Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of novel therapeutic targets in chronic myeloid leukemia Rothe, Katharina 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_february_rothe_katharina.pdf [ 3.89MB ]
Metadata
JSON: 24-1.0221673.json
JSON-LD: 24-1.0221673-ld.json
RDF/XML (Pretty): 24-1.0221673-rdf.xml
RDF/JSON: 24-1.0221673-rdf.json
Turtle: 24-1.0221673-turtle.txt
N-Triples: 24-1.0221673-rdf-ntriples.txt
Original Record: 24-1.0221673-source.json
Full Text
24-1.0221673-fulltext.txt
Citation
24-1.0221673.ris

Full Text

CHARACTERIZATION OF NOVEL THERAPEUTIC TARGETS  IN CHRONIC MYELOID LEUKEMIA by  Katharina Rothe  B.Sc., Christian-Albrechts-University of Kiel, 2005 M.Sc., Christian-Albrechts-University of Kiel, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2015  © Katharina Rothe, 2015 ii  Abstract  The identification of BCR-ABL1 as the key molecular event in chronic myeloid leukemia (CML) has revolutionized treatment opportunities for early phase patients. Imatinib mesylate (IM) and other ABL1 tyrosine kinase inhibitors (TKIs) have been introduced into the clinic with remarkable effects. However, initial and acquired resistance, relapse and in particular, the persistence of CML stem cells upon TKI therapy represent critical challenges and warrant the identification of predictive biomarkers and novel, distinct targets for improved treatment strategies.  In this work, I investigated how CML stem and progenitor cells survive TKI therapy through intrinsic and bone marrow (BM) niche-associated mechanisms. I revealed that the core autophagy protease ATG4B, and the focal adhesion protein and serine/threonine kinase Integrin-linked kinase (ILK) play crucial roles in CML, and that they can be successfully targeted with small molecule inhibitors.  By comparing the expression of various core autophagy genes and proteins, ATG4B was identified as potential biomarker in CML to predict IM-responders versus IM-nonresponders prior to the initiation of therapy. Furthermore, my studies illustrated that deregulation of ATG4B is critical to autophagy, survival and growth of CML stem and progenitor cells. Inhibition or suppression of ATG4B decreased CML cell viability significantly and sensitized leukemic cells to TKI treatment highlighting ATG4B as a novel target in CML.  ILK was identified as a differentially expressed gene between CD34+ CML patient cells and healthy donors by RNA-sequencing (RNA-seq) analysis, and the importance of the ILK protein and its kinase functions in mediating TKI responses and resistance in CML stem and iii  progenitor cells was demonstrated by ILK inhibitor (QLT0267) and ILK suppression studies. Moreover, various in vitro and in vivo assays showed that the simultaneous kinase inhibition of ILK and BCR-ABL1 is effective in targeting both leukemic stem and progenitor cells, including quiescent CML cells, and in the presence of stromal cells of the BM microenvironment that make TKI monotherapies ineffective.  Overall, these studies provide the first evidence of the importance of ATG4B and ILK in CML, and their potential as novel therapeutic targets for improved combination treatments with TKIs to specifically eliminate CML stem and progenitor cells.   iv  Preface  Katharina Rothe conducted all investigations presented in this thesis, except for the parts stated below, under the supervision of Dr. Xiaoyan Jiang at the Terry Fox Laboratory at the BC Cancer Research Centre, Vancouver, Canada. Katharina Rothe designed and carried out experiments, analyzed and interpreted data, composed and edited the thesis, while Dr. Xiaoyan Jiang contributed to the experimental design, data interpretation and editing of this thesis. Most of the studies described in Chapter 3, including Figures 3.1-3.8, and sections of Chapter 2 have been published as a first-author publication. Rothe K, Lin H, Lin K, Leung A, Wang HM, Malekesmaeili M, Brinkman RR, Forrest D, Gorski S and Jiang X. (2014) Identification of the core autophagy protein ATG4B as a potential biomarker and therapeutic target in CML stem/progenitor cells. Blood. 123:3622-34. Katharina Rothe contributed 85% of the work with experimental design and study development. She performed the vast majority of experiments, analyzed and interpreted data, and wrote the manuscript. Dr. Xiaoyan Jiang, Dr. Sharon Gorski, Dr. Donna Forrest and Dr. Kevin Lin contributed to the development of the concept and design of experiments. Dr. Kevin Lin also initiated and performed some of the initial ATG4B suppression experiments in CML cell lines, while Leon Lin carried out and analyzed the miRNA experiments. Amy Leung designed and optimized Q-RT-PCR primers and Helena Wang assisted in the initial production of lentiviruses and some transduction experiments. Mehrnoush Malekesmaeili and Ryan Brinkman performed and confirmed statistical analysis, and Dr. Donna Forrest provided clinical data. Dr. Kevin Lin, Leon Lin and Dr. Xiaoyan Jiang also assisted with writing the manuscript and all other authors commented on it.  v  The ATG4B inhibitor experiments presented in Chapter 3, Figures 3.9-3.15, were conducted in collaboration with Drs. Sharon Gorski and Robert Young, Simon-Fraser University, Burnaby, Canada; as well as Dr. Jianghong An, Genome Sciences Centre, and the Centre for Drug Research and Development, Vancouver, Canada, who optimized and provided the various ATG4B inhibitors. Akie Watanabe performed some of the experiments under Katharina Rothe’s supervision.                   The studies presented in Chapter 4 include collaborations with Drs. Shoukat Dedhar and Connie Eaves. Dr. Shoukat Dedhar provided the QLT0267 inhibitor and Dr. Connie Eaves provided primary CML patient samples. Both discussed with me some of the experiments. Dr. Min Chen helped with the in vivo study with NSG mice, and Artem Babaian assisted with the RNA-sequencing analysis. The data of Chapter 4 are currently used to prepare a manuscript for publication in a peer-reviewed journal.  All studies performed with primary samples from CML patients or healthy donors were approved by the University of British Columbia Clinical Research Ethics Board, certificate number H12-02372. I thank members of the Leukemia/BMT Program of British Columbia and the Hematology Cell Bank of British Columbia, Vancouver, BC, Canada, for providing CML patient samples and the Terry Fox Laboratory FACS Facility for cell sorting.    All mouse experiments were conducted in accordance with the policies and guidelines of the University of British Columbia Animal Care Committee. Study permission was granted under the certificate protocol number A15-0060. Mice were housed in the Animal Resource Centre (ARC) with the assistance of ARC staff.   vi  Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents ......................................................................................................................... vi List of Tables ............................................................................................................................... xii List of Figures ............................................................................................................................. xiii List of Symbols ........................................................................................................................... xvi List of Abbreviations ................................................................................................................ xvii Acknowledgements ......................................................................................................................xx Dedication .................................................................................................................................. xxii Chapter 1: Introduction ................................................................................................................1 1.1 Introduction to Chronic Myeloid Leukemia ................................................................... 1 1.2 Current Treatment Strategies in Chronic Myeloid Leukemia and Challenges ............... 3 1.3 Mechanisms of Tyrosine Kinase Inhibitor Resistance in Chronic Myeloid Leukemia .. 4 1.3.1 BCR-ABL1-Dependent Resistance ............................................................................ 4 1.3.2 BCR-ABL1-Independent Resistance .......................................................................... 5 1.4 BCR-ABL1-Activated Signaling .................................................................................... 9 1.5 Autophagy ..................................................................................................................... 12 1.5.1 Macroautophagy and the Critical Functions of ATG4B ........................................... 13 1.5.2 Autophagy in Cancer Including CML ...................................................................... 15 1.6 The Stem Cell Niche ..................................................................................................... 16 1.6.1 The Bone Marrow Microenvironment ...................................................................... 16 vii  1.6.2 Extracellular Matrix Shapes the Stem Cell Niche .................................................... 19 1.6.3 Integrins Mediate Extracellular Matrix-Stem Cell Interactions ................................ 20 1.7 Integrin-Linked Kinase ................................................................................................. 22 1.7.1 Moderator of Integrin Signaling ............................................................................... 22 1.7.2 Integrin-Linked Kinase in Cancer ............................................................................. 25 1.8 Thesis Objectives .......................................................................................................... 26 Chapter 2: Materials and Methods ............................................................................................29 2.1 Cell Culturing and Sorting ............................................................................................ 29 2.1.1 Cell Lines .................................................................................................................. 29 2.1.2 Human Cells.............................................................................................................. 29 2.1.3 Inhibitors ................................................................................................................... 30 2.1.4 Fluorescence-Activated Cell Sorting ........................................................................ 31 2.2 Molecular Techniques and Immunoassays ................................................................... 31 2.2.1 RNA-Extraction ........................................................................................................ 31 2.2.2 Quantitative Real-time PCR ..................................................................................... 32 2.2.3 Protein Extraction and Quantification ...................................................................... 32 2.2.4 Western Blotting ....................................................................................................... 34 2.2.5 Intracellular Staining ................................................................................................. 35 2.2.6 Endogenous LC3B Puncta Staining and Confocal Microscopy ............................... 35 2.3 Transfections and Transductions .................................................................................. 35 2.3.1 Lentivirus Production................................................................................................ 35 2.3.2 Lentiviral shRNA- and siRNA-Mediated Knockdowns in CML Cells .................... 36 2.4 In Vitro Assays .............................................................................................................. 37 viii  2.4.1 Viability Assay.......................................................................................................... 37 2.4.2 Apoptosis Assay........................................................................................................ 38 2.4.3 Cell Cycle Measurements ......................................................................................... 38 2.4.4 Cell Proliferation Assay with CFSE ......................................................................... 39 2.4.5 Analysis of Drug Interactions ................................................................................... 39 2.4.6 Colony-Forming Cell Assay ..................................................................................... 39 2.4.7 Long-Term Culture-Initiating Cell Assay ................................................................. 40 2.5 In Vivo Methods ............................................................................................................ 40 2.5.1 Transplantation of Immunodeficient Mice with BV173YFP/Luc Cells ........................ 40 2.5.2 Hematopoietic Mouse Tissue Analysis ..................................................................... 41 2.6 Statistical Analysis ........................................................................................................ 41 Chapter 3: The Core Autophagy Protein ATG4B as a Possible Biomarker and Therapeutic Target in CML .............................................................................................................................43 3.1 Introduction ................................................................................................................... 43 3.2 Results ........................................................................................................................... 45 3.2.1 ATG4B Is Highly Expressed in Primitive, Normal Hematopoietic Cells ................. 45 3.2.2 Several Core Autophagy Genes and Proteins Including ATG4B Are Differentially Expressed in CD34+ CML Cells ........................................................................................... 46 3.2.3 The Expression of ATG4B Is Increased in CD34+ CML Cells from Subsequent IM-nonresponders versus IM-responders ................................................................................... 48 3.2.4 Leukemic Stem Cells from IM-nonresponders Express Higher Levels of Several ATG Genes, Including ATG4B, Compared to IM-responders .............................................. 51 ix  3.2.5 Exposure to IM In Vitro Elevates mRNA and Protein Expression of ATG4B and Induces Autophagic Flux in CD34+ CML Cells ................................................................... 53 3.2.6 Transient Depletion of ATG4B Increases IM-Mediated Inhibition of Colony Formation by CML Cells ...................................................................................................... 55 3.2.7 Lentiviral-Mediated Knockdown of ATG4B Impairs Autophagy and Effects Survival of K562 and IMR K562 Cells ................................................................................ 57 3.2.8 Stable Suppression of ATG4B Impairs Autophagy in CML Stem/Progenitor Cells and Sensitizes These Cells to IM Treatment in Short- and Long-Term Cultures ................. 59 3.2.9 Inhibition of ATG4B by Compound 4Bi-1 Sensitizes K562 Cells to IM Treatment upon Autophagy Induction by Starvation ............................................................................. 62 3.2.10 Combined Treatment with 4Bi-1 and TKIs Reduces Colony Formation by CD34+ CML Cells, but Is Less Inhibitory Towards Normal Cells ................................................... 65 3.2.11 The ATG4B Inhibitors 4Bi-2 and 4Bi-3 Block Autophagy in K562 Cells, Decrease Cell Proliferation and Synergize with IM Treatment In Vitro .............................. 67 3.2.12 Combining 4Bi-2 or 4Bi-3 with IM Treatment Decreases Survival of K562 Cells upon Autophagy Induction ................................................................................................... 70 3.2.13 Growth and Survival of IM-Resistant K562 and BV173 Cells is Reduced by 4Bi-2 or 4Bi-3 Treatment upon Starvation ..................................................................................... 72 3.2.14 UT7-BCR-ABL1 and UT7-BCR-ABL1-T315I Mutant Cell Lines Are Sensitive to 4Bi-2 and 4Bi-3 Treatment In Vitro...................................................................................... 74 3.2.15 A Combination of 4Bi-2 or 4Bi-3 with IM or DA Inhibits Colony Formation by Stem/Progenitor Cells from CML Patients, but not from Healthy Donors........................... 76 3.3 Discussion and Future Directions ................................................................................. 78 x  Chapter 4: The Focal Adhesion Component Integrin-Linked Kinase is Key to Stromal Cell Interactions and Survival of CML Stem/Progenitor Cells .......................................................85 4.1 Introduction ................................................................................................................... 85 4.2 Results ........................................................................................................................... 86 4.2.1 ILK Expression Is Significantly Increased in CML Stem and Progenitor Cells ...... 86 4.2.2 IM Treatment or Co-Culture with Stromal Cells Further Increases ILK Expression in CD34+ CML Cells ................................................................................................................. 89 4.2.3 The ILK Kinase Inhibitor QLT0267 Affects Viability, Apoptosis and TKI Responses of K562 and BV173 Cells ................................................................................... 90 4.2.4 Simultaneous Kinase Inhibition of ILK and BCR-ABL1 Increases Apoptosis of Primary CD34+ CML Cells and Overcomes Protection by Stromal Cells in Co-Cultures ... 93 4.2.5 A Combination of QLT0267 and TKIs Blocks Short- and Long-Term Colony Growth of CD34+ CML Cells from IM-Resistant Patients, but Spares Normal Cells ......... 95 4.2.6 Combined Inhibition of ILK and BCR-ABL1 Kinase Activities Reduces the Persistence of Primitive, Quiescent CML Cells ................................................................... 97 4.2.7 QLT0267 Treatment Decreases Adhesion of CML Cells and Reduces Phosphorylation of GSK3β and STAT3 in CML Cells ........................................................ 98 4.2.8 Oral Gavage Treatment with QLT0267 and DA Decreases Leukemia Burden and Enhances Survival of Leukemic Mice ................................................................................ 101 4.2.9 Leukemia Infiltration into Hematopoietic Tissues Is Decreased by a Combination of QLT0267 and DA Treatment In Vivo ................................................................................. 103 4.2.10 Lentiviral-Mediated Suppression of ILK in K562 Cells Reduces Proliferation and Cell Viability ....................................................................................................................... 106 xi  4.2.11 Stable Knockdown of ILK in CD34+ CML Cells Decreases Their Survival and Growth Potential in the Presence and Absence of Stromal Cells ....................................... 108 4.2.12 Combined ILK Suppression and BCR-ABL1 Inhibition Decreases Significantly Short- and Long-Term Colony Growth of CML Stem and Progenitor Cells ..................... 110 4.3 Discussion and Future Directions ............................................................................... 112 Chapter 5: General Summary and Discussion ........................................................................121 5.1 Summary ..................................................................................................................... 121 5.2 Significance and Limitations of the Work .................................................................. 122 References ...................................................................................................................................127  xii  List of Tables  Table 2.1: Specific primers used for Q-RT-PCR of CML and normal BM cells ......................... 33 Table 2.2: MISSION shRNAs (Sigma-Aldrich) used for stable, lentiviral-mediated suppression of ATG4B or ILK in CML cells ................................................................................................... 37 Table 3.1:  Estimation of coefficients of the logistic regression model used to analyze the transcript levels of ATG genes between IM-responders and IM-nonresponders .......................... 50  xiii  List of Figures  Figure 1.1: Generation of the Philadelphia Chromosome. ............................................................. 2 Figure 1.2: Schematic representation of the classical hierarchical concept of hematopoiesis. ...... 8 Figure 1.3: Overview of the autophagic process. ......................................................................... 14 Figure 1.4: ILK is abundantly localized in focal adhesions and activates several pro-survival signaling pathways ........................................................................................................................ 24 Figure 3.1: ATG4B is highly expressed in CD34+ normal BM cells. ........................................... 45 Figure 3.2: ATG4B expression is increased in CD34+ CML cells. .............................................. 47 Figure 3.3: ATG4B expression is elevated in CD34+ CML cells from IM-nonresponders versus IM-responders. .............................................................................................................................. 49 Figure 3.4: Several ATG transcripts are differentially expressed in CD34 subpopulations from subsequent IM-responders versus IM-nonresponders. ................................................................. 52 Figure 3.5: Enhanced expression of ATG4B and induced autophagic flux in CD34+ CML cells upon IM treatment......................................................................................................................... 54 Figure 3.6: Transient depletion of ATG4B by RNA interference in K562, K562 IM-resistant and primary CD34+ CML cells enhances IM-mediated inhibition of colony formation. .................... 56 Figure 3.7: Knockdown of ATG4B by RNA interference in K562 and IM-resistant K562 cells impairs autophagy and reduces viability and growth of these cells.............................................. 58 Figure 3.8: Lentiviral-mediated depletion of ATG4B in primary CD34+ CML cells and its effects on autophagy, short- and long-term proliferation of these cells, cell viability and apoptosis. ..... 61 Figure 3.9: The ATG4B antagonist 4Bi-1 blocks autophagy in K562 cells and reduces cell survival in combination with IM upon starvation. ........................................................................ 64 xiv  Figure 3.10: A combination of compound 4Bi-1 with IM or DA reduces colony formation by CD34+ CML stem/progenitor cells, but is less inhibitory towards their normal counterparts. .... 66 Figure 3.11: ATG4B inhibitors 4Bi-2 and 4Bi-3 block autophagy in K562 cells and act synergistically with IM. ................................................................................................................ 69 Figure 3.12: A combination of IM and the ATG4B inhibitor 4Bi-2 or 4Bi-3 decreases growth and survival of K562 cells upon induction of autophagy. ................................................................... 71 Figure 3.13: ATG4B inhibitors 4Bi-2 and 4Bi-3 decrease growth and survival properties of IM-resistant K562 and BV173 cells upon starvation. ......................................................................... 73 Figure 3.14: UT7-BCR-ABL1 wild-type and UT7-BCR-ABL1-T315I mutant cells are more sensitive to the ATG4B inhibitors 4Bi-2 and 4Bi-3 than UT7 parental cells. .............................. 75 Figure 3.15: A combination of the ATG4B inhibitor 4Bi-2 or 4Bi-3 with IM or DA inhibits colony formation by CD34+ CML stem/progenitor cells, but spares normal cells. ...................... 77 Figure 4.1: ILK expression is increased in CML stem and progenitor cells. ............................... 88 Figure 4.2: IM treatment or stromal cell co-culture increase ILK expression in CD34+ CML cells........................................................................................................................................................ 90 Figure 4.3: Combined treatment with QLT0267 and IM enhances cell death of K562 and BV173 cells. .............................................................................................................................................. 92 Figure 4.4: Simultaneous inhibition of ILK and BCR-ABL1 kinases increases apoptosis of primary CD34+ CML cells and overcomes protection by stromal cells in co-cultures. ............... 94 Figure 4.5: A combination of QLT0267 and TKIs blocks short- and long-term colony growth of CD34+ CML cells, but is not toxic to normal cells. ...................................................................... 96 Figure 4.6: Combined inhibition of ILK and BCR-ABL1 kinases targets quiescent cells from IM-resistant CML patients. ................................................................................................................. 98 xv  Figure 4.7: Treatment with the ILK inhibitor QLT0267 prevents deregulated adhesion of CML cells and decreases protein phosphorylation of GSK3β and STAT3 in K562 cells. .................. 100 Figure 4.8: Combined treatment with QLT0267 and DA decreases leukemia burden in vivo and enhances survival of leukemic mice. .......................................................................................... 102 Figure 4.9: Oral gavage treatment of QLT0267 in combination with DA decreases infiltration of leukemic cells into hematopoietic tissues in mice. ..................................................................... 104 Figure 4.10: Lentiviral-mediated depletion of ILK reduces proliferation and viability of K562 cells. ............................................................................................................................................ 107 Figure 4.11: Stable suppression of ILK decreases survival and growth of primary CD34+ CML cells in the presence or absence of stromal cells......................................................................... 109 Figure 4.12: Stable knockdown of ILK reduces colony formation of CML stem and progenitor cells from IM-resistant patients. ................................................................................................. 111  xvi  List of Symbols α = alpha  β = beta μ = micro m = milli M = Molar n = nano N = number  p = phospho V = Volt % = percent < = smaller than   Amino acids (single letter code):  D = Aspartic acid E = Glutamic acid F = Phenylalanine G = Glycine H = Histidine I = Isoleucine K = Lysine M = Methionine S = Serine T = Threonine V = Valine Y = Tyrosine  xvii  List of Abbreviations ABCB1 = ATP Binding Cassette B1 ABCG2 = ATP Binding Cassette G2 AKT = Protein Kinase B AML = Acute Myeloid Leukemia AP = Advanced Phase APC = Allophycocyanin ATG = Autophagy-Related Gene ATP = Adenosine Triphosphate BC = Blast Crisis BCR-ABL1 = Breakpoint Cluster Region – Abelson Tyrosine Kinase 1 BFU-E = Blast-Forming Unit - Erythrocyte BM = Bone Marrow  BrdU = Bromodeoxyuridine BSA = Bovine Serum Albumin CD = Cluster of Differentiation CFC = Colony-Forming Cell CFSE = Carboxyfluorescein Diacetate-Succinimidyl Ester CFU-GM = Colony-Forming Unit – Granylocyte/Macrophage CI = Combination Index CLP = Common Lymphoid Progenitor CML = Chronic Myeloid Leukemia  CMP = Common Myeloid Progenitor CP = Chronic Phase CQ = Chloroquine  CXCL12 = (SDF-1) Stromal-Cell-Derived Factor-1 CXCR4 = Chemokine Receptor 4 DA = Dasatinib  DMEM = Dulbecco's Modified Eagle Medium DMSO = Dimethylsulfoxide  EB = Eryhtroblast ECM = Extracellular Matrix ED = Effective Dosage ERK = Extracellular Signal-Regulated Kinase FACS = Fluorescence-Activated Cell Sorting FBS = Fetal Bovine Serum FITC = Fluorescein-Isothiocyanate GAB2 = GRB2-Associated Binding Protein 2 G-CSF = Granulocyte-Colony Stimulating Factor   GM-CSF = Granulocyte/Macrophage-Colony Stimulating Factor GMP = Granulocyte-Macrophage Progenitor GRB2 = Growth Factor Receptor-Bound Protein 2 GSK3β = Glycogen-Synthase-Kinase 3 Beta GTP = Guanosine Triphosphate xviii  HCQ = Hydroxychloroquine HPC = Hematopoietic Progenitor Cell HSC = Hematopoietic Stem Cell IC50 = 50% Inhibitory Concentration IF = Immunofluorescence  ILK = Integrin-Linked Kinase IL = Interleukin IM = Imatinib Mesylate IM-NR = Imatinib-nonresponder(s) IM-R = Imatinib-responder(s) JAK = Janus Kinase  kD = kilo Dalton LC3 = Microtubule-Associated Light Chain 3 LTC-IC = Long-Term Culture-Initiating Cell Luc = Luciferase MAPK = Mitogen-Activated Protein Kinase MEK = (MAPKK) Mitogen-Activated Protein Kinase Kinase MEP = Megakaryocyte-Eryhtrocyte Progenitor miRNA = microRNA  min = Minutes  MKP = Megakaryocyte Progenitor MPP = Multipotent Progenitor mTOR = mammalian Target of Rapamycin NBM = Normal Bone Marrow NK = Natural Killer Cells NSG = NOD Scid Gamma OCT1 = Organic Cation Transporter 1 PB = Peripheral Blood PBS = Phosphate Buffered Saline PI = Propidium Iodide PE = Phosphatidylethanolamine PE = Phycoerythrin (FACS) PEI = Polyethylenimine Ph+ = Philadelphia Chromosome-positive PI3K = Phospho-Inositide-3-Kinase PIP2 = Phosphatidylinositol Biphosphate PIP3 = Phosphatidylinositol Triphosphate PTEN = Phosphatase and Tensin Homolog Q-RT-PCR = Quantitative-Real-Time-Polymerase Chain Reaction  RAS = Rat Sarcoma Viral Oncogene RNA-seq = Ribonucleic Acid-sequencing  RPMI = Rosewell Park Memorial Institute RT = Room Temperature SD = Standard Deviation SDS = Sodium Dodecyl Sulphate SEM = Standard Error of the Mean xix  SFM = Serum Free Medium SH2 = Src Homology 2 SOS = Son of Sevenless SRC = Sarcoma-family Kinase STAT = Signal Transducer and Activator of Transcription shRNA = small hairpin RNA siRNA = small interfering RNA TBS = Tris-Buffered Saline TBST = Tris-Buffered Saline Tween 20 TGF-β = Transforming Growth Factor-Beta TKI = Tyrosine Kinase Inhibitor YFP = Yellow Fluorescent Protein   xx  Acknowledgements  Science is collaborative work and with that I would like to thank the many people who helped me to grow and succeed in my thesis projects and beyond.  First, I would like to express my sincere gratitude to my supervisor Dr. Xiaoyan Jiang, who always supported me outstandingly throughout my PhD, and for giving me the freedom and trust to explore my interests. I truly enjoyed being part of your laboratory and learned a lot that I will be taking forward!  I would also like to thank very much my Committee members Drs. Connie Eaves, Shoukat Dedhar, and Keith Humphries for their advice, suggestions and encouraging interest in my research! Your expertise and critiques were always appreciated and invaluable to my accomplishments.  Furthermore, I thank past and present members of the Jiang lab, the Autophagy Team, the Eaves lab, and the Stem Cell Assay lab; in particular Dr. Min Chen, Dr. Kevin Lin, Leon Lin, Akie Watanabe, Dr. Sharon Gorski, Dr. Naoto Nakamichi, Dr. Philip Beer, Dr. Nagarajan Kannan, Paul Miller, David Knapp, Kyi Min Saw and Glenn Edin. Your knowledge, help and willingness to share your experience and information with me made many of my experiments run much smoother. Akie, you were an incredible Co-op student and I loved every aspect of supervising and mentoring you! The collaborative environment in the Autophagy Team was truly enjoyable and highly valuable. Thanks everyone for the positive and inspiring working environment in the lab! Good luck to you all!  xxi  I also thank past and present GrasPods executive members as well as the entire Terry Fox Lab. This place is very special and it is because of you and your dedication to make things happen!   Furthermore, I would like to express my gratitude to my Examination Committee. Many thanks go to my External Examiner Dr. Saghi Ghaffari, Icahn Medical Institute Mount Sinai Hospital, New York, for reviewing my dissertation and for providing many detailed comments, very appreciated! Thank you very much, Drs. Calvin Roskelley and Gerald Krystal, for taking the time to be my UBC External Examiners, and Dr. Fumio Takei for being an excellent Exam Chair. Also, thank you Drs. Xiaoyan Jiang and Connie Eaves for challenging and supporting me once more as a graduate student. I enjoyed my defence.    Thanks, Andrew Chapman, for helping me with the editing of my thesis. I know it must have been a long evening for you.   In addition, I would like to acknowledge the BC Cancer Agency, CCSRI, CIHR, ASH, ISEH, ESH, iGSN, Medical Genetics and UBC for funding part of my work, tuition and conference travels.   My heartfelt thanks go to my beloved parents, Martin, and Artem. Thank you for your patience, support, help, insightful discussions and encouragement throughout many busy years! You helped me to explore and to discover what I really enjoy doing!          