You may notice some images loading slow across the Open Collections website. Thank you for your patience as we rebuild the cache to make images load faster.

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of class 5 semaphorins in LTD-mediated synapse elimination Gomm, Rachel 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata


24-ubc_2016_february_gomm_rachel.pdf [ 4.5MB ]
JSON: 24-1.0221402.json
JSON-LD: 24-1.0221402-ld.json
RDF/XML (Pretty): 24-1.0221402-rdf.xml
RDF/JSON: 24-1.0221402-rdf.json
Turtle: 24-1.0221402-turtle.txt
N-Triples: 24-1.0221402-rdf-ntriples.txt
Original Record: 24-1.0221402-source.json
Full Text

Full Text

ROLE%OF%CLASS%5%SEMAPHORINS%IN%LTD2MEDIATED%SYNAPSE%ELIMINATION%%by##RACHEL#GOMM#B.Sc.,#Dalhousie#University,#2013###A#THESIS#SUBMITTED#IN#PARTIAL#FULFILLMENT#OF#THE#REQUIREMENTS#FOR##THE#DEGREE#OF#%MASTER#OF#SCIENCE##in##THE#FACULTY#OF#GRADUATE#AND#POSTDOCTORAL#STUDIES##(Neuroscience)##THE#UNIVERSITY#OF#BRITISH#COLUMBIA#(Vancouver)#December#2015#©#Rachel#Gomm,#2015#! ii!ABSTRACT%The#semaphorins#are#a#large#protein#family,#highly#conserved#across#diverse#phyla.#They#are#expressed#throughout#the#body,#with#a#diversity#of#functions#including#axon#guidance,#synapse#development#and#plasticity,#cell#proliferation#and#migration,#dendritic#arborization,#and#neuronal#polarization.#Class#5#semaphorins,#Sema5A#and#Sema5B,#are#highly#similar#transmembrane#proteins,#functioning#in#developmental#axon#guidance#and#synapse#plasticity.#Sema5A#is#geneticallyXlinked#to#Autism#Spectrum#Disorder#(ASD)#and#its#expression#is#decreased#in#people#with#ASD.#However,#its#function#in#synapse#plasticity#is#poorly#understood.##Our#study#examines#the#role#of#Sema5A#in#synapse#elimination#and#the#regulation#of#class#5#semaphorins#by#neural#activity,#specifically#longXterm#potentiation#(LTP)#and#longXterm#depression#(LTD).#We#demonstrate#that#Sema5A,#like#Sema5B,#mediates#synapse#elimination#of#hippocampal#neurons.#Furthermore,#we#show#that#the#expression#of#both#class#5#semaphorins#is#upXregulated#by#LTD#and#that#LTD#enhances#the#membrane#localization#of#Sema5A.#As#LTD#and#Sema5A#were#independently#found#to#mediate#synapse#elimination#and#as#we#determined#that#Sema5A#is#upXregulated#by#LTD,#we#tested#the#hypothesis#that#LTDXmediates#synapse#elimination#through#Sema5A#upXregulation.#However,#we#discovered#that#Sema5A#is#not#required#for#LTDXmediated#synapse#elimination#and#therefore#likely#functions#to#eliminate#synapses#through#a#separate#pathway.##! iii!PREFACE%%This#dissertation#is#original,#unpublished#work#by#the#author,#R.#Gomm.#All#experiments#and#data#analysis#was#done#by#myself#with#the#following#exceptions:#The#Matlab#script#for#data#analysis#in#Figure#3.5#was#written#by#Katie#Goodwin;#the#immunocytochemistry#experiment#in#Figure#3.6#was#done#with#assistance#from#an#undergraduate#student,#Blair#Jovellar,#under#my#supervision.###! iv!TABLE%OF%CONTENTS#%ABSTRACT#...........................................................................................................................................................#ii%PREFACE#.............................................................................................................................................................#iii%TABLE%OF%CONTENTS#...................................................................................................................................#iv%LIST%OF%TABLES#............................................................................................................................................#viii#LIST%OF%FIGURES#.............................................................................................................................................#ix#LIST%OF%ABBREVIATIONS#............................................................................................................................#x#ACKNOWLEDGEMENT#...............................................................................................................................#xiv#CHAPTER%1:%INTRODUCTION#....................................................................................................................#1%1.1%%Development%of%the%Nervous%System#....................................................................................#1#1.1.1##Formation#of#Neural#Networks#.........................................................................................#1#1.1.2##Developmental#Synapse#Elimination#..............................................................................#2#1.2##Excitatory%Synapses#........................................................................................................................#4#1.2.1##Structure#and#Function#of#Excitatory#Synapses#.........................................................#5#1.2.2##Ionotropic#Glutamate#Receptors#......................................................................................#7#1.3##Synapse%Plasticity%#...........................................................................................................................#8#1.3.1##LongXTerm#Potentiation#....................................................................................................#11#1.3.2##LongXTerm#Depression#......................................................................................................#13##1.3.3#In#Vivo#Correlates#of#LTP#and#LTD#................................................................................#18#Memory'Formation'and'Synapse'Plasticity#....................................................................#18'LTD'and'Developmental'Synapse'Pruning#......................................................................#20'1.4%%Semaphorins#....................................................................................................................................#20#1.4.1##Overview#of#the#Semaphorin#Protein#Family#...........................................................#20##! v!1.4.2##Binding#Partners#of#Semaphorins#.................................................................................#23#1.4.3##Functions#of#Semaphorins#in#the#Nervous#System#................................................#25##Axon'Pathfinding#......................................................................................................................#25'Dendritic'Arborization#...........................................................................................................#26'Synapse'Development'and'Plasticity#.................................................................................#26'1.4.4##Class#5#Semaphorins#...........................................................................................................#28#1.4.5##Receptors#of#Class#5#Semaphorins#................................................................................#28#1.4.6##Functions#of#Class#5#Semaphorins#................................................................................#29#Axon'Guidance#...........................................................................................................................#29'Circuit'Development#................................................................................................................#31''Synapse'Plasticity#.....................................................................................................................#31'1.4.7##Sema5A#and#Autism#............................................................................................................#32#1.5%%Overall%Objective#...........................................................................................................................#33%1.6%%Hypothesis#.........................................................................................................................................#33%CHAPTER%2:%MATERIALS%AND%METHODS#.......................................................................................#34%2.1%%DNA%Constructs#...............................................................................................................................#34%2.2%%Hippocampal%Culture%and%Transfection#...........................................................................