hsp90.2-11 displayed enhanced disease resistance against Hpa Noco2 compared with wild type, hsp90.2-5 and hsp90.2-8 (Figure 2.5d). Similar to the hsp90.3 alleles, both hsp90.2-3 and hsp90.2-11 exhibited increased disease susceptibility against the bacterial pathogen Psm ES4326 (Figure 2.5e).  We further examined whether the enhanced disease susceptibility was specific to Psm ES4326. As shown in Figure 2.5f, hsp90.2-11 was also more susceptible to Pseudomonas syringae pv. tomato (Pst) DC3000 than wild type Col-0 plants, similar to what was observed in hsp90.2-3. Intriguingly, bacterial growth in hsp90.3-1 plants was comparable with growth in wild type plants. Both hsp90.2 and hsp90.3 alleles tested did not show altered disease resistance against a dis-armed pathogen Pst DC3000 hrcC (Figure 2.6). Collectively, we conclude that in addition to their positive roles in plant immunity against certain bacterial pathogens (Figure 2.5c, 2.5e and 2.5f), Arabidopsis HSP90.2 and HSP90.3 also negatively regulate the plant defense response against Hpa Noco2 (Figure 2.5b and 2.5d).   38   Figure 2.4 muse12 is an allele of hsp90.2. (a) Genomic DNA sequence alignment between muse12 and HSP90.2. Stars indicate the mutation sites. (b) Plant morphology of hsp90.2 alleles. The photograph was taken when the soil-grown plants were four weeks old. Scale bar is 1 cm. (c) Gene structure of HSP90.2. T-DNA insertion site of SALK_058553 (hsp90.2-5) and mutation sites of hsp90.2-3, hsp90.2-8 and hsp90.2-11 are indicated. Grey lines before start codon and after stop codon indicate 5’ and 3’ untranslated region, respectively. Dashed arrows indicate the position of primers used for semi-quantitative RT-PCR analysis. (d) RT-PCR expression analysis of hsp90.2 alleles using primers indicated in Figure 2.4c. (e) Morphology of 4-week-old Col-0, snc1, hsp90.2-3, snc1 hsp90.2-3, hsp90.2-5, snc1 hsp90.2-5, hsp90.2-8 and snc1 hsp90.2-8 plants. 39   Figure 2.5 Single mutant analyses of hsp90.3 and hsp90.2 alleles. (a) PR1 and PR2 gene expression in hsp90.3 single mutants. This RT-PCR experiment was performed as in Figure 2.1b. (b) Quantification of Hpa Noco2 growth. Ten-day-old soil-grown plants were spray-inoculated with Hpa Noco2 at a concentration of 120,000 conidia spores/mL of water. Sporulation was quantified 7 dpi. Letters indicate statistical difference (p<0.05, Bonferroni post-test). Bars represent means ± SD (n=5 with 4 plants each).  40  (c) Bacterial growth of Psm ES4326 in four-week-old soil-grown plants. Leaves of plants were infiltrated with a bacterial suspension (OD600=0.0001). Bacterial colony-forming-units (cfu) were calculated at Day 0 and Day 3. Bars represent means ± SD (n=5). Letters indicate statistical difference (p<0.001, Bonferroni post-test) among genotypes in Day 3. The experiment was repeated three times with similar results. (d) Quantification of Hpa Noco2 growth.  Plants were grown on soil for 10 days and spray-inoculated with Hpa Noco2 at a concentration of 120,000 conidia spores/mL of water. Sporulation was quantified 7 dpi. Bars represent means ± SD (n=5 with 4 plants each).  (e) Bacterial growth of Psm ES4326 on the indicated genotypes. Infection was carried out as in Figure 2.5c. Letters indicate statistical difference (p<0.001, Bonferroni post-test) among genotypes in Day 3. The experiment was repeated three times with similar results. Bars represent means ± SD (n=5).  (f) Bacterial growth of Pst DC3000 in four-week-old soil-grown plants. Leaves of plants were infiltrated with a bacterial suspension (OD600=0.0001). Bacterial colony-forming-units (cfu) were calculated at Day 0 and Day 3. Bars represent means ± SD (n=5). Letters indicate statistical difference (p<0.001, Bonferroni test) among genotypes in Day 3. The experiment was repeated once with similar results.      Figure 2.6 Pst DC3000 hrcC infection assay on hsp90 alleles. Bacterial growth of Pst DC3000 hrcC in four-week-old soil-grown plants. Leaves of plants were infiltrated with a bacterial suspension (OD600=0.0001). Bacterial colony-forming-units (cfu) were calculated at Day 0 and Day 3. Bars represent means ± SD (n=5). The experiment was repeated once with similar results.       41  2.4.5 HSP90.2 and HSP90.3 are required for accumulation of NLRs HSP90 proteins are molecular chaperones that play numerous roles in signaling (Taipale et al., 2010). NLR proteins are among the few known client proteins of HSP90s in plants (Kadota et al., 2010). Since HSP90 was previously shown to interact directly with SGT1, which plays a negative role in the control of protein accumulation of RPM1 and RPS5 (Holt et al. 2005), we wondered whether HSP90s could contribute a similar negative role for SNC1. This hypothesis was further suggested by our recent finding that SGT1 is part of the SKP1-Cullin 1-F-Box (SCF) complex that possibly also includes CPR1 and SRFR1 and which regulates protein turnover of SNC1 (Li et al., 2010c; Cheng et al., 2011; Cheng and Li, 2012). Interestingly, we noted higher accumulation of SNC1 protein in hsp90.3-1, hsp90.3-4, and HSP90muse10-HA compared to Col-0 (Figure 2.7a, 2.7b and 2.7c). These data indicate that HSP90.3 is involved in the negative regulation of SNC1 protein accumulation and explains the suppressive effects of hsp90.3-1 in mos2 snc1 npr1. When SNC1 protein levels were examined in hsp90.2 mutants, we observed slight increase of SNC1 in all the tested hsp90.2 alleles (Figure 2.7d), with hsp90.2-3 and hsp90.2-11 showing the highest SNC1 accumulation. This agrees with our snc1 double mutant analysis, where only hsp90.2-3 and hsp90.2-11 enhanced snc1 phenotypes (Figure 2.4e). Importantly, the increased SNC1 protein level in the tested hsp90 alleles was not due to increased SNC1 transcript levels (Figure 2.7e). We also tested whether mutation in another cytosolic HSP90, hsp90.1KO (SALK_075596) could enhance snc1 phenotypes. We found that hsp90.1KO does not seem to enhance snc1 growth nor SNC1 protein accumulation (Figure 2.8), suggesting specificity of HSP90.2 and HSP90.3 in regulating SNC1 protein level.  To further study the role of HSP90.3 in controlling R protein function, we examined the protein levels of three additional NB-LRRs, RPM1-myc, RPS2-HA and RPS4-HA, in the 42  hsp90.3-1 background (Grant et al., 1995; Axtell and Staskawicz, 2003; Wirthmueller et al., 2007), by crossing transgenic plants expressing RPM1-myc, RPS2-HA or RPS4-HA with hsp90.3-1. Interestingly, both RPS2-HA and RPS4-HA accumulated to considerably higher levels in hsp90.3-1 compared to wild type (Figure 2.9a and 2.9b), however, the RPM1-myc protein level was decreased in hsp90.3-1 (Figure 2.9c), indicating that HSP90.3 play different roles in regulating the accumulation of different NLR proteins.   To further examine the role of HSP90.3 in R protein-mediated defense, we challenged hsp90.3-1 with Pst DC3000 carrying specific avirulent effectors. We observed significantly higher bacterial titer of AvrRpm1 and AvrRps4 while less bacteria growth of AvrRpt2 on hsp90.3-1 plants (Figure 2.9d, 2.9e and 2.9f). These observations are mostly in agreement with previously reported pathogen growth data in hsp90.3 mutants (Figure 5 in Bao et al., 2014). The enhanced disease susceptibility against Pst DC3000 AvrRps4 in hsp90.3-1 allele indicates that HSP90.3 might also play a positive role in downstream signaling against this pathogen, which cannot be compensated by the increased RPS4-HA protein level. 2.4.6 HSP90.3 associates with SNC1  In Skp, Cullin, F-box containing (SCF) complexes, HSP90 is known to interact with SGT1 to chaperone its clients to the SCF complex (Zhang et al., 2008).  Because our previous data indicated that SCFCPR1 targets SNC1 and RPS2 for degradation (Cheng et al. 2011), we  tested whether HSP90.3 associates with SNC1 as a substrate in planta using a co-immunoprecipitation (IP) assay with HSP90.3-HA and SNC1-FLAG proteins co-expressed in Nicotiana benthamiana. As shown in Figure 2.10a, HSP90.3-HA is indeed pulled down by SNC1-FLAG, indicating that they associate with each other in the same protein complex. As CPR1 associates with SNC1 (Cheng et al. 2011), we tested if HSP90 could associate with the SCFCPR1 complex through the 43  F-box protein.  We therefore performed a similar assay in N.benthamiana using HSP90.3-HA and CPR1-FLAG proteins. However, CPR1 cannot pull down HSP90.3 (Figure 2.10b), indicating that HSP90.3 and CPR1 may not directly associate.   44  Figure 2.7 HSP90.2 and HSP90.3 are required for accumulation of NLRs.  (a-d) Immunoblot analysis of SNC1 protein level in hsp90.3 single mutants (a), HSP90muse10-HA transgenic line in Col background (b), HSP90muse10-HA in snc1 background(c) and hsp90.2 (d) alleles. Total protein was extracted from leaf tissues of two-week-old plate-grown seedlings. Ponceau staining was used as internal loading control. Numbers at the bottom of the blot indicate SNC1 protein band intensity normalized to Col-0. The experiments were repeated at least three times with similar results.  The blot band intensity was quantified using ImageJ and normalized to Ponceau staining.   (e) Real-time PCR analysis of SNC1 transcript levels in hsp90.2 and hsp90.3 mutants. Expression levels were normalized to ACTIN1. This experiment was repeated once with similar result.      Figure 2.8 Knockout analysis of HSP90.1KO.  (e) Morphology of 4-week-old Col-0, snc1, hsp90.1 KO and snc1 hsp90.1 KO. (d) SNC1 protein levels in Col-0, snc1 and hsp90.1 KO.   45   Figure 2.9 HSP90.3 plays distinct roles on different NLR proteins. (a-c) Immunoblot analysis of protein levels of RPS2-HA (a), RPS4-HA (b) and RPM1-myc (c) in hsp90.3-1.  Total protein was extracted from four-week-old soil-grown plants. Protein levels were detected using western blot. Ponceau staining was included to show equal loading. Homozygous transgene carrying either the epitope-tagged RPM1, RPS2 or RPS4 was introduced into hsp90.3-1 background by crossing and subsequence allele-specific genotyping and selection marker screening.  (d-f) Bacterial growth of avirulent pathogens on the indicated genotype. Four-week-old soil-grown plants were infiltrated with a bacterial suspension (OD600=0.001). Bacterial colony-forming-units (cfu) were calculated at Day 0 and Day 3. Stars indicate statistical difference (Student’s t-test, *p<0.05, **p<0.01, ***p<0.001). Bars represent means ± SD (n=5).           46   Figure 2.10 HSP90.3 associates with SNC1 in N. benthamiana. (a) SNC1-FLAG co-immunoprecipitates with HSP90.3-HA in N. benthamiana.  (b) CPR1-FLAG does not co-immunoprecipitate with HSP90.3-HA.          47  Table 2.1 Primers used in this study.  48  2.5 Discussion HSP90 chaperone proteins are ubiquitous and can be found in bacteria and higher eukaryotes including flowering plants and mammals. Accounting for up to 1% of total cellular protein (Taipale et al. 2010), their functions have been widely studied in bacteria, yeast and humans (Pearl and Prodromou, 2006; Wandinger et al., 2008; Shirasu, 2009; Kadota and Shirasu, 2012; Jackson, 2013). Although HSP90s have general chaperone activities that prevent mis-folding and aggregation of client proteins, they also show substrate specificity. They play critical roles in signal transduction and are extremely important in stress responses. However, relatively less has been revealed concerning their roles in plant biology. Previous studies on Arabidopsis cytosolic HSP90s disclosed their function in controlling R protein activity and stability (Shirasu et al. 2009). Specific mutant alleles of hsp90s including some null alleles exhibit reduced accumulation and attenuated resistance of NLRs such as RPM1, RPS5, Rx, RPS4 and RPP4 (Hubert et al. 2003, Lu et al. 2003, Holt et al. 2005, Hubert et al. 2009, Bao et al. 2014), indicating that the HSP90s may be needed for their stability or NLR activation complex assembly. Interestingly, point mutant alleles of hsp90.2 were also recovered from a rar1 suppressor screen, and they partially rescue the reduced NLR levels in rar1 (Hubert et al. 2009). However, they did not show noticeable phenotypes in the absence of rar1. From our current study, new alleles of hsp90.2 and hsp90.3 isolated from a snc1 enhancer screen exhibit a different phenotype where the accumulation of NLR proteins, such as SNC1, RPS4 and RPS2, are enhanced. This negative role of HSP90s in controlling defence output through regulating R protein degradation may be facilitated by its known co-chaperone SGT1 that functions in SCF complexes that target R proteins for ubiquitination and degradation.  49  The chaperone-clientele relationship between HSP90 and NLR proteins has been established for both mammalian NLRs and plant NLR proteins (da Silva Correia et al., 2007; Mayor et al., 2007; Shirasu, 2009). In mammals, SGT1 and HSP90 are speculated to be involved in inflammasome complex formation leading to Nod2-mediated activation of the transcription factor NF-kappaB (Mayor et al. 2007). Mutant phenotype and biochemical analyses in Arabidopsis suggest that co-chaperones RAR1 and SGT1 work together with HSP90 to mediate R protein activation and stability (Shirasu 2009). However, the molecular mechanisms underlying these phenomena are still unclear. Based on the varied phenotypes exhibited by different mutant alleles of hsp90, it can be postulated that HSP90 may serve as a chaperone for the same client NLR protein but in functionally distinct NLR protein complexes in the cell. During NLR protein activation, HSP90 may facilitate the maturation of the active NLR protein complex with SGT1 and RAR1 to activate downstream defense responses. Therefore loss of the chaperones leads to destabilized client NLRs as in the case of RPM1, RPS5 and Rx (Hubert et al. 2003, Lu et al. 2003, Holt et al. 2005, Hubert et al. 2009). However, when NLRs accumulate to levels that are too high, the NLR degradation pathway mediated by the proteasome needs to be enhanced to prevent autoimmunity. During NLR degradation, the E3 ligase-substrate complex has to be assembled, which may be facilitated by HSP90.  The direct protein-protein interaction between co-chaperone SGT1 and the core component of the SCF-type E3 ubiquitin ligases, S-phase kinase-associated protein 1 (SKP1), is conserved from yeast to higher plants (Kitagawa et al., 1999; Zhang et al., 2008). Since SKP1 is an essential component of SCF E3 ligase complexes, SGT1 is believed to be a subunit of SCF complexes (Kitagawa et al., 1999; Gray et al., 2003). As SCFCPR1 targets NLRs including SNC1 and RPS2 for degradation (Cheng et al., 2011; Gou et al., 2012), it has been speculated that 50  SGT1 may assist maturation or assembly of this SCF complex to facilitate NLR substrate ubiquitination and subsequent degradation. In agreement with that, loss of SGT1b in Arabidopsis leads to higher accumulation of NLR proteins such as RPM1, RPS5 and SNC1 (Holt et al. 2005, Li et al. 2010).  As SGT1 functions as a co-chaperone that acts as a client adaptor to link HSP90 to SKP1 (Catlett and Kaplan, 2006), it was also proposed that both chaperone activities are needed to assemble the SCF complexes (Botër et al., 2007). Indeed, our isolation of an hsp90.3-1 allele that exhibits higher SNC1, RPS2, and RPS4 protein accumulation supports such activity. Specific mutations of HSP90 isoforms may affect SCFCPR1 complex assembly, leading to reduced ubiquitination and further degradation of the target NLR proteins.  The dynamic assembly and disassembly activities of SCF E3 complexes are not well understood, although they are central to understanding the regulation of turnover of the E3 substrate proteins. Modification of Cul1 by RUB/NEDD8 seems to be critical for SCF assembly, while removal of RUB/NEDD8 by COP9 signalosome enables Cul1 to interact with CAND1, enhancing SCF disassembly (Goldenberg et al., 2004). In the case of plant SCFZTL, cytosolic HSP90 directly interacts with F-box protein ZTL and it is believed to be involved in the maturation of the F-box protein for SCF assembly (Kim et al., 2011), therefore regulating the circadian period. From our immunoprecipitation experiment, we observed protein-protein association between HSP90 and SNC1, but not between HSP90 and the F-box protein CPR1, suggesting that HSP90 may provide a different function in SCFCPR1 than with SCFZTL. In SCFCPR1, NLR proteins like SNC1 serve as HSP90 clients to be chaperoned for SCF assembly. In this scenario, HSP90 might associate with the SCF substrates in the protein complex rather than with the F-box protein.  