xxii  Dedication      To my parents, who gave me options and raised me with an independent, critical mind.  1  Chapter 1: Introduction  1.1  Introduction to Chronic Myeloid Leukemia  Chronic myeloid leukemia (CML) is a clonal, multi-lineage, hematopoietic stem cell (HSC) disorder that occurs with an incidence of 1-2 new cases per 100,000 adults each year [1, 2]. More than 95% of affected individuals harbor a shortened 22q – the Philadelphia Chromosome (Ph+), which is formed upon the reciprocal translocation between the long arms of chromosome 9 and 22 [3-5]. This translocation leads to the fusion of the Breakpoint Cluster Region (BCR) gene to the Abelson Tyrosine Kinase 1 (ABL1) proto-oncogene resulting in the generation of the BCR-ABL1 oncogene (Figure 1.1) [1, 6]. The BCR-ABL1 oncogene encodes a protein with constitutively elevated tyrosine kinase activity [6]. It activates several intracellular signaling cascades such as PI3K/AKT, JAK/STAT, and RAS/RAF/MEK/ERK pathways, which in turn promote enhanced proliferation, resistance to apoptosis and altered adhesion properties of CML cells explaining the clinical features of the chronic phase (CP) of the disease [4, 7, 8].   In the initial CP, CML patients present with an excessive accumulation of myeloid but fully differentiated cells in the bone marrow and peripheral blood, and this stage of the disease lasts on average for 3-5 years [9]. However, without therapeutic intervention, CML patients progress via an accelerated phase (AP) or less frequently directly into the final stage, Blast Crisis (BC) (with myeloid or lymphoid blast cells in nature), that is characterized by >20% of blast cells in the marrow and peripheral blood as well as a block in differentiation at the molecular level, and eventually leads to the death of almost all patients due to bone marrow (BM) failure [10-12].  2   The identification of BCR-ABL1 as the hallmark of the disease was found to be of great diagnostic as well as prognostic value, and most importantly has led to the development of targeted therapies [13, 14].           Figure 1.1: Generation of the Philadelphia Chromosome. A reciprocal translocation between chromosomes 9 and 22 leads to the fusion of the Breakpoint Cluster Region (BCR) gene to the Abelson Tyrosine Kinase 1 (ABL1) proto-oncogene resulting in the creation of the BCR-ABL1 oncogene. The BCR-ABL1 oncogene encodes for a protein with a constitutively active kinase, the hallmark of CML.           3  1.2  Current Treatment Strategies in Chronic Myeloid Leukemia and Challenges Due to the discovery of the unique BCR-ABL1 aberration in CML, recent treatment options have focused on the inhibition of the BCR-ABL1 tyrosine kinase activity [13, 15-19]. Currently, 5 different BCR-ABL1 inhibitors are FDA/EMA-approved for front- or second-line therapy in CML [20]. Imatinib mesylate (IM; Gleevec) was the first BCR-ABL1 tyrosine kinase inhibitor (TKI) to be introduced into the clinic in May 2001 and has proven to be one of the greatest success stories in molecular targeted therapy to date [15, 17, 21-24]. IM acts as an ATP-competitive inhibitor that binds to the ATP-binding site of the ABL1 kinase and thus, prevents BCR-ABL1 from phosphorylating its substrates [13, 25-27]. Frontline therapy with IM in early CP CML patients showed remarkable effects in achieving complete hematological (normal white blood cell count) and cytogenetic (undetectable Ph+ chromosomes by metaphase analysis) responses in many patients and reduced the frequency of patients progressing from CP to AC/BC [21]. However, intolerance and resistance most commonly due to point mutations in the kinase domain of ABL1 emerged soon as critical problems in 25% of TKI-naïve patients and 50-90% of CP CML patients initially treated with IM [21, 25]. In addition, IM treatment has been shown to be less successful in the advanced stages of CML where hematological and cytogenetic responses drastically decrease below 40% (AP) and below 20% (BC), respectively [17, 25]. Moreover, BCR-ABL1 transcripts remain detectable in patients treated with IM, indicating residual disease and supported by the observation of more than 60% of patients with evidence of molecular relapse upon IM discontinuation [17, 28-30].  In an attempt to circumvent these problems, several second generation TKIs such as Dasatinib (DA), Nilotinib and Bosutinib and lastly, Ponatinib, a third generation pan BCR-ABL1 inhibitor, were developed [18, 19, 31-33]. In particular, DA has shown initial promise by being 4  more potent than IM (325-fold) and achieving earlier complete hematological and cytogenetic responses inclusive of some patients with resistance to IM [19, 34]. Some of these effects may be attributed to the ability of DA to bind the active as well as inactive confirmation of the BCR-ABL1 kinase activation loop, its potential to target both BCR-ABL1 and SRC family member kinases, and by being able to eliminate more primitive cells in comparison to IM [34, 35]. Nevertheless, primitive BCR-ABL1-positive cells persist and while TKI therapy may control the disease burden, it is rarely curative in CML. Regardless of the kind of TKI monotherapy applied, some patients are intolerant, resistant or become unresponsive to TKI treatment, including to sequential therapy with various TKIs. An allogenic stem cell transplantation remains the sole possible curative option so far, but is very often not feasible due to serious morbidity and mortality risks associated with the transplant procedure, the age of patients and most importantly, a lack of suitable donors [12, 14]. Hence, novel and more effective treatments are highly warranted.     1.3  Mechanisms of Tyrosine Kinase Inhibitor Resistance in Chronic Myeloid Leukemia  Despite the success of TKI therapy in CML, various mechanisms of resistance have emerged and are subject of many debates and investigations to improve treatment strategies in the future.  1.3.1 BCR-ABL1-Dependent Resistance The most frequent and major mechanism of BCR-ABL1-dependent resistance, observed prior or with TKI treatment, is the acquisition of single point mutations in the kinase domain of ABL1 that prevent successful binding of the TKI. More than 100 different point mutations have 5  been reported in relation to IM and less frequent to second-generation TKIs, mostly within or around the catalytic domain such as the phosphate binding loop (P-loop, ATP binding site) or activation loop [20]. Some of the most frequent occurring mutations, that account for about 85% of resistant cases, include M244V, G250E, Y253F/H, E255K/V (all P-loop), V304D (SH3 contact), T315I (adjunct to IM binding site), M351T and F359V (SH2 contact) [36, 37]. The T315I mutation arises in 4-19% of resistant cases on IM therapy and is resistant to all ABL1 kinase inhibitors except the newly developed TKI Ponatinib [32, 36].  One issue that has recently gained interest is the occurrence of BCR-ABL1 compound mutations that represent a change of 2 or more altered amino acid residues within the same BCR-ABL1 allele [38]. They are believed to be selected for under the pressure of TKI therapy and more than 60 different mutations have been already reported to be associated with TKI resistance [38-42]. Compound mutations that include T315I have been established in unsuccessful ponatinib trials, signifying an additional clinical challenge [33, 40].  Another mechanism that contributes to resistance is the amplification of BCR-ABL1 itself. This enhances genomic instability and may increase expression of BCR-ABL1 and other mutant genes [4, 43, 44]. Taken together, BCR-ABL1 is not only a driving force in CML, but a subset of clinical resistance to TKI therapy can be explained by BCR-ABL1 alterations.         1.3.2 BCR-ABL1-Independent Resistance The notion that none of the presently available TKI monotherapies is generally curative despite effective BCR-ABL1 inhibition has led to several investigations regarding BCR-ABL1-independent mechanisms of TKI resistance.   6  One of the most critical drawbacks to successful CML therapy is the concept that TKIs fail to eliminate primitive, quiescent leukemic stem cells [4, 35, 45-47]. In general, it is believed that the BCR-ABL1 fusion occurs in a HSC whose progeny acquire a survival and proliferation advantage over normal cells, giving rise to and sustaining the CML clone (Figure 1.2) [4, 48]. Although these leukemic stem cells are not very well defined, they seem to share many characteristics with their normal counterparts, such as quiescence, self-renewal ability and differentiation capacity [48-50]. CML stem cells are considered to be the root of CML and constitute a critical source of disease recurrence and a significant reservoir for the emergence of TKI-resistant subclones [4, 51]. These ideas are supported by the observations that BCR-ABL1 transcripts remain detectable by sensitive quantitative Real-time PCR (Q-RT-PCR) in samples from CML patients with clinical remission and that about 60% of patients show molecular relapse when TKI treatment is discontinued, suggesting that TKI therapy does not eradicate all diseased cells [4, 28-30, 35, 46, 52]. Several studies have indicated that the unique properties of leukemic stem cells may add to the insensitivity to TKI therapy. CML stem cells are believed to be mostly quiescent in nature, are not strictly dependent on the tyrosine kinase activity of BCR-ABL1 for their maintenance, are protected by the BM microenvironment and may exploit or be influenced by alternative signaling pathways [4, 52-56].   In addition, it has been shown that the expression of various drug efflux and influx transporters can vary between different patients and may influence individual responses to TKI treatment due to insufficient therapeutic concentrations within cells [36, 37, 57]. For example, the drug efflux transporters ABCB1 (MDR-1) and ABCG2 display increased expression levels in CML patient cells, while the expression of the drug influx transporter OCT-1 is decreased. This 7  is of particular interest for IM therapy as an active process of cellular delivery, whereas the uptake of DA is more passive [36].  Furthermore, deregulated or alternative pro-survival signaling pathways such as KRAS, JAK2, PI3K and autophagy may compensate for the loss of the BCR-ABL1 kinase activity or contribute to TKI resistance, partially in yet to be identified details [58-62].   Altogether, further research in the area of BCR-ABL1-independent mechanisms to TKI treatments are highly needed and of great interest for future, novel drug developments to improve therapies and potentially a cure for CML.   8                                                                                                                         Figure 1.2: Schematic representation of the classical hierarchical concept of hematopoiesis. In this model long-term HSC (LT-HSC) constitute the top of the hierarchy and give rise to all myeloid and lymphoid lineages of the hematopoietic system. They are the only cells with long-term self-renewal ability (indicated by arrow) and thought to be the cell-of-origin with the BCR-ABL1 transformation driving leukemogenesis. Multipotent progenitor cells can be isolated with the help of the surface markers Lineage-CD34+CD38-, while oligopotent progenitors are characterized by Lineage-CD34+CD38+, and lineage-restricted progenitors and mature cells express lineage markers (Lineage+) but not CD34. ST-HSC = short-term HSC; MPP = Multipotent Progenitor; CLP = Common Lymphoid Progenitor; CMP = Common Myeloid Progenitor; MEP = Megakaryocyte/Erythrocyte Progenitor; GMP = Granulocyte/Macrophage Progenitor. 9  1.4  BCR-ABL1-Activated Signaling  The BCR-ABL1 protein kinase is key to CML and as such activates and interacts with multiple components of various signaling cascades conferring a survival and proliferation advantage of malignant cells and resulting in the deregulated expansion of all compartments downstream of the CML stem cell (except T and NK cell lineages).   Three of the major signaling pathways that are perturbed by the steady presence of BCR-ABL1 in the cytoplasm and continuous activity of the kinase, directly or indirectly via autocrine growth factor stimulation, include the JAK/STAT axis, RAS/RAF/MEK/ERK and PI3K/AKT signaling pathways.   JAK/STAT The JAK/STAT pathway consists of various gene family members such as JAKs, the Janus family of tyrosine kinases (JAK1, JAK2, JAK3, TYK2), STATs, the signal transducers and activators of transcription family (STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6), and the CIS/SOCS proteins that inhibit JAK activity by targeting them for proteasomal degradation [63-66]. In particular, JAK2 and STAT5 have been well studied in the context of BCR-ABL1 and leukemogenesis [67-71]. JAK2 has been confirmed to be able to phosphorylate BCR-ABL on tyrosine-177 (Y177), a key event to stimulate BCR-ABL1 kinase activity [70]. On the other hand, it has been shown that the activity of the BCR-ABL1 kinase can directly enhance JAK2/STAT5 signaling [67, 71]. Once activated, JAKs promote the formation of STAT dimers, which locate to the nucleus to stimulate transcription of target genes such as Bcl-XL as in the case of STAT5 to inhibit apoptosis [72, 73]. 10  STAT5 is constitutively active in BCR-ABL1-positive cells, and over-expression of STAT5 in murine cells leads to a phenotype that looks like BCR-ABL1-induced CML, while STAT5 knockout mice do not develop BCR-ABL1-induced CML-like disease [74, 75]. Furthermore, inhibition of STAT5 by small molecules reduces CML cell survival [71, 76], and very recently, one study has shown that PPARγ agonist treatment decreases STAT5 expression effecting the survival of primary, quiescent CML cells [77].   Noteworthy, in contrast to STAT5, JAK2 was not essential to initiate and maintain myeloid leukemia in a BCR-ABL1 mouse model, suggesting that BCR-ABL1 may directly activate STAT5 [78, 79]. Nevertheless, it has been revealed that shRNA- and inhibitor-mediated suppression of JAK2 or IM treatment in CML cell lines results in decreased activity of STAT5 [70, 71, 80]. In addition, JAK2 inhibitors have shown promise in targeting primary and TKI-resistant CML cells [80-82].      RAS/RAF/MEK/ERK  The RAS/RAF/MEK/ERK signal transduction pathway is one of the most prominent and a central signaling pathway deregulated in cancer that promotes cell proliferation while preventing cell apoptosis [83]. RAS signaling starts with the binding of GRB2 with its SH2 domain to the activated GRB2-binding site Y177 within the BCR portion of BCR-ABL1, leading to the recruitment of the scaffold adaptor GAB2 [84]. The GRB2/GAB2 protein complex then binds the GDP/GTP exchange factor SOS to cause activation of the small G-protein RAS [85-87]. Active, GTP-bound RAS recruits RAF and phosphorylates the kinase MEK1/2 followed by the activation of the downstream kinase ERK1/2 (MAPK1/2) by phosphorylation [87]. This results in the dimerization of ERK1/2 proteins, that enter the nucleus and activate the 11  transcription of several target genes including CREB, c-MYC, c-Jun/c-Fos, and NFκB [83, 88]. Studies have shown that disruption of this pathway by dominant-negative forms of RAS impair BCR-ABL1 transformation and CML-like myeloproliferative disease in mouse models [86, 89]. In addition, targeting of MEK1/2 by small-molecule inhibitors led to apoptosis of CML stem/progenitor cells in vitro [90, 91].  PI3K/AKT Similar to RAS/MAPK signaling, BCR-ABL1 can stimulate the PI3K/AKT pathway via the GRB2/GAB2 proteins to target other kinases and transcription factors that regulate cell cycle progression, survival, metabolism and mediate anti-apoptotic functions [84]. The PI3K enzymes belong to various classes with the heterodimeric proteins of the class 1A category being activated downstream of tyrosine kinases such as BCR-ABL1 [92, 93]. The 85-kDa regulatory subunit of PI3K recognizes and binds through its SH2 domain phosphorylated tyrosines on GAB2. This leads to phosphorylation of the PI3K catalytic subunit p110 and activates PI3K, that in turn converts phosphatidylinositol-4,5-diphosphate (PIP2) to phosphatidylinositol-3,4,5-triphosphate (PIP3) [93, 94]. Membrane-bound PIP3 serves as docking site for proteins with pleckstrin homology domains such as PDK-1 and AKT, resulting in the phosphorylation (at S308) and activation of AKT by PDK-1. AKT is the key downstream effector of the PI3K signaling cascade and once activated, targets many substrates including GSK3β, FOXO transcription factors, anti-apoptotic BAD, Caspase-9, Mdm2, IκK of the NFκB pathway, and the mTOR signaling cascade [95, 96]. GSK3β is a serine/threonine kinase that is also involved in multiple downstream signaling events and rendered inactive through phosphorylation by AKT, allowing, for example, β-catenin to be stabilized and to translocate to the nucleus, where it associates with LEF/TCF and 12  activates transcription of target genes such as cyclin D1 or c-MYC [97-99]. AKT also phosphorylates members of the FOXO transcription factor family, resulting in their cytoplasmic sequestration or degradation and abolished activity of FOXO target genes such as p27KIP, Bim and TRAIL [100, 101]. In addition, it has been revealed that the PI3K/AKT pathway stimulates mTOR signaling [102, 103]. AKT is thought to mostly regulate mTOR activity indirectly by phosphorylating TSC2 that suppresses mTOR via the TSC1/TSC2 complex. Following that, Rheb is released from the TSC1/TSC2 complex and activates mTOR that targets the ribosomal kinase p70S6K as well as the protein translation inhibitor 4EBP-1 [103, 104]. Consequently, mTOR signaling controls protein synthesis, cell size and has been reported to be involved in autophagy regulation.   PI3K/AKT signaling has been shown to be crucial for the BCR-ABL1-dependent transformation of hematopoietic cells and CML maintenance, while PI3K inhibition synergizes with IM and induces apoptosis of primitive CML cells [105, 106]. Moreover, PTEN is an inhibitor of the PI3K/AKT signaling cascade and frequently down-regulated in CML [107, 108].  In summary, all of the described signaling pathways are influenced and deregulated by the abnormal activity and interactions of BCR-ABL1 with cytoplasmic proteins, and these interactions converge into the same phenotype: they disrupt key cellular processes such as control over cell proliferation and apoptosis in favor of expanding the leukemic clone.   1.5  Autophagy  Another cell survival mechanism, that has been shown to play a critical role in many cancers, including CML, is autophagy. Three primary types of autophagy have been described: 13  macroautophagy, microautophagy and chaperone-mediated autophagy, with macroautophagy being the best characterized and most studied form of cargo delivery to the lysosome.   1.5.1 Macroautophagy and the Critical Functions of ATG4B   Macroautophagy (autophagy hereafter) is a highly-conserved and organized, catabolic process that enables cells to degrade cytoplasmic proteins and damaged organelles to recycle nutrients and critical amino acids during conditions of stress or starvation to counteract cell damage or cell death [109]. The process begins with the initiation and elongation of vesicles with a double-membrane, called autophagosomes, that fuse with lysosomes to form autolysosomes, where the sequestered content is degraded via the activity of proteases (Figure 1.3) [110, 111]. Each step involves numerous autophagy-related (ATG) genes and their protein products that tightly regulate the formation and maturation of the autolysosome in a specific sequence [112]. More than 30 different ATG’s have been revealed to be important for the autophagic process in the yeast model system Saccharamyces cervisiae, and most components are conserved in mammals [113, 114]. Among these proteins are ATG4, and the tumor suppressor BECLIN-1, ATG5 and ATG7. BECLIN-1 is part of a PI3K complex that initiates the formation of the isolation membrane of the autophagosome, whereas ATG4, ATG5 and ATG7 contribute to the following elongation phase [115-117]. A major event in the autophagy cascade is the proteolytic cleavage of cytoplasmic microtubule-associated protein 1 light chain 3 B (pro-LC3) to generate LC3-I with an exposed critical internal glycine residue to enable the conjugation to phosphatidylethanolamine (PE), generating lipidated LC3-II that associates with autophagosome membranes. This step is the hallmark of autophagosome creation and used to assess and monitor autophagy in cells [118]. The key reactions are catalyzed by the cysteine protease ATG4 and are 14  indispensable for membrane closure and recycling of LC3-II from autophagosomal membranes [119-122]. In contrast to a single ATG4 form identified in yeast, mammals express 4 different ATG4 family members (ATG4A, B, C, D) [123]. Among the various ATG4’s, ATG4B has the broadest substrate spectrum for different LC3 isoforms (LC3A, LC3B, LC3B2, LC3C) and GABARAP’s (GABARAP, GABARAPL1, GABARAPL2, GABARAPL3), and cleaves LC3B with a 1500-fold higher catalytic efficiency over the other ATG4 family members [124-127]. In addition, ATG4B and LC3B have been reported to be essential for amplifying and sustaining an autophagic response [119]. In accordance with that, ATG4B knockout mice display a global reduction in autophagy [123].   Figure 1.3: Overview of the autophagic process. Macroautophagy occurs in distinct steps that lead to degradation and recycling of cytoplasmic components to maintain cellular homeostasis during times of altered nutrient needs or stress. The process begins with the formation of a double-membrane structure, the pagophore that elongates and matures into an autophagosome, sequestering the cytoplasmic cargo. The autophagosome fuses then with a lysosome, generating 15  an autolysosome, and the engulfed content is degraded through proteases and amino acids, fatty acids, sugars and nucleosides are released back into the cytosol. Various indicated ATG proteins and complexes facilitate certain steps in this catabolic pathway. In addition, the conversion of LC3-I to LC3-II and the degradation of p62 together with the enclosed cargo, serve as markers of active autophagy in molecular and immunochemical assays. CQ/HCQ treatment inhibits autophagy and also leads to an increase of LC3-II levels in these cells, but p62 accumulates.               1.5.2 Autophagy in Cancer Including CML  Although autophagy is a well-studied, catabolic process that takes place at basal levels in the majority of mammalian cells, its various functions in tumor cells are complex and likely depend on the stage of the cancer and the type of tissue affected [128, 129]. While this degradation pathway may be tumor suppressive by preventing the initial transformation of healthy cells, autophagy has also been identified to accelerate tumor growth or in association with poor prognosis outcomes in some cancers [130-132]. In addition, numerous reports highlight a cytoprotective role of autophagy, where the pathway causes resistance to traditional chemotherapeutics, making it an attractive target for combination treatments [133-135].  Similarly to other cancers, the roles of autophagy in the regulation of hematopoiesis and pathogenesis of leukemia have yet to be fully explored. A few recent reports indicate that autophagy is induced upon IM treatment in CML cell lines and primary patient samples, and that this phenomenon contributes to the recovery of some cells from treatment [136-140]. Interestingly, several studies revealed that targeting autophagy by genetic or inhibitor approaches augments the activity of TKIs in drug resistant and primitive CML cells [137, 141-143]. For example, suppressing critical autophagy proteins such as BECLIN-1, ATG5 or ATG7 by RNA interference was effective in sensitizing BCR-ABL1-positive cells, including primary cells from CML patients, to IM treatment in vitro and hence, enhanced cell death significantly compared to IM treatment alone [137]. In addition, two reports demonstrated that pharmacological inhibition 16  of autophagy by the compound Spautin-1 or chloroquine (CQ) in combination with TKIs was more effective than single agents in reducing the growth of K562 and primitive CML cells in vitro [137, 143]. CQ and its derivatives (e.g. Hydroxychloroquine, HCQ) are broad-spectrum autophagy inhibitors that block late stage autophagy by increasing the pH of lysosomes, rendering critical proteases non-functional and consequently, preventing the degradation of cargo in autolysosomes. Currently, CQ and HCQ are utilized in 33 clinical trials to treat various cancers, including one ongoing clinical trial in the UK examining the combination regimen IM and CQ in CML (CHOICES: Chloroquine and Imatinib Combination to Eliminate Stem Cells, T. Holyoake, unpublished). However, one recent study suggested that the potential anti-cancer effects of CQ may be due to off-target effects rather than effective autophagy inhibition, emphasizing the need for novel, more specific and potent autophagy inhibitors [144].     In summary, the current evidence suggests that autophagy may play an important role in CML stem/progenitor cell survival and their response to TKIs. However, details about the regulation of this process and the molecular basis for these observations in primitive CML cells are largely unknown.          1.6  The Stem Cell Niche 1.6.1 The Bone Marrow Microenvironment The behavior of individual cells is not only determined by cell-intrinsic properties, but also influenced by external cues mediated through cell-cell interactions, protein components or other soluble metabolites that can initiate a specific response. Increasing evidence indicates that interactions and signals of the surrounding microenvironment with cancer cells and vice versa in vivo are critical to disease progression and therapy resistance.  17  Similar to normal HSC, leukemic stem cells are believed to reside in a specialized microenvironment of the BM compartment and that their properties are very likely regulated in association with niche elements [145-148]. The human BM compartment consists of a multi-functional, heterogeneous and dynamic network of cells, extracellular matrix (ECM) and secreted as well as bound soluble factors that provide a physical site where quiescence, survival, self-renewal, proliferation and differentiation of HSC are mediated and balanced [149-151]. Thus, the niche plays an important role of regulating the functioning of HSC in vivo [152].  The term “stem cell niche” was first proposed by Raymond Schofield in 1978, and recent technological advances and investigations have shed light on its complexity and dynamic nature [153-155]. The BM niche has been shown to include various cell types such as mesenchymal stem cells (MSC, that can further differentiate into fibroblasts, adipocytes, chondrocytes and myocytes), osteoblasts, osteoclasts, endothelial cells, megakaryocytes, macrophages and nerve cells [145, 154, 156]. Historically, it was thought that HSC are either located in the ‘endosteal niche’ on the surface of trabecular bones populated with osteoblasts, or in the ‘vasculature niche’ around sinusoidal blood vessels and arterioles [157, 158]. However, modern imaging approaches of HSC in their native BM cavity in mice revealed that although HSC can be observed in osteoblast-rich trabecular bones, most HSC (~ 85%), including non-dividing stem cells, are detected in close proximity to sinusoids and in direct contact with Leptin-positive and CXCL12high niche cells throughout the BM [155, 159, 160]. Activation of HSCs followed by release into the peripheral blood versus maintaining a quiescent state may be influenced by various direct and indirect means such as cell interactions, secreted cytokines, chemokines, growth factors and possibly other contributors. For example, vascular endothelial cells and perivascular mesenchymal stromal cells express the chemokine CXCL12 [161, 162]. CXCL12 18  binds to its receptor CXCR4 expressed on HSC and hematopoietic progenitor cells [163, 164]. The chemotactic interaction between CXCL12 and CXCR4 is crucial for the retention of HSCs in the hematopoietic microenvironment and for the marrow specific homing of circulating HSCs [165, 166]. Interestingly, it has been reported that the expression level of CXCR4 on CML cells is decreased due to the activity of the BCR-ABL1 kinase, but can be highly up-regulated during IM treatment and even further through MSC co-cultures in vitro [167, 168]. Indeed, it has been shown that the direct contact between MSCs of BM origin and CML cells effectively protects leukemia progenitors from IM-induced cell death [169]. Moreover, it was demonstrated that MSC confer resistance to IM treatment in otherwise IM-sensitive CML progenitors via the CXCR4/CXCL12 axis [169]. On the other hand, several studies with various CXCR4 antagonists have proven anti-leukemia activities and are able to overcome the stroma-induced protection of leukemic cells in vitro and in vivo [170-173]. In addition, a recent report indicated that a novel CML stem cell marker, CD26, is involved in the deregulation of the CXCL12/CXCR4 signaling axis and may serve as a therapeutic target to decrease the spread of BCR-ABL1-positive cells [174, 175].  Numerous other signaling pathways are also involved in mediating the reciprocal communication and interactions between leukemic stem cells and the BM microenvironment. Some of the signaling cascades that have been implicated in stem cell fate control include the Wnt/β-catenin, Hedgehog, Notch and JAK/STAT pathways [55, 176-179]. It is also becoming increasingly evident that these signaling cues play major roles in the resistance of CML stem cells to TKI therapies and hence, present potential novel targets for treatment to eliminate cancer stem cells in CML patients [55, 77, 180]. Of particular interest is STAT3 that has been recently described as a “major signaling node conferring TKI resistance” [56]. A few studies have shown 19  that co-culture of CML cells with mesenchymal stromal cells or conditioned medium induces and increases the phosphorylation of STAT3 (Y705) in CML cells [56, 181, 182]. Moreover, treatment with IM or other TKIs could not reduce nor abolish this effect, respectively, indicating a BCR-ABL1 kinase-independent mechanism [56]. Interestingly, CML cells derived from TKI-resistant patients, but without BCR-ABL1 kinase mutations, also revealed elevated p-STAT3 levels in ex vivo cultures in the absence of BM-derived factors [56]. These data suggest STAT3 may be a key hub in combining extrinsic and intrinsic TKI-independent resistance pathways in CML making it an attractive therapeutic target.               1.6.2 Extracellular Matrix Shapes the Stem Cell Niche    The extracellular matrix (ECM) is crucial in the stem cell niche by providing architectural structure and instructive power to ensure a well-controlled balance between self-renewal and differentiation of stem cells [183]. The most compelling evidence for the importance of the ECM in determining the properties of stem cells and tissue specificity comes from experiments with de-cellularized organs with the ECM preserved. These studies demonstrate that natural ECM scaffolds guide stem cells to differentiate into the types of cells belonging to the original tissue from which the ECM was obtained [184]. The molecular composition, type of macromolecules present and their three-dimensional organization in the ECM provide a specific niche in various tissues which is complex and can be dynamically adjusted to finely tune stem cell behavior [185]. ECM proteins that can be most abundantly found in the BM include fibronectin, collagens I-XI, laminin, elastin, tenascin and thrombospondin [151, 186, 187]. In addition, proteoglycans with their large side chains such as hyaluronic acid or heparin sulfate, 20  soluble factors such as various growth factors and ECM-associated soluble or membrane-bound glycoproteins are important to the integrity of the ECM [188-190].   Interactions of the ECM with stem cells via cell surface proteins and transmembrane receptors fulfill three major but crucial functions for stem cells: (1) they allow cell-anchorage, (2) they provide a local reservoir for the bioavailability of growth factors to regulate intracellular signaling cascades and (3) they permit biomechanical stiffness to influence mechanotransduction [183, 185, 189]. Hence, it is this crosstalk between the ECM and stem cells that ensures tissue polarity and homeostasis in the stem cell niche, control of cell division, differentiation and cell migration. Key mediators for the binding of cells to the ECM are integrins, which are heterodimeric transmembrane receptors [191]. They connect the extracellular environment to the intracellular cytoskeleton of the cell and are a research area of growing interest to better understand the stem cell niche architecture and regulation of stem cell properties [183].          1.6.3 Integrins Mediate Extracellular Matrix-Stem Cell Interactions   Integrins belong to a large family of transmembrane receptors that form heterodimers on the surface of the cell to facilitate a bidirectional communication between external cues and intracellular signals across the cell membrane [191]. This crosstalk between the ECM and integrins, but also with growth factor and cytokine receptors, triggers a variety of specific responses and is crucial within the stem cell niche for adhesion, migration, self-renewal, survival, proliferation and differentiation of stem cells [192].  