UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Roles of Mediator subunit CDK-8 in developmental and physiological responses in Caenorhabditis elegans Grants, Jennifer M. 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_september_grants_jennifer.pdf [ 41.74MB ]
Metadata
JSON: 24-1.0300224.json
JSON-LD: 24-1.0300224-ld.json
RDF/XML (Pretty): 24-1.0300224-rdf.xml
RDF/JSON: 24-1.0300224-rdf.json
Turtle: 24-1.0300224-turtle.txt
N-Triples: 24-1.0300224-rdf-ntriples.txt
Original Record: 24-1.0300224-source.json
Full Text
24-1.0300224-fulltext.txt
Citation
24-1.0300224.ris

Full Text

ROLES OF MEDIATOR SUBUNIT CDK-8 IN DEVELOPMENTAL AND PHYSIOLOGICAL RESPONSES IN CAENORHABDITIS ELEGANS by  Jennifer M. Grants  B.Sc. hon., The University of Victoria, 2010  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2016  © Jennifer M. Grants, 2016 ii  Abstract  The Mediator complex is a conserved coregulator of RNA polymerase II transcription. Whereas some Mediator subunits are universally essential for transcription, others regulate specialized gene programs by interacting with sequence-specific transcription factors (TFs). Mediator’s Cyclin dependent kinase 8 (CDK8) kinase module (CKM) consists of four subunits (CDK8, Cyclin C, MED12, MED13) and regulates transcription downstream of multiple cell signaling pathways. In addition, the CKM regulates other Mediator subunits, as CDK8-mediated phosphorylation promotes Mediator subunit turnover, at least in yeast. CKM subunits have been identified as human oncogenes or tumor suppressors, indicating that the CKM can modulate transcription in tumorigenesis. However, the roles of the CKM in animal development and physiology are less well understood, as its target TFs often remain undefined. Furthermore, whether the CKM regulates the activity of other Mediator subunits in metazoans remains unknown. In this dissertation, I investigated CKM interactions with TFs and other Mediator subunits in Caenorhabditis elegans development and physiology. Gene expression profiling of C. elegans cdk-8 mutants implicated CDK-8 in regulation of epidermal growth factor receptor (EGFR)-Ras-extracellular signal-regulated kinase (ERK)-driven transcription and cadmium-responsive transcription. I showed that the CKM inhibits ectopic vulval cell fates downstream of the EGFR-Ras-ERK pathway, dependent on CDK-8 kinase activity. Mechanistically, the CKM inhibits EGFR-Ras-ERK pathway output by promoting transcriptional repression by the LIN-1/Elk1 TF, and by inhibiting transcriptional activation by the Mediator subunit MDT-15. Furthermore, cdk-8 is required for post-transcriptional regulation of MDT-15. Therefore, the CKM restrains EGFR-Ras-ERK signaling in C. elegans development by regulating TF and iii  Mediator activity. I also studied cdk-8 in the cadmium response. I showed that cdk-8 is required for cadmium-inducible transcription and organismal cadmium resistance. Dissecting a modular cadmium-responsive promoter, cdr-1, I showed that cdk-8 may cooperate with other factors known to regulate cadmium-responsive transcription: mdt-15, GATA-family TF elt-2 and GATA elements, and a high zinc-activated (HZA) element. I speculate that CDK-8 promotes cadmium-inducible transcription by activating MDT-15, ELT-2, or an HZA-binding TF. In sum, cdk-8 cooperates with distinct TFs, and can oppose or cooperate with the Mediator subunit mdt-15, to regulate EGFR-Ras-ERK-inducible vs. cadmium-inducible transcription.  iv  Preface Chapter 1 Portions of Chapter 1 have been published in the journal Nucleic Acids Research as a Survey and Summary review article: Grants J. M., Goh G. Y. S., Taubert S., “The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator” (Grants et al. 2015). As co-first author, I contributed substantially to designing the outline of the review, generating the figures, and writing the review. Chapter 2 Chapter 2 was published in the journal Genetics: Grants J. M., Ying L. T. L., Yoda A., You C. C., Okano H., Sawa H., Taubert S., “The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans” (Grants et al. 2016). As first author, I designed and conducted and/or supervised all experiments, except EASE analysis, conducted by J. Ewbank (Centre d'Immunologie de Marseille-Luminy) and mdt-12/dpy-22 experiments, conducted by A.Y., H.O, and H.S., and analyzed and interpreted the data. I was responsible for designing figures and writing the paper. Chapter 3 Chapter 3 is a manuscript in preparation for submission to a peer reviewed journal: Grants J.M., Shomer N., Muhuri A., Goh, G.Y.S., and Taubert S., “The Mediator subunit cdk-8 promotes cadmium-inducible transcription”. As first author, I designed and conducted and/or supervised all experiments, except for oPOSSUM promoter analysis, which was conducted by Dr. Anthony Mathelier (Centre for Molecular Medicine and Therapeutics). I also analyzed and interpreted the data for all experiments, generated the figures, and will have written the paper. v  Table of Contents  Abstract .......................................................................................................................................... ii!Preface ........................................................................................................................................... iv!Table of Contents ...........................................................................................................................v!List of Tables .................................................................................................................................. x!List of Figures ............................................................................................................................... xi!List of Abbreviations ................................................................................................................. xiii!Acknowledgements ...................................................................................................................... xv!Dedication ................................................................................................................................... xvi!Chapter 1: Introduction ................................................................................................................1!1.1! Transcriptional regulation by the Mediator complex ......................................................... 1!1.1.1! The Mediator complex in initiation of basal and regulated transcription ................... 1!1.1.2! Structural and functional modules of the Mediator complex ...................................... 2!1.1.3! Distinct molecular roles of Mediator subunits ............................................................ 3!1.1.3.1! Mediator subunit interaction with Pol II .............................................................. 4!1.1.3.2! Mediator subunit interactions with GTFs, elongation and termination factors ... 5!1.1.3.3! Mediator subunit interactions with chromatin modifiers ..................................... 8!1.1.3.4! Intra-Mediator regulation by CDK8 .................................................................. 10!1.1.3.5! Mediator subunit interactions with sequence-specific TFs ................................ 11!1.1.4! Mediator subunit mutations in human disease .......................................................... 15!1.1.4.1! Developmental anomalies .................................................................................. 15!1.1.4.2! Cancers or tumors .............................................................................................. 17!vi  1.2! Evolutionary conservation of Mediator ........................................................................... 19!1.2.1! Mediator complexes of yeast and metazoans ............................................................ 19!1.2.2! Mediator complex of C. elegans ............................................................................... 20!1.3! Mediator subunit roles in pathways of animal development ........................................... 21!1.3.1! Epidermal growth factor receptor signaling ............................................................. 22!1.3.2! Wnt signaling ............................................................................................................ 26!1.3.3! Cell cycle progression ............................................................................................... 29!1.3.4! Other developmental phenotypes of Mediator mutants ............................................ 30!1.3.5! Regulatory hub activity of MED12 ........................................................................... 31!1.3.6! Parallels between Mediator roles in development and in cancer .............................. 32!1.3.6.1! Mediator subunit roles in EGFR signaling-driven tumorigenesis ..................... 32!1.3.6.2! Mediator repression of Notch signaling-driven tumorigenesis .......................... 33!1.3.6.3! Mediator subunit roles in Wnt signaling-driven tumorigenesis ......................... 33!1.3.6.4! Mediator interaction with Retinoblastoma tumor suppressor protein ................ 34!1.4! Roles of the Mediator complex in physiological responses of adult animals .................. 34!1.4.1! Lipid metabolism ...................................................................................................... 35!1.4.2! Stress responses ........................................................................................................ 37!1.4.3! Innate immune responses .......................................................................................... 39!1.4.4! Conservation of Mediator subunit roles in physiological responses ........................ 40!1.5! Concluding remarks, hypothesis and objectives .............................................................. 42!Chapter 2: The Mediator kinase module restrains epidermal growth factor receptor signaling and represses vulval cell fate specification in Caenorhabditis elegans ....................50!2.1! Synopsis ........................................................................................................................... 50!vii  2.2! Background ...................................................................................................................... 51!2.2.1! Transcriptional regulation by the CDK8 Kinase Module ......................................... 51!2.2.2! Transcriptional regulation in C. elegans vulva development ................................... 51!2.3! Results .............................................................................................................................. 56!2.3.1! cdk-8-dependent transcripts overlap with targets of a synMuv gene ........................ 56!2.3.2! cdk-8 represses EGFR signaling-dependent primary vulval cell fate specification . 57!2.3.3! cdk-8 interacts genetically with the synMuv repressors of lin-3/EGF transcription 63!2.3.4! cdk-8 regulates lin-3/EGF transcription in the anchor cell ....................................... 65!2.3.5! cdk-8 acts downstream of mpk-1/ERK to regulate vulval induction cell autonomously ........................................................................................................................ 67!2.3.6! cdk-8 kinase activity is required to repress vulval induction .................................... 70!2.3.7! cdk-8 promotes lin-1/Ets repressor activity .............................................................. 71!2.3.8! The CKM subunit mdt-13/let-19 represses primary vulval fate specification .......... 73!2.3.9! The CKM restricts the specificity of core Mediator subunits ................................... 76!2.4! Discussion ........................................................................................................................ 80!2.4.1! The CKM inhibits vulva development in a kinase dependent manner ..................... 82!2.4.2! The CKM inhibits the primary vulval cell fate ......................................................... 84!2.4.3! The CKM promotes LIN-1/Ets repressor activity .................................................... 86!2.4.4! The CKM restrains the core Mediator tail module triad ........................................... 89!2.5! Materials and methods ..................................................................................................... 91!2.5.1! Microarrays and data analysis ................................................................................... 91!2.5.2! C. elegans strains, culture, and genetic methods ...................................................... 92!2.5.3! VPC induction ........................................................................................................... 95!viii  2.5.4! Multivulva and vulvaless phenotype penetrance ...................................................... 95!2.5.5! RNA isolation and quantitative real-time PCR ......................................................... 96!2.5.6! Fluorescent reporter analysis .................................................................................... 97!2.5.7! Generation of transgenic strains ................................................................................ 97!2.5.8! Feeding RNAi knockdown ....................................................................................... 98!2.5.9! Western blot .............................................................................................................. 99!Chapter 3: The cdk-8 Mediator subunit promotes cadmium-responsive transcription ......100!3.1! Synopsis ......................................................................................................................... 100!3.2! Background .................................................................................................................... 101!3.3! Results ............................................................................................................................ 106!3.3.1! cdk-8 is required for induction of cadmium-responsive genes ............................... 106!3.3.2! cdk-8 is required for cadmium resistance in vivo .................................................... 110!3.3.3! mdt-15 is required for basal expression and induction of the cdr-1 promoter ........ 111!3.3.4! elt-2, GATA, and HZA are required for induction of the cdr-1 promoter .............. 112!3.3.5! daf-16/FoxO is required to repress the cdr-1 promoter .......................................... 117!3.3.6! Stress specificity of cdr-1 promoter induction ........................................................ 118!3.4! Discussion ...................................................................................................................... 119!3.4.1! cdk-8 promotes cadmium-responsive gene expression ........................................... 122!3.4.2! mdt-15 promotes expression of the cdr-1 promoter ................................................ 125!3.4.3! cdr-1 promoter regulatory elements ........................................................................ 127!3.4.4! SKN-1-independent MDT-15 action at the cdr-1 promoter ................................... 130!3.4.5! ELT-2 and GATA elements in cdr-1 promoter induction ...................................... 131!3.4.6! The HZA element in cdr-1 promoter induction ...................................................... 133!ix  3.4.7! DAF-16 and DBE in cdr-1 promoter repression ..................................................... 136!3.5! Materials and methods ................................................................................................... 138!3.5.1! Microarrays and data analysis ................................................................................. 138!3.5.2! Regulatory element analysis ................................................................................... 139!3.5.3! C. elegans strains, culture, and genetic methods .................................................... 140!3.5.4! RNA isolation and quantitative real-time PCR ....................................................... 140!3.5.5! Cadmium sensitivity assay ...................................................................................... 141!3.5.6! cdr-1 reporter fluorescence analysis ....................................................................... 142!3.5.7! Feeding RNAi knockdown ..................................................................................... 143!Chapter 4: Discussion and conclusions ....................................................................................144!4.1! The CKM as regulatory hub in metazoan development ................................................ 144!4.2! CDK8 as a regulator of responses to environmental stimuli ......................................... 147!4.3! The CDK8-tail module relationship in metazoans ......................................................... 150!4.4! Conclusion ..................................................................................................................... 153!Bibliography ...............................................................................................................................155! x  List of Tables  Table 1.1 C. elegans Mediator subunits and their mammalian and yeast orthologs. ................... 44!Table 2.1 VPC induction scores and Muv/Vul penetrance in L4 animals (20°C) ........................ 59!Table 2.2 Muv penetrance in adult animals. ................................................................................. 60!Table 2.3 C. elegans strains used in Chapter 2 ............................................................................. 93!Table 2.4 qPCR primers used in Chapter 2 ................................................................................... 96!Table 2.5 Cloning primers used in Chapter 2. .............................................................................. 98!Table 3.1 cdr-1 promoter regulatory element mutants. .............................................................. 114!Table 3.2 C. elegans strains used in Chapter 3 ........................................................................... 140!Table 3.3 qPCR primer list for Chapter 3 ................................................................................... 141!Table 3.4 Cloning primer list for Chapter 3 ................................................................................ 142! xi  List of Figures  Figure 1.1 Yeast and human Mediator complex architecture. ...................................................... 46!Figure 1.2 Mediator interactions with Pol II, chromatin modifiers, GTFs, elongation factors, and sequence-specific TFs. .................................................................................................................. 47!Figure 1.3 Overview of the biological activities of Mediator subunits in C. elegans. ................. 48!Figure 1.4 MDT-12 is a regulatory hub with links to human disease. .......................................... 49!Figure 2.1 Transcriptional regulators in C. elegans vulval induction. .......................................... 55!Figure 2.2 cdk-8-dependent transcripts overlap with targets of a transcriptional corepressor in the EGFR-Ras-ERK pathway. ............................................................................................................ 57!Figure 2.3 cdk-8 represses vulval cell fates redundantly with synMuv genes. ............................. 63!Figure 2.4 cdk-8 represses lin-3/EGF transcription via an anchor cell-specific enhancer element........................................................................................................................................................ 66!Figure 2.5 cdk-8 acts cell autonomously downstream of mpk-1/ERK. ......................................... 69!Figure 2.6 cdk-8 kinase activity is required to repress vulval induction. ..................................... 70!Figure 2.7 CDK-8 is a LIN-1/Ets corepressor. ............................................................................. 72!Figure 2.8 mdt-13/let-19 represses vulval cell fates downstream of mpk-1/ERK. ........................ 75!Figure 2.9 The CKM inhibits activation of vulval induction by the mdt-15, mdt-27, mdt-29 triad........................................................................................................................................................ 79!Figure 2.10 Kinase module action in C. elegans vulval cell fate specification. ........................... 82!Figure 3.1 Regulatory elements in promoters of cdr-1, mtl-1 and mtl-2 cadmium-responsive genes. .......................................................................................................................................... 105!Figure 3.2 cdk-8 is required for cadmium-inducible gene expression. ....................................... 110!xii  Figure 3.3 cdk-8 is required for cadmium resistance in C. elegans. ........................................... 111!Figure 3.4 mdt-15 is required for cadmium-inducible transcription of the cdr-1 promoter. ...... 112!Figure 3.5 elt-2 and an HZA-binding TF are required for cadmium-inducible expression of the cdr-1 promoter. ........................................................................................................................... 117!Figure 3.6 Proposed model of Mediator subunit, TF, and regulatory element roles in basal and cadmium-inducible transcription of the cdr-1 promoter. ............................................................ 121!   xiii  List of Abbreviations  CDK  Cyclin dependent kinase cic-1  Cyclin C gene (C. elegans) CCNC  Cyclin C gene (human) cdr-1  Cadmium-responsive gene 1 CF1  Cleavage factor 1 CKM  CDK8 kinase module Cryo-EM Cryo-electron microscopy CTD  C-terminal domain ER  Endoplasmic reticulum  ERK  Extracellular signal-regulated kinase FA  Fatty acid GCN5L Gcn5-like GTF  General transcription factor H2B  Histone 2B H3S10P Histone 3 serine 10 phosphorylation H3K9me2 Hitone 3 lysine 9 dimethylation H3K14Ac Histone 3 lysine 14 acetylation H3K27 Histone 3 lysine 27 HIF1!  Hypoxia-inducible factor 1 ! HNF4! Hepatocyte nuclear factor 4 ! Hox  Homeobox ID  Intellectual disability IEG  Immediate early gene ER  Endoplasmic reticulum ERK  Extracellular signal-regulated kinase MAPK  Mitogen activated protein kinase mH2A  Macro-Histone 2A mtl  Metallothionein MUFA  Monounsaturated fatty acid Muv  Multivulva NHR  Nuclear hormone receptor NICD  Notch intracellular domain NuRD  Nucleosome remodeling and deacetylase complex PKA  Protein kinase A PPAR" Peroxisome proliferator-activated receptor " Pol II  RNA polymerase II P-TEFb Positive transcription elongation factor b PUFA  Polyunsaturated fatty acid REST  RE1 silencing transcription factor SEC  Super elongation complex SEM  Standard error of the mean xiv  SREBP1! Sterol regulatory element binding protein 1! TAF  TBP-associated factor T-ALL  T cell acute lymphoblastic leukemia t-BOOH Tert-butyl hydrogen peroxide TBP  TATA-binding protein TF  Transcription factor T/G-Mediator TRRAP/GCN5L-Mediator TGF-#  Transforming growth factor # TR  Thyroid hormone receptor TRRAP Transformation/transcription domain-associated protein UPR  Unfolded protein response VPC  Vulva precursor cell Vul  Vulvaless xv  Acknowledgements  First and foremost, I would like to thank my research supervisor, Dr. Stefan Taubert. Thank you, Stefan, for all your support and guidance throughout this process, for helping me to grow as a researcher, and for giving me the freedom to follow the scientific paths that interested me the most. I would also like to thank my supervisory committee members, Dr. Matthew Lorincz, Dr. Don Moerman, and Dr. Ann Rose, for their helpful guidance and encouragement all along the way, in matters concerning my research project and my career. I would also like to thank Dr. Fred Picard for his always cheerful support and encouragement. I also extend my sincere gratitude for the financial support I received from NSERC, CFRI, UBC, and the Vanier Canada Graduate Scholarship. To the dear members of the Taubert lab: Thank you for making our lab such a wonderful, supportive, creative, and fun environment to work in. Thank you for taking the time to have countless conversations with me about my research project, in those times when talking to a cutout of ‘Sydney’ didn’t cut it. A special thanks to those who worked tirelessly and cheerfully with me on my projects: Lisa Ying, Anik Muhuri, Naomi Shomer, Shirley Chen, Charlotte You, James Chen, and Amy Poon. Most of all, a big thanks to the Taubert lab members past and present who have become some of my dearest friends.  Last but not least, I would like to thank my family for believing in me, and for doing everything they can to encourage and support me. Thank you, Mom and Dad, for your unconditional love and support, and for making me the person I am today. Thank you, Chelsey, for being like a sister to me, and for caring about me so much. Thank you, Shawn, for being such an incredibly supportive, and adventurous partner throughout this journey. I love you all with all my heart. xvi  Dedication     For Mom and Dad.   1  Chapter 1: Introduction  1.1 Transcriptional regulation by the Mediator complex 1.1.1 The Mediator complex in initiation of basal and regulated transcription  RNA polymerase II (Pol II) transcribes all eukaryotic protein coding genes, as well as most non-coding RNAs. However, the Pol II enzyme requires a host of regulatory factors to initiate transcription. Initiation of basal transcription, i.e. transcription that occurs in the absence of a gene-specific transcription factor (TF), requires general TFs (GTFs), TFIIA, B, D, E, F, H, which bind to and unwind the promoter DNA and activate Pol II (Luse 2014), and the Mediator complex, a conserved eukaryotic multi-subunit transcriptional coregulator that stabilizes and/or activates several GTFs and Pol II (Malik and Roeder 2010; Poss et al. 2013; Allen and Taatjes 2015). Initiation of regulated transcription, i.e. gene-specific transcription, additionally requires sequence-specific TFs, which enhance Pol II recruitment to the promoter (Malik and Roeder 2010; Poss et al. 2013; Allen and Taatjes 2015). However, TFs cannot interact directly with Pol II, and instead engage transcriptional coactivators, such as Mediator, to influence Pol II function (Kornberg 2005).   Mediator was first identified in Saccharomyces cerevisiae (budding yeast) as a protein complex required for purified Pol II and GTFs to respond to a sequence-specific TF (Kelleher et al. 1990; Flanagan et al. 1991; Kim et al. 1994). Human Mediator was first identified as a protein complex associated with the thyroid hormone-bound thyroid hormone receptor (TR), a potent TF (Fondell et al. 1996). Like in yeast, human Mediator was required for TF-mediated activation of purified Pol II and GTFs (Fondell et al. 1996). Since its discovery, Mediator has been identified as the target of numerous TFs across eukaryotes (Borggrefe and Yue 2011; Poss 2  et al. 2013). Overall, Mediator is a critical player in transcription initiation, as it stabilizes and activates the basal transcription machinery, and provides a means of communication between TFs and Pol II in regulated transcription. The molecular interactions between Mediator and the transcription machinery and TFs will be described in greater detail in Section 1.1.3.  1.1.2 Structural and functional modules of the Mediator complex  The Mediator complex consists of 25-30 protein subunits, dependent on species (Bourbon 2008). Mediator subunits are organized into four modules (head, middle, tail and kinase modules) based on their structural connections and their functional roles within the complex. Structurally, the head module occupies a central position within the Mediator complex, and the tail and middle modules form extensive interfaces with opposite sides of the head module (Tsai et al. 2014) (Figure 1.1; see Table 1.1 for subunits assigned to each module). The fourth module, the cyclin dependent kinase 8 (CDK8) kinase module (CKM), associates reversibly with the rest of the Mediator complex (hereafter referred to as the ‘core’ Mediator), primarily via interaction with the middle module (Tsai et al. 2013).  Mediator’s four modules perform different molecular functions in transcriptional regulation. Cryo-electron microscopy (cryo-EM) analysis and genetic studies suggest that the head and middle modules form the primary interface with Pol II, whereas the tail module binds TFs (Soutourina et al. 2011; Tsai et al. 2014). Mediator interaction with Pol II or TFs induce extensive conformational changes in the complex (Davis et al. 2002; Poss et al. 2013; Tsai et al. 2014), and some TFs can induce Mediator conformations that mimic the Pol II-Mediator complex (Näär et al. 2002; Tsai et al. 2014), suggesting a means by which TF binding to Mediator might affect its ability to recruit and activate Pol II. The CKM primarily contacts 3  Mediator’s middle module (Tsai et al. 2013), and once bound, it can alter the activity of TFs or of the core Mediator itself by phosphorylation or by steric hindrance. Specifically, the CKM subunit CDK8 phosphorylates various TFs, leading to their activation or promoting their degradation (Borggrefe and Yue 2011; Poss et al. 2013) (see Section 1.1.3.5), and phosphorylates other Mediator subunits to influence their interactions with TFs or with the core Mediator (van de Peppel et al. 2005; Gonzalez et al. 2014) (see Section 1.1.3.4). In addition, CKM binding to the core Mediator blocks the Pol II-Mediator interaction either by binding directly to Mediator’s Pol II binding site, as observed in yeast Mediator (Tsai et al. 2013), or by allosterically inducing a conformational change in the Pol II binding site, as observed in human Mediator (Näär et al. 2002; Knuesel et al. 2009b) (see Section 1.2.1). In sum, Mediator’s head, middle, tail and CKM modules perform distinct functions within the complex.  1.1.3 Distinct molecular roles of Mediator subunits  Individual Mediator subunits can bind to and/or modify Pol II, GTFs, chromatin modifiers, Mediator itself, or distinct TFs. In the case of Mediator subunit interactions with sequence-specific TFs, these interactions can modulate highly specialized transcriptional programs. The molecular roles ascribed to individual Mediator subunits are described below (summarized in Figure 1.2). The Mediator complex on the whole, or large multi-subunit interfaces therein, can also interact with factors in several of the classes listed below; however, details of these interactions are beyond the scope of this literature review (refer to (Malik and Roeder 2010; Poss et al. 2013; Allen and Taatjes 2015) and references therein for more information).  4  1.1.3.1 Mediator subunit interaction with Pol II  Mediator binds to Pol II, and structural analysis by cryo-EM suggests an extensive interface with Pol II at Mediator’s head/middle module boundary (Davis et al. 2002; Tsai et al. 2014). However, disruption of Pol II contact with a single head module subunit can globally disrupt Pol II recruitment to promoters in yeast. The Med17 head module subunit binds directly to the Pol II subunit Rpb3 in vivo, and an rpb3 mutation that decreases Rpb3-Med17 binding causes a 1.5-fold reduction in Pol II recruitment throughout the genome, as well as loss of Pol II recruitment to inducible genes (Soutourina et al. 2011). Thus, Med17 appears to play an important role in Pol II recruitment in basal and regulated transcription, by directly binding to Pol II’s Rpb3 subunit. This is likely not, however, the only Mediator-Pol II contact that drives Pol II recruitment. Both yeast and human Mediator bind to the Pol II C-terminal domain (CTD) of the Rpb1/POLR2A subunit (Myers et al. 1998; Näär et al. 2002), although the Mediator subunit(s) responsible for CTD binding remain undefined. The CTD appears to be a key target of Mediator in regulated transcription, as Mediator fails to promote TF-stimulated transcription in vitro if the Pol II CTD is deleted (Myers et al. 1998). Therefore, Mediator subunits in addition to Med17 likely play critical roles in Pol II binding.  The CTD is a regulatory domain in the Rpb1/POLR2A Pol II subunit that consists of multiple copies of a heptapeptide repeat (Tyr1-Ser2-Pro3-Thr4-Ser5-Pro6-Ser7; 26 copies in S. cerevisiae, 52 copies in human) that is subject to post-translational modifications that influence Pol II function. Of particular importance, Ser5 phosphorylation primarily occurs during Pol II transcription initiation, while Ser2 phosphorylation primarily occurs during Pol II elongation (Srivastava and Ahn 2015). The Mediator CKM subunit CDK8 has been identified as a Pol II CTD kinase in yeast and human cells. Yeast Cdk8 phosphorylates Ser5 of the CTD in vitro, 5  which appears to repress transcription by disrupting Pol II interaction with DNA (Hengartner et al. 1998). However, in yeast harbouring a CTD truncation mutation, Cdk8 activates transcription via CTD Ser5 phosphorylation. Specifically, CTD truncation derepresses transcription of a subset of retrotransposons in the yeast genome, which is associated with increased CTD Ser5 phosphorylation. Loss of cdk8 in the CTD truncation mutant normalizes retrotransposon transcript levels and CTD Ser5 phosphorylation, indicating that Cdk8 activates transcription by promoting Ser5 phosphorylation, although whether Cdk8 phosphorylates Ser5 directly in this context remains undetermined (Aristizabal et al. 2015). Human CDK8 phosphorylates Ser2 and Ser5 of the CTD in vitro, which appears to promote thyroid hormone- and TR-activated transcription (Belakavadi and Fondell 2010). Thus, CDK8 is a conserved Pol II CTD kinase, but its effect on transcription activation vs. repression may be context dependent.  1.1.3.2 Mediator subunit interactions with GTFs, elongation and termination factors  Specific Mediator subunits regulate the activity or recruitment of GTFs and elongation factors, particularly those that influence the phosphorylation of the Pol II CTD. Two Mediator subunits directly modulate the activity or recruitment of a CTD Ser5 kinase, CDK7/Cyclin H, which is part of the multi-subunit GTF TFIIH. Human CDK8 negatively regulates TFIIH kinase activity. In an in vitro transcription assay, TFIIH potentiates transcription initiation by phosphorylating the Pol II CTD, but this effect is strongly inhibited by CDK8-mediated phosphorylation of Cyclin H. This effect appears to be relevant in vivo, as Cyclin H is phosphorylated in human cells in a CDK8-dependent manner. However, yeast Ccl1/Cyclin H does not appear to be phosphorylated by Cdk8, indicating that the regulatory relationship between CDK8 and TFIIH may be specific to higher organisms (Akoulitchev et al. 2000).  6   The Mediator head module subunit Med11 promotes promoter recruitment of TFIIH in yeast. Med11 binds to TFIIH by interacting directly with the TFIIH helicase subunit Rad3, driving TFIIH recruitment to promoters (Esnault et al. 2008). Mechanistically, TFIIH recruitment is critical for Pol II CTD Ser5 phosphorylation, via the Kin28/CDK7 CTD kinase subunit (Esnault et al. 2008). Conservation of a MED11-CDK7 interaction in metazoan systems, e.g. human cells, has not been explored. If this mechanism is indeed conserved, it would imply opposing action of two Mediator subunits, CDK8 and MED11, in the control of CDK7-mediated CTD Ser5 phosphorylation to regulate Pol II transcription initiation.  The Mediator middle module subunit MED26 promotes the switch from transcription initiation to elongation by interacting with the GTF TFIID during initiation, and recruiting the super elongation complex (SEC) to promote elongation. The SEC is a complex of multiple elongation factors, including the Pol II CTD Ser2 kinase CDK9/Cyclin T (Luo et al. 2012). TFIID and components of SEC appear to compete for a common binding site in the human MED26 N-terminus (Takahashi et al. 2011), suggesting that MED26 may act as a molecular switch to recruit Pol II initiation factors vs. elongation factors. The precise mechanistic implications of MED26-TFIID binding in transcription initiation remain unclear, as TFIID can bind to Mediator independently of MED26; however, MED26 siRNA depletion causes decreased Pol II CTD Ser5 phosphorylation (Takahashi et al. 2011), suggesting that MED26 may stabilize other components of the initiation complex, such as CDK7. MED26-SEC binding is critical for SEC recruitment to promoters and gene bodies, as well as for the Pol II transition to elongation. Specifically, Pol II occupancy in gene bodies and CTD Ser2 phosphorylation is disrupted in MED26 depleted cells (Takahashi et al. 2011). Notably, MED26 knockdown only affects the expression levels of a subset of genes (~10% of genes in the human embryonic kidney cell line 7  used by Takahashi et al.); however, the reason for this specificity remains unexplored. Overall, MED26 regulates the activity of initiation factors and elongation factors during transcription of a subset of human genes.  The Mediator CKM subunit CDK8 also promotes transcription elongation of serum- or hypoxia-inducible genes by recruiting CDK9-containing complexes in human cells. In the absence of serum stimulation or hypoxic conditions, many inducible genes are bound by Pol II that is paused in the early elongation stage. Recruitment of elongation factors, including CDK9, is critical for release of Pol II pausing upon serum stimulation or hypoxia (Donner et al. 2010; Galbraith et al. 2013). During serum stimulation, CDK8 is required to recruit the CDK9-containing positive transcription elongation factor b complex (P-TEFb), to promote Pol II CTD phosphorylation and enhance the transcription elongation rate. Mechanistically, P-TEFb binds to the free CKM or CKM-containing Mediator, but not to Mediator lacking the CKM, suggesting that P-TEFb may bind directly to the CKM (Donner et al. 2010). During hypoxia, CKM-containing Mediator is recruited to hypoxia-inducible genes by hypoxia inducible factor 1! (HIF1!), a key TF of the hypoxia response. At these hypoxia-inducible genes, CDK8 is required to recruit two CDK9-containing complexes, P-TEFb and the larger SEC (Galbraith et al. 2013). Overall, these studies demonstrate that CDK8 promotes transcription elongation in inducible gene expression responses that involve Pol II pausing.   Finally, the Mediator head module subunit Med18 is required for transcription termination at a subset of genes in yeast. Med18 is required for expression of ~16% of the yeast genome (Holstege et al. 1998). At these loci, Med18 localizes to the 5’ and 3’ gene ends, and is required for DNA looping (Mukundan and Ansari 2011, 2013), suggesting that Med18 facilitates contact between promoter-bound Mediator and the terminator region. Med18 recruits the 8  Cleavage Factor 1 (CF1) termination complex, in a DNA looping-dependent manner, thereby promoting Pol II transcription termination (Mukundan and Ansari 2011, 2013). Intriguingly, in murine embryonic stem cells, Mediator interacts with the cohesin complex, which is responsible for DNA looping (Kagey et al. 2010). Thus, Med18 may be a conserved regulator of DNA looping during transcription termination.   1.1.3.3 Mediator subunit interactions with chromatin modifiers  Several Mediator subunits interact with chromatin modifying enzymes to modulate transcription. The human CKM-Mediator, but not the core Mediator alone, recruits a histone acetyl transferase, Gcn5-like (GCN5L), and an associated scaffold protein, Transformation/transcription domain-associated protein (TRRAP), to form a larger complex referred to as ‘T/G-Mediator’ (Meyer et al. 2008). Histone acetyltransferases modify conserved lysine residues in histone tails, which promotes chromatin decondensation and recruitment of chromatin-binding proteins leading to transcriptional activation (Kouzarides 2007). GCN5L is often found as part of the TFTC or STAGA complexes (Wieczorek et al. 1998; Martinez et al. 1998);  however, no other TFTC or STAGA complex members are part of T/G-Mediator (Meyer et al. 2008), suggesting that T/G-Mediator is a distinct complex. In vitro, T/G-Mediator phosphorylates histone 3 serine 10 (H3S10P), and acetylates histone 3 lysine 14 (H3K14Ac) in a H3S10P-dependent manner (Meyer et al. 2008). As CDK8 is required for phosphorylation of H3S10, these findings suggests that CDK8 stimulates GCN5L acetylatransferase activity via the H3S10 phosphorylation (Meyer et al. 2008; Knuesel et al. 2009a). Indeed, CDK8 knockdown in cell culture causes a global decrease in the amount of histone 3 carrying S10P/K14Ac modifications (Meyer et al. 2008). As H3K14 acetylation marks transcriptionally active genes 9  (Kouzarides 2007), this suggests a mechanism in which CDK8 and GCN5L cooperate to activate transcription; however, the effect of CDK8 knockdown on H3S10P/K14Ac levels at genes directly bound and activated by CDK8 remains to be examined.  The human CKM subunit MED12 recruits a chromatin modifying enzyme to repress gene expression. Specifically, MED12 binds to and recruits the G9a histone methyltransferase at regulatory elements targeted by the RE1 silencing transcription factor (REST), a TF that represses neuronal gene expression in non-neuronal cells (Ding et al. 2008). G9a dimethylates histone 3 lysine 9 (H3K9me2), which serves to repress REST target genes. MED12 knockdown or disease-associated loss-of-function mutations (see Section 1.1.4.1 for information on MED12 disease mutations) disrupt G9a recruitment and H3K9me2-mediated repression of REST target genes (Ding et al. 2008). Taken together with the study on T/G-Mediator, these findings demonstrate that CKM subunits can activate or repress gene expression by activation or recruitment of a histone acetyltransferase or a histone methyltransferase, respectively.  