UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Viral protease disruption of host transcription and translation factors in the pathogenesis of coxsackievirus… Hanson, Paul J. 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_may_hanson_paul.pdf [ 3.01MB ]
Metadata
JSON: 24-1.0300023.json
JSON-LD: 24-1.0300023-ld.json
RDF/XML (Pretty): 24-1.0300023-rdf.xml
RDF/JSON: 24-1.0300023-rdf.json
Turtle: 24-1.0300023-turtle.txt
N-Triples: 24-1.0300023-rdf-ntriples.txt
Original Record: 24-1.0300023-source.json
Full Text
24-1.0300023-fulltext.txt
Citation
24-1.0300023.ris

Full Text

VIRAL PROTEASE DISRUPTION OF HOST TRANSCRIPTION AND TRANSLATION FACTORS IN THE PATHOGENESIS OF COXSACKIEVIRUS B3 INDUCED VIRAL MYOCARDITIS by  Paul J. Hanson  B.Sc., University of Wisconsin, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  Doctor of Philosophy in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   April 2016  © Paul J. Hanson, 2016 ii  Abstract Myocarditis, inflammation of the heart muscle, is a spectrum of conditions causing significant morbidity and mortality, yet scientific and clinical knowledge related to this entity is limited. One of the most common and best studied causes of myocarditis is infection by coxsackievirus B3 (CVB3). An improved understanding of the science behind CVB3 myocarditis is critical to establishing better diagnostic and therapeutic strategies for affected individuals.  CVB3 infection redirects numerous cellular pathways from physiologic processes to viral replication, often mediated by viral proteases. Two viral targets in this process are death associated protein 5 (DAP5) and nuclear pore complex protein 98 (Nup98). DAP5 is a translation initiation factor specific to internal ribosome entry site (IRES) mediated translation.  Nup98 is a component of the nuclear pore complex and a transcription factor. In this thesis, I hypothesize that viral proteases contribute to the pathogenesis of viral myocarditis through interaction with DAP5 and Nup98, redirecting translation and transcription towards viral replication. Using in vitro (plasmid expressed viral proteases), in situ (CVB3 infection in cell culture), and in vivo (mouse myocarditis model) models, I demonstrate that viral protease 2A is responsible for the cleavage of DAP5 and Nup98 during CVB3 infection. Both cleavage events I show to be integral to the viral lifecycle using over expression of recombinant fragments and siRNA inhibition of that expression. These results suggest two previously unidentified targets for improved diagnostics and therapeutics for myocarditis, both areas for future research. iii  Preface Portions of Chapter 1, including Figure 6, are based upon a review article “IRES-dependent translational control during virus-induced endoplasmic reticulum stress and apoptosis”1 . I conducted the literature review, wrote the first draft of the manuscript, and executed the suggested revisions from co-authors.  Chapter 3 is based upon an original research article titled “Cleavage of DAP5 by Coxsackievirus B3 2A Protease Facilitates Viral Replication and Enhances Apoptosis by Altering Translation of IRES Containing Genes”. I designed all of the experiments and generated the majority of the data. I drafted the first draft of the manuscript and executed the suggested revisions from co-authors.  Chapter 5 is based on unpublished data and is the basis for a manuscript in preparation titled “Cleavage and sub-cellular redistribution of Nuclear Pore protein 98 (Nup98) by Coxsackievirus B3 protease 2A modulates cardioprotective gene expression”. I designed all experiments, generated the majority of the data, and have written the first version of the manuscript.   In addition to the work presented here, I contributed to other research efforts that have produced eight (8) peer-reviewed original manuscripts, four (4) book chapters, and three (3) published abstracts.   All animal experiments were carried out in accordance with the Guide to the Care and Use of Experimental Animals – Canadian Council on Animal Care, and all protocols were approved by the Animal Care Committee, University of British Columbia (protocol number: A11-0052). iv   Human tissue studies were conducted in accordance with the Declaration of Helsinki and current Tri-Council Policy Statement Version 2 guidelines, and the protocols were reviewed by the Providence Health Care Research Institute / University of British Columbia Research Ethics Board (protocols H05-50004, H05-50208, and H15-00408). v  Table of Contents  Abstract…………………………………………..………………………………………………ii Preface ........................................................................................................................................... iii Table of Contents ...........................................................................................................................v List of Tables ..................................................................................................................................x List of Figures ............................................................................................................................... xi List of Abbreviations ................................................................................................................. xiii Acknowledgements ................................................................................................................... xvii Dedication ................................................................................................................................. xviii Chapter 1: Introduction ................................................................................................................1 1.1 Myocarditis: Overview ................................................................................................... 1 1.1.1 History and Definition ................................................................................................ 1 1.1.2 The Dallas Criteria ...................................................................................................... 1 1.1.3 Clinical Presentation ................................................................................................... 3 1.1.4 Myocarditis: Epidemiology ........................................................................................ 3 1.1.5 Myocarditis: Diagnostics ............................................................................................ 5 1.1.6 Myocarditis: Treatment ............................................................................................... 6 1.1.7 Myocarditis: Etiology ................................................................................................. 7 1.1.7.1 Toxin Induced Myocarditis ................................................................................. 7 1.1.7.2 Hypersensitivity Myocarditis .............................................................................. 8 1.1.7.3 Autoimmune Myocarditis ................................................................................... 9 1.1.7.4 Bacterial, Fungal and Parasitic Myocarditis ..................................................... 10 vi  1.1.7.5 Viral Myocarditis .............................................................................................. 10 1.1.8 Pathogenesis of Viral Myocarditis ............................................................................ 12 1.1.8.1 Acute Phase ....................................................................................................... 14 1.1.8.2 Subacute Phase.................................................................................................. 14 1.1.8.3 Chronic Phase ................................................................................................... 15 1.2 Coxsackievirus B3 ........................................................................................................ 16 1.2.1 CVB3 Entry Into Cells .............................................................................................. 17 1.2.2 Tissue Tropism.......................................................................................................... 18 1.2.3 CVB3 Lifecycle ........................................................................................................ 18 1.2.4 Picornaviral Proteases: 2A and 3C ........................................................................... 22 1.2.5 CVB3 Inhibits Canonical Translation and Favors Cap-independent Translation .... 23 1.2.6 Death Associated Protein 5 ....................................................................................... 24 1.3 Viral-induced Nucleocytoplasmic Redistribution of Cellular Proteins ........................ 25 1.3.1 Nuclear Pore Protein 98 ............................................................................................ 26 1.3.2 Neuregulin-1 ............................................................................................................. 27 1.3.3 ERBB4 ...................................................................................................................... 29 1.4 Rationale, Hypothesis and Objectives .......................................................................... 29 1.4.1 Project Background and Rationale ............................................................................ 29 1.4.2 Hypothesis................................................................................................................. 30 1.4.3 Specific Aims and Experimental design ................................................................... 30 Chapter 2: Materials and Methods ............................................................................................32 2.1 Virus, Cells, Animals and Plasmids .............................................................................. 32 2.2 Transfection and Virus Infection .................................................................................. 33 vii  2.3 In Vitro Cleavage Assay ............................................................................................... 34 2.4 Western Blot and Desitometric Analysis ...................................................................... 35 2.5 Quantitative RT-PCR .................................................................................................... 36 2.6 Bicistronic Luciferase Reporter Assay ......................................................................... 37 2.7 Immunocytochemistry and Confocal Microscopy ........................................................ 38 2.8 MTS Assay.................................................................................................................... 38 2.9 Viral Plaque Assay ........................................................................................................ 38 2.10      Statistical Analysis……………………………………………………………………38 Chapter 3: Cleavage of DAP5 by CVB3 2A Protease Facilitates Viral Replication and Enhances Apoptosis by Altering Translation of IRES-containing Genes ..............................39 3.1 Background ................................................................................................................... 39 3.1.1 CVB3 IRES Mediated Translation ........................................................................... 39 3.1.2 DAP5 Structure and Function ................................................................................... 39 3.1.3 Viral Proteases Control Cellular Translation ............................................................ 40 3.2 Hypothesis and Specific Aims ...................................................................................... 41 3.3 Results ........................................................................................................................... 41 3.3.1 DAP5 Is Cleaved During CVB3 Infection in Tissue Culture Cells and in Mouse Heart…………… .................................................................................................................. 42 3.3.2 Viral Protease 2A but Not 3C Is Responsible for DAP5 Cleavage During CVB3 Infection ................................................................................................................................ 44 3.3.3 Glycine 434 Is the Site of DAP5 Cleavage by 2A During CVB3 Infection. ............ 48 3.3.4 DAP5-N Translocates to the Nucleus During Either Ectopic 2A Overexpression or CVB3 Infection. .................................................................................................................... 50 viii  3.3.5 Cleavage of DAP5 by 2A or Ectopic Expression of DAP5-N Enhances VP1 Production While siRNA Knockdown of DAP5 Suppresses VP1 Production.. ................... 54 3.3.6 Cleavage of DAP5 or Ectopic Expression of DAP5-N Enhances Viral Particle Formation While siRNA Knockdown of DAP5 Decreases Viral Particle Formation. ......... 57 3.3.7 DAP5-N and DAP5-C Differentially Regulate Translation of p53 and Bcl-2 and Result in Apoptotic Cell Death.. ........................................................................................... 60 3.3.8 DAP5-N and DAP5-C Differentially Alter Translation but Not Transcription of IRES-containing Genes P53 and BCL-2............................................................................... 64 3.4 Discussion ..................................................................................................................... 66 Chapter 4: Cleavage and Subcellular Redistribution of Nuclear Pore Protein 98 by Coxsackievirus B3 Protease 2A Modulates Cardioprotective Gene Expression ...................71 4.1 Background ................................................................................................................... 71 4.1.1 The Nuclear Pore Complex in Disease Pathogenesis ............................................... 71 4.1.2 Nup98 in Viral Pathogenesis .................................................................................... 72 4.1.3 Nup98-Nrg-1-erbB4 Signaling Axis ......................................................................... 73 4.2 Rationale ....................................................................................................................... 73 4.3 Hypothesis and Specific Aims ...................................................................................... 74 4.4 Results ........................................................................................................................... 74 4.4.1 Nup98 is Cleaved During CVB3 Infection. .............................................................. 74 4.4.2 CVB3 Protease 2A Is Responsible for the Cleavage of Nup98 During CVB3 Infection.. .............................................................................................................................. 74 4.4.3 CVB3 Infection Induces the Redistribution of Nup98 to Cytoplasmic Punctate Structures. ............................................................................................................................. 77 ix  4.4.4 Ectopic Expression of Viral Protease 2A Induces the Subcellular Redistribution of Nup98 to Punctate Cytoplasmic Structures. ......................................................................... 79 4.4.5 siRNA Knockdown of Nup98 Differentially Regulates Cardioprotective and Viral Gene Expression. .................................................................................................................. 80 4.4.6 siRNA Knockdown of Nup98 During CVB3 Infection Enhances Viral Titer During Early Infection Time Points. ................................................................................................. 82 4.4.7 Nup98, NRG1 and erbB4 Are Upregulated in CVB3 Infected Mouse Myocardium..... ..................................................................................................................... 83 4.5 Discussion ..................................................................................................................... 86 Chapter 5: Concluding Remarks ................................................................................................88 5.1 Conclusions ................................................................................................................... 88 5.2 Limitations .................................................................................................................... 90 5.3 Future Perspectives ....................................................................................................... 91 Bibliography .................................................................................................................................94  x  List of Tables Table 1: Etiologies of Myocarditis ...............................................................................................8 Table 2: Primer Sequences Used for q-PCR ...............................................................................36 xi  List of Figures Figure 1: Viral and Autoimmune Myocarditis Etiologies may be Histologically Indistinguishable.......................................................................................................................................................2 Figure 2: Cross-section of Human Normal and Chronic Active Myocarditis/Dilated Cardiomyopathy Hearts...………………………………………………………………………12 Figure 3: Virus-induced Myocarditis is a Triphasic Disease ......................................................13 Figure 4: Picornaviral Lifecycle .................................................................................................21 Figure 5: Schematic of the CVB3 Genome ................................................................................22 Figure 6: Picornavirus Infection and Other Cellular Stresses Induce Cap-independent Translation.....................................................................................................................................................24 Figure 7: DAP5 is Cleaved into N- and C- terminal Truncated Forms During CVB3 Infection in vitro and in vivo and is Transcriptionally Downregulated ..........................................................43 Figure 8: Viral Protease 2A and not 3C Cleaves Overexpressed WT FLAG-DAP5 and Endogenous DAP5 into 45 and 52kDa Truncates Generated During CVB3 Infection ..............46 Figure 9: Glycine 434 is the Site of 2A Cleavage of DAP5 During CVB3 Infection ................49 Figure 10: DAP5-N Translocates to Nucleus While G434E DAP5 and DAP5-C Remain in the Cytoplasm ...................................................................................................................................53 Figure 11: Cleavage of DAP5 During CVB3 Infection Enhances VP1 Production and siRNA Knockdown of DAP5 Suppresses VP1 Production ....................................................................56 Figure 12: Cleavage of DAP5 During CVB3 Infection Significantly Enhances Viral Titer ......59 Figure 13: DAP5-N and DAP5-C Differentially Regulate Translation of p53 and Bcl-2 and Result in Apoptotic Cell Death ...................................................................................................62 xii  Figure 14: Overexpression of DAP5-N and DAP5-C alters translation but not transcription of IRES-containing genes P53 and BCL-2  ....................................................................................65 Figure 15: Nup98 is Cleaved by Viral Protease 2A During CVB3 infection .............................76 Figure 16: CVB3 Infection Induces the Sub-cellular Redistribution of Nup98 in Cardiomyocytes.....................................................................................................................................................78 Figure 17: Ectopic Expression of Viral Protease 2A Results in the Sub-cellular Redistribution of Nup98 ..........................................................................................................................................80 Figure 18: siRNA Knockdown of Nup98 Differentially Regulates NRG-1 and VP-1 Expression.....................................................................................................................................................81 Figure 19: siRNA Knockdown of Nup98 Enhances Viral Titer 20-fold ....................................83 Figure 20: Nup98, NRG-1 and erbB4 are Upregulated in CVB3 Infected Mouse Hearts .........85    xiii  List of Abbreviations ADAM: A disintegrin and metalloproteinase ANP: atrial natriuretic peptide Akt: protein kinase B Apaf-1: apoptotic peptidase activating factor 1 ATRA: all-trans retinoic acid Bcl-2: B-cell lymphoma 2 BNP: brain natriuretic peptide CAR: coxsackievirus-adenovirus receptor Cdk-1: cyclin-dependent kinase 1 CMV: cytomegalovirus CVB: coxsackie group B serotypes DAF: decay-accelerating factor  DAP5: death associated protein 5 DCM: dilated cardiomyopathy DMEM: Dulbecco's modified Eagle's medium EBV: Epstein-Barr virus eIF4G: eukaryotic initiation factor 4G EMB: endomyocardial biopsy ER: endoplasmic reticulum FAK: focal adhesion kinase FBS: fetal bovine serum GCM: giant cell myocarditis  xiv  GPI: glycosyl-phosphatidylinositol HCV: hepatitis C virus H&E: hematoxylin and eosin HER2: human epidermal growth factor receptor 2 HIAP2: human inhibitor of apoptosis protein 2 HLA: human leukocyte antigen HIV: human immunodeficiency virus HnRNPs: heterogeneous nuclear ribonucleoproteins hpi: hours post infection HRV: human rhinovirus IL: interleukin IFN: interferon IRES: internal ribosomal entry site ITAFs: IRES trans-acting factors kDa: kilodalton KO: knockout LV: left ventricular LVEF: left ventricle ejection fraction MHC: major histocompatibility complex MRI: magnetic resonance imaging Mut: mutant MOI: multiplicity of infection xv  MTS: (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt) NE: nuclear envelope NES: nuclear export signal  NLS: nuclear localization signal NK cells: natural killer cells NPC: nuclear pore complex Nups: nuclear pore proteins Nup98: nuclear pore protein 98 nt: nucleotides ORF: open reading frame PABP: poly(A)-binding protein PBS: phosphate buffer saline pfu/mL: plaque forming units per mL PI3K: phophatidyl-3-kinase PCBP2: poly (rC)-binding protein 2 PTB: polypyrimidine tract binding protein q-RT-PCR: quantitative reverse transcriptase PCR RT: reverse transcription SIDS: sudden infant death syndrome siRNA: small interfering RNAs ShcA: Src homology and collagen A Src: non-receptor tyrosine kinase protein encoded SRC gene xvi  TNF: tumor necrosis factor UTR: untranslated region VPg: viral genome linked protein wt: wild type XIAP: x-linked inhibitor of apoptosis xvii  Acknowledgements I would like to acknowledge my Supervisors Dr. Decheng Yang and Dr. David J. Granville for the opportunity to conduct research in their respective laboratories. Their guidance and mentorship inspired and directed me throughout the process of becoming an independent researcher. I am truly grateful to them for their support in reviewing manuscripts, taking the time to meet and discuss research, and their mentorship on experimental design and data analysis. This dissertation is built upon three manuscripts, and has been supported by CIHR grant [MOP231119].   I would like to thank the Yang laboratory members, Ye Qiu, Mary Zhang, Xin Ye and Maged Hemida for their guidance and training. Also, I thank the Granville laboratory members Alon Hendel, Leigh Parkinson, Paul Hiebert, Wendy Boivin, Lisa Ang, as well HLI members Jeremy Hirota, Anna Meredith, Amrit Samra and Harpreet Rai. They were mentors as well as true friends to me throughout this journey. I could not have accomplished this without them.   I am also grateful to my supervisory committee members, Drs. Bruce McManus, Honglin Luo, John Boyd, and Janet Chantler. Their guidance, input and support made this work possible.   Lastly, I would like to especially thank Dr. Michael Seidman. His critical review and insight were integral to completion of my thesis. His mentorship has been phenomenal; I have learned more working with him over the past couple of years than at any time during my PhD. I have an enormous sense of gratitude and humility for being able to work closely with him.  xviii  Dedication  I would like to dedicate this dissertation to my parents. Without their unconditional love and support I would not have been able to accomplish this feat.  1  Chapter 1: Introduction 1.1 Myocarditis: Overview 1.1.1 History and Definition  Myocarditis, defined as inflammation of the heart muscle, is a spectrum of conditions causing considerable morbidity and mortality, yet there are considerable gaps in our scientific and clinical knowledge base relating to this entity 2. As a disease, myocarditis presents with wide-ranging and potentially life-threatening symptoms, and although myocarditis affects all demographics, it more commonly affects children and young adults. The most significant sequela of chronic myocarditis is dilated cardiomyopathy (DCM), which frequently necessitates mechanical circulatory support and/or heart transplantation. The term “myocarditis” was coined by Sobernheim in 1837 3 and expanded upon by Feidler in 1899 to include “isolated idiopathic interstitial myocarditis” 4. In 1942, Saphir proposed the first etiologic classification and highlighted the disparity between clinical and pathological presentation that persists today 5. In the 1960s, endomyocardial biopsy (EMB) was used to obtain tissue to facilitate firm clinical diagnoses in patients with suspected myocarditis. This technique remains the gold standard for diagnosis today 6.  1.1.2 The Dallas Criteria The Dallas criteria, established in 1986 by a group of eight cardiac pathologists, were the first widely accepted formalized diagnostic criteria for myocarditis, defined by those criteria as inflammatory cell infiltration of the myocardium with or without necrosis 7, 8. It provided two histopathologic categories upon which diagnosis could be based: 1) myocarditis with inflammatory infiltrate associated with necrosis or myocyte 2  degeneration without evidence of an ischemic event, and 2) borderline myocarditis with inflammatory infiltrate (often less pronounced) and no microscopic evidence of myocyte damage 7, 8. These criteria established a standard for the diagnosis of myocarditis, however they are limited in several respects. One limitation is the low diagnostic sensitivity of untargeted endomyocardial biopsy, attributed to the spatial heterogeneity of the disease9, 10. Further, the criteria do not take into account modern serologic methods for detecting virus11-13, radiologic methods for documenting tissue damage14, 15, or modern techniques for histologically studying immune activation, cell infiltration, or viral replication16, 17. Finally, EMB often cannot distinguish different etiologies of myocarditis (e.g. viral versus autoimmune, Figure 1) 18, 19, cannot predict short or long term outcomes, and cannot predict response to different treatment modalities9.         