In total, 18 alpha (α) and 8 beta (β) subunits can constitute 24 distinct integrin heterodimers that are expressed in a cell-type specific manner and bind to a number of different ECM components or other adhesion molecules and cell surface receptors [193]. For example, α4, 21  α6, α9 and β1 integrins are expressed on HSC and have been reported to be essential in the homing of HSC to the BM niche after transplantation into irradiated mice [194-196]. Furthermore, β1 integrins have been shown to regulate stem cell fate by controlling the orientation of the mitotic spindle which influences the balance between symmetric versus asymmetric cell divisions [197-199]. In addition, a study with engineered, artificial 3D matrices revealed that binding and activation of β1 integrins induces the expression of a transcriptional profile associated with ‘stemness’ in embryonic cells [200].   Leukemic cells express the integrins β1, β2, and α4β1 that bind to the adhesion molecule fibronectin in the BM microenvironment [201]. Upon binding, the PI3K/AKT/BCL-2 signaling cascade is activated and confers survival of leukemic blast cells [201].     Another extensive area of research involves the cooperation, transactivation and pathway modulation of integrins with growth factor and cytokine receptors in normal and patho-physiological processes [192, 202-206]. Integrins of the subfamilies β1, β4, β7, and α5 have been confirmed to be able to potentiate growth factor signaling pathways in response to IL-3 and TGF-β [204-206]. Moreover, a study illustrated that the IL-3 receptor β common subunit (IL-3Rbc) can physically interact with β1-integrins and that this may be important in the tumor microenvironment [205, 206]. Interestingly, IL-3 and TGF-β stimulated signaling has been shown to be critical in CML and increases survival, self-renewal and proliferation capacities of diseased cells [207-210].                   Importantly, unlike other transmembrane receptors, integrins themselves do not possess any detectable enzymatic activity [192]. Integrins are believed to exert most of their effects by recruiting and assembling different intracellular partner-proteins and complexes, for example focal adhesions, and by binding kinases such as focal adhesion kinase (FAK), PI3K or Integrin-22  linked kinase (ILK) that activate downstream signaling events [192, 211-213]. In particular, ILK has been shown to be involved in many deregulated pathways in a variety of different cancers drawing attention as a potential therapeutic target.           1.7  Integrin-Linked Kinase  1.7.1 Moderator of Integrin Signaling  One of the key mediators of integrin signaling is ILK [213], which was identified through a yeast two-hybrid screen as a binding partner of β1-integrins in 1996 [214]. Since then, numerous studies have confirmed the fundamental roles of ILK as a critical focal adhesion component, a hub for multiple signaling pathways and its importance in mitosis, to regulate various cellular processes such as cell growth, proliferation, differentiation, migration, angiogenesis and invasion in normal and cancerous cells [192, 213, 215, 216].     Interactions between integrins and ECM components are accompanied by the recruitment of several cytoskeletal and regulatory proteins to specialized cell adhesion sites at the cell cortex known as focal adhesions [217, 218]. Focal adhesions are large, multi-protein complexes that serve as intracellular scaffolds and sensory structures between the surrounding microenvironment and the interior of the cell, and they are required for integrin-mediated adhesion as well as integrin signaling [216, 219, 220]. One prominent constituent of focal adhesions is the multi-functional protein ILK [213, 221, 222]. ILK binds to the cytoplasmic domain of β1- as well as β3-integrins, and functions as both a structural hub that connects integrins to the actin (via α/β-PARVINs and paxillin) and microtubule cytoskeleton [214, 223, 224], and as a signaling platform that integrates and propagates signals from the ECM and soluble ligands to intracellular signaling pathways to determine cell fate [213, 225-227]. 23  Moreover, ILK has been illustrated to not only be crucial to the structural integrity of mature focal adhesions, but also to play an important role in the initial formation of adhesive structures called focal complexes [216]. Fibroblasts depleted of ILK display disorganized actin filaments, and ILK knockout mice and Xenopus laevis models are embryonic lethal due to defects in establishing polarity and proper adhesion [228, 229].   Despite some initial controversies, ILK has been confirmed to be a bona fide serine/threonine kinase that is able to phosphorylate and control a diverse set of downstream effectors (Figure 1.4) [214, 230, 231]. Upon engagement of integrins with the ECM, ILK is activated in a PI3K-dependent mechanism in focal adhesions and can, for example, directly phosphorylate AKT on S473, which in turn can activate NFκB or inhibit caspase pathways suppressing apoptosis and promoting angiogenesis and increased invasiveness of cells [215, 221, 232]. A second key downstream target of ILK is GSK3β. ILK mediates the phosphorylation and subsequent inhibition of the activity of GSK3β that leads to the nuclear translocation of β-catenin and thus, increased expression of cyclin D1 [215, 233]. An elevation in cyclin D1 protein levels results in the stimulation of CDK4 activity, which promotes hyperphosphorylation of the retinoblastoma protein, a key step in the transition of cells from the G1 to S-phase of the cell cycle [221]. Additionally, the inhibition of GSK3β causes not only an accumulation of β-catenin in the nucleus, but also increases the abundance of intracellular fragments of Notch in the nucleus of HSC, which results in the activation of Notch targets such as Hes1 and thus, promotes self-renewal of these cells [234, 235]. Furthermore, ILK can regulate cell migration and cytoskeletal organization by activating PIX (PAK-interactive exchange factor), a guanine-nucleotide exchange factor for Rac1 and Cdc42 [236]. The confined regulation of all of these 24  cellular processes is critical for tissue homeostasis and their deregulation is highly implicated in the development of cancer and tumor progression [213].                                     Figure 1.4: ILK is abundantly localized in focal adhesions and activates several pro-survival signaling pathways. Upon integrin engagement with the ECM, integrins undergo conformational changes and recruit integrin-interacting partners to the cell cortex to transmit extracellular cues to the cell. PI3K is activated through focal adhesion kinase (FAK) and leads to clustering and co-activation of focal adhesion components, including ILK. Stimulated ILK maintains upstream signaling to β1-integrins and activates downstream signaling cascades such as GSK3β/β-catenin, AKT, and STATs, promoting survival, proliferation, self-renewal and maintenance of primitive CML cells and may also influence cell responses towards TKIs. In addition, ILK is involved in linking integrins to F-actin, ensuring structural integrity. PTEN is a negative regulator of ILK activity.     Although ILK is most abundantly found in focal adhesions, recent investigations revealed that ILK is also localized in centrosomes, where it is critically involved in centrosome clustering and in the regulation of the correct mitotic spindle assembly and orientation [237-240]. Studies 25  in epithelial cells have shown that symmetric versus asymmetric cell division determines if a stem cell generates to identical stem cells or if it gives rise to two different cells: one stem cell and one progenitor that can differentiate [199, 241]. Either of these two options is controlled by the proper placement of the mitotic spindle that will create the cell division plane and has been shown to require ILK and α-PARVIN in epithelial cells [242, 243]. Deviations from this guarded mechanism may also play a role in stem cell exhaustion and abnormal growth of progenitors [240, 244].    1.7.2 Integrin-Linked Kinase in Cancer  Several studies have shown that the expression levels of ILK and its activity are low in healthy cells but increased in many types of cancer, including breast, brain, prostate, colon, gastric, ovarian, pancreatic cancer, AML and malignant melanomas [245-249]. Moreover, various investigations have revealed that in some human malignancies the expression levels of ILK correlate with tumor progression and are inversely related to patient survival [233, 250], making it an attractive target for therapeutics. Considerable evidence has also demonstrated that ILK can be successfully targeted and thus, the oncogenic effects of ILK in several cancers can be reversed [227, 251-253]. By utilizing RNA interference or antisense oligonucleotides, the expression of ILK can be down-regulated, whereas small-molecule inhibitors (e.g. QLT0267, a second generation competitive ATP inhibitor) abrogate its kinase activity [231, 254]. For example, siRNA-mediated depletion of ILK in different cancer-cell line models has been shown to impair the phosphorylation of AKT at S473 resulting in the induction of apoptosis of these cells in vitro [213, 255] and in vivo [256]. Furthermore, defects in adhesion and spreading of cells were observed in melanoma cells upon ILK-depletion [253], while another study revealed 26  that targeted ablation of ILK in the mammary gland is required for the initiation phase of ErbB2-induced tumors in vivo [257]. Of clinical relevance is the possible use of pharmacological ILK inhibitors in vivo. Several investigations indicate that ILK inhibitor applications reduce tumor growth and suppress angiogenesis in various mouse models, such as breast, orthotopic pancreatic, lung-cancer, and thyroid xenografts [227, 256, 258-261]. A few studies suggested that the activation of ILK is a critical pro-survival pathway in CML and AML cells, and that treatment of primary AML cells with the specific ILK inhibitor QLT0267 in combination with FLT-3 abrogation or LY294002 (a PI3K inhibitor) decreases survival of primitive leukemia cells, but mainly spares normal HSC and progenitors, in the absence or presence of stromal cells [262-264]. These findings are promising since leukemic stem cells in CML also display a significant therapeutic challenge, which might be overcome with improved treatment strategies targeting BCR-ABL1 and cooperative signaling pathways involved in BM niche interactions.  1.8  Thesis Objectives   The overall objective of my thesis was to identify and characterize how CML stem and progenitor cells survive, even when they are targeted by BCR-ABL1 TKIs, through intrinsic and BM niche associated mechanisms to potentially identify novel therapeutic targets and combination treatment strategies in CML capable of eradicating TKI-insensitive cells. In order to explore various possibilities, I focused my work on two projects:  1. The importance of core ATG genes and their possible deregulated expression in primitive leukemic cells to exploit autophagy in CML.  2. The role of the focal adhesion component ILK in mediating TKI response/resistance of CML stem and progenitor cells in vitro and in vivo.  27  Previous studies have shown that IM treatment induces autophagy in CML cells and that this process is critical to the survival of primitive leukemic stem and progenitor cells upon IM therapy [137, 139, 142, 265]. However, it was not known whether the autophagy process differs at basal levels between CML patients and healthy individuals and if pre-treatment CML cells harbor unique autophagy characteristics that could determine if a patient will respond to TKI therapy or not and be utilized as possible targets for therapy. First, I hypothesized that treatment- naïve CML stem/progenitor cells harbor a unique autophagy gene expression profile that could be predictive of a patient’s clinical outcome. The work described in Chapter 3 outlines how I started to investigate the expression levels of several key autophagy genes in CD34+ CML stem/progenitor cells and how I identified ATG4B as a potential biomarker in CML. Moreover, I observed that knockdown of ATG4B impaired autophagy in primary CD34+ CML cells and sensitized them to IM treatment. These findings led me to hypothesize further that the simultaneous inhibition of ATG4B-mediated survival pathways and BCR-ABL1 kinase activity by novel ATG4B inhibitors and TKIs represents a new therapeutic approach to overcome TKI-resistance in CML. Therefore, Chapter 3 also includes how I started to test novel ATG4B compounds.  Chapter 4 begins with the presentation of my RNA-seq analysis with respect to focal adhesion components. Focal adhesions are crucial in mediating interactions between the BM microenvironment and stem cells to determine cell survival, proliferation, self-renewal versus differentiation and migration [216, 219, 220]. In addition, growing evidence indicates that interactions of cancer cells with their microenvironment in vivo can influence disease progression and therapy resistance, including in CML [169, 171]. I discovered that the focal adhesion component ILK is highly expressed, but deregulated, in CD34+ CML patient cells 28  compared to the same cells from healthy individuals. Furthermore, my follow-up experiments revealed that ILK expression is increased in the Lin-CD34+CD38- stem cell-enriched CML population and increases in CML patient cells following their co-culture with stromal cells. Based on these results, I hypothesized that ILK mediates TKI response/resistance of CML stem and progenitor cells by enhancing BM niche interactions and/or activating pro-survival pathways in primitive CML cells. Hence, the combined suppression of the BCR-ABL1 and ILK kinase activities is effective in eliminating CML stem and progenitor cells in vitro and in vivo. The work I performed to investigate and illustrate these possibilities is presented in Chapter 4.     29  Chapter 2: Materials and Methods  2.1 Cell Culturing and Sorting 2.1.1 Cell Lines The human CML BC cell lines K562, IM-resistant K562 (IMR K562; no BCR-ABL1 kinase mutations; kindly donated by Dr. A. Turhan, University of Poitiers, France), BV173, and the AML cell lines UT7, UT7-BCR-ABL1, UT7-BCR-ABL1-T315I were maintained in Rosewell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum (FBS) unless stated otherwise, 100 U/mL penicillin, 0.1 mg/mL streptomycin, and 10-4 M β-mercaptoethanol (STEMCELL Technologies, Vancouver, BC), at 37°C, 5% CO2, in a humidified cell culture incubator. In addition, GM-CSF (5 ng/mL) was added to UT7 cells. All cells were cultured at a cell density of less than 1.5 × 106 cells/mL as suspension cultures in 10 cm Falcon® tissue culture dishes (Corning).  2.1.2 Human Cells Heparin-anticoagulated peripheral blood (PB) or BM cells were obtained from newly diagnosed CML patients, prior to TKI therapy, and from healthy adult donors (ALLCELL). Informed consent was obtained in accordance with the Declaration of Helsinki and all procedures used, were approved by the Research Ethics Board at the University of British Columbia. Mononuclear cells were isolated using Lymphoprep (STEMCELL Technologies) density gradient separation and CD34+ cells (>85%) were enriched immunomagnetically using the EasySep CD34 positive selection kit (STEMCELL Technologies). Purity was verified by re-30  staining isolated cells with an allophycocyanin-labeled (APC) anti-CD34 antibody (BD Biosciences) and by analyzing them on a fluorescence-activated cell sorter.  CD34+ cells were cultured in Iscove’s medium plus bovine serum albumin (BSA), insulin, transferrin (STEMCELL Technologies) and 10-4 M 2-mercaptoethanol (Sigma-Aldrich), + recombinant human growth factors (20 ng/mL IL-3, 20 ng/mL IL-6, 100ng/mL Flt3-ligand, and 20 ng/mL G-CSF; all from STEMCELL Technologies), + inhibitors and + stromal cells (M2-10B4, engineered to produce and secrete human IL-3, G-CSF, and stem cell factor; kindly donated by Dr. C. Eaves, BC Cancer Agency, Vancouver).   All CP CML samples studied were from patients that had not been previously treated with TKIs. Subsequent IM-responders (n=14) achieved complete hematologic remission within three months, major cytogenetic remission within 12 months, and complete cytogenetic remission within 18 months (criteria based on the European Leukemia Net treatment guidelines [266, 267]). Conversely, IM-nonresponders (n=14) were defined as individuals who did not achieve these responses or had subsequent evidence of loss of a response.  BCR-ABL1 mutations were not detectable in blood samples from IM-nonresponders.   2.1.3 Inhibitors IM was obtained from Novartis (Basel, Switzerland) and DA from Bristol-Myers Squibb (New York, USA). Stock solutions of 10 mM were prepared with ddH2O (IM) or DMSO (DA) and stored at -20°C. QLT0267 was provided by Dr. Shoukat Dedhar; stock solutions of 40 mM were prepared with DMSO and stored at -80°C. The ATG4B antagonist #1 (4Bi-1) was identified by intensive in silico screening of commercially available compounds based on the crystal structure of ATG4B by Dr. Jianghong An at the Genome Sciences Centre; stock solutions 31  of 20 mM were prepared with DMSO and stored at -20°C. The ATG4B inhibitor #2 (4Bi-2) was synthesized in Dr. Robert Young’s laboratory (SFU, Burnaby, Canada) and is an optimized version of compound 4Bi-1. 4Bi-2 was dissolved in DMSO at 10 mM and stored at -20°C. The ATG4B inhibitor #3 (4Bi-3) was identified in a high-throughput screening using a fluorescent peptide‐based assay [268], stock solutions prepared at 10 mM with DMSO and stored at -20°C. Chloroquine (CQ) was purchased from Sigma-Aldrich, stock solutions of 50 mM prepared with ddH2O and stored at -20°C.   2.1.4 Fluorescence-Activated Cell Sorting Mononuclear PB or BM sample cells were suspended in Hank’s buffer with 2% FBS and stained for 30 min at 4°C with anti-human CD38-Phycoerythrin (PE, STEMCELL Technologies) and CD34-APC (BD Biosciences) antibodies. CD34 subpopulations were sorted by FACS as described [4]. To measure autophagic flux, a Cyto-ID autophagy detection kit (Enzo Life Sciences) was used according to the manufactures instructions. Briefly, cells were harvested after treatment, washed and stained for 30 min with Cyto-ID dye on ice and then analyzed by FACS.   2.2 Molecular Techniques and Immunoassays 2.2.1 RNA-Extraction Total RNA was extracted with TRIzol (Life Technologies) [269]. Glycogen (Life Technologies) was added as a carrier to facilitate visibility of the RNA pellet. RNA was dissolved in RNase- and DNase-free ddH2O (Life Technologies) and the concentration determined with a Nanodrop instrument (Thermo Scientific).  32  2.2.2 Quantitative Real-time PCR   100-200 ng RNA was reversed transcribed into cDNA with the high capacity cDNA reverse transcription kit (Life Technologies) according to the manufacturer’s instructions. Quantitative real-time PCR (Q-RT-PCR) was performed with 6 µL of a 2X SYBR Green PCR Master Mix (Life Technologies), 1 µL of 20 µM gene specific primer solutions, 1 µL cDNA and 10.5 µl ddH2O on the 7500 Real Time PCR System (Applied Biosystems). SYBR served as reporter dye and ROX as passive reference. Data for each sample were analyzed with the ∆∆Ct method with β2-microglobulin (β2M) as control, and then compared to normal BM values and expressed as relative transcript levels. Primers used are listed in Table 2.1.   2.2.3 Protein Extraction and Quantification To extract proteins, cells were incubated with a lysis buffer on ice for 30 min. The lysis buffer consisted of 440 μL phosphorylation solubilisation buffer (PSB), 50 μL NP-40 Alternative Protein Grade Detergent (Calbiochem), 5 μL of a 10% sodium dodecyl sulphate (SDS) solution, 2.5 μL phenylmethylsulfonyl fluoride (PMSF, Sigma-Aldrich) and 2.5 μL protease inhibitor cocktail (PIC, Sigma-Aldrich). The cell lysate was then centrifuged at 300 x g for 10 min at 4°C to pellet cell debris and membranes, and the supernatant containing the released proteins collected. The Bradford assay was used to quantify protein concentrations. In brief, Bio Rad Protein Assay Dye Reagent (Bio Rad) was diluted in ddH2O at a ratio of 1:5. Protein lysates were diluted at a ratio of 1:10 in ddH2O. Serial dilutions of purified bovine serum albumin (BSA) were used to generate a standard curve. 20 μL of diluted protein lysate and 200 μL of diluted Bio-Rad dye were combined in duplicates in a flat-bottom 96-well Falcon plate and the 33  absorbance of standards, controls and samples measured at 630 nm using an Elx808TM Absorbance Microplate Reader (BioTekk Instruments).   Table 2.1: Specific primers used for Q-RT-PCR of CML and normal BM cells Primer Name Sequence (5' to 3') ACTB-F2 GCACAGAGCCTCGCCTT ACTB-R2 GTTGTCGACGACGAGCG B2M-F1 TAGCTGTGCTCGCGCTACT B2M-R1 TCTCTGCTGGATGACGTGAG GAPDH-F AAGATCATCAGCAATGCCTCC GAPDH-R TGGACTGTGGTCATGAGTCCTT ATG4A-F2 GGATGACAGCTGGAGAATGG ATG4A-R2 GGAGATGCTGCTTCCCTAAG ATG4B-F ACTGGGAAGATGGACGCAG ATG4B-R AGTATCCAAACGGGCTCTGA ATG4C-F TGTTCAGGACTTCAAACGAGC ATG4C-R TCTCTGGAATGACCATTTACAAAA ATG4D-F CTCAACCCCGTGTATGTGC ATG4D-R TACAGTGAGTGTCGCGGTTT ATG5 1F TGATCCTGAAGATGGGGAAA ATG5 1R TCCGGGTAGCTCAGATGTTC ATG7-F CGGGGGCAAGAAATAATG ATG7-R CCCAACATCCAAGGCACTAC ATG12-F TTGTGGCCTCAGAACAGTTG ATG12-R CCATCACTGCCAAAACACTC Bec1-F1 GGAGAGGAGCCATTTATTGAAA Bec1-R1 AGAGTGAAGCTGTTGGCACTTT MAP1LC3B-F1 GAACGATACAAGGGTGAGAAGC MAP1LC3B-R1 AGAAGGCCTGATTAGCATTGAG ILK-F  TTTCAGGGTACCGAAGAA ILK-R  TCTGCAGAATTCTACTTGT   34  2.2.4 Western Blotting Samples for Western blot analysis were prepared with 20-40 μg protein lysate (cell lines) or 150,000 CD34+ cells directly lysed in PSB as described above, 4x SDS-loading buffer, and ddH2O. The samples were then heated at 90°C for 10 min and separated on 8%-15% SDS-page gels with 1.0 mm wells alongside a PageRuler Pre-stained Protein Ladder (Fermentas). The gels were run under reducing conditions at 80 V for 30 min, followed by 150 V for 1 hour. Proteins were then transferred from the electrophoresed gel onto a Polyvinylidene Difluoride (PVDF) membrane (Millipore) using NuPAGE Transfer Buffer (Invitrogen) at 33 V for 1.5 hours. Following that, the PVDF membrane was blocked in Tris-buffered saline Tween 20 (TBST) with 5% skimmed milk powder (Sigma-Aldrich) for 1 hour at room temperature (RT), washed twice briefly with TBST, and then incubated with a primary antibody under light agitation at 4°C overnight. After incubation with the primary antibody, the membrane was washed with TBST for 3x10 minutes and incubated with a corresponding secondary antibody (conjugated to horseradish peroxidase) for 1 hour at RT. Afterwards, the PVDF membrane was washed again with TBST for 3x10 min. Target proteins were visualized by incubation with an enhanced chemiluminescence reagent on a KODAK autoradiography film.  Primary antibodies used include anti-human ATG4B (Abcam), anti-ATG4D (Abcam), anti-ATG5 (Novus Biologicals), anti-human p62 (Sigma-Aldrich), anti-LC3B (LC3B D11 XP; Cell Signaling), anti-BECLIN-1 (Santa Cruz Biotechnology), anti-p-BCR-ABL1 (4G10, Millipore), anti-BCR-ABL1 (8E9, Abcam), anti-p-STAT3 (Y708, Cell Signaling), anti-STAT3 (Cell Signaling), anti-p-AKT (Cell Signaling XP D9E), anti-AKT (Cell Signaling), anti-p-GSK3β (Cell Signaling), anti-GSK3β (Cell Signaling), anti-ILK (BD Biosciences), and anti-β-Actin (Sigma-Aldrich).  35  2.2.5 Intracellular Staining CD34+ CML cells (1-2x105) were fixed with 4% paraformaldehyde, permeabilized with 0.2% saponine and stained with an anti-ILK1 antibody (1:100; Cell Signaling) or an IgG control at 4°C overnight, followed by incubation with a secondary antibody (anti–rabbit IgG FITC-conjugate, Invitrogen) for 1 hour on ice prior to FACS analysis. Intracellular ILK protein levels were determined as the geometric mean fluorescence intensity (MFI).   2.2.6 Endogenous LC3B Puncta Staining and Confocal Microscopy CD34+ CML cells (1-2x105) were seeded on poly-L-lysine coated slides for 10 min, fixed with 4% paraformaldehyde, permeabilized with ice-cold methanol, blocked for 1 hour with 5% rat serum and 0.3% Triton-X in phosphate buffered saline (PBS), before primary antibody staining was performed with LC3B (diluted 1:200 in 1% BSA and 0.3% Triton-X) at 4°C overnight. Slides were then washed in PBS and stained with a secondary antibody (1:1000, anti-rabbit Alexa Fluor 488, Invitrogen) for 1 hour at RT protected from light. Slides were then washed again with PBS and mounted in Prolong Gold with DAPI (Invitrogen). Imaging was performed with a Leica SP5II Inverted LSCM and a 100x objective (oil), AP23. Depicted pictures are representatives of five replicates and are displayed as maximum projections generated with Leica LAS-AF software.    2.3 Transfections and Transductions 2.3.1 Lentivirus Production Lentiviruses were produced by growing 293T cells in SFM using polyethyleimine (PEI) as transfection reagent. 6 × 106 293T cells were plated in 10-cm Falcon® tissue culture dishes in 7 36  mL Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS 24 hours prior to transfection. In total, 5 dishes were prepared for each construct. The next day, the culture medium was replaced and reduced to 4.5 mL per dish 2 hours before the transfection procedure. In a sterile tube, the DNA mixture was prepared with 6 μg of total plasmid DNA (vector), two packaging constructs (3.9 μg of ∆R and 1.5 μg of REV), and 2.1 μg of vesicular stomatitis virus glycoprotein (VSV-G) envelope construct mixed with Opti-MEM® medium (Thermo Fisher Scientific), to reach a total volume of 250 μL for the transfection of each 10-cm dish. Packaging and envelope plasmids were gifts from P. Leboulch (Harvard University, Boston, MA, USA). In a separate tube, 40 μL of PEI (1 μg/μL) were mixed with 210 μL Opti-MEM® medium and afterwards incubated with the DNA mixture for 20 min at RT before it was added drop-wise to 293T cells. The viral supernatant was collected 48 hours post-transfection and filtered with a 0.45 μm low protein-binding filter, followed by concentration of the virus by ultracentrifugation.  The virus pellet was resuspended in SFM containing 5% DNase under gentle agitation for 1 hour at RT and multiple aliquots of the concentrated virus stored at -80°C.    2.3.2 Lentiviral shRNA- and siRNA-Mediated Knockdowns in CML Cells  For stable knockdown of ATG4B or ILK, K562 cell lines were seeded at 2x105 cells/24-well in 300 μL RPMI 1640 and infected with 5 μL concentrated lentiviruses containing MISSION shRNA constructs targeting human ATG4B or ILK (see Table 2.2) or a non-targeting sequence (SHC002, pLKO.1-puro, Sigma-Aldrich) in the presence of protamine sulfate for 24 hours. Cells were then washed with Hank’s buffer, resuspended in fresh medium and puromycin (2 μg/mL) added the following day. CD34+ CML cells were similarly transduced for 6 hours after pre-stimulation and incubation on fibronectin-coated plates for 10-12 hours. Transient 37  knockdown of ATG4B was performed with 400 nM of a FlexiTube ATG4B siRNA GeneSolution (Qiagen) containing four different targeting sequences or a scrambled siRNA control (Qiagen). 2x105 cells were transfected according to manufacturer’s instructions. Cells were allowed to recover for 72 hours before Western blotting and in vitro assays were performed.   Table 2.2: MISSION shRNAs (Sigma-Aldrich) used for stable, lentiviral-mediated suppression of ATG4B or ILK in CML cells shRNA construct  TRC Number  SHC (control)  TRC1.5 pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA (SHC002) shATG4B #1 TRCN0000365107 shATG4B #2 TRCN0000370105 shATG4B #3 TRCN0000365104 shILK #1 TRCN0000000968 shILK #2 TRCN0000195112 shILK #3 TRCN0000199983  2.4 In Vitro Assays 2.4.1 Viability Assay Total cell counts and cell viability was assessed with the trypan blue exclusion method. In contrast to healthy cells, trypan blue remains in cells with compromised cell membranes giving them a dark blue-ish color.  This made it possible to distinguish and enumerate viable (white, shiny) vs. dead (blue) cells in a mixed cell population with a Neubauer hemocytometer. For cell lines, 0.5-1x105 cells were seeded in 24-wells in 500 μL medium and for primary CD34+ cells, 1-2x104 cells were seeded in 96-wells in 100 μL SFM with growth factors, and cell viability was assessed in the presence or absence of inhibitors at 24, 48 and 72 hours.   38  2.4.2 Apoptosis Assay To detect cell apoptosis, an Annexin V-APC apoptosis detection kit (eBioscience) was used according to the manufacturer’s instructions. In brief, cells were harvested at indicated time points, washed with Hank’s buffer, resuspended in 50 µL 1x Annexin V buffer (eBioscience) and 2.5 µL Annexin V-APC antibody (eBioscience) added to each sample. After 20 min incubation on ice in the dark, 3.5 µL propidium iodide (PI) (eBioscience) and 200 µL 1x Annexin V buffer were added to each sample. Flow cytometry was performed on a FACSCaliburTM cytometer (BD Bioscience). Unstained and single stained samples served as controls for compensation. Percent apoptotic cells were analyzed with FlowJo 9 or 10 software and “early” (Annexin V+/ PI-) and “late” apoptotic cells (Annexin V+/PI+) summarized. Results were converted to % apoptotic cells relative to controls to allow comparisons between biological repeats or different patient samples.   2.4.3 Cell Cycle Measurements Cell cycle kinetics were assessed with 5-bromo-2’-deoxyuridine (BrdU) staining according to the manufacturer’s instructions (FITC BrdU Flow kit; BD Biosciences) after 3 days of culture. In brief, 10 µM BrdU (BD) was added to cultures with primary CD34+ cells for the last 24 hours of incubation, then cells pelleted, washed with 1x BD Perm/Wash Buffer, fixed and permeabilized with BD Cytofix/Cytoperm Buffer and BD Cytoperm Permeabilization Buffer Plus. Afterwards, cells were treated with DNase (30 µg/106 cells) for 1 hour at 37°C to expose incorporated BrdU, followed by staining with a FITC-conjugated anti-BrdU antibody (BD Biosciences) for 20 min at room temperature (RT). Total DNA was stained with 7-AAD (BD Biosciences) and stained cells acquired on a flow cytometer.    39  2.4.4 Cell Proliferation Assay with CFSE 5x106 CD34+ CML cells were stained with 10 µM carboxyfluorescein diacetate-succinimidyl ester (CFSE) for 15 min at 37°C protected from light and then washed three times with cold culture medium. Stained CML cells were incubated overnight and the following day washed twice with Hank’s buffer/2% FBS before Fluorescence-activated cell sorting for viable, CFSE-high expressing cells was performed. CFSE-positive cells were then plated at 1x105 cells per 250 µL culture medium in 24-wells, drug treatments performed and cell divisions analyzed by FACS after 72 hours. Colcemid-treated samples served as control for undivided cells.        2.4.5 Analysis of Drug Interactions For drug interaction analysis, primary CD34+ CML cells were exposed to a wide range of various inhibitors in single and combination treatments for 72 hours and afterwards total viable cells enumerated. For all drug combinations a constant ratio was applied and possible drug interactions analyzed according to the median-dose effect method of Chou-Talalay [270, 271]. The combination index (CI) was calculated using CalcuSyn software (Biosoft, Cambridge, United Kingdom).  CI < 1 represents synergistic, CI = 1 additive, and CI > 1 antagonistic effects, respectively.   2.4.6 Colony-Forming Cell Assay Colony-forming cell (CFC) assays were performed to investigate the proliferation as well as the differentiation of hematopoietic and leukemic progenitor cells by their ability to form colonies of mature blood cells in semisolid medium. These were conducted as previously described [272, 273]. Briefly, 300 cells (cell lines) or 1000 CD34+ cells were mixed in 1 mL 40  MethoCult (STEMCELL Technologies) with desired concentrations of inhibitors or DMSO (0.05%) as control, plated and incubated for 12-14 days, followed by enumeration based on colony size (cell lines) or colony number and type (primary samples).   2.4.7 Long-Term Culture-Initiating Cell Assay  The long-term culture-initiating cell (LTC-IC) assay is a well-established in vitro method to measure primitive hematopoietic and leukemic stem cells by their capacity to produce myeloid progenitors for a minimum of 5 weeks in culture [274]. Primary CD34+ cells were plated onto mixed feeders (M2-10B4 stromal cells engineered to produce and secrete human IL-3, G-CSF, and stem cell factor) for 6 weeks with weekly half-medium changes. Inhibitors were added only for the first 14 days once weekly. At the end of the 6 weeks, all cells were harvested and 10,000 viable cells were plated into CFC assays.       2.5 In Vivo Methods 2.5.1 Transplantation of Immunodeficient Mice with BV173YFP/Luc Cells 9 to 11-week old, sub-lethally cesium irradiated (315 cGy) NOD/SCID-interleukin 2 receptor γ–chain-deficient (NSG) mice were injected intravenously with 2.5×106 BV173 cells expressing YFP and the enzyme luciferase (BV173YFP/Luc). Two weeks post-transplant, mice were injected intraperitoneally with 2 µM D-Luciferin (Sigma-Aldrich) and in vivo images acquired with the Xenogen IVIS® 50 Bioluminescence Imaging System, 1 second exposure time, Live Imaging Software Version 3.0.  Following that, treatment with vehicle (propylene glycol 50:50 or PEG300/Ethanol/Tween 80/citrate (63:29:7.8:0.2 w/v/w/w)) or inhibitors (DA 15 mg/kg, QLT0267 25 mg/kg, QLT0267 75 mg/kg, or a combination of these) was initiated and 41  carried out once a day for two weeks by oral gavage. IVIS was repeated (preferentially on the same mice) at 2 and 5 weeks after completion of oral gavage treatments. Mice were closely monitored for changes in appearance, body weight and survival, during and after oral gavage.   