UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Staphylococcus aureus heme acquisition from hemoglobin Li, Jun Wen 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_li_junwen.pdf [ 2.44MB ]
Metadata
JSON: 24-1.0306899.json
JSON-LD: 24-1.0306899-ld.json
RDF/XML (Pretty): 24-1.0306899-rdf.xml
RDF/JSON: 24-1.0306899-rdf.json
Turtle: 24-1.0306899-turtle.txt
N-Triples: 24-1.0306899-rdf-ntriples.txt
Original Record: 24-1.0306899-source.json
Full Text
24-1.0306899-fulltext.txt
Citation
24-1.0306899.ris

Full Text

STAPHYLOCOCCUS AUREUS HEME ACQUISITION FROM HEMOGLOBIN  by  Jun Wen Li  B.Sc., The University of Waterloo, 2014  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2016  © Jun Wen Li, 2016  ii ABSTRACT  Staphylococcus aureus is a bacterial pathogen of major health concern. Furthermore, the emergence of methicillin-resistant S. aureus (MRSA) strains limit the number of treatment options. Iron is essential for S. aureus survival and growth; however, the majority of iron in the human body is stored as hemoglobin (Hb) in erythrocytes. Hb released from lysed erythrocytes is quickly captured by serum haptoglobin (Hp) and the complex is degraded in the liver where released iron is then recycled. To date, the Iron Surface Determinant (Isd) system is the only heme utilization pathway identified in S. aureus. IsdB is the primary receptor at the cell surface that binds Hb to extract heme. Heme is then transferred to IsdA or IsdC, which then relay it to other Isd proteins for internalization. IsdB contains two NEAT (NEAr Iron Transporter) domains, and both domains and the intervening linker are needed for efficient heme uptake from Hb. In the first part of my study, the molecular mechanism of heme transfer from Hb to IsdB was investigated using site-directed mutagenesis. Residues in the heme-binding pocket were identified by inspection of a crystal structure of the complex of IsdB and Hb. The Y440F/Y444F (YFYF), E354A, M363L and S361A variants were found to be deficient in heme transfer. In particular, spectroscopic analysis of the YFYF mutant mixed with Hb provided evidence of a trapped heme transfer intermediate similar to that observed in the crystal structure of the wild-type protein. In the second part of my study, Hp was found to inhibit heme transfer from Hb to IsdB in a concentration-dependent manner and heme transfer was completely blocked when Hp was added to Hb above the binding stoichiometry determined by structural and solution studies. Moreover, Hb mixed with excess Hp did not support growth of S. aureus on iron-restrictive media. This study gained insight into the heme transfer mechanism between Hb and IsdB and revealed a novel role of Hp in blocking heme uptake by S. aureus.  iii PREFACE  The work in this thesis includes contributions made by fellow scientists and collaborators. Part of the work was made possible by collaboration with Dr. D. Heinrichs at University of Western Ontario (UWO). The S. aureus strain Newman ΔisdB::eryR and S. aureus strain RN6390 ΔisdH::specR were constructed by members of his lab. I transduced the mutations into the S. aureus USA300 strain and performed the growth experiments. The IsdBN1N2 (F366A) variant was cloned with assistance from William Pardoe. I produced all other IsdBN1N2 variants and carried out the activity assays.    The thesis contains work from a manuscript in preparation.   Bowden, C. F. M., Anson, C. K., Li, E. J. W., Arrieta, A. L., Eltis, L. D., and Murphy, M. E. P. Haptoglobin blocks formation of a key intermediate in heme transfer from hemoglobin to IsdB of Staphylococcus aureus. In preparation.   Dr. Catherine Bowden produced recombinant IsdBN1N2, performed stopped-flow experiments, crystallized the IsdBN1N2-Hb complex, and wrote the first draft of the manuscript. Dr. Anson Chan helped with solving the crystal structure. Angelé Arrieta cloned the YFYF variant expression plasmid. I produced and purified YFYF protein and carried out the activity assays in collaboration with Catherine. I also did the S. aureus growth experiments on Hb as a sole iron source and demonstrating inhibition by Hp. I created the figures and wrote the first draft of relevant parts of the methods and results sections pertaining to my work. Dr. Lindsay Eltis assisted with the analysis of the heme transfer kinetics. The manuscript was edited by Dr. Michael Murphy and Dr. Anson Chan.    iv  This project required Ethics Approval for purifying hemoglobin from fresh human blood. Approval was provided by the UBC Clinical Research Ethics Board, Certificate Number H11- 03395, under Project Title “Hemoglobin binding by the IsdB receptor of Staphylococcus aureus.   This project required Biohazard approval for the handling of Staphylococcus aureus and Escherichia coli. Approval was provided by the UBC Biosafety Committee, Certificate number: B13-0096   v TABLE OF CONTENTS ABSTRACT .................................................................................................................................... ii	PREFACE ...................................................................................................................................... iii	TABLE OF CONTENTS ................................................................................................................. v	LIST OF TABLES ....................................................................................................................... viii	LIST OF FIGURES ......................................................................................................................... ix	LIST OF ABBREVIATIONS ......................................................................................................... xi	ACKNOWLEDGEMENTS ......................................................................................................... xiii	Chapter 1 Introduction ..................................................................................................................... 1	1.1: Staphylococcus aureus .......................................................................................................... 1	1.1.1: Epidemiology and pathogenesis ..................................................................................... 1	1.1.2: Staphylococcus aureus virulence factors ....................................................................... 2	1.2: Human iron metabolism ........................................................................................................ 3	1.2.1: Iron storage, transport and regulation ............................................................................ 3	1.2.2: Biological states of hemoglobin. .................................................................................... 5	1.2.3: Haptoglobin and hemopexin .......................................................................................... 6	1.3: Staphylococcus aureus iron acquisition systems .................................................................. 9	1.3.1: Siderophore mediated iron uptake systems .................................................................... 9	1.3.2: The Iron Surface Determinant system (Isd) ................................................................. 10	1.3.3: The NEAT domains ..................................................................................................... 12	1.3.4: The IsdB receptor. ........................................................................................................ 14	1.3.5: Structure of IsdBN1N2 -Hb complex .............................................................................. 15	1.4: Objectives and hypotheses .................................................................................................. 18	vi Chapter 2 Methods ......................................................................................................................... 19	2.1 Bacterial strains and growth conditions ............................................................................... 19	2.2: Cloning, protein expression and S. aureus mutant construction. ........................................ 20	2.2.1: Cloning of in vivo construct of IsdB for complementation study ................................ 20	2.2.2: Site-directed mutagenesis of IsdB variants for in vitro and in vivo studies ................. 20	2.2.3: Expression and purification of IsdBN1N2 variants ......................................................... 23	2.2.4: Preparation of plasma and oxyHb from human blood ................................................. 24	2.2.5: MetHb preparation ....................................................................................................... 25	2.2.6: Heme solution preparation ........................................................................................... 25	2.2.7: Heme protein concentration by the pyridine hemochrome assay ................................ 25	2.2.8: Bradford assay for Hp concentration determination .................................................... 25	2.3 Biochemical characterization of IsdB variants ..................................................................... 26	2.3.1: Electronic spectra of heme transfer end point from metHb ......................................... 26	2.3.2: IsdBN1N2 variants pulldown studies .............................................................................. 26	2.3.3: MetHb titration with IsdBN1N2 (YFYF) ........................................................................ 27	2.3.4: Isothermal titration calorimetry (ITC) ......................................................................... 27	2.3.5: Endpoint spectra of metHb with Hp and IsdBN1N2 ....................................................... 27	2.3.6: Modeling of IsdBN1N2 mutations .................................................................................. 28	2.4 Growth experiments ............................................................................................................. 28	2.4.1: Phage transduction for S. aureus strains ...................................................................... 28	2.4.2: Hb dependent growth of S. aureus ............................................................................... 28	2.4.3: Preparation of iron-free RPMI (NRPMI) media .......................................................... 29	2.4.4: Growth of S. aureus on Hb-Hp as sole iron source. ..................................................... 29	Chapter 3 Results ........................................................................................................................... 31	vii 3.1: Biochemical characterization of IsdBN1N2 variants ............................................................. 31	3.1.1: Heme binding and heme transfer characterizations of IsdBN1N2 variants ..................... 31	3.1.2: Assessing binding of IsdBN1N2 variants to metHb by pull down assays. ..................... 37	3.1.3: YFYF binding to metHb characterized by ITC. ........................................................... 39	3.1.4: MetHb titration with YFYF ......................................................................................... 40	3.2: Effect of Hp on S. aureus heme uptake. .............................................................................. 41	3.2.1: Hp 1-1 effect on heme transfer between metHb and IsdBN1N2 ..................................... 41	3.2.2: S. aureus growth on Hb-Hp as sole iron source. .......................................................... 42	Chapter 4 Discussion ...................................................................................................................... 44	4.1: Molecular characterization of IsdB mutants deficient in heme transfer ............................. 44	4.2: Role of Hp in S. aureus infections ...................................................................................... 50	4.3: Conclusions ......................................................................................................................... 53	4.4: Future directions .................................................................................................................. 54	Bibliography ................................................................................................................................... 56	    viii LIST OF TABLES Table 1.1: Summary of heme-bound structures of Isd NEAT domains. ........................................ 14	Table 2.1: List of bacterial strains used in this study ..................................................................... 19	Table 2.2: List of plasmids used in this study ................................................................................ 20	Table 2.3: List of primers for this study ......................................................................................... 22	Table 3.1: Estimation of heme transfer from metHb to IsdBN1N2 variants. .................................... 37	   ix LIST OF FIGURES Figure 1.1: Human iron metabolism. ............................................................................................... 4	Figure 1.2: Structure of Fe coordination in oxyHb. ......................................................................... 6	Figure 1.3: Serotypes of haptoglobin. .............................................................................................. 7	Figure 1.4: Structure of porcine Hb-Hp complex. ........................................................................... 8	Figure 1.5: Iron Surface Determinant (Isd) pathway of S. aureus. ................................................ 11	Figure 1.6: Structural diagram of cell wall anchored Isd proteins. ................................................ 12	Figure 1.7: Crystal structure of heme-bound IsdAN1. .................................................................... 13	Figure 1.8: Structure of the IsdBN1N2-Hb complex. ....................................................................... 17	Figure 3.1: Electronic spectra of metHb and free heme mixed with excess IsdBN1N2. .................. 32	Figure 3.2: Electronic spectra of metHb and free heme mixed with IsdBN1N2 variants. ................ 33	Figure 3.3: Electronic spectra of metHb and free heme mixed with IsdBN1N2 (M363L). .............. 34	Figure 3.4: Electronic endpoint spectra of metHb and free heme mixed with IsdBN1N2 (E354A) and IsdBN1N2 (S361A). ............................................................................................................ 35	Figure 3.5: Electronic endpoint spectra of metHb and free heme mixed with IsdBN1N2 (YFYF). . 36	Figure 3.6: Pull down assay of metHb and IsdBN1N2 variants. ....................................................... 38	Figure 3.7: Representative ITC data for titration of IsdBN1N2 (YFYF) into metHb. ...................... 39	Figure 3.8: MetHb titration with IsdBN1N2 (YFYF). ...................................................................... 