Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of ergothioneine in the physiology and pathogenesis of Mycobacterium tuberculosis. Richard-Greenblatt, Melissa 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_richardgreenblatt_melissa.pdf [ 2.6MB ]
Metadata
JSON: 24-1.0307173.json
JSON-LD: 24-1.0307173-ld.json
RDF/XML (Pretty): 24-1.0307173-rdf.xml
RDF/JSON: 24-1.0307173-rdf.json
Turtle: 24-1.0307173-turtle.txt
N-Triples: 24-1.0307173-rdf-ntriples.txt
Original Record: 24-1.0307173-source.json
Full Text
24-1.0307173-fulltext.txt
Citation
24-1.0307173.ris

Full Text

The Role of Ergothioneine in the Physiology and Pathogenesis of Mycobacterium tuberculosis  by Melissa Richard-Greenblatt  Bachelor of Kinesiology, Brock University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2016  © Melissa Richard-Greenblatt, 2016  ii  Abstract Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), is capable of synthesizing the small sulfur compound ergothioneine (EGT). The physiological role and regulation of EGT biosynthesis in Mtb is unknown. However, mammalian cells deficient in EGT demonstrate augmented oxidative stress and cell death, suggesting that EGT is an antioxidant.  Through this work, we identified the Mtb EGT biosynthesis genes and characterized rv3701c (egtD) to encode for a histidine methyltransferase that forms the EGT biosynthetic pathway intermediate, hercynine (N-α-trimethylhistidine). Construction of a knockout (ΔegtD) demonstrated the methyltransferase to be essential for EGT biosynthesis in Mtb. We investigated the role of EGT in protecting Mtb during macrophage infection and observed a small but significant difference in the ex vivo growth and survival of the ΔegtD strain relative to H37Rv wildtype and the complement strains 120 h post-infection of murine macrophages. However, there was no difference in survival of the ΔegtD mutant in human THP-1 cells over this time period suggesting an alternative role for EGT in Mtb physiology and pathogenesis. Upon further analysis we found EgtD to be phosphorylated by and interact with the Mtb Serine/Threonine Protein Kinase PknD. Phosphorylation of EgtD both in vitro and inside Escherichia coli identified phosphorylation at site Thr-213, permitting us to generate an EgtD phosphomimetic and phosphoablative mutant strains with our ΔegtD mutant. In vitro analysis, demonstrated phosphorylated EgtD to produce significantly lower quantities of methylated histidine relative to the non-phosphorylated form. Further quantification of intracellular EGT levels in the Mtb EgtD phosphomutants and Mtb PknD transposon mutant identified PknD to negatively regulate EGT biosynthesis. From these results, we identified that EGT biosynthesis is iii  up-regulated in response to nutrient starvation. Under these conditions, the Mtb ΔegtD mutant was unable to maintain viability compared to its parental wildtype and complement strains. As starvation induces a non-replicative state in Mtb, these findings indicate that EGT plays a role in mediating persistent infection or disease latency. Further metabolic analysis identified Mtb intracellular EGT levels to be directly correlated with carbon source type and availability, suggesting a role for EGT in long-term energy storage.    iv  Preface Parts of this thesis have been published in the peer-reviewed journals listed below in chronological order:  1. Richard-Greenblatt, M., Bach, H., Adamson, J., Peña-Diaz, S., Li, W., Steyn, A.J.C., Av-Gay, Y. (2015). Regulation of ergothioneine biosynthesis and its effect on Mycobacterium tuberculosis growth and infectivity. Journal of Biological Chemistry. 290, 23064-76. In the aforementioned manuscript, Y. A.-G. and M. R.-G. conceived and coordinated the study and wrote the paper. M. R.-G., H. B., A. J. C. S., and Y. A.-G. designed experiments. M. R.-G. performed experiments. J. A. designed and performed ergothioneine mass spectrometric analysis. S. P.-D. assisted with mouse macrophages infection studies described in Figure 12A. L. W. cloned PknD for co-expression studies in E. coli found in Section 5.6. A version of this published work is located in Chapter 2 (Sections 2.1-2.10) and Chapters 3-5.  2. Saini, V., Cumming, B.M., Guidry, L., Lamprecht, D., Adamson, J.H., Reddy, V.P., Chinta, K.C., Mazorodzo, J., Glasgow, J.N., Richard-Greenblatt, M., Gomez-Velasco, A., Bach, H., Av-Gay, Y., Hyungjin, E., Rhee, K., and Steyn, A.J.C. (2016). Ergothioneine maintains redox and bioenergetic homeostasis essential for drug susceptibility and virulence of Mycobacterium tuberculosis. Cell Reports. 14, 572-585.  v  In the aforementioned manuscript, I designed and performed the experiments analyzing EGT levels in whib3 mutant the presence of various carbon sources. A modified version of these published results can be found in Figure 19B.  3. Richard-Greenblatt, M., Av-Gay, Y. Epigenetic control of the persistence phenotype by phosphorylation. In W.J. Jacobs, H. McShane, V. Mizrahi, I. Orme (Eds.). The Signature Problem of TB: Persistence. Washington, DC: American Society for Microbiology. In press.  The following book chapter is a review on our current knowledge of the involvement of M. tuberculosis STPKs in establishing a persistent infection in the host. Both Dr. Y. Av-Gay and I participated in writing and editing the manuscript. Modified version of this published work can be found in Section 1.4.  All experiments performed in this thesis were conducted in accordance with the University of British Columbia Research Policies and Procedures, the University Biosafety Committee, the Public Health Agency of Canada guidelines, and with approval from the University of British Columbia Office of Research Services. Biohazard Approval Certificate: B14-0160 (Containment level 2 laboratory) and B14-0157 (Containment level 3 laboratory). Work performed with radioactive materials was approved by the University of British Columbia Advisory Committee on Radioisotopes and Radiation Hazards. Radioisotope License: MEDI-3175-18.     vi  Table of Contents Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iv Table of Contents ........................................................................................................................... vi List of Tables ...................................................................................................................................x List of Figures ................................................................................................................................ xi List of Abbreviations .................................................................................................................... xii Acknowledgements .................................................................................................................... xviii Dedication ......................................................................................................................................xx Chapter 1: Introduction ................................................................................................................... 1  Tuberculosis ............................................................................................................ 1     1.1.1 Historical Significance of Tuberculosis .................................................................. 1     1.1.2 Robert Koch and the Tubercule Bacillus ................................................................ 2     1.1.3 Drug Discovery ....................................................................................................... 3     1.1.4 How the Battle Against TB was Won – and Lost ................................................... 8  Biology of Mycobacterium tuberculosis ............................................................... 11  Pathogenesis of Mtb .............................................................................................. 15     1.3.1 Gaining Access to the Phagosome ........................................................................ 15     1.3.2 Evasion of the Innate Immune Response .............................................................. 16     1.3.3 Disease Latency and Mycobacterium tuberculosis Persistence ............................ 18  Mtb Pathogenesis is Dependent on Signal Transduction ...................................... 21     1.4.1 Protein Phosphorylation in Bacteria ..................................................................... 21     1.4.2 Signal Transduction in Mycobacterium tuberculosis ........................................... 23 vii   Ergothioneine ........................................................................................................ 25     1.5.1 Introduction ........................................................................................................... 25     1.5.2 EGT Biosynthesis ................................................................................................. 26     1.5.3 Chemistry .............................................................................................................. 30     1.5.4 Biological Function ............................................................................................... 35                   1.5.4.1 EGT as a Scavenger of ROS and RNS in vitro ............................................. 35   1.5.4.2 EGT in and disease ....................................................................................... 37  Aims of the Study .................................................................................................. 40 Chapter 2: Materials and Methods ................................................................................................ 42  Bacterial Strains and Growth Conditions .............................................................. 42  Cloning and Protein Expression and Purification ................................................. 42  Construction and Complementation of the Mtb H37Rv ΔegtD Mutant ................ 46   2.3.1 Allelic Exchange ................................................................................................... 46   2.3.2 Southern Blot Hybridization ................................................................................. 47  EgtD in vitro Methylation Activity ....................................................................... 47  Intracellular Quantification of EGT ...................................................................... 48    2.5.1 EGT Extraction from Mtb ..................................................................................... 48    2.5.2 ESI LC-MS/MS Analysis of EGT ........................................................................ 49  In vitro Kinase Assays ........................................................................................... 49  Protein-Protein Interaction Assay ......................................................................... 50  Cell-based Phosphorylation ................................................................................... 50  TLC Analysis of Phosphorylated EgtD Activity................................................... 51  Murine J774A.1 Macrophage and THP-1 Monocyte Infection ............................ 51 viii     2.10.1 Tissue Culture ....................................................................................................... 51    2.10.2 J774A.1 and THP-1 Differentiation ...................................................................... 52    2.10.3 Mtb Infection of J774A.1 and THP-1 Cells .......................................................... 52  Mtb Starvation Studies .......................................................................................... 53  Quantification of Mtb Intracellular EGT in the Presence of Carbon Sources ...... 53 Chapter 3: Rv3701c Encodes for a Histidine Methyltransferase Required for EGT Biosynthesis in Mtb ................................................................................................................................................ 55  Introduction ........................................................................................................... 55  Identification of EGT Biosynthesis Pathway in Mtb ............................................ 55  Rv3701c Encodes for EgtD in EGT Biosynthesis ................................................. 56  EgtD is Essential for EGT Biosynthesis in Mtb .................................................... 59  Chapter Summary .................................................................................................. 60 Chapter 4: Role of EGT in the in vitro Growth and Intracellular Survival of Mtb ...................... 62  Introduction ........................................................................................................... 62  Role of Intracellular EGT During in vitro Growth ............................................... 63  Growth and Survival of Mtb ΔegtD in J774A.1 and THP-1 Cells........................ 65  Chapter Summary .................................................................................................. 66 Chapter 5: Regulation of EGT Biosynthesis by Mtb STPKs ........................................................ 68  Introduction ........................................................................................................... 68  EgtD is a Substrate of Mtb STPKs ........................................................................ 69  EgtA is an in vitro Substrate of Mtb STPKs ......................................................... 70  PknD Preferentially Phosphorylates EgtD in vitro ............................................... 71  Phosphorylation of EgtD Reduces the Formation of Methylated His ................... 72 ix   PknD Negatively Regulates EGT Biosynthesis in Mtb ........................................ 74  Chapter Summary .................................................................................................. 77 Chapter 6: Role of EGT in Mtb Starvation and Central Metabolism ........................................... 79  Introduction ........................................................................................................... 79  Mtb Intracellular EGT Levels Increase During Starvation ................................... 80  EGT Biosynthesis is Dependent on Central Carbon Metabolism ......................... 81  Chapter Summary .................................................................................................. 83 Chapter 7: Discussion ................................................................................................................... 84  Rv3701c Encodes for a Histidine Methyltransferase Required for EGT   Biosynthesis in Mtb .................................................................................................................. 84  Regulation of EGT Biosynthesis by Mtb STPKs .................................................. 86  Role of EGT in the in vitro Growth and Intracellular Survival of Mtb ................ 88  EGT is Linked to Central Carbon Metabolism in Mtb.......................................... 91  EGT Maintains Viability of Mtb During Quiescence ........................................... 96  Targeting EGT Biosynthesis as a Strategy to Eliminate Quiescent Mtb ............ 100  Conclusions ......................................................................................................... 101  Future Directions ................................................................................................. 102 References ....................................................................................................................................103  x  List of Tables Table 1. Challenges for the Global Control of Tuberculosis .......................................................... 9 Table 2. Plasmids Used for the Construction of Strains and Recombinant Proteins .................... 43 Table 3. Primers, Oligonucleotides and Restriction Enzymes Used for the Construction of Strains and Recombinant Proteins ............................................................................................................ 44 Table 4. E. coli BL21 (DE3) Protein Expression Conditions for the His and GST-Tagged Recombinant Proteins ................................................................................................................... 45 Table 5. Sequence Identity of Mtb’s EGT Biosynthetic Gene Cluster (rv3700c-rv3704c) with M. smegmatis (msmeg6246-6250)...................................................................................................... 54 Table 6. EgtD Phosphorylation Kinetics ...................................................................................... 71              xi  List of Figures Figure 1. Mtb STPK Signalling Network Associated with Persistence........................................ 25 Figure 2. EGT Biosynthetic Pathway in M. smegmatis ................................................................ 28 Figure 3. Structural Representation of GSH and MSH................................................................. 30 Figure 4. Structure of the Thione-Thiol Tautomers of EGT ......................................................... 31 Figure 5. Schematic of the SAM510™ Methyltransferase Assay  ............................................... 48 Figure 6. In Silico Identification of the Mtb EGT Biosynthesis Gene Cluster ............................. 55 Figure 7. Production of the EgtD Recombinant Protein ............................................................... 56 Figure 8. EgtD Methylation Activity and Kinetics ....................................................................... 57 Figure 9. Construction and in vitro Characterization of ΔegtD in Mtb ........................................ 59 Figure 10. In vitro Growth of Mtb in Nutrient Rich Media .......................................................... 63 Figure 11. Intracellular EGT Levels During Growth of Mtb H37Rv Wildtype  .......................... 64 Figure 12. Replication and Survival of H37Rv Wildtype, ΔegtD, and Complement Strain in J774A1. Macrophages and THP-1 Cells  ...................................................................................... 65 Figure 13. EgtD is a Substrate of Multiple Mtb STPKs ............................................................... 68 Figure 14. EgtA is Phosphorylated by Multiple STPKs in vitro. ................................................. 70 Figure 15. Phosphorylation of EgtD Reduces the Formation of Methylated His ......................... 72 Figure 16. Identification of EgtD Phosphorylation Site by PknD ................................................ 74 Figure 17. Phosphorylation of EgtD Negatively Regulates EGT Levels in Mtb.......................... 76 Figure 18. EGT Biosynthesis is Up-Regulated and Essential for Mtb Survival During Long-Term Starvation ...................................................................................................................................... 79 Figure 19. Intracellular EGT Levels are Influenced by Type and Availability of Carbon Source ....................................................................................................................................................... 81 xii  List of Abbreviations ADS   Albumin, Dextrose, Sodium Chloride Amp   Ampicillin  ART   Antiretroviral Therapy Asp   Aspartate ATP   Adenosine Triphosphate BCG   Bacille Calmette-Guérin bp   Base pair cAMP   cyclic-Adenosine Monophosphate CD4+   Cluster of Differentiation 4 CFP10   10-kDa Culture Filtrate Protein CFU   Colony Forming Unit Cpm   Counts per minute C. purpurea      Claviceps purpurae DIG   Digoxygenin DNA   Deoxyribonucleic Acid DR   Drug Resistant DS   Drug Sensitive DTT   Dithiothreitol E. coli   Escherichia coli EGT   Ergothioneine EgtA   γ-Glutamylcysteine Ligase EgtB   Sulfoxide Synthase xiii  EgtC   Glutamine Aminotransferase  EgtD   Histidine Methyltransferase  EgtE   Pyridoxal 5’-Phosphate Protein  Egt1   Ergothioneine Biosynthesis Protein 1   Egt2   Ergothioneine Biosynthesis Protein 2 ESAT6  Early Secretory Antigenic Target-6 ESSC   Ergothioneine-Cysteine Mixed Disulfide ESSE   Ergothioneine Disulfide ESI LC-MS/MS Electrospray Ionization Liquid Chromatography Tandem Mass Spectrophotometry FAS Fatty Acid Synthase FBS Fetal Bovine Serum Fe2+ Ferrous Iron (II) gDNA Genomic Deoxyribonucleic Acid GDP Guanine Diphosphate GST Glutathione S-Transferase GSH   Glutathione (reduced) GSSG   Glutathione Disulfide (oxidized) h   Hour HEPES  4-(2-hydroxylethyl)-1-piperazineethanesulfonic acid HIV   Human Immunodeficiency Virus His   Histidine HPLC   High Performance Liquid Chromatography xiv  Hyg   Hygromycin ICAM-1  Intracellular Adhesion Molecule-1 IFN-γ   Interferon-γ IL-6   Interleukin-6 IL-8   Interleukin-8 iNOS   Inducible Nitric Oxide Synthase IPTG   1-Thio-β-ᴅ-galactopyranoside JNK   C-Jun N-Terminal Kinase Kan   Kanamycin kDa   KiloDalton LB   Luria Bertani LC-MS/MS  Liquid Chromatography Tandem Mass Spectrophotometry LmbT   Glycosyltransferase (Lincomycin A Biosynthesis) LMW   Low Molecular Weight LTBI   Latent Tuberculosis Infection M. africanum  Mycobacterium africanum M. bovis  Mycobacterium bovis M. leprae  Mycobacterium leprae mDHFR  Murine Dihydrofoltate Reductase  MDR-TB  Multi-Drug Resistant Tuberculosis MHC-II  Major Histocompatibility Complex Class II min   Minute M-PFC  Mycobacterial Protein Fragment Complementation xv  MPP+       Methyl-4-Phenylpyridinium Ion MSH   Mycothiol M. smegmatis  Mycobacterium smegmatis Mtb   Mycobacterium tuberculosis MTBC   Mycobacterium tuberculosis Complex m/z   Mass-to-Charge-Ratio Na+   Sodium NADPH  Nicotinamide Adenine Dinucleotide Phosphate N. crassa  Neurospora crassa NO   Nitric Oxide NOX2   Nicotinamide Adenine Dinucleotide Phosphate Oxidase NRP    Non-Replicating Persistence OADC   Oleic Acid, Albumin, Dextrose and Catalase OCTN1  Organic Cation Transporter 1 OD   Optical Density ORF   Open Reading Frame p38   p38 Mitogen-Activated Protein Kinase pSer   Phosphoserine pThr   Phosphothreonine pTyr   Phosphotyrosine PAS   Para-Aminosalicyclic Acid PBS   Phosphate Buffered Saline PCR   Polymerase Chain Reaction xvi  PDIM   Phthiocerol Dimycocerosate Pkn (A,B,D-L) Protein kinase (A,B,D-L)  ROS   Reactive Oxygen Species RNS   Reactive Nitrogen Species SAH   S-adenosyl homocysteine SAM   S-adenosyl methionine S. cerevisiae    Saccharomyces cerevisiae  SDS   Sodium Dodecyl Sulfate SDS-PAGE  Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Ser   Serine S. pombe  Schizosaccharomyces pombe STPK   Serine/Threonine Protein Kinase TAG   Triacylglycerol TB   Tuberculosis TCA   Tricarboxylic Acid Cycle Thr   Threonine TLC   Thin Layer Chromatography TMP   Trimethoprim Tn   Transposon TNF   Tumour Necrosis Factor Tyr   Tyrosine VCAM-1  Vascular Cell Adhesion Molecule-1 WT   Wildtype xvii  XDR-TB  Extensively Drug-Resistant Tuberculosis  xviii  Acknowledgements The work presented in my thesis represents but a fraction of the opportunities and experiences I have had throughout my Ph.D. studies. I have been very fortunate to collaborate and be under the mentorship of many talented scientists and medical professionals to whom I wish express my gratitude.  First and foremost, I wish to acknowledge the role of my PhD supervisor, Dr. Yossef Av-Gay, in my studies. Over the years, Dr. Av-Gay has maintained an environment for his students that fosters creativity and independent learning which has enabled us to excel as young scientists. Reflecting on my graduate studies I am very appreciative of the freedom Dr. Av-Gay provided me with regards to my project. This freedom allowed me to make mistakes, learn how to solve problems, and gain the confidence to become an independent researcher. Still, in the midst of this independent learning experience Dr. Av-Gay has been supportive. In times where I have felt discouraged, Dr. Av-Gay always demonstrated endless trust in my abilities to excel as a scientist. My Ph.D. studies have pushed me beyond what I believed I would be capable of, and I want to thank Dr. Av-Gay for providing me with the resources and personal support to do so.  I would like to acknowledge my committee members, Dr. Steven Pelech, Dr. Zakaria Hmama, and Dr. Horacio Bach, for dedicating their time and expertise toward my project and personal development. In particular, Dr. Bach has played an instrumental role in my time as a graduate student from the first until the very last day of my training. Dr. Bach taught me a number of techniques, regularly contributed valuable insight to my project, and we have collaborated on a number of projects together.   During my studies I was very fortunate to travel to Durban, South Africa to complete a portion of my research as well as gain knowledge on the clinical and societal aspects of TB. xix  None of this would have been possible without the generosity of Constance Livingstone-Friedman and Sydney Friedman through their creation of the University of British Columbia’s Friedman Scholars Program. I would also like to thank Dr. Charles Slonecker, Dr. James Jamieson and John Fleming for their assistance and support with regards to the Constance Livingstone-Friedman and Sydney Friedman Foundation Scholarships. In South Africa, I worked under the supervision of Dr. Andries Steyn, a lead investigator at the KwaZulu-Natal Research Institute for TB and HIV (K-RITH). I would like to thank Dr. Steyn as well as his lab members for welcoming me into their lab and providing a collaborative work environment. Dr. Steyn also provided me with a unique experience to participate in clinical TB research where I not only gained clinical knowledge, but also learned the impact of socio-cultural, economic and infrastructural factors on the disease.  I would like to thank all of the past and current members of the Av-Gay lab and members of the Centre of Tuberculosis Research. Special thanks to Mary Ko for doing an extraordinary job at managing our lab, Xingji Zheng for hours of helpful discussion, and Dr. Valerie Poirier for her endless support and friendship. I would like to acknowledge financial support from the University of British Columbia Four Year Doctoral Fellowship and the British Columbia Lung Association, and also the British Columbia Center for Disease Control for providing us access to a BCL-3 laboratory.      xx  Dedication To all that have worked toward reducing the suffering of those affected by tuberculosis. Your work and compassion has been most courageous and admirable.  “The Great White Plague, tuberculosis, is never done with its  insidious work; for numberless years it has been silently, continuously  and unrelentingly pursuing its destructive course, never remitting its  deadly work, always reaching out for new victims, and today it is  the most universal scourge of the human race.”    Otis, Edward O. The Great White Plague: Tuberculosis. New York: Thomas Y. Crowell & CO, 1909. Print, p. 2.   1  Chapter 1: Introduction  Tuberculosis 1.1.1 Historical Significance of Tuberculosis Often the importance of a disease to mankind is measured by the number of fatalities it causes. Therefore, tuberculosis (TB), responsible for approximately a billion deaths in the last two centuries, must be considered one of the most significant human diseases of all time (1). Even as we attempt to grasp the magnitude of one billion lives, our imagination must extend further over many more centuries and beyond written history to begin to appreciate the extraordinary nature of the disease itself. Nowhere in the ancient communities of Eurasia is there a record of its beginning. Throughout history it remained a familiar fear, written in the ancient texts of Rigveda and Huangdi Neijung (2). The later stages of TB can sometimes result in disfiguring changes that are easily recognizable in ancient skeletal remains of humans. Particularly, the ulcerative destruction of the vertebrae in TB causes the collapse of the upper region of the spine, generating a characteristic “hunchback” (3).  Such pathology has been observed in the spines of Egyptian mummies and in paintings of hunchback figures on the walls of tombs, suggesting TB was endemic to Egypt as early as 5000 BC (2,4). Yet even further in history, morphological and molecular analysis of the remains of a population living in one of the first known villages of agricultural and animal domestication (9000 BC) confirmed the presence of TB (5) suggesting that the disease has been present since the beginning of civilization. Establishment of the disease in mainland Europe occurred between 2500-1500 BC, but is not predicted to have manifested itself in Britain for a thousand or more years later (6). Throughout succeeding centuries, the prevalence of the disease increased markedly, and by the 2  mid-17th century it was recorded in the London Bills of Mortality that one in five of deaths in the city was due to TB. At the turn of the 19th century, the global death rate was an estimated seven million people a year. Both New York and London, the two most affected cities shared fifty million active cases, and at least half the world’s population was latently infected (1).  Up until this point the cause of TB remained entirely unknown. It was not until the French military doctor, Jean-Antoine Villemin  (1827-1892) showed that TB could be transmitted from infected human tissue to animals in 1865 (7). Still, no treatment existed and by the end of the nineteenth century there was a growing fear that TB may destroy European civilization (1). 1.1.2 Robert Koch and the Tubercle Bacillus On the evening of March 24th, 1882, Dr. Robert Heinrich Herman Koch (1843-1910), a German medical doctor gave a lecture titled “Die Tuberculose” (On Tuberculosis) to the Physiological Society in Berlin (8,9). “The nature of TB has been studied by many, but this has led to no successful results.”  Acknowledging the work of the previous investigators Villemin, Klebs, Cohnheim and Salomonsen, he reminded the audience that none of the previous investigations led to a bacterial cause for TB. Traditional staining methods (methylene blue) used for the demonstration of pathogenic microorganisms in other diseases were unsuccessful. Every experiment devised to identify and culture the TB infective agent had failed. For his own studies, Koch had begun by using the same staining and culturing methods; however, a number of observations led the brilliant scientist in another direction. Following staining with methylene blue, Koch counterstained his slides with vesuvin, a diazo dye, to remove the deep blue stain which coloured everything. At this point, when looking under a microscope, the structures of the animal tissues were brown, but for those known cases of TB, the presence of beautiful blue 3  tubercle bacteria could also be observed. When Koch extracted the tuberculous material from human tissues, he could grow the microorganism, although very slowly, on solidified serum slopes. Upon injecting these cultures into test guinea pigs, in all cases, the disease which developed was the same, and the bacteria obtained from the guinea pigs was identical to that of the serum slopes. Through this set of experiments, Koch not only identified the etiological agent of TB, but conceived his famous postulates, known as Koch’s postulates (9). Even today, Koch’s lecture is generally accepted as the most important in medical history, and was the first step toward a cure for TB. 1.1.3 Drug Discovery  Remaining as a leading cause of death at the turn of the twentieth century, discovering a cure for TB was the most urgent medical problem faced by the world. Despite the discovery of arsphenamine (Salvarsan), penicillin and Prontosil (the first sulfonamide) in the early 1900s, it was soon determined that a cure for TB was not so simple. None of these first antimicrobial agents were active against TB. As a result, the early optimism associated with Koch’s discovery was replaced by pessimism. By the 1930s, few individuals believed a cure would ever be possible (1).  Dr. Selman Waksman (1888-1973), one of the most prominent soil microbiologists of his time, recognized that a large number of disease-causing Gram-negative bacteria were resistant to sulfonamides and penicillin. Waksman was already well aware that soil microorganisms had anti-microbial potential due to the discovery of penicillin (10), gramicidin (11), and his own observations (12,13). In 1943, Waksman hired the graduate student, Albert Schatz, to search for an antibiotic agent possessing broader range activity, especially against Gram-negative bacteria. 4  Streptothricin, which was previously extracted from Streptomyces lavendulae was shown to kill both Gram-positive and –negative bacteria (14,15). These findings led Schatz to focus on Streptomyces species for new antibiotic substances for his studies. One morning, only a couple of months after commencing his PhD, Schatz identified a unique greenish grey colony of bacteria grown from a sample of soil that soon became known as Streptomyces griseus (16). Like all the other bacteria Schatz isolated from soil samples, he analyzed the growth of various infectious bacteria in the presence of S. griseus. To Schatz’s amazement, the zones of inhibition were millimetres and sometimes even centrimetres away from the grey-green streaks of S. griseus. It was clear that Schatz had discovered his first antibiotic,which he called streptomycin. Upon further testing, streptomycin was also found to kill the previously resistant staphylococcus and Gram-negative bacteria (16). Due to its broad range of antimicrobial activity, Waksman and Schatz decided to test streptomycin’s antimicrobial activity as a treatment for TB. Schatz grew the TB bacilli on agar slants to which he had added streptomycin. After three weeks the control slants clearly showed the TB bacillus, meanwhile those containing streptomycin were devoid of growth (16). Despite these seemingly miraculous findings, the two scientists knew based on Waksman’s previous work with streptothricin that, once tested in animals, streptomycin could exhibit significant toxicity (17).  