#34%2.3%%Neuronal%Stimulation#.................................................................................................................#35%2.4%%Immunohistochemistry#.............................................................................................................#36%2.5%%Image%Acquisition#.........................................................................................................................#36%2.6%%Image%Analysis%and%Quantification#.....................................................................................#37%2.6.1##cLTD#Validation#....................................................................................................................#37#2.6.2##Sema5AXSEP#Validation#.....................................................................................................#37#! vi!2.6.3##RNA#Extraction#and#qPCR#.................................................................................................#38#2.6.4##Live#Imaging#of#Sema5AXSEP#..........................................................................................#39#2.6.5##Synapse#Density#Experiments#........................................................................................#39#2.7%%Statistical%Analysis#........................................................................................................................#41%CHAPTER%3:%RESULTS#................................................................................................................................#42%3.1%Sema5A%Mediates%Synapse%Elimination%in%Hippocampal%Neurons#....................#42%3.2%Effect%of%LTP%and%LTD%on%Expression%of%Class%5%Semaphorins#..............................#43%3.2.1#Validation#of#Chemical#LTD#Protocol#............................................................................#43#3.2.2#LTP#and#LTD#Regulate#the#Expression#of#Class#5#Semaphorins#........................#45#3.3%Effect%of%LTD%on%Membrane%Localization%of%Sema5A#.................................................#47%3.3.1#Sema5A#is#Inserted#into#the#Membrane#in#Response#to#LTD#.............................#47#3.3.2#LTD#Does#Not#Recruit#Sema5A#to#Synapses#..............................................................#52#3.4%Effect%of%Class%5%Semaphorin%Expression%on%LTD2Mediated%Elimination%of%Excitatory%Synapses#.....................................................................................#53%3.4.1#Sema5B#Overexpression#Abolishes#LTDXMediated#Synapse#Elimination;#Sema5A#Has#No#Effect##........................................................................................................#53##3.4.2#Sema5A#is#Not#Required#for#LTDXMediated#Decreases###########in#Synapse#Density#................................................................................................................#56#CHAPTER%4:%DISCUSSION#.........................................................................................................................#58%4.1%%Sema5A,%like%Sema5B,%Mediates%Synapse%Elimination%%of%Mature%Synapses#......................................................................................................................#58%%4.2%%Class%5%Semaphorins%are%Regulated%by%Activity#...........................................................#60%4.3%%Sema5B%Overexpression%Abolishes%LTD2Mediated%Synapse%Elimination;%%Sema5A%Overexpression%Has%No%Effect#.............................................................................#62%4.4%%Sema5A%is%Not%Required%for%NMDAR2LTD2Mediated%Decreases%%in%Synapse%Density#........................................................................................................................#64%! vii!4.5%%Possible%Mechanisms%of%Sema5A%Function#....................................................................#65%4.6%%Sema5A%and%ASD#............................................................................................................................#66#BIBLIOGRAPHY#..............................................................................................................................................#69%% %! viii!LIST%OF%TABLES%%Table%1.1.##Select#methods#for#inducing#NMDARXdependent#synaptic#plasticity#in#the#hippocampus#............................................................................................................................#11## #! ix!LIST%OF%FIGURES%Figure%1.1.%Structure#of#an#excitatory#synapse#in#the#hippocampus#..........................................#5#Figure%1.2.%LongXlasting#synaptic#plasticity#.......................................................................................#10#Figure%1.3.%NMDARXdependent#LTP#induction#and#expression#................................................#12#Figure%1.4.%NMDARXdependent#LTD#induction#and#expression#................................................#16#Figure%1.5.%The#Semaphorin#family#of#proteins#................................................................................#22#Figure%1.6.%Binding#partners#of#semaphorins#...................................................................................#24#Figure%3.1.#Sema5A#overexpression#decreases#synapse#density#and#Sema5A#knockdown#increases#synapse#density#........................................................................#42#Figure%3.2.%Validation#of#cLTD#protocol#...............................................................................................#45#Figure%3.3.%LTD#increases#transcription#of#Sema5A#and#Sema5B#............................................#46#Figure%3.4.%Validation#of#Sema5AXSEP#construct#.............................................................................#48#Figure%3.5.%Sema5A#is#inserted#into#the#plasma#membrane#following#LTD#but#not#specifically#to#the#synaptic#membrane#.........................................................................#50#Figure%3.6.#Sema5A#overexpression#has#no#effect#on#LTDXmediated#decreased#synapse#density,#while#Sema5B#overexpression#abolishes#the#effect#of#LTD#................#55#Figure%3.7.%Sema5A#is#not#required#for#LTDXmediated#decreases#in#synapse#density#....#57#%% %! x!LIST%OF%ABBREVIATIONS%% AMPA#X#αXaminoX3XhydroxyX5XmethylX4Xisoxazolepropionic#acid#AMPARs#X#AMPA#receptors#ANOVA#–#analysis#of#variance#ASD#X#Autism#Spectrum#Disorder#BDNF#–#brainXderived#neurotrophic#factor#BFP#–#blue#fluorescent#protein#Ca2+#–#calcium#CAMKII#–#Ca2+/calmodulinXdependent#protein#kinase#II#cDNA#–#complementary#DNA#cLTD#X#chemicallyXinduced#LTD#cLTP#–#chemicallyXinduced#LTP#CNS#X#central#nervous#system#CNV#–#copyXnumber#variation#CRD#X#cysteineXrich#domain#CSPG#X#chondroitin#sulfate#proteoglycan#DG#X#dentate#gyrus#DHPG#X#(R,S)X3,5Xdihydroxyphenylglycine##DIV#X#days#in'vitro#dLGN#X#dorsal#lateral#geniculate#nucleus#DRG#X#dorsal#root#ganglion#DSMX5#–#diagnostic#and#statistical#manual#of#mental#disorders#! xi!E18#X#embryonic#day#18#ECS#–#extracellular#solution#FMRP#X#fragile#X#mental#retardation#protein#GAP#X#GTPaseXactivating#protein#GC#X#granule#cell#GFP#–#green#fluorescent#protein#GSK3#X#glycogen#synthase#kinaseX3##GPI#–#glycosylphosphatidylinositol#h5A#X#human#Sema5A#HA#–#human#influenza#hemagglutinin#(HA)#tag##HSPG#X#heparan#sulfate#proteoglycan#Ig#X#immunoglobulin#iGluRs#X#ionotropic#glutamate#receptors#IntDens#X#integrated#density#KA#X#kainate#KD#X#knockdown#LTD#X#longXterm#depression#LTP#X#longXterm#potentiation#MAP#X#mitogenXactivated#protein#MEF2#–#myocyte#enhancer#factorX2##MEM#X#minimum#essential#medium#mEPSCs#–#miniature#excitatory#postsynaptic#current#MES#X#2X(NXmorpholino)ethanesulfonic#acid#! xii!Mg2+#X#magnesium#mGluRs#X#metabotropic#glutamate#receptors#mRNA#–#messenger#RNA#MWM#X#Morris#water#maze#NMDA#X#NXmethylXDXaspartate#NMDARXLTD#X#NMDARXdependent#form#of#LTD#NMDARs#X#NMDA#receptors#Npn#X#neurophilin#PBS#X#phosphate#buffered#saline#pDisp#–#pDisplay##PFA#X#paraformaldehyde#PICK1#X#phosphorylating#protein#interacting#with#C#kinase#1#PKA#X#protein#kinase#A#PKC#X#protein#kinase#C#Plex#X#plexin#PP1#X#protein#phosphatase#1#PSD#X#postsynaptic#density#PSDX95#X#postsynaptic#density#proteinX95#PSDX95XRFP#X#PSDX95#tagged#with#red#fluorescent#protein#PSI#X#plexinXsemaphorinXintegrin#qPCR#X#realXtime#quantitative#PCR#RGC#X#retinal#ganglion#cells#RNA#–#ribonucleic#acid#! xiii!SEM#–#standard#error#of#the#mean#Sema#X#Semaphorin#Sema5A#X#Semaphorin#5A##Sema5AXHA#X#Sema5A#construct#that#has#an#extracellular#HA#tag#Sema5AXSEP#X#Sema5A#construct#extracellularly#tagged#with#SEP#Sema5B#X#Semaphorin#5B#Sema5BXSEP#X#Sema5B#construct#extracellularly#tagged#with#SEP#SEP#X#super#ecliptic#pHluorin#SEPXGluA1#X#GluA1#extracellularly#tagged#with#super#ecliptic#pHluorin#SHANK#–#SH3#and#multiple#ankyrin#repeat#domains#protein##shRNA#X#short#hairpin#RNA#SNP#X#singleXnucleotide#polymorphism#STDP#X#spike#timing#dependent#plasticity#SV#X#synaptic#vesicle#TSC#–#tuberous#sclerosis#complex#protein#TSR#X#typeX1#thrombospondin#repeat#TTX#X#tetrodotoxin#VGluT#X#vesicular#glutamate#transporter#% %! xiv!ACKNOWLEDGEMENTS%#I#would#firstly#like#to#express#my#gratitude#to#my#supervisor,#Dr.