2.5.2 Hematopoietic Mouse Tissue Analysis At Day 53 post-transplant (3.5 weeks after completion of oral gavage treatments) and Day 67 post-injection of BV173YFP/Luc cells (5.5 weeks after completion of oral gavage treatments), 1 mouse per treatment group was sacrificed and engraftment levels of human cells analyzed. In brief, spleen and liver were collected from the mice, PB derived by cardiac puncture immediately after euthanasia, and BM from the right and left femurs and tibias combined. Spleen and liver were mechanically broken down into smaller pieces and filtered through a 40 µm cell strainer (Falcon). All cell suspensions were treated with an ammonium chloride solution (STEMCELL Technologies). Samples were then blocked with 5% human serum (Sigma-Aldrich) and anti-mouse CD16/CD32 (BD Biosciences) and anti-human CD32 antibodies (STEMCELL Technologies), followed by staining with an anti-human CD19-PE antibody (1:100 dilution, eBioscience) and PI. Viable (PI-negative), CD19+/YFP+ cells were analyzed by flow cytometry.        2.6 Statistical Analysis Unless otherwise indicated, results are shown as the mean ± standard error of values obtained in two to four independent experiments. Differences between groups were compared using a two-tailed Student’s t-test for unpaired samples with unequal variance or one-way ANOVA, with correction for multiple comparisons, using GraphPad Prism version 5 and 6 (GraphPad Software). P-values <0.05 were considered statistically significant. Means between 42  groups were compared using the Welch two-sample t-test and Wilcoxon Rank Sum, with confirmation by Receiver Operating Characteristic (ROC) analysis. Some experiments with statistically significant p-values were selected for logistic regression analysis. Survival curves of mice were compared with the log-rank (Mantel-Cox) test.   43  Chapter 3: The Core Autophagy Protein ATG4B as a Possible Biomarker and Therapeutic Target in CML  3.1 Introduction IM and other second- and third-generation TKIs have had a major impact on the treatment of CP CML [13, 18, 19, 31, 32]. However, none of the currently available TKI monotherapies are generally curative. BCR-ABL1 transcripts continue to be detectable in most patients with complete molecular remission and initial and acquired resistance to TKIs, and relapse remain a challenge [28, 29, 275, 276]. Extensive investigations have revealed that primary CML stem cells are not effectively eliminated by TKIs and hence, constitute a critical population of cells that lead to setbacks upon therapy discontinuation and generate TKI-resistant clones [4, 28, 35, 51, 53, 277, 278]. But to date, no promising predictive test exists to identify patients who are unlikely to benefit from TKI monotherapies. In addition, it has been demonstrated that CML stem cells do not depend on the BCR-ABL1 tyrosine kinase activity for their survival, warranting further research into possible distinct survival pathways in these cells in order to improve treatments [54, 279]. One critical pathway that potentially supports leukemic stem cell survival and has been shown to play an important role in cancer, including CML, is autophagy [109, 128, 129]. Autophagy is a degradation pathway that enables cells to adapt to decreased nutrient availability and to cope with cellular stress to counteract cell damage and cell death [109]. The catabolic process involves the formation of double-membrane vesicles (autophagosomes) that deliver the enclosed cargo to lysosomes generating autolysosomes, where proteases ensure the breakdown of organelles and proteins into amino acids, fatty acids, sugars and nucleosides [110, 44  111]. Each step of the pathway is tightly regulated by numerous ATGs and their protein products [113, 114]. One major event is the proteolytic cleavage of cytoplasmic LC3 to form LC3-I, which becomes conjugated to PE to generate membrane-bound LC3-II. Proteolytic cleavage is also required for the following de-lipidation and recycling of LC3-II to LC3-I and these key steps are catalyzed by the cysteine protease ATG4, in particular ATG4B [119-123].  Autophagy has been shown to be induced upon IM treatment in CML cell lines and primary patient samples and the process could be partially impaired by knockdown of ATG5 or ATG7 [137, 139, 142, 265]. Moreover, a combination of a TKI with the broad- spectrum autophagy inhibitor CQ was more effective than single agents in impairing growth of primitive CML cells in vitro [137]. These results suggest that autophagy may play a role in the response of primitive CML cells to TKIs, but how this process is regulated and details regarding the molecular basis for these observations in primitive CML cells are largely unknown. I hypothesized that treatment-naïve CML stem/progenitor cells harbor a unique autophagy gene expression profile that may be predictive of a patient’s response to TKI therapy.  In this chapter, I report the novel findings that primitive CD34+ CML cells express increased levels of several key autophagy genes; in particular ATG4B is differentially expressed in pre-treatment CML stem/progenitor cells and its expression correlates with subsequent clinical response to IM therapy. Knockdown of ATG4B expression or pharmacological inhibition of ATG4B activity significantly reduced cell viability and inhibited proliferation of leukemic cell lines and primary CD34+ CML cells, while an accumulation of LC3-II and p62 indicated impaired autophagy. This is the first study that investigated differences in several autophagy gene and protein expressions in CD34+ CML subpopulations from IM-responders versus IM-nonresponders, and identified ATG4B as a potential novel therapeutic target in CML.  45  3.2 Results  3.2.1 ATG4B Is Highly Expressed in Primitive, Normal Hematopoietic Cells To assess the expression levels of various key autophagy and autophagy-related genes in hematopoietic cells, the transcripts of ATG4A, ATG4B, ATG4C, ATG4D, ATG5, ATG7, ATG12, BECLIN-1, and MAP1LC3B were determined by Q-RT-PCR in CD34+ cells from 10 healthy donors. Figure 3.1 summarizes the transcript levels of all nine investigated genes normalized to β2-microglobulin (β2M) and relative to BECLIN-1. While BECLIN-1 and ATG5 were expressed at relatively low levels, the transcripts for ATG4B, ATG4D, ATG12 and ATG7 were found to be notably higher (>60-fold) relative to BECLIN-1.      Figure 3.1: ATG4B is highly expressed in CD34+ normal BM cells. Q-RT-PCR analysis of transcript levels of 9 key autophagy genes in CD34+ normal BM cells isolated from healthy individuals (N=10). Transcripts for a specific gene were first normalized to β2-microglobulin (β2M) transcript levels in each patient sample, respectively, and then expressed as relative transcript levels in comparison to BECLIN-1, which displayed the lowest mRNA expression of all ATG genes investigated. ATG4B and ATG12 were found to be highly expressed, while ATG4A and ATG4C transcripts were much lower in comparison to each other.    46  3.2.2 Several Core Autophagy Genes and Proteins Including ATG4B Are Differentially Expressed in CD34+ CML Cells Previous studies have shown that autophagy is deregulated in CML cell lines and some patient samples, and that inhibition of autophagy can sensitize these cells to TKI treatment [137]. To determine whether these observations could be attributed to the differential expression of some key autophagy genes between CML stem and progenitor cells and normal BM-derived cells, I compared the mRNA expression levels of ATG4A, ATG4B, ATG4C, ATG4D, ATG5, ATG7, ATG12, BECLIN-1, and MAP1LC3B in CD34+ cells from 28 CP CML patients at diagnosis (prior to IM treatment) and in CD34+ cells from 10 healthy individuals, using Q-RT-PCR (Figure 3.2A). Transcript levels for a specific ATG gene were first normalized to β2M in each sample, respectively, and then relative transcripts of all CML patient samples calculated and expressed in comparison to transcripts of normal donors with the ∆∆Ct method. Interestingly, CD34+ CML cells displayed significantly higher transcript levels of ATG4B and ATG4D, ATG5 and BECLIN-1 compared to CD34+ normal BM cells (p<0.02). In addition, Western blotting analysis confirmed that protein expressions of ATG4B, ATG4D, ATG5 and BECLIN-1 were also significantly increased in CD34+ CML cells (N=6) compared to normal controls (N=4; p<0.05, Figure 3.2B). These results indicate that key autophagy genes are differentially expressed in normal hematopoietic stem and progenitor cells at basal levels, and that up-regulation of some autophagy genes and proteins occurs in CD34+ CML cells.      47   Figure 3.2: ATG4B expression is increased in CD34+ CML cells. (A) Comparison of transcript levels of 9 ATG genes in CD34+ normal BM cells (N=10) and pre-treatment CD34+ CML cells obtained from CP CML patients (N=28). Each data point represents the average of a triplicate quantitative measurement of each transcript normalized to β2M in one patient sample, and then graphed relative to CD34+ normal BM cells. Bars represent the mean of data for each group and significantly differentially expressed genes between normal and CML groups are indicated by p-values. (B) Western blotting analysis of ATG4B, ATG4D, ATG5 and BECLIN-1 48  in CD34+ cells obtained from healthy individuals (N=4) and CML patients (N=6). Protein expression relative to ACTIN was compared and quantified by ImageJ software.    3.2.3 The Expression of ATG4B Is Increased in CD34+ CML Cells from Subsequent IM-nonresponders versus IM-responders To characterize the ATG gene expression profile and determine whether potential differential expressions could be predictive of a patient’s response to TKI therapy, I divided patient samples retrospectively into IM-responders and IM-nonresponders. The patient samples were obtained at diagnosis, but after initiation of IM therapy in the clinic they were classified as IM-responders (N=14) and IM-nonresponders (N=14, Figure 3.3). Q-RT-PCR revealed that the transcript levels of ATG4B were overall significantly higher in CD34+ CML cells from subsequent IM-nonresponders compared to IM-responders (p<0.02), whereas ATG5 transcripts were lower in subsequent IM-nonresponders (p<0.02, Figure 3.3A).  CD34+ cells from a few IM-nonresponders samples appeared to express higher levels of BECLIN-1 relative to IM-responders, but the differences were overall not significant. Western blot analysis further showed that the protein expression of ATG4B was significantly higher in CD34+ cells from IM-nonresponders (N=6) compared to IM-responders (N=6; p<0.05, Figure 3.3B). In addition, intracellular staining with a Cyto-ID dye revealed a significant difference between IM-responders and IM-nonresponders, with IM-nonresponders displaying increased autophagy at basal levels (p<0.05, Figure 3.3C). A logistic regression model confirmed that the clinically defined IM-responders and IM-nonresponders were significantly different from each other with respect to the transcript levels of ATG4B, with a significant impact at the 5% level (Table 3.1).     49   Figure 3.3: ATG4B expression is elevated in CD34+ CML cells from IM-nonresponders versus IM-responders. (A) Comparison of transcript levels of 9 ATG genes in CD34+ CML cells from subsequent IM-responders (N=14) and IM-nonresponders (N=14). Bars represent the mean of data for each group and significantly differentially expressed genes between IM-50  responders and IM-nonresponders are indicated by p-values. (B) Western blotting analysis of ATG4B in CD34+ cells obtained from healthy individuals (Normal, N=3), IM-responders (R, N=6) and IM-nonresponders (NR, N=6). Protein expression of ATG4B relative to ACTIN was compared. Values shown are the mean ± SEM of measurements from healthy individuals, IM-responders and IM-nonresponders. (C) Cyto-ID green detection dye in CD34+ cells from an IM-responder (R3) and an IM-nonresponder (NR2). Detection of the differences in mean fluorescence intensity of intracellular Cyto-ID green detection dye obtained from 3 IM-responders versus 3 IM-nonresponders (right). Values shown are the mean + SEM.            Table 3.1:  Estimation of coefficients of the logistic regression model used to analyze the transcript levels of ATG genes between IM-responders and IM-nonresponders      Variable  Coefficient Estimate  SD  p-value  Intercept  0.891  0.317  <0.01*  ATG4B  -0.190  0.089  0.043*  ATG5  0.106  0.053  0.054  MAP1LC3B  -0.510  0.283  0.084      A logistic model was used to study any possible correlation between ATG genes with significant p-values between IM-responders and IM-nonresponders. The model applied was β0 + β1ATG4B + β2ATG5 + β3MAP1LC3B.   * The estimated coefficients and p-values of the final model show that the transcript levels of ATG4B have a significant impact at the 5% level.   51  3.2.4 Leukemic Stem Cells from IM-nonresponders Express Higher Levels of Several ATG Genes, Including ATG4B, Compared to IM-responders     In order to investigate whether CML subpopulations differentially express key autophagy genes that regulate autophagy, Lin-CD34+CD38-, Lin-CD34+CD38+ and Lin+CD34- subpopulations were FACS-purified from retrospectively classified IM-responders (N=6) and IM-nonresponders (N=6), and ATG transcripts assessed by Q-RT-PCR (Figure 3.4).  The results indicate that the stem cell-enriched population (Lin-CD34+CD38-) from IM-nonresponders expressed higher levels of ATG4 family members, ATG5, ATG7 and ATG12 than the same cells from IM-responders. Increased transcript levels of ATG4B were also observed in progenitor cells (Lin-CD34+CD38+) from IM-nonresponders, while more mature cells (Lin+CD34-) expressed the lowest levels of the explored ATG genes.  In summary, CML stem and progenitor cells expressed higher levels of ATG genes relative to their more mature counterparts, and leukemic stem cells from IM-nonresponders expressed higher levels of ATG4B relative to IM-responders.   52   Figure 3.4: Several ATG transcripts are differentially expressed in CD34 subpopulations from subsequent IM-responders versus IM-nonresponders. Comparison of transcript levels of 9 ATG genes in CD34 subpopulations including the stem cell-enriched population (CD34+CD38-), progenitors (CD34+CD38+) and mature (CD34-) cells from IM-responders (N=6) and IM-nonresponders (N=6). Values shown are the mean ± SEM of measurements of each transcript normalized to β2M.     53  3.2.5 Exposure to IM In Vitro Elevates mRNA and Protein Expression of ATG4B and Induces Autophagic Flux in CD34+ CML Cells   To explore whether expression of specific ATG genes changes upon inhibition of BCR-ABL1 tyrosine kinase activity, I compared potential expression changes in several ATG genes (ATG4 family members, ATG5, ATG7 ATG12, BECLIN-1 and MAP1LC3B) in CD34+ cells isolated from CML patient samples (N=3) after 6 and 24 hours of IM treatment (5 µM).  Transcript levels of all examined genes increased in cultured CML cells after 24 hours with or without IM, indicating that expression of most autophagy genes is induced in vitro. Outstandingly, mRNA and protein expression levels of ATG4B increased in CD34+ cells upon IM treatment in all three patient samples examined, compared to the same cells cultured without IM (p≤0.05), whereas other ATG transcripts did not change reliably in all patient samples upon exposure to IM (Figure 3.5A&B). Consistent with previous reports [137, 141, 142], IM treatment induced autophagy in CD34+ cells from CML patients (N=3), as evident by elevated LC3-II levels, which was further enhanced upon IM and CQ combination treatments (~2-fold, Figure 3.5C). LC3-II levels also increased with DA or NL treatment alone, and, in particular, in combination with CQ (Figure 3.5C). These results were strengthened by detection of increased autophagic flux in the same cells by intracellular Cyto-ID staining and FACS analysis (p<0.05, Figure 3.5D).          54   Figure 3.5: Enhanced expression of ATG4B and induced autophagic flux in CD34+ CML cells upon IM treatment. (A) Q-RT-PCR analysis of transcript levels of ATG4 family members in CD34+ CML cells from 3 patient samples in the presence and absence of IM (5 µM) after 6 hours incubation in vitro. Values shown are the mean ± SEM of triplicate measurements of each transcript normalized to β2M and relative to uncultured CD34+ cells. (B) Western blot analysis 55  of ATG4B protein expression in the same cells upon IM treatment in vitro. Protein expression of ATG4B relative to ACTIN was compared. Values shown are the mean ± SEM of measurements. (C) Western blotting analysis of LC3-II levels in CD34+ CML cells from 3 patient samples treated with IM (5 µM), DA, (150 nM), NL (5 µM), CQ (10 µM), or IM + CQ for 5 hours. LC3 antibody used preferentially recognized LC3-II. Protein expression of LC3-II relative to ACTIN was compared and relative expression levels are indicated for measurements of LC3-II protein expression in treated cells relative to control (No Treatment). (D) A representative example of the comparison of FACS profiles of intracellular Cyto-ID® Green detection dye in CD34+ CML cells in the presence or absence of IM (5 µM), CQ (10 µM) or IM + CQ for 5 hours (left panel).  Detection of the differences in mean fluorescence intensity of intracellular Cyto-ID® Green detection dye obtained from CML patients (IM-nonresponders) in the presence or absence of indicated inhibitors (N=4, right panel). The increase in fluorescence intensity in the IM + CQ treated samples relative to IM or CQ treatment is indicative of autophagic flux. Values shown are the mean ± SEM of measurements from 4 CML patient samples.  3.2.6 Transient Depletion of ATG4B Increases IM-Mediated Inhibition of Colony Formation by CML Cells Based on my findings that ATG4B expression and autophagy are increased in CML and in particular in IM-nonresponders, I decided to examine whether knockdown of ATG4B protein expression by RNA interference would affect autophagic flux, proliferation and survival of CML cell lines and primitive CML patient cells. K562 cells and a spontaneously derived cell line that is resistant to IM (IMR K562; kind gift from A. Turhan, France) were transfected with either a control siRNA (scramble) or a FlexiTube combination of 4 different siRNA against human ATG4B. Western blotting confirmed knockdown of ATG4B in K562 cells and IMR K562 cells (>90%, Figure 3.6B&C). In both cases a slight increase in the LC3-II/LC3-I ratio as well as elevated p62 protein levels were observed upon ATG4B suppression, suggesting inhibition of autophagy in K562 and IMR K562 cells (Figure 3.6A-C). Colony-forming cell assays revealed a reduction in CFC numbers upon ATG4B suppression, and these effects were further enhanced by additional IM treatment in K562 (Figure 3.6D) and IMR K562 cells (Figure 3.6E). However, when CD34+ CML cells from 2 patients were transfected with scramble or ATG4B siRNA’s, 56  ATG4B knockdown was not as efficient (Figure 3.6F) and differences in colony formation in semi-solid cultures were not as obvious as for CML cell lines (Figure 3.6G). Hence, I decided to pursue further studies with a lentiviral-mediated approach to suppress ATG4B stably.        Figure 3.6: Transient depletion of ATG4B by RNA interference in K562, K562 IM-resistant and primary CD34+ CML cells enhances IM-mediated inhibition of colony formation. (A) Overview of how autophagy induction versus ATG4B inhibition or suppression affects LC3-II and p62 protein expressions. (B) Western blot analysis of cell lysates from K562 57  cells transfected with a scrambled siRNA control or a FlexiTube ATG4B siRNA gene solution mix consisting of 4 different siRNA directed against ATG4B. Accumulation of p62 and LC3-II indicate a block in autophagy in ATG4B knockdown cells. (C) Western blot analysis of cell lysates from IMR K562 cells transfected with a scrambled siRNA control or ATG4B siRNAs.  (D) Numbers of colonies produced by K562 cells transfected with a scrambled siRNA control or ATG4B siRNA gene solution mix directed against ATG4B in semisolid culture medium in the absence or presence of IM (0.5 µM) or DMSO (Control). (E) Numbers of colonies produced by IMR K562 cells transfected with a scrambled siRNA control or ATG4B siRNAs in semisolid culture medium in the absence or presence of IM (0.5 µM) or a DMSO control. (F) Western blot analysis of cell lysates from primary CD34+ CML cells transfected with a scrambled siRNA control or ATG4B siRNAs. (G) Numbers of colonies produced by the same transfected cells in semisolid culture in the presence of IM (0.5 and 5 µM) or DMSO control.     3.2.7 Lentiviral-Mediated Knockdown of ATG4B Impairs Autophagy and Effects Survival of K562 and IMR K562 Cells To investigate whether stable depletion of ATG4B would affect K562 and IMR K562 cell survival and growth, both cell lines were transduced with lentiviruses containing either a non-targeting control sequence (SHC) or constructs containing one of three different shRNA targeting sequences against human ATG4B (shATG4B), respectively. Stable knockdown of ATG4B (>90%) was confirmed in all shATG4B transduced K562 and IMR K562 cells by Western blotting (Figure 3.7A&E). An increase in the LC3-II/LC3-I ratio as well as elevated p62 protein levels were observed upon ATG4B suppression, indicating inhibition of autophagy (Figure 3.7A&E). Noteworthy, stable suppression of ATG4B resulted in significantly reduced viability and an increase in apoptosis in both K562 and IMR K562 cells, and these effects were further enhanced with IM treatment (Figure 3.7B,C&F,G). Moreover, ATG4B knockdown reduced the ability of these cells to grow in suspension culture and to form CFC colonies in semi-solid culture medium compared to control cells (2-3-fold, Figure 3.7D&H).    58   Figure 3.7: Knockdown of ATG4B by RNA interference in K562 and IM-resistant K562 cells impairs autophagy and reduces viability and growth of these cells. (A) Western blot analysis of cell lysates from K562 cells transduced with either a non-targeting shRNA control 59  (SHC) or shRNA against human ATG4B (shATG4B) to knockdown ATG4B protein expression. Accumulation of the autophagy markers LC3-II and p62 indicates a block in autophagy in ATG4B knockdown cells. (B) Viability of 3 different ATG4B knockdown clones and control cells was measured after 48 hours in the presence or absence of IM (0.5 µM) and apoptosis of these cells determined. (C) Growth of K562 ATG4B knockdown clones and control-transduced cells was recorded every 24 hours over 3 days in culture. (D) Numbers of colonies produced by the same transduced cells in semisolid culture medium in the absence or presence of IM (0.5 µM) or DMSO (Control). Numbers for large (>500 cells), medium (50-500 cells) and small (<50 cells) colonies are indicated. (E) Western blot analysis of cell lysates from IMR K562 cells transduced with either a non-targeting shRNA control (SHC) or shRNA against human ATG4B (shATG4B). Accumulation of the autophagy markers LC3-II and p62 indicates impaired autophagy in ATG4B knockdown cells. (F) Viability of 3 different ATG4B knockdown clones and control cells was measured after 48 hours in the presence or absence of IM (2.5 µM) and apoptosis of these cells determined. (G) Growth of IMR K562 ATG4B knockdown clones and control-transduced cells was recorded every 24 hours over 3 days in culture. (H) Numbers of colonies produced by the same transduced cells in semisolid cultures in the absence or presence of IM (2.5 µM) or DMSO (Control). Numbers for large (>500 cells), medium (50-500 cells) and small (<50 cells) colonies are indicated. Data shown are the mean ± SEM of measurements from 3 (K562) or 2 (IMR K562) independent experiments. * Indicates significant difference between control and ATG4B knockdown cells at p<0.05, ** p<0.01, and *** p<0.001.    3.2.8 Stable Suppression of ATG4B Impairs Autophagy in CML Stem/Progenitor Cells and Sensitizes These Cells to IM Treatment in Short- and Long-Term Cultures Similar to CML cell lines, primary CD34+ CML cells were transduced with lentiviruses containing either a non-targeting control sequence (SHC) or constructs containing one of three different shRNA targeting sequences against human ATG4B (shATG4B). Stable suppression of ATG4B expression in pre-treatment CD34+ cells from 3 IM-nonresponder patient samples resulted in increased LC3-II and p62 protein levels as well as an accumulation of endogenous LC3B puncta (Figure 3.8A&B), suggesting a block in autophagy and decreased autophagic flux in these cells. In addition, viability and proliferation of CD34+ CML cells was significantly reduced and apoptosis was increased upon ATG4B suppression, and these effects were further enhanced upon IM treatment (Figure 3.8C&D). Interestingly, knockdown of ATG4B 60  significantly decreased the ability of CML stem and progenitor cells to form colonies in short- and long-term cultures and sensitized them to IM, as assessed by CFC and LTC-IC assays (Figure 3.8E&F). CFC were reduced by 50-70% upon knockdown of ATG4B in CD34+ CML cells compared to control-transduced cells, and up to 90% fewer CFC formed in combination with IM treatment (Figure 3.8E). Similarly, suppression of ATG4B inhibited LTC-IC-derived CFC growth by 50-80% and up to 90% when combined with IM treatment compared to the control (SHC) in CD34+ cells from 2 different CML patients (Figure 3.8F).  In conclusion, impairment of autophagy via knockdown of ATG4B significantly reduced proliferation and survival of IM-resistant cells and primary CML stem/progenitor cells from subsequent IM-nonresponders, and enhanced the effects of IM treatment.    61   Figure 3.8: Lentiviral-mediated depletion of ATG4B in primary CD34+ CML cells and its effects on autophagy, short- and long-term proliferation of these cells, cell viability and apoptosis. (A) Western blot analysis of cell lysates from 3 different CML patient samples 62  transduced with either a non-targeting shRNA control (SHC) or shRNA against human ATG4B (shATG4B). Accumulation of the autophagy markers LC3-II and p62 indicate a block in autophagy in ATG4B knockdown cells. (B) Confocal microscopy reveals an accumulation of endogenous LC3 puncta upon ATG4B knockdown for 3 different ATG4B constructs in all 3 patient samples. (C) Viability of all 3 ATG4B knockdown clones and control cells was measured after 72 hours in the presence or absence of IM (5 µM) and apoptosis of these cells determined. (D) Growth of CML patient cells with ATG4B knockdown and control-transduced cells was recorded every 24 hours over 3 days in culture. (E) Numbers and types of colonies produced by the same transduced cells in semisolid culture medium in the absence or presence of IM (5 µM) or DMSO (Control). (F) LTC-IC assays in 2 CML patient samples confirm impaired growth of primitive ATG4B shRNA-transduced CD34+ CML cells, that is further enhanced upon IM (5 µM) treatment. Data shown are the mean ± SEM of all 3 CML patient samples or technical duplicates for each CML patient sample. *Indicates significant difference between control and ATG4B knockdown cells at p<0.05, ** p<0.01, and *** p<0.001.      3.2.9 Inhibition of ATG4B by Compound 4Bi-1 Sensitizes K562 Cells to IM Treatment upon Autophagy Induction by Starvation To examine a potential clinical application of ATG4B suppression, I investigated the biological effects of newly developed ATG4B inhibitors. The novel ATG4B antagonist 4Bi-1 was identified by intensive in silico screening of commercially available compounds based on the crystal structure of ATG4B by Dr. Jianghong An at the Genome Sciences Centre (unpublished) and tested for its biological effects on CML cells in our laboratory. In initial experiments, K562 cells were treated with compound 4Bi-1 at a concentration of 10 µM or 25 µM, IM alone (0.5 µM) or combinations of these in normal growth medium with 10% fetal bovine serum (FBS) for 72 hours before viability and apoptosis were assessed (Figure 3.9A). However, under these conditions no significant change in viability or apoptosis of K562 cells was observed between single and combination treatments (Figure 3.9A). A recent study by Akin et al. revealed that testing of potential ATG4B inhibitors and their autophagy-dependent effects can be observed best upon autophagy induction such as serum starvation [280]. Therefore, I 63  executed the following experiments with K562 cells under serum-deprivation by reducing the amount of FBS from 10% to 0.5% in the culture medium to stimulate autophagy in these cells. This set up allowed K562 cells to survive and proliferate well, whereas a complete absence of FBS caused significant reduced cell viability (data not shown). Western Blotting analysis confirmed that IM treatment in low-serum conditions induced autophagy in K562 cells as evident by reduced p62 protein levels and increased LC3-II expression (Figure 3.9C). Upon autophagy induction, I observed that a combination of compound 4Bi-1 (10 µM) with IM (0.5 µM) significantly reduced the number of viable K562 cells and increased apoptosis in these cells more effectively than either single treatment within 72 hours (Figure 3.9B). In addition, Immunoblotting illustrated that treatment of K562 cells with the ATG4B inhibitor 4Bi-1 increased p62 expression while LC3-I and LC3-II protein levels were reduced, indicating a block in autophagy (Figure 3.9C).   64   Figure 3.9: The ATG4B antagonist 4Bi-1 blocks autophagy in K562 cells and reduces cell survival in combination with IM upon starvation. (A) Percent viable K562 cells (left) and percent apoptotic K562 cells (right) grown in medium with 10% serum relative to the control at 72 hours following 0.5 µM IM and 4Bi-1 treatment alone (at indicated doses) or in combination. (B) Percent viable K562 cells (left) and percent apoptotic K562 cells (right) grown in medium with 0.5% serum relative to the control at 72 hours following 0.5 µM IM and 4Bi-1 treatment alone (at indicated doses) or in combination. Compound 4Bi-1 alone inhibits K562 cell growth and induces apoptosis upon autophagy induction; these effects can be significantly enhanced by a combination of 4Bi-1 and IM. (C) Western blotting of K562 cells treated with indicated drugs for 72 hours upon starvation suggests a block in autophagy by compound 4Bi-1. * p<0.05, ** p<0.01, and *** p<0.001. Ctr. = Control.  65  3.2.10 Combined Treatment with 4Bi-1 and TKIs Reduces Colony Formation by CD34+ CML Cells, but Is Less Inhibitory Towards Normal Cells To investigate the significance of my findings for compound 4Bi-1 and its effects on K562 cells in CML patient samples, I performed CFC assays with CD34+ cells from 3 different CML patients (retrospectively classified as IM-nonresponders) upon single-drug treatments, or combinations, as indicated in Figure 3.10A. The results demonstrate that a combination of 4Bi-1 at 10 µM with either IM (5 µM) or DA (150 nM) reduced significantly the number of colonies generated by 50-80% compared to the control or 4Bi-1 treatment alone (Figure 3.10A), while a similar combination approach was less inhibitory on colony formation by CD34+ cells from 2 healthy donors, although some toxicity was noted (Figure 3.10B).   In summary, the ATG4B inhibitor 4Bi-1 increased the cytotoxic effects of TKIs in combination approaches in K562 cells upon autophagy induction by starvation and primary CML patient samples, but displayed some toxicity in normal BM cells suggesting further development or optimization of the compound is needed.    66   Figure 3.10: A combination of compound 4Bi-1 with IM or DA reduces colony formation by CD34+ CML stem/progenitor cells, but is less inhibitory towards their normal counterparts. (A) Number and type of colonies generated by CD34+ CML cells obtained from IM-nonresponders (N=3) after 2 weeks of treatment with indicated doses of compound 4Bi-1, IM (5 µM), DA (150 nM) or combinations. The combination treatment inhibits growth of CD34+ treatment-naïve IM-nonresponder cells more efficiently compared to any single agent or IM plus DA. (B) Number and type of colonies generated by CD34+ normal BM cells from 2 donors after 2 weeks of treatment with indicated doses of drugs. Compound 4Bi-1 (up to 10 μM) is not very toxic to CD34+ normal BM cells. Ctr. = Control.  67  3.2.11 The ATG4B Inhibitors 4Bi-2 and 4Bi-3 Block Autophagy in K562 Cells, Decrease Cell Proliferation and Synergize with IM Treatment In Vitro  With the need to identify ATG4B inhibitors with specificity and high potency, but less toxicity towards normal BM cells, 4Bi-2 and 4Bi-3 were developed. 4Bi-2 is an optimized version of compound 4Bi-1 with higher potency, while 4Bi-3 was identified in a high-throughput screening using a fluorescent peptide‐based assay [268, 281]. To verify the effects of 4Bi-2 and 4Bi-3 on autophagy, K562 cells were treated with these ATG4B inhibitors upon starvation, respectively, and p62 and LC3 protein expression assessed and compared to controls under normal growth conditions (10% FBS; Fed) or starvation (0.5% FBS) alone. Western blotting displayed an accumulation of p62 protein upon a combination of starvation (autophagy induction) and 4Bi-2 or 4Bi-3 treatment in comparison to controls, while the LC3-II/LC3-I ratio was increased, indicating inhibition of autophagy (Figure 3.11A). In addition, an increase in endogenous LC3B puncta was observed upon 4Bi-2 or 4Bi-3 treatment by confocal microscopy (Figure 3.11B). In order to elucidate more details regarding the autophagic process and its intervention by ATG4B inhibitors, I utilized a tandem mRFP-GFP-LC3 construct that allowed me to distinguish autolysosomes (red fluorescence due to quenching of GFP in lysosomes) from autophagosomes (yellow fluorescence due to the combined signals of RFP and GFP) by fluorescence microscopy [282]. Forced expression of mRFP-GFP-LC3 in K562 cells pointed out that 4Bi-2 or 4Bi-3 treatment halted autophagy at the autophagosome stage, whereas starvation alone resulted in an increase of autolysosomes in K562 cells compared to control cells as expected (Figure 3.11B).  