Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functional analysis of non-annotated genes in Saccharomyces cerevisiae using wine yeast and chardonnay… Iwashita, Mayumi 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_iwashita_mayumi.pdf [ 7.32MB ]
Metadata
JSON: 24-1.0304572.json
JSON-LD: 24-1.0304572-ld.json
RDF/XML (Pretty): 24-1.0304572-rdf.xml
RDF/JSON: 24-1.0304572-rdf.json
Turtle: 24-1.0304572-turtle.txt
N-Triples: 24-1.0304572-rdf-ntriples.txt
Original Record: 24-1.0304572-source.json
Full Text
24-1.0304572-fulltext.txt
Citation
24-1.0304572.ris

Full Text

          Functional analysis of non-annotated genes in Saccharomyces cerevisiae using wine yeast and Chardonnay fermentation  by  Mayumi Iwashita  B.Sc., The University of British Columbia, 2009     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  The Faculty of Graduate and Postdoctoral Studies   (Food Science)     THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  June 2016    © Mayumi Iwashita, 2016       ii  Abstract The genome sequence of a laboratory Saccharomyces cerevisiae, S288c, was first released in 1996, and novel genes/ORFs continue to be discovered in other S. cerevisiae strains. Approximately one-third of genes/ORFs in S288c are still missing their biological process annotations. Gene functional studies using non-laboratory S. cerevisiae strains is a promising approach, as non-annotated genes/ORFs in laboratory S. cerevisiae are speculated to have lost phenotypes due to mutations during ~80 years of storage in laboratory conditions. The phenotypes of 149 non-annotated ORFs clustered as upregulated or expressed constitutively during wine fermentation (Marks et al. 2008) and eight novel ORFs that are conserved among wine strains but not found in S288c were investigated using a commercial wine S. cerevisiae called Enoferm M2 during Chardonnay fermentation. The overexpression of RGI1 and YDR249C resulted in increased acetic acid production (1.26-fold, p = 0.0491 and 1.52-fold increase, p = 0.001, respectively). Deletion of GEP5 resulted in higher glycerol (1.39-fold, p = 0.0005) and acetic acid (1.61-fold, p = 0.0020). The deletion of nine ORFs (GEP5, MTC7, PAR32, YBL071C-B, YCR051W, YDR089W, YDR249C, YDR524W-A, YMR027W) caused slow growth phenotypes in an aerobic growth curve analysis in Chardonnay grape must at three different temperatures (19, 22 and 30 °C). The localization of C-terminally GFP-tagged proteins was observed for GEP5, PDR18, YBL071C-B andYDR114C as well as five novel ORFs. One of the novel M2 ORFs, 13-2, is a potential novel transcription factor with a Zn(2)-C6 fungal-type DNA-binding domain and was found to localize in the nucleus. The deletion of 13-2 caused a reduction in the expression of ZRT1 by 5-fold (p = 0.0016) based on a qRT-PCR method. A search for additional novel ORFs in the Enoferm M2 genome sequence resulted in the identification of 16 novel ORFs, all of which were previously identified in non-reference S. cerevisiae genome sequences. The majority of non-annotated ORFs and novel ORFs investigated in this study did not show strong phenotypes during Chardonnay wine fermentation upon their deletions and/or overexpressions. It is speculated that conditions that are more challenging than the fermentation of table wine will be required to elucidate their functions.  iii  Preface This thesis is an original and unpublished work conducted by the author, Mayumi Iwashita, under the supervision of Dr. Hennie J. J. van Vuuren and the guidance of her committee members; Dr. Vivien Measday, Dr. Christopher J. R. Loewen and Dr. Thibault Mayor.  The main idea for this research project and the research design was developed by Dr. van Vuuren. The research was funded by Natural Sciences and Engineering Research Council Collaborative Research and Development (NSERC CRD) grant to Dr. van Vuuren in partnership with Mark Anthony Group Inc. The majority of the work presented henceforth was conducted in the Wine Research Centre at the University of British Columbia. The Open Reading Frames (ORFs) investigated in this study were selected based on the previous study published by the van Vuuren Laboratory (Marks et al. 2008). The list of the novel ORFs investigated in this study were obtained from the Gardner Laboratory at University of Auckland, New Zealand.   The construction of 129 null mutants of Cluster 13 ORFs and eight null mutants of novel ORFs were performed by Dr. Christopher J. Walkey. Any other mutants described in this study were constructed by M. Iwashita.  The growth curve data of all null mutants from Clusters 7 and 13 ORFs and novel ORFs were collected by Dr. Walkey, and the data analyses were conducted by M. Iwashita. All the other experiments were conducted by M. Iwashita under the technical guidance of Dr. van Vuuren, Dr. Walkey and Dr. Zongli Luo. Day-to-day guidance and encouragement were provided by Dr. Walkey and Dr. Luo. Analysis of the fermented wine with high-pressure liquid chromatography (HPLC) was conducted under the technical guidance of the Wine Research Centre Research Manager, Lufiani L. Madilao, at the University of British Columbia.  Dr. van Vuuren and Dr. Measday contributed to the editing of the thesis.   iv  Table of Contents 1.  Abstract ........................................................................................................................................... ii Preface............................................................................................................................................ iii Table of Contents ........................................................................................................................... iv List of Tables .................................................................................................................................. x List of Figures .............................................................................................................................. xiii List of Abbreviations ................................................................................................................... xvi 1. Introduction ........................................................................................................................... 1 1.1 A brief history of Saccharomyces cerevisiae ...................................................................................... 1 1.2 Mating types and genetic manipulations in yeast ............................................................................... 2 1.3 High-throughput gene functional studies ............................................................................................ 3 1.3.1 Yeast knock-out (YKO) collection .............................................................................................. 3 1.3.2 Microarray studies ....................................................................................................................... 4 1.3.3 RNA-sequencing approach .......................................................................................................... 5 1.3.4 Summary of other yeast libraries/collections ............................................................................... 6 1.3.5 Bioinformatics in gene annotation ............................................................................................... 7 1.4 Current status and challenges with annotation of ORFs ..................................................................... 9 1.5 Lineage of S288c .............................................................................................................................. 11 1.5.1 A brief summary of laboratory S. cerevisiae genotypes ............................................................ 12 1.6 Yeast on grapes ................................................................................................................................. 13 1.6.1 Genetics of wine strains of S. cerevisiae .................................................................................... 14 1.6.2 Horizontal gene transfer in wine strains of S. cerevisiae ........................................................... 15 1.7 Wine fermentation with S. cerevisiae ............................................................................................... 16 1.7.1 Fermentation in aerobic and anaerobic environments ............................................................... 17 1.7.2 Comparison of YPD and grape must ......................................................................................... 18 1.7.3 Selective pressure of grape must and hybridization rate in wine yeasts .................................... 19 1.7.4 Sluggish or stuck fermentations ................................................................................................. 20 1.7.5 Global transcriptomic changes in wine S. cerevisiae during wine fermentation ....................... 21 1.7.6 Wine flavor properties influenced by yeast ............................................................................... 22  v  1.8 Previous studies on non-annotated ORFs/genes using wine yeast and wine fermentation in the van Vuuren laboratory ............................................................................................................................. 25 1.9 Research proposal ............................................................................................................................. 26 1.9.1 Research hypotheses .................................................................................................................. 26 1.9.2 Enoferm M2 in genetic studies .................................................................................................. 27 1.9.3 Chardonnay wine fermentation for genetic studies .................................................................... 27 1.9.4 Research objectives .................................................................................................................... 28 2. Materials and Methods ....................................................................................................... 30 2.1 Construction of mutants for this study .............................................................................................. 30 2.1.1 PCR amplification of cassettes to construct null mutants .......................................................... 30 2.1.2 PCR amplification of cassettes to construct overexpression mutants ........................................ 32 2.1.3 Yeast transformation .................................................................................................................. 32 2.2 Storage of yeast ................................................................................................................................. 33 2.3 Wine fermentation ............................................................................................................................ 33 2.4 High pressure liquid chromatography (HPLC) Analyses ................................................................. 35 2.4.1 Analysis of HPLC data .............................................................................................................. 35 2.5 Construction of GFP-tagged strains .................................................................................................. 36 2.5.1 GFP imaging .............................................................................................................................. 36 2.6 TCA protein extraction, SDS-PAGE and Western blot analyses...................................................... 37 2.7 Infusion cloning ................................................................................................................................ 38 2.8 Add-back experiment ........................................................................................................................ 38 2.9 Microarray analysis ........................................................................................................................... 39 2.9.1 Sample collections and chip hybridization ................................................................................ 39 2.9.2 Analysis method for microarray data ......................................................................................... 40 2.10 Quantitative real time PCR (qRT-PCR) .......................................................................................... 40 2.11 lacZ reporter assays ......................................................................................................................... 41 2.12 Nitrogen media used in phenotype screening for the 13-2 null mutant .......................................... 42 2.13 Spot assays and plates ..................................................................................................................... 42 2.14 Identification of novel ORFs in M2 genome sequence contigs ...................................................... 43 3. Results for ORFs in Clusters 7 and 13 ............................................................................... 44 3.1 Construction of 19 NL and OE mutants of Cluster 7 ORFs and 118 NL mutants of Cluster 13 ORFs .......................................................................................................................................................... 44 3.2 Phenotypes associated with Clusters 7 and 13 ORFs........................................................................ 45  vi  3.2.1 Fermentation characteristics of wild type M2 ............................................................................ 45 3.2.2 HPLC analyses of Chardonnay wine fermented with Cluster 7 ORF mutants: RGI1 and YDR249C OE mutants produced higher amounts of acetic acid .............................................. 46 3.2.3 HPLC analyses of Chardonnay wine produced with Cluster 13 ORF mutants: Deletion of GEP5 results in higher glycerol and acetic acid levels .............................................................. 47 3.3 Growth curve phenotypes associated with the NL mutants of ORFs in Clusters 7 and 13 ............... 48 3.3.1 Slow growth phenotypes associated with mtc7Δ, par32Δ and ydr249cΔ (Cluster 7) in Chardonnay grape must ............................................................................................................. 49 3.3.1.1 Slow growth phenotype of homozygous MTC7 OE mutant (Cluster 7) ......................... 50 3.3.2 Growth curve phenotypes associated with six NL mutants of Cluster 13 ORFs ....................... 51 3.3.2.1 Small colony formation phenotypes of ybl071c-b∆ and ycr051w∆ (Cluster 13 ORFs) . 54 3.4 Protein localization for proteins encoded by ORFs in Clusters 7 and 13 ......................................... 54 3.4.1 No GFP localization observed for proteins encoded by Mtc7p and Ydl206wp (Cluster 7) ...... 55 3.4.2 GFP localization for proteins encoded by Cluster 13 ORFs: Gep5p, Pdr18p, Ybl071c-bp, Ybr056wp, Ycr051wp, Ydr114cp and Ypl225wp ..................................................................... 55 3.5 Exploring the use of various wine fermentation relevant stresses to identify strong phenotypes for Cluster 13 ORFs ............................................................................................................................... 59 3.6 Phenotype dependence on growth phases: Exponential vs stationary phases ................................... 61 4. Functional Study of Novel ORFs ........................................................................................ 65 4.1 DNA and protein sequence of eight novel ORFs .............................................................................. 65 4.2 Fifteen additional novel ORFs found in the M2 genome .................................................................. 69 4.3 Proteins encoded by novel ORFs are not involved in wine fermentation kinetics ........................... 70 4.4 The homozygous diploid 13-2 NL mutant shows a slightly low growth rate at 18 °C and low maximum cell density at 22 °C......................................................................................................... 71 4.5 Protein localization using a C-terminal GFP-tag .............................................................................. 71 4.6 Effect of deletion of novel ORFs on global gene expression patterns .............................................. 75 4.6.1 Genes involved in sterol biosynthesis and those that encode for transposable elements were commonly identified as DE in novel ORF mutants ................................................................... 77 4.6.2 Gene expression patterns obtained for the 13-1 deletion mutant ............................................... 78 4.6.3 Deletion of 13-2 leads to repression of ZRT1 ............................................................................ 79 4.6.4 Deletion of 13-4 results in upregulation of glucose transport and glycogen metabolic process related genes .............................................................................................................................. 82 4.6.5 Deletion of 13-5 may affect copper or sterol transport .............................................................. 84 4.6.6 Deletion of 13-6 leads to downregulation of genes constituting RNA polymerase I................. 86 4.6.7 Deletion of 14-1 results in upregulation of various transporters ................................................ 89  vii  4.6.8 Deletion of 14-2 leads to upregulation of a large set of genes involved in ribosome biogenesis and various metabolic processes ................................................................................................ 91 4.6.9 Deletion of 14-4 leads to upregulation of genes involved in glycogen, sterol and alcohol metabolism ................................................................................................................................. 95 4.7 Experiments conducted for each novel ORF .................................................................................... 99 4.7.1 Results of functional analysis specific to 13-2 ........................................................................... 99 4.7.1.1 The expression of ZRT1 is suppressed in 13-2Δ............................................................. 99 4.7.1.2 pH dependent growth phenotype is associated with the deletion of 13-2 ..................... 102 4.7.1.3 The connection between pH, sulfate and zinc ............................................................... 105 4.7.2 Phenotype screening for 13-6: Overexpression results in sensitivity to K2S2O5...................... 106 4.7.3 Deletion of 14-1 does not lead to pH difference in aging colonies .......................................... 107 4.7.4 Double deletion of 14-2 and M27 confer sensitivity to acetic acid ......................................... 107 5. Discussion ........................................................................................................................... 109 5.1 Fermentation characteristics of the wild type M2 yeast strain ........................................................ 109 5.2 Functional study of non-annotated Clusters 7 and 13 ..................................................................... 111 5.2.1 The M2 yeast strain  may carry a new synthetic lethality between TOP3 and THI7 ............... 111 5.2.2 Unsuccessful deletions of YAL064W, YBR013C, YHL008C  and YIR042C reveals sequence differences and SNPs between S288c and M2 ........................................................................ 113 5.2.3 Three ORFs from Clusters 7 and 13 displayed phenotypes during Chardonnay fermentation 116 5.2.4 Overexpression of MTC7 leads to a strongly decreased growth rate ...................................... 117 5.2.5 A normal Chardonnay fermentation rate was observed with the deletion of RGI1 in M2 ...... 118 5.2.6 The PAR32 gene may have a role at the end of wine fermentation and in a cold environment ................................................................................................................................................. 119 5.2.7 Overexpression of YDR249C in an homozygous diploid S. cerevisiae yeast strain results in higher levels of acetic acid ...................................................................................................... 120 5.2.8 Deletion of GEP5 likely alters cellular lipid composition and cell wall morphology leading to higher sensitivity to high osmotic pressure and change in tolerance to sulfites, acetic acid and ethanol ..................................................................................................................................... 120 5.2.9 YBL071C-B NL shows no phenotype during Chardonnay fermentation but has a strong slow growth phenotype in Chardonnay grape must under aerobic condition .................................. 125 5.2.10 Slow growth phenotype of ycr051w∆ under aerobic conditions may associate with the interference of RSC6 expression ............................................................................................ 126 5.2.11 Phenotypes associated with YDR089W may be accentuated in more stressful wine fermentation conditions such as ice wine and dessert wines .................................................. 127 5.2.12 Overexpression of YDR114C may lead to the identification of its phenotype during wine fermentation ........................................................................................................................... 127  viii  5.2.13 The mechanism of slow growth phenotype associated with ydr524w-cΔ may be due to a role in repairing DNA damage which may be relevant for industrial fermentations .................... 128 5.2.14 Slow growth phenotype of ymr027w∆ in aerobic condition may be due to interference of normal TAP42 transcription ................................................................................................... 129 5.2.15 Using the experimental conditions outside the product specifications may lead to observation of stronger phenotypes of industrial S. cerevisiae strains ...................................................... 130 5.3 Functional analysis of novel ORFs ................................................................................................. 130 5.3.1 Deletion of eight novel ORFs did not lead to phenotypes during Chardonnay fermentation .. 130 5.3.2 The 13-2 ORF may encode for a novel transcription factor likely involved in ion and pH homeostasis .............................................................................................................................. 131 5.3.3 The 13-4p has similarity to OXP1 but its deletion has little effect on Chardonnay fermentation ................................................................................................................................................. 135 5.3.4 The 13-5p contains an MFS domain and may be a novel transporter for hydrophobic molecules ................................................................................................................................................. 136 5.3.5 Understanding the role that FLO11 superfamily domain containing novel protein 13-6p plays on lipid bodies may lead to identifying the key difference in stress tolerance between laboratory and wine strains of S. cerevisiae ............................................................................ 137 5.3.6 The 14-1 ORF encodes  protein with sequence similar to Ady2p but may not be involved in ammonium ion transport .......................................................................................................... 139 5.3.7 Novel ORFs 14-2 and M27 may be paralogs ........................................................................... 140 5.3.8 The 14-4p shares sequence similarity to Yps6p ....................................................................... 141 6. Conclusions......................................................................................................................... 142 Literature Cited ........................................................................................................................ 148 Appendices ................................................................................................................................. 183 A. Genotypes of yeast strains used in this study ...................................................................... 183 B. List of oligonucleotide primers used in this study ............................................................... 190 C. List of primers for qRT-PCR ............................................................................................... 200 D. Primers used for cloning ...................................................................................................... 201 E. Western blotting for C-termini GFP-tagged proteins .......................................................... 202 F. Summary of ORFs without phenotypes ............................................................................... 205 G. qRT-PCR results without positive results ........................................................................... 211 H. Additional results for the functional analysis of 13-2 ......................................................... 212  ix  I. Spot assays for novel ORFs ................................................................................................. 215 J. Additional results ................................................................................................................. 218    x  List of Tables Table 1.1A short list of resources built for S. cerevisiae comprehensive gene functional studies. .............. 6 Table 1.2 Three S288c ORF categories used on SGD and the snapshot of the current status. ................... 10 Table 1.3 Current status of GO terms for all the registered ORFs on SGD. ............................................... 10 Table 1.4 Summary of favorable wine yeast fermentation kinetics. ........................................................... 21 Table 1.5 Common flavor-active compounds produced by S. cerevisiae or produced as a result of chemical reactions between the metabolites. .............................................................................. 24 Table 2.1 Minimum fold change levels for compounds analysed by HPLC.. ............................................ 36 Table 3.1 Eight ORFs from Cluster 13 resulted in inviable homozygous NL mutants. ............................. 45 Table 3.2 Glucose, fructose, glycerol, acetic acid and ethanol in Chardonnay wine fermented with wild type M2. ...................................................................................................................................... 46 Table 3.3 RGI1 and YDR279C OE mutants produce higher levels of acetic acid during Chardonnay fermentation (n = 3).. .................................................................................................................. 46 Table 3.4 The levels of glucose, fructose, glycerol, acetic acid and ethanol in the Chardonnay wine fermented with gep5∆ (n = 3).. ................................................................................................... 48 Table 3.5 Seven Cluster 13 ORFs selected for GFP localization imaging, and the reasons for their selections. ................................................................................................................................... 56 Table 3.6 Six Cluster 13 ORFs showed GFP localization in M2. ............................................................... 59 Table 4.1 DNA and protein sequence analysis of eight novel ORFs.. ........................................................ 66 Table 4.2 Twenty six ORFs of >500bp in M2 that are not found in S288c reference genome sequence. .. 69 Table 4.3 Summary of GFP localization proteins encoded by novel ORFs. .............................................. 72 Table 4.4 DE genes/ORFs identified in the 13-1 null mutant. .................................................................... 78 Table 4.5 Biological process GO terms significantly enriched amongst DE genes in the 13-1 deletion mutant (no correction).. .............................................................................................................. 78 Table 4.6 Functions associated with DE genes identified in the GO term enrichment analysis for the 13-1 null mutant.. ................................................................................................................................ 79 Table 4.7 DE genes/ORFs in the 13-2 null mutant. .................................................................................... 80 Table 4.8 Enriched GO biological process terms amongst DE genes in the 13-2 deletion mutant fermentation.. .............................................................................................................................. 80 Table 4.9 Functions of DE genes identified in GO term enrichment analysis for the 13-2 null mutant.. ... 81 Table 4.10 DE genes/ORFs in the 13-4 null mutant. .................................................................................. 83 Table 4.11 Enriched GO biological process terms amongst DE genes in the 13-4 deletion mutant fermentation. ............................................................................................................................ 83 Table 4.12 Functions associated with DE genes identified in GO term enrichment analysis for the 13-4 null mutant.. ............................................................................................................................. 84 Table 4.13 DE genes/ORFs in the 13-5 null mutant. .................................................................................. 85  xi  Table 4.14 Enriched GO biological process terms amongst DE genes in the 13-5 deletion mutant fermentation.. ........................................................................................................................... 85 Table 4.15 Functions of DE genes identified in GO term enrichment analysis for the 13-5 null mutant.. . 86 Table 4.16 DE genes/ORFs in the 13-6 null mutant. .................................................................................. 87 Table 4.17 Enriched GO biological process terms amongst DE genes in the 13-6 deletion mutant fermentation. ............................................................................................................................ 87 Table 4.18 Functions associated with DE genes identified in GO term enrichment analysis for the 13-6 null mutant.. ............................................................................................................................. 88 Table 4.19 DE genes/ORFs in the 14-1 null mutant.. ................................................................................. 89 Table 4.20 Enriched GO biological process terms amongst DE genes in the 14-1 deletion mutant fermentation.. ........................................................................................................................... 90 Table 4.21 Functions associated with DE genes identified in the GO term enrichment analysis for the 14-1 null mutant.. ............................................................................................................................. 90 Table 4.22 DE genes/ORFs in the 14-2 null mutant.. ................................................................................. 92 Table 4.23 Enriched GO biological process terms amongst DE genes in the 14-1 deletion mutant fermentation.. ........................................................................................................................... 93 Table 4.24 Functions associated with DE genes identified in GO term enrichment analysis for the 14-2 null mutant.. ............................................................................................................................. 94 Table 4.25 Summary of differentially expressed (DE) genes/ORFs in 14-4 null mutant. .......................... 96 Table 4.26 Biological process GO terms found to be significantly enriched in 14-4 deletion mutant. ...... 97 Table 4.27 Functions associated with DE genes identified in GO term enrichment analysis in 14-4 null mutant.. .................................................................................................................................... 98 Table 4.28 The components of DAP media and AS media. ..................................................................... 104 Table 5.1 Sequence difference between S288c and M2 leading to the joining of YLR235C and YLR236C in M2.. ...................................................................................................................................... 113 Table 5.2 ORFs that were not investigated in this study due to unsuccessful construction of homozygous null mutants.. ............................................................................................................................ 113 Table 5.3 Fourteen non-annotated Clusters 7 and 13 ORFs showed phenotypes in this study.. ............... 116 Table 5.4 Enriched GO terms identified in gep5∆.. .................................................................................. 121 Table 5.5 Phenotypes NL and OE mutants of eight novel ORFs investigated in this study. .................... 131 Table 6.1 The microarray signal strengths of Cluster 7 ORFs investigated in this study.. ....................... 143 Table A.1 Genotype of wild type Enoferm M2 ........................................................................................ 183 Table A.2 Genotype of null and overexpression mutants constructed for ORFs in Cluster 7.. ................ 183 Table A.3 Genotype of null mutants constructed for ORFs in Cluster 13.. .............................................. 184 Table A.4 Genotype of null mutants constructed for novel ORFs.. .......................................................... 187 Table A.5 Genotype of NIC96-mCherry strains used in GFP localization study. .................................... 187 Table A.6 Genotypes of strains constructed for GFP localization study for Clusters 7 and 13. ............... 188  xii  Table A.7 Genotypes of strains constructed for GFP localization study for novel ORFs. ....................... 189 Table A.8 Genotypes of strains constructed for ORF specific experiments. ............................................ 189 Table B.1 List of primers used to construct deletion and overexpression mutants for ORFs in Cluster 7. ....  .................................................................................................................................................. 190 Table B.2 List of primers used for GFP localization study for ORFs in Clusters 7 and 13. ..................... 194 Table B.3 List of primers used for GFP localization study for novel ORFs. ............................................ 197 Table B.4 List of primers used for the construction of mutants for ORF specific experiments. .............. 199 Table C.1 List of primers used in qRT-PCR. ............................................................................................ 200 Table D.1 List of primers used for add-back experiment with pCW6. ..................................................... 201 Table D.2 List of primers used for sequencing of pCW6 after cloning. ................................................... 201 Table D.3 List of primers used to construct gene specific lacZ reporter plasmid (pCW5)....................... 201 Table D.4 List of primers used for sequencing of pCW5 after promoter insertion. ................................. 201 Table F.1 ORFs in Cluster 7 without phenotype or phenotypes likely to associate with the disruption of neighbouring genes. .................................................................................................................. 205 Table F.2 ORFs in Cluster 13 without phenotypes or phenotypes likely associate with the disruption of neighbouring genes. .................................................................................................................. 206 Table J.1 Phenotypes detected by HPLC for ybl071c-b∆ during Chardonnay fermentation (n = 3). ....... 218 Table J.2 Phenotypes of metabolic compounds produced by ydr114c∆ during Chardonnay fermentation (n = 3). .......................................................................................................................................... 219   xiii  List of Figures Figure 1.1 Homolog, paralog and ortholog genes.. ....................................................................................... 8 Figure 1.2 A schematic pathways of fermentation (non-oxidative) and aerobic respiration (oxidative) in S. cerevisiae ................................................................................................................................... 17 Figure 1.3 Typical flow of wine making ..................................................................................................... 20 Figure 2.1 Schematic diagram of construction of null mutants .................................................................. 31 Figure 2.2 Schematic diagram of homologous recombination for the construction of overexpression mutants.. .................................................................................................................................... 32 Figure 2.3 Schematic diagram of homologous recombination for the C-terminal GFP tagging.. .............. 37 Figure 2.4 pCW6 plasmid used to construct plasmids with ORFs expressed under the PGK1 promoter. . 39 Figure 3.1 Slow fermentation kinetics of gep5Δ reflected in the slow weight loss during Chardonnay fermentation (n = 3).. ................................................................................................................. 48 Figure 3.2 Growth curve phenotypes of mtc7Δ, par32Δ and ydr249cΔ (n = 7). ........................................ 49 Figure 3.3 Tetrad dissection of heterozygous diploid OE MTC7 mutant resulted in a slow growth phenotype .................................................................................................................................. 51 Figure 3.4 Location of MTC7 and its neighboring genes in M2.. ............................................................... 51 Figure 3.5 PGK1 promoter driven overexpression of MTC7 on pCW6 plasmid. ....................................... 51 Figure 3.6 Growth curve phenotypes of gep5Δ, ybl071c-bΔ, ycr051wΔ ydr089wΔ, ydr524w-aΔ and ymr027wΔ (n = 7). .................................................................................................................... 52 Figure 3.7 Small colony formation phenotypes of ybl071c-b∆ and ycr051w∆. ......................................... 54 Figure 3.8 Cellular of GFP tagged Gep5p, Pdr18p, Ybl071c-bp, Ybr056wp, Ycr051wp and Ydr1104cp (Cluster 13).. .............................................................................................................................. 58 Figure 3.9 ydl129wΔ and ydr089wΔ are sensitive to wine fermentation related stresses. ......................... 60 Figure 3.10 Comparison of the effect of K2S2O5 on the cells in exponential and stationary phases. ......... 62 Figure 3.11 Higher resistance of gep5Δ to acetic acid and K2S2O5. ........................................................... 63 Figure 4.1 Locations of eight novel M2 ORFs. .......................................................................................... 65 Figure 4.2 Locations of three novel ORFs, 14-1, 14-2 and 14-4 in AWRI796. .......................................... 66 Figure 4.3 Predicted 3D folding of proteins encoded by novel ORFs.. ...................................................... 68 Figure 4.4 Deletion of 13-2 in M2 results in subtle slow growth at 18 °C and low maximum cell density at 22 °C (n = 7).. ............................................................................................................................ 71 Figure 4.5 Novel ORF encoded protein-GFP cellular localization ............................................................. 73 Figure 4.6 Relative expressions of ZRT1 in wild type M2 and 13-2 null (NL) mutant at day 3 of Chardonnay fermentation (n = 3). ........................................................................................... 100 Figure 4.7 Comparison of ZRT1 and ZRT2 expression levels in wild type 13-2 null and 13-2 overexpression strains (n = 3) .................................................................................................. 100 Figure 4.8 -galactosidase assay for ZRT1 promoter region (n = 3)......................................................... 101  xiv  Figure 4.9 The 13-2 null mutant has a slow growth phenotype when using DAP as a sole nitrogen source (n = 7). ..................................................................................................................................... 102 Figure 4.10 Growth rate of the 13-2 null mutant on DAP and AS media at different pH. ....................... 103 Figure 4.11 Addition of K2SO4 to DAP as the sole nitrogen source media.. ............................................ 105 Figure 4.12 Expression levels of SUL1, SUL2 and GLR1 in 13-2 null and overexpression mutants. ...... 105 Figure 4.13 Spot assays for 13-6 phenotype screening. ............................................................................ 106 Figure 4.14 Observation of pH difference among aging colonies on GM-BKP plates due to ammonia excretion. ............................................................................................................................... 107 Figure 4.15 The 14-2/M27 double mutant are sensitive to acetic acid.The cells were grown overnight and diluted to OD600 = 0.3.. ......................................................................................................... 108 Figure 5.1 The region around YLR235C and YLR236C on Chromosome 12 in (a) S288c and in (b) M2.. ................................................................................................................................................. 112 Figure 5.2 Genomic location of YIR042C in M2 compared to S288c. .................................................... 115 Figure 5.3 Predicted 3D folding of 13-6p by Phyre2.. .............................................................................. 138 Figure E.1 Visualization of C-termini GFP tagged protein sizes with Western blot (13-4, 13-2, 13-5, 13-6, 14-2 and 14-4).. ...................................................................................................................... 202 Figure E.2 Visualization of C-termini GFP tagged protein sizes with Western blot (13-2, 13-5, 13-6, 14-1, 14-2 and 14-4). ....................................................................................................................... 203 Figure E.3 Visualization of C-termini GFP tagged protein sizes with Western blot (Mtc7p, Ydl206wp, Ybr056wp, Ydr061wp, Ylr236cp, Ypl225wp, Gep5p and Ygl024wp). ................................ 204 Figure G.1 qRT-PCR study of DE genes identified in 13-2 null mutant.. ................................................ 211 Figure G.2 qRT-PCR study of DE genes identified in 14-2 null mutant.. ................................................ 211 Figure H.1 Expression level of ZRT1, ZRT2 and SUL1 in cells grown in YPD media. ........................... 212 Figure H.2 The effect of excess zinc in media on 13-2 null and overexpression mutants. ....................... 212 Figure H.3 The effect of K2HPO4 with ammonium sulfate as only nitrogen media.. ............................... 213 Figure H.4 Slow growth of 13-2 null mutant on both high and low pH YPD plates. ............................... 213 Figure H.5 Slow growth phenotype of 13-2 null mutant on both high and low pH YPD plates is independent of ZAP1. ............................................................................................................. 213 Figure H.6 Slow growth phenotype of 13-2 null mutant observed with the addition of tartaric acid (2.5 % w/v).. ....................................................................................................................................... 214 Figure I.1 Spot assays for 13-1 phenotype screening.. ............................................................................. 215 Figure I.2 Spot assays for 13-4 phenotype screening. .............................................................................. 215 Figure I.3 Spot assays for 13-5 phenotype screening. The cells were growth overnight and spotted on each plate. The same cell culture of each strain/mutant was spotted on all six plates shown. ........ 216 Figure I.4 Spot assays for 14-1 phenotype screening. .............................................................................. 216 Figure I.5 Spot assays for 14-2 phenotype screening. .............................................................................. 217 Figure J.1 ybl071c-bΔ shows no phenotype in Chardonnay fermentation kinetics (n = 3). ..................... 218  xv  Figure J.2 ydr114c∆ results in slow growth. ............................................................................................. 218 Figure J.3 ydr114cΔ shows slow fermentation rate. ................................................................................. 219 Figure J.4 Add-back experiment for YDR114C on YPD+hygro plate (Day 2).. ...................................... 219    xvi  List of Abbreviations Abbreviations Definition ADY Active Dry Yeast aRNA/cRNA anti-sense RNA/complementary RNA (i.e. complementary to mRNA) AS Ammonium Sulfate ATP Adenosine Tri-Phosphate BLAST Basic Local Alignment Search Tool cDNA complementary DNA (i.e. complementary to mRNA) CL Cardiolipin CNV Copy Number Variation cRNA/aRNA complementary RNA/anti-sense RNA (i.e. complementary to mRNA) DAmP Decreased Abundance by mRNA Perturbation DAP Diammonium Phosphate DE Differentially Expressed DNA Deoxyribo Nucleic Acid DNP Double Nucleotide Polymorphism FLEX Full-Length Expression-ready FSR genes Fermentation Stress Response genes G418 Geneticin GC Gas chromatography GC-MS Gas Chromatography coupled with Mass Spectrometer GFP Green Fluorescence Protein GO Gene Ontology GPI Glycophosphatidylinositol GST-tag Glutathione S-transferase (211 amino acids, 26 kDa) tag HGT (LGT) Horizontal Gene transfer (= Lateral Gene Transfer) HIP Harvard Institute of Proteomics  HIP FLEXGene Harvard Institute of Proteomics Full-Length EXpresison-ready gene plasmids HPLC High pressure Liquid Chromatography HRP Horseradish Peroxidase Indel Insertions/deletions KEGG Kyoto Encyclopedia of Genes and Genomes K-LARGE L-Arginine/Urea/Ammonia Assay Kit (Megazyme) K-PANOPA Primary Amino Nitrogen Assay Kit (Megazyme) LC Liquid Chromatography LGT (HGT) Lateral gene transfer (= Horizontal Gene Transfer) LiAc Lithium acetate LoFlo Low fluorescence  MFS domain Major facilitator superfamily domain MIPS Munich Information Centre for Protein Sequences MM Mismatch  MoBY-ORF Molecular Barcoded Yeast ORF library mRNA Messenger RNA (ribonucleic acid) MS Mass spectrometry NAT cloNAT, nourseothricin  xvii   Abbreviations Definition NCBI National Center for Biotechnology Information NGS Next-Generation Sequencing NL Deletion (mutant) OE Overexpression (mutant) ORF Open Reading Frames PC Phosphatidylcholine PCR Polymerase Chain Reaction PDMS Polydimethylsiloxane PE Phosphatidyl Ethanolamine PEG Polyethylene Glycol PM Perfect Match PMSF Phenylmethylsulfonyl fluoride (a protease inhibitor) qRT-PCR Quantitative real time PCR RMA Robust multi-array RNA Ribonucleic Acid RNA-seq RNA-sequencing rRNA ribosomal RNA SAGE Serial Analysis of Gene Expression SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis SGA Synthetic Genetic Array SGD Saccharomyces Genome Database shRNA small hairpin RNA SNP Single Nucleotide Polymorphism SPME Solid Phase Micro-Extraction SPX domain 180 residue domain found in SYG1/Pho81/XPR1 SS Single-Stranded TA Titratable Acids TAP-tag Tandem Affinity Purification tag TBST Tris-Buffered Saline and Tween 20 TCA Trichloroacetic Acid TET promoter Tetracycline-controlled transcriptional activator TNP Triple Nucleotide Polymorphism TOR Target of Rapamycin TORC Target of Rapamycin Complex TS mutant Temperature Sensitive mutant WGD Whole Genome Duplication Y2H Yeast two-hybrid library YAN Yeast Assimilable Nitrogen YKO Yeast Knock-out YPD Yeast extract, peptone, dextrose media     1  1. Introduction 1.1 A brief history of Saccharomyces cerevisiae Saccharomyces cerevisiae (S. cerevisiae) is a unicellular budding yeast species of about 5-10 m in length and 1-7 m in width. It is essential to the production of some of the most popular fermented foods including alcoholic beverages and bread. Archeological evidence indicates that S. cerevisiae has been integrated with human lives for thousands of years (Legras et al. 2007; Chambers and Pretorius 2010). Before the development of good microscopes, the fermentation process was thought to be mere chemical reactions instead of a biological phenomenon and was studied only by chemists (Barnett 1998). The first study of yeasts by a biologist, Desmazières (1827), published the drawings of the microbes in beer and named them Mycoderma cerevisiae, where cerevisiae comes from a Latin word for beer. As the taxonomy developed, the yeast species identified in beer were later re-named Saccharomyces cerevisiae, where Saccharomyces means “sugar using fungus” (Barnett 1998). Currently, there are seven species in the genus Saccharomyces, and industrial S. cerevisiae is considered to be highly domesticated, while other species, including its closest relative Saccharomyces paradoxus, are never found in food and beverage fermentation processes (Boynton and Greig 2014). Although some S. cerevisiae strains commonly used in food productions share certain DNA signatures and indicate the significant role that human applications and selections have been playing in their evolutions, whether the whole S. cerevisiae species was derived by human domestication process is highly controversial (Fay and Benavides 2005; Boynton and Greig 2014; Liti 2015). (More on the domestication of S. cerevisiae in Section 1.7.2 and 1.7.3). Fast forwarding 170 years from the discovery of S. cerevisiae, the first complete eukaryotic genome sequence of the most commonly used haploid laboratory S. cerevisiae strain called S288c was accomplished in 1996 (Goffeau et al. 1996). This grandiose genome sequencing project, with the technology available at that time, was achieved through a concerted global effort of hundreds of  2  researchers. The obtained sequence elucidated thousands of novel genes and endorsed the necessity for the human genome project. Many S288c genes (40 - 50 %) were also found to be conserved across evolution including mammals, which has been particularly true for essential genes (Chervitz et al. 1998; Giaever et al. 2002). With this genetic validation as well as its long historical relationship to humans, S. cerevisiae was established as one of the most widely used and successful model eukaryotic organisms.  1.2 Mating types and genetic manipulations in yeast S. cerevisiae is composed of three genetic components, the sizes of which in the reference  S. cerevisiae strain, S288c, are: 1) 16 linear nuclear chromosomes that range in sizes from 230 to 1500 kb (total ~12 Mbp) with ~6000 Open Reading Frames (ORFs), 2) 86 kbp mitochondrial DNA with ~20 genes and 3) 40 - 60 copies (in haploid cells) of 2-micron nuclear plasmids with four genes (Cherry et al. 2012; Chan et al. 2013). S. cerevisiae can stably exist in haploid or diploid status (Engel et al. 2014; Lundblad and Struhl 2008). Genetic manipulation by mating of yeast can be accomplished between heterothallic haploid mating types of a- and -factor producing cells. Heterothallic yeasts have a mutation in the HO gene (HOmothallic switching endonuclease) that prevents mating-type switching and, thus, remain haploid (Jensen et al. 1983; Haber 2012). Homothallic yeast, on the other hand, is wild type at the HO locus and, due to mating type switching, found stably in a diploid status.  Meiosis in diploid cells can usually be induced by nitrogen starvation, forming an ascus with four spores, called a tetrad, each carrying a 1N copy of the genome. Tetrads can then undergo dissection under the microscope to separate out the spores for genetic analysis. Mating between the same mating types can be observed among homothallic cells including self-fertilization with its daughter cell as homothallic cells can go through a mating-type switch. These characteristics of yeast can strategically be used in combination with other genetic techniques such as transformation, where foreign DNA can be introduced, to achieve desired genetic manipulations. With a regeneration time of about ~90 min during logarithmic growth, S. cerevisiae is highly appreciated as a simple and more economical eukaryotic model organism among others to conduct genetic and molecular biology studies.  3  1.3 High-throughput gene functional studies The release of the S288c genomic sequence set an important stepping stone to high-throughput approaches for genetic studies as well as the emergence of functional genomics and systems biology (Goffeau et al. 1996). In functional genomics and systems biology, modularized ‘omics’ data, such as genomics, transcriptomics, proteomics and metabolomics, are reviewed in an integrated manner. Because of its unicellular nature and relative ease of the manipulation of its genetics, yeast cells offer unique and powerful high-throughput approaches to study eukaryotic cells. At the initiation of the S. cerevisiae genome sequencing project in 1989, the functions of approximately 1000 genes had been studied (Mortimer et al. 1989). One of the next challenges that naturally followed the project, therefore, was to characterize the functions of the 5885 ORFs that were initially estimated to potentially code for proteins longer than 100 amino acids (Goffeau et al. 1996) [6604 ORFs are currently registered on SGD (SGD 2015c)]. Deletion or disruption of a gene and studying the associated phenotypes is a powerful approach to characterize gene functions (Giaever and Nislow 2014). A few variations of such gene deletion or gene disruption approach conducted in a comprehensive scale include the use of transposons and transformations (Ross-Macdonald et al. 1999; Winzeler et al. 1999; Giaever et al. 2002). 1.3.1 Yeast knock-out (YKO) collection One valuable resource built through a global scale gene functional study, the Saccharomyces Genome Deletion Project, is a library of more than 21,000 Yeast Knock-out (YKO) mutants with 20-mer unique barcode tags (Giaever et al. 2002). The project was inspired by the first sequencing project, and S. cerevisiae is still the only eukaryotic organism to have such a library for most of its ORFs (Giaever and Nislow 2014). In addition to the profound qualitative and quantitative phenotype investigations conducted with the YKO library, it also harnessed the next stage of functional analyses such as the Synthetic Genetic Array (SGA) method, where the interactions of double gene deletions in S. cerevisiae can be investigated in a high-throughput manner (Tong et al. 2001). These technologies, which have been developed using S.  4  cerevisiae, offer unique methods of high-throughput approaches to study gene functions in eukaryotic cells.  