Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of complement activation in age-related macular degeneration Cao, Sijia 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_cao_sijia.pdf [ 2.03MB ]
Metadata
JSON: 24-1.0307354.json
JSON-LD: 24-1.0307354-ld.json
RDF/XML (Pretty): 24-1.0307354-rdf.xml
RDF/JSON: 24-1.0307354-rdf.json
Turtle: 24-1.0307354-turtle.txt
N-Triples: 24-1.0307354-rdf-ntriples.txt
Original Record: 24-1.0307354-source.json
Full Text
24-1.0307354-fulltext.txt
Citation
24-1.0307354.ris

Full Text

THE ROLE OF COMPLEMENT ACTIVATION IN AGE-RELATED MACULAR DEGENERATION by  Sijia Cao  M.D., Shanghai Jiao Tong University, 2006 M.Sc., Pierre and Marie Curie University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Neuroscience)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2016  © Sijia Cao, 2016 ii  Abstract  Purpose: Age-related macular degeneration (AMD) is a multifactorial degenerative disease that occurs in the central part of the retina − macula. The disease affects approximately one million Canadians and constitutes the number one cause of vision loss after cataract in the elderly. The Y402H polymorphism in the complement factor H (CFH) gene and drusen load are two salient risk factors for AMD. Little is known of the detailed cellular pathway(s) shared by these two factors. Here we investigate their interactions in in vitro models of AMD and in AMD samples.  Methods: The biological samples came from 44 dry AMD patients, 23 postmortem eyes and retinal pigment epithelial (RPE) cell models. Drusen load and choroidal thickness in patients were measured using spectral-domain optical coherence tomography. We used analytical techniques including genotyping, Bio-Plex suspension assays, immunohistochemistry, immunofluorescence, reverse transcription PCR, Western blot, flow cytometry and lactate dehydrogenase assay  Results: In dry AMD patients, higher systemic levels of interleukin (IL)-6, IL-18, and tumor necrosis factor (TNF)-α were associated with the at-risk CC variant of CFH Y402H polymorphism. IL-1β while not significant, demonstrated a similar trend. Drusen load was inversely correlated with choroidal thickness and visual acuity. Postmortem eyes genotyped with the Y402H risk variant showed significantly increased levels of GM-CSF in vitreous and immunoreactivity for CD68, C5a, IL-18 and TNF-α in Bruch’s membrane and/or choroid. Exposure to complement activation product C5a in RPE cells promoted NF-κB activation and upregulated inflammatory cytokines iii  and growth factors. The drusen component, Aβ, induced complement activation and downregulated the membrane bound complement inhibitor, CD55, leading to sublytic MAC formation in RPE cells, which was inhibited by aurin tricarboxylic acid complex.  Conclusion:  Two important risk factors for AMD, CFH Y402H polymorphism and drusen load, both promote complement activation. Complement activation can mediate downstream events associated with sublytic changes in RPE, such as proinflammatory cytokine release. These results suggest that complement activation might be the central response to multiple risk factors and the complement activation products may further inflict injury on RPE cells. Complement activation products could be potential therapeutic targets to stop chronic inflammation in AMD.  iv  Preface  A version of chapter 2 has been published. [Cao S], Ko A, Partanen M, Pakzad-Vaezi K, Merkur AB, Albiani DA, Kirker AW, Wang A, Cui JZ, Forooghian F, Matsubara JA. Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration. American Journal of Ophthalmology. Dec 2013;156(6):1176-1183. I participated in study design and performed 70% of the experiments in the manuscript, analyzed and interpreted data, prepared the first draft and revised the manuscript until acceptance and publication. The study was approved by the Providence Health Care Research Ethics Board at the University of British Columbia (Certificate number: H11-02328).  A version of chapter 3 has been published. Ko A, [Cao S], Pakzad-Vaezi K, Brasher PM, Merkur AB, Albiani DA, Kirker AW, Cui J, Matsubara J, Forooghian F. Optical coherence tomography-based correlation between choroidal thickness and drusen load in dry age-related macular degeneration. Retina (Philadelphia, Pa.). May 2013;33(5):1005-1010. I participated in study design and performed 40% of the experiments in the manuscript, analyzed and interpreted data, and revised the manuscript until acceptance and publication. The study was approved by Providence Health Care Research Ethics Board at the University of British Columbia (Certificate number: H11-02328).  A version of chapter 4 has been published. Wang JC, [Cao S], Wang A, To E, Law G, Gao J, Zhang D, Cui JZ, Matsubara JA. CFH Y402H polymorphism is associated with elevated vitreal GM-CSF and choroidal macrophages in the postmortem human eye. Mol Vis. 2015;21:264-272. v  I designed the experiments and performed 70% of the experiments in the manuscript, analyzed and interpreted data, edited and revised the manuscript until acceptance and publication. The study protocol was approved by the Clinical Ethics Research Board of the University of British Columbia (Certificate number: H00-70411donor eye only).  A version of chapter 5 has been published. [Cao S], Wang JC, Gao J, Wong M, To E, White VA, Cui JZ, Matsubara JA. CFH Y402H polymorphism and the complement activation product C5a: effects on NF-kappa B activation and inflammasome gene regulation. The British Journal of Ophthalmology. May 2016;100(5):713-718. I designed the experiments and performed 70% of the experiments in the manuscript, analyzed and interpreted data, prepared the first draft and revised the manuscript until acceptance and publication. This study was approved by the Clinical Ethics Research Board of the University of British Columbia (Certificate number: H00-70411 and H11-02772).  Chapter 6 is based on work conducted in the Department of Ophthalmology and Visual Sciences by [Cao S], Gao J, Cui JZ and Matsubara JA. I designed the study and performed all the experiments, analyzed and interpreted data. The data are being prepared for submission to a scientific journal.  vi  Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents ......................................................................................................................... vi List of Tables ................................................................................................................................ xi List of Figures .............................................................................................................................. xii List of Abbreviations ...................................................................................................................xv Glossary ...................................................................................................................................... xix Acknowledgements .................................................................................................................... xxi Dedication ................................................................................................................................. xxiii Chapter 1: Introduction ................................................................................................................1 1.1 Background ..................................................................................................................... 1 1.1.1 Ocular structure and AMD.......................................................................................... 1 1.1.2 Drusen ......................................................................................................................... 5 1.1.3 CFH Y402H polymorphism ........................................................................................ 7 1.1.4 Complement pathways ................................................................................................ 8 1.1.5 Inflammation ............................................................................................................. 11 1.2 Rationale ....................................................................................................................... 11 1.3 Objectives and Hypotheses ........................................................................................... 13 Chapter 2: Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration ..................................16 2.1 Introduction ................................................................................................................... 16 vii  2.2 Methods......................................................................................................................... 17 2.2.1 Study population ....................................................................................................... 17 2.2.2 Eye examination, drusen area and choroidal thickness measurements ..................... 18 2.2.3 Cytokine analysis ...................................................................................................... 19 2.2.4 CFH Y402H genotyping ........................................................................................... 20 2.2.5 Statistical analysis ..................................................................................................... 20 2.3 Results ........................................................................................................................... 22 2.3.1 Subject characteristics ............................................................................................... 22 2.3.2 Cytokines, drusen area, choroidal thickness and genotype variants ......................... 24 2.3.3 Cytokines and choroidal thickness, drusen area ....................................................... 28 2.4 Discussion ..................................................................................................................... 28 2.5 Conclusion .................................................................................................................... 31 Chapter 3: Optical coherence tomography–based correlation between choroidal thickness and drusen load in dry age-related macular degeneration ......................................................32 3.1 Introduction ................................................................................................................... 32 3.2 Methods......................................................................................................................... 33 3.3 Results ........................................................................................................................... 35 3.4 Discussion ..................................................................................................................... 41 Chapter 4: CFH Y402H polymorphism is associated with elevated vitreal GM-CSF and choroidal macrophages in the postmortem human eye ............................................................45 4.1 Introduction ................................................................................................................... 45 4.2 Methods......................................................................................................................... 46 4.2.1 Postmortem donor eye tissues ................................................................................... 46 viii  4.2.2 Total genomic DNA isolation and CFH Y402H genotyping.................................... 47 4.2.3 GM-CSF level measurement..................................................................................... 48 4.2.4 RPE stimulation ........................................................................................................ 49 4.2.5 Immunohistochemistry ............................................................................................. 50 4.2.6 Statistical analysis ..................................................................................................... 50 4.3 Results ........................................................................................................................... 51 4.3.1 GM-CSF is elevated in the vitreous of eyes with the at-risk homozygous CC variant in CFH ................................................................................................................................... 51 4.3.2 Macrophages are increased in eyes with the at-risk homozygous CC variant in CFH .   ................................................................................................................................... 55 4.3.3 Stimulation of RPE with C3a and C5a promotes upregulation of GM-CSF in vitro 55 4.3.4 Stimulation of RPE with HNE and TNF-α promotes secretion of GM-CSF in vitro 55 4.4 Discussion ..................................................................................................................... 59 4.5 Conclusion .................................................................................................................... 60 Chapter 5: CFH Y402H polymorphism and the complement activation product C5a: effects on NF-κB activation and inflammasome gene regulation ............................................62 5.1 Introduction ................................................................................................................... 62 5.2 Methods......................................................................................................................... 63 5.2.1 Human eye tissues and CFH Y402H genotyping ..................................................... 63 5.2.2 Immunohistochemistry ............................................................................................. 64 5.2.3 In vitro RPE stimulation ........................................................................................... 65 5.2.4 Reverse transcription PCR ........................................................................................ 65 5.2.5 Statistical analysis ..................................................................................................... 66 ix  5.3 Results ........................................................................................................................... 66 5.3.1 Complement activation products are greater in outer retina of eyes with the at-risk variant in CFH gene .............................................................................................................. 66 5.3.2 Selected cytokines are highly expressed in outer retina of eyes with the at-risk variant in CFH gene .............................................................................................................. 69 5.3.3 Activation of the NF-κB pathway by pro-inflammatory mediators in RPE in vitro 72 5.3.4 Inflammasome products, IL-1β and IL-18, are increased in RPE of GA eyes ......... 74 5.4 Discussion ..................................................................................................................... 76 5.4.1 Complement activation product, C5a, is associated with the at-risk variant in the CFH gene and promotes inflammasome activation product IL-18 ....................................... 76 5.4.2 IL-18 and TNF-α immunoreactivity in outer retina is associated with the at-risk variant in the CFH gene ........................................................................................................ 77 5.5 Conclusion .................................................................................................................... 78 Chapter 6: Drusen component amyloid beta activates complement cascade and induces sublytic membrane attack complex formation ..........................................................................79 6.1 Introduction ................................................................................................................... 79 6.2 Methods......................................................................................................................... 80 6.2.1 RPE stimulation ........................................................................................................ 80 6.2.2 Aβ preparation .......................................................................................................... 81 6.2.3 Reverse transcription PCR and Western blot............................................................ 81 6.2.4 Quantification of MAC ............................................................................................. 82 6.2.5 Lactate dehydrogenase assay .................................................................................... 83 6.2.6 Statistical analysis ..................................................................................................... 84 x  6.3 Results ........................................................................................................................... 84 6.3.1 Aβ downregulates CD55 in RPE cells ...................................................................... 84 6.3.2 Aβ promotes complement activation and forms sublytic MAC on RPE cells .......... 87 6.3.3 Aβ-promoted MAC formation is mainly via classical pathway ............................... 90 6.3.4 ATAC inhibits MAC formation on RPE cells .......................................................... 92 6.4 Discussion ..................................................................................................................... 94 6.5 Conclusion .................................................................................................................... 96 Chapter 7: Conclusion .................................................................................................................97 7.1 Significance and Strengths ............................................................................................ 97 7.1.1 A potential double source of CFH: retina vs. liver ................................................... 97 7.1.2 The relationship of complement activation and pro-inflammatory cytokines .......... 98 7.1.3 Complement activation: A common pathway shared by multiple risk factors? ..... 100 7.2 Limitation .................................................................................................................... 101 7.3 Future Work ................................................................................................................ 102 7.3.1 The role of MAC formation .................................................................................... 102 7.3.2 The interaction between drusen and CFH Y402H. ................................................. 103 7.4 Summary ..................................................................................................................... 104 Bibliography ...............................................................................................................................105 Appendices ..................................................................................................................................122 Appendix A Supplementary tables ......................................................................................... 122 Appendix B Supplementary figures ........................................................................................ 125  xi  List of Tables  Table 2.1 Characteristics of the recruited patients with dry age-related macular degeneration. .. 23 Table 2.2 Descriptive statistics and analysis of covariance results from plasma cytokine levels in dry age-related macular degeneration patients with different genotypes of the complement factor H Y402H polymorphism............................................................................................................... 25 Table 3.1 Results of univariable and multivariable regression analyses ...................................... 38 Table 4.1 Characteristics of postmortem human donor eyes ........................................................ 53 Table 4.2 Descriptive statistics and analysis of covariance results for vitreous granulocyte macrophage colony-stimulating factor (GM-CSF), age and collection time stratified by different genotypes of the complement factor H (CFH) Y402H polymorphism......................................... 53  xii  List of Figures  Figure 1.1 A cross section of the eye .............................................................................................. 3 Figure 1.2 The histological structure of the retina .......................................................................... 4 Figure 1.3 Diagram of the complement system .............................................................................. 9 Figure 2.1 Plasma levels of interleukin(IL)-6 in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism ............................................................................................................................... 26 Figure 2.2 Plasma levels of interleukin(IL)-18 in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism ............................................................................................................................... 26 Figure 2.3 Plasma levels of tumor necrosis factor(TNF)-α in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism ....................................................................................................... 27 Figure 2.4 Plasma levels of interleukin(IL)-1β in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism ............................................................................................................................... 27 Figure 3.1 Linear regression analysis of drusen volume versus drusen area ................................ 38 Figure 3.2 Univariable linear regression analysis of drusen area versus choroid thickness ......... 39 Figure 3.3 Univariable linear regression analysis of drusen area versus visual acuity................. 39 Figure 3.4 Univariable linear regression analysis of choroid thickness versus visual acuity ....... 40 xiii  Figure 4.1 The increased granulocyte macrophage colony-stimulating factor (GM-CSF) in vitreous was associated with the at risk variants of complement factor H (CFH) Y402H polymorphism ............................................................................................................................... 54 Figure 4.2 The increased number of macrophages in choroid was associated with the at-risk variants of complement factor H (CFH) Y402H polymorphism .................................................. 57 Figure 4.3 Stimulation with complement activation products upregulated the expression of granulocyte macrophage colony-stimulating factor (GM-CSF) in retinal pigment epithelium (RPE)............................................................................................................................................. 58 Figure 4.4 Retinal pigment epithelium (RPE) secreted higher levels of granulocyte macrophage colony-stimulating factor (GM-CSF) after stimulation with 4-hydroxynonenal (HNE) and tumor necrosis factor (TNF)-α ................................................................................................................ 58 Figure 5.1 Increased complement C5a immunoreactivity in the Bruch’s membrane (BM)–choroid (Ch) complex is associated with the at-risk CC variant of the complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes ................................................. 68 Figure 5.2 Increased interleukin (IL)-18 in the Bruch’s membrane (BM)–choroid (Ch) is associated with the at-risk CC variant of complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes ..................................................................................................... 70 Figure 5.3 Increased tumor necrosis factor (TNF)-α in the Bruch’s membrane (BM)–choroid (Ch) is associated with the at-risk CC variant of complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes ......................................................................... 71 Figure 5.4 Complement C5a and tumor necrosis factor (TNF)-α induced nuclear factor (NF)-κB pathway activation in polarized ARPE19/NF-κB luciferase reporter cells .................................. 73 xiv  Figure 5.5 Complement C5a or tumor necrosis factor (TNF)-α upregulated nuclear factor (NF)-κB-responsive genes in polarized ARPE-19 cells ........................................................................ 73 Figure 5.6 Increased interleukin (IL)-1β and IL-18 immunoreactivity in retinal pigment epithelial (RPE) cells in eyes with geographic atrophy (GA) ...................................................................... 75 Figure 6.1 Amyloid beta (Aβ) downregulated CD55 expression in retinal pigment epithelial (RPE) cells .................................................................................................................................... 86 Figure 6.2 Amyloid beta (Aβ) promotes complement activation and forms sublytic membrane attack complex (MAC) on retinal pigment epithelial (RPE) cells ................................................ 88 Figure 6.3 Amyloid beta (Aβ)-promoted membrane attack complex (MAC) formation is mainly via classical pathway..................................................................................................................... 91 Figure 6.4 Aurin tricarboxylic acid complex (ATAC) inhibits MAC formation on retinal pigment epithelial (RPE) cells .................................................................................................................... 