Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Protecting our beta-lactam antibiotic assets : structural investigation of beta-lactamases King, Dustin T. 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_february_king_dustin.pdf [ 18.22MB ]
Metadata
JSON: 24-1.0222998.json
JSON-LD: 24-1.0222998-ld.json
RDF/XML (Pretty): 24-1.0222998-rdf.xml
RDF/JSON: 24-1.0222998-rdf.json
Turtle: 24-1.0222998-turtle.txt
N-Triples: 24-1.0222998-rdf-ntriples.txt
Original Record: 24-1.0222998-source.json
Full Text
24-1.0222998-fulltext.txt
Citation
24-1.0222998.ris

Full Text

PROTECTING OUR β-LACTAM ANTIBIOTIC ASSETS: STRUCTURAL INVESTIGATION OF  β-LACTAMASES    by   DUSTIN T. KING  B.Sc. The University of Northern British Columbia, 2010     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES   (Biochemistry and Molecular Biology)       THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)             January 2016 © Dustin T. King, 2016 	   ii	  Abstract Bacterial diseases have an enormous impact on human health. The most widespread class of human antibacterials is the β-lactams that target the transpeptidase activity of penicillin-binding proteins, which are responsible for cross-linking the peptidoglycan cell-wall. However, bacteria have gained resistance to all major classes of β-lactams. To protect the clinical utility of the β-lactams it is essential to understand the structural basis for this resistance. This thesis aims to better understand the molecular details governing extended-spectrum β-lactamase mediated β-lactam resistance, and to gain insights into inhibition of these emerging resistance factors. Recently, a novel resistance factor known as the New Delhi Metallo-β-Lactamase-1 has been found to confer enteric pathogens such as Escherichia coli and Klebsiella pneumoniae with nearly complete resistance to all β-lactams. The 2.1Å resolution crystal structure of K. pneumoniae holo-NDM-1 revealed an expansive active site, which we propose leads to a broader β-lactam substrate specificity. Furthermore, NDM-1 localizes to the bacterial outer-membrane by sucrose density gradient centrifugation. The structural details underpinning the broad-spectrum resistance of NDM-1 was further investigated by analysis of the protein in complex with hydrolyzed β-lactams as well as bound to the inhibitor L-captopril.  An analysis of the NDM-1 active site in these structures reveals key features important for the informed design of novel inhibitors of NDM-1 and other metallo-β-lactamases. The novel diazabicyclooctane (DBO) avibactam inhibits a wider range of serine β-lactamases than has been previously observed with clinical β-lactamase inhibitors. To understand the molecular basis and spectrum of inhibition by avibactam, we provide structural and mechanistic analysis of the compound in complex with important class A and D serine β-lactamases. A kinetic analysis of key active-site mutants for class A β-lactamase CTX-M-15 allows us to propose a validated mechanism for avibactam-mediated β-lactamase inhibition including a unique role for S130, which acts as a general base. We then show that avibactam derivatives retain β-lactamase inhibitory properties but also exhibit 	   iii	  considerable antimicrobial activity against clinically relevant bacteria via targeting penicillin-binding proteins.  Our results provide evidence that structure-activity relationship studies for the purposes of drug discovery must consider both β-lactamases and penicillin-binding proteins as targets.                              	   iv	  Preface Material from the introductory chapter has been published or is soon due for publication in the form of peer-reviewed reviews or a book chapter that I was involved in preparing (see below). I was responsible for the preparation of all figures and text throughout the various sections described in the introduction, and Dr. Strynadka was involved in editing of the final version. Sobhanifar S.*, King D.T.*, Strynadka N.C.J. Fortifying the wall: synthesis, regulation and degradation of bacterial peptidoglycan. Curr. Opin. Struct. Biol . 23(5): 695-703. (2013) King D.T.*, Sobhanifar, S. *, Strynadka N.C.J. Handbook of Antimicrobial Resistance: The Mechanisms of Resistance to β-Lactam Antibiotics. DOI 10.1007/98-1-4939-0667-3_10-1  Sobhanifar S.*, King D.T. *, Strynadka N.C.J. Current trends in combatting bacterial resistance to the β -lactams. Prot. Sci. (review submitted) King D.T., Strynadka N.C.J. Targeting metallo-β-lactamase enzymes in antibiotic resistance. Future Med. Chem.  5(11): 1243-1263. (2013)  * Co-first authorship  Chapters 2, and 3 pertain to work that I conducted in Dr. Strynadka’s lab. Under Dr. Strynadka’s supervision, I was responsible for designing and performing all experiments as well as data analysis and all manuscript preparation. Liam Worrall and Robert Gruninger were involved during my training on X-ray crystallography equipment. The manuscripts were edited by all co-authors involved.  Versions of chapters 2 and 3 have been published: King D.T., Strynadka N.C.J. Crystal Structure of New Delhi metallo-β-lactamase Reveals Molecular Basis for Antibiotic Resistance. Protein Sci.  134(28): 1243-1263. (2011) King D.T., Worrall L.J., Gruninger R., Strynadka N.C.J. New Delhi Metallo-β -lactamase: Insights into β -lactam Recognition and Inhibition. J. Am. Chem. Soc.  134(28): 11362-11365. (2012)  Chapter 4 is based on work conducted as a joint effort between Dr. Strynadka and Dr. Gerard Wright at the University of McMaster. For this paper, I completed all structural work and was responsible for all manuscript preparation. Andrew King, a student in Dr. Wrights lab was responsible for kinetic experiments on mutant enzymes, site-directed mutagenesis, dynamic light scattering, and LC-MS experiments. Manuscript editing was done by all co-authors involved. 	   v	  A version of chapter 4 has been published: King D.T.*, King A.M.*, Lal S.M., Wright G.D., Strynadka N.C.J. Molecular mechanism of avibactam mediated β-lactamase inhibition. ACS Infect. Dis. DOI: 10.1021/acsinfecdis.5b00007  * Co-first authorship  Chapter 5 is based on work conducted primarily as a joint effort between Dr. Strynadka and Dr. Gerard Wright. Detailed author contributions are as follows: D.T.K, A.M.K, S.F, E.D.B., F.M., T.R.P., N.C.J.S., and G.D.W. designed experiments. A.M.K and D.T.K. overexpressed and purified enzymes with help in cloning from M.V.; D.T.K solved CTX-M-15 and PBP1b co-crystal complexes and with J.A.N.A. solved OXA-48 crystal complexes. A.M.K performed enzyme kinetics and all MIC experiments; S.F. performed microscopy experiments; A.A., E.B, and D.T.K performed BOCILLIN FL competition assays. D.T.K, A.M.K, N.C.J.S., and G.D.W principally wrote the manuscript with input from all. A version of chapter 5 has been published: Andrew M. King*, Dustin T. King*, Shawn French, Eric Brouillette, Abdelhamid Asli, J. Andrew N. Alexander, Marija Vuckovic, Thomas R. Parr Jr., Eric D. Brown, François Malouin, Natalie C.J. Strynadka, and Gerard D. Wright. Structural and Kinetic Characterization of Diazabicyclooctanes as Dual Inhibitors of Both Serine-β-Lactamases and Penicillin-Binding Proteins. ACS Chem. Biol. DOI: 10.1021/acschembio.5b00944  * Co-first authorship                 	   vi	  Table of Contents  Abstract ................................................................................................................................................... ii Preface .................................................................................................................................................... iv Table of Contents ................................................................................................................................... vi List of Tables .......................................................................................................................................... ix List of Figures ......................................................................................................................................... x Acknowledgements ............................................................................................................................... xii  1    Introduction ....................................................................................................................................... 1 1.1 Overview of Peptidoglycan Biosynthesis .................................................................................... 1 1.2 Penicillin-Binding Proteins .......................................................................................................... 2 1.2.1 Peptidoglycan transglycosylation ...................................................................................... 2 1.2.2 Peptidoglycan transpeptidation ......................................................................................... 4 1.3 β-Lactams: Mechanism of Action ............................................................................................... 7 1.3.1 β-Lactam mediated inhibition of PG transpeptidase ......................................................... 7 1.3.2 Major classes of β-lactams ................................................................................................ 9 1.4 β-Lactam Resistance Mechanisms ............................................................................................. 11 1.4.1 Target modification ......................................................................................................... 11 1.4.2 Regulation of β-lactam entry and efflux .......................................................................... 12 1.4.3 Enzymatic degradation .................................................................................................... 12 1.4.3.1 Serine β-lactamases ............................................................................................. 13 1.4.3.2 Metallo-β-lactamases .......................................................................................... 16 1.5 β-Lactamase Inhibitors .............................................................................................................. 19 1.6 Objectives of Thesis ......................................................................................................................... 24  2   Crystal Structure of New Delhi-Metallo-β-Lactamase (NDM-1) Reveals Molecular Basis for Antibiotic Resistance ................................................................................................................... 26 2.1 Introduction ............................................................................................................................... 26 2.2 Methods ..................................................................................................................................... 27 2.2.1 Cloning, protein expression and purification .................................................................. 27 2.2.2 Crystallization, data collection, and structure determination .......................................... 28 2.2.3 Sucrose density gradient centrifugation .......................................................................... 29 2.2.4 Inductively coupled plasma mass spectrometry .............................................................. 29 2.2.5 Dynamic light scattering .................................................................................................. 30 2.2.6 Chemical cross-linking .................................................................................................... 30 2.3 Results and Discussion .............................................................................................................. 31 2.3.1 Structure solution ............................................................................................................. 31 2.3.2 Overall structure .............................................................................................................. 32 2.3.3 Oligomerization state and membrane localization .......................................................... 33 2.3.4 NDM-1 active site ........................................................................................................... 36 2.3.5 Active site structure ......................................................................................................... 39 2.3.6 Evolutionary trends in antibiotic resistance .................................................................... 40  3   New Delhi Metallo-β-Lactamase: Structural Insights into β-Lactam Recognition and Inhibition ...................................................................................................................................... 42 3.1 Introduction ............................................................................................................................... 42 3.2 Methods ..................................................................................................................................... 43 3.2.1 Protein expression and purification ................................................................................. 43 	   vii	  3.2.2 Crystallization, data collection, and structure determination .......................................... 43 3.3 Results and Discussion .............................................................................................................. 45 3.3.1 Hydrolyzed penicillin bound NDM-1 complexes ........................................................... 45 3.3.2 Hydrolyzed meropenem bound NDM-1 .......................................................................... 51 3.3.3 L-Captopril mediated NDM-1 inhibition ........................................................................ 52   4      Molecular Mechanism of Avibactam-Mediated β-Lactamase Inhibition ............................... 56 4.1 Introduction ............................................................................................................................... 56 4.2 Methods ..................................................................................................................................... 59 4.2.1 DNA manipulations and plasmid construction ................................................................ 59 4.2.2 Site-directed mutagenesis of CTX-M-15 ........................................................................ 59 4.2.3 Protein expression and purification for kinetic studies ................................................... 59 4.2.4 CTX-M-15 enzyme assays .............................................................................................. 60 4.2.5 Crystallization, data collection, and structure determination .......................................... 63  4.2.6 Dynamic light scattering .................................................................................................. 64 4.2.7 LC-MS analysis of avibactam-CTX-M-15 mutants ........................................................ 64 4.2.8 Protein expression and purification for crystallographic studies .................................... 64  4.3 Results and Discussion .............................................................................................................. 65 4.3.1 Inhibition of CTX-M-15 by avibactam ........................................................................... 65 4.3.2 Carbamylation/decarbamylation kinetics for CTX-M-15 active site mutants ................ 68 4.3.3 Inhibition of the class D SBLs by avibactam .................................................................. 71 4.3.4 Comparison of carbamyl-avibactam in the class D SBLs OXA-10 and OXA-48 .......... 75 4.3.5 Comparison of avibactam and β-lactam binding in the class D SBLs ............................ 76 4.3.6 Carboxylation state of lysine 73 in the avibactam carbamyl-enzyme complexes ........... 77 4.3.7 Universal mechanism for avibactam mediated SBL inhibition ....................................... 79  5    Diazabicyclooctane Derivatives are Both Potent Antibiotics and Serine-β-Lactamase Inhibitors ...................................................................................................................................... 81  5.1 Introduction ............................................................................................................................... 81 5.2 Methods ..................................................................................................................................... 82 5.2.1 Reagents .......................................................................................................................... 82 5.2.2 β-Lactamase protein expression and purification ............................................................ 82 5.2.3 PBP plasmid construction, protein expression, and purification ..................................... 82 5.2.4 Crystallization, data collection, and structure determination .......................................... 84 5.2.5 Enzyme assays ................................................................................................................. 85 5.2.6 Antimicrobial susceptibility testing ................................................................................. 86 5.2.7 PBP binding assays .......................................................................................................... 86 5.2.4 BOCILLIN FL competition assays using purified E. coli PBPs ..................................... 87 5.2.4 Microscopy ...................................................................................................................... 88  5.3 Results and Discussion .............................................................................................................. 89 5.3.1 Inhibition of SBLs by diazabicyclooctane derivatives .................................................... 89 5.3.2 Diazabicyclooctane derivatives act as antimicrobial agents, and target PBP2 ............... 93  6    Conclusions and Future Directions ............................................................................................. 100 6.1 Summary and Significance of Results ..................................................................................... 100 6.2 Future Directions ..................................................................................................................... 102 References ............................................................................................................................................ 107 	   viii	   Appendices ........................................................................................................................................... 117 Appendix A: Publications Arising From Graduate Work ............................................................. 117 Appendix B: Chapter 4 Supplementary Information ..................................................................... 118 Appendix C: Chapter 5 Supplementary Information ..................................................................... 133                              	   ix	  List of Tables Table 2.1 Data collection and refinement statistics for NDM-1 ............................................................. 30  Table 3.1 Data collection and refinement statistics for NDM-1 complexes ........................................... 46 Table 4.1 Data collection and refinement statistics for avibactam bound β-lactamases ........................ 67 Table 4.2 Kinetic values for the carbamylation and decarbamylation of avibactam against a panel of CTX-M-15 active site mutants ............................................................................................................... 70 Table 5.1 Data collection and refinement statistics for CTX-M-15 co-crystal structures ...................... 90 Table 5.2 Data collection and refinement statistics for OXA-48 co-crystal structures .......................... 91 Table 5.3 Table 5.3 Kinetic values for the carbamylation and decarbamylation of DBO compounds against CTX-M-15 and OXA-48 ............................................................................................................ 93 Table 5.4 Antimicrobial susceptibility patterns of E. coli BW25113 pGDP-2 transformants  expressing β-lactamase ........................................................................................................................... 94 Table 5.5 Antimicrobial susceptibility patterns of NDM-1-positive clinical isolates to FPI-1602	  .........	  94	  Table 5.6 Gel based BOCILLIN FL competition assays ........................................................................ 97 Table 5.7 Data collection and refinement statistics for FPI-1465-E.coli PBP1b co-crystal structure .... 98 Table B.1 Primers used for β-lactamase cloning .................................................................................. 132 Table C.1 Antimicrobial susceptibility patterns of E. coli ASKA strains ............................................ 139                 	   x	  List of Figures Figure 1.1 PBP catalyzed transglycosylation and transpeptidation .......................................................... 6 Figure 1.2 β-Lactam-mediated inhibition of PBP TPase .......................................................................... 8 Figure 1.3 Chemical structure of β-lactam antibiotic classes that are in current clinical use ................. 10 Figure 1.4 Structural comparison of β-lactamase enzymes .................................................................... 18 Figure 1.5 The chemical structure of various β-lactamase inhibitors ..................................................... 20 Figure 2.1 Overall structure of holo-NDM-1, NDM-1 localization, and crystallographic dimerization ...  ................................................................................................................................................................ 33 Figure 2.2 The oligomeric state of NDM-1 ............................................................................................ 35 Figure 2.3 Holo-NDM-1/hydrolyzed ampicillin (hAMP) bound NDM-1 and holo-NDM-1/VIM-2 active site comparisons ........................................................................................................................... 38 Figure 2.4 NDM-1 metal ion analysis by ICP mass spectrometry ......................................................... 39 Figure 3.1 Class B1 metallo-β-lactamase mediated β-lactam hydrolysis .............................................. 42 Figure 3.2 β-lactam product complex crystal structures ........................................................................ 47 Figure 3.3 Penicillin product complex crystal structures ....................................................................... 49 Figure 3.4 Stereoview of hydrolyzed methicillin (hMETH)/modeled hydrolyzed aztreonam (hAZTR) bound NDM-1 active site overlay ........................................................................................................... 50 Figure 3.5 Competitive inhibition of NDM-1 by L-captopril ................................................................. 53 Figure 3.6 Stereoview of L-captopril, D-captopril and ethylene glycol bound NDM-1 active site overlay .................................................................................................................................................... 54 Figure 4.1 Avibactam mediated reversible SBL inhibition .................................................................... 58 Figure 4.2 Inhibition of CTX-M-15 by avibactam ................................................................................. 66 Figure 4.3 Characterization of the particle size distribution for CTX-M-15 variants using dynamic  light scattering ........................................................................................................................................ 68 Figure 4.4 Avibactam electron density for carbamylated CTX-M-15, OXA-48, and OXA-10 crystal structures ................................................................................................................................................. 72 Figure 4.5 Inhibition of OXA-48 and OXA-10 by avibactam ................................................................ 74 Figure 4.6 Proposed general catalytic mechanism for avibactam mediated SBL inhibition .................. 79 Figure 5.1 Inhibition of β-lactamases by avibactam derivatives ............................................................ 92	  Figure 5.2 PBP2 is the primary cellular target of avibactam derivatives in E. coli ................................ 96 Figure B.1 Carbamyl-avibactam bound CTX-M-15 active site details ................................................ 118 Figure B.2 Interactions between avibactam and active site residues in OXA-48 and OXA-10 ........... 119 	   xi	  Figure B.3 Carboxylation state of the SXXK lysine in OXA-48 and OXA-10 ................................... 120 Figure B.4 Comparison of carbamyl-avibactam CTX-M-15, OXA-48, and AmpC co-crystal  structures ............................................................................................................................................... 121 Figures B.5-B.14 ESI-LC-MS trace overlays of avibactam incubated with β-lactamases as noted at pH 7.5 ................................................................................................................................................... 122 Figure C.1 Avibactam derivative electron density maps and ligand protein interactions for  CTX-M-15 co-crystal complexes ......................................................................................................... 133 Figure C.2 Avibactam derivative electron density maps and ligand protein interactions for  OXA-48 co-crystal complexes ............................................................................................................. 134 Figure C.3 FPI compounds inhibit SBLs but not MBLs ...................................................................... 135 Figure C.4 Avibactam and derivatives specifically bind PBP2 ............................................................ 136 Figure C.5 Pearson correlation map for morphological defects in the presence of select  antibiotics .............................................................................................................................................. 137 Figure C.6 Gel based BOCILLIN FL competition assays to analyze the ability of unlabeled  competitor compounds to bind purified E. coli PBP1b ........................................................................ 138 Figure C.7 Avibactam derivative electron density for carbamyl-FPI-1465-E. coli PBP1b ................. 139   	                	   xii	  Acknowledgements	   First and foremost, I would like to thank my wife Elizabeth King for her unconditional patience and support throughout. I would like to thank my supervisor Dr. Natalie Strynadka for her mentorship and for providing me with the opportunity to pursue my own research interests and for teaching me countless valuable lessons along the way. Dr. Strynadka has been instrumental in my development as a young scientist particularly in the areas of scientific communication, critical thinking, and manuscript preparation. I would also like to thank my committee members Dr. Lawrence McIntosh and Dr. Filip Van Petegem for their thoughtful insights and critical feedback throughout.  I am grateful for past and present lab members who have been key to my development as a structural biologist. In particular, I would like to thank Dr. Susan Safadi for being an excellent mentor, colleague, and friend throughout my first two years in the lab. I would also like to thank Dr. Liam Worrall, Dr. Emilie Lameignere, Greg Wasney, and Liza de Castro for the countless hours of training on crystallography, SEC-MALS, kinetics software, and protein purification that they provided. I would like to thank Dr. Gerard Wright and his student Andrew King for their fruitful collaboration with regards to the avibactam work. Finally, I would like to thank all the members of the Strynadka lab for providing help and support throughout my research.  I am also grateful for the scholarship support that I have received from the Canadian Institutes of Health Research. 	   1	  I Introduction 1.1 Overview of Peptidoglycan Biosynthesis Most bacteria envelope themselves within a peptide cross-linked glycan meshwork known as the peptidoglycan (PG) sacculus. In Gram-negative bacteria, the PG layer is an essential cell surface feature that sits between the inner and outer membranes and helps to protect the bacterium from osmotic rupture due to membrane turgor pressure and is the defining layer that governs cell shape and morphogenesis (1). PG biosynthesis initiates with the well-characterized Mur enzyme pathway [reviewed in (1)], responsible for the synthesis of the UDP-N-acetylmuramic acid (MurNAc) pentapeptide precursor molecule. The pentapeptide moiety (attached at the C3 position lactyl moiety of MurNAc and often termed the stem peptide) is typically comprised of L-alanine-γ-D-glutamate-diaminopimelate(meso-DAP)-D-alanine-D-alanine in Gram-negative bacteria and L-alanine-γ-D-glutamate-L-lysine-D-alanine-D-alanine in Gram-positive bacteria with a pentaglycine branch protruding from the L-lysine residue in the latter. This precursor is then attached via a pyrophosphate linkage to the membrane anchored C55 lipid carrier by the integral membrane phosphotransferase MraY. Subsequently, the glycosyltransferase MurG adds an N-acetylglucosamine (GlcNAc) to form C55-PP activated GlcNAc-β-1,4-MurNAc pentapeptide, completing the formation of the PG precursor lipid II (1). The polymerization of PG occurs on the outer leaflet of the cytoplasmic membrane, necessitating the translocation or ‘flipping’ of lipid II across the membrane barrier. The bioinformatic search for the ‘flippase’ responsible for facilitating the transfer of lipid II has been narrowed down to several promising candidates including MurJ, FtsW, and RodA (2,3). Recently, it has been shown that FtsW is directly involved in the transport of lipid II across the membrane, although the possibility of other candidates performing complementary or redundant roles is not excluded (4). 	   2	  Lipid II precursors are stitched into the net-like structure of the cell-wall sacculus by high-molecular-weight penicillin-binding proteins (HMW PBPs) in two successive steps followed by recycling of C55-PP. Firstly, the non-reducing end of the lipid II disaccharide (acceptor) is attached via a β1,4-glycosidic linkage to the reducing end of a growing (donor) PG chain through the membrane anchored glycosyl transferase (GT) action of PBPs. Secondly, the newly incorporated pentapeptide of the growing chain is cross-linked to a preexisting PG chain by the transpeptidase (TP) action of PBPs (Figure 1.1a-c) (1). Class A PBPs are bi-functional enzymes harboring both GT and TP activities in distinct catalytic sites, whereas class B PBPs have only TP activity [reviewed in (1)] and are thought to play more prominent roles during specialized cellular events such as division or in response to environmental cues including antibiotic stress. 1.2 Penicillin-Binding Proteins 1.2.1 Peptidoglycan transglycosylation The seminal crystal structures of the full-length bi-functional Staphylococcus aureus PBP2 and Aquifex aeolicus PBP1a GT domain reveal that the PBP GT domain displays significant structural similarity to λ lysozyme (5,6). An extended active site cleft is formed at the interface of a solvent exposed λ lysozyme like α-helical ‘head’ subdomain and a ‘jaw’ subdomain. The head subdomain includes an active site span sufficient for the binding of 6 sugar moieties flanking a conserved catalytic glutamic acid (E114 in the PG-GT family). PG-GTs are characterized by an N-terminal hydrophobic, membrane embedded ‘jaw’ subdomain having no similarity to lysozyme. The jaw subdomain consists of an inner-helix, an outer-helix and a hydrophobic channel, which together define a putative donor lipid binding site (Figure 1.1b) (5). Co-crystallization of S. aureus PBP2 and subsequently Escherichia coli PBP1b and the S. aureus monofunctional GT with the natural product inhibitor moenomycin A showed that this compound binds at the donor lipid site as a substrate mimic of lipid IV (the tetrasaccharide-C55-PP product of the first round of lipid II donor/acceptor transfer; the so-called ‘growing chain’). These complexes provide the structural basis for our current understanding of lipid II 	   3	  polymerization (5,7,8). Glycosylation proceeds via E114 mediated de-protonation of an acceptor (lipid II) C4 hydroxyl followed by nucleophilic attack at the donor MurNAc anomeric C1 acyl phosphate linkage resulting in β1,4-glycosyl bond formation and departure of the C55-PP leaving group. It is currently unclear whether K163, R167 or E171 stabilize the pyrophosphate leaving group by direct protonation or coordination of a metal ion (5,7). Following glycosyl bond formation, a patch of basic residues flanking the donor binding site is proposed to create an electropositive sink for positioning the pyrophosphate of the growing glycan-linked C55-PP product. Analysis of the distribution of glycan products in a gel electrophoresis assay using 14C labeled lipid II revealed that PG GTases catalyze polymerization in a processive manner, meaning that they undergo multiple successive rounds of glycosyltransfer without releasing the growing polymer (6). A recent crystal structure of the S. aureus monofunctional GT bound to a lipid II analog has elucidated the structural details of lipid II binding to the acceptor site (7). As proposed in earlier models (5), the lipid II analog binds between the α3 and α5 helices with the nucleophilic GlcNAc C4-OH directly adjacent to its requisite base, E114. In this structure, R103 and R107 form electrostatic interactions with the acceptor pyrophosphate group and are required for lipid II polymerization, as shown by mutagenesis studies (Figure 1.1b) (7). A distinct crystal form of partially truncated S. aureus PBP2 (PBP2Δ) revealed the presence of a π-bulge in the conserved outer helix located between the donor and acceptor binding sites (9). It is hypothesized that the π-bulge may promote localized unfolding in order to sterically permit translocation of the lipid linked polymer from the acceptor to donor site following glycosyl bond formation (9). Interestingly, the donor site requires a lipid tether length of at least 20 carbon units whereas the acceptor site displays a broad tolerance of lipid lengths (10). The observed lipid stringency of the donor site may suggest that membrane anchoring and/or hydrophobic interactions with residues of the jaw subdomain are important for PG polymerization. Synthesis of large glycan chains requires the presence of the full transmembrane domain of Streptococcus pneumonia PBP2a, further corroborating the notion that membrane proximity and interaction is a key determinant for processive polymerization (11). 	   