#Shernaz#Bamji#for#her#guidance#and#support#throughout#this#project.#Thank#you#for#helping#me#achieve#this#great#accomplishment.###I#would#also#like#to#thank#the#members#of#my#committee:#Dr.#Tim#O’Connor#and#Dr.#Ann#Marie#Craig#for#giving#their#time#and#helpful#input#throughout#my#thesis.##A#special#thank#you#to#all#the#members#of#the#Bamji#lab,#past#and#present#for#making#it#a#great#environment#to#work#it.#In#particular,#I#would#like#to#thank#Stefano#Brigidi#for#all#the#assistance#and#advice#in#the#beginning#when#I#was#just#getting#started#in#the#lab#and#Riki#Dingwall#for#his#support#in#the#last#year.#I#would#also#like#to#thank#Andrea#Globa,#Fergil#Mills,#Jordan#Shimell,#and#Mahsan#Mobasser#for#their#friendship#and#help.###I#would#especially#like#to#thank#my#family#as#this#wouldn’t#have#been#possible#without#them.#I#am#eternally#grateful#to#my#husband#Martin#for#supporting,#encouraging,#and#motivating#me.#His#patience#and#love#mean#the#world#to#me.#Finally,#I#would#like#to#thank#my#parents,#my#sister,#and#my#brothers#who#have#supported#me#from#far#away.#####! 1!CHAPTER%1:%INTRODUCTION%1.1%%Development%of%the%Nervous%System%For#proper#functioning,#the#mammalian#central#nervous#system#(CNS)#relies#on#the#development#of#precise,#interconnected#networks#of#neurons,#which#allow#for#appropriate#communication#between#and#within#specific#regions.#This#is#an#impressive#accomplishment#as#in#adult#humans,#there#are#about#100#billion#neurons#(Azevedo#et#al.,#2009)#that#must#integrate#into#the#network,#each#making#thousands#of#synapses.#Without#accurate#connections#between#individual#neurons#and#neural#circuits,#we#would#be#unable#to#experience#and#function#in#the#world#normally,#leading#to#the#development#of#neurological#disorders.#The#initial#foundation#for#these#circuits#occurs#during#embryonic#development#with#an#overproduction#of#cells#and#synaptic#connections#(Cowan#et#al.,#1984;#Innocenti#&#Price,#2005).#Subsequent#remodeling#of#this#network#occurs#during#postnatal#development#through#cell#death,#synapse#elimination#and#axonal#retraction#(Cowan#et#al.,#1984;#Kano#&#Hashimoto,#2009;#Schuldiner#&#Yaron,#2015).#Normal#development#therefore#requires#a#precise#interplay#between#formation#and#elimination#of#connections.#1.1.1%%Formation%of%Neural%Networks%%The#first#crucial#step#after#neurons#are#born#is#ensuring#they#migrate#to#their#appropriate#destination.#Once#neuron#cell#bodies#are#in#place,#they#differentiate#and#extend#axons#to#form#synapses#with#targets#either#locally#or#far#away.#Axon#pathfinding#is#a#highly#coordinated#process,#directed#by#environmental#attractive#and#repulsive#guidance#molecules#such#as#ephrins,#netrins,#and#semaphorins,#in#which#few#mistakes#occur#(TessierXLavigne#&#Goodman,#1996).#Once#the#tip#of#the#axon,#the#growth#cone,#! 2!reaches#a#filopodia#of#the#target#dendrite,#various#cellXsurface#proteins#including#cell#adhesion#molecules#induce#synapse#formation#and#stabilization#through#recruitment#of#preX#and#postsynaptic#compartment#components#(reviewed#in:#Waites#et#al.,#2005;#Williams#et#al.,#2010).#Many#of#these#synapses#are#transient#because#extraneous#synapses#are#formed#during#embryonic#patterning#of#the#nervous#system#and#must#be#eliminated#during#postnatal#development.####1.1.2%%Developmental%Synapse%Elimination%After#embryonic#development#of#neural#connections#in#the#CNS,#a#normal#process#of#wideXspread#synapse#pruning#occurs#to#remodel#brain#circuitry#and#eliminate#aberrant#or#unused#connections.#This#phenomenon#was#originally#identified#over#a#century#ago#by#Ramon#y#Cajal,#who#referred#to#it#as#“process#resorption”#(Schuldiner#&#Yaron,#2015)#and#has#since#been#demonstrated#in#a#variety#of#model#systems.#Axons#can#be#retracted#or#removed#depending#on#various#extracellular#factors#including:#synaptic#activity,#competition#for#trophic#factors#such#as#BDNF#from#targets,#thyroid#hormones,#and#repulsive#signaling#molecules#such#as#semaphorins#(reviewed#in:#Innocenti#&#Price,#2005;#Schuldiner#&#Yaron,#2015).##Along#with#axons,#synapses#undergo#extensive#pruning#during#development.#Synapse#elimination#may#occur#concurrently#with#and#induce#axon#retraction#as#in#the#loss#of#synapses#located#at#axon#terminal#boutons#in#the#hippocampal#Mossy#fiber#connections#with#CA3#cells#(Liu#et#al.,#2005).#The#mechanism#of#synapse#elimination#and#axon#retraction#in#this#case#is#thought#to#be#due#to#plexinXA3#signaling,#likely#through#class#3#semaphorins#(Bagri#et#al.,#2003),#as#plexinXA3#knockout#mice#maintained#mature#synapses#and#pruning#of#axon#collaterals#did#not#occur#(Liu#et#al.,#2005).#Most#synapse#! 3!elimination#in#vertebrates#is#thought#to#occur#in#an#activityXdependent#manner.#Synapse#elimination#has#been#highly#studied#in#the#connections#between#retinal#ganglion#cells#(RGC)#and#dorsal#lateral#geniculate#nucleus#(dLGN)#neurons.#In#this#system,#removal#of#extraneous#synapses#requires#synaptic#activity#occurring#in#spontaneous#retinal#waves#or#through#sensory#experience#(Hooks#&#Chen,#2006).#Furthermore,#elevated#levels#of#glutamate#in#the#synaptic#cleft#can#increase#developmental#spine#elimination#(Yu#et#al.,#2013).##Cellular#and#molecular#processes#involved#in#synapse#elimination#are#not#yet#wellXcharacterized;#however,#evidence#is#growing#for#the#involvement#of#nonXneuronal#cells.#For#example,#components#of#the#complement#pathway,#including#C1q#and#C3,#are#secreted#by#glial#cells#and#are#required#for#synapse#elimination#in#the#visual#pathway#(Stevens#et#al.,#2007).#Additionally,#the#glutamate#transporter#of#astrocytes#can#regulate#dendritic#spine#elimination#(Yu#et#al.,#2013).#Furthermore,#microglia#are#required#for#activityXdependent#phagocytosis#of#eliminated#synaptic#compartments#to#complete#the#synapse#elimination#process#and#refine#neural#circuits#(Schafer#et#al.,#2012).##In#the#postsynaptic#compartment,#synapse#elimination#occurs#through#the#proteasome#pathway.#The#transcription#factor,#MEFX2,#is#required#for#normal#synapse#elimination#in#hippocampal#neurons#as#reduced#expression#of#MEFX2#results#in#increased#synapse#density#and#synaptic#transmission#(Flavell#et#al.,#2006).#MEFX2#function#requires#intact#ability#as#a#transcription#activating#factor#and#activityXdependent#activation#by#calcineurinXmediated#dephosphorylation#(Flavell#et#al.,#2006).#MEFX2#activation#induces#PSDX95#ubiquitination#and#proteasomal#degredation#eventually#leading#to#synapse#elimination#(Tsai#et#al.,#2012).#Additional#components#of#! 4!this#pathway#have#since#been#identified,#including#fragile#X#mental#retardation#protein#(FMRP),#an#RNA#binding#protein#essential#for#MEF2#function#(Pfeiffer#et#al.,#2010)#and#protocadherinX10,#which#facilitates#association#of#ubiquitinated#PSD95#with#the#proteasome#(Tsai#et#al.,#2012).##1.2%%Excitatory%Synapses%Chemical#synapses#of#the#CNS#are#important#points#of#contact#and#communication#between#neurons#that#are#formed,#maintained,#and#eliminated#through#the#interactions#of#many#proteins,#all#of#which#must#work#in#exacting#concert#for#proper#development#of#the#neural#networks#underlying#cognition.#These#synapses#can#be#classified#by#the#effect#of#their#signal#as#either#excitatory#or#inhibitory#and#by#the#main#neurotransmitter,#or#chemical#signal,#they#use#to#communicate.#Inhibitory#synapses#will#not#be#further#discussed#in#this#thesis;#instead#the#will#focus#will#be#on#the#structure,#function,#and#plasticity#of#excitatory#synapses.