1.3.2 Microarray studies Another high-throughput approach that immediately leveraged on the availability of S. cerevisiae genome sequence and provided researchers with a powerful tool to study global gene expression changes is the whole genome DNA microarray chip technologies (DeRisi et al. 1997; Cho et al. 1998). DNA microarray chips are fabricated either by spotting or printing cDNAs (500-2000 nt) or by in situ synthesis of oligonucleotides on chips. Spotted DNA microarrays can be produced without prior sequence knowledge and can be fabricated with both known and unknown cDNA and PCR fragments. In situ synthesis of DNA microarrays, on the other hand, requires the precise knowledge of the gene or genome sequences. The first commercially produced DNA microarrays called GeneChips by Affymetrix was fabricated by in situ synthesis. This technology was an adaptation of their original microarray technology, which was invented to synthesize peptides on chips to screen for a large number of ligands for potential drug discovery (Lenoir and Giannella 2006). GeneChips contain 25-mer oligonucleotides called probes that are synthesized directly on a chip. Labelled complementary DNA (cDNA) or complementary/anti-sense RNA (cRNA/aRNA) called targets are allowed to hybridize with the probes, and the non-specific hybridizations are removed by washing the chips. The intensities of the signals detected on each spot are converted to the quantitative estimates of the gene expressions. Since the chips can be mass-produced once they are designed, microarray technology offered a more cost effective alternative to another quantitative transcriptomic method frequently used at the time called Serial Analysis of Gene Expression (SAGE) (Velculescu et al. 1995). The first Affymetrix array for S. cerevisiae genome-wide transcriptomic profiling was Ye6100, which came in a four-array set and was fabricated by using the original S. cerevisiae sequence released in 1996. This array provided probe sets for 6100 ORFs. The second array was Yeast Genome S98 Array (YG-S98),  5  which was designed primarily based on the December 1998 version of the Saccharomyces Genome Database (SGD) (Affymetrix 2001). YG-S98 contained ~16 probe pairs per gene representing approximately 7000 sequences: these included the ORFs registered on SGD, those on Munich Information Centre for Protein Sequences (MIPS) that are not regarded as such by SGD, putative ORFs suggested by SAGE, mitochondrial proteins, TY proteins, ORFs on 2 micron plasmids and a small number of ORFs from strains other than S288c. The latest Affymetrix array for S. cerevisiae is Yeast Genome 2.0 Array, which is based on the sequence from GenBank® retrieved in May 2004 (Affymetrix 2004). This array contains 5744 probe sets for 5841 of the 5845 genes present in S. cerevisiae, and each transcript is represented by 11 probe pairs. The coverage of ORFs detected by Yeast Genome 2.0, therefore, is considerably reduced from YG-S98.  A short list of the applications of this hybridization based technology include profiling of gene expression (DeRisi et al. 1997; Cho et al. 1998), detection of strains using the YKO mutants with their unique barcode tags (Winzeler et al. 1999), genome composition analysis (i.e. polymorphism and allelic differences) (Lipshutz, et al. 1999) and comparative genomics (Winzeler et al. 2003). The field of comparative genomics emerged as more genome sequences from different strains and species are revealed. Hybridization array technology substantially accelerated the functional annotations of genes in S. cerevisiae. 1.3.3 RNA-sequencing approach The latest promising high-throughput technology that is currently replacing DNA microarray hybridization technology in transcriptomic analysis is RNA-sequencing (RNA-seq) (Nagalakshmi et al. 2008; Wang et al. 2009). RNA-seq is an application of next-generation sequencing (NGS) technology, which can process a larger set of DNA sequences in parallel at a fraction of the cost than Sanger sequencing. RNA-seq offers a revolutionizing solution to study transcriptomes in organisms with unknown genome sequences. While the hybridization array technology requires good to precise  6  knowledge of an organism’s genomic sequence to design an effective array, RNA-seq can be applied without such pre-existing knowledge. Also, while the transcripts that are not represented by probes cannot be detected by DNA microarrays, similar to SAGE technology, RNA-seq does not have this limitation. However, detection of transcripts that are expressed at scarce level can be challenging and require deep sequencing. As it offers the opportunity to elucidate novel genes and observe transcriptomic changes in organisms without genome sequences, the functions of many more novel and non-annotated genes are expected to be revealed by using RNA-seq. 1.3.4 Summary of other yeast libraries/collections Other high-throughput projects that significantly contributed to the characterization of S. cerevisiae gene functions include a comprehensive GFP-fusion library, which was constructed by O’Shea and her colleagues for the investigation of protein localization (Huh et al. 2003), and a comprehensive yeast two-hybrid library (Y2H), which was conducted by Fields, Rothberg and their colleagues for the investigation of interactions between two proteins (Uetz et al. 2000). A short list of the collections that are available to be used with S. cerevisiae is summarized in Table 1.1. Table 1.1A short list of resources built for S. cerevisiae comprehensive gene functional studies. Libraries/Collections Related Researches and Projects YKO Collection ORFs replaced by KanMX gene with the addition of 20-mer molecular bar codes. Constructed through Saccharomyces Genome Deletion Consortium (Winzeler et al. 1999; Giaever et al. 2002) Yeast-GFP Clone Collection For comprehensive investigation of protein localization. GFP is tagged on C-terminus (Huh et al. 2003) MoBY-ORF Library Molecular Barcoded Yeast ORF (MoBY-ORF) library. A collection in which each gene, controlled by its native promoter and terminator, has been cloned into a centromere based vector along with two unique DNA barcodes (Ho et al. 2009). DAmP Collection Decreased Abundance by mRNA Perturbation (DAmP) collection. Alleles of essential genes with modest growth defects; >950 genes as diploid and >800 genes as haploid. (Breslow et al. 2008) Bar-coded DAmP collection Bar-coded Decreased Abundance mRNA Perturbation (DAmP) collection (Yan et al. 2008). HIP FLEXGene Collection Harvard Institute of Proteomics Full-Length EXpression-ready collection (HIP FLEXGEne). Galactose-inducible gene overexpression plasmids (Hu et al. 2007).   7  Table 1.1 (Continued) Libraries/Collections Related Researches and Projects barFLEX Collection Full-Length EXpression-ready collection HIP FLEXGene plasmids in ~5100 bar-coded yeast strains (Douglas et al. 2012).  The Yeast Transposon Insertion Library Collection Derived by using mini-transposons (nTns) to construct mutagenized a yeast genomic DNA library (Ross-Macdonald et al. 1999) TS mutant collection 250 TS mutants for essential genes. (Ben-Aroya et al. 2008) 787 TS mutants for essential genes (Li et al. 2011) Yeast genomic tiling collection Comprehensive overexpression screens on 2 micron-based LEU2 vector. Total of ~1500 plasmids contain inserts of average ~10 kb. (Jones et al. 2008) Yeast GST-Tagged Collection GST-tag on N-terminus with galactose inducible overexpression promoter (GAL1/10 promoter) (Sopko et al. 2006).  Yeast Kinase YFP Fusion Collection Approximately 120 kinase genes have been cloned with a C-terminal YFP tag and 1 kb upstream sequence (to encompass native promoters) into a Gateway® donor vector (Ma et al. 2008). Yeast ORF collection Moveable ORF library (MORF library). 4900 ORFs have been adapted with Gateway recombination sites and subsequently cloned into a yeast expression vector. Contains C-terminal tag and expressed under the control of GAL promoter. (Gelperin et al. 2005) Yeast Tet-promoters  Hughes Collection Addition of Tet-promoters to 800 essential yeast genes, where addition of doxycycline can turn off the expression (for studying essential genes) (Hughes et al. 2000; Mnaimneh et al. 2004) Yeast-Tap Fusion Library Protein expressions during log-phase were studied by using the library of mutants with TAP-tags on C-terminus (Ghaemmaghami et al. 2003)  1.3.5 Bioinformatics in gene annotation To manage large scale datasets obtained from various strains, species and organisms, the area of bioinformatics has progressively advanced. For example, next generation sequencing relies on bioinformatics to assemble the small DNA sequence reads de novo or by alignment to preexisting sequences. Although the genome of S. cerevisiae is relatively small compared to other eukaryotic organisms, bioinformatics allows effective investigation of high-throughput data as well as extensive data mining.  One popular application used for analysis of high-throughput transcriptomic data is Gene Ontology (GO). GO can be used to assess high-throughput transcriptomic data collected by SAGE, microarrays or RNA-seq for possible GO term enrichment to produce a list of gene functions or pathways that are enriched in a dataset (Ashburner et al. 2000; Christie et al. 2009). GO organizes genes by using three GO term categories: biological process (e.g. DNA repair, signaling), molecular function (e.g. hydrolyase  8  activity, DNA binding) and cellular component (e.g. cytoplasm, nucleus). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis is another useful database to screen for the enrichment of metabolic pathways in a dataset (Kanehisa et al. 2000; Kanehisa et al. 2014). KEGG pathway analysis can produce a visualization of metabolic pathways with wiring diagrams.  Genes that are found in different species and have evolved from a common ancestral gene are referred to as orthologs (Figure 1.1). Orthologs usually retain the same function in the course of evolution. Therefore, finding gene orthologs is also an essential strategy for efficient annotation of newly sequenced genomes as well as extrapolating the newly discovered annotations to organisms that carry the orthologs.    Figure 1.1 Homolog, paralog and ortholog genes. Homolog genes are related genes that share a common ancestral DNA sequence and include both paralog and ortholog genes. Paralog genes are found within a genome and arose from gene duplications. Paralog genes that resulted from whole-genome duplication (WGD) in yeast are specifically referred to as ohnologs. More mutations tend to accumulate in paralog genes as second copy experiences less selective pressure. Paralogs therefore often evolve new functions or become pseudogenes. Orthologs are found in different species and evolved from a common ancestral gene by speciation (e.g. Gene A1 in specie 1 and 2 or gene A2 in specie 1 and 2 are orthologs). Orthologs usually retain the same function and, therefore, are useful in predicting gene functions. The image was created by MS PowerPoint 2013 based on the images and information in Wolfe (2004) and Koonin (2005).   A large number of genes in S. cerevisiae are described on SGD to have orthologs or likely to have orthologs in other yeast species and in more distant organisms such as humans, mouse, fruit flies, and zebrafish. Several functions of S. cerevisiae genes were revealed as a result of their orthologs being  9  characterized in other species and organisms or vice versa (Shani et al. 1995; Tang et al. 1997; Imbach et al. 1999; Devault et al. 2002; Trott and Morano 2003; Gerbasi et al. 2004; Hastie et al. 2006; Ryan et al. 2012). Orthology has also become a new approach to the phylogenetics, which was previously based on morphology and other observable characteristics (Remm et al. 2001; Storm and Sonnhammer 2001). Other useful approaches used for gene functional characterization include analysis of DNA sequence motifs and identification of protein sequence homologies and conserved protein domains. Although small scale experiments to obtain direct evidence will always be required for reliable functional annotations, the predictions of gene functions and higher networks made by bioinformatics are crucial in gaining insights and designing effective experiments to investigate non-annotated genes.  1.4 Current status and challenges with annotation of ORFs Since the first S. cerevisiae sequencing project, several next-generation sequencing methods have been developed. With one of such methods called Illumina HiSequation 36-base sequencing, the S288c genome was officially re-sequenced, which is referred to as “S288C 2010” (Engel et al. 2014). These updates, as well as new information elucidated from other sequencing projects of highly similar strains and species, are constantly entered on SGD (Fisk et al. 2006). It has been almost two decades since the original sequencing of S288c, and the current database now includes small ORFs of below 100 codons that were initially excluded but were later found likely to be functional genes. The addition of these new ORFs to SGD and new data collected from related strains and species and computational predictions continued to improve SGD and refined the “working hypotheses” (Fisk et al. 2006). The current snapshot of the S288c genome is summarized in Table 1.2.  The current annotation status of S288c ORFs on SGD illuminates future directions as well as the challenges in regards to the functional annotations of S. cerevisiae ORFs. Although most ORFs (5136 ORFs or 86.8 %) are now classified as verified (Table 1.2), i.e. have the experimental evidence as a protein-encoding gene, they are not always accompanied by functional annotations (Table 1.3). In fact, many ORFs are still missing GO term annotations (Table 1.3). Caution must be taken, however, to  10  interpret these numbers: 784 ORFs are categorized as dubious ORFs (Table 1.2), the majority of which are associated with unknown GO terms. Since the statistics of GO term summary in Table 1.3 retrieved from SGD do not exclude dubious ORFs, the number of verified or uncharacterized genes associated with unknown GO terms is expected to be roughly ~750 less. Although high-throughput approaches have exponentially increased our understanding of gene functions, a review provided by Peña-Castillo and Hughes (2007) highlights the lack of experimental evidence, especially small scale data, to elucidate the function of all ORFs. One reason that the function of many ORFs still remains to be characterized is that 188 ORFs were added to the database as newly found ORFs, which typically carry a suffix (e.g. YAL001W-A). These ORFs were not included in the high-throughput studies designed by using the initial list of ORFs, and 156 of them are not in the TAP/GFP collections.   Table 1.2 Three S288c ORF categories used on SGD and the snapshot of the current status. (SGD 2015b; SGD 2015c) Categories ORFs Definitions Verified 5136 Has clear experimental evidence that a gene product is produced in S. cerevisiae. Generally have obvious orthologs in one or more other Saccharomyces species. Uncharacterized 684 From the orthologs in other species, likely to code for a gene product, but there are no specific experimental data in S. cerevisiae to be upgraded to verified status.   Dubious 784 Unlikely to encode an expressed protein. ORFs with specific experimental data are included in this category instead of deleting them from the database. Dubious ORFs may meet some or all of the following criteria: 1) the ORF is not conserved in other Saccharomyces species; 2) there is no well-controlled, small-scale, published experimental evidence that a gene product is produced; 3) a phenotype caused by disruption of the ORF can be ascribed to mutation of an overlapping gene; and 4) the ORF does not contain an intron. Total 6604    Table 1.3 Current status of GO terms for all the registered ORFs on SGD. The percent values (%) were calculated by using the total registered ORFs of 6604 (SGD 2015d). The statistics include 784 dubious ORFs.  GO Terms ORFs % Examples Unknown biological processes 1839 27.8 DNA repair, signaling Unknown molecular functions 2661 40.3 Hydrolyase activity, DNA binding Unknown cellular localizations 1415 21.4 cytoplasm, nucleus  11  Another major challenge for the functional annotations of the remaining non-annotated ORFs is the lack of strong phenotypes in the commonly tested conditions.  Several possible factors accounting for the weak phenotypes are: 1) expression of genes under only specific conditions, 2) re-wiring of metabolic pathways to compensate for the introduced mutation, 3) redundancy of genes and 4) expression of genes at specific cell cycle or time point (Peña-Castillo and Hughes 2007). The challenge associated with the expression of genes under specific conditions is hypothesized to arise from the difference between commonly used laboratory media and the native environment, where S. cerevisiae is thought to have originally evolved. Commonly tested conditions such as high salt, high pH, antibiotic resistance and heat sensitivity are not frequently encountered by S. cerevisiae in wild conditions or industrial applications. (The difference between laboratory media and the native environment is further discussed in Section 1.7.2.) The genetic buffering or metabolic plasticity to re-wire or compensate for altered metabolic pathways could lead to weak or no detectable phenotypes by an introduced mutation unless the mutant is analyzed by transcriptomic methods such as SAGE, microarrays or RNA-seq. Similarly, deletion of the redundant gene(s) will not lead to any detectable phenotypes unless both genes are deleted or unless they show strong dosage dependent effects. The SGA technique and its variations to produce double mutants are one approach to study redundant genes, functionally overlapping paralogs and identifying interactomes. By screening the phenotypes of double mutants in various conditions or by deleting the genes that are identified to be involved in genetic buffering by SGA, new functions of annotated and non-annotated genes have been revealed (DeLuna et al. 2008; Bandyopadhyay et al. 2010; Usher et al. 2011).  Combinations of these factors, such as redundant genes expressed in specific conditions that are heavily controlled by genetic buffering, can lead to profound complexities, and well-designed experiments are required to characterize the functions of such genes.  1.5 Lineage of S288c The S. cerevisiae strain used for first eukaryotic genome sequencing project, S288c, was primarily (~88% of its genome) constructed from EM93, a yeast strain isolated from a rotting fig in Central  12  California (Mortimer and Johnston 1986; Engel et al. 2014). The remaining 12 % comes from five different progenitors: two natural isolates (EM126 also isolated from a rotting fig in Central California and NRRL YB-210 isolated from rotting bananas from Costa Rica) and three commercial baking strains (Yeast Foam, FLD and LK) (Mortimer and Johnston 1986; Engel et al. 2014). The majority of commonly used laboratory S. cerevisiae strains were constructed in laboratories from the strains collected approximately 80 years ago and have been maintained on media that are different from their native environments where they originally evolved (Mortimer and Johnston 1986; SGD 2015a). Since yeast also reproduces asexually, and its progenies are virtually clones, mutations can accumulate in the genes that are under no selective pressures. The accumulation of mutations is pointed out to be a possible reason for the lack of phenotypes of some genes/ORFs in laboratory strains (Peña-Castillo and Hughes 2007). Based on the sequencing conducted by Liti et al. (2009), 498 unambiguous single nucleotide polymorphisms (SNPs) were discovered between the Liti et al. (2009) S288c sequence and the reference S288c genome. Although Liti et al. (2009) suggest that the majority of the SNPs are errors in the reference sequence, the possibility that these SNPs arose from mutations that occurred without any noticeable phenotypes cannot be dismissed.  1.5.1 A brief summary of laboratory S. cerevisiae genotypes Frequently used laboratory yeast strains were selected mainly due to historical reasons and, therefore, depending on the research purposes, may not offer an ideal genetic background. S288c, in fact, was found to have some drawbacks such as a low sporulation rate (Deutschbauer and Davis 2005), an inability to grow on maltose (Charron et al. 1986), failure to initiate filamentous growth (Gagiano et al. 2002), and increased petite frequency (Dimitrov et al. 2009). As the genetic variations among S. cerevisiae strains have been elucidated, the strains with the suitable genetic background to achieve different research goals can now be selected. Additionally, the availability of various genome sequences of closely related strains and species revealed the diversity within S. cerevisiae through comparative genomics, and many new ORFs have been discovered. For example, Liti et al. (2009) identified 38 new hypothetical ORFs in their  13  comparative genomics study using 70 S. cerevisiae and S. paradoxus isolates. Using unconventional strains or species, therefore, offers great potential to reveal functions of currently non-annotated ORFs or not well characterized genes.  1.6 Yeast on grapes Without the knowledge of microorganisms, spontaneous fermentation, where yeast was allowed to enter the grape must in uncontrolled manner from the environment, was the initial practice of wine making in the ancient time of around 5400-5000 BC (Neolithic period) (McGovern et al. 1996a; McGovern et al. 1997a; McGovern et al. 1997b; Sicard and Legras 2011). Some wineries retain the practice of spontaneous fermentation as a long kept tradition for their distinctive styles, and new wineries embrace and experiment this romantic idea with more modernized innovative approaches (Pretorius 2000). Surprisingly, S. cerevisiae is only rarely found on grapes, and the number of yeast species detectable on grapes is limited. Commonly found yeast species (99 % of the population) include those belong to Rhodotorula, which has strictly oxidative metabolism, and a few alcohol-sensitive species such as Kloeckera apiculata and Hanseniaspora uvarum (Ribéreau-Gayon et al. 2006a and 2006b). Another such example is a specialized wine commonly known as Noble Rot, which is made from grapes naturally infected with the fungus Botrytis cinerea that become moldy on the vine (Bakker and Clarke 2012b). These microbes found on grapes are unable to ferment the sugar content of the juice to attenuation [defined as a final reducing sugar concentration of <0.2 %w/v (Jacobson 2006; Fugelsang and Edwards 2007a)] (the condition of grape must is described in Section 1.7.2). Only S. cerevisiae and closely related species are sufficiently alcohol resistant to complete the task of making wine. The most common practice to start a wine fermentation, therefore, is by adding one or a mix of a few selected wine S. cerevisiae strain(s). This practice also has an additional benefit of producing consistent wine products. The genetics of wine yeast described in this section will focus on the commonly used commercial wine S. cerevisiae strains.  14  1.6.1 Genetics of wine strains of S. cerevisiae Even within the S. cerevisiae species, a wide diversity in stress tolerance, growth rate and fermentation characteristics are observed likely due to the adaptation of each strain to its niche environments as well as the selective pressure created by human applications (Codón et al. 1998; Donalies et al. 2008; Albertin et al. 2011; Camarasa et al. 2011). Dunn et al. (2005) reported substantial evolutionary differences between laboratory and wine yeasts strains in response to environmental changes. Many strains of S. cerevisiae selected for bread making are not suitable for wine fermentation as they cannot achieve the high alcohol level that the majority of wine S. cerevisiae strains can, and these two industrial groups are known to produce different aromatic profiles (Donalies et al. 2008; Albertin et al. 2011). Although the high ethanol fermenting characteristic is shared between wine and Japanese sake S. cerevisiae strains, these two populations are no more similar than other S. cerevisiae strains and are thought to have evolved at two different events (Fay and Benavides 2005). S. cerevisiae wine strains have high DNA polymorphism as well as interspecific two- and three-way hybridity of different degrees with other commonly used commercial wine Saccharomyces species including S. bayanus, S. kudriavzevii, S. uvarum and S. eubayanus (Bradbury et al. 2006; Bergström et al. 2014; Dequin and Casaregola 2011; Boynton and Greig 2014; Ibáñez et al. 2014). Most S. cerevisiae wine strains are diploid, heterozygous, and homothallic, while homozygous strains and aneuploid strains are found at a lesser extent (Dunn et al. 2005; Bradbury et al. 2006; Legras et al. 2007). Although high genetic diversities such as SNPs, insertions/deletions (indels), presence of novel ORFs, deletion segments, ploidy differences, allelic differences and high copy number variations (CNVs) in subtelomeric regions are observed among S. cerevisiae strains (Borneman et al. 2008; Liti et al. 2009; Schacherer et al. 2009; Borneman et al. 2011a; Dunn et al. 2012), S. cerevisiae wine strains were observed to cluster together when they were analyzed with other S. cerevisiae strains (Ben-Ari et al. 2005; Fay and Benavides 2005; Legras et al. 2007; Liti et al. 2009; Schacherer et al. 2009; Borneman et al. 2011a; Sipiczki 2010; Dunn et al. 2012). Some of the DNA signatures that are responsible for the formation of wine S. cerevisiae  15  clusters include depletion of the tandemly-repeated ASP3 (asparaginase) genes, the tandemly-repeated ENA (sodium transport) genes and HXT9 and HXT11  (hexose transporters) (Lashkari et al. 1997; Dunn et al. 2005; League et al. 2012), amplification of regions containing AAD3 (aryl-alcohol dehydrogenase) and ADH7 (alcohol dehydrogenase) (Dunn et al. 2005), similarity in subtelomeric CNV patterns (Dunn et al. 2012) and unique chromosomal regions gained through horizontal gene transfer (HGT) [also called lateral gene transfer (LGT)] (Novo et al. 2009; Borneman et al. 2011a; Borneman et al. 2011b).  1.6.2 Horizontal gene transfer in wine strains of S. cerevisiae HGT is the transmission of portions of genomic DNA between organisms in a manner decoupled from the vertical transfer, where the transmission of genes occurs from parental generation to offspring via sexual or asexual reproduction. Novo et al. (2009) sequenced the genome of a widely used wine S. cerevisiae strain called EC1118 and identified three unique regions (total 120 kb) containing 34 ORFs that are likely involved in key wine fermentation functions such as carbon and nitrogen metabolism and stress response. The phylogeny and synteny analyses they conducted demonstrated that one of these regions may have originated from a closely related Saccharomyces species while two others are considered to be from non-Saccharomyces species, likely Zygosaccharomyces and Kluyveromyces (Novo et al. 2009). The region that was originally speculated to be from a closely related Saccharomyces species was recently identified to originate from Torulaspora microellipsoides (Marsit et al. 2015a; Marsit et al. 2015b). The segment speculated to be from Zygosaccahromyces is highly conserved among wine strains including RM11-1a, AWRI631, AWRI796, Lalvin QA23, VL3 and VIN13 as well as non-wine S. cerevisiae strains such as YJM789 (clinical isolate) and JAY291 (bioethanol strain) (Novo et al. 2009; Borneman et al. 2011a). Borneman et al. (2011a) suggest an alternative possibility that this segment which is conserved in some S. cerevisiae strains and matches with Zygosaccharomcyes genomic sequence was originally transferred from S. cerevisiae to Zygosaccharomyces and was lost in some S. cerevisiae strains such as S288c. Since wine strains may carry all or some of these unique regions in varying number of copies and at varying genomic loci, a sequence transfer through the formation of circular episome is  16  suggested (Borneman et al. 2011a; Galeote et al. 2011).  When wine strains were clustered based on these unique HGT regions, similar strains such as “Champagne/Flor yeasts” (flor yeasts = film forming indigenous yeast often found on the surface of sherry wines) and “Wine/European” were found to form groups (Galeote et al. 2011). Also, these segments may exist in multiples, resulting in different ORF copy numbers on the HGT segments among wine strains (Galeote et al. 2011). These wine S. cerevisiae unique features are thought suggested to have promoted their high fitness in wine fermentation and played an important role in their fast adaptive characteristics (Sipiczki 2010). 1.7 Wine fermentation with S. cerevisiae A brief summary of fermentation (non-oxidative) and aerobic respiration (oxidative) pathways are shown in Figure 1.2. The wine fermentation process is usually conducted in closed containers or tanks and occurs under anaerobic conditions. The oxygen that is initially dissolved in the grape must and present in the headspace is quickly depleted within 24 hours of the fermentation (fermentation in the aerobic and anaerobic environment is described in Section 1.7.1). Preventing any introduction of oxygen is extremely important especially for white wines, as it leads to oxidative and enzymatic browning. Although S. cerevisiae is well suited for wine fermentation as it can thrive under anaerobic conditions, S. cerevisiae cell division is only finite without oxygen. Synthesis of some compounds such as lanosterol, ergosterol and unsaturated fatty acyl coenzyme A esters requires oxygen, and, without it, these compounds become scarce each time a S. cerevisiae cell buds and divides to produce a daughter cell (Walker 1998; Ribéreau-Gayon et al. 2006a). Since sterols play an important role in membrane permeability, especially in an environment where high ethanol concentration (14-15 %v/v in wine) affects the membrane integrity, the addition of these compounds can increase the viability of yeasts and help to avoid sluggish or stuck fermentations (Lafon-Lafourcade et al. 1979). Although some grapes supply a portion of the lipids from their cuticular waxes and replace the yeast’s requirement for ergosterol (Bréchot et al. 1971), it is highly desirable to grow yeast under aerobic conditions prior to wine fermentation so that the plasma membrane is densely packed with these compounds. The level of sterols also influences  17  wine characteristics as sterols affect the synthesis of volatile odor and flavor compounds (Mauricio et al. 1997).    Figure 1.2 A schematic pathways of fermentation (non-oxidative) and aerobic respiration (oxidative) in S. cerevisiae. The fermentation pathway occurs in the cytosol, and the respiratory pathway occurs in mitochondria. The image was created with MS PowerPoint 2013 based on the images and information in Piškura et al. (2006), Faria-Oliveira et al. (2015) and Morton (1980).  1.7.1 Fermentation in aerobic and anaerobic environments Although wine fermentation is usually carried out without aeration, S. cerevisiae does not always require an anaerobic environment to produce ethanol through its non-oxidative fermentation pathway. It was initially believed that the presence of oxygen inhibits the fermentation process in yeast; the phenomenon observed by Louis Pasteur in 1857 and named as the Pasteur Effect. However, in 1929, Herbert G. Crabtree reported that S. cerevisiae produces ethanol under aerobic conditions when the  18  glucose concentration is high, which is referred to as the Crabtree Effect. Although these phenomena may appear to contradict each other, they are both true, and which phenotype a yeast strain exhibits depends on the strain’s genetic composition (Pronk et al. 1996; Lutfiyya et al. 1998; Otterstedt et al. 2004; Merico et al. 2007; Westholm et al. 2008; Lewis and Gasch 2012). In Crabtree positive strains, the overflow in sugar metabolism is identified to be the underlying mechanism of aerobic alcoholic fermentation (Hagman and Piškur 2015, Marsit and Dequin 2015a). The oxidative pathway is usually considered to be the preferred pathway as it results in more net ATPs (18 ATPs) than the fermentation pathway (2 ATPs) (Figure 1.2). The Crabtree-positive trait, on the other hand, is considered to be the result of adaptation to high sugar environments, where creation of a high alcohol and low pH environment deter other competing organisms (Pfeiffer and Morley 2014; Goddard and Greig 2015). The production of ethanol, heat and CO2, two of latter are also produced at a higher rate during fermentation process than the aerobic respiration process. Since S. cerevisiae has a better tolerance to the harsh environment resulting from its own fermentation process, switching to a fermentation pathway may fight off other competing organisms. Once the sugar is depleted, however, S. cerevisiae starts metabolizing ethanol when oxygen is available (Sicard and Legras 2011). Depending on the tradition and practical reasons including prevention of oxidation and off-flavors and loss of aromatic compounds, alcoholic beverages are produced in both aerobic and anaerobic environments.  1.7.2 Comparison of YPD and grape must Compared to commonly used laboratory media such as YPD (1 % w/v yeast extract, 2 % w/v peptone, 2 % w/v dextrose), grape must is a much more challenging environment for S. cerevisiae survival. The sugar level in grape must is usually above 20 % w/v up to as high as 45 % w/v in the case of ice wines. Winemakers are leaving their fruit longer on the vine to develop stronger flavor precursors in recent years, which leads to higher sugar levels (Wineanorak 2015a; Wineanorak 2015b; Davies 2014). To prevent the growth of unwanted organisms as well as to prevent oxidative browning, sulfur dioxide (SO2) producing sulfites are often added before initiating fermentation, which is another stress factor for microorganisms  19  including S. cerevisiae (Figure 1.3). Also, the pH of grape must can be as low as 2.9 – 3.8 (below 3.4 is recommended) (Richter et al. 2012; Jackson 2014), while that of YPD usually is around 4.0 – 6.0. Keeping the pH low is another important factor to suppress the growth of unwanted microorganisms that may have entered the wine making process. Depending on the growing season, grape must may have limited nutrients including nitrogen, vitamins and minerals. Especially in the case of white wines, these nutrients may not meet the minimum requirements of yeast to complete the fermentation. Therefore, commercially pre-blended fermentation supplements are commonly available and used to prevent sluggish or prematurely stopped fermentations (referred to as “stuck fermentation”). The harsh environment of wine making, however, is highly desirable for producing good wines by limiting contamination by spoilage microorganisms. 1.7.3 Selective pressure of grape must and hybridization rate in wine yeasts The challenging environment of wine making is considered to have been a strong selective pressure for facilitating the evolution of domesticated S. cerevisiae wine strains. The domestication process has been suggested to increase the phenotypic diversity of domesticated S. cerevisiae as seen in the morphological diversity of dogs (Boynton and Greig 2014). Although the genome sequence diversity is lower than its closely related wild species called S. paradoxus, S. cerevisiae shows higher variation in gene count (i.e. the presence and/or absence of genes and copy number variations) (Bergström et al. 2014), and more hybrid strains are commonly found in the commercial S. cerevisiae than in the wild Saccharomyces species (Boynton and Greig 2014).  Since laboratory-produced hybrids were reported to have better fitness in extremely stressful environments than their parental species, it is highly likely that the man-made wine fermentation environment acted as a selective pressure for a higher spontaneous hybridization rate among wine yeasts (Boynton and Greig 2014).   20   Figure 1.3 Typical flow of wine making. The major difference between red and white wines is the maceration step, where the red colour is extracted from the skin. The image was created with MS PowerPoint 2013 based on the images and information available in Bakker and Clarke (2012c) and Zoecklein (2006).  1.7.4 Sluggish or stuck fermentations Sluggish or stuck fermentation, where fermentation prematurely stops with a high level of residual fermentable sugars, is a common problem that wine makers face as wine fermentation is conducted in a high sugar and nutrient scarce conditions. However, the addition of too many nutrients should be avoided as unused nutrients can easily lead to contaminations and off-flavors. The wine at the end of fermentation should ideally be a “nutrient desert” (Fugelsang and Edwards 2007b), and a fine balance is required to achieve such a condition at the end. Another characteristic often observed among wine yeast is a low to  21  no flocculation rate. Although fast sedimentation at the end of fermentation is desirable for fast clarification, if sedimentation occurs too early during fermentation, it will lead to sluggish/stuck fermentations (Dequin 2001; Bauer et al. 2010; Soares 2010; Govender et al. 2011). This is because yeast will settle to the bottom of the fermentation vessel, leading to the diminished contact with the fermentable sugars. The ideal sedimentation/flocculation characteristics at the end of fermentation without premature sedimentation/flocculation in wine S. cerevisiae continues to be investigated (Romano et al. 1985; Bidard et al. 1994; Shinohara et al. 1997; Govender et al. 2011). The favorable characteristics related to yeast wine fermentation kinetics is summarized in Table 1.4. Table 1.4 Summary of favorable wine yeast fermentation kinetics.  Characteristics In measurable terms Reasoning Rapid initiation Short lag phase Rapid growth Tolerance to high osmotic pressure Prevents contamination. Out-grows any contaminants. Achieves hypoxic environment fast to prevent any oxidation. High fermentation efficiency Tolerance to high ethanol Tolerance to low pH Growth at low/high temperatures Prevents sluggish/stuck fermentation.  1.7.5 Global transcriptomic changes in wine S. cerevisiae during wine fermentation Global transcriptomic analysis conducted with industrial S. cerevisiae wine strains under wine fermentation conditions uncovered underlying drastic and specific gene expression changes that S. cerevisiae exhibits during enological fermentation to deal with the challenging environment (Backhus et al. 2001; Rossignol et al. 2003; Varela et al. 2005; Salvadó et al. 2007; Marks et al. 2008; Rossignol et al. 2008; Rossouw and Bauer 2009; Rossouw et al. 2009; Rossouw et al. 2010). The metabolic pathways and groups of genes that are consistently observed to show substantial changes during wine fermentation in various transcriptomic studies include glycolysis and ethanol production pathways, nitrogen and sulfur metabolism pathways and several groups of transporters such as uptake of amino acids and sterols (Backhus et al. 2001; Rossignol et al. 2003; Rossouw et al. 2009; Rossouw and Bauer 2009). Genes involved in biotin biosynthesis were reported to be upregulated at the beginning of fermentation (Backhus et al. 2001; Rossignol et al. 2003) as well as those involved in ergosterol uptake, thiamine biosynthesis,  22  anaerobiosis and stress response were also observed to be upregulated during fermentation (Rossignol et al. 2003; Varela et al. 2005; Rossouw and Bauer 2009). Using a synthetic grape juice medium, a low nitrogen level was found to shift the carbon metabolism from a fermentation pathway to an oxidative pathway (Backhus et al. 2001; Rossignol et al. 2003). This slight metabolic shift from an alcoholic fermentation pathway to oxidative carbon metabolism is also observed at the end of fermentation when nitrogen is depleted and lead to speculation that the alcoholic fermentation has higher nitrogen requirements than the oxidative carbon metabolism. Several genes that are likely involved in stuck fermentation caused by nitrogen-limitation were also identified (Backhus et al. 2001). One such gene was RGS2, a negative regulator of glucose-induced cAMP signaling to the external nutrients (Versele et al. 1999). Higher expression of RGS2 in low nitrogen conditions represses the response to glucose and causes arrest of fermentation pathways (Backhus et al. 2001). Cells in stuck fermentation due to nitrogen depletion, therefore, are in the stationary phase and experience a wide array of changes in their metabolic pathways, which suggests a mechanism to why simple addition of more nitrogen cannot re-initiate the fermentation. Although not a lot of cellular activities were thought to be happening at the end of wine fermentations, using SAGE, Varela et al. (2005) reported a high increase in the number of new transcripts in late stationary phase, where the ethanol concentration was at around 12 % v/v. The transcripts detected at the end of fermentation included various novel transcripts, and Varela et al. (2005) speculate that the harsh environment towards the end of fermentation, which is remote from the frequently used laboratory conditions, accounts for such discoveries. 1.7.6 Wine flavor properties influenced by yeast To describe the smell of wine, terms such as “nose,” “note,” “aroma” and “bouquet” are often used in wine tasting. Although they all point to the smell of wine, “aroma” is often used to describe the varietal characteristics in young wines that are not intended for aging (e.g. lychee aroma) and “bouquet” to  23  describe more complex fermentation character that arise from chemical reactions between acids, sugars, alcohols and phenolic compounds as ageing process takes (e.g. dark chocolate bouquet) (Peynaud 1996; Bakker and Clarke 2012d). “Nose” and “note” are used interchangeably to describe the smell in general. The science of wine aroma or bouquet is highly complex, dynamic and transient. Some compounds are formed by chemical reactions in wine, which are affected by a myriad of factors including pH, temperature and the presence or absence of enzymes produced by yeast (Bakker and Clarke 2012d ; Carrau et al. 2007; Bisson and Karpel 2010; Cordente et al. 2012; Rollero et al. 2015). Therefore, winemakers experiment with various methods to achieve desirable flavor profiles including off- and on-lees (i.e. Sur Lie) maturations, cold stabilization at near freezing temperature, heat stabilization around ~60 °C, oak barrel ageing and bottle ageing. The recent effort to characterize flavor phenotypes of wine S. cerevisiae strains with associated transcriptomic profiles is leading to the identification of some sets of genes that appear to be crucial in understanding the mechanisms of the formation of flavor compounds in wine (Cordente et al. 2012; Gamero et al. 2015; Rossouw et al. 2008; Rossouw et al. 2012; Styger et al. 2011a; Styger et al. 2011; Styger et al. 2013). However, defining the specific genes responsible for specific wine flavors is challenging due to its complexity (Bisson and Karpel 2010). The major groups of aroma compounds found in wine are monoterpenes, norisoprenoids, aliphatics, higher alcohols, esters, phenylpropanoids, methoxypyrazines and volatile sulfurs (Robinson et al. 2014). Unlike longer fatty acids, shorter fatty acids are volatile, and 90 % of this class in wine is comprised of acetic acid (Robinson et al. 2014). Esters are usually the most encouraged aromatic compound in wine as they often contribute pleasant sweet-fruity aromas. Esters represent the greatest concentration of volatiles in alcoholic beverages. Yeast also produces various higher alcohols by catabolism of amino acids via the Ehrlich pathway. Branched-chain higher alcohols are synthesized from branched-chain amino acids and often contribute solvent-like fermented aroma at high concentrations. Sulfur-containing volatile compounds have long been recognized as off-notes; however, a number of volatile thiols have recently been shown to impart pleasant herbaceous, fruity, mineral, smoky and toasty aromas in wine (Robinson et  24  al. 2014). The science of aroma is complex, for human perception can be subjective, and it also depends on the concentrations as well as the interaction with other compounds. Therefore, aromas that are usually considered as wine faults at high concentration may play an important role at low concentrations and should not be completely eliminated. The common flavor active compounds produced by yeast or formed from their metabolites are summarized in Table 1.5.   Table 1.5 Common flavor-active compounds produced by S. cerevisiae or produced as a result of chemical reactions between the metabolites. (F) = commonly recognized for causing wine fault. (Styger et al. 2011; Cordente et al. 2012; Robinson et al. 2014) Compounds Descriptions of Odour Esters Ethyl acetate [Low] Sweet pear like aroma, [High] (F) Nail-polish remover Ethyl butyrate Tropical fruits, mango, tinned pineapple Ethyl hexanoate Flowery/fruity, pineapple, blackberry, apple-peel, strawberry Ethyl octanoate Sweet, fruity, apricot, banana, brandy, pear Ethyl decanoate Sweet, fruity, apple, grape, brandy Hexyl acetate Fruity, sweet, apple and pear, banana peel Isoamyl acetate Sweet, banana, fruity Isobutyl acetate Sweet, fruity, tropical Phenylethyl acetate Floral, rose, sweet, honey 2-phenyl acetate Rose, honey, flowery Ethyl isovalerate Apple, fruity Fatty acids Acetic acid (F) Vinegar  Isobutyric acid Acidic  Isovaleric acid Sweet, apple-like [High] (F) Stale cheese or sweaty socks Butyric acid (F) Rancid butter or baby vomit  Propanoic acid Pungent, acidic, cheesy, vinegar Hexanoic acid Sour, fatty, sweat, cheese Octanoic acid Fatty, waxy, rancid, oily, vegetable, cheesy Decanoic acid [Low] citrus, [High] (F) Unpleasant, rancid, sour, fatty Higher alcohols and branched-chain higher alcohols 2-phenylethanol Flowery, rose Isobutanol Fruity, alcohol, solvent like Amyl alcohol (active) Marzipan (almond) Isoamyl alcohol Fusel oil, alcoholic, cognac Isobutyl alcohol winey, whiskey        25  Table 1.5 (Continued) Compounds Descriptions of Odor Sulfur containing compounds Methanthiol (F) Vegetable oil, eggy, decomposing cabbage, garlic Hydrogen sulfide (F) Rotten eggs or garlic that has gone bad Sulfur dioxide (F) Burnt matches Dimethyl sulfide (F) Cooked cabbage, canned corn asparagus  Ethyl mercaptan (F) Skunk, garlic, cabbage Others Acetaldehyde (F) Roasted nuts or dried out straw Diacetyl (F) Buttery  Other flavor active compounds in wine including terpenes are derived from grapes. The level of these grape-origin flavor compounds, however, can still be influenced by yeast, as they produce enzymes (e.g. glycosidase) that help to release the compounds from the fruits. The degree to which these enzymes are produced depends on the strains, and these phenotypes also play a role in yeast selections by wine makers.   Another crucial flavor aspect of wine is ‘mouthfeel’ or ‘body,’ which is the perceived viscosity of the liquid. Various compounds are known to affect wine’s mouthfeel including hydrophilic proline-rich protein-phenol complex and anthocyanins, which contribute astringency (Bakker and Clarke 2012a). One important yeast metabolite that contributes a positive and smooth mouthfeel is glycerol (Figure 1.2). Besides contributing to the body, glycerol also adds a sugary flavor similar to glucose and plays an important organoleptic role in wine (Ribéreau-Gayon et al. 2006e). High glycerol producing yeast strains or improving glycerol production in yeast, therefore, are usually considered desirable. 1.8 Previous studies on non-annotated ORFs/genes using wine yeast and wine fermentation in the van Vuuren laboratory While the phenotypes of most ORFs in S. cerevisiae have been successfully observed through various classical and high-throughput studies, characterization of the remaining non-annotated ORFs has been challenging (The current status of ORFs in S. cerevisiae is summarized in Section 1.4.). The approach to use native conditions, where S. cerevisiae is thought to have originally evolved, was suggested by Peña- 26  Castillo and Hughes (2007) to investigate remaining uncharacterized ORFs. Such studies have been successful in revealing phenotypes and functions of several non-annotated ORFs (Walkey et al. 2011; Walkey et al. 2012; Luo et al. 2013).  Previously in the van Vuuren laboratory, Marks et al. (2008) conducted a global transcriptomic study of ORFs during Riesling wine fermentation using Affymetrix Yeast Genome S98 Chips and a commercial wine S. cerevisiae strain, VIN13. The ORFs were clustered into 20 different groups based on expression behavior over the course of a 15 day fermentation. In this study, Marks et al. (2008) discovered that yeast cells respond to the challenging condition of wine fermentation by alteration of their transcriptomes, and 223 genes that increased in expression by at least 4-fold were named fermentation stress response genes (FSR). The investigation of non-annotated ORFs/genes amongst the FSR genes during fermentation successfully lead to discoveries of IGD1, a cytoplasmic protein that inhibits Gdb1p glycogen debranching activity, and AAF1, a transcription factor that regulates acetate production (Walkey et al. 2011; Walkey et al. 2012; Luo et al. 2013).  1.9 Research proposal 1.9.1 Research hypotheses Gene functional studies using non-laboratory yeast strains using non-laboratory conditions have led to the identification of novel ORFs and functions that are important for industrial applications of S. cerevisiae. Based on the literature review and the previous studies conducted in van Vuuren laboratory, the hypotheses for my research are the following: H1) Some ORFs/genes in S. cerevisiae have evolved to survive stresses found in industrial applications such as wine fermentation, and their functions, therefore, can be elucidated by mimicking such conditions rather than using laboratory media.  27  H2) Using a non-laboratory S. cerevisiae strain will lead to the successful characterization of the non-annotated ORFs/genes as relevant genes have likely been mutated and lost phenotypes in the laboratory S. cerevisiae strain. H3) Novel ORFs/genes identified in wine S. cerevisiae strains likely play important roles in wine fermentations.   1.9.2 Enoferm M2 in genetic studies Previously, Bradbury et al. (2006) investigated homo- or heterozygosity and ploidy status of 45 commercial wine yeast strains. A popular S. cerevisiae strain called Enoferm M2 was found to be diploid and highly homozygous. This strain is also known to be highly amenable to genetic modifications and has successfully been used in various genetic studies in wine fermentations (Walkey et al. 2011; Walkey et al. 2012; Luo et al. 2013). 1.9.3 Chardonnay wine fermentation for genetic studies In the van Vuuren laboratory, the use of white wine fermentation was observed to be suitable for yeast gene functional studies as a maceration step is not required, and there is less interference from the background (i.e. grape origin) volatile compounds. Chardonnay is a white grape variety that is grown in almost all wine making regions of the new world (i.e. outside the traditional wine growing areas of Europe and the Middle East), and Chardonnay wine is also highly consumed (Gambetta et al. 2014). Here in British Columbia, Chardonnay grapes are also one of the top three white wine grape varietals cultivated in terms of acreage (Mount Kobau Wine Services 2014). The worldly success of the Chardonnay variety is partly due the fact that it can adapt relatively easily to all sorts of environmental conditions and produce good wines without losing the varietal characteristics but is malleable enough to reflect the impression of its terroir, yeast strains and the experience of winemakers (Chardonnay-du-Monde 2015).  28  1.9.4 Research objectives To test the research hypotheses (Section 1.9.1), the use of Enoferm M2 and Chardonnay fermentation are deemed suitable as described in Section 1.9.2 and 1.9.3. Non-annotated ORFs and not well characterized genes from the FSR dataset were previously investigated in the van Vuuren laboratory (Marks et al. 2008; Walkey et al. 2011; Walkey et al. 2012; Luo et al. 2013). For this research project, therefore, non-annotated ORFs/genes that were clustered by Marks et al. (2008) in Cluster 7 and Cluster 13 with PKC1 and PGK1 as seed genes, respectively, will be investigated. PKC1 is a serine/threonine kinase and is essential for cell wall remodeling during growth (Levin et al. 1994; Watanabe et al. 1994).  Genes in Cluster 7, which are represented by PKC1 expression showed a gradual mild increase over the course of fermentation. PGK1 is a 3-phosphoglycerate kinase and is a key enzyme in glycolysis and gluconeogenesis (Hitzeman et al. 1980; Blake and Rice 1981). Genes in Cluster 13, which is represented by PGK1 were constitutively expressed over the course of fermentation.  The genome sequence of M2 was first obtained by the Gardner laboratory and then re-sequenced by the van Vuuren laboratory (unpublished). Eight novel ORFs that are not found in the S288c reference genome but are conserved among wine strains were identified in M2 by the Gardner laboratory, and their sequence information was kindly made available for this study. Therefore, a similar approach to the investigation of non-annotated ORFs in Cluster 7 and 13 is taken to investigate the functions of these novel ORFs.  My research objectives to test the hypotheses (Section 1.9.1) are the following: O1) Investigate the phenotypes of non-annotated ORFs/genes by using Enoferm M2 and Chardonnay fermentation O2) Investigate the phenotypes of conserved novel ORFs/genes found in Enoferm M2 using Chardonnay fermentation  29  The data for M2 genome re-sequencing by the van Vuuren laboratory was obtained during the project, and we suspected that there may be more novel ORFs in M2. Therefore, the following hypothesis and objective are included in this study:  H4)    Enoferm M2 is likely to carry more than eight novel ORFs O3) Search for more novel ORFs in M2 genome sequence contigs obtained by the van Vuuren laboratory   30  2. Materials and Methods 2.1 Construction of mutants for this study All the mutant strains used in this study were constructed from a commonly used commercial wine S. cerevisiae strain called Enoferm M2 (a gift from Dr. Richard C. Gardner at The University of Auckland, NZ); M2 was originally isolated in Stellenbosch, South Africa and was selected from the Massey University (New Zealand) culture collection (Culture# M182) by Lallemand to be sold as commercial active dry yeast (ADY) (Lallemand 2012; Lallemand 2015). M2 is recommended as a general purpose wine yeast for a wide range of red, white and rosé wines. It is described to produce neutral to low aroma, has potential to produce high concentration of succinic acid under unknown conditions, contributes significantly to the mouthfeel that is not attributed to glycerol production, and is sensitive to sulfur dioxide (SO2) at pH 3.2 or lower. In some literature, M2 is described to be the same or highly similar to AWRI 796 (Maurivin, AB Mauri Australia) and WE372 (Anchor, South Africa), however, whether they are the exact same strain is unclear (Sundstrom and Jiranek 2013; Roncoroni et al. 2013). The genotype of M2 is shown in Table A.1, and that of all the mutants used in this study are listed in Appendix A. The M2 strain was previously used in similar studies, where null mutants of 62 uncharacterized FSR genes, identified by Marks et al. (2008), were investigated for their functions during wine fermentations (Walkey et al. 2011; Walkey et al., 2012; Luo et al. 2013). The M2 strain has been shown to be a homozygous diploid (Bradbury et al. 2006; Deed et al. 2011), homothallic and has been observed to have high sporulation and transformation rate, which are suitable characteristics for genetic manipulations. 