Two Mediator tail module subunits, MED23 and MED25, interact with histone modifying enzymes to activate gene expression. Profiling of histone modification abundance in MED23 null murine embryonic fibroblasts compared to wild type revealed that MED23 is specifically required for histone 2B (H2B) ubiquitination at lysine 120 (Yao et al. 2015). MED23, as part of the Mediator complex, appears to recruit the H2B-ubiquitinating RNF20/40 and PAF complexes to chromatin, thereby promoting H2B ubiquitination (Yao et al. 2015). H2B ubiquitination is associated with enhanced Pol II chromatin binding and enhanced transcription (Yao et al. 2015), suggesting that MED23 can promote transcriptional activation via an epigenetic mechanism. At a promoter activated by the hepatocyte nuclear factor 4! (HNF4!), Mediator recruitment via the human MED25 subunit is critical for establishment or maintenance 10  of an open chromatin state (Englert et al. 2015). Specifically, MED25 is required for recruitment of the CREBBP histone acetyltransferase, which acetylates histone H3 lysine 27 (H3K27), and for exclusion of the Polycomb repressive complex, which methylates H3K27 (Englert et al. 2015). Overall, these studies show that certain Mediator tail module subunits can influence recruitment of chromatin modifiers to promote transcriptional activation.  1.1.3.4 Intra-Mediator regulation by CDK8    In the yeast Mediator complex, the CKM negatively regulates several core Mediator subunits that activate transcription. The Med2, Med3, and Med15 tail module subunits activate highly similar target gene sets (van de Peppel et al. 2005), and appear to form a stable triad (Zhang et al. 2004). The CKM opposes transcriptional activation by the tail module triad, as the gene expression profiles of CKM mutants show a high degree of anti-correlation with the med2/3/15 mutant profiles (van de Peppel et al. 2005). Mechanistically, Cdk8 phosphorylates Med3, which promotes ubiquitin-proteasome mediated degradation of Med2, Med3 and Med15, thereby inhibiting transcriptional activation by the tail module triad (Gonzalez et al. 2014). Furthermore, Cdk8-mediated phosphorylation of Med2 can inhibit a specialized gene expression program that responds to iron deficiency (van de Peppel et al. 2005); however, the precise molecular mechanism of this regulation remains undetermined. In addition, the CKM also opposes transcriptional activation by the head module subunit Med18 (van de Peppel et al. 2005), by mechanisms that remain to be identified. Overall, the CKM negatively regulates the activity of Mediator subunits in the tail and head modules in yeast; however, whether such intra-Mediator regulatory interactions occur in metazoans and affect e.g. animal development has not yet been tested. 11   1.1.3.5 Mediator subunit interactions with sequence-specific TFs  Mediator subunits regulate specific gene expression programs primarily by binding to sequence-specific TFs, thus linking the TF to the rest of the Mediator complex. Numerous molecular interactions between Mediator subunits and TFs have been identified, and the themes that emerge in these interactions are highlighted below. Note that many studies have identified molecular interactions between Mediator subunits and sequence-specific TFs in yeast (Poss et al. 2013); however, for the purposes of this literature review, I will only discuss those that relate to the themes highlighted below.  The human MED1 middle module subunit binds to numerous nuclear hormone receptor (NHR) TFs, including TR, HNF4!, vitamin D receptor, peroxisome proliferator-activated receptor " (PPAR"), estrogen receptor, androgen receptor, glucocorticoid receptor, and others (Malik and Roeder 2010; Poss et al. 2013). These interactions are mediated by NHR ligand binding domains and MED1’s LXXLL motifs (L: leucine, X: any amino acid), a motif conserved among several NHR coactivators (Malik et al. 2004). In keeping with a central and specific role for MED1 in NHR-mediated transcription, MED1 knockout murine fibroblasts show specific disruption of NHR-mediated transcription (Ito et al. 2000), and are deficient in adipocyte differentiation controlled by PPAR" (Ge et al. 2002).   In addition to MED1, the Mediator subunits MED14, MED25, and CDK8 also contain LXXLL motifs (Xie et al. 2015). Human MED14 and MED25 and bind to some of the same NHRs as does MED1 (Hittelman et al. 1999; Malik et al. 2002; Lee et al. 2007; Grøntved et al. 2010; Han et al. 2012). Interaction of Drosophila CDK8 with an NHR was recently described (Xie et al. 2015). Direct interaction between CDK8 and NHRs in other organisms has not yet 12  been explored, although the CKM-containing Mediator complex is required for Pol II and CDK9 recruitment during TR-activated transcription (Belakavadi and Fondell 2010). The LXXLL motifs of human MED25 are required for interaction with NHRs (Lee et al. 2007; Han et al. 2012); however, the requirement for the MED14 or CDK8 LXXLL motifs remains unexplored. Interestingly, in C. elegans, the MED1 homologs MDT-1.1 and MDT-1.2 do not appear to interact with NHRs, and instead the MED15 homolog MDT-15 interacts with multiple NHRs (Taubert et al. 2006; Arda et al. 2010). Yeast Med15 also interacts with NHR-like TFs (Thakur et al. 2009), suggesting that NHR-binding may be an ancient role of MED15 that has been replaced by MED1, MED14 and MED25 in higher organisms. In summary, human MED1 appears to act as the primary target of NHR TFs, a function which may in some cases be partially redundant with MED14, MED25, while C. elegans and yeast MED15 mediates NHR interactions.   The MED15 tail module subunit also binds to several TFs involved in lipid metabolism and stress responses. In human cells, MED15 binds to the sterol regulatory element binding protein 1! (SREBP1!), a cholesterol sensor and regulator of lipid metabolism genes (Yang et al. 2006). This interaction is evolutionarily conserved, as C. elegans MDT-15, binds to the SREBP homolog, SBP-1 (Yang et al. 2006). In addition, MDT-15 also binds to NHR-49, an NHR that regulates lipid metabolism gene expression (Taubert et al. 2006). In yeast, Med15 binds to an NHR-like like TF that senses cellular fatty acids, Oaf1 (Thakur et al. 2009; Näär and Thakur 2009). In addition to these interactions with TFs that regulate lipid metabolism genes, MED15 also binds to stress responsive TFs. During genotoxic stress, human MED15 binds to p73, a p53-family tumor suppressor protein, and is required for induction of p73 target genes involved in cell cycle arrest and apoptosis (Satija and Das 2015). C. elegans MDT-15 binds to SKN-1, a key 13  TF in an oxidative stress response, and is required for induction of some oxidative stress response genes (Goh et al. 2014). Finally, yeast Med15 binds to a TF that responds to multiple environmental stresses, Msn2 (Lallet et al. 2006), and an NHR-like TF that senses drugs, Pdr1 (Thakur et al. 2008). Therefore, MED15 is a coactivator of diverse TFs that respond to nutrition or stress signals. One report has shown that Xenopus laevis MED15 coactivates Smad-family TFs in the transforming growth factor # (TGF-#) signaling pathway (Kato et al. 2002), indicating that MED15 may also play important roles in development. See Section 1.4 for further discussion of MDT-15 functions in C. elegans.  The MED23 tail module subunit is an important coactivator of transcription downstream of the extracellular signal-regulated kinase (ERK) mitogen activated protein kinase (MAPK) signaling cascade. Murine MED23 binds to Elk1, a TF that is phosphorylated by ERK (Stevens et al. 2002). ERK phosphorylation of Elk1 occurs in response to growth factor or insulin signaling, and triggers Elk1-mediated transcription of immediate early response genes (IEGs), in a MED23-dependent manner (Wang et al. 2005, 2009). Many IEGs are TFs that activate gene expression cascades. For example, the IEG Egr2 encodes a TF controlling an adipogenesis cascade, as it induces expression of the PPAR" adipogenic TF. Thus, due to their defect in Elk1-mediated IEG expression, MED23-/- murine fibroblasts exhibit defective differentiation to adipocytes (Wang et al. 2009). In summary, MED23 is a regulator of Elk1-mediated transcription, but this can have widespread effects on the activation of gene expression cascades downstream of Elk1 target genes. See Sections 1.3.1 and 1.4.3 for further discussion of mdt-23 functions in the ERK signaling pathway in C. elegans.  MED23 is also required for transcription driven by the insulin signaling pathway-regulated TF FOXO1. A liver-specific MED23 knockout mouse displays increased glucose 14  tolerance and insulin sensitivity, even when fed a high fat diet (Chu et al. 2014). MED23 is required for Mediator recruitment and activated transcription of several FOXO1 target genes (Chu et al. 2014), suggesting that MED23 may also interact with FOXO1 in the insulin signaling pathway.  CKM subunits bind to and/or modify multiple TFs that act in diverse cell signaling pathways. Mammalian CDK8 phosphorylates several TFs to promote or inhibit their activity or abundance. Activation of Notch signaling triggers cleavage and nuclear translocation of the Notch intracellular domain (NICD), where it forms a complex with other nuclear proteins to activate gene expression. The NICD complex recruits CDK8, which phosphorylates NICD to promote ubiquitin-mediated degradation, thus dampening gene expression downstream of an important developmental pathway (Fryer et al. 2004). Similarly, CDK8-mediated phosphorylation promotes ubiquitination and proteasome-mediated degradation of SREBP1c, a key TF activated downstream of the insulin signaling pathway (Zhao et al. 2012). CDK8 also phosphorylates SMAD TFs that act downstream of the bone morphogenic protein and TGF-# signaling pathways. These phosphorylation events promote SMAD-driven transcriptional activation as well as ubiquitination and proteasome-mediated degradation of the SMAD factors, thus fine-tuning the gene expression response downstream of two developmental signaling pathways (Alarcón et al. 2009). Unlike NICD, SREBP1c, or SMADs, CDK8-mediated phosphorylation of STAT1, an effector TF of the interferon " signaling cascade, activates STAT1-driven transcription (Bancerek et al. 2013). Finally, CDK8-mediated phosphorylation of the E2F1 TF suppresses its ability to inhibit #-catenin-driven transcription; thus, CDK8 indirectly promotes #-catenin activity, a key effector of the Wnt signaling pathway (Morris et al. 2008). Intriguingly, #-catenin also binds directly to the human MED12 CKM subunit, to recruit 15  Mediator during transcriptional activation (Kim et al. 2006); therefore, the CKM promotes #-catenin-driven transcription both directly and indirectly. Yeast Cdk8 also phosphorylates several TFs that act in MAPK signaling-mediated starvation or stress response pathways. Specifically, Cdk8 phosphorylates Ste12 and Phd1, which activate nutrient deprivation response genes, to promote their turnover in nutrient rich conditions (Nelson et al. 2003; Raithatha et al. 2012). Cdk8 also phosphorylates Msn2, a multistress-responsive TF, to promote its nuclear exclusion in the absence of stress (Chi et al. 2001). Thus, the CKM promotes or inhibits TF activity downstream of multiple cell signaling pathways in human cells and in yeast. See Section 1.3 for further discussion of CKM subunit roles in developmental signaling pathways of C. elegans.  1.1.4 Mediator subunit mutations in human disease 1.1.4.1 Developmental anomalies  Mutations in Mediator subunits have been identified in diverse human diseases (Spaeth et al. 2011). Several Mediator subunit mutations have been discovered in families or patients with neurodevelopmental syndromes. A MED25 missense mutation was identified in a large consanguineous family with autosomal recessive axonal Charcot-Marie-Tooth motor and sensory neuropathy (Leal et al. 2009). A MED17 missense mutation causing postnatal cerebellar atrophy and myelination defects was identified in a Caucasus Jewish population (Kaufmann et al. 2010). A chromosomal inversion was found to disrupt a CDK8 paralog, CDK19, in a patient with microcephaly, intellectual disability and other congenital defects (Mukhopadhyay et al. 2010). In all of these cases, the underlying molecular mechanisms that cause neurodevelopmental defects remain poorly understood. MED12 missense mutations cause three X-linked intellectual disability syndromes, Opitz-Kaveggia (also known as FG) syndrome, Lujan syndrome, or Ohdo 16  syndrome (Risheg et al. 2007; Schwartz et al. 2007; Vulto-van Silfhout et al. 2013). The molecular etiology of Opitz-Kaveggia and Lujan syndromes has been partially elucidated. Mutations found in both syndromes disrupt CDK8-mediated repression of genes induced by the sonic hedgehog signaling pathway, an important pathway in embryogenesis (Zhou et al. 2012). Furthermore, Opitz-Kaveggia and Lujan syndrome mutations disrupt MED12 interaction with the histone methyltransferase G9a at neuronal genes repressed by REST (Ding et al. 2008), suggesting that Opitz-Kaveggia and Lujan syndrome MED12 mutations may deregulate neuronal gene expression in inappropriate cell types or at inappropriate times. Finally, a Lujan syndrome MED12 mutation perturbs mRNA levels of some IEGs induced in the serum response network (Hashimoto et al. 2011). As a MED23 missense mutation linked to intellectual disability in a large consanguineous Algerian family also disrupts serum response IEG expression (Hashimoto et al. 2011), this pathway appears to be a prominent target of Mediator action in neurological development (see commentary by (Goh and Grants 2012)).  Two Mediator subunit mutations have been identified in developmental defects of the cardiovascular system. Missense mutations or translocations disrupting a MED13 paralog, MED13L, were identified in multiple patients with transposition of the great arteries, a congenital heart defect (Muncke et al. 2003). In addition, the MED15 gene is located within the chromosome 22q11.2 region typically deleted in DiGeorge syndrome, which causes multiple developmental phenotypes including cardiac defects (Berti et al. 2001); however, as the DiGeorge syndrome deletion typically encompasses ~60 genes, a role for MED15 in cardiac development remains to be determined.  17  1.1.4.2 Cancers or tumors  Several CKM subunits are mutated or display altered expression in human tumors and cancers. The MED12 CKM subunit gene harbours recurrent mutations in or near exon 2 in approximately 70% of uterine leiomyomas and 60% of breast fibroadenomas, benign tumors of the uterus and breast (Mäkinen et al. 2011; Lim et al. 2014). A uterine-conditional mouse model of a MED12 exon 2 mutation suggests a gain-of-function or dominant-negative mode of action, as the MED12 exon 2 mutant transgene can predispose wild-type mice to uterine leiomyoma (Mittal et al. 2015). Analysis of gene expression in MED12 mutant vs. MED12 wild-type tumors has revealed increased Insulin-like growth factor 2 mRNA in uterine leiomyomas (Di Tommaso et al. 2014), and increased estrogen receptor target gene expression in breast fibroadenomas (Lim et al. 2014), which could account for hyperplasia. In vitro, uterine leiomyoma-linked MED12 mutations disrupt MED12 binding to Cyclin C, and abrogate CDK8 association with Mediator and its kinase activity (Turunen et al. 2014). A potential explanation for these conflicting findings is that these MED12 mutations may have a dominant negative effect on Cyclin C and/or CDK8 activity, and that Cyclin C or CDK8 repress an oncogenic pathway. Cyclin C has been identified as a haploinsufficient tumor suppressor in T-cell acute lymphoblastic leukemia (T-ALL), as the CCNC gene is subject to heterozygous deletions, leading to decreased CCNC mRNA expression in approximately 10% of T-ALL patients (Li et al. 2014). This deletion promotes transcriptional activation of Notch signaling target genes, as Cyclin C-CDK8 phosphorylates the NICD to promote its turnover (Fryer et al. 2004; Li et al. 2014). Furthermore, in a mouse xenograft model of hematopoeitic progenitor cells transduced with oncogenic Notch, heterozygous CCNC deletion accelerates T-ALL development (Li et al. 2014). CDK8 has been identified as a putative oncogene, as it is overexpressed in approximately 18  70% of colon cancers (Firestein et al. 2010) and 75% of a melanoma subtype that lacks the histone variant macro-H2A (mH2A) (Kapoor et al. 2010). CDK8 overexpression in colon cancer arises due to CDK8 copy number amplification, and is critical for cellular proliferation driven by activation of Wnt signaling or the serum response (Firestein et al. 2008; Donner et al. 2010). CDK8 overexpression in melanoma is associated with loss of the repressive histone variant mH2A at the CDK8 promoter, and although CDK8 is required for proliferation of melanoma cell lines, the underlying mechanism remains unknown (Kapoor et al. 2010). In sum, the CKM subunits MED12 and CDK8 appear to act as human oncogenes, while Cyclin C is a haploinsufficient tumor suppressor. Together, these findings suggest that the CKM plays an important, and perhaps dichotomous, role in human cancers.  MED1, a coregulator of many NHRs, is also overexpressed in hormone-dependent cancers. MED1 overexpression occurs in approximately 50% of estrogen receptor positive breast cancers (Zhu et al. 1999) and 50% of prostate cancers (Vijayvargia et al. 2007). The pathogenic role of MED1 overexpression in breast cancer has not been explored. However, MED1 is required for proliferation and/or survival of both androgen-dependent and androgen-independent prostate cancer cell lines (Vijayvargia et al. 2007), suggesting that overexpression of MED1 can potentiate androgen receptor signaling regardless of the presence of its ligand. Thus, in addition to MED12 and CDK8, the MED1 Mediator subunit appears to act as an oncogene in some malignancies.  Overall, the wide spectrum of disease phenotypes caused by mutations in distinct Mediator subunits supports the notion that some Mediator subunits influence specific gene expression programs. However, in many cases the pathogenic mechanisms underlying these 19  disease mutations remain poorly understood, underscoring the need to further study individual Mediator subunits and their in vivo functions.   1.2 Evolutionary conservation of Mediator 1.2.1 Mediator complexes of yeast and metazoans  Mediator is conserved across eukaryotes, both at the level of Mediator subunit homology and overall Mediator complex structure. The majority of Mediator subunits appear to have orthologs from yeast to humans. Some notable exceptions are MED23, MED25, MED26, MED28 and MED30, which are absent from yeast Mediator (Bourbon 2008), but are present in metazoans as well as some unicellular eukaryotes. In addition, the sequence conservation is very weak between yeast Med2, 3, and 5 and their putative metazoan orthologs, MED29, 27, and 24, respectively (Bourbon 2008); therefore, it remains to be determined if these subunits adopt similar functions within the yeast and metazoan Mediator complexes.   Structural comparison of yeast and human Mediator also shows a similar complex architecture. The modular organization of Mediator (see Section 1.1.2) is quite similar between yeast and human, as the head, middle and tail modules adopt the same relative positions (Tsai et al. 2014), and the CKM attaches to the core Mediator primarily via MED13 binding to the MED19 middle module subunit in both yeast and human Mediator (Tsai et al. 2014).   Three notable differences in Mediator structure can be identified between yeast and human. First, the Mediator subunits that are absent from or highly divergent in yeast Mediator form a much larger tail module in the metazoan Mediator, which makes additional contacts with the middle and head modules (Tsai et al. 2014): MED23, MED24, and MED25 form contacts at 20  the tail-middle module interface; and MED27-30 form contacts at the tail-head module interface (Figure 1.1). Second, human MED26, which is absent from yeast Mediator, can bind reversibly to MED19 in the middle module (Tsai et al. 2014). Finally, in both yeast and human Mediator, CKM and Pol II binding to the core Mediator appears to be mutually exclusive (Näär et al. 2002; Tsai et al. 2013), but for different structural reasons. The yeast CKM forms an extensive interface with the Mediator middle module, via both Med13 and Cdk8, which sterically blocks the Mediator’s Pol II CTD binding site (Tsai et al. 2013). The human CKM forms less extensive contacts with the Mediator middle module, via MED13 only (Tsai et al. 2013), and instead causes structural rearrangements in the Mediator complex that alter the conformation of the Pol II binding site (Taatjes et al. 2002; Bernecky et al. 2011). Therefore, although yeast and metazoan Mediator share homology and structural similarity, key structural differences may influence Mediator’s regulatory mechanisms, e.g. intra-Mediator regulatory interactions (see Section 1.1.3.4).   1.2.2 Mediator complex of C. elegans   Yeast and human Mediator have been studied extensively using in vitro transcription assays, in vitro structural studies, or gene expression analysis of cultured yeast or human cells. A few Mediator subunits have been studied in mouse models; embryonic lethality has often hampered in vivo studies (Stevens et al. 2002; Wang et al. 2005, 2009; Westerling et al. 2007; Li et al. 2014), although conditional knockout models are viable and can reveal Mediator subunit functions in specific tissues or life stages (Chu et al. 2014; Li et al. 2014). Several Mediator subunit mutations have been identified in diverse human diseases (see Section 1.1.4), indicating that disruption of specific Mediator subunits can have distinct consequences in complex, living 21  organisms. Thus, studying the in vivo phenotypes of individual Mediator subunit mutants in a metazoan model organism can shed light on Mediator subunit-specific roles in development and/or physiology.   The nematode worm C. elegans provides an ideal system in which to study Mediator subunit mutant phenotypes. The availability of a fully annotated genome, genome-wide RNA interference (RNAi) libraries, large-scale collections of promoter reporters, a set of 2000 completely sequenced C. elegans strains collectively harbouring nearly a million mutations, and thousands of additional mutations originating from individual labs and knockout consortia collectively provide some insight into Mediator subunit function in this metazoan (C. elegans Sequencing Consortium 1998; Kamath et al. 2003; Thompson et al. 2013). As such, many novel Mediator subunit roles have been identified in C. elegans, which I discuss in detail in Sections 1.3 and 1.4. Note that several C. elegans Mediator subunits are commonly referred to by their classical gene names (e.g. mdt-12 as dpy-22, mdt-13 as let-19); throughout this dissertation I preferentially use standardized ‘mdt’ nomenclature (Bourbon et al. 2004), but I also provide classical C. elegans gene names where these are the most commonly used form (e.g. mdt-12/dpy-22, mdt-13/let-19).  Many cell signaling pathways, metabolic pathways, and most Mediator subunits are conserved in C. elegans. Thus, studies of C. elegans Mediator subunit mutants can provide insights into their roles in conserved developmental or physiological responses.   1.3 Mediator subunit roles in pathways of animal development The power of genetic analysis in C. elegans and in particular of large-scale forward and 22  reverse genetic screens has brought to light the importance of some Mediator subunits in developmental signaling pathways. Here, I describe the developmental phenotypes associated with mutations in certain Mediator subunits in C. elegans, and the mechanisms by which these subunits regulate cell fate by modulating the epidermal growth factor receptor (EGFR)-Ras-extracellular signal-regulated (ERK)/mitogen activated protein kinase (MAPK) signaling pathway, the Wnt signaling pathway, or the cell cycle (Figure 1.3).   1.3.1 Epidermal growth factor receptor signaling  The EGFR-Ras-ERK pathway is a highly conserved signaling cascade that regulates cell proliferation and differentiation in eukaryotes (Yoon and Seger 2006; Avraham and Yarden 2011). Mutations in the EGFR signaling pathway cause several human developmental syndromes and underlie numerous human cancer types (Karnoub and Weinberg 2008; Tidyman and Rauen 2009). Several Mediator subunits modulate EGFR signaling pathway activity. Many of these regulatory roles were first discovered in studies on C. elegans development, often followed later by the description of similar regulatory mechanisms in human cancer contexts. In C. elegans, the EGFR-Ras-ERK cascade consists of an EGF-like ligand, LIN-3, that binds to LET-23/EGFR to promote activation of a downstream cascade that includes LET-60/Ras, LIN-45/Raf, and MPK-1/ERK MAPK (Moghal and Sternberg 2003b). ERK targets include the Ets-family TF LIN-1, the FoxB TF LIN-31, and the homeobox TF LIN-39 (Moghal and Sternberg 2003b). The C. elegans EGFR-Ras-ERK signaling pathway directs the development of several tissues, including the vulva precursor cells (VPCs), the excretory cell (a tissue analogous to the mammalian kidney), male mating structures (spicules, hook), and others 23  (Moghal and Sternberg 2003b). Thus, the EGFR signaling pathway is broadly required for C. elegans development.  The hermaphrodite vulva is perhaps the best-studied organogenesis paradigm in C. elegans (Sternberg 2005; Félix and Barkoulas 2012). In the nascent vulva, EGFR and Notch signaling direct three of six equivalent vulva precursor cells (VPCs) to adopt a vulval cell fate, while the remaining VPCs adopt a hypodermal fate. The cell fate decision of VPCs is exquisitely sensitive to perturbations in the EGFR-Ras-ERK pathway: increased EGFR signaling activity promotes additional VPCs to adopt the vulval cell fate, leading to a multivulva phenotype with ectopic non-functional pseudovulvae; vice versa, reduced EGFR signaling activity inhibits the vulval cell fate and leads to a vulvaless phenotype (Sternberg 2005). These visible phenotypes have been used very effectively to identify positive and negative regulators of EGFR signaling, including several Mediator subunits. Mediator plays a critical role in activating EGFR-Ras-ERK signaling-driven developmental events in C. elegans, as two Mediator tail module subunits were identified in forward genetic screens for positive regulators of vulva development (Tuck and Greenwald 1995; Singh and Han 1995): mdt-23/sur-2, and the divergent MED24 ortholog lin-25/mdt-24 (Bourbon 2008). Both mdt-23/sur-2 and mdt-24/lin-25 are essential for vulva development in C. elegans, as mutants display a completely penetrant vulvaless phenotype. These subunits act downstream of Ras, as loss of mdt-23/sur-2 or mdt-24/lin-25 suppresses the multivulva phenotype of let-60/Ras gain-of-function mutants (Tuck and Greenwald 1995; Singh and Han 1995). Similarly, the Mediator head module subunit mdt-6 may also be a positive regulator downstream of Ras, as depletion of mdt-6 partially suppresses the multivulva phenotype of let-60/Ras gain-of-function (Kwon and Lee 2001). 24  The molecular mechanisms of mdt-23/sur-2 action in EGFR-driven vulva development have been partially elucidated, and they involve the Notch ligand lag-2, a key target gene of EGFR signaling (Chen and Greenwald 2004; Zhang and Greenwald 2011). In cells not receiving an EGF signal, LIN-1/Ets represses the lag-2 promoter through the repressive element VPCrep; in contrast, in VPCs with activated EGFR signaling, the activating element VPCact promotes lag-2 expression. Together, these mechanisms restrict lag-2 expression to the appropriate VPCs. Loss of mdt-23/sur-2 strongly decreases VPCact activity in cells with active EGFR signaling, suggesting that MDT-23 is a critical coactivator at this element. To date, the TF(s) that partners with MDT-23 to activate VPCact has not yet been identified (Zhang and Greenwald 2011). Interestingly, in murine cells, MED23 associates directly with the Ets-family TF Elk-1 to coactivate serum response genes (Stevens et al. 2002). However, at the C. elegans lag-2 promoter, the Elk-1 ortholog LIN-1/Ets acts exclusively as a repressor through VPCrep (Zhang and Greenwald 2011), suggesting that MDT-23 may not cooperate with LIN-1/Ets to activate this particular EGFR target. mdt-23/sur-2 and mdt-24/lin-25 are required for additional developmental events regulated by the EGFR-Ras-MAPK cascade (Nilsson et al. 2000), suggesting that these Mediator subunits are generally required downstream of Ras. However, mdt-23/sur-2 and mdt-24/lin-25 do not appear to be required in certain developmental phenotypes or processes (e.g. body transparency, oogenesis) wherein LET-60/Ras is activated by an alternate receptor tyrosine kinase (RTK), such as fibroblast growth factor receptor or others (Nilsson et al. 2000; Schutzman et al. 2001). The mechanism for this specificity remains unclear, but likely depends on interactions between Mediator subunits and specific downstream TFs. 25   In contrast to mdt-6, -23, and -24, the Mediator CKM subunit mdt-12/dpy-22 was identified in a forward genetic screen as a negative regulator of vulva development (Moghal and Sternberg 2003a). Reduction-of-function mutations in mdt-12/dpy-22 cause a low penetrance multivulva phenotype in wild-type worms and strongly enhance the penetrance of the multivulva phenotype caused by heterozygous gain-of-function mutations in let-23/EGFR or let-60/Ras. mdt-12/dpy-22 acts downstream of EGFR, as reduction-of-function of mdt-12/dpy-22 partially suppresses the vulvaless phenotype of a let-23/EGFR reduction-of-function mutant (Moghal and Sternberg 2003a). Beyond this, the position of mdt-12/dpy-22 activity in the EGFR-Ras-MAPK pathway has not been mapped further, although an MDT-12::GFP fusion protein is expressed in the VPCs (Moghal and Sternberg 2003a), suggesting a function in this tissue, perhaps at the level of the effector TFs LIN-1 or LIN-31. Alternatively, MDT-12/DPY-22 could repress ectopic expression of the EGF ligand in the surrounding hypodermis (skin), as do several other transcriptional coregulators (Fay and Yochem 2007), or could repress the Notch signaling pathway, which acts genetically downstream of the EGFR signaling pathway in vulva development (Chen and Greenwald 2004). mdt-23/sur-2 and mdt-24/lin-25 promote, whereas mdt-12/dpy-22 inhibits vulva development, an organogenesis event driven by EGFR-Ras-ERK signaling. Thus, it would be informative to conduct genetic epistasis analyses to determine whether these Mediator subunits regulate each other’s activity in this pathway. As noted above (Section 1.1.3.4), such epistatic relationships have been observed in yeast between the kinase module subunit CDK8 and the tail module subunits Med2, Med3, and Med15 (van de Peppel et al. 2005; Gonzalez et al. 2014); it will be of interest to determine whether a similar relationship exists in metazoans. Furthermore, other Mediator subunits might also regulate EGFR signaling, and the C. elegans vulva provides 26  an excellent system to explore this possibility. In particular, since the kinase module subunit mdt-12/dpy-22 has already been implicated in vulva development (Moghal and Sternberg 2003a), the other CKM subunits, cdk-8, cic-1/Cyclin C, and mdt-13/let-19 are promising candidates for additional negative regulators of the pathway.  1.3.2  Wnt signaling  The Wnt signaling pathway is an important regulator of cell fate and of proliferation and self-renewal of stem and progenitor cells (Angers and Moon 2009). Reduction of Wnt signaling causes degenerative diseases such as syndromic osteoporosis, whereas increased Wnt signaling underlies multiple human cancers including colon cancer and melanoma (Clevers and Nusse 2012). Several Mediator subunits regulate canonical Wnt signaling in C. elegans development.  The components of the canonical Wnt signaling pathway are conserved from C. elegans to humans. In the absence of a Wnt signal, a degradation complex consisting of Axin, Disheveled, APC, GSK3#, and CK1 homologs phosphorylates the transcriptional coactivator BAR-1/#-catenin, thus targeting it for ubiquitination and proteasomal degradation (Korswagen 2002). The C. elegans genome encodes five Wnt ligands and four Frizzled receptors. Binding of ligand to receptor triggers recruitment of the BAR-1/#-catenin degradation complex to the plasma membrane, allowing unphosphorylated BAR-1/#-catenin to accumulate and enter the nucleus, where it coactivates transcription driven by the TCF/LEF family TF POP-1 (Korswagen 2002). This canonical Wnt signaling pathway regulates various aspects of C. elegans development, including VPC competence and polarity, neuroblast migration, P12 ectoblast cell fate specification, and generation of seam cell-derived structures (e.g. male tail rays). In addition, 27  a divergent canonical Wnt signaling pathway, involving the #-catenin orthologs WRM-1 and/or SYS-1, regulates asymmetric cell division (Korswagen 2002). In the C. elegans vulva, mdt-12/dpy-22 and mdt-13/let-19 regulate cell fusion events controlled by BAR-1/#-catenin (Yoda et al. 2005). In the VPCs, BAR-1/#-catenin inhibits cell fusion by inducing the homeobox (Hox) TF lin-39, which prevents fusion of the VPCs with the surrounding hypodermal tissue (Clark et al. 1993). Loss of mdt-12/dpy-22 or mdt-13/let-19 inhibits VPC fusion and suppresses the ectopic cell fusion phenotype of bar-1/!-catenin mutants. However, loss of mdt-12/dpy-22 or mdt-13/let-19 does not suppress the ectopic cell fusion phenotype of lin-39 mutants (Yoda et al. 2005). Thus, mdt-12/dpy-22 and mdt-13/let-19 apparently act parallel to or downstream of bar-1/!-catenin, but upstream of lin-39 to promote cell fusion. Forward genetic screens additionally identified several Mediator subunits as regulators of Wnt-orchestrated developmental events such as cell fate patterning of C. elegans male tail rays. This process is governed by the Hox TFs pal-1/Caudal, mab-5/Antennapedia, and egl-5/Abdominal-B. The Mediator CKM subunit mdt-12/dpy-22 and the middle module subunit mdt-1.1 are required to prevent aberrant activation of this Hox TF cascade by BAR-1/#-catenin (Zhang and Emmons 2000, 2001). Specifically, these Mediator subunits are required to repress aberrant BAR-1/#-catenin-mediated transcriptional activation of pal-1/Caudal and of egl-5/Abdominal-B (Zhang and Emmons 2000, 2001). Conversely, the Mediator head module subunit mdt-6 appears to promote the aberrant BAR-1/#-catenin-driven pal-1 activation that arises in mdt-12/dpy-22 mutants (Kwon and Lee 2001). Thus, as seen in yeast (van de Peppel et al. 2005; Gonzalez et al. 2014) and as suggested for Mediator subunit action in EGFR-driven development (Section 1.3.1), functional opposition between Mediator subunits may occur in the 28  Wnt signaling pathway. Interestingly, the Mediator subunit mdt-23/sur-2 is not required for BAR-1/#-catenin–dependent transcriptional regulation of pal-1 (Zhang and Emmons 2001), demonstrating that regulation of Wnt signaling is specific to a subset of Mediator subunits.  Mediator subunits also regulate an asymmetric cell division event mediated by divergent canonical Wnt signaling in C. elegans. Asymmetric division of the T blast cell, which determines whether the T cell daughters adopt a neural or hypodermal fate, requires lin-44/Wnt and lin-17/Frizzled to establish polarity of two asymmetrically expressed TFs, POP-1/TCF and TLP-1/Sp1 (Herman 2001; Zhao et al. 2002). The Mediator kinase module subunits mdt-12/dpy-22 and mdt-13/let-19 are required downstream of lin-17/Frizzled to establish the asymmetric expression of TLP-1/Sp1, but not of POP-1/TCF, in the T cell daughters (Yoda et al. 2005). Thus, mdt-12/dpy-22 and mdt-13/let-19 regulate a Wnt signaling-mediated asymmetric cell division event; however, MDT-12/DPY-22 and MDT-13/LET-19 proteins are symmetrically distributed in the T cell daughters (Yoda et al. 2005), suggesting that their activity as transcriptional coregulators may itself be subject to regulation by the Wnt pathway. Although mdt-12/dpy-22 and mdt-13/let-19 regulate at least three developmental processes governed by Wnt signaling, they do not indiscriminately influence all Wnt-regulated developmental events. First, migration of the C. elegans QL neuroblast requires egl-20/Wnt and bar-1/!-catenin, but mdt-12/dpy-22 and mdt-13/let-19 mutants show no migration defects (Yoda et al. 2005). Second, endoderm induction requires a divergent canonical Wnt signaling pathway that acts through wrm-1/!-catenin; however, RNAi knockdown of mdt-13/let-19 has no effect on endoderm development ((Yoda et al. 2005); note, however, that mdt-13/let-19 knockdown efficiency was not reported). Finally, somatic gonad development requires lin-17/Frizzled and 29  pop-1/TCF, but mdt-12/dpy-22 and mdt-13/let-19 mutants display superficially normal somatic gonads (Yoda et al. 2005).  1.3.3 Cell cycle progression  Tight cell cycle regulation is essential for animal development, and certain Mediator subunits influence cell fate by regulating this process. Cellular quiescence (i.e. temporary or permanent exit from the cell cycle) is particularly important for specification of the VPC equivalence group in C. elegans. During normal vulva development, six VPCs arrest in an extended G1 phase that lasts from the first larval stage L1 until the time of their cell fate determination (vulval fate vs. hypodermal fate) in the third larval stage L3 (Euling and Ambros 1996). Disruption of this cell cycle quiescence expands the VPC equivalence group, producing more VPCs capable of adopting vulval fates. An elegant genetic screen for regulators of VPC quiescence revealed that multiple Mediator subunits contribute to cell cycle entry and/or exit (Clayton et al. 2008). Loss of the middle module subunit mdt-1.1, the tail module subunits mdt-23/sur-2 or mdt-24/lin-25, or of the kinase module subunits cdk-8, mdt-12/dpy-22, or mdt-13/let-19 prevents establishment or maintenance of VPC quiescence. Depletion of 13 additional Mediator subunits caused no observable effect on cell cycle quiescence, suggesting that only a subset of Mediator subunits are involved in this process (Clayton et al. 2008). Mechanistically, mdt-13/let-19 was not required to express the Cyclin dependent kinase inhibitor cki-1, a key effector of VPC quiescence, implying that Mediator regulates the transcription of other, unknown genes involved in cell cycle quiescence (Clayton et al. 2008). The six Mediator subunits identified in this screen have been implicated as regulators of cell signaling pathways 30  (see Sections 1.3.1 and 1.3.2), suggesting that Mediator may integrate information from various cell signaling cascades to coordinate cellular quiescence in development.  1.3.4 Other developmental phenotypes of Mediator mutants  Besides the well-characterized roles described above, Mediator subunits participate in additional events in C. elegans development. The underlying molecular pathways are less well defined in these instances, yet these studies elegantly reveal differential Mediator subunit action during embryonic and post-embryonic development.  C. elegans provides an ideal system to study the contributions of Mediator subunits to gene-specific vs. general embryonic transcription, as maternal gene products allow embryos with null mutations in essential genes to survive to at least the 100-cell stage despite drastically perturbed transcription (Powell-Coffman et al. 1996). In this system, loss of the head module subunit mdt-6, the middle module subunits mdt-7 or mdt-10, or the kinase module subunit mdt-13/let-19 causes embryonic arrest at the ~300-cell stage, before cell differentiation and body morphogenesis begin (Kwon et al. 1999; Wang et al. 2004). Examination of transcriptional reporters demonstrated that the depletion of these Mediator subunits prevents the expression of some stage- or lineage-specific genes, but not of ubiquitously expressed genes (Kwon et al. 1999; Wang et al. 2004). In contrast, depleting mdt-14, which occupies a central position connecting the head, middle, and tail modules of Mediator (Figure 1.3), causes embryonic arrest at the 100-cell stage due to a broad loss of transcription as evidenced by loss of Pol II CTD phosphorylation (Shim et al. 2002). Thus, whereas many Mediator subunits appear to be required for specific developmental and differentiation programs in early embryogenesis, mdt-14 is more broadly required for transcription. It would be interesting to conduct a systematic study to 31  determine the embryonic requirements for all Mediator subunits, and whether these requirements involve gene-specific or global transcriptional regulation. Several processes during C. elegans larval development also depend on Mediator subunits. The tail module subunit mdt-23/sur-2 was identified in a screen for genes required for muscle development, as mdt-23/sur-2 depletion caused aggregation of muscle myosin myo-3 in myofilaments (Meissner et al. 2009). Furthermore, mdt-23/sur-2 and the kinase module subunits cdk-8, cic-1/Cyclin C, mdt-12/dpy-22, and mdt-13/let-19 are required for correct navigation of ventral nerve cord axons (Steimel et al. 2013). The axon guidance defects of cdk-8 mutants are suppressed by mutation of sax-3/ROBO, a receptor for Slit-family ligands that guide axon navigation, suggesting that the kinase module may inhibit the sax-3/ROBO pathway by molecular mechanisms that remain to be elucidated (Steimel et al. 2013).  