To ensure for follow up experiments a suitable dose and time point for both ATG4B inhibitors, I determined growth curves and the IC50 for both drugs in K562 cells. K562 cells were 68  cultured in low-serum-containing medium with serial dilutions of 4Bi-2 or 4Bi-3 and viability assessed with trypan blue staining 72 hours post-treatment (Figure 3.11C).  Under these conditions an IC50 of ~7.5 µM was established in K562 cells for 4Bi-2 and an IC50 of ~10 µM determined for 4Bi-3 (Figure 3.11C). K562 cell proliferation was monitored by counting cells every 24 hours for 4 days upon single doses of 4Bi-2 or 4Bi-3 treatments combined with autophagy induction in low-serum medium (Figure 3.11D). While control cells proliferated well for 72 hours, 4Bi-2 or 4Bi-3 treated cells displayed an obvious reduction to no growth with increasing drug doses (Figure 3.11D). Furthermore, when I combined serial dilutions of IM with various concentrations of either 4Bi-2 or 4Bi-3 treatment in K562 cells upon starvation, drug interaction analyses indicated synergy for both combination approaches (Figure 3.11E), making it an interesting avenue to follow up on.  69   Figure 3.11: ATG4B inhibitors 4Bi-2 and 4Bi-3 block autophagy in K562 cells and act synergistically with IM. (A) Western blot analysis of cell lysates from K562 cells treated with 4Bi-2 or 4Bi-3 displays an increase in LC3-II and p62 protein levels compared to controls. (B) Representative confocal images at maximum projection of K562 cells under normal growth conditions (Fed), starvation and ATG4B inhibitor treatments show an accumulation of LC3B puncta (top panel) by ATG4B inhibitors. Introduction of the tandem mRFP-GFP-LC3 construct indicates presence of autolysosomes under starvation (red dots, bottom panel), while 4Bi-2 or 4Bi-3 treatment results in a block of autophagy at the autophagosome level (yellow). (C) IC50 analysis of both ATG4B inhibitors shows their effective IC50 in K562 cells upon starvation 72 hours post-treatment. (D) Growth of K562 cells with 4Bi-2 or 4Bi-3 treatment under starvation conditions (0.5% serum). (E) Isobolograms of drug interaction analysis with CalcuSyn software indicate synergy between various IM and 4Bi-2 or 4Bi-3 combination treatments (CI<0.9 and CI<0.7, respectively).   70  3.2.12 Combining 4Bi-2 or 4Bi-3 with IM Treatment Decreases Survival of K562 Cells upon Autophagy Induction To determine whether induction of autophagy and treatment with the ATG4B inhibitor 4Bi-2 simultaneously would affect CML cell viability, K562 cells were treated with 5 µM or 10 µM 4Bi-2 in combination or without the addition of IM (0.5 µM). As the results show in Figure 3.12A, K562 cell viability was significantly reduced upon combination treatments compared to either single agent treatment, and a combination of 10 µM 4Bi-2 together with IM killed almost all cells (Figure 3.12A). Similar effects were observed in apoptosis assays: combined treatment of K562 cells with the autophagy inhibitor 4Bi-2 at 10 µM and IM upon starvation increased the percentage of apoptotic cells significantly and reached close to 100% (Figure 3.12A).  The other ATG4B inhibitor, 4Bi-3, was tested in a comparable way in K562 cells. Notably, treatment with 4Bi-3 alone seemed less toxic to K562 cells upon starvation conditions than 4Bi-2; e.g. with 5 µM 4Bi-3, about 95% of the cells remained viable 72 hours post-treatment (Figure 3.12B). However, a combination of 10 µM 4Bi-3 together with IM reduced the viability of K562 cells to 10% (Figure 3.12B). Comparably, apoptosis of K562 cells significantly increased upon the combination approach of the ATG4B inhibitor 4Bi-3 and IM to almost 100% (Figure 3.12B).   71   Figure 3.12: A combination of IM and the ATG4B inhibitor 4Bi-2 or 4Bi-3 decreases growth and survival of K562 cells upon induction of autophagy. (A) Percentage of viable K562 cells (left) and K562 cells undergoing apoptosis (right) 72 hours following treatment with 0.5 µM IM and 4Bi-2 at indicated doses in low-serum conditions (0.5%). (B) Percentage of viable K562 cells (left) and percentage of apoptotic K562 cells (right) relative to control after 72 hours of treatment with 0.5 µM IM and various concentrations of 4Bi-3 upon starvation (0.5% serum). A combination of IM and ATG4B inhibitors is more effective at inhibiting cell growth and in inducing apoptosis compared to any single agent.  * p<0.05, ** p<0.01, and *** p<0.001. Ctr. = Control.    72  3.2.13 Growth and Survival of IM-Resistant K562 and BV173 Cells is Reduced by 4Bi-2 or 4Bi-3 Treatment upon Starvation  Based on the promising findings of the two novel ATG4B inhibitors in K562 cells, I extended my investigations to other cell lines to determine the effects of 4Bi-2 and 4Bi-3. For both cell lines, IMR K562 and BV173, 4Bi-2 and 4Bi-3 treatment reduced cell proliferation upon autophagy induction with 4Bi-2 being more effective than 4Bi-3 (Figure 3.13A). Similarly, the viability of IMR K562 cells was reduced to 10% of controls upon 10 µM 4Bi-2 treatment in low-serum conditions 72 hours post-drug exposure. In combination with IM, the viability of these cells was further reduced to 5% (Figure 3.13B). 4Bi-3 treatment alone in IMR K562 cells decreased their viability to 30% and to 25% when combined with IM of control values (Figure 3.13B). BV173 cells displayed a more differential response between single and drug combinations. 4Bi-2 treatment alone reduced BV173 cell viability to ~20% of controls, while a combination of 4Bi-2 and IM decreased the viability of BV173 cells to 5% (Figure 3.13B). About 35% and 10% viable BV173 cells, respectively, were detectable upon 4Bi-3 treatment only, or in combination with IM in comparison to the control (Figure 3.13B). In addition, apoptosis assays revealed that a combination of an ATG4B inhibitor with IM was more effective in inducing apoptosis in IMR K562 and BV173 cells than either drug alone within 72 hours upon autophagy induction (Figure 3.13C).   73   Figure 3.13: ATG4B inhibitors 4Bi-2 and 4Bi-3 decrease growth and survival properties of IM-resistant K562 and BV173 cells upon starvation. (A) Growth of IMR K562 cells (left) and BV173 cells (right) with 4Bi-2 or 4Bi-3 treatment upon starvation. (B) Percentage of viable IMR K562 cells (left) and BV173 cells (right) relative to controls after 72 hours of treatment with 1 µM IM, 4Bi-2 (10 µM), 4Bi-3 (10 µM) or indicated combinations. (C) Percentage of IMR K562 cells and BV173 cells undergoing apoptosis at 72 hours following treatment with IM and 4Bi-2 or 4Bi-3 reveals the effectiveness of the combination approach. * p<0.05, ** p<0.01, and *** p<0.001. Ctr. = Control.   74  3.2.14 UT7-BCR-ABL1 and UT7-BCR-ABL1-T315I Mutant Cell Lines Are Sensitive to 4Bi-2 and 4Bi-3 Treatment In Vitro  To investigate whether 4Bi-2 and 4Bi-3 can target T315I mutant cells, I utilized two available UT7 cell lines from our laboratory that over-express BCR-ABL1 or the mutant BCR-ABL1-T315I, and also compared them to UT7 parental cells. Western blotting analysis suggested that UT7 cells over-expressing BCR-ABL1 or the kinase mutant BCR-ABL1-T315I increase and potentially depend on autophagy upon starvation in low-serum medium. This was indicated by increased LC3-II and decreased p62 protein levels in comparison to cells cultured in normal growth medium (Figure 3.14A). Hence, I continued to examine possible alterations of these cell lines and parental UT7 cells upon the addition of 4Bi-2 or 4Bi-3 with respect to their proliferation, viability and apoptosis. As shown by the growth curves in Figure 3.13B, treatment with the ATG4B inhibitor 4Bi-2 or 4Bi-3 decreased proliferation of both UT7-BCR-ABL1 and UT7-BCR-ABL1-T315I cells below the rate of UT7 parental cells, although their growth rate in normal medium was about twice that of UT7 cells (Figure 3.14B). Similarly, the greatest reduction in viability was observed with 4Bi-2 or 4Bi-2 plus IM treatment in UT7-BCR-ABL1 and UT7-BCR-ABL1-T315I cells, and to a much lesser extent in UT7 cells (Figure 3.14C). However, the difference between single 4Bi-3 treatments, or in combination with IM, was very small for all UT7 cell lines tested (Figure 3.14C). Apoptosis assays confirmed these observations, although the variance between biological repeats was fairly large (Figure 3.14D). A combination of 4Bi-2 and IM induced apoptosis to the highest degree in UT7-BCR-ABL1 cells that are also sensitive to IM treatment, while UT7 parental cells did overall not display an increase in apoptosis with a single drug or drug combinations, and no obvious benefit of combinations was observed for the mutant cells UT7-BCR-ABL1-T315I (Figure 3.14D). 75   Figure 3.14: UT7-BCR-ABL1 wild-type and UT7-BCR-ABL1-T315I mutant cells are more sensitive to the ATG4B inhibitors 4Bi-2 and 4Bi-3 than UT7 parental cells. (A) Western blot analysis of UT7 cell lines upon basal (Fed) and induced autophagy (Starved). (B) Growth of UT7 cells, UT7 cells over-expressing BCR-ABL1 or the BCR-ABL1 T315I mutant following treatment with indicated ATG4B inhibitors in low-serum medium. (C) Percent viable cells relative to control after treatment with 1 µM IM, 10 µM 4Bi-2, 10 µM 4Bi-3 or combinations for 72 hours upon induction of autophagy. (D) Percentage of apoptosis at 72 hours following treatment with IM and 4Bi-2 or 4Bi-3 reveals the increased effectiveness of the combination IM plus 4Bi-2, in particular on apoptosis of UT7-BCR-ABL1 cells. Ctr. = Control. 76  3.2.15 A Combination of 4Bi-2 or 4Bi-3 with IM or DA Inhibits Colony Formation by Stem/Progenitor Cells from CML Patients, but not from Healthy Donors  To elucidate if the ATG4B inhibitors 4Bi-2 and 4Bi-3 can sensitize primitive cells from CML patients to TKIs, I performed CFC assays with CD34+ cells from 3 subsequent IM-nonresponder samples and single drug treatments or combinations. As the results in Figure 3.15A indicate, a combination of IM or DA with either 4Bi-2 or 4Bi-3 was more effective in reducing the number of colonies formed by CD34+ CML cells than either single drug or a combination of IM and DA. Notably, CFC growth of CD34+ cells from 2 normal healthy BM donors was not reduced upon different single or combination treatments, and the CFC output of 4Bi-2 or 4Bi-3 combinations was very similar to control or IM-treated cells (Figure 3.15B). This suggests a selective role for 4Bi-2 and 4Bi-3 to specifically target primitive CML cells, but not their normal counterparts.             77   Figure 3.15: A combination of the ATG4B inhibitor 4Bi-2 or 4Bi-3 with IM or DA inhibits colony formation by CD34+ CML stem/progenitor cells, but spares normal cells.  (A) Number and type of colonies generated by CD34+ CML cells obtained from IM-nonresponders (N=3) after 2 weeks of treatment with ATG4B inhibitors 4Bi-2 (LV) and 4Bi-3 (DB), IM (5 µM), DA (150 nM) or combinations. The combination treatment inhibits the growth of CD34+ treatment-naïve IM-nonresponder cells more efficiently as compared to any single agent or IM plus DA. (B) Number and type of colonies generated by CD34+ normal BM cells from 2 donors after 2 weeks of treatment with indicated drugs. 4Bi-2 and 4Bi-3 (up to 10 μM) are not toxic to CD34+ normal BM cells. Ctr. = Control.  78  3.3 Discussion and Future Directions Growing tumors are often faced with limited nutrient conditions due to their rapid growth or thrive in a nutrient-deprived microenvironment making autophagy a critical source of energy. Nevertheless, it has been shown that depending on the stage or environment of different types of cancers autophagy can play dual, paradoxical roles of being tumor-suppressive or tumor- promoting [129, 283]. Recent investigations in CML have revealed that IM treatment in vitro results in the induction of tumor-protective autophagy, while genetic ablation or pharmacologic targeting of autophagy enhances TKI-mediated cell death [137, 139, 142, 265]. Hereby, these studies have mainly focused on the suppression of ATG5, ATG7 and BECLIN-1, or utilized rather unspecific broad-spectrum autophagy inhibitors such as CQ or HCQ, warranting further research into more specific autophagy inhibitors with increased potency.  In this study, I first explored the expression of several ATG genes and demonstrated that transcript levels of ATG4B were highest in CD34+ hematopoietic stem/progenitor cells for all genes examined (110-fold higher expression than BECLIN-1, Figure 3.1). Remarkably, transcript levels of all ATG4 family members were significantly higher in CD34+ CML cells compared to healthy donor cells, and the protein expression of ATG4B was also elevated (Figure 3.2). A previous kinetic and substrate-specific analysis of ATG4 family members has reported that ATG4B is the most critical cysteine protease regulating the autophagic process by both generating LC3-I and recycling LC3-II with the broadest substrate spectrum for various LC3 homologs [119, 123]. In addition, ATG4B is the most active ATG4 form, followed by ATG4A, whereas ATG4C and D possess minimal protease activity [126]. Notably, my investigations also showed that ATG4C is expressed at very low levels in primitive hematopoietic cells, suggesting that ATG4C may play a minor role, whereas ATG4B may be the dominant form in these cells, as 79  suggested by its strikingly high expression (Figures 3.1&3.2). This interpretation is further supported by studies using mouse models lacking various ATG4 family members, where ATG4C knockout mice display a mild autophagy defect, but ATG4B null mice display defective proteolytic cleavage of LC3 and demonstrate a systemic reduction in autophagic flux [124, 127, 284]. Even though ATG4A and ATG4D transcripts were detected, it is possible that these also play minor roles in the autophagic process in primitive CD34+ cells, because ATG4A is expressed at very low levels and ATG4D was shown to display minimal activity against LC3 (Figures 3.1&3.2) [125]. These results suggest that ATG4B plays an important role in maintaining cellular integrity under homeostatic conditions in primitive hematopoietic cells and that its deregulation in CML stem/progenitor cells may be associated with pro-survival mechanisms of leukemic cells. Most interestingly, I found that ATG4B expression was significantly higher in CD34+ cells from patients retrospectively classified as IM-nonresponders versus IM-responders, including higher expression in their stem cell–enriched population (Figures 3.3&3.4). Thus, determining ATG4B transcript and protein levels may be useful in predicting TKI responses in a clinical setting, and the prospective assessment of this gene signature change may allow improved patient management. Suppression of ATG4B protein expression not only significantly decreased CML cell viability, but also reduced cell proliferation and their colony-forming ability, with effects even more pronounced upon IM treatment in vitro in IM-sensitive and IM-resistant K562 cells as well as in pre-treatment CD34+ stem/progenitor cells from IM-nonresponders (Figures 3.6-3.8). I also observed that abolished ATG4B expression resulted in an accumulation of endogenous LC3-II in CD34+ CML cells or an increase in the LC3-II/LC3-I ratio in K562 cell lines, which was accompanied by an accumulation of p62 protein (Figures 3.6-3.8). An accumulation of LC3-II 80  could be due to induction rather than inhibition of autophagy. However, the observation of simultaneously increased p62 protein in these cells indicates a block in autophagy as p62 is incorporated into the completed autophagosome and subsequently degraded in the autolysosome [110, 111, 285]. This is consistent with an early report showing that suppression of ATG4B increases lipidated LC3 in HEK293 cells [119] and a recent study showing that silencing of ATG4B increases LC3-II in NIH/3T3 cells [286]. Therefore, my study supports the critical role of ATG4B in generating and recycling LC3 for an efficient autophagic process in primitive leukemic cells, possibly to ensure their rapid expansion and survival.  Both RNA and protein expression of ATG5 and BECLIN-1 were also increased in CD34+ CML cells, supported by recent studies showing that knockdown of ATG5 or BECLIN-1 enhances the cell-death–inducing effects of IM in CML cells [137, 138]. In addition, both ATG5 and BECLIN-1 were found to be target genes of miR-30a, and the use of a miR-30a mimic significantly reduced levels of ATG5 and BECLIN-1, resulting in inhibition of autophagy and enhanced IM-induced apoptosis of CML cells [265].  Previous studies by our laboratory and others have consistently demonstrated that the CML stem cell–enriched population (Lin-CD34+CD38-) and progenitor cells (Lin-CD34+CD38+) are intrinsically less sensitive to IM and other TKIs than more mature cells (CD34-) that compose the bulk (>90%) of the leukemic clone [4, 35, 51, 53, 277, 278]. These rare cells also constitute a critical population for generating genetically IM-resistant subclones [4, 51]. Therefore, it was critical to determine expression patterns of key autophagy genes in CD34 subpopulations. Indeed, I observed increased expression of ATG4 family members, ATG5, ATG7, and ATG12 in the CML stem cell-enriched fraction of IM-nonresponders compared to IM-responders, but most ATG genes examined did not express higher levels in CML stem cells than progenitor cells. 81  Nevertheless, more mature cells expressed the lowest levels of these genes (Figure 3.4). It is possible that most leukemic stem cells are not catabolically active and thus, do not display a high turnover of autophagy proteins at basal levels due to their quiescent status and limited bioenergetic needs [128, 287]. However, these cells can be stimulated in response to stress and metabolic changes to induce autophagy, and inhibition of the autophagy process by knockdown of key autophagy proteins or combination treatments of TKIs and drugs that inhibit autophagy (CQ or 3-methyladenine) can enhance cell death of these primitive cells [137, 265, 287, 288]. Consistent with these findings, higher levels of key autophagy gene transcripts and proteins were found in pre-treatment CML stem/progenitor cells, in particular in IM-nonresponders, relative to their more mature cells, further explaining their reduced sensitivity to TKI monotherapies due to preferentially enhanced pro-survival activities associated with the induction of autophagy. Hence, targeting of specific autophagy proteins, such as ATG4B, could provide therapeutic strategies that, in combination with TKIs, might be more effective in targeting the CML stem/progenitor cell population. A recent investigation performed an ATG4B inhibitor screen with a fluorescence-based assay and another study completed an in silico docking approach of the active site of ATG4B to identify potential novel compounds to inhibit ATG4B [280, 289]. One of these ATG4B antagonists, NSC185058, was able to suppress starvation-induced autophagy in Saos-2 cells in vitro and prevented osteosarcoma tumor growth in mouse models [280]. For my study, I also utilized newly identified ATG4B-inhibitory compounds and observed similar effects. ATG4B knockdown reduced cell viability and proliferation of CD34+ CML cells and various leukemic cell lines upon inhibitor treatment and autophagy induction by starvation (Figures 3.9-3.15). In addition, these effects were further enhanced upon a combination of an ATG4B inhibitor with a 82  TKI and resulted in a significant increase in apoptosis reaching nearly 100% in K562, BV173 and UT7 cells over-expressing BCR-ABL1 in low-serum conditions (Figures 3.9&3.12-3.14). Furthermore, the simultaneous suppression of BCR-ABL1 kinase activity and ATG4B reduced the formation of colonies of primary CD34+ CML cells, but mainly spared CD34+ cells from healthy donors, particularly upon treatment with IM or DA and ATG4B inhibitors 4Bi-2 or 4Bi-3 (Figure 3.15). Drug interaction analyses in K562 cells revealed synergistic effects, and the IC50 for both ATG4B compounds was with ~7.5 μM for 4Bi-2 and ~10 μM for 4Bi-3 well below the previously published ATG4B inhibitor with an IC50 of 50 μM (Figure 3.11) [280]. These results illustrate that ATG4B is a valid therapeutic target in CML and show that a combination of BCR-ABL1 and ATG4B inhibitors is more effective in targeting primitive CML cells than either single agent alone.          In order to understand how the expression of ATG4B is deregulated in CML, our group also examined the expression of miRNAs predicted to regulate ATG4B and ATG4D expression. Both miR-34a and miR-152 expression levels were found to be down-regulated in CML stem/progenitor cells compared to CD34+ normal BM cells, correlating inversely with increased transcript levels of ATG4B and ATG4D, respectively [290]. Moreover, forced expression of miR-34a significantly reduced ATG4B protein levels in CML cells and further sensitized these cells to IM treatment. Luciferase assays confirmed direct targeting of ATG4B by miR-34a but did not confirm direct targeting of ATG4D by miR-152, although both miR-34a and miR-152 are predicted to target ATG4B and ATG4D, respectively [290]. Nevertheless, miR-34a-mediated ATG4B regulation may not explain the overall increase in basal autophagy in CML entirely and further investigations are needed.  83  The mammalian target of rapamycin (mTOR) of the TORC1 signaling pathway is a well-known negative regulator of autophagy, and BCR-ABL1 has been shown to suppress autophagy via the PI3K/AKT/FOXO4/ATF-5 pathway by stimulating transcription of mTOR [285, 291, 292]. On the other hand, it has been illustrated that autophagy is induced by BCR-ABL1 via the rapamycin-insensitive mTORC2 signaling complex and helps CML cells to recover from TKI treatment [139, 293]. The kinase mTOR can be part of two distinct complexes, TORC1 and TORC2 [292]. While the TORC1 complex and its negative regulation on autophagy has been extensively studied, much less is known about the TORC2 complex that stimulates and mediates autophagy during amino acid starvation [292]. TORC2 promotes autophagy via its downstream target Ypk1 that in turn inhibits calcineurin allowing activation of the eIF2α kinase Gcn2 and phosphorylation of 4E-BP1 T37/46 and S65 to stimulate autophagy [292]. Future investigations should determine the presence of these pathway components, its phosphorylation status and potential changes upon ATG4B inhibition in CML. In addition, TORC2 could be mutated and possible alterations in the expression of ATG4B could be examined to determine if ATG4B is downstream of TORC2. Moreover, the specificity of the ATG4B inhibitors should be confirmed by cleavage assays and by assessing the phosphorylation status and potential alterations of various kinases and its effectors such as PI3K/AKT/GSK3β or MAPK and p-ERK upon treatment [268, 281, 286]. One study has shown that autophagy is regulated by HMGB1 through an increase in the transcriptional activity of JNK and ERK [294], and ERK has recently been revealed to be a target of ATG4B, but also to be involved in the induction of autophagy [286].  Another study illustrated that loss of REDD1 within a redox-sensitive protein complex that senses alterations in ROS and hypoxia results in hyperactivity of ATG4B accompanied by impaired autophagic flux [295]. Interestingly, our RNA-seq analysis confirmed a 4.5-5-fold 84  reduction of REDD1 in CD34+ CML cells compared to CD34+ cells from normal individuals (Jiang lab, unpublished). In addition, the REDD1/TXNIP complex has been reported to be able to inhibit mTORC1 and thus, may foster autophagy stimulation via the TORC2 pathway [295]. An additional avenue for potential further investigations may include experiments with respect to the expression and activity of SIRT1 that has been recently demonstrated to modulate autophagy in response to oxidative stress and nutrient deprivation [296].    In summary, I identified ATG4B as a critical modulator of autophagy in CML and its potential as an effective and novel therapeutic target for improved combination treatments. Nevertheless, more detailed investigations regarding the regulation of ATG4B in leukemic cells are warranted and the specificity of novel ATG4B inhibitors needs to be confirmed.                 85  Chapter 4: The Focal Adhesion Component Integrin-Linked Kinase is Key to Stromal Cell Interactions and Survival of CML Stem/Progenitor Cells  4.1 Introduction The human BM compartment consists of a heterogeneous, multi-functional network of cells and extracellular matrix that interact with HSC to allow them to retain stem cell properties [149, 150]. Growing evidence indicates that this microenvironment and its reciprocal communication with primitive cancer cells also influences disease progression and the emergence of therapy resistance in CML and other leukemias [297]. CML stem cells are believed to be the origin of the disease where the BCR/ABL1 fusion occurs and reside, similar to normal HSC, in a protective niche in the BM [2, 46, 145-147]. CML stem cells are not effectively eliminated by TKI monotherapies and do not depend on the BCR-ABL1 kinase activity for their survival causing TKI resistance and relapse [35, 54, 279]. In addition, it has been shown that co-culture of stromal cells with primitive CML cells in vitro reduces the sensitivity of leukemic cells to TKI treatment significantly, suggesting that leukemia-stroma interactions contribute to disease persistence on TKI therapy [167, 169, 171, 173]. Therefore, it is critical to identify complementary therapies that target both key molecular events in CML stem/progenitor cells and their associated BM niche to prevent acquisition of resistance. One candidate is ILK, a serine/threonine kinase that is a critical component of focal adhesions and mediator in the regulation of multiple signaling pathways in the BM microenvironment influencing cell growth, proliferation, differentiation, adhesion and migration [213-216]. However, the possibility that ILK contributes to the regulation of CML and its response to therapy is unknown. 86  My RNA-seq data analysis revealed that the expression of ILK is significantly increased in CD34+ cells from CML patients compared to normal CD34+ human BM cells, with the highest ILK transcript levels detectable in the Lin-CD34+CD38- stem cell-enriched CML population. Knockdown of ILK expression by lentiviral-mediated shRNAs or inhibition of ILK activity by a selective ILK inhibitor (QLT0267) in CD34+ CML patient cells significantly impaired their survival and proliferation and sensitized them to TKIs added to both short- and long-term cultures + stromal cells. Notably, QLT0267 in combination with a TKI specifically targeted quiescent CML stem cells from TKI-resistant patients, and QLT0267 (up to 10 μM) was not toxic to normal CD34+ BM cells. These findings indicate that ILK may play a critical role in regulating CML stem cell activity and that targeting of ILK and BCR-ABL1 kinases simultaneously may offer an important new therapeutic avenue.   4.2 Results 4.2.1 ILK Expression Is Significantly Increased in CML Stem and Progenitor Cells To identify differentially expressed genes in CML cells associated with BM niche interactions, I analyzed the transcriptomes of CD34+ cells from 6 different CP CML patients at diagnosis, prior to TKI therapy, and 3 normal healthy donors with respect to all known intracellular components of focal adhesion complexes [298]. This analysis revealed ILK as one of the most deregulated genes in CD34+ CML cells from CP patients (Figure 4.1A). To validate these findings, I performed Q-RT-PCR on CD34+ cells from 22 additional CML patients and 10 healthy volunteers (Figure 4.1B). ILK mRNA levels were discovered to be elevated between 2-6-fold in CML stem/progenitor cells compared to the same cell phenotypes isolated from healthy 87  BM samples (p<0.05, Figure 4.1B). In particular, ILK transcripts were highly increased in some CML patient samples that subsequently became resistant to IM therapy, although no overall significant difference between retrospectively classified IM-responders and IM-nonresponders was detectable (Figure 4.1B). In addition, Western blotting showed increased protein expression of ILK in CD34+ CML cells obtained from 4 patients versus CD34+ BM cells from 3 normal individuals (~3-fold, p<0.05, Figure 4.1C). Interestingly, ILK transcript levels were much higher in the more primitive and rarer, but minor, CD38- CML stem cell-enriched subset of the Lin-CD34+ population as compared to the more mature and prevalent CD38+ subset (bulk of CD34+ cells) or the terminally differentiated Lin+CD34- cells (p<0.01, Figure 4.1D).     88   Figure 4.1: ILK expression is increased in CML stem and progenitor cells.  (A) Volcano plot of RNA-seq analysis of intracellular focal adhesion components reveals that the transcript levels of ILK are significantly up-regulated in CD34+ CML cells compared to healthy donor cells. Dot size indicates relative gene expression, and red dots indicate differentially expressed genes between CML and normal BM cells with all statistically significant hits (p<0.05) above the red dotted line (B) Q-RT-PCR analysis confirms increased mRNA levels of ILK in CD34+ cells from CML patients (N=28) compared to normal CD34+ cells (N=10). Black circled squares are the results from subsequent IM-nonresponders (N=6). (C) Western blot analysis shows significantly higher ILK protein expression in CD34+ CML cells from patient samples (N=4) compared to normal cells (N=3). (D) Q-RT-PCR analysis shows that the stem-cell enriched population (Lin-CD34+CD38-) from CML patient samples harbor the highest mRNA levels for ILK compared to progenitor (Lin-CD34+CD38+) and differentiated (CD34-) cell populations.    89  4.2.2 IM Treatment or Co-Culture with Stromal Cells Further Increases ILK Expression in CD34+ CML Cells IM therapy has been found to be ineffective in eliminating CML stem cells, although it does inhibit the BCR-ABL1 tyrosine kinase activity in these cells [54, 279]. To investigate how IM treatment affects ILK expression, FACS-purified CD34+ and CD34- cells from 2 CML patients were cultured in vitro upon the addition of 5 µM IM, and after 24 hours, 48 hours, and 5 days, RNA was isolated and Q-RT-PCR analyses were performed. As depicted in Figure 4.2A, ILK transcript levels greatly increased in CD34+ CML cells with IM treatment over time, but not in the more differentiated CD34- CML subset (Figure 4.2A). Moreover, when CD34+ CML cells were co-cultured with stromal cells, intracellular ILK protein expression was found to be increased compared to CD34+ CML cells not in direct contact with stromal cells (Figure 4.2B).     90   Figure 4.2: IM treatment or stromal cell co-culture increase ILK expression in CD34+ CML cells. (A) ILK transcripts are elevated in FACS-sorted CD34+ cells from CML patients in response to IM treatment after 24 hours and are continuously elevated at 48 hours and 5 days post-treatment, whereas no changes in ILK transcripts were detected in CD34- cells by Q-RT-PCR. (B) CD34+ CML cells co-cultured with stromal cells express higher levels of intracellular ILK compared to the same cells not in contact with stromal cells.    4.2.3 The ILK Kinase Inhibitor QLT0267 Affects Viability, Apoptosis and TKI Responses of K562 and BV173 Cells Based on the finding that ILK expression is significantly increased in CML stem/progenitor cells from patients as compared to their normal counterparts, I next sought to 91  determine whether the kinase activity of ILK or its protein scaffold function, or both, are important for CML cell growth and survival. To suppress the kinase activity of ILK, Dr. Jiang and I collaborated with Dr. S. Dedhar (BC Cancer Agency, Vancouver) to utilize the pre-clinically validated and specific ILK inhibitor QLT0267. Initial experiments were performed in K562 cells to assess its IC50 for viability, apoptosis and CFC with QLT0267 treatment alone or in combination with IM. As shown in Figure 4.3A, an IC50 of ~10 µM was established for QLT0267 in K562 cells and used for the following experiments (Figure 4.3A). Viability assays revealed that a combination of ILK and BCR-ABL1 kinase inhibition is more effective in reducing the number of viable cells within 48 hours to 20% relative to the control, whereas IM treatment alone yielded ~50% viable cells and QLT0267 single treatment resulted in 80% viable K562 cells (Figure 4.3B). In addition, a combination of IM and QLT0267 significantly increased the proportion of apoptotic K562 cells to ~45% compared to controls, while IM or QLT0267 treatment alone resulted in ~25% and ~15% apoptotic cells, respectively (Figure 4.3B). To assess how single cells can grow and form colonies upon drug treatments, CFC assays were performed with K562 cells. Again, a combination of ILK and BCR-ABL1 inhibition proved to be more effective than any single agent in inhibiting clonal growth of K562 cells; in particular the production of large- and medium-sized colonies was reduced (Figure 4.3C). While the IC50 of QLT0267 was lower in BV173 cells with 5 µM (Figure 4.3D), significantly decreased viability and enhanced apoptosis were also observed in BV173 cells, particularly upon the dual inhibition of ILK and BCR-ABL1 activities (Figure 4.3E).   