2.1.1 PCR amplification of cassettes to construct null mutants In order to construct the null mutants, the start codon to termination codon of target genes or ORFs were replaced with the Geneticin-resistance gene (kanMX4) by transformation followed by homologous recombination, unless the use of another antibiotic resistance gene was required (Figure 2.1) (The method of transformation is described in Section 2.1.3.). The oligonucleotide sequences and the plasmid  31  templates used in this study are listed in Appendix B. The kanMX4 gene from pUG6 (Güldener et al. 1996), hygromycin-resistance gene (hphMX4) from pAG32 and cloNAT-resistance gene (natMX4) from pAG25 (Goldstein and McCusker 1999) were amplified by PCR. The PCR primers were designed to have 20 nucleotides at the 3’ end to amplify the cassette and 60 gene/ORF-specific nucleotides at the 5’ end that match with the up- and downstream of the start and stop codons, respectively. Since the M2 genome sequence was not available at the beginning of this study, the 60 gene/ORF-specific sequences were obtained from the S288c reference sequence available on SGD. The ORFs that were not successfully deleted for unknown reasons (i.e. not due to affecting the essential gene(s)) were later checked against M2 genome sequence when it became available. iProof High-Fidelity DNA Polymerase (Bio-Rad Laboratories, Hercules, CA) was used for all PCR cassette amplifications. All the amplified cassettes were confirmed to have the expected migration size by running on 1 % agarose gels with 1 kb DNA ladder as a standard.    Figure 2.1 Schematic diagram of the construction of null mutants. (a) PCR cassette amplifications from a plasmid using forward and reverse primers with a 60 bp gene/ORF-specific overhang and 20 bp plasmid specific sequences. (b) Homologous recombination on the nuclear chromosome at a target ORF. PTEF1 = TEF1 promoter, TTEF1 = TEF1 terminator, TER = termination codon. The image was created with MS PowerPoint 2013.   32  2.1.2 PCR amplification of cassettes to construct overexpression mutants To construct overexpression mutants, the promoter region of the PGK1 gene was inserted at the immediate 5’ end of the start codon by homologous recombination (Figure 2.2). Previously, insertion of 788 bp upstream of the PGK1 gene linked to kanMx4 was successfully used for overexpression of genes in M2 (Walkey et al. 2012; Luo et al. 2013; Walkey et al. 2015). The PCR primers contained 22-29 bases at the 3’ end to amplify the cassette from pCW1 (Walkey et al. 2012) and 60 gene/ORF-specific nucleotides at the 5’ end from immediately up- and downstream of the start codon.     Figure 2.2 Schematic diagram of homologous recombination for the construction of overexpression mutants. PCR cassettes were amplified by using pCW1as the template. (a) Homologous recombination on a nuclear chromosome at a target ORF. (b) Insertion of PGK1 promoter immediately upstream of the start codon of the target ORF. PTEF1 = TEF1 promoter, TTEF1 = TEF1 terminator, TER = termination codon. The image was created with MS PowerPoint 2013.  2.1.3 Yeast transformation The amplified DNA gene knockout cassettes were introduced to yeast cells by a standard lithium acetate/single-stranded carrier DNA/polyethylene glycol (LiAc/SS-Carrier DNA/PEG) transformation method with 20 min heat shock at 42 °C (Schiestl and Gietz 1989; Gietz et al. 1995). Cells were grown to mid-log phase (OD600 = 1.0-1.5) in YPD media and were incubated in 100 mM LiAc  (Sigma-Aldrich, St. Louis, MI) for 10 min at 30 ⁰C to make them competent. The competent cells were immediately used for transformation with the appropriate cassettes and salmon sperm SS-carrier DNA (Invitrogen, Waltham,  33  MA) suspended in PEG3350 (Sigma-Aldrich) and LiAc. The recombinants were selected by the appropriate antibiotic selection [200 g/ml Geneticin (Life Technologies, Waltham, MA), 300 g/ml Hygromycin B (Invitrogen), and/or 100 g/ml cloNAT (Werner BioAgents, Jena, Germany)], and several colonies growing on the selection plates were confirmed for the correct integration by colony PCR using DreamTaq Green PCR Master Mix ( Life Technologies). The primers for colony PCR are listed in Appendix B. The amplified nucleic acids were confirmed to have the expected migration pattern on a 1 % agarose gel as described above for the confirmation of the knockout cassette PCR amplification.    The heterozygous diploid recombinants were sporulated on 1 % potassium acetate (Sigma-Aldrich) sporulation plates and tetrad dissected to construct homozygous diploid mutant strains. M2 is homothallic and goes through mating type switching and eventual mating with its own daughter cell after tetrad dissection. Cell walls of the spores were digested with 100 units /ml Zymolyase 100T (Seikagaku Corp., Tokyo, Japan) for 10 min at 30 °C. Tetrad dissections were performed on YPD agar plates. Tetrad dissected colonies were selected by the appropriate antibiotic selection, and several colonies were tested for homozygosity by colony PCR with the presence and absence of mutant and wild type bands, respectively. 2.2 Storage of yeast All the strains used in the projects were grown in YPD media (1 % yeast extract, 2 % peptone, 2 % dextrose, MP Biomedicals, Santa Ana, CA) unless otherwise specified, and stored at -80 °C with the addition of glycerol to a final concentration of 15 % v/v. 2.3 Wine fermentation The fermentation procedure was carried out at 19 ⁰C as described in previous studies by using 70 ml of filter sterilized Chardonnay grape must (23.4 Brix, pH 3.48, TA 0.57 g/L, SO2 50 ppm) (Scarlett Ranch Chardonnay from Lanza Vineyard in Suisun Valley California, M & M Wine Grape Co, CT) (Walkey et  34  al. 2011; Walkey et al. 2012; Luo et al. 2013; Walkey et al. 2015). The grape must came in plastic pail containers and were transferred to 1 L screw top glass bottles for storage in -80 °C.  Although, theoretically speaking, the must from the same pail should be exactly the same, they were pooled together and the same batch of the must was used for each experimental group for consistency. The grape must usually contained ~13 % w/v each of glucose and fructose (total ~26 % w/v) and were tested for Yeast Assimilable Nitrogen (YAN) using a Primary Amino Nitrogen Assay Kit (K-PANOPA) and L-Arginine/Urea/Ammonia Assay Kit (K-LARGE) (Megazyme, Wicklow, Ireland). Only grape must with a minimal YAN level of 200 mg/L was used. Fermentations were usually conducted with a manageable number of ~10 strains in triplicates, unless otherwise specified, without any additional nutrients. To prepare yeast for fermentation, the overnight culture was diluted to OD600 = 0.3, and cells were grown for 2-3 generations to mid-log phase (OD600 = 0.8-1.2) in YPD media at 30 °C under aerobic conditions with shaking (~ 3 hrs). Cells were then centrifuged and inoculated in the grape must to achieve OD600 = 0.2 to initiate the fermentation. Fermentation vials were closed off with rubber bungs with S-shaped airlocks, filled with 4 ml of sterile water to prevent any contamination as well as to maintain an anaerobic environment.   The fermentation progress was followed by the weight change. Commercial Chardonnay fermentations usually take approximately 2-3 weeks following on- or off-lees maturation and/or secondary fermentation such as malolactic fermentation depending on the winemakers (Lea and Piggott 2003). Since the difference in fermentation speed can be analyzed from the recorded weight change data, growth curve test and HPLC analysis, the fermentations were left for at least 24 days to minimize the effect of residual sugars on the analysis of volatile compounds by GC-MS. A few days prior to the GC-MS analysis, wine samples were decanted and stored at 4 ⁰C with the addition of 0.78 mM potassium metabisulfite (K2S2O5) (Sigma-Aldrich). Depending on the availability of the equipment (HPLC or GC-MS), fermented samples may have been kept longer than 24 days in the fermentation vials on-lees to minimize the oxidation effect. 35  2.4 High pressure liquid chromatography (HPLC) Analyses At the end of the fermentation, wine samples were analyzed for glucose, fructose, glycerol, acetic acid and ethanol levels by Agilent 1100 HPLC (Agilent Technologies, Santa Clara, CA). The method was adapted from previous studies (Adams and van Vuuren 2010; Terrell 2010; Saberi 2011; Walkey et al. 2012). The equipment consisted of a binary HPLC pump, an auto-sampler fitted with a 100-ul sample loop, a refractive index detector (RID) (Agilent 1260 Infinity) with 8 l-flow cell, and LC/MS Chemstation (Rev.A.09.03). A nucleogel Ion 300 OA column (10 m, 300 x 7.8 mm) (Macherey-Nagel, Düren, Germany) was used with an isocratic run of 4.25 mM sulfuric acid as the mobile phase at the flow rate of 0.75 ml/min (total run time 28 min).  The sample temperature was ambient, the column temperature was 71 °C, RID unit temperature was 40 ° C and the injection volume was 4 l. Wine samples were filtered by using 0.22 m syringe filters prior to HPLC analysis to remove any yeast and insoluble solids.  2.4.1 Analysis of HPLC data The peaks of glucose, fructose and glycerol were converted to concentrations in % w/v, and that of acetic acid and ethanol were converted to concentrations in % v/v using calibration curves for each compound.  Since the fermentation speed and the attenuation levels naturally vary from batch to batch, the obtained data was converted to relative quantity against control (i.e. wild type M2) in order to cross-analyze the data between various experimental groups. To select ORFs with strong reproducible phenotypes, small differences were ignored even if they had a significant p-value (p ≤ 0.05) as small differences were observed to be not reproducible in most cases likely due to the high batch to batch variability associated with the fermentation process. The cut-off values used in conjunction with t-test for the fold changes are listed in Table 2.1.     36  Table 2.1 Minimum fold change levels for compounds analyzed by HPLC. To select mutants with strong phenotypes, these minimum fold changes were used in conjunction with a t-test (p ≤ 0.05). Compounds Fold-change cut-off Reason Glucose 10x Final values were approximately 0.01 % w/v. When sugar levels decrease by 0.10 %w/v, fermentation is usually considered to have not attenuated. Fructose 2x Final values were approximately 0.1-0.2 % w/v. Similar reasoning to glucose was used. Glycerol 1.25x Final values were approximately 0.7 % w/v. At least 25 % change was selected.  Acetic Acid 1.25x Final values were approximately 0.05 % v/v. At least 25 % change was selected.  Ethanol 1.07x Final values were approximately 15 % v/v. At least 1.0 %v/v change was selected.   2.5 Construction of GFP-tagged strains For selected ORFs, the cassette of GFP was inserted at the 3’ end of the target ORFs as described in a previously study to investigate their protein localization (Luo et al. 2013) (Figure 2.3). To compare the GFP fusion protein localization with the location of the nucleus, a strain with mCherry fluorescent protein with hphMX4 tagged to C-terminus of Nic96p, a nuclear membrane protein (Luo et al. 2013), was used. The PCR primers contained 21 base oligonucleotides at the 3’ end to amplify the cassette from pGFP+(NAT) plasmid (Vizeacoumar et al. 2006) and 55 base gene-specific nucleotides at the 5’ end that are immediate up- and downstream of the termination codon. The amplified DNA cassettes were introduced by transformation and sporulated as described in Section 2.1.3. Several colonies grown on the appropriate selection plates were tested by colony PCR after the transformation and after the tetrad dissection to confirm the correct integration of GFP-tag at 3’ end of the target ORFs. When the localization of a GFP fusion was unclear or not observed, the PGK1 promoter was inserted on the both strands of the chromosomes (i.e. homozygous diploid overexpression) to enable overexpression of the GFP-tagged protein.   2.5.1 GFP imaging Cells carrying the GFP-fusions were imaged in a manner similar to that described in Luo et al. (2013). Cells were grown overnight in the following Low Fluorescence (LoFlo) media: 2 % glucose (#D15, Fisher Scientific) and 6.9 g/L LoFlo YNB (#CYN6501, Formedium). An aliquot of yeast cells was  37  immobilized under an agarose gel slab and immediately visualized and photographed by fluorescence microscopy with a Zeiss Axio Observer Z.1 microscope. The control (no GFP-tag) and the GFP-tagged strains were prepared on the same slide, and the same exposure time was used unless otherwise specified.     Figure 2.3 Schematic diagram of homologous recombination for the C-terminal GFP tagging. The pGFP+NAT plasmid was used as a template. (a) Homologous recombination on a nuclear chromosome at a target ORF. (b) The GFP+ cassette is inserted and the native termination codon is lost. PTEF1 = TEF1 promoter, TTEF1 = TEF1 terminator, TER = termination codon. The image was created with MS PowerPoint 2013.  2.6 TCA protein extraction, SDS-PAGE and Western blot analyses Proteins from whole cell lysates were extracted by a standard trichloroacetic acid (TCA) and bead beating method. Cells were grown overnight in YPD media at 30 °C under aerobic conditions to OD600 = 1.0-1.5. Cells were exposed to 10 %v/v TCA (Sigma-Aldrich) for 10 min on ice and were lysed with 0.5 mm glass beads (Bio Spec, Bartlesville, OK) using a FastPrep24 (MP Biomedicals) in SDS-PAGE loading buffer [62.5 mM Tris-HCl pH 6.8 (Fisher Scientific), 10 % glycerol, 20 mg/ml SDS (both Sigma-Aldrich), 2 % 2-mercaptoethanol (OmniPur, Caldwell, ID), 1 ng/ml bromophenol blue (Acros Organics, Waltham, MA), protease inhibitors (Roche, Basel, Switzerland), 1 mM PMSF (Boehringer Mannheim, Basel, Switzerland)]. Protein extracts were loaded on pre-casted 4-15 % gradient gels (Bio-Rad). Separated proteins were transferred to 0.45 m nitrocellulose membrane (Bio-Rad) and were visualized with PierceReversible Protein stain Kit (Life Technologies) to confirm the equal loading of proteins. The membrane was immunoblotted with the primary rat monoclonal -GFP antibody (Chromotek, Planegg- 38  Martinsried, Germany) diluted at 3000-fold and with the secondary Goat anti-mouse (H + L)-HRP Conjugate antibody (Bio-Rad) diluted 2500-fold in 4 % skimmed milk (Saputo, Montreal, QC) TBST [50 mM Tris, 150 mM NaCl (Fisher Scientific), 0.05 % Tween 20 (BDH Chemicals, Darmstadt, Germany)]. The blot was developed with SuperSignal West Femto Maximum Sensitivity chemiluminescent substrate (Life Technologies), and the image was captured by BioSpectrum Imaging System (UVP).  2.7 Infusion cloning All the cloning in this study was conducted with an In-Fusion HD Cloning Kit (Clontech Laboratories, Kyoto, Japan). Following the In-Fusion manual, primers were designed with 18-25 base sequences specific to the cassette to be inserted with 15 base overhangs homologous to the cut site of the vector. After In-Fusion cloning, cloned plasmids were transformed into competent E. coli cells included in the kit. The plasmids from the colonies obtained on the ampicillin selection plate were purified and tested for the correct clone by the restriction digest. A plasmid that showed the expected digestion patterns were then confirmed for the correct clone by sequencing.   2.8 Add-back experiment For the add-back experiment to confirm the association of the phenotype to the deleted ORFs, the target ORF was cloned into pCW6, a plasmid constructed by Dr. Walkey (Figure 2.4). When genes are inserted in pCW6 using the SalI restriction site, they are expressed under the PGK1 promoter. The primers were designed by following the protocol described by the In-Fusion HD Cloning Kit. They contained 15-16 base of sequence at the 5’ end that matches the sequence on the plasmid at the SalI site and 20-25 nucleotides at the 3’ end to enable amplification of the gene of interest with ~200 bases of the downstream region (Primers listed in Table D.1). The exact lengths of the termination region were slightly adjusted based on the GC content; M2 genomic DNA was used as the template. The correct recombinant plasmid construction was first confirmed by the restriction enzyme digest and then by sequencing (Primers for sequencing shown in Table D.2). The constructed plasmids were transformed  39  into wild type M2 as well as corresponding null mutants as described in Section 2.1.3. The correct transformants were selected by two selection markers: one for the deletion of the chromosomal gene and the second for the plasmid uptake.    Figure 2.4 pCW6 plasmid used to construct plasmids with ORFs expressed under the PGK1 promoter. Genes to be overexpressed were inserted at the SalI restriction site. The image was produced with SnapGene Viewer 2.6.2.  2.9 Microarray analysis 2.9.1 Sample collections and chip hybridization The microarray analysis in this study was used as a screening tool and the transcriptomic analysis did not contain any replicates. Cells equivalent to OD600 = 1 were collected from Chardonnay fermentation at three time points; day 1, 3 and 5. From the protein domain analysis on Protein BLAST (Altschul et al. 1990), some ORFs were found to share similarities with genes that are important in the later phase of the  40  fermentation. For those ORFs, the analysis of cells on day eight was also conducted. The sampled wine fermentation culture was centrifuged, aspirated and stored at -80 °C until all the samples were collected. Total RNA was extracted with RiboPure RNA purification kit (Life Technologies), which was then reverse transcribed to cDNA with a T7 Oligo(dT) Primer in poly(A) tail (i.e. mRNA) specific manner with MessageAmp III RNA Amplification kit (Ambion). The first strand of cDNA was then transcribed to double-stranded cDNA. The obtained double-stranded cDNA was used to in vitro transcription of biotin-modified cRNA/aRNA, which were fragmented for hybridization with Yeast Genome 2.0 Array (Affymetrix) in GeneChip Hybridization, washed and stained with Wash and Stain Kit (Affymetrix). The arrays were scanned by the Gene Chip Scanner 3000 7G, and the expression data (CHP files) was generated using Affymetrix Expression ConsoleTM Software (Build 1.4.1.46) with RMA (robust multi-array) algorithm.  2.9.2 Analysis method for microarray data The data were normalized with RMA method, and the fold change was calculated by comparing with the wild type M2 signals. The commonly used signal intensity cutoff of ≤100 was applied (Baggerly et al. 2001; Dudoit et al. 2002; Li et al. 2005). Due to the absence of replicates, genes/ORFs with at least 3-fold change are deemed differentially expressed (DE) and shown in the results section. GO term enrichment analysis was conducted through YeastMine (Balakrishnan et al. 2012; Cherry et al. 2012), and Bonferroni corrections were applied whenever possible (i.e. enriched GO terms were obtainable with the correction).  2.10 Quantitative real time PCR (qRT-PCR) The qRT-PCR method was used to confirm the mRNA expression difference detected by microarray analysis. The same method described by Walkey et al. (2012) was used. Fermentation was set up in triplicates, and OD600=1.0-3.0 cells were collected at the time points, where the highest fold change for the gene of interest was observed by microarray analysis unless otherwise specified. RNA extraction was performed as described for the microarray analysis. Using the VILO cDNA Synthesis Kit (#11754, Life  41  Technologies), 100-500 ng of RNA was converted to cDNA. The quantification of mRNA of the target gene was analyzed using a SYBR Green dye (#4472919, Life Technologies) based PCR technique with the Applied Biosystems 7500 Real Time PCR System. The samples were set up with three biological replicates and two technical replicates.  Amplification of TAF10 was used as an internal control for normalization, and the obtained data was analyzed by comparative quantification algorithms (ΔΔCT) to determine the fold difference in the gene expression. The list of primers used in qRT-PCR is summarized in Table C.1. All primers were validated for linear amplification.  2.11 lacZ reporter assays One of the novel genes studied, 13-2, was identified to carry a transcription factor domain. Genes that were identified to change in expression levels by microarray and qRT-PCR in 13-2 null mutant were tested by using the lacZ translational fusion reporter plasmid, pCW5 (Walkey et al. 2012). pCW5 is a LacZ reporter plasmid constructed by Dr. Walkey with a hygromycin resistance gene marker, and it was successfully used in M2, which has no known auxotrophic selection.  The promoter region (500-1000 bp upstream) of the gene of interest was cloned into pCW5 to construct a gene specific reporter plasmid. The primers were designed by following the protocol described by In-Fusion HD Cloning Kit. Primers contained 15-16 bases of sequence at the 5’ end that match the sequence on the plasmid’s SalI restriction site and 20-25 bases of nucleotides at the 3’ end that can amplify the promoter region of the gene of interest (Primers listed in Table D.3). The length of cloned promoters was slightly adjusted based on the GC content as well as the existence of overlapping genes. If any overlapping genes existed, a minimum of 500 bp length was used to avoid any interference. The amplification of the promoter region by PCR was performed by using purified M2 genomic DNA as a template. The correct recombinant plasmid construction was first confirmed by the restriction enzyme digest and then by sequencing (Primers listed in Table D.4). The lacZ reporter plasmids were transformed in a similar manner as described in Section 2.1.3.  42  For the -galactosidase assay, the transformed strains were grown overnight in YPD with 300 g/ml Hygromycin B unless otherwise specified. A yeast -galactosidase assay kit (ThermoFisher Scientific) was used by following the provided manual. Cell density was measured at OD600, and the assays were conducted in triplicate using 100 l of culture in a final volume of 0.3 ml. After 30 min incubation at 37 °C, the intensity of the yellow colour was measured by taking the absorbance at 420 nm. The data were converted to Miller units by using the following formula initially developed by Miller (1972) and altered by Zhang and Bremer (1995): 𝑀𝑖𝑙𝑙𝑒𝑟 𝑈𝑛𝑖𝑡𝑠 =  𝐴420  × 1000𝑂𝐷600  × 30 𝑚𝑖𝑛  × 0.3  𝑚𝑙 2.12 Nitrogen media used in phenotype screening for the 13-2 null mutant To assess the phenotype of the 13-2 null mutant in various nitrogen sources, growth curve analysis with the following nitrogen sources was performed: 16.44 g/L proline (Sigma-Aldrich ), 21.01 g/L glutamic acid (Sigma-Aldrich ), 6.22 g/L arginine (Sigma-Aldrich), 4.29 g/L urea (Sigma-Aldrich), 9.43 g/L ammonium sulfate (AS) (Fisher Scientific) and 9.43 g/L diammonium hydrogen phosphate (DAP) (Merck, NJ, US). YPD was used as a control, and quantities of nitrogen sources was determined to achieve 2000 mgN/L to match the nitrogen level in YPD. Glucose was dissolved and sterilized by autoclaving in the standard manner. Each nitrogen compound was dissolved and filter sterilized through a 0.2 m syringe filter. A 10x concentration of YNB without amino acids or ammonium sulfate was also sterilized by filtration through a 0.2 m syringe filter.  The growth curve analysis was conducted in the same manner as described in Section 2.6.  2.13 Spot assays and plates For spot assays, cells were grown overnight at 30 °C in aerobic conditions unless otherwise specified. For those cells containing plasmids, the appropriate antibiotic was added at the concentrations described in Section 2.1.3.   43  For the low pH YPD plates (up to pH 3.5), 100 mM Glycine-HCl (Bio Basic Canada, Ontario, Canada) was used as a buffer. The pH was adjusted with HCl, and the media were microwave sterilized as described by Kothari et al. (2011). After the temperature dropped to ~40-50 °C, 4 % microwave sanitized agar constantly being kept at 60 °C was added to achieve the final concentration of 1 %. For the high pH YPD plates, 100 mM Tris-HCl (Fisher Scientific) was used as a buffer. The pH was adjusted with HCl before the addition of agar. For all the acid added grape must plates, the acids were added after the autoclaved media temperature reached ~40-50 °C. Potassium metabisulfite (K2S2O5) plates were always freshly made. For ethanol grape must plates, 100 % ethanol was diluted with grape must to 60 % and added to achieve the target ethanol level. GM-BKP plates were used as described in Palková et al. (1997) to test for the pH difference due to ammonia excretion. Media containing 1 % yeast extract, 3 % glycerol, 2 % agar and 30 mM CaCl2 (Fisher Scientific) was autoclaved in a standard manner. A 0.2 m syringe filter sterilized bromocresol purple was added to the final concentration of 0.01 % m/v. 2.14 Identification of novel ORFs in M2 genome sequence contigs Sequencing of M2 genome resulted in 242 contigs. For the contig assembly and search of novel ORFs, Geneious 7.0.6 was used. The contigs were first assembled by De Novo assembly using Geneious assembler with High Sensitivity with the default settings into supercontigs. Assembled contigs were then aligned to the S288c genome sequence and manually screened for non-matching ORFs. The regions that do not align to S288c sequence were then closely studied to identify potential novel ORFs. Since some ORFs in S288c may be present on different regions or chromosomes in M2, the obtained ORF sequence was searched against the database using BLAST to confirm that they were not previously found in S288c.    44  3. Results for ORFs in Clusters 7 and 13 To investigate the functions of non-annotated genes/ORFs in Clusters 7 and 13 (Marks et al. 2008), homozygous diploid deletion (NL) mutants were constructed by replacing the target genes with the kanMX4 antibiotic gene (20 and 129 ORFs, respectively). For Clusters 7 ORFs (Marks et al. 2008), homozygous diploid overexpression (OE) mutants were also constructed by replacing the native promoter with the PGK1 promoter. The mutant phenotypes were screened by analyzing the speed of Chardonnay fermentation by weight loss, the levels of ethanol, acetic acid, glycerol, glucose and fructose in finished wine by HPLC and the growth rate of the first 72 hours in Chardonnay grape must under aerobic condition at three different temperatures (18 °C, 22 °C and 30 °C). Based on the observed phenotypes and the DNA and protein sequence analysis by BLAST (Altschul et al. 1990; Hunter et al. 2009) and InterPro (Jones et al. 2014; Mitchell, et al. 2015), two ORFs from Cluster 7 (MTC7 and YDL206W) and seven ORFs from Cluster 13 (GEP5, PDR18, YBL071C-B, YBR056W, YCR051W, YDR114C and YPL225W) were selected for GFP localization imaging.  3.1 Construction of 19 NL and OE mutants of Cluster 7 ORFs and 118 NL mutants of Cluster 13 ORFs The deletion of eight Cluster 13 ORFs resulted in inviable NL mutants (Table 3.1), most of which were found to disrupt the neighboring essential genes.  Deletion mutants of one Cluster 7 ORF (yhl008cΔ) and three Cluster 13 ORFs (ybr013cΔ, yal064wΔ and yir042cΔ) were not studied as the construction of the gene deletion mutants was not achieved (further discussion in Section 5.2.2). As a result, the phenotypes of 19 NL and 19 OE mutants from Cluster 7 and 118 NL mutants from Cluster 13 were investigated in this study.    45  Table 3.1 Eight ORFs from Cluster 13 resulted in inviable homozygous NL mutants. The overlapping and/or neighboring genes were identified by using the M2 genome sequence obtained by the Gardner laboratory (Sequence is available in the NCBI database. BioProject #: SAMN03417849, Sample: UOA_M2).  ORF SGDa Probable reasons for inviability YDR366C Uch Overlap with the promoter region of an essential gene, KEI1 YKL083W Dub Overlap with an essential gene, RRP14 YKL111C Dub Overlap with an essential gene, ABF1 YLL037W Dub Overlap with an essential gene, PRP19 YLR101C Dub Overlap with ERG27, deletion of which is documented to result in an inviable NL mutant. YLR140W Dub Overlap with SLS2 and RRN5, the latter of which is documented to result in an inviable NL mutant. YLR230W Dub Overlap with an essential gene, CDC42 YLR235C Dub Overlaps TOP3 and may affect expression of  downstream gene THI7  aDub = Dubious, Uch = Uncharacterized , Ver = Verified status on SGD (July 26, 2015)  3.2 Phenotypes associated with Clusters 7 and 13 ORFs 3.2.1 Fermentation characteristics of wild type M2 The wine fermentation experiments were carried out in small manageable groups of approximately 10 strains. The M2 strain was inoculated in ~23.4 Brix of Chardonnay grape must at OD600 = 0.20 in triplicates. Fermentations were allowed to proceed to dryness, which is defined as a final reducing sugar concentration of < 0.2 % w/v for dry table wines (Jacobson 2006; Fugelsang and Edwards 2007a). To follow the progress of fermentation, the weight loss was used as an approximate indicator. The weight of grape must decreases as the fermentation progresses due to the loss of carbon dioxide (CO2). Therefore, weight loss is commonly used as a non-invasive method to monitor the progress of fermentation. When the weight loss plateaued, the fermentation was deemed to have reached attenuation (i.e. completion). The fermented wine was analyzed for the following compounds by HPLC; glucose, fructose, glycerol, acetic acid and ethanol. The levels of HPLC detected compounds associated with wild type M2 from three experimental groups are shown in Table 3.2. 46  Table 3.2 Glucose, fructose, glycerol, acetic acid and ethanol in Chardonnay wine fermented with wild type M2 (n = 3 for the each experimental group). Exp.  Days Glucose  (% w/v) Fructose  (% w/v) Glycerol (% w/v) Acetic Acid (% v/v) Ethanol (% v/v) 1 24 0.007 ± 0.000 0.12 ± 0.02 0.71 ± 0.01 0.052 ± 0.001 15.85 ± 0.06 2 23 0.011 ± 0.000 0.18 ± 0.05 0.69 ± 0.02 0.051 ± 0.002 15.40 ± 0.12 3 23 0.007 ± 0.000 0.12 ± 0.01 0.63 ± 0.03 0.047 ± 0.002 14.63 ± 0.08 *, **, *** represent p ≤ 0.05, 0.01 and 0.001, respectively.  3.2.2 HPLC analyses of Chardonnay wine fermented with Cluster 7 ORF mutants: RGI1 and YDR249C OE mutants produced higher amounts of acetic acid Wine fermentations were carried out in triplicate for M2 strains carrying 19 NL or 19 OE  based on the non-annotated ORFs identified from microarrays Cluster 7 in Riesling grape must (Marks et al. 2008). The data obtained were converted to fold change against the control (wild type M2) within each experimental group to allow cross comparison of results between different experimental groups. To filter out the mutants with weak phenotypes, the fold change cut-off levels described in Table 2.1 were used in conjunction with t-test (p ≤ 0.05). Using this selection approach, the RGI1 OE and YDR249C OE mutants were observed to result in increased acetic acid levels during Chardonnay fermentation (Table 3.3).  Table 3.3 The RGI1 OE and YDR279C OE mutants produce higher levels of acetic acid during Chardonnay fermentation (n = 3). The levels of glucose, fructose, acetic acid, glycerol and ethanol in wine were quantified by HPLC. Bold letters indicate values that met both the p-value cut off (p ≤ 0.05) with t-test that the fold change cut-off levels of: 10x for glucose, 2x for fructose, 1.25x for glycerol and acetic acid and 1.07x for ethanol. The fold changes below 1.00 were converted to the negative value for easier comparison. ORF Glucose (%w/v) Fructose (%w/v) Glycerol (%w/v) Acetic acid (%v/v) Ethanol (%v/v) WT 0.011±0.001 0.18±0.05 0.69±0.01 0.051±0.002 15.40±0.12 rgi1Δ (FCa) 0.011±0.000 (1.09) 0.16±0.06 (-1.10) 0.75±0.12 (1.08) 0.053±0.002 (1.03) 14.99±0.58 (-1.03) WT 0.007±0.00 0.17±0.02 0.70±0.02 0.049±0.00 15.58±0.07 OE_RGI1 (FCa) 0.004±0.00 (-1.84*) 0.08±0.08 (-2.09) 0.66±0.03 (-1.06) 0.061±0.00 (1.26*) 15.42±0.19 (-1.01) WT 0.007±0.000 0.12±0.01 0.63±0.03 0.047±0.002 14.63±0.08 ydr249cΔ (FCa) 0.008±0.000 (1.07) 0.19±0.06 (1.56) 0.60±0.02 (-1.06) 0.046±0.003 (-1.01) 14.45±0.16 (-1.01) WT 0.006±0.000 0.09±0.04 0.63±0.06 0.047±0.003 15.06±0.02 OE_YDR249C (FCa) 0.007±0.000 (1.16) 0.35±0.15 (4.06) 0.62±0.01 (-1.01*) 0.072±0.001 (1.52*) 15.04±0.08 (1.00*) *, **, *** represent p ≤ 0.05, 0.01 and 0.001, respectively. aFC = fold change   47  A slight increase in acetic acid level was observed with RGI1 OE (1.26-fold increase, p = 0.0491) and YDR249C OE (1.52-fold increase, p = 0.001) mutants (Table 3.3). The phenotype of increased acetic acid observed for RGI1 OE and YDR249C OE mutants is a negative trait in wine production. Since the reverse effect (i.e. lower acetic acid) was not observed in the complementary NL mutant strains (Table 3.3), no further experiments were designed for these ORFs due to the lack of beneficial phenotypes for wine making. 3.2.3 HPLC analyses of Chardonnay wine produced with Cluster 13 ORF mutants: Deletion of GEP5 results in higher glycerol and acetic acid levels The fermentation experiments and HPLC analysis for ORFs in Cluster 13 were conducted in a similar manner as for Cluster 7 ORFs. However, due to the sheer number of mutants to be screened (118 ORFs), they were first screened without any replicates for potential phenotypes with the same cut-off levels described in Table 2.1. Those with potentially strong and/or interesting phenotypes for wine fermentation were then re-examined in triplicate. One homozygous diploid NL mutant, gep5Δ, was observed to show a strong phenotype during Chardonnay fermentation (Table 3.4).  The GEP5 (GEnetic interactors of Prohibitins) NL mutant had a slow fermentation phenotype (Figure 3.1, Table 3.4), which was also observed in the growth curve (Section 3.3.2). GEP5 is reported to be required for mitochondrial genome maintenance, and the slow growth phenotype under aerobic conditions was previously demonstrated (Merz and Westermann 2009). Fermentation of Chardonnay grape must with gep5Δ resulted in an increase in glycerol (1.39-fold increase, p = 0.0005) and acetic acid (1.61-fold increase, p = 0.0020) (Table 3.4). Increase in both glycerol and acetic acid is an interesting phenotype as their metabolic pathways are major contributors to the cellular redox balance (further discussion in Section 5.2.8). Although higher residual sugars were identified in the gep5Δ fermented Chardonnay (13.5-fold higher glucose and 12.4-fold higher fructose), reflecting the slow fermentation rate, the p- 48  values were found not to be significant (p = 0.3326 and p = 0.1677, respectively) due to the higher difference among the biological replicates.  Table 3.4 The levels of glucose, fructose, glycerol, acetic acid and ethanol in the Chardonnay wine fermented with gep5∆ (n = 3). Bold letters indicate values that met both the p-value cut off (p ≤ 0.05) with t-test that the fold change cut-off levels of: 10x for glucose, 2x for fructose, 1.25x for glycerol and acetic acid and 1.07x for ethanol. The fold changes below 1 were converted to a negative value for easier comparison. ORF Glucose (%w/v) Fructose (%w/v) Glycerol (%w/v) Acetic acid (%v/v) Ethanol (%v/v) WT 0.006±0.001 0.12±0.03 0.71±0.01 0.054±0.003 17.49±0.23 gep5Δ (FCa) 0.082±0.119 (13.5) 1.48±0.17 (12.4) 0.99±0.00 (1.39***) 0.086±0.002 (1.61**) 16.59±0.07 (-1.05) *, **, *** represent p ≤ 0.05, 0.01 and 0.001, respectively. aFC = fold change    Figure 3.1 Slow fermentation kinetics of gep5Δ reflected in the slow weight loss during Chardonnay fermentation (n = 3). The weight change was calculated as a percentage of the weight of grape must.   3.3 Growth curve phenotypes associated with the NL mutants of ORFs in Clusters 7 and 13 The NL mutants of ORFs in Clusters 7 and 13 were grown in heptaplicate in 96-well plates, and growth rate was monitored at 420 - 580 nm every 15 minutes for 72 hours using a BioScreen C MBR. The growth curve data were collected by Dr. Walkey, and the data analyses were conducted by M. Iwashita. The data were included in this thesis as it was important for narrowing down the ORFs to pursue a more in-depth analysis. The yeast growth curve analysis can be separated into four phases: 1) lag phase, 2) exponential growth phase, 3) stationary phase and 4) death phase. Although modelling of a growth curve is ideal for analysis, for phenotype screening purposes, the growth curves were plotted and visually assessed. Mutant strains with strong phenotypes in each experimental batch were plotted with  49  wild type M2 and their standard deviations. The standard deviation was calculated at each reading point (every 15 min). 3.3.1 Slow growth phenotypes associated with mtc7Δ, par32Δ and ydr249cΔ (Cluster 7) in Chardonnay grape must At 18 °C and 22 °C, mtc7Δ, par32Δ and ydr249cΔ showed slow growth rates (Figure 3.2). At 30 °C, the slow growth rate observed mtc7Δ and par32Δ were no longer present, while ydr249cΔ showed improved growth rate (Figure 3.2). The phenotypes associated with ydr249cΔ, however, need to be confirmed as this ORF is only 341 bp upstream of a putative gluconokinase (YDR248C) in M2.  Incubation Temperatures   18 °C 22 °C 30 °C  OD500    mtc7∆    par32∆  Time (H)   Figure 3.2 Growth curve phenotypes of mtc7Δ, par32Δ and ydr249cΔ (n = 7). All the mutants shown are M2 homozygous diploid NL mutants. The optical density of cells grown in 96 well plate was measured at 420 - 580 nm every 15 min for 72 hours with BioScreen C MBR. The standard deviation was calculated at each reading point.  50    Incubation Temperatures   18 °C 22 °C 30 °C  OD500    ydr249c∆  Time (H)   Figure 3.2 (Continued)  3.3.1.1 Slow growth phenotype of homozygous MTC7 OE mutant (Cluster 7)  The tetrad dissection of heterozygous diploid MTC7 (Maintenance of Telomere Capping) OE mutant resulted in a slow growth phenotype (Figure 3.3a,b). The 5’ end of MTC7overlaps with the 5’ end of a dubious ORF, YEL034C-A, by 37 bp, and it is 5 bp upstream of tRNA-Ser (Figure 3.4). MTC7 is also 29 bp downstream of HYP2 (HYPusine-containing protein, a translation elongation factor eIF-5A) and 338 bp upstream of MCM3 (MiniChromosome Maintenance, involved in DNA replication) (Figure 3.4). The insertion of the PGK1 promoter immediately upstream of the MTC7 ATG codon lead to the disruption of YEL034C-A and likely the termination region of HYP2. To test if the slow growth phenotype is associated with the overexpression of MTC7, the gene was inserted in the pCW6 CEN plasmid, under the control of the PGK1 promoter (pCW6-P_MTC7). The slow growth phenotype, however, was not observed upon the transformation of pCW6-P_MTC7 plasmid to M2 (Figure 3.5).  51   (a)  (b)  (c)   Figure 3.3 Tetrad dissection of heterozygous diploid OE MTC7 mutant resulted in a slow growth phenotype. (a) Tetrad dissection of heterozygous diploid OE MTC7 mutant resulted in two normal and two small colonies. (b) Replica plate of (a) on G418 selection plate showing that the small colonies correspond to the kanMX marker+PGK1 promoter carrying mutant (also confirmed by colony PCR). (c) Spot assay on YPD plate showing the retarded growth of the tetrad dissected OE mutant. Although M2 is homothallic, and the ploidy status of the tetrad dissected mutant is presumably diploid, the actual ploidy level is untested. P_MTC7 = PGK1 promoter driven overexpression of MTC7.   Figure 3.4 Location of MTC7 and its neighboring genes in M2. MTC7 and YEL 034C-A (dubious ORF) overlaps for 37 bp. MTC7 is 5 bp upstream of tRNA-Ser, 29 bp downstream of HYP2 and 338 bp upstream of MCM3.  The image was produced with SnapGene Viewer 2.6.2.      Figure 3.5 PGK1 promoter driven overexpression of MTC7 on pCW6 plasmid. Cells were grown overnight, diluted to OD600 = 0.3 and diluted by 10x by serial dilutions and spotted on the YPD + hygromycin B (300 g/ml) plate. Although P_MTC7/P_MTC7 strain is presumably diploid due to the homothallic nature of WT M2, the actual ploidy status is unconfirmed.   3.3.2 Growth curve phenotypes associated with six NL mutants of Cluster 13 ORFs The NL mutants of Cluster 13 ORFs with growth curve phenotypes are shown in Figure 3.6. Following six homozygous diploid NL mutants were found to have phenotypes by growth curve analysis: gep5Δ, ybl071c-bΔ, ycr051wΔ ydr089wΔ, ydr524w-aΔ and ymr027wΔ.   52   Incubation Temperatures   18° C 22 °C 30 °C  OD500    gep5∆    ybl071c-b∆    ycr051w∆    ydr089w∆  Time (H)   Figure 3.6 Growth curve phenotypes of gep5Δ, ybl071c-bΔ, ycr051wΔ ydr089wΔ, ydr524w-aΔ and ymr027wΔ (n = 7). All the mutants shown are M2 homozygous diploid NL mutants. The optical density of cells grown in 96 well plate was measured at 420 - 580 nm every 15 min for 72 hours with BioScreen C MBR. The standard deviation was calculated at each reading point.   53   Incubation Temperatures   18° C 22 °C 30 °C  OD500    ydr524w-c∆    ymr027w∆  Time (H)   Figure 3.6 (continued)   Strong inhibition of growth was observed with gep5∆ and ybl071c-b∆ at all three (18 °C, 22 °C, and 30 °C) temperatures (Figure 3.6). The slow growth phenotype of gep5∆ appears to reside in exponential phase as the lengths of lag phase at 18 °C and 30 °C appeared comparable to that of wild type M2. The fermentation rate of ybl071c-b∆ was not observed during Chardonnay fermentation, and, therefore, the observed slow growth phenotype may be dependent on the availability of oxygen. Additionally, the slow growth phenotype of ybl071c-b∆ was observed to be alleviated with increase in the incubation temperatures (Figure 3.6).  The following four mutants were observed to show moderate slow growth phenotypes: ycr051wΔ, ydr089wΔ, ydr524w-aΔ and ymr027wΔ (Figure 3.6). The slight slow growth phenotype of ydr089wΔ was observed at all three temperatures (18 °C, 22 °C, and 30 °C) (Figure 3.6). The ycr051wΔ and  54  ydr524w-cΔ strains had slightly slow growth phenotypes at 18 °C and 22 °C (Figure 3.6). The slow growth phenotype of ymr027wΔ was observed only at 18 °C (Figure 3.6).  3.3.2.1 Small colony formation phenotypes of ybl071c-b∆ and ycr051w∆ (Cluster 13 ORFs)  Two NL mutants of Cluster 13 ORFs with slow growth curve phenotypes (Section 3.3.23.3.2), ybl071c-b∆ and ycr051w∆, were tested for the colony formation phenotype by spot assays on YPD at three different temperatures (19 °C, 22 °C and 30 °C ) (Figure 3.7). The ybl071c-b∆ was observed to form small colonies at 100x dilution at 19 °C and 30 °C and at 10x dilution at 22 °C (Figure 3.7) and ycr051w∆ had small colony formation at 1000x dilution at 19 °C and 30 °C and at 100x at 22 °C (Figure 3.7).     Figure 3.7 Small colony formation phenotypes of ybl071c-b∆ and ycr051w∆. All the mutants tested were homozygous diploid NL mutants. Cells were grown overnight, diluted to OD600 = 0.3 and diluted by 10x by serial dilutions and spotted on YPD plate. The same cell culture of each strain/mutant was spotted on all three YPD plates. The black outline indicates that the cells were spotted on the same plate.   3.4 Protein localization for proteins encoded by ORFs in Clusters 7 and 13 For the GFP-fusion localization study, MTC7 and YDL206W from Cluster 7 and GEP5, PDR18, YBR056W, YCR051W, YDR114C and YPL225W from Cluster 13 were selected based on the observed phenotypes and the functions predicted on SGD as well as domains identified by protein sequence analysis with Protein BLAST (Altschul et al. 1990; Gish and States 1993) and InterPro (Jones et al. 2014; Mitchell, et al. 2015). Some ORFs already have a known GFP localization; however, they were still included as their localization may be altered in the M2 yeast strain. The ORFs were tagged with GFP on  55  both copies in the M2 genome at their C-termini. If the GFP-tagged protein could not be visualized when expressed from the endogenous promoter, a PGK1 promoter was placed upstream of both copies of the ORFs to induce higher levels of expression. 3.4.1 No GFP localization observed for proteins encoded by Mtc7p and Ydl206wp (Cluster 7) From Cluster 7 ORFs, Mtc7p and Ydl206wp were selected for GFP localization imaging. No previous Mtc7p-GFP and Ydl206wp-GFP fusion localizations have been reported. The MTC7 OE mutant was observed to show a strongly stunted growth phenotype (Section 3.3.1.1), and mtc7Δ had a moderate slow growth phenotype (Section 3.3.1).  No phenotypes for both the NL and OE mutants of YDL206W were observed in this study; however, Ydl206wp was included as the protein sequence analysis indicated Ydl206wp to be a potential Na+/Ca2+ cation transporter; Na+/Ca2+ cation transporter regulates the intracellular Ca2+concentration, and many metal ions are known to play important roles in the process of yeast fermentation.  The localization of Mtc7-GFP and Ydl206wp-GFP fusion proteins under native or PGK1 promoters were not observed in M2 (data not shown). Although the detection level was low, PGK1 promoter driven expression of Ydl206wp-GFP was confirmed by Western blotting (Figure E.3). The expression of Mtc7p-GFP by Western blotting resulted in the detection of GFP band (27 kDa) and not the Mtc7p-GFP fusion band (43 kDa) (Figure E.3). 3.4.2 GFP localization for proteins encoded by Cluster 13 ORFs: Gep5p, Pdr18p, Ybl071c-bp, Ybr056wp, Ycr051wp, Ydr114cp and Ypl225wp For GFP imaging, all the constructed mutants with C-terminus GFP-tag on both chromosomes were grown in LoFlo media for overnight at 30 °C under aerobic conditions. Proteins encoded by nine ORFs from Cluster 13 were initially selected for C-terminus GFP-tag and localization imaging. However, the  56  results for YGL024W and YKL053W were excluded as no GFP localization was observed, and there is little evidence that YGL024W and YKL053W are functional genes (both are listed as dubious ORFs on SGD). The slow growth phenotypes observed with ygl024wΔ and ykl053wΔ during the growth curve analysis (data not shown) were likely associated with the disruption of their neighbouring genes PGD1 (a subunit of RNA polymerase II, Bröhl et al. 1994) and ASK1 (an essential subunit of the Dam1 complex involved in chromosome segregation, Li et al. 2002; Li and Elledge 2003; Westermann et al. 2006), respectively. The list of seven ORFs and the reasons for their selection are described in Table 3.5, and the localization data are shown in Figure 3.9 and Table 3.5.  Table 3.5 Seven Cluster 13 ORFs selected for GFP localization imaging, and the reasons for their selections. ORF Reasons GEP5 The null mutant was associated with slow fermentation rate resulting in increased glycerol and acetic acid concentrations and a slow growth curve was observed. Observed to localize in mitochondria in S288c (Huh et al. 2003).  PDR18 No mutant phenotypes were observed in this study. However, the description given on SGD indicates that this ORF may play an important role in fermentation as it is involved in plasma membrane sterol incorporation, increasing resistance to ethanol stress, and decreasing the intracellular accumulation of ethanol. Previously detected in highly purified mitochondria in high-throughput studies. No previous GFP localization reported.   YBL071C-B The null mutant showed strong slow growth phenotype with growth curve analysis. It is a new ORF added in 2002 to SGD (Kumar et al. 2002), and no GFP localization data has been documented.  YBR056W This ORF is predicted to be a putative glycoside hydrolase of the mitochondrial intermembrane space (Vögtle et al. 2012). Some yeast glycosidase enzymes play an important role in enhancing wine aroma. GFP localization was previously reported in the cytosol (Huh et al. 2003). Although no phenotypes were observed in this study, this ORF was included to determine if any localization pattern is observed in M2. YCR051W The null mutant showed weak slow growth phenotype with growth curve analysis. Previously documented to localize in the cytosol and nucleus (Huh et al. 2003).  YDR114C The null mutant showed strong phenotypes of slow fermentation rate and slow growth (later found to associate with disrupting the neighboring genes). No previous GFP localization data has been documented.  YPL225W No phenotypes were observed in this study. However, the protein sequence analysis indicates this protein to contain a polysaccharide biosynthesis domain. Documented to localize in the cytosol (Huh et al. 2003).   Gep5p was previously documented to localize to the mitochondria and to be required for mitochondrial genome maintenance (Huh et al. 2003; Merz and Westermann 2009). When expressed in  57  M2, endogenous levels of Gep5p-GFP were not detected, however when expressed from the PGK1 promoter, Gep5p-GFP localized near the plasma membrane in the cytosol (Figure 3.8). Although the localization appears to be in mitochondria, this needs to be confirmed by co-localization with a mitochondrial marker protein or mitochondrial staining. No phenotypes were observed for the pdr18Δ in this study, however, Pdr18p was previously observed to play a role in plasma membrane sterol incorporation (Cabrito et al. 2011), resistance to ethanol stress and reducing the intracellular accumulation of ethanol (Teixeira et al. 2012). Although no previous Pdr18p-GFP localization has been reported, Reinders et al. (2006) identified Pdr18p in a purified mitochondrial preparation. No Pdr18p-GFP fusion was detected at endogenous levels (Figure 3.8). When overexpressed from the PGK1 promoter, however, Pdr18p-GFP localized to the cell periphery, likely integrated in the plasma membrane (Figure 3.8).  The Ybl071c-bp-GFP fusion protein was observed to localize in the nucleus and likely also in the cytosol (Figure 3.8). The level of expression of this ORF was sufficiently high under the endogenous native promoter that overexpression with the PGK1 promoter was not required for GFP imaging. The cell morphology was also observed to become rounder shape than wild type M2. Since Ybl071c-bp (32 aa) is a lot smaller than the GFP tag (239 aa), the function of Ybl071c-bp might be compromised with the GFP tagging. Using S288c, Ybr056wp-GFP and Ycr051wp-GFP fusion proteins were previously reported to localize in the cytosol and to the cytosol and the nucleus, respectively (Huh et al. 2003). The similar localizations to the previous reports were observed in M2 for both Ybr056wp-GFP and Ycr051wp-GFP (Figure 3.8)    58      DIC EGFP RFP Merge    DIC EGFP RFP Merge WT      YBR056W Native     GEP5 Native     PGK1pro     PGK1pro     YCR051W Native     PDR18 Native     YDR114C Native     PGK1pro     PGK1pro     YBL071C-B Native     Figure 3.8 Cellular location of GFP tagged Gep5p, Pdr18p, Ybl071c-bp, Ybr056wp, Ycr051wp and Ydr1104cp (Cluster 13). GFP was tagged at the C-terminus on both copies of ORFs in M2 genome. When the localization was not observed under native promoter, the protein was overexpressed under the PGK1 promoter. The bar shown in the wild type DIC image corresponds to 5 m.         59  The localization of Ydr114cp has not been previously reported. No Ydr114cp-GFP signal was detected when expressed from the endogenous native promoter in the M2 strain. The PGK1 promoter driven Ydr114cp-GFP in the M2 strain was observed as a punctate cytosolic signal, which has a resemblance to localization in Golgi (Figure 3.8). Expression of Ydr114cp-GFP under the PGK1 promoter also resulted in an abnormal vacuolar morphology as well as smaller cell sizes. Little is known about Ypl225wp; however, the localization was previously reported to be cytosolic (Huh et al. 2003). Protein sequence analysis indicates that this protein contains a polysaccharide biosynthesis domain. No Ypl225wp-GFP localization was observed in M2 when expressed under native or PGK1 promoter (image not shown).  Table 3.6 Six Cluster 13 ORFs showed GFP localization in M2.  ORF Results GEP5 Localization in cell periphery (likely mitochondria as previously reported)   PDR18 Previously detected in highly purified mitochondria. Observed to localize in the cell periphery, likely integrated to the plasma membrane  YBL071C-B Observed to localize in the nucleus and likely in cytosol  YBR056W As previously reported with S288c, localization in the cytosol was observed  YCR051W As previously reported with S288c, localization in the nucleus was observed   YDR114C Observed to localize in the cytosol in a punctated manner (unknown location) under PGK1 promoter expression  YPL225W Previously reported to localize in the cytosol. No localization observed in M2   3.5 Exploring the use of various wine fermentation relevant stresses to identify strong phenotypes for Cluster 13 ORFs Since the majority of the NL mutants did not show strong phenotypes during Chardonnay fermentation and growth curve analyses, other wine fermentation relevant stresses were explored as a phenotype screening method. Using the NL mutants of Cluster 13 ORFs without any phenotypes or weak phenotypes (ybl086c∆, ycr100c∆, ydl129w∆, ydr089w∆ and ypl150w∆), colony formation phenotype was examined on plates with five wine fermentation related conditions (pH 2.25, 9% v/v ethanol, 0.37 % w/v malic acid, 0.55 mM K2S2O5 and 40 mM CH3COOH) (Figure 3.9).  60  A moderate slow growth curve phenotype was observed with ydr089wΔ at all three temperatures (18 °C, 22 °C and 30 °C) (Figure 3.6). Although ydr089wΔ did not show the small colony formation phenotype on the control pH 3.50 YPD plate at 30 °C, it showed small colony formation phenotype on YPD pH 2.25, 9% v/v ethanol, 0.37% w/v malic acid and 40 mM acetic acid plates (Figure 3.9). The ydl129wΔ also had small colony formation on YPD pH 2.25 plate, which was not observed on plates where malic acid or acetic acid was added (Figure 3.9).    Figure 3.9 The ydl129wΔ and ydr089wΔ are sensitive to wine fermentation related stresses. Cells were grown overnight, diluted to OD600 = 0.3 and were diluted 10x by serial dilutions. Chardonnay grape must was used for non-YPD plates. The plates were incubated at 30 °C. The same cell culture of each strain/mutant was spotted on all six plates shown. YPD at pH 3.50 was used as the control plate. YPD pH 3.50 was a non-transparent plate, and the image was captured from the top of the plate. The black outline indicates that the cells were spotted on the same plate.    61  3.6 Phenotype dependence on growth phases: Exponential vs stationary phases Besides the results shown in Section 3.5, various other mutants were also screened by spot assays, however, phenotypes were noticed to have low reproducibility in some cases. One possible reason for this observation was hypothesized to be the difference in the cell growth phases as cells were simply grown overnight and spotted. Some spot assay protocols use cells grown to stationary phase (>48 hours) while others use those in the exponential phase. To test if different cell growth phases affect the observed phenotypes, two mutants from Cluster 13 ORFs with the strongest phenotypes in this study, gep5Δ and ybl071c-aΔ, were grown to both exponential (grown for 2 – 3 generations in fresh YPD) and stationary (>48 hours in YPD) phases and spotted onto Chardonnay grape must plate with or without potassium metabisulfite (K2S2O5), which is a preservative commonly added to protect wine aroma (The significance of K2S2O5 in wine making is described further in Section 5.2.8). The OE mutants of these genes were also included for comparison. Both exponential and stationary phase gep5Δ were observed to show slow colony formation phenotype on the Chardonnay grape must plate at 30 °C (Figure 3.10a,b). The GEP5 OE mutant had no growth phase dependent phenotype on the grape must (Figure 3.10a,b). When K2S2O5 was added to the Chardonnay must, wild type M2 and GEP5 OE mutant in the exponential phase were found to be more resistant to K2S2O5 than those in the stationary phase (Figure 3.10 cd, ef, gh pairs). However, when gep5Δ was spotted on the K2S2O5 added Chardonnay must plate (Figure 3.10 cd, ef, gh pairs), the growth phase dependent phenotypes did not appear as strong as the effect observed with wild type M2 and GEP5 OE mutant. Both ybl071c-bΔ and YBL071C-B OE mutants showed slow colony formation phenotype on the control Chardonnay grape must plate when compared to wild type M2 (Figure 3.10a,b). The ybl071c-bΔ and YBL071C-B OE mutants were both found to be more sensitive to K2S2O5 than wild type M2, and their growth was completely suppressed as the concentration of K2S2O5 increased (Figure 3.10 cd, ef, gh pairs). Although ybl071c-bΔ did not show strong growth phase dependent phenotypes, YBL071C-B OE  62  mutant showed slightly better growth when it was in the stationary phase at 0.43 mM K2S2O5 (Figure 3.10 c,d).   Figure 3.10 Comparison of the effect of K2S2O5 on the cells in exponential and stationary phases.  The cells for stationary phase were grown for >48hours at 30 °C under aerobic conditions. On the day of spotting, the cells grown for 48 hours were diluted to OD600 = 0.03 and allowed to grow for 2 – 3 generations. For the spotting, cells were diluted to OD600 = 0.3 and were then diluted by 10x by serial dilutions. Chardonnay grape must was used for all the plates. The plates were incubated at 30 °C. The same cell culture of each strain/mutant in the designated growth phase was spotted on all four plates. P_GEP5 and P_YBL071C-B are homozygous diploid OE mutants. The black outline indicates that the cells were spotted on the same plate.  