40	Figure 3.9: Electronic spectra of metHb mixed with Hp 1-1 and IsdBN1N2. .................................. 42	Figure 3.10: S. aureus growth on various iron sources. ................................................................. 43	Figure 4.1: Modeling of the M363L mutation in the IsdBN1N2-Hb structure ................................. 45	Figure 4.2: Modeling of the S361A mutation in the IsdBN1N2-Hb structure. ................................. 46	Figure 4.3: Residue 354 in the heme pocket of IsdBN1N2-Hb and heme-bound IsdBN2 structures. 47	x Figure 4.4: Residues 440 and 444 in the heme pocket of IsdBN1N2-Hb and heme-bound IsdBN2 structures. ............................................................................................................................... 48	Figure 4.5: Superposition of the oxyHb and IsdBN1N2-Hb structures. ........................................... 49	Figure 4.6: Superposition of IsdBN1N2-Hb and Hb-βHp structures. ............................................. 55	   xi LIST OF ABBREVIATIONS 2 YT 2x yeast extract tryptone 6x-His Hexahistidine affinity purification tag Å Angstrom CA-MRSA Community acquired methicillin resistant Staphylococcus aureus  Da Daltons DMT1 Divalent metal transporter 1 EDDHA Ethylenediamine-N,N'-bis(2-hydroxyphenylacetic acid) EDTA Ethylenediaminetetraacetic acid Fe2+ Ferrous iron Fe3+ Ferric iron Fur ferric uptake regulator Hb Hemoglobin HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV Human Immunodeficiency Virus Hm Heme Hp Haptoglobin Hx Hemopexin IL-6 Interleukin-6 IPTG Isopropyl β-D-1-thiogalactopyranoside Isd Iron Surface Determinant  IsdB-N1 IsdB NEAT 1 domain IsdBN1 Recombinant protein construct of IsdB NEAT 1 domain xii ITC Isothermal Titration Calorimetry KD Dissociation constant  LB Luria-Bertani Broth MetHb Methemoglobin MRSA Methicillin resistant Staphylococcus aureus MSCRAMM Microbial surface component recognizing adhesive matrix molecule  MWCO Molecular Weight Cut Off NEAT NEAr iron Transporter NTA Nitrilotriacetic acid Normal (N) Concentration of heme in a hemoprotein sample OxyHb Oxyhemoglobin RPMI-1640 Roswell Park Memorial Institute 1640 SA Staphyloferrin A SB Staphyloferrin B SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SSTI Skin and soft-tissue infections TSB Tryptic Soy Broth   YFYF Y440F Y444F mutation in IsdB      xiii ACKNOWLEDGEMENTS  I would like to express my gratitude to Dr. Michael Murphy for giving me the opportunity of working in his laboratory and for being a great mentor in terms of providing guidance and support for project ideas and career goals. I would like to acknowledge project funding from the Canadian Institute of Health Research held by Dr. Michael Murphy and CHIR-CGSM award for financial support.   Thanks to my committee members Dr. Ross MacGillivray and Dr. Bob Hancock for sharing their unique perspectives and providing insightful feedback towards my project.    Thanks to my collaborators Dr. David Heinrichs, Dr. Jessica Sheldon and Cristina Marolda from David Heinrichs Laboratory (UWO) for project ideas and training of genetic manipulation of Staphylococci. Also thanks to those who helped project from the technical side, Siobhan Wong, Gaye Sweet, and Fred Rosell for the training of ITC, Bioscreen C and TECAN respectively. Thanks to the volunteers who donated blood for the purification of hemoglobin.   Acknowledgements to members of the Murphy lab, past and present, who were always there to offer advice, guidance, and support. Special thanks to Catherine and Angelé who taught me all the basics for this project. To Maxim, thanks for being my evil twin and support my crazy ideas. To Angela, thanks for being a great friend who listened to me complaining about a hundred problems in life.  Thanks for my family and friends who always believed in me and supported me even when science turns me into a crazy person.    To Alex, thank you for your encouragements, inspiration, and love. I am immensely grateful to have you standing beside me through all the up and downs of my life.1 Chapter 1 Introduction 1.1: Staphylococcus aureus 1.1.1: Epidemiology and pathogenesis  Staphylococcus aureus is a Gram-positive bacterium that is both a commensal and an opportunist human pathogen (1). S. aureus colonizes the squamous epithelium of the anterior nasal nares, skin or mucous membranes of human hosts (1). Other sites that may be colonized by this bacterium include the gastrointestinal tract, underarm and groin areas (2). However, when host defense is weakened in cases such as catheter implantation, shaving or surgery to name a few, S. aureus is able to invade past the mucosal barrier to cause disease (2).    As a versatile pathogen, S. aureus causes health issues ranging from mild skin infections, to life-threatening conditions such as infectious endocarditis, soft-tissue (SSTIs) infections, sepsis, osteoarticular infections and pleuropulmonary associated infections (3). Although people who are most at risk for these infections include the youngest and eldest of the population, immune-compromised individuals such as HIV positive patients, and those undergoing hemodialysis are also at risk (2). Treatment of this infection is complicated by the fact that many antibiotic resistant strains are on the rise and increasing reports of strains with multiple antibiotic resistances, including those with high level of vancomycin resistance (4). Furthermore, there is an emergence of community-acquired methicillin resistant strains (CA-MRSA) in humans and livestock (4). In Canada alone, the cost of MRSA treatment and control is estimated about 82 million dollars in 2004 and is expected to rise over the years (5). 2 1.1.2: Staphylococcus aureus virulence factors  S. aureus is equipped with many virulence factors which are up-regulated through global regulators such as agr, sae, srrAB, sarA and sigB in response to changes in the environment during pathogenesis (1). In general, S. aureus upregulates cell-surface adhesion molecules and those involved in immune evasion to aid in colonization and survival at early phases of infections. During later stages, it employs toxins to facilitate spread into tissues (1). S. aureus contains cell surface virulence factors including capsular polysaccharides, cell wall anchored proteins and wall teichoic acids (1). Capsular polysaccharides are covalently linked to peptidoglycan and help reduce phagocytosis by neutrophils (6). The roles of wall teichoic acids are not well understood but they were found to help bacterial survival by assisting tissue adhesion and eliciting host inflammatory responses (1, 7). Cell wall anchored proteins have many functions ranging from immune evasion, invasion of tissues and formation of biofilms (8). The predominant group of cell wall anchored proteins is the microbial surface component recognizing adhesive matrix molecule (MSCRAMM) family which is responsible for promoting tissue adhesion and invasion (8). Prominent members of this family include fibronectin-binding proteins A and B (FnBPA and FnBPB), clumping factor A and B (ClfA, and ClfB), Protein A (SpA) and collagen adhesin (Cna) (1).  S. aureus secretes many virulence factors during later growth phases including superantigens, pore-forming cytotoxins and exoenzymes (9). Superantigens such as staphylococcal enterotoxins and toxic shock syndrome toxin-1 (TSST-1) are responsible for producing symptoms of sepsis by linking MHC II proteins to T-cell receptor on the surface of T-cell and hence eliciting an inappropriate immune response (10). Cytotoxins such as cytolysins (α, β, γ and δ), leukocidins (Panton-Valentine leukocidin, LukM, LukD/E), and phenol-soluble modulins form pores in the membrane of different cell types (9). S. aureus exoenzymes including 3 glycerol ester hydrolase (lipase), staphylokinase, and exofoliative toxins are responsible for disrupting host cell tissues to facilitate bacterial dissemination (9). Finally, phenol-soluble modulins, coagulase (Coa) and von Willebrand factor binding protein (vWbp) promote the activation of prothrombin, which cleaves fibrinogen to form a fibrin clot. This in turn promotes ClfA and ClfB mediated aggregation of Staphylococci and this agglutination effect protects bacteria from immune clearance (11).   1.2: Human iron metabolism  1.2.1: Iron storage, transport and regulation  Iron is an essential trace nutrient for humans since it is the co-factor of many enzymes that mediate metabolism such as cytochromes and heme-iron plays an important role in the transport and storage of oxygen as part of hemoglobin (Hb) (12). The human body contains 3-5 grams of iron and most of it is stored intracellularly as Hb in erythrocytes (2500 mg), myoglobin in muscle cells (300 mg), and ferritin in the liver (1000 mg); macrophages of the spleen, liver and bone marrow maintain a transient fraction of iron (600 mg) (Figure 1.1) (13). The human body has an elaborate system of iron regulation since both iron deficiency and iron overload have adverse health consequences (12). Iron from dietary intake is reduced to its ferrous form by membrane reductases and then transported into enterocytes by divalent metal transporter 1 (DMT1) (14). Once inside the body, free iron is quickly sequestered by high affinity iron binding proteins due to its toxicity (15). The ability of our body to halt growth of invading pathogens by limiting nutrients such as iron is known as nutritional immunity and is an important part of the innate immune defense system (16). Transferrin, a serum iron transport protein is able to bind iron with an dissociation rate (KD) of 10-36 M and deliver iron to peripheral tissues via receptor-4 mediated endocytosis of transferrin receptor 1 (TfR1) (15). Lactoferrin is another potent iron chelator which is found in body secretions such as breast milk, tears, saliva and bile (17) to restrict iron availability at mucosal surfaces and extracellular spaces (18). Only 25-50 % of transferrin and lactoferrin are saturated leaving the rest available to bind free iron (19). During periods of iron starvation, cellular iron stored within ferritin could be released into the plasma through transporter ferroportin (14), a process regulated by the hormone hepcidin (12).   Figure 1.1: Human iron metabolism. Iron absorbed into the body is mainly used by hemoglobin in erythrocytes (2500 mg), myoglobin in muscle cells and heme-proteins in tissues (300 mg) with transit stores in the reticuloendothelial macrophages (600 mg) and excess stored in liver ferritins (1000 mg). Transferrin is the iron transporter that delivers iron to tissues and is usually only 25 - 50 % bound by iron. Diagram is adapted from (13, 19).   5 1.2.2: Biological states of hemoglobin.  A majority of iron in the human body is in the form of heme, which is bound by hemoproteins such as Hb. Hb sequestered intracellularly reduces tissue damage since Hb, heme and free iron are all redox reactive (20). The average healthy adult has 120 g/L-150 g/L of Hb circulating in blood and the lifespan of erythrocytes is approximately 120 days. Human Hb A is a tetrameric protein consisting of two α chains and two β chains (α2β2); the α chains are 141 amino acids in length and the β chains are 146 amino acids in length. Each chain is made up of alpha helices that are named from A to H from the N-terminus to the C-terminus and contains a heme molecule that is coordinated by the iron atom to the imidazole side chain of residue HisF8 (21). In the oxygen bound form (oxyhemoglobin, oxyHb), the O2 molecule is bound to the ferrous (Fe2+) ion of heme reversibly, meaning each tetrameric Hb can bind up to four O2 molecules. Hb exists primarily in two states: tense (T) and relaxed (R). In the T state, binding affinity for ligand is very low; however, upon binding of ligand, binding affinity increases and triggers a switch to the R state, a property known as cooperative binding (22). The structures of the T and R states reveal that the αβ interfaces between α1β1 dimer and α2β2 dimer do not change between states but the αβ interfaces of the α1β2 and α2β1 dimers vary greatly (22). Many interchain and intrachain linkages exist in the T state and binding of ligand on heme promotes breakage of these linkages and changes to the quaternary structure (22).  Heme-iron coordination is octahedral, where it is coordinated by four nitrogen atoms on the porphyrin ring, and a fifth HisF8 residue from Hb (Figure 1.2). The sixth position could be occupied by gaseous ligands such as oxygen (oxyHb) or carbon monoxide (carboxyhemoglobin). However, upon intravascular hemolysis, Hb is released from the erythrocytes where the iron is quickly oxidized into its ferric (Fe3+) state, which is predominantly in a high-spin state at neutral 6 pH (23). This form of dimeric Hb is known as methemoglobin (metHb) and is unable to bind oxygen. .  Figure 1.2: Structure of Fe coordination in oxyHb. The ferrous iron is coordinated in an octahedral fashion by four nitrogen atoms from the porphyrin ring, a nearby histidine from Hb and a gaseous atom (in this case O2).   1.2.3: Haptoglobin and hemopexin  Hb released through the destruction of erythrocytes is oxidized into metHb, which is bound by serum haptoglobin (Hp) at high affinity (KD in the pM range) (24). Hp concentration under physiological conditions ranges from 0.38 - 2.08 g/L (24, 25). Hp is considered an antioxidant because it protects Hb from nitric oxide and thereby prevents the release of redox-reactive heme into the environment (25). Hb-Hp complex is then taken up by macrophages through CD163 receptor where the it is degraded (26)  The human haptoglobin gene (HP) exists in two allelic forms (HP1 or HP2), which makes Hp a polymorphic protein with three serotypes: Hp 1-1, Hp 2-1, and Hp 2-2 (Figure 1.3), where the numbers refer to the form of HP allele. Hp is made from two polypeptide chains; the β chain is identical between different phenotypes (40 kDa) and the α chain exists as the light α1 form (8.6 kDa) and the heavy α2 form (16 kDa) (24). The α and β chains are translated as a large polypeptide that is cleaved to yield the two chains which are linked together through a disulfide bridge (27). Hp 1-1 consists of α1β dimers, which is the simplest form with a molecular weight of 7 86 kDa (24). Hp 2-2 consists of α2β chains and since the HP2 allele is partially duplicated, this leads to further polymerization of the α2 chains that produces cyclic polymers (26). Humans who are heterozygous with HP1 and HP2 alleles have the Hp 2-1 phenotype, which contains one α1β dimer and multiple α2β units which produces linear polymers (26).   Figure 1.3: Serotypes of haptoglobin. A) Hp 1-1 exists only as α1β dimers, Hp 2-1 contains a mixture of α1β and α2β subunits and tends to form linear multimers due to extra disulfide bridges formed by the α2 chains, Hp 2-2 have multiple α2β dimers which forms cyclic polymers. Adapted from (28).   