92   Figure 4.3: Combined treatment with QLT0267 and IM enhances cell death of K562 and BV173 cells.  (A) Percentage of inhibition of cell growth in K562 cells by QLT0267. The IC50 is ~10 µM. (B) A combination of ILK inhibitor and IM significantly reduces viable cells and enhances apoptosis in K562 cells compared to single agent treatment. (C) Assessment of CFC output in K562 cells reveals significantly reduced CFC numbers upon combination treatment compared to single agents. A combination of QLT0267 and IM reduces in particular the formation of large and medium-sized colonies. (D) The IC50 for the ILK inhibitor in BV173 cells is ~5 µM. (E) Combining IM with QLT0267 reduces the viability of BV173 cells and increases apoptosis significantly compared to treatment with single agents.      93  4.2.4 Simultaneous Kinase Inhibition of ILK and BCR-ABL1 Increases Apoptosis of Primary CD34+ CML Cells and Overcomes Protection by Stromal Cells in Co-Cultures To extend my studies of the effects of ILK kinase inhibition to primitive CML cells, I established the IC50 for QLT0267 in CD34+ cells derived from CML patients, and assessed cell viability and apoptosis of these cells upon single and drug combination treatments. As for K562 cells, I observed growth inhibition of primitive CML cells from 2 patients upon QLT0267 treatment for 72 hours with an IC50 of about 10 µM (Figure 4.4A). Moreover, when CD34+ CML cells were treated with IM or DA in combination with QLT0267 for 3 days in vitro, cell viability was reduced to 20% of the control compared to 80-55% viable cells upon any single drug treatment or TKI combination (Figure 4.4B). In addition, apoptosis measurements revealed that the simultaneous suppression of ILK and BCR-ABL1 kinase activities significantly increased the percentage of apoptotic cells compared to single agents or a TKI combination, from ca. 15% to ~35% relative to control cells (Figure 4.4B).  To address the question of whether the kinase activity of ILK plays a role in stromal cell interactions such as in the BM niche, apoptosis assays were also performed with QLT0267 alone or in combination with TKIs in the presence of expanded BM stromal cells and compared to the results in the absence of stromal cells. It is known that co-culture of primary CML cells with stromal cells protects them from the cytotoxic effects of TKIs [55, 169]. As previously reported, my apoptosis assays confirmed that IM or DA treatment induces less apoptosis in CML stem/progenitor cells in the presence of stromal cells compared to CD34+ CML cells cultured and treated with TKIs in the absence of stromal cells (Figure 4.4C). However, this effect was abolished when primitive CML cells were treated simultaneously with QLT0267 and a TKI (Figure 4.4C). Interestingly, pre-treatment of CD34+ cells from CML patients for 24 hours with 94  the cytokine IL-3 followed by TKI and QLT0267 single or combination treatments did not protect CML cells from TKI-induced apoptosis, but sensitized CD34+ CML cells to QLT0267 treatment alone and in drug combination approaches compared to cells cultured without added IL-3 (Figure 4.4D). Drug interaction analysis between IM and QLT0267 indicated strong synergy for these drugs on CD34+ CML cells (CI value < 0.3) as well as for DA and QLT0267 combinations (CI value < 0.35) in the absence and presence of stroma co-cultures (Figure 4.4E).      Figure 4.4: Simultaneous inhibition of ILK and BCR-ABL1 kinases increases apoptosis of primary CD34+ CML cells and overcomes protection by stromal cells in co-cultures.        (A) Treatment with the ILK inhibitor QLT0267 inhibits the growth of CD34+ CML patient cells 95  (N=2) in vitro. The IC50 is ~10 µM. (B) A combination of QLT0267 with IM or DA reduces cell viability and enhances apoptosis of CD34+ CML cells, which cannot be achieved with single agents or a combination of IM + DA (N=4). (C) Co-culture with stromal cells protects CD34+ CML cells from apoptosis upon TKI treatment. However, treatment with the ILK inhibitor enhances apoptosis in CD34+ CML cells and abolishes the protective effect of stromal cells on primitive CML cells upon combination treatments with TKIs and QLT0267. (D) Pre-stimulation of CD34+ CML cells with IL-3 has a protective effect on these cells upon TKI treatment. However, the presence of IL-3 followed by ILK inhibitor treatment enhances killing of CD34+ CML cells in suspension culture compared to cultures without IL-3 pre-stimulation. (E) Isobolograms of drug interaction analysis with CalcuSyn software indicate synergy between IM and QLT0267 (CI<0.3) or DA and QLT0267 (CI<0.35) combinations. * p<0.05 in comparison to all other treatments.    4.2.5 A Combination of QLT0267 and TKIs Blocks Short- and Long-Term Colony Growth of CD34+ CML Cells from IM-Resistant Patients, but Spares Normal Cells To quantitate clonogenic proliferation and differentiation of intermediate leukemic progenitors into mature progeny upon various drug treatments in vitro, CFC assays were performed with CD34+ cells from CP CML patients that were retrospectively classified as IM-nonresponders [267]. CFC assays revealed that QLT0267 plus a TKI significantly reduced the yield of colonies obtained from CD34+ CML cells compared to any single agent or a combination of TKIs (N=6; p<0.01, Figure 4.5A). Analysis of the lineages affected, showed that a combination of IM or DA with QLT0267 had a more pronounced effect on myeloid colony formation (CFU-GM), at concentrations where either or both TKIs had little effect (i.e. 85-90% inhibition vs. 30-45%) on CML cells (Figure 4.5A). Moreover, the simultaneous inhibition of ILK and BCR-ABL1 activities also effectively inhibited the growth of more primitive and rare long-term multi-lineage leukemic cells (from IM-nonresponders) when these were co-cultured with an irradiated supportive feeder monolayer in 6-week long-term cultures (LTC), in contrast to the lack of these effects in the presence of single TKIs or TKI combinations (Figure 4.5C). 96  Importantly, QLT0267 or a combination of QLT0267 with a TKI, was not toxic to normal CD34+ cells in either direct CFC (Figure 4.5B) or LTC-IC assays (Figure 4.5C), suggesting ILK may be a promising target for drug combinations in primitive CML cells.    Figure 4.5: A combination of QLT0267 and TKIs blocks short- and long-term colony growth of CD34+ CML cells, but is not toxic to normal cells. (A) Percentage of colonies obtained relative to untreated cells in semi-solid media with IM (5 µM), DA (150 nM) or QLT0267 (10 µM) alone, or in combinations, of Lin-CD34+ CML cells from IM-resistant patients (N=5). The combined use of TKIs with the ILK inhibitor significantly reduces CML cell growth, particularly of CFU-GM colonies, as compared to treatment with one or a combination of TKIs. (B) CFC formation of CD34+ cells from healthy donors shows minimal toxicity of QLT0267 alone or in combination with TKIs (N=5). (C) Long-term culture-initiating cell assays reveal that QLT0267 treatment effectively inhibits the growth of very primitive CML cells in combination with TKIs (N=3), without effects on CD34+ cells from normal donors (N=3).  97  4.2.6 Combined Inhibition of ILK and BCR-ABL1 Kinase Activities Reduces the Persistence of Primitive, Quiescent CML Cells Previous reports have shown that TKIs cannot target the quiescent population of primary CML cells in vitro and likely also not in patients [35, 46, 278]. To determine whether the ILK inhibitor QLT0267 would affect this critical fraction of primitive CML cells, cell division tracking analysis with CFSE (Carboxyfluorescein diacetate-succinimidyl ester) was initiated on patient-derived CD34+ cells from subsequent IM-nonresponders upon various single agent or drug combination treatments in vitro. CFSE division analysis 3 days post-drug exposure validated that IM or DA treatment, or a combination of both, eliminate mostly dividing cells but not the quiescent population of leukemic cells, as indicated by an increase in the fraction of cells that are still undivided compared to controls (Figure 4.6). However, QLT0267 treatment alone, and more importantly QLT0267 in combination with either IM or DA, did not exhibit this effect, suggesting that QLT0267 plus a TKI may target quiescent CML stem cells from IM-resistant patients (N=4; p<0.05, Figure 4.6).   98   Figure 4.6: Combined inhibition of ILK and BCR-ABL1 kinases targets quiescent cells from IM-resistant CML patients. Cell division tracking analysis reveals effects of TKIs and QLT0267 on the proliferative activity of CD34+ CML cells (N=4). QLT0267 alone, or in combination with TKIs, reduces quiescent cell numbers (undivided cells) as compared to single TKI or TKI combination treatments.    4.2.7 QLT0267 Treatment Decreases Adhesion of CML Cells and Reduces Phosphorylation of GSK3β and STAT3 in CML Cells To identify whether ILK kinase inhibition affects adhesion of CML cells, adhesion assays were conducted with BV173 or primitive CD34+ CML cells. BV173 cells were plated on 99  Fibronectin (α5β1)-coated dishes to allow binding of cells and to stimulate β1-integrin interactions. Concurrent or pre-treatment of BV173 cells with IM resulted in an increased proportion of adherent cells, while treatment with QLT0267 alone or in combination with IM prevented this effect (Figure 4.7A). CD34+ cells from CML patient samples were cultured on expanded BM stromal cells with and without the addition of QLT0267. As displayed in Figure 4.7B, treatment with QLT0267 reduced the proportion of adherent cells by about 20% compared to control-treated cells (Figure 4.7B). To investigate in more detail which ILK kinase-dependent signaling pathways may be affected by QLT0267, K562 cells were used first due to easy access of larger amounts of cells and a similar IC50 to primary CML cells. Treatment of K562 cells with 10 µM QLT0267 followed by Western blotting revealed that ILK kinase inhibition reduces phosphorylation of GSK3β within 1 min of QLT0267 exposure (Figure 4.7C). Moreover, QLT0267 treatment also reduced p-STAT3 (Y705) protein levels within 60 min post-drug exposure in K562 cells (Figure 4.7C). Analogous experiments in K562 cells with IM exposure (0.5 µM) did not illustrate such changes in p-GSK3β or p-STAT3, indicating that they are specific consequences of ILK inhibition (Figure 4.7C).           Together, the enhanced and selective effects obtained by dual inhibition of both kinases ILK and BCR-ABL1 in vitro, particularly in the presence of protective stromal cells to mimic their response within the BM microenvironment, suggest that ILK may be an important player in the regulation of TKI responses and resistance of CML cells.    100   Figure 4.7: Treatment with the ILK inhibitor QLT0267 prevents deregulated adhesion of CML cells and decreases protein phosphorylation of GSK3β and STAT3 in K562 cells.  (A) Treatment of BV173 cells with IM enhances their adhesion to fibronectin (α5β1), whereas simultaneous or pre-treatment with an ILK inhibitor can prevent this effect, including in the presence of IM (B) Adhesion of primary CD34+ CML cells (CD45+) decreases to stromal cells (CD45-) upon QLT0267 treatment compared to control-treated cells. (C) Western blot analysis shows that QLT0267 treatment reduces phospho-GSK3β and phospho-STAT3 levels in K562 cells (left), while IM treatment did not display such effects (right), indicating that QLT0267 selectively targets ILK and its downstream targets.  101  4.2.8 Oral Gavage Treatment with QLT0267 and DA Decreases Leukemia Burden and Enhances Survival of Leukemic Mice To investigate whether a combination of QLT0267 and DA decreases leukemia development in vivo, NSG mice were injected intravenously with 2.5×106 BV173YFP/Luc cells per mouse (Figure 4.8A). BV173 cells have been shown to be able to induce an aggressive leukemia, affecting all hematopoietic organs, in NSG mice [80, 82]. Expression of the enzyme luciferase (Luc) would allow close monitoring of engraftment of BV173 cells in vivo.  At Day 14 post-transplantation, a subset of mice were imaged in vivo and representative results are depicted in Figure 4.8B. All mice injected with BV173YFP/Luc cells displayed similar engraftment levels, mostly in the BM, as indicated by the strong bioluminescence signals (Figure 4.8B). Oral gavage treatments were then performed for 14 days once daily. At 3 weeks after completion of this procedure, mice were imaged again to monitor leukemia development. As shown in Figure 4.8C, vehicle-treated mice progressed to develop leukemia in all hematopoietic organs, while treatment with single agents (QLT 25 mg/kg or 75 mg/kg, or DA 15 mg/kg) decreased the degree of leukemia progression compared to vehicle-treated mice, but was not able to prevent a spread of leukemic cells from the BM into liver and spleen. In contrast, combination treatments with DA (15 mg/kg) and QLT0267 (25 mg/kg or 75 mg/kg) did not only prevent leukemia progression, but also decreased the previously established leukemia below detection limits (Figure 4.8C). To follow up on this finding, bioluminescence in vivo imaging was repeated on a few remaining mice 5 weeks after completion of oral gavage treatments (Figure 4.8D). While mice previously treated with DA revealed a strong bioluminescence signal in liver and spleen indicative of high leukemia burden, mice treated with QLT0267 (75 mg/kg, but not 25 mg/kg) and DA continued to be negative for leukemic BV173YFP/Luc cells (Figure 4.8D).                 102   Figure 4.8: Combined treatment with QLT0267 and DA decreases leukemia burden in vivo and enhances survival of leukemic mice. (A) Experimental design of in vivo study. (B) Bioluminescence imaging of NSG mice 14 days after intravenous injection with 2.5x106 103  BV173YFP/Luc cells per mouse indicates similar engraftment levels. (C) In vivo images of mice 2 weeks after completion of oral gavage treatments with vehicle, QLT0267 (25 mg/kg or 75 mg/kg), DA (15 mg/kg) or a combination of QLT0267 (25 mg/kg or 75 mg/kg) and DA (15 mg/kg). (D) Comparison of bioluminescence images of mice treated with DA (15 mg/kg) alone, or a combination of DA (15 mg/kg) and QLT0267 (25 mg/kg or 75 mg/kg) 5 weeks post-oral gavage treatments. (E) Survival curve of leukemic mice (N=5-6 mice per group) treated with indicated drugs. (F) Body weight measurements of all mice in each treatment group. Data shown are the mean + SEM. i.v. = intravenous; IVIS = In vivo imaging system.   In addition, survival of 5-6 mice per treatment group was monitored. Mice treated with DA survived longer than mice treated with vehicle or QLT0267 (25 mg/kg or 75 mg/kg) treatment alone (Figure 4.8E). However, mice that received a combination of QLT0267 (75 mg/kg) and DA survived on average much longer (median survival 86 days) than mice treated with DA alone (median survival 67 days; p=0.011, Figure 4.8E). The combined treatment of 25 mg/kg QLT0267 with DA was not as effective long-term and did not significantly increase survival of these mice in comparison to DA-treated mice overall (Figure 4.8E).      4.2.9 Leukemia Infiltration into Hematopoietic Tissues Is Decreased by a Combination of QLT0267 and DA Treatment In Vivo  To confirm the findings from the in vivo imaging studies, 1 mouse per treatment group was sacrificed at 3.5 weeks and at 5.5 weeks after completion of the oral gavage procedure, respectively, and hematopoietic organs investigated for the presence of human leukemic cells. As shown in Figure 4.9A, spleens and livers of mice treated with vehicle or QLT0267 (25 mg/kg or 75 mg/kg) were enlarged in comparison to organs from a normal healthy NSG mouse not injected with BV173YFP/Luc cells (no cells). The liver, but not the spleen, of a DA-treated mouse was slightly enlarged, while the organs from mice treated with QLT0267 and DA combinations were very comparable in size and weight to normal healthy organs (Figure 4.9A).         104   Figure 4.9: Oral gavage treatment of QLT0267 in combination with DA decreases infiltration of leukemic cells into hematopoietic tissues in mice. (A) Spleen and liver 105  appearance of sacrificed mice (N=1 mouse per treatment group) at Day 53 post-injection with BV173YFP/Luc cells and 3.5 weeks after completion of oral gavage treatment with vehicle, QLT0267 (25 mg/kg or 75 mg/kg), DA (15 mg/kg) or a combination of QLT0267 (25 mg/kg or 75 mg/kg) and DA (15 mg/kg). (B) FACS analysis of PB, BM, spleen and liver of the same sacrificed mice at Day 53 post-transplantation shows percentage of engraftment of viable, human CD19+/YFP+ cells. (C) Spleen and liver appearance of 1 sacrificed mouse per remaining treatment groups at Day 67 post-transplantation (= 5.5 weeks after completion of oral gavage treatments). (D) FACS profiles of PB, BM, spleen and liver of the same sacrificed mice at Day 67. Engraftment levels of viable, human, leukemic CD19+/YFP+ cells is shown in percent.      FACS analysis confirmed that PB, BM, spleen, and liver from mice treated with vehicle or QLT0267 (25 mg/kg or 75 mg/kg) contained a high number of human, leukemic CD19+/YFP+ cells (Figure 4.9B). Mice treated with DA revealed a similar high percentage of human, leukemic cells in the liver, but fewer leukemic cells in PB, BM and spleen in comparison to mice treated with vehicle or QLT0267 alone (Figure 4.9B). In contrast, mice treated with a combination of QLT0267 (75 mg/kg) and DA, displayed only a very slight increase of leukemic cells in BM and spleen, and to a larger extent in the liver, compared to normal healthy mice, but remarkably less than DA-treated mice (Figure 4.9B). Mice treated with a lower dose of QLT0267 (25 mg/kg) in combination with DA presented with engraftment levels of leukemic cells between mice treated with DA alone or a combination of QLT0267 (75 mg/kg) and DA (Figure 4.9B).  The analysis at Day 67 post-transplant revealed that mice treated with a combination of QLT0267 (75 mg/kg) and DA had a slight increase in spleen and liver size (Figure 4.9C), but continued to have relatively few leukemic cells in all hematopoietic organs investigated (Figure 4.9D). However, the vehicle- and DA-treated mice, as well as mice treated with a combination of 25 mg/kg QLT0267 and DA displayed greatly enlarged spleens and livers (Figure 4.9C), in addition to high proportions of leukemic CD19+/YFP+ cells in PB, BM, spleen and liver (Figure 4.9D).          106  4.2.10 Lentiviral-Mediated Suppression of ILK in K562 Cells Reduces Proliferation and Cell Viability   To characterize the biological effects of ILK protein inhibition in CML cells and to confirm the specificity of the ILK inhibitor studies, I performed stable suppression of ILK by lentiviral-mediated means using MISSION shRNAs (Sigma-Aldrich) targeting the 3’ UTR region or coding sequence of ILK (Figure 4.10A). First, the knockdown efficiency of 3 different ILK-targeting shRNAs was tested in K562 cells and compared to a non-targeting control (SHC) (Figure 4.10B). The two constructs shILK#1 and shILK#3 achieved a very good suppression of ILK protein expression, while transductions with shILK#2 resulted in a less efficient knockdown of ILK in K562 cells (Figure 4.10B). Growth monitoring of these cell lines illustrated a decrease in proliferation of K562 cells correlating with the level of ILK protein suppression (Figure 4.10C). Similarly, viability assessments without and with IM treatment 48 hours post-treatment revealed a reduction of viable K562 cells that was most obvious for cells transduced with shILK#1 and to a lesser extent for shILK#3, while K562 cells transduced with shILK#2 yielded viability levels between the control and the other two knockdown cell lines (Figure 4.10D). IM treatment further enhanced these effects, although not significantly (Figure 4.10D). Moreover, K562 cells transduced with either shILK#1 or shILK#3 exhibited 35-40% apoptotic cells, whereas the control cells showed 20% apoptotic cells, and cells transduced with shILK#2 about 25% apoptosis (Figure 4.10E). Once again, IM exposure resulted in an increase in apoptotic cells infected with shILK#1 and shILK#3 up to 55% compared to the control and K562 cells expressing shILK#2 with ~35% (Figure 4.10E). These data illustrate that stable suppression of ILK can be achieved in CML cells and it affects leukemic cell survival and proliferation.  107   Figure 4.10: Lentiviral-mediated depletion of ILK reduces proliferation and viability of K562 cells. (A) Schematic representation of ILK-targeting by various shRNAs. (B) Western blotting of K562 cells transduced with a non-targeting control shRNA (SHC) or shRNAs targeting ILK confirms knockdown of ILK protein to various degrees for the 3 different constructs used. (C) Depletion of ILK protein decreases growth rates of K562 cells, in particular of cells expressing shILK#1 or shILK#3, compared to the control (SHC). (D) ILK knockdown in K562 cells also reduces cell viability. (E) Suppression of ILK increases apoptosis, and these effects can be enhanced with simultaneous IM treatment.    108  4.2.11 Stable Knockdown of ILK in CD34+ CML Cells Decreases Their Survival and Growth Potential in the Presence and Absence of Stromal Cells Stable suppression of ILK protein was also investigated in patient-derived CD34+ cells for its effects on CML stem and progenitor cell survival and proliferation in vitro. Successful knockdown of ILK was confirmed by Western blotting or intracellular ILK staining followed by flow cytometry in CD34+ cells from 3 different CML patients (Figure 4.11A). Similarly to K562 cells, knockdown with shILK#1 and shILK#3 was more efficient than with shILK#2 in primary CML cells (Figure 4.11A). Monitoring of proliferation of these cells from 2 patients over 10 days in culture, displayed less growth of cells transduced with shILK#1 or shILK#3 compared to control cells (SHC) or cells transduced with shILK#2 (Figure 4.11B). Cell cycle analysis revealed that these observations might be attributed to a reduction of cells progressing into or through S-phase upon almost complete suppression of ILK protein (shILK#1 and shILK#3), whereas a less efficient ILK knockdown did not exhibit this effect as pointed out by shILK#2-transduced cells in comparison to control-transduced cells (SHC)  (Figure 4.11C). In addition, I detected decreased viability and increased apoptosis for primary ILK knockdown cells (Figure 4.11D). Treatment with IM or DA reduced viability further in these cells and apoptosis reached close to 100% in CD34+ CML cells transduced with shILK#1 or shILK#3 compared to the control upon concurrent treatment with IM or DA in these ILK-suppressed cells (Figure 4.11D). Furthermore, comparable results for viability and apoptosis were obtained when CD34+ CML cells with stable suppression of ILK were co-cultured on stromal cells, with and without IM or DA treatment (Figure 4.11E), suggesting that simultaneous targeting of ILK protein expression and BCR-ABL1 kinase activity reduces survival of CML stem/progenitor cells.    109   Figure 4.11: Stable suppression of ILK decreases survival and growth of primary CD34+ CML cells in the presence or absence of stromal cells. (A) Western blotting and intracellular staining confirm ILK knockdown in CD34+ cells from 3 different CML patient samples. (B) Depletion of ILK protein expression decreases proliferation of primary CML cells. (C) BrdU incorporation reveals a reduction in S-phase CML cells upon strong ILK suppression. (D) Decreased viability and increased apoptosis are observed upon ILK knockdown in the absence of stromal cells and (E) in the presence of stromal cell co-cultures. * p<0.05.  110  4.2.12 Combined ILK Suppression and BCR-ABL1 Inhibition Decreases Significantly Short- and Long-Term Colony Growth of CML Stem and Progenitor Cells  Colony-formation assays upon short- and long-term cultures emphasized the effectiveness of the combination approach of suppressing ILK and BCR-ABL1 kinase simultaneously further. The number of CFU-GM and BFU-E colonies formed by CD34+ cells with stable ILK knockdown was significantly reduced, and almost all colonies were completely abolished when cells were transduced with shILK#1 or shILK#3 and simultaneously treated with IM or DA (Figure 4.12A). LTC-IC assays demonstrated that suppression of ILK also decreased the more rare long-term primitive CML cells when these were co-cultured on feeder monolayers, with enhanced effects in particular for cells expressing shILK#1 and shILK#3 upon concurrent IM or DA exposure (Figure 4.12B).    111   Figure 4.12: Stable knockdown of ILK reduces colony formation of CML stem and progenitor cells from IM-resistant patients. (A) Colonies formed by CD34+ CML cells from IM-resistant patients (N=3) in comparison to control-transduced cells (SHC) from the same patients demonstrates the effect of ILK suppression in decreasing the ability of single cells to grow colonies in semi-solid culture medium. (B) CFC output from 6-week long-term cultures of CD34+ CML cells from IM-resistant patients (N=2) in the presence of stromal cells with and without ILK knockdown. Suppression of ILK in combination with a TKI almost eliminates very primitive leukemic cells. * p<0.05.       112  4.3 Discussion and Future Directions Niche-targeted therapies may be an important adjunct to eliminate leukemic stem and progenitor cells in vivo as the BM microenvironment contributes to disease progression and resistance to chemotherapy, including in CML [167, 169, 172, 173, 297]. Novel therapies could be directed towards self-renewal pathways, homing or cell adhesion molecules to eradicate CML stem cells, but would need to not affect co-existing HSCs. This challenging task requires the identification of unique alterations or differential activation of key molecular events in primitive CML cells and their associated niche compared to normal HSCs. However, the BM niche includes a complex network of cells, ECM and signaling molecules and thus, pinpointing therapies to one specific target is a challenge [149, 297]. ILK was found to be differentially expressed between CD34+ CML and normal BM cells, with the highest ILK transcripts detectable in the most primitive Lin-CD38- subset of CD34+ CML cells (Figure 4.1) (Blood 2014; 124(21):402). In addition, intracellular ILK protein levels were higher in primary CML cells that are in contact with stromal cells as compared to the same cells cultured without stroma (Figure 4.2B). ILK transcripts were also increased in CD34+, but not CD34- cells, upon IM treatment in vitro (Figure 4.2A).  ILK is unique and an interesting target due to its multiple functions as a scaffold and serine/threonine kinase [213, 214, 216]. ILK is not only an important constituent of focal adhesions, facilitating interactions and reciprocal communication between the intra- and extracellular environment via integrins, but also a key mediator of multiple signaling pathways influencing cell proliferation, differentiation, adhesion and migration [213, 216]. To investigate both properties of ILK as a scaffold and as a signaling hub, I performed ILK kinase inhibitor and protein suppression studies. While treatment with QLT0267 alone did not kill many CML or 113  normal cells, the simultaneous combination of the ILK inhibitor with a TKI was particularly effective in eliminating primitive CML cells, including in the presence of stromal cells, and extended survival of leukemic mice by oral gavage treatment in vivo (Figures 4.4-4.5&4.8-4.9). In addition, stable knockdown of ILK decreased CML cell viability and proliferation drastically compared to control cells, and these effects were slightly enhanced by additional TKI treatment of CD34+ CML as most cells were not viable after ILK knockdown (Figure 4.10&4.11). This suggests that ILK is critical to CML cell survival and growth, and that QLT0267 treatment sensitizes primitive CML cells to TKI treatment. However, to confirm whether the structural presence of ILK and/or its signaling functions within focal adhesions are important in CML cells, rescue studies in ILK knockdown cells with kinase-dead ILK mutants need to be performed [254]. In addition, kinase assays should be completed to verify the successful inhibition of the ILK kinase in CML cells [214].        The outstanding effectiveness of the combined treatment with QLT0267 and TKIs to prevent the growth of very primitive and quiescent CML cells, even in the presence of stromal cells (Figure 4.5&4.6), suggests that BCR-ABL1-dependent and –independent pathways may be targeted. This hypothesis is supported by the strong synergy in drug interactions between QLT0267 and IM or DA in CD34+ CML cells (Figure 4.4). Notably, normal BM cells were significantly less inhibited by the combination approach indicating that cancer-specific pathways are being targeted. STAT3 (Y705) phosphorylation was reduced by QLT0267 treatment, but not by IM, although it was functional as a TKI as evident by the reduced phosphorylation levels of BCR-ABL1, that were on the other hand unchanged upon QLT0267 treatment (Figure 4.7). STAT3 has been implicated to be important for cancer progression, playing a central role in cancer stem cells and in stromal cells of the tumor microenvironment [299]. Furthermore, several 114  publications demonstrated that stromal cell co-cultures with CML cells or conditioned media elevate phosphorylation of STAT3 (Y705) that is maintained upon TKI treatment, and may be involved in conferring resistance and protection of leukemic cells by the BM niche [181, 182]. A recent study also illustrated that p-STAT3 (Y705) remained increased in CML cells once TKI resistance is established without the addition of conditioned media [56]. Therefore, STAT3 may be a critical convergence point of intrinsic and acquired resistance in CML, emphasizing it as a promising therapeutic target. But, STAT3 is a challenging therapeutic target because it lacks enzymatic activity and harbors sequence similarity with other STATs. Nevertheless, one STAT3 SH2 domain inhibitor has been developed [56] and further trials may prove its effectiveness in CML in the future. Targeting of STAT3 via ILK suppression or inhibition may be a valid alternative although it has not been established yet if ILK directly or indirectly influences STAT3 phosphorylation. To test this premise, in vitro assays with recombinant STAT3 could be performed. Traditionally, STAT3 was thought to be activated by JAK2 or JAK1, and IL-6, well-known and important mediators in CML, that will need to be investigated in the context of ILK inhibition [68, 78-80, 82]. In addition, many serine/threonine kinases can directly phosphorylate STAT3, including ILK [299].  Another interesting finding was that GSK3β phosphorylation is reduced by QLT0267, but not IM treatment, in K562 cells (Figure 4.7), suggesting that ILK inhibition may also affect the Wnt/β-catenin signaling pathway and further investigations are necessary. Since ILK is upstream of various signaling pathways that may be active or important in CML and TKI resistance, it would be advised to perform a global phospho-proteomics approach such as mass cytometry with CyTOF (Fluidigm) or multicolor FACS analysis, which would simultaneously allow elucidation of molecular events in rare, primary CML stem cell populations upon QLT0267 115  treatment [300-302]. The results could then be compared to the same cells treated with IM to identify overlapping and BCR-ABL1-independent signaling pathways.          For most experiments so far, CD34+ CML cells were utilized that contain very few stem and mostly progenitor cells due to the limited availability of precious patient material. Nonetheless, I detected a significant difference between CML patient and healthy BM donor samples with respect to ILK expression, which was also confirmed to be further increased in CML cells purified towards a stem cell-enriched population. Future experiments should be repeated with various CD34 subpopulations, including Lin-CD34+CD38- and maybe CD26+ CML stem cells, for the most interesting findings to verify the importance of ILK in the CML stem cell compartment. However, the problem of rapid cell differentiation of these primitive cells in in vitro cultures remains.  As previously described, I also observed an increase in ILK transcripts upon IM treatment in CD34+ CML cells, but not the CD34- fraction (Figure 4.2A). Here, I need to determine if IM stimulates the expression of ILK or if CML cells with high ILK expression preferentially persist upon therapy relative to cells with low ILK expression. The latter may be the more likely case because TKIs are known to not effectively target primitive CML cells and ILK expression was highest in more primitive CML patient cells. Nevertheless, a possible future experiment comparing death rates of cells versus levels of ILK expression changes in CD34 subpopulations may help to address this question.   A similar question arises with the stroma co-culture experiments. Stromal cells or their secreted factors could potentially directly or indirectly induce ILK expression in contrast to attracting and binding primitive CML cells with higher ILK expression. Here, additional studies 116  with conditioned media produced by stromal cells could be used to prove if the direct contact between primitive CML and stromal cells is necessary to stimulate ILK expression.  