To further explore the exponential and the stationary phase dependent growth phenotypes associated with gep5Δ, the NL and OE mutants were tested in various wine fermentation related conditions (Figure 3.11). Similar to the phenotypes observed with the addition of K2S2O5 (Figure 3.10), gep5Δ in both stationary and exponential phases were found to be less affected by the addition of acetic acid  63  (CH3COOH) than wild type M2 (Figure 3.11e,f). The GEP5 OE mutant in exponential phase was observed to show better resistance to CH3COOH than wild type M2 (Figure 3.11e). In general, all three strains were observed to be more tolerant to CH3COOH when the cells were in exponential growth phase (Figure 3.11e).     Figure 3.11 Higher resistance of gep5Δ to acetic acid and K2S2O5. The cells for stationary phase were grown for >48hours at 30 °C under aerobic condition. On the day of spotting, the cells grown for 48 hours were diluted to OD600 = 0.03 and allowed to grow for 2 – 3 generations. For the spotting, cells were diluted to OD600 = 0.3 and were then diluted by 10x by serial dilutions. Chardonnay grape must was used for all the plates. The plates were incubated at 30 °C. The same cell culture of each strain/mutant in the designated growth phase was spotted on all four plates. P_GEP5 is homozygous diploid OE mutants. The black outline indicates that the cells were spotted on the same plate. gep5Δ showed growth phase dependent phenotype to 0.31 mM K2S2O5 and 45 mM CH3COOH, and the growth of gep5Δ was inhibited by 9% v/v ethanol.  When the level of K2S2O5 was reduced to 0.31 mM (Figure 3.11c,d) from 0.43 – 0.51 mM (Figure 3.10), the growth of all three strains in exponential phase (Figure 3.11c) showed similar growth to the cells on the control Chardonnay grape must plate (Figure 3.11a). When the cells were grown for >48 hours, wild type M2 and GEP5 OE mutant showed higher sensitivity to K2S2O5 (Figure 3.11c,d). However, as observed in Figure 3.10, the gep5Δ was observed show less growth phase dependent phenotype against K2S2O5 (Figure 3.11c,d).   64  The addition of 9 % v/v ethanol (Figure 3.11g,h) was found to slow the growth rate and require longer incubation length when compared to the control Chardonnay grape must plate (Figure 3.11a,b). However, no growth phase dependent phenotypes against 9 % v/v ethanol were observed (Figure 3.11g,h). The growth of gep5Δ was completely suppressed in the presence of 9 % v/v ethanol in both growth phases (Figure 3.11g,h).  65  4. Functional Study of Novel ORFs 4.1 DNA and protein sequence of eight novel ORFs The M2 genome sequence became available for this study after the sequence was kindly provided from the Gardner laboratory to the van Vuuren laboratory [unpublished, available at NCBI database (BioSample: SAMN03417849, BioProject: PRJNA278337, Sample name: UOA_M2)]. The M2 genome was then re-sequenced by the van Vuuren laboratory, and these contig reads also became available for this study. The genome sequence from the Gardner laboratory was assembled de novo and aligned to EC1118, which is one of the most widely used wine yeast strains in the world. The genome sequence of EC1118 was previously assembled and published by Novo et al. (2009). The M2 sequence provided by Dr. Gardner contains eight novel ORFs from horizontal gene transfer segments (HGT) that are conserved among wine strains but not found in S288c.  (a)  (b)   Figure 4.1 Locations of eight novel M2 ORFs. Two contigs represented by (a) and (b) obtained from the van Vuuren laboratory M2 sequence contained five and three novel ORFs, respectively, that were investigated in this study. Dr. Gardner’s M2 sequence shows five novel ORFs on contig (a) aligned to chromosome 13 and three novel ORFs on contig (b) aligned to chromosome 14. The image was produced with SnapGene Viewer 2.6.2.  The novel ORFs investigated in this study are simply denoted with the chromosome number that they are likely located on. For example, “13-1” indicates ORF 1 on Chromosome 13 (Figure 4.1). However, although these ORFs appear to exist on the designated chromosome when M2 genome reads were aligned to the EC1118 genome, their genomic locations in M2 are not confirmed. As reviewed in Section 1.6.2., segments of HGT can be identified on various different genomic loci in different wine yeast strains. The genomic loci of the contig (b) is unclear as the ORFs at the upstream of 14-4 are YIR042C and  66  YDL248W (COS7) (Figure 4.1b). Although the alignment of M2 genome reads to EC1118 conducted by the Gardner laboratory resulted in the assembly of ORFs on contig (b) in Figure 4.1 to chromosome 14, these three novel ORFs are not found in EC1118.  The similar HGT segment to contig (b) (Figure 4.1) is found in AWRI796, which is assembled to chromosome 14 (Borneman et al. 2011). However, the segment in AWRI796 contains SNPs and indels when compared to M2 sequence, and 14-4 and 14-2 are prematurely truncated (Figure 4.2). When 14-1 is searched by DNA BLAST (Altschul et al. 1990), this ORF is also found on chromosome 5 in some YJM clinical S. cerevisiae strains (Strope et al. 2015). The reason for these two potential genomic loci of chromosome 14 or 5 for contig (b) in Figure 4.1 is likely due to the ORFs found at the upstream of 14-1 being present in paralogs on chromosome 14 and 5 (Figure 4.2). Although which chromosomes these two HGT segments (Figure 4.1) investigated in this study exactly are located in M2 is yet to be determined, the locations of the novel ORFs relative to each other are valuable data. Confirmation of the complete M2 genome sequence assembly will provide a wealth of information; however, it was beyond the scope of this study and remains to be done. The summary of DNA and protein sequence analysis for the novel ORFs investigated in this study as well as the ORFs in other wine strains that share high sequence similarities are summarized in Table 4.1, and the predicted 3D protein folding structures generated by Phyre2 (Kelley et al. 2015) is shown in Figure 4.3.   Figure 4.2 Locations of three novel ORFs, 14-1, 14-2 and 14-4 in AWRI796. AWRI796 was sequenced and assembled by Borneman et al. (2011). When the ORFs are compared to M2, 14-4 and 14-2 are missing 1116 bp and 1308 bp, respectively, due to SNPs and indels. Also because of a frameshift, a new ORF, 14-4’, was gained in AWRI796. DSF1 and HXT17 have paralogs YNR073C and HXT13, respectively, indicating the potential HGT genomic loci on Chromosome 5 or 14. The image was produced with SnapGene Viewer 2.6.2.    Table 4.1 DNA and protein sequence analyses of eight novel ORFs. The domains were identified by using  67  InterPro and protein BLAST (Altschul et al. 1990; Hunter et al. 2009), and the similar ORFs found in other industrial S. cerevisiae strains were identified by DNA BLAST (Altschul et al. 1990). ORFa Length (bp) DNA/Protein sequence  similarities and domains Other industrial yeast strains with similar ORFs  13-1 981 Contains fungal specific transcription factor domain. Some similarities to CDF91658 in Zygosaccharomyces bailii (CLIB 213).  Conserved in Lalvin QA23, VL3, AWRI796 and many YJM strains. EC1118_1N26_0045g, QA23_3412, SCRG_03376 (RM11-1a), VL3_5124 13-2 1959 Zn(2)-C6 fungal-type DNA-binding domain and fungal transcription factor domain. Conserved in EC1118 and many YJM strains. Weak similarities to PUT3 (Transcription activator for Proline UTilization) and ASG1 (Transcriptional regulator for stress response). EC1118_1N26_0056g,  QA23_4140, QA23_5177, QA23_3417, VIN13_3401, VIN13_3402, VIN13_5118, VIN13_5119,  VL3_5123, (pseudogene in RM11-1a) 13-4 3861 Contains hydantoinase A N-terminus domain, hydantoinase A superfamily domain and hydantoinase B superfamily domain.   Conserved in EC1118 and many YJM strains. VIN13_5117, VIN13_3399, QA23_3416, QA23_4136, QA23_5176, EC1118_1N26_0012g, VL3_5121 (pseudogene in RM11-1a) 13-5 1509 Contains Major Facilitator Superfamily (MFS) domain seen in e.g. D-galactonate transporter, sugar phosphate permease.  Conserved in EC1118 and many YJM strains. VIN13_3398, VIN13_5116, QA23_4137, QA23_5175, EC1118_1N26_0023g, VL3_5126, (pseudogene in RM11-1a) 13-6 1179 Contains FLO11 superfamily domain.  Conserved in EC1118 and many YJM strains. SCRG_03373 (RM11-1a), VIN13_3397, QA23_3413, QA23_5175, QA23_4138, EC1118_1N26_0034g, VL3_5125 14-1 825 Contains GPR1/FUN34/yaaH family domain. This domain is found in Ady2p, which is required for acetate transportation and normal sporulation in S. cerevisiae. A homolog in Yarrowia lipolytica (GPR1) has a role in acetic acid sensitivity. Some sequence similarity to ATO3and ATO2. ATO2 is a paralog of ADY2.  Conserved in many YJM strains. AWRI796_4254, SCRG_02225 (RM11-1a) , K7_06167 14-2 1794 Contains amidase superfamily domain. GO term prediction for the molecular function: carbon-nitrogen ligase activity, with glutamine as amido-N-donor.  Conserved in many YJM strains. AWRI796_4255, AWRI796_5170, SCRG_02224 (RM11-1a), R008_O14156, K7_AMI1 14-4 1596 Contains pepsin retropepsin like superfamily domain (aspartic peptidase domain). Has similarity to YPS6.  Conserved in many YJM strains. AWRI796_4257, SCRG_02223 (RM11-1a), K7_06169 aThe first number of ORF notations indicate the chromosome number, on which the ORF likely to be present when aligned to EC1118 genome sequence.  68   (a) 13-1p   (b) 13-2p  (c) 13-4p   (d) 13-5p   (e) 13-6p    (f) 14-1p      (g) 14-2p   (h) 14-4p    Figure 4.3 Predicted 3D folding of proteins encoded by novel ORFs. (a) 13-1p contains fungal transcription superfamily domain (pfam11951) at 8 – 326 aa (green). (b) 13-2p contains Zn(2)-C6 fungal type DNA binding domain (IPR001138) at 4 – 49 aa (green) and fungal transcription factor domain (IPR007219) at 224 – 394 aa (orange). (c) 13-4p did not result in clear 3D folding structure. 13-4p contains hydantoinase/oxoprolinase N-ter domain (IPR002821, IPR003692) at 11 – 227 aa (green). (d) 13-5p contains MFS domain (IPR011701) at 49 – 476 aa (green). (e) 13-6p contains FLO11 domain (IPR018789) at 73 – 223 aa (green). (f) 14-1p contains GPR1/FUN34/yaaH domain (IPR000791) at 74 – 274 aa (green). (g) 14-2p contains amidase domain (IPR00120) at 79 – 588 aa (green). (h) 14-4p contains aspartic peptidase domain (IPR001461) at 61 – 434 aa (green). Domains were identified by InterPro and Protein BLAST (Altschul et al. 1990; Hunter et al. 2009) and the potential folding structures were generated with Phyre2 (Kelley et al. 2015) and visualized with PyMOL v1.7.4.   69  4.2 Fifteen additional novel ORFs found in the M2 genome Table 4.2 Twenty-six ORFs containing >500 bp in M2 that are not found in S288c reference genome sequence.   # ContigID Length (bp) ORF Name Note [Similar ORFs in other industrial strains] Eight ORFs identified by the Gardner laboratory 1 2169 1182 13-6 Investigated in this study [Shown in Table 4.1] 2 2169 1512 13-5 Investigated in this study [Shown in Table 4.1] 3 2169 3864 13-4 Investigated in this study [Shown in Table 4.1] 4 2169 1962 13-2 Investigated in this study [Shown in Table 4.1] 5 2169 984 13-1 Investigated in this study [Shown in Table 4.1] 6 2091 1599 14-4 Investigated in this study [Shown in Table 4.1] 7 2091 1797 14-2 Investigated in this study [Shown in Table 4.1] 8 2091 828 14-1 Investigated in this study [Shown in Table 4.1] Previously characterized ORFs 9 2084 1344 M6 Tyrosine permease (TAT3) in S. pastorianus (Omura et al. 2007). Highly conserved in other wine yeast strains. DIP5 in VIN7 wine strain. [AWRI796_3907, VIN7_10204] 10 2157 1509 M24 98 % similar to mannitol dehydrogenase (DSF1) in S288c (Ohkuni et al. 2006) [R008_O14146, AWRI796_5171, DSF1 in YJM1252 and YJM248] 11 2166 690 M29 Previously characterized. MPR1 (Takagi et al. 2000) [VIN7_5254, VL3_2444, EC1118_1O30_0012g, MPR1 in JAY291, AWRI1631_11000010] Novel ORFs identified in this study 12 2157 1926 M13 Conserved in other wine strains. Similar to D-mandelate dehydrogenase in Z. bailli [AWRI796_5153, R008_O14106] 13 2157 573 M14 Likely 3’ end of -galactosidase (MEL5). M15 is likely the 5’ end. M14 and M15 may not be functional. Not found in S288C, but found in other S. cerevisiae (not wine strain specific). In AWRI769, this ORF is also separated into two segments.  [M14: AWRI796_5154] [M15: R008_O14111, AWRI796_5155] 14 2157 801 M15 15 2157 687 M16 Conserved among wine strains. Related to aryl-alcohol dehydrogenase in Z. bailli. [AWRI796_5156] 16 2157 1080 M17 80 % similar to ADH7. Could be a second copy. [Similar to ADH7 in P283 and R008] 17 2157 2484 M18 Conserved in wine strains. Similar to RDS1. Could be a second copy. [AWRI796_5159] 18 2157 651 M19 Found in AWRI796. Aryl-alcohol dehydrogenase in Z. bailli [AWRI796_5161, AWRI796_5156] 19 2157 1128 M20 Highly conserved in wine strains. Similar to AAD4 (aryl-alcohol dehydrogenase) [R008_O14126, AWRI796_5166] 20 2157 1344 M21 Found in AWRI796. Putative transporter.  [R008_O14131, AWRI796_5163] 21 2157 915 M22 [R008_O14136] 22 2157 1446 M23 Found in AWRI796. Possible aminotransferase [AWRI796_5167, HXT17 in YJM1326]  23 2157 528 M25 Found in AWRI796. [AWRI796_5168] 24 2157 828 M26 Conserved among wine strains. Putative ammonium transporter (ATO3) [AWRI796_5169] 25 2157 1752 M27 Conserved among wine strains. Similar to amidase homolog in S. pastorianus. Sequence highly similar to 14-2. [R008_O14156, AWRI796_5170, K7_AMI1] 26 2166 890 M28 Conserved among wine strains. Similar to HPF1 [VIN13_0549]  70  The M2 genome sequencing by the van Vuuren laboratory resulted in 242 contigs. De novo assembly resulted in the assembly of 207 contigs into 41 scaffolds; 35 contigs were not assembled. The total of 76 contigs/scaffolds were aligned to S288c reference genome one by one and manually screened for regions with non-matching ORFs of >100 bp. The non-matching ORFs were then searched against the sequences in NCBI nucleotide sequence database through DNA BLAST (Altschul et al. 1990) to see if they are actually novel ORFs not previously identified in S288c reference genome. Some ORFs that exist in S288c were occasionally found on different chromosomes or at a different position on the same chromosome in M2. Twenty-six ORFs that were not found in S288c reference genome were identified (Table 4.2). Among them, eight ORFs were the ORFs identified by the Gardner laboratory in M2 that were investigated in this study. The functions of three novel ORFs were previously characterized by other research groups (Takagi et al. 2000; Ohkuni et al. 2006; Omura et al. 2007). Fifteen ORFs were newly identified as potential novel ORFs. Among them, M27 was found to be highly similar to ORF 14-2 investigated in this study. The M27 ORF (1752 bp) is slightly shorter than 14-2 (1797 bp), and they align at the 3’ end – i.e. the start codon for M27 matches with +46th bp of 14-2. Over the 1752 bp coverage, their sequence is 91 percent identical.  4.3 Proteins encoded by novel ORFs are not involved in wine fermentation kinetics The homozygous diploid NL mutants of eight novel ORFs were constructed by Dr. Walkey by replacing the target gene with kanMX4 gene through homologous recombination. Unless otherwise stated, all other mutants in this chapter were constructed by M. Iwashita. The fermentation experiments for the homozygous diploid deletion mutants of novel ORFs were carried out in a similar manner as for the ORFs in Clusters 7 and 13 (Chapter 3). The HPLC data was converted to fold change against the control (wild type M2) as described in Section 3.2.1. The fold change cut-off levels (Table 2.1) in conjunction with t-test (p ≤ 0.05) were used to screen for strong phenotypes.  Based on the HPLC analyses performed after the fermentations were completed, none of the eight deletion mutants of novel ORFs investigated (13-1, 2, 4, 5, 6, 14-1, 2, 4) showed a phenotype when  71  compared to the wild type M2. Although the HPLC analysis screened for only five compounds - glucose, fructose, glycerol, acetic acid and ethanol - these parameters are useful indicators of fermentation kinetics.  Deletion mutations of the eight novel M2 13-1, 2, 4, 5, 6, 14-1, 2, 4 ORFs investigated in this study, therefore, did not appear to significantly affect wine fermentation kinetics.   4.4 The homozygous diploid 13-2 NL mutant shows a slightly low growth rate at 18 °C and low maximum cell density at 22 °C As previously described in Section 3.3, the growth curve data was obtained by Dr. Walkey and analyzed by M. Iwashita. No clear growth phenotypes were observed except for the 13-2Δ, which showed a slightly low growth rate at 18 °C and a low maximum cell density at 22 °C (Figure 4.4).   18 °C 22 °C OD500    Time (H)  Figure 4.4 Deletion of 13-2 in M2 results in subtle slow growth at 18 °C and low maximum cell density at 22 °C (n = 7). All the mutants shown are NL mutants. The cells were grown in Chardonnay must under aerobic conditions. Optical density was measured at 420-580 nm every 15 min for 72 hours. Standard deviations were omitted for clarity.   4.5 Protein localization using a C-terminal GFP-tag The cellular localization of a protein can give hints as to its cellular function. The eight novel ORFs analyzed above were tagged with GFP at the C-terminus and imaged using fluorescence microscopy to 0.000.501.001.502.000 12 24 36 48 60 7213-1 13-2 13-413-5 13-6 14-114-2 14-4 M20.000.501.001.502.000 12 24 36 48 60 7213-1 13-2 13-413-5 13-6 14-114-2 14-4 M2 72  determine their cellular localizations in aerobic logarithmic growth conditions. The GFP fusion proteins were imaged in an M2 strain with a Nic96p-RFP nuclear membrane marker. The microscopy images are shown in Figure 4.5, and the results are summarized in Table 4.3.  Table 4.3 Summary of GFP localization proteins encoded by novel ORFs. ORF GFP localization 13-1 No GFP signal observed under native or PGK1 promoter  13-2 Localized to the nucleus when expressed under the PGK1 promoter 13-4 Punctated GFP signal in the cytosol when expression is driven by the PGK1 promoter 13-5 Localization likely in lipid bodies around the nucleus under PGK1 promoter expression 13-6 Localization likely in lipid bodies around nucleus under native promoter. Under PGK1 promoter, the localization is accentuated 14-1 Possible localization in the cytosol in a punctated manner under native promoter. More clear localization observed under the the PGK1 promoter. Under the PGK1 promoter, abnormal vacuolar morphology is also observed 14-2 No GFP localization observed even when expressed from the PGK1 promoter 14-4 No GFP localization observed even when expressed from the PGK1 promoter  The13-2p-GFP fusion was observed to localize in the nucleus under PGK1 promoter driven expression (Figure 4.5). The protein sequence analysis showed that 13-2p has a Zn(2)-C6 fungal-type DNA-binding domain (4 - 49 aa) and a fungal transcription factor domain (224 - 394 aa). 13-2p is, therefore, highly likely to be a novel transcription factor. The 13-4p contains a hydantoinase A and B superfamily domain, which are found in 5-oxoprolinase (ATP-hydrolysing) that participates in glutathione metabolism (conversion of 5-oxoproline to L-glutamate) (Penninckx 2002). The OXP1 gene encodes 5-oxoprolinase in S. cerevisiae, and the GFP localization of this protein in laboratory strains is evenly dispersed throughout the cytosol without any punctate dots (Huh et al. 2003; Kumar and Bachhawat 2010).  There was no 13-4p-GFP signal detected when the GFP fusion was expressed from the native 13-4 promoter (Figure 4.5). When 13-4p-GFP expression was increased using the PGK1 promoter, bright GFP foci were detected in the cytoplasm, which has a pattern reminiscent to localization in Golgi (Figure 4.5).  73   Figure 4.5 Novel ORF encoded protein-GFP cellular localization. The Nic96p-RFP signal marks the nuclear membrane. The bar shown in the wild type DIC image corresponds to 5 m.     74   Figure 4.5 (Continued)     75  The GFP localization for 13-5p was observed under the PGK1 promoter driven expression but not under the native 13-5 promoter expression. The 13-5p-GFP signal was detected in circles that formed around the nucleus (Figure 4.5). This localization is seen in proteins that are components of lipid bodies, which are thought to form from the perinuclear ER, especially during stationary phase or during the growth in the nutrient scarce environment (Jacquier et al. 2011; Wolinski, et al. 2011; Bouchez et al. 2015; Wang 2015). The protein sequence of 13-5p contains a Major Facilitator Superfamily (MFS) domain that is found in a wide range of transporters and permeases for compounds such as sugar, ions and drugs (Pao et al. 1998). Another ORF, 13-6, when fused to GFP displayed a similar putative lipid body localization to 13-5p-GFP (Figure 4.5). The 13-6p-GFP signal was detected under its native promoter, and this GFP signal was intensified under PGK1 promoter.  The 14-1p-GFP signal, when expressed under the 14-1 native promoter, was not detectable above background levels (Figure 4.5). Upon PGK1 overexpression, there was 14-1p-GFP signal near the cell periphery which may be mitochondria or another membrane structure associated with the plasma membrane; however, the exact location has to be confirmed by co-localization with appropriate marker proteins.  4.6 Effect of deletion of novel ORFs on global gene expression patterns To study the effect of deletion of the novel ORFs on the transcriptome, each mutant strain was inoculated into Chardonnay juice, and cell samples were collected on days 1, 3 and 5 of fermentations. A cell sample for the 14-1 NL mutant fermentation was also collected on day 8 as the predicted 14-1p sequence analysis indicated a potential involvement in the later phase of fermentation. The 14-1p has a domain found in the Ady2p acetate transporter and sequence similarity to Ato2p (a paralog of ADY2) and Ato3p, which are putative ammonia transporters (Palková et al. 2002). Excreted ammonia act as a starvation signal and promotes cell death in aging colonies to redistribute the nutrients to outer (i.e. younger) part of the colonies on agar plates (Palková et al. 2002; Váchová and Palková et al. 2005).    76  The signal intensity cutoff of ≤100 is commonly used in microarray analysis as higher variance is reported between biological replicates below ≤100 signal intensity (Baggerly et al. 2001; Dudoit et al. 2002; Li et al. 2005). Although using this cut-off level has the drawback of losing data on genes expressed at low levels, managing the false positive rate was deemed more important. To identify the differently expressed (DE) genes, at least a 2-fold change is a commonly used criterion in microarray data analysis. However, in general, when too few or too many DE genes are identified, adjustment of the fold-change cutoff levels can be reconsidered (Mutch et al. 2002). For this study, some control probes (e.g. non-S. cerevisiae sequence probes) that were not supposed to show any changes in the signal intensities between the wild type and the mutants had a more than 2.0-fold difference in the signal intensities. These signals would likely be eliminated as the statistical power is increased with the inclusion of replicates. To filter out these false positives, a 3.0-fold cutoff level was used to identify DE genes in this study. At the beginning of the microarray data analyses, the Affymetrix proprietary analytical method, the Microarray Analysis Suite 5 (MAS5) algorithm, was conducted; MAS5 calculates the signal intensity for each gene by subtracting the signals of the mismatch (MM) probe from the signals of its complimentary perfect match (PM) probe. A gene on Affymetrix Yeast 2.0 array is represented by multiple probe sets of 25-mer sequences matching to multiple sections of a gene. Each probe also comes in a pair of MM and PM probes: MM probe contains one SNP in the middle of 25-mer sequence compared to PM probe. In theory, the subtraction of MM signals from PM signals account for the background noise signals generated from the non-specific hybridizations. However, in reality, such practice often adds more error, and the subtraction of MM signals from PM signals can result in negative values (Irizarry et al. 2003). When the DE genes identified by the MAS5 algorithm in this study were later analyzed by qRT-PCR, many genes were not confirmed as DE in wild type versus mutant strains suggesting the data contained false positives. Since M2 sequence contains unknown numbers of SNPs when hybridized to Yeast 2.0 array, MAS5 algorithm is likely not suitable. One of the commonly used microarray algorithms developed by Irizarry et al. (2003) named Robust Multi-array Average (RMA) uses only PM signals to  77  avoid additional error introduced by using the MM signals. The results below were obtained by reprocessing the data using the RMA algorithm.  4.6.1 Genes involved in sterol biosynthesis and those that encode for transposable elements were commonly identified as DE in novel ORF mutants Across six novel ORF mutants (13-1Δ , 13-2Δ, 13-4Δ, 13-5Δ, 13-6Δ and 14-1Δ), genes involved in sterol biosynthesis were identified to be DE. In 13-1Δ, two genes with roles in sterol biosynthesis - the hydroxymethylglutaryl-CoA (HMG-CoA) reductase encoded from HMG1 (3.5-fold increase), which is considered one of the rate limiting steps in sterol biosynthesis (Basson et al. 1988; Polakowski et al. 1998) and UPC2 (3.1-fold decrease) which binds to sterol regulatory elements to induce expression of sterol biosynthesis genes (Vik and Rine 2001) were identified as DE (Section 4.6.2, Table 4.4). In 13-2Δ (Section 4.6.3, Table 4.7), 13-4Δ (Section 4.6.4, Table 4.10), 13-5Δ (Section 4.6.5, Table 4.13), 13-6Δ (Section 4.6.6, Table 4.16) and 14-1Δ (Section 4.6.7, Table 4.19), UPC2, YML083C and FHN1 were commonly identified to be upregulated. YML083C and FHN1 (proteins of unknown functions) are regulated by Upc2p through sterol regulatory element (SRE) in their promoter regions (Vik and Rine 2001; Brohée et al. 2011). The expression of YML083C is also reported to be upregulated during anaerobic growth compared to aerobic growth (Ter Linde et al. 2003). In 13-2Δ (Section 4.6.3, Table 4.7) and 13-4Δ (Section 4.6.4, Table 4.10), HMG1 was downregulated. Whether these novel ORFs actually affects cellular sterol synthesis will have to be confirmed.  Transposable element genes (TYA Gag gene), YBL100W-A and YBL005W-A, were another commonly identified DE genes in five novel ORF null mutants. In 13-4Δ (Section 4.6.4, Table 4.10) and 13-5Δ (Section 4.6.5, Table 4.13), YBL100W-A and YBL005W-A were found to be upregulated, while in 13-6Δ (Section 4.6.6, Table 4.16) and 14-4Δ (Section 4.6.9, Table 4.25) , they were downregulated; 14-1Δ showed upregulation of YBL100W-A and YBL05W-A on day three and downregulation on day eight  78  (Section 4.6.7, Table 4.19). Again, whether these differential expressions are shared among these novel ORFs need to be confirmed.  4.6.2 Gene expression patterns obtained for the 13-1 deletion mutant The DE genes identified in 13-1Δ in comparison to WT are summarized in Table 4.4. Only few DE genes were identified in 13-1Δ; six ORFs on day one, one ORF on day three and four ORFs on day five. No GO term enrichment was identified among the DE genes identified at each sampling time point. When all the DE genes in 13-1Δ from the three different time points were pooled and analyzed together, a few enriched GO terms were identified: Alcohol metabolic process, ergosterol, phytosteroid and cellular alcohol biosynthetic processes (Table 4.5 and Table 4.6). Due to the lack of strong evidence that 13-1 is a functional ORF in M2, the expression of 13-1 mRNA  in wild type M2 was tested by qRT-PCR with the day three samples collected from the Chardonnay fermentation. The threshold (CT) for 13-1 (22.77 ± 0.17 cycles) was found to be fairly close to that of the control gene, TAF10, (22.58 ± 0.25 cycles), confirming that 13-1 is transcribed in wild type M2.  Table 4.4 DE genes/ORFs identified in the 13-1 null mutant. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (6 ORFs) Day 3 (1 ORF) Day 5 (4 ORFs) TMA10 YPL272C UPC2 YNR014W SRX1 YAL065C -4.4 -3.9 -3.1 -3.1 3.1 3.2 1892 4910 2250 1899 580 220 BAP3 5.1 1993 PAU5,7 PAU17 HMG1 CYC1 -3.8 -3.4 3.5 3.7 2,360 1,365 1,315 934 aFC = fold change in comparison to WT. bSigI=signal intensity  Table 4.5 Biological process GO terms significantly enriched amongst DE genes in the 13-1 deletion mutant (no correction). All the genes identified to be DE in Table 4.4 across all time points were pooled together. The functions of the genes associated with the enriched GO terms are described in Table 4.6. GO term enrichment analyses were conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Alcohol metabolic process [GO:0006066] (7.11E-4) HMG1 (3.5) [d5] PBI1 (-3.9) [d1] UPC2 (-3.1) [d1] Ergosterol biosynthetic process [GO:0006696] (7.46E-4) Phytosteroid biosynthetic process [GO:0016129] (7.46E-4) Cellular alcohol biosynthetic process [GO:0044108] (7.46E-4) HMG1 (3.5) [d5] UPC2 (-3.1) [d1] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified  79   Table 4.6 Functions associated with DE genes identified in the GO term enrichment analysis for the 13-1 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes PBI1 Unknown function. Induced by ketoconazole (alter potassium homeostasis) UPC2 Sterol regulator element binding protein. Induces sterol biosynthetic genes  HMG1 HMG-CoA reductase involved in sterol biosynthesis   4.6.3 Deletion of 13-2 leads to repression of ZRT1 The ORFs identified to be DE in the 13-2 null mutant fermentation are listed in Table 4.7. More DE genes were identified on day one and three cell samples than on day five, indicating the potential involvement of 13-2 at early stages of fermentation. GO term enrichment analysis highlighted two groups of transporters that are affected by the deletion of 13-2: 1) nitrogen related transporters and 2) transition metal ion transporters (Table 4.8). A brief summary of the cellular functions associated with the DE genes identified in the enriched GO terms were retrieved from SGD and listed in Table 4.9. ORF 13-2 shares high sequence similarity with PUT3 in Zygosaccharomyces bailii (Z. bailii) (Cover 50 %, Ident. 96 %, E = 0.0), a transcription activator of the proline utilization pathway that binds to the promoters of PUT genes. Since a few PUT family genes were identified as DE genes in 13-2Δ, their expression levels were tested by qRT-PCR. The expression levels of PUT genes in M2, however, were not affected by the deletion of 13-2 (Appendix G). Other DE genes that are involved in nitrogen related pathways, such as MEP family genes (transporter of ammonium) and BAP3 (branched chain amino acid permease) were also screened by qRT-PCR, however, these also did not show any difference in the expression levels in the 13-2 null mutant (Appendix G).      80  Table 4.7 DE genes/ORFs in the 13-2 null mutant. Genes in grey colour were tested by qRT-PCR and found to be possible false positives. Genes in bold letters were identified as DE at more than one sampling time point. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (25 ORFs) Day 3 (19 ORFs) Day 5 (5 ORFs) YMR244W PRM7 ZRT1 THI73 CTR3 YAL065C SRX1 FRE1GFD2 FAR1 YLL053C PHM8 SRL3 PIG2 FHN1FMP16 HSP30 UPC2YPR015C YML083CYNR014W PIR3 SIP18 TMA10 YPL272C -5.2 -4.5 -3.9 -3.8 -3.7 -3.7 -3.3 -3.2 -3.1 -3.0 -3.0 3.0 3.0 3.1 3.3 3.3 3.3 3.5 3.8 3.9 3.9 4.0 4.0 4.7 5.2 211 2629 2332 886 120 194 552 1030 2475 110 494 723 2399 3277 4708 3473 1342 2534 453 1588 2354 5003 1108 2026 6535 PUT1 DAL7 DAL3 VHT1BIO3DUR3 MEP2 ZRT1CYB2 ADH4 DUR1,2 PUT4 UGA4 THI11 YJL133C-A HMG1 MUP1 GNP1 BAP3 -8.4 -5.5 -5.2 -4.9 -4.6 -4.5 -4.3 -3.9 -3.6 -3.3 -3.3 -3.2 -3.2 -3.1 -3.1 -3.0 3.7 4.0 14.3 1591 672 427 1570 423 1766 833 1655 175 1190 1755 183 415 3453 3458 376 1527 432 5546 MMT1HXT17 PUT1 MUP1 BAP3 -4.3 -3.2 -3.0 3.0 5.1 828 126 1612 1547 5646 aFC = fold change in comparison to WT. bSigI=signal intensity   Table 4.8 Enriched GO biological process terms amongst DE genes in the 13-2 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.7 were analysed for GO term enrichment, however, those that were identified to be not DE by qRT-PCR were excluded from the analysis. Genes in bold letters were identified as DE genes at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.9. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Transition metal ion transport [GO:0000041] (3.58E-4) Metal ion transport [GO:00300001] (1.85E-3) CTR3 (-3.7) FRE1 (-3.2) ZRT1 (-3.9) Copper ion import [GO:0015677] (4.60E-4) Copper ion transport [GO:0006825] (1.56E-3) CTR3 (-3.7) FRE1 (-3.2) Ion transport [GO:0006811] (2.82E-3) CTR3 (-3.7) FRE1 (-3.2) THI73 (-3.8) YLL053C (-3.0) ZRT1 (-3.9) Cellular response to chemical stimulus [GO:0070887] (3.31E-3) FAR1 (-3.0) HSP30 (3.3) SIP18 (4.0) SRX1 (-3.3) UPC2 (3.5) aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)     81  Table 4.8 (Continued)  GO Terms Genes/ORFsa (FCb) [dayc] Day 3 (Holm-Bonferroni correction) Ion transport [GO:0006811] (3.87E-3) DUR3 (-4.5) GNP1 (4.0) MEP2 (-4.3) MUP1 (3.7) PUT4 (-3.2) UGA4 (-3.2) VHT1 (-4.9) ZRT1 (-3.9) Cellular amide catabolic process [GO:0043605] (6.30E-3) DAL3 (-5.2) DAL7 (-5.5) DUR3 (-4.5) Day 5 (No correction)  Transmembrane transport [GO:0055085] (4.71E-4) HXT17 (-3.2) MMT1 (-4.3) MUP1 (3.0) All time points (Bonferroni correction) Ion transport [GO:0006811] (1.19E-4) CTR3 (-3.7) [d1] DUR3 (-4.5) [d3] FRE1 (-3.2) [d1] GNP1 (4.0) [d3] MEP2 (-4.3) [d3) MMT1 (-4.3) [d5] MUP1(3.7) [d3] MUP1 (3.0) [d5] PUT4 (-3.2) [d3] THI73 (-3.1) [d3] UGA4 (-3.2) [d3] VHT1 (-4.9) [d3] YLL053C (-3.0) [d1] ZRT1 (-3.9) [d1] ZRT1 (-3.9) [d3] Transmembrane transport [GO:0055085] (2.60E-4) CTR3 (-3.7) [d1] DUR3 (-4.5) [d3] GNP1 (4.0) [d3] HXT17 (-3.2) [d5] MEP2 (-4.3) [d3] MMT1 (-4.3) [d5] MUP1(3.7) [d3] MUP1 (3.0) [d5] PUT4 (-3.2) [d3] THI73 (-3.1) [d3] UGA4 (-3.2) [d3] VHT1 (-4.9) [d3] YLL053C (-3.0) [d1] ZRT1 (-3.9) [d1] ZRT1 (-3.9) [d3] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)     Table 4.9 Functions of DE genes identified in GO term enrichment analysis for the 13-2 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes CTR3 High-affinity copper transporter on the plasma membrane. DUR3 Plasma membrane transporter for urea and polyamines.  FRE1 Ferric reductase and cupric reductase (prior to uptake by transporters). GNP1 High-affinity glutamine permease.  HSP30 Negative regulator of the H+-ATPase Pma1p.Induced by ethanol treatment and weak organic acid, glucose limitation.  HXT17 Hexose transporter. Repressed by high levels of glucose.  MEP2 Ammonium permease involved in regulation of pseudohyphal growth.  MMT1 Putative metal transporter involved in mitochondrial iron accumulation.  MUP1 High-affinity methionine permease.  PUT4 Proline permease.  THI73 Putative plasma membrane permease for carboxylic acid uptake.  UGA4 GABA (gamma-aminobutyrate) permease. UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes. VHT1 High-affinity plasma membrane H+-biotin symporter. YLL053C Putative protein.  ZRT1 High-affinity zinc transporter on the plasma membrane.   82  To explore the possibility that 13-2p regulates the expression of ion transporters, the expression of ZRT1 (a high-affinity zinc uptake transmembrane transporter) (Zhao and Eide 1996), which was identified as DE in the 13-2 deletion mutant on both day one (3.9-fold decrease) and day three (3.9-fold decrease) of fermentation (Table 4.7), was tested by qRT-PCR. The expression of ZRT1 was confirmed to be downregulated by >5-fold in 13-2Δ on day three of Chardonnay fermentations (Section 4.7.1.1). Other metal ion transporters related genes identified to be DE include CTR3 (3.7-fold decrease, day one), a high-affinity copper transporter of the plasma membrane (Knight et al. 1996), FRE1 (3.2-fold decrease, day one), a ferric reductase and cupric reductase for their uptake (Dancis et al. 1990), and MMT1 (4.3-fold decrease, day five), a putative metal transporter involved in mitochondrial iron accumulation (Li and Kaplan 1997), all of which were downregulated (Table 4.7). VHT1, a high-affinity plasma membrane proton:biotin symporter (Stolz et al. 1999), and BIO3, an enzyme involved in biotin biosynthesis pathway (Phalip et al. 1999), were both found to be downregulated by 4.9-fold and 4.6-fold, respectively, on day three (Table 4.7). 4.6.4 Deletion of 13-4 results in upregulation of glucose transport and glycogen metabolic process related genes The ORFs identified to be DE in 13-4 NL mutant are listed in Table 4.10. Most of DE genes in the 13-4 null mutant were identified on day one. GO term analysis indicated the enrichment of genes involved in glucose transport and glycogen metabolic processes, which were observed to be upregulated (Table 4.11).      83   Table 4.10 DE genes/ORFs in the 13-4 null mutant. Genes in bold letters were identified as DE at more than one sampling time point.  ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (40 ORFs) Day 1 (Cont.) Day 3 (8 ORFs) PRM7 YMR244W GFD2 OYE3 FRE1 YAL065C AQY2 SRX1 SPO19 SYO1 MRD1 YOR378W DHR2 RRN7 SRL3 YSR3 ECL1 HES1 MTH1 YKR075C -8.0 -5.4 -4.8 -4.0 -3.9 -3.6 -3.4 -3.4 -3.3 -3.3 -3.2 -3.2 -3.1 -3.1 3.0 3.0 3.1 3.1 3.1 3.1 1465 201 1580 176 857 196 146 532 153 754 988 770 720 501 2431 2099 2978 3142 518 3926 EGO4 IGD1 SPI1 ALD4 PHM8 SIP18 HSP26 FHN1 FMP16 HXT2 FMP43 PIG2 RTS3 UPC2 HSP30 YPR015C YML083C YNR014W PBI1 TMA10 3.1 3.2 3.2 3.3 3.3 3.3 3.5 3.8 3.8 3.8 3.9 3.9 4.2 4.2 4.3 5.2 5.3 5.7 6.2 8.1 9378 2565 6244 10442 797 927 6787 5432 4040 1080 10867 4112 7752 3040 1757 623 2142 3455 7865 3497 CYC1 BIO5 HMG1 YNR075C-A YBL100W-A COS10 YBL005W-A BAP3 -4.8 -3.6 -3.4 3.1 3.8 4.1 4.9 6.1 204 247 330 319 8169 794 2227 2384 Day 5 (1 ORF) BAP3 3.3 3595 aFC = fold change in comparison to WT. bSigI=signal intensity   Table 4.11 Enriched GO biological process terms amongst DE genes in the 13-4 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.10 were analysed for GO term enrichment. Genes in bold letters were identified as DE genes at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.12. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium).  GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Regulation of glycogen metabolic process [GO:0070873] (1.04E-3) IGD1 (3.2) PIG2 (3.9) Response to abiotic (non-living) stimulus [GO:0009628] (1.63E-3) HSP26(3.5) HSP30(4.3) SIP18(3.3)   SPI1 (3.2) UPC2 (4.2) Alcoholic metabolic process [GO:0032881] (4.28E-3) ALD4 (3.3) HES1 (3.1) PBI1 (6.2) UPC2 (4.2) Day 3 (No correction) Amino acid transmembrane transport [GO:0003333] (7.65E-4) Organic acid transmembrane transport {GO:1903825} (1.21E-3) BAP3 (6.1) BIO5 (-3.6) aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)     84   Table 4.11 (Continued)  GO Terms Genes/ORFsa (FCb) [dayc] All time points (No correction) Alcohol metabolic process [GO:0006066] (1.39E-3) ALD4 (3.3) [d1] HES1 (3.1) [d1] HMG1 (-4.3) [d3] PBI1 (6.2) [d1] UPC2 (4.2) [d1] Regulation of glycogen metabolic process [GO:0070873] (1.62E-3) IGD1 (3.2) [d1] PIG2 (3.9) [d1] Sterol biosynthetic process [GO:0016126] (1.83E-3) HES1 (3.1) [d1] HMG1 (-4.3) [d3] UPC2 (4.2) [d1] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points.)     Table 4.12 Functions associated with DE genes identified in GO term enrichment analysis for the 13-4 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes ALD4 Mitochondrial aldehyde dehydrogenase. Required for growth on ethanol  BAP3 Branched amino acid permease BIO5 Putative transmembrane protein involved in the biotin biosynthesis HES1 Involved in the regulation of ergosterol biosynthesis  HMG1 HMG-CoA reductase responsible for a rate-limiting step in sterol biosynthesis  HSP26 Small heat shock protein with chaperone activity HSP30 Negative regulator of the H+-ATPase Pma1p IGD1 Cytoplasmic protein that inhibits Gdb1p glycogen debranching activity PBI1 Unknown function. Induced by ketoconazole (alter potassium homeostasis) PIG2 Putative phosphatase targeting Gsy2p (glycogen synthase) SIP18 Phospholipid-binding hydrophilin. Essential to overcome desiccation-rehydration process  SPI1 GPI-anchored cell wall protein involved in weak acid resistance  UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes  4.6.5 Deletion of 13-5 may affect copper or sterol transport The ORFs identified to be DE in 13-5Δ are listed in Table 4.13. The majority of DE genes were, again, identified in the sample collected on day one of fermentation. GO term enrichment analysis identified upregulation of sterol related genes and downregulation in ion transport (Table 4.14). In the day one sample, genes involved in the sterol transport, PDR11 and HES1, were upregulated by 3.2-fold and 3.4-fold, respectively, and the genes related to copper and iron ion transport, CTR3 and FRE1, were found to be downregulated by 3.2-fold and 3.8-fold, respectively (Table 4.13).    85  Table 4.13 DE genes/ORFs in the 13-5 null mutant. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (28 ORFs) Day 1 (Cont.) Day 3 (4 ORFs) PRM7 YMR244W YOR338W GFD2 MGA1 FRE1 OYE3 SRX1 AMF1 YAL065C NCA3 CTR3 RRN7 YLL053C -10.9 -6.2 -5.6 -4.9 -3.9 -3.8 -3.8 -3.6 -3.5 -3.4 -3.3 -3.2 -3.0 -3.0 1078 174 208 1553 370 880 184 508 708 208 2104 139 509 488 MPC3 PDR11 PRM4 HES1 UPC2 HSP30 YSR3 RTS3 FHN1 YNR014W YPR015C YML083C TMA10 YPL272C 3.2 3.2 3.2 3.4 3.4 3.5 3.7 3.8 4.3 4.8 4.9 5.6 6.6 7.0 8884 4087 1194 3442 2483 1430 2564 6942 6052 2913 582 2284 2834 8852 YEL076C-A COS10 YBL100W-A  YBL005W-A 3.1 3.2 4.3 5.6 365 609 9358 2537 Day 5 (7 ORFs) YEH1 CYC1 MOT3 FUI1 AAH1 ROX1 CYB5 3.0 3.4 3.5 3.6 3.8 4.4 8.5 3616 864 1236 1167 1071 3294 2902 aFC = fold change in comparison to WT. bSigI=signal intensity.  Table 4.14 Enriched GO biological process terms amongst DE genes in the 13-5 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.13 were analysed for GO term enrichment. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.15. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Sterol transport [GO:0015918] (1.92E-4) Organic hydroxy compound transport [GO:0015850] (5.90E-4) HES1 (3.4) PDR11 (3.2) UPC2  (3.4) Copper ion import [GO:0015677] (6.40E-4) CTR3 (-3.2) FRE1 (-3.8) Transmembrane transport [GO:0055085] (3.38E-3) AMF1 (-3.5) CTR3 (-3.2) MPC3 (3.2) PDR11 (3.2) UPC2  (3.4) YLL053C (-3.4) Ion transport [GO:0006811] (6.07E-3) AMF1 (-3.5) CTR3 (-3.2) FRE1 (-3.8) MPC3 (3.2) YLL053C (-3.4) Day 3 (No correction) Transposition, RNA-mediated {GO:0032197} (1.09E-3) YBL005W-A  (5.6)  YBL100W-A  (4.3) Day 5 (No correction) Sterol metabolic process [GO:0016125] (2.50E-5) Steroid metabolic process [GO:0008202] (2.64E-5) Alcohol metabolic process [GO:0006066] (4.52E-4) CYB5 (8.5) MOT3 (3.5) YEH1 (3.0) Small molecule metabolic process [GO:0044281] (1.19E-3) AAH1  (3.8) CYB5 (8.5) CYC1 (3.4) MOT3 (3.5) YEH1 (3.0) All time points (Holm-Bonferroni correction) Sterol metabolic process [GO:0016125] (3.25E-2) CYB5 (8.5) [d5] HES1 (3.4) [d1] MOT3 (3.5) [d5] UPC2  (3.4) [d1] YEH1 (3.0) [d5] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points.)     86  Table 4.15 Functions of DE genes identified in GO term enrichment analysis for the 13-5 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes AAH1 Adenine deaminase, involved in purine salvage  AMF1 Low-affinity NH4+ transporter CTR3 High-affinity copper transporter on the plasma membrane CYB5 Cytochrome b5 involved in the sterol and lipid biosynthesis pathways  CYC1 Cytochrome c. Electron carrier of mitochondrial intermembrane space  HES1 Involved in the regulation of ergosterol biosynthesis MOT3 Involved in repression of a subset of hypoxic genes by Rox1p MPC3 Mitochondrial pyruvate carrier (MPC) PDR11 Multidrug ATP-binding cassette (ABC) transporter. Also mediates sterol uptake when sterol biosynthesis is compromised  UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes YBL005W-A Transposable element gene YBL100W-A Transposable element gene  YEH1 Steryl ester hydrolase involved in sterol homeostasis YLL053C Encodes aquaporin (H2O channel)  4.6.6 Deletion of 13-6 leads to downregulation of genes constituting RNA polymerase I  The ORFs identified to be DE in 13-6 null mutant are summarized in Table 4.16; most of the DE genes were identified in the day one samples. The GO terms identified to be enriched are listed in Table 4.17, and a brief summary of the DE genes responsible for the identified GO terms are listed in Table 4.18. GO term enrichment analysis on day one DE genes identified the upregulation of genes involved in hexose transport and downregulation of genes involved in transcription initiation from RNA polymerase I promoter (Table 4.17). RRN11 and RRN7, both of which are required for transcription of 35S rRNA genes by RNA polymerase I, were both downregulated by 3.1-fold (Lalo et al. 1996) (Table 4.16). The expression of EGO4 (3.1-fold increase) and SPI1 (3.3-fold increase) are both reported to be controlled by Msn2p/Msn4p, a stress-responsive transcriptional activator (Martínez -Pastor et al. 1996; Schmitt and McEntee 1996; Görner et al. 1998; Estruch 2000; Boy-Marcotte et al. 2006). EGO4, a protein of unknown function, was reported to be involved in the TOR pathway especially at the point when the cells resume re-grow after the Rapamycin inhibition was removed (Dubouloz et al. 2005; Powis et al. 2015). PSI1 is a glycosylphosphatidylinositol (GPI) anchored cell wall protein identified to be highly expressed during the stationary phase of wine fermentation and was found to be involved in resistance to weak acidic environment (Puig and Pérez-Ortín 2000; Simões et al. 2006). Three PAU family genes, PAU5, PAU17  87  and PAU7 were found to be downregulated by 4.4-fold, 3.4-fold and 3.2-fold, respectively, on day five (Table 4.16). Table 4.16 DE genes/ORFs in the 13-6 null mutant. Genes in bold letters were identified as DE at more than one sampling time point. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (40 ORFs) Day 1 (Cont.) Day 3 (8 ORFs) PRM7 RRT5 PCL1 YMR244W GFD2 RFU1 SPO19 YAL065C FRE1 SYO1 DHR2 AAH1 MRD1 SRX1 YOR338W RRN11 RRN7 FAR1 JJJ3 RGI1 PDR11 EGO4 YKR075C YNL194C FHN1 -7.5 -4.7 -4.3 -4.1 -3.9 -3.9 -3.8 -3.7 -3.6 -3.5 -3.4 -3.3 -3.2 -3.2 -3.2 -3.1 -3.1 -3.0 -3.0 3.0 3.1 3.1 3.2 3.2 3.3 1575 403 340 265 1955 469 136 192 924 703 662 2128 969 564 360 621 489 112 277 15171 3921 9450 3958 625 4649 PRM4 SPI1 YBL100W-A  YJR115W PHM8 ALD4 FMP16 IGD1 ATO2 PIG2 ECL1 USV1 HXT5 UPC2 YML083C HSP30 YPR015C RTS3 HXT2 ISF1 YNR014W YPL272C MTH1 BAG7 TMA10 3.3 3.3 3.3 3.3 3.4 3.5 3.5 3.5 3.7 3.7 3.8 3.8 3.9 4.0 4.0 4.3 4.4 4.5 5.1 5.4 5.6 5.7 6.4 6.9 11.7 1252 6582 6117 1372 797 11213 3751 2818 545 3900 3568 656 730 2892 1628 1739 533 8280 1444 924 3373 7239 1054 1204 5048 PAU17 MUP1 RPR2 YIR014W NUT2 YBL100W-A  YBL005W-A  BAP3 -3.0 3.0 3.0 3.3 3.4 4.1 5.5 7.0 2154 1230 387 2871 1273 8877 2482 2725 Day 5 (13 ORFs) PAU5 TIR3 PAU17 PAU7 SET4 GEX1 ALK2 CYB2 MCM16 FAL1 YLR042C BAP3 CYC1 -4.4 -3.6 -3.4 -3.2 -3.2 -3.0 3.0 3.2 3.2 3.7 3.8 3.9 4.3 2122 622 1486 587 278 179 1298 1110 1421 2141 737 4268 1088 aFC = fold change in comparison to WT. bSigI=signal intensity  Table 4.17 Enriched GO biological process terms amongst DE genes in the 13-6 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.16 were analysed for GO term enrichment. Genes in bold letters were identified as DE at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.18. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Transcription initiation from RNA polymerase I promoter [GO:0006361] (2.47E-4) RRN7 (-3.1) RRN11 (-3.1) Energy reserve metabolic process [GO:0006112] (1.46E-3) IDG1  (3.5) PIG2 (3.7) RGI1 (3.0) Regulation of glycogen metabolic process [GO:0070873] (1.81E-3) IDG1  (3.5) PIG2 (3.7) aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)     88  Table 4.17 (Continued)  GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (Continued) Hexose transport [GO:0008645] (2.00E-3) HXT2 (5.1) HXT5 (3.9) MTH1 (6.4)  Sterol import [GO:0035376] (3.10E-3)  PDR11 (3.1) UPC2 (4.0) Day 3 (No correction) Amino acid transmembrane transport [GO:0003333] (7.65E-2) BAP3 (7.0) MUP1 (3.0) Day 5 (No correction) Anion transmembrane transport [GO:0098656] (9.96E-3) BAP3 (3.9) GEX1 (-3.0) Response to stress [GO:0006950] (1.74E-2) ALK2 (3.0) PAU5 (-4.4) PAU7 (-3.2) PAU17 (-3.4) TIR3 (-3.6) All time points (No correction) Transcription initiation from RNA polymerase I promoter [GO:0006361] (5.10E-4) RRN7 (-3.1) [d1] RRN11 (-3.1) [d1] Regulation of glycogen metabolic process [GO:0070873] (3.69E-3) IDG1  (3.5) [d1] PIG2 (3.7) [d1] Energy reserve metabolic process [GO:0006112] (4.11E-3) IDG1  (3.5) [d1] PIG2 (3.7) [d1] RGI1 (3.0) [d1] Hexose transport [GO:0008645] (5.59E-3) HXT2 (5.1) [d1] HXT5 (3.9) [d1] MTH1 (6.4) [d1] Sterol import [GO:0035376] PDR11 (3.1) [d1] UPC2 (4.0) [d1] Oxidation-reduction process [GO:0055114] (7.13E-3) ALD4 (3.5) [d1] CYB2 (3.2) [d5] CYC1 (4.3) [d5] IDG1  (3.5) [d1] ISF1  (5.4) [d1] FRE1 (-3.6) [d1] PIG2 (3.7) [d1] PRM4 (3.3) [d1] RGI1 (3.0) [d1] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points.)    Table 4.18 Functions associated with DE genes identified in GO term enrichment analysis for the 13-6 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes ALD4 Mitochondrial aldehyde dehydrogenase. Required for growth on ethanol ALK2 Protein kinase required for proper spindle positioning and nuclear segregation  BAP3 Branched amino acid permease CYB2 Cytochrome b2. Required for lactate utilization. Repressed by glucose and in anaerobic conditions  CYC1 Cytochrome c. Electron carrier of mitochondrial intermembrane space FRE1 Ferric reductase and cupric reductase (prior to uptake by transporters) GEX1 Proton:glutathione antiporter on vacuolar and plasma membranes  HXT2 High-affinity glucose transporter HXT5 Hexose transporter with moderate affinity for glucose  IDG1 Cytoplasmic protein that inhibits Gdb1p glycogen debranching activity ISF1 Glucose controlled protein. Participates in mitochondrial functions  MTH1 Negative regulator of the glucose-sensing signal transduction pathway  MUP1 High-affinity methionine permease  PAU17 Unknown function  PAU5 Induced during alcoholic fermentation, low temperature and anaerobic conditions  PAU7 Active during alcoholic fermentation, regulated by anaerobiosis, inhibited by O2  PDR11 Multidrug ATP-binding cassette (ABC) transporter. Also mediates sterol uptake when sterol biosynthesis is compromised   89  Table 4.18 (Continued)  DE genes Involved metabolic processes PIG2 Putative phosphatase targeting Gsy2p (glycogen synthase) PRM4 Pheromone-regulated protein likely involved in mating  RGI1 Unknown function. Involved in energy metabolism under respiratory conditions  RRN11 Component of the core factor (CF) rDNA transcription factor complex  RRN7 Component of the core factor (CF) rDNA transcription factor complex  TIR3 Cell wall mannoprotein. Expressed under anaerobic conditions  UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes  4.6.7 Deletion of 14-1 results in upregulation of various transporters The ORFs identified to be differentially expressed in 14-1 deletion mutant are shown in Table 4.19. Compared to other novel ORFs investigated in this study, few DE genes were identified in the 14-1 null mutant. Still the most number of DE genes were identified in the day one sample (Table 4.19). When DE genes were analysed for the GO term enrichment, general upregulation of the genes involved in sterol, hexose and amino acid transport and alcohol metabolism were identified (Table 4.20).  Table 4.19 DE genes/ORFs in the 14-1 null mutant. Genes in bold letters were identified as DE at more than one sampling time point. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day 1 (17 ORFs) Day 3 (12 ORFs) Day 5 (1 ORF) YJL133C-A YSR3 NRG2 UPC2 ISF1 MPC3 YKR075C FHN1 HES1 MTH1 YPR015C RTS3 YNR014W HXT2 YML083C PBI1 TMA10 3.0 3.0 3.1 3.1 3.2 3.2 3.6 3.8 3.8 3.8 4.1 4.2 4.2 4.3 4.5 5.2 7.1 5396 2077 4256 2231 547 8998 4516 5340 3853 631 487 7827 2515 1215 1836 6545 307 CYC1 BIO5 HMG1 MUP1 RPR2 YJU2 GNP1 COS10 YEL076C-A YBL100W-A  YBL005W-A  BAP3 -4.8 -4.3 -3.8 3.0 3.1 3.1 3.3 3.6 4.2 5.5 8.6 8.9 201 206 293 1222 405 396 358 696 494 11873 3866 3444 BAP3 3.5 3889 Day 8 (4 ORFs) YBL100W-A MRT4 YBL005W-A YMR244W -7.7 -5.0 -4.8 -4.3 620 689 226 393 aFC = fold change in comparison to WT. bSigI=signal intensity   90   Table 4.20 Enriched GO biological process terms amongst DE genes in the 14-1 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.19 were analysed for GO term enrichment. Genes in bold letters were identified as DE at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.21. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Sterol transport [GO:0015918] (1.44E-3) HES1 (3.8) UPC2 (3.1) Alcohol metabolic process {GO:0006066} (1.47E-3) HES1 (3.8) PBI1 (5.2) UPC2 (3.1) Organic substance transport [GO:00717202] (1.84E-3) HES1 (3.8) HXT2 (4.3) MPC3 (3.2) MTH1 (3.8) UPC2 (3.1) Hexose transport [GO:0008645] (2.01E-3) HXT2 (4.3) MTH1 (3.8) Day 3 (Holm-Bonferroni correction) Amino acid transmembrane transport [GO:0003333] (1.98E-3) BAP3 (8.9) BIO5 (-4.3) GNP1 (3.3) MUP1 (3.0) Day 8 (No correction) Transposition, RNA-mediated [GO:0032197] (1.09E-3) YBL005W-A  (-4.8) YBL100W-A (-7.7) All time points (Holm-Bonferroni correction) Organic acid transmembrane transport [GO:1903825] (2.71E-3) BAP3 (8.9) [d3] BAP3 (3.5) [d5] BIO5 (-4.3) [d3] GNP1 (3.3) [d3] MPC3 (3.2) [d1] MUP1 (3.0) [d3] Amino acid transmembrane transport [GO:0003333] (4.18E-2) BAP3 (8.9) [d3] BAP3 (3.5) [d5] BIO5 (-4.3) [d3] GNP1 (3.3) [d3] MUP1 (3.0) [d3] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)     Table 4.21 Functions associated with DE genes identified in the GO term enrichment analysis for the 14-1 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes HES1 Involved in the regulation of ergosterol biosynthesis  PBI1 Unknown function. Induced by ketoconazole (alter potassium homeostasis) MTH1 Negative regulator of the glucose-sensing signal transduction pathway  MPC3 Mitochondrial pyruvate carrier (MPC) HXT2 High-affinity glucose transporter BAP3 Branched amino acid permease GNP1 High-affinity glutamine permease  MUP1 High-affinity methionine permease  BIO5 Putative transmembrane protein involved in the biotin biosynthesis    91  4.6.8 Deletion of 14-2 leads to upregulation of a large set of genes involved in ribosome biogenesis and various metabolic processes The ORFs identified as DE in the 14-2 deletion mutant are listed in Table 4.22. The result of GO term enrichment analysis is summarized in Table 4.23, and the functions of DE genes identified in the enriched GO terms are listed in Table 4.24. No DE genes were identified on day five. A large set of DE genes were identified on day one and three, and the GO term analysis indicated an enrichment in genes involved in ribosome biogenesis, sterol metabolism and alcohol metabolism (Table 4.22). As GO term enrichment identified, many of the genes that are involved in transcription and translation such as RPA family genes (RNA polymerase I subunits) and UTP family genes (encode for preribosome and Small Subunit processome) were identified to be upregulated on day three in the 14-2 null mutant (Table 4.22 and Table 4.23). Likely due to upregulation of the genes involved in transcription and translation, 97% of the DE genes identified on day three showed an increase in expression. Genes that are often considered to be important during fermentation, such as ERG family genes (ERGosterol biosynthesis) were also observed to be upregulated on day three. One of the DE ORFs, YDR222W, which had an 8.6-fold increase in expression, was re-tested for transcript levels in wild type versus the 14-2 deletion mutant on day three of fermentation by qRT-PCR (Figure G.2). However, no difference in the expression of YDR222W in 14-2Δ was observed (RQ 0.76, p=0.3327) when cells were collected from the newly set up Chardonnay fermentation. This leads to the speculation that the obtained list of DE genes likely contains false positives.   