93  xv  List of Abbreviations  AMD   age-related macular degeneration ANCOVA analysis of covariance ANOVA  analysis of variance ARPE-19 A spontaneously immortalized cell line of human retinal pigment epithelium ATAC  aurin tricarboxylic acid complex Aβ  amyloid beta BM  Bruch’s membrane BRB  blood-retina barrier C1q complement component 1q, a complement protein essential to the classical pathway C3  complement component 3  C5   complement component 5  C5b-9  membrane attack complex C7  complement component 7 C9  complement component 9 CD46 one of complement regulators on cell surface that inhibit the complement cascade, also known as membrane cofactor protein (MCP) CD55 one of complement regulators on cell surface that inhibit the complement cascade, also known as decay-accelerating factor (DAF) CD59  one of complement regulators on cell surface that inhibit the complement cascade CFB complement factor B, a complement protein essential to the alternative pathway xvi  CFD  complement factor D CFH  complement factor H, a large soluble glycoprotein (molecular weight: 155 kDa) that can inhibit the complement cascade CFI  complement factor I, an inhibitor of the complement cascade CI confidence interval CNV choroidal neovascularization CNS central nervous system CRISPR clustered regularly interspaced short palindromic repeats CRP C-reactive protein CXCL chemokine (C-X-C motif) ligand DAF decay-accelerating factor, also known as CD55 DSB double strand break EDI enhanced depth imaging EDTA ethylene-diamine-tetraacetic acid ELISA  enzyme-linked immunosorbent assay ER endoplasmic reticulum FBS  fetal bovine serum GA geographic atrophy GAPDH glyceraldehydes-3-phosphate dehydrogenase GM-CSF granulocyte-macrophage colony-stimulating factor HDR homology-directed repair HI-HNS heat inactivated normal human HNE 4-hydroxynonenal xvii  IL  interleukin LDH  lactate dehydrogenase LDL  low-density lipoprotein logMAR logarithm of minimal angle of resolution MAC  membrane attack complex MCP  membrane cofactor protein, also known as CD46 MCP-1 monocyte chemoattractant protein 1, also known as chemokine (C-C motif) ligand 2 (CCL2) MDA malondialdehyde N  sample size NHS normal human serum containing relevant complement proteins required for the activation of complement cascade NLRP  Nod-like receptor proteins NLRP3 product of the Nod-like receptor family, pyrin domain containing 3 gene, and a major component of the inflammasome NF-κB  nuclear factor kappa B NSAIDs nonsteroidal anti-inflammatory drugs ONH   optic nerve head PBS  phosphate buffered saline PCR  polymerase chain reaction PFA  paraformaldehyde RT-PCR reverse transcription PCR ROS  reactive oxygen species xviii  RPE  retinal pigment epithelium RT  room temperature SEM  standard error of the mean SD  standard deviation SD-OCT  spectral domain optical coherence tomography SNP   single nucleotide polymorphism TER  transepithelial resistance TNF-α  tumor necrosis factor alpha VEGF  vascular endothelial growth factor WB  Western blot xix  Glossary  Complement 3 (C3)    One of the complement components that is cleaved into C3a and C3b when the complement cascade is activated. Complement 5 (C5)    One of the complement components that is cleaved into C5a and C5b when the complement cascade is activated. CFH Y402H polymorphism (rs1061170)    A single nucleotide in the gene coding complement factor H (CFH), with T as the more common allele and C as the rarer allele. The C allele is associated with high risk for age-related macular degeneration. The odds ratio for the homozygous CC variant and the heterozygous CT variant is approximately 7 and 4, respectively. The T-to-C change in this SNP leads to an amino acid change from tyrosine (Y) to histidine (H). Geographic atrophy (GA)    A type of AMD lesion observed clinically in patients with late stage AMD and characterized by photoreceptor and RPE cell death. Heat inactivated-normal human serum (HI-NHS)    An experimental control as opposed to normal human serum (NHS), in which complement cascade cannot be induced because of a lack of complement proteins denatured in the heating process. Interleukin-1β (IL-1β)    A proinflammatory cytokine. IL-1β is a mature product of inflammasome activation. Interleukin-6 (IL-6)    A proinflammatory cytokine that mediates a wide range of inflammation response and usually requires activation of the NF-κB pathway. Interleukin-18 (IL-18)    A proinflammatory cytokine. It is a mature product of inflammasome activation. xx  Membrane attack complex (MAC, aka C5b-9)    The end product of complement pathways that may cause cell lysis by forming transmembrane channels on cells. Normal human serum (NHS)    Serum that comes from healthy human donors and contains relevant complement proteins required for the activation of complement cascade. NOD-like receptor family pyrin domains (NLRP)    A subfamily of NOD-like receptors that are intracellular receptors and mediate the innate immune response. Nod-like receptor family, pyrin domain containing 3 (NLRP3)    The protein product of the NLRP3 gene and a major component of the inflammasome. Nuclear factor kappa B (NF-κB)    A protein complex that controls transcription of genes involved in many processes, including immune and inflammatory responses. Tumor necrosis factor alpha (TNF-α)    A pro-inflammatory cytokine that can induce RPE damage. xxi  Acknowledgements  I offer my deepest gratitude to Dr. Joanne A. Matsubara for accepting me in the lab, offering her supervision and guidance through my six-year PhD training.  I would like to thank my committee members, Dr. Brian MacVicar, Dr. Orson Moritz, Dr. Katherina Dorovini-Zis for their expertise, time and effort to help me complete this work.  I owe particular thanks to Dr. Jing Z. Cui for her help with my overall study design and labwork as well as with my personal life.   I would also like to thank Aikun Wang for his help with various technical aspects of molecular biology, Eleanor To for her help with immunohistochemistry analyses and administrative work, Jiangyuan Wade Gao, Jay Wang for their support and inspiration they extended.  I would also like to express the appreciation to the faculty in the Department of Ophthalmology &Visual Science, especially Dr. Farzin Forooghian and Dr. Valerie A. White, who have inspired me with their clinical perspectives.  Special thanks are owed to my parents, who have supported me throughout my years of education, both morally and financially.  xxii  This work was supported by New Researcher Grant from the Canadian National Institute for the Blind, Toronto, ON, Canada, to Dr. Farzin Forooghian and Canadian Institute of Health Research (CIHR) grant number MOP-97806 and MOP-126195 to Dr. Joanne Matsubara. xxiii  Dedication  This dissertation is dedicated to my loving parents, Mr. Xueyong Cao and Ms. Fengmei Chen, and my many friends, specifically Dr. Huifang Li, Donald Wang and Yilan Zhu.   The path to completion of this PhD program was full of challenges and stress. If it were not for the love, support and patience of my family and friends, I can honestly say that I would not have been able to complete this program. Thank you all so much for everything!1  Chapter 1: Introduction  1.1 Background  1.1.1 Ocular structure and AMD The retina is a thin and multilayered sheet of neural tissue that lines the back of the eye, with its inner surface apposed to vitreous and its outer surface apposed to choroid and sclera. The light passes through cornea and lens, and thence converges onto the retina, which converts light energy into electrical neural signals.  The signals are then sent to the brain for visual function and recognition (Figure 1.1). From an en face view, the retina spreads out from optic nerve head (ONH) and extends anteriorly to the ora serrata. The human retina can be clinically divided into the central posterior pole, including the macula and ONH, and the peripheral retina (Figure 1.2). While the ONH is a confluence of the ganglion cell axons that carries the visual signals away from the retina to the brain, the macula is a ~0.6mm diameter pigmented circular area temporal to ONH and is responsible for the central vision. Within the center of the macula is the fovea, a ~1mm circular area which accounts for the highest visual acuity (Figure 1.2).   Like the other parts of central nervous system (CNS), the retina is embryologically derived from the neural tube and has similar multilayered structures. Under the microscope, the retinal layers can be easily discerned in cross section. The inner neural retina is composed of three major neuronal layers and several layers of synapses and axons. Light is received by the rods and cones in the photoreceptor cell layer and converted into electrical signals. The signals are relayed to the layer of intermediary neurons, including bipolar, amacrine, and horizontal cells, and then 2  processed further by the ganglion cells. The visual signals are finally conducted along the nerve fiber layer composed of the ganglion cell axons, towards the ONH on their way to the visual processing centers in the CNS. The photoreceptors are apposed to the retinal pigment epithelium (RPE), a monolayer of pigmented cells that connect the neurosensory retina and the Bruch’s membrane (BM)-choroid complex. The RPE cells play an important role in maintaining the homeostasis of the outer retina. They participate in a wide range of biological processes, including absorbing stray light, recycling components of the visual cycle from photoreceptors, secreting trophic factors for photoreceptors, controlling cross-epithelium transport and maintaining the outer blood-retinal barrier.1-3  To maintain its function, the retina receives its blood supply from two sources: the choriocapillaris immediately outside BM, which supplies the outer third of the retina, from the RPE to the outer plexiform layer, by diffusion of nutrients and oxygen; and branches of the central retinal artery, which supply the inner two thirds of the retina by forming vessel networks (Figure 1.2). In addition, to regulate the entry of blood substances to the retina and maintain its transparency, there are blood-retina barriers (BRB) at the two blood supply levels. The inner BRB is composed of tight junctions between retinal capillary endothelial cells and the outer BRB of tight junctions between RPE cells.3   Figure 1.1 A cross section of the eye The retina lines the eye, between the choroid and the vitreous, and occupies the inner wall of the posterior two-thirds of the eye globe. (© Webvision, http://webvision.med.utah.edu/ with permission)Ora serrata 4   Figure 1.2 The histological structure of the retina Left: Fundus picture of the central posterior pole, including the macula (outer white circle area) and optic nerve head. The fovea (inner white circle) within the center of the macula accounts for the highest visual acuity. Right: The retina is a multilayered structure, with the nerve fiber layer apposed to vitreous and Bruch’s membrane and choroid apposed to sclera.. The red arrows illustrate the two sources of retina blood supply. (© 2014  Mikael Häggström adapted with CC0 license) Nerve fiber layer (NFL) Ganglion cell layer (GCL)  Inner plexiform layer (IPL)   Inner nuclear layer(INL)    Outer plexiform layer (OPL)  Outer nuclear layer (ONL)    Inner and outer segment of photoreceptors  Retinal pigment epithelium (RPE) Bruch’s membrane (BM) Choroid 5  Age-related macular degeneration (AMD) is a multifactorial degenerative disease that occurs in the central part of the retina (macula). The disease affects approximately one million Canadians and constitutes the number one cause of vision loss after cataract in the elderly.4, 5 According to its natural progression, AMD can be classified into early and late stages.6, 7 Early AMD usually presents with normal vision, yet is characterized by altered pigmentation of the retina and the appearance of extracellular deposits between the basal lamina of RPE and BM, known as drusen. Late (also known as advanced) AMD is usually accompanied by severe vision loss, can be present in two forms, ‘exudative’ or ‘atrophic’ AMD. The exudative form of AMD results from invasion of choroid neovessels into the sub-RPE or subretinal space through breaks in BM. The hemorrhages, or leakage from choroidal neovascularization, are the culprits of severe vision loss in exudative AMD which accounts for approximately 10% of all AMD cases. Treatments by application of anti-vascular endothelial growth factor (VEGF) drugs do help with the exudative form.8  However, the more common, dry form (combination of early stage and atrophic form, the latter also known as geographic atrophy) accounts for 90% of AMD, and its late stage is featured by RPE and/or photoreceptor abnormalities.9 Unfortunately, effective measures to prevent vision loss in the late stage of the dry form are still lacking due to insufficient knowledge of the underlying mechanisms.  1.1.2 Drusen Several factors, including aging, oxidative stress, genetic factors, and drusen, are well known to contribute to the increased risk for AMD.10, 11  Many studies have consistently shown that increasing age is a strong risk factor for AMD.12, 13 AMD usually affects people over 50 years old and the incidence, prevalence and progression of AMD sharply increase with aging.7, 9, 14-17 6  The prevalence of late AMD can rise from 0.05% before the age of 50 years to 11.8% after 80 years old.18 A common feature associated with aging is the presence of pale yellowish lesions, known as drusen, in the fundus of the eye. Histologically drusen are deposits of acellular, polymorphous debris between the RPE and BM. To better predict the increased risk for disease progression in clinic, drusen are categorized as small (<63μm in diameter), medium (63 to 125μm), or large (>125μm, roughly equivalent to the size of the retinal vein at the rim of the ONH). Drusen can also be categorized clinically as hard or soft based on uniformity of density (color) from center to periphery, sharpness of edges, and thickness.  Those with decreasing density from center to periphery and irregular edges are placed in the soft-indistinct category; those with uniform density, sharp edges, and a solid, thick appearance in the soft-distinct category; and those with sharp edges but without a solid, thick, nodular appearance in the hard category.7, 19 Many studies have agreed that a few small hard drusen are common in the aging macula and do not pose any risk for further evolution, while the presence of numerous, bigger or soft drusen carries an increased risk to progression to late AMD.9, 20, 21 Proteomic and lipodomic analyses have revealed that drusen are comprised of proinflammatory factors, complement regulators, amyloid beta (Aβ), and oxidation byproducts.22-30 Despite the fact that early dry AMD is not usually associated with an appreciable loss of vision in patients, the number and the size of drusen deposits serve as a sign of disease progression.31 Suggestive of an associated, and perhaps causal, role in RPE dysfunction is the finding that RPE cells overlying drusen appear swollen and vacuolated.22   7  1.1.3 CFH Y402H polymorphism  The CFH Y402H polymorphism is the most salient genetic risk factor for AMD. In 2005, four genome wide association studies discovered that the single nucleotide polymorphism Y402H (rs1061170, sequence: T1277C) in the gene coding complement factor H (CFH) is associated with AMD.32-35 In individuals homozygous or heterozygous for the risk C allele (sequence: CC or CT; protein: HH or HY), the likelihood of AMD is increased by a factor of approximately 6 and 3.5, respectively.32-35 Subsequently, Gangnon et al. demonstrated in a population-based study that the homozygous variant confers an increased risk not only for AMD incidence but progression in the elderly as well.36  CFH protein is composed of 20 structural domains termed as short consensus repeat (SCR) and the Y402H polymorphism (rs1061170, sequence: T1277C; protein:Y402H) leads to a substitution of tyrosine (Y) with histidine (H) at amino acid 402 in SCR7 of CFH protein.37 The main function of CFH is to control the alternative pathway of complement cascade by accelerating the decay of C3 convertase (C3bBb) or acting as a cofactor for complement factor I (CFI)-mediated cleavage and inactivation of C3b (Figure 1.3).38-40  In addition, CFH can also control C3 deposits and complement activation on cell-surfaces by binding to the cells and compete with C1q for the binding site.41 Although the mechanism is unclear for how the CFH Y402H polymorphism confers a higher risk for AMD, it is believed to be associated with the increased complement cascade due to the lowered efficiency of controlling the complement cascade by the risk variant of CFH protein.  It was shown that the levels of the terminal activation product-membrane attack complex (MAC) in the eye and the complement components in blood are associated with the risk genotype of CFH Y402H polymorphism.42, 43  However, the 8  mechanism by which CFH Y402H polymorphism contributes to the tissue damage in AMD is not known.   1.1.4 Complement pathways The complement system is an essential part of the innate immunity and plays an important role in defending against microorganisms, eliminating foreign particles and dead cells, activating and modulating the immune response including adaptive immunity. The system is composed of three cascade-like pathways: the classical, the alternative, and the lectin pathway. These pathways may differ in initiators, but they all go through four steps: initiation, C3 convertase, C5 convertase, and terminal pathway.44 Since the classical and alternative pathways have been implicated in AMD,45 they will be briefly discussed here (Figure 1.3). The classical pathway is mostly triggered by the binding of C1q to the antibody-antigen complex, while the alternative pathway is activated continuously at a low rate by the spontaneous hydrolysis of the central component C3 into C3a and C3b. The C3b can bind factor B (CFB), which is then cleaved by factor D (CFD), generating the membrane-bound C3 convertase (C3bBb). This enzyme cleaves more C3, creating an amplification effect and C5 convertase (C3bBbC3b) is formed. C5 convertase cleaves complement component 5 (C5) to generate C5a and C5b. Finally, terminal pathway is activated and the MAC (also known as C5b-9) is assembled by C5b binding to other complement proteins (C6, C7, C8, C9).46 To prevent unintended injury by the activated complement products, the activation process is tightly regulated by a complex set of soluble proteins such as CFH, CFI and cell-bound regulators such as CD46 (aka membrane cofactor protein, MCP), CD55 (aka decay-accelerating factor, DAF), CD59 (Figure 1.3).44 9   Figure 1.3 Diagram of the complement system The classical and alternative pathways of complement cascade implicated in AMD converge upon a terminal pathway that results in the formation of the membrane attack complex (MAC). Multiple complement regulatory proteins (grey box) act at different levels to keep the complement activation in check under normal physiological condition. Sera depleted of pathway-specific components (yellow box) will be used in place of normal human serum to identify which complement pathway(s) is involved in amyloid beta (Aβ)-promoted MAC formation (Chapter 6). The effect of aurin tricarboxylic acid complex (ATAC), a small molecule MAC inhibitor will be assessed in the MAC formation assay on retinal pigment epithelial cells (Chapter 6). CFB: complement factor B; CFD: complement factor D; CFH: complement factor H; CFI: complement factor I. Alternative Pathway  Nonspecific activators CFD C3bBb (C3 convertase) Classical Pathway Antigen-antibody complexes Bind C1q C4b2a (C3 convertase) C2, C4 CFH CD46 CD55 C3 C5 C3bBbC3b (C5 convertase) C4b2a3b (C5 convertase) C5b   + C5a C6, C3 ATAC C5b-9 (MAC) Lysis, cytotoxicity CD59 C9 C8, CFB + C3b C3 iC3b CFI + C3a C3a + C7 10  Abundant evidence has pointed to increased complement activation associated with AMD.  The complement activation products, including C3a, C3b, C5a and MAC are present in drusen, the hallmark of early AMD.22, 28, 47  Work from our lab has also demonstrated that the protein level of MAC in eye increases with chronologic aging.48 The finding is not restricted to the local environment of the eye, but extends to the systemic level. Recent studies demonstrated that there is an increase in complement activation products in the blood of AMD patients compared to age-matched controls.49-51 Of note, this complement activation even occurs in the early stage of AMD when the cell death and tissue damage is not apparent; therefore, it is likely that the activation of complement pathway may contribute to disease process by inducing sublethal changes in the eye tissue.  Complement activation can interact with the production of the inflammatory mediators. For instance, complement activation products C3a or C5a synergistically enhance Toll-like receptor-induced production of proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β and IL-6 in vitro and in vivo.52 Many studies showed that rather than lysing cells, sublytic MAC may mediate the activation of inflammasome in immune cells or lung epithelial cells.53, 54  Recently, inflammasome activation has been implicated in AMD and characterized by the production of IL-1β and IL-18.53, 55, 56 However, the regulatory role of complement activation in the expression of inflammatory mediators has yet to be explored in AMD and is the topic of this work.   11  1.1.5 Inflammation Much evidence suggests that chronic inflammation plays a critical role in the development and progression of AMD. Studies from other labs and ours found that many pro-inflammatory mediators (IL-1β, IL-18, eotaxin, chemokine (C-X-C motif) ligand (CXCL)10 and CXCL11) are highly expressed in eyes with AMD compared to age-matched controls.57, 58  In addition, the increased level of pro-inflammatory mediators or immune cells has also been observed to be associated with AMD risk factors such as aging and drusen.22, 48, 59 The work from our lab demonstrated several cytokines are up-regulated in in vitro models of AMD.60-62 The pro-inflammatory cytokines/chemokines such as IL-6, IL-8 and TNF-α are known to induce harmful effects, including aggravating immune response or recruiting immune cells when studied individually.63, 64 And more recently, the products of inflammasome activation, IL-1β and IL-18, were reported to be associated with RPE cell death in mice model of atrophic AMD.55 Therefore, identification of the pathways underlying exactly how these pro-inflammatory mediators are upregulated may contribute to the understanding of AMD mechanism.  1.2 Rationale AMD is a major cause of blindness among the elderly in the industrialized countries.65 The early stage of AMD begins with the presence of extracellular deposits (drusen) between the basal lamina of RPE and BM, and altered RPE pigmentation. Late stage AMD is characterized by RPE atrophy, photoreceptor loss and/or choroidal neovascularization leading to severe visual loss.6 Many risk factors, such as genetics, aging, drusen load and smoking, are thought to play a role in the pathogenesis of this degenerative eye disease.66 However, the cellular mechanism underlying AMD is poorly understood and an effective treatment targeting the early stage of AMD is not 12  available. It is widely accepted that chronic inflammation may play a central role in the disease process. The critical evidence lies in the facts that pro-inflammatory mediators and complement-related proteins are present in the eye lesions or in the blood of AMD patients.1, 25, 67 Recent studies from our lab support this hypothesis as we have shown several cytokines or chemokines (IL-1β, IL-18, and CXCL11) are up-regulated in human eyes with late stage AMD. The overall goal of my thesis is to understand the detailed cellular pathway(s) by which the risk factors for AMD contribute to the central inflammation process that mediates the disease progression.  The CFH Y402H polymorphism and drusen load are two salient risk factors for AMD. Recent studies have shown that the Y402H single nucleotide polymorphism in the CFH gene confers an increased risk for AMD incidence and progression.32-36, 68 Although previous studies have demonstrated that the binding capacity of CFH is altered due to the Y402H polymorphism, it is not fully established how this alteration affects the pro-inflammatory processes that promote AMD.45, 69, 70 The role of CFH is to keep complement activation in check. It does this by accelerating the decay of the alternative pathway C3 convertase (C3bBb) or by functioning as a cofactor for CFI-mediated cleavage and inactivation of C3b.38-40 It is possible that the Y402H polymorphism may compromise the function of CFH to control complement activation. CFH is present both in the blood (secreted by the liver) and in the eye (secreted by RPE).32, 45 The expression level in the eye is comparable to that of liver.32 Therefore the dysregulation of complement cascade may exist in both local and systemic levels.  The presence of drusen is another important risk factor for AMD. People with larger drusen and greater numbers of drusen are likely to develop vision loss associated with AMD.71-73 Numerous 13  complement-related proteins or products of complement cascade are present in the drusen.22-24, 26 Of note, the complement cascade product iC3b is found to colocalize with Aβ, a protein known to also accumulate in brain with Alzheimer’s disease and mediate complement activation.27, 74 We therefore hypothesize that Aβ may also play a role in complement activation in AMD pathogenesis. Given that complement activation products (C3a, C5a or MAC) may enhance the expression of pro-inflammatory cytokines (e.g. IL-6, TNF-α, IL-1β and IL-18) in cells,43, 52, 53 my work focuses on elucidating the effect of the risk factors on complement activation and pro-inflammatory cytokines in AMD. My goal is to identify the detailed cellular pathway(s) that are shared by multiple risk factors including CFH Y402H and drusen accumulation. The knowledge I obtain will allow us to identify the candidate triggers of chronic inflammation in outer retina towards the development of new strategies to minimize AMD progression.   1.3 Objectives and Hypotheses The CFH Y402H polymorphism and drusen are two of the most important risk factors for AMD incidence and progression. The Y402H polymorphism can lead to an amino acid change in the protein of CFH, an inhibitor for complement activation.45 Complement proteins and complement activation products are abundantly found in drusen and one drusen component, Aβ colocalizes with complement activation product.45 Therefore, we hypothesize that the CFH Y402H polymorphism and drusen can both overactivate the complement cascade. Given that complement activation products (C3a, C5a or MAC) may enhance the expression of pro-inflammatory cytokines (e.g. IL-6, TNF-α, IL-1β and IL-18) in cells,43, 52, 53 we further hypothesize that due to the Y402H polymorphism and/or drusen, complement activation is 14  overactivated and thus proinflammatory cytokines may be elevated. The hypotheses will be tested by the following three aims.   Aim 1: Investigate whether the carriers of the Y402H ‘at risk’ polymorphism have higher levels of systemic pro-inflammatory cytokines and increased drusen load. Given the fact that CFH is secreted by liver and circulates in blood, this observational (cross sectional) study in AMD patients will provide the evidence for the potential effect of CFH Y402H polymorphism on pro-inflammatory cytokines at the systemic level and in the disease severity of AMD.   Aim 2: Examine whether the risk genotype of CFH Y402H polymorphism is associated with higher level of complement activation products and cytokines in the retina of non-AMD post-mortem donor eyes. Given the fact that CFH is also expressed by RPE, this observational study will reveal the relationship of CFH Y402H polymorphism and the expression of pro-inflammatory cytokines at the local retinal level.   Aim 3: Assess the effect of complement activation on the expression of pro-inflammatory mediators, using an in vitro model of RPE cells stimulated with drusen component – fibrillar Aβ. This in vitro study will test the hypothesis that RPE cells modify their gene expression patterns in response to cellular stress due to drusen components (i.e. Aβ) and are thus more susceptible to complement activation, which promotes progression of aberrant cytokine expression.  15   Aim 4: Assess the effect of a MAC inhibition compound, aurin tricarboxylic acid complex (ATAC) on fibrillar Aβ induced changes in RPE using the model established in the Aim 3. This in vitro study will allow me to examine the therapeutic potential of ATAC, a MAC inhibitor, in reversing AMD-associated changes in RPE in vitro. 