3  Figure 1. Viral and Autoimmune Myocarditis Etiologies may be Histologically Indistinguishable. Hematoxylin and eosin (H&E) staining of normal human left ventricular tissue at 10x and 40x magnification (left panels) and H&E staining of pathologist-confirmed myocarditis from a corresponding region of the left ventricle (right panels). Note the presence of mononuclear cell infiltration imaged in myocarditis as compared to normal heart tissue. The pathologist could not comment on viral versus autoimmune etiology as the histology is consistent with either.  1.1.3 Clinical Presentation  Myocarditis presentations are diverse. Acute infection may be asymptomatic, present with weakness, fatigue, exercise intolerance, shortness of breath, fever, nausea, vomiting, chest or abdominal pain, acute heart failure and/or cardiogenic shock, or induce sudden cardiac death 2, 18, 20 21. While many cases resolve without long term sequelae (estimated as much as half), others may develop arrhythmia or heart failure associated with chronic active myocarditis or dilated cardiomyopathy (DCM), possibly requiring implanted cardiac defibrillators, mechanical circulatory support, and/or heart transplantation 18, 22, 2, 23-28. In addition to this heterogeneity, children and young adults are frequently harder to diagnose due to having a greater capacity to compensate for cardiac dysfunction29. The longer the acute phase of illness goes undiagnosed and untreated, the more likely adverse chronic outcomes, such as heart failure and death, are likely. 1.1.4 Myocarditis: Epidemiology Due to the diverse presentation and poor diagnostic criteria and methods, the precise incidence of myocarditis is difficult to assess and likely underreported. Autopsy studies 4  of sudden, unexpected death in young people report myocarditis in 2 to 42% of cases30, 31. In Japan, a twenty year study found that 1:1000 of all autopsies had myocarditis 32. In tissue from cases of idiopathic DCM, myocarditis was reported in 9-16% of adults and in 46% of children 29, 33, 34. A significant fraction of sudden unexpected death is attributed to acute myocarditis, but the accuracy of these data are uncertain given possible under diagnosis (e.g., no post mortem investigation, poor tissue sampling) and possible over diagnosis (e.g., small foci of myocarditis as a cause of death without considering genetic causes, etc.) 35-37. When autopsy was performed, myocarditis was detected in 16-20% infants with suspected sudden infant death syndrome (SIDS) 38-40. An examination of EMB from patients with recent acute heart failure found that 89% of those had myocarditis 41. Over a 23 year study conducted in the United States, myocarditis was diagnosed in 0.3% of pediatric patients seen for cardiac dysfunction and found in 1.15% of autopsies 42. Furthermore, 27% of cases of pediatric DCM were found to have progressed from viral myocarditis 43 with only a 60% 10 year survival rate without heart transplantation in children29. In fact, meta-analysis of myocarditis studies from 1968 to 1975 demonstrated that ~52% of all cases were from children and young adults under the age of 40 44. The majority of myocarditis cases in developed countries are believed to be of viral etiology 45-47. The most common viral etiologies identified to date are enteroviruses, adenoviruses, herpesvirus 6 and parvovirus B19 48-50, although some of those data are under question51. Recently, 11.2% of H3N2 influenza cases showed evidence of viral induced myocardial injury in patients without cardiac symptoms 52. 5  These epidemiological data support the heterogeneous nature of myocarditis, but at least show that the disease is, in a clinical sense, common, and perhaps very common.  1.1.5 Myocarditis: Diagnostics The Dallas criteria attempted to standardize diagnostic guidelines for myocarditis, however, as mentioned (section 1.1.2) several limitations exist along with inter-observer variability 19. Due to its limitations, several other diagnostic approaches have been proposed, however there are to date no universally accepted or practiced guidelines. High blood pressure and heart rate have proven to be accurate predictors of acute myocarditis in patients without prior indications of heart failure 53. Electrocardiography (ECG) criteria for suspected myocarditis have been proposed25, 54. Radiologic imaging, such as magnetic resonance imaging (MRI) and positron emission tomography (PET), have increasingly been used to detect myocardial edema, fibrosis, and inflammation55-57. Laboratory evaluation of biomarkers such as cardiac troponins, B-type natriuretic peptide (BNP) and circulating cytokines has also been proposed as useful58. Relatedly, serology to detect immune response to virus (antibodies) or cardiac proteins (autoantibodies) have been used, but are found to have poor sensitivity and/or specificity11. Molecular detection of virus in blood and biopsy tissue has been used to increase sensitivity for the disease, with immunohistochemistry or in situ hybridization used for verification of actively replicating virus in heart tissue, even in the absence of inflammation59. These diagnostic modalities are primarily focused on acute myocarditis, with even fewer good diagnostic criteria for the long term sequelae of the disease. Using dilated 6  cardiomyopathy as a particularly prevalent outcome where myocarditis is a possible cause, under the current guidelines, approximately 50% of cases are classified as idiopathic, and these include a mix of undocumented toxin exposures, genetic causes, and others, in addition to undiagnosed myocarditis (Figure 1) 60. Patterns of myocardial injury in a non-ischemic distribution (i.e., not corresponding to vascular distribution), as determined by any given radiologic technique, can be suggestive of prior myocarditis. There are histologic patterns associated with prior myocarditis (irregularly distributed fibrosis, for example), but these require large pieces of tissue, often whole explants, to evaluate. 1.1.6 Myocarditis: Treatment The inherent complexity of making a proper diagnosis of myocarditis makes it equally challenging for clinicians to prescribe proper treatment. Studies performed to date show that even with a definite diagnosis of myocarditis, many treatment regimens are largely ineffective. This is further confounded by the diverse etiologies of myocarditis (see below). Antiviral therapy has been shown to be effective in some studies but not in others61, and presumably is only effective in cases with active viral infection. Corticosteroid therapy has similarly mixed results34, 62-64; in fact, it would be reasonable to hypothesize that steroids would help cases with sterile inflammation but might worsen cases with active viral infection. As a result of these variable data and the inability to reliably diagnose viral versus non-viral cases, care for myocarditis patients with acute heart failure remains largely supportive, often requiring intensive care unit admission. More recently, however, mechanical circulatory support, such as ventricular assist devices, has emerged as a way to support heart function while allowing the heart to rest 7  and recover, A large fraction of such patients can eventually have the assist device removed or turned off, returning to approximately normal heart function. For the patients that progress to arrhythmia, anti-arrhythmic medications and implanted cardiac defibrillators are effective. For patients that develop chronic heart failure, medical regimens, mechanical support, and heart transplantation are all well validated therapies. Unfortunately, we have no good data on any therapies that will decrease the likelihood of these chronic sequelae.  1.1.7 Myocarditis: Etiology  Myocarditis can result from multiple causes. The most common causes are infections (viral, bacterial, fungal), toxins, drug hypersensitivity and autoimmune origins 18; the full spectrum of these etiologies in summarized in Table 1, and each is discussed further below.  1.1.7.1 Toxin Induced Myocarditis Myocarditis may result from direct toxicity of a substance to cardiomyocytes, inducing a secondary immune response. Common agents associated with this mechanism are alcohol and cocaine, but a number of medications also cause similar toxicity. Most notable among these are doxorubicin, a common chemotherapy agent toxic to all cells, and trastuzumab, a monoclonal antibody used in treating breast cancer by targeting HER2, a receptor expressed on both breast cancer cells and cardiomyocytes65, 66 (see also section 1.3.2). Avoidance or low dose exposures are the primary means of avoiding heart damage 8  from these agents, but there is also growing research in cardioprotection67. In the future, tissue targeting may be effective to avoid cardiotoxicity.  Table 1. Etiologies of MyocarditisViral Bacterial Parasitic Coxsackievirus B3 Staphylococcus aureus Larva migransHIV Borrelia burgodoferi (Lyme disease) Trypanosoma cruziParvovirus B19 Ehrliichia  species SchistosomiasisAdenovirus Myobacteria Fungal CMV Mycoplasma pneumoniae HistoplasmaHCV Treponema pallidum AspergillusInfluenza A and B Autoimmune CoccidioidesHypersensitivity Giant-cell myocarditis CrytoccoccusDoxorubicin Churg-Strauss syndrome CandidaDiuretics Sarcoidosis Toxins Tricyclic anti-depressants Systemic lupus erythrematosus AlcoholDobutamine Thyrotoxicosis CocaineSulfonamides Wegner’s granulomatosis AntracyclinesCephalosporins Diabetes mellitus Interleukin-2Digoxins Takyasu’s arteritis Transtuzumab (Herceptin)adapted from Feldman and McNamara (reference 3)  1.1.7.2 Hypersensitivity Myocarditis Some agents, often medications, damage the heart not directly but via an immune hypersensitivity response, which may be heart focused (often for unknown reasons) or systemic14. Common agents associated with this phenomenon include antibiotics, antipsychotics, and anti-inflammatory medications. Histologically, this phenomenon is often associated with an eosinophilic infiltrate rather than the mononuclear infiltrate seen in some other etiologies. Drug hypersensitivity is commonly reversible once the drug has been withdrawn14, 65, 68. 9   1.1.7.3 Autoimmune Myocarditis In addition to immune responses to drugs, the body occasionally also mounts immune responses to heart tissue directly, i.e., autoimmunity69-72. This category includes two mechanisms, the first being primary autoimmunity, i.e. a failure in immune tolerance that causes a direct immune reaction to components of heart tissue. The other mechanism is a post-infectious model where infection, such as with virus, causes a persistent immune response to heart tissue by virtue of having unmasked an antigen or breaking tolerance. In reality, these mechanisms are very difficult to distinguish and may very well be on the same spectrum of immunologic events. Furthermore, the post-viral form of autoimmunity is incredibly difficult to distinguish from active viral myocarditis, particularly in cases of persistent viral genomes but in the absence of viral replication (see also 1.1.7.5). Autoimmune myocarditis may present with a number of different histologic pictures (see Figure 1). A vasculitic pattern is associated with rheumatoid arthritis and lupus. Eosinophilic myocarditis is associated with Churg-Strauss syndrome and Loeffler’s disease (the latter representing something between a hypersensitivity and autoimmunity)73, 74. Giant cells can be seen in giant cell myocarditis (GCM), which lacks true granulomas, and cardiac sarcoidosis, characterized by numerous well formed granulomas 14, 75, 76. The most troublesome histologic picture, however, is lymphocytic myocarditis. While classically considered synonymous with viral myocarditis, many cases with this histologic picture lack an identifiable pathogen, suggesting either clearance of the virus (and thus a post-viral autoimmune etiology) or a primary autoimmune etiology31, 71, 72. 10  Unfortunately, antibodies against heart components, most commonly myosin heavy chain (MHC)77, may form as a metaphenomenon in viral cases and thus are not a useful diagnostic adjunct.   1.1.7.4 Bacterial, Fungal and Parasitic Myocarditis Although not as common as viral myocarditis (see below), other infectious agents may cause myocarditis as well. These are more common in developing countries and rural areas, and in immunocompromised patients. Bacterial etiologies of myocarditis include Staphylococcus aureus (often associated with sepsis), Borrelia burgdoferi (Lyme disease, often self limited 18, 70), Ehrliichia species 78, and Corynebacterium diphtheria (diphtheria, often associated with heart block) 78. Fungal myocarditis, most often with Candida, is quite uncommon, and most often seen in the septic setting, often due to intravenous drug use or immunosuppression. Trypanosoma cruzi, a parasite common in Central and South America, causes Chagas disease and the associated myocarditis. Toxoplasmosis is an opportunistic parasitic infection seen in AIDS and transplant patients.  1.1.7.5 Viral Myocarditis Viruses make up the majority of infectious myocarditis cases in the developed world and is perhaps the leading cause of non-ischemic, non-genetic cardiomyopathy 79. Viral genomes have been found in 67.4% of patients with idiopathic DCM 80. In more than 25% of patients diagnosed with myocarditis, infections by at least two viruses were detected in their myocardium 80. Enteroviruses, particularly coxsackieviruses, are one of 11  the most commonly identified viruses in such cases, and the coxsackievirus B3 strain is perhaps the best studied cause of myocarditis to date. However, there is an ever-expanding panel of viruses being found in the myocardium of individuals with myocarditis, including RNA viruses such as other enteroviruses, hepatitis C, and influenza A and B viruses and DNA viruses such as parvovirus B19, adenovirus, Epstein Barr virus (EPV), cytomegalovirus (CMV), hepatitis B virus, and human immunodeficiency virus (HIV) (Table 1) 31. The overall frequency of viruses identified in cases of myocarditis may be an overestimate of causality, however. The increasing use of PCR, a highly sensitive technique, may be detecting latent or bystander viral genomes (such as EBV, the cause of mononucleosis, an incredibly prevalent infection), not just actively replicating viruses, with the latter being the canonical feature of true viral myocarditis. The best way to avoid such over detection is to use immunohistochemistry of in situ hybridization to detect virus in cardiomyocytes, or to use emerging techniques that specifically identify replicating viral RNA. On the other hand, these same techniques may also be missing cases of viral myocarditis. One cause of such is the limited sampling performed on heart tissue during EMB. Additionally, PCR is a targeted assay, and as such does not identify viruses for which we don’t yet know to look. Ultimately, teasing out both sides of this challenge will be essential to determining appropriate use of antiviral medications. 12   Figure 2. Cross-section of Human Normal and Chronic Active Myocarditis/Dilated Cardiomyopathy Hearts. Cross-sectional cut through the ventricles of a normal human heart compared to chronic active myocarditis/DCM. Note the dilated left ventricular chamber and regions of repeat inflammatory insult (scarring, yellow and white) in the myocardium of the chronic active myocarditic/DCM heart. The normal human heart has been formalin fixed and the chronic active myocarditis/dilated cardiomyopathy (DCM) image is explanted heart tissue from a transplant recipient. Images were generated from specimens at the cardiovascular tissue registry biobank, St. Paul’s Hospital, UBC, Vancouver, BC.  1.1.8 Pathogenesis of Viral Myocarditis  The pathogenesis of viral myocarditis is classically described as triphasic (Figure 3) 81, 82. The first phase is the acute infection, where there is active replication of the virus in the myocardium, resulting in direct damage to cardiomyocytes via necrosis and  13   Figure 3. Virus-induced Myocarditis is a Triphasic Disease. Based upon findings in murine models, viral myocarditis occurs in three distinct phases. 1) Acute phase or viremic phase, occurring 0-4 days post-infection, 2) Sub-acute or inflammatory phase 4-5 to 14 days post-infection 3) Chronic or remodeling phase 90 days post-infection and beyond. Each phase is characterized in time points post-infection and by distinct pathological events in the heart. The lower panels represent clinical presentations at each phase of myocarditis. Figure 3 is adapted from Esfandiarei et. al. Annual review of pathology69.   apoptosis, stimulating early immune responses. The second phase is the subacute or inflammatory stage, during which immune cells infiltrate the myocardium, clear the viral infection, and begin healing the myocardium. The third phase is the chronic phase, which in many patients is asymptomatic, but in some patients may manifest as either 14  chronic active myocarditis or DCM. Chronic active myocarditis is characterized by a mix of active inflammation and healing in the same heart over extended time periods, often years, with or without detectable virus. DCM is a form of cardiac remodeling, i.e., a response to damage, that results in enlarged chambers, decreased cardiac function, and ultimately heart failure.  1.1.8.1 Acute Phase The acute phase of myocarditis lasts from the time of viral infection of the myocardium up to approximately four days post infection. Symptoms may be subclinical (i.e., not appreciated by the patient or a physician), or be more consistent with one of two clinical presentations, classic or fulminant. The classic clinical presentations include symptoms such as dyspnea (shortness of breath), fatigue, angina (chest pain) and/or arrhythmia 2, 18. In the fulminant picture, patients present with severe left ventricular dysfunction without dilation, resulting in life threatening acute heart failure, typically requiring circulatory support, as well as potentially lethal arrhythmia, sometimes with sudden death 22, 83. In all clinical presentations, symptoms in the acute stage are manifestations of varying degrees of cardiac dysfunction and damage caused by viral replication directly damaging the myocardium. This damage induces host innate immune responses such as expression of the cytokines interleukin (IL)-1, IL-6 and IL-18 and interferon (IFN)-γ 84, 85.  1.1.8.2 Subacute Phase The subacute phase is characterized by immune cell infiltration and viral clearance, occurring typically five to fourteen days post infection, varying in length dependent 15  upon the degree of damage sustained during the acute phase. Active viral replication is virtually undetectable during the subacute phase and healing from the initial viral insult has begun. Clearance of tissue debris and tissue remodeling occur as a means of recovering from tissue injury and immune cell infiltration. During this phase, natural killer (NK) cells are highly active in response to IFN-γ. In addition, immunologic memory through T- and B-cells occurs to protect against future infection; occasionally, this particular step results in auto-reactive lymphocytes that later induce autoimmune type reactions.  1.1.8.3 Chronic Phase The chronic phase of myocarditis begins around 14 days post infection and continues indefinitely. In this phase, some individuals may fully recovery from the viral insult, leaving some degree of fibrosis (scar), but with no active inflammation and the absence of virus. Some of these individuals will experience no significant sequelae from this, but others, however, may be at risk for arrhythmia depending on the extent of the myocardial damage 86. Yet other individuals will progress to one of two chronic disease scenarios. In the first, chronic active myocarditis, there is ongoing inflammation and healing, with or without detectable virus, possibly reflecting an autoimmune component. The degree of damage will progress over time, and both the resultant scarring and the continued inflammation significantly predispose these patients to arrhythmia. Furthermore, the ongoing damage causes a progressively worsening heart failure, with an end stage very similar to the other chronic disease picture, DCM. DCM results from the heart remodeling in the setting on significant scar, be it acute or chronic active in 16  origin, in order to preserve vital cardiac function. Unfortunately, this remodeling has limits, and eventually results in heart failure. Furthermore, the scar burden and the remodeling both also predispose to arrhythmia. Such DCM is one of the most common indications for mechanical circulatory support and/or heart transplantation.  1.2 Coxsackievirus B3 Most of this understanding of viral myocarditis comes from study of coxsackievirus B3 (CVB3), one of the most common causes of viral myocarditis 87, 88. However, at the present, there is no widely approved or accepted antiviral therapy specific for CVB3, and there is no vaccine available. Coxsackieviruses were first described by Helwig and Schmidt in 1945 as “a filter-passing agent producing interstitial myocarditis” 89. In 1948, Dalldorf and Sickles isolated coxsackievirus A from the feces of children with paralysis showing features similar to poliovirus, a closely related enterovirus 90; they named the viruses after Coxsackie, NY, the town where the first fecal specimen was obtained. By 1949, Melnick had isolated coxsackievirus B, describing it as “a virus from patients diagnosed as non-paralytic poliomyelitis or aseptic meningitis” 91. Today, the coxsackieviruses include twenty nine identified serotypes divided into two groups, A and B 92, with serotypes CVB1, CVB3, and CVB5 being the most commonly identified in myocarditis 69. CVB3 in particular has been implicated in 20-40% of acute onset heart failure and DCM 93, 94. Infection by coxsackievirus occurs via the fecal-oral route. CVB3 is taken up by the host gastrointestinal tract and initially infects and replicates in lymphocytes and macrophages in the spleen 95. From there, infectious virons pass into the blood stream, where they 17  infect the pancreas, brain and heart causing pancreatitis, aseptic meningitis and myocarditis, respectively 96.   1.2.1 CVB3 Entry into Cells In order to gain entry into the cell, CVB3 first binds to its receptor, decay-accelerating factor (DAF), a widely expressed, glycophosphatidylinositol (GPI)-anchored membrane protein, on the apical surface of the host cell 69, 97, 98. The GPI anchor on DAF interacts with p56ICK, a Src-family tyrosine kinase that plays an integral part in CVB3 infection of T-cells and viral-induced injury of the myocardium 99. CVB3 also requires a second receptor for internalization into the host cell, the coxsackievirus B and adenovirus group C receptor (CAR) 100, an intercellular adhesion molecule of the immunoglobulin superfamily. In vivo models have demonstrated that cardiac specific deletion of CAR results in an inability of CVB3 to infect cardiomyocytes, inhibition of inflammation and prevention of cardiomyopathy 101. Interestingly, the CAR receptor is localized to tight junctions of intercalated disks in the myocardium, which are not readily available to the viral particle. Therefore, CVB3 must first bind DAF, allowing for actin rearrangement through the activation of Abl kinase, allowing the viral particle to migrate along the apical membrane into the tight junctions where CAR is located 102, 103. CVB3 binding to CAR allows for its endocytosis into the cell via caveolin-1 104. Additionally, expression of CAR may partially explain and determine tissue tropism for CVB3 infection (see below). CAR is expressed at high levels in the heart, brain, and testes, and is expressed at highest levels among children and neonates, the group most affected by viral 18  myocarditis. CAR receptor expression decreases with age, as does the frequency of viral myocarditis. 69, 105.  1.2.2 Tissue Tropism CVB3 is more prone to infect cells with higher levels of expression of CAR and DAF, and with higher metabolic activity, such as lymphocytes. However, some highly metabolically active cell types, such as hepatocytes, are not particularly susceptible to infection. Quiescent cells such as skeletal muscle and cardiomyocytes have been demonstrated to have a high degree of latent viral infection and persistence (i.e. viral RNA not actively replicating), but CVB3 requires cells undergoing the cell cycle to be actively proliferative. Mutations made to the CVB3 5’ untranslated region (UTR) and internal ribosomal entry site (IRES) have also been demonstrated to affect tissue tropism 106. Even these factors, however, do not adequately explain the observed phenomena. Previous studies have shown that mRNA expression of CAR doesn’t necessarily correlate with organ susceptibility to infection 107. Furthermore, why some individuals experience meningitis, another common disease manifestation of CVB3, while others experience myocarditis is not well understood.  