The anti-tubercular activity was tested in animal trials with streptomycin in guinea pigs, where it was found that Mtb infection was abolished and the guinea pigs appeared to have suffered little side-effects from streptomycin (18). A year after these animal trials, streptomycin treatment in the first human suffers from TB took place (19). Shortly prior to this publication, Waksman received a telegram from Feldman and Hinshaw who conducted the studies stating that: “Our streptomycin studies… were fully confirmed 5  experimentally and clinically, establishing this as the first effective chemotherapeutic remedy for tuberculosis. Hearty congratulations.” (20) The celebrations for streptomycin’s success in treating TB were short lived. Within five years of its clinical appearance, streptomycin, which had previously saved the lives of hundreds of thousands, was no longer helpful. In 1948, a publication by the British Medical Research Council compared the outcome of fifty-five patients with pulmonary TB treated with streptomycin to fifty-two patients treated solely with the sanatorium regime (21). Within the first six months, most patients treated with streptomycin showed clearing of TB in their chest X-rays, with only four deaths in this time frame. In contrast, fourteen patients treated with the sanatorium regimen died within the first six months and only 8% showed improvement. As one might expect, these initial findings demonstrated the potency of streptomycin, but a five year follow-up of the same group told a more harrowing tale. Of the fifty-two patients prescribed solely to the sanatorium regimen, seventeen remained, and of those fifty-five treated with streptomycin, twenty-three.  The results were heartbreaking. Streptomycin was not a cure; it reduced, usually only temporarily, the severity of the disease. The American bacteriologist William Steenken Jr. explained these results through drug resistance, as when he monitored the patients treated with streptomycin the majority had germs that were sensitive to the antibiotic. However, after four months of therapy, 90% of patients now had sputum containing streptomycin resistant bacteria (22). Furthermore, in approximately 10% of patients, streptomycin caused ototoxicity, leaving them deaf or permanently dizzy (23).  During the development of streptomycin, the Swedish physician and chemist Jorgen Lehmann was also investigating the use of para-aminosalicyclic acid (PAS) in the treatment of 6  TB. It had been previously shown by Bernheim that salicyclic acid was able to increase the oxygen consumption of the TB bacillus (24), and thus Lehmann deduced that by slightly altering the structure of aspirin he could develop a competitive inhibitor. PAS worked wonderfully against TB in animals (25). The drug not only improved their health in comparison to the control group, it was also free of poisonous side-effects. However, from 1944-1947, the discovery of PAS was overshadowed by streptomycin due to difficulties in its manufacturing. Once mass production was made possible, doctors worldwide could receive large quantities of PAS for clinical trials. PAS was effective in treating patients suffering from severe pulmonary TB that had disseminated to the bowel (26). Later work by Carstensen further showed that PAS could cure other forms of miliary TB (27), and additional studies to follow would confirm these findings (28,29). Despite its observed effectiveness, these trials also ended with a concerning outcome. Although not as dramatically seen with streptomycin, one-third of patients were harbouring bacilli resistant to PAS (30). However, studies performed by the British Medical Council (31) showed that when PAS was given with streptomycin the risk of developing resistance was significantly lower six months following the start of treatment, indicating that the use of combination therapy could be a superior treatment for TB. Having spent over a decade trying to develop an anti-TB drug derived from sulfonamides, Gerhard Domagk, a German Nobel Prize winner for his work in developing the first commercially available antibiotic, stood in front of his audience at the 12th International Congress of Pure and Applied Chemistry. Displaying four drug groups effective against TB, gram for gram (in terms of effectiveness) he demonstrated streptomycin as ten times more effective than PAS for killing the TB bacteria, thiosemicarbazones ten times more than streptomycin, and a new compound that was ten times more potent than thiosemicarbazones. 7  Domagk’s new discovery, called isoniazid (32), had a similar healing effect to that of PAS and streptomycin combined (33). Isoniazid also had a low incidence of side-effects, and was relatively inexpensive to produce. Yet, similar to when PAS and streptomycin were used individually during therapy, the tuberculosis bacteria quickly developed resistance to isoniazid (33). At this point, it became apparent that regardless of the antibiotic used, monotherapy was not a cure for TB. In 1958, Sir John Crofton, a TB expert at the University of Edinburgh discovered that in patients not harboring a drug resistant strain, adherence to a prolonged combination of all three drugs resulted in cure (34). In theory, if a bacterium develops resistance to one of the drugs during treatment, the remaining two drugs would still be adequate to eradicate the infection, but Crofton knew this was not enough. In his 1960 lecture to the Royal College of Physicians in London, Crofton cautioned that combination therapy alone could not defeat the TB epidemic (35). Necessary action included pasteurization of milk, mass radiography of the disease followed by adequate triple drug therapy for all infected, quarantine of all patients until no longer infectious, and general population living standards to reduce overcrowding. To prove this idea, Crofton and colleagues screened 80% of the adult population for TB in Edinburgh and treated all known infections (36), and within eight years the most common cause of death in Edinburgh had been brought under control and the presence of TB was virtually abolished (1).  In a short time, Crofton’s triple therapy would be composed of a more powerful combination. In 1963, the pharmaceutical company Lepetit extracted Rifamycin B from Streptomyces mediterranei (known today as Amycolatopsis rifamycinia) and found it to be as equally  potent as isoniazid (37). Kuschner and colleagues (38) discovered pyrazinamide, and Lederle laboratories ethambutol (39,40). Streptomycin and PAS were replaced by Rifamycin B, 8  ethambutol and pyrazinamide in modern therapy, meanwhile isoniazid remains. To these first six antibiotics, others with less potency or greater toxicity have been added to the list and remain as second and third-line therapies. With the advent of the new drug combination, and the implementation of the all new embracing approach initiated by Crofton across the developed world, although taking almost two decades to achieve, today it appears that people no longer die from TB. It became a disease of the past.  1.1.4 How the Battle Against TB was Won – and Lost Although TB had become greatly reduced in developed countries it has never been eradicated. Despite our current efforts and the determination of all of those before us we have not been successful. In reality, extreme poverty, ignorance, war, corruption and the lack of medical infrastructure observed in the third world has allowed the disease to evolve to appalling proportions.  The World Health Organization (WHO) reports that TB remains the primary cause of death due to an infectious agent worldwide. In 2014, 1.5 million people succumbed to the disease, while another 9.6 million were newly infected. It is estimated that one-third of the world’s population has the asymptomatic form of the disease (latent TB), to which 13 million individuals have active TB at any point in time. Currently, 22 countries are referred to as “high burden” for TB, constituting 82% of global TB prevalence. Of these locations, India (23%), China (10%) and Indonesia (10%) account for the largest number of cases, yet Africa has the greatest burden relative to its population (41).  The arena of the Third World not only prevents the eradication of TB, but has also led to the emergence of drug-resistant strains. Table 1 outlines our current challenges in the global control of TB. It is estimated that 20% of previously treated cases and 3% of new cases are resistant to both isoniazid and rifampin (derived from the early Rifamycin), which is known as 9  multidrug- resistant TB or MDR-TB. Of these cases, 10% are considered extensively drug-resistant (XDR-TB) where patients are unresponsive to at least one injectable second-line drug (kanamycin, amikacin and capreomycin) plus a fluoroquinolone. Even more regrettably, we are beginning to see cases of total drug-resistant TB develop in areas such as South Africa, China, Russia and India.  Table 1. Challenges for the Global Control of TB. Adapted from (42). Diagnostics  Sputum microscopy, main diagnostic in endemic areas: Not sensitive (>104 microorganisms/ml sputum) - Cannot differentiate between DS- from DR-TB - Not effective in diagnosis of pediatric TB, HIV+ patients and extra-pulmonary TB  Culture based methods are the most accurate, but require biosecure laboratories and trained personnel which are costly  Genotypic resistance offers rapid turnaround and fair accuracy but high probability of false-positive diagnosis  GeneXpert Mtb/RIF assay only identifies rifampicin resistance Infection control  Prevention of aerosol transmission in health care facilities and hot-spots in the community is difficult due to high burden  Early diagnosis and treatment are essential to decrease transmission, difficult due to slow treatment response  Lack of infrastructure and funds for prolonged isolation of patients HIV co-infection  HIV epidemic has resulted in poorer treatment outcomes, and higher rates of recurrent disease  Shared toxicities for second-line TB and antiretrovirals  HIV patients susceptible to TB immune reconstitution disease Complicated treatment  Long treatment duration - 6-9 months DS, > 2 years DR  Second-line treatment expensive, more toxic, less potent  Optimal drug regimens for DR cases poorly characterized Inadequate vaccine  BCG vaccine ranges from 0-80% effectiveness in protecting against adult pulmonary TB (43) Limited funding  Cost of treatment is high  Most endemic countries cannot afford to maintain infrastructure and services to optimally manage patients Lack of political commitment  Lack of TB awareness in general  Poor quantification of true disease burden  No immediate threat perceived (Western countries)  No international political pressure 10  Abbreviations: TB, tuberculosis; HIV, human immunodeficiency virus; DS, drug sensitive; DR, drug resistant; BCG, Bacille Calmette-Guérin.  The emergence of the human immunodeficiency virus (HIV) epidemic has also added another unexpected twist to the TB dilemma due to co-infection. The progression of HIV results in the body being in a state of chronic immune inactivation, enhancing one’s susceptibility to infection. During latent TB, the bacteria is contained within a granuloma (collection of immune cells), but in the case of TB-HIV co-infection, the immune system breaks down resulting in reactivation and systemic dissemination of the infection. Consequentially, for individuals with HIV, TB is the number one cause of death. Of further concern are the complications arising out of therapy for TB-HIV co-infection. Restoration of immune competence by antiretroviral therapy (ART), results in a hyper-immune response to the TB bacilli, known as immune reconstitution inflammatory syndrome. Co-administration of TB chemotherapy and ART can also result in severe side-effects such as hepatotoxicity and peripheral neuropathy. Furthermore, rifamycins are strong inducers of the liver metabolic enzyme cytochrome P450, causing enhanced antiretroviral clearance and suboptimal HIV suppression (44). As a result, the challenges associated with treating TB-HIV co-infection increases TB mortality rates, transmission, and risk of disease reactivation. Our neglect of TB as a global health priority has not only been morally indefensible, but reckless. Perhaps the Western World’s fortune in the lack of epidemiological importance of TB has made us ignorant to this global health threat, but in the era of globalization it was only a matter of time that TB would come knocking at our backdoor. Since the advent of TB chemotherapy, the annual incidence of TB has dropped to 4.7 per 100,000 people in Canada and 11  has remained consistent for the last decade (45). However, foreign-born individuals continue to be the main source of our cases (71%) (45). The same holds true for the United States (46) and United Kingdom (47) where migrants from TB endemic countries account for 63% and 73% of cases, respectively, further demonstrating the global spread of the disease. The influx of migrants from TB endemic locations is also a major contributor to the incline of drug-resistant cases in low incidence countries (48). Our measures to detect and treat latent infection of individuals can only be deemed futile as our present prophylactic treatments with isoniazid or rifampicin are likely ineffective for cases of MDR. Consequentially, we continue to observe countless MDR outbreaks throughout the developed world, with direct costs for treatment of each case approximating $134,000 US (49). Thus, if we do not take on the challenge of controlling TB in the undeveloped world now, the work and dedication of all those before us to eradicate this disease will have been for nothing.  Biology of Mycobacterium tuberculosis In 1882, Prof. Robert Koch identified the bacterium Mycobacterium tuberculosis (Mtb) to be the causative agent of TB in humans (9). When Koch peered down his microscope he observed his stained bacteria in brilliant blue take the long slender shape of a bacilli that barely reaches 3 millionths of a meter in length. At the same time, he noticed many of Mtb’s characteristics were similar to another bacterium, M. leprae, which causes leprosy. Indeed, both of these microorganisms are members of the genus Mycobacterium that belong to the suborder Corynebacterineae and order of Actinomycetales.  Mycobacteria are predominantly environmental organisms, living in soil and aquatic environments; however, several transitions from the environment to pathogenicity have occurred in this genus. Mtb is a member of a group of mycobacteria known as the M. tuberculosis 12  complex (MTBC), which is believed to have risen from the clonal expansion of a smooth tubercle bacillus progenitor population some 2.5 million years ago (50). In addition to Mtb, the MTBC also includes the human pathogen Mycobacterium africanum and a clade of animal-infecting mycobacteria (such as Mycobacterium bovis), all of which exhibit low genetic diversity (99.9% nucleotide similarity and identical 16S rRNA) (51,52).  Genomic data of smooth tubercle bacilli indicate that the origin of MTBC is from a previous human-infecting mycobacterial species derived from East Africa, and human migration out of Africa led to the emergence of seven separate Mtb lineages. During this period, a strain of Mtb evolved to infect non-human mammals, generating the animal-adapted M. bovis ecotypes approximately 70,000 years ago. These genomic studies indicate that human TB did not arise from zoonosis, and mycobacterial diseases likely predates Homo sapiens (50).  Mycobacterial pathogens can also be divided into two groups based on growth rate: slow-growing and fast-growing species. Rapid growers, such as Mycobacterium fortuitum, generally show visible growth from dilute inocula within 3-4 days. In contrast, those slow-growing species, including Mtb, have a doubling time at barely a thirtieth the rate (doubling time ~ 20 hour) of well-studied bacteria and are visible after three weeks of growth. Despite growing slowly, the metabolic rates of mycobacteria are comparable to fast-growing bacteria. This characteristic confers mycobacteria with a major survival advantage over their counterparts. Slow growth with normal rates of metabolism permits the induction of cellular adaptation before reaching determinants of cell survival. For fast-growing bacteria, the inhibition of a cell process coupled with rapid growth results in imbalances in metabolism and ultimately cell death (53).  There are several examples of the success of mycobacterial adaptation to environmental conditions, most notable being anaerobiosis (54,55), low pH (56) and starvation (57-59). These 13  conditions induce a state of quiescence where the bacterial population slows or arrests its growth and can persist in a viable non-replicating state for months or even years. Another unique aspect of mycobacteria is their metabolic requirements. These bacteria are neither fastidious nor auxotrophic (53). Despite metabolic activity being influenced by oxygen tension, mycobacteria are facultative aerobes, and can generate fumarate and use it as an electron sink through the reductive tricarboxylic acid (TCA) cycle for the synthesis of ATP during anaerobiosis (60). Furthermore, mycobacteria lack catabolite repression systems that enable many bacteria to selectively use carbon sources (61). Rather, mycobacteria co-catabolize multiple carbon sources simultaneously, permitting the exploitation of nutrients available and ease the adaptation to nutrient deficiencies. Consequentially, this unusual metabolic plasticity further enables mycobacteria to adapt to a wide range of environments.  Perhaps the most unique characteristic of mycobacteria is its cell wall. The Mtb cell wall is a complex structure that differs significantly from the canonical cell envelope of Gram-positive and Gram-negative microorganisms (62). One of its key aspects is its high lipid content, accounting for up to 60% of the dry weight of the bacterium (63,64). This unique architecture confers the cell envelope with an unusually high hydrophobicity and low permeability. Consequentially, the low permeability of the cell wall prevents accurate Gram staining, and thus requires mycobacteria to be diagnostically recognized using acid-fast dyes, such as Ziehl-Neelsen stain (65). The cell envelope itself is composed of three main components: a plasma membrane, a covalently linked complex of peptidoglycan, arabinogalactan and mycolic acids, and a polysaccharide-rich capsule-like layer (62). The most interior portion of the cell envelope, the plasma membrane, is similar to that of other Gram-positive bacteria with the exception that it is 14  rich in phosphatidylinositol mannosides, a feature similar to all members of Actinomycetales (66). Surrounding the plasma membrane is a thin peptidoglycan layer consisting of an unusually high degree of cross-linking. Traditionally, peptidoglycan precursors inserted into the cell wall are linked by transpeptidases to produce 3-4 crosslinks; however, in the case of Mtb, up to 80% of peptidoglycan contains 3-3 peptide crosslinks (67,68). This heavy cross-linking not only provides added structural stability to the cell, but also plays an important role in resisting  immune clearance (69-72). Attached to the N-acetyl glucosamine polymers of peptidoglycan are molecules of arabinogalactan, which are in turn esterified at their distal ends to a variety of 60- to 90- carbon long, branched α-alkyl, β-hydroxy mycolic acids. Mycolic acids are a large family of related lipids present in mycobacteria, and are the hallmark of this genus, as they are responsible for the observed thick waxy coat and a major contributor to their cell wall impermeability. This mycolyl-arabinogalactan-peptidoglycan complex layer is further intercalated with an assortment of “free lipids”, such as phthiocerol dimycoserosates (PDIMs), phenolic glycolipids, trehalose-containing glycolipids, and sulfolipids that are anchored to the plasma membrane and extend to the exterior of the cell wall. Lastly, a loosely bound extracellular material, in the form of the capsule, acts as the interface between the mycobacterial environment and cell wall. This matrix is primarily composed of proteins and polysaccharides (73), with only a small proportion (2-3%) containing lipid (74). Variation in the composition and structure of the mycobacterial membrane exist and is a major determinant of growth, physiology and virulence between these species. Although only briefly described here, the biology of mycobacteria is complex and differs significantly from other bacteria. It might be expected that the slow growth of mycobacteria would result in being outcompeted by other microorganisms in their environment. However, these bacteria have evolved compensating factors such as a hydrophobic, lipid-rich impermeable 15  cell wall envelope, the ability to transition into a state of quiescence during environmental stress, and metabolic flexibility, that have permitted their survival, growth and persistence in a wide range of environments. Furthermore, this slow growth allows time for mycobacterial cells to adapt to changing conditions before loss in viability. Taken together, it is evident that the adaptive strategies employed by Mtb are essential in its pathogenesis, yet we understand so little about it. Thus, if we want to manage TB, we must prioritize our understanding of Mtb biology and its response to changes in the environment.  Pathogenesis of Mtb Mtb has evolved into an extraordinarily successful pathogen that has enabled it to intimately sense the host’s environment, and adapt its physiology to prevent unrestrained replication or perfect symbiosis that would threaten its existence as a species. Thus, to avoid killing of the host or itself, the lifecycle of Mtb consists of a prolonged period of replicative quiescence tolerant to host immunity and conventional antibiotics, which can at times last decades or even the lifetime of the host, followed by an obligatory episode of replication, required for transmission to a new host. 1.3.1 Gaining Access to the Phagosome Following aerosol transmission to a new host, Mtb first encounters the alveolus of the lung where it is phagocytosed by tissue resident alveolar macrophages, neutrophils, or dendritic cells. Although macrophages are the primary reservoir for Mtb during infection, the bacillus has also been reported to infect non-phagocytic cell types such as adipocytes and epithelial cells (75,76). Entry of Mtb into cells can occur through macropinocytosis (77) or through a variety of receptors. Receptor mediated phagocytosis is believed to be primarily non-opsonic (C-type lectin) and triggered by the surface components of Mtb (78). However, entry into the 16  macrophage through these receptor mediated pathways is thought to block its microbicidal mechanisms (79), assisting the bacterium to acquire safe passage to its intracellular niche, the phagosome.  1.3.2 Evasion of the Innate Immune Response Following internalization of a particle or pathogen, phagosomes normally undergo a series of rapid and extensive modifications that alter their biochemical composition and function in a process known as phagosome maturation. The process of maturation includes subsequent fusion of the phagosome with endosomes and lysosomes, leading to progressive acidification, alteration in ionic composition, and accumulation of lytic enzymes, oxygenated lipids, and reactive oxygen and nitrogen species (ROS and RNS, respectively) that can further be intensified with immune activation by cytokines, such as interferon-γ (IFN-γ). The acidic pH of the maturing phagosome activates enzymes that degrade bacterial proteins and lipids, and simultaneously suppresses bacterial metabolism. ROS and RNS act to damage the cell components of microorganisms by modifying their DNA, lipids, thiol groups, tyrosine side chains and active centres of metalloproteins. As maturation progresses, the invading microbe experiences further insult by cationic antimicrobial peptides that cause permeabilization of their membrane (80). As an intracellular pathogen, Mtb is able to circumvent the killing mechanisms of the macrophage permitting the bacterium to reside and replicate in the phagosome. During the process of phagocytosis, Mtb encounters ROS generated by NADPH oxidase (NOX2), known as the phagocyte oxidative burst. The transfer of electrons from NADPH to phagosomal oxygen by NOX2 creates superoxide, which can further be converted into other microbicidal molecules such as hydrogen peroxide and hydroxyl radicals. In vitro experiments performed by Chan et al. 17  (81) showed that intracellular growth of NOX2-deficient macrophages had no effect on intracellular bacterial growth, suggesting that Mtb is resistant to the inhibitory effects of the oxidative burst.  However, in murine models of infection conflicting evidence exists (82-84). Further studies investigating the response of Mtb to ROS identified the bacilli to be resistant to high levels of oxidative stress, where exposure to 10mM of hydrogen peroxide had no effect on cell viability (85). From these results, it appears that ROS play a minor role in controlling Mtb growth during infection and likely depends on a variety of factors including mode of entry into phagocytes (79), degree of ROS production (86), and the induction of Mtb’s response to oxidative stress (85,87). In contrast, the production of nitric oxide (NO) by inducible nitric oxide synthase (iNOS) has been shown to play a crucial role in the immune control of Mtb (87,88). NO is a highly diffusible free radical, soluble in both lipids and water, and is capable of reacting with oxygen and ROS, to form a variety of RNS, including the highly mycobactericidal peroxynitrite. Mice deficient in iNOS are highly susceptible to TB infection (83,88,89), and the killing of Mtb by human alveolar macrophages is dependent on the activity of iNOS (87). Furthermore, the production of NO has been identified to play a crucial role in maintaining disease latency (89), indicating that NO also exhibits a bacteriostatic effect.  Since the products of iNOS are highly reactive, it is important that iNOS is localized in close proximity to the phagosomal membrane to effectively kill the invading microbe.  To enhance its survival within the phagosome, Mtb employs a number of mechanisms to defend itself against host derived ROS and RNS. One approach utilized by Mtb is to prevent its exposure to these toxic compounds, by either directly inhibiting the assembly of the NOX2 complex (90) and/or interfering with the delivery of iNOS to the proximity of the phagosomal 18  membrane (91). Although significantly contributing to the virulence of Mtb, these two mechanisms are not fool proof. To compensate, Mtb has a number of detoxification processes comprising of (a) scavenging enzymes such as catalase, superoxide dismutase, alkyl hydroperoxide reductases, (b) redox buffering systems (thioredoxins and mycothiol), and (c) truncated haemoglobins (92). Furthermore, Mtb’s resistance to ROS is further augmented by the cell wall components, lipoarabinomannan, cyclopropanated mycolic acids, as well as phenolic glycolipid I, which act as potent scavengers of oxygen radicals (93). Despite its well evolved defense system against ROS and RNS, the intracellular pathogenesis of Mtb is primarily achieved by (a) prevention of phagosome acidification (94) and (b) blocking the fusion of the mycobacteria-containing phagosomes with lysosomes (95). In addition to non-opsonic phagocytosis, Mtb is also known to actively block phagosomal acidification and maturation through the secretion of protein phosphatases (96-98). Preventing the fusion of phagosomes with lysosomal compartments fails to expose Mtb to hydrolytic enzymes, not only enabling bacterial survival, but also halting antigen processing and presentation by the major histocompatibility complex (MHC) class II. In parallel, a number of Mtb lipoproteins act as Toll-like receptor 2 (TLR2) agonists and thus induce signalling pathways responsible for the inhibition of MHC-II expression (79). Attenuation of macrophage antigen presentation impedes T-cell activation and successive secretion of various cytokines required to initiate an adaptive immune response. Through the modulation of MHC-II activity, Mtb is able to escape host immune surveillance and persist long-term within the phagosome. 1.3.3 Disease Latency and Mycobacterium tuberculosis Persistence Innate immune response has little immediate antibacterial effect on Mtb which undergoes “rapid” division until the onset of adaptive immunity. Yet, internalization of Mtb by alveolar 19  macrophages in the airway triggers a pro-inflammatory response that results in the macrophage invading the subtending epithelium. Infected macrophages also secrete a number of cytokines and chemokines that initiate the recruitment of mononuclear cells from nearby blood vessels (99). This process generates a primary lesion of infection that consists of a core of infected macrophages surrounded by foamy macrophages that are further enclosed by lymphocytes. The eventual accumulation of infected antigen presenting cells in the regional lymph nodes of the lungs leads to the development of the adaptive immune response against Mtb (99). This process stimulates the activation of phagocyte antimicrobial activities and leads to the recruitment of additional mononuclear leukocytes into the site of infection. In time, the focus of infection matures and becomes a well-organized, dynamic structure of immune cells at various stages of differentiation known as a granuloma (99). Despite this extensive cell-mediated response, adaptive immunity is unable to eradicate or provide sterile immunity against Mtb (100). The onset of adaptive immunity in conjunction with the tissue response described above act to contain the infection and arrest the period of rapid replication of Mtb (99). At this stage the majority of individuals become asymptomatic, do not shed bacteria, and are considered to have latent TB infection (LTBI). Clinically, LTBI is defined by a reactive tuberculin skin test, indicating a delayed-type hypersensitivity response to intradermal injection of Mtb-derived purified proteins, in the absence of radiographic findings or symptoms of active TB. During this period of latency, the infection is sustained mainly by a population of non-replicating bacilli. During LTBI, the granuloma exhibits a solid architecture comprised of mononuclear phagocytes at different developmental stages, dendritic cells and fibroblasts at its core. A fibrous cuff as well as T and B lymphocytes encases these phagocytic cells, separating them from the surrounding lung tissue. However, in a small number of individuals (2-23%), the immune system 20  cannot effectively contain the infection. The centre of the granuloma can become necrotic and collapse, releasing live bacilli into the airways. This stage of infection is known as reactivation, and leads to active, symptomatic disease which generally results in shedding of Mtb in respiratory secretions, completing the life-cycle of the bacillus (99). While some individuals are never able to contain the primary infection, the majority of adult TB cases are the result of reactivation (with the exception of geographical regions with an extremely high prevalence of TB) (101), and can even occur decades after the initial infection (102). The inability to progress to or maintain LTBI is widely attributed to defects in immunity. Although CD4+ T cells and tumour necrosis factor (TNF) have been described as two major elements in the control of TB and prevent its reactivation, these mechanisms can only explain the minority of situations (101). As previously mentioned, the maximal growth rate of Mtb is approximately 20 h, a finding that is more so related to optimal growth conditions in vitro. In contrast, bacterial populations inside chronically infected animals are found to replicate every 100 h or more (103,104). It is suspected that the unfavourable growth conditions of the host trigger a metabolic adaptation in the bacilli, where a subset of bacteria undergoes complete growth cessation for significant periods of time. Nutrient limitation (58,59), acidic pH (105), low oxygen tension (106), and other host gases (107) associated with the granuloma are suspected to play a major role in slowing the growth of Mtb and causing a drastic drop in its respiration. This physiological adaptation, known as cellular quiescence, is considered a “norm” in the microbial world. When organisms are exposed to growth-limiting stress, the bulk of the bacterial population will slow or arrest its growth and can persist in a viable non-replicating state for months or even years (108). It is important to note that Mtb does not enter a state of true microbial dormancy (sporulation) during its life cycle. Rather, Mtb displays nominal metabolic capacity, maintains its membrane 21  potential, and does not undergo morphological differentiation (106,109). Consequentially, this strategy permits Mtb to maintain its population size throughout a period of stress, relieving the necessity for rapid growth when environmental conditions become favourable which may hinder the bacterium from adapting to its environment. Therefore, the ability of Mtb to adapt its physiology to a variety of conditions, a crucial factor in its pathogenic success, depends on the bacilli’s ability to sense its environment and orchestrate an appropriate response.  