Remarkably, the simultaneous kinase inhibition of ILK and BCR-ABL1 reduced viability and CML cell survival in the absence and presence of stromal cells significantly, indicating that targeting ILK may affect multiple survival pathways in CML. Some critics argue that QLT0267 may also inhibit the activity of SRC kinases [213], and that DA targets more than 30 kinases, including ILK [303]. However, my results do not support these statements as DA plus QLT0267 was not more effective than a combination of IM with QLT0267 in decreasing viability and in inducing apoptosis of CD34+ CML cells in short- and long-term culture assays (Figure 4.4&4.5). More importantly, SRC kinases were found to not play a prominent role in primitive CML cells [45]. Nevertheless, I will confirm whether QLT0267 treatment affects SRC phosphorylation in CML cells.   Another important signaling pathway in CML is IL-3 signaling [207, 304]. Pre-stimulation of primary CD34+ CML cells with IL-3 in vitro, followed by ILK kinase inhibition, caused an increase in apoptosis upon single QLT0267 and combination treatments with QLT0267 and TKIs (Figure 4.4). IL-3 stimulates and cross-talks with β1-integrins, and ILK is a key mediator of downstream signaling of β1-integrins [204, 205]. Hence, my findings agree with the model that IL-3 signaling is key in CML and suggest that indirect inhibition of the IL-3 signaling pathway via ILK may affect CML cell survival. In addition, future experiments should include other cytokines such as G-CSF that can for example, induce STAT3 signaling [299], or experiments with fibronectin to stimulate β1-integrin-ILK interactions and ILK signaling.          Further observations that I made, and which seem to add to stroma-independent effects of ILK suppression, are related to cell cycle progression. Consistent with another study [305], I 117  found that ILK silencing decreased the amount of cells in S-phase and hence, cell cycle slowing that needs to be validated in more samples (Figure 4.11). At the same time, cell division tracking with CFSE revealed that treatment of CD34+ CML cells with QLT0267 or a combination of QLT0267 with a TKI did not enrich the fraction of quiescent cells, in contrast to treatment with a single TKI or TKI combinations, suggesting that ILK inhibition specifically affects both CML stem and progenitor cells (Figure 4.6).    During cell divisions, ILK is also involved in regulating microtubule dynamics and centrosome clustering, an aspect that has not been investigated for this study yet [237-240]. Assembly and organization of the mitotic spindle is critical for asymmetric cell divisions in epithelial stem cells since it relies on the ability of cells to establish cell polarity and may be also an important feature causing elimination of leukemic stem cells [239, 240]. Future directions could include confocal imaging to demonstrate whether ILK suppression or inhibition results in multipolar anaphases or failed cytokinesis with bi- or multipolar cells and/or aberrations in mitotic spindle formations.  In focal adhesions, ILK forms multi-protein complexes with many proteins to control and adjust cytoskeletal dynamics in response to external and internal cues [213]. Cell spreading, adhesion, cytoskeletal tension, contractility and mechanotransduction require ILK, F-actin, myosin II, Rho, cofilin, ROCK and several actin-binding adaptors such as PARVINs and paxillin that bind to ILK [213, 306]. Defects in the organization of actin or focal adhesions have major implications for cells including adhesion, migration and polarity defects potentially causing loss of cell integrity. Therefore, future directions could include investigations regarding actin-structures, PIX/Rac/Cdc42 and cell migration upon ILK inhibition or suppression as Rac/Cdc42 signaling has been shown to be deregulated in CML [307]. In particular, the interactions between 118  ILK, β-PARVIN and cofilin are critical for linking integrins to the actin-cytoskeleton and to mediate cell migration [308]. Interestingly, β-PARVIN transcripts were also increased in my RNA-seq data set in CD34+ CML cells compared to normal BM donor cells (Jiang lab, unpublished), suggesting that the structural functions of ILK and possibly also the interaction between ILK and β-PARVIN should not be underestimated in the pathogenesis of CML. ILK forms a complex with PARVIN and PINCH, the IPP complex, that is recruited to cell adhesion sites early upon cell-substrate interactions to facilitate cell adhesion, spreading and cytoskeletal remodeling [230, 309]. Remarkably, ILK is the only component of this complex that possesses kinase activity, although the presence of all three proteins is required to prevent degradation of the entire complex [230]. Transient knockdown of ILK leads in human intestinal cells to a loss of the expression of β-PARVIN and severely affects cell proliferation and adhesion [310]. Although this phenomenon has not been investigated in CML cells yet, it may explain the drastic effects of the stable ILK suppression I observed on cell viability and apoptosis of CD34+ CML cells, in particular of primitive CML cells in the presence of stromal cells, that were much more pronounced than upon treatment with the ILK kinase inhibitor QLT0267 (Figures 4.4-4.5&4.11-4.12). Future experiments with kinase-dead ILK mutants in ILK knockout cells may also help to elucidate if the kinase function or adaptor role of ILK, or both, are important to mediate and influence these multiple interactions and adhesion of CML cells. Preliminary adhesion assays have shown that QLT0267 treatment can reduce the adhesive properties of CML cells, and it would be interesting to determine if this effect may be enhanced in CML cells deprived of ILK expression, including in more primitive CD34+ subpopulations.        Although combinations of QLT0267 and TKI treatments have shown remarkable results in multiple in vitro and in vivo assays, the IC50 for the current generation of QLT0267 is quite high 119  with 10 μM in CD34+ CML cells. Possibly, other available ILK inhibitors such as “compound 22” (Cpd22) could be tested to investigate if it is as effective as QLT0267 and whether it targets similar pathways in CML cells [311]. A very recent publication demonstrated that treatment of various Ph+ cell lines with 500 nM of Cpd22 alone induced apoptosis and decreased cell proliferation [264]. In contrast, my studies showed that treatment with QLT0267 was not very effective in eliminating leukemic cells as a single agent, and this raises the question of how toxic and specific both inhibitors are in targeting unique CML survival pathways. My in vivo study with oral gavage treatment of QLT0267 in combination with DA reduced and delayed the development of an aggressive leukemia, and no toxicity was observed in the mice or in in vitro assays with CD34+ normal BM cells, even with high QLT0267 doses (Figures 4.5&4.8-4.9). To further confirm the specificity of ILK inhibition and to control for potential off-target effects, a second in vivo study will be performed with primary CML cells with ILK suppression. This approach will also allow me to address whether the scaffold function of ILK is important for homing and adhesion of CML stem cells in the BM niche in vivo.  In summary, I have identified the focal adhesion protein and serine/threonine kinase ILK as being over-expressed in primitive CML cells compared to normal BM cells, and I started to characterize the distinct functions of ILK and its potential as a novel therapeutic target in CML using various in vitro and in vivo assays. My ILK inhibitor and suppression studies indicate that ILK contributes to survival, TKI responses and resistance in CML. Although more mechanistic details need to be explored, ILK seems to exert most of its effects in CML as a critical component of focal adhesions, mediating leukemia-stroma cell interactions, and as a kinase, influencing the activity of various important signaling effectors such as STAT3 and GSK3β to modulate proliferation, leukemia progression, resistance and stromal cell protection of primitive 120  CML cells. Importantly, ILK can be targeted with the ILK inhibitor QLT0267, and the enhanced and selective effects obtained by dual inhibition of ILK and BCR-ABL1 activities, particularly in the presence of protective stromal cells to mimic their response within the BM niche, may offer an important new therapeutic possibility in CML. 121  Chapter 5: General Summary and Discussion  5.1 Summary  The identification of BCR-ABL1 as the key molecular event in CML has revolutionized treatment opportunities for CP patients. IM, DA and other TKIs inhibiting the kinase activity of BCR-ABL1 have been introduced into the clinic with remarkable effects. However, initial and acquired resistance, relapse and in particular, the persistence of CML stem cells upon TKI therapy have led to extensive investigations to identify predictive biomarkers and novel, distinct targets for improved treatment strategies. Here, I believe I have made some new and useful contributions to the field by revealing ATG4B and ILK, respectively, as critical players and potential novel therapeutic targets for improved combination treatments in CML.  My work in Chapter 3 illustrates the core autophagy protease ATG4B as a potential biomarker in CML to predict IM-responders versus IM-nonresponders, prior to the initiation of therapy, and exploits the possibility of focusing dual therapies onto targeting autophagy by inhibiting ATG4B in combination with TKIs. My studies demonstrate that ATG4B is critical to completing autophagy in CML cells, ensuring survival and rapid growth of CML stem and progenitor cells. Inhibition or suppression of ATG4B decreased CML cell viability and sensitized leukemic cells to TKI treatment, with strikingly enhanced effects upon simultaneous autophagy induction. Therefore, targeting of autophagy via ATG4B represents a potential therapeutic option in particular for TKI-nonresponders and possibly aggressive leukemia where diseased cells have increased needs for this catabolic pathway to gain additional nutrients and energy.        122  In Chapter 4, I focused my research on investigating focal adhesion components to elucidate differences between primitive CML and normal BM cells with respect to BM niche interactions. I identified the key focal adhesion protein and serine/threonine kinase ILK as differentially expressed protein and confirmed the importance of ILK in mediating TKI responses and resistance in CML stem/progenitor cells. Moreover, various in vitro and in vivo assays proved that the combined inhibition of ILK and BCR-ABL1 kinase activities is highly effective in targeting both leukemic stem and progenitor cells, including in the presence of protective stromal cells when TKI monotherapies are ineffective.   5.2 Significance and Limitations of the Work This is the first detailed study to investigate ATG4B and ILK in CML, and their potential as novel therapeutic targets for improved combination treatments with TKIs in CML stem and progenitor cells. Although autophagy has been shown to play a role in the persistence of primitive CML cells upon TKI therapy, the importance of the cysteine protease ATG4B has not been explored, yet. ATG4B is a core autophagy protein that is key to the completion of the autophagic process by cleaving pro-LC3 to generate LC3-I and by recycling LC3-II from autophagosomes. For the first time, I have demonstrated that ATG4B is highly expressed in hematopoietic CD34+ cells and even further up-regulated in CD34+ CML cells. Moreover, expression of ATG4B correlated with subsequent IM-responder versus IM-nonresponder status, suggesting ATG4B as new predictive biomarker in CML. Nevertheless, more patient samples should be investigated to determine whether ATG4B alone is sufficient to consistently predict future IM and maybe also other TKI responses or whether a combination of various genes or proteins would be more powerful such as a combination of ATG4B transcripts and inversely 123  correlated mi-RNA expressions. Although I found a statistically significant difference between both groups for IM-responders versus IM-nonresponders, a few individual patient samples showed some overlap, making it difficult to decide on a likely response in a clinical setting. Here, a larger study with more patient samples may help to define detection limits and cut-off points to distinguish IM-responders versus IM-nonresponders.  In addition, I confirmed with suppression studies and novel inhibitors that ATG4B is a valid target in CML, in particular in combination with TKIs upon autophagy induction. Nevertheless, these new ATG4B inhibitors could be further developed to be more effective at lower doses while minimizing toxicity on normal BM cells. Also, the combination of ATG4B inhibitors with a TKI needs to be tested in mouse models in vivo to validate its potential as an improved treatment strategy in CML because autophagy can be tumor-promoting or tumor-suppressive, depending on the context including microenvironmental influences.   In the second project of my work, I revealed that the focal adhesion protein and serine/threonine kinase ILK is highly expressed in CML stem and progenitor cells, but not their normal counterparts, making it an attractive target in CML. Growing evidence indicates that interactions of cancer cells with their microenvironment in vivo can influence disease progression and therapy resistance, including CML. Focal adhesions that modulate cell adhesion, migration, proliferation and various intracellular signaling pathways are considered critical mediators of some of these interactions and ILK is a major constituent of focal adhesions. Based on my findings, ILK seems to provide critical scaffold and kinase functions in primitive CML cells. Suppression of ILK resulted in decreased viability and proliferation of leukemic cell lines and primary patient sample cells in vitro, and further studies are needed to identify more mechanistic details. Interestingly, the sole inhibition of the ILK kinase by the selective ILK 124  inhibitor QLT0267 did not show much effect in CML or normal cells regarding growth and apoptosis, but a combination approach with the ILK inhibitor and a TKI was highly effective in targeting both CML stem and progenitor cells in vitro and in vivo. My functional studies revealed that the simultaneous inhibition of ILK and BCR-ABL1 enhanced the induction of apoptosis and cell division tracking analysis with CFSE showed that QLT0267 specifically targets quiescent CML stem cells from IM-resistant patients. In addition, treatment with the ILK inhibitor alone or in combination with a TKI enhanced apoptosis of primitive CML cells in vitro by abolishing the protective effect of BM stromal cells observed under TKI monotherapy. Combination treatments also confirmed strong synergy between IM or DA and QLT0267. Importantly, QLT0267 (up to 10 μM) was not toxic to normal CD34+ BM cells in either short- or long-term culture systems with and without stromal cells. Furthermore, my investigations demonstrated that GSK3β and STAT3 may be direct or indirect targets of ILK, respectively. However, these studies were performed in K562 cells so far and need to be validated in primary CML cells. In a future experiment, I’m planning to utilize mass cytometry (CyTOF) to identify potential changes in phosphorylation patterns of multiple possible downstream targets of the ILK kinase upon QLT0267 treatment in CML patient cells. This technique will also allow me to observe alterations at the single cell level such as highly purified leukemic stem cells. Nevertheless, there is always the risk of unspecific effects during inhibitor applications and the most interesting results will need to be confirmed by ILK suppression studies. The difficulty that arises with silencing of ILK is the complex nature of ILK as an adaptor protein and kinase. Abolishing ILK protein expression will not only affect its kinase function but also its role as a scaffold in collaboration with other focal adhesion components. Here, rescue experiments with kinase-dead ILK mutants are highly warranted, but require a difficult double infection of primary CML cells.    125  Currently, most experiments have been performed with CD34+ CML cells that may or may not contain very few leukemic stem cells. Purifying sufficient numbers of CML stem cells from patient material is a challenging task and based on the assumption of surface marker expressions correlating with one distinct subset of hematopoietic or leukemic cells that does not account for transparency or dynamic changes. In addition, the idea of CML as a stem cell disease is mostly based on a hypothesis that follows a hierarchical model. However, other studies have shown that early granulocyte-macrophage progenitors could potentially also act as CML stem cells, in particular in BC CML [312], questioning a one-way hierarchy.         Another challenge with respect to complexity is the issue of mimicking BM niche effects in vitro. For my study, I have made use of stromal cells that were originally isolated from mouse BM and engineered to produce and secrete human growth factors such as IL-3, G-CSF and stem cell factor. However, as described earlier, the BM niche consists in vivo of a complex network of multiple cell types, ECM and soluble factors in a 3D structure. Novel strategies to investigate stem cell-niche interactions are engineered stem cell niches that consist of micropatterned islands of niche components with defined composition and structures on glass coverslips [185, 313], which could be utilized in future investigations. However, these approaches are also limited to our current, still changing, knowledge of the BM composition and possible architecture.   In addition, in vivo studies with primary CML patient cells would be an important part of continuing this project. But, the relatively low levels of long-term engraftment obtainable from primitive CML patient cells limit this approach for evaluating the ability of drug treatments to block leukemia development in vivo. Therefore, I utilized BV173YFP/Luc cells, derived from a BC patient and shown to induce a lethal leukemia in NSG mice [80, 82], to perform such studies. This is also not an ideal model but allowed me to examine the ability of the simultaneous 126  inhibition of ILK and BCR-ABL1 kinases to block leukemia development in vivo and hence, extend survival of transplanted mice. Alternatively, the inducible, transgenic SCL-tTA-BCR-ABL1 mouse model [314] could be used to test the effectiveness of combination treatments, but would be restricted to mouse cells and not human patient material.        127  References  1. Goldman, J.M. and J.V. Melo, Chronic Myeloid Leukemia — Advances in Biology and New Approaches to Treatment. New England Journal of Medicine, 2003. 349(15): p. 1451-1464. 2. Jabbour, E. and H. Kantarjian, Chronic myeloid leukemia: 2014 update on diagnosis, monitoring, and management. American Journal of Hematology, 2014. 89(5): p. 547-556. 3. Rowley, J.D., Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature, 1973. 243(5405): p. 290-3. 4. Jiang, X., et al., Instability of BCR–ABL Gene in Primary and Cultured Chronic Myeloid Leukemia Stem Cells. Journal of the National Cancer Institute, 2007. 99(9): p. 680-693. 5. Apperley, J.F., Part I: Mechanisms of resistance to imatinib in chronic myeloid leukaemia. The Lancet Oncology, 2007. 8(11): p. 1018-1029. 6. Sullivan, C., et al., Targeted therapy of chronic myeloid leukemia. Biochemical Pharmacology, 2010. 80(5): p. 584-591. 7. Sattler, M. and J.D. Griffin, Molecular mechanisms of transformation by the BCR-ABL oncogene. Semin Hematol, 2003. 40(2 Suppl 2): p. 4-10. 8. Zou, X. and K. Calame, Signaling pathways activated by oncogenic forms of Abl tyrosine kinase. J Biol Chem, 1999. 274(26): p. 18141-4. 9. Apperley, J.F., Chronic myeloid leukaemia. Lancet, 2015. 385(9976): p. 1447-59. 10. Perrotti, D., et al., Chronic myeloid leukemia: mechanisms of blastic transformation. J Clin Invest, 2010. 120(7): p. 2254-64. 11. Kantarjian, H.M., et al., Chronic myelogenous leukemia in blast crisis. Analysis of 242 patients. Am J Med, 1987. 83(3): p. 445-54. 12. Ilaria, R.L., Jr., Pathobiology of lymphoid and myeloid blast crisis and management issues. Hematology Am Soc Hematol Educ Program, 2005: p. 188-94. 13. Druker, B.J., et al., Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med, 1996. 2(5): p. 561-6. 14. Quintas-Cardama, A. and J.E. Cortes, Chronic myeloid leukemia: diagnosis and treatment. Mayo Clin Proc, 2006. 81(7): p. 973-88. 15. Druker, B.J., et al., Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med, 2001. 344(14): p. 1031-7. 16. Kantarjian, H., et al., Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia. N Engl J Med, 2002. 346(9): p. 645-52. 17. Deininger, M., E. Buchdunger, and B.J. Druker, The development of imatinib as a therapeutic agent for chronic myeloid leukemia. Blood, 2005. 105(7): p. 2640-53. 18. Shah, N.P., et al., Overriding Imatinib Resistance with a Novel ABL Kinase Inhibitor. Science, 2004. 305(5682): p. 399-401. 19. Weisberg, E., et al., Characterization of AMN107, a selective inhibitor of native and mutant Bcr-Abl. Cancer Cell, 2005. 7(2): p. 129-41. 128  20. Eide, C.A. and T. O'Hare, Chronic myeloid leukemia: advances in understanding disease biology and mechanisms of resistance to tyrosine kinase inhibitors. Curr Hematol Malig Rep, 2015. 10(2): p. 158-66. 21. Druker, B.J., et al., Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. N Engl J Med, 2006. 355(23): p. 2408-17. 22. Khan, A.M. and D.L. Bixby, BCR-ABL inhibitors: updates in the management of patients with chronic-phase chronic myeloid leukemia. Hematology, 2014. 19(5): p. 249-58. 23. Trivedi, D., et al., Adherence and persistence among chronic myeloid leukemia patients during second-line tyrosine kinase inhibitor treatment. J Manag Care Spec Pharm, 2014. 20(10): p. 1006-15. 24. Jain, P., et al., Early responses predict better outcomes in patients with newly diagnosed chronic myeloid leukemia: results with four tyrosine kinase inhibitor modalities. Blood, 2013. 121(24): p. 4867-74. 25. Druker, B.J., Translation of the Philadelphia chromosome into therapy for CML. Blood, 2008. 112(13): p. 4808-17. 26. Raitano, A.B., Y.E. Whang, and C.L. Sawyers, Signal transduction by wild-type and leukemogenic Abl proteins. Biochim Biophys Acta, 1997. 1333(3): p. F201-16. 27. Hantschel, O. and G. Superti-Furga, Regulation of the c-Abl and Bcr-Abl tyrosine kinases. Nat Rev Mol Cell Biol, 2004. 5(1): p. 33-44. 28. Mahon, F.X., et al., Discontinuation of imatinib in patients with chronic myeloid leukaemia who have maintained complete molecular remission for at least 2 years: the prospective, multicentre Stop Imatinib (STIM) trial. Lancet Oncol, 2010. 11(11): p. 1029-35. 29. Ross, D.M., et al., Patients with chronic myeloid leukemia who maintain a complete molecular response after stopping imatinib treatment have evidence of persistent leukemia by DNA PCR. Leukemia, 2010. 24(10): p. 1719-24. 30. Rousselot, P., et al., Imatinib mesylate discontinuation in patients with chronic myelogenous leukemia in complete molecular remission for more than 2 years. Blood, 2007. 109(1): p. 58-60. 31. Remsing Rix, L.L., et al., Global target profile of the kinase inhibitor bosutinib in primary chronic myeloid leukemia cells. Leukemia, 2009. 23(3): p. 477-85. 32. Cortes, J.E., et al., Ponatinib in refractory Philadelphia chromosome-positive leukemias. N Engl J Med, 2012. 367(22): p. 2075-88. 33. Cortes, J.E., et al., A phase 2 trial of ponatinib in Philadelphia chromosome-positive leukemias. N Engl J Med, 2013. 369(19): p. 1783-96. 34. Chen, R. and B. Chen, The role of dasatinib in the management of chronic myeloid leukemia. Drug Des Devel Ther, 2015. 9: p. 773-9. 35. Copland, M., et al., Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction. Blood, 2006. 107(11): p. 4532-9. 36. Milojkovic, D. and J. Apperley, Mechanisms of Resistance to Imatinib and Second-Generation Tyrosine Inhibitors in Chronic Myeloid Leukemia. Clin Cancer Res, 2009. 15(24): p. 7519-7527. 37. Jiang, X., et al., Properties of CD34+ CML stem/progenitor cells that correlate with different clinical responses to imatinib mesylate. Blood, 2010. 116(12): p. 2112-21. 129  38. Shah, N.P., et al., Sequential ABL kinase inhibitor therapy selects for compound drug-resistant BCR-ABL mutations with altered oncogenic potency. J Clin Invest, 2007. 117(9): p. 2562-9. 39. Khorashad, J.S., et al., BCR-ABL1 compound mutations in tyrosine kinase inhibitor-resistant CML: frequency and clonal relationships. Blood, 2013. 121(3): p. 489-98. 40. Zabriskie, M.S., et al., BCR-ABL1 compound mutations combining key kinase domain positions confer clinical resistance to ponatinib in Ph chromosome-positive leukemia. Cancer Cell, 2014. 26(3): p. 428-42. 41. Soverini, S., et al., Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain. Blood, 2013. 122(9): p. 1634-48. 42. Gibbons, D.L., et al., Molecular dynamics reveal BCR-ABL1 polymutants as a unique mechanism of resistance to PAN-BCR-ABL1 kinase inhibitor therapy. Proc Natl Acad Sci U S A, 2014. 111(9): p. 3550-5. 43. Slupianek, A., et al., BCR-ABL1 kinase inhibits uracil DNA glycosylase UNG2 to enhance oxidative DNA damage and stimulate genomic instability. Leukemia, 2013. 27(3): p. 629-34. 44. Sweet, K., et al., Increased genomic instability may contribute to the development of kinase domain mutations in chronic myeloid leukemia. Int J Hematol, 2014. 100(6): p. 567-74. 45. Konig, H., et al., Effects of dasatinib on SRC kinase activity and downstream intracellular signaling in primitive chronic myelogenous leukemia hematopoietic cells. Cancer Res, 2008. 68(23): p. 9624-33. 46. Bhatia, R., et al., Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment. Blood, 2003. 101(12): p. 4701-7. 47. Jorgensen, H.G., et al., Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells. Blood, 2007. 109(9): p. 4016-9. 48. Bruns, I., et al., The hematopoietic stem cell in chronic phase CML is characterized by a transcriptional profile resembling normal myeloid progenitor cells and reflecting loss of quiescence. Leukemia, 2009. 23(5): p. 892-9. 49. Becker, A.J., C.E. Mc, and J.E. Till, Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature, 1963. 197: p. 452-4. 50. Bonnet, D. and J.E. Dick, Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med, 1997. 3(7): p. 730-7. 51. Chu, S., et al., Detection of BCR-ABL kinase mutations in CD34+ cells from chronic myelogenous leukemia patients in complete cytogenetic remission on imatinib mesylate treatment. Blood, 2005. 105(5): p. 2093-8. 52. Holyoake, T., et al., Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia. Blood, 1999. 94(6): p. 2056-64. 53. Graham, S.M., et al., Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro. Blood, 2002. 99(1): p. 319-25. 54. Corbin, A.S., et al., Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity. J Clin Invest, 2011. 121(1): p. 396-409. 130  55. Zhang, B., et al., Microenvironmental protection of CML stem and progenitor cells from tyrosine kinase inhibitors through N-cadherin and Wnt-beta-catenin signaling. Blood, 2013. 121(10): p. 1824-38. 56. Eiring, A.M., et al., Combined STAT3 and BCR-ABL1 inhibition induces synthetic lethality in therapy-resistant chronic myeloid leukemia. Leukemia, 2015. 29(3): p. 586-97. 57. Alves, R., et al., Drug transporters play a key role in the complex process of Imatinib resistance in vitro. Leuk Res, 2015. 39(3): p. 355-60. 58. Donato, N.J., et al., BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571. Blood, 2003. 101(2): p. 690-8. 59. Burchert, A., et al., Compensatory PI3-kinase/Akt/mTor activation regulates imatinib resistance development. Leukemia, 2005. 19(10): p. 1774-82. 60. Wang, Y., et al., Adaptive secretion of granulocyte-macrophage colony-stimulating factor (GM-CSF) mediates imatinib and nilotinib resistance in BCR/ABL+ progenitors via JAK-2/STAT-5 pathway activation. Blood, 2007. 109(5): p. 2147-55. 61. Agarwal, A., et al., An activating KRAS mutation in imatinib-resistant chronic myeloid leukemia. Leukemia, 2008. 22(12): p. 2269-72. 62. Gioia, R., et al., Quantitative phosphoproteomics revealed interplay between Syk and Lyn in the resistance to nilotinib in chronic myeloid leukemia cells. Blood, 2011. 118(8): p. 2211-21. 63. Fujitani, Y., et al., An alternative pathway for STAT activation that is mediated by the direct interaction between JAK and STAT. Oncogene, 1997. 14(7): p. 751-61. 64. Krebs, D.L. and D.J. Hilton, SOCS proteins: negative regulators of cytokine signaling. Stem Cells, 2001. 19(5): p. 378-87. 65. Kisseleva, T., et al., Signaling through the JAK/STAT pathway, recent advances and future challenges. Gene, 2002. 285(1-2): p. 1-24. 66. Lin, T.S., S. Mahajan, and D.A. Frank, STAT signaling in the pathogenesis and treatment of leukemias. Oncogene, 2000. 19(21): p. 2496-504. 67. Chai, S.K., G.L. Nichols, and P. Rothman, Constitutive activation of JAKs and STATs in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients. J Immunol, 1997. 159(10): p. 4720-8. 68. Xie, S., et al., Involvement of Jak2 tyrosine phosphorylation in Bcr-Abl transformation. Oncogene, 2001. 20(43): p. 6188-95. 69. Hennighausen, L. and G.W. Robinson, Interpretation of cytokine signaling through the transcription factors STAT5A and STAT5B. Genes Dev, 2008. 22(6): p. 711-21. 70. Samanta, A., et al., Janus kinase 2 regulates Bcr-Abl signaling in chronic myeloid leukemia. Leukemia, 2011. 25(3): p. 463-72. 71. Warsch, W., C. Walz, and V. Sexl, JAK of all trades: JAK2-STAT5 as novel therapeutic targets in BCR-ABL1+ chronic myeloid leukemia. Blood, 2013. 122(13): p. 2167-75. 72. Danial, N.N., A. Pernis, and P.B. Rothman, Jak-STAT signaling induced by the v-abl oncogene. Science, 1995. 269(5232): p. 1875-7. 73. Danial, N.N. and P. Rothman, JAK-STAT signaling activated by Abl oncogenes. Oncogene, 2000. 19(21): p. 2523-31. 74. Hoelbl, A., et al., Stat5 is indispensable for the maintenance of bcr/abl-positive leukaemia. EMBO Mol Med, 2010. 2(3): p. 98-110. 131  75. Walz, C., et al., Essential role for Stat5a/b in myeloproliferative neoplasms induced by BCR-ABL1 and JAK2(V617F) in mice. Blood, 2012. 119(15): p. 3550-60. 76. Nelson, E.A., et al., The STAT5 inhibitor pimozide decreases survival of chronic myelogenous leukemia cells resistant to kinase inhibitors. Blood, 2011. 117(12): p. 3421-9. 77. Prost, S., et al., Erosion of the chronic myeloid leukaemia stem cell pool by PPARgamma agonists. Nature, 2015. 525(7569): p. 380-3. 78. Hantschel, O., et al., BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia. Nat Chem Biol, 2012. 8(3): p. 285-93. 79. Schafranek, L., et al., Sustained inhibition of STAT5, but not JAK2, is essential for TKI-induced cell death in chronic myeloid leukemia. Leukemia, 2015. 29(1): p. 76-85. 80. Lin, H., et al., Selective JAK2/ABL dual inhibition therapy effectively eliminates TKI-insensitive CML stem/progenitor cells. Oncotarget, 2014. 5(18): p. 8637-50. 81. Samanta, A.K., et al., Jak2 inhibition deactivates Lyn kinase through the SET-PP2A-SHP1 pathway, causing apoptosis in drug-resistant cells from chronic myelogenous leukemia patients. Oncogene, 2009. 28(14): p. 1669-81. 82. Chen, M., et al., Targeting primitive chronic myeloid leukemia cells by effective inhibition of a new AHI-1-BCR-ABL-JAK2 complex. J Natl Cancer Inst, 2013. 105(6): p. 405-23. 83. Steelman, L.S., et al., Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. Leukemia, 2011. 25(7): p. 1080-94. 84. Sattler, M., et al., Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell, 2002. 1(5): p. 479-92. 85. Skorski, T., et al., Negative regulation of p120GAP GTPase promoting activity by p210bcr/abl: implication for RAS-dependent Philadelphia chromosome positive cell growth. J Exp Med, 1994. 179(6): p. 1855-65. 86. Sawyers, C.L., J. McLaughlin, and O.N. Witte, Genetic requirement for Ras in the transformation of fibroblasts and hematopoietic cells by the Bcr-Abl oncogene. J Exp Med, 1995. 181(1): p. 307-13. 87. Steelman, L.S., et al., JAK/STAT, Raf/MEK/ERK, PI3K/Akt and BCR-ABL in cell cycle progression and leukemogenesis. Leukemia, 2004. 18(2): p. 189-218. 88. Reuther, J.Y., et al., A requirement for NF-kappaB activation in Bcr-Abl-mediated transformation. Genes Dev, 1998. 12(7): p. 968-81. 89. Baum, K.J. and R. Ren, Effect of Ras inhibition in hematopoiesis and BCR/ABL leukemogenesis. J Hematol Oncol, 2008. 1: p. 5. 90. Packer, L.M., et al., Nilotinib and MEK inhibitors induce synthetic lethality through paradoxical activation of RAF in drug-resistant chronic myeloid leukemia. Cancer Cell, 2011. 20(6): p. 715-27. 91. Pellicano, F., et al., The MEK inhibitor PD184352 enhances BMS-214662-induced apoptosis in CD34+ CML stem/progenitor cells. Leukemia, 2011. 25(7): p. 1159-67. 92. Fruman, D.A., R.E. Meyers, and L.C. Cantley, Phosphoinositide kinases. Annu Rev Biochem, 1998. 67: p. 481-507. 93. Kharas, M.G. and D.A. Fruman, ABL oncogenes and phosphoinositide 3-kinase: mechanism of activation and downstream effectors. Cancer Res, 2005. 65(6): p. 2047-53. 94. Cilloni, D. and G. Saglio, Molecular pathways: BCR-ABL. Clin Cancer Res, 2012. 18(4): p. 930-7. 132  95. Brazil, D.P., Z.Z. Yang, and B.A. Hemmings, Advances in protein kinase B signalling: AKTion on multiple fronts. Trends Biochem Sci, 2004. 29(5): p. 233-42. 96. Downward, J., PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol, 2004. 15(2): p. 177-82. 97. Pap, M. and G.M. Cooper, Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-Kinase/Akt cell survival pathway. J Biol Chem, 1998. 273(32): p. 19929-32. 