1.3.5 Regulatory hub activity of MED12   Network theory can be used to analyze the patterns of genetic interactions in cells and organisms. Gene networks of various origins typically conform to a common format, wherein most genes interact with relatively few other genes, and a few genes form highly connected regulatory “hubs” (Barabási and Oltvai 2004). A high-throughput screen for pairwise genetic interactions in C. elegans revealed that the Mediator subunit mdt-12/dpy-22 is one of six highly connected hubs, and the only Mediator subunit, that bridge multiple signaling pathways, including EGFR signaling, Notch signaling, Wnt signaling, and cell death/migration. In addition, mdt-12/dpy-22 and the other candidate hub genes enhance the loss-of-function phenotype of genes involved in processes unrelated to cell signaling, indicating that mdt-12/dpy-22 acts as genetic buffer to moderate the effect of genetic perturbations in an organism (Lehner et al. 32  2006). The fact that MED12 is implicated in numerous and diverse human diseases may suggest that its role as a regulatory hub is evolutionarily conserved (Section 1.1.4). Thus, by interacting with diverse signaling pathways, and hence conferring a risk for diverse pathologies, human MED12 may represent a regulatory hub as described for C. elegans mdt-12 (Figure 1.4).  1.3.6 Parallels between Mediator roles in development and in cancer 1.3.6.1 Mediator subunit roles in EGFR signaling-driven tumorigenesis  In the last few years, a strong parallel has emerged between the roles of mdt-23/sur-2 and mdt-12/dpy-22 in EGFR signaling-regulated development in C. elegans and the roles of MED23 and MED12 in EGFR signaling-driven tumorigenesis in humans. MED23 is required for the proliferation and tumorigenicity of human lung cancer cells with hyperactive Ras mutations, but not in cells lacking Ras mutations (Yang et al. 2012). Thus, just as observed decades earlier in C. elegans (Singh and Han 1995), loss of human MED23 suppresses the effects of activated Ras, suggesting a potential role as a transcriptional coactivator downstream of Ras. Moreover, in human melanoma cells, loss of MED12 promotes cellular resistance to chemotherapeutic agents that inhibit the ERK signaling pathway component BRAF (Shalem et al. 2014). This suggests that, like C. elegans mdt-12/dpy-22 (Moghal and Sternberg 2003a), MED12 inhibits ERK signaling in melanoma cells by acting downstream of BRAF, perhaps by corepressing downstream target genes. Lastly, the two Mediator subunits MED12 and CDK8 are mutated or amplified in human tumors (Firestein et al. 2010; Mäkinen et al. 2011; Lim et al. 2014), but their impact on EGFR signaling in these contexts have not been examined. Overall, the parallels between C. elegans development and human cancer indicate that further study of C. elegans 33  Mediator subunits’ actions within the EGFR signaling pathway may yield clinically applicable findings for cancers bearing activating mutations in this signaling cascade.  1.3.6.2 Mediator repression of Notch signaling-driven tumorigenesis  The Mediator CKM subunit Cyclin C has recently been identified as a haploinsufficient tumor suppressor, via repression of Notch signaling-driven transcription, in T-ALL (Li et al. 2014) (see Section 1.1.4.2). Both Notch signaling and EGFR signaling are important players in C. elegans vulval cell fate determination (Sternberg 1988; Moghal and Sternberg 2003b; Chen and Greenwald 2004). The CKM subunit mdt-12 represses vulval cell fates downstream of let-23/EGFR (Moghal and Sternberg 2003a). As requirements in EGFR and/or Notch signaling could potentially explain the vulval phenotypes of mdt-12 mutants (see Section 1.3.1), further studies of mdt-12 and other CKM subunits in EGFR- vs. Notch-induced vulval cell fates are needed to distinguish between these possibilities.  1.3.6.3 Mediator subunit roles in Wnt signaling-driven tumorigenesis  The involvement of C. elegans Mediator CKM subunits in Wnt/#-catenin signaling is intriguing, as human CDK8 regulates Wnt signaling in colon cancers. Specifically, CDK8 expression is upregulated in a substantial fraction of human colon cancer specimens, often due to copy number gain at the CDK8 locus (Firestein et al. 2010), and this promotes Wnt/#-catenin-driven cell proliferation and tumorigenicity (Firestein et al. 2008; Morris et al. 2008) (see Sections 1.1.3.5 and 1.1.4.2). Thus, CDK8 promotes the oncogenic action of #-catenin in human colon cancer. These data contrast with the inhibitory role of C. elegans CKM subunits mdt-12/dpy-22 and/or mdt-13/let-19 in the Wnt/#-catenin signaling pathway in male tail patterning 34  and in VPC fusion (Zhang and Emmons 2000; Yoda et al. 2005). This may suggest evolutionary divergence of the CKM’s role in Wnt signaling, or divergence of the roles of individual CKM subunits in Wnt regulation. Further work is needed to answer these questions, particularly in elucidating whether MDT-12/DPY-22 and MDT-13/LET-19 regulate BAR-1/#-catenin directly or indirectly in the context of cell differentiation and fusion.  1.3.6.4 Mediator interaction with Retinoblastoma tumor suppressor protein   The role of Mediator CKM subunits in cell cycle regulation in C. elegans parallels a function of a human MED13 paralog, MED13L. Specifically, the cellular senescence or cell cycle arrest induced by a constitutively active Retinoblastoma tumor suppressor protein (RB) mutant depends on MED13L (Angus and Nevins 2012). In this context, MED13L inhibits cell cycle progression by acting as a corepressor for RB/E2F, as loss of MED13L results in derepression of the RB/E2F target Cyclin A even in the presence of constitutively active RB (Angus and Nevins 2012). Similarly, in Drosophila, CDK8 acts in parallel to RB as a direct corepressor of E2F1 (Morris et al. 2008). Together, these data suggest that the Mediator CKM and RB may target common TFs to regulate the cell cycle. It would be interesting to explore this hypothesis further using the C. elegans VPC quiescence model, to determine whether the CKM subunits, and other Mediator subunits identified as regulators of cell cycle quiescence (Clayton et al. 2008) (see Section 1.3.3), cooperate with RB in this capacity.   1.4 Roles of the Mediator complex in physiological responses of adult animals  A growing number of studies have identified roles for the Mediator complex in regulating 35  adult physiology in C. elegans. Specifically, Mediator subunits have been identified as regulators of lipid metabolism, stress responses, and innate immune responses (Figure 1.3).  1.4.1 Lipid metabolism  The Mediator tail module subunit MDT-15 is a central regulator of lipid metabolism gene expression in C. elegans. MDT-15 was first identified as coactivator of two TFs with known roles in lipid metabolism, SBP-1/SREBP, a TF that activates fatty acid (FA) desaturation and synthesis genes, and NHR-49, an NHR that regulates FA desaturation and #-oxidation genes (Taubert et al. 2006; Yang et al. 2006). As such, mdt-15 is a critical regulator of gene expression in FA homeostasis and energy metabolism, as outlined below.  mdt-15 mutants, like nhr-49 or sbp-1 mutants, lack certain monounsaturated fatty acid (MUFA) or polyunsaturated FA (PUFA) species (Taubert et al. 2006; Yang et al. 2006). mdt-15 is required to activate transcription of the FA desaturase genes fat-5, fat-6, and fat-7, which are gene targets of SBP-1 and NHR-49 (Taubert et al. 2006; Yang et al. 2006). These enzymes catalyze the formation of carbon-carbon double bonds in saturated FAs, forming MUFAs, which also serve as substrates for the formation of PUFAs. Defects in FA desaturation are in part responsible for pleiotropic phenotypes in mdt-15 mutants, e.g. short life span, sterility, uncoordinated locomotion, and morphological defects, as supplementation with unsaturated FAs can partially rescue these phenotypes (Taubert et al. 2006; Yang et al. 2006). However, the partial nature of this rescue is indicative of the fact that MDT-15 regulates other physiological processes in addition to lipid metabolism (see Section 1.4.2).  Precise regulation of FA desaturation is important for the maintenance of cellular and organelle membrane integrity or function. For example, loss of mdt-15 causes activation of the 36  endoplasmic reticulum (ER) unfolded protein response (UPR). Although this pathway normally responds to protein misfolding, activation of the ER UPR in worms lacking mdt-15 appears to be driven by changes in FA desaturation of the membrane phospholipid phosphatidylcholine (Hou et al. 2014). This suggests that FA desaturation plays a role in the maintenance of ER membrane integrity or function. In line with an important role for mdt-15 in membrane lipid desaturation and homeostasis, an mdt-15 gain-of-function allele suppresses cold sensitivity in a mutant background with aberrant membrane lipid saturation (Svensk et al. 2013), a known determinant of membrane fluidity and cold resistance. Intriguingly, several nhr-49 gain-of-function alleles can also suppress this cold sensitivity phenotype by increasing membrane lipid unsaturated FA content (Svensk et al. 2013). The mdt-15 and nhr-49 gain-of-function mutations are in close proximity to domains in MDT-15 and NHR-49 that interact with each other (Taubert et al. 2006), suggesting that MDT-15 and NHR-49 may act together to promote membrane fluidity and cold resistance via regulation of membrane lipid FA composition.  FA desaturation is also important in the physiological response to a high glucose diet. A glucose-rich diet causes accumulation of FAs and substantially decreases C. elegans lifespan. mdt-15 and sbp-1 are required for survival on a high glucose diet, as mdt-15(RNAi) or sbp-1(RNAi) further shorten the lifespan of glucose-fed worms, and mdt-15 gain-of-function mutation or sbp-1 overexpression extend the lifespan of glucose-fed worms (Lee et al. 2015). In this context, MDT-15 and SBP-1 appear to decrease so-called ‘glucolipotoxicity’, as mdt-15 and sbp-1 are required to activate transcription of glucose-inducible FA desaturation enzymes fat-2, -5, -6, and -7, which detoxify the saturated FA by-products of a high glucose diet by converting them to MUFAs and PUFAs (Lee et al. 2015). 37   MDT-15 also regulates expression of several genes encoding #-oxidation enzymes in response to fasting, via both NHR-49-dependent and -independent mechanisms (Taubert et al. 2006). NHR-49-independent roles of MDT-15 in starvation-induced #-oxidation gene expression imply that MDT-15 coactivates additional TFs in this context. A recent study suggested that an MDT-15-binding stress-responsive TF, SKN-1 (see Section 1.4.2), may activate expression of #-oxidation enzyme genes in an mdt-15-dependent manner (Pang et al. 2014). Furthermore, additional MDT-15 binding TFs, e.g. several NHRs in addition to NHR-49 (Arda et al. 2010), may also have undiscovered roles in #-oxidation gene regulation.  1.4.2 Stress responses  MDT-15 also plays an important role in adaptive responses to environmental stresses, such as toxins, metals, or chemicals that cause oxidative stress. Microarray analysis of mdt-15(RNAi) worms revealed that, in addition to regulating many genes involved in lipid metabolism, mdt-15 also regulates many genes involved in the metabolism and clearance of toxic substances (Taubert et al. 2008). Indeed, mdt-15 is required for gene expression induced by the xenobiotics fluoranthene, b-napthoflavone, and RPW-24 (discussed further in Section 1.4.3), the physiological metal zinc, or the carcinogenic heavy metal cadmium (Taubert et al. 2008; Pukkila-Worley et al. 2014; Roh et al. 2015). The role of mdt-15 in these detoxification responses appears to be specific, as mdt-15 is not required for heat shock-inducible gene expression or thermotolerance (Taubert et al. 2008), for resistance to the proteotoxic stressor tunicamycin (Hou et al. 2014), or for inducible detoxification responses to certain pesticides (Jones et al. 2013). The specificity of mdt-15 in certain detoxification gene expression responses suggests that MDT-15 interacts with specialized TFs to control gene expression responses to 38  xenobiotics or cadmium. However, the TF(s) that interact with MDT-15 in these contexts have not been identified to date.  Regulatory and physical interaction of MDT-15 with SKN-1/Nrf2, a conserved master regulator of detoxification, drives a gene expression response to the oxidative stressor sodium meta-arsenite (hereafter referred to as ‘arsenite’). Specifically, MDT-15 binds directly to SKN-1, and is required for the induction of many SKN-1-dependent detoxification genes in response to arsenite exposure, and for arsenite resistance in vivo (Goh et al. 2014). Interestingly, MDT-15’s role in this oxidative stress response is distinct from its role in FA desaturation, as unsaturated FA supplementation does not rescue mdt-15 mutant arsenite sensitivity (Goh et al. 2014). Whether MDT-15 interaction with SKN-1 drives other detoxification responses, e.g. to fluoranthene or cadmium, remains to be determined.  MDT-15 also regulates a SKN-1-independent oxidative stress response induced by an organic peroxide, tert-butyl hydroperoxide (t-BOOH). Specifically, mdt-15, but not skn-1, is required for induction of many detoxification genes in response to t-BOOH exposure, and for t-BOOH resistance in vivo (Oliveira et al. 2009; Goh et al. 2014). MDT-15-binding NHRs (Taubert et al. 2006; Arda et al. 2010) may mediate this gene expression response, as nhr-64 and nhr-49 mutants display t-BOOH sensitivity (Goh et al. 2014). Taken together, these findings demonstrate that MDT-15 interaction with SKN-1 or NHRs can drive detoxification gene expression responses, but further work is needed to fully delineate these regulatory interactions.  Two additional Mediator subunits, the middle module subunit MDT-26 and the CKM subunit MDT-12/DPY-22, were identified in a reverse genetic screen for regulators of cytoprotective and detoxification responses that contribute to longevity. Namely, mdt-26 is required for longevity of worms with decreased insulin signaling or dietary restriction, whereas 39  mdt-12/dpy-22 is required for longevity of worms with decreased mitochondrial function (Shore et al. 2012). These effects on longevity are thought to stem from requirements for mdt-26 or mdt-12/dpy-22 in gene expression in responses to a variety of stresses such as proteotoxic, mitochondrial, or oxidative stress (Shore et al. 2012). For example, mdt-12/dpy-22 was identified in a reverse genetic screen for genes required in oxidative stress-responsive transcription (Crook-McMahon et al. 2014). However, further investigation is needed to determine if these Mediator subunits regulate stress responsive transcription directly, e.g. through interactions with TFs.   1.4.3 Innate immune responses  mdt-15 is required in an innate immune response controlled by a C. elegans stress-responsive p38 MAPK, PMK-1. Specifically, mdt-15 is required for induction of pmk-1-dependent innate immunity genes in response to an immune-stimulatory xenobiotic toxin, RPW-24, or to the pathogenic bacterium Pseudomonas aeruginosa (Pukkila-Worley et al. 2014). Accordingly, mdt-15 is required for resistance to P. aeruginosa infection. Curiously, mdt-15 is also required in PMK-1-independent aspects of the response to RPW-24 or P. aeruginosa, namely the pmk-1-independent expression of detoxification genes and resistance to the P. aeruginosa-secreted toxin phenazine (Pukkila-Worley et al. 2014). Thus, mdt-15 is required to regulate both the expression of innate immunity genes downstream of PMK-1 activated by pathogenic bacteria, and the expression of detoxification genes activated by bacterial toxins. This dual function of MDT-15 suggests that it may engage distinct, as yet unidentified TFs in each branch of the response to pathogenic bacteria. Taken together with MDT-15’s roles in xenobiotic detoxification, heavy metal stress, and oxidative stress responses, these results suggest that 40  MDT-15 is a critical coregulator of adaptive responses to environmental insults, at least in C. elegans.  The Mediator subunits mdt-23/sur-2 and mdt-24/lin-25 are required for an innate immune response to the pathogenic bacterium Microbacterium nematophilum. Intriguingly, the immune response to M. nematophilum is activated by an ERK MAPK (MPK-1 in C. elegans) cascade instead of the canonical stress responsive p38 MAPK/PMK-1 cascade, and indeed mdt-23/sur-2 and mdt-24/lin-25 act downstream of activated mpk-1/ERK to promote the response to M. nematophilum infection (Nicholas and Hodgkin 2004). Taken together with the roles of mdt-23/sur-2 and mdt-24/lin-25 in developmental events controlled by ERK signaling (see Section 1.3.1), this suggests that these Mediator tail module subunits are central regulators of ERK signaling-driven responses in development and adulthood.  1.4.4 Conservation of Mediator subunit roles in physiological responses  The role of MED15 as a coactivator of SREBP-driven transcription appears to be highly conserved from worms to mammals. Just as observed in C. elegans, murine MED15 binds to and activates SREBP-driven transcription (Yang et al. 2006). However, the target genes of C. elegans and murine SREBP differ, with murine SREBP playing additional roles in cholesterol metabolism that do not appear to be prominent in C. elegans, likely because C. elegans is a cholesterol auxotroph (Hieb and Rothstein 1968; Yang et al. 2006). Thus, MED15 is a conserved coactivator of SREBP-driven transcription from worms to mammals, but changes in the biological function of MED15 have arisen during evolution due to altered target gene specificity of the SREBP TF. 41   The role of MDT-15 as a coactivator of NHR-49-driven transcription of lipid metabolism genes may represent an ancestral function of this Mediator subunit. Specifically, whereas C. elegans MDT-15 binds to multiple NHRs (Taubert et al. 2006; Arda et al. 2010), human MED1 primarily engages NHRs, although human MED14 and MED25 are also capable of binding certain NHRs, and Drosophila CDK8 also binds an NHR (Borggrefe and Yue 2011; Poss et al. 2013; Xie et al. 2015). The molecular nature of these Mediator subunit-NHR interactions is also highly divergent: whereas human MED1, MED14, and MED25 utilize the NHR-binding LXXLL motif, C. elegans MDT-15 does not contain LXXLL motifs and instead utilizes an alternative NHR-binding KIX domain (Taubert et al. 2006). Interestingly, the conservation of LXXLL motifs in Mediator subunits differs across species: MED1 LXXLL motifs are not conserved in invertebrates, e.g. Drosophila and C. elegans, MED14 LXXLL motifs are conserved from Drosophila to humans, but not C. elegans, and the LXXLL motif in CDK-8 is conserved from yeast to humans (Xie et al. 2015). Furthermore, although conserved from yeast to humans, the function of the KIX domain appears to have diverged across species: the KIX domain of yeast Med15 binds to NHR-like TFs, Oaf1 and Pdr1 (Phelps et al. 2006; Thakur et al. 2008, 2009; Näär and Thakur 2009) and the C. elegans MDT-15 KIX domain bind to NHRs and SBP-1/SREBP (Taubert et al. 2006; Yang et al. 2006), whereas the human MED15 KIX domain binds to SREBP but not to TR, a MED1-binding NHR (Yang et al. 2006). Thus, binding of MED15 orthologs to NHRs may represent an ancestral function of this Mediator subunit, which has been distributed to other Mediator subunits such as MED1 and MED14 in higher organisms.  While the role of human MED15 in detoxification responses has not been investigated, it is worthy to note that the MDT-15-interacting TF SKN-1 has a human ortholog, Nrf2, which regulates oxidative stress-responsive transcription (Ma 2013). Therefore, it would be informative 42  to determine if MED15 is a conserved coactivator of Nrf2 in oxidative stress responses in humans.   1.5 Concluding remarks, hypothesis and objectives  There is substantial mechanistic and phenotypic evidence that, while the Mediator complex is required for transcription of virtually all protein coding genes, individual Mediator subunits can play strikingly distinct roles in transcriptional activation or repression of specific gene expression programs, in response to diverse developmental and physiological stimuli. Underlying this regulatory diversity are the interactions between individual Mediator subunits and sequence-specific TFs. Studies of C. elegans mutants have revealed that Mediator subunits are required in multiple developmental and physiological pathways, but in many cases the underlying interactions with specific TFs remain unidentified. Furthermore, the overlapping phenotypes of several C. elegans Mediator subunit mutants indicate that multiple Mediator subunits can converge on the same developmental or physiological pathway; however, the regulatory interactions between Mediator subunits in a common pathway remains largely unexplored.   Mediator CKM subunits, CDK8, Cyclin C, MED12 and MED13, are implicated in transcription stimulated by several cell signaling pathways in human cell culture, in cancers and in C. elegans. Unpublished microarray gene expression profiles of cdk-8 mutants from the Taubert lab implicate C. elegans CDK-8 in regulation of EGFR-Ras-ERK-driven transcription and cadmium-responsive transcription (see Sections 2.3.1 and 3.3.1, respectively), suggesting that the CKM may regulate these important transcriptional responses. As other Mediator subunits 43  also converge on EGFR-Ras-ERK-driven transcription, (i.e. mdt-23/sur-2, mdt-24/lin-25 and mdt-6) or cadmium-responsive transcription (i.e. mdt-15), and as evidence in yeast suggests that the CKM can regulate the activity of other Mediator subunits, it is possible that the CKM may coordinate Mediator activity within these gene expression programs in metazoans.  The overall hypothesis of my thesis is that subunits of the Mediator CDK8 kinase module drive gene expression changes in the EGFR-Ras-ERK signaling pathway and in the cadmium response by interacting with sequence-specific TFs, and/or by regulating the activity of other Mediator subunits. Thus, the specific objectives are: 1. To identify novel interactions of cdk-8 with transcriptional regulators in the EGFR-Ras-ERK signaling pathway. 2. To identify TFs and regulatory elements that cooperate with cdk-8 to regulate cadmium-responsive gene expression.   3. To explore regulatory interactions between cdk-8 and other Mediator subunits in EGFR-Ras-ERK signaling-driven or cadmium responsive transcription.44  Table 1.1 C. elegans Mediator subunits and their mammalian and yeast orthologs. C. elegans subunits Alternative C. elegans names Sequence number Mammalian ortholog S. cerevisiae ortholog Module MDT-1.1 SOP-3 Y71F9B.10 MED1 Med1 Middle MDT-1.2  T23C6.1 MED1L  Middle MDT-4  ZK546.13 MED4 Med4 Middle MDT-6 LET-425 Y57E12AL.5 MED6 Med6 Head MDT-7 LET-49 Y54E5B.3 MED7 Med7 Middle MDT-8  Y62F5A.1 MED8 Med8 Head MDT-9  Y62E10A.11 MED9 Med9/Cse1 Middle MDT-10  T09A5.6 MED10 Med10/Nut2 Middle MDT-11  R144.9 MED11 Med11 Head MDT-12 DPY-22, SOP-1, PSA-6 F47A4.2 MED12 Med12/Srb8 Kinase MDT-13 LET-19, PSA-7, PQN-49 K08F8.6 MED13 Med13/Srb9/Ssn2 Kinase MDT-14 RGR-1 C38C10.5 MED14 Med14/Rgr1 Tail MDT-15  R12B2.5 MED15 Med15/Gal11 Tail    MED16 Med16/Sin4 Tail MDT-17  Y113G7B.18 MED17 Med17/Srb4 Head MDT-18  C55B7.9 MED18 Med18/Srb5 Head MDT-19  Y71H2B.6 MED19 Med19/Rox3 Middle MDT-20  Y104H12D.1 MED20 Med20/Srb2 Head MDT-21  C24H11.9 MED21 Med21/Srb7 Middle MDT-22  ZK970.3 MED22 Med22/Srb6 Head MDT-23  SUR-2 F39B2.4 MED23  Tail  MDT-24  LIN-25 F56H9.5 MED24 Med5a Tail    MED25  Tail MDT-26  C25H3.6 MED26  Middle       45  C. elegans subunits Alternative C. elegans names Sequence number Mammalian ortholog S. cerevisiae ortholog Module MDT-27  T18H9.6 MED27  Med3a Density between head and tail  MDT-28  W01A8.1 MED28  Density between head and tail  MDT-29  K08E3.8 MED29 Med2a Density between head and tail  MDT-30 PQN-38 F44B9.7 MED30  Density between head and tail  MDT-31  F32H2.2 MED31 Med31/Soh1 Middle CDK-8  F39H11.3 CDK8 Cdk8/Srb10/Ssn3/Ume5 Kinase CIC-1  H14E04.5 CycC CycC/Srb11/Ssn8/Ume3 Kinase       aWeak sequence homology (Bourbon 2008).  46   Figure 1.1 Yeast and human Mediator complex architecture. Left: Yeast Mediator complex defined by cryo-EM with molecular tags, and guided docking of X-ray crystallographic structures (Tsai et al. 2013, 2014). Right: Human Mediator complex defined by cryo-EM and co-immunoprecipitation analyses. Highly conserved subunits are shown in analogous positions to their yeast orthologs. Position of MED26 was determined by cryo-EM with a molecular tag. Positions of other subunits are inferred from their biochemical interactions with other Mediator subunits (Tsai et al. 2013, 2014). 47   Figure 1.2 Mediator interactions with Pol II, chromatin modifiers, GTFs, elongation factors, and sequence-specific TFs. Physical interactions identified for yeast, human, C. elegans or Drosophila Mediator subunits are shown. For references, see Section 1.1.3. Chromatin modifiers: CREBBP, G9a, GCN5L & TRRAP, PAF, RNF20/40. GTFs: TFIID, TFIIH. Elongation factors and cleavage factors: CF1, P-TEFb, SEC. Trancription factors: !-catenin, E2F1, Elk1, FOXO1, Gal4, Msn2, NHRs, NICD, Oaf1, p73, Pdr1, Phd1, SBP1, SKN-1/Nrf2, SMADs, SREBP, STAT1, Ste12. 48    Figure 1.3 Overview of the biological activities of Mediator subunits in C. elegans. The figure summarizes the roles of C. elegans Mediator subunits in developmental and physiological pathways. The architecture of Mediator is based on structural and biochemical studies of yeast and human Mediator (Tsai et al. 2013, 2014). Subunits labeled with a dashed outline do not appear to have a C. elegans ortholog. In cases where the homology between yeast and metazoan Mediator subunits is controversial, both the C. elegans and the yeast names are listed (e.g. MDT-24/MED5). Putative functions identified in large-scale genetic screens only (i.e. without further experimental validation) are not listed.    MDT-6MDT-22MDT-8MDT-18MDT-20MDT-11MDT-19MDT-10MDT-21MDT-4MDT-9MDT-7MDT-31MDT-1.1MDT-27/MED3MDT-29/MED2MDT-15MDT-16MDT-24/MED5Head moduleMiddle moduleTail moduleKinase moduleMDT-26MDT-30MDT-28MDT-25MDT-23MDT-13MDT-12CIC-1CDK-8MDT-17MDT-14EGFR signalingWnt signalingCell cycle quiescenceEmbryonic viabilityMuscle developmentAxon guidanceLipid metabolismOxidative stress responsesXenobiotic & heavy metaldetoxi!cationImmune responsesNo known function49   Figure 1.4 MDT-12 is a regulatory hub with links to human disease. C. elegans mdt-12 interacts genetically with multiple signaling pathways, indicating a role as a regulatory hub. In addition, mdt-12 interacts genetically with several additional cellular processes, implying a role as a general buffer against genetic perturbations. Similarly, human MED12 mutations are implicated in multiple developmental diseases or somatic tumors and are associated with perturbed cell signaling. Asterisks (*) indicate genetic interactions with pathways/processes that were identified in a genetic screen (Lehner et al. 2006) but have not been further validated. IEG: immediate-early genes. ID: intellectual disability.       50  Chapter 2: The Mediator kinase module restrains epidermal growth factor receptor signaling and represses vulval cell fate specification in Caenorhabditis elegans  2.1  Synopsis  Cell signaling pathways that control proliferation and determine cell fates are tightly regulated to prevent developmental anomalies and cancer. TFs and coregulators are important effectors of signaling pathway output, as they regulate downstream gene programs. In Caenorhabditis elegans, several subunits of the Mediator transcriptional coregulator complex promote or inhibit vulva development, but pertinent mechanisms are poorly defined. Here, I show that Mediator’s dissociable Cyclin Dependent Kinase 8 (CDK8) Module (CKM), consisting of cdk-8, cic-1/Cyclin C, mdt-12/dpy-22, and mdt-13/let-19, is required to inhibit ectopic vulval cell fates downstream of the epidermal growth factor receptor (EGFR)-Ras-extracellular signal-regulated kinase (ERK) pathway. cdk-8 inhibits ectopic vulva formation by acting downstream of mpk-1/ERK, cell autonomously in vulval cells, and in a kinase-dependent manner. I also provide evidence that the CKM acts as a corepressor for the Ets-family TF LIN-1, as cdk-8 promotes transcriptional repression by LIN-1. In addition, I find that CKM mutation alters Mediator subunit requirements in vulva development: the mdt-23/sur-2 subunit, which is required for vulva development in wild-type worms, is dispensable for ectopic vulva formation in CKM mutants, which instead display hallmarks of unrestrained Mediator tail module activity. I propose a model whereby the CKM controls EGFR-Ras-ERK transcriptional output by corepressing LIN-1 and by fine-tuning Mediator specificity, thus balancing transcriptional 51  repression vs. activation in a critical developmental signaling pathway. Collectively, these data offer an explanation for CKM repression of EGFR signaling output and ectopic vulva formation and provide the first evidence of Mediator CKM-tail module subunit crosstalk in animals.    2.2 Background 2.2.1 Transcriptional regulation by the CDK8 Kinase Module  The Mediator complex consists of ~30 subunits that assemble into four modules: the head, middle, tail and the CDK8 kinase module (CKM). The CKM consists of enzymatic subunits Cyclin Dependent Kinase 8 (CDK8), Cyclin C, and structural subunits MED12, and MED13 that tether the CKM to core Mediator (Tsai et al. 2013). CKM subunits regulate many transcriptional programs important for development and/or tumorigenesis, often by directly binding to and influencing the activity of key TFs (e.g. !-catenin, Notch, etc.) (Fryer et al. 2004; Donner et al. 2007; Firestein et al. 2008; Zhou et al. 2012). Furthermore, in Saccharomyces cerevisiae, the CKM regulates the activity of the Mediator tail module subunits Med2, Med3, and Med15 (van de Peppel et al. 2005; Gonzalez et al. 2014). However, whether such intra-Mediator signaling effects occur in metazoans and affect e.g. animal development has not yet been tested.  2.2.2 Transcriptional regulation in C. elegans vulva development  Several Mediator subunits including at least one CKM subunit regulate vulva development in C. elegans (Tuck and Greenwald 1995; Singh and Han 1995; Kwon and Lee 2001; Moghal and Sternberg 2003a). The study of cell fate specification in the C. elegans vulva 52  has proven a powerful way to identify the components and regulatory interactions of several evolutionarily conserved signaling pathways, such as epidermal growth factor receptor (EGFR), Notch, and Wnt signaling (Schmid and Hajnal 2015). Thus, this organogenesis event provides an ideal paradigm to study Mediator subunit specificity and cooperation in a metazoan.  C. elegans vulval organogenesis is induced by epidermal growth factor receptor (EGFR) signaling (Schmid and Hajnal 2015), a prominent pathway in animal development that is frequently activated in human cancers (Normanno et al. 2006; Baselga and Swain 2009). The C. elegans vulva develops from six ventral vulva precursor cells (VPCs), named P3.p through P8.p from anterior to posterior (Figure 2.1). The VPCs form an equivalence group, meaning that all six cells are able to adopt the primary (1°) vulval cell fate (producing eight descendants), the secondary (2°) vulval cell fate (producing seven descendants), or the tertiary (3°) non-vulval fate (producing two descendants that fuse with the surrounding hypodermis). A signaling cell in the somatic gonad, called the anchor cell, emits an EGF-like ligand, LIN-3, in close proximity to P6.p (Hill and Sternberg 1992); therefore, LET-23/EGFR and the downstream LET-60/Ras, MPK-1/ Extracellular signal-regulated kinase (ERK) cascade is strongly activated in P6.p (Aroian et al. 1990). MPK-1/ERK activation in P6.p modulates the activity of effector TFs such as the ELK1/Ets-family TF LIN-1 and the FoxB TF LIN-31, thereby specifying the 1° vulval fate in P6.p (Miller et al. 1993; Tan et al. 1998; Jacobs et al. 1998). The neighbouring P5.p and P7.p cells are thought to receive a weaker LIN-3/EGF signal from the anchor cell (Katz et al. 1995) as well as a lateral Notch signal emitted from the 1° cell P6.p, inducing them to adopt a 2° vulval fate (Chen and Greenwald 2004). Located furthest form the anchor cell, P3.p, P4.p, and P8.p do not receive sufficient EGF signal, and adopt the 3° non-vulval cell fate (Sternberg and Horvitz 1986). Mutations that enhance or reduce EGFR or Notch signaling induce ectopic vulval 53  cell fates (Muv, multivulva phenotype) or loss of vulval cell fates (Vul, vulvaless phenotype), respectively (Sternberg and Horvitz 1989). Furthermore, changes in EGFR or Notch signaling pathway activity can be monitored using reporter genes that are expressed strongly in EGFR-driven 1°-fated cells (e.g. egl-17P::CFP; (Yoo et al. 2004)) or in Notch-driven 2°-fated cells (e.g. lip-1P::GFP; (Berset et al. 2001)). Together, these phenotypes and cell fate reporters are thus powerful indicators of EGFR and Notch signaling pathway activity.   Transcriptional regulation is important in maintaining appropriate EGFR signaling pathway output (Figure 2.1). For example, TFs such as LIN-1/Ets and LIN-31/Forkhead are required to repress 1° cell fate specification in VPCs other than P6.p (Miller et al. 1993; Beitel et al. 1995). In addition, multiple chromatin-modifying complexes, encoded by the synthetic Multivulva (synMuv) genes, redundantly repress ectopic lin-3/EGF transcription in the hypodermis and other tissues to inhibit 1° cell fate specification in VPCs other than P6.p (Myers and Greenwald 2005; Cui et al. 2006; Saffer et al. 2011). Furthermore, the Mediator subunits mdt-23/sur-2, mdt-24/lin-25, and mdt-6 promote vulva development, whereas the CKM subunit mdt-12/dpy-22 inhibits vulva development in an anchor cell independent manner (see Section 1.3.1). The mechanism by which mdt-23/sur-2 promotes vulva development has been partially elucidated, as it is a critical coactivator of a target gene downstream of the EGFR signaling pathway, the lag-2 Notch ligand gene (Zhang and Greenwald 2011). The lin-1/Ets effector TF is required to repress the lag-2 gene (Zhang and Greenwald 2011), raising the question of whether and how Mediator and LIN-1 interact to control common target genes. The other three Mediator subunits implicated in vulva development (mdt-6, mdt-12/dpy-22, and mdt-24/lin-25) interact genetically with components of the EGFR signaling pathway, but their mode of action within this pathway, and their functional interactions within the Mediator complex, remain poorly 54  understood. In yeast and cell culture models, CKM subunits interact with multiple TFs and chromatin modifiers, and regulate the activity of core Mediator subunits (see Section 1.1.3). Thus, I anticipated that studying CKM function in the C. elegans vulva would shed light on its regulatory interactions with TFs and other Mediator subunits in vivo in metazoans.  Here, I used the vulva organogenesis paradigm to study the requirements of all four CKM subunits in this process and to interrogate their functional interactions with other transcriptional regulators, including the synMuv genes, the key TFs lin-1/Ets and lin-31/Forkhead, and the Mediator subunit mdt-23/sur-2, an essential effector of EGFR signaling output. I show that all four CKM subunits inhibit ectopic vulval cell fates in C. elegans. I demonstrate that the CKM catalytic subunit cdk-8 acts downstream of let-23/EGFR and mpk-1/ERK in VPCs, in a kinase-dependent manner. My data implicate cdk-8 as a corepressor for the LIN-1/Ets repressive TF to inhibit EGFR signaling-induced transcription. Furthermore, my data indicate that vulval induction in CKM mutants is independent of the mdt-23/sur-2 coactivator, and instead requires the Mediator tail module subunits mdt-15, mdt-27 and mdt-29 for induction of ectopic vulval cell fates.   55   Figure 2.1 Transcriptional regulators in C. elegans vulval induction. The C. elegans vulva is derived from an equivalence group consisting of six vulva precursor cells (VPCs), named P3.p through P8.p from anterior to posterior (left to right in top panel). Localized LIN-3/EGF signal from the anchor cell (AC) in the somatic gonad activates a LET-23/EGFR-LET-60/Ras-MPK-1/ERK signaling cascade strongly in P6.p. ERK activation modulates TF activity in the nucleus (only LIN-1 is shown here for simplicity), leading to induction of the 1° cell fate. In P5.p and P7.p, weak LIN-3/EGF signal, combined with lateral Notch signaling from P6.p (not depicted), instead produces the 2° cell fate. In P3.p, P4.p and P8.p, the EGFR signaling cascade is not activated by LIN-3/EGF, and cells adopt the non-vulval 3° cell fate. Transcriptional regulators that impinge on the EGFR signaling pathway are critical for correct vulval cell fate specification: e.g. the MDT-23/SUR-2 Mediator subunit is a critical activator of EGFR signaling-induced transcription, the SynMuv transcriptional corepressor complexes are required to inhibit ectopic lin-3/EGF transcription in the hypodermis (Hyp7) surrounding the VPCs, and the MDT-12/DPY-22 Mediator subunit is required to inhibit vulva development by mechanisms that remain unclear (dashed arrow). The GTPase activating protein GAP-1 that negatively regulates LET-60/Ras activity post-translationally is also shown.     56  2.3 Results 2.3.1 cdk-8-dependent transcripts overlap with targets of a synMuv gene  To define the role of the CKM in metazoan development, I compared transcriptional profiles of developmentally synchronized L4 larval stage cdk-8(tm1238) null mutants (Figure 2.2) to wild-type N2 worms using microarrays. I found that 829 genes were upregulated and 461 genes were downregulated more than two-fold in cdk-8 null mutants, representing ~6.7% of C. elegans protein-coding genes. To identify cdk-8-dependent gene programs, I compared our lists of cdk-8 regulated genes to other gene lists using EASE (Hosack et al. 2003; Engelmann et al. 2011). The top hit among genes upregulated in cdk-8 mutants was a set of genes upregulated in lin-35/Retinoblastoma (RB) synMuv gene mutants (Kirienko and Fay 2007), and lin-35-repressed genes also overlapped significantly with genes downregulated in cdk-8 mutants (Figure 2.2B). Importantly, the mRNA levels of lin-35 and the efl-1/dpl-1 TF heterodimer that is repressed by LIN-35 were not altered in cdk-8 mutants (Figure 2.2C), indicating that cdk-8 does not affect lin-35 target gene expression by altering the abundance of lin-35 or its partners. Together, these data suggest that cdk-8 could act in parallel to lin-35 as they regulate similar gene sets, although direct action of CDK-8 at these promoters has not yet been established.  57   Figure 2.2 cdk-8-dependent transcripts overlap with targets of a transcriptional corepressor in the EGFR-Ras-ERK pathway.  (A) qPCR analysis of cdk-8 mRNA levels in cdk-8 mutants relative to wild type (n=3, error bars represent standard error of the mean (SEM)). (B) Overlap of cdk-8 target genes with lin-35/RB repressed genes. P-value determined by Fisher’s exact test. (C) qPCR analysis of mRNA levels in cdk-8 mutants relative to wild type (n=3; error bars represent SEM; n.s. = not significant, Wilcoxon signed rank test by method of Pratt).  2.3.2 cdk-8 represses EGFR signaling-dependent primary vulval cell fate specification  I next investigated whether cdk-8, like mdt-12/dpy-22 (Moghal and Sternberg 2003a), also represses vulval induction. Indeed, cdk-8 and cic-1(tm3740) null mutants displayed a low penetrance Muv phenotype, as measured both by VPC induction analysis in L4 animals (Table 2.1) and by scoring the occurrence of ectopic vulval protrusions in adult worms (Figure 2.3A; see statistical comparisons between L4 and adult Muv scores, Table 2.2). cdk-8 and cic-1 appeared to function together in vulva formation, as cdk-8; cic-1 double mutants showed no 58  significant increase in Muv penetrance compared to either single mutant (Figure 2.3A). I then tested if the cdk-8 mutant Muv phenotype was associated with ectopic EGFR signaling-induced 1° vulval cell fates using an egl-17P::CFP reporter (arIs92; (Yoo et al. 2004)). In wild-type worms, I observed strong egl-17P::CFP expression in the 1° cell descendants, P6.px, and occasional weak expression in the 2° cell descendants, P5.px or P7.px (Figure 2.3B), as reported (Yoo et al. 2004). cdk-8 mutants expressed egl-17P::CFP strongly in P6.px and weakly in P5.px and P7.px, like wild type (Figure 2.3B). However, some cdk-8 mutants exhibited egl-17P::CFP expression in P5.px or P7.px that was equal in intensity to the expression level in the 1° cell descendants P6.px, or exhibited ectopic induction of egl-17P::CFP in VPCs that normally adopt the non-vulval fate (Figure 2.3B). The ectopic expression of egl-17::CFP suggested that the 1˚cell fate had been derepressed in presumptive 2˚ or non-vulval cells. This reflects that the low penetrance Muv phenotype of cdk-8 mutants is caused in part through derepressed ERK signaling output.     