##Glutamatergic#synapses#are#the#most#abundant#kind#of#excitatory#synapses#in#the#mammalian#CNS#and#the#most#relevant#for#this#thesis;#therefore,#they#will#be#hereafter#referred#to#as#“synapse”#or#“excitatory#synapse”.#Excitatory#synapses#consist#of#a#presynaptic#compartment,#located#along#the#axon#of#a#neuron,#contacting#a#postsynaptic#compartment#located#in#spines#protruding#from#the#dendrite#of#another#neuron#(Figure#1.1).#The#preX#and#postsynaptic#membranes#are#held#in#close#apposition#by#various#cell#adhesion#molecules,#which#allows#the#rapid#diffusion#of#neurotransmitters#across#the#synaptic#cleft.####! 5!#Figure%1.1.%Structure%of%an%excitatory%synapse%in%the%hippocampus.#The#presynaptic#terminal#contains#synaptic#vesicles#that#hold#and#release#neurotransmitters#such#as#glutamate.#The#preX#and#postsynaptic#compartments#are#held#in#close#apposition#by#synaptic#cell#adhesion#molecules.#The#synaptic#cleft#allows#for#diffusion#of#neurotransmitters#and#communication#between#the#preX#and#postsynaptic#neurons.#The#postsynaptic#neuron#contains#a#variety#of#neurotransmitter#receptors# including#NMDARs,#AMPARs,#and#mGluRs,#which#are#maintained#at#the#membrane#by#scaffolding#proteins#of#the#postsynaptic#density.###1.2.1%%Structure%and%Function%of%Excitatory%Synapses%Synapse#transmission#is#the#transduction#of#an#electrical#impulse#into#a#chemical#signal#and#back#again#that#allows#neurons#to#communicate#with#each#other#for#signal#integration#and#information#processing.#The#preX#and#postsynaptic#compartments#are#highly#specialized#regions#of#the#neuron.##The#axonal#presynaptic#compartment#synthesizes,#stores,#and#upon#electrical#depolarization,#releases#the#neurotransmitter#glutamate.#Glutamate#is#synthesized#from#glutamine#enzymatically#by#phosphateXactivated#glutaminase#in#the#cytoplasm#of#the#presynaptic#neuron#(Takamori,#2006).#Newly#synthesized#glutamate#is#transported#into#! 6!the#lumen#of#synaptic#vesicles#(SVs)#by#the#membraneXassociated#vesicular#glutamate#transporter#(VGluT),#driven#by#an#electrochemical#proton#(H+)#gradient#created#across#the#vesicle#membrane#by#an#H+XATPase#(Takamori,#2006).#GlutamateXfilled#SVs#are#stored#in#the#presynaptic#terminal#until#calcium#(Ca2+)Xinduced,#depolarizationXdependent,#synaptic#vesicle#fusion#and#exocytosis,#or#neurotransmitter#release,#occurs#at#the#presynaptic#active#zone#(Santos,#Li,#&#Voglmaier,#2009;#Sudhof,#2013).##The#postsynaptic#compartments#of#excitatory#synapses#are#mostly#localized#to#spiny#protrusions#along#dendrites#and#are#specialized#to#receive#chemical#signals#and#transduce#them#into#an#electrical#potential,#which#propagates#through#the#neuron.#The#postsynaptic#density#(PSD)#is#an#electronXdense#region#adjacent#to#the#postsynaptic#membrane#comprised#of#neurotransmitter#receptors,#scaffolding#proteins,#and#signaling#molecules.#Postsynaptic#density#proteinX95#(PSDX95)#is#a#key#scaffolding#component#of#the#PSD#and#coordinates#many#proteinXprotein#interactions,#including#clustering#of#neurotransmitter#receptors#(Kim#&#Sheng,#2004;#Sheng#&#Hoogenraad,#2007)#through#its#PDZXbinding#motif,#a#conserved#region#of#90#amino#acids#(Hung#&#Sheng,#2002).#The#postsynaptic#responses#to#glutamate#are#mediated#through#glutamateXactivated#cation#channels,#called#ionotropic#glutamate#receptors#(iGluRs),#and#G#proteinXcoupled#receptors,#called#metabotropic#glutamate#receptors#(mGluRs).#The#iGluRs#are#subXclassified#into#three#groups#based#on#their#affinity#for#specific#ligands#other#than#glutamate:#NXmethylXDXaspartate#(NMDA),#αXaminoX3XhydroxyX5XmethylX4Xisoxazolepropionic#acid#(AMPA),#and#kainate#(KA)#receptors.#The#NMDA#receptors#(NMDARs)#and#AMPA#receptors#(AMPARs)#are#important#mediators#of#synaptic#plasticity,#the#process#whereby#synapses#increase#or#decrease#in#strength,#because#they#! 7!respond#to#changes#in#synaptic#activity#through#mechanisms#such#as#membrane#trafficking#and#subunit#switching#(Collingridge#et#al.,#2010;#Hunt#&#Castillo,#2012;#Kopec#et#al.,#2006;#Malinow#&#Malenka,#2002).#1.2.2%%Ionotropic%Glutamate%Receptors%# Most#excitatory#synaptic#neurotransmission#in#the#CNS#is#mediated#through#AMPARs,#which#create#the#initial#depolarization#of#the#postsynaptic#neuron#when#glutamate#binds#and#the#channel#opens#allowing#cations#to#enter#the#cell#(Greger#&#Esteban,#2007).#AMPARs#are#heterotetrameric#channels#consisting#of#a#combination#of#four#subunits#GluA1XGluA4;#the#specific#subunit#combination#confers#variations#in#functional#properties,#membrane#trafficking#and#synaptic#localization,#which#is#important#for#synaptic#plasticity#(Greger#&#Esteban,#2007).#For#example,#in#the#hippocampus#in#particular,#these#glutamate#receptors#are#mostly#Ca2+Ximpermeable#as#approximately#80%#are#GluA1/A2#heteromers#(Lu#et#al.,#2009).##NMDARs#are#a#second#glutamate#receptor#critical#for#excitatory#synapse#function;#however,#they#are#more#important#for#synaptic#plasticity#than#basal#neurotransmission.#Like#AMPARs,#NMDARs#are#heterotetrameric#transmembrane#channels#consisting#of#a#combination#of#four#subunits#from#among#seven#subtypes#(GluN1,#GluN2AXD,#or#GluN3AXB)#and#the#specific#combination#of#subunits#confers#differential#functional#properties#(Paoletti,#Bellone,#&#Zhou,#2013).#The#subunit#composition#of#NMDARs#changes#with#developmental#stage#indicating#that#some#subunits#are#important#for#synaptogenesis#and#early#synapse#maturation,#while#others#are#more#important#for#plasticity#of#adult#synapses.#For#example,#GluN2B,#GluN2D#and#GluN3A#predominate#early#in#development#when#synapses#are#forming;#whereas#! 8!GluN2A#and#GluN2B#are#highly#expressed#together#in#adult#neurons,#especially#in#the#hippocampus,#suggesting#their#importance#for#modifications#of#synaptic#strength#(Watanabe#et#al.,#1992;#Akazawa#et#al.,#1994;#Monyer#et#al.,#1994).#Interestingly,#GluN3A#expression#in#early#development#is#consistent#with#it#functioning#in#developmental#synapse#pruning.#In#hippocampal#slices,#GluN3A#overexpression#decreased#spine#density#overtime,#promoting#synapse#elimination;#whereas#reduced#GluN3A#expression#restrained#synapse#elimination#(Kehoe#et#al.,#2014).#Moreover,#abnormal#expression#of#GluN3A#in#mature#tissue#reinstated#a#propensity#for#synapse#destabilization#and#pruning#(Kehoe#et#al.,#2014).#Unlike#the#majority#of#AMPARs#in#the#hippocampus,#NMDARs#are#Ca2+Xpermeable,#a#property#essential#for#their#role#in#synaptic#plasticity,#which#will#be#discussed#in#more#detail#in#the#following#section#(Section#1.3).##NMDARs#have#been#called#“coincidence#detectors”#as#they#are#both#ligandX#and#voltageXgated,#requiring#precise#timing#of#glutamate#and#glycine,#a#coXagonist,#binding#and#postXsynaptic#depolarization#to#occur#(Huganir#&#Nicoll,#2013).#Depolarization#is#required#to#remove#a#positive#ion,#Mg2+,#from#its#blocking#position#in#the#channel.#This#dual#form#of#activation#serves#a#signal#integration#function#allowing#for#temporal#summation#and#activityXmediated#synaptic#plasticity.#This#unique#channel#property#also#confers#the#ability#of#NMDARs#to#promote#the#maturation#of#silent#synapses,#which#are#earlyXformed#synapses#lacking#AMPARXmediated#activity#(Kerchner#&#Nicoll,#2008).#%1.3%%Synapse%Plasticity%%# Synapses#are#essential#for#communication#between#neurons#and#neural#networks#of#the#CNS,#which#underlies#information#processing.#An#important#feature#of#synapses#is#their#capacity#for#structural#and#functional#modification#in#response#to#! 9!neural#activity#throughout#life#and#is#referred#to#as#synaptic#plasticity.#This#is#essential#for#both#the#initial#development#of#brain#circuitry#and#for#continued#fineXtuning#of#information#processing#networks#in#response#to#stimuli.#Synapse#plasticity#is#therefore#critical#for#learning#and#memory.##The#hippocampus#is#a#wellXdefined,#highly#studied#anatomical#region#of#the#brain#which#has#been#associated#with#learning#and#memory#for#almost#60#years,#since#researches#demonstrated#the#loss#of#shortXterm#memory#following#biXlateral#section#of#the#hippocampus#in#the#famous#patient#HM#and#others#(Scoville#&#Milner,#1957).#Subsequently,#many#researchers#have#studied#the#hippocampus#to#determine#the#cellular#and#molecular#correlates#of#learning#and#memory#and#hippocampal#slices#or#primary#cultures#became#popular#model#systems.