The distribution of Hp phenotypes differs across different geographical regions (26, 27). Notably, a subset of the human population has one or two copies of the HP0 allele that leads to reduced expression (hypohaptoglobinemia) or null expression of Hp (ahaptoglobinemia) (27, 29). The three serotypes vary in Hb binding affinity and rate of clearance; for example, Hp 1-1 has the highest binding affinity to Hb, whereas polymers of Hp 2-1 and Hp 2-2 are able to bind a greater number of αβHb dimers; lastly, Hp 2-2-Hb complexes have higher affinity for CD163 receptor (30). Three IL-6 responsive elements are found around the HP promoter and Hp is mostly up-regulated by inflammatory cytokines IL-6 and IL-1 (29, 30). Hp is an acute phase protein whose 8 level in serum can increase up to 3-8 fold in response to inflammation (31). All three crystal structures of human or porcine Hb-Hp indicate that the αβ dimer of Hb (αβHb) binds to the β chain of Hp (βHp) whereas the Hp α chain (αHp) is responsible for dimerization in αβHp dimers (Figure 1.4) (32–34).  Figure 1.4: Structure of porcine Hb-Hp complex. Two Hp αβ dimers (green and yellow) are linked by disulfide bridges through the dimerization domain of the α chain (αHp). One Hp β chain (βHp) binds to one αβ Hb dimer (dark green, red, yellow and blue) (PDB ID 4F4O).   Hemopexin (Hx) is a heme scavenger that binds heme at very high affinity (KD = 10-13 M) (25). During the course of hemolytic disease, circulating serum Hp in patients is depleted within hours whereas the level of serum Hx remains at its physiological level longer (35). Since Hx is recycled by liver cells as opposed to Hp which is degraded, Hx is able to provide prolonged control of heme-triggered oxidative tissue damage (25). These observations suggest that Hp and Hx work together as a sequential protection system, with Hp acting as the primary scavenger and Hx as the backup (35, 36). Heme binding by Hx prevents heme from entering tissues to generate free radicals resulting in lipid, protein and DNA oxidation (25, 36). Lastly, albumin and a1-microglobulin act as a third line of defense as alternative heme-binding proteins with KD values of 10-8 M and 10-6 M, respectively (25) 9 1.3: Staphylococcus aureus iron acquisition systems  Iron is an essential nutrient for many bacteria including S. aureus. However, the amount of free iron in the human body (10-18 M) is insufficient to support growth of S. aureus, which requires 0.4 - 40 µM of iron during infection (37). Therefore, it is crucial for the pathogen to exploit various pools of iron inside the human body. S. aureus responds to iron-restricted environments by up-regulating iron acquisition systems and other virulence factors through the ferric uptake regulator (Fur). During iron limiting conditions, inactivation of fur repression allows expression of genes encoding iron-uptake systems such as siderophore synthesis and transport. In addition, up-regulation of glycolysis is coupled with down-regulation of the TCA cycle is used to reduce the iron demands of the cell (38). Relieving Fur repression also increases the expression of hemolysins that are secreted to lyse erythrocytes (39). S. aureus lacking Fur is found to have reduced virulence in a murine skin abscess model of infection (40). To date, many S. aureus iron acquisition systems have been characterized and can be categorized based on the iron source exploited. Previously, it was observed that S. aureus preferentially uses [54Fe] heme-iron over [57Fe] transferrin in iron-restricted media (41).  1.3.1: Siderophore mediated iron uptake systems  Siderophores are high affinity iron chelators that can extract iron bound to transferrin and lactoferrin (15). S. aureus expresses and secretes two carboxylate-type siderophores, Staphyloferrin A (SA) and Staphyloferrin B (SB), which are both Fur regulated (15). The enzymes for SA and SB biosynthesis have been identified and characterized. SA biosynthesis is encoded by the sfa locus which contains sfaABC on one operon and sfaD transcribed separately (15). S. aureus lacking SA showed no deficiency when grown in the presence of serum whereas 10 SB-deficient S. aureus exhibited reduced growth (42). SB biosynthesis and export is encoded by the sbn gene cluster which is composed of nine genes (sbnA-sbnI). SbnC, SbnE, SbnF and SbnH are required for SB synthesis whereas SbnA, SbnB and SbnG are mainly used for the synthesis of precursors needed for SB synthesis (43). The genes encoding the ABC transporters HtsABC and SirABC are found in close proximity to their respective siderophore biosynthesis gene clusters and are responsible for the transport of SA and SB into the cytoplasm, respectively (44, 45). HtsA and SirA are surface receptors whereas HtsBC and SirBC are membrane proteins that transport siderophores into the cell (45). S. aureus can also acquire xenosiderophores released by other species within the same niche (46).   1.3.2: The Iron Surface Determinant system (Isd)  The Isd system is the only heme uptake system known in S. aureus and has been the subject of numerous studies since its initial discovery (47). The Isd system is composed of Isd proteins and Sortase B which are all under the control of the Fur repressor (48). The system is located on three separate gene clusters with five separate transcriptional units (47). Four members (IsdABCH) are peptidoglycan-anchored proteins which are able to bind to heme (48). IsdC is anchored covalently to the cell wall by Sortase B and the rest (IsdABH) are all anchored by Sortase A through the recognition of a LPXTG motif (49). The function of IsdD remains unknown and is hypothesized to be a membrane transporter (49).    The Isd system was shown to relay heme in a unidirectional manner (Figure 1.5) (50). The sequence of heme passage across the cell wall has been elucidated (47). IsdB and IsdH (HarA) are receptors that extract heme from hemoglobin to pass it onto IsdA or IsdC (51). Heme is then transferred to IsdEF, an ABC transporter with associated lipoprotein for internalization 11 (51). Finally, heme is degraded by heme IsdG and IsdI inside the bacterial cytoplasm to release Fe (48).     Figure 1.5: Iron Surface Determinant (Isd) pathway of S. aureus. A) Overview of heme uptake by the Isd pathway. Upon release of Hb from erythrocytes, metHb can be bound by Hp (Hb-Hp) and free heme can be bound by Hx (Hm-Hx). IsdB and IsdH bind to metHb to extract heme and relay it to other Isd proteins for use by S. aureus. IsdABCH are covalently anchored into peptidoglycan through C-terminal sortase signals. B) Genes of the Isd system are distributed in three separate gene loci under five separate transcriptional units.  12 1.3.3: The NEAT domains  The four cell wall anchored proteins (IsdABCH) share common features including a N-terminal secretion signal, a C-terminal sortase signal and one to three copies of a conserved protein fold known as the NEAT (NEAr iron Transporter) domains (Figure 1.6) (48). NEAT domains are ~ 125 residues in length and are named based on their prevalence in genes found in close proximity to the siderophore transporters on the bacterial genome (52). The NEAT domain is conserved across many Gram-positive pathogens containing systems similar to the Isd system (53). Sequence similarity of these NEAT domains between Isd proteins ranges from 11% to 65% (52). Studies using magnetic circular dichroism and UV-visible spectroscopy using isolated NEAT domains show that only the C-terminal NEAT domain is able to bind heme (54).   Figure 1.6: Structural diagram of cell wall anchored Isd proteins. IsdABCH all contain a N-terminal secretion signal. IsdA and IsdC each contain one NEAT domain that can bind heme. IsdB and IsdH contain two and three NEAT domains, respectively. IsdABH are anchored by Sortase A through recognition of the LPXTG motif at the C-terminus. IsdC is anchored into the cell wall by Sortase B through the NPQTN motif. Only the C-terminal NEAT domain binds heme.  13  The structures of many NEAT domains have been solved by either crystallography or nuclear magnetic resonance spectroscopy in their ligand free or heme bound forms (Table 1.1). These structures show that the NEAT domains all adopt an eight-stranded immunoglobulin-like β-sandwich fold (49). The NEAT domain of IsdA (IsdAN1) in the heme bound (PDB ID 2ITF) and ligand free forms (PDB ID 21TE) was the first NEAT domain with its structure solved. This structure revealed a pentacoordinated heme iron with a conserved tyrosine (Tyr166) serving as its axial ligand. Tyr166 is stabilized by Tyr170 through a conserved hydrogen bond (55). Sequence alignments with other NEAT domains revealed a YXXXY motif in which the heme coordinating Tyr166 and the stabilizing Tyr170 are conserved in IsdC and the C-terminal domains of IsdB and IsdH (55, 56). From here on, superscript (IsdBN2) will be used to indicate the recombinant protein construct, and dash will refer to specific domains (IsdB-N2).   Figure 1.7: Crystal structure of heme-bound IsdAN1. A) IsdAN1 adopts a conserved 8-stranded β sandwich fold. Heme is shown as a stick figure. B) Heme binding pocket of IsdAN1 with selected residues highlighted in yellow stick model (PDB ID 2ITF). Fe, N and O atoms are shown in orange, blue and red, respectively.   14  The residues that coordinate iron at the distal position relative to the Tyr residue are not conserved in heme binding NEAT domains. In the IsdAN1 structure, while His83 occupies the distal position, the conformation of this residue preclude coordination to the heme (55). Met362, Ile48 and Val596 occupy the corresponding position in IsdB (48), IsdC (57) and IsdH (58) heme bound structures respectively. Of these residues, only Met362 has the potential to coordinate iron and is observed to coordinate the heme iron in the IsdBN2 structure.  In addition, IsdB-N1 and IsdH-N2 domains have been characterized to be important in binding to Hb but not heme (52, 59–61).   Table 1.1: Summary of heme-bound structures of Isd NEAT domains. NEAT domain PDB ID Crystal structure resolution (Å) Residues nearest to the heme-Fe atom References IsdAN1  2ITF 1.90 Tyr166 His83 (55)  IsdBN2  3RTL 1.45 Tyr440 Met362 (48) IsdCN1  2O6P 1.50 Tyr52 Ile48 (57) IsdHN3  2Z6F 3VTM 1.90 2.80 Tyr642 Val596 (58, 62)  1.3.4: The IsdB receptor.  IsdB is a key receptor that acts at the interface between the extracellular environment and the bacterial cell surface. S. aureus lacking IsdB exhibited significantly reduced growth with Hb as the sole iron source (63–65). In addition, transcriptional profiling using microarray analysis indicated that IsdB is highly up-regulated when S. aureus is cultured on iron-chelated media in vitro and is one of the most up-regulated genes seen in an in vivo tissue cage model study (66). Furthermore, another transcriptomics study shows that IsdB is the second most up-regulated gene in blood (1000 fold) and serum compared to growth on tryptic soy agar (TSA) alone (37). 15 Coupled to these observations is the upregulation of hlgABC gene cluster in S. aureus cultured in the presence of blood which encodes Υ-hemolysin that is responsible for lysing erythrocytes (37). A recent study using a cotton rat nasal nares colonization model showed that IsdB is slightly up-regulated during nasal colonization, 10 fold less when compared to its expression level in blood (bacteremia) and heart (thromboembolic lesions) (67). Lastly, a S. aureus strain with an ΔisdB deletion exhibits lower pathogenicity in murine heart, kidney and spleen models (63, 65, 67). In comparison, IsdH is not as up-regulated in blood or serum and a S. aureus strain with an ΔisdH deletion exhibited little difference in growth phenotype on Hb compared to WT (37, 65). These studies provide strong evidence that IsdB, not IsdH, is the main hemoglobin receptor of S. aureus.   1.3.5: Structure of IsdBN1N2 -Hb complex  IsdB can bind to both oxyHb and metHb but can only extract heme from metHb, suggesting metHb as the physiological heme source during infections (59). Although IsdB-N1 is mainly involved in hemoglobin binding and IsdB-N2 binds heme, both domains along with the connecting linker region are necessary in Hb binding and heme extraction from hemoglobin (59, 68). For biochemical studies, a truncated construct consisted of N1-linker-N2 regions (IsdBN1N2, Asn126-Thr459) has been used as the recombinant form of IsdB (59).   The structure of IsdBN1N2 in complex with Hb (IsdBN1N2 -Hb) has been solved by a former student in the lab to a resolution of 3.6 Å (Figure 1.8) (data unpublished). The structure consists complete molecules of IsdBN1N2 binding to each of the two αHb chains of the Hb tetramer and truncated molecules of IsdBN1N2 (only the IsdB-N1 domain is observed) binding to each of the two βHb chains. IsdBN1N2 is shaped like a dumbbell, similar to the solution structure of IsdHN2N3 16 (53). IsdBN1N2 binds αHb through the IsdB-N1 domain at one end to form a binding interface, which enables the positioning of the IsdB-N2 domain through the linker to extract heme from the other end (Figure 1.8 B). The heme group remains bound to each αHb chains but has shifted towards the heme-binding pocket of each IsdB-N2 domain. This shift in heme position is accompanied by a unique heme-iron coordination by His58 and His89 such that His87 is pivoted out of heme pocket of oxyHb. Inspection of the interface between IsdBN1N2 and Hb in the structure reveals residues of IsdB near heme. Tyr440 is positioned adjacent to the heme pyrrole ring forming a π-stacking network of interactions (Figure 1.8 C). Interestingly, Tyr444 is adjacent to His89 of Hb and is positioned closer to heme than Tyr440, suggesting that it may have a more direct role in heme transfer than merely stabilizing Tyr440 in the IsdB-heme complex (Figure 1.8 C). Ser361 and Glu354 stabilize heme propionate group through hydrogen bonding (Figure 1.8 D). Met363 and Phe366 form hydrophobic contacts (Figure 1.8 D). Ile438, His434, Asp439 are located on a distal loop of the IsdB-N2 domain that closely abuts Hb. Previously, two single point variants, IsdBN1N2 (Y440A) and IsdBN1N2 (M362L) were created by site-directed mutagenesis (69). M362L was not stable in solution and could not be characterized biochemically (69). Y440A was shown to be deficient in heme transfer but also appeared to lack Hb binding (69).   17  Figure 1.8: Structure of the IsdBN1N2-Hb complex. A) Two IsdBN1N2 (blue) bound to two αHb chains (silver). Two βHb chains (orange) are bound by two IsdB-N1 domain of IsdBN1N2 (green). B) Expansion of interface between IsdBN1N2 and αHb. C) Important heme pocket residues of Hb (silver cartoon) and IsdBN1N2 (blue cartoon) highlighted. D) Other heme pocket residues of Hb (silver cartoon) and IsdBN1N2 (blue cartoon) highlighted. Heme is shown as red sticks. Fe, N, O, S atoms are shown in orange, blue, red and yellow respectively.    