16  Chapter 2: Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration  2.1 Introduction Age-related macular degeneration (AMD) constitutes the number one cause of blindness among the elderly in industrialized countries.65 The hallmark of AMD is the accumulation of extracellular deposits called drusen, which are located between the retinal pigmented epithelium (RPE) and Bruch’s membrane.8 Larger size and greater number of drusen confer higher risk of developing vision-loss due to geographic atrophy (GA) and choroidal neovascularization (CNV).9 In addition, choroidal abnormalities have been reported to be associated with drusen formation in dry AMD.75-77 The recent introduction of enhanced depth imaging (EDI) and segmentation algorithm in spectral domain optical coherence tomography (SD-OCT) allows for better quantification of drusen load and choroidal measurements.78, 79 This non-invasive, reliable imaging method of measuring drusen load and choroidal thickness creates an opportunity to quantify these parameters of slow progression in patients with early stage of dry AMD. Additionaly, this method has potential to allow for an in-depth study of the underlying mechanism in AMD pathogenesis.80  Although the clinical presentation of AMD mainly involves local processes within the retina, systemic factors in the circulating blood might also contribute to the pathogenesis of AMD via exchange between the choroid and the retina. For example, the homozygous CC variant of Y402H polymorphism in the gene coding complement factor H (CFH), a regulator of the 17  alternative complement pathway, is associated with high incidence as well as progression to late AMD.36 Proposed mechanisms supporting this include the finding that circulating CFH at-risk proteins have a weaker capacity to bind oxydized phospholipids in situ, thereby modulating proinflammatory stress in the outer retina.69, 70 Systemic activation of complement cascade was also found in AMD patients.49, 81 Together with the crosstalk between the complement activation products and pro-inflammatory cytokines reported in blood cells, these findings highlight the potential role of systemic inflammatory cytokines in the pathogenesis of AMD.43, 52 However, several questions remain as few studies have addressed the relationship between the systemic cytokine levels and CFH Y402H polymorphism in AMD patients, or whether systemic levels of cytokines are associated with the local ocular manifestations such as drusen load and choroidal thinning that occur in early dry AMD. Using a new SD-OCT tool to follow drusen enlargement and changes of choroidal thickness, two parameters to assess disease progression, we conducted a pilot study to investigate the relationship of systemic cytokines with these two parameters as well as CFH Y402H polymorphism in patients with dry AMD. We focus on four inflammation-related cytokines. Interleukin (IL)-1β, IL-6, IL-18, and tumor necrosis factor (TNF)-α are classic pro-inflammatory cytokines and previously shown to affect RPE function and implicated in AMD pathogenesis.55, 56, 62, 82-85  2.2 Methods  2.2.1 Study population The design of this study was cross-sectional, and it was approved prospectively by Providence Health Care Research Ethics Board at the University of British Columbia and complied with the 18  Declaration of Helsinki. Forty-four patients under the care of the retina service at UBC (DA, FF, AK, and AM) were enrolled in this study with informed consent. The inclusion criteria were age 55 years or older, diagnosis of dry AMD in both eyes, and absence of any other disease affecting the macula that could compromise the ability to properly assess for drusen (e.g. epiretinal membrane, vitreomacular traction, adult vitelliform dystrophy, etc.). Exclusion criteria were exudative AMD or geographic atrophy in either eye, ocular media opacity that precluded adequate visualization or imaging of the macula, cancer within the last 10 years (except for basal cell carcinoma), cardiovascular disease with complications (heart attack or stroke) within the past year, diabetes with uncontrolled glucose level or complications (diabetic eye disease, diabetic kidney disease, or diabetic nerve damage), any other medical conditions that, in the opinion of the investigators, would affect the study results, and medications that could affect the levels of biomarkers in blood (e.g. corticosteroids and NSAIDs).  2.2.2 Eye examination, drusen area and choroidal thickness measurements Patients underwent a full ophthalmic exam including measurement of best-corrected visual acuity (BCVA), intraocular pressure, biomicroscopy, and dilated fundus examination. Cirrus SD-OCT (version 6 software, Carl Zeiss Meditec Inc., Dublin, CA) was used for drusen area and choroidal thickness measurements.  Each eye was scanned once using a cube scan protocol (200 X 200 cube scan).  In the same session, each eye was also scanned a minimum of two times with the EDI raster scan.  Each scan was centered on the fovea automatically and covered a 6 X 6 mm area.  The minimum required signal strength for every scan was 6 out of 10.   19  The drusen area measurements were automatically generated by the Cirrus SD-OCT software algorithm from the cube scans.  For measurement of subfoveal choroidal thickness, three independent investigators (A.K., K.P.-V., F.F.) measured the choroidal thickness beneath the fovea manually from the EDI raster images using the program’s caliper function during two different sessions. The scan with the best signal strength score was chosen for each eye.  Each researcher was blinded to the measurements of others and to their own previous sessions.  2.2.3 Cytokine analysis Non-fasting blood specimens were obtained at the time of the study visit. Ethylene-diamine-tetraacetic acid (EDTA) plasma from patients was prepared into aliquots within 2 hours of phlebotomy and stored at -80°C until analysis. Cytokines of EDTA plasma from patients were measured by a Bio-Plex ProTM human cytokine, chemokine and growth factor assays as described by the manufacturer (Bio-Rad Laboratories, Hercules, CA). The assays use xMAP technology (Luminex, Austin, TX), which permits the quantification of multiple cytokines in a single well with 50 μL of diluted sample (1:4). In our experiments, the premixed multiplex beads of the Bio-Plex human cytokine 27-plex assay and an additional 2-plex were employed.  They included the following cytokines: Interleukin (IL)-1β, IL-1ra, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 (p70), IL-13, IL-15, IL-17, IL-18, chemokine (C-C motif) ligand (CCL)11/eotaxin, basic fibroblast growth factor (basic FGF), granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF), interferon-gamma (IFN-γ), chemokine (C-X-C motif) ligand (CXCL)10/interferon gamma-induced protein 10 (IP-10), CCL2/monocyte chemoattractant protein (MCP)-1, CCL3/macrophage inflammatory protein (MIP)-1α, CCL4/MIP-1β, platelet-derived growth factor (PDGF)-BB, CCL5/regulated on 20  activation, normal T cell expressed and secreted (RANTES), CXCL12/stromal cell-derived factor (SDF)-1α, tumor necrosis factor (TNF)-α, and vascular endothelial growth factor (VEGF).  2.2.4 CFH Y402H genotyping Genomic DNA was extracted from EDTA-contained whole blood using QIAsymphony SP system (Qiagen, Toronto, ON, Canada) and eluted in 200ul volume. The extracted DNA was quantified using Quant-iTTM PicoGreen® dsDNA Assay Kit (Life Technologies, Burlington, ON, Canada) to make sure that sufficient concentration (>50ng/μL) of genomic DNA was obtained. The subsequent polymerase chain reaction (PCR) amplification and sequencing analysis were performed as previously described.86 Briefly, amplicons of 660bp containing CFH Y402H (rs1061170) were produced in PCR reaction using the forward and reverse primers of 5' AGTAACTTTAGTTCGTCTTCAG 3' and 5' ATCTTCTTGGTGTGAGATAACG 3', respectively. After purified with QIAquick PCR Purification Kit (Qiagen, Toronto, ON, Canada), the PCR products were mixed with sequencing primer at suitable concentrations as required and then sent to GENEWIZ (South Plainfield, NJ) for sequencing analysis. The CFH sequencing primer was 5’ ACTTTAGTTCGTCTTCAG 3’.  2.2.5 Statistical analysis Means were calculated between the two eyes for drusen area, as well as between the two eyes and three measurements for choroidal thickness. We used a mean value in order to compare to the single measurements obtained from the cytokines. All analyses were conducted with SPSS Statistics v. 20 (IBM, Armonk, NY).  21  Our previous study showed that SD-OCT based drusen area and drusen volume, two parameters of drusen are highly correlated (r = 0.86).87 For this reason, we decided to only employ drusen area in our analysis.  In the first analysis, we examined the differences in plasma levels of four cytokines among the three variants of CFH Y402H in our study population. We conducted a series of analysis of covariance (ANCOVA) using the genotype groups (CC, CT, TT) as the between-subjects factor and individual cytokine, drusen area, and choroidal thickness as the dependent variables. We also included age as a covariate because previous work showed the possible relationship between cytokines and age.88-90 We used a Bonferroni correction to account for multiple comparisons (p < .01) and post-hoc comparisons were conducted following a significant omnibus result. For the post-hoc comparisons, we used a priori contrasts between the CC and CT variants and between the CC and TT variants, as we were most interested in these contrasts.   In the second analysis, we examined the correlation between each selected cytokine and drusen area or choroidal thickness. We conducted a series of Pearson correlations using cytokines, drusen area, and choroidal thickness as variables. We again used a Bonferroni correction to account for multiple comparisons (p < .01).     22  2.3 Results  2.3.1 Subject characteristics  Participants for this study were recruited between February 2012 and May 2012. The characteristics of the 44 subjects were described previously.87 Briefly, each subject had bilateral dry AMD.  None of our subjects were current smokers.  The mean age of all subjects was 75.77 years old (standard deviation [SD]: 8.42 years). The mean drusen area between the two eyes was 1.44 mm2 (SD: 1.22), with 1.57 mm2 (SD: 1.64) for right eyes and 1.30 mm2 (SD: 1.16) for left eyes. The mean choroidal thickness between the two eyes was 230.73 μm (SD: 53.23), with 232.00 μm (SD: 53.44), for right eyes and 229.47 μm (SD: 59.58) for left eyes. In terms of CFH Y402H polymorphism, 17 patients (38.6%) had CC variant, 14 patients (31.8%) had CT variant, and 13 patients (29.5%) had TT variant (Table 2.1). 23  Sample Characteristics Mean (SD) or n (%) 95% CI Age (years) 75.77 (8.42) 73.28-78.26 Drusen Area (mm2) 1.44 (1.22) 1.08-1.80 Right Eyes 1.57 (1.64) 1.09-2.05 Left Eyes 1.30 (1.16) 0.96-1.65 Choroidal thickness (μm) 230.73 (53.23) 215.00-246.46 Right Eyes 232.00 (53.44) 216.21-247.79 Left Eyes 229.47 (59.58) 211.86-247.07 CFH Y402H genotype†    CC 17 (38.6%)  CT 14 (31.8%)  TT 13 (29.5%)  CI = confidence interval; SD = standard deviation; CFH = complement factor H. †CC, CT and TT are three genotype variants of CFH Y402H polymorphism.  Table 2.1 Characteristics of the recruited patients with dry age-related macular degeneration.24  2.3.2 Cytokines, drusen area, choroidal thickness and genotype variants To examine if there is a relationship between systemic cytokines, drusen area, or choroidal thickness and genotype of CFH Y402H polymorphism, four cytokines were selected for analysis: IL-1β, IL-6, IL-18, and TNF-α. IL-1β and IL-18 were both products of inflammasome activation – a pathway recently studied for its association with both GA and CNV development.55, 56 IL-18 was known to induce RPE degeneration in mice.55 IL-6 and TNF-α are classic pro-inflammatory cytokines, which have been shown to affect RPE function in vitro.62, 82-85   Our ANCOVA results showed that three of the four cytokines are significantly different among patients with CC, CT or TT variants of the CFH Y402H genotype (p < .01), when corrected for age (Table 2.2). Patients with the CC variant had a higher level of IL-6 than those with the CT or TT variant (p < .01). The level of IL-6 in patients with the CC variant is greater than that in patients with the TT (36%) or the CT (52%) variant (Figure 2.1). The levels of IL-18 and TNF-α in patients with the CC variant are only significantly higher compared to those with the CT variant, with 39% and 42% increase, respectively (Figure 2.2 and 2.3). There is a trend for group differences in IL-1β levels, but it does not reach significance when corrected for multiple comparisons (p = .02, Figure 2.4).  The ANCOVA results showed that there were no significant differences between the CFH Y402H variants on variables such as drusen area (F (degrees of freedom, 2, 39) = 0.79, p = .46) or choroidal thickness (F (2, 39) = 0.06, p = .94), when corrected for age. This suggests that the systemic elevation of cytokines in the CC variant is not directly related to drusen area and choroidal thickness.25   CFH Y402H Polymorphism† P value  CC  CT  TT  Mean SD SEM  Mean SD SEM  Mean SD SEM IL-1β 22.22 6.21 8.92  16.89 5.54 7.17  17.61 6.17 7.09 .02 IL-6 62.35 21.22 13.53  41.03 15.99 10.26  45.70 18.99 10.49 < .005 IL-18 140.56 36.32 23.32  101.00 28.06 19.07  116.61 51.81 16.20 .01 TNF-α 267.86 85.75 28.93  189.14 73.65 22.04  216.77 87.81 23.13 .01 CFH = complement factor H; SD = standard deviation; SEM = standard error of the mean; IL= interleukin;  TNF = tumor necrosis factor †CC, CT and TT are three genotype variants of CFH Y402H polymorphism  Table 2.2 Descriptive statistics and analysis of covariance results from plasma cytokine levels in dry age-related macular degeneration patients with different genotypes of the complement factor H Y402H polymorphism 26   Figure 2.1 Plasma levels of interleukin(IL)-6 in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism Plasma IL-6 level in dry AMD patients with homozygous CC variant is 52% higher than homozygous TT variant and 36% higher than heterozygous CT variant (Mean ± SEM, post hoc p < .01, shown by asterisk).   Figure 2.2 Plasma levels of interleukin(IL)-18 in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism Plasma IL-18 level in dry AMD patients with homozygous CC variant is 39% higher than heterozygous CT variant (Mean ± SEM, post hoc p < .01, shown by asterisk). 27   Figure 2.3 Plasma levels of tumor necrosis factor(TNF)-α in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism Plasma TNF-α level in dry AMD patients with homozygous CC variant is 42% higher than heterozygous CT variant (Mean ± SEM, post hoc p < .01, shown by asterisk).   Figure 2.4 Plasma levels of interleukin(IL)-1β in patients with dry age-related macular degeneration (AMD) stratified by three genotype variants of complement factor H (CFH) Y402H polymorphism There is a trend for IL-1β levels to be different among dry AMD patients with CC, CT and TT variants, but it does not reach significance when corrected for multiple comparisons (Mean ± SEM, p = .02).28  2.3.3 Cytokines and choroidal thickness, drusen area In our earlier study, drusen area and choroidal thickness were inversely related in dry AMD patients and both may reflect, to some degree, the severity of disease.87 In the current study, to explore the relationship of the ocular pathology and the systemic cytokine levels, we investigated the relationship of drusen area or choroidal thickness with cytokine levels in plasma. However, we did not see any relationship between the systemic levels of cytokines studied and drusen area or choroidal thickness (all p > .15).  2.4 Discussion In this pilot study, we showed that patients with homozygous at-risk CC variant for CFH Y402H polymorphism had higher systemic cytokine levels than those with only one risk allele (CT) or without any risk alleles (TT). The cytokines examined in our study are pro-inflammatory and are known to affect the function of retinal cells in the outer retina. They can work alone or synergistically to induce further cytokine production and adhesion molecules from RPE, thereby enhancing the local pro-inflammatory status. Other effects include increasing the permeability of the endothelium, a process involved in blood- retina barrier breakdown, and neovascularization.63, 91-95 The association of patients with the CC variant and the significant elevated IL-18 and the trend demonstrated by IL-1β (Table 2.2) suggests that there may be systemic inflammasome activation in these patients. IL-1β and IL-18 are both products of inflammasome activation and are known to induce local eye changes associated with both GA and CNV development.55, 56 With the access to the outer retina via the choroidal vasculature, the higher cytokines in the blood may predispose the local retinal environment to a pro-29  inflammatory status, which may explain why patients with CC variant have a higher risk for AMD progression than those with TT variant.  The CFH Y402H polymorphism is considered to be the most salient genetic factor to confer an increased risk for AMD incidence as well as progression, although the details of the underlying mechanisms are still under investigation.32-36, 68 CFH is the main inhibitor of the complement alternative pathway. By interactions with C3 and inactivation of its activation products, CFH keeps the spontaneous activation of the alternative pathway in check.96 With the CFH Y402H risk variant, the inhibitory function of CFH may be altered. Earlier studies showed that the CFH Y402H polymorphism may be associated with an increased activation of complement cascade not only systemically, but in local tissues as well.42, 45, 49 The complement activation products such as C3a and C5a may regulate the expression of proinflammatory cytokines such as IL-1β, IL-6, TNF-α in blood cells.52, 97-99 It is therefore possible that the elevation of the cytokines shown in this pilot study is secondary to the increased complement activation associated with the CC risk variant. In addition, the CFH Y402H variant may also affect systemic cytokine levels due to its altered binding properties. Previous studies showed that the at-risk Y402H variant of CFH binds poorly to molecules such as C-reactive protein (CRP) and malondialdehyde (MDA).45, 70 The efficient formation of CRP-CFH complex on cell surfaces is important to dampen complement activation and reduce the secretion of the proinflammatory cytokine TNF-α,100 which may explain our finding that at risk variant carriers have a higher TNF-α level. Similarly, MDA, a common lipid peroxidation product, when inefficiently bound to CFH (due to the CC variant), can induce macrophages/monocytes to secrete many proinflammatory cytokines, including IL-6.101 Our data support the relationship of elevated systemic cytokine levels and 30  CFH Y402H at risk variants in patients with dry AMD, and suggest that systemic cytokines may also be associated with genetic factors and thus contribute to disease manifestations in the ageing macula.  Our finding that dry AMD patients with the CC variant had higher IL-6 level than patients with TT variant was consistent with an earlier study that focused on an aged general population.102 In addition, our study was also consistent with Moorijaart et al in that no differences were observed between individuals with the CT variant compared to those with the TT variant. However, it is interesting that the IL-6 level found in our study population (median, 48.3 pg/mL) is generally higher than in a general aged population  (median, 11 pg/mL) as shown by Moorijaart et al.  The difference in the level of IL-6 between two studies may be related to two factors. The participants in our study are all diagnosed with dry AMD, while the earlier study focused on a general population. Methods to quantify IL-6 from plasma included a suspension array in our study, while Moorijaart et al used enzyme-linked immunosorbent assay (ELISA).  Given the fact that a systemic complement activation was found in AMD patients and large drusen area confer higher risk to late stage of AMD,9, 43, 58 we hypothesized that drusen load and chroidal thickness measured by OCT may demostrate a relationship with systemic levels of inflammatory cytokines associated with complement activation. However, we did not find any relationship between the cytokines we analyzed and drusen load or choroidal thickness.  This might partially be due to the small sample size, which is a limitation of our study. The standard deviation of drusen load is 1.22 mm2, relatively large in regard to the mean of 1.4 mm2. And the range of drusen load is from 0 to 4.25 mm2, which is relatively small compared to previous 31  cohort studies.20, 73 Therefore, future studies should be conducted with a larger cohort to assess the relationship between systemic cytokines and drusen load or choroidal thickness. We were constrained from analyzing all 29 tested cytokines/growth factors with multiple testing correction due to our relatively small sample size in this pilot study.  Therefore, we focused on 4 cytokines which are known to play a significant role in the development of AMD. Future research should conduct a larger study in order to evaluate the effect of all 27 cytokines and whether there are any differences or similarities between them.  2.5 Conclusion Our study demonstrated that the systemic levels of selected pro-inflammatory cytokines, including those representing products of inflammasome activation were higher in dry AMD patients with the CC at-risk variant of the CFH Y402H polymorphism. Our data support the central role of inflammation in the pathogenesis of AMD and provides new evidence of a systemic involvement in AMD etiology. Future work will assess the potential interactions of inflammasome activation at the systemic and local retinal level, and the usefulness of systemic cytokine biomarkers as indicators of AMD progression.  32  Chapter 3: Optical coherence tomography–based correlation between choroidal thickness and drusen load in dry age-related macular degeneration  3.1 Introduction Age-related macular degeneration (AMD) is one of the leading causes of vision loss in people over the age of 50 in the developed world.103, 104 The role of the choroid in the pathogenesis and progression of dry AMD through the formation and accumulation of drusen deserves further investigation. The choroid provides the only circulation for the retinal pigment epithelium (RPE) and outer retina. Therefore, it is the primary means of metabolic support for these tissues.103 It has been shown that the choriocapillaris has unique features including high flow rate and low oxygen extraction that are mandatory to sustain normal photoreceptor metabolism.105 Hence, the choroid’s critical role of metabolic support for the retina and RPE suggests that this vascular layer may have a role in drusen development. In other words, RPE with poor metabolic support secondary to deficient choroidal supply may be more prone to developing drusen as they are unable to completely metabolize photoreceptor byproducts.106, 107  Spectral domain optical coherence tomography (SD-OCT) is a relatively new technology that allows detailed imaging within the retina, including the photoreceptor layer and RPE, as well as the choroid.108 High-definition SD-OCT has previously been used to measure choroidal thickness in AMD.79 It has been demonstrated that enhanced depth imaging (EDI) SD-OCT, which produces an inverted image from 100 scans to improve signal-to-noise ratio, can be used to visualize the choroid even better.109-112 The new technology has lead to better understanding of 33  the role of choroid in various macular diseases, including central serious chorioretinopathy,110-112 high myopia,113, 114 Vogt–Koyanagi–Harada disease,115 and a variety of retinal dystrophies.116 However, although SD-OCT has been used to assess choroidal thickness in various diseases, including AMD, it has not yet been used to correlate choroidal thickness with drusen load in dry AMD.  In addition to measuring choroidal thickness, SD-OCT can now be used to measure drusen load (area and volume). This novel diagnostic technology and algorithm was evaluated and showed the ability to generate highly reproducible qualitative and quantitative analysis of the drusen area and volume.78 It also demonstrated the capacity to illustrate undulating changes in drusen area and volume over time.117 With the advent and availability of SD-OCT, EDI, and reliable measurements of drusen area and volume, the relationship between choroidal thickness and dry AMD can now be more accurately studied. To the best of our knowledge, this is the first study examining the relationship between choroidal thickness and drusen load in dry AMD using SD-OCT.  3.2 Methods This study was approved by the Research Ethics Board at the University of British Columbia. Patients with a clinical diagnosis of dry AMD currently under care of the retina service at the University of British Columbia (D.A.A., F.F., A.W.K., A.B.M.) were asked to participate. Inclusion criteria included the following: aged 55 years or older at the time of recruitment, dry AMD diagnosed in both eyes, and no evidence of other macular disease (diabetic retinopathy, 34  epiretinal membrane, vitreomacular traction, etc). Exclusion criteria were the following: past or present diagnosis of wet AMD, geographic atrophy, and significant ocular media opacity.  Patients underwent a full ophthalmic examination, including measurement of best-corrected visual acuity, intraocular pressure, biomicroscopy, and dilated fundus examination. Snellen visual acuity was converted to logarithm of minimal angle of resolution (logMAR) equivalents for statistical analysis. Cirrus SD-OCT (version 6 software; Carl Zeiss Meditec, Inc, Dublin, CA) was used. Each eye was scanned once using a cube scan protocol (200 × 200 cube scan). In the same single session, each eye was also scanned a minimum of two times with the EDI raster scan. Each scan was centered on the fovea automatically and covered a 6 × 6-mm area. The minimum required signal strength for every scan was 6 of 10.  The drusen volume and area data used in this study for analysis were automatically generated by the Cirrus SD-OCT software algorithm from the cube scans. For measurement of choroid thickness, three independent investigators measured the choroidal thickness beneath the fovea manually from the EDI raster images using the program's caliper function during two different sessions. The scan with the best signal strength score was chosen for each eye. Each researcher was blinded to the measurements of others and to their own measurements from previous sessions.  Sample characteristics were described as frequency (percent) for categorical variables and as mean (standard deviation [SD]) for continuous variables. Intra- and interrater reliability of the measurement of choroid thickness was assessed using intraclass correlation coefficients and 35  limits of agreement determined by fitting a linear mixed model. The association between the drusen area and choroid thickness was assessed using a general linear regression model. The drusen area values were square root transformed to better meet the assumptions of normality and homogeneity of variance, and generalized estimating equations were used to account for the within-person correlation arising from both eyes. We repeated the analysis adjusting for age and sex. Similar analyses were used to assess the association between choroid thickness and visual acuity. Stata v12.1 (StataCorp. 2011. Stata Statistical Software: Release 12; StataCorp LP, College Station, TX) was used for all analyses.  The sample size was one of convenience; it represented the number of patients who could be recruited with the resources available for the study. No formal a priori sample size calculation was made.  3.3 Results Participant enrollment took place between February 2012 and May 2012. A total of 44 subjects were recruited with the initial diagnosis of bilateral dry AMD, of which 31 were women (70%). The average age of all subjects was 75.7 years (SD, 8.4 years; range, 60–91 years).  