4	  Understanding the structural and molecular mechanisms governing acceptor (lipid II) binding, glycan length determination and polymer processivity are important future avenues of investigation. The PBP GT active site remains an attractive antibiotic target. Despite having low nanomolar inhibitory activity, moenomycin is impractical for use in humans due largely to poor bioavailability and long serum half-life resulting in poor pharmacokinetic properties (12). However, Kahne and colleagues have recently reported the design and use of an analog containing the minimal moenomycin pharmacophore, linked to a fluorescent probe that was used to screen for low micromolar affinity GT inhibitors (13). Furthermore, Herdewijn and colleagues have synthesized a series of lipid II substrate analogs that display low micromolar affinity inhibition of PBP1b catalyzed glycosyltransfer, and have antibacterial activity against Bacillus subtilis (14). Recently, Cooper and colleagues have used moenomycin and other GT inhibitors as templates to synthesize a novel pyranose scaffold based compound library. They identify two novel monosaccharides that display in vitro inhibition comparable to moenomycin, with excellent in vivo efficacy in a mouse mammary gland S. aureus infection model (15). Taken together, the rapidly evolving structural understanding of GT mediated lipid II polymerization and improved fluorescence-based assays make the informed design of structure-based inhibitors more tangible than ever. 1.2.2 Peptidoglycan transpeptidation The transpeptidation step in PG biosynthesis confers rigidity to the sacculus and is the main target for the β-lactam antibiotics. TPs catalyze a two-step reaction that begins with serine-mediated acylation of the position 4 D-alanine carbonyl in the stem-peptide of the growing strand. This intermediate is then deacylated via nucleophilic attack by a side chain amino group in the 3rd position of the pentapeptide (typically meso-DAP or L-lysine-pentaglycine) on an adjacent PG strand resulting in transpeptidation [Figure 1.1c; reviewed in (1)]. In the TP active site the binding location for the acceptor pentapeptide is as of yet unknown (in contrast to that of the donor pentapeptide). 	   5	  For bi-functional PBPs, it is predicted that the growing polymer is fed directly into the TP active site following transglycosylation (8). This hypothesis is indirectly supported by the observation that transpeptidation only occurs on a glycan-polymerized substrate (16,17), hence it is likely that the activity of the TP and GT active sites is in some way coordinated. However, this hypothesis is yet to be directly validated and is complicated by the fact that the PBPs are part of a multi-protein synthase machine and thus the regulation and mechanics of synthesis must be viewed in this context (18). The limitations in our current understanding of PG synthesis are likely in part due to the fact that the building blocks of the PG synthesis machinery have traditionally been studied independently rather than as an integrated macro-molecular machine.  	   6	   Figure 1.1 PBP catalyzed transglycosylation and transpeptidation. (a) Schematic of the GT and TP mediated incorporation of lipid II monomers into peptidoglycan. Staphylococcus aureus PBP2 [PDB ID: 2OLV (5)] is shown in a surface representation with GT, linker and TP domains colored blue, green and red respectively. (b) Active site close-up and mechanistic details of the GT reaction. The moenomycin bound PBP2 GT domain [PDB ID: 2OLV (5)] is depicted as a blue cartoon with selected active site residues shown as green sticks with atoms colored by type (N, blue; O, red; S, yellow). The donor molecule mimic (moenomycin) bound to PBP2 is depicted as pink sticks with atoms colored by type. The lipid II analog bound S. aureus monofunctional GT [PDB ID: 3VMT (7)] is overlaid onto the PBP2 bound structure and the acceptor analog molecule, R103 and R117 are displayed as cyan and brown sticks with atoms colored by type. (c) Active site and mechanistic details of PG TP. The D-α-meso-DAP-ɛ-D-alanine-D-alanine bound PBP4a acyl enzyme complex protein backbone [PDB ID: 2J9P (19)] is shown as a red cartoon with the pentapeptide mimic depicted as beige sticks with atoms colored by type. Residues of the SXXK, SXN and KTG(S/T) motifs are represented in teal, blue and orange sticks respectively with atoms colored by type.    	   7	  1.3 β-Lactams: Mechanism of Action Sir Alexander Fleming’s discovery of benzylpenicillin in the late 1920s initiated interest in deciphering the molecular mechanism of β-lactam action. In the 1940s radioactive benzylpenicillin was shown to localize to the cytoplasmic membrane leading to the conclusion that β-lactams were affecting the synthesis of some key cell surface structure (20,21). However, further target identification had to wait 20 years for elucidation of the peptidoglycan (PG) chemical architecture and biosynthetic pathway [for a detailed review on PG synthesis, please see (1)]. The bacterial PG is a vast glycan mesh that envelops the entire cell and imparts the rigidity necessary to define cell shape and morphogenesis as well as protect the cell from osmotic rupture (18). In the mid-1960s, the stem peptide cross-linking PG transpeptidases (TPs) were identified as the lethal target of the β-lactams, and the complexity of β-lactam action was attributed to the multiple penicillin-binding proteins (PBPs) that are targeted by them (22,23). The PBP TPs typically catalyze a two-step reaction in which the position 3 amino group of an acceptor strand attacks the peptide bond of the terminal D-alanine-D-alanine of a donor strand, releasing the D-alanine leaving group and forming a peptide cross-link (24,25). The inhibition of PBPs ultimately results in reduced PG stem peptide cross-links and deregulation of PG degradation, which causes the accumulation of sacculus defects (26). These localized PG defects result in the inability of the cell wall to withstand the osmotic turgor pressure of the cytoplasmic membrane resulting in outer-membrane encased balloon-like structures on the surface of the bacterial cell that eventually rupture leading to cell death (27). 1.3.1 β-lactam mediated inhibition of PG transpeptidase The β-lactam antibiotics act as covalent substrate analogues of the D-alanine-D-alanine portion of the acceptor stem peptide. All PBP TP domains contain three highly conserved active site sequence motifs: (i) the SXXK motif (that includes the catalytic serine nucleophile and general base lysine), (ii) the SXN triad, and (iii) the KTG(T/S) motif (24). The mechanism of TP inhibition is initiated by deprotonation of the motif i catalytic S61 O-γ by the concerted general base K64 N-ζ facilitating nucleophilic attack 	   8	  on the β-lactam amide carbonyl carbon resulting in the formation of a tetrahedral intermediate (Figure 1.2a). This transiently formed intermediate is stabilized by hydrogen bonding to conserved residues in the oxyanion hole (comprised of main chain amides of motifs i and iii). Subsequently, the tetrahedral intermediate collapses to expel the negatively charged nitrogen leaving group which is presumably stabilized by protonation via S122 (motif ii), thereby forming an acyl-enzyme intermediate. The stable species is resistant to hydrolysis, presumably due to steric blockage of a requisite deacylating water by the nitrogen of the former β-lactam ring [Figure 1.2a-b; reviewed in (24,25)].  Figure 1.2 β-Lactam-mediated inhibition of PBP TPase. (a) Mechanism of PBP-mediated acylation and eventual hydrolysis. (b) Active site close-up of benzylpenicillin-bound Thermosynechococcus elongatus PBPA. The benzylpenicillin-bound PBPA active site (PDB ID: 2JBF) is depicted as a blue cartoon with selected active site residues shown as blue sticks with atoms colored by type (N, blue; O, red; S, yellow). The acylated benzylpenicillin is depicted as pink sticks with atoms colored by type. Hydrogen bonding and electrostatic interactions are shown as black dashes.    	   9	  1.3.2 Major classes of β-lactams Since the initial discovery of benzylpenicillin, numerous other β-lactam classes have been developed, expanding our antibiotic arsenal to combat resistance. β-Lactams fall into four distinct structural classes that all have the four-membered lactam core moiety in common (penicillins, cephalosporins, carbapenems, and monobactams). Taken together, the multiple β-lactams constitute a comprehensive and structurally diverse set of compounds that display different pharmacological properties and are used for unique clinical indications.  The penicillins were initially derived from Penicillium fungi and represent the oldest “pure” antibiotic concoction used by man. The clinical testing of Fleming’s purified penicillin extract in the early 1940s was met with unparalleled success and marked a seminal advancement in medical history (28). The penicillin core consists of a five-membered thiazolidine ring fused at the 2’ and 3’ positions to the β-lactam ring (Figure 1.3). Today, there are four major penicillin subclasses: (i) natural penicillins, (ii) penicillinase-resistant penicillins, (iii) aminopenicillins, and (iv) extended-spectrum penicillins (29). The evolution of bacterial resistance to natural product penicillins stimulated a renaissance in the development of novel semisynthetic derivatives, which are made using the 6-aminopenicillanic acid (6-APA) precursor molecule (30). Although the penicillin family continues to be an important cornerstone in modern medicine, the emergence of widespread bacterial resistance has led to decreased efficacy in recent decades driving development of alternative β-lactams. The cephalosporins (the first of which, cephalosporin C, was isolated from the fungi Cephalosporium acremonium in 1948) have a six-membered dihydrothiazine ring attached to the lactam core (Fig. 2). Interest in the clinical development of cephalosporins stemmed from their resistance to hydrolysis by penicillinases (31). The side chains used in the development of semisynthetic penicillins were incorporated into the cephalosporin core scaffold (32). However, in contrast to the penicillins, the cephalosporin core offers an additional site of variation at the C3 position (Figure 1.3), giving rise to a breadth of structural diversity. The cephalosporins are generally grouped 	   10	  into four distinct generations based upon several features of antimicrobial activity [reviewed in (32)]. The most recent cephalosporins in development either display antipseudomonal activity or are effective against methicillin-resistant Staphylococcus aureus (MRSA) (eg. ceftobiprole) (33).   Figure 1.3 Chemical structures of β-lactam core scaffolds that are in current clinical use. The carbapenems [the first of which, thienamycin, was discovered in the mid-1980s as a metabolic product of Streptomyces cattleya (34)] have a five-membered 2,3 unsaturated ring with a C1 carbon rather than sulfur 4,5 fused to the lactam core. In place of the acylamino group seen at the R1 position in penicillins and cephalosporins, the carbapenems have a hydroxyethyl side chain that is important for resisting β-lactamase-mediated hydrolysis (Figure 1.3) (35). Remarkably, carbapenems have overall broader antimicrobial activity than the penicillins, cephalosporins, and other β-lactam/β-lactamase inhibitor combinations (36). A key attribute of the carbapenems is their ability to bind indiscriminately to multiple PBPs and resist hydrolysis or inhibit many β-lactamases (37,38). Today, carbapenems are often our last line of defense against multidrug-resistant Gram-negative pathogens. However, clinically available carbapenems have low oral bioavailability and thus do not readily penetrate gastrointestinal tissues and are typically administered intravenously (36). The monobactams are predominantly synthetic monocyclic β-lactams with variable organic groups at positions C3 and C4 as well as a sulfonic acid moiety attached to the N1 nitrogen (Figure 1.3). The sulfonic acid group is thought to activate the β-lactam ring assisting the acylation of transpeptidases (39). Aztreonam is currently the only clinically approved monobactam. Aztreonam 	   11	  binds to PBP3 of susceptible aerobic Gram-negative pathogens with high affinity, yet displays very poor acylation of Gram-positive PBPs resulting in an inability to treat Gram-positive infections (40). Due to its relatively narrow spectrum of activity, aztreonam is generally used as part of antibiotic combination therapies (such as aztreonam-vancomycin) (41). However, there is substantial interest in developing new monobactams given that they are stable to the emerging metallo-β-lactamase (MBL) enzymes (42). 1.4 β-Lactam Resistance Mechanisms Even before penicillin was commercialized in the early 1940s, penicillin-resistant β-lactamase expressing strains of E. coli were identified (43). The identification of β-lactam resistance led to the development of extended-spectrum antibiotics such as ceftazidime, cefotaxime, and the carbapenems as well as β-lactam-based serine β-lactamase inhibitors such as tazobactam, sulbactam, and clavulanic acid (44). However, extensive use of these compounds both in medicine and in the agricultural industry has placed a tremendous selective pressure on bacteria, such that currently no single β-lactam is free from resistance. It is now commonplace for individual bacteria to have multiple different resistance genes that function in concert to confer extended-spectrum resistance. The three main mechanisms of bacterial resistance to the β-lactam antibiotics are (i) target modification of the PBPs resulting in a lack of β-lactam binding, (ii) regulation of β-lactam entry and efflux, and (iii) enzymatic degradation by β-lactamases. 1.4.1 Target modification: A common mechanism by which Gram-positive bacteria evade the onslaught of β-lactams is through the acquisition of modified PBP targets with reduced susceptibility. Modified PBPs typically arise via resistance mutations that occur in the presence of β-lactam induced selective pressure, or by acquisition of resistant PBPs by horizontal gene transfer (45). The modified PBP must have reduced susceptibility to β-lactams, yet still retain cellular function. Today, some of the most prominent 	   12	  nosocomial multi-drug resistant Gram-positive bacterial infections owe their resistance to modified low-affinity PBPs [egs. MRSA and Enterococcus faecium] (46,47). 1.4.2  Regulation of β-lactam entry and efflux β-Lactams are among the few antibacterials that are effective against both Gram-positive and Gram-negative bacteria, facilitated by the accessibility of the PBP targets that reside on the outer leaflet of the cytoplasmic membrane. Nevertheless, some Gram-negatives such as Pseudomonas aeruginosa have developed sophisticated mechanisms for restricting access of the β-lactams to their target PBPs. The two most common mechanisms that regulate this phenomenon at the Gram-negative outer-membrane are the restricted entry of drugs via the alteration or loss of porins and their active expulsion via multi-drug efflux pumps [reviewed in (48,49)].	  1.4.3 Enzymatic degradation The single most prominent mechanism of bacterial resistance to the β-lactams is the expression of hydrolytic enzymes called β-lactamases. These enzymes specifically recognize and hydrolyze the four-membered β-lactam ring leading to an inactivated product that is no longer effective at inhibiting PBPs. Most frequently, resistance is conferred by mutation of preexisting β-lactamase genes resulting in a protein product with an enhanced spectrum of hydrolytic activity against the various β-lactam classes (50). Horizontal genetic transfer within microbial populations accounts for much of the spread of β-lactamase mediated resistance. Exogenous resistance genes are usually acquired by bacteria through transformation, conjugation, and transduction (51) The new genetic material is then either incorporated into the bacterial chromosome or replicates separately. The mobile genetic elements that facilitate horizontal gene transfer are: i) extra-chromosomal double-stranded circular DNA (plasmids), ii) DNA sequences that can insert themselves into alternate locations in the genome (transposons), and iii) genetic assembly elements that can capture and incorporate gene cassettes by site-specific recombination (integrons) [reviewed in (52,53)]. Many β-lactamases are encoded on these mobile genetic elements leading to increased transmission and spread such that it is now commonplace to find 	   13	  bacterial strains harboring as many as eight different β-lactamases each tailored to inactivate a unique subset of antibiotics (54). β-Lactamases themselves are typically grouped into four distinct classes based upon amino acid sequence similarity (molecular classes A–D). Molecular classes A, C, and D utilize an active site serine to initiate bond hydrolysis and are thereby referred to as serine β-lactamases (SBLs). In contrast, the unique molecular class B enzymes are metallo-β-lactamases (MBLs) that use active site zinc ions to coordinate a nucleophilic hydroxide to mediate ring opening. The class B enzymes are further categorized into the subclasses B1, B2, and B3 based upon amino acid sequence similarities. Collectively, these enzymes are capable of hydrolyzing every clinically available β-lactam. 1.4.3.1 Serine β-lactamases Class A The class A penicillinase TEM (or RTEM) was the first clinically relevant plasmid-encoded β-lactamase identified in Gram-negative bacteria (E. coli and Salmonella enterica) in the early 1960s (55). By the late 1970s and early 1980s, broad-spectrum TEM and SHV were the most common plasmid-encoded β-lactamases in Gram-negative isolates. Their apparent abundance and location on mobile genetic elements provided a rich environment for the evolution of these enzymes in response to the introduction of new β-lactams (56). Class A extended-spectrum β-lactamases (ESBLs) of the TEM, SHV, and CTX-M families are currently among the most clinically significant β-lactamases and have evolved to not only hydrolyze the penicillins but also broad-spectrum cephalosporins and monobactams (55). Today, the class A CTX-M enzymes are the most prominent ESBLs globally and have the ability to readily hydrolyze extended-spectrum cephalosporins such as cefotaxime (57). The blaCTX-M-15 gene has spread worldwide, and is often located on highly mobile IncFII plasmids and is associated with the insertion sequence IS26 (58). KPC-2 (also commonly located on IncFII plasmids) is the most frequently reported class A carbapenemase to date and has been found as the causative agent in numerous carbapenem-resistant nosocomial outbreaks (59). The active site of class A β-lactamases contains four distinct motifs that are important for substrate binding and catalysis: (i) S70XXK, (ii) 	   14	  S130XN, (iii) K234-T/SG, and (iv) the Ω loop (Figure 1.4a). The general mechanism of class A β-lactamase hydrolysis begins with the activation of S70 by deprotonation. There are currently two proposed mechanisms for S70 activation: (i) K73 acts as a general base to deprotonate the catalytic S70 (60,61), and (ii) E166 activates a water molecule which subsequently deprotonates S70 (62). Once activated, S70 attacks the β-lactam amide bond resulting in the formation of a tetrahedral intermediate that is stabilized by the oxyanion hole of the enzyme (63). Subsequently, the tetrahedral intermediate breaks down to expel the N4 nitrogen leaving group, which is protonated by S130 resulting in the formation of a transient acyl-enzyme intermediate. K73 is thought to shuttle a proton to S130 for leaving group protonation during this process (62). Deacylation is generally thought to proceed through activation of a nucleophilic water molecule by E166 on the Ω loop, resulting in the hydrolysis of the acyl bond with concomitant back donation of a proton to S70, likely through a concerted shuttle via K73, and release of the de-activated product from the active site (64). Class C  The class C β-lactamases or AmpC enzymes originally evolved to hydrolyze cephalosporin antibiotics. However, today many of these enzymes show high catalytic efficiency toward the penicillins (65). These enzymes are typically chromosomally encoded carbapenemases that are often under inducible expression. However, several class C enzymes have now been found localized on high copy number mobile plasmids (66). The class C enzymes are predominantly found in Gram-negative organisms such as E. coli and K. pneumoniae (67). Typically, AmpC enzymes are resistant to the clinically approved β-lactamase inhibitors; however, some remain susceptible to sulbactam and tazobactam (65). The four active site motifs that define the class C enzymes are (i) the S64XXK, (ii) Y150AN, (iii) K314TG, and (iv) the Ω loop. The Ω loop occupies a unique position when compared to the class A enzymes, leaving room for more bulky cephalosporin β-lactam side chains (Figure 1.4c) (65). The general mechanism of catalysis for AmpC β-lactamases is assumed to be largely analogous to the class A enzymes. However, the unique Y150 (motif ii) is ideally positioned to act as a potential 	   15	  proton donor to the β-lactam nitrogen leaving group following acylation, and it is generally accepted that this residue has a vital role in catalysis (67). Class D  The class D β-lactamases are the most structurally divergent of the SBL subclasses, and amino acid sequence similarity to the class A and C enzymes is restricted to distinct active site regions. These β-lactamases are predominantly known as OXA enzymes due to their ability to hydrolyze oxacillin (68). The class D genes are typically plasmid encoded and are often localized to gene cassettes in integron regions. Similar to class A enzymes, the class D β-lactamases were originally identified as penicillinases, which have subsequently evolved the ability to hydrolyze a specific subset of cephalosporins and carbapenems (68). Recently, the carbapenem-hydrolyzing OXA-48 enzyme has gained attention due to its broad substrate specificity and large clinical prevalence in carbapenem-resistant Enterobacteriaceae (69). The blaOXA-48 gene is predominantly located on a single 62 kb IncL/M plasmid (70). Several class D SBLs have been found to exist as a dimer in solution, and the dimer-monomer equilibrium appears to be an important factor governing the kinetics of β-lactam hydrolysis (71,72). It is disquieting that this emerging class of enzymes cannot be efficiently inhibited by any of the clinically approved β-lactamase inhibitors and is developing hydrolytic activity toward the heralded carbapenems (73). Class D SBLs have a truncated sequence between helices α3 and α5, as well as between α8 and strand β7 when compared to the class A and C enzymes, resulting in a dramatically larger active site cleft (Figure 1.4d). As for other SBLs, the class D enzymes contain four key active site sequence motifs, (i) S67XXK, (ii) S115XXV, (iii) the K205-T/S-G motif, and (iv) the Ω loop (71). When compared to the class A enzymes, the Ω loop is further from the active site core, which results in a larger substrate binding cleft. In addition, the (motif i) K70 is N-carboxylated to a varying extent depending on the particular OXA enzyme under consideration  (Figure 1.4d) (68). As in other SBLs, S67 (motif i) acts as a nucleophile to attack the β-lactam amide carbon. However, it is thought that the role of carboxylation 	   16	  is to increase the basicity of K70 so as to serve as a more potent base to abstract a proton directly from S67 during acylation (74). Furthermore, the carboxylated K70 is positioned ideally to activate the deacylating water during hydrolytic deacylation (75).  1.4.3.2 Metallo-β-lactamases The first discovered class B enzyme was the Bacillus cereus MBL BcII in 1966 by Sabath and Abraham (76). By 1989, only four MBL enzymes had been discovered, and each appeared to be chromosomally encoded and species specific. For the following two decades, the MBLs were seen as interesting, yet clinically insignificant. However, in 1991, the discovery of plasmid-encoded IMP-1 from P. aeruginosa in Japan launched a renaissance in the discovery and characterization of new MBLs (77). MBL-mediated resistance in nosocomial infections has gained traction in many multidrug-resistant Gram-negative pathogens including P. aeruginosa, E. coli, K. pneumoniae, Bacteroides fragilis, and Aeromonas hydrophila (77). Today, MBLs are predominantly plasmid encoded as part of mobile genetic cassettes, which facilitates their transmission throughout microbial populations (78). MBLs are known for their promiscuous nature and ability to hydrolyze nearly all β-lactams with the exception of the monobactams. Recent years have seen the development of MBLs like the New Delhi metallo-β-lactamase (NDM-1) that can confer enteric pathogens such as E. coli and K. pneumoniae with nearly complete resistance to all β-lactams including the carbapenems (79). The blaNDM-1 gene is broadly disseminated in Enterobacteriaceae and is not restricted to a particular plasmid family (79-81). Additionally, bacteria co-expressing SBLs and MBLs are often capable of hydrolyzing the clinically relevant monobactam aztreonam (82). Despite vast research efforts, and due in part to the lack of a covalently bound adduct during hydrolysis, the development of a clinically useful MBL inhibitor is yet to materialize.  Despite having relatively low sequence identity, the MBL enzymes have a remarkably conserved fold, which is characterized by an internal β-sandwich flanked on its outer face by five solvent-exposed α-helices (Figure 1.4b). The zinc-containing active site is localized to one face of the 	   17	  β-sandwich in a broad, yet shallow groove (42). Although MBLs are generally homovalent zinc-dependent hydrolases, several have nevertheless been found to bind cobalt and cadmium in addition to zinc, with varying degrees of hydrolytic efficiency (83). The MBLs are either mono-zinc or di-zinc depending upon the particular enzyme subclass being considered. The B1 and B3 enzymes utilize a di-zinc center to mediate hydrolysis, whereas the B2 MBLs are mono-zinc enzymes that are inhibited by the presence of a second active site zinc ion and display high specificity for carbapenem hydrolysis (84,85).  In the substrate free form of subclass B1 and B3 MBLs, Zn1 is coordinated in a tetrahedral fashion by three universally conserved histidine residues and a bridging hydroxide ion. Both the subclass B1 and B3 enzymes coordinate Zn2 with trigonal bipyramidal geometry yet differ in the ligands typically utilized. The subclass B1 MBLs coordinate Zn2 with D124, C208 and H250  (NDM-1 numbering used) whereas, the B3 enzymes typically coordinate Zn2 using D120, H121 and H263 (FEZ-1 numbering) in addition to two axial water molecules (86). In contrast, the mono-zinc subclass B2 MBLs coordinate a single zinc ion with D120, C221 and H263 (CphA numbering), which is equivalent to the Zn2 site in the di-zinc subclass B1 MBLs (87). In crystal structures of the subclass B1 and B3 MBLs, Zn1 is typically refined with higher average occupancy than Zn2, suggesting potentially weaker binding of the latter ion. However, catalytic efficiency is generally believed to be optimal when the subclass B1 and B3 enzymes are in the di-zinc form (88,89).  For the subclass B1 and B3 MBLs (for which the mechanism has been more extensively studied), the β-lactam carbonyl is coordinated by Zn1 in the precatalytic complex. The C3 carboxylate of the substrate forms an electrostatic interaction with the conserved K211 (Figure 1.4b). Binding by the electropositive zinc ions maintains the bridging catalytic hydroxide at a measured pKa of 5–6 (90). Nucleophilic attack by this hydroxide on the activated carbonyl results in the formation of a tetrahedral intermediate, which is stabilized by a predicted oxyanion hole (consisting of Zn1 and potentially the amide side chain nitrogen of N220). The tetrahedral intermediate then breaks down to expel the 	   18	  negatively charged nitrogen, which is proposed to be protonated by bulk solvent (91). The product is subsequently released from the active site, and the nucleophilic hydroxide is reloaded between the zinc ions for another round of catalysis. For a more complete analysis of the MBL catalytic mechanism, please refer to the following reviews (87,91).          Figure 1.4 Structural comparison of β-lactamase enzymes. (a) Overall structure and active site close-up of the class A β-lactamase CTX-M-9 (PDB ID: 3HLW). The CTX-M-9 protein is depicted as a green cartoon with selected active site residues shown as pink sticks. Acylated cefotaxime is depicted as blue sticks. (b) Overall structure and active site close-up of the class B1 β-lactamase NDM-1 (PDB ID: 4EY2). The NDM-1 protein is depicted as a cyan cartoon with selected active site residues shown as beige sticks with atoms colored by type. Hydrolyzed methicillin is depicted as pink sticks. (c) 	   19	  Overall structure and active site close-up of the class C β-lactamase AmpC (PDB ID: 1IEL). The AmpC protein is depicted in blue cartoon representation with selected active site residues shown as gold sticks with atoms colored by type. Acylated ceftazidime is shown as cyan sticks. (d) Overall structure and active site close-up of the class D β-lactamase OXA-1 (PDB ID: 3ISG). The OXA-1 protein is depicted in dark teal cartoon representation with selected active site residues shown as orange sticks with atoms colored by type. Acylated doripenem is shown as pink sticks. In (a–d), a close-up of the native (left) and acylated (right) enzyme is depicted. In all panels, hydrogen bonding and electrostatic interactions are shown as blue dashes, and all non-carbon ligand and residue atoms are colored by type (O; red, N; blue, S; yellow).  1.5  β-Lactamase Inhibitors To overcome SBL resistance, three β-lactam based inhibitors have been introduced into clinical practice (sulbactam, clavulanic acid and tazobactam). Sulbactam and tazobactam are penicillanic acid sulfones (92), while clavulanic acid is a clavam secondary metabolite from Streptomyces clavuligerus originally isolated in the early 1970’s (93). These inhibitors form a long-lived acyl-enzyme intermediate with the catalytic serine, characterized by a very slow rate of hydrolytic deacylation. Following acylation, a second ring-opening event occurs leading to a stable imine that undergoes various chemical transformations. Eventually, the acyl-enzyme hydrolytically deacylates either directly, or through a series of covalent intermediates to yield active enzyme and inactivated product (94). The β-lactam based inhibitors target the molecular class A enzymes and are generally ineffective against strains harboring the emerging class C and D SBLs. Furthermore, there are now several class A enzymes that have evolved resistance to these β-lactam based compounds, a prospect that makes the development of novel inhibitors paramount (94).   The latest β-lactam/β-lactamase inhibitor combination to be approved for clinical use in humans by the U.S. FDA was ceftazidime-avibactam in early 2015 for the treatment of complicated intra-abdominal and urinary tract infections (IAI’s, and UTI’s). Additionally, there are three β-lactam/inhibitor combinations in late stage clinical development; ceftaroline-avibactam, imipenem-cilastatin-MK-7655, ceftolozane-tazobactam, and meropenem-RPX7009 (inhibitor chemical structures shown in Figure 1.5) (95,96). Typically, new inhibitors are paired with either late generation cephalosporins or carbapenems in large part due to their broad-spectrum activity.  	   20	   Figure 1.5 The chemical structures of various β-lactamase inhibitors. Diazabicyclooctane SBL inhibitors  Avibactam and MK-7655 are members of a novel non-β-lactam based class of inhibitors called diazabicyclooctanes (DBOs). These compounds contain a bridged bicyclic urea core and display potent inhibition of an unprecedented range of β-lactamase targets that encompasses the class A, C and a subset of class D SBLs (97,98). MK-7655 is structurally very similar to avibactam with the addition of a piperidine ring attached to the C2 carboxamide (hereafter referred to as R1) (Figure 1.5). The AztraZeneca and Activis combination therapies (avibactam-ceftaroline, and avibactam-aztreonam) are currently in phase II and phase I clinical trials (http://www.clinicaltrials.gov). Merck has partnered MK-7655 with imipenem and the human dehydropeptidase inhibitor ‘cilastatin’ as part of a triple combination drug that is currently in phase II clinical trials for the treatment of cUTI’s (95). The role of cilastatin is to prolong the half-life of imipenem by inactivating human dehydropeptidase, which would otherwise readily degrade the carbapenem.   DBOs form a unique carbamyl linkage with the catalytic serine as apposed to the acyl-enzyme observed for the β-lactam based compounds (99). Importantly, avibactam does not decarbamylate via hydrolysis as is true for the β-lactam based inhibitors, yet rather undergoes a reversible recyclization mechanism that re-capitulates intact avibactam (100). Taken together, rapid carbamylation, slow 	   21	  recyclization and regeneration of intact avibactam during decarbamylation result in its unprecedented potency. Crystal structures of carbamyl-avibactam bound to the class A and C SBLs (CTX-M15 and AmpC) show that it acts as a substrate analog of the β-lactam acyl enzyme (99). Future development of the DBOs should focus on extending their spectrum of activity to include a broader range of class D and potentially class B β-lactamases. Boronic acid SBL inhibitors  Boron contains an empty p-shell making it an excellent electrophile with a high propensity to form dative covalent bonds with active site serine nucleophiles (101,102). Since their initial discovery in the late 1970s, the boronates have proven to be effective SBL inhibitors in vitro. The boronates function as transition state analogues that form a reversible non-hydrolyzable bond with the catalytic serine O-γ, mimicking the sp3 hybridized anionic tetrahedral intermediate(s) formed during β-lactam hydrolysis. The development of SBL inhibitory boronates has largely focused on molecular mimicry with clinically approved β-lactams to confer affinity and specificity (103). A novel heterocyclic boronate inhibitor RPX7009 is being developed by Rempex Pharmaceuticals and displays strong potentiation of the carbapenem antibiotic biapenem against class A carbapenemase producing Enterobacteriaceae (96). RPX7009 contains a thiophene moiety in an analogous position to the R1 group of the nitrocefin and cefoxitin cephalosporins (Figure 1.5). Currently, RPX7009 is in phase III clinical trials in combination with meropenem (carbavance) for the treatment of UTIs or acute pyelonephritis (http://www.clinicaltrials.gov). A major challenge for the future will be the design of clinically useful boronic acid inhibitors that target the class B and D enzymes. A major consideration in development of the boronic acid SBL inhibitors is their propensity for off-target inhibition of serine proteases and the proteasome, such that structure-guided functionalization conferring target specificity is of prime importance in their continued development (104).    	   22	  Overcoming MBL and Class D SBL mediated resistance There is a troubling paucity of inhibitors active against the rapidly emerging molecular class B and D β-lactamases, creating an ominous unmet medical need. A current strategy to counteract MBL-positive pathogens is to utilize monobactams, which are the only β-lactam subclass that are immune to MBL catalyzed hydrolysis. Basilea Pharmaceutica is currently developing a triple combination antibacterial cocktail (BAL30376) containing the monobactam AmpC inhibitor BAL29880, monobactam-siderophore BAL19764 and the clinically approved class A β-lactamase inhibitor clavulanic acid (Figure 1.5). The strategy is that BAL29880 and clavulanic acid will inactivate the class C and A enzymes, leaving the MBL stable BAL19764 to inhibit its PBP targets (105). Basilea is also developing a new siderophore monosulfactam ‘BAL30072’, which has potent activity against carbapenemase producing strains of Gram-negative bacilli including Acinetobacter spp., Pseudomonas aeruginosa, Burkholderia cepacia, and a pan multi-drug resistant Enterobacteriacea (106). Furthermore, AstraZeneca has recently entered the aztreonam-avibactam combination therapy into phase I clinical trials, a cocktail that is impervious to the hydrolytic activity of the vast majority of β-lactamases, with a notable exception being a subset of class D enzymes (107). A promising preclinical MBL inhibitor candidate is the fungal natural product aspergillomarasmine A (AMA) (Figure 1.5), which is a potent inhibitor of the VIM and NDM MBLs, presumably via chelation of the catalytically essential active site zinc (108). AMA fully restored the antimicrobial activity of meropenem against VIM or NDM-1 carrying clinical isolates of Enterobacteriaceae, Pseudomonas spp., and Acinetobacter spp. Most notably however is that in mice infected with NDM-1 positive Klebsiella pneumoniae, AMA was able to effectively restore meropenem activity (108,109). Recently, Brem and colleagues characterized rhodanine hydrolysis products as potent MBL inhibitors and show that they complex with the VIM-2 active site zinc ions via thioenolate mediated zinc intercalation (110).    