Mtb Pathogenesis is Dependent on Signal Transduction 1.4.1 Protein Phosphorylation in Bacteria Phosphorylation is the most common type of post-translational modification that occurs in the cell, and it is the principle mechanism by which extracellular signals are translated into cellular responses (110). Protein kinases are responsible for catalyzing the transfer of phosphate (phosphorylation) to a specific residue on its target protein. The addition of a phosphoryl group provides a double negative charge, a characteristic that is not carried by naturally occurring amino acids, and the ability to form hydrogen bonds through the phosphoryl oxygens. This modification converts a hydrophobic portion of the protein into a polar or hydrophilic region that usually induces a conformational change in the protein’s structure. For example, phosphorylation of a protein can alter its biological activity, stabilize or mark it for destruction, facilitate or inhibit movement between subcellular compartments, or promote conformational changes that can initiate or disrupt protein-protein interactions. With regards to signal transduction, phosphorylation can activate the substrate to transfer the accepted phosphate group to a downstream effector, initiating a cascade of signal-response reaction.  Phosphorylation reactions can be reversed through the action of protein phosphatases. The removal of phosphate from the substrate, a process known as dephosphorylation, can be 22  thought of as restoring activators and effectors to their original or an alternative functional state. Therefore, kinases and phosphatases together represent intracellular on/off control mechanisms of many physiological processes. Today, protein phosphorylation is known to occur across all three domains of life; however, the study of post-translational modification in bacteria was neglected for considerable time. Early attempts to detect its presence were unsuccessful, generating the dogma that protein phosphorylation was a regulatory mechanism that emerged late in evolution to meet the needs of organisms composed of multiple and differentiated cells. The pioneering work of several groups in the 1970s identified protein kinase activity in both Escherichia coli and Salmonella typhimurium (111-113), which soon led to the discovery of the histidine/aspartate (His/Asp) kinases of the two component systems (114,115). The first aspect of this system involves the stimulation of a His kinase by a particular environmental or intracellular signal, resulting in auto-phosphorylation on a key His residue. The phospho-His can then be used as a substrate by the cognate response regulator for its own auto-phosphorylation on an Asp residue. The majority of response regulators are DNA-binding proteins that trigger expression from target promoters. Usually, two component systems work in isolation where a given pair of His kinase and response regulator is highly selective for each other via protein-protein interaction. During the initial phase of His/Asp – dependent phosphorylation discovery, these systems were regarded as the major signal transduction pathway in bacteria, and led to the hypothesis that Ser/Thr/Tyr phosphorylation was a eukaryotic trait, whereas His/Asp phosphorylation was exclusive to prokaryotes. Since this time, our knowledge of protein phosphorylation has been revised. Hundreds of two-component systems have been discovered in eukaryotic cells (116), and recent genomic data indicates that “eukaryotic-like” Serine/Threonine protein kinases 23  (STPKs) are as prevalent in prokaryotes as their His kinase counterparts (117). However, two component systems remain the main signalling mechanism in all phyla of bacteria, with STPKs being most abundant among Acidobacteria, Actinobacteria, various groups of Cyanobacteria as well as bacteria belonging to the order of Myxococcales. 1.4.2 Signal Transduction in Mtb The pathogenic success of Mtb is largely dependent on its ability to sense and adapt to the dynamic environment of the host. As a result, Mtb has evolved an extensive intracellular signalling network consisting of 12 paired two-component regulatory systems (also including four orphan regulators), 11 STPKs, a single protein-tyrosine kinase and three phosphatases, which have been extensively reviewed in the past two decades (97,118,119). The presence of Serine (Ser), Threonine (Thr) and Tyrosine (Tyr) protein kinases enables the cell to generate phosphorylated residues with far greater stability. Generally, the hydrolytic half-time of phosphoryl-Asp is only a couple of hours whereas Ser/Thr/Tyr phosphor-esters, or O-phosphorylation, can produce signals that are stable and require a phosphatase to be reversed (120). Consequently, our current hypothesis is that Mtb uses phosphoryl-Asp for rapid, short-term signal transduction and Ser/Thr/Tyr phosphorylation for long-term global responses giving cells the advantage to adapt and survive in complex environments. The discovery of Mtb STPKs originated from the identification of 11 genes encoding for the subdomains of the Hank’s superfamily of kinases, resulting in their annotation as “eukaryotic-like” STPKs (121). Of the 11 STPKs (PknA, B, D-L), the sequences of nine of these kinases contain a transmembrane region that connects the intracellular N-terminal kinase domain to a C-terminal sensory component that is located extracellularly. Current structural data indicates that these transmembrane receptor kinases are activated by dimerization of their kinase 24  domains resulting in the phosphorylation of the activation loop and ultimately leading to kinase activation (122). The remaining two kinases, PknK and PknG, lack a transmembrane domain. Yet, subcellular fractions of Mtb lysates showed PknK to be present in the cell wall/membrane fraction rather than the cytosol through an unknown anchoring mechanism (123). Therefore, PknG is described as the sole soluble STPK in Mtb. Similar to other prokaryotes, the overall extent of O-phosphorylation in Mtb is limited, amounting to 7.5% of all proteins being phosphorylated (124) in comparison to the 40-45% of eukaryotes (125). As expected, the number of phosphoserine (pSer) and phosphothreonine (pThr) sites in Mtb is significantly greater than phosphotyrosine (pTyr) sites, with over 500 sites identified (124). These findings indicate that each STPK can act on multiple substrates. However, little is known regarding STPK signalling cascades and kinase hierarchy in Mtb. In contrast to His-kinases, which typically phosphorylate a single response regulator, the cross-reactivity observed with Ser/Thr/Tyr protein kinases results in complex signalling cascades, and rarely does the direct output of Mtb Ser/Thr protein phosphorylation involve the direct regulation of expression of target genes. However, some evidence exists of STPK signalling organization typical of two-component systems (123,126-128). Our understanding of bacterial signal transduction has become of great significance due to its role in pathogenicity. During the course of infection, the growth and/or survival of a pathogen relies largely upon its successful adaptation to a continuously changing environment. Our laboratory has argued that STPKs play a crucial role in Mtb’s ability to establish a persistent infection in its host (129). As seen in Figure 1, these intracellular signalling cascades can culminate in alterations in gene transcription, enzymatic activity, cellular localization, or protein-25  protein interactions that result in the rapid adaptation of the bacterium to changes in its environment resulting in a persistent infection.  Figure 1. Mtb STPK Signalling Network Associated with Persistence. STPKs sense specific environmental cues (starvation, hypoxia, and nitric oxide) and coordinate a physiological response that trigger Mtb to enter a state of non-replicating persistence. FAS, fatty acid synthase.   Image from: Richard-Greenblatt and Av-Gay. Epigenetic control of the persistence phenotype by phosphorylation. In W.J. Jacobs, H. McShane, V. Mizrahi, I. Orme (Eds.). The Signature Problem of TB: Persistence. Washington, DC: American Society for Microbiology. In press.    Ergothioneine 1.5.1 Introduction In the middle ages, Europe was haunted by epidemics of gangrenous and convulsive symptoms, a disease known today as ergotism (130). The cause of the disease remained 26  unknown for many centuries until a French physician, Dr. Thuillier, linked these symptoms with the consumption of rye grain infected with ergot in 1670 (131). Ergot, a group of fungi classified by the genus Claviceps, parasitize a number monocotyledonous plants, including corn, wheat, barley, and rye. These fungi produce an assortment of alkaloids that are responsible for the disease that occurs in humans and animals that consume infected grains. The devastating effects from ergot prompted a number of scientists to search for a method to protect crops from infection, and in 1909 this is precisely what French pharmacist and ethnobotanist, Charles Tanret, was undertaking. However, rather than finding a solution he isolated an unusual compound from ergot, to which he named ergothionéine (132). 1.5.2  Ergothioneine Biosynthesis Although ergothioneine (EGT) was originally identified in the fungi Claviceps, its presence has since been found to be distributed across all domains of life. However, not all organisms are able to synthesize EGT. As early as 1911, Barger and Ewins (133) isolated EGT from the blood of pigs and since this discovery all studied animals are found to accumulate EGT in specific tissues. Despite extensive investigation, no evidence exists for the biosynthesis of EGT in mammalian cells (134,135), but the discovery of its occurrence in plant material clarified the question as to its origin in animals (136). EGT is not present in the majority of commonly consumed foods, but is found at high concentrations in specialty mushrooms (Boletus edulis and Pleurotus ostreatus), meat products (liver and kidney) and certain plant products (black beans, red beans, oat bran and garlic) (137). A number of investigations have shown that tissue EGT levels are directly dependent on diet (135,138,139); however, high variability exists in EGT concentration between food groups and within food groups as a result of different cultural practices, geographical location, and timing of harvest (137,140,141). 27  Very little work has been performed regarding its origin in plant material but it is suspected that plants also acquire EGT as a nutrient from their environment (136). To date, EGT biosynthesis is found to be exclusive to a subset of fungi and bacteria. A number of studies have demonstrated that EGT is synthesized by Ascomycetes (142-144) and bacterial species belonging to the Actinobacterial (145-147) and Cyanobacterial (148) phyla. Furthermore, a genetic survey of prokaryotic genomes revealed that EGT biosynthesis also occurs in specific Bacteriodetes, Proteobacteria, Acidobacteria, and Archaeal species (149).  Between microorganisms, EGT biosynthesis follows a similar path, that is, the conversion of His to EGT through the intermediate hercynine. Initial studies in the fungi Neurospora crassa identified the amino acids His, methionine and cysteine to serve as precursors of EGT (150).  Further investigation established that intact histidine is incorporated into EGT (150,151), followed by a triple transmethylation process at the α-amino carbon to form the intermediate hercynine (152,153). Next, hercynine undergoes a sulfurization reaction catalyzed by Fe2+ and O2 to form a second intermediate compound, S-(β-amino-β-carboxyethyl) EGT sulfoxide, which is subsequently converted by a pyridoxal-requiring enzyme to EGT and pyruvate (154). The genes involved in the synthesis of EGT remained entirely unknown until Seebeck (155) identified the mycobacterial EGT gene cluster in M. smegmatis that codes for: a γ–glutamyl cysteine synthase (EgtA), a formylglycine-generating enzyme-like protein (EgtB), a glutamine amidotransferase (EgtC), a methyltransferase (EgtD), and lastly, a pyridoxal 5-phosphate binding protein (EgtE) (Figure 2).  28    Figure 2. EGT Biosynthetic Pathway in M. smegmatis According to Seebeck (155). EGT biosynthesis occurs through five enzymatic steps, and encodes for a γ-glutamyl-cysteine synthase (EgtA), a formylglycine-generating enzyme-like protein (EgtB), a glutamine amidotransferase (EgtC), a methyltransferase (EgtD), and a pyridoxal 5-phosphate protein (EgtE). The pathway proceeds from L-histidine through the intermediary precursor hercynine, hercynyl γ-glutamyl-cysteine sulfoxide, and hercynylcysteine sulfoxide. EGT acquires its sulfur from γ-glutamylcysteine. Modified from (155). SAM, S-adenosyl methionine; ATP, adenine triphosphate; PLP, pyridoxal 5’-phosphate.   Studies in mycobacteria have revealed that EGT biosynthesis follows a similar pathway as in fungi; however, subtle differences have been noted. Interestingly, cysteine and other alternative thiols were unable to act as substrates in the conversion of hercynine, with the exception of γ-glutamylcysteine, a dipeptide formed by EgtA (155). Thus, hercynylglutamylcysteine sulfoxide is a necessary intermediate in the mycobacterial biosynthesis of EGT and the pathway appears to differ in the thiolation process of the imidazole ring of hercynine from fungi (154). Since γ-glutamylcysteine is a precursor for reduced glutathione (GSH; Figure 3A), the major redox buffer in fungi and essential to cellular survival, competition for EGT biosynthesis is not desirable. This idea is supported by the finding that EGT 29  biosynthesis has a 62-fold greater specificity for cysteine than γ-glutamylcysteine by N. crassa (156). However, this does not rationalize the utilization of γ-glutamylcysteine in mycobacterial EGT biosynthesis. Perhaps these findings represent the evolution of GSH biosynthesis in microorganisms. Interesting to note is that when GSH, but not γ-glutamylcysteine, is depleted from the cyanobacterium Synechocystis, EGT is no longer produced, indicating that GSH or a similar mechanism is required for the biosynthesis of EGT (157); however, the role of GSH in EGT biosynthesis remains to be investigated. A second variation exists between the fungal and mycobacterial pathways, as fungi contain a bifunctional enzyme (Egt-1) that catalyzes the first two steps of EGT biosynthesis from His to hercynine to hercynlcysteine sulfoxide. The enzyme contains an N-terminal methyltransferase, and the DinB_2 and FGE-sulfatase domains in the C-terminal region (143). Since EGT biosynthesis in fungi relies on cysteine and does not require an additional enzymatic step for the removal of glutamate, the resulting pathways consists of only two enzymes (Egt-1 and Egt-2). There is increasing evidence that EGT biosynthesis in fungi is linked to sporulation since there is a significantly higher concentration of EGT in the conidia, and the Schizosaccharomyces pombe Egt-1 homologue is up-regulated ~10-fold during ascospore development (143,158). However, certain bacteria belonging to the order Actinomycetales, such as mycobacteria, do not sporulate, and consequently EGT biosynthesis cannot be directly attributed to spore formation. As mentioned earlier, mycobacteria do enter a state of quiescence which can be induced in in vitro cultures through prolonged stationary phase. Interestingly, EGT was found to accumulate in stationary phase cultures of M. smegmatis (159) as well as during quiescence induced by starvation of S. pombe (160,161). It was also demonstrated that EGT biosynthesis increases in 30  response to the depletion of the main redox buffer, mycothiol (MSH; Figure 3B), in M. smegmatis during exponential growth (159). Despite the enhanced production of EGT under these conditions, its quantity always remains in the micromolar range and does not appear to be metabolized by microorganisms known to synthesize it (162-164). Intracellular EGT content is also dependent on the microbial species, their culturing conditions, and phase of growth (146).   Figure 3. Structural Representation of GSH (A) and MSH (B). GSH is derived from the amino acids cysteine, glutamic acid and glycine meanwhile MSH is the product of cysteine, glucosamine and inositol.   1.5.3 Chemistry Two years following its discovery, Barger and Ewins (133) predicted the structure of EGT to be a novel amino acid, a betaine of 2-mercaptohistidine, which was later confirmed by Akabori (165). The location of the sulfur atom on the amidine carbon of the imidazole ring enables EGT to exist in three different tautomeric forms (Figure 4) (166). Although generally misclassified as a thiol, EGT is found predominantly in its thione form under physiological conditions (167), and it is only at a higher pH that EGT ionizes to its thiolate (168).   31   Figure 4. Structure of the Thione-Thiol Tautomers of EGT. Although characterized as a thiol (A), EGT exists primarily as a thione (B) under physiological conditions.   The thiol group of an amino acid is a versatile site for many chemical processes due to its pKa, nucleophilicity, redox properties, metal ion affinity, and bonding characteristics (169). Thiols are generally easily oxidized due to the low dissociation energy of the sulfhydryl (-SH) group. This feature of thiol chemistry became of particular importance following the evolution of aerobic respiration as the amino acid cysteine is highly sensitive to auto-oxidation. Therefore, for a cell to be able to utilize and/or produce oxygen it must cope with thiol oxidation. The most common mechanism employed by cells to prevent cysteine auto-oxidation is by keeping the concentration of free cysteine low and maintaining the bulk of the cysteine supply in a form that is more resistant to auto-oxidation than cysteine itself. These cysteine-containing compounds are generally referred to as low-molecular-weight (LMW) thiols. GSH is the most abundant LMW thiol in mammalian cells and Gram-negative bacteria, and is generally produced at millimolar levels (169).  In contrast, mycobacteria do not produce GSH, rather they synthesize MSH as their major LMW thiol. These cysteine based compounds can undergo autoxidation without serious consequence as the cell contains disulfide reductases that act to restore the compound to its 32  reduced state. Therefore, compounds such as GSH and MSH behave as redox buffers, protecting the cell from endogenous and exogenous oxidative stress.  However, the thiol/thione tautomerism confers enhanced stability of ESH. The standard redox potentials (Eo’) for thiol/disulfide couples generally ranges between -0.20 to -0.40 V (170). In contrast, EGT has an exceptionally high reduction potential of Eo’ = -0.06 V (170), which is almost 200 mV more positive than the GSH/GSSG or MSH/MSSM couple (171). The implication of this distinct redox behaviour results in the resistance of EGT to autoxidation under physiological conditions, a situation where LMW thiols would be easily oxidized (172). Furthermore, this insensitivity to autoxidation enables EGT to participate in heavy metal binding (173), and thereby prevents metal ions from partaking in Fenton-type radical-generating reactions (174). Perhaps the most significant difference between EGT and LMW thiols is the instability of the disulfide (ESSE) under physiological conditions. As mentioned, LMW thiols require reductase enzymes to maintain them in their reduced form (175). To date, there is no evidence of the existence of enzymes catalyzing the reduction of the EGT disulfide back to its thione form. The calculated net free energy of the reduction of ESSE by Hand and Honek (176) indicate that this reaction is thermodynamically favorable in the presence of millimolar concentrations of GSH and EGT. In comparison to other aromatic thiols, the EGT disulfide is less thermodynamically stable due to the tautomerization step of the thiol form of EGT to its thione. Conversion of the thiol to the lower energy thione serves to drive the overall thermodynamics of the ESSE reduction reaction (176). As a result of the inherent instability of the EGT disulfide at physiological pH, EGT is found entirely in its reduced state in biological systems. Thus, it is 33  only possible to observe EGT and ESSE simultaneously under strongly acidic conditions, although it has been observed as a transient species in biological systems (177). The original premise that EGT existed in its sulfhydryl form led many authors to assume its physiological role to be similar to that of GSH. This generalization still appears to dominate literature even today, although early on Woodward and Fry (178) described distinct differences in redox behaviour between these two compounds. Unlike GSH, EGT oxidation in the presence of iodine was almost negligible under extremely acidic conditions. Interestingly, in the presence of GSH in acidic blood filtrates, EGT oxidation can be induced, and is completely oxidized when increasing pH to 5.9 (178). It was later shown that in the presence of excess reduced GSH, EGT does not undergo oxidation. It is only in the presence of oxidized GSH (GSSG) that oxidized EGT can be detected. Thus, the oxidation of EGT in this situation does not result in the restoration of GSH (GSSG + ESH → GSSE + GSH), indicating that GSH is involved in the immediate reduction of EGT (172).  A more in depth investigation of the oxidation conditions for EGT was performed by Heath and Tonnies (172), where it was discovered that EGT can be slowly oxidized (one week) by oxygen in the presence of copper and in strongly acidic solutions, but not under neutral or alkaline conditions. In the same study, EGT was also found to be oxidized immediately after the addition of hydrogen peroxide, but only in acidic solutions. The original spectrum of EGT from these reactions could be restored by the addition of cysteine, indicating that EGT can be reversibly oxidized. The process of reduction by cysteine is described to involve the formation of a mixed disulfide with EGT. In contrast to cysteine, EGT immediately oxidizes to its disulfide (ESSE) in strongly acidic solutions by hydrogen peroxide, 2EGT + H2O2 → ESSE + 2H2O 34  The formation of ESSE results in its rapid reaction with cysteine enabling the formation of a mixed disulfide (ESSC), ESSE + 2 cysteine → 2ESSC  In the presence of excess cysteine, the mixed disulfide is immediately converted to EGT and cystine,  ESSC + cysteine → 2EGT + cystine. The reduction of EGT by GSH was shown to occur in the same manner as described above for cysteine. In the absence of cysteine, the ESSE disulfide slowly reverts back to its reduced form, with decomposition of millimolar solutions taking 3-5 days in water. This slow decomposition can be accelerated if the solution is made alkaline. Once decomposition is complete, only 60-70% of the theoretical amount of EGT can be detected, even following the addition of cysteine. This finding indicates that the decomposition of the disulfide is not solely due to a reduction reaction, and it has been hypothesized to additionally proceed through hydrolytic fission of the disulfide bond to sulfenic acid (has not been experimentally confirmed), ESSE + H2O → ESH + ESOH  which then decomposes further  2ESOH → ESH + ESO2H Therefore, it appears that there are two mechanisms that work in biological systems to maintain EGT in its reduced form: the thermodynamics of the ESSE and GSH. The fact that there are multiple paths to maintain EGT in its reduced form in addition to its resistance to autoxidation indicates the importance of the thione structure for its biological function. Furthermore, the above reactions indicate that ESSE is a highly oxidizing agent, and would cause significant 35  damage to thiol groups in the cell. Perhaps this is one of the reasons that it is maintained at low quantities in the cell. 1.5.4 Biological Function 1.5.4.1 EGT as a Scavenger of ROS and RNS in vitro Based on the presence of its sulfur atom, the majority of research surrounding the biological function of EGT has focused on its role as an antioxidant in cells. The control of ROS and RNS generated by the cell, or from exogenous sources, is a major challenge for aerobic organisms. The hydroxyl radical is one of the most aggressive species as it is capable of reacting with virtually any molecule it encounters in the cell at a diffusion controlled rate (109 to 1010 M-1 s-1) (179). EGT has been found to scavenge hydroxyl radicals near diffusion controlled rates and was 60% more active than the reference antioxidant, uric acid (180). However, it is expected that EGT does not function as a scavenger of hydroxyl radicals in vivo due to the presence of LMW thiols existing at higher intracellular concentrations that are also equally as reactive with the radical. Ozone, a major constituent of photochemical smog and air pollution, is also highly toxic to cells as it can easily react with water to form hydroxyl radicals or extract hydrogen from molecular oxygen to initiate chain reactions. As the skin employs an antioxidant-based system to protect from environmental reactive oxygen species, EGT was analyzed for its ability to neutralize ozone-induced oxidation of β-phycoerythrin. Of the known antioxidants of the skin, EGT demonstrated to have the greatest activity against ozone in vitro (181).   Another biologically relevant ROS is hypochlorous acid, a compound generated by myeloperoxidase from neutrophils at sites of inflammation. One of the major targets of hypochlorous acid in vivo is α1-antiproteinase, the main inhibitor of serine proteinases, such as elastase (182). At concentrations present in vivo, EGT is found to almost completely protect α1-36  antiproteinase from hypochlorous acid (180). Therefore, it has been concluded that this molecule may assist in protecting tissue against the toxic effects of hypochlorous acid. Peroxynitrite is a RNS that is formed through the reaction of NO and superoxide. This anion is both a nitrating agent and powerful oxidant of many biologically important compounds such as lipids and DNA (183). Based on a total oxyradical scavenging assay EGT is shown to directly scavenge peroxynitrite 10%, 80%, and 2950% more efficiently compared to uric acid, trolox (an analog of vitamin E),  and GSH (184). Peroxynitrite induced DNA damage (185), tyrosine nitration, and α1-antiproteinase oxidation (186) was also prevented in the presence of EGT, indicating scavenging occurs at a biologically significant rate. Moreover, EGT displays activity against other peroxyl species to a greater extent than other antioxidants (177,184).  Although EGT scavenges a number of ROS and RNS in vitro, it has not been found to be an efficient scavenger of superoxide (180,187), singlet oxygen (187,188), nitrite or hydrogen peroxide (173) in vitro. The quenching of singlet oxygen by thiols occurs predominately in their thiolate form, and thus its chemical reaction with EGT is highly pH dependent and cannot be observed under physiological conditions (188). Despite these findings, EGT was found to quench singlet oxygen formation by Rose Bengal and phenosafranin, indicating that EGT may function in protecting cells against photochemical damage caused by photosensitizers (189,190). Furthermore, EGT is thought to be unable to scavenge NO due to its inability to protect against the cytotoxic effects of sodium nitroprusside (191).  Enzymatic degradation by catalase and several peroxidases, such as glutathione peroxidase, are the major contributors to controlling levels of hydrogen peroxide in biological systems. Although a weak oxidizing agent, hydrogen peroxide does react with thiols.  However, due to the primary occurrence of the thione, oxidation of EGT by hydrogen peroxide is not 37  observed under physiological conditions (172,192,193). Still, several groups have reported EGT to act as a cytoprotectant against hydrogen peroxide mediated toxicity in cell cultures, indicating that EGT may play a role in the regulation of oxidants (185,194,195) or take part in a cell process that contributes to this effect.  1.5.4.2 Ergothioneine in Mammals and Disease The distribution of EGT throughout the mammalian body is non-uniform as a consequence of the plasma membrane being intrinsically impermeable to this hydrophilic compound. Thus, to be able to enter the cell, EGT requires active transport. More recently, the multi-specific, bidirectional novel organic cation transporter (OCTN1) was identified as having EGT as its optimal substrate, but is also known to transport cationic compounds, such as tetraethylammonium, pyrilamine, quinidine, verapamil, donepezil, betonicine and stachydrine (196,197). Two important factors associated with EGT uptake is the influence of pH and Na+ ions. On the one hand, transport of EGT is optimal under alkaline conditions, and the activity was found to be significantly decreased by 55% when the medium was acidic (198). EGT is also co-transported with Na+, and thus the Na+ gradient across the plasma membrane is a strong driving force for its uptake. On the other hand, the result of the low intracellular Na+ concentration limits the efflux of EGT from the cell, which ultimately results in the accumulation observed in cells containing OCTN1 (196).  The subcellular location of the OCTN1 has been confirmed in the plasma membrane compartments (199,200); however, its presence in the mitochondrial membrane remains controversial (201,202).  A direct relationship between EGT tissue concentration and OCTN1 expression is described in literature (173). Cells expressing OCTN1 were found to accumulate EGT to higher levels than octn1 (-/-) gene knockout mice and resulted in higher baseline intestinal inflammation 38  (203). However, an attempt to characterize EGT deficiency in Caenorhabditis elegans OCTN1 mutants demonstrated an absence of impaired EGT uptake (204). These findings indicate that EGT may accumulate in the extracellular matrix of cells or have alternative transport mechanisms in addition to OCTN1. Therefore the relevance of the OCTN1 transporter in EGT uptake varies between organisms (173) and thus studies analyzing the effect of EGT deficiencies based off of OCTN1 mutants should be interpreted with caution. Perhaps most interesting from this study was the finding that despite the lack of impaired uptake of EGT in OCTN1 mutant nematodes, these organisms still exhibited higher levels of baseline oxidative stress and a reduced lifespan. Furthermore, the provision of excess EGT was unable to rescue the debilitating phenotype, indicating that EGT transport does not explain the deleterious effects of OCTN1 (204). Therefore, it is questionable as to whether EGT deficiency is directly responsible for the oxidative stress phenotype observed with OCTN1 mutations.  EGT has been implicated in inflammatory processes, although its role remains unclear. Several polymorphisms in the octn1 gene have been associated with rheumatoid arthritis (205,206) and Crohn’s disease (207,208) where these mutations result in elevated intracellular EGT levels. In these chronic inflammatory conditions, increased EGT was hypothesized to stimulate inflammation by promoting the survival of immune cells (209,210) as erythroid cells impaired in EGT uptake were observed to be pro-apoptotic (211). Other studies have indicated that elevated levels of EGT is a secondary effect due to cytokine-mediated up-regulation of OCTN1 by TNF-α (209) and interleukin (IL)-1β (212). In contrast, OCTN1 knockout mice were found to be predisposed to intestinal inflammation, and the authors suggest that EGT may play a role in counteracting inflammation (203). In support of this anti-inflammatory effect, EGT has been shown to inhibit TNF-α mediated secretion of IL-8 in epithelial cell cultures (213) as well 39  as IL-6 expression induced by p38 and c-jun N-terminal kinase (JNK) signalling pathways (214). The immunomodulatory effects of EGT are also believed to extend to cardiovascular diseases as EGT has been observed to inhibit the induction of the adhesion molecules VCAM-1, ICAM-1, and E-selectin and prevent binding of monocytes to the endothelium (215).  Although its presence in brain tissue is significantly lower (0.3-1 mg per 100 g tissue) relative to other organs, several groups have analyzed the cytoprotective effects of EGT in neurobiology. EGT was observed to protect against β-amyloid induced apoptosis of PC12 cells (191) and prevent the anti-proliferative effects of cisplatin in rat cortical neurons (216). The neurotoxic effects of both β-amyloid and cisplatin are believed to result from ROS generation. Mice treated with cisplatin exhibited decreased brain EGT levels and body weight and showed increased brain lipid peroxidation, all of which could be restored by oral supplementation with EGT (216). Overstimulation of glutamate receptors by N-methyl-ᴅ-Asp also leads to the production of free radicals and causes neuronal cell death. However, intraperitoneal injection of EGT was found to significantly reduce N-methyl-ᴅ-asparate excitotoxicity of neurons (217). EGT has also been shown to protect rat cardiac and liver tissue  (192,218,219), but not rabbit hearts from ischemia/reperfusion induced damage (220). These findings may represent differences in experimental design or dissimilar expression of OCTN1 by different animals and tissues. Injury from ischemia/reperfusion occurs as a consequence of oxidative stress upon reperfusion; however, the role EGT plays in protecting tissue remains unknown. Lastly, elevated blood EGT levels have been associated with other clinical conditions, such as diabetes and TB. In the case of diabetic patients, EGT was believed to bind zinc, and thereby inhibiting the storage of glucagon and insulin (221-223). However, it has also been suggested that EGT prevents insulin resistance and type 2 diabetes by inhibiting palmitic acid-40  induction of IL-6 (173,214) and reduces embryo malformations in diabetic pregnant rats (224). A link, although not well established, was originally identified in 1951 between EGT and TB (225). Aboriginal patients with pulmonary TB demonstrated elevated blood EGT levels in comparison to healthy controls. In contrast, Caucasian patients with TB showed no difference in blood EGT levels. This correlative study has been criticized for these observed differences resulting from diet (226), and therefore  a well-controlled follow up study is warranted. However, a more recent study observed an association between single nucleotide polymorphisms in OCTN1 and TB susceptibility in the Thai population (227). Although implicated in a wide range of immune-related diseases, it remains unknown as to whether EGT contributes to the pathogenesis or is a cellular defense mechanism. Perhaps understanding the role EGT plays in simpler life forms can help elucidate its function in higher organisms.  