18 1.4: Objectives and hypotheses Although the structure of IsdBN1N2 -Hb has been solved, the mechanism by which IsdB extracts heme from metHb remains largely unknown. In the first part of my research, I investigated the molecular mechanism by which IsdB extracts heme from hemoglobin. I hypothesize that residues in the heme-binding pocket of IsdB-N2 are important in mediating heme transfer. I defined the roles of these residues by site-directed mutagenesis coupled to biochemical assays including heme transfer assay, pull-downs and Isothermal Titration Calorimetry (ITC).  In addition, preliminary data showed that the transfer of heme iron between metHb to IsdB is inhibited by the addition of Hp. In the second part of my research, I investigated Hp as a potential inhibitor of this heme-uptake system in vivo and in vitro. I hypothesize that S. aureus is unable to uptake heme from Hb-Hp. Since Hp is abundant in serum, Hb-Hp is a source of iron that is potentially physiologically relevant during S. aureus infections.  IsdB is an effective vaccine in a mouse model of infection and a promising candidate for vaccine development. Previously, a monovalent IsdB protein was developed into the V710 vaccine by Merck Ltd. which has been shown to offer protective immunity in mice and rhesus monkeys but failed in clinical trials due to lack of protection and increased mortality in patients given the vaccine (70, 71). An understanding of the molecular mechanism of how IsdB is able to extract heme from Hb and inhibition of heme transfer by Hp will be a valuable foundation for developing an effective vaccine or therapeutic to combat S. aureus infection.     19 Chapter 2 Methods 2.1 Bacterial strains and growth conditions  Escherichia coli (E. coli) strain DH5α was used for gene cloning and BL-21 (DE3) was used for protein expression. E.coli DC10B is a strain deficient in cytosine methylation that allows transformation of plasmids of E. coli parental origin into S. aureus (72). An alternative, S. aureus strain RN4220 also accepts parental E. coli DNA. S. aureus strains Newman and USA300 are clinical isolate strains that were used growth studies. For genetic manipulations, E. coli strains were grown in Luria-Bertani broth (LB) (Becton Dickinson) and S. aureus strains were grown in Tryptic Soy broth (TSB) (Becton Dickinson).   Table 2.1: List of bacterial strains used in this study Bacteria Strain name Description or genotype Source or reference Escherichia coli BL-21 (DE3) F– ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) [malB+]K-12(λS) Novagen Escherichia coli DH5α F– endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK–mK+), λ– Life Technologies Escherichia coli DC10B E. coli K12, Δdcm mutant (72) Staphylococcus aureus USA300 USA300 LAC cured of resistance plasmids. USA300 LAC is a hypervirulent MRSA strain isolated from Los Angeles County.  Received from David Heinrichs (UWO)  Staphylococcus aureus RN6390 Prophage cured lab strain Received from D. Heinrichs (UWO) Staphylococcus aureus Newman MSSA clinical isolate Received from D. Heinrichs (UWO) Staphylococcus aureus RN4220 Restriction deficient strain for DNA transformation into S. aureus Received from D. Heinrichs (UWO) 20 2.2: Cloning, protein expression and S. aureus mutant construction.  2.2.1: Cloning of in vivo construct of IsdB for complementation study  pJW01 was generated from pCN54 by replacing the ermC cassette with a cat cassette using restriction-ligation cloning (73). The isdB gene was amplified from S. aureus USA300 genomic DNA with the addition of BamHI at the 5' end and KpnI at the 3' end and then cloned into pJW01. Constructs were confirmed by sequencing (Genewiz Inc).    Table 2.2: List of plasmids used in this study Plasmid name Description Antibiotic Resistance Source or references pET28a Expression vectors carrying an N-terminal His-tage/thrombin/T7 tag Kanamycin in E. coli EMD Biosciences pCN54 E. coli - S. aureus shuttle vector with GFP reporter, contains Pcad -CadC inducible promoter Ampicillin in E. coli,  Erythromycin in S. aureus (73) pJW01 pCN54 with ermC gene substituted for cat gene Ampicillin in E. coli,  Chloramphenicol in S. aureus This study  2.2.2: Site-directed mutagenesis of IsdB variants for in vitro and in vivo studies  To probe the heme transfer function of IsdB, mutants were constructed by substituting amino acid residues near the heme in the IsdBN1N2-Hb structure. Tyr440 coordinates to the heme iron in the IsdBN2-heme crystal structure and Tyr444 forms a conserved hydrogen bond to Tyr440 in all heme-binding NEAT domains. Both Tyr440 and Tyr444 were mutated to phenylalanine to remove the potential to coordinate the heme iron and to stabilize the structure. Glu354 and Ser361 were mutated to the alanine to remove hydrogen bonds to one of the heme propionates. Met362 and Met363 are in close contact with the heme in the IsdBN1N2-Hb structure as were mutated to leucine to remove the potential of these residues to coordinate the heme iron 21 during transfer. Phe366 also is part of the hydrophobic heme-binding pocket in the IsdBN1N2-Hb structure. This residue was mutated to alanine to test the potential role of the phenyl ring in heme transfer. Three residues (Ile438, His434, Asp439) are part of loop of IsdB at the interface with Hb in the IsdBN1N2-Hb structure. These residues were mutated alanine to determine the role of this loop in disrupting the structure of Hb for heme transfer. Site-directed mutagenesis was carried out using a PCR method. For recombinant expression of soluble IsdB protein, the template was a plasmid with the coding region for IsdBN1N2 (Asn126 - Thr459) in pET28α (59). For complementation experiments, pJW01-IsdB was used as template. The same primers were used for generating mutations in the IsdBN1N2 or the IsdB-full length constructs. Primers for Y440F Y444F mutations were generated using the QuikChange protocol and then transformed into XL-10 Gold E. coli cells. For all other mutations, primers were designed with a 5' phosphate. PCR reactions contained Phusion polymerase (NEB) and Ampligase (Epicentre) to amplify and ligate mutant plasmids. PCR products were then digested with DpnI for 3 hours at 37°C to remove methylated or hemi-methylated DNA. For the IsdBN1N2 constructs, ligation mixtures were transformed into E. coli BL-21 (DE3). For complementation, plasmids from E. coli strains were transformed into S. aureus RN4220 and then S. aureus USA300 ΔisdB ΔisdH strain. Mutations were confirmed by sequencing (Genewiz Inc).   22 Table 2.3: List of primers for this study Underlined letters indicate nucleotide changes with respect to the S. aureus USA300 sequence, red letters indicate the codons that have been changed. Bolded letters indicate restriction enzyme sites added. a: mutation only made in the full length IsdB construct  b: mutation only made in the IsdBN1N2 construct    Description  Names of primer(s) Primer sequence (5'- 3') IsdB-BamH1 and Kpn1  ELP044 and ELP045 GATCGGATCCAATTAGGAGTTGTTTCTAC CTAGGGTACCCTAGTTTTTACGTTTTCTAGG Y440F Y444F ELP052 and ELP053- Y440/4F quikchange-PCR CGTAAAAACGATTGATTTTGATGGACAATTCCATGTCAGAATCGTTG CAACGATTCTGACATGGAATTGTCCATCAAAATCAATCGTTTTTACG S361A ELP018- IsdB S361A mutagenesis 5' phos GTTGAGAATAACGAAGCTATGATGGATACTT E354A ELP031- IsdB E354A mutagenesis 5' phos CAAAATATGTTGTTTATGCAAGTGTTGAGAATAACGAATC M363L ELP030- IsdB M363L mutagenesis 5' phos GTTGAGAATAACGAATCTATGCTGGATACTTTTGTTAAAC I438A (b) ELP019- IsdB I438A mutagenesis 5' phos AGTTCACGTAAAAACGGCTGATTATGATGGACA F366A (b) ELP037- IsdB F366A mutagenesis 5' phos CGAATCTATGATGGATACTGCTGTTAAACACCCTATTA H434A D439A (b) ELP020- IsdB H434A D439A mutagenesis 5' phos GCTATCGTTAAAGTTGCAGTAAAAACGATTGCTTATGATGGACAATAC M362L (a) ELP017- IsdB M362L 5' phos GAGAATAACGAATCTTTGATGGATACTTTTG 23 2.2.3: Expression and purification of IsdBN1N2 variants  To purify IsdBN1N2 and variants, the following procedure was used. One-liter of LB with 100 µg/mL kanamycin was inoculated with a 5 mL of BL-21 with the respective expression system. The culture was grown at 37°C for 4-5 h until OD600 of 0.7-1. The culture was then induced with IPTG and allowed to grow overnight at 25°C. The cells were collected by centrifugation and 30 mL of buffer containing 50 mM Tris, 100 mM NaCl, 20 mM imidazole (pH 8.0) was added. Cells were disrupted using a homogenizer (Avestin) under high pressure, centrifuged for 45 min to separate the soluble fraction and filtered using a 0.8 µm syringe filter (Pall Corporation). The lysate was applied to a Nickel NTA HisTrap Column (GE Healthcare) connected to the ÄKTA FPLC purification system (GE Healthcare). A gradient of 0-500 mM imidazole was used to elute the protein. The non-heme bound form of IsdBN1N2 (apo- IsdBN1N2) was separated from the heme bound IsdBN1N2 (holo- IsdBN1N2). Apo- IsdBN1N2 fractions were cleaved with thrombin at 500:1 ratio and dialyzed against 50 mM HEPES (pH 8.0) buffer. Protein purity (>95%) was confirmed by loading eluted fractions on a 15% SDS-PAGE. If further purification was needed, the fraction was applied to a Source 15S cation exchange column (GE Healthcare) and eluted by a gradient of 0-500 mM NaCl. The resultant fractions were dialyzed into 20 mM HEPES, 80 mM NaCl (pH 7.4) buffer overnight. Protein was concentrated using a 10K MWCO Amicon filter (Millipore) and aliquots were flash frozen in liquid nitrogen and stored at -80°C. Protein concentrations were calculated by measuring absorbance at 280 nm in a 1 cm quartz cuvette under denaturing conditions and dividing by the predicted extinction coefficients calculated by Biology Workbench (San Diego Supercomputer Center).   24 2.2.4: Preparation of plasma and oxyHb from human blood  Approximately 16 mL (4 vials) of human blood was collected from a volunteer into 3.2 % sodium citrate vials by a phlebotomist following institutional protocols. The vials were then centrifuged at 4,000 g at 4°C to separate plasma (supernatant) and whole cells (pellet). The plasma was carefully removed, sterile-filtered (0.22 µm) and flash froze in liquid nitrogen and stored at -80°C for future use.  The whole cell fraction was transferred to 15 mL conical tubes. The pellet was washed with three volumes of 0.9 M NaCl solution three times. To lyse the red blood cells, three volumes of lysis buffer (50 mM Tris, 2 mM EDTA, pH 8.6) were added to the vials. The tubes were incubated on ice for 30 minutes at 4°C to allow complete cell lysis. The tubes were centrifuged at 11,000 g for 30 minutes to separate hemoglobin (supernatant) and cell debris (pellet). 50 mg/mL of NaCl was added to precipitate the stroma which was then removed by centrifugation at 11,000 g for 30 minutes at 4°C. The red blood cell lysate (supernatant) was then dialyzed overnight at 4°C against 50 mM Tris, 1 mM EDTA (pH 8.6) buffer.   On the next day, 2 mL of lysate was loaded onto a Source 15Q anion exchange column (GE Healthcare) that was pre-equilibrated with 50 mM Tris buffer (pH 8.6) and eluted by running a gradient 0-500 mM NaCl. The remaining lysate was aliquoted into 2 mL fractions, flash frozen and stored at -80°C. The majority of the lysate was assumed to be in the form of hemoglobin A (HbA), the most abundant form of hemoglobin in healthy adults. The collected fractions were dialyzed overnight into 20 mM HEPES, 80 mM NaCl (pH 7.4) buffer.   On the third day, the collected oxyHb was concentrated using a 30K MWCO Amicon filter (Millipore). Small aliquots of protein were flash frozen and stored at -80°C.  25 2.2.5: MetHb preparation  A five molar excess of potassium hexacyanoferrate (III) (Sigma) was added to a thawed tube of oxyHb and the reaction was allowed to proceed for 20 minutes at room temperature. The mixture was then applied to a Sephadex G25 (fine) column (GE Healthcare) that was preequilibrated with 20 mM HEPES, 80 mM NaCl (pH 7.4) buffer. MetHb (brown) was separated from FeCN (yellow) by visualization.   2.2.6: Heme solution preparation  Lyophilized porcine heme (Sigma) was dissolved in 0.1 M NaOH solution to make 5 mM stock. The solution was filtered through 0.22 µm syringe filter. For growth experiments, small aliquots of 1 mM stocks were made, flash frozen and stored at -80°C.  2.2.7: Heme protein concentration by the pyridine hemochrome assay  Pyridine hemochrome assays were conducted to determine the concentration of heme in hemoproteins (oxyHb, metHb, heme, heme-bound IsdB proteins) (50). The extinction coefficient used is ε419 = 191.5 mM-1 cm-1. The concentration of heme proteins is thus expressed as "normals" to indicate one unit of heme. Since oxyHb is typically in the form of tetramer, 1 mM of tetramer oxyHb is expressed as 4 mN of oxyHb.   2.2.8: Bradford assay for Hp concentration determination   Hp 1-1 (Athens Research and Technology) was purchased in lyophilized form and dissolved in 20 mM HEPES (pH 7.4) buffer. Hp concentration was determined by a Bradford assay based on protocol described by BioRad. Diluted Bradford reagent (BioRad) was added to 26 the BSA standards and Hp with various dilutions. Samples were incubated at room temperature for approximately 5 minutes. Absorbance at 595 nm was measured using the Nanodrop 2000c spectrophotometer (Thermo Scientific).   2.3 Biochemical characterization of IsdB variants 2.3.1: Electronic spectra of heme transfer end point from metHb  UV-visible spectra of heme transfer from metHb to apo-IsdBN1N2 proteins were monitored using the Cary50 spectrophotometer. Wild type apo-IsdBN1N2 and variants were added to 4 µN metHb in 200 uL HEPES buffer in a 1 cm quartz cuvette. Spectral changes were monitored from 250 nm to 750 nm immediately and re-measured after 10 minutes of incubation at room temperature.  2.3.2: IsdBN1N2 variants pulldown studies  IsdBN1N2 pulldown studies were conducted as described previously (59). Nickel NTA beads were washed three times with binding buffer (20 mM HEPES, 80 mM NaCl, pH 7.4). 50 µL of 20 µN metHb proteins or buffer control were added to 25 µL of nickel NTA beads and incubated on ice for 15 minutes with occasional mixing. 50 µL of 20 µM IsdBN1N2 variants with the His-tag removed were added and incubated on ice for another 15 minutes with occasional mixing. Mixture was then washed two times with wash buffer (20 mM HEPES, 80 mM NaCl, 10 mM imidazole, pH 7.4) to remove proteins not bound to the beads. Finally the bound proteins were eluted by 25 µL elution buffer (20 mM HEPES, 80 mM NaCl, 100 mM imidazole, pH 7.4). Elutent (5 µL) were mixed with SDS loading dye were then loaded onto a 15% SDS-PAGE running at 200 V for one hour. Gels were stained with Coomassie blue.  27 2.3.3: MetHb titration with IsdBN1N2 (YFYF)  To titrate metHb with YFYF, 4 µN of metHb (ligand) was mixed with 1 - 9 µM of YFYF (titrant) in 1 µM increments. Proteins were mixed in a total volume of 1000 µL HEPES buffer in a 1 cm path length quartz cuvette using a UV visible spectrophotometer (Cary50). Readings of three separate experiments were taken at 25°C. For each reaction, the initial absorbance of metHb only spectra at 410 nm (with 0 µL YFYF) was subtracted from each subsequent reading with increasing amounts of YFYF. The data was then plotted and a linear fit was generated indicating the saturation point of YFYF.  2.3.4: Isothermal titration calorimetry (ITC)  ITC was carried out in a MicroCAL ITC-200 instrument. Syringe and cell samples were co-dialyzed overnight against 20 mM HEPES, 80 mM NaCl (pH 7.4) buffer. Dialysis buffer was collected and filtered to wash the ITC cell. ITC experiments were conducted at 25°C with 1.2 mN of metHb as the titrant in the syringe and 200 µM of YFYF as the macromolecule in the cell. Binding isotherms were collected and analyzed with the MicroCal Origin 7.0 software using the One-site model. Three ITC experiments were conducted and their final dissociation constant (KD) and stoichiometry (N) were averaged. Standard deviation were calculated and reported as error values.   