The class D OXA SBLs, were originally named for their ability to hydrolyze oxacillin and are a diverse group of enzymes with substrate hydrolysis profiles spanning from narrow to broad. At present, 	   23	  the clinically available SBL inhibitors are ineffective against the class D enzymes. However, promising data is emerging with respect to certain penicillin sulfones and thiophenyl oxime phosphonates that display potent inhibition of OXA24/OXA40 and demonstrate efficacy at potentiating carbapenems against OXA carrying Acinetobacter baumannii (111). Also of note is the encouraging ability of avibactam to inhibit certain class D enzymes. The observed variability is predominantly due to discrepancies in carbamylation rather than decarbamylation rates, an attribute that should be considered in future DBO drug design efforts (112).                                   	   24	  1.6 Objectives of Thesis The crisis of antibiotic resistance is now well known to experts and the public. Identifying new compounds and chemical strategies to address the resistance issue is paramount. Of particular concern is the widespread resistance to β-lactam antibiotics, which represent the single most commonly prescribed class of antibacterials used in medicine (38). This resistance is predominantly due to the expression of β-lactamases that hydrolyze the warhead lactam ring. The combination of β-lactam antibiotics with β-lactamase inhibitors such as clavulanic acid and tazobactam has proven to be a successful strategy for overcoming this resistance in the clinic. However, many prominent pathogens harboring extended-spectrum β-lactamases (ESBLs) and metallo-β-lactamases (MBLs) are now impervious to the activity of these early inhibitors creating an ever-growing unmet medical need. The aim of this thesis is to better understand the molecular details governing emerging β-lactamase mediated β-lactam resistance, and to gain detailed insights into β-lactamase inhibition.  Chapter 2 describes the structural and biochemical characterization of K. pneumoniae NDM-1, an enzyme that confers enteric pathogens with nearly complete resistance to the β-lactams. Crystallographic analysis of holo-NDM-1 as well as oligomerization and localization data is presented. This work has been published in Protein Science (113). Chapter 3 describes the structural characterization of multiple ligands bound to NDM-1. The high-resolution X-ray crystal structures of NDM-1 bound to the hydrolyzed penicillin antibiotics (benzyl penicillin, oxacillin and methicillin) as well as the hydrolyzed carbapenem (meropenem) and high affinity MBL inhibitor L-captopril are provided. This work has been published in the Journal of the American Chemical Society (114). Chapter 4 describes the molecular mechanism of avibactam mediated β-lactamase inhibition. For kinetic studies, we utilized the class A enzyme CTX-M-15, which is the most widely distributed extended-spectrum β-lactamase globally. The crystal structures of the carbamyl-enzyme complexes of 	   25	  avibactam bound to the clinical variants (OXA-10 and OXA-48) reveal the molecular details of class D SBL inhibition. This work has been published in ACS Infectious Diseases (115). Chapter 5 involves the characterization of a novel series of diazabicyclooctane avibactam derivatives. Structural and kinetic analysis of these derivatives in complex with class A and D SBLs (CTX-M-15 and OXA-48) confirm that the derivatives retain avibactam’s potent β-lactamase inhibitory properties.  The derivatives also display remarkable synergy in combination with β-lactams against a number of strains, including those harboring MBLs like NDM-1, despite a lack of inhibition of MBLs in vitro.  We find that the diazabicyclooctane derivatives act as potent antimicrobial agents outright and display robust antibacterial activity against clinical isolates of P. aeruginosa, E. coli, and Enterobacter spp. Furthermore, we use E. coli as a model system to identify the cellular target of these derivatives as the essential cell elongation associated Penicillin-Binding Protein 2 (PBP2) and elucidate the molecular details governing PBP inhibition by solving the co-crystal structure of the PBP1b membrane protein in complex with an avibactam derivative. This work has been published in ACS Chemical Biology.               	   26	  2 Crystal Structure of New Delhi Metallo-β-Lactamase (NDM-1) Reveals Molecular Basis for Antibiotic Resistance1 2.1 Introduction β-lactam antibiotics such as the cephalosporins and carbapenems remain the largest class of clinically used antibiotics worldwide (116). β-lactams act by inhibiting cell wall biosynthesis, leading to membrane lysis and bacterial cell death. Specifically, they attenuate peptidoglycan biosynthesis by inhibiting the transpeptidase enzymes, involved in cross linking adjacent peptidoglycan strands via their penta-peptide repeats (117). This strategy for antibiotic treatment has been very successful due largely to limited toxicity, excellent bioavailability and broad activity (118).  Unfortunately, bacteria have gained broad-spectrum resistance to β-lactam antibiotics, resulting in devastating treatment issues. The single most important cause of high level bacterial resistance is the expression of enzymes called β-lactamases, which hydrolyze the four-member lactam ring of the antibiotic, yielding a product that is clinically inactive (119,120). β-lactamases are found widely disseminated throughout Gram-positive and Gram-negative bacteria, and are often encoded on mobile genetic elements, which facilitate their transmission (121).   β-lactamases have been grouped into four major classes (A-D) based upon amino acid sequence similarity (121). Classes A, C and D use an active site serine as a nucleophile. However, the class B metallo-β-lactamase enzymes (MBL), utilize bound zinc atoms in the active site to help ionize and coordinate a nucleophilic hydroxide ion to mediate hydrolysis (90). β-lactamase induced resistance has led to two main therapeutic strategies, i) introducing newly functionalized β-lactam antibiotics that are not recognized by β-lactamases; ii) co-administration of β-lactam antibiotics with β-lactamase inhibitor 	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	    1 A version of this chapter has been published. King D.T., Strynadka N.C.J. Crystal Structure of New Delhi Metallo-β-Lactamase Reveals Molecular Basis for Antibiotic Resistance. Protein Sci.  134(28): 1243-1263. (2011) 	   27	  compounds, active against the class A, C and D enzymes. However, despite vast research efforts in this area, there are currently no effective inhibitors targeted against the emerging class B enzymes. MBL enzymes are now found widely disseminated throughout the world (121). Coupled with their broad-spectrum substrate profile the clinical threat of MBLs is increasingly dire.      Recently, a novel resistance factor called the New Delhi metallo-β-lactamase (NDM-1) has been found to confer Enterobacteriaceae with nearly complete resistance to all β-lactam antibiotics including the carbapenems. This novel resistance gene was discovered in India and has rapidly spread throughout human populations on nearly every continent (122). NDM-1 positive Escherichia coli are now widespread in the environment and water supplies in India (123), likely a result of the fact that NDM-1 genes are typically located on readily transferable plasmids that are prone to rearrangement (79). Due to the selective advantage that NDM-1 confers and its propensity for plasmid-mediated horizontal gene transfer, it is feared that NDM-1 may herald the end of treatment with those drugs that are used clinically to fight Gram-negative infections (123,124).  In order to gain a more complete understanding of the structural basis for the antibiotic resistance conferred by NDM-1, we have determined the crystal structure of the holo form of this enzyme to a resolution of 2.1 Å using molecular replacement phases generated from a previously determined MBL homolog VIM-4 (125). Comparison of our NDM-1 structure with the very recent product complex form of NDM-1 (126) as well as other characterized Class B MBLs, provides important new insights into the catalytic mechanism within the active site as well as unique molecular features that may contribute to its broad spectrum antibiotic specificity.  2.2   Methods 2.2.1 Cloning, protein expression and purification Our sequence analysis suggests the NDM-1 gene (NCBI Code: FN396876) encodes an N-terminal type II lipidation signal peptide, with a cleavage site located between C26 and M27 (as 	   28	  predicted by LipoP) (127). The DNA sequence of the full length and mature proteins (M1-R270 and M27-R270) were synthesized by BioBasic and cloned into pUC57. This plasmid DNA was used as a template for PCR amplification of the NDM-1 gene (873 bp). Restriction free cloning produced a pET41b expression vector containing NDM-1 with an 8XHis tag on the N-terminus (128). NDM-1 protein was expressed in E. coli BL21 cells at 37°C until an OD600 of .7 was reached, and expression was induced by addition of 1mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and the culture was grown at 25°C for 12-16 hours. Harvested cells (~20g) were re-suspended in 50 mL lysis buffer (50mM Tris pH 7, 150 mM NaCl, 1 complete, EDTA-free protease inhibitor tablet from Roche), and lysed by French press at ~ 12,000 p.s.i. and the lysate was centrifuged (45,000 rpm, in a Beckman 60Ti Rotor) for 1 hr. Supernatant was passed through a 1-mL Hi-Trap HP His column, pre-equilibrated in lysis buffer. Elution buffer (50 mM Tris pH7, .5 M NaCl, 1M imidazole) was used to elute 8xHis NDM-1 with a gradient of imidazole from 0-.5M in 40 min. NDM-1 enriched fractions were dialyzed into buffer A (20mM HEPES pH8) and loaded onto a Mono Q 10/10 column equilibrated in buffer A. A continuous gradient of 10 column volumes (from A into A plus 2M NaCl) was used. NDM-1 eluted at ~400 mM NaCl. Fractions were passed over a Superdex 75 column using (20mM HEPES pH 6.8, 150 mM NaCl) as running buffer and concentrated to ~68 mg/ml.  2.2.2 Crystallization, data collection, and structure determination Crystals were grown by the sitting-drop method at 25°C using .2 µl protein solution, mixed with an equal volume of precipitant. Crystal conditions were .1M lithium sulfate, .63M ammonium sulfate, .05M Tris at pH 8.5. NDM-1 crystals were soaked for ~30s in cryoprotectant solution (precipitant + 25% glycerol), followed by flash cooling in liquid nitrogen. Data were collected at beamline CMCF-2 of the Canadian Light Source and processed using HKL2000 (129), and CCP4 (130). A total of 5% of reflections were used for cross validation. The structure of NDM-1 was solved by molecular replacement with Phaser (131), using the VIM-4 main chain atoms as a template (Protein Data Bank accession number 2WHG). Several cycles of manual rebuilding in Coot (132), and 	   29	  refinement with strict NCS restraints using REFMAC (CCP4) were carried out. Simulated annealing was performed on the partially refined model using Phenix (133). In the final stages of refinement, NCS restraints were relaxed and TLS groups (residues 43-65, 71-183 and 255-269) were defined to allow for differences in loop regions between the five monomers. Zinc and waters were added manually by examination of Fo-Fc and 2Fo-Fc maps and refined at full occupancy. Coordinates and structure factors were deposited in the protein data bank (PDB) with entry code (3ZSD). Figures were generated using PyMol (134), and the electrostatic surface was calculated using the adaptive Poisson-Boltzmann solver (APBS) program (135).  2.2.3 Sucrose density gradient centrifugation E. coli BL21 cells expressing full length c-terminally His-tagged NDM-1 (M1-R270) were prepared and lysed as described above. Lysate was centrifuged at 9,000 rpm for 15 min followed by centrifugation (45,000-rpm in a Beckman 60 Ti rotor) for 1hr to isolate cell membranes. Membranes were re-suspended in lysis buffer and layered atop a stepped sucrose gradient of 30, 35, 45, 50 and 55% sucrose in lysis buffer. Centrifugation was carried out at 39,000 rpm in a Beckman SW 41 Ti rotor for 16 hours at 4°C and sucrose layers were separated and analyzed by Western blot using an anti-His(C-term)-HRP antibody from Invitrogen. 2.2.4 Inductively coupled plasma mass spectrometry Inductively coupled plasma mass spectrometry (ICP-MS) was used to analyze purified NDM-1 samples for the presence of various metal ions (Mg24, Al27, Mn55, Co59, Ni60 and Zn66). The NDM-1 protein was purified as previously described and freshly dialyzed into ms-buffer (20mM HEPES, 100mM NaCl, pH7) in order to remove any contaminating metals. The protein was concentrated to ~12mg/mL and diluted 1/100 in ms buffer, followed by a 1/10 dilution in an internal standard (10 µg/L Sc45, 1% nitric acid, Inorganic Ventures).  Prior to sample analysis, the ICP-MS was calibrated using a standard solution containing the metal isotopes of interest (Inorganic Ventures). The protein sample was then transferred by nebulization into a NexION 3000 ICP mass spectrometer (Perkin Elmer). 	   30	  Quantitative analysis was performed in triplicate for each sample with 60 sweeps per reading using the peak-hopping mode with a 50ms/AMU dwell time for each element. Instrument settings were: rf power (1600 W), integration time (35s), collision gas (Ar40), RPQ voltage (25V) and sample flow rate (4 rpm).  Isotope abundance was determined by integrating peak areas using the NexION software program, and the data was represented graphically using Prism. 2.2.5 Dynamic light scattering Full length NDM-1 protein was purified as previously outlined, concentrated to ~10mg/mL and double filtered through a 0.22-µM filter prior to analysis.  Samples were immediately added to a clean quartz cuvette with a 1µL inner volume and analyzed using a DynaPro Nanostar instrument (Wyatt). The light source for the system was a 100 mW air launched laser, operating at 662 nm. All measurements were made at a constant temperature of 21°C, path length of 1cm and a scattering angle of 90°.  Data were fit using the Wyatt DYNAMICS software program to attain an approximate hydrodynamic radius and corresponding molecular weight. 2.2.6 Chemical cross-linking Purified full-length NDM-1 was prepared as previously described. Purified protein was exchanged into fresh cross-linking buffer (20mM HEPES, 150mM NaCl, pH8.0). A total of 140µg of purified NDM-1 protein was added to varying amounts of the chemical cross linker bis [sulfosuccinimidyl] suberate (Thermo Scientific). Reactions were made up to a final volume of 30µL with cross-linking buffer and incubated at room temperature for 30 min. The reactions were terminated using quenching buffer (1M Tris-HCl, pH 7.5) and immediately prepared for SDS polyacrylamide gel electrophoresis, or Western blot analysis.    	   31	  2.3  Results and Discussion 2.3.1    Structure solution NDM-1 is a single chain polypeptide, with a mature sequence from M27-R270 after cleavage of the signal peptide. The structure of holo-NDM-1 was solved by molecular replacement phasing and subsequently refined to a resolution of 2.1 Å (Table 2.1). The crystals are P1 with five protein chains in the asymmetric unit, and a Matthews coefficient of 2.67 (136), corresponding to a predicted solvent content of 53.6%, which roughly approximates the solvent content (44%) based on the model. In chains A, C and D, there were additional residues at the C-terminus left over after thrombin cleavage of the HIS tag (Table 2.1).  Due to missing density at the termini of the various chains, the following amino acids could be modeled; Chain A (43-270 and K271-L272-V273-P274 of the tag), Chain B (31-268), Chain C (43-270 and K271-L272-V273-P274 of the tag), D (43-270 and K271-L272-V273 of the tag) and E (43-269). The final refined model has an Rwork and Rfree of 21.7 and 25.1%, respectively, displays good stereochemistry as defined by PROCHECK (137), and contains 471 water and 10 Zn2+ ions within the asymmetric unit, all refined with an occupancy of 1.00. Each monomer had one residue (D90) in a disallowed region on the Ramachandran plot. This residue is a second shell zinc coordinating ligand involved in extensive hydrogen bonding interactions, which displays clear electron density, and has nearly identical phi/psi angles in the 1.3Å product-complex structure (126).          	   32	  Table 2.1 Data collection and refinement statistics for NDM-1.    NDM-1 Data collection CLS CMCF-2 Wavelength 1.00 Å Resolution Åa 49.21-2.10 Å (2.21-2.10 Å) Space group P1 a 66.54 Å b 73.91 Å c 77.41 Å       α, β, γ 70.32, 75.86, 65.30° Rsym (%)a .083(.533) I/σ(I)a 9(1.8) Completenessa 96%(89.5%) Unique reflectionsa 70204(9574) Redundancya 2.2(2.2) Refinement      Average B factor (Å2)           Protein 28.2          Ligand 30.0           Water 32.1     Ramachandran statistics           Favored regions 92.2%          Additionally allowed regions 7.3%          Disallowed regions 0.5%     Rwork 21.7%     Rfree 25.1%     r.m.s. b bonds 0.014Å     r.m.s. angles 1.86°   a Values in parenthesis represent the highest resolution shell.   b r.m.s. means root mean square.  2.3.2    Overall structure NDM-1 displays the typical MBL αβ/βα fold, as observed in the previously characterized MBL enzymes VIM-2 and IMP-1 (sequence identity ~32%), with an internal beta sandwich flanked by 5 solvent-exposed α-helices on its external face. Also in common, we observe the bi-nuclear Zn containing active site flanked by the L3 and L10 loops to locate near one edge of the β-sandwich in a shallow, broad groove (Figure 2.1a). However, when compared to the structure of the closely related enzyme VIM-2 (32% sequence identity and with a pair-wise RMSD of 1.22Å on the 87 common CA atoms of the holo-enzyme forms), two notable differences do exist. In particular, NDM-1 has an extra 	   33	  β-strand extension at the N-terminus of the enzyme, as well as a β-turn with an elongated loop region (L8) in place of the strand β8 present in VIM-2 and other homologues (loop L8; Figure 2.1b).            Figure 2.1 Overall structure of holo-NDM-1, NDM-1 localization and crystallographic dimerization. A, Cartoon of holo-NDM-1 structure (green), active site zinc ions (grey spheres), zinc ligands (stick, cpk coloring) and active site loops L3 and L10 (red). Secondary structure designations are labeled. B, Superposition of NDM-1 on holo-VIM-2 (PDB ID: 1K03) (138) (magenta). NDM-1 zinc ligands are colored by atom, and the NDM-1 loops L3, L8 and L10 are highlighted with a red arrow. C, Western blot of a step sucrose gradient of membrane associated 8xHIS FL-NDM-1. Negative control is E. coli BL21 membranes only. Positive control is outer membrane protein ZirT (139). D, NDM-1 crystallographic dimer interface for both holo (green) and ampicillinic acid bound (grey, PDB ID: 3Q6X) (126) forms. The L8, L10 and α3 helix constitute the dimer interface and are labeled on the holo structure (red).   2.3.3    Oligomerization state and membrane localization  Four of the five molecules within our P1 holo-NDM-1 unit cell and both chains in the P212121 product-complex NDM-1 structure display the same dimer interface involving two protein chains rotated ~180° relative to one another (Figure 2.1d). The fifth monomer in our holo structure sits on one face of the two dimer pairs in the asymmetric unit making crystal packing interactions with chains A, B 	   34	  and C in the adjacent unit cell and is not involved in dimerization. The dimer interface has a buried surface area of ~1900 Å2 and is predicted to be stable in solution by the CCP4 program PISA (140). The loop L8 that is unique to NDM-1 forms key contacts involved in this dimer interface. These involve hydrophobic and van der Waals interactions between the α3 helix residues A143, L144, N146 and Q147 with residues; T162, F163, A165 and G167 in the L8 loop region. This suggests a potential functional role in dimerization for this unique insertion.  Supporting a potential physiological role for the dimer interface in our crystallographic data, we used size exclusion chromatography, dynamic light scattering and chemical cross linking to show that the M1-R270 NDM-1 (FL) enzyme exists as a dimer in solution (Figure 2.2). To our knowledge, the only other example of a class B MBL oligomer is the L1 functional tetramer (141,142). This dimerization of purified NDM-1 may be an important feature for antibiotic resistance in a biological context.  Our biochemical analysis also suggests an unusual lipidation and outer membrane localization for NDM-1.  Normally, MBL enzymes contain a type I signal peptide.  However, the LipoP server (127) revealed probability scores of -.39 and 1.06 for type I (soluble) and lipidation signal peptides, respectively. As NDM-1 has a methionine rather than aspartic acid at position +2 from the lipidation signal cleavage site, it is expected to localize to the outer, rather than inner membrane (139). To probe the possibility of NDM-1 being a lipoprotein β-lactamase and study its potential localization, FL 8X HIS-tagged NDM-1 containing E. coli membrane samples were analyzed by a step sucrose gradient, followed by Western blot analysis using an anti-HIS antibody. Similar to our positive control (outer membrane porin ZirT), it was found that NDM-1 clearly predominated in the higher percentage sucrose layers (40-50% sucrose), suggesting that it preferentially localizes to the bacterial outer membrane (Figure 2.1c) (143). To our knowledge, there is only one other example of a lipoprotein β-lactamase enzyme (BRO-1) (144), and the functional role of its membrane localization remains uncharacterized. 	   35	  However, the observation of a lipidation signal and outer membrane localization in a clinically important and broad-spectrum β-lactamase such as NDM-1 re-opens this as a potentially important avenue of discovery in terms of antibiotic resistance and therapeutic development. 	                          Figure 2.2 The oligomeric state of NDM-1. A, The size exclusion chromatography profile of FL NDM-1.  The corresponding peaks are marked, along with appropriate positions of molecular mass standards 67 and 47 kDa. B, Dynamic light scattering plot of purified FL NDM-1. The monomer and dimer fractions, collected from gel filtration are shown in red and blue. The plot indicates that NDM-1 can exist as a dimer in solution. The results are displayed as particle size distributions with the inset showing the results summary table. C, 12% SDS-PAGE gel analysis of chemical cross linking between NDM-1 dimers.  Samples were incubated with and without 2.5 mM bis [sulfosuccinimidyl] suberate (BS3) chemical cross linker. The negative control (IMP-1) is a MBL that is known to be predominantly monomeric in solution (145).    	   36	  2.3.4    NDM-1 active site Our 2.1 Å resolution crystal structure allows for a direct comparison between the holo-enzyme and ampicillinic acid (product) bound forms of NDM-1 (126), revealing key conformational changes that occur around the active site, which further our understanding of MBL substrate binding. In particular, the flexible active site loop L3 is elongated and disordered in the holo-enzyme form, yet upon ligand binding, β3 and β4 form an extended β-sheet interaction (Figure 2.3a).  This zippering effect pulls the tip of the L3 loop further away from the zinc center, causing the side chain sulfur of M67 to reorient away from the zinc center by 4.9Å, presumably to accommodate the substrate by hydrophobic interaction with the R1 phenyl group of ampicillin (Figure 2.3a). In contrast, the L65 Cδ moves 2.1Å closer to the zinc center and substrate upon binding. Together, residues L65, M67 and W93 form a hydrophobic face that interacts with the R1 phenyl group of the substrate. The observed flexibility in the holo-enzyme may be a mechanistic feature of MBLs that provides the L3 loop with the plasticity required to form substrate-specific hydrophobic interactions. Therefore, altering the hydrophobicity of the R1 functional group may alter the affinity of β-lactam antibiotics for MBLs.     Upon ligand binding, the L10 loop also plays an important role in interacting with the substrate. In particular, the N220 side-chain nitrogen is pulled 1.0Å closer to the zinc center when comparing holo and ampicillinic acid bound forms (Figure 2.3a). This shift is larger than the rms differences in superposition of the 232 common CA atoms in the two models of 0.28Å. This movement positions the highly conserved N220 for interaction with the lactam carbonyl group observed in the product complex structure (126). This conserved N220 residue, together with Zn1 are thought to provide an oxy-anion hole, which helps to polarize the lactam carbonyl upon binding and facilitate nucleophilic attack by the adjacent hydroxide (see below) (91). The observed plasticity in the L3 and L10 loops likely provide NDM-1 with the ability to accommodate multiple substrates with differing molecular architectures.   Comparison of the holo NDM-1 and VIM-2 structures indicates key differences in the shape 	   37	  and electrostatic characteristics of the active site, providing insight into possible features that govern the differences in specificity in these enzymes. In general, NDM-1 has a more extensive active site cleft [NDM-1 solvent accessible surface area (SASA)=520Å2, VIM-2 SASA=450Å2 as calculated using the CASTp server (146)] and a more electrostatically neutral L3 loop than does VIM-2 (Figure 2.3a-c). It has been proposed that VIM-2 and VIM-4 are restricted in their substrate profile due to the presence of a narrow active site cleft (125). The larger surface area of NDM-1 arises in part from the orientation of the active site loops L3 and L10, which are positioned further away from the zinc active site center (see also below) when compared to VIM-2 (Figure 2.3b-c). Another difference between the two species is that K211 of NDM-1, which orients the negatively charged carboxylate common to β-lactam substrates, is substituted by a tyrosine in VIM-2. However, an analogous electrostatic interaction with substrate arises from R228 on the L12 loop of VIM-2, which projects into the active site to interact with the β-lactam C3 carboxylate (140). The protrusion of VIM-2 R228 into the active site cleft reduces the size of the binding pocket, potentially limiting the VIM-2 substrate binding profile. In addition, VIM-2 has several residues (including F61, D62, Y67 and R228) which project into the active site cleft adding both charge and steric bulk. In equivalent positions, NDM-1 contains residues M67, P68, V73 and A215, which present more hydrophobicity in the L3 loop and less steric bulk in the active site (Figure 2.3a-b). We also observe that NDM-1 has an enhanced positively charged electrostatic profile around Zn1 compared to VIM-2 (Figure 2.3c), which may serve to attract and orientate the negatively charged β-lactam carboxylate during hydrolysis. These active site characteristics likely decrease steric interference with incoming substrates and facilitate a favorable electrostatic environment leading to a broad substrate profile. In this light, the design of mechanism-based inhibitors may be more effective than simple β-lactam functionalization as a therapeutic approach.   	   38	   Figure 2.3 Holo-NDM-1/hydrolyzed ampicillin (hAMP) bound NDM-1 and holo-NDM-1/holo-VIM-2 active site comparisons. A, Holo-NDM-1/hAMP NDM-1 active site overlay: holo-NDM-1 backbone (green), hydrolyzed ampicillin (hAMP) product complex (grey, PDB ID: 3Q6X) with selected active site residues (sticks) labeled. B, Holo-NDM-1/VIM-2 active site overlay: NDM-1 backbone (green), selected NDM-1 and VIM-2 active site residues are shown as green and magenta sticks with cpk atom coloring, respectively. The 2Fo-Fc map at 2σ is shown for NDM-1 zinc ions and coordinating ligands. C, Electrostatic surface representation of holo-NDM-1 and VIM-2 active site clefts, calculated using APBS software (135), with a PARSE force field contoured at -3 and +3. D, Zinc coordination: Zinc ions and ligands are in green and grey for holo-NDM-1 and hAMP bound NDM-1. Coordination interactions are blue dashes and hAMP is shown in cpk colored stick representation (carbons are magenta).       	   39	  2.3.5   Active site structure In our holo-NDM-1 crystal structure, all five of the NDM-1 monomers in the asymmetric unit have two zinc atoms in the active site as indicated by the refined electron density (Figure 2.3b). In addition, the presence of zinc was confirmed by ICP mass spectrometry (Figure 2.4).  We therefore infer that NDM-1 likely uses a di-zinc catalyzed mechanism for substrate hydrolysis much like other members of the class B1 and B3 MBLs. In this mechanism, Zn1 functions to orientate the substrate carbonyl bond, whereas Zn2 is required for interaction with the amide nitrogen of the substrate (90). A presumed active site hydroxide located between the two zinc ions, which is present in all five holo-NDM-1 monomers and hydrolyzed ampicillin bound NDM-1 (126), serves as a nucleophile (91). Following attack of the hydroxide on the carbonyl carbon, the peptide bond is broken with Zn2 acting as a Lewis acid to stabilize the charge on the nitrogen leaving group generated during this step (90).                                  Figure 2.4 NDM-1 metal ion analysis by ICP mass spectrometry.  Zinc was the only metal ion present in high abundance, with a Zn/NDM-1 protein ratio of ~1.53.  Generally, di-zinc MBLs such as NDM-1 have a lower Zn2 occupancy than Zn1 (148). Our refined crystallographic data also suggests a consistent differential occupancy of the 2 zinc ions in each of the 5 active sites of the asymmetric unit, in that Zn1 refines with lower average temperature factors (B factor 26.3 +/-3.7Å2) than Zn2 (B factor 33.7 +/-2.3Å2).  In our structures, Zn1 is tightly coordinated with tetrahedral geometry by three invariant histidine residues and a bridging water (H120, H122, 	   40	  H189 and W1) and the higher B-factor Zn2 is coordinated by the conserved D124, C208, H250 and water W1. Interestingly, ICP mass spectrometry revealed ~1.5 moles of Zn per mole of enzyme (Figure 2.4), suggesting that the Zn2 site is undergoing exchange with solvent. The observed zinc stoichiometry is lower than for members of the VIM or IMP MBLs (145,149), yet similar to the class B1 MBL SPM-1 (148). For SPM-1, an increased Zn2 coordination distance by the conserved aspartic acid ligand was associated with the lower occupancy metal binding (148). In contrast, the NDM-1 Zn2 ligands (D124, C208 and H250) display relatively tight zinc coordination distances (2.1, 2.4 and 2.1 Å). However, NDM-1 displays substantial electropositive charge around the zinc center compared to that of VIM-2 (Figure 2.3c).  In particular, K125, which immediately precedes the Zn2 ligand D124 presents a positive charge in close proximity to the Zn2 binding site (Figure 2.3a). Therefore, this charge may in part lead to a repulsion of Zn2.    Interestingly, the two zinc atoms display very similar Zn-Zn interatomic distances of ~3.8Å (+/- .16 Å) in our ensemble of 5 holo-NDM-1 structures.  However, in the recently determined product complex of NDM-1 with bound hydrolyzed substrate (ampicillinic acid), the Zn-Zn distance is substantially longer ~4.6Å (126). Mutagenesis studies on the subclass B1 MBL (BcII), revealed a decrease in catalytic efficiency upon increasing the Zn-Zn distance (150). In theory, shortening the Zn-Zn distance should bring Zn2 closer to the uncleaved β-lactam amide nitrogen, allowing for stronger coordination of the substrate and facilitating departure of the leaving group during catalysis. The larger Zn-Zn distance observed in the hydrolyzed ampicillin form of NDM-1 likely occurs to accommodate zinc binding to the newly formed carboxylic acid following lactam hydrolysis. This shift exemplifies the role of plasticity, and active site rearrangements in facilitating turnover in MBLs. 2.3.6    Evolutionary trends in antibiotic resistance  Among the most troubling attributes of MBL enzymes is their tendency of having a broad-spectrum substrate profile. Previously, eight residues in and around the active site of IMP-1 displayed a substrate dependent sequence requirement, in that they were required for cleavage of some, but not all 	   41	  β-lactams tested (151). Despite the relatively low sequence identity between the two enzymes (~32%), NDM-1 contains six of these residues (D90, K211, G219, N220, D223, S249)(Figure 2.3a-b).  Four of the six residues (K211, G219, N220 and D223) are located in the L10 loop and are thought to directly interact with β-lactam functional groups, however residues D90 and S249 do not interact with substrate directly, but are second shell Zn ligands, suggesting a potential substrate dependent zinc requirement. Taken together, these amino acids may point to an evolutionary trend in promoting broad-spectrum antibiotic resistance.                   	   42	  3 New Delhi Metallo-β-Lactamase: Structural Insights into β-Lactam Recognition and Inhibition2 3.1     Introduction β-lactams such as the penicillins and carbapenems constitute ~50% of all antibiotic prescriptions world wide (116). These antibacterials inhibit cell wall biosynthesis by acting as substrate analogs to prevent the transpeptidase mediated cross-linking of adjacent peptidoglycan strands (24). The prospect that bacteria can develop or acquire high levels of resistance to these and other antibiotics is of global health concern. The most prevalent cause of bacterial resistance to β-lactam antibiotics is the expression of β-lactamase enzymes, which hydrolyze the amide bond in the β-lactam ring yielding an inactivated product (77).  β-lactamase enzymes consist of four classes (A-D), based upon amino acid sequence similarity.  Classes A, C, and D utilize an active site serine as a nucleophile, whereas the class B enzymes are metallo-β-lactamases (MBLs) which use active site zinc ions to coordinate a nucleophilic hydroxide to mediate hydrolysis.  The class B enzymes are further divided into subclasses B1, B2 and B3 of which the class B1 enzymes have emerged as the most clinically significant and are characterized as having two active site zinc ions (Figure 3.1) (77,90).  Figure 3.1 Class B1 metallo-β-lactamase mediated β-lactam hydrolysis. 	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  2	  A	  version	  of	  this	  chapter	  has	  been	  published.	  King D.T., Worrall L.J., Gruninger R., Strynadka N.C. New Delhi Metallo-β-lactamase: Insights into β-lactam Recognition and Inhibition. J. Am. Chem. Soc.  134(28): 11362-11365. (2012) 	  	   43	  However, in parallel with a lack of structural knowledge there has been little advance in the development of clinically relevant MBL inhibitors (152). Among the most promising candidates are the L- and D- diasteriomers of the mercaptocarboxamide inhibitor captopril, which display potent and broad-spectrum MBL inhibitory activity (153). L-Captopril is an FDA approved angiotensin-converting enzyme (ACE) inhibitor used clinically to treat hypertension.  