Aims of the Study Prior to initiating these studies, there was no known published work on the role of EGT in microorganisms. Based on in vitro findings that EGT can scavenge specific oxidants, and its proposed antioxidant function in mammalian cells, we hypothesized that Mtb synthesizes EGT to protect against macrophage-generated ROS and RNS during the early stages of infection. To explore this hypothesis, we constructed an Mtb H37Rv strain devoid of EGT (ΔegtD) and investigated the role of EGT in Mtb physiology and pathogenesis.  To gain insight into the function of EGT in Mtb, we were interested in examining potential regulators of EGT biosynthesis. We screened the proteins involved in Mtb EGT biosynthesis for their ability to act as substrates of Mtb STPKs and identified multiple STPKs that could phosphorylate multiple enzymes involved in EGT biosynthesis. In our work, we 41  focused specifically on the effect of EgtD phosphorylation by PknD. Here we found that PknD negatively regulates EGT biosynthesis in Mtb. As pknD transcripts are down-regulated during nutrient starvation (228) we predicted that intracellular EGT levels may be increased under these conditions. In addition to finding that the depletion of carbon sources increases the intracellular EGT content, we also observed that EGT is required to maintain viability of Mtb under these conditions. Results from this thesis indicate that EGT plays a role in disease latency, possibly through its effects on Mtb’s central metabolism. 42  Chapter 2: Materials and Methods  Bacterial Strains and Growth Conditions Mtb H37Rv cultures were grown aerobically at 37°C on Middlebrook 7H10 agar plates with 10% (v/v) OADC (oleic acid/albumin/dextrose/catalase) enrichment (BD) or in Middlebrook 7H9 broth (BD) supplemented with 0.05% (v/v) Tween-80, 0.2% (v/v) glycerol, and 10% (v/v) OADC. Hygromycin (Hyg; 50 μg/ml) and kanamycin (Kan; 25 μg/ml) were added for the selection of the appropriate Mtb strains. E. coli DH5α and BL21 (DE3) were grown at 37ºC in Luria Bertani (LB) broth or on LB agar and were supplemented with Kan (50 μg/ml), or ampicillin (Amp; 100 μg/ml) when required.  Cloning and Protein Expression and Purification Tables 2 and 3 summarize the primers, vectors, and restriction enzymes utilized for cloning and site-directed mutagenesis in this study. DNA was amplified by polymerase chain reaction (PCR) from H37Rv genomic DNA using standard methods for cloning. After sequencing, recombinant plasmids were further transformed into E. coli BL21 (DE3) cells for protein expression. Strains harboring the genes to produce recombinant protein were used to inoculate LB broth from an overnight culture (1:100) and the cells were induced with 1-thio-β-ᴅ-galactopyranoside (IPTG) once an OD600= 0.6-0.8 was reached (see Table 4 for over-expression conditions). Protein purification was carried out on either nickel-nitrilotriacetic acid (Qiagen) or GSH agarose (Sigma-Aldrich) resins, according to the manufacturers’ instructions.  Site-directed mutagenesis was performed following established protocol (Stratagene Quick Change). Parental pMV261-egtD or pET28-egtD was used as a template to generate the EgtD phosphomutants in Mtb or E. coli, respectively.  43   Table 2. Plasmids Used for the Construction of Strains and Recombinant Proteins. Plasmids Characteristics Source/Ref. Methylation Assay   pET-28a Produces N-term His6-tagged proteins, KanR Novagen pET-28-egtD pET-28a carrying egtD cloned between NdeI and XhoI, KanR This study egtD knockout mutation   p0004S Cloning vector containing two Van91I sites, HygR (229) phAE159 Temperature-sensitive mycobacteriophage phasmid, AmpR (229) pMRG p0004S carrying 999 bp fragments up- and downstream of rv3701c, HygR This study pGEX-RF pGEX-4T3 carrying 999 bp downstream region of rv3701c, AmpR This study Kinase Assays   pET-22b Produces C-term His6-tagged proteins, AmpR Novagen pET-22b-pknG pET-22b carrying pknG cloned between NdeI and HindIII, AmpR (194) pET-22b-pknH pET-22b carrying pknH(1-401) cloned between XhoI and NdeI, AmpR (230) pET-28-egtA pET28a carrying egtA cloned between NdeI and XhoI, KanR This study pET28-egtDT213A pET-28a carrying full-length egtDT213A cloned between NdeI and XhoI, KanR This study pET28-egtDS70A pET-28a carrying full-length egtDS70A cloned between NdeI and XhoI, KanR This study pGEX-4T3 Produces N-term GST-tagged proteins, AmpR GE Health Care pGEX-pknA pGEX-4T3 carrying pknA(1-337) cloned between BamHI and SalI, AmpR (231) pGEX-pknB pGEX-4T3 carrying pknB(1-332) cloned between BamHI and SalI, AmpR This study pGEX-pknD pGEX-4T3 carrying pknD(1-378) cloned between BamHI and NotI, AmpR (231) pGEX-pknE pGEX-4T3 carrying pknE(1-336) cloned between BamHI and SalI, AmpR (231) pGEX-pknF pGEX-4T3 carrying pknF(1-292) cloned between EcoRI and NotI, AmpR (231) pGEX-pknK pGEX-4T3 carrying pknK(1-299) cloned between BamHI and Not I, AmpR (231)  44    Plasmids Characteristics Source/Ref. M-PFC Assay   pUAB100 Phps60-BamHI-GCN4-ClaI-Gly-mDHFR-[F1,2], HygR (232) pUAB100-egtD pUAB100 carrying full-length egtD between BamHI and XhoI, HygR This study pUAB200 Phps60-MfeII-GCN4-ClaI-Gly-mDHFR-[F3], KanR (232) pUAB200-pknA pUAB200 carrying pknA(1-337) between AflII and ClaI, HygR (231) pUAB200-pknB pUAB200 carrying pknB(1-332) between AflII and ClaI, HygR (231) pUAB200-pknD pUAB200 carrying pknD(1-378) between AflII and ClaI, HygR (231) pUAB200-pknK pUAB200 carrying pknK(1-299) between AflII and ClaI, HygR (231) Co-expression Analysis   pGEX-egtD pGEX-4T3 carrying full-length egtD between BamHI and XhoI, AmpR This study pET-28a-pknD pET-28a carrying pknD(1-378) between BamHI and XhoI, KanR This study Intracellular EGT Levels   pMV261 Mycobacterial extrachromosomal expression vector with a Phsp60 promoter, KanR (233) pMV261-egtD pMV261 carrying full-length egtD between BamHI and ClaI, KanR This study pMV261-egtDT213A pMV261 carrying full-length egtDT213A between BamHI and ClaI, KanR This study pMV261-egtDT213E pMV261 carrying full-length egtDT213E between BamHI and ClaI, KanR This study  Table 3. Primers and Restriction Enzymes used for the Construction of Strains and Recombinant Proteins. Cloning Primers Sequence Restriction Site Methylation Assay   pET-28a-egtD F Ttttttcatatggtgacttcacccgagcag NdeI pET-28a-egtD R Tttctcgagtcagatgtcccacgccaa XhoI egtD Knockout Mutation   pMRG Upstream forward Ttttttttgcataaattgcgcggtcaaacgctgcgcccc BstAPI pMRG Upstream reverse Ttttttttgcatttcttgccgaggtcctttcgcgcggt BstAPI pMRG Downstream forward tttttgcatagattgcgccgcgccggcgacgatgca BstAPI 45  Cloning Primers Sequence Restriction Site pMRG Downstream reverse Tttttgcatcttttgcgtcgatcggcgccagggtgg BstAPI pGEX-UP F ttttttggatccgcggtcaaacgctgcgcccc  BamHI pGEX-UP R Tttttgcggccgccgaggtcctttcgcgcggt NotI pMV261-egtD F Ttttttggatccatgagagtgtcggttgcc BamHI pMV261-egtD R Ttttttatcgattcacttggcggccagcg ClaI Kinase Assays   pET-28a-egtA F Ttttttcatatgacgcttgccgccatg   NdeI pET-28a-egtA R Tttctcgagtcacgacgccccgtgc XhoI pGEX-pknB F Ctattggatccatgaccaccccttcccac BamHI pGEX-pknB R Tatctgtcgactcaccaacggcccaccgaaccgat SalI M-PFC Assay   pUAB100-egtD F Ttttttggatccatgagagtgtcggttgcc BamHI pUAB100-egtD R Ttttttatcgattcacttggcggccagcg ClaI Co-expression Analysis   pGEX-egtD F Ttttttggatccatgagagtgtcggttgcc BamHI pGEX-egtD R Ttttttctcgagtcacttggcggccag XhoI pET-28a-pknD F Ttttttggatccgtgagcgatgccgttccgcag BamHI pET-28a-pknD R Ttttttctcgagctagccgcggctgtccgc XhoI Site-Directed Mutagenesis   UP P22P F Gctggacccgccccaggttctgc - UP P22P R Gcagaacctggggcgggtccagc - UP G107G F Gttcaccgatggacactggttgc - UP G107G R Gcaaccagtgtccatcggtgaac - pMV261-egtDT213A F Cctggcggggtggcggctcagttcaatcgc - pMV261-egtDT213A R Gcgattgaactgagccgccaccccgccagg - pMV261-egtDT213E F Cctggcggggtggaggctcagttcaatcgc -  Table 4: E. coli BL21 (DE3) Expression Conditions for the His and GST-tagged Recombinant Proteins. Plasmid Temperature (ºC) Incubation (h) IPTG (mM) pET-28a_egtA 25 16 0.001 pET-28a_egtD 25 16 0.0001 pGEX_egtD 25 16 1 pGEX_pknA(1-337) 25 16 0.5 pGEX_pknB(1-332) 25 16 0.4 pGEX_pknD(1-336) 16 16 1 pGEX_pknF(1-292) 25 16 0.5 pET-22b_pknG(full length) 25 16 0.1 pET-22b_pknH(1-401) 37 4 1 pGEX_pknK(1-299) 25 16 0.5 46  Plasmid Temperature (ᴼC) Incubation (h) IPTG (mM) pET-28a_pknD(1-336) 25 16 1   Construction and Complementation of the Mtb H37Rv ΔegtD Mutant 2.3.1 Allelic Exchange The ΔegtD mutant strain was constructed via allelic exchange using the conditionally replicating mycobacteriophage, phAE159, as previously described (229). phAE159 is a temperature-sensitive shuttle plasmid that replicates at 30°C, but not at 37°C. To construct the egtD knockout phage, flanking regions comprising of 1000 bp upstream and downstream regions of the egtD (rv3701c) gene were amplified from H37Rv genomic DNA using the primers for pMRG described in Table 3. Flanking sequences for upstream and downstream regions of egtD were amplified by PCR and each fragment contained BstAPI sites for directional cloning into the p0004S cosmid. The up and downstream regions flanking egtD were cloned on either side of the Hyg-resistance/sacB cassette, which was confirmed by sequence analysis and restriction digest using a combination of EcoRI, NcoI, HindIII and NdeI. The recombinant cosmid was digested with PacI and ligated into the PacI site of phAE159 to generate a phasmid capable of replicating as a cosmid in E. coli and a temperature sensitive phage in mycobacteria. The ligated DNA was packaged into phage λ with Gigapack III Gold packaging extract (Stratagene), and E. coli HB101 cells that were previously grown in MgSO4 and maltose overnight. Colonies were selected for growth on LB plates containing 150 µg/ml of Hyg, and phage DNA was extracted and electroporated into M. smegmatis mc2155. Transformation plates were incubated at 30°C for 3 days. Several plaques were picked, and used to prepare a high-titer phage stock (109 PFU/ml) with M. smegmatis. Phages were transduced into Mtb H37Rv and plated on Middlebrook 7H10 supplemented with OADC and Hyg (50 μg/ml). After 4 weeks, Hyg-resistant colonies appeared and were cultured for analysis by PCR and Southern hybridization to identify clones in which allelic exchange had occurred within the rv3701c gene. 47  2.3.2 Southern Blot Hybridization  Southern blotting was performed using the digoxygenin (DIG) hybridization system (Roche Applied Sciences). Chromosomal DNA (12 g) from both the H37Rv wildtype and rv3701c null mutant strain was digested with AflIII. Digested DNA was resolved on a 1% agarose gel prior to its transfer to a nylon membrane via capillary method overnight. Hybridization was performed at 68°C overnight with a DIG-11-dUTP labelled probe. Anti-DIG antibodies were used to detect the probe hybridized to its DNA target.   EgtD in vitro Methylation Activity A reaction containing 10 mM histidine, 4 mM S-adenosyl methionine (SAM), 1 mM Mg(OAc)2, 5 mM NaCl, 20 μg of EgtD and 5 μg S-adenosyl homocysteine (SAH) nucleosidase was prepared as described (155) and incubated overnight at 37ºC. Detection of methylated His products in the reaction was determined by Electrospray Ionization Mass Spectrometry (ESI-MS) at the University of Victoria Genome BC Proteomics Centre. EgtD substrate specificity was analyzed using a continuous enzyme coupled SAM510™: SAM Methyltransferase Assay (Figure 5; G-Biosciences) according to the manufacture’s protocol. Reactions were initiated immediately following the addition of 1 mM of each tested substrate (all proteinogenic amino acids (exception of cysteine), histamine, imidazole, α-methyl-DL-His, 1-methyl-L-His, 3-methyl-L-His) and monitored at 510 nm for 30 min at room temperature.  48   Figure 5. Schematic of the SAM510™ Methyltransferase Assay. The transfer of a methyl group from SAM to the newly methylated substrate results in the formation of SAH. SAH nucleosidase present in the reaction mix converts SAH to S-ribosylhomocysteine and adenine, which is converted into hypoxanthine. Xanthine oxidase further converts hypoxanthine to urate and hydrogen peroxide. The assay is designed to monitor the rate of formation of hydrogen peroxide at 510nm using a colourimetric agent. Image was taken from the G-Biosciences website for the SAM510™:SAM Methyltransferase Assay.   Intracellular Quantification of EGT 2.5.1 EGT Extraction from Mtb Four millilitres wildtype Mtb was harvested by centrifugation. Cells were washed twice in the same volume of ddH2O. Following washing, the cells were resuspended in 2 ml of 70% acetonitrile with 25 ng/ml of the internal standard 1-methyl-4-phenylpyridinium ion (MPP+). Cells were disrupted with the MagNAlyser (Roche) and 0.1 mm silica beads (BioSpec) at a speed of 7000 rpm for 60 s intervals followed by 2 min of rest at -20°C (repeated three times). The extract was then filter sterilized using 0.22 µm nylon polypropylene Spin-X® Centrifuge Tubes prior to exiting the Biosafety Containment Level 3 lab for further analysis by ESI LC-MS/MS. 49  2.5.2 ESI LC-MS/MS Analysis of EGT EGT was quantified using an Agilent 1200 binary HPLC system coupled to an AB Sciex 5500 Q-Trap, triple quadrupole mass spectrometer (Massachusetts, USA). Separation was performed on a Zorbax HILIC Plus column (Agilent Technologies, California, USA; 100 x 2.1 mm, 3.5 µm particle size). Acetonitrile (76%), and water (24%), both containing 0.1% formic acid were used as mobile phase at a flow rate of 200 µl/min. The peak area of EGT was measured using Analyst 1.5.2 (AB Sciex, Massachusetts, USA) and normalized by the weighted contribution of the peak areas of the MPP+ internal standard. Identification of EGT was based on its theoretical m/z value, MS/MS fragmentation data, and its retention time, which was verified by analyzing a pure standard (Oxis International Inc., California, USA).  Calibration curves were generated through a series of EGT standard additions to the sample. Regression coefficients of each calibration curve were all greater than 0.99.  In vitro Kinase Assays In vitro phosphorylation screen was performed as previously described (230) using 1 μg of EgtD or EgtA in 20 μl of the assay buffer (20 mM Tris-HCl pH 7.4, 5 mM MgCl2, 5 mM MnCl2, 1 mM DTT) and varying concentrations of kinase (0.1-1 μg) to obtain optimal autophosphorylation activity. The kinase domains of the following Mtb STPKs used for screening in this assay were PknA, PknB, PknD, PknE, PknF, PknG, PknH, and PknK (see Table 3 for region cloned). Reactions were commenced by the addition of 10 μCi of [γ-32P] ATP (PerkinElmer Life Sciences, 3000 Ci/mmol) and were incubated at room temperature (23ºC) for 30 min. Following the incubation period, reactions were arrested using SDS-sample loading buffer, heated at 95ºC and resolved by SDS-PAGE. Protein was visualized using Coomassie Blue. EgtD dose-dependent phosphorylation kinetics were performed as described above with 50  minor changes. First, the kinase was left to autophosphorylate for 20 min prior to the addition of EgtD. Cold ATP (100 μM) was spiked into 10 μCi of [γ-32P] ATP prior to the addition of ATP to the reactions. The reaction kinetics were monitored by excising the bands corresponding to EgtD and subjecting them to scintillation counting (Beckman Coulter LS 6500). Kinetic parameters were calculated using Prism Software (GraphPad 6.04). EgtD phosphorylation sites were analyzed using LC-MS/MS (phosphopeptide analysis) as described (126) with 1 mM non-radiolabelled ATP by the Genome British Columbia Proteomics Centre at the University of Victoria.  Protein-Protein Interaction Assay Protein-protein interactions were investigated using the mycobacterial protein fragment complementation (M-PFC) assay as previously described (232). Mtb EgtD and STPKs (PknA, PknB, PknD, and PknK) were amplified by PCR and cloned into pUAB100 (expressing murine dihydrofolate enzyme fragments F1, F2) and pUAB200 (expressing murine dihydrofolate fragment F3), respectively. EgtD was co-transformed with each of the four kinases into M. smegmatis mc2155 and co-transformants were selected on 7H11/ Kan/Hyg plates. Co-transformants were re-plated on 7H11/Kan/Hyg plates supplemented with 0 and 10 μg/ml trimethoprim (TMP) and analyzed for growth over 4-5 days.   Cell-based Phosphorylation  EgtD was cloned into pGEX-4T3 and pknD into pET-28a. Both plasmids were co-transformed into E. coli BL21 (see Table 2). Co-transformants were selected on LB plates containing Amp and Kan. Cultures were induced with 1 mM IPTG and further grown for 16 h at 25ºC. Both proteins were purified as described above and resolved by SDS-PAGE and stained using Coomassie Blue to ensure adequate expression of both proteins in the culture. 51  Approximately 20 μg of recombinant protein were then subjected to phosphopeptide analysis by LC-MS/MS to determine egtD phosphorylation sites in a cell-based system.  TLC Analysis of Phosphorylated EgtD Activity Phosphorylated EgtD was obtained through the in vitro kinase assay outlined above. The reaction varied slightly in that 8 μM EgtD, 10 μM non-radiolabelled ATP and 0.4 μM of kinase were used. Reactions were incubated at room temperature for 1.5 h to obtain the maximum yield of phosphorylated EgtD (stoichiometry not determined). Next, 15 mM histidine, 2.5 mM NaCl, 500 μM Mg(OAc)2, and 10 μM SAH nucleosidase were added to the 8 μM of phosphorylated EgtD. The methylation reaction was initiated upon the addition of 10 μmol of S-[methyl-14C]-Adenosyl-L-Methionine (PerkinElmer Life Sciences, 60mCi/mmol).  Samples (10 μl) were taken from the reaction at various time points, which were stopped with 1 μl of 1% trifluoroacetic acid, and stored at -20°C prior to analysis. Samples were subjected to TLC, using PEI Cellulose F plates (EMD Millipore, Darmstadt, Germany) developed in butanol/water/acetic acid (60:25:15; v/v).The separation of radiolabelled SAM and methylated His was visualized using the PhosphorImager SI (Molecular Dynamics) following 7 days of exposure. Ninhydrin (0.03% butanol solution) was used to detect His on the plate. The spots corresponding to His were cut from the plate and subjected to scintillation counting (Beckman Coulter LS 6500) to quantify the formation of methylated His over time.  Murine J774A.1 Macrophage and THP-1 Monocyte Infection 2.10.1 Tissue Culture Both the human monocytic leukemia cell line THP-1 (TIB-202; American Type Culture Collection, Manassas, VA), and murine J774A.1 macrophages (American Type Culture Collection; ATCC catalogue number TIB-67) were grown in 125 cm2 tissue culture flasks 52  (Corning Inc., Corning, NY). J774A.1 cells were cultured in Dulbecco’s modified Eagle medium, high glucose supplemented with 10% fetal bovine serum (FBS), and with 1% of each HEPES, streptomycin, penicillin and non-essential amino acids. In contrast, THP-1 cells were grown in RMPI 1640 medium supplemented with 10% FBS, and 1% of each: L-glutamine, penicillin and streptomycin. Both strains were incubated at 37 °C in a humidified atmosphere of 5% CO2 for 18 h. 2.10.2 J774A.1 and THP-1 Differentiation Both J774A.1 and THP-1 cells were washed with their respective incomplete culture media (media described above without antibiotics) and seeded in 24-well plates (Corning Inc., Corning, NY) at a density of 2.5 x 105 cells/well. THP-1 cells were differentiated into a macrophage-like cell line with 20 ng/ml phorbol myristate acetate. Strains were incubated at 37°C in a humidified atmosphere of 5% CO2 for 18 h. 2.10.3 Mtb Infection of J774A.1 and THP-1 Cells Following differentiation, either cell line was infected with exponentially growing Mtb (OD600 = 0.5) at an MOI of 5:1. However, infection of THP-1 cells was used with human serum-opsonized Mtb. Macrophages were incubated with Mtb for 3 h at 37ºC, 5% CO2. Wells were washed three times and resuspended in culture medium containing 100 μg/ml gentamicin to kill any remaining extracellular Mtb. For colony forming unit (CFU) counting, cells were further washed with incomplete culture medium and the macrophages were lysed using 0.025% SDS at the selected time points post-infection. Serial dilutions of the lysate were plated onto Middlebrook 7H10 agar medium supplemented with OADC and the appropriate antibiotics. Colonies were counted after incubation for 3 weeks at 37ºC. 53   Mtb Starvation Studies Mycobacterial cultures were grown by shaking in Middlebrook 7H9, 0.2% glycerol (v/v), 10% OADC and 0.05% tyloxapol to an OD600 = 0.8. Cells were washed twice with phosphate buffered saline (PBS) and then resuspended in PBS prior to leaving the cultures to stand at 37ºC in sealed 125 ml Erylenmyer culture flasks (Corning Inc., Corning, NY). Mtb viability during starvation was determined by counting CFUs from triplicate cultures over a four-week period. Serial dilutions of the cells were performed and followed by plating onto Middlebrook 7H10 agar medium supplemented with OADC and the appropriate antibiotics. Colonies were counted after incubation for three weeks at 37ºC. The extraction and quantification of intracellular EGT levels was performed at various time points throughout starvation as described in Methods Section 2.5.  Quantification of Mtb Intracellular EGT in the Presence of Carbon Sources H37Rv wildtype was grown to an OD600= ~1.0 in 7H9 supplemented with 10% OADC, 0.2% glycerol and 0.05% tyloxapol. Cells were washed three times in 7H9 containing 0.05% tyloxapol and these cells were used to inoculate new cultures at a starting OD600=0.2. Each culture was grown in the presence 0.05 mM and/or 25 mM of the respective carbon source (glucose, acetate, propionate, myristate, stearate, behenate, palmitate, cholesterol). Lipid and cholesterol stocks (100 mM) were prepared fresh in tyloxapol/ethanol (1:1 v/v) and dissolved at 80ºC immediately prior to use. Carbon sources were added to previously filter sterilized 7H9 and were filtered a second time to prevent contamination. Glucose, acetate and propionate were dissolved in water; however, an equal volume of the tyloxapol:ethanol mixture was added to the media prior to filter sterilization (tyloxapol:ethanol concentration in all carbon source media was 54  a final concentration of 0.5%). Following four days of growth, intracellular EGT was extracted and quantified from the three strains grown in each carbon source.  55  Chapter 3: Rv3701c Encodes for a Histidine Methyltransferase Required for EGT Biosynthesis in Mtb   Introduction To investigate the role of EGT in the physiology and pathogenesis of Mtb we needed to generate a strain devoid of EGT and to identify a candidate gene in EGT biosynthesis for the knock-out procedure. In the majority of mycobacteria, EGT biosynthesis is thought to occur through five enzymatic steps, and the genes encode for a γ-glutamylcysteine ligase (EgtA), a sulfoxide synthase (EgtB), a glutamine aminotransferase (EgtC), a histidine methyltransferase (EgtD) and pyridoxal 5-phosphate protein (EgtE) (155). Of these genes, we were interested in selecting one to construct a knockout strain. Rather than immediately constructing an EGT deficient strain, we wanted to verify that the selected gene was in fact involved and is potentially essential for EGT biosynthesis.  Identification of EGT Biosynthesis Pathway in Mtb Using the NCBI Basic Local Alignment Search Tool, we identified a five gene cluster in the open reading frames rv3700c-rv3704c to putatively encode for EGT biosynthesis in Mtb (Table 5). Table 5.  Sequence Identity of Mtb's EGT Biosynthetic Gene Cluster (Rv3700c-Rv3704c) with the M. smegmatis (msmeg6246-6250). Enzyme Accession Number % Identity % Similarity E-valuea EgtA NP_218221.1 66 77 0.0 EgtB NP_218220.1 77 83 0.0 EgtC NP_218219.1 74 82 4e-116 EgtD NP_218218.1 74 81 6e-173 EgtE NP_338356.1 66 79 9e-158 aObtained from BLAST analysis  56   The five enzymes described in Mtb are similar to that of M. smegmatis (77-83%), and are the reciprocal best hits which provided considerable confidence that this gene cluster is responsible for EGT biosynthesis in Mtb. Furthermore, we did not identify any other gene clusters encoding for these five enzymes. Therefore, based on our in silico analysis we concluded that EGT biosynthesis occurs in Mtb as described in Figure 6.   Figure 6. In silico Analysis Identified the Gene Cluster rv3701c-rv3704c to Encode for EGT Biosynthesis in Mtb.    Rv3701c Encodes for EgtD in EGT Biosynthesis As the main tool needed for the identification of the EGT biosynthetic pathway in Mtb was to generate a single gene knockout mutant, we next determined which gene we were interested in removing. As seen in Figure 4, we predicted that rv3701c encodes for EgtD, a histidine methyltransferase that catalyzes the first reaction step involved in EGT biosynthesis (Figure 2). We believed that knocking out rv3701c would be best suited for our goal of understanding the role of EGT in Mtb physiology. Deleting the first enzyme in the pathway would prevent the accumulation of any intermediates, generating a phenotype specific for the loss of EGT. In addition, His methylation is a very rare reaction in nature and thus we deemed it unlikely that Mtb would contain a methyltransferase homologue which can compensate for EgtD. The synthesis of γ-glutamylcysteine by EgtA represents a second entrance to the pathway. However, we deemed the removal of EgtA would generate a phenotype in Mtb representative of a deficiency in γ-glutamylcysteine, which is a known antioxidant in bacteria (169). 57   We next wanted to confirm that rv3701c was indeed a histidine methyltransferase that is involved in EGT biosynthesis. To test this hypothesis, we cloned rv3701c from Mtb H37Rv for expression in E. coli (Figure 7) and assayed the purified recombinant protein (Figure 8).   Figure 7. Production of the EgtD Recombinant Protein. A, PCR amplification of egtD (966 bp) from Mtb H37Rv genomic DNA; 1% agarose gel. B, egtD positive clone in pET-28a (lane 5), double digested (NdeI-XhoI); 1% agarose gel. C, Purification of the over-expressed EgtD recombinant protein. EgtD was prepared following the induction of E. coli BL21 (DE3) harbouring the pET-28a-egtD plasmid. Proteins were purified using Ni-NTA resin. The elution fraction (containing 250 mM imidazole) was resolved by SDS-12% PAGE and stained with Coomassie blue. The DNA and molecular mass markers are indicated on the left in bp and kDa, respectively.    Using the SAM510 assay, the methylation activity of EgtD was assessed in the presence of each of the proteinogenic amino acids with the exception of cysteine due to its interference with the assay (234). The consumption of SAM in the reaction was continuously monitored at 1-min intervals over a 30-min time period. No change in absorbance was observed, with the exception of His, indicating that only this amino acid could undergo methylation by EgtD (Figure 8A). We further explored substrate specificity using the same methods, and did not detect methylation activity using imidazole and other His-derived substrates such as histamine and the 1-methyl-L-His, 3-methyl-L-His and α-methyl-DL-His. These findings established that EgtD is a methyltransferase with high specificity for the amino acid His. 58   Figure 8. EgtD Methylation Activity and Kinetics. A, Screen of Rv3701c in the presence of each of the proteinogenic amino acids and additional compounds was performed to confirm Rv3701c as a His methyltransferase. Dash line: His; solid line: all proteinogenic amino acids (exception of cysteine), histamine, imidazole, α-methyl-DL-His, 1-methyl-L-His, 3-methyl-L-His. Methylation activity was analyzed by continuously monitoring the consumption of SAM at 510 nm. B, ESI-MS analysis of the methylation activity of Rv3701c in the presence of SAM and His. Upper, Rv3701c catalyzes the methylation of the α-amino nitrogen atom of His to form mono-, di-, and trimethylated His; Lower, Reaction in the absence of Rv3701c. No methylated His products were observed. C, EgtD activity was assessed using the enzyme-coupled SAM510 assay at various concentrations of His. Methylation kinetics indicate that EgtD follows Michaelis-Menten reaction (R2=0.99).   The methyltransferase assay we used for EgtD characterization does not identify the number of methyl groups added to a substrate, but solely describes if methylation is in fact occurring. Thus, we performed ESI-MS analysis on a methylation reaction containing EgtD and His with the attempt to isolate hercynine (α-N,N,N-trimethyl His) variants. As observed in the 59  upper panel of Figure 8B, three methylation products, mono-, di-, and trimethylated His were produced in the presence of EgtD. However, when the same reaction was prepared in the absence of the methyltransferase (Figure 8B lower), His was not transformed into any of the expected methylated products.  Lastly, the dependence of reaction velocity on His concentration was measured in the presence of 5.3 μM EgtD (Figure 8C) using the SAM510 assay at various concentrations of His (0-15 mM). Experimental data was best fitted using the Michaelis-Menten equation (R2= 0.99), and Vmax (115 µM/min·mg ± 2) and Km (422 μM ± 4) were calculated based on the averages of multiple measurements with standard error less than 15%. Based on these values, we further calculated the enzyme’s kcat (2 x 10-2 s-1± 0.0003) and kcat/Km (5 x 103 ± 89 M-1·s-1).  EgtD is Essential for EGT Biosynthesis in Mtb To further confirm the role and determine the necessity of EgtD in EGT biosynthesis, we constructed an Mtb ΔegtD mutant in the H37Rv strain. We replaced the genomic Rv3701c open reading frame by specialized transduction with a Hyg-resistant cassette (Figure 9A) and verified the knock-out strain formation by Southern blot hybridization and PCR (Figure 9B and C, respectively). Intracellular EGT levels were quantified in the parental wildtype Mtb, the Rv3701c null mutant, and a complemented strain whereby the rv3701c mutant was transformed with a plasmid containing the rv3701c gene (pMV261:ΔegtD). Negligible traces of EGT could be detected in extracts prepared from the ΔegtD mutant, while both the wildtype and complemented strains synthesized considerable amounts of EGT (Figure 9D). 60   Figure 9. Construction and in vitro Characterization of ΔegtD in Mtb. A, Schematic diagram of the Rv3701c region of the chromosome of Mtb. Genomic DNA was digested with AflIII, and the blot was probed with a DIG-11-dUTP labelled DNA fragment containing 314 bp of the egtD 3’ flanking sequence. B, Confirmation of the ΔegtD mutant through Southern blot. AflIII digested gDNA giving rise to an expected 1.77 kbp fragment in wildtype Mtb (lane 1) and 2.74 kbp fragment in the Hyg-resistant transductant in which egtD was disrupted with the hyg marker (lane 2). C, PCR analysis of the Hyg-resistant tranductant gDNA for the ΔegtD. Left panel, PCR amplification of the egtD (966 bp). Right panel, PCR amplification of the Hyg-resistant cassette (~700 bp), which replaces egtD in the mutants.  D, Intracellular EGT levels from wildtype Mtb, ΔegtD Mtb and ΔegtD complemented with pMV261:egtD quantified by ESI LC-MS/MS. Error bars indicate the means ± S.D. of three independent experiments.    Chapter Summary Based on its close sequence identity to the previously characterized pathway in M. smegmatis and from the findings presented in this chapter, we found that ORF rv3700c-rv3704c encodes for EGT biosynthesis genes in Mtb. Through a number of biochemical assays, we further characterized the gene product of rv3701c to be a methyltransferase that catalyzes the conversion of His to hercynine in the first reaction step of EGT biosynthesis. Therefore, for the 61  remainder of our work we will refer to rv3701c as egtD. Lastly, the absence of EGT production in the ΔegtD mutant indicates that EgtD is essential for the synthesis of EGT in Mtb. 62  Chapter 4: Role of EGT in the in vitro Growth and Intracellular Survival of Mtb   Introduction To ensure survival throughout infection, Mtb must overcome oxidative and nitrosative challenges associated with xenobiotics, including free radicals produced by the host to cope with infection, antibiotics, and general bacterial respiration. This stress is countered by an intricate detoxification system employed by Mtb that is composed of (a) enzymes such as catalase, superoxide dismutase, and alkyl hydroperoxidase, (b) truncated haemoglobins (c) oxidoreductases, and (d) redox coupling systems (92). The most common molecules involved in defense mechanism against cellular damage induced by ROS are LMW thiols. These small molecules (<500 Da) act as buffers against the hazards of ROS toxicity, scavenging oxidants through their sulfur group. GSH tends to be the dominant thiol in eukaryotes; however, considerable diversity exists in this protective system in prokaryotes (235). Mycobacteria, like most Gram-positive bacteria, do not produce GSH. Rather, they synthesize MSH at millimolar levels designating it as the most abundant LMW thiol in these species (236). Similar to GSH, MSH also serves as an antioxidant that is important in maintaining a highly reducing environment inside the cell (237). Several studies have demonstrated the role of MSH in detoxifying reactive species by either (i) donating a reducing equivalent (238), or (ii) forming an S-conjugate composed of MSH and the respective agent (239). Consistent with these findings, mycobacterial species deficient in MSH are found to have varying yet increased sensitivity to hydrogen peroxide (237,238,240), NO (241), and other redox cycling agents (237,238,242,243). Despite the importance of MSH in protecting mycobacteria against oxidative and nitrosative 63  stressors, Mtb strains lacking MSH remain viable in vivo, which indicates a compensatory mechanism (244). Fahey’s group (159) showed that M. smegmatis mutants devoid of MSH displayed a marked elevation in EGT levels. As mentioned earlier, EGT exists primarily as a thione under physiological conditions, and possesses a lower redox couple value (E0’ -0.06V) (245). Although a poorer reductant, EGT is described as an effective antioxidant through quenching of singlet oxygen, scavenging of hydroxyl radicals, and inhibition of heavy metal-catalyzed reactions, as reviewed in (173), and its depletion in mammalian cells leads to augmented oxidative damage and cell death in the presence of exogenous stressors (195). Furthermore, we show that a transposon mutant that disrupts egtD (hereafter referred to as egtD:Tn) in Mtb CDC1551 exhibits increased sensitivity to hydrogen peroxide, paraquat, menadione, and cumene hydroperoxide (246). Therefore, we were interested in examining the role of EGT in protecting Mtb against ROS toxicity that results from growth in vitro and its influence on the survival of Mtb ex vivo.  