98. Diehl, J.A., et al., Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev, 1998. 12(22): p. 3499-511. 99. Sawafuji, K., et al., Aminopeptidase inhibitors inhibit proliferation and induce apoptosis of K562 and STI571-resistant K562 cell lines through the MAPK and GSK-3beta pathways. Leuk Lymphoma, 2003. 44(11): p. 1987-96. 100. Burgering, B.M. and G.J. Kops, Cell cycle and death control: long live Forkheads. Trends Biochem Sci, 2002. 27(7): p. 352-60. 101. Tran, H., et al., The many forks in FOXO's road. Sci STKE, 2003. 2003(172): p. RE5. 102. Bjornsti, M.A. and P.J. Houghton, The TOR pathway: a target for cancer therapy. Nat Rev Cancer, 2004. 4(5): p. 335-48. 103. Richardson, C.J., S.S. Schalm, and J. Blenis, PI3-kinase and TOR: PIKTORing cell growth. Semin Cell Dev Biol, 2004. 15(2): p. 147-59. 104. Hay, N. and N. Sonenberg, Upstream and downstream of mTOR. Genes Dev, 2004. 18(16): p. 1926-45. 105. Skorski, T., et al., Transformation of hematopoietic cells by BCR/ABL requires activation of a PI-3k/Akt-dependent pathway. EMBO J, 1997. 16(20): p. 6151-61. 106. Klejman, A., et al., Phosphatidylinositol-3 kinase inhibitors enhance the anti-leukemia effect of STI571. Oncogene, 2002. 21(38): p. 5868-76. 107. Peng, C., et al., PTEN is a tumor suppressor in CML stem cells and BCR-ABL-induced leukemias in mice. Blood, 2010. 115(3): p. 626-35. 108. Panuzzo, C., et al., BCR-ABL promotes PTEN downregulation in chronic myeloid leukemia. PLoS One, 2014. 9(10): p. e110682. 109. Mizushima, N., Autophagy: process and function. Genes Dev, 2007. 21(22): p. 2861-73. 110. Xie, Z. and D.J. Klionsky, Autophagosome formation: core machinery and adaptations. Nat Cell Biol, 2007. 9(10): p. 1102-9. 111. Kroemer, G. and M. Jaattela, Lysosomes and autophagy in cell death control. Nat Rev Cancer, 2005. 5(11): p. 886-97. 112. Mehrpour, M., et al., Overview of macroautophagy regulation in mammalian cells. Cell Res, 2010. 20(7): p. 748-62. 113. Tsukada, M. and Y. Ohsumi, Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett, 1993. 333(1-2): p. 169-74. 114. Meijer, W.H., et al., ATG genes involved in non-selective autophagy are conserved from yeast to man, but the selective Cvt and pexophagy pathways also require organism-specific genes. Autophagy, 2007. 3(2): p. 106-16. 115. Mizushima, N., et al., A protein conjugation system essential for autophagy. Nature, 1998. 395(6700): p. 395-8. 116. Liang, X.H., et al., Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature, 1999. 402(6762): p. 672-6. 133  117. Kirisako, T., et al., The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol, 2000. 151(2): p. 263-76. 118. Klionsky, D.J., et al., Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy, 2012. 8(4): p. 445-544. 119. Tanida, I., et al., HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule-associated protein light chain 3- and GABAA receptor-associated protein-phospholipid conjugates. J Biol Chem, 2004. 279(35): p. 36268-76. 120. Fujita, N., et al., An Atg4B mutant hampers the lipidation of LC3 paralogues and causes defects in autophagosome closure. Mol Biol Cell, 2008. 19(11): p. 4651-9. 121. Nakatogawa, H., et al., Atg4 recycles inappropriately lipidated Atg8 to promote autophagosome biogenesis. Autophagy, 2012. 8(2): p. 177-86. 122. Nair, U., et al., A role for Atg8-PE deconjugation in autophagosome biogenesis. Autophagy, 2012. 8(5): p. 780-93. 123. Marino, G., et al., Human autophagins, a family of cysteine proteinases potentially implicated in cell degradation by autophagy. J Biol Chem, 2003. 278(6): p. 3671-8. 124. Marino, G., et al., Autophagy is essential for mouse sense of balance. J Clin Invest, 2010. 120(7): p. 2331-44. 125. Betin, V.M. and J.D. Lane, Caspase cleavage of Atg4D stimulates GABARAP-L1 processing and triggers mitochondrial targeting and apoptosis. J Cell Sci, 2009. 122(Pt 14): p. 2554-66. 126. Li, M., et al., Kinetics comparisons of mammalian Atg4 homologues indicate selective preferences toward diverse Atg8 substrates. J Biol Chem, 2011. 286(9): p. 7327-38. 127. Read, R., et al., Histopathological and neurological features of Atg4b knockout mice. Vet Pathol, 2011. 48(2): p. 486-94. 128. White, E., Deconvoluting the context-dependent role for autophagy in cancer. Nat Rev Cancer, 2012. 12(6): p. 401-410. 129. White, E., The role for autophagy in cancer. J Clin Invest, 2015. 125(1): p. 42-6. 130. Ding, Z.B., et al., Association of autophagy defect with a malignant phenotype and poor prognosis of hepatocellular carcinoma. Cancer Res, 2008. 68(22): p. 9167-75. 131. Choi, J.H., et al., Absence of autophagy-related proteins expression is associated with poor prognosis in patients with colorectal adenocarcinoma. Gastroenterol Res Pract, 2014. 2014: p. 179586. 132. Karantza-Wadsworth, V., et al., Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis. Genes Dev, 2007. 21(13): p. 1621-35. 133. Gewirtz, D.A., When cytoprotective autophagy isn't... and even when it is. Autophagy, 2014. 10(3): p. 391-2. 134. Dai, Y. and S. Grant, BCL2L11/Bim as a dual-agent regulating autophagy and apoptosis in drug resistance. Autophagy, 2015. 11(2): p. 416-8. 135. Martin, A.P., et al., Inhibition of MCL-1 enhances lapatinib toxicity and overcomes lapatinib resistance via BAK-dependent autophagy. Cancer Biol Ther, 2009. 8(21): p. 2084-96. 136. Ertmer, A., et al., The anticancer drug imatinib induces cellular autophagy. Leukemia, 2007. 21(5): p. 936-42. 134  137. Bellodi, C., et al., Targeting autophagy potentiates tyrosine kinase inhibitor-induced cell death in Philadelphia chromosome-positive cells, including primary CML stem cells. J Clin Invest, 2009. 119(5): p. 1109-23. 138. Can, G., H.A. Ekiz, and Y. Baran, Imatinib induces autophagy through BECLIN-1 and ATG5 genes in chronic myeloid leukemia cells. Hematology, 2011. 16(2): p. 95-9. 139. Crowley, L.C., et al., Autophagy induction by Bcr-Abl-expressing cells facilitates their recovery from a targeted or nontargeted treatment. Am J Hematol, 2011. 86(1): p. 38-47. 140. Elzinga, B.M., et al., Induction of autophagy by Imatinib sequesters Bcr-Abl in autophagosomes and down-regulates Bcr-Abl protein. Am J Hematol, 2013. 88(6): p. 455-62. 141. Carew, J.S., et al., Targeting autophagy augments the anticancer activity of the histone deacetylase inhibitor SAHA to overcome Bcr-Abl-mediated drug resistance. Blood, 2007. 110(1): p. 313-22. 142. Drullion, C., et al., Apoptosis and autophagy have opposite roles on imatinib-induced K562 leukemia cell senescence. Cell Death Dis, 2012. 3: p. e373. 143. Shao, S., et al., Spautin-1, a novel autophagy inhibitor, enhances imatinib-induced apoptosis in chronic myeloid leukemia. Int J Oncol, 2014. 44(5): p. 1661-8. 144. Maycotte, P., et al., Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy. Autophagy, 2012. 8(2): p. 200-12. 145. Agarwal, P. and R. Bhatia, Influence of Bone Marrow Microenvironment on Leukemic Stem Cells: Breaking Up an Intimate Relationship. Adv Cancer Res, 2015. 127: p. 227-52. 146. Lee, G.Y., J.A. Kim, and I.H. Oh, Stem cell niche as a prognostic factor in leukemia. BMB Rep, 2015. 48(8): p. 427-428. 147. Mendelson, A. and P.S. Frenette, Hematopoietic stem cell niche maintenance during homeostasis and regeneration. Nat Med, 2014. 20(8): p. 833-46. 148. Raaijmakers, M.H. and D.T. Scadden, Evolving concepts on the microenvironmental niche for hematopoietic stem cells. Curr Opin Hematol, 2008. 15(4): p. 301-6. 149. Boulais, P.E. and P.S. Frenette, Making sense of hematopoietic stem cell niches. Blood, 2015. 125(17): p. 2621-9. 150. Verfaillie, C.M., et al., The Hematopoietic Microenvironment: Stromal Extracellular Matrix Components As Growth Regulators For Human Hematopoietic Progenitors. Hematology, 1999. 4(4): p. 321-333. 151. Klein, G., The extracellular matrix of the hematopoietic microenvironment. Experientia, 1995. 51(9-10): p. 914-26. 152. Lander, A.D., et al., What does the concept of the stem cell niche really mean today? BMC Biol, 2012. 10: p. 19. 153. Schofield, R., The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells, 1978. 4(1-2): p. 7-25. 154. Schepers, K., T.B. Campbell, and E. Passegue, Normal and leukemic stem cell niches: insights and therapeutic opportunities. Cell Stem Cell, 2015. 16(3): p. 254-67. 155. Acar, M., et al., Deep imaging of bone marrow shows non-dividing stem cells are mainly perisinusoidal. Nature, 2015. 526(7571): p. 126-30. 156. Yin, T. and L. Li, The stem cell niches in bone. J Clin Invest, 2006. 116(5): p. 1195-201. 157. Calvi, L.M., et al., Osteoblastic cells regulate the haematopoietic stem cell niche. Nature, 2003. 425(6960): p. 841-6. 135  158. Nilsson, S.K., H.M. Johnston, and J.A. Coverdale, Spatial localization of transplanted hemopoietic stem cells: inferences for the localization of stem cell niches. Blood, 2001. 97(8): p. 2293-9. 159. Kiel, M.J., et al., SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell, 2005. 121(7): p. 1109-21. 160. Kunisaki, Y., et al., Arteriolar niches maintain haematopoietic stem cell quiescence. Nature, 2013. 502(7473): p. 637-43. 161. Nagasawa, T., CXCL12/SDF-1 and CXCR4. Front Immunol, 2015. 6: p. 301. 162. Schroeder, M.A. and J.F. DiPersio, Mobilization of hematopoietic stem and leukemia cells. J Leukoc Biol, 2012. 91(1): p. 47-57. 163. Broxmeyer, H.E., et al., Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist. J Exp Med, 2005. 201(8): p. 1307-18. 164. Dar, A., et al., Rapid mobilization of hematopoietic progenitors by AMD3100 and catecholamines is mediated by CXCR4-dependent SDF-1 release from bone marrow stromal cells. Leukemia, 2011. 25(8): p. 1286-96. 165. Peled, A., et al., Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science, 1999. 283(5403): p. 845-8. 166. Aiuti, A., et al., The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J Exp Med, 1997. 185(1): p. 111-20. 167. Jin, L., et al., CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells. Mol Cancer Ther, 2008. 7(1): p. 48-58. 168. Geay, J.F., et al., p210BCR-ABL inhibits SDF-1 chemotactic response via alteration of CXCR4 signaling and down-regulation of CXCR4 expression. Cancer Res, 2005. 65(7): p. 2676-83. 169. Vianello, F., et al., Bone marrow mesenchymal stromal cells non-selectively protect chronic myeloid leukemia cells from imatinib-induced apoptosis via the CXCR4/CXCL12 axis. Haematologica, 2010. 95(7): p. 1081-9. 170. Dillmann, F., et al., Plerixafor inhibits chemotaxis toward SDF-1 and CXCR4-mediated stroma contact in a dose-dependent manner resulting in increased susceptibility of BCR-ABL+ cell to Imatinib and Nilotinib. Leuk Lymphoma, 2009. 50(10): p. 1676-86. 171. Beider, K., et al., Combination of imatinib with CXCR4 antagonist BKT140 overcomes the protective effect of stroma and targets CML in vitro and in vivo. Mol Cancer Ther, 2014. 13(5): p. 1155-69. 172. Cho, B.S., et al., Antileukemia activity of the novel peptidic CXCR4 antagonist LY2510924 as monotherapy and in combination with chemotherapy. Blood, 2015. 126(2): p. 222-32. 173. Weisberg, E., et al., Inhibition of CXCR4 in CML cells disrupts their interaction with the bone marrow microenvironment and sensitizes them to nilotinib. Leukemia, 2012. 26(5): p. 985-90. 174. Valent, P., et al., DPPIV (CD26) as a novel stem cell marker in Ph+ chronic myeloid leukaemia. Eur J Clin Invest, 2014. 44(12): p. 1239-45. 136  175. Herrmann, H., et al., Dipeptidylpeptidase IV (CD26) defines leukemic stem cells (LSC) in chronic myeloid leukemia. Blood, 2014. 123(25): p. 3951-62. 176. Aljedai, A., et al., Potential role of Notch signalling in CD34+ chronic myeloid leukaemia cells: cross-talk between Notch and BCR-ABL. PLoS One, 2015. 10(4): p. e0123016. 177. Okabe, S., et al., Combination of the ABL kinase inhibitor imatinib with the Janus kinase 2 inhibitor TG101348 for targeting residual BCR-ABL-positive cells. J Hematol Oncol, 2014. 7: p. 37. 178. Gregory, M.A., et al., Wnt/Ca2+/NFAT signaling maintains survival of Ph+ leukemia cells upon inhibition of Bcr-Abl. Cancer Cell, 2010. 18(1): p. 74-87. 179. Sengupta, A., et al., Deregulation and cross talk among Sonic hedgehog, Wnt, Hox and Notch signaling in chronic myeloid leukemia progression. Leukemia, 2007. 21(5): p. 949-55. 180. Heidel, F.H., et al., Genetic and pharmacologic inhibition of beta-catenin targets imatinib-resistant leukemia stem cells in CML. Cell Stem Cell, 2012. 10(4): p. 412-24. 181. Nair, R.R., J.H. Tolentino, and L.A. Hazlehurst, Role of STAT3 in Transformation and Drug Resistance in CML. Front Oncol, 2012. 2: p. 30. 182. Bewry, N.N., et al., Stat3 contributes to resistance toward BCR-ABL inhibitors in a bone marrow microenvironment model of drug resistance. Mol Cancer Ther, 2008. 7(10): p. 3169-75. 183. Brizzi, M.F., G. Tarone, and P. Defilippi, Extracellular matrix, integrins, and growth factors as tailors of the stem cell niche. Curr Opin Cell Biol, 2012. 24(5): p. 645-51. 184. Nakayama, K.H., et al., Decellularized rhesus monkey kidney as a three-dimensional scaffold for renal tissue engineering. Tissue Eng Part A, 2010. 16(7): p. 2207-16. 185. Gattazzo, F., A. Urciuolo, and P. Bonaldo, Extracellular matrix: a dynamic microenvironment for stem cell niche. Biochim Biophys Acta, 2014. 1840(8): p. 2506-19. 186. Nilsson, S.K., et al., Immunofluorescence characterization of key extracellular matrix proteins in murine bone marrow in situ. J Histochem Cytochem, 1998. 46(3): p. 371-7. 187. Hamilton, R. and F.R. Campbell, Immunochemical localization of extracellular materials in bone marrow of rats. Anat Rec, 1991. 231(2): p. 218-24. 188. Rodgers, K.D., J.D. San Antonio, and O. Jacenko, Heparan sulfate proteoglycans: a GAGgle of skeletal-hematopoietic regulators. Dev Dyn, 2008. 237(10): p. 2622-42. 189. Hynes, R.O., The extracellular matrix: not just pretty fibrils. Science, 2009. 326(5957): p. 1216-9. 190. Klamer, S. and C. Voermans, The role of novel and known extracellular matrix and adhesion molecules in the homeostatic and regenerative bone marrow microenvironment. Cell Adh Migr, 2014. 8(6): p. 563-77. 191. De Franceschi, N., et al., Integrin traffic - the update. J Cell Sci, 2015. 128(5): p. 839-52. 192. Legate, K.R., S.A. Wickstrom, and R. Fassler, Genetic and cell biological analysis of integrin outside-in signaling. Genes Dev, 2009. 23(4): p. 397-418. 193. Hynes, R.O., Integrins: bidirectional, allosteric signaling machines. Cell, 2002. 110(6): p. 673-87. 194. Potocnik, A.J., C. Brakebusch, and R. Fassler, Fetal and adult hematopoietic stem cells require beta1 integrin function for colonizing fetal liver, spleen, and bone marrow. Immunity, 2000. 12(6): p. 653-63. 137  195. Qian, H., et al., Contribution of alpha6 integrins to hematopoietic stem and progenitor cell homing to bone marrow and collaboration with alpha4 integrins. Blood, 2006. 107(9): p. 3503-10. 196. Schreiber, T.D., et al., The integrin alpha9beta1 on hematopoietic stem and progenitor cells: involvement in cell adhesion, proliferation and differentiation. Haematologica, 2009. 94(11): p. 1493-501. 197. Chen, S., M. Lewallen, and T. Xie, Adhesion in the stem cell niche: biological roles and regulation. Development, 2013. 140(2): p. 255-65. 198. Reverte, C.G., et al., Perturbing integrin function inhibits microtubule growth from centrosomes, spindle assembly, and cytokinesis. J Cell Biol, 2006. 174(4): p. 491-7. 199. Marthiens, V., et al., Adhesion molecules in the stem cell niche--more than just staying in shape? J Cell Sci, 2010. 123(Pt 10): p. 1613-22. 200. Lee, S.T., et al., Engineering integrin signaling for promoting embryonic stem cell self-renewal in a precisely defined niche. Biomaterials, 2010. 31(6): p. 1219-26. 201. McCubrey, J.A., et al., Targeting survival cascades induced by activation of Ras/Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways for effective leukemia therapy. Leukemia, 2008. 22(4): p. 708-22. 202. Miranti, C.K. and J.S. Brugge, Sensing the environment: a historical perspective on integrin signal transduction. Nat Cell Biol, 2002. 4(4): p. E83-90. 203. Giancotti, F.G. and G. Tarone, Positional control of cell fate through joint integrin/receptor protein kinase signaling. Annu Rev Cell Dev Biol, 2003. 19: p. 173-206. 204. Defilippi, P., et al., {beta}1 Integrin and IL-3R coordinately regulate STAT5 activation and anchorage-dependent proliferation. J Cell Biol, 2005. 168(7): p. 1099-108. 205. Uberti, B., et al., Inhibition of beta1 integrin and IL-3Rbeta common subunit interaction hinders tumour angiogenesis. Oncogene, 2010. 29(50): p. 6581-90. 206. Margadant, C. and A. Sonnenberg, Integrin-TGF-beta crosstalk in fibrosis, cancer and wound healing. EMBO Rep, 2010. 11(2): p. 97-105. 207. Jiang, X., et al., Primitive interleukin 3 null hematopoietic cells transduced with BCR-ABL show accelerated loss after culture of factor-independence in vitro and leukemogenic activity in vivo. Blood, 2002. 100(10): p. 3731-40. 208. Holyoake, T.L., et al., Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3. Blood, 2001. 97(3): p. 720-8. 209. Miyazono, K., Tumour promoting functions of TGF-beta in CML-initiating cells. J Biochem, 2012. 152(5): p. 383-5. 210. Su, E., X. Han, and G. Jiang, The transforming growth factor beta 1/SMAD signaling pathway involved in human chronic myeloid leukemia. Tumori, 2010. 96(5): p. 659-66. 211. Lu, P., V.M. Weaver, and Z. Werb, The extracellular matrix: a dynamic niche in cancer progression. J Cell Biol, 2012. 196(4): p. 395-406. 212. Buitenhuis, M., The role of PI3K/protein kinase B (PKB/c-akt) in migration and homing of hematopoietic stem and progenitor cells. Curr Opin Hematol, 2011. 18(4): p. 226-30. 213. McDonald, P.C., A.B. Fielding, and S. Dedhar, Integrin-linked kinase--essential roles in physiology and cancer biology. J Cell Sci, 2008. 121(Pt 19): p. 3121-32. 138  214. Hannigan, G.E., et al., Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 1996. 379(6560): p. 91-6. 215. Hannigan, G., A.A. Troussard, and S. Dedhar, Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer, 2005. 5(1): p. 51-63. 216. Elad, N., et al., The role of integrin-linked kinase in the molecular architecture of focal adhesions. J Cell Sci, 2013. 126(Pt 18): p. 4099-107. 217. Lo, S.H., Focal adhesions: what's new inside. Dev Biol, 2006. 294(2): p. 280-91. 218. Burridge, K. and M. Chrzanowska-Wodnicka, Focal adhesions, contractility, and signaling. Annu Rev Cell Dev Biol, 1996. 12: p. 463-518. 219. Wozniak, M.A., et al., Focal adhesion regulation of cell behavior. Biochim Biophys Acta, 2004. 1692(2-3): p. 103-19. 220. Jockusch, B.M., et al., The molecular architecture of focal adhesions. Annu Rev Cell Dev Biol, 1995. 11: p. 379-416. 221. Yoganathan, N., et al., Integrin-linked kinase, a promising cancer therapeutic target: biochemical and biological properties. Pharmacol Ther, 2002. 93(2-3): p. 233-42. 222. Li, F., Y. Zhang, and C. Wu, Integrin-linked kinase is localized to cell-matrix focal adhesions but not cell-cell adhesion sites and the focal adhesion localization of integrin-linked kinase is regulated by the PINCH-binding ANK repeats. J Cell Sci, 1999. 112 ( Pt 24): p. 4589-99. 223. Brakebusch, C. and R. Fassler, The integrin-actin connection, an eternal love affair. Embo j, 2003. 22(10): p. 2324-33. 224. Oloumi, A., et al., Cooperative signaling between Wnt1 and integrin-linked kinase induces accelerated breast tumor development. Breast Cancer Res, 2010. 12(3): p. R38. 225. Wu, C. and S. Dedhar, Integrin-linked kinase (ILK) and its interactors: a new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J Cell Biol, 2001. 155(4): p. 505-10. 226. Persad, S. and S. Dedhar, The role of integrin-linked kinase (ILK) in cancer progression. Cancer Metastasis Rev, 2003. 22(4): p. 375-84. 227. Tan, C., et al., Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell, 2004. 5(1): p. 79-90. 228. Sakai, T., et al., Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev, 2003. 17(7): p. 926-40. 229. Yasunaga, T., et al., Xenopus ILK (integrin-linked kinase) is required for morphogenetic movements during gastrulation. Genes Cells, 2005. 10(4): p. 369-79. 230. Wickstrom, S.A., et al., The ILK/PINCH/parvin complex: the kinase is dead, long live the pseudokinase! Embo j, 2010. 29(2): p. 281-91. 231. Maydan, M., et al., Integrin-linked kinase is a functional Mn2+-dependent protein kinase that regulates glycogen synthase kinase-3beta (GSK-3beta) phosphorylation. PLoS One, 2010. 5(8): p. e12356. 232. Lynch, D.K., et al., Integrin-linked kinase regulates phosphorylation of serine 473 of protein kinase B by an indirect mechanism. Oncogene, 1999. 18(56): p. 8024-32. 233. Bravou, V., et al., ILK over-expression in human colon cancer progression correlates with activation of beta-catenin, down-regulation of E-cadherin and activation of the Akt-FKHR pathway. J Pathol, 2006. 208(1): p. 91-9. 234. Trowbridge, J.J., et al., Glycogen synthase kinase-3 is an in vivo regulator of hematopoietic stem cell repopulation. Nat Med, 2006. 12(1): p. 89-98. 139  235. Iso, T., L. Kedes, and Y. Hamamori, HES and HERP families: multiple effectors of the Notch signaling pathway. J Cell Physiol, 2003. 194(3): p. 237-55. 236. Filipenko, N.R., et al., Integrin-linked kinase activity regulates Rac- and Cdc42-mediated actin cytoskeleton reorganization via alpha-PIX. Oncogene, 2005. 24(38): p. 5837-49. 237. Fielding, A.B., I. Dobreva, and S. Dedhar, Beyond focal adhesions: integrin-linked kinase associates with tubulin and regulates mitotic spindle organization. Cell Cycle, 2008. 7(13): p. 1899-906. 238. Fielding, A.B., et al., A critical role of integrin-linked kinase, ch-TOG and TACC3 in centrosome clustering in cancer cells. Oncogene, 2011. 30(5): p. 521-34. 239. Lim, S., et al., Integrin-linked kinase regulates interphase and mitotic microtubule dynamics. PLoS One, 2013. 8(1): p. e53702. 240. Morris, E.J., et al., Integrin-linked kinase links dynactin-1/dynactin-2 with cortical integrin receptors to orient the mitotic spindle relative to the substratum. Sci Rep, 2015. 5: p. 8389. 241. Raymond, K., et al., Adhesion within the stem cell niches. Curr Opin Cell Biol, 2009. 21(5): p. 623-9. 242. Kiyomitsu, T. and I.M. Cheeseman, Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Nat Cell Biol, 2012. 14(3): p. 311-7. 243. Cabernard, C., K.E. Prehoda, and C.Q. Doe, A spindle-independent cleavage furrow positioning pathway. Nature, 2010. 467(7311): p. 91-4. 244. Taddei, I., et al., Beta1 integrin deletion from the basal compartment of the mammary epithelium affects stem cells. Nat Cell Biol, 2008. 10(6): p. 716-22. 245. Ahmed, N., et al., Cell-free 59 kDa immunoreactive integrin-linked kinase: a novel marker for ovarian carcinoma. Clin Cancer Res, 2004. 10(7): p. 2415-20. 246. Lu, H., et al., Integrin-linked kinase expression is elevated in human cardiac hypertrophy and induces hypertrophy in transgenic mice. Circulation, 2006. 114(21): p. 2271-9. 247. Okamura, M., et al., Prognostic value of integrin beta1-ILK-pAkt signaling pathway in non-small cell lung cancer. Hum Pathol, 2007. 38(7): p. 1081-91. 248. Qi, X.P., et al., [Expression of integrin-linked kinase in prostate cancer and its significance]. Zhonghua Nan Ke Xue, 2005. 11(1): p. 34-7. 249. Dai, D.L., et al., Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 2003. 9(12): p. 4409-14. 250. Graff, J.R., et al., Integrin-linked kinase expression increases with prostate tumor grade. Clin Cancer Res, 2001. 7(7): p. 1987-91. 251. Tan, C., et al., Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 2001. 20(1): p. 133-40. 252. Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12. 253. Wong, R.P., et al., The role of integrin-linked kinase in melanoma cell migration, invasion, and tumor growth. Mol Cancer Ther, 2007. 6(6): p. 1692-700. 140  254. Persad, S., et al., Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem, 2001. 276(29): p. 27462-9. 255. Edwards, L.A., et al., Inhibition of ILK in PTEN-mutant human glioblastomas inhibits PKB/Akt activation, induces apoptosis, and delays tumor growth. Oncogene, 2005. 24(22): p. 3596-605. 256. Yau, C.Y., et al., Inhibition of integrin-linked kinase by a selective small molecule inhibitor, QLT0254, inhibits the PI3K/PKB/mTOR, Stat3, and FKHR pathways and tumor growth, and enhances gemcitabine-induced apoptosis in human orthotopic primary pancreatic cancer xenografts. Cancer Res, 2005. 65(4): p. 1497-504. 257. Pontier, S.M., et al., Integrin-linked kinase has a critical role in ErbB2 mammary tumor progression: implications for human breast cancer. Oncogene, 2010. 29(23): p. 3374-85. 258. Serrano, I., et al., Inactivation of the Hippo tumour suppressor pathway by integrin-linked kinase. Nat Commun, 2013. 4: p. 2976. 259. Kalra, J., et al., Validating the use of a luciferase labeled breast cancer cell line, MDA435LCC6, as a means to monitor tumor progression and to assess the therapeutic activity of an established anticancer drug, docetaxel (Dt) alone or in combination with the ILK inhibitor, QLT0267. Cancer Biol Ther, 2011. 11(9): p. 826-38. 260. Edwards, L.A., et al., Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment by inhibition of integrin-linked kinase (ILK). Mol Cancer Ther, 2008. 7(1): p. 59-70. 261. Younes, M.N., et al., Integrin-linked kinase is a potential therapeutic target for anaplastic thyroid cancer. Mol Cancer Ther, 2005. 4(8): p. 1146-56. 262. Muranyi, A.L., S. Dedhar, and D.E. Hogge, Targeting integrin linked kinase and FMS-like tyrosine kinase-3 is cytotoxic to acute myeloid leukemia stem cells but spares normal progenitors. Leuk Res, 2010. 34(10): p. 1358-65. 263. Tabe, Y., et al., Activation of integrin-linked kinase is a critical prosurvival pathway induced in leukemic cells by bone marrow-derived stromal cells. Cancer Res, 2007. 67(2): p. 684-94. 264. de la Puente, P., et al., Identification of ILK as a novel therapeutic target for acute and chronic myeloid leukemia. Leuk Res, 2015. 265. Yu, Y., et al., Targeting microRNA-30a-mediated autophagy enhances imatinib activity against human chronic myeloid leukemia cells. Leukemia, 2012. 26(8): p. 1752-60. 266. Forrest, D.L., et al., An approach to the management of chronic myeloid leukemia in British Columbia. Curr Oncol, 2008. 15(2): p. 90-7. 267. Baccarani, M., et al., European LeukemiaNet recommendations for the management of chronic myeloid leukemia: 2013. Blood, 2013. 122(6): p. 872-84. 268. Nguyen, T.G., et al., Development of fluorescent substrates and assays for the key autophagy-related cysteine protease enzyme, ATG4B. Assay Drug Dev Technol, 2014. 12(3): p. 176-89. 269. Rio, D.C., et al., Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc, 2010. 2010(6): p. pdb.prot5439. 270. Chou, T.C., Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res, 2010. 70(2): p. 440-6. 271. Ashton, J.C., Drug combination studies and their synergy quantification using the Chou-Talalay method--letter. Cancer Res, 2015. 75(11): p. 2400. 141  272. Sarma, N.J., A. Takeda, and N.R. Yaseen, Colony forming cell (CFC) assay for human hematopoietic cells. J Vis Exp, 2010(46). 273. Zhou, L.L., et al., AHI-1 interacts with BCR-ABL and modulates BCR-ABL transforming activity and imatinib response of CML stem/progenitor cells. J Exp Med, 2008. 205(11): p. 2657-71. 274. Liu, M., C.L. Miller, and C.J. Eaves, Human long-term culture initiating cell assay. Methods Mol Biol, 2013. 946: p. 241-56. 275. Gorre, M.E., et al., Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science, 2001. 293(5531): p. 876-80. 276. O'Hare, T., et al., Pushing the limits of targeted therapy in chronic myeloid leukaemia. Nat Rev Cancer, 2012. 12(8): p. 513-26. 277. Jiang, X., et al., Chronic myeloid leukemia stem cells possess multiple unique features of resistance to BCR-ABL targeted therapies. Leukemia, 2007. 21(5): p. 926-35. 278. Chomel, J.C., et al., Leukemic stem cell persistence in chronic myeloid leukemia patients with sustained undetectable molecular residual disease. Blood, 2011. 118(13): p. 3657-60. 279. Hamilton, A., et al., Chronic myeloid leukemia stem cells are not dependent on Bcr-Abl kinase activity for their survival. Blood, 2012. 119(6): p. 1501-10. 280. Akin, D., et al., A novel ATG4B antagonist inhibits autophagy and has a negative impact on osteosarcoma tumors. Autophagy, 2014. 10(11): p. 2021-35. 281. Vezenkov, L., et al., Development of fluorescent peptide substrates and assays for the key autophagy-initiating cysteine protease enzyme, ATG4B. Bioorg Med Chem, 2015. 23(13): p. 3237-47. 282. Kimura, S., T. Noda, and T. Yoshimori, Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy, 2007. 3(5): p. 452-60. 283. Lebovitz, C.B., S.B. Bortnik, and S.M. Gorski, Here, there be dragons: charting autophagy-related alterations in human tumors. Clin Cancer Res, 2012. 18(5): p. 1214-26. 284. Marino, G., et al., Tissue-specific autophagy alterations and increased tumorigenesis in mice deficient in Atg4C/autophagin-3. J Biol Chem, 2007. 282(25): p. 18573-83. 285. Sheng, Z., et al., BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription. Blood, 2011. 118(10): p. 2840-8. 286. Martinez-Lopez, N., et al., Autophagy proteins regulate ERK phosphorylation. Nat Commun, 2013. 4: p. 2799. 287. Helgason, G.V., M. Karvela, and T.L. Holyoake, Kill one bird with two stones: potential efficacy of BCR-ABL and autophagy inhibition in CML. Blood, 2011. 118(8): p. 2035-43. 288. Altman, B.J., et al., Autophagy is essential to suppress cell stress and to allow BCR-Abl-mediated leukemogenesis. Oncogene, 2011. 30(16): p. 1855-67. 289. Shu, C.W., et al., High-throughput fluorescence assay for small-molecule inhibitors of autophagins/Atg4. J Biomol Screen, 2011. 16(2): p. 174-82. 290. Rothe, K., et al., The core autophagy protein ATG4B is a potential biomarker and therapeutic target in CML stem/progenitor cells. Blood, 2014. 123(23): p. 3622-34. 291. Alers, S., et al., Role of AMPK-mTOR-Ulk1/2 in the regulation of autophagy: cross talk, shortcuts, and feedbacks. Mol Cell Biol, 2012. 32(1): p. 2-11. 142  292. Vlahakis, A. and T. Powers, A role for TOR complex 2 signaling in promoting autophagy. Autophagy, 2014. 10(11): p. 2085-6. 293. Carayol, N., et al., Critical roles for mTORC2- and rapamycin-insensitive mTORC1-complexes in growth and survival of BCR-ABL-expressing leukemic cells. Proc Natl Acad Sci U S A, 2010. 107(28): p. 12469-74. 294. Zhao, M., et al., HMGB1 regulates autophagy through increasing transcriptional activities of JNK and ERK in human myeloid leukemia cells. BMB Rep, 2011. 44(9): p. 601-6. 295. Qiao, S., et al., A REDD1/TXNIP pro-oxidant complex regulates ATG4B activity to control stress-induced autophagy and sustain exercise capacity. Nat Commun, 2015. 6: p. 7014. 296. Li, L. and R. Bhatia, Role of SIRT1 in the growth and regulation of normal hematopoietic and leukemia stem cells. Curr Opin Hematol, 2015. 22(4): p. 324-9. 297. Krause, D.S., et al., Differential regulation of myeloid leukemias by the bone marrow microenvironment. Nat Med, 2013. 19(11): p. 1513-7. 298. Zaidel-Bar, R., et al., Functional atlas of the integrin adhesome. Nat Cell Biol, 2007. 9(8): p. 858-67. 299. Yu, H., et al., Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer, 2014. 14(11): p. 736-46. 300. Han, L., et al., Single-cell mass cytometry reveals intracellular survival/proliferative signaling in FLT3-ITD-mutated AML stem/progenitor cells. Cytometry A, 2015. 87(4): p. 346-56. 301. Lai, L., et al., A CD45-based barcoding approach to multiplex mass-cytometry (CyTOF). Cytometry A, 2015. 87(4): p. 369-74. 302. Cheung, R.K. and P.J. Utz, Screening: CyTOF-the next generation of cell detection. Nat Rev Rheumatol, 2011. 7(9): p. 502-3. 303. Li, J., et al., A chemical and phosphoproteomic characterization of dasatinib action in lung cancer. Nat Chem Biol, 2010. 6(4): p. 291-9. 304. Jiang, X., et al., Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukemia. Proc Natl Acad Sci U S A, 1999. 96(22): p. 12804-9. 305. Song, W., C. Zhao, and R. Jiang, Integrin-linked kinase silencing induces a S/G2/M phases cell cycle slowing and modulates metastasis-related genes in SGC7901 human gastric carcinoma cells. Tumori, 2013. 99(2): p. 249-56. 306. DuFort, C.C., M.J. Paszek, and V.M. Weaver, Balancing forces: architectural control of mechanotransduction. Nat Rev Mol Cell Biol, 2011. 12(5): p. 308-19. 307. Chang, Y.C., et al., p210(Bcr-Abl) desensitizes Cdc42 GTPase signaling for SDF-1alpha-directed migration in chronic myeloid leukemia cells. Oncogene, 2009. 28(46): p. 4105-15. 308. Shibue, T., M.W. Brooks, and R.A. Weinberg, An integrin-linked machinery of cytoskeletal regulation that enables experimental tumor initiation and metastatic colonization. Cancer Cell, 2013. 24(4): p. 481-98. 309. Sepulveda, J.L. and C. Wu, The parvins. Cell Mol Life Sci, 2006. 63(1): p. 25-35. 310. Gagne, D., et al., Integrin-linked kinase regulates migration and proliferation of human intestinal cells under a fibronectin-dependent mechanism. J Cell Physiol, 2010. 222(2): p. 387-400. 143  311. Lee, S.L., et al., Identification and characterization of a novel integrin-linked kinase inhibitor. J Med Chem, 2011. 54(18): p. 6364-74. 312. Jamieson, C.H., et al., Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med, 2004. 351(7): p. 657-67. 313. Peerani, R. and P.W. Zandstra, Enabling stem cell therapies through synthetic stem cell-niche engineering. J Clin Invest, 2010. 120(1): p. 60-70. 314. Koschmieder, S., et al., Inducible chronic phase of myeloid leukemia with expansion of hematopoietic stem cells in a transgenic model of BCR-ABL leukemogenesis. Blood, 2005. 105(1): p. 324-34.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0221673/manifest

Comment

Related Items