59  Table 2.1 VPC induction scores and Muv/Vul penetrance in L4 animals (20°C)  Genotype VPC induction ± SEM % Muv L4a % Vul L4b % WT L4 Vulva n  N2 3.00 ± 0.00 0 0 100 15 CKM cdk-8(tm1238) 3.02 ± 0.02 2 0 98 50 mdt-13(mn19) 2.96 ± 0.07 15 27 65 26 SynMuv lin-15A(n767) 3.00 ± 0.00 0 0 100 18 cdk-8(tm1238); lin-15A(n767) 3.20 ± 0.08 21 0 79 28 lin-15B(n744) 3.00 ± 0.00 0 0 100 12 cdk-8(tm1238); lin-15B(n744) 3.07 ± 0.05 14 0 86 14 N2 + EV RNAi 3.00 ± 0.00 0 0 100 48 N2 + trr-1 RNAi 3.00 ± 0.00 0 0 100 15 cdk-8(tm1238) + EV RNAi 3.00 ± 0.00 0 0 100 37 cdk-8(tm1238) + trr-1 RNAi 3.02 ± 0.02 4 0 96 26 gap-1(ga133) 3.00 ± 0.00 0 0 100 15 cdk-8(tm1238); gap-1(ga133) 3.03 ± 0.02 7 0 93 29 let-23 let-23(sy97) 0.00 ± 0.00 0 96 4 23 cdk-8(tm1238); let-23(sy97) 2.44 ± 0.27 0 37 63 8 mpk-1 mpk-1(oz140) 2.03 ± 0.17 0 80 20 15 cdk-8(tm1238); mpk-1(oz140) 2.95 ± 0.03 0 10 90 15 mdt-13(mn19); mpk-1(oz140) 2.85 ± 0.27 23 31 46 13 lin-1 lin-1(n1790) 2.98 ± 0.08 20 25 65 20 cdk-8(tm1238); lin-1(n1790) 3.58 ± 0.16 67 0 34 12 mdt-13(mn19); lin-1(n1790) 5.33 ± 0.15 100 0 0 12 N2 + lin-1 RNAi 3.10 ± 0.06 7 0 93 40 cdk-8(tm1238) + lin-1 RNAi 3.25 ± 0.06 31 0 69 61 lin-31 lin-31(n301) 3.65 ± 0.14 73 20 13 30 cdk-8(tm1238); lin-31(n301) 2.46 ± 0.23 33 53 30 30 mdt-23 mdt-23 (ku9) 1.13 ± 0.16 0 100 0 23 mdt-13(mn19); mdt-23(ku9) 3.57 ± 0.21 64 18 23 22 mdt-15 N2 + mdt-15 RNAi 3.00 ± 0.00 0 0 100 33 lin-1(n1790) + EV RNAi 3.00 ± 0.12 17 19 70 46 lin-1(n1790) + mdt-15 RNAi 3.01 ± 0.14 18 22 67 45 a % L4 animals with ectopic vulval invagination at P3.p, P4.p or P8.p. b % L4 animals with vulval induction <3.0 at P5.p-P7.p. Note: it is possible for an animal to be scored as both Vul and Muv.   60  Table 2.2 Muv penetrance in adult animals.  % Muv adultsa  20°C n 23°C n N2 0.00b 399 0.00 402 cdk-8(tm1238) 0.72b 835 0.70 1278 cic-1(tm3740) 1.23c 163 0.83 121 cdk-8(tm1238); cic-1(tm3740)   1.33 600 lin-15A(n767) 0.00b 151 0.00 152 cdk-8(tm1238); lin-15A(n767) 13.91b 151 29.41 119 cic-1(tm3740); lin-15A(n767) 12.56c 207 28.40 162 lin-15B(n744) 0.00b 164 0.00 109 cdk-8(tm1238); lin-15B(n744) 6.58b 76 5.84 154 N2 + EV1 RNAi 0.10b 955 0.00 499 N2 + trr-1 RNAi 0.00b 743 0.66 455 cdk-8(tm1238) + EV RNAi 0.90b 666 1.53 589 cdk-8(tm1238) + trr-1 RNAi 2.48b 968 4.14 798 gap-1(ga133) 0.00b 931 0.00 148 cdk-8(tm1238); gap-1(ga133) 9.91b 111 8.41 440 Sib: cdk-8(tm1238); lin-15A(n767); Ex[cdk-8(+)]   60.67 89 Transgenic: cdk-8(tm1238); lin-15A(n767); Ex[cdk-8(+)]   7.05 227 Sib: cdk-8(tm1238); lin-15A(n767); Ex[lin-31P::cdk-8]   39.47 76 Transgenic: cdk-8(tm1238); lin-15A(n767); Ex[lin-31P::cdk-8]   8.24 85 Sib: cdk-8(tm1238); lin-15A(n767);Ex[dpy-7P::cdk-8]   28.51 228 Transgenic: cdk-8(tm1238); lin-15A(n767);Ex[dpy-7P::cdk-8]   22.64 212 cdk-8(tm1238); lin-15A(n767); Ex[cdk-8(KD)] 41.46c 41   N2 + lin-1 RNAi 5.38b 1505 7.29 905 cdk-8(tm1238) + lin-1 RNAi 27.19b 526 41.46 410 mdt-12(os38)   49.32 296 mdt-13(mn19) 20.92b 196 62.59 425 mdt-13(mn19); lin-15A(n767)   72.55 459 lin-15B(n374)   0.00 many mdt-13(mn19); lin-15B(n374)   69.70 99 lin-1(n1790) 10.04b 259 1.55 192 mdt-13(mn19); lin-1(n1790) 96.97b 66 95.45 44 N2 + mdt-15 RNAi 0.00b 395   N2 + mdt-27 RNAi 0.00c 641   61   % Muv adultsa  20°C n 23°C n N2 + mdt-29 RNAi 0.24c 414   N2 + mdt-1.1 RNAi 0.59c 338   mdt-13(mn19) + mdt-15 RNAi 13.28c 256   mdt-13(mn19) + mdt-27 RNAi 15.94c 640   mdt-13(mn19)  + mdt-29 RNAi 9.09c 198   mdt-13(mn19) + mdt-1.1 RNAi 30.54c 203   a % Adults with ectopic vulval protrusion. b No significant difference vs. Muv penetrance in L4 animals at 20°C (Table 1), Fisher’s exact test. c L4 Muv penetrance not determined, no statistical comparison. 1 EV, Empty Vector.    62    63  Figure 2.3 cdk-8 represses vulval cell fates redundantly with synMuv genes. (A) Adult Muv penetrance in cdk-8 and mutants with synMuv genes (n"76). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. cdk-8 mutant or vs. cdk-8 + empty vector (EV), Fisher’s exact test. ND, not determined. See Table 2.2 for raw data.  (B) Micrographs show wild-type or cdk-8 mutant worms expressing the arIs92[egl-17P::CFP] 1° fate marker. Bracket: Pn.px cells expressing reporter. Asterisk: ectopic reporter expression. Scale bar: 10 µm. The graph displays the percentage of animals (n>50) with ectopic egl-17P::CFP expression (defined as expression in P3.p/P4.p/P8.p, or expression in P5.p/P7.p of equal intensity to P6.p) or weak P5.p/P7.p expression (defined as expression in P5.p/P7.p that is weaker intensity than P6.p). * p < 0.05, Fisher’s exact test. (C) Micrographs show lin-15A and cdk-8; lin-15A mutants expressing the Notch-inducible reporter zhIs4[lip-1P::GFP]. Dashed bracket: P6.px. Solid bracket: P5.px and P7.px. Open circle: loss of expression. Asterisk: ectopic expression. Scale bar: 10 µm. The graph shows the percentage of animals (n"13) with ectopic expression (defined as strong expression in P3.p, P4.p, or P8.p) or loss of expression (defined as weak or no expression in P5.p or P7.p) of the lip-1P::GFP reporter.* p < 0.05, Fisher’s exact test.  2.3.3 cdk-8 interacts genetically with the synMuv repressors of lin-3/EGF transcription  The CKM subunit mdt-12/dpy-22 was previously shown to act downstream of let-23/EGFR to modulate vulva development (Moghal and Sternberg 2003a). However, the developmental roles of all four CKM subunits are not equivalent (Loncle et al. 2007), and our gene expression profiling suggested that cdk-8 might interact genetically with the synMuv genes to alter vulval cell fate decisions. As synMuv genes encode three redundant chromatin-modifying complexes, a Muv phenotype results when genes in any two complexes are simultaneously mutated (Myers and Greenwald 2005; Cui et al. 2006; Saffer et al. 2011). I therefore studied the simultaneous inactivation of cdk-8 or cic-1 and representative synMuv class A (lin-15A), B (lin-15B), or C (trr-1) genes. Mutation or RNA interference (RNAi) depletion of all representative synMuv genes enhanced the Muv phenotype of cdk-8 mutants (Figure 2.3A, 64  Table 2.1). In addition, loss of the Ras GTPase-activating protein gene gap-1, which causes weak LET-60/Ras derepression, also enhanced the cdk-8 mutant Muv penetrance (Figure 2.3A, Table 2.1). Our microarray analysis did not reveal significant downregulation of any known synMuv gene transcripts in cdk-8 mutants, indicating that cdk-8 does not simply regulate synMuv mRNA levels. Taken together, these results suggest that cdk-8 and cic-1 act redundantly with synMuv genes to repress vulval cell fates.  I observed adjacent VPCs expressing a 1° cell fate marker in cdk-8 mutants (Figure 2.3B), which is uncharacteristic of synMuv gene mutants. This phenotype instead suggests defects in Notch signaling, which inhibits adjacent 1° fates by inducing EGFR signaling inhibitor genes (Sternberg 1988; Berset et al. 2001; Yoo et al. 2004; Chen and Greenwald 2004). Therefore, I examined the expression of the Notch-inducible EGFR signaling inhibitor, lip-1/ERK phosphatase, using a lip-1P::GFP reporter (zhIs4; (Berset et al. 2001)). I used the sensitized lin-15A mutant background to increase the frequency of ectopic VPC induction events. lin-15A single mutants expressed lip-1P::GFP strongly in P5.px and P7.px, but expression was weak or absent in other Pn.px cells (Figure 2.3C), as reported for wild-type worms (Berset et al. 2001). In contrast, some cdk-8; lin-15A mutants lost strong lip-1P::GFP expression in P5.px and P7.px, consistent with loss of the 2° fate (Figure 2.3C). Furthermore, some cdk-8; lin-15A mutants ectopically expressed lip-1P::GFP strongly in non-vulval P3.p, P4.p, or P8.p, suggesting ectopic 2° fates (Figure 2.3C). Thus, cdk-8 mutants display hallmarks of both down- and upregulated Notch signaling, suggesting that CDK-8 action on the Notch pathway may occur indirectly via the EGFR signaling pathway upstream.  65  2.3.4 cdk-8 regulates lin-3/EGF transcription in the anchor cell  I next tested if cdk-8 acts redundantly with the synMuv genes to repress lin-3/EGF transcription (Cui et al. 2006; Saffer et al. 2011). As the synMuv genes act primarily in the hypodermis to repress lin-3 transcription (Myers and Greenwald 2005; Saffer et al. 2011), derepression of lin-3 in synMuv double mutants is detectable by quantitative PCR in whole-animal preparations (Cui et al. 2006). I used Taqman quantitative PCR analysis to quantify whole-animal lin-3 mRNA levels in cdk-8, lin-15A, and lin-15B single mutants, and in cdk-8; lin-15A and cdk-8; lin-15B double mutants; the lin-15AB(n309) mutant served as a positive control, as it is known to upregulate lin-3 expression (Figure 2.4A) (Cui et al. 2006). Compared to wild-type worms, cdk-8 single mutants, cdk-8; lin-15A double mutants, and cdk-8; lin-15B double mutants showed no statistically significant change in lin-3 mRNA levels (Figure 2.4A). Thus, the enhanced Muv penetrance of cdk-8; lin-15A and cdk-8; lin-15B mutants compared to cdk-8 single mutants (Figure 2.3A) likely does not arise from hypodermal lin-3 derepression.   Next, I investigated if cdk-8 is required to regulate lin-3 transcription in the signal-emitting anchor cell, which would not be detectable in whole-animal quantitative PCR analysis. In line with this hypothesis, I observed expression of a transcriptional cdk-8P::GFP reporter (hdEx508; (Steimel et al. 2013)) in the anchor cell (Figure 2.4B). To assess lin-3 transcription in the anchor cell alone, I used a lin-3 anchor cell-specific enhancer element (ACEL) GFP reporter (syIs107; (Hwang and Sternberg 2004)). I detected a small but significant upregulation of lin-3 ACEL reporter expression in cdk-8 mutants compared to wild-type worms at the L3 larval stage (Figure 2.4C), suggesting that cdk-8 is required to repress lin-3/EGF transcription in the anchor cell. 66    Figure 2.4 cdk-8 represses lin-3/EGF transcription via an anchor cell-specific enhancer element. (A) qPCR analysis of lin-3 mRNA levels in cdk-8 single mutants and mutants with synMuv genes, relative to wild-type worms. lin-15AB mutant is shown as a positive control (hatched bar). Error bars represent standard error of the mean (SEM, n=3 independent trials). No statistically significance differences, Wilcoxon signed rank test by method of Pratt. (B) hdEx508[cdk-8P::GFP] expression in the anchor cell (arrow) during early vulval induction. Top: VPCs divided once (Pn.px). Middle: VPCs divided twice (Pn.pxx). Bottom: Invagination of Pn.pxx epithelium. The fluorescent signal visible near VPCs localizes to neuron cell bodies. Scale bar: 10 µm. (C) Average fluorescence intensity of syIs107[lin-3ACEL::GFP] in anchor cell of wild-type worms and cdk-8 mutants. * p < 0.05 vs. N2, t-test. A.U., arbitrary units.    67  2.3.5 cdk-8 acts downstream of mpk-1/ERK to regulate vulval induction cell autonomously  As the effect size of cdk-8 loss on lin-3/EGF anchor cell expression was small, and as mdt-12/dpy-22 has been found to act downstream of let-23/EGFR (Moghal and Sternberg 2003a), I next investigated cdk-8’s role in the EGFR signaling pathway downstream of lin-3. I conducted genetic epistasis analyses with loss-of-function alleles of EGFR, let-23(sy97), and ERK, mpk-1(oz140). let-23(sy97) is a strong loss-of-function allele that causes a highly penetrant Vul phenotype (Figure 2.5A, Table 2.1), and causes insensitivity to increased lin-3/EGF transcription as in lin-15AB mutants (Aroian and Sternberg 1991), due to blockade of the EGFR-Ras-ERK pathway. I note that one presumed let-23(sy97) mutant worm (out of 23 worms total) exhibited wild-type vulva development; however, as I isolated let-23(sy97) homozygous mutants from balanced let-23(sy97)/+ heterozygotes, it is possible that this animal was incorrectly identified as a homozygote when in fact it was a heterozygote. cdk-8 inactivation significantly rescued the Vul phenotype of let-23(sy97) single mutants (Figure 2.5A, Table 2.1), suggesting that cdk-8 acts downstream of let-23/EGFR. mpk-1(oz140) is a loss-of-function allele that causes a strong but not fully penetrant Vul phenotype (Figure 2.5A, Table 2.1). cdk-8 inactivation also significantly rescued the Vul phenotype of mpk-1(oz140), in line with a role downstream of mpk-1/ERK. Due to the partial nature of the mpk-1(oz140) Vul phenotype I cannot completely rule out the possibility that cdk-8 acts upstream of mpk-1, e.g. at the level of lin-3/EGF transcriptional regulation; however, as I found that cdk-8 acts downstream of a strong let-23/EGFR loss-of-function allele, which is insensitive to increased lin-3/EGF transcription, I favour the possibility that cdk-8 acts downstream of let-23/EGFR and mpk-1/ERK. As in any epistasis analysis, I also cannot rule out the possibility that cdk-8 acts parallel to the EGFR-Ras-68  ERK pathway; however, for reasons discussed in Section 2.4.2, I favour the interpretation that cdk-8 action in e.g. Notch or Wnt signaling is not a primary driver of the vulva development defects observed in cdk-8 mutants. Overall, these data suggest that cdk-8 primarily acts downstream of mpk-1/ERK to repress vulval cell fate specification by the EGFR signaling pathway.  cdk-8’s position downstream of mpk-1/ERK suggested a cell-autonomous role in VPCs (Figure 2.1). Nuclear expression of the MDT-12/DPY-22 protein in VPCs and in the anchor cell had previously been observed, and gonad-independent vulval induction in mdt-12/dpy-22 mutants suggested an anchor cell-independent role for MDT-12/DPY-22 (Moghal and Sternberg 2003a). However, the tissue-specific requirements for MDT-12/DPY-22 in VPCs vs. the hypodermis, two important drivers of VPC cell fate (Fay and Yochem 2007; Schmid and Hajnal 2015), had not been tested. I used the lin-15A sensitized background to analyze tissue-specific requirements for cdk-8 in VPCs vs. the hypodermis. First, I demonstrated that a transgene expressing cdk-8 from its own promoter (cdk-8(+)) rescued the cdk-8; lin-15A mutant Muv phenotype compared to non-transgenic siblings (Figure 2.5B). This transgene appeared to be broadly expressed and functional, as it rescued two additional phenotypes observed in cdk-8 mutants: decreased body length (Dumpy phenotype, Dpy) and the low brood size of the cdk-8 mutant (Figure 2.5C, D). Expression of cdk-8 from the lin-31 promoter (lin-31P::cdk-8), which drives transgene expression in Pn.ps and some neurons (Tan et al. 1998; Kishore and Sundaram 2002), also significantly rescued the cdk-8; lin-15A Muv phenotype (Figure 2.5B). In contrast, expression of cdk-8 from the hypodermis-specific dpy-7 minimal promoter (dpy-7P::cdk-8) (Gilleard et al. 1997) did not significantly rescue the Muv penetrance of cdk-8; lin-15A mutant worms (Figure 2.5B), although it was able to rescue the Dpy phenotype (Figure 2.5C). 69  Unexpectedly, the lin-31P::cdk-8 transgene partially rescued the cdk-8; lin-15A Dpy phenotype compared to non-transgenic worms, albeit to a lesser extent than cdk-8(+) or dpy-7P::cdk-8 (Figure 2.5C). In sum, these experiments provide evidence that cdk-8 is required cell-autonomously in VPCs but not in the hypodermis to suppress ectopic vulval induction.   Figure 2.5 cdk-8 acts cell autonomously downstream of mpk-1/ERK. (A) L4 Vul penetrance in cdk-8, cdk-8; let-23/EGFR, and cdk-8; mpk-1/ERK mutants (n"8). **** p < 0.0001, Fisher’s exact test. See Table 2.1 for raw data. (B) Tissue specificity of Muv phenotype in cdk-8; lin-15A mutant 70  adults expressing wild-type cdk-8 driven by its own promoter cdk-8(+), the Pn.p promoter lin-31P, or the hypodermal promoter dpy-7P, compared to non-transgenic siblings (Sib) in each strain (n"76). **** p < 0.0001 vs. non-transgenic sibling, Fisher’s exact test. See Table 2.2 for raw data. (C) Genetic rescue of cdk-8 mutant Dpy phenotype (n>150). **** p < 0.0001 vs. cdk-8 mutant, Fisher’s exact test. (D) Genetic rescue of cdk-8 mutant brood size. **** p < 0.0001, t-test. n.s. not significant.  2.3.6 cdk-8 kinase activity is required to repress vulval induction  I next addressed how cdk-8 functions downstream of mpk-1/ERK. First, I studied CDK-8’s kinase requirement using a kinase-dead CDK-8(D182A) transgene (CDK-8(KD)). The D182A mutation is homologous to the previously reported D173A mutation in human CDK8 and the D290A mutation in budding yeast Cdk8, both of which result in loss of enzymatic activity (Liao et al. 1995; Gold and Rice 1998); however, I note that the kinase activity of C. elegans CDK-8(D182A) has not been tested directly. CDK-8(KD) did not rescue the cdk-8; lin-15A mutant Muv phenotype, and actually enhanced Muv penetrance (Figure 2.6), suggesting that kinase activity is required for transgenic rescue of the Muv phenotype of cdk-8 null mutants.    Figure 2.6 cdk-8 kinase activity is required to repress vulval induction. Adult Muv penetrance in cdk-8; lin-15A mutants expressing kinase dead (KD) cdk-8, compared to non-transgenic cdk-8; lin-15A (n"41). *** p < 0.001 vs. non-transgenic, Fisher’s exact test. See Table 2.2 for raw data. 71   2.3.7 cdk-8 promotes lin-1/Ets repressor activity  Next, I investigated TFs that repress VPC induction, i.e. the ELK1/Ets-family TF LIN-1 and the Forkhead-family TF LIN-31 (Miller et al. 1993; Beitel et al. 1995). I hypothesized that the CKM may coregulate LIN-1 and/or LIN-31, and thus tested their genetic interactions with cdk-8. Unexpectedly, cdk-8 suppressed the lin-31 null mutant Muv phenotype (Table 2.1), suggesting that in the absence of LIN-31, cdk-8 promotes vulval induction, perhaps through coactivation of an alternative TF. Albeit interesting, I did not investigate lin-31 further for the purposes of this study. In contrast, cdk-8 mutation strongly enhanced the low Muv penetrance caused by lin-1 RNAi depletion (Figure 2.7A, Table 2.1). To corroborate the RNAi experiment, I also studied the lin-1(n1790) mutant, which displays both reduction-of-function (ectopic vulval induction of P3.p, P4.p and P8.p due to reduced lin-1 mRNA levels) and gain-of-function (reduced vulval induction in P5.p-P7.p due to impaired LIN-1–ERK binding) phenotypes (Jacobs et al. 1998). As seen in lin-1 RNAi worms, loss of cdk-8 significantly enhanced the Muv penetrance of the lin-1(n1790) mutant (Figure 2.7B, Table 2.1). Together, these results suggest that residual LIN-1 requires cdk-8 for efficient repression of vulval induction.  To test if cdk-8 promotes transcriptional repression by LIN-1, I investigated whether the direct LIN-1 target gene lag-2 (Zhang and Greenwald 2011) was derepressed in cdk-8 mutants. In wild-type animals, a lag-2P(min)::YFP minimal promoter reporter (arEx1098) is induced by EGFR signaling in P6.p, whereas in lin-1 null mutants, it is ectopically induced in additional VPCs (Zhang and Greenwald 2011). I again used the lin-15A sensitized background to study cdk-8 requirements for lag-2P(min) repression. In all lin-15A single mutant animals examined, lag-2P(min)::YFP exhibited a wild-type expression pattern, as expected (n=29;Figure 2.7C). In 72  contrast, in cdk-8; lin-15A mutants, lag-2P(min)::YFP was occasionally ectopically expressed in VPCs other than P6.p (in 3/41 animals; Figure 2.7C). Thus, cdk-8 is partially required to repress a direct LIN-1 target gene. Taken together with the requirement for cdk-8 for lin-1 repressor function in vulval induction, these data suggest that CDK-8 may function as a LIN-1 corepressor, perhaps acting redundantly with other corepressors.    Figure 2.7 CDK-8 is a LIN-1/Ets corepressor. (A) Adult Muv penetrance in cdk-8 mutants on empty vector (EV) or lin-1/Ets RNAi (n"410) **** p < 0.0001 vs. cdk-8 + empty vector (EV), †††† p < 0.0001 vs. N2 + lin-1 RNAi, Fisher’s exact test. See Table S2 for raw data. (B) L4 Muv penetrance in cdk-8; lin-1(n1790) mutants (n"12). **** p < 0.0001 vs. cdk-8, † p < 0.05 vs. lin-1(n1790), Fisher’s exact test. See Table 1 for raw data.  (C) Wild-type expression pattern of arEx1098[lag-2P(min)::GFP] in lin-15A mutants, and ectopic expression in cdk-8; lin-15A mutants. Bracket: Pn.px. Asterisk: ectopic expression. Scale bar: 10 µm. Number of ectopic expression events over total sample size noted next to genotype. 73   2.3.8 The CKM subunit mdt-13/let-19 represses primary vulval fate specification  Having shown that the enzymatic CKM subunit represses EGFR signaling-induced transcription in the C. elegans vulva, I next investigated whether the structural CKM subunits mdt-12/dpy-22 and mdt-13/let-19 (Tsai et al. 2013) have similar molecular functions. C. elegans mdt-12/dpy-22 represses ectopic vulva formation downstream of let-23/EGFR (Moghal and Sternberg 2003a), but whether and how it affects vulval cell fate specification is not understood. Thus, I investigated the requirements and mechanisms of structural CKM subunits in the EGFR signaling pathway, focusing primarily on mdt-13/let-19.   I first investigated the vulval phenotypes of mdt-12/dpy-22 and mdt-13/let-19 mutants. mdt-13/let-19 mutants exhibited a temperature sensitive Muv phenotype (Figure 2.8A) of much higher penetrance than cdk-8 mutants (Figure 2.3A). I observed a similarly high penetrance Muv phenotype in mdt-12/dpy-22 reduction-of-function mutants (Figure 2.8A). I note that the os38 mutant used in this study shows higher Muv penetrance than the 2-3% Muv penetrance reported for dpy-22(sy622) and dpy-22(sy665) mutants (Moghal and Sternberg 2003a). os38 may cause stronger loss-of-function than these alleles due to truncation closer to the N-terminus and/or the presence of an additional missense mutation (Yoda et al. 2005). I also note that when scoring VPC induction in mdt-13/let-19 mutants at the L4 larval stage, I observed partial Vul phenotypes, as 27% of animals displayed partial loss of induction of P5.p and/or P7.p (Table 2.1). Overall, these results demonstrate that mdt-12/dpy-22 and mdt-13/let-19 are more strongly required than cdk-8 and cic-1 to repress vulval induction, and perhaps that mdt-13/let-19 may also be required for cell fate determination in VPCs that normally adopt the 2° fate. 74   I next tested if mdt-13/let-19 adopts roles similar to cdk-8 in vulva development. mdt-13/let-19 mutants induced egl-17P::CFP expression in 46/47 P6.px cells examined (Figure 2.8B). In addition, mdt-13/let-19 mutants displayed increased proportions of P.5px and P7.px weakly expressing egl-17P::CFP compared to wild-type worms (Figure 2.8B). Furthermore, mdt-13/let-19 mutants displayed strong egl-17P::CFP expression in some P5.px and P7.px cells, or ectopic expression of egl-17P::CFP outside of P5.px–P7.px, suggesting derepression of the 1° fate in these cells (Figure 2.8B). Overall, these data indicated that the Muv phenotype of mdt-13/let-19 mutants was due in part to derepressed ERK signaling output.  In support of a role similar to cdk-8 in regulation of vulval cell fate specification, mdt-13/let-19 interacted genetically with the synMuv genes and with lin-1/Ets. Specifically, mdt-13/let-19 mutants interacted genetically with the class A synMuv transcriptional repressor lin-15A, and the class B synMuv gene lin-15B showed a similar trend (Figure 2.8A). In addition, loss of mdt-13/let-19 significantly enhanced the Muv penetrance of lin-1(n1790) mutant worms (Figure 2.8C, Table 2.1), in line with a role for MDT-13/LET-19 as a LIN-1 corepressor. Thus, like cdk-8, mdt-13/let-19 interacts genetically with transcriptional regulators in the EGFR signaling pathway.  Finally, I investigated the genetic position of mdt-13/let-19 in the EGFR-Ras-ERK pathway. Similarly to cdk-8, loss of mdt-13/let-19 suppressed the mpk-1 loss-of-function Vul phenotype (Figure 2.8D, Table 2.1). Furthermore, the mdt-13/let-19 mutant Muv phenotype appeared epistatic to the mpk-1 mutant Vul phenotype, although this trend was not statistically significant (Figure 2.8D, Table 2.1). Together, these data support a model in which the CKM acts downstream of mpk-1/ERK to inhibit vulval cell fate specification.   75     Figure 2.8 mdt-13/let-19 represses vulval cell fates downstream of mpk-1/ERK. (A) Adult Muv penetrance in mdt-13/let-19 mutants and mutants with representative synMuv genes (n"99). ** p < 0.01 vs. mdt-13/let-19 single mutant, Fisher’s exact test. ND, not determined. See Table 2.2 for raw data. (B) Micrographs show mdt-13/let-19 and mdt-13/let-19; mdt-23/sur-2 mutants expressing the arIs92[egl-17P::CFP] 1° 76  fate marker. Bracket: Pn.px cells expressing reporter. Asterisk: ectopic reporter expression. Scale bar: 10 µm. Graphs show the percentage of animals (n>20) with ectopic egl-17P::CFP expression (defined as expression in P3.p/P4.p/P8.p, or expression in P5.p/P7.p of equal intensity to P6.p) or weak P5.p/P7.p expression (defined as expression in P5.p/P7.p that is weaker intensity than P6.p). * p < 0.05, Fisher’s exact test. (C) Adult Muv penetrance in mdt-13/let-19; lin-1(n1790) mutants (n"44). mdt-13/let-19 single mutant Muv penetrance from panel A is included for reference. *** p < 0.001 vs. mdt-13/let-19 single mutant, ††† p < 0.001 vs. lin-1(n1790) single mutant, Fisher’s exact test. See Table 2.2 for raw data.  (D) L4 Muv and Vul penetrance in mdt-13/let-19; mpk-1/ERK mutants (n"13). p = 0.09 (Muv) and * p < 0.05 (Vul) vs. mpk-1 single mutant, Fisher’s exact test. See Table 2.1 for raw data. (E) L4 Muv and Vul penetrance in mdt-13/let-19; mdt-23/sur-2 mutants (n"22). *** p < 0.001 vs. mdt-13/let-19 single mutant, †††† p < 0.0001 vs. mdt-23/sur-2 single mutant, Fisher’s exact test. See Table 2.1 for raw data.  2.3.9 The CKM restricts the specificity of core Mediator subunits  As several Mediator subunits positively regulate vulva development (Section 1.3.1), I hypothesized that the CKM might function in part by inhibiting these subunits. In wild-type worms, the mdt-23/sur-2 tail module subunit is critical for vulva development downstream of Ras (Singh and Han 1995), and it is required for activation of the EGFR signaling target gene lag-2 (Zhang and Greenwald 2011); therefore, I tested how a mutation in a CKM subunit affected vulval induction in mdt-23/sur-2 mutants. All mdt-23/sur-2 single mutants examined exhibited a Vul phenotype (Figure 2.8E, Table 2.1). VPC induction analysis of mdt-13/let-19 single mutants demonstrated that, in addition to the Muv phenotype, some animals also displayed decreased proliferation of P5.p or P7.p (mild Vul; Figure 2.8E, Table 2.1). Unexpectedly, mdt-13/let-19; mdt-23/sur-2 mutants exhibited a significantly stronger Muv penetrance than mdt-13/let-19 single mutants, and loss of mdt-13/let-19 function significantly suppressed the Vul phenotype of mdt-23/sur-2 single mutants (Figure 2.8E, Table 2.1), 77  suggesting that loss of mdt-13/let-19 derepresses vulval induction independently of mdt-23/sur-2. As seen in mdt-13/let-19 single mutants, mdt-13/let-19; mdt-23/sur-2 double mutants showed strong egl-17P::CFP expression in some P5.px and P7.px cells, or ectopic expression of egl-17P::CFP outside of P5.px–P7.px, suggesting derepression of the 1° fate (Figure 2.8B). Overall, these data indicated that the Muv phenotype of mdt-13/let-19; mdt-23/sur-2 double mutants was due in part to derepressed ERK signaling output. Together, these findings indicate that loss of the CKM allows activation of EGFR signaling-driven cell fate specification independently of mdt-23/sur-2 activity.  My results suggested that the CKM might influence Mediator subunit(s) other than mdt-23/sur-2. As S. cerevisiae Cdk8 inhibits the Mediator tail module triad composed of Med2, Med3, and Med15 (van de Peppel et al. 2005; Gonzalez et al. 2014), I hypothesized that their putative C. elegans orthologs MDT-29, MDT-27, and MDT-15 (Bourbon 2008), might be targets for CKM inhibition. mdt-15 and mdt-29 knockdown had no effect on vulva formation in wild-type animals (i.e. causing neither Muv nor Vul phenotypes and displaying normal VPC induction; Table 2.1), but significantly reduced the Muv penetrance of mdt-13/let-19 mutants (Figure 2.9A); mdt-27 RNAi yielded a similar trend (Figure 2.9A). This effect was specific to the tail module triad, as knockdown of the mdt-1.1 tail module subunit in fact increased the Muv penetrance of mdt-13/let-19 mutants (Figure 2.9A). Furthermore, a requirement for the tail module triad in ectopic vulva formation appeared to be specific to CKM mutants, as mdt-15 RNAi had no effect on ectopic vulva formation in lin-1(n1790) mutants (Figure 2.9B, Table 2.1). Thus, tail module triad activity appears to be derepressed in a CKM mutant, causing aberrant activation of vulval fate specification.   78   Next, I investigated whether the CKM modifies the target gene specificity of the triad. I used qPCR to quantify the expression of cdk-8-repressed genes identified by our microarray analysis in wild-type worms and cdk-8 mutants treated with empty vector (EV), mdt-15, mdt-27, or mdt-29 RNAi. On EV RNAi, seven of nine genes tested were upregulated in cdk-8 mutants compared to wild-type worms, as expected (Figure 2.9C). Upregulation of these cdk-8-repressed genes was strongly attenuated by mdt-15 depletion, whereas mdt-29 knockdown only affected fat-7, and mdt-27 depletion caused no significant changes (Figure 2.9C). Thus, for the genes investigated, induction in cdk-8 mutants appears to specifically require mdt-15, but not the other predicted tail module triad subunits. However, I cannot rule out unequal RNAi efficiency accounting for these differing requirements, although RNAi knockdown of all three genes appeared successful, as I observed partial sterility (not shown) consistent with the essential nature of these genes (Fernandez et al. 2005; Sönnichsen et al. 2005; Taubert et al. 2006). Notably, only two cdk-8-repressed genes, acd-2 and fat-7, displayed mdt-15 and/or mdt-29-dependent activation in wild-type worms (Figure 2.9C). Thus, as seen in the genetic analysis of vulva induction, loss of cdk-8 appears to cause unrestrained tail module activity, i.e. mdt-15 activates novel target genes when cdk-8 is deleted.  Finally, I investigated the molecular cause of unrestrained mdt-15 activity in CKM mutants. Loss of cdk-8 did not alter mRNA levels of any triad subunits (Figure 2.9D). Western blot analysis showed elevated MDT-15 protein levels in cdk-8 mutants compared to wild type (Figure 2.9E). Taken together, these results demonstrate that cdk-8 is required for post-transcriptional regulation of MDT-15.   79   Figure 2.9 The CKM inhibits activation of vulval induction by the mdt-15, mdt-27, mdt-29 triad. 80  (A) Adult Muv penetrance in mdt-13/let-19 mutants on mdt-15, mdt-27, or mdt-29 triad subunit RNAi or mdt-1.1 non-triad subunit RNAi (n"198). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. mdt-13/let-19 + empty vector (EV), Fisher’s exact test. See Table 2.2 for raw data. (B) L4 Muv penetrance in lin-1(n1790) mutants on mdt-15 RNAi (n"45). No statistically significant difference, Fisher’s exact test. See Table 2.1 for raw data. (C) qPCR analysis of mRNA levels of cdk-8-repressed genes upon mdt-15, mdt-27, or mdt-29 RNAi. Error bars represent SEM, n = 3 independent trials. * p < 0.05, ** p < 0.01 vs. cdk-8 + empty vector (EV); † p < 0.05, †† p < 0.01, ††† p < 0.001, †††† p < 0.0001 vs. N2 + empty vector (EV), unpaired t-test. (D) qPCR analysis of mRNA levels in cdk-8 mutants relative to wild type (n=3, error bars represent SEM, n.s. not significant by Wilcoxon signed-rank test, method of Pratt). (E) #-MDT-15 Western blot in wild-type vs. cdk-8 mutants, with #-GAPDH loading control. Representative immunoblot from one of three trials.   2.4 Discussion  EGFR signaling is critical for cell proliferation and cell fate determination in animal development. Several Mediator subunits positively or negatively regulate EGFR signaling-driven developmental processes (Section 1.3.1), but pertinent mechanisms remain incompletely understood. Here, I used the well-characterized vulva development paradigm in C. elegans to delineate the role of the Mediator CKM module. My results suggest a model whereby the CKM acts within the vulval precursor cells, in a kinase-dependent manner, to fine-tune EGFR transcriptional output by modulating two transcriptional regulators: the key downstream TF LIN-1/Ets, and core Mediator (Figure 2.10). This model is based on four key observations: First, I demonstrate that the primary site of action for the CKM is in the VPCs, as cdk-8 and mdt-13 repress vulva formation downstream of mpk-1/ERK, a key component of the EGFR signaling cascade inside VPCs, and cdk-8 expression in VPCs is sufficient for this repression. Second, 81  cdk-8 repression of ectopic vulva formation is kinase-dependent. Third, the CKM appears to act as a corepressor of the Ets-family TF LIN-1, as loss of cdk-8 or mdt-13 enhances the ectopic vulval induction caused by lin-1 reduction-of-function, and cdk-8 is required for full repression of a direct LIN-1 target promoter. Fourth, ectopic vulva formation in mdt-13/let-19 is independent of the Mediator subunit mdt-23/sur-2, which is critical for EGFR signaling-driven transcription and vulval development in wild-type worms (Singh and Han 1995; Zhang and Greenwald 2011); instead, mdt-13/let-19 modulates the specificity of the tail module triad subunits mdt-15, mdt-29, and mdt-27, preventing aberrant activation of downstream transcription. By implicating all CKM subunits and by connecting the CKM to lin-1 and to core Mediator, my data substantially expand on the prior finding that loss of CKM subunit mdt-12 caused ectopic vulva formation by unknown molecular mechanisms (Moghal and Sternberg 2003a). Additionally, my genetic and molecular analyses provide the first evidence that CKM-tail module crosstalk, akin to that seen in yeast Mediator (van de Peppel et al. 2005; Gonzalez et al. 2014), occurs in metazoan Mediator, an important experimental finding as tail module subunit sequence conservation between species is extremely poor (Bourbon 2008).   82    Figure 2.10 Kinase module action in C. elegans vulval cell fate specification. Model of CKM inhibition of EGFR-Ras-MAPK signaling-dependent cell fate specification by repressing lin-3/EGF in the anchor cell (AC), promoting LIN-1 repressor activity (e.g. at lag-2), and inhibiting tail module triad activity (e.g. at cdk-8-repressed genes) in non-1° VPCs (i.e. VPCs other than P6.p).  2.4.1 The CKM inhibits vulva development in a kinase dependent manner  We performed unbiased gene expression profiling to define gene programs that depend on cdk-8 in vivo, which revealed that only 6.7% of C. elegans genes are deregulated in cdk-8 mutants (Figure 2.2B). This number agrees with studies in yeast, wherein only 3% of genes are deregulated in cdk8 mutants (Holstege et al. 1998). Thus, CDK8 appears to be a gene program-specific transcriptional coregulator across species. It is important to note that the cdk-8-dependent genes defined in our gene expression analysis may include genes that are not direct targets of CDK-8. CDK-8 chromatin immunoprecipitation-sequencing analysis is needed to 83  define direct CDK-8 targets; however, we currently lack a reliable #-CDK-8 antibody or a functional epitope-tagged CDK-8 transgene to conduct such a study.  Among cdk-8-dependent genes, we identified a significant overlap with genes regulated by lin-35/RB, a synMuv transcriptional repressor (Figure 2.2B) (Kirienko and Fay 2007). I note that as synMuv genes act redundantly, lin-35 single mutants do not exhibit any defects in EGFR signaling or vulval induction (Myers and Greenwald 2005; Cui et al. 2006; Kirienko and Fay 2007). Thus, the overlap between cdk-8- and lin-35-dependent genes suggested that the CKM and lin-35 cooperate in multiple aspects of C. elegans development. Similarly, in Drosophila, CDK8 and RB act in parallel in the Wnt signaling pathway (Morris et al. 2008). Therefore, I explored whether the CKM and synMuv genes cooperate in the EGFR signaling pathway to regulate C. elegans vulva development. Both cdk-8 and mdt-13/let-19 were required to repress C. elegans vulva formation, in a partially redundant manner with the synMuv genes (Figure 2.3A, Figure 2.8A). However, cdk-8 did not act redundantly with the synMuv genes to repress lin-3/EGF transcription (Figure 2.4A), suggesting that the CKM and the synMuv genes regulate EGFR signaling at different junctions, as discussed below.  Comparing the vulval phenotypes of CKM mutants, I found evidence that cdk-8 and cic-1 act together to repress vulval induction, as a cdk-8; cic-1 double mutant displayed the same Muv penetrance as cdk-8 or cic-1 single mutants (Figure 2.3A). In addition, I found that mdt-12/dpy-22 and mdt-13/let-19 were more strongly required to repress vulva development than cdk-8 or cic-1 (Figure 2.8A). In S. cerevisiae Mediator, Med12 and Med13 enable Cdk8 and Cyclin C docking to Mediator (Tsai et al. 2013). Loss of MDT-12/DPY-22 or -13 in C. elegans may similarly disrupt CDK-8 and CIC-1 function, as well as considerably reducing the size of the CKM. Although CDK-8’s kinase activity is required to inhibit vulva development (Figure 84  2.6), this does not rule out the possibility that the CKM also employs kinase-independent steric mechanisms, as observed in other systems (Knuesel et al. 2009b). Thus, additional kinase-independent mechanisms could account for the stronger requirement for mdt-12/dpy-22 and -13 in vulva development.   2.4.2 The CKM inhibits the primary vulval cell fate  Vulva formation in C. elegans requires both EGFR and Notch signaling (Félix and Barkoulas 2012), and human CDK8 and Cyclin C repress Notch signaling-driven transcription by promoting turnover of the Notch intracellular domain (Fryer et al. 2004; Li et al. 2014). Therefore, I examined whether the vulval phenotypes in CKM mutants occur due to defects in EGFR signaling, Notch signaling, or both. Using an EGFR-Ras-ERK signaling-induced 1° cell fate reporter, I demonstrated that cdk-8 and mdt-13/let-19 are required to repress ectopic vulva formation in part by repressing the 1° cell fate (Figure 2.3B, Figure 2.8B). Using a Notch signaling-induced 2° cell fate reporter, I showed that cdk-8 is required to represses ectopic 2° fates in non-vulval VPCs, as well as to promote the 2° fate in P5.p and P7.p (Figure 2.3C). However, cdk-8 action in the Notch pathway might occur indirectly in this context. EGFR signaling in P6.p induces expression of Notch ligands, e.g. lag-2, which promote the 2° fate in the neighbouring cells, P5.p and P7.p (Chen and Greenwald 2004). I observed evidence of possible cell fate transformations from 2° to 1° in P5.p or P7.p in cdk-8 and mdt-13 mutants, as these cells occasionally exhibited strong expression of the 1° cell fate marker egl-17P::CFP (Figure 2.3B, Figure 2.8B), expression of the EGFR signaling target gene lag-2 (Figure 2.7C), or loss of the strong lip-1P::GFP expression characteristic of 2° cells (Figure 2.3C). It is possible that VPCs transformed to the 1° fate could then induce 2° fates in neighbouring VPCs, 85  accounting for my observation of ectopic 2° cells. It would be interesting to explore this hypothesis further using a cdk-8 mutant strain simultaneously expressing 1° and 2° cell fate markers. In addition, some mdt-13/let-19 mutants displayed a partial Vul phenotype due to reduced proliferation of P5.p or P7.p descendants (Table 2.1). This suggests that, like cdk-8 mutants which occasionally showed loss of the strong lip-1P::GFP expression characteristic of 2°-fated P5.p and P7.p descendants (Figure 2.3C), some mdt-13/let-19 mutants may also exhibit partial loss of the 2° cell fate in the vulva, although examination of the lip-1P::GFP 2° fate reporter in mdt-13/let-19 mutants is needed to substantiate this possibility.  CKM subunits have been implicated as regulators of canonical Wnt signaling (Zhang and Emmons 2000; Firestein et al. 2008; Morris et al. 2008) and cell cycle quiescence (Clayton et al. 2008), processes which also contribute to vulva development. Activation of Wnt signaling can bypass requirements for let-23/EGFR in vulva development (Gleason et al. 2002). However, the vulval phenotype of mdt-12/dpy-22 mutants is independent of bar-1/!-catenin (Moghal and Sternberg 2003a), suggesting that the CKM does not repress vulva development through the canonical Wnt signaling pathway. Deregulation of cell cycle quiescence can expand the VPC equivalence group, which are competent to form ectopic vulvae if presented with the appropriate signals (e.g. lin-12/Notch gain-of-function employed by (Clayton et al. 2008)). Although CKM subunits are required for VPC cell cycle quiescence (Clayton et al. 2008), this alone is unlikely to account for the ectopic vulvae observed in these animals. First, the ectopic vulval invaginations observed in cdk-8 and mdt-13/let-19 animals while scoring VPC induction (Table 2.1) were positioned in the correct location for P3.p, P4.p and P8.p descendants. Second, ectopic expression of 1° and 2° cell fate markers in cdk-8 and mdt-13/let-19 mutants (Figure 2.3B, C, 86  Figure 2.8B) suggests that EGFR and/or Notch signaling indeed drives ectopic vulva formation in these mutants.  2.4.3 The CKM promotes LIN-1/Ets repressor activity  I observed derepression of the lin-3/EGF anchor cell specific enhancer element (ACEL) in cdk-8 mutants (Figure 2.4C), implicating cdk-8 as a novel repressor of lin-3/EGF transcription in the anchor cell. Albeit interesting, genetic epistasis analysis with let-23/EGFR and mpk-1/ERK loss-of-function alleles clearly demonstrated that cdk-8 is primarily required downstream of mpk-1/ERK to repress vulval induction (Figure 2.5A). The let-23(sy97) mutant protein is ligand insensitive (Aroian and Sternberg 1991; Aroian et al. 1994); therefore, weak lin-3/EGF activation in the anchor cell due to loss of cdk-8 cannot account for the vulval phenotypes observed in cdk-8; let-23(sy97) mutants (Figure 2.5A). Furthermore, epistasis analysis with mpk-1/ERK confirmed that cdk-8 acts downstream of the core EGFR-Ras-ERK pathway to regulate vulval induction (Figure 2.5A). In line with a function downstream of mpk-1/ERK, I showed that cdk-8 is required in VPCs to suppress ectopic vulval induction (Figure 2.5B). A previous report demonstrated that repression of vulval induction by the CKM subunit mdt-12/dpy-22 is gonad-independent, and thus anchor cell-independent, and that an MDT-12/DPY-22::GFP transgene is expressed in VPCs (Moghal and Sternberg 2003a), supporting a role for the CKM in VPCs.  