##The#first#researchers#to#demonstrate#longXlasting#changes#in#synaptic#strength#did#so#by#giving#highXfrequency#electrical#stimulation#to#neurons#of#the#hippocampal#perforant#pathway#and#taking#recordings#from#cells#of#the#dentate#gyrus,#showing#an#increase#in#the#amplitude#of#the#response#that#lasted#at#least#ten#hours#(Bliss#&#Lomo,#1973).#This#longXlasting,#activityXdependent#synaptic#strengthening#is#referred#to#as#longXterm#potentiation#(LTP;#Figure#1.2).#An#alternative#form#of#synapse#plasticity#in#the#hippocampus#was#later#discovered#that#involves#a#longXlasting#decrease#in#synapse#strength#termed#longXterm#depression#(LTD;#Figure#1.2;#Dudek#and#Bear,#1992).#Researchers#have#since#discovered#multiple#ways#to#induce#NMDARXdependent#LTP#and#LTD#in#the#hippocampus,#some#of#which#are#outlined#below#in#table#1.1.####! 10!#####Figure%1.2.%Long2lasting%synaptic%plasticity.#LTP,#a#longXlasting#increase#in#synapse#strength,#occurs#in#response#to#highXfrequency#stimulation#as#indicated#by#increased#EPSC#amplitude.#A#longXlasting#decrease#in#synapse#strength,#or#LTD,#occurs# in#response#to# lowXfrequency#stimulation#as# indicated#by#sustained#decreases#in#EPSC#amplitude.#LTP#and#LTD#can#also#be#induced#chemically#through#application#of#glycine#or#NMDA,#respectively#(Adapted#with#permission#from#Collingridge#et#al.,#2010).###########! 11!#Table%1.1.##Select#methods#for#inducing#NMDARXdependent#synaptic#plasticity#in#the#hippocampus.###Experimental#Method# LTP#Protocol# LTD#Protocol#Electrophysiology# High#Frequency#Stimulation#(Bliss#&#Lomo,#1973)# Low#Frequency#Stimulation#(Dudek#&#Bear,#1992)#Electrophysiology# Spike#Timing#Dependent#Plasticity#(STDP)##Repeated#activation#with#presynaptic#stimulation#followed#within#20#ms#by#a#postsynaptic#spike.#(Bi#&#Poo,#1998)#Spike#Timing#Dependent#Plasticity#(STDP)##Reverse#of#LTP#protocol;#repeated#activation#with#postsynaptic#spikes#followed#by#presynaptic#spikes.##(Bi#&#Poo,#1998)#Chemical#Stimulation# Glycine#(200#μM)#for#3#min##(Lu#et#al.,#2001)# NMDA#(20#μM)#for#3#min##(Lee#et#al.,#1998)#%1.3.1%%Long2Term%Potentiation%Early#studies#of#LTP#in#the#hippocampus#revealed#the#importance#of#NMDARs#for#LTP#expression.#Researchers#blocked#LTP#induction#in#CA1#cells#by#applying#the#selective#antagonist#of#NMDARs,#APV,#to#hippocampal#slices#before#highXfrequency#stimulation#of#the#Schaffer#collateral#pathway#(Collingridge#et#al.,#1983).#Other#researchers#determined#that#postsynaptic#depolarization#is#required#for#LTP#by#demonstrating#that#hyperpolarizing#postsynaptic#cells#during#highXfrequency#stimulation#prevented#increases#in#synapse#strength#(Malinow#&#Miller,#1986).#This#result#further#supports#the#idea#that#NMDARs#are#important#for#LTP#because#these#receptors#uniquely#require#postsynaptic#depolarization#in#addition#to#ligandXbinding#for#activation.##Subsequent#studies#demonstrated#that#LTP#expression#requires#increases#in#postsynaptic#Ca2+,#protein#kinase#activation,#phosphorylation,#and#de'novo#protein#synthesis#(Fig.#1.3;#Huganir#&#Nicoll,#2013;#Karpova#et#al.,#2006;#Vickers#&#Wyllie,#! 12!2007).#These#findings#were#used#to#develop#a#theory#of#the#molecular#pathway#involved#in#LTP.#NMDAR#activation#results#in#an#influx#of#Ca2+#in#the#postsynaptic#cell.#Ca2+#binds#to#and#activates#various#protein#kinases#such#as#CaMKII,#protein#kinase#A#(PKA)#and#protein#kinase#C#(PKC),#which#leads#to#phosphorylation#of#signaling#molecules,#some#of#which#act#locally#at#the#synapse#and#others#that#translocate#to#the#nucleus#and#initiate#protein#synthesis.##%%Figure% 1.3.% NMDAR2dependent% LTP% induction% and% expression.# Concurrent# NMDAR# activation# by#glutamate#binding#and#postsynaptic#depolarization#leads#to#relief#of#the#Mg2+#block#and#Ca2+#entry#into#the# postsynaptic# compartment.# Increased# Ca2+# activates# CaMKII# and# PKA# which# leads# to# the#phosphorylation#of#signaling#molecules,#some#of#which#act#locally#to#induce#AMPAR#membrane#insertion#and#others# that# translocate# to# the#nucleus# to# initiate#protein# synthesis# (Adapted#with#permission# from#Kauer#&#Malenka,#2007).##! 13!There#are#two#separate#but#overlapping#ways#LTP#is#expressed:#a#functional#increase#in#AMPAR#currents#and#structural#modifications#to#spines.#Early#experiments#using#GFPXtagged#AMPARs#(GFPXGluA1#constructs)#demonstrated#that#the#increase#in#AMPAR#currents#following#LTP#stimulation#results#from#AMPAR#insertion#into#the#postsynaptic#plasma#membrane#(Hayashi#et#al.,#2000;#Shi#et#al.,#1999).#Subsequent#studies#revealed#that#the#GluA1#AMPAR#subunit#is#required#for#activityXmediated#trafficking#and#membrane#insertion#of#AMPARs#and#that#it#is#due#to#phosphorylation#by#CaMKII#(Hayashi#et#al.,#2000;#Barria#et#al.,#1997;#Mammen#et#al.,#1997;#Roche#et#al.,#1996;#Shi#et#al.,#1999).#The#addition#of#synaptic#AMPARs#appears#to#be#through#a#process#of#extraXsynaptic#membrane#insertion#followed#by#lateral#diffusion#to#postsynaptic#sites#(Makino#&#Malinow,#2009).#Further#experiments#in#hippocampal#slices#demonstrate#that#rapid#enlargement#of#existing#dendritic#spines#(Matsuzaki#et#al.,#2004)#and#formation#of#new#spines#(Engert#&#Bonhoeffer,#1999)#accompanies#induction#of#LTP#in#CA1#neurons.#Furthermore,#consistent#with#functional#increases#in#synapse#strength,#if#LTP#stimulation#is#blocked#by#application#of#the#NMDAR#antagonist,#APV,#these#structural#changes#do#not#occur.#LiveXimaging#of#chemicallyXinduced#LTP#suggests#that#structural#spine#enlargements#precede#increases#in#synaptic#AMPARs#(Kopec#et#al.,#2006).##1.3.2%%Long2Term%Depression%%In#the#hippocampus,#researchers#also#discovered#a#form#of#longXlasting#synaptic#plasticity#involving#decreases#in#synapse#strength#that#was#termed#longXterm#depression#(LTD;#Dudek#and#Bear,#1992).#There#are#multiple#forms#of#LTD,#which#are#categorized#based#on#the#type#of#induction#protocol,#the#receptors#that#are#triggered#in#! 14!the#induction#process#(i.e.#NMDARs#or#mGluRs),#and#whether#or#not#it#occurs#following#LTP#(Collingridge#et#al.,#2010).#Researchers#have#studied#the#multiple#forms#of#LTD#in#various#brain#regions#including#the#hippocampus#and#cerebellum.#This#thesis#will#focus#on#the#NMDARXdependent#form#of#LTD#(NMDARXLTD)#in#the#hippocampus.#Researchers#first#induced#LTD#of#CA1#neurons#through#lowXfrequency#stimulation#of#Schaffer#collaterals#in#the#hippocampus#(Dudek#and#Bear,#1992)#and#this#continues#to#be#the#most#common#way#to#induce#NMDARXLTD.#This#form#of#plasticity#can#also#be#induced#electrically#through#a#spikeXtiming#dependent#protocol#or#chemically#with#application#of#NMDA#(Collingridge#et#al.,#2010;#Table#1.1).##Decreased#synapse#transmission,#which#is#associated#with#NMDARXLTD#is#due#to#internalization#of#AMPARs,#showing#that#AMPAR#trafficking#is#important#for#bidirectional#synapse#plasticity.#Early#studies#showed#rapid#endocytosis#of#AMPARs#following#treatment#of#hippocampal#cultures#with#NMDA#(chemicallyXinduced#LTD#(cLTD);#Beattie#et#al.,#2000;#Kameyama#et#al.,#1998).#Studies#using#glutamate#uncaging#at#synapses#where#LTD#was#induced#with#LFS#support#the#importance#for#removal#of#synaptic#AMPARs#in#LTD#induction#(Kandler#et#al.,#1998).##Interestingly,#expression#of#NMDARXLTD,#like#LTP,#requires#postsynaptic#Ca2+#influx#through#NMDARs#as#it#can#be#blocked#by#the#NMDAR#antagonists,#APV#or#MKX801,#and#by#the#addition#of#postsynaptic#BAPTA,#a#calcium#chelator#(Dudek#&#Bear,#1992;#Babiec#et#al.,#2014).#Unlike#LTP#however,#LTD#requires#activation#of#calcineurin,#and#dephosphorylation#of#proteins#such#as#PKA,#PKC,#and#the#AMPAR#GluA1#subunit#(Mulkey#et#al.,#1993;#Mulkey#et#al.,#1994;#Lee#et#al.,#1998;#Jurado#et#al.,#2010;#Lee#et#al.,#2003).#The#proposed#factors#that#determine#whether#LTP#or#LTD#is#induced#in#response#! 15!to#Ca2+#influx#are#the#magnitude#and#duration#of#calcium#signaling#in#the#postsynaptic#cell#(Malenka#&#Bear,#2004).#In#this#model,#high#levels#of#calcium#activate#the#lowXaffinity#kinase,#CaMKII,#to#induce#phosphorylation#and#activate#signaling#cascades#leading#to#LTP.#Alternatively,#LTD#results#due#to#dephosphorylation#of#postsynaptic#proteins#when#low#levels#of#calcium#activate#the#highXaffinity#phosphatase,#calcineurin.