1.2.3 CVB3 Lifecycle  CVB3 is a non-enveloped, positive, single-stranded 7.4-kb RNA virus, in the family Picornaviridae, genus enterovirus. Once internalized into the cell, the CVB3 virion, made up of four capsid proteins (VP1-VP4), is destabilized and uncoats. The positive-sense RNA strand then enters the cytoplasm. The CVB3 genome contains a single open reading frame flanked by highly structured 5’ and 3’ untranslated regions (UTR), which 19  are necessary for viral transcription and translation. The genomic RNA of CVB3 (and all picornaviruses) differs from cellular mRNA in that it lacks the m7G(5’)ppp(5’)N cap structure at the 5’ end. Instead, the 5’ UTR and the covalently bound VPg (see below) form an IRES, facilitating an alternative pathway for translation 108. This is of critical strategic and evolutionary importance to picornaviral translation, as it allows the virus to suppress most host gene expression while maintaining viral translation. The viral RNA is further stabilized by a poly-A tail in the 3’UTR 109 110 111, 112. It has been demonstrated that host proteins are also required for CVB3 translation, including La-antigen 113, polypyrimidine tract binding protein (PTB), eIF3B, and Poly (rC)-binding protein 2 (PCBP2) 114, 115, facilitating circularization of the RNA and thus multiple rounds of translation of the CVB3 genome. The virus is translated as a single polyprotein, within which several viral proteases are proteolytically active. These cleave the polyprotein into three precursor molecules, P1, P2 and P3, that are further processed into structural and non-structural proteins 69, 97, 116. The P1 region is further cleaved to generate the structural capsid proteins VP1-VP4, responsible for encapsulation of the viral genome, viral attachment to DAF and CAR mediated internalization. The P2 and P3 fragments are processed into the non-structural proteins, designated 2A and 2BC (from P2) and 3AB and 3CD (from P3) 117, 118. Protein 2A is a cysteine proteinase similar in structure to chymotrypsin (discussed in detail in section 1.2.4) 119, 120. Protein 2BC is cleaved to mature proteins 2B and 2C. Protein 2B alters Ca2+ levels in the Golgi complex and endoplasmic reticulum (ER), causes disassembly of the Golgi complex, blocks cell secretory pathways, regulates RNA synthesis, permeabilizes the plasma membrane, and interacts with the membranous 20  vesicles formed during viral replication 121-125. Highly conserved among picornaviruses, Protein 2C functions in all facets of the viral lifecycle including uncoating, host membrane disruption, RNA replication and encapsidation 126-129 130 131-133. Protein 3AB has been reported to interact with the membranous vesicles 134 and stimulate the autolysis and polymerase activity of 3CD 134-136, as well as being processed into proteins 3A and 3B. Protein 3A is the least conserved of the picornaviral proteins; like many of the other viral proteins, it associates with membranous vesicles and disrupts Golgi complex trafficking 121, 137, and it also prevents the secretion of antiviral cytokines 138. Protein 3B, also known as VPg, is a small protein that covalently attaches to the 5’ end of picornaviral RNA and is absolutely essential for the picornaviral lifecycle 139, 140, acting as the primer for positive and negative RNA synthesis and interacting with the RNA polymerase 3D 141. VPg is specifically required for the cap-independent translation of CVB3, bypassing host canonical translation initiation factor eIF4E. Protein 3CD is the precursor to the 3C protease and 3D polymerase. The mature 3C protease catalyzes the processing of the P2 and P3 proteins. Protease 3C has a structure similar to chymotrypsin, but 3C has a cysteine instead of serine as the nucleophilic amino acid 142. Like its 2A counterpart, 3C cleaves host proteins involved in gene expression in order to favor viral gene expression 143. Protein 3D encodes an RNA-dependent RNA polymerase, essential to replication of the CVB3 RNA through a negative strand intermediate. The resulting, replicated, positive strand continues to act as a template for translation, as well as a template for negative strand transcription. In addition, the positive strand becomes encapsidated to form new viral particles, which are released 21  from the cell via cell lysis, thus beginning the viral lifecycle again.   Figure 4. Picornaviral Lifecycle. CVB3 binds the DAF receptor and is internalized by the CAR receptor at the intercalated disks of cardiomyocytes. Once internalized, the virus uncoats and the genome is translated via IRES-mediated translation. The viral polyprotein is processed and induces pro- and anti-apoptotic effects, shut-off of cap-dependent host translation and shut-off of host transcription. Positive (viral genome) and negative strand occurs viral replication complexes. The positive stranded viral RNA is packaged into mature virons and cell lysis occurs due to viral induced apoptosis. Viral egress occurs and the lifecycle begins again in surrounding non-infected cardiomyocytes. (Figure was adapted from Whitten, et. al. Nature Reviews 144).  22   1.2.4 Picornaviral Proteases: 2A and 3C The picornaviral proteases were first described over 40 years ago in encephalomyocarditis virus (EMCV) 145, 146. Protease 3C was identified by Hanecak et al. in 1982147  and protease 2A by Toyoda et al. in 1986 148. Several groups identified cysteine as the active nucleophile site for protease 3C, however its tertiary fold structure was more similar to chymotrypsin-like proteases (which have a serine nucleophile) 149-151. In all picornaviruses, 3C cleavage sites require a glycine at position P’1 152, 153. Protease 2A also utilizes cysteine as the active nucleophile site, with its tertiary structure similar to small bacteria chymotrypsin-like proteases 150.                                                                                       Figure 5. Schematic of the CVB3 Genome. The CVB3 genome is 7.4 kB positive stranded RNA containing a long IRES within its 5’UTR with VPg protein replacing the cap-structure for translation initiation found in cellular mRNA. The ORF codes for 11 viral proteins, 4 structural proteins which generate the viral capsid, and 7 non-structural proteins (see section 1.2.3 detailing viral protein function). This figure was adapted from Feng et. al. 2014 154.  23  Proteases 2A and 3C directly contribute to the pathogenesis of viral myocarditis through cleavage of numerous cellular substrates. This has been shown to disrupt the cytoskeleton 155-157, induce apoptosis 158 159, induce stress granules 160, and cleave transcription factors and block gene expression 161.  Furthermore, expression of 2A has been demonstrated to induce dilated cardiomyopathy 162. However, the detailed mechanisms of how this occurs are not fully elucidated.   1.2.5 CVB3 Inhibits Canonical Translation and Favors Cap-independent Translation  CVB3 hijacks host cellular translation machinery, inducing preferential translation of the viral genome. This is particularly facilitated by blocking canonical 5’ cap mediated mRNA translation and inducing IRES mediated translation, a mechanism shared across the picornavirus family 88, 159 160, 161 163. Proteases 2A and 3C have been demonstrated to cleave and inactivate eukaryotic initiation factor GI (eIF4GI) between the eIF4E and eIF3 binding site, generating a truncated C-terminal fragment that is unable to bind the cap-sensing canonical translation initiation factor eIF4E 1, 164-166, but which instead facilitates IRES-mediated translation. Viral proteases also cleave eIF4GII, eIF5B, and the poly-(A) binding protein (PABP) 167, 168 169-171. Of note, however, a small subset of native cellular mRNAs does undergo IRES mediated translation, and these are not necessarily inhibited by the virus induced shift away from canonical translation1.   24   Figure 6. Picornavirus Infection and Other Cellular Stresses Induce Cap-independent Translation. (Figure is from Hanson, et. al.1) 1.2.6 Death Associated Protein 5  A recently identified target of the viral proteases, death-associated protein 5 (DAP5), also termed p97 and NAT1, is a 97 kDa protein independently discovered by several groups in 1997 172-175. DAP5 shares homology with the central and C-terminal region of eIF4GI, including the binding sites for eIF4A, eIF3, Mnk1, and eIF2β 176, 177, but DAP5 lacks the N-terminal region of eIF4G that contains binding sites for PABP and eIF4E, the latter being the factor that binds the 5’ cap in canonical translation 175, 178. DAP5 is a key regulator of cap-independent translation in concert with eIF4AI and eIF2β 179, facilitating the translation of genes involved in apoptosis, growth, differentiation, and ER stress response 177, 180, 181. DAP5 activity is partially regulated through proteolytic cleavage, both by native and viral proteases 176, 182, 183. In its proform (p97), DAP5 has an anti-apoptotic role, stimulating the translation of Bcl-2 and Cdk-1 181, but during caspase-mediated 25  apoptosis, DAP5 is cleaved near the C-terminus into an 86 kDa form (p86) by caspase-3, shifting translation towards a particular subset of apoptosis related genes 184, 185. The p86 form is also able to generate a positive feedback loop by stimulating DAP5 translation 182. DAP5 has been shown to be cleaved during CVB3 infection 183, but the cleavage site, protease responsible, and function of the cleavage fragments has not been examined. Previous reports have demonstrated key roles for virus-induced cleavage fragments of translation initiation factors that benefit the virus through preferential translation of viral genome and inhibition of cellular protein translation. Thus, the identification of the protease cleaving DAP5 and determining the effect of cleavage on viral replication and progeny release during CVB3 infection may provide novel insight into the understanding of functional role of DAP5 in viral pathogenesis. (Chapter 3)  1.3 Viral-induced Nucleocytoplasmic Redistribution of Cellular Proteins Picornaviruses are cytoplasmic in nature. However, many of the proteins associated with mRNA formation and induction of translation reside in the nucleus, where mRNA is typically formed. The viruses have evolved mechanisms to induce subcellular redistribution of these nuclear resident proteins to the cytoplasm. Redistributed nuclear resident proteins La autoantigen 186, Sam68 187 and several members of the heterogeneous nuclear ribonucleoproteins (HnRNPs) all act as IRES transactivating factors (ITAFs) that stabilize viral RNA and facilitate viral translation 188-192. This redistribution results from virus mediated modifications to the nucelo-cytoplasmic transport system, specifically the nuclear pore complex (NPC), and contributes to shut down of host gene transcription and subsequent translation 163. That same system is absolutely essential to signal transduction in cellular 26  innate immune and antiviral responses 193, and thus the modified NPC activity also contributes to evasion of host response 163. The nuclear pore complex (NPC) is a protein complex embedded in the lipid bilayer nuclear envelope (NE) composed of over 40 different proteins termed nuclear pore proteins, or Nups 194. While diffusion across the NE can occur for proteins less than 50kDa, the majority of nuclear transport is mediated by the NPC, which recognizes various Phe-Gly (FG) amino acid repeat sequences for nuclear import or export, termed nuclear localization signals (NLSs) or nuclear export signals (NESs). Removal of these signals will cause cellular redistribution by virtue of being unable to cross the NE. As an example of how the virus uses this, Protease 3C has been demonstrated to cleave the NLS on the La autoantigen, preventing delivery to the nucleus and causing accumulation in the cytoplasm 186, 195. A further mechanism of such redistribution is to disrupt the NPC itself, and reports have emerged of picornaviruses cleaving Nups to facilitate enhanced viral pathogenesis, viral evasion of host immune responsiveness and increased viral replication 187, 188, 196, 197 198-202. Poliovirus protease 2A, closely related to CVB3 2A, cleaves Nup153, Nup98 and Nup62 203, allowing for nucleo-cytoplasmic redistribution of hnRNPs and La autoantigen 195, 204.  1.3.1 Nuclear Pore Protein 98 The Nup98 component of the NPC plays a major role in the pathogenesis of disease, not only in nucleo-cytoplasmic trafficking, but also as a mobile, dynamic transcription factor18, 205. Nup98 enhances the transcription of anti-viral genes in Drosophila in response to RNA viral infections 80. During human development, the expression of a dominant negative fragment of Nup98 inhibited the transcription and expression of 138 27  genes 205. Nup98 is targeted early and with high affinity by protease 2A during poliovirus infection, an enterovirus closely related to CVB3197. Moreover, Nup98 deficient mice are highly susceptible to viral infection and are not responsive to type I or II interferons, displaying dysregulated innate and adaptive immunity 206. Nup98 is responsive to and upregulated by interferons (particularly IFN-γ), which promotes its function of enhancing transcription 207. Natural killer (NK) cells respond to CVB3 infected cells by increasing and secreting IFN-γ in humans208. IFN-γ mediates Th-1 responses and protects against chronic viral myocarditis by reducing fibrosis and profibrotic cytokines in the heart 70.  1.3.2 Neuregulin-1  Nup98 enhances the transcription of neuregulin-1 (NRG-1), a so-called cardioprotective gene 205. CVB3 infected mice treated with NRG-1 protected from myocardial damage in comparison to non-treated controls 209. NRG-1 signaling through receptors erbB4 and erbB2 induces cardiomyocyte proliferation and repair post-myocardial infarction in mice by kinase activation of pro-survival pathways through Src, ShcA and PI3K 185, 210. Additionally, erbB4 knock-out mice develop DCM 211. Therefore, disruption and dysregulation of Nup98 and the Nup98-NRG-1-erbB4 signaling axis likely plays a critical role in the pathogenesis of CVB3 induced myocarditis and cardiac remodeling in immunocompromised individuals. As its name suggests, neuregulin-1 (NRG1) was first identified in the brain. Since its original discovery, an integral role in cardiac development and maintenance of structural and functional integrity in the adult heart has emerged 212. Neuregulin-1 is a 1400 kb gene 28  on chromosome 8p12 213 and expresses 3 Nrg-1α and 8 Nrg-1β isoforms, with the β isoforms being more bioreactive as well as having higher affinity for its receptors, transmembrane tyrosine kinase receptors of ERBB family which includes the epidermal growth factor receptor erbB4 212, 214. Nrg-1 is a membrane protein that is typically cleaved by cellular proteases in the A Disintegrin and Metalloproteinases (ADAM) family, resulting in two fragments; a truncated membrane bound fragment and the release of its extracellular portion that has paracrine activity215. During development of the heart, NRG1 plays an integral role in trabeculation and myocyte proliferation, resulting in the thickening of the myocardium, allowing for proper functioning of the ventricles. Knockout (KO) of NRG-1, ERBB2 or ERBB4 is lethal in mice, due to failure of cardiac development216-218. In healthy adults, Nrg-1 activation of the PI3K/Akt pathway is cardioprotective and maintains cell survival during conditions of ischemia, metabolic stress, serum starvation, drug toxicity and hypersensitivity (e.g. doxorubicin induced cardiac toxicity) 219-221. In addition, Nrg-1 activates focal adhesion kinase (FAK) in cardiomyocytes, which maintains sacromeric integrity and stimulates cell survival 222, 223. Inhibition of Nrg-1 stimulation of FAK has been demonstrated to lead to ventricular dilation and regression to fetal cardiac gene expression224, 225. In chronic heart failure patients, circulating Nrg-1 has been identified as a potential biomarker associated with disease severity and increased risk of cardiac death 226. Nrg-1 likely has a clinical application in that preconditioning with Nrg-1 has been shown to protect the heart from ischemia/reperfusion injury 227 and has shown promise in treatment of patients with heart failure 228. Treatment with recombinant Nrg-1 improved cardiac function, attenuated disease pathogenesis, reversed cardiac remodeling and prolonged survival in multiple 29  animal models of heart disease, including viral cardiomyopathy, shown to be mediated through the erbB4 receptor 229, 230. Recently, human trials have also demonstrated increases in left ventricle ejection fraction (LVEF) % with treatment of recombinant Nrg-1 in patients with chronic heart failure231.   1.3.3 ERBB4 Nrg-1 signaling through erbB4 regulates cardiomyocyte growth, proliferation, survival and angiogenesis, among other processes involved in cardiac structure and function 232, 233. ERBB4 is expressed at high levels at the intercalated discs, a critical site for intercellular communication, which may offer insight into the ability of recombinant Nrg-1 administration to promote cell-cell activation in heart failure models 234 210. Nrg-1/erbB4 signaling can also induce cardiomyocyte regeneration following pathological insult210, 229. Mice with ERBB2 or ERBB4 KO arrest during development due to an inability to properly develop musculature in the ventricles and do not develop a ventricular septum 234. The importance of this signaling axis is further exemplified by a recent study demonstrating that in a cardiac specific, inducible KO of ERBB4, mice spontaneously developed DCM235. Moreover, patients with chronic heart failure showed decreased ErbB4 expression236.  1.4 Rationale, Hypothesis and Objectives 1.4.1 Project Background and Rationale These accumulated data show that CVB3, a common etiologic agent of myocarditis, hijacks cellular transcription and translation machinery and evades the host immune 30  system to induce this potentially lethal disease. In particular, a shift towards IRES mediated translation and disruptions of the NPC are key mechanisms in this pathogenesis. A better understanding of the role of viral proteases in altering host translation, protein trafficking and transcription of protective and immune-mediated genes will provide critical insight into the diagnosis, pathogenesis, and potential therapeutic targets of myocarditis.  1.4.2 Hypothesis Viral proteases 2A and 3C contribute to the pathogenesis of viral myocarditis via disruption of translation, transcription, cardioprotection, and immune response through cleavage of DAP5 and Nup98 with downstream impact on Bcl-2, p53, Nrg-1 and erbB4.  1.4.3 Specific Aims and Experimental Design  Aim 1: What is/are the mechanism(s) and functional significance of CVB3-induced DAP5 cleavage? Although it has been demonstrated that DAP5 is cleaved during CVB3 infection, it is not known which viral protease is responsible, what the exact cleavage site is, or what the impact of the cleaved protein is on cell physiology and viral replication. Cell culture studies with recombinant proteins were used to investigate these questions. This work is discussed in Chapter 3.  31  Aim 2: What is/are the Mechanism(s) and Functional Significance of CVB3-Induced Nup98 Cleavage? Although related viruses have been associated with Nup98 cleavage, this has not been demonstrated in CVB3 infection. Again, cell culture and recombinant proteins were used to explore this topic, and to determine the impact of any such cleavage. This work is discussed in chapter 4.  32  Chapter 2: Materials and Methods 2.1 Virus, Cells, Animals and Plasmids This study was carried out in strict accordance with the recommendations in the Guide to the Care and Use of Experimental Animals – Canadian Council on Animal Care. All protocols were approved by the Animal Care Committee, University of British Columbia (protocol number: A11-0052). CVB3 (CG) strain was obtained from Dr. Charles Gauntt (University of Texas Health Science Center, San Antonio, TX) and propagated in HeLa cells (ATCC). Virus stock was isolated from cells by three freeze-thaw cycles followed by centrifugation to remove cell debris, and stored at -80oC. The titer of virus stock was determined by plaque assay as described in a later section. 4-Week old male A/J mice were purchased from Jackson Laboratories (Maine, USA). Mice were infected with 105 PFU of CVB3 or sham infected with PBS (Sigma, St. Louis, MO) by intraperitoneal inoculation. HeLa cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Clontech, Palo Alto, CA). FLAG-DAP5/97 plasmid (WT DAP5) was generously provided by Dr. Martin Holcik (Children’s Hospital of Eastern Ontario, Ottawa, ON) 177. pIRES-2A was produced as previously described 50. Cell lystates were prepared at 24 and/or 48 h post transfection for western blot analysis using the appropriate antibody, described below. Two plasmids (pcDNA3-FLAG-DAP5N and pcDNA3-DAP5C-HA), expressing the N- and C-terminal cleavage products of DAP5 respectively, were constructed by a PCR-mediated method. Briefly, cDNA fragments encoding the N- or C-terminal region of DAP5 were synthesized by PCR using the up- and down-stream primers containing Xho I/Bam HI and Xho I/EcoR I restriction sites, respectively. The fragments were cloned into pcDNA3.1-5’FLAG and pcDNA3.1-3’HA vector at the above mentioned restriction sites, respectively. The uncleavable DAP5 plasmid pcDNA3.1-FLAG-33  DAP5/G434E was constructed commercially (TopGene Technologies, Quebec, Canada) by site-directed mutagenesis of the WT pcDNA3.1-FLAG-DAP5 plasmid to change nucleotide G to E, which resulted in the change from Glycine at 434 to Glutamic Acid. HeLa cells were transfected with WT DAP5 or G434E DAP5 and subsequently infected with CVB3 at 48 h post transfection. Cell lysates were analyzed by western blot using a FLAG antibody. The bicistronic luciferase reporter plasmids (C49-CVB3-5’UTR, C49-Bcl2-5’UTR, C49-p53-5’UTR) were constructed by inserting the corresponding 5’ UTRs between the Renilla and the firefly luciferase coding regions on C49 vector, a kind gift from Dr. Joanna Floros’s laboratory. The CVB3 and Bcl-2 5’UTRs were amplified by PCR using specific primers and the plasmids we have as templates. The p53 5’UTR 237 was synthesized by RT-PCR and cloned into the C49 vector. All the 5’UTRs are flanked by EcoRI digesting sites matching the cloning site on the vector. 2.2 Transfection and Virus Infection HeLa cells (2 × 105/well) at 70-80% confluence in 6-well plates were washed with PBS and overlaid for 24 h with transfection complex containing 2 µg of plasmid DNA and 10 µl of lipofectamine 2000 (Invitrogen) or 10µM Scrambled siRNA, DAP5 or Nup98 siRNA (Santa Cruz) and 5µl oligofectamine (Invitrogen) reagent per well. The transfection medium was then replaced with DMEM containing 10% FBS and the incubation was continued for 24 h prior to viral infection, or 48 h for plasmid DNA or 48 h for all siRNA experiments prior to harvesting. For viral infection, cells were washed with PBS and infected in 500 µl of serum-free DMEM at a multiplicity of infection (MOI) of 10 or sham-infected with PBS for the indicated time points in hours (hpi).  34  2.3 In Vitro Cleavage Assay Purified, recombinant proteases 2A and 3C were a generous gift from Gabriel Fung, via Dr. Eric Jan’s lab (University of British Columbia, Biochemistry and Molecular Biology). Cleavage reactions were performed as previously described238 . Briefly, HeLa cell lysates were combined with CVB 2A or 2A catalytically inactivated mutant at 5ng/µl or CVB3 3C or 3C catalytically inactive mutant at 100ng/µl in 20 mM Hepes, 150 mM KOAc and 1 mM DTT. Reaction mixtures were incubated for 16 h at 37ºC. Reactions were stopped by the addition of SDS-PAGE sample treatment buffer. Cleavage activity was assessed by western blot.  2.4 Western Blot and Densitometric Analysis Western blots were performed using standard protocols as previously described 239. Mouse heart tissue was sectioned from the apical tissue and homogenized in MOSLB lysis buffer. The lysates were centrifuged at 13,000 × g for 20 min and the supernatants were collected for measuring the protein concentration using the Bradford Assay (Bio-Rad Laboratories, Mississauga, ON). Cells were washed twice in cold PBS after transfection or infection at different time points mentioned above. Cells were lysed in lysis buffer (0.025 M Tris-HCl, pH 8.0, 137 mM NaCl, 10% glycerol, 1mM EDTA, 1mM EGTA, 1%Triton X-100 and protease inhibitor cocktail) on ice for 20 min. Supernatants containing proteins were isolated by centrifugation at 13,000 × g at 4 °C for 15 min. Nuclear and cytoplasmic proteins were isolated using the NePER kit according to the manufacturer’s instructions (Thermo Scientific, Waltham, MA). WT DAP5, DAP5-N or DAP5-C was transfected into HeLa cells for 48 h in the absence of CVB3 infection, followed by nuclear protein extraction to separate the nuclear and cytoplasmic fractions. Histone-1 was used as a nuclear purity control and β-actin was used as a loading control, which is present in both the nucleus and cytoplasm240, 241. Proteins were separated by 10% SDS-polyacrylamide gel 35  electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (Amersham GE, Buckinghamshire, UK). Membranes were blocked in 5% skim milk in Tris-buffered saline 10% tween (TBST) buffer for 1 h and subsequently incubated with one of the following primary antibodies against DAP5-N (Thermo Scientific), DAP5-C (Cell Signaling), Oct-8 (FLAG), HA and p53 (Santa Cruz), Bcl-2 (Cell signaling), caspase-3 (Cell signaling), PARP (Santa Cruz), phospho-eIF4E (Ser209) (Santa Cruz), total eIF4E (Santa Cruz), VP-1 (Dako) Nup98 (Cell signaling), Neuregulin-1 (Santa Cruz), erbB4 (Santa Cruz) and β-actin (Sigma) at 4 °C overnight. Membranes were then washed in TBST 3 times for 10 min each, followed by incubation with the appropriate secondary antibody (goat anti-mouse or donkey anti-rabbit) conjugated to horseradish peroxidase (Amersham) and visualized using the enhanced chemiluminescence method as per the manufacturer’s instructions (Amersham). Image J software (http://rsb.info.nih.gov/ij/index.html) was used to compare band intensity of western blots as previously described in the user’s guide. Briefly, intensities from at least 3 different experiments were quantified and normalized to β-actin or GAPDH. See section 2.9 for statistical analysis.  