UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and analysis of E3 ligases and helper NLRs in plant immunity Tong, Meixuezi 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_may_tong_meixuezi.pdf [ 7.37MB ]
Metadata
JSON: 24-1.0229563.json
JSON-LD: 24-1.0229563-ld.json
RDF/XML (Pretty): 24-1.0229563-rdf.xml
RDF/JSON: 24-1.0229563-rdf.json
Turtle: 24-1.0229563-turtle.txt
N-Triples: 24-1.0229563-rdf-ntriples.txt
Original Record: 24-1.0229563-source.json
Full Text
24-1.0229563-fulltext.txt
Citation
24-1.0229563.ris

Full Text

IDENTIFICATION AND ANALYSIS OF E3 LIGASES AND HELPER NLRS IN PLANT IMMUNITY by Meixuezi Tong B. Sc., Northwest A&F University, 2011 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Botany) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2016 © Meixuezi Tong, 2016 	  	  ii	   Abstract Plant immunity is usually initiated with two types of immune receptors: 1) pattern recognition receptors (PRRs) recognize the conserved molecular features of pathogens (pathogen-associated molecular patterns, PAMPs) and trigger PTI (PAMP-triggered immunity) and; 2) nucleotide-binding/leucine-rich repeats (NLRs) serve as intracellular immune receptors with the ability to recognize the presence of relatively diverse pathogen effectors and trigger ETI (effector-triggered immunity). The Arabidopsis thaliana mutant snc1 contains a gain-of-function mutation in a Toll/interleukin-1 (TIR)-type NLR (TNL) gene and displays a dwarf morphology. Here, I report on the results of a snc1-influencing plant E3 ligase reverse genetic (SNIPER) screen that looked for snc1 plants with altered dwarfism in the presence of overexpressed E3 ligases. Six SNIPER genes were identified with four snc1-suppressors and two snc1-enhancers. SNIPER1/2/3 were selected for further characterization. The analysis of SNIPER1/2 is incomplete, thus is not included in this thesis.          Chapter 3 describes SNIPER3, previously known as SAUL1 (Senescence-Associated E3 Ubiquitin Ligase 1) or PUB44 (Plant U-box 44), which encodes a U-box-type E3 ligase. Our data suggests that SAUL1 plays a dual role in plant immunity: on one hand, SAUL1 positively regulates basal resistance; on the other hand, SAUL1 suppresses a typical TNL immune receptor SUSA1 (Suppressor of saul1) to prevent its autoimmunity.      ADR1, ADR1-L1 and ADR1-L2 are three homologous coiled-coil (CC)-type NLRs (CNLs), which were previously shown to work as helper NLRs. Chapter 4 further explores the specificity of the genetic requirement of ADR1s for typical TNLs, SNC1 and CHS2 (CHILLING SENSITIVE 2). Among the three ADR1 members, ADR1 is the leading contributor while ADR1-L1 is the least. Moreover, loss-of-function mutation of ADR1-L1 leads to over compensation of the transcript expression level of ADR1 and ADR1-L2 and results in the enhancement of snc1-mediated immunity. 	  	  iii	      Overall, the studies I completed as part of my Ph.D. thesis expand our knowledge of the roles of E3 ligases and ADR1s in plant defense and help us to better understand the sophisticated regulatory mechanisms of plant innate immunity.   	  	  iv	  Preface The chapters reported in this Ph.D. thesis describe the research results collected from January 2012 through January 2016. Below is a list of manuscripts (published or in revision) and the author contributions that comprise this thesis. Chapter 2 - A reverse genetic screen looking for key E3 ubiquitin ligases involved in plant immunity • The candidate performed most of the experiments under the supervision of Li X. Zhang Y. analyzed microarray data and selected the list of E3 ligase genes for the SNIPER screen. Zhu C. generated 35S::SNIPER2 transgenic lines in snc1 background. Kapos P. provided pathogen infection data of 35S::SNIPER4/5 plants.  Chapter 3 - E3 ligase SAUL1 serves as a positive immune regulator guarded by a TNL receptor SUSA1 was modified from the manuscript: Tong, M. *; Koturc, T. *; Li, Y.; Vogelmann, K.; Kleine, T.; Leister, D.; Zhang, Y.; Hoth, S.; Li, X. E3 ligase SAUL1 serves as a positive immune regulator guarded by a TNL receptor SUSA1.  • The candidate performed most of the experiments and wrote the manuscript under the supervision of Li X. The saul1 suppressor screens were performed in two independent labs: one by the candidate under the supervision of Li X., the other by Koturc T., Vogelmann K., Kleine T., Leister D. under the supervision of Hoth S. Li Y. analyzed the whole genome sequencing data of saul1 susa1 mutants. Koturc T., Vogelmann K., Kleine T., Leister D. contributed the subcellular localization figure of SUSA1. Zhang Y. selected the list of E3 ligase genes for the SNIPER screen.    Chapter 4 - ADR1 family is required for the signalling of typical TNL-mediated immunity in Arabidopsis was modified from the manuscript: 	  	  v	  Dong, O. *; Tong, M. *; Bonardi, V.; Kasmi, F.; Woloshen, V.; Wünsch, L.; Dangl, J.; Li, X. TNL-mediated immunity in Arabidopsis requires complex transcriptional regulation of the redundant ADR1 gene family. (* Co-first authors) New Phytologist. 2016; doi:10.1111/nph.13821. • The candidate generated and phenotypically assayed the collection of all combinatorial double, triple and quadruple adr1 snc1 mutants. The candidate generated Figure 2d and Figure 6 under the supervision of Li X. Bonardi V., Kasmi F. and Wünsch L. generated the Figure 4.4 and 4.5 under the supervision of Dangl. J. Dong O. and Li X. wrote the manuscript. All the other co-authors edited the manuscript.   	  	  vi	  Table of contents  Abstract .................................................................................................................................... ii Preface ..................................................................................................................................... iv Table of contents .................................................................................................................... vi List of tables ........................................................................................................................... ix List of figures ........................................................................................................................... x List of abbreviations ............................................................................................................. xii Acknowledgements ............................................................................................................ xviii 1 Introduction ...................................................................................................................... 1 1.1 Host and non-host resistance ................................................................................................. 1 1.2 Non-host resistance ................................................................................................................. 1 1.3 Two forms of innate immunity mediated by two types of immune receptors ................... 2 1.3.1 Perception of pathogen presence by PRRs ......................................................................... 3 1.3.2 PRR signalling events ........................................................................................................ 3 1.3.3 Pathogen effectors perturbing plant immunity ................................................................... 6 1.3.4 Gene-for-gene concept ....................................................................................................... 6 1.3.5 NLR structure ..................................................................................................................... 7 1.3.6 Perception of pathogen’s presence by NLRs ..................................................................... 8 1.3.7 NLR homo- and hetero-dimerization ................................................................................. 8 1.3.8 Nuclear translocation of some NLRs ................................................................................. 9 1.3.9 Transcriptional controls by NLRs .................................................................................... 10 1.3.10 Plasma membrane localized CNLs ................................................................................ 11 1.4 Regulation of SNC1 by MOSes and MUSEs ...................................................................... 11 1.4.1 Transcriptional regulation of SNC1 ................................................................................. 12 1.4.2 SNC1 mRNA splicing and export .................................................................................... 13 1.4.3 Post-translational regulation: NLR’s protein stability is control by N-terminal acetylation and ubiquitination ......................................................................................................................... 14 1.5 Thesis objectives ................................................................................................................... 15 1.5.1 Identification and characterization of E3 ubiquitin ligases involved in plant immunity . 15 1.5.2 Studying the role and specificity of ADR1s in NLR signalling ....................................... 16 2 A reverse genetic screen looking for key E3 ubiquitin ligases involved in plant immunity ................................................................................................................................ 17 2.1 Summary ............................................................................................................................... 17 2.2 Introduction .......................................................................................................................... 17 2.3 Results .................................................................................................................................... 20 2.3.1 Primary screen .................................................................................................................. 20 	  	  vii	  2.3.2 Secondary screen: phenotypic and functional characterization of candidate SNIPERs .. 24 2.4 Discussion .............................................................................................................................. 28 3. E3 ligase SAUL1 serves as a positive immune regulator guarded by a TNL receptor SUSA1 .................................................................................................................................... 30 3.1 Summary ............................................................................................................................... 30 3.2 Introduction .......................................................................................................................... 31 3.3 Results .................................................................................................................................... 34 3.3.1 Overexpression of SAUL1 enhances snc1 and leads to autoimmunity in wild-type Col-0 34 3.3.2 Identification and molecular cloning of SUPPRESSOR OF SAUL1 1 (SUSA1) ............. 36 3.3.3 PAMP-triggered responses are impaired in saul1-1 susa1 pub43 triple mutant .............. 41 3.3.4 The autoimmune SAUL1 overexpression phenotypes are dependent on SUSA1. ............ 46 3.3.5 Subcellular localization of SUSA1 .................................................................................. 48 3.3.6 SAUL1 associates with SUSA1 in Nicotiana benthamiana ............................................ 51 3.3.7 The ubiquitination activity of SAUL1 is required for the saul1 phenotype and TN2 is not needed for the autoimmunity of saul1 .......................................................................................... 53 3.4 Discussion .............................................................................................................................. 57 3.5 Materials and methods ......................................................................................................... 64 3.5.1 Plant materials and growth conditions ............................................................................. 64 3.5.2 Plant materials and growth conditions ............................................................................. 64 3.5.3 Ethyl methanesulfonate (EMS) mutagenesis, saul1 suppressor screen and next generation sequencing (Li Lab) ...................................................................................................................... 64 3.5.4 EMS mutagenesis, suppressor screen, next generation sequencing (Hoth Lab) .............. 65 3.5.5 Infection assays ................................................................................................................ 66 3.5.6 Gene Expression Analysis ................................................................................................ 66 3.5.7 ROS Assay ....................................................................................................................... 67 3.5.8 Construction of plasmids .................................................................................................. 67 3.5.9 Transformation of yeast cells ........................................................................................... 69 3.5.10 Split-luciferase assay ..................................................................................................... 69 3.5.11 Protoplasts isolation ....................................................................................................... 70 3.5.12 Confocal laser scanning microscopy ............................................................................. 70 3.5.13 Transient protein expression and co-immunoprecipitation in N. benthamiana ............. 71 3.5.14 Isolation of total protein from N. benthamiana leaves .................................................. 71 3.5.15 SDS-PAGE and immunoblotting ................................................................................... 71 3.5.16 Accession numbers ........................................................................................................ 72 4. The ADR1 family is required for the signalling of typical TNL-mediated immunity in Arabidopsis1 ....................................................................................................................... 73 4.1 Summary ............................................................................................................................... 73 4.2 Introduction .......................................................................................................................... 74 4.3 Results .................................................................................................................................... 76 	  	  viii	  4.3.1 The ADR1 gene family is fully required for SNC1-mediated immunity ......................... 76 4.3.2 Genetic interplay among the three redundant ADR1 genes ............................................. 78 4.3.3 Loss of all three ADR members completely suppresses the phenotypes of the typical TNL CHS2, but not that of atypical NLRs: CHS3, SLH1 and UNI ....................................................... 80 4.4 Discussion .............................................................................................................................. 84 4.5 Materials and methods ......................................................................................................... 85 4.5.1 Plant materials used .......................................................................................................... 85 4.5.2 Growth conditions ............................................................................................................ 85 4.5.3 Plant genotyping ............................................................................................................... 85 4.5.4 Infection assay .................................................................................................................. 86 4.5.5 Total SA measurement ..................................................................................................... 86 4.5.6 RNA extraction and gene expression analyses ................................................................ 87 4.5.7 Protein extraction and western blot analysis .................................................................... 88 4.5.8 Transient protein expression and co-immunoprecipitation in N. benthamiana ............... 88 5. Discussion ....................................................................................................................... 89 5.1 A positive immune regulator SNIPER3/SAUL1 is guarded by a TNL immune receptor SUSA1 .............................................................................................................................................. 90 5.2 The ADR1 family acts downstream of typical TNLs ......................................................... 93 References .............................................................................................................................. 96   	  	  ix	  List of tables Table 2.1 A summary of SNIPER screen and their overexpression phenotypes in snc1.. 23	  	   	  	  	  x	  List of figures Figure 2.1 SNIPER screen strategy and two representative SNIPERs. .................................. 22	  Figure 2.2 Phenotypic characterization of representative transgenic lines of 35S::SNIPER1-6 in snc1 plants. ......................................................................................................................... 26	  Figure 2.3 Phenotypic characterization of representative transgenic lines of 35S::SNIPER1, 3-6 in Col-0 background. ........................................................................................................ 27	  Figure 3.1 Overexpression of SAUL1 enhances snc1 and confers autoimmunity in wild-type Col-0 background. .................................................................................................................. 35	  Figure 3.2 Characterization of saul1 suppressors. .................................................................. 39	  Figure 3.3 Amino acid sequence alignments of SUSA1 with SUSA1-like proteins and selected TNLs from Arabidopsis. ........................................................................................... 40	  Figure 3.4 Characterization of saul1-1 susa1 double and saul1-1 susa1-5 pub43 triple mutants. ................................................................................................................................... 43	  Figure 3.5. Amino acid alignment of full length SAUL1 and PUB43. .................................. 45	  Figure 3.6. The autoimmune SAUL1 overexpression phenotypes are dependent on SUSA1. 47	  Figure 3.7. Subcellular localization of GFP-SUSA1. ............................................................. 49	  Figure 3.8. The protein expression from full-length GFP-SUSA1 fusion gene and Colocalization of SAUL1 and SUSA1 in N. benthamiana. ..................................................... 50	  Figure 3.9. SUSA1 associates with SAUL1 in Nicotiana benthamiana. ............................... 52	  Figure 3.10. The E3 ligase activity is required for the autoimmunity of both the saul1-1 knockout and SAUL1 overexpression phenotypes; and TN2 is not required for saul1-mediated autoimmunity. ......................................................................................................................... 54	  Figure 3.11 Genomic arrangements of SUSA1, CHS1 and TN2. ............................................ 55	  Figure 3.12. A working model for SAUL1 and SUSA1 function. ......................................... 55	  Figure 3.13. PUB43 cannot complement saul1-1. .................................................................. 59	  Figure 3.14. SAUL1 does not target SUSA1 for degradation. ............................................... 62	  	  	  xi	  Figure 3.15. SUSA1 causes cell death when expressed in N. benthamiana. .......................... 63	  Figure 4.1 The ADR1 family is required for snc1-mediated immunity .................................. 77	  Figure 4.2 Characterization of combinatory mutants between snc1 and adr1s. ..................... 79	  Figure 4.3 adr1 triple mutant suppresses the autoimmune phenotypes of gain-of-function typical TNL mutants, but not others. ....................................................................................... 82	  Figure 4.4 Partial suppression of the uni-1D autoimmune pheonotypes by adr1 triple mutant. ................................................................................................................................................ 83	  	  	  xii	  List of abbreviations  35S  a very strong constitutive promoter found in Cauliflower mosaic virus (CaMV); the coefficient of sedimentation of viral transcript whose expression is naturally driven by this promoter is 35S  ABRC  Arabidopsis Biological Resource Center  ACT  Actin  ADP  Adenosine Di-Phosphate  ADR Activated Disease Resistance AFP Anti Fungal Protein ANOVA Analysis of Variance APC Anaphase-Promoting Complex ARF Auxin Responsive Transcription Factor ARM Armadillo ATP  Adenosine Tri-Phosphate  ATXR7 Arabidopsis Trithorax-related 7 Avr  Avirulent or Avirulence  AvrB  Avirulence protein B; an avirulence effector from Pseudomonas syringae pv. glycinea  Avr-Pita  Avirulence protein Pita; an avirulence effector from Magnaporthe grisea  AvrPto  Avirulence protein Pto; an avirulence protein from Pseudomonas syringae  AvrRpm1  Avirulence protein Rpm1; an avirulence protein isolated from Pseudomonas syringae pv. maculicola strain M2  AvrRps4  Avirulence protein Rps4; an avirulence protein isolated from Pseudomonas syringae pv. pisi  AvrRpt2  Avirulence protein Rpt2; an avirulence protein isolated from Pseudomonas syringae pv. tomato  Ax21  Activator of Xa21-mediated immunity  BAK1  Brassinosteroid Associated Kinase 1  BAT2 HLA-B ASSOCIATED TRANSCRIPT 2 Bgh Blumeria graminis f. sp. hordei  bHLH basic Helix-Loop-Helix BIK1 Botrytis-Induced Kinase 1 BLAST  Basic Local Alignment Search Tool  BTB Bric à Brac, Tramtrack, and Broad Complex CaMV Cauliflower Mosaic Virus Cas9 CRISPR-associated CC  Coiled-coil  	  	  xiii	  CDPK Calcium-Dependent Protein Kinase CERK1 Chitin Elicitor Receptor Kinase 1 CEBiP Chitin Elicitor Binding Protein CFU  Colony Forming Unit  ChIP Chromatin immunoprecipitation CHS Chilling-Sensitive COI1 Coronatine-Insensitive 1 Col  Columbia-0, an Arabidopsis ecotype; it is also referred as wild type in this thesis work  CPR1/CPR30  Constitutive Expresser of PR Genes 1; also known as Constitutive Expresser of PR Genes 30  CRISPR Clustered Regularly Interspaced Short Palindromic Repeats CSA Constitutive Shade-Avoidance 1 C terminal  Carboxyl terminal  Cul1  Cullin 1  Dex Dexamethasone DND1  Defense No Death 1  DND2  Defense No Death 2  E1  Ubiquitin-activating enzyme  E2  Ubiquitin-conjugating enzyme  E3  Ubiquitin ligase  EDS1  Enhanced Disease Susceptibility 1  EFR  EF-Tu receptor  EF-Tu  Bacterial Elongation Factor Tu  elf18/26  An N-acetylated peptide comprising the first 18/26 amino acids of bacterial elongation factor Tu  EMS  Ethyl methanesulfonate; a chemical mutagen  ETI  Effector-Triggered Immunity  Exo70 Exocyst subunit 70 FLAG  An epitope protein tag compose of a single or repeated DYKDDDDK sequence  flg22  Flagellin conserved domain 22  FLS2  FLAGELLIN-SENSITIVE 2  GFP  Green Fluorescent Protein  GR Glucocorticoid Receptor GSL Glucosinolate H3K4 Lysine 4 of Histone 3 H.a.  