Recently, a novel class B1 MBL called the New Delhi Metallo-β-Lactamase-1 (NDM-1) was found to confer enteric bacteria with nearly complete resistance to all β-lactam antibiotics including the late generation carbapenems meropenem and imipenem (124). This activity is of particular concern as carbapenems have the widest spectrum activity of all the β-lactam antibiotics and are used clinically as our last line of defense against multi-drug resistant Gram-negative bacteria and in particular those displaying extended spectrum β–lactamase activity (154). Additionally, NDM-1 is encoded on a readily transferrable plasmids, which facilitates its transmission (124). NDM-1 has spread to nearly every continent worldwide and has become a formidable threat to human health, prompting the World Health Organization to issue a global warning (155,156). To gain insight into β-lactam recognition and inhibition, we used x-ray crystallography to characterize various β-lactams bound to the NDM-1 active site as well as the potent inhibitor, L-captopril, the latter representing the first reported structure for an NDM-1 inhibitor complex. 3.2   Methods 3.2.1 Protein expression and purification The NDM-1 protein construct includes the mature sequence (M27 to R270) with signal peptide removed and was prepared as previously described (113). Purified protein was then dialyzed into fresh crystallization buffer (20mM HEPES pH 7.5, 2mM 2-mercaptoethanol, 150 mM NaCl) and concentrated to ~60 mg/ml. 3.2.2 Crystallization, data collection and structure determination Benzylpenicillin, oxacillin and methicillin bound product complex NDM-1 crystals were grown 	   44	  using the sitting drop method at 25°C. Drops contained 1µL of (60 mg/mL protein + 40mM methicillin, benzylpenicillin or oxacillin), combined with 1µL of precipitant (0.2M MgCl2, 25% PEG3350, 0.1M bis-tris pH5.5). Drops were then streak seeded with finely crushed ampicillin bound NDM-1 crystals (prepared as previously described) (126). Crystals were soaked in cryoprotectant solution for 30s (precipitant + 25% glycerol), and flash vitrified in liquid nitrogen. The benzylpenicillin, oxacillin and methicillin bound crystals diffracted to 1.8, 1.17 and 1.16Å at beamline CMCF-1 of the Canadian light source (CLS).  Meropenem bound product complex crystals were grown using the sitting drop vapor diffusion method at 25ºC using 1µL of (55 mg/mL protein + 4mM meropenem), combined with an equal volume of precipitant (1M trisodium cacodylate, 0.1M sodium cacodylate pH 6.5). Crystals were soaked in cryoprotectant solution for 30s (mother liquor + 30% glycerol), and flash vitrified in liquid nitrogen.  Meropenem bound crystals diffracted to 1.9Å at beamline CMCF-1 of the CLS. Crystals of ethylene glycol bound NDM-1 grew at 25ºC in a condition containing 0.5 µl protein solution mixed with an equal volume of precipitant (10% w/v PEG8K, 8%v/v ethylene glycol, and 0.1M HEPES pH 7.5). L-Captopril bound crystals were then attained by soaking ethylene glycol NDM-1 crystals in mother liquor plus 15mM L-captopril for ~30 min. Crystals were soaked in cryoprotectant solution for 30s (precipitant, 25% glycerol, 15mM L-captopril), and flash frozen in liquid nitrogen. Ethylene glycol and L-captopril bound crystals diffracted to 1.47Å and 2.3Å at beamline CMCF-1 at the Canadian Light Source (CLS).  Data were processed using IMOSFILM and CCP4 (130,157). A total of 5% of reflections were set aside for cross validation. All structures of NDM-1 were solved by molecular replacement using the program Phaser (131), with chain A of the ampicillin bound NDM-1 structure as a starting model (PDB ID: 3Q6X) (126). Several cycles of manual rebuilding in coot (132), followed by refinement using REFMAC (130) (CCP4) were carried out. The hydrolyzed methicillin, hydrolyzed oxacillin and 	   45	  ethylene glycol bound structures were refined with anisotropic B-factors. However, hydrolyzed benzyl penicillin, hydrolyzed meropenem and L-captopril bound structures were refined with isotropic B-factors. Zinc, water and the appropriate ligands were added manually by examination of the Fo-Fc and 2Fo-Fc electron density maps. Coordinates and structure factors for hydrolyzed methicillin, hydrolyzed oxacillin, hydrolyzed benzylpenicillin, ethylene glycol, L-captopril and hydrolyzed meropenem bound NDM-1 were deposited in the PDB with accession codes (4EY2, 4EYB, 4EYF, 4EXY, 4EXS and 4EYL). Figures 3.2-3.6 were made using PyMol (134). 3.3   Results and Discussion 3.3.1 Hydrolyzed penicillin bound NDM-1 complexes Hydrolyzed methicillin, benzylpenicillin, oxacillin and meropenem bound NDM-1 crystal structures were solved to 1.2Å, 1.8Å, 1.2Å and 1.9Å resolution. The penicillin and meropenem product complexes crystallized in the space groups P212121 and P41212 with two protein chains in the asymmetric unit (Table 3.1). There are two zinc ions displaying clear Fo-Fc electron density in each active site, which were refined at 90% occupancy and confirmed previously by inductively coupled plasma mass spectrometry (ICP-MS) (113). The two chains in the asymmetric unit displayed high structural similarity (RMSDs for all common CA atoms in chains A and B for hydrolyzed methicillin, benzylpenicillin, oxacillin and meropenem bound NDM-1; 0.1Å, 0.2Å, 0.1Å and 0.8Å) and therefore we have limited our analysis to chain A for each product complex. All hydrolyzed β-lactam products display clear 2Fo-Fc electron density in the di-zinc containing active sites of both protein chains in the asymmetric unit and were refined at full occupancy for the penicillin complexes and 0.8 occupancy for the hydrolyzed meropenem structure (Figures 3.2 and 3.3, and Table 3.1).     	   46	  Table 3.1 Data collection and refinement statistics for NDM-1 complexes.   Benzyl Pen OX METH MERO L-CAP EG Data  Collectiona Home Source CLS CMCF-1 CLS CMCF-1 CLS CMCF-1 Home Source CLS CMCF-1 Wavelength 1.54 Å 1.00 Å 1.00 Å 1.00 Å 1.54 Å 1.00 Å Resolution (Å) 29.71-1.8  (1.9 -1.8) 25.42-1.16 (1.23-1.16) 25.43-1.17 (1.23-1.17) 42.19-1.90        (2.00-1.90) 58.71-2.4 (2.59-2.4) 35.74-1.47 (1.55-1.47) Space group P212121 P212121 P212121 P41212 P41212 P41212 a(Å) 39.03 39.20 39.12 106.00 107.12 107.22 b(Å) 79.49 79.37 79.36 106.00 107.12 107.22 c(Å) 134.21 134.15 133.80 92.58 92.90 92.85 α(º) 90 90 90 90 90 90 β(º) 90 90 90 90 90 90 γ(º) 90 90 90 90 90 90 Rmerge (%)c 0.103(0.376) 0.079(0.558) 0.061(0.231) 0.114(0.536) 0.142(0.497) 0.060(0.372) I/σI 7.9(2.8) 9.6 (3.0) 6.9(2.9) 5.9(2.1) 6.9(2.1) 10.6 (3.0) Completeness 98.7%(97.6%) 99.6%(98.7%) 96.8%(93.9%) 96.1%(92.2%) 99.0%(99.7%) 99.7%(98.4%) Unique  Reflections 39036(5542) 143064(20466) 137386(19417) 40390(5536) 21474(3088) 91755(13015) Redundancy 3.0(2.9) 2.9(2.6) 2.1(1.9) 3.3(3.0) 3.2(3.2) 4.0(3.7) Refinement Statistics d Ligand Occupancy chainA, chainB 1.00, 1.00 1.00, 1.00 1.00, 1.00 0.80, 0.80 1.00, 0.60 1.00,1.00 Average B factor (Å2):       Protein 11.0 14.7 12.6 17.3 18.1 17.4 Zinc 12.5 8.7 6.3 19.2 16.7 13.5 Ligand 11.9 14.5 8.8 43.2 34.1 18.0 Water 17.1 24.8 23.0 20.9 18.5 27.2 Ramachandran statistics:       Favored  98.1% 98.8% 98.5% 97.7% 96.6% 97.8% Additionally  allowed 0.5% 0.8% 1.3% 1.5% 2.6% 1.9% Disallowed  0.4% 0.4% 0.2% 0.8% 0.8% 0.4%     Rwork 16.27% 13.48% 12.98% 18.36% 18.99% 13.99%     Rfree 19.73% 16.40% 15.87% 22.37% 24.11% 18.20%     r.m.s.b bonds 0.012 0.019 0.017 0.013 0.013 0.017     r.m.s. angles 1.29 2.14 2.11 1.97 1.47 2.10 a Values in parenthesis represent the highest resolution shell. b r.m.s. means root mean square. c Rmerge= ∑hkl∑j[Ihkl,j-<Ihkl>/∑hkl∑jIhkl,j. d 5% of the reflections were excluded from refinement and used to calculate Rfree.  Benzylpenicillin (Benzyl Pen), oxacillin (OX), methicillin (METH), meropenem (MERO), L-captopril (L-Cap), ethylene glycol (EG).    	   47	   Figure 3.2 β-lactam product complex crystal structures. (A) Hydrolyzed penicillin and hydrolyzed meropenem (hMER) structures. (B) Stereoview active site close-up of overlay of penicillin product complexes bound to NDM-1. The hydrolyzed benzylpenicillin (hBenzyl), hydrolyzed ampicillin (hAMP, PDB ID: 3Q6X), hydrolyzed methicillin (hMETH) and hydrolyzed oxacillin (hOX) are orange, pink, slate and brown and are colored by atom type. The NDM-1 structure is represented as a green cartoon and zinc coordinating ligands are green sticks with atoms colored by type. (C) Stereoview active site close-up of hMER bound NDM-1. NDM-1 is shown in green cartoon representation with selected active site residues displayed as sticks and atoms are colored by type.  The hMER ligand is slate with atoms colored by type and the 2Fo-Fc electron density is contoured to 0.9σ and represented as grey mesh. Zinc ions are shown as grey spheres. (D) Stereoview active site overlay close-up of hMER/hMETH zinc coordination. The hMETH and hMER are shown as orange and slate sticks with atoms colored by type. Zinc ions are slate and orange spheres for hMER and hMETH bound structures. Bonds representing zinc coordination, hydrogen bonding, hydrophobic and electrostatic interactions are displayed as thin blue, thin black, thick grey and thick purple dashes.     The observed position of the presumed nucleophilic hydroxide, W1, is common to all penicillin product complex structures and is located directly between Zn1 and Zn2 at distances of 2.0 Å (± 0.1Å) and 3.0 Å (± 0.1Å), respectively.  Previously, it was thought that following product release W1 is re-loaded between the zinc ions for another round of hydrolysis (90,138). However, the presence of the nucleophilic W1 in our product complexes suggests that the nucleophilic hydroxide may be re-loaded into its catalytic position even before the product leaves the active site. This observation is in keeping with pre-steady state kinetic data suggesting that the rate-limiting step in NDM-1, L1 and CcrA 	   48	  mediated β-lactam hydrolysis is protonation of the nitrogen leaving group following C-N bond scission rather than re-loading of the nucleophile (158,159).  Penicillins are drug variants that contain a thiazolidine 5-membered heterocycle fused to the β-lactam ring moiety (Figure 3.2). Atoms within this penicillin core displayed lower average temperature factors than those within the side R1 functional group when averaged across all hydrolyzed products (9.7 Å2  vs. 15.0 Å2). In addition, the R1 functional group displays variable conformations, whilst the β-lactam core is virtually identical in all product complexes analyzed (RMSD 0.1 Å on all common penicillin core atoms) (Figure 3.2b). Thus, the penicillin core coordinates to the NDM-1 zinc center in a precise and rigid conformation, which is independent of the constituents present on the R1 functional group. Remarkably, we see that the enlarged NDM-1 active site cleft easily accommodates the bulky methicillin and oxacillin R1 groups located directly between the L3 and L10 loops (Figure 3.3). The fact that NDM-1 accommodates bulky R1 groups suggests that addition of large moieties at this position (historically the typical site of change for creation of new β-lactam variants) may not be an effective strategy for the design of novel NDM-1 resistant β-lactams.  	   49	   Figure 3.3 Penicillin product complex crystal structures. (A) Hydrolyzed benzylpenicillin (hBenzyl Pen), hydrolyzed methicillin (hMETH) and hydrolyzed oxacillin (hOX) structures (B) Stereoview of hBenzyl Pen and hydrolyzed ampicillin (hAMP) active site overlay. The hBenzyl Pen and hAMP (PDB ID: 3Q6X) bound NDM-1 cartoons are shown in green and slate with selected active site residues colored by atom type and zinc ions shown as grey spheres. The hBenzyl Pen and hAMP ligands are orange and pink sticks with atoms colored by type. (C) Stereoview active site close-up of hOX bound NDM-1. The hOX bound NDM-1 cartoon is green with selected active site residues colored by atom and zinc ions displayed as grey spheres. The hOX ligand is brown with atoms colored by type. (D) Stereoview active site close-up of hMETH bound NDM-1. The hMETH bound NDM-1 cartoon is green with selected active site residues colored by atom and zinc ions colored grey. The hMETH ligand is slate with atoms colored by type. The 2Fo-Fc maps for hBenzyl Pen, hMETH and hOX are contoured at 1.3, 1.8 and 1.3σ and are represented as grey mesh in B, C and D. Bonds representing zinc coordination, hydrogen bonding, hydrophobic and amide-π interactions are displayed as thin blue, thin black, thick grey and thick cyan dashes.      In all structures, Zn1 is tightly bound at 2.5Å away from the C6 carboxylate oxygen of the β-lactam product. Zn2 displays tight binding to N4 and the C3 carboxylate oxygen at 2.1Å and 2.2Å (Figure 3.2b). Recently, the monobactam antibiotic aztreonam has been characterized as the only β-	   50	  lactam which is poorly hydrolyzed by NDM-1 (159). Monobactams are characterized by the absence of a fused ring attached to the β-lactam core. Consequently, monobactams lack the C3 carboxylate that is present in all other classes of β-lactam antibiotics and that is required for interaction with one or both hydroxyl groups within the penicillin binding protein (PBP) transpeptidase active site KTGT motif as well as for electrostatic interaction with proximal conserved lys/arg side chains (24). Instead, monobactams have a bulky electronegative sulfonate group covalently attached to N4 which binds the conserved PBP KTGT motif (160). Our high-resolution penicillin product complex structures in NDM-1 display a particularly strong coordination interaction between the C3 carboxylate and Zn2 (Figure 3.2b), suggesting a potential reason why aztreonam, lacking this carboxylate, is poorly hydrolyzed by this enzyme. Modeling of the aztreonam into the NDM-1 active site suggests the sulfonate, displaced effectively 1 carbon unit away from the carboxylate, is too far away (~3.5Å) for direct coordination to Zn2 with overall weakened electrostatic interactions to the enzyme active site (Figure 3.4). Therefore, development of the monobactams presents a logical avenue for the design of novel antibiotics that are not recognized by MBLs.                 Figure 3.4 Stereoview of hydrolyzed methicillin (hMETH)/modeled hydrolyzed aztreonam (hAZTR) bound NDM-1 active site overlay. The hAZTR C6 carboxylate oxygens and N4 zinc coordinating atoms were fixed in the exact positions as seen in the hMETH bound structure. The hAZTR and hMETH ligands are pink sticks and slate lines with atoms colored by type. NDM-1 is shown in green cartoon representation with zinc ions as grey spheres.  The hMETH zinc coordinating interactions are shown as blue dashed lines.  	   51	  3.3.2 Hydrolyzed meropenem bound NDM-1 The hydrolyzed carbapenem core of meropenem displays extensive noncovalent interactions with the zinc center, however the dimethylamino carbonyl pyrrolidine (DMP) R2 group does not make any strong interactions with NDM-1 (Figure 3.2). Indeed, the carbapenem core refines with lower average temperature factors than does the DMP group (31.2 +/-5.1 vs. 55.0 +/-6.5 Å2). This observed disorder may be in part responsible for the higher Km values of meropenem for NDM-1 than for either benzylpenicillin or ampicillin (49.0µM vs. 22.0 µM and 16.0 µM) (79). However, the large NDM-1 active site cleft provides steric accommodation of the bulky DMP functional group despite the lack of specific interactions, leading to recognition and hydrolysis of meropenem. We conclude therefore that simple functionalization of the carbapenem R2 group may not be an effective strategy for the design of novel MBL resistant β-lactam antibiotics. The carbapenem and penicillin cores bind differentially to the NDM-1 di-zinc center. The carbapenem N4 and C3 carboxylate oxygen coordinate to Zn2 at 2.4 and 2.7Å, respectively, in an analogous fashion to the hydrolyzed penicillin product complex structures (Figure 3.2c). However, the newly formed C6 carboxylate directly intercalates Zn1 and Zn2 at 2.2Å and 2.6Å forming a bridging coordination ligand between the two metal ions resulting in tetrahedral coordination of Zn1 and hexa-coordination of Zn2 in the product complex. This differs from the hydrolyzed penicillin bound structures in which the C6 carboxylate is shifted away from Zn2 toward the L10 loop resulting in a penta rather than hexa coordinated Zn2 (Figure 3.2c-d). The inter-zinc distance is also shorter in the meropenem bound structure, 4.0Å, as opposed to 4.6Å in the penicillin product complex structures. Despite these conformational differences, NDM-1 mediated hydrolysis of meropenem, benzylpenicillin and ampicillin display remarkably similar Kcat values (12s-1, 11s-1 and 15s-1) (79).  The observed variability in binding of the penicillin and carbapenem cores in NDM-1 exemplifies the ability of zinc to facilitate multiple ligand geometries and coordination numbers (161).    	   52	  It has been suggested that the highly conserved N220 of class B1 MBLs contributes to the formation of an oxyanion hole and stabilizes the tetrahedral intermediate via interaction between its δNH2 with the lactam carbonyl oxygen (90,162). For the homologue IMP-1 (32% identical), the N220A and N220E mutants displayed significantly increased Km and reduced Kcat values for hydrolysis of imipenem when compared to wild-type supporting an important role for N220 in carbapenem binding and hydrolysis (151). In the meropenem product complex structure, the C6 carboxylate oxygen O71 displays tight hydrogen bonding, 2.8Å away from the δNH2 side chain nitrogen of N220 (Figure 3.2c, Figure A.1). These results provide evidence that N220 interacts directly with the substrate and thus supports the potential role of this residue in stabilizing the transient tetrahedral intermediate via formation, along with Zn1, of an oxyanion hole.   3.3.3  L-Captopril mediated NDM-1 inhibition Previously, the crystal structure of the class B1 MBL enzyme BlaB from Chryseobacterium meningosepticum has been solved in complex with D-captopril to 1.5Å resolution (153). However, we present the first reported crystal structure of an L-captopril inhibited MBL enzyme complex to 2.4Å resolution. The L-captopril bound NDM-1 crystals are P41212 with two protein chains in the asymmetric unit. The two chains displayed high overall structural similarity (RMSD 0.2Å on all common CA atoms within chains A and B) and therefore only chain A was used for structural analysis.  The L-captopril S1 intercalates directly between Zn1 and Zn2 at 2.1Å from either ion. Upon binding, the S1 sulfur displaces the nucleophilic W1 leading to a competitively inhibited enzyme. In this complex both Zn1 and Zn2 display tetrahedral coordination geometries in which the L-captopril S1 forms the final coordination site for each ion (Figure 3.5). The intercalated S1 presumably decreases electrostatic repulsion between the two zinc ions. Polarizable molecular mechanics studies support this intercalation scheme as being the most energetically favorable mode of binding and suggest that the S1 	   53	  sulfhydryl exists as an anion, similar to the catalytic hydroxide. This is due to the effect that zinc has on lowering the pKa of bound thiol groups by ~2 orders of magnitude (163). L-captopril presents two chemically distinct binding faces, one hydrophobic face which interacts with the L3 loop and the other hydrophilic, which hydrogen bonds to N220 on the L10 loop. N220 makes a hydrogen-bond interaction between its backbone amide and the L-captopril O2 at 3.3Å (Figure 3.5, Figure A.5).  In addition, the L3 loop residues V73 and M67 make hydrophobic contacts with the L-captopril C6 and C3 atoms and the L5 loop W93 with the L-captopril C3 and C5 atoms (Figure 3.5).                            Figure 3.5 Competitive inhibition of NDM-1 by L-captopril. (A) Structure of L-captopril (C8 chiral carbon is highlighted with a red asterisk). (B) Stereoview active site close-up of L-captopril bound NDM-1. The NDM-1 backbone is represented in green cartoon and selected active site residues are shown as sticks with atoms colored by type. The L-captopril ligand is brown with atoms colored by type and the 2Fo-Fc electron density map is contoured to 1.0σ and shown as grey mesh and zinc ions are grey spheres. Hydrogen bonds, zinc coordination bonds and hydrophobic interactions are shown as thin black, thin blue and thick grey dashes.   Interestingly, an overlay of BlaB bound D-captopril (153) and our NDM-1 bound L-captopril reveals that the two diasteriomers bind in opposite orientations yet intercalate their S1 sulfur atom in 	   54	  exactly the same fashion (Figure 3.6). These two enzymes share 26% sequence identity yet contain very similar active site architectures and virtually identical zinc coordination geometries.  On this basis, it has been suggested that D-captopril likely adopts the same general orientation within the BlaB and NDM-1 active sites (163). Indeed, NDM-1 contains many potential hydrogen bond donors and acceptors capable of making productive contacts with D-captopril in the BlaB type orientation (Figure 3.6). The fact that both diasteriomers are capable of making productive contacts and display virtually identical S1 zinc intercalation suggests that a fusion of the two molecules whereby D- and L-captopril share a common S1 and C1 would likely generate an even tighter binding inhibitor.                    Figure 3.6 Stereoview of L-captopril, D-captopril and ethylene glycol bound NDM-1 active site overlay. The L-captopril bound NDM-1 protein is shown as a green cartoon and selected active site residues are green sticks, which are colored by atom type. L-captopril, D-captopril and ethylene glycol are brown, light blue and teal with atoms colored by type.  D-captopril is modeled in the NDM-1 active site using the D-captopril BlaB crystal structure (PDB ID: 1M2X) as a template (153). Proposed D-captopril hydrogen bonding and zinc coordination interactions are displayed as black and blue dashes.  Despite having relatively low sequence identity, the class B1 MBLs in general display remarkable structural similarity, especially with respect to the disposition of the catalytic residues and ions (77). Consequently, inhibitory compounds often act universally on all MBLs. Sulfhydryl mediated zinc intercalation is emerging as an exciting avenue for the development of competitive MBL inhibitors (152,153). Our L-captopril bound structure lends further support to this approach and presents possible 	   55	  ways to increase binding affinity. An alternative approach to overcome MBL resistance would be to design β-lactam antibiotics that are not recognized by MBLs. Our product complex structures reveal that the traditional strategy of developing newly functionalized R1 and R2 groups may be readily thwarted by the plastic and open nature of the MBL active site. However, the monobactam core provides a promising scaffold on which to synthesize novel MBL resistant β-lactams.                    	   56	  4 Molecular Mechanism of Avibactam-Mediated β-Lactamase Inhibition3 4.1  Introduction The β-lactam antibiotics target the final synthetic step in peptidoglycan (PG) biogenesis, whereby they act as substrate analogues of the penultimate D-ala-D-ala on the PG stem peptide to inhibit the penicillin-binding protein (PBP) catalyzed transpeptidation of adjacent PG strands. The most clinically prevalent resistance mechanism to the β-lactams in Gram-negative bacteria is the expression of β-lactamase enzymes that hydrolyze the four membered lactam ring, yielding an inactivated product. These enzymes are often encoded on readily transferable plasmids that facilitate their transmission throughout microbial populations (121).  The β-lactamases are often grouped into four distinct classes (A-D) based upon amino acid sequence homology (164). The class A, C and D serine β-lactamases (SBLs) evolved from the PBP transpeptidases, and are the most clinically prevalent and employ an active site serine as a nucleophile in β-lactam hydrolysis. In contrast, the class B metallo-β-lactamases (MBLs) utilize active site zinc ions to mediate lactam bond fission. SBL catalyzed β-lactam hydrolysis occurs via the formation and subsequent hydrolysis of a serine-bound acyl enzyme intermediate. Despite having low overall sequence identity, amino acid sequence comparisons and structural analysis has identified three common active site motifs among the SBLs: motif (i) harbors the nucleophilic serine required for acylation (SXXK), motif (ii) is required for protonation of the β-lactam nitrogen leaving group upon acylation (S/Y-X-N/V), and motif (iii) is involved in activation of the motif ii S/Y proton donor, and in substrate recognition and oxyanion stabilization (K/R-T/S-G) (164). The class A enzymes have a conserved E166 (thought to be the general base required for activation of the catalytic water during hydrolytic deacylation), located in a region known as the Ω loop (residues 161-179). In contrast, the class D (OXA) enzymes lack the Ω loop E166 and instead involve a carboxylated lysine (i.e. lysine is 	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  3 A version of this chapter has been published. King D.T.*, King A.M.*, Lal S.M., Wright G.D., Strynadka N.C.J. Molecular mechanism of avibactam mediated β-lactamase inhibition. ACS Infect. Dis. DOI: 10.1021/acsinfecdis.5b00007 	   57	  reversibly modified with CO2 at the ε amino group) in a SXXK motif, which is thought to play a dual role as the general base involved in both serine activation during acylation and in activation of the catalytic water during hydrolytic deacylation (165)(75)(154). To overcome SBL mediated resistance, three β-lactam-based inhibitors have been introduced into clinical practice in the late seventies and early eighties: clavulanic acid, sulbactam and tazobactam (152). These compounds are mechanism based, covalent inactivators that form a stable acyl-enzyme intermediate with the catalytic serine. At clinically used concentrations, the bound inhibitor undergoes slow hydrolytic deacylation, either directly or through a series of covalent intermediates whereby the heteroatom at the inhibitor 1-position acts as a leaving group and generates an acyclic acyl-enzyme complex that tautomerizes between a stable imine and enamine intermediate (166). Traditionally, these inhibitors target the class A β-lactamases and are clinically ineffective against strains harboring the emerging class C, and D SBL enzymes (94). Furthermore, there are now several class A β-lactamases that have evolved resistance to these compounds (egs. inhibitor-resistant TEM and complex mutant TEM) (152,167), making the development of novel inhibitors paramount.   Perhaps of greatest promise for the immediate future is the novel class of non-β-lactam based β-lactamase inhibitors termed diazabicyclooctanes (DBOs). These were originally designed in the late 1990’s and display remarkably potent and broad-spectrum inhibition of SBLs. The DBO compound avibactam is currently in phase III clinical development as part of a combination therapy in conjunction with ceftazidime to treat complicated urinary-tract and intra-abdominal infections (98). Ceftazidime-avibactam is active against the majority of Enterobacteriaceae, including multi-drug resistant strains, and importantly is effective against Pseudomonas aeruginosa (168). In animal models, avibactam-ceftazidime has been utilized to effectively treat ceftazidime-resistant Gram-negative bacterial septicemia, meningitis, pneumonia and pyelonephritis. The avibactam-ceftazidime safety and tolerability in clinical trials has been outstanding, and there have been relatively few adverse drug effects documented (168). 	   58	                                    Figure 4.1 Avibactam mediated reversible SBL inhibition. Although avibactam displays excellent inhibitory activity against the class A and C enzymes, more variable levels of inhibition have been observed towards the class D SBLs (97).  Avibactam forms a unique carbamyl linkage with the catalytic serine, which does not decompose via a hydrolytic mechanism as is true for the β-lactam based SBL inhibitors (Figure 4.1).  Instead decarbamylation of avibactam occurs via recyclization of the DBO fused ring structure, re-forming the intact inhibitor that can then either re-carbamylate the same active site or be released into solution to inactivate subsequent SBLs (100). The most common mechanism of resistance to ceftazidime-avibactam is the expression of β-lactamases that are unhindered by avibactam (for example, the MBLs and the majority of class D SBLs). Crystal structures of avibactam bound to the class A enzymes BlaC and CTX-M-15, the class C enzyme AmpC have recently been released (99)(169). Additionally, Lahiri and colleagues recently reported the crystal structures of OXA-24 and OXA-48 bound to avibactam at 2.3 and 2.4Å resolution (170). However, the mechanism and roles of individual amino acids in SBLs that contribute to avibactam activity remain largely unresolved.  To address the underlying molecular details of avibactam inhibition, we have undertaken a multifaceted structural, kinetic and mutagenesis study on known targets. We have utilized the class A enzyme CTX-M-15 which is the most widely distributed extended-spectrum β-lactamase (ESBL) globally (171) as a model enzyme. The universally conserved S130 acts both as a general acid during carbamylation and a general base during de-carbamylation in the avibactam recycling pathway. We further reveal the 2.0 and 1.7Å resolution crystal structures of avibactam covalently bound to the 	   59	  catalytic serine of the clinical variants, OXA-48 and OXA-10. The narrow spectrum oxacillinase OXA-10 is among the most prevalent class D enzymes in P. aeruginosa (172), and the carbapenem hydrolyzing OXA-48 is prevalent in the emerging carbapenem resistant Enterobacteriaceae (CRE) (97,173). The data elucidates the active site features likely responsible for the variable inhibition observed for this class of SBL enzymes that uniquely relies on a post-translationally modified (carboxylated) lysine during catalysis. 4.2  Methods 4.2.1  DNA manipulations and plasmid construction.  Primers used for PCR DNA amplification and site-directed mutagenesis were purchased from MOBIX lab (McMaster University, Hamilton, ON, Canada) or Integrated DNA Technologies (IDT; Coralville, IA). pET-28b (CTX-M-15), encoding mature CTX-M-15 (Q26-L288) was constructed by amplifying the blaCTX-M-15 gene from K. pneumoniae strain H0142423 (Mt. Sinai hospital, New York, NY) and cloning into pET-28b.  pET-28b(KPC-2) and pET-28b(OXA-48) were constructed by cloning the mature genes into pET-28b.  Genes were synthesized by IDT.  4.2.2  Site-directed mutagenesis of CTX-M-15.  A two-primer, two-stage PCR method (174) was used to engineer CTX-M-15 variants harboring the following point mutations (K73A, N104A, S130A, N132A, E166Q, K234A) (see Table B.1 for a complete list of primers).  pET-28b(CTX-M-15) was used as template in mutagenesis experiments to generate the listed pET-28b(CTX-M-15) variants for protein expression and purification.  4.2.3  Protein expression and purification for kinetic studies.  For kinetics studies, an E. coli BL21(DE3) colony transformed with its respective β-lactamase construct, CTX-M-15 (WT, K73A, N104A, S130A, N132A, E166Q, K234A), KPC-2 or OXA-48, was inoculated into LB medium containing 50 µg/mL kanamycin and grown at 37°C.  Protein expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at OD600 0.7 and cultures were 	   60	  incubated overnight at 16°C.  Cells were harvested by centrifugation and cell paste from 1 L of culture expressing β-lactamase was washed with 8 mL 0.85 % NaCl, resuspended in buffer containing 50 mM HEPES pH 7.5, 350 mM NaCl, and 20 mM imidazole then lysed by cell disruption at 20,000 p.s.i.  Lysate was centrifuged using a Beckman JA 25.50 rotor at 20 000 RPM (48 254 x g) for 45 min at 4°C.  The supernatant was applied to a 5-mL HiTrap Ni-NTA column (GE Lifesciences) at a constant flow rate of 3 mL/min.  The column was washed with 5 column volumes of the same buffer and step gradients of increasing imidazole were used for wash and elution steps.  Fractions containing purified β-lactamase, based on SDS-PAGE, were pooled and dialyzed overnight at 4°C in buffer containing 50 mM HEPES pH 7.5, 150 mM NaCl, and 20% glycerol.  All purified enzymes were verified to be >95% pure as assessed by SDS-PAGE and stored at -20°C. 4.2.4  CTX-M-15 enzyme assays.  Nitrocefin was synthesized as reported previously (175).  Kinetic parameters of purified mutant CTX-M-15 β-lactamase hydrolysis of nitrocefin were determined at 30°C in 50 mM HEPES buffer (pH 7.5).  Rates of hydrolysis were measured in 96-well microplate format at 490 nm using a Spectramax reader (Molecular Dynamics).  Enzyme concentrations were adjusted so as to yield the following concentrations in 200 µL: WT (0.5 nM), K73A (5 nM), N104A (0.1 nM), S130A (0.1 nM), N132A (0.5 nM), E166Q (100 nM), K234A (20 nM).  All enzyme dilutions were done in 100 ng/µL bovine serum albumin (BSA).  Nitrocefin concentrations ranged from 320 µM to 2.5 µM. For WT, N104A, and N132A, carbamylation experiments were carried out using a Bio-Logic SFM-4 Stopped-Flow/Quench-Flow instrument using a cuvette with 2 mm path length.  A four-syringe method was used to give a constant final concentration of 20 nM enzyme and 200 µM nitrocefin in 50 mM HEPES pH 7.5 with 0.01% Tween20.  The maximum concentration of avibactam used was 10 µM.  Total flow rate was adjusted to 3 mL/s.  Absorbance was read continuously at 490 nm.  For data analysis, the offset between reaction initiation and the first absorbance read was 700 ms. For E166Q and K234A acylation experiments were carried out in 96-well microplate format monitored 	   61	  continuously at 490 nm using a Spectramax reader (Molecular Dynamics).  Enzyme concentrations were adjusted so as to yield the following final concentrations in 200 µL wells: 200 nM E166Q, 10 nM K234A.  For E166Q on-rate assays the maximum concentration of avibactam used was 1 µM with 100 µM nitrocefin as reporter substrate.  For K234A on-rate assays the maximum concentration of avibactam used was 256 µM with 200 µM nitrocefin as reporter substrate.  Data were fit to a two-step reversible inhibition model as described previously (112),                                                                                                     (Eq. 1) where K! =    !!!!!                                                                                                                                             (Eq. 2)                                        and K!∗ =    !!!!!!!!!!!                                                                                                                                      (Eq. 3)                                                                   Time courses were fit to Equation 4 to obtain the pseudo first-order rate constant for enzyme inactivation, kobs(176).   P = v!t+ (v!   −   v!) (!!  !!!")!                                                                                                            (Eq. 4)                   where P, vs, v0, and t are the amount of product formed, the steady state rate (approximated by a no enzyme control), the initial rate (approximated by a no inhibitor control), and time.  Equation 5 was used to derive k2/Ki, the second-order rate constant for enzyme carbamylation, k!"# =   k!! +   !!!! [!]!!   [!]!!                                                                                                                    (Eq.5) where [I], [S], and Km are the concentration of avibactam, nitrocefin, and the Km value of each enzyme for nitrocefin (see Table B.2).  Error values reported are the standard errors of the fit.  For K73A and S130A on-rate assays, discontinuous sampling was employed from samples incubated at 30°C for 120 and 20 hours, respectively.  Enzyme concentrations were adjusted so as to 	   62	  yield 5 nM K73A and 0.5 nM S130A final.  The maximum concentration of avibactam used was 320 µM and 64 µM for K73A and S130A, respectively.  Rates were measured periodically as above by adding 180 µL of the above to 20 µL of nitrocefin (final concentration 50 µM) and fit to Equation 6 to obtain the pseudo first-order rate constant for enzyme inactivation, kobs (176).   v =   v! + v! −   v! ∗ e!!"                                                                                                                   (Eq. 6)                                                                            Where v is the rate of reaction taken at time, t.  