92  Table 4.22 DE genes/ORFs in the 14-2 null mutant. Genes in bold letters were identified as DE genes at more than one sampling time point. ORF FCa SigIb ORF FCa SigIb ORF FCa SigIb Day1 (48 ORFs) Day 3 (97 ORFs) Day 3 (Cont.) PCL1 RRT5 PRM7 SPO19 FRE1 YAL065C HLR1 RRN11 DHR2 RFU1 GFD2 SYO1 YOX1 SRX1 YMR244W MRD1 RRN7 VTS1 GUT2 HSP26 RSB1 ECL1 MPC3  RGI1 EGO4 PHM8 ALD4 FMP16 YPR015C YJL144W YNL195C IGD1 YJL133C-A HXT2 PBI1 ATO2 SPI1 RTS3 HXT5 YNL194C USV1 ISF1 MTH1 YJR115W YNR014W BAG7 HSP30 TMA10 -9.5 -4.9 -4.1 -4.1 -3.6 -3.5 -3.4 -3.4 -3.3 -3.3 -3.2 -3.2 -3.2 -3.1 -3.1 -3.0 -3.0 -3.0 3.0 3.0 3.0 3.2 3.2 3.2 3.2 3.3 3.4 3.4 3.4 3.6 3.6 3.9 3.9 4.0 4.1 4.2 4.3 4.6 4.9 5.0 5.4 5.7 5.9 5.9 6.0 6.8 8.4 13.8 154 389 2834 126 924 207 362 555 682 553 2360 765 706 581 351 1051 505 856 3657 5954 1415 3008 9067 16470 9674 778 10912 3661 402 977 1542 3165 7087 1138 5135 608 8504 8446 916 975 922 980 978 2508 3615 1198 3393 5985 YJR151W-A ADH4 RDH54 ARX1 DHR2 ERG7 GCD10 HMT1 HPA2 MSC7 PUF6 RGS2 RPA34 RRN7 SLY41 URA7 YBR242W YHK8 YJU2 ATO2 ERB1 SOF1 SRP40 UTP14 UTP4 YGL101W YKR075C ALG5 NOC2 PDR12 PRP43 RPA43 SSF1 UTP5 ACA1 BFR2 DIA1 JID1 AAH1 NMD3 NOG1 RNH203 CYB5 ERG5 RPA49 VTS1 RNT1 SPB1 TRM11 -3.4 -3.3 -3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.1 3.1 3.1 3.1 3.1 3.1 3.1 3.1 3.2 3.2 3.2 3.2 3.2 3.2 3.2 3.3 3.3 3.3 3.3 3.4 3.4 3.4 3.4 3.5 3.6 3.6 3.6 3.7 3.7 3.7 128 1189 725 1907 1005 4887 1457 4786 2588 5909 3239 3105 2697 645 4054 1193 5290 558 392 2375 1521 1515 1205 1549 861 1826 1402 1021 1299 12588 2043 957 877 2150 1903 2307 4884 3321 5165 3828 2228 2125 11179 16713 1353 903 1060 649 1048 YEH1 YOL029C TRM82 UTP13 VHR2 YLR063W YOR378W ARE2 NOP58 SRX1 RKI1 TPA1 ERG11 NOP14 GPX2 YER053C-A FET3 GFD2 YJL107C MUP1 RIX1 FTR1 FUI1 YBL100W-A DIP5 ROX1 SUE1 SYO1 PRM7 YGR266W YLR108C RSA4 NOG2 ARO10 CYC1 HMG1 MOT3 PUT4 SRO9 YBR056W-A HMX1 YAP7 DBP2 CYB2 YDR222W YBL005W-A  STL1 GNP1 3.7 3.7 3.8 3.8 3.8 3.8 3.8 3.9 3.9 3.9 4.0 4.0 4.1 4.1 4.2 4.2 4.3 4.4 4.5 4.6 4.6 4.9 4.9 4.9 5.0 5.1 5.1 5.1 5.2 5.2 5.5 5.7 5.9 6.0 6.0 6.1 6.6 6.7 6.8 6.8 7.2 7.2 7.3 8.1 8.6 9.3 12.8 15.0 9066 3535 1968 1564 1765 582 2640 5375 6306 3547 1347 5751 15286 878 2741 5678 433 2575 665 1887 847 1033 4028 10499 1211 10889 5367 1792 1397 1374 5695 1109 4855 1350 5781 6804 3022 3986 3529 3377 2514 887 4094 5090 1472 4185 1686 1635 aFC = fold change in comparison to WT. bSigI=signal intensity   93    Table 4.23 Enriched GO biological process terms amongst DE genes in the 14-1 deletion mutant fermentation. Genes identified to be DE and listed in Table 4.22 were analysed for GO term enrichment. Genes in bold letters were identified as DE at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.24. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Transcription initiation from RNA polymerase I promoter [GO:0006361] (2.21E-4) RRN7 (-3.0) RRN11 (-3.4) Hexose transport [GO:0008645] (1.70E-3) HXT2 (4.0) HXT5 (4.9) MTH1 (5.9) Response to abiotic stimulus [GO:0009628] (4.49E-3) HSP26 (3.0) HSP30 (8.4) SPI1 (4.3) USV1 (5.4) YJL144W (3.6) Day 3 (Holm-Bonferroni correction) Ribosome biogenesis [GO:0042254] (2.70E-7) Ribonucleoprotein complex biogenesis [GO:0022613] (4.75E-6) ARX1 (3.0) BFR2 (3.3) NOP14 (4.1) SBP1 (3.7) SYO1 (5.1) RSA4 (5.7) UTP4 (3.1) UTP5 (3.2) ncRNA metabolic process [GO:0034660] (2.03E-3) BFR2 (3.3) NOP14 (4.1) PRP43 (3.2) RIX1 (4.6) SBP1 (3.7) SSF1 (3.2) TRM82 (3.8) UTP4 (3.1) UTP5 (3.2) Organic hydroxy compound metabolic process [GO:1901615] (3.58E-3) ADH4 (-3.3) ALG5 (3.2) ARE2 (3.9) ARO10 (6.0) CYB2 (8.1) CYB5 (3.5) ERG5 (3.6) ERG7 (3.0) ERG11 (4.1) HMG1 (6.1) MOT3  (6.6) RKI1 (4.0) YEH1 (3.7) Sterol metabolic process [GO:0016125] (4.11E-3) ARE2 (3.9) CYB5 (3.5) ERG5 (3.6) ERG7 (3.0) ERG11 (4.1) HMG1 (6.1) MOT3  (6.6) YEH1 (3.7) rRNA processing [GO:0006364] (9.50E-3) BFR2 (3.3) DHR2 (3.0) NOP14 (4.1) PRP43 (3.2) RIX1 (4.6) SBP1 (3.7) SSF1 (3.2) UTP4 (3.1) UTP5 (3.2) Alcohol metabolic process [GO:0006066] (2.01E-2) ADH4 (-3.3) ALG5 (3.2) ARE2 (3.9) ARO10 (6.0) CYB5 (3.5) ERG5 (3.6) ERG7 (3.0) ERG11 (4.1) HMG1 (6.1) MOT3  (6.6) YEH1 (3.7) aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)      94  Table 4.23 (Continued)  GO Terms Genes/ORFsa (FCb) [dayc] All time points (Holm-Bonferroni correction) Ribosome biogenesis [GO:0042254] (1.05E-4) ARX1 (3.0) [d3] BFR2 (3.3) [d3] NPO14 (4.1) [d3] RSA4 (5.7) [d3] SBP1 (3.7) [d3] SYO1 (-3.2) [d1) SYO1 (5.1) [d3) UTP4 (3.1) [d3] UTP5 (3.2) [d3] Organic hydroxy compound metabolic process [GO:1901615] (6.06E-4) ADH4 (-3.3) [d3] ALD4 (3.4) [d1] ALG5  (3.2) [d3] ARE2 (3.9) [d3] ARO10 (6.0) [d3] CYB2 (8.1) [d3] CYB5 (3.5) [d3] ERG5 (3.6) [d3] ERG7 (3.0) [d3] ERG11 (4.1) [d3] GUT2 (3.0) [d1] HMG1 (6.1) [d3] MOT3  (6.6) [d3] PBI1 (4.1) [d1] RKI1 (4.0) [d3] YEH1 (3.7) [d3] Alcohol metabolic process [GO:0006066] (2.43E-3) ADH4 (-3.3) [d3] ALD4 (3.4) [d1] ALG5  (3.2) [d3] ARE2 (3.9) [d3] ARO10 (6.0) [d3] CYB5 (3.5) [d3] ERG5 (3.6) [d3] ERG7 (3.0) [d3] ERG11 (4.1) [d3] GUT2 (3.0) [d1] HMG1 (6.1) [d3] MOT3  (6.6) [d3] PBI1 (4.1) [d1] YEH1 (3.7) [d3] Sterol metabolic process [GO:0016125] (3.84E-2) ARE2 (3.9) [d3] CYB5 (3.5) [d3] ERG5 (3.6) [d3] ERG7 (3.0) [d3] ERG11 (4.1) [d3] HMG1 (6.1) [d3] MOT3  (6.6) [d3] YEH1 (3.7) [d3] Maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8 rRNA, LSU-rRNA) [GO:0000462] (4.59E-2) BFR2 (3.3) [d3] DHR2 (-3.3) [d1] DHR2 (3.0) [d3] MRD1 (-3.0) [d1] NOP14 (4.1) [d3] NOP58 (3.9) [d3] PRP43 (3.2) [d3] SOF1 (3.1) [d3] UTP4 (3.1) [d3] UTP5 (3.2) [d3] UTP13 (3.8) [d3] UTP14 (3.1) [d3] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)    Table 4.24 Functions associated with DE genes identified in GO term enrichment analysis for the 14-2 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes ALD4 Mitochondrial aldehyde dehydrogenase. Required for growth on ethanol ADH4 Alcohol dehydrogenase ALG5 Glucosyltransferase involved in asparagine-linked glycosylation in ER ARE2 Sterol acyltransferase in ER ARO10 Phenylpyruvate decarboxylase ARX1 Nuclear export factor for ribosomal pre-60S subunit BFR2 Component of the SSU and 90S preribosomes CYB2 Cytochrome b2. Required for lactate utilization. Repressed by glucose and in anaerobic conditions CYB5 Cytochrome b5 involved in the sterol and lipid biosynthesis pathways DHR2 ATP-dependent RNA helicase required for 18S rRNA synthesis ERG11 Member of cytochrome P450 family involved in ergosterol biosynthesis   95  Table 4.24 (Continued) DE genes Involved metabolic processes ERG5 C-22 sterol desaturase involved in ergosterol biosynthesis  ERG7 Lanosterol synthase involved in ergosterol biosynthesis  HMG1 HMG-CoA involved in sterol biosynthesis  HSP26 Small heat shock protein with chaperone activity HSP30 Negative regulator of the H+-ATPase Pma1p.Induced by ethanol treatment and weak organic acid, glucose limitation HXT2 High-affinity glucose transporter HXT5 Hexose transporter with moderate affinity for glucose  MOT3 Involved in repression of a subset of hypoxic genes by Rox1p MTH1 Negative regulator of the glucose-sensing signal transduction pathway  NOP14 Nuclear protein required for processing of pre-18S rRNA PRP43 RNA helicase required for efficient biogenesis of both small- and large-subunit rRNAs RIX1 Component of the pre-60S ribosomal particle RRN11 Component of the core factor (CF) rDNA transcription factor complex RRN7 Component of the core factor (CF) rDNA transcription factor complex RSA4 Involved in ribosome biogenesis SBP1 Protein that binds eIF4G and has a role in repression of translation SPI1 GPI-anchored cell wall protein involved in weak acid resistance  SSF1 Constituent of 66S pre-ribosomal particles SYO1 Transport adaptor or symportin required for biogenesis of the large ribosomal subunit  TRM82 Catalytic subunit of a tRNA methyltransferase complex USV1 Putative transcription factor containing a C2H2 zinc finger, mutation affects transcriptional regulation of genes involved in growth on non-fermentable carbon sources  UTP4 Subunit of U3-containing 90S preribosomes and SSU processome complexes UTP5 Subunit of U3-containing Small Subunit (SSU) processome complex YEH1 Steryl ester hydrolase involved in sterol homeostasis YJL144W Cytoplasmic hydrophilin essential in desiccation-rehydration process  4.6.9 Deletion of 14-4 leads to upregulation of genes involved in glycogen, sterol and alcohol metabolism  The ORFs identified to be DE in the 14-4 NL mutant are listed in Table 4.25. The result of GO term enrichment analyses is shown in Table 4.26, and the functions of DE genes identified in the enriched GO terms are listed Table 4.27. Although a higher number of DE genes are identified on day one and three, the deletion of 14-4 resulted in the identification of a relatively fair number of DE genes on day five compared to other novel ORFs investigated in this study (Table 4.25). A wide range of metabolic pathways including, glycogen metabolism, sterol biosynthesis and alcohol metabolism were observed to be generally upregulated in the 14-4 null mutant on days one, three and four (Table 4.25). RRN7 and RRN11, components of RNA polymerase I, however, were observed to be down-regulated on day one  96  (Table 4.25). On day three, STL1, a glycerol proton symporter on the plasma membrane, was found to be upregulated by 25-fold in expression. Since increased expression of STL1 is reported under the osmotic stress (Zhao et al. 1994; Ferreira et al. 2005), increase in STL1 expression may reflect a change in cellular component leading to sensitivity to osmotic pressure. Table 4.25 Summary of differentially expressed (DE) genes/ORFs in 14-4 null mutant. Genes in bold letters were identified as DE genes at more than one sampling time point. ORF FCa Signal ORF FCa Signal ORF FCa Signal Day1 (49 ORFs) Day 1 (Cont.) Day 3 (Cont.) AAH1 ALD4 ATO2 BAG7 DHR2 ECL1 FHN1 FMP16 MPC3 FRE1 GFD2 HSP30 HXT2 HXT5 IGD1 ISF1 JJJ3 MRD1 MTH1 PCL1 PHO84 PIG2 PRM4 PRM7 RFU1 RRN11 RRN7 RRT5 RTS3 SPI1 SPO19 SYO1 TMA10 TOD6 UBC11 -3.1 3.9 3.6 6.0 -3.6 3.2 3.2 3.3 3.3 -3.6 -4.0 3.4 5.4 4.3 3.3 5.8 -3.4 -3.4 7.1 -4.2 -3.1 3.2 3.0 -6.5 -4.0 -3.4 -3.2 -5.1 4.9 3.3 -5.1 -3.5 13.7 -3.0 -3.4 2281 12469 529 1042 614 2985 4478 3513 9253 915 1917 1398 1520 807 2667 987 248 928 1172 352 125 3353 1109 1822 450 560 480 370 9061 6523 101 707 5934 601 119 UPC2 USV1 YAL065C YJL133C-A YJR115W YKR075C YML083C YMR244W YNL194C YNR014W EGO4 YOR338W YPL272C YPR015C 3.3 3.2 -4.4 3.8 3.3 3.6 3.7 -4.3 3.5 5.6 3.0 -4.4 4.3 3.8 2357 547 162 6874 1412 4517 1481 252 669 3387 9018 263 5418 456 TIR3 YAP7 YBL005W-A YBL100W-A  YBR056W-A YER053C-A YGR266W YJL107C YKR075C YLR108C -3.2 3.7 5.4 3.9 4.0 3.5 3.6 3.9 3.0 3.7 1376 453 2430 8309 2000 4758 971 570 1364 3884  Day 5 (24 ORFs) COS10 CYB2 CYB5 CYC1 ERG3 HES1 HMG1 HMX1 HPA2 PAU17 PAU5 PAU7 PBI1 PDR11 PUT4 RNH203 ROX1 SET4 TIR1 TIR3 TIR4 YER053C-A YML083C YNR071C -3.2 6.9 5.6 10.6 3.1 -3.2 6.9 3.9 6.0 -4.6 -5.2 -4.8 -3.2 -4.3 4.7 3.1 3.9 -4.1 -3.4 -5.4 -4.5 3.2 -3.5 -3.4 111 2394 1902 2664 4717 612 2583 1184 3361 1108 1724 389 534 1871 702 2878 219 4393 422 1835 5161 740 903 2374  Day 3 (31 ORFs) ARO10 ARO9 CYB2 CYC1 DBP2 DIP5 ERG11 FET3 FTR1 GNP1 HMG1 HMX1 MOT3 PAU17 PAU7 PUT4 ROX1 RSA4 SRO9 STL1 SUE1 8.7 4.5 7.2 4.5 3.7 5.2 3.0 4.1 4.0 8.5 3.8 4.4 4.1 -3.7 -3.4 5.7 3.6 3.1 3.5 25.2 4.0 1942 1537 4527 4384 2080 1269 11175 412 843 931 4278 1540 1905 1303 1623 3378 7777 607 1791 3324 4173 aFC = fold change in comparison to WT. bSigI=signal intensity   97  Table 4.26 Biological process GO terms found to be significantly enriched in 14-4 deletion mutant. Genes identified to be DE and listed in Table 4.25 were analysed for GO term enrichment. Genes in bold letters were identified as DE genes at more than one sampling time point. Corrections for GO term enrichment analysis were applied if any enrichment was still obtained after the correction. The functions of the genes associated with the enriched GO terms are described in Table 4.27. GO term enrichment analysis was conducted through YeastMine (Ashburner et al. 2000; The Gene Ontology Consortium). GO Terms Genes/ORFsa (FCb) [dayc] Day 1 (No correction) Transcription initiation from RNA polymerase I [GO:0006361] (2.21E-4) RRN7 (-3.2) RRN11 (-3.4) Regulation of glycogen metabolic process [GO:0070873] (1.62E-3) IGD1 (3.3) PIG2 (3.2) Hexose transport [GO:0008645] (1.70E-3) HXT2 (5.4) HXT5 (4.3) MTH1 (7.1) Day 3 (No correction)   Anion transmembrane transport [GO:0098656] (1.34E-5) DIP5 (5.2) FET3 (4.1) FTR1 (4.0) GNP1 (8.5) PUT4 (5.7) Iron assimilation [GO:0033212] (1.87E-5), Iron assimilation by reduction and transport [GO:0033215] (1.87E-5), Arsenate ion transmembrane transport [GO:1901684] (1.87E-5), High-affinity iron ion transmembrane transport [GO:0006827] (5.58E-5), Iron ion transmembrane transport [GO0034755] (1.85E-4) FET3 (4.1) FTR1 (4.0) Ergosterol biosynthetic process [GO:0006696] (2.86E-4) ERG11 (3.0) HMG1 (3.8) MOT3 (4.1) Alcohol biosynthetic process [GO:0046165] (4.50E-4) ARO110 (8.7) ERG11  (3.0) HMG1 (3.8) MOT3 (4.1) Day 5 (No correction) Sterol biosynthetic process [GO:0016126] (1.43E-5) CYB5 (5.6) ERG3 (3.1) HES1 (-3.2) HMG1 (6.9) Organic hydroxy compound metabolic process [GO:1901615] (2.65E-5) CYB2 (6.9) CYB5 (5.6) ERG3 (3.1) HES1 (-3.2) HMG1 (6.9) PBI1 (-3.2) Alcohol metabolic process [GO:0006066] (1.46E-4) CYB5 (5.6) ERG3 (3.1) HES1 (-3.2) HMG1 (6.9) PBI1 (-3.2) All time points (Holm-Bonferroni correction) Sterol biosynthetic process [GO:0016126] (2.70E-3) CYB5 (5.6) [d5] ERG11 (3.0) [d3] HES1 (-3.2) [d5] HMG1 (3.8) [d3] HMG1 (6.9) [d5] MOT3 (4.1) [d3] UPC2 (3.3) [d1] Organic hydroxy compound metabolic process [GO:1901615] (2.69E-2) ALD4 (3.9) [d1] ARO110 (8.7) [d3] CYB2 (7.2) [d3] CYB2 (6.9) [d5] CYB5 (5.6) [d5] ERG3 (3.1) [d3] ERG11 (3.0) [d3] HES1 (-3.2) [d5] HMG1 (3.8) [d3] HMG1 (6.9) [d5] MOT3 (4.1) [d3] PBI1 (-3.2) [d5] UPC2 (3.3) [d1] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)   98   Table 4.26 (Continued)  GO Terms Genes/ORFsa (FCb) [dayc] Alcohol metabolic process [GO:006066] (3.74E-2) ALD4 (3.9) [d1] ARO110 (8.7) [d3] CYB5 (5.6) [d5] ERG3 (3.1) [d3] ERG11 (3.0) [d3] HES1 (-3.2) [d5] HMG1 (3.8) [d3] HMG1 (6.9) [d5] MOT3 (4.1) [d3] PBI1 (-3.2) [d5] UPC2 (3.3) [d1] Alcohol biosynthetic process [GO:0046165] (4.69E-2) ARO110 (8.7) [d3] CYB5 (5.6) [d5] ERG3 (3.1) [d3] ERG11 (3.0) [d3] HES1 (-3.2) [d5] HMG1 (3.8) [d3] HMG1 (6.9) [d5] MOT3 (4.1) [d3] UPC2 (3.3) [d1] aList of genes leading to the identified GO term(s). bFC = fold change in comparison to WT. cThe day when the DE gene was identified (indicated only for the pooled GO term analysis using the DE genes from all three sampling time points)    Table 4.27 Functions associated with DE genes identified in GO term enrichment analysis in 14-4 null mutant. The descriptions were obtained from SGD. DE genes Involved metabolic processes ALD4 Mitochondrial aldehyde dehydrogenase. Required for growth on ethanol ARO10 Phenylpyruvate decarboxylase responsible for the first step in the Ehrlich pathway CYB2 Cytochrome b2. Required for lactate utilization. Repressed by glucose and in anaerobic conditions CYB5 Cytochrome b5 involved in the sterol and lipid biosynthesis pathways DIP5 Dicarboxylic amino acid permease. High-affinity transporter of Gln, Asn, Ser, Ala, and Gly  ERG11 Member of cytochrome P450 family involved in ergosterol biosynthesis pathway  ERG3 C-5 sterol desaturase, down-regulated when ergosterol in excess FET3 Required for high-affinity iron uptake, and involved in mediating resistance to copper ion toxicity FTR1 High-affinity iron permease  GNP1 High-affinity glutamine permease HES1 Involved in the regulation of ergosterol biosynthesis HMG1 HMG-CoA reductase responsible for a rate-limiting step in sterol biosynthesis HXT2 High-affinity glucose transporter HXT5 Hexose transporter with moderate affinity for glucose  IGD1 Cytoplasmic protein that inhibits Gdb1p glycogen debranching activity MOT3 Involved in repression of a subset of hypoxic genes by Rox1p MTH1 Negative regulator of the glucose-sensing signal transduction pathway PBI1 Unknown function. Induced by ketoconazole (alter potassium homeostasis) PIG2 Putative phosphatase targeting Gsy2p (glycogen synthase) PUT4 Proline permease RRN11 Component of the core factor (CF) rDNA transcription factor complex RRN7 Component of the core factor (CF) rDNA transcription factor complex UPC2 Sterol regulatory element binding protein. Induces sterol biosynthetic genes  99  4.7 Experiments conducted for each novel ORF Based on the phenotypes obtained from the fermentation experiments, growth curve analysis, GFP localization study and microarray screening, various experiments were designed for each novel ORF to investigate their potential function. 4.7.1 Results of functional analysis specific to 13-2 4.7.1.1 The expression of ZRT1 is suppressed in 13-2Δ The protein sequence analysis predicts that 13-2 encodes for a transcription factor, and GFP-tagged 13-2p was observed to localize in the nucleus (Section 4.5). Initially, this ORF was predicted to be involved in proline metabolism as high protein sequence similarities (Cover 50 %, Ident 96 %, E = 0.0) to PUT3, a transcriptional activator for proline utilization genes, in Z. bailii was identified. Z. bailii is thought to be the origin of the segment of DNA with the novel ORFs investigated in this study (Novo et al. 2009). Since proline is one of the most abundant amino acids in grapes (Bell and Henschke 2005), and some PUT family genes (PUT1, PUT4) were identified to be DE in the 13-2 null mutant, the possibility that 13-2 is involved in proline metabolism was examined. However, deletion of 13-2 was observed not to affect the expression of PUT1 and PUT2 by qRT-PCR (Figure G.1).  Several other DE genes identified with microarray including MEP family genes (ammonium permease), BAP3 (Branched-chain amino acid permease) and ZRT1 (a high-affinity zinc transporter) were also screened by qRT-PCR (Figure G1). Microarray results identified the downregulation of ZRT1 by 3.9-fold on days one and three (Table 4.7), and qRT-PCR confirmed that the deletion of 13-2 suppressed the expression of ZRT1 (a high-affinity zinc transporter) by 5-fold on day three (Figure 4.6).   100   Figure 4.6 Relative expressions of ZRT1 in wild type M2 and 13-2 null (NL) mutant at day three of Chardonnay fermentation (n = 3). (RQ 0.17 ± 0.09, p = 0.0016)  To test if the expression of a low-affinity zinc transporter, ZRT2, is affected by the deletion of 13-2, ZRT2 was also screened by qRT-PCR (Figure 4.7). In this experiment, the 13-2 OE mutant was also included. The expression of both ZRT1 (RQ 0.36 or 2.8-fold decrease, p = 0.0016) and ZRT2 (RQ 0.57 or 1.8-fold decrease, p = 0.0086) were found to be reduced by the deletion of 13-2 (Figure 4.7). The overexpression of 13-2, however, did not lead to an increase in the expression level of ZRT1 or ZRT2 (Figure 4.7). Relative Quantity     (13-2NL: RQ 0.36, p = 0.0016) (13-2OE: RQ 0.68 p = 0.0719) (13-2NL: RQ 0.57, p = 0.0086) (13-2OE: RQ 0.93 p = 0.5708) (13-2NL: RQ 1.6E-5, p = 0.0001) (13-2OE: RQ 21.5 p = 0.0000)  Figure 4.7 Comparison of ZRT1 and ZRT2 expression levels in wild type 13-2 null and 13-2 overexpression strains (n = 3). The samples collected on the day one of the Chardonnay fermentation were used. The expression level of 13-2 is also shown. The relative quantity was calculated for each gene against the wild type value.   1.0 0.17 0.00.20.40.60.81.01.21.4ZRT1Relative Quantity WT13-2NL1.0 1.0 0.36 0.57 0.68 0.93 0.00.20.40.60.81.01.2ZRT1 ZRT2WT 13-2NL 13-2OE1.0 0.00 21.5 0.05.010.015.020.025.013-2WT 101  To test if 13-2 regulates ZRT1 promoter region, 1034 bp upstream of ZRT1 was inserted to pCW5 plasmid immediate upstream of the lacZ gene. Wild type M2, 13-2Δ and 13-2 OE were transformed with this plasmid. ZAP1 is a known transcription factor for zinc transporters (Zhao and Eide 1997), and to compare the effect of 13-2 and ZAP1 as well as their interaction on ZRT1 expression, ZAP1 null mutant and 13-2+ZAP1 double homozygous null mutant were also constructed and transformed with the plasmid. The cells used for the -galactosidase assay experiment were grown in YPD as the suppression of ZRT1 in 13-2 was observed to be stronger in YPD than in Chardonnay must: ZRT1 was observed to be suppressed by ~5-fold (Figure 4.6) in Chardonnay must, while it was suppressed by ~18-fold in YPD (Figure H.1).      p = 1.37E-6 p = 2.67E-3 p = 3.18E-7 (a) p = 2.95E-7     (b) p = 0.1429 Figure 4.8 The ORF 13-2 is required for optimal expression from the Zap1 regulated ZRT1 promoter (n = 3). Cells were grown overnight in YPD. P-values indicate the difference in comparison to WT. For 13-2+ZAP1double null mutant, (a) is the p-value in comparison to WT, and (b) is the p-value in comparison to ZAP1 null.   Expression from the ZRT1 promoter-lacZ fusion was confirmed to be decreased by 2.8-fold (p = 1.37E-6) in the 13-2 null mutant (Figure 4.8). However, the reduction of ZRT1 expression was more pronounced in the ZAP1 deletion mutant, where ZRT1-lacZ expression was reduced by 13.4-fold (p = 3.18E-7). Similar to the qRT-PCR result (Figure 4.7), an increase in ZRT1-lacZ expression was not 175.8 63.0 154.9 13.1 11.3 0.050.0100.0150.0200.0WT  13-2null  13-2oex  Zap1null  13-2+Zap1null-gal Activity  102  observed in the 13-2 OE mutant (Figure 4.8). To test if there was an interaction between ZAP1 and 13-2, the double null mutant was constructed and assayed for ZRT1-lacZ expression.  The 13-2+ZAP1 double null mutant showed slightly higher fold change (15.6-fold reduction, p = 2.97E-7) than the ZAP1 single null mutant (13.4-fold change, p = 3.18E-7), however, the difference between the two mutants (p = 0.1429) was not significant at = 0.05.  4.7.1.2 pH dependent growth phenotype is associated with the deletion of 13-2 Although the PUT family genes were found not to be affected in the 13-2 null mutant, at first 13-2 was hypothesized to be involved in nitrogen metabolism related pathways due to the sequence similarity to PUT3 in Z. bailii. Before the expression change with ZRT1 in 13-2 was confirmed by qRT-PCR (Figure 4.6), the phenotype of the 13-2 null mutant was screened on media containing various nitrogen sources: proline, glutamic acid, arginine, urea, ammonium sulfate (AS) and diammonium hydrogen phosphate (DAP). AS and DAP are economical nitrogen sources and are the two most commonly used nitrogen supplements in wine making.   Ammonium Sulfate (AS)  (NH4)2SO4 (2000 mg N/L) Diammonium Hydrogen Phosphate (DAP) (NH4)2HPO4 (2000 mg N/L) OD500    Time (H)  Figure 4.9 The 13-2 null mutant has a slow growth phenotype when using DAP as a sole nitrogen source (n = 7). Cells were grown at 19 °C, and the optical density was measured at 420-580 nm every 15 min for 72 hours.  0.00.51.01.52 14 26 38 50 62WT13-2Null0.00.51.01.52 14 26 38 50 62WT13-2Null 103   Wild type M2 grew slowly in DAP medium compared to AS medium, however, the 13-2 null mutant had severely delayed growth when DAP was used as the sole nitrogen source (Figure 4.9). Both AS and DAP provide nitrogen in an ammonium ion form (NH4+). However, the 13-2 null mutant displayed no growth defect in AS media (Figure 4.9). Therefore, components other than the ammonium ion were likely responsible for the slow growth phenotype of the 13-2 null mutant in DAP media. First, the addition of hydrogen phosphate (HPO42-) as potassium hydrogen phosphate (K2HPO4) to the AS media was explored; however, no phenotype difference was observed (Figure H.3).                        (a)        (b)                        (c)         (d)   Figure 4.10 Growth rate of the 13-2 null mutant on DAP and AS media at different pH levels. The 13-2 null mutant grows slowly on (a) pH 7.5 DAP medium but displays normal growth on (b) pH 4.5 DAP medium. Raising the pH of AS medium did not result in the slow growth of 13-2 (c, d). The same cell culture of each strain/mutant was spotted on all four plates shown.  Another major difference between AS and DAP media was identified to be the pH. When DAP is added at a higher dosage, dissociation of hydrogen phosphate (HPO42-) raises the pH. The pH of the AS and DAP media used in the growth curve analysis in Figure 4.9 was determined to be 4.11 and 7.26,  104  respectively. To test the hypothesis that high pH was responsible for the slow growth of the 13-2 null mutant, the pH of the DAP medium was lowered to pH 4.5. The spot assay conducted on DAP medium at pH 7.5 versus 4.5 showed that the slow growth phenotype associated with the 13-2 null mutant in DAP medium at pH 7.5 can be rescued when the pH of the DAP medium is adjusted to an acidic pH range (Figure 4.10a,b).  To test if the slow growth phenotype of the 13-2 null mutant was observed by raising the pH of AS medium, the pH was gradually raised up to as high as pH 8.0 (Figure 4.10c,d); however, similar slow growth phenotype observed on DAP medium (Figure 4.10a) was not observed. At pH 8.5, none of the strains grew in AS medium (image not shown). Although cells took longer to grow at higher pH in general, cells on the AS medium plate at pH 7.5 took a much shorter time (two days, Figure 4.10c) to grow compared to DAP media at pH 7.5 (five days, Figure 4.10a).  The components of DAP and AS media are summarized in Table 4.35. To test whether sulfate (SO42-) in AS medium is playing any role in the absence of slow growth phenotype of 13-2 null mutant at high pH, a DAP plate with K2SO4 addition was tested. At around pH 7.5, a small change in pH was found to be detrimental in DAP medium, and the growth of all three strains were affected (Figure 4.11). Although the addition of K2SO4 resulted in a superior survival of 13-2 OE mutant, unlike the normal growth observed on AS medium at pH 7.5 and 8.0 (Figure 4.10c,d) the growth of 13-2Δ was completely suppressed, and that of M2 wild type was also strongly affected (Figure 4.11). Table 4.28 The components of DAP and AS media.  DAP Medium AS Medium YNB w/o amino acids and AS YNB w/o amino acids and AS Glucose Glucose (NH4)2HPO4 (NH4)2SO4   105   Figure 4.11 Addition of K2SO4 to DAP as the sole nitrogen source. The cells were grown overnight and diluted to OD600 = 0.3. For serial dilutions, cells were diluted by 10x. The plates were incubated at 30 °C. The same cell culture of the designated strain was spotted on both plates. 13-2Δ = homozygous diploid null mutant. P_13-2 = homozygous OE mutant under the control of the PGK1 promoter.  4.7.1.3 The connection between pH, sulfate and zinc The high-affinity sulfate permeases, SUL1 and SUL2, are documented to regulate the endogenous sulfate concentration (Cherest et al. 1997).  Since the connection between sulfate and high pH was initially unclear, the involvement of glutathione was investigated as it is known to be involved in various stress conditions especially against oxidative stresses. In many cases, reactive oxygen species are observed to increase in stress conditions for unknown reasons. To test this hypothesis, the expression of SUL1, SUL2, and GLR1, glutathione oxidoreductase, was screened by qRT-PCR in the 13-2 NL and OE mutants (Figure 4.12). The expression of SUL1 (RQ 0.57, p = 0.0002) and SUL2 (RQ 0.56, p = 0.0011) were reduced in 13-2Δ. However, similar to ZRT1 expression, SUL1 and SUL2 expression was not affected in the 13-2 OE mutant. The level of GLR1 was not affected in either 13-2Δ or 13-2 OE mutant (RQ 1.0, p = 0.5070) (Figure 4.12).   13-2NL (RQ0.57, p=0.0002) 13-2OE (RQ1.1, p=0.3559) 13-2NL (RQ0.56, p=0.0011) 13-2OE (RQ1.2, p=0.02442) 13-2NL (RQ1.0, p=0.5070) 13-2OE (RQ0.87, p=0.0024)  Figure 4.12 Expression levels of SUL1, SUL2 and GLR1 in 13-2 null and overexpression mutants. Cells were grown aerobically for two days in DAP as the sole nitrogen source media at pH 7.26.  1.0 1.0 1.0 0.57 0.56 1.0 1.1 1.2 0.87 0.00.51.01.5SUL1 SUL2 GLR1Relative Quantity WT 13-2NL 13-2OE 106  4.7.2 Phenotype screening for 13-6: Overexpression results in sensitivity to K2S2O5 Protein sequence analysis of 13-6 identified Flo11 superfamily domain (Table 4.1), and the 13-6-GFP fusion protein localizes to lipid bodies (Figure 4.5). Therefore, 13-6p was hypothesized to be involved in the formation of lipid body clusters around the nucleus. The result of GO term enrichment analysis, however, did not show any obvious connections between the observed DE genes and lipid bodies (Section 4.6.6). The 13-6 NL and OE mutants were screened for phenotypes in various wine fermentation related conditions. Both 13-6 null and OE mutants showed slightly slow growth on K2S2O5 added plates (Figure 4.13).  The possible reason for the 13-6 overexpression mutant showing higher sensitivity to K2S2O5 is unclear.    Figure 4.13 Spot assays for 13-6 phenotype screening. The cells were grown overnight and diluted to OD600 = 0.3. For serial dilutions, cells were diluted by 10x. Chardonnay grape must was used for the grape must plates. The plates were incubated at 30 °C. The same cell culture of the designated strain was spotted on all six plates. The black outline indicates that the cells were spotted on the same plate. 13-6Δ = homozygous diploid null mutant. P_13-6 = homozygous OE mutant under PGK1 promoter   107  4.7.3 Deletion of 14-1 does not lead to pH difference in aging colonies  Protein sequence analysis identified sequence similarity of 14-1 to ATO3 and ATO2, both of which are putative ammonia transporters (Palková et al. 2002). Aging colonies produce ammonia as a starvation signal which promotes cell death (Palková et al. 1997). The nutrients from the dead cells are then recycled and redistributed to young cells in the colonies (Palková et al. 1997). The effect of ammonia produced by colonies was previously visualized by using GM-BKP plates by Palková et al. (1997). To test if aging colonies of 14-1 NL and OE mutants show any phenotype associated with ammonia production, they were spotted on GM-BKP plates. However, no phenotypes were observed (Figure 4.14). Also screening on various plates by spot assay did not result in detection of any phenotypes (Figure I.4).   Figure 4.14 Observation of pH difference among aging colonies on GM-BKP plates due to ammonia excretion. GM-BKP plate was used by Palková et al. (1997) to detect the excretion of ammonia from colonies. GM-BKP plate contains bromocresol, which changes in colour as the pH under the colonies change. Aging colonies start to show a dark ring due to pH change.  4.7.4 Double deletion of 14-2 and M27 confer sensitivity to acetic acid Screening for phenotypes of the 14-2 deletion mutant in various wine fermentation related stresses did not identify any phenotypes (Figure I5). During the search for more novel ORFs in M2 (Section 4.2), one ORF, referred to as M27, was found to be highly similar in sequence to 14-2 (Cover 97 %, Ident. 91 %, E = 0.0). The promoter region of 14-2 and M27 (-500bp) are somewhat similar (Cover 86 %, Ident. 76 %, E = 2E-81) while the terminator regions (200 bp) share no significant similarity. The 14-2+M27  108  double deletion mutant was screened for phenotypes and observed to have slow growth on acetic acid added plate (Figure 4.15). The sensitivity to acetic acid was not detected in either of the 14-2 or M27 single deletion mutants. Therefore, these data indicate that 14-2 and M27 may have a redundant function that protects the cell from acetic acid.    Figure 4.15 The 14-2/M27 double mutant is sensitive to acetic acid.The cells were grown overnight and diluted to OD600 = 0.3. For serial dilutions, cells were diluted by 10x. Chardonnay grape must was used for the grape must plates. The plates were incubated at 30 °C. The same cell culture of the designated strain was spotted on all five plates. The black outline indicates that the cells were spotted on the same plate. 14-2Δ and M27Δ = homozygous diploid null mutant. 14-2Δ/M27Δ = double null mutant   109  5. Discussion Despite a major research effort from scientists around the world, approximately 10 % (684 ORFs) of S. cerevisiae genes are still categorized as uncharacterized on the SGD website (SGD 2015d). Previously in the van Vuuren laboratory, 223 FSR genes were identified to be upregulated by more than four-fold (Clusters 1 – 6) during a 15 day Riesling fermentation using the wine yeast strain VIN13 (Marks et al. 2008). The upregulation of FSR genes was observed to be reproducible in M2 by Dr. Luo (unpublished), and the investigations of the function of 62 non-annotated FSR genes during Chardonnay fermentation using M2 resulted in the successful functional characterization of two genes, IGD1 and AAF1 (Walkey et al. 2011; Walkey et al. 2012; Luo et al. 2013). This thesis study was a continuation of such previous efforts in the van Vuuren laboratory to characterize non-annotated genes in the S. cerevisiae wine strain M2 with a focus on phenotypes relevant to wine fermentation.  5.1 Fermentation characteristics of the wild type M2 yeast strain The fermentation of wild type M2 in Chardonnay grape juice in this study revealed that M2 produces higher levels of ethanol and lower levels of glycerol than most wine yeast strains. Grape must contains approximately the same quantity of glucose and fructose comprising a total sugar level of around 160 – 300 g/L (Amerine and Thoukis 1958; Fleet and Heard 1993).  S. cerevisiae wine strains usually utilize glucose at a faster rate than fructose due to the difference in the efficiency of the transporters (Gafner and Schütz 1996; Berthels et al. 2004; Tronchoni et al. 2009). Therefore, as observed in this study, residual fructose is normally observed at a higher concentration than residual glucose in the final wine (Table 3.2). The ethanol levels observed in this study (~14.5 – 16.0 % v/v) were at the higher end of alcohol levels found in most table wines (13.5-14.0 % v/v). This is likely due to the high sugar content (~26 % w/v) in the grape must used in this study as the sugar content of grape must is usually around 22 % w/v. The sugar level of ~26 % w/v is observed in wines such as Vin Santo (Italian dessert wine), where the alcohol levels are reported to reach ~16-17 % v/v (Domizio and Lencioni 2011). The grape must in this study was,  110  however, never diluted as such practice is prohibited in most countries including here in British Columbia (Agri-Food 2005; Ontario 2015).  Wine is reported to contain ~8 g of glycerol per 100 g of ethanol (Ribéreau-Gayon et al. 2006e); these authors estimated that 8 % of sugar molecules undergo glyceropyruvic fermentation and 92 % undergo alcoholic fermentation. Glycerol is produced through the glyceropyruvic fermentation pathway and is the third most abundant product of fermentation after ethanol and carbon dioxide. Using the same estimation approach suggested by Ribéreau-Gayon et al. (2006e), 14.50 - 16.00 % v/v ethanol containing wine, which was commonly observed in this study, is predicted to contain approximately 0.92 – 1.01 % w/v glycerol level. However, the glycerol produced by the M2 yeast strain was around ~0.70 % w/v (Table 3.2), indicating that M2 might be an efficient ethanol producing strain but not a particularly high glycerol producing strain. The level of glycerol produced by M2, however, is within the range usually found in dry table wines (0.4-1.0 % w/v) (Rankine and Bridson 1971). Noble and Bursick (1984) reported the threshold of perceived sweetness of glycerol in white wine to be 5.2 g/L (or 0.52 % w/v). The level of glycerol produced by M2, therefore, is considered to be high enough to contribute some sweetness to the wine.  The level of acetic acid produced by wild type M2 in this study (~0.047-0.052 %v/v, Table 3.2) was observed to be comparable to the previous study conducted by Lafon-Lafourcade (1983) (data cited in Ribéreau-Gayon et al. 2006d). Lafon-Lafourcade (1983) observed that the level of acetic acid produced by S. cerevisiae fermentation of grape must is closely dependent on the initial sugar concentration of the grape must, and they reported 0.045 % w/v acetic acid to be produced with 26.8 % w/v initial sugar (data cited in Ribéreau-Gayon et al. 2006d). The sensory threshold of acetic acid that leads to a negative effect in wine is reported to be >700 ppm (or >0.07 % w/v) (Dittrich 1987) which is above the level observed with the M2 fermentation (Table 3.2).  111  5.2 Functional study of non-annotated Clusters 7 and 13 In this thesis, non-annotated ORFs grouped in Cluster 7 (slight upregulation at 10 % v/v ethanol during the Riesling fermentation) and in Cluster 13 (constitutive expression during the Riesling fermentation) (Marks et al. 2008) were investigated for their phenotypes during Chardonnay wine fermentation. To construct homozygous diploid null mutants, 19 ORFs from Cluster 7 and 118 ORFs from Cluster 13 were systematically deleted in the M2. The promoter regions of 19 ORFs in Cluster 7 were also systematically replaced with PGK1 promoter for overexpression. All the NL and OE mutants were screened for the phenotypes by screening the volatile and non-volatile compounds produced during Chardonnay fermentation by HPLC and HS-SPME-GC-MS. The fermentation rate was also investigated by the weight loss during the fermentation. The mutants were also screened for the growth curve phenotypes for 72 hours in Chardonnay grape must at 18 °C, 22 °C and 30 °C. ORFs with potentially interesting phenotypes were then investigated by the GFP-protein fusion imaging for cellular protein locations. 5.2.1 The M2 yeast strain  may carry a new synthetic lethality between TOP3 and THI7 Since the M2 genome sequence was not available until later in this study, the systematic deletion of the non-annotated ORFs in this study was conducted by using the primers designed with the S288c sequence. The deletion of YLR235C (dubious ORF on SGD) in M2 resulted in an inviable homozygous NL mutant possibly due to synthetic lethality with its overlapping/neighbouring genes, TOP3 (TOPisomerase) and THI7 (THIamine metabolism). Deletion of TOP3 and THI7, each on their own, resulted in viable null mutants (Giaever et al. 2002). In S288c, there are two dubious ORFs at this region, YLR235C and YLR236C, which have 262 bp of overlapping DNA (Figure 5.1a). In the M2 strain, one thiamine base is missing in this overlapping region (Table 5.2), and YLR235C and YLR236C are joined together (YLR235/236C) (total 585 bp) (Figure 5.1b). By conducting a DNA sequence comparison on BLAST (Altschul et al. 1990), YLR235/236C was found to be highly conserved among wine strains (AWRI796, EC1118, RM11-1a, P283, P301, QA23, R008, R103, VL3, VIN7 and VIN13), while they  112  exist as separate ORFs in beer strains (FostersB and FostersO) and in a sake strain (Kyokai no. 7) [Accession #: PRJNA48559 (AWRI796, Borneman et al. 2011), PRJEA37863 (EC1118, Novo et al. 2009), PRJNA48569 (FostersB, Borneman et al. 2011a), PRJNA48567 (FostersO, Borneman et al. 2011a), PRJNA161093 (P283, Treu et al. 2014), PRJNA162717 (P301, Treu et al. 2014), PRJNA48561 (QA23, Borneman et al. 2011), PRJNA162713 (R008, Treu et al. 2014), PRJNA162715 (R103, Treu et al. 2014), PRJNA13674 (RM11-1a, Brem et al. 2002), PRJNA73971 (VIN7, Borneman et al. 2012), PRJNA48563 (VIN13, Borneman et al. 2011a), PRJNA48565 (VL3, Borneman et al. 2011a), and PRJDA45827 (Kyokai no. 7, Akao et al. 2011)]. (a) (b)                                 (c)    Figure 5.1 The region around YLR235C and YLR236C on Chromosome 12 in (a) S288c and in (b) M2. The location of these ORFs on Chromosome 12 in S288c was retrieved from SGD (c). M2 has one missing thiamine base in the overlapping region of YLR235C and YLR236C. Two nucleotides are missing in the intergenic region between YLR236C and THI7. The locations of missing bases are indicated in (a) with red lines. The images for (a) and (b) were produced with SnapGene Viewer 2.6.2, and image (c) was obtained from SGD.  Before YLR235C and YLR236C were found to be merged in M2, the deletion strain of YLR236C was also constructed, based on the S288C sequence, as YLR236C was in the list of Cluster 13 ORFs investigated in this study. The YLR236C deletion in M2 resulted in the deletion of most of YLR235/236C (323 bp) at its N-terminus, however, the homozygous diploid mutant was viable. The deletion of YLR235C resulted in the deletion of 398 bp of YLR235/236C at the C-terminus as well as 222 bp of TOP3 at the C-terminus in M2. Although the exact location of the required THI7 promoter motif(s) is unknown, a larger portion of the THI7 promoter region was deleted when the YLR263C gene was  113  disrupted. Since the YLR236C homozygous deletion mutant was viable, the lethality observed with the YLR235C deletion might be associated with the deletion of the TOP3 C-terminus. However, the possibility of synthetic lethality between TOP3 and THI7 in M2 is not excluded although no negative genetic interaction has been documented between TOP3 and THI7 in S288C. Table 5.1 Sequence difference between S288c and M2 leading to the joining of YLR235C and YLR236C in M2. One thiamine base is missing in M2 YLR235C.  S288c 5’ ATTCAGCTGACTGCATATGTGCATTTTCAGTACCAGCCGC 3’ M2 5’ ATTCAGCAGACTGCATATGTGCA_TTTCAGTACCAGCCGC 3’  5.2.2 Unsuccessful deletions of YAL064W, YBR013C, YHL008C  and YIR042C reveals sequence differences and SNPs between S288c and M2 One Cluster 7 ORF and three Cluster 13 ORFs were not studied because the construction of the gene deletion mutants was not achieved (Table 5.2). The inability to construct the YBR013C and YHL008C deletion mutants was due to the different up- and/or downstream sequences compared to S288c, which was realized later in the study when the M2 genome sequence became available [The M2 sequence by the Gardner laboratory is posted on NCBI (BioProject #: SAMN03417849, Sample: UOA_M2). The M2 sequence by the van Vuuren laboratory is unpublished].  Table 5.2 ORFs that were not investigated in this study due to the unsuccessful construction of homozygous null mutants. The overlapping and/or neighbouring genes were identified by using the M2 genome sequence stored in the NCBI database (Sequenced by the Gardner laboratory. BioSample: SAMN03417849, BioProject: PRJNA278337, Sample name: UOA_M2). Cluster ORF SGDa Reason 13 YBR013C Uch Downstream sequence is highly different from S288c  13 YAL064W Ver Truncated in M2. Some SNPs in the immediate up- and downstream (60 bp) sequences compared to S288c 13 YIR042C Uch From 14 bp upstream of the termination codon, the 3’ end of the ORF and the immediate downstream is highly different from S288c. Also, the 5’ upstream sequence of YIR042C has low sequence match to S288c   7 YHL008C Uch The immediate sequence upstream of the start codon (~100 bp) is highly different from S288c. The immediate downstream (100 bp) and ORF sequence similarity is 97 % and 87 %, respectively    aUch = Uncharacterized , Ver = Verified statuses on SGD (July 26, 2015)  114  The immediate sequences around YAL064W (200 bp up and downstream) are fairly similar between S288c and M2 except for some single nucleotide polymorphisms (SNPs). The reason for the unsuccessful deletion of YAL064W, therefore, is likely due to the SNPs in the primer binding regions. More specific primer design to M2 sequence is expected to lead to a successful deletion mutant. The comparison of the coding region of YAL064W (285bp) in M2 and S288C, however, identified a premature termination codon in this ORF in M2 (126 bp).  Using DNA BLAST (Altschul et al. 1990), the same premature termination codon was found to be conserved in other wine strains (AWRI796, EC1118, P283, P301, QA23, R008, R103, RM11-1a, VIN7, VIN13 and VL3) [Accession #: PRJNA48559 (AWRI796, Borneman et al. 2011a), PRJEA37863 (EC1118, Novo et al. 2009), PRJNA161093 (P283, Treu et al. 2014), PRJNA162717 (P301, Treu et al. 2014), PRJNA48561 (QA23, Borneman et al. 2011a), PRJNA162713 (R008, Treu et al. 2014), PRJNA162715 (R103, Treu et al. 2014),  PRJNA13674 (RM11-1a, Brem et al. 2002), PRJNA73971 (VIN7, Borneman et al. 2012), PRJNA48563 (VIN13, Borneman et al. 2011a), PRJNA48565 (VL3, Borneman et al. 2011a)]. The deletion of YIR042C was not achieved because the 3’ end sequence and the genomic location in M2 highly differ from those in S288c. YIR042C is located directly adjacent to the right telomere of Chromosome 9 in S288c (Figure 5.2b) (Goffeau et al. 1996; Engel et al. 2014). The M2 sequencing data obtained by the van Vuuren laboratory showed that the ORF immediately upstream of YIR042C is YDL248W (COS7) (Figure 5.2a). Since COS7 is located on the left telomere of chromosome 4 in S288C, there has likely been a rearrangement between chromosome 4 and 9 in M2 (Figure 5.2b).  Interestingly, there are novel ORFs (14-1, 14-2 and 14-4) downstream of YIR042C in M2 (Figure 5.2a) that have not been identified in other wine yeast genomes that are already assembled. The assignment of the region between COS7 and novel ORF 14-1 in M2 to a particular chromosome remains to be done.     115  (a)              (b)   Figure 5.2 Genomic location of YIR042C in M2 compared to S288c. (a) The region surrounding YIR042C obtained from M2 genome sequencing by the van Vuuren laboratory. Three novel ORFs (14-1, 14-2 and 14-4) representing one of the HGT segments in M2 are found at the downstream of YIR042C.  (b) The location of YIR042C on Chromosome 9 in S288c was retrieved from SGD (Goffeau et al. 1996; Engel et al. 2014).   Although M2 has the same gene size of YIR042C (711 bp) as S288c, in some wine strains (RM11-1a and AWRI796), YIR042C is truncated to 308 bp with a premature termination codon [Accession #: PRJNA48559 (AWRI796, Borneman et al. 2011a) and PRJNA13674 (RM11-1a, Brem et al. 2002)]. Other wine strains (EC1118, P283, P301, R008, VIN13 and VL3), on the other hand, do not contain YIR042C in their genome sequences [Accession #: PRJEA37863 (EC1118, Novo et al. 2009), PRJNA161093 (P283, Treu et al. 2014), PRJNA162717 (P301, Treu et al. 2014), PRJNA162713 (R008, Treu et al. 2014), PRJNA48563 (VIN13, Borneman et al. 2011a) and PRJNA48565 (VL3, Borneman et al. 2011a)].  When compared to S288c, YIR042C in M2 was found to carry 77 SNPs, seven double nucleotide polymorphisms (DNPs) and one triple nucleotide polymorphism (TNP). The protein domain analysis, however, indicated that both S288c and M2 YIR042C contain a GNAT domain, a domain found in Acyl-CoA N-acyltransferase.QA23 and R103 are the two sequenced wine strains that carry YIR042C. Their YIR042C sequences highly resemble S288c YIR042C with few SNPs [Accession #: PRJNA48561 (QA23, Borneman et al. 2011a) and PRJNA162715 (R103, Treu et al. 2014)]. The YIR042C containing contig in R103 is assembled to Chromosome 9 while the similar contig in QA23 remains to be assembled. The location of YIR042C in QA23 is unclear as its up and downstream genes are COS8 (YHL042W) and PAU15 (YIR041W), respectively.   116  5.2.3 Three ORFs from Clusters 7 and 13 displayed phenotypes during Chardonnay fermentation To screen for the phenotypes of non-annotated ORFs grouped in Clusters 7 and 13 (Marks et al. 2008), 19 NL and 19 OE mutants of Cluster 7 ORFs and 118 NL mutants of Cluster 13 ORFs were examined during Chardonnay fermentation. Four ORFs of Cluster 7 (MTC7, RGI1, PAR32 and YDR249C) and 10 ORFs of Cluster 13 (GEP5, PDR18, YBL071C-B, YBR056W, YCR051W, YDR089W, YDR114C, YDR5247W-A, YMR027W and YPL225W) were found to show some phenotypes (Table 5.3), most of which were growth curve phenotypes. Among them, two ORFs (RGI1 and YDR249C) from Cluster 7 and one ORF from Cluster 13 (GEP5) had phenotypes during Chardonnay fermentation. Table 5.3 Fourteen non-annotated Clusters 7 and 13 ORFs showed phenotypes in this study. The non-annotated ORFs were selected based on the previous clustering results (Marks et al. 2008).  ORF Statusa OVLPb HPLC Growth Curvec (°C) GFP-tag Spot Assayf 18 22 30 Previousd This studye Cluster 7: MTC7 Uch Yes - ↓ ↓ - No No Yes RGI1 Ver Yes  - - - No - - PAR32 Ver - - ↓ ↓ - No - - YDR249C Uch Yes  ↓ ↓ ↑ No No -  Cluster 13: GEP5 Ver Yes  ↓↓ ↓↓ ↓↓ Yes Yes Yes PDR18 Ver - - - - - No Yes - YBL071C-B Uch Yes - ↓↓ ↓↓ ↓↓ No Yes Yes YBR056W Ver - - - - - Yes Yes - YCR051W Uch Yes - ↓ ↓ - Yes Yes Yes YDR089W Ver - - ↓ ↓ ↓ - - - YDR114C Uch Yes  ↓↓ ↓↓ ↓↓ No Yes No YDR524W-A Uch Yes - ↓ ↓ - - - - YMR027W Uch Yes - ↓ - - - - - YPL225W Ver - - - - - Yes No - aStatus on SGD: Ver = verified and Uch = uncharacterized. bExistence of overlapping gene(s) (dubious ORFs excluded) or within 500 bp upstream of another gene. cGrowth curve analysis. ↓ = slight decrease, ↓↓ = large decrease, ↑ = slight increase and ↑↑ = large increase.  dGFP fusion protein was previously observed. eGFP localization results in this study. fPhenotype obtained with spot assay   117  5.2.4 Overexpression of MTC7 leads to a strongly decreased growth rate  Deletion of MTC7 (Maintenance of Telomere Capping) was previously reported to cause a short telomere phenotype and a very slow growth phenotype using the S288c derived BY4742 S. cerevisiae laboratory strain (Askree et al., 2004). Although the location of MTC7 in M2 and BY4742 is the same based on the genome sequence assembled by the Gardner laboratory (BioProject #: SAMN03417849, Sample: UOA_M2), deletion of MTC7 in M2 did not result in a strongly suppressed growth rate during growth curve analysis (Figure 3.2). Several possibilities accounting for the phenotype difference between M2 and BY4742 include the presence of paralogs in wine strains, different telomerase related mechanisms in wine strains, different functions associated with MTC7 in wine strains or ploidy status (haploid BY4742 vs diploid M2) affecting the function of MTC7. The MTC7 homozygous OE mutant of M2, on the other hand, resulted in strongly stunted growth (Figure 3.3). However, the overexpression of MTC7 under the PGK1 promoter on pCW6 (CEN plasmid) was observed not to lead to the same stunted growth phenotype (Figure 3.5). Therefore, the reason for the phenotypic difference between MTC7 NL and OE mutants is unclear and requires more investigation. One thing to note in the experiments conducted in this study, however, is the ploidy difference; M2 is homothallic, and the colonies obtained after the tetrad dissection was assumed to be diploid in this study. In the case of the MTC7 overexpression mutant, since the tetrad dissection of heterozygous diploid OE mutant resulted in a strongly stunted growth phenotype (Figure 3.3), the true ploidy level of the colonies after the tetrad dissection should be tested. Also, since the slow phenotype of MTC7 deletion was observed with BY4742, a haploid strain (Askree et al. 2004), construction of MTC7 deletion mutant with haploid M2 may lead to the observed phenotype. Introducing a marker upstream of the MTC7 that does not carry the PGK1 promoter would be another approach to determine whether the overexpression of MTC7 is indeed involved in the observed phenotype as opposed to disruption of the chromatin structure upstream of MTC7. Although no physical interactions have previously been reported, using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) (Snel et al. 2000; Szklarczyk et al. 2015), HYP2 is predicted to be one of the  118  potential functional partners of MTC7 based on co-expression data and text mining. Therefore, another possible cause of the stunted growth associated only with the MTC7 OE mutant and not with the NL mutant in M2 may be the combination of the disruption of the termination sequence of HYP2 and the overexpression of MTC7 as they are adjacent to each other (Figure 3.4).  5.2.5 A normal Chardonnay fermentation rate was observed with the deletion of RGI1 in M2   Although deletion of RGI1 (Respiratory Growth Induced) in S288c and BY4741 are previously documented to result in decreased accumulation of ergosterol, trehalose, glycogen, decreased respiratory growth on ethanol and glycerol, and increased sensitivity to ethanol, (Domitrovic et al. 2010; Yang et al. 2011), no phenotype was observed with M2 RGT1deletion strain during the Chardonnay fermentations. The overexpression of RGI1 in M2, on the other hand, resulted in a slight increase in acetic acid produced (1.26-fold, p = 0.0491) (Table 3.3). Domitrovic et al. (2010) compared several microarray datasets and identified the expression of RGI1 to be tightly linked to genes involved in carbohydrate metabolism. Although the possible mechanism of RGI1 overexpression resulting in increased acetic acid is unclear, production of acetic acid is closely related to carbon and fat metabolism. In Crabtree positive strains, where anaerobic respiration is preferred over the aerobic oxidation pathway, the loss of ability to utilize non-fermentable carbons likely leads to a detrimental effect when sugar is depleted. However, decreased respiratory growth and the ability to use ethanol as carbon source without conferring the ethanol sensitivity or compromising the normal fermentation rate can be beneficial to industrial applications such as bioethanol production, where oxygenation during fermentation is explored to achieve the higher ethanol production (O'Connor-Cox and Ingledew 1990; Jones et al. 2007). Therefore, if the deletion of RGI1 in M2 leads to a decreased growth on ethanol, RGI1 can be a potential genetic engineering target to produce strains that do not consume ethanol after the conversion of fermentable sugar to ethanol is completed without sacrificing the normal fermentation rate.  119  5.2.6 The PAR32 gene may have a role at the end of wine fermentation and in a cold environment The par32∆ strain was found to grow more slowly at 18 °C than 22 °C or 30 °C when compared to the wild type M2 strain (Figure 3.2). Aguilera et al. (2007), Abe and Minegishi (2008) and Córcoles-Sáez et al. (2012) also reported similar slow growth phenotypes of par32∆ at low temperatures. The protein sequence analysis of Par32p (295 aa) by InterPro (Jones et al. 2014; Mitchell et al. 2015) identified a DUF3602 domain, a domain of unknown function. The Par32p (Phosphorylated After Rapamycin) was initially identified as highly phosphorylated after rapamycin treatment (Huber et al. 2009). The target of rapamycin (TOR) genes are widely conserved across various kingdoms; although, similar to mammals, S. cerevisiae is unique because it carries two Target of Rapamycin Complexes - TORC1 and TORC2 (Loewith and Hall 2011). Two branches of TOR signalling pathways in S. cerevisiae that are initiated by TOR gene products interacting with Tap42p or Sch9p, affect all aspects of cell growth including synthesis and degradation of mRNA and protein, nutrient transport, autophagy, polarized organization of the actin cytoskeleton, endocytosis, and sphingolipid synthesis (Cardenas et al. 1999; Loewith et al. 2011). While TORC1 and TORC2 have some functional redundancies, TORC2 is insensitive to rapamycin treatment (Loewith et al. 2002; Gaubitz et al. 2015). Rapamycin treatment inhibits the function of TORC1, which arrests cells in G1 (Heitman et al. 1991; Zheng et al. 1995; Barbet et al. 1996). Besides rapamycin treatment, nitrogen starvation was also observed to trigger hyperphosphorylation of Par32p by the Npr1p protein kinase (Nitrogen Permease Reactivator), while glucose starvation leads to dephosphorylation of Par32p (Hallett et al. 2014; Boeckstaens et al. 2015). Npr1p is regulated by TORC1 through Tap42p and is activated by dephosphorylation in a nitrogen limited environment (Vandenbol et al. 1987; Schmidt et al. 1998; De Craene et al. 2001; Jacinto et al. 2001). Although the exact role that PAR32 plays is yet to be determined, an increase in the PAR32 transcriptomic signal towards the end of fermentation observed by Marks et al. (2008) agrees with the results reported by Hallet et al. (2014) and Boeckstaens et al. (2015) that PAR32 plays a role in a nitrogen and glucose depleted environment. The importance of the TOR  120  pathways during wine fermentation has been previously documented in several studies (Rossignol et al. 2003; Brice et al. 2014; Tesnière et al. 2015). Since par32∆ in this study did not have phenotype during Chardonnay fermentation, the functional study of PAR32 in an environment resembling the end of wine fermentation or dry wine may lead to an interesting phenotype. Also studying the function of PAR32 in a lager S. pastorianus yeast, which is known to be highly adapted to lower temperature of lager beer fermentations (~7 - 14 °C), may help to understand the function of PAR32. 5.2.7 Overexpression of YDR249C in an homozygous diploid S. cerevisiae yeast strain results in higher levels of acetic acid The YDR249C OE mutant was observed to produce higher acetic acid (1.52-fold increase, p = 0.001, Table 3.3) compared to the WT M2 yeast. Sopko et al. (2006) previously reported that YDR249C overexpression leads to abnormal budding, cell cycle and cellular morphology. The DNA sequence of YDR249C in S288c and M2 are identical, and the protein sequence analysis did not lead to the identification of any domains. Further investigation is required to understand how the increase in acetic acid results from the observations reported by Sopko et al. (2006).  