##A#cohesive#model#for#the#mechanism#of#NMDARXLTD#expression#remains#elusive,#as#conflicting#experimental#results#make#it#difficult#to#determine#the#necessary#and#sufficient#components#of#the#signaling#cascade.#The#postsynaptic#protein,#PSDX95,#is#required#for#LTD#because#mice#lacking#PSDX95#have#no#LTD#(Xu#et#al.,#2008).#The#NMDAR#subunit#GluN2B#can#be#required#for#LTD#under#some#conditions#but#not#all,#indicating#there#is#flexibility#in#the#requirements#for#specific#NMDAR#subunits#(Brigman#et#al.,#2010;#Bartlett#et#al.,#2007;#Morishita#et#al.,#2007).#In#addition#to#protein#phosphatases#being#important#for#LTD,#results#of#multiple#studies#indicate#that#the#activity#of#some#protein#kinases#are#also#required,#for#example#glycogen#synthase#kinaseX3#(GSK3;#Peineau#et#al.,#2007;#Yagishita#et#al.,#2015).#GSK3#may#mediate#its#effects#by#phosphorylating#protein#interacting#with#C#kinase#1#(PICK1),#a#synaptic#calcium#sensor#that#is#important#for#LTD#and#has#been#implicated#in#the#AMPAR#internalization#process#(Hanley#&#Henley,#2005;#Lin#&#Huganir,#2007;#Yagishita#et#al.,#2015).#Other#signaling#molecules#that#have#been#implicated#in#LTD#include:#the#GTPase#Arf1#(Rocca#et#al.,#2013)#and#members#of#the#JAK/STAT#signaling#pathway#(Nicolas#et#al.,#2012).#Furthermore,#recent#findings#indicate#that#caspaseX3#is#required#for#NMDARXLTD#expression#(Ertürk,#Wang#&#Sheng,#2014;#Li#et#al.,#2010).#To#create#a#! 16!comprehensive#model,#it#is#clear#that#more#work#needs#to#be#done;#however,#an#emerging#model#is#outlined#in#figure#1.4#below.####Figure%1.4.%NMDAR2dependent%LTD%induction%and%expression.#NMDAR#activation#allows#Ca2+#entry#into#the#postsynaptic#compartment,#which#activates#calcineurin,#a#protein#phosphatase.#Calcineurin#activation#leads# to# the# activation# of# protein# phosphatase# 1# (PP1),# which# dephosphorylates# various# substrates#including# the#GluA1#subunit#of#AMPARs#and#GSK3,#which#may# lead# to#AMPAR# internalization.#PP1#also#dephosphorylates# PSDX95,# which# may# result# in# structural# changes# associated# with# LTD,# allowing# for#AMPAR# internalization# and# spine# shrinkage.# CaspaseX3# is# important# for# LTDXassociated# synapse#elimination#and#is#activated#through#a#cytochromeXc,#caspaseX9#cascade.#Downstream#signaling#molecules#are#activated#that#translocate#to#the#nucleus#to#initiate#de'novo#protein#synthesis#for#longXterm#maintenance#of#LTD.###! 17!There#has#been#much#debate#as#to#the#importance#of#specific#AMPAR#subunits#for#LTD.#The#GluA2#subunit#was#first#implicated#in#hippocampal#LTD#expression.#Studies#showed#a#correlation#between#GluA2#S880#phosphorylation#and#AMPAR#internalization,#increased#phosphorylation#of#GluA2#S880#following#LTD,#and#impaired#LTD#with#overexpression#of#GluA2#phosphorylation#mutants#(Kim#et#al.,#2001;#Seidenman#et#al.,#2003;#Shi#et#al.,#2001).#However,#in#opposition#to#this,#mice#lacking#both#GluA2#and#GluA3#subunits#have#normal#LTD#(Meng#et#al.,#2003),#indicating#GluA2#is#not#required#for#LTD.#Phosphorylation#of#the#GluA1#subunit#was#also#suggested#to#be#required#for#LTD#because#a#knockXin#mouse#having#GluA1#S845#replaced#with#alanine#did#not#show#LTDXmediated#plasticity#(Lee#et#al.,#2010).#However,#another#study#found#that#GluA1#knockout#mice#have#normal#LTD#(Selcher#et#al.,#2012).#It#now#seems#likely#that#no#specific#AMPAR#subunit#is#required#for#LTD#induction#because#LTD#was#normal#in#cells#with#all#endogenous#AMPARs#replaced#by#kainate#receptors#(Granger#&#Nicoll,#2014).##During#LTP,#increases#in#synapse#strength#results#from#increased#synaptic#AMPAR#insertion#and#increased#AMPARXmediated#synaptic#transmission,#which#coincide#with#structural#enhancement#of#dendritic#spines#and#increased#spine#number.#The#opposite#is#true#during#NMDARXLTD#in#the#hippocampus.#Using#2Xphoton#timeXlapse#imaging#of#hippocampal#CA1#neurons#during#LFS,#researchers#demonstrated#reductions#in#spine#volume#and#number#overtime#(Nagerl#et#al.,#2004;#Zhou#et#al.,#2004;#Shinoda#et#al.,#2010;#Bastrikova#et#al.,#2008).#Application#of#NMDAR#antagonists#resulted#in#blockage#of#these#structural#spine#changes,#indicating#the#importance#of#! 18!NMDARs#for#structural#as#well#as#functional#NMDARXLTD#expression#(Nagerl#et#al.,#2004;#Zhou#et#al.,#2004).#1.3.3%%In#Vivo%Correlates%of%LTP%and%LTD%%Memory#Formation#and#Synapse#Plasticity#Early#experiments#to#establish#a#connection#between#the#cellular#mechanisms#of#LTP#and#in'vivo#learning#and#memory#determined#the#importance#of#NMDA#receptor#function#in#memory#acquisition#and#retention.#Injection#of#APV,#an#NMDAR#antagonist,#into#the#ventricles#of#rats#before#the#introduction#of#a#water#maze#prevented#the#rats#from#learning#the#location#of#the#hidden#platform#(Morris#et#al.,#1986).#Additionally,#mice#lacking#the#obligatory#GluN1#subunit#of#NMDARs#in#the#hippocampus#were#deficient#in#the#ability#to#learn#a#water#maze#platform#location#and#LTP#was#inhibited#in#their#hippocampal#slice#cultures#(Tsien#et#al.,#1996).#These#types#of#experiments#were#only#correlative,#linking#LTP#to#memory#formation#through#their#shared#necessity#for#NMDAR#activation.##In#a#more#direct#approach,#experimenters#investigated#the#effect#of#in'vivo#LTP#induction#on#associative#learning#by#electrically#stimulating#the#Schaffer#Collateral#pathway#in#the#hippocampus#before#and#after#eyeXblink#conditioning#(Madronal#et#al.,#2007).#LTP#induction#before,#but#not#after,#conditioning#impeded#the#formation#of#an#associative#memory,#as#the#mice#showed#a#significantly#diminished#conditioned#response.#In#contrast#to#this,#contextual#fear#learning#blocked#in'vivo#LTP#induction#of#the#Schaffer#Collateral#pathway#(Whitlock#et#al.,#2006).##A#growing#body#of#evidence#now#supports#that#memory#formation#and#LTP#involve#similar#molecular#pathways#and#cellular#expression#mechanisms.##! 19!# More#recently,#researchers#have#been#discovering#a#role#for#LTD#in#learning#and#memory.##Interference#with#the#NMDAR#subunit#GluN2B#expression,#through#genetic#knockout,#or#function,#through#chemical#antagonism#(using#the#GluN2BXspecific#antagonist#Ro25X6981),#blocks#NMDARXdependent#hippocampal#LTD#and#impairs#spatial#memory#consolidation#(Brigman#et#al.,#2010;#Ge#et#al.,#2010).#Likewise,#impairing#downstream#signaling#proteins#can#block#both#memory#formation#and#hippocampal#LTD.#Conditional#knockout#of#calcineurin#impaired#both#LTD#of#CA1#synapses#and#episodic#memory#formation#in#mice#(Zeng#et#al.,#2001).## An#important#aspect#of#learning#and#memory#is#our#ability#to#forget#irrelevant,#old,#or#incorrect#information#to#allow#space#for#new#and#more#accurate#memories.#LTD#may#have#an#important#role#in#neural#circuit#flexibility#by#weakening#unused#synapses#or#those#previously#potentiated#(referred#to#as#depotentiation).#This#can#be#investigated#through#reversal#learning#in#a#Morris#water#maze#(MWM),#in#which#animals#are#forced#to#learn#the#new#location#of#a#hidden#platform#after#previously#establishing#its#place#in#a#different#location.#Rats#injected#with#Ro25X6981,#inhibiting#NMDARs,#prior#to#reversal#learning#trials#of#the#MWM#were#significantly#impaired#in#learning#the#new#location#compared#to#control#rats#(Dong#et#al.,#2013).#As#AMPAR#endocytosis#is#associated#with#LTD#expression#in'vitro,#rats#were#tested#with#the#MWM#reversal#learning#task#after#AMPAR#endocytosis#was#prevented#by#administering#TatXGluR23y#peptide#(Dong#et#al.,#2013).#After#this#treatment,#rats#were#significantly#impaired#in#learning#the#new#platform#location.#Furthermore,#blocking#the#action#of#protein#phosphatase#2A,#a#component#of#LTD#signaling,#diminished#in'vivo#LTD#expression#and#inhibited#reversal#learning#(Nicholls#et#al.,#2008).##########! 20!LTD#and#Developmental#Synapse#Pruning#There#are#many#similarities#between#studies#of#synapse#elimination,#which#is#important#for#developmental#pruning#of#extraneous#synapses,#and#activityXmediated#LTD.#For#example,#NMDARXLTD#involves#activation#of#calcineurin#(Collingridge#et#al.,#2010),#which#is#required#for#MEFX2Xmediated#synapse#elimination#and#MEFX2#requires#activityXdependent#activation#to#induce#synapse#elimination#(Flavell#et#al.,#2006).#Furthermore,#LTDXinducing#stimulation#results#in#synapse#elimination#in#adult#and#developing#neurons#(Nagerl#et#al.,#2004;#Zhou#et#al.,#2004;#Shinoda#et#al.,#2010).