Role of Intracellular EGT during in vitro Growth We first explored a potential role for EGT in Mtb growth in vitro. Previously it was shown that MSH is essential for Mtb growth in the absence of catalase (244). The function of catalase supplementation is to remove toxic peroxides in the media (242). As EGT was previously suggested to have overlapping functions with MSH in mycobacteria and protect against peroxides (247), we tested whether the ΔegtD mutant possesses similar growth defects to the MSH deficient mutant under in vitro growth conditions. No differences in growth were observed in rolling or standing cultures containing Middlebrook 7H9 medium supplemented with 10% OADC, 0.2% glycerol and 0.05% Tween-80 (Figure 10A and C). The same results were also observed when these strains were grown in ADS (albumin, dextrose and NaCl) for the 64  wildtype, ΔegtD, and ΔegtD complemented strains (Figure 10B and D). These findings indicate that Mtb does not require EGT for in vitro growth, and the ΔegtD mutant does not require catalase for protection against ROS.  Figure 10. In vitro Growth of Mtb in Nutrient Rich Media. Growth of H37Rv wildtype, ΔegtD, and the corresponding complemented strain (ΔegtD::egtD) grown in Middlebrook 7H9 medium supplemented with 10% OADC (A and C) or ADS (B and D), 0.2% glycerol, and 0.05% Tween-80. Strains were further grown in rolling bottle (A and B) or stationary cultures (C and D). Results are representative of two independent experiments ±S.E. (error bars).   Despite not having observed a growth defect in the ΔegtD mutant, we quantified intracellular EGT levels in wildtype at varying culture densities. Interestingly, we observed EGT to accumulate in Mtb during late-logarithmic phase (Figure 11). These findings indicate that Mtb 65  may utilize EGT under conditions involving growth limiting factors such as nutrient limitation, endogenous waste production, or low pH, rather than the growth process itself.  Figure 11. Intracellular EGT Levels During Growth of H37Rv Wildtype Mtb. Mtb was grown in nutrient rich broth (Middlebrook 7H9 supplemented with 10% OADC, 0.2% glycerol and 0.05% tyloxapol).    Growth and Survival of Mtb ΔegtD in J774A.1 and THP-1 Cells  Since the macrophage generates ROS and RNS as a first line of defence against invading  microorganisms, we hypothesized that EGT enhances the survival of Mtb during intracellular infection. Controversy still exists as to whether human macrophages produce adequate levels of NO. Since the expression of functional iNOS in mouse macrophages has been clearly demonstrated (248), we decided to study the role of mycobacterial EGT in both human monocytes and mouse macrophages. We assessed the growth and survival of the H37Rv wildtype, ΔegtD, ΔegtD::egtD strains in human THP-1 cells and J774A.1 macrophages. Independent infection of the J774A.1 cells showed an approximate half-log reduction in CFUs at 120 h in the ΔegtD mutant (Figure 12A). In contrast, no difference in the survival of the ΔegtD 66  mutant was observed relative to the wildtype in THP-1 cells (Figure 12B). These findings indicate that EGT provides Mtb with greater protection from the environment of murine macrophages rather than human monocytes five days post-infection.  Figure 12. Replication and Survival of H37Rv Wildtype (WT), ΔegtD, and the Corresponding Complement Strain (ΔegtD::egtD) in Macrophages. J774A.1 macrophages (A), and THP-1 monocytes (B) were infected at a multiplicity of infection of 5:1. CFUs were calculated at the specified time points post-infection. Results are representative of two independent experiments that were each performed in triplicates ± S.E. (error bars), **P value <0.01.    Chapter Summary We examined the role of EGT in the growth of Mtb both in vitro and ex vivo. Through these studies we found that growth of ΔegtD mutant is similar to that of wildtype parental strain when grown in rolling bottle or stationary cultures and the media is supplemented with ADS or OADC. From these findings, it appears that EGT is not required for the in vitro growth of Mtb and plays little to any role in protecting against oxidative stress generated under these conditions. When we monitored intracellular EGT levels during Mtb growth in oxygenated nutrient rich cultures, we found EGT to accumulate in late-stationary phase indicating a role for EGT under growth limiting conditions. Despite the observed accumulation of EGT, there was no apparent 67  defect in the ΔegtD mutant entering stationary phase. Our ex vivo experiments showed reduced viability of the ΔegtD mutant in murine macrophages. Interestingly, a similar phenotype for the ΔegtD mutant was not observed in the THP-1 cells, which indicated that the protective effect of EGT is species or cell-line dependent. Furthermore, as the protective effect of EGT does not coincide with the oxidative burst of the macrophage and had no effect on the survival of Mtb infecting THP-1 cells, we suspect that EGT is needed to a greater extent at later stages of the disease.    68  Chapter 5: Regulation of EGT Biosynthesis by Mtb STPKs  Introduction The limited impact EGT has on the survival of Mtb inside of the macrophage led us to hypothesize that EGT has an alternative function in the bacilli’s physiology and pathogenesis. Upon further analysis of the EGT biosynthetic pathway we realized that the synthesis of this molecule is quite an expensive process, consuming the amino acids His and cysteine as well as the co-factors ATP, SAM, and PLP (Figure 2). Therefore, we rationalized that its synthesis must be regulated. We further stipulated that if we could identify the environmental conditions under which EGT is regulated we could gain insight into its role. To start, we surveyed the literature to determine if any of the genes (rv3700c-rv3704c) in the cluster were regulated at a transcriptional level; however, we did not find any evidence for it. Consequently, we postulated that the Egt enzymes might be regulated post-translationally. Since phosphorylation is the most common type of regulatory post-translational modification, we became interested in exploring if the EGT biosynthetic enzymes are a substrate of one of Mtb’s protein kinases. In Mtb, protein phosphorylation occurs through either two-component systems or STPKs. Generally, two component systems work in isolation, where a given pair of a His kinase and response regulator is highly selective for each other via protein-protein interaction (121), and thus we deemed it unlikely that EGT biosynthesis would be regulated in this manner. In contrast, Mtb STPKs have multiple substrates and have previously been identified in regulating several metabolic pathways, including mycolic acid (249-252), glutamine (194), PDIM (253) and glucan (254) biosynthesis. Therefore, we hypothesized that EGT biosynthesis may be regulated through Mtb’s STPK. 69   EgtD is a Substrate of Mtb STPKs Since EgtD is essential for EGT biosynthesis in Mtb (Figure 9D), the enzyme is a logical candidate for regulation in the pathway. As a result, we screened a set of Mtb STPKs for their ability to phosphorylate purified EgtD using in vitro kinase assays. From this screen, we identified PknA, PknB, PknD and PknK as kinases capable of phosphorylating EgtD (Figure 13A), as no radioactive bands were observed in the presence of the other STPKs or when EgtD was incubated in the absence of kinase. These findings indicate that EgtD is an in vitro substrate of several of Mtb’s STPKs.   Figure 13. EgtD is a Substrate of Multiple Mtb STPKs. A, In vitro phosphorylation of EgtD by multiple kinases. Mtb STPKs purified as GST or His fusions were incubated with His-tagged EgtD and [γ- 32P] ATP. Samples were separated by SDS-PAGE, stained with Coomassie blue followed by visualization by autoradiography. Upper bands represent autophosphorylation activity of each kinase (Pkn); lower bands reflect phosphorylated EgtD. B,Interaction between EgtD and Mtb’s STPKs facilitates the reassembly of complementary fragments F1, F2, and F3 of murine dihydrofolate reductase and thus confers M. smegmatis resistance to trimethoprim (TMP). Growth was monitored over 4 days on Kan/Hyg plates supplemented with 0 or 10 g/ml TMP.  Control plates without TMP revealed growth of all strains. Positive control, Mtb ESAT-6 - 35  - 66 kDa - 45 70  (F1, F2), CFP-10 (F3); Negative control, EgtD (F1, F2) with F3 alone. Experiments are shown in duplicates.  To further explore the possibility that EgtD may be regulated post-translationally, we investigated whether EgtD interacts with the four identified kinases in a cell-based interaction assay (232). Performed in M. smegmatis, this assay involves the reassembly of complementary fragments F1, F2 (expressed by pUAB100) and F3 (expressed by pUAB200) of murine dihydrofolate reductase (mDHFR) enzyme, conferring resistance to trimethoprim (TMP). As illustrated in Figure 13B, growth of M. smegmatis co-transformed with pUAB100-egtD and pUAB200 containing pknB, pknD or pknK was present. No growth was observed in the strain co-expressing EgtD and PknA, indicating that these two proteins do not interact under in vivo growth conditions. The interaction between EgtD and the kinases is weaker than the positive control, CFP-10 and ESAT-6, which is expected due to the transient nature of kinase-substrate interactions. Therefore, the M-PFC assay provides evidence that EgtD is potentially a substrate for Mtb STPKs, PknB, PknD and PknK in mycobacteria.  EgtA is an in vitro Substrate of Mtb STPKs As EgtA represents the second entrance to the pathway and commits glutamate and cysteine to EGT biosynthesis, we believed that this could be a second site of post-translational regulation. To test this hypothesis, we cloned egtA into pET-28a, overexpressed and purified the corresponding protein to determine if EgtA was a substrate of Mtb’s STPKs (Figure 14). In this screen we also found that PknA, PknB, and PknD were able to phosphorylate EgtA.   71   Figure 14. EgtA is Phosphorylated by Multiple STPKs in vitro. A, Purification of the overexpressed EgtA recombinant protein. EgtA was prepared following the induction of the E. coli BL21 (DE3) harbouring the pET-28a-egtA plasmid. The EgtA protein was purified using Ni-NTA resin and the elution fraction was resolved by SDS-12% PAGE and stained with Coomassie Blue. The molecular mass markers are indicated on the left in kDa. B, In vitro phosphorylation of EgtA by multiple kinases. Mtb STPKs purified as GST or His fusions were incubated with His-tagged EgtA and [γ-32P]-ATP. Samples were separated by SDS-12% PAGE, stained with Coomassie Blue followed by visualization by autoradiography. Upper bands represent autophosphorylation activity of each kinase (Pkn); lower bands reflect phosphorylated EgtA. This assay was performed with the assistance of Elenore Divry, an intern from the École Supérieure de Biologie-Biochimie-Biotechnologies (Lyon, France).    PknD Preferentially Phosphorylates EgtD in vitro Although it is apparent from Figure 13A that PknD possesses the greatest phosphorylation capacity towards EgtD, we wanted to further verify this notion by analyzing EgtD’s phosphorylation kinetics. As observed from the results in Table 6, PknD possesses the greatest kcat/KM and lowest KM for the methyltransferase, indicating that the interaction between these two proteins has the greatest relevance. Therefore, for the remainder of our work, we focused on the effect of PknD phosphorylating EgtD.     - 66 kDa - 45 72  Table 6. EgtD Phosphorylation Kinetics. Various concentrations of EgtD (1-12 μM) were phosphorylated by 0.7-1 nM of kinase. The transfer of γ-32P was measured via scintillation counting to determine phosphorylation kinetics. Data is representative of three independent experiments and presented as average values ± S.E. Kinase Vmax (nmol/min/mg) Km (μM) kcat (s-1) kcat/Km (M-1·s-1) PknB 27 ± 2 2 ± 0.6 0.005 ± 0.0003 3 x 103 ± 918 PknD 15 ± 0.8 0.2 ± 0.09 0.002 ± 0.0001 1 x 104 ± 4528 PknK 10 ± 1 0.6 ± 0.2 0.001 ± 0.0002 2 x 103 ± 777    Phosphorylation of EgtD Reduces the Formation of Methylated His Phosphorylation of a protein introduces a negative charge on the targeted amino acid(s) which may ultimately affect protein activity. To investigate the effect of phosphorylation on EgtD’s methylation activity, we developed an assay designed to monitor the transfer of methyl-14C from SAM to His. Phosphorylated and non-phosphorylated EgtD were prepared using the in vitro kinase assay in the presence or absence of PknD. Following 2 h of incubation at room temperature, the kinase assays containing EgtD were added to the methylation assays containing S-[methyl-14C]-Adenosyl-L-Methionine and His. Samples were taken at various time points from the reaction and separated by TLC (Figure 15A). The formation of methyl-14C His was visualized by autoradiography (upper), while total His was observed on TLC plates developed with ninhydrin (lower). As expected, the combined kinase and methylation assay absent of EgtD did not form methyl-14C His following 2 h. However, the production of methylated His by phosphorylated EgtD was visibly less than that of the non-phosphorylated enzyme. 14C His spots were then scraped from the TLC plate and the cellulose stationary phase was added to scintillation fluid for quantification. Counts per minute (Cpm) of phosphorylated and non-phosphorylated EgtD methylated His were plotted as a function of time for both enzyme sets 73  (Figure 15B). An approximate 20% reduction in product formation in the phosphorylated EgtD reactions was observed compared to the non-phosphorylated EgtD reactions following 30 min of incubation. However, there was no significant difference in the initial rate of methylated product formed during the first 10 min of these reactions suggesting phosphorylation may decrease EgtD’s affinity for the methylated His intermediates, rather than decrease the catalytic efficiency of the enzyme itself. Nonetheless, the formation of methyl-14C-His was significantly lower in the reaction containing phosphorylated EgtD, suggesting that PknD may negatively regulate EgtD in Mtb.  Figure 15. Phosphorylation of EgtD Reduces the Formation of Methylated His. A, Phosphorylated and non-phosphorylated EgtD was obtained from an in vitro kinase assay and 74  was added to a methylation assay containing S-[methyl-14C]-Adenosyl-L-Methionine (2 μCi/ml). The transfer of methyl-14C to His was monitored over a two-hour period and analyzed by one-dimensional TLC using butanol/acetic acid/water (60:15:25, v/v). Upper, Detection of methyl-14C-His was performed by autoradiography, exposing the TLC plate to X-ray cassettes for one week. Lower, TLC plate developed with ninhydrin to visualize His. B, Graphical representation of the effect of phosphorylation on methylated His formation from the EgtD methylation reactions. **P<0.005, ***P<0.0005 for comparison of phosphorylated vs. non-phosphorylated EgtD. Error bars indicate the means ± SEM of three independent experiments. Cpm, counts per minute; SAM, S-adenosylmethioneine.    PknD Negatively Regulates EGT Biosynthesis in Mtb Introduction of a negative charge, through the substitution of acidic residues such as Asp or Glu, has been previously shown to mimic phosphorylation of a protein with regards to functional activity (249,251,252,254). We were interested in further determining the effect of phosphorylation on EGT levels in Mtb, and thus constructing EgtD variant strains with constitutively altered activities.  To do this, we were first required to identify EgtD phosphorylation site(s) by PknD. Mass spectrometry was used to identify the nature and location of phosphorylation on Mtb EgtD as performed previously (126). MS/MS analysis of purified recombinant EgtD incubated in the presence of PknD identified phosphorylation on the trypsin-digested 205AYDDPGGVTAQFNR218 peptide which was located on Thr-213 in the C-terminus of the protein (Figure 16A). No autophosphorylation was observed in the negative control containing EgtD incubated with ATP in the absence of PknD. The phosphopeptide identified by mass spectrometry was validated by substituting EgtD Thr-213 to alanine (EgtD T213A) by site-directed mutagenesis in order to prevent phosphorylation. The autoradiogram in Figure 16B shows that T213A site-directed mutagenesis resulted in abrogation of EgtD phosphorylation compared with wildtype EgtD. The above findings further supported EgtD Thr-213 as the major phosphorylation site for PknD in vitro. 75   Figure 16. Identification of EgtD Phosphorylation by PknD. A, MS/MS spectra at (+2) representing peptide positions 205-218 with a monoisotopic mass of 1,510.69 Da from EgtD phosphorylated by PknD in vitro. Phosphorylation at Thr-213 was shown by the “y” C-terminal daughter ion series, where all y ions identified lose phosphoric acid (-98 Da) after the phosphorylated residue. pT, phosphothreonine; amu, atomic mass units. B, In vitro kinase assay confirmed Thr-213 as the major phosphorylation site of EgtD by PknD. EgtD T213A is defective in phosphorylation. Upper, phosphorimage; lower, Coomassie Blue stain. Arrowhead points to EgtD. C, MS/MS spectra m/z 795.83 (+2) representing peptide positions 205-218 from EgtD phosphorylated in a cell-based system with PknD showing phosphorylation of Thr-213. Phosphorylation at Thr-213 is shown by the “y” C-terminal daughter ion series, where all y ions after Thr-213 lose phosphoric acid.   We wanted to further validate EgtD’s phosphorylation site in an “in vivo” cell-based system. Due to potential interference of other mycobacterial STPKs, we decided to study the interaction between EgtD and PknD using E. coli as a heterologous host, which lacks STPKs. The active kinase domain of PknD and full-length recombinant wildtype EgtD were sub-cloned into pET-28a and pGEX-4T3, respectively; to achieve compatible expression conditions. 35 - 66 - kDa  45 - 76  Purified EgtD expressed in the presence and absence of PknD inside E. coli underwent LC-MS/MS analysis to identify the phosphorylation sites. As seen previously in vitro, EgtD co-expressed with PknD was monophosphorylated on peptide 205AYDDPGGVTAQFNR218 (Figure 16C), but no phosphorylation was observed in the absence of the kinase in E. coli. From these results, we concluded that Thr-213 is the major phosphorylation site of EgtD both in vitro and in an in vivo cell-based system. Following the identification of Thr-213 as the major phosphorylation site, we constructed and then transformed the ΔegtD mutant with pMV261 derivatives allowing constitutive expression of different egtD alleles under the control of the hsp60 promoter: egtD_WT, phosphomimetic egtD_T213E and phosphoablative EgtD_T213A. As shown in Figure 17A, EGT levels in the EgtD_T213A over-expression strain were comparable to EgtD_WT, with a minor reduction likely due to the nature of the amino acid substitution. In contrast, over-expression of EgtD_T213E was accompanied by a significant decrease in EGT levels in comparison to EgtD_T213A and EgtD_WT, providing evidence that EgtD phosphorylation negatively regulates EGT biosynthesis in Mtb.  To further confirm the effect of EgtD phosphorylation on EGT biosynthesis we investigated EGT levels in the CDC1551 pknD:Tn mutant generously provided by John Hopkins School of Medicine (Figure 17B). Since PknD is expressed during mid- log phase (255), and we observed phosphorylation to negatively regulate EgtD methylation activity and EGT biosynthesis, we hypothesized that the pknD mutant would exhibit higher levels of EGT than wildtype Mtb in culture. Intracellular EGT was extracted from CDC1551 wildtype and pknD:Tn mutant at an OD600=0.5. As expected, the pknD:Tn mutant had significantly higher levels of EGT than 77  wildtype, indicating that in the absence of PknD regulation EgtD’s enzymatic activity is enhanced.  Figure 17. Phosphorylation of EgtD Reduces EGT Levels in Mtb. A, Electrocompetent H37Rv Mtb cells were transformed with pMV261_egtD_WT, pMV261_egtD_T213A, pMV261_egtD_T213E to allow for the constitutive expression of the egtD alleles under the control of the hsp60 promoter. Bacteria were harvested at mid log phase, washed with purified water, and lysed in 70% acetonitrile using MagNAlyser (Roche). Bacterial lysates were collected and analyzed for EGT by ESI LC-MS/MS. EGT intracellular levels were normalized to number of cells. B, CDC1551 wildtype and a PknD:Tn (point of insertion at bp 1166) were generously provided by the John Hopkins Mutant Library (Baltimore, MD) and were grown to mid log phase prior to extraction and EGT was quantified by ESI LC-MS/MS. The results presented for both A and B are expressed as the mean of three independent experiments ± S.E.**P<0.005, ***P<0.0005.    Chapter Summary In this chapter, we show that EgtD is a substrate of multiple Mtb STPKs both in vitro and intracellularly as shown in M. smegmatis and E. coli. Studies describing phosphorylation kinetics further demonstrated that PknD preferentially phosphorylates EgtD, and that phosphorylation by this kinase negatively regulates EgtD’s methylation activity in vitro. To understand the effect of PknD on EGT biosynthesis in Mtb we identified the major phosphorylation site for EgtD both in 78  vitro and in a cell-based system. Complementation of the ΔegtD mutant with a phosphomimicking (T213E), but not the phosphoablative (T213A) or wildtype EgtD protein led to significantly reduced intracellular EGT levels. Further confirming these results, we showed that a Mtb mutant harbouring a defective PknD protein showed elevated levels of intracellular EGT in comparison to the wildtype strain. Together, these findings indicate that through the phosphorylation of EgtD, PknD negatively regulates EGT biosynthesis in Mtb.  79  Chapter 6: Role of EGT in Mtb Starvation and Central Metabolism  Introduction Given our new information on the regulation of EGT biosynthesis in Mtb, we sought out conditions where intracellular EGT levels may be up-regulated. Microarray studies analyzing the global adaptation of Mtb described pknD to be down-regulated 4 h following nutrient starvation (228). As we described PknD to be a negative regulator of Mtb EgtD, we therefore hypothesized that EGT levels will increase during starvation. Although still unclear, it is generally believed that the phagosome is a site of nutrient deprivation for pathogens (256). Genome-wide expression profiling of Mtb RNA isolated from chronically infected mouse lungs or sputum of tuberculosis patients revealed transcriptional signatures reflective of nutrient limitation (257-260). Further evidence indicates Mtb secretes a siderophore to acquire iron within the phagosome (261), as well as upregulating its glyoxylate cycle to limit the loss of carbon through the production of CO2 from the TCA cycle (262-265). In addition, Mtb isolated from lung lesions demonstrated an altered morphology and staining properties that were similar to cultures starved in distilled water for two years (266). Upon further analysis, Loebel et al. (58) and Betts et al. (228) identified that starvation of Mtb in PBS resulted in the gradual shutdown of respiration to minimal levels, and the bacteria remained viable but non-replicating, a physiological state similar to that observed in during latent infection. NRP confers Mtb with phenotypic resistance against major first- and second-line anti-TB drugs (267-269), which not only makes latent disease difficult to eradicate, but the presence of these sub-populations in active TB cases are responsible for prolonged treatment times. The WHO estimates that one-third of the world’s population has latent TB, further placing these individuals at risk of disease reactivation during their lifetime. Despite the apparent importance 80  of understanding bacterial persistence in TB to improve disease management, the physiology of Mtb quiescence is poorly understood. Therefore, it was of interest to verify and gain insight into the role of EGT in Mtb persistence.  Mtb Intracellular EGT Levels Increase During Starvation To identify if EGT plays a role in starvation we grew wildtype H37Rv in PBS containing 0.05% tyloxapol and extracted intracellular EGT from cells over a 24 h time period. Corresponding to a decrease in pknD transcripts described by Betts et al. (228) 4 h following starvation, we observed a slight increase in EGT at 4 and 24 h (Figure 18A). From these results, we speculated that EGT levels likely continue to increase following a 24 h time period, and thus we decided to monitor its synthesis during long-term starvation.  At one week following starvation, EGT levels increased and were maintained over the six-week experimental time frame (Figure 18B). Despite being elevated during long-term starvation, we wanted to determine if EGT was indeed necessary for the survival of Mtb under these conditions. Again, we grew our cultures in PBS containing 0.05% tyloxapol and monitored bacterial survival by counting CFUs for up to four weeks. The H37Rv wildtype and the ΔegtD complement strains did not show a significant loss in viability over this time period; however, the ΔegtD mutant CFUs were reduced by a magnitude of approximately 1.5 log after three weeks (Figure 18C). From these findings, we conclude that Mtb requires EGT for its survival during long-term starvation.  81   Figure 18. EGT Biosynthesis is Up-Regulated and Necessary for Mtb Survival During Long-Term Starvation. Wildtype Mtb intracellular EGT levels were monitored during short-term (A) and long-term (B) starvation. EGT was quantified by ESI LC-MS/MS. C, survival of H37Rv wildtype, ΔegtD and ΔegtD::egtD strains in 4-week-starved cultures. Samples were taken on a weekly basis to assess viability by CFU counts.  In these three experiments (A-C), samples were taken from Mtb incubated as static cultures at 37ºC and starved in PBS with 0.05% tyloxapol. The results are representative of two independent experiments (each experiment performed in triplicates) ±S.E. ***P<0.0001.   EGT Biosynthesis is Dependent on Central Carbon Metabolism The observation that EGT is required for the survival of Mtb under conditions of long-term starvation indicates its involvement in metabolism.  To further establish a link between EGT and carbon source availability, we quantified intracellular EGT levels in the presence of different concentrations of glucose, acetate and propionate (Figure 19A). Regardless of the carbon source, intracellular EGT levels decrease with increasing availability of glucose, acetate or propionate, and negligible EGT levels were observed when Mtb was grown in the presence of high glucose concentrations. Another observation from these results was the apparent influence a carbon source has on intracellular EGT levels. We therefore became interested in further examining this effect in the presence of longer chained fatty acids and cholesterol as these are Mtb’s primary in vivo carbon sources (256). Again, we grew wildtype H37Rv in the presence of various carbon sources (0.05 mM) in 7H9 supplemented with 0.05% tyloxapol, and quantified intracellular EGT levels. Mtb that was grown in cultures containing higher (25 mM) 82  concentrations of the respective carbon source grew at a faster rate indicating that the tested carbon sources had not reached saturating levels in Mtb metabolism. However, Mtb grown in 0.05 mM concentrations of the examined carbon sources all grew at a similar rate as an A600 = ~1.0 was reached and EGT was extracted from the cells on the same day.  From Figure 19B, it is apparent that the type of carbon source influences intracellular EGT levels; however, the carbon chain length does not. Lastly, we examined the impact of EGT on Mtb growth in the presence and absence of glucose (1 mM) over 14 days (Figure 19C). In this set of experiments, we observed that in the absence of a carbon source, the absorbance of the Mtb ΔegtD mutant was significantly lower than that of the wildtype by day 12. However, the observed decrease in OD could be reversed by the addition of glucose to the culture (Figure 19C).  83  Figure 19. Intracellular EGT Levels are Influenced by Type and Availability of Carbon Source. H37Rv wildtype Mtb was grown in 7H9 supplemented with 0.05% tyloxapol and the respective carbon source to an A600= ~1.0 prior to quantifying EGT levels by ESI LC-MS/MS. A) Intracellular EGT levels monitored at different concentrations of glucose, acetate or propionate. B) Quantification of intracellular EGT levels in the presence of various carbon sources (0.05 mM). C) Absorbance readings of ΔegtD mutant cultures relative to wildtype and ΔegtD::egtD over a 14 day period in the presence (right) or absence (left) glucose (1 mM).    Chapter Summary Through our findings on the regulation of EGT biosynthesis we hypothesized that intracellular EGT levels are related to carbon source availability. We found EGT levels to be up-regulated during long-term starvation, and for EGT to be required for Mtb survival in this state of NRP. These findings were further supported by the fact that EGT levels decrease upon increasing availability of a carbon source. In addition, we found intracellular EGT levels to be influenced by the type of carbon source present. Particularly, EGT biosynthesis is up-regulated in the presence of palmitate and cholesterol, two primary components of Mtb lipid bodies, but remains constant in the presence of other fatty acids. Taken together, these findings link EGT to Mtb metabolism and persistence.     84  Chapter 7: Discussion Although EGT was discovered  over one hundred years ago (132) its role in microbial physiology and infection remained unknown. Due to its previously proposed antioxidant properties (173), and observed elevation in a M. smegmatis MSH deficient mutant (159) we hypothesized that EGT contributes to Mtb’s resistance to oxidative stress generated by the macrophage during the early stages of infection (92). Therefore, the underlying goal of this work was to elucidate the role of EGT in the physiology and pathogenesis of Mtb.   Rv3701c Encodes for a His Methyltransferase Required for EGT Biosynthesis in Mtb To effectively study the role of EGT in Mtb biology, we generated a strain deficient in EGT for comparative studies. We used an in silico analysis based off of Seebeck’s work (155) to identify a putative five gene cluster (rv3700c-rv3704c) in Mtb. Purification of the recombinant protein encoded by rv3701c led us to characterize the protein as EgtD, as we found it to possess methylation activity specific to His (Figure 8A). The lack of methylation activity detected when using imidazole or histamine indicates that the substrate-binding site of EgtD recognizes both the imidazole ring and carboxylate side chain to be catalytically active. In addition, the presence of substituted methyl groups, as shown by 1-methyl-L-His, 3-methyl-L-His and α-methyl-DL-His, could not be recognized by EgtD’s active site, which demonstrated the importance of the spatial orientation of the imidazole ring and α-carbon. These findings indicate that Mtb EgtD can only accommodate substitutions at the α-nitrogen of His. This notion is further supported by recent crystallographic analysis of the substrate-binding site where the carboxylate group and imidazole ring of His form an extensive hydrogen bonding network with a number of EgtD amino acid residues. In contrast, the α-amino group of His forms a single hydrogen bond permitting the accommodation of methyl groups at this site (270,271). 