51  Since plants have massively expanded gene families encoding both NLR proteins and F-box proteins, it is unlikely that CPR1 is the only F-box protein targeting NLRs for degradation. Indeed, the heightened accumulation of RPS4 in hsp90.3-1 (Figure 2.9) cannot be explained by SCFCPR1, since RPS4 does not seem to be a substrate of CPR1 (Cheng et al. 2011). It is possible that an unknown SCF complex regulates RPS4 accumulation, and HSP90 could be present in this yet-to-be-identified complex. In addition, the isolated hsp90.3 alleles exhibit varying degrees of developmental and growth phenotypes including variation in flowering time, leaf shape and fertility (Bao et al. 2014 and current study). These phenotypes could reflect the contributions of HSP90s to SCF complex assembly involved in these other plant developmental processes.  Why do different alleles of hsp90 exhibit varied phenotypes regarding R protein accumulation? Since HSP90s chaperone diverse client proteins, different point mutations are known to cause drastically different, or even opposite biological consequences (Table S1 from Hubert et al. 2009).  Each mutation often only affects HSP90 activities in certain, but not all, client proteins or protein complexes. Our hsp90.3 and hsp90.2 alleles that affect NLR protein accumulation carry mutations concentrating at the N-terminus of the protein, where the substrate binding, ATP-binding and hydrolysis activities reside. In hsp90.2-11, two mutations caused amino acid changes in HSP90.2, R33H and D41N. Although we are not clear whether both mutations are needed to cause the snc1-enhancing phenotypes, these drastic mutations may together change the substrate binding specificity with SCF complexes involved in NLR turnover. In hsp90.3-1, S100 is mutated to F. This severe change in the ATP-binding pocket may change the ATPase activity in addition to chaperone client specificity. The dominant-negative effects from this allele are in agreement with this possibility. However, in hsp90.3-4, the T-DNA insertion site is very close to the mutation site of hsp90.3-1, leading to an early truncation of the 52  encoded protein product. It most likely represents a null allele of hsp90.3. In agreement with that, more severe developmental defects are observed in this allele compared to hsp90.3-1. Furthermore, it is interesting to note that the previously isolated hsp90.2-2 and hsp90.3-1 alleles carry the exact same mutation (S100F) as our hsp90.3-1 allele (Hubert et al. 2009, Bao et al. 2014). hsp90.2-2 is more sterile than hsp90.3-1, while hsp90.3-1 plants are larger in size and exhibit curlier leaves (Hubert et al. 2009 and current study). Although Arabidopsis cytosolic HSP90s are mostly redundant in many of their functions (Hubert et al. 2009), the phenotypic differences in these hsp90.2 and hsp90.3 null and point mutant alleles support that they still have slightly different client specificity or preference. Based on the mutant phenotypes of hsp90.3 alleles, it is likely that HSP90.3 participates more in SCF complexes involved in NLR R protein turnover.  One intriguing observation from some hsp90 single mutant alleles (hsp90.3-1, hsp90.3-4, hsp90.2-3 and hsp90.2-11) is that although they exhibit enhanced resistance against Hpa Noco2 (Figure 2.5), possibly due to heightened accumulation of NLR proteins, they also show enhanced susceptibility to virulent Psm ES4326 and Pst DC3000 (Figure 2.5). In addition, although RPS4 accumulates more in hsp90.3-1 (Figure 2.9b), hsp90.3-1 plants are slightly more susceptible than WT (Figure 2.9e; Bao et al., 2014). This is in contrast to the cases of RPS2 and RPM1 (Figure 2.9), where the NLR levels correlate with the resistance levels against the cognate effector. The eventual resistance phenotype observed in a single hsp90 mutant must be very complex, representing the final consequence after the addition of positive forces that drive and subtraction of negative forces that repress the defence responses. For different pathogens with different lifestyles, the formula seems different, as revealed in differential responses in our Hpa Noco2 and Psm ES4326 experiments. One fundamental difference between these two infection assays is 53  the growth condition, which probably contributes to the immune status of the mutants. For Hpa infections, two-week-old seedlings are kept at 18ºC with 100% humidity, while the Psm infections are carried out at room temperature on fully grown mature plants that are 4-5 weeks old. It is likely that HSP90 chaperone activity is influenced by these growth conditions. Under chilling temperature, the hsp90 mutant defects in SCF assembly could be relatively more severe, enabling higher accumulation of the NLRs resulting in enhanced resistance. At room temperature, the defects of NLR activation complex assembly could be relatively worse, leading to susceptibility. Except for facilitating NLR functions, HSP90s must also play positive roles in downstream immune signaling, which could partly explain why increased RPS4-HA protein level does not lead to enhanced resistance to AvrRPS4 (Figure 2.9e). Future research endeavors are needed to reveal the mechanisms underlying the diverse roles of HSP90 in defence signaling.          54  Chapter 3 Two Redundant Plant TRAF Proteins Participate in NLR Immune Receptor Turnover 1   3.1 Summary  In animals, tumor necrosis factor receptor-associated factor (TRAF) proteins are molecular adaptors that play essential roles in regulating innate and adaptive immunity, development, and abiotic stress responses. Although gene families encoding TRAF domain-containing proteins are expanded and exhibit enriched diversity in higher plants, their biological roles are poorly defined. Here, we report the identification of two redundant TRAF proteins, Mutant, snc1-enhancing 13 (MUSE13) and MUSE14, that contribute to the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of MUSE13 and MUSE14 leads to NLR accumulation, while MUSE13 overexpression results in reduced NLR levels and activity. In planta, MUSE13 associates with SNC1, RPS2, and SCFCPR1. Taken together, we speculate that MUSE13 and MUSE14 associate with the SCF E3 ligase complex to form a plant-type TRAFasome, which modulates ubiquitination and subsequent degradation of NLR immune sensors to maintain their homeostasis.      1 A version of this chapter has been published. Huang, S., Chen, X., Zhong, X., Li, M., Ao, K., Huang, J., & Li, X. (2016). Plant TRAF Proteins Regulate NLR Immune Receptor Turnover. Cell Host & Microbe, 19(2), 204-215.   55  3.2 Introduction  Unlike mammals, plants do not have specialized cells that confer adaptive immunity. Instead, they have evolved elaborate immune receptor families to sense and respond to various microbial pathogens including viruses, bacteria, and fungi (Chisholm et al., 2006; Jones and Dangl, 2006; Dangl et al., 2013). In response to pathogen invasion, membrane-localized pattern-recognition receptors (PRRs) can sense conserved pathogen-associated molecular patterns (PAMPs) and initiate PAMP-triggered immunity (PTI) (Boller and Felix, 2009). In contrast, cytosolic nucleotide-binding domain and leucine-rich repeat-containing proteins (NLRs) can detect specific and less-conserved effector molecules that pathogens deliver into the host cells in order to promote infection. Recognition of pathogenic effectors by plant NLRs triggers strong immune responses termed effector-triggered immunity (ETI). The two typical classes of NLR immune receptor proteins in plants are Toll-interleukin-1 receptor-like (TIR)-type NLRs (TNLs) and coiled-coil (CC)-type NLRs (CNLs) (Li et al., 2015), which differ primarily in their distinctive N-termini.  Plant NLR proteins are under tight negative control since over-accumulation of many NLRs can lead to autoimmunity, which compromises plant growth. For example, SNC1 (Suppressor of npr1-1, Constitutive 1) is a typical TNL, and a point mutation in the autoimmune mutant snc1 constitutively activates defense responses due to elevated steady state SNC1 protein stability (Li et al., 2001; Zhang et al., 2003; Cheng et al., 2011). To avoid autoimmunity, plant NLR homeostasis is regulated at multiple levels (Li et al., 2015). Post-translationally, ubiquitination-mediated protein degradation plays a pivotal role in maintaining NLR homeostasis.  Protein ubiquitination is the process of conjugating ubiquitin molecules to the substrate, typically leading to protein degradation (Komander and Rape, 2012). Ubiquitination of substrate 56  proteins requires three sequential enzymes, namely ubiquitin activating enzyme (E1), ubiquitin conjugating enzyme (E2) and ubiquitin ligase (E3), with the E3 largely determining the substrate specificity. For example, the F-box E3 ubiquitin ligase, SCFCPR1 (Skp1-Cullin1-F-box; Constitutive PR gene expression 1), targets NLRs RPS2 (Resistant to P. syringae 2) and SNC1 for ubiquitination, leading to subsequent degradation (Cheng et al., 2011). In addition, efficient degradation of plant NLRs also requires the E4 ligase MUSE3 (Mutant, snc1-enhancing 3), which promotes polyubiquitin chains formation on the NLR substrates (Huang et al., 2014b). Tumor necrosis factor receptor (TNFR)-associated factors (TRAFs) are cytosolic adaptor proteins that are required for signaling by various cell surface receptors in mammals (Napetschnig and Wu, 2013). Seven TRAF genes (TRAF1-7) have been identified in the human genome. The TRAF domain, also called the MATH (meprin and TRAF-C homology) domain, is a fold composed of seven or eight anti-parallel β-helices that is involved in protein-protein interactions (Park et al., 1999; Ye et al., 2002). In mammals, TRAFs are employed by immune receptors, such as Toll-like receptors (TLRs), NLRs and TNF familiy receptors on T cells and other immune cells, for downstream signaling  (Xie, 2013). In comparison, plants contain highly expanded gene families encoding TRAF domain-containing proteins (Bradley and Pober, 2001). There are more than 70 TRAF domain-containing protein-encoding genes in Arabidopsis (Oelmüller et al., 2005). Although mammalian TRAF proteins play diverse and indispensable roles in innate and adaptive immunity, the function of TRAF domain-containing proteins in plant immunity is largely untested. Here, we report the identification of two TRAF domain-containing proteins, MUSE13 and MUSE14, as redundant immune regulators in Arabidopsis. They function together with SCFCPR1 to regulate NLR turnover, likely through the formation of a plant-type TRAFasome.  57  3.3 Materials and methods 3.3.1 Plant materials and growth conditions All plants were grown under ambient conditions with a 16 hr light and 8 hr dark regime. Arabidopsis seeds were surface-sterilized using 15% bleach and 0.1% Tween-20 (in ddH2O). Seeds were stratified at 4°C for at least two days before sowing on soil or on sterile half-strength Murashige and Skoog (MS) medium. 3.3.2 Ethyl methanesulfonate (EMS) mutagenesis, mutant screens, and positional cloning The muse (mutant, snc1-enhancing) screen was carried out as previously described (Huang et al., 2013). The muse13-2 muse14-1 suppressor screen was carried out with an EMS-mutagenized muse13-2 muse14-1 population. Mutants were identified in M2 by selecting plants completely reverting to WT morphology in the extremely dwarfed double mutant background. The mutants were mapped following a similar strategy as described before (Cheng et al., 2009). Map-based cloning and next-generation whole-genome sequencing were performed as previously described (Huang et al., 2013). 3.3.3 Construction of plasmids and Arabidopsis transformation  A genomic fragment of AT1G04300 containing a 1,100 bp region upstream of the start codon was PCR-amplified using primers KpnI-F (5' CGGGGTACCACGTTGTCGT TCGGTTGTAAAAAC 3') and BamHI-R (5' CGCGGATCCATGACCATTCGATG GCCTGAACTC 3') from WT Col-0 genomic DNA. The fragment was then digested using KpnI and BamHI and cloned into pCAMBIA1305-FLAG-ZZ and pGreen0229-GFP to generate MUSE13::MUSE13-FLAG-ZZ and MUSE13::MUSE13-GFP, respectively. All the plasmids were validated using Sanger sequencing.  58  For Arabidopsis transformation, the above constructed binary constructs were transformed into Agrobacterium tumefaciens GV3101 (pMP90) by electroporation and subsequently transformed into Arabidopsis plants by the floral dip method (Clough and Bent, 1998). Transgenic plants were screened on 1/2 MS medium supplied with 100 mg/L hygromycin (pCAMBIA1305-FLAG-ZZ) or on soil by spraying 100 mg/L Basta for four times with a two-day interval between each treatment (pGreen0229-GFP). The construction of transient expression vectors RPS2::RPS2-FLAG-ZZ, 35S::CPR1-FLAG, snc1-GFP and SNC1(aaa)-GFP was previously described (Cheng et al., 2009; Cheng et al., 2011; Xu et al., 2014a; Xu et al., 2014b). 3.3.4 Hpa Noco2 infection and bacterial infection assays Two-week-old soil-grown seedlings were surface-sprayed with Hpa Noco2 at a concentration of 105 spores per ml of water. The Hpa Noco2 oomycete was allowed to propagate for 7 days in a humid growth chamber (12 h light/12 h dark, 18°C) before the number of spores on the plant surface was quantified using a hemocytometer. For bacterial infection assays, four-week-old soil-grown plants under short-day growth conditions (12 h light/12 h dark, 22°C) were used. Bacterial suspension at indicated concentrations was pressure-infiltrated into the underside of Arabidopsis rosette leaves using a needleless syringe. Leaf punches were collected at day 0 and day 2 or day 3 and ground in a 1.5 ml tube containing 10 mM MgCl2. Bacteria were serially diluted and plated on Luria–Bertani (LB) plates containing appropriate antibiotics and incubated at room temperature for 2 days before colony forming units (cfu) were counted.  59  3.3.5 Gene expression analysis About 0.1 g of tissue was collected from plate-grown or soil-grown plants as indicated and RNA was extracted using an RNA isolation kit (Bio Basic; Cat#BS82314). The RNA was reverse-transcribed to cDNA using ProtoScript II reverse transcriptase (NEB; Cat#B0368). The expression of PR1, PR2, ACTIN7 and SNC1 was analyzed via RT-PCR according to a protocol described previously (Zhang et al., 2003). 3.3.6 Plant total protein extraction, immunoblot analysis and immunoprecipitation assays For immunoblot analysis, plant total protein was extracted from about 100 mg of tissue using extraction buffer [100 mM Tris-HCl pH 8.0, 0.2% (w/v) SDS and 2% (v/v) β-mercaptoethanol, 1mM phenylmethylsulfonyl fluoride (PMSF) and 1× protease inhibitor cocktail (Sigma, http://www.sigmaaldrich.com/)], and 4× SDS loading buffer was added to each protein sample before boiling for 7 min at 95°C. The resulting protein samples were separated on SDS-PAGE gels. The co-IP experiments in N.benthamiana were performed as previously described (Moffett et al., 2002). Briefly, construct-containing Agrobacteria was cultured in liquid LB medium containing 50 µg/mL kanamycin at 28°C overnight (225 rpm). The bacteria (1:100 dilution) was then transferred to culturing medium [10.5 g/L K2HPO4, 4.5 g/L KH2PO4, 0.5 g/L sodium citrate, 1.0 g/L (NH4)2SO4, 0.2% glucose, 0.5% glycerol, 1 mM MgSO4, 50 µM acetosyringone and 10 mM N-morpholino-ethanesulfonic acid (MES) pH 5.6] containing 50 µg/mL kanamycin at 28°C (225 rpm) for another 12–14 h. Cells were then harvested by centrifugation at 3,220 g  for 20 min and resuspended in MS buffer (4.4 g/L MS, 10 mM MES, 150 µM acetosyringone). For infiltration, each bacterial strain was diluted as follows: MUSE13::MUSE13-FLAG-ZZ (OD600=0.4), MUSE13::MUSE13-GFP (OD600=0.4), 60  RPS2::RPS2-FLAG-ZZ (OD600=0.3) and 35S::CPR1-FLAG (OD600=0.3). Three to four-week-old N. benthamiana leaves were used in this study. The immunoprecipitation assay was performed as described previously (Huang et al., 2014a). About 3 g of leaf tissue was ground into fine power in liquid nitrogen using a pre-chilled mortar and pestle. All the following procedures were carried out at 4°C. The powder was further homogenized in 2 v/w (6 ml) of extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 0.4% Nonidet P-40 substitute, 10% glycerol, 5 mM DTT, 2 mM NaF, 1 mM Na2MoO4·2H2O, 1% w/v polyvinylpolypyrrolidone, 1 mM PMSF and 1× protease inhibitor cocktail). The sample was then spun down (21,130 g, 10 min) and the supernatant was collected into 1.5 ml tubes. The FLAG-tagged proteins were immunoprecipitated using 30 µL anti-FLAG M2 beads (Sigma; Cat. #A2220) with gentle rotation for 1 h at 4°C. The FLAG-ZZ-tagged proteins were immunoprecipitated using 30 µL IgG sepharose beads (GE Healthcare; Cat. #17-0969-01; pull-down 1 h for RPS2-FLAG-ZZ and 0.5 h for MUSE13-FLAG-ZZ). Proteins without bait were used as negative control. After pull-down, the beads were washed three times using wash buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 0.4% Nonidet P-40 substitute, 10% glycerol, 1 mM DTT, 2 mM NaF, 1 mM Na2MoO4·2H2O, 1 mM PMSF and 1× protease inhibitor cocktail). 