#One#in'vivo#study#looked#at#the#connection#between#LTD#and#ocular#dominance#column#development.#Normally,#monocular#deprivation#induces#synaptic#depression#and#reduced#responsiveness#to#inputs#from#the#deprived#eye.#However,#blocking#GluA2Xdependent#AMPAR#endocytosis#with#G2CT#peptide#concurrently#with#monocular#deprivation#inhibits#the#synaptic#depression#effect,#indicating#LTDXmediated#mechanisms#may#play#a#role#in#development#of#ocular#dominance#(Yoon#et#al.,#2009).#Although#there#are#few#direct#studies#implicating#LTD#in#developmental#synapse#pruning#in'vivo,#it#remains#likely#that#LTD#is#one#possible#mechanism#for#selecting#those#synapses#that#need#to#be#eliminated#during#development.#%1.4%%Semaphorins%%1.4.1%%Overview%of%the%Semaphorin%Protein%Family%%# The#semaphorins#are#a#large#family#of#proteins#consisting#of#transmembrane,#secreted,#and#glycosylphosphatidylinositol#(GPI)Xanchored#forms#all#containing#an#extracellular#aminoXterminal#cysteineXrich#Semaphorin#(Sema)#protein#domain#of#approximately#500#amino#acids#that#is#highly#conserved#across#diverse#phyla#(Kolodkin#! 21!et#al.,#1993;#Semaphorin#Nomenclature#Committee,#1999).#The#first#semaphorin#was#isolated#from#grasshoppers#and#originally#named#fasciclin#IV#(Kolodkin#et#al.,#1992).#Since#then,#more#than#twenty#types#of#semaphorins#have#been#isolated#from#vertebrates#alone#and#naming#conventions#were#required#to#organize#the#field#(Yazdani#&#Terman,#2006;#Semaphorin#Nomenclature#Committee,#1999).#There#are#eight#different#subfamilies,#five#of#which#are#in#vertebrates#(Semaphorin#Classes#3#through#7,#except#Sema5c#(Rollmann#et#al.,#2007)),#distinguished#by#their#extracellular#motifs,#type#of#membrane#association,#and#phylogenetic#relationships##(Semaphorin#Nomenclature#Committee,#1999;#Figure#1.5).#The#conserved#Sema#domain#is#important#for#interactions#with#binding#partners#such#as#members#of#the#plexin#family#(Tamagnone#et#al.,#1999)#and#is#critical#for#mediating#diverse#semaphorin#functions#(Koppel#et#al.,#1997;#Eickholt#et#al.,#1997;#Oster#et#al.,#2003).#All#vertebrate#semaphorins#also#have#an#extracellular#plexinXsemaphorinXintegrin#(PSI)#domain,#also#known#as#a#cysteineXrich#domain#(CRD),#which#is#highly#conserved#in#structure#but#can#vary#in#location#relative#to#the#Sema#domain#(Yazdani#&#Terman,#2006).#In#addition#to#the#Sema#and#PSI#domains,#different#classes#of#semaphorins#may#have#immunoglobulinXlike#(Ig)#domains#or#typeX1#thrombospondin#repeats#(TSRs)#in#their#extracellular#portion,#which#are#important#for#mediating#their#effects.#For#example#the#TSR#domain,#interacting#with#different#coXreceptors,#confers#bidirectionality#to#Sema5A#signaling#in#the#developing#brain#(Kantor#et#al.,#2004).##! 22!#Figure%1.5.%The%Semaphorin%family%of%proteins.#There#are#8#classes#of#semaphorins,#distinguished#by#their#extracellular#motifs,#type#of#membrane#association,#and#phylogenetic#relationships:#Classes#1#and#2#are#found#in#invertebrates,#Classes#3#through#7#(except#Sema5c)#are#found#in#vertebrates,#and#Class#V#are#viral# semaphorins.#All# semaphorins#have#an#extracellular#Sema#domain# important# for# interactions#with#binding#partners.#Vertebrate#semaphorins#have#an#extracellular#cysteineXrich#domain#(CRD),#also#known#as#a#plexinXsemaphorinXintegrin#(PSI)#domain,#which#is#highly#conserved#but#varies#in#location#relative#to#the# Sema# domain.# Semaphorins# can# be# secreted,# transmembrane,# or# GPIXanchored# (GPI,#glycosylphosphatidylinositol)#(Adapted#with#permission#from#Gherardi#et#al.,#2004).### Semaphorins#have#been#identified#in#diverse#species#including#nematode#worms,#insects,#vertebrates#and#viruses#(Kolodkin,#et#al.,#1993;#Ginzburg,#Roy,#&#Culotti,#2002).#As#a#group,#they#are#widely#expressed#throughout#the#body#including#the#nervous,#cardiovascular,#immune,#renal,#musculoskeletal,#respiratory,#and#reproductive#systems;#however,#expression#varies#depending#on#developmental#stage#(Adams,#Betz#&#Püschel,#1996;#Nakagawa#et#al.,#2011;#Püschel,#Adams#&#Betz,#1995;#Qu#et#al.,#2002).##%%%! 23!1.4.2%%Binding%Partners%of%Semaphorins%# Semaphorins#mediate#their#diverse#signaling#functions#through#interactions#with#various#binding#partners#(Figure#1.6).#Plexins#are#the#main#receptor#for#semaphorins#and#have#been#shown#to#bind#directly#to#all#classes#of#semaphorins#except#class#2#semaphorins#(Negishi#et#al.,#2005).#The#four#classes#of#plexins#(PlexA1X4,#PlexB1X3,#PlexC1,#PlexD1)#all#contain#an#extracellular#Sema#domain#that#is#important#for#their#interactions#with#semaphorins#(Gherardi#et#al.,#2004).#A#wellXcharacterized#semaphorinXplexin#signaling#cascade#is#Sema4DXPlexB1#mediated#axon#guidance#repulsion,#in#which#PlexB1#acts#as#a#GTPaseXactivating#protein#(GAP;#Oinuma#et#al.,#2004).#However,#the#various#classes#of#semaphorins#and#the#range#of#semaphorin#functions#may#be#reflected#in#a#diversity#of#signaling#cascades,#as#many#other#molecules#have#been#identified#in#semaphorin#signaling#pathways#(reviewed#in:#Castellani#&#Rougon,#2002;#Negishi#et#al.,#2005;#Yazdane#&Termen,#2006).###! 24!#Figure%1.6.%Binding%partners%of%semaphorins.#Members#of#the#plexin#family#of#receptors#are#divided#into#four#classes#(A,#B,#C,#and#D).#All#plexins#have#an#extracellular#Sema#domain#and#are#known#to#bind#all#classes#of#vertebrate#semaphorins.#Neurophilins#are#known#coXreceptors#for#secreted#class#3#semaphorins.#Class#4#semaphorins#bind#immune#system#associated#proteins#such#as#TimX2,#expressed#on#activated#TXcells,#and#CD72# (Sema,# semaphorin;# PSI,# plexinXsemaphorinXintegrin;# IPT,# immunoglobulinXlike# fold# shared# by#plexins# and# transcription# factors;# GAP,# GTPaseXactivating# protein;# MAM,# Meprin,# A5,# Mu;# PMR,#polymorphic#region;#ITIM,#immunoreceptor#tyrosineXbased#inhibitory#motif;#IgV,#immunoglobulin#variable#region;#Adapted#with#permission#from#Yazdani#&#Terman,#2006).###### In#addition#to#plexins,#semaphorins#have#a#variety#of#binding#partners.#CD72#and#TimX2#act#as#immune#system#receptors#for#class#4#semaphorins#(Kumanogoh#et#al.,#2000;#Kumanogoh#et#al.,#2002).#Class#5#semaphorins#interact#with#heparan#and#chondroitin#sulfate#proteoglycans,#which#mediate#the#bidirectionality#of#semaphorin#function#but#require#an#unknown#coXreceptor#(Kantor#et#al.,#2004).#Secreted#class#3#semaphorins#bind#neurophilins#(Npn)#in#addition#to#plexins.#NpnX1#and#NpnX2#are#transmembrane#receptors#with#a#short#cytoplasmic#domain#that#cannot#mediate#Sema3#! 25!signaling#alone,#requiring#additional#binding#with#plexins#to#initiate#intracellular#signaling#(Huber#et#al.,#2003).#Furthermore,#it#is#possible#that#additional#receptors#for#semaphorins#have#yet#to#be#identified,#as#many#semaphorin#signaling#pathways#remain#unclear.###1.4.3%%Functions%of%Semaphorins%in%the%Nervous%System%%Semaphorins#were#originally#identified#as#repellant#axon#guidance#cues#(Kolodkin#et#al.,#1993;#Semaphorin#Nomenclature#Committee,#1999);#however,#a#diversity#of#functions#has#since#been#discovered.#Recent#evidence#indicates#they#are#also#involved#in#neuronal#polarization#(Shelly#et#al.,#2011),#dendritic#morphology#(Matsuoka#et#al.,#2011;#Ng#et#al.,#2013),#synapse#plasticity#(Bouzioukh#et#al.,#2006;#O’Connor#et#al,#2009;#Paradis#et#al.,#2007;#Sahay#et#al.,#2005;#Uesaka#et#al.,#2014),#cell#proliferation#(BenXZvi#et#al.,#2006),#cell#migration#(Artigiani#et#al.,#2004;#Law#&#Lee,#2012),#angiogenesis#(Neufeld#et#al.,#2012),#and#disease#pathogenesis#(Gras#et#al.,#2014;#Law#&#Lee,#2012;#Pasterkamp#&#Giger,#2009;#Purohit#et#al.,#2014)#in#multiple#organ#systems.#This#thesis#will#focus#on#semaphorin#functions#in#the#nervous#system.##Axon#Pathfinding## Secreted#class#3#semaphorins#are#the#canonical#semaphorin#axon#guidance#molecule#and#their#functions#in#axon#repulsion#are#well#characterized.#Sema3A#inhibits#axon#outgrowth#in#many#in'vitro#embryonic#systems#including:#dorsal#root#ganglion#(DRG)#cells#(Luo#et#al.,#1993),#sympathetic#ganglion#cells#(Koppel#et#al.,#1997),#motoneurons#(VarelaXEchavarria#et#al.,#1997),#cerebellar#mossy#fibers#(Rabacchi#et#al.,#1999)#and#hippocampal#cells#(Chedotal#et#al.,#1998).#Class#3#semaphorins#can#also#influence#axon#outgrowth#permissively#by#Sema3B#and#Sema3C#inhibitory#action#on#! 26!Sema3A#signaling#through#competitive#antagonism#for#the#neurophilin#receptor#(Takahashi#et#al.,#1998).