Hyaloperonospora arabidopsidis  HA  Hemagglutinin; an epitope protein tag compose of a single or repeated YPYDVPDYA sequence  HR  Hypersensitive Response  	  	  xiv	  HSP90  Heat Shock Protein 90  IAA Indole-3-Acetic Acid IP  Immunoprecipitation  IP-MS Immunoprecitpation-mass Spectrometry JA Jasmonic Acid JAZ JA-ZIM domain Ler  Landsberg erecta; an Arabidopsis ecotype  L  Flax NBS-LRR protein with specific recognition of AvrL from the flax rust fungus Melampsora lini  LORE Lipooligosaccharide-specific reduced elicitation LPS Lipopolysaccharide LRR  Leucine-rich Repeat  MAP  Mitogen-activated Protein  MG132  A proteasome inhibitor  MKP1  MAP Kinase Phosphatase 1  MLA Mildew A MOS  Modifier of snc1  MOS1  Modifier of snc1, 1; a BAT2 domain containing protein  MOS2  Modifier of snc1, 2; a G-patch and KOW domains containing protein  MOS3  Modifier of snc1, 3; also known as AtNup96 or SAR3  MOS4  Modifier of snc1, 4; a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2)  MOS5  Modifier of snc1, 5; also known as UBIQUITIN-ACTIVATING ENZYME 1 (UBA1), one of the two Arabidopsis Ubiquitin-activating enzymes  MOS6  Modifier of snc1, 6; also known as IMPORTIN ALPHA 3 (IMPA-3)  MOS7  Modifier of snc1, 7; homologous to human and Drosophila Nup88  MOS8  Modifier of snc1, 8; also known as ENHANCED RESPONSE TO ABA 1 (ERA1)  MOS9  Modifier of snc1, 9  MOS10  Modifier of snc1, 10; also known as Topless-Related 1 (TPR1)  MOS11  Modifier of snc1, 11; homologous to the human RNA binding protein CIP29  MOS12  Modifier of snc1, 12; an Arabidopsis cyclin L homolog  MOS14  Modifier of snc1, 14; a nuclear importer of serine-arginine rich (SR) proteins  MKS1 MAP kinase 4 substrate 1 MUSE  Mutant, snc1-enhancing Screen  MS medium  Murashige and Skoog medium; a plant growth medium  	  	  xv	  N  Nicotiana  NADPH Nicotinamide adenine dinucleotide phosphate NAIP Neuronal Apotopsis Inhibitory Protein Nat N-terminal Acetyltransferase NB-LRR  Nucleotide Binding-Leucine Rich Repeat  NDR1  Non-race Specific Disease Resistance 1  NLR  Nod-Like Receptor or nucleotide binding and leucine-rich repeat-containing R protein  NLRC4 Nod-Like receptor 4 NLS  Nuclear Localization Signal or Sequence  NOD  Nucleotide Oligomerization Domain  NPC Nuclear Pore Complex NPR1  NONEXPRESSER OF PR GENES 1  NRG N-Required Gene N terminal  Amino Terminal  Nup88  Nucleoporin 88kDa that functions in CRM1-Dependent Nuclear Protein Export  OD  Optical Density  ORF Open Reading Frame PAD PDR  Phytoalexin Deficient  Pleiotropic Drug Resistance	  SDS-PAGE  Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis  PAMP  Pathogen-Associated Molecular Pattern  PBS1 AvrPphB Susceptible 1 PBL PBS1-like PEN  Penetration Pita  Rice NBS-LRR protein confers resistance to Magnaporthe grisea that express Ave-Pita  PM  Plasma Membrane  PopP2  An avirulence effector from Ralstonia solanacearum  PP5 Protein Phosphatase 5 PR  Pathogenesis-related  PRR  Pattern Recognition Receptor  Psm  Pseudomonas syringae pv. maculicola  Pst Pseudomonas syringae pv. tomato PTI  PAMP-Triggered Immunity  Pto  Tomato R protein confers resistance to races of Pseudomonas syringae pv. tomato that carry the AvrPto  PUB Plant U-box pv  Pathovar  qRT-PCR  Quantitative Reverse Transcriptase PCR  	  	  xvi	  R  Resistance  RAR1  Required for MLA12 Resistance 1  Rax Required for Activation of XA21  RBOHD Respiratory Burst Oxidase Homolog D RIN4  RPM1-Interacting Protein 4  RING  Really Interesting New Gene  RLK  Receptor-Like Kinase  RLU Relative Light Units ROS  Reactive Oxygen Species  RPM1  Resistant to P. syringae pv maculicola 1  RPP4  Recognition of Peronospora parasitica 4  RPS2  Resistant to P. syringae 2  RPS4  Resistant to P. syringae 4 RPS5  Resistant to P. syringae 5 RRS1  Resistant to Ralstonia solanacearum 1; also known as AtWRKY52 or Sensitive to Low Humidity 1 (SLH1)  RT-PCR  Reverse Transcriptase PCR  RPW8 Resistance to Powdery Mildew 8 SA  Salicylic Acid  SAUL1 Senescence-Associated Ubiquitin Ligase 1 SERK Somatic Embryogenesis Receptor-like Kinase SCF  Skp1-Cullin-F-box  SD S-domain SGT1  Suppressor of G2 Allele of SKP1  SID2  SA Induction Deficient 2  SKP1  Suppressor of Kinetochore Protein 1  SNC1  Suppressor of npr1, Constitutive, 1  snc1-r1  the revertant mutant of snc1 that has 10 nucleotides deleted in the first exon of SNC1  SNIPER snc1-influencing plant E3 ligase reverse genetic SR  Serine-arginine Rich proteins  SRFR1  Suppressor of rps4-RLD 1  SUMM Suppressor of mkk1 mkk2 SUSA Suppressor of saul1 SYP Syntaxin of Plants T3SS Type III secretion system TALEN Transcription Activator-Like Effector Nuclease T-DNA  Transfer DNA  TIR  Toll/interleukin-1 Receptor or Transport Inhibitor Response TMV Tobacco Mosaic Virus TN TIR-NB 	  	  xvii	  TNL Toll/interleukin-1/nucleotide-binding/leucine-rich repeat TPL  TOPLESS  TPR1  TOPLESS-RELATED 1  Ub  Ubiquitin  UPS Ubiquitin-26S Proteasome System WT  Wild-type  Xa21  A rice resistance locus that confers disease resistance to Xanthomonas oryzae pv. oryzae  Xoo  Xanthomonas oryzae pv. oryzae    	  	  xviii	  Acknowledgements First and foremost, I would like to thank my supervisor Dr. Xin Li. Her dedication to science, kindness to people and efficiency at work has influenced me positively. Most importantly, she can always see the bright side of situations no matter how dire they are. It is her optimism that helped me navigate through all the difficulties in Science during my Ph.D. career. Moreover, her availability in the lab allowed me to discuss questions or to explore new puzzles efficiently with her whenever they arose. My projects would not have gone so smoothly without her supervision. I would also like to thank my committee members Dr. Lacey Samuels, Dr. Carl Douglas and Dr. Jim Kronstad for their advice and guidance during the course of my degree.     Special thanks also goes to past and current lab members. A big thank-you goes to Fang Xu, who taught me almost all the experimental techniques I needed when I first got started. I am also grateful for her companionship through all the ups and downs during the first three years of my graduate studies. Thanks to Yu Ti Cheng for being a reliable leader in the lab; I really miss the hiking trips and hotpot parties she organized and hosted. Thanks to Oliver Dong for always being delightful and responsible and for the tremendous efforts he put into the maintenance of the lab as a lab manager. Thanks to Kaeli Johnson, Kevin Ao, Charles Copeland and Paul Kapos for helping me edit my proposals, manuscripts and thesis. Thanks to Shuai Huang for helpful discussions on my experiments. Thanks to Jianhua Huang, a reliable friend who never said “no” when I asked for help. Thanks to Kevin Ao, Wanwan Liang and Zhongshou Wu, the three new graduate students in the lab, for taking over my projects and developing them further. Last but not least, I would also like to thank all the Zhang Lab members who provided me with lots of support and help that allowed me to finish my degree successfully.     I would like to express my appreciation for the financial support from Chinese Scholarship Council (CSC), Natural Sciences and Engineering Research Council of Canada 	  	  xix	  (NSERC), and the William Cooper Endowment Fund. I would also like to thank the UBC Botany Department for providing a teaching assistantship opportunity, from which I sincerely learned a lot.     Finally, I would like to give my sincerest thanks to my incredibly supportive family and friends, who always believe in me and have my back. My thesis could not have been completed without you by my side. It is your love and support that drove me through my Ph.D. years.	  	  1	  1 Introduction 1.1 Host and non-host resistance Plants are constantly confronted with pathogen attacks in nature. However, plant diseases are rare; most plants are healthy the majority of time.  This is because plants have evolved complicated mechanisms that form an immune system mainly composed of host and non-host disease resistance, in order to combat pathogens. Non-host resistance defines the non-specific, broad-spectrum resistance to almost all the microbial pathogens in plants; whereas host resistance describes the defense responses triggered by adapted pathogens, which are able to colonize the host plants. Host resistance often consists of two layers of immunity mediated by two different types of immune receptors: PAMP (pathogen-associated molecular pattern)-triggered immunity (PTI) mediated by membrane-localized PRRs (pattern recognition receptors) and effector triggered immunity (ETI) mediated by intracellular effector receptors NLRs (nucleotide-binding, leucine-rich repeats domains) (Jones and Dangl, 2006).  1.2 Non-host resistance The preformed structures present on plant surfaces, such as rigid cell walls, play a role in preventing the initial establishment of pathogen invasion (Heath, 2000). Additionally, components present in the apoplast: antimicrobial chemicals (reactive oxygen species, phytoalexins, etc.), proteins (defensins, PR-1, etc.), and enzymes (chitinase, beta-glucanases, etc.), compose a second chemical barrier to limit pathogen invasion (Heath, 2000). For example, the phytoalexin-deficient (pad) mutant pad3, which fails to produce the phytoalexin camalexin, was shown to display enhanced susceptibility to a necrotrophic fungal pathogen Alternaria brassicicola (Thomma et al., 1999). Moreover, overexpression of a radish defensin encoding gene Raphanus sativus-antifungal protein 2 (RsAFP2) in tobacco leads to 	  	  2	  increased resistance upon infection with the fungal pathogen Alternaria longipes (Broekaert et al., 1995). These examples suggest that antimicrobial molecules are crucial to inhibit pathogen growth. More mutant studies in the genetic dissection of non-host immunity using nonhost interaction between Arabidopsis and the grass powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh) uncovered three PENETRATION (PEN) genes: PEN1 (Collins et al., 2003), PEN2 (Lipka et al., 2005) and PEN3 (Stein et al., 2006). These studies further highlighted the importance of vesicle trafficking and the secretion of antimicrobial components in non-host resistance (Clay et al., 2009; Lu et al., 2015; Karnik et al., 2015).  PEN1/AtSYP121 encodes a syntaxin protein that is involved in SNARE (soluble NSF attachment protein receptor)-mediated membrane fusion events (Collins et al., 2003). PEN2 encodes an atypical beta-thioglucoside glucohydrolase that metabolizes indole glucosinolates (GSLs) to produce antimicrobials following pathogen attack (Clay et al., 2009; Bednarek et al., 2009). PEN3 is a pleiotropic drug resistance (PDR)-type ATP-binding cassette transporter to efflux molecules during defense responses (Collins et al., 2003; Lu et al., 2015). Although the precise role of each PEN gene in penetration resistance is unclear, it is hypothesized that PEN2 is involved in the production of antimicrobials like GSL, and PEN1 and PEN3 participate in exporting the antimicrobials extracellularly to inhibit pathogen infection (Stein et al., 2006; Lu et al., 2015).  1.3 Two forms of innate immunity mediated by two types of immune receptors Plants employ a two-layered immunity, mediated by two different types of immune receptors, against pathogen infection. Plasma membrane localized PRRs (Pattern Recognition Receptors) initiate the first layer of immunity by perception of conserved features of pathogens (known as Pathogen-Associated Molecular Patterns, PAMPs) called PAMP-triggered immunity (PTI). Pathogens, in order to overcome these primary lines of 	  	  3	  defense, evolved a repertoire of effector molecules to dampen PTI and to promote their own growth. Through the pathogen-host co-evolution process, plants developed a family of nucleotide-binding/leucine-rich-repeat (NLR) receptors that allows them to detect the presence of pathogen effectors and to trigger a more robust and sustained immune response, known as effector-triggered immunity (ETI) (Jones and Dangl, 2006).  1.3.1 Perception of pathogen presence by PRRs The entry of pathogens first triggers PTI responses through the recognition of PAMPs by PRRs. All PRRs are membrane-localized receptor-like kinases (RLKs) or Receptor-like Proteins (RLPs) depending on whether they have a C-terminal kinase domain. A typical RLK usually consists of an extracellular LRR domain, a transmembrane domain and an intracellular kinase domain. The well-known PRR examples are bacterial flagellin receptor FLS2 (Zipfel et al., 2004), bacterial Elongation Factor-Tu receptor EFR (Zipfel et al., 2006), and chitin receptor CERK1 (Arabidopsis) and CEBiP (rice) (Miya et al., 2007; Kaku et al., 2006).      Over 20 years ago, Ronald’s group first identified XA21, a RLK that confers resistance to Xanthomonas oryzae pv. oryzae (Xoo) (Song et al., 1995), but identification of the real corresponding ligand turned out to be a long journey. The previously published report of the type I-secreted sulphated protein Ax21 as the XA21 ligand in 2009 was retracted because of mislabelled Xoo strains (Lee et al., 2009). Six years later, the same group corrected their mistakes and identified the sulphated RaxX (required for activation of XA21, X), rather than Ax21, which is required for activation of XA21-mediated immunity (Pruitt et al., 2015).   1.3.2 PRR signalling events After elicitation by PAMPs, the plant cells undergo a series of rapid responses including 	  	  4	  bursts of calcium and reactive oxygen species (ROS), as well as activation of mitogen-associated kinases (MAPKs) and calcium-dependent protein kinases (CDPKs), leading to massive transcriptional programming (Nühse et al., 2000; Blume et al., 2000). The activation of PRRs FLS2 and EFR requires a family of small LRR-RLK SERK (SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE) proteins: BAK1/SERK3 and BKK1/SERK4 (Roux et al., 2011). Upon ligand perception, the SERKs rapidly form complexes with FLS2 and EFR, then trans-phosphorylate cytoplasmic kinase BIK1 (BOTRYTIS-INDUCED KINASE1) and its paralogous protein PBS1 (AvrPphB susceptible 1), PBL (PBS1-like)1 and PBL2 (Lu et al., 2010; Zhang et al., 2010). BIK1 and its paralogs subsequently transduce signals through phosphorylating their downstream targets. The ROS burst is an important immunity signalling output shared by different kingdoms and species. Extracellular ROS is proposed to act as a cross-linker of plant cell wall components, a direct anti-microbial agent, as well as a secondary messenger to trigger downstream immune responses (Lamb and Dixon, 1997). Generation of ROS bursts upon PAMP perception is through plasma-membrane localized NADPH oxidase respiratory burst oxidase homolog D (RBOHD) (Torres et al., 2005). Recent studies from Zipfel’s and Zhou’s groups have revealed that activation of ROBHD requires phosphorylation events by BIK1 upon elicitation by the PAMPs flg22 and elf18 (Kadota et al., 2014; Li et al., 2014). MAPK cascades act as conserved signalling modules downstream of PAMP elicitation. The Arabidopsis genome encodes approximately 60 MAP3Ks/MEKKs, 10 MAP2Ks/MKKs and 20 MAPKs (Ichimura et al., 2002). Genetic studies have proposed two MAPK cascades in PAMP-triggered immunity (PTI): MEKK1-MKK1/2-MPK4 and MEKK1-MKK4/5-MPK3/6 (Ichimura et al., 1998; Kiegerl, 2000; Yang et al., 2001). MPK3/6/4 are rapidly phosphorylated upon PAMP stimulation (Cardinale et al., 2000), but the molecular linkages between PRR receptors and MAPK cascades remain obscure. Yeast-two-hybrid screens have identified MAP kinase 4 substrate 1 (MKS1) and WRKY transcription factors WRKY25/WRKY33 as MPK4’s direct substrates (Andreasson et al., 	  	  5	  2005). It was proposed that MPK4 may complex with MKS1 to phosphorylate and activate transcription factors WRKY25 and WRKY33 to regulate transcription of defense related genes (Andreasson et al., 2005).      Loss of function mutants of MEKK1, MKK1 MKK2 double mutant, or MPK4 all exhibit similar dwarf phenotypes with enhanced defense responses, suggesting that the MEKK1-MKK1/2-MPK4 cascade negatively regulates plant immune responses (Petersen et al., 2000; Gao et al., 2008). A suppressor screen of mkk1 mkk2 double mutants revealed that the autoimmunity of the MPK cascade is inhibited by a signalling pathway which requires a MAP kinase kinase kinase MEKK2/SUMM1 (SUPPRESSOR OF mkk1 mkk2 1) and a nucleotide-binding/leucine-rich-repeat (NLR) protein SUMM2 (Kong et al., 2012; Zhang et al., 2012). It was hypothesized that MEKK2 monitors the intactness of MEKK1-MKK1/2-MPK4 cascade. The perturbation of MEKK1-MKK1/2-MPK4 cascade presumably by pathogen effectors can be sensed by MEKK2, which subsequently activates SUMM2-mediated defense responses (Kong et al., 2012; Zhang et al., 2012). The perception of PAMPs also triggers an influx of calcium ions, leading to an increase of intracellular calcium concentration. Even though the exact identity of the calcium channel in plants is not clear, it has been shown that plant calcium-dependent protein kinases (CDPKs, abbreviated as CPKs in Arabidopsis) are responsible for sensing intracellular calcium concentration changes and conducting signal transmissions by phosphorylation of their downstream substrates (Harmon et al., 2000; Kudla et al., 2010). In particular, Arabidopsis CPK5 was shown to directly phosphorylate NADPH oxidase RHOBD in a ligand-dependent manner, and thereby positive regulate the production of ROS upon pathogen infection (Dubiella et al., 2013). Moreover, CPK28 was identified as a negative regulator in PTI by directly binding and phosphorylating BIK1. The phosphorylation of BIK1 by CPK28 subsequently contribute to BIK1’s turnover (Monaghan et al., 2014). 	  	  6	  1.3.3 Pathogen effectors perturbing plant immunity The inhibition of pathogen growth by PTI imposes selective pressure on pathogens to overcome this layer of immunity. One successful strategy that adapted pathogens have employed is to use a large repertoire of effector molecules to suppress PAMP-triggered defenses. For example, Pseudomonas syringae effector AvrPto directly targets and inhibits the kinase activities of PRRs, including FLS2 and EFR, thus blocking PAMP-induced immunity in Arabidopsis (Xiang et al., 2008). Another well-known effector example is HopAI1. Previous studies have shown that plants expressing transgenic HopAI1 are able to inactivate MPK3 and MPK6 to promote virulence (Zhang et al., 2007). Moreover, MPK4 was shown to be an additional virulence target of HopAI1 in a more recent study (Zhang et al., 2012). A third effector example includes AvrPphB, a cysteine protease that cleaves the BIK1’ paralogous protein PBS1 to inhibit immune signal transduction (Shao et al., 2003). 1.3.4 Gene-for-gene concept In the 1940’s, H. H. Flor’s studies on the inheritance of pathogenicity of flax rust fungus yielded a gene-for-gene hypothesis which proposed that the resistant variant of the plant has a gene for resistance in correspondence to the avirulence gene of pathogens (Flor, 1971). Together, both the plant resistance (R) gene and pathogen avirulence (Avr) or effector gene determine the disease resistance specificity (Flor, 1971). Over the last century, numerous R genes have been cloned. Most of R genes were found to encode nucleotide-binding/leucine-rich-repeat (NLR) proteins. Genome-wide analysis has revealed that there are around 150 NLR coding genes in Arabidopsis, which mainly fall into two distinct groups: TIR-NB-LRR (TNL) group with an N-terminal Toll and interleukin-1 (TIR)-like domain, and CC-NB-LRR (CNL) group with an N-terminal coiled-coil domain (Meyers, 2003).  	  	  7	  1.3.5 NLR structure NLR proteins usually have a tri-domain structure, consisting of a nucleotide-binding (NB) domain, a C-terminal leucine-rich repeat (LRR) domain, and either a coiled-coil or a TIR-like domain at the N-terminus (Meyers, 2003). The presence of either a CC or TIR domain typically determines whether the NLR-mediated defense response requires NDR1 (Non-race-specific Disease Resistance) or the EDS1 (Enhanced Disease Susceptibility 1) / PAD4 (Phytoalexin Deficient 4) / SAG101 (Senescence Associated Gene 101) complex, respectively (Aarts et al., 1998). However, the detailed molecular linkages between these pathways remain elusive.  As NLR proteins are modular with multi-domains, it is important to know how individual sub-domains contribute to the functional roles of NLR proteins as pathogen sensors. Mutational analyses and domain-swap experiments revealed that the recognition of pathogen effectors is mainly determined by the LRR domain (Ravensdale et al., 2012; Krasileva et al., 2010). In the absence of the effectors, the NB domain interacts with the LRR domain, keeping the protein in an inactive conformation. Upon effector recognition, the NLR’s conformation undergoes a conformation change that allows the NB domain to exchange ADP with ATP, thereby activating nucleotide hydrolysis and triggering downstream signalling (Takken and Tameling, 2009). Besides the structural constraints that maintain the R protein conformation (Takken and Goverse, 2012), the chaperone SGT1/HSP90 (Heat Shock Protein 90) / RAR1 (Required for MLA12 Resistance 1) / PP5 (Protein Phosphatase 5) complex is required for the proper folding of R proteins. Reduced expression or activity of HSP90, RAR1 or PP5 compromises steady-state protein levels of many NLR proteins and results in enhanced disease susceptibility (Azevedo et al., 2002; Mauch et al., 2004; Holt III et al., 2005).  	  	  8	  1.3.6 Perception of pathogen’s presence by NLRs Plant NLRs act as intracellular immune receptors that recognize cytoplasmic effectors delivered by pathogens. The recognition could be direct or indirect depending on different effectors. As an example of direct recognition cases, rice NLR protein Pi-ta detects Avr-Pita effector of rice blast fungus, Magnaporthe grisea by direct protein-protein interaction revealed from a yeast-two-hybrid system and an in vitro binding assay (Jia et al., 2000). Flax TNL L5 and L6 recognize rust effector Avr567 by direct protein interaction (Dodds et al., 2006). However, more and more cases suggest that NLRs act by monitoring/guarding the target of pathogen effectors (guardees), rather than recognition through direct physical interaction. One well-studied guardee, RIN4 (RPM1-INTERACTING 4), is targeted by two unrelated P. syringae effectors AvrB and AvrRpm1, leading to phosphorylation of RIN4 which triggers the activation of NLR RPM1 (RESISTANCE TO P. SYRINGAE PV MACULICOLA 1) (Chung et al., 2011; Liu et al., 2011). Another P. syringe effector AvrRpt2 cleaves RIN4, activating RPS2 (RESISTANT TO P. SYRINGAE 2)-mediated immunity (Axtell and Staskawicz, 2003; Chung et al., 2011; Mackey et al., 2003).  Recognition of pathogen effectors by monitoring the effects of effectors (indirect recognition) rather than physical shapes of effectors (direct recognition) allows the plants to detect a wide variety of pathogen effectors with a limited number of NLR proteins. Thus, compared with direct recognition, indirect recognition could be a more efficient strategy employed by plants to combat pathogens through the arms race between them during the evolutionary time. 1.3.7 NLR homo- and hetero-dimerization NLRs were found to self-associate as oligomers after activation (Xu et al., 2014a; Maekawa 	  	  9	  et al., 2011; Ntoukakis et al., 2014). Disruption of self-association by site-directed mutations abolished the cell death mediated by NLRs (Maekawa et al., 2011), suggesting that self-association is critical for NLR signalling.  RRS1 is a TNL protein integrated with a WRKY domain as its recognition domain to detect bacterial effectors AvrRps4 and PopP2 (Sarris et al., 2015; Le Roux et al., 2015). Evidence has shown that RRS1 complexes with another TNL RPS4 through their TIR domain. The TIR domain heterodimerization is required for the recognition of the effectors AvrRps4 and PopP2 (Williams et al., 2014).  In mammalian immunity, NLRC4 (Nod-like receptor 4) associates with two independent immune receptors NAIP2 (neuronal apotopsis inhibitory protein 2) and NAIP5 upon PAMP perception (Kofoed and Vance, 2011). The heteromers then organize into the inflammasome to initiate innate immune responses by activating the caspase 1 protease (Schroder and Tschopp, 2010). This corroborating evidence from both plant and mammalian systems highlighted the importance of assembling heteromeric NLR complexes in innate immunity. 1.3.8 Nuclear translocation of some NLRs Recent studies have highlighted the significance of nuclear accumulation of various NLRs in immunity. For example, barley CNL mildew A (MLA1) and Arabidopsis TNL-WRKY RRS1 showed an increased nuclear accumulation upon pathogen perception (Shen et al., 2007; Tasset et al., 2010). Additionally, Arabidopsis TNL SNC1 was shown to only activate immunity after shuttling into the nucleus (Xu et al., 2014a). Conditionally retaining snc1 in the cytosol by fusion to a glucocorticoid receptor (GR) fully suppresses snc1 dwarfism (Xu et al., 2014a). In the absence of dexamethasone (DEX), the SNC1–GR fusion protein was expected to be sequestered by cytoplasmic HSP90/HSP70 chaperones (Pratt et al., 2001) and therefore inactive. Whereas DEX treatment releases snc1 to the nucleus, resulting in 	  	  10	  dwarfism and enhanced disease resistance (Xu et al., 2014a).  Further evidence implies that translocation of NLR proteins to the nucleus requires the nuclear pore complex (NPC). One of the core component of NPC: MOS7 (Modifier of snc1 7), which is homologous with Drosophila and human nucleoporin protein Nup88, plays a critical role in maintaining the nuclear pool of SNC1 (Cheng et al., 2009). Additionally, MOS6, which was identified from the same snc1 suppressor screen as MOS7, works as an importin alpha protein that could be involved in the recognition of nuclear-localization signal (NLS) peptides of SNC1 to translocate SNC1 to the nucleus (Palma et al., 2005). 1.3.9 Transcriptional controls by NLRs From the significance of nuclear localization of NLRs, it is speculated that these NLRs shuttling into the nucleus would function to regulate the expression of defense-related genes. Barley MLA gene encodes a barley CNL protein that confers resistance to barley powdery mildew pathogen Erysiphe graminis f. sp. hordei (Wei et al., 1999). It was found that MLA directly interacts with transcription repressors WRKY1 and WRKY2 to release their inhibition of defense transcriptional reprogramming (Shen et al., 2007). Moreover, one additional transcription factor MYB6 was identified from a yeast-two hybrid screen to be MLA’s direct interactor (Chang et al., 2013). MYB6 was shown to positively regulate basal defense and MLA-mediated immunity (Chang et al., 2013). After activation, MLA relocates to nucleus and releases WRKY1 repression of MYB6, thus initiating defense transcription (Chang et al., 2013).     More recent genetic and biochemical evidences have revealed several transcriptional regulators as nuclear targets of SNC1, which encodes a typical TNL in Arabidopsis. MOS10/TPR1 (Topless-related1) (Zhu et al., 2010) encodes a transcriptional co-repressor with high homology to TPR4 and TPL. The single mutant tpr1 partially suppresses the snc1 phenotype, and the combination of tpr1 tpr4 and tpl mutations completely suppresses the 	  	  11	  snc1 dwarfism and enhanced disease resistance, suggesting redundancy in the TPR family. Biochemical data revealed a physical association between TPR1 and SNC1, suggesting that SNC1 may activate defense response by regulating the transcriptional repression activity of TPR1 which suppresses the expression of negative regulators of immune responses (Zhu et al., 2010). Moreover, a reverse genetic screen has identified a bHLH (basic Helix-Loop-Helix) type transcription factor bHLH84 capable of physically associating with SNC1 (Xu et al., 2014b). bHLH84 triggers significantly enhanced immunity when it is overexpressed. The constitutive defense response conferred by ectopic expression of bHLH84 is partially lost when SNC1 is knocked-out (Xu et al., 2014b).      