The mean signal strength for the cube scans was 7.91 (SD, 0.98), and all signal strengths were 6 or greater. The mean signal strength for the EDI raster scans was 8.45 (SD, 1.11). All but one patient had signal strength greater than 6. The one subject had signal strength of 5 in both eyes, which could not be improved on multiple attempts. Forty patients were taking Age-Related Eye Disease Study vitamin supplementation (91%). None of the patients were current smokers; 8 36  patients (18%) were previous smokers who had quit between 13 and 49 years ago. The mean visual acuity was 0.39 logMAR (SD, 0.29) for right eyes and 0.36 logMAR (SD, 0.23) for left eyes.  Average (across eyes) intrarater intraclass correlation coefficients for the 3 raters were 0.87, 0.80, and 0.64. The average interrater intraclass correlation coefficient was 0.67. Although these intraclass correlation coefficient values are considered acceptable,118 the limits of agreement between any 2 raters were in the range of -100 to 100 µm (~40% of the average choroid thickness) indicating substantial absolute disagreement between the raters. We considered the average choroid thickness across all three raters to be the best estimate of choroid thickness, and this was used in our statistical analyses.  We found a strong correlation between the drusen area and drusen volume (Figure 3.1, r = 0.86). Given this finding and that the square root of the drusen area better fit the model assumptions rather than the cubic root of the drusen volume, only the square root of the drusen area was used for further data analysis. Neither age nor gender was statistically significant in any of the models nor did their inclusion result in changes to the effect estimate. Not surprisingly, given the small sample size, the inclusion of these variables spuriously increased the standard error of the estimates (Table 3.1) and so we focus our interpretation on the results of the univariable analyses.  An inverse relationship between the drusen area and choroidal thickness (Figure 3.2, r = -0.35; P = 0.04) was shown, demonstrating that patients with thinner choroid tended to have greater 37  drusen load. The relationship between the drusen area and choroid thickness was independent of age and gender.  We looked at the relationship between the drusen area and visual acuity of the subjects. Figure 3.3 illustrates a positive correlation between the drusen area and visual acuity (r = 0.32, P = 0.04). Patients with greater drusen load tended to have worse visual acuity, and this was independent of choroidal thickness. Finally, an inverse relationship between choroid thickness and visual acuity was seen (Figure 3.4, r = -0.22, P = 0.21), independent of drusen area, showing that thinner choroid is associated with poorer visual acuity. However, this result was not statistically significant and should be interpreted cautiously.38   Figure 3.1 Linear regression analysis of drusen volume versus drusen area  Outcome Predictor Beta (SE) P Model R2 (P) √drusen area Choroid thickness -0.0025  (0.0012) 0.04 0.12 (0.04) √drusen area Choroid thickness -0.0022 (0.0012) 0.07 0.13 (0.04)  Age 0.006 (0.009) 0.50   Female -0.19 (0.16) 0.23  √drusen area Visual acuity 0.65 (0.31) 0.04 0.10 (0.04) √drusen area Visual acuity 0.61 (0.33) 0.07 0.19 (0.001)  Age -0.001 (0.009) 0.89   Female -0.17 (0.14) 0.22   Choroid -0.002 (0.001) 0.08  Choroid thickness Visual acuity -19.5 (15.7) 0.21 0.05 (0.21) Choroid thickness Visual acuity -8.2 (14.4) 0.57 0.12 (0.19)  Age  -1.2 (0.9) 0.18   Female 13.7 (18.6) 0.74    √drusen area -8.4 (10.4) 0.42  Beta, regression coefficient , SE, standard error, √drusen area, square root of drusen area Table 3.1 Results of univariable and multivariable regression analyses  39   Figure 3.2 Univariable linear regression analysis of drusen area versus choroid thickness   Figure 3.3 Univariable linear regression analysis of drusen area versus visual acuity 40   Figure 3.4 Univariable linear regression analysis of choroid thickness versus visual acuity 41  3.4 Discussion This exploratory study using SD-OCT shows that a correlation exists between choroidal thickness and drusen load in patients with dry AMD. Spectral domain OCT has previously been used to measure choroidal thickness in dry AMD,79 but its ability to demonstrate a correlation between choroidal thickness and drusen load in dry AMD has not yet been illustrated. We also found a strong correlation between the drusen area and drusen volume. This suggests that either the drusen area or the drusen volume alone may be enough as a parameter for monitoring dry AMD.  Our study found an inverse relationship between drusen load and choroidal thickness using SD-OCT. Choroid is normally thickest under the fovea, and it decreases with age.114, 119-123 Foveal choroidal flow and volume also decrease with age.124 Grunwald et al. hypothesized that this was in response to age-related decrease in density and diameter of the choriocapillaris that was previously observed by Ramrattan et al.124, 125 A more recent study found an inverse relationship between choroidal blood flow (and volume) and drusen extent.103 Another study also found that the eyes with the most drusen had the lowest choriocapillaris density.76 It is not yet clear as to the reason for the inverse relationship. Berenberg et al. hypothesized that choroidal thinning may be because of drusen creating a distribution barrier to the trophic substances necessary for proper choriocapillaris maintenance.103 Inversely, they also hypothesized that thinner choroid and decreased blood flow result in decreased waste removal from the structures it supports, ultimately leading to drusen formation.  42  In addition, our study found that the drusen area correlated inversely with the visual acuity. This may be because of the fact that drusen represents disruption of RPE, the Bruch membrane, and choriocapillaris, subsequently affecting the health of the overlying photoreceptors.126 A study using SD-OCT showed that the photoreceptor layer over drusen was decreased in thickness compared with that of controls.127 A more detailed observation using SD-OCT revealed that drusen causes disruption to the structural integrity within the photoreceptor layer, namely at the inner and outer segment junction, although it was also shown that the disruption may be restored after drusen regression.128 Unhealthy photoreceptors, or their atrophy, would lead to subjects' functional deficits in the form of decreased visual acuity.129 A correlation between choroidal thickness and visual acuity was also suggested in our study, but this did not reach a conventional level of statistical significance. This result could be expected with reasonable confidence because another group has also recently shown an inverse correlation between choroidal thickness and visual acuity in myopia.114 It is important to note that their study showed that subfoveal choroidal thickness was the only significant predictor for visual acuity while other parameters, including retinal and foveal thickness, outer retinal hyporeflective layer thickness, and inner segment to RPE aggregate thickness, were not significant predictors. They ultimately concluded that OCT-measured retinal features are not correlated with visual acuity. Our study supports their finding that choroidal thickness is a reliable indicator of visual acuity. Choriocapillaris plays an important part in the health of photoreceptors along with RPE and the Bruch membrane.126 Similar to the effects of drusen, the decrease in choroidal thickness, and therefore blood flow, could compromise the health of the photoreceptors and subsequently lead to their functional decrease and decreased visual acuity.  43  Optical coherence tomography parameters have been used as outcome measures in various clinical trials for wet AMD.130, 131 Not only were OCT criteria an outcome measure in these trials but they were also used as part of treatment criteria. However, to date, there has been a paucity of clinical trials for dry AMD. One reason for this is that the anatomical progression of dry AMD is very slow and at times even undetectable. The same may be said for vision loss secondary to dry AMD. Thus, these changes often take months to years to be realized,108 and as a result, no imaging modality has yet been shown to be superior to other modalities as for measuring outcome parameters in dry AMD studies.108 Spectral domain OCT outcomes are now being incorporated into dry AMD studies. To date, SD-OCT has mostly been used to measure geographic atrophy in AMD trials.132, 133 As SD-OCT has been demonstrated to be a promising tool in assessing drusen morphology,78, 117, 134 it is now being used to evaluate drusen in some dry AMD trials as well.108 Currently, a clinical trial is underway using SD-OCT to study the effects of eculizumab on the growth of both geographic atrophy and drusen volume in dry AMD patients.108, 135 The Age-Related Eye Disease Study 2108, 136 is currently attempting to determine if SD-OCT can be used to predict disease progression and vision loss by using it to observe various parameters, including drusen volume and geographic atrophy.108 Our study suggests that other SD-OCT parameters like choroidal thickness may also be useful outcome parameters in dry AMD trials. However, the moderate interrater agreement that we observed in the measurement of choroid thickness suggests that other methods for measuring choroid thickness, such as automated algorithms,137 may be more reproducible than manual measurements. Furthermore, diurnal fluctuations in choroidal thickness138, 139 would need to be accounted for in the clinical use of these measurements.  44  To our knowledge, this is the first study using SD-OCT to show that a correlation exists between choroidal thickness and drusen load in patients with dry AMD. Furthermore, an inverse relationship was shown between visual acuity and both choroid thickness and drusen load. Our data suggest that SD-OCT parameters such as choroidal thickness and drusen load may not only be useful in the management of patients with dry AMD but may also be used as outcome parameters in clinical trials of dry AMD. 45  Chapter 4: CFH Y402H polymorphism is associated with elevated vitreal GM-CSF and choroidal macrophages in the postmortem human eye  4.1 Introduction Age-related macular degeneration (AMD) is the leading cause of irreversible central blindness among people aged 50 and above in developed countries.8, 104, 140, 141 It is a progressively degenerative disease of the retina characterized by dysfunction of the retinal pigment epithelial (RPE) cells and associated photoreceptor loss.8, 142 Though the mechanisms leading to the development of AMD are not well understood, it is believed that the cause is multifactorial and that genetics, chronic local inflammation and oxidative stress have been implicated in the pathogenesis of AMD.1, 143, 144  Earlier genome wide association studies reported that the single nucleotide polymorphism (SNP) Y402H (rs1061170, sequence: T1277C) in the gene coding complement factor H (CFH) is associated with AMD.32-34 The homozygous CC variant of CFH Y402H SNP is associated with an approximate 6-fold increased risk of developing AMD, compared to the TT variant.32-35 The mechanism by which the at-risk CC variant confers an increased risk for AMD is still under investigation. Previous studies, including ours own, have suggested that the CFH Y402H at-risk variant is associated with the elevated levels of complement activation products and classic pro-inflammatory cytokines, including TNF-α.42, 69, 145, 146 Moreover, a higher level of oxidative stress markers appears to be associated with polymorphisms in CFH.147  46  In this study, we focus on granulocyte macrophage colony-stimulating factor (GM-CSF), a growth factor that promotes the survival and activation of microglia and macrophages and its relationship with the CFH Y402H polymorphism in postmortem human eye and in RPE cell cultures.148 Previous histological studies showed microglia/macrophages are associated with AMD lesions, although the role of these cells is not clear.149 In animal studies, transgenic mice that lack CFH, or express the human risk variant of CFH, demonstrate increased levels of macrophage/microglia in the kidney, brain and central retina compared to the wild-type controls.150-152 It is also known that macrophages and microglia differentiate and proliferate when stimulated with GM-CSF.148, 153, 154 Given this evidence in transgenic mice, we were interested in understanding the relationship between CFH Y402H genotype and levels of GM-CSF in the postmortem human eye.  We hypothesize that eye tissues from donors genotyped with the at-risk CC variant would exhibit higher levels of GM-CSF and accordingly, more macrophages or microglial cells compared to the eye tissues from donors with the protective TT variant.  Given the evidence that CFH polymorphisms interact with oxidative stress and pro-inflammatory molecules, we will also investigate the role of 4-hydroxynonenal (HNE), tumor necrosis factor alpha (TNF-α) and complement activation products C5a and C3a on GM-CSF regulation in RPE in vitro.   4.2 Methods  4.2.1 Postmortem donor eye tissues Twenty-two pairs of postmortem donor eyes were obtained from the Eye Bank of British Columbia (Vancouver, BC, Canada). The study protocol was approved by the Clinical Ethics 47  Research Board of the University of British Columbia and strictly adhered to the Declaration of Helsinki. All eye specimens used in this study were normal. Eyes from donors with the following pathologies were excluded for use in this study: evidence of local or systemic infection, progressive central nervous system pathologies, systemic diseases of unknown origin, lymphoproliferative disorder, myeloproliferative disorders or any intrinsic eye disease. The right eyes were paraffin-embedded to obtain 6 µm sections for immunohistochemistry. The left eyes were dissected for collection of vitreous and retina. Briefly, each globe was incised circumferentially at the pars plana to remove the anterior segment. Approximately 3.5-4 mL of vitreous was aspirated by inserting a 20 gauge needle attached to a 5 mL syringe into the vitreous chamber.  The vitreous samples were centrifuged at 1500g for 15 min at 4°C and the supernatant was collected, aliquoted and stored at -80°C until use.86, 155-157 The neuroretina tissues were carefully removed from the RPE and choroid and cut into 5mm × 5mm blocks for DNA extraction and CFH genotype analyses. The length of time between death and collection of postmortem human eye tissues varied due to individual institutional and/or hospital procedures. In order to investigate whether the variability in postmortem collection time affected the GM-CSF level, we conducted a Pearson correlation test and found that there is no relationship between the GM-CSF level and the collection time (r = 0.2769, p = 0.237, Supplementary figure 4.1).   4.2.2 Total genomic DNA isolation and CFH Y402H genotyping The methods of total genomic DNA isolation and genotyping followed our earlier study.86 Total DNA was isolated from retinal tissues of each donor following the phenol-chloroform-isoamyl method, and then amplified through polymerase chain reaction (PCR) for the selected fragment 48  of CFH gene spanning the Y402H SNP locus (rs1061170). The forward and reverse primers used were 5' AGTAACTTTAGTTCGTCTTCAG 3' and 5' ATCTTCTTGGTGTGAGATAACG 3', respectively. The amplified PCR products were then purified and sequenced (Genewiz, South Plainfield, NJ). The sequencing primer for CFH was 5’ ACTTTAGTTCGTCTTCAG 3’.  4.2.3 GM-CSF level measurement The GM-CSF levels in vitreous fluids or supernatant from in vitro experiments were measured with a suspension assay (Bio-Rad Laboratories, Hercules, CA). Briefly, 50 μL of standards and diluted samples (1:4) were incubated with the premixed anti-GM-CSF conjugated beads in 96-well filter plates at room temperature, with agitation (1,100 rpm for 30 sec, and then 300 rpm for 2 hours). After wash, plates were then incubated with 25 μL of diluted biotinylated detection antibody for 30 min at room temperature with agitation, followed by three washes and incubation with 25 μL of streptavidin–phycoerythrin for 10 min at room temperature with agitation. The bead-bound standards and samples were resuspended in 125 μL of Bio-Plex assay buffer, and vortexed for 30 seconds at 1,100 rpm before being analyzed using the Bio-Plex 200 Suspension Array System. The subsequent raw median fluorescent intensity data were captured and analyzed using Bio-Plex Manager software 4.1 (Bio-Rad Laboratories).   The gene expression level of GM-CSF in cells was assessed by reverse transcription polymerase chain reaction (RT-PCR). Total RNA was isolated from tissue using ultRNA column purification kit (Applied Biological Materials, Richmond, BC, Canada) and reverse transcribed into cDNA using the High Capacity RNA-to-cDNA Master Mix (Life Technologies, Burlington, ON, Canada). RNA quantity and quality were assessed using the Nanodrop 2000c spectrophotometer 49  (Fisher Thermo Scientific, Wilmington, DE). The same quantity of total RNA from each group was used for reaction. The following GM-CSF primers were used: forward: 5’ AAAGGCTAAAGTTCTCTGGA 3’; reverse: 5’ CCTGGAGGTCAAACATTTC 3’. The RT-PCR was carried out on the 7500 Fast SDS (Applied Biosystems, Carlsbad, CA) with the following cycling conditions: 95 °C for 30 sec, 50 °C for 30 sec, 72 °C for 45sec, 45 cycles. Melting curve analysis was automatically performed immediately after amplification. Each stimulation group was compared to control group and the results were expressed in mRNA fold change normalized to housekeeping gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) using the 2−ΔΔCt method. The ΔCt values were subjected to statistical analysis.  4.2.4 RPE stimulation Human RPE cells were isolated from fetal donor eye tissues for primary culture as previously described.60, 61 Primary RPE cells and ARPE-19 cells (American Type Culture Collection, Manassas, VA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Sigma Aldrich, St. Louis, MO) containing 10% fetal bovine serum (FBS; Fisher Scientific, Ottawa, ON, Canada), penicillin (100 U/mL, Fisher Scientific) and streptomycin (100 µg/mL, Fisher Scientific). The primary RPE cells at passage 4 were seeded in a 24-well plate and cultured in complete medium for 20 hours (hrs). Stimulation experiments were conducted on RPE cell cultures at 90% confluence. The cells were washed twice with 1× PBS. Then, 200 µl of 1× phenol-free minimum essential media (MEM)/F12 medium (Life Technologies, Burlington, ON) containing either 4-hydroxynonenal (HNE, Millipore, Etobicoke, Canada) at 10 µM, or recombinant human tumor necrosis factor alpha (TNF-α, R&D Systems, Minneapolis, MN) at 20 ng/ml was added into each corresponding well and incubated for 6 hrs. C3a or C5a (R&D 50  Systems) at 5µg/ml was used to incubate with cell culture for 24 hrs. After incubation, the resulting supernatants or the cell lysate were collected, centrifuged and stored at -80°C for suspension assay or for RT-PCR.  4.2.5 Immunohistochemistry The immunohistochemical procedures used in this study followed those previously described.48, 60 In brief, formalin-fixed paraffin-embedded sections were deparaffinized and rehydrated by standard procedures. After heat-induced antigen retrieval in citrate buffer (pH 6.0) for 20 min, sections were blocked with 0.3% H2O2 for 15 min and 3% normal horse serum for 40 min. Antibody against human CD68 (1:50, clone PG-M1, Dako, Burlington, Canada) was applied as primary antibody at 4˚C overnight. Primary antibody omission and non-immune isotype antibodies were used as negative controls. Sections were then incubated in appropriate secondary antibody and developed in ABC–AEC system (Vector Labs, Burlingame, CA). The nuclei were counterstained with Mayer’s hematoxylin (Sigma Aldrich). The CD68 positive cells were assessed in the choroid and neuroretina using the 40x objective lens (Eclipse 80i; Nikon, Tokyo, Japan). Only the CD68 positive cells in the choroidal stroma were scored while those in vessel lumens were ignored. The immunoreactive cell numbers in the choroid were counted and then normalized to an area of 0.1mm2. The numbers of CD68 immunoreactive cells were compared between the at-risk CC genotype eyes and the normal TT genotyped eyes.  4.2.6 Statistical analysis The results were described as frequency (percent) for categorical variables and mean (standard error of the mean [SEM]) for continuous variables. The one-way analysis of variance (ANOVA) 51  and post hoc Bonferroni multiple comparison test were used to determine whether the vitreous GM-CSF level, the CD68 immunoreactive cell numbers, the age of donors, the collection time differ among those with the at-risk CC variant, the heterozygous CT variant and those with the protective TT variant. The Chi-square test was conducted to see if there is a relationship between the genotypes and the sex of donors. The Student’s t test was used to assess whether the GM-CSF level derived from primary RPE culture changed after exposure to HNE, TNF-α, C3a and C5a stimulation. The association between the vitreous GM-CSF level and the collection time was assessed using Pearson correlation. All analyses were conducted with GraphPad Prism 5.0 (GraphPad Software, Inc., La Jolla, CA). Statistical significance in this study was set at p < 0.05.  4.3 Results  4.3.1 GM-CSF is elevated in the vitreous of eyes with the at-risk homozygous CC variant in CFH Table 4.1 outlines the characteristics of the postmortem donor eyes used in this study. Briefly, all eye specimens were free of ocular diseases. The mean age of the sample population was 58.5 ± 3.3 years old and the mean length of time between death and donor eye harvest was 14.3 ± 1.1 hrs. Ten donors were female and 12 were male. When categorized by CFH Y402H SNP, 4 donors had the at-risk CC variant, 10 had the CT variant, and 8 had the protective TT variant.   To determine whether the GM-CSF level differs among CFH Y402H variants, we compared the levels of GM-CSF in the vitreous among eyes with the at-risk homozygous CC variant, those with the heterozygous CT variant and those with the TT variant. The level of GM-CSF was 52  significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (One-way ANOVA, p < 0.01, Table 4.2). The GM-CSF level was significantly higher in the vitreous obtained from the donors with CC (N = 4, 607.54 ± 85.83 pg/mL) or CT (N = 10, 656.32 ± 15.20 pg/mL) variants, compared to that obtained from donors with the TT variant, respectively (N = 8, 286.69 ± 81.96 pg/mL, post hoc Bonferroni multiple comparison test, p < 0.05, Figure 4.1). The vitreous level of GM-CSF was 2.12 and 2.29 times higher in donors with CC or CT variants than those with the TT variants, respectively. This finding is independent of age of donor, sex of donor, and collection time (Table 4.2). 53  Sample Characteristics Mean (SEM) or N (%) Age (years) 58.5 (3.3) Collection time (hrs) 14.3 (1.1) Gender   Male 12 (54.5) Female 10 (45.5) CFH Y402H genotype   CC 4 (18.2%) CT 10 (45.5%) TT 8 (36.3%) CFH = complement factor H; SEM = standard error of the mean; N= sample size  Table 4.1 Characteristics of postmortem human donor eyes    CFH Y402H Polymorphism P value  CC  CT  TT  Mean SEM  Mean SEM  Mean SEM GM-CSF (pg/mL) 607.54 85.83  656.32 15.20  286.69 81.96 0.0003 Age (years) 60.25 6.84  58.90 4.48  62.50 4.22 0.8505 Collection time (hrs) 14.50 1.76  16.56 1.58  11.50 2.04 0.1487  Table 4.2 Descriptive statistics and analysis of covariance results for vitreous granulocyte macrophage colony-stimulating factor (GM-CSF), age and collection time stratified by different genotypes of the complement factor H (CFH) Y402H polymorphism 54   Figure 4.1 The increased granulocyte macrophage colony-stimulating factor (GM-CSF) in vitreous was associated with the at risk variants of complement factor H (CFH) Y402H polymorphism The level of GM-CSF was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (One-way ANOVA, p < 0.01). The GM-CSF level was significantly higher in the vitreous from the donors with CC and CT variants compared to that of the donors with the protective TT variant (mean ± SEM, 607.54 ± 85.83 pg/mL, N = 4, 656.32 ± 15.20 pg/mL, N = 10 versus 286.69 ± 81.96 pg/mL, N = 8, respectively, post hoc Bonferroni's multiple comparison test, *p < 0.05).55  4.3.2 Macrophages are increased in eyes with the at-risk homozygous CC variant in CFH GM-CSF is a growth factor that activates monocyte-derived cells such as macrophages and microglia.148, 158  Given that higher levels of GM-CSF were found in the vitreous of eyes with the CC variant, we hypothesized that there would be greater numbers of these immune cells in the eye of the at-risk CC variant compared to those with the protective TT variant. To examine the level of microglia and macrophages, postmortem human eye sections were immunoreacted with an antibody that binds CD68, a known marker for the monocyte lineage.159, 160 Our data revealed significantly more CD68-immunoreactive cells in the choroid of the CC eyes (3.44 ± 0.77 per 0.1mm2, N =4) compared to TT eyes (1.12 ± 0.20 per 0.1mm2, N=6, one-way ANOVA and post hoc Bonferroni multiple comparison test, p < 0.05, Figure 4.2).  4.3.3 Stimulation of RPE with C3a and C5a promotes upregulation of GM-CSF in vitro The RPE in the outer retina produce and secrete GM-CSF.161 In addition, previous literature suggests that the level of complement activation is elevated not only systemically, but also locally, in the outer retina of donors genotyped with the at-risk CC variant in CFH.42, 49 Therefore, we investigated the GM-CSF expression by human ARPE-19 cell stimulated with complement activation products, C3a and C5a. The expression of GM-CSF was upregulated 2.38 and 2.84 fold by C3a and C5a at 5µg/ml after 24-hour incubation, respectively (C3a: N=3, 2.38 ± 0.31 fold, p < 0.05; C5a: N=3, 2.84 ± 0.54 fold, p < 0.01, Student t test, Figure 4.3).  4.3.4 Stimulation of RPE with HNE and TNF-α promotes secretion of GM-CSF in vitro Apart from complement activation products, C3a and C5a, higher levels of oxidative stress and proinflammatory cytokines were also associated with CFH polymorphism.146, 147 Therefore, we 56  also investigated whether HNE, an agent that promotes oxidative stress and TNF-α, a pro-inflammatory cytokine may affect the secretion of GM-CSF by RPE. Ten µM HNE and 20 ng/ml TNF-α were used to stimulate primary RPE in vitro, and the level of GM-CSF secreted by RPE into the culture supernatant after 6-hour stimulation was measured. The mean levels of GM-CSF secreted by RPE in the HNE treatment, the TNF-α treatment and the control group were 145.88 ± 5.06 pg/mL, 149.32 ± 3.76 pg/mL and 123.27 ± 4.05 pg/mL, respectively (N=3).  The levels of GM-CSF secreted by HNE- or TNF-α-stimulated RPE were higher compared to that of the control group, representing an 18% and 20% increase, respectively (both p < 0.05, Figure 4.4).57   Figure 4.2 The increased number of macrophages in choroid was associated with the at-risk variants of complement factor H (CFH) Y402H polymorphism The macrophages in postmortem human eye sections were immunoreacted with CD68, a known marker for macrophages. The immunoreactivity for CD68 was developed with AEC (red) and counterstained with Mayer’s hematoxylin (blue; scale bar: 20 μm). A: Representative picture of CD68 immunoreactivity in the outer retina from a donor eye with the at-risk CC variant. B: Representative picture of CD68 immunoreactivity from a donor eye with the heterozygous CT variant. C: Representative picture of CD68 immunoreactivity from a donor eye with the protective TT variant. D: Negative control by primary antibody omission. E: The number of CD68 positive cell per 0.1mm2 choroid area was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (mean ± SEM, one-way ANOVA, p < 0.05). There are more CD68 immunoreactive cells in the choroid of the CC eyes (3.44 ± 0.77 per 0.1mm2, N=4) compared to TT eyes (1.12 ± 0.20 per 0.1mm2, N = 6) post hoc Bonferroni's multiple comparison test, *p < 0.05). 