5.2.8 Deletion of GEP5 likely alters cellular lipid composition and cell wall morphology leading to higher sensitivity to high osmotic pressure and change in tolerance to sulfites, acetic acid and ethanol Chardonnay fermentations with the gep5∆ mutant progressed slowly compared to the wild type strain and also resulted in higher glycerol (1.39-fold increase, p = 0.0005) and acetic acid concentrations (1.61-fold increase, p = 0.0020) (Figure 3.1 and Table 3.4). The gep5∆ mutant also had a slow growth phenotype in Chardonnay grape must at all three (18 °C, 22 °C and 30 °C) temperatures (Figure 3.6) and a slow colony formation on Chardonnay grape must plates (Figure 3.10a). The Gep5p-GFP fusion protein was observed to localize in the cytosol in a punctated manner near the cell periphery, likely in mitochondria (unconfirmed, Figure 3.8). The transcriptomic changes in the gep5∆ strain on day two of  121  Chardonnay fermentation was examined using microarray technology by Dr. Walkey and Dr. Luo in the van Vuuren laboratory (unpublished data). Deletion of GEP5 resulted in the downregulation of 163 and up-regulation of 102 genes, reflecting the large transcriptomic changes accompanying the slow fermentation phenotype of gep5∆. Downregulated DE genes were enriched in GO terms related to cellular component assembly involved in morphogenesis (E = 3.63E-8) and developmental process involved in reproduction (7.37E-8) (Table 5.4). Therefore, Gep5p is not only involved in lipid synthesis as reported by Osman et al. (2009) and Tamura et al. (2012), but it also likely affects yeast cell morphology and reproduction process.  Table 5.4 Enriched GO terms identified in gep5∆. Deletion of GEP5 resulted in downregulation of 163 genes and up-regulation of 102 genes on day two of Chardonnay fermentation. Holm-Bonferroni correction was applied. Enriched GO terms No. ORFs p-val GO terms enriched in downregulated genes:   Cellular component assembly involved in morphogenesis [GO:0010927] 16 3.63E-8 Developmental process involved in reproduction [GO:0003006] 22 7.37E-8 Reproductive Process in single-celled organism [GO:0032989] 21 9.68E-8 Cellular component morphogenesis [GO:0032989] 18 2.02E-7 Ascospore wall assembly [GO:0030476], spore wall assembly [GO:0042244], spore wall biogenesis [GO:0070590], ascospore wall biogenesis [GO:0070591] 13 5.31E-7  GO terms enriched in upregulated genes:   Ribosome biogenesis [GO:0042254] 41 8.74E-18 Ribonucleoprotein complex biogenesis [GO:0022613] 41 1.12E-14 ncRNA processing [GO:0034470] 36 2.24E-13 rRNA processing [GO:0006364] 31 1.19E-12  GO terms enriched in all DE genes:   Cellular component assembly involved in morphogenesis [GO:0010927] 16 9.73E-5 Reproductive process in single-celled organism [GO:0022413] 22 3.46E-4 Ascospore wall assembly [GO:0030476] 13 3.47E-4  Since GEP5 has previously been reported to be required for mitochondrial genome maintenance (Merz and Westermann 2009), the deletion of GEP5 likely impairs normal mitochondrial function. Merz and Westermann (2009) previously showed that gep5∆ was unable to grow on glycerol and ethanol, which are non-fermentable carbon sources and require oxidative metabolism in mitochondria (Merz and Westermann 2009). Defective mitochondria were also reported to result in the alteration of cell surface  122  characteristics likely due to the perturbed formation of the normal cell wall (Evans et al. 1980; Iung et al. 1999). Deletion of mtDNA (rho0) resulted in more dissociation sensitive phosphopeptidomannans, a type of glycoprotein, compared to the wildtype (Iung et al. 1999). A change in the level of glycoproteins is reported to affect the cell wall morphology (Klis et al. 2002; Lesage and Bussey 2006; Orlean 2012). The localization of GFP-tagged Gep5p is previously observed in both mitochondria and in cytoplasm especially during the rapamycin treatment and hydroxyurea treatment, respectively, suggesting the diverse functional roles that Gep5p may play (Koç et al. 2004; Chong et al. 2015; Koh et al. 2015).  Osman et al. (2009) previously reported a decrease in mitochondrial cardiolipin (CL) and phosphatidylethanolamine (PE) upon the deletion of GEP5. Although the overall cellular lipid profile of gep5∆  has not been tested, such a global lipid profile change is likely as the overexpression of Psd1p, a mitochondrial inner membrane decarboxylase converting phosphatidylserine (PS) to (PE), was found to restore the normal PE production level in gep5∆ (Tamura et al. 2012). If the GEP5 deletion is confirmed to affect the normal cell wall formation as well as the normal plasma membrane lipid composition, increased sensitivity to high osmotic pressure may result. This lower tolerance to higher osmotic pressure may be the major reason that gep5∆ showing slow Chardonnay fermentation kinetics (Figure 3.1) and slow growth rate in Chardonnay grape must (Figure 3.4). Exposure to a hyperosmotic environment was previously reported to result in the production of higher glycerol accompanied by an increase in acetate in S. cerevisiae (Nevoigt and Stahl 1997; Modig et al. 2007), which were the phenotypes observed during Chardonnay fermentation with gep5∆ in this study. In this study, gep5∆ was observed to have an improved growth rate at 18 ° C compared to 22 ° C (Figure 3.6). The plasma membrane phospholipid composition and fatty acid chain lengths of S. cerevisiae were previously observed to dynamically change in response to changes in temperature to maintain optimum membrane fluidity (Torija et al. 2002; Laroche et al. 2001). The temperature dependent growth phenotype of gep5∆ (Figure 3.6), therefore, again leads to a possibility that the deletion of GEP5  123  affects the overall cellular phospholipid profile and is not limited to the mitochondrial phospholipid profile (Osman et al. 2009; Tamura et al. 2012). Due to a small number of mutants showing strong phenotypes during Chardonnay fermentation, colony formation phenotypes under various wine fermentation related stresses including the tolerance to K2S2O5 were screened (Figure 3.10 and Figure 3.11). The GEP5 overexpression mutant was also included in the screening to obtain more phenotypes. The addition of sulfite containing compounds (NaHSO3, KHSO3, Na2S2O5, K2S2O5) to grape must and wine is a very common practice started in ancient times and achieves the following purposes: 1) protects wine aroma by preventing oxidation and by binding to ethanal, 2) prevents enzymatic and oxidation browning, 3) prevents growth of spoilage microorganisms both before and after fermentation and 4) has a stimulating effect to finish the last grams of sugars rapidly (Ribéreau-Gayon et al. 2006e). When sulfite salts are added to wine, sulfur dioxide (SO2) is produced in a pH dependent manner (Equation 1 and 2) (Ribéreau-Gayon et al. 2006e). The prevention of oxidation by the addition of sulfites is mainly due to the oxygen scavenging nature of SO2 (Equation 3) (Ribéreau-Gayon et al. 2006e). The amount of sulfuric acid (H2SO4) produced in wine is very small as there is very little sulfite (SO32-) present at wine pH (Equation 4). The mild anoxic environment created by the addition of sulfites also retards the growth of obligate aerobes. (1) 𝐾2𝑆2𝑂5    →    2𝐾+   +  𝑆𝑂2   +  𝑆𝑂32− (2) 𝑆𝑂2   +  𝐻2𝑂   ↔    𝐻+   +  𝐻𝑆𝑂3−    ↔    2𝐻+   +   𝑆𝑂32− (3) 𝑆𝑂2   +  12𝑂2    →    𝑆𝑂3 (4) 𝑆𝑂32−   +   𝑂2   +  𝐻2𝑂   →    𝐻2𝑆𝑂4 Another factor contributing to the inhibition of spoilage organisms is due to SO2 crossing cell membranes (Ribéreau-Gayon et al. 2006e; Benoit et al. 2012). Molecular SO2 is a small polar molecule similar to H2O and can diffuse through the plasma membrane to reach the cytosol. Inside the cells, the pH is close to neutral, and SO2 is converted to HSO3- at a much higher rate than the extracellular environment (Equation  124  2). The cytosolic conversion of SO2 to HSO3- also encourages more SO2 to diffuse into the cell (Ribéreau-Gayon et al. 2006e; Benoit et al. 2012). Cytosolic SO2 not only scavenges oxygen but also interferes with the normal cellular activities as SO2 and its related species (HSO3- and SO32-) are highly reactive and act as reducing agents (Divol et al. 2012). The SO2 is reported to damage cellular membrane by binding to membrane receptors and also to react with intracellular metabolites, proteins and enzymes (e.g. reduction of disulfide bridges) (Ribéreau-Gayon et al. 2006e; Divol et al. 2012).  A growth phase dependent phenotype of S. cerevisiae to K2S2O5 (Figure 3.11) has long been known (Ventre 1934 cited in Ribéreau-Gayon et al. 2006e). Although the exact mechanism is yet to be discovered, a few different mechanisms are likely involved as various alleles of SSU1, plasma membrane sulfite pump, and FZF1, a transcription factor for SSU1, have been identified (Goto-Yamamoto et al. 1998; Park et al. 1999; Park and Balakinsky 2000; Townsend et al. 2003; Nardi et al. 2009; Zimmer et al. 2014). One possible reason, however, is likely due to the formation of higher intracellular sulfites at the beginning of the fermentation. Higher levels of sulfites have previously been reported in rich media (beer wort) than in a minimal media (Donalies and Stahl 2002). When intracellular sulfite is produced from the endogenous metabolic pathways at a higher level, SSU1 is likely upregulated. Therefore, the higher sulfite resistance of the exponential growth phase cells observed in this study (Figure 3.11) is likely due to the higher expression level of SSU1 in the rapidly growing cells. In the transcriptomic study conducted by Marks et al. (2008), the expression of SSU1 in VIN13 was indeed found to be the highest at the beginning of the fermentation and decrease over the course of the 15 day fermentation, resulting in its inclusion in Cluster 18. The comparison of the promoter regions (-1000 bp) of SSU1 in VIN13 and M2 was found to be highly similar except for a few possible indels or sequence reading errors likely in the VIN13 sequence (contains more missing nucleotide readings). The sequence of VIN13 SSU1, however, was found to be 48 bp shorter than M2 SSU1 at the 5’ end. Whether this difference is true or not still needs to be confirmed, however, it would be interesting to compare the functional level of Ssu1p in VIN13 and M2 if the loss is confirmed to be true.   125  Understanding the mechanism behind the higher tolerance of stationary phase gep5∆ mutant to sulfites (Figure 3.11) and higher sensitivity of exponential phase and stationary phase gep5∆ mutant to ethanol (Figure 3.11) will require further investigation. One underlying factor, however, is likely the change in the plasma membrane lipid composition in gep5∆. Sulfites and ethanol can diffuse through the plasma membrane (Ribéreau-Gayon et al. 2006e; Tanaka et al. 2012), and, therefore, the stress tolerance of S. cerevisiae to sulfites and ethanol are considered to be influenced by the membrane lipid composition, which affects the membrane fluidity (Alexandre et al. 1996; Tierney et al. 2005; Rodríguez-Vargas et al. 2007; Vanegas et al. 2010; Dupont et al. 2011; Balogh et al. 2013; Henderson et al. 2013). Since the cells in exponential and stationary phases are well documented to have different membrane compositions (Takeo et al. 1976; Janssen et al. 2000; Henderson et al. 2012; Henderson et al. 2013; Henderson and Block 2014), the growth phase dependent differences in the sulfite and ethanol tolerances likely stem from the membrane compositional differences accompanying the growth phase transitions. The reason for the higher tolerance of stationary phase gep5∆ mutant to acetic acid (Figure 3.11) is unclear. The decline of mitochondrial function in S. cerevisiae is thought to be involved in the response to acid treatment (Giannattasio et al. 2013), and, therefore, the observed phenotype in this study may be due to the altered mitochondrial function in gep5∆. The caution should be exercised, however, to interpret the growth phase dependent phenotypes of gep5∆ (Figure 3.10 and Figure 3.11) as the exact growth phase of gep5∆ after >48 hours is unknown. Determining the growth phase patterns of gep5∆ and the accompanying lipid compositions will likely help to elucidate the mechanisms accounting for the difference in the tolerance towards sulfites, acetic acid and ethanol.  5.2.9 YBL071C-B NL shows no phenotype during Chardonnay fermentation but has a strong slow growth phenotype in Chardonnay grape must under aerobic condition The ybl071c-b∆ strain displayed a slow growth phenotype in Chardonnay grape must at all three temperatures (18 °C, 22 °C  and 30 °C) (Figure 3.6) and a slow colony formation on Chardonnay grape must plates (Figure 3.10). However, ybl071c-b∆ showed no phenotype during the Chardonnay  126  fermentation (Appendix J), indicating its slow growth and colony formation phenotypes are likely specific to aerobic environment. YBL071C-B codes for a small peptide (32 aa), and it is 332 bp upstream of RPS8A (Ribosomal Protein of the Small Subunit) on the Crick strand and 421 bp upstream of KTI11 (Kluyveromyces lactis Toxin Insensitive) on the Watson strand in M2. K. lactis zymocin arrests cell cycle progression at G1 in S. cerevisiae likely by affecting RNA polymerase II (Jablonowski et al. 2001).  Both the deletion of RPS8A or KTI11 were previously reported to show slow growth (Fichtner and Schaffrath 2002; Yoshikawa et al. 2011; Samanfar et al. 2013), and therefore, the slow growth phenotype observed with ybl071c-bΔ needs to be confirmed to be associated with YBL071C-B.  5.2.10 Slow growth phenotype of ycr051w∆ under aerobic conditions may associate with the interference of RSC6 expression A moderate slow growth of the ycr051w∆ strain was observed during the growth curve analysis at 18 °C and 22 °C (Figure 3.6). Slow vegetative growth associated with the deletion of YCR051W was previously reported (Yoshikawa et al. 2015). The YCR051W ORF is 254 bp upstream of RSC6 in M2, a component of the RSC (Remodel the Structure of Chromatin) complex. Deletion of RSC6 in both S288c and W303 results in lethality (Cairns et al. 1996; Giaever et al. 2002), and, therefore, the observed slow growth phenotype needs to be confirmed to be associated with YCR051W and not due to lack of RSC6 expression. Although little is known about YCR051W, Erasmus et al. (2003) previously reported the down-regulation of YCR051W by 2.7-fold upon high sugar osmotic shock (40 % w/v) using the polypoid industrial wine strain VIN7. The sequences of YCR051W and its promoter region (-1000 bp) are almost identical between M2 and S288c. Although the microarray signal intensity in Erasmus et al. (2003) is unpublished, the signal intensity detected by Marks et al. (2008) with VIN13 was approximately ~98, which stayed constant over the course of 15 day Riesling fermentation.  Studying the phenotype of ycr051w∆ under much higher osmotic stress may lead to the detection of a phenotype.  127  5.2.11 Phenotypes associated with YDR089W may be accentuated in more stressful wine fermentation conditions such as ice wine and dessert wines  A moderate slow growth of ydr089w∆ was observed during the growth curve analysis at all three temperatures (18 °C, 22 °C and 30 °C) (Figure 3.6). A slow anaerobic growth phenotype of ydr089w∆ on a YPD plate (Samanfar et al. 2013) and a slow vegetative growth of a YDR089W overexpression mutant in 4 % raffinose and 0.2 % galactose containing synthetic medium was previously reported (Yoshikawa et al. 2011). The deletion of YDR089W was also previously shown to confer resistance to nickel (Bishop et al. 2006; Arita et al. 2009).  In this study, ydr089w∆ formed colonies slowly at low pH (2.25), and on agar plates containing 40 mM acetic acid, 0.37 % w/v malic acid, 9 % v/v ethanol and 0.55 mM K2S2O5 added plates (Figure 3.10). Ydr089wp contains an SPX domain, which is frequently found at the N-termini of PHO genes (PHosphate metabolism) (Heuck et al. 2010; Secco et al. 2012). Erasmus et al. (2003) reported that the expression of YDR089W was observed to decrease by 4.4-fold upon high sugar osmotic shock (40 % w/v). Although a strong phenotype was not observed with ydr089wΔ during Chardonnay fermentation, YDR089W may show a stronger phenotype in more stressful wine fermentation conditions such as fermentation of ice wine and dessert wine. 5.2.12 Overexpression of YDR114C may lead to the identification of its phenotype during wine fermentation The ydr114cΔ strain had a strong phenotype of slow fermentation rate and slow growth rate in Chardonnay grape must (Appendix J). An add-back experiment was conducted by cloning YDR114C in pCW6, expressing the gene under the PGK1 promoter. The presence of YDR114C in the pCW6-YDR114C construct did not restore normal growth. The YDR114C ORF is 306 bp upstream of PDS1 and overlaps 52 bp with YDR115C at their 5’ ends; PDS1 codes for securin, a protein involved in the control of the metaphase-anaphase transition. Securin regulates the separation of sister chromatid by inhibiting the cysteine protease known as separase (Esp1p) (Yamamoto et al. 1996; Ciosk et al. 1998; Zou et al.  128  1999; Hornig et al. 2002; Kerr et al. 2012). When securin is degraded through ubiquitination and subsequent proteasomal degradation, Esp1 is released to cleave the cohesin subunit Scc1p located at the centromere, which allows the separation of sister chromatids (anaphase) (King et al. 1996; Hornig et al. 2002; Kerr et al. 2012). Although PDS1 is not an essential gene, the deletion mutant is reported to show frequent cell death (Yamamoto et al. 1996), 300-fold increase in chromosome loss (Yamamoto et al. 1996), abnormal chromosome segregation (Yamamoto et al. 1996), abnormal recombination (Cooper et al. 2009) and increased mutation frequency (Hwang et al. 2008). Little is known about YDR115W, however, its structural similarity to the large subunit of a mitochondrial ribosomal protein has been reported (Gan et al. 2002). The deletion of YDR115W leads to a loss of respiratory growth ability when tested using glycerol as the sole carbon source (Hughes et al. 2000) and to an increase in replicative lifespan (i.e. the number of divisions a cell can undergo before dying) (McCormick et al. 2015). Therefore, the slow fermentation rate and slow growth rate phenotypes observed for ydr114cΔ may not be associated with YDR114C but instead with the adjacent genes.  Before conducting the add-back experiment, the localization of Ydr114cp-GFP fusion protein was conducted using fluorescence microscopy. When expressed under the PGK1 promoter, Ydr114cp-GFP was observed to localize in the cytosol in a punctated manner, possibly in the Golgi (unconfirmed, Figure 3.8). Insertion of PGK1 promoter also resulted in the smaller cells and abnormal vacuolar morphological phenotypes (Figure 3.8). A phenotype for YDR114C, therefore, may be observed when YDR114C is overexpressed, which is not extensively studied before.  5.2.13 The mechanism of slow growth phenotype associated with ydr524w-cΔ may be due to a role in repairing DNA damage which may be relevant for industrial fermentations The ydr524w-cΔ strain grew slightly slower than wild type at 18 °C and 22 °C (Figure 3.6). YDR524W-C is a small ORF (90 bp) and little is known about this ORF. No currently known domains in  129  this protein were identified through protein sequence analysis based on its gene sequence. The sequence of YDR524W and its promoter region (-1000 bp) was found to be almost identical between M2 and S288c. Kastenmayer et al. (2006) reported an increase in sensitivity against bleomycin upon the deletion of YDR524W-C. Bleomycin is a glycopeptide antibiotic highly utilized in cancer therapy (Keszenman et al. 1992). Although the exact mechanism is yet to be seen, the pharmacological benefit of bleomycin is known to arise from its DNA scission effect. Radiosensitive mutants of S. cerevisiae treated with bleomycin were reported to show defective recombination, excision and RAD6 (RADiation sensitive) dependent DNA repair (Keszenman et al. 1992). Although using bleomycin to screen for genes that are beneficial in wine fermentation has not previously been conducted, damage to DNA is highly relevant to wine fermentation due to reactive oxygen species (ROS) produced in high-stress environment through unknown mechanisms (Landolfo et al. 2008; Rowe et al. 2008; Mendes-Ferreira et al. 2010). Therefore, YDR524W may play a role in preventing DNA damage or in a DNA repair mechanism during wine fermentation, which is important for industrial strains of S. cerevisiae used in fuel ethanol production where yeast is often recycled and re-used for multiple fermentations. 5.2.14 Slow growth phenotype of ymr027w∆ in aerobic condition may be due to interference of normal TAP42 transcription The YMR027W ORF is 193 bp upstream of TAP42, an essential protein phosphorylated by TORC1 in response to the nutritional status in the environment (More on TOR pathways in Section 5.2.6). Since no previous studies on the minimum promoter region lengths or motifs required for the normal transcription of TAP42 has been conducted, whether the deletion of YMR027W interferes with the expression of TAP42 is unknown. However, since YMR027W is fairly close to TAP42, the moderate slow growth of ymr027w∆ needs to be confirmed to be associated with YMR027W (Figure 3.6). Interestingly, an ortholog of YMR027W in S. pombe, prl64, has been reported to confer sensitivity to rapamycin upon its deletion (Doi et al. 2015). Based on the homology to mammalian C6orf211, prl64 is thought to be a protein carboxyl methyltransferase and is implicated in DNA damage response (Perry et al. 2015). In S.  130  pombe, TAP42 (Chr III, 844192-845417) is not found at the immediate downstream of prl64 (Chr III, 824949-827652) (Wood et al. 2011).    5.2.15 Using the experimental conditions outside the product specifications may lead to observation of stronger phenotypes of industrial S. cerevisiae strains One common characteristic observed during the growth curve analysis (Section 3.3) among the majority of mutants is that the slow growth phenotypes were accentuated at lower temperatures. Although the recommended fermentation temperature range of Enoferm M2 by Lallemand is 15-30 °C (Enoferm M2 2015), unlike the lager strain of S. pastorianus, which is known to be well adapted to low temperatures, M2 was observed to show more phenotypes at the colder end of such recommended growth temperature range. Recommended temperature ranges given by yeast suppliers are considered to be where strains can perform fermentation at healthy kinetics without affecting its aromatic profile and result in the occurrence of stuck fermentations. Therefore, to screen for phenotypes of non-annotated genes in S. cerevisiae using industrial wine strains of S. cerevisiae, the conditions outside the fermentation specifications recommended by the suppliers may lead to the observation of phenotypes.  5.3 Functional analysis of novel ORFs 5.3.1 Deletion of eight novel ORFs did not lead to phenotypes during Chardonnay fermentation The eight novel ORFs investigated in this study were identified by the Gardner laboratory, and their null mutants were constructed by Dr. Walkey in the van Vuuren laboratory. Analyses of the genome sequence contigs obtained from the re-sequencing of M2 by the van Vuuren laboratory resulted in the identification of an additional 15 novel ORFs (M13, M14, M15, M16, M17, M18, M19, M20, M21, M22, M23, M25, M26, M27 and M28) (Table 4.1).   131  No phenotypes were observed to be associated with the deletion of eight novel ORFs during Chardonnay fermentation and HPLC analysis of the resulting wines (Table 5.5). This was a surprising result as some of these ORFs are conserved among wine S. cerevisiae strains such as EC1118, VIN13 and QA23, and similarities identified from DNA and protein sequence analysis lead to a speculation that they may play roles during wine fermentation (Table 4.1). However, as observed for 14-2, some novel ORFs likely exist in multiple copies. Therefore, deletion of paralog genes may be required to observe clear phenotypes of the novel M2 ORFs. Table 5.5 Phenotypes NL and OE mutants of eight novel ORFs investigated in this study.  ORF HPLC Growth Curvea (°C) GFP-tag qRT-PCRb Spot Assayc 18 22 30 13-1 - - - - No Expression observed No 13-2 - ↓ ↓ - Yes ZRT1, SUL1, SUL2 Yes 13-4 - - - - Yes n/a No 13-5 - - - - Yes n/a No 13-6 - - - - Yes n/a Yes 14-1 - - - - Yes n/a No 14-2 - - - - No n/a Yes 14-4 - - - - No n/a n/a aGrowth curve analysis: ↓ = slight decrease, ↓↓ = large decrease, ↑ = slight increase and ↑↑ = large increase. bGenes observed to change in expression and confirmed by qRT-PCR. cPresence of phenotype with spot assay   5.3.2 The 13-2 ORF may encode for a novel transcription factor likely involved in ion and pH homeostasis Protein sequence analyses indicate that the M2 novel ORF 13-2 contains an N-terminal Zn(2)-C6 fungal-type binuclear DNA binding domain (IPR001138) and a fungal transcription factor domain (IPR007219) that are found in various transcription factors including GAL4 (galactose metabolism), PPR1 (pyrimidine pathway regulation), HAP1 (heme activator protein), DAL81 (degradation of allantoin) and STB5 (regulating multidrug resistance and oxidative stress response) (Table 4.1). The 13-2p-GFP fusion protein in M2 was observed to localize in the nucleus (Figure 4.5), and, therefore, 13-2p is predicted to be a novel transcription factor. The DE genes identified in 13-2∆ by microarray study (Table 4.7) was tested by qRT-PCR to confirm the changes in the expression levels (Section 4.7.1.1). Deletion of  132  13-2 was observed to result in the downregulation of ZRT1 by 5-fold (p = 0.0016) on day three of Chardonnay fermentation (Figure 4.6). The presence or absence of genetic interactions between 13-2 and ZAP1, a known transcription factor for ZRT1 (Zhao and Eide 1997), could not be clearly established with -galactosidase assays (Figure 4.8). This is likely due to the low expression level of ZRT1 in the ZAP1 null mutant. Therefore, to investigate the presence of any genetic interaction between ZAP1 and 13-2, construction of double ZAP1 and 13-2 overexpression mutant or ZAP1 allele with reduced activity in 13-2 deletion mutant may be suitable. The 13-2 NL mutant was coincidentally found to show higher sensitivity to alkaline pH during the study using various nitrogen sources (Section 4.7.1.2). Due to the differences in growth phenotypes observed in AS and DAP media, the expression levels of SUL1 and SUL2 were tested by qRT-PCR. In DAP medium at pH 7.26, SUL1 and SUL2 were both observed to be slightly downregulated by 1.8-fold (p = 0.0002 and p = 0.0011, respectively) in the 13-2 null mutant (Figure 4.12). In the 13-2 OE mutant, although the expression of SUL2 was observed to be slightly increased (1.2-fold increase, p = 0.0244), the expression of ZRT1 and SUL1 were found to be unaffected (Figure 4.7 and Figure 4.12).  One possible reason for the lack of strong gene expression changes in the 13-2 OE mutant may be due to the post-transcriptional regulation of the genes regulated by 13-2. Alternatively, there may be other major targets of 13-2p, which affects the expression of ZRT1, SUL1 or SUL2. Two other divalent ion transporters identified by microarray as DE in the 13-2 null mutant are CTR3 (3.7-fold decrease) and MMT1 (4.3-fold decrease) for copper and iron, respectively (Dancis et al. 1994a; Dancis et al. 1994b; Li and Kaplan 1997; Lange et al. 1999) (Section 4.6.2). The FRE1 gene (iron and copper reductase, 3.2-fold decrease) is another DE metal ion transport related gene, which is known to facilitate the transport of iron and copper in an iron and copper deficient environment (Dancis et al. 1990; Anderson et al. 1992; Georgatsou and Alexandraki 1994; Hassett and Kosman 1995; Georgatsou et al. 1997; Yamaguchi-Iwai et al. 1997; Georgatsou and Alexandraki 1999; Gross et al. 2000; Yun et al. 2001). Divalent ions act as cofactors of essential enzymes such as alcohol dehydrogenases (ADHs) in S. cerevisiae and play  133  important roles during fermentation. Serrano et al. (2004) found that iron and copper are limiting factors for growth under alkaline pH and reported that the addition of these two ions drastically improved growth at high pH. Therefore, it would be interesting to examine the expression levels of other ion transporters detected as DE in the13-2 NL mutant.  The connection between the reduced expression of ZRT1, SUL1 and SUL2 leading to the sensitivity of the 13-2 null mutant to high pH was not immediately obvious. The fact that the overexpression of 13-2 did not have any effect on the expression of ZRT1, SUL1 and SUL2 also did not help elucidate the function of this ORF. However, 13-2p may function to regulate cellular cation ion and pH homeostasis, which can be affected by the expression of various ion transporters including ZRT1, SUL1 and SUL2 (Cyert and Philpott 2013). S. cerevisiae is known to grow better in acidic environments than in alkaline environments (Yalcin and Ozbas 2008; Batt 2014). Although wine strains of S. cerevisiae can tolerate a wide range of pHs (~3.0-7.0), the cytosolic pH is strictly maintained within a narrow pH range of 7.0-7.2 (Peñalva et al. 2008; Cyert and Philpott 2013).  As a result, in an acidic environment, S. cerevisiae can utilize a proton-motive force to transport nutrients without using active transporters and consuming energy (Serrano et al. 1986; Rao et al. 1993; Cyert and Philpott 2013; Schothorst et al. 2013). Major nutrient permeases for glucose, other sugars and amino acids in S. cerevisiae are H+ symporters (van der Rest et al. 1995; Orij et al. 2011; Cyert and Philpott 2013; Schothorst et al. 2013).  The accumulated protons, in turn, are pumped out of the cytosol to maintain the pH gradient. Two major proton pumps are Pma1p (Serrano et al. 1986), which resides in the plasma membrane, and V-ATPase (Hirata et al. 1990), which acidifies the endomembrane organelle compartments. An acidic luminal environment is required for the hydrolysis of macromolecules, the release of ligands from receptors, processing of hormones and protein sorting (Hirata et al. 2002; Cyert and Philpott 2013). Although the major player in achieving the acidic luminal pH is V-ATPase, loss of V-ATPase function does not lead to an inviable mutant (Hirata et al. 2002; Martínez-Muñoz and Kane 2008). Various other transporters and mechanisms have been identified to achieve the acidic luminal pH (Cyert and Philpott 2013), and one such mechanism is the  134  addition of sulfate ions (Hirata et al. 2002).  The addition of sulfate ions increased the proton gradient in the vacuolar vesicles while the addition of alkaline cations (Na+, K+, Li+ or Rb+) decreased the proton gradient in yeast vacuolar vesicles (Hirata et al. 2002). Therefore, the superior growth of the 13-2 OE mutant in K2SO4 added pH 7.6 DAP media (Figure 4.10) maybe due to the enhanced vacuolar acidification by the sulfate ions.  Another connection between zinc and sulfate in S. cerevisiae is the reactive oxygen species (ROS). Zap1p is a well-studied transcription factor of zinc transporters that also acts as a “zinc-stat” (Cyert and Philpott 2013). The Zap1 protein contains multiple transcriptional activation domains, all of which bind zinc. The degree to which these domains are occupied by zinc corresponds to the cellular zinc status and Zap1 activates different sets of genes to deal with the cellular zinc levels (Cyert and Philpott 2013). One such metabolic change observed in zinc deficient media is decreased sulfate assimilation (Cyert and Philpott 2013). The decreased sulfate assimilation is speculated to result in response to the increased ROS, which is triggered by the zinc deficiency (Cyert and Philpott 2013). The source of the increased oxidative stress that occurs with zinc deficiency is unknown; however, cells that are grown in zinc-limited medium exhibit increased sensitivity to exogenous H2O2 and produce increased amounts of ROS (Cyert and Philpott 2013). Zinc deficiency triggers the Zap1p-mediated transcription of TSA1, a major peroxiredoxin of yeast, to protect the cells against the oxidative damage (Cyert and Philpott 2013). The down-regulation of sulfate assimilation in zinc deficiency is speculated to occur in order to make more NADPH available for the regeneration of reduced peroxiredoxin and glutathione (Cyert and Philpott 2013). Other changes observed under zinc deficiency such as significant changes in the lipid composition (a large increase in PI and a large decrease in PE) are also considered to occur as the cell diverts most of its NADPH to control oxidative stress in a zinc deficient environment. Therefore, 13-2p may also be involved in the regulation of ZRT1, SUL1 and SUL2 to manage the increased oxidative stresses.   Finally, another important aspect of ion/proton gradient and pH homeostasis is the membrane potential (∆Ψ). Maintaining the proper membrane potential of a slightly negative internal voltage across  135  the lipid bilayer is critical so that the potential dependent membrane proteins are functional to operate as solute transporters (van der Rest et al. 1995). To balance the membrane potential, the movement of protons is accompanied by the counter flow of alkali ions to maintain the electrochemical gradient. For example, a drop in internal pH is associated with the activation of K+ uptake through plasma membrane transporters, Trk1/2, which offsets the electrogenic potential created by Pma1p-mediated proton pumping and facilitates its activation (Yenush et al. 2005). Another such example is Na+/ H+ antiporters. Since cellular ion concentration, pH and membrane potential homeostasis all affect each other, 13-2p may have a role in the complex network of ion transporters.  5.3.3 The 13-4p has similarity to OXP1 but its deletion has little effect on Chardonnay fermentation The deletion of 13-4 in M2 did not result in any phenotypes during Chardonnay fermentation. The GO term analysis of transcriptomic data collected by microarray identified enrichment of the genes involved in glucose transport and glycogen metabolic process, which were upregulated on Day 1 of the Chardonnay fermentation. The protein sequence analysis showed that 13-4p contains a hydantoinase/oxoprolinase domain (Table 4.1). Oxoprolinase in S288c is coded by OXP1 and is predicted to be involved in the -glutamyl cycle, which is an important cycle for synthesis and degradation of glutathione (Kumar and Bachhawat 2010). Oxp1p hydrolyze 5-oxoproline to L-glutamate in an ATP-dependent manner during the metabolism of glutathione (Kumar and Bachhawat 2010). Deletion of OXP1 was observed to increase the cellular 5-oxoproline levels (Lu et al. 2010). Whether the 13-4 ORF codes for an enzyme that is also involved in glutathione metabolism is yet to be determined.  Glutathione homeostasis was previously reported to influence normal nitrogen/carbon signaling as well as carbon metabolism (Maris et al. 2000; Perrone et al. 2005). Therefore, the GO term enrichment of glycogen and alcohol metabolism genes observed in the 13-4 null mutant microarray data may reflect that 13-4p shares some functional similarity with Oxp1p. However, when the OXP1 NL and OXP1+13-4 double NL  136  mutants were screened for phenotypes in wine fermentation related conditions by spot assay, no genetic interactions were observed (Figure J.2).   5.3.4 The 13-5p contains an MFS domain and may be a novel transporter for hydrophobic molecules  Protein sequence analyses indicated that the predicted 13-5 protein contains an MFS domain, which is found in a wide range of transporters including the HXT family genes (hexose transporters) (Kruckeberg and Bisson 1990; Özcan and Johnston 1999).  The 13-5p-GFP fusion protein was visualized in lipid bodies when its expression was increased under the PGK1 promoter (Figure 4.5). GO term analyses identified upregulation of genes involved in sterol transport and sterol metabolism (CYB5, HES1, MOT3, PDR11, ROX1, UPC2, and YEH1) in the 13-5 null mutant microarray data (Table 4.13). The co-identification of MOT3 and ROX1 as DE genes is interesting as they are synergic transcriptional repressors of hypoxic genes such as ERG family genes in aerobic environment (Sertil et al. 2003; Montañés et al. 2011; Martínez-Montañés et al. 2013).  Lipid bodies are reported to contain various enzymes and proteins that are involved in lipid and sterol metabolism (Grillitsch et al. 2011; Casanovas et al. 2014). Due to the phospholipid monolayer membrane, proteins found in the lipid body membrane are rarely found to contain transmembrane spanning domains (Müllner et al. 2004; Grillitsch et al. 2011). One fatty acid transporter on the plasma membrane, Fat1p, was previously observed to localize to lipid bodies; however, it also acts as a very long chain fatty acyl-CoA synthetase and does not contain commonly found transporter domains such as ABC transporters or MFS domains. Recent lipid body proteomic analysis identified proteins that are not directly involved in the lipid and sterol metabolism/synthesis in lipid body isolates (Jacquier et al. 2011; Grillitsch et al. 2011; Pol et al. 2014). These include proteins that are predicted to be involved in the formation of lipid bodies, the transfer of lipids from lipid bodies to ER and the cellular localization of lipid bodies (Jacquier et al. 2011; Grillitsch et al. 2011; Pol et al. 2014). Other proteins may be stored in lipid bodies as the  137  posttranslational regulation to store them in the correct folding state (Pol et al. 2014). Lipid bodies are observed to interact with other organelles to exchange lipid and proteins and, therefore, are now viewed as an interactive organelle rather than a mere sterol and lipid storage organelle (Pol et al. 2014). Whether 13-5p directly contributes to the functions of lipid bodies is yet to be seen; however, since some MFS transporters especially those involved in multi drug resistance (MRD) transport hydrophobic cationic molecules (Ehrenhofer-Murray et al. 1998), 13-5p may be a novel transporter for fatty acids and other hydrophobic molecules.  5.3.5 Understanding the role that FLO11 superfamily domain containing novel protein 13-6p plays on lipid bodies may lead to identifying the key difference in stress tolerance between laboratory and wine strains of S. cerevisiae The predicted 13-6p contains a FLO11 superfamily domain – FLO11 encodes a glycophosphatidylinositol (GPI)-anchored cell surface glycoprotein that plays an important role in cell to cell adhesion leading to flocculation in liquid media and pseudohyphae growth on solid agar plates (Lo and Dranginis 1996). Downregulated genes in the 13-6 null mutant microarray dataset were enriched for GO terms such as “transcription initiation from RNA polymerase I promoter” and upregulation genes were enriched for GO terms such as “energy reserve metabolic process”, “glycogen metabolic process”, “hexose transport and sterol import” (Table 4.17). Similar to 13-5p, the localization of 13-6p-GFP fusion protein was observed in lipid bodies (Figure 4.5). Western blot for 13-6p-GFP resulted in the detection of a band around 130-140 kDa, which is 60-70 kDa heavier than the expected band size of 69 kDa (Protein size ~ 42 kDa and GFP is ~27 kDa) (Figure E.1 and E.2). Such shift may suggest possible modifications on 13-6p. Flo11p is known to be heavily glycosylated at the stalk region, which is anchored to GPI (Fidalgo et al. 2006; Meem and Cullen 2012; Kraushaar et al. 2015). Hypothetical 3D modeling of 13-6p resulted in a conformation highly resembling Flo11p with three -helices forming the apical region for interactions. The additional C-termini structure (172 aa) contains a potential S-palmitoylation site on Cys-235 and a S-farnesylation site on Cys-391 when the sequence was analyzed with GPS-lipid (Ren et al.  138  2008; Xie et al. 2014) (Figure 5.3). Both S-palmitoylated and S-farnesylated proteins are reported to promote stable protein localization in the membrane (Fujiyama et al. 1991; Linder and Deschenes 2007; Salaun et al. 2010), and 13-6p could, therefore, be localized in the membranes of lipid bodies.  (a)  ↕ (b)   ↕ (c)   ↕  Figure 5.3 Predicted 3D folding of 13-6p by Phyre2. The possible 3D folding of 13-6p is shown in the cartoon (a) and surface (b,c) depictions. Hydrophobic residues are shown in blue in (c). 13-6p contains FLO11 domain (IPR018789) at 73 – 223 aa (green),  S-palmitoylation site on Cys-235 (red) and S-farnesylation site on Cys-391 (orange). Both lipidation sites were observed to be placed on the surface of the predicted structure (b, c). Domains and modification sites were identified by InterPro and GPS lipid (Ren et al. 2008; Hunter et al. 2009; Xie et al. 2014) and the potential folding structures were generated with Phyre2 (Kelley et al. 2015) based on the DNAN sequence and visualized with PyMOL v1.7.4. Besides proteins involved in lipid and sterol metabolism, the lipid body proteome also contains proteins that are involved in organelle trafficking and inter-organellar communications (Goodman 2008; Granneman and Moore 2008; Murphy et al. 2009; Zehmer et al. 2009). The mechanism of yeast flocculation through the hydrophobic interactions of Flo11p on the cell surface is well documented (Bayly et al. 2005; Verstrepen and Klis 2006; Kraushaar et al. 2015). Therefore, one possible function of 13-6p may be cellular lipid body trafficking, the mechanism of which is not yet well understood (Walther and  139  Farese 2009). Although the exact distribution of the cellular lipid bodies was not examined in this study, the presumed lipid bodies observed with 13-5p-GFP or 13-6p-GFP microscopy were highly clustered around the nucleus (Figure 4.5). Lipid bodies are reported to localize around nucleus in S. cerevisiae stationary phase cells or cells growing in nutrient poor conditions (Wolinski et al. 2011; Bouchez et al. 2015; Wang 2015). S. cerevisiae cells in stationary phase are reported to have higher tolerance to certain stresses such as heat and oxidative stresses compared to cells in exponential growth phase (Steels et al. 1994). Therefore, change in the cellular lipid body distribution may be associated with growth phase dependent difference in stress tolerance. The stress tolerance of stationary phase cells is crucial in wine fermentation as most of the sugar in grape must is converted to ethanol when S. cerevisiae is in stationary phase (Ansanay-Galeote et al. 2001; Orozco et al. 2012; Henderson and Block 2014). The superior stress tolerance of wine S. cerevisiae compared to laboratory strains of S. cerevisiae in stationary phase is considered one of the factors attributing to the ability of wine S. cerevisiae to ferment grape must to dryness (Orozco et al. 2012). In various high ethanol resistance studies, cellular flocculation behaviour is reported to contribute to higher ethanol tolerance as it reduces plasma membrane permeability (Chi and Arneborg 1999; Hu et al. 2003; Zhao and Bai 2009). The formation of lipid body clusters around the nucleus, therefore, may similarly reduce the permeability of the nuclear membrane to cytosolic compounds including ethanol. Alternatively, lipid bodies clustered around the nucleus are considered to be highly interactive with the ER and reflect the dynamic lipid compositional changes taking place. Whether the 13-6 protein plays a function in lipid bodies or localizes to lipid bodies temporarily for post-translational regulation is unknown. However, lipid and sterol related experiments for 13-6p will likely lead to characterizing the function of this gene.    5.3.6 The 14-1 ORF encodes  protein with sequence similar to Ady2p but may not be involved in ammonium ion transport The 14-1 protein has a GPR1/FUN34/yaaH family domain, which is found in Ady2p, an acetate transporter required for normal sporulation (Rabitsch et al. 2001; Paiva, et al. 2004). Also protein  140  sequence similarity was identified between 14-1p and Ato2p/Ato3p (ammonium exporters); Ato2p and Ady2p are paralogs; Ady2p, Ato2p and Ato3p are reported to be phosphorylated in the mitochondria (Reinders et al. 2007). The localization of Ato3p was previously observed in the vacuole (Huh et al. 2003) while no previous localization images for Ady2p and Ato2p are available. When overexpressed under the PGK1 promoter, the 14-1p-GFP fusion protein localized in the cytosol in a punctated manner near the cell periphery (Figure 4.5). The expression of 14-1p-GFP under the PGK1 promoter also resulted in the formation of a large vacuole, which is likely pushing all the organelles to the cell periphery in general. Export of ammonia by Ato2p and Ato3p is a starvation signal that promotes cell death in aging colonies (Palková et al. 2002; Váchová and Palková et al. 2005). GO term enrichment of the 14-1 mutant gene expression data, however, did not identify any cell death or ammonium ion transport related pathways. Instead, an increase in various other transporters such as sterol, amino acid and organic substance was identified. Therefore, 14-1 may play a different function than the transport of ammonium ions.  5.3.7 Novel ORFs 14-2 and M27 may be paralogs An amidase superfamily domain was identified in 14-2p by sequence analyses. Amidase catalyzes hydrolysis of an amide with release of an ammonium ion. NTA1 encodes amidase in S. cerevisiae, which hydrolyzes the N-terminal asparagine and glutamine residues for subsequent ubiquitination and degradation (Baker and Varshavsky 1995).  The results of protein sequence analysis and upregulation in ribosome biogenesis, sterol metabolism and alcohol metabolism in the 14-2 null mutant, however, did not have any immediately obvious connections, and the potential functions for 14-2p are difficult to speculate on. The 14-2p-GFP fusion protein did not show any clear localization even when it was expressed under the PGK1 promoter, although 14-2p-GFP was detected by western blot (Figure E.1 and Figure E.2). The sequence of 14-2 ORF obtained by the Gardner and the van Vuuren laboratories showed some discrepancies [16 SNPs and one missing base leading to two ORFs in Novo et al. (2009) sequence], which may be due to the presence of highly similar paralog, M27, identified in the van Vuuren laboratory M2 contig reads (Table 4.1). The re-sequencing of 14-2 and M27 including their promoter and terminator  141  regions will help to clarify the exact sequence differences between these two ORFs. Once the exact sequence differences are revealed, more effective GFP localization experiments may be designed. Since higher sensitivity to acetic acid was observed for the double deletion mutant of 14-2 and M27 (Figure 4.15), deletion of these two ORFs may lead to more clear phenotypes during wine fermentation.  5.3.8 The 14-4p shares sequence similarity to Yps6p  Analysis of the 14-4 protein sequence revealed a pepsin/retropepsin like superfamily (aspartic peptidase) domain and similarity to Yps6p (Table 4.1). Although the exact mechanism is unknown, deletion of Yps6p, a glycosyphosphatidylinositol-linked aspartyl proteases, was previously observed to result in hypersensitivity to cell wall perturbation (Olsen et al. 1999; Krysan et al. 2005). Although localization of the 14-4p-GFP fusion protein was not observed, the fusion protein was detected by western blot (Figure E.1 and Figure E.2). The band detected by western blot was observed to be ~140kD which is ~55 kDa heavier than the expected band size at 85 kDa (protein 58 kDa + GFP 27 kDa) (Figure E.1 and Figure E.2), suggesting possible post-translational modifications. The Yps6p also contains several glycosylation sites and a lipidation site and was previously identified to be glycosylated (Kung et al. 2009). However, the DE genes in the 14-4Δ gene expression data did not show any enrichment in the cell wall growth and maintenance related pathways, in which Yps6p is likely to be involved. Instead, the GO terms for 14-4Δ expression data include anion transmembrane transport [GO:0098656] (day 3, 1.35E-5), iron assimilation [GO:0033212] (1.87E-5), sterol biosynthetic process [GO:0016126] (1.43E-5) and organic hydroxy compound metabolic process [GO:1901615] (2.65E-5) (Table 4.26).   142  6. Conclusions The goal of this thesis study was to identify functions of 150 non-annotated ORFs in S. cerevisiae and eight novel ORFs conserved among wine S. cerevisiae strains using the M2 wine yeast strain and Chardonnay wine fermentation. Based on the gene expression analysis of the VIN13 wine yeast strain during Riesling fermentation (Marks et al. 2008), 20 non-annotated ORFs grouped in Cluster 7 (induced mid-way through fermentation) and 130 non-annotated ORFs grouped in Cluster 13 (constitutively expressed) were systematically deleted and/or overexpressed and screened for phenotypes. The phenotypes associated with mutants during Chardonnay fermentation were screened by measuring the weight loss speed over the course of fermentation and quantification of the volatile and non-volatile compounds in wine by HPLC. The growth curves of the mutants for 72 hours in Chardonnay grape must under aerobic conditions at three different temperatures (19 °C, 22 °C and 30 °C) were also measured. Two ORFs (RGI1 and YDR249C) from Cluster 7 non-annotated ORFs showed phenotypes during Chardonnay fermentation (Table 5.3). The overexpression of RGI1 and YDR249C both resulted in the increased acetic acid production (1.26-fold, p = 0.0491 and 1.52-fold increase, p = 0.001, respectively) (Table 3.3). Two other ORFs (MTC7 and PAR32) also showed slow growth phenotype with the growth curve analysis (Table 5.3, Figure 3.2). No phenotypes were identified for the 15 non-annotated Cluster 7 ORFs investigated in this study.  One common characteristic shared among Cluster 7 ORFs investigated (Table 6.1) is the higher level of gene expressions at the later stage (120 h and 340 h) of the fermentation. Therefore, these ORFs may play roles at the later stage of fermentation or to deal with the challenges found in the later stages of wine fermentation such as high ethanol, nitrogen starvation, carbon starvation, lack of fermentable sugars and low pH. In fact, RGI1 and PAR32 investigated as part of the Cluster 7 non-annotated ORFs are both speculated to play roles at the end of fermentation or after the fermentation is completed (Section 5.2.5 and 5.2.6). The lack of phenotypes with the majority of Cluster 7 ORFs investigated in this study may  143  suggest that the normal table wine fermentation condition is likely not the best condition to study the function of non-annotated ORFs in Cluster 7. Wine is usually racked (i.e. removal of yeast) after the completion of ethanol fermentation, and, unlike beer and fuel ethanol productions where yeast is recycled and re-used, viability and vitality at the end of fermentation are not a strong selection pressure for wine yeast strains. In nature, S. cerevisiae growing on the surface of rotten fruits will face the challenge to survive the conditions beyond the ethanol fermentation. Therefore, using the conditions that represent the conditions at the end of fermentation may be effective in identifying the phenotypes associated with the non-annotated ORFs grouped in Cluster 7.  Table 6.1 The microarray signal strengths of Cluster 7 ORFs investigated in this study. The table is a reproduction of Table S2 in the original study by Marks et al. (2008). For the clustering analysis, first two time points were not used in Marks et al. (2008).  No. ORF Statusa Time (H) 24 48 60 120 340 - PKC1 (Seed) Ver 49.9 54.5 69.5 96.1 128.8 1 COM2 Ver 108.4 101.5 138.2 240.0 330.6 2 MPO1 Ver 161.1 179.4 249.6 311.4 575.8 3 MTC7 Uch 39.2 48.5 59.0 74.8 122.2 4 PAR32 Ver 304.1 287.7 356.0 489.1 801.8 5 RGI1 Ver 165.7 419.1 380.3 415.9 706.7   6 RTK1 Ver 166.0 232.5 262.4 303.4 453.9 7 SNA2 Ver 817.0 1361.2 1504.7 1914.4 2828.9 8 YAL037W Uch 58.4 97.7 102.3 70.4 318.8 9 YBR063C Uch 73.5 105.2 146.3 185.9 324.5 10 YBR219C Uch 10.0 12.1 12.6 14.2 25.6 11 YCL042W Uch 143.5 147.8 629.5 294.5 612.4 12 YDL199C Uch 15.0 23.7 32.5 34.9 45.8 13 YDL206W Uch 32.0 51.6 67.3 84.5 94.1 14 YDR249C Uch 18.1 24.5 34.5 44.5 59.4 15 YDR476C Uch 598.2 711.2 755.4 1456.1 1380.6 16 YFL034W Uch 17.2 21.3 21.8 24.0 53.4 17 YGL101W Uch 108.4 86.1 118.5 315.9 214.5 18 YGR035C Uch 117.9 175.9 221.4 389.8 426.3 19 YGR079W Uch 158.5 272.7 384.0 628.4 616.3 20 YHL008C Uch 55.4 71.2 74.1 106.4 147.3 a Status on SGD: Ver = verified, Uch = uncharacterized, and Dub = dubious.  Screening of 118 non-annotated ORFs in Cluster 13 resulted in the identification slow fermentation phenotype associated with gep5Δ (Figure 3.1). Analysis of the Chardonnay wine also identified that the deletion of GEP5 leads to higher glycerol (1.39-fold, p = 0.0005) and acetic acid (1.61-fold, p = 0.0020)  144  levels (Table 3.4). The majority of non-annotated ORFs in Cluster 13, however, showed no phenotypes during Chardonnay fermentation in this study (Table 5.3). One possible reason for the lack of strong phenotypes may be due to the low microarray signal intensities (<100) associated with the majority of ORFs (79.2 % or 99 ORFs) investigated in this study (Marks et al. 2008, Table S2). Since Cluster 13 represents a constant expression pattern over the five sampling time points, the ORFs detected at the constitutively low signal levels (68.7 % or 1314 ORFs) lack in strong evidence that they are expressed during wine fermentation. Cluster 13 non-annotated ORFs investigated in this study indeed contained a large number of dubious ORFs (48 ORFs or 37.5 %), which is defined as “unlikely to encode an expressed protein” on SGD (2015b). Although the initial set of genes recognized in 1996 by Goffeau et al. was not exhaustive especially on the inclusion of small (<100 codons) genes, numerous research groups have since identified new and small genes in S288c or S288c derived strains and expanded the repository (Basrai et al. 1997; Olivas et al. 1997; Mackiewicz et al. 1999; Ross-Macdonald et al. 1999; Wood et al. 2001; Kumar et al. 2002; Mackiewicz et al. 2002; Oshiro et al. 2002; Brachat et al. 2003; Cliften et al. 2003; Kellis et al. 2003; Luo et al. 2003; Havilio et al. 2005; Fisk et al. 2006; Kastenmayer et al. 2006; Li et al. 2008; Nagalakshmi et al. 2008). The current set of dubious ORFs listed on SGD have been achieved as a result of several scrutinous examinations and, therefore, appear to stay consistent in the recent years (Peña-Castillo and Hughes 2007). The inclusion of ORFs with constantly low microarray signal intensities (961 ORFs are <50 signal intensities, 353 ORFs are >50 and <100 signal intensities, total 1314 ORFs out of 1876 ORFs in Cluster 13 or 70.0 %) likely led to higher false positives in Cluster 13. Re-clustering of the results obtained by using Yeast Genome S98 array (~6400 ORFs) in Marks et al. (2008) study by using the current 5744 probe sets on Yeast Genome 2.0 array released in 2004 and remove the ORFs with constantly low (<100) signal levels may lead to an interesting set of genes/ORFs in Cluster 13. The eight novel ORFs (13-1, 13-2, 13-4, 14-5, 13-6, 14-1, 14-2, 14-4) examined in this study were identified by the Gardner laboratory. Five novel ORFs (13-1, 13-2, 13-4, 13-5, 13-6) were found to be highly conserved among wine strains such as QA23, EC1118, VL3, AWRI796 and VIN13, while the  145  other three novel ORFs (14-1, 14-2 and 14-4) were found to be conserved among the wine strains at the lesser extent (Table 4.1).  