Collectively, this evidence suggested that some NLRs likely activate defense responses by translocating into the nucleus to modulate transcriptional regulators to confer immune responses. 1.3.10 Plasma membrane localized CNLs A number of Arabidopsis CNL proteins, such as RPM1, RPS2 and RPS5, were found to associate with the plasma membrane. So far, there is no evidence that these membrane-localized CNLs translocate to the nucleus. It is therefore an open question of how those CLRs transmit the signals into the nucleus. It is possible that the membrane localized CLRs may share common downstream pathways with PRRs to transduce signals. For example, RPS2 has been shown to activate MPK3/6 upon pathogen perception in a more sustained manner (Tsuda et al., 2013). MPK3/6 could further go to the nucleus to activate defense related transcription factors, such as WRKY33 to initiate defense transcription programming (Mao et al., 2011). 1.4 Regulation of SNC1 by MOSes and MUSEs SNC1 encodes a typical TNL that was identified through a suppressor screen of npr1 	  	  12	  (nonexpresser of PR gene 1) (Zhang et al., 2003b; Xu et al., 2014a). The mutant snc1 carries a glutamic acid to lysine gain-of-function mutation in the linker region between the NB and LRR domains (Zhang et al., 2003b). Recent evidence has shown that the point mutation stabilizes snc1 protein, increasing its steady state level (Cheng et al., 2011a). The subsequent over-accumulation of snc1 protein consequently results in constitutive activation of defense signal transduction with increased levels of SA, constitutive expression of PR genes, and increased resistance against virulent pathogens such as the bacterium Pseudomonas syringae pv. maculicola (P.s.m) ES4326 and the oomycete Hyaloperonospora arabidopsidis (H.a.) Noco2 (Zhang et al., 2003b). Furthermore, snc1 plants exhibit dwarf morphology without producing HR lesions, making this autoimmune mutant a powerful tool for genetic analysis without the interference of cell death.     Multiple forward genetics strategies have been employed in snc1 genetic screens in order to find both positive and negative regulators of SNC1-mediated immunity, allowing for the identification of a number of modifier of snc1 (mos) mutants (reviewed in Johnson et al., 2012) and mutant, snc1-enhancing (muse) mutants (Huang et al., 2013; Li et al., 2015), respectively. Characterization of these MOS and MUSE genes revealed a series of molecular events that are important for the regulation of SNC1-mediated immunity, most of which are involved in transcriptional regulations, mRNA processing and SNC1’s protein stability control (MOS6, MOS7 and MOS10 mentioned above, are involved in protein nucleocytoplasmic transport and downstream gene transcription regulation of SNC1, respectively). 1.4.1 Transcriptional regulation of SNC1 MOS1 encodes a protein containing an HLA-B ASSOCIATED TRANSCRIPT 2 (BAT2) domain (Li et al., 2010). Methylation levels of the DNA upstream of coding region of SNC1 was largely reduced in the mos1 loss-of-function background (Li et al., 2010), suggesting 	  	  13	  that MOS1 regulates the expression of SNC1 at the chromatin level.      An additional MOS gene, MOS9 encodes a plant-specific gene with an unknown function (Xia et al., 2013). In an effort to identify MOS9-associated proteins, an immunoprecipitation-mass spectroscopy experiment (IP-MS) was performed on MOS9-GFP transgenic plants, resulting in the identification of the Set1 class lysine 4 of histone 3 (H3K4) methyltransferase ATXR7 (ARABIDOPSIS TRITHORAX-RELATED 7) as a MOS9 direct interactor. Chromatin immunoprecipitation (ChIP) assays revealed a decrease in trimethylated H3K4 marks on the promoters of SNC1 and its homologous TNL gene RESISTANCE TO PERONOSPORA PARASITICA4 (RPP4), associated with a reduced expression of SNC1 and RPP4 transcripts in mos9 plants (Xia et al., 2013). Taken together, these data suggested that chromatin regulators including MOS1, ATXR7 and MOS9 alter methylation of histone codes to regulate SNC1 gene transcription. 1.4.2 SNC1 mRNA splicing and export Following transcription, MOS2, MOS4 and associated complex proteins (MAC), MOS12, MOS14 are all required for proper splicing of the transcripts of SNC1 (Zhang et al., 2005; Palma et al., 2007; Xu et al., 2012, 2011). After splicing, 5’ capping and addition of 3’ polyA tail, mature mRNAs are exported from the nucleus to the cytosol to be translated. This export step involves an RNA cochaperone, MOS11, as well as the Nup 107-160 nuclear pore complex which includes MOS3 (Germain et al., 2010; Zhang and Li, 2005). Collectively, these pre-translational regulatory steps of SNC1 suggest that the up-regulation of SNC1 expression is important during defense response. The increased amount of an NLR protein would likely enhance pathogen detection capabilities and amplify immune response signalling.  	  	  14	  1.4.3 Post-translational regulation: NLR’s protein stability is control by N-terminal acetylation and ubiquitination The protein levels of NLR immune receptors must be tightly controlled to avoid autoimmunity. The functional identification of CPR1/CPR30 (Constitutive Expressor of PR genes), which encodes the F-box protein of a Cullin-based E3 ligase complex, revealed that it controls the protein stability of TNL SNC1 and CNL RPS2 (Cheng et al., 2011b). The SNC1 and RPS2 proteins accumulated in the cpr1 mutant, and were rapidly degraded when CPR1 was overexpressed. Additionally, the constitutive defense responses in cpr1 can be largely suppressed by the loss-of-function mutation of SNC1. (Cheng et al., 2011b).     Moreover, the MUSE screen identified a novel gene MUSE3 that facilitates the ubiquitination process of SNC1 and RPS2 (Huang et al., 2014b). MUSE3 encodes an E4 ubiquitin ligase, a highly conserved gene in eukaryotes that promotes ubiquitin chain elongation during the ubiquitination process (Huang et al., 2014b). Mutation in MUSE3 leads to the enhancement of snc1-mediated immunity and accumulation of SNC1 and RPS2 protein levels (Huang et al., 2014b). The SNC1 or RPS2 protein levels were reduced when MUSE3 was transiently co-expressed with CPR1 and SNC1 or RPS2 compared with co-expressing CRP1 and SNC1 or RPS2 alone in Nicotiana benthamiana. Interestingly, the SNC1 protein level was not altered when MUSE3 and SNC1 were co-expressed, suggesting that MUSE3 only facilitates to degrade SNC1 and RPS2 in the presence of the proper E3 ligase (Huang et al., 2014b).     Furthermore, mutations in two additional MUSEs, MUSE10 and MUSE12, also result in accumulation of the protein levels of the NLRs including SNC1, RPS2 and RPS4 (Huang et al., 2014a). MUSE10 and MUSE12 encode two isoforms of HSP90, HSP90.3 and HSP90.2, respectively. Co-immunoprecipitation analysis revealed that HSP90.3 and HSP90.2 directly interact with SNC1 to facilitate its degradation, possibly through the assistance of SCF E3 ubiquitin ligase complex assembly with SGT1 (Huang et al., 2014a).  	  	  15	      In addition to ubiquitination, N-terminal acetylation was found to be another important mechanism to regulate SNC1 turnover (Xu et al., 2015a). It has been shown that SNC1 protein undergoes N-terminal translation initiation at two independent codons and acetylation that leads to opposite consequences for protein stability (Xu et al., 2015a). Initiation of SNC1 from the first Met results in being acetylated by N-terminal acetyltransferase (Nat) A, causing a more unstable SNC1 protein. Whereas acetylation of the second Met mediated by Nat B results in a more stable SNC1 protein (Xu et al., 2015a). MUSE6 encodes a subunit of the Nat A complex. Loss-of-function of MUSE6 leads to the abolishment of the first Met acetylation and consequently, a heightened protein level of SNC1 (Xu et al., 2015a).     Collectively, the identification of the negative regulators of SNC1’s turnover, including CPR1, MUSE3, MUSE6, MUSE10 and MUSE12, uncovered the significance of maintaining NLR’s homeostasis in plant cells, as over-accumulation of NLR proteins could lead to autoimmunity and be detrimental to plant growth and propagation.  1.5 Thesis objectives 1.5.1 Identification and characterization of E3 ubiquitin ligases involved in plant immunity The identification of negative regulators of SNC1 turnover highlighted the importance of homeostatic control of immune regulators in plants. One of the most common homeostasis regulatory mechanisms is by ubiquitination. By labeling a protein with a ubiquitin chain (at least four moieties) linked via the Lys48 residue, the protein is targeted for degradation by the ubiquitin-26S proteasome (Smalle and Vierstra, 2004). The ubiquitin-26S proteasome system (UPS) involves the sequential steps of three enzymes, a ubiquitin activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin ligase enzyme (E3). Among the three enzymes, E3 ubiquitin ligases are key factors in determining substrate specificity 	  	  16	  (Smalle and Vierstra, 2004). There are over 1500 E3 ubiquitin ligase encoding genes in the Arabidopsis genome (Vierstra, 2003). However, so far only a small number of them have been well characterized. In order to uncover important E3 ubiquitin ligases involved in plant immunity, I aimed to use a reverse overexpression genetic screen to identify key immune-related E3 ubiquitin ligases and to investigate how they are involved in plant immunity. This was the first objective of my thesis. 1.5.2 Studying the role and specificity of ADR1s in NLR signalling The Arabidopsis ADR1 (Activated Disease Resistance) is a small family of CNLs consisting of three members (ADR1, ADR1-L1, ADR1-L2) (Chini and Loake, 2005). ADR1s function as “helper NB-LRRs” to transduce signals after activation of specific NLR proteins and are essential for basal defense against virulent pathogens (Bonardi et al., 2011). Auto-activation of ADR1 or ADR1-L2 results in the constitutive activation of defense responses ( Grant et al., 2003; Chini et al., 2004; Chini and Loake, 2005; Bonardi et al., 2011). Loss-of-function of adr triple (i.e. the adr1 adr1-l1 adr1-l2 triple mutant) leads to compromised basal defense and significant suppression of ETI mediated defence by specific NLRs such as RPP4 and RPP2 (Bonardi et al., 2011). However, the role of ADRs in NLR signalling and the specificity of ADRs required by different NLRs are unknown. Thus, the second objective of my thesis was to specifically investigate the involvement of ADRs in SNC1-mediated immunity using molecular genetic approaches.     	  	  17	  2 A reverse genetic screen looking for key E3 ubiquitin ligases involved in plant immunity 2.1 Summary As a common post-translational modification, ubiquitination is used for regulating protein function, notably in terms of stability. In recent years, ubiquitination has emerged as a major player in plant immunity regulation; however, not many E3 ligases have been identified in this biological process, likely due to the high redundancy or knock-out lethality of E3 ubiquitin ligase families in plants. In an effort to identify E3 ubiquitin ligases involved in plant defense, I conducted a snc1-influencing plant E3 ligase reverse genetic (SNIPER) screen. I first selected candidate E3 ligase-encoding genes whose transcripts are up-regulated upon plant defense, according to TAIR Microarray Expression databases. The chosen candidates were then overexpressed in the autoimmune mutant snc1 background, and screened for transgenic enhancers or suppressors that altered snc1-mediated autoimmunity. From the screen, six SNIPER genes were identified. When overexpressed, four of them suppress snc1 phenotype to different degrees and two of them enhance it. 2.2 Introduction A three-step enzyme catalytic reaction (E1 activation, E2 conjugation, E3 ligation) that covalently attaches ubiquitin polymers at lysine 48 on targeted substrates, subjects them to degradation by the 26S proteasome (Smalle and Vierstra, 2004). Among these three ubiquitin catalytic enzymes, E3 ligases are the key factors determining the specificities for substrates. There are more than 1500 E3 ubiquitin ligase-coding genes in Arabidopsis genome, accounting for over 5% the Arabidopsis proteome (Vierstra, 2003), suggesting that they have significant roles in plant physiological regulation.     The plant E3 ubiquitin ligases can be grouped into two classes, each including three 	  	  18	  types, depending on their different conserved domains and mechanisms of action: 1) simple E3s including HECT (Homology to E6AP C Terminus)-type, RING (Real Interesting New Gene)-type and U-box-type; and 2) complex E3s including Cullin 1-based SCF complex, Cullin 3-based BTB (Bric à Brac, Tramtrack, and Broad Complex)-type and APC (Anaphase-Promoting Complex)-type (Cheng and Li, 2012). HECT E3 ligases contain unique HECT domains that enable them to form ubiquintin-E3 thiol-ester intermediates prior to the ubiquitin-substrate product (Downes et al., 2003). RING/U-box E3 ligases, on the other hand, bear either RING domains or RING derivative domains called U-box domains that allow the E3 ligases to bind E2 conjugating enzymes. The RING domain contains eight highly conserved cysteines (Cs) and histidines (Hs), which bind two zinc ions in one of two formats: C3H2C3 or C3H1C4 (Deshaies and Joazeiro, 2009). The U-box domain is structurally similar to the RING domain (Ohi et al., 2003). However, instead of using zinc ion chelation, the U-box domain exploits electrostatic interactions to stabilize its structure (Ohi et al., 2003).      SCF is an E3 complex consisting of three subunits: S phase kinase-associated protein 1 (SKP1), Cullin1 and an F-box protein. Similar to RING/U-box E3s, SCF complexes serve as scaffolds that bring together an E2 enzyme and a specific substrate, allowing the transfer of ubiquitin molecules from the E2 to the substrate. Among the three subunits of the SCF complex, the F-box protein is the substrate-determining factor. F-box genes compose the biggest E3 ubiquitin ligase group in plants, accounting for over 700 in the Arabidopsis genome (Gagne et al., 2002).      It has been shown that E3 ligases are at the core of almost all aspects of plant development and physiology (Dreher and Callis, 2007). The most representative examples are the roles of E3 ligases in hormone signalling in response to auxin, jasmonic acid (JA), gibberellins, etc. Auxin is a plant developmental hormone that directly regulates plant growth through a family of auxin responsive transcription factors (ARFs) (Okushima et al., 2005). These ARFs are strongly repressed by AUXIN (AUX) or INDOLE-3-ACETIC ACID (IAA) 	  	  19	  proteins. The presence of auxin induces the degradation of AUX/IAA proteins; F-box E3 ubiquitin ligases in the TRANSPORT INHIBITOR RESPONSE 1 (TIR1) family target AUX/IAA proteins in the presence of auxin, resulting in the de-repression of ARF transcription factors that activate auxin responses (Dharmasiri et al., 2005).       A similar mechanism of de-repression by the ubiquitin proteasome system (UPS) also applies to JA signalling. Normally, the family of JA responsive transcription factors MYB DOMAIN PROTEINs (MYBs) is inhibited by a family of JA-ZIM domain (JAZ) repressors (Thines et al., 2007; Chini et al., 2007). The presence of a biological active form of JA, JA-Ile, serves as a molecular glue to significantly enhance the interaction of an F-box protein, CORONATINE-INSENSITIVE 1 (COI1), with JAZs for their efficiently degradation (Katsir et al., 2008). The degradation of the JAZ repressors consequently reverses the repression of the transcription of the MYB family, thus triggering the activation of JA responses (Katsir et al., 2008).     In addition to plant hormone signalling, there is emerging evidence showing that many E3 ubiquitin ligases are involved in plant immunity. For example, a trio of Plant U-box (PUB) E3 ubiquitin ligases PUB22/PUB23/PUB24 has been shown to negatively regulate PTI (Trujillo et al., 2008). The pub22 pub23 pub24 triple mutant displayed elevated oxidative burst, enhanced MPK3/MPK6 activity, and increased transcriptional activation of PTI marker genes (Trujillo et al., 2008). Yeast-two hybrid screens identified Exo70B2, a subunit of the exocyst complex that mediates vesicle tethering during exocytosis, as the substrate of PUB22, PUB23 and PUB24 (Stegmann et al., 2012). Moreover, two homologous E3 ligases PUB12 and PUB13 were identified to specifically regulate the turnover of flagellin receptor FLS2. Upon flg22 treatment, PUB12 and PUB13 are phosphorylated by BAK1, which primes them to subsequently ubiquitinate and degrade FLS2 through 26S proteasome (Lu et al., 2011).      In order to identify additional important E3 ligases involved in plant immunity, I 	  	  20	  conducted a snc1-influencing plant E3 ubiquitin ligase reverse genetic (SNIPER) screen. I selected candidate E3 ligase-encoding genes whose transcripts are up-regulated upon plant defense, according to TAIR Microarray Expression databases. Next, these E3 ligase genes were overexpressed in snc1 background to look for snc1-enhancers or suppressors. Here we described the SNIPER screen and the six SNIPER mutants identified through the screen.   2.3 Results 2.3.1 Primary screen 2.3.1.1 Compilation of the candidate list of putative E3 ligases based on microarray data In order to investigate the E3 ligases involved in plant innate immunity, we selected 50 putative E3 ligase-encoding genes whose transcripts are up-regulated upon PAMP treatment based on TAIR Microarray Expression databases (1.7-fold induction was used as the cut off threshold), and aimed to overexpress them in the snc1 background searching for either suppressors or enhancers.  2.3.1.2 Overexpression of E3 ligase genes in snc1 background To accelerate cloning, we ordered available U-clones from ABRC (Arabidopsis Biological Resource Center). U-clones are PCR-amplified, sequence verified ORF (Open Reading Frame) clones in the pUNI vector. These U-clones were subcloned into a modified pGreen0229 binary vector driven by the CaMV 35S promoter with an N-terminus HA tag. These binary vectors containing E3 ligase genes were then transformed into Agrobacterium tumefaciens and then agro-transformed into snc1 plants using a floral dipping method (Clough and Bent, 1998) (Figure 2.1). For each E3 ligase transgene, an average number of 24 	  	  21	  transformants were obtained.     The snc1 mutant displays typical autoimmune phenotypes with stunted growth, dark green curly leaves and siliques organized in bushy clusters (Li et al., 2001a). These snc1-related morphological phenotypes usually correlate with defense outputs, and were used as criteria to select snc1-suppressing and enhancing mutants. The detailed morphological phenotypes of E3 ligase transformants were collected and summarized in Table 2.1. The morphology photographs of a representative suppressor and enhancer are shown in Figure 2.1.   	  	  22	    Figure 2.1 SNIPER screen strategy and two representative SNIPERs. A diagram of SNIPER screen workflow: 50 E3 coding genes with upregulated expression upon PAMP treatment were selected through the microarray data. U-clones of 33 of these E3 genes were obtained from ABRC and were subsequently subcloned into pGST1 vector. Once transformed into Agrobacterium, the E3-containing pGST vectors were transformed into the snc1 background by Agrobacterium-mediated floral dip method (Clough and Bent, 1998). Pictures of the morphology of one representative snc1-suppressor and one representative snc1-enhancer are shown on the bottom left.    	  	  23	  Table 2.1 A summary of SNIPER screen and their overexpression phenotypes in snc1. No.	   E3	  type	   Phenotype	   Gene	  ID/lab	  code	  1	   RING	   -­‐-­‐-­‐	   SNIPER2/U4H	  2	   RING	   +/-­‐	   U1	  3	   U-­‐box	   ++	   SNIPER3/U3	  4	   RING	   -­‐-­‐-­‐	   SNIPER1/U4	  5	   F-­‐box	   ++	   U5	  6	   RING	   -­‐	   U6	  7	   U-­‐box	   ++	   CMPG1/U7	  8	   F-­‐box	   +/-­‐	   U8	  9	   F-­‐box	   -­‐	   U9	  10	   F-­‐box	   +/-­‐	   U10	  11	   F-­‐box	   +	   U11	  12	   BTB/POZ	   -­‐-­‐	   SNIPER4/U12	  13	   ASK3	   +/-­‐	   U13	  14	   RING	   +/-­‐	   U15	  15	   F-­‐box	   +/-­‐	   U17	  16	   RING	   +/-­‐	   U18	  17	   RING	   +	   U19	  18	   RING	   -­‐	   U20	  19	   RING	   +	   U21	  20	   U-­‐box	   +	   U22	  21	   F-­‐box	   +++	   SNIPER5/U23	  22	   RING	   ++	   U25	  23	   BTB/POZ	   +/-­‐	   U26	  24	   RING	   +++	   U27	  25	   U-­‐box	   +/-­‐	   U28	  26	   F-­‐box	   +/-­‐	   U30	  27	   RING	   -­‐-­‐	   SNIPER6/U31	  28	   F-­‐box	   +/-­‐	   U32	  29	   RING	   +	   U33	  30	   F-­‐box	   +/-­‐	   U35	  31	   U-­‐box	   +/-­‐	   U36	  32	   RING	   +	   U37	  33	   RING	   +/-­‐	   U38	  Note:	  "+"	  enhancing,	   	   "-­‐"	  suppressing,	  "+/-­‐"	  no	  changes	    	  	  24	  2.3.1.3  Selection of candidate E3 genes Phenotypic observations of the snc1 plants containing E3 ligase transgenes indicated that 19 out of 33 overexpressed E3 ligases altered snc1 dwarfism to varying degrees, six of which displayed dramatic snc1 phenotypic alterations. When overexpressed, two E3 ligases fully suppress snc1, two partially suppress snc1, and two enhance snc1 (Table 2.1). These six E3 ligases were then named SNIPER1 to SNIPER6 (Table 2.1). 2.3.2 Secondary screen: phenotypic and functional characterization of candidate SNIPERs  In order to confirm that the phenotypes of the E3 transformants resulted from over expression of the E3 ligase genes rather than silencing, the transcript levels of transgenes were examined by Reverse Transcriptase-mediated (RT)-PCR and the protein expression levels were analyzed by Western blot. The enhanced transcript and/or protein levels of the transgenes were correlated with the altered snc1 phenotypes, suggesting that the phenotypes are not the consequences of gene silencing (data not shown).     To rule out possible interference of the epitope HA tag with the function of the E3 ligase, untagged E3 ligase driven by CaMV 35S promoter transgenic plants were generated and phenotypically assayed. Consistent morphological phenotypes of the untagged E3 ligase transgenic plants with that observed in the tagged E3 transgenic plants were observed (data not shown), suggesting that the HA epitope tag did not interfere with the E3 ligase overexpression phenotypes.  2.3.2.1 Phenotypic characterizations of 35S::SNIPER lines To confirm that the 35S::SNIPER mutants isolated from the primary screen are indeed involved in immunity, defense-related phenotypes including resistance to virulent pathogens 	  	  25	  were assessed in each 35S::SNIPER mutant.     For SNIPER suppressors and SNIPER enhancers, enhanced susceptibility and enhanced resistance were confirmed with pathogen infections with Hyaloperonospora arabidopsidis (H.a.) Noco2 (Figure 2.2). For H.a. Noco2 infections, the plant seedlings (~14 days old, grown on soil) were sprayed with a solution of Noco2 conidiospores and were maintained under high humidity. Scoring was performed after incubation for a week by assessing the appearance of conidiospores on the leaves of the seedlings following a protocol described in Li et al. (2001).      To test whether the suppressing or enhancing phenotypes of 35S::SNIPER lines in snc1 are dependent on snc1, 35S::SNIPER lines in the Col-0 background were generated. (As SNIPER2 has 37% amino acid identities with SNIPER1 and overexpression of SNIPER2 displayed snc1-suppressing phenotypes as overexpression of SNIPER1, we concluded that SNIPER1 and SNIPER2 are homologous to each other, thus only the data of 35S::SNIPER1 in Col-0 was shown here. Data of 35S::SNIPER5 not shown here.) Each 35S::SNIPER line was phenotypically characterized with the infections of H.a. Noco2 and/or Pseudomonas syringae pv. Maculicola (P.s.m.) ES4326. For P.s.m. infection, four-week-old adult plant leaves were infiltrated with a bacterial solution (OD600 = 0.0001). Infected leaves were harvested, ground and serial diluted to a countable colony-forming unit (cfu) number at 0 and 3 days after inoculation. The results showed that the overexpression SNIPER snc1-suppressors (SNIPER1 and 4) /enhancers (SNIPER3 and 6) also showed enhanced disease susceptibility and resistance, respectively, in the Col-0 background (Figure 2.3), suggesting that the overexpression phenotypes of SNIPERs are not snc1-dependent.      	  	  26	   Figure 2.2 Phenotypic characterization of representative transgenic lines of 35S::SNIPER1-6 in snc1 plants.  (A to D) Morphology of four-week-old plants and the growth of H.a. Noco2 on two-week old Col-0, snc1, and two representative transgenic lines of snc1-suppressing SNIPER plants. (E to F) Morphology of four-week-old Col-0, snc1, and two representative transgenic lines of snc1-enhancing SNIPER plants. 	  	  27	   Figure 2.3 Phenotypic characterization of representative transgenic lines of 35S::SNIPER1, 3-6 in Col-0 background.  (A to B) Bacterial growth of P.s.m. ES4326 on four-week old Col-0, snc1, and two representative transgenic lines of snc1-suppressing SNIPER1 and 4 plants. (C to E) Morphology, pathogen growth of P.s.m. ES4326 and H.a. Noco2 of four-week-old Col-0, snc1, and two representative transgenic lines of snc1-enhancing SNIPER3 plants. (F to H) Morphology, pathogen growth of P.s.m. ES4326 and H.a. Noco2 of four-week-old Col-0, snc1, and two representative transgenic lines of snc1-enhancing SNIPER6 plants. (A, B, D, E, G and H) Data represent means of five replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6). 	  	  28	  2.4 Discussion  Here we report the SNIPER screen to identify E3 ligases whose overexpression resulted in altered snc1-mediated immunity. From the screen, we identified six SNIPER genes as well as CMPG1 (Table 2.1), which was previously found as a positive regulator required for ETI responses in tobacco and tomato (González-Lamothe et al., 2006). SNIPER1 and SNIPER2 encode two homologous RING-type E3 ligases. Overexpression of SNIPER1 completely suppressed snc1-related phenotypes in snc1 background and enhanced disease susceptibility to virulent pathogens in wild-type background. SNIPER4 and SNIPER5, encoding a BTB- and a U-box-type E3 ligase, respectively, are two partial snc1-suppressors when overexpressed. In contrast, overexpression of SNIPER3 and SNIPER6, which encode a U-box-type and an F-box E3 ligase showed enhanced disease resistance phenotypes in both snc1 and Col-0 background. Overall, 6 out of 33 E3 ligases (encompassing a range of different E3-types) tested from the screen have varying degrees of alteration in defense responses in both snc1 and Col-0. Among the 6 SNIPERs, I selected the SNIPER1/2 gene pair and SNIPER3 for further analysis. The analysis of SNIPER1/2 is incomplete, and thus is not included in this thesis. Chapter 3 will describe SNIPER3 in more detail.     The analysis of SNIPER loss-of-function mutants could confirm the functions of these SNIPERs. The SNIPERs loss-of-function mutants are expected to show the opposite defense phenotypes of the SNIPER overexpression lines. Due to genetic redundancy, double or higher order mutants can be generated in order to observe the phenotypes. As the SNIPERs encode E3 ligases, identification of their ubiquitination substrates is fundamental to understand how these SNIPERs regulate plant immunity. This could be done using Yeast-2-Hybrid screens and/or immunoprecipitation-mass spectrometry (IP-MS) approaches. Targets could also be speculated from known regulators of SNC1-mediated immunity based on the phenotypes. For example, for snc1-suppressing E3s, the targets could be positive regulators such as EDS1, PAD4; transcriptional regulators MOS10, bHLH84; or SNC1 itself. 	  	  29	  For snc1-enhancing E3s, the targets could be negative regulators such as CPR1 or MUSE proteins. To test these possibilities, protein levels of these potential targets can be examined in both E3 knock-out mutants and E3-overexpressing transgenic plants.   	  	  30	  3. E3 ligase SAUL1 serves as a positive immune regulator guarded by a TNL receptor SUSA1 3.1 Summary Ubiquitination is a common post-translational modification for regulating protein functions, notably in terms of stability. Although E3 ligase-encoding gene families are highly expanded in higher plants, not very many have been functionally characterized. To search for E3s functioning in plant immunity, we designed a snc1-influencing plant E3 ligase reverse genetic screen (SNIPER), where candidate E3s were overexpressed in the sensitized autoimmune snc1 background to search for E3s that can alter the phenotypes of snc1 upon overexpression. Here we describe SNIPER3/SAUL1/PUB44 as a snc1 enhancer, as its overexpression leads to enhanced resistance responses in both snc1 and wild-type backgrounds. Since loss-of-function saul1-1 plants exhibit seedling lethality, suppressor screens were conducted with saul1-1 to search for its E3 ligase substrate. From the screens, we identified a novel Toll Interleukin 1 Receptor (TIR)-type nucleotide-binding leucine-rich repeat (TNL) immune receptor-encoding gene Suppressor of saul1 1 (SUSA1). Knocking out SUSA1 completely suppresses saul1-related autoimmune phenotypes. In addition, SAUL1 associates with SUSA1 in planta. However, SUSA1 does not seem to be the ubiquitination substrate of SAUL1. Interestingly, the SAUL1 overexpression autoimmune phenotypes also require SUSA1, suggesting a role of SUSA1 in sensing SAUL1’s homeostasis. Although SUSA1 is genomically in tandem with CHS1 and TN2, which encode truncated TNLs without LRR domains, saul1-1 does not seem to rely on CHS1 or TN2. Moreover, triple mutant analysis of saul1-1 susa1 pub43 revealed that SAUL1 works redundantly with it closest homolog PUB43 in positively regulating pathogen-associated molecular patter (PAMP)-triggered immunity. In summary, the E3 ligase SAUL1 serves as a positive regulator of immunity and its homeostasis is monitored by TNL SUSA1. 	  	  31	  3.2 Introduction Plant immune responses against microbial pathogen infections can be initiated by two types of immune receptors ( Jones and Dangl, 2006; Dodds and Rathjen, 2010). Plasma membrane-localized pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs), such as bacterial flagellin and fungal chitin to activate PAMP triggered immunity (PTI) (Boller and Felix, 2009; Monaghan and Zipfel, 2012). In contrast, intracellular nucleotide-binding leucine-rich repeats proteins (NLR; or Nod-like receptor) confer disease resistance by monitoring the presence or activity of pathogen effectors to initiate effector-triggered immunity (ETI). In Arabidopsis, there are two typical classes of NLR proteins depending on their N-terminal structure, one with a coiled-coil (CC) domain, and the other with a Toll and interleukin-1 receptor (TIR) domain (Li et al., 2015). Suppressor of NPR1, Constitutive 1 (SNC1) encodes a TIR-type NLR (TNL). Mutant snc1 carries a gain-of-function mutation resulting in the constitutive activation of immune responses, with constitutive expression of defense marker Pathogenesis Related (PR) genes, and enhanced resistance against virulent pathogens such as bacteria Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 and oomycete Hyaloperonospora arabidopsidis (H.a.) Noco2 (Li et al., 2001a; Zhang et al., 2003a). Furthermore, unlike many other autoimmune mutants, snc1 plants exhibit a dwarf morphology without cell death lesions, making it a useful sensitized background for genetic screening (Johnson et al., 2012).     Ubiquitination is a common post-translational modification in eukaryotes, which is most often utilized to regulate its substrate protein’s stability (Vierstra, 2009). By covalently attaching ubiquitin linked via the Lys48 residue to its substrate, the protein is marked and subsequently targeted for degradation by the 26S proteasome. The ubiquitination reaction involves three sequential steps catalyzed by three enzymes, a ubiquitin activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin ligase (E3). Among these proteins, E3 ligases are key factors in determining substrate specificity (Hershko and Ciechanover, 1998). Compared to less than 700 E3-encoding genes in the human genome, higher plants 	  	  32	  have largely expanded E3 gene families. For example, the Arabidopsis genome contains over 1400 E3-encoding genes (Cheng and Li, 2012). Such expansion suggests their likely roles in plant-specific processes and/or the potential existence of genetic redundancy.     Recent studies revealed that E3 ligases play important roles in immune signaling in both PTI and ETI. For example, the Arabidopsis Plant U-box (PUB) protein PUB12 and PUB13 were identified to negatively regulate flagella-induced PTI responses through the degradation of flagellin receptor FLS2 ( Flagellin-Sensitive 2) (Lu et al., 2011). A triplet of U-box protein paralogs PUB22, PUB23 and PUB24 redundantly target exocyst complex component EXO70B2 (Exocyst subunit EXO70 B2) for degradation, required for PTI responses (Stegmann et al., 2012). In addition, the F-box protein CPR1 (Constitutive Expressor of PR genes) was found to control the stability of NLRs including SNC1 and RPS2 (Cheng et al., 2011a). The process of the polyubiquitination and degradation of SNC1 and RPS2 was facilitated by the E4 ubiquitin ligase MUSE3 (Mutant, snc1-enhancing 3) (Huang et al., 2014b). Furthermore, the mutant of E3 ligase saul1-1 (Senescence-Associated E3 Ubiquitin Ligase 1; also named PUB44) was identified as an autoimmune mutant whose autoimmunity can be suppressed by environment factors such as high temperature and high light conditions(Disch et al., 2015; Vogelmann et al., 2012) Interestingly, the leaf necrosis/seedling lethality phenotype of saul1-1 fully depends on PAD4 and EDS1 (Disch et al., 2015), suggesting that knocking out SAUL1 promotes PAD4- and EDS1-dependent immune responses.     To search for novel E3s involved in plant immunity regulation, we conducted a snc1-influencing plant E3 ligase reverse genetic screen (SNIPER), which identified SAUL1/SNIPER3/PUB44. When overexpressed, SAUL1 enhances snc1 phenotypes and also results in autoimmunity in wild-type background, suggesting that SAUL1 positively regulates immune responses. Suppressor screens of saul1-1 mutant reveal that loss of SAUL1 leads to the activation of a typical TNL protein SUSA1 (Suppressor of saul1 1). SUSA1 can associate with SAUL1 in planta. Interestingly, the autoimmunity of SAUL1 overexpressing plants also 	  	  33	  relies on SUSA1. Triple mutant saul1-1 susa1 pub43 exhibit susceptibility to P.s.t. hrcC-, suggesting that SAUL1 and PUB43 function redundantly in PTI. These results indicate that SAUL1 is a positive immune regulator, whose homeostasis is monitored by a TNL protein.    	  	  34	  3.3 Results 3.3.1 Overexpression of SAUL1 enhances snc1 and leads to autoimmunity in wild-type Col-0 In an effort to search for E3 ligases involved in plant immunity, a snc1-influencing plant E3 ligase reverse genetic screen (SNIPER) was conducted. We selected 50 candidate E3-encoding genes whose transcripts are up-regulated upon plant defense, according to TAIR Microarray Expression databases. The chosen candidates were overexpressed in the autoimmune mutant snc1 background. In the primary screen, we searched for transgenic enhancers and suppressors that altered snc1-mediated dwarfism.     From the SNIPER screen, we identified SNIPER3/SAUL1 (also named PUB44/AT1G20780, hereafter SAUL1) as a snc1 enhancer. When overexpressed in snc1, it enhanced snc1 dwarfism (Figure 3.1A and 3.1B). To examine its overexpression phenotypes in wild-type background, independent transgenic plants carrying SAUL1 driven by Cauliflower Mosaic Virus (CaMV) 35S promoter were obtained. The majority of the transformants exhibited stunted growth and necrosis (Figure 3.1C), indicative of autoimmunity. In the 35S::SAUL1 transgenic plants, the expression of PR1 was up-regulated significantly compared with Col-0 (Figure 3.1D). Consistent with the constitutive PR1 expression, the growth of virulent pathogens oomycete Hyaloperonospora arabidopsidis (H.a.) Noco2 (Figure 3.1E) and bacteria Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 (Figure 3.1F) was also reduced. Taken together, these data suggest that SAUL1 plays a positive role in promoting immune responses. When overexpressed, the plants exhibit autoimmunity.   	  	  35	   Figure 3.1 Overexpression of SAUL1 enhances snc1 and confers autoimmunity in wild-type Col-0 background. (A) SAUL1 expression in the indicated genotypes as determined by RT-PCR. ACTIN7 serves as loading control. The fragments of SAUL1 and ACTIN1 were amplified from cDNA templates by 31 cycles of PCR. The PCR products were then analyzed by agarose gel electrophoresis. (B) Morphology of four-week-old Col-0, snc1 and two independent 35S::SAUL1 transgenic lines in the snc1 background. (C) Morphology of four-week-old Col-0 and two independent 35S::SAUL1 transgenic lines in Col-0 background. 	  	  36	  (D) SAUL1 and PR1 genes expression in the indicated genotypes as determined by RT-PCR. ACTIN7 serves as loading control. The fragments of SAUL1 and PR1 were amplified from cDNA templates by 31 and 26 cycles of PCR, respectively. The PCR products were then analyzed by agarose gel electrophoresis. (E) Quantification of H.a. Noco2 sporulation on the indicated genotypes. Three-week-old plants were spay-inoculated with H.a. Noco2 conidia spores at a concentration of 100,000 conidia spores per ml water. Quantification of conidia growth on leaf surface was determined 7 days post inoculation (dpi). Data represent means of four replicates. Error bars are standard deviations. ***p< 0.001. (Student’s t test, GraphPad Prism 6) (F) Bacterial growth of P.s.m. ES4326 in the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.m. ES4326 at OD600 = 0.001. Quantification of colony-forming-units (cfu) in the infected area was examined at 0 and 3 dpi, respectively. Data represent means of five replicates. Error bars are standard deviations. ***p< 0.001. (Student’s t test, GraphPad Prism 6) 3.3.2 Identification and molecular cloning of SUPPRESSOR OF SAUL1 1 (SUSA1) saul1-1 knockout mutants exhibit autoimmunity that is dependent on PAD4 and EDS1 (Vogelmann et al., 2012; Disch et al., 2015). Because E3 ligases mostly target proteins for degradation, loss-of-function of an E3 would likely result in higher accumulation of its target protein. The E3 substrate can therefore be identified by screening for genetic suppressors using the E3 mutant. Additionally, such suppressor screen may also identify component(s) downstream of or in parallel with SAUL1 to reveal its signaling mechanism. Two independent genetic suppressor screens were carried out with saul1-1, one in Germany (Hoth Lab), and the other in Canada (Li Lab). As shown in Figure 3.2A, these saul1-1 susa1 suppressor mutants completely or partially reverted saul1-1 to wild-type size and abolished its necrosis phenotype. They were named suppressor of saul1 1 (susa1) mutants.  	  	  37	   In order to map susa1, saul1-1 susa1-2 mutant in Columbia (Col-0) background was crossed with Landsberg erecta (Ler) to generate an F2 segregating population. However, among 288 F2 plants, none exhibited saul1-like phenotypes, indicating a tight genetic linkage between saul1 and susa1. This was further confirmed with crosses between saul1-1 susa1-2, saul1-1 susa1-7, saul1-1 susa1-8, or saul1-1 susa1-10 and Col-0. Among 100 to 400 F2 plants from each cross, no saul1-like progeny was identified. In addition, when saul1-1 susa1-2 was crossed with saul1-1 susa1-5, failed complementation was observed in F1 progeny, suggesting that these two susa1 mutants carry mutations in the same gene. Pair-wise allelism tests among saul1-1 susa1-7, saul1-1 susa1-8, saul1-1 susa1-9, saul1-1 susa1-10, saul1-1 susa1-12, and saul1-1 susa1-13 further confirmed that the susa1 mutants identified in the Hoth Lab were allelic to each other.     In order to identify the molecular lesions in susa1 mutants, whole genome re-sequencing was carried out on saul1-1 susa1-2 and saul1-1 susa1-5 identified in the Li Lab and on saul1-1 susa1-7, saul1-1 susa1-12, and saul1-1 susa1-13 from the Hoth Lab. Close examination of mutations in the genomic region close to saul1 in all mutants identified only one common candidate, AT1G17600, where independent mutations were found in all the susa1 mutants. In susa1-2, a C to T mutation caused a Leucine to Phenylalanine change at amino acid position 455. In susa1-5, a C to T mutation resulted in a Leucine to Phenylalanine change at amino acid position 922. In susa1-7, a G to A mutation resulted in a change from Glycine to Arginine at amino acid position 212. In susa1-12, a C to T mutation resulted in a change from Serine to Phenylalanine at amino acid position 960. In susa1-13, a G to A mutation resulted in a change from Valine to Methionine at amino acid position 712. Eight more alleles of susa1 were further identified by Sanger sequencing of AT1G17600 with genomic DNAs from other saul1-1 susa1 alleles (Figure 3.2B). Collectively, these data indicate that SUSA1 is most likely AT1G17600.     Sequence analysis revealed that SUSA1 encodes a typical TNL immune receptor protein. 	  	  38	  Among the 13 susa1 alleles isolated from the screens, one missense mutation was found in the TIR domain, five in the NB domain, six in the LRR domain, and one at the C-terminus (Figure 3.2C), suggesting that each domain of the TNL is important for its function. A canonical NLR protein requires an intact P-loop motif that facilitates ATP binding and hydrolysis (Takken and Tameling, 2009). From the screen, we obtained two P-loop mutant alleles, susa1-7 (G212R) and susa1-8 (G214R) (Figure 3.3A), suggesting that the P-loop motif is indispensible for the proper function of SUSA1.      To further confirm the proper cloning of SUSA1, we obtained two exonic T-DNA knock out alleles of susa1, SALK_200339 designated as susa1-14, and SALK_069931 designated as susa1-15 (Figure 3.2B and 3.2C). The saul1-1 susa1-14 double mutant completely reverted saul1 to WT morphology (Figure 3.2D). Additionally, the higher expression level of PR1 in saul1 was completely suppressed in the saul1-1 susa1-14 double mutant (Figure 3.2E). Taken together, these data indicate that SUSA1 is AT1G17600, which encodes a P-loop dependent putative TNL immune receptor.   	  	  39	   Figure 3.2 Characterization of saul1 suppressors. (A) Morphology of four-week-old Col-0, saul1-1 and saul1 susa1 mutants. (B) List of susa1 alleles identified from independent screens carried out in Canada or Germany. The consequences of the mutations at the protein level are annotated.  (C) Predicted protein structure of SUSA1 with amino acid changes in each susa1 alleles indicated as arrows. SUSA1 encodes a typical TNL.  (D) Morphology of four-week-old Col-0, saul1-1, saul1-1 susa1-14 and susa1-14 plants. (E) Relative transcript levels of PR1 in the indicated genotypes as determined by RT-PCR. Total RNA was extracted from four-week-old plants grown at 22°C under long day conditions (16hr light/8hr dark). ACT7 was used to normalize the transcript levels. Data 	  	  40	  represent means of three replicates. Error bars are standard deviations. saul1-1 plants were grown at 28°C for three weeks before moving to 22°C to rescue the seedling lethal phenotypes.   Figure 3.3 Amino acid sequence alignments of SUSA1 with SUSA1-like proteins and selected TNLs from Arabidopsis. Amino acid sequence alignment of 1-273 aa (A) and 441-560 aa (B) of SUSA1 with SUSA1-like proteins and selected TNLs. was carried out with ClustalW (BioEdit Sequence Alignment Editor). The positions of the P-loop and MHD motif are indicated with black lines. The mutation sites of susa1-7 and susa1-8 in the P-loop region are labeled.   	  	  41	  3.3.3 PAMP-triggered responses are impaired in saul1-1 susa1 pub43 triple mutant  As SAUL1 serves a positive role in immune regulation (Figure 4.1), loss of SAUL1 function should yield an enhanced susceptibility phenotype. As the autoimmunity of saul1-1 is mediated by SUSA1, the real phenotype of saul1-1 is likely masked by the activation of SUSA1. To investigate the exact biological function of SAUL1 in basal defense, we challenged saul1-1 susa1 double mutants with virulent pathogen P.s.m. ES4326 (Figure 4.3A) and P.s.t. DC3000 (Figure 4.3B). We consistently observed a slight, but not always significant increase in bacterial growth in saul1-1 susa1 double and susa1 single mutants. This suggests that SUSA1 might be recognizing an effector in P.s.m. ES4326 or P.s.t. DC3000. Loss of SUSA1 leads to enhanced susceptibility to these two bacterial strains. However, saul1-1 susa1 double mutants and susa1 single mutants showed wild-type level of susceptibility against virulent oomycete pathogen H.a. Noco2 (Figure 4.3C), suggesting that SAUL1 and SUSA1 are not required for the immunity to H.a. Noco2.     To further determine whether SAUL1 is required for immune responses by known NLR proteins, we conducted pathogen growth assays on saul1-1 susa1 double mutants with avirulent bacteria P.s.t. DC3000 expressing AvrRps4 or AvrRpt2 effectors. These pathogen effectors are recognized by TNL protein RPS4 (Resistance to Pseudomonas syringae 4) (Axtell and Staskawicz, 2003) or CNL protein RPS2 (Mackey et al., 2003), respectively. The growth of either P.s.t. DC3000 AvrRps4 or AvrRpt2 were not significantly affected in saul1 susa1 double mutant (Figure 4.3D and 4.3E), suggesting that SAUL1 is not required for RPS4- and RPS2-mediated immunity.     In order to investigate the role of SAUL1 in PAMP-triggered immunity, we challenged saul1-1 susa1 double mutant with the Type III Secretion System (T3SS) deficient bacterial strain P.s.t DC3000 hrcC-. No alteration of the growth of hrcC- was observed in saul1 susa1 plants (Figure 4.3F). Since SAUL1 shares 73% amino acid identities with its closest homolog PUB43 (Figure 5), we speculated a possible functional redundancy between SAUL1 and 	  	  42	  PUB43. Thus, we generated saul1-1 susa1-5 pub43 triple mutant for hrcC- growth assays. As shown in Figure 4.3F, the day 3 bacterial growth was significantly increased in saul1-1 susa1-5 pub43 triple mutants compared to saul1 susa1 double mutants and wild type plants, suggesting that SAUL1 and PUB43 work redundantly in positive regulation of PTI. To examine whether SAUL1 and PUB43 are required for ROS production, we conducted a time-course ROS assay on saul1-1 susa1 and saul1-1 susa1-5 pub43 plants in response to flg22. As shown in Figure 4.3G, the ROS production in saul1-1 susa1 and saul1-1 susa1-5 pub43 accumulated to a similar level as wild type, suggesting that SAUL1 and PUB43 are not required for ROS production triggered by flg22. Taken together, these data indicate that SAUL1 and PUB43 are redundantly required for PTI responses, but are not required for ROS production. 	  	  43	   Figure 3.4 Characterization of saul1-1 susa1 double and saul1-1 susa1-5 pub43 triple mutants. (A,B,D,E) Bacterial growth of P.s.m. ES4326 (A), P.s.t. DC3000 (B), P.s.t. DC3000 AvrRps4 (D), and P.s.t. DC3000 AvrRpt2 (E) in the leaves of the indicated genotypes. Leaves of four-week-old plants were infiltrated with bacterial culture of P.s.m. ES4326, P.s.t. DC3000, P.s.t. DC3000 AvrRps4 and P.s.t. DC3000 AvrRpt2 at a dosage of OD600 = 0.0001, 	  	  44	  0.0001, 0.002 and 0.002, respectively. Quantification of cfu was carried out at 0 and 3 dpi. Data represent means of five replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6, p<0.05). (C) Quantification of H.a. Noco2 sporulation on the indicated genotypes. Two-week-old plants were spray-inoculated with H.a. Noco2 conidia at a concentration of 100,000 conidia per ml water. Quantification of conidia growth on leaf surface was determined 7 days post inoculation (dpi). Data represent means of four replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6, p<0.05). (F) Bacterial growth of P.s.t. DC3000 hrcC- in the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.t. DC3000 hrcC- at OD600=0.001. Quantification of cfu was examined at 0 and 3 dpi. Data represent means of five replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6, p<0.05). The mutant agb1-2 (Arabidopsis G-protein ß-subunit 1) was previously shown to have PTI defects [64], and it served as a positive control in hrcC- growth and ROS assays. (G) Time course of ROS production in response to flg22 in the indicated genotypes. Excised leaves of four-week-old plants were treated with 100 nM flg22. RLU (Relative Light Units) were quantified using a luminometer.  	  	  45	   Figure 3.5. Amino acid alignment of full length SAUL1 and PUB43. Amino acid sequence alignment was carried out with ClustalW (BioEdit Sequence Alignment Editor).    	  	  46	  3.3.4 The autoimmune SAUL1 overexpression phenotypes are dependent on SUSA1. As saul1-1 knockout phenotypes are fully dependent on SUSA1, we asked whether SAUL1 overexpression autoimmune phenotypes are also dependent on SUSA1. To test this, we crossed 35S::SAUL1 T1-7 with susa1-14. Intriguingly, susa1-14 completely suppressed the dwarf phenotype of the SAUL1 overexpression line (Figure 3.6A). In addition, the enhanced immunity of SAUL1 transgenic line 35S::SAUL1 T1-7 against H.a. Noco2 was reverted to WT level by susa1-14 (Figure 3.6B). Moreover, the decreased bacterial growth in SAUL1 overexpression line in response to Pst DC3000, Psm ES4326, Pst DC3000 (AvrRps4 and AvrRpt2) was also fully suppressed in 35S::SAUL1 T1-7 susa1-14 double mutants (Figure 3.6C-3.6F). Overall, these data suggest that the autoimmune SAUL1 overexpression phenotypes are dependent on SUSA1. In addition, when 35S::SAUL1 was transformed in susa1-14 and Col-0 backgrounds, among the T1 plants obtained, 67% (14/21) T1 in Col-0 showed dwarfism, whereas all (35/35) of the T1 progeny in susa1-14 background showed a WT morphology, confirming that the SAUL1 overexpression phenotypes require SUSA1.	  	   	  	  	  47	     Figure 3.6. The autoimmune SAUL1 overexpression phenotypes are dependent on SUSA1. (A) Morphology of four-week-old Col-0, 35S::SAUL1 T1-7, 35S::SAUL1 T1-7 susa1-14 and susa1-14 plants. (B) Quantification of H.a. Noco2 sporulation on the indicated genotypes. Three-week-old plants were spay-inoculated with H.a. Noco2 conidia spores at a concentration of 100,000 conidia spores per ml water. Quantification of conidia growth on leaf surface was determined 7 days post inoculation (dpi). Data represent means of four replicates. Error bars are standard deviations. (One-way ANOVA, GraphPad Prism 6, p<0.05). (C to F) Bacterial growth of P.s.m. ES4326 (C), P.s.t. DC3000 (D), P.s.t. DC3000 AvrRps4 (E), and P.s.t. DC3000 AvrRpt2 (F) in the leaves of the indicated genotypes. Leaves of four-week-old plants were infiltrated with bacterial culture of P.s.m. ES4326, P.s.t. DC3000, P.s.t. DC3000 AvrRps4 or P.s.t. DC3000 AvrRpt2 at a dosage of OD600 = 0.0001, 0.0001, 	  	  48	  0.002 and 0.002, respectively. Quantification of cfu was carried out at 0 and 3 dpi. Data represent means of five replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6, p<0.05). 