2.3.5: Endpoint spectra of metHb with Hp and IsdBN1N2  MetHb (2 µN) was mixed with 0.05 - 1 µM of Hp 1-1 with and without 10 µM IsdBN1N2 in 200 µL HEPES buffer. Spectra readings (250 nm - 750 nm) were taken immediately and after 10 minutes of incubation at room temperature. The experiment was performed in triplicates. The 28 absorbance of metHb with Hp and metHb with Hp and IsdBN1N2 at 406 nm was plotted as a function of increasing amounts of Hp.   2.3.6: Modeling of IsdBN1N2 mutations  Point mutations in the IsdBN1N2-Hb structure were modeled using Coot (74). Regularize zone function was used to minimize stereochemical restraints without reference to any electron density. Structural pictures were generated in MacPyMOL (Schrödinger, LLC.).   2.4 Growth experiments 2.4.1: Phage transduction for S. aureus strains  S. aureus Newman ΔisdB::eryR and S. aureus RN6390 ΔisdH::specR mutants were transduced into the S. aureus USA300 strain using previous established protocols (75). 2.5 mM CaCl2 was added to ensure higher transduction efficiency. The isdB mutation was also transduced into the S. aureus USA300 ΔisdH::specR  mutant, hence generating a double deletion mutant with the genotype ΔisdB::eryR ΔisdH::specR. The genotype of each mutant was confirmed by PCR and host strains were confirmed based hemolysis patterns on sheep blood agar.   2.4.2: Hb dependent growth of S. aureus  Growth of S.aureus was adopted from procedure described previously (64). Roswell Park Memorial Institute (RPMI) 1640 medium (Life Technologies) with L-glutamine and phenol red is purchased in powdered form and dissolved in MilliQ (18 mΩ) at 10.4 g/L. Sodium bicarbonate (2.0 g/L) was added. The media was sterile-filtered and stored at 4°C. 50 mM stocks of 29 Ethylenediamine-di(O-hydroxyphenylacetic acid) (EDDHA) (LGC Standards GmbH) iron chelator was made by dissolving powder into 0.1 N NaOH. Aliquots are stored in -20°C.  Single isolated colonies of S. aureus were inoculated into cRPMI media with 0.5 µM of EDDHA. Cultures were then grown overnight until an OD600 of 1-2. The precultures were washed twice in cRPMI media with 5 µM of EDDHA and then normalized to an OD600 of 2. Cultures were inoculated into 200 µL cRPMI media in 96-well plates with starting OD600 of 0.05. Plates were shaken at 200 rpm at 37°C. OD600 readings were taken at 12 h and 24 h with path length correction such that the absorbance values are comparable to the 1 cm path length of standard spectrophotometers.   2.4.3: Preparation of iron-free RPMI (NRPMI) media  Liquid RPMI-1640 media (Sigma Aldrich) was supplemented with 1 % (w/v) casamino acids (Becton Dickinson) and 2 g/L NaHCO3. Metal-depleted RPMI (NRPMI) medium was prepared by adding 7 % (w/v) Chelex-100 sodium form (Sigma-Aldrich) to RPMI medium and stir mixed overnight. Chelex-100 was then filtered from the medium which was supplemented to 25 µM ZnCl2, 25 µM MnCl2, 100 mM CaCl2, and 1 mM MgCl2. NRPMI medium was titrated to neutral pH, sterilized through a Stericup (Millipore) and stored at 4°C.   2.4.4: Growth of S. aureus on Hb-Hp as sole iron source.    Single colonies of S. aureus strain Newman on TSA plates were inoculated into NRPMI medium with 0.5 mM EDDHA. Cultures were incubated at 37°C for 16-20 hours at 200 rpm. Overnight cultures were centrifuged for 2 minutes at 11,000 g and pellet was washed three times in NRPMI with 0.5 mM EDDHA. Cell concentration was then normalized to OD600 of 3 and sub-30 cultured 1:100 into 200 µL NRPMI with 0.5 mM EDDHA. In addition to a no iron control, cultures were inoculated into media supplied with 200 nN Hb or 2 µN of heme mixed with 10 - 100 nN Hp, mixed-serotype (Athens Research and Technology). Cultures were grown in a Bioscreen C machine under continuous shaking at fast speed and high amplitude (Growth Curve USA) at 37°C. Growth experiments were repeated three times and the average growth with standard deviation as error was plotted.   31 Chapter 3 Results 3.1: Biochemical characterization of IsdBN1N2 variants  Site-directed mutagenesis was used to construct variants of IsdBN1N2 to probe the mechanism of heme transfer from metHb. The variants were expressed in E. coli and apo-IsdB was purified to high homogeneity as judged by SDS-PAGE. The proteins were concentrated to > 5 mg/mL without visible precipitation suggesting the proteins were sufficiently stable in solution for biochemical experiments. Proteins were flash frozen and stored at -80°C.  3.1.1: Heme binding and heme transfer characterizations of IsdBN1N2 variants  Heme transfer between metHb and IsdBN1N2 mutants was investigated by electronic spectroscopy by exploiting the large spectral differences between Hb and heme-bound IsdB (76). Spectra upon addition of IsdBN1N2 to metHb are characterized by a decrease in the Soret peak (406 nm), broadening of the shoulder (380 nm) and a slight decrease in the 575 nm band of the α/β region; these changes are both titrateable and saturateable (69). When 10 µM IsdBN1N2 was mixed with 2 µN metHb, the absorbance at the Soret peak decreased to halfway between that of the metHb spectra and heme-bound IsdBN1N2 spectra. Assuming a two state model of heme bound to metHb and heme bound to IsdBN1N2, the spectra indicate that approximately 50% of the heme transferred from metHb to IsdBN1N2 (Figure 3.1).    32  Figure 3.1: Electronic spectra of metHb and free heme mixed with excess IsdBN1N2. A) Spectra of metHb and free heme mixed with excess IsdBN1N2. Important regions are indicated by their absorption maxima. B) Expansion of selected spectra in the α/β region in panel A.     When the IsdBN1N2 (F366A), IsdBN1N2 (I438A) and IsdBN1N2 (H434A D439A) mutants were mixed with metHb, the spectra were similar to that of metHb mixed with wild type IsdBN1N2. Also, spectra after the addition of heme to these mutants resembled addition of heme to wild type IsdBN1N2. Heme transfer of metHb to the I438A and H434A D439A mutants were estimated to be 50% and heme transfer of metHb to the F366A mutant was estimated to be 40%, as determined by the change in Soret peaks (Figure 3.2).  300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUN1N24 µN metHb4 µN metHb + 10 µM N1N2A4 µN heme4 µN heme + 10 µM N1N2406380450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUB N1N25754 µN metHb4 µN metHb + 10 µM N1N233  Figure 3.2: Electronic spectra of metHb and free heme mixed with IsdBN1N2 variants. A) Spectra of metHb and free heme mixed with IsdBN1N2 (F366A). B) Expansion of the α/β region in panel A. C) Spectra of metHb and free heme mixed with IsdBN1N2 (I438A). D) Expansion of the α/β region in panel C. E) Spectra of metHb and free heme mixed with IsdBN1N2 (H434A D439A). F) Expansion of the α/β region in panel E.     300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUF366A4 µN metHb4 µN metHb + 10 µM F366AA4 µN heme4 µN heme + 10 µM F366A406300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUI438A4 µN metHb4 µN metHb + 10 µM I438AC4 µN heme4 µN heme + 10 µM I438A406300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUH434A D439A4 µN metHb4 µN metHb + 10 µM HADAE4 µN heme4 µN heme + 10 µM HADA406450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUB F366A4 µN metHb4 µN metHb + 10 µM F366A450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUD I438A4 µN metHb4 µN metHb + 10 µM I438A450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUF H434A D439A4 µN metHb4 µN metHb + 10 µM HADA34  Heme transfer between metHb and IsdBN1N2 (M363L) was also evaluated (Figure 3.3). The mutant bound heme similar to IsdBN1N2. When metHb was mixed with this mutant, modest spectral changes were seen in the Soret and shoulder region. By comparing the height of the Soret of the endpoint transfer spectra between mutant and wild type IsdBN1N2, heme transfer is approximated to 25%.    Figure 3.3: Electronic spectra of metHb and free heme mixed with IsdBN1N2 (M363L). A) Spectra of metHb and free heme mixed with excess IsdBN1N2 (M363L). B) Expansion of the α/β region in panel A.    Spectra of heme bound IsdBN1N2 (E354A) resembled neither that of free heme alone nor heme-bound IsdBN1N2 (Figure 3.4 A). A slight decrease in the Soret band was observed in spectra collected after mixing metHb with IsdBN1N2 (E354A), suggesting little to no heme transferred. However, absorption in the α/β region increased similar to that observed in IsdBN1N2 (M363L) implying a change in the heme environment (Figure 3.4 A, B). Spectra of heme added to IsdBN1N2 (S361A) were similar to that of IsdBN1N2 suggesting heme was bound in a similar environment (Figure 3.4 C). A slight decrease in the Soret peak was observed when S361A was mixed with metHb but the α/β region was least perturbed of all the mutants tested (Figure 3.4 C, D). Heme transfer of metHb to the S361A mutant was estimated to 20%.  300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUM363L4 µN metHb 4 µN metHb + 10 µM M363LA4 µN heme4 µN heme + 10 µM M363L406450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUB M363L4 µN metHb 4 µN metHb + 10 µM M363L35  Figure 3.4: Electronic endpoint spectra of metHb and free heme mixed with IsdBN1N2 (E354A) and IsdBN1N2 (S361A). A) Spectra of metHb and free heme mixed with excess IsdBN1N2 (E354A). B) Expansion of the α/β region in panel A. C) Spectra of metHb and free heme mixed with excess IsdBN1N2 (S361A) D) Expansion of the α/β region in panel C.     IsdBN1N2 (Y440F Y444F) (referred to as YFYF) mixed with heme resulted in spectra that did not resemble that of heme-bound IsdBN1N2, consistent with a change in the heme environment resulting from the substitution of the heme-Fe coordinating residue (Figure 3.5 A). Moreover, the spectra of YFYF mixed with metHb was very different from that of either IsdBN1N2 or heme bound YFYF indicating that the tyrosine mutations greatly perturbed the heme transfer reaction. This spectral change remained stable after 10 minutes of incubation (data not shown). The Soret 300 400 500 600 7000.00.20.40.60.8wavelength (nm)AU4 µN metHb 4 µN metHb + 10 µM E354AE354A4 µN heme4 µN heme + 10 µM E354A402406A300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUS361A4 µN metHb4 µN metHb + 10 µM S361AC4 µN heme4 µN heme + 10 µM S361A406450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUB E354A4 µN metHb 4 µN metHb + 10 µM E354A450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUS361AD4 µN metHb4 µN metHb + 10 µM S361A36 peak was red-shifted to 410 nm, with a distinct shoulder that developed at 360 nm, and 535 nm and 565 nm peaks were observed in the α/β region. Moreover, a decreased signal in the charge-transfer band at 630 nm is indicative of low spin heme-iron or changes in the oxidation state of the iron (Figure 3.5) (77).   Figure 3.5: Electronic endpoint spectra of metHb and free heme mixed with IsdBN1N2 (YFYF). A) Spectra of metHb and free heme mixed with excess YFYF. B) Expansion of the α/β region in panel A. The maxima at 535 nm and 565 nm and the loss of the 630 nm peak are consistent with the formation of hemichrome-like heme iron coordination.     Heme transfer between metHb and IsdBN1N2 variants were calculated by visually comparing the height of the Soret (406 nm) of metHb with IsdBN1N2 to that of metHb (0% heme transfer) and heme-bound IsdBN1N2 variants (100% heme transfer) (Table 3.1). This method assumes a two state model of heme bound to metHb and heme bound to IsdBN1N2, and for this reason, heme transfer between metHb and YFYF and IsdBN1N2 (E354A) could not be determined due to the shift in the Soret peak. IsdBN1N2 variants with heme transfer of less than 40% were classified as heme transfer deficient. A titration between metHb and IsdBN1N2 variants is required to make sure the spectral changes are titrateable and saturateable. 300 400 500 600 7000.00.20.40.60.8wavelength (nm)AUY440F Y444F4 µN metHb4 µN metHb + 10 µM YFYFA4 µN heme4 µN heme + 10 µM YFYF410406450 500 550 600 650 700 7500.000.020.040.060.080.10wavelength (nm)AUB Y440F Y444F5355654 µN metHb4 µN metHb + 10 µM YFYF63037 Table 3.1: Estimation of heme transfer from metHb to IsdBN1N2 variants. IsdBN1N2 variant Soret peak (nm) Heme transfer (%) IsdBN1N2  406 50 YFYF 410 Could not be determined E354A 402 Could not be determined S361A 406 20 M363L 406 25 F366A 406 40 I438A 406 50 H434A D439A 406 50  3.1.2: Assessing binding of IsdBN1N2 variants to metHb by pull down assays.   To ensure the loss of heme transfer by the S361A, E354A, M363L and YFYF mutants was not caused by loss of binding to metHb, a pull down assay was conducted by immobilizing metHb to nickel NTA beads. The surface of metHb contains histidine residues that enables weak binding to nickel NTA beads (78). IsdBN1N2 was included as the positive control; IsdBN1 and IsdBN2 constructs were included as negative controls; they were shown previously to not bind to metHb in this assay (59). While IsdBN1 and IsdBN2 did not bind to metHb, IsdBN1N2, as well as the YFYF, S361A, E354A and M363L mutants all were pulled down by metHb (Figure 3.6).  38    Figure 3.6: Pull down assay of metHb and IsdBN1N2 variants. In each experiment, 20 µN metHb was used as bait to pull down 20 µM IsdBN1N2 mutant; 5 µL of elutent from the nickel NTA beads was loaded on 15% SDS PAGE stained with Coomassie blue. A) IsdBN1N2 and variants with the His-tag removed did not bind to the nickel beads in the absence of metHb but were pulled down by metHb immobilized on the nickel NTA beads. B) MetHb can bind to nickel NTA beads alone. IsdBN1N2 with the His-tag removed could not bind to nickel NTA beads alone but was pulled down by metHb. IsdBN2 and IsdBN1 with the His-tag removed cannot bind to metHb immobilized on the nickel NTA beads. 