Downstream of mpk-1/ERK, I found evidence that the CKM promotes LIN-1/Ets-mediated repression of vulval induction (Figure 2.7A, B, Figure 2.8C), and that cdk-8 promotes transcriptional repression of a direct LIN-1 target, the lag-2/Notch ligand minimal promoter (Figure 2.7C). The lag-2 minimal promoter contains activator and repressor elements, VPCact and VPCrep, that cooperatively restrict expression to P6.p (Zhang and Greenwald 2011). On its 87  own, VPCact is sufficient to drive transcription in all VPCs (P3.p-P8.p) in a LIN-3/EGF ligand-independent manner. VPCrep represses this basal VPCact-driven transcription in VPCs other than P6.p, thereby restricting expression of the lag-2 minimal promoter to the 1°-fated VPC. VPCrep contains an Elk1 consensus site, which is bound by LIN-1 in vitro (Miley et al. 2004), and requires lin-1/Ets for repression of transcription in VPCs other than P6.p (Zhang and Greenwald 2011). My results indicate that cdk-8 is partially required for transcriptional repression of the lag-2 minimal promoter (Figure 2.7C), suggesting that the CKM promotes LIN-1-mediated repression at VPCrep. An alternative explanation for the ectopic expression of the lag-2 minimal promoter observed in cdk-8 mutants is that the CKM might inhibit a factor that activates transcription through VPCact. The TF(s) that act at VPCact remain poorly defined; however, the mdt-23/sur-2 Mediator subunit is required for VPCact-driven transcription in P3.p-P8.p (Zhang and Greenwald 2011). As I demonstrated that vulval induction in mdt-13/let-19 mutants does not require mdt-23/sur-2 (Figure 2.8B, E), this implies that the CKM likely does not inhibit MDT-23/SUR-2 activity at VPCact. Overall, my findings suggest that the CKM may act as a corepressor for LIN-1. Additional experiments are needed to determine if CDK-8 binds to LIN-1, which would imply that LIN-1 recruits the CKM-containing Mediator complex to repress transcription of its target genes.  In addition to vulva development, lin-1 also represses a subset of other mpk-1/ERK-dependent developmental events: excretory system, posterior ectoderm, and male tail spicule development, but not meiosis or sex myoblast migration (Sundaram 2013). Interestingly, the Mediator subunits mdt-23/sur-2 and mdt-24/ lin-25 promote these lin-1-mediated developmental events (Nilsson et al. 2000), suggesting that these Mediator subunits activate gene expression in all tissues in which lin-1 is required. Further work is needed to determine if CKM mutants show 88  phenotypes of the excretory system, posterior ectoderm, and male tail similar to lin-1 mutants. If so, this would support a model in which LIN-1 recruits the CKM-containing Mediator complex to corepress its target genes in all tissues in which lin-1 is required.  In murine embryonic stem cells, Mediator recruitment is important for transcriptional activation by Ets factors, e.g. Elk1 (Stevens et al. 2002; Balamotis et al. 2009). In this context, activation of Elk1 by ERK phosphorylation promotes binding to Mediator in a MED23/Sur2-dependent manner (Stevens et al. 2002). Similarly, in a colon cancer cell line, CDK8 promotes transcriptional elongation of serum response IEGs, which are targeted by multiple TFs including Elk1 (Donner et al. 2010). However, the role of Mediator in transcriptional repression by an Ets factor has not previously been explored. In the absence of ERK phosphorylation, sumoylation of LIN-1 promotes recruitment of subunits of the nucleosome remodeling and deacetylase (NuRD) complex, leading to transcriptional repression of target genes (Jacobs et al. 1998; Leight et al. 2005, 2015). The current study provides evidence that the CKM is required for repression by LIN-1, indicating that transcriptional repression by this Ets factor involves interactions both with a chromatin remodeler, the NuRD complex, and with a coregulator of Pol II transcription, the Mediator complex.  My findings are of potential clinical interest, as the human CKM is implicated in tumorigenesis (Firestein et al. 2008; Donner et al. 2010; Mäkinen et al. 2011; Lim et al. 2014). Loss of MED12 causes cellular resistance to chemotherapeutic agents that inhibit activated BRAF, the human ERK kinase kinase (Shalem et al. 2014); this suggests that MED12 represses EGFR signaling downstream of BRAF, in line with my findings for the C. elegans CKM. Furthermore, recurrent MED12 mutations are implicated in uterine leiomyomas and breast fibroadenomas (Mäkinen et al. 2011; Lim et al. 2014; Mittal et al. 2015), but the pathogenic 89  mechanisms of these mutations have not been fully elucidated. Investigation of these mutations using the C. elegans vulva development paradigm may provide insight into their mode of action.  2.4.4 The CKM restrains the core Mediator tail module triad  Epistatic relationships between Mediator subunits have been identified in S. cerevisiae (van de Peppel et al. 2005; Gonzalez et al. 2014), but intra-Mediator regulation has not been demonstrated in metazoans. Previous studies (Section 1.1.3.4) and my data show that several core Mediator subunits promote C. elegans vulva development, whereas CKM subunits inhibit this process. This suggested that intra-Mediator regulation might coordinate gene expression downstream of the EGFR-Ras-ERK signaling pathway that drives vulva development. Initially, I hypothesized that the CKM may oppose mdt-23/sur-2-mediated activation of EGFR signaling, as mdt-23/sur-2 is required for vulval induction and activation of EGFR signaling-induced transcription, e.g. lag-2 (Singh and Han 1995; Zhang and Greenwald 2011). Unexpectedly, loss of mdt-13/let-19 circumvented the requirement for mdt-23/sur-2 in vulval induction (Figure 2.8E). I therefore explored regulatory interactions between the CKM and the metazoan orthologs of S. cerevisiae Med2, Med3, and Med15, which are subject to inhibitory post-translational regulation by Cdk8 (van de Peppel et al. 2005; Gonzalez et al. 2014). Sequence conservation is weak between yeast Med2 and Med3 and their putative metazoan homologs, MED29 and MED27, respectively (Bourbon 2008). Whether MED29 and MED27 function as part of the tail module remains unclear, as structural and biochemical studies locate these subunits between the head and tail modules (Sato et al. 2003; Tsai et al. 2014). Thus, I was intrigued to find that vulva formation in a C. elegans CKM mutant required mdt-15, mdt-27, and mdt-29 (Figure 2.9A). This requirement appeared specific to the tail module triad, as neither mdt-1.1/MED1 nor mdt-23/sur-90  2 was required for vulval induction in CKM mutants (Figure 2.8E, Figure 2.9A). Furthermore, the triad did not appear to be generally required for ectopic vulval induction in animals with a wild-type CKM, as mdt-15 knockdown had no effect on ectopic vulval induction in lin-1(n1790) mutants (Figure 2.9B). Together, these findings suggest that the CKM restrains triad activity, preventing it from aberrantly activating vulval induction.   Gene expression analysis in cdk-8 mutants identified a requirement for mdt-15, but little or no requirement for mdt-27 or mdt-29, in transcriptional activation of cdk-8-repressed genes (Figure 2.9C). In the S. cerevisiae tail module triad, both med3 and med2 are required for overexpression of Cdk8-repressed genes in cdk8 mutants, but the requirement for med15 has not been tested directly (van de Peppel et al. 2005; Gonzalez et al. 2014). These requirements might be explained by the fact that both Med2 and Med3 are necessary to anchor the triad to the tail module (Myers et al. 1999; van de Peppel et al. 2005; Gonzalez et al. 2014). Similar requirements may not in exist in metazoan Mediator, as human Mediator displays more extensive structural contacts between the head and tail modules (Tsai et al. 2014), which may redundantly anchor some tail module subunits.   Investigating the regulatory relationship between CDK-8 and MDT-15 further, I found that cdk-8 is required for post-transcriptional negative regulation of MDT-15, as MDT-15 protein but not mRNA levels increase in cdk-8 mutants (Figure 2.9D, E). A limitation of these experiments is that I examined MDT-15 mRNA and protein levels in whole animal extracts, not in VPCs. However, I found that mdt-15 is required both for transcriptional activation of cdk-8-repressed genes in cdk-8 mutants, which was determined using whole animal extracts (Figure 2.9C), and for ectopic vulva formation in mdt-13/let-19 mutants, which reflects a VPC-specific phenotype (Figure 2.9A). Thus, CDK-8 likely acts as a negative regulator of MDT-15 in 91  multiple tissues, including VPCs. This regulatory relationship resembles that seen in yeast where the three triad subunits Med2, Med3, and Med15 are negatively regulated post-translationally by Cdk8-driven phosphorylation of Med3, promoting ubiquitin-proteasome dependent turnover of all three triad subunits (Gonzalez et al. 2014). It will be interesting to delineate whether the metazoan CKM regulates MDT-15 protein levels directly, e.g. by phosphorylation leading to ubiquitin-mediated degradation, or indirectly through action upon other Mediator subunits.   In summary, my findings suggest that the Mediator CKM represses EGFR-Ras-ERK signaling-driven cell fate specification in C. elegans by regulating repressor activity of an Ets-family TF and by promoting specificity of Mediator tail module subunits.    2.5 Materials and methods 2.5.1 Microarrays and data analysis  Microarray gene expression profiling was performed at the UCSF SABRE Functional Genomics Facility. We used Agilent C. elegans (V2) 4x44K Gene Expression Microarrays (#G2519F-020186) and single color labeling. Total RNA was extracted from developmentally synchronized mid-L4 stage worms as assessed by vulval morphology (wild-type N2 worms and cdk-8(tm1238) mutants), as described (Taubert et al. 2008). RNA quality was assessed on an Agilent 2100 Bioanalyzer using a Pico Chip (Agilent). RNA was amplified and labeled with Cy3-CTP using the Agilent low RNA input fluorescent linear amplification kit. Labeled cRNA was assessed using the Nanodrop ND-100, and equal amounts of Cy3 labeled target were hybridized to the microarrays for 14 hrs, according to the manufacturers protocol. Arrays were scanned using the Agilent microarray scanner and raw signal intensities were extracted with 92  Feature Extraction v9.1 software. The dataset was normalized using quantile normalization (Bolstad et al. 2003). No background subtraction was performed, and median feature pixel intensity was used as raw signal before normalization. All arrays were of good quality and had similar foreground and background signal distributions for both mRNA and control probes. This suggests that quantile normalization is appropriate. To identify differentially expressed genes, a linear model was fit to the comparison to estimate the mean M values and calculate moderated t-statistic, B statistic, false discovery rate, and p-value for each gene. Adjusted p-values (AdjP) were produced as described (Holm 1979). All procedures were carried out using functions in the R package limma in Bioconductor (Gentleman et al. 2004; Smyth 2004). Using this approach, we identified a total of 1860 spots with an AdjP < 0.05 and a fold-change " 2 (representing 461 downregulated and 829 upregulated genes) (Table S1). Microarray data have been deposited in Gene Expression Omnibus (GSE68520).  Differentially expressed genes were compared to published gene expression datasets using EASE (Hosack et al. 2003). For best comparison to our data, we reanalyzed published lin-35 data (Kirienko and Fay 2007) to define a set of genes deregulated two-fold or more in L4 larvae, yielding 132 downregulated and 367 upregulated genes. We compared this set to our cdk-8 targets and calculated the significance of the overlap using Fisher’s exact test.   2.5.2 C. elegans strains, culture, and genetic methods  C. elegans strains were cultured as described (Brenner, 1974) at 20°C or 23°C, as indicated. I used nematode growth medium (NGM)-lite (0.2% NaCl, 0.4% tryptone, 0.3% KH2PO4, 0.05% K2HPO4) agar plates seeded with Escherichia coli strain OP50 unless otherwise indicated.  93   Strains are listed in Table 2.3. Wild type was Bristol N2. cdk-8(tm1238) and cic-1(tm3740) are likely null alleles that abolish cdk-8 expression (Figure 2.2A) and cic-1 function, respectively (see also (Steimel et al. 2013)). For allele details, see www.wormbase.org. mdt-12/dpy-22 mutants were identified as Dpy, GFP-negative progeny of rescued dpy-22(os38); osEx89[dpy-22(+)] mothers, and homozygous mdt-13/let-19 mutants were identified as Dpy, GFP-negative progeny of balanced let-19(mn19)/mIn1 mothers.  Table 2.3 C. elegans strains used in Chapter 2 Strain Genotype XA7703  cdk-8(tm1238) I MH17  sur-2(ku9 ) I MT10430  lin-35(n745) I HS310  let-19(mn19)/mIn1[dpy-10(e128) mIs14] II PS295  let-23(sy97) unc-4(e120)/mnC1[dpy-10(e128) unc-52(e444)] II MT301  lin-31(n301) II STE13  cic-1(tm3740) III WU125  lin-1(n1790) IV HS445  dpy-22(os38) X; osEx89[dpy-22(+)]  MT1806  lin-15A(n767) X MT2495  lin-15B(n744) X AH12  gap-1(ga133) X STE74 cdk-8(tm1238) I; lin-15A(n767) X STE75 cic-1(tm3740) III; lin-15A(n767) X HS432 let-19(mn19)/mIn1[dpy-10(e128) mIs14] II; lin-15A(n767) X STE76 cdk-8(tm1238) I; lin-15B(n744) X 94  Strain Genotype HS433 let-19(mn19)/mIn1[dpy-10(e128) mIs14] II; lin-15B(n374) X STE77 cdk-8(tm1238) I; gap-1(ga133) X MT309 lin-15AB(n309) X STE78 cdk-8(tm1238) I; let-23(sy97) unc-4(120)/mnC1[dpy-10(e128) unc-52(e444)] II STE79 cdk-8(tm1238) I; lin-1(n1790) IV HS510 let-19(mn19)/mIn1[dpy-10(e128) mIs14] II; lin-1(n1790) IV HS356 sur-2(ku9) I; let-19(mn19)/mIn1[dpy-10(e128) mIs14] II GS3582  arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]; unc-4(e120) II  NH2466  ayIs4[egl-17p::GFP + dpy-20(+)] I; dpy-20(e1282) IV  PS4308  syIs107[unc-119(+) + lin-3(delta-pes-10)::GFP]; unc-119(ed4) III GS5096  arEx1098[lag-2p(min)::2nls-yfp::unc-54 3’UTR + pha-1(+)]; pha-1(e2123) III AH142  zhIs4[lip-1p::GFP]  STE80 steEx43[cdk-8(+) + myo-2P::mCherry] STE81 cdk-8(tm1238) I; arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP] STE82 cic-1(tm3740) III; ayIs4[egl-17p::GFP + dpy-20(+)] STE83 cdk-8(tm1238) I; steEx43[cdk-8(+) + myo-2P::mCherry] STE84 cdk-8(tm1238) I; lin-15A(n767) X; steEx43[cdk-8(+) + myo-2P::mCherry] STE85 cdk-8(tm1238) I; syIs107[unc-119(+) + lin-3(delta-pes-10)::GFP] STE86  lin-15A(n767) X; arEx1098[lag-2p(min)::2nls-yfp::unc-54 3’UTR + pha-1(+)] STE87 cdk-8(tm1238) I; lin-15A(n767) X; arEx1098[lag-2p(min)::2nls-yfp::unc-54 3’UTR + pha-1(+)] STE88 cdk-8(tm1238) I; zhIs4[lip-1p::GFP] STE89 steEx44[cdk-8P::GFP + myo-2P::mCherry] STE90 steEx45[lin-31P::cdk-8 + myo-2P::mCherry] STE91 steEx46[dpy-7P::cdk-8 + myo-2P::mCherry] 95  Strain Genotype STE92 steEx47[cdk-8P::cdk-8(KD)::cdk-8-3’UTR + myo-2P::mCherry] STE93 cdk-8(tm1238) I; lin-15A(n767) X; steEx45[lin-31P::cdk-8 + myo-2P::mCherry] STE94 cdk-8(tm1238) I; lin-15A(n767) X; steEx46[dpy-7P::cdk-8 + myo-2P::mCherry] STE95 cdk-8(tm1238) I; lin-15A(n767) X; steEx47[cdk-8P::cdk-8(KD)::cdk-8-3’UTR + myo-2P::mCherry] STE96 steEx48[pCeBiFC-VN173-lin-1 + pCeBiFC-VC155-cdk-8 + myo-2P::mCherry] STE97 steEx49[pCeBiFC-VN173-lin-1 + pCeBiFC-VC155-cdk-8(KD) + myo-2P::mCherry]  2.5.3 VPC induction  VPC induction was scored as described (Han et al. 1990), in synchronous mid-L4 animals under DIC optics at 1000X magnification. In wild-type animals, P5.p, P6.p, and P7.p are induced to give a VPC induction score of 3.0. In Vul animals, these VPCs are not fully induced (VPC induction < 3.0); in Muv animals, P3.p, P4.p, or P.8p are induced (VPC induction > 3.0).  2.5.4 Multivulva and vulvaless phenotype penetrance  Muv and Vul morphologies have been described (Horvitz and Sulston 1980; Sulston and Horvitz 1981). To facilitate scoring a large number of worms to accurately assess low-penetrance phenotypes, Muv phenotype penetrance was scored in synchronous day 1 adult animals in a dissection microscope at 200x magnification (mdt-13/let-19 mutants) or 56x magnification (all other strains). To corroborate Muv penetrances scored in adult animals, I also conducted VPC induction analysis in L4 animals (see Section 0). To assess Vul phenotypes, both Vul and Muv penetrances were extrapolated from VPC induction scores: animals were scored as 96  Vul if VPC induction < 3.0 in P5.p-P7.p, and were scored as Muv if VPC induction occurred in P3.p, P4.p or P8.p; using these criteria, animals were occasionally scored as simultaneous Vul and Muv.  2.5.5 RNA isolation and quantitative real-time PCR  Total RNA was extracted from developmentally synchronized mid-L4 stage worms as assessed by vulval morphology. RNA isolation and qPCR were performed as described (Goh et al. 2014). I used t-tests (two-tailed, equal variance) to calculate statistical significance of gene expression changes between mutants (Gaussian distribution). qPCR primers were designed with Primer3web (bioinfo.ut.ee/primer3/) and tested on serial cDNA dilutions to analyze PCR efficiency (primer sequences in Table 2.4), except lin-3 (analyzed by TaqMan assay, Invitrogen #4448892, Assay ID Ce02418781_m1).  Table 2.4 qPCR primers used in Chapter 2 Gene Primer sequence (F/R) cdk-8 CTGCATGCAGAGAAATTGCTC / TGATAACGTGCCAGAGATCG lin-35 CGAGACGAACTTGGAAGACC / CCAGCATTGTGATTTTGCAC efl-1 TGCTCCAGATGAAATGATGG / TCTCCGGTGCTCGAATAAAC dpl-1 GCGGAAGAAGTCAAAACTGC / CGTATTGGGCTTGTGAGAGG mdt-15 CACGACCCGGTCTTTCGTC / CTAGACCACCGCTTGTCTGG mdt-27 CCCACAAACTTCGCCCAATG / AAGGGACCTGTGACTCAAAC mdt-29 TCTCGACGGGGAGGTTATG / TGTCGTCTTCGCATACTTTCC col-127 AGCTTGGTGCCAGTGTGAG / TGTGGGCAGTTGATTGGAG K03D3.2 GGGTTGATGGAAAGGGAAAC / ACGACATTCTTGCCCTTGAG 97  Gene Primer sequence (F/R) acd-2 TGTGATGGAGCTGAAATTCG / TTCTGTCGACTCGTTTGGTG Y49G5A.1 CCCATTGGCTTTTGAGTACAG / CGGTTTGGCAGTTTTTATCG fat-7 TTTCCACCACACATTCCCAC / TCTTCACTTCCGTGATTGGC ftn-1 TGGAAGAGCAGGTACATTCG / GCCGGCTCTCTTGATATTTG nlp-4 CTCCAATCCGTGTTCCAGTT / ACTGAAAGACAAGTCTCTCTTCACAC ubc-2 AGGGAGGTGTCTTCTTCCTCAC / CGGATTTGGATCACAGAGCAGC tba-1 GTACACTCCACTGATCTCTGCTGACAAG / CTCTGTACAAGAGGCAAACAGCCATG act-1 GCTGGACGTGATCTTACTGATTACC / GTAGCAGAGCTTCTCCTTGATGTC  2.5.6 Fluorescent reporter analysis  Synchronous worms were imaged using DIC optics and fluorescence microscopy on a Zeiss Axioplan 2 microscope. Analysis of fluorescence intensity was conducted using ImageJ software, normalizing for cell size and background fluorescence.  2.5.7 Generation of transgenic strains  The cdk-8(+) rescue transgene was generated by cloning the cdk-8 genomic locus including promoter and 3’ UTR into the PCR Blunt II TOPO vector. The lin-31 promoter-driven tissue-specific rescue transgene was generated by sub-cloning promoterless cdk-8 (from start codon to 3’ UTR) into the pB255 vector (Tan et al. 1998). The dpy-7 promoter-driven tissue-specific rescue transgene was generated by cloning the dpy-7 promoter (Gilleard et al. 1997) into the GFP vector pPD95.77, then excising and replacing GFP with promoterless cdk-8. Kinase dead cdk-8 was generated by site-directed mutagenesis of the cdk-8(+) plasmid using the Q5 98  Site-Directed Mutagenesis kit (NEB E0554S). Cloning primers are listed in Table 2.5.   cdk-8 rescue strains (steEx43, 45-47) or cdk-8P::GFP reporter strain were generated by gonad microinjection of a mixture of 50 ng/µl rescue plasmid, 5 ng/µl pCFJ90[myo-2p::mCherry], and 95 ng/µl pPD95.77 empty vector into N2 worms, then selecting transgenic mCherry-positive progeny. These were then crossed to cdk-8 and/or cdk-8; lin-15A mutants.  Table 2.5 Cloning primers used in Chapter 2.  Primer sequences (F/R) cdk-8P aagcttCCTGGAAATAAATTTAAAACTCT /ggatccAGTGCAAATTTCCAACTTACGTG cdk-8(+) CCTGGAATTAAATTTAAAACTCTTTTCAG /ATTTTATTGTGAACGTATTTCAAAAAAATAC Promoterless cdk-8 (for lin-31P) ctcgagATGACGTAAGTTGGAAATTTGC / gcggccgcATTTTATTGTGAACGTATTTCAAAAAAATAC Promoterless cdk-8 (for dpy-7P) ggtaccATGACGTAAGTTGGAAATTTGC / cttaagATTTTATTGTGAACGTATTTCAAAAAAATAC dpy-7P aagcttCATCTCTTCTCGTTTGGAATC / ggatccAAGAACATGGATTGTAGAAAACG cdk-8(KD) GTAAAAATTGCTGcTTTGGGATTTTC /CCTAGAATTATTATTTCATATTATCGC  2.5.8 Feeding RNAi knockdown  Feeding RNAi was performed as described (Goh et al. 2014), with the following modifications: synchronous mid-L4 hermaphrodites were allowed to lay eggs at 20°C overnight on RNAi plates (Ahringer library 96-well format; mdt-15: plate 74, well C09; lin-1: 94, G02; Vidal library 96-well format: mdt-27: GHR-11064@H02; mdt-29: GHR-11007@D05; all clones were sequenced to confirm identity; negative control was empty vector L4440), after which 99  embryos were isolated by bleach treatment and transferred to fresh RNAi plates. F1 progeny were grown on RNAi plates (20°C or 23°C) until they reached the desired developmental stage.  2.5.9 Western blot  Immunoblot using standard lysis, SDS-PAGE and Western blot techniques was performed, with #-MDT-15 (Taubert et al. 2006) and #-GAPDH (Calbiochem, CB1001) antibodies, as described (Goh et al. 2014).   100  Chapter 3: The cdk-8 Mediator subunit promotes cadmium-responsive transcription  3.1 Synopsis  Organisms mount a strong transcriptional response to the toxic heavy metal cadmium, making it an excellent paradigm to study inducible transcription. Previous studies of cadmium-inducible transcription in C. elegans have focused on relatively simple promoters containing few regulatory elements. Here, I dissected the highly modular, cadmium-responsive gene 1 (cdr-1) promoter to identify Mediator subunits, TFs, and regulatory elements that cooperate in cadmium-inducible transcription. I identified a novel role for the Mediator subunit cdk-8 in cadmium-inducible transcription and cadmium resistance. Furthermore, using a cdr-1 promoter reporter, I showed that cdk-8 cooperates with other factors with known roles in cadmium-responsive transcription: the Mediator tail module subunit mdt-15, the GATA-family TF elt-2 (and GATA elements), and the high zinc-activated (HZA) element. Although the cdr-1 promoter also contains regulatory elements recognized by the stress-responsive TFs SKN-1/Nrf2 and HSF-1, I demonstrated that these factors are not required for cdr-1 induction. Finally, I showed that the stress-responsive TF DAF-16/FoxO and its cognate regulatory element are required to repress cadmium-inducible cdr-1 transcription. Thus, my study expands the known repertoire of regulators in the cadmium response to include the coactivator CDK-8 and the repressor DAF-16, implying that, together with MDT-15, ELT-2 and an HZA-binding TF, these factors provide tight, combinatorial control of a highly complex cadmium-inducible promoter.  101   3.2 Background  Cadmium is a toxic heavy metal that causes extensive cellular damage by perturbing redox balance, protein folding or function, and proteolysis (Vallee and Ulmer 1972; Figueiredo-Pereira et al. 1998). Consequently, organisms mount a strong gene expression response to cadmium exposure. Cadmium-induced transcription has been characterized in C. elegans: early cadmium-responsive genes (induced within 4 hours of exposure, although earlier time points have not been tested) are involved in metal ion homeostasis, general stress responses, and energy metabolism, whereas late cadmium-responsive genes (following 24 hours exposure) include the continued expression of many early genes, in addition to proteolysis genes (Cui et al. 2007). Among the most highly induced early genes are the metallothionein-family metal binding protein genes, mtl-1 and mtl-2, and a lysosomal integral membrane protein gene, cadmium-responsive gene 1 (cdr-1), which are redundantly required for organismal cadmium resistance (Liao et al. 2002; Cui et al. 2007).   Several studies have identified TFs and/or DNA regulatory elements that drive cadmium-responsive transcription (Figure 3.1A, C). Mutational analysis of the mtl-1 and mtl-2 promoters revealed that GATA elements, and the intestinal GATA-family TF ELT-2, promote cadmium-inducible gene expression (Moilanen et al. 1999). Regulation of these promoters by ELT-2 appears to be direct, as ELT-2 binds in vitro to an mtl-1 GATA element (Moilanen et al. 1999). However, as transcriptome profiling of the C. elegans intestine indicates that ELT-2 activates virtually all genes expressed in the adult intestine (McGhee et al. 2007), regulation by ELT-2 and GATA sites does not appear to be specific to cadmium-inducible transcription. Recently, a regulatory element activated by excess zinc, the high zinc-activated (HZA) element, was 102  identified in the promoters of several cadmium-responsive genes, including mtl-1, mtl-2, and cdr-1 (Roh et al. 2015). The HZA is often found in close proximity to a GATA element, and indeed, tandem repeats of a 62 bp HZA and GATA element-containing fragment of the mtl-1 promoter are sufficient for cadmium-inducible transcription from a minimal promoter (Roh et al. 2015). Thus, the HZA element appears to recruit an ancillary TF that cooperates with ELT-2 to regulate cadmium-inducible transcription. In addition to these elements and factors, DAF-16, the C. elegans FoxO TF ortholog which is the canonical stress-responsive TF repressed by the insulin signaling pathway (Kenyon et al. 1993), may regulate cadmium-inducible transcription. Inactivation of the insulin signaling pathway, which derepresses DAF-16 activity, results in increased resistance to cadmium toxicity (Barsyte et al. 2001) and increased mtl-1 mRNA levels in the absence of cadmium (Murphy et al. 2003), both of which are dependent on daf-16. Furthermore, the mtl-1 promoter contains a DAF-16 binding element (DBE) consensus sequence (Murphy et al. 2003). Activation of mtl-1 transcription by DAF-16 appears to be direct, as DAF-16 binds to the mtl-1 promoter in vivo (Zhang et al. 2013). Thus, DAF-16 may promote cadmium resistance by inducing detoxification genes such as mtl-1. Finally, the Mediator tail module subunit mdt-15 is required for cadmium-induced expression of several cadmium detoxification genes, including mtl-1, mtl-2, and cdr-1 (Taubert et al. 2008), suggesting that MDT-15 may coactivate ELT-2, the HZA-binding TF, DAF-16, or perhaps other TFs in the cadmium response.  MDT-15 is critical for transcriptional responses to multiple stressors, including oxidizing agents, organic carcinogens, excess zinc, cadmium, and pathogenic bacteria (Taubert et al. 2008; Goh et al. 2014; Pukkila-Worley et al. 2014; Roh et al. 2015). In oxidative stress responses, the MDT-15-binding TFs SKN-1/Nrf2, NHR-49 and NHR-64 are required for stress-responsive 103  transcription and/or stress resistance (Goh et al. 2014). Beyond this, little is known about the MDT-15-TF interactions driving other mdt-15-dependent stress responses. Notably, nhr-49 is not required for the mdt-15-dependent transcriptional response to organic carcinogens (Taubert et al. 2008), suggesting that MDT-15 may engage distinct TFs in different stress responses.   Promoters are made up of modular arrangements of regulatory elements, which can confer developmental stage-specific, cell type-specific, and stimulus-specific gene expression patterns (Gaudet and McGhee 2010). The promoters of the cadmium-inducible metallothionein genes mtl-1 and mtl-2 are relatively simple, containing only GATA, HZA, DBE or a putative hypoxia response element (HRE; described in Section 3.4.1) (Figure 3.1A). In contrast, the promoter of the cadmium-inducible gene cdr-1 contains multiple putative regulatory elements in addition to GATA, HZA, and DBE elements (Figure 3.1A). These include putative binding sites for several stress-responsive TFs: two antioxidant response element-like (ARE-like), which bind the oxidative stress-responsive TF SKN-1, the C. elegans Nrf2 ortholog (Blackwell et al. 1994; An and Blackwell 2003); four metal response elements (MRE) (Stuart et al. 1984; Chen et al. 1999), for which a cognate TF in C. elegans remains unknown; and a heat shock element (HSE) (Sorger 1991), which binds the HSF-1 heat shock-responsive TF (Chiang et al. 2012) (Figure 3.1C). Thus, additional TFs and regulatory elements may be involved in cadmium-responsive transcription of cdr-1. As the Mediator subunit mdt-15 is required for cadmium-induced expression of cdr-1, mtl-1 and mtl-2, this suggests that different combinations of TFs could interact with MDT-15 at these distinct promoters. In addition, it is worth noting that the requirements for additional Mediator subunits in the cadmium response have not been tested; therefore, additional Mediator subunits may cooperate with MDT-15 to regulate cadmium-inducible transcription. 104   Here, I show that, in addition to mdt-15, the cdk-8 Mediator subunit is required for cadmium-inducible transcription and cadmium resistance in vivo. Both cdk-8 and mdt-15 are required for both basal and cadmium-induced expression of the complex cdr-1 promoter. Investigating regulatory elements and TFs required for cadmium induction of the cdr-1 promoter, I find that elt-2 and GATA elements, and the HZA element are required for basal and cadmium-induced expression of cdr-1, suggesting that these factors may cooperate with cdk-8 and mdt-15 at this promoter. In contrast, other stress-responsive TFs, skn-1 and hsf-1, whose cognate regulatory elements are also found in the cdr-1 promoter, are dispensable for basal and cadmium-induced expression of this promoter. In addition, I show that DAF-16, acting through the DBE, represses cadmium-induced transcription of the cdr-1 promoter. Thus, I define TFs that act together with or in parallel to cdk-8 and mdt-15 to promote cadmium-inducible transcription, in opposition to negative regulation by DAF-16.    105   Figure 3.1 Regulatory elements in promoters of cdr-1, mtl-1 and mtl-2 cadmium-responsive genes. 106  (A) Diagram of regulatory elements found in promoters (-1500 base pairs) of cdr-1, mtl-1, and mtl-2 (not drawn to scale). Gray hatching denotes regulatory elements that activate cadmium-inducible transcription of mtl-1 or mtl-2 (Moilanen et al. 1999; Roh et al. 2015). (B) Diagram of regulatory elements found in promoters (-1500 base pairs) of two cdk-8-independent cadmium-inducible genes, cdf-2 and gst-38. (C) Regulatory element consensus sequences and their prevalence upstream (-1500 base pairs) of cadmium-inducible genes vs. all C. elegans genes, and cognate TFs. *p<0.05, **p<0.01, ****p<0.0001 vs. all genes. Regulatory elements for which cognate TF is unknown are indicated by a question mark. Regulatory element abbreviations: ARE, antioxidant response element; MRE, metal response element; HSE, heat shock response element; DBE, DAF-16 binding element; HZA, high zinc-activated element; HRE, hypoxia response element. White hatching denotes TFs that activate mtl-1 or mtl-2 transcription (as indicated) and/or promote cadmium resistance (Moilanen et al. 1999; Barsyte et al. 2001; Zhang et al. 2013).   3.3 Results  3.3.1 cdk-8 is required for induction of cadmium-responsive genes  To identify cdk-8-dependent genes, we compared the transcriptional profiles of developmentally synchronized L4 larval stage cdk-8(tm1238) null mutants to wild-type N2 worms using microarrays. In total, 829 genes were upregulated and 461 genes were downregulated more than two-fold in cdk-8 null mutants. To identify biological processes that require cdk-8, we then compared the cdk-8-dependent gene set to other published gene lists using EASE (Hosack et al. 2003; Engelmann et al. 2011). This unbiased analysis revealed significant overlaps between cdk-8-dependent genes (up- or downregulated in cdk-8 mutants) and cadmium-responsive genes (up- or downregulated in response to cadmium exposure; (Cui et al. 2007)), with the exception of cdk-8-repressed genes and cadmium-activated genes (Figure 3.2A). Using quantitative PCR (qPCR), I validated selected overlapping genes to demonstrate 107  that they are indeed downregulated (cdr-1, acdh-1, T24B8.5) or upregulated (C31B8.4) in cdk-8 mutants compared to N2, in the absence of cadmium exposure (Figure 3.2B). Overall, these data demonstrate that cdk-8 is required for basal expression of a subset of cadmium-responsive genes, although direct action of CDK-8 at these promoters has not yet been established.  I next tested whether cdk-8 promotes induction of cadmium-responsive genes upon cadmium exposure by comparing the relative mRNA expression of three highly cadmium-inducible genes, cdr-1, mtl-1, and mtl-2, in N2 and cdk-8 mutants prior to (0 hours) or following (4 hours) exposure to 100 µM cadmium (Cd2+). Unlike the basal expression of cdr-1, basal expression of mtl-1 and mtl-2 was not significantly altered in cdk-8 mutants compared to wild type (Figure 3.2C). All three of these genes were strongly induced by cadmium exposure in N2 (Figure 3.2C). Cadmium induction of cdr-1 and mtl-1 was significantly impaired in cdk-8 mutants compared to wild type; mtl-2 showed a similar trend (Figure 3.2C). However, induction of two additional cadmium-responsive genes that were not differentially expressed in cdk-8 mutant microarrays, cdf-2 and gst-38, was not affected in cdk-8 mutants (not shown). In addition, using a transcriptional GFP reporter, I found that cdk-8 is required for basal expression and cadmium induction of a 2.8 kb promoter upstream of the cdr-1 transcription start site (see methods for details on reporter construction; Figure 3.2D). Thus, cdk-8 is required for full induction of a subset of cadmium-responsive genes.  I next compared the promoters of cdk-8-dependent (cdr-1, mtl-1, mtl-2) vs. cdk-8-independent cadmium-responsive genes (cdf-2, gst-38), to identify regulatory elements that may define cdk-8-dependent cadmium-responsive promoters. GATA and HZA elements are the only regulatory elements common to the cdk-8-dependent promoters cdr-1, mtl-1, and mtl-2, and indeed these are the only identifiable elements in the mtl-2 promoter (Figure 3.1A). The gst-38 108  promoter contained GATA, MRE and HRE sites (Figure 3.1B); unlike the cdk-8-dependent cadmium-responsive promoters, the gst-38 promoter did not contain an HZA element. The cdf-2 promoter, however, contained several GATA elements and one HZA element, similar to the mtl-2 promoter (Figure 3.1B). Therefore, based on this small sample of promoters, I cannot identify a set of regulatory elements that define cdk-8-dependent vs. cdk-8-independent cadmium-responsive promoters. Future work will include unbiased analysis of the promoters of the set of cdk-8-dependent cadmium-responsive genes vs. cdk-8-independent cadmium-responsive genes identified in our microarray comparison (Figure 3.2A), to identify over-represented TF binding motifs. 109   110  Figure 3.2 cdk-8 is required for cadmium-inducible gene expression. (A) Venn diagrams depicting statistically significant overlaps between cdk-8-dependent genes and cadmium-responsive genes. Fisher’s exact test p-values shown. (B) qPCR analysis of cadmium-responsive genes in cdk-8 mutants grown in standard culture conditions. Error bars: SEM, n = 3 independent trials. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. N2, unpaired t-test. (C) qPCR analysis of cadmium-responsive genes in wild type or cdk-8 mutants exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Fold induction values represent the relative mRNA expression in cadmium-exposed worms divided by the relative mRNA expression in control (no cadmium) worms within a genotype. Error bars: SEM, n = 3 independent trials. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. no cadmium control in the same genotype, or for the comparison indicated, unpaired t-test. (D) Representative images of cdr-1P::GFP transcriptional reporter (green) in wild type or cdk-8 mutants exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Co-injection marker: myo-2P::mCherry (red). Scale bar: 300 µm. Bar graph represents average fluorescence intensity (arbitrary units, A.U.); error bars: SEM, n " 10 worms. ** p < 0.01, **** p < 0.0001 vs. no cadmium control in the same genotype, or for the comparison indicated, unpaired t-test.   3.3.2 cdk-8 is required for cadmium resistance in vivo  To further verify the requirement for cdk-8 in the cadmium response, I tested if loss of cdk-8 causes cadmium sensitivity. Cadmium sensitive worms show impaired larval growth when grown in the presence of cadmium (Cui et al. 2007). Therefore, I compared the developmental rate of cdk-8 and wild-type worms grown in the presence of 0 (control), 2.5, 5, 10, or 25 µM cadmium. In the absence of cadmium, cdk-8 mutants developed slightly slower than wild type, as 94-98% of wild-type but only ~72-82% of cdk-8 mutants developed from L1 stage worms into L4 stage worms in 40 hours at 20°C (starting from synchronized arrested L1 larvae; see methods for details); therefore, I normalized all developmental rate data to the fraction of animals reaching L4 in the 0 µM cadmium control condition within each genotype (‘normalized fraction L4’, Figure 3.3). I found that some wild-type worms exhibited delayed growth in the 111  presence of 10 µM cadmium, and nearly all were delayed in 25 µM cadmium (Figure 3.3). cdk-8 mutants showed a strong trend toward growth delay starting at 5 µM cadmium, and a significantly greater proportion of cdk-8 mutants exhibited delayed growth in 10 µM cadmium compared to wild type (Figure 3.3). Therefore, cdk-8 mutants exhibit increased cadmium sensitivity compared to wild type, suggesting that cdk-8 is required for cadmium resistance in C. elegans.   Figure 3.3 cdk-8 is required for cadmium resistance in C. elegans. Cadmium sensitivity of cdk-8 mutants as assessed by severity of growth delay when raised in increasing concentrations of cadmium. Normalized fraction L4 represents the fraction of animals that reached L4 after 40 hours at 20°C relative to no cadmium control (see Materials and methods, Section 3.5.5 for details). Error bars: SEM, n = 3 independent trials. * p < 0.05, unpaired t-test.  3.3.3 mdt-15 is required for basal expression and induction of the cdr-1 promoter  As the Mediator subunit mdt-15 was previously found to be required for cadmium-inducible transcription, including induction of cdr-1, mtl-1, and mtl-2 (Taubert et al. 2008), I wished to verify that mdt-15, like cdk-8, is required at the 2.8 kb cdr-1 promoter. RNAi 112  knockdown of mdt-15 caused a statistically significant ~3-fold decrease in cdr-1P::GFP reporter expression in the absence of cadmium compared to empty vector (EV) RNAi (Figure 3.4). Furthermore, mdt-15 knockdown completely abrogated induction of the cdr-1P::GFP reporter in response to cadmium (Figure 3.4). Therefore, mdt-15 is required for both basal expression and cadmium induction of the cdr-1 promoter.   Figure 3.4 mdt-15 is required for cadmium-inducible transcription of the cdr-1 promoter. Fluorescence intensity of cdr-1P::GFP transcriptional reporter with empty vector (EV) or mdt-15 RNAi exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). A.U.: arbitrary units. Error bars: SEM, n " 19 worms. **** p < 0.0001 vs. no cadmium control in the same genotype, or for the comparison indicated, unpaired t-test. Fold induction values represent the average fluorescence intensity in cadmium-exposed worms divided by the average fluorescence intensity in control (no cadmium) worms within a genotype.  3.3.4 elt-2, GATA, and HZA are required for induction of the cdr-1 promoter  Next, I aimed to identify TFs that cooperate with cdk-8 and mdt-15 to regulate cadmium responsive genes such as cdr-1. The cdr-1 promoter contains several regulatory element consensus sequences (Figure 3.1A, Figure 3.5A), which may recruit specific TFs. Comparison of 113  the prevalence of these consensus regulatory elements upstream of cadmium-inducible genes (Cui et al. 2007) vs. all C. elegans genes showed that HZA elements are enriched 10-fold upstream of cadmium-inducible genes compared to all C. elegans genes (Figure 3.1C). This estimate may be low due to the limitations of using a consensus sequence. In addition, GATA elements, DBEs, and MREs are slightly but significantly enriched upstream of cadmium-inducible genes compared to all C. elegans genes (Figure 3.1C). This analysis may also have missed additional enrichments due to the limitations of consensus sequences.   As HZA and GATA elements are sufficient to drive cadmium inducible gene expression from a minimal promoter (Roh et al. 2015), I first tested whether HZA and GATA elements are required for cadmium induction of the cdr-1 promoter. To this end, I generated substitution mutations in the cdr-1P::GFP reporter’s HZA site (mutHZA) or in its two GATA sites (mutGATA1 and mutGATA2; Table 3.1).    114  Table 3.1 cdr-1 promoter regulatory element mutants.  Strand Wild-typea Mutanta References HZA (+) AACAGAAACTACAAT GGTGAGGGTCGTGGC Roh et al. 2015 GATA1 (-) TGTGATAAAA TGCAGCGGAA Liao et al. 2002, McGhee et al. 2007 GATA2 (-) TGTGATAAGA TGCAGCGGGA Liao et al. 2002, McGhee et al. 2007 MRE (+) TGCACCC CATGTTT Stuart et al. 1984, Chen et al. 1999, Liao et al. 2002 DBE (+) TGTTTAC CACCCGT Furuyama et al. 2000, Murphy et al. 2003      a Residues targeted by site-directed mutagenesis shown in bold.   