Equation 5 was used to derive k2/Ki, the second-order rate constant for enzyme carbamylation as above.  Since the samples were incubated in the absence of nitrocefin, the concentration of substrate used in calculations was 0.    For WT, N104A, and N132A, decarbamylation experiments were performed using the jump dilution method (174).  Enzyme (1 µM) was incubated with avibactam (10 µM) for 20 minutes at 30°C and diluted 1/400 in buffer and 20 µL was added to 180 µL of nitrocefin for final concentrations of enzyme (0.25 nM), avibactam (5 nM) and nitrocefin (400 µM).  For E166Q and K234A, decarbamylation experiments were performed using a PD-10 desalting column (GE Healthcare) according to the manufacturer’s gravity protocol.  E166Q (200 nM) or K234A (20 nM) were incubated with avibactam (5 µM) at 30°C for 0.5 and 2 hours, respectively.  After desalting via PD-10 column (1.4x dilution), 180 µL was added to 20 µL nitrocefin (final concentration 400 µM for K234A and 200 µM for E166Q).  For WT, N104A, N132A, E166Q, and K234A experiments were carried out in 96-well microplate format monitored continuously at 490 nm using a Spectramax reader (Molecular Dynamics).  Data were fit to Equation 4 to obtain koff.  In the off-rate experiment, vs was approximated by a no inhibitor control and v0 by a no enzyme control.  Error values reported are the standard deviation of three technical replicates.   For K73A and S130A, decarbamylation experiments were performed using a PD-10 spin column as above.  K73A (5 nM) or S130A (1 nM) were incubated with avibactam (256 µM and 128 µM, respectively) at 30°C for 60 hours (K73A) or 3 hours (S130A).  After removal of excess avibactam via PD-10 column (1.4x dilution), discontinuous sampling of the mixtures was done by 	   63	  taking 90 µL of the above into 10 µL of nitrocefin (final concentration 100 µM).  Data were fit to Equation 6 to obtain koff (176).  In the off-rate experiment, vs was approximated by a no inhibitor control and v0 by a no enzyme control.  Error values reported are the standard deviation of three technical replicates. 4.2.5  Crystallization, data collection, and structure determination.  Avibactam bound CTX-M-15, OXA-10 (71) and OXA-48 crystals were grown using the sitting drop vapor diffusion method at 25 °C. For CTX-M-15, drops contained 2µL of 30mg/mL CTX-M-15 in an equal volume of precipitant (0.2M ammonium sulfate, 0.1M MES pH 6.5, 30% PEG 5K MME, 5mM avibactam). For OXA-10, drops contained 3µL of 10 mg/mL protein in an equal volume of precipitant (1.8 M (NH4)2SO4, 0.1 M MES pH 6.5, 10 mM CoCl2, 2mM avibactam). For the OXA-48 crystal structures, drops contained 2uL of 50 mg/mL protein in an equal volume of precipitant [(i) OXA-48-AVI6.5: 0.1M sodium cacodylate pH 6.5, 40% v/v MPD, 5% wt/v PEG 8K, 2mM avibactam, (ii) OXA-48-AVI7.5: 200mM tris pH 7.5, 0.1M ammonium chloride, 40% MPD, 5% PEG 8K, 100 mM NaCl, 2 mM avibactam, (iii) Native OXA-48: The OXA-48-AVI7.5 precipitant minus avibactam, and (iv) and OXA-48-AVI8.5: 0.1M TRIS pH 8.5, 20% ethanol, 2mM avibactam]. Crystallization mother liquor plus 25% glycerol was used as a cryo-protectant and the crystals were flash vitrified in liquid nitrogen. The CTX-M-15-AVI, OXA-48-AVI7.5, OXA-48-AVI8.5, native OXA-48 and OXA-10-AVI crystals diffracted to 1.6, 2.1, 2.0, 1.7, and 2.0Å at beamline CMCF-2 at the Canadian Light Source (CLS). The OXA-48-AVI6.5 crystals diffracted to 2.5Å at our in house x-ray machine. At the CLS and x-ray home source, data was collected at a wavelength of 1.0 and 1.54Å, at a temperature of 100K.  Data were processed using iMOSFLM(157), and the CCP4(130) program suite. For cross-validation purposes, a total of 5% of reflections were set aside.  The avibactam bound CTX-M-15, OXA-48 and OXA-10 structures were solved by molecular replacement using the program Phaser (131), with chain A of the native (CTX-M-14, OXA-48 and OXA-10) crystal structures as starting 	   64	  models [PDB ID: 1YLT (177), 3HBR (74), 1FOF (71)]. Several cycles of manual rebuilding in coot (132), followed by refinement using REFMAC (CCP4)(130) were carried out.  All structures were refined with isotropic B-factors. Water and avibactam were added manually by examination of the Fo-Fc and 2Fo-Fc electron density maps. Coordinates and structure factors were deposited in the PDB with accession codes (4S2I, 4S2J, 4S2K, 4S2N, 4S2P, and 4S2O) for CTX-M-15-AVI, OXA-48-AVI6.5, OXA-48-AVI7.5, OXA-48-AVI8.5, native OXA-48, OXA-10-AVI crystal structures. Figures 4.2, 4.4, 4.5, B.1a, B.3 and B.4 were designed using PyMol(134) and figures B.1b and B.2 were created using LIGPLOT+ (178). 4.2.6  Dynamic light scattering.  Dynamic light scattering was performed using a Zetasizer NanoS (Malvern Instruments). All measurements were taken using a 12 µL quartz cell (ZEN2112) at 25°C. Size distribution of the samples was calculated based on the correlation function provided by the Zetasizer Nano S software. 4.2.7  LC-MS analysis of avibactam-CTX-M-15 mutants.  LC-ESI-MS data were obtained by using an Agilent 1100 Series LC system (Agilent Technologies Canada, Inc.) and a QTRAP LC/MS/MS System (Applied Biosystems). The reverse phase HPLC was performed using C18 column (SunFire C18 5 µm, 4.6x50 mm, Waters) with Agilent 1100 LC binary pump at a flow rate of 1 mL/min, under the following conditions: isocratic 5% solvent B (0.05% formic acid in acetonitrile) and 95% solvent A (0.05% formic acid in water) for 1 min, followed by a linear gradient to 97% B over 10 min.  CTX-M-15 WT, K73A, N104A, S130A, N132A, E166Q, K234A; and KPC-2 (7 µM) were incubated with 14 µM avibactam in buffer containing 30 mM HEPES pH 7.5, 300 mM NaCl, and 20 % v/v glycerol and analyzed at both 0 h and 24 h. 4.2.8  Protein expression and purification for crystallographic studies.  The P. aeruginosa OXA-10 protein (UniProt ID: P14489) corresponding to the mature sequence (20-266) was cloned, overexpressed and purified as previously described  (71).  	   65	  The E. coli CTX-M-15 and Klebsiella pneumoniae OXA-48 expression vectors were constructed as described above. The expression vectors were then transformed into E. coli BL21 DE3 cells. The cells were grown in Lauria Bertani (LB) broth at 37°C until an OD600 of 0.7 was reached at which point the culture was cooled to room temperature. Protein expression was induced by addition of 1mM IPTG and the cultures were grown at 22°C for 12-16 hours. The cells (~20g) were then harvested and resuspended in 50mL lysis buffer (50mM Tris, pH 7.5, 350mM NaCl, and one complete, EDTA-free protease inhibitor tablet from Roche). The cells were lysed by two passes on a French Press at ~12,000 p.s.i., and the lysate was centrifuged (45,000 rpm in a Beckman 70 Ti rotor) for 35 minutes. The supernatant was then filtered using a 0.22 µM syringe filter and passed through a 1mL Hi-Trap HP His column, which was pre-equilibrated in lysis buffer. Elution buffer (50 mM Tris, pH 7.5, 350mM NaCl, 1M imidazole) was used to elute the His-tagged proteins from the column with a gradient of imidazole from 0 to 500mM in 50 minutes. Fractions enriched in the protein of interest were pooled and 1U/mL of bovine α-thrombin (Roche) was added and the samples were incubated overnight at 4°C. Samples were then exchanged via a 10 kDa cut-off Amicon centrifugation concentrator into crystallization buffer (20mM Tris, pH 7.5, 100mM NaCl). Samples were passed over a Superdex 200 column using crystallization buffer, as running buffer and pooled fractions were concentrated to 30 mg/mL for CTX-M-15, 50 mg/mL for OXA-48 and 10mg/mL for OXA-10. 4.3 Results and Discussion 4.3.1  Inhibition of CTX-M-15 by avibactam.  We have solved the co-crystal structure of avibactam complexed with the CTX-M-15 class A SBL in spacegroup, P21, at 1.6Å resolution, with two protein chains in the asymmetric unit (ASU) [see Table 4.1 for a full list of data collection and refinement statistics]. Recently, Docquier et al. presented a 1.1Å resolution x-ray co-crystal structure of the avibactam-CTX-M-15 carbamyl-enzyme complex, which crystallized in space-group P212121 with a single protein monomer in the ASU (PDB ID: 4HBU). However, a close electrostatic interaction between the bound avibactam sulfate group and R42 on an 	   66	  adjacent monomer was observed as a crystallographic artifact (avibactam N6 sulfate to R42 guanidino η1 distance= 3.0Å) (99). Despite this difference in avibactam binding we find that the compound itself takes on a nearly identical conformation between the two crystal forms and resulting structures (see Figure B.1).	   Figure 4.2 Inhibition of CTX-M-15 by avibactam. Stereoview active site close-up of carbamyl-avibactam bound CTX-M-15. The carbon atoms of avibactam are pink and all other atoms are colored by type (N, blue; O, red; S, yellow). The avibactam bound CTX-M-15 protein backbone is displayed as a green cartoon. The catalytic water (W1) is shown as a green sphere. Hydrogen bonding and electrostatic interactions are depicted as black dashes.                        	   67	  Table 4.1  Data collection and refinement statistics for avibactam bound β-lactamases.   CTX-M-15-AVI OXA-10-AVI OXA-48-AVI8.5 OXA-48-AVI7.5 OXA-48-AVI6.5 OXA-48-Native Data collection       Space group P21 P212121 P32 P32 P212121 P22121 Cell dimensions             a, b, c (Å) 62.0, 60.6, 71.5 48.6, 96.5, 125.7 142.0, 142.0, 52.4 142.8, 142.8, 52.4 64.1, 108.1, 162.8 43.4, 102.9, 124.7     α, β, γ  (°)  90, 104, 90 90, 90, 90 90, 90, 120 90, 90, 120 90, 90, 90 90, 90, 90 Resolution (Å) 34.7-1.6 (1.69-1.60) 52.66-1.70 (1.73-1.70) 46.64-2.00 (2.11-2.00) 52.42-2.10 (2.21-2.10) 65.03-2.54 (2.65-2.54) 41.6-1.70 (1.73-1.70) Rmerge 0.052(0.296) 0.040(0.290) 0.090(0.295) 0.096(0.457) 0.065(0.150) 0.055(0.424) I / σI 13.7(3.5) 24.5(5.2) 6.1(2.9) 8.5(2.9) 12.7(6.1) 12.1(2.3) Completeness (%) 96.7(95.2) 98.0(99.9) 99.2(99.4) 99.8(100.0) 91.2(91.4) 99.7(99.9) Redundancy 3.9(3.9) 4.8(4.9) 2.5(2.5) 3.4(3.4) 4.0(3.8) 5.0(4.9)        Refinement       Resolution (Å) 34.7-1.60 52.66-1.70  46.64-2.00 52.42-2.10 65.03-2.54 41.6-1.70 No. reflections 65645(9368) 64493(3478) 76256(11167) 69650(10200) 34471(4158) 62226(3297) Rwork / Rfree 0.165/0.198 0.185/0.230 0.171%/0.205 0.172/0.205 0.184/0.222 0.192/0.226 Avibactam occupancy chainA, chainB, etc. 1.00, 1.00 1.00, 1.00  0.70, 0.70, 1.00, 1.00 1.00, 1.00, 1.00, 1.00 1.00, 1.00, 1.00, 1.00 N/A, N/A No. atoms           Protein 3930 3957 8000 8043 7972 3963     Ligand/ion 34 38 68 68 68 N/A     Water 546 438 385 537 185 438 B-factors           Protein 17.8 22.6 40.2 30.3 34.1 27.2     Ligand/ion 17.8 17.5 36.7 22.4 35.4 N/A     Water 27.4 28.7 37.6 32.3 29.2 35.4 R.m.s. deviations           Bond lengths (Å) 0.012 0.012 0.014 0.012 0.011 0.014     Bond angles (°) 1.62 1.70 1.72 1.68 1.49 1.53 Favored/allowed/ disallowed (%)+ 98.2, 1.4, 0.4 97.8, 2.0, 0.2 97.6, 2.4, 0.0 97.2, 2.8, 0.0 97.9, 2.1, 0.0 97.7, 2.3, 0.0 *All datasets correspond to diffraction data collected from a single crystal.  *Values in parentheses are for highest-resolution shell. *Avibactam (AVI) +phenix.ramalyze; “allowed” is the percentage remaining after “favored” and “outlier” residues are subtracted.  From our co-crystal structure, we see that upon carbamylation by the SXXK S70, the avibactam C7-N6 amide bond is liberated rather than the C7-N1 bond (Figure 4.2). The avibactam sulfate projects into an electropositive pocket formed by K234 and is stabilized by interactions with T235 and K234 on motif iii. The R1 carboxamide is oriented away from the active site core and is within hydrogen bonding distance (3.0Å and 2.7Å) away from the side chain amide nitrogens of N104 and N132 (Figure 4.2, and Figure B.1).  Water (W1), the nucleophile responsible for hydrolytic deacylation of the β-lactams, occupies the typical catalytic position, oriented by hydrogen bonds to the side chains of E166 and N170 	   68	  protruding from the CTX-M-15 Ω-loop motif.  We suggest that a major contributing factor to the avoidance of the carbamyl-enzyme to hydrolytic decarbamylation is that the carbamyl carbon is less susceptible to nucleophilic attack than its ester (acyl-enzyme) counterpart (179), (180). This stability is presumably due to a resonance effect, in which the lone pair of electrons on the sp2 hybridized N1 aligns with the carbonyl C=O p-orbitals, thereby increasing electron density at the electrophilic carbonyl carbon (181). Carbamyl bond formation is a common feature observed for inhibitors of serine hydrolases, some of which have also been shown to retain the catalytic water in the carbamylated state (182), (180). 4.3.2  Carbamylation/decarbamylation kinetics for CTX-M-15 active site mutants.  To evaluate the mechanistic details governing the reversible recyclization reaction of avibactam inhibition, we mutagenized key active site residues within CTX-M-15 and measured enzyme activity using the colorimetric cephalosporin, nitrocefin, as a reporter substrate. We confirmed that mutants adopt a WT particle size distribution by dynamic light scattering, and that no hydrolysis of avibactam occurred using liquid chromatography-mass spectrometry (LC-MS) (Figures 4.3, and B.5-B.14) (97).                                    Figure 4.3 Characterization of the particle size distribution for CTX-M-15 variants using dynamic light scattering. CTX-M-15 variants show a nearly identical elution profile to WT suggesting they are similarly folded.  D ia m e te r  (n m )% Volume0 .1 1 1 0 1 0 0 1 0 0 0051 01 52 02 5W TK 73AN 104AS 130AN 132AE 166QK 234A	   69	  For class A SBLs like CTX-M-15, there are alternative views on the mechanism of S70 activation during β-lactam acylation. In one perspective, the Ω-loop E166 activates S70 for nucleophilic attack by O-γ deprotonation through a water molecule. The second proposal involves K73 as the base responsible for S70 activation. Here, we find that E166Q has a comparable avibactam carbamylation rate to wild-type [WT and E166Q carbamylation rates (k2/Ki) = 1.6 ± 0.2 x 105 and 9.3 ± 1.2 x 104 M-1s-1], suggesting that E166 is likely not directly involved in the carbamylation mechanism. In contrast, K73A was almost completely carbamylation deficient (2.8 ± 0.1 x 10-1 M-1s-1) (Table 4.2). These data support the proposition that K73 is the general base responsible for S70 activation during avibactam carbamylation. This may in part facilitate avibactam’s ability to inhibit all SBL subclasses that all have the universally conserved SXXK lysine.   During carbamylation, the avibactam N6 nitrogen is protonated following ring opening. We hypothesized that the S130 γ-OH is responsible for this protonation event due to its proximity to N6 in the carbamyl-enzyme crystal structure (2.9Å, Figure 4.2). We observed a dramatic reduction in carbamylation rate for the S130A mutant [WT and S130A carbamylation rates (k2/Ki) = 1.6 ± 0.2 x 105 and 3.3 ± 0.4 M-1s-1] (Table 4.2). Therefore, we propose that in an analogous fashion to its role in β-lactam nitrogen protonation during acylation, S130 also acts as the general acid responsible for protonation of the avibactam N6 during carbamylation.          	   70	  Table 4.2 Kinetic values for the carbamylation and decarbamylation of avibactam against a panel of CTX-M-15 active site mutants.  The carbamylation and decarbamylation rates were measured using the colorimetric reporter substrate nitrocefin. The KD values are calculated from the carbamylation and decarbamylation rates. Parameter WT K73A N104A S130A N132A E166Q K234A On-rate k2/Ki (M-1s-1) 1.6 ± 0.2 x 105 2.8 ± 0.1 x 10-1 3.9 ± 0.2 x 104 3.3 ± 0.4 3.7 ± 0.3 x 105 9.3 ± 1.2 x 104 8.0 ± 0.9 x 102 Off-rate koff (s-1) 1.5 ± 0.1 x 10-4 2.1 ± 0.3 x 10-7 7.1 ± 0.1 x 10-5 7.7 ± 0.7 x 10-7 1.6 ± 0.1 x 10-4 1.8 ± 0.3 x 10-4 4.0 ± 0.8 x 10-5 Off-rate t1/2 (min) 76 6 x 104 160 9 x 103 74 63 292 Kd (µM) 0.001 0.8 0.002 0.2 0.001 0.002 0.05  For subsequent avibactam recyclization to occur, the N6 nitrogen must be deprotonated to facilitate intramolecular attack of the carbamyl linkage reforming the N6-C7 bond. Due to the close proximity of S130 O-γ to the avibactam N6 nitrogen in the CTX-M-15 bound structure and considering the concept of microscopic reversibility with regards to its role as a general acid during carbamylation (2.9Å, Figure 4.2, Figure B.1), Docquier et al. proposed that S130 may act as the general base responsible for reversible-recyclization (99).  To test this, we analyzed the decarbamylation rate for the S130A CTX-M-15 mutant. The carbamyl enzyme intermediate was virtually unable to decarbamylate in the S130A mutant [WT and S130A decarbamylation rates (koff) = 1.5 ± 0.1 x 10-4 and 7.7 ± 0.7 x 10-7 s-1] (Table 4.2) consistent with a role of S130 as the general base responsible for avibactam recyclization. Despite intensive research on SBLs over the past several decades, this is the first evidence of S130 acting as a general base, a feature that exemplifies the novelty of the avibactam inhibitor and the functional plasticity of this residue. In the carbamyl avibactam-CTX-M-15 crystal structure, K73 and K234 are directly hydrogen bonded to the side chain O-γ of S130, suggesting that they may be responsible for regulating the protonation state of S130 during carbamylation/decarbamylation (Figure 4.2, Figure B.1). The K73A mutant mimic’s the effect of S130A whereby it is almost completely deficient in decarbamylation (koff = 2.1 ± 0.3 x 10-7 s-1). However, K234A only displays a moderate reduction in decarbamylation rate as compared to the wild-type enzyme (Table 4.2). We therefore suggest that K73 may potentially be the 	   71	  base responsible for S130 activation during recyclization with K234 playing an additional electrostatic role in modulating the pKa depression of S130 to facilitate its necessary oxyanion state. Class A SBL catalyzed hydrolytic deacylation of β-lactams is thought to proceed through E166 catalyzed hydrolysis of the acyl-enzyme intermediate, and subsequent protonation of the S70 O-γ via an E166 coordinated water molecule (183). However, for avibactam re-cyclization, we find that the E166Q decarbamylation rate is virtually identical to wild-type suggesting that E166 is not required for S70 protonation (Table 4.2). Due to the close proximity of the K73 N-ζ to the S70 O-γ in the unbound CTX-M-15 crystal structure (2.7 Å) (99), and the apparent decarbamylation deficiency of the K73A mutant (t1/2= ~1000 hours), we suggest that K73 acts as part of a concerted proton shuttle pathway for S70 regeneration during avibactam decarbamylation.  In the carbamyl avibactam-CTX-M-15 crystal structure, the side chain amide nitrogen atoms of N132 and N104 are within hydrogen bonding distance 2.7 and 3.0 Å away from the avibactam C2 carboxamide oxygen (Figure 4.2, Figure B.1). We found that mutant N104A, but not N132A, had a 4-fold reduction in carbamylation rate as compared to the WT enzyme but minimal effect on decarbamylation (Table 4.2). Previous structural and kinetic analysis suggests that the N104 side chain amide nitrogen is also important for the stabilization of the acylamide R1 group of the β-lactam antibiotics in the class A SBLs (184), (185). Thus, the role of N104 in class A β-lactamases is likely to contribute to Michaelis complex formation by interacting with the avibactam C2 carboxamide in an analogous fashion to the R1 side chain of β-lactams. Future drug design efforts should seek to maintain a hydrogen bond acceptor at the avibactam C2 carboxamide oxygen position. 4.3.3  Inhibition of the class D SBLs by avibactam.  To understand the structural basis for DBO-mediated inhibition of the class D β-lactamases, we determined co-crystal structures of avibactam bound to OXA-10, and OXA-48 at three different pH values (6.5, 7.5 and 8.5; hereafter called OXA-48-AVI6.5, OXA-48-AVI7.5 and OXA-48-AVI8.5) to 1.7, 2.5, 2.1 and 2.0Å resolution, respectively (Table 4.1). Generally, all protein monomers within the 	   72	  ASU contain high structural similarity [with root-mean-square deviations (r.m.s.d.) of <0.2Å for all common alpha-carbon (CA) atoms in all chains in the ASU]. Therefore, we limit our analysis to chain A for each product complex. For simplicity, we further limit our analysis to OXA-48-AVI7.5 unless otherwise stated. All avibactam-bound complexes display clear, and unambiguous ligand omit map Fo-Fc electron density for avibactam within the active site of each protein chain in the ASU (Figure 4.4). The carbamyl avibactam molecules were refined at full occupancy, with the exception of the OXA-48-AVI8.5 (Chains A and B), which were refined at an occupancy of 0.7 (Table 4.1).  Figure 4.4 Avibactam electron density for carbamylated CTX-M-15, OXA-48 and OXA-10 crystal structures. In a-c, the Fo-Fc ligand omit maps are contoured at 3.0, 4.0 and 5.0 σ and are shown as pink, cyan and red transparent surfaces. (a) Carbamyl-avibactam CTX-M-15 ligand omit Fo-Fc electron density. The CTX-M-15 cartoon is shown in white with selected active site residues displayed 	   73	  in stick representation and non-carbon atoms are colored by type. (b) and (c), Carbamyl-avibactam OXA-48-AVI7.5 and OXA-10 ligand omit Fo-Fc electron density. In B and C, the OXA-48-AVI7.5 and OXA-10 protein backbones are shown in white cartoon representation with selected active site residues displayed as white sticks with non-carbon atoms colored by type. In all panels, the carbamyl-avibactam is represented as pink sticks with atoms colored by type. (d) Carbamyl-avibactam OXA-48-AVI7.5 final refined 2Fo-Fc electron density. The OXA-48-AVI7.5 protein and bound avibactam are displayed as in b. The 2Fo-Fc electron density map is contoured at 1.0σ and is displayed as a grey mesh.   The high resolution of the models allows us to make detailed observations about key active site interactions. For clarity, we use OXA-48 residue numbering throughout the text when describing both OXA-48 and OXA-10, except in figure 3b whereby we use OXA-10 numbering for consistency with the PDB file. The average temperature-factors for the refined avibactam in the OXA-48 and OXA-10 bound structures are 22.4 and 17.5Å2 (similar to the average protein B-factors of 30.3 and 22.6Å2), indicating that the inhibitor is bound in a rigid fashion with little conformational variation and flexibility (Table 4.1). In the complexes, the bound avibactam forms a carbamyl bond between the active site S70 O-γ and its C7 carbon, as evidenced by the continuous Fo-Fc ligand omit map electron density in this region (Figure 4.4). Like the class A and C enzymes (CTX-M-15 and AmpC) (99), the C7-N6 bond breaks rather the C7-N1 bond upon class D SBL mediated carbamylation. We attribute the C7-N6 bond fission in part to the fact that the N6-OSO3- is a better leaving group than the corresponding RR’N1-. From a structural standpoint, the location of S118 (equivalent to S130 in the class A enzymes), likely also contributes to the observed bond fission as it is ideally positioned to protonate an N6 rather than N1 leaving group (Figure 4.5a-b).   	   74	   Figure 4.5 Inhibition of OXA-48 and OXA-10 by avibactam. (a) Active site close-up of carbamyl-avibactam OXA-48. The carbon atoms of avibactam are pink with all other non-carbon atoms colored by atom type. The avibactam bound OXA-48 protein chain is displayed in orange cartoon representation, and key active site residues are shown as sticks with atoms colored by type. (b) Active site overlay of carbamyl-avibactam and uncomplexed OXA-10. The avibactam bound and unbound OXA-10 protein chains are illustrated in cyan and white cartoon representation, and key active site residues are depicted as sticks with atoms colored by type (OXA-10 numbering). (c) Active site overlay of carbamyl-avibactam and uncomplexed OXA-48. The carbamyl-avibactam and OXA-48 protein chain are displayed as in A. The unbound OXA-48 protein chain is illustrated in grey cartoon representation, and key active site residues are depicted as sticks with atoms colored by type. (d) Active site overlay of carbamyl-avibactam OXA-48 and OXA-10. The OXA-48 and OXA-10 protein chains, active site residues and bound avibactam are displayed as in a, and b. (e) Structure of oxacillin.  (f) Active site overlay of carbamyl-avibactam bound OXA-48 and acyl-oxacillin bound K84D OXA-24 (PDB ID: 4F94). The carbamyl-avibactam bound structure is displayed as in a. The OXA-24 protein backbone is illustrated as a white cartoon, and key active site residues are shown in stick representation with atoms colored by type. The acyl-oxacillin carbon atoms are grey and all other atoms are colored by type.  In a, b, c, d and f, all hydrogen bonding and electrostatic interactions are depicted as black dashes.    In the OXA-48 and OXA-10 carbamylated form, the six membered piperidine ring of avibactam adopts a chair-type conformation, with the C4 and N1 atoms located above and below the plane (Figure 4.5). The C7 carbonyl oxygen of the newly formed carbamyl linkage is located in the oxyanion hole of the enzyme, and is bound by the backbone amide protons of S70 and Y211 at 2.7 and 2.8Å, 	   75	  respectively. The avibactam sulfate group projects into a positively charged cavity consisting of R250, T209 and K208, which binds the analogous C3/C4 carboxylate of β-lactams (Figure 4.5a-b, and Figure B.2) (186). OXA-48 and OXA-10 display a strong electrostatic interaction between the avibactam sulfate oxygen’s (O62 and O63) and the R250 guanidino group η1 and η2 at 2.8 and 3.2Å, an interaction that is not observed in the class A and C SBL-avibactam complexes. In the OXA-48 and OXA-10 bound structures, the avibactam C2 carbamate is not stabilized by hydrogen bonding with asparagine residues as observed in the class A and C carbamyl avibactam bound CTX-M-15 and PAO1 AmpC crystal structures (99).  When aligning the native and avibactam bound OXA-10 and OXA-48 crystal structures, we observe that the protein chains are nearly identical (r.m.s.d. on all common Cα atoms=0.4Å and 0.4Å), with a remarkably similar juxtaposition of active site residues (Figure 4.5b-c). Thus, the class D SBL active site is poised for interaction with avibactam without the need for complicated conformational rearrangements that can substantially slow acylation, as observed for S. aureus PBP2a (187), (188). 4.3.4  Comparison of carbamyl-avibactam in the class D SBLs OXA-10 and OXA-48.  The OXA-10 and OXA-48 enzymes differ by 2 orders of magnitude in their avibactam carbamylation rates (1.1  ± 0.1 x 101 and 1.4 ± 0.1 x 103 M-1s-1), despite having a virtually identical arrangement of catalytic residues (Figure 4.5d) (97). Although carboxylation of K73 may be important to the observed carbamylation rates (see discussion below), structural differences between enzymes may also play a role. When overlaying the avibactam bound OXA-48 and OXA-10 crystal structures (49% amino acid sequence identity), we see that the two protein chains align very well (r.m.s.d on 112 common CA atoms= 0.97Å). The only substantial difference between the two proteins is the β-hairpin connecting strands β5 and β6 (Figure 4.5d), which flanks the active site and is an important feature defining carbapenemase activity via interaction with the carbapenem hydroxyethyl moiety (189). For OXA-48, the β-hairpin residue R214 interacts electrostatically with D159 on the Ω loop (R214 η1 to 	   76	  D159 δO distance= 3.0Å), bringing the β-hairpin closer to the catalytic core than observed for the elongated OXA-10 β5-β6 hairpin (Figure 4.5d). From the OXA-48-bound avibactam structure in two out of 4 monomers in the ASU we see that there is a hydrogen bond between the R214 η2 guanidino nitrogen and a water molecule (W2, refined at full occupancy) at 2.9Å, which in turn hydrogen bonds to the amide nitrogen of the avibactam C2 carboxamide at 3.0Å (Figure 4.5d). Therefore, the β5-β6 hairpin may be important for stabilizing the avibactam C2 carboxamide, and thus future structure-based drug designed efforts should aim to maintain this water-mediated interaction.   4.3.5  Comparison of avibactam and β-lactam binding in the class D SBLs.  When overlaying avibactam-bound OXA-48 onto the 2.4Å resolution crystal structure of acyl-oxacillin bound K84D OXA-24 (PDB ID: 4F94, unpublished data), we see that the two protein chains align well (r.m.s.d=1.1Å on 80 common CA atoms). Furthermore, the oxacillin and avibactam ligands display analogous overall orientations despite their chemical differences (Figure 4.5f). In both structures, the acyl/carbamyl carbonyl oxygen interacts with the backbone amides of the oxyanion hole residues S70 and Y211 on strand β5 (OXA-48 residue numbering). The electronegative substituent (the avibactam N6 sulfate and penicillin C3 carboxylate) both project toward the basic patch defined by R250, K208 and T209. Additionally, the avibactam C2 carboxamide and the analogous β-lactam R1 functional groups orient away from the catalytic core, toward bulk solvent in both structures (Figure 4.5f). Taken together, the observed similarities between DBO and β-lactam binding, in part help to explain the broad-spectrum SBL target profile for avibactam, which clearly acts as a substrate analogue. The DBO C2 carboxamide group may be a key site for chemical modification in future drug design efforts, as has been the case for the β-lactam R1 moiety (190).   β-Lactams hydrolytically deacylate from the SBL catalytic serine rather than recyclize to the active antibiotic (68). However, both the avibactam N6 and the analogous oxacillin N4 atoms are within hydrogen bonding distance (3.1Å and 3.3Å) from the recyclization general base S118 (Figure 4.5f). We propose that recyclization is prohibited in the β-lactams due in part to an intrinsically high-	   77	  energy barrier to cyclize the strained 4-membered lactam ring, as opposed to the 5-membered ring that is formed upon avibactam re-cyclization. 4.3.6  Carboxylation state of lysine 73 in the avibactam carbamyl-enzyme complexes.  The N-carboxylation state of K73 is sensitive to pH, with carboxylation increasing at higher pH values presumably due to an increased reactivity of K73 to carbon dioxide in more basic solutions, and the greater stability of carbamic acid in the anionic form at higher pH (75).  OXA-48 with no avibactam present was crystallized at pH 7.5 and displays clear, unambiguous K73 omit map Fo-Fc electron density for carboxylated lysine, which was refined at full occupancy for both monomers within the ASU (Figure B.3a). Interestingly, in the avibactam bound OXA-48 structures at both pH 6.5 and 7.5, all monomers display no evidence for carboxylation at K73 upon inspection of the Fo-Fc K73 omit electron density maps (Figure B.3b-c). Therefore, the presence of the bound avibactam appears to disfavor K73 carboxylation in the carbamyl-enzyme complexes.  Only in the pH 8.5 structure, OXA-48-AVI8.5, do 2 out of 4 monomers in the ASU (chains A and B) display partial occupancy for N-carboxylated K73 (Figure B.3d). At the same time, these are the only chains from all OXA-48 structures that display partial rather than full occupancy for avibactam (Table 4.1). However, it should be noted, at pH 8.5 avibactam was shown to degrade when free in solution by LC-MS (Figure B.14), providing an alternative or additional reason for the observed partial occupancy. As an interesting aside, to our knowledge, this is the first report showing that avibactam is not stable at high pH. Recently, Ehmann et al. have shown by monitoring OXA-10 carbamyl exchange with TEM-1, that OXA-10, like the majority of SBLs tested, undergoes a reversible, rather than hydrolytic route to avibactam decarbamylation (97). Taken together, the absence of K73 N-carboxylation clearly disfavors hydrolytic decarbamylation of avibactam for the class D enzymes. The acyl enzyme crystal structure of OXA-24 bound to tazobactam (which undergoes hydrolytic deacylation rather than decarbamylation), displays a carboxylated K73 (PDB ID: 3ZNT, unpublished), further corroborating the notion that motif 	   78	  i lysine carboxylation is a key feature governing hydrolysis in the class D enzymes. However, it is currently unclear whether or not carboxylated-K73 is the general base responsible for S70 activation during carbamylation and how this modification affects avibactam carbamylation rates for the class D SBLs.   In the avibactam-bound OXA-48 structure, the de-carboxylated K73 is oriented toward S118, rather than W57 as observed in the unbound, carboxylated state (Figure 4.5c). In the avibactam bound form, the de-carboxylated K73 hydrogen bonds to S118 at a distance of 2.9Å, which in turn hydrogen bonds to the N6 proton on avibactam at 3.1Å (Figures 4.5a, and 4.5c).  This conformational switch is reminiscent of the CTX-M-15 avibactam bound structure whereby K73 is hydrogen bonded to S130 (equivalent to the OXA-48 S118) (Figure 4.2), yet this interaction is not present in the unbound CTX-M-15 structure (99). We propose that upon avibactam recyclization, this hydrogen bonding network results in K73 mediated deprotonation of S118, which in turn removes the avibactam N6 hydrogen facilitating attack on the carbamyl bond and subsequent re-cyclization.  	   79	                   Figure 4.6 Proposed general catalytic mechanism for avibactam mediated SBL inhibition. 4.3.7  Universal mechanism for avibactam mediated SBL inhibition.  Analysis of the avibactam-bound carbamyl enzyme crystal structures of the class A, C and D β-lactamases (CTX-M-15, P. aeruginosa PA01 AmpC (99), and OXA-48) reveals that the DBO core takes on a similar orientation with respect to the conserved SBL active site motifs in all three structures (Figure B.4). Taken together, these crystal structures along with the CTX-M-15 mutant kinetic data allows us to propose a universal mechanism for SBL inhibition. Electrostatic stabilization of the N6 sulfate likely helps to orient the bound avibactam in the pre-catalytic Michaelis complex, whereby the sulfate occupies the electropositive pocket formed by the SBL motif iii. The catalytic serine is activated 	   80	  via general base mediated deprotonation (SXXK, Figure 4.6), likely by K73 for the class A SBLs, K67 for the class C SBLs and K73 for the class D enzymes. The subsequent attack of the activated serine O-γ on the avibactam C7 carbonyl results in the formation of a transient tetrahedral intermediate that is stabilized by the oxyanion hole of the enzyme (consisting of the backbone amides of the catalytic serine and residue X from the K-T/S-G-X motif iii). The lone pair of electrons on the C7 oxygen drive back into carbonyl formation expelling the negatively charged N6 nitrogen, which is concomitantly protonated by the motif ii serine (or tyrosine for the class C enzymes), resulting in the formation of a stable carbamyl enzyme complex. The complex resists decomposition by hydrolysis likely due in part to the inherent stability of the carbamyl bond, and/or by removal of the general base involved in β-lactam hydrolytic deacylation (as proposed for the de-carboxylation of the SXXK carboxy-lysine in the class D enzymes). Upon eventual avibactam decarbamylation, a reversible mechanism of recyclization generally occurs, whereby the SXXK lysine takes part in a concerted acid-base shuffling of protons from the motif ii serine (for class A and D), or tyrosine (for class C), which deprotonates the N6 nitrogen facilitating an intramolecular nucleophilic attack on the electrophilic C7 carbamyl carbon.  The decarbamylation results in departure of the catalytic serine-leaving group, which likely abstracts a proton from the N-ζ of the now protonated SXXK lysine to regenerate the active site (Figure 4.6).            	   81	  5 Diazabicyclooctane Derivatives are Both Potent Antibiotics and Serine-β-Lactamase Inhibitors 4 5.1 Introduction The discovery and semisynthetic modification of the prototypical β-lactam antibiotic, penicillin, revolutionized modern medicine with its unprecedented ability to combat bacterial infection (191). β-lactams target the final step in bacterial peptidoglycan biogenesis, wherein they inactivate the transpeptidase activity of penicillin-binding proteins (PBPs) (21).  