39 3.1.3: YFYF binding to metHb characterized by ITC. The binding affinity (KD) of the YFYF mutant to metHb was measured by ITC. MetHb (1.2 mN) in the syringe was titrated into 200 µM of YFYF in the cell in 20 mM HEPES, 100 mM NaCl (pH 7.4) buffer. Titration of metHb into YFYF resulted in an exothermic reaction as observed by the negative change in enthalpy (Figure 3.7). Analysis of the data with a one-site model gave a KD of 6 µM ± 2 µM and a stoichiometry (N) of ~ 0.5 (average of three runs), implying two YFYF molecules bound to one metHb monomer. Since Hb has two unequal subunits that may interact with IsdBN1N2 differently, the KD and stoichiometry measurements are assumed to be the average of binding to αHb and βHb. A previous ITC study between IsdBN1N2 and carboxyhemoglobin reported a KD of 420 ± 50 nM (59) and a SPR study using full-length IsdB and unspecified Hb yielded a KD of 50 nM (60).   Figure 3.7: Representative ITC data for titration of IsdBN1N2 (YFYF) into metHb. MetHb (1.2 mM) in the syringe was titrated into YFYF (200 µM) in the cell; 20 x 2 µL injections were made at 180s intervals in 20 mM HEPES buffer (pH 7.4) at 25°C. 40 3.1.4: MetHb titration with YFYF  To independently determine the stoichiometry of metHb interaction with YFYF, a titration was conducted by adding increasing amounts of YFYF (1 - 9 µM) into 4 µM metHb (Figure 3.8). By plotting Δ410 nm vs. YFYF concentration, a linear fit could be generated through the first five points, indicating the stoichiometry was 1.3:1 YFYF to metHb monomers.   Figure 3.8: MetHb titration with IsdBN1N2 (YFYF). A) Visible electronic spectra of metHb mixed with increasing amounts of YFYF. Increasing the concentration of YFYF resulted in the decreased absorbance in the Soret peak at 410 nm. B) Expansion of the α/β region in panel A. Titrating YFYF into metHb resulted in the appearance of the 535 nm and 565 nm peaks as well as the disappearance of the 630 nm band. C) A plot of the change in absorption at 410 nm (Δ410 nm) is plotted against concentration of YFYF. Figure contributed by Dr. Catherine Bowden. 41 3.2: Effect of Hp on S. aureus heme uptake.  3.2.1: Hp 1-1 effect on heme transfer between metHb and IsdBN1N2 Hp tightly binds to metHb and experiments using a mixed sera type of Hp showed inhibition of heme transfer to IsdBN1N2 (69). To further characterize the effect of Hp on heme uptake by IsdBN1N2, 2 µN metHb was pre-incubated with the single sera type Hp 1-1 (0.5 - 8 µM) and electronic spectra were monitored. Next, 10 µM of IsdBN1N2 was added to each mixture and spectra were monitored for up to 10 minutes to ensure the heme transfer endpoint was reached (Figure 3.9 A, B). To quantify how much Hp was required for inhibition of heme transfer; absorbance at 406 nm was plotted for both metHb mixed with Hp, and metHb mixed with Hp and IsdBN1N2 (Figure 3.9 C). The absorption at the Soret peak remained mostly unchanged with the addition of increasing amounts of Hp to metHb. However, as indicated by a decrease in the Soret peak, IsdBN1N2 was only able to extract heme from metHb at low Hp concentrations and heme transfer was inhibited at Hp concentrations higher than 0.5 µM. The changes in the Soret peak absorption (Δ406 nm) between the metHb-Hp spectra and metHb-Hp- IsdBN1N2 were plotted as a function of Hp concentration (Figure 3.9 D). A linear decrease in absorption was observed until 0.5 µM Hp or or approximately 4:1 ratio of metHb monomer to Hp 1-1. The residual difference in absorption is likely due to the formation of a ternary complex between Hp, metHb and IsdBN1N2.  42  Figure 3.9: Electronic spectra of metHb mixed with Hp 1-1 and IsdBN1N2. A) Electronic spectra of 2 µN of metHb with increasing Hp 1-1 (0.05- 1 µM). B) Spectra of 2 µN of metHb incubated with increasing Hp 1-1, followed by the addition of 10 µM IsdBN1N2. C) Absorbance at 406 nm derived from the spectra in panels A and B plotted as a function of increasing Hp concentration. D) The change in absorption of the Soret peak (Δ406 nm) between the data for metHb-Hp and metHb-Hp-IsdBN1N2. A linear fit is generated through first five points. Error bars are the standard deviation calculated by error propagation.   3.2.2: S. aureus growth on Hb-Hp as sole iron source.  Although Hp was shown to have an inhibitory effect of heme transfer in vitro, the ability of Hp to inhibit growth of S. aureus on Hb is unknown. The possibility of Hp inhibition of heme uptake was tested by culturing S. aureus on Hb as sole iron source in the presence of varying ratios of Hp to Hb (Figure 3.10). Hb (200 nN) with varying amount of Hp (mixed serotype) were 300 400 500 600 7000.00.10.20.30.4wavelength (nm)AU+ 0.1 µM Hp+ 0.5 µM Hp2 µN metHb + 0.05 µM Hp+ 0.2 µM Hp+ 1 µM HpA0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.00.250.300.350.40Hp concentration (µM)A406nm2 µN metHb + Hp2 µN metHb + Hp + 10 µM N1N2C300 400 500 600 7000.00.10.20.30.4wavelength (nm)AU2 µN metHb + 10 µM N1N2+ 0.05 µM Hp+ 0.1 µM Hp+ 0.2 µM Hp+ 0.5 µM Hp+ 1 µM HpB0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.00.000.050.100.15Hp concentration (µM)Δ406nmD43 added to NRPMI media. Hp was quantified by assuming the Hp 2-2 serotype, which has the highest molecular weight and thus is an underestimation of the molar amount Hp in the sample. The experiment showed that adding Hp to Hb reduced S. aureus growth and this effect was concentration dependent. As a control to show that the effect of Hp was specific for Hb, heme was used an alternative iron source and was included at the highest concentration of Hp tested. Adding Hp did not affect the growth of S. aureus on heme, which supports the conclusion that the inhibitory effect was specific to Hb.   Figure 3.10: S. aureus growth on various iron sources. Cultures were inoculated into honeycomb plates with continuous shaking in a Bioscreen C machine. OD600 measurements were taken every hour. Growth curves were averaged from three biological replicates (N=3).  0 10 20 300.00.20.40.60.8Time (Hours)OD 600200 nN Hb200 nN Hb + 10 nM Hp200 nN Hb + 25 nM Hp200 nN Hb + 50 nM Hp200 nN Hb + 100 nM Hp100 nM Hp2 µN heme 2 µN heme + 100 nM Hp44 Chapter 4 Discussion 4.1: Molecular characterization of IsdB mutants deficient in heme transfer  Heme pocket residues of the IsdBN1N2-Hb structure were mutated to identify key residues required for catalytic heme transfer. Of these mutants, the IsdBN1N2 (I438A) and IsdBN1N2 (H434A D439A) mutants were not heme transfer deficient. These residues are located on a loop proximal to Hb in the IsdBN1N2-Hb crystal structure; however, this loop does not appear to be important for heme transfer. Although Phe366 of IsdBN1N2 forms part of the hydrophobic pocket that binds heme in the IsdBN2 crystal structure (48), the F366A mutation may not sufficiently perturb the pocket to disrupt heme transfer.    The visible electronic spectrum of heme bound IsdBN1N2 (M363L) is comparable to that of IsdBN1N2 (Figure 3.3). The M363L mutant is able to bind heme but is partially heme transfer deficient. Met363 forms part of the hydrophobic contacts of the heme binding pocket in the IsdBN2 structure (48) and the IsdBN1N2-Hb structure (Figure 4.1). However, this residue seems not to be critical in coordinating heme iron during transfer. Another possibility is that a conserved mutation from methionine to another large hydrophobic residue, leucine, may not be sufficient enough to greatly perturb the heme transfer process.    45  Figure 4.1: Modeling of the M363L mutation in the IsdBN1N2-Hb structure A) Met363 in the IsdBN1N2-Hb structure is drawn in blue sticks with the Sδ atom in yellow. B) A model of the M363L mutation in IsdBN1N2. The side chain of Leu363 is drawn as pink sticks. The heme and coordinating residues are drawn as sticks.    On the other hand, in the IsdBN2 structure the hydroxyl group of Ser361 forms a hydrogen bond with one of the propionate groups of heme (Figure 4.2). Visible spectra of IsdBN2 (S361A) more closely resembled that of free heme than heme-bound IsdBN2, suggesting that the mutation resulted in weak heme binding (48). However, the equivalent amino acid substitutions in the IsdBN1N2 construct retained heme-binding ability when equimolar heme was added to the S361A mutant (Figure 3.4). This observation of higher affinity heme binding in the large construct was previously observed between the IsdBN2 (Y440A) and IsdBN1N2 (Y440A) constructs (48, 69). IsdBN1N2 (S361A) was deficient in heme transfer from metHb compared to wild type; the lack of the hydroxyl group of Ser361 likely disrupted stability of the IsdB heme pocket resulting in incomplete heme transfer. To further characterize this mutation, the affinity of the mutant and IsdBN1N2 could be measured, as well as the use of stopped-flow spectroscopy to assess the kinetics of heme transfer. Nonetheless, the Ser361 residue is essential for full heme transfer from metHb to IsdB.    46  Figure 4.2: Modeling of the S361A mutation in the IsdBN1N2-Hb structure. A) Ser361 in the IsdBN1N2-Hb structure is drawn as blue sticks with the Oγ atom in red. B) The S361A mutation of IsdBN1N2 is drawn in pink sticks. Distances (Å) between residue 361 and the heme propionate are indicated by dotted lines. The heme and coordinating residues are drawn as sticks.   Electronic spectra of IsdBN1N2 (E354A) mixed with heme were blue-shifted compared to that of IsdBN1N2, leading to the hypothesis that the heme environment was altered in the mutant. This hypothesis needs to be tested by crystallography or by measuring heme-binding affinity by methods such as fluorescence quenching of Trp392 at the base of the heme binding pocket (48). The E354A mutant was impaired in heme transfer, highlighting the importance of Glu354 for heme transfer. In the IsdBN1N2-Hb structure, Glu354 is observed to form a hydrogen bond with propionate group of heme, potentially to stabilize heme transfer (Figure 4.3 A). However, in the IsdBN2 structure, Glu354 is positioned further from the heme propionate, suggesting that the residue has an important role in heme transfer but is not essential for heme binding (Figure 4.3 C). Although preliminary data from the pulldown study suggested that all heme transfer deficient mutants bind Hb, this could be a consequence of non-specific surface interactions. Therefore, ITC or Surface Plasmon Resonance (SPR) may be needed to quantify the binding affinity and stoichiometry of binding by these variants. 47  Figure 4.3: Residue 354 in the heme pocket of IsdBN1N2-Hb and heme-bound IsdBN2 structures. A) Glu354 in the IsdBN1N2-Hb structure is drawn as blue sticks with the Oγ atom in red. B) The E354A mutation of IsdBN1N2 is drawn in pink sticks. C) Glu354 in the heme-bound IsdBN2 structure drawn as green sticks with the Oγ atom in red. Distances (Å) between residue 354 and the heme propionate are indicated by dotted lines. The heme and coordinating residues are drawn as sticks.   Notably, the spectroscopic features of YFYF mixed with metHb resembled the features of neither metHb and heme-bound YFYF indicating the heme was in a unique environment different from that of metHb nor YFYF in isolation. The YFYF mutation results in the loss of the heme-Fe coordination residue and disrupts a conserved hydrogen bond between the Tyr residues, both of which are conserved throughout heme binding Isd proteins (Figure 4.4). Closer inspection of the α/β region revealed increased absorbance at 535 nm and 565 nm as well as decreased absorbance in the 630 nm band, these spectroscopic features are characteristic of heme with bis-His iron coordination (Figure 3.5). This spectral feature is similar to that observed for hemichrome, a form of hemoglobin with heme iron in its ferric state and the sixth heme coordination position occupied by a nitrogen atom from an imidazole ring, pyridine base or tryptophan (79). Interestingly, hemichrome was formed when the denaturant sodium benzoate was added to horse metHb, suggesting that formation of hemichrome is coupled to protein unfolding (80). 48  Figure 4.4: Residues 440 and 444 in the heme pocket of IsdBN1N2-Hb and heme-bound IsdBN2 structures. A) Tyr440 and Tyr444 in the IsdBN1N2-Hb structure is drawn as blue sticks with the Oγ atom in red. B) The YFYF mutation of IsdBN1N2 is drawn in pink sticks. C) Tyr440, Tyr444 and Met362 in the heme-bound IsdBN2 structure drawn as green sticks with the Oγ atom in red and Sδ atom in yellow. Distances (Å) between residues 440 and 444 are indicated by dotted lines. The heme and coordinating residues are drawn as sticks.   The formation of a hemichrome-like state in metHb may be the first step in heme transfer to IsdB. Interestingly, an example of hemichrome-like iron coordination was also seen in the IsdBN1N2–Hb complex crystal structure, in which heme is coordinated by His89 and His58, unlike the normal state of hemoglobin, in which heme is coordinated solely by His87 (in αHb). In this structure, the bis-His conformation in αHb is accompanied by a large-scale structural change in the F helix as well parts of the E helix (Asp74-Arg92) (Figure 4.5), indicating that binding of IsdBN1N2 unwinds the helices to aid heme transfer. ITC studies showed that although YFYF is able to bind to metHb, this interaction is of lower affinity than Hb binding to IsdB reported previously (59, 60). Note, the weaker interaction of YFYF for metHb may be due to a conformational change in the structure of metHb analogous to that observed in the IsdBN1N2-Hb crystal structure. In contrast, the interaction of IsdBN1N2 with carboxyhemoglobin used in the ITC experiment may be used as a model for the initial binding of IsdB to Hb before distortion of the structure. To determine if binding of YFYF to metHb results in a similar structural 49 rearrangement, attempts were made to co-crystallize YFYF-Hb complex. Small crystals were obtained; however, optimization is required for better diffraction.   Figure 4.5: Superposition of the oxyHb and IsdBN1N2-Hb structures. A superposition of αHb of the IsdBN1N2-Hb structure (green) with αHb of the oxyHb structure (pink) (PDB ID 2DN1) is presented. E and F helices highlighted. Heme is shown as stick figures.   50 4.2: Role of Hp in S. aureus infections  The previous study of inhibition of heme transfer from metHb to IsdBN1N2 used mixed serotype Hp so the molar amount of Hp present was not accurately determined (69). To overcome this issue, the effect of Hp 1-1 on heme transfer from metHb by IsdBN1N2 was investigated. Hp bound to metHb was not an accessible heme source for IsdBN1N2 and this effect was concentration dependent with linear changes in the Soret peak until 0.5 µM or more Hp was added to 2 µN metHb. Previous structural (32–34) and binding studies (23) reported a binding stoichiometry of Hb-Hp as 1:4 on a monomer basis; in other words, 0.5 µM Hp 1-1 (β-α-α-β complex) is sufficient to bind up 2 µN metHb, consistent with this study. Although IsdB is unable to bind Hp alone, it is able to bind Hb-Hp with KD = 6 nM (60).   