Mutation of the HZA element caused a ~2.5-fold decrease in basal cdr-1P::GFP reporter expression, and a ~40-fold decrease in cadmium-induced expression compared to the wild-type cdr-1P reporter (Figure 3.5B). Furthermore, mutation of the HZA abrogated cadmium induction of the cdr-1P reporter (Figure 3.5B). Mutation of GATA1 had no effect on basal expression of the cdr-1P, but abrogated cadmium induction (Figure 3.5C). In contrast, mutation of GATA2 caused a ~4-fold decrease in basal cdr-1P::GFP reporter expression, and a ~7-fold decrease in cadmium-induced expression compared to the wild-type cdr-1P reporter (Figure 3.5C). The cdr-1P(mutGATA2)::GFP reporter was still induced by cadmium exposure, but the fold induction was reduced to about half that of the wild-type reporter (Figure 3.5C). Therefore, the GATA1 element is required only for cadmium-induced expression, whereas the HZA and GATA2 elements are required for both basal and cadmium-induced expression of the cdr-1 promoter. 115   The ELT-2 TF binds to GATA elements, and is required for cadmium induction of the metallothionein gene mtl-2, whose promoter contains GATA elements (Moilanen et al. 1999). Therefore, I tested if elt-2 is required for basal or cadmium-induced expression of the cdr-1 promoter. RNAi knockdown of elt-2 caused a ~2-fold decrease in basal cdr-1P::GFP reporter expression compared to EV RNAi, and completely abrogated cadmium induction of the cdr-1P reporter (Figure 3.5D). As elt-2 is required for intestinal differentiation and function (McGhee 2013), I also tested if post-developmental elt-2 knockdown would cause similar defects in basal and inducible expression of the cdr-1 promoter. Indeed, worms exposed to elt-2 RNAi during the first two days of adulthood showed significant defects in basal and cadmium-induced expression of the cdr-1P::GFP reporter (Figure 3.5E). Therefore, elt-2 is required for basal expression and cadmium induction of the cdr-1 promoter, independently of its role in development. Currently I cannot rule out the possibility that elt-2 is required to maintain intestinal integrity in adults; however, I did not observe any gross morphological defects in intestines of animals treated with elt-2 RNAi in adulthood only.  116   117  Figure 3.5 elt-2 and an HZA-binding TF are required for cadmium-inducible expression of the cdr-1 promoter. (A) Diagram of the cdr-1P::GFP reporter (not drawn to scale). The first 11 base pairs downstream of the cdr-1 transcription start site are included in the reporter, but the cdr-1 start codon is mutated (G to C mutation at the +3 position) whereas the GFP start codon is intact. The MRE identified by Freedman and colleagues (Liao et al. 2002), marked with  an asterisk (*), is mutagenized in panel F. (B-C) Fluorescence intensity of wild-type cdr-1P::GFP transcriptional reporter compared to (B) HZA or (C) GATA site mutants exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Error bars: SEM, n " 18 worms. ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. no cadmium control in the same genotype, or for the comparison indicated, unpaired t-test. (D) Fluorescence intensity of cdr-1P::GFP transcriptional reporter with empty vector (EV) or stress-responsive TF RNAi exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Error bars: SEM, n " 14 worms. **** p < 0.0001 vs. no cadmium control in the same genotype, † † † p < 0.001 or † † † † p < 0.0001 vs. cdr-1P::GFP no cadmium control, ‡ ‡ ‡ ‡ p < 0.0001 vs. cdr-1P::GFP with cadmium, unpaired t-test. (E) Fluorescence intensity of cdr-1P::GFP transcriptional reporter with empty vector (EV) or elt-2 RNAi in first two days of adulthood. Error bars: SEM, n = 3 independent trials. * p < 0.05, *** p < 0.001, unpaired t-test. (F) Fluorescence intensity of cdr-1P::GFP transcriptional reporter and MRE mutant (MRE marked with asterisk in panel A) exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Error bars: SEM, n " 6 worms. *** p < 0.001, **** p < 0.0001 vs. no cadmium control in the same genotype. (G) Fluorescence intensity of cdr-1P::GFP transcriptional reporter and DBE mutant exposed for 4 hours to 100 µM Cd2+ (or no cadmium control). Error bars: SEM, n " 8 worms. ** p < 0.01, **** p < 0.0001 vs. no cadmium control in the same genotype, or for the comparison indicated, unpaired t-test. A.U.: arbitrary units. Fold induction values represent the average fluorescence intensity in cadmium-exposed worms divided by the average fluorescence intensity in control (no cadmium) worms within a genotype.  3.3.5 daf-16/FoxO is required to repress the cdr-1 promoter  To determine if additional TFs regulate cadmium responsive promoters, I depleted additional stress-responsive TFs with corresponding putative regulatory elements in the cdr-1 promoter. Specifically, cdr-1P contains putative SKN-1 binding sites (ARE-like), a putative 118  HSF-1 binding site (HSE), putative metal response elements (MRE), and a putative DAF-16 binding site (DBE) (Figure 3.1A, Figure 3.5A). RNAi knockdown of skn-1 or hsf-1 had no effect on basal or cadmium-induced expression of the cdr-1P::GFP reporter compared to EV RNAi (Figure 3.5D). There is no known MRE-binding TF in C. elegans, but mutation of the cdr-1 promoter MRE identified by Freedman and colleagues (Liao et al. 2002) had no effect on its basal or cadmium induced expression (Table 3.1, Figure 3.5F). I note that the cdr-1 promoter contains three additional MREs (Figure 3.1A), which I have not yet tested by mutagenesis. In contrast, daf-16 knockdown caused a significant ~1.5-fold increase in both basal and cadmium-induced expression of cdr-1P::GFP compared to EV RNAi (Figure 3.5D). This implies that daf-16 is required for repression of cadmium-induced cdr-1 expression.   As daf-16 typically acts as an activator of stress-responsive transcription (Murphy et al. 2003), we wished to test whether the observed derepression of the cdr-1 promoter was a direct or indirect effect of daf-16 depletion. To assess whether DAF-16 directly regulates the cdr-1 promoter, we examined the requirement for the DBE in cdr-1P::GFP repression. Mutatino of the DBE caused no change in basal cdr-1P::GFP expression (Figure 3.5G), suggesting that the effect observed in daf-16 RNAi is not directly mediated by the DBE. In contrast, mutation of the DBE caused a significant increase in cadmium-induced expression of the cdr-1 promoter compared to the wild-type cdr-1P::GFP construct (Figure 3.5G). Taken together with the observation that DAF-16 binds to DBEs in vitro (Furuyama et al. 2000), this suggests that DAF-16 can act directly at the cdr-1 promoter to repress cadmium-inducible expression.  3.3.6 Stress specificity of cdr-1 promoter induction  I next wished to test if the DBE represses induction of cdr-1 by stresses other than 119  cadmium. Induction of the cdr-1 promoter is thought to be highly specific to cadmium and zinc stress (Liao et al. 2002; Roh et al. 2015). Namely, the cdr-1 promoter does not appear to respond to other metals (copper, lead, mercury), oxidative stressors (juglone, paraquat), or heat shock, although this evidence comes from a LacZ reporter that is sensitive enough to detect cadmium-induced but not zinc-induced cdr-1 transcription (Liao et al. 2002; Roh et al. 2015). Therefore, I began by testing whether the wild-type cdr-1P::GFP reporter is responsive to oxidative stress, using sodium meta-arsenite (henceforth ‘arsenite’), an oxidizing agent and potent SKN-1 activator (An and Blackwell 2003; Goh et al. 2014); or to heat shock, which activates HSF-1-mediated transcription (Hsu et al. 2003). Exposure of worms expressing the wild-type cdr-1P::GFP reporter for 4 hours to 5 mM arsenite did not cause induction of the reporter (not shown). Heat shock for 1 hour at 37°C, followed by 1 hour recovery at 20°C, also did not cause cdr-1P::GFP reporter induction (not shown). Thus, cdr-1P::GFP is not induced by an oxidizing agent that activates SKN-1-mediated transcription, or to heat shock, which activates transcription via HSF-1. I hypothesized that DAF-16 and the DBE may repress responsiveness of cdr-1 ARE-like and HSE regulatory elements to arsenite and heat shock, respectively. Therefore, I tested if cdr-1P(mutDBE)::GFP was responsive to arsenite or heat shock. cdr-1P(mutDBE)::GFP was not induced by either of these stresses (not shown). Therefore, the DBE does not repress induction of the cdr-1 promoter by oxidative or heat stress.   3.4 Discussion  Exposure to the toxic heavy metal cadmium provokes a strong gene expression response in C. elegans. Previous studies have shown that the Mediator subunit mdt-15, GATA and HZA 120  regulatory elements, and the TF elt-2 are required to induce this response (Moilanen et al. 1999; Taubert et al. 2008; Roh et al. 2015). However, these studies may have missed additional factors that fine-tune cadmium responsive transcription for two reasons: first, these studies did not test Mediator subunits other than mdt-15 in the cadmium response, leaving open the possibility that other Mediator subunits may contribute to regulation of cadmium-inducible transcription; second, these studies primarily investigated simple cadmium-responsive promoters containing few regulatory elements, meaning that additional TFs could contribute to regulation of more complex cadmium-inducible promoters. Here, I demonstrated that the Mediator subunit cdk-8 is required for cadmium-inducible transcription and cadmium resistance in C. elegans. Analysis of the complex cdr-1 promoter revealed that cdk-8, mdt-15, elt-2, GATA elements, and an HZA element are each required for basal and cadmium-inducible cdr-1 expression, implying that these factors act together or in parallel at this promoter. As ELT-2 and GATA elements drive virtually all intestinal gene expression in adult worms, I propose that ELT-2 is a permissive factor for intestinal expression of cdr-1 (discussed in Section 3.4.5). Based on the fact that MDT-15 and CDK-8 engage NHR-family TFs in other contexts, and that NHRs are canonical xenobiotic stress-responsive TFs that may be capable of binding to cadmium, I propose that an NHR may regulate transcription via the HZA (discussed in Section 3.4.6). In addition, I found that daf-16 and the DBE are required to repress cadmium induction of the cdr-1 promoter. Thus, my study expands the known repertoire of regulators in the cadmium response to include the coactivator CDK-8 and the repressor DAF-16, implying that, together with MDT-15, ELT-2 and an HZA-binding TF, these factors provide combinatorial control of a complex cadmium-inducible promoter (Figure 3.6).  121   Figure 3.6 Proposed model of Mediator subunit, TF, and regulatory element roles in basal and cadmium-inducible transcription of the cdr-1 promoter. Top: Basal expression of the cdr-1 promoter requires the Mediator subunits CDK-8 and MDT-15, the ELT-2 GATA-family TF, and the GATA2 and HZA regulatory elements. I propose that ELT-2 serves as a permissive factor enabling intestinal transcription, e.g. by recruiting Mediator to intestinal promoters (gray dashed arrow), whereas an NHR may bind to the HZA element (orange dashed arrow) and reinforce recruitment of the Mediator complex to the cdr-1 promoter via specific interactions with CDK-8 and/or MDT-15 (black dashed arrows), thereby stimulating low levels of Pol II transcription (blue dashed arrow). Dashed arrows indicate proposed interactions. Bottom: Cadmium-induced expression of the cdr-1 promoter requires CDK-8, MDT-15, ELT-2, both GATA elements, and the HZA. I propose that ELT-2 primarily serves as a permissive factor enabling induction of transcription in the intestine, e.g. by recruiting Mediator to intestinal promoters (gray dashed arrow). Furthermore, I propose that an NHR bound to the HZA element (orange dashed arrow) senses cadmium (green dashed arrow), which may enhance recruitment of Mediator via specific interaction with CDK-8 and/or MDT-15 (bold black arrows), thereby stimulating Pol II recruitment, initiation, or elongation (bold blue arrow). Finally, DAF-16 and the 122  DBE are required for repression of cadmium-induced cdr-1 expression (repression arrow), but molecular target of DAF-16 remains unknown (indicated by ‘?’). Dashed arrows indicate proposed interactions.  3.4.1 cdk-8 promotes cadmium-responsive gene expression  cdk-8-dependent genes identified in our microarray analysis overlapped significantly with genes that are activated or repressed by cadmium exposure ((Cui et al. 2007); Figure 3.2A). As noted in Chapter 2 (Section 2.3.1), these genes may be direct or indirect targets of CDK-8. It is also important to note that, as our microarray analysis of cdk-8 mutants was conducted under standard laboratory conditions, i.e. in the absence of cadmium, this overlap only identified cadmium-responsive genes whose basal levels are altered in cdk-8 mutants vs. wild type, e.g. cdr-1 (Figure 3.2B). Upon cadmium exposure, cdk-8 mutants also showed a substantial, although not complete, block in cadmium induction of cdr-1, and of other cadmium-responsive genes whose basal expression levels were unchanged in cdk-8 mutants, e.g. mtl-1 (Figure 3.2C). I note that the observed decrease in the fold induction of e.g. cdr-1 and mtl-1 in cdk-8 mutants compared to wild type is not due to increased basal expression of these transcripts; in fact, their basal expression was decreased or unchanged in cdk-8 mutants compared to wild type (Figure 3.2C). Taken together, our microarray and qPCR analysis suggest that cdk-8 is required for basal and/or full cadmium-induced expression of a subset of cadmium-responsive genes. In the future, it will be interesting to expand this analysis, for example by genome wide expression profiling of cdk-8 mutants compared to wild type upon cadmium treatment, to determine the proportion of cadmium-responsive genes that require cdk-8 for cadmium induction.   In support of a requirement for cdk-8 in the cadmium response, I also showed that cdk-8 mutants are cadmium sensitive compared to wild type (Figure 3.3). Loss of individual cadmium-123  responsive genes has little effect on cadmium sensitivity in C. elegans; however, in double or triple mutants in mtl-1, mtl-2, and cdr-1, or in mtl-2 mutants subjected to RNAi knockdown of a panel of 50 other cadmium-responsive genes, cadmium toxicity phenotypes such as growth delay or egg laying defects become apparent (Cui et al. 2007; Hall et al. 2012). Thus, the C. elegans cadmium response appears to be highly redundant, perhaps due to the serious adverse effects of this heavy metal. My observation that cdk-8 mutants are cadmium sensitive supports a model in which cdk-8 acts upstream of multiple cadmium-responsive genes to activate their transcription.  A limitation of this study is that I have not assessed the tissue-specificity of cdk-8 action in the cadmium response. The intestine is a major site of detoxification in C. elegans (McGhee 2007). Accordingly, cdr-1 and mtl-2 are expressed solely in the intestine, and mtl-1 is expressed in the intestine and posterior pharynx (Figure 3.2D) (Freedman et al. 1993; Liao et al. 2002). cdk-8 appears to be expressed in most if not all C. elegans tissues, including the intestine (Steimel et al. 2013), suggesting that CDK-8 likely regulates cadmium-responsive gene expression cell autonomously in the intestine. Further work is needed to establish whether intestinal expression of a wild-type cdk-8 transgene is sufficient to rescue cadmium-responsive gene expression and cadmium sensitivity defects in cdk-8 mutants.    CDK8 has largely been studied in the context of transcriptional regulation downstream of cell signaling pathways governing cell proliferation or differentiation in animal development or in cancer cell lines ((Firestein et al. 2008; Morris et al. 2008; Donner et al. 2010); and this work, Chapter 2). However, there is also evidence that CDK8 promotes certain stress-responsive transcription programs. In response to DNA damage, the tumor suppressor p53 can activate genes involved in cell cycle arrest, DNA damage repair, metabolism and apoptosis (Vousden 124  and Prives 2009). Among these is the CDK inhibitor p21CIP1, encoded by the CDKN1A gene. Intriguingly, CDKN1A transcription is strongly activated by some stimuli but weakly activated by others, despite the fact that p53 is recruited to the CDKN1A promoter equally by these stimuli (Donner et al. 2007). This difference in expression correlates with increased CDK8 recruitment to the CDKN1A promoter during strong vs. weak induction, despite other Mediator subunits such as MED1 and MED17 (in the middle and head modules, respectively) being recruited equally by CDKN1A-activating stimuli (Donner et al. 2007). Furthermore, CDK8 siRNA knockdown decreases CDKN1A induction by strong inducers (Donner et al. 2007). Thus, CDK8 promotes strong induction of p53 target genes, suggesting that CDK8 may act as a p53 coactivator in the response to genotoxic stress. Interestingly, cadmium is associated with accumulation of p53 protein, and induces p53-dependent apoptosis in some prostate cancer cell lines (Aimola et al. 2012); however, as cyotoxic doses of cadmium cause DNA damage (Filipic et al. 2006), p53 induction is likely an indirect effect of cadmium toxicity.  CDK8 is also implicated in the hypoxia response. In hypoxic conditions, the hypoxia inducible factors HIF1# and HIF2# activate genes involved in switching from oxidative to glycolytic glucose metabolism and genes involved in the oxidative stress response (Semenza 2012). Expression of many HIF1# target genes under hypoxic conditions requires CDK8, which recruits the elongation factors BRD4 and SEC (Galbraith et al. 2013). Thus, CDK8 acts as a HIF1# coactivator. Intriguingly, cadmium activates HIF1# expression in cell culture, via a mechanism involving enhanced production of reactive oxygen species (Jing et al. 2012). However, the cdr-1 promoter does not contain a canonical HIF-1 binding site (HRE) (Shen et al. 2005), indicating that CDK-8-mediated regulation of HIF-1 likely does not play a role in 125  cadmium induction of cdr-1. On the other hand, the mtl-1 promoter contains a putative HRE (Figure 3.1A), suggesting that HIF-1 could potentially regulate its expression.   Cdk8 also promotes the activity of certain stimulus-responsive TFs in yeast. The galactose-inducible TF Gal4 is required to switch from glucose to galactose utilization in the absence of glucose (Johnston 1987). Cdk8-mediated phosphorylation promotes Gal4-driven transcriptional activation of galactose-inducible genes (Hirst et al. 1999), indicating that Cdk8 promotes adaptation to different carbon sources in yeast. The proteasome-activating TF Rpn4 is required for resistance to multiple cellular stressors (Wang et al. 2008). The Rpn4 protein is stabilized in a Cdk8-dependent manner in yeast strains with truncating mutations in the Pol II CTD (Aristizabal et al. 2013). Thus, Cdk8 promotes protein stability of a stress-responsive TF during the cellular stress response elicited by impaired CTD function. Interestingly, Rpn4 is required for resistance to cadmium stress (Wang et al. 2008), suggesting that Cdk8 may have an evolutionarily ancient role in cadmium-responsive transcription, although its TF target(s) in this pathway may differ from yeast to C. elegans. Overall, previous studies have shown that CDK8 can activate stimulus-responsive transcription in cell lines or in yeast. To my knowledge, my study provides the first evidence that CDK8 promotes stress-responsive transcription in vivo in multicellular organisms.  3.4.2 mdt-15 promotes expression of the cdr-1 promoter  mdt-15 is required for basal and cadmium-induced expression of certain cadmium-responsive genes, including mtl-1, mtl-2, and cdr-1 (Taubert et al. 2008). Furthermore, mdt-15 is required for zinc induction of the mtl-1 promoter, an event that also requires elt-2, GATA, and HZA elements (Roh et al. 2015). Thus, previous studies have suggested that mdt-15 may act 126  together with elt-2, at GATA elements, and perhaps with an HZA-binding TF. In this study, I show that mdt-15 is strongly required for basal and cadmium-induced expression of the cdr-1 promoter, which contains many additional stress-responsive regulatory elements, suggesting the involvement of additional TFs (see Section 3.3.3).  mdt-15 appears to be more strongly required at the cdr-1 promoter than cdk-8. Both mdt-15 and cdk-8 are required for basal expression of cdr-1 (Figure 3.2C, D, Figure 3.4). Cadmium induction of the cdr-1 promoter is completely abrogated in mdt-15 mutants, whereas in cdk-8 mutants, cdr-1 is still induced by cadmium, but at much reduced levels compared to wild type (Figure 3.2D, Figure 3.4). This suggests that mdt-15 is a critical coactivator of one or more of the TFs that activates both basal and cadmium-induced expression of the cdr-1 promoter. On the other hand, cdk-8 may only be partially required as a coactivator of the same TF(s).  Opposition or cooperation of CDK8 and MED15 in transcription have been previously described, either by action upon a common TF or by regulatory interactions between the two Mediator subunits. For example, MED15 binds to and promotes SREBP-driven transcription of a cholesterol and fatty acid homeostasis gene expression program (Yang et al. 2006), whereas CDK8 phosphorylates SREBP to promote its degradation, thereby opposing MED15 action on a common TF (Zhao et al. 2012). In yeast, both Med15 and Cdk8 promote transcriptional activation by the galactose-responsive TF Gal4, although the mechanism by which they cooperate to regulate this TF remains incompletely understood (Sadowski et al. 1996; Hirst et al. 1999). Within the yeast Mediator complex, Cdk8 phosphorylates the tail module subunit Med3, leading to ubiquitin-mediated degradation of Med3 and associated subunits Med2 and Med15 (Gonzalez et al. 2014). This negative regulatory relationship corresponds to a large degree of anticorrelation between the gene expression profiles of cdk8 vs. med2, med3 or med15 mutants: 127  many genes that are derepressed in cdk8 mutants genes are downregulated in med2, med3 and med15 mutants (van de Peppel et al. 2005). Similarly, I showed that in C. elegans, cdk-8 inhibits MDT-15-driven transcription by a post-transcriptional regulatory mechanism (see Section 2.3.9). Interestingly, closer examination of the gene expression profiles of yeast mutants reveals that some genes that are downregulated in cdk8 mutants also appear to require med2, med3 or med15 (van de Peppel et al. 2005), suggesting that these Mediator subunits may cooperatively activate gene expression in some contexts. This also appears to be the case in the cadmium response, as both cdk-8 and mdt-15 act to positively regulate transcription ((Taubert et al. 2008), and this study). By analogy to their regulatory relationships in other contexts, this suggests that CDK-8 and MDT-15 might cooperate as coactivators of a common cadmium-responsive TF, or that in response to cadmium, CDK-8 might post-translationally activate MDT-15. Further work is needed to distinguish these possibilities, e.g. by identifying a common TF binding partner of CDK-8 and MDT-15, or by measuring MDT-15 protein abundance in cdk-8 mutants vs. wild type exposed to cadmium.  3.4.3 cdr-1 promoter regulatory elements  The cdr-1 promoter provided an excellent system in which to identify additional cadmium-responsive TFs that may interact with cdk-8 and mdt-15. Regulatory element requirements in cadmium-inducible transcription have largely been investigated in the mtl-1 and mtl-2 promoters (Moilanen et al. 1999), or isolated regulatory elements derived from the mtl-1 promoter (Roh et al. 2015). Studies involving these promoters have been instrumental in identifying GATA and HZA elements as necessary and sufficient for cadmium-inducible transcription (Moilanen et al. 1999; Roh et al. 2015). Furthermore, mtl-1 transcription is 128  activated by DAF-16, as mtl-1 transcription is upregulated in insulin receptor mutants, which have increased DAF-16 activity (Murphy et al. 2003), and DAF-16 binds to the mtl-1 promoter in vivo (Zhang et al. 2013). However, these studies were conducted in standard laboratory conditions, and the contribution of DAF-16 to mtl-1 transcription in cadmium-exposed worms has not been investigated. Whereas the mtl-1 and mtl-2 promoters contain only GATA, HZA, DBE, or HRE regulatory elements, the cdr-1 promoter additionally contains putative ARE-like, MRE, and HSE elements (Figure 3.1A), whose contribution to cadmium-inducible transcription have not previously been investigated. Thus, the cdr-1 promoter allowed me to test whether additional TFs, such as SKN-1/Nrf2 (ARE-like binding) and HSF-1 (HSE binding), cooperate with the Mediator subunits mdt-15 and cdk-8 in cadmium-inducible transcription.   Complex promoters can confer highly specific gene expression patterns by recruiting a collection of TFs that are expressed or activated in a tissue-specific or stimulus-specific manner (Gaudet and McGhee 2010). Induction of the cdr-1 promoter is highly specific to cadmium and zinc stress, as other transition metals (lead, mercury, copper), oxidizing agents, or heat stress do not the induce cdr-1 promoter (Liao et al. 2002; Roh et al. 2015). Thus, at the outset of this study, I presumed that, instead of activating cdr-1 transcription in response to many different stresses, the complex array of regulatory elements in the cdr-1 promoter might instead contribute in a combinatorial fashion to cadmium induction of cdr-1, each contributing to cdr-1 activation in response to a different aspect of cadmium stress. For example, cadmium causes oxidative stress by depleting the antioxidant glutathione (Figueiredo-Pereira et al. 1998), which could promote SKN-1-dependent transcription via ARE-like sites. In addition, cadmium stress causes protein aggregation (Figueiredo-Pereira et al. 1998), which might activate HSF-1-dependent transcription via the HSE, as hsf-1 is required for detoxification of aggregation-prone proteins 129  (Hsu et al. 2003; Cohen et al. 2006). Furthermore, MREs are critical for cadmium-inducible transcription driven by metal-responsive transcription factor 1 (MTF-1) in other organisms (Wimmer et al. 2005), and although a C. elegans MTF-1 homolog has not been identified, the presence of MRE consensus sequences in the cdr-1 promoter suggested that a cryptic MTF-1 homolog could act at this promoter. However, my study demonstrates that skn-1, hsf-1 and at least one of the MREs are not required for cadmium induction of the cdr-1 promoter (Figure 3.5D, F), and that neither the oxidative stressor arsenite nor heat shock can induce the cdr-1 promoter (not shown). As the cdr-1 promoter contains additional MRE sites (Figure 3.1A), further site-directed mutagenesis analyses are required to rule out MRE-mediated regulation. I found that the intestine-specific TF elt-2 and its cognate GATA elements, and the cadmium- and zinc-activated HZA element, are strongly required for cdr-1 induction (Figure 3.5B-D). Thus, the specificity of the cdr-1 promoter toward cadmium and zinc does not appear to be achieved by combinatorial activation by multiple TFs responding to different aspects of cadmium stress. I also found that daf-16 and its DBE are required to repress cadmium induction of the cdr-1 promoter (Figure 3.5G), which led me to hypothesize that DAF-16 may prevent induction of the cdr-1 promoter by other stresses. However, loss of the DBE did not allow the cdr-1 promoter to be induced by oxidative stress or heat shock. Therefore, it is tempting to speculate that cdr-1 is specifically induced by cadmium and zinc not because of repression via DAF-16, but because of a cadmium- and zinc-sensing TF (see Section 3.4.6 for further discussion).  Some of the regulatory elements examined in this study were enriched in cadmium-inducible promoters. Specifically, we found that HZA elements are enriched at least 10-fold upstream of cadmium-inducible genes compared to all C. elegans genes (Figure 3.1C). Kornfeld and colleagues previously examined the promoters of 29 genes that are induced greater than 4-130  fold in response to cadmium, and found that all contained HZA elements (Roh et al. 2015). Thus, our estimate that 6% of cadmium-inducible promoters contain HZA elements is likely low, perhaps because we used consensus sequences as a proxy for position frequency matrices to define regulatory element motifs. Furthermore, I found that GATA elements, DBEs, and MREs are slightly but significantly enriched upstream of cadmium-inducible genes (Figure 3.1C). Conversely, ARE-like elements and HSEs are not enriched upstream of cadmium-inducible genes (Figure 3.1C); however, these analyses may also have been limited by the use of consensus sequences instead of motif position frequency matrices. It is important to note that core GATA elements, ARE-like elements, and MREs were each present upstream of more than 50% of C. elegans genes. This implies that their presence upstream of e.g. cdr-1 does not indicate a functional role a priori, as evidenced by my genetic analyses showing that GATA elements but not AREs or an MRE are required for cadmium induction of the cdr-1 promoter.   3.4.4 SKN-1-independent MDT-15 action at the cdr-1 promoter  MDT-15 and SKN-1 cooperate to promote oxidative stress-responsive transcription. Specifically, mdt-15 is required for basal and/or oxidizing agent-induced expression of several skn-1-dependent genes (Goh et al. 2014), which have predicted ARE-like SKN-1 binding sites. Furthermore, MDT-15 binds to SKN-1, indicating that it is a direct coactivator of this TF (Goh et al. 2014). I found that although the cdr-1 promoter contains two ARE-like motifs (Figure 3.1A), its basal and cadmium-inducible expression requires mdt-15 but not skn-1 (Figure 3.4, Figure 3.5D). In support of skn-1-independent cadmium-responsive transcription, Choi and colleagues have shown that skn-1 mutants are not significantly more cadmium sensitive than 131  wild-type worms (Roh et al. 2009). Taken together, these findings suggest that MDT-15 engages different TFs in oxidative stress-responsive vs. cadmium-responsive transcription.  3.4.5 ELT-2 and GATA elements in cdr-1 promoter induction  I found that elt-2 and GATA elements are required for basal and/or cadmium-inducible expression of the cdr-1 promoter (Figure 3.5C-E, Figure 3.6). Specifically, elt-2 RNAi knockdown or mutation of the cdr-1 promoter GATA2 element caused significant reduction of both basal and cadmium-induced expression of the cdr-1P::GFP reporter, whereas mutation of the GATA1 element affected cadmium-induced but not basal expression of the reporter. Similarly, the mtl-1 and mtl-2 promoters also contain multiple GATA elements, but not all are required for cadmium-inducible transcription (Moilanen et al. 1999).Why are GATA elements differentially required in cadmium-responsive promoters? Bioinformatic analysis of intestinally-expressed gene promoters identified an extended 10 base pair GATA-like consensus sequence: A1(A/C/T)2T3G4A5T6A7A8 (A/G)9(A/G)10 (McGhee et al. 2007). The cdr-1 extended GATA-like elements differ in sequence at position 9 (Table 3.1), which could account for their differential requirements in basal transcription of the cdr-1 promoter. Neither of the cdr-1 GATA elements conforms perfectly to the extended GATA-like consensus sequence (Table 3.1), which could explain why both GATA sites are required for cadmium-inducible expression of the cdr-1 promoter. By contrast, investigation of two GATA elements in the mtl-1 promoter previously showed that only one GATA element, which perfectly matches the extended GATA-like consensus sequence, is required for cadmium-inducible expression (Moilanen et al. 1999). Thus, differences in extended GATA-like sequences could explain the differential requirements for the 132  cdr-1 GATA elements in basal transcription, but single base pair mutagenesis studies are needed to explore this possibility.  Several intestinal gene expression responses require elt-2. Immunity to multiple intestinal pathogens requires elt-2, including Salmonella enterica, Pseudomonas aeruginosa, Enterococcus faecalis, and Cryptococcus neoformans (Kerry et al. 2006). elt-2 is required for gene expression changes in response to S. enterica infection and in recovery following acute exposure to this pathogen (Kerry et al. 2006; Head and Aballay 2014). elt-2 is also required for the gene expression response to P. aeruginosa infection. In this context, elt-2 appears to cooperate with the TFs atf-7 or skn-1, effectors of the p38 MAPK innate immune response pathway (Block et al. 2015). Finally, as outlined above, elt-2 and its GATA site are required for transcription of the mtl-1 promoter in response to excess zinc (Roh et al. 2015). Thus, elt-2 is required for transcription induced by multiple stressors in the C. elegans intestine.  The extended GATA-like element defined by McGhee and colleagues is found in virtually all intestinally-expressed promoters in C. elegans, and ELT-2 is the predominant GATA-family TF required for expression of most intestinal genes in adults (McGhee et al. 2007). This suggests that, although critical for the expression of intestinal genes such as cdr-1, ELT-2 is unlikely to be a specific driver of the gene expression response to cadmium exposure. Instead, ELT-2 likely functions as a permissive factor required for basal intestinal transcription and inducible responses to many stimuli. Taken together with my analysis of the cdr-1 promoter, this can account for the tissue-specific expression pattern of cdr-1: others and I have shown that cdr-1 is expressed solely in the intestine, both in the absence and presence of cadmium (Figure 3.2D) (Liao et al. 2002). I showed that elt-2 and GATA elements are strongly required for basal and cadmium-induced expression of the cdr-1 promoter (Figure 3.5C-E), suggesting that the cdr-133  1 promoter GATA sites drive intestine-specific expression by recruiting ELT-2, which is only expressed in intestinal cells. At the cdr-1 promoter, ELT-2 may be required for critical steps in transcription, e.g. Mediator recruitment, thus ensuring intestine-specific activation of a globally expressed transcriptional coregulator (Figure 3.6). However, chromatin immunoprecipitation experiments are needed to determine if ELT-2 influences Mediator occupancy at the cdr-1 promoter. In addition, an HZA-binding TF could also be expressed in an intestine-specific manner, thereby contributing to the intestine-specificity of cdr-1 expression.  Mediator requirements in GATA factor-driven transcription have been studied in Drosophila hematopoiesis. Specifically, 20 of 30 Mediator subunits, including the CKM, are required for transcription driven by the GATA factor Serpent and the RUNX factor Lozenge in hemocytes. Indeed, CDK8, Cyclin C, MED12 and MED13 are required for proliferation of Drosophila platelet (crystal cell) progenitors, a Serpent/GATA-dependent process. In contrast, MED12 and MED13, but not CDK8 and Cyclin C, are required for differentiation of mature crystal cells, a process driven by Serpent/GATA and Lozenge/RUNX (Gobert et al. 2010). This raises the intriguing possibility that, in Drosophila hematopoiesis, CDK8 and Cyclin C may be dispensable for GATA factor-driven transcription when it acts together with a second cell type-specific TF. In contrast, in the current study I show that cdk-8 is required for transcription of a promoter driven by both a GATA factor and an HZA-binding TF, suggesting that CDK-8 is not dispensable in all cases where GATA factors cooperate with additional TFs.  3.4.6 The HZA element in cdr-1 promoter induction  I found that the HZA element is required for basal expression and cadmium induction of the cdr-1 promoter (Figure 3.5C, Figure 3.6). The HZA element was discovered as a regulatory 134  element necessary for transcription induced by excess zinc (Roh et al. 2015). This element is present in many cadmium-responsive genes, including cdr-1, mtl-1, and mtl-2, and is sufficient to drive cadmium-inducible transcription in combination with a GATA element and minimal promoter (Roh et al. 2015). The overlap between regulatory elements driving cadmium- and zinc-inducible transcription may stem from the similar biological targets of these transition metals. For example, both cadmium and zinc bind to protein sulfhydryl groups (Vallee and Ulmer 1972). Kornfeld and colleagues have hypothesized that cadmium binds to a zinc-sensing TF to activate transcription via the HZA (Roh et al. 2015). Alternatively, it is conceivable that as cadmium and zinc bind to the same metal storage proteins (e.g. metallothioneins; (Vallee and Ulmer 1972)), cadmium could displace zinc from its storage sites, leading to a transient excess of zinc that induces transcription via a zinc-binding TF and the HZA. Interestingly, none of the TFs or Mediator subunits identified in the current study are transcriptionally regulated by cadmium (Cui et al. 2007), although post-translational regulation of these factors has not been explored. Furthermore, ELT-2 is constitutively localized to intestinal nuclei (Fukushige et al. 1999), and the DNA binding affinity of ELT-2 is not affected by cadmium (Moilanen et al. 1999), indicating that cadmium is unlikely to enhance ELT-2 interaction with GATA elements to drive cadmium-inducible gene expression. Therefore, I favour the possibility that a cadmium- or zinc-activated HZA-binding TF may coordinate cadmium-inducible transcription. For example, in its metal-activated state, an HZA-binding TF could enhance Mediator recruitment to cadmium-responsive promoters, thereby stimulating Pol II recruitment, initiation, or elongation (Figure 3.6). However, chromatin immunoprecipitation experiments are needed to determine if the HZA is required for CDK-8, MDT-15 and/or Mediator complex recruitment, and Pol II recruitment and/or CTD phosphorylation at the cdr-1 promoter.  135   NHRs make attractive candidates for the HZA-binding TF for several reasons (Figure 3.6). First, many NHRs are able to sense and respond to xenobiotics (Handschin and Meyer 2003), suggesting that NHRs could also sense cadmium and zinc. Second, although NHRs typically bind to xenobiotics via their ligand binding domain, their DNA binding domain could potentially bind to cadmium, as it consists of two C4 zinc finger domains, which use four cysteine residues to coordinate a zinc ion (Mangelsdorf et al. 1995). Thus, as cadmium and zinc bind to protein sulfhydryl groups (Vallee and Ulmer 1972), NHRs might be able to sense these metals via the cysteine-rich DNA binding domain. Third, mdt-15 is required for cadmium- and zinc-inducible transcription ((Taubert et al. 2008; Roh et al. 2015), and this study), and MDT-15 engages multiple NHRs (Taubert et al. 2006; Arda et al. 2010), suggesting that MDT-15 might also interact with an NHR in the cadmium and zinc responses (Figure 3.6).   CDK8 is required for NHR-driven transcription in human cells and in Drosophila. Human CDK8 is required, as part of the Mediator complex, for thyroid hormone-activated transcription driven by TR (Belakavadi and Fondell 2010). Furthermore, CDK8 was recently identified as a coactivator required for DNA binding and transcription driven by a Drosophila NHR, the Ecdysone Receptor (EcR) (Xie et al. 2015). CDK8 binds directly to EcR and contains a conserved LXXLL NHR binding motif (Xie et al. 2015), suggesting that CDK8 may also bind to NHRs in other species. Further work is needed to determine whether CDK8-NHR interactions may be required in cadmium-responsive transcription (Figure 3.6), by testing whether the conserved LXXLL motif in C. elegans CDK-8 is required for cadmium-inducible transcription of the cdr-1 promoter.  136  3.4.7 DAF-16 and DBE in cdr-1 promoter repression  I found that daf-16 and the DBE are required to repress cadmium-induced expression of the cdr-1 promoter (Figure 3.5D, G, Figure 3.6). Requirement for the DBE suggests that DAF-16 may bind directly to the cdr-1 promoter to restrain its induction by cadmium, but the molecular mechanisms underlying this repression remain to be identified. Gene expression profiling has identified sets of genes that are upregulated in insulin receptor (daf-2) mutants in a daf-16-dependent manner, which include many stress-responsive genes required for the extended lifespan of daf-2 mutants (Class I genes), or genes that are downregulated in daf-2 mutants in a daf-16-dependent manner, which include many metabolic genes that are detrimental to the lifespan of wild-type worms (Class II genes) (Murphy et al. 2003). Interestingly, the DBE is overrepresented in both Class I and Class II genes (Murphy et al. 2003), suggesting that DAF-16 directly activates and represses these genes, respectively. As cdr-1 is repressed by DAF-16, it would be interesting to determine if it behaves as a canonical Class II gene, i.e. repressed in daf-2 mutants and detrimental to lifespan.  