58   Figure 4.3 Stimulation with complement activation products upregulated the expression of granulocyte macrophage colony-stimulating factor (GM-CSF) in retinal pigment epithelium (RPE) The expression of GM-CSF in ARPE-19 cell was upregulated 2.84 and 2.38 fold by C5a and C3a at 5µg/mL after 24-hour incubation, respectively (C5a: mean ± SEM, 2.84 ± 0.54 fold, N =3, Student’s t test, **p < 0.01; C3a: 2.38 ± 0.31 fold, N=3, Student’s t test, *p < 0.05).   Figure 4.4 Retinal pigment epithelium (RPE) secreted higher levels of granulocyte macrophage colony-stimulating factor (GM-CSF) after stimulation with 4-hydroxynonenal (HNE) and tumor necrosis factor (TNF)-α The GM-CSF secreted into the culture supernatant was increased when primary RPE cells were exposed to HNE, an agent that promotes oxidative stress, at 10 µM for 6 hours (mean ± SEM, 145.88 ± 5.06 pg/mL versus 123.27 ± 4.05 pg/mL, N=3, Student’s t test, *p < 0.05).  In addition, RPE cells stimulated with 20 ng/mL TNF-α for 6 hours also resulted in increased levels of GM-CSF secreted into the culture supernatant (149.32 ± 3.76 pg/mL versus 123.27 ± 4.05 pg/mL, N=3, Student’s t test, *p < 0.05).59  4.4 Discussion In this study we showed that an elevated level of GM-CSF in the vitreous is associated with the at-risk variant of CFH Y402H polymorphism in postmortem human eyes. Several previous studies suggested that the CFH Y402H SNP is associated with a state of inflammation characterized by increased pro-inflammatory molecules systemically in the circulation and locally in eye tissue.42, 43, 102, 146 Our findings are consistent with this idea, and extend the findings to include vitreous, an important compartment of the eye. GM-CSF is known to promote the survival and activation of phagocytes, such as macrophages and microglia.153, 154 Our results also demonstrated more CD68 positive cells in eye tissues from donors with the at-risk CC variant. It is possible that the higher levels of GM-CSF may promote or support these immune cells in the local retinal tissues of eyes genotyped with the at-risk CC variant in the CFH gene.   While we observed immunoreactivity for CD68 in the choroid, immunoreactivity was at background levels in the neuroretina and subretinal space, compartments that also contain microglia/macrophages.  It is possible that the accumulation of subretinal macrophages and neuroretina microglia is not a characteristic of normal human eyes, as studied here, but rather one of diseased eyes.162, 163  The change of choroidal macrophage seen in our study is consistent with the trend shown in the transgenic mice with the human at-risk CC variant.152  The relationship between vitreal GM-CSF and CFH Y402H polymorphism reported here supports the association between ocular proinflammatory mechanisms and CFH genotype in the human postmortem eye. A limitation of this study is the relatively small sample size of genotyped tissues. Nevertheless, the in vitro stimulation results support our proposed hypotheses 60  that GM-CSF synthesis is regulated in RPE.  We demonstrated an upregulation of the GM-CSF gene in RPE after stimulation with complement activation products, C3a and C5a. A non-polarized RPE cell model was used in this study, which might be of some limitation. Future studies using a polarized RPE culture model would be important to confirm and extend the findings of this study. Earlier studies showed that the CFH Y402H polymorphism is associated with an increased level of complement activation, and accordingly, its activation products in the eye.42, 45, 49, 164 Increased transcription of GM-CSF in RPE stimulated by activation products, C3a and C5a, reported here and by others, suggests a possible mechanism by which levels of GM-CSF are elevated in eyes with the at-risk CC variant.165 However, as our results are from normal, non-diseased eye tissues, future studies on genotyped AMD eyes are needed to extend these findings to the AMD eye.  Earlier studies have shown that the levels of complement activation products in blood were especially higher in AMD cases compared to controls with the same genotype.49, 51, 81, 166, 167  In addition, the secretion of GM-CSF was also elevated in RPE cells when stimulated by the cytokine, TNF-α and by pro-oxidant, HNE. Given that the CC at-risk variant in the CFH gene was shown to promote oxidative stress and heighten cytokine levels these factors may represent candidate mechanisms that underlie the elevated vitreal GM-CSF and choroidal macrophages seen in eyes with the CC at-risk variant in this study.146, 147  4.5 Conclusion To our knowledge, this is the first study to report increased levels of GM-CSF in the vitreous and macrophages in the choroid of human donor eyes in association with the at-risk CC variant in the CFH Y402H SNP. Our results suggest that the polymorphism in the CFH gene, a known genetic risk factor for AMD, may contribute to the disease process through mechanisms that increase 61  GM-CSF, a hematopoietic cytokine that promotes activation of macrophages and microglia. Further studies are required to evaluate the novel role of this cytokine in the development of chronic inflammatory retinal diseases such as AMD.  62  Chapter 5: CFH Y402H polymorphism and the complement activation product C5a: effects on NF-κB activation and inflammasome gene regulation  5.1 Introduction Age-related macular degeneration (AMD) is a common neurodegenerative disease of the eye that can lead to irreversible central blindness among the elderly.8 Chronic inflammation is thought to play a central role in AMD development and progression to late-stage disease. One of the most salient, supportive examples is the association between AMD and the single nucleotide polymorphism Y402H (rs1061170, sequence: T1277C) in the gene coding complement factor H (CFH). Studies suggest that individuals with the homozygous at-risk CC variant of this polymorphism have an increased risk for AMD incidence, and probably progression, compared to those with the protective TT variant.32, 36  The mechanism by which the at-risk variant confers an increased risk for AMD is still unclear. Our earlier study, and those of others, reported that the at-risk variant is associated with the elevated levels of complement activation products and classic pro-inflammatory cytokines systemically, in the blood of AMD patients.145, 168 The extent to which systemic levels of cytokines and complement proteins may affect the local retinal tissues is important to understanding AMD pathologies, particularly in light of a recent finding that there is an increase of membrane attack complex (MAC), the terminal end product of complement pathway in the choroidal tissues from donors with the at-risk variant.42 To further understand the role of the 63  complement cascade in AMD, we assessed the complement activation products and classic pro-inflammatory cytokines in eye tissues genotyped for CFH Y402H polymorphism.  Complement activation products, C3a and C5a, are anaphylatoxins and mediate the expression of many inflammatory cytokines, including those associated with NF-κB pathway, a master switch for cytokine production.165, 169 The NF-κB pathway mediates the expression of classic inflammatory cytokines (IL-6, IL-8) and those associated with the activation of the NLRP3 inflammasome (IL-1β, IL-18), which play important roles in AMD pathology.170, 171 The relationship between C3a, C5a and NF-κB activation is unclear in the retinal pigment epithelium (RPE), a cell that is in close proximity to the choroidal circulation in outer retina. Thus, in order to further understand the cellular mechanisms associated with complement cascade and cytokine secretion we also assessed whether complement activation products promoted NF-κB activation in RPE in vitro.  5.2 Methods  5.2.1 Human eye tissues and CFH Y402H genotyping  This study was approved by the Clinical Ethics Research Board of the University of British Columbia (UBC) and strictly adhered to the Declaration of Helsinki. Twenty pairs of non-diseased donor eyes, consented for research, were obtained from the Eye Bank of British Columbia (Vancouver, BC, Canada). Donors with the following pathologies were excluded in this study: local or systemic infection, progressive brain pathologies, systemic diseases of unknown origin, lymphoproliferative or myeloproliferative disorders, or any intrinsic eye 64  disease. The right globes were fixed and paraffin-embedded to obtain 6µm sections for immunohistochemistry. The left eyes were flash frozen, and the neuroretinal tissues used for CFH Y402H genotyping, as previously published.86   Eyes with geographic atrophy (GA) or choroidal neovascularization (CNV) were obtained from the Department of Pathology, UBC. Multiple sections prepared as above, through the macular area were stained by hematoxylin and eosin and then screened to determine the ocular pathologies. In total, 7 eyes with GA and 6 eyes with CNV were included in this study.  5.2.2 Immunohistochemistry The immunohistochemical procedures and analysis followed those previously described.172 Briefly, sections were probed with primary antibodies against molecules of interest (Supplementary table 5.1), followed by secondary antibodies and developed in ABC–AEC system (Vector Labs, Burlingame, CA). The immunoreactive RPE cells were counted and normalized to 1050μm length BM.  The immunoreactivity intensity in BM and choroid was scored semi-quantitatively with a score of 0 indicating background levels of labeling as determined by comparison with the negative control sections. The most intense immunoreactivity was classified as a score of 3. For intermediate intensity levels, a score of 1 was given to samples with the weakest labeling, while a score of 2 represented intermediate labeling. The immunoreactivity was compared among the at-risk CC, CT and the protective TT genotyped eyes.  65  5.2.3 In vitro RPE stimulation ARPE-19 and ARPE19/NF-κB-luciferase reporter cells were grown on Transwell inserts.  ARPE19/NF-κB luciferase reporter cell line was established as previously described.172 Briefly, approximately 1.6×105/cm2 cells were seeded in a laminin-coated Transwell insert (0.4μm pore size, 12mm diameter, Fisher Scientific, Ottawa, ON, Canada) in 0.5mL DMEM/F12 medium (Life Technologies, Burlington, ON) containing 10%fetal bovine serum (FBS), 100U/mL penicillin and 100μg/mL streptomycin (Fisher Scientific). After overnight incubation, medium was changed to 1%FBS. Cells were maintained for at least 4 weeks before stimulation.173, 174 The transepithelial resistance (TER) of ARPE-19 or ARPE19/NF-κB-luciferase reporter cells was 24.4±4.03Ω·cm2 and demonstrated an immunofluorescence pattern of tight junctional protein, ZO-1 (Supplementary figure 5.1). After washing the cells, 5µg/mL recombinant human complement C3a or C5a (R&D Systems, Minneapolis, MN), or 20ng/mL recombinant human tumor necrosis factor alpha (TNF-α, R&D Systems) was introduced to the basal compartment of the Transwell inserts for 12 hours (hrs). Cell lysates were then collected for RT-PCR.  5.2.4 Reverse transcription PCR Expression of selected genes was assessed by reverse transcription polymerase chain reaction (RT-PCR), using primers listed in Supplementary table 5.2.172  A 7500 Fast SDS (Applied Biosystems, Carlsbad, CA) set with the following cycling conditions: 95°C for 30 sec, 50°C for 30sec, 72°C for 45 sec, 45 cycles was used for RT-PCR, followed by melting curve analysis. The results were expressed in mRNA fold change normalized to the housekeeping gene, glyceraldehydes-3-phosphate dehydrogenase (GAPDH), using the 2−ΔΔCT method. The ΔCT values from stimulation and control groups were subjected to statistical analysis. 66   5.2.5 Statistical analysis The Kruskal-Wallis and post hoc Dunn's multiple comparison tests were used to determine immunoreactivity intensity differences among groups. The Student’s t test was used to assess gene expression changes after exposure to C5a and TNF-α in vitro. One-way analysis of variance (ANOVA) and post hoc Bonferroni’s multiple comparison tests were used to assess RPE labeling among eyes with GA, CNV and age-matched controls. The significance was set at p < 0.05 using GraphPad Prism 5.0 (GraphPad Prism 5 Software, La Jolla, CA).  5.3 Results  5.3.1 Complement activation products are greater in outer retina of eyes with the at-risk variant in CFH gene To determine whether there is increased complement activation in the outer retina associated with the risk variant of the CFH Y402H polymorphism, we compared the immunoreactivity levels of C3a and C5a, both activation products of the complement cascade, among eyes with the at-risk homozygous CC, the heterozygous CT, and the protective TT variant. Of the 20 pairs of eyes used in this study, 5 pairs of eyes were CC, 9 were CT, and 6 were TT. Nine were from female donors and 11 were from male donors.  The mean age of the sample population was 59.1±3.7 years old (Mean±standard error of the mean [SEM]) and the time delay between death and eye harvest was 14.4±1.2 hrs. There is no significant difference in age, time delay and sex among eyes with various genotypes (One way ANOVA and Chi square, p >0.05)   67  The level of C5a was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (Kruskal Wallis test, p < 0.05). The level of C5a in BM and choroid was increased in eyes with the at-risk CC variant compared to those with the protective TT variant (post hoc Dunn’s test, p <0.05, Figure 5.1). We found a similar trend for the C3a immunoreactivity among eyes with the CC, CT or TT variant; however, this did not reach significance (Supplementary figure 5.2).68   Figure 5.1 Increased complement C5a immunoreactivity in the Bruch’s membrane (BM)–choroid (Ch) complex is associated with the at-risk CC variant of the complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes A: The level of C5a was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (mean ± SEM, Kruskal Wallis test, p < 0.05). The immunoreactivity was higher in the BM and choroid of the CC eyes compared to TT eyes (post hoc Dunn’s test, *p < 0.05). B-D: The immunoreactivity for C5a was developed with AEC (red) and counterstained with Mayer’s hematoxylin (blue). Representative images of C5a immunoreactivity in the outer retina from a donor eye with the at-risk CC variant (B), the heterozygous CT variant (C) and the protective TT variant (D). Primary antibody omission and non-immune isotype antibodies were used as negative controls (E). Scale bar: 20 μm.69  5.3.2 Selected cytokines are highly expressed in outer retina of eyes with the at-risk variant in CFH gene Previously, we reported that several cytokines were increased in the blood of dry AMD patients with the at-risk CC variant compared to those with the CT or TT variant.168 In this study, we were interested in knowing whether the pro-inflammatory milieu, observed systemically in blood, also extended to include the local retinal tissues.  Our results revealed a significant increase in IL-18 immunoreactivity in BM and choroid in tissues from CC compared with TT eyes (Kruskal Wallis test and post hoc Dunn’s test, p < 0.05, Figure 5.2A-D).  Additionally, TNF-α immunoreactivity was also significantly higher in the choroid of CC donor eyes (Kruskal Wallis test and post hoc Dunn’s test, p < 0.05, Figure 5.3A-D).  The immunoreactivity level for IL-18 and TNF-α in CT eyes were either similar to TT, or intermediate between CC and TT eyes. 70   Figure 5.2 Increased interleukin (IL)-18 in the Bruch’s membrane (BM)–choroid (Ch) is associated with the at-risk CC variant of complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes A: The IL-18 immunoreactivity in BM and choroid (Ch) was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (mean ± SEM, Kruskal Wallis test, p < 0.05). The immunoreactivity was higher in the BM and choroid of the CC eyes compared to TT eyes (post hoc Dunn’s test, *p < 0.05). B-D: Representative picture of IL-18 immunoreactivity in the outer retina from a donor eye with the at-risk CC variant (B), the heterozygous CT variant (C) and the protective TT variant (D). The immunoreactivity for IL-18 was developed with AEC (red) and counterstained with Mayer’s hematoxylin (blue). Scale bar: 20 μm.20μm 71   Figure 5.3 Increased tumor necrosis factor (TNF)-α in the Bruch’s membrane (BM)–choroid (Ch) is associated with the at-risk CC variant of complement factor H (CFH) Y402H polymorphism in non-diseased postmortem eyes A: TNF-α immunoreactivity in choroid (Ch) was significantly different among donors with CC, CT, or TT variants of the CFH Y402H polymorphism (mean ± SEM, Kruskal Wallis test, p < 0.05). The immunoreactivity was higher in the choroid of the CC eyes compared to CT eyes (post hoc Dunn’s test, *p < 0.05). B-D: Representative picture of TNF-α immunoreactivity in the outer retina from a donor eye with the at-risk CC variant (B), the heterozygous CT variant (C), and the protective TT variant (D). The immunoreactivity for TNF-α was developed with AEC (red) and counterstained with Mayer’s hematoxylin (blue). Scale bar: 20 μm.72  5.3.3 Activation of the NF-κB pathway by pro-inflammatory mediators in RPE in vitro Next, we investigated the effects of complement activation product, C5a, and cytokine TNF-α, on ARPE19/NF-κB-luciferase reporter cells in polarized cultures. Basolateral stimulation with C5a (5µg/ml) induced a 1.5-fold increase in NF-κB activation in ARPE19 reporter cells, while TNF-α (20ng/mL) induced a 3.7-fold increase in NF-κB activation (N=3, Student’s t test, p < 0.05, Figure 5.4). The response pattern from polarized ARPE-19 was similar to that from a non-polarized culture, but the magnitude of change was less. For example, in the non-polarized system, C5a stimulation induced a 4.6-fold increase in NF-κB activation, while TNF-α induced a 30-fold increase (N=3, Student’s t test, p < 0.01, Supplementary figure 5.3). These responses demonstrate that C5a or TNF-α activates the NF-κB pathway in the ARPE-19 cell.   The NF-κB pathway mediates the expression of many cytokines, including classic ones such as IL-6, IL-8 as well as inflammasome genes.171 Therefore, we assessed the gene expression levels of NF-κB responsive genes in ARPE-19 polarized cells. TNF-α stimulation caused upregulation of caspase-1 (~4 fold), IL-1β (~21 fold), IL-6 (~2 fold), IL-8 (~114 fold), IL-18 (~3 fold), while it downregulated NLRP3 (~2 fold) at 12 hrs. Interestingly, C5a stimulation resulted in only upregulation of IL-18 (~3 fold, N=3, Student’s t test, p < 0.05, Figure 5.5). The polarized cell culture did not demonstrate upregulation of IL-6 or IL-8 by C5a, while upregulation of these two cytokines was evident in the non-polarized ARPE-19 cell (IL-6 ~1.5 fold; IL-8 ~5 fold, Supplementary figure 5.3)73   Figure 5.4 Complement C5a and tumor necrosis factor (TNF)-α induced nuclear factor (NF)-κB pathway activation in polarized ARPE19/NF-κB luciferase reporter cells C5a stimulation at 5 µg/ml induced NF-κB activation in ARPE19 reporter cells, while TNF-α stimulation at 10 or 20 ng/ml induced NF-κB activation (N=3, Student’s t test, **p < 0.01, *p<0.05).   Figure 5.5 Complement C5a or tumor necrosis factor (TNF)-α upregulated nuclear factor (NF)-κB-responsive genes in polarized ARPE-19 cells TNF-α (20 ng/ml, 12 hrs) upregulated the inflammasome genes caspase-1, IL-1β, IL-18 as well as pro-inflammatory genes IL-6, IL-8, but downregulated NLRP3. C5a (5 µg/ml, 12 hrs) upregulated IL-18. N=3, Student’s t test, **p<0.01, *p<0.05.74  5.3.4 Inflammasome products, IL-1β and IL-18, are increased in RPE of GA eyes Our earlier work, and those of others, suggest that inflammasome activation is involved in the pathophysiology of AMD.171, 175, 176 To further support this idea, we assessed the expression of inflammasome activation products IL-1β and IL-18 in AMD eyes and compared with age matched control eyes.  The levels of both IL-1β and IL-18 were significantly higher in the RPE layer of GA eyes compared to controls (One-way ANOVA and post hoc Bonferroni’s test, p < 0.05, Figure 5.6). Immunoreactivity in CNV eyes did not reach significance for either IL-1β or IL-18, but an increased trend compared to controls was observed (p > 0.05, Figure 5.6). Immunoreactivity in BM and choroid of GA and CNV eyes did not differ from age-matched control eyes (Figure 5.6A, E). 75   Figure 5.6 Increased interleukin (IL)-1β and IL-18 immunoreactivity in retinal pigment epithelial (RPE) cells in eyes with geographic atrophy (GA) A: Eyes with GA (N=7) demonstrated more IL-1β positive RPE cells than age-matched control eyes (N=5, one-way ANOVA and post hoc Bonferroni’s test, *p<0.05). The IL-1β immunoreactivity in the Bruch’s membrane (BM)–choroid (Ch) complex did not differ among three groups (Kruskal Wallis test, p>0.05). Immunoreactivity in eyes with choroidal neovascularization (CNV, N=6) did not differ from age-matched control (Ctrl) eyes. B-D: Representative pictures for IL-1β immunoreactivity (AEC, red) from the central retina counterstained with Mayer’s hematoxylin (blue; scale bar: 20 μm). E: Eyes with GA (N=7) had more IL-18 positive RPE cells than age-matched control eyes (N=5, one-way ANOVA and post hoc Bonferroni’s test, *p<0.05). The eyes with CNV (N=6), while demonstrating a similar trend, did not reach significance. The IL-18 immunoreactivity in the BM – Ch complex did not differ among three groups (Kruskal Wallis test, p>0.05). F-H: Representative pictures for IL-18 immunoreactivity (AEC, red) from the central retina counterstained with Mayer’s hematoxylin (blue, scale bar: 20 μm). IL-18 reactivity was found in RPE (arrowhead) from the Ctrl (F), as well as GA (G) and CNV (H) eyes. 76  5.4 Discussion  5.4.1 Complement activation product, C5a, is associated with the at-risk variant in the CFH gene and promotes inflammasome activation product IL-18 Here we showed that an elevated level of C5a in BM and choroid of the postmortem donor eye is associated with the at-risk homozygous variant of the CFH gene. This finding is consistent with a previous report demonstrating an association with the CFH at-risk variant and an elevated level of MAC, the terminal product of the complement cascade, in the choroid of postmortem donor eyes.42 The immunoreactivity level for C5a in CT eyes was intermediate between CC and TT eyes, but did not reach significance. This finding suggests that C5a may act synergistically with other factors to promote AMD, given that the heterozygous CT variant, like the homozygous CC variant also confers risk for AMD, but with a lower odds ratio.32   Being juxtaposed to the choroid, the RPE cells are important gatekeepers associated with the exchange between the choroid and retina.  With C5a receptors present on RPE,177 it is of importance to understand the effects of C5a on RPE function.  We found that C5a stimulation activated the NF-κB pathway in RPE in vitro. The NF-κB pathway is known to mediate the translation of many pro-inflammatory mediators, including inflammasome products, and thereby contribute to the local pro-inflammatory status in outer retina.  Thus, we further studied the expression patterns of several inflammatory cytokines that are relevant to AMD.55, 82, 83 We found that IL-18 is upregulated by C5a in RPE in vitro. While previous studies reported the role of C5a in angiogenesis and inflammation by upregulating VEGF and ICAM-1 and suppressing TGF-β2,28, 178, 179 our finding that IL-18, an inflammasome product, is upregulated in RPE in 77  response to C5a is novel and supports the proposed relationship between complement cascade and inflammasome activation.  Interestingly, recent studies reported that IL-18 may induce RPE degeneration, thus suggesting another cellular mechanism whereby complement activation may promote RPE degeneration via inflammasome activation and IL-18 overexpression.175, 176   Our results demonstrated that the response to C5a may vary depending on the culture conditions. Stimulation of ARPE-19 with C5a in non-polarized cultures yielded significant upregulation of IL-18, IL-6 and IL-8, but only IL-18 in the polarized cells. Other studies reported similar findings with the non-polarized ARPE-19 culture.165  Similarly, TNF-α induced NF-κB activation in both culture systems, but was more robust in the non-polarized culture compared to the polarized culture method with basal stimulation.  The polarized cell culture, originally proposed in 2006,173, 174 has the advantage that cells can be stimulated from the basal or apical side, and thus may represent more physiological conditions. However, in our study, the non-polarized system did demonstrate a consistent, and more robust, trend in comparison with the polarized system, a finding that may in part be due to the resting state of the polarized cell cultures, which require over 4 weeks to mature.180  5.4.2 IL-18 and TNF-α immunoreactivity in outer retina is associated with the at-risk variant in the CFH gene We also observed increased immunoreactivity of TNF-α and IL-18 in the choroidal tissues from donors with the CFH at-risk variant.  These findings in outer retina support and extend our earlier finding of an association between systemic (plasma) levels of cytokines and the at-risk variant in the CFH gene and highlight the idea that individuals with the at-risk variant of CFH 78  gene may have a high pro-inflammatory status in the outer retina.168 Presently, we do not know whether C5a, TNF-α or IL-18 is derived from the blood circulation or from the retinal microenvironment including RPE, or both.  The subsequent elevation of caspase-1, IL-1β, and IL-18 associated with the CFH at-risk variant may predispose these eyes to further inflammation-induced stress.  In the AMD eye, we found IL-18 levels to be greater in GA compared to CNV and age-matched control eyes, supporting an involvement of IL-18 in GA.  The general expression of IL-18 in RPE cells is higher than that of IL-1β, which is consistent with the finding in RPE in vitro by Shi et al.181   5.5 Conclusion Our results suggest that CFH Y402H polymorphism, a known genetic risk factor for AMD, may contribute to the disease process through increased activation of the NF-κB pathways and upregulation of inflammasome genes.  Further work is needed to understand the exact role of complement and inflammasome activation in the development of chronic inflammatory retinal diseases such as AMD.  79  Chapter 6: Drusen component amyloid beta activates complement cascade and induces sublytic membrane attack complex formation  6.1 Introduction Age-related macular degeneration (AMD) is a major cause of blindness among the elderly in the industrialized countries.65 In the early stage of the disease, it is characterized by the accumulation of extracellular deposits, known as drusen, between the basal lamina of retinal pigment epithelium (RPE) and Bruch’s membrane (BM).  