85   An earlier study by Reinhold et al. (272) observed the conversion of His to α-N-methyl-L-His and α-N-N-dimethyl-L-His derivatives, and hercynine in the presence of a cell-free extract of N. crassa mycelium. The findings from Reinhold et al. (272) in combination with our own substrate specificity data indicate that the methylated His products observed in Figure 8B were mono-, di- and tri-methylated on its α-nitrogen. The α-N-methyl-L-His and α-N-N-dimethyl-L-His intermediates are the preferential substrates of EgtD in N. crassa (272) and M. smegmatis (155), which indicates that EgtD methylates His in a step-wise reaction. As all three EgtD-catalyzed reactions proceed with a similar turnover number (kcat) and little difference in catalytic efficiencies (kcat/KM) these findings suggest that the observed processivity is a result of increased affinity for the methylated intermediates (270). Indeed, Vit et al., (270) identified EgtD to have four- and 70-times stronger binding of α-N-methyl His and N-α-dimethyl His, respectively, than that of His itself. The specificity of EgtD for these methylated derivatives likely acts as a regulatory mechanism limiting the quantity of His taken up for EGT biosynthesis. Comparison of our EgtD kinetics with that of Vit et al. (270) showed similar KM and kcat/KM values. Similarity, kinetic data in these two studies suggest similar structure and properties between Mtb EgtD and M. smegmatis (270). From our biochemical assays we concluded that rv3701c encodes for a His methyltransferase that is able to generate a trimethylated His product which we predicted to be the EGT biosynthetic intermediate hercynine. Through allelic exchange using a conditionally replicating mycobacteriophage, we constructed an rv3701c knockout strain to determine the relevance of rv3701c in EGT biosynthesis (Figure 9B and C). The absence of EGT in this knockout strain confirms that rv3701c encodes for EgtD and is required for EGT biosynthesis in Mtb (Figure 9D). We also showed that the Mtb CDC1551 egtD and egtA transposon mutants 86  were unable to synthesize EGT (246), and the essentiality of egtD in M. smegmatis in EGT biosynthesis has been independently confirmed (273). Furthermore, the enzyme Egt1, a fusion protein of both EgtD and EgtB, was also found to be essential for EGT biosynthesis in N. crassa (143) and S. pombe (144).  Regulation of EGT Biosynthesis by Mtb STPKs The inherent energy cost of synthesizing EGT in mycobacteria led us to believe that biosynthesis is likely regulated as it would not be energetically economic for the cell to continuously canalize numerous metabolites into the pathway. We identified EgtD to act as a substrate for several STPKs and specifically of PknD, which negatively regulates EGT biosynthesis in Mtb. Thr-213 was shown to be the phosphorylation site both in vitro and inside E. coli, and in combination with the observed negative effect of phosphorylation on EgtD activity and EGT biosynthesis, these findings point to Thr-213 as a critical residue in regulation. Crystallization studies of M. smegmatis EgtD, performed by Vit et al. (270) and Jeong et al. (271) show Thr-213 to be responsible for binding the imidazole ring of His via a water-mediated hydrogen bond. Therefore, the introduction of a phosphate at this residue may impede the interaction between the methyltransferase and its substrates, resulting in the observed reduction in methylated His. Interestingly, the phosphosite Thr-213 is buried deep within EgtD’s structure when bound to His (271) suggesting that phosphorylation of EgtD at this residue takes place prior to substrate-binding. Although superimposition of EgtD-His on the apo-EgtD structure did not show any significant difference in protein conformation, the authors were unable to exclude the possibility that the binding of His resulted in a conformational change. Interestingly, the imidazole and acetate molecules from the crystallization solution were both found to occupy the His binding pocket of the apo-EgtD and the interaction mode of these bound molecules highly 87  resembled that of His (271). Due to the low concentrations of imidazole and acetate in a physiological environment it is predicted that the apo-form of EgtD in cells will have an open conformation for easy access of PknD and/or the substrate into the substrate-binding pocket. The results of our phosphopeptide analysis (Figure 16c) further support the notion of the dynamic structure of EgtD, as we observed phosphorylation of EgtD at Thr-213 by PknD in a cell based system. We discovered the amount of His methylation product was reduced by only 20% by phosphorylated EgtD in vitro (Figure 15); however, we observed a dramatic drop in EGT levels (~85%) from our genetic experiments (Figure 17). Based on our observations from the progress curve in Figure 15B, phosphorylation exhibits little effect on EgtD’s catalytic efficiency in the presence of His. Therefore, we deem it likely that phosphorylation influences the affinity of the mono- and/or di-methylated His intermediates. If this is indeed the case, we would expect there to be little influence on the initial rate of EgtD’s methylation activity with His, but overtime result in lower levels of methylated product due to the higher affinity of non-phosphorylated EgtD for mono- and di-methylated His. A reduced affinity for the methylated intermediates would ultimately produce inadequate amounts of hercynine limiting EGT biosynthesis in Mtb. Furthermore, a number of fungi contain two EgtD homologues, one of which contains considerable variation at position 213 (based on Mtb EgtD numbering). For example, Ybs from Aspergillus nidulans has an asparagine at position 213 and His is ten times less efficient as a substrate than that of Tyr (270). Further structural analysis identified this residue in recognizing Tyr as a substrate through hydrogen bonding. From these findings it is evident that position 213 plays a crucial role in not only modulating EgtD’s methylation activity but also substrate specificity. 88  It is also plausible that, despite incubating EgtD with PknD for an extended period of time to achieve optimal phosphorylation, only a small portion of the methyltransferase population was phosphorylated. Column purification of recombinant EgtD from E. coli was performed using imidazole as the eluent, and despite being dialyzed in Tris following purification, may have left a significant portion of the EgtD population in a closed confirmation impeding PknD’s access to Thr-213. Stochiometric analysis of the level of phosphorylation achieved for EgtD would have aided in the clarification of whether the effect of PknD on EGT biosynthesis is due to negatively regulating EgtD’s catalytic activity or altering its affinity for methylated His substrates. Regardless of the mechanism, both in vitro and in vivo phosphorylation of EgtD by PknD demonstrate a negative effect on EGT biosynthesis. In addition to PknD, we also found that EgtD can serve as a substrate for both PknB and PknK (Figure 13). It is not uncommon for substrates to be the target of more than one Mtb STPK. The effect of phosphorylation on its substrate’s enzymatic activity has been shown to remain the same, regardless of the acting STPK, and has been proposed as a means for the cell to “fine tune” enzymatic activity (274). STPKs are also found to regulate more than a single enzyme in a biosynthetic pathway, indicating that other EGT biosynthetic genes could be regulated. Our preliminary work demonstrating that EgtA can also be phosphorylated by multiple STPKs in vitro (Figure 14) provide evidence that this may be the case.   Role of EGT in the in vitro Growth and Intracellular Survival of Mtb MSH has been found to be essential in the in vitro growth of Mtb in the absence of exogenous catalase, indicating a role for MSH in protecting against baseline oxidative stress (244). However, we did not observe any growth defect between the ΔegtD mutant, the wildtype and ΔegtD complement strains when grown in the presence or absence of catalase (Figure 10). 89  As a result, we believe that EGT has a limited role in protecting Mtb against oxidants generated during in vitro growth. Despite having limited effect on the in vitro growth of Mtb, we wanted to further investigate if EGT played a role in protecting Mtb against free radicals generated by the host. The oxidative burst initiated upon phagocytosis of an invading microorganism creates a highly oxidative environment within the phagosome. Previously, it was shown that MSH is not required for the survival of Mtb in immunocompetent C57Bl/6 mice and immunocompromised SCID mice following aerosol infection (244), indicating that Mtb uses an alternative scavenging system in vivo. As Ta et al. (159) observed elevated EGT levels in the M. smegmatis ΔmshA mutant, we hypothesized that EGT provides Mtb with protection against the macrophage’s microbiocidal molecules during infection. However, when we monitored the survival of the Mtb ΔegtD mutant relative to wildtype in THP-1 cells no difference was observed over a 120 h time period (Figure 12A). A similar trend was observed in J774A.1 murine macrophages, with the exception of a half-log decrease in survival of the ΔegtD strain relative to wildtype and complement at 120 h (Figure 12B). These results were further confirmed in the Mtb egtD:Tn where there was only a half-log reduction in survival relative to wildtype in RAW264.7 murine macrophages (246).  Differences in the oxidative response of macrophages is known to exist between species, with the production of NO (248) and superoxide (275) to be greater in mice. Furthermore, monocyte-derived macrophages also produce up to 90% less superoxide than their peripheral blood precursors (276-278). These results could explain the differences in ΔegtD survival between THP-1 cells and murine macrophages. However, we remain open to the possibility of other cell-line or species-specific characteristics that may contribute to the observed differences, 90  such as rates of phagosomal acidification and degree of proteolysis (275). Still, our finding that the ΔegtD mutant was only slightly attenuated at 120 h was surprising due to EGT’s reputation as an antioxidant. Perhaps MSH or γ-glutamylcysteine provide a compensatory effect in Mtb in the absence of EGT ex vivo; however, neither we nor other authors have found increased levels of MSH in the absence of EGT (159,246,247). Furthermore, the pknD:Tn mutant showed no difference in viability when infecting J774 macrophages (173), further supporting the notion that EGT levels have limited effect on the survival of Mtb in murine macrophages (279). Additional studies examining the survival of Mtb ΔegtD in murine gp91Phox-/- and NOS2-/- macrophages would attribute a clearer role to EGT protecting the bacilli against host generated ROS and RNS ex vivo.  The fact that MSH, but not EGT, is required for growth in the absence of catalase (244)  indicates that EGT is not the primary redox buffer in the cell. However, we still found the Mtb egtD:Tn mutant to have reduced survival relative to the wildtype and its complement strain in presence of hydrogen peroxide, paraquat, menadione, and cumene hydroperoxide (246). Interestingly though, the egtA:Tn and egtD:Tn from this study demonstrate varying survival profiles in the presence of oxidants, again exemplifying different phenotypes for these mutants. Therefore, we caution correlating egtA mutant phenotypes with that of EGT and therefore avoid making comparisons with other studies (246) investigating the phenotype of the EgtA mutant. It is more likely that this mutant is representative of a cell absent of the antioxidant, γ-glutamylcysteine, rather than EGT.   How the egtD:Tn  survival profile compares to that of an Mtb MSH mutant in the presence of oxidants is difficult to determine due to the in vitro growth restrictions of MSH deficient strains in the absence of catalase. M. smegmatis, which does not require MSH for in 91  vitro growth (237), showed an ΔegtD/ΔmshA double mutant to be significantly lower in survival in comparison to the ΔmshA or ΔegtD single mutants when challenged with cumene hydroperoxide or tert-butyl hydroperoxide (273). This work may indicate a redox buffer hierarchy for EGT and MSH in mycobacteria, at least for hydroperoxides. At the same time, we observed EGT to act as a cytoprotectant against exogenous hydrogen peroxide or superoxide (246), although EGT has not been found to directly scavenge these oxidants (173). Despite these observed cytoprotectant effects, EGT’s low intracellular concentration relative to MSH (1:166) (159,280), extensive resistance to auto-oxidation (281) and low reduction potential (170) do not support its primary role as an antioxidant/redox buffer in the cell. Another interesting point is that the reducing power of γ-glutamylcysteine is significantly greater (-234 mV; (282) than that of EGT, so it becomes of interest to speculate why the cell would use a superior antioxidant as an intermediate in EGT biosynthesis. Therefore, we believe it is more likely that EGT plays an alternative role in Mtb physiology, which happens to coincide with protecting the cell against oxidative stress.  EGT is Linked to Central Carbon Metabolism in Mtb As the overall goal of our work was to understand the role of EGT in Mtb physiology and pathogenesis, we wanted to utilize our findings on the regulation of EGT biosynthesis in Mtb to direct us toward its biological function. Our first hint came from our studies monitoring EGT levels at various stages of growth (Figure 11). Here, we observed intracellular EGT levels to rise substantially during late-logarithmic phase and to accumulate to an even greater amount in stationary phase. Elevated levels of intracellular EGT was also observed during the stationary phase of M. smegmatis by Ta et al. (159) but the reverse was shown by Sao Emani et al. (247).  92  Stationary phase is characterized by a number of growth limiting factors, one of which is nutrient deprivation. From our literature search, we were unable to identify any environmental conditions which impacted the transcript levels of the egt genes in Mtb. However, previous work identified S. pombe egt1+ to be positively regulated by the transcription factor Ste11 (283). As a key regulator in the control of mating and sporulation of this microorganism (284),  Ste11 has been shown to be negatively regulated by cyclic-adenosine monophosphate (cAMP) levels in response to nutrient starvation (285). In response to unfavourable growth conditions, intracellular cAMP levels drop, down-regulating the activity of the cAMP-dependent kinase, protein kinase A (PKA) (286). PKA negatively regulates the expression of ste11 by phosphorylating and thereby preventing the translocation of the ste11 transcription factor, Rst2, to the nucleus (287). In addition, the STPK, target of rapamycin (TOR), also negatively regulates ste11 expression (288). Similar to PKA, the TOR signalling pathway regulates cell growth in response to growth factors, nutrients and energy conditions. These findings indicate that EGT levels are regulated at a transcriptional level in S. pombe in response to nutrient availability. An earlier study using a nutrient starvation model of persistence in Mtb identified pknD to be significantly down-regulated 4 h following starvation (228). Since EgtD is negatively regulated by PknD, we expected to observe increased levels of intracellular EGT during starvation. Despite being metabolically costly to the cell, Mtb maintained elevated intracellular EGT levels over six weeks in the absence of a carbon source, which indicated that EGT is needed during long-term starvation (Figure 18). Further evidence for a role of EGT during starvation arose from our findings that EGT levels were significantly greater in Mtb grown in the presence of low (0.05 mM) versus high (25 mM) concentrations of glucose, acetate or propionate (Figure 19A). In agreement with our findings, previous studies in S. pombe identified EGT 93  biosynthesis to be up-regulated during nitrogen (161) and glucose (160) growth-limiting conditions. However, EGT was found to accumulate within 1 h following nutrient limitation in S. pombe  (289) which may represent differences between the growth rates (minimum of 2.5 h for S. pombe; (290) and 16 h for Mtb; (291)) between these organisms. We observed a discrepancy in EGT levels between the immediately starved (week 1-6, ~300 ng/108 cells) and stationary phase (OD600 = 2.0, 750 ng/108 cells) cultures. It is possible that these differences are the result of Mtb sensing the gradual depletion of nutrients under non-chemostatic culture conditions during stationary phase, which provided the bacilli with the opportunity to accumulate more EGT. These findings are in accordance with those of S. pombe where intracellular EGT levels peak when grown in the presence of low glucose concentrations  (1.1-5.6 mM) in comparison to high glucose or a lack thereof (160).  As we observed that nutrient availability has an effect on EGT levels, we wanted to further examine the role of different carbon sources on EGT levels (Figure 19). We observed that EGT levels were lowest in the presence of glucose but increased in the presence of fatty acids. As β-oxidation of fatty acids is a major source of endogenous oxidative stress for organisms, we would expect EGT levels to increase in response to the carbon chain length of fatty acids if EGT was acting as an antioxidant. However, there was no correlation between EGT levels and carbon chain length. Furthermore, intracellular EGT levels of Mtb grown in the presence of the TCA cycle intermediates propionate and acetate were on par with cultures containing fatty acids that are catabolized through β-oxidation, again indicating no correlation with β-oxidation. We did observe, however, that EGT levels were highest in the presence of cholesterol. EGT was also recently found to accumulate in hepatocytes of guinea pigs fed diets high in cholesterol, and 94  these levels were correlated with the degree of TAG formation (hepatic steatosis) in the liver (292). Still, no role has yet to be attributed to EGT in the liver. There is significant evidence that Mtb relies on fatty acids as their the primary carbon source during infection (256) as well as starvation in vitro (228,293). As intracellular EGT levels remain the same regardless of whether the fatty acid enters β-oxidation, we rationalize that EGT is not related to this metabolic process. However, elevated intracellular EGT levels are correlated with  lipid-rich diets both in Mtb (246) and mammals (292). In response to low blood glucose levels, the liver must generate more glucose from glycogenolysis, gluconeogenesis, or glycerol derived from TAGs. These metabolic processes are essential for mammals as glucose acts as the primary energy source of cells.  Interestingly, red blood cell metabolism, which relies entirely on the anaerobic metabolism of glucose to lactate, was previously shown to be influenced by EGT (294). Daily administration of EGT over seven days to rats was found to maintain lactate levels in red blood cells when the animals were fasted for 24 h, whereas lactate levels of those animals not fed EGT decreased by 60%. Interestingly, under normal feeding conditions, EGT had no influence on red blood cell lactate levels (294). These findings indicate that EGT may be involved in one of the metabolic pathways responsible for maintaining blood glucose levels; however, no follow-up investigations have been performed.  Only recently has a new role been shown for EGT as a mediator or coenzyme in catalytic enzymatic reactions. Through the characterization of the biosynthetic pathway of the antibiotic lincomycin A in Streptomyces lincolnensis, EGT was demonstrated to act as a sugar carrier (295). At the start of the pathway, a glycosyltransferase (LmpT) catalyzes the reversible displacement of guanosine diphosphate (GDP) from GDP-D-α-D-lincosamide by EGT to 95  generate an EGT β-S-conjugated lincosamine. Formation of this intermediate mediates lincosamine’s condensation with 4-propyl-L-proline, thereby driving the reaction forward. EGT is then exchanged with MSH, through a second, but irreversible glycosylation reaction generating an α-S-linkage in the MSH S-conjugate which undergoes additional modifications before becoming lincomycin A. The function of EGT in the biosynthesis of lincomycin A appears to play a role in the preservation of lincosamine stereochemistry to enable the attachment of MSH in the same orientation as that of GDP. These findings are of considerable interest as they point to the possibility that EGT could be involved in more general sugar modification reactions. Blast analysis of the lincosamide synthase complex against mycobacterial genes identified a phosphoheptose isomerase (GhmA) in Mtb to share 53% identity. This enzyme is responsible for catalyzing the isomerization of sedoheptulose 7-phosphate to D-glycero-D-manno-heptose 7-phosphate, an intermediate involved in glycan biosynthesis in Mtb. When the glycosyltransferase responsible for transferring lincosamide to EGT was used in a Blast search, we found LmbT to belong to the glycosyltransferase family 4, which exhibit a wide range of biological functions that can be observed at http://www.cazy.org/GT4.html. Interestingly though, these glycosyltransferases are found to be involved in glycogen and trehalose biosynthesis in many organisms. Perhaps coincidental, but taking together the work of ours and others, it appears that EGT is involved in metabolic pathways linked to carbohydrate metabolism. Alpha-glucan, a polymer similar to glycogen with the exception of a higher degree of branching (73,296,297), is known to accumulate in Mtb under nitrogen- or sulfur-limiting conditions (298). In bacteria, α-glucans are polymerized by the glycogen synthases, GlgA and GlgB, and these orthologues in mycobacteria can also synthesize glycogen (299-301).  The role 96  of α-glucans in Mtb is not limited to carbon storage. The bacilli also surrounds itself in a capsule primarily composed of α-glucans, which are known to participate in the evasion of both the innate and adaptive immune response (302-304) and contributes to persistence in mice (299). Interesting, this capsule is found to accumulate when Mtb enters a non-replicating state (305). Therefore, more specifically, we suspect EGT to be involved in α-glucan metabolism of Mtb, which could also have broad physiological implications.  It is important that we return to the original findings that EGT protects cells against oxidative stress (173). The plethora of studies in support of the cytoprotectant role of EGT cannot be ignored; however, based off of our knowledge of EGT’s chemistry and its involvement in biochemical processes, it is necessary that we revisit our interpretation of these results. Oxidative challenge has been shown to result in the accumulation of glycogen in yeast (306-308) and yeast unable to breakdown glycogen under stress conditions exhibit higher ROS production accompanied by a shortened lifespan (309). Therefore, it appears that glycogen and the control of the glycolytic flux is essential for the cell under stress. If EGT does play a role in the metabolism of these carbohydrate reserves, it would indirectly contribute to protecting the cell against oxidative stress.  EGT Maintains Viability of Mtb during Quiescence To better understand the importance of EGT during starvation, we monitored the survival (CFU) of the ΔegtD mutant in the absence of carbon sources. After three weeks we observed a significant loss in the viability of the ΔegtD mutant (~ 1.5 log) relative to the wildtype and ΔegtD::egtD strain. These findings indicate that EGT is required for the long-term survival of Mtb during starvation. Interestingly, the wildtype and complement strains did not show differences in CFUs over the four weeks of starvation, yet optical density over 14-days increased 97  not in direct correlation with cell numbers (Figure 19C). Mtb has been described to undergo a wide variety of morphological changes in response to entering a quiescent state (305). One of the major noted differences is the extensive cell-wall remodeling Mtb undergoes while transitioning into a state of NRP (108).  Cunningham and Spreadbury (310) reported a very prominent thickening of the cell wall outer layer in Mtb which was later attributed to the gradual accumulation of  loosely bound extracellular material around the bacilli in the form of a capsule (305). This matrix is primarily composed of proteins and polysaccharides (73), with only a small proportion (2-3%) containing lipids (74). Interestingly, the major carbohydrates making up 80% of the extracellular capsule are α-glucans (305). Furthermore, stationary phase is known to increase cell density, and this is described to result from an accumulation of storage carbohydrates, particularly trehalose and glycogen (311). Therefore, the changes in absorbance observed in the absence of cell proliferation may be due to the enhanced synthesis of carbohydrates.  In the same set of experiments, we found the absorbance of the ΔegtD mutant to be significantly lower than that of the wildtype and ΔegtD::ΔegtD strains after 14-days. Coincidently, these findings correlate with the decreased survival of the ΔegtD mutant after two weeks. Interestingly, when the ΔegtD mutant was provided with a low concentration of glucose, the absorbance pattern of the strain was restored to that of wildtype and the ΔegtD complement. These findings indicate an implication for glucose, or maybe just carbon source availability, in these absorbance differences.   Similar to our studies, comparative metabolomic analysis of S. pombe identified quiescent cells to contain significantly more EGT than vegetative cells (144,160,161). No loss in viability of the S. pombe Δegt1 was reported 20 days following media change (144), a result similar to our findings where we did not identify our Mtb ΔegtD mutant to have a loss in 98  viability during early stationary phase. These findings, in conjunction with our ΔegtD survival studies under starvation, indicate a requirement for EGT during quiescence.   Further support for a role of EGT in cellular quiescence comes from studies in fungi. Perhaps the first link between EGT and fungal spores was the identification of EGT in the honeydew (sugar rich secretion) of rye grain containing C. purpurae conidia (312). Later studies analyzing the EGT content of the conidia of Beauveria bassiana (313), N. crassa and Collectotrichium graminicola (143) were all found to have significantly higher concentrations of EGT relative to their mycelia. The role of EGT in fungal physiology was further analyzed and was not found to impact the mycelial growth or conidial germination of N. crassa in the presence of superoxide or cupric sulfate (143). Endogenous EGT was also not found to have any effect on the mutation rate of untreated conidia or mitigate the lethality or mutagenicity of UV light in N. crassa (314). The authors did, however, find the germination of the Δegt1 mutant to be significantly more sensitive to tert-butyl hydroperoxide than wildtype (143). From these findings, it was suggested that EGT scavenges ROS in N. crassa conidia; however, due to the high reactivity of tert-butyl peroxide it is likely that the oxidant reacts with the conidial membrane before reaching EGT in the cytosol. Therefore, we again suggest that EGT may be playing an indirect role in protecting against ROS in the conidia.  Both the sporulation and germination process of N. crassa is described to have a transient hyperoxidative state to which EGT could be exerting a protective effect (315,316). However, in the absence of exogenous tert-butyl hydroperoxide the authors did not visualize enhanced oxidative stress in germinating conidia (143), indicating that EGT does not play a role in mitigating endogenous oxidative stress in fungal spores. However, assessment of percent germination of N. crassa conidia over 84 days identified the Δegt1 mutant to be significantly 99  lower than that of wildtype (143). It was later observed that the Δegt1 mutant produces fewer (~40%) ascospore progeny, and that these cells exhibit a significantly reduced lifespan (314). Previous up-regulation of egt1 transcripts in the presence of hydrogen peroxide (317), cadmium (317), and light (318) indicated that the biosynthesis of EGT is strongly stress responsive. However, egt1+ transcripts were found to be elevated in response to meiosis (158), and not specific to environmental conditions that induce oxidative stress (314), support a role of EGT in cell quiescence itself. If EGT does play a role in Mtb quiescence, we might expect to see a decrease in survival of the egtD mutant during the later stages of infection. However, mice infected with the egtD:Tn strain that were sacrificed five weeks post-infection had less than a quarter-log reduction in bacillary load in the lungs in comparison to the Mtb wildtype and complement strains (246). From this work it could be concluded that EGT plays a minor role in persistence; however, the mouse is a poor model for assessing the role of Mtb in human latent infection.  Due to the high bacterial load and progressive pathology associated with Mtb infection in mice, it is thus considered as more of a chronic infection (319). In addition, the human granuloma does not resemble those found in mice, which are non-necrotic,  and lacking in structure and organization (320). The importance of necrosis when studying LTBI is due to the fact that this process leads to the death of the majority of tubercle bacilli, leaving behind a small population which is in a state of NRP (321). Consequentially, if EGT’s role is primarily during quiescence, it would be difficult to assess EGT’s role in pathogenicity in a mouse model. We suggest a more appropriate in vivo model to assess the role and impact of EGT in Mtb’s pathogenicity would be to use rabbits as these animals undergo intragranulomatous necrosis as well as exhibit disease latency (322).   100   Targeting EGT Biosynthesis as a Strategy to Eliminate Quiescent Mtb  It could be argued that the exceptionally long treatment course that is required to prevent disease relapse is one of the most important factors limiting our control of TB. Currently, our first line drug regimen takes 6-9 months to treat active disease, yet when the same drugs are used in vitro we are able to rapidly kill the bacilli (108). The environment of the host is shown to cause Mtb to further slow its replication or induce a quiescent state during infection (80), and as the majority of our antitubercular drugs target functions necessary for cell growth it is not surprising that these cells are less sensitive to existing antibiotics. Furthermore, these non-replicating bacilli are responsible for generating latent disease. Therefore, the importance of understanding Mtb quiescence is paramount for identifying new strategies for eliminating non-replicating bacterial populations. In turn, targeting quiescent bacteria in our therapies would likely accelerate treatment time, reduce the risk of developing a latent infection and prevent disease reactivation. In principle, there are three possible ways to target quiescent cells: sensitize existing cells to current antibiotics, identify new drug candidates that target pathways essential for quiescence, or alter host immune pressures that induce an antibiotic tolerant state (108). Evidence exists, although the correlation is not absolute, where drugs that retain activity against non-replicating Mtb in vitro have a strong sterilizing activity in vivo (323). These findings further reinforce the idea that TB drug development should largely focus on targeting pathways that are essential for Mtb in a quiescent state. We have shown that EGT is required for maintaining Mtb viability in the absence of replication. Despite requiring further validation in a necrotic granuloma animal model, these findings provide support for the EGT biosynthetic pathway as a novel drug target in TB treatment. In addition, the fact that the egtD:Tn mutant exhibited increased susceptibility 101  against a wide range of antitubercular reagents in actively replicating Mtb (246) indicates that targeting the EGT biosynthetic pathway would also render, and perhaps more so, quiescent cells more susceptible to current treatment.   Conclusion Our investigation to elucidate the role of EGT in Mtb physiology and pathogenesis has led us down many new avenues and has provided novel insight into this molecule’s function. Our studies initiated with the biochemical analysis of the gene product of rv3701c, which we postulated to encode for EgtD in EGT biosynthesis. We identified that EgtD is a His methyltransferase that catalyzes the first reaction step of EGT biosynthesis. When we knocked out egtD in Mtb we showed its essentiality in the synthesis of EGT. The absence of EGT in ΔegtD mutant provided an additional tool to explore the environmental conditions that EGT was required for by Mtb. Results from our ex vivo studies indicate that endogenous EGT plays a small role in maintaining Mtb viability within 120 h post-infection. Thus, we deem protection against ROS and RNS generated by the innate immune response is not the primary role of EGT in Mtb. Using a number of biochemical assays and genetic studies we identified that PknD negatively regulates EGT biosynthesis in Mtb through its phosphorylation of EgtD. Our findings on the regulation of EGT biosynthesis led to identification of EGT up-regulation under nutrient limited conditions and its essentiality for the survival of Mtb during quiescence in vitro. Due to the apparent involvement of EGT in maintaining Mtb survival in the absence of replication, we recommend further studies be performed to confirm the role of EGT in Mtb persistence in disease latency in vivo. Preliminary observations from our work on EGT levels in 102  the presence of different carbon sources and their availability, in combination with the findings of other groups (295,324), indicates a role for EGT in sugar metabolism.  Although quiescence is characterized as a downshift in metabolism (311), Mtb never truly enters a dormant state and is required to maintain its membrane potential and continue ATP synthesis (109). Many studies have implicated the importance of storage carbohydrates and gluconeogenesis (264,325) in the survival of microorganisms during quiescence which is likely supporting energy homeostasis in Mtb. We hypothesize that the decrease in survival of the ΔegtD mutant during quiescence is due to EGT’s role in energy storage and homeostasis.  