Though IsdBN1N2 is unable to extract heme from Hb-Hp, on the bacterial cell surface another protein may act in synergy with IsdB to enable heme extraction from Hb-Hp. One candidate protein to consider is IsdH, which was originally named as HarA for haptoglobin-binding surface anchored protein. In contrast to IsdB, it is capable of binding to Hp alone as well as the Hb-Hp complex (52, 60). The effect of Hp on heme transfer from metHb by IsdH has not been explored due to lack of stable and functional recombinant constructs. Previous studies have investigated the possibility of complementing IsdBN1N2 with the IsdHN1, since IsdB-N1N2 with linker region shares 64% sequence similarity with the homologous region in IsdH-N2N3 (69). However, no heme transfer was seen even when IsdHN1 was added at a 2.5 fold excess to IsdBN1N2 (69).   Another possibility is that regions N-terminal of IsdB-N1 (~83 amino acids) and C-terminal of IsdB-N2 (~154 amino acids) are required for uptake of heme from Hb-Hp and these regions are missing in the IsdBN1N2 construct. Previously, longer constructs of IsdB43-609 and 51 IsdB106-459 have been produced; the former construct was not stable in solution and could not be characterized, but the latter construct is stable and could be tested (69).   Lastly, the possibility that full length IsdB indeed cannot extract heme from Hb-Hp was tested using a S. aureus growth assay on various iron sources including Hb-Hp. Since Hp is present in serum in large amounts (~ 1 mg/mL), during local hemolysis, most Hb is assumed to be captured by Hp, hence Hb-Hp may be an important physiological source of iron. Interestingly, S. aureus was unable to grow on Hb-Hp as sole iron source under the condition tested.  While this study discovered that S. aureus cannot extract heme from Hb-Hp, two previous growth studies have concluded that S. aureus is able to utilize heme from Hb-Hp (61, 81). Francis et al. assessed uptake of radiolabeled mouse Hb in complex with human Hp in S. aureus by measuring the degree of radioactivity of the cell pellet (81). However, this method is not specific for detecting intracellular 59Fe since cell surface-bound iron would also be detected. Moreover, S. aureus grown in media containing tryptone, yeast extract and no iron chelator inhibits the expression of the Isd system which is only up-regulated during iron-limiting conditions (81). The study did not provide a no-iron condition for comparison. Moreover, a recent study highlighted the importance of fresh human Hb over commercial Hb in growth studies and demonstrated that use of a large quantity of Hb could mask the specificity of the Isd system (65). For example, S. aureus isdB deletion mutants challenged with a large amount of commercial lyophilized Hb had similar growth as wild type, (82) whereas a significant reduction in growth was seen when fresh Hb in nanomolar concentrations was used (64). This provides an explanation of why Dryla et al. observed S. aureus growth on Hb-Hp, since they used Hb at 10 times (2 µN) the concentration as this study (200 nN) (61). In addition, S. aureus growth was observed in the unsupplemented condition, suggesting that excessive residual iron is present in 52 the media. Also, no error bars were shown and thus the differences observed between unsupplemented and Hb-Hp conditions may not be significant (61). The differences between findings are likely a consequence of different growth conditions. The growth condition used here is more appropriate for testing the growth of S. aureus on Hb-Hp media since the concentration of Hb is closer to the physiological concentrations of cell-free plasma hemoglobin (~600 nN) (61).   Many studies have assessed uptake of heme from Hb-Hp by different bacteria including Neisseria meningidis (83), Cornebacterium diphtheriae (84), Vibrio vulnificus (85, 86), pathogenic E. coli (86, 87), Haemophilus influenzae (88), and mesophilic Aeromonas species (89). While the bacteriostatic effect of Hp was reported for pathogenic E. coli (86, 87), all of the other studies reported that the organism(s) of study are capable of utilizing Hb-Hp as sole iron source.  While it might seem surprising that S. aureus, a well-known pathogen for causing bloodstream infections, is unable to utilize a common heme source present in serum, there are several possible explanations for this observation. S. aureus could rely on the actions of hemolysins to lyse erythrocytes to create a large pool of Hb locally, this will saturate circulating Hp in serum and render Hb available to be captured by IsdB and IsdH (60).   S. aureus binding to Hb and Hb-Hp without uptake of heme may have advantages for S. aureus infection. Coating of S. aureus with host proteins such as Hp may provide protection against phagocytosis by macrophages (60). Interestingly, chemotaxis of granulocytes and differentiated human promyelocytic HL-60 cells in response to a bacterial tripeptide was inhibited in the presence of Hp (90). Moreover phagocytosis and intracellular killing of E. coli were also inhibited when Hp is added to the medium (90). While no studies have directly 53 demonstrated if displaying Hp on bacterial surface may protect bacteria from immune surveillance, camouflage of the surface of microbes is a common strategy employed by many bacteria to evade host recognition. Currently, most literature involving Hp is focused on its role as a clinical marker for the diagnosis of diseases, such as hemolysis (30), vascular diseases (91), and malignancies (27). This study offers a unique perspective on the role of Hp in host-microbe interactions.   4.3: Conclusions   Part of what makes S. aureus a successful pathogen is its ability to adapt to different environments, which is orchestrated through the regulation of virulence factors. The Isd system helps S. aureus to thrive in conditions with low iron availability by utilizing hemoglobin, a human major reservoir of iron as an iron source. In the first part of my study, I found that E354A, Y440F Y444F, S361A, M363L mutations perturbed heme transfer completely or partially. The electronic spectra of the YFYF mutant resembles that of a bis-His heme coordination that is also observed in the IsdBN1N2-Hb structure, leading us to the hypothesis that the bis-His heme-iron coordination state in Hb is an intermediate step during heme transfer. The role of Hp during heme uptake from Hb was characterized, and Hp 1-1 blocked heme transfer between metHb to IsdBN1N2 in a concentration dependent manner. Moreover, S. aureus could not utilize Hb-Hp as an iron source at physiological levels of serum Hb, which revealed a potential bacteriostatic effect of Hp on S. aureus growth on Hb.  54 4.4: Future directions  The IsdBN1N2 mutants investigated here could be assessed for the ability to support growth of S. aureus on Hb as sole iron source. Towards this aim, I have designed a complementation experiment using an S. aureus USA300 strain with inactivated isdB and isdH and complementing with plasmids carrying IsdB variants IsdB (S361A), IsdB (YFYF), IsdB (M362L), IsdB (E354A), and IsdB (M363L). So far I made the deletion strain and complementation system, and I showed that both IsdB and IsdH were required to restrict S. aureus growth on Hb under the growth conditions tested (data not shown). Lack of IsdB expression was confirmed by a western blot analysis (not shown). Further testing is needed to determine if the complemented strains are able to restore bacterial growth on Hb.   Furthermore, it would helpful to cultivate S. aureus on Hb-Hp in the presence of serum to produce a more physiological relevant condition that mimics blood and serum. Although the inhibitory effect of Hp on heme transfer has been shown, little is known about the mechanism. A superposition of the human Hb-βHp crystal structure on the IsdBN1N2-Hb structure shows that their Hb binding sites do not overlap, as Hp binds at the interface of αβHb dimers and IsdBN1N2 binds to the end of one monomer of Hb parallel to Hp (Figure 4.6). A crystal structure of the Hb-Hp-IsdBN1N2 complex could be used to determine if binding of Hp and IsdB produce any conformational changes to Hb. For crystallization, purified Hp is needed to ensure higher purity and quantity. Previously, I have attempted to make a truncated construct of Hp containing only the beta chain (Val148-Asn406) but the construct did not yield soluble protein in E. coli BL-21 cells, likely due to lack of post-translational surface glycosylation (92). An eukaryotic expression system such as baculovirus-infected insect cells may be required to purify recombinant Hp (34). Alternatively, Hp could be purified from fresh human serum using affinity chromatography (33, 55 93). In addition, it is important to find a volunteer with the Hp 1-1 serotype to ensure a sample of uniform size and composition.   Figure 4.6: Superposition of IsdBN1N2-Hb and Hb-βHp structures. A) IsdBN1N2 (pink) binds to one end of αHb (green and magenta) in the Hb-βHp structure (PDB ID 4X0L). B) βHp (grey) binds at the αβHb (magenta, green, yellow and blue) interface. Heme is shown as red sticks.    Another area of exploration is the effect of Hx on S. aureus heme uptake. Spectroscopy could be used to assess if Hx inhibits heme binding by IsdB. Since S. aureus cannot use Hx as iron source (63), a growth study could be used to determine if S. aureus can uptake iron from heme-Hx.  To explore if S. aureus can evade immune surveillance through camouflaging its surface with Hp, an in vitro model could be developed to determine if Hp aids or prevents phagocytosis of S. aureus by macrophages and neutrophils. This could be followed up with an in vivo mouse study to determine if exogenous Hp offers protection against S. aureus infections. It would be also interesting to compare the inhibitory effect of different Hp phenotypes to determine if certain phenotypes are more protective against S. aureus infection than others.  56 Bibliography 1.  Dayan, G., Naglaa, M., Scully, I., Cooper, D., Begier, E., Eiden, J., Jansen, K., Gurtman, A., and Anderson, A. (2016) Staphylococcus aureus: The current state of disease, pathophysiology and strategies for prevention. Expert Rev. Vaccines. DOI: 10.1080/14760584.2016.1179583 2.  Foster, T. J. (2009) Colonization and infection of the human host by staphylococci: adhesion, survival and immune evasion. Vet. Dermatol. 20, 456–70 3.  Liew, Y. K., Hamat, R. A., van Belkum, A., Chong, P. P., and Neela, V. (2015) Comparative Exoproteomics and Host Inflammatory Response in Staphylococcus aureus skin and soft Tissue Infections, Bacteremia and Sub-Clinical Colonization. Clin. Vaccine Immunol. 22, 593–603 4.  Gordon, R. J., and Lowy, F. D. (2008) Pathogenesis of Methicillin-Resistant Staphylococcus aureus Infection. Clin. Infect. Dis. 46, 1–16 5.  Cimolai, N. (2010) Methicillin-resistant Staphylococcus aureus in Canada: a historical perspective and lessons learned. Can. J. Microbiol. 56, 89–120 6.  Nanra, J. S., Buitrago, S. M., Crawford, S., Ng, J., Fink, P. S., Hawkins, J., Scully, I. L., McNeil, L. K., Aste-Am Éaga, J., Cooper, D., Jansen, K. U., and Anderson, A. S. (2013) Capsular polysaccharides are an important immune evasion mechanism for Staphylococcus aureus. Hum. Vaccines Immunother. 9, 480–487 7.  Thomer, L., Schneewind, O., and Missiakas, D. (2016) Pathogenesis of Staphylococcus aureus Bloodstream Infections. Annu. Rev. Pathol. Mech. Dis. 11, 343–364 8.  Foster, T. J., Geoghegan, J. A., Ganesh, V. K., and Höök, M. (2014) Adhesion, invasion and evasion: the many functions of the surface proteins of Staphylococcus aureus. Nat.Rev.Microbiol. 12, 49–62 9.  Lin, Y., and Peterson, M. (2010) New insights into the prevention of staphylococcal infections and toxic shock syndrome. Expert Rev. Clin. Pharmacol. 3, 753–767 10.  Foster, T. J. (2005) Immune evasion by staphylococci. Nat.Rev.Microbiol. 3, 948–958 11.  Powers, M. E., and Wardenburg, J. B. (2014) Igniting the Fire: Staphylococcus aureus Virulence Factors in the Pathogenesis of Sepsis. PLoS Pathog. 10, 10–13 57 12.  Ganz, T., and Nemeth, E. (2016) Iron Balance and the Role of Hepcidin in Chronic Kidney Disease. Semin. Nephrol. 36, 87–93 13.  Pantopoulos, K., Porwal, S. K., Tartakoff, A., and Devireddy, L. (2013) Mechanisms of mammalian iron homeostasis. Biochemistry. 51, 5705–5724 14.  Parrow, N. L., Fleming, R. E., and Minnick, M. F. (2013) Sequestration and scavenging of iron in infection. Infect. Immun. 81, 3503–3514 15.  Haley, K. P., and Skaar, E. P. (2013) A battle for iron: host sequestration and Staphylococcus aureus acquisition. Microbes Infect. 14, 217–227 16.  Sheldon, J. R., and Heinrichs, D. E. (2015) Recent developments in understanding the iron acquisition strategies of gram positive pathogens. FEMS Microbiol. Rev. fuv009, 1–39 17.  Johnson, E., and Wessling-Resnick, M. (2012) Iron metabolism and the innate immune response to infection. Microbes Infect. 14, 207–216 18.  Brown, J. S., and Holden, D. W. (2002) Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect. 4, 1149–1156 19.  Beard, J. (2001) Iron-deficiency anemia: reexamining the nature and magnitude of the public health problem. J. Nutr. 131, 616–635 20.  Alayash, A. I., Andersen, C. B. F., Moestrup, S. K., and Bülow, L. (2013) Haptoglobin: The hemoglobin detoxifier in plasma. Trends Biotechnol. 31, 2–3 21.  Nagatomo, S., Nagai, Y., Aki, Y., Sakurai, H., Imai, K., Mizusawa, N., Ogura, T., Kitagawa, T., and Nagai, M. (2015) An Origin of Cooperative Oxygen Binding of Human Adult Hemoglobin: Different Roles of the α and β Subunits in the α2β2 Tetramer. PLoS One. 10, e0135080 22.  Mihailescu, M. R., and Russu, I. M. (2001) A signature of the T ---> R transition in human hemoglobin. Proc. Natl. Acad. Sci. U. S. A. 98, 3773–3777 23.  Svistunenko, D. A., Sharpe, M. A., Nicholls, P., Blenkinsop, C., Davies, N. A., Dunne, J., Wilson, M. T., and Cooper, C. E. (2000) The pH dependence of naturally occurring low-spin forms of methaemoglobin and metmyoglobin: an EPR study. Biochem. J. 351 Pt 3, 595–605 24.  Sadrzadeh, S. M., and Bozorgmehr, J. (2004) Haptoglobin phenotypes in health and disorders. Am. J. Clin. Pathol. 121, 97–104 58 25.  Deuel, J. W., Vallelian, F., Schaer, C. A., Puglia, M., Buehler, P. W., and Schaer, D. J. (2015) Different target specificities of haptoglobin and hemopexin define a sequential protection system against vascular hemoglobin toxicity. Free Radic. Biol. Med. 89, 931–943 26.  Van Vlierberghe, H., Langlois, M., and Delanghe, J. (2004) Haptoglobin polymorphisms and iron homeostasis in health and in disease. Clin. Chim. Acta. 345, 35–42 27.  Wobeto, V. P. D. A., Zaccariotto, T. R., and Sonati, M. D. F. (2008) Polymorphism of human haptoglobin and its clinical importance. Genet. Mol. Biol. 31, 602–620 28.  Gast, M. C., Tinteren, H. van, Bontenbal, M., Hoesel, R. Q. van, Nooij, M. A., Rodenhuis, S., Span, P. N., Tjan-Heijnen, V. C., Vries, E. G. F. de, Harris, N., Twisk, J. W., Schellens, J. H. M., and Beijnen, J. H. (2008) Haptoglobin phenotype is not a predictor of recurrence free survival in high-risk primary breast cancer patients. BMC Cancer. vol. 8, 389 29.  Quaye, I. K. (2008) Haptoglobin, inflammation and disease. Trans. R. Soc. Trop. Med. Hyg. 102, 735–742 30.  Shih, A. W. Y., Mcfarlane, A., and Verhovsek, M. (2014) Haptoglobin testing in hemolysis: Measurement and interpretation. Am. J. Hematol. 