3.3.5 Subcellular localization of SUSA1 As SAUL1 associates with the plasma membrane (Vogelmann et al., 2014), we examined the subcellular localization of SUSA1. Full-length genomic AT1G17600 was cloned in-frame with an N-terminal GFP tag driven by CaMV 35S promoter. When transformed into saul1-1 susa1-5 double mutant, the T1 GFP-SAUL1 transformants were able to fully complement the phenotypes of susa1-5 (Figure 3.7A). Therefore GFP-SUSA1 should localize to its correct subcellular compartments. From western blot experiments, the full-length GFP-SUSA1 was properly expressed (Figure 3.8). When GFP-SUSA1 was expressed in Arabidopsis leaf protoplasts, GFP fluorescence was observed in the cytosol in some protoplasts, but to the endoplasmic reticulum (ER) in others (Figure 3.7B). When GFP-SUSA1 was co-expressed with red-fluorescent cytosol/nucleus or ER markers, respectively, merging green and red fluorescence indicated that in both cases the signals largely overlapped (Figure 3.7B). We did not observe overlap of GFP-SUSA1 with the cytosol/nucleus marker in the nucleus of protoplasts. However, when transiently expressing GFP-SUSA1 in Nicotiana benthamiana leaf epidermal cells, GFP fluorescence indicated the presence of the fusion protein in some nuclei, whereas other nuclei were only surrounded by the GFP fluorescence signal. This was different from the GFP control that showed GFP fluorescence in all nuclei as expected (Figure 3.7C). Collectively, these data suggest that SUSA1 localizes to cytosol, ER, and nucleus. When GFP-SUSA1 and SAUL1-RFP were transiently co-expressed in N. benthamiana to check for co-localizaton, partial co-localization of SUSA1 and SAUL1 on the plasma membrane was observed (Figure 3.8), suggesting a potential interaction of 	  	  49	  SAUL1 and SUSA1 in the co-localized area.  Figure 3.7. Subcellular localization of GFP-SUSA1. (A) Morphology of four-week-old Col-0, saul1-1, saul1-1 susa1-5, and two independent complementing 35S::GFP-SUSA1 transgenic T1 plants in saul1-1 susa1-5 background. (B) Co-localization of GFP-SUSA1 with the cytosol marker Wave1RmCherrypNIGEL (top row) and the ER marker ER-rk CD3-959 (bottom row) in Arabidopsis leaf protoplasts. From left to right, images show GFP fluorescence in green, the respective marker fluorescence in red, chlorophyll fluorescence in blue, and the merged picture. Scale bars represent 10 µm. (C) Localization of GFP-SUSA1 following transient expression in Nicotiana benthamiana leaf epidermal cells, represented in a maximum projection (left). White and yellow 	  	  50	  arrows indicate the localization of GFP-SUSA1 in the nucleus or only around the nucleus. The GFP control is represented in a single section (right). Scale bars represent 25 µm.  Figure 3.8. The protein expression from full-length GFP-SUSA1 fusion gene and Colocalization of SAUL1 and SUSA1 in N. benthamiana. (Left) Western blot showed the expression of full-length GFP-SUSA1 protein at the predicted size. N. benthamiana leaves were infiltrated with GFP-SUSA1/P19, GFP/P19 or P19, respectively. Total protein was extracted from infiltrated N. benthamiana leaves 72h after infiltration and was used for western blot analysis. No band was visible in the P19 negative control. GFP alone from the GFP/P19 positive control was visualized at 26.9 kDa. The GFP-SUSA1 full-length protein was detected at the predicted size of about 147 kDa (red asterisk). An additional weak signal, likely a SUSA1 degradation product, was observed at approximately 50 kDa (red asterisk). Coomassie Brilliant Blue Staining of Rubisco served as loading control. (Right) N. benthamiana leaves were co-infiltrated with Agrobacterium carrying constructs with GFP-SUSA1 and SAUL1-RFP. Co-localization was analyzed by confocal laser scanning microscopy 72h after infiltration. The merge of GFP fluorescence 	  	  51	  (green), RFP fluorescence (red), and chlorophyll fluorescence (blue) indicated some partial overlap of GFP-SUSA1 and SAUL1-RFP (arrows). The scale bar represents 25 µm. 3.3.6 SAUL1 associates with SUSA1 in Nicotiana benthamiana  To test the interaction between SAUL1 and SUSA1, we transiently expressed 35S::HA-SAUL1 and Super::SUSA1-HA-FLAG in N. benthamiana. Co-immunoprecipitation by FLAG agarose beads pulled down HA-SAUL1 protein (Figure 3.9A), suggesting that SAUL1 and SUSA1 associate with each other in planta. However, in a reverse co-IP experiment, we were not able to pull down HA-SUSA1 using SAUL1-FLAG. This is probably because of the much lower expression level of SUSA1 compared with that of SAUL1 (Figure 3.14). The amount of SAUL1 associated SUSA1 protein may be too low to be detected in the reverse IP (Figure 3.9B). Or, in the reverse IP, the FLAG epitope is masked in the SAUL1-SUSA1 complex, and only free SAUL1 is being pulled down.     We also conducted a split-luciferase assay in N. benthamiana and a yeast two-hybrid assay to examine the interaction between SAUL1 and SUSA1 (Figure 3.9C and 3.9D). For split-luciferase assay, SUSA1 was fused with the C-terminal Luciferase (CLuc-SUSA1) and SAUL1 was fused with the N-terminal Luciferase (SAUL1-NLuc), both driven by the CaMV 35S promoters and transiently co-expressed in N. benthamiana leaves. Luciferase activity was detected only in the positive control, but not in the cells carrying SAUL1-NLuc and CLuc-SUSA1 (Figure 3.9C), an indication that SAUL1 and SUSA1 may not interact directly. In the yeast two-hybrid assay, SAUL1ΔNΔC was fused to the binding domain (BD) of the GAL4 transcription factor, and the SUSA1 full-length and the TIR domain of SUSA1 were fused to the GAL4 activation domain (AD), respectively. Co-transformed yeast cells with BD-SAUL1ΔNΔC and SUSA1-AD or SUSA1-TIR-AD were not able to grow on selection agar plates containing 3-AT (Figure 3.9D). Collectively, these data suggest that the interaction between SAUL1 and SUSA1 may be indirect.   	  	  52	  	    Figure 3.9. SUSA1 associates with SAUL1 in Nicotiana benthamiana. (A and B) Co-immunoprecipitation of HA-SAUL1 by HA-FLAG-SUSA1 (A) and co-IP of HA-SUSA1 by SAUL1-FLAG (B). The leaves of five-week-old Nicotiana benthamiana were infiltrated with Agrobacterium carrying the constructs expressing the indicated proteins. Total protein was harvested 48 h after infiltration. Total protein extracts were immunoprecipitated with anti-FLAG beads and subjected to western blot analysis. (D) Split-luciferase assay. Luciferase activity, as revealed by dark spots at the infiltration site in N. benthamiana leaves, after co-infiltration of Agrobacteria strains containing the indicated constructs. NLuc, N-terminal Luciferase; CLuc, C-terminal Luciferase.  (E) Yeast two-hybrid assay showed negative interactions between BD-SAUL1ΔNΔC and SUSA1-AD or SUSA1-TIR-AD. AD, GAL4 activation domain fusions; BD, GAL4 DNA binding domain fusions; -L-T-H, medium without leucine, tryptophan and histidine.  	  	  53	  3.3.7 The ubiquitination activity of SAUL1 is required for the saul1 phenotype and TN2 is not needed for the autoimmunity of saul1 SAUL1 has been shown to exhibit E3 ligase activity, but it remains unclear whether its ubiquitination activity is required for the activation of SUSA1-dependent immunity when it is knocked out or overexpressed. To test this, we made an E3 deficient mutant of SAUL1 by deleting the U-box domain (SAUL1∆U-box) and transformed the construct 35S::SAUL1∆U-box in saul1-1, Col-0 or susa1-14 background, respectively. The results showed that:1)SAUL1∆U-box cannot complement saul1-1. All of the 22 T1 transgenic plants obtained in saul1 background resembled saul1-1 (Figure 3.10A), suggesting that the ubiquitination activity of SAUL1 is required for saul1-mediated autoimmunity. Without the U-box domain, SAUL1∆U-box cannot complement the saul1-1 defects. 2) None of the 35S::SAUL1∆U-box T1 transgenic lines exhibited the dwarf, curly leaf phenotypes of SAUL1 overexpression plants, indicating that the E3 activity is also needed for the SAUL1 overexpression phenotype. 3) Among 36 T1 transgenic plants of 35S::SAUL1∆U-box in Col-0 background, 20 plants were WT like and 16 plants exhibited a seedling lethality phenotype resembling saul1 plants (Figure 3.10B), suggesting that deletion of the U-box domain likely causes a dominant-negative effect. Agreeing with this notion, all of the 36 transformants of 35S::SAUL1∆U-box in susa1-14 background exhibited wild-type morphology (Figure 3.10B), suggesting that the dominant-negative phenotypes of 35S::SAUL1∆U-box are dependent on SUSA1, like with saul1 mutants.     SUSA1 resides in an NLR gene cluster with two TIR-NB genes: CHS1 (CHILING SENSITIVE 1, AT1G17610) and TN2 (AT1G17615) (Figure 3.11). To test whether TN2 is required for saul1-mediated autoimmunity, we generated the saul1-1 tn2 double mutant. As shown in Figure 3.10C, the double mutant is saul1-like, suggesting that TN2 does not contribute to saul1 phenotypes.  	  	  54	   Figure 3.10. The E3 ligase activity is required for the autoimmunity of both the saul1-1 knockout and SAUL1 overexpression phenotypes; and TN2 is not required for saul1-mediated autoimmunity. (A) Morphology of three-week-old Col-0, saul1 and two representative transgenic plants of 35S:: SAUL1 ∆U-box in saul1-1.  (B) Morphology of four-week-old Col-0 and two representative transgenic plants of 35S:: SAUL1 ∆U-box in Col-0 or susa1-14 background, respectively.  Morphology of four-week old Col-0, saul1-1 and saul1-1 tn2 plants. Plants were grown at 28°C for two weeks and at 22°C for one week to reveal the yellowing saul1 phenotypes. 	  	  55	   Figure 3.11 Genomic arrangements of SUSA1, CHS1 and TN2. Boxes denote exons; lines denote introns; arrows indicate transcription directions. The regions of encoded protein domains are indicated below the corresponding genomic regions.   Figure 3.12. A working model for SAUL1 and SUSA1 function.  Substrate = SAUL1 E3 ligase substrate; predicted to be a negative regulator of PTI (see Discussion).  (A) In wild-type plants without infection, SAUL1 is expressed at a low level. The SAUL1 substrate accumulates and negative regulates PTI, hence basal resistance is off. On the other hand, SAUL1 associates with SUSA1 and SUSA1-mediated ETI is off. (B) In wild-type plants challenged with a compatible pathogen, SAUL1 gene expression is induced (from TAIR microarray data analysis). This causes enhanced ubiquitination and a further substrate decrease, releasing the negative regulation of PTI. PTI is enhanced 	  	  56	  under this scenario. On the other hand, SAUL1 associates with SUSA1 and SUSA1-mediated ETI is off.  (C) In wild-type plants challenged with an incompatible pathogen carrying an unknown effector that specifically targets SAUL1, SAUL1 is inactivated, leading to accumulation of the substrate to repress PTI. Meanwhile, loss of SAUL1 results in the constitutive activation of SUSA1, triggering strong ETI. (D) In saul1-1 plants, loss of SAUL1 results in high accumulation of the substrates to repress PTI and also constitutive activation of TNL SUSA1-mediated ETI. As a consequence, saul1 plants exhibit strong autoimmunity, which is dependent on PAD4 and EDS1, general TNL regulators.  (E) In SAUL1 overexpression plants, overexpression of SAUL1 leads to the reduction of its substrate protein level to activate PTI. On the other hand, SAUL overexpression can also lead to the activation of SUSA1-mediated ETI.    	  	  57	  3.4 Discussion From our SNIPER overexpression reverse genetics screen, we identified SAUL1/SNIPER3 as a snc1 enhancer when overexpressed (Figure 3.1A and 3.1B). SAUL1 encodes a U-box type E3 ubiquitin ligase with 12 ARM repeats at its C-terminus (Mudgil et al., 2004). SAUL1 overexpression also leads to enhanced resistance to pathogens in wild-type background (Figure 3.1C to 3.1F), indicating that SAUL1 is a positive regulator of immunity. However, loss-of-function of SAUL1 results in EDS1-/PAD4-dependent seedling lethality in Arabidopsis (Disch et al., 2015; Vogelmann et al., 2012), suggesting that SAUL1 is a negative regulator of immunity that represses EDS1-/PAD4-mediated defense. How to explain these seemingly opposite conclusions on SAUL1 function? From two independent saul1 suppressor screens conducted in Canada and Germany, we identified many alleles of saul1 suppressor susa1. Interestingly, SUSA1 encodes a TNL protein that is able to interact with SAUL1 in vivo. Since SAUL1 has a close homolog PUB43, further phenotypic immune analysis of the saul1 susa1 pub43 triple mutant revealed that the E3 ligase SAUL1 functions redundantly with PUB43 in positive regulation of PTI. SUSA1 seems to act as a TNL immune sensor to monitor SAUL1’s homeostasis (Figure 3.12). Either loss or overexpression of SAUL1 activates SUSA1-mediated immunity.      Positive PTI immune regulators can be guarded by NLR immune receptors. As a consequence, loss-of-function of these regulators would trigger autoimmunity through the activation of NLRs, masking the true susceptibility phenotypes of their knockout mutants. For example, the mekk1 and mpk4 single mutants and mkk1 mkk2 double mutant exhibit lesion mimic phenotypes with enhanced resistance to virulent pathogens (Qiu et al., 2008; Gao et al., 2008). These phenotypes are dependent on the CNL SUPPRESSOR OF MKK1 MKK2, 2 (SUMM2), suggesting that the MEKK1-MKK1/MKK2-MPK4 kinase cascade is guarded by SUMM2 (Zhang et al., 2012). mkk1 mkk2 summ2 triple mutant plants exhibit enhanced susceptibility to pathogens, revealing the true function of MKK1/MKK2 as positive regulators of PTI. Another well-studied guardee is RIN4 (RPM1-INTERACTING 4). 	  	  58	  RIN4 is targeted by two unrelated P. syringae effectors AvrB and AvrRpm1, leading to phosphorylation of RIN4 which triggers the activation of CNL RPM1 (RESISTANCE TO P. SYRINGAE PV MACULICOLA 1) (Chung et al., 2011; Liu et al., 2011). In addition, P. syringe effector AvrRpt2 cleaves RIN4, activating CNL RPS2 (RESISTANT TO P. SYRINGAE 2)-mediated immunity (Axtell and Staskawicz, 2003; Chung et al., 2011; Mackey et al., 2003). Knockout rin4 is lethal due to extreme autoimmunity caused by activation of RPS2 and RPM1, however, recent studies on rpm1 rps2 rin4 plants revealed that RIN4 functions to promote stomata opening through activation of the plasma membrane H+-ATPase AHA1 (Lee et al., 2015; Zhou et al., 2015). Bacterial effectors manipulate RIN4 to facilitate entry into plants (Lee et al., 2015; Zhou et al., 2015).     From our current study, loss of SAUL1 results in the activation of TNL SUSA1, leading to a seedling lethality phenotype. Therefore, the real biological function of SAUL1 is masked by the autoimmunity mediated by SUSA1 (Figure 3.12). Although SAUL1 shares 73% amino acid identities with its closest homolog PUB43 (Figure 3.3), PUB43 does not seem to be guarded by NLRs as pub43 single mutant plants do not exhibit any abnormal immune phenotypes. Moreover, PUB43 cannot rescue the saul1 defects (Figure 3.13), suggesting that PUB43 is not monitored by SUSA1. The saul1-1 susa1-5 pub43 triple mutant exhibits more P.s.t. DC3000 hrcC- growth, revealing that SAUL1 and PUB43 work redundantly as positive regulators of PTI. However, how SUSA1 monitors SAUL1 homeostasis is unclear. The slight enhanced susceptibility of susa1 single mutants is also intriguing (Figure 3.4A and 3.4B). It is possible that P.s.t. DC3000 and P.s.m. ES4326 may contain SUSA1-targeting effectors.  	  	  59	    Figure 3.13. PUB43 cannot complement saul1-1.  Morphology of three-week-old Col-0, saul1-1 and two representative transgenic plants of 35S::PUB43 in saul1-1. Plants were grown at 28°C for two weeks and 22°C for one week to reveal the yellowing saul1 phenotypes of saul1-1.      Positive regulators of PTI can often be targeted by pathogen effectors to suppress basal immunity. For example, Phytophthora infestans AVR3a and Xanthomonasoryzae pv. oryzae XopPXoo target positive defense regulators U-box E3 ubiquitin ligases CMPG1 and OsPUB44 respectively to promote virulence (Bos et al., 2010; Ishikawa et al., 2014). AVR3a directly binds CMPG1 to inhibit its E3 ligase activity, whereas XopPXoo specifically binds to the U-box domain of OsPUB44 to interfere with its activity (Bos et al., 2010; Ishikawa et al., 2014). The positive regulator SAUL1 of PTI can also likely be an effector target. This yet-to-be identified effector can then be indirectly recognized by the TNL immune receptor SUSA1 to trigger ETI (Figure 3.12). Under this guarding scenario, SAUL1 serves as the guardee of SUSA1 that is an intermediate protein between the effector and the NLR receptor.      One major question to be answered is what the protein substrate of SAUL1 is? SAUL1 is a membrane-associated PUB-ARM E3 ligase (Vogelmann et al., 2014). Although SUSA1 was identified as a genetic suppressor of saul1, it is unlikely to be a ubiquitination substrate of SAUL1 to be targeted for degradation, since when SAUL1 and SUSA1 were co-expressed 	  	  60	  in N. benthamiana, the SUSA1 protein level was not reduced significantly in the presence of SAUL1 (Figure 3.14). We also did not observe ubiquitinated SUSA1 forms (Figure 3.14). Based on the phenotypes of saul1 pub43 susa1 triple mutant plants, SAUL1 likely regulates PTI through ubiquitinating one or more membrane associated PTI negative regulator(s), leading to their further degradation by the proteasome (Figure 3.12). Hence, future identification of the ubiquitination substrate(s) of SAUL1 would be a critical step to understand how exactly SAUL1 regulates PTI. Identified from the CCSB interactome database (Dreze et al., 2011), one of SAUL1’s alleged interactors is LORE1/SD1.29. LORE1 encodes a bulb-type lectin S-domain-1 receptor-like kinase, which was shown to confer the recognition of lipopolysaccharide (LPS) from Gram-negative bacteria (Ranf et al., 2015). It can therefore be speculated that SAUL1 may act downstream of LORE1 upon LPS elicitation to trigger PTI.     SUSA1 encodes a typical TNL. The two motifs essential for proper NLR activity are the P-loop (phosphate-binding loop) motif and the MHD motif. The P-loop presumably coordinates with ATP binding and works as a molecular switch to turn on (ATP-bound) or off (ADP-bound) NLR (Hanson and Whiteheart, 2005). Mutations in the P-loop often result in loss of NLR function (Tameling et al., 2006; Xu et al., 2014a). From the current study, two P-loop mutants, susa1-7 and susa1-8, have been identified through the saul1-1 suppressor screens (Figure 3.3), suggesting that SUSA1 is a typical TNL protein that requires an intact P-loop. On the other hand, MHD motif is a conserved plant-specific motif that locates in the ARC2 sub-domain of the extended NB-ARC domain. In contrast with the effects of P-loop mutations, mutation of the Aspartic acid (D) in the MHD motif often results in auto-activated NLR proteins that induce pathogen-independent, constitutively activated defense responses in plants (van Ooijen et al., 2008; Williams et al., 2011; Zhang et al., 2012). Interestingly, SUSA1 protein contains K residue rather than D in MHD motif (Figure 3.3B), presumably conferring auto-activation. In support of this notion, expression of SUSA1 in N.benthamiana alone indeed triggers HR (Figure 3.15). Thus, it is possible that SUSA1 is an autoactive NLR 	  	  61	  in Arabidopsis, whose activity must be repressed by one or more negative regulator(s).  SUSA1 forms a head-to-head triplet cluster with two TIR-NB (TN) genes: CHS1 (CHILING SENSITIVE 1, AT1G17610) and TN2 (AT1G17615) (Figure 3.11). The head-to-head arrangement indicates a possible co-regulation between these genes as suggested by recent studies (Deslandes et al., 2003; Gassmann et al., 1999; Narusaka et al., 2009; Williams et al., 2014; Sarris et al., 2015; Jander et al., 2002; van der Biezen et al., 2002; Le Roux et al., 2015; Xu et al., 2015b; Bi et al., 2011). For example, TNL RPS4 (Resistance to Pseudomonas syringae 4) is genomically head-to-head with RRS1 (Resistance to Ralstonia solanacearum 1). RPS4 pairs with RRS1 to confer resistance to the bacterial effectors AvrRps4 or PopP2 (Deslandes et al., 2003; Gassmann et al., 1999; Narusaka et al., 2009; Williams et al., 2014; Sarris et al., 2015; Jander et al., 2002; van der Biezen et al., 2002; Le Roux et al., 2015). Similarly, CHS3 (CHILLING SENSITIVE 3), which encodes an atypical TNL with an additional LIM ( Lin-11, Isl-1 and Mec-3 ) domain, requires its adjacent head-to-head TNL gene CSA1 (CONSTITUTIVE SHADE-AVOIDANCE 1) (Xu et al., 2015b; Bi et al., 2011). However, as we did not isolate any alleles of chs1 or tn2 from the exhaustive saul1 suppressor screens, and knocking out TN2 does not suppress the autoimmunity of saul1-1 (Figure 3.10C), saul1 phenotypes do not seem to require the functionality of either CHS1 or TN2. However, we cannot rule out the possibility that TN2 and CHS1 might be functionally redundant to pair with SUSA1. The exact relationship between CHS1/TN2 and SAUL1 will be an interesting question to be addressed in the future.      	  	  62	  	   	  Figure 3.14. SAUL1 does not target SUSA1 for degradation. (A) HA-SAUL1 or an EV (empty vector) was co-expressed with SUSA1-HA-FLAG in N. benthamiana leaves. Leaf tissue was harvested 48 hours after infiltration. Total protein extracts were subjected to western blot analysis. Ponceau staining served as loading control. (B) Quantification of protein levels of SUSA1-HA-FLAG in the presence of HA-SAUL1 or EV in N. benthamiana. The band intensity was determined by ImageJ and was normalized to the Ponceau loading control. Data represent means of three replicates. Error bars are standard deviations.   	  	  63	   Figure 3.15. SUSA1 causes cell death when expressed in N. benthamiana. Transiently expressing SUSA1-HA-FLAG in N. benthamiana leaves caused hypersensitive responses in N. benthamiana. The picture was taken 48 hours after infiltration. Scale bar represents 1 cm.    	  	  64	  3.5 Materials and methods 3.5.1 Plant materials and growth conditions  All plants for assays were grown at 22°C growth chambers under long day conditions (16h light/ 8h dark). As saul1 phenotypes are temperature sensitive(Disch et al., 2015), they were grown at 28°C under long day conditions for seeds. The suppressor lines were grown at 25°C under long day conditions for 14 days in a growth cabinet and then transferred to 22°C. For protoplast isolation, Arabidopsis thaliana Col-0 plants were grown at 22°C under short day conditions (8h light/16h dark). 3.5.2 Plant materials and growth conditions  All plants for assays were grown at 22℃ growth chambers under long day conditions (16h light/ 8h dark). As saul1 phenotypes are temperature sensitive(Disch et al., 2015), they were grown at 28℃ under long day conditions for seeds. The suppressor lines were grown at 25°C under long day conditions for 14 days in a growth cabinet and then transferred to 22°C. For protoplast isolation, Arabidopsis thaliana Col-0 plants were grown at 22°C under short day conditions (8h light/16h dark). 3.5.3 Ethyl methanesulfonate (EMS) mutagenesis, saul1 suppressor screen and next generation sequencing (Li Lab) 100 mg (~5000) saul1-1 seeds were soaked in a solution of 0.1 M sodium phosphate (pH 5), 5% dimethyl sulphoxide, and 0.25% EMS for 16 hours with constant shaking. After incubation, the seeds were washed twice in 100 mM sodium thiosulphate for 15 min and three times in distilled water for 15 min.  	  	  65	      The mutagenized saul1 seeds were planted on half strength Murashige and Skoog (MS) plate for 10 days. Then ~4000 seedlings were transplanted on soil and grown at 28°C for seeds. M2 seeds from 25 M1 plants were harvested in each pool. For screening, ~500 M2 seeds from each pool were planted. Seeds from putative mutants reverting partially or completely to wild-type were kept.      The genomic DNA from the candidate suppressors was extracted using CTAB method (Li et al., 2001b) followed by the purification using Qiagen plant DNA extraction kit (Qiagen, Germany). The library preparation and Illumina sequencing were carried by BGI (Beijing Genomic Institute, China).  3.5.4 EMS mutagenesis, suppressor screen, next generation sequencing (Hoth Lab) For EMS mutagenesis, 500 mg seeds of saul1-1 mutants were incubated in 0.3% EMS for 15 hours with gentle agitation. After incubation, the seeds were washed in ddH2O 10 times.     The M2 plants rescuing the saul1-1 phenotype were backcrossed into saul1-1 mutants two times. The genotype of the suppressor lines was confirmed for the T-DNA insertion using the SAUL1 specific primers 5'-TGAGGCCAATCAAATGATTTC-3’ and 5’-TTTCCCCATTCATGAGTGAAG-3’ as well as the T-DNA insertion (SALK) specific primer LBa1 (5’-TGGTTCACGTAGTGGGCCATCG-3’), respectively.     For next generation sequencing total genomic DNA was extracted from 24-day-old mutant plants. 