The deletion of novel ORFs leading to detection of no strong phenotypes during wine fermentation was an unexpected result. Although wine fermentation conditions represent a much harsher environment compared to common laboratory media such as YPD, wine yeast strains are thought to be well adapted or selected to thrive in the conditions of wine fermentation. Therefore, using much more challenging conditions than the fermentation of table wine may lead to the identification of interesting phenotypes associated with the novel ORFs conserved among wine S. cerevisiae strains. As mentioned earlier, yeast in wine fermentation is usually used only once and discarded after the completion of fermentation. Such disposable use of yeast in the modern industrial wine production likely places little selective pressure on wine yeast to survive outside of the narrow window of wine fermentation. However, in nature, S. cerevisiae strains that have been selected for wine fermentations are not always converting the sugars in grapes or fruits to ethanol. They likely spend a much larger portion of their life not converting the sugars to ethanol. Therefore, some genes in wine yeast are expected to play roles to survive a long period of nutrient depletion. Also, wine yeast has to tolerate cycles that shift between an extreme high sugar environment at the time when the fruits become ripe and an extreme nutrient depletion season during winter. Some genes in wine strains likely play roles to enable survival during such extreme environmental shifts, and therefore, the phenotypes may not be observed during the period of wine fermentation.  Although Enoferm M2 is highly amenable to genetic manipulations and its homozygosity is an advantage to genetic studies, it is also known for the absence of negative characteristics in wine fermentation. The M2 yeast strain is documented to have neutral to low aroma production that does not dominate varietal character (Enoferm M2 2015). It is also known to produce low hydrogen sulfide (H2S), sulfur dioxide (SO2) and foam (Enoferm M2 2015). These characteristics are highly desired in certain styles of winemaking; however, the lack of strong aromatic phenotypes may not be ideal for gene functional studies related to volatile metabolites produced during wine fermentation. If the lack of strong  146  aromatic phenotypes is due to mutations resulting in pseudogenes or recessive alleles, deletion of these genes may not lead to strong phenotypes, which, in turn, makes the functional characterization more challenging. Therefore, using wine strains of S. cerevisiae known to contribute various characteristics of wine (e.g. aroma, mouth feel, acidity and better color retention) may help to reveal the functions of remaining non-annotated ORFs in S. cerevisiae during wine fermentation.   Screening for phenotypes by using various wine fermentation related conditions such as the addition of potassium metabisulfite, acetic acid, tartaric acid, malic acid, various nitrogen sources and extreme pHs were observed to be a promising strategy in this study. Also studying the cells in different growth phases in combination with the above stress conditions resulted in interesting growth phase dependent phenotypes.  Since yeast in nature likely spends more time in stationary phase, phenotype screening with cells in stationary phase may lead to the functional characterization of novel ORFs as well as non-annotated ORFs that currently have few phenotypes associated with them. Because laboratory S. cerevisiae has lost its tolerance to wine fermentation conditions and is unable to ferment grape must to completion, there were high expectations that the novel M2 ORFs would be responsible for the differences between laboratory and wine strains of S. cerevisiae. Some novel ORFs have indeed been previously characterized to play an important role and contribute to the suitability of wine strains for fermentations (Galeote et al. 2010). However, deletion of eight novel ORFs in this study did not lead to strong phenotypes during Chardonnay fermentation. Although the investigations on the novel ORFs are not yet exhausted, allelic differences in the common genes between laboratory and wine strains are hypothesized to be responsible for many of the differences between laboratory and wine strains of S. cerevisiae. A few such examples include a dominant allele of the sulfite pump (SSU1-R), a highly efficient allele for fructose transporter (HXT3), and a fast fermentation rate and low sulfide producing allele, cystathione beta-synthase (CYS4) (Goto-Yamamoto et al. 1998; Linderholm et al. 2006; Guillaume et al. 2007). Therefore, in addition to the novel ORFs, already characterized genes may play previously uncharacterized important roles during wine fermentation due to allelic differences. Searching for the  147  DNA and protein sequence differences in the motifs in promoters and domains in the resultant proteins may lead to the further identification of allelic differences between laboratory and wine S. cerevisiae strains. Also, since laboratory S. cerevisiae is unable to completely ferment grape must to wine, comparing the transcriptomic differences between laboratory and wine strains of S. cerevisiae in response to fermentation of grape must may lead to the identification of new functions of currently known genes that are common between wine and laboratory strains of S. cerevisiae. Such a study will greatly benefit from new transcriptomic approaches such as RNA-seq as the presence of SNPs will not affect the detection of gene expression levels. Being able to monitor the expression levels of novel ORFs by RNA-seq method will also likely lead to more in-depth knowledge of differences between laboratory and wine strains of S. cerevisiae.   148  Literature Cited Abe, F., Minegishi, H. (2008). Global screening of genes essential for growth in high-pressure and cold environments: searching for basic adaptive strategies using a yeast deletion library. Cellular genetics. 178(2):851-872. doi: 10.1534/genetics.107.083063 Adams, C., van Vuuren, H. J. J. (2010). Effect of timing of diammonium phosphate addition to fermenting grape must on the production of ethyl carbamate in wine. Am J Enol Vitic. 61(1):125-129.  Affymetrix (2001). GeneChip® Yeast Genome S98 Array. GeneChip Yeast Genome S98 Array. Retrieved on: October 12, 2015 Retrieved from: http://media.affymetrix.com/support/technical/datasheets/yeast_datasheet.pdf Affymetrix (2004). GeneChip® Yeast Genome 2.0 Array. GeneChip Yeast Genome 2.0 Array. Retrieved on: October 12, 2015 Retrieved from: http://media.affymetrix.com/support/technical/datasheets/yeast_datasheet.pdf Agri-food choice and quality act. (2005). Wines of marked quality regulation. Retrieved on: Nov 14, 2015 Retrieved from: http://www.bclaws.ca/EPLibraries/bclaws_new/document/ID/freeside/11_79_2005#section23 Aguilera, J., Randex-Gil., Francisca, Prieto, J. A. (2007). Cold response in Saccharomyces cerevisiae: new functions for old mechanisms. FEMS Microbiol Rev. 31(3):327-341. doi: 10.1111/j.1574-6976.2007.00066.x Akao, T., Yashiro, I., Hosoyama, A., Kitagaki, H., Horikawa, H., Watanabe, D., Akada, R., Ando, Y., Harashima, S., Inoue, T. et al. (2011). Whole-genome sequencing of sake yeast Saccharomyces cerevisiae Kyokai no. 7. DNA Res. 18(6):423-434. doi: 10.1093/dnares/dsr029 Albertin, W., Marullo, P., Aigle, M., Dillmann, C., de Vienne, D., Bely, M., Sicard, D. (2011). Population size drives industrial Saccharomyces cerevisiae alcoholic fermentation and is under genetic control. Appl Environ Microbiol. 77(8):2772-2784.  doi: 10.1128/AEM.02547-10 Alexandre, H., Mathieu, B., Charpentier, C. (1996). Alteration in membrane fluidity and lipid composition, and modulation of H+-ATPase activity in Saccharomyces cerevisiae caused by decanoic acid. Microbiology. 142(Pt 3):469-475. doi: 10.1099/13500872-142-3-469 Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol. 215(3):403-410. doi: 10.1016/S0022-2836(05)80360-2 Amerine, M. A., Thoukis, G. (1958). The glucose-fructose ratio of California grapes. Vitis. 1:224-229. Anderson, G. J., Lesuisse, E., Dancis, A., Roman, D. G., Labbe, P., Klausner, R. D. (1992). Ferric iron reduction and iron assimilation in Saccharomyces cerevisiae. J Inorg Biochem. 47(1):249-255. doi: 10.1016/0162-0134(92)84070-4  149  Ansanay-Galeote, V., Blondin, B., Dequin, S., Sablayrolles, J.-M. (2001). Stress effect of ethanol on fermentation kinetics by stationary-phase cells of Saccharomyces cerevisiae. Biotechnol Lett. 23(9):677-681. doi: 10.1023/A:1010396232420 Arita, A., Zhou, X., Ellen, T. P., Liu, X., Bai, J., Rooney, J. P., Kurtz, A., Klein, C. V., Dai, W., Begley, T. J., Costa, M. (2009). A genome-wide deletion mutant screen identifies pathways affected by nickel sulfate in Saccharomyces cerevisiae. BMC Genomics. 10:524. doi: 10.1186/1471-2164-10-524 Ashburner, M., Ball, C. A., Blake, J. A., Botstein, D., Butler, H., Cherry, M., Davis, A. P., Dolinski, K., Dwight, S. S., Eppig, J. T. (2000). Gene ontology: tool for the unification of biology. Nat Genet. 25:25-29. doi: 10.1038/75556 Askree, S. H., Yehuda, T., Smolikov, S., Gurevich, R., Hawk, J., Coker, C., Krauskopf, A., Kupiec, M., McEachern, M. J. (2004). A genome-wide screen for Saccharomyces cerevisiae deletion mutants that affect telomere length. PNAS. 101(23):8658-8663. doi: 10.1073/pnas.0401263101 Backhus, L. E., DeRisi, J., Brown, P. O., Bisson, L. F. (2001). Functional genomic analysis of a commercial wine strain of Saccharomyces cerevisiae under differing nitrogen conditions. FEMS Yeast Res. 1(2):111-125. doi: http://dx.doi.org/10.1111/j.1567-1364.2001.tb00022.x Baggerly, K. A., Coombes, K. R., Hess, K. R., Stivers, D. N., Abruzzo. L. V., Zhang, W. (2001). Identifying differentially expressed genes in cDNA microarray experiments. J Comput Biol. 8(6):639-659. doi: 10.1089/106652701753307539 Baker, R. T., Varshavsky, A. (1995). Yeast N-terminal amidase. A new enzyme and component of the N-end rule pathway. J Biol Chem. 270(20):12065-12074. doi: 10.1074/jbc.270.20.12065 Bakker, J., Clarke, R. J. (2012a). Mouth feel. Wine flavor chemistry (2nd ed.). (pp. 128-129). West Sussex, UK. Blackwell Publishing Ltd. Bakker, J., Clarke, R. J. (2012b). Sweet wines from Botrytis cinerea infected grapes. Wine flavor chemistry (2nd ed.). (pp. 32). West Sussex, UK. Blackwell Publishing Ltd. Bakker, J., Clarke, R. J. (2012c). Vinification process. Wine: Flavour chemistry (2nd ed.). (pp. 9-10). West Sussex, UK: Wiley Blackwell Publishing. Bakker, J., Clarke, R. J. (2012d). Wine aromas. Wine: Flavour chemistry (2nd ed.). (pp. 259-279). West Sussex, UK: Wiley Blackwell Publishing. Balakrishnan, R., Park, J., Karra, K., Binkley, G., Hong, E. L., Sullivan, J., MIcklem, G., Cherry, J. M. (2012). YeastMine: an integrated data warehouse for Saccharomyces cerevisiae data as a multipurpose tool-kit. Database (Oxford). Bar062. doi: 10.1093/database/bar062 Balogh, G., Pétera, M., Glatza, A., Gombosa, I., Töröka, Z., Horvátha, I., Harwoodb, J. L., Vígha, L. (2013). Key role of lipids in heat stress management. FEBS Lett. 587(13):1970-1980. doi: 10.1016/j.febslet.2013.05.016  150  Bandyopadhyay, S., Mehta, M., Kuo, D., Sung, M.-K., Chuang, R., Jaehnig, E. J., Bodenmiller, B., Licon, K., Copeland, W., Shales, M. et al. (2010). Rewiring of genetic networks in response to DNA damage. Science. 330(6009):1385-1389. doi: 10.1126/science.1195618 Barbet, N. C., Schneider, U., Helliwell., S. B., Stansfield, I., Tuite, M. F., Hall, M. N. (1996). TOR controls translation initiation and early G1 progression in yeast. Mol Biol Cell. 7(1):25-42. doi: 10.1091/mbc.7.1.25 Barnett, J. A. (1998). A history of research on yeasts 1: work by chemists and biologists 1789-1850. Yeast. 14(16):1439-1451. doi: 10.1002/(SICI)1097-0061(199812)14:16<1439::AID-YEA339>3.0.CO;2-Z Basrai, M. A., Hieter, P., Boeke, J. D. (1997). Small open reading frames: beautiful needles in the haystack. Genome Res. 7(8):768-771. doi: 10.1101/gr.7.8.768 Basson, M. E., Thorsness, M., Finer-Moore, J., Stroud, R. M., Rine, J. (1988). Structural and functional conservation between yeast and human 3-hydroxy-3-methylglutaryl coenzyme A reductases, the rate-limiting enzyme of sterol biosynthesis. Mol Cell Biol. 8(9):3797-3808. Batt, C. A. (2014). Effect of pH according to the physiological state. Encyclopedia of Food Microbiology (2nd ed.). (pp. 582-583). Academic Press.  Bauer, F. F., Govender, P., Bester, M. C. (2010). Yeast flocculation and its biotechnological relevance. Appl Microbiol Biotechnol. 88(1):31-39. doi: 10.1007/s00253-010-2783-0 Bayly, J. C., Douglas, L. M., Pretorius, I. S., Bauer, F. F., Dranginis, A. M. (2005). Characteristics of Flo11-dependent flocculation in Saccharomyces cerevisiae. FEMS Yeast Res. 5(12):1151-1156. doi: 10.1016/j.femsyr.2005.05.004 Bell, S.-J., Henschke, P. A. (2005). Implications of nitrogen nutrition for grapes, fermentation and wine. Aust J Grape Wine Res. 11(3):242-295. doi: 10.1111/j.1755-238.2005.tb00028.x Ben-Ari, G., Zenvirth, D., Sherman, A., Simchen, G., Lavi, U., Hillel, J. (2005). Application of SNPs for assessing biodiversity and phylogeny among yeast strains. Heredity (Edinb). 95(6):493-501. doi: 10.1038/sj.hdy.6800759 Ben-Aroya, S., Pan, X., Boeke, J. D., Hieter, P. (2010). Making temperature-sensitive mutants. Methods Enzymol. 470:181-204. doi: 10.1016/S0076-6879(10)70008-2 Benoit, D., du Toit, M., Duckitt, E. (2012). Surviving in the presence of sulphur dioxide: strategies developed by wine yeasts. Appl Microbiol Biotechnol. 95(3):601-6013. doi: 10.1007/s00253-012-4186-x Berg, H.W., Filipello, F., Hinreiner, E., and Webb, A.D. (1955). Evaluation of threshold and minimum difference concentrations for various constituents of wines: I. Water solutions of pure substances. Food Tech. 9:23-26. Bergström, A., Simpson, J. T., Salinas, F., Barré, B., Parts, L., Zia, A., Ba, A. N. N., Moses, A. M., Louis, E. J., Mustonen, V. et al. (2014). A high-definition view of functional genetic variation from natural yeast genomes. Mol Biol Evol. 31(4):872-888. doi: 10.1093/molbev/msu037  151  Berthels, N. J., Cordero Otero, R. R., Bauer, F. F., Thevelein, J. M., Pretorius, I. S. (2004). Discrepancy in glucose and fructose utilisation during fermentation by Saccharomyces cerevisiae wine yeast strains. FEMS Yeast Res. 4(7):683-689. doi: http://dx.doi.org/10.1016/j.femsyr.2004.02.005 Bidard, F., Blondin, B., Dequin, S., Vezinhet, F., Barre, P. (1994). Cloning and analysis of a FLO5 flocculation gene from S. cerevisiae. Curr Genet. 25(3):196-201. doi: 10.1007/BF00357162 Bishop, A. L., Rab, F. A., Sumner, E. R., Avery, S. V. (2006). Phenotypic heterogeneity can enhance rare-cell survival in ‘stress-sensitive’ yeast populations. Mol Microbiol. 63(2):507-520. doi: 10.1111/j.1365-2958.2006.05504.x Bisson, L. F., Karpel, J. E. (2010). Genetics of yeast impacting wine quality. Annu Rev Food Sci Technol. 1:139-162. doi: 10.1146/annurev.food.080708.100734 Blake, C. C., Rice, D. W. (1981). Phosphoglycerate kinase. Philos Trans R Soc Lond B Biol Sci. 293(1063):93-104. doi: 10.1098/rstb.1981.0063 Boeckstaens, M., Merhi, A., Llinares, E., Van Vooren, P., Springael, J.-Y., Wintjens, R., Marini, A. M. (2015). Identification of a novel regulatory mechanism of nutrient transport controlled by TORC1-Npr1-Amu1/Par32. PLoS Genet. 11(7):e1005382. doi: 10.1371/journal.pgen.1005382 Borneman, A. R., Forgan, A. H., Pretorius, I. S., Chambers, P. J. (2008). Comparative genome analysis of a Saccharomyces cerevisiae wine strain. FEMS Yeast Res. 8(7):1185-1195. doi: 10.1111/j.1567-1364.2008.00434.x Borneman, A. R., Desany, B. A., Riches, D., Affourtit, J. P., Forgan, A. H., Pretorius, I. S., Egholm, M., Chambers, P. J. (2011a). Whole-genome comparison reveals novel genetic elements that characterize the genome of industrial strains of Saccharomyces cerevisiae. PLoS Genet. 7(2):e1001287. doi: 10.1371/journal.pgen.1001287 Borneman, A. R., Desany, B. A., Riches, D., Affourtit, J. P., Forgan, A. H., Pretorius, I. S., Egholm, M., Chambers, P. J. (2011b). The genome sequence of the wine yeast VIN7 reveals an allotriploid hybrid genome with Saccharomyces cerevisiae and Saccharomyces kudriavzevii origins. FEMS Yeast Res. 12(1):88-96. doi: 10.1111/j.1567-1364.2011.00773.x Borneman, A. R., Desany, B. A., Riches, D., Affourtit, J. P., Forgan, A. H., Pretorius, I. S., Chambers, P. J. (2012). The genome sequence of the wine yeast VIN7 reveals an allotriploid hybrid genome with Saccharomyces cerevisiae and Saccharomyces kudriavzeii origins. FEMS Yeast Res. 12(1):88-96. doi: 10.1111/j.1567-1364.2011.00773.x Bouchez, I., Pouteaux, M., Canonge, M., Genet, M., Chardot, T., Guillot, A., Froissard, M. (2015). Regulation of lipid droplet dynamics in Saccharomyces cerevisiae depends on the Rab7-like Ypt7p, HOPS complex and V1-ATPase. Biol Open. 4(7):764-775. doi: 10.1242/bio.20148615 Boy-Marcotte, E., Garmendia, C., Garreau, H., Lallet, S., Mallet, L., Jacquet, M. (2006). The transcriptional activation region of Msn2p, in Saccharomyces cerevisiae, is regulated by stress but is insensitive to the cAMP signaling pathway. Mol Genet Genomics. 275(3):277-287. doi: 10.1007/s00438-005-0017-4  152  Boynton, P. J., Greig, D. (2014). The ecology and evolution of non-domesticated Saccharomyces species. Yeast. 31(12):449-462. doi: 10.1002/yea.3040 Brachat, S., Dietrich, F. S., Voegeli, S., Zhang, Z., Stuart, L., Lerch, A., Gates, K., Gaffney, T., Philippsen, P. (2003). Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol. 4(7):R45.  doi:  10.1186/gb-2003-4-7-r45 Bradbury, J. E., Richards, K. D., Niederer, H. A., Lee, S. A., Dunbar, P. R., Gardner, R. C. (2006). A homozygous diploid subset of commercial wine yeast strains. Antonie van Leeuwenhoek. 89(1):27-37. doi: 10.1007/s10482-005-9006-1 Bréchot, P., Chauvet, J., Dupuy, P., Croson, M., Rabatu, A. (1971). Oleanolic acid, anaerobe growth factor of wine yeast. C R Acad Sci Hebd Seances Acad Sci D. 272(6):890-893. Brem, R. B., Yvert, G., Clinton, R., Kruglyak, L. (2002). Genetic dissection of transcriptional regulation in dubbing yeast. Science. 296(5568):752-755. doi: 10.1126/science.1069516 Breslow, D. K., Cameron, D. M., Collins, S. R., Schuldiner, M., Stewart-Ornstein, J., Newman, H. W., Braun, S., Madhani, H. D., Krogan, N. J.Weissman, J. S. (2008). A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat Methods. 5(8):711-718. doi: 10.1038/nmeth.1234 Brice, C., Sanchez, I., Bigey, F., Legras, J.-L., Blondin, B. (2014). A genetic approach of wine yeast fermentation capacity in nitrogen-starvation reveals the key role of nitrogen signaling. BMC Genomics. 15:495. doi: 10.1186/1471-2164-15-495 Brohée, S., Janky, R., Abdel-Sater, F., Vanderstocken, G., André, B., van Helden, J. (2011). Unraveling networks of co-regulated genes on the sole basis of genome sequences. Nucl Acids Res. 39(15):6340-6358. doi: 10.1093/nar/gkr264 Bröhl, S., Lisowsky, T., Riemen, G., Michaelis, G. (1994). A new nuclear suppressor system for a mitochondrial RNA polymerase mutant identifies an unusual zinc-finger protein and a polyglutamine domain protein in Saccharomyces cerevisiae. Yeast. 10(6):719-731. doi: 10.1002/yea.320100604 Cabrito, T. R., Teixeira, M. C., Singh, A., Prasad, R., Sá-Correia, S. (2011). The yeast ABC transporter Pdr18 (ORF YNR070W) controls plasma membrane sterol composition, playing a role in multidrug resistance. Biochem J. 440(2):195-202. doi: 10.1042/BJ20110876. Cairns, B. R., Lorch, Y., Li, Y., Zhang, M., Lacomis, L., Erdjument-Bromage, H., Tempst, P., Laurent, B., Lornberg, R. D. (1996). RSC, an essential, abundant chromatin-remodeling complex. 87(7):1249-1260. doi: http://dx.doi.org/10.1016/S0092-8674(00)81820-6 Camarasa, C., Sanchez, I., Brial, P., Bigey, F., Dequin, S. (2011). Phenotypic landscape of Saccharomyces cerevisiae during wine fermentation: Evidence for origin-dependent metabolic traits. PLoS One. 6(9):e25147. doi: 10.1371/journal.pone.0025147  153  Cardenas, M. E., Cutler, N. S., Lorenz, M. C., Como, C. J. D. Heitman, J. (1999). The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev. 13(24):3271-3279.  Carrau, F. M., Medina, K., Farina, L., Boido, E., Henschke, P. A., Dellacassa, E. (2007). Production of fermentation aroma compounds by Saccharomyces cerevisiae wine yeasts: effects of yeast assimilable nitrogen on two model strains. FEMS Yeast Res. 8(7):1196-1207. doi: 10.1111/j.1567-1364.2008.00412.x Casanovas, A., Hannibal-Bach, H. K., Jensen, O. N., Ejsing, C. S. (2014). Shotgun lipidomic analysis of chemically sulfated sterols compromises analytical sensitivity: Recommendation for large-scale global lipidome analysis. Eur J Lipid Sci Technol. 116(12):1618-1620. doi: 10.1002/ejlt.201400451 Chambers, P. J., Pretorius, I. S. (2010). Fermenting knowledge: the history of winemaking, science and yeast research. EMBO Rep. 11(12):914-920. doi: 10.1038/embor.2010.179 Chan, K.-M, Liu, Y.-T, Ma, C.-H. Jayaram, M., Sau, S. (2013). The 2 micron plasmid of Saccharomyces cerevisiae: a miniaturized selfish genome with optimized functional competence. Plasmid. 70(1):2-17. doi: 10.1016/j.plasmid.2013.03.001 Chardonnay-du-monde. (2015, August 17). Learn more about the Chardonnay. Retrieved on August 17, 2015 from http://www.chardonnay-du-monde.com/Fr/80_chard/index.en.html Charron, M. J., Dubin, R. A., Michels, C. A. (1986). Structural and functional analysis of the MAL1 locus of Saccharomyces cerevisiae. Mol Cell Biol 6(11): 3891–3899. Cherest, H., Davidian, J. C., Thomas, D., Benes, V., Ansorge, W., Surdin-Kerjan, Y. (1997). Molecular characterization of two high affinity sulfate transporters in Saccharomyces cerevisiae. Genetics. 145(3):627-635. Cherry, J. M., Hong, E. L., Amundsen, C., Balakrishnan, R., Binkley, G., Chan, E. T., Christie, K. R., Costanzo, M. C., Dwight, S. S., Engel, S. R. et al. (2012). Saccharomyces Genome Database: the genomics resource of budding yeast. Nucl Acids Res. Jan;40(Database issue):D700-5. doi: 10.1093/nar/gkr1029 Chervitz, S. A., Aravind, L., Sherlock, G., Ball, C. A., Koonin, E. V., Dwight, S. S., Harris, M. A., Mohr, S., Smoth, T. et al. (1998). Comparison of the complete protein sets of worm and yeast: orthology and divergence. Science. 282(5396):2022–2028. Chi, Z., Arneborg, N. (1999). Relationship between lipid composition, frequency of ethanol-induced respiratory deficient mutants, and ethanol tolerance in Saccharomyces cerevisiae. J Appl Microbiol. 86(6):1047-1052. doi: 10.1046/j.1365-2672.1999.00793.x Cho, R. J., Campbell, M. J., Winzeler, E. A., Steinmetz, L., Conway, A., Wodicka, L., Wolfsberg, T. G., Gabrielian, A. E., Landsman, D., Lockhard, D. J. (1998). A genome-wide transcriptional analysis of the mitotic cell cycle. Mol Cell. 2(1):65-73. doi: 10.1016/S1097-2765(00)80114-8  154  Christie, K. R., Hong, E. L., Cherry, M. (2009). Functional annotations for the Saccharomyces cerevisiae genome: the knowns and the known unknowns. Trends Microbiol. 17(7):286-294. doi: 10.1016/j.tim.2009.04.005 Chong, Y.T., Koh, J. L. Y., Friesen, H., Duffy, S. K., Cox, M. J., Moses, A., Moffat, J., Boone, C., Andrews, B. J. (2015). Yeast proteome dynamics from single cell imaging and automated analysis. Cell. 161(6):1413-1424. doi: 10.1016/j.cell.2015.04.051 Ciosk, R., Zachariae, W., Michaelis, C., Shevchenko, A., Mann, M., Nasmyth, K. (1998). An Esp1/Pds1 complex regulates loss of sister chromatid cohesin at the metaphase to anaphase transition in yeast. Cell. 93(6):1067-1076. doi: http://dx.doi.org/10.1016/S0092-8674(00)81211-8 Cliften, P., Sudarsanam, P., Desikan, A., Fulton, L., Fulton, B., Majors, J., Waterston, R., Cohen, B. A., Johnston, M. (2003). Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science. 301(5629):71-76. doi: 10.1126/science.1084337 Codón, A. C., Benítez, T., Korhola, M. (1998). Chromosomal polymorphism and adaptation to specific industrial environments of Saccharomyces strains. Appl Microbiol Biotechnol. 49(2):154-163. doi: 10.1126/science.1084337 Cooper, K. F., Mallory, M. J., Guacci, V., Lowe, K., Strich, R. (2009). Pds1p is required for meiotic recombination and prophase I progression in Saccharomyces cerevisiae. Genetics. 181(1):65-79. doi: 10.1534/genetics.108.095513 Córcoles-Sáez, I., Ballester-Tomas, L., de la Torre-Ruiz, M. A., Prieto, J. A., Randez-Gil, F. (2012). Low temperature highlights the functional role of the cell wall integrity pathway in the regulation of growth in Saccharomyces cerevisiae. Biochem J. 446(3):477-488. doi: 10.1042/BJ20120634 Cordente, A. G., Curtin, C. D., Varela, C., Pretorius, I. S. (2012). Flavour-active wine yeasts. Appl Microbiol Biotechnol. 96(3):601-618. doi: 10.1007/s00253-012-4370-z Cyert, M. S., Philpott, C. C. (2013). Regulation of cation balance in Saccharomyces cerevisiae. Genetics. 193(3):677-713. doi: 10.1534/genetics.112.147207 Dancis, A., Haile, D., Yuan, D. S., Klausner, R. D. (1994a). The Saccharomyces cerevisiae copper transport protein (Ctr1p). Biochemical characterization, regulation by copper, and physiologic role in copper uptake. J Biol Chem. 269(41):25660-25667. Dancis, A., Klausner, R. D., Hinnebusch, A. G., Barriocanal, J. G. (1990). Genetic evidence that ferric reductase is required for iron uptake in Saccharomyces cerevisiae. Mol Cell Biol. 10(5):2294-2301. Dancis, A., Yuan, D. S., Haile, D., Askwith, C., Eide, D., Moehle, C., Kaplan, J., Klaunsner, R. D. (1994b). Molecular characterization of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport. Cell. 76(2):393-402.  Davies, C. (2014). Understanding and managing the timing of berry ripening and the flavor-ripe/sugar-ripe nexus. CSIRO Plant Industry. Retrieved on: October 24, 2015 Retrieved from: http://research.wineaustralia.com/completed_projects/understanding-and-managing-the-timing-of-berry- 155  ripening-and-the-flavour-ripesugar-ripe-nexus/ or http://research.wineaustralia.com/wp-content/uploads/2014/10/CSP-0905-Final-Report.pdf De Craene, J. O., Soetens, O., Andre, B. (2001). The Npr1 kinase controls biosynthetic and endocytic sorting of the yeast Gap1 permease. J Biol Chem. 276(47):43939-43948. doi: 10.1074/jbc.M102944200 Deed, N. K., van Vuuren, H. J. J., Gardner, R. C. (2011). Effects of nitrogen catabolite repression and di-ammonium phosphate addition during wine fermentation by a commercial strain of S. cerevisiae. Appl Microbiol Biotechnol. 89(5):1537–1549.  doi: 10.1007/s00253-011-3084-y DeLuna, A., Vetsigian, K., Shoresh, N., Hegreness, M., Colón-González, M., Chao, S., Kishony, R. (2008). Exposing the fitness contribution of duplicated genes. Nat Genet. 40(5):676-681. doi: 10.1038/ng.123 Dequin, S. (2001). The potential of genetic engineering for improving brewing, wine-making and baking yeasts. Appl Microbiol Biotechnol. 56(5-6):577-588. doi: 10.1007/s002530100700 Dequin, S., Casaregola, S. (2011). The genomes of fermentative Saccharomcyes. Comptes Rendus Biologies. 334(8-9):687-693. doi: 10.1016/j.crvi.2011.05.019 DeRisi, J. L., Lyer, V. R., Brown, P. O. (1997). Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278(5338):680-686. doi: 10.1126/science.278.5338.680 Desmazières, J. B. H. J. (1827). Recherches microscopiques et physiologiques sur le genre Mycoderma (2). Annales des Sciences Naturelles 10:42–67. Deutschbauer, A. M., Davis, R. W. (2005). Quantitative trait loci mapped to single nucleotide resolution in yeast. Nat Genet. 37(12): 1333-1340. doi: 10.1038/ng1674 Devault, A., Vallen, E. A., Yuan, T., Green, S., Bensimon, A., Schwob, E. (2002). Identification of Tah11/Sid2 as the ortholog of the replication licensing factor Cdt1 in Saccharomyces cerevisiae. Curr Biol. 12(8):689-694. doi: 10.1016/S0960-9822(02)00768-6 Dimitrov, L. N., Brem, R. B., Kruglyak, L., Gottschling, D. E. (2009). Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains. Genetics. 183(1):365-383. doi: 10.1534/genetics.109.104497 Dittrich, H. (1987). Microbiologie des Wines, 2nd ed. Stuttgart: Verlag Eugen Ulmer.  Divol, B., du Toit, M., Duckitt, E. (2012). Surviving in the presence of sulphur dioxide: strategies developed by wine yeasts. Appl Microbiol Biotechnol. 95(3):601-613. doi: 10.1007/s00253-012-4186-x Doi, A., Fujimoto, A., Sato, S., Uno, T., Kanda, Y., Asami, K., Tanaka, Y., Kita, A., Satoh, R., Sugiura, R. (2015). Chemical genomics approach to identify genes associated with sensitivity to rapamycin in the fission yeast Schizosaccharomyces pombe. Genes to Cells. 20(4):292-309. doi: 10.1111/gtc.12223 Domitrovic, T., Kozlov, G., Freire, J. C., Masuda, C. A., da Silva, Almedia, M., Montero-Lomeli, M., Atella, G. C., Matta-Camacho, E., Gehring, K., Kurtenbach, E. (2010). Structural and functional study of  156  YER067W, a new protein involved in yeast metabolism control and drug resistance. PLoS One. 5(6):e11163. doi: 10.1371/journal.pone.0011163 Domizio, P., Lencioni, L. (2011). Italian Vin Santo. Speciality wines. (pp. 46-65). Oxford, UK: Elsevier Inc.  Donalies, U. E. B., Stahl, U. (2002). Increasing sulfite formation in Saccharomyces cerevisiae by overexpression of MET14 and SSU1. Yeast. 19(6):475-484. doi: 10.1002/yea.849 Donalies, U. E. B., Nguyen, H. T. T., Stahl, U., Nevoigt, E. (2008). Improvement of Saccharomyces yeast strains used in brewing, wine making and baking. Adv Biochem Eng/Biotechnol. 111:67-98. doi: 10.1007/10_2008_099 Douglas, A. C., Smith, A. M., Sharifpoor, S., Yan, Z., Durbic, T., Heisler, L. E., Lee, A. Y., Ryan, O., Göttert, H., Surendra, A. et al. (2012). Functional analysis with a barcoder yeast gene overexpression system. G3 (Bethesda). 2(10):1279-1289. doi: 10.1534/g3.112.003400 Dubouloz, F., Deloche, O., Wanke, V., Cameroni, E., De Virgilio, C. (2005). The TOR and EGO protein complexes orchestrate microautophagy in yeast. Mol Cell. 19(1):15-26. doi: http://dx.doi.org/10.1016/j.molcel.2005.05.020 Dudoit, S., Yang, Y. H., Callow, M. J., Speed, T. P. (2002). Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments. Statistica Sinica. 12:111-139. Dunn, B., Levine, R. P., Sherlock, G. (2005). Microarray karyotyping of commercial wine yeast strains reveals shared, as well as unique, genomic signatures. BMC Genomics. 6:53. doi: 10.1186/1471-2164-6-53  Dunn, B., Richter, C., Kvitek, D. J., Sherlock, G. (2012). Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments. Genome Res. 22(5):908-924. doi: 10.1101/gr.130310.111 Dupont, S., Beney, L., Ferreira, T., Gervais, P. (2011). Nature of sterols affects plasma membrane behavior and yeast survival during dehydration. Biochim Biophys Acta. 1808(6):1520-1528. doi: 10.1016/j.bbamem.2010.11.012 Ehrenhofer-Murray, A. E., Seitz, M. U., Sengstag, C. (1998). The Sge1 protein of Saccharomyces cerevisiae is a membrane-associated multidrug transporter. Yeast. 14(1):49-65. doi: 10.1002/(SICI)1097-0061(19980115)14:1<49::AID-YEA199>3.0.CO;2-T Engel, S. R., Dietrich, F. S., Fisk, D. G., Binkley, G., Balakrishnan, R., Costanzo, M. C., Dwight, S. S., Hitz, B. C., Karra, K., Nash, R. S. et al. (2014). The reference genome sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda). 4(3):389-398. doi: 10.1534/g3.113.008995 Enoferm M2. (2015, August 31). Australia & New Zealand Technical Data Sheet. Lallemand Australia. Retrieved on August 31, 2015 from http://winequip.com.au/wp-content/uploads/2015/01/M2.pdf   157  Erasmus, D. J., van der Merwe, G. K., van Vuuren, H. J. J. (2003). Genome-wide expression analysis: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress. FEMS Yeast Res. 3(4):375-399. doi: 10.1016/S1567-1356(02)00203-9 Estruch, F. (2000). Stress-controlled transcription factors, stress-induced genes and stress tolerance in budding yeast. FEMS Microbiol Rev. 24(4):469-486. doi: 10.1016/S0168-6445(00)00035-8 Evans, I H., Diala, E. S., Earl, A., Wilkie, D. (1980). Mitochondrial control of cell surface characteristics in Saccharomyces cerevisiae. BBA - Biomembranes. 602(1):201-206. doi:10.1016/0005-2736(80)90302-8 Faria-Oliveira, F., Diniz, R. H. S., Godoy-Santos, F., Piló, F. B., Mezadri, H., Castro, I. M., Brandão, R. L. (2015). The role of yeast and lactic acid bacteria in the production of fermented beverages in South America. Food Production and Industry. Ed. Ayman Hafiz Amer Eissa. Accessed on December 19, 2015. Accessed at http://www.intechopen.com/books/food-production-and-industry/the-role-of-yeast-and-lactic-acid-bacteria-in-the-production-of-fermented-beverages-in-south-america#exportas Fay, J. C., Benavides, J. A. (2005). Evidence for domesticated and wild populations of Saccharomyces cerevisiae. PLoS Genet. 1(1):e5. doi: 10.1371/journal.pgen.0010005 Ferreira, C., van Voorst, F., Martins, A., Neves, L., Oliveira, R., Kielland-Brandt, M. C., Lucas, C., Brandt, A. (2005). A member of the sugar transporter family, Stl1p is the glycerol/H+ symporter in Saccharomyces cerevisiae. Mol Biol Cell. 16(4):2068-2076. doi: 10.1091/mbc.E04-10-0884 Fichtner, L., Schaffrath, R. (2002). KTI11 and KIT13, Saccharomyces cerevisiae genes controlling sensitivity to G1 arrest induced by Kluyveromyces lactis zymocin. Mol Microbiol. 44(3):865-875. doi: 10.1046/j.1365-2958.2002.02928.x Fidalgo, M., Barrales, R. R., Ibeas, J. I., Jimenez, J. (2006). Adaptive evolution by mutations in the FLO11 gene. PNAS. 103(30):11228-112233. doi: 10.1073/pnas.0601713103 Fisk, D. G., Ball, C. A., Dolinski, K., Engel, S. R., Houng, E. L., Issel-Traver, L., Schwartz, K., Sethuraman, A., Bostein, D., Cherry, J. M. (2006). Saccharomyces cerevisiae S288c genome annotation: a working hypothesis. Yeast. 23(12):857-865. doi: 10.1002/yea.1400 Fleet, G. H., Heard, G. M. (1993). Yeasts – growth during Fermentation. Wine microbiology and biotechnology (Fleet, G. H. ed). Chur, Switzerland; Harwood Academic Publishers. pp. 27-54. Fugelsang, K., Edwards, C. (2007a).  Alcoholic fermentation. Wine microbiology: practical applications and procedures (2nd ed.). (pp. 85-86). New York, NY:Springer Science+Business Media.  Fugelsang, K., Edwards, C. (2007b).  Fermentation and post-fermentation processing. Wine microbiology: practical applications and procedures (2nd ed.). (pp. 115-138). New York, NY:Springer Science+Business Media.  Fujiyama, A., Tsunasawa, S., Tamanoi, F., Sakiyama, F. (1991). S-Farnesylation and methyl esterification of C-terminal domain of yeast RAS2 protein prior to fatty acid acylation. J Biol Chem. 266(27):17926-17931.  158  Gafner, J., Schütz, M. (1996). Impact of glucose-fructose ratio on stuck fermentations: practical experience to restart stuck fermentation. Vitic Enol Sci. 51: 214-218. Gagiano, M., Bauer, F. F., Pretorius, I. S. (2002). The sensing of nutritional status and the relationship to filamentous growth in Saccharomyces cerevisiae. FEMS Yeast Res. 2: 433–470. doi: http://dx.doi.org/10.1111/j.1567-1364.2002.tb00114.x Galeote, V., Bigey, F., Beyne, E., Novo, M., Legras, J.-L. Casaregola, S., Dequin, S. (2011). Amplification of a Zygosaccharomyces bailii DNA segment in wine yeast genomes by extrachromosomal circular DNA formation. PLoS One. 6(3):e17872. doi: 10.1371/journal.pone.0017872 Galeote, V., Novo, M., Salema-Oom, M., Brion, C., Valério, E., Gonçalves, P., Dequin, S. (2010). FSY1, a horizontally transferred gene in the Saccharomyces cerevisiae EC1118 wine yeast strain, encodes a high-affinity fructose/H+ symporter. Microbiology. 156(Pt 12):3754-3761. doi: 10.1099/mic.0.041673-0 Gambetta, J. M., Bastian, S. E. P., Cozzolino, D., Jeffery, D. W. (2014). Factors influencing the aroma composition of Chardonnay wines. J Agric Food Chem. 62(28):6512-6534. doi: 10.1021/jf501945s Gamero, A., Belloch, C., Querol, A. (2015). Genomic and transcriptomic analysis of aroma synthesis in two hybrids between Saccharomyces cerevisiae and S. kudriavzevii in winemaking conditions. Microb Cell Fact. 14:128. doi: 10.1186/s12934-015-0314-5 Gan, X., Kitakawa, M., Yoshino, K., Oshiro, N., Yonezawa, K., Isono, K. (2002). Tag-mediated isolation of yeast mitochondrial ribosome and mass spectrometric identification of its new components. Eur J Biochem. 269(21):5203-5214. doi: 10.1046/j.1432-1033.2002.03226.x Gaubitz, C., Oliveira, T. M., Prouteau, M., Leitner, A., Karuppasamy, M., Konstantinidou, G., Rispal, D., Eltschinger, S., Robinson, G. C., Thore, S. et al. (2015). Molecular basis of the rapamycin insensitivity of target of rapamycin complex 2. Mol Cell. 58(6):977-988.  doi:10.1016/j.molcel.2015.04.031 Gelperin, D. M., White, M. A., Wilkinson, M. L., Kon, Y., Kung, L. A., Wise, K. J., Lopez-Hoyo, N., Jiang, L., Piccirillo, S., Yu, H. et al. (2005). Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev. 19(23):2816-2826. doi: 10.1101/gad.1362105 Georgatsou, E., Alexandraki, D. (1994). Two distinctly regulated genes are required for ferric reduction, the first step of iron uptake in Saccharomyces cerevisiae. Mol Cell Biol. 14(5):3065-3073. Georgatsou, E., Alexandraki, D. (1999). Regulated expression of the Saccharomyces cerevisiae Fre1p/Fre2p Fe/Cu reductase related genes. Yeast. 15(7):573-584. doi: 10.1002/(SICI)1097-0061(199905)15:7<573::AID-YEA404>3.0.CO;2-7 Georgatsou, E., Mavrogiannis, L. A., Fragiadakis, G. S., Alexandraki, D. (1997). The yeast Fre1p/Fre2p cupric reductases facilitate copper uptake and are regulated by the copper-modulated Mac1p activator. J Biol Chem. 272(21):13786-13792. doi: 10.1074/jbc.272.21.13786 Gerbasi, V. R., Weaver, C. M., Hill, S., Friedman, D. B., Link, A. J. (2004). Yeast Asc1p and mammalian RACK1 are functionally orthologous core 40S ribosomal proteins that repress gene expression. Mol Cell Biol. 24(18):8276-8287. doi: 10.1128/MCB.24.18.8276-8287.2004  159  Ghaemmaghami, S., Huh, W. K., Bower, K., Howson, R. W., Belle, A., Dephoure, N., O’Shea, E. K., Weissman, J. S. (2003). Global analysis of protein expression in yeast. Nature. 425(6959):737-741. doi: 10.1038/nature02046 Giaever, G., Chu, A. M., Ni, L., Connelly, C., Riles, L., Véronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., André, B. et al. (2002). Functional profiling of the Saccharomyces cerevisiae genome. Nature. 418(6896):387-391. doi: 10.1038/nature00935 Giaever, G., Nislow, C. (2014). The yeast deletion collection: a decade of functional genomics. Genetics. 197(2):451-465. doi: 10.1534/genetics.114.161620 Giannattasio, S., Guaragnella, N., Ždralević, M., Marra, E. (2013). Molecular mechanisms of Saccharomyces cerevisiae stress adaptation and programmed cell death in response to acetic acid. Front Microbiol. 4(33):1-7. doi: 10.3389/fmicb.2013.00033 Gietz, R. D., Schiestl, R. H., Willems, A. R., Woods, R. A. (1995). Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast. 11(4):355-360. doi: 10.1002/yea.320110408 Gish, W., States, D. J. (1993). Identification of protein coding regions by database similarity search. Nat Genet. 3(3):266-72. doi: 10.1038/ng0393-266 Goddard, M. R., Greig, D. (2015). Saccharomyces cerevisiae: a nomadic yeast with no niche? FEMS Yeast Res. 15(3)3:fov009. doi: 10.1093/femsyr/fov009 Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J. D., Jacq, C., Johnston, M. et al. (1996). Life with 6000 genes. Science. 274(5287):546, 563-567. doi: 10.1126/science.274.5287.546 Goldstein, A.L., McCusker, J.H . (1999). Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15(14): 1541–1553. doi: 10.1002/(SICI)1097-0061(199910)15:14<1541::AID-YEA476>3.0.CO;2-K Goodman, J. M. (2008). The gregarious lipid droplet. J Biol Chem. 283(4):28005-28009. doi: 10.1074/jbc.R800042200 Görner, W., Durchschlag, E., Martinex-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton, B., Ruis, H., Schüller, C. (1998). Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12(4):586-597.  Goto-Yamamoto, N., Kitano, K., Shiki, K., Yoshida, Y., Suzuki, T., Iwata, T., Yamane, Y., Hara, S. (1998). SSU1-R, a sulfite resistance gene of wine yeast, is an allele of SSU1 with a different upstream sequence. J Ferm Bioeng. 86(5):427-433. doi: 10.1016/S0922-338X(98)80146-3 Govender, P., Kroppenstedt, S., Bauer, F. F. (2011). Novel wine-mediated FLO11 flocculation phenotype of commercial Saccharomyces cerevisiae wine yeast strains with modified FLO gene expression. FEMS Microbiol Lett. 317(2):117-126. doi: 10.1111/j.1574-6968.2011.02219.x Granneman, J. G., Moore, H. P. (2008). Location, location: protein trafficking and lipolysis in adipocytes. Trends Endocrinol Metab. 19(1):3-9. doi: dx.doi.org/10.1016/j.tem.2007.10.006  160  Grillitsch, K., Connerth, M., Köfeler, H., Arrey, T. N., Rietschel, B., Wagner, B., Karas, M., Daum, G. (2011). Lipid particles/droplets of the yeast Saccharomyces cerevisiae revisited: lipidome meets proteome. Biochim Biophys Acta. 1811(12):1165-1176. doi: 10.1016/j.bbalip.2011.07.015 Gross, C., Kelleher, M., Iyer, V. R., Brown, P. O., Winge, D. R. (2000). Identification of the copper regulon in Saccharomyces cerevisiae by DNA microarrays. J Biol Chem. 275(41):32310-32316. doi: 10.1074/jbc.M005946200 Guillaume, C., Delobel, P., Sablayrolles, J. M., Blondin, B. (2007). Molecular basis of fructose utilization by the wine yeast Saccharomyces cerevisiae: a mutated HXT3 allele enhances fructose fermentation. Appl Environ Microbiol. 73(8):2432-2439. doi: 10.1128/AEM.02269-06 Güldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. (1996). A new efficient gene disruption cassette for repeated use in budding yeast. Nucl Acids Res. 24(13):2519–2524.  Hagman, A., Piškur, J. (2015). A study on the fundamental mechanism and the evolutionary driving forces behind aerobic fermentation in yeast. PLoS ONE. 10(1):e0116942. doi: 10.1371/journal. pone.0116942 Hallett, J. E. H., Luo, X., Capaldi, A. P. (2014). State transitions in the TORC1 signaling pathway and information processing in Saccharomyces cerevisiae.198:773-786. doi: 10.1534/genetics.114.168369 Haber, J. E. (2012). Mating-type genes and MAT switching in Saccharomyces cerevisiae. Genetics. 191(1):33-64. doi: 10.1534/genetics.111.134577 Hassett, R., Kosman, D. J. (1995). Evidence for Cu(II) reduction as a component of copper uptake by Saccharomyces cerevisiae. J Biol Chem. 270(1):128-134. doi: 10.1074/jbc.270.1.128 Hastie, C. J., Vázquez-Martin, C., Philp, A., Stark, M. J. R., Cohen, P. T. W. (2006). The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin. FEBS J. 273(14):3322-3334. doi: 10.1111/j.1742-4658.2006.05336.x Havilio, M., Levanon, E. Y., Lerman, G., Kupiec, M., Eisenberg, E. (2005). Evidence for abundant transcription of non-coding regions in the Saccharomyces cerevisiae genome. BMC Genomics. 6:93. doi: 10.1186/1471-2164-6-93 Heitman, J., Movva, N. R., Hall, M.N. (1991). Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science. 253(5022):905-909.  Henderson, C. M., Block, D. E. (2014). Examining the role of membrane lipid composition in determining the ethanol tolerance of Saccharomyces cerevisiae. Appl Environ Microbiol. 80(10):2966-2972. doi: 10.1128/AEM.04151-13 Henderson, C. M., Lozada-Contreras, M., Jiranek, V., Longo, M. L., Block, D. E. (2012). Ethanol production and maximum cell growth are highly correlated with membrane lipid composition during fermentation as determined by lipidomic analysis of 22 Saccharomyces cerevisiae strains. Appl Environ Microbiol. 79(1):91-104. doi: 10.1128/AEM.02670-12  161  Henderson, C. M., Zeno, W. F., Lerno, L. A., Longo, M. L., Block, D. E. (2013). Fermentation temperature modulates phosphatidylethanolamine and phosphatidylinositol levels in the cell membrane Saccharomyces cerevisiae. Appl Environ Microbiol. 79(17):5345-5356. doi: 10.1128/AEM.01144-13 Heuck, S., Gerstamnn, U. C., Michalke, B., Kanter, U. (2010). Genome-wide analysis of caesium and strontium accumulation in Saccharomyces cerevisiae. Yeast. 27(10):817-835. doi: 10.1002/yea.1780 Hirata, D., Kishimoto, N., Suda, M., Sogabe, Y., Nakagawa, S., Yoshida, Y., Sakai, K., Mizunuma, M., Miyakawa, T., Ishiguro, J., Toda, J. (2002). Fission yeast Mor2/Cps12, a protein similar to Drosophila Furry, is essential for cell morphogenesis and its mutation induced Wee1-dependent G(2) delay. EMBO J. 21(18):4863-4874. doi: 10.1093/emboj/cdf495 Hirata, R., Ohsumk, Y., Nakano, A., Kawasaki, H., Suzuki, K., Anraku, Y. (1990). Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae. J Biol Chem. 265(12):6726-6733.  Hitzeman, R. A., Clarke, L., Carbon, J. (1980). Isolation and characterization of the yeast 3-phosphoglycerokinase gene (PGK) by an immunological screening technique. J Biol Chem. 255(24):12073-12080. Ho, C. D., Magtanong, L., Barker, S. L., Gresham, D., Nishimura, S., Natarajan, P., Koh, J. L., Porter, J., Gray, C. A., Andersen, R. J. et al. (2009). A molecular barcoded yeast ORF library enables mode-of-action analysis of bioactive compounds. Nat Biotechnol. 27(4):369-377.  doi: 10.1038/nbt.1534 Hornig, N. C. D., Knowles, P. P., McDonald, N. Q., Uhlmann, F. (2002). The dual mechanism of separase regulation by securin. Curr Biol. 12(12):973-982. doi: http://dx.doi.org/10.1016/S0960-9822(02)00847-3 Hu, C.-K., Bai, F.-W., An, L.-J. (2003). Enhancing ethanol tolerance of a self-flocculating fusant of Schizosaccharomyces pombe and Saccharomyces cerevisiae by Mg2+ via reduction in plasma membrane permeability. Biotechnol Lett. 25(4):1191-1194. doi: 10.1023/A:1024583503274 Hu, Y., Rolfs, A., Bhullar, B., Murthy, T. V., Zhu, C., Camargo, A. A., Kelley, F., McCarron, S., Jepson, D., Richardson, A. et al. (2007). Approaching a complete repository of sequence-verified protein-encoding clones for Saccharomyces cerevisiae. Genome Res. 17(4):536-543. doi:  10.1101/gr.6037607 Huber, A., Bodenmiller, B., Uotila, A., Stahl, M., Wanka, S., Gerrits, B., Aebersold, R., Loewith, R. (2009). Characterization of the rapamycin-sensitive phosphoproteome reveals that Sch9 is a central coordinator of protein synthesis. Genes Dev. 23(16):1929-1943. doi: 10.1101/gad.532109 Hughes, T. R., Marton, M. J., Jones, A. R., Roberts, C. J., Stoughton, R., Armour, C. D., Bennett, H. A., Coffey, E., Dai, H., He, Y. D. et al. (2000). Functional discovery via a compendium of expression profiles. Cell. 102(1):109-126. doi:  http://dx.doi.org/10.1016/S0092-8674(00)00015-5 Huh, W.-K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S., O’Shea, E. K. (2003). Global analysis of protein localization in budding yeast. 425:686-691. doi: 10.1038/nature02026  162  Hunter, S., Apweiler, R., Attwood, T. K., Bairoch, A., Bateman, A., Binns, D., Bork, P., Das, U., Daugherty, L., Duquenne, L. et al. (2009). InterPro: the integrative protein signature database. 37(Database issue):D211-D215.  doi: 10.1093/nar/gkn785 Hwang, J. Y., Smith, S., Ceschia, A., Torres-Rosell, J., Aragon, L., Myung, K. (2008). Smc5-Smc6 complex suppresses gross chromosomal rearrangements mediated by breaking replications. DNA Repair (Amst). 7(9):1426-1436. doi: 10.1016/j.dnarep.2008.05.006 Ibáñez, C., Pérez-Torrado, R., Chiva, R., Guillamón, J. M., Barrio, E., Querol, A. (2014). Comparative genomic analysis of Saccharomyces cerevisiae yeasts isolated from fermentations of traditional beverages unveils different adaptive strategies. Int J Food Microbiol. 171(3):129-135. doi: 10.1016/j.ijfoodmicro.2013.10.023 Imbach, T., Burda, P., Kuhnert, P., Wevers, R. A., Aebi, M., Berger, E. G., Hennet, T. (1999). A mutation in human ortholog of the Saccharomyces cerevisiae ALG6 gene causes carbohydrate-deficient glycoprotein syndrome type-Ic. PNAS. 96(12):6982-6987.  Iung, A. R., Coulon, J., Kiss, F., Ekome, J. N., Vallner, J., Bonaly, R. (1999). Mitochondrial function in cell wall glycoprotein synthesis in Saccharomyces cerevisiae NCYC 625 (Wild Type) and [rho0] mutants. Appl Environ Microbiol. 65(12):5398-5402.  Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U., Speed, T. P. (2003). Exploration, Normalization, and Summaries of High Density Oligonucleotide Array Probe Level Data. Nucl Acids Res. 31(4):e15. doi: 10.1093/nar/gng015 Jablonowski, D., Frohloff, F., Fichtner, L., Stark, M. J., Schaffrath, R. (2001). Kluyveromyces lactis zymocin mode of action is linked to RNA polymerase II function via elongator. Mol Microbiol. 42(4):1095-1105. doi: 10.1046/j.1365-2958.2001.02705.x Jacinto, E., Guo, B., Arndt, K. T., Schmelzle, T., Hall, M. N. (2001). TIP41 interacts with TAP42 and negatively regulates the TOR signaling pathway. Mol Cell. 8(5):1017-1026. doi: 10.1016/S1097-2765(01)00386-0 Jackson, R. S. (2014). Acidity and pH adjustment. Wine science: principles and applications (4th ed.) (pp. 536-537). San Diego, CA: Academic Press.   Jacobson, J. L. (2006). Fermentation. Introduction to wine laboratory practices and procedures (pp. 108-112). New York, NY: Springer Science+Business Media Inc.  Jacquier, N., Choudhary, V., Mari, M., Toulmay, A., Reggiori, F., Schneiter, R. (2011). Lipid droplets are functionally connected to the endoplasmic reticulum in Saccharomyces cerevisiae. J Cell Sci. 124(Pt 14):2424-2437. doi: 10.1242/jcs.076836 Janssen, M. J. F. W., Koorengevel, M. C., de Kruijff, B., de Kroon, A. I. P. M. (2000). The phosphatidylcholine to phosphatidylethanolamine ratio of Saccharomyces cerevisiae varies with the growth phase. Yeast. 16(7):641-650. doi: 10.1002/(SICI)1097-0061(200005)16:7<641::AID-YEA578>3.0.CO;2-U  163  Jensen, R., Sprague, G. F. Jr., Herskowitz, I. (1983). Regulation of yeast mating-type interconversion: feedback control of HO gene expression by the mating-type locus. PNAS. 80(10):3035-3539. Jones, H. L., Margaritis, A., Stewart, R. J. (2007). The combined effects of oxygen supply strategy, inoculum size and temperature profile on very-high-gravity beer fermentation by Saccharomyces cerevisiae. J Inst Brew. 113(2): 168-184. doi: 10.1002/j.2050-0416.2007.tb00274.x Jones, G. M., Stalker, J., Humphray, S., West, A., Cox, T., Rogers, J., Dunham, I., Prelich, G. (2008). A systematic library for comprehensive overexpression screens in Saccharomyces cerevisiae. Nat Meth. 5(3):239-241. doi: 10.1038/nmeth.1181 Jones, P., Binns, D., Chang, H.-Y., Fraser, M., Li, W., McAnulla, C., McWilliam, H., Maslen, J., Mitchell, A., Nuka, G., Pesseat, S. (2014). InterProScan 5: genome-scale protein function classification. Bioinformatics. 30(9):1236-1240. doi: 10.1093/bioinformatics/btu031 Kanehisa, M., Goto, S. (2000). KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 28(1):27-30.  Kanehisa, M., Goto, S., Sato, Y., Kawashima, M., Furumichi, M., Tanabe, M. (2014). Data, information, knowledge and principle: back to metabolism in KEGG. Nucleic Acids Res. 42(Database issue):D199-D205. doi: 10.1093/nar/gkt1076 Kastenmayer, J. P., Ni, L., Chu, A., Kitchen, L. E., Au, W.-C., Yang, H., Carter, C. D., Wheeler, D., Davis, R. W., Boeke, J. D., Snyder, M. A., Basrai, M. A. (2006). Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res. 16(3):365-373. doi: 10.1101/gr.4355406 Kellis, M., Patterson, N., Endrizzi, M., Birren, B., Lander, E. S. (2003). Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature. 423(6937):241-254. doi: 10.1038/nature01644 Keszenman, D. J., Salvo, V. A., Nunes, E. (1992). Effects of bleomycin on growth kinetics and survival of Saccharomyces cerevisiae: a model of repair pathways. 174(10):3125-3132. Kelley, L. A., Mezullis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. (2015). The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc. 10(6):845-858. doi: 10.1038/nprot.2015.053 Kerr, G. W., Sarkar, S., Arumugam, P. (2012). How to halve ploidy: lessons from budding yeast meiosis. Cell Mol Life Sci. 69(18):3037-3051. doi: 10.1007/s00018-012-0974-9 King, R. W., Deshaies, R. J., Peters, J.-M., Kirschner, M. W. (1996). How proteolysis drives the cell cycle. Science. 274(5293):1652-1659. dio: 10.1126/science.274.5293.1652 Knight, S. A., Labbé, S., Kwon, L. F., Kosman, D. J., Thiele, D. J. (1996). A widespread transposable element masks expression of a yeast copper transport gene. Genes Dev. 10(15):1917-1929. doi: 10.1101/gad.10.15.1917 Koç, A., Wheeler, L. J., Mathews, C. K., Merrill, G. F. (2004). Hydroxyurea arrests DNA replication by a mechanism that preserves basal dNTP pool.  J Biol Chem. 279(1):223-230. doi: 10.1074/jbc.M303952200  164  Koh, J. L. Chong, Y. T., Friesen, H., Moses, A., Boone, C., Andrews, B. J., Moffat, J. (2015). CYCLoPs: A comprehensive database constructed from automated analysis of protein abundance and subcellular localization patterns in Saccharomyces cerevisiae. G3 (Bethesda). 5(6):1223-1232. doi: 10.1534/g3.115.017830 Kothari, V., Patadia, M., Trivedi, N. (2011). Microwave sterilized media supports better microbial growth than autoclaved media. Research in Biotechnology. 2(5): 63-72.  Koonin, E. V. (2005). Orthologs, paralogs, and evolutionary genomics. Annu Rev Genet. 39:309-38. doi: 10.1146/annurev.genet.39.073003.114725 Kraushaar, T., Brückner, S., Veelders, M., Rhinow, D., Schreiner, F., Birke, R., Pagenstecher, A., Mösch, H.-U., Essen, L.-O. (2015). Interactions by the fungal Flo11 adhesin depend on a fibronectin type III-like adhesion domain girdled by aromatic bands. Structure. 23(6):1005-1017. doi: dx.doi.org/10.1016/j.str.2015.03.021 Kruckeberg, A. L., Bisson, L. F. (1990). The HXT2 gene of Saccharomyces cerevisiae is required for high-affinity glucose transport. Mol Cell Biol. 10(11):5903-5913.  Krysan, D. J., Ting, E. L., Abeijon, C., Kroos, L., Fuller, R. S. (2005). Yapsins are a family of aspartyl proteases required for cell wall integrity in Saccharomyces cerevisiae. Eukaryot Cell. 4(8): 1364-1374. doi: 10.1128/EC.4.8.1364-1374.2005 Kumar, A., Harrison, P. M., Cheung, K.-H., Lan, N., Echols, N., Bertone, P., Miller, P., Gerstein, M. B., Synder, M. (2002). An integrated approach for finding overlooked genes in yeast. Nat Biotech. 20(1):58-63. doi: 10.1038/nbt0102-58 Kumar, A., Bachhawat, A. K. (2010). OXP1/YKL215C encodes an ATP-dependent 5-oxoprolinase in Saccharomyces cerevisiae: functional characterization, domain structure and identification of actin-like ATP-binding motifs in eukaryotic 5-oxoprolinases. FEMS Yeast Res. 10(4):394-401. doi: 10.1111/j.1567-1364.2010.00619.x Kung, L. A., Tao, S. C., Qian, J., Smith, M. G., Snyder, M., Zhu, H. (2009). Global analysis of the glycoproteome in Saccharomyces cerevisiae reveals new roles for protein glycosylation in eukaryotes. Mol Syst Biol. 5:308. doi: 10.1038/msb.2009.64 Lafon-Lafourcade, S., Larue, F., Ribéreau-Gayon, P. (1979). Evidence for the existence of "survival factors" as an explanation for some peculiarities of yeast growth, especially in grape must of high sugar concentration. Appl Environ Microbiol. 38(6):1069-1073.  Lallemand (2015). Enoferm M2. Australia & New Zealand Technical Data Sheet. Retrieved on: October 25, 2015 Retrieved from: http://winequip.com.au/wp-content/uploads/2015/01/M2.pdf Lallemand. (2012) Oenology Portfolio: Australia & New Zealand. Retrieved on: October 25, 2015 Retrieved from: http://www.winebiz.com.au/pdf/CB4001.pdf Lalo, D., Steffan, J. S., Dodd, J. A., Nomura, M. (1996). RRN11 encodes the third subunit of the complex containing Rrn6p and Rrn7p that is essential for the initiation of rDNA transcription by yeast RNA polymerase I. J Biol Chem. 271(35):21062-21067. doi: 10.1074/jbc.271.35.21062  165  Landolfo, S., Politi, H., Angelozzi, D., Mannazzu, I. (2008). ROS accumulation and oxidative damage to cell structures in Saccharomyces cerevisiae wine strains during fermentation of high-sugar-containing medium. Biochim Biophys Acta. 1780(6):892-898. doi: 10.1016/j.bbagen.2008.03.008 Lange, H., Kispal, G., Lill, R. (1999). Mechanism of iron transport to the site of heme synthesis inside yeast mitochondria. J Biol Chem. 274(27):18989-18996. doi: 10.1074/jbc.274.27.18989 Laroche, C., Beney, L., Marechal, P. A., Gervais, P. (2001). The effect of osmotic pressure on the membrane fluidity of Saccharomyces cerevisiae at different physiological temperatures. Appl Microbiol Biotechnol. 56(1-2):249-254. doi: 10.1007/s002530000583 Lashkari, D A., DeRisi, J. L., McCusker, J. H., Namath, A. F., Gentile, C., Hwang, S. Y., Brown, P. O., Davis, R. W. (1997). Yeast microarrays for genome wide parallel genetic and gene expression analysis. PNAS. 94(24):13057-13062. Lea, A. G. H., Piggott, J. R. (2003). Fermented beverage production. 2nd ed.  New York (NY):Springer Science+Business Media (US). doi: 10.1007/978-1-4615-0187-9 League, G. P., Slot, J. C., Rokas, A. (2012). The ASP3 locus in Saccharomyces cerevisiae originated by horizontal gene transfer from Wickerhamomyces. FEMS Yeast Res. 12(7):859-863. doi: 10.1111/j.1567-1364.2012.00828.x Legras, J.-L., Merdinoglu, D., Cornuet, J.-M., Karst, F. (2007). Bread, beer and wine: Saccharomyces cerevisiae diversity reflects human history. Mol Ecol. 16(10):2091-2102. doi: 10.1111/j.1365-294X.2007.03266.x Lenoir, T., Giannella, E. (2006). The emergence and diffusion of DNA microarray technology. J Biomed Discov Collab. 1:11. doi: 10.1186/1747-5333-1-11 Lesage, G., Bussey, H. (2006). Cell wall assembly in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 70(2):317-343. doi: 10.1128/MMBR.00038-05 Levin, D. E., Bowers, B., Chen, C. Y., Kamada, Y., Watanabe, M. (1994). Dissecting the protein kinase C/MAP kinase signalling pathway of Saccharomyces cerevisiae. Cell Mol Biol Res. 40(3):229-239.  