The work from this thesis contributes to our limited knowledge regarding the physiology of Mtb during quiescence, as well as proposing a novel role for EGT in biological systems. Further investigation of the dispensability and role of EGT during latent infection is warranted; however, our findings suggest the EGT biosynthetic pathway may be a promising target for eliminating non-replicating bacterial populations.   Future Directions  We previously assessed the viability of the egtD:Tn mutant in BALB/c mice (246). The mouse model is the best characterized and most extensively used model to study Mtb pathogenesis. Despite its advantages to in vitro models of Mtb growth restriction, the classical murine model does not represent human LTBI. In contrast to humans, Mtb in mice continues to multiply (104) and remains metabolically active (260) during chronic infection leading to high bacillary burden and early death (326). Since we established that EGT is essential for the survival of Mtb during quiescence and is not associated with bacterial growth inside of the macrophage, it is not surprising that we did not observe a more prominent effect on the survival of the egtD:Tn mutant in mice. To date, rabbits are the most feasible model for studying LTBI. 103  Rabbits are relatively resistant to Mtb infection resulting in suppression of bacillary loads following 10 weeks infection (327,328). In addition, this model forms granulomas similar to those found in humans (326) and disease reactivation can be triggered through administration of immune-modulating agents (327,328). Therefore, to accurately assess a role of EGT in Mtb pathogenicity and disease latency, future studies should look at the viability of the ΔegtD mutant in the rabbit model.   As we observe the viability of Mtb during quiescence to be reduced in the ΔegtD mutant, it is of interest to understand the mechanism behind this reduction in survival. Having originally been proposed as an antioxidant, one of the first set of experiments we would propose is to investigate the role of EGT in protecting against endogenous and exogenous oxidative stress in quiescent Mtb. However, we would like to mention an observation that EGT protects Mtb against oxidative stress in these experiments does not necessarily imply that EGT is acting as a scavenger. As we observed a link between EGT and Mtb metabolism (246), we hypothesize that EGT is involved in energy homeostasis during quiescence, which would ultimately support Mtb’s oxidative stress defense system. Therefore, monitoring the generation of ROS and ATP levels may provide us with insight as to whether EGT is protecting against oxidative stress or playing a role in ATP homeostasis, respectively.  We predict the involvement of EGT in energy storage, particularly sugar metabolism due to the previously observed role of EGT in lincomycin A biosynthesis (295). Both glycogen and trehalose are known to accumulate in microorganisms (311), including Mtb (298,305), under conditions which induce quiescence. The exact role of intracellular trehalose remains to be determined; however, it is thought that the trehalose released from glycolipids in the Mtb cell wall during infection are used for the synthesis of α-glucans or acts as a reservoir for glucose 104  (256,329). Therefore, we recommend quantifying glycogen and trehalose levels prior to and following nutrient starvation for several weeks and comparing them in our wildtype, ΔegtD mutant and ΔegtD::egtD strains. Any differences observed in trehalose or glycogen levels would likely implicate a role for EGT in the metabolism of storage carbohydrates in Mtb. TAGs are the major energy source for animals, plants and prokaryotes during and following dormancy and hibernation and are also being used by Mtb during disease latency (330). The correlation between EGT and TAG accumulation in the livers of guinea pigs (292), along with our observations that Mtb EGT levels increase in the presence of fatty acids may merit an involvement of EGT in TAG metabolism (246) and require further scrutiny as well.  Evaluating the importance of EGT for the survival of Mtb during quiescence (latent disease) is of importance as EgtD demonstrates considerable potential as a drug target for TB. Furthermore, identifying the role EGT plays in Mtb will have broader implications, as EGT is present across many life forms. If we can demonstrate EGT’s involvement in energy storage or carbohydrate metabolism in Mtb, these findings may assist in our understanding of the involvement of EGT in human diseases such as diabetes, Crohn’s disease and rheumatoid arthritis.  105  References 1. Ryan, F. (1992) The forgotten plague. How the battle against tuberculosis was won - and lost, Little, Brown and Company, Toronto 2. Daniel, T. M. (2006) The history of tuberculosis. Respir Med 100, 1862-1870 3. Rasouli, M. R., Mirkoohi, M., Vaccaro, A. R., Yarandi, K. K., and Rahimi-Movaghar, V. (2012) Spinal tuberculosis: diagnosis and management. Asian Spine J 6, 294-308 4. Marchant, J. (2011) Ancient DNA: Curse of the Pharaoh's DNA. Nature 472, 404-406 5. Hershkovitz, I., Donoghue, H. D., Minnikin, D. E., Besra, G. S., Lee, O. Y., Gernaey, A. M., Galili, E., Eshed, V., Greenblatt, C. L., Lemma, E., Bar-Gal, G. K., and Spigelman, M. (2008) Detection and molecular characterization of 9,000-year-old Mycobacterium tuberculosis from a Neolithic settlement in the Eastern Mediterranean. PloS One 3, e3426 6. Stirlanda, A., Waldron, T. (1990) The earliest cases of tuberculosis in Britain. J Archaeol Sci 17, 221-230 7. Major, R. H. (1945) Classic descriptions of disease, 3 ed., Charles C Thomas Pub Ltd, Springfield 8. Koch, R. (1982) Classics in infectious diseases. The etiology of tuberculosis: Robert Koch. Berlin, Germany 1882. Rev Infect Dis 4, 1270-1274 9. Koch, R. (1882) Die aetiologie der Tuberculose. Berliner Klinische Wochenschrift 19, 221-230 10. Fleming, A. (1929) On the antibacterial action of cultures of a penicillium, with special reference to their use in the isolation of B. influenzæ. Br J Exp Pathol 10, 226-236 11. Dubos, R. J., and Hotchkiss, R. D. (1941) The production of bactericidal substances by aerobic sporulating bacilli. J Exp Med 73, 629-640 12. Waksman, S. A., and Woodruff, H. B. (1942) Selective antibiotic action of various substances of microbial origin. J Bacteriol 44, 373-384 13. Waksman, S. A., and Woodruff, H. B. (1941) Actinomyces antibioticus, a new soil organism antagonistic to pathogenic and non-pathogenic bacteria. J Bacteriol 42, 231-249 14. Waksman, S. A. (1943) Production and activity of streptothricin. J Bacteriol 46, 299-310 15. Waksman, S. A., Woodruff, H.B. (1942) Streptothricin, a new selective bacteriostatic and bactericidal agent, particularly active against gram-negative bacteria. Proc Soc Exp Biol Med 49, 207-210 16. Schatz, A., Bugie, E., Waksman, S.A. (1944) Streptomycin, a substance exhibiting antibiotic activity against Gram-positive and Gram-negative bacteria. Proc Soc Exp Biol Med 55, 66-69 17. Robinson, H. J., Graessle, O. E., and Smith, D. G. (1944) Studies on the toxicity and activity of streptothricin. Science 99, 540-542 18. Feldman, W. H., Hindshaw, H.C. (1944) Effects of streptomycin on experimental tuberculosis in guinea pigs: A preliminary study. Proc Staff Meet Mayo Clin 19, 593-599 19. Hinshaw, H. C., Feldman, W.H. (1945) Streptomycin in treatment of clinical tuberculosis: a preliminary report. Proc Staff Meet Mayo Clin 20, 313-318 20. Waksman, S. A. (1964) The conquest of tuberculosis, University of California Press, Berkeley 21. (1948) Streptomycin treatment of pulmonary tuberculosis. Br Med J 2, 769-782 106  22. Steenken, W. (1949) Streptomycin and the tubercule bacillus. in Streptomycin and dihydrostreptomycin in pulmonary tuberculosis (McLeod Riggins, H. a. H., C. ed.), National Tuberculosis Association, New York. pp  23. Girling, D. J. (1982) Adverse effects of antituberculosis drugs. Drugs 23, 56-74 24. Fitzgerald, R. J., and Bernheim, F. (1948) The effect of salicylic acid on the growth, morphology and virulence of M. tuberculosis. Am Rev Tuberc 58, 210-214 25. Feldman, W. H., Karlson, A. G., and Hinshaw, H. C. (1947) Para-aminosalicylic acid in experimental tuberculosis in guinea pigs. Proc Staff Meet Mayo Clin 22, 473-479 26. Carstensen, B., Sjolin S. (1948) Para-aminosalicylsyra (PAS) vid lung-tuberkulos med sek tarmtuberkulos. Svenska Lakartidn 45, 729-743 27. Carstensen, B., and Sjolin, S. (1949) L'acide para-amino-salicylique dans le traitement de la tuberculose pulmonaire avec tuberculose intestinale secondaire. Poumon 5, 209-223 28. tuberculosis, T. t. c. o. t. S. n. a. a. (1950) Para-aminosalicyclic acid treatment in pulmonary tuberculosis. Am Rev Tuberc 61, 597-612 29. Todd, R. M. (1953) Treatment of primary pulmonary tuberculosis with P.A.S. Br Med J 1, 1247-1249 30. Lehmann, J. (1964) Twenty Years Afterward Historical Notes on the Discovery of the Antituberculosis Effect of Paraaminosalicylic Acid (Pas) and the First Clinical Trials. Am Rev Respir Dis 90, 953-956 31. (1949) Treatment of pulmonary tuberculosis with para-aminosalicylic acid and streptomycin. A preliminary report. Br Med J 2, 1521 32. Domagk, G., Offe, H. A., and Siefken, W. (1952) Additional investigations in experimental chemotherapy of tuberculosis (neoteban). Dtsch Med Wochenschr 77, 573-578 33. Council, M. R. (1953) Isoniazid in the treatment of pulmonary tuberculosis. Br Med J 1, 521-536 34. Crofton, J. (1975) Letter: Short-course triple chemotherapy for tuberculosis. Lancet 2, 322 35. Crofton, J. (1960) Tuberculosis undefeated. Br Med J 2, 679-687 36. Seiler, H. E., Welstead, A.G., Williamson, J (1958) Report on Edinburgh X-ray campaign, 1958. . Tubercule 39, 339-359 37. Sensi, P., Greco, A. M., and Ballotta, R. (1959) Rifomycin. I. Isolation and properties of rifomycin B and rifomycin complex. Antibiot Annu 7, 262-270 38. Kushner, S., Dalalian, H., Sanjurjo, D.L., Bach, F.L., Safir, S.R., Smith, V.K., Williams, J.H. (1952) Experimental chemotherapy of tuberculosis. II. The synthesis of pyrazinamides and related compounds. J Am Chem Soc 74, 3617-3621 39. Shepherd, R. G., and Wilkinson, R. G. (1962) Antituberculous agents. Ii. N,N'-diisopropylethylenediamine and analogs. J Med Pharm Chem 91, 823-835 40. Shepherd, R. G., Baughn, C., Cantrall, M. L., Goodstein, B., Thomas, J. P., and Wilkinson, R. G. (1966) Structure-activity studies leading to ethambutol, a new type of antituberculous compound. Ann N Y Acad Sci 135, 686-710 41. Organization, W. H. (2015) Global tuberculosis report 2015. WHO Press, Geneva 42. Zumla, A., Abubakar, I., Raviglione, M., Hoelscher, M., Ditiu, L., McHugh, T. D., Squire, S. B., Cox, H., Ford, N., McNerney, R., Marais, B., Grobusch, M., Lawn, S. D., Migliori, G. B., Mwaba, P., O'Grady, J., Pletschette, M., Ramsay, A., Chakaya, J., Schito, M., Swaminathan, S., Memish, Z., Maeurer, M., and Atun, R. (2012) Drug-resistant 107  tuberculosis--current dilemmas, unanswered questions, challenges, and priority needs. J Infect Dis 205 Suppl 2, S228-240 43. Brewer, T. F. (2000) Preventing tuberculosis with bacillus Calmette-Guerin vaccine: a meta-analysis of the literature. Clin Infect Dis 31 Suppl 3, S64-67 44. Montales, M. T., Chaudhury, A., Beebe, A., Patil, S., and Patil, N. (2015) HIV-associated TB syndemic: a growing clinical challenge worldwide. Front Public Health 3, 281 45. Gallant, V., McGuire, M., Ogunnaike-Cooke, S. (2015) A summary of tuberculosis in Canada, 2013. Canada Communicable Disease Report 41, 2-7 46. (2013) Trends in tuberculosis--United States, 2012. MMWR Morb Mortal Wkly Rep 62, 201-205 47. England, P. H. (2014) Tuberculosis in the UK, 2014 report.  48. Abubakar, I., Zignol, M., Falzon, D., Raviglione, M., Ditiu, L., Masham, S., Adetifa, I., Ford, N., Cox, H., Lawn, S. D., Marais, B. J., McHugh, T. D., Mwaba, P., Bates, M., Lipman, M., Zijenah, L., Logan, S., McNerney, R., Zumla, A., Sarda, K., Nahid, P., Hoelscher, M., Pletschette, M., Memish, Z. A., Kim, P., Hafner, R., Cole, S., Migliori, G. B., Maeurer, M., and Schito, M. (2013) Drug-resistant tuberculosis: time for visionary political leadership. Lancet Infect Dis 13, 529-539 49. Marks, S. M., Flood, J., Seaworth, B., Hirsch-Moverman, Y., Armstrong, L., Mase, S., Salcedo, K., Oh, P., Graviss, E. A., Colson, P. W., Armitige, L., Revuelta, M., and Sheeran, K. (2014) Treatment practices, outcomes, and costs of multidrug-resistant and extensively drug-resistant tuberculosis, United States, 2005-2007. Emerg Infect Dis 20, 812-821 50. Galagan, J. E. (2014) Genomic insights into tuberculosis. Nat Rev Genet 15, 307-320 51. Sreevatsan, S., Pan, X., Stockbauer, K. E., Connell, N. D., Kreiswirth, B. N., Whittam, T. S., and Musser, J. M. (1997) Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci U S A 94, 9869-9874 52. Boddinghaus, B., Rogall, T., Flohr, T., Blocker, H., and Bottger, E. C. (1990) Detection and identification of mycobacteria by amplification of rRNA. J Clin Microbiol 28, 1751-1759 53. Falkinham, J. O. (2009) The biology of environmental mycobacteria. Environ Microbiol Rep 1, 477-487 54. Dick, T., Lee, B. H., and Murugasu-Oei, B. (1998) Oxygen depletion induced dormancy in Mycobacterium smegmatis. FEMS Microbiol Lett 163, 159-164 55. Wayne, L. G. (1976) Dynamics of submerged growth of Mycobacterium tuberculosis under aerobic and microaerophilic conditions. Am Rev Respir Dis 114, 807-811 56. Vandal, O. H., Nathan, C. F., and Ehrt, S. (2009) Acid resistance in Mycobacterium tuberculosis. J Bacteriol 191, 4714-4721 57. Archuleta, R. J., Yvonne Hoppes, P., and Primm, T. P. (2005) Mycobacterium avium enters a state of metabolic dormancy in response to starvation. Tuberculosis (Edinb) 85, 147-158 58. Loebel, R. O., Shorr, E., and Richardson, H. B. (1933) The influence of adverse conditions upon the respiratory metabolism and growth of human tubercle bacilli. J Bacteriol 26, 167-200 59. Loebel, R. O., Shorr, E., and Richardson, H. B. (1933) The influence of foodstuffs upon the respiratory metabolism and growth of human tubercle bacilli. J Bacteriol 26, 139-166 108  60. Watanabe, S., Zimmermann, M., Goodwin, M. B., Sauer, U., Barry, C. E., 3rd, and Boshoff, H. I. (2011) Fumarate reductase activity maintains an energized membrane in anaerobic Mycobacterium tuberculosis. PLoS Pathog 7, e1002287 61. Gorke, B., and Stulke, J. (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol 6, 613-624 62. Kieser, K. J., and Rubin, E. J. (2014) How sisters grow apart: mycobacterial growth and division. Nat Rev Microbiol 12, 550-562 63. Brennan, P. J., and Nikaido, H. (1995) The envelope of mycobacteria. Annu Rev Biochem 64, 29-63 64. Daffe, M., and Draper, P. (1998) The envelope layers of mycobacteria with reference to their pathogenicity. Adv Microb Physiol 39, 131-203 65. Hett, E. C., and Rubin, E. J. (2008) Bacterial growth and cell division: a mycobacterial perspective. Microbiol Mol Biol Rev 72, 126-156, table of contents 66. Brennan, P. J. (1988) Mycobacterium and other actinomycetes. in Microbial lipids (Ratledge, C., Wilkinson, S.G. ed.), Academic Press, Ltd., London. pp 203-298 67. Kumar, P., Arora, K., Lloyd, J. R., Lee, I. Y., Nair, V., Fischer, E., Boshoff, H. I., and Barry, C. E., 3rd. (2012) Meropenem inhibits D,D-carboxypeptidase activity in Mycobacterium tuberculosis. Mol Microbiol 86, 367-381 68. Lavollay, M., Arthur, M., Fourgeaud, M., Dubost, L., Marie, A., Veziris, N., Blanot, D., Gutmann, L., and Mainardi, J. L. (2008) The peptidoglycan of stationary-phase Mycobacterium tuberculosis predominantly contains cross-links generated by L,D-transpeptidation. J Bacteriol 190, 4360-4366 69. Gupta, R., Lavollay, M., Mainardi, J. L., Arthur, M., Bishai, W. R., and Lamichhane, G. (2010) The Mycobacterium tuberculosis protein LdtMt2 is a nonclassical transpeptidase required for virulence and resistance to amoxicillin. Nat Med 16, 466-469 70. Davis, K. M., and Weiser, J. N. (2011) Modifications to the peptidoglycan backbone help bacteria to establish infection. Infect Immun 79, 562-570 71. Hansen, J. M., Golchin, S. A., Veyrier, F. J., Domenech, P., Boneca, I. G., Azad, A. K., Rajaram, M. V., Schlesinger, L. S., Divangahi, M., Reed, M. B., and Behr, M. A. (2014) N-glycolylated peptidoglycan contributes to the immunogenicity but not pathogenicity of Mycobacterium tuberculosis. J Infect Dis 209, 1045-1054 72. Coulombe, F., Divangahi, M., Veyrier, F., de Leseleuc, L., Gleason, J. L., Yang, Y., Kelliher, M. A., Pandey, A. K., Sassetti, C. M., Reed, M. B., and Behr, M. A. (2009) Increased NOD2-mediated recognition of N-glycolyl muramyl dipeptide. J Exp Med 206, 1709-1716 73. Ortalo-Magne, A., Dupont, M. A., Lemassu, A., Andersen, A. B., Gounon, P., and Daffe, M. (1995) Molecular composition of the outermost capsular material of the tubercle bacillus. Microbiology 141 ( Pt 7), 1609-1620 74. Ortalo-Magne, A., Lemassu, A., Laneelle, M. A., Bardou, F., Silve, G., Gounon, P., Marchal, G., and Daffe, M. (1996) Identification of the surface-exposed lipids on the cell envelopes of Mycobacterium tuberculosis and other mycobacterial species. J Bacteriol 178, 456-461 75. Nathan, C. (2009) Taming tuberculosis: a challenge for science and society. Cell Host Microbe 5, 220-224 76. Neyrolles, O., Hernandez-Pando, R., Pietri-Rouxel, F., Fornes, P., Tailleux, L., Barrios Payan, J. A., Pivert, E., Bordat, Y., Aguilar, D., Prevost, M. C., Petit, C., and Gicquel, B. 109  (2006) Is adipose tissue a place for Mycobacterium tuberculosis persistence? PloS One 1, e43 77. Garcia-Perez, B. E., Mondragon-Flores, R., and Luna-Herrera, J. (2003) Internalization of Mycobacterium tuberculosis by macropinocytosis in non-phagocytic cells. Microb Pathog 35, 49-55 78. Killick, K. E., Ni Cheallaigh, C., O'Farrelly, C., Hokamp, K., MacHugh, D. E., and Harris, J. (2013) Receptor-mediated recognition of mycobacterial pathogens. Cell Microbiol 15, 1484-1495 79. Hmama, Z., Pena-Diaz, S., Joseph, S., and Av-Gay, Y. (2015) Immunoevasion and immunosuppression of the macrophage by Mycobacterium tuberculosis. Immunol Rev 264, 220-232 80. Gengenbacher, M., and Kaufmann, S. H. (2012) Mycobacterium tuberculosis: success through dormancy. FEMS Microbiol Rev 36, 514-532 81. Chan, J., Xing, Y., Magliozzo, R. S., and Bloom, B. R. (1992) Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. J Exp Med 175, 1111-1122 82. Cooper, A. M., Segal, B. H., Frank, A. A., Holland, S. M., and Orme, I. M. (2000) Transient loss of resistance to pulmonary tuberculosis in p47(phox-/-) mice. Infect Immun 68, 1231-1234 83. Jung, Y. J., LaCourse, R., Ryan, L., and North, R. J. (2002) Virulent but not avirulent Mycobacterium tuberculosis can evade the growth inhibitory action of a T helper 1-dependent, nitric oxide synthase 2-independent defense in mice. J Exp Med 196, 991-998 84. Adams, L. B., Dinauer, M. C., Morgenstern, D. E., and Krahenbuhl, J. L. (1997) Comparison of the roles of reactive oxygen and nitrogen intermediates in the host response to Mycobacterium tuberculosis using transgenic mice. Tuber Lung Dis 78, 237-246 85. Voskuil, M. I., Bartek, I. L., Visconti, K., and Schoolnik, G. K. (2011) The response of mycobacterium tuberculosis to reactive oxygen and nitrogen species. Front Microbiol 2, 105 86. Wilson, C. B., Tsai, V., and Remington, J. S. (1980) Failure to trigger the oxidative metabolic burst by normal macrophages: possible mechanism for survival of intracellular pathogens. J Exp Med 151, 328-346 87. Yang, C. S., Yuk, J. M., and Jo, E. K. (2009) The role of nitric oxide in mycobacterial infections. Immune Netw 9, 46-52 88. MacMicking, J. D., North, R. J., LaCourse, R., Mudgett, J. S., Shah, S. K., and Nathan, C. F. (1997) Identification of nitric oxide synthase as a protective locus against tuberculosis. Proc Natl Acad Sci U S A 94, 5243-5248 89. Scanga, C. A., Mohan, V. P., Tanaka, K., Alland, D., Flynn, J. L., and Chan, J. (2001) The inducible nitric oxide synthase locus confers protection against aerogenic challenge of both clinical and laboratory strains of Mycobacterium tuberculosis in mice. Infect Immun 69, 7711-7717 90. Sun, J., Singh, V., Lau, A., Stokes, R. W., Obregon-Henao, A., Orme, I. M., Wong, D., Av-Gay, Y., and Hmama, Z. (2013) Mycobacterium tuberculosis nucleoside diphosphate kinase inactivates small GTPases leading to evasion of innate immunity. PLoS Pathog 9, e1003499 110  91. Davis, A. S., Vergne, I., Master, S. S., Kyei, G. B., Chua, J., and Deretic, V. (2007) Mechanism of inducible nitric oxide synthase exclusion from mycobacterial phagosomes. PLoS Pathog 3, e186 92. Kumar, A., Farhana, A., Guidry, L., Saini, V., Hondalus, M., and Steyn, A. J. (2011) Redox homeostasis in mycobacteria: the key to tuberculosis control? Expert Rev Mol Med 13, e39 93. Flynn, J. L., and Chan, J. (2001) Immunology of tuberculosis. Annu Rev Immunol 19, 93-129 94. Sturgill-Koszycki, S., Schlesinger, P. H., Chakraborty, P., Haddix, P. L., Collins, H. L., Fok, A. K., Allen, R. D., Gluck, S. L., Heuser, J., and Russell, D. G. (1994) Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 263, 678-681 95. Armstrong, J. A., and Hart, P. D. (1971) Response of cultured macrophages to Mycobacterium tuberculosis, with observations on fusion of lysosomes with phagosomes. J Exp Med 134, 713-740 96. Bach, H., Papavinasasundaram, K. G., Wong, D., Hmama, Z., and Av-Gay, Y. (2008) Mycobacterium tuberculosis virulence is mediated by PtpA dephosphorylation of human vacuolar protein sorting 33B. Cell Host Microbe 3, 316-322 97. Chao, J., Wong, D., Zheng, X., Poirier, V., Bach, H., Hmama, Z., and Av-Gay, Y. (2010) Protein kinase and phosphatase signaling in Mycobacterium tuberculosis physiology and pathogenesis. Biochim Biophys Acta 1804, 620-627 98. Vergne, I., Chua, J., Lee, H.H., Lucas, M., Belisle, J., Deretic, V. (2005) Mechanism of phagolysosome biogenesis block by viable Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 102, 4033-4038 99. Russell, D. G., Cardona, P. J., Kim, M. J., Allain, S., and Altare, F. (2009) Foamy macrophages and the progression of the human tuberculosis granuloma. Nat Immunol 10, 943-948 100. Wolf, A. J., Desvignes, L., Linas, B., Banaiee, N., Tamura, T., Takatsu, K., and Ernst, J. D. (2008) Initiation of the adaptive immune response to Mycobacterium tuberculosis depends on antigen production in the local lymph node, not the lungs. J Exp Med 205, 105-115 101. Ernst, J. D. (2012) The immunological life cycle of tuberculosis. Nat Rev Immunol 12, 581-591 102. Lillebaek, T., Dirksen, A., Vynnycky, E., Baess, I., Thomsen, V. O., and Andersen, A. B. (2003) Stability of DNA patterns and evidence of Mycobacterium tuberculosis reactivation occurring decades after the initial infection. J Infect Dis 188, 1032-1039 103. Munoz-Elias, E. J., Timm, J., Botha, T., Chan, W. T., Gomez, J. E., and McKinney, J. D. (2005) Replication dynamics of Mycobacterium tuberculosis in chronically infected mice. Infect Immun 73, 546-551 104. Gill, W. P., Harik, N. S., Whiddon, M. R., Liao, R. P., Mittler, J. E., and Sherman, D. R. (2009) A replication clock for Mycobacterium tuberculosis. Nat Med 15, 211-214 105. Piddington, D. L., Kashkouli, A., and Buchmeier, N. A. (2000) Growth of Mycobacterium tuberculosis in a defined medium is very restricted by acid pH and Mg(2+) levels. Infect Immun 68, 4518-4522 111  106. Wayne, L. G., and Hayes, L. G. (1996) An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infect Immun 64, 2062-2069 107. Sivaramakrishnan, S., and de Montellano, P. R. (2013) The DosS-DosT/DosR Mycobacterial sensor system. Biosensors (Basel) 3, 259-282 108. Rittershaus, E. S., Baek, S. H., and Sassetti, C. M. (2013) The normalcy of dormancy: common themes in microbial quiescence. Cell Host Microbe 13, 643-651 109. Rao, S. P., Alonso, S., Rand, L., Dick, T., Pethe, K. (2008) The protonmotive force is required for maintaining ATP homeostasis and viability of hypoxic, nonreplicating Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 105, 11945-11950 110. Khoury, G. A., Baliban, R. C., and Floudas, C. A. (2011) Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep 1 111. Wang, J. Y., and Koshland, D. E., Jr. (1978) Evidence for protein kinase activities in the prokaryote Salmonella typhimurium. J Biol Chem 253, 7605-7608 112. Garnak, M., and Reeves, H. C. (1979) Phosphorylation of Isocitrate dehydrogenase of Escherichia coli. Science 203, 1111-1112 113. Manai, M., and Cozzone, A. J. (1979) Analysis of the protein-kinase activity of Escherichia coli cells. Biochem Biophys Res Commun 91, 819-826 114. Mizuno, T., Wurtzel, E. T., and Inouye, M. (1982) Osmoregulation of gene expression. II. DNA sequence of the envZ gene of the ompB operon of Escherichia coli and characterization of its gene product. J Biol Chem 257, 13692-13698 115. Tommassen, J., de Geus, P., Lugtenberg, B., Hackett, J., Reeves, P. (1982) Regulation of the pho regulon of Escherichia coli K-12. Cloning of the regulatory genes phoB and phoR and identification of their gene products. J Mol Biol 157, 265-274 116. Grebe, T. W., and Stock, J. B. (1999) The histidine protein kinase superfamily. Adv Microb Physiol 41, 139-227 117. Kannan, N., Taylor, S. S., Zhai, Y., Venter, J. C., and Manning, G. (2007) Structural and functional diversity of the microbial kinome. PLoS Biol 5, e17 118. Wong, D., Chao, J. D., and Av-Gay, Y. (2013) Mycobacterium tuberculosis-secreted phosphatases: from pathogenesis to targets for TB drug development. Trends Microbiol 21, 100-109 119. Prisic, S., and Husson, R. N. (2014) Mycobacterium tuberculosis serine/threonine protein kinases. Microbiol Spectr 2 120. Sickmann, A., and Meyer, H. E. (2001) Phosphoamino acid analysis. Proteomics 1, 200-206 121. Av-Gay, Y., and Everett, M. (2000) The eukaryotic-like ser/thr protein kinases of Mycobacterium tuberculosis. Trends Microbiol 8, 238-244 122. Alber, T. (2009) Signaling mechanisms of the Mycobacterium tuberculosis receptor Ser/Thr protein kinases. Curr Opin Struct Biol 19, 650-657 123. Kumar, P., Kumar, D., Parikh, A., Rananaware, D., Gupta, M., Singh, Y., and Nandicoori, V. K. (2009) The Mycobacterium tuberculosis protein kinase K modulates activation of transcription from the promoter of mycobacterial monooxygenase operon through phosphorylation of the transcriptional regulator VirS. J Biol Chem 284, 11090-11099 112  124. Prisic, S., Dankwa, S., Schwartz, D., Chou, M. F., Locasale, J. W., Kang, C. M., Bemis, G., Church, G. M., Steen, H., and Husson, R. N. (2010) Extensive phosphorylation with overlapping specificity by Mycobacterium tuberculosis serine/threonine protein kinases. Proc Natl Acad Sci U S A 107, 7521-7526 125. Junger, M. A., Aebersold, R. (2014) Mass spectrometry-drivenphosphoproteomics: patterningthe systems biology mosaic. WIREs Dev Biol 3, 83-112 126. Chao, J. D., Papavinasasundaram, K. G., Zheng, X., Chavez-Steenbock, A., Wang, X., Lee, G. Q., and Av-Gay, Y. (2010) Convergence of Ser/Thr and two-component signaling to coordinate expression of the dormancy regulon in Mycobacterium tuberculosis. J Biol Chem 285, 29239-29246 127. Sharma, K., Gupta, M., Pathak, M., Gupta, N., Koul, A., Sarangi, S., Baweja, R., and Singh, Y. (2006) Transcriptional control of the mycobacterial embCAB operon by PknH through a regulatory protein, EmbR, in vivo. J Bacteriol 188, 2936-2944 128. Cohen-Gonsaud, M., Barthe, P., Canova, M. J., Stagier-Simon, C., Kremer, L., Roumestand, C., and Molle, V. (2009) The Mycobacterium tuberculosis Ser/Thr kinase substrate Rv2175c is a DNA-binding protein regulated by phosphorylation. J Biol Chem 284, 19290-19300 129. Richard-Greenblatt, M., Av-Gay, Y. (In press) Epigenetic control of the persistence phenotype by phosphorylation. in The Signature Problem of TB: Persistence. (Jacobs, W. J., McShane, H., Mizrahi, V., Orme, I. ed.), American Society for Microbiology, Washington, DC. pp  130. Schiff, P. L. (2006) Ergot and its alkaloids. Am J Pharm Educ 70, 98 131. Blyth, A. (1895) Poisons, their effects and detection, William and Wood Company, New York 132. Tanret, C. (1909) Sur une base nouvelle retiree du seigle ergote, l'ergothioneine. Comptes Rendus Chimie 44, 222-224 133. Barger, G., Ewins A.J (1911) The constitution of ergothioneine: a betaine related to histidine. J Chem Soc 99, 2236-2341 134. Melville, D. B., Horner, W.H., Otken, C.C., Ludwig, M.L. (1955) Studies on the origin of ergothioneine in animals. J Biol Chem 213, 61-68 135. Melville, D. B., Otken, C.C., Kovalenko, V. (1955) On the origin of animal ergothioneine J Biol Chem 216, 325-231 136. Melville, D. B., and Eich, S. (1956) The occurrence of ergothioneine in plant material. J Biol Chem 218, 647-651 137. Ey, J., Schömig, E., Taubert, D. (2007) Dietary sources and antioxidant effects of ergothioneine. J Agric Food Chem 55, 6466-6474 138. Baldridge RC, L. H. (1953) Diet and the ergothioneine content of blood. J Biol Chem 202, 169-176 139. Eagles, B. A., Vars, H.M. (1928) The physiology of ergothioneine. J Biol Chem 202, 169-176 140. Hunter, G. (1951) On ergothioneine in blood and diazo-reacting substances in maize. Biochem J 48, 265-270 141. Dubost, N. J., Beelman, R.B., Peterson, D., Royse, D.J. (2007) Influence of selected cultural factors and postharvest storage on ergothioneine content of common button mushroom Agaricus bisporus. Int J Med Mushrooms 9, 163-176 113  142. Melville, D. B., Genghof, D.S., Inamine, E., Kovalenko, V. (1956) Ergothioneine in microorganisms. J Biol Chem 223, 9-17 143. Bello MH, B.