200 plants were pooled and pestled in liquid nitrogen in aliquots of 10 plants each pool. To each sample 800 µl extraction buffer (1% N-Laurylsarcosine, 100 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0), 100 mM NaCl) and 800 µl phenol/chloroform/isoamyl alcohol (25:24:1) were added and mixed. The samples were centrifuged for 10 minutes at 13500 x g and room temperature. The supernatant was precipitated with 80 µl 3M sodium acetate (pH 5.2) and 800 µl isopropanol for 30 minutes at -20 °C. After centrifugation for 10 min at 13500 x g and 4 °C the pellet was washed with 	  	  66	  1 ml 80 % ethanol twice. The genomic DNA was incubated with 50 µl R100 (100 µg/ml RNase A in TE buffer) for 30 minutes at 37 °C. To remove the RNase A, the samples were mixed again with equal amounts of phenol/chloroform/Isoamyl alcohol (25:24:1) and were centrifuged for 10 minutes at 13500 x g and 4 °C. The supernatants were washed with chloroform three times and were precipitated with 1/10 volume 3 M sodium acetate (pH 5.2) and 2.5 volumes ethanol for 4 hours at -80 °C. After centrifugation for 30 min at 13500 x g and 4 °C the pellet was washed with 1 ml 80% ethanol twice. The genomic DNA was resuspended in 50-100 µl ddH2O. Library preparation, HiSeq Illumina sequencing and the bioinformatic analysis were carried out by Eurofins Genomics (Ebersberg, Germany). 3.5.5 Infection assays For oomycete infection, two-week-old soil-grown seedlings were sprayed with a H.a. Noco2 conidiospore suspension at a concentration of 50,000 or 100,000 spores/ml. The infected plants were then domed and maintained at 18°C under 80% humidity in a long-day growth chamber. After 7 days, oomycete growth was quantified following a protocol described in (Zhang and Li, 2005).     For bacterial infection, leaves of 4-week-old plants were infiltrated with a suspension of P.s.m. ES4326, P.s.t. DC3000, P.s.t. DC3000 (AvrRpt2) or P.s.t. DC3000 (AvrRps4) at the dosage indicated in the figure legend respectively. Bacterial growth was assayed by quantification of colony-forming-units (cfu) at 0 dpi and 3 dpi, respectively, as described previously in (Li et al., 2001a). 3.5.6 Gene Expression Analysis Total RNA was extracted from four-week-old soil-grown plants using the EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, Canada). The extracted RNA was then 	  	  67	  reverse transcribed to cDNA with Easy ScriptTM reverse transcriptase (ABM, Canada). RT-PCR was conducted using the total cDNA as template to determine the expression of the tested genes. 3.5.7 ROS Assay The Arabidopsis leaf discs from four-week-old soil-grown plants were sliced by six cuts with a razor blade to increase surface area, and were placed into a distilled H20 containing 96-well plate for overnight incubation under dim light condition. After incubation, the water was removed, the elicitation buffer containing 20 mM luminol, 10 mg mL–1 horseradish peroxidase with 100 nM flg22 was added into the plate. Quantification of luminescence was determined by a 96 microplate luminometer.  3.5.8 Construction of plasmids For the construction of pCam1300 SAUL1, the SAUL1 cDNA was amplified from the wild-type cDNA using primers 5'-CGCGCTCTAGAATGGTTGGAAGCTCGGATG-3’ and 5'-CGCCGGGATCCTGCGATGTTTGGGAATATACTTG-3’. The amplified fragment was then digested with XbaI and BamHI and ligated into pCam1300 vector. For the construction of pCam1300 SAUL1∆U-box, the SAUL1 cDNA was amplified from the wild-type cDNA using primers 5'-CGCGCTCTAGAATGAGATCCAGGAATGATGCTGC-3’ and 5'-CGCCGGGATCCTGCGATGTTTGGGAATATACTTG-3’. The amplified fragment was then digested with XbaI and BamHI and ligated into pCam1300 vector. The HA-SAUL1 construct was described previously (Drechsel et al., 2011) For cloning GFP-SUSA1, SUSA1 (At1g17600) was amplified from genomic DNA using primers 5'-CACCATGGTGTCCTCCTCTGCAC-3’ and 5'-GGATCMCTTGAAAACACGCAGGAG-3’. The PCR fragment was cloned into the 	  	  68	  pENTR/D-TOPO vector (Thermo Fisher Scientific, Waltham, USA) and the construct was confirmed by sequencing. Using the gateway cloning technology (Thermo Fisher Scientific), the genomic SUSA1 fragment was recombined into the destination vector pMDC43 for N-terminal fusion (Curtis and Grossniklaus, 2003). The GFP-PUB43 construct was described previously (Drechsel et al., 2011).  The constructs: pCam1300 SAUL1, pCam1300 SAUL1∆U-box and GFP-PUB43 were electroporated in Agrobacterium tumefaciens GV3101 and transformed into Arabidopsis by a floral dipping method (Clough and Bent, 1998). For cloning SAUL1-RFP, SAUL1 cDNA was amplified as previously described [51]. Using the gateway technology (Thermo Fisher Scientific, Waltham, USA) SAUL1 was recombined from the pENTRTM/D-TOPO® vector into the destination vector pH7RWG2.0 for N-terminal fusion with RFP (Karimi et al., 2007). The binding domain vector for the yeast two-hybrid experiments was cloned from the previously described pENTR_SAUL1ΔNΔC vector (Drechsel et al., 2011). The SAUL1ΔNΔC fragment was cloned into the pGBT9 vector (provided by Frederik Börnke, Leibniz-Insitut für Gemüse- und Zoerpflanzenbau Großbeeren, Germany) by using the gateway cloning technology (Thermo Fisher Scientific, Waltham, USA). The coding sequence of SUSA1 was amplified using primers 5´-CACCATGGTGTCCTCCTCTGCAC-3´ and 5`- GGATCMCTTGAAAACACGCAGGAG -3´. For cloning the TIR domain, SUSA1-TIR was amplified from cDNA using the primers 5´-CACCATGGTGTCCTCCTCTGCAC-3´ and 5`-GTGGCTTGAAACCACGCC-3`. SUSA1 and the TIR domain of SUSA1 (SUSA1-TIR, CDS 1-462 (exon 1)) were recombined from the entry vector into the destination vector pGAD-CF with a C-terminally fused activation domain (provided by Frederik Börnke, Leibniz-Insitut für Gemüse- und Zierpflanzenbau Großbeeren, Germany) by using the gateway cloning technology (Thermo Fisher Scientific, Waltham, USA).  	  	  69	  3.5.9 Transformation of yeast cells  Transformation of the yeast strain AH109 was carried out according to Gietz et al. (1997) (Gietz et al., 1997). In brief, the binding and activation domain vectors were transformed simultaneously and the cells were spread on yeast minimal medium (SD medium: 0,66% Yeast Nitrogen Base without amino acids, 0,066% amino acid mix, 2% glucose) lacking leucine and tryptophan (SD -L-W). After three days of incubation at 29°C, overnight cultures of single colonies were grown in double dropout medium (SD -L-W) under continuous shaking for 24 hours at 29°C. The optical density was set to OD600=4 and a dilution series from 10-1 to 10-3 was dripped on selection agar plates lacking histidine (SD -L-W-H) and containing 0.5 mM 3-Amino-1,2,4-triazole (3-AT) as well as on SD -L-W as a control. As a positive control for transformation pGAD-424_KNU 3´UTR and pGBKT7_TPL were transformed, as a negative control pGAD-424_KNUΔEAR and pGBKT7_TPL (Causier et al., 2012). 3.5.10 Split-luciferase assay The split-luciferase assay system has been previously described (Chen et al., 2008). Briefly, the constructs were transformed into Agrobacterium tumefaciens GV3101 cells. The cells were collected and resuspended in an infiltration medium (10 mM MES, pH 5.6, 150 µM acetosyringone) to a final concentration of OD600 = 0.6. Four-week-old N. benthamiana leaves were infiltrated using 1 ml syringes with different combinations of bacterial suspensions. The plants were incubated at room temperature in the dim light for 48 h. 1 mM of D-Luciferin (Sigma-Aldrich) dissolved in DMSO, 10 mM MgCl2 and 10 mM MES, pH 5.6, were infiltrated into the Agrobacteria-infiltrated leaves before cutting the leaves for luminescence imaging. Luminescence was visualized after a 20-30 min exposure using a CCD camera with a low-light imaging system (ChemiDocTM XRS+; Bio-Rad, http://www.bio-rad.com/) using a 3x3 binning 	  	  70	  settings for all images. 3.5.11 Protoplasts isolation Protoplast isolation was carried out as previous protocols with minor changes (Drechsel et al., 2011). Mesophyll protoplasts were isolated from leaves of 6 weeks-old plants in protoplasting buffer (500 mM sorbitol, 1 mM CaCl2, 0.25% Macerozym R10, 1% cellulase R10, 10 mM MES-KOH, pH 5.7). The protoplast transformation was performed with 150 µl of protoplasts, 20 µg plasmid DNA and 165 µl PEG-Ca buffer (40 % PEG 4000, 200 mM sorbitol, 100 mM CaCl2). The transformation sample was mixed completely by gently rotating the tube and was incubated for 30 minutes at room temperature in the dark. To stop this process, the sample was diluted with W5 buffer (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, 2 mM MES, pH 5.7) in three steps of 500 µl, 1 ml and 1.5 ml. The sample was centrifuged at 60 x g for 3 minutes (without brake) and was washed with 3 ml W5 buffer twice. The protoplasts were incubated for 24 hours at room temperature in the dark and GFP signals were analysed by confocal laser scanning microscopy. 3.5.12 Confocal laser scanning microscopy To detect fluorescence of GFP-fusion proteins in living cells, confocal laser scanning microscopy was applied by using the Leica TCS SP8 Confocal Platform (Leica Microsystems, Wetzlar, Germany). The cytosol/nucleus marker Wave1RmCherrypNIGEL (Geldner et al., 2009) and the ER marker ER-rk CD3-959 (Nelson et al., 2007) were used for co-localization experiments. For excitation of GFP and mCherry/RFP laser light of 488 nm and 561 nm was used, respectively. The detection windows ranged from 496 nm to 511 nm (GFP), 569 nm to 591 nm (mCherry/RFP) and from 690 nm to 708 nm for detection of chlorophyll auto-fluorescence. 	  	  71	   3.5.13 Transient protein expression and co-immunoprecipitation in N. benthamiana The transient protein expression in N. benthamiana leaves was carried out as previously described (Drechsel et al., 2011). The infiltration buffer was adjusted to 0.1 M Na-phosphate buffer (pH 6.0), with 10 mM MgCl2 and 0.01 mM acetosyringone. GFP-SUSA1 and pBIN19-35S::GFP (Tan, 2012) were co-infiltrated with vector P19 (Lakatos et al., 2004), respectively. The Co-IP protocol was followed as previously described (Moffett et al., 2002; Xu et al., 2014b). 3.5.14 Isolation of total protein from N. benthamiana leaves For total protein isolation infiltrated N. benthamiana leaves were grounded in liquid nitrogen. To each sample 700 µl phenol and 700 µl crude extract buffer (30% sucrose, 2% SDS, 5% DTT, 0.1M Tris-HCl pH 8.0) were added. The samples were centrifuged for 5 minutes at 10000 x g at room temperature. The supernatant was precipitated with 1.5 ml 0.1M ammonium acetate (in methanol) for 45 minutes at -20°C. After centrifugation for 8 minutes at 10000 x g the pellet was washed with 800 µl 0.1M ammonium acetate (in methanol) and 800 µl 80% acetone two times, respectively. The pellet was resuspended in 100 µl Laemmli buffer.  3.5.15 SDS-PAGE and immunoblotting For SDS-PAGE, the TruPAGE™ Precast Gels (gradient: 4-20%) (Sigma-Aldrich Chemie GmbH, Taufkirchen, Deutschland) were used and the proteins were transferred to nitrocellulose membrane. For immunodetection the anti-GFP antibody (dilution: 1:3500; 	  	  72	  rabbit IgG; Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) and Goat Anti-Rabbit IgG Antibody with HRP (dilution: 1:5000; peroxidase conjugated; Merck Millipore, Merck Chemicals GmbH, Darmstadt, Germany) were used. 3.5.16 Accession numbers The T-DNA alleles of saul1-1, susa1-14, susa1-15, pub43-1 and tn2 are SALK_063974, SALK_200339, SALK_069931, SALK_112870 and SALK_204239, respectively.   	  	  73	  4. The ADR1 family is required for the signalling of typical TNL-mediated immunity in Arabidopsis1 4.1 Summary Nucleotide-binding leucine-rich repeat proteins (NLRs; or Nod-like receptors) serve as intracellular immune receptors in animals and plants. Sensor NLRs recognize pathogen-derived effector molecules and trigger robust host defense responses. Recent studies revealed the role of the three CC-type NLRs (CNLs) of the ADR1 family, ADR1, ADR1-L1 and ADR1-L2, as redundant helper NLRs, whose function is required for defense mediated by multiple sensor NLRs. Here we showed that the autoimmunity of snc1 and chs2, which encodes typical TIR-type NLRs (TLRs) is fully suppressed by adr1 adr1-L1 adr1-L2 triple mutant, suggesting that the ADR1 triple function downstream of TLR signalling. Using the snc1-suppressing phenotype as criteria, we found that among the three ADR1 genes, ADR1 is the leading contributor while ADR1-L1 is the least contributor. Interestingly, we found the unexpected enhancement of snc1-related phenotypes in adr1-l1 snc1 double mutants, possibly because of the over compensation from the transcripts of ADR1 and ADR1-L2. Collectively, we showed a complex genetic interplay among ADR1 genes, which are required for typical TNL-mediated immune signalling in Arabidopsis.                                                         1A portion of this chapter has been published. Dong, O. *; Tong, M. *; Bonardi, V.; Kasmi, F.; Woloshen, V.; Wünsch, L.; Dangl, J.; Li, X. (* Co-first authors) (2016) New Phytologist. doi: 10.1111/nph.13821 	  	  74	  4.2 Introduction Plants are equipped with two layers of innate immunity to combat with pathogens. The first layer is dependent on membrane localized pattern recognition receptors (PRRs), which recognize conserved pathogen-associated molecular patterns (PAMPs) to turn on the immune responses termed as PAMP-triggered immunity (PTI) (Boller and Felix, 2009). Adaptive pathogens have evolved to deliver effector molecules to dampen PTI and favor their own growth. To overcome the interference of pathogens, plants have evolved a second layer of immunity that is initiated by intracellular nucleotide-binding/leucine-rich repeats (NLR) immune receptors. The NLR proteins are able to recognize the presence of effectors and trigger effector-triggered immunity (ETI) (Jones and Dangl, 2006). The NLR proteins further fall into two different classes depending on their different N-termini. The first class has a N-terminal coiled-coil (CC) domain, termed as CNL protein, whereas the second class contains a N-terminal Toll/Interleukin-1-receptor-like (TIR) domain, termed as TNL protein (Meyers, 2003). The presence of either a CC or TIR domain typically determines whether the NLR mediated defense response requires either NDR1 (Non-race-specific Disease Resistance) or the EDS1 (Enhanced Disease Susceptibility 1) / PAD4 (Phytoalexin Deficient 4) / SAG101 (Senescence Associated Gene 101) complex, respectively (Aarts et al., 1998). However, the detailed molecular linkages between these pathways remain elusive.      SNC1 encodes a canonical TNL that was identified through a suppressor screen of npr1 (nonexpresser of PR gene 1) (Zhang et al., 2003b; Xu et al., 2014a). The mutant snc1 carries a glutamic acid to lysine gain-of-function mutation in the linker region between the NB and LRR domains (Zhang et al., 2003b). This mutation consequently results in constitutive activation of defense responses with increased levels of SA, constitutive expression of PR genes, and increased resistance against virulent pathogens such as the bacteria Pseudomonas syringae pv. maculicola (P.s.m) ES4326 and the oomycete Hyaloperonospora arabidopsidis (H.a.) Noco2 (Zhang et al., 2003b). 	  	  75	      ACTIVATED DISEASE RESISTANCE 1 (ADR1), ADR1-LIKE 1 (ADR1-L1) and ADR1-LIKE2 (ADR1-L2) are three homologous genes that are redundantly required for basal resistance and ETI responses mediated by the CNL protein RESISTANT TO PSEUDOMONAS SYRINGAE 2 (RPS2) and TNLs RECOGNITION OF PERONOSPERA PARASITICA 2 (RPP2) and RECOGNITION OF PERONOSPERA PARASITICA 4 (RPP4) (Bonardi et al., 2011). ADR1s encode CNLs with a non-canonical N-terminal CC domain, which shares closest sequence homology with RESISTANCE TO POWDERY MILDEW8 (RPW8), a resistance (R) gene that confers a broad range of powdery mildew resistance in Arabidopsis (Xiao et al., 2001; Grant et al., 2003; Collier et al., 2011). Beyond the typical effector recognition function of NLRs, the ADR1 family may work as helper NLRs required for typical NLRs (Bonardi et al., 2011).      In this study, we further investigated the specificity of ADR1’s requirement for a variety of different NLRs and found that ADR1s are fully required for the functionality of typical TNLs including SNC1 and CHS2, but not that of CHS3, SLH1 and UNI encoding atypical TNLs and CNLs. Moreover, we also found that among the three ADR1 genes, ADR1 is the biggest contributor whereas ADR1-L1 negatively regulates snc1-mediated immunity. Collectively, these data indicate the complex genetic interplay of ADR1s downstream of typical TNLs.   	  	  76	  4.3 Results 4.3.1 The ADR1 gene family is fully required for SNC1-mediated immunity In order to test whether the ADR1 family is required for SNC1-mediated immunity, we introduced the T-DNA knockout mutations in an adr1 adr1-L1 adr1-L2 triple mutant (hereafter, adr triple) (Bonardi et al., 2011) into the autoimmune mutant snc1. Intriguingly, the dwarfism of snc1 was completely suppressed in the presence of adr1 adr1-L1 adr1-L2 triple mutations (Figure 4.1A). In addition, consistent with the suppression of morphology, the resistance against virulent bacteria pathogen Pseudomonas syringae pv. maculicola (P.s.m) ES4326 (Figure 4.1B) and the levels of salicylic acid (Figure 4.1C) of snc1 mutants were largely suppressed in snc1 adr triple mutants, suggesting that the ADR1 family is fully required for snc1 downstream signalling. 	  	  77	   Figure 4.1 The ADR1 family is required for snc1-mediated immunity (A) Morphology of four-week-old soil-grown Col-0, adr triple snc1 and snc1 plants. (B) Bacterial growth of P.s.m. ES4326 in the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.m. ES4326 at OD600=0.001. Quantification of colony-forming-units (cfu) was examined at 0 and 3 dpi, respectively. Data represent means of five replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6). (C) Total SA levels in four-week-old soil grown Col-0, snc1, adr triple snc1 and adr triple plants. Four replicates were included for each genotype. Data represent means of four 	  	  78	  replicates. Error bars are standard deviations. Different superscripts indicate significant differences between groups, whereas identical superscripts denote no significant differences (One-way ANOVA, GraphPad Prism 6). 4.3.2 Genetic interplay among the three redundant ADR1 genes To further elucidate the detailed contribution of each ADR1 gene in the requirement for snc1 downstream signalling, we generated a collection of double mutants: snc1 adr1, snc1 adr1-L1, snc1 adr1-L2, and triple mutants: snc1 adr1 adr1-L1, snc1 adr1 adr1-L2, snc1 adr1-L1 adr1-L2. The collection of mutants was then assayed for morphology, fresh weight and PR gene expressions (Figure 4.2A-C). The results showed that, among the three adr1 single knockout genes, adr1 suppressed snc1-related phenotypes the most, whereas adr1-l2 did not show significant suppression or the suppression was too small to be detected. Interestingly, we observed snc1-enhancing phenotypes in snc1 adr1-L1 double mutant (Figure 4.2). In addition, the snc1-enhancing phenotypes in snc1 adr1-L1 double mutant were largely suppressed by adr1 and fully suppressed by adr1 adr1-L2 as observed in morphology, fresh weight and the expression levels of PR1 and PR2 (Figure 4.2), suggesting that the snc1-enhancing phenotypes in snc1 adr1-L1 are dependent on ADR1 and ADR1-L2.   	  	  79	   Figure 4.2 Characterization of combinatory mutants between snc1 and adr1s.  (A) Morphological phenotypes of four-week-old WT, snc1, snc1 adr1-L1, snc1 adr1-L2, snc1 adr1, snc1 adr1-L1 adr1-L2, snc1 adr1 adr1-L1, snc1 adr1 adr1-L2 and snc1 adr1 adr1-L1 adr1-L2 plants grown at 22°C under long day conditions (16 hr light/8hr dark). (B) Fresh weights of four-week-old plants of the indicated genotypes grown at 22°C under 	  	  80	  long day conditions (16hr light/8hr dark). Six replicates were included for each genotype. Error bars are standard deviations. One-way ANOVA was used to calculate the statistical significance between genotypes, as indicated by different letters (P < 0.05). (C, D) Relative transcript levels of PR1 and PR2 (C); ADR1 and ADR1-L2 (D) in the indicated genotypes as determined by RT-PCR. Total RNA was extracted from four-week-old plants grown at 22°C under long day conditions (16hr light/8hr dark). ACT1 was used to normalize the transcript levels. Data represent means of three replicates. Error bars are standard deviations. One-way ANOVA was used to calculate the statistical significance between genotypes, as indicated by different letters (P < 0.05).  4.3.3 Loss of all three ADR members completely suppresses the phenotypes of the typical TNL CHS2, but not that of atypical NLRs: CHS3, SLH1 and UNI   When the adr1 triple (adr1-1 adr1-L1-2 adr1-L2-4) snc1 quadruple mutant was generated, a complete snc1-suppressing phenotype was observed (Figure 4.1A under UBC and 4.3A under UNC growth conditions), suggesting that ADRs are fully required for snc1 signalling.      We then tested whether the autoimmune phenotypes caused by additional NLR gain-of-function mutants also require the combined action of the ADR helpers. We crossed the adr1 triple mutant into chs2-1, chs3-1, slh1-9 and uni-1D, each of which causes autoimmune phenotypes under particular growth conditions. The uni-1D mutant carries a missense mutation in a CNL (At1g61180) gene in Ws-0 (Wassilewskija), causing severe dwarfism and seedling-lethality under certain conditions (Igari et al., 2008). uni-1D was introgressed to Col-0 and uni-1D/+ plants were used for our cross with the adr1 triple mutant. The Arabidopsis slh1 (sensitive to low humidity 1) mutant has a mutation in the WRKY domain of the atypical TNL RRS1 that causes activation of defense responses and hypersensitive cell death (Noutoshi et al., 2005). 	  	  81	      As shown in Figure 4.3B, the adr1 triple mutant completely suppressed chs2-1 under chs2-1-phenotype-inducing growth conditions, although leaves from the suppressed, wild-type sized plants were often curled. We observed weak or partial suppression of the autoimmune phenotypes of chs3 encoding an atypical TNL with TNL-LIM fusion (Yang et al., 2010), uni-1D (Igari et al., 2008) and slh1-9 (Noutoshi et al., 2005), in each of the respective phenotype-inducing growth conditions (Figure 4.3C-E, Figure 4.4C). We also observed weak suppression of the seedling lethal phenotype for uni-1D adr1 triple plants under our short day conditions on plates and on soil (Figure 4.4). Together, these results are consistent with a general helper function for the ADR family for NLR signalling (Bonardi et al., 2011). More specifically, the ADRs seem to be fully required for typical TNL signalling. We collected all known epistasis data to address what possible common signalling pathway might function downstream of the ADR helper NLRs and found that loss of SA biosynthesis was the only function that also suppressed all of the tested gain-of-function NLR mutations. This is consistent with the loss of pathogen-induced SA accumulation in the triple adr mutant (Bonardi et al., 2011).    	  	  82	   Figure 4.3 adr1 triple mutant suppresses the autoimmune phenotypes of gain-of-function typical TNL mutants, but not others1. (A) Morphological phenotypes of four-week-old WT, snc1, snc1 adr1 triple and adr1 triple mutant plants grown at 22°C under long day conditions (16hr light/8hr dark). (B) Morphological phenotypes of three-week-old WT, chs2-1, chs2-1 adr1 triple and adr1 triple mutant plants grown at 16°C under long day conditions (16hr light/8hr dark). Asterisk denotes the curled leaf suppression phenotype of some chs2-1 adr1 triple mutant plants. (C) Morphological phenotypes of three-week-old WT, chs3-1, chs3-1 adr1 triple and adr1 triple mutant plants grown at 16°C under long day conditions (16hr light/8hr dark). (D) Morphological phenotypes of three-week-old WT, slh1-9, slh1-9 adr1 triple and adr1 triple mutant plants grown at 22°C under long day conditions (16hr light/8hr dark). (E) Morphological phenotypes of six-week-old WT, uni-1D/+, uni-1D, uni-1D adr1 triple and adr1 triple mutant plants grown at 21°C/18°C under short day conditions (9hr light/15hr dark).                                                        1This figure was generated by Bonardi V., Kasmi F. and Wünsch L. from UNC   	  	  83	   Figure 4.4 Partial suppression of the uni-1D autoimmune pheonotypes by adr1 triple mutant1. (A) Morphological phenotypes of four-week-old WT, uni-1D/+, uni-1D adr1 triple and adr1 triple mutant plants grown at 22°C under long day conditions (16hr light/8hr dark). (B) Morphological phenotypes of 14-day-old WT, uni-1D/+, adr1 triple, uni-1D and uni-1D adr1 triple seedlings grown at 22°C in continuous light on 1/2 MS agar. (C) Fresh weights of eight week old uni-1D and adr1 triple uni-1D plants grown at 21°C/18°C under short day conditions (9hr light/15hr dark). One-way ANOVA was used to calculate the statistical significance between genotypes, as indicated by different letters (P < 0.002).                                                         1This figure was generated by Bonardi V., Kasmi F. and Wünsch L. from UNC   	  	  84	  4.4 Discussion Here we reported that the triple mutant of adr1 adr1-L1 adr1-L2 is able to completely suppress the autoimmunity mediated by the typical TNL proteins SNC1 and CHS2 but not that of the atypical TNLs or CNLs CHS3, SLH1 and UNI. Using the snc1-suppressing phenotype as criteria, these three ADR1 genes of ADR1 family seem to exhibit unequal redundancy, where ADR1 seems to be the major contributor while ADR1-L1 is the minor contributor. The unexpected snc1-enhancing phenotypes of adr1-L1 loss-of-function alleles reveal an apparent negative role in plant defense. The snc1-enhancing phenotypes in snc1 adr1-L1 mutants are fully dependent on ADR1 and ADR1-L2. It is possible that loss of ADR1-L1 results in the over compensation in the synthesis of transcripts for ADR1 and ADR1-L2, as revealed by the up-regulated expression of ADR1 and ADR1-L2 in the RT-PCR assays.      