2× SDS loading buffer was added to the beads and boiled for 7 min. Supernatant was loaded onto a single lane of 6%~8% SDS-PAGE gel and detected by western blot using the corresponding antibodies. For immunoprecipitation assays in Arabidopsis, 2.5 g of two-week-old seedlings grown on half-strength MS medium was homogenized in 2 v/w (5 ml) of extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 1% Nonidet P-40 substitute, 10% glycerol, 5 mM DTT, 2 mM NaF, 1 mM Na2MoO4·2H2O, 0.5% w/v polyvinylpolypyrrolidone, 1 61  mM PMSF and 1× protease inhibitor cocktail). Samples were incubated at 4°C until thawed and clarified by a 20 min centrifugation at 21,130 g at 4 °C. The FLAG-tagged proteins were immunoprecipitated using 30 µL anti-FLAG M2 beads with gentle rotation for 1 h at 4 °C. The FLAG-ZZ-tagged proteins were immunoprecipitated using 30 µL IgG sepharose beads (pull-down 1 h for CPR1-FLAG and 0.5 h for MUSE13-FLAG-ZZ). Proteins without bait were used as negative control. Beads were washed three times using wash buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 1% Nonidet P-40 substitute, 10% glycerol, 5 mM DTT, 2 mM NaF, 1 mM Na2MoO4·2H2O, 1 mM PMSF and 1× protease inhibitor cocktail), before adding SDS loading buffer. 3.3.7 Statistical analysis The GraphPad Prism 5.0 software (GraphPad Software, Inc.) and Microsoft Excel 2010 were used for the statistical analyses in this work. 3.4 Results 3.4.1 Identification, characterization, and molecular cloning of muse13-1, a mutant isolated from a modified snc1 enhancer screen To isolate novel negative regulators of plant immunity, we previously performed mutant, snc1-enhancing (muse) forward genetic screens to search for snc1 enhancers (Huang et al., 2013). The muse13-1 mutant was identified from a screen conducted in the mos2 snc1 npr1 background, which is morphologically and immunologically wild-type (WT)-like. muse13-1 enhances all aspects of snc1-mediated autoimmune phenotypes, including reduced plant growth (Figure 3.1A), elevated Pathogenesis Related (PR) defence marker gene expression (Figure 3.1B) and enhanced disease resistance against the virulent oomycete pathogen Hyaloperonospora arabidopsidis (Hpa) Noco2 (Figure 3.1C).  62  To identify the molecular lesion responsible for the muse13-1 phenotype, muse13-1 mos2 snc1 npr1 (in the Col-0 background) was crossed with the Landsberg erecta (Ler-0) ecotype to generate an F2 mapping population. Linkage analysis disclosed that the muse13-1 mutation is between markers F10O3 (0.75 Mbp) and T7A14 (1.42 Mbp) on the top arm of chromosome 1. Comparison of genomic sequences of whole-genome re-sequenced muse13-1 mos2 snc1 npr1 and mos2 snc1 npr1 parent sequence revealed that there were sixteen mutations in twelve genes within the mapped muse13-1 region (Table 3.1). Only five of the mutations cause non-synonymous amino acid or stop codon changes, including those in AT1G03770, AT1G04200, AT1G04300, AT1G04450 and AT1G04670 (Table 3.1), which became muse13-1 candidates.  When muse13-1 mos2 snc1 npr1 was backcrossed with the mos2 snc1 npr1 parent line, the F1 plants resembled mos2 snc1 npr1, indicating that muse13-1 is recessive. Therefore muse13-1 is likely a loss-of-function mutation. To determine which mutation caused the muse13-1 phenotype, we obtained T-DNA mutant alleles of the above-mentioned five genes from the Arabidopsis Biological Resource Center (ABRC), including SALK_117958 (AT1G03770), SALK_056393 (AT1G04200), SALK_026088 (AT1G04300), SALK_128174 (AT1G04450) and SAIL_723_C07 (AT1G04670). All T-DNA lines were confirmed to harbor T-DNA insertions in exons using PCR, therefore most likely resulting in loss-of-function of the respective genes. Homozygous T-DNA lines for these five genes were all indistinguishable from WT in terms of growth and development (Figure 3.1D). When double mutants with snc1 were generated by crossing, only SALK_026088 (AT1G04300) significantly enhanced the snc1 phenotype (Figure 3.1D and 3.1E), similar to the muse13-1 snc1 double mutant (Figure 3.2). This suggests that MUSE13 is likely AT1G04300. 63  To confirm the allelism of SALK_026088 with muse13-1, SALK_026088 was crossed with muse13-1 mos2 snc1 npr1. All F1 plants resembled snc1 (Figure 3.1F), indicating failed complementation. We therefore concluded that muse13-1 is a loss-of-function allele of AT1G04300, and thus renamed SALK_026088 as muse13-2. The muse13-1 mutation results in an Arg683 to stop codon (R683X) change and muse13-2 harbors a T-DNA insertion in the last exon, both of which presumably lead to truncation of the encoded protein (Figure 3.1G and 3.1H). 3.4.2 MUSE13 encodes a TRAF-like protein and functions redundantly with MUSE14 BLAST analysis revealed that MUSE13 encodes a tumor necrosis factor receptor-associated factor (TRAF) domain-containing protein. The TRAF domain in MUSE13 is composed of 132 amino acids and is located at its N-terminus (Figure 3.1I). Most human TRAFs (TRAF1-6) contain a conserved C-terminal region of about 180 residues, known as the TRAF or MATH domain, sometimes also designated as the TRAF-C or the meprin homology domain. TRAF domain-containing proteins are only present in eukaryotes (Zapata et al., 2007;  Figure 3.3). This domain consists of 7 or 8 anti-parallel β-strands that participates in protein-protein interactions (Bradley and Pober, 2001). Structural prediction of the MUSE13 TRAF domain revealed that it is comprised of seven anti-parallel β-strands that share high 3-D homology with an array of human TRAF domains (Figure 3.4).  Phylogenetic analysis identified a close paralog of MUSE13, AT5G43560, in the Arabidopsis genome (Figure 3.5). When a T-DNA allele of AT5G43560 (SALK_059309), which carries a T-DNA insertion in the 3rd exon, was crossed with snc1, it significantly enhanced snc1-mediated dwarfism to a similar degree as muse13 (Figure 3.6). Another more distant paralog of MUSE13 within the same phylogenetic clade, AT5G52330, was also examined for its potential 64   Figure 3.1 Characterization and positional cloning of muse13-1. A. Morphology of 4-week-old Col-0, snc1, mos2 snc1 npr1 and muse13-1 mos2 snc1 npr1 plants.  B. PR1 and PR2 gene expression in two-week-old plate-grown seedlings of indicated genotypes. Equal amounts of cDNA were used for RT-PCR analysis. ACT7 serves as loading control. C. Sporulation of oomycete Hpa Noco2 on the indicated plants. Bars represent means ± SD (n = 5). Letters indicate statistical difference (p < 0.001, one-way ANOVA, Tukey post-test). D. Morphology of 4-week-old Col-0, snc1, SALK_117958 (AT1G03770), snc1 SALK_117958, SALK_056393 (AT1G04200), snc1 SALK_056393, SALK_026088 (AT1G04300), snc1 SALK_026088, 65  SALK_128174 (AT1G04450), snc1 SALK_128174, SAIL_723_C07 (AT1G04670) and snc1 SAIL_723_C07. Bar=1cm. E. Fresh weight of plants as shown in (D). Error bars represent means ± SD (6 plants per genotype, *** indicates significance (p < 0.001, one-way ANOVA analysis between snc1 and double mutants).  F. Allelism test between muse13-1 and SALK_026088. Morphology of 4-week-old Col-0, snc1, SALK_026088, an F1 plant from a cross between SALK_026088 and muse13-1 mos2 snc1 npr1, and muse13-1 mos2 snc1 npr1 plants. snc1 is semi-dominant in defense but recessive in morphology (heterozygous SNC1/snc1 plants are WT like), while mos2 and npr1 are recessive. In the F1 plant, snc1, mos2 and npr1 are all heterozygous, thus they should be WT in morphology if muse13-1 and SALK_026088 complement each other. Severely dwarfed F1 progeny observed here suggest failed complementation between muse13-1 and SALK_026088 (both are recessive), which enhances the growth of heterozygous snc1/SNC1.  G. Gene structure of AT1G04300. Mutation sites of muse13-1 and muse13-2 are shown. H. DNA alignment of muse13-1 and MUSE13 where the muse13-1 mutation occurs. Corresponding amino acids are shown below. Star indicates the muse13-1 mutation site, leading to Arg683 to stop codon change. I. Protein structure of MUSE13. The TRAF domain is indicated in cyan. The arrows indicate muse13-1 and muse13-2 mutation sites.  redundancy (Figure 3.5), however SAIL_239_E04, an exonic T-DNA allele of AT5G52330, was not able to enhance snc1 (Figure 3.6). Thus, due to the snc1-enhancing phenotype of SALK_059309, we renamed AT5G43560 as MUSE14, and SALK_059309 as muse14-1. MUSE14 shares about 60% amino acid identity and around 70% sequence similarity with MUSE13 (Figure 3.7). To further examine the evolution of MUSE13 and MUSE14, a phylogenetic tree was generated using the full-length protein sequences of MUSE13 and MUSE14 as input. Although TRAF domain-containing proteins are found in all eukaryotes, orthologs of MUSE13 and MUSE14 seem to be present only in higher plants (Figure 3.8). Both muse13-2 and muse14-1 single mutant plants display WT-like morphology (Figure 3.9A). To test whether MUSE13 and MUSE14 are functionally redundant, we generated the muse13-2 muse14-1 double mutant. When grown at room temperature, the muse13-2 muse14-1 double mutant plants are extremely dwarfed (Figure 3.9A). However, when grown at 28˚C they are indistinguishable from WT, a phenotype indicative of NLR-mediated autoimmunity (Zhu et al., 2010). RT-PCR analysis using four-week-old soil-grown plants showed that the expression 66   Figure 3.2 Both muse13-1 and muse13-2 enhance snc1. A. Plant morphology of Col-0, snc1, muse13-1, muse13-1 snc1, muse13-2 and muse13-2 snc1. The photograph was taken when soil-grown plants were four weeks old. Bar=1cm. B. Fresh weight of the plants as shown in (A). Error bars represent means ± SD (6 plants for each genotype, *** indicates statistical difference (p < 0.001, one-way ANOVA analysis between snc1 and double mutants).  of PR genes is significantly elevated in muse13-2 muse14-1 double mutant plants as compared to WT plants, confirming its autoimmunity (Figure 3.9B). To examine whether the muse13-2 muse14-1 double mutant has altered immunity to pathogens, we challenged the double mutant seedlings with Hpa Noco2. As shown in Figure 3.9C, no growth of the Hpa Noco2 spores was observed on muse13-2 muse14-1 plants. However, disease resistance in muse13-2 and muse14-1 single mutant plants was comparable with that in WT. Taken together, these data indicate that MUSE13 and MUSE14 function redundantly in the negative regulation of defense responses. Although the single muse13 and muse14 mutants do not exhibit obvious phenotypes in the WT Col-0 background, their mild defects become obvious in combination with snc1 due to the highly sensitized autoimmune background.  67    Figure 3.3 Amino acid alignments of selected TRAF domains from eukaryotic organisms.  List of the organisms included: Fungi Thielavia terrestris (XP_003649647.1), algae Chlamydomonas reinhardtii (XP_001700533.1), moss Physcomitrella patens (XP_001772289.1), rice Oryza sativa (NP_001044408.2), Arabidopsis thaliana MUSE13 and MUSE14, worm Caenorhabditis elegans (NP_001022764.1), fruit fly Drosophila melanogaster (NP_650325.1), mouse Mus musculus (NP_084049.2) and human Homo sapiens TRAF2 (NP_066961.), TRAF3 (NP_001186356.1), TRAF5 (NP_004610.1), TRAF6 (NP_004611.1), HAUSP (NP_003461.1) and SPOP (NP_003554.1). Protein sequences were aligned using CLUSTAL and shaded using BOXSHADE. 68   Figure 3.4 Threading analysis of the MUSE13 TRAF domain. The 3D model of MUSE13 TRAF domain was predicted using I-TASSER server (C-score 0.37, TM-score 0.76 ± 0.10 and RMSD 3.8 ± 2.6Å). The MUSE13 TRAF domain was superimposed with those of human TRAF2 (1CA4.PDB), TRAF3 (1L0A.PDB), TRAF5 (4GJH.PDB), TRAF6 (1LB6.PDB), HAUSP (2F1Z.PDB) and SPOP (3HQI) using PyMOL. TM-scores (template modeling score) are indicated in the parentheses. The TM-score measures similarity between two protein models, the more close to 1.0, the more similar of the two (Xu and Zhang, 2010). Proteins with a TM-score >0.6 are very likely (90% of chance) to share a similar fold. 69   Figure 3.5 Phylogeny of gene families encoding TRAF domain-containing proteins in Arabidopsis. Arabidopsis TRAF domain proteins were obtained in Plaza using MUSE13 protein as input. Sequences were aligned using Muscle. A Neighbor-joining tree was generated using MEGA 5.0 with JTT model and 5000 bootstrap value. MUSE13 ( AT1G04300) and MUSE14 (  AT5G43560) are bolded. The TRAF-BTB clade is highlighted in blue.    70   Figure 3.6 Knocking out AT5G43560 (MUSE14), but not AT5G52330, enhances snc1. A. Growth of Col-0, snc1, SALK_059309 (AT5G43560), snc1 SALK_059309, SAIL_239_E04 (AT5G52330) and snc1 SAIL_239_E04. B. Fresh weight of the plants in (A). Error bars represent means ± SD (n=6). *** indicates statistical difference (p<0.001, one-way ANOVA analysis between snc1 and the double mutants.   71   Figure 3.7 Amino acid alignments of MUSE13 and MUSE14.  Protein sequences were aligned using CLUSTAL and shaded using BOXSHADE. Protein identity and similarity were calculated using the Sequence Identity and Similarity (SIAS) website. The predicted TRAF domain is highlighted in box. Star indicates the muse13-1 mutation site (Arg to stop codon change). 72   Figure 3.8 Phylogenetic tree of predicted MUSE13 orthologs in higher plants.  Putative MUSE13 orthologs were obtained from Plaza (http://bioinformatics.psb.ugent.be/plaza/) using MUSE13 full-length protein sequence as input. Sequences were aligned using Muscle. A Neighbor-joining tree was generated using MEGA 5.0 with JTT model and 5000 bootstrap value. Input sequences: Manihot esculenta (ME01551G01290), Populus trichocarpa (PT10G07440), Theobroma cacao (TC04G024900), Vitis vinifera (VV05G06180), Glycine max (GM10G01170), Medicago truncatula (MT1G044450), Arabidopsis thaliana (MUSE13/AT1G04300, MUSE14/AT5G43560), Zea mays (ZM03G15890), Oryza sativa (OS12G40520), Brachypodium distachyon (BD2G20415), and Sorghum bicolor (SB03G036140). 73   Figure 3.9 MUSE13 functions redundantly with MUSE14. A. Plant morphology of Col, snc1, muse13-2, muse14-1 and muse13-2 muse14-1 (m.m.) double mutant plants. The photograph was taken when plants were four weeks old. Bar=1cm. B. RT-PCR analysis of PR gene expression in four-week-old soil-grown plants of Col, snc1, muse13-2, muse14-1 and m.m. plants. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.001, one-way ANOVA, Tukey post-test). C. Sporulation of Hpa Noco2 on Col, snc1, muse13-2, muse14-1 and m.m. double mutant plants. Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.001, one-way ANOVA, Tukey post-test). 74  3.4.3 MUSE13 localizes in the cytosol and on the plasma membrane To better study the function of MUSE13, we first generated a C-terminal green fluorescence protein (GFP)-tagged MUSE13 driven by its native promoter to examine its subcellular localization. MUSE13-GFP can fully complement the autoimmune phenotypes of muse13-2 muse14-1 plants, including plant morphology (Figure 3.10A), constitutive PR gene expression (Figure 3.10B) and enhanced immunity against Hpa Noco2 (Figure 3.10C), suggesting that the fusion protein is fully functional and localizes to its native subcellular locations. Confocal microscopy analysis revealed that MUSE13-GFP is mainly detected in the cytosol in both root and leaf epidermis cells in Arabidopsis (Figure 3.10D and, 3.10E). We did not detect an obvious nuclear signal for MUSE13-GFP (Figure 3.10; Figure 3.11A).  