However, the evolution and dissemination of bacterial resistance to β-lactams, primarily mediated by β-lactamase expression, has emerged in response to the selective pressure due in-part to widespread clinical use (192). β-Lactamases are grouped into four classes: the class B enzymes are metallo-β-lactamases (MBLs) that use active site zinc ion(s) during bond cleavage, whereas the more clinically prevalent class A, C and D enzymes are serine β-lactamases (SBLs) that employ a serine nucleophile to catalyze hydrolysis (164).  Two therapeutic strategies have emerged in response to β-lactamase-mediated β-lactam resistance: 1) discovery of additional β-lactam scaffolds and subsequent medicinal chemistry efforts towards evading β-lactamase resistance (116) and 2) development of β-lactamase inhibitors (193).  Avibactam is a reversible, covalent inhibitor possessing a novel diazabicyclooctane (DBO) core scaffold recently approved by the U.S. Food and Drug Administration (FDA) in combination with ceftazidime (Avicaz) to address the challenge of antibiotic resistance (194). Avibactam forms a long-lived carbamyl-linkage with the SBL active site serine. This complex does not dissociate by hydrolysis as do the β-lactam based inhibitors, yet undergoes a reversible recyclization mechanism that reforms intact avibactam (100). Avibactam displays unprecedented inhibitory activity against the class A and C β-lactamases, however variable levels of inhibition are observed for the class D SBLs.  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  4	  A	  version	  of	  this	  chapter	  has	  been	  published.	  Andrew M. King*, Dustin T. King*, Shawn French, Eric Brouillette, Abdelhamid Asli, J. Andrew N. Alexander, Marija Vuckovic, Thomas R. Parr Jr., Eric D. Brown, François Malouin, Natalie C.J. Strynadka, and Gerard D. Wright. Structural and Kinetic Characterization of Diazabicyclooctanes as Dual Inhibitors of Both Serine-β-Lactamases and Penicillin-Binding Proteins. ACS Chem. Biol. DOI: 10.1021/acschembio.5b00944	  	   82	  Semisynthetic modification of the acyl side-chain of penicillin led to the development of derivatives with a broader spectrum of activity and resistance to β-lactamases, amongst other favorable properties (195), and this practice of side-chain modification while retaining the β-lactam core scaffold has been a hallmark of this antibiotic class.  Modification of the avibactam C2 carboxamide yielded three derivatives (FPI-1465, FPI-1523, and FPI-1602, Figure 5.1a), which were synthesized by Fedora Pharmaceuticals as previously described (196). We show here that the FPI compounds retain β-lactamase inhibitory properties but also exhibit considerable antimicrobial activity against clinically relevant bacteria via targeting penicillin-binding proteins.  Our results provide evidence that structure-activity relationship studies for the purposes of drug discovery must consider both β-lactamases and penicillin-binding proteins as targets. 5.2    Methods 5.2.1 Reagents   All chemicals of analytical grade were purchased from Sigma-Aldrich, unless otherwise stated.  Nitrocefin was synthesized as described previously (175). 5.2.2 β-Lactamase protein expression and purification  The Escherichia coli CTX-M-15 and Klebsiella pneumonia OXA-48 constructs include the mature sequences (Q26-L288, and W25-P265) with the signal peptide removed and were prepared as previously described (115). Purified CTX-M-15 (with His-tag cleaved) and OXA-48 (with un-cleaved His-tag) were dialyzed into fresh crystallization buffer (CTX-M-15 buffer: 10mM Tris pH 7.5, 100mM NaCl, 250uM 2-mercaptoethanol, and OXA-48 Buffer: 20mM Tris pH 7.5, 100mM NaCl) and concentrated to ~30mg/mL.  For kinetics studies CTX-M-15 and OXA-48 were purified as previously described (197).  5.2.3 PBP plasmid construction, protein expression, and purification The E. coli PBP1a, PBP1b, PBP2, and PBP3 DNA corresponding to amino acid residues 1-855, 58-804, 60-633, and 57-577 were amplified from E. coli K12 genomic DNA. Restriction free cloning 	   83	  was used to produce pET-41b expression vectors containing each of the PBPs with a thrombin cleavable C-terminal 8XHis tag (128).  Vectors containing the E. coli PBP1b, and PBP1a membrane proteins were transformed into BL21(DE3), and C43(DE3) host cells. The transformed cells were grown at 37°C until an OD600 of 0.6 was reached, and the samples were cooled to room temperature for 30 min.  Protein expression was induced by addition of 1mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and the cultures were incubated at 25 °C overnight. Cell pellets were resuspended in lysis buffer (PBP1a: 25mM Tris pH 7.5, 10mM MgCl2, 300mM NaCl, 1 EDTA free protease inhibitor tablet from Roche, PBP1b: 20mM Tris pH 8.0, 300 mM NaCl, 1 EDTA free protease inhibitor tablet from Roche) and lysed by 2 passes on a French press at a pressure of 1500 p.s.i. The cell lysate was then centrifuged twice at 11, 000 rpm for 15 minutes using a Beckman JA 25.50 rotor to remove unbroken cells and inclusion bodies. The supernatant was then centrifuged at 45,000 rpm for 1 hour using a Beckman 60Ti rotor in order to pellet the membranes.  Membranes were homogenized and incubated for 4 hours in the presence of extraction buffer (lysis buffer + 20mM n-Dodecyl-β-D-maltopyranoside, DDM; Anatrace). The solubilized protein was then purified using nickel chelation chromatography.  The column was pre-incubated in the presence of equilibration buffer (PBP1a: 25mM Tris pH 7.5, 300mM NaCl, 1mM DDM, PBP1b: 20mM Tris pH 8.0, 300mM NaCl, 1mM DDM) and eluted using a linear gradient of imidazole from 0-500mM. Fractions containing purified protein were exchanged using a 100 kDa cut-off concentrator into assay buffer [PBP1a: equilibration buffer, PBP1b: 20mM Tris pH 8.0, 300mM NaCl, 4.5 mM n-Decyl-β-D-maltopyranoside (DM), Anatrace]. BL21(DE3) host cells transformed with the E. coli PBP2 and PBP3 expression vectors were grown at 37°C until an OD600 of 0.7 was attained.  Protein expression was induced by addition of 1mM IPTG and the cultures (typically 9L) were incubated at 30°C for 16 hrs. Cell pellets were resuspended in lysis buffer [PBP2: 50mM Tris pH 8.0, 300mM NaCl, 1 EDTA free protease inhibitor table from Roche, PBP3: 20mM Tris pH 8.0, 10% glycerol, 300 mM NaCl, 10 mM MgCl2, 40mM 3-[(3-	   84	  cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 1 EDTA free protease inhibitor tablet from Roche] and lysed by 2 passes on a French press at a pressure of 1500 p.s.i. The cell lysate was then centrifuged at 45,000 rpm for 1 hour using a Beckman 70Ti rotor. The supernatant was purified using nickel chelation chromatography.  The column was pre-incubated in the presence of equilibration buffer (50mM Tris pH 8.0, 300mM NaCl, 5% glycerol) and eluted using a linear gradient of imidazole from 0-600mM. Peak fractions containing purified protein were pooled and exchanged into assay buffer (equilibration buffer), using a 50 KDa cutoff Amicon centrifugal concentrator. 5.2.4 Crystallization, data collection and structure determination  FPI-1465, FPI-1523, and FPI-1602 carbamyl-enzyme complex CTX-M-15 crystals were grown using the sitting drop vapor diffusion method at 24°C. The drops consisted of 1 µL (30mg/mL protein + 2mM FPI-1465, FPI-1523 or FPI-1602), combined with an equal volume of precipitant [0.2M ammonium sulfate, 0.1M 2-(N-morpholino)ethanesulfonic acid (MES) pH6.5, 30% PEG5K monomethyl ether]. Crystals were soaked in cryoprotectant solution for 30s (mother liquor + 25% glycerol), and flash vitrified in liquid nitrogen. The FPI-1465, FPI-1523 and FPI-1602 crystals diffracted to 3.0, 1.67 and 2.70 Å at beamline CMCF-08B1-1 of the Canadian Light Source in Saskatoon Saskatchewan (CLS).             FPI-1465 and FPI-1523 carbamyl-enzyme complex OXA-48 crystals were grown using the sitting drop vapor diffusion method at 24°C. The drops consisted of 1 µL (30 mg/mL protein + 3.6 mM FPI-1465 or 3.9 mM FPI-1523), combined with an equal volume of precipitant (0.005 M CoCl2, 0.005 M CdCl2, 0.005 M MgCl2, 0.005 M NiCl2, 0.1 M HEPES pH 7.5, 12% w/v PEG 3350). Co-crystallization attempts with FPI-1602 and OXA-48 failed to yield suitable crystals so apo crystals were grown as above but without ligand and soaked in 9.0 mM FPI-1602 for 2 days. Crystals were soaked in cryoprotectant solution for 30s (mother liquor + 29 to 33% (v/v) glycerol, and 3mM inhibitor), and flash vitrified in liquid nitrogen. The FPI-1465, FPI-1523, and FPI-1602 bound OXA-48 crystals diffracted to 1.96, 1.74 and 2.09Å at beamline CMCF 08B1-1 of the CLS. 	   85	   FPI-1465 carbamyl-enzyme PBP1b crystals were grown using the sitting drop vapor diffusion method at 24°C. Drops contained 1µL (10mg/mL protein + 5mM FPI-1465), combined with an equal volume of precipitant (20% w/v PEG 3350, 0.2M potassium/sodium tartrate, 0.1M Bis Tris pH 8.5). Crystals were soaked in cryoprotectant solution for 4 min (mother liquor + 40% glycerol), and flash vitrified in liquid nitrogen. The FPI-1465-PBP1b crystals diffracted to 2.85Å resolution at beamline CMCF-08B1-1 of the CLS. All crystallographic data in this study was collected at a temperature of 100K and wavelength of 1.00Å.  Data were processed using Xia2 (198). During refinement, 5% of reflections were set aside for cross validation. All structures of CTX-M-15, OXA-48, and PBP1b were solved by molecular replacement using the program Phaser (131), with chain A of the native crystal structures as starting models (PDB ID’s, CTX-M-15; 4HBT, OXA-48; 3HBR, PBP1b; 3VMA). Several iterations of manual rebuilding in Coot (132), followed by refinement using Phenix (199) were carried out. All structures were refined using isotropic B-factors, with the notable exception of FPI-1523-CTX-M-15, which was refined using anisotropic B-factors. Water and the appropriate ligands were added manually by examination of the Fo-Fc and 2Fo-Fc electron density maps. In all structures, all ligands were refined at full occupancy. Coordinates and structure factors for FPI-1465-CTX-M-15, FPI-1523-CTX-M-15, FPI-1602-CTX-M-15, FPI-1465-OXA-48, FPI-1523-OXA-48, FPI-1602-OXA-48 and FPI-1465-PBP1b were deposited in the PDB with accession codes (XXXX, XXXX, XXXX, XXXX, XXXX, XXXX, XXXX). Figures 5.1b-c, 5.2d, C.1, C.2 and C.7 were made using PyMol (134). 5.2.5 Enzyme assays   For all enzyme assays the buffer consisted of 50 mM HEPES pH 7.5 and Tween20 0.01%.  OXA-48 experiments were performed with the addition of 50 mM NaHCO3.  Enzyme dilutions were made in BSA to 100 ng/µL.  Acylation and deacylation experiments were performed as described previously (112,115).  For all compounds described, on-rates were determined using a continuous assay with nitrocefin as reporter substrate.  For CTX-M-15, 100 µL enzyme (0.2 nM [final]) was added to 100 µL 	   86	  nitrocefin (50 µM [final]; Km = 10 µM) and inhibitor.  The maximum concentration of inhibitor used for CTX-M-15 on-rates was: avibactam, 0.8 µM; FPI-1465, 9 µM; FPI-1523, 4 µM; FPI-1602, 9 µM.   The same methods were applied for OXA-48 (0.03 nM [final]) with nitrocefin (100 µM [final]; Km = 50 µM). For OXA-48, the maximum concentration of inhibitor used was: avibactam, 50 µM; FPI-1465, 100 µM; FPI-1523, 100 µM; FPI-1602, 100 µM. For CTX-M-15, off-rates were determined continuously using the jump dilution method (97) where 1 µM enzyme was incubated with 10 µM inhibitor at 37°C for 30 minutes and then diluted 1/400 before adding 20 µL to 180 µL of nitrocefin (400 µM) in assay buffer.  For OXA-48 7 µM enzyme was incubated with 10 µM inhibitor for 1 hour before 1/16000 dilution and addition to substrate (200 µM) as above.  For OXA-48, discontinuous sampling was applied for all inhibitors other than FPI-1465. For concentration-response experiments assay buffer was used as above.  All enzymes (1 nM) were incubated with inhibitor for 30 minutes at 37°C before dilution in nitrocefin (20 µM).  Metalloenzymes were supplemented with 10 µM ZnSO4.  The maximum concentration of avibactam used was 20 µM. 5.2.6 Antimicrobial susceptibility testing   MIC testing was done according to the Clinical Laboratory Standards Institute (200).  All experiments were performed in duplicate and strains were grown at 37°C for 18 hours.  For the ASKA overexpression experiments IPTG was added for a final concentration of 50 µM and strains were grown for 24 hours.  pGDP constructs were made with the noted gene under control of a bla promoter for high-level constitutive expression. 5.2.7 PBP binding assays   For bacterial membrane preparation, an overnight culture of E. coli K-12 (MG1665) in BHI broth was diluted in a fresh medium and was further incubated at 37°C under agitation to reach an OD600 of ~0.6-0.7.  The cells were harvested by centrifugation at 3,000 g for 15 min at 4°C, washed and suspended in KPN (20 mM potassium phosphate - 140 mM NaCl, pH 7.5). Cells were first treated with 	   87	  lysozyme (500 µg/mL) for 1h at 37°C, before addition of a protease inhibitor cocktail (Sigma Aldrich Canada, Oakville, ON), deoxyribonuclease (6 µg/mL) and ribonuclease (6 µg/mL).  After 30 minutes of treatment, cells were disrupted by a French press and the bacterial lysate was centrifuged at 12,000 g for 10 min to remove unbroken cells. The supernatant was then centrifuged at 150,000 g for 40 min at 4°C using a fixed-angle rotor to collect the membranes.  The membranes were suspended in a minimal volume of KPN buffer and stored at -86°C. Protein concentration was estimated by the method of Bradford with the BCA kit (Pierce) using bovine serum albumin as a standard. The relative binding affinity of test molecules for bacterial PBPs were assayed in a competition assay with BOCILLIN FL (Invitrogen, Carlsbad, CA) as the reporter molecule. Increasing concentrations of the test compounds were added to aliquots of the reaction mixture containing 30 µg of bacterial membrane preparation for 10 min at 37°C prior to the addition of BOCILLIN FL (100 µM) for an additional 20 min. Membrane-containing samples were then heated to 95°C for 3 min in electrophoretic loading buffer containing SDS before electrophoresis and separation of proteins on a SDS-polyacrylamide discontinuous gel system (5% stacking and 10% separating gels). After electrophoresis, the gels were quickly rinsed in water and incubated for 30 min in a fixing solution (50% methanol - 7% acetic acid). Gels were scanned with a Molecular Imager FX Pro instrument (Bio-Rad Laboratories Canada, Mississauga, ON) using the excitation and emission wavelengths of 488 nm and 530 nm, respectively, to collect the image of the PBP profile.  The concentration of the test compound needed to block 50% of the subsequent binding of BOCILLIN FL to each PBP represented the IC50 value. 5.2.8 BOCILLIN FL competition assays using purified E. coli PBPs  To assess the relative inhibition of E. coli PBPs by the avibactam derivatives, SDS-PAGE based concentration response experiments were performed in triplicate using the fluorescent penicillin BOCILLIN FL as a reporter molecule. All reagents were diluted in assay buffer prior to use. To start the reaction, various concentrations of unlabeled compound and 27.8 µM BOCILLIN FL were 	   88	  simultaneously added to 4.7 µM of purified PBP in a final reaction volume of 36 µL. The reaction was incubated at 25°C for 20 min prior to addition of 10X SDS-PAGE loading dye. In contrast, for pre-incubation experiments various amounts of competitor compound were pre-incubated with 4.7 µM E. coli PBP1b for 48 hours prior to an additional 20 min incubation in the presence of 27.8 µM BOCILLIN FL (Supplementary Figure 1).  The samples were then boiled for 2 min prior to loading 10µL on a 12% SDS-PAGE precast gel (Bio-Rad). Following electrophoresis, gels were imaged under UV light using a Syngene ChemiGenius2 bio imaging System. Densitometry analysis was performed using ImageJ as previously described (201). The individual data points were normalized to the maximum value of the fluorescence intensity, which represents total saturation of protein by BOCILLIN FL in the absence of unlabeled compound. Benzyl penicillin, and Kanamycin were used as positive and negative controls, respectively. The IC50 values are defined as the compound concentration required to reduce the residual binding of BOCILLIN FL by 50% and were calculated using SigmaPlot. 5.2.9 Microscopy   Cells were cultured in a standard MIC curve, then fixed and imaged according to the methods of Czarny et al (202).  In brief, after culture densities were recorded using a spectrophotometer, cultures were diluted 1:10 in 2% glutaraldehyde buffered with 25 mM HEPES (pH 6.8) for one hour.  Then, 15 µL of this solution was transferred to a 0.17 mm glass-bottom 384-well microplate, along with 5 uL of 1.5% filter-sterilized nigrosin stain.  Plates were gently flushed with nitrogen gas, then heat-fixed at 50°C in a humidity-controlled incubator.  Finally, plates were imaged under brightfield using a Nikon Eclipse Ti-E inverted microscope.  Cell features were quantified with ImageJ (201), using the analysis pipeline in Czarny et al (202).  These image features were used to cluster drug treatments using Ward's least variance, as well as compute a correlation map and Pearson correlation values for treatments.   	   89	  5.3    Results and Discussion 5.3.1  Inhibition of SBLs by diazabicyclooctane derivatives We first characterized interactions of the FPI compounds with the class A β-lactamase CTX-M-15, which is among the most widely disseminated extended spectrum β-lactamases (ESBLs) worldwide (203), and OXA-48, a class D carbapenemase found increasingly in carbapenem-resistant Enterobacteriaceae (CRE) (204).  Structural analysis of enzyme-derivative interactions was done by solving the x-ray co-crystal structures of FPI-1465, FPI-1523 and FPI-1602 bound to the CTX-M-15 active site to a resolution of 3.00, 1.67 and 2.70Å.  Similarly, the crystal structures of FPI-1465, FPI-1523, and FPI-1602 bound to OXA-48 were solved to 1.96, 1.74 and 2.09Å resolution (Tables 5.1 and 5.2). The CTX-M-15 and OXA-48 proteins crystallized with two protein monomers within the asymmetric unit (ASU). Generally, all protein monomers within the ASU contained high structural similarity [root-mean-square deviations (rmsd’s) of ≤ 0.2Å for all α-carbon atoms (CA) in both chains within the ASU]. For simplicity, we limit our analysis to chain A for each complex.   We previously determined the co-crystal structures of both CTX-M-15 and OXA-48 bound to avibactam (115), allowing for comparison with the corresponding derivative bound enzyme complexes.                      	   90	  Table 5.1 Data collection and refinement statistics for CTX-M-15 co-crystal structures.  FPI-1465 FPI-1523 FPI-1602 Data collection    Space group P212121 P1211 P1211 Cell dimensions          a, b, c (Å) 43.9, 62.7, 175.5 62.7, 60.3, 76.0 63.1, 61.8, 73.1     α, β, γ (°)  90.0, 90.0, 90.0 90.0, 112.8, 90.0 90.0, 104.0, 90.0 Resolution (Å) 33.28-3.00 (3.16-3.00)* 70.1-1.67 (1.71-1.67) 30.97-2.70 (2.77- 2.70) Rsym  0.10 (0.34) 0.053(0.42) 0.06(0.21) I/σI 7.8(2.4) 12.2(1.9) 11.7(3.4) Completeness (%) 98.3(97.4) 98.4(99.7) 95.4(92.1) Redundancy 4.4(4.3) 2.9(2.9) 2.5(2.4)     Refinement    Resolution (Å) 33.28-3.00  70.1-1.67 30.97-2.70 No. reflections 10061(715) 59836(4407) 14478(1010) Rwork/ Rfree 0.223, 0.271 0.166, 0.197 0.187, 0.227 No. atoms        Protein 3934 3946 3926     Ligand 46 70 48     Water 34 520 85 B-factors (Å2)        Protein 30.4 15.3 27.8     Ligand 52.2 14.7 31.1     Water 21.2 27.6 18.1 R.m.s deviations        Bond lengths (Å)  0.009 0.015 0.011     Bond angles (º) 1.43 1.73 1.48 Favored/allowed/disallowed (%)+ 94.9, 4.3, 0.8 97.2, 1.6, 1.2 96.1, 3.1, 0.8 Data corresponds to diffraction from a single crystal for each structure.  *Highest resolution shell is shown in parenthesis.  +phenix.ramalyze; “allowed” is the percentage remaining after “favored” and “outlier” residues are subtracted.              	   91	  Table 5.2 Data collection and refinement statistics for OXA-48 co-crystal structures.  FPI-1465 FPI-1523 FPI-1602 Data collection    Space group P212121 P212121 P212121 Cell dimensions          a, b, c (Å) 72.8, 75.5, 107.0 73.0, 75.8, 106.7 73.1, 75.8, 106.7     α, β, γ (°)  90, 90, 90 90, 90, 90 90, 90, 90 Resolution (Å) 43.64-1.96 (2.01-1.96) 43.62-1.74 (1.79-1.74) 47.18-2.09 (2.14-2.09) Rmerge 0.071(0.467) 0.04(0.440) 0.072(0.540) I/σI 22.6(4.3) 30.6(4.1) 21.2(3.4) Completeness (%) 99.7(99.9) 99.9(99.3) 99.7(99.9) Redundancy 7.3(7.4) 7.4(7.4) 7.3(7.5)     Refinement    Resolution (Å) 43.64-1.96 43.62-1.74 47.18-2.09 No. reflections 42805(3145) 61458(4464) 35720(2595) Rwork/ Rfree 0.168/0.210 0.157/0.178 0.167/0.216 No. atoms        Protein 3988 4336 4026           Ligand 46 42 48     Ion 13 13 11     Water 422 457 293 B-factors (Å2)        Protein 25.6 25.9 35.5     Ligand 32.7 32.7 51.3     Ion 27.1 26.2 42.6     Water 32.8 34.6 40.6 R.m.s deviations        Bond lengths (Å)  0.017 0.013 0.010     Bond angles (º) 1.78 1.56 1.59 Favored/allowed/disallowed (%)+ 97.9, 2.1, 0.0 98.0, 2.0, 0.0 98.3, 1.7, 0.0 Data corresponds to diffraction from a single crystal for each structure.  *Highest resolution shell is shown in parenthesis.  +phenix.ramalyze; “allowed” is the percentage remaining after “favored” and “outlier” residues are subtracted.   All OXA-48 and CTX-M-15 derivative bound structures display clear and unambiguous Fo-Fc ligand omit map electron density corresponding to a C7-S70 O-γ linked carbamyl-enzyme intermediate (Figures C.1 and C.2), which is directly analogous to the carbamyl-avibactam complexes (115). An analysis of the overall binding conformation of the DBO core amongst the various derivative 	   92	  complexes reveals a striking resemblance to avibactam (Figures 5.1b-c). Additionally, these structures have a nearly identical juxtaposition of catalytic residues (Figures C.1 and C.2).     Figure 5.1 Inhibition of β-lactamases by avibactam derivatives. a, Chemical structures of avibactam derivatives used in this study. b, Overlay of avibactam derivatives covalently bound to the class A β-lactamase CTX-M-15 active site (rmsd= 0.2Å on all CA atoms). c, Overlay of carbamyl-avibactam derivatives bound to the class D  β-lactamase OXA-48 (rmsd= 0.1Å on all CA atoms). In (b) and (c), the CTX-M-15 and OXA-48 bound protein backbones are displayed as white cartoons with highlighted active site residues shown in stick representation with non-carbon atoms colored by type [N; blue, O; red, S; yellow]. Hydrogen bonding and electrostatic interactions are depicted as black dashes.   To evaluate the relative β-lactamase inhibitory activity of the FPI compounds, we kinetically characterized them as previously reported (97,100). For CTX-M-15, slightly reduced on-rates were observed, likely a consequence of carboxamide modification leading to a lower affinity pre-covalent complex. However, off-rates were also lower, resulting in an overall balance in the dissociation constant (Kd) for these compounds (Table 5.3). The reduced off-rates are likely due in part to stabilization of the carbamyl-enzyme intermediate by hydrogen bonds between the various FPI C2 functional groups and conserved active site residues (Figures C.1d and C.1e).   	   93	  Table 5.3 Kinetic values for the carbamylation and decarbamylation of DBO compounds against CTX-M-15 and OXA-48.  The carbamylation and decarbamylation rates were measured using the colorimetric reporter substrate nitrocefin. The Kd values are calculated from the carbamylation and decarbamylation rates.  Enzyme Parameter Avibactam FPI-1465 FPI-1523 FPI-1602 CTX-M-15 On-rate k2/Ki (M-1s-1) 2.5 ± 0.1 x 105 1.3 ± 0.1 x 104 3.9 ± 0.1 x 104 1.1 ± 0.1 x 104  Off-rate koff (s-1) 5.4 ± 0.7 x 10-4 1.4 ± 0.1 x 10-4 1.6 ± 0.1 x 10-4 1.1 ± 0.1 x 10-4  Off-rate t1/2 (min) 22 ± 3 84 ± 6 72 ± 5 102 ± 5  Kd (µM) 0.002 0.011 0.004 0.010 OXA-48 On-rate k2/Ki (M-1s-1) 2.5 ± 0.2 x 103 1.0 ± 0.1 x 102 7.0 ± 0.2 x 102 2.0 ± 0.1 x 102  Off-rate koff (s-1) 7.7 ± 0.9 x 10-6 5.3 ± 0.3 x 10-4 2.4 ± 1 x 10-5 2.1 ± 0.2 x 10-5  Off-rate t1/2 (min) 1500 ± 200 22 ± 1 480 ± 80 560 ± 50  Kd (µM) 0.003 5.3 0.034 0.11  For OXA-48, all FPI derivatives displayed roughly an order of magnitude slower on-rates as well as faster off-rates, leading to significantly increased Kd values (Table 5.3).  In particular, the FPI-1465-OXA-48 carbamyl-enzyme displayed a very short half-life (off-rate t1/2 for avibactam vs. FPI-1465: 1500 ±200 min vs. 22 ±1 min). In the OXA-48 bound FPI co-crystal structures we observe numerous direct and water mediated hydrogen-bonds between the various C2 functional groups and conserved active site residues (Figures C.2d and C.2e). The observed higher Kd values may be due in part to an entropic cost associated with ordering the C2 side chain of the derivatives via these hydrogen bonds. Variation in avibactam inhibition efficacy with the class D β-lactamases has already been observed (97) and results here reinforce the need for studying inhibition of these emerging resistance determinants. 5.3.2    Diazabicyclooctane derivatives act as antimicrobial agents, and target E. coli PBP2 Previously, FPI-1465 displayed remarkable synergy in combination with β-lactams against MBL-expressing strains (205). Therefore, we used FPI-1465 as a model DBO compound, and assessed its ability to inhibit a panel of SBLs and MBLs in vitro (Figure C.3).  FPI-1465 displayed no inhibitory activity against MBLs, implying a different mechanism for synergy.  We next tested the minimum 	   94	  inhibitory concentration (MIC) of avibactam, FPI-1465, FPI-1523, and FPI-1602 against E. coli BW25113 pGDP-2 transformants either with empty vector or expressing different β-lactamases (197).  All compounds displayed consistently low MICs irrespective of β-lactamase expression (Table 5.4).  FPI-1602 demonstrated a remarkably low MIC value of < 0.5 µg/mL and was therefore selected for further MIC experiments against a panel of clinical isolates including a number of CRE, Acinetobacter baumannii, and P. aeruginosa.  FPI-1602 displayed marked antimicrobial activity against P. aeruginosa, E. coli, and Enterobacter spp. (Table 5.5).  The activity against P. aeruginosa is particularly interesting as a recent publication has described a similar compound (OP0595) that does not exhibit antimicrobial activity against P. aeruginosa (MIC > 32 µg/mL) (206). Table 5.4  Antimicrobial susceptibility patterns of E. coli BW25113 pGDP-2 transformants expressing β-lactamase.    MIC (µg/mL)   Antibiotic CTX-M-15 KPC-2 NDM-1 OXA-48 control Ampicillin 32 >512 >512 16 4 Avibactam 32 16 16 16 16 FPI-1465 4 4 2 2 2 FPI-1523 2 2 2 1 1 FPI-1602 <0.5 <0.5 <0.5 <0.5 <0.5  Table 5.5  Antimicrobial susceptibility patterns of NDM-1-positive clinical isolates to FPI-1602. Strain MIC (µg/mL) E. coli GN688 0.5 E. coli GN610 2 E. cloacae GN574 1 E. cloacae GN579 2 P. aeruginosa PAO1 2 E. cloacae GN687 8 K. oxytoca GN942 32 C. freundii GN978 64 A. baumanii >128 K. pneumoniae GN629 >128 K. pneumoniae GN529 >128 M. morganii GN575 >128 P. rettgeri GN570 >128 P. stuartii GN576 >128   	   95	   Serine β-lactamases and the PBP transpeptidases are thought to have evolved from a common ancestor, and both belong to the penicilloyl serine transferase superfamily and share common active site sequence motifs and an analogous reaction path that proceeds through formation of a covalent acyl-enzyme intermediate (207). Therefore, we hypothesized that the observed antimicrobial activity of the FPIs may be due to direct inhibition of PBPs in much the same way as β-lactams. We used the E. coli K-12 ASKA library, in which each open reading frame has been separately cloned into an overexpression vector (208) to assess the effect of PBP overexpression on MIC values of the derivatives. There was an eight-fold increase in the MIC for FPI-1602 against the PBP2 overexpressing strain (Table C.1), suggesting that the essential PBP2 is potentially the lethal target. Next, we performed gel-based competition assays to assess the relative ability of the derivatives to block binding of the fluorescent penicillin (BOCILLIN FL) to endogenously expressed E. coli PBPs using purified membrane extracts. All FPI derivatives tested displayed preferential inhibition of PBP2 in these in vitro binding assays (Figures 5.2a and C.4). BOCILLIN FL competition assays were then performed using purified E. coli PBPs (PBP1a, PBP1b, PBP2, and PBP3). The avibactam derivatives specifically inhibit binding of BOCILLIN FL to purified E. coli PBP2 (Table 5.6). The relative potency of PBP2 inhibition by the derivatives closely mirrors their MIC values against E. coli BW25113 pGDP-2 β-lactamase transformants (Table 5.4), with FPI-1523 and FPI-1602 displaying more potent inhibition (IC50 = 3.2 ± 0.4µM and 3.6 ± 0.3µM), than FPI-1465 and avibactam (IC50 = 14.8 ± 1.1µM and 63.2 ± 5.5µM, Table 5.6). In E. coli, PBP2 is intimately involved in cell elongation and consequently its inhibition leads to cell rounding and loss of rod-shaped growth, while inhibition of the cell division specific PBP3 leads to long chains of filamentous cells unable to form septa (209).  Microscopy studies performed on cells treated with sub-MIC concentrations of mecillinam (PBP2 targeting), and ceftazidime (PBP3 targeting) confirmed the expected cell morphology phenotypes (Figure 5.2b). All FPI derivatives exactly phenocopied the cell rounding effects of mecillinam, further supporting the notion that PBP2 is the cellular target of these compounds (Figures 5.2b and C.5). Furthermore, we observed synergy (all 	   96	  fractional inhibitory concentrations < 0.4) when aztreonam (PBP3 targeting) was used in combination with FPI-1602 against isogenic β-lactamase-expressing strains of E. coli (Figure 5.2c).  Figure 5.2 PBP2 is the primary cellular target of avibactam derivatives in E. coli. (a)  E. coli PBP banding profile and PBP binding competition assay for compound FPI-1465. The banding profile was generated using BOCILLIN FL and compound FPI-1465 was used at increasing concentrations during the assay. (b) Brightfield microscopy images of E. coli, treated with known antibiotics (ceftazidime, mecillinam, avibactam), alongside FPI compounds.  Samples are negatively stained with 1.5% nigrosin, depicting morphological defects associated with drug treatments.  Avibactam and its derivatives morphologically phenocopy mecillinam.  Stars indicate statistical correlation (P < 0.01), with a full Pearson correlation map presented in Figure C5.  (c)  Microdilution checkerboard analysis demonstrates antimicrobial synergy between aztreonam and FPI-1602 against E. coli expressing clinically relevant β-lactamases from class A (CTX-M-15), B (NDM-1), and D (OXA-48).  (d) Active site close-up of carbamyl-FPI-1465-E. coli PBP1b co-crystal structure. The bound protein backbone is displayed as a blue cartoon with key active site residues shown in stick representation with non-carbon atoms colored by type. Selected hydrogen bonds and electrostatic interactions are depicted as black dashes.    	   97	  Table 5.6  Gel based BOCILLIN FL competition assaysa.     IC50b (µM)  Antibiotic PBP2 PBP1b PBP1a PBP3 Avibactam  63.2 ± 5.5 NI NI NI FPI-1465 14.8 ± 1.1 NI NI NI FPI-1523 3.2 ± 0.4 NI NI NI FPI-1602 3.6 ± 0.3 NI NI NI Benzyl penicillin 318.1 ± 32.3 161.72 ± 8.6 196.9 ± 26.3  35.5 ± 3.27 Mecillinam 0.3 ± 0.1 NI NI NI Kanamycin NI NI NI NI  a The avibactam derivatives were analyzed for the ability to inhibit binding of BOCILLIN FL to purified E. coli PBPs. BOCILLIN FL and competitor compound were added at the same time to start the reaction.  NI, no observable inhibition up to 2000 µM competitor compound.  b IC50 values are taken as averages from three separate experiments and represent the concentration of unlabeled compound required to reduce the residual binding of BOCILLIN FL by 50%  Pre-incubation of FPI-1602 with E. coli PBP1b prior to addition of BOCILLIN FL resulted in a concentration dependent inhibition of BOCILLIN FL binding (Figure C.6), indicating that at high concentrations the derivatives can act as slow binding inhibitors of PBP1b. Therefore, due to difficulties in crystallizing E. coli PBP2, we reasoned that co-crystallization of E. coli PBP1b with the avibactam derivatives would lend insight into the structural basis of PBP inhibition by these compounds. The co-crystal structure of the single pass bitopic membrane protein E. coli PBP1b covalently inhibited by FPI-1465 was solved to 2.85Å resolution in spacegroup P22121 with a single protein monomer in the ASU (for ligand electron density maps and crystallographic data statistics see Figure C.7, and Table 5.7). The overall orientation of FPI-1465 in the PBP1b active site is directly analogous to the carbamyl-SBL bound complexes (Figures 5.2d and 5.1b-c). The FPI-1465 N6 sulfate projects toward the conserved motif iii and makes hydrogen bonding contacts with the O-γ of T699 and T701. Also, the FPI-1465 C7 carbonyl oxygen occupies the canonical oxyanion hole constituted by the backbone amides of T701 and S510. Finally, the C2 side chain projects away from the catalytic core and the C2 pyrrolidine heterocyclic nitrogen forms a hydrogen bond with the N703 backbone amide 	   98	  nitrogen (2.9Å) (Figure 5.2d). This data demonstrates the ability of avibactam derivatives to interact directly with the conserved active site motifs of PBPs, and provides a molecular basis for future structure-based drug design efforts.  Table 5.7 Data collection and refinement statistics for FPI-1465-E. coli PBP1b co-crystal structure.  FPI-1465 Data collection  Space group P22121 Cell dimensions        a, b, c (Å) 62.48, 63.22, 293.9     α, β, γ  (°)  90, 90, 90 Resolution (Å) 63.22-2.85(2.93-2.85) Rmerge 0.040(0.238) I/σI 23.4(4.0) Completeness (%) 95.1(90.7) Redundancy 3.9(2.5)   Refinement  Resolution (Å) 63.22-2.85 No. reflections 26383(1797) Rwork/ Rfree 29.0/23.7 No. atoms      Protein 5461     Moenomycin 77      FPI-1465 23     Water 59 B-factors (Å2)      Protein 63.6     Moenomycin 109.5     FPI-1465 87.0     Water 36.2 R.m.s deviations      Bond lengths (Å)  0.013     Bond angles (º) 1.65 Favored/allowed/disallowed (%)+ 93.9, 6.0, 0.1 Data corresponds to diffraction from a single crystal for each structure.  *Highest resolution shell is shown in parenthesis.  +phenix.ramalyze; “allowed” is the percentage remaining after “favoured” and “outlier” residues are subtracted.  	   99	  In the FPI-1465-E. coli PBP1b crystal structure, the N6 nitrogen is 4.4Å from the S572 O-γ (Figure 5.2d). In contrast, in the FPI-1465 bound CTX-M-15 and OXA-48 structures, the N6 nitrogen is much closer to the equivalent motif II serine O-γ  (3.3Å, and 3.0Å Figure 5.1b-c). The motif II serine has an essential role as the general acid for protonation of the β-lactam or DBO nitrogen leaving group upon formation of the acyl-enzyme covalent intermediate (115). Therefore, we propose that the relatively poor inhibition of E. coli PBP1b by the DBO’s is likely due in part to the suboptimal positioning of the general acid required for acylation. However, to fully elucidate the molecular details governing specificity, future structural investigations of the DBO’s in complex with E. coli PBP2 are required.  The demonstration that avibactam derivatives are potent antibiotics as well as β-lactamase inhibitors has far-reaching clinical implications.  Early DBOs were considered to be poor antibiotics, and were therefore pursued as β-lactamase inhibitors and this mindset has continued with the development of avibactam (210).  However, there is now significant pharmaceutical investment in this scaffold and it is crucial that any drug development efforts acknowledge their potent antimicrobial activity.  We also note the potential for aztreonam combination therapy to be effective against Enterobacteriaceae and other clinical pathogens expressing any given β-lactamase.                 	   