The non-canonical function of the ADR1 family as helper NLRs is reminiscent of NLRC4 (Nod-like receptor 4) (Kofoed and Vance, 2011). NLRC4 associates with two independent immune receptors NAIP2 (neuronal apotopsis inhibitory protein 2) and NAIP5 upon PAMP perception. In this scenario, NLRC4 works as a signalling convergent module to transduce signals from the sensor NLRs to activate downstream defense responses (Kofoed and Vance, 2011). Similarly, the ADR1 family could play a general role to mediate signal transduction from different NLRs, especially from typical TNLs.      The function of the ADR1 family resembles those of PAD4 and EDS1, which are signalling intermediates of many typical TNLs upstream of SA synthesis (Wiermer et al., 2005). These observations beg many questions to be addressed in the future. These questions include: What is the relationship between EDS1/PAD4 and ADRs? Where and how do these CNLs transduce signal downstream of TNLs? What protein partners are working together with these helper ADRs and how do the ADR protein dynamics change during defense? Answers to these questions will be key to understanding the involvement of ADRs in the 	  	  85	  activation of sensor TNLs.   4.5 Materials and methods 4.5.1 Plant materials used Arabidopsis mutants used in this thesis include snc1 (Li et al., 2001), adr1-1 (Bonardi et al., 2011), adr1-L1-2 (Bonardi et al., 2011), adr1-L2-4 (Bonardi et al., 2011), lsd1-2 (Jabs et al., 1996), chs1-2 (Wang et al., 2013), chs2-1 (Huang et al., 2010), chs3-1 (Yang et al., 2010), uni-1D (Igari et al., 2008), and slh1-9 (Noutoshi et al., 2005). 4.5.2 Growth conditions For soil grown plants, seeds were vernalized at 4°C for two days, sown onto sterile soil and transferred to plant growth rooms for either long day (22°C/18°C, 16h light/8h dark; ~50% relative humidity) or short day (21°C/18°C, 9h light/15h dark; ~50% relative humidity) or continuous light (22°C) conditions as specified in figure legends. Phenotypes were scored at indicated time points. For all agar plate-grown seedlings, seeds where surface sterilized and sown on 1/2 MS agar plates, vernalized for two days and grown under long day at 22°C.  4.5.3 Plant genotyping Mutant genotyping primers used are as follows: adr1 (SAIL_842_B05) ADR1-1_s-Gen: CAA AGG ACG ATG ATG TTC GAG, ADR1-1_as: CGG ATT GTT CAC TAT AGT AAG G, LB_SAIL: TTT CAT AAC CAA TCT CGA TAC AC; adr1-L1-1 (SAIL_302_C06) L1_1-s: ATG GCC ATC ACC GAT TTT TTC, adr1-L1_as: GTC AGG AAC AGG ATT TCC AG, LB_SAIL; adr1-L2-4 (Salk_126422) PHX21_1_s: ATG GCA GAT ATA ATC 	  	  86	  GGC GG, PHX_ReT4_as: TGG GAG ATT GTG ACA CAG TC, LB1.3: ATT TTG CCG ATT TCG GAA C; uni-1D (Col-0, introgressed Ws line): VB14: GTT ATT TCT CGG AGA TAC CAT GC, VB15: GGA CAG TTT GAA ACA TCC ATG, Col-0 amplicon is ~300bp and uni-1D amplicon is ~260bp; chs2 (RPP4) VB12: GAT TGA CCT TGT ATA TGA GGT GG, VB13: CAC TCA TCT TTG TCC CTT CCT TTT GAA, cut amplicon with MboII at 37°C o/n, Col-0 138bp and 35bp, chs2 138bp and 60bp; chs3 VB10: TCC TCC TTA CTC CTT GTG AGA C, VB11: TCT CTC TCT CAC TCT CTT CGT AGT TCC CA, cut amplicon with Bci130I at 37°C or 8hr, Col-0 170bp and 25bp, chs3 194bp; slh1-9 LW1: GTT ATA TCG ACG TTG GAT GCA G, LW2: CCA GCA AGT TTA GGA TGA TTA CG, cut amplicon with DdeI at 37°C o/n, Col-0 260bp and 120bp, slh1-9 380bp. cpr1 (SALK_045148) LP: TTT CGT AAA TTT TTA CAC AAA ATC G, RP: TGT GAG TAG CCT TGT CTT GGG. To genotype homozygous eds5-3, SNP primers F: ACT TCA GAG CGG TGA TCA GA and R: CAT CAA CGG TCC ACA AGT C were used. All mutant combinations were confirmed by genotyping.  4.5.4 Infection assay Ten-day-old soil-grown Arabidopsis seedlings were spray-inoculated with freshly harvested H.a.Noco2 spores re-suspended in water. Infected plants were kept at 18ºC with 80% humidity for seven days before data collection. Growth of the pathogen was measured by totaling the number of spores per gram of fresh weight.  4.5.5 Total SA measurement Leaf tissue was harvested from four-week-old Arabidopsis plants and homogenized and mixed with 0.2 mL 90% methanol. Samples were sonicated using a water bath sonicator for 20 minutes and centrifuged at 15000 g for 20 minutes. 0.3 mL 100% methanol was added to 	  	  87	  the debris for a second extraction. Samples were thoroughly votexed, spun down again and the supernatant from the two extractions were combined and left to dry overnight at room temperature. The next day, 0.1 mL β-glucosidase solution (80unit/mL β-glucosidase (Sigma G0395), in 0.1M NaAc, pH5.2) was added to each sample. Samples were vortexed and sonicated for 5 minutes and incubated at 37°C for 90 minutes. 0.5mL 0.5% TCA (Sigma T6399) was added to the samples. Samples were spun down at 15000g for 15 minutes and the supernatant was transferred to a new set of tubes and was extracted 3 times using extraction medium (ethylacetate:cyclopentant:isopropanol=100:99:1). The combined extraction product was left to dry overnight at room temperature. SA samples were dissolved in mobile phase (0.2M KAc, 0.5mM EDTA, pH5.0) and the quantity of SA was measured using HPLC. The abundance of SA was presented as µg SA per gram fresh weight of plant tissue. 4.5.6 RNA extraction and gene expression analyses Total RNA was extracted from two-week-old seedlings grown on 1/2 MS medium or four-week-old soil grown plants using Totally RNA kit (Ambion). Reverse transcription was performed using Easyscript Reverse Transcription Kit (ABM). Semi-quantitative PCR was performed as described before (Zhang et al., 2003). Real-time PCR was performed using Perfect Realtime Kit (TAKARA). Sequences of the primers used are ACT7 F: GGTGTCATGGTTGGTATGGGTC, R: CCTCTGTGAGTAGAACTGGGTGC; PR1 F: GTAGGTGCTCTTGTTCTTCCC, R: CACATAATTCCCACGAGGATC; PR2 F: GCTTCCTTCTTCAACCACACAGC, R: CGTTGATGTACCGGAATCTGAC; ADR1 F: ATAGTGAACAATCCGAGGTT, R: TTTCATCCATTTCCCCTGT; ADR1-L2 F: CTTGTGAAAGATCCAAGGTT, R: TGAGTCATTTCTCCTGTGT. 	  	  88	  4.5.7 Protein extraction and western blot analysis Total protein was extracted from two-week-old Arabidopsis seedlings grown on 1/2 MS medium. The whole extraction was performed either on ice or in a 4°C cold room. Tissues were homogenized and mixed with extraction buffer (100 mM Tris-HCl pH 8.0, 0.1% SDS and 2% β-mercaptoethanol). Samples were vortexed and centrifuged at 15000 g for 10 minutes. SDS loading buffer was added to supernatants and samples were boiled for 5 minutes before loading onto a SDS-PAGE gel. After electrophoresis, separated protein samples were transferred to a membrane and subjected to western blot analyses. 4.5.8 Transient protein expression and co-immunoprecipitation in N. benthamiana The transient protein expression in N. benthamiana leaves was carried out as previously described (Drechsel et al., 2011). The infiltration buffer was adapted to 0.1 M Na-phosphate buffer (pH 6.0), with 10 mM MgCl2 and 0.01 mM acetosyringone. The Co-IP protocol was followed as previously described (Moffett et al., 2002; Xu et al., 2014b).         	  	  89	  5. Discussion SNC1 encodes a typical TNL that has been extensively studied in our lab over the last 15 years. The mutant snc1 harbors a gain-of-function mutation that renders snc1 with constitutively activated defense responses including enhanced PR gene expression, elevated levels of salicylic acid and reduced pathogen growth (Li et al., 2001a; Zhang et al., 2003b). Additionally, the constitutive defense responses in snc1 lead a dwarf morphology with dark green and curly leaves. Forward genetic screens including MOS (Modifier of snc1) snc1 suppressor and MUSE (Mutant, snc1-enhancing) snc1 enhancer screens in the snc1 background have resulted in successful identification of many important regulators of NLR-mediated immunity (Johnson et al., 2012; Huang et al., 2013).      Studies on individuals in the collection of identified genes from the genetic screens, including CPR1, MUSE3, MUSE10 and MUSE12, have highlighted the significant role of ubiquitination in the homeostatic control of the immune receptors (Cheng et al., 2011a; Huang et al., 2014b, 2014a). In order to identify key E3 ubiquitin ligases in plant immunity, we conducted a snc1-influencing plant E3 ubiquitin ligase reverse genetic (SNIPER) screen and identified six SNIPER candidates: four snc1-suppressors and two snc1-enhancers. Among the six SNIPERs, SNIPER 3 was chosen for characterization and described thoroughly in Chapter 3.     The ADR1 family encodes three homologous non-canonical CNLs with a unique N-terminal CC domain, which shares closest sequence homology with RESISTANCE TO POWDERY MILDEW8 (RPW8), thus termed as CCR domain (Xiao et al., 2001; Grant et al., 2003; Collier et al., 2011). The three members of ADR1 family including ADR1, ADR1-LIKE1 (ADR1-L1) and ADR1-L2 were shown to regulate basal defense and some NLR-mediated ETI responses involving RPP2 and RPP4 (Bonardi et al., 2011). Chapter 4 described the specificity of the ADR1 family’s requirement for additional NLRs, both 	  	  90	  genetically and biochemically, and also explored the different contributions of ADR1 family members to NLR-mediated immunity. 5.1 A positive immune regulator SNIPER3/SAUL1 is guarded by a TNL immune receptor SUSA1 SNIPER3/SAUL1 (AT1G20780, hereafter, SAUL1, SENESCENCE-ASSOCIATED UBIQUITIN LIGASE1) was identified through the SNIPER screen as a snc1-enhancer. Overexpression of SAUL1 leads to the enhancement of snc1 dwarfism and increased disease resistance in Col-0 background with reduced pathogen growth and heightened expression levels of PR genes. SAUL1 protein contains an N-terminal U-box domain, that is involved in E2 binding, and C-terminal armadillo (ARM) repeats, which likely constitute interface for protein-protein interactions (Raab et al., 2009). Loss-of-function mutant of SAUL1 displays autoimmunity with severe cell death and seedling lethality, which was previously misinterpreted as early senescence phenotypes (Raab et al., 2009). Interestingly, the autoimmunity of saul1 is fully dependent on EDS1 and PAD4, which are both key downstream components of TNL proteins (Disch et al., 2015). Suppressor screens of saul1 from two independent groups have identified 11 saul1 suppressors, all with mutations with the same gene encoding a typical TNL protein SUSA1 (Suppressor of saul1).     To test for the role of SAUL1 in basal resistance, saul1 susa1 double mutants were used to block the interference of the activation of SUSA1-mediated ETI responses. The results showed the increase growth of virulent bacterial pathogens Pseudomonas syringae pv. maculicola (P.s.m) ES4326 and P.s. pv tomato (P.s.t.) DC3000 in saul1 susa1 double mutants. However, the bacterial growth of P.s.t. DC3000 carrying the effectors AvrRps4 and AvrRpt2 was not affected in saul1 susa1 double mutants. SAUL1 shares the closest sequence similarities with PUB43, and therefore studies were done to confirm its homology. A reduction of flg22-induced MPKs activation and an enhanced susceptibility to a type III secretion system (T3SS) deficient bacteria mutant P.s.t. DC3000 hrcC- were shown in saul1 	  	  91	  pub43 susa1 triple mutants, suggesting that SAUL1 and PUB43 may redundantly and positively regulate PTI responses.      Collectively, these data suggest that SAUL1 plays a dual role in plant immunity. On one hand, SAUL1 positively regulates basal resistance. On the other hand, SAUL1 suppresses a typical TNL immune receptor SUSA1 to prevent its autoimmunity. As SAUL1 is an E3 ligase, it is plausible to suspect that SUSA1 could be SAUL1’s ubiquitination target. However, this is probably not true, since if SAUL1 targets SUSA1 for degradation, overexpression of SAUL1 would yield plants with a wild-type like morphology similar to susa1 mutant plants. Contrary to this theory, SAUL1 overexpression lines are dwarfed with autoimmunity, arguing against it being the substrate of SAUL1. Based on the phenotypes of SAUL1 overexpression lines and saul1 susa1 double mutant plants, SAUL1 likely regulates PTI through ubiquitinating one or more PTI negative regulator(s), leading to their further degradation by the proteasome. Hence, future identification of the ubiquitination substrate(s) of SAUL1 is a critical step to understand how exactly SAUL1 regulates PTI and basal resistance.     SAUL1 was previously shown to associate with the plasma membrane with its extended C-terminal ARM repeats (Vogelmann et al., 2014), whereas SUSA1 mainly localizes in the cytosol. We did not observe any change of SAUL1’s membrane localization upon pathogen treatment (Stefan Hoth, personal communication). Considering their different localizations, it remains obscure how SUSA1 guards SAUL1. Does the association of SUSA1 and SAUL1 require additional components and/or pathogen elicitation? Is there any pathogen effector targeting SAUL1 that can be recognized by SUSA1? Answers to these questions would help us to better understand the relationship between SAUL1 and SUSA1.     Identified from the CCSB interactome database (Dreze et al., 2011), one of SAUL1’s alleged interactors is LORE1/SD1.29. LORE1 encodes a bulb-type lectin S-domain-1 receptor-like kinase, which was shown to confer the recognition of lipopolysaccharide (LPS) from Gram-negative bacteria (Ranf et al., 2015). It is speculated that SAUL1 could act 	  	  92	  downstream of LORE1 upon LPS elicitation. To test whether SAUL1 is required for LORE1-mediated immunity, saul1 susa1 or saul1 pub43 susa1 mutants can be assayed for impaired PTI responses upon LPS treatment. Moreover, it is also worthwhile to test whether SAUL1 can be phosphorylated by LORE1 after LPS elicitation, and if it can, the following up would be to test whether this phosphorylation is critical for SAUL1’s function.      SUSA1 encodes a typical TIR-type NLR protein. The two motifs essential for proper NLR activity are the P-loop (phosphate-binding loop) motif and MHD motif. The P-loop motif coordinates with ATP binding and works as a molecular switch to turn on (ATP-bound) and off (ADP-bound) the NLR protein (Hanson and Whiteheart, 2005). Mutations in the P-loop often result in the loss-of-function of NLR proteins (Tameling et al., 2006; Williams et al., 2011; Zhang et al., 2012). Two P-loop mutants, susa1-7 and susa1-8, have been identified through the saul1 suppressor screens, suggesting that SUSA1 is a typical TNL protein that requires an intact P-loop motif.      MHD motif is a conserved plant-specific motif that locates in the ARC2 sub-domain of the extended NB-ARC domain. In contrast with the effects of P-loop motif mutations, mutation of the Aspartic acid (D) in the MHD motif often results in auto activating NLR proteins that induce pathogen-independent, constitutively activated defense responses in plants (Williams et al., 2011; Zhang et al., 2012). Interestingly, SUSA1 protein contains a MHV motif instead of MHD motif, presumably conferring autoactivation. Thus, it is highly possible that SUSA1 is an autoactive NLR in Arabidopsis, whose activity must be repressed by one or more negative regulator(s), such as SAUL1.     SUSA1 gene forms a head-to-head triplet cluster with two TIR-NB (TN) genes: CHS1 (CHILING SENSITIVE 1, AT1G17610) and TN2 (AT1G17615). The head-to-head arrangement indicates a possible co-regulation between these genes as suggested in recent studies (Deslandes et al., 2003; Gassmann et al., 1999; Narusaka et al., 2009; Williams et al., 2014; Sarris et al., 2015; Jander et al., 2002; van der Biezen et al., 2002; Le Roux et al., 2015; Xu et al., 2015b; Bi et al., 2011). It is possible that the two neighbour TNs of SUSA1 may 	  	  93	  work to fine-tune the activation of SUSA1. CHS1 has been shown to weakly interact with SAUL1 in protoplasts (Stefan Hoth, personal communication). It is possible that CHS1 could work together with SAUL1 to suppress the activation of SUSA1. In this scenario, it is expected that overexpression of CHS1 could rescue saul1’s autoimmunity, and knocking out of CHS1 in saul1 mutant could yield a similar phenotype as saul1. Future experimental evidence can help us better understand the CHS1-SAUL1-SUSA1 relationship.  5.2 The ADR1 family acts downstream of typical TNLs The ACTIVATED DISEASE RESISTANCE 1 (ADR1) gene family (ADR1, ADR1-L1 and ADR1-L2) has been previously shown to play positive roles in basal resistance and ETI responses (Bonardi et al., 2011). The adr1 adr1-L1 adr1-L2 triple mutant (hereafter “adr1 triple”) displayed significantly compromised disease resistance against various pathogens including the bacterial pathogen Pseudomonas syringae pv. tomato (P.s.t) DC3000 expressing either the AvrRpm1 or AvrRpt2 effectors, and two isolates of the biotrophic oomycete pathogen Hyaloperonospora arabidopsidis (H.a. isolates Emwa1 and Cala2); these pathogens contain effectors that can be recognized by NLR receptors RPM1, RPS2, RPP4 and RPP2, respectively (Bonardi et al., 2011). It was suggested that the ADR1 family works as helper NLRs to transduce signals downstream of specific NLR receptors after effector recognition and activation.     Results described in chapter 4 revealed that adr1 triple is able to suppress the autoimmunity of NLR mutants including snc1 (Li et al., 2001a), chs2-1 (Huang et al., 2010), but not that of chs3-1 (Yang et al., 2010), uni-1D (Igari et al., 2008) and slh1-9 (Noutoshi et al., 2005). SNC1 and CHS2 both encode typical TNL proteins, whereas CHS3, UNI and SLH encode a TIR-NB, a CNL and a TNL-WRKY, respectively, suggesting that ADR1 family is required for typical TNL-mediated signalling. It also supports the notion that there are different signalling mechanisms downstream of different types of NLRs. 	  	  94	      Using the snc1-suppressing phenotype as criterion, we found that among the three ADR1 genes, ADR1 is the leading contributor while ADR1-L1 makes the least contribution in suppressing snc1 phenotypes. Interestingly, we also identified unexpected snc1-enhancing phenotypes in adr1-L1 snc1 double mutants: the transcripts of ADR1 and ADR1-L2 were up-regulated compared with snc1 in adr1-L1 snc1 mutants; and the loss of ADR1 and ADR1-L2 can fully suppress the snc1-enhancing phenotypes in snc1 adr1-L1 mutant. Thus it is possible that the snc1-enhancing phenotypes caused by loss of ADR1-L1 are contributed by the over compensation of the expression of ADR1 and ADR1-L2 transcripts.     The ADR1 family contains a unique CC domain, which has high homology with RPW8, a resistance (R) gene that confers a broad range of powdery mildew resistance in Arabidopsis (Xiao et al., 2001; Grant et al., 2003; Collier et al., 2011). Thus, the RPW8-like CC domain is termed as CCR domain (Xiao et al., 2001; Grant et al., 2003; Collier et al., 2011). The second CCR-NB-LRR encoding gene group is typified by the Nicotiana benthamiana N-required gene 1 (NRG1) (Collier et al., 2011; Peart et al., 2005), which is required for TNL protein N mediated-resistance against tobacco mosaic virus (TMV) (Whitham et al., 1994; Peart et al., 2005). There are two NRG1-like genes (At5g66900/NRG1.1and At5g66910/NRG1.2) that lie in tandem repeats in the Arabidopsis genome (Collier et al., 2011). The expression of CCR domain of NRG1.2 is able to trigger severe cell death in N. benthimiana (Collier et al., 2011), suggesting that the gene product of NRG1.2 is functional. However, so far, there is no genetic evidence in Arabidopsis suggesting NRG1s’ role in plant immunity, possibly because of the difficulty of generating an nrg1.1nrg1.2 double mutant given their tandem repeated organization. The availability of new tools like CRISPR and TALENs will allow us to knock out adjacent NRG1 gene and study the nrg1 mutants to investigate their potentially significant roles in NLR-mediated immunity.           Here we provide additional evidence suggesting that, in contrast to the classical role of effector recognition, the NLR ADR1s have acquired expanded functions to transduce signals downstream of effector-recognizing NLRs. But where and how do ADR1s function 	  	  95	  downstream of NLRs? It has been previously shown that nuclear translocation is required for the proper function of some NLRs (Shen et al., 2007; Tasset et al., 2010; Xu et al., 2014a). It is speculated that the nuclear entry of ADR1s is required to activate defense. Future examination of the subcellular localization of ADR1s upon elicitation would help to answer this question. The phenotypes of adr triple are reminiscent of the phenotypes of loss-of-function of EDS1 or PAD4, which are the signalling intermediates of many typical TNLs. It would be interesting to examine the genetic and biochemical relationships between EDS1/PAD4 and ADR1s.      Overall, the report of two stories in my Ph.D. thesis: 1) A positive regulator SAUL1 is guarded by a NLR immune receptor SUSA1; 2) ADR1 family is required for downstream signalling of typical NLRs, emphasizes the importance of the guarding model and the roles of ADR1 family as NLR helpers in defense response. The findings in my Ph.D. thesis therefore push the boundaries of our knowledge on the sophisticated regulatory mechanisms behind plant innate immunity.    	  	  96	  References Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 95: 10306–11. Andreasson, E. et al. (2005). The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J. 24: 2579–2589. Axtell, M.J. and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369–77. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and Schulze-Lefert, P. (2002). The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 295: 2073–6. Bednarek, P., Pislewska-Bednarek, M., Svatos, A., Schneider, B., Doubsky, J., Mansurova, M., Humphry, M., Consonni, C., Panstruga, R., Sanchez-Vallet, A., Molina, A., and Schulze-Lefert, P. (2009). A glucosinolate metabolism pathway in living plant cells mediates broad-spectrum antifungal defense. Science 323: 101–106. Bi, D., Johnson, K.C.M., Zhu, Z., Huang, Y., Chen, F., Zhang, Y., and Li, X. (2011). Mutations in an Atypical TIR-NB-LRR-LIM Resistance Protein Confer Autoimmunity. Front. Plant Sci. 2: 1–10. van der Biezen, E. a, Freddie, C.T., Kahn, K., Parker, J.E., and Jones, J.D.G. (2002). Arabidopsis RPP4 is a member of the RPP5 multigene family of TIR-NB-LRR genes and confers downy mildew resistance through multiple signalling components. Plant J. 29: 439–51. Blume, B., Nürnberger, T., Nass, N., and Scheel, D. (2000). Receptor-mediated increase in cytoplasmic free calcium required for activation of pathogen defense in parsley. Plant Cell 12: 1425–1440. Boller, T. and Felix, G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60: 379–406. 	  	  97	  Bonardi, V., Tang, S., Stallmann, A., Roberts, M., Cherkis, K., and Dangl, J.L. (2011). Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors. Proc. Natl. Acad. Sci. U. S. A. 108: 16463–8. Bos, J.I.B. et al. (2010). Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1. Proc. Natl. Acad. Sci. U. S. A. 107: 9909–9914. Broekaert, W.F., Terras, F.R., Cammue, B.P., and Osborn, R.W. (1995). Plant defensins: novel antimicrobial peptides as components of the host defense system. Plant Physiol. 108: 1353–1358. Cardinale, F., Jonak, C., Ligterink, W., Niehaus, K., Boller, T., and Hirt, H. (2000). Differential activation of four specific MAPK pathways by distinct elicitors. J. Biol. Chem. 275: 36734–36740. Causier, B., Ashworth, M., Guo, W., and Davies, B. (2012). The TOPLESS Interactome: A Framework for Gene Repression in Arabidopsis. Plant Physiol. 158: 423–438. Chang, C., Yu, D., Jiao, J., Jing, S., Schulze-Lefert, P., and Shen, Q.-H. (2013). Barley MLA immune receptors directly interfere with antagonistically acting transcription factors to initiate disease resistance signaling. Plant Cell 25: 1158–73. Chen, H., Zou, Y., Shang, Y., Lin, H., Wang, Y., and Cai, R. (2008). Firefly Luciferase Complementation Imaging Assay for Protein-Protein Interactions in Plants. Plant Physiol. 146: 368–376. Cheng, Y.T., Germain, H., Wiermer, M., Bi, D., Xu, F., García, A. V, Wirthmueller, L., Després, C., Parker, J.E., Zhang, Y., and Li, X. (2009). Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis. Plant Cell 21: 2503–2516. Cheng, Y.T. and Li, X. (2012). Ubiquitination in NB-LRR-mediated immunity. Curr. Opin. Plant Biol. 15: 392–399. Cheng, Y.T., Li, Y., Huang, S., Huang, Y., Dong, X., Zhang, Y., and Li, X. (2011a). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proc. Natl. Acad. Sci. U. S. A. 108: 14694–14699. 	  	  98	  Cheng, Y.Y.T., Li, Y., Huang, S., Huang, Y., Dong, X., Zhang, Y., and Li, X. (2011b). Stability of plant immune-receptor resistance proteins is controlled by SKP1-CULLIN1-F-box (SCF)-mediated protein degradation. Proc. Natl. Acad. Sci. 108: 14694–14699. Chini, A., Fonseca, S., Fernández, G., Adie, B., Chico, J.M., Lorenzo, O., García-Casado, G., López-Vidriero, I., Lozano, F.M., Ponce, M.R., Micol, J.L., and Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448: 666–671. Chini, A., Grant, J.J., Seki, M., Shinozaki, K., and Loake, G.J. (2004). Drought tolerance established by enhanced expression of the CC-NBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1. Plant J. 38: 810–822. Chini, A. and Loake, G.J. (2005). Motifs specific for the ADR1 NBS-LRR protein family in Arabidopsis are conserved among NBS-LRR sequences from both dicotyledonous and monocotyledonous plants. Planta 221: 597–601. Chung, E.H., Da Cunha, L., Wu, A.J., Gao, Z., Cherkis, K., Afzal, A.J., MacKey, D., and Dangl, J.L. (2011). Specific threonine phosphorylation of a host target by two unrelated type III effectors activates a host innate immune receptor in plants. Cell Host Microbe 9: 125–136. Clay, N.K., Adio, A.M., Denoux, C., Jander, G., and Ausubel, F.M. (2009). Glucosinolate metabolites required for an Arabidopsis innate immune response. Science 323: 95–101. Clough, S.J. and Bent, A.F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735–743. Collier, S.M., Hamel, L.