89, 443–447 31.  Dobryszycka, W. (1997) Biological functions of haptoglobin--new pieces to an old puzzle. Eur. J. Clin. Chem. Clin. Biochem. 35, 647–654 32.  Andersen, C. B. F., Torvund-Jensen, M., Nielsen, M. J., de Oliveira, C. L. P., Hersleth, H.-P., Andersen, N. H., Pedersen, J. S., Andersen, G. R., and Moestrup, S. K. (2012) Structure of the haptoglobin-haemoglobin complex. Nature. 489, 456–459 33.  Stødkilde, K., Torvund-Jensen, M., Moestrup, S. K., and Andersen, C. B. F. (2014) Structural basis for trypanosomal haem acquisition and susceptibility to the host innate immune system. Nat. Commun. 5, 5487 34.  Lane-Serff, H., MacGregor, P., Lowe, E. D., Carrington, M., and Higgins, M. K. (2014) Structural basis for ligand and innate immunity factor uptake by the trypanosome haptoglobin-haemoglobin receptor. Elife. 3, 1–18 35.  Muller-Eberhard, U., Javid, J., Liem, H. H., Hanstein, A., Hanna, M. (1968) Plasma concentrations of hemopexin, haptoglobin and heme in patients with various hemolytic disease. Blood. 32, 811–816 59 36.  Schaer, D. J., Vinchi, F., Ingoglia, G., Tolosano, E., and Buehler, P. W. (2014) Haptoglobin, hemopexin, and related defense pathways ”basic science, clinical perspectives, and drug development. Front. Physiol. 5, 1–13 37.  Malachowa, N., Whitney, A. R., Kobayashi, S. D., Sturdevant, D. E., Kennedy, A. D., Braughton, K. R., Shabb, D. W., Diep, B. A., Chambers, H. F., Otto, M., and DeLeo, F. R. (2011) Global changes in staphylococcus aureus gene expression in human blood. PLoS One. 6, e18617 38.  Friedman, D. B., Stauff, D. L., Pishchany, G., Whitwell, C. W., Torres, V. J., and Skaar, E. P. (2006) Staphylococcus aureus redirects central metabolism to increase iron availability. PLoS Pathog. 2, 0777–0789 39.  Torres, V. J., Attia, A. S., Mason, W. J., Hood, M. I., Corbin, B. D., Beasley, F. C., Anderson, K. L., Stauff, D. L., McDonald, W. H., Zimmerman, L. J., Friedman, D. B., Heinrichs, D. E., Dunman, P. M., and Skaar, E. P. (2010) Staphylococcus aureus fur regulates the expression of virulence factors that contribute to the pathogenesis of pneumonia. Infect. Immun. 78, 1618–1628 40.  Horsburgh, M. J., Ingham, E., and Foster, S. J. (2001) In Staphylococcus aureus, Fur is an interactive regulator with PerR, contributes to virulence, and is necessary for oxidative stress resistance through positive regulation of catalase and iron homeostasis. J. Bacteriol. 183, 468–475 41.  Skaar, E. P., Humayun, M., Bae, T., DeBord, K. L., and Schneewind, O. (2004) Iron-source preference of Staphylococcus aureus infections. Science. 305, 1626–1628 42.  Beasley, F. C., Vines, E. D., C., G. J., Zheng, Q., Liu, S., Lajoie, G. A., Murphy, M. E. P., and Heinrichs, D. E. (2009) Characterization of staphyloferrin A biosynthetic and transport mutants in Staphylococcus aureus. Mol. Microbiol. 72, 947–963 43.  Kobylarz, M. J., Grigg, J. C., Takayama, S. J., Rai, D. K., Heinrichs, D. E., and Murphy, M. E. P. (2014) Synthesis of L-2,3-diaminopropionic acid, a siderophore and antibiotic precursor. Chem. Biol. 21, 379–388 44.  Hammer, N., and Skaar, E. (2011) Molecular mechanisms of Staphylococcus aureus iron acquisition. Annu. Rev. Microbiol. 10.1146/annurev-micro-090110-102851.Molecular 45.  Caza, M., and Kronstad, J. W. (2013) Shared and distinct mechanisms of iron acquisition by bacterial and fungal pathogens of humans. Front. Cell. Infect. Microbiol. 3, 80 60 46.  Stentzel, S., Vu, H. C., Weyrich, A. M., Jehmlich, N., Schmidt, F., Salazar, M. G., Steil, L., Völker, U., and Bröker, B. M. (2014) Altered immune proteome of Staphylococcus aureus under iron-restricted growth conditions. Proteomics. 14, 1857–1867 47.  Mazmanian, S. K., Skaar, E. P., Gaspar, A. H., Humayun, M., Gornicki, P., Jelenska, J., Joachmiak, A., Missiakas, D. M., and Schneewind, O. (2003) Passage of heme-iron across the envelope of Staphylococcus aureus. Science. 299, 906–909 48.  Gaudin, C. F. M., Grigg, J. C., Arrieta, A. L., and Murphy, M. E. P. (2011) Unique heme-iron coordination by the hemoglobin receptor IsdB of Staphylococcus aureus. Biochemistry. 50, 5443–5452 49.  Grigg, J. C., Ukpabi, G., Gaudin, C. F. M., and Murphy, M. E. P. (2010) Structural biology of heme binding in the Staphylococcus aureus Isd system. J. Inorg. Biochem. 104, 341–348 50.  Zhu, H., Xie, G., Liu, M., Olson, J. S., Fabian, M., Dooley, D. M., and Lei, B. (2008) Pathway for heme uptake from human methemoglobin by the iron-regulated surface determinants system of Staphylococcus aureus. J. Biol. Chem. 283, 18450–60 51.  Pishchany, G., Dickey, S. E., and Skaar, E. P. (2009) Subcellular localization of the Staphylococcus aureus heme iron transport components IsdA and IsdB. Infect. Immun. 77, 2624–2634 52.  Pilpa, R. M., Robson, S. a, Villareal, V. a, Wong, M. L., Phillips, M., and Clubb, R. T. (2009) Functionally distinct NEAT (NEAr Transporter) domains within the Staphylococcus aureus IsdH/HarA protein extract heme from methemoglobin. J. Biol. Chem. 284, 1166–1176 53.  Sjodt, M., Macdonald, R., Spirig, T., Chan, A. H., Dickson, C. F., Fabian, M., Olson, J. S., Gell, D. A., and Clubb, R. T. (2016) The PRE-Derived NMR Model of the 38.8-kDa Tri-Domain IsdH Protein from Staphylococcus aureus Suggests That It Adaptively Recognizes Human Hemoglobin. J. Mol. Biol. 428, 1107–1129 54.  Tiedemann, M. T., Muryoi, N., Heinrichs, D. E., and Stillman, M. J. (2008) Iron acquisition by the haem-binding Isd proteins in Staphylococcus aureus: studies of the mechanism using magnetic circular dichroism. Biochem. Soc. Trans. 36, 1138–1143 55.  Grigg, J. C., Vermeiren, C. L., Heinrichs, D. E., and Murphy, M. E. P. (2007) Haem recognition by a Staphylococcus aureus NEAT domain. Mol. Microbiol. 63, 139–149 61 56.  Fonner, B. A., Tripet, B. P., Eilers, B. J., Stanisich, J., Sullivan-springhetti, R. K., Moore, R., Liu, M., and Lei, B. (2015) Solution Structure and Molecular Determinants of Hemoglobin Binding of the First NEAT Domain of IsdB in Staphylococcus aureus. Biochemistry. 53, 3922–3933 57.  Sharp, K. H., Schneider, S., Cockayne, A., and Paoli, M. (2007) Crystal structure of the heme-IsdC complex, the central conduit of the Isd iron/heme uptake system in Staphylococcus aureus. J. Biol. Chem. 282, 10625–10631 58.  Vu, N. T., Moriwaki, Y., Caaveiro, J. M. M., Terada, T., Tsutsumi, H., Hamachi, I., Shimizu, K., and Tsumoto, K. (2013) Selective binding of antimicrobial porphyrins to the heme-receptor IsdH-NEAT3 of Staphylococcus aureus. Protein Sci. 22, 942–953 59.  Bowden, C. F. M., Verstraete, M. M., Eltis, L. D., and Murphy, M. E. P. (2014) Hemoglobin binding and catalytic heme extraction by IsdB near iron transporter domains. Biochemistry. 53, 2286–2294 60.  Dryla, A., Hoffmann, B., Gelbmann, D., Giefing, C., Hanner, M., Meinke, A., Anderson, A. S., Koppensteiner, W., Konrat, R., von Gabain, A., and Nagy, E. (2007) High-affinity binding of the staphylococcal HarA protein to haptoglobin and hemoglobin involves a domain with an antiparallel eight-stranded beta-barrel fold. J. Bacteriol. 189, 254–264 61.  Dryla, A., Gelbmann, D., Von Gabain, A., and Nagy, E. (2003) Identification of a novel iron regulated staphylococcal surface protein with haptoglobin-haemoglobin binding activity. Mol. Microbiol. 49, 37–53 62.  Watanabe, M., Tanaka, Y., Suenaga, A., Kuroda, M., Yao, M., Watanabe, N., Arisaka, F., Ohta, T., Tanaka, I., and Tsumoto, K. (2008) Structural basis for multimeric heme complexation through a specific protein-heme interaction: The case of the third NEAT domain of IsdH from Staphylococcus aureus. J. Biol. Chem. 283, 28649–28659 63.  Torres, V. J., Pishchany, G., Humayun, M., Schneewind, O., and Skaar, E. P. (2006) Staphylococcus aureus IsdB is a hemoglobin receptor required for heme iron utilization. J. Bacteriol. 188, 8421–8429 64.  Pishchany, G., Haley, K. P., and Skaar, E. P. (2013) Staphylococcus aureus growth using human hemoglobin as an iron source. J. Vis. Exp. 72, 1–6 62 65.  Pishchany, G., Sheldon, J. R., Dickson, C. F., Alam, M. T., Read, T. D., Gell, D. a, Heinrichs, D. E., and Skaar, E. P. (2014) IsdB-dependent hemoglobin binding is required for acquisition of heme by Staphylococcus aureus. J. Infect. Dis. 209, 1764–1772 66.  Allard, M., Moisan, H., Brouillette, E., Gervais, A. L., Jacques, M., Lacasse, P., Diarra, M. S., and Malouin, F. (2006) Transcriptional modulation of some Staphylococcus aureus iron-regulated genes during growth in vitro and in a tissue cage model in vivo. Microbes Infect. 8, 1679–1690 67.  Jenkins, A., Diep, A., Mai, T. T., Vo, N. H., Warrener, P., Suzich, J., Stover, C. K., and Sellman, R. (2015) Differential Expression and Roles of Staphylococcus aureus Virulence Determinants during Colonization and Disease. MBio. 6, 1–10 68.  Zhu, H., Li, D., Liu, M., Copié, V., and Lei, B. (2014) Non-heme-binding domains and segments of the Staphylococcus aureus IsdB protein critically contribute to the kinetics and equilibrium of heme acquisition from methemoglobin. PLoS One. 9, e100744 69.  Bowden, C. (2014) Hemoglobin binding, heme extraction and heme transfer by the staphylococcus aureus surface protein IsdB. Ph.D. thesis, UBC 70.  Kuklin, N. A., Clark, D. J., Secore, S., Cook, J., Cope, L. D., McNeely, T., Noble, L., Brown, M. J., Zorman, J. K., Wang, X. M., Pancari, G., Fan, H., Isett, K., Burgess, B., Bryan, J., Brownlow, M., George, H., Meinz, M., Liddell, M. E., Kelly, R., Schultz, L., Montgomery, D., Onishi, J., Losada, M., Martin, M., Ebert, T., Tan, C. Y., Schofield, T. L., Nagy, E., Meineke, A., Joyce, J. G., Kurtz, M. B., Caulfield, M. J., Jansen, K. U., McClements, W., and Anderson, A. S. (2006) A novel Staphylococcus aureus vaccine: iron surface determinant B induces rapid antibody responses in rhesus macaques and specific increased survival in a murine S. aureus sepsis model. Infect. Immun. 74, 2215–23 71.  McNeely, T. B., Shah, N. a, Fridman, A., Joshi, A., Hartzel, J. S., Keshari, R. S., Lupu, F., and DiNubile, M. J. (2015) Mortality among recipients of the Merck V710 Staphylococcus aureus vaccine after postoperative S. aureus infections: An analysis of possible contributing host factors. Hum. Vaccin. Immunother. 10, 3513–3516 72.  Monk, I. R., Shah, I. M., and Xu, M. (2012) Transforming the Untransformable : Application of Direct Transformation to manipulate genetically Staphylococcus aureus and staphylococcus epidermidis. MBio. 3, e00277–11 63 73.  Charpentier, E., Anton, A. I., Barry, P., Alfonso, B., Fang, Y., and Novick, R. P. (2004) Novel cassette-based shuttle vector system for gram-positive bacteria. Appl. Environ. Microbiol. 70, 6076–6085 74.  Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features and development of Coot. Acta Crystallogr. Sect. D Biol. Crystallogr. 66, 486–501 75.  McNamara, P. J., and Iandolo, J. J. (1998) Genetic instability of the global regulator agr explains the phenotype of the xpr mutation in Staphylococcus aureus KSI9051. J. Bacteriol. 180, 2609–2615 76.  Zhu, H., Xie, G., Liu, M., Olson, J. S., Fabian, M., Dooley, D. M., and Lei, B. (2008) Pathway for heme uptake from human methemoglobin by the iron-regulated surface determinants system of Staphylococcus aureus. J. Biol. Chem. 283, 18450–18460 77.  Rachmilewitz, E.A., Peisach, J., and Blumberg, W. E. (1971) Studies on the stability of oxyhemoglobin A and its constituent chains and their derivatives. Am. Soc. Biochem. Mol. Biol. 246, 3356–3366 78.  Williams, L. M., Fu, Z., Dulloor, P., Yen, T., Barron-Casella, E., Savage, W., Van Eyk, J. E., Casella, J. F., and Everett, A. (2010) Hemoglobin depletion from plasma: Considerations for proteomic discovery in Sickle Cell disease and other hemolytic processes. Proteomics - Clin. Appl. 4, 926–930 79.  Rachmilewitz, E. A. (1969) Formation of hemichromes from oxidized hemoglobin subunits. Ann N Y Acad Sci. 165, 171–184 80.  Kajita, A. (1956) Interrelations between the catalytic function of heme proteins and the structural modifications of their protein parts. VII. sulfhydryl groups of modified methemoglobin. J. Biochem. 43, 243–250 81.  Francis, R. T., Booth, J. W., and Becker, R. R. (1985) Uptake of iron from hemoglobin and the haptoglobin-hemoglobin complex by hemolytic bacteria. Int. J. Biochem. 17, 767–773 82.  Hurd, A. F., Garcia-Lara, J., Rauter, Y., Cartron, M., Mohamed, R., and Foster, S. J. (2012) The iron-regulated surface proteins IsdA, IsdB, and IsdH are not required for heme iron utilization in Staphylococcus aureus. FEMS Microbiol. Lett. 329, 93–100 64 83.  Rohde, K. H., and Dyer, D. W. (2004) Analysis of Haptoglobin and Hemoglobin-Haptoglobin Interactions with the Neisseria meningitidis TonB-Dependent Receptor HpuAB by Flow Cytometry. Infect. Immun. 72, 2494–2506 84.  Allen, C. E., and Schmitt, M. P. (2015) Utilization of Host Iron Sources by Corynebacterium diphtheriae: Multiple Hemoglobin-Binding Proteins Are Essential for the Use of Iron from the Hemoglobin-Haptoglobin Complex. J. Bacteriol. 197, 553–562 85.  Zakaria-Meehan, Z., Massad, G., Simpson, L. M., Travis, J. C., and Oliver, J. D. (1988) Ability of Vibrio vulnificus to obtain iron from hemoglobin-haptoglobin complexes. Infect. Immun. 56, 275–277 86.  Helms, S. D., Oliver, J. D., and Travis, J. C. (1984) Role of heme compounds and haptoglobin in vibrio vulnificus pathogenicity. Infect. Immun. 45, 345–349 87.  Eaton, J. W., Brandt, P., Mahoney, J. R. (1982) Haptoglobin, A natural bacteriostat. Science (80-. ). 215, 691–693 88.  Morton, D. J., VanWagoner, T. M., Seale, T. W., Whitby, P. W., and Stull, T. L. (2006) Differential utilization by Haemophilus influenzae of haemoglobin complexed to the three human haptoglobin phenotypes. FEMS Immunol. Med. Microbiol. 46, 426–432 89.  Massad, G., Arceneaux, J. E., and Byers, B. R. (1991) Acquisition of iron from host sources by mesophilic Aeromonas species. J. Gen. Microbiol. 137, 237–241 90.  Rossbacher, J., Wagner, L., and Pasternack, M. S. (1999) Inhibitory effect of haptoglobin on granulocyte chemotaxis, phagocytosis and bactericidal activity. Scand. J. Immunol. 50, 399–404 91.  Levy, A. P., Hochberg, I., Jablonski, K., Resnick, H. E., Lee, E. T., Best, L., and Howard, B. V. (2002) Haptoglobin phenotype is an independent risk factor for cardiovascular disease in individuals with diabetes: The strong heart study. J. Am. Coll. Cardiol. 40, 1984–1990 92.  Maresca, B., Cigliano, L., Spagnuolo, M. S., Dal Piaz, F., Corsaro, M. M., Balato, N., Nino, M., Balato, A., Ayala, F., and Abrescia, P. (2012) Differences between the Glycosylation Patterns of Haptoglobin Isolated from Skin Scales and Plasma of Psoriatic Patients. PLoS One. 7, 1–12 65 93.  Sun, L., Huang, Y., Zhang, Y., Meng, Q., Luo, J., Fan, B., Ma, G., and Su, Z. (2011) A simple and rapid procedure for purification of haptoglobin from human plasma fraction IV. Artif. Cells. Blood Substit. Immobil. Biotechnol. 39, 79–86  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0306899/manifest

Comment

Related Items