The relationship between mdt-15 and the insulin signaling pathway in longevity-promoting gene transcription and in oxidative stress-responsive transcription has previously been explored. DAF-16 appears to regulate some of its longevity-promoting target genes in a cell non-autonomous manner, dependent on mdt-15. Specifically, daf-2 mutants expressing daf-16 only in the intestine are still able to activate certain DAF-16-target genes in muscle and hypodermis, but this cell non-autonomous activation is abrogated by mdt-15 knockdown (Zhang et al. 2013). In this context, mdt-15 activity may also be cell non-autonomous, as mdt-15 appears to be expressed in the intestine and neurons, but not in muscle and hypodermis (Zhang et al. 2013). As transcription of mdt-15 itself is activated by DAF-16 (Murphy et al. 2003), Kenyon and 137  colleagues have hypothesized that intestinal DAF-16 may activate mdt-15 transcription in the intestine, which then promotes the production of a lipid signal that alters gene expression in other tissues (Zhang et al. 2013). In line with a role for mdt-15 downstream of daf-16, mdt-15 is required more strongly for longevity of daf-2 mutants than of daf-2; daf-16 mutants (Zhang et al. 2013). In the oxidative stress response, DAF-16 also regulates many stress response genes (Murphy et al. 2003). In the absence of oxidative stress, daf-2 mutants upregulate several stress response genes, in a manner dependent on mdt-15 and skn-1 (Goh et al. 2014). Therefore, mdt-15 is required for upregulation of oxidative stress response genes in daf-2 mutants. However, in this context mdt-15 appears to act primarily through skn-1, and has little effect on daf-16-dependent oxidative stress response gene transcription (Goh et al. 2014). Overall, in longevity, mdt-15 appears to function downstream of daf-16, and in the oxidative stress response, mdt-15 appears to function in parallel to daf-16, suggesting that MDT-15 is not a coactivator of DAF-16-driven transcription. In the present study, I found that mdt-15 and daf-16 act in opposition at the cdr-1 promoter, suggesting that in this context, too, MDT-15 is not a coactivator of this canonical stress-responsive TF.  Overall, I demonstrate that the Mediator subunits cdk-8 and mdt-15, the GATA and HZA regulatory elements, and the TF elt-2 are required for cadmium induction of the cdr-1 promoter. In contrast, the stress-responsive TFs skn-1 and hsf-1 are not required for cdr-1 induction, and daf-16 is required to repress cadmium-inducible cdr-1 transcription. Thus, this work defines the TFs that cooperate with or oppose two Mediator subunits at a highly complex, inducible promoter.   138  3.5 Materials and methods 3.5.1 Microarrays and data analysis  Microarray gene expression profiling was performed at the UCSF SABRE Functional Genomics Facility. We used Agilent C. elegans (V2) 4x44K Gene Expression Microarrays (#G2519F-020186) and single color labeling. Total RNA was extracted from developmentally synchronized mid-L4 stage worms as assessed by vulval morphology (wild-type N2 worms and cdk-8(tm1238) mutants), as described (Taubert et al. 2008). RNA quality was assessed on an Agilent 2100 Bioanalyzer using a Pico Chip (Agilent). RNA was amplified and labeled with Cy3-CTP using the Agilent low RNA input fluorescent linear amplification kit. Labeled cRNA was assessed using the Nanodrop ND-100, and equal amounts of Cy3 labeled target were hybridized to the microarrays for 14 hrs, according to the manufacturers protocol. Arrays were scanned using the Agilent microarray scanner and raw signal intensities were extracted with Feature Extraction v9.1 software. The dataset was normalized using quantile normalization (Bolstad et al. 2003). No background subtraction was performed, and median feature pixel intensity was used as raw signal before normalization. All arrays were of good quality and had similar foreground and background signal distributions for both mRNA and control probes. This suggests that quantile normalization is appropriate. To identify differentially expressed genes, a linear model was fit to the comparison to estimate the mean M values and calculate moderated t-statistic, B statistic, false discovery rate, and p-value for each gene. Adjusted p-values (AdjP) were produced as described (Holm 1979). All procedures were carried out using functions in the R package limma in Bioconductor (Gentleman et al. 2004; Smyth 2004). Using this approach, we identified a total of 1860 spots with an AdjP < 0.05 and a fold-change " 2 (representing 461 139  downregulated and 829 upregulated genes). Microarray data have been deposited in Gene Expression Omnibus (GSE68520).  Differentially expressed genes were compared to published gene expression datasets using EASE (Hosack et al. 2003). Microarray analysis of wild-type worms exposed to 100 µM Cd2+ for 4 or 24 hours had previously identified 53 genes downregulated and 237 genes upregulated in response to cadmium exposure (Cui et al. 2007). We compared this set to our cdk-8 targets and calculated the significance of the overlap using Fisher’s exact test.  3.5.2 Regulatory element analysis    Candidate regulatory elements involved in the cadmium response, the high zinc response, or other detoxification or stress responses were identified in the literature (Stuart et al. 1984; Sorger 1991; Blackwell et al. 1994; Chen et al. 1999; Furuyama et al. 2000; Smale and Kadonaga 2003; An and Blackwell 2003; Shen et al. 2005; McGhee et al. 2007; Chiang et al. 2012; Roh et al. 2015). These included ARE, DBE, GATA element, HRE, HSE, HZA element, MRE, and TATA box. If available, the equivalent C. elegans consensus sequence for each regulatory element was identified in the literature, otherwise the eukaryotic consensus sequence was used. The cdf-2, cdr-1, gst-38, mtl-1, and mtl-2 promoters (-1500 base pairs) were searched manually for the candidate regulatory elements using SerialCloner 2.5 software. Analysis of -1500 base pair regions upstream of all cadmium-inducible genes (Cui et al. 2007) vs. all C. elegans genes (WBcel235 release 81) was conducted using oPOSSUM sequence-based single site analysis (Ho Sui et al. 2005).   140  3.5.3 C. elegans strains, culture, and genetic methods  C. elegans strains were cultured as described (Brenner 1974) at 20°C. We used nematode growth medium (NGM)-lite (0.2% NaCl, 0.4% tryptone, 0.3% KH2PO4, 0.05% K2HPO4) agar plates, supplemented with 5 µg/mL cholesterol. Plates were seeded with Escherichia coli strain OP50 unless otherwise indicated. Wild type is the N2 Bristol strain.; all other strains are listed in Table 3.2.  Table 3.2 C. elegans strains used in Chapter 3 Strain Genotype XA7703  cdk-8(tm1238) I STE101 steEx49[cdr-1P::GFP] STE102 cdk-8(tm1238) I; steEx49[cdr-1P::GFP] STE103 steEx50[cdr-1P(mutHZA)::GFP] STE104 steEx51[cdr-1P(mutGATA1)::GFP] STE105 steEx52[cdr-1P(mutGATA2)::GFP] STE106 steEx53[cdr-1P(mutDBE)::GFP] STE107 steEx54[cdr-1P(mutMRE)::GFP]  3.5.4 RNA isolation and quantitative real-time PCR  Total RNA was extracted from developmentally synchronized mid-L4 stage worms as assessed by vulval morphology. RNA isolation and qPCR were performed as described (Goh et al. 2014). We used t-tests (two-tailed, equal variance) to calculate statistical significance of gene expression changes between mutants (Gaussian distribution). qPCR primers were designed with 141  Primer3web (bioinfo.ut.ee/primer3/) and tested on serial cDNA dilutions to analyze PCR efficiency (primer sequences in Table 3.3).  Table 3.3 qPCR primer list for Chapter 3   Primer sequences (F/R) cdr-1 TCTTCTCTCAATTGGCAACTG / TTTGGGTAAACTTCATGACGA mtl-1 TGGATGTAAGGGAGACTGCAA / CATTTTAATGAGCCGCAGCA mtl-2 AAGTGTGCCAACTGCGAATGT / GCTTTCAAGAAAAAACCTCGA act-1 GCTGGACGTGATCTTACTGATTACC / GTAGCAGAGCTTCTCCTTGATGTC tba-1 GTACACTCCACTGATCTCTGCTGACAAG / CTCTGTACAAGAGGCAAACAGCCATG ubc-2 AGGGAGGTGTCTTCTTCCTCAC / CGGATTTGGATCACAGAGCAGC  3.5.5 Cadmium sensitivity assay  Synchronous L1 animals were grown at 20°C for 40 hours on NGM-lite plates seeded with 5x concentrated, heat-killed OP50 containing 0, 2.5, 5., 10, or 25 µM CdCl2. Developmental stage was scored by visual analysis. To normalize for differences in developmental timing between strains, the normalized fraction of L4 animals was calculated by dividing the fraction of L4s in a given cadmium-exposed population by the fraction of L4s in the 0 µM CdCl2 population for the same genotype.  The cdr-1P::GFP reporter was generated by PCR amplification of the genomic region from 2853 base pairs upstream to 11 base pairs downstream of the cdr-1 start codon (a G>C mutation at the +3 nucleotide was introduced in the reverse primer to mutate the cdr-1 start codon), and cloning into the pPD95.77 GFP vector from the Fire lab vector kit (Addgene plasmid #1495). Mutant transgenes were generated by site-directed mutagenesis of the 142  pPD95.77-cdr-1P plasmid using the Q5 Site-Directed Mutagenesis kit (NEB E0554S). Cloning primers are listed in Table 3.4. Transgenic strains were generated by injection of a mixture of 50 ng/µl GFP reporter plasmid, 5 ng/µl pCFJ90[myo-2p::mCherry], and 95 ng/µl pPD95.77 empty vector into N2 worms, then selecting transgenic mCherry-positive progeny.  Table 3.4 Cloning primer list for Chapter 3   Primer sequences (F/R) cdr-1P gtcgacTTTGACGATGACAGAAGAAATG / ggatccTGAATCCAAGATACTTGAGACAGT mutHZA tcgtggcAATTTTATCACAAAACACAGTTC / ccctcaccTCAATTGCAGAATACCATTTG mutGATA1 TACAATAATTccgctgCAAAACACAGTTCTCCC / GTTTCTGTTTCAATTGCAGAATAC mutGATA2 CCCTACTTTCccgctgCATTATGTCATCGGG / AGAACTGTGTTTTGTGATAAAATTATTG mutDBE ccgtCCAGAAAGCTTAAAATTCAAG / gtggAACGGAAAAATATAATATGTATATACAC mutMRE tttaGTTACATTTGTATTTGTTTGATCAGATG / catgTTAAGAGCGCCTTTTGGTATTG   3.5.6 cdr-1 reporter fluorescence analysis  Synchronous day 1 adult worms were subjected to (a) 4 hours exposure to 100 µM CdCl2, (b) 4 hours exposure to 5 mM NaAsO2, (c) 1 hour heat shock at 37°C followed by 1 hour recovery at 20°C, or (d) 4 hours no stress control. All chemicals were dissolved in NGM-lite plates, and all plates were seeded with 5x concentrated, heat-killed OP50. Animals were imaged using DIC optics and fluorescence microscopy on a Zeiss Axioplan 2 microscope. Fluorescence intensity of the intestine was analyzed using ImageJ software, and was normalized for intestine size and background fluorescence.   143  3.5.7 Feeding RNAi knockdown  Feeding RNAi was performed using NGM-lite plates containing 25 µg/mL carbenicillin, 1 mM IPTG, and 12.5 µg/mL tetracycline, and seeded twice with appropriate HT115 RNAi bacteria (Ahringer library 96-well format: mdt-15: plate 74, well C09; elt-2: plate 196, well E06; daf-16: plate 18, well G12; skn-1: plate 99, well G09; hsf-1: plate 21, well B05; all clones were sequenced to confirm the insert identity.) Synchronous L1 animals grown on seeded RNAi plates until day 1 of adulthood.   144  Chapter 4: Discussion and conclusions   In this dissertation, I addressed the hypothesis that subunits of the Mediator CDK8 kinase module drive gene expression changes in the EGFR-Ras-ERK signaling pathway or the cadmium response by interaction with transcriptional regulators or with other Mediator subunits. I found that cdk-8 represses TF and Mediator tail module subunit activity downstream of the EGFR-Ras-ERK pathway. I also found that both cdk-8 and mdt-15 activate a complex cadmium-inducible promoter, and identified regulatory elements and TFs required at this promoter. These findings agree with previously identified roles of metazoan CDK8 as a regulator of multiple developmental pathways, and adds significantly to our understanding of CKM mechanisms in the EGFR-Ras-ERK pathway and within the Mediator complex. Furthermore, these findings reveal that, similar to yeast Cdk8, which is a coregulator of several stress-responsive TFs, metazoan CDK-8 is a coactivator of cadmium-responsive transcription.  4.1 The CKM as regulatory hub in metazoan development   In Chapter 2, I showed that CDK-8 and other CKM subunits repress EGFR-Ras-ERK pathway-driven cell fate specification in the C. elegans vulva, by acting as a corepressor for a conserved Ets-family TF, and by restraining the activity of Mediator tail module subunits mdt-29/med2, mdt-27/med3, and particularly mdt-15. Thus, the CKM regulates C. elegans development by acting in a conserved cell signaling pathway.  Over the past decade, the Mediator CKM has emerged as a regulator of multiple developmental processes in metazoans. Studies in invertebrate animal models have identified roles of the CKM in multiple developmental signaling pathways or TF cascades. In C. elegans, 145  cdk-8, mdt-12/dpy-22, and mdt-13/let-19 repress EGFR signaling-driven transcription in vulva development ((Moghal and Sternberg 2003a), Section 1.3.1; and this work, Chapter 2); mdt-12/dpy-22 and mdt-13/let-19 repress Wnt signaling-regulated developmental events in multiple tissues ((Zhang and Emmons 2000; Yoda et al. 2005); Section 1.3.2); and all four CKM subunits are required for correct axon navigation, potentially by repressing the sax-3/ROBO pathway ((Steimel et al. 2013); Section 1.3.4). In Drosophila, Cdk8 binds to the steroid hormone-sensing NHR EcR to orchestrate transcription changes during developmental transitions (Xie et al. 2015). In addition, the Drosophila CKM is required for hematopoietic cell fate specification, driven by the GATA factor Serpent, and Med12/Med13 are required for hematopoietic cell differentiation, driven by both Serpent and the RUNX factor Lozenge (Gobert et al. 2010). Thus, the CKM orchestrates metazoan development by acting in diverse pathways. In some cases, the conservation of these CKM roles in higher organisms, e.g. mammals, remains unexplored, as the essential nature of CKM genes in vertebrates has hindered studies of CKM subunit action in development. For example, murine CDK8 is required in very early embryonic development, prior to or during the 8-cell stage; however, the precise pathway or target genes regulated by CDK8 in this context remains unknown (Westerling et al. 2007). Similarly, MED12 is required early in zebrafish development for brain, neural crest, and kidney development, but pertinent regulatory mechanisms remain undefined (Hong et al. 2005; Hong and Dawid 2011). MED12 has been studied more extensively in mouse development using a reduction-of-function mutation that reduces but does not completely abolish MED12 mRNA; this revealed a requirement for MED12 in Wnt signaling target gene expression during embryonic development (Rocha et al. 2010). 146   The CKM regulates the output of multiple signaling pathways, suggesting that it may either be employed downstream of each pathway separately, or it may simultaneously integrate inputs from multiple pathways. Signaling in the C. elegans VPCs provides a system in which to probe this question. VPC cell fate determination requires both bar-1/!-catenin and let-60/Ras to activate expression of the Hox TF gene, lin-39, in successive phases of vulva development. First, in the phase prior to the onset of VPC induction by EGFR-Ras-ERK signaling, bar-1-mediated activation of lin-39 inhibits VPC fusion with the surrounding hypodermis, thereby maintaining VPC competence to later adopt the 1°, 2° or 3° fates (Eisenmann et al. 1998). Later, during VPC induction, EGFR-Ras-ERK signaling alleviates inhibition of lin-39 by the lin-1/Ets TF, leading to lin-39 upregulation in the presumptive 1° cell, which promotes cell division (Maloof and Kenyon 1998; Wagmaister et al. 2006). However, hyperactivation of bar-1/!-catenin can also promote vulval cell proliferation independently of EGFR-Ras-ERK signaling, suggesting that Wnt/!-catenin signaling can independently drive VPC induction (Gleason et al. 2002). Prior to VPC induction, mdt-12/dpy-22 and mdt-13/let-19 act downstream of bar-1/!-catenin and upstream of lin-39 to promote VPC fusion ((Yoda et al. 2005), Section 1.3.2). This suggests that the CKM may repress lin-39 transcription prior to VPC induction, when it is controlled by !-catenin ((Yoda et al. 2005), Section 1.3.2). During VPC induction, cdk-8 and mdt-13/let-19 promote transcriptional repression by lin-1/Ets (Chapter 2). As LIN-1 represses lin-39 (Maloof and Kenyon 1998; Wagmaister et al. 2006), this suggests that the CKM may also repress lin-39 transcription during VPC induction, when it is controlled by lin-1. Importantly, mdt-12/dpy-22 regulates VPC induction independently of bar-1/!-catenin (Moghal and Sternberg 2003a), suggesting that the CKM switches from a role downstream of the Wnt/!-catenin signaling pathway prior to VPC induction, to a role downstream of the EGFR-Ras-ERK pathway during 147  VPC induction. Together, these findings suggest that the CKM adopts distinct roles downstream of the Wnt/!-catenin pathway and the EGFR-Ras-ERK pathway at different phases in vulva development.   Many of the CKM’s roles in developmental signaling pathways are recapitulated in human cancers. Pertinent to the genetic interaction I identified in Chapter 2, there is evidence that the human CKM represses EGFR signaling-driven transcription, as MED12 is required downstream of BRAF to inhibit melanoma cell growth (Shalem et al. 2014). In addition, just as MED12 promotes Wnt signaling-driven transcription in murine development (Rocha et al. 2010), human CDK8 gene amplification frequently drives Wnt/!-catenin-mediated transcription in colon cancers (Firestein et al. 2008, 2010). Furthermore, MED12 is subject to recurrent mutations in benign tumors of the uterus and breast (Mäkinen et al. 2011; Lim et al. 2014), suggesting a generalized role in promoting cell proliferation. Finally, human CycC is subject to heterozygous deletions in a subset of T-ALL, which drives activation of Notch-mediated transcription (Li et al. 2014). Thus, human CKM subunits appear to adopt tumor suppressor roles in the EGFR and Notch signaling pathways, and adopt an oncogenic role in the Wnt signaling pathway. This suggests that, like the pathway-specific roles of the CKM in different phases of C. elegans vulva development, the CKM can adopt distinct roles in human cancers depending on the predominant oncogenic pathway driving tumor formation.     4.2 CDK8 as a regulator of responses to environmental stimuli  In Chapter 3, I showed that cdk-8 is required for induction of a subset of cadmium-responsive genes, and for cadmium resistance in C. elegans. In this context, cdk-8 acts together 148  with or in parallel to the mdt-15 Mediator tail module subunit, regulatory GATA elements and the elt-2 GATA factor, and the high zinc-activated (HZA) element; in addition, cdk-8 acts in opposition to negative regulation by the DAF-16 binding element (DBE) and the daf-16/FoxO stress-responsive TF (Chapter 3). Thus, I identified multiple elements and factors required for cadmium-inducible transcription of a single responsive gene, implying potential regulatory interactions between CDK-8 and these factors.   CDK8 regulates gene expression responses to multiple environmental stimuli through interactions with TFs. As discussed in Chapter 3, CDK8 activates several stimulus-responsive gene expression programs in mammalian cell lines or in yeast, via interactions with p53, HIF1#, Gal4, or Rpn4 (see Section 3.4.1). Interestingly, CDK8 also acts as a repressor of several transcriptional responses to environmental stimuli in yeast and metazoans. The role of CDK8 in stress-responsive transcription was first identified in yeast, where Cdk8 was found to repress a multitude of stress-responsive genes (Holstege et al. 1998). Many of these stress-responsive genes respond to nutrient deprivation; accordingly, cdk8 mutants exhibit inappropriate induction of pseudohyphal colony morphology, a mode of growth usually induced only during nutrient deprivation (Holstege et al. 1998). Cdk8 represses pseudohyphal growth by phosphorylating two TFs, Ste12 and Phd1, which leads to their degradation (Nelson et al. 2003; Raithatha et al. 2012). Under nutrient-limiting conditions, Cdk8 is degraded, leading to accumulation of Ste12 and Phd1, and induction of the pseudohyphal growth gene expression program (Holstege et al. 1998; Nelson et al. 2003; Raithatha et al. 2012). Intriguingly, mammalian CDK8 protein levels are also regulated by nutrient status, although in a manner opposite to that of yeast Cdk8. In the mouse liver, CDK8 protein accumulates during fasting, and is degraded in response to re-feeding or insulin (Zhao et al. 2012). During fasting, CDK8 inhibits fat storage by promoting 149  degradation of the lipogenic TF SREBP1c; during re-feeding or insulin treatment, CDK8 degradation allows accumulation of SREBP1c and induction of lipogenic gene expression (Zhao et al. 2012). Regulation of CDK8 protein levels by nutrient status and CDK8-mediated regulation of SREBP is conserved in Drosophila (Zhao et al. 2012; Xie et al. 2015), suggesting that CDK8 is a conserved repressor of lipogenic gene expression in metazoans. Thus, CDK8 is an important regulator of responses to nutrient status in yeast and metazoans, although the upstream regulatory mechanisms and downstream TF targets are not conserved. Furthermore, as these studies demonstrate that CDK8 protein levels are regulated by nutrient deprivation across species, this raises the intriguing possibility that other stimuli, e.g. cadmium exposure, could also alter gene expression by post-translational regulation of CDK8.   Yeast Cdk8 also represses heat shock-responsive transcription. Many Cdk8-repressed genes overlap with stress-responsive genes activated by the Msn2 TF (Holstege et al. 1998). Msn2 activity is regulated by cytoplasmic to nuclear translocation in response to multiple stresses (Görner et al. 1998). Cdk8-mediated phosphorylation of Msn2 appears to promote nuclear exclusion of Msn2 in non-stressed cells, as cdk8 mutants exhibit aberrant nuclear accumulation of Msn2 in the absence of stress (Chi et al. 2001). Cdk8-mediated phosphorylation may also attenuate Msn2-driven stress-responsive transcription, as heat shock induces rapid phosphorylation of nuclear Msn2 in a Cdk8-dependent manner (Chi et al. 2001). Thus, Cdk8 appears to repress Msn2-driven stress-responsive transcription.  In Chapter 3, our unbiased gene expression profiling of C. elegans cdk-8 mutants revealed a role for CDK-8 as a regulator of cadmium-responsive genes. I found that, in worms exposed to cadmium, cdk-8 is required for activation of cadmium-responsive transcription. Therefore, my study reveals that CDK-8 can act as a positive regulator of stress-responsive 150  transcription in vivo in a metazoan. As I show that cdk-8 acts together with or in parallel to mdt-15, elt-2, or an HZA-binding TF to activate a cadmium-responsive promoter, I speculate that CDK-8 promotes cadmium-inducible transcription by activating one or more of these factors.    4.3 The CDK8-tail module relationship in metazoans  Multiple Mediator subunits are subject to post-translational regulation in yeast (van de Peppel et al. 2005; Miller et al. 2012; Gonzalez et al. 2014), but this was largely unexplored in multicellular organisms prior to my study. In Chapter 2, I identified a post-transcriptional regulatory interaction between C. elegans CDK-8 and MDT-15, as mdt-15 is required for ectopic vulva formation in mdt-13 mutants and derepression of cdk-8-repressed transcripts, and MDT-15 protein abundance is negatively regulated by cdk-8. These findings demonstrate for the first time that metazoan CDK-8 can inhibit a tail module subunit post-transcriptionally; in the future, it will be of interest to determine if MDT-15 is regulated post-translationally, e.g. by CDK-8-mediated phosphorylation. In yeast, Cdk8-mediated phosphorylation can inhibit transcriptional activation by tail module subunits Med2 and Med3 (van de Peppel et al. 2005; Gonzalez et al. 2014). Cdk8-mediated phosphorylation of Med3 leads to its ubiquitination and proteasome-dependent turnover, as well as turnover of Med3-interacting tail module subunits, Med2 and Med15 (Gonzalez et al. 2014). However, as the presence of additional subunits in the metazoan Mediator tail module creates a more highly connective tail module architecture than in the yeast tail module (Tsai et al. 2014) (see Section 1.2.1 and Figure 1.1), it was not clear, prior to my study, whether or not metazoan CDK8 could similarly regulate tail module subunit stability. Indeed, my study demonstrates that although mdt-29/med2, mdt-27/med3, and mdt-15 are 151  required for aberrant activation of vulval induction in cdk-8 mutants, only mdt-15 is required for activation of cdk-8-repressed genes in cdk-8 mutants, suggesting that the metazoan vs. yeast tail module architecture may alter the tail module’s regulatory interactions with CDK8.  Ras and ERK signaling pathways have been found to regulate Mediator subunit activity post-translationally. In yeast, a Ras-Protein kinase A (PKA) signaling pathway phosphorylates Med13 to promote CKM-mediated repression of nutrient deprivation genes (Chang et al. 2004). In human cells, steroid hormone-mediated activation of ERK leads to phosphorylation of MED1, which promotes its binding to the Mediator complex and its ability to coactivate NHR-driven transcription (Belakavadi et al. 2008). Thus, Ras-PKA or hormone-ERK signaling can phosphorylate Mediator subunits to promote their transcriptional coregulator activity. I have shown that the CKM represses EGFR-Ras-ERK signaling-driven vulval cell fate specification in C. elegans, in part through inhibition of Mediator tail module subunit activity. As CDK-8 kinase activity is required to repress vulva formation, I predict that CDK-8 inhibits the Mediator tail module by phosphorylation of e.g. MDT-15, but in vitro kinase assays are needed to explore this hypothesis (Chapter 2). Further work is also needed to determine if any of the Mediator subunits that regulate vulva development could also be subject to ERK phosphorylation, thereby linking EGFR-Ras-ERK pathway activation and Mediator subunit activity in the C. elegans vulva.   Mediator subunit phosphorylation influences stress-responsive transcription in yeast. For example, Cdk8-mediated phosphorylation of Med2 is required to repress twelve genes in the yeast genome, ten of which contain the consensus site for a TF that activates a low iron stress response (van de Peppel et al. 2005). Thus, Cdk8-mediated phosphorylation of Med2 may alter its interaction with a low iron-responsive TF, thereby restraining low iron-responsive transcription. Phosphorylation of multiple serine and threonine residues in the Med15 C-152  terminus is required to repress osmotic stress-responsive transcription in yeast grown in normal conditions. Under osmotic stress, a subset of these sites are dephosphorylated, suggesting that dynamic changes in Med15 phosphorylation can induce stress-responsive transcription (Miller et al. 2012). The kinase responsible for Med15 phosphorylation has not been identified, but by analogy to the relationship between Cdk8 and Med2 in the low iron stress response, it is tempting to speculate that Cdk8 could phosphorylate Med15 to restrain stress-responsive transcription in yeast.   Yeast Cdk8 and Med15 may also have opposing effects on stress-responsive transcription by acting upon a common TF. Specifically, med15 is required for activation of heat shock-responsive transcription by the stress-responsive TF Msn2, whereas Cdk8-mediated phosphorylation drives Msn2 degradation (Lallet et al. 2006). Intriguingly, Msn2 phosphorylation also requires med15 (Lallet et al. 2006), suggesting that Med15-mediated binding of Msn2 to the Mediator complex is required for Cdk8-mediated Msn2 phosphorylation. Thus, yeast Cdk8 can oppose Med15 activity in stress-responsive transcription by promoting degradation of a Med15-binding TF. I have shown that C. elegans cdk-8 inhibits MDT-15 activity in vulva development (Chapter 2), but that cdk-8 and mdt-15 are both required to activate cadmium-responsive transcription (Chapter 3). Thus, antagonism between CDK-8 and the tail module may not apply to stress-responsive transcription in metazoans, at least in the C. elegans cadmium response. It will be interesting to determine whether CDK-8 and MDT-15 interact with a common cadmium-responsive TF, or whether CDK-8 can promote MDT-15’s transcriptional coactivator function directly.   153  4.4 Conclusion  The Mediator CKM regulates multiple developmental events and signaling pathways in metazoans. I have defined novel roles and mechanisms of CKM action in the EGFR-Ras-ERK signaling pathway in C. elegans vulval cell fate specification. Human CDK8 acts as an oncogene in the Wnt signaling pathway (Firestein et al. 2008, 2010) and MED12 appears to promote tumor growth (Mäkinen et al. 2011; Lim et al. 2014; Mittal et al. 2015), whereas Cyclin C is a tumor suppressor in the Notch signaling pathway (Li et al. 2014); thus it appears that, depending on the cellular context, CKM subunits can have vastly different influences in tumorigenesis. My work shows that all four CKM subunits repress EGFR-Ras-ERK signaling-driven cell fates, suggesting that in cancers driven by this oncogenic cell signaling pathway, the CKM subunits may act as tumor suppressors. In addition, I have defined a novel regulatory interaction between the metazoan CKM and Mediator tail module subunits. As such intra-Mediator regulation has previously only been observed in yeast (van de Peppel et al. 2005; Gonzalez et al. 2014), where tail module subunits and overall architecture are poorly conserved (Tsai et al. 2014), this represents a significant advance in our understanding of combinatorial control of cell signaling by multiple Mediator subunits. As the CKM is a player in human cancer, it will be of interest in future to determine if the regulatory interactions I have defined are conserved in cancer cell lines with activating mutations in the EGFR-Ras-ERK pathway.  CDK8 regulates several stress-responsive TFs in yeast, in human cell culture, or in murine and Drosophila models, but prior to my study, the role of CDK8 in cadmium-responsive transcription remained unexplored. I have shown that C. elegans cdk-8 is required for activation of cadmium-responsive transcription, and defined several DNA regulatory elements and TFs that may interact with CDK-8 in this context. As the Mediator tail module subunit mdt-15 is also 154  required for this response (Taubert et al. 2008), my work identifies a context in which these Mediator subunits may cooperate. Future work is needed to identify whether CDK-8 and/or MDT-15 bind to and directly regulate the TFs involved in cadmium-inducible transcription.   155  Bibliography  Aimola P., Carmignani M., Volpe A. R., Di Benedetto A., Claudio L., Waalkes M. P., Bokhoven A. van, Tokar E. J., Claudio P. P., 2012 Cadmium induces p53-dependent apoptosis in human prostate epithelial cells. PloS One 7: e33647. Akoulitchev S., Chuikov S., Reinberg D., 2000 TFIIH is negatively regulated by cdk8-containing mediator complexes. Nature 407: 102–106. Alarcón C., Zaromytidou A.-I., Xi Q., Gao S., Yu J., Fujisawa S., Barlas A., Miller A. N., Manova-Todorova K., Macias M. J., Sapkota G., Pan D., Massagué J., 2009 Nuclear CDKs drive Smad transcriptional activation and turnover in BMP and TGF-beta pathways. Cell 139: 757–769. Allen B. L., Taatjes D. J., 2015 The Mediator complex: a central integrator of transcription. Nat. Rev. Mol. Cell Biol. 16: 155–166. An J. H., Blackwell T. K., 2003 SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev. 17: 1882–1893. Angers S., Moon R. T., 2009 Proximal events in Wnt signal transduction. Nat. Rev. Mol. Cell Biol. 10: 468–477. Angus S. P., Nevins J. R., 2012 A role for Mediator complex subunit MED13L in Rb/E2F-induced growth arrest. Oncogene 31: 4709–4717. Arda H. E., Taubert S., MacNeil L. T., Conine C. C., Tsuda B., Van Gilst M., Sequerra R., Doucette-Stamm L., Yamamoto K. R., Walhout A. J. M., 2010 Functional modularity of nuclear hormone receptors in a Caenorhabditis elegans metabolic gene regulatory network. Mol. Syst. Biol. 6: 367. Aristizabal M. J., Negri G. L., Benschop J. J., Holstege F. C. P., Krogan N. J., Kobor M. S., 2013 High-Throughput Genetic and Gene Expression Analysis of the RNAPII-CTD Reveals Unexpected Connections to SRB10/CDK8. PLoS Genet 9: e1003758. Aristizabal M. J., Negri G. L., Kobor M. S., 2015 The RNAPII-CTD Maintains Genome Integrity through Inhibition of Retrotransposon Gene Expression and Transposition. PLoS Genet 11: e1005608. Aroian R. V., Koga M., Mendel J. E., Ohshima Y., Sternberg P. W., 1990 The let-23 gene necessary for Caenorhabditis elegans vulval induction encodes a tyrosine kinase of the EGF receptor subfamily. Nature 348: 693–699. 156  Aroian R. V., Sternberg P. W., 1991 Multiple functions of let-23, a Caenorhabditis elegans receptor tyrosine kinase gene required for vulval induction. Genetics 128: 251–267. Aroian R. V., Lesa G. M., Sternberg P. W., 1994 Mutations in the Caenorhabditis elegans let-23 EGFR-like gene define elements important for cell-type specificity and function. EMBO J. 13: 360–366. Avraham R., Yarden Y., 2011 Feedback regulation of EGFR signalling: decision making by early and delayed loops. Nat. Rev. Mol. Cell Biol. 12: 104–117. Balamotis M. A., Pennella M. A., Stevens J. L., Wasylyk B., Belmont A. S., Berk A. J., 2009 Complexity in transcription control at the activation domain-mediator interface. Sci. Signal. 2: ra20. Bancerek J., Poss Z. C., Steinparzer I., Sedlyarov V., Pfaffenwimmer T., Mikulic I., Dölken L., Strobl B., Müller M., Taatjes D. J., Kovarik P., 2013 CDK8 kinase phosphorylates transcription factor STAT1 to selectively regulate the interferon response. Immunity 38: 250–262. Barabási A.-L., Oltvai Z. N., 2004 Network biology: understanding the cell’s functional organization. Nat. Rev. Genet. 5: 101–113. Barsyte D., Lovejoy D. A., Lithgow G. J., 2001 Longevity and heavy metal resistance in daf-2 and age-1 long-lived mutants of Caenorhabditis elegans. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 15: 627–634. Baselga J., Swain S. M., 2009 Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat. Rev. Cancer 9: 463–475. Beitel G. J., Tuck S., Greenwald I., Horvitz H. R., 1995 The Caenorhabditis elegans gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval induction pathway. Genes Dev. 9: 3149–3162. Belakavadi M., Pandey P. K., Vijayvargia R., Fondell J. D., 2008 MED1 phosphorylation promotes its association with mediator: implications for nuclear receptor signaling. Mol. Cell. Biol. 28: 3932–3942. Belakavadi M., Fondell J. D., 2010 Cyclin-dependent kinase 8 positively cooperates with Mediator to promote thyroid hormone receptor-dependent transcriptional activation. Mol. Cell. Biol. 30: 2437–2448. Bernecky C., Grob P., Ebmeier C. C., Nogales E., Taatjes D. J., 2011 Molecular Architecture of the Human Mediator–RNA Polymerase II–TFIIF Assembly. PLoS Biol 9: e1000603. Berset T., Hoier E. F., Battu G., Canevascini S., Hajnal A., 2001 Notch inhibition of RAS signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 291: 1055–1058. 157  Berti L., Mittler G., Przemeck G. K., Stelzer G., Günzler B., Amati F., Conti E., Dallapiccola B., Hrabé de Angelis M., Novelli G., Meisterernst M., 2001 Isolation and characterization of a novel gene from the DiGeorge chromosomal region that encodes for a mediator subunit. Genomics 74: 320–332. Blackwell T. K., Bowerman B., Priess J. R., Weintraub H., 1994 Formation of a monomeric DNA binding domain by Skn-1 bZIP and homeodomain elements. Science 266: 621–628. Block D. H. S., Twumasi-Boateng K., Kang H. S., Carlisle J. A., Hanganu A., Lai T. Y.-J., Shapira M., 2015 The Developmental Intestinal Regulator ELT-2 Controls p38-Dependent Immune Responses in Adult C. elegans. PLoS Genet. 11: e1005265. Bolstad B. M., Irizarry R. A., Astrand M., Speed T. P., 2003 A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinforma. Oxf. Engl. 19: 185–193. Borggrefe T., Yue X., 2011 Interactions between subunits of the Mediator complex with gene-specific transcription factors. Semin. Cell Dev. Biol. 22: 759–768. Bourbon H.-M., Aguilera A., Ansari A. Z., Asturias F. J., Berk A. J., Bjorklund S., Blackwell T. K., Borggrefe T., Carey M., Carlson M., Conaway J. W., Conaway R. C., Emmons S. W., Fondell J. D., Freedman L. P., Fukasawa T., Gustafsson C. M., Han M., He X., Herman P. K., Hinnebusch A. G., Holmberg S., Holstege F. C., Jaehning J. A., Kim Y.-J., Kuras L., Leutz A., Lis J. T., Meisterernest M., Naar A. M., Nasmyth K., Parvin J. D., Ptashne M., Reinberg D., Ronne H., Sadowski I., Sakurai H., Sipiczki M., Sternberg P. W., Stillman D. J., Strich R., Struhl K., Svejstrup J. Q., Tuck S., Winston F., Roeder R. G., Kornberg R. D., 2004 A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II. Mol. Cell 14: 553–557. Bourbon H.-M., 2008 Comparative genomics supports a deep evolutionary origin for the large, four-module transcriptional mediator complex. Nucleic Acids Res. 36: 3993–4008. Brenner S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94. C. elegans Sequencing Consortium, 1998 Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282: 2012–2018. Chang Y.-W., Howard S. C., Herman P. K., 2004 The Ras/PKA signaling pathway directly targets the Srb9 protein, a component of the general RNA polymerase II transcription apparatus. Mol. Cell 15: 107–116. Chen X., Chu M., Giedroc D. P., 1999 MRE-Binding transcription factor-1: weak zinc-binding finger domains 5 and 6 modulate the structure, affinity, and specificity of the metal-response element complex. Biochemistry (Mosc.) 38: 12915–12925. 158  Chen N., Greenwald I., 2004 The lateral signal for LIN-12/Notch in C. elegans vulval development comprises redundant secreted and transmembrane DSL proteins. Dev. Cell 6: 183–192. Chi Y., Huddleston M. J., Zhang X., Young R. A., Annan R. S., Carr S. A., Deshaies R. J., 2001 Negative regulation of Gcn4 and Msn2 transcription factors by Srb10 cyclin-dependent kinase. Genes Dev. 15: 1078–1092. Chiang W.-C., Ching T.-T., Lee H. C., Mousigian C., Hsu A.-L., 2012 HSF-1 Regulators DDL-1/2 Link Insulin-like Signaling to Heat-Shock Responses and Modulation of Longevity. Cell 148: 322–334. Chu Y., Gómez Rosso L., Huang P., Wang Z., Xu Y., Yao X., Bao M., Yan J., Song H., Wang G., 2014 Liver Med23 ablation improves glucose and lipid metabolism through modulating FOXO1 activity. Cell Res. 24: 1250–1265. Clark S. G., Chisholm A. D., Horvitz H. R., 1993 Control of cell fates in the central body region of C. elegans by the homeobox gene lin-39. Cell 74: 43–55. Clayton J. E., Heuvel S. J. L. van den, Saito R. M., 2008 Transcriptional control of cell-cycle quiescence during C. elegans development. Dev. Biol. 313: 603–613. Clevers H., Nusse R., 2012 Wnt/!-catenin signaling and disease. Cell 149: 1192–1205. Cohen E., Bieschke J., Perciavalle R. M., Kelly J. W., Dillin A., 2006 Opposing activities protect against age-onset proteotoxicity. Science 313: 1604–1610. Crook-McMahon H. M., Oláhová M., Button E. L., Winter J. J., Veal E. A., 2014 Genome-wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals. BMC Biol. 12: 64. Cui M., Chen J., Myers T. R., Hwang B. J., Sternberg P. W., Greenwald I., Han M., 2006 SynMuv genes redundantly inhibit lin-3/EGF expression to prevent inappropriate vulval induction in C. elegans. Dev. Cell 10: 667–672. Cui Y., McBride S. J., Boyd W. A., Alper S., Freedman J. H., 2007 Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity. Genome Biol. 8: R122. Davis J. A., Takagi Y., Kornberg R. D., Asturias F. A., 2002 Structure of the yeast RNA polymerase II holoenzyme: Mediator conformation and polymerase interaction. Mol. Cell 10: 409–415. Di Tommaso S., Tinelli A., Malvasi A., Massari S., 2014 Missense mutations in exon 2 of the MED12 gene are involved in IGF-2 overexpression in uterine leiomyoma. Mol. Hum. Reprod. 159  Ding N., Zhou H., Esteve P.-O., Chin H. G., Kim S., Xu X., Joseph S. M., Friez M. J., Schwartz C. E., Pradhan S., Boyer T. G., 2008 Mediator links epigenetic silencing of neuronal gene expression with x-linked mental retardation. Mol. Cell 31: 347–359. Donner A. J., Szostek S., Hoover J. M., Espinosa J. M., 2007 CDK8 Is a Stimulus-Specific Positive Coregulator of p53 Target Genes. Mol. Cell 27: 121–133. Donner A. J., Ebmeier C. C., Taatjes D. J., Espinosa J. M., 2010 CDK8 is a positive regulator of transcriptional elongation within the serum response network. Nat. Struct. Mol. Biol. 17: 194–201. Eisenmann D. M., Maloof J. N., Simske J. S., Kenyon C., Kim S. K., 1998 The beta-catenin homolog BAR-1 and LET-60 Ras coordinately regulate the Hox gene lin-39 during Caenorhabditis elegans vulval development. Dev. Camb. Engl. 125: 3667–3680. Engelmann I., Griffon A., Tichit L., Montañana-Sanchis F., Wang G., Reinke V., Waterston R. H., Hillier L. W., Ewbank J. J., 2011 A comprehensive analysis of gene expression changes provoked by bacterial and fungal infection in C. elegans. PloS One 6: e19055. Englert N. A., Luo G., Goldstein J. A., Surapureddi S., 2015 Epigenetic modification of histone 3 lysine 27: mediator subunit MED25 is required for the dissociation of polycomb repressive complex 2 from the promoter of cytochrome P450 2C9. J. Biol. Chem. 290: 2264–2278. Esnault C., Ghavi-Helm Y., Brun S., Soutourina J., Van Berkum N., Boschiero C., Holstege F., Werner M., 2008 Mediator-dependent recruitment of TFIIH modules in preinitiation complex. Mol. Cell 31: 337–346. Euling S., Ambros V., 1996 Heterochronic genes control cell cycle progress and developmental competence of C. elegans vulva precursor cells. Cell 84: 667–676. Fay D. S., Yochem J., 2007 The SynMuv genes of Caenorhabditis elegans in vulval development and beyond. Dev. Biol. 306: 1–9. Félix M.-A., Barkoulas M., 2012 Robustness and flexibility in nematode vulva development. Trends Genet. TIG 28: 185–195. Fernandez A. G., Gunsalus K. C., Huang J., Chuang L.-S., Ying N., Liang H.-L., Tang C., Schetter A. J., Zegar C., Rual J.-F., Hill D. E., Reinke V., Vidal M., Piano F., 2005 New genes with roles in the C. elegans embryo revealed using RNAi of ovary-enriched ORFeome clones. Genome Res. 15: 250–259. Figueiredo-Pereira M. E., Yakushin S., Cohen G., 1998 Disruption of the intracellular sulfhydryl homeostasis by cadmium-induced oxidative stress leads to protein thiolation and ubiquitination in neuronal cells. J. Biol. Chem. 273: 12703–12709. 160  Filipic M., Fatur T., Vudrag M., 2006 Molecular mechanisms of cadmium induced mutagenicity. Hum. Exp. Toxicol. 