MUSE13-GFP also co-localizes with FM 4-64-stained plasma membrane in both root and leaf epidermis cells (Figure 3.11B and 3.11C). MUSE13 itself does not contain any predicted transmembrane domains, suggesting that MUSE13 probably associates with the plasma membrane through post-translational modifications or by interacting with other membrane proteins. To examine whether MUSE13 changes its subcellular location after NLR activation, we treated the MUSE13-GFP plants using Pseudomonas syringae pv. tomato (Pst) DC3000 that express AvrRpt2 (Figure 3.12). AvrRpt2 treatment induces hypersensitive response (HR) at 8 h post-inoculation (hpi) (Figure 3.12A). We did not detect an obvious alteration in MUSE13-GFP localization at time points up to 7 hpi (Figure 3.12B). Several human TRAFs are capable of binding to membrane receptors and initiating downstream immune signaling (Napetschnig and Wu, 2013). We therefore hypothesized that MUSE13 may participate in PTI responses. However, the autoimmune dwarf stature phenotype of muse13-2 muse14-1 was not suppressed by several pivotal PTI signaling mutants including 75  bak1-4 (Chinchilla et al., 2007), bak1-5 (Schwessinger et al., 2011), agb1-2 (Liu et al., 2013) and sobir1-12 (Gao et al., 2009) (Figure 3.13). Therefore, it is unlikely that MUSE13 and MUSE14 contribute to PTI membrane receptor signaling.  Figure 3.10 Subcellular localization of MUSE13-GFP. A. Plant morphology of the following genotypes: Col-0, muse13-2, muse14-1, m.m. (muse13 muse14 double mutant) and pMUSE13::MUSE13-GFP transformed in m.m.. The photograph was taken when plants were four weeks old. Bar=1cm. B. RT-PCR analysis of PR gene expression in four-week-old soil-grown plants of the indicated genotypes. C. Sporulation of Hpa Noco2 on indicated genotypes. Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.001, one-way ANOVA, Tukey post-test). (D and E). MUSE13-GFP expression in Arabidopsis root cells (D) and leaf epidermal cells (E) (Green in the middle). Propidium iodide (PI) staining indicates the outline of the cell wall (red). Merge (right) indicates merged image of PI and GFP.  76   Figure 3.11 MUSE13-GFP co-localizes with plasma membrane and is absent from the nucleus. A. MUSE13-GFP is absent from the nucleus. The cell membrane is stained using propidium iodide (PI) (red). Nuclei (arrows) can be visualized in the bright field.  (B and C). MUSE13-GFP co-localizes with the plasma membrane in both root cells (B) and leaf epidermal cells (C) in Arabidopsis. The plasma membrane was stained using FM 4-64 (red). Merge (right) indicates merged image of FM 4-64 and GFP. Bar=0.1 µm.  77   Figure 3.12 MUSE13-GFP localization after Pst DC3000 (AvrRpt2) treatment. A. Hypersensitive response (HR) after Pst DC3000 (AvrRpt2) treatment. Leaves of three-week-old soil-grown plants were infiltrated with bacteria expressing AvrRpt2 at an OD600 = 0.1. The picture was taken when HR became apparent at 8 hours post-inoculation (hpi). Arrows indicate leaves showing HR. B. MUSE13-GFP expression in leaf epidermal cells after AvrRpt2 treatment. MUSE13-GFP subcellular localization does not change during ETI. The images were taken at the indicated time points before HR.   0 hpi 5 hpi 7 hpi 78   Figure 3.13  The autoimmunity of muse13-2 muse14-1 is not suppressed by selected PTI deficient mutants including bak1-4, bak1-5, agb1-2 or sobir1-12.  Growth of Col-0, muse13-2, muse14-1, muse13-2 muse14-1 (m.m.), bak1-4, bak1-4 m.m., bak1-5, bak1-5 m.m., agb1-2, agb1-2 m.m., sobir1-12, sobir1-12 m.m.. The photograph was taken when soil-grown plants were four weeks old. Bar=1cm.  3.4.4 The muse13-2 muse14-1 autoimmune phenotypes rely on SNC1 To search for components required for the muse13-2 muse14-1 autoimmune phenotypes, we performed a forward genetic suppressor screen using the muse13-2 muse14-1 double mutant. Approximately 5,000 muse13-2 muse14-1 seeds were mutagenized using ethyl methanesulfonate (EMS), and 50,000 M2 plants were screened for mutants that could revert the muse13-2 muse14-1 dwarfism back to WT. In total, 206 putative mutants were isolated and two of these mutants, 9-1 and 84-1, were characterized in detail. Both mutants displayed WT-like morphology (Figure 3.14A). An allelism test indicated that 9-1 and 84-1 are alleles of the same gene. As these mutations were mapped to the RPP4 cluster on chromosome 4, direct Sanger sequencing was carried out to find the molecular lesions responsible for the observed phenotypes. Both mutants were found to harbor mutations in SNC1 (AT4G16890) (Figure 3.14B), indicating that 9-1 and 84-1 are probably loss-of-function alleles of SNC1. The C to T mutation in 9-1 caused a Leu772 to Phe772 (L772F) substitution, while the G to A mutation in 84-1 caused an Ala942 to Thr942 (A942T) substitution.  79  To confirm the reliance of MUSE13 and MUSE14 on SNC1, we crossed muse13-2 muse14-1 with snc1-r1, a known snc1 null allele carrying a deletion in SNC1 (Zhang et al., 2003). As shown in Figure 3.14C, snc1-r1 fully suppresses the muse13-2 muse14-1 dwarfism. These data indicate that 9-1 and 84-1 are indeed loss-of-function snc1 alleles, and that the muse13-2 muse14-1 autoimmune phenotypes require a functional SNC1 protein.  To further examine whether loss-of-function snc1-r1 can fully suppress other autoimmune defects of muse13-2 muse14-1, we examined the PR gene expression in muse13-2 muse14-1 snc1-r1 plants. Interestingly, the elevated PR gene expression was only partially reduced by snc1-r1 (Figure 3.14D). The enhanced disease resistance against Hpa Noco2 in the muse13-2 muse14-1 double mutant was also partially suppressed by snc1-r1 (Figure 3.14E). This is reminiscent of the cpr1 snc1-r1 phenotype, where snc1-r1 largely suppresses the dwarfism of cpr1, while still exhibiting slight autoimmunity in regards to PR gene expression and pathogen resistance (Cheng et al., 2011). These data suggest that MUSE13 and MUSE14 function is not only specific to SNC1.  To further test the specificity of MUSE13 and MUSE14, we examined the growth of selected avirulent pathogens, including Pst DC3000 (AvrRpt2), Pst DC3000 (AvrRps4), Pst DC3000 (AvrRpm1) and Pst DC3000 (AvrPphB) on muse13-2 muse14-1 snc1-r1 plants. AvrRpt2 and AvrRps4 effectors can be recognized by CNL RPS2 and TNL RPS4, respectively. As shown in Figures 3.14F and 3.14G, reduced bacterial growth of Pst DC3000 (AvrRpt2), but not Pst DC3000 (AvrRps4), was observed in the triple mutant. The growth of the virulent strain Pseudomonas syringae pv. maculicola (Psm ES4326) was not altered in muse13-2 muse14-1 snc1-r1 plants (Figure 3.14H). In addition, MUSE13 and MUSE14 did not seem to contribute to immunity mediated by two other CNLs, RPM1 or RPS5 (Figure 3.15), which recognizes 80  AvrRpm1 and AvrPphB respectively. These data indicate that MUSE13 and MUSE14 may also modulate CNL RPS2-, but not TNL RPS4- or CNL RPM1- or RPS5-, mediated defenses.   Figure 3.14 The autoimmunity of muse13-2 muse14-1 partially depends on SNC1. A. Morphology of Col-0, m.m. and two suppressor mutants (9-1 and 84-1) identified in the muse13-2 muse14-1 (m.m.) double mutant background. The photograph was taken when plants were four-week-old. Bar=1cm.  B. Schematic structure of SNC1 protein. Mutation sites of snc1, 9-1 and 84-1 are indicated. C. Plant morphology of Col, snc1, muse13-2, muse14-1, m.m., snc1-r1 and m.m. snc1-r1 plants. snc1-r1 is a null allele of snc1.  D. RT-PCR analysis of PR gene expression in two-week-old plate-grown seedlings of the indicated genotypes. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.01, one-way ANOVA, Tukey post-test). E. Hpa Noco2 sporulation on Col, snc1, muse13-2, muse14-1, m.m., snc1-r1 and m.m. snc1-r1 plants. Error bars represent means ± SD (n=5). Letters indicate statistical differences (p < 0.01, one-way ANOVA, Tukey post-test). F-H. Growth of Pst DC3000 (AvrRpt2) (F), Pst DC3000 (AvrRps4) (G) and Psm ES4326 (H) on the indicated genotypes.  Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.01, two-way ANOVA). Bacterial inoculum was diluted to an OD600 = 0.001 in 10 mM MgCl2.  81    Figure 3.15 Growth of Pst DC3000 (AvrRpm1) (A) and Pst DC3000 (AvrPphB) (B) on the indicated genotypes.   Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.01, two-way ANOVA). Bacterial inoculum was diluted to an OD600=0.001 in 10 mM MgCl2. The experiments were repeated twice with similar results.   3.4.5 MUSE13 is involved in NLR protein turnover To study how MUSE13 affects NLR-mediated defense, we first examined SNC1 transcript and SNC1 protein levels in the muse13-2 muse14-1 double mutant as most of the MUSEs we have identified to date are involved in SNC1 homeostasis control (Li et al., 2015). As a control, we generated the muse13-2 muse14-1 eds1-2 triple mutant to block the feedback up-regulation of SNC1 transcription in muse13-2 muse14-1 that may complicate data interpretation. As expected, eds1-2 fully suppressed the autoimmunity of muse13-2 muse14-1 (Figures 3.16A-C). RT-PCR analysis showed that the expression of SNC1 was WT-like in the muse13-2 and muse14-1 single mutants, but its expression in muse13-2 muse14-1 was more than four-fold higher than in WT (Figure 3.16D). In contrast, the expression of SNC1 in the muse13-2 muse14-1 eds1-2 triple mutant was not significantly different from that observed in WT and eds1-2 plants (Figure 3.16D). Similarly, immunoblot analysis detected much higher SNC1 protein levels in the A B 82  muse13-2 muse14-1 double mutant plants but not in muse13-2 or muse14-1 single mutant plants when compared with WT (Figure 3.16E). This SNC1 accumulation is likely the combined consequence from both SNC1 gene transcript up-regulation and protein accumulation. Indeed, a greater than two-fold elevation in SNC1 protein levels was observed in the muse13-2 muse14-1 eds1-2 triple mutant background when compared with levels observed in eds1-2 (Figure 3.16E). These data indicate that MUSE13 and MUSE14 are required for the turnover of SNC1, as without these two MUSE proteins, SNC1 protein accumulates.  Since muse13-2 muse14-1 snc1-r1 plants exhibit enhanced resistance against Pst DC3000 (AvrRpt2), we also tested whether MUSE13 and MUSE14 participate in the protein turnover of RPS2. We generate muse13-2 mues14-1 RPS2-HA by crossing muse13-2 muse14-1 with epitope-tagged RPS2-HA (Axtell and Staskawicz, 2003). As shown in Figure 3.16F, RPS2-HA levels were more than tripled in the muse13-2 muse14-1 background as compared to levels observed in the parent RPS2-HA transgenic line. Since RPS2 expression was also increased in the muse13-2 muse14-1 background (Figure 3.16G), we generated the muse13-2 muse14-1 eds1-2 RPS2-HA quadruple mutant. As shown in Figures 3.16G and 3.16H, RPS2-HA levels were elevated in muse13-2 muse14-1 eds1-2 while RPS2 expression remained unaltered. These data indicate that MUSE13 and MUSE14 are also involved in RPS2 protein turnover. We further examined whether MUSE13 overexpression can alter disease resistance and NLR turnover by transforming MUSE13::MUSE13-FLAG-ZZ in Col-0. The MUSE13::MUSE13-FLAG- ZZ construct can fully complement the muse13-2 muse14-1 double mutant autoimmune phenotype (Figure 3.17), suggesting that the fusion gene is fully functional. Two high expression lines were selected based on MUSE13 transcript levels (Figure 3.18A). We did not detect altered disease resistance against virulent bacterial pathogens Pst DC3000 and 83  Psm ES4326 (Figure 3.18B and 3.18C). However, immunoblot analysis showed that SNC1 protein level was slightly deceased in MUSE13 overexpression lines (Figure 3.18D). Consistently, overexpression of MUSE13-GFP in snc1 partially suppressed snc1-mediated defenses. Specifically, transgenic plants were larger in size (Figure 3.19A and 3.19B) and displayed reduced SNC1 protein levels (Figure 3.19C and 3.19D) and reduced PR gene expression (Figure 3.19E), but not decreased disease resistance against virulent pathogens Hpa Noco2 and Psm ES4326. These data further support that MUSE13 and MUSE14 are involved in regulating the turnover of SNC1. Loss of MUSE13 and MUSE14 leads to an over-accumulation of SNC1, while overexpression of MUSE13 renders lower SNC1 protein levels.  We also examined the effects of MUSE13 overexpression on RPS2 protein levels. MUSE13 overexpression caused a large decrease in RPS2-HA levels (Figure 3.19F). Taken together, MUSE13 and MUSE14 are involved in the protein turnover of both SNC1 and RPS2.  84    85  Figure 3.16 MUSE13 is involved in protein turnover of SNC1 and RPS2. A. Morphology Col-0, snc1, muse13-2, muse14-1, eds1-2, m.m. and m.m. eds1-2 plants. The photograph was taken when plants were four weeks old. Bar=1cm. B. RT-PCR analysis of PR1 and PR2 gene expression in four-week-old soil-grown plants of Col-0, snc1, muse13-2, muse14-1, eds1-2, m.m. and m.m. eds1-2 plants.  C. Sporulation of Hpa Noco2 on plants of the indicated genotypes. Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.001, one-way ANOVA followed by Tukey post-test). D. RT-PCR analysis of SNC1 expression in the indicated genotypes. Total mRNA was isolated from two-week-old plants grown on half strength MS media. Expression of SNC1 was normalized to ACT7. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Tukey post-test). E. Immunoblot analysis of SNC1 protein levels in the indicated genotypes. Total protein was extracted from four-week-old soil-grown plants. Equal loading was shown by Ponceau S staining. Relative SNC1 band intensity is indicated above (normalized to loading control). F. Immunoblot analysis of RPS2-HA protein levels in WT and muse13-2 muse14-1 (m.m.) background. Relative RPS2-HA band intensity is shown below (normalized to loading control, and relative to RPS2-HA parent line). G. RT-PCR analysis of RPS2 expression in the indicated genotypes. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Tukey post-test). H. Immunoblot analysis of RPS2-HA protein levels in WT and muse13-2 muse14-1 eds1-2 (m.m. eds1-2) background. Relative RPS2-HA band intensity is shown below (normalized to loading control, and relative to RPS2-HA parent line).  86   Figure 3.17 MUSE13::MUSE13-FLAG-ZZ complements the autoimmune phenotypes of muse13-2 muse14-1. A. Growth of Col-0, muse13-2, muse14-1, m.m. and MUSE13::MUSE13-FLAG-ZZ in m.m.. The photograph was taken when soil-grown plants were four weeks old. Bar=1cm. B. RT-PCR analysis of PR gene expression in Col-0, muse13-2, muse14-1, m.m. and MUSE13::MUSE13-FLAG-ZZ in m.m.. RNA was isolated from four-week-old soil-grown plants. C. Sporulation of Hpa Noco2 on the indicated genotypes. Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Turkey post-test). 87   Figure 3.18 Overexpression analysis of MUSE13 in Col-0. A. RT-PCR analysis of MUSE13 transcript level in Col-0 and two independent homozygous MUSE13-FLAG-ZZ transgenic lines in Col-0 background. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Turkey post-test). B. Growth of Pst DC3000 in Col-0, MUSE13-FLAG-ZZ transgenic lines in Col-0 (T1-1 and T1-2) and eds1 plants. Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.01, two-way ANOVA). Bacterial inoculum was diluted to an OD600=0.0001 in 10mM MgCl2. C. Growth of Psm ES4326 in Col-0 and MUSE13-FLAG-ZZ transgenic lines in Col-0 (T1-1 and T1-2). Error bars represent means ± SD (n=5). Letters indicate statistical difference (p < 0.01, two-way ANOVA). Bacterial inoculum was diluted to an OD600=0.0001 in 10mM MgCl2. D. Immunoblot analysis of SNC1 protein level in snc1, Col-0 and MUSE13-FLAG-ZZ transgenic lines in Col-0 (T1-1 and T1-2). Relative SNC1 band intensity is shown below (normalized to loading control and relative to WT Col-0). 