The late stage of AMD is characterized by RPE atrophy, photoreceptor loss and/or choroidal neovascularization leading to severe visual loss.6 The treatment to prevent the development, or to stop the progression, of AMD in early stage is not available since the cellular mechanism(s) underlying AMD is poorly understood. However, it is believed that the overdrive of complement cascade may play a central role in the disease process.45 Evidence in favor of abnormal complement activation includes the presence of complement-related proteins or complement activation products in the drusen and the association between AMD and numerous genetic variants related to complement proteins such as complement factor H (CFH), complement factor B (CFB), C3.22-26, 32-35, 182, 183  Recent studies have revealed that the terminal complement activation product – membrane attack complex (MAC) can induce many physiological changes in RPE, including secretion of inflammatory cytokines and vascular endothelial growth factor (VEGF), endoplasmic reticulum (ER) stress-mediated lipid accumulation and intracellular calcium increase.184-187 The deposition of MAC was associated with multiple risk factors for AMD, including CFH Y402H 80  polymorphism, aging, oxidative stress and drusen.24, 42, 47, 48 Previous reports defined the causal relationship of oxidative stress and MAC formation in RPE, but little has been reported about a specific drusen component as a trigger of complement activation and MAC formation.186, 188-190  Previous immunohistochemical studies reported the colocalization of amyloid beta (Aβ) and complement activation product iC3 in the drusen. Our in vivo data demonstrated that drusen component Aβ and MAC concomitantly accumulate in the outer retina of aged rodents,27, 191 and thus we hypothesize that drusen component Aβ may promote complement cascade, leading to MAC formation in RPE. In this study, we established the causal relationship of drusen component Aβ and MAC in vitro and identified the specific pathways by which Aβ induces MAC formation in RPE. Furthmore, we explored the effect of aurin tricarboxylic acid complex (ATAC), a small molecule MAC inhibitor, in our Aβ-complement activation model.192, 193   6.2 Methods  6.2.1 RPE stimulation ARPE-19 cells (American Type Culture Collection, Manassas, VA) were cultured in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12; Fisher Scientific, Ottawa, ON, Canada) containing 10% heat-inactivated fetal bovine serum (FBS; Fisher Scientific), penicillin (100 U/mL, Fisher Scientific) and streptomycin (100 µg/mL, Fisher Scientific). Stimulation experiments were conducted on RPE cell cultures at confluence. The cells were washed twice with DMEM/F12 and then treated with stimuli-contained DMEM/F12. The reagents used to stimulate RPE include 0.3uM Aβ, 10% normal human serum (NHS), heat-inactivated (56°C, 30min) NHS, C1q-depleted serum, CFB-depleted serum, C7-depleted serum (CompTech, Tyler, 81  TX) and 40uM-1mM ATAC. After incubation, the cells undergo immunofluorescence for the detection of MAC formation and then were analyzed by confocal microscopy or flow cytometry.  6.2.2 Aβ preparation  The lyophilized, synthetic Aβ1–40 peptide in its HCl salt form was purchased from American Peptide (Sunnyvale, CA). We chose Aβ1–40 peptide over its structurally similar but more toxic, Alzheimer’s disease-specific, form of Aβ1–42 peptide based on earlier studies that demonstrated the presence of Aβ1–40 in drusen deposits in postmortem human eyes and its effects on complement genes in RPE cells in vitro.61, 194  Fibrillar Aβ1–40 was prepared according to published protocols.191, 195, 196 Briefly, the synthetic Aβ1–40 peptide was reconstituted in sterile distilled H2O and incubated at room temperature (RT) for 30 min, then evaporated by speed vacuum for 1.5 hrs resulting in a thin transparent Aβ1–40 peptide film. Aβ1–40 peptide film was reconstituted in 100 % dimethyl sulfoxide to a concentration of 1 mM, and further diluted and incubated for 1 week in Tris-buffered saline (TBS; 20mM Tris-HCl, 100mM NaCl, pH7.4, 37°C) to produce the Aβ1–40 stock solution of 100 μM. The resulting product was tested in Western blot to confirm the high fibrillar and low oligomeric contents.  6.2.3 Reverse transcription PCR and Western blot The gene expression of complement regulators was assessed by reverse transcription polymerase chain reaction (RT-PCR), using primers listed in Supplementary table 6.1.172, 197  A 7500 Fast SDS (Applied Biosystems, Carlsbad, CA) set with the following cycling conditions: 95°C for 30 82  sec, 67°C for 30sec, 72°C for 45 sec, 45 cycles was used for RT-PCR, followed by melting curve analysis. The results were expressed in mRNA fold change normalized to the housekeeping gene, glyceraldehydes-3-phosphate dehydrogenase (GAPDH), using the 2−ΔΔCT method. The ΔCT values from stimulation and control groups were subjected to statistical analysis.  To detect the protein level of complement regulators, the RPE cells were homogenized in ice-cold RIPA buffer (Thermo Scientific, Waltham, MA) containing protease inhibitor cocktail (Roche Diagnostics). Blotting procedures followed our established protocol.172, 191 Twenty μg of total protein was mixed with equal volume of 2× loading buffer, and directly subjected to 5–12.5 % SDS-PAGE. Proteins were transferred to a PVDF membrane and incubated with a series of blocking buffers, primary antibody against CD55 (Bio-Rad AbD Serotec, Raleigh, NC), and HRP conjugated secondary antibody (R&D Systems, Minneapolis, MN). The enhanced chemiluminescence (ECL) method was used to detect the CD55 protein bands.  For GAPDH, the same membrane was incubated in stripping buffer and then re-probed with the GAPDH antibody (EMD Millipore, Billerica, MA). All protein bands were subsequently quantified using Image J (NIH, Bethesda MD), and then normalized into ratios relative to GAPDH for analysis.   6.2.4 Quantification of MAC MAC formation was detected by immunofluorescence and quantified as the percentage of RPE cells positive for MAC compared to the total number of cells. Briefly, for observation under confocal microscopy ARPE-19 cells, cultured and treated in Lab-TekTM II 8-Chamber SlideTM system (Fisher Scientific), were washed twice with PBS, and then fixed with 4% paraformaldehyde (PFA) for 20 minutes. Complement activation was detected by indirect 83  immunofluorescence (Cy3) for MAC (1:50, Clone aE11, Dako, Burlington, Ontario, Canada) and nuclei were counterstained by Hoechst 33342 (Fisher Scientific). The cells were prepared for flow cytometry analysis using the modified protocol based on the earlier publications.187, 198 Briefly, cells were detached with 1X TrypLETM Express (Fisher Scientific) and fixed in 0.5% PFA for 10 minutes at 37°C followed by cold incubation on ice for 1 minute. Cells were then blocked 1% bovine serum albumin (BSA, Sigma-Aldrich)/0.2%Saponin (Sigma-Aldrich)/PBS and incubated with primary anti-MAC antibody (Clone aE11, 1:25) at RT for 30 min. The cells were washed and then incubated with Alexa 647-conjungated goat anti-mouse antibody (1:600, Fisher Scientific) at RT for 30min. After wash, the cells were resuspended in 0.5% PFA for analysis with BD FACSCaliburTM platform. The experiments were done in triplicate or quadruplicate for each stimulation condition. The flow cytometric data were analyzed and the counts were retrieved by applying the same gates in all comparison groups of each experiment (Flowing Software version 2.5.1, University of Turku, Finland).  6.2.5 Lactate dehydrogenase assay Lactate dehydrogenase (LDH) assay was conducted to evaluate the cytotoxicity effect of specific stimulation in vitro as previously published.60 Briefly, the supernatant was collected after stimulation. The LDH concentration within the supernatant was measured with an LDH kit (Clontech Laboratories, Mountain View, CA). The kit coupled the LDH-catalyzed conversion of lactate to pyruvate to the reduction of tetrazolium (yellow) to formazan (red). A rise in the LDH due to membrane damage following cell death correlates to the amount of red formazan produced, which was detected with spectrophotometry (absorbance at 490nm). The readings 84  from cell-free culture supernatant were also obtained to normalize the supernatant-derived LDH. Experiments were done in quadruplicate or higher.  6.2.6 Statistical analysis The Student’s t test was used to assess gene and protein expression changes after exposure to Aβ in vitro. One-way analysis of variance (ANOVA) and post hoc Bonferroni tests were used to assess the difference in the percentage of MAC positive cells or the cytotoxicity amongst the treatment groups. Two-way ANOVA and post hoc Bonferroni tests were used when treatment and time point were both involved as independent factors in one experiment. The significance was set at p<0.05 using GraphPad Prism 5.0 (GraphPad Prism 5 Software, La Jolla, CA).  6.3 Results  6.3.1 Aβ downregulates CD55 in RPE cells The complement cascade is known to be regulated by several complement inhibitors and downregulation of expression of these complement inhibitors may promote the activation of complement pathway.44 To assess the effect of drusen component Aβ on the expression of the complement inhibitors expressed by RPE cells, RPE cells were stimulated with 0.3μM Aβ and the gene transcription of CD46, CD55, CD59, complement factor H (CFH), and complement factor I (CFI) was quantified by RT-PCR. Among these complement inhibitors, the transcriptional expression of CD55 was downregulated by 3.38 fold by Aβ at 0.3μM after 6 hours incubation, respectively (N=3, Mean±standard error of the mean [SEM]: 3.38±0.39 fold, Student’s t test p<0.01, Figure 6.1). The regulation of CD55 in protein level was confirmed by 85  Western blot. The stimulation with 0.3μM Aβ for 6 hours lowered the protein expression of CD55 in RPE by 2 fold (N=3, Aβ: 0.21±0.01 versus Ctrl: 0.43±0.10, p=0.06, Figure 6.1). 86   Figure 6.1 Amyloid beta (Aβ) downregulated CD55 expression in retinal pigment epithelial (RPE) cells A. Stimulation with 0.3μM Aβ for 6 hours downregulated the gene transcription of CD55 by 3.38 fold compared with the unstimulated control. (N=3, Mean±standard error of the mean [SEM]: 3.38±0.39 fold, Student’s t test, **p<0.01). B, C. Exposure to 0.3μM Aβ for 6 hours tended to lower the protein expression of CD55 by approximately 2 fold compared with the unstimulated control (N=3, p=0.06). B. The protein level of CD55 was tested by Western blot. C. The relative band intensities of CD55 were 0.21±0.01 in Aβ-treated group and 0.43±0.10 in unstimulated control (Ctrl) group. CFH: complement factor H. CFI: complement factor I.87  6.3.2 Aβ promotes complement activation and forms sublytic MAC on RPE cells Previous studies demonstrated by immunofluorescence that Aβ colocalizes with complement activation product iC3 in the drusen.27 With our results that Aβ downregulated complement inhibitor CD55, we further hypothesized that Aβ might drive complement cascade and form MAC on RPE cells. To assess the MAC formation on RPE cells, we incubated RPE cells with Aβ in the presence of normal human serum, which contains a full set of complement proteins for MAC formation. RPE cells were then subjected to immunofluorescence for MAC and observed under confocal microscopy. The level of MAC positive cells was higher in the group of NHS combined with Aβ, compared to that of NHS alone. There were no positive cells in the negative control groups, including the treatment groups of heat-inactivated (HI) NHS in the presence, or absence, of Aβ, Aβ alone or non-treated group. We further confirmed this observation with quantitative flow cytometry analysis. There was a significantly higher level of MAC positive cells in the treatment group with 10%NHS and  Aβ, compared to the treatment group with 10% NHS alone (p<0.01, one-way ANOVA and Bonferroni post test, Figure 6.2). The increase was consistently observed at three time points: 6, 12 and 24-hour incubation, with all three time points generating significant results (p<0.01, two-way ANOVA and post hoc Bonferroni test, Figure 6.2). To test whether Aβ-promoted MAC formation can cause cell death, we conducted lactate dehydrogenase (LDH) assays. The treatment of Aβ and NHS combined did not cause higher cytotoxicity than other groups, including untreated, Aβ alone, NHS alone, HI-NHS combined or not with Aβ (p>0.05, one-way ANOVA and Bonferroni post test, Figure 6.2). 88   Figure 6.2 Amyloid beta (Aβ) promotes complement activation and forms sublytic membrane attack complex (MAC) on retinal pigment epithelial (RPE) cells A-D. Representative images from immunofluorescence staining for MAC (Red) on RPE cells. There are more MAC positive cells in the treatment of (A) 0.3μM Aβ and 10% normal human serum (NHS) combined, compared to other groups, including (B) NHS alone, (C) Aβ combined with 10% heat-inactivated (HI)-NHS or (D) untreated. The nuclei were counterstained with DAPI (Blue). E. Representative flow cytometry histogram overlay of MAC Alexa 647 fluorescence in cells treated with Aβ and NHS combined and NHS alone. F. The measurement of MAC positive cells by flow cytometry. The percentage of MAC positive cells 89  was higher for cells exposed to Aβ and NHS combined, compared to those with NHS alone (N=3, one-way ANOVA and Bonferroni post test, **p<0.01). The increase was consistently observed at three time points: 6, 12 and 24-hour incubation and the magnitude is greater for 6 and 12 hours (N=3, two-way ANOVA and post hoc Bonferroni test, p<0.01). G. Cell death after exposure to Aβ and NHS combined measured by lactate dehydrogenase (LDH) assays. The treatment of Aβ and NHS combined did not cause a higher cytotoxicity than that observed for other groups, including untreated, Aβ alone, NHS alone, HI-NHS alone and HI-NHS combined with Aβ (N≥4, one-way ANOVA and Bonferroni post test,  p>0.05). 90  6.3.3 Aβ-promoted MAC formation is mainly via classical pathway To identify which complement pathway(s) is involved in Aβ-promoted MAC formation, sera depleted of pathway-specific components were used in place of normal human serum in the MAC formation assay demonstrated in Section 6.3.2. The percentage level of MAC positive cells in RPE cells treated with Aβ combined with C1q-depleted serum for 6 hours was significantly lower than that with Aβ combined NHS (N=4, Mean±SEM: 0.38±0.14 vs. 12.36±0.21, one-way ANOVA and Bonferroni post test, p<0.01), but not different from that treated with NHS alone (N=4, 0.38±0.14 vs. 0.98±0.24, one-way ANOVA and Bonferroni post test, p>0.05). Interestingly, the percentage of MAC positive cells in RPE cells treated with Aβ combined with CFB depleted serum for 6 hours was also significantly lower than that with Aβ combined NHS (N=4, 8.91±0.21 vs. 12.36±0.21, one-way ANOVA and Bonferroni post test, p<0.01), but was also significantly higher than that treated with NHS alone (N=4, 8.91±0.21 vs. 0.98±0.24, one-way ANOVA and Bonferroni post test, p<0.01). The serum depleted of C7, a component of MAC, reduced the positivity to the background level, which confirms the specificity of the antibody we used to detect MAC formation and thus validate these results. The finding was consistent in 6 hour and 12 hour time points (Figure 6.3). The serum depleted of C1q, a component essential for classical pathway abolished Aβ-promoted MAC, bringing the level down to that observed in absence of Aβ.  However, the serum depleted of CFB, a component essential to alternative pathway, only partially decreased the level of MAC positive cells, which suggests that Aβ-promoted MAC formation is mainly via the classical pathway and only partially via the alternative pathway. 91   Figure 6.3 Amyloid beta (Aβ)-promoted membrane attack complex (MAC) formation is mainly via classical pathway The percentage of MAC positive cells in RPE cells treated with Aβ combined with C1q-depleted (Dpl) serum for 6 hours was significantly lower than that with Aβ combined with NHS (N=4, Mean±SEM: 0.38±0.14 vs. 12.36±0.21, one-way ANOVA and Bonferroni post test, **p<0.01) and equivalent to treatment with NHS alone (N=4, 0.38±0.14 vs. 0.98±0.24, one-way ANOVA and Bonferroni post test, p>0.05). Interestingly, the percentage of MAC positive cells after treatment with Aβ combined with CFB depleted serum for 6 hours was also significantly lower than treatment with Aβ combined with NHS (N=4, 8.91±0.21 vs. 12.36±0.21, one-way ANOVA and Bonferroni post test, **p<0.01), but was also significantly higher than that treated with NHS alone (N=4, 8.91±0.21 vs. 0.98±0.24, one-way ANOVA and Bonferroni post test,**p<0.01). The C7-Dpl serum reduced the MAC positive cells to background levels as without C7, MAC formation cannot occur, and  thus confirms the specificity of the antibody we used to detect MAC formation and validate our result. The trend was similar at both time points tested.92  6.3.4 ATAC inhibits MAC formation on RPE cells To test the effect of ATAC on MAC formation in vitro, we incubated RPE cells with ATAC at  different concentrations along with combined Aβ and NHS. After 6 hour incubation, the percentage of MAC positive cells in RPE cells treated with 1mM ATAC was significantly lower than that with Aβ combined NHS (N=4, Mean±SEM: 1.76±0.18 vs. 11.88±0.37, one-way ANOVA and Bonferroni post test, p<0.01), while the level in RPE cells treated with 40μM or 200μM ATAC did not differ from that untreated, in presence of Aβ combined with NHS (N=4, 12.92±0.47 and 11.41±0.56 vs. 11.88±0.37, one-way ANOVA and Bonferroni post test, p>0.05, Figure 6.4A). To further confirm this finding, we investigated the inhibitory effect of ATAC at a 12 hour incubation, and found that ATAC can equally inhibit MAC formation at 12 hours (N=3, 1.62±0.07 vs. 6.82±0.18, one-way ANOVA and Bonferroni post test, p<0.01, Figure 6.4B). To assess the safety of ATAC, we examined the cytotoxicity of ATAC on RPE cells by lactate dehydrogenase (LDH) assays. The cytotoxicity in ARPE-19 cells did not differ across the groups, including ATAC alone, ATAC (600μM or 1mM) in presence of Aβ and NHS combined or non-stimulated (N≥4, one-way ANOVA and Bonferroni post test, p>0.05, Figure 6.4C). 93   Figure 6.4 Aurin tricarboxylic acid complex (ATAC) inhibits MAC formation on retinal pigment epithelial (RPE) cells A. At 6 hour time point, the percentage of  MAC positive cells treated with 1mM ATAC in presence of amyloid beta (Aβ) combined with NHS was significantly lower than that with Aβ combined NHS but without ATAC (N=4, Mean±SEM: 1.76±0.18 vs. 11.88±0.37, one-way ANOVA and Bonferroni post test, **p<0.01).  Lower dosages (40μM or 200μM ATAC) did not affect MAC deposition (N=4, 12.92±0.47 and 11.41±0.56 vs. 11.88±0.37, one-way ANOVA and Bonferroni post test, p>0.05). B. ATAC inhibited MAC formation at both 6 hours and 12 hours (N=3, 1.07±0.10 vs. 8.06±0.50 and 1.62±0.07 vs. 6.82±0.18, respectively, one-way ANOVA and Bonferroni post test, **p<0.01). C. The cytotoxicity in ARPE-19 cells measured by lactate dehydrogenase (LDH) assays did not differ across the groups, including ATAC alone, ATAC (600μM or 1mM) in presence of Aβ and NHS combined, or untreated (N≥4, one way-ANOVA and Bonferroni post test, p>0.05).94  6.4 Discussion In this study we showed that drusen component Aβ can promote complement activation and form sublytic MAC on RPE cells. This finding might explain why Aβ and complement activation product colocalized in drusen in the previous studies.27, 199 This is the first report that Aβ can drive the activation of complement cascade, leading to the formation of the terminal product MAC in RPE cells and it suggests that apart from oxidative stress reagents, drusen component Aβ could be another causal factor for complement activation and MAC deposition adjacent to RPE cells.186, 188-190  The MAC positivity in RPE cells was obtained by the staining process with permeabilizing cells with 0.2% saponin (data without permeabilization not shown), which suggested that the MAC may not only exist at the cell membrane but also at the intracellular level. It can be explained by the fact that RPE can remove the MAC from its surface via endocytosis.200 Interestingly, we also found that the MAC positivity in RPE cells decreased with the incubation time and may suggest that RPE cells may further eliminate intracellular MAC via activating ER stress and/or ubiquitin-proteasome system, which requires further investigation.186, 201  In the current study, to ensure the physiological relevance to the disease process we used Aβ of 0.3μM, a concentration that did not induce cytotoxicity in RPE cells (Figure 6.2) and was slightly higher than that reported in blood, based on the fact that the accumulation of Aβ in drusen is most likely from the blood. 202-206 Using the combination of Aβ with sera depleted of complement pathway-specific proteins, we were able to identify that Aβ activated complement cascade mainly through the classical complement pathway and partially via the alternative pathway. The possible mechanism underlying the classical pathway activation may be the 95  interaction between Aβ and the classical pathway initiators C1q, C1s or C4,207, 208 while Aβ-promoted alternative pathway activation may be due to its binding to CFI and inhibition of CFI to cleave C3b.209 Although it is known that Aβ activates complement cascade,209 our finding that Aβ promotes complement cascade to the terminal stage on RPE is original. It is possible that the Aβ-induced downregulation in the membrane bound complement inhibitor, CD55, may facilitate MAC formation in the presence of NHS on cells. Future work is required to further assess Aβ’s role in MAC formation on RPE.  Interestingly, cell lysis was not observed in RPE cells treated with Aβ and NHS. This result  might be associated with the effective elimination of MAC by RPE cells.210 This finding also corroborated the fact that the overall morphology was preserved in RPE overlying MAC contained drusen.27 However, Aβ-promoted MAC might execute changes in RPE physiology, such as dysregulating gene expression of inflammatory cytokines and growth factors, enhancing ER stress, inducing lipid accumulation and intracellular calcium increase, all of which require further assessment.184-187 It is known that the Y402H at-risk variant in the CFH gene is associated with greater MAC deposition in RPE-choroid compared to the protective variant and many oxidative stressors (such as all-trans retinal, A2E, H2O2 and oxidized low-density lipoprotein [LDL]) may mediate complement activation and MAC formation.42, 186, 188, 211 Thus, in individuals with the Y402H at risk variant in the CFH gene, concomitant exposure to drusen components, such as Aβ, may further exacerbate MAC formation leading to RPE dysfunction in outer retina.  96  Another interesting finding of our study relates to the efficacy of ATAC to inhibit MAC formation in RPE cells. Our previous studies, and others, showed that administration of ATAC inhibits MAC deposition in the aging rat retina or in the laser-induced neovascularization mouse model.191, 212 Here we provided evidence that ATAC can also inhibit MAC in human RPE cells in vitro. Previous studies have reported that ATAC may act both to hinder the formation of the C3 convertase and to block the addition of C9 to the C5b-8 complex and this may explain why the efficacy is consistent at different time points (Figure 6.4B).192, 193 In addition, we showed that the efficacy of ATAC is dependent on the dosage administered (Figure 6.4A) and the inhibitory dosage of ATAC did not affect the viability of RPE cells (Figure 6.4B). This result suggested that ATAC can be a relatively safe drug for local application, and due to its small molecular weight, it may cross the BM easily compared to most therapeutic antibodies against complement proteins and reach the interface between BM and RPE to inhibit MAC deposition in the sub-RPE deposits. 135, 192, 213  6.5 Conclusion Our results showed that the drusen component, Aβ, induced sublytic MAC formation in ARPE-19 cells, and it promotes this process mainly via the classical pathway. Aβ lowers the expression of complement inhibitor CD55, at the transcription and translation level, which likely further promotes MAC formation.  Combined with other risk factors, Aβ may have a synergistic effect to activate complement and exacerbate MAC formation leading to RPE dysfunction in outer retina. Further studies will be conducted to understand the effects of MAC deposition on RPE injury, during the early stages of dry AMD.97  Chapter 7: Conclusion  7.1 Significance and Strengths  7.1.1 A potential double source of CFH: retina vs. liver The CFH Y402H polymorphism is one of the most important genetic risk factors associated with increased incidence and progression of AMD.32, 36 Since CFH is expressed by RPE and choroid, in almost the same quantity as the liver, it is likely that the CFH-regulated pathways in the outer retinal could be affected by CFH produced locally in the retina as well as by CFH produced systemically and carried via the blood circulation to the eye.32, 45 Understanding whether AMD is a “local” and/or a “systemic” disease is of importance to the development of  effective drugs and drug delivery routes to prevent AMD.   We demonstrated a correlation between complement activation product C5a and CFH Y402H polymorphism in ocular tissues (Chapter 5), an important finding as it identifies that the overdrive of complement activation can occur locally in the eye as well as systemically in the blood as previously reported.43, 81, 164 C5a immunoreactivity associated with the CFH risk variant was localized to the same ocular compartment as MAC, suggesting that activation of the complement cascade proceeds through intermediate stages (C5a) towards the final stage (MAC) of the cascade.42 Furthermore, our work was the first to report that increased cytokine and growth factors are associated with the at risk variant of the CFH Y402H polymorphism in ocular tissues (Chapter 2, 4 and 5) and suggests that CFH Y402H polymorphism may play an important 98  role in affecting the pro-inflammatory mediator release in the eye and parallels the earlier findings in blood circulation.   Recently Klein et al. reported that several inflammatory mediators at the systemic level, including IL-6, were associated with the 20-year incidence of early AMD.214 We showed that the increased pro-inflammatory cytokines were mainly localized in RPE-BM-choroid complex (Chapter 5). This compartment, not restrained by the outer blood retinal barrier, can easily be accessed by blood circulation due to the high permeability of choroid vessels and BM.213 Therefore, the increased pro-inflammatory cytokines might result from complement dysregulation at both levels, which makes the systemic manipulation an attractive delivery option for complement-based therapies for it can reach both the systemic and local levels.  7.1.2 The relationship of complement activation and pro-inflammatory cytokines  Increased complement activation appears evident at both local and systemic levels in individuals with AMD, or carriers of the risk variant of CFH Y402H. However, the downstream events that may aggravate the disease process are still poorly understood.49, 51, 81, 164, 166, 167 Given that complement activation products (C3a, C5a or C5b-9) may enhance the expression of pro-inflammatory cytokines (e.g. IL-6, TNF-α, IL-1β and IL-18) in immune cells,43, 52, 53 we investigated whether the risk genotype of CFH Y402H polymorphism is also associated with higher levels of cytokines. We found that carriers of the CFH Y402H homozygous risk variant possessed increased levels of cytokines (IL-6, IL-18, and TNF-α) in the blood (Chapter 2) and increased cytokines and growth factors (IL-18, TNF-α and GM-CSF) in the eye (Chapter 4 and 99  5). The increased expression of cytokines and growth factors was observed in the same tissue compartments as C5a and MAC, suggestive of a potential regulatory role played by the complement activation products.  