2.5 Quantitative RT-PCR Cellular mRNAs were extracted and isolated using RNeasy mini Kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription of RNAs was performed using SuperScript III First-Strand cDNA Synthesis System for RT-PCR according to the manufacturer’s instructions (Invitrogen). cDNA was measured by quantitative real-time PCR (q-RT-PCR) using the QuantiTect SYBR Green PCR Kit (Qiagen). Primers were designed from previous publications; for p53 237, Bcl-2 181 and DAP5 181 GAPDH mRNA levels served as an endogenous control. All 36  real-time q-RT-PCR experiments were performed in triplicate with no-template as a negative control. Table 2. Primer Sequences Used for q-PCR Gene Forward Primer Reverse Primer Reference P53 5′-TGGGCTTCTTGCATTCTGG-3’ 5′-GCTGTGACTGCTTGTAGATGGC-3′ 237 DAP5 5′- CTCTTATCCCAGCTGCAAGG-3′ 5′- CCCAGAGGTGGTGTTTGAGT-3′ 181 β-actin 5′-TCCCTGGAGAAGAGCTACGA-3′ 5′- AGCACTGTGTTGGCGTACAG-3 242 GAPDH 5′GTCGGAGTCAACGGATTTGG-3′ 5′- AAAAGCAGCCCTGGTGACC-3′ 237 BCL-2 5’ – ATCGCCCTG TGGATGATC GAG – 3’ 5’ – CAGCCAGGAGAAATCAAACAGAGG – 3’ 181  2.6 Bicistronic Luciferase Reporter Assay HeLa cells were seeded in 24-well plates and co-transfected with C49-CVB3-5’UTR, C49-Bcl2-5’UTR, C49-p53-5’UTR or C49 vector only and plasmid expressing WT DAP5, DAP5-N- or DAP5-C as described above. At 48 h post transfection, firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase analysis system (Promega) according to the manufacturer’s protocol. Briefly, the transfected cells were lysed with 100 μL/well of passive lysis buffer (Promega), and then 20 μL of the lysates were mixed with 100 μL of LAR II luciferase assay substrate. The firefly luciferase activity was measured immediately using a Tecan GENios fluorescence reader to detect the intensity of signal. One hundred μL of Stop & Glo® solution was then added and the Renilla luciferase activity was detected using the same reader. All the assays were performed in triplicates. 37  2.7 Immunocytochemistry and Confocal Microscopy  HeLa cells proliferating on glass coverslips in a 6-well plate at approximately 70% confluence were cotransfected with pIRES-2A and plasmid (FLAG-DAP5-HA) expressing WT DAP5 containing an N-terminal FLAG tag and a C-terminal HA tag or G434E DAP5 (containing an N-terminal FLAG tag) and then immunostained the N- and C-terminal regions of DAP5 with FLAG and HA antibody, respectively, at 48 h post co-transfection or subjected to CVB3 infection at the indicated time points and subsequently immunostained as described previously 243. Briefly, cells were fixed with 4% paraformaldehyde, permeabilized in methanol/acetone (50:50) at -20 °C for 20 min and stained with an anti-Nup98 primary antibody (Cell Signaling), anti-FLAG or anti-HA primary antibody (Santa Cruz). Slides were washed and stained with a goat anti-rabbit IgG (H + L) labeled with ALEXA Fluor 488 or 594 (Invitrogen). Nuclei were stained with 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Vector Laboratories). Cells were observed with a Leica SP2 AOBS confocal microscope. Mouse hearts were harvested from 4 week old CVB3 infected A/J mice (see above) and fixed in 10% Formalin (Fisher) for at least 24h. Hearts were then imbedded in paraffin and sectioned in 4um sections onto slides for staining. Sections were deparaffinized, rehydrated and subjected to citrate buffer (pH 6.0, Invitrogen) heat-induced antigen retrieval. Slides were washed in TBS and blocked for 30 mins in TBS/10% BSA solution at room temperature (RT). Slides were incubated overnight at 4C with primary antibody (Nup98, Nrg-1, or erbB4) diluted in TBS/1% BSA according to the manufacturer’s suggestion. The following day, the slides were treated with Mach 4 polymer detection complex-alkaline phosphatase (Biocare Medical) amplification step followed by Warp Chromagen Red (Biocare Medical, Concord, CA, USA) as the substrate. Hematoxylin was used to counterstain cell nuclei. Brightfield images (Nikon Eclipse E600 microscope, Nikon, El 38  Segundo, CA, USA) were digitally captured (SpotFlex camera; Diagnostic Instruments, Sterling Heights, MI, USA), with n=3 mouse hearts for each antigen detected.  2.8 MTS Assay  Cell viability was analyzed by using a 3-(4-5-dimethylthiazol-2-yl)-5-(-3-carboxymethoxyphenyl)-2H-tetrazolium salt (MTS) assay kit following the manufacturer’s instructions (Promega). Briefly, HeLa cells were transfected with a plasmid expressing WT, N-terminal or C-terminal DAP5 for 48 h. Cells were then incubated with MTS solution for 2 h. Absorbency of formazan was measured at 492 nm using enzyme-linked immunosorbent assay (ELISA) plate reader. The absorbency of vector-transfected cells was defined as 100% survival (control). The remaining data were converted to percentage of control.  2.9 Viral Plaque Assay  Viral titers were determined as previously described244. Briefly, HeLa cells were seeded into 6-well plates (8 × 105 cells/well) and incubated at 37°C for 20 h to a confluence of approximately 90%, then washed with PBS and overlaid with 500 μl of virus serially diluted in cell-culture medium. Virus was obtained by centrifugation (4000 × g) of freeze-thawed cell suspensions as described above. After a viral-adsorption period of 60 min at 37 °C, the supernatant was removed, the cells overlaid with 2 ml of sterilized soft Bacto-agar-minimal essential medium, cultured at 37 °C for 72 h, fixed with Carnoy’s fixative for 30 min, and stained with 1% crystal violet. The plaques were counted and viral PFU per ml calculated.  2.10 Statistical Analysis Student’s t-test was employed to analyze the data. Results are expressed as means ± standard deviation of three independent experiments. A P value less than 0.05 was considered statistically significant. 39  Chapter 3: Cleavage of DAP5 by CVB3 2A Protease Facilitates Viral Replication and Enhances Apoptosis by Altering Translation of IRES-containing Genes 3.1 Background 3.1.1 CVB3 IRES Mediated Translation Coxsackievirus B3 (CVB3) is a primary cause of viral myocarditis, which can lead to development of dilated cardiomyopathy and heart failure 2. Experimental murine models of myocarditis using CVB3 as an etiological agent have been well-established and widely used. Like other picornaviruses, the CVB3 genome is linked to a small viral peptide, Vpg, rather than a 7-methyl guanosine cap structure at its 5’ terminus. Thus, CVB3 RNA is translated by a cap-independent mechanism and is driven by an internal ribosome entry site (IRES) harbored in the highly structured 5’ untranslated region (5’UTR)110, 245. Translation is a key component of the viral life-cycle and is also the rate-limiting step. Therefore, translation of the viral genome is tightly regulated, requiring viral induced modulation of host-cell canonical translation, as well as utilizing a specific subset of non-canonical host-cell proteins to be effective in facilitating the viral life-cycle.   3.1.2 DAP5 Structure and Function Death-Associated Protein 5 (DAP5) is a eukaryotic translation initiation factor that preferentially initiates cap-independent translation182, 246. This 97 kDa protein is homologous with the central region of canonical translation initiation factor eIF4G. Importantly, the central region of DAP5 contains binding sites for the RNA helicase eIF4A and eIF3, capable of binding RNA and DNA, but lacks eIF4E site, the mRNA cap-40  binding protein 182, 247. The C-terminal domain of DAP5 contains two aromatic and acidic (AA boxes) also known as an eIF5C or W2 binding domain247. The AA box motif of DAP5 and eIF4G binds to mnk-1. In contrast to the analogous domain on eIF4G, the C-terminal AA box motif of DAP5 also binds to eIF2β 176, 247. The C-terminal region of DAP5 also contains a DETD domain, where it is cleaved by caspases at amino acid 792 during apoptosis, generating a truncated, yet functional 86 kDa form of DAP5 that is more potent and efficient at translation initiation 182. The 5’UTR of DAP5 harbors an IRES element and is proficient in promoting its own translation, generating a positive feedback loop for its expression 177, 182. DAP5 is preferentially expressing during IFN-γ induced apoptosis 175. Varieties of cellular stresses inhibit canonical, cap-dependent translation and favor IRES-mediated translation. DAP5 initiates translation of proteins specifically expressed during development, cell cycle regulation and endoplasmic reticulum (ER) stress conditions 177, 248. It has been reported that DAP5 regulates IRES-driven translation of Bcl-2, p53, XIAP, CDK1, c-Myc and other IRES-containing genes under conditions of stress, growth and apoptosis 181, 184, 237.  3.1.3 Viral Proteases Control Cellular Translation  Viral proteases are actively involved in multiple host cell shutoff activities that help the virus evade host defense mechanisms, promote viral replication and host cell apoptosis. For example, enterovirus proteases can cleave eukaryotic translation initiation factors 4GI (eIF4GI) 166, 183, 249 and eIF4GII 167, 250. Picornavirus proteases have also been reported to cleave other canonical translation initiation factors in the cap-dependent translation initiation complex, such as eIF5B 251 and eIF4A 252. Additionally, viral protease 3C has been demonstrated to cleave Ras-GAP SH3 domain binding protein 1 (G3BP1), a key nucleating 41  protein in stress granule formation, at late time points of infection238, 253. G3BP1 cleavage causes stress granule disassembly 238 and leads to the release of translation initiation factors that may be hijacked for viral polyprotein translation. Accumulating evidence implies that viral proteases play crucial roles in modulating viral and host gene expression through cleavage of various host protein factors involved in mRNA transcription and cap-dependent translation. 3.2 Hypothesis and Specific Aims The objective of this chapter is to elucidate the mechanism of DAP5 cleavage and determine how cleavage alters the function and subcellular localization of DAP5 during CVB3 infection. I hypothesized that DAP5 is cleaved by viral protease(s) during CVB3 infection, generating N- and C-terminal fragments with differential functions that promote translation of proapoptotic genes that facilitate viral replication and progeny release.  Specific Aims: 1. To determine the protease responsible for DAP5 cleavage during CVB3 infection 2. To determine the cleavage site of DAP5 during CVB3 infection 3. To explore the subcellular localization of DAP5 cleavage fragments generated during CVB3 infection 4. To study the function of DAP5 cleavage fragments on cellular and CVB3 translation  42  3.3 Results 3.3.1 DAP5 is Cleaved During CVB3 Infection in Tissue Culture Cells and in Mouse Heart During CVB3 infection, we observed the cleavage of DAP5 indicated by an accumulation of a ~45-kDa DAP5-N and a ~52-kDa DAP5-C at 5 hpi in HeLa cells (Fig.7 A-B). This finding suggests that DAP5 is not degraded during CVB3 infection, but cleaved into truncated fragments. However, at later time points of infection, the proform and cleavage products do not equal the total level of DAP5 early in infection, potentially due to altered expression of DAP5. To verify this, q-RT-PCR was performed to determine DAP5 transcription levels. DAP5 transcription was down regulated at 5 and 6 hpi, corresponding to DAP5 cleavage (Fig. 7C). To investigate whether the cleavage of DAP5 also occurs in vivo, a CVB3 infected myocarditis mouse model was employed. Mouse heart tissue was harvested at 3 and 9 days post infection (dpi). Cleavage of DAP5 to 45-kDa DAP5-N and a 52 kDa DAP5-C truncates were observed (Fig. 7D). In contrast to in vitro DAP5 expression, which was reduced during CVB3 infection, DAP5 was upregulated relative to sham-infected control in mouse hearts. This may be due to a lower percentage of CVB3 infected cells in the myocardium than in tissue culture cells. This may also explain the relatively low abundance of DAP5 cleavage products in vivo versus in vitro, as viral infection is required for cleavage. Additionally, we found that at 9 dpi, heart tissue showed massive immune cell infiltration, a hallmark of myocarditis (Fig. 7E). These findings indicate that the cleavage of DAP5 occurs both in vitro and in vivo.  43     Figure 7. DAP5 Is Cleaved into N- and C- terminal Truncated Forms During CVB3 Infection in vitro and in vivo and Is Transcriptionally Downregulated. HeLa cells were infected with CVB3 at 10 MOI and collected at the indicated time points pi. Lysates were analyzed by western blot with the indicated N-terminal (A) and C-terminal (B) 44  DAP5 antibodies.* denotes the cleavage product (cp). The line indicates ~50 kDa. (C) Quantitative PCR of DAP5 mRNA during CVB3 infection. DAP5 mRNA is downregulated at 5 and 7hpi in HeLa cells by approximately 40 % relative to sham infected controls. (D) A/J mice at 4 weeks of age were infected with CVB3 at 105 PFU or sham-infected with PBS as a control. Hearts were collected at 3 and 9 days pi. Harvested heart tissue was lysed and analyzed by western blot using a C-terminal specific antibody against the 52 kDa C-terminal cleavage product. GAPDH was used as a loading control. (E) H and E staining of A/J mice hearts (C) at day 9 pi. Protein levels of pro- and cleaved forms of DAP5 were quantitated by densitometry using the NIH ImageJ software (http://imagej.nih.gov/ij/index.html) and normalized to GAPDH or β-actin. Values are presented under each blot, with sham levels set to 1.00. 3.3.2 Viral Protease 2A but not 3C Is Responsible for DAP5 Cleavage During CVB3 Infection To determine if viral proteases are responsible for cleavage of DAP5, plasmids expressing WT FLAG-tagged DAP5 and protease 2A or 3C via IRES-driven cap-independent translation were co-transfected into HeLa cells, the cleavage was determined by western blot analysis. Our laboratory has previously shown that Caspases are unable to cleave DAP5 into the 45- and 52-kDa fragments 183 and that transient transfection of CVB3 2A or 3C protease-expressing plasmid does not induce cleavage of DAP5. This was likely due to the application of a classical expression plasmid, from which the protease-coding mRNA was transcribed and subsequently translated by a cap-dependent mechanism. Thus, the synthesized protease could cleave eIF4G, as well as other canonical translation initiation factors, which in turn shut off the translation of cap-45  dependent mRNA, including the protease 2A and 3C expressed from the plasmid. Moreover, it is likely DAP5 is less sensitive to 2A (i.e. its protease recognition motif has lower affinity than eIF4G), thus requiring a higher level of protease for detectable cleavage. Therefore, the result of no DAP5 cleavage by viral proteases may be inconclusive. To verify this speculation and to determine the viral protease responsible for cleavage of DAP5, we co-transfected HeLa cells with WT DAP5 and pIRES-2A or pIRES-3C. The 45-kDa DAP5-N products were only observed in the 2A expressing cells, suggesting that viral protease 2A but not 3C is responsible for the cleavage of DAP5 during CVB3 infection (Fig. 8A). To confirm that these plasmids expressed active proteases 2A and 3C, the cleavage of endogenous, known substrates of 2A and 3C were observed by western blot analyses. Figure 8B shows that endogenous DAP5 was cleaved by 2A but not 3C. Other known substrates, eIF5B and eIF4G 168, 251, 254, were cleaved either by 2A or 3C (Fig. 8C-8D). Additionally, the cleavage of eIF4G occurred at 24 h post transfection, compared to 48 h post infection for DAP5, suggesting that DAP5 is less sensitive to 2A cleavage than eIF4G.  46     Figure 8. Viral Protease 2A and Not 3C Cleaves Overexpressed WT FLAG-DAP5 and Endogenous DAP5 Into 45 and 52kDa Truncates Generated During CVB3 Infection. (A) pIRES-2A or 3C plasmid was co-transfected into HeLa cells with WT FLAG-DAP5. As a control, HeLa cells were co-transfected with an empty pIRES vector and WT FLAG-DAP5 or with WT FLAG- DAP5 only. Cell lysates were collected 48 h post transfection and analyzed by western blot using an anti-FLAG antibody. β-actin was used as a loading control. (B) pIRES vector, pIRES-2A or pIRES 3C was transfected into HeLa cells. Lysates were collected and probed by western blot for endogenous C-47  terminal DAP5. As a control (C), western blot was conducted on eIF4G and eIF5B, to verify pIRES-2A and 3C constructs were effective at cleaving their respective substrates.  48   3.3.3 Glycine 434 Is the Site of DAP5 Cleavage by 2A During CVB3 Infection.  According to the molecular mass of the cleavage products DAP5-N and DAP5-C, we proposed that the cleavage site is located upstream of the middle region of DAP5 protein (Fig. 9A). Further, we narrowed down the potential DAP5 cleavage sites by using the reported 2A attack sites as a guide 161. Additionally, a bioinformatic prediction using the NetPicoRNA 1.0 software (http://www.cbs.dtu.dk/services/NetPicoRNA/) (data not shown) was performed. Based on this available information, we proposed that glycine 434 might be the site for DAP5 cleavage. For verification, a point mutation changing glycine 434 to glutamic acid residue (G434E) was constructed by site-directed mutagenesis (Fig. 9B) in the FLAG tagged DAP5 construct, referred to as G434E DAP5. Cells expressing WT DAP5 showed the 45-kDa cleavage product at the 6 hpi, whereas cells expressing G434E-DAP5 remained uncleaved (Fig. 9C).  49   Figure 9. Glycine 434 Is the Site of 2A Cleavage of DAP5 During CVB3 Infection. (A) Schematic structures of eIF4G and DAP5 as well the known binding sites for proteins involved in translation initiation. The red dashed line indicates the proposed 2A cleave site at amino acid residue 434 of DAP5 protein. (B) Sequence structure illustrating the site-directed mutagenesis at glycine 434 of DAP5. (C) HeLa cells were transfected with FLAG-tagged WT DAP5 construct or G434E DAP5 mutant for 48 h and subsequently 50  infected with CVB3 at an MOI of 10 or sham-infected with PBS. Lysates were collected at 6 hpi and analyzed by western blot to detect DAP5 using an anti-FLAG antibody.    3.3.4 DAP5-N Translocates to the Nucleus During Either Ectopic 2A Overexpression or CVB3 Infection. To determine if the sub-cellular localization of the DAP5 cleavage products differs from that of WT DAP5, a FLAG-tagged DAP5-N (from N-terminal to G434) and a HA-tagged DAP5-C (from G434 to the C-terminus) expression plasmids (Fig. 10A) were generated. Following transfection, lystates were subjected to nuclear and cytoplasmic fractionation. Data demonstrated that WT DAP5 (100%) and DAP5-C (87%) remained mainly in the cytoplasm (Fig.10B). However, a significant portion of DAP5-N localized to the nucleus (45%). Immunochemical staining and confocal image analyses were performed on the overexpressed plasmids to verify the differences in sub-cellular localization. The ectopic expression of the cleavage products resulted in nuclear translocation only for DAP5-N (Fig. 10C). Next, we determined whether ectopic expression of viral protease 2A could cause cleavage of DAP5 and subsequent nuclear translocation of the N-terminal portion of DAP5. Figure 10D demonstrates that in WT DAP5/pIRES-2A-transfected cells the N-terminal FLAG tag portion of WT DAP5 translocated to the nucleus, while the C-terminal HA portion remained in the cytoplasm. However, in G434E DAP5/pIRES-2A transfected cells the majority of the DAP5 proteins were distributed in the cytoplasm, showing a similar pattern to that observed in WT DAP5 control cells co-transfected with vector. These data suggest that DAP5 cleavage by ectopically expressed 2A leads to enhanced nuclear translocation of the N-terminal cleavage product. Lastly, the nuclear translocation of N-terminal DAP5 was 51  confirmed during CVB3 infection. WT DAP5-transfected cells translocated to nucleus beginning at 5hpi with nearly full nuclear translocation at 7hpi (Fig. 10E). These results demonstrate that the viral protease 2A cleavage of DAP5 at G434 during CVB3 infection results in a partial nuclear translocation of the N-terminal DAP5.    52  53    Figure 10. DAP5-N Translocates to the Nucleus While G434E DAP5 and DAP5-C Remain in the Cytoplasm. (A) Schematic structures of clones of the DAP5-N and DAP5-C. The FLAG and HA tags as well as the binding sites of interacting proteins involved in translation initiation are indicated. The numbers are the specific amino acids positions for the binding sites. (B) western blot analysis of cellular distribution of WT DAP5, DAP5-N and DAP5-C after transfection. HeLa cells were transfected with WT 54  DAP5 (FLAG), DAP5-N (FLAG) or DAP5-C (HA) for 48 h. Nuclear and cytoplasmic proteins were isolated using NE-PER kit. Histone-1 was used as a nuclear purity control and β-actin was used as a loading control. (C) Confocal imaging of intracellular localization of WT DAP5, DAP5-N and DAP5-C after transfection. HeLa cells were transfected as described in (B). Cells were immunostained with FLAG (WT and DAP5-N) or HA (DAP5-C) antibody and probed with Alexa 488 (green for WT and DAP5-C) or Alexa 594 (red for DAP5-N). DAPI staining was used to image nuclei (blue). (D) Confocal imaging of WT DAP5, FLAG-G434E-DAP5, DAP5-N and DAP5-C in pIRES vector or protease 2A-expressing cells. HeLa cells were co-transfected with a plasmid expressing WT DAP5 containing an N-terminal FLAG tag (lanes 1-2) and a C-terminal HA tag (lanes 5-6) and either pIRES empty vector or 2A-expressing pIRES-2A plasmid. Cells co-transfected with the G434E DAP5 with pIRES empty vector or pIRES 2A (lanes 3-4). Cellular distribution of the cleavage products were detected by immunostaining for FLAG or HA and imaged by confocal microscopy. (E) Confocal imaging of intracellular localization of WT DAP5 (N-terminal FLAG, C-terminal HA tagged) or G434E DAP5 in sham (lanes 1-3) or CVB3-infected cells (lanes 4-9). HeLa cells were transfected for 48h and subsequently infected with 10 MOI CVB3 for 5 or 7hpi or sham-infected with PBS. Cellular distribution of WT DAP5 FLAG or HA and G434E DAP5 were detected by immunostaining for FLAG or HA and imaged by confocal microscopy. 3.3.5 Cleavage of DAP5 by 2A or Ectopic Expression of DAP5-N Enhances VP1 Production While siRNA Knockdown of DAP5 Suppresses VP1 Production. Since DAP5 is an IRES-driven translation initiation factor, we sought to determine the effect of DAP5 cleavage on CVB3 replication. Cleavage percentages for each time point were calculated 55  relative to proform and normalized to β-actin (Fig.11D). The accumulation of the 45 kDa cleavage product in the WT DAP5-transfected samples shows that DAP5 cleavage occurred at 5 and 7 hpi (Fig. 11A). However, in G434E DAP5-transfected samples, only the antibody against endogenous DAP5 detected a cleavage product (Fig. 11A), while the anti-FLAG antibody used to detect G434E-DAP5 remained its 97 kDa (Fig. 11A) form. VP1 production was decreased 4.6-fold (Fig. 11E) relative to that of WT DAP5 overexpressing cells at 7 hpi. The enhancement in VP1 in WT DAP5 relative to G434E DAP5 prompted us to examine the effect of overexpression of DAP5-N and DAP5-C during CVB3 infection. Since DAP5-N retains the eIF3 and eIF4A binding sites, we speculated that DAP5-N may be able to directly participate in translation or enhance translation of CVB3 compared to DAP5-C, which cannot interact with other translation initiation factors. Figure 6B demonstrates that ectopically expressed DAP5-N during CVB3 infection increased VP1 translation 2.5-fold compared to cells overexpressing DAP5-C, which remained equal to vector (Fig. 11F). These data suggest that viral protease 2A cleavage of DAP5 and subsequent generation of the N-terminal truncated form aid in viral replication. Data were further confirmed by knocking down DAP5 with specific siRNA (siDAP5) (Fig. 11C) which indicates that at 5 and 7 hpi, siRNA treatment reduced VP1 production by 3.12- and 3.97-fold, respectively (Fig. 11G). 56   Figure 11. Cleavage of DAP5 During CVB3 Infection Enhances VP1 Production and siRNA Knockdown of DAP5 Suppresses VP1 Production. (A) HeLa cells were transfected with pcDNA3.1 vector, WT DAP5 or G434E DAP5 for 48 h and subsequently infected with 10 MOI CVB3. Lysates were collected at the indicated timepoints and probed by western blot 57  using antibodies against endogenous DAP5, FLAG-DAP5 and VP1. β-actin was used as a loading control (B) HeLa cells were transfected with pcDNA3.1 vector, DAP5-N or DAP5-C and subsequently infected with 10 MOI CVB3. Lysates were collected at the indicated time points and probed by western blot using antibodies against FLAG (DAP5-N), HA (DAP5-C) or VP1. β-Actin was used as a loading control. (C) HeLa cells were transfected with DAP5-specific siRNA (siDAP5) to knockdown DAP5 expression and then infected with CVB3. Cell lysates were harvested at the indicated time points after infection for the analysis of DAP5 cleavage fragment and viral VP1 production. Scrambled small interfering RNA (scr) was used as a control. (D) DAP5 proform protein was quantified by densitometric analysis as described in Figure 7. Sham protein levels were set as 100% and subsequent values were calculated as percentages relative to sham protein levels. (E–G) VP1 protein production in (A–C) was quantified by densitometric analysis using the ImageJ (NIH) program and normalized to the corresponding controls and the data are presented as means±S.D. of three independent experiments in (D–F), respectively. *P<0.05 and **P<0.01.  3.3.6 Cleavage of DAP5 or Ectopic Expression of DAP5-N Enhances Viral Particle Formation While siRNA Knockdown of DAP5 Decreases Viral Particle Formation. Given that WT DAP5 and DAP5-N enhance VP1 production compared to uncleavable G434E and DAP5-C, we sought to determine their effect on viral titer by viral plaque assay, using the supernatant of the cells described in Figure 11. As shown, WT DAP5-transfected cells significantly increase to 106 pfu at 5 hpi and 1.3 x 107 pfu at 7 hpi compared vector at 5.33 x 105 and 2.74 106 pfu or G434E DAP5 at 4.97 x105 pfu and 3.95 x 106 pfu at 5 and 7 hpi, respectively (Fig. 12A and 12B), indicating that cleavage of DAP5 enhances viral replication 58  and progeny release. We then compared the effects of ectopic expression of DAP5-N and DAP5-C on CVB3 titers. DAP5-N significantly enhances viral titer to 6.46 x 105 pfu and 4.90 107 as compared to vector controls at 5 and 7 hpi (Fig. 12A and 12D) (described above). Meanwhile, overexpression of DAP5-C resulted in a significant reduction in virus titer when compared to vector (3.12 x 105) at 5 hpi and was equal to vector levels (2.68 x 106 pfu) at 7hpi (Fig. 12C and 12D). These data indicate a significant role of DAP5-N in viral replication and subsequent release. Furthermore, siRNA knockdown of DAP5 (siDAP5) during CVB3 infection significantly reduced viral particle formation (Fig.12E and 12F) from 1.66 x 106 and 5.33 x 107 pfu in scrambled siRNA transfected (scr) to 1.34 x 105 and 1.28 x 106 pfu in siDAP5-transfected cells at 5 and 7hpi, respectively, indicating a significant role of DAP5 in viral particle formation and release during CVB3 infection.   