88   Figure 3.19 Overexpression of MUSE13-GFP leads to decreased NLR protein levels. A. Plant morphology of Col-0, snc1, and two independent MUSE13-GFP transgenic lines in snc1 background (T1-5 and T1-6). The photograph was taken when plants were four weeks old. Bar=1cm. B. Fresh weight of plants shown in (A). Bars represent means ± SD (n=6). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Tukey post-test). C. Immunoblot analysis of MUSE13-GFP expression in T1-5 and T1-6 transgenic lines. Relative MUSE13-GFP band intensity is shown below (normalized to loading control, relative to T1-5). D. SNC1 protein level in the indicated genotypes. Relative SNC1 band intensity is quantified below (normalized to loading control, relative to WT). E. RT-PCR analysis of PR1 and PR2 gene expression in two-week-old plate-grown seedlings of the indicated genotypes. Error bars represent means ± SD (n=3). Letters indicate statistical difference (p < 0.01, one-way ANOVA followed by Tukey post-test). F. Immunoblot analysis of MUSE13-GFP and RPS2-HA where MUSE13-GFP was transformed into RPS2-HA line. One transgenic line (T1-2) was shown. Relative RPS2-HA band intensity is shown below (normalized to loading control, relative to RPS2-HA parent line).  89  3.4.6 MUSE13 associates with CPR1 and multiple NLRs, and forms homo-oligomers We previously identified an F-box protein, CPR1, that seems to target SNC1and RPS2 for ubiquitination and subsequent degradation (Cheng et al., 2011). As MUSE13 is also involved in the turnover of SNC1 and RPS2, we examine whether MUSE13 forms a protein complex with CPR1. When MUSE13::MUSE13-GFP and 35S::CPR1-FLAG were transiently expressed in Nicotiana benthamiana, an immunoprecipitation assay showed that CPR1-FLAG was able to efficiently pull down and enrich MUSE13-GFP (Figure 3.20A). The interaction was confirmed in Arabidopsis transgenic lines carrying both MUSE13-GFP and CPR1-FLAG (Figure 3.20B), indicating that MUSE13 and CPR1 are in the same protein complex. Interestingly, we were only able to detect MUSE13-GFP degradation products in CPR1-FLAG pulldown in Arabidopsis, suggesting that MUSE13 is turned over very quickly. Indeed, MUSE13-GFP is highly unstable (Figure 3.20C). Most of the protein disappears within 15 minutes at room temperature. Treatment with the proteasome inhibitor MG132 could significantly stabilize MUSE13-GFP protein in Arabidopsis (Figure 3.20C), suggesting that MUSE13 is likely ubiquitinated by an unknown E3 ligase which marks it for rapid degradation by the proteasome. Because CPR1 interacts with SNC1 (Cheng et al., 2011), we tested whether MUSE13 associates with SNC1. In MUSE13-FLAG-ZZ transgenic plants, we could detect SNC1 in the MUSE13 co-immunoprecipitates with anti-FLAG beads, but not in co-immunoprecipitates with beads without the antibody attachment (Figure 3.20D). This was confirmed in an independent IP experiment where plants without MUSE13-FLAG-ZZ were used as negative control (Figure 3.21). These data suggest that MUSE13 also associates with SNC1 in planta. To further test whether different forms of SNC1 affects the MUSE13-SNC1 association, we examined the interaction between MUSE13 and a constitutively active form of SNC1, snc1, or a p-loop mutant of SNC1 90  (Xu et al., 2014a), where SNC1 is non-functional due to mutations in the nucleotide-binding domain. As shown in Figure 3.20E and 3.20F, MUSE13-FLAG-ZZ associates with both snc1-GFP and the inactive p-loop mutant SNC1(aaa)-GFP, suggesting that MUSE13 and SNC1 form a protein complex regardless of the activation state of SNC1. SNC1 likely forms different protein complexes during its activation or ubiquitination, and the two complexes do not interact via using MUSE13. We next asked whether MUSE13 associates with RPS2 in planta. MUSE13-GFP and RPS2-FLAG-ZZ were transiently expressed in Nicotiana benthamiana. We could detect highly enriched MUSE13-GFP in RPS2-FLAG-ZZ co-immunoprecipitates (Figure 3.22A), indicating that MUSE13 also associates with RPS2.  In mammals, some TRAF proteins form homo-trimers in association with their binding partners (Locksley et al., 2001). To examine whether MUSE13 can form homo-oligomers, MUSE13::MUSE13-GFP and MUSE13::MUSE13-FLAG-ZZ were transiently expressed in Nicotiana benthamiana. As shown in Figure 3.22B, we could detect MUSE13-GFP in the MUSE13-FLAG-ZZ co-immunoprecipitates, indicating that MUSE13 self-associates. Taken together, these results suggest that MUSE13 can form homo-oligomers and that MUSE13 can form a complex with SCFCPR1, along with SNC1 or RPS2.          91   Figure 3.20 MUSE13-GFP associates with CPR1-FLAG and SNC1 in planta. A. Immunoprecipitation of MUSE13-GFP by CPR1-FLAG in Nicotiana benthamiana. MUSE13-GFP input bands were only obvious after long exposure time. B. Immunoprecipitation of MUSE13-GFP by CPR1-FLAG in Arabidopsis plants stably transformed with the two transgenes. Star indicates MUSE13-GFP degradation product. Protein A beads were used as negative controls. C. Proteasome inhibitor MG132 stabilizes MUSE13-GFP. Total protein was extracted from two-week-old plate-grown MUSE13-GFP transgenic Arabidopsis seedlings. Equal amount of protein was incubated at room temperature in the presence or absence of 100 µM MG132 for the indicated periods. MUSE13-GFP was visualized by immunoblot with anti-GFP. D. Immunoprecipitation of SNC1 by MUSE13-FLAG-ZZ in Arabidopsis. SNC1 was detected using an α-SNC1 antibody (Li et al., 2010). The low molecular weight bands represent degradation products of MUSE13-FLAG-ZZ. The difference in band intensity of the degradation products compared with (B) is likely caused by differential immunoprecipitation efficiency using different antibodies. Protein A beads were used as negative controls. (E and F). Immunoprecipitation of snc1-GFP (E) and SNC1(aaa)-GFP (F) by MUSE13-FLAG-ZZ in Nicotiana benthamiana. snc1-GFP (E) input was only obvious after long exposure time. 92   Figure 3.21 Immunoprecipitation of SNC1 by MUSE13-FLAG-ZZ in Arabidopsis.  SNC1 was detected using an α-SNC1 antibody (Li et al., 2010). MUSE13-FLAG-ZZ was detected using α-flag antibody. Wild-type Col-0 plants containing endogenous SNC1 were used as negative controls.       Figure 3.22 MUSE13-GFP associates with RPS2-FLAG-ZZ in planta and it also self-associates. A. Immunoprecipitation of MUSE13-GFP by RPS2-FLAG-ZZ in Nicotiana benthamiana.  B. Immunoprecipitation of MUSE13-GFP by MUSE13-FLAG-ZZ in Nicotiana benthamiana.           93  Table 3.1 Mutations identified in the mapped muse13-1 region. Genes with non-synonymous mutations are bolded and shown in red. They became muse13 candidates.      94  3.5 Discussion NLR proteins serve as immune receptors in mammals and plants. Their uncontrolled accumulation or activation may lead to autoimmunity and compromise general fitness. In this study, we identified two plant TRAF proteins, MUSE13 and MUSE14, which function redundantly in the regulation of NLR protein homeostasis in Arabidopsis. Knocking out both MUSE13 and MUSE14 constitutively activates immune responses, leading to stunted growth, elevated PR gene expression, and enhanced disease resistance against virulent pathogens. Our genetic and biochemical analyses revealed that the levels of two NLR proteins, SNC1 and RPS2, are increased in the muse13-2 muse14-1 double mutant and decreased in MUSE13 overexpression lines. Further, we provide evidence that MUSE13 forms homo-oligomers and associates with SNC1 and RPS2 in planta. Lastly, MUSE13 also interacts with the F-box protein CPR1, suggesting the existence of MUSE13 (or MUSE14) - SCF E3 ligase - NLR complexes that promote NLR ubiquitination and turnover. TRAF proteins have been studied extensively in mammals during the past twenty years. Most mammalian TRAF proteins are involved in protein processing and ubiquitination (Zapata et al., 2007). They serve as adaptors to connect upstream immune receptors, for example tumor necrosis factor receptors (TNFs) or Toll-like receptors, to downstream executing signaling proteins including the transcription factor NF-κB (Chen, 2005), c-Jun NH2-terminal kinase (JNK) (Yeh et al., 1997), and mitogen-activated protein kinases (MAPKs) (Xie, 2013). With the exception of TRAF7, mammalian TRAFs have a C-terminal TRAF domain and several discrete protein domains at the N-terminus. The C-terminal TRAF motif can bind to the cytoplasmic domains of membrane receptors and other signaling proteins and mediate self-association. The N-termini of TRAFs 2-7 contain RING finger domains and different numbers of zinc finger 95  motifs (Pineda et al., 2007), rendering them bona fide E3 ubiquitin ligases as well as being signaling adaptors. MUSE13 and MUSE14, however, have largely disordered C-termini and their TRAF domain is at the N-terminus. They do not contain E3 RING domains, although our study indicates that MUSE13 associates with a known E3 ligase SCFCPR1 (Figure 3.20A and 3.20B). Like human TRAFs, MUSE13 can also form homo-oligomers (Figure 3.22B). As muse13 and muse14 single mutants do not exhibit obvious phenotypes, MUSE13 and MUSE14 are unlikely to form hetero-dimers.   Mammalian TRAFs are crucial for the assembly of large signalosomes (also called TRAFasomes) for immune activation or signaling. Many TRAF proteins, such as TRAF2, TRAF5, and TRAF6, are involved in the activation events occurring downstream of immune receptor signaling, including NF-κB activation (Chen, 2005), MAPK cascade induction, and interferon production (Xie, 2013). TRAF2 and TRAF6, two of the most well-documented TRAF proteins, are best known as positive regulators in the NF-κB pathway (Hayden and Ghosh, 2008). Upon TNF-α induction, TRAF2 is recruited to TNFR1 (Hsu et al., 1996). TRAF2 undergoes autoubiquitination through K63-linked polyubiquitin chains, resulting in degradation-independent protein activation. Its autoubiquitination is crucial for the activation of JNK, IKK and AP-1 (Yeh et al., 1997). Like TRAF2, TRAF6 is also recruited to membrane receptor complexes upon ligand stimulation.  TRAF6 is required for MyD88-dependent TLR signaling (Gohda et al., 2004). Oligomerization of TRAF6 activates its E3 ligase activity, leading to K63-linked polyubiquitination of its targets. One of its targets, TBK1, once activated, phosphorylates and activates IKK (Wang et al., 2001), a central kinase in the canonical NF-κB pathway.   Although most mammalian TRAF proteins are positive regulators of immune responses, some also exhibit negative roles in both innate and adaptive immunity. For example, TRAF3 96  serves as a major positive regulator of type I interferon production (Oganesyan et al., 2006; Tseng et al., 2010), but negatively regulates the alternative NF-κB signaling (Sun, 2012) and TRAF2/6- dependent MAPK activation (Matsuzawa et al., 2008). The non-canonical NF-κB pathway requires the activation of NF-κB inducing kinase (NIK) (Häcker and Karin, 2006; Scheidereit, 2006). In the unstimulated state, TRAF3 constantly ubiquitinates NIK and causes the latter to be degraded. NIK degradation prevents processing of p100, an NF-κB precursor, to p52 (Vallabhapurapu et al., 2008). Upon induction, TRAF3 is degraded, stabilizing NIK (Liao et al., 2004). The negative role of TRAF3 is somewhat similar to what is observed for MUSE13 and MUSE14.  Lacking a canonical E3 ligase domain, MUSE13 likely recruits the SCFCPR1 E3 ligase complex to target plant NLRs for ubiquitination and further degradation to avoid autoimmunity.  The highly expanded nature of the TRAF gene family in higher plants as compared to humans is a source of interest. This expansion coincides with a parallel expansion of NLR-encoding genes (Meyers et al., 2003). Compared to less than 10 TRAF-encoding genes in the human genome, the Arabidopsis genome contains over 70 genes encoding TRAF domain-containing proteins (Figure 3.5). Many of these genes are duplicated in tandem, a phenomenon also observed for NLR genes in higher plants. Their potential high levels of redundancy likely precluded the discovery of their functions in the past. Therefore although TRAF gene families are more prevalent and diversified in higher plants, little is known about their biological and biochemical roles (Zhao et al., 2013). Previous studies on a few plant TRAF proteins have only revealed their involvement in processes such as ABA signaling (Lechner et al., 2011; Bao et al., 2014b), fatty acid metabolism (Chen et al., 2013), restriction of virus movement (Cosson et al., 2010) and regulation of spindle length (Juranić et al., 2012). Although most mammalian TRAF 97  proteins contain an E3 RING domain, only TRAF-BTB proteins, a subset of TRAF-domain proteins in plants (Figure 3.5), seem to be directly involved in the ubiquitination pathway. Several Arabidopsis TRAF-BTB proteins were shown to interact with CULLIN 3 (Dieterle et al., 2005; Figueroa et al., 2005; Gingerich et al., 2005; Weber et al., 2005), serving as E3 adaptors for target ubiquitination. Due to the involvement of all mammal TRAF proteins in immune regulation, we speculate that perhaps most of the plant TRAF proteins are also immune regulators. Future in-depth reverse genetic analysis will help reveal the functions of these mysterious TRAF genes.   The modular SCF (Skp1, Cullin1, and F-box) ubiquitin ligase complex consists of three invariant components, Skp1, Cullin1 (Cul1), and Rbx1 (Goldenberg et al., 2004) and a diversifying F-box protein. Cul1 serves as the scaffold and together with Rbx1 forms the catalytic core of the complex. Skp1, as an adaptor protein, recruits different F-box proteins to the E3 complex (Deshaies, 1999). SGT1 also seems to be a subunit of SCFs (Kitagawa et al., 1999).The dynamic assembly of the SCF complex and incorporation and exchange of different F-box proteins into the SCF allows many substrates to be specifically ubiquitinated (Pierce et al., 2013). The repertoire of components included in SCF complexes is regulated by Cand1 (Cullin-associated and neddylation-dissociated protein 1) (Pierce et al., 2013), which largely expands the landscape of cellular SCF complexes.  In higher plants, F-box genes are again highly expanded and form one of the largest gene super-families involved in the regulation of almost all biological processes (Xu et al., 2009). For example, the F-box proteins TIR1 (transport inhibitor response 1) and COI1 (coronatine-insensitive 1) serve as receptors for plant hormones auxin and JA, respectively (Dharmasiri et al., 2005; Katsir et al., 2008). Successful assembly of the SCFTIR1 or SCFCOI1 complexes is required 98  for the removal of transcriptional repressors and subsequent hormone responses. Although each SCF contains common components, it also includes unique factors such as auxin or JA-Ile in the case of SCFTIR1 or SCFCOI1, respectively. Such dynamicity hinders the biochemical in vitro assembly of SCFs in general. A number of recent studies have examined the components required for the assembly of the SCFCPR1 complex. In addition to the common factors CUL1, SKP1 and SGT1b, the SCFCPR1 complex also seems to require a large number of distinct components such as CPR1, HSP90, SRFR1 and MUSE13/14 (Kadota et al., 2008; Davies and Kaplan, 2010; Kadota et al., 2010; Li et al., 2010c).   How does MUSE13/14 assist NLR turnover? The association between MUSE13 and the NLRs SNC1 and RPS2 suggests the formation of a plant-type TRAFasome consisting of MUSE13/MUSE14, SCFCPR1 and NLRs. This complex negatively regulates immune responses by modulating plant NLR ubiquitination and subsequent degradation (Figure 3.23). As SCF complex formation is an essential and critical step in activating the F-box type of E3 ligases, this proposed SCF-TRAFasome formation mediated by TRAF proteins may represent a novel method plants use to assemble SCF complexes upon pathogen infection. As the association of MUSE13 with SNC1 does not rely on the p-loop of the NLR (Figure 3.20F), MUSE13 seems to contribute to NLR turnover regardless of their activation state. The absence of MUSE13-GFP from the nucleus is intriguing (Figure 3.10 and 3.11), as nuclear localization of SNC1 is required for its activation in immunity (Xu et al., 2014a).  