The effects of complement activation products, C3a and C5a, on RPE function was studied in vitro. Using an ARPE19/NF-κB-luciferase reporter cell line, we showed that C5a stimulation activated the NF-κB pathway in RPE in both polarized and non-polarized culture systems. The NF-κB pathway is known to mediate the translation of many pro-inflammatory mediators in RPE, including inflammasome products, and thereby contribute to the local pro-inflammatory status in outer retina (Chapter 5). Thus, we further studied the expression patterns of several inflammatory cytokines that are relevant to AMD.55, 82, 83 We found that GM-CSF and IL-18 are upregulated by C5a in RPE in vitro (Chapter 4 and 5). While previous studies reported the role of C5a in angiogenesis,28, 178, 179 our finding that IL-18, an inflammasome product, is upregulated in RPE in response to C5a is novel and supports the proposed relationship between complement cascade and inflammasome activation. The effect of MAC was studied in vivo and we found that MAC can promote inflammasome activation and IL-1β and IL-18 expression, which can be reversed by MAC inhibitor ATAC.191 All the pro-inflammatory cytokines/chemokines investigated here, including GM-CSF, IL-6, IL-8, and TNF-α are implicated in AMD and known to induce harmful effects, including aggravating the immune response or recruiting immune cells when studied individually.55, 56, 62-64, 82-85 Recent studies reported that IL-18 may induce RPE degeneration, which adds cell death as another mechanism that may be triggered by complement and inflammasome activation.175, 176  100  7.1.3 Complement activation: A common pathway shared by multiple risk factors? Heightened complement activation has been reported in AMD patients not only in ocular tissues  but also at the systemic level.45, 49, 51, 166 The complement terminal product, MAC, is known to be associated with multiple risk factors for AMD, including CFH Y402H polymorphism, aging, smoking and drusen.24, 42, 47, 48, 215 Previous reports defined the causal relationship of oxidative stress reagents (e.g. all-trans retinal, A2E, H2O2 and oxidized LDL) and MAC formation in RPE, but little has been reported about a specific drusen component as a trigger of complement activation and MAC formation.186, 188-190, 216  In this study, we demonstrated that the drusen component, Aβ, can induce complement activation and downregulate the membrane bound complement inhibitor, CD55, leading to sublytic MAC formation in RPE cells, in vitro.  We further illustrated that Aβ promotes complement activation mainly via the antibody-independent classical complement pathway (Chapter 6). Hereby, we established the causal relationship of drusen component, Aβ, and MAC formation in vitro. This result corroborated our earlier finding that Aβ and MAC accumulate in the outer retina in an aged rodent model, also suggestive of a causal relationship.191  It is hypothesized that in AMD, RPE cells undergo cellular stress due to an increased drusen load. Our results suggest that Aβ may be an important factor underlying RPE cell stress in AMD by promoting complement activation and aberrant cytokine regulation.27, 61, 194, 217 Along with the findings associated with CFH Y402H, our results suggest that complement activation might be the central response to multiple risk factors and the complement activation products may further inflict injury on RPE cells via cytokine release.  In this study, we explored the effect of a small molecule MAC inhibitor, ATAC, which when given systemically can reach the sub-RPE space in animal models, in our Aβ-promoted 101  complement activation cell model.192, 193, 213 Our in vitro study showed that ATAC can inhibit MAC formation on RPE cells, without undue cytotoxicity, thus highlighting the therapeutic potential of ATAC  in suppressing ocular MAC formation, an important factor associated with RPE stress in AMD.   7.2 Limitation Although the samples from human subjects allowed us to explore the relationship of the CFH Y402H polymorphism, complement activation and cytokine upregulation in ocular tissues as well as in blood samples, our sample size is relatively small (N= 23 and 44, respectively) considering the genetic variation in human samples, which is a limitation of our study. We are continuously collecting human donor eyes for future verification studies.  We demonstrated an upregulation of the GM-CSF gene in RPE after stimulation with complement activation products, C3a and C5a. We found complement activation in RPE cells stimulated with drusen component Aβ. A non-polarized RPE cell model was used in these experiments, which might be considered a limitation by some. RPE is highly polarized in situ and forms the outer blood-retinal barrier that selectively transports biomolecules between the neural retina and choriocapillaris and maintains homeostasis in the outer retina.11 Polarized RPE cell cultures may be better and more closely model RPE in situ. Despite the difference between the two culture systems, our results with the polarized system in Chapter 5 showed the same trend as the non-polarized system in terms of regulation of the NF-κB pathway. Future studies using a polarized RPE culture model would be important to confirm and extend the findings of this study.218 102   Although we showed that C5a can upregulate the gene expression of growth factors and cytokines such as GM-CSF, IL-6, IL-18 (Chapter 5) in vitro, it is still unknown whether other CFH Y402H-associated mechanisms exist. For example, the Y402H polymorphism-induced amino acid change in CFH protein may lead to a decreased binding affinity to MDA or oxidized phospholipids, which, in free form, can increase the gene expression of pro-inflammatory mediators in macrophages.69, 70  7.3 Future Work  7.3.1 The role of MAC formation This study did not fully explore the physiological changes in RPE cells induced by MAC.  For discussion purposes, we relied upon the literature to infer the physiological consequences of MAC deposition on RPE cells in vitro. Some of the reported changes, such as dysregulation of inflammatory cytokines and growth factors, enhancing ER stress, inducing lipid accumulation and intracellular calcium increase will require further assessment.184-187 To address this issue, we propose to collect mRNA and protein samples from RPE stimulated with Aβ and NHS and investigate the expression of pro-inflammatory cytokines/chemokines. It is known from non-ocular culture systems that MAC enhances toll-like receptor signaling to induce the expression of pro-inflammatory cytokines such as IL-6, TNF-α and IL-1β via NF-κB pathway or inflammasome activation.52, 53 Our future work will focus on understanding the MAC induced changes in RPE gene and protein changes.  The future studies will also include stimulation groups, such as C7- or C9-depleted sera, in order to verify the mechanistic role of MAC. The 103  small molecule drug, ATAC, will be further assessed as a therapeutic agent to protect against MAC-induced injury.  Other aspects of MAC deposition will be studied towards understanding its role in AMD disease progression. For example, the generation of reactive oxygen species (ROS) will be evaluated by staining with a fluorogenic dye, 2,7-dichlorofluorescein diacetate dye (DCFDA; Molecular Probes/Invitrogen) and lipid peroxidation will be assessed with thiobarbituric acid assays. The lipid dysregulation in RPE will be evaluated by measuring expression of apolipoprotein(apo) B and apoE and lipid deposition will be detected by immunohistochemistry with Nile Red. The mitochondrial function will be assessed by measurement of mitochondrial membrane potential by JC-1 dye and estimation of mitochondrial mass by MitoTracker Green dye. Finally, the lysosomal function will be evaluated with fluorometric cathepsin D activity assay kit. Knowing how MAC may affect lipid dysregulation, lysosomal and mitochondrial function in RPE will help to better understand the significance of MAC in the context of AMD.   7.3.2 The interaction between drusen and CFH Y402H. Since AMD is a multifactorial disease, it is crucial to address the complex interactions associated with the multiple risk factors. Although we illustrated that drusen component Aβ and CFH Y402H polymorphism may independently contribute to complement activation and upregulation of cytokine release, it is unknown how these two factors work synergistically. The genetic variation in RPE culture from human donor eyes or the unique genetic background in the ARPE-19 cell line makes it difficult to conduct such a study. However, this can now be overcome by the cutting-edge technology of CRISPR/Cas9. We propose to establish RPE cells with only CFH 104  Y402H genotype in difference by CRISPR/Cas9 technology based on ARPE-19, a cell line carrying the heterozygous CT variant of CFH Y402H polymorphism. The RNA-guided Cas9 nuclease from the microbial clustered regularly interspaced short palindromic repeats (CRISPR) adaptive immune system can create a double strand break (DSB) at specific region on genome DNA by specifying a 20-nt targeting sequence within its guide RNA. Provided with a repair template, the repair of DSB will be mediated through homology-directed repair (HDR) pathway, which provides an effective and simple method for making small edits in the genome, such as introduction of single nucleotide exchange. The heterozygous CT genotype of CFH Y402H SNP in ARPE-19 will be edited either to the homozygous CC risk genotype or to the homozygous TT protective genotype. In addition, animal models carrying this SNP were recently created and characterized, which sets a platform to verify our finding in vitro.219 These new models will allow us to study the interaction of CFH Y402H SNP with other risk factor such as drusen. We will test our hypothesis that the CFH Y402H variation in RPE cells will amplify Aβ-promoted MAC formation in the RPE, resulting in cytokine release and RPE degeneration.  7.4 Summary Our results showed that the complement activation is affected by genetic background (e.g. CFH polymorphisms) and also by additional AMD risk factors such as drusen accumulation. Complement activation may mediate downstream events in RPE such as secretion of proinflammatory cytokines, inflammasome activation and cell death.  Complement activation products, such as MAC, are potential therapeutic targets to stop these downstream events in RPE.   105  Bibliography 1. Ambati J, Atkinson JP, Gelfand BD. Immunology of age-related macular degeneration. Nature reviews Immunology 2013;13:438-451. 2. Boulton M, Dayhaw-Barker P. The role of the retinal pigment epithelium: topographical variation and ageing changes. Eye (London, England) 2001;15:384-389. 3. Strauss O. The retinal pigment epithelium in visual function. Physiol Rev 2005;85:845-881. 4. Cruess AF, Gordon KD, Bellan L, Mitchell S, Pezzullo ML. The cost of vision loss in Canada. 2. Results. Canadian journal of ophthalmology Journal canadien d'ophtalmologie 2011;46:315-318. 5. Gordon KD, Cruess AF, Bellan L, Mitchell S, Pezzullo ML. The cost of vision loss in Canada. 1. Methodology. Canadian journal of ophthalmology Journal canadien d'ophtalmologie 2011;46:310-314. 6. de Jong PT. Age-related macular degeneration. The New England journal of medicine 2006;355:1474-1485. 7. Bird AC, Bressler NM, Bressler SB, et al. An international classification and grading system for age-related maculopathy and age-related macular degeneration. The International ARM Epidemiological Study Group. Survey of ophthalmology 1995;39:367-374. 8. Jager RD, Mieler WF, Miller JW. Age-related macular degeneration. The New England journal of medicine 2008;358:2606-2617. 9. Klein R, Klein BE, Knudtson MD, Meuer SM, Swift M, Gangnon RE. Fifteen-year cumulative incidence of age-related macular degeneration: the Beaver Dam Eye Study. Ophthalmology 2007;114:253-262. 10. Berger JW, Fine SL, Maguire MG. Age-related macular degeneration: Mosby; 1999. 11. Ryan SJ, Schachat AP, Wilkinson CP, Hinton DR, Sadda SVR, Wiedemann P. Retina: Elsevier Health Sciences; 2012. 12. Cruickshanks KJ, Klein R, Klein BE. Sunlight and age-related macular degeneration. The Beaver Dam Eye Study. Archives of ophthalmology 1993;111:514-518. 13. Vingerling JR, Dielemans I, Hofman A, et al. The prevalence of age-related maculopathy in the Rotterdam Study. Ophthalmology 1995;102:205-210. 14. Age-Related Eye Disease Study Research G. Risk factors associated with age-related macular degeneration. A case-control study in the age-related eye disease study: Age-Related Eye Disease Study Report Number 3. Ophthalmology 2000;107:2224-2232. 15. VanNewkirk MR, Nanjan MB, Wang JJ, Mitchell P, Taylor HR, McCarty CA. The prevalence of age-related maculopathy: the visual impairment project. Ophthalmology 2000;107:1593-1600. 106  16. Augood CA, Vingerling JR, de Jong PT, et al. Prevalence of age-related maculopathy in older Europeans: the European Eye Study (EUREYE). Archives of ophthalmology 2006;124:529-535. 17. Friedman DS, Katz J, Bressler NM, Rahmani B, Tielsch JM. Racial differences in the prevalence of age-related macular degeneration: the Baltimore Eye Survey. Ophthalmology 1999;106:1049-1055. 18. Friedman DS, O'Colmain BJ, Munoz B, et al. Prevalence of age-related macular degeneration in the United States. Archives of ophthalmology 2004;122:564-572. 19. Age-Related Eye Disease Study Research G. The Age-Related Eye Disease Study system for classifying age-related macular degeneration from stereoscopic color fundus photographs: the Age-Related Eye Disease Study Report Number 6. American journal of ophthalmology 2001;132:668-681. 20. Davis MD, Gangnon RE, Lee LY, et al. The Age-Related Eye Disease Study severity scale for age-related macular degeneration: AREDS Report No. 17. Archives of ophthalmology 2005;123:1484-1498. 21. Ferris FL, Davis MD, Clemons TE, et al. A simplified severity scale for age-related macular degeneration: AREDS Report No. 18. Archives of ophthalmology 2005;123:1570-1574. 22. Anderson DH, Mullins RF, Hageman GS, Johnson LV. A role for local inflammation in the formation of drusen in the aging eye. American journal of ophthalmology 2002;134:411-431. 23. Crabb JW, Miyagi M, Gu X, et al. Drusen proteome analysis: an approach to the etiology of age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 2002;99:14682-14687. 24. Mullins RF, Russell SR, Anderson DH, Hageman GS. Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2000;14:835-846. 25. Hageman GS, Luthert PJ, Victor Chong NH, Johnson LV, Anderson DH, Mullins RF. An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-Bruch's membrane interface in aging and age-related macular degeneration. Progress in retinal and eye research 2001;20:705-732. 26. Johnson LV, Leitner WP, Staples MK, Anderson DH. Complement activation and inflammatory processes in Drusen formation and age related macular degeneration. Experimental eye research 2001;73:887-896. 27. Johnson LV, Leitner WP, Rivest AJ, Staples MK, Radeke MJ, Anderson DH. The Alzheimer's A beta -peptide is deposited at sites of complement activation in pathologic deposits associated with aging and age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 2002;99:11830-11835. 107  28. Nozaki M, Raisler BJ, Sakurai E, et al. Drusen complement components C3a and C5a promote choroidal neovascularization. Proceedings of the National Academy of Sciences of the United States of America 2006;103:2328-2333. 29. Dentchev T, Milam AH, Lee VM, Trojanowski JQ, Dunaief JL. Amyloid-beta is found in drusen from some age-related macular degeneration retinas, but not in drusen from normal retinas. Mol Vis 2003;9:184-190. 30. Luibl V, Isas JM, Kayed R, Glabe CG, Langen R, Chen J. Drusen deposits associated with aging and age-related macular degeneration contain nonfibrillar amyloid oligomers. J Clin Invest 2006;116:378-385. 31. Fine SL, Berger JW, Maguire MG, Ho AC. Age-related macular degeneration. The New England journal of medicine 2000;342:483-492. 32. Hageman GS, Anderson DH, Johnson LV, et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 2005;102:7227-7232. 33. Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385-389. 34. Edwards AO, Ritter R, 3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005;308:421-424. 35. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308:419-421. 36. Gangnon RE, Lee KE, Klein BE, Iyengar SK, Sivakumaran TA, Klein R. Effect of the Y402H variant in the complement factor H gene on the incidence and progression of age-related macular degeneration: results from multistate models applied to the Beaver Dam Eye Study. Archives of ophthalmology 2012;130:1169-1176. 37. Jozsi M, Zipfel PF. Factor H family proteins and human diseases. Trends in immunology 2008;29:380-387. 38. Harrison RA, Lachmann PJ. The physiological breakdown of the third component of human complement. Mol Immunol 1980;17:9-20. 39. Pangburn MK, Schreiber RD, Muller-Eberhard HJ. Human complement C3b inactivator: isolation, characterization, and demonstration of an absolute requirement for the serum protein beta1H for cleavage of C3b and C4b in solution. J Exp Med 1977;146:257-270. 40. Whaley K, Ruddy S. Modulation of C3b hemolytic activity by a plasma protein distinct from C3b inactivator. Science 1976;193:1011-1013. 41. Yu BB, Moffatt BE, Fedorova M, et al. Purification, quantification, and functional analysis of Complement Factor H. Methods in molecular biology 2014;1100:207-223. 108  42. Mullins RF, Dewald AD, Streb LM, Wang K, Kuehn MH, Stone EM. Elevated membrane attack complex in human choroid with high risk complement factor H genotypes. Experimental eye research 2011;93:565-567. 43. Liu B, Wei L, Meyerle C, et al. Complement component C5a promotes expression of IL-22 and IL-17 from human T cells and its implication in age-related macular degeneration. Journal of translational medicine 2011;9:1-12. 44. Zipfel PF, Skerka C. Complement regulators and inhibitory proteins. Nature reviewsImmunology 2009;9:729-740. 45. Anderson DH, Radeke MJ, Gallo NB, et al. The pivotal role of the complement system in aging and age-related macular degeneration: hypothesis re-visited. Prog Retin Eye Res 2010;29:95-112. 46. Walport MJ. Complement. First of two parts. The New England journal of medicine 2001;344:1058-1066. 47. Johnson LV, Ozaki S, Staples MK, Erickson PA, Anderson DH. A potential role for immune complex pathogenesis in drusen formation. Experimental eye research 2000;70:441-449. 48. Seth A, Cui J, To E, Kwee M, Matsubara J. Complement-associated deposits in the human retina. Invest Ophthalmol Vis Sci 2008;49:743-750. 49. Scholl HP, Charbel Issa P, Walier M, et al. Systemic complement activation in age-related macular degeneration. PloS one 2008;3:e2593. 50. Charbel Issa P, Chong NV, Scholl HP. The significance of the complement system for the pathogenesis of age-related macular degeneration - current evidence and translation into clinical application. Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie 2011;249:163-174. 51. Reynolds R, Hartnett ME, Atkinson JP, Giclas PC, Rosner B, Seddon JM. Plasma complement components and activation fragments: associations with age-related macular degeneration genotypes and phenotypes. Invest Ophthalmol Vis Sci 2009;50:5818-5827. 52. Zhang X, Kimura Y, Fang C, et al. Regulation of Toll-like receptor-mediated inflammatory response by complement in vivo. Blood 2007;110:228-236. 53. Laudisi F, Spreafico R, Evrard M, et al. Cutting Edge: The NLRP3 Inflammasome Links Complement-Mediated Inflammation and IL-1beta Release. Journal of immunology 2013;191:1006-1010. 54. Triantafilou K, Hughes TR, Triantafilou M, Morgan BP. The complement membrane attack complex triggers intracellular Ca2+ fluxes leading to NLRP3 inflammasome activation. Journal of cell science 2013;126:2903-2913. 55. Tarallo V, Hirano Y, Gelfand BD, et al. DICER1 loss and Alu RNA induce age-related macular degeneration via the NLRP3 inflammasome and MyD88. Cell 2012;149:847-859. 109  56. Doyle SL, Campbell M, Ozaki E, et al. NLRP3 has a protective role in age-related macular degeneration through the induction of IL-18 by drusen components. Nature medicine 2012;18:791-798. 57. Cao X, Shen D, Patel MM, et al. Macrophage polarization in the maculae of age-related macular degeneration: a pilot study. Pathology international 2011;61:528-535. 58. Mo FM, Proia AD, Johnson WH, Cyr D, Lashkari K. Interferon gamma-inducible protein-10 (IP-10) and eotaxin as biomarkers in age-related macular degeneration. Invest Ophthalmol Vis Sci 2010;51:4226-4236. 59. Xu H, Chen M, Forrester JV. Para-inflammation in the aging retina. Prog Retin Eye Res 2009;28:348-368. 60. Cao S, Walker GB, Wang X, Cui JZ, Matsubara JA. Altered cytokine profiles of human retinal pigment epithelium: oxidant injury and replicative senescence. Mol Vis 2013;19:718-728. 61. Kurji KH, Cui JZ, Lin T, et al. Microarray analysis identifies changes in inflammatory gene expression in response to amyloid-beta stimulation of cultured human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 2010;51:1151-1163. 62. Lin T, Walker GB, Kurji K, et al. Parainflammation associated with advanced glycation endproduct stimulation of RPE in vitro: implications for age-related degenerative diseases of the eye. Cytokine 2013;62:369-381. 63. Elner VM, Scales W, Elner SG, Danforth J, Kunkel SL, Strieter RM. Interleukin-6 (IL-6) gene expression and secretion by cytokine-stimulated human retinal pigment epithelial cells. Experimental eye research 1992;54:361-368. 64. Yoshida A, Elner SG, Bian ZM, Kunkel SL, Lukacs NW, Elner VM. Differential chemokine regulation by Th2 cytokines during human RPE-monocyte coculture. Invest Ophthalmol Vis Sci 2001;42:1631-1638. 65. Resnikoff S, Pascolini D, Etya'ale D, et al. Global data on visual impairment in the year 2002. Bulletin of the World Health Organization 2004;82:844-851. 66. Chakravarthy U, Wong TY, Fletcher A, et al. Clinical risk factors for age-related macular degeneration: a systematic review and meta-analysis. BMC ophthalmology 2010;10:31. 67. Telander DG. Inflammation and age-related macular degeneration (AMD). Seminars in Ophthalmology 2011;26:192-197. 68. Priya RR, Chew EY, Swaroop A. Genetic studies of age-related macular degeneration: lessons, challenges, and opportunities for disease management. Ophthalmology 2012;119:2526-2536. 69. Shaw PX, Zhang L, Zhang M, et al. Complement factor H genotypes impact risk of age-related macular degeneration by interaction with oxidized phospholipids. Proceedings of the National Academy of Sciences of the United States of America 2012;109:13757-13762. 110  70. Weismann D, Hartvigsen K, Lauer N, et al. Complement factor H binds malondialdehyde epitopes and protects from oxidative stress. Nature 2011;478:76-81. 71. Buch H, Nielsen NV, Vinding T, Jensen GB, Prause JU, la Cour M. 14-year incidence, progression, and visual morbidity of age-related maculopathy: the Copenhagen City Eye Study. Ophthalmology 2005;112:787-798. 72. Varma R, Foong AW, Lai MY, et al. Four-year incidence and progression of age-related macular degeneration: the Los Angeles Latino Eye Study. American journal of ophthalmology 2010;149:741-751. 73. van Leeuwen R, Klaver CC, Vingerling JR, Hofman A, de Jong PT. The risk and natural course of age-related maculopathy: follow-up at 6 1/2 years in the Rotterdam study. Archives of ophthalmology 2003;121:519-526. 74. Selkoe DJ, Hardy J. The amyloid hypothesis of Alzheimer's disease at 25 years. EMBO molecular medicine 2016. 75. McLeod DS, Grebe R, Bhutto I, Merges C, Baba T, Lutty GA. Relationship between RPE and choriocapillaris in age-related macular degeneration. Invest Ophthalmol Vis Sci 2009;50:4982-4991. 76. Mullins RF, Johnson MN, Faidley EA, Skeie JM, Huang J. Choriocapillaris vascular dropout related to density of drusen in human eyes with early age-related macular degeneration. Invest Ophthalmol Vis Sci 2011;52:1606-1612. 77. Kim SW, Oh J, Kwon SS, Yoo J, Huh K. Comparison of choroidal thickness among patients with healthy eyes, early age-related maculopathy, neovascular age-related macular degeneration, central serous chorioretinopathy, and polypoidal choroidal vasculopathy. Retina (Philadelphia, Pa) 2011;31:1904-1911. 78. Gregori G, Wang F, Rosenfeld PJ, et al. Spectral domain optical coherence tomography imaging of drusen in nonexudative age-related macular degeneration. Ophthalmology 2011;118:1373-1379. 79. Manjunath V, Goren J, Fujimoto JG, Duker JS. Analysis of choroidal thickness in age-related macular degeneration using spectral-domain optical coherence tomography. American journal of ophthalmology 2011;152:663-668. 80. Yehoshua Z, Rosenfeld PJ, Gregori G, Penha F. Spectral domain optical coherence tomography imaging of dry age-related macular degeneration. Ophthalmic Surg Lasers Imaging 2010;41 Suppl:S6-S14. 81. Smailhodzic D, Klaver CC, Klevering BJ, et al. Risk alleles in CFH and ARMS2 are independently associated with systemic complement activation in age-related macular degeneration. Ophthalmology 2012;119:339-346. 82. Seddon JM, George S, Rosner B, Rifai N. Progression of age-related macular degeneration: prospective assessment of C-reactive protein, interleukin 6, and other cardiovascular biomarkers. Archives of ophthalmology 2005;123:774-782. 111  83. Jonas JB, Tao Y, Neumaier M, Findeisen P. Cytokine concentration in aqueous humour of eyes with exudative age-related macular degeneration. Acta Ophthalmol 2012;90:e381-388. 84. Oh H, Takagi H, Takagi C, et al. The potential angiogenic role of macrophages in the formation of choroidal neovascular membranes. Invest Ophthalmol Vis Sci 1999;40:1891-1898. 85. Cousins SW, Espinosa-Heidmann DG, Csaky KG. Monocyte activation in patients with age-related macular degeneration: a biomarker of risk for choroidal neovascularization? Archives of ophthalmology 2004;122:1013-1018. 86. Wang JCC, Wang AK, Gao JY, et al. Technical Brief: Isolation of total DNA from postmortem human eye tissues and quality comparison between iris and retina. Mol Vis 2012;18:3049-3056. 87. Ko A, Cao S, Pakzad-Vaezi K, et al. Optical coherence tomography-based correlation between choroidal thickness and drusen load in dry age-related macular degeneration. Retina (Philadelphia, Pa) 2013;33:1005-1010. 88. Ershler WB, Sun WH, Binkley N, et al. Interleukin-6 and aging: blood levels and mononuclear cell production increase with advancing age and in vitro production is modifiable by dietary restriction. Lymphokine Cytokine Res 1993;12:225-230. 89. Ershler WB, Keller ET. Age-associated increased interleukin-6 gene expression, late-life diseases, and frailty. Annu Rev Med 2000;51:245-270. 90. Rink L, Cakman I, Kirchner H. Altered cytokine production in the elderly. Mechanisms of Ageing and Development 1998;102:199-209. 91. Bamforth SD, Lightman S, Greenwood J. The effect of TNF-alpha and IL-6 on the permeability of the rat blood-retinal barrier in vivo. Acta Neuropathol 1996;91:624-632. 92. Bamforth SD, Lightman SL, Greenwood J. Ultrastructural analysis of interleukin-1 beta-induced leukocyte recruitment to the rat retina. Invest Ophthalmol Vis Sci 1997;38:25-35. 93. Duchini A, Govindarajan S, Santucci M, Zampi G, Hofman FM. Effects of tumor necrosis factor-alpha and interleukin-6 on fluid-phase permeability and ammonia diffusion in CNS-derived endothelial cells. J Investig Med 1996;44:474-482. 94. Elner SG, Strieter RM, Elner VM, Rollins BJ, Del Monte MA, Kunkel SL. Monocyte chemotactic protein gene expression by cytokine-treated human retinal pigment epithelial cells. Laboratory investigation; a journal of technical methods and pathology 1991;64:819-825. 95. Nagineni CN, Detrick B, Hooks JJ. Synergistic effects of gamma interferon on inflammatory mediators that induce interleukin-6 gene expression and secretion by human retinal pigment epithelial cells. Clin Diagn Lab Immunol 1994;1:569-577. 96. Bradley DT, Zipfel PF, Hughes AE. Complement in age-related macular degeneration: a focus on function. Eye (London, England) 2011;25:683-693. 