25: 67–77. Firestein R., Bass A. J., Kim S. Y., Dunn I. F., Silver S. J., Guney I., Freed E., Ligon A. H., Vena N., Ogino S., Chheda M. G., Tamayo P., Finn S., Shrestha Y., Boehm J. S., Jain S., Bojarski E., Mermel C., Barretina J., Chan J. A., Baselga J., Tabernero J., Root D. E., Fuchs C. S., Loda M., Shivdasani R. A., Meyerson M., Hahn W. C., 2008 CDK8 is a colorectal cancer oncogene that regulates [bgr]-catenin activity. Nature 455: 547–551. Firestein R., Shima K., Nosho K., Irahara N., Baba Y., Bojarski E., Giovannucci E. L., Hahn W. C., Fuchs C. S., Ogino S., 2010 CDK8 expression in 470 colorectal cancers in relation to beta-catenin activation, other molecular alterations and patient survival. Int. J. Cancer J. Int. Cancer 126: 2863–2873. Flanagan P. M., Kelleher R. J., Sayre M. H., Tschochner H., Kornberg R. D., 1991 A mediator required for activation of RNA polymerase II transcription in vitro. Nature 350: 436–438. Fondell J. D., Ge H., Roeder R. G., 1996 Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. Proc. Natl. Acad. Sci. U. S. A. 93: 8329–8333. Freedman J. H., Slice L. W., Dixon D., Fire A., Rubin C. S., 1993 The novel metallothionein genes of Caenorhabditis elegans. Structural organization and inducible, cell-specific expression. J. Biol. Chem. 268: 2554–2564. Fryer C. J., White J. B., Jones K. A., 2004 Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover. Mol. Cell 16: 509–520. Fukushige T., Hendzel M. J., Bazett-Jones D. P., McGhee J. D., 1999 Direct visualization of the elt-2 gut-specific GATA factor binding to a target promoter inside the living Caenorhabditis elegans embryo. Proc. Natl. Acad. Sci. U. S. A. 96: 11883–11888. Furuyama T., Nakazawa T., Nakano I., Mori N., 2000 Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. Biochem. J. 349: 629–634. Galbraith M. D., Allen M. A., Bensard C. L., Wang X., Schwinn M. K., Qin B., Long H. W., Daniels D. L., Hahn W. C., Dowell R. D., Espinosa J. M., 2013 HIF1A employs CDK8-mediator to stimulate RNAPII elongation in response to hypoxia. Cell 153: 1327–1339. Gaudet J., McGhee J. D., 2010 Recent advances in understanding the molecular mechanisms regulating C. elegans transcription. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 239: 1388–1404. Ge K., Guermah M., Yuan C.-X., Ito M., Wallberg A. E., Spiegelman B. M., Roeder R. G., 2002 Transcription coactivator TRAP220 is required for PPAR gamma 2-stimulated adipogenesis. Nature 417: 563–567. 161  Gentleman R. C., Carey V. J., Bates D. M., Bolstad B., Dettling M., Dudoit S., Ellis B., Gautier L., Ge Y., Gentry J., Hornik K., Hothorn T., Huber W., Iacus S., Irizarry R., Leisch F., Li C., Maechler M., Rossini A. J., Sawitzki G., Smith C., Smyth G., Tierney L., Yang J. Y. H., Zhang J., 2004 Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5: R80. Gilleard J. S., Barry J. D., Johnstone I. L., 1997 cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7. Mol. Cell. Biol. 17: 2301–2311. Gleason J. E., Korswagen H. C., Eisenmann D. M., 2002 Activation of Wnt signaling bypasses the requirement for RTK/Ras signaling during C. elegans vulval induction. Genes Dev. 16: 1281–1290. Gobert V., Osman D., Bras S., Augé B., Boube M., Bourbon H.-M., Horn T., Boutros M., Haenlin M., Waltzer L., 2010 A genome-wide RNA interference screen identifies a differential role of the mediator CDK8 module subunits for GATA/ RUNX-activated transcription in Drosophila. Mol. Cell. Biol. 30: 2837–2848. Goh Y. S., Grants J. M., 2012 Mutations in the Mediator subunit MED23 link intellectual disability to immediate early gene regulation. Clin. Genet. 81: 430. Goh G. Y. S., Martelli K. L., Parhar K. S., Kwong A. W. L., Wong M. A., Mah A., Hou N. S., Taubert S., 2014 The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans. Aging Cell 13: 70–79. Gold M. O., Rice A. P., 1998 Targeting of CDK8 to a promoter-proximal RNA element demonstrates catalysis-dependent activation of gene expression. Nucleic Acids Res. 26: 3784–3788. Gonzalez D., Hamidi N., Del Sol R., Benschop J. J., Nancy T., Li C., Francis L., Tzouros M., Krijgsveld J., Holstege F. C. P., Conlan R. S., 2014 Suppression of Mediator is regulated by Cdk8-dependent Grr1 turnover of the Med3 coactivator. Proc. Natl. Acad. Sci. U. S. A. 111: 2500–2505. Görner W., Durchschlag E., Martinez-Pastor M. T., Estruch F., Ammerer G., Hamilton B., Ruis H., Schüller C., 1998 Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12: 586–597. Grants J. M., Goh G. Y. S., Taubert S., 2015 The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator. Nucleic Acids Res. 43: 2442–2453. Grants J. M., Ying L. T. L., Yoda A., You C. C., Okano H., Sawa H., Taubert S., 2016 The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and 162  Represses Vulval Cell Fate Specification in Caenorhabditis elegans. Genetics 202: 583–599. Grøntved L., Madsen M. S., Boergesen M., Roeder R. G., Mandrup S., 2010 MED14 tethers mediator to the N-terminal domain of peroxisome proliferator-activated receptor gamma and is required for full transcriptional activity and adipogenesis. Mol. Cell. Biol. 30: 2155–2169. Hall J., Haas K. L., Freedman J. H., 2012 Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans. Toxicol. Sci. Off. J. Soc. Toxicol. 128: 418–426. Han M., Aroian R. V., Sternberg P. W., 1990 The let-60 locus controls the switch between vulval and nonvulval cell fates in Caenorhabditis elegans. Genetics 126: 899–913. Han E. H., Rha G. B., Chi Y.-I., 2012 MED25 is a mediator component of HNF4#-driven transcription leading to insulin secretion in pancreatic beta-cells. PloS One 7: e44007. Handschin C., Meyer U. A., 2003 Induction of drug metabolism: the role of nuclear receptors. Pharmacol. Rev. 55: 649–673. Hashimoto S., Boissel S., Zarhrate M., Rio M., Munnich A., Egly J.-M., Colleaux L., 2011 MED23 mutation links intellectual disability to dysregulation of immediate early gene expression. Science 333: 1161–1163. Head B., Aballay A., 2014 Recovery from an Acute Infection in C. elegans Requires the GATA Transcription Factor ELT-2. PLoS Genet 10: e1004609. Hengartner C. J., Myer V. E., Liao S.-M., Wilson C. J., Koh S. S., Young R. A., 1998 Temporal Regulation of RNA Polymerase II by Srb10 and Kin28 Cyclin-Dependent Kinases. Mol. Cell 2: 43–53. Herman M., 2001 C. elegans POP-1/TCF functions in a canonical Wnt pathway that controls cell migration and in a noncanonical Wnt pathway that controls cell polarity. Dev. Camb. Engl. 128: 581–590. Hieb W. F., Rothstein M., 1968 Sterol requirement for reproduction of a free-living nematode. Science 160: 778–780. Hill R. J., Sternberg P. W., 1992 The gene lin-3 encodes an inductive signal for vulval development in C. elegans. Nature 358: 470–476. Hirst M., Kobor M. S., Kuriakose N., Greenblatt J., Sadowski I., 1999 GAL4 Is Regulated by the RNA Polymerase II Holoenzyme–Associated Cyclin-Dependent Protein Kinase SRB10/CDK8. Mol. Cell 3: 673–678. 163  Hittelman A. B., Burakov D., Iñiguez-Lluhí J. A., Freedman L. P., Garabedian M. J., 1999 Differential regulation of glucocorticoid receptor transcriptional activation via AF-1-associated proteins. EMBO J. 18: 5380–5388. Ho Sui S. J., Mortimer J. R., Arenillas D. J., Brumm J., Walsh C. J., Kennedy B. P., Wasserman W. W., 2005 oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes. Nucleic Acids Res. 33: 3154–3164. Holm S., 1979 A Simple Sequentially Rejective Multiple Test Procedure. Scand. J. Stat. 6: 65–70. Holstege F. C., Jennings E. G., Wyrick J. J., Lee T. I., Hengartner C. J., Green M. R., Golub T. R., Lander E. S., Young R. A., 1998 Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95: 717–728. Hong S.-K., Haldin C. E., Lawson N. D., Weinstein B. M., Dawid I. B., Hukriede N. A., 2005 The zebrafish kohtalo/trap230 gene is required for the development of the brain, neural crest, and pronephric kidney. Proc. Natl. Acad. Sci. U. S. A. 102: 18473–18478. Hong S.-K., Dawid I. B., 2011 The transcriptional mediator component med12 is required for hindbrain boundary formation. PloS One 6: e19076. Horvitz H. R., Sulston J. E., 1980 Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics 96: 435–454. Hosack D. A., Dennis G. Jr, Sherman B. T., Lane H. C., Lempicki R. A., 2003 Identifying biological themes within lists of genes with EASE. Genome Biol. 4: R70. Hou N. S., Gutschmidt A., Choi D. Y., Pather K., Shi X., Watts J. L., Hoppe T., Taubert S., 2014 Activation of the endoplasmic reticulum unfolded protein response by lipid disequilibrium without disturbed proteostasis in vivo. Proc. Natl. Acad. Sci. U. S. A. 111: E2271-2280. Hsu A.-L., Murphy C. T., Kenyon C., 2003 Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science 300: 1142–1145. Hwang B. J., Sternberg P. W., 2004 A cell-specific enhancer that specifies lin-3 expression in the C. elegans anchor cell for vulval development. Dev. Camb. Engl. 131: 143–151. Ito M., Yuan C. X., Okano H. J., Darnell R. B., Roeder R. G., 2000 Involvement of the TRAP220 component of the TRAP/SMCC coactivator complex in embryonic development and thyroid hormone action. Mol. Cell 5: 683–693. Jacobs D., Beitel G. J., Clark S. G., Horvitz H. R., Kornfeld K., 1998 Gain-of-Function Mutations in the Caenorhabditis elegans lin-1 ETS Gene Identify a C-Terminal Regulatory Domain Phosphorylated by ERK MAP Kinase. Genetics 149: 1809–1822. 164  Jing Y., Liu L.-Z., Jiang Y., Zhu Y., Guo N. L., Barnett J., Rojanasakul Y., Agani F., Jiang B.-H., 2012 Cadmium increases HIF-1 and VEGF expression through ROS, ERK, and AKT signaling pathways and induces malignant transformation of human bronchial epithelial cells. Toxicol. Sci. Off. J. Soc. Toxicol. 125: 10–19. Johnston M., 1987 A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol. Rev. 51: 458–476. Jones L. M., Rayson S. J., Flemming A. J., Urwin P. E., 2013 Adaptive and specialised transcriptional responses to xenobiotic stress in Caenorhabditis elegans are regulated by nuclear hormone receptors. PloS One 8: e69956. Kagey M. H., Newman J. J., Bilodeau S., Zhan Y., Orlando D. A., Berkum N. L. van, Ebmeier C. C., Goossens J., Rahl P. B., Levine S. S., Taatjes D. J., Dekker J., Young R. A., 2010 Mediator and cohesin connect gene expression and chromatin architecture. Nature 467: 430–435. Kamath R. S., Fraser A. G., Dong Y., Poulin G., Durbin R., Gotta M., Kanapin A., Bot N. L., Moreno S., Sohrmann M., Welchman D. P., Zipperlen P., Ahringer J., 2003 Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231–237. Kapoor A., Goldberg M. S., Cumberland L. K., Ratnakumar K., Segura M. F., Emanuel P. O., Menendez S., Vardabasso C., Leroy G., Vidal C. I., Polsky D., Osman I., Garcia B. A., Hernando E., Bernstein E., 2010 The histone variant macroH2A suppresses melanoma progression through regulation of CDK8. Nature 468: 1105–1109. Karnoub A. E., Weinberg R. A., 2008 Ras oncogenes: split personalities. Nat. Rev. Mol. Cell Biol. 9: 517–531. Kato Y., Habas R., Katsuyama Y., Näär A. M., He X., 2002 A component of the ARC/Mediator complex required for TGF beta/Nodal signalling. Nature 418: 641–646. Katz W. S., Hill R. J., Clandinin T. R., Sternberg P. W., 1995 Different levels of the C. elegans growth factor LIN-3 promote distinct vulval precursor fates. Cell 82: 297–307. Kaufmann R., Straussberg R., Mandel H., Fattal-Valevski A., Ben-Zeev B., Naamati A., Shaag A., Zenvirt S., Konen O., Mimouni-Bloch A., Dobyns W. B., Edvardson S., Pines O., Elpeleg O., 2010 Infantile cerebral and cerebellar atrophy is associated with a mutation in the MED17 subunit of the transcription preinitiation mediator complex. Am. J. Hum. Genet. 87: 667–670. Kelleher R. J., Flanagan P. M., Kornberg R. D., 1990 A novel mediator between activator proteins and the RNA polymerase II transcription apparatus. Cell 61: 1209–1215. Kenyon C., Chang J., Gensch E., Rudner A., Tabtiang R., 1993 A C. elegans mutant that lives twice as long as wild type. Nature 366: 461–464. 165  Kerry S., TeKippe M., Gaddis N. C., Aballay A., 2006 GATA transcription factor required for immunity to bacterial and fungal pathogens. PloS One 1: e77. Kim Y. J., Björklund S., Li Y., Sayre M. H., Kornberg R. D., 1994 A multiprotein mediator of transcriptional activation and its interaction with the C-terminal repeat domain of RNA polymerase II. Cell 77: 599–608. Kim S., Xu X., Hecht A., Boyer T. G., 2006 Mediator is a transducer of Wnt/beta-catenin signaling. J. Biol. Chem. 281: 14066–14075. Kirienko N. V., Fay D. S., 2007 Transcriptome profiling of the C. elegans Rb ortholog reveals diverse developmental roles. Dev. Biol. 305: 674–684. Kishore R. S., Sundaram M. V., 2002 ced-10 Rac and mig-2 function redundantly and act with unc-73 trio to control the orientation of vulval cell divisions and migrations in Caenorhabditis elegans. Dev. Biol. 241: 339–348. Knuesel M. T., Meyer K. D., Donner A. J., Espinosa J. M., Taatjes D. J., 2009a The human CDK8 subcomplex is a histone kinase that requires Med12 for activity and can function independently of mediator. Mol. Cell. Biol. 29: 650–661. Knuesel M. T., Meyer K. D., Bernecky C., Taatjes D. J., 2009b The human CDK8 subcomplex is a molecular switch that controls Mediator coactivator function. Genes Dev. 23: 439–451. Kornberg R. D., 2005 Mediator and the mechanism of transcriptional activation. Trends Biochem. Sci. 30: 235–239. Korswagen H. C., 2002 Canonical and non-canonical Wnt signaling pathways in Caenorhabditis elegans: variations on a common signaling theme. BioEssays News Rev. Mol. Cell. Dev. Biol. 24: 801–810. Kouzarides T., 2007 Chromatin modifications and their function. Cell 128: 693–705. Kwon J. Y., Park J. M., Gim B. S., Han S. J., Lee J., Kim Y. J., 1999 Caenorhabditis elegans mediator complexes are required for developmental-specific transcriptional activation. Proc. Natl. Acad. Sci. U. S. A. 96: 14990–14995. Kwon J. Y., Lee J., 2001 Biological significance of a universally conserved transcription mediator in metazoan developmental signaling pathways. Dev. Camb. Engl. 128: 3095–3104. Lallet S., Garreau H., Garmendia-Torres C., Szestakowska D., Boy-Marcotte E., Quevillon-Chéruel S., Jacquet M., 2006 Role of Gal11, a component of the RNA polymerase II mediator in stress-induced hyperphosphorylation of Msn2 in Saccharomyces cerevisiae. Mol. Microbiol. 62: 438–452. 166  Leal A., Huehne K., Bauer F., Sticht H., Berger P., Suter U., Morera B., Del Valle G., Lupski J. R., Ekici A., Pasutto F., Endele S., Barrantes R., Berghoff C., Berghoff M., Neundörfer B., Heuss D., Dorn T., Young P., Santolin L., Uhlmann T., Meisterernst M., Sereda M. W., Sereda M., Stassart R. M., Meyer zu Horste G., Nave K.-A., Reis A., Rautenstrauss B., 2009 Identification of the variant Ala335Val of MED25 as responsible for CMT2B2: molecular data, functional studies of the SH3 recognition motif and correlation between wild-type MED25 and PMP22 RNA levels in CMT1A animal models. Neurogenetics 10: 275–287. Lee H.-K., Park U.-H., Kim E.-J., Um S.-J., 2007 MED25 is distinct from TRAP220/MED1 in cooperating with CBP for retinoid receptor activation. EMBO J. 26: 3545–3557. Lee D., Jeong D.-E., Son H. G., Yamaoka Y., Kim H., Seo K., Khan A. A., Roh T.-Y., Moon D. W., Lee Y., Lee S.-J. V., 2015 SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat. Genes Dev. 29: 2490–2503. Lehner B., Crombie C., Tischler J., Fortunato A., Fraser A. G., 2006 Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat. Genet. 38: 896–903. Leight E. R., Glossip D., Kornfeld K., 2005 Sumoylation of LIN-1 promotes transcriptional repression and inhibition of vulval cell fates. Dev. Camb. Engl. 132: 1047–1056. Leight E. R., Murphy J. T., Fantz D. A., Pepin D., Schneider D. L., Ratliff T. M., Mohammad D. H., Herman M. A., Kornfeld K., 2015 Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator. Genetics 199: 761–775. Li N., Fassl A., Chick J., Inuzuka H., Li X., Mansour M. R., Liu L., Wang H., King B., Shaik S., Gutierrez A., Ordureau A., Otto T., Kreslavsky T., Baitsch L., Bury L., Meyer C. A., Ke N., Mulry K. A., Kluk M. J., Roy M., Kim S., Zhang X., Geng Y., Zagozdzon A., Jenkinson S., Gale R. E., Linch D. C., Zhao J. J., Mullighan C. G., Harper J. W., Aster J. C., Aifantis I., Boehmer H. von, Gygi S. P., Wei W., Look A. T., Sicinski P., 2014 Cyclin C is a haploinsufficient tumour suppressor. Nat. Cell Biol. Liao S. M., Zhang J., Jeffery D. A., Koleske A. J., Thompson C. M., Chao D. M., Viljoen M., Vuuren H. J. van, Young R. A., 1995 A kinase-cyclin pair in the RNA polymerase II holoenzyme. Nature 374: 193–196. Liao V. H.-C., Dong J., Freedman J. H., 2002 Molecular characterization of a novel, cadmium-inducible gene from the nematode Caenorhabditis elegans. A new gene that contributes to the resistance to cadmium toxicity. J. Biol. Chem. 277: 42049–42059. Lim W. K., Ong C. K., Tan J., Thike A. A., Ng C. C. Y., Rajasegaran V., Myint S. S., Nagarajan S., Nasir N. D. M., McPherson J. R., Cutcutache I., Poore G., Tay S. T., Ooi W. S., Tan 167  V. K. M., Hartman M., Ong K. W., Tan B. K. T., Rozen S. G., Tan P. H., Tan P., Teh B. T., 2014 Exome sequencing identifies highly recurrent MED12 somatic mutations in breast fibroadenoma. Nat. Genet. Loncle N., Boube M., Joulia L., Boschiero C., Werner M., Cribbs D. L., Bourbon H.-M., 2007 Distinct roles for Mediator Cdk8 module subunits in Drosophila development. EMBO J. 26: 1045–1054. Luo Z., Lin C., Shilatifard A., 2012 The super elongation complex (SEC) family in transcriptional control. Nat. Rev. Mol. Cell Biol. 13: 543–547. Luse D. S., 2014 The RNA polymerase II preinitiation complex. Through what pathway is the complex assembled? Transcription 5: e27050. Ma Q., 2013 Role of Nrf2 in Oxidative Stress and Toxicity. Annu. Rev. Pharmacol. Toxicol. 53: 401–426. Mäkinen N., Mehine M., Tolvanen J., Kaasinen E., Li Y., Lehtonen H. J., Gentile M., Yan J., Enge M., Taipale M., Aavikko M., Katainen R., Virolainen E., Böhling T., Koski T. A., Launonen V., Sjöberg J., Taipale J., Vahteristo P., Aaltonen L. A., 2011 MED12, the mediator complex subunit 12 gene, is mutated at high frequency in uterine leiomyomas. Science 334: 252–255. Malik S., Wallberg A. E., Kang Y. K., Roeder R. G., 2002 TRAP/SMCC/mediator-dependent transcriptional activation from DNA and chromatin templates by orphan nuclear receptor hepatocyte nuclear factor 4. Mol. Cell. Biol. 22: 5626–5637. Malik S., Guermah M., Yuan C.-X., Wu W., Yamamura S., Roeder R. G., 2004 Structural and functional organization of TRAP220, the TRAP/mediator subunit that is targeted by nuclear receptors. Mol. Cell. Biol. 24: 8244–8254. Malik S., Roeder R. G., 2010 The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation. Nat. Rev. Genet. 11: 761–772. Maloof J. N., Kenyon C., 1998 The Hox gene lin-39 is required during C. elegans vulval induction to select the outcome of Ras signaling. Dev. Camb. Engl. 125: 181–190. Mangelsdorf D. J., Thummel C., Beato M., Herrlich P., Schütz G., Umesono K., Blumberg B., Kastner P., Mark M., Chambon P., Evans R. M., 1995 The nuclear receptor superfamily: The second decade. Cell 83: 835–839. Martinez E., Kundu T. K., Fu J., Roeder R. G., 1998 A human SPT3-TAFII31-GCN5-L acetylase complex distinct from transcription factor IID. J. Biol. Chem. 273: 23781–23785. McGhee J., 2007 The C. elegans intestine. WormBook. 168  McGhee J. D., Sleumer M. C., Bilenky M., Wong K., McKay S. J., Goszczynski B., Tian H., Krich N. D., Khattra J., Holt R. A., Baillie D. L., Kohara Y., Marra M. A., Jones S. J. M., Moerman D. G., Robertson A. G., 2007 The ELT-2 GATA-factor and the global regulation of transcription in the C. elegans intestine. Dev. Biol. 302: 627–645. McGhee J. D., 2013 The Caenorhabditis elegans intestine. Wiley Interdiscip. Rev. Dev. Biol. 2: 347–367. Meissner B., Warner A., Wong K., Dube N., Lorch A., McKay S. J., Khattra J., Rogalski T., Somasiri A., Chaudhry I., Fox R. M., Miller D. M. 3rd, Baillie D. L., Holt R. A., Jones S. J. M., Marra M. A., Moerman D. G., 2009 An integrated strategy to study muscle development and myofilament structure in Caenorhabditis elegans. PLoS Genet. 5: e1000537. Meyer K. D., Donner A. J., Knuesel M. T., York A. G., Espinosa J. M., Taatjes D. J., 2008 Cooperative activity of cdk8 and GCN5L within Mediator directs tandem phosphoacetylation of histone H3. EMBO J. 27: 1447–1457. Miley G. R., Fantz D., Glossip D., Lu X., Saito R. M., Palmer R. E., Inoue T., Heuvel S. van den, Sternberg P. W., Kornfeld K., 2004 Identification of Residues of the Caenorhabditis elegans LIN-1 ETS Domain That Are Necessary for DNA Binding and Regulation of Vulval Cell Fates. Genetics 167: 1697–1709. Miller L. M., Gallegos M. E., Morisseau B. A., Kim S. K., 1993 lin-31, a Caenorhabditis elegans HNF-3/fork head transcription factor homolog, specifies three alternative cell fates in vulval development. Genes Dev. 7: 933–947. Miller C., Matic I., Maier K. C., Schwalb B., Roether S., Strässer K., Tresch A., Mann M., Cramer P., 2012 Mediator phosphorylation prevents stress response transcription during non-stress conditions. J. Biol. Chem. 287: 44017–44026. Mittal P., Shin Y.-H., Yatsenko S. A., Castro C. A., Surti U., Rajkovic A., 2015 Med12 gain-of-function mutation causes leiomyomas and genomic instability. J. Clin. Invest. Moghal N., Sternberg P. W., 2003a A component of the transcriptional mediator complex inhibits RAS-dependent vulval fate specification in C. elegans. Dev. Camb. Engl. 130: 57–69. Moghal N., Sternberg P. W., 2003b The epidermal growth factor system in Caenorhabditis elegans. Exp. Cell Res. 284: 150–159. Moilanen L. H., Fukushige T., Freedman J. H., 1999 Regulation of metallothionein gene transcription. Identification of upstream regulatory elements and transcription factors responsible for cell-specific expression of the metallothionein genes from Caenorhabditis elegans. J. Biol. Chem. 274: 29655–29665. 169  Morris E. J., Ji J.-Y., Yang F., Di Stefano L., Herr A., Moon N.-S., Kwon E.-J., Haigis K. M., Naar A. M., Dyson N. J., 2008 E2F1 represses [bgr]-catenin transcription and is antagonized by both pRB and CDK8. Nature 455: 552–556. Mukhopadhyay A., Kramer J. M., Merkx G., Lugtenberg D., Smeets D. F., Oortveld M. A. W., Blokland E. A. W., Agrawal J., Schenck A., Bokhoven H. van, Huys E., Schoenmakers E. F., Kessel A. G. van, Nouhuys C. E. van, Cremers F. P. M., 2010 CDK19 is disrupted in a female patient with bilateral congenital retinal folds, microcephaly and mild mental retardation. Hum. Genet. 128: 281–291. Mukundan B., Ansari A., 2011 Novel role for mediator complex subunit Srb5/Med18 in termination of transcription. J. Biol. Chem. 286: 37053–37057. Mukundan B., Ansari A., 2013 Srb5/Med18-mediated termination of transcription is dependent on gene looping. J. Biol. Chem. 288: 11384–11394. Muncke N., Jung C., Rüdiger H., Ulmer H., Roeth R., Hubert A., Goldmuntz E., Driscoll D., Goodship J., Schön K., Rappold G., 2003 Missense mutations and gene interruption in PROSIT240, a novel TRAP240-like gene, in patients with congenital heart defect (transposition of the great arteries). Circulation 108: 2843–2850. Murphy C. T., McCarroll S. A., Bargmann C. I., Fraser A., Kamath R. S., Ahringer J., Li H., Kenyon C., 2003 Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424: 277–283. Myers L. C., Gustafsson C. M., Bushnell D. A., Lui M., Erdjument-Bromage H., Tempst P., Kornberg R. D., 1998 The Med proteins of yeast and their function through the RNA polymerase II carboxy-terminal domain. Genes Dev. 12: 45–54. Myers L. C., Gustafsson C. M., Hayashibara K. C., Brown P. O., Kornberg R. D., 1999 Mediator protein mutations that selectively abolish activated transcription. Proc. Natl. Acad. Sci. U. S. A. 96: 67–72. Myers T. R., Greenwald I., 2005 lin-35 Rb acts in the major hypodermis to oppose ras-mediated vulval induction in C. elegans. Dev. Cell 8: 117–123. Näär A. M., Taatjes D. J., Zhai W., Nogales E., Tjian R., 2002 Human CRSP interacts with RNA polymerase II CTD and adopts a specific CTD-bound conformation. Genes Dev. 16: 1339–1344. Näär A. M., Thakur J. K., 2009 Nuclear receptor-like transcription factors in fungi. Genes Dev. 23: 419–432. Nelson C., Goto S., Lund K., Hung W., Sadowski I., 2003 Srb10/Cdk8 regulates yeast filamentous growth by phosphorylating the transcription factor Ste12. Nature 421: 187–190. 170  Nicholas H. R., Hodgkin J., 2004 The ERK MAP kinase cascade mediates tail swelling and a protective response to rectal infection in C. elegans. Curr. Biol. CB 14: 1256–1261. Nilsson L., Tiensuu T., Tuck S., 2000 Caenorhabditis elegans lin-25: a study of its role in multiple cell fate specification events involving Ras and the identification and characterization of evolutionarily conserved domains. Genetics 156: 1083–1096. Normanno N., De Luca A., Bianco C., Strizzi L., Mancino M., Maiello M. R., Carotenuto A., De Feo G., Caponigro F., Salomon D. S., 2006 Epidermal growth factor receptor (EGFR) signaling in cancer. Gene 366: 2–16. Oliveira R. P., Porter Abate J., Dilks K., Landis J., Ashraf J., Murphy C. T., Blackwell T. K., 2009 Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell 8: 524–541. Pang S., Lynn D. A., Lo J. Y., Paek J., Curran S. P., 2014 SKN-1 and Nrf2 couples proline catabolism with lipid metabolism during nutrient deprivation. Nat. Commun. 5: 5048. Peppel J. van de, Kettelarij N., Bakel H. van, Kockelkorn T. T. J. P., Leenen D. van, Holstege F. C. P., 2005 Mediator Expression Profiling Epistasis Reveals a Signal Transduction Pathway with Antagonistic Submodules and Highly Specific Downstream Targets. Mol. Cell 19: 511–522. Phelps C., Gburcik V., Suslova E., Dudek P., Forafonov F., Bot N., MacLean M., Fagan R. J., Picard D., 2006 Fungi and animals may share a common ancestor to nuclear receptors. Proc. Natl. Acad. Sci. U. S. A. 103: 7077–7081. Poss Z. C., Ebmeier C. C., Taatjes D. J., 2013 The Mediator complex and transcription regulation. Crit. Rev. Biochem. Mol. Biol. 48: 575–608. Powell-Coffman J. A., Knight J., Wood W. B., 1996 Onset of C. elegans gastrulation is blocked by inhibition of embryonic transcription with an RNA polymerase antisense RNA. Dev. Biol. 178: 472–483. Pukkila-Worley R., Feinbaum R. L., McEwan D. L., Conery A. L., Ausubel F. M., 2014 The evolutionarily conserved mediator subunit MDT-15/MED15 links protective innate immune responses and xenobiotic detoxification. PLoS Pathog. 10: e1004143. Raithatha S., Su T.-C., Lourenco P., Goto S., Sadowski I., 2012 Cdk8 regulates stability of the transcription factor Phd1 to control pseudohyphal differentiation of Saccharomyces cerevisiae. Mol. Cell. Biol. 32: 664–674. Risheg H., Graham J. M., Clark R. D., Rogers R. C., Opitz J. M., Moeschler J. B., Peiffer A. P., May M., Joseph S. M., Jones J. R., Stevenson R. E., Schwartz C. E., Friez M. J., 2007 A recurrent mutation in MED12 leading to R961W causes Opitz-Kaveggia syndrome. Nat. Genet. 39: 451–453. 171  Rocha P. P., Scholze M., Bleiss W., Schrewe H., 2010 Med12 is essential for early mouse development and for canonical Wnt and Wnt/PCP signaling. Dev. Camb. Engl. 137: 2723–2731. Roh J.-Y., Park Y.-J., Choi J., 2009 A cadmium toxicity assay using stress responsive Caenorhabditis elegans mutant strains. Environ. Toxicol. Pharmacol. 28: 409–413. Roh H. C., Dimitrov I., Deshmukh K., Zhao G., Warnhoff K., Cabrera D., Tsai W., Kornfeld K., 2015 A modular system of DNA enhancer elements mediates tissue-specific activation of transcription by high dietary zinc in C. elegans. Nucleic Acids Res. 43: 803–816. Sadowski I., Costa C., Dhanawansa R., 1996 Phosphorylation of Ga14p at a single C-terminal residue is necessary for galactose-inducible transcription. Mol. Cell. Biol. 16: 4879–4887. Saffer A. M., Kim D. H., Oudenaarden A. van, Horvitz H. R., 2011 The Caenorhabditis elegans synthetic multivulva genes prevent ras pathway activation by tightly repressing global ectopic expression of lin-3 EGF. PLoS Genet. 7: e1002418. Satija Y. K., Das S., 2015 Tyr99 phosphorylation determines the regulatory milieu of tumor suppressor p73. Oncogene. Sato S., Tomomori-Sato C., Banks C. A. S., Parmely T. J., Sorokina I., Brower C. S., Conaway R. C., Conaway J. W., 2003 A mammalian homolog of Drosophila melanogaster transcriptional coactivator intersex is a subunit of the mammalian Mediator complex. J. Biol. Chem. 278: 49671–49674. Schmid T., Hajnal A., 2015 Signal transduction during C. elegans vulval development: a NeverEnding story. Curr. Opin. Genet. Dev. 32: 1–9. Schutzman J. L., Borland C. Z., Newman J. C., Robinson M. K., Kokel M., Stern M. J., 2001 The Caenorhabditis elegans EGL-15 signaling pathway implicates a DOS-like multisubstrate adaptor protein in fibroblast growth factor signal transduction. Mol. Cell. Biol. 21: 8104–8116. Schwartz C. E., Tarpey P. S., Lubs H. A., Verloes A., May M. M., Risheg H., Friez M. J., Futreal P. A., Edkins S., Teague J., Briault S., Skinner C., Bauer-Carlin A., Simensen R. J., Joseph S. M., Jones J. R., Gecz J., Stratton M. R., Raymond F. L., Stevenson R. E., 2007 The original Lujan syndrome family has a novel missense mutation (p.N1007S) in the MED12 gene. J. Med. Genet. 44: 472–477. Semenza G. L., 2012 Hypoxia-Inducible Factors in Physiology and Medicine. Cell 148: 399–408. Shalem O., Sanjana N. E., Hartenian E., Shi X., Scott D. A., Mikkelsen T. S., Heckl D., Ebert B. L., Root D. E., Doench J. G., Zhang F., 2014 Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343: 84–87. 172  Shen C., Nettleton D., Jiang M., Kim S. K., Powell-Coffman J. A., 2005 Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. J. Biol. Chem. 280: 20580–20588. Shim E. Y., Walker A. K., Blackwell T. K., 2002 Broad requirement for the mediator subunit RGR-1 for transcription in the Caenorhabditis elegans embryo. J. Biol. Chem. 277: 30413–30416. Shore D. E., Carr C. E., Ruvkun G., 2012 Induction of cytoprotective pathways is central to the extension of lifespan conferred by multiple longevity pathways. PLoS Genet. 8: e1002792. Singh N., Han M., 1995 sur-2, a novel gene, functions late in the let-60 ras-mediated signaling pathway during Caenorhabditis elegans vulval induction. Genes Dev. 9: 2251–2265. Smale S. T., Kadonaga J. T., 2003 The RNA Polymerase II Core Promoter. Annu. Rev. Biochem. 72: 449–479. Smyth G. K., 2004 Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3: Article3. Sönnichsen B., Koski L. B., Walsh A., Marschall P., Neumann B., Brehm M., Alleaume A.-M., Artelt J., Bettencourt P., Cassin E., Hewitson M., Holz C., Khan M., Lazik S., Martin C., Nitzsche B., Ruer M., Stamford J., Winzi M., Heinkel R., Röder M., Finell J., Häntsch H., Jones S. J. M., Jones M., Piano F., Gunsalus K. C., Oegema K., Gönczy P., Coulson A., Hyman A. A., Echeverri C. J., 2005 Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434: 462–469. Sorger P. K., 1991 Heat shock factor and the heat shock response. Cell 65: 363–366. Soutourina J., Wydau S., Ambroise Y., Boschiero C., Werner M., 2011 Direct Interaction of RNA Polymerase II and Mediator Required for Transcription in Vivo. Science 331: 1451–1454. Spaeth J. M., Kim N. H., Boyer T. G., 2011 Mediator and human disease. Semin. Cell Dev. Biol. 22: 776–787. Srivastava R., Ahn S. H., 2015 Modifications of RNA polymerase II CTD: Connections to the histone code and cellular function. Biotechnol. Adv. 33: 856–872. Steimel A., Suh J., Hussainkhel A., Deheshi S., Grants J. M., Zapf R., Moerman D. G., Taubert S., Hutter H., 2013 The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation. Dev. Biol. Sternberg P. W., Horvitz H. R., 1986 Pattern formation during vulval development in C. elegans. Cell 44: 761–772. 173  Sternberg P. W., 1988 Lateral inhibition during vulval induction in Caenorhabditis elegans. Nature 335: 551–554. Sternberg P. W., Horvitz H. R., 1989 The combined action of two intercellular signaling pathways specifies three cell fates during vulval induction in C. elegans. Cell 58: 679–693. Sternberg P. W., 2005 Vulval development. WormBook. Stevens J. L., Cantin G. T., Wang G., Shevchenko A., Shevchenko A., Berk A. J., 2002 Transcription control by E1A and MAP kinase pathway via Sur2 mediator subunit. Science 296: 755–758. Stuart G. W., Searle P. F., Chen H. Y., Brinster R. L., Palmiter R. D., 1984 A 12-base-pair DNA motif that is repeated several times in metallothionein gene promoters confers metal regulation to a heterologous gene. Proc. Natl. Acad. Sci. U. S. A. 81: 7318–7322. Sulston J. E., Horvitz H. R., 1981 Abnormal cell lineages in mutants of the nematode Caenorhabditis elegans. Dev. Biol. 82: 41–55. Sundaram M. V., 2013 Canonical RTK-Ras-ERK signaling and related alternative pathways. WormBook: 1–38. Svensk E., Ståhlman M., Andersson C.-H., Johansson M., Borén J., Pilon M., 2013 PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans. PLoS Genet. 9: e1003801. Taatjes D. J., Näär A. M., Andel F., Nogales E., Tjian R., 2002 Structure, function, and activator-induced conformations of the CRSP coactivator. Science 295: 1058–1062. Takahashi H., Parmely T. J., Sato S., Tomomori-Sato C., Banks C. A. S., Kong S. E., Szutorisz H., Swanson S. K., Martin-Brown S., Washburn M. P., Florens L., Seidel C. W., Lin C., Smith E. R., Shilatifard A., Conaway R. C., Conaway J. W., 2011 Human mediator subunit MED26 functions as a docking site for transcription elongation factors. Cell 146: 92–104. Tan P. B., Lackner M. R., Kim S. K., 1998 MAP kinase signaling specificity mediated by the LIN-1 Ets/LIN-31 WH transcription factor complex during C. elegans vulval induction. Cell 93: 569–580. Taubert S., Van Gilst M. R., Hansen M., Yamamoto K. R., 2006 A Mediator subunit, MDT-15, integrates regulation of fatty acid metabolism by NHR-49-dependent and -independent pathways in C. elegans. Genes Dev. 20: 1137–1149. Taubert S., Hansen M., Van Gilst M. R., Cooper S. B., Yamamoto K. R., 2008 The Mediator subunit MDT-15 confers metabolic adaptation to ingested material. PLoS Genet. 4: e1000021. 174  Thakur J. K., Arthanari H., Yang F., Pan S.-J., Fan X., Breger J., Frueh D. P., Gulshan K., Li D. K., Mylonakis E., Struhl K., Moye-Rowley W. S., Cormack B. P., Wagner G., Näär A. M., 2008 A nuclear receptor-like pathway regulating multidrug resistance in fungi. Nature 452: 604–609. Thakur J. K., Arthanari H., Yang F., Chau K. H., Wagner G., Näär A. M., 2009 Mediator subunit Gal11p/MED15 is required for fatty acid-dependent gene activation by yeast transcription factor Oaf1p. J. Biol. Chem. 284: 4422–4428. Thompson O., Edgley M., Strasbourger P., Flibotte S., Ewing B., Adair R., Au V., Chaudhry I., Fernando L., Hutter H., Kieffer A., Lau J., Lee N., Miller A., Raymant G., Shen B., Shendure J., Taylor J., Turner E. H., Hillier L. W., Moerman D. G., Waterston R. H., 2013 The million mutation project: a new approach to genetics in Caenorhabditis elegans. Genome Res. 23: 1749–1762. Tidyman W. E., Rauen K. A., 2009 The RASopathies: developmental syndromes of Ras/MAPK pathway dysregulation. Curr. Opin. Genet. Dev. 19: 230–236. Tsai K.-L., Sato S., Tomomori-Sato C., Conaway R. C., Conaway J. W., Asturias F. J., 2013 A conserved Mediator-CDK8 kinase module association regulates Mediator-RNA polymerase II interaction. Nat. Struct. Mol. Biol. Tsai K.-L., Tomomori-Sato C., Sato S., Conaway R. C., Conaway J. W., Asturias F. J., 2014 Subunit architecture and functional modular rearrangements of the transcriptional mediator complex. Cell 157: 1430–1444. Tuck S., Greenwald I., 1995 lin-25, a gene required for vulval induction in Caenorhabditis elegans. Genes Dev. 9: 341–357. Turunen M., Spaeth J. M., Keskitalo S., Park M. J., Kivioja T., Clark A. D., Mäkinen N., Gao F., Palin K., Nurkkala H., Vähärautio A., Aavikko M., Kämpjärvi K., Vahteristo P., Kim C. A., Aaltonen L. A., Varjosalo M., Taipale J., Boyer T. G., 2014 Uterine Leiomyoma-Linked MED12 Mutations Disrupt Mediator-Associated CDK Activity. Cell Rep. Vallee B. L., Ulmer D. D., 1972 Biochemical effects of mercury, cadmium, and lead. Annu. Rev. Biochem. 41: 91–128. Vijayvargia R., May M. S., Fondell J. D., 2007 A coregulatory role for the mediator complex in prostate cancer cell proliferation and gene expression. Cancer Res. 67: 4034–4041. Vousden K. H., Prives C., 2009 Blinded by the Light: The Growing Complexity of p53. Cell 137: 413–431. Vulto-van Silfhout A. T., Vries B. B. A. de, Bon B. W. M. van, Hoischen A., Ruiterkamp-Versteeg M., Gilissen C., Gao F., Zwam M. van, Harteveld C. L., Essen A. J. van, Hamel B. C. J., Kleefstra T., Willemsen M. A. A. P., Yntema H. G., Bokhoven H. van, Brunner 175  H. G., Boyer T. G., Brouwer A. P. M. de, 2013 Mutations in MED12 cause X-linked Ohdo syndrome. Am. J. Hum. Genet. 92: 401–406. Wagmaister J. A., Miley G. R., Morris C. A., Gleason J. E., Miller L. M., Kornfeld K., Eisenmann D. M., 2006 Identification of cis-regulatory elements from the C. elegans Hox gene lin-39 required for embryonic expression and for regulation by the transcription factors LIN-1, LIN-31 and LIN-39. Dev. Biol. 297: 550–565. Wang J.-C., Walker A., Blackwell T. K., Yamamoto K. R., 2004 The Caenorhabditis elegans ortholog of TRAP240, CeTRAP240/let-19, selectively modulates gene expression and is essential for embryogenesis. J. Biol. Chem. 279: 29270–29277. Wang G., Balamotis M. A., Stevens J. L., Yamaguchi Y., Handa H., Berk A. J., 2005 Mediator requirement for both recruitment and postrecruitment steps in transcription initiation. Mol. Cell 17: 683–694. Wang X., Xu H., Ju D., Xie Y., 2008 Disruption of Rpn4-induced proteasome expression in Saccharomyces cerevisiae reduces cell viability under stressed conditions. Genetics 180: 1945–1953. Wang W., Huang L., Huang Y., Yin J., Berk A. J., Friedman J. M., Wang G., 2009 Mediator MED23 links insulin signaling to the adipogenesis transcription cascade. Dev. Cell 16: 764–771. Westerling T., Kuuluvainen E., Makela T. P., 2007 Cdk8 Is Essential for Preimplantation Mouse Development. Mol Cell Biol 27: 6177–6182. Wieczorek E., Brand M., Jacq X., Tora L., 1998 Function of TAF(II)-containing complex without TBP in transcription by RNA polymerase II. Nature 393: 187–191. Wimmer U., Wang Y., Georgiev O., Schaffner W., 2005 Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic Acids Res. 33: 5715–5727. Xie X.-J., Hsu F.-N., Gao X., Xu W., Ni J.-Q., Xing Y., Huang L., Hsiao H.-C., Zheng H., Wang C., Zheng Y., Xiaoli A. M., Yang F., Bondos S. E., Ji J.-Y., 2015 CDK8-Cyclin C Mediates Nutritional Regulation of Developmental Transitions through the Ecdysone Receptor in Drosophila. PLoS Biol 13: e1002207. Yang F., Vought B. W., Satterlee J. S., Walker A. K., Jim Sun Z.-Y., Watts J. L., DeBeaumont R., Saito R. M., Hyberts S. G., Yang S., Macol C., Iyer L., Tjian R., Heuvel S. van den, Hart A. C., Wagner G., Näär A. M., 2006 An ARC/Mediator subunit required for SREBP control of cholesterol and lipid homeostasis. Nature 442: 700–704. Yang X., Zhao M., Xia M., Liu Y., Yan J., Ji H., Wang G., 2012 Selective requirement for Mediator MED23 in Ras-active lung cancer. Proc. Natl. Acad. Sci. U. S. A. 109: E2813-2822. 176  Yao X., Tang Z., Fu X., Yin J., Liang Y., Li C., Li H., Tian Q., Roeder R. G., Wang G., 2015 The Mediator subunit MED23 couples H2B mono-ubiquitination to transcriptional control and cell fate determination. EMBO J. Yoda A., Kouike H., Okano H., Sawa H., 2005 Components of the transcriptional Mediator complex are required for asymmetric cell division in C. elegans. Dev. Camb. Engl. 132: 1885–1893. Yoo A. S., Bais C., Greenwald I., 2004 Crosstalk between the EGFR and LIN-12/Notch pathways in C. elegans vulval development. Science 303: 663–666. Yoon S., Seger R., 2006 The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors Chur Switz. 24: 21–44. Zhang H., Emmons S. W., 2000 A C. elegans mediator protein confers regulatory selectivity on lineage-specific expression of a transcription factor gene. Genes Dev. 14: 2161–2172. Zhang H., Emmons S. W., 2001 The novel C. elegans gene sop-3 modulates Wnt signaling to regulate Hox gene expression. Dev. Camb. Engl. 128: 767–777. Zhang F., Sumibcay L., Hinnebusch A. G., Swanson M. J., 2004 A Triad of Subunits from the Gal11/Tail Domain of Srb Mediator Is an In Vivo Target of Transcriptional Activator Gcn4p. Mol. Cell. Biol. 24: 6871–6886. Zhang X., Greenwald I., 2011 Spatial regulation of lag-2 transcription during vulval precursor cell fate patterning in Caenorhabditis elegans. Genetics 188: 847–858. Zhang P., Judy M., Lee S.-J., Kenyon C., 2013 Direct and indirect gene regulation by a life-extending FOXO protein in C. elegans: roles for GATA factors and lipid gene regulators. Cell Metab. 17: 85–100. Zhao X., Yang Y., Fitch D. H. A., Herman M. A., 2002 TLP-1 is an asymmetric cell fate determinant that responds to Wnt signals and controls male tail tip morphogenesis in C. elegans. Dev. Camb. Engl. 129: 1497–1508. Zhao X., Feng D., Wang Q., Abdulla A., Xie X.-J., Zhou J., Sun Y., Yang E. S., Liu L.-P., Vaitheesvaran B., Bridges L., Kurland I. J., Strich R., Ni J.-Q., Wang C., Ericsson J., Pessin J. E., Ji J.-Y., Yang F., 2012 Regulation of lipogenesis by cyclin-dependent kinase 8-mediated control of SREBP-1. J. Clin. Invest. 122: 2417–2427. Zhou H., Spaeth J. M., Kim N. H., Xu X., Friez M. J., Schwartz C. E., Boyer T. G., 2012 MED12 mutations link intellectual disability syndromes with dysregulated GLI3-dependent Sonic Hedgehog signaling. Proc. Natl. Acad. Sci. U. S. A. 109: 19763–19768. Zhu Y., Qi C., Jain S., Le Beau M. M., Espinosa R. 3rd, Atkins G. B., Lazar M. A., Yeldandi A. V., Rao M. S., Reddy J. K., 1999 Amplification and overexpression of peroxisome 177  proliferator-activated receptor binding protein (PBP/PPARBP) gene in breast cancer. Proc. Natl. Acad. Sci. U. S. A. 96: 10848–10853.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0300224/manifest

Comment

Related Items