100	  6 Conclusions and Future Directions 6.1 Summary of Significance of Results The main goal of this thesis investigation was to gain structural insights into emerging β-lactamase mediated β-lactam resistance, and to gain detailed insights into β-lactamase inhibition. To this end, the structural and biochemical properties of β-lactamases of the molecular classes A, B, and D were investigated. These studies have shed light on the broad-spectrum substrate profile of the New Delhi metallo-β-lactamase-1 (NDM-1). A detailed structural and kinetic analysis of the class A, and D β-lactamases in complex with avibactam reveals its molecular mechanism of inhibition and provides valuable information for structure based-drug design efforts. Furthermore, the characterization of diazabicyclooctane derivatives as potent antibiotics and SBL inhibitors opens up new potential avenues for treating multi-drug resistant Gram-negative infections (including MBL positive Enterobacteriaceae and Pseudomonads).  NDM-1 confers enteric pathogens such as E. coli and K. pneumoniae with nearly complete resistance to all β-lactams, with the exception of aztreonam. The structural and biochemical characterization of NDM-1 revealed that it adopts the canonical MBL fold that facilitates a two zinc catalyzed mechanism of β-lactam antibiotic hydrolysis. However, NDM-1 displays a large active site and an electrostatic profile that can accommodate a wide variety of substrate molecules. The crystal structure of NDM-1 bound to meropenem shows for the first time the molecular details of how carbapenem antibiotics are recognized by di-zinc containing MBLs. Additionally, product complex structures of hydrolyzed benzylpenicillin, methicillin and oxacillin bound NDM-1 were solved to 1.8Å, 1.2Å and 1.2Å and represent the highest resolution structural data of any MBL to date. Finally, the crystal structure of NDM-1 bound to the competitive inhibitor L-captopril reveals inhibition by sulfhydryl mediated zinc intercalation. Taken together, these structural investigations of NDM-1 help provide a molecular basis for its broad-spectrum antibiotic resistance, and represent a valuable step in 	   101	  the informed design of novel MBL inhibitors. SBLs represent a serious and ongoing clinical threat to the most commonly prescribed class of human antibacterials, the β-lactams. The combination of β-lactams with β-lactamase inhibitors has historically been a successful strategy for overcoming this resistance. However, many pathogens harboring extended-spectrum β-lactamases are now impervious to the activity of these inhibitors. Among the most promising candidates to restore the clinical utility of the β-lactams against these bacteria is the novel SBL inhibitor avibactam, which was recently approved by the U.S. FDA in combination with ceftazidime (Avicaz) for the treatment of complicated urinary-tract and intra-abdominal infections.  Avibactam binds to the three major classes of SBLs (Class A, C and D) in an overall similar fashion. However, subtle differences in active site hydrogen bonding networks and electrostatic interactions lead to substantial discrepancies in carbamylation rates both between and within these enzyme subclasses. Using CTX-M-15 as a model enzyme we perform kinetic assays on key active site mutants to show that the motif ii serine is the likely base required for avibactam’s characteristic re-cyclization. The crystal structures of OXA-48 and OXA-10 bound to avibactam highlights key binding features that should help to guide prospective synthetic efforts targeted at inhibition of the class D SBLs. Furthermore, we show that diazabicyclooctane avibactam derivatives retain β-lactamase inhibitory properties but also exhibit considerable antimicrobial activity against clinically relevant bacteria. Furthermore, we identify PBP2 as the likely antibiotic target for these derivatives in E. coli. The crystal structure of FPI-1465 bound to E. coli PBP1b demonstrates the ability of avibactam derivatives to interact directly with the conserved active site motifs of PBPs. Our results provide evidence that structure-activity relationship studies for the purposes of drug discovery must consider both β-lactamases and penicillin-binding proteins as targets.    	   102	  6.2 Future Directions Despite the biochemical and structural data presented in this thesis, there is much to learn about β-lactamase mediated resistance and inhibition. For NDM-1, there remains an urgent need to develop potent inhibitors that can be used clinically to potentiate the activity of β-lactams. Research is ongoing to develop direct competitive inhibitors of NDM-1 based on the L-captopril bound NDM-1 crystal structure. In collaboration with Dr. David Baker at the University of Washington, we are utilizing the L-captopril molecule as a starting point (D-Cys-L-Pro) to computationally design a series of 7-aa backbone cyclized mixed D/L peptide inhibitors. To test the computational designs, the established nitrocefin inhibition assays will be utilized.  Our initial sucrose density gradient analysis supports the proposition that NDM-1 may localize to the bacterial outer-membrane, and bioinformatics analysis suggests the presence of a lipoprotein signal peptide. In E. coli, the Lol pathway translocates outer-membrane destined proteins from the periplasmic face of the cytoplasmic membrane to the inner leaflet of the outer membrane (211).  In order to confirm the proposed outer-membrane localization of NDM-1 it would be necessary to show using liquid chromatography-mass spectrometry (212) that FL-NDM-1 is N-terminally linked to a diacylglyceryl moiety as predicted by its signal sequence. Furthermore, NDM-1 localization in live E. coli cells could be monitored using a confocal microscopy based approach to study GFP-tagged outer-membrane localized proteins in E. coli grown in saline solutions that allow for optical differentiation of the inner and outer-membranes, respectively (213). These localization experiments could then be repeated using a D+2/E+3 NDM-1 mutant to cause inner-membrane retention, as well as variants where the entire lipoprotein signal sequence is replaced with that of TEM-1, a soluble periplasmic β-lactamase. An ongoing debate in the MBL field regards the number of zinc ions required for catalysis. It has long been known that the class B1 and B3 enzymes have two zinc binding sites, whereas the class B2 MBLs are mono-zinc hydrolases. However, the contribution of the solvent exchangeable Zn2 ion to 	   103	  NDM-1 catalysis and its relative substrate dependent requirement remain largely unresolved. The NDM-1 bound hydrolyzed product complexes strongly suggest that Zn2 assists in stabilizing the nitrogen leaving group following lactam hydrolysis. However, a detailed kinetic analysis of NDM-1 Zn2 ligand mutants (C208S for example), against a panel of β-lactams would shed light on this issue and lend further experimental support to the crystallographic observations. Avibactam shows potential to address the therapeutic challenge put forth by class D SBLs. However, in the context of avibactam carbamylation for the class D enzymes it is currently unclear whether or not carboxylated-K73 is the general base responsible for S70 activation during carbamylation, and how this modification affects avibactam carbamylation rates. It is well established that for the class D enzymes, addition of bicarbonate increases K73 carboxylation and thereby increases nitrocefin hydrolysis rates (75). Therefore, using the established nitrocefin kinetic assay to study avibactam carbamylation/decarbamylation rates in the presence and absence of bicarbonate provides an approach to deciphering the role of carboxy-lysine in the avibactam reversible recyclization mechanism. Our data indicates that the likely target of the avibactam derivatives in E. coli is the essential cell-elongation associated PBP2. However, this initial finding should spark further cell-based and biophysical assays into the detailed antibiotic mechanism. To further support PG synthesis as the primary target of these derivatives, macromolecular synthesis studies using E. coli as a model organism should be performed to assess the diazabicyclooctanes relative inhibition of DNA, RNA, protein, and cell wall synthesis as previously described (214). To gain a more comprehensive kinetic understanding of inhibition it is necessary to develop a transpeptidation assay for E. coli PBP2. We are working to establish a TPase assay by detection of D-ala using the Amplex Red-based fluorescent assay described previously (215). This assay would enable a steady state kinetics analysis of E. coli PBP2 inhibition and thereby lay the foundation for more complete mechanistic insights into TPase inhibition by the diazabicyclooctanes. To fully elucidate the structural details governing the observed E. coli PBP2 	   104	  specificity, future crystallographic investigations of the derivatives in complex with PBP2 are required. This structural work may help facilitate the informed design of a new generation of inhibitors with further improved PBP2 inhibitory properties.  Our in vitro data suggests that avibactam derivatives act as potent antibacterial agents and β-lactamase inhibitors. However, these compounds await a thorough in vivo analysis to assess their therapeutic potential against multi-drug resistant Gram-negative bacterial infections. A CD-1 mouse infection model can be used to study the effects of the avibactam derivatives both alone and in combination with various β-lactam antibiotics on survival and bacterial load as has been described previously (108). In this infection model, the NDM-1 positive clinical isolate [K. pneumoniae N11-2218 (108)] can be utilized in order to assess the in vivo ability of these compounds to address the therapeutic challenge of MBL positive Gram-negative infections.  This thesis focused primarily on β-lactamase inhibition as a therapeutic approach toward reviving the activity of the β-lactams against formerly resistant bacteria. However, an alternative approach to overcome the rapid emergence of β-lactam resistance is to exploit new antibacterial targets altogether. PG synthesis regulatory factors represent potential therapeutic targets due to their central role in the growth and maintenance of the bacterial cell wall. Recently, the outer-membrane lipoprotein LpoB has been found essential for the in vivo function of the bifunctional peptidoglycan synthase PBP1b in Enterobacteriaceae (213,216). Furthermore, LpoB was shown to directly interact with the PBP1b UB2H domain and activate PBP1b catalyzed glycosyltransfer (217). To better understand its biological role, I recently published an article elucidating structural insights into LpoB (218). Sequence analysis combined with circular dichroism spectroscopy studies suggest that LpoB has a disordered proline-rich N-terminal region, followed by a globular C-terminal domain, which was structurally investigated by X-ray crystallography. We suggest that the proline-rich N-terminal region of LpoB facilitates the stretching required to traverse the periplasmic space and contact its PBP1b binding 	   105	  partner located in the inner membrane.  The structural elucidation of the LpoB protein sets the stage for further structure-function characterization of the PBP1b-LpoB complex. Recently, Egan and colleagues have used NMR chemical shift perturbation data to map a putative LpoB-PBP1b UB2H binding interface (219). However, there are likely several cellular factors that effect LpoB-PBP1b complex formation and consequently peptidoglycan synthesis. Both binding partners are anchored to distinct biological membranes and thus have restricted diffusion, a factor that has been proposed in other systems to directly influence complex formation (220). Additional interactions by PBP1b, both to self in the observed dimeric oligomerization state of the enzyme as well as to a number of proposed cellular partners, including the cell-division-specific lipoprotein FtsN, the septal transpeptidase PBP3, the coordinator of septal PG synthesis CpoB (221), and the lytic transglycosylase MipA (222-224), are also important factors to consider in potential modulation of LpoB-PBP1b complex formation. Therefore, a detailed analysis of LpoB-PBP1b complex formation in the presence and absence of these potential accessory binding partners would be valuable. In the Strynadka lab, we routinely use biolayer interferometry to study such protein-protein interactions (225)  I have established cloning, expression, purification and crystallization of the PBP1b membrane protein. For LpoB-PBP1b complex crystallization experiments, it would be worthwhile creating a fusion construct in which full length LpoB (containing the N-terminal flexible linker) is fused to the C-terminus of PBP1b. This fusion construct would effectively tether the two binding partners and should help to promote complex formation for crystallographic purposes. Also, we are working to establish a bead proximity α-screen assay (226) using tagged versions of LpoB and PBP1b with the goal of developing a high throughput screen for small molecule inhibitors of the interaction. It is our hope that such an inhibitor may have therapeutic potential or be used as a chemical probe to study the complex in cells.  	   106	  Previously, it was suggested that the trans-envelope nature of the PBP1b-LpoB complex may serve to guide the synthase machinery along tracks oriented in the direction of pre-existing cables of PG (filigree) that constitute the sacculus (213). Total internal reflection fluorescence microscopy (TIRFM) experiments directed at studying GFP tagged MreB/PBP1b PG synthase patch motility in an LpoB knock-out would be informative in deciphering whether LpoB plays a defining role in directing the well-established patch motility patterns (227).                     	   107	  References 1. Lovering, A. L., Safadi, S. S., and Strynadka, N. C. (2012) Structural perspective of peptidoglycan biosynthesis and assembly. Annu Rev Biochem 81, 451-478 2. Ikeda, M., Sato, T., Wachi, M., Jung, H. K., Ishino, F., Kobayashi, Y., and Matsuhashi, M. (1989) Structural similarity among Escherichia coli FtsW and RodA proteins and Bacillus subtilis SpoVE protein, which function in cell division, cell elongation, and spore formation, respectively. J Bacteriol 171, 6375-6378 3. Ruiz, N. (2008) Bioinformatics identification of MurJ (MviN) as the peptidoglycan lipid II flippase in Escherichia coli. Proc Natl Acad Sci U S A 105, 15553-15557 4. Mohammadi, T., van Dam, V., Sijbrandi, R., Vernet, T., Zapun, A., Bouhss, A., Diepeveen-de Bruin, M., Nguyen-Distèche, M., de Kruijff, B., and Breukink, E. (2011) Identification of FtsW as a transporter of lipid-linked cell wall precursors across the membrane. EMBO J 30, 1425-1432 5. Lovering, A. L., de Castro, L. H., Lim, D., and Strynadka, N. C. (2007) Structural insight into the transglycosylation step of bacterial cell-wall biosynthesis. Science 315, 1402-1405 6. Yuan, Y., Barrett, D., Zhang, Y., Kahne, D., Sliz, P., and Walker, S. (2007) Crystal structure of a peptidoglycan glycosyltransferase suggests a model for processive glycan chain synthesis. Proc Natl Acad Sci U S A 104, 5348-5353 7. Huang, C. Y., Shih, H. W., Lin, L. Y., Tien, Y. W., Cheng, T. J., Cheng, W. C., Wong, C. H., and Ma, C. (2012) Crystal structure of Staphylococcus aureus transglycosylase in complex with a lipid II analog and elucidation of peptidoglycan synthesis mechanism. Proc Natl Acad Sci U S A 109, 6496-6501 8. Sung, M. T., Lai, Y. T., Huang, C. Y., Chou, L. Y., Shih, H. W., Cheng, W. C., Wong, C. H., and Ma, C. (2009) Crystal structure of the membrane-bound bifunctional transglycosylase PBP1b from Escherichia coli. Proc Natl Acad Sci U S A 106, 8824-8829 9. Lovering, A. L., De Castro, L., and Strynadka, N. C. (2008) Identification of dynamic structural motifs involved in peptidoglycan glycosyltransfer. J Mol Biol 383, 167-177 10. Perlstein, D. L., Wang, T. S., Doud, E. H., Kahne, D., and Walker, S. (2010) The role of the substrate lipid in processive glycan polymerization by the peptidoglycan glycosyltransferases. J Am Chem Soc 132, 48-49 11. Helassa, N., Vollmer, W., Breukink, E., Vernet, T., and Zapun, A. (2012) The membrane anchor of penicillin-binding protein PBP2a from Streptococcus pneumoniae influences peptidoglycan chain length. FEBS J 279, 2071-2081 12. Horne, G., and Wilson, F. X. (2011) Therapeutic applications of iminosugars: current perspectives and future opportunities. Prog Med Chem 50, 135-176 13. Gampe, C. M., Tsukamoto, H., Doud, E. H., Walker, S., and Kahne, D. (2013) Tuning the moenomycin pharmacophore to enable discovery of bacterial cell wall synthesis inhibitors. J Am Chem Soc 135, 3776-3779 14. Dumbre, S., Derouaux, A., Lescrinier, E., Piette, A., Joris, B., Terrak, M., and Herdewijn, P. (2012) Synthesis of modified peptidoglycan precursor analogues for the inhibition of glycosyltransferase. J Am Chem Soc 134, 9343-9351 15. Zuegg, J., Muldoon, C., Adamson, G., McKeveney, D., Le Thanh, G., Premraj, R., Becker, B., Cheng, M., Elliott, A. G., Huang, J. X., Butler, M. S., Bajaj, M., Seifert, J., Singh, L., Galley, N. F., Roper, D. I., Lloyd, A. J., Dowson, C. G., Cheng, T. J., Cheng, W. C., Demon, D., Meyer, E., Meutermans, W., and Cooper, M. A. (2015) Carbohydrate scaffolds as glycosyltransferase inhibitors with in vivo antibacterial activity. Nat Commun 6, 7719 16. Terrak, M., Ghosh, T. K., van Heijenoort, J., Van Beeumen, J., Lampilas, M., Aszodi, J., Ayala, J. A., Ghuysen, J. M., and Nguyen-Distèche, M. (1999) The catalytic, glycosyl transferase and acyl transferase modules of the cell wall peptidoglycan-polymerizing penicillin-binding protein 1b of Escherichia coli. Mol Microbiol 34, 350-364 17. Born, P., Breukink, E., and Vollmer, W. (2006) In vitro synthesis of cross-linked murein and its attachment to sacculi by PBP1A from Escherichia coli. J Biol Chem 281, 26985-26993 18. Typas, A., Banzhaf, M., Gross, C. A., and Vollmer, W. (2012) From the regulation of peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol 10, 123-136 19. Sauvage, E., Duez, C., Herman, R., Kerff, F., Petrella, S., Anderson, J. W., Adediran, S. A., Pratt, R. F., Frère, J. M., and Charlier, P. (2007) Crystal structure of the Bacillus subtilis penicillin-binding protein 4a, and its complex with a peptidoglycan mimetic peptide. J Mol Biol 371, 528-539 20. Duguid, J. P. (1946) The sensitivity of bacteria to the action of penicillin. Edinb Med J 53, 401-412 21. Waxman, D. J., and Strominger, J. L. (1983) Penicillin-binding proteins and the mechanism of action of beta-lactam antibiotics. Annu Rev Biochem 52, 825-869 22. Wise, E. M., and Park, J. T. (1965) Penicillin: its basic site of action as an inhibitor of a peptide cross-linking reaction in cell wall mucopeptide synthesis. Proc Natl Acad Sci U S A 54, 75-81 23. Tipper, D. J., and Strominger, J. L. (1965) Mechanism of action of penicillins: a proposal based on their structural similarity to acyl-D-alanyl-D-alanine. Proc Natl Acad Sci U S A 54, 1133-1141 	   108	  24. Sauvage, E., Kerff, F., Terrak, M., Ayala, J. A., and Charlier, P. (2008) The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis. FEMS Microbiol Rev 32, 234-258 25. Macheboeuf, P., Contreras-Martel, C., Job, V., Dideberg, O., and Dessen, A. (2006) Penicillin binding proteins: key players in bacterial cell cycle and drug resistance processes. FEMS Microbiol Rev 30, 673-691 26. Cho, H., Uehara, T., and Bernhardt, T. G. (2014) Beta-lactam antibiotics induce a lethal malfunctioning of the bacterial cell wall synthesis machinery. Cell 159, 1300-1311 27. Yao, Z., Kahne, D., and Kishony, R. (2012) Distinct single-cell morphological dynamics under beta-lactam antibiotics. Mol Cell 48, 705-712 28. Keefer, C. S., Blake, F. G., Marshall, E. K., Lockwood, J. S., and Wood, W. B. (1943) Penicillin in the Treatment of Infections. The Journal of the American Medical Association 130, 1053 29. Miller, E. L. (2002) The penicillins: a review and update. J Midwifery Womens Health 47, 426-434 30. Rolinson, G. N., and Geddes, A. M. (2007) The 50th anniversary of the discovery of 6-aminopenicillanic acid (6-APA). Int J Antimicrob Agents 29, 3-8 31. Neu, H. C. (1982) The new beta-lactamase-stable cephalosporins. Ann Intern Med 97, 408-419 32. Page, M.G.P. (2012) Beta-lactam antibiotics. Antibiotic Discovery and Development, 79-117 33. Bush, K., and Macielag, M. J. (2010) New β-lactam antibiotics and β-lactamase inhibitors. Expert Opin Ther Pat 20, 1277-1293 34. Birnbaum, J., Kahan, F. M., Kropp, H., and MacDonald, J. S. (1985) Carbapenems, a new class of beta-lactam antibiotics. Discovery and development of imipenem/cilastatin. Am J Med 78, 3-21 35. Maveyraud, L., Mourey, L., Kotra, L.P. (1998) Structural basis for clinical longevity of carbapenem antibiotics in the face of challenge by the common class A β-lactamases from the antibiotic-resistant bacteria. J. Amer. Chem. Soc. 120, 9748-9752 36. Papp-Wallace, K. M., Endimiani, A., Taracila, M. A., and Bonomo, R. A. (2011) Carbapenems: past, present, and future. Antimicrob Agents Chemother 55, 4943-4960 37. Queenan, A. M., Shang, W., Flamm, R., and Bush, K. (2010) Hydrolysis and inhibition profiles of beta-lactamases from molecular classes A to D with doripenem, imipenem, and meropenem. Antimicrob Agents Chemother 54, 565-569 38. Bonfiglio, G., Russo, G., and Nicoletti, G. (2002) Recent developments in carbapenems. Expert Opin Investig Drugs 11, 529-544 39. Finberg, R.W., Guharoy, R. (2012) Monobactams. Clinical Use of Anti-infective Agents, 37-39 40. Westley-Horton, E., and Koestner, J. A. (1991) Aztreonam: a review of the first monobactam. Am J Med Sci 302, 46-49 41. Ellis-Grosse, E. J., Babinchak, T., Dartois, N., Rose, G., Loh, E., Group, T. c. S., and Group, T. c. S. (2005) The efficacy and safety of tigecycline in the treatment of skin and skin-structure infections: results of 2 double-blind phase 3 comparison studies with vancomycin-aztreonam. Clin Infect Dis 41 Suppl 5, S341-353 42. King, D. T., and Strynadka, N. C. (2013) Targeting metallo-β-lactamase enzymes in antibiotic resistance. Future Med Chem 5, 1243-1263 43. Abraham, E. P., and Chain, E. (1988) An enzyme from bacteria able to destroy penicillin. 1940. Rev Infect Dis 10, 677-678 44. Page, M. G. (2000) β-Lactamase inhibitors. Drug Resist Updat 3, 109-125 45. Lambert, P. A. (2005) Bacterial resistance to antibiotics: modified target sites. Adv Drug Deliv Rev 57, 1471-1485 46. Chambers, H. F., and Deleo, F. R. (2009) Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol 7, 629-641 47. Arias, C. A., and Murray, B. E. (2012) The rise of the Enterococcus: beyond vancomycin resistance. Nat Rev Microbiol 10, 266-278 48. Marquez, B. (2005) Bacterial efflux systems and efflux pumps inhibitors. Biochimie 87, 1137-1147 49. Pagès, J. M., James, C. E., and Winterhalter, M. (2008) The porin and the permeating antibiotic: a selective diffusion barrier in Gram-negative bacteria. Nat Rev Microbiol 6, 893-903 50. Novais, A., Comas, I., Baquero, F., Cantón, R., Coque, T. M., Moya, A., González-Candelas, F., and Galán, J. C. (2010) Evolutionary trajectories of beta-lactamase CTX-M-1 cluster enzymes: predicting antibiotic resistance. PLoS Pathog 6, e1000735 51. D'Costa, V. M., Griffiths, E., and Wright, G. D. (2007) Expanding the soil antibiotic resistome: exploring environmental diversity. Curr Opin Microbiol 10, 481-489 52. Hall, R. M., and Collis, C. M. (1998) Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat 1, 109-119 53. Stokes, H. W., and Gillings, M. R. (2011) Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into Gram-negative pathogens. FEMS Microbiol Rev 35, 790-819 54. Bush, K. (2013) Proliferation and significance of clinically relevant β-lactamases. Ann N Y Acad Sci 1277, 84-90 	   109	  55. Bush, K. (2012) Evolution of beta-lactamases: past, present, and future. Antibiotic Discovery and Development, 427-453 56. Turner, P. J. (2005) Extended-spectrum beta-lactamases. Clin Infect Dis 41 Suppl 4, S273-275 57. Delmas, J., Leyssene, D., Dubois, D., Birck, C., Vazeille, E., Robin, F., and Bonnet, R. (2010) Structural insights into substrate recognition and product expulsion in CTX-M enzymes. J Mol Biol 400, 108-120 58. Shaikh, S., Fatima, J., Shakil, S., Rizvi, S. M., and Kamal, M. A. (2015) Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi J Biol Sci 22, 90-101 59. Nordmann, P., Cuzon, G., and Naas, T. (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9, 228-236 60. Swarén, P., Maveyraud, L., Guillet, V., Masson, J. M., Mourey, L., and Samama, J. P. (1995) Electrostatic analysis of TEM1 beta-lactamase: effect of substrate binding, steep potential gradients and consequences of site-directed mutations. Structure 3, 603-613 61. Strynadka, N. C., Adachi, H., Jensen, S. E., Johns, K., Sielecki, A., Betzel, C., Sutoh, K., and James, M. N. (1992) Molecular structure of the acyl-enzyme intermediate in beta-lactam hydrolysis at 1.7 A resolution. Nature 359, 700-705 62. Hermann, J. C., Hensen, C., Ridder, L., Mulholland, A. J., and Höltje, H. D. (2005) Mechanisms of antibiotic resistance: QM/MM modeling of the acylation reaction of a class A beta-lactamase with benzylpenicillin. J Am Chem Soc 127, 4454-4465 63. Strynadka, N. C., Martin, R., Jensen, S. E., Gold, M., and Jones, J. B. (1996) Structure-based design of a potent transition state analogue for TEM-1 beta-lactamase. Nat Struct Biol 3, 688-695 64. Damblon, C., Raquet, X., Lian, L. Y., Lamotte-Brasseur, J., Fonze, E., Charlier, P., Roberts, G. C., and Frère, J. M. (1996) The catalytic mechanism of beta-lactamases: NMR titration of an active-site lysine residue of the TEM-1 enzyme. Proc Natl Acad Sci U S A 93, 1747-1752 65. Jacoby, G. A. (2009) AmpC beta-lactamases. Clin Microbiol Rev 22, 161-182 66. Philippon, A., Arlet, G., and Jacoby, G. A. (2002) Plasmid-determined AmpC-type beta-lactamases. Antimicrob Agents Chemother 46, 1-11 67. Fenollar-Ferrer, C., Frau, J., Donoso, J., Munoz, F. (2008) Evolution of class C β-lactamases: factors influencing their hydrolysis and recognition mechanisms. Theor Chem Accounts 121, 209-218 68. Majiduddin, F. K., Materon, I. C., and Palzkill, T. G. (2002) Molecular analysis of beta-lactamase structure and function. Int J Med Microbiol 292, 127-137 69. Poirel, L., Potron, A., and Nordmann, P. (2012) OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother 67, 1597-1606 70. Potron, A., Poirel, L., Rondinaud, E., and Nordmann, P. (2013) Intercontinental spread of OXA-48 beta-lactamase-producing Enterobacteriaceae over a 11-year period, 2001 to 2011. Euro Surveill 18 71. Paetzel, M., Danel, F., de Castro, L., Mosimann, S. C., Page, M. G., and Strynadka, N. C. (2000) Crystal structure of the class D beta-lactamase OXA-10. Nat Struct Biol 7, 918-925 72. Vercheval, L., Bauvois, C., di Paolo, A., Borel, F., Ferrer, J. L., Sauvage, E., Matagne, A., Frère, J. M., Charlier, P., Galleni, M., and Kerff, F. (2010) Three factors that modulate the activity of class D β-lactamases and interfere with the post-translational carboxylation of Lys70. Biochem J 432, 495-504 73. Szarecka, A., Lesnock, K. R., Ramirez-Mondragon, C. A., Nicholas, H. B., and Wymore, T. (2011) The Class D beta-lactamase family: residues governing the maintenance and diversity of function. Protein Eng Des Sel 24, 801-809 74. Docquier, J. D., Calderone, V., De Luca, F., Benvenuti, M., Giuliani, F., Bellucci, L., Tafi, A., Nordmann, P., Botta, M., Rossolini, G. M., and Mangani, S. (2009) Crystal structure of the OXA-48 beta-lactamase reveals mechanistic diversity among class D carbapenemases. Chem Biol 16, 540-547 75. Golemi, D., Maveyraud, L., Vakulenko, S., Samama, J. P., and Mobashery, S. (2001) Critical involvement of a carbamylated lysine in catalytic function of class D beta-lactamases. Proc Natl Acad Sci U S A 98, 14280-14285 76. Sabath, L. D., and Abraham, E. P. (1966) Zinc as a cofactor for cephalosporinase from Bacillus cereus 569. Biochem J 98, 11C-13C 77. Bebrone, C. (2007) Metallo-beta-lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily. Biochem Pharmacol 74, 1686-1701 78. Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. (2005) Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev 18, 306-325 79. Yong, D., Toleman, M. A., Giske, C. G., Cho, H. S., Sundman, K., Lee, K., and Walsh, T. R. (2009) Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53, 5046-5054 	   110	  80. Zhou, G., Guo, S., Luo, Y., Ye, L., Song, Y., Sun, G., Guo, L., Chen, Y., Han, L., and Yang, J. (2014) NDM-1-producing strains, family Enterobacteriaceae, in hospital, Beijing, China. Emerg Infect Dis 20, 340-342 81. Pesesky, M. W., Hussain, T., Wallace, M., Wang, B., Andleeb, S., Burnham, C. A., and Dantas, G. (2015) KPC and NDM-1 genes in related Enterobacteriaceae strains and plasmids from Pakistan and the United States. Emerg Infect Dis 21, 1034-1037 82. Nordmann, P., Poirel, L., Walsh, T. R., and Livermore, D. M. (2011) The emerging NDM carbapenemases. Trends Microbiol 19, 588-595 83. de Seny, D., Heinz, U., Wommer, S., Kiefer, M., Meyer-Klaucke, W., Galleni, M., Frere, J. M., Bauer, R., and Adolph, H. W. (2001) Metal ion binding and coordination geometry for wild type and mutants of metallo-beta -lactamase from Bacillus cereus 569/H/9 (BcII): a combined thermodynamic, kinetic, and spectroscopic approach. J Biol Chem 276, 45065-45078 84. Bebrone, C., Delbrück, H., Kupper, M. B., Schlömer, P., Willmann, C., Frère, J. M., Fischer, R., Galleni, M., and Hoffmann, K. M. (2009) The structure of the dizinc subclass B2 metallo-beta-lactamase CphA reveals that the second inhibitory zinc ion binds in the histidine site. Antimicrob Agents Chemother 53, 4464-4471 85. Hernandez Valladares, M., Felici, A., Weber, G., Adolph, H. W., Zeppezauer, M., Rossolini, G. M., Amicosante, G., Frère, J. M., and Galleni, M. (1997) Zn(II) dependence of the Aeromonas hydrophila AE036 metallo-beta-lactamase activity and stability. Biochemistry 36, 11534-11541 86. García-Sáez, I., Mercuri, P. S., Papamicael, C., Kahn, R., Frère, J. M., Galleni, M., Rossolini, G. M., and Dideberg, O. (2003) Three-dimensional structure of FEZ-1, a monomeric subclass B3 metallo-beta-lactamase from Fluoribacter gormanii, in native form and in complex with D-captopril. J Mol Biol 325, 651-660 87. Xu, D., Xie, D., and Guo, H. (2006) Catalytic mechanism of class B2 metallo-beta-lactamase. J Biol Chem 281, 8740-8747 88. Dal Peraro, M., Vila, A. J., Carloni, P., and Klein, M. L. (2007) Role of zinc content on the catalytic efficiency of B1 metallo beta-lactamases. J Am Chem Soc 129, 2808-2816 89. González, J. M., Meini, M. R., Tomatis, P. E., Medrano Martín, F. J., Cricco, J. A., and Vila, A. J. (2012) Metallo-β-lactamases withstand low Zn(II) conditions by tuning metal-ligand interactions. Nat Chem Biol 8, 698-700 90. Wang, Z., Fast, W., Valentine, A. M., and Benkovic, S. J. (1999) Metallo-beta-lactamase: structure and mechanism. Curr Opin Chem Biol 3, 614-622 91. Page, M. I., and Badarau, A. (2008) The mechanisms of catalysis by metallo beta-lactamases. Bioinorg Chem Appl, 576297 92. Papp-Wallace, K. M., Bethel, C. R., Gootz, T. D., Shang, W., Stroh, J., Lau, W., McLeod, D., Price, L., Marfat, A., Distler, A., Drawz, S. M., Chen, H., Harry, E., Nottingham, M., Carey, P. R., Buynak, J. D., and Bonomo, R. A. (2012) Inactivation of a class A and a class C β-lactamase by 6β-(hydroxymethyl)penicillanic acid sulfone. Biochem Pharmacol 83, 462-471 93. Drawz, S. M., Papp-Wallace, K. M., and Bonomo, R. A. (2014) New β-lactamase inhibitors: a therapeutic renaissance in an MDR world. Antimicrob Agents Chemother 58, 1835-1846 94. Bebrone, C., Lassaux, P., Vercheval, L., Sohier, J. S., Jehaes, A., Sauvage, E., and Galleni, M. (2010) Current challenges in antimicrobial chemotherapy: focus on ß-lactamase inhibition. Drugs 70, 651-679 95. Shlaes, D. M. (2013) New β-lactam-β-lactamase inhibitor combinations in clinical development. Ann N Y Acad Sci 1277, 105-114 96. Livermore, D. M., and Mushtaq, S. (2013) Activity of biapenem (RPX2003) combined with the boronate β-lactamase inhibitor RPX7009 against carbapenem-resistant Enterobacteriaceae. J Antimicrob Chemother 68, 1825-1831 97. Ehmann, D. E., Jahic, H., Ross, P. L., Gu, R. F., Hu, J., Durand-Réville, T. F., Lahiri, S., Thresher, J., Livchak, S., Gao, N., Palmer, T., Walkup, G. K., and Fisher, S. L. (2013) Kinetics of avibactam inhibition against Class A, C, and D β-lactamases. J Biol Chem 288, 27960-27971 98. Lagacé-Wiens, P., Walkty, A., and Karlowsky, J. A. (2014) Ceftazidime-avibactam: an evidence-based review of its pharmacology and potential use in the treatment of Gram-negative bacterial infections. Core Evid 9, 13-25 99. Lahiri, S. D., Mangani, S., Durand-Reville, T., Benvenuti, M., De Luca, F., Sanyal, G., and Docquier, J. D. (2013) Structural insight into potent broad-spectrum inhibition with reversible recyclization mechanism: avibactam in complex with CTX-M-15 and Pseudomonas aeruginosa AmpC β-lactamases. Antimicrob Agents Chemother 57, 2496-2505 100. Ehmann, D. E., Jahić, H., Ross, P. L., Gu, R. F., Hu, J., Kern, G., Walkup, G. K., and Fisher, S. L. (2012) Avibactam is a covalent, reversible, non-β-lactam β-lactamase inhibitor. Proc Natl Acad Sci U S A 109, 11663-11668 101. Smoum, R., Rubinstein, A., Dembitsky, V. M., and Srebnik, M. (2012) Boron containing compounds as protease inhibitors. Chem Rev 112, 4156-4220 	   111	  102. Baker, S. J., Tomsho, J. W., and Benkovic, S. J. (2011) Boron-containing inhibitors of synthetases. Chem Soc Rev 40, 4279-4285 103. Ness, S., Martin, R., Kindler, A. M., Paetzel, M., Gold, M., Jensen, S. E., Jones, J. B., and Strynadka, N. C. (2000) Structure-based design guides the improved efficacy of deacylation transition state analogue inhibitors of TEM-1 beta-Lactamase(,). Biochemistry 39, 5312-5321 104. Yang, W., Gao, X., and Wang, B. (2003) Boronic acid compounds as potential pharmaceutical agents. Med Res Rev 23, 346-368 105. Livermore, D. M., Mushtaq, S., and Warner, M. (2010) Activity of BAL30376 (monobactam BAL19764 + BAL29880 + clavulanate) versus Gram-negative bacteria with characterized resistance mechanisms. J Antimicrob Chemother 65, 2382-2395 106. Page, M. G., Dantier, C., and Desarbre, E. (2010) In vitro properties of BAL30072, a novel siderophore sulfactam with activity against multiresistant gram-negative bacilli. Antimicrob Agents Chemother 54, 2291-2302 107. Crandon, J. L., and Nicolau, D. P. (2013) Human simulated studies of aztreonam and aztreonam-avibactam to evaluate activity against challenging gram-negative organisms, including metallo-β-lactamase producers. Antimicrob Agents Chemother 57, 3299-3306 108. King, A. M., Reid-Yu, S. A., Wang, W., King, D. T., Gianfranco, D. P., Strynadka, N. C., Walsh, T. R., Coombes, B. K., and Wright, G. D. (2014) Aspergillomarasmine A overcomes metallo-beta-lactamase antibiotic resistance. Nature 510, 503-506 109. Tan, Q., Ogawa, A. M., Raghoobar, S. L., Wisniewski, D., Colwell, L., Park, Y. W., Young, K., Hermes, J. D., Dininno, F. P., and Hammond, M. L. (2011) Thiophenyl oxime-derived phosphonates as nano-molar class C beta-lactamase inhibitors reducing MIC of imipenem against Pseudomonas aeruginosa and Acinetobacter baumannii. Bioorg Med Chem Lett 21, 4363-4365 110. Brem, J., van Berkel, S. S., Aik, W., Rydzik, A. M., Avison, M. B., Pettinati, I., Umland, K. D., Kawamura, A., Spencer, J., Claridge, T. D., McDonough, M. A., and Schofield, C. J. (2014) Rhodanine hydrolysis leads to potent thioenolate mediated metallo-β-lactamase inhibition. Nat Chem 6, 1084-1090 111. Drawz, S. M., Bethel, C. R., Doppalapudi, V. R., Sheri, A., Pagadala, S. R., Hujer, A. M., Skalweit, M. J., Anderson, V. E., Chen, S. G., Buynak, J. D., and Bonomo, R. A. (2010) Penicillin sulfone inhibitors of class D beta-lactamases. Antimicrob Agents Chemother 54, 1414-1424 112. Ehmann, D. E., Jahic, H., Ross, P. L., Gu, R. F., Hu, J., Durand-Reville, T. F., Lahiri, S., Thresher, J., Livchak, S., Gao, N., Palmer, T., Walkup, G. K., and Fisher, S. L. (2013) Kinetics of avibactam inhibition against Class A, C, and D beta-lactamases. The Journal of biological chemistry 288, 27960-27971 113. King, D., and Strynadka, N. (2011) Crystal structure of New Delhi metallo-β-lactamase reveals molecular basis for antibiotic resistance. Protein Sci 20, 1484-1491 114. King, D. T., Worrall, L. J., Gruninger, R., and Strynadka, N. C. (2012) New Delhi metallo-β-lactamase: structural insights into β-lactam recognition and inhibition. J Am Chem Soc 134, 11362-11365 115. King, D. T., King, A. M., Lal, S. M., Wright, G. D., and Strynadka, N. C. J. (2015) Molecular Mechanism of Avibactam-Mediated β-Lactamase Inhibition. ACS Infect. Dis 1, 175-184 116. Dalhoff, A., and Thomson, C. J. (2003) The art of fusion: from penams and cephems to penems. Chemotherapy 49, 105-120 117. Guignard, B., Entenza, J. M., and Moreillon, P. (2005) Beta-lactams against methicillin-resistant Staphylococcus aureus. Curr Opin Pharmacol 5, 479-489 118. Triboulet, S., Arthur, M., Mainardi, J. L., Veckerlé, C., Dubée, V., Nguekam-Moumi, A., Gutmann, L., Rice, L. B., and Hugonnet, J. E. (2011) Inactivation kinetics of a new target of beta-lactam antibiotics. J Biol Chem 286, 22777-22784 119. Livermore, D. (2007) The zeitgeist of resistance. J Antimicrob Chemother 60 Suppl 1, i59-61 120. Pitout, J. D., and Laupland, K. B. (2008) Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis 8, 159-166 121. Bush, K. (2010) Alarming β-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Curr Opin Microbiol 13, 558-564 122. Moellering, R. C. (2010) NDM-1--a cause for worldwide concern. N Engl J Med 363, 2377-2379 123. Walsh, T. R., Weeks, J., Livermore, D. M., and Toleman, M. A. (2011) Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 11, 355-362 124. Kumarasamy, K. K., Toleman, M. A., Walsh, T. R., Bagaria, J., Butt, F., Balakrishnan, R., Chaudhary, U., Doumith, M., Giske, C. G., Irfan, S., Krishnan, P., Kumar, A. V., Maharjan, S., Mushtaq, S., Noorie, T., Paterson, D. L., Pearson, A., Perry, C., Pike, R., Rao, B., Ray, U., Sarma, J. B., Sharma, M., Sheridan, E., Thirunarayan, M. A., Turton, J., Upadhyay, S., Warner, M., Welfare, W., Livermore, D. M., and Woodford, N. (2010) Emergence of 	   112	  a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis 10, 597-602 125. Lassaux, P., Traoré, D. A., Loisel, E., Favier, A., Docquier, J. D., Sohier, J. S., Laurent, C., Bebrone, C., Frère, J. M., Ferrer, J. L., and Galleni, M. (2011) Biochemical and structural characterization of the subclass B1 metallo-β-lactamase VIM-4. Antimicrob Agents Chemother 55, 1248-1255 126. Zhang, H., and Hao, Q. (2011) Crystal structure of NDM-1 reveals a common β-lactam hydrolysis mechanism. FASEB J 25, 2574-2582 127. Juncker, A. S., Willenbrock, H., Von Heijne, G., Brunak, S., Nielsen, H., and Krogh, A. (2003) Prediction of lipoprotein signal peptides in Gram-negative bacteria. Protein Sci 12, 1652-1662 128. van den Ent, F., and Löwe, J. (2006) RF cloning: a restriction-free method for inserting target genes into plasmids. J Biochem Biophys Methods 67, 67-74 129. Z, O., and W, M. (1997) Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymology 130. Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A., and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235-242 131. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C., and Read, R. J. (2007) Phaser crystallographic software. J Appl Crystallogr 40, 658-674 132. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501 133. Afonine, P. V., Grosse-Kunstleve, R. W., Chen, V. B., Headd, J. J., Moriarty, N. W., Richardson, J. S., Richardson, D. C., Urzhumtsev, A., Zwart, P. H., and Adams, P. D. (2010) phenix.model_vs_data: a high-level tool for the calculation of crystallographic model and data statistics. J Appl Crystallogr 43, 669-676 134. Schrödinger, L. The PyMOL Molecular Graphics System. Version 1.5.0.4 135. Baker, N. A., Sept, D., Joseph, S., Holst, M. J., and McCammon, J. A. (2001) Electrostatics of nanosystems: application to microtubules and the ribosome. Proc Natl Acad Sci U S A 98, 10037-10041 136. Matthews, B. W. (1968) Solvent content of protein crystals. J Mol Biol 33, 491-497 137. Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M. (1993) PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst. 26, 283-291 138. Concha, N. O., Rasmussen, B. A., Bush, K., and Herzberg, O. (1996) Crystal structure of the wide-spectrum binuclear zinc beta-lactamase from Bacteroides fragilis. Structure 4, 823-836 139. Masuda, K., Matsuyama, S., and Tokuda, H. (2002) Elucidation of the function of lipoprotein-sorting signals that determine membrane localization. Proc Natl Acad Sci U S A 99, 7390-7395 140. Garcia-Saez, I., Docquier, J. D., Rossolini, G. M., and Dideberg, O. (2008) The three-dimensional structure of VIM-2, a Zn-beta-lactamase from Pseudomonas aeruginosa in its reduced and oxidised form. J Mol Biol 375, 604-611 141. Gal-Mor, O., Gibson, D. L., Baluta, D., Vallance, B. A., and Finlay, B. B. (2008) A novel secretion pathway of Salmonella enterica acts as an antivirulence modulator during salmonellosis. PLoS Pathog 4, e1000036 142. Krissinel, E., and Henrick, K. (2007) Inference of macromolecular assemblies from crystalline state. J Mol Biol 372, 774-797 143. Viarre, V., Cascales, E., Ball, G., Michel, G. P., Filloux, A., and Voulhoux, R. (2009) HxcQ liposecretin is self-piloted to the outer membrane by its N-terminal lipid anchor. J Biol Chem 284, 33815-33823 144. Bootsma, H. J., Aerts, P. C., Posthuma, G., Harmsen, T., Verhoef, J., van Dijk, H., and Mooi, F. R. (1999) Moraxella (Branhamella) catarrhalis BRO beta-lactamase: a lipoprotein of gram-positive origin? J Bacteriol 181, 5090-5093 145. Siemann, S., Brewer, D., Clarke, A. J., Dmitrienko, G. I., Lajoie, G., and Viswanatha, T. (2002) IMP-1 metallo-beta-lactamase: effect of chelators and assessment of metal requirement by electrospray mass spectrometry. Biochim Biophys Acta 1571, 190-200 146. Dundas, J., Ouyang, Z., Tseng, J., Binkowski, A., Turpaz, Y., and Liang, J. (2006) CASTp: computed atlas of surface topography of proteins with structural and topographical mapping of functionally annotated residues. Nucleic Acids Res 34, W116-118 147. Laskowski, R. A. (2009) PDBsum new things. Nucleic Acids Res 37, D355-359 148. Murphy, T. A., Catto, L. E., Halford, S. E., Hadfield, A. T., Minor, W., Walsh, T. R., and Spencer, J. (2006) Crystal structure of Pseudomonas aeruginosa SPM-1 provides insights into variable zinc affinity of metallo-beta-lactamases. J Mol Biol 357, 890-903 149. Docquier, J. D., Lamotte-Brasseur, J., Galleni, M., Amicosante, G., Frère, J. M., and Rossolini, G. M. (2003) On functional and structural heterogeneity of VIM-type metallo-beta-lactamases. J Antimicrob Chemother 51, 257-266 	   113	  150. González, J. M., Medrano Martín, F. J., Costello, A. L., Tierney, D. L., and Vila, A. J. (2007) The Zn2 position in metallo-beta-lactamases is critical for activity: a study on chimeric metal sites on a conserved protein scaffold. J Mol Biol 373, 1141-1156 151. Materon, I. C., Beharry, Z., Huang, W., Perez, C., and Palzkill, T. (2004) Analysis of the context dependent sequence requirements of active site residues in the metallo-beta-lactamase IMP-1. J Mol Biol 344, 653-663 152. Drawz, S. M., and Bonomo, R. A. (2010) Three decades of beta-lactamase inhibitors. Clin Microbiol Rev 23, 160-201 153. García-Saez, I., Hopkins, J., Papamicael, C., Franceschini, N., Amicosante, G., Rossolini, G. M., Galleni, M., Frère, J. M., and Dideberg, O. (2003) The 1.5-A structure of Chryseobacterium meningosepticum zinc beta-lactamase in complex with the inhibitor, D-captopril. J Biol Chem 278, 23868-23873 154. Schneider, K. D., Karpen, M. E., Bonomo, R. A., Leonard, D. A., and Powers, R. A. (2009) The 1.4 A crystal structure of the class D beta-lactamase OXA-1 complexed with doripenem. Biochemistry 48, 11840-11847 155. McKenna, M. (2011) The enemy within. Sci Am 304, 46-53 156. Hsu, L. Y., and Koh, T. H. (2011) World Health Day 2011: combating antimicrobial resistance. Singapore Med J 52, 230-231 157. Battye, T. G., Kontogiannis, L., Johnson, O., Powell, H. R., and Leslie, A. G. (2011) iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 67, 271-281 158. Park, H., Brothers, E. N., and Merz, K. M. (2005) Hybrid QM/MM and DFT investigations of the catalytic mechanism and inhibition of the dinuclear zinc metallo-beta-lactamase CcrA from Bacteroides fragilis. J Am Chem Soc 127, 4232-4241 159. Yang, H., Aitha, M., Hetrick, A. M., Richmond, T. K., Tierney, D. L., and Crowder, M. W. (2012) Mechanistic and spectroscopic studies of metallo-β-lactamase NDM-1. Biochemistry 51, 3839-3847 160. Han, S., Zaniewski, R. P., Marr, E. S., Lacey, B. M., Tomaras, A. P., Evdokimov, A., Miller, J. R., and Shanmugasundaram, V. (2010) Structural basis for effectiveness of siderophore-conjugated monocarbams against clinically relevant strains of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 107, 22002-22007 161. Auld, D. S. (2001) Zinc coordination sphere in biochemical zinc sites. Biometals 14, 271-313 162. Brown, N. G., Horton, L. B., Huang, W., Vongpunsawad, S., and Palzkill, T. (2011) Analysis of the functional contributions of Asn233 in metallo-β-lactamase IMP-1. Antimicrob Agents Chemother 55, 5696-5702 163. Antony, J., Gresh, N., Olsen, L., Hemmingsen, L., Schofield, C. J., and Bauer, R. (2002) Binding of D- and L-captopril inhibitors to metallo-beta-lactamase studied by polarizable molecular mechanics and quantum mechanics. J Comput Chem 23, 1281-1296 164. Bush, K. (2013) The ABCD's of β-lactamase nomenclature. J Infect Chemother 19, 549-559 165. Delmas, J., Chen, Y., Prati, F., Robin, F., Shoichet, B. K., and Bonnet, R. (2008) Structure and dynamics of CTX-M enzymes reveal insights into substrate accommodation by extended-spectrum beta-lactamases. J Mol Biol 375, 192-201 166. Helfand, M. S., Totir, M. A., Carey, M. P., Hujer, A. M., Bonomo, R. A., and Carey, P. R. (2003) Following the reactions of mechanism-based inhibitors with beta-lactamase by Raman crystallography. Biochemistry 42, 13386-13392 167. Cantón, R., Morosini, M. I., Martín, O., de la Maza, O. M., and de la Pedrosa, E. G. (2008) IRT and CMT beta-lactamases and inhibitor resistance. Clin Microbiol Infect 14 Suppl 1, 53-62 168. Coleman, K. (2011) Diazabicyclooctanes (DBOs): a potent new class of non-β-lactam β-lactamase inhibitors. Curr Opin Microbiol 14, 550-555 169. Xu, H., Hazra, S., and Blanchard, J. S. (2012) NXL104 irreversibly inhibits the β-lactamase from Mycobacterium tuberculosis. Biochemistry 51, 4551-4557 170. Lahiri, S. D., Mangani, S., Jahić, H., Benvenuti, M., Durand-Reville, T. F., De Luca, F., Ehmann, D. E., Rossolini, G. M., Alm, R. A., and Docquier, J. D. (2014) Molecular Basis of Selective Inhibition and Slow Reversibility of Avibactam against Class D Carbapenemases: A Structure-Guided Study of OXA-24 and OXA-48. ACS Chem Biol 10, 591-600 171. Poirel, L., Nordmann, P., Ducroz, S., Boulouis, H. J., Arné, P., and Millemann, Y. (2013) Extended-spectrum β-lactamase CTX-M-15-producing Klebsiella pneumoniae of sequence type ST274 in companion animals. Antimicrob Agents Chemother 57, 2372-2375 172. Antunes, N. T., Lamoureaux, T. L., Toth, M., Stewart, N. K., Frase, H., and Vakulenko, S. B. (2014) Class D β-lactamases: are they all carbapenemases? Antimicrob Agents Chemother 58, 2119-2125 173. Zhang, L., Lü, X., and Zong, Z. (2013) The emergence of blaCTX-M-15-carrying Escherichia coli of ST131 and new sequence types in Western China. Ann Clin Microbiol Antimicrob 12, 35 174. Copeland, R. A., Basavapathruni, A., Moyer, M., and Scott, M. P. (2011) Impact of enzyme concentration and residence time on apparent activity recovery in jump dilution analysis. Analytical biochemistry 416, 206-210 	   114	  175. Lee, M., Hesek, D., and Mobashery, S. (2005) A Practical Synthesis of Nitrocefin. The Journal of organic chemistry 70, 367-369 176. Morrison, J. F., and Walsh, C. T. (1988) The behaviour and significance of slow-binding enzyme inhibitors. Advances in Enzymology and Related Areas of Molecular Biology 61, 201 177. Chen, Y., Delmas, J., Sirot, J., Shoichet, B., and Bonnet, R. (2005) Atomic resolution structures of CTX-M beta-lactamases: extended spectrum activities from increased mobility and decreased stability. J Mol Biol 348, 349-362 178. Laskowski, R. A., and Swindells, M. B. (2011) LigPlot+: multiple ligand-protein interaction diagrams for drug discovery. J Chem Inf Model 51, 2778-2786 179. Alexander, J. P., and Cravatt, B. F. (2005) Mechanism of carbamate inactivation of FAAH: implications for the design of covalent inhibitors and in vivo functional probes for enzymes. Chem Biol 12, 1179-1187 180. Mileni, M., Kamtekar, S., Wood, D. C., Benson, T. E., Cravatt, B. F., and Stevens, R. C. (2010) Crystal structure of fatty acid amide hydrolase bound to the carbamate inhibitor URB597: discovery of a deacylating water molecule and insight into enzyme inactivation. J Mol Biol 400, 743-754 181. Pattabiraman, V. R., and Bode, J. W. (2011) Rethinking amide bond synthesis. Nature 480, 471-479 182. Yang, Q., Li, Y., Dou, D., Gan, X., Mohan, S., Groutas, C. S., Stevenson, L. E., Lai, Z., Alliston, K. R., Zhong, J., Williams, T. D., and Groutas, W. C. (2008) Inhibition of serine proteases by a new class of cyclosulfamide-based carbamylating agents. Arch Biochem Biophys 475, 115-120 183. Lamotte-Brasseur, J., Dive, G., Dideberg, O., Charlier, P., Frère, J. M., and Ghuysen, J. M. (1991) Mechanism of acyl transfer by the class A serine beta-lactamase of Streptomyces albus G. Biochem J 279 ( Pt 1), 213-221 184. Shimamura, T., Ibuka, A., Fushinobu, S., Wakagi, T., Ishiguro, M., Ishii, Y., and Matsuzawa, H. (2002) Acyl-intermediate structures of the extended-spectrum class A beta-lactamase, Toho-1, in complex with cefotaxime, cephalothin, and benzylpenicillin. J Biol Chem 277, 46601-46608 185. Pérez-Llarena, F. J., Kerff, F., Abián, O., Mallo, S., Fernández, M. C., Galleni, M., Sancho, J., and Bou, G. (2011) Distant and new mutations in CTX-M-1 beta-lactamase affect cefotaxime hydrolysis. Antimicrob Agents Chemother 55, 4361-4368 186. Yasuyuki, F., Noriaki, O., Masayuki, H., Tetsu, N., Kenji, Y., Ryutaro, S., Atsushi, S., Noriyuki, F., Takahiro, K., Hideaki, F., Atsushi, K., Toshikazu, E., Saburo, N., Tyuji, H. (2003) Molecular Dynamics Study on Class A β-Lactamase: Hydrogen Bond Network among the Functional Groups of Penicillin G and Side Chains of the Conserved Residues in the Active Site. J. Phys. Chem. 107, 10274-10283 187. Eisenmesser, E. Z., Millet, O., Labeikovsky, W., Korzhnev, D. M., Wolf-Watz, M., Bosco, D. A., Skalicky, J. J., Kay, L. E., and Kern, D. (2005) Intrinsic dynamics of an enzyme underlies catalysis. Nature 438, 117-121 188. Lim, D., and Strynadka, N. C. (2002) Structural basis for the beta lactam resistance of PBP2a from methicillin-resistant Staphylococcus aureus. Nat Struct Biol 9, 870-876 189. De Luca, F., Benvenuti, M., Carboni, F., Pozzi, C., Rossolini, G. M., Mangani, S., and Docquier, J. D. (2011) Evolution to carbapenem-hydrolyzing activity in noncarbapenemase class D β-lactamase OXA-10 by rational protein design. Proc Natl Acad Sci U S A 108, 18424-18429 190. Chen, Y., Shoichet, B., and Bonnet, R. (2005) Structure, function, and inhibition along the reaction coordinate of CTX-M beta-lactamases. J Am Chem Soc 127, 5423-5434 191. Kardos, N., and Demain, A. L. (2011) Penicillin: the medicine with the greatest impact on therapeutic outcomes. Applied microbiology and biotechnology 92, 677-687 192. Fisher, J. F., Meroueh, S. O., and Mobashery, S. (2005) Bacterial Resistance to β-Lactam Antibiotics: Compelling Opportunism, Compelling Opportunity. Chemical reviews 105, 395-424 193. Drawz, S., and Bonomo, R. (2010) Three decades of beta-lactamase inhibitors. Clinical microbiology reviews 23, 160-201 194. Rubin, R. (2015) New Antibacterial Drug Approved. JAMA 313 195. Rolinson, G. N. (1998) Forty years of beta-lactam research. The Journal of antimicrobial chemotherapy 41, 589-603 196. Maiti, S., Nguyen, D., Khan, J., and Ling, R. (2013) US2013225554.   197. King, A. M., Reid-Yu, S. A., Wang, W., King, D. T., De Pascale, G., Strynadka, N. C., Walsh, T. R., Coombes, B. K., and Wright, G. D. (2014) Aspergillomarasmine A overcomes metallo-beta-lactamase antibiotic resistance. Nature 510, 503-506 198. Winter, G., Lobley, C. M., and Prince, S. M. (2013) Decision making in xia2. Acta Crystallogr D Biol Crystallogr 69, 1260-1273 199. Adams, P. D., Afonine, P. V., Bunkóczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213-221 	   115	  200. (2012) Methods for Dilution: Antimicrobial Susceptibility Testing of Bacteria that Grow Aerobically. Clinical and Laboratory Standards Institute, Wayne, PA 201. Schneider, C. A., Rasband, W. S., and Eliceiri, K. W. (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675 202. Czarny, T. L., Perri, A. L., French, S., and Brown, E. D. (2014) Discovery of novel cell wall-active compounds using PywaC, a sensitive reporter of cell wall stress, in the model gram-positive bacterium Bacillus subtilis. Antimicrob Agents Chemother 58, 3261-3269 203. Bush, K. (2013) Proliferation and significance of clinically relevant β-lactamases. Annals of the New York Academy of Sciences 1277, 84-90 204. Evans, B. A., and Amyes, S. G. (2014) OXA beta-lactamases. Clin Microbiol Rev 27, 241-263 205. Mendes, R. E., Rhomberg, P. R., Becker, H. K., and Jones, R. N. (2013) β-lactam Activity Tested in Combination with β-lactamase Inhibitor Candidates against Enterobacteriaceae Producing Class A, B and D Carbapenemases in ICAAC, Denver, CO 206. Morinaka, A., Tsutsumi, Y., Yamada, M., Suzuki, K., Watanabe, T., Abe, T., Furuuchi, T., Inamura, S., Sakamaki, Y., Mitsuhashi, N., Ida, T., and Livermore, D. M. (2015) OP0595, a new diazabicyclooctane: mode of action as a serine beta-lactamase inhibitor, antibiotic and beta-lactam 'enhancer'. The Journal of antimicrobial chemotherapy  207. Knox, J. R., Moews, P. C., and Frere, J. M. (1996) Molecular evolution of bacterial beta-lactam resistance. Chem Biol 3, 937-947 208. Kitagawa, M., Ara, T., Arifuzzaman, M., Ioka-Nakamichi, T., Inamoto, E., Toyonaga, H., and Mori, H. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA research : an international journal for rapid publication of reports on genes and genomes 12, 291-299 209. Tipper, D. J. (1985) Mode of action of beta-lactam antibiotics. Pharmacology & therapeutics 27, 1-35 210. Hayes, M. V., and Orr, D. C. (1983) Mode of action of ceftazidime: affinity for the penicillin-binding proteins of Escherichia coli K12, Pseudomonas aeruginosa and Staphylococcus aureus. The Journal of antimicrobial chemotherapy 12, 119-126 211. Okuda, S., and Tokuda, H. (2011) Lipoprotein sorting in bacteria. Annu Rev Microbiol 65, 239-259 212. Kim, H. Y., and Salem, N. (1993) Liquid chromatography-mass spectrometry of lipids. Prog Lipid Res 32, 221-245 213. Paradis-Bleau, C., Markovski, M., Uehara, T., Lupoli, T. J., Walker, S., Kahne, D. E., and Bernhardt, T. G. (2010) Lipoprotein cofactors located in the outer membrane activate bacterial cell wall polymerases. Cell 143, 1110-1120 214. Ling, L. L., Schneider, T., Peoples, A. J., Spoering, A. L., Engels, I., Conlon, B. P., Mueller, A., Schäberle, T. F., Hughes, D. E., Epstein, S., Jones, M., Lazarides, L., Steadman, V. A., Cohen, D. R., Felix, C. R., Fetterman, K. A., Millett, W. P., Nitti, A. G., Zullo, A. M., Chen, C., and Lewis, K. (2015) A new antibiotic kills pathogens without detectable resistance. Nature 517, 455-459 215. Gutheil, W. G., Stefanova, M. E., and Nicholas, R. A. (2000) Fluorescent coupled enzyme assays for D-alanine: application to penicillin-binding protein and vancomycin activity assays. Anal Biochem 287, 196-202 216. Typas, A., Banzhaf, M., van den Berg van Saparoea, B., Verheul, J., Biboy, J., Nichols, R. J., Zietek, M., Beilharz, K., Kannenberg, K., von Rechenberg, M., Breukink, E., den Blaauwen, T., Gross, C. A., and Vollmer, W. (2010) Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell 143, 1097-1109 217. Lupoli, T. J., Lebar, M. D., Markovski, M., Bernhardt, T., Kahne, D., and Walker, S. (2014) Lipoprotein activators stimulate Escherichia coli penicillin-binding proteins by different mechanisms. J Am Chem Soc 136, 52-55 218. King, D. T., Lameignere, E., and Strynadka, N. C. (2014) Structural insights into the lipoprotein outer-membrane regulator of penicillin-binding protein 1B. J Biol Chem 289, 19245-19253  219. Egan, A. J., Jean, N. L., Koumoutsi, A., Bougault, C. M., Biboy, J., Sassine, J., Solovyova, A. S., Breukink, E., Typas, A., Vollmer, W., and Simorre, J. P. (2014) Outer-membrane lipoprotein LpoB spans the periplasm to stimulate the peptidoglycan synthase PBP1B. Proc Natl Acad Sci U S A 111, 8197-8202 220. Jacobson, K., Ishihara, A., and Inman, R. (1987) Lateral diffusion of proteins in membranes. Annu Rev Physiol 49, 163-175 221. Gray, A. N., Egan, A. J., Van't Veer, I. L., Verheul, J., Colavin, A., Koumoutsi, A., Biboy, J., Altelaar, A. F., Damen, M. J., Huang, K. C., Simorre, J. P., Breukink, E., den Blaauwen, T., Typas, A., Gross, C. A., and Vollmer, W. (2015) Coordination of peptidoglycan synthesis and outer membrane constriction during Escherichia coli cell division. Elife 4 222. Müller, P., Ewers, C., Bertsche, U., Anstett, M., Kallis, T., Breukink, E., Fraipont, C., Terrak, M., Nguyen-Distèche, M., and Vollmer, W. (2007) The essential cell division protein FtsN interacts with the murein (peptidoglycan) synthase PBP1B in Escherichia coli. J Biol Chem 282, 36394-36402 	   116	  223. Bertsche, U., Kast, T., Wolf, B., Fraipont, C., Aarsman, M. E., Kannenberg, K., von Rechenberg, M., Nguyen-Distèche, M., den Blaauwen, T., Höltje, J. V., and Vollmer, W. (2006) Interaction between two murein (peptidoglycan) synthases, PBP3 and PBP1B, in Escherichia coli. Mol Microbiol 61, 675-690 224. Vollmer, W., von Rechenberg, M., and Höltje, J. V. (1999) Demonstration of molecular interactions between the murein polymerase PBP1B, the lytic transglycosylase MltA, and the scaffolding protein MipA of Escherichia coli. J Biol Chem 274, 6726-6734 225. Sultana, A., and Lee, J. E. (2015) Measuring protein-protein and protein-nucleic Acid interactions by biolayer interferometry. Curr Protoc Protein Sci 79, 19.25.11-19.25.26 226. Eglen, R. M., Reisine, T., Roby, P., Rouleau, N., Illy, C., Bossé, R., and Bielefeld, M. (2008) The use of AlphaScreen technology in HTS: current status. Curr Chem Genomics 1, 2-10 227. Domínguez-Escobar, J., Chastanet, A., Crevenna, A. H., Fromion, V., Wedlich-Söldner, R., and Carballido-López, R. (2011) Processive movement of MreB-associated cell wall biosynthetic complexes in bacteria. Science 333, 225-228                    	   117	  Appendices Appendix A: Publications Arising from Graduate Work First author Publications arising from Ph.D. studies (2016) Andrew M. King*, Dustin T. King*, Shawn French, Eric Brouillette, Abdelhamid Asli, J. Andrew N. Alexander, Marija Vuckovic, Thomas R. Parr Jr., Eric D. Brown, François Malouin, Natalie C.J. Strynadka, and Gerard D. Wright. Structural and Kinetic Characterization of Diazabicyclooctanes as Dual Inhibitors of Both Serine-β-Lactamases and Penicillin-Binding Proteins. ACS Chem. Biol. DOI: 10.1021/acschembio.5b00944  (2015)  King D.T.*, King A.M.*, Lal S.M., Wright G.D., Strynadka N.C.J. Molecular mechanism of avibactam mediated β-lactamase inhibition. ACS Infect. Dis. DOI: 10.1021/acsinfecdis.5b00007.   (2015)  King D.T.*, Sobhanifar, S. *, Strynadka N.C.J. Handbook of Antimicrobial Resistance: The Mechanisms of Resistance to β-Lactam Antibiotics. DOI 10.1007/98-1-4939-0667-3_10-1.   (2014) King D.T., Lameignere E, Strynadka N.C. Structural Insights into the Lipoprotein Outer Membrane Regulator of Penicillin-Binding-Protein 1B. J. Biol. Chem. 289(27): 19245-19253.   (2013)  Sobhanifar S.,* King D.T.,* Strynadka N.C. Fortifying the wall: synthesis, regulation and degradation of bacterial peptidoglycan. Curr. Opin. Struct. Biol. 23(5): 695-703.   (2013)  King D.T., Strynadka N.C. Targeting metallo-β-lactamase enzymes in antibiotic resistance. Future Med. Chem. 5(11): 1243-1263.   (2012)  King D.T., Strynadka N.C. New Delhi Metallo-β-lactamase: Insights into β-lactam recognition and inhibition. J. Am. Chem. Soc. 134(28): 11362-11365.    (2011)  King D.T., Strynadka N. Crystal Structure of New Delhi metallo-β-lactamase reveals molecular basis for antibiotic resistance. Protein Sci. 134(28): 1243-1263.               *Co-first authorship  Additional publications arising from graduate work (2015)  Ghavami A., Labbé G., Brem J., Goodfellow V.J., Marrone L., Tanner C.A., King D.T., Lam M., Strynadka N.C.J., Pillai D.R., Siemann S., Spencer J., Schofield C.J., and Dmitrienko G.I. Assays for drug discovery:  Synthesis and testing of novel nitrocefin analogues for use as β-lactamase substrates. Anal. Biochem. DOI: 10.1016/j.ab.2015.06.032.   (2014)  King A.M., Reid-Yu S.A., Wang W., King D.T., De Pascale G., Strynadka N.C., Walsh T.R., Coombes B.K., Wright G.D. Aspergillomarasmine A overcomes metallo-β-lactamase antibiotic resistance. Nature. 510(7506): 503-506.     Publications arising from B.Sc. studies (2015)  Barnes M., van Rensburg G., Li W.M., Mehmood K., Mackedenski S., Chan CM, King D.T., Miller A.L., Lee C.H. Molecular insights into the coding region determinant-binding protein-RNA interaction through site-directed mutagenesis in the heterogeneous nuclear ribonucleoprotein-K-homology domains.  J. Biol. Chem. 290(1): 625-639.  (2014)  King D.T., Barnes M., Thomsen D., Lee C.H. Assessing specific oligonucleotides and small molecule antibiotics for the ability to inhibit the CRD-BP-CD44 RNA Interaction. PLoS One. 9(3): e91585.    (2010)  Kim, W., King, D., Lee, C.H. RNA-cleaving properties of human apurinic/apyrimidinic endonuclease 1 (APE1). Int. J. Biochem. Mol. Biol. 1(1):12-25.        	   118	  Appendix B: Chapter 4 Supplementary Information  Figure B.1 Carbamyl-avibactam bound CTX-M-15 active site details. (a) Active site overlay of carbamyl-avibactam CTX-M-15 complexes in spacegroups P212121 (PDB ID: 4HBU), and P21 (PDB ID: 4S2I). Carbon atoms for the 4HBU and 4S2I active site residues and avibactam are displayed in grey and green, with all other non-carbon atoms colored by type (N, blue; O, red; S, yellow). The 4HBU and 4S2I CTX-M-15 protein backbones are displayed as grey and green cartoons. (b) Protein-ligand interactions between CTX-M-15 and avibactam depicted in monomer A using LigPlot+. Avibactam and CTX-M-15 are displayed as purple and orange sticks with atoms colored by type. Hydrogen bonding and electrostatic interactions are shown as green dashes. Ligand-protein hydrophobic contacts are shown as curved red combs.  	   119	   Figure B.2 Interactions between avibactam and active site residues in OXA-48 and OXA-10. (a) and (b), Chain A-avibactam interactions in OXA-48-AVI-7.5 and OXA-10-AVI crystal complexes designed using LigPlot+. In all panels, the carbamyl-avibactam and active site residues are displayed as purple and orange sticks with atoms colored by type. Hydrogen bonding and electrostatic interactions are shown as green dashes. Ligand-protein hydrophobic contacts are displayed as curved red combs.       	   120	                                Figure B.3 Carboxylation state of the SXXK lysine in OXA-48 and OXA-10. (a) Native OXA-48 (pH 7.5), chain A K73 omit Fo-Fc electron density. The OXA-48 protein backbone is displayed as an orange cartoon with selected active site residues shown as sticks with all non-carbon atoms colored by type. The Fo-Fc K73 omit electron density map is contoured at 3.0σ and is shown as a green mesh. (b), (c) and (d) OXA-48-AVI6.5 (pH 6.5), OXA-48-AVI7.5 (pH 7.5) and OXA-48-AVI8.5 (pH 8.5), chain A K73 omit Fo-Fc electron density. The OXA-48 protein backbone, active site residues and Fo-Fc K73 omit electron density maps are shown as in A. The carbamyl-avibactam is represented as pink sticks with all non-carbon atoms colored by type.  (e) OXA-10-AVI (pH 6.5) chain A K70 omit Fo-Fc electron density map. The OXA-10 protein backbone is displayed in cyan cartoon representation with selected active site residues shown as sticks with all non-carbon atoms colored by type. The Fo-Fc K70 omit electron density map is represented as in a. The carbamyl-avibactam is represented as in b.  	   121	    Figure B.4 Comparison of carbamyl-avibactam CTX-M-15, OXA-48 and AmpC co-crystal structures.  (a) Active site close-up of carbamyl-avibactam CTX-M-15. The carbon atoms of avibactam are pink with non-carbon atoms colored by atom type. The avibactam bound CTX-M-15 protein chain is represented as a green cartoon, with key active site residues shown as sticks with atoms colored by type. (b) and (c) Active site close-up of carbamyl-avibactam OXA-48, and AmpC (PDB ID: 4HEF). In b and c, the bound avibactam is represented as in a. The OXA-48 and AmpC protein chains are illustrated as orange and grey cartoons, and active site residues are depicted as sticks with non-carbon atoms colored by type. In a-c, hydrogen bonding and electrostatic interactions are shown as black dashes. (d) Overlay of carbamyl-avibactam from the CTX-M-15, OXA-48 and AmpC co-crystal structures (PDB ID’s: 4S2I, 4S2K, 4HEF). Carbamyl-avibactam from the CTX-M-15, OXA-48 and AmpC structures are displayed as green, orange and white sticks with all non-carbon atoms colored by type. The carbamyl-avibactam C7 carbon, carbonyl oxygen and N1 atoms were fixed in the exact same positions.  	   122	  Figures B.5-B.14 ESI-LC-MS trace overlays of avibactam incubated with β-lactamases as noted at pH 7.5. Samples were analyzed at 0 hours (red trace) and 24 hours (blue trace).  Avibactam remains intact in all samples with the exception of KPC-2 and no enzyme pH 8.5.    No enzyme                  	   123	  CTX-M-15                             	   124	  KPC-2   	                         	   125	  CTX-M-15 K73A 	                         	  	   126	  CTX-M-15 N104A 	                          	   127	  CTX-M-15 S130A  	  	  	                        	   128	  CTX-M-15 N132A  	                         	   129	  CTX-M-15 E166Q                         	   130	  CTX-M-15 K234A  	                       	   131	  No enzyme (pH 8.5)            	  	  	           	   132	  Table B.1 Primers used for β-lactamase cloning.  Underline shows restriction sites. Primer Sequence (5’-3’) CTX-M-15 F AATATCATATGCAAACGGCGGACGTACAGCA CTX-M-15 R TATTAGAATTCTTACCGTCGGTGACGATTTTAGCC OXA-48 F GCTTCATATGGAATGGCAAGAAAACAAAAGTTGGAATGCT OXA-48 R CGTACTCGAGCTAGGGAATAATTTTTTCCTGTTTGAGCAC K73A F GCGATGTGCAGCACCAGTGCGGTGATGG K73A R CGCTACACGTCGTGGTCACGCCACTACC N104A F CGAGTTGAGATCAAAAAATCTGACCTTGTTGCGTATAATCCGATTGC N104A R GCTCAACTCTAGTTTTTTAGACTGGAACAACGCATATTAGGCTAACG S130A F CGCTACAGTACGCGGATAACGTGGCGATGAATAAGC S130A R GCGATGTCATGCGCCTATTGCACCGCTACTTATTCG N132A F GCTACAGTACAGCGATGCGGTGGCGATGAATAAGC N132A R CGATGTCATGTCGCTACGCCACCGCTACTTATTCG E166Q F GCTGGGAGACGAAACGTTCCGTCTCGACC E166Q R CGACCCTCTGCTTTGCAAGGCAGAGCTGG K234A F GGTTGTGGGGGATGCGACCGGCAGC K234A R CCAACACCCCCTACGCTGGCCGTCG T7 terminator GCTAGTTATTGCTCAGCGG                  	   133	  Appendix C: Chapter 5 Supplementary Information 	  Figure C.1 Avibactam derivative electron density maps and ligand protein interactions for CTX-M-15 co-crystal complexes. a, Carbamyl FPI-1465-CTX-M-15 ligand electron density maps. b, Carbamyl FPI-1523-CTX-M-15 ligand electron density maps.  c, Carbamyl FPI-1602-CTX-M-15 ligand electron density maps. In (a-c), the carbamyl-avibactam derivative is represented as pink sticks with atoms colored by type. The left panel for (a-c) shows Fo-Fc ligand omit maps contoured at 3.0, 4.0 and 5.0 σ displayed as pink, cyan and red transparent surfaces. The right panel in (a-c) shows final refined 2Fo-Fc electron density maps for each ligand contoured at 1.0σ. d, Active site overlay of FPI-1523 and FPI-1602 bound to CTX-M-15 (rmsd= 0.2Å on all CA atoms). The carbamyl -FPI-1523 and -FPI-1602 are displayed in cyan and grey stick representation with non-carbon atoms colored by atom type. e, Active site close-up of FPI-1465 bound to CTX-M-15. The bound FPI-1465 is displayed as 	   134	  green sticks with non-carbon atoms colored by type. In all panels, the CTX-M-15 cartoon is shown in white with selected active site residues displayed in stick representation with all non-carbon atoms colored by type. 	    Figure C.2 Avibactam derivative electron density maps and ligand protein interactions for OXA-48 co-crystal complexes. a, Carbamyl FPI-1465-OXA-48 ligand electron density maps. b, Carbamyl FPI-1523-OXA-48 ligand electron density maps.  c, Carbamyl FPI-1602-OXA-48 ligand electron density maps. In (a-c), the carbamyl-avibactam derivative is represented as pink sticks with atoms colored by type. The left panel for (a-c) shows Fo-Fc ligand omit maps contoured at 3.0, 4.0 and 5.0 σ and illustrated as pink, cyan and red transparent surfaces. The right panel in (a-c) shows final refined 2Fo-Fc electron density maps for each ligand contoured at 1.0σ.	  d, Active site overlay of FPI-1523 and FPI-1602 bound to OXA-48 (rmsd= 0.2Å on all CA atoms). The carbamyl -FPI-1523 and -FPI-1602 are displayed in stick representation with non-carbon atoms colored by atom type. e, Active site close-	   135	  up of FPI-1465 bound to the OXA-48 active site. The bound FPI-1465 is displayed as green sticks with atoms colored by type. In all panels, the OXA-48 cartoon is shown in white with selected active site residues displayed in stick representation with all non-carbon atoms colored by type.    Figure C.3 FPI compounds inhibit SBLs but not MBLs.  Concentration-response plots show the SBLs CTX-M-15 and KPC-2 are effectively inhibited by FPI-1465 but not the MBLs IMP-7, NDM-1, or VIM-2.  [FPI-1465] (µM)%ResidualActivity020406080100120IMP-7[FPI-1465] (µM)%ResidualActivity020406080100120VIM-2[FPI-1465] (µM)%ResidualActivity020406080100120CTX-M-15[FPI-1465] (µM)%ResidualActivity020406080100120KPC-2[FPI-1465] (µM)10-11 101%ResidualActivity020406080100120NDM-110-11 10110-11 101 10-11 10110-11 101	   136	   Figure C.4 Avibactam and derivatives specifically bind PBP2. E. coli PBP banding profile and PBP binding competition assay for a, avibactam and b, FPI-1523. The banding profile was generated using BOCILLIN FL and the test compound was used at increasing concentrations during the assay. Binding of BOCILLIN FL to PBP2 was specifically decreased by the presence of all DBOs tested.  c, MICs and PBP2 IC50 of avibactam and derivatives for E. coli K12. Note that the PBP binding competition assay for FPI-1465 is shown in Figure 5.2.  	   137	    Figure C.5 Pearson correlation map for morphological defects in the presence of select antibiotics. a, The correlation is based on ImageJ features shown in b, which were normalized for comparative purposes.  It shows clear correlations between derivatives and known drugs avibactam and mecillinam, and a strong negative correlation with ceftazidime.	   	   138	   Figure C.6 Gel based BOCILLIN FL competition assays to analyze the ability of unlabeled competitor compounds to bind purified E. coli PBP1b. In a, b, and c, various amounts of unlabeled FPI-1602, benzyl-penicillin, or kanamycin were pre-incubated with E. coli PBP1b for 48 hours prior to addition of BOCILLIN-FL. Error bars represent standard deviations from two separate technical replicates.   	  	   139	    Figure C.7 Avibactam derivative electron density for carbamyl-FPI-1465-E. coli PBP1b. a, Carbamyl-FPI-1465 PBP1b ligand omit Fo-Fc electron density. The Fo-Fc ligand omit maps are contoured at 3.0, 4.0 and 5.0 σ and are shown as pink, cyan and red transparent surfaces. b, Carbamyl-FPI-1523 final refined 2Fo-Fc electron density map contoured at 1.0σ. In both panels, the PBP1b cartoon is shown in white with selected active site residues displayed as sticks with all non-carbon atoms colored by type. In all panels, the carbamyl-FPI-1465 is represented as pink sticks with atoms colored by type.    Table C.1  Antimicrobial susceptibility patterns of E. coli ASKA strains.    MIC (µg/mL)   Antibiotic ftsI (PBP3) mrcA (PBP1a) mrcB (PBP1b) mrdA (PBP2) WT Ceftazidime  NT NT NT NT 0.25 Mecillinam NT NT NT NT 0.5 Avibactam 8 8-16 16 4 16 FPI-1465 2 16 2-4 4 4 FPI-1523 1 1 1 2 1 FPI-1602 0.5 0.5 0.5 4 0.5  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0222998/manifest

Comment

Related Items