112  97. Markiewski MM, Lambris JD. The role of complement in inflammatory diseases from behind the scenes into the spotlight. Am J Pathol 2007;171:715-727. 98. Takabayashi T, Vannier E, Clark BD, et al. A new biologic role for C3a and C3a desArg: regulation of TNF-alpha and IL-1 beta synthesis. Journal of immunology 1996;156:3455-3460. 99. Takabayashi T, Vannier E, Burke JF, Tompkins RG, Gelfand JA, Clark BD. Both C3a and C3a(desArg) regulate interleukin-6 synthesis in human peripheral blood mononuclear cells. The Journal of infectious diseases 1998;177:1622-1628. 100. Lauer N, Mihlan M, Hartmann A, et al. Complement regulation at necrotic cell lesions is impaired by the age-related macular degeneration-associated factor-H His402 risk variant. Journal of immunology 2011;187:4374-4383. 101. Shanmugam N, Figarola JL, Li Y, Swiderski PM, Rahbar S, Natarajan R. Proinflammatory effects of advanced lipoxidation end products in monocytes. Diabetes 2008;57:879-888. 102. Mooijaart SP, Koeijvoets KM, Sijbrands EJ, Daha MR, Westendorp RG. Complement Factor H polymorphism Y402H associates with inflammation, visual acuity, and cardiovascular mortality in the elderly population at large. Experimental gerontology 2007;42:1116-1122. 103. Berenberg TL, Metelitsina TI, Madow B, et al. The association between drusen extent and foveolar choroidal blood flow in age-related macular degeneration. Retina (Philadelphia, Pa) 2012;32:25-31. 104. Congdon N, O'Colmain B, Klaver CC, et al. Causes and prevalence of visual impairment among adults in the United States. Archives of ophthalmology 2004;122:477-485. 105. Linsenmeier RA, Padnick-Silver L. Metabolic dependence of photoreceptors on the choroid in the normal and detached retina. Invest Ophthalmol Vis Sci 2000;41:3117-3123. 106. D'Souza YB, Jones CJ, Bonshek RE. Comparison of lectin binding of drusen, RPE, Bruch's membrane, and photoreceptors. Mol Vis 2009;15:906-911. 107. Sarks JP, Sarks SH, Killingsworth MC. Evolution of soft drusen in age-related macular degeneration. Eye (London, England) 1994;8 ( Pt 3):269-283. 108. Yehoshua Z, Rosenfeld PJ, Albini TA. Current Clinical Trials in Dry AMD and the Definition of Appropriate Clinical Outcome Measures. Seminars in ophthalmology 2011;26:167-180. 109. Spaide RF, Koizumi H, Pozzoni MC. Enhanced depth imaging spectral-domain optical coherence tomography. American journal of ophthalmology 2008;146:496-500. 110. Imamura Y, Fujiwara T, Margolis R, Spaide RF. Enhanced depth imaging optical coherence tomography of the choroid in central serous chorioretinopathy. Retina (Philadelphia, Pa) 2009;29:1469-1473. 113  111. Maruko I, Iida T, Sugano Y, Ojima A, Sekiryu T. Subfoveal choroidal thickness in fellow eyes of patients with central serous chorioretinopathy. Retina (Philadelphia, Pa) 2011;31:1603-1608. 112. Maruko I, Iida T, Sugano Y, Furuta M, Sekiryu T. One-year choroidal thickness results after photodynamic therapy for central serous chorioretinopathy. Retina (Philadelphia, Pa) 2011;31:1921-1927. 113. Fujiwara T, Imamura Y, Margolis R, Slakter JS, Spaide RF. Enhanced depth imaging optical coherence tomography of the choroid in highly myopic eyes. American journal of ophthalmology 2009;148:445-450. 114. Nishida Y, Fujiwara T, Imamura Y, Lima LH, Kurosaka D, Spaide RF. Choroidal thickness and visual acuity in highly myopic eyes. Retina (Philadelphia, Pa) 2012;32:1229-1236. 115. Fong AH, Li KK, Wong D. Choroidal evaluation using enhanced depth imaging spectral-domain optical coherence tomography in Vogt-Koyanagi-Harada disease. Retina (Philadelphia, Pa) 2011;31:502-509. 116. Yeoh J, Rahman W, Chen F, et al. Choroidal imaging in inherited retinal disease using the technique of enhanced depth imaging optical coherence tomography. Graefes Arch Clin Exp Ophthalmol 2010;248:1719-1728. 117. Yehoshua Z, Wang F, Rosenfeld PJ, Penha FM, Feuer WJ, Gregori G. Natural History of Drusen Morphology in Age-Related Macular Degeneration Using Spectral Domain Optical Coherence Tomography. Ophthalmology 2011. 118. Landis JR, Koch GG. The measurement of observer agreement for categorical data. Biometrics 1977;33:159-174. 119. Manjunath V, Taha M, Fujimoto JG, Duker JS. Choroidal thickness in normal eyes measured using Cirrus HD optical coherence tomography. American journal of ophthalmology 2010;150:325-329 e321. 120. Margolis R, Spaide RF. A pilot study of enhanced depth imaging optical coherence tomography of the choroid in normal eyes. American journal of ophthalmology 2009;147:811-815. 121. Fujiwara A, Shiragami C, Shirakata Y, Manabe S, Izumibata S, Shiraga F. Enhanced depth imaging spectral-domain optical coherence tomography of subfoveal choroidal thickness in normal Japanese eyes. Japanese journal of ophthalmology 2012;56:230-235. 122. Shin JW, Shin YU, Lee BR. Choroidal thickness and volume mapping by a six radial scan protocol on spectral-domain optical coherence tomography. Ophthalmology 2012;119:1017-1023. 123. Switzer DW, Jr., Mendonca LS, Saito M, Zweifel SA, Spaide RF. Segregation of ophthalmoscopic characteristics according to choroidal thickness in patients with early age-related macular degeneration. Retina (Philadelphia, Pa) 2012;32:1265-1271. 114  124. Grunwald JE, Hariprasad SM, DuPont J. Effect of aging on foveolar choroidal circulation. Archives of ophthalmology 1998;116:150-154. 125. Ramrattan RS, van der Schaft TL, Mooy CM, de Bruijn WC, Mulder PG, de Jong PT. Morphometric analysis of Bruch's membrane, the choriocapillaris, and the choroid in aging. Invest Ophthalmol Vis Sci 1994;35:2857-2864. 126. Curcio CA, Owsley C, Jackson GR. Spare the rods, save the cones in aging and age-related maculopathy. Invest Ophthalmol Vis Sci 2000;41:2015-2018. 127. Schuman SG, Koreishi AF, Farsiu S, Jung SH, Izatt JA, Toth CA. Photoreceptor layer thinning over drusen in eyes with age-related macular degeneration imaged in vivo with spectral-domain optical coherence tomography. Ophthalmology 2009;116:488-496 e482. 128. Hartmann KI, Gomez ML, Bartsch DU, Schuster AK, Freeman WR. Effect of change in drusen evolution on photoreceptor inner segment/outer segment junction. Retina (Philadelphia, Pa) 2012;32:1492-1499. 129. Curcio CA, Medeiros NE, Millican CL. Photoreceptor loss in age-related macular degeneration. Invest Ophthalmol Vis Sci 1996;37:1236-1249. 130. CATT Research Group, Martin DF, Maguire MG, et al. Ranibizumab and bevacizumab for neovascular age-related macular degeneration. The New England journal of medicine 2011;364:1897-1908. 131. Comparison of Age-related Macular Degeneration Treatments Trials Research Group, Martin DF, Maguire MG, et al. Ranibizumab and bevacizumab for treatment of neovascular age-related macular degeneration: two-year results. Ophthalmology 2012;119:1388-1398. 132. Mones J, Biarnes M, Trindade F. Hyporeflective wedge-shaped band in geographic atrophy secondary to age-related macular degeneration: an underreported finding. Ophthalmology 2012;119:1412-1419. 133. Fleckenstein M, Charbel Issa P, Helb HM, et al. High-resolution spectral domain-OCT imaging in geographic atrophy associated with age-related macular degeneration. Invest Ophthalmol Vis Sci 2008;49:4137-4144. 134. Jain N, Farsiu S, Khanifar AA, et al. Quantitative comparison of drusen segmented on SD-OCT versus drusen delineated on color fundus photographs. Invest Ophthalmol Vis Sci 2010;51:4875-4883. 135. Yehoshua Z, de Amorim Garcia Filho CA, Nunes RP, et al. Systemic complement inhibition with eculizumab for geographic atrophy in age-related macular degeneration: the COMPLETE study. Ophthalmology 2014;121:693-701. 136. ClinicalTrials.gov. AREDS 2 Ancillary Spectral Domain Optical Coherence Tomography Study (A2ASDOCT). 2015:NCT00734487. 137. Zhang L, Lee K, Niemeijer M, Mullins RF, Sonka M, Abramoff MD. Automated segmentation of the choroid from clinical SD-OCT. Invest Ophthalmol Vis Sci 2012;53:7510-7519. 115  138. Tan CS, Ouyang Y, Ruiz H, Sadda SR. Diurnal variation of choroidal thickness in normal, healthy subjects measured by spectral domain optical coherence tomography. Invest Ophthalmol Vis Sci 2012;53:261-266. 139. Brown JS, Flitcroft DI, Ying GS, et al. In vivo human choroidal thickness measurements: evidence for diurnal fluctuations. Invest Ophthalmol Vis Sci 2009;50:5-12. 140. Khandhadia S, Cherry J, Lotery AJ. Age-related macular degeneration. Advances in experimental medicine and biology 2012;724:15-36. 141. Pascolini D, Mariotti SP, Pokharel GP, et al. 2002 global update of available data on visual impairment: a compilation of population-based prevalence studies. Ophthalmic epidemiology 2004;11:67-115. 142. Kaarniranta K, Salminen A, Haapasalo A, Soininen H, Hiltunen M. Age-related macular degeneration (AMD): Alzheimer's disease in the eye? J Alzheimers Dis 2011;24:615-631. 143. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Survey of ophthalmology 2000;45:115-134. 144. Swaroop A, Chew EY, Rickman CB, Abecasis GR. Unraveling a multifactorial late-onset disease: from genetic susceptibility to disease mechanisms for age-related macular degeneration. Annual review of genomics and human genetics 2009;10:19-43. 145. Johnson PT, Betts KE, Radeke MJ, Hageman GS, Anderson DH, Johnson LV. Individuals homozygous for the age-related macular degeneration risk-conferring variant of complement factor H have elevated levels of CRP in the choroid. Proceedings of the National Academy of Sciences of the United States of America 2006;103:17456-17461. 146. Cao S, Ko A, Partanen M, et al. Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration. Am J Ophthalmol 2013;156:1176-1183. 147. Brantley MA, Jr., Osborn MP, Sanders BJ, et al. Plasma Biomarkers of Oxidative Stress and Genetic Variants in Age-Related Macular Degeneration. American journal of ophthalmology 2011. 148. Hamilton JA. Colony-stimulating factors in inflammation and autoimmunity. Nature reviews Immunology 2008;8:533-544. 149. Grunin M, Hagbi-Levi S, Chowers I. The role of monocytes and macrophages in age-related macular degeneration. Advances in experimental medicine and biology 2014;801:199-205. 150. Bao L, Haas M, Quigg RJ. Complement factor H deficiency accelerates development of lupus nephritis. Journal of the American Society of Nephrology : JASN 2011;22:285-295. 151. Rowan S, Weikel K, Chang ML, et al. Cfh genotype interacts with dietary glycemic index to modulate age-related macular degeneration-like features in mice. Invest Ophthalmol Vis Sci 2014;55:492-501. 116  152. Ufret-Vincenty RL, Aredo B, Liu X, et al. Transgenic mice expressing variants of complement factor H develop AMD-like retinal findings. Invest Ophthalmol Vis Sci 2010;51:5878-5887. 153. Lee SC, Liu W, Brosnan CF, Dickson DW. GM-CSF promotes proliferation of human fetal and adult microglia in primary cultures. Glia 1994;12:309-318. 154. Ruef C, Coleman DL. Granulocyte-macrophage colony-stimulating factor: pleiotropic cytokine with potential clinical usefulness. Rev Infect Dis 1990;12:41-62. 155. Jashnani KD, Kale SA, Rupani AB. Vitreous humor: biochemical constituents in estimation of postmortem interval. J Forensic Sci 2010;55:1523-1527. 156. Maberley D, Cui JZ, Matsubara JA. Vitreous leptin levels in retinal disease. Eye (London, England) 2006;20:801-804. 157. Osuna E, Vivero G, Conejero J, et al. Postmortem vitreous humor beta-hydroxybutyrate: its utility for the postmortem interpretation of diabetes mellitus. Forensic Sci Int 2005;153:189-195. 158. Fischer HG, Bielinsky AK, Nitzgen B, Daubener W, Hadding U. Functional dichotomy of mouse microglia developed in vitro: differential effects of macrophage and granulocyte/macrophage colony-stimulating factor on cytokine secretion and antitoxoplasmic activity. Journal of neuroimmunology 1993;45:193-201. 159. Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage subsets. Nature reviews Immunology 2011;11:723-737. 160. Cherepanoff S, McMenamin P, Gillies MC, Kettle E, Sarks SH. Bruch's membrane and choroidal macrophages in early and advanced age-related macular degeneration. The British journal of ophthalmology 2010;94:918-925. 161. Planck SR, Huang XN, Robertson JE, Rosenbaum JT. Retinal pigment epithelial cells produce interleukin-1 beta and granulocyte-macrophage colony-stimulating factor in response to interleukin-1 alpha. Current eye research 1993;12:205-212. 162. Gupta N, Brown KE, Milam AH. Activated microglia in human retinitis pigmentosa, late-onset retinal degeneration, and age-related macular degeneration. Experimental eye research 2003;76:463-471. 163. Zeng HY, Green WR, Tso MO. Microglial activation in human diabetic retinopathy. Archives of ophthalmology 2008;126:227-232. 164. Loyet KM, Deforge LE, Katschke KJ, Jr., et al. Activation of the alternative complement pathway in vitreous is controlled by genetics in age-related macular degeneration. Invest Ophthalmol Vis Sci 2012;53:6628-6637. 165. Fukuoka Y, Strainic M, Medof ME. Differential cytokine expression of human retinal pigment epithelial cells in response to stimulation by C5a. Clinical and experimental immunology 2003;131:248-253. 117  166. Hecker LA, Edwards AO, Ryu E, et al. Genetic control of the alternative pathway of complement in humans and age-related macular degeneration. Human molecular genetics 2010;19:209-215. 167. Ristau T, Paun C, Ersoy L, et al. Impact of the common genetic associations of age-related macular degeneration upon systemic complement component C3d levels. PloS one 2014;9:e93459. 168. Cao S, Ko A, Partanen M, et al. Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration. American journal of ophthalmology 2013;156:1176-1183. 169. Yang IH, Wong JH, Chang CM, et al. Involvement of intracellular calcium mobilization in IL-8 activation in human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 2015;56:761-769. 170. Bauernfeind FG, Horvath G, Stutz A, et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. Journal of immunology 2009;183:787-791. 171. Gao J, Liu RT, Cao S, et al. NLRP3 inflammasome: activation and regulation in age-related macular degeneration. Mediators of inflammation 2015;2015:690243. 172. Liu RT, Wang A, To E, et al. Vinpocetine inhibits amyloid-beta induced activation of NF-kappaB, NLRP3 inflammasome and cytokine production in retinal pigment epithelial cells. Experimental eye research 2014;127:49-58. 173. Kannan R, Zhang N, Sreekumar PG, et al. Stimulation of apical and basolateral VEGF-A and VEGF-C secretion by oxidative stress in polarized retinal pigment epithelial cells. Mol Vis 2006;12:1649-1659. 174. Geisen P, McColm JR, King BM, Hartnett ME. Characterization of barrier properties and inducible VEGF expression of several types of retinal pigment epithelium in medium-term culture. Current eye research 2006;31:739-748. 175. Doyle SL, Ozaki E, Brennan K, et al. IL-18 attenuates experimental choroidal neovascularization as a potential therapy for wet age-related macular degeneration. Science translational medicine 2014;6:230ra244. 176. Ijima R, Kaneko H, Ye F, et al. Interleukin-18 induces retinal pigment epithelium degeneration in mice. Invest Ophthalmol Vis Sci 2014;55:6673-6678. 177. Cortright DN, Meade R, Waters SM, Chenard BL, Krause JE. C5a, but not C3a, increases VEGF secretion in ARPE-19 human retinal pigment epithelial cells. Current eye research 2009;34:57-61. 178. Hu M, Liu B, Jawad S, et al. C5a contributes to intraocular inflammation by affecting retinal pigment epithelial cells and immune cells. The British journal of ophthalmology 2011;95:1738-1744. 118  179. Skeie JM, Fingert JH, Russell SR, Stone EM, Mullins RF. Complement component C5a activates ICAM-1 expression on human choroidal endothelial cells. Invest Ophthalmol Vis Sci 2010;51:5336-5342. 180. Sonoda S, Sreekumar PG, Kase S, et al. Attainment of polarity promotes growth factor secretion by retinal pigment epithelial cells: relevance to age-related macular degeneration. Aging 2010;2:28-42. 181. Shi G, Chen S, Wandu WS, et al. Inflammasomes Induced by 7-Ketocholesterol and Other Stimuli in RPE and in Bone Marrow-Derived Cells Differ Markedly in Their Production of IL-1beta and IL-18. Invest Ophthalmol Vis Sci 2015;56:1658-1664. 182. Gold B, Merriam JE, Zernant J, et al. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nature genetics 2006;38:458-462. 183. Thakkinstian A, McKay GJ, McEvoy M, et al. Systematic review and meta-analysis of the association between complement component 3 and age-related macular degeneration: a HuGE review and meta-analysis. American journal of epidemiology 2011;173:1365-1379. 184. Lueck K, Wasmuth S, Williams J, et al. Sub-lytic C5b-9 induces functional changes in retinal pigment epithelial cells consistent with age-related macular degeneration. Eye (London, England) 2011;25:1074-1082. 185. Kunchithapautham K, Rohrer B. Sublytic membrane-attack-complex (MAC) activation alters regulated rather than constitutive vascular endothelial growth factor (VEGF) secretion in retinal pigment epithelium monolayers. J Biol Chem 2011;286:23717-23724. 186. Kunchithapautham K, Atkinson C, Rohrer B. Smoke exposure causes endoplasmic reticulum stress and lipid accumulation in retinal pigment epithelium through oxidative stress and complement activation. J Biol Chem 2014;289:14534-14546. 187. Yang P, Baciu P, Kerrigan BC, et al. Retinal pigment epithelial cell death by the alternative complement cascade: role of membrane regulatory proteins, calcium, PKC, and oxidative stress. Invest Ophthalmol Vis Sci 2014;55:3012-3021. 188. Thurman JM, Renner B, Kunchithapautham K, et al. Oxidative stress renders retinal pigment epithelial cells susceptible to complement-mediated injury. J Biol Chem 2009;284:16939-16947. 189. Ebrahimi KB, Handa JT. Lipids, lipoproteins, and age-related macular degeneration. Journal of lipids 2011;2011:802059. 190. Zhou J, Jang YP, Kim SR, Sparrow JR. Complement activation by photooxidation products of A2E, a lipofuscin constituent of the retinal pigment epithelium. Proceedings of the National Academy of Sciences of the United States of America 2006;103:16182-16187. 191. Zhao T, Gao J, Van J, et al. Age-related increases in amyloid beta and membrane attack complex: evidence of inflammasome activation in the rodent eye. Journal of neuroinflammation 2015;12:121. 119  192. Lee M, Guo JP, Schwab C, McGeer EG, McGeer PL. Selective inhibition of the membrane attack complex of complement by low molecular weight components of the aurin tricarboxylic acid synthetic complex. Neurobiology of aging 2012;33:2237-2246. 193. Lee M, Narayanan S, McGeer EG, McGeer PL. Aurin tricarboxylic acid protects against red blood cell hemolysis in patients with paroxysmal nocturnal hemoglobinemia. PloS one 2014;9:e87316. 194. Liu RT, Gao J, Cao S, et al. Inflammatory mediators induced by amyloid-beta in the retina and RPE in vivo: implications for inflammasome activation in age-related macular degeneration. Invest Ophthalmol Vis Sci 2013;54:2225-2237. 195. Stine WB, Jungbauer L, Yu C, LaDu MJ. Preparing synthetic Abeta in different aggregation states. Methods in molecular biology 2011;670:13-32. 196. Sarroukh R, Cerf E, Derclaye S, et al. Transformation of amyloid beta(1-40) oligomers into fibrils is characterized by a major change in secondary structure. Cell Mol Life Sci 2011;68:1429-1438. 197. Cao S, Wang JC, Gao J, et al. CFH Y402H polymorphism and the complement activation product C5a: effects on NF-kappaB activation and inflammasome gene regulation. The British journal of ophthalmology 2016;100:713-718. 198. Yang P, Tyrrell J, Han I, Jaffe GJ. Expression and modulation of RPE cell membrane complement regulatory proteins. Invest Ophthalmol Vis Sci 2009;50:3473-3481. 199. Anderson DH, Talaga KC, Rivest AJ, Barron E, Hageman GS, Johnson LV. Characterization of beta amyloid assemblies in drusen: the deposits associated with aging and age-related macular degeneration. Experimental eye research 2004;78:243-256. 200. Georgiannakis A, Burgoyne T, Lueck K, Futter C, Greenwood J, Moss SE. Retinal Pigment Epithelial Cells Mitigate the Effects of Complement Attack by Endocytosis of C5b-9. Journal of immunology 2015;195:3382-3389. 201. Kitzler TM, Papillon J, Guillemette J, Wing SS, Cybulsky AV. Complement modulates the function of the ubiquitin-proteasome system and endoplasmic reticulum-associated degradation in glomerular epithelial cells. Biochimica et biophysica acta 2012;1823:1007-1016. 202. An E, Lu X, Flippin J, et al. Secreted proteome profiling in human RPE cell cultures derived from donors with age related macular degeneration and age matched healthy donors. Journal of proteome research 2006;5:2599-2610. 203. Johnson LV, Forest DL, Banna CD, et al. Cell culture model that mimics drusen formation and triggers complement activation associated with age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 2011;108:18277-18282. 204. Thompson RB, Reffatto V, Bundy JG, et al. Identification of hydroxyapatite spherules provides new insight into subretinal pigment epithelial deposit formation in the aging eye. Proceedings of the National Academy of Sciences of the United States of America 2015;112:1565-1570. 120  205. Song F, Poljak A, Valenzuela M, Mayeux R, Smythe GA, Sachdev PS. Meta-analysis of plasma amyloid-beta levels in Alzheimer's disease. J Alzheimers Dis 2011;26:365-375. 206. Guymer R, Cipriani T, Rittenhouse KD, et al. Plasma levels of amyloid beta and other proinflammatory mediators in patients with age-related macular degeneration. Graefes Arch Clin Exp Ophthalmol 2015;253:1347-1354. 207. Jiang H, Burdick D, Glabe CG, Cotman CW, Tenner AJ. beta-Amyloid activates complement by binding to a specific region of the collagen-like domain of the C1q A chain. Journal of immunology 1994;152:5050-5059. 208. Bergamaschini L, Canziani S, Bottasso B, Cugno M, Braidotti P, Agostoni A. Alzheimer's beta-amyloid peptides can activate the early components of complement classical pathway in a C1q-independent manner. Clinical and experimental immunology 1999;115:526-533. 209. Wang J, Ohno-Matsui K, Yoshida T, et al. Altered function of factor I caused by amyloid beta: implication for pathogenesis of age-related macular degeneration from Drusen. Journal of immunology (Baltimore, Md: 1950) 2008;181:712-720. 210. Moskovich O, Herzog LO, Ehrlich M, Fishelson Z. Caveolin-1 and dynamin-2 are essential for removal of the complement C5b-9 complex via endocytosis. J Biol Chem 2012;287:19904-19915. 211. Ebrahimi KB, Fijalkowski N, Cano M, Handa JT. Decreased membrane complement regulators in the retinal pigmented epithelium contributes to age-related macular degeneration. J Pathol 2013;229:729-742. 212. Lipo E, Cashman SM, Kumar-Singh R. Aurintricarboxylic acid inhibits complement activation, membrane attack complex, and choroidal neovascularization in a model of macular degeneration. Invest Ophthalmol Vis Sci 2013;54:7107-7114. 213. Hussain AA, Starita C, Hodgetts A, Marshall J. Macromolecular diffusion characteristics of ageing human Bruch's membrane: implications for age-related macular degeneration (AMD). Experimental eye research 2010;90:703-710. 214. Klein R, Myers CE, Cruickshanks KJ, et al. Markers of Inflammation, Oxidative Stress, and Endothelial Dysfunction and the 20-Year Cumulative Incidence of Early Age-Related Macular Degeneration: The Beaver Dam Eye Study. JAMA ophthalmology 2014. 215. Wang AL, Lukas TJ, Yuan M, Du N, Handa JT, Neufeld AH. Changes in retinal pigment epithelium related to cigarette smoke: possible relevance to smoking as a risk factor for age-related macular degeneration. PloS one 2009;4:e5304. 216. Berchuck JE, Yang P, Toimil BA, Ma Z, Baciu P, Jaffe GJ. All-trans-retinal sensitizes human RPE cells to alternative complement pathway-induced cell death. Invest Ophthalmol Vis Sci 2013;54:2669-2677. 217. Loffler KU, Edward DP, Tso MO. Immunoreactivity against tau, amyloid precursor protein, and beta-amyloid in the human retina. Invest Ophthalmol Vis Sci 1995;36:24-31. 121  218. Sonoda S, Spee C, Barron E, Ryan SJ, Kannan R, Hinton DR. A protocol for the culture and differentiation of highly polarized human retinal pigment epithelial cells. Nature protocols 2009;4:662-673. 219. Ding JD, Kelly U, Landowski M, et al. Expression of human complement factor H prevents age-related macular degeneration-like retina damage and kidney abnormalities in aged Cfh knockout mice. Am J Pathol 2015;185:29-42.   122  Appendices  Appendix A  Supplementary tables    Supplementary table 5.1. List of primary antibodies used in immunohistochemistryAntigen Type Dilution Specificity Source and Catalogue No. C5a Mouse monoclonal 5µg/mL Detects a neo-epitope on human C5a and C5a des Arg Abcam, Toronto, ON, Canada; ab11877 C3a Mouse monoclonal 1µg/mL Detects a neo-epitope on human C3a and C3a des Arg Abcam; ab37230 Interleukin (IL)-1β Mouse monoclonal 2.5ug/mL Detects human IL-1β in tissue sections Sigma-Aldrich,  St. Louis, MO; I3642 IL-18 Rabbit polyclonal 5µg/mL Detects IL-18 of human origin in tissue sections MBL International, Woburn, MA; PM014 Tumor necrosis factor (TNF)-α Rabbit polyclonal 1µg/mL Detects human TNF-α existing in forms of Type II membrane protein and extracellular soluble protein  Abcam; ab66579 123  Gene Forward Primer Reverse Primer Luciferase TCACAGAATCGTCGTATGC CGTGATGGAATGGAACAAC IL-1β AAACAGATGAAGTGCTCCTT CAGTTCAGTGATCGTACAG IL-18 GCTTTACTTTATAGCTGAAGAT TCTCACAGGAGAGAGTTGAA Caspase-1 GTCCTGAAGGAGAAGAGA ATGAGAGCAAGACGTGTG NLRP3 CATCCTGGCTGTAACATTC TCTCCCCCACATAGAGTCT IL-6 CCAGGAGAAGATTCCAAAG TGTTCTGGAGGTACTCTAG IL-8 TTGGCAGCCTTCCTGATTT AGACAGAGCTCTCTTCCAT GAPDH CATCACCATCTTCCAGGA AGCTCAGGGATGACCTTG  Supplementary table 5.2. The sequences of RT-PCR primers124  Gene Forward Primer Reverse Primer CD46 CCAAAGTGTCTTAAAGTGCTGCCTC CTAGGACCTGAGGCACTGGACG CD55 AGGCATTTTCATCTTTCCTTCGGG CCTTATCACCATCAACACCCCTGG CD59 GAGCCCAGGGAGGGAAAGGTTC CGAGGTTAAGGCAAAACCCTACGG Complement factor H (CFH) GCCTTCCTTGTAAATCTCCACCTG TCTGCATGTTGGCCTTCCTGTCC Complement factor I (CFI) GGCAGGTGGCAATTAAGGATGCC GGGGTGTATCCAGTCTACTACTGT GAPDH AATCCCATCACCATCTTCCAGGAG GTTCAGCTCAGGGATGACCTTGC  Supplementary table 6.1. The sequences of RT-PCR primers125  Appendix B  Supplementary figures    Supplementary figure 4.1. The GM-CSF level in vitreous is not associated with the collection time. Each point represented data from one donor sample. There is no relationship between the GM-CSF level and the collection time (Pearson correlation, N = 20, r = 0.2769, p = 0.237).126   Supplementary figure 5.1. Immunofluorescence pattern of tight junction protein ZO-1 in ARPE-19 cultured on Transwell filters for 4 weeks.127   Supplementary figure 5.2. The increased trend of C3a was associated with the CFH Y402H polymorphism, but did not induce NF-κB pathway in RPE cells. A: The immunoreactivity of C3a demonstrated an elevated trend associated with the at-risk CC variant of the CFH Y402H polymorphism, but did not reach significance (mean ± SEM, Kruskal Wallis test, p > 0.05). B: C3a at different dosages did not induce NF-κB pathway activation in ARPE19/NF-κB luciferase reporter cells. (N=3, Student’s t test, p > 0.05).128   Supplementary figure 5.3. Stimulation with C5a and TNF-α on non-polarized ARPE-19 culture. A: C5a and TNF-α induced dose-dependent NF-κB pathway activation in ARPE19/NF-κB luciferase reporter cells. C5a stimulation at 1 or 5 µg/ml induced NF-κB activation in ARPE19 reporter cells, while TNF-α stimulation at 10 or 20 ng/ml induced NF-κB activation (N=3, Student’s t test, **p < 0.01, *p<0.05). B: Stimulation with C5a or TNF-α upregulated NF-κB-responsive genes. TNF-α (20 ng/ml, 12 hrs) upregulated the inflammasome genes caspase-1, IL-1β, as well as pro-inflammatory genes IL-6, IL-8, while C5a (5 µg/ml, 12 hrs) upregulated IL-18, IL-6 and IL-8. (N=3, Student’s t test, **p<0.01, *p<0.05). 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0307354/manifest

Comment

Related Items