As both SNC1 and CPR1 can be found in the cytosol and nucleus (Cheng et al., 2009; Gou et al., 2009), it is possible that the MUSE13/14 TRAFasome contributes to SNC1 protein turnover only in the cytosol. The nuclear pool of SNC1, which is more important for NLR activation, is not influenced by MUSE13/14. 99  Although TRAFs in mammals play essential roles in immunity, MUSE13 and MUSE14 are so far the only plant TRAF proteins implicated in plant immune receptor regulation. Other TRAF proteins are likely to be involved in mediating immunity, possibly through modulating the assembly of different plant immune regulatory complexes. Additional investigations into the potential roles of other TRAF proteins in mediating immunity, as well as how TRAF proteins affect immune receptor activation in plants will be of great interest for future explorations.  Figure 3.23 Proposed model of MUSE13/14 function.  To avoid autoimmunity, MUSE13 (or MUSE14) homo-dimerizes to recruit SCFCPR1 E3 ligase complex to target NLRs, including SNC1 and RPS2, for ubiquitination and degradation. MUSE13/14, SCF E3 ligase complex, and NLRs form a plant-type TRAFasome. The assembly of SCFCPR1 complex also requires SGT1b, HSP90 and SRFR1.        100  Chapter 4 Highlights, Implications and Future Directions 4.1 Summary The goal of this dissertation work was to clone and characterize novel negative regulators in SNC1-mediated immunity, including muse10, muse12, muse13 and muse14. One of the major contributions of this thesis work is that I have shown specific HSP90 alleles playing negative roles in plant NLR-mediated immunity. This finding is a good complement of the well-known positive roles HSP90s play. By studying one of the representative hsp90 point mutants, hsp90.3-1/muse10, I demonstrated that two NLR protein levels were increased in the hsp90.3-1 background, including SNC1 and RPS2. The hsp90.3-1 mutation (and likely hsp90.2-11/muse12) functions in a dominant-negative (DN) way to regulate NLR protein stability. Using an immunoprecipitation assay, I showed that SNC1 associates with HSP90.3 and therefore serves as a client of HSP90 in Arabidopsis. I speculate that HSP90.3 might be a component of the SCFCPR1 complex to control NLR protein levels through the 26S proteasome. However, alternative models should also be accepted that HSP90.3 might not be directly involved in the negative regulation of SNC1 protein turnover, but rather by affecting the activity of other proteins. Future studies will help answer these questions.  Secondly, I demonstrated that, MUSE13 and MUSE14, two members of the TRAF protein family are involved in the negative regulation of plant NLR turnover. MUSE13 and MUSE14 are functionally redundant, and knocking out both results in autoimmunity. Genetic analysis showed that the autoimmune phenotype of muse13 muse14 double mutant plants primarily depends on a functional SNC1. In a transient expression assay, MUSE13 self-associates and forms protein complexes with SNC1 and the E3 ligase CPR1. I provided the first 101  genetic and biochemical evidence that there exists a plant type TRAFasome consisting of SCFCPR1, MUSE13/14 and NLR that together modulates NLR homeostasis.   4.2 Future directions My work on the characterization of several MUSE proteins has led to several key findings, some of which have good potential for future research projects: 1) I did not detect interactions between HSP90.3 and CPR1. This may be due to weak or transient interactions of the two. I suggest using alternative approaches such as the split luciferase assay to follow up on this and test potential associations between HSP90.3 and other SCF components. 2) It will be interesting to examine whether the DN form of HSP90.3 exhibits different binding affinities with SNC1. For example, the DN HSP90.3 may associate weaker with SNC1 compared with the WT HSP90.3. It is also possible that the DN HSP90.3 affects the association of other components with SNC1, which also leads to compromised turnover of the client protein. Since overexpression of a WT copy of HSP90.3 did not rescue the hsp90.3-1 single mutant phenotype (Chapter 2), it is more likely that the DN form of HSP90.3 affects the function of other proteins. I suggest testing the effect of the DN form of HSP90.3 on the association between SNC1 and SCF complex components.  3) The Arabidopsis TRAF protein family consists of more than 70 members and many are redundant pairs or encoded by gene clusters. In contrast, humans have only 7 TRAF proteins, and all of them have immune functions. My investigation on MUSE13/MUSE14 implies that other members of this gene family may also be involved in plant immunity regulation. The reason their function has not been uncovered is likely due to high degree of redundancy. To overcome this problem, the CRISPR (clustered 102  regularly-interspaced short palindromic repeats)/Cas9 (CRISPR-associated) system can be used to simultaneously knockout two, three or a whole clade of genes encoding TRAF-containing proteins (Jiang et al., 2013; Feng et al., 2014). Unraveling the function of this gene family will yield more insights into the plant innate immune system. 4) The MUSE13 protein is rapidly processed. I suggest determining the molecular nature of the processed MUSE13 protein using peptide sequencing. It is possible that MUSE13 is cleaved by proteases. To search for the potential proteases, a yeast two hybrid screen could be performed. Since MUSE13 only contains one defined protein domain, the TRAF domain, a screen using the TRAF domain as bait could be carried out. Subsequently, follow-up studies on the biological relevance of the processed MUSE13 products will also be of great interest. For example, certain processed MUSE13 forms could be expressed in plants and examine the consequences on MSUE13 WT protein as well as the formation of the TRAFasome complex. 5) I detected a rapid turnover rate of MUSE13 protein, which depends on ubiquitin-mediated proteasome degradation. I suggest follow up studies to uncover the potential E3 ligases that target MUSE13/14 for degradation. Such E3 ligases when overexpressed would behave as muse mutants, which can enhance snc1-mediated immunity. Since MUSE13 functions redundantly with MUSE14, there might be a pair of E3 ligases that target MUSE13/14 for degradation. 6) In this dissertation, we only examined the basal levels of SNC1 and RPS2. Whether MUSE13/14 affect the dynamic change of protein levels of NLRs during activated defense remains unanswered. I suggest follow-up studies on this. 103  References Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. PNAS 95, 10306-10311. Ade, J., DeYoung, B.J., Golstein, C., and Innes, R.W. (2007). Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proc Natl Acad Sci U S A 104, 2531-2536. Aires, A., Mota, V.R., Saavedra, M.J., Monteiro, A.A., Simoes, M., Rosa, E.A., and Bennett, R.N. (2009). Initial in vitro evaluations of the antibacterial activities of glucosinolate enzymatic hydrolysis products against plant pathogenic bacteria. J Appl Microbiol 106, 2096-2105. Alexandratos, N., and Bruinsma, J. (2012). World agriculture towards 2030/2050: the 2012 revision (ESA Working paper). Aravind, L., and Koonin, E.V. (1999). G-patch: a new conserved domain in eukaryotic RNA-processing proteins and type D retroviral polyproteins. Trends Biochem Sci 24, 342-344. Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6, 973-979. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377. Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., Noël, L., Sadanandom, A., Casais, C., Parker, J., and Shirasu, K. (2006). Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J 25, 2007-2016. Bao, F., Huang, X., Zhu, C., Zhang, X., Li, X., and Yang, S. (2014a). Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses. New Phytol. Bao, Y., Wang, C., Jiang, C., Pan, J., Zhang, G., Liu, H., and Zhang, H. (2014b). The tumor necrosis factor receptor-associated factor (TRAF)-like family protein SEVEN IN ABSENTIA 2 (SINA2) promotes drought tolerance in an ABA-dependent manner in Arabidopsis. New Phytol 202, 174-187. 104  Bent, A.F., Kunkel, B.N., Dahlbeck, D., Brown, K.L., Schmidt, R., Giraudat, J., Leung, J., and Staskawicz, B.J. (1994). RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes. Science 265, 1856-1860. Bernoux, M., Ve, T., Williams, S., Warren, C., Hatters, D., Valkov, E., Zhang, X., Ellis, J.G., Kobe, B., and Dodds, P.N. (2011). Structural and functional analysis of a plant resistance protein TIR domain reveals interfaces for self-association, signaling, and autoregulation. Cell Host Microbe 9, 200-211. Bernoux, M., Burdett, H., Williams, S.J., Zhang, X., Chen, C., Newell, K., Lawrence, G.J., Kobe, B., Ellis, J.G., Anderson, P.A., and Dodds, P.N. (2016). Comparative Analysis of the Flax Immune Receptors L6 and L7 Suggests an Equilibrium-Based Switch Activation Model. Plant Cell 28, 146-159. Bieri, S., Mauch, S., Shen, Q.H., Peart, J., Devoto, A., Casais, C., Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K., and Schulze-Lefert, P. (2004). RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell 16, 3480-3495. Boller, T., and Felix, G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 60, 379-406. Boller, T., and He, S.Y. (2009). Innate immunity in plants: an arms race between pattern recognition receptors in plants and effectors in microbial pathogens. Science 324, 742-744. Bonardi, V., Tang, S., Stallmann, A., Roberts, M., Cherkis, K., and Dangl, J.L. (2011). Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors. Proc Natl Acad Sci U S A 108, 16463-16468. Botër, M., Amigues, B., Peart, J., Breuer, C., Kadota, Y., Casais, C., Moore, G., Kleanthous, C., Ochsenbein, F., Shirasu, K., and Guerois, R. (2007). Structural and functional analysis of SGT1 reveals that its interaction with HSP90 is required for the accumulation of Rx, an R protein involved in plant immunity. Plant Cell 19, 3791-3804. Bradley, J.R., and Pober, J.S. (2001). Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 20, 6482-6491. 105  Catanzariti, A.M., Dodds, P.N., Ve, T., Kobe, B., Ellis, J.G., and Staskawicz, B.J. (2010). The AvrM effector from flax rust has a structured C-terminal domain and interacts directly with the M resistance protein. Mol Plant Microbe Interact 23, 49-57. Catlett, M.G., and Kaplan, K.B. (2006). Sgt1p is a unique co-chaperone that acts as a client adaptor to link Hsp90 to Skp1p. J Biol Chem 281, 33739-33748. Cecchini, N.M., Monteoliva, M.I., and Alvarez, M.E. (2011). Proline dehydrogenase contributes to pathogen defense in Arabidopsis. Plant Physiol 155, 1947-1959. Century, K.S., Holub, E.B., and Staskawicz, B.J. (1995). NDR1, a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and a fungal pathogen. Proc Natl Acad Sci U S A 92, 6597-6601. Chen, L., Lee, J.H., Weber, H., Tohge, T., Witt, S., Roje, S., Fernie, A.R., and Hellmann, H. (2013). Arabidopsis BPM proteins function as substrate adaptors to a cullin3-based E3 ligase to affect fatty acid metabolism in plants. The Plant Cell Online 25, 2253-2264. Chen, Z.J. (2005). Ubiquitin signalling in the NF-κB pathway. Nature cell biology 7, 758-765. Cheng, Y.T., and Li, X. (2012). Ubiquitination in NB-LRR-mediated immunity. Curr Opin Plant Biol 15, 392-399. Cheng, Y.T., Li, Y., Huang, S., Huang, Y., Dong, X., Zhang, Y., and Li, X. (2011). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proc Natl Acad Sci U S A 108, 14694-14699. Cheng, Y.T., Germain, H., Wiermer, M., Bi, D., Xu, F., García, A.V., Wirthmueller, L., Després, C., Parker, J.E., Zhang, Y., and Li, X. (2009). Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis. Plant Cell 21, 2503-2516. Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18, 465-476. Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nürnberger, T., Jones, J.D., Felix, G., and Boller, T. (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448, 497-500. Chisholm, S.T., Coaker, G., Day, B., and Staskawicz, B.J. (2006). Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803-814. 106  Clark, R.M., Schweikert, G., Toomajian, C., Ossowski, S., Zeller, G., Shinn, P., Warthmann, N., Hu, T.T., Fu, G., Hinds, D.A., Chen, H., Frazer, K.A., Huson, D.H., Scholkopf, B., Nordborg, M., Ratsch, G., Ecker, J.R., and Weigel, D. (2007). Common sequence polymorphisms shaping genetic diversity in Arabidopsis thaliana. Science 317, 338-342. Clarke, J.D., Aarts, N., Feys, B.J., Dong, X., and Parker, J.E. (2001). Constitutive disease resistance requires EDS1 in the Arabidopsis mutants cpr1 and cpr6 and is partially EDS1‐dependent in cpr5. The Plant Journal 26, 409-420. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. Coll, N.S., Epple, P., and Dangl, J.L. (2011). Programmed cell death in the plant immune system. Cell Death Differ 18, 1247-1256. Collier, S.M., and Moffett, P. (2009). NB-LRRs work a "bait and switch" on pathogens. Trends Plant Sci 14, 521-529. Copeland, C., Woloshen, V., Huang, Y., and Li, X. (2016). AtCDC48A is involved in the turnover of an NLR immune receptor. Plant J. Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana. Plant J 40, 225-237. Cosson, P., Sofer, L., Le, Q.H., Leger, V., Schurdi-Levraud, V., Whitham, S.A., Yamamoto, M.L., Gopalan, S., Le Gall, O., Candresse, T., Carrington, J.C., and Revers, F. (2010). RTM3, which controls long-distance movement of potyviruses, is a member of a new plant gene family encoding a meprin and TRAF homology domain-containing protein. Plant Physiol 154, 222-232. Cramer, P., Armache, K.J., Baumli, S., Benkert, S., Brueckner, F., Buchen, C., Damsma, G.E., Dengl, S., Geiger, S.R., Jasiak, A.J., Jawhari, A., Jennebach, S., Kamenski, T., Kettenberger, H., Kuhn, C.D., Lehmann, E., Leike, K., Sydow, J.F., and Vannini, A. (2008). Structure of eukaryotic RNA polymerases. Annu Rev Biophys 37, 337-352. da Silva Correia, J., Miranda, Y., Leonard, N., and Ulevitch, R. (2007). SGT1 is essential for Nod1 activation. Proc Natl Acad Sci U S A 104, 6764-6769. 107  Dangl, J.L., Horvath, D.M., and Staskawicz, B.J. (2013). Pivoting the plant immune system from dissection to deployment. Science 341, 746-751. Davies, A.E., and Kaplan, K.B. (2010). Hsp90-Sgt1 and Skp1 target human Mis12 complexes to ensure efficient formation of kinetochore-microtubule binding sites. J Cell Biol 189, 261-274. de la Fuente van Bentem, S., Vossen, J.H., de Vries, K.J., van Wees, S., Tameling, W.I., Dekker, H.L., de Koster, C.G., Haring, M.A., Takken, F.L., and Cornelissen, B.J. (2005). Heat shock protein 90 and its co-chaperone protein phosphatase 5 interact with distinct regions of the tomato I-2 disease resistance protein. Plant J 43, 284-298. Deshaies, R.J. (1999). SCF and Cullin/Ring H2-based ubiquitin ligases. Annu Rev Cell Dev Biol 15, 435-467. Deslandes, L., Olivier, J., Theulieres, F., Hirsch, J., Feng, D.X., Bittner-Eddy, P., Beynon, J., and Marco, Y. (2002). Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive RRS1-R gene, a member of a novel family of resistance genes. Proc Natl Acad Sci U S A 99, 2404-2409. Dharmasiri, N., Dharmasiri, S., and Estelle, M. (2005). The F-box protein TIR1 is an auxin receptor. Nature 435, 441-445. Dieterle, M., Zhou, Y.C., Schafer, E., Funk, M., and Kretsch, T. (2001). EID1, an F-box protein involved in phytochrome A-specific light signaling. Genes Dev 15, 939-944. Dieterle, M., Thomann, A., Renou, J.P., Parmentier, Y., Cognat, V., Lemonnier, G., Müller, R., Shen, W.H., Kretsch, T., and Genschik, P. (2005). Molecular and functional characterization of Arabidopsis Cullin 3A. Plant J 41, 386-399. Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Teh, T., Wang, C.I., Ayliffe, M.A., Kobe, B., and Ellis, J.G. (2006). Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci U S A 103, 8888-8893. Dong, O.X., Tong, M., Bonardi, V., El Kasmi, F., Woloshen, V., Wünsch, L.K., Dangl, J.L., and Li, X. (2016). TNL‐mediated immunity in Arabidopsis requires complex regulation of the redundant ADR1 gene family. New Phytologist. Eitas, T.K., and Dangl, J.L. (2010). NB-LRR proteins: pairs, pieces, perception, partners, and pathways. Curr Opin Plant Biol 13, 472-477. 108  Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant J 18, 265-276. Feng, Z., Mao, Y., Xu, N., Zhang, B., Wei, P., Yang, D.L., Wang, Z., Zhang, Z., Zheng, R., Yang, L., Zeng, L., Liu, X., and Zhu, J.K. (2014). Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl Acad Sci U S A 111, 4632-4637. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17, 2601-2613. Figueroa, P., Gusmaroli, G., Serino, G., Habashi, J., Ma, L., Shen, Y., Feng, S., Bostick, M., Callis, J., and Hellmann, H. (2005). Arabidopsis has two redundant Cullin3 proteins that are essential for embryo development and that interact with RBX1 and BTB proteins to form multisubunit E3 ubiquitin ligase complexes in vivo. The Plant Cell Online 17, 1180-1195. Flor, H. (1942). Inheritance of pathogenicity in Melampsora lini. Phytopathology 32, 653-669. Flor, H. (1955). Host-parasite interaction in flax rust-its genetics and other implications. Phytopathology 45, 680-685. Flor, H.H. (1971). Current status of the gene-for-gene concept. Annual review of phytopathology 9, 275-296. Frazier, A.E., Dudek, J., Guiard, B., Voos, W., Li, Y., Lind, M., Meisinger, C., Geissler, A., Sickmann, A., Meyer, H.E., Bilanchone, V., Cumsky, M.G., Truscott, K.N., Pfanner, N., and Rehling, P. (2004). Pam16 has an essential role in the mitochondrial protein import motor. Nat Struct Mol Biol 11, 226-233. Gagne, J.M., Downes, B.P., Shiu, S.H., Durski, A.M., and Vierstra, R.D. (2002). The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc Natl Acad Sci U S A 99, 11519-11524. Gao, M., Wang, X., Wang, D., Xu, F., Ding, X., Zhang, Z., Bi, D., Cheng, Y.T., Chen, S., Li, X., and Zhang, Y. (2009). Regulation of cell death and innate immunity by two receptor-like kinases in Arabidopsis. Cell Host Microbe 6, 34-44. 109  García, A.V., Blanvillain-Baufumé, S., Huibers, R.P., Wiermer, M., Li, G., Gobbato, E., Rietz, S., and Parker, J.E. (2010). Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response. PLoS Pathog 6, e1000970. Gingerich, D.J., Gagne, J.M., Salter, D.W., Hellmann, H., Estelle, M., Ma, L., and Vierstra, R.D. (2005). Cullins 3a and 3b assemble with members of the broad complex/tramtrack/bric-a-brac (BTB) protein family to form essential ubiquitin-protein ligases (E3s) in Arabidopsis. J Biol Chem 280, 18810-18821. Gohda, J., Matsumura, T., and Inoue, J. (2004). Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling. J Immunol 173, 2913-2917. Goldenberg, S.J., Cascio, T.C., Shumway, S.D., Garbutt, K.C., Liu, J., Xiong, Y., and Zheng, N. (2004). Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell 119, 517-528. Gou, M., Shi, Z., Zhu, Y., Bao, Z., Wang, G., and Hua, J. (2012). The F-box protein CPR1/CPR30 negatively regulates R protein SNC1 accumulation. Plant J 69, 411-420. Gou, M., Su, N., Zheng, J., Huai, J., Wu, G., Zhao, J., He, J., Tang, D., Yang, S., and Wang, G. (2009). An F-box gene, CPR30, functions as a negative regulator of the defense response in Arabidopsis. Plant J 60, 757-770. Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W., and Dangl, J.L. (1995). Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science 269, 843-846. Gray, W.M., Muskett, P.R., Chuang, H.W., and Parker, J.E. (2003). Arabidopsis SGT1b is required for SCF(TIR1)-mediated auxin response. Plant Cell 15, 1310-1319. Groll, M., and Huber, R. (2003). Substrate access and processing by the 20S proteasome core particle. Int J Biochem Cell Biol 35, 606-616. Haag, J.R., and Pikaard, C.S. (2011). Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing. Nat Rev Mol Cell Biol 12, 483-492. Hahn, J.S. (2005). Regulation of Nod1 by Hsp90 chaperone complex. FEBS Lett 579, 4513-4519. 110  Hayden, M.S., and Ghosh, S. (2008). Shared principles in NF-κB signaling. Cell 132, 344-362. Heidrich, K., Wirthmueller, L., Tasset, C., Pouzet, C., Deslandes, L., and Parker, J.E. (2011). Arabidopsis EDS1 connects pathogen effector recognition to cell compartment-specific immune responses. Science 334, 1401-1404. Holt, B.F., Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic control of disease resistance protein stability in the plant immune system. Science 309, 929-932. Howard, R.J., and Valent, B. (1996). Breaking and entering: host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu Rev Microbiol 50, 491-512. Hsu, H., Shu, H.B., Pan, M.G., and Goeddel, D.V. (1996). TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 84, 299-308. Hu, Z., Zhou, Q., Zhang, C., Fan, S., Cheng, W., Zhao, Y., Shao, F., Wang, H.W., Sui, S.F., and Chai, J. (2015). Structural and biochemical basis for induced self-propagation of NLRC4. Science 350, 399-404. Hu, Z., Yan, C., Liu, P., Huang, Z., Ma, R., Zhang, C., Wang, R., Zhang, Y., Martinon, F., Miao, D., Deng, H., Wang, J., Chang, J., and Chai, J. (2013). Crystal structure of NLRC4 reveals its autoinhibition mechanism. Science 341, 172-175. Hua, J., Grisafi, P., Cheng, S.H., and Fink, G.R. (2001). Plant growth homeostasis is controlled by the Arabidopsis BON1 and BAP1 genes. Genes Dev 15, 2263-2272. Huang, S., Monaghan, J., Zhong, X., Lin, L., Sun, T., Dong, O.X., and Li, X. (2014a). HSP90s are required for NLR immune receptor accumulation in Arabidopsis. Plant J 79, 427-439. Huang, S., Chen, X., Zhong, X., Li, M., Ao, K., Huang, J., and Li, X. (2016). Plant TRAF Proteins Regulate NLR Immune Receptor Turnover. Cell Host Microbe 19, 204-215. Huang, Y., Minaker, S., Roth, C., Huang, S., Hieter, P., Lipka, V., Wiermer, M., and Li, X. (2014b). An E4 ligase facilitates polyubiquitination of plant immune receptor resistance proteins in Arabidopsis. Plant Cell 26, 485-496. Huang, Y., Chen, X., Liu, Y., Roth, C., Copeland, C., McFarlane, H.E., Huang, S., Lipka, V., Wiermer, M., and Li, X. (2013). Mitochondrial AtPAM16 is required for plant survival and the negative regulation of plant immunity. Nat Commun 4, 2558. 111  Hubert, D.A., He, Y., McNulty, B.C., Tornero, P., and Dangl, J.L. (2009). Specific Arabidopsis HSP90.2 alleles recapitulate RAR1 cochaperone function in plant NB-LRR disease resistance protein regulation. Proc Natl Acad Sci U S A 106, 9556-9563. Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K., and Dangl, J.L. (2003). Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J 22, 5679-5689. Huveneers, S., and Danen, E.H. (2009). Adhesion signaling - crosstalk between integrins, Src and Rho. J Cell Sci 122, 1059-1069. Häcker, H., and Karin, M. (2006). Regulation and function of IKK and IKK-related kinases. Sci STKE 2006, re13. Jackson, S.E. (2013). Hsp90: structure and function. Top Curr Chem 328, 155-240. Jacob, F., Vernaldi, S., and Maekawa, T. (2013). Evolution and conservation of plant NLR functions. Frontiers in immunology 4. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. Embo j 19, 4004-4014. Jiang, W., Zhou, H., Bi, H., Fromm, M., Yang, B., and Weeks, D.P. (2013). Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res 41, e188. Johal, G.S., and Briggs, S.P. (1992). Reductase activity encoded by the HM1 disease resistance gene in maize. Science 258, 985-987. Johnson, K.C., Dong, O.X., Huang, Y., and Li, X. (2012). A Rolling Stone Gathers No Moss, but Resistant Plants Must Gather Their MOSes. Cold Spring Harb Symp Quant Biol 77, 259-268. Johnson, K.C., Dong, O.X., Huang, Y., and Li, X. (2013). A Rolling Stone Gathers No Moss, but Resistant Plants Must Gather Their MOSes. Cold Spring Harb Symp Quant Biol. Johnson, K.C., Xia, S., Feng, X., and Li, X. (2015). The Chromatin Remodeler SPLAYED Negatively Regulates SNC1-Mediated Immunity. Plant Cell Physiol 56, 1616-1623. Johnson, K.C., Yu, Y., Gao, L., Eng, R.C., Wasteneys, G.O., Chen, X., and Li, X. (2016). A partial loss-of-function mutation in an Arabidopsis RNA polymerase III subunit leads to pleiotropic defects. J Exp Bot 67, 2219-2230. 112  Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329. Juge, N. (2006). Plant protein inhibitors of cell wall degrading enzymes. Trends Plant Sci 11, 359-367. Juranić, M., Srilunchang, K.-o., Krohn, N.G., Leljak-Levanić, D., Sprunck, S., and Dresselhaus, T. (2012). Germline-specific MATH-BTB substrate adaptor MAB1 regulates spindle length and nuclei identity in maize. The Plant Cell Online 24, 4974-4991. Kadota, Y., and Shirasu, K. (2012). The HSP90 complex of plants. Biochim Biophys Acta 1823, 689-697. Kadota, Y., Shirasu, K., and Guerois, R. (2010). NLR sensors meet at the SGT1-HSP90 crossroad. Trends Biochem Sci 35, 199-207. Kadota, Y., Amigues, B., Ducassou, L., Madaoui, H., Ochsenbein, F., Guerois, R., and Shirasu, K. (2008). Structural and functional analysis of SGT1-HSP90 core complex required for innate immunity in plants. EMBO Rep 9, 1209-1215. Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., Jones, J.D., Shirasu, K., Menke, F., Jones, A., and Zipfel, C. (2014). Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. Mol Cell 54, 43-55. Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., and Howe, G.A. (2008). COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc Natl Acad Sci U S A 105, 7100-7105. Kim, H.S., and Delaney, T.P. (2002). Arabidopsis SON1 is an F-box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance. Plant Cell 14, 1469-1482. Kim, T.S., Kim, W.Y., Fujiwara, S., Kim, J., Cha, J.Y., Park, J.H., Lee, S.Y., and Somers, D.E. (2011). HSP90 functions in the circadian clock through stabilization of the client F-box protein ZEITLUPE. Proc Natl Acad Sci U S A 108, 16843-16848. Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W., and Hieter, P. (1999). SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell 4, 21-33. 113  Knepper, C., Savory, E.A., and Day, B. (2011). Arabidopsis NDR1 is an integrin-like protein with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol 156, 286-300. Koegl, M., Hoppe, T., Schlenker, S., Ulrich, H.D., Mayer, T.U., and Jentsch, S. (1999). A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly. Cell 96, 635-644. Komander, D., and Rape, M. (2012). The ubiquitin code. Annu Rev Biochem 81, 203-229. Krasileva, K.V., Dahlbeck, D., and Staskawicz, B.J. (2010). Activation of an Arabidopsis resistance protein is specified by the in planta association of its leucine-rich repeat domain with the cognate oomycete effector. Plant Cell 22, 2444-2458. Krishna, P., and Gloor, G. (2001). The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones 6, 238-246. Kyrpides, N.C., Woese, C.R., and Ouzounis, C.A. (1996). KOW: a novel motif linking a bacterial transcription factor with ribosomal proteins. Trends Biochem Sci 21, 425-426. Lange, C., Hemmrich, G., Klostermeier, U.C., Lopez-Quintero, J.A., Miller, D.J., Rahn, T., Weiss, Y., Bosch, T.C., and Rosenstiel, P. (2011). Defining the origins of the NOD-like receptor system at the base of animal evolution. Mol Biol Evol 28, 1687-1702. Lechner, E., Leonhardt, N., Eisler, H., Parmentier, Y., Alioua, M., Jacquet, H., Leung, J., and Genschik, P. (2011). MATH/BTB CRL3 receptors target the homeodomain-leucine zipper ATHB6 to modulate abscisic acid signaling. Dev Cell 21, 1116-1128. Lee, J., Nam, J., Park, H.C., Na, G., Miura, K., Jin, J.B., Yoo, C.Y., Baek, D., Kim, D.H., and Jeong, J.C. (2007). Salicylic acid‐mediated innate immunity in Arabidopsis is regulated by SIZ1 SUMO E3 ligase. The Plant Journal 49, 79-90. Lee, S.C., Hwang, I.S., Choi, H.W., and Hwang, B.K. (2008). Involvement of the pepper antimicrobial protein CaAMP1 gene in broad spectrum disease resistance. Plant Physiol 148, 1004-1020. Leipe, D.D., Koonin, E.V., and Aravind, L. (2004). STAND, a class of P-loop NTPases including animal and plant regulators of programmed cell death: multiple, complex domain architectures, unusual phyletic patterns, and evolution by horizontal gene transfer. J Mol Biol 343, 1-28. 114  Li, J., and Chory, J. (1997). A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. Cell 90, 929-938. Li, J., Zhao-Hui, C., Batoux, M., Nekrasov, V., Roux, M., Chinchilla, D., Zipfel, C., and Jones, J.D. (2009). Specific ER quality control components required for biogenesis of the plant innate immune receptor EFR. Proc Natl Acad Sci U S A 106, 15973-15978. Li, J., Ding, J., Zhang, W., Zhang, Y., Tang, P., Chen, J.Q., Tian, D., and Yang, S. (2010a). Unique evolutionary pattern of numbers of gramineous NBS-LRR genes. Mol Genet Genomics 283, 427-438. Li, L., Li, M., Yu, L., Zhou, Z., Liang, X., Liu, Z., Cai, G., Gao, L., Zhang, X., Wang, Y., Chen, S., and Zhou, J.M. (2014). The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity. Cell Host Microbe 15, 329-338. Li, X., Kapos, P., and Zhang, Y. (2015). NLRs in plants. Curr Opin Immunol 32C, 114-121. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001). Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact 14, 1131-1139. Li, Y., Tessaro, M.J., Li, X., and Zhang, Y. (2010b). Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol 153, 1425-1434. Li, Y., Li, S., Bi, D., Cheng, Y.T., Li, X., and Zhang, Y. (2010c). SRFR1 negatively regulates plant NB-LRR resistance protein accumulation to prevent autoimmunity. PLoS Pathog 6, e1001111. Liao, G., Zhang, M., Harhaj, E.W., and Sun, S.C. (2004). Regulation of the NF-kappaB-inducing kinase by tumor necrosis factor receptor-associated factor 3-induced degradation. J Biol Chem 279, 26243-26250. Lister, R., Hulett, J.M., Lithgow, T., and Whelan, J. (2005). Protein import into mitochondria: origins and functions today (review). Mol Membr Biol 22, 87-100. Liu, J., Ding, P., Sun, T., Nitta, Y., Dong, O., Huang, X., Yang, W., Li, X., Botella, J.R., and Zhang, Y. (2013). Heterotrimeric G proteins serve as a converging point in plant defense signaling activated by multiple receptor-like kinases. Plant Physiol 161, 2146-2158. 115  Liu, Y., Burch-Smith, T., Schiff, M., Feng, S., and Dinesh-Kumar, S.P. (2004). Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J Biol Chem 279, 2101-2108. Locksley, R.M., Killeen, N., and Lenardo, M.J. (2001). The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487-501. Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L., and He, P. (2010). A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proc Natl Acad Sci U S A 107, 496-501. Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J., Wu, A.J., Rathjen, J.P., Bendahmane, A., Day, L., and Baulcombe, D.C. (2003). High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22, 5690-5699. Maekawa, T., Kufer, T.A., and Schulze-Lefert, P. (2011a). NLR functions in plant and animal immune systems: so far and yet so close. Nat Immunol 12, 817-826. Maekawa, T., Cheng, W., Spiridon, L.N., Toller, A., Lukasik, E., Saijo, Y., Liu, P., Shen, Q.H., Micluta, M.A., Somssich, I.E., Takken, F.L., Petrescu, A.J., Chai, J., and Schulze-Lefert, P. (2011b). Coiled-coil domain-dependent homodimerization of intracellular barley immune receptors defines a minimal functional module for triggering cell death. Cell Host Microbe 9, 187-199. Makhnevych, T., and Houry, W.A. (2012). The role of Hsp90 in protein complex assembly. Biochim Biophys Acta 1823, 674-682. Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary, A., Ganal, M.W., Spivey, R., Wu, T., Earle, E.D., and Tanksley, S.D. (1993). Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 262, 1432-1436. Matsuzawa, A., Tseng, P.H., Vallabhapurapu, S., Luo, J.L., Zhang, W., Wang, H., Vignali, D.A., Gallagher, E., and Karin, M. (2008). Essential cytoplasmic translocation of a cytokine receptor-assembled signaling complex. Science 321, 663-668. Mayor, A., Martinon, F., De Smedt, T., Pétrilli, V., and Tschopp, J. (2007). A crucial function of SGT1 and HSP90 in inflammasome activity links mammalian and plant innate immune responses. Nat Immunol 8, 497-503. 116  Mazzucotelli, E., Belloni, S., Marone, D., De Leonardis, A., Guerra, D., Di Fonzo, N., Cattivelli, L., and Mastrangelo, A. (2006). The e3 ubiquitin ligase gene family in plants: regulation by degradation. Curr Genomics 7, 509-522. Mestre, P., and Baulcombe, D.C. (2006). Elicitor-mediated oligomerization of the tobacco N disease resistance protein. Plant Cell 18, 491-501. Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Michelmore, R.W. (2003). Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15, 809-834. Mindrinos, M., Katagiri, F., Yu, G.-L., and Ausubel, F.M. (1994). The A. thaliana disease resistance gene RPS2 encodes a protein containing a nucleotide-binding site and leucine-rich repeats. Cell 78, 1089-1099. Moffett, P., Farnham, G., Peart, J., and Baulcombe, D.C. (2002). Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J 21, 4511-4519. Monaghan, J., Xu, F., Gao, M., Zhao, Q., Palma, K., Long, C., Chen, S., Zhang, Y., and Li, X. (2009). Two Prp19-like U-box proteins in the MOS4-associated complex play redundant roles in plant innate immunity. PLoS Pathog 5, e1000526. Muskett, P.R., Kahn, K., Austin, M.J., Moisan, L.J., Sadanandom, A., Shirasu, K., Jones, J.D., and Parker, J.E. (2002). Arabidopsis RAR1 exerts rate-limiting control of R gene-mediated defenses against multiple pathogens. Plant Cell 14, 979-992. Napetschnig, J., and Wu, H. (2013). Molecular basis of NF-kappaB signaling. Annu Rev Biophys 42, 443-468. Narusaka, M., Shirasu, K., Noutoshi, Y., Kubo, Y., Shiraishi, T., Iwabuchi, M., and Narusaka, Y. (2009). RRS1 and RPS4 provide a dual Resistance-gene system against fungal and bacterial pathogens. Plant J 60, 218-226. Nuhse, T.S., Bottrill, A.R., Jones, A.M., and Peck, S.C. (2007). Quantitative phosphoproteomic analysis of plasma membrane proteins reveals regulatory mechanisms of plant innate immune responses. Plant J 51, 931-940. Oelmüller, R., Peškan‐Berghöfer, T., Shahollari, B., Trebicka, A., Sherameti, I., and Varma, A. (2005). MATH domain proteins represent a novel protein family in Arabidopsis thaliana, and at least one member is modified in roots during the course of a plant–microbe interaction. Physiologia Plantarum 124, 152-166. 117  Oganesyan, G., Saha, S.K., Guo, B., He, J.Q., Shahangian, A., Zarnegar, B., Perry, A., and Cheng, G. (2006). Critical role of TRAF3 in the Toll-like receptor-dependent and -independent antiviral response. Nature 439, 208-211. Palma, K., Zhao, Q., Cheng, Y.T., Bi, D., Monaghan, J., Cheng, W., Zhang, Y., and Li, X. (2007). Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms. Genes Dev 21, 1484-1493. Park, Y.C., Burkitt, V., Villa, A.R., Tong, L., and Wu, H. (1999). Structural basis for self-association and receptor recognition of human TRAF2. Nature 398, 533-538. Paul, S. (2008). Dysfunction of the ubiquitin-proteasome system in multiple disease conditions: therapeutic approaches. Bioessays 30, 1172-1184. Pearl, L.H., and Prodromou, C. (2006). Structure and mechanism of the Hsp90 molecular chaperone machinery. Annu Rev Biochem 75, 271-294. Peart, J.R., Mestre, P., Lu, R., Malcuit, I., and Baulcombe, D.C. (2005). NRG1, a CC-NB-LRR protein, together with N, a TIR-NB-LRR protein, mediates resistance against tobacco mosaic virus. Curr Biol 15, 968-973. Person, C., Samborski, D.J., and Rohringer. (1962). The gene-for-gene concept (Nature), pp. 1-62. Pierce, N.W., Lee, J.E., Liu, X., Sweredoski, M.J., Graham, R.L., Larimore, E.A., Rome, M., Zheng, N., Clurman, B.E., Hess, S., Shan, S.O., and Deshaies, R.J. (2013). Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell 153, 206-215. Pineda, G., Ea, C.K., and Chen, Z.J. (2007). Ubiquitination and TRAF signaling. Adv Exp Med Biol 597, 80-92. Rairdan, G.J., Collier, S.M., Sacco, M.A., Baldwin, T.T., Boettrich, T., and Moffett, P. (2008). The coiled-coil and nucleotide binding domains of the Potato Rx disease resistance protein function in pathogen recognition and signaling. Plant Cell 20, 739-751. Samach, A., Klenz, J.E., Kohalmi, S.E., Risseeuw, E., Haughn, G.W., and Crosby, W.L. (1999). The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. Plant J 20, 433-445. 118  Sarris, P.F., Cevik, V., Dagdas, G., Jones, J.D., and Krasileva, K.V. (2016). Comparative analysis of plant immune receptor architectures uncovers host proteins likely targeted by pathogens. BMC Biol 14, 8. Sarris, P.F., Duxbury, Z., Huh, S.U., Ma, Y., Segonzac, C., Sklenar, J., Derbyshire, P., Cevik, V., Rallapalli, G., Saucet, S.B., Wirthmueller, L., Menke, F.L., Sohn, K.H., and Jones, J.D. (2015). A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors. Cell 161, 1089-1100. Scheidereit, C. (2006). IkappaB kinase complexes: gateways to NF-kappaB activation and transcription. Oncogene 25, 6685-6705. Schulze, B., Mentzel, T., Jehle, A.K., Mueller, K., Beeler, S., Boller, T., Felix, G., and Chinchilla, D. (2010). Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1. J Biol Chem 285, 9444-9451. Schwessinger, B., and Zipfel, C. (2008). News from the frontline: recent insights into PAMP-triggered immunity in plants. Curr Opin Plant Biol 11, 389-395. Schwessinger, B., Roux, M., Kadota, Y., Ntoukakis, V., Sklenar, J., Jones, A., and Zipfel, C. (2011). Phosphorylation-dependent differential regulation of plant growth, cell death, and innate immunity by the regulatory receptor-like kinase BAK1. PLoS Genet 7, e1002046. Senthil-Kumar, M., and Mysore, K.S. (2013). Nonhost resistance against bacterial pathogens: retrospectives and prospects. Annu Rev Phytopathol 51, 407-427. Shao, Z.Q., Xue, J.Y., Wu, P., Zhang, Y.M., Wu, Y., Hang, Y.Y., Wang, B., and Chen, J.Q. (2016). Large-scale analyses of angiosperm nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes reveal three anciently diverged classes with distinct evolutionary patterns. Plant Physiol. She, J., Han, Z., Kim, T.W., Wang, J., Cheng, W., Chang, J., Shi, S., Yang, M., Wang, Z.Y., and Chai, J. (2011). Structural insight into brassinosteroid perception by BRI1. Nature 474, 472-476. Sheard, L.B., Tan, X., Mao, H., Withers, J., Ben-Nissan, G., Hinds, T.R., Kobayashi, Y., Hsu, F.F., Sharon, M., Browse, J., He, S.Y., Rizo, J., Howe, G.A., and Zheng, N. (2010). Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 468, 400-405. 119  Shirasu, K. (2009). The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu Rev Plant Biol 60, 139-164. Shirasu, K., Lahaye, T., Tan, M.W., Zhou, F., Azevedo, C., and Schulze-Lefert, P. (1999). A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C. elegans. Cell 99, 355-366. Shiu, S.-H., and Bleecker, A.B. (2001). Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. PANS 98. Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55, 555-590. Somers, D.E., Schultz, T.F., Milnamow, M., and Kay, S.A. (2000). ZEITLUPE encodes a novel clock-associated PAS protein from Arabidopsis. Cell 101, 319-329. Staskawicz, B., Dahlbeck, D., Keen, N., and Napoli, C. (1987). Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169, 5789-5794. Steinbrenner, A.D., Goritschnig, S., and Staskawicz, B.J. (2015). Recognition and activation domains contribute to allele-specific responses of an Arabidopsis NLR receptor to an oomycete effector protein. PLoS Pathog 11, e1004665. Sun, S.C. (2012). The noncanonical NF-κB pathway. Immunol Rev 246, 125-140. Sun, Y., Li, L., Macho, A.P., Han, Z., Hu, Z., Zipfel, C., Zhou, J.M., and Chai, J. (2013). Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex. Science 342, 624-628. Taipale, M., Jarosz, D.F., and Lindquist, S. (2010). HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11, 515-528. Takahashi, A., Casais, C., Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci U S A 100, 11777-11782. Tameling, W.I., Vossen, J.H., Albrecht, M., Lengauer, T., Berden, J.A., Haring, M.A., Cornelissen, B.J., and Takken, F.L. (2006). Mutations in the NB-ARC domain of I-2 that impair ATP hydrolysis cause autoactivation. Plant Physiol 140, 1233-1245. Trujillo, M., and Shirasu, K. (2010). Ubiquitination in plant immunity. Curr Opin Plant Biol 13, 402-408. 120  Tseng, P.H., Matsuzawa, A., Zhang, W., Mino, T., Vignali, D.A., and Karin, M. (2010). Different modes of ubiquitination of the adaptor TRAF3 selectively activate the expression of type I interferons and proinflammatory cytokines. Nat Immunol 11, 70-75. Vallabhapurapu, S., Matsuzawa, A., Zhang, W., Tseng, P.H., Keats, J.J., Wang, H., Vignali, D.A., Bergsagel, P.L., and Karin, M. (2008). Nonredundant and complementary functions of TRAF2 and TRAF3 in a ubiquitination cascade that activates NIK-dependent alternative NF-kappaB signaling. Nat Immunol 9, 1364-1370. van der Biezen, E.A., and Jones, J.D. (1998). The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. In Curr Biol (England), pp. R226-227. van der Hoorn, R.A., and Kamoun, S. (2008). From Guard to Decoy: a new model for perception of plant pathogen effectors. Plant Cell 20, 2009-2017. van der Laan, M., Hutu, D.P., and Rehling, P. (2010). On the mechanism of preprotein import by the mitochondrial presequence translocase. Biochim Biophys Acta 1803, 732-739. Van Ooijen, G., Lukasik, E., Van Den Burg, H.A., Vossen, J.H., Cornelissen, B.J., and Takken, F.L. (2010). The small heat shock protein 20 RSI2 interacts with and is required for stability and function of tomato resistance protein I-2. Plant J 63, 563-572. Varet, A., Parker, J., Tornero, P., Nass, N., Nürnberger, T., Dangl, J.L., Scheel, D., and Lee, J. (2002). NHL25 and NHL3, two NDR1/HIN1-1ike genes in Arabidopsis thaliana with potential role(s) in plant defense. Mol Plant Microbe Interact 15, 608-616. Varshavsky, A. (2011). The N-end rule pathway and regulation by proteolysis. Protein Sci 20, 1298-1345. Vogel, J.P., Raab, T.K., Schiff, C., and Somerville, S.C. (2002). PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis. Plant Cell 14, 2095-2106. Voges, D., Zwickl, P., and Baumeister, W. (1999). The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu Rev Biochem 68, 1015-1068. Vorwerk, S., Somerville, S., and Somerville, C. (2004). The role of plant cell wall polysaccharide composition in disease resistance. Trends Plant Sci 9, 203-209. Wagner, D., and Meyerowitz, E.M. (2002). SPLAYED, a novel SWI/SNF ATPase homolog, controls reproductive development in Arabidopsis. Curr Biol 12, 85-94. 121  Wagner, S., Stuttmann, J., Rietz, S., Guerois, R., Brunstein, E., Bautor, J., Niefind, K., and Parker, J.E. (2013). Structural basis for signaling by exclusive EDS1 heteromeric complexes with SAG101 or PAD4 in plant innate immunity. Cell Host Microbe 14, 619-630. Wandinger, S.K., Richter, K., and Buchner, J. (2008). The Hsp90 chaperone machinery. J Biol Chem 283, 18473-18477. Wang, C., Deng, L., Hong, M., Akkaraju, G.R., Inoue, J., and Chen, Z.J. (2001). TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412, 346-351. Wang, G., Ellendorff, U., Kemp, B., Mansfield, J.W., Forsyth, A., Mitchell, K., Bastas, K., Liu, C.M., Woods-Tör, A., Zipfel, C., de Wit, P.J., Jones, J.D., Tör, M., and Thomma, B.P. (2008). A genome-wide functional investigation into the roles of receptor-like proteins in Arabidopsis. Plant Physiol 147, 503-517. Weber, H., Bernhardt, A., Dieterle, M., Hano, P., Mutlu, A., Estelle, M., Genschik, P., and Hellmann, H. (2005). Arabidopsis AtCUL3a and AtCUL3b form complexes with members of the BTB/POZ-MATH protein family. Plant physiology 137, 83-93. Whitham, S., Dinesh-Kumar, S., Choi, D., Hehl, R., Corr, C., and Baker, B. (1994). The product of the tobacco mosaic virus resistance gene N: similarity to toll and the interleukin-1 receptor. Cell 78, 1101-1115. Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node. Current opinion in plant biology 8, 383-389. Wirthmueller, L., Zhang, Y., Jones, J.D., and Parker, J.E. (2007). Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense. Curr Biol 17, 2023-2029. Woodham-Smith, C., and Davidson, F. (1991). The great hunger: Ireland 1845-1849. (Penguin books). Xia, S., Cheng, Y.T., Huang, S., Win, J., Soards, A., Jinn, T.L., Jones, J.D., Kamoun, S., Chen, S., Zhang, Y., and Li, X. (2013). Regulation of transcription of nucleotide-binding leucine-rich repeat-encoding genes SNC1 and RPP4 via H3K4 trimethylation. Plant Physiol 162, 1694-1705. Xie, P. (2013). TRAF molecules in cell signaling and in human diseases. J Mol Signal 8, 7. 122  Xu, F., Xu, S., Wiermer, M., Zhang, Y., and Li, X. (2012). The cyclin L homolog MOS12 and the MOS4-associated complex are required for the proper splicing of plant resistance genes. Plant J 70, 916-928. Xu, F., Cheng, Y.T., Kapos, P., Huang, Y., and Li, X. (2014a). P-Loop-Dependent NLR SNC1 Can Oligomerize and Activate Immunity in the Nucleus. Molecular Plant 7, 1801-1804. Xu, F., Kapos, P., Cheng, Y.T., Li, M., Zhang, Y., and Li, X. (2014b). NLR-associating transcription factor bHLH84 and its paralogs function redundantly in plant immunity. PLoS Pathog 10, e1004312. Xu, F., Huang, Y., Li, L., Gannon, P., Linster, E., Huber, M., Kapos, P., Bienvenut, W., Polevoda, B., Meinnel, T., Hell, R., Giglione, C., Zhang, Y., Wirtz, M., Chen, S., and Li, X. (2015). Two N-terminal acetyltransferases antagonistically regulate the stability of a nod-like receptor in Arabidopsis. Plant Cell 27, 1547-1562. Xu, G., Ma, H., Nei, M., and Kong, H. (2009). Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification. Proc Natl Acad Sci U S A 106, 835-840. Xu, J., and Zhang, Y. (2010). How significant is a protein structure similarity with TM-score = 0.5? Bioinformatics 26, 889-895. Xue, J.Y., Wang, Y., Wu, P., Wang, Q., Yang, L.T., Pan, X.H., Wang, B., and Chen, J.Q. (2012). A primary survey on bryophyte species reveals two novel classes of nucleotide-binding site (NBS) genes. PLoS One 7, e36700. Yao, R., Ming, Z., Yan, L., Li, S., Wang, F., Ma, S., Yu, C., Yang, M., Chen, L., Li, Y., Yan, C., Miao, D., Sun, Z., Yan, J., Sun, Y., Wang, L., Chu, J., Fan, S., He, W., Deng, H., Nan, F., Li, J., Rao, Z., Lou, Z., and Xie, D. (2016). DWARF14 is a non-canonical hormone receptor for strigolactone. Nature. Ye, H., Arron, J.R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N.K., Segal, D., Dzivenu, O.K., Vologodskaia, M., Yim, M., Du, K., Singh, S., Pike, J.W., Darnay, B.G., Choi, Y., and Wu, H. (2002). Distinct molecular mechanism for initiating TRAF6 signalling. Nature 418, 443-447. Yeh, W.C., Shahinian, A., Speiser, D., Kraunus, J., Billia, F., Wakeham, A., de la Pompa, J.L., Ferrick, D., Hum, B., Iscove, N., Ohashi, P., Rothe, M., Goeddel, D.V., and 123  Mak, T.W. (1997). Early lethality, functional NF-kappaB activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7, 715-725. Yue, J.X., Meyers, B.C., Chen, J.Q., Tian, D., and Yang, S. (2012). Tracing the origin and evolutionary history of plant nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes. New Phytol 193, 1049-1063. Zapata, J.M., Martínez-García, V., and Lefebvre, S. (2007). Phylogeny of the TRAF/MATH domain. In TNF Receptor Associated Factors (TRAFs) (Springer), pp. 1-24. Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., Chen, S., Tang, X., and Zhou, J.M. (2007). A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. Cell Host Microbe 1, 175-185. Zhang, L., Chen, S., Ruan, J., Wu, J., Tong, A.B., Yin, Q., Li, Y., David, L., Lu, A., Wang, W.L., Marks, C., Ouyang, Q., Zhang, X., Mao, Y., and Wu, H. (2015). Cryo-EM structure of the activated NAIP2-NLRC4 inflammasome reveals nucleated polymerization. Science 350, 404-409. Zhang, M., Botër, M., Li, K., Kadota, Y., Panaretou, B., Prodromou, C., Shirasu, K., and Pearl, L.H. (2008). Structural and functional coupling of Hsp90- and Sgt1-centred multi-protein complexes. EMBO J 27, 2789-2798. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646. Zhang, Y., Dorey, S., Swiderski, M., and Jones, J.D. (2004). Expression of RPS4 in tobacco induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90. Plant J 40, 213-224. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr Biol 15, 1936-1942. Zhao, L., Huang, Y., Hu, Y., He, X., Shen, W., Liu, C., and Ruan, Y. (2013). Phylogenetic Analysis of Brassica rapa MATH-Domain Proteins. Curr Genomics 14, 214-223. Zhao, R., Davey, M., Hsu, Y.C., Kaplanek, P., Tong, A., Parsons, A.B., Krogan, N., Cagney, G., Mai, D., Greenblatt, J., Boone, C., Emili, A., and Houry, W.A. (2005). Navigating 124  the chaperone network: an integrative map of physical and genetic interactions mediated by the hsp90 chaperone. Cell 120, 715-727. Zhu, Y., Qian, W., and Hua, J. (2010). Temperature modulates plant defense responses through NB-LRR proteins. PLoS Pathog 6, e1000844. Zipfel, C. (2008). Pattern-recognition receptors in plant innate immunity. Curr Opin Immunol 20, 10-16. Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764-767. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125, 749-760.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0308599/manifest

Comment

Related Items