-P. V., Morin D, Epstein L. (2012) The Neurospora crassa mutant NcΔEgt-1 identifies an ergothioneine biosynthetic gene and demonstrates that ergothioneine enhances conidial survival and protects against peroxide toxicity during conidial germination. Fungal Genet Biol 49, 160-172 144. Pluskal, T., Ueno, M., and Yanagida, M. (2014) Genetic and metabolomic dissection of the ergothioneine and selenoneine biosynthetic pathway in the fission yeast, S. pombe, and construction of an overproduction system. PloS One 9, e97774 145. Genghof, D. S. (1960) The production of ergothioneine by Mycobacterium tuberculosis. Bacteriol Proc  146. Genghof, D. S. (1970) Biosynthesis of ergothioneine and hercynine by fungi and Actinomycetales. J Bacteriol 103, 475-478 147. Genghof, D. S., and Vandamme, O. (1964) Biosynthesis of Ergothioneine and Hercynine by Mycobacteria. J Bacteriol 87, 852-862 148. Pfeiffer, C., Bauer, T., Surek, B. Schӧmig, E., Gründemann, D. (2011) Cyanobacteria produce high levels of ergothioneine. Food Chem 129, 1766-1769 149. Jones, G. W., Doyle, S., and Fitzpatrick, D. A. (2014) The evolutionary history of the genes involved in the biosynthesis of the antioxidant ergothioneine. Gene 549, 161-170 150. Melville, D. B., Eich, S., and Ludwig, M. L. (1957) The biosynthesis of ergothioneine. J Biol Chem 224, 871-877 151. Heath H, W. J. (1957) Biosynthesis of ESH. Nature 179, 196-197 152. Melville, D. B., Ludwig, M. L., Inamine, E., and Rachele, J. R. (1959) Transmethylation in the biosynthesis of ergothionelne. J Biol Chem 234, 1195-1198 153. Askari, A., Melville, D.B. (1962) The reaction sequence in ergothioneine biosynthesis: hercynine as an intermediate. J Biol Chem 237, 1615-1618 154. Ishikawa, Y., Israel, S. E., and Melville, D. B. (1974) Participation of an intermediate sulfoxide in the enzymatic thiolation of the imidazole ring of hercynine to form ergothioneine. J Biol Chem 249, 4420-4427 155. Seebeck, F. P. (2010) In vitro reconstitution of Mycobacterial ergothioneine biosynthesis. J Am Chem Soc 132, 6632-6633 156. Hu, W., Song, H., Sae Her, A., Bak, D. W., Naowarojna, N., Elliott, S. J., Qin, L., Chen, X., and Liu, P. (2014) Bioinformatic and biochemical characterizations of C-S bond formation and cleavage enzymes in the fungus Neurospora crassa ergothioneine biosynthetic pathway. Org Lett 16, 5382-5385 157. Narainsamy, K., Farci, S., Braun, E., Junot, C., Cassier-Chauvat, C., and Chauvat, F. (2015) Oxidative-stress detoxification and signaling in cyanobacteria: The crucial glutathione synthesis pathway supports the production of ergothioneine and ophthalmate. Mol Microbiol  158. Mata, J., Lyne, R., Burns, G., Bahler, J. (2002) The transcriptional program of meiosis and sporulation in fission yeast. Nat Genet 32, 143-147 159. Ta, P., Buchmeier, N., Newton, G. L., Rawat, M., and Fahey, R. C. (2011) Organic hydroperoxide resistance protein and ergothioneine compensate for loss of mycothiol in Mycobacterium smegmatis mutants. J Bacteriol 193, 1981-1990 114  160. Pluskal, T., Hayashi, T., Saitoh, S., Fujisawa, A., Yanagida, M. (2011) Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast. FEBS J 278, 1299-1315 161. Sajiki, K., Pluskal, T., Shimanuki, M., and Yanagida, M. (2013) Metabolomic analysis of fission yeast at the onset of nitrogen starvation. Metabolites 3, 1118-1129 162. Muramatsu, H., Matsuo, H., Okada, N., Ueda, M., Yamamoto, H., Kato, S. I., and Nagata, S. (2012) Characterization of ergothionase from Burkholderia sp. HME13 and its application to enzymatic quantification of ergothioneine. Appl Microbiol Biotechnol  163. Wolff, J. (1962) Ergothionase from Escherichia coli J Biol Chem 237, 874-881 164. Yanasugondha, D., Appleman, M.D. (1957) Degradation of ergothioneine by Alcaligenes faecalis. J Bacteriol 74, 381-385 165. Akabori, S. (1933) Synthese von imidazol-derivaten aus α-amino-säuren, I, mitteil.: Eine neue synthese von desamino-histidin und ein beitrag zur kenntnis der konstitution des ergothioneins. Ber Dtsch Chem Ges 66, 151-158 166. Sugihara, A., Uemura, K. (1976) The crystal structure of L-ergothioneine dihydrate, C9H15N3O2S ∙ 2H2O. Acta Crystallogr B32, 181-185 167. Motohashi, N., Mori, I., Sugiura, Y. (1976) 13C-nuclear magnetic resonance and raman spectroscopic studies on ionization and mercury complex of ergothioneine. Chem Pharm Bull (Tokyo) 24, 1737-1741 168. Jovanovic, S. V., Simic, M.G. (1991) Anticarcinogenesis and radiation protection 2, Plenum Press, New York 169. Fahey, R. C. (2001) Novel thiols of prokaryotes. Annu Rev Microbiol 55, 333-356 170. Jocelyn, P. C. (1972) Biochemistry of the SH group, Academic Press, New York 171. Bhaskar, A., Chawla, M., Mehta, M., Parikh, P., Chandra, P., Bhave, D., Kumar, D., Carroll, K. S., and Singh, A. (2014) Reengineering redox sensitive GFP to measure mycothiol redox potential of Mycobacterium tuberculosis during infection. PLoS Pathog 10, e1003902 172. Heath, H., and Toennies, G. (1958) The preparation and properties of ergothioneine disulphide. Biochem J 68, 204-210 173. Cheah, I. K., Halliwell, B. (2012) Ergothioneine; antioxidant potential, physiological function and role in disease. Biochemica and Biophysica Acta 1822, 784-793 174. Zhu, B. Z., Mao, L., Fan, R.M., Zhu, J.G., Zhang, Y.N., Wang, J., Kalyanaraman, B., Frei, B. (2011) Ergothioneine prevents copper-induced oxidative damage to DNA and protein by forming a redox-inactive ergothioneine-copper complex. Chem Res Toxicol 24, 30-34 175. Hand, C. E., and Honek, J. F. (2005) Biological chemistry of naturally occurring thiols of microbial and marine origin. J Nat Prod 68, 293-308 176. Hand, C. E., Taylor, N. J., and Honek, J. F. (2005) Ab initio studies of the properties of intracellular thiols ergothioneine and ovothiol. Bioorg Med Chem Lett 15, 1357-1360 177. Asmus, K. D., Bensasson, R. V., Bernier, J. L., Houssin, R., and Land, E. J. (1996) One-electron oxidation of ergothioneine and analogues investigated by pulse radiolysis: redox reaction involving ergothioneine and vitamin C. Biochem J 315 ( Pt 2), 625-629 178. Woodward, G. E., Fry, E.G. (1932) The determination of blood glutathione. J Biol Chem 97, 465-482 179. Aruoma OI, L. M., Halliwell B. (1989) Carnosine, homocarnosine and anserine: Could they act as antioxidants in vivo? Biochem J 264, 863-869 115  180. Akanmu, D., Cecchini, R., Aruoma, O.I., Halliwell, B. (1991) The antioxidant action of ergothioneine. Arch Biochem Biophys 288, 10-16 181. He, Q. C., Krone, K., Scherl, D., Kotler, M., Tavakkol, A. (2004) The use of ozone as an oxidizing agent to evaluate antioxidant activities of natural substances. Skin Pharmacol Physiol 17, 183-189 182. Weiss, S. (1989) Tissue destruction by neutrophils. N Engl J Med 320, 365-376 183. Acworth, I. N. M., D.R., Maher, T.J. (1997) The analysis of free radicals, their reaction products, and antioxidants. in Oxidants, antioxidants, and free radicals (Baskin SI, S. H. ed.), Taylor & Francis, Washinton. pp 23-78 184. Franzoni, F., Colognato, R., Galetta, F., Laurenza, I., Barsotti, M., Di Stefano, R., Bocchetti, R., Regoli, F., Carpi, A., Balbarini, A., Migliore, L., and Santoro, G. (2006) An in vitro study on the free radical scavenging capacity of ergothioneine: comparison with reduced glutathione, uric acid and trolox. Biomed Pharmacother 60, 453-457 185. Aruoma, O. I., Spencer, J.P., Mahmood, N. (1999) Protection against oxidative damage and cell death by the natural antioxidant ergothioneine. Food Chem Toxicol 37, 1043-1053 186. Aruoma, O. I., Whiteman, M., England, T.G., Halliwell, B. (1997) Antioxidant action of ergothioneine: assessment of its ability to scavenge peroxynitrite. Biochem Biophys Res Commun 231, 389-391 187. Obayashi, K., Kurihara, K., Okano, Y., Masaki, H., and Yarosh, D. B. (2005) L-Ergothioneine scavenges superoxide and singlet oxygen and suppresses TNF-alpha and MMP-1 expression in UV-irradiated human dermal fibroblasts. J Cosmet Sci 56, 17-27 188. Devasagayam, T. P., Sundquist, A.R., Di Mascio, P., Kaiser, S., Sies, H. (1991) Activity of thiols as singlet molecular oxygen quenchers. J Photochem Photobiol B 9, 105-116 189. Dahl, T. A., Midden, W.R., Hartman, P.E. (1988) Some prevalent biomolecules as defenses against singlet oxygen damage. Photochem Photobiol 47, 357-362 190. Hartman, P. E., Hartman, Z., Ault, K.T. (1990) Scavenging of singlet molecular oxygen by imidazole compounds: high and sustained activities of carboxy terminal histidine dipeptides and exceptional activity of imidazole-4-acetic acid. Photochem and Photobiol 51, 59-66 191. Jang, J. H., Aruoma, O.I., Jen, L.S., Chung, H.Y., Surh, Y.J. (2004) Ergothioneine rescues PC12 cells from beta-amyloid-induced apoptotic death. Free Radic Biol Med 36, 288-299 192. Arduini, A., Eddy, L., and Hochstein, P. (1990) The reduction of ferryl myoglobin by ergothioneine: a novel function for ergothioneine. Arch Biochem Biophys 281, 41-43 193. Hartman, P. E. (1990) Ergothioneine as antioxidant. Methods Enzymol 186, 310-318 194. Cowley, S., Ko, M., Pick, N., Chow, R., Downing, K. J., Gordhan, B. G., Betts, J. C., Mizrahi, V., Smith, D. A., Stokes, R. W., and Av-Gay, Y. (2004) The Mycobacterium tuberculosis protein serine/threonine kinase PknG is linked to cellular glutamate/glutamine levels and is important for growth in vivo. Mol Microbiol 52, 1691-1702 195. Paul, D. B., Snyder, S. H. (2010) The unusual amino acid L-ergothioneine is a physiologic cytoprotectant. Cell Death Differ 17, 1134-1140 196. Grundemann, D., Harlfinger, S., Golz, S., Geerts, A., Lazar, A., Berkels, R., Jung, N., Rubbert, A., and Schomig, E. (2005) Discovery of the ergothioneine transporter. Proc Natl Acad Sci U S A 102, 5256-5261 116  197. Yabuuchi, H., Tamai, I., Nezu, J., Sakamoto, K., Oku, A., Shimane, M., Sai, Y., and Tsuji, A. (1999) Novel membrane transporter OCTN1 mediates multispecific, bidirectional, and pH-dependent transport of organic cations. J Pharmacol Exp Ther 289, 768-773 198. Nakamura, T., Yoshida, K., Yabuuchi, H., Maeda, T., Tamai, I. (2008) Functional characterization of ergothioneine transport by rat organic cation/carnitine transporter Octn1 (slc22a4). Biol Pharm Bull 31, 1580-1584 199. Nikodemus, D., Lazic, D., Bach, M., Bauer, T., Pfeiffer, C., Wiltzer, L., Lain, E., Schömig, E., Gründemann, D. (2011) Paramount levels of ergothioneine transporter SLC22A4 mRNA in boar seminal vesicles and cross-species analysis of ergothioneine and glutathione in seminal plasma. J Physiol Pharmacol 62, 411-419 200. Tamai, I., Nakanishi, T., Kobayashi, D., China, K., Kosugi, Y., Nezu, J., Sai, Y., Tsuji, A. (2004) Involvement of OCTN1 (SLC22A4) in pH-dependent transport of organic cations. Mol Pharm 1, 57-66 201. Lamhonwah, A. M., Tein, I. (2006) Novel localization of OCTN1, an organic cation/carnitine transporter, to mammalian mitochondria. Biochem Biophys Res Commun 345, 1315-1325 202. Grundemann, D. (2012) The ergothioneine transporter control and indicates ergothioneine activity - a review. Prev Med 54, S71-S-74 203. Kato, Y., Kubo, Y., Iwata, D., Kato, S., Sudo, T., Sugiura, T., Kagaya, T., Wakayama, T., Hirayama, A., Sugimoto, M., Sugihara, K., Kaneko, S., Soga, T., Asano, M., Tomita, M., Matsui, T., Wada, M., and Tsuji, A. (2010) Gene knockout and metabolome analysis of carnitine/organic cation transporter OCTN1. Pharm Res 27, 832-840 204. Cheah, I. K., Ong, R. L., Gruber, J., Yew, T. S., Ng, L. F., Chen, C. B., and Halliwell, B. (2013) Knockout of a putative ergothioneine transporter in Caenorhabditis elegans decreases lifespan and increases susceptibility to oxidative damage. Free Radic Res 47, 1036-1045 205. Tokuhiro, S., Yamanda, R., Chang, X., et al. (2003) An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis. Nat Genet 35, 341-348 206. Taubert, D., Lazar, A., Grimberg, G., Jung, N., Rubbert, A., Delank, K. S., Perniok, A., Erdmann, E., and Schomig, E. (2006) Association of rheumatoid arthritis with ergothioneine levels in red blood cells: a case control study. J Rheumatol 33, 2139-2145 207. Leung, E., Hong, J., Fraser, A. G., Merriman, T. R., Vishnu, P., and Krissansen, G. W. (2006) Polymorphisms in the organic cation transporter genes SLC22A4 and SLC22A5 and Crohn's disease in a New Zealand Caucasian cohort. Immunol Cell Biol 84, 233-236 208. Peltekova, V. D., Wintle, R. F., Rubin, L. A., Amos, C. I., Huang, Q., Gu, X., Newman, B., Van Oene, M., Cescon, D., Greenberg, G., Griffiths, A. M., St George-Hyslop, P. H., and Siminovitch, K. A. (2004) Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat Genet 36, 471-475 209. Taubert, D., Jung, N., Goeser, T., and Schomig, E. (2009) Increased ergothioneine tissue concentrations in carriers of the Crohn's disease risk-associated 503F variant of the organic cation transporter OCTN1. Gut 58, 312-314 210. Taubert, D., Grimberg, G., Jung, N., Rubbert, A., and Schomig, E. (2005) Functional role of the 503F variant of the organic cation transporter OCTN1 in Crohn's disease. Gut 54, 1505-1506 117  211. Nakamura, T., Sugiura, S., Kobayashi, D., Yoshida, K., Yabuuchi, H., Aizawa, S., Maeda, T., and Tamai, I. (2007) Decreased proliferation and erythroid differentiation of K562 cells by siRNA-induced depression of OCTN1 (SLC22A4) transporter gene. Pharm Res 24, 1628-1635 212. Maeda, T., Hirayama, M., Kobayashi, D., Miyazawa, K., and Tamai, I. (2007) Mechanism of the regulation of organic cation/carnitine transporter 1 (SLC22A4) by rheumatoid arthritis-associated transcriptional factor RUNX1 and inflammatory cytokines. Drug Metab Dispos 35, 394-401 213. Rahman, I., Gilmour, P. S., Jimenez, L. A., Biswas, S. K., Antonicelli, F., and Aruoma, O. I. (2003) Ergothioneine inhibits oxidative stress- and TNF-alpha-induced NF-kappa B activation and interleukin-8 release in alveolar epithelial cells. Biochem Biophys Res Commun 302, 860-864 214. Laurenza, I., Colognato, R., Migliore, L., Del Prato, S., and Benzi, L. (2008) Modulation of palmitic acid-induced cell death by ergothioneine: evidence of an anti-inflammatory action. Biofactors 33, 237-247 215. Martin, K. R. (2010) The bioactive agent ergothineine, a key component of dietary mushrooms, inhibits monocyte binding to endothelial cells characteristic of early cardiovascular disease. J Med Food 13, 1340-1346 216. Song, T. Y., Chen, C.L., Liao, J.W., Ou, H.C., Tsai, M.S. (2010) Ergothioneine protects against neuronal injury induced by cisplatin both in vitro and in vivo. Food Chem Toxicol 48, 3492-3499 217. Moncaster, J. A., Walsh, D. T., Gentleman, S. M., Jen, L. S., and Aruoma, O. I. (2002) Ergothioneine treatment protects neurons against N-methyl-D-aspartate excitotoxicity in an in vivo rat retinal model. Neurosci Lett 328, 55-59 218. Bedirli, A., Sakrak, O., Muhtaroglu, S., Soyuer, I., Guler, I., Erdogan, A. R., Sozuer, E.M. (2004) Ergothioneine pretreatment protects the liver from ischemia-reperfusion injury caucalsed by increasing hepatic heat shock protein 70. J Surg Res 122, 96-102 219. Sakrak, O., Kerem, M., Bedirli, A., Pasaoglu, H., Akyurek, N., Ofluoglu, E., and Gultekin, F. A. (2008) Ergothioneine modulates proinflammatory cytokines and heat shock protein 70 in mesenteric ischemia and reperfusion injury. J Surg Res 144, 36-42 220. Cargnoni, A., Bernocchi, P., Ceconi, C., Curello, S., and Ferrari, R. (1995) In vitro administration of ergothioneine failed to protect isolated ischaemic and reperfused rabbit heart. Biochim Biophys Acta 1270, 173-178 221. Epand, R. M., Epand, R.F., Wong, S.C. (1988) Study of the ergothioneine concentration in the blood of individuals with diabetes mellitus. J Clin Chem Clin Biochem 26, 623-626 222. Fraser, R., and Jegard, S. (1950) Blood ergothioneine levels in diabetes mellitus. J Lab Clin Med 35, 960-967 223. Salt, H. (1931) The ergothioneine content of the blood in health and disease. Biochem J 25, 1712-1719 224. Guijarro, M. V., Indart, A., Aruoma, O.I., Viana, M., Bonet, B. (2002) Effects of ergothioneine on diabetic embryopathy in pregnant rats. Food Chem Toxicol 40, 1751-1755 225. Fraser, R. S. (1951) Blood ergothioneine levels in disease. J Lab Clin Med 37, 199-206 226. Cumming, B. M., Lamprecht, D. A., Wells, R. M., Saini, V., Mazorodze, J. H., and Steyn, A. J. (2014) The physiology and genetics of oxidative stress in mycobacteria. Microbiol Spectr 2 118  227. Ridruechai, C., Mahasirimongkol, S., Phromjai, J., Yanai, H., Nishida, N., Matsushita, I., Ohashi, J., Yamada, N., Moolphate, S., Summanapan, S., Chuchottaworn, C., Manosuthi, W., Kantipong, P., Kanitvittaya, S., Sawanpanyalert, P., Keicho, N., Khusmith, S., and Tokunaga, K. (2010) Association analysis of susceptibility candidate region on chromosome 5q31 for tuberculosis. Genes Immun 11, 416-422 228. Betts, J. C., Lukey, P. T., Robb, L. C., McAdam, R. A., and Duncan, K. (2002) Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mol Microbiol 43, 717-731 229. Bardarov, S., Bardarov Jr, S., Jr., Pavelka Jr, M. S., Jr., Sambandamurthy, V., Larsen, M., Tufariello, J., Chan, J., Hatfull, G., and Jacobs Jr, W. R., Jr. (2002) Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology 148, 3007-3017 230. Zheng, X., Papavinasasundaram, K. G., and Av-Gay, Y. (2007) Novel substrates of Mycobacterium tuberculosis PknH ser/thr kinase. Biochem Biophys Res Commun 355, 162-168 231. Zhou, P., Li, W., Wong, D., Xie, J., and Av-Gay, Y. (2014) Phosphorylation control of protein tyrosine phosphatase A activity in Mycobacterium tuberculosis. FEBS Lett  232. Singh, A., Mai, D., Kumar, A., Steyn, A.J. (2006) Dissecting virulence pathways of Mycobacterium tuberculosis through protein-protein association. Proc Natl Acad Sci U S A 103, 11346-11351 233. Stover CK, d. l. C. V., Fuerst TR, Burlein JE, Benson LA, Bennett LT, Bansal GP, Young JF, Lee MH, Hatfull GF, Snapper SB, Barletta RG, Jacobs RJ, Jr, Bloom BR. (1991) New use of BCG for recombinant vaccines. Nature 351, 456-460 234. Luo, D., Smith, S. W., and Anderson, B. D. (2005) Kinetics and mechanism of the reaction of cysteine and hydrogen peroxide in aqueous solution. J Pharm Sci 94, 304-316 235. Fahey, R. C. (2013) Glutathione analogs in prokaryotes. Biochim Biophys Acta 1830, 3182-3198 236. Newton, G. L., Arnold, K., Price, M. S., Sherrill, C., Delcardayre, S. B., Aharonowitz, Y., Cohen, G., Davies, J., Fahey, R. C., and Davis, C. (1996) Distribution of thiols in microorganisms: mycothiol is a major thiol in most actinomycetes. J Bacteriol 178, 1990-1995 237. Rawat, M., Newton, G. L., Ko, M., Martinez, G. J., Fahey, R. C., and Av-Gay, Y. (2002) Mycothiol-deficient Mycobacterium smegmatis mutants are hypersensitive to alkylating agents, free radicals, and antibiotics. Antimicrob Agents Chemother 46, 3348-3355 238. Ung, K. S., and Av-Gay, Y. (2006) Mycothiol-dependent mycobacterial response to oxidative stress. FEBS Lett 580, 2712-2716 239. Rawat, M., Uppal, M., Newton, G., Steffek, M., Fahey, R. C., and Av-Gay, Y. (2004) Targeted mutagenesis of the Mycobacterium smegmatis mca gene, encoding a mycothiol-dependent detoxification protein. J Bacteriol 186, 6050-6058 240. Newton, G. L., Unson, M. D., Anderberg, S. J., Aguilera, J. A., Oh, N. N., delCardayre, S. B., Av-Gay, Y., and Fahey, R. C. (1999) Characterization of Mycobacterium smegmatis mutants defective in 1-d-myo-inosityl-2-amino-2-deoxy-alpha-d-glucopyranoside and mycothiol biosynthesis. Biochem Biophys Res Commun 255, 239-244 119  241. Miller, C. C., Rawat, M., Johnson, T., and Av-Gay, Y. (2007) Innate protection of Mycobacterium smegmatis against the antimicrobial activity of nitric oxide is provided by mycothiol. Antimicrob Agents Chemother 51, 3364-3366 242. Rawat, M., Johnson, C., Cadiz, V., and Av-Gay, Y. (2007) Comparative analysis of mutants in the mycothiol biosynthesis pathway in Mycobacterium smegmatis. Biochem Biophys Res Commun 363, 71-76 243. Rawat, M., Kovacevic, S., Billman-Jacobe, H., and Av-Gay, Y. (2003) Inactivation of mshB, a key gene in the mycothiol biosynthesis pathway in Mycobacterium smegmatis. Microbiology 149, 1341-1349 244. Vilcheze, C., Av-Gay, Y., Attarian, R., Liu, Z., Hazbon, M. H., Colangeli, R., Chen, B., Liu, W., Alland, D., Sacchettini, J. C., and Jacobs, W. R., Jr. (2008) Mycothiol biosynthesis is essential for ethionamide susceptibility in Mycobacterium tuberculosis. Mol Microbiol 69, 1316-1329 245. Calvin, M. (1956) GSH Symposium, Academic Press, London and New York 246. Saini, V., Cumming, B. M., Guidry, L., Lamprecht, D. A., Adamson, J. H., Reddy, V. P., Chinta, K. C., Mazorodze, J. H., Glasgow, J. N., Richard-Greenblatt, M., Gomez-Velasco, A., Bach, H., Av-Gay, Y., Eoh, H., Rhee, K., and Steyn, A. J. (2016) Ergothioneine maintains redox and bioenergetic homeostasis essential for drug susceptibility and virulence of Mycobacterium tuberculosis. Cell Rep 14, 572-585 247. Sao Emani C, W. M., Wiid IJ, Hiten NF, Viljoen AJ, Pietersen RD, van Helden PD, Baker B. (2013) Ergothioneine is a secreted antioxidant in Mycobacterium smegmatis. Antimicrobial agents and chemotherapy 57, 3202-3207 248. Mestas, J., and Hughes, C. C. (2004) Of mice and not men: differences between mouse and human immunology. J Immunol 172, 2731-2738 249. Khan, S., Nagarajan, S. N., Parikh, A., Samantaray, S., Singh, A., Kumar, D., Roy, R. P., Bhatt, A., and Nandicoori, V. K. (2010) Phosphorylation of enoyl-acyl carrier protein reductase InhA impacts mycobacterial growth and survival. J Biol Chem 285, 37860-37871 250. Veyron-Churlet, R., Zanella-Cleon, I., Cohen-Gonsaud, M., Molle, V., and Kremer, L. (2010) Phosphorylation of the Mycobacterium tuberculosis beta-ketoacyl-acyl carrier protein reductase MabA regulates mycolic acid biosynthesis. J Biol Chem 285, 12714-12725 251. Molle, V., Gulten, G., Vilcheze, C., Veyron-Churlet, R., Zanella-Cleon, I., Sacchettini, J. C., Jacobs, W. R., Jr., and Kremer, L. (2010) Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis. Mol Microbiol 78, 1591-1605 252. Corrales, R. M., Molle, V., Leiba, J., Mourey, L., de Chastellier, C., and Kremer, L. (2012) Phosphorylation of mycobacterial PcaA inhibits mycolic acid cyclopropanation: consequences for intracellular survival and for phagosome maturation block. J Biol Chem 287, 26187-26199 253. Gomez-Velasco, A., Bach, H., Rana, A. K., Cox, L. R., Bhatt, A., Besra, G. S., and Av-Gay, Y. (2013) Disruption of the serine/threonine protein kinase H affects phthiocerol dimycocerosates synthesis in Mycobacterium tuberculosis. Microbiology 159, 726-736 254. Leiba, J., Syson, K., Baronian, G., Zanella-Cleon, I., Kalscheuer, R., Kremer, L., Bornemann, S., and Molle, V. (2013) Mycobacterium tuberculosis maltosyltransferase 120  GlgE, a genetically validated antituberculosis target, is negatively regulated by Ser/Thr phosphorylation. J Biol Chem 288, 16546-16556 255. Vanzembergh, F., Peirs, P., Lefevre, P., Celio, N., Mathys, V., Content, J., and Kalai, M. (2010) Effect of PstS sub-units or PknD deficiency on the survival of Mycobacterium tuberculosis. Tuberculosis (Edinb) 90, 338-345 256. Ehrt, S., and Rhee, K. (2013) Mycobacterium tuberculosis metabolism and host interaction: mysteries and paradoxes. Curr Top Microbiol Immunol 374, 163-188 257. Timm, J., Post, F. A., Bekker, L. G., Walther, G. B., Wainwright, H. C., Manganelli, R., Chan, W. T., Tsenova, L., Gold, B., Smith, I., Kaplan, G., and McKinney, J. D. (2003) Differential expression of iron-, carbon-, and oxygen-responsive mycobacterial genes in the lungs of chronically infected mice and tuberculosis patients. Proc Natl Acad Sci U S A 100, 14321-14326 258. Garton, N. J., Waddell, S. J., Sherratt, A. L., Lee, S. M., Smith, R. J., Senner, C., Hinds, J., Rajakumar, K., Adegbola, R. A., Besra, G. S., Butcher, P. D., and Barer, M. R. (2008) Cytological and transcript analyses reveal fat and lazy persister-like bacilli in tuberculous sputum. PLoS Med 5, e75 259. Voskuil, M. I. (2004) Mycobacterium tuberculosis gene expression during environmental conditions associated with latency. Tuberculosis (Edinb) 84, 138-143 260. Talaat, A. M., Ward, S. K., Wu, C. W., Rondon, E., Tavano, C., Bannantine, J. P., Lyons, R., and Johnston, S. A. (2007) Mycobacterial bacilli are metabolically active during chronic tuberculosis in murine lungs: insights from genome-wide transcriptional profiling. J Bacteriol 189, 4265-4274 261. Luo, M., Fadeev, E. A., and Groves, J. T. (2005) Mycobactin-mediated iron acquisition within macrophages. Nat Chem Biol 1, 149-153 262. McKinney, J. D., Honer zu Bentrup, K., Munoz-Elias, E. J., Miczak, A., Chen, B., Chan, W. T., Swenson, D., Sacchettini, J. C., Jacobs, W. R., Jr., and Russell, D. G. (2000) Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406, 735-738 263. Munoz-Elias, E. J., and McKinney, J. D. (2005) Mycobacterium tuberculosis isocitrate lyases 1 and 2 are jointly required for in vivo growth and virulence. Nat Med 11, 638-644 264. Marrero, J., Rhee, K. Y., Schnappinger, D., Pethe, K., and Ehrt, S. (2010) Gluconeogenic carbon flow of tricarboxylic acid cycle intermediates is critical for Mycobacterium tuberculosis to establish and maintain infection. Proc Natl Acad Sci U S A 107, 9819-9824 265. Blumenthal, A., Trujillo, C., Ehrt, S., and Schnappinger, D. (2010) Simultaneous analysis of multiple Mycobacterium tuberculosis knockdown mutants in vitro and in vivo. PloS One 5, e15667 266. Nyka, W. (1974) Studies on the effect of starvation on mycobacteria. Infect Immun 9, 843-850 267. Wayne, L. G., and Sohaskey, C. D. (2001) Nonreplicating persistence of Mycobacterium tuberculosis. Annu Rev Microbiol 55, 139-163 268. Stewart, G. R., Robertson, B. D., and Young, D. B. (2003) Tuberculosis: a problem with persistence. Nat Rev Microbiol 1, 97-105 269. Ulrichs, T., and Kaufmann, S. H. (2006) New insights into the function of granulomas in human tuberculosis. J Pathol 208, 261-269 121  270. Vit A, M. L., Blankenfeldt W, Seebeck FP. (2015) Ergothioneine Biosynthetic Methyltransferase EgtD Reveals the Structural Basis of Aromatic Amino Acid Betaine Biosynthesis. Chembiochem 16, 119-125 271. Jeong, J. H., Cha, H. J., Ha, S. C., Rojviriya, C., and Kim, Y. G. (2014) Structural insights into the histidine trimethylation activity of EgtD from Mycobacterium smegmatis. Biochem Biophys Res Commun 452, 1098-1103 272. Reinhold, V. N., Ishikawa, Y., and Melville, D. B. (1970) Conversion of histidine to hercynine by Neurospora crassa. J Bacteriol 101, 881-884 273. Sao Emani, C., Williams, M.J., Wiid, I.J., Hiten, N.F., Viljoen, A.J., Pietersen, R.D., van Helden, P.D., Baker, B. (2013) Ergothioneine is a secreted antioxidant in Mycobacterium smegmatis. Antimicrob Agents Chemother 57, 3202-3207 274. Molle, V., Kremer, L. (2010) Division and cell envelope regulation by ser/thr phosphorylation: Mycobacterium shows the way. Mol Microbiol 75, 1064-1077 275. Podinovskaia, M., Lee, W., Caldwell, S., and Russell, D. G. (2013) Infection of macrophages with Mycobacterium tuberculosis induces global modifications to phagosomal function. Cell Microbiol 15, 843-859 276. Murray, H. W., Byrne, G. I., Rothermel, C. D., and Cartelli, D. M. (1983) Lymphokine enhances oxygen-independent activity against intracellular pathogens. J Exp Med 158, 234-239 277. Nakagawara, A., Nathan, C. F., and Cohn, Z. A. (1981) Hydrogen peroxide metabolism in human monocytes during differentiation in vitro. J Clin Invest 68, 1243-1252 278. Pabst, M. J., Hedegaard, H. B., and Johnston, R. B., Jr. (1982) Cultured human monocytes require exposure to bacterial products to maintain an optimal oxygen radical response. J Immunol 128, 123-128 279. Be, N. A., Bishai, W. R., and Jain, S. K. (2012) Role of Mycobacterium tuberculosis pknD in the pathogenesis of central nervous system tuberculosis. BMC Microbiol 12, 7 280. Richard-Greenblatt, M., Bach, H., Adamson, J., Pena-Diaz, S., Wu, L., Steyn, A. J., and Av-Gay, Y. (2015) Regulation of ergothioneine biosynthesis and its effect on Mycobacterium tuberculosis growth and infectivity. J Biol Chem  281. Misra, H. P. (1974) Generation of superoxide free radical during the autoxidation of thiols. J Biol Chem 249, 2151-2155 282. Birtic, S., Colville, L., Pritchard, H. W., Pearce, S. R., and Kranner, I. (2011) Mathematically combined half-cell reduction potentials of low-molecular-weight thiols as markers of seed ageing. Free Radic Res 45, 1093-1102 283. Sugimoto, A., Iino, Y., Maeda, T., Watanabe, Y., and Yamamoto, M. (1991) Schizosaccharomyces pombe ste11+ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev 5, 1990-1999 284. Yamamoto, M., Imai, Y., Watanabe, Y. (1997) Mating and sporulation in Schizosaccharomyces pombe. in Yeast III (Pringle, J. R., Broach, J. R., Jones, E. W., ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor. pp 1037–1106 285. Mochizuki, N., and Yamamoto, M. (1992) Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol Gen Genet 233, 17-24 286. DeVoti, J., Seydoux, G., Beach, D., and McLeod, M. (1991) Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J 10, 3759-3768 122  287. Higuchi, T., Watanabe, Y., and Yamamoto, M. (2002) Protein kinase A regulates sexual development and gluconeogenesis through phosphorylation of the Zn finger transcriptional activator Rst2p in fission yeast. Mol Cell Biol 22, 1-11 288. Valbuena, N., and Moreno, S. (2010) TOR and PKA pathways synergize at the level of the Ste11 transcription factor to prevent mating and meiosis in fission yeast. PloS One 5, e11514 289. Sajiki K, P. T., Shimanuki M, Yanagida M. (2013) Metabolomic analysis of fission yeast at the onset of nitrogen starvation. Metabolites 3, 1118-1129 290. Carlson, C. R., Grallert, B., Stokke, T., and Boye, E. (1999) Regulation of the start of DNA replication in Schizosaccharomyces pombe. J Cell Sci 112 ( Pt 6), 939-946 291. James, B. W., Williams, A., and Marsh, P. D. (2000) The physiology and pathogenicity of Mycobacterium tuberculosis grown under controlled conditions in a defined medium. J Appl Microbiol 88, 669-677 292. Cheah, I. K., Tang, R., Ye, P., Yew, T. S., Lim, K. H., and Halliwell, B. (2016) Liver ergothioneine accumulation in a guinea pig model of non-alcoholic fatty liver disease. A possible mechanism of defence? Free Radic Res 50, 14-25 293. Albrethsen, J., Agner, J., Piersma, S. R., Hojrup, P., Pham, T. V., Weldingh, K., Jimenez, C. R., Andersen, P., and Rosenkrands, I. (2013) Proteomic profiling of Mycobacterium tuberculosis identifies nutrient-starvation-responsive toxin-antitoxin systems. Mol Cell Proteomics 12, 1180-1191 294. Kawano, H., Higuchi F., Mayumi, T., Hama, T. (1982) Studies on ergothioneine. VII. Some effects on ergothioneine on glycolytic metabolism in red blood cells from rats. Chem Pharm Bull (Tokyo) 30, 2611-2613 295. Zhao, Q., Wang, M., Xu, D., Zhang, Q., and Liu, W. (2015) Metabolic coupling of two small-molecule thiols programs the biosynthesis of lincomycin A. Nature 518, 115-119 296. Lemassu, A., and Daffe, M. (1994) Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis. Biochem J 297 ( Pt 2), 351-357 297. Dinadayala, P., Sambou, T., Daffe, M., and Lemassu, A. (2008) Comparative structural analyses of the alpha-glucan and glycogen from Mycobacterium bovis. Glycobiology 18, 502-508 298. Antoine, A. D., and Tepper, B. S. (1969) Environmental control of glycogen and lipid content of Mycobacterium tuberculosis. J Bacteriol 100, 538-539 299. Sambou, T., Dinadayala, P., Stadthagen, G., Barilone, N., Bordat, Y., Constant, P., Levillain, F., Neyrolles, O., Gicquel, B., Lemassu, A., Daffe, M., and Jackson, M. (2008) Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice. Mol Microbiol 70, 762-774 300. Elbein, A. D., and Mitchell, M. (1973) Levels of glycogen and trehalose in Mycobacterium smegmatis and the purification and properties of the glycogen synthetase. J Bacteriol 113, 863-873 301. Asencion Diez, M. D., Demonte, A. M., Syson, K., Arias, D. G., Gorelik, A., Guerrero, S. A., Bornemann, S., and Iglesias, A. A. (2015) Allosteric regulation of the partitioning of glucose-1-phosphate between glycogen and trehalose biosynthesis in Mycobacterium tuberculosis. Biochim Biophys Acta 1850, 13-21 302. Cywes, C., Hoppe, H. C., Daffe, M., and Ehlers, M. R. (1997) Nonopsonic binding of Mycobacterium tuberculosis to complement receptor type 3 is mediated by capsular polysaccharides and is strain dependent. Infect Immun 65, 4258-4266 123  303. Geurtsen, J., Chedammi, S., Mesters, J., Cot, M., Driessen, N. N., Sambou, T., Kakutani, R., Ummels, R., Maaskant, J., Takata, H., Baba, O., Terashima, T., Bovin, N., Vandenbroucke-Grauls, C. M., Nigou, J., Puzo, G., Lemassu, A., Daffe, M., and Appelmelk, B. J. (2009) Identification of mycobacterial alpha-glucan as a novel ligand for DC-SIGN: involvement of mycobacterial capsular polysaccharides in host immune modulation. J Immunol 183, 5221-5231 304. Gagliardi, M. C., Lemassu, A., Teloni, R., Mariotti, S., Sargentini, V., Pardini, M., Daffe, M., and Nisini, R. (2007) Cell wall-associated alpha-glucan is instrumental for Mycobacterium tuberculosis to block CD1 molecule expression and disable the function of dendritic cell derived from infected monocyte. Cell Microbiol 9, 2081-2092 305. Bacon, J., Alderwick, L. J., Allnutt, J. A., Gabasova, E., Watson, R., Hatch, K. A., Clark, S. O., Jeeves, R. E., Marriott, A., Rayner, E., Tolley, H., Pearson, G., Hall, G., Besra, G. S., Wernisch, L., Williams, A., and Marsh, P. D. (2014) Non-replicating Mycobacterium tuberculosis elicits a reduced infectivity profile with corresponding modifications to the cell wall and extracellular matrix. PloS One 9, e87329 306. Lavoie, S., Allaman, I., Petit, J. M., Do, K. Q., and Magistretti, P. J. (2011) Altered glycogen metabolism in cultured astrocytes from mice with chronic glutathione deficit; relevance for neuroenergetics in schizophrenia. PloS One 6, e22875 307. Kanwal, S., Saharan, S.K., Mahmood, A., Sharma, S.C. (2011) Effect of reserve carbohydrates on oxidative stress in yeast saccharomyces cerevisiae Y6210. Current Research Journal of Biological Sciences 3, 633-636 308. Lazarova, N., Krumova, E., Stefanova, T., Georgieva, N., and Angelova, M. (2014) The oxidative stress response of the filamentous yeast R57 to copper, cadmium and chromium exposure. Biotechnol Biotechnol Equip 28, 855-862 309. Favre, C., Aguilar, P. S., and Carrillo, M. C. (2008) Oxidative stress and chronological aging in glycogen-phosphorylase-deleted yeast. Free Radic Biol Med 45, 1446-1456 310. Cunningham, A. F., and Spreadbury, C. L. (1998) Mycobacterial stationary phase induced by low oxygen tension: cell wall thickening and localization of the 16-kilodalton alpha-crystallin homolog. J Bacteriol 180, 801-808 311. Valcourt, J. R., Lemons, J. M., Haley, E. M., Kojima, M., Demuren, O. O., and Coller, H. A. (2012) Staying alive: metabolic adaptations to quiescence. Cell Cycle 11, 1680-1696 312. Garay, A. (1956) Role of ergothioneine and catalase in infection by ergot fungus (Claviceps purpurae Tul.). Nature 177, 91-92 313. Liu, H., Zhao, X., Guo, M., and Zheng, Z. (2015) Growth and metabolism of Beauveria bassiana spores and mycelia. BMC Microbiol 15, 267 314. Bello, M. H., Mogannam, J. C., Morin, D., and Epstein, L. (2014) Endogenous ergothioneine is required for wild type levels of conidiogenesis and conidial survival but does not protect against 254 nm UV-induced mutagenesis or kill. Fungal Genet Biol 73, 120-127 315. Lledias, F., Rangel, P., and Hansberg, W. (1999) Singlet oxygen is part of a hyperoxidant state generated during spore germination. Free Radic Biol Med 26, 1396-1404 316. Toledo, I., Rangel, P., and Hansberg, W. (1995) Redox imbalance at the start of each morphogenetic step of Neurospora crassa conidiation. Arch Biochem Biophys 319, 519-524 124  317. Chen, D., Toone, W. M., Mata, J., Lyne, R., Burns, G., Kivinen, K., Brazma, A., Jones, N., and Bahler, J. (2003) Global transcriptional responses of fission yeast to environmental stress. Mol Biol Cell 14, 214-229 318. Chen, C. H., Ringelberg, C. S., Gross, R. H., Dunlap, J. C., and Loros, J. J. (2009) Genome-wide analysis of light-inducible responses reveals hierarchical light signalling in Neurospora. EMBO J 28, 1029-1042 319. Guirado, E., and Schlesinger, L. S. (2013) Modeling the Mycobacterium tuberculosis granuloma - the critical battlefield in host immunity and disease. Front Immunol 4, 98 320. Rhoades, E. R., Frank, A. A., and Orme, I. M. (1997) Progression of chronic pulmonary tuberculosis in mice aerogenically infected with virulent Mycobacterium tuberculosis. Tuber Lung Dis 78, 57-66 321. Mc Dermott, W. (1959) Inapparent infection: relation of latent and dormant infections to microbial persistence. Public Health Rep 74, 485-499 322. Lenaerts, A. J., Hoff, D., Aly, S., Ehlers, S., Andries, K., Cantarero, L., Orme, I. M., and Basaraba, R. J. (2007) Location of persisting mycobacteria in a Guinea pig model of tuberculosis revealed by r207910. Antimicrob Agents Chemother 51, 3338-3345 323. Mitchison, D. A., and Coates, A. R. (2004) Predictive in vitro models of the sterilizing activity of anti-tuberculosis drugs. Curr Pharm Des 10, 3285-3295 324. Kawano, H., Otani, M., Takeyama, K., Kawai, Y., Mayumi, T., and Hama, T. (1982) Studies on ergothioneine. VI. Distribution and fluctuations of ergothioneine in rats. Chem Pharm Bull (Tokyo) 30, 1760-1765 325. Marrero, J., Trujillo, C., Rhee, K. Y., and Ehrt, S. (2013) Glucose phosphorylation is required for Mycobacterium tuberculosis persistence in mice. PLoS Pathog 9, e1003116 326. Dutta, N. K., and Karakousis, P. C. (2014) Latent tuberculosis infection: myths, models, and molecular mechanisms. Microbiol Mol Biol Rev 78, 343-371 327. Manabe, Y. C., Kesavan, A. K., Lopez-Molina, J., Hatem, C. L., Brooks, M., Fujiwara, R., Hochstein, K., Pitt, M. L., Tufariello, J., Chan, J., McMurray, D. N., Bishai, W. R., Dannenberg, A. M., Jr., and Mendez, S. (2008) The aerosol rabbit model of TB latency, reactivation and immune reconstitution inflammatory syndrome. Tuberculosis (Edinb) 88, 187-196 328. Kesavan, A. K., Brooks, M., Tufariello, J., Chan, J., and Manabe, Y. C. (2009) Tuberculosis genes expressed during persistence and reactivation in the resistant rabbit model. Tuberculosis (Edinb) 89, 17-21 329. Kalscheuer, R., Weinrick, B., Veeraraghavan, U., Besra, G. S., and Jacobs, W. R., Jr. (2010) Trehalose-recycling ABC transporter LpqY-SugA-SugB-SugC is essential for virulence of Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 107, 21761-21766 330. Daniel, J., Deb, C., Dubey, V. S., Sirakova, T. D., Abomoelak, B., Morbidoni, H. R., and Kolattukudy, P. E. (2004) Induction of a novel class of diacylglycerol acyltransferases and triacylglycerol accumulation in Mycobacterium tuberculosis as it goes into a dormancy-like state in culture. J Bacteriol 186, 5017-5030   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0307173/manifest

Comment

Related Items