-P., and Moffett, P. (2011). Cell death mediated by the N-terminal domains of a unique and highly conserved class of NB-LRR protein. Mol. Plant. Microbe. Interact. 24: 918–931. Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J.-L., Hückelhoven, R., Stein, M., Freialdenhoven, A., Somerville, S.C., and Schulze-Lefert, P. (2003). SNARE-protein-mediated disease resistance at the plant cell wall. Nature 425: 973–977. Curtis, M.D. and Grossniklaus, U. (2003). A Gateway cloning vector set for high-hhroughput hunctional hnalysis of henes in planta. Plant Physiol. 133: 462–469. 	  	  99	  Deshaies, R.J. and Joazeiro, C. a P. (2009). RING domain E3 ubiquitin ligases. Annu. Rev. Biochem. 78: 399–434. Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C., Somssich, I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc. Natl. Acad. Sci. U. S. A. 100: 8024–8029. Dharmasiri, N., Dharmasiri, S., and Estelle, M. (2005). The F-box protein TIR1 is an auxin receptor. Nature 435: 441–445. Disch, E.-M., Tong, M., Kotur, T., Koch, G., Wolf, C.-A., Li, X., and Hoth, S. (2015). Membrane-Associated Ubiquitin Ligase SAUL1 Suppresses Temperature- and Humidity-Dependent Autoimmunity in Arabidopsis. Mol. Plant. Microbe. Interact. in press. Dodds, P.N., Lawrence, G.J., Catanzariti, A.-M., Teh, T., Wang, C.-I.A., Ayliffe, M.A., Kobe, B., and Ellis, J.G. (2006). Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc. Natl. Acad. Sci. U. S. A. 103: 8888–8893. Dodds, P.N. and Rathjen, J.P. (2010). Plant immunity: towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 11: 539–548. Downes, B.P., Stupar, R.M., Gingerich, D.J., and Vierstra, R.D. (2003). The HECT ubiquitin-protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J. 35: 729–742. Drechsel, G., Bergler, J., Wippel, K., Sauer, N., Vogelmann, K., and Hoth, S. (2011). C-terminal armadillo repeats are essential and sufficient for association of the plant U-box armadillo E3 ubiquitin ligase SAUL1 with the plasma membrane. J. Exp. Bot. 62: 775–785. Dreher, K. and Callis, J. (2007). Ubiquitin, Hormones and Biotic Stress in Plants. Ann. Bot. 99: 787–822. Dreze, M. et al. (2011). Evidence for Network Evolution in an Arabidopsis Interactome Map. Science (80-. ). 333: 601–607. Dubiella, U., Seybold, H., Durian, G., Komander, E., Lassig, R., Witte, C.-P., Schulze, 	  	  100	  W.X., and Romeis, T. (2013). Calcium-dependent protein kinase/NADPH oxidase activation circuit is required for rapid defense signal propagation. Proc. Natl. Acad. Sci. U. S. A. 110: 8744–8749. Flor, H.H. (1971). Current status of the gene-for-gene concept. Annu. Rev. Phytopathol. 9: 275–296. Gagne, J.M., Downes, B.P., Shiu, S.-H., Durski, A.M., and Vierstra, R.D. (2002). The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 99: 11519–11524. Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., and Zhang, Y. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res. 18: 1190–1198. Gassmann, W., Hinsch, M.E., and Staskawicz, B.J. (1999). The Arabidopsis RPS4 bacterial-resistance gene is a member of the TIR-NBS-LRR family of disease-resistance genes. Plant J. 20: 265–277. Geldner, N., Dénervaud-Tendon, V., Hyman, D.L., Mayer, U., Stierhof, Y.-D., and Chory, J. (2009). Rapid, combinatorial analysis of membrane compartments in intact plants with a multicolor marker set. Plant J. 59: 169–178. Germain, H. et al. (2010). MOS11: a new component in the mRNA export pathway. PLoS Genet. 6: e1001250. Gietz, R.D., Triggs-Raine, B., Robbins, A., Graham, K.C., and Woods, R. a. (1997). Identification of proteins that interact with a protein of interest: Applications of the yeast two-hybrid system. Mol. Cell. Biochem. 172: 67–79. González-Lamothe, R., Tsitsigiannis, D.I., Ludwig, A. a, Panicot, M., Shirasu, K., and Jones, J.D.G. (2006). The U-box protein CMPG1 is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18: 1067–1083. Grant, J.J., Chini, A., Basu, D., and Loake, G.J. (2003). Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens. Mol. Plant. Microbe. Interact. 16: 669–680. Hanson, P.I. and Whiteheart, S.W. (2005). AAA+ proteins: have engine, will work. Nat. 	  	  101	  Rev. Mol. Cell Biol. 6: 519–529. Harmon, A.C., Gribskov, M., and Harper, J.F. (2000). CDPKs – a kinase for every Ca2+ signal? Trends Plant Sci. 5: 154–159. Heath, M.C. (2000). Nonhost resistance and nonspecific plant defenses. Curr. Opin. Plant Biol. 3: 315–319. Hershko,  a and Ciechanover,  a (1998). The ubiquitin system. Annu. Rev. Biochem. 67: 425–479. Holt III, B.F., Belkhadir, Y., Dangl, J.L., Holt, B.F., Belkhadir, Y., and Dangl, J.L. (2005). Antagonistic Control of Disease Resistance Protein Stability in the Plant Immune System. Science (80-. ). 309: 929–932. Huang, S., Monaghan, J., Zhong, X., Lin, L., Sun, T., Dong, O.X., and Li, X. (2014a). HSP90s are required for NLR immune receptor accumulation in Arabidopsis. Plant J. 79: 427–439. Huang, Y., Chen, X., Liu, Y., Roth, C., Copeland, C., McFarlane, H.E., Huang, S., Lipka, V., Wiermer, M., and Li, X. (2013). Mitochondrial AtPAM16 is required for plant survival and the negative regulation of plant immunity. Nat. Commun. 4: 2558. Huang, Y., Minaker, S., Roth, C., Huang, S., Hieter, P., Lipka, V., Wiermer, M., and Li, X. (2014b). An E4 ligase facilitates polyubiquitination of plant immune receptor resistance proteins in Arabidopsis. Plant Cell 26: 485–496. Ichimura, K. et al. (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci. 7: 301–308. Ichimura, K., Mizoguchi, T., Irie, K., Morris, P., Giraudat, J., Matsumoto, K., and Shinozaki, K. (1998). Isolation of ATMEKK1 (a MAP kinase kinase kinase)-interacting proteins and analysis of a MAP kinase cascade in Arabidopsis. Biochem Biophys Res Commun 253: 532–543. Ishikawa, K., Yamaguchi, K., Sakamoto, K., Yoshimura, S., Inoue, K., Tsuge, S., Kojima, C., and Kawasaki, T. (2014). Bacterial effector modulation of host E3 ligase activity suppresses PAMP-triggered immunity in rice. Nat. Commun. 5: 5430. Jander, G., Norris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M., Last, R.L., Llc, C.G., 	  	  102	  and Street, S. (2002). Arabidopsis Map-Based Cloning in the Post-Genome Era. Plant Physiol. 129: 440–450. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19: 4004–4014. Johnson, K.C.M., Dong, O.X., Huang, Y., and Li, X. (2012). A rolling stone gathers no moss, but resistant plants must gather their MOSes. Cold Spring Harb. Symp. Quant. Biol. 77: 259–268. Jones, J.D.G. and Dangl, J.L. (2006). The plant immune system. Nature 444: 323–9. Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., Jones, J.D., Shirasu, K., Menke, F., Jones, A., and Zipfel, C. (2014). Direct Regulation of the NADPH Oxidase RBOHD by the PRR-Associated Kinase BIK1 during Plant Immunity. Mol. Cell 54: 43–55. Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K., Minami, E., and Shibuya, N. (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. U. S. A. 103: 11086–11091. Karimi, M., Depicker, A., and Hilson, P. (2007). Recombinational cloning with plant gateway vectors. Plant Physiol. 145: 1144–1154. Karnik, R., Zhang, B., Waghmare, S., Aderhold, C., Grefen, C., and Blatt, M.R. (2015). Binding of SEC11 Indicates Its Role in SNARE Recycling after Vesicle Fusion and Identifies Two Pathways for Vesicular Traffic to the Plasma Membrane. Plant Cell Online 27: tpc.114.134429. Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., and Howe, G. a (2008). COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. U. S. A. 105: 7100–7105. Kiegerl, S. (2000). SIMKK, a Mitogen-Activated Protein Kinase (MAPK) Kinase, Is a Specific Activator of the Salt Stress-Induced MAPK, SIMK. Plant Cell Online 12: 2247–2258. Kofoed, E.M. and Vance, R.E. (2011). Innate immune recognition of bacterial ligands by 	  	  103	  NAIPs determines inflammasome specificity. Nature 477: 592–595. Kong, Q., Qu, N., Gao, M., Zhang, Z., Ding, X., Yang, F., Li, Y., Dong, O.X., Chen, S., Li, X., and Zhang, Y. (2012). The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis. Plant Cell 24: 2225–36. Krasileva, K. V, Dahlbeck, D., and Staskawicz, B.J. (2010). Activation of an Arabidopsis resistance protein is specified by the in planta association of its leucine-rich repeat domain with the cognate oomycete effector. Plant Cell 22: 2444–2458. Kudla, J., Batistic, O., and Hashimoto, K. (2010). Calcium Signals: The Lead Currency of Plant Information Processing. Plant Cell 22: 541–563. Lakatos, L., Szittya, G., Silhavy, D., and Burgyán, J. (2004). Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses. EMBO J. 23: 876–884. Lamb, C. and Dixon, R.A. (1997). The oxidative burst in plant disease resistance. Annu. Rev. Plant Biol. 48: 251–275. Le Roux, C. et al. (2015). A Receptor Pair with an Integrated Decoy Converts Pathogen Disabling of Transcription Factors to Immunity. Cell 161: 1074–1088. Lee, D., Bourdais, G., Yu, G., Robatzek, S., and Coaker, G. (2015). Phosphorylation of the Plant Immune Regulator RPM1-INTERACTING PROTEIN4 Enhances Plant Plasma Membrane H + -ATPase Activity and Inhibits Flagellin-Triggered Immune Responses in Arabidopsis. Plant Cell: tpc.114.132308. Lee, S., Han, S., Sririyanum, M., Park, C., Seo, Y., and Ronald, P. (2009). A Type I – Secreted, Sulfated Peptide Triggers XA21-Mediated Innate Immunity. Science: 850–85. Li, L., Li, M., Yu, L., Zhou, Z., Liang, X., Liu, Z., Cai, G., Gao, L., Zhang, X., Wang, Y., Chen, S., and Zhou, J.-M. (2014). The FLS2-Associated Kinase BIK1 Directly Phosphorylates the NADPH Oxidase RbohD to Control Plant Immunity. Cell Host Microbe 15: 329–338. Li, X., Clarke, J.D., Zhang, Y., and Dong, X. (2001a). Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Mol. Plant. Microbe. Interact. 14: 1131–9. 	  	  104	  Li, X., Kapos, P., and Zhang, Y. (2015). NLRs in plants. Curr. Opin. Immunol. 32: 114–121. Li, X., Song, Y., Century, K., Straight, S., Ronald, P., Dong, X., Lassner, M., and Zhang, Y. (2001b). A fast neutron deletion mutagenesis-based reverse genetics system for plants. Plant J. 27: 235–242. Li, Y., Tessaro, M.J., Li, X., and Zhang, Y. (2010). Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol. 153: 1425–1434. Lipka, V. et al. (2005). Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis. Science 310: 1180–1183. Liu, J., Elmore, J.M., Lin, Z.J.D., and Coaker, G. (2011). A receptor-like cytoplasmic kinase phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor. Cell Host Microbe 9: 137–146. Lu, D., Lin, W., Gao, X., Wu, S., Cheng, C., Avila, J., Heese, A., Devarenne, T.P., He, P., and Shan, L. (2011). Direct ubiquitination of pattern recognition receptor FLS2 attenuates plant innate immunity. Science 332: 1439–1442. Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L., and He, P. (2010). A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proc. Natl. Acad. Sci. 107: 496–501. Lu, X., Dittgen, J., Piślewska-Bednarek, M., Molina, A., Schneider, B., Svatoš, A., Doubský, J., Schneeberger, K., Weigel, D., Bednarek, P., and Schulze-Lefert, P. (2015). Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways. Plant Physiol. 168: 814–827. Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112: 379–389. Maekawa, T. et al. (2011). Coiled-Coil Domain-Dependent Homodimerization of Intracellular Barley Immune Receptors Defines a Minimal Functional Module for Triggering Cell Death. Cell Host Microbe 9: 187–199. 	  	  105	  Mao, G., Meng, X., Liu, Y., Zheng, Z., Chen, Z., and Zhang, S. (2011). Phosphorylation of a WRKY Transcription Factor by Two Pathogen-Responsive MAPKs Drives Phytoalexin Biosynthesis in Arabidopsis. Plant Cell 23: 1639–1653. Mauch, S., Shen, Q., Peart, J., Devoto, A., and Casais, C. (2004). RAR1 Positively Controls Steady State Levels of Barley MLA Resistance Proteins and Enables Sufficient MLA6 Accumulation for Effective Resistance. 16: 3480–3495. Meyers, B.C. (2003). Genome-Wide Analysis of NBS-LRR-Encoding Genes in Arabidopsis. Plant Cell 15: 809–834. Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 104: 19613–19618. Moffett, P., Farnham, G., Peart, J., and Baulcombe, D.C. (2002). Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J. 21: 4511–4519. Monaghan, J., Matschi, S., Shorinola, O., Rovenich, H., Matei, A., Segonzac, C., Malinovsky, F.G., Rathjen, J.P., MacLean, D., Romeis, T., and Zipfel, C. (2014). The Calcium-Dependent Protein Kinase CPK28 Buffers Plant Immunity and Regulates BIK1 Turnover. Cell Host Microbe 16: 605–615. Monaghan, J. and Zipfel, C. (2012). Plant pattern recognition receptor complexes at the plasma membrane. Curr. Opin. Plant Biol. 15: 349–357. Mudgil, Y., Shiu, S.-H., Stone, S.L., Salt, J.N., and Goring, D.R. (2004). A large complement of the predicted Arabidopsis ARM repeat proteins are members of the U-box E3 ubiquitin ligase family. Plant Physiol. 134: 59–66. Narusaka, M., Shirasu, K., Noutoshi, Y., Kubo, Y., Shiraishi, T., Iwabuchi, M., and Narusaka, Y. (2009). RRS1 and RPS4 provide a dual Resistance-gene system against fungal and bacterial pathogens. Plant J. 60: 218–226. Nelson, B.K., Cai, X., and Nebenführ, A. (2007). A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J. 51: 1126–1136. 	  	  106	  Ntoukakis, V., Saur, I.M., Conlan, B., and Rathjen, J.P. (2014). The changing of the guard: the Pto/Prf receptor complex of tomato and pathogen recognition. Curr. Opin. Plant Biol. 20C: 69–74. Nühse, T.S., Peck, S.C., Hirt, H., and Boller, T. (2000). Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK 6. J. Biol. Chem. 275: 7521–7526. Ohi, M.D., Vander Kooi, C.W., Rosenberg, J. a, Chazin, W.J., and Gould, K.L. (2003). Structural insights into the U-box, a domain associated with multi-ubiquitination. Nat. Struct. Biol. 10: 250–255. Okushima, Y. et al. (2005). Functional Genomic Analysis of the AUXIN RESPONSE FACTOR Gene Family Members in Arabidopsis thaliOkushima, Y., Overvoorde, P. J., Arima, K., Alonso, J. M., Chan, A., Chang, C., Ecker, J. R., et al. (2005). Functional Genomic Analysis of the AUXIN RESPONSE. Plant Cell 17: 444–463. van Ooijen, G., Mayr, G., Kasiem, M.M. a, Albrecht, M., Cornelissen, B.J.C., and Takken, F.L.W. (2008). Structure-function analysis of the NB-ARC domain of plant disease resistance proteins. J. Exp. Bot. 59: 1383–1397. Palma, K., Zhang, Y., and Li, X. (2005). An importin alpha homolog, MOS6, plays an important role in plant innate immunity. Curr. Biol. 15: 1129–1135. Palma, K., Zhao, Q., Yu, T.C., Bi, D., Monaghan, J., Cheng, W., Zhang, Y., and Li, X. (2007). Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms. Genes Dev. 21: 1484–1493. Peart, J.R., Mestre, P., Lu, R., Malcuit, I., and Baulcombe, D.C. (2005). NRG1, a CC-NB-LRR protein, together with N, a TIR-NB-LRR protein, mediates resistance against tobacco mosaic virus. Curr. Biol. 15: 968–973. Petersen, M. et al. (2000). Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103: 1111–1120. Pratt, W.B., Krishna, P., and Olsen, L.J. (2001). Hsp90-binding immunophilins in plants: The protein movers. Trends Plant Sci. 6: 54–58. Pruitt, R.N. et al. (2015). The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a Gram-negative bacterium. Sci. Adv. 1: e1500245–e1500245. 	  	  107	  Qiu, J.-L. et al. (2008). Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus. EMBO J. 27: 2214–2221. Raab, S., Drechsel, G., Zarepour, M., Hartung, W., Koshiba, T., Bittner, F., and Hoth, S. (2009). Identification of a novel E3 ubiquitin ligase that is required for suppression of premature senescence in Arabidopsis. Plant J. 59: 39–51. Ranf, S., Gisch, N., Schäffer, M., Illig, T., Westphal, L., Knirel, Y.A., Sánchez-Carballo, P.M., Zähringer, U., Hückelhoven, R., Lee, J., and Scheel, D. (2015). A lectin S-domain receptor kinase mediates lipopolysaccharide sensing in Arabidopsis thaliana. Nat. Immunol. 16: 426–433. Ravensdale, M., Bernoux, M., Ve, T., Kobe, B., Thrall, P.H., Ellis, J.G., and Dodds, P.N. (2012). Intramolecular Interaction Influences Binding of the Flax L5 and L6 Resistance Proteins to their AvrL567 Ligands. PLoS Pathog. 8: e1003004. Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N., Malinovsky, F.G., Tor, M., de Vries, S., and Zipfel, C. (2011). The Arabidopsis Leucine-Rich Repeat Receptor-Like Kinases BAK1/SERK3 and BKK1/SERK4 Are Required for Innate Immunity to Hemibiotrophic and Biotrophic Pathogens. Plant Cell 23: 2440–2455. Sarris, P.F. et al. (2015). A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors. Cell 161: 1089–1100. Schroder, K. and Tschopp, J.J.J. (2010). The inflammasomes. Cell 140: 821–832. Shao, F., Golstein, C., Ade, J., and Stoutemyer, M. (2003). Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301: 1230-1233. Shen, Q.-H., Saijo, Y., Mauch, S., Biskup, C., Bieri, S., Keller, B., Seki, H., Ulker, B., Somssich, I.E., and Schulze-Lefert, P. (2007). Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses. Science 315: 1098–1103. Smalle, J. and Vierstra, R.D. (2004). the Ubiquitin 26S Proteasome Proteolytic Pathway. Annu. Rev. Plant Biol. 55: 555–590. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor 	  	  108	  kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270: 1804–1806. Stegmann, M., Anderson, R.G., Ichimura, K., Pecenkova, T., Reuter, P., Žársky, V., McDowell, J.M., Shirasu, K., and Trujillo, M. (2012). The ubiquitin ligase PUB22 targets a subunit of the exocyst complex required for PAMP-triggered responses in Arabidopsis. Plant Cell 24: 4703–4716. Stein, M., Dittgen, J., Sanchez-Rodrguez, C., Hou, B., Molina, A., Schulze-lefert, P., Lipka, V., and Somerville, S. (2006). Arabidopsis PEN3 / PDR8 , an ATP Binding Cassette Transporter , Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration. 18: 731–746. Takken, F.L.W. and Goverse, A. (2012). How to build a pathogen detector: Structural basis of NB-LRR function. Curr. Opin. Plant Biol. 15: 375–384. Takken, F.L.W. and Tameling, W.I.L. (2009). To nibble at plant resistance proteins. Science 324: 744–746. Tameling, W.I.L., Vossen, J.H., Albrecht, M., Lengauer, T., Berden, J. a, Haring, M. a, Cornelissen, B.J.C., and Takken, F.L.W. (2006). Mutations in the NB-ARC domain of I-2 that impair ATP hydrolysis cause autoactivation. Plant Physiol. 140: 1233–1245. Tan, X. (2012). A Comparative Testing of Cucumber mosaic virus(CMV)-Based Constructs to Generate Virus Resistant Plants. Am. J. Plant Sci. 03: 461–472. Tasset, C., Bernoux, M., Jauneau, A., Pouzet, C., Brière, C., Kieffer-Jacquinod, S., Rivas, S., Marco, Y., and Deslandes, L. (2010). Autoacetylation of the Ralstonia solanacearum effector PopP2 targets a lysine residue essential for RRS1-R-mediated immunity in Arabidopsis. PLoS Pathog. 6: e1001202. Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He, S.Y., Howe, G.A., and Browse, J. (2007). JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature 448: 661–665. Thomma, B.P.H.J., Nelissen, I., Eggermont, K., and Broekaert, W.F. (1999). Deficiency in phytoalexin production causes enhanced susceptibility of Arabidopsis thaliana to the fungus Alternaria brassicicola. Plant J. 19: 163–171. Torres, M.A., Jones, J.D.G., and Dangl, J.L. (2005). Pathogen-induced, NADPH 	  	  109	  oxidase-derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nat. Genet. 37: 1130–1134. Trujillo, M., Ichimura, K., Casais, C., and Shirasu, K. (2008). Negative Regulation of PAMP-Triggered Immunity by an E3 Ubiquitin Ligase Triplet in Arabidopsis. Curr. Biol. 18: 1396–1401. Tsuda, K., Mine, A., Bethke, G., Igarashi, D., Botanga, C.J., Tsuda, Y., Glazebrook, J., Sato, M., and Katagiri, F. (2013). Dual regulation of gene expression mediated by extended MAPK activation and salicylic acid contributes to robust innate immunity in Arabidopsis thaliana. PLoS Genet. 9: e1004015. Vierstra, R.D. (2009). The ubiquitin-26S proteasome system at the nexus of plant biology. Nat. Rev. Mol. Cell Biol. 10: 385–397. Vierstra, R.D. (2003). The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci. 8: 135–142. Vogelmann, K., Drechsel, G., Bergler, J., Subert, C., Philippar, K., Soll, J., Engelmann, J.C., Engelsdorf, T., Voll, L.M., and Hoth, S. (2012). Early Senescence and Cell Death in Arabidopsis saul1 Mutants Involves the PAD4-Dependent Salicylic Acid Pathway. Plant Physiol. 159: 1477–1487. Vogelmann, K., Subert, C., Danzberger, N., Drechsel, G., Bergler, J., Kotur, T., Burmester, T., and Hoth, S. (2014). Plasma membrane-association of SAUL1-type plant U-box armadillo repeat proteins is conserved in land plants. Front. Plant Sci. 5: 37. Wei, F., Gobelman-Werner, K., Morroll, S.M., Kurth, J., Mao, L., Wing, R., Leister, D., Schulze-Lefert, P., and Wise, R.P. (1999). The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 153: 1929–1948. Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R., Corr, C., and Baker, B. (1994). The product of the tobacco mosaic virus resistance gene N: Similarity to toll and the interleukin-1 receptor. Cell 78: 1101–1115. Williams, S.J. et al. (2014). Structural basis for assembly and function of a heterodimeric plant immune receptor. Science 344: 299–303. 	  	  110	  Williams, S.J., Sornaraj, P., deCourcy-Ireland, E., Menz, R.I., Kobe, B., Ellis, J.G., Dodds, P.N., and Anderson, P. a (2011). An autoactive mutant of the M flax rust resistance protein has a preference for binding ATP, whereas wild-type M protein binds ADP. Mol. Plant. Microbe. Interact. 24: 897–906. Xia, S., Cheng, Y.T., Huang, S., Win, J., Soards, A., Jinn, T.-L., Jones, J.D.G., Kamoun, S., Chen, S., Zhang, Y., and Li, X. (2013). Regulation of transcription of nucleotide-binding leucine-rich repeat-encoding genes SNC1 and RPP4 via H3K4 trimethylation. Plant Physiol. 162: 1694–1705. Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J., and Zhou, J.-M. (2008). Pseudomonas syringae Effector AvrPto Blocks Innate Immunity by Targeting Receptor Kinases. Curr. Biol. 18: 74–80. Xiao, S., Ellwood, S., Calis, O., Patrick, E., Li, T., Coleman, M., and Turner, J.G. (2001). Broad-spectrum mildew resistance in Arabidopsis thaliana mediated by RPW8. Science 291: 118–120. Xu, F. et al. (2015a). Two N-Terminal Acetyltransferases Antagonistically Regulate the Stability of a Nod-Like Receptor in Arabidopsis. Plant Cell: 1–17. Xu, F., Cheng, Y.T., Kapos, P., Huang, Y., and Li, X. (2014a). P-Loop-Dependent NLR SNC1 Can Oligomerize and Activate Immunity in the Nucleus. Mol. Plant: 1801–1804. Xu, F., Kapos, P., Cheng, Y.T., Li, M., Zhang, Y., and Li, X. (2014b). NLR-associating transcription factor bHLH84 and its paralogs function redundantly in plant immunity. PLoS Pathog. 10: e1004312. Xu, F., Xu, S., Wiermer, M., Zhang, Y., and Li, X. (2012). The cyclin L homolog MOS12 and the MOS4-associated complex are required for the proper splicing of plant resistance genes. Plant J. 70: 916–928. Xu, F., Zhu, C., Cevik, V., Johnson, K., Liu, Y., Sohn, K., Jones, J.D., Holub, E.B., and Li, X. (2015b). Autoimmunity conferred by chs3-2D relies on CSA1, its adjacent TNL-encoding neighbour. Sci. Rep. 5: 8792. Xu, S., Zhang, Z., Jing, B., Gannon, P., Ding, J., Xu, F., Li, X., and Zhang, Y. (2011). Transportin-SR Is Required for Proper Splicing of Resistance Genes and Plant Immunity. PLoS Genet. 7: e1002159. 	  	  111	  Yang, K.Y., Liu, Y., and Zhang, S. (2001). Activation of a mitogen-activated protein kinase pathway is involved in disease resistance in tobacco. Proc. Natl. Acad. Sci. U. S. A. 98: 741–746. Zhang, J. et al. (2007). A Pseudomonas syringae Effector Inactivates MAPKs to Suppress PAMP-Induced Immunity in Plants. Cell Host Microbe 1: 175–185. Zhang, J. et al. (2010). Receptor-like Cytoplasmic Kinases Integrate Signaling from Multiple Plant Immune Receptors and Are Targeted by a Pseudomonas syringae Effector. Cell Host Microbe 7: 290–301. Zhang, Y., Cheng, Y.T., Bi, D., Palma, K., and Li, X. (2005). MOS2, a protein containing G-patch and KOW motifs, is essential for innate immunity in Arabidopsis thaliana. Curr. Biol. 15: 1936–1942. Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003a). A gain-of-gunction mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1 , constitutive 1. 15: 2636–2646. Zhang, Y. and Li, X. (2005). A putative nucleoporin 96 Is required for both basal defense and constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant Cell 17: 1306–1316. Zhang, Y., Zhang, Y., Goritschnig, S., Goritschnig, S., Dong, X., Dong, X., Li, X., and Li, X. (2003b). A Gain-of-Function Mutation in a Plant Disease Resistance Gene Leads to Constitutive Activation of Downstream Signal Transduction Pathways in. Society 15: 2636–2646. Zhang, Z., Wu, Y., Gao, M., Zhang, J., Kong, Q., Liu, Y., Ba, H., Zhou, J., and Zhang, Y. (2012). Disruption of PAMP-induced MAP kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2. Cell Host Microbe 11: 253–263. Zhou, Z., Wu, Y., Yang, Y., Du, M., Zhang, X., Guo, Y., Li, C., and Zhou, J.-M. (2015). An Arabidopsis Plasma Membrane Proton ATPase Modulates JA Signaling and Is Exploited by the Pseudomonas syringae Effector Protein AvrB for Stomatal Invasion. Plant Cell 2: tpc.15.00466. Zhu, Z., Xu, F., Zhang, Y., Cheng, Y.T., Wiermer, M., Li, X., and Zhang, Y. (2010). Arabidopsis resistance protein SNC1 activates immune responses through association 	  	  112	  with a transcriptional corepressor. Proc. Natl. Acad. Sci. U. S. A. 107: 13960–13965. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts Agrobacterium-Mediated Transformation. Cell 125: 749–760. Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428: 764–767. 	   	   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0229563/manifest

Comment

Related Items