#Class#5#semaphorins#are#also#involved#in#axon#guidance#during#development#and#their#functions#will#be#discussed#in#more#detail#in#a#following#section#(Section#1.4.6).###Dendritic#Arborization#Another#important#aspect#of#neuronal#development#is#dendritic#arborization#as#the#complexity#of#the#dendritic#arbor#determines#many#aspects#of#neuron#function#and,#in#highly#stratified#areas#of#the#CNS,#can#function#in#itself#to#impose#the#proper#network#connections#(Jan#&#Jan,#2010).#In#cultured#hippocampal#neurons,#Sema3A#promotes#dendrite#growth#and#suppresses#axon#growth,#resulting#in#axon#development#away#from#the#Sema3A#location#and#functionally#polarizing#developing#neurons#(Shelly#et#al.,#2011).#Furthermore,#class#3#semaphorins,#acting#through#neurophilin#1#and#2#receptors,#promote#dendrite#growth#and#branching#in#newborn#neurons#of#adult#brains#(Ng#et#al.,#2013).#In#retinal#development,#Sema6A#signaling#through#PlexinXA4#functions#to#restrict#dendritic#arborization#within#proper#lamina#of#the#inner#plexiform#layer#(Matsuoka#et#al.,#2011)#and#class#5#semaphorin#signaling#is#important#for#dendrite#arborization#of#retinal#ganglion#cells#(RGCs;#Matsuoka#et#al.,#2011).##Synapse#Development#and#Plasticity## The#role#of#semaphorins#in#synapse#formation#and#elimination#during#development#and#in#adulthood#has#been#only#recently#studied.#During#development#of#the#cerebral#cortex#and#hippocampus,#secreted#Sema3F#inhibits#excitatory#but#not#inhibitory#synapse#formation,#influencing#excitationXinhibition#balance#(Tran#et#al.,#2008).#Additionally,#Sema3F#influences#the#location#of#synapse#formation#by#specifically#! 27!constraining#apical#dendritic#spine#density#and#not#spine#density#of#basal#dendrites#on#the#same#neurons#(Tran#et#al.,#2008).#Class#4#semaphorins#can#also#influence#synapse#development.#Knockdown#of#Sema4B#in#cultured#hippocampal#neurons#decreases#both#excitatory#and#inhibitory#synapse#density;#whereas,#knockdown#of#Sema4D#decreases#only#inhibitory#synapse#density#(Paradis#et#al.,#2007).##Semaphorins#are#localized#and#function#at#synapses#in#the#adult#nervous#system#as#well#as#during#development.#Class#4#and#5#semaphorins#have#been#shown#to#localize#to#postsynaptic#membranes#in#adult#cortical#and#postnatal#hippocampal#neurons#(Burkhardt#et#al.,#2005;#Inagaki#et#al.,#2001;#Schultze#et#al.,#2001;#Duan#et#al.,#2014).#Sema5B#mediates#the#elimination#of#mature#synapses#in#hippocampal#cultures#(O’Connor#et#al,#2009).#Class#3#semaphorins#have#been#shown#to#function#in#synapse#plasticity#in#the#hippocampus#and#cerebellum.#In#hippocampal#slices#from#adult#mice,#bath#application#of#Sema3F#increased#the#frequency#and#amplitude#of#AMPAR#currents#(mEPSCs)#of#dentate#granule#cells#and#increased#the#frequency,#but#not#amplitude,#of#mEPSCs#in#CA1#neurons#(Sahay#et#al.,#2005).#Sema3A#bath#application#causes#a#doseXdependent#decrease#in#the#strength#of#CA1#EPSPs#but#does#not#affect#presynaptic#excitability#or#release#probability#(Bouzioukh#et#al.,#2006).#In#early#postnatal#development#of#the#cerebellum,#when#elimination#of#extraneous#synapses#occurs,#Sema3A#maintains#or#strengthens#synapses#as#knockdown#of#Sema3A#resulted#in#increased#synapse#elimination#and#decreased#strength#of#excitatory#transmission#(Uesaka#et#al.,#2014).#In#contrast,#during#later#postnatal#development,#knockdown#of#Sema7A#increased#the#number#of#climbing#fibers#that#innervate#Purkinje#cells#and#there#was#no#change#in#synaptic#transmission#(Uesaka#et#al.,#2014).#This#indicates#that#! 28!Sema3A#and#Sema7A#oppose#and#enhance#synapse#elimination#in#the#cerebellum,#respectively.#1.4.4%%Class%5%Semaphorins%Vertebrate#class#5#semaphorins#(Sema5A#and#Sema5B)#are#transmembrane#proteins#distinguished#from#other#semaphorins#by#seven#typeX1#thrombospondin#repeats#(TSRs)#in#their#extracellular#domain#on#the#cXterminal#end#of#the#conserved#Sema#domain#(Adams,#Betz#&#Püschel,#1996).#The#initial#discovery#and#description#of#Sema5A#and#Sema5B#revealed#that#these#proteins#are#72%#similar#and#58%#identical#in#amino#acid#sequence,#having#1077#and#1093#amino#acids,#respectively#(Adams,#Betz#&#Püschel,#1996).#They#are#most#similar#in#their#Sema#domains#and#more#divergent#in#their#cytoplasmic#regions#(Adams,#Betz#&#Püschel,#1996).##Class#5#semaphorins#are#expressed#throughout#development#in#various#vertebrate#species.#Sema5A#and#Sema5B#are#expressed#in#differential#amounts#during#murine#embryonic#development#from#E10#to#birth#(Adams,#Betz#&#Püschel,#1996).#Sema5A#and#Sema5B#expression#patterns#are#nonXoverlapping#in#both#embryonic#mouse#and#chick#spinal#cord#(Masuda#et#al.,#2014).#Additionally,#Sema5A#expression#has#been#detected#in#various#adult#organs#including#muscle,#heart,#lung,#spleen,#kidney,#liver#and#brain;#however,#the#same#study#found#Sema5B#expression#exclusively#in#adult#brain#tissue#(Adams,#Betz#&#Püschel.,#1996).##1.4.5%%Receptors%of%Class%5%Semaphorins%Various#receptors#for#Sema5A#and#Sema5B#have#been#proposed.#NrpX2#and#PlexB3#are#coXexpressed#with#Sema5A#at#many#developmental#stages#and#in#organs#such#as#brain,#lung,#and#spleen#(Artigiani#et#al.,#2004;#Sadanandam#et#al.,#2008).#The#! 29!Sema5AXPlexB3#interaction#is#functional#as#it#promotes#a#collapsing#response#in#fibroblasts#in'vitro#(Artigiani#et#al.,#2004).#Furthermore,#endothelial#cell#proliferation#and#migration#may#be#promoted#through#Sema5AXPlexB3#interactions#(Sadanandam#et#al.,#2010)#In#zebrafish#motor#neuron#development,#PlexA3#and#Sema5A#have#complementary#expression#patterns#and#their#interaction#could#mediate#Sema5A#function#(Hilario#et#al.,#2009).#Sema5A#and#Sema5B#repulsive#activity#in#RGC#neurite#development#may#be#mediated#through#PlexA1#or#PlexA3#(Matsuoka#et#al.,#2011).#The#many#different#receptors#so#far#identified#may#serve#to#alter#the#response#to#Sema5A#and#Sema5B#in#order#to#confer#spatial#and#temporal#signaling#specificity.##1.4.6%%Functions%of%Class%5%Semaphorins%Axon#Guidance## The#role#of#class#5#semaphorins#in#axon#guidance#has#been#studied#in#both#in'vitro#and#in'vivo#preparations#of#various#model#systems.#Sema5B#was#found#to#act#as#a#repellant#axon#guidance#cue.#Exogenous#Sema5B#expressed#by#HEK293#cells#is#sufficient#to#reduce#axon#growth#from#dissociated#chick#dorsal#root#ganglia#(DRG)#cells#by#more#than#one#third#(Liu#et#al.,#2014).#Supporting#this#finding,#in'vivo#shRNAXmediated#knockdown#of#Sema5B#in#the#spinal#cord#during#embryonic#development#results#in#aberrant#targeting#of#sensory#neuron#axons#past#dorsal#horn#grey#matter#to#ventricular#zone#sites#(Liu#et#al.,#2014).#Likewise,#Sema5B#acts#as#a#repulsive#axon#guidance#cue#in#CNS#development.#Corticofugal#axons,#in#organotypic#culture,#were#impeded#from#growing#towards#areas#with#cells#expressing#exogenous#Sema5B#but#not#towards#control#cells#(Lett,#Wang#&#O’Connor,#2009).#! 30!Sema5A#can#act#as#a#permissive#or#repellant#guidance#cue#depending#on#the#environment.#In#the#mammalian#retina,#Sema5A#promotes#growth#cone#collapse#during#embryonic#development#of#RGCs#(Oster#et#al.,#2003)#and#reduces#mature#RGC#axon#outgrowth#in'vitro#(Goldberg#et#al.,#2004).#Researchers#further#determined#that#the#Sema#domain#was#required#to#induce#growth#cone#collapse;#however,#the#full#extracellular#domain#provided#optimal#ability#for#promoting#axon#collapse#(Oster#et#al,#2003).#Interfering#with#Sema5A#function#by#intraocular#injections#of#Sema5A#antibodies#during#embryonic#development#results#in#RGC#axons#straying#away#from#the#correct#pathway,#perturbing#formation#of#the#optic#nerve#(Oster#et#al.,#2003).##In#zebrafish#motor#axon#development,#Sema5A#acts#as#a#bifunctional#guidance#cue.#The#thrombospondin#repeat#(TSR)#domain#functions#to#promote#axon#outgrowth#into#the#ventral#myotome#(Hilario#et#al.,#2009).#In#contrast,#the#Sema#domain#is#required#for#repulsive#action#to#prevent#axon#branching#and#maintain#the#axon#along#its#defined#pathway#(Hilario#et#al.,#2009).#In#sensory#axon#guidance,#Sema5A#was#also#discovered#to#act#as#a#bifunctional#cue#depending#on#its#location.#When#abnormally#expressed#in#the#chick#embryonic#spinal#cord,#Sema5A#induced#aberrant#exiting#of#axons#from#the#DRG#towards#its#location,#acting#as#an#attractive#cue#(Masuda#et#al.,#2