Lewis, J. A., Gasch, A. P. (2012). Natural variation in the yeast glucose-signaling network reveals a new role for the Mig3p transcription factor. G3 (Bethesda). 2(12):1607-1612. doi: 10.1534/g3.112.004127 Li, L., Kaplan, J. (1997). Characterization of two homologous yeast genes that encode mitochondrial iron transporters. J Biol Chem. 272(45):28485-28493. doi: 10.1074/jbc.272.45.28485 Li, Q. Y., Carvunis, A. R., Yu, H., Han, J. D., Zhong, Q., Simonis, N., Tam, S., Hao, T., Klitgord, N. J., Dupuy, D. et al. (2008). Revisiting the Saccharomyces cerevisiae predicted ORFeome. Genome Res. 18(8):1294-1303. doi: 10.1101/gr.076661.108 Li, Y., Bachant, J., Alcasabas, A. A., Wang, Y., Qin, J., Elledge, S. J. (2002). The mitotic spindle is required for loading of the DASH complex onto the kinetochore. Genes Dev. 16(2):183-197. doi:  10.1101/gad.959402  166  Li, Y., Elledge, S. J. (2003). The DASH complex component Ask1 is a cell cycle-regulated Cdk substrate in Saccharomyces cerevisiae. Cell Cycle. 2(2):143-148.  Li, Z., Vizeacoumar, F. J., Bahr, S., Li, J., Warringer, J., Vizeacoumar, F. S., Min, R., Vandersluis, B., Bellay, J., Devit, M. (2011). Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat Biotechnol. 29(4):361-367. doi: 10.1038/nbt.1832 Li, X., Kim, J., Zhou, J., Gu, W., Quigg, R. (2005). Use of signal thresholds to determine significant changes in microarray data analyses. Genet Mol Biol. 28(2):191-200.  Linder, M. E., Deschenes, R. J. (2007). Palmitoylation: policing protein stability and traffic. Nature Reviews Molecular Cell Biology. Nat Rev Mol Cell Biol. 8:74-84. doi: 10.1038/nrm2084 Linderholm, A. L., Olineka, T. L., Hong, Y., Bisson, L. F. (2006). Allele diversity among genes of the sulfate reduction pathway in wine strains of Saccharomyces cerevisiae. Am J Enol Vitic. 57(4):431-440.  Lipshutz, R. J., Fodor, S. P. A., Gingeras, T. R., Lockhart, D. J. (1999). High density synthetic oligonucleotide arrays. Nat Gen. 21(1 Suppl):20-24. doi: 10.1038/4447 Liti, G. (2015). The fascinating and secret wild life of the budding yeast S. cerevisiae. eLife. 4:e05835 835.doi: http://dx.doi.org/10.7554/eLife.05835 Liti, G., Carter, D. M., Moses, A. M., Warringer, J., Parts, L., James, S. A., Tsai, I. J., Bergman, C. M., Bensasson, D., O’Kelly, M. J. T. et al. (2009). Population genomics of domestic and wild yeast. Nature. 458:337-341. doi: 10.1038/nature07743 Lo, W. S., Dranginis, A. M. (1996). FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin. J Bacteriol. 178(24):7144-7151.  Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D., Oppliger, W., Jenoe, P., Hall, M. N. (2002). Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell. 10(3):457-468. doi:10.1016/S1097-2765(02)00636-6 Loewith, R., Hall, M. N. (2011). Target of rapamycin (TOR) in nutrient signaling and growth control. Genetics. 189(4):1177-1201. doi: 10.1534/genetics.111.133363 Lu, W., Clasquin, M. F., Melamud, E., Amador-Noguez, D., Caudy, A. A., Rabinowitz, J. D. (2010). Metabolomic analysis via reverse-phase ion-pairing liquid chromatography coupled to a stand alone orbitrap mass spectrometer. Anal Chem. 82(8):3212-3221. doi: 10.1021/ac902837x Lundblad, V., Struhl, K. (2008). Yeast. Current Protocols in Molecular Biology. 82(13.0):13.0.1-13.0.4. doi: 10.1002/0471142727.mb1300s82 Luo, L., Li, H., Zhang, L. (2003). ORF organization and gene recognition in the yeast genome. CompFunctGenom. 4(3):318-328. doi: 10.1002/cfg.292 Luo, Z., Walkey, C. J., Madilao, L. L., Measday, V., van Vuuren, H. J. J. (2013). Functional improvement of Saccharomyces cerevisiae to reduce volatile acidity in wine. FEMS Yeast Res. 13(5):485-495. doi: 10.1111/1567-1364.12053  167  Lutfiyya, L. L., Iyer, V. R., DeRisi, J., DeVit, M. J., Brown, P. O., Johnston, M. (1998). Characterization of three related glucose repressors and genes they regulate in Saccharomyces cerevisiae. Genetics. 150(4):1377-1391. Ma, J., Bharucha, N., Dobry, C. J., Fisch, R. L., Lawson, S., Kumar, A. (2008). Localization of autophagy-related proteins in yeast using a versatile plasmid-based resource of fluorescent protein fusions. Autophagy. 4(6):792-800. doi: 10.4161/auto.6308 Mackiewicz, P., Kowalczuk, M., Gierlik, A., Dudek, M. R., Cebrat, S. (1999). Origin and properties of non-coding ORFs in the yeast genome. Nucl Acids Res. 27(17):3503-3509. doi: 10.1093/nar/27.17.3503 Mackiewicz, P., Kowalczuk, M., Mackiewicz, D., Nowicka, A., Dudkiewicz, M., Laszkiewicz, A., Dudek, M. R., Cebrat, S. (2002). How many protein-coding genes are there in the Saccharomyces cerevisiae genome? Yeast. 19(7):619-629. doi: 10.1002/yea.865 Maris, A. F., Kern, A. L., Picada, J. N., Boccardi, F., Brendel, M., Henriques, J. A. P. (2000). Glutathione, but not transcription factor Yap1, is required for carbon source-dependent resistance to oxidative stress in Saccharomyces cerevisiae. Curr Gen. 37(3):175-182. doi: 10.1007/s002940050516 Marks, V. D., Ho Sui, S. J., Erasmus, D., van der Merwe, G. K., Brumm, J., Wasserman, W. W., Bryan, J., van Vuuren, H. J. J. (2008). Dynamics of the yeast transcriptome during wine fermentation reveals a novel fermentation stress response. FEMS Yeast Res. 8:35-52. doi: 10.1111/j.1567-1364.2007.00338.x Marsit, S., Dequin, S. (2015a). Diversity and adaptive evolution of Saccharomyces wine yeast: a review. FEMS Yeast Res. 15(7):fov067. doi: 10.1093/femsyr/fov067 Marsit, S., Mena, A., Bigey, F., Sauvage, F.-X., Couloux, A., Guy, J., Legras, J.-L., Barrio, E., Dequin, S., Galeote, V. (2015b). Evolutionary advantage conferred by an eukaryote-to-eukaryote gene transfer event in wine yeasts. Mol Biol Evol. 32(7):1695-1707. doi: 10.1093/molbev/msv057 Martínez-Muñoz, G. A., Kane, P. (2008). Vacuolar and plasma membrane proton pumps collaborate to achieve cytosolic pH homeostasis in yeast. J Biol Chem. 283(29):20309-20319. doi: 10.1074/jbc.M710470200 Martínez-Montañés, F., Rienzo, A., Poveda-Huertes, D., Pascual-Ahuir, A., Markus, P. (2013). Activator and repressor functions of the Mot3 transcription factor in the osmostress response of Saccharomyces cerevisiae. Eukaryot Cell. 12(5):636-647. doi: 10.1128/EC.00037-13 Martínez-Pastor, M. T., Marchler, G., Schüller, C., Marchler-Bauer, A., Ruis, H., Estruch, F. (1996). The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). 15(9):2227-2235.  Mauricio, J. C., Moreno, J., Ortega, J. M. (1997). In vitro specific activities of alcohol and aldehyde dehydrogenase from two flor yeasts during controlled wine aging. J Agric Food Chem. 45(5):1967-1971. doi: 10.1021/jf960634i McCormick, M. A., Delaney, J. R., Tsuchiya, M., Tsuchiyama, S., Shemorry, A., Sim, S., Chou, A. C., Ahmed, U., Carr, D., Murakami, C. J. et al. (2015). A comprehensive analysis of replicative lifespan in  168  4698 single-gene deletion strains uncovers conserved mechanisms of aging. Cell Metab. 22(5):895-906. doi: 10.1016/j.cmet.2015.09.008 McGovern, P. E., Glusker, D. L., Exner, L. J., Voigt, M. M. (1996a). Neolithic resonated wine. Nature. 381:480-481.  McGovern, P., Fleming, S., Katz, S. (1996b). Origins and ancient history of wine (Food and nutrition in history and anthropology). New York, NY: Routledge.   McGovern, P. E., Hartung, U., Badler, V. R., Exner, L. J. (1997a). The beginnings of wine making and viticulture in the ancient near east and Egypt Exped. 39(1):3-21. McGovern, P. E. (1997b). Wine of Egypt’s golden age: An archaeochemical perspective. J Egypt Arch. 83:69-108. doi: 10.2307/3822459 Meem, M. H., Cullen, P. J. (2012). The impact of protein glycosylation on Flo11-dependent adherence in Saccharomyces cerevisiae. 12(7):809-818. doi: 10.1111/j.1567-1364.2012.00832.x Mendes-Ferreira, A., Sampaio-Marques, B., Barbosa, C., Rodrigues, F., Costa, V., Mendes-Faia, A., Ludovico, P., Leão, C. (2010). Accumulation of non-superoxide anion reactive oxygen species mediates nitrogen-limited alcoholic fermentation by Saccharomyces cerevisiae. Appl Environ Microbiol. 76(24):7918-7924. doi: 10.1128/AEM.01535-10 Merico, A., Sulo, P., Piskur, J., Compagno, C. (2007). Fermentative lifestyle in yeasts belonging to the Saccharomyces complex. FEBS J. 274(4):976-989. doi: 10.1111/j.1742-4658.2007.05645.x Merz, S., Westermann, B. (2009). Genome-wide deletion mutant analysis reveals genes required for respiratory growth, mitochondrial genome maintenance and mitochondrial protein synthesis in Saccharomyces cerevisiae. Genome Biol. 10(9):R95. doi: 10.1186/gb-2009-10-9-r95 Miller, J. H. (1972). Experiments in molecular genetics. Cold Spring, NY: Cold Spring Harbor Laboratory. Mitchell, A., Chang, H.-Y., Daugherty, L., Fraser, M., Hunter, S., Lopez, R., McAnulla, C., McMenamin, C., Nuka, G., Pesseat, S. et al. (2015). The InterPro protein families database: the classification resource after 15 years. Nucl Acids Res. 43(Database issue):D213-D221. doi: 10.1093/nar/gku1243 Mnaimneh, S., Davierwala, A. P., Haynes, J., Moffat, J., Peng, W. T., Zhang, W., Pootoolal, J., Chua, G., Lopez, A., Trochesset, M. et al. (2004). Exploration of essential gene functions via titratable promoter alleles. Cell. 118(1):31-44. doi: http://dx.doi.org/10.1016/j.cell.2004.06.013 Modig, T., Granath, K., Adler, L., Lidén, G. (2007). Anaerobic glycerol production by Saccharomyces cerevisiae strains under hyperosmotic stress. Appl Microbiol Biotechnol. 75(2):289-296. doi: 10.1007/s00253-006-0821-8 Montañés, F. M., Pascual-Ahuir, A., Proft, M. (2011). Repression of ergosterol biosynthesis is essential for stress resistance and is mediated by the Hog1 MAP kinase and the Mot3 and Tox1 transcription factors. Mol Microbiol. 79(4):1008-1023. doi: 10.1111/j.1365-2958.2010.07502.x  169  Mortimer, R. K., Johnston, J. R. (1986). Genealogy and principal strains of the yeast genetic stock center. Genetics. 113(1):35-43.  Morton, J. S. (1980). Glycolysis and alcoholic fermentation. Acts & Facts. 9(12). Accessed on Dec 19, 2015. Accessed at http://www.icr.org/article/glycolysis-alcoholic-fermentation/ Mount Kobau Wine Services. (2014). 2014 B.C. wine grape acreage report. Retrieved on August 17, 2015 from http://www.bcwgc.org/resource/acreage-report http://grapegrowers.bc.ca/pdf/2014AcreageSurveyReport.pdf Müllner, H., Zweytick, D., Leber, R., Turnowsky, F., Daum, G. (2004). Targeting of proteins involved in sterol biosynthesis to lipid particles of the yeast Saccharomyces cerevisiae. Biochim Biophys Acta. 1663(1-2):9-13. doi: 10.1016/j.bbamem.2004.03.001 Murphy, S., Martin, S., Parton, R. G. (2009). Lipid droplet-organelle interactions; sharing the fats. Biochim Biophys Acta. 1791(6):441-447. doi: 10.1016/j.bbalip.2008.07.004 Mutch, D. M., Berger, A., Mansourian, R., Rytz, A., Roberts, M.-A. (2002). The limited fold change model: A practical approach for selecting differentially expressed genes from microarray data. BMC Bioinform. 3:17. doi: 10.1186/1471-2105-3-17 Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., Snyder, M. (2008). The transcriptional landscape of the yeast genome defined by RNA sequencing. Science. 320(5881):1344-1349. doi: 10.1126/science.1158441 Nardi, T., Corich, V., Giacomini, A., Blondin, B. (2009). A sulphite-inducible form of the sulphite efflux gene SSU1 in a Saccharomyces cerevisiae wine yeast. Microbiol. 156:1686-1696. doi: 10.1099/mic.0.036723-0 Nevoigt, E., Stahl, U. (1997). Osmoregulation and glycerol metabolism in the yeast Saccharomyces cerevisiae. FEMS MicrobiolRev. 21(3):231-241. doi: 10.1016/S0168-6445(97)00058-2 Noble, A. C., Bursick, G. F. (1984). The contribution of glycerol to perceived viscosity and sweetness in white wine. Am J Enol Vitic. 35:110-112.  Novo, M., Bigey, F., Beyne, E., Galeote, V., Gavory, F., Mallet, S., Cambon, B., Legras, J.-L., Wincker, P., Casaregola, S., Dequin, S. (2009). Eukaryote-to-eukaryote gene transfer events revealed by the genome sequence of the wine yeast Saccharomyces cerevisiae EC1118. PNAS. 106(38):16333-16338. doi: 10.1073/pnas.0904673106 O’Connor-Cox, E. S. C., Ingledew, W. M. (1990). Effect of the timing of oxygenation on very high gravity brewing fermentations. J Am Soc Brew Chem. 48:0026. doi: 10.1094/ASBCJ-48-0026 Ohkuni, K., Kikuchi, Y., Hara, K., Taneda, T., Hayashi, N., Kikuchi, A. (2006). Suppressor analysis of the mpt5/htr1/uth4/puf5 deletion in Saccharomyces cerevisiae. Mol Gen Genom. 275(1):81-88. doi: 10.1007/s00438-005-0064-x  170  Olivas, W. M., Muhlrad, D., Parker, R. (1997). Analysis of the yeast genome: Identification of new non-coding and small ORF-containing RNAs. Nucl Acids Res. 25(22):4619-4625. doi: 10.1093/nar/25.22.4619 Olsen, V., Cawley, N. X., Brandt, J., Egel-Mitani, M., Loh. Y. P. (1999). Identification and characterization of Saccharomyces cerevisiae yapsin 3, a new member of the yapsin family of aspartic proteases encoded by the YPS3 gene. Biochem J. 339(Pt 2):407-411.  Omura, F., Hatanaka, H., Nakao, Y. (2007). Characterization of a novel tyrosine permease of lager brewing yeast shared by Saccharomyces cerevisiae strain RM11-1a. FEMS Yeast Res. 7(8):1350-1361. doi: http://dx.doi.org/10.1111/j.1567-1364.2007.00310.x Ontario (2015). Wine content and labelling act, 2000, S. O. 2000, c. 26, Sched. P. Retrieved on: Nov 14, 2015 Retrieved from: http://www.ontario.ca/laws/regulation/000659 Orij, R., Rul, S., Smits, G. J. (2011). Intracellular pH is a tightly controlled signal in yeast. Biochim Biophys Acta. 1810(10):933-944. doi: 10.1016/j.bbagen.2011.03.011 Orlean, P. (2012). Architecture and biosynthesis of the Saccharomyces cerevisiae cell wall. Genetics. 192(3):775-818. doi: 10.1534/genetics.112.144485 Orozco, H., Matallana, E., Aranda, A. (2012). Oxidative stress tolerance, adenylate cyclase, and autophagy are key players in the chronological life span of Saccharomyces cerevisiae during winemaking. Appl Environ Microbiol. 78(8):2748-2757. doi: 10.1128/AEM.07261-11 Oshiro, G., Wodicka, L. M., Washburn, M. P., Yates III, J. R. Lockhart, D. J., Winzeler, E. A. (2002). Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res. 12(8):1210-1220.  doi: 10.1101/gr.226802 Osman, C., Haag, M., Potting, C., Rodenfels, J., Dip, P. V., Wieland, F. T., Brügger, B., Westermann, B., Langer, T. (2009). The genetic interactome of prohibitins: coordinated control of cardiolipin and phosphatidylethanolamine by conserved regulators in mitochondria. J Cell Biol. 184(4):583-596. doi: 10.1083/jcb.200810189 Otterstedt, K., Larsson, C., Bill, R. N., Ståhlberg, A. Boles, E., Hohmann, S., Gustafsson, L. (2004). Switching the mode of metabolism in the yeast Saccharomyces cerevisiae. EMBO Rep. 5(5):532-537. doi: 10.1038/sj.embor.7400132 Özcan, S., Johnston, M. (1999). Function and regulation of yeast hexose transporters. Microbiol Mol Biol Rev. 63(3):554-569.  Paiva, S., Devaux, F., Barbosa, S., Jacq, C., Casal, M. (2004). Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast. 21(3):201-210. doi: 10.1002/yea.1056 Palková, Z., Devaux, F., Icicová, M., Mináriková, L., Le Crom, S., Jacq, C. (2002). Ammonia pulses and metabolic oscillations guide yeast colony development. Mol Biol Cell. 13(11):3901-3914. doi:  10.1091/mbc.E01-12-0149  171  Palková, Z., Janderová, B., Gabriel, J., Zikánová, Z., Pospísek, M., Forstová, J. (1997). Ammonia mediates communication between yeast colonies. Nature. 390(6659):532-536. doi: 10.1038/37398 Pao, S. S., Paulsen, I. T., Saier, M. H., Jr. (1998). Major facilitator superfamily. Microbiol Mol Biol Rev. 62(1):1-34.  Park, H., Bakalinsky, A. T. (2000). SSU1 mediates sulphite efflux in Saccharomyces cerevisiae. Yeast. 16(10):881-888. doi: 10.1002/1097-0061(200007)16:10<881::AID-YEA576>3.0.CO;2-3 Park, H., Lopez, N. I., Bakalinsky, A. T. (1999). Use of sulfite resistance in Saccharomyces cerevisiae as a dominant selectable marker. Curr Genet. 36(6):339-344. doi: 10.1007/s002940050508 Penninckx, M. J. (2002). An overview on glutathione in Saccharomyces versus non-conventional yeasts. FEMS Yeast Res. 2(3):295-305. doi: 10.1111/j.1567-1364.2002.tb00098.x Perrone, G. G., Grant, C. M., Dawes, I. W. (2005). Genetic and environmental factors influencing glutathione homeostasis in Saccharomyces cerevisiae. Mol Biol Cell. 16(1):218-230. doi:  10.1091/mbc.E04-07-0560 Perry, J. J. P., Ballard, G. D., Albert, A. E., Dobrolecki, L. E., Malkas, L. H., Hoelz, D. J. (2015). Human C6orf211 encodes Armt1, a protein carboxyl methyltransferase that targets PCNA and is linked to the DNA damage response. Cell Reports. 10(8):1288-1296. doi: 10.1016/j.celrep.2015.01.054  Peña-Castillo, L., Hughes, T. R. (2007). Why are there still over 1000 uncharacterized yeast genes? Genetics. 176(1):7-14. doi: 10.1534/genetics.107.074468 Peñalva, M. A., Tilburn, J., Bingell, E., Arst H. N. Jr. (2008). Ambient pH gene regulation in fungi: making connections. Trends Microbiol. 16(6):291-300. doi: 10.1016/j.tim.2008.03.006 Peynaud, E. (1996). The taste of wine: The art science of wine appreciation (2nd ed.). New York, NY:  John Wiley & Sons. Pfeiffer, T., Morley, A. (2014). An evolutionary perspective on the Crabtree effect. Front Mol Biosci. 1:17. doi: 10.3389/fmolb.2014.00017 Pfeiffer, T., Schuster, S., Bonhoeffer, S. (2001). Cooperation and competition in the evolution of ATP-producing pathways. Science. 292(5516):504-507. doi: 10.1126/science.1058079 Phalip, V., Kuhn, I., Lemoine, Y., Jeltsch, J. M. (1999). Characterization of the biotin biosynthesis pathway in Saccharomyces cerevisiae and evidence for a cluster containing BIO5, a novel gene involved in vitamer uptake. Gene. 232(1):43-51. doi: 10.1016/S0378-1119(99)00117-1 Piškura, J., Rozpędowska, E., Polakova, S., Merico, A., Compagno, C. (2006). How did Saccharomyces evolve to become a good brewer? Cell Press. 22(4):183-186. doi: 10.1016/j.tig.2006.02.002 Pol, A., Gross, S. P., Parton, R. G. (2014). Biogenesis of the multifunctional lipid droplet: Lipids, proteins, and sites. J Biol Chem. 204(5):635. doi: 10.1083/jcb.201311051  172  Polakowski, T., Stahl, U., Lang, C. (1998). Overexpression of a cytosolic hydrozymentylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbiol Biotechnol. 49(1):66-71. doi: 10.1007/s002530051138 Powis, K., Zhang, T., Panchaud, N., Wang, R., De Virgillo, C., Ding, J. (2015). Crystal structure of the Ego1-Ego2-Ego3 complex and its role in promoting Rag GTPase-dependent TORC1 signaling. 25(9):1043-1059. doi: 10.1038/cr.2015.86 Pretorius, I. S. (2000). Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast. 16(8):675-729. doi: 10.1002/1097-0061(20000615)16:8<675::AID-YEA585>3.0.CO;2-B Pronk, J. T., Y de Steensma, H., Van Dijken, J. P. (1996). Pyruvate metabolism in Saccharomyces cerevisiae. Yeast. 12(16):1607-1633. doi: 10.1002/(SICI)1097-0061(199612)12:16<1607::AID-YEA70>3.0.CO;2-4 Puig, S., Pérez-Ortín, J. E. (2000). Stress response and expression patterns in wine fermentations of yeast genes induced at the diauxic shift. Yeast. 16(2):139-148. doi: 10.1002/(SICI)1097-0061(20000130)16:2<139::AID-YEA512>3.0.CO;2-J Rabitsch, K. P., Tóth, A., Gálová, M., Schleiffer, A., Schaffner, G., Aigner, E., Rupp, C., Penkner, A. M., Moreno-Borchart, A. C., Primig, M., Esposito, R. E., Klein, F., Knop, M., Nasmyth, K. (2001). A screen for genes required for meiosis and spore formation based on whole-genome expression. Curr Biol. 11(13):1001-1009. doi: http://dx.doi.org/10.1016/S0960-9822(01)00274-3 Rankine, B.C., Bridson, D.A. (1971). Glycerol in Australian wines and factors influencing its formation. Am J Enol Vitic. 22(1):6–12. Rao, R., Drummond-Barbosa, D., Slayman, C. W. (1993). Transcriptional regulation by glucose of the yeast PMA1 gene encoding the plasma membrane H(+)-ATPase. Yeast. 9(10):1075-1084. doi: 10.1002/yea.320091006 Reinders, J., Wagner, K., Zahedi, R. P., Stojanovski, D., Eyrich, B., van der Laan, M., Rehling, P., Sickmann, A., Pfanner, N., Meisinger, C. (2007). Profiling phosphoproteins of yeast mitochondria reveals a role of phosphorylation in assembly of the ATP synthase. Mol Cell Proteomics. 6(11):1896-1906. doi: 10.1074/mcp.M700098-MCP200 Reinders, J., Zahedi, R. P., Pfanner, N., Meisinger, C., Sickmann, A. (2006). Toward the complete yeast mitochondrial proteome: multidimensional separation techniques for mitochondrial proteomics. J Prot Res. 5(7):1543-1554. doi: 10.1021/pr050477f Remm, M., Storm, C. E. V., Sonnhammer, E. L. L. (2001). Automatic clustering of orthologs and in-paralogs from pairwise species comparisons. J Mol Biol. 314(5):1041-1052. doi: 10.1006/jmbi.2000.5197 Ren, J., Wen, L., Gao, X., Jin, C., Xue, Y., Yao, X. (2008). CSS-Palm 2.0: an updated software for palmitoylation sites prediction. Protein Engineering, Design and Selection. 21(11):639-644. doi: 10.1093/protein/gzn039  173  Ribéreau-Gayon, P. Dubourdieu, D., Donéche, B., Lonvaud, A. (2006a). Biochemistry of alcoholic fermentation and metabolic pathways of wine yeasts. Handbook of Enology (Vol. 1). The microbiology of wine and vinifications (2nd ed.). (pp. 52-77). West Sussex, UK. Blackwell Publishing Ltd. Ribéreau-Gayon, P. Dubourdieu, D., Donéche, B., Lonvaud, A. (2006b). Ecology of grape and wine yeasts. Handbook of enology (Vol. 1) The microbiology of wine and vinifications (2nd ed.). (pp. 40-48). West Sussex, UK. Blackwell Publishing Ltd. Ribéreau-Gayon, P. Dubourdieu, D., Donéche, B., Lonvaud, A. (2006c). Formation and accumulation of acetic acid by yeasts. Handbook of enology (Vol. 1) The microbiology of wine and vinifications (2nd ed.). (pp. 64-67). West Sussex, UK. Blackwell Publishing Ltd.    Ribéreau-Gayon, P. Dubourdieu, D., Donéche, B., Lonvaud, A. (2006d). Regulation between alcoholic fermentation and glyceropyruvic fermentation; glycerol accumulation. Handbook of enology (Vol. 1) The microbiology of wine and vinifications (2nd ed.). (pp. 62-64). West Sussex, UK. Blackwell Publishing Ltd.    Ribéreau-Gayon, P. Dubourdieu, D., Donéche, B., Lonvaud, A. (2006e). The use of sulfur dioxide in must and wine treatment. Handbook of enology (Vol. 1) The microbiology of wine and vinifications (2nd ed.). (pp. 193-221). West Sussex, UK. Blackwell Publishing Ltd.    Richter, C. L., Dunn, B., Sherlock, G., Pugh, T. (2012). Comparative metabolic foot printing of a large number of commercial wine yeast strains in Chardonnay fermentations. FEMS Yeast Res. 13(4):394-410. doi: 10.1111/1567-1364.12046 Robinson, A. L., Boss, P. K., Solomon, P. S., Trengove, R. D., Heymann, H., Ebeler, S. E. (2014). Origins of grape and wine aroma. Part1. Chemical components and viticultural impacts. Am J Enol Vitic. 65(1):1-24. doi: 10.5344/ajev.2013.12070 Rodríguez-Vargas, S., Sánchez-García, A., Martínez-Rivas, J. M., Prieto, J. A., Randez-Gil, F. (2007). Fluidization of membrane lipids enhances the tolerance of Saccharomyces cerevisiae to freezing and salt stress. Appl Environ Microbiol. 73(1):110-116. doi: 10.1128/AEM.01360-06 Rollero, S., Bloem, A., Camarasa, C., Sanchez, I., Ortiz-Julien, A., Sablayrolles, J.-M., Dequin, S., Mouret, J.-R. (2015). Combined effects of nutrients and temperature on the production of fermentative aromas by Saccharomyces cerevisiae during wine fermentation. Appl Microbiol Biotechnol. 99(5):2291-2304. doi: 10.1007/s00253-014-6210-9 Romano, P., Soli, M. G., Suzzi, G., Zambonelli, C. (1985). Improvement of a wine Saccharomyces cerevisiae strain by a breeding program. Appl Environ Microbiol. 50(4):064-1067. Roncoroni, M., Huang, M., Gardner, R., Jiranek, V. (2013). Identifying genes of oenological relevance in winemaking yeast. Australian & New Zealand Grapegrower & Winemaker. 599:83-85. Retrieved on: October 25, 2015 Retrieved from:  http://issuu.com/provincialpressgroup/docs/gw_currentissue_14c4ec5a4ea98f Rossignol, T., Dulau, L., Julien, A., Blondin, B. (2003). Genome-wide monitoring of wine yeast gene expression during alcoholic fermentation. Yeast. 20(16):1369-1385. doi: 10.1002/yea.1046  174  Rossignol, T., Kobi, D., Jacquet-Gutfreund, L., Blondin, B. (2008). The proteome of a wine yeast strains during fermentation, correlation with the transcriptome. J Appl Microbiol. 107(1):4-55.  doi: 10.1111/j.1365-2672.2009.04156.x Ross-Macdonald, P., Coelho, P. S. R., Roemer, T., Agarwal, S., Kumar, A., Jansen, R., Cheung, K.-H., Sheehan, A., Symoniatis, D., Umansky, L. et al. (1999). Large-scale analysis of the yeast genome by transposon tagging and gene disruption. Nature. 402(6760):413-418. doi: 10.1038/46558 Rossouw, D., Bauer F. F. (2009). Comparing the transcriptomes of wine yeast strains: toward understanding the interaction between environment and transcriptome during fermentation. Appl Microbiol Biotechnol. 84(5):937-954. doi: 10.1007/s00253-009-2204-4 Rossouw, D., Jacobson, D., Bauer, F. F. (2012). Transcriptional regulation and the diversification of metabolism in wine yeast strains. Genetics. 190(1):251-261. doi: 10.1534/genetics.111.132720 Rossouw, D., Naes, T., Bauer, F. F. (2008). Linking gene regulation and the exo-metabolome: A comparative transcriptomics approach to identify genes that impact on the production of volatile aroma compounds in yeast. BMC Genomics. 9:530. doi: 10.1186/1471-2164-9-530 Rossouw, D., Olivares-Hernandes, R., Nielsen, J., Bauer, F. F. (2009). Comparative transcriptomic approach to investigate differences in wine yeast physiology and metabolism during fermentation. Appl Environ Microbiol. 75(20):6600-6612. doi: 10.1128/AEM.01251-09 Rossouw, D., van den Dool, A. H., Jacobson, D., Bauer, F. F. (2010). Comparative transcriptomic and proteomic profiling of industrial wine yeast strains. Appl Environ Microbiol. 76(12). 3911-3923. doi: 10.1128/AEM.00586-10 Rowe, L. A., Degtyareva, N., Doetsch, P. W. (2008). DNA damage-induced reactive oxygen species (ROS) stress response in Saccharomyces cerevisiae. Free Radic Biol Med. 45(8):1167-1177. doi: 10.1016/j.freeradbiomed.2008.07.018 Ryan, C. J., Roguev, A., Patrick, K., Xu, J., Jahari, H., Tong, Z., Beltrao, P., Shales, M., Qu, H., Collins, S. R. et al. (2012). Hierarchical modularity and the evolution of genetic interactomes across species. Mol Cell. 46(5):691-704.  doi: 10.1016/j.molcel.2012.05.028 Saberi, S. (2011). Effect of mixed Saccharomyces cerevisiae strains on Chardonnay wine composition. (Master thesis, The University of British Columbia, British Columbia, Canada). Retrieved on August 17, 2015 from http://hdl.handle.net/2429/36299 Salaun, C., Greaves, J., Chamberlain, L. H. (2010). The intracellular dynamic of protein palmitoylation. J Biol Chem. 191(7):1229-1238. doi: 10.1083/jcb.201008160 Salvadó, Z., Chiva, R., Rodriguez-Vargas, S., Rández-Gil, F., Mas, A., Guillamón, J. M. (2007). Proteomic evolution of a wine yeast during the first hours of fermentation. FEMS Yeast Res. 8(7):1137-1146. doi: 10.1111/j.1567-1364.2008.00389.x  175  Samanfar, B., Omidi, K., Hooshyar, M., Laliberte, B., Alamgir, M., Seal, A. J., Ahmed-Muhsin, E. Viteri, D. F., Said, K., Chalabian, F. (2013). Large-scale investigation of oxygen response mutants in Saccharomyces cerevisiae. 9(6):1351-1359. doi: 10.1039/c3mb25516f Schacherer, J., Shapiro, J. A., Ruderfer, D. M., Leonid, K. (2009). Comprehensive polymorphism survey elucidates population structure of Saccharomyces cerevisiae. Nature. 458:342-345. doi: 10.1038/nature07670 Schiestl, R. H., Gietz, R. D. (1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet. 16(5-6):339-346. doi: 10.1007/BF00340712 Schmidt, A., Beck, T., Koller, A., Kunz, J., Hall, M. N. (1998). The TOR nutrient signalling pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease. EMBO J. 17(23):6924-2931. doi: 10.1093/emboj/17.23.6924 Schmitt, A. P., McEntee, K. (1996). Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae. PNAS. 93(12):5777-5782.  Schothorst, J., Kankipati, H. N., Conrad, M., Samyn, D. R., van Zeebroeck, G., Popova, Y., Rubio-Texeira, M., Persson, B. L., Thevelein, J. M. (2013). Yeast nutrient transceptors provide novel insight in the functionality of membrane transporters. Curr Genet. 59(4):197-206. doi: 10.1007/s00294-013-0413-y Secco, D., Wang, C., Shou, H., Whelan, J. (2012). Phosphate homeostasis in yeast Saccharomyces cerevisiae, the key role of the SPX domain-containing proteins. FEBS Letters. 586(4):289-295. doi: 10.1016/j.febslet.2012.01.036 Serrano R., Bernal, D., Simón, E., Ariño, J. (2004). Copper and iron are the limiting factors for growth of the yeast Saccharomyces cerevisiae in an alkaline environment. J Biol Chem. 279(19):19698-19704. doi: 10.1074/jbc.M313746200 Serrano, R., Kielland-Brandt, M. C., Fink, G. R. (1986). Yeast plasma membrane ATPase is essential for growth and has homology with (Na+ + K+), K+- and Ca+-ATPases. Nature. 319(6055):689-693. doi: 10.1038/319689a0  Sertil, O., Kapoor, R., Cohen, B. D., Abramova, N., Lowry, C. V. (2003). Synergistic repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae. Nucl Acids Res. 31(20):5831-5837. doi: 10.1093/nar/gkg792 SGD: Saccharomyces Genome Database. (2014, Nov 22). Strains. SGD-Wiki. Retrieved on: September 19, 2015 Retrieved from: http://wiki.yeastgenome.org/index.php/Strains  SGD: Saccharomyces Genome Database. (2015a, May 27). Commonly used strains. SGD-Wiki. Retrieved on: September 19, 2015 Retrieved from: http://wiki.yeastgenome.org/index.php/Commonly_used_strains  SGD: Saccharomyces Genome Database. (2015b, September 19) Glossary. Retrieved on: September 19, 2015 Retrieved from:  http://www.yeastgenome.org/help/general-help/glossary  176  SGD: Saccharomyces Genome Database. (2015c, September 19). Genome inventory. Saccharomyces cerevisiae genome project. Retrieved on: September 19, 2015 Retrieved from: http://www.yeastgenome.org/genomesnapshot SGD: Saccharomyces Genome Database. (2015d, September 19). Summary of gene ontology (GO) annotations. Saccharomyces cerevisiae genome project. Retrieved on: September 19, 2015 Retrieved from: http://www.yeastgenome.org/genomesnapshot Shani, N., Watkins, P. A., Valle, D. (1995). PXA1, a possible Saccharomyces cerevisiae ortholog of the human adrenoleukodystrophy gene. PNAS. 92(13):6012-6016.  Shinohara, T., Mamiya, S., Yanagida, F. (1997). Introduction of flocculation property into wine yeasts (Saccharomyces cerevisiae) by hybridization. J Ferm Bioeng. 83(1):96-101. doi: 10.1016/S0922-338X(97)87334-5 Sicard, D., Legras, J.-L. (2011). Bread, beer and wine: yeast domestication in the Saccharomyces sensu stricto complex. C R Biol. 334(3): 229-236. doi: 10.1016/j.crvi.2010.12.016 Simões, T., Mira, N. P., Fernandes, A. R., Sá-Correia, I. (2006). The SPI1 gene, encoding a glycosylphosphatidylinositol-anchored cell wall protein, plays a prominent role in the development of yeast resistance to lipiphilic weak-acid food preservatives. Appl Environ Microbiol. 72(11):7168-7175. doi: 10.1128/AEM.01476-06 Sipiczki, M. (2010). Diversity, variability and fast adaptive evolution of the wine yeast (Saccharomyces cerevisiae) genome – a review. Ann Microbiol. 61(1):85-93. doi: 10.1007/s13213-010-0086-4 Snel, B., Lehmann, G., Huynen, M. A. (2000). STRING: a web-server to retrieve and display the repeatedly occurring neighbourhood of a gene. Nucl Acids Res. 28(18):3442-3444.  Soares, E. V. (2010). Flocculation in Saccharomyces cerevisiae: review. J Appl Microbiol. 110(1):1-18. doi: 10.1111/j.1365-2672.2010.04897.x Sopko, R., Huang, D., Preston, N., Chua, G., Papp, B., Kafadar, K., Snyder, M., Oliver, S. G., Cyert, M., Hughes, T. R., Boone, C. (2006). Mapping pathways and phenotypes by systematic gene overexpression. Molecular Cell. 21(3):319-330. doi: 10.1016/j.molcel.2005.12.011 Steels, E. L., Learmonth, R. P., Watson, K. (1994). Stress tolerance and membrane lipid unsaturation in Saccharomyces cerevisiae grown aerobically or anaerobically. Microbiology. 140(Pt 3): 569-576.  Stolz, J., Hoia, U., Meier, S., Sauer, N., Schweizer, E. (1999). Identification of the plasma membrane H+-biotin symporter of Saccharomyces cerevisiae by rescue of a fatty acid-auxotrophic mutant. J Biol Chem. 274(26):18741-18746. doi: 10.1074/jbc.274.26.18741 Storm, C. E. V., Sonnhammer, E. L. L. (2001). Automated ortholog inference from phylogenetic trees and calculation of orthology reliability. Bioinformatics. 18(1):92-99. doi: 10.1093/bioinformatics/18.1.92 Strope, P. K., Skelly, D. A., Kozmin, S. G., Mahadevan, G., Stone, E. A., Magwene, P. M., Dietrich, F. S., McCusker, J. H. (2015). The 100-genomes strains, an S. cerevisiae resource that illuminates its natural  177  phenotypic and genotypic variation and emergence as an opportunistic pathogen. Genome Res. doi: 10.1101/gr.185538.114 Styger, G., Jacobson, D., Bauer, F. F. (2011). Identifying genes that impact on aroma profiles produced by Saccharomyces cerevisiae and the production of higher alcohols. Appl Microbiol Biotechnol. 91(3):713-730. doi: 10.1007/s00253-011-3237-z Styger, G., Jacobson, D., Prior, B., Bauer, F. F. (2013). Genetic analysis of the metabolic pathways responsible for aroma metabolite production by Saccharomyces cerevisiae.  Appl Microbiol Biotechnol. 97(10):4429-4442. doi: 10.1007/s00253-012-4522-1 Sundstrom, J. F., Jiranek, V. (2013). Attendance & presentation at “Yeasts: products, discovery 2013” (YPD2013) conference, Massey University, Auckland, New Zealand, November 2013. The University of Adelaide. Retrieved on October 25, 2015. Retrieved from: http://research.wineaustralia.com/wp-content/uploads/2014/06/GWT-1302.pdf Szklarczyk, D., Franceschini, A., Wyder, S., Forslund, K., Heller, D., Huerta-Cepas, J., Simonovic, M., Roth, A., Santos, A., Tsafou, K. P. et al. (2015). STRING v10: protein–protein interaction networks, integrated over the tree of life. Nucl Acids Res. 43(Database issue):D447–D452. doi: 10.1093/nar/gku1003 Takagi, H., Shichiri, M., Takemura, M., Mohri, M., Nakamori, S. (2000). Saccharomyces cerevisiae sigma 1278b has novel genes of the N-acetyltransferase gene superfamily required for L-proline analogue resistance. J Bacteriol. 182(15):4249-4256. Takeo, K., Shigeta, M., Takagi, Y. (1976). Plasma membrane ultrastructural differences between the exponential and stationary phases of Saccharomyces cerevisiae as revealed by freeze-etching. Microbiology. 97(2):323-329. doi: 10.1099/00221287-97-2-323 Tamura, Y., Onguka, O., Itoh, K., Endo, T., Iijima, M., Claypool, S. M., Sesaki, H. (2012). Phosphatidylethanolamine biosynthesis in mitochondria: phosphatidylserine (PS) trafficking is independent of a PS decarboxylase and intermembrane space proteins Ups1p and Ups2p. J Biol Chem. 287(52):43961-43971. doi: 10.1074/jbc.M112.390997 Tanaka, K., Ishii, Y., Ogawa, J., Shima, J. (2012). Enhancement of acetic acid tolerance in Saccharomyces cerevisiae by overexpression of the HAA1 gene, encoding a transcriptional activator. Appl Environ Microbiol. 78(22):8161-8163. doi: 10.1128/AEM.02356-12 Tang, J, Abovich, N. Fleming, M. L., Seraphin, B., Rosbash, M. (1997). Identification and characterization of a yeast homolog of U1 snRNP-specific protein C. EMBO J. 16(13):4082-4091. doi: 10.1093/emboj/16.13.4082 Teixeira, M. C., Godinho, C. P., Cabrito, T. R., Mira, N. P., Sá-Correia, I. (2012). Increased expression of the yeast multidrug resistance ABC transporter Pdr18 leads to increased ethanol tolerance and ethanol production in high gravity alcohol fermentation. Microb Cell Fact. 11:98 doi: 10.1186/1475-2859-11-98 Ter Linde, J. J., Régnacq, M., Steensma, H. Y. (2003). Transcriptional regulation of YML083C under aerobic and anaerobic conditions. Yeast. 20(5):439-454. doi: 10.1002/yea.975  178  Terrell, E. E. (2010). Effect of mixed Saccharomyces strain fermentation on Pinot noir wine. (Master thesis, The University of British Columbia, British Columbia, Canada). Retrieved from http://hdl.handle.net/2429/21421 Tesnière, C., Brice, C., Blondin, B. (2015). Responses of Saccharomyces cerevisiae to nitrogen starvation in wine alcoholic fermentation. Appl Microbiol Biotechnol. 99(17):7025-7034. doi: 10.1007/s00253-015-6810-z The Gene Ontology Consortium. Gene ontology Consortium: going forward. (2015). Nucl Acids Res. 43(Database issue):D1049-D1056. Accessed on: August 2015. Tierney, J. J., Block, D. E., Longo, M. L. (2005). Elasticity and phase behavior of DPPC membrane modulated by cholesterol, ergosterol and ethanol. Bio Phys. 89(4):2481-2493. doi:  10.1529/biophysj.104.057943 Tong, A. H., Evangelista, M., Parsons, A.B., Xu, H., Barder, G. D., Pagé, N., Robinson, M., Raghibizadeh, S., Hogue, C. W., Bussey, H., Andrews, B. et al. (2001). Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294(5550):2364-2368. doi:: 10.1126/science.1065810 Torija, M. J., Beltran, G., Novo, M., Poblet, M., Guillammón, J. M., Mas, A., Rozés, N. (2002). Effects of fermentation temperature and Saccharomyces species on the cell fatty acid composition and presence of volatile compounds in wine. Int J Food Microbiol. 85(1-2):127-136. doi: 10.1016/S0168-1605(02)00506-8 Townsend, J. P., Cavalieri, D., Hartl, D. L. (2003). Population genetic variation in genome-wide gene expression. Mol Biol Evol. 20(6):955-963. doi: 10.1093/molbev/msg106 Treu, L., Toniolo, C., Sardu, A., Giacomini, A., Corich, V., Campanaro, S. (2014). The impact of genomic variability on gene expression in environmental Saccharomyces cerevisiae strains. Environ Microbiol. 16(5):1378-1397. doi: 10.1111/1462-2920.12327 Tronchoni, J., Gamero, A., Arroyo- López, F. N., Barrio, E., Querol, A. (2009). Differences in the glucose and fructose consumption profiles in diverse Saccharomyces wine species and their hybrids during grape juice fermentation. I J Food Microbiol. 134(3):237-243. doi: 10.1016/j.ijfoodmicro.2009.07.004 Trott, A., Morano, K. A. (2003). SYM1 is the stress-induced Saccharomyces cerevisiae ortholog of the mammalian kidney disease gene Mpv17 and is required for ethanol metabolism and tolerance during heat shock. Eukaryot Cell. 3(3):620-631. doi: 10.1128/EC.3.3.620-631.2004 Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P. et al. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature. 403(6770):623-627. doi: 10.1038/35001009 Usher, J., Balderas-Hernandez, V., Quon, P., Gold, N. D., Martin, V. J. J., Mahadevan, R., Baetz, K. (2011). Chemical and synthetic genetic array analysis identifies genes that suppress xylose utilization and fermentation in Saccharomyces cerevisiae. 1(4):247-258. doi: 10.1534/g3.111.000695  179  Váchová, L., Palková, Z. (2005). Physiological regulation of yeast cell death in multicellular colonies is triggered by ammonia. J Cell Biol. 169(5):711-717. doi: 10.1083/jcb.200410064 Varela, C., Cárdenas, J., Melo, F., Agosin, E. (2005). Quantitative analysis of wine yeast gene expression profiles under winemaking conditions. 22(5):369-383. doi: 10.1002/yea.1217 van der Rest, M. E., Kamminga, A. H., Nakano, A., Anraku, Y., Poolman, B., Konings, W. N. (1995). The plasma membrane of Saccharomyces cerevisiae: structure, function and biogenesis. Microbiol Rev. 59(2):304-322. Vandenbol, M., Jauniaux, J. C., Vissers, S., Grenson, M. (1987). Isolation of the NPR1 gene responsible for the reactivation of ammonia-sensitive amino-acid permeases in Saccharomyces cerevisiae. RNA analysis and gene dosage effects. Eur J Biochem. 164(3):607-612. doi: 10.1111/j.1432-1033.1987.tb11170.x Vanegas, J. M., Faller, R., Longo, M. L. (2010). Influence of ethanol on lipid/sterol membranes: phase diagram construction from AFM imaging. Langmuir. 26(13):10415-10418. doi: 10.1021/la1012268 Velculescu, V. E., Zhang, L., Vogelstein, B., Kinzler, K. W. (1995). Serial analysis of gene expression. Science. 270(5235):484-487. doi: 10.1126/science.270.5235.484 Ventre J (1934) Les levures en vinification: étude du ferment et du milieu - conditions d’emploi. Revue de Viticulture, Paris Versele, M., de Winde, J. H., Thevelein, J. M. (1999). A novel regulator of G protein signalling in yeast, Rgs2, downregulates glucose-activation of the cAMP pathway through direct inhibition of Gpa2. EMBO J. 18(20):5577-5591. doi: 10.1093/emboj/18.20.5577 Verstrepen, K. J., Klis, F. M. (2006). Flocculation, adhesion and biofilm formation in yeasts. Molecular Microbiology. 60(1):5-15. doi: 10.1111/j.1365-2958.2006.05072.x Vik, A., Rine, J. (2001). Upc2p and Ecm22p, dual regulators of sterol biosynthesis in Saccharomyces cerevisiae. Mol Cell Biol. 21(19):6395-6405. doi: 10.1128/MCB.21.19.6395-6405.2001 Vizeacoumar, F. J., Vreden, W. N., Fagarasanu, M., Eitzen, G. A., Aitchison, J. D., Rachubinski, R. A. (2006). The dynamin-like protein Vps1p of the yeast Saccharomyces cerevisiae associates with peroxisomes in a Pex19p-dependent manner. J Biol Chem. 281(18): 12817–12823. doi: 10.1074/jbc.M600365200 Vögtle, F.-N., Burkhart, J. M., Rao, S., Gerbeth, C., Hinrichs, J., Martinou, J.-C., Chacinska, A., Sickmann, A., Zahedi, R. P. and Meisinger, C. (2012). Intermembrane space proteome of yeast mitochondria. Mol Cell Proteomics. 11(12):1840-1852. doi: 10.1074/mcp.M112.021105 Walker, G. M. (1998). Yeast nutritional requirements. Yeast physiology and biotechnology. (pp. 52-61).  New York, NY: Wiley.   Walkey, C. J., Kitts, D. D., Liu, Y., van Vuuren, H. J. J. (2015). Bioengineering yeast to enhance folate levels in wine. Process Biochem. 50(2):205-210. doi: 10.1016/j.procbio.2014.12.017  180  Walkey, C. J., Luo, Z., Borchers, C. H., Measday, V., van Vuuren, H. J. J. (2011). The Saccharomyces cerevisiae fermentation stress response protein Igd1p/Yfr017p regulates glycogen levels by inhibiting the glycogen debranching enzyme. FEMS Yeast Res. 11(6):499-508. doi: 10.1111/j.1567-1364.2011.00740.x Walkey, C. J., Luo, Z., Madilao, L. L., van Vuuren, H. J. J. (2012). The fermentation stress response protein Aaf1p/Yml081Wp regulates acetate production in Saccharomyces cerevisiae. PLoS ONE. 7(12):e51551. doi: 10.1371/journal.pone.0051551 Walther, T. C., Farese, R. V. (2009). The life of lipid droplets. Biochim Biophys Acta. 1791(6):459-466. doi: 10.1016/j.bbalip.2008.10.009 Wang, C.-W. (2015). Lipid droplet dynamics in budding yeast. Cell Mol Life Sci. 72(14):2677-2695. doi: 10.1007/s00018-015-1903-5 Wang, Z., Gerstein, M., Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Gen. 10(1):57-63. doi: 10.1038/nrg2484 Watanabe, M., Chen, C. Y., Levin, D. E. (1994). Saccharomyces cerevisiae PKC1 encodes a protein kinase C (PKC) homolog with a substrate specificity similar to that of mammalian PKC. J Biol Chem. 269(24):16829-16836.  Westermann, S., Wang, H. W., Avila-Sakar, A., Drubin, D. G., Nogales, E., Barnes, G. (2006). The Dam1 kinetochore ring complex moves processively on depolymerizing microtubule ends. Nature. 440(7083):565-569. doi: 10.1038/nature04409 Westholm, J. O., Nordberg, N., Murén, E., Ameur, A., Komorowski, J., Ronne, H. (2008). Combinatorial control of gene expression by the three yeast repressors Mig1, Mig2, and Mig3. BMC Genomics. 9:601. doi: 10.1186/1471-2164-9-601 Wineanorak. (2015a). Ripeness. October 24, 2015 Retrieved from: http://www.wineanorak.com/ripeness.htm Wineanorak. (2015b). Overripeness: one of the wine world’s big issues. Retrieved on: October 24, 2015 Retrieved from: http://www.wineanorak.com/overripeness.htm Winzeler, E. A., Castillo-Davis, C. I., Oshiro, G., Liang, D., Richards, D. R., Zhou, Y., Hartl, D. L. (2003). Genetic diversity in yeast assessed with whole-genome oligonucleotide arrays. Genetics. 163(1):79-89.  Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H. et al. (1999). Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science. 285(5429):901-906. doi: 10.1126/science.285.5429.901 Wolfe, K. (2004). Evolutionary genomics: yeasts accelerate beyond BLAST. Curr Biol. 14(10):R392-R394. doi: 10.1016/j.cub.2004.05.015 Wolinski, H., Kolb, D., Hermann, S., Koning, R. I., Kohlwein, S. D. (2011). A role for seipin in lipid droplet dynamics and inheritance in yeast. J Cell Sci. 124(Pt 22):3894-3904. doi: 10.1242/jcs.091454  181  Wood, V., Rutherford, K. M., Ivens, A., Rajandream, M.-A., Barrell, B. (2001). A re-annotation of the Saccharomyces cerevisiae genome. Comp Funct Genomics. 2(3):143-154. doi: 10.1002/cfg.86 Wood, V., Harris, M. A., McDowall, M. D., Rutherford, K., Vaughan, B. W., Staines, D. M., Aslett, M., Lock, A., Bähler, J., Kersey, P. J., Oliver, S. G. (2011). PomBase: a comprehensive online resource for fission yeast. Nucl Acids Res. 40(Database issue):D695-9. doi: 10.1093/nar/gkr853 Xie, Y., Zheng, Y., Mu, W., Hou, M., Cao, S., Zhao, Q., Liu, W., Ren, J. (2014). GPS-Lipid: an integrated web server for the prediction of lipid modification sites. (Submitted). Accessed on Feb 5, 2016. Accessed at: http://lipid.biocuckoo.org/citedby.php Yalcin, S. K., Ozbas, Y. (2008). Effects of pH and temperature on growth and glycerol production kinetics of two indigenous wine strains of Saccharomyces cerevisiae from Turkey. Braz J Microbiol. 39(2):325-332. doi: 10.1590/S1517-838220080002000024 Yamaguchi-Iwai, Y., Serpe, M., Haile, D., Yang, W., Kosman, D. J., Klausner, R. D., Dancis, A. (1997). Homeostatic regulation of copper uptake in yeast via direct binding of MAC1 protein to upstream regulatory sequences of FRE1 and CTR1. J Biol Chem. 272(28):17711-17718. doi: 10.1074/jbc.272.28.17711 Yamamoto, A., Guacci, V., Koshland, D. (1996). Pds1p is required for faithful execution of anaphase in the yeast, Saccharomyces cerevisiae. J Biol Chem. 133(1):85-97. doi: 10.1083/jcb.133.1.85 Yan, Z., Constanzo, M., Heisler, L. E., Paw, J., Kaper, F., Andrews, B. J., Boone, C., Giaever, G., Nislow, C. (2008). Yeast barcoders: a chemogenomic application of a universal donor-strain collection carrying bar-code identifiers. Nat Methods. 5(8):719-725. doi: 10.1038/nmeth.1231 Yang, J., Bae, J. Y., Lee, Y. M., Kwon, H., Moon, H. Y., Kang, H. A., Yee, S. B., Kim, W., Choi, W. (2011). Construction of Saccharomyces cerevisiae strains with enhanced ethanol tolerance by mutagenesis of the TATA-binding protein gene and identification of novel genes associated with ethanol tolerance. Biotechnol Bioeng. 108(8):1776-1787. doi: 10.1002/bit.23141 Yenush, L., Merchan, S., Holmes, J., Serrano, R. (2005). pH-Responsive, posttranslational regulation of the Trk1 potassium transporter by the type 1-related Ppz1 phosphatase. Mol Cell Biol. 25(19):8683-8693. doi: 10.1128/MCB.25.19.8683-8692.2005 Yoshikawa, K., Tanaka, T., Ida, Y., Furusawa, C., Hirasawa, T., Shimizu, H. (2011). Comprehensive phenotypic analysis of single-gene deletion and overexpression stsrains of Saccharomyces cerevisiae. Yeast. 28(5):349-361. doi: 10.1002/yea.1843 Yun, C. W., Bauler, M., Moore, R. E., Klebba, P. E., Philpott, C. C. (2001). The role of the FRE family of plasma membrane reductases in the uptake of siderophore-iron in Saccharomyces cerevisiae. J Biol Chem. 276(13):10218-102123. doi: 10.1074/jbc.M010065200 Zehmer, J. K., Huang, Y., Peng, G., Pu, J., Anderson, R. G. W., Liu, P. (2009). A role for lipid droplets in intermembrane lipid traffic. Proteomics. 9(4):914-921. doi: 10.1002/pmic.200800584  182  Zhang, X., Bremer, H. (1995). Control of the Escherichia coli rrnB P1 promoter strength by ppGpp. J Biol Chem. 270(19):11181-11189. doi: 10.1074/jbc.270.19.11181 Zhao, H., Eide, D. (1996). The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. PNAS. 93(6):2454-2458.  Zhao, H., Eide, D. J. (1997). Zap1p, a metalloregulatory protein involved in zinc-responsive transcriptional regulation in Saccharomyces cerevisiae. Mol Cell Biol. 17(9):5044-5052.  Zhao, S., Douglas, N. W., Heine, M. J., Williams, G. M., Winther-Larsen, H. C., Meaden, P. G. (1994). The STL1 gene of Saccharomyces cerevisiae is predicted to encode a sugar transporter-like protein. Genet. 146(2):215-219.  Zhao, X. Q., Bai, F. W. (2009). Yeast flocculation: new story in fuel ethanol production. Biotechnol Adv. 27(6): 849-856. doi: 10.1016/j.biotechadv.2009.06.006 Zheng, X. F., Florentino, D., Chen, J., Crabtree, G. R., Schreiber, S. L. (1995). TOR kinase domains are required for two distinct functions, only one of which is inhibited by rapamycin. Cell. 82(1):121-130. doi: http://dx.doi.org/10.1016/0092-8674(95)90058-6 Zimmer, A., Durand, C., Loira, N., Durrens, P., Sherman, D. J., Marullo, P. (2014). QLT dissection of lag phase in wine fermentation reveals a new translocation responsible for Saccharomyces cerevisiae adaptation to sulfite. PLoS ONE. 9(1):e86298. doi: 10.1371/journal.pone.0086298 Zoecklein, B. (2006). Enology Notes #115. Grape Chemistry. Accessed on December 19, 2015. Accessed at http://www.apps.fst.vt.edu/extension/enology/EN/115.html#3 Zou, H., McGarry, J., Bernal, T., Kirschner, M. W. (1999). Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science. 285(5426):418-422. doi: 10.1126/science.285.5426.418   183  Appendices A. Genotypes of yeast strains used in this study  Table A.1 Genotype of wild type Enoferm M2 Strain Genotype Source Enoferm M2 MATa /MATα R. Gardner   Table A.2 Genotype of null and overexpression mutants constructed for ORFs in Cluster 7 (Marks et al. 2008). The primers used for the construction of mutants are listed in Table B1. # Target ORF Strain Genotype 1 COM2 com2∆ M2, com2Δ::kanMX4/com2Δ::kanMX4 OE-COM2 M2, kanMX4-PGK1pr-COM2/kanMX4-PGK1pr-COM2 2 MPO1 mpo1∆ M2, mpo1Δ::kanMX4/mpo1Δ::kanMX4 OE-MPO1 M2, kanMX4-PGK1pr-MPO1/kanMX4-PGK1pr-MPO1 3 MTC7 mtc7∆ M2, mtc7Δ::kanMX4/mtc7Δ::kanMX4 OE-MTC7 M2, kanMX4-PGK1pr-MTC7/kanMX4-PGK1pr-MTC7 4 PAR32 par32∆ M2, par32Δ::kanMX4/par32Δ::kanMX4 OE-PAR32 M2, kanMX4-PGK1pr-PAR32/kanMX4-PGK1pr-PAR32 5 RGI1 rgi1∆ M2, rgi1Δ::kanMX4/rgi1Δ::kanMX4 OE-RGI1 M2, kanMX4-PGK1pr-RGI1/kanMX4-PGK1pr-RGI1 6 RTK1 rtk1∆ M2, rtk1Δ::kanMX4/rtk1Δ::kanMX4 OE-RTK1 M2, kanMX4-PGK1pr-RTK1/kanMX4-PGK1pr-RTK1 7 SNA2 sna2∆ M2, sna2Δ::kanMX4/sna2Δ::kanMX4 OE-SNA2 M2, kanMX4-PGK1pr-SNA2/ kanMX4-PGK1pr-SNA2 8 YAL037W yal037w∆ M2, yal037wΔ::kanMX4/yal037wΔ::kanMX4 OE-YAL037W M2, kanMX4-PGK1pr-YAL037W/kanMX4-PGK1pr-YAL037W 9 YBR063C ybr063c∆ M2, ybr063cΔ::kanMX4/ybr063cΔ::kanMX4 OE-YBR063C M2, kanMX4-PGK1pr-YBR063C/kanMX4-PGK1pr-YBR063C 10 YBR219C ybr219c∆ M2, ybr219cΔ::kanMX4/ybr219cΔ::kanMX4 OE-YBR219C M2, kanMX4-PGK1pr-YBR219C/kanMX4-PGK1pr-YBR219C 11 YDL042W ydl042w∆ M2, ydl042wΔ::kanMX4/ydl042wΔ::kanMX4 OE-YDL042W M2, kanMX4-PGK1pr-YDL042W/kanMX4-PGK1pr-YDL042W 12 YDL199C ydl199c∆ M2, ydl199cΔ::kanMX4/ydl199cΔ::kanMX4 OE-YDL199C M2, kanMX4-PGK1pr-YDL199C/kanMX4-PGK1pr-YDL199C 13 YDL206W ydl206w∆ M2, ydl206wΔ::kanMX4/ydl206wΔ::kanMX4 OE-YDL206W M2, kanMX4-PGK1pr-YDL206W/kanMX4-PGK1pr-YDL206W 14 YDR249C ydr249c∆ M2, ydr249cΔ::kanMX4/ydr249cΔ::kanMX4 OE-YDR249C M2, kanMX4-PGK1pr-YDR249C/kanMX4-PGK1pr-YDR249C 15 YDR476C ydr476c∆ M2, ydr476cΔ::kanMX4/ydr476cΔ::kanMX4 OE-YDR476C M2, kanMX4-PGK1pr-YDR476C/kanMX4-PGK1pr-YDR476C 16 YFL034W yfl034w∆ M2, yfl034wΔ::kanMX4/yfl034wΔ::kanMX4 OE-YFL034W M2, kanMX4-PGK1pr-YFL034W/kanMX4-PGK1pr-YFL034W 17 YGL101W ygl101w∆ M2, ygl101wΔ::kanMX4/ygl101wΔ::kanMX4 OE-YGL101w M2, kanMX4-PGK1pr-YGL101W/kanMX4-PGK1pr-YGL101W  184  Table A.2 (Continued) # Target ORF Strain Genotype 18 YGR035C ygr035c∆ M2, ygr035cΔ::kanMX4/ygr035cΔ::kanMX4 OE-YGR035C M2, kanMX4-PGK1pr-YGR035C/kanMX4-PGK1pr-YGR035C 19 YGR079W ygr079w∆ M2, ygr079wΔ::kanMX4/ygr079wΔ::kanMX4 OE-YGR079W M2, kanMX4-PGK1pr-YGR079W/kanMX4-PGK1pr-YGR079W 20 YHL008C yhl008c∆ M2, yhl008cΔ::kanMX4/yhl008cΔ::kanMX4 OE-YHL008C M2, kanMX4-PGK1pr-YHL008C/kanMX4-PGK1pr-YHL008C  Table A.3 Genotype of null mutants constructed for ORFs in Cluster 13 (Marks et al. 2008). These mutants were constructed by Dr. Christopher Walkey. # Target ORF Strain Genotype 1 GEP5 gep5∆ M2, gep5Δ::kanMX4/gep5Δ::kanMX4 2 LDS1 lds1∆ M2, lds1Δ::kanMX4/lds1Δ::kanMX4 3 MRX10 mrx10∆ M2, mrx10Δ::kanMX4/mrx10Δ::kanMX4 4 PDR18 pdr18∆ M2, pdr18Δ::kanMX4/pdr18Δ::kanMX4 5 PHO92 pho92∆ M2, pho92Δ::kanMX4/pho92Δ::kanMX4 6 RQC2 rqc2∆ M2, rqc2Δ::kanMX4/rqc2Δ::kanMX4 7 RRT7 rrt7∆ M2, rrt7Δ::kanMX4/rrt7Δ::kanMX4 8 TDA8 tda8∆ M2, tda8Δ::kanMX4/tda8Δ::kanMX4 9 YAL042C-A yal042c-a∆ M2, yal042c-aΔ::kanMX4/yal042c-aΔ::kanMX4 10 YAR028W yar028w∆ M2, yar028wΔ::kanMX4/yar028wΔ::kanMX4 11 YAR029W yar029w∆ M2, yar029wΔ::kanMX4/yar029wΔ::kanMX4 12 YAR030C yar030c∆ M2, yar030cΔ::kanMX4/yar030cΔ::kanMX4 13 YBL010C ybl010c∆ M2, ybl010cΔ::kanMX4/ybl010cΔ::kanMX4 14 YBL036C ybl036c∆ M2, ybl036cΔ::kanMX4/ybl036cΔ::kanMX4 15 YBL044W ybl044w∆ M2, ybl044wΔ::kanMX4/ybl044wΔ::kanMX4 16 YBL071C-B ybl071c-b∆ M2, ybl071c-bΔ::kanMX4/ybl071c-bΔ::kanMX4 17 YBL081W ybl081w∆ M2, ybl081wΔ::kanMX4/ybl081wΔ::kanMX4 18 YBL086C ybl086c∆ M2, ybl086cΔ::kanMX4/ybl086cΔ::kanMX4 19 YBL112C ybl112c∆ M2, ybl112cΔ::kanMX4/ybl112cΔ::kanMX4 20 YBR056W ybr056w∆ M2, ybr056wΔ::kanMX4/ybr056wΔ::kanMX4 21 YBR090C ybr090c∆ M2, ybr090cΔ::kanMX4/ybr090cΔ::kanMX4 22 YBR126W-A ybr126w-a∆ M2, ybr126w-aΔ::kanMX4/ybr126w-aΔ::kanMX4 23 YBR139W ybr139w∆ M2, ybr139wΔ::kanMX4/ybr139wΔ::kanMX4 24 YBR184W ybr184w∆ M2, ybr184wΔ::kanMX4/ybr184wΔ::kanMX4 25 YBR259W ybr259w∆ M2, ybr259wΔ::kanMX4/ybr259wΔ::kanMX4 26 YBR285W ybr285w∆ M2, ybr285wΔ::kanMX4/ybr285wΔ::kanMX4 27 YCL001W-A ycl001w-a∆ M2, ycl001w-aΔ::kanMX4/ycl001w-aΔ::kanMX4 28 YCL042W ycl042w∆ M2, ycl042wΔ::kanMX4/ycl042wΔ::kanMX4 29 YCR023C ycr023c∆ M2, ycr023cΔ::kanMX4/ycr023cΔ::kanMX4 30 YCR051W ycr051w∆ M2, ycr051wΔ::kanMX4/ycr051wΔ::kanMX4 31 YCR099C ycr099c∆ M2, ycr099cΔ::kanMX4/ycr099cΔ::kanMX4 32 YCR100C ycr100c∆ M2, ycr100cΔ::kanMX4/ycr100cΔ::kanMX4 33 YCR101C ycr101c∆ M2, ycr101cΔ::kanMX4/ycr101cΔ::kanMX4    185   Table A.3 (Continued) # Target ORF Strain Genotype 34 YDL073W ydl073w∆ M2, ydl073wΔ::kanMX4/ydl073wΔ::kanMX4 35 YDL114W ydl114w∆ M2, ydl114wΔ::kanMX4/ydl114wΔ::kanMX4 36 YDL129W ydl129w∆ M2, ydl129wΔ::kanMX4/ydl129wΔ::kanMX4 37 YDL176W ydl176w∆ M2, ydl176wΔ::kanMX4/ydl176wΔ::kanMX4 38 YDL180W ydl180w∆ M2, ydl180wΔ::kanMX4/ydl180wΔ::kanMX4 39 YDL186W ydl186w∆ M2, ydl186wΔ::kanMX4/ydl186wΔ::kanMX4 40 YDL211C ydl211c∆ M2, ydl211cΔ::kanMX4/ydl211cΔ::kanMX4 41 YDR034W-B ydr034w-b∆ M2, ydr034w-bΔ::kanMX4/ydr034w-bΔ::kanMX4 42 YDR061W ydr061w∆ M2, ydr061wΔ::kanMX4/ydr061wΔ::kanMX4 43 YDR089W ydr089w∆ M2, ydr089wΔ::kanMX4/ydr089wΔ::kanMX4 44 YDR114C ydr114c∆ M2, ydr114cΔ::kanMX4/ydr114cΔ::kanMX4 45 YDR124W ydr124w∆ M2, ydr124wΔ::kanMX4/ydr124wΔ::kanMX4 46 YDR131C ydr131c∆ M2, ydr131cΔ::kanMX4/ydr131cΔ::kanMX4 47 YDR220C ydr220c∆ M2, ydr220cΔ::kanMX4/ydr220cΔ::kanMX4 48 YDR274C ydr274c∆ M2, ydr274cΔ::kanMX4/ydr274cΔ::kanMX4 49 YDR290W ydr290w∆ M2, ydr290wΔ::kanMX4/ydr290wΔ::kanMX4 50 YDR444W ydr444w∆ M2, ydr444wΔ::kanMX4/ydr444wΔ::kanMX4 51 YDR491C ydr491c∆ M2, ydr491cΔ::kanMX4/ydr491cΔ::kanMX4 52 YDR524W-C ydr524w-c∆ M2, ydr524w-cΔ::kanMX4/ydr524w-cΔ::kanMX4 53 YDR537C ydr537c∆ M2, ydr537cΔ::kanMX4/ydr537cΔ::kanMX4 54 YEL023C yel023c∆ M2, yel023cΔ::kanMX4/yel023cΔ::kanMX4 55 YEL043W yel043w∆ M2, yel043cΔ::kanMX4/yel043cΔ::kanMX4 56 YEL067C yel067c∆ M2, yel067cΔ::kanMX4/yel067cΔ::kanMX4 57 YER085C yer085c∆ M2, yer085cΔ::kanMX4/yer085cΔ::kanMX4 58 YER097W yer097w∆ M2, yer097wΔ::kanMX4/yer097wΔ::kanMX4 59 YER135C yer135c∆ M2, yer135cΔ::kanMX4/yer135cΔ::kanMX4 60 YER187W yer187w∆ M2, yer187wΔ::kanMX4/yer187wΔ::kanMX4 61 YER188W yer188w∆ M2, yer188wΔ::kanMX4/yer188wΔ::kanMX4 62 YFL015C yfl015c∆ M2, yfl015cΔ::kanMX4/yfl015cΔ::kanMX4 63 YFL019C yfl019c∆ M2, yfl019cΔ::kanMX4/yfl019cΔ::kanMX4 64 YFL032W yfl032w∆ M2, yfl032wΔ::kanMX4/yfl032wΔ::kanMX4 65 YFL054C yfl054c∆ M2, yfl054cΔ::kanMX4/yfl054cΔ::kanMX4 66 YFL067W yfl067w∆ M2, yfl067wΔ::kanMX4/yfl067wΔ::kanMX4 67 YFL068W yfl068w∆ M2, yfl068wΔ::kanMX4/yfl068wΔ::kanMX4 68 YFR012W-A yfr012w-a∆ M2, yfl012w-aΔ::kanMX4/yfl012w-aΔ::kanMX4 69 YFR035C yfr035c∆ M2, yfr035cΔ::kanMX4/yfr035cΔ::kanMX4 70 YFR054C yfr054c∆ M2, yfr054cΔ::kanMX4/yfr054cΔ::kanMX4 71 YFR056W yfr056w∆ M2, yfr056wΔ::kanMX4/yfr056wΔ::kanMX4 72 YFR057W yfr057w∆ M2, yfR057wΔ::kanMX4/yfR057wΔ::kanMX4 73 YGL024W ygl024w∆ M2, ygl024wΔ::kanMX4/ygl024wΔ::kanMX4 74 YGL034C ygl034c∆ M2, yfr034cΔ::kanMX4/yfr034cΔ::kanMX4 75 YGL052W ygl052w∆ M2, ygl052wΔ::kanMX4/ygl052wΔ::kanMX4 76 YGL117W ygl117w∆ M2, ygl117wΔ::kanMX4/ygl117wΔ::kanMX4 77 YGL138C ygl138c∆ M2, ygl138cΔ::kanMX4/ygl138cΔ::kanMX4   186    Table A.3 (Continued) # Target ORF Strain Genotype 78 YGL193C ygl193c∆ M2, ygl193cΔ::kanMX4/ygl193cΔ::kanMX4 79 YGL199C ygl199c∆ M2, ygl199cΔ::kanMX4/ygl199cΔ::kanMX4 80 YGL204C ygl204c∆ M2, ygl204cΔ::kanMX4/ygl204cΔ::kanMX4 81 YJL055W yjl055w∆ M2, yjl055wΔ::kanMX4/yjl055wΔ::kanMX4 82 YKL053W ykl053w∆ M2, ykl053wΔ::kanMX4/ykl053wΔ::kanMX4 83 YKL063C ykl063c∆ M2, ykl063cΔ::kanMX4/ykl063cΔ::kanMX4 84 YKL066W ykl066w∆ M2, ykl066wΔ::kanMX4/ykl066wΔ::kanMX4 85 YKL102C ykl102c∆ M2, ykl102cΔ::kanMX4/ykl102cΔ::kanMX4 86 YKL136W ykl136w∆ M2, ykl136wΔ::kanMX4/ykl136wΔ::kanMX4 87 YKL162C-A ykl162c-a∆ M2, ykl053wΔ::kanMX4/ykl053wΔ::kanMX4 88 YKR012C ykr012c∆ M2, ykr012cΔ::kanMX4/ykr012cΔ::kanMX4 89 YKR032W ykr032w∆ M2, ykr032wΔ::kanMX4/ykr032wΔ::kanMX4 90 YKR033W ykr033w∆ M2, ykr033wΔ::kanMX4/ykr033wΔ::kanMX4 91 YKR040C ykr040c∆ M2, ykr040cΔ::kanMX4/ykr040cΔ::kanMX4 92 YKR047W ykr047w∆ M2, ykr047wΔ