59   Figure 12. Cleavage of DAP5 During CVB3 Infection Significantly Enhances Viral Titer. (A and B) HeLa cells were transfected with WT DAP5, G434E DAP5 or empty vector for 48 h and subsequently infected with 10 MOI (multiplicity of infection) CVB3. Supernatants were collected at 5 (A) and 7 hpi (B) and used to measure CVB3 particles by plaque assay. (C and 60  D) HeLa cells were transfected with DAP5-N, DAP5-C or empty vector for 48 h and subsequently infected with 10 MOI CVB3. Supernatants were collected at 5 (C) and 7 hpi (D) and used to measure CVB3 particles by plaque assay (E and F) HeLa cells were transfected with siDAP5 and then infected with 10 MOI CVB3. Scrambled small interfering RNA (scr) was used as a control. Supernatants were collected at 5 (E) and 7 hpi (F) and used to measure CVB3 particles by plaque assay. Data are presented as means±S.D. n=3, *P<0.05 or **P<0.01. 3.3.7 DAP5-N and DAP5-C Differentially Regulate Translation of p53 and Bcl-2 and Result in Apoptotic Cell Death. Previous studies have identified a role of DAP5 in the translation of IRES-containing genes Bcl-2 (pro-survival) and p53 (pro-apoptosis), amongst others 181, 237. In order to determine this, overexpression of DAP5 constructs were evaluated by examining overall protein expression of known IRES containing p53 and Bcl-2, as well as phosphorylation of cap-dependent translation initiation factor eIF4E. Our results indicate that overexpression of WT-DAP5 and DAP5-N significantly enhanced translation of pro-apoptotic p53 by 1.91 and 1.73-fold over vector levels, respectively; while DAP5-C overexpression resulted in increased p53 levels, but significantly reduced Bcl-2 translation (up to 50%) compared to vector (Fig.13 A and C). Compared to WT DAP5, DAP5-N and DAP5-C retained similar activity for initiating p53 translation but exhibited much weaker activity for Bcl-2 translation. To study the mechanism(s) by which DAP5 and its cleavage products mediate cap-independent translation, phosphorylated (Ser209) eIF4E and total eIF4E were quantified (Fig.13A and13D). To our surprise, overexpression of WT-DAP5, DAP5-N and DAP5-C significantly reduced eIF4E phosphorylation (7.94-, 8.68- and 10.27-fold relative to vector) compared to the total protein, indicating an inhibitory effect, particularly DAP5-C, on 61  cap-dependent translation. Differential alterations of p53 and Bcl-2 translation by DAP5 truncates contributed to the overall induction of apoptotic cell death as indicated by cleavage of pro-caspase-3, cleavage of the caspase-3 substrate PARP (poly ADP-ribose polymerase) (Fig. 13B and 13E) and a significant reduction in cell survival rate (Fig. 13F) when either was compared to vector or WT DAP5.  62   Figure 13. DAP5-N and DAP5-C Differentially Regulate Translation of p53 and Bcl-2 and Result in Apoptotic Cell Death. HeLa cells were transfected with WT DAP5, DAP5-N, DAP5-C or vector. At 48 h after transfection, cells lysates were prepared for 63  western blot analysis of proteins using the indicated antibodies (A and B). Quantification of western blot signals was conducted by densitometry analysis using the ImageJ program and normalized to β-actin, total eIF4E or proform of the proteins (C–E). (F) Cell viability was analyzed by MTS assay. Cell viability of WT DAP5-transfected cells was defined as 100% (control). Other data are presented as the percentage of the control. *P<0.05 and **P<0.01; n=3.  64  3.3.8 DAP5-N and DAP5-C Differentially Alter Translation but Not Transcription of IRES-containing Genes P53 and BCL-2. To directly demonstrate an effect of DAP5 cleavage products on IRES-driven translation of p53, Bcl2 and CVB3 mRNA, bicistronic luciferase reporters were constructed by insertion of the 5’UTR of these genes or the CVB3 genome between Renilla and firefly reporter genes (Fig. 14A). Compared to the WT DAP5, the DAP5 truncates retained the nearly full capability for initiating IRES-driven translation of proapoptotic p53 but not for prosurvival Bcl-2, where translation was reduced 27% and 14% by DAP5-N and DAP5-C, respectively. Additionally, the expression of both truncates retained (or slightly enhanced by DAP5-C) the capability of initiating CVB3 genome translation (Fig. 14B). These data agree with overexpression of these truncates in Figure 13A. To rule out the possibility that the observed changes in protein levels were due to transcriptional changes, q-RT-PCR was performed to measure Bcl-2 and p53 mRNAs in HeLa cells transfected with vector, WT-DAP5, DAP5-N or DAP5-C. All values were normalized to GAPDH and β-actin, a non-IRES-containing mRNA, was also quantified (Fig.14C). No significant differences in mRNA levels were observed among these groups, indicating that DAP5-N and DAP5-C do not directly affect transcription of p53 or Bcl-2 mRNA. 65   Figure 14. Overexpression of DAP5-N and DAP5-C Alters Translation but Not Transcription of IRES-containing Genes P53 and BCL-2. (A) Schematic structures of luciferase reporters. The 5′-UTR of Bcl-2, p53 or CVB3 genome was inserted into the site between Renilla and firefly luciferase coding regions on C49 plasmid. (B) HeLa cells were co-transfected with the luciferase reporter plasmid and a plasmid expressing WT DAP5, DAP5-N or DAP5-C. At 48 h after transfection, cell lysates were collected for 66  luciferase assay to determine the relative luciferase activity. Results are shown as means±S.D. (N=15). *P<0.05 and **P<0.01. (c) q-RT-PCR to detect mRNA of p53 and Bcl-2. HeLa cells were transfected with empty vector or a plasmid expressing WT DAP5, DAP5-N or DAP5-C. At 48 h after transfection, total RNAs were isolated from the cells and used for q-RT-PCR to measure the mRNAs of IRES-containing genes, p53 and Bcl-2. β-Actin mRNA was used as a control for cap-containing gene. All values were normalized to GAPDH.  3.4 Discussion The characterization of host cellular translation initiation factors altered during viral infection is a key component in understanding viral pathogenesis. Enterovirus proteases, including CVB3 cleave translation initiation factors, 166-168, 183, 249, 250, 255-257 251 leading to the shutoff of cellular translation. DAP5, an eIF4G homolog responsible for cap-independent translation initiation, was found to likely be a cleavage target of CVB3 protease 2A. However, it is possible that expression of protease 2A activates another cellular protease that cleaves DAP5. Recombinant proteins (2A and DAP5) need to be used to verify 2A cleavage. The role of DAP5 in initiation of mRNA translation of IRES-containing genes in cellular stress conditions has been studied in different model systems 177, 182, 184, 185, 258. However, the proteolytic modification of DAP5 by viral proteases and its subsequent functional changes have not been explored in the context of viral pathogenesis. Here, DAP5 was cleaved by CVB3 protease 2A to produce N-terminal ~45-kDa and C-terminal ~52-kDa proteins. By site-directed mutagenesis, FMKSQ↓G434LSQ was identified as the cleavage site of 2A protease, consistent with the cleavage recognition sites reported for other substrates of 2A, where the position P2 contains a T, or S, position P4 is a L, I or M and position P1’ is always a G residue 161, 259. Further evidence comes from the observation 67  that the molecular masses of the N- and C-terminal truncates estimated from electrophoretic mobility are in agreement with those calculated based on the identified cleavage site. Intriguingly, cleavage of DAP5 caused partial nuclear translocation of the N-terminal cleavage product while the C-terminal cleavage product remained primarily in the cytoplasm. Cleavage and the subsequent sub-cellular redistribution of the truncated proteins resulted in altered DAP5 function. DAP5 has been reported to be cleaved by caspase-3 near the C-terminus producing an 86-kDa isoform during cellular apoptosis, and this truncated isoform is more active than full-length DAP5 in promoting IRES-driven translation of mRNAs coding for apoptosis-related genes 182. In this study, CVB3 2A protease cleavage of DAP5 during infection, produced two fragments of DAP5 protein; the 45 kDa DAP5-N remained active in IRES-driven translation initiation, but favored the translation of proapoptotic genes (e.g. p53) and of CVB3, while the 52 kDa DAP5-C appeared to induce an inhibitory effect on global translation and indirectly facilitated IRES-driven translation by de-phosphorylation of eIF4E, the cap-binding translation initiation factor. To verify DAP5-C inhibition of global, cap-dependent translation, additional experiments need to be conducted (i.e. metabolic labeling or polysome analysis). Preferential enhancement of p53 by DAP5-N but not pro-survival Bcl-2 may be attributed to DAP5-N induced caspase activation, limiting the expression of Bcl-2 and thereby inducing apoptosis 260. DAP5-C induced non-specific, cap-independent translation of Bcl-2, p53 and CVB3 likely through competition with eIF4E for mnk1 phosphorylation, thus inhibiting eIF4E from participating in cap-dependent translation initiation 261-263. These changes in function may be explained based upon the structural differences in each DAP5 fragment. DAP5 shares structural homology at the middle region with eIF4GI, termed the MIF4G domain. This 30-kDa MIF4G domain of eIF4GI mediates protein-protein interactions with eIF4A and eIF3 and also exhibits 68  RNA and DNA binding capabilities 264. It has been shown to interact directly with the IRES element of the encephalomyocarditis virus (EMCV) RNA265, 266 and allow eIF4G to recruit the ribosome to the EMCV RNA in a cap-independent manner by interacting with eIF3 and the RNA simultaneously. Since DAP5-N retains the eIF4A and eIF3 binding domains, it is competent for initiation of IRES-driven translation. This result is in line with previous reports on the capability of the C-terminal truncate of eIF4G in driving IRES-containing mRNA translation. This study showed that the primary cleavage of eIF4G by picornavirus proteases generates an 18-kDa N-terminal polypeptide and a large C-terminal fragment. The C-terminal truncate possesses the eIF4A and eIF3 binding domains and is responsible for ribosome binding via eIF3 and, in complex with eIF4A, forms part of the RNA helicase apparatus 267, 268. This is further supported by another in vitro translation study using rabbit reticulocyte lysates 269 and recently, the interaction sites between DAP5, MIF4G and eIF4A have been identified by crystal structural analysis 246, 270. These data suggest that eIF4A and eIF3 binding domains on DAP5-N are critical for cap-independent translation initiation. DAP5-N-mediated translation of IRES-containing genes differs from WT DAP5. DAP5-N initiates translation of IRES-containing genes that are pro-apoptotic, as indicated by our results showing the enhancement of p53 IRES translation, cleavage of pro-caspase-3 and a significant reduction in cell survival rate. Furthermore, DAP5-C likely contributes to the enhancement of cell death by reduction of Bcl-2 and enhancement of IRES-mediated pro-apoptotic gene p53.  The functional change of DAP5-C may also relate to its structural features. It is documented that the C-terminal region of DAP5 also shares structural homology with its counterpart of eIF4G. These homologous regions include MA3 (or mini-protein) domain and Mnk1 binding motif. However, the MA3 domain of DAP5 does not support eIF4A binding 271, 69  leaving DAP5 with a single eIF4A interaction domain on the DAP5-N cleavage product, compared to two eIF4A binding domains on protease 2A cleaved eIF4G 272. CVB3 and all type I viral IRES translation requires cleaved eIF4G (or DAP5) and eIF4A 272 as eIF4G (and DAP5) bring eIF4A into the translation initiation complex. The 2:1 eIF4A binding site ratio allow eIF4G a stoichiometric advantage 273, (i.e. higher avidity) along with high affinity preferential cleavage of eIF4G early on during infection 274 may explain the relatively low changes in VP1 expression when DAP5-C is overexpressed. Although DAP5-C induces dephosphorylation of eIF4E, its effect on enhancement of viral translation may be modest, given that eIF4E is downregulated by miRNA-141 during enteroviral infection 275 and eIF4E dephosphorylation occurs early on during infection 262. However, the generation of DAP5-C, along with 4EBP1 276, may partially explain the dephosphorylation of eIF4E during the later phase infection, where DAP5-C competes with eIF4E for mnk1 phosphorylation. In addition, the C-terminal regions of both DAP5 and eIF4G contain two aromatic and acidic boxes (AA boxes), also known as eIF5C or W2 domain 277, 278. Notably, both eIF4G and DAP5 bind to Mnk1, a kinase to phosphorylate cap-binding protein eIF4E, using the AA-box motif, when eIF4E is in the pre-translation initiation complex 263. In contrast, DAP5, but not eIF4G, binds to eIF2β through the AA box motif 176, 179. Therefore, DAP5-C is incapable of direct interaction with IRES mRNA due to the lack of eIF4A binding domain essential for joining the initiation complex, however likely indirectly enhances IRES-driven translation by competing with eIF4E for mnk1 phoshorylation. Thus, DAP5-C may have dominant negative effect on cap-dependent and indirectly enhance cap-independent translation.  Cleavage of translation initiation factors, such as DAP5, alters the cellular environment in a way that is advantageous for viral replication. This occurs in vitro and in vivo as demonstrated here. siRNA knockdown of DAP5 during CVB3 infection resulted in significant reductions in 70  VP1 levels and viral titer. In support, overexpression of DAP5-N resulted in higher levels of both VP1 and virus released, even when compared to WT DAP5. Intriguingly, upon cleavage, DAP5-N is still functional and plays a role in differentially regulating gene expression at the level of translation. In addition, DAP5-N is also capable of nuclear translocation upon cleavage during late time points of CVB3 infection. Bioinformatics suggest DAP5-N may have a NLS, facilitating its entry into the nucleus. What the functional role is after DAP5-N translocates to nucleus needs to be elucidated. DAP5 was previously reported to undergo nuclear translocation during ATRA induced terminal differentiation in APL cells, resulting in the inhibition of PI3K/Akt pro-survival pathway279. PI3K/AKT pathway suppression via dephosphorylation of AKT 280 occurs concurrently with DAP5 nuclear translocation (6 hpi) during CVB3 infection, corresponding with the induction of apoptosis. This result is similar to our finding showing the induction of apoptosis, which is evidenced by the activation of pro-caspase-3 and reduction of cell survival rate following the cleavage and subsequent nuclear translocation of the DAP5-N truncate. Future studies may identify the function of DAP5-N in the nucleus as well as exploring the effect of DAP5 cleavage on immune cell infiltration and viral pathogenesis using a genetically modified mouse models.  Taken together, this study has revealed for the first time that DAP5 is cleaved by CVB3 2A protease during infection resulting in altered sub-cellular redistribution and activity. The 2A-generated DAP5 cleavage products differentially regulate IRES-containing genes, promoting the translation of pro-apoptotic genes as well as viral genome, leading to enhanced viral replication and cell apoptosis.   71  Chapter 4: Cleavage and Subcellular Redistribution of Nuclear Pore Protein 98 by Coxsackievirus B3 Protease 2A Modulates Cardioprotective Gene Expression 4.1 Background 4.1.1 The Nuclear Pore Complex in Disease Pathogenesis The nuclear pore complex (NPC) is 125 MDa complex made up of ~30  proteins, spanning the double membrane of the nuclear envelope 205, 281. In the 1960’s, transmission electron microscopy (TEM) studies revealed that nuclear pores have 8-fold radial symmetry in the plane of the nuclear envelope, but are asymmetric relative to the nuclear envelope (NE) 195. Late in the 1990’s, using scanning electron microscopy (SEM), it was revealed that the cytoplasmic side of the NPC contains filamentous structures which project outward, in contrast to the nuclear side where filamentous structures coalesce into a basket-like structure containing the transporter region 282. Traditionally, nuclear pore proteins were thought to be mere gatekeepers of the nucleus, regulating the translocation of proteins in and RNA out of the nucleus in response to cell signals. For example, in response to viral infection, interferon stimulated signaling to the nuclear pore complex allows the transport of anti-viral gene RNAs across the nuclear pore complex for translation in the cytoplasm. While the gatekeeper function of nuclear pore proteins has been well described, in recent years, multiple, dynamic localizations and functions have emerged, in particular for Nup98. In contrast to other Nups, which are found exclusively around the nuclear periphery, Nup98 was detected not only at the nuclear periphery, but diffused throughout the nuclear interior and in discrete nuclear structures 283. Recently, functionality has been ascribed to the perceived localization of 72  Nup98, such as transcriptional activation or repression. Nup98 is capable of migrating from the nuclear periphery to interact directly with chromatin or as a direct transcription factor. This has been demonstrated during human development and in various pathological conditions (i.e. cancer, viral infections). Many of the transcriptional activities of Nup98 are immune-responsive. For example, in response to interferon-γ (IFN-γ), a critical cytokine involved in the innate and adaptive immune response to pathogens, including CVB3. Nup98 further facilitates transcriptional memory, interacting with RNA polymerase II and H3Kme2 to promote the transcription of IFN-γ inducible genes, such as antigen presenting MHC I, over four generations of cells after IFN-γ stimulus has been removed 207. Furthermore, Nup98 interacts with transcription factor FoxK to promote antiviral gene expression in response to a host of viral infections 284.  4.1.2 Nup98 in Viral Pathogenesis A major challenge during, and key component of, the viral lifecycle is the reliance on host cellular machinery for viral protein translation and RNA replication 164. CVB3 translation occurs via IRES-mediated translation and therefore bypasses the use of some host canonical translation initiation factors. Instead, it utilizes IRES transacting factors (ITAFs), many of which typically reside in the nucleus, to complete its lifecycle 114, 285, 286. Therefore, the virus must overcome protein localization maintained by nuclear pore proteins (Nups) to make available nuclear resident proteins that facilitate the viral life cycle in the cytoplasm. Cleavage of Nups by 2A during poliovirus infection has been demonstrated to induce Nup relocalization and block RNA export during infection 197 203 287, and similar mechanisms have been described for other positive single stranded RNA (ssRNA) viruses  288 289, and for the negative ssRNA virus, influenza 290. Viruses have 73  also been shown, however, to induce anti-viral gene expression through the transcriptional activity of Nup98 80, 284. Given these data, Nup98 is likely a target of CVB3 proteases, as blocking its function would sequester the necessary ITAFs in the cytoplasm and prevent egress of the antiviral and cardioprotective mRNAs.  4.1.3 Nup98-Nrg-1-erbB4 Signaling Axis During human heart development, Nup98 has been shown to be a transcription factor for neuregulin-1 (NRG-1) 205, a protein currently undergoing clinical trials for treatment of the failing heart in both acute and chronic cardiovascular diseases 230, 291. NRG-1 and its receptor, erbB4, are discussed in Chapter 1, and have been shown to have significant implications on cardiac function185, 210, 219-221, 224-227, 232, 234, 292. Given the data to date, NRG-1 and erbB4 may be of critical importance to the recovery from acute and chronic CVB3 induced myocarditis. Indeed, NRG-1 and erbB4 dysfunction have been described as key contributors in the pathogenesis of cancer, cardiovascular disease, and neurological disorders 211, 293, 294.  4.2 Rationale Nup98 is an integral member of the nuclear pore complex shown to be a target for cleavage by other picornaviruses, shown to mediate IFN-γ antiviral activity, and shown to act as a transcription factor for immune responsive and cardioprotective genes. Therefore, I aimed to determine the role of Nup98 during CVB3 infection and of viral myocarditis.  74  4.3 Hypothesis and Specific Aims Nup98 is targeted by viral proteases during infection, inhibiting its ability to transcribe antiviral and cardioprotective genes, and potentiating viral replication, presumably through cytoplasmic relocalization of ITAFs.   Specific Aims: 1. To determine if Nup98 is cleaved and relocalized during CVB3 infection. 2. To determine the protease responsible for Nup98 cleavage during CVB3 infection.  3. To determine the effect of Nup98 cleavage during CVB3 infection on viral replication and cardioprotective gene expression. 4. To examine the role of the Nup98-Nrg-1-erbB4 signaling axis during CVB3 infection.  4.4 Results 4.4.1 Nup98 Is Cleaved During CVB3 Infection.  During CVB3 infection, Nup98 is cleaved at 3 hpi from its 98 kDa proform to a ~55kDa form. A secondary cleavage of Nup98 to a ~45kDa form was observed at 4 hpi and increased in abundance throughout the duration of infection (7 h) (Figure 15A). 4.4.2 CVB3 Protease 2A Is Responsible for the Cleavage of Nup98 During CVB3 Infection. HeLa cell lysates were incubated for 16 h with viral protease 2A. As a control, recombinant 2A with the catalytic site mutated (2Amut) was also incubated with HeLa cells lysates. CVB3 infected cell lysates collected at 7 hpi were used as a positive control. 75  Data are shown in Figure 15B. I observed the same ~45kDa cleavage product in the recombinant 2A protease treated samples as observed during CVB3 infection. Therefore, I conclude that viral protease 2A is responsible for the observed cleavage of Nup98 during CVB3 infection. Similar experiments using instead viral protease 3C demonstrate that 3C does not cleave Nup98.   76   Figure 15. Nup98 Is Cleaved by Viral Protease 2A During CVB3 Infection. (A) HeLa cells were infected with sham (PBS) or CVB3 and probed by western Blot for Nup98. VP-1 is a viral capsid-protein used to represent viral replication and β-actin was used as a loading control. (B) Non-infected HeLa cells lysates were incubated over night with recombinant viral protease 2A, 3C, 2Amut or 3Cmut (mutants have mutated, inactive catalytic sites). Lysates were subsequently probed by western blot for Nup98 to determine the protease responsible for cleavage. CVB3 infected lysate harvested at 7hpi was used as a control.    77  4.4.3 CVB3 Infection Induces the Redistribution of Nup98 to Cytoplasmic Punctate Structures.  To examine whether CVB3 induces the redistribution of Nup98 during infection, confocal microscopy was employed to observe the sub-cellular distribution of Nup98. HL-1 cardiomyocytes were infected with CVB3 at 10 MOI and fixed at 2, 4 and 6 hpi. Cells were probed with Nup98 antibody, followed by Alexa 488 secondary antibody for confocal imaging. As shown in Figure 16, at 4 hpi, Nup98 has migrated from the nuclear periphery into the nucleoplasm, and there is increased signal likely due to cellular upregulation of Nup98 in response to CVB3 infection. At 6 hpi, Nup98 was observed in punctate structures mostly in the cytoplasm. 78   Figure 16. CVB3 Infection Induces the Subcellular Redistribution of Nup98 in Cardiomyocytes. HL-1 cardiomyocytes were sham infected (PBS) or infected with CVB3 for the above-indicated time-points. Cells were fixed and nuclei were stained with DAPI (blue) or probed by Nup98 and Alexa 488 secondary antibody (green). Cells were observed at each time-point by confocal microscopy.   79  4.4.4 Ectopic Expression of Viral Protease 2A Induces the Subcellular Redistribution of Nup98 to Punctate Cytoplasmic Structures.  To determine if viral protease 2A alone could induce the sub-cellular redistribution of Nup98 observed during CVB3 infection (Figure 16), HeLa cells were transfected with a plasmid containing the 2A gene (pIRES-2A), 3C gene (pIRES-3C) or empty vector (pIRES) for 48 h and subsequently fixed for confocal microscopy. As demonstrated in Figure 17, expression of protease 2A without virus induces the same sub-cellular redistribution of Nup98 as seen in viral infection, whereas empty vector does not. Intriguingly, ectopic expression of viral protease 3C in the absence of viral infection appears to induce the upregulation and redistribution of Nup98 to the nucleoplasm (see discussion).  80   Figure 17. Ectopic Expression of Viral Protease 2A Results in the Subcellular Redistribution of Nup98. HeLa cells were transfected with empty vector, viral protease 2A or 3C for 24h. Cells were fixed and probed for Nup98. Nuclei were stained with DAPI (blue) and probed with Alexa 488 (green) representing Nup98. Cells were visualized by confocal microscopy.  4.4.5 siRNA Knockdown of Nup98 Differentially Regulates Cardioprotective and Viral Gene Expression.  To examine the impact of Nup98 knockdown during CVB3 infection on the expression of NRG1 and viral capsid protein VP1 (a measure of viral protein synthesis), siRNA 81  targeting Nup98 or scrambled siRNA were transfected into HeLa cells 48 h prior to infection. Lysates were collected from sham infected (PBS treated) and virus infected cells at 3, 5, and 7 hpi. Western blot confirmed knockdown of Nup98. Relative to sham infected cells with scrambled siRNA, NRG1 in sham infected cells with siNup98 were ~40-fold lower. Again compared to sham infected cells with scrambled siRNA, NRG1 levels during viral infection were ~30-fold lower in both scrambled siRNA and siNup98 transfected cells at all timepoints during infection. Levels of ERBB4 protein were comparable between scrambled siRNA and siNup98 in sham and viral infected cells across all time points, with a slight increase in ERBB4 levels at 3 and 5 hpi compared to sham levels. Knockdown of Nup98 at 5 hpi caused a ~4-fold decrease in VP1 expression. At 7 hpi, scrambled and siNup98 VP1 levels were comparable.    82  Figure 18. siRNA Knockdown of Nup98 Differentially Regulates NRG-1 and VP-1 Expression. (A) HeLa cells were transfected with scrambled or Nup98 siRNA for 48h. Cells were subsequently infected with sham (PBS) or CVB3 and harvested at the indicated time-points. Lysates were probed by western blot for Nup98, erbB4, NRG-1 and VP-1. β-actin was used as a loading control. (B) Densitometry analysis was performed on the western blot images (n=3) for NRG-1, VP-1 and erbB4 and displayed graphically. NRG-1, VP1 and erbB4 protein expression (A) were quantified by densitometric analysis (B) using the ImageJ (NIH) program and normalized to the corresponding controls and the data are presented as means±S.D. of three independent experiments in (D–F), respectively. *P<0.05 and **P<0.01 (see Chapter 2: Materials and Methods sections 2.4 and 2.10).   4.4.6 siRNA Knockdown of Nup98 During CVB3 Infection Enhances Viral Titer During Early Infection Time Points.  Supernatants from CVB3 infected HeLa cells treated with scrambled siRNA or siNup98 (4.4.5, Figure 18) were collected at the 5 and 7 hpi (n=3 each), the two timepoints at which VP1 expression was detectable. A plaque assay (see Materials and Methods) was performed to determine viral titer at each time point for each condition. At 5 hpi, siNup98 treated cells had ~20-fold higher virus titer than scrambled siRNA controls. At 7 hpi, there was no statistical difference between the two groups.  83   Figure 19. siRNA Knockdown of Nup98 Enhances Viral Titer 20-fold. HeLa cells were transfected with scrambled or Nup98 siRNA for 48h. Cells were subsequently infected with sham (PBS) or CVB3 for 5 or 7 h. Supernatants were collected and serial diluted to known concentrations. Supernatants were used to subsequently infect HeLa cells and overlaid with agar for 72h. Cells were stained with crystal violet and viral plaques were quantified (n=3).  4.4.7 Nup98, NRG1 and erbB4 are Upregulated in CVB3 Infected Mouse Myocardium.  Four week old male A/J mice were infected with 105 PFU CVB3 or sham infected (PBS). Hearts were harvested at 4, 9 and 30 dpi, corresponding to previously defined timepoints of acute viral infection and recovery295. Tissue was lysed for western blot, or formalin fixed and paraffin embedded and stained by immunohistochemistry. Nup98, NRG1 and erbB4 were all upregulated (Figure 20) during the acute infection phase (7 and 9 dpi). 84  NRG1 and erbB4 levels were restored to baseline following heart recovery from acute infection (30 dpi), while Nup98 levels remained upregulated relative to sham infected hearts (Figure 20C), indicating activation of the Nup98-erbB4-Nrg-1 signaling axis during acute viral myocarditis in vivo.      85   Figure 20. Nup98, NRG-1 and erbB4 are Upregulated in CVB3 Infected Mouse Hearts. 4 week-old A/J mice were infected with sham (PBS) or CVB3 at 105 PFU. Mouse heart tissue was harvested at 7 and 30 days post infection. (A) Tissue was lysed and used for western blot. (B-D) Densitometry was performed on western blot signaling (n=3) using the ImageJ (NIH) program and normalized to the corresponding controls and the data are presented as means±S.D. of three independent experiments in , respectively. *P<0.05 and **P<0.01 (see 86  Chapter 2: Materials and Methods sections 2.4 and 2.10). (E) Tissue was fixed in formalin and paraffin embedded. Immunohistochemistry was performed using Nup98, NRG-1 or erbB4 antibody. Red staining indicates the protein of interest. Hematoxylin was used as a nuclear counterstain for Nrg-1 and erbB4 staining. The images were taken at 40x magnification. Images shown are representative (n=3).  4.5 Discussion The nuclear pore complex, a megamolecular structure at the nuclear envelope, facilitates the transport of macromolecules between the nucleus and cytoplasm. It provides a physical barrier through which transcription in the nucleus and translation in the cytoplasm are separated. Disruption of the NPC during viral infections has been previously described, occurring through proteolytic cleavage of Nups, disrupting the balance of molecules (i.e. RNA and protein) available between the nucleus and cytoplasm. This disruption benefits the virus by making nuclear resident ITAFs remain in the cytoplasm where they are available for viral translation and inhibiting the passage of cellular RNA into the cytoplasm for translation. I found that Nup98, a dynamic, mobile, multi-functional nuclear pore protein, is cleaved by viral protease 2A, and not 3C, during CVB3 infection, causing relocalization of Nup98 from the nuclear envelope to the cytoplasm. Knockdown of Nup98 by siRNA decreases expression of cardioprotective gene NRG1, but not its receptor erbB4, and increases viral protein production and viral titer at 5 hpi.  In an in vivo murine model of myocarditis, Nup98, NRG-1, and erbB4 are all upregulated in the myocardium during acute CVB3. Although siNup98 increased viral gene expression and titer at 5 hpi, by 7 hpi there was no effect. That said, the levels of expression and the viral titers at 7 hpi were much higher 87  than at 5 hpi. This is particularly striking in light of Nup98 already showing dramatic cleavage by 5 hpi. This may reflect Nup98 transcription of antiviral genes, which, when Nup98 is expressed, limit viral replication. Knockdown of Nup98 during infection likely allows the virus to be more productive at early timepoints during infection as it no longer has to first over come antiviral activity generated by Nup98 transcription.  Interestingly, expression of viral protease 3C induced upregulation of Nup98 and redistribution of Nup98 to the nucleoplasm, despite no apparent protease effect of 3C on Nup98. The likely mechanisms for this could be that 3C cleavage of its substrates induces antiviral signaling within the cell. As such, Nup98 is upregulated and migrates to the nucleoplasm, where it acts as a transcription factor for antiviral and cardioprotective genes in the absence of cleavage by viral protease 2A. This would imply that ectopic expression of protease 3C is capable of activating cellular antiviral/cardioprotective responses via Nup98 regulatory pathways.   The in vivo data demonstrate that Nup98 is upregulated during acute viral infection, as would be expected from other available data; of note, the cleavage state of that upregulated protein is not known at this time. The downstream target NRG1 is also upregulated, again as would be expected. Unexpectedly, erbB4 is also upregulated. This may be due to changes in the expression of its ligand NRG1, which may also indirectly induce the upregulation of erbB4, via an alternative transcription factor.     88  Chapter 5: Concluding Remarks  5.1 Conclusions  In this dissertation, I found that CVB3 viral protease 2A cleaves cellular translation initiation factor DAP5 and immune responsive transcription factor and nuclear pore protein Nup98. DAP5 cleavage promotes the virus-induced shift from canonical to IRES mediated translation. Nup98 cleavage causes redistribution of the protein within the cell and may promote viral replication, presumably through cytoplasmic sequestration of normally nuclear resident proteins. In the surrounding non-infected myocytes, Nup98 expression is enhanced by the viral induced immune mediated response resulting in upregulation of cardioprotective and antiviral genes, presumably both through transcriptional activation and of mRNA efflux.  Viral proteases alter the host cellular environment in order evade host anti-viral responses and facilitate the viral lifecycle at every phase. The findings of this dissertation provide examples of how viral protease 2A cleaves IRES specific translation initiation factor DAP5 during the later phases of infection. This cleavage results in two functionally distinct cleavage fragments which enhance cellular apoptosis by promoting the translation (DAP5-N) of pro-apoptotic genes (p53) or through competition with canonical translation initiation factors involved in cap-dependent translation (eIF4E), thereby indirectly promoting viral translation (DAP5-C). In addition, overexpression of the DAP5 cleavage fragments leads to cellular apoptosis through the promotion of Caspase-3 cleavage, thereby promoting viral egress and promoting the viral lifecycle. Therefore, cleavage of DAP5 and the product of DAP5 cleavage fragments increase damage to the 89  host, by enhancing viral replication and viral titer. This allows for the virus to be more productive and in turn infect more cells in the surrounding myocardium, leading to enhanced viral insult.  Furthermore, viral proteases were demonstrated to cleave nuclear pore protein Nup98. This cleavage resulted in the relocalization of Nup98 from the nuclear periphery and within the nuclear envelope to the cytoplasm in vitro. The cleavage or siRNA knockdown of Nup98 resulted in increased viral replication (VP1) and viral progeny release (plaque assay), indicating an antiviral role for Nup98 prior to proteolytic cleavage. Recent studies conducted in Drosophila have reported that Nup98 is induced in response to a panel of RNA viral infection and controls the transcription of antiviral genes284, 296.   In addition, it was demonstrated that Nup98 enhanced the transcription and expression of cardioprotective NRG-1, and this transcriptional enhancement was attenuated with viral protease cleavage of siRNA knockdown of Nup98. Moreover, in vivo mouse models of CVB3 induced myocarditis revealed that the Nup98-Nrg-1-erbB4 signaling axis was upregulated during acute infection. This upregulation likely plays a protective role in the surrounding non-infected cardiomyocytes, whereby Nup98 is upregulated in response to interferon signaling, which in turn upregulates antiviral genes and cardioprotective Nrg-1 and erbB4 (through an undetermined mechanism) which protect the heart from further viral insult and aid in the recovery from viral induced damage.  Based upon the results presented in this dissertation, I conclude that viral protease 2A cleavage of translation initiation factor DAP5 and nuclear pore/immune-responsive transcription factor Nup98 contribute significantly to exacerbate pathogenesis of CVB3 induced myocarditis.  90  5.2 Limitations As with most studies, these studies also have some experimental and scientific limitations. In some of the western blots which demonstrated viral protease cleavage (i.e. Figure 7A), loading controls were not added. This likely has no impact on the findings or interpretation of the data, as several previous studies demonstrating proteolytic cleavage do not include loading controls251, 297.  The MTS cell viability assay (see Figure 13F) may not have directly measured cellular apoptosis. The assay is inherently limited in that it measures mitochondrial integrity by assessing the conversion of MTS to formazan. Cells may have lost mitochondrial integrity, but still retain viability. Furthermore, cell number was only taken into account pre-transfection. It is possible that the expression of DAP5 or its fragments could result in the inhibition of focal adhesion kinase (FAK) (or a similar factor), resulting in cellular detachment and falsely be counted as being apoptotic (i.e. less cells, less signal). Additionally, non-viable cells were assumed to be apoptotic; however, this does not take into account cell death as a result of other mechanisms (i.e. necrosis, necroptosis). That being said, this is a common assay for measuring cell viability, regardless of the aforementioned limitations. The use of bicistronic luciferase reporters in determining IRES activity may also have limitations if proper controls are not used.  For example, cryptic splicing and cryptic promoters may exist, generating a monocistronic reporter or a spliced version of the mRNA, resulting in translation not through an IRES-mediated mechanism, but through a different mechanism such as ribosomal scanning. This would result in a false positive IRES signal. In order to avoid such false signal reporting, Northern blot analysis of mRNA, RT-PCR or siRNA targeting the first cistron could be employed to ensure IRES RNA is intact in the reporter 91  system. In this study, these controls were not implemented. However, the reporter constructs used have been used in previous publications and documented as true IRES structures181, 237. Lastly, the 2A expressing plasmid used to determine cleavage of DAP5 may not have indicted direct cleavage by 2A. It is possible (however not likely) that expression of 2A activated another cellular protease, which cleaved DAP5. To confirm that 2A is directly cleaving DAP5, recombinant protease and recombinant DAP5 protein should be assayed to determine if the same cleave fragments are produced. Even allowing for these limitations, the significance of this work is evident and remains.   5.3 Future Perspectives At the present, significant gaps in our scientific knowledge and ability to diagnose and treat patients with viral induced, post-viral autoimmune and autoimmune myocarditis exist. Using current histological methodologies, etiologies of viral-induced and lymphocytic autoimmune myocarditis are indistinguishable. Techniques such as in situ hybridization and PCR may suggest viral etiology; however negative results cannot exclude the possibility of viral origin. In addition, these techniques may not be sensitive to the numerous viruses (and those still being discovered) which are may cause myocarditis. Additionally, a positive result for a virus doesn’t necessarily exclude the possibility of an autoimmune component in the pathogenesis of the disease (i.e. viral unmasking of an immune reactive autoantigen). Due to the exorbitant amount of viruses implicated in the pathogenesis of myocarditis coupled with a high mutation rate, a vaccine is likely not a viable therapeutic option. The findings of this research may 92  contribute to the development of a diagnostic adjuvant (i.e. biomarkers) as well as the discovery of novel therapeutic targets.  The identification of the 2A cleavage site of DAP5 may provide an avenue of future study whereby mice express tissue-specific uncleavable DAP5. Assuming this uncleavable form also causes attenuated CVB3 replication, this would suggest inhibition of viral proteases and stabilization of DAP5 both as potential therapeutic avenues in CVB3 induced myocarditis. Additionally, these data support the idea of inhibiting IRES mediated translation as a therapeutic strategy. Regardless of whether the uncleavable form inhibits the viral lifecycle, the upregulation of DAP5 found during CVB3 infection could potentially be used as an adjuvant diagnostic in myocarditis, either in tissue biopsies, e.g. by immunohistochemistry, or in blood, e.g. by immunoassay.  Identifying Nup98 as a target of CVB protease 2A opens a number of future avenues of research. First off, many of the preliminary findings in the work presented here need to be fleshed out, most notably confirming that Nup98 cleavage is the step required to alter Nup98 function. This confirmation would again propose viral protease inhibition and host protein stabilization as therapeutic strategies. Furthermore, the observed downstream effects on NRG1 and erbB4, combined with existing data regarding therapeutic use of these proteins 224, 285, suggest exogenous application or induction of expression of these molecules as further therapeutic modalities. The murine finding of upregulation of Nup98, NRG1, and erbB4 during CVB3 infection is currently being confirmed in human heart tissue with pathologically verified idiopathic myocarditis (i.e. post-viral autoimmune or autoimmune). I further confirmed the findings of the murine model of upregulation of NRG1 and erbB4 related to normal human hearts in 25 cases of human 93  myocarditis from the cardiovascular registry at St. Paul’s Hospital. Currently, Nup98 expression is also being evaluated by our lab. In the future, a larger cohort of idiopathic human myocarditic hearts will need to be evaluated to validate these findings. If these findings are validated, they become candidate adjuvants for the diagnosis of viral myocarditis, providing a new tool to be used by clinicians. Intriguingly, the pattern of upregulation occurs in regions of the myocardium with and without inflammation. Therefore, upregulation of these proteins in biopsies could be indicative of myocarditis in the absence of inflammation. At the present, only approximately 30% of EMB positively detect myocarditis in patients later found to be positive for myocardial inflammation. If verified, upregulation of Nup98-Nrg-1-erbB4 could substantial increase the amount of accurate myocarditic diagnoses, which in turn may significantly improve therapy and prognosis. In addition, it’s possible that one or more of these molecules may become an ideal biomarker for viral and/or autoimmune mediated myocarditis. As such, erbB4 is an attractive candidate in that it may be cleaved298 and potentially solubilzed, allowing its cleavage product to be detected as an indication of myocarditic insult. The increased understanding of the role of protease 2A on the viral lifecycle, particularly through DAP5 and Nup98, gained in these studies also suggests further avenues of basic science research, such as better understanding of the processes essential to IRES mediated viral translation, a complete understanding of the redistribution of cellular proteins during viral replication, more insight into modifications to nuclear transport during CVB3 infection, and better understanding of changes to gene translation on a global scale during CVB3 infection. Taken together, each of these avenues of study are likely to further identify potential diagnostic and therapeutic targets. 94  Bibliography 1. Hanson PJ, Zhang HFM, Hemida MG, Ye X, Qiu Y, Yang DC. IRES-dependent translational control during virus-induced endoplasnnic reticulum stress and apoptosis. Front Microbiol 2012; 3.  2. Feldman AM, McNamara D. Myocarditis. The New England journal of medicine 2000 Nov 9; 343(19): 1388-1398.  3. Smith SC, Ladenson JH, Mason JW, Jaffe AS. Elevations of cardiac troponin I associated with myocarditis. Experimental and clinical correlates. Circulation 1997 Jan 7; 95(1): 163-168.  4. Franz WM, Remppis A, Kandolf R, Kubler W, Katus HA. Serum troponin T: diagnostic marker for acute myocarditis. Clin Chem 1996 Feb; 42(2): 340-341.  5. Saphir O. Myocarditis - A general review, with an analysis of two hundred and forty cases. Arch Pathol 1942 Jan; 33(1): 88-137.  6. Sakakibara S, Konno S. Endomyocardial biopsy. Japanese heart journal 1962 Nov; 3: 537-543.  7. Aretz HT. Myocarditis: the Dallas criteria. Human pathology 1987 Jun; 18(6): 619-624.  8. Aretz HT, Billingham ME, Edwards WD, Factor SM, Fallon JT, Fenoglio JJ, Jr., et al. Myocarditis. A histopathologic definition and classification. Am J Cardiovasc Pathol 1987 Jan; 1(1): 3-14.  9. Chow LH, Radio SJ, Sears TD, McManus BM. Insensitivity of right ventricular endomyocardial biopsy in the diagnosis of myocarditis. Journal of the American College of Cardiology 1989 Oct; 14(4): 915-920.  10. Hauck AJ, Kearney DL, Edwards WD. Evaluation of postmortem endomyocardial biopsy specimens from 38 patients with lymphocytic myocarditis: implications for role of sampling error. Mayo Clinic proceedings 1989 Oct; 64(10): 1235-1245.  11. Mahfoud F, Gartner B, Kindermann M, Ukena C, Gadomski K, Klingel K, et al. Virus serology in patients with suspected myocarditis: utility or futility? European heart journal 2011 Apr; 32(7): 897-903.  12. Tracy S, Chapman NM, McManus BM, Pallansch MA, Beck MA, Carstens J. A molecular and serologic evaluation of enteroviral involvement in human myocarditis. Journal of molecular and cellular cardiology 1990 Apr; 22(4): 403-414.  95  13. Vikerfors T, Stjerna A, Olcen P, Malmcrona R, Magnius L. Acute myocarditis. Serologic diagnosis, clinical findings and follow-up. Acta Med Scand 1988; 223(1): 45-52.  14. Kindermann I, Barth C, Mahfoud F, Ukena C, Lenski M, Yilmaz A, et al. Update on myocarditis. Journal of the American College of Cardiology 2012 Feb 28; 59(9): 779-792.  15. Santangeli P, Hamilton-Craig C, Dello Russo A, Pieroni M, Casella M, Pelargonio G, et al. Imaging of scar in patients with ventricular arrhythmias of right ventricular origin: cardiac magnetic resonance versus electroanatomic mapping. Journal of cardiovascular electrophysiology 2011 Dec; 22(12): 1359-1366.  16. Asimaki A, Tandri H, Huang H, Halushka MK, Gautam S, Basso C, et al. A new diagnostic test for arrhythmogenic right ventricular cardiomyopathy. The New England journal of medicine 2009 Mar 12; 360(11): 1075-1084.  17. Noorman M, Hakim S, Asimaki A, Vreeker A, van Rijen HV, van der Heyden MA, et al. Reduced plakoglobin immunoreactivity in arrhythmogenic cardiomyopathy: methodological considerations. Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology 2013 Sep-Oct; 22(5): 314-318.  18. Kashuba E, Pokrovskaja K, Klein G, Szekely L. Epstein-Barr virus-encoded nuclear protein EBNA-3 interacts with the epsilon-subunit of the T-complex protein 1 chaperonin complex. J Hum Virol 1999 Jan-Feb; 2(1): 33-37.  19. Baughman KL. Diagnosis of myocarditis: death of Dallas criteria. Circulation 2006 Jan 31; 113(4): 593-595.  20. Pollack A, Kontorovich AR, Fuster V, Dec GW. Viral myocarditis-diagnosis, treatment options, and current controversies. Nature reviews Cardiology 2015 Jul 21.  21. Guglin M, Nallamshetty L. Myocarditis: diagnosis and treatment. Curr Treat Options Cardiovasc Med 2012 Dec; 14(6): 637-651.  22. Gupta S, Markham DW, Drazner MH, Mammen PP. Fulminant myocarditis. Nature clinical practice Cardiovascular medicine 2008 Nov; 5(11): 693-706.  23. McCarthy RE, 3rd, Boehmer JP, Hruban RH, Hutchins GM, Kasper EK, Hare JM, et al. Long-term outcome of fulminant myocarditis as compared with acute (nonfulminant) myocarditis. The New England journal of medicine 2000 Mar 9; 342(10): 690-695.  24. Kindermann I, Kindermann M, Kandolf R, Klingel K, Bultmann B, Muller T, et al. Predictors of outcome in patients with suspected myocarditis. Circulation 2008 Aug 5; 118(6): 639-648.  96  25. Magnani JW, Dec GW. Myocarditis: current trends in diagnosis and treatment. Circulation 2006 Feb 14; 113(6): 876-890.  26. Schultheiss HP, Kuhl U, Cooper LT. The management of myocarditis. European heart journal 2011 Nov; 32(21): 2616-2625.  27. Richardson P, McKenna W, Bristow M, Maisch B, Mautner B, O'Connell J, et al. Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Definition and Classification of cardiomyopathies. Circulation 1996 Mar 1; 93(5): 841-842.  28. Jefferies JL, Towbin JA. Dilated cardiomyopathy. Lancet 2010 Feb 27; 375(9716): 752-762.  29. Towbin JA, Lowe AM, Colan SD, Sleeper LA, Orav EJ, Clunie S, et al. Incidence, causes, and outcomes of dilated cardiomyopathy in children. Jama 2006 Oct 18; 296(15): 1867-1876.  30. Basso C, Calabrese F, Corrado D, Thiene G. Postmortem diagnosis in sudden cardiac death victims: macroscopic, microscopic and molecular findings. Cardiovascular research 2001 May; 50(2): 290-300.  31. Basso C, Calabrese F, Angelini A, Carturan E, Thiene G. Classification and histological, immunohistochemical, and molecular diagnosis of inflammatory myocardial disease. Heart failure reviews 2013 Nov; 18(6): 673-681.  32. Wakafuji S, Okada R. Twenty year autopsy statistics of myocarditis incidence in Japan. Japanese circulation journal 1986 Dec; 50(12): 1288-1293.  33. Felker GM, Hu W, Hare JM, Hruban RH, Baughman KL, Kasper EK. The spectrum of dilated cardiomyopathy. The Johns Hopkins experience with 1,278 patients. Medicine 1999 Jul; 78(4): 270-283.  34. Mason JW, O'Connell JB, Herskowitz A, Rose NR, McManus BM, Billingham ME, et al. A clinical trial of immunosuppressive therapy for myocarditis. The Myocarditis Treatment Trial Investigators. The New England journal of medicine 1995 Aug 3; 333(5): 269-275.  35. Maron BJ, Doerer JJ, Haas TS, Tierney DM, Mueller FO. Sudden deaths in young competitive athletes: analysis of 1866 deaths in the United States, 1980-2006. Circulation 2009 Mar 3; 119(8): 1085-1092.  36. Basso C, Corrado D, Rossi L, Thiene G. Ventricular preexcitation in children and young adults: atrial myocarditis as a possible trigger of sudden death. Circulation 2001 Jan 16; 103(2): 269-275.  97  37. Steinberger J, Lucas RV, Jr., Edwards JE, Titus JL. Causes of sudden unexpected cardiac death in the first two decades of life. The American journal of cardiology 1996 May 1; 77(11): 992-995.  38. Shatz A, Hiss J, Arensburg B. Myocarditis misdiagnosed as sudden infant death syndrome (SIDS). Medicine, science, and the law 1997 Jan; 37(1): 16-18.  39. Rajs J, Hammarquist F. Sudden infant death in Stockholm. A forensic pathology study covering ten years. Acta paediatrica Scandinavica 1988 Nov; 77(6): 812-820.  40. Rasten-Almqvist P, Eksborg S, Rajs J. Myocarditis and sudden infant death syndrome. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica 2002 Jun; 110(6): 469-480.  41. Dec GW, Jr., Palacios IF, Fallon JT, Aretz HT, Mills J, Lee DC, et al. Active myocarditis in the spectrum of acute dilated cardiomyopathies. Clinical features, histologic correlates, and clinical outcome. The New England journal of medicine 1985 Apr 4; 312(14): 885-890.  42. Durani Y, Giordano K, Goudie BW. Myocarditis and pericarditis in children. Pediatric clinics of North America 2010 Dec; 57(6): 1281-1303.  43. Lipshultz SE, Sleeper LA, Towbin JA, Lowe AM, Orav EJ, Cox GF, et al. The incidence of pediatric cardiomyopathy in two regions of the United States. The New England journal of medicine 2003 Apr 24; 348(17): 1647-1655.  44. Martino TA, Liu P, Sole MJ. Viral infection and the pathogenesis of dilated cardiomyopathy. Circulation research 1994 Feb; 74(2): 182-188.  45. Woodruff JF. Viral myocarditis. A review. The American journal of pathology 1980 Nov; 101(2): 425-484.  46. Brodison A, Swann JW. Myocarditis: a review. The Journal of infection 1998 Sep; 37(2): 99-103.  47. Bowles NE, Bowles KR, Towbin JA. Viral genomic detection and outcome in myocarditis. Heart failure clinics 2005 Oct; 1(3): 407-417.  48. Pankuweit S, Moll R, Baandrup U, Portig I, Hufnagel G, Maisch B. Prevalence of the parvovirus B19 genome in endomyocardial biopsy specimens. Human pathology 2003 May; 34(5): 497-503.  49. Breinholt JP, Moulik M, Dreyer WJ, Denfield SW, Kim JJ, Jefferies JL, et al. Viral epidemiologic shift in inflammatory heart disease: the increasing involvement of parvovirus B19 in the myocardium of pediatric cardiac transplant patients. The Journal of 98  heart and lung transplantation : the official publication of the International Society for Heart Transplantation 2010 Jul; 29(7): 739-746.  50. Szeles A, Falk KI, Imreh S, Klein G. Visualization of alternative Epstein-Barr virus expression programs by fluorescent in situ hybridization at the cell level. Journal of virology 1999 Jun; 73(6): 5064-5069.  51. Koepsell SA, Anderson DR, Radio SJ. Parvovirus B19 is a bystander in adult myocarditis. Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology 2012 Nov-Dec; 21(6): 476-481.  52. Kaji M, Kuno H, Turu T, Sato Y, Oizumi K. Elevated serum myosin light chain I in influenza patients. Internal medicine 2001 Jul; 40(7): 594-597.  53. Mahfoud F, Ukena C, Kandolf R, Kindermann M, Bohm M, Kindermann I. Blood pressure and heart rate predict outcome in patients acutely admitted with suspected myocarditis without previous heart failure. Journal of hypertension 2012 Jun; 30(6): 1217-1224.  54. Wang K, Asinger RW, Marriott HJ. ST-segment elevation in conditions other than acute myocardial infarction. The New England journal of medicine 2003 Nov 27; 349(22): 2128-2135.  55. Childs H, Friedrich MG. Cardiovascular magnetic resonance imaging in myocarditis. Progress in cardiovascular diseases 2011 Nov-Dec; 54(3): 266-275.  56. Mavrogeni S, Dimitroulas T, Kitas GD. Multimodality imaging and the emerging role of cardiac magnetic resonance in autoimmune myocarditis. Autoimmun Rev 2012 Dec; 12(2): 305-312.  57. Skouri HN, Dec GW, Friedrich MG, Cooper LT. Noninvasive imaging in myocarditis. Journal of the American College of Cardiology 2006 Nov 21; 48(10): 2085-2093.  58. Elamm C, Fairweather D, Cooper LT. Pathogenesis and diagnosis of myocarditis. Heart 2012 Jun; 98(11): 835-840.  59. Why HJ, Meany BT, Richardson PJ, Olsen EG, Bowles NE, Cunningham L, et al. Clinical and prognostic significance of detection of enteroviral RNA in the myocardium of patients with myocarditis or dilated cardiomyopathy. Circulation 1994 Jun; 89(6): 2582-2589.  60. Felker GM, Thompson RE, Hare JM, Hruban RH, Clemetson DE, Howard DL, et al. Underlying causes and long-term survival in patients with initially unexplained cardiomyopathy. The New England journal of medicine 2000 Apr 13; 342(15): 1077-1084.  99  61. Frustaci A, Chimenti C, Calabrese F, Pieroni M, Thiene G, Maseri A. Immunosuppressive therapy for active lymphocytic myocarditis: virological and immunologic profile of responders versus nonresponders. Circulation 2003 Feb 18; 107(6): 857-863.  62. McNamara DM, Holubkov R, Starling RC, Dec GW, Loh E, Torre-Amione G, et al. Controlled trial of intravenous immune globulin in recent-onset dilated cardiomyopathy. Circulation 2001 May 8; 103(18): 2254-2259.  63. Frustaci A, Russo MA, Chimenti C. Randomized study on the efficacy of immunosuppressive therapy in patients with virus-negative inflammatory cardiomyopathy: the TIMIC study. European heart journal 2009 Aug; 30(16): 1995-2002.  64. Wojnicz R, Nowalany-Kozielska E, Wojciechowska C, Glanowska G, Wilczewski P, Niklewski T, et al. Randomized, placebo-controlled study for immunosuppressive treatment of inflammatory dilated cardiomyopathy: two-year follow-up results. Circulation 2001 Jul 3; 104(1): 39-45.  65. Stelts S, Taylor MH, Nappi J, Van Bakel AB. Mesalamine-associated hypersensitivity myocarditis in ulcerative colitis. The Annals of pharmacotherapy 2008 Jun; 42(6): 904-905.  66. Givertz MM, Mann DL. Epidemiology and natural history of recovery of left ventricular function in recent onset dilated cardiomyopathies. Current heart failure reports 2013 Dec; 10(4): 321-330.  67. Chen X, Chen Y, Bi Y, Fu N, Shan C, Wang S, et al. Preventive cardioprotection of erythropoietin against doxorubicin-induced cardiomyopathy. Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy 2007 Oct; 21(5): 367-374.  68. Kilian JG, Kerr K, Lawrence C, Celermajer DS. Myocarditis and cardiomyopathy associated with clozapine. Lancet 1999 Nov 27; 354(9193): 1841-1845.  69. Esfandiarei M, McManus BM. Molecular biology and pathogenesis of viral myocarditis. Annual review of pathology 2008; 3: 127-155.  70. Weger S, Wendland M, Kleinschmidt JA, Heilbronn R. The adeno-associated virus type 2 regulatory proteins rep78 and rep68 interact with the transcriptional coactivator PC4. Journal of virology 1999 Jan; 73(1): 260-269.  71. Leuschner F, Katus HA, Kaya Z. Autoimmune myocarditis: past, present and future. Journal of autoimmunity 2009 Nov-Dec; 33(3-4): 282-289.  100  72. Caforio AL, Marcolongo R, Jahns R, Fu M, Felix SB, Iliceto S. Immune-mediated and autoimmune myocarditis: clinical presentation, diagnosis and management. Heart failure reviews 2013 Nov; 18(6): 715-732.  73. Corssmit EP, Trip MD, Durrer JD. Loffler's endomyocarditis in the idiopathic hypereosinophilic syndrome. Cardiology 1999; 91(4): 272-276.  74. Vinit J, Bielefeld P, Muller G, Pfitzenmeyer P, Bonniaud P, Lorcerie B, et al. Heart involvement in Churg-Strauss syndrome: retrospective study in French Burgundy population in past 10 years. European journal of internal medicine 2010 Aug; 21(4): 341-346.  75. Cooper LT, Jr. Giant cell and granulomatous myocarditis. Heart failure clinics 2005 Oct; 1(3): 431-437.  76. Nunes H, Freynet O, Naggara N, Soussan M, Weinman P, Diebold B, et al. Cardiac sarcoidosis. Seminars in respiratory and critical care medicine 2010 Aug; 31(4): 428-441.  77. Neumann DA, Burek CL, Baughman KL, Rose NR, Herskowitz A. Circulating heart-reactive antibodies in patients with myocarditis or cardiomyopathy. Journal of the American College of Cardiology 1990 Nov; 16(6): 839-846.  78. Bouwes Bavinck JN, Stark S, Petridis AK, Marugg ME, Ter Schegget J, Westendorp RG, et al. The presence of antibodies against virus-like particles of epidermodysplasia verruciformis-associated humanpapillomavirus type 8 in patients with actinic keratoses. The British journal of dermatology 2000 Jan; 142(1): 103-109.  79. Morris SA, Tanowitz HB, Wittner M, Bilezikian JP. Pathophysiological insights into the cardiomyopathy of Chagas' disease. Circulation 1990 Dec; 82(6): 1900-1909.  80. Major ME, Mihalik K, Fernandez J, Seidman J, Kleiner D, Kolykhalov AA, et al. Long-term follow-up of chimpanzees inoculated with the first infectious clone for hepatitis C virus. Journal of virology 1999 Apr; 73(4): 3317-3325.  81. Liu PP, Mason JW. Advances in the understanding of myocarditis. Circulation 2001 Aug 28; 104(9): 1076-1082.  82. Dennert R, Crijns HJ, Heymans S. Acute viral myocarditis. European heart journal 2008 Sep; 29(17): 2073-2082.  83. Eckart RE, Scoville SL, Campbell CL, Shry EA, Stajduhar KC, Potter RN, et al. Sudden death in young adults: a 25-year review of autopsies in military recruits. Annals of internal medicine 2004 Dec 7; 141(11): 829-834.  101  84. McManus BM, Chow LH, Wilson JE, Anderson DR, Gulizia JM, Gauntt CJ, et al. Direct myocardial injury by enterovirus: a central role in the evolution of murine myocarditis. Clinical immunology and immunopathology 1993 Aug; 68(2): 159-169.  85. Seko Y, Takahashi N, Yagita H, Okumura K, Yazaki Y. Expression of cytokine mRNAs in murine hearts with acute myocarditis caused by coxsackievirus b3. The Journal of pathology 1997 Sep; 183(1): 105-108.  86. Schultheiss HP, Kuhl U. Overview on chronic viral cardiomyopathy/chronic myocarditis. Ernst Schering Research Foundation workshop 2006; (55): 3-18.  87. McManus BM, Gauntt CJ, Cassling RS. Immunopathologic basis of myocardial injury. Cardiovascular clinics 1988; 18(2): 163-184.  88. Abelmann WH. Virus and the heart. Circulation 1971 Nov; 44(5): 950-956.  89. Helwig FC, Schmidt CH. A Filter-Passing Agent Producing Interstitial Myocarditis in Anthropoid Apes and Small Animals. Science 1945 Jul 13; 102(2637): 31-33.  90. Dalldorf G, Sickles GM. An Unidentified, Filtrable Agent Isolated From the Feces of Children With Paralysis. Science 1948 Jul 16; 108(2794): 61-62.  91. Melnick JL, Shaw EW, Curnen EC. A virus isolated from patients diagnosed as non-paralytic poliomyelitis or aseptic meningitis. Proceedings of the Society for Experimental Biology and Medicine Society for Experimental Biology and Medicine 1949 Jul; 71(3): 344-349.  92. Pons-Salort M, Parker EP, Grassly NC. The epidemiology of non-polio enteroviruses: recent advances and outstanding questions. Current opinion in infectious diseases 2015 Oct; 28(5): 479-487.  93. Baboonian C, Davies MJ, Booth JC, McKenna WJ. Coxsackie B viruses and human heart disease. Current topics in microbiology and immunology 1997; 223: 31-52.  94. Baboonian C, Treasure T. Meta-analysis of the association of enteroviruses with human heart disease. Heart 1997 Dec; 78(6): 539-543.  95. Klingel K, Stephan S, Sauter M, Zell R, McManus BM, Bultmann B, et al. Pathogenesis of murine enterovirus myocarditis: virus dissemination and immune cell targets. Journal of virology 1996 Dec; 70(12): 8888-8895.  96. Corsten MF, Schroen B, Heymans S. Inflammation in viral myocarditis: friend or foe? Trends in molecular medicine 2012 Jul; 18(7): 426-437.  97. Bonderoff JM, Lloyd RE. CVB translation: lessons from the polioviruses. Current topics in microbiology and immunology 2008; 323: 123-147. 102   98. Nicholson-Weller A, Wang CE. Structure and function of decay accelerating factor CD55. The Journal of laboratory and clinical medicine 1994 Apr; 123(4): 485-491.  99. Liu P, Aitken K, Kong YY, Opavsky MA, Martino T, Dawood F, et al. The tyrosine kinase p56lck is essential in coxsackievirus B3-mediated heart disease. Nature medicine 2000 Apr; 6(4): 429-434.  100. Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, et al. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 1997 Feb 28; 275(5304): 1320-1323.  101. Shi Y, Chen C, Lisewski U, Wrackmeyer U, Radke M, Westermann D, et al. Cardiac deletion of the Coxsackievirus-adenovirus receptor abolishes Coxsackievirus B3 infection and prevents myocarditis in vivo. Journal of the American College of Cardiology 2009 Apr 7; 53(14): 1219-1226.  102. Kashimura T, Kodama M, Hotta Y, Hosoya J, Yoshida K, Ozawa T, et al. Spatiotemporal changes of coxsackievirus and adenovirus receptor in rat hearts during postnatal development and in cultured cardiomyocytes of neonatal rat. Virchows Archiv : an international journal of pathology 2004 Mar; 444(3): 283-292.  103. Lim BK, Xiong D, Dorner A, Youn TJ, Yung A, Liu TI, et al. Coxsackievirus and adenovirus receptor (CAR) mediates atrioventricular-node function and connexin 45 localization in the murine heart. The Journal of clinical investigation 2008 Aug; 118(8): 2758-2770.  104. Marchant D, Si X, Luo H, McManus B, Yang D. The impact of CVB3 infection on host cell biology. Current topics in microbiology and immunology 2008; 323: 177-198.  105. Honda T, Saitoh H, Masuko M, Katagiri-Abe T, Tominaga K, Kozakai I, et al. The coxsackievirus-adenovirus receptor protein as a cell adhesion molecule in the developing mouse brain. Brain research Molecular brain research 2000 Apr 14; 77(1): 19-28.  106. McManus BM, Yanagawa B, Rezai N, Luo H, Taylor L, Zhang M, et al. Genetic determinants of coxsackievirus B3 pathogenesis. Annals of the New York Academy of Sciences 2002 Dec; 975: 169-179.  107. Cheung PK, Yuan J, Zhang HM, Chau D, Yanagawa B, Suarez A, et al. Specific interactions of mouse organ proteins with the 5'untranslated region of coxsackievirus B3: potential determinants of viral tissue tropism. Journal of medical virology 2005 Nov; 77(3): 414-424.  108. Martinez-Salas E, Francisco-Velilla R, Fernandez-Chamorro J, Lozano G, Diaz-Toledano R. Picornavirus IRES elements: RNA structure and host protein interactions. Virus research 2015 Aug 3; 206: 62-73. 103   109. van Ooij MJ, Glaudemans DH, Heus HA, van Kuppeveld FJ, Melchers WJ. Structural and functional integrity of the coxsackievirus B3 oriR: spacing between coaxial RNA helices. The Journal of general virology 2006 Mar; 87(Pt 3): 689-695.  110. Klump WM, Bergmann I, Muller BC, Ameis D, Kandolf R. Complete nucleotide sequence of infectious Coxsackievirus B3 cDNA: two initial 5' uridine residues are regained during plus-strand RNA synthesis. Journal of virology 1990 Apr; 64(4): 1573-1583.  111. Preiss T, Hentze MW. Dual function of the messenger RNA cap structure in poly(A)-tail-promoted translation in yeast. Nature 1998 Apr 2; 392(6675): 516-520.  112. Preiss T, Muckenthaler M, Hentze MW. Poly(A)-tail-promoted translation in yeast: implications for translational control. RNA 1998 Nov; 4(11): 1321-1331.  113. Bhattacharyya S, Das S. Mapping of secondary structure of the spacer region within the 5'-untranslated region of the coxsackievirus B3 RNA: possible role of an apical GAGA loop in binding La protein and influencing internal initiation of translation. Virus research 2005 Mar; 108(1-2): 89-100.  114. Verma B, Bhattacharyya S, Das S. Polypyrimidine tract-binding protein interacts with coxsackievirus B3 RNA and influences its translation. The Journal of general virology 2010 May; 91(Pt 5): 1245-1255.  115. Souii A, M'Hadheb-Gharbi MB, Gharbi J. Cellular Proteins Act as Bridge Between 5' and 3' Ends of the Coxsackievirus B3 Mediating Genome Circularization During RNA Translation. Current microbiology 2015 Sep; 71(3): 387-395.  116. Massilamany C, Gangaplara A, Reddy J. Intricacies of cardiac damage in coxsackievirus B3 infection: implications for therapy. International journal of cardiology 2014 Dec 15; 177(2): 330-339.  117. Wimmer E, Hellen CU, Cao X. Genetics of poliovirus. Annual review of genetics 1993; 27: 353-436.  118. Jacobson MF, Baltimore D. Polypeptide cleavages in the formation of poliovirus proteins. Proceedings of the National Academy of Sciences of the United States of America 1968 Sep; 61(1): 77-84.  119. Lloyd RE, Toyoda H, Etchison D, Wimmer E, Ehrenfeld E. Cleavage of the cap binding protein complex polypeptide p220 is not effected by the second poliovirus protease 2A. Virology 1986 Apr 15; 150(1): 299-303.  120. Konig H, Rosenwirth B. Purification and partial characterization of poliovirus protease 2A by means of a functional assay. Journal of virology 1988 Apr; 62(4): 1243-1250. 104   121. Doedens JR, Kirkegaard K. Inhibition of cellular protein secretion by poliovirus proteins 2B and 3A. The EMBO journal 1995 Mar 1; 14(5): 894-907.  122. Kumagai Y, Lin LY, Hiratsuka A, Narimatsu S, Suzuki T, Yamada H, et al. Participation of cytochrome P450-2B and -2D isozymes in the demethylenation of methylenedioxymethamphetamine enantiomers by rats. Molecular pharmacology 1994 Feb; 45(2): 359-365.  123. Teterina NL, Bienz K, Egger D, Gorbalenya AE, Ehrenfeld E. Induction of intracellular membrane rearrangements by HAV proteins 2C and 2BC. Virology 1997 Oct 13; 237(1): 66-77.  124. van Kuppeveld FJ, Hoenderop JG, Smeets RL, Willems PH, Dijkman HB, Galama JM, et al. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. The EMBO journal 1997 Jun 16; 16(12): 3519-3532.  125. van Kuppeveld FJ, van den Hurk PJ, van der Vliet W, Galama JM, Melchers WJ. Chimeric coxsackie B3 virus genomes that express hybrid coxsackievirus-poliovirus 2B proteins: functional dissection of structural domains involved in RNA replication. The Journal of general virology 1997 Aug; 78 ( Pt 8): 1833-1840.  126. Hohenadl C, Klingel K, Rieger P, Hofschneider PH, Kandolf R. Investigation of the coxsackievirus B3 nonstructural proteins 2B, 2C, and 3AB: generation of specific polyclonal antisera and detection of replicating virus in infected tissue. J Virol Methods 1994 May; 47(3): 279-295.  127. Aldabe R, Carrasco L. Induction of membrane proliferation by poliovirus proteins 2C and 2BC. Biochemical and biophysical research communications 1995 Jan 5; 206(1): 64-76.  128. Cho MW, Teterina N, Egger D, Bienz K, Ehrenfeld E. Membrane rearrangement and vesicle induction by recombinant poliovirus 2C and 2BC in human cells. Virology 1994 Jul; 202(1): 129-145.  129. Banerjee R, Dasgupta A. Specific interaction of hepatitis C virus protease/helicase NS3 with the 3'-terminal sequences of viral positive- and negative-strand RNA. Journal of virology 2001 Feb; 75(4): 1708-1721.  130. Echeverri AC, Dasgupta A. Amino terminal regions of poliovirus 2C protein mediate membrane binding. Virology 1995 Apr 20; 208(2): 540-553.  131. Pincus SE, Diamond DC, Emini EA, Wimmer E. Guanidine-selected mutants of poliovirus: mapping of point mutations to polypeptide 2C. Journal of virology 1986 Feb; 57(2): 638-646.  105  132. Pincus SE, Wimmer E. Production of guanidine-resistant and -dependent poliovirus mutants from cloned cDNA: mutations in polypeptide 2C are directly responsible for altered guanidine sensitivity. Journal of virology 1986 Nov; 60(2): 793-796.  133. Pfister T, Wimmer E. Characterization of the nucleoside triphosphatase activity of poliovirus protein 2C reveals a mechanism by which guanidine inhibits poliovirus replication. The Journal of biological chemistry 1999 Mar 12; 274(11): 6992-7001.  134. Molla A, Harris KS, Paul AV, Shin SH, Mugavero J, Wimmer E. Stimulation of poliovirus proteinase 3Cpro-related proteolysis by the genome-linked protein VPg and its precursor 3AB. The Journal of biological chemistry 1994 Oct 28; 269(43): 27015-27020.  135. Paul AV, Cao X, Harris KS, Lama J, Wimmer E. Studies with poliovirus polymerase 3Dpol. Stimulation of poly(U) synthesis in vitro by purified poliovirus protein 3AB. The Journal of biological chemistry 1994 Nov 18; 269(46): 29173-29181.  136. Lama J, Paul AV, Harris KS, Wimmer E. Properties of purified recombinant poliovirus protein 3aB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpol. The Journal of biological chemistry 1994 Jan 7; 269(1): 66-70.  137. Doedens JR, Giddings TH, Jr., Kirkegaard K. Inhibition of endoplasmic reticulum-to-Golgi traffic by poliovirus protein 3A: genetic and ultrastructural analysis. Journal of virology 1997 Dec; 71(12): 9054-9064.  138. Dodd DA, Giddings TH, Jr., Kirkegaard K. Poliovirus 3A protein limits interleukin-6 (IL-6), IL-8, and beta interferon secretion during viral infection. Journal of virology 2001 Sep; 75(17): 8158-8165.  139. Pettersson RF, Flanegan JB, Rose JK, Baltimore D. 5'-Terminal nucleotide sequences of polio virus polyribosomal RNA and virion RNA are identical. Nature 1977 Jul 21; 268(5617): 270-272.  140. Nomoto A, Kitamura N, Golini F, Wimmer E. The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg. Proceedings of the National Academy of Sciences of the United States of America 1977 Dec; 74(12): 5345-5349.  141. Lee YF, Nomoto A, Detjen BM, Wimmer E. A protein covalently linked to poliovirus genome RNA. Proceedings of the National Academy of Sciences of the United States of America 1977 Jan; 74(1): 59-63.  142. Mosimann SC, Cherney MM, Sia S, Plotch S, James MN. Refined X-ray crystallographic structure of the poliovirus 3C gene product. Journal of molecular biology 1997 Nov 14; 273(5): 1032-1047.  106  143. Kuyumcu-Martinez NM, Joachims M, Lloyd RE. Efficient cleavage of ribosome-associated poly(A)-binding protein by enterovirus 3C protease. Journal of virology 2002 Mar; 76(5): 2062-2074.  144. Whitton JL, Cornell CT, Feuer R. Host and virus determinants of picornavirus pathogenesis and tropism. Nature reviews Microbiology 2005 Oct; 3(10): 765-776.  145. Lawrence C, Thach RE. Identification of a viral protein involved in post-translational maturation of the encephalomyocarditis virus capsid precursor. Journal of virology 1975 Apr; 15(4): 918-928.  146. Pelham HR. Translation of encephalomyocarditis virus RNA in vitro yields an active proteolytic processing enzyme. European journal of biochemistry / FEBS 1978 Apr 17; 85(2): 457-462.  147. Hanecak R, Semler BL, Anderson CW, Wimmer E. Proteolytic processing of poliovirus polypeptides: antibodies to polypeptide P3-7c inhibit cleavage at glutamine-glycine pairs. Proceedings of the National Academy of Sciences of the United States of America 1982 Jul; 79(13): 3973-3977.  148. Toyoda H, Nicklin MJ, Murray MG, Anderson CW, Dunn JJ, Studier FW, et al. A second virus-encoded proteinase involved in proteolytic processing of poliovirus polyprotein. Cell 1986 Jun 6; 45(5): 761-770.  149. Gorbalenya AE, Donchenko AP, Blinov VM, Koonin EV. Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases. A distinct protein superfamily with a common structural fold. FEBS Lett 1989 Jan 30; 243(2): 103-114.  150. Bazan JF, Fletterick RJ. Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences of the United States of America 1988 Nov; 85(21): 7872-7876.  151. Blinov VM, Gorbalenia AE, Donchenko AP. [Structural similarity of poliovirus cysteine proteinase P3-7c and cellular serine proteinase of trypsin]. Doklady Akademii nauk SSSR 1984; 279(2): 502-505.  152. Bergmann EM, Cherney MM, McKendrick J, Frormann S, Luo C, Malcolm BA, et al. Crystal structure of an inhibitor complex of the 3C proteinase from hepatitis A virus (HAV) and implications for the polyprotein processing in HAV. Virology 1999 Dec 5; 265(1): 153-163.  153. Bergmann EM, Mosimann SC, Chernaia MM, Malcolm BA, James MN. The refined crystal structure of the 3C gene product from hepatitis A virus: specific proteinase activity and RNA recognition. Journal of virology 1997 Mar; 71(3): 2436-2448.  107  154. Feng Q, Langereis MA, Olagnier D, Chiang C, van de Winkel R, van Essen P, et al. Coxsackievirus cloverleaf RNA containing a 5' triphosphate triggers an antiviral response via RIG-I activation. Plos One 2014; 9(4): e95927.  155. Groppo R, Palmenberg AC. Cardiovirus 2A protein associates with 40S but not 80S ribosome subunits during infection. Journal of virology 2007 Dec; 81(23): 13067-13074.  156. Joachims M, Harris KS, Etchison D. Poliovirus protease 3C mediates cleavage of microtubule-associated protein 4. Virology 1995 Aug 20; 211(2): 451-461.  157. Badorff C, Berkely N, Mehrotra S, Talhouk JW, Rhoads RE, Knowlton KU. Enteroviral protease 2A directly cleaves dystrophin and is inhibited by a dystrophin-based substrate analogue. The Journal of biological chemistry 2000 Apr 14; 275(15): 11191-11197.  158. Barco A, Feduchi E, Carrasco L. Poliovirus protease 3C(pro) kills cells by apoptosis. Virology 2000 Jan 20; 266(2): 352-360.  159. Goldstaub D, Gradi A, Bercovitch Z, Grosmann Z, Nophar Y, Luria S, et al. Poliovirus 2A protease induces apoptotic cell death. Molecular and cellular biology 2000 Feb; 20(4): 1271-1277.  160. Wu S, Wang Y, Lin L, Si X, Wang T, Zhong X, et al. Protease 2A induces stress granule formation during coxsackievirus B3 and enterovirus 71 infections. Virology journal 2014; 11: 192.  161. Wong J, Zhang J, Yanagawa B, Luo Z, Yang X, Chang J, et al. Cleavage of serum response factor mediated by enteroviral protease 2A contributes to impaired cardiac function. Cell Res 2012 Feb; 22(2): 360-371.  162. Xiong DD, Yajima T, Lim BK, Stenbit A, Dublin A, Dalton ND, et al. Inducible cardiac-restricted expression of enteroviral protease 2A is sufficient to induce dilated cardiomyopathy. Circulation 2007 Jan 2; 115(1): 94-102.  163. Younessi P, Jans DA, Ghildyal R. Modulation of host cell nucleocytoplasmic trafficking during picornavirus infection. Infectious disorders drug targets 2012 Feb; 12(1): 59-67.  164. Svitkin YV, Herdy B, Costa-Mattioli M, Gingras AC, Raught B, Sonenberg N. Eukaryotic translation initiation factor 4E availability controls the switch between cap-dependent and internal ribosomal entry site-mediated translation. Molecular and cellular biology 2005 Dec; 25(23): 10556-10565.  165. Bovee ML, Lamphear BJ, Rhoads RE, Lloyd RE. Direct cleavage of elF4G by poliovirus 2A protease is inefficient in vitro. Virology 1998 Jun 5; 245(2): 241-249.  166. Lamphear BJ, Kirchweger R, Skern T, Rhoads RE. Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. 108  Implications for cap-dependent and cap-independent translational initiation. The Journal of biological chemistry 1995 Sep 15; 270(37): 21975-21983.  167. Gradi A, Svitkin YV, Imataka H, Sonenberg N. Proteolysis of human eukaryotic translation initiation factor eIF4GII, but not eIF4GI, coincides with the shutoff of host protein synthesis after poliovirus infection. Proceedings of the National Academy of Sciences of the United States of America 1998 Sep 15; 95(19): 11089-11094.  168. Joachims M, Van Breugel PC, Lloyd RE. Cleavage of poly(A)-binding protein by enterovirus proteases concurrent with inhibition of translation in vitro. Journal of virology 1999 Jan; 73(1): 718-727.  169. Redondo N, Sanz MA, Welnowska E, Carrasco L. Translation without eIF2 Promoted by Poliovirus 2A Protease. Plos One 2011 Oct 7; 6(10).  170. Welnowska E, Sanz MA, Redondo N, Carrasco L. Translation of Viral mRNA without Active eIF2: The Case of Picornaviruses. Plos One 2011 Jul 14; 6(7).  171. White JP, Reineke LC, Lloyd RE. Poliovirus Switches to an eIF2-Independent Mode of Translation during Infection. Journal of virology 2011 Sep; 85(17): 8884-8893.  172. Shaughnessy JD, Jr., Jenkins NA, Copeland NG. cDNA cloning, expression analysis, and chromosomal localization of a gene with high homology to wheat eIF-(iso)4F and mammalian eIF-4G. Genomics 1997 Jan 15; 39(2): 192-197.  173. Yamanaka S, Poksay KS, Arnold KS, Innerarity TL. A novel translational repressor mRNA is edited extensively in livers containing tumors caused by the transgene expression of the apoB mRNA-editing enzyme. Genes & development 1997 Feb 1; 11(3): 321-333.  174. Imataka H, Olsen HS, Sonenberg N. A new translational regulator with homology to eukaryotic translation initiation factor 4G. The EMBO journal 1997 Feb 17; 16(4): 817-825.  175. Levy-Strumpf N, Deiss LP, Berissi H, Kimchi A. DAP-5, a novel homolog of eukaryotic translation initiation factor 4G isolated as a putative modulator of gamma interferon-induced programmed cell death. Molecular and cellular biology 1997 Mar; 17(3): 1615-1625.  176. Lee SH, McCormick F. p97/DAP5 is a ribosome-associated factor that facilitates protein synthesis and cell proliferation by modulating the synthesis of cell cycle proteins. The EMBO journal 2006 Sep 6; 25(17): 4008-4019.  177. Lewis SM, Cerquozzi S, Graber TE, Ungureanu NH, Andrews M, Holcik M. The eIF4G homolog DAP5/p97 supports the translation of select mRNAs during endoplasmic reticulum stress. Nucleic acids research 2008 Jan; 36(1): 168-178. 109   178. Imataka H, Gradi A, Sonenberg N. A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. The EMBO journal 1998 Dec 15; 17(24): 7480-7489.  179. Liberman N, Gandin V, Svitkin YV, David M, Virgili G, Jaramillo M, et al. DAP5 associates with eIF2beta and eIF4AI to promote Internal Ribosome Entry Site driven translation. Nucleic acids research 2015 Apr 20; 43(7): 3764-3775.  180. Marash L, Kimchi A. DAP5 and IRES-mediated translation during programmed cell death. Cell death and differentiation 2005 Jun; 12(6): 554-562.  181. Marash L, Liberman N, Henis-Korenblit S, Sivan G, Reem E, Elroy-Stein O, et al. DAP5 promotes cap-independent translation of Bcl-2 and CDK1 to facilitate cell survival during mitosis. Molecular cell 2008 May 23; 30(4): 447-459.  182. Henis-Korenblit S, Strumpf NL, Goldstaub D, Kimchi A. A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleavage and internal ribosome entry site-mediated translation. Molecular and cellular biology 2000 Jan; 20(2): 496-506.  183. Chau DH, Yuan J, Zhang H, Cheung P, Lim T, Liu Z, et al. Coxsackievirus B3 proteases 2A and 3C induce apoptotic cell death through mitochondrial injury and cleavage of eIF4GI but not DAP5/p97/NAT1. Apoptosis : an international journal on programmed cell death 2007 Mar; 12(3): 513-524.  184. Henis-Korenblit S, Shani G, Sines T, Marash L, Shohat G, Kimchi A. The caspase-cleaved DAP5 protein supports internal ribosome entry site-mediated translation of death proteins. Proceedings of the National Academy of Sciences of the United States of America 2002 Apr 16; 99(8): 5400-5405.  185. Baliga RR, Pimental DR, Zhao YY, Simmons WW, Marchionni MA, Sawyer DB, et al. NRG-1-induced cardiomyocyte hypertrophy. Role of PI-3-kinase, p70(S6K), and MEK-MAPK-RSK. The American journal of physiology 1999 Nov; 277(5 Pt 2): H2026-2037.  186. Meerovitch K, Svitkin YV, Lee HS, Lejbkowicz F, Kenan DJ, Chan EK, et al. La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate. Journal of virology 1993 Jul; 67(7): 3798-3807.  187. Gustin KE, Sarnow P. Inhibition of nuclear import and alteration of nuclear pore complex composition by rhinovirus. Journal of virology 2002 Sep; 76(17): 8787-8796.  188. Fitzgerald KD, Semler BL. Re-localization of cellular protein SRp20 during poliovirus infection: bridging a viral IRES to the host cell translation apparatus. PLoS pathogens 2011 Jul; 7(7): e1002127.  110  189. Belov GA, Lidsky PV, Mikitas OV, Egger D, Lukyanov KA, Bienz K, et al. Bidirectional increase in permeability of nuclear envelope upon poliovirus infection and accompanying alterations of nuclear pores. Journal of virology 2004 Sep; 78(18): 10166-10177.  190. Lewis SM, Holcik M. For IRES trans-acting factors, it is all about location. Oncogene 2008 Feb 14; 27(8): 1033-1035.  191. Spriggs KA, Bushell M, Mitchell SA, Willis AE. Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell death and differentiation 2005 Jun; 12(6): 585-591.  192. Pilipenko EV, Pestova TV, Kolupaeva VG, Khitrina EV, Poperechnaya AN, Agol VI, et al. A cell cycle-dependent protein serves as a template-specific translation initiation factor. Genes & development 2000 Aug 15; 14(16): 2028-2045.  193. Castello A, Alvarez E, Carrasco L. The multifaceted poliovirus 2A protease: regulation of gene expression by picornavirus proteases. Journal of biomedicine & biotechnology 2011; 2011: 369648.  194. Gourevitch MN, Teeter R, Schoenbaum EE, Klein RS. Self-assessment of tuberculin skin test reactions by drug users with or at risk for human immunodeficiency virus infection. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 1999 Apr; 3(4): 321-325.  195. Shiroki K, Isoyama T, Kuge S, Ishii T, Ohmi S, Hata S, et al. Intracellular redistribution of truncated La protein produced by poliovirus 3Cpro-mediated cleavage. Journal of virology 1999 Mar; 73(3): 2193-2200.  196. Gustin JA, Maehama T, Dixon JE, Donner DB. The PTEN tumor suppressor protein inhibits tumor necrosis factor-induced nuclear factor kappa B activity. The Journal of biological chemistry 2001 Jul 20; 276(29): 27740-27744.  197. Klein R, Mullges W, Bendszus M, Woydt M, Kreipe H, Roggendorf W. Primary intracerebral Hodgkin's disease: report of a case with Epstein-Barr virus association and review of the literature. The American journal of surgical pathology 1999 Apr; 23(4): 477-481.  198. Ghildyal R, Jordan B, Li D, Dagher H, Bardin PG, Gern JE, et al. Rhinovirus 3C protease can localize in the nucleus and alter active and passive nucleocytoplasmic transport. Journal of virology 2009 Jul; 83(14): 7349-7352.  199. Chahine MN, Pierce GN. Therapeutic targeting of nuclear protein import in pathological cell conditions. Pharmacological reviews 2009 Sep; 61(3): 358-372.  111  200. Cronshaw JM, Matunis MJ. The nuclear pore complex: disease associations and functional correlations. Trends in endocrinology and metabolism: TEM 2004 Jan-Feb; 15(1): 34-39.  201. Park N, Skern T, Gustin KE. Specific cleavage of the nuclear pore complex protein Nup62 by a viral protease. The Journal of biological chemistry 2010 Sep 10; 285(37): 28796-28805.  202. Watters K, Palmenberg AC. Differential processing of nuclear pore complex proteins by rhinovirus 2A proteases from different species and serotypes. Journal of virology 2011 Oct; 85(20): 10874-10883.  203. Sporer B, Koedel U, Paul R, Kohleisen B, Erfle V, Fontana A, et al. Human immunodeficiency virus type-1 Nef protein induces blood-brain barrier disruption in the rat: role of matrix metalloproteinase-9. Journal of neuroimmunology 2000 Jan 24; 102(2): 125-130.  204. Brunner JE, Ertel KJ, Rozovics JM, Semler BL. Delayed kinetics of poliovirus RNA synthesis in a human cell line with reduced levels of hnRNP C proteins. Virology 2010 May 10; 400(2): 240-247.  205. Leutenegger CM, Klein D, Hofmann-Lehmann R, Mislin C, Hummel U, Boni J, et al. Rapid feline immunodeficiency virus provirus quantitation by polymerase chain reaction using the TaqMan fluorogenic real-time detection system. Journal of virological methods 1999 Mar; 78(1-2): 105-116.  206. Klein D, Janda P, Steinborn R, Muller M, Salmons B, Gunzburg WH. Proviral load determination of different feline immunodeficiency virus isolates using real-time polymerase chain reaction: influence of mismatches on quantification. Electrophoresis 1999 Feb; 20(2): 291-299.  207. Bartlett JS, Kleinschmidt J, Boucher RC, Samulski RJ. Targeted adeno-associated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab'gamma)2 antibody. Nature biotechnology 1999 Feb; 17(2): 181-186.  208. Herlocher ML, Ewasyshyn M, Sambhara S, Gharaee-Kermani M, Cho D, Lai J, et al. Immunological properties of plaque purified strains of live attenuated respiratory syncytial virus (RSV) for human vaccine. Vaccine 1999 Jan; 17(2): 172-181.  209. Petter A, Heim K, Guger M, Ciresa-Ko Nig A, Christensen N, Sarcletti M, et al. Specific serum IgG, IgM and IgA antibodies to human papillomavirus types 6, 11, 16, 18 and 31 virus-like particles in human immunodeficiency virus-seropositive women. The Journal of general virology 2000 Mar; 81(Pt 3): 701-708.  210. Bersell K, Arab S, Haring B, Kuhn B. Neuregulin1/ErbB4 signaling induces cardiomyocyte proliferation and repair of heart injury. Cell 2009 Jul 23; 138(2): 257-270. 112   211. Isoyama T, Kamoshita N, Yasui K, Iwai A, Shiroki K, Toyoda H, et al. Lower concentration of La protein required for internal ribosome entry on hepatitis C virus RNA than on poliovirus RNA. The Journal of general virology 1999 Sep; 80 ( Pt 9): 2319-2327.  212. Britsch S. The neuregulin-I/ErbB signaling system in development and disease. Advances in anatomy, embryology, and cell biology 2007; 190: 1-65.  213. Meyer D, Birchmeier C. Distinct isoforms of neuregulin are expressed in mesenchymal and neuronal cells during mouse development. Proceedings of the National Academy of Sciences of the United States of America 1994 Feb 1; 91(3): 1064-1068.  214. Cote GM, Miller TA, Lebrasseur NK, Kuramochi Y, Sawyer DB. Neuregulin-1alpha and beta isoform expression in cardiac microvascular endothelial cells and function in cardiac myocytes in vitro. Experimental cell research 2005 Nov 15; 311(1): 135-146.  215. Montero JC, Yuste L, Diaz-Rodriguez E, Esparis-Ogando A, Pandiella A. Differential shedding of transmembrane neuregulin isoforms by the tumor necrosis factor-alpha-converting enzyme. Molecular and cellular neurosciences 2000 Nov; 16(5): 631-648.  216. Lee KF, Simon H, Chen H, Bates B, Hung MC, Hauser C. Requirement for neuregulin receptor erbB2 in neural and cardiac development. Nature 1995 Nov 23; 378(6555): 394-398.  217. Meyer D, Birchmeier C. Multiple essential functions of neuregulin in development. Nature 1995 Nov 23; 378(6555): 386-390.  218. Gassmann M, Casagranda F, Orioli D, Simon H, Lai C, Klein R, et al. Aberrant neural and cardiac development in mice lacking the ErbB4 neuregulin receptor. Nature 1995 Nov 23; 378(6555): 390-394.  219. Miao W, Luo Z, Kitsis RN, Walsh K. Intracoronary, adenovirus-mediated Akt gene transfer in heart limits infarct size following ischemia-reperfusion injury in vivo. Journal of molecular and cellular cardiology 2000 Dec; 32(12): 2397-2402.  220. Fukazawa R, Miller TA, Kuramochi Y, Frantz S, Kim YD, Marchionni MA, et al. Neuregulin-1 protects ventricular myocytes from anthracycline-induced apoptosis via erbB4-dependent activation of PI3-kinase/Akt. Journal of molecular and cellular cardiology 2003 Dec; 35(12): 1473-1479.  221. Matsui T, Li L, del Monte F, Fukui Y, Franke TF, Hajjar RJ, et al. Adenoviral gene transfer of activated phosphatidylinositol 3'-kinase and Akt inhibits apoptosis of hypoxic cardiomyocytes in vitro. Circulation 1999 Dec 7; 100(23): 2373-2379.  113  222. Mansour H, de Tombe PP, Samarel AM, Russell B. Restoration of resting sarcomere length after uniaxial static strain is regulated by protein kinase Cepsilon and focal adhesion kinase. Circulation research 2004 Mar 19; 94(5): 642-649.  223. Kuppuswamy D. Importance of integrin signaling in myocyte growth and survival. Circulation research 2002 Jun 28; 90(12): 1240-1242.  224. Peng X, Kraus MS, Wei H, Shen TL, Pariaut R, Alcaraz A, et al. Inactivation of focal adhesion kinase in cardiomyocytes promotes eccentric cardiac hypertrophy and fibrosis in mice. The Journal of clinical investigation 2006 Jan; 116(1): 217-227.  225. Peng X, Wu X, Druso JE, Wei H, Park AY, Kraus MS, et al. Cardiac developmental defects and eccentric right ventricular hypertrophy in cardiomyocyte focal adhesion kinase (FAK) conditional knockout mice. Proceedings of the National Academy of Sciences of the United States of America 2008 May 6; 105(18): 6638-6643.  226. Ky B, Kimmel SE, Safa RN, Putt ME, Sweitzer NK, Fang JC, et al. Neuregulin-1 beta is associated with disease severity and adverse outcomes in chronic heart failure. Circulation 2009 Jul 28; 120(4): 310-317.  227. Fang SJ, Wu XS, Han ZH, Zhang XX, Wang CM, Li XY, et al. Neuregulin-1 preconditioning protects the heart against ischemia/reperfusion injury through a PI3K/Akt-dependent mechanism. Chinese medical journal 2010 Dec; 123(24): 3597-3604.  228. Sawyer DB, Caggiano A. Neuregulin-1beta for the treatment of systolic heart failure. Journal of molecular and cellular cardiology 2011 Oct; 51(4): 501-505.  229. Liu X, Gu X, Li Z, Li X, Li H, Chang J, et al. Neuregulin-1/erbB-activation improves cardiac function and survival in models of ischemic, dilated, and viral cardiomyopathy. Journal of the American College of Cardiology 2006 Oct 3; 48(7): 1438-1447.  230. Xu Y, Li X, Liu X, Zhou M. Neuregulin-1/ErbB signaling and chronic heart failure. Advances in pharmacology 2010; 59: 31-51.  231. Gao R, Zhang J, Cheng L, Wu X, Dong W, Yang X, et al. A Phase II, randomized, double-blind, multicenter, based on standard therapy, placebo-controlled study of the efficacy and safety of recombinant human neuregulin-1 in patients with chronic heart failure. Journal of the American College of Cardiology 2010 May 4; 55(18): 1907-1914.  232. Zhao YY, Sawyer DR, Baliga RR, Opel DJ, Han X, Marchionni MA, et al. Neuregulins promote survival and growth of cardiac myocytes. Persistence of ErbB2 and ErbB4 expression in neonatal and adult ventricular myocytes. The Journal of biological chemistry 1998 Apr 24; 273(17): 10261-10269.  114  233. Russell KS, Stern DF, Polverini PJ, Bender JR. Neuregulin activation of ErbB receptors in vascular endothelium leads to angiogenesis. The American journal of physiology 1999 Dec; 277(6 Pt 2): H2205-2211.  234. Pentassuglia L, Sawyer DB. The role of Neuregulin-1beta/ErbB signaling in the heart. Experimental cell research 2009 Feb 15; 315(4): 627-637.  235. Garcia-Rivello H, Taranda J, Said M, Cabeza-Meckert P, Vila-Petroff M, Scaglione J, et al. Dilated cardiomyopathy in Erb-b4-deficient ventricular muscle. American journal of physiology Heart and circulatory physiology 2005 Sep; 289(3): H1153-1160.  236. Rohrbach S, Niemann B, Silber RE, Holtz J. Neuregulin receptors erbB2 and erbB4 in failing human myocardium -- depressed expression and attenuated activation. Basic research in cardiology 2005 May; 100(3): 240-249.  237. Weingarten-Gabbay S, Khan D, Liberman N, Yoffe Y, Bialik S, Das S, et al. The translation initiation factor DAP5 promotes IRES-driven translation of p53 mRNA. Oncogene 2014 Jan 30; 33(5): 611-618.  238. Fung G, Ng CS, Zhang J, Shi J, Wong J, Piesik P, et al. Production of a dominant-negative fragment due to G3BP1 cleavage contributes to the disruption of mitochondria-associated protective stress granules during CVB3 infection. Plos One 2013; 8(11): e79546.  239. Liu Z, Zhang HM, Yuan J, Lim T, Sall A, Taylor GA, et al. Focal adhesion kinase mediates the interferon-gamma-inducible GTPase-induced phosphatidylinositol 3-kinase/Akt survival pathway and further initiates a positive feedback loop of NF-kappaB activation. Cellular microbiology 2008 Sep; 10(9): 1787-1800.  240. Hofmann WA, de Lanerolle P. Nuclear actin: to polymerize or not to polymerize. The Journal of cell biology 2006 Feb 13; 172(4): 495-496.  241. McDonald D, Carrero G, Andrin C, de Vries G, Hendzel MJ. Nucleoplasmic beta-actin exists in a dynamic equilibrium between low-mobility polymeric species and rapidly diffusing populations. The Journal of cell biology 2006 Feb 13; 172(4): 541-552.  242. Walker SR, Nelson EA, Frank DA. STAT5 represses BCL6 expression by binding to a regulatory region frequently mutated in lymphomas. Oncogene 2007 Jan 11; 26(2): 224-233.  243. Sall A, Zhang HM, Qiu D, Liu Z, Yuan J, Liu Z, et al. Pro-apoptotic activity of mBNIP-21 depends on its BNIP-2 and Cdc42GAP homology (BCH) domain and is enhanced by coxsackievirus B3 infection. Cellular microbiology 2010 May 1; 12(5): 599-614.  244. Pokrovskaja K, Okan I, Kashuba E, Lowbeer M, Klein G, Szekely L. Epstein-Barr virus infection and mitogen stimulation of normal B cells induces wild-type p53 without 115  subsequent growth arrest or apoptosis. The Journal of general virology 1999 Apr; 80 ( Pt 4): 987-995.  245. Yang D, Wilson JE, Anderson DR, Bohunek L, Cordeiro C, Kandolf R, et al. In vitro mutational and inhibitory analysis of the cis-acting translational elements within the 5' untranslated region of coxsackievirus B3: potential targets for antiviral action of antisense oligomers. Virology 1997 Feb 3; 228(1): 63-73.  246. Virgili G, Frank F, Feoktistova K, Sawicki M, Sonenberg N, Fraser CS, et al. Structural analysis of the DAP5 MIF4G domain and its interaction with eIF4A. Structure 2013 Apr 2; 21(4): 517-527.  247. Liberman N, Dym O, Unger T, Albeck S, Peleg Y, Jacobovitch Y, et al. The crystal structure of the C-terminal DAP5/p97 domain sheds light on the molecular basis for its processing by caspase cleavage. Journal of molecular biology 2008 Nov 14; 383(3): 539-548.  248. Yamanaka S, Zhang XY, Maeda M, Miura K, Wang S, Farese RV, Jr., et al. Essential role of NAT1/p97/DAP5 in embryonic differentiation and the retinoic acid pathway. The EMBO journal 2000 Oct 16; 19(20): 5533-5541.  249. Lamphear BJ, Rhoads RE. A single amino acid change in protein synthesis initiation factor 4G renders cap-dependent translation resistant to picornaviral 2A proteases. Biochemistry 1996 Dec 10; 35(49): 15726-15733.  250. Svitkin YV, Gradi A, Imataka H, Morino S, Sonenberg N. Eukaryotic initiation factor 4GII (eIF4GII), but not eIF4GI, cleavage correlates with inhibition of host cell protein synthesis after human rhinovirus infection. Journal of virology 1999 Apr; 73(4): 3467-3472.  251. de Breyne S, Bonderoff JM, Chumakov KM, Lloyd RE, Hellen CU. Cleavage of eukaryotic initiation factor eIF5B by enterovirus 3C proteases. Virology 2008 Aug 15; 378(1): 118-122.  252. Belsham GJ, McInerney GM, Ross-Smith N. Foot-and-mouth disease virus 3C protease induces cleavage of translation initiation factors eIF4A and eIF4G within infected cells. Journal of virology 2000 Jan; 74(1): 272-280.  253. Fung G, Shi J, Deng H, Hou J, Wang C, Hong A, et al. Cytoplasmic translocation, aggregation, and cleavage of TDP-43 by enteroviral proteases modulate viral pathogenesis. Cell Death Differ 2015 May 15.  254. Carthy CM, Granville DJ, Watson KA, Anderson DR, Wilson JE, Yang D, et al. Caspase activation and specific cleavage of substrates after coxsackievirus B3-induced cytopathic effect in HeLa cells. Journal of virology 1998 Sep; 72(9): 7669-7675.  116  255. Kerekatte V, Keiper BD, Badorff C, Cai A, Knowlton KU, Rhoads RE. Cleavage of Poly(A)-binding protein by coxsackievirus 2A protease in vitro and in vivo: another mechanism for host protein synthesis shutoff? Journal of virology 1999 Jan; 73(1): 709-717.  256. Kahvejian A, Svitkin YV, Sukarieh R, M'Boutchou MN, Sonenberg N. Mammalian poly(A)-binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms. Genes & development 2005 Jan 1; 19(1): 104-113.  257. Kuyumcu-Martinez NM, Van Eden ME, Younan P, Lloyd RE. Cleavage of poly(A)-binding protein by poliovirus 3C protease inhibits host cell translation: a novel mechanism for host translation shutoff. Molecular and cellular biology 2004 Feb; 24(4): 1779-1790.  258. Nevins TA, Harder ZM, Korneluk RG, Holcik M. Distinct regulation of internal ribosome entry site-mediated translation following cellular stress is mediated by apoptotic fragments of eIF4G translation initiation factor family members eIF4GI and p97/DAP5/NAT1. The Journal of biological chemistry 2003 Feb 7; 278(6): 3572-3579.  259. Parrillo JE, Aretz HT, Palacios I, Fallon JT, Block PC. The results of transvenous endomyocardial biopsy can frequently be used to diagnose myocardial diseases in patients with idiopathic heart failure. Endomyocardial biopsies in 100 consecutive patients revealed a substantial incidence of myocarditis. Circulation 1984 Jan; 69(1): 93-101.  260. Hanson PJ, Zhang HM, Hemida MG, Ye X, Qiu Y, Yang D. IRES-Dependent Translational Control during Virus-Induced Endoplasmic Reticulum Stress and Apoptosis. Frontiers in microbiology 2012; 3: 92.  261. Montero H, Garcia-Roman R, Mora SI. eIF4E as a control target for viruses. Viruses 2015 Feb; 7(2): 739-750.  262. Kleijn M, Vrins CL, Voorma HO, Thomas AA. Phosphorylation state of the cap-binding protein eIF4E during viral infection. Virology 1996 Mar 15; 217(2): 486-494.  263. Walsh D, Mathews MB, Mohr I. Tinkering with translation: protein synthesis in virus-infected cells. Cold Spring Harbor perspectives in biology 2013 Jan; 5(1): a012351.  264. Ponting CP. Novel eIF4G domain homologues linking mRNA translation with nonsense-mediated mRNA decay. Trends in biochemical sciences 2000 Sep; 25(9): 423-426.  265. Pestova TV, Shatsky IN, Hellen CU. Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. Molecular and cellular biology 1996 Dec; 16(12): 6870-6878.  117  266. Lomakin IB, Hellen CU, Pestova TV. Physical association of eukaryotic initiation factor 4G (eIF4G) with eIF4A strongly enhances binding of eIF4G to the internal ribosomal entry site of encephalomyocarditis virus and is required for internal initiation of translation. Molecular and cellular biology 2000 Aug; 20(16): 6019-6029.  267. Rogers GW, Jr., Richter NJ, Lima WF, Merrick WC. Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F. The Journal of biological chemistry 2001 Aug 17; 276(33): 30914-30922.  268. Oberer M, Marintchev A, Wagner G. Structural basis for the enhancement of eIF4A helicase activity by eIF4G. Genes & development 2005 Sep 15; 19(18): 2212-2223.  269. Ohlmann T, Rau M, Pain VM, Morley SJ. The C-terminal domain of eukaryotic protein synthesis initiation factor (eIF) 4G is sufficient to support cap-independent translation in the absence of eIF4E. The EMBO journal 1996 Mar 15; 15(6): 1371-1382.  270. Frank F, Virgili G, Sonenberg N, Nagar B. Crystallization and preliminary X-ray diffraction analysis of the MIF4G domain of DAP5. Acta crystallographica Section F, Structural biology and crystallization communications 2010 Jan 1; 66(Pt 1): 15-19.  271. Imataka H, Sonenberg N. Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. Molecular and cellular biology 1997 Dec; 17(12): 6940-6947.  272. de Breyne S, Yu Y, Unbehaun A, Pestova TV, Hellen CU. Direct functional interaction of initiation factor eIF4G with type 1 internal ribosomal entry sites. Proceedings of the National Academy of Sciences of the United States of America 2009 Jun 9; 106(23): 9197-9202.  273. Padrick SB, Deka RK, Chuang JL, Wynn RM, Chuang DT, Norgard MV, et al. Determination of protein complex stoichiometry through multisignal sedimentation velocity experiments. Analytical biochemistry 2010 Dec 1; 407(1): 89-103.  274. Etchison D, Milburn SC, Edery I, Sonenberg N, Hershey JW. Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eucaryotic initiation factor 3 and a cap binding protein complex. The Journal of biological chemistry 1982 Dec 25; 257(24): 14806-14810.  275. Ho BC, Yu SL, Chen JJ, Chang SY, Yan BS, Hong QS, et al. Enterovirus-induced miR-141 contributes to shutoff of host protein translation by targeting the translation initiation factor eIF4E. Cell host & microbe 2011 Jan 20; 9(1): 58-69.  276. Li X, Li Z, Zhou W, Xing X, Huang L, Tian L, et al. Overexpression of 4EBP1, p70S6K, Akt1 or Akt2 differentially promotes Coxsackievirus B3-induced apoptosis in HeLa cells. Cell death & disease 2013; 4: e803-809. 118   277. Asano K, Krishnamoorthy T, Phan L, Pavitt GD, Hinnebusch AG. Conserved bipartite motifs in yeast eIF5 and eIF2Bepsilon, GTPase-activating and GDP-GTP exchange factors in translation initiation, mediate binding to their common substrate eIF2. The EMBO journal 1999 Mar 15; 18(6): 1673-1688.  278. Bellsolell L, Cho-Park PF, Poulin F, Sonenberg N, Burley SK. Two structurally atypical HEAT domains in the C-terminal portion of human eIF4G support binding to eIF4A and Mnk1. Structure 2006 May; 14(5): 913-923.  279. Ozpolat B, Akar U, Zorrilla-Calancha I, Vivas-Mejia P, Acevedo-Alvarez M, Lopez-Berestein G. Death-associated protein 5 (DAP5/p97/NAT1) contributes to retinoic acid-induced granulocytic differentiation and arsenic trioxide-induced apoptosis in acute promyelocytic leukemia. Apoptosis : an international journal on programmed cell death 2008 Jul; 13(7): 915-928.  280. Zhang HM, Qiu Y, Ye X, Hemida MG, Hanson P, Yang D. P58(IPK) inhibits coxsackievirus-induced apoptosis via the PI3K/Akt pathway requiring activation of ATF6a and subsequent upregulation of mitofusin 2. Cellular microbiology 2014 Mar; 16(3): 411-424.  281. Cautain B, Hill R, de Pedro N, Link W. Components and regulation of nuclear transport processes. FEBS J 2015 Feb; 282(3): 445-462.  282. Goldberg MW, Allen TD. The nuclear pore complex: three-dimensional surface structure revealed by field emission, in-lens scanning electron microscopy, with underlying structure uncovered by proteolysis. Journal of cell science 1993 Sep; 106 ( Pt 1): 261-274.  283. Powers MA, Macaulay C, Masiarz FR, Forbes DJ. Reconstituted nuclei depleted of a vertebrate GLFG nuclear pore protein, p97, import but are defective in nuclear growth and replication. The Journal of cell biology 1995 Mar; 128(5): 721-736.  284. Panda D, Gold B, Tartell MA, Rausch K, Casas-Tinto S, Cherry S. The transcription factor FoxK participates with Nup98 to regulate antiviral gene expression. mBio 2015; 6(2).  285. Ray PS, Das S. La autoantigen is required for the internal ribosome entry site-mediated translation of Coxsackievirus B3 RNA. Nucleic Acids Res 2002 Oct 15; 30(20): 4500-4508.  286. Stoneley M, Willis AE. Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression. Oncogene 2004 Apr 19; 23(18): 3200-3207.  119  287. Fitzgerald KD, Chase AJ, Cathcart AL, Tran GP, Semler BL. Viral proteinase requirements for the nucleocytoplasmic relocalization of cellular splicing factor SRp20 during picornavirus infections. Journal of virology 2013 Mar; 87(5): 2390-2400.  288. Schwartz M, Chen J, Lee WM, Janda M, Ahlquist P. Alternate, virus-induced membrane rearrangements support positive-strand RNA virus genome replication. Proceedings of the National Academy of Sciences of the United States of America 2004 Aug 3; 101(31): 11263-11268.  289. Neufeldt CJ, Joyce MA, Levin A, Steenbergen RH, Pang D, Shields J, et al. Hepatitis C Virus-Induced Cytoplasmic Organelles Use the Nuclear Transport Machinery to Establish an Environment Conducive to Virus Replication. Plos Pathog 2013 Oct; 9(10).  290. Robertson JS, Etchison JR, Summers DF. Comparison of the oligosaccharide structure of the glycoprotein of vesicular stomatitis virus and a thermolabile mutant (tl-17). The Journal of general virology 1982 Jan; 58 Pt 1: 13-23.  291. Galindo CL, Ryzhov S, Sawyer DB. Neuregulin as a heart failure therapy and mediator of reverse remodeling. Curr Heart Fail Rep 2014 Mar; 11(1): 40-49.  292. Brunner M, Peng X, Liu GX, Ren XQ, Ziv O, Choi BR, et al. Mechanisms of cardiac arrhythmias and sudden death in transgenic rabbits with long QT syndrome. The Journal of clinical investigation 2008 Jun; 118(6): 2246-2259.  293. Cui W, Tao J, Wang Z, Ren M, Zhang Y, Sun Y, et al. Neuregulin1beta1 antagonizes apoptosis via ErbB4-dependent activation of PI3-kinase/Akt in APP/PS1 transgenic mice. Neurochemical research 2013 Nov; 38(11): 2237-2246.  294. Woo RS, Lee JH, Yu HN, Song DY, Baik TK. Expression of ErbB4 in the neurons of Alzheimer's disease brain and APP/PS1 mice, a model of Alzheimer's disease. Anatomy & cell biology 2011 Jun; 44(2): 116-127.  295. Taylor LA, Carthy CM, Yang D, Saad K, Wong D, Schreiner G, et al. Host gene regulation during coxsackievirus B3 infection in mice: assessment by microarrays. Circulation research 2000 Aug 18; 87(4): 328-334.  296. Panda D, Pascual-Garcia P, Dunagin M, Tudor M, Hopkins KC, Xu J, et al. Nup98 promotes antiviral gene expression to restrict RNA viral infection in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 2014 Sep 16; 111(37): E3890-3899.  297. Marissen WE, Lloyd RE. Eukaryotic translation initiation factor 4G is targeted for proteolytic cleavage by caspase 3 during inhibition of translation in apoptotic cells. Molecular and cellular biology 1998 Dec; 18(12): 7565-7574.  120  298. Vidal GA, Naresh A, Marrero L, Jones FE. Presenilin-dependent gamma-secretase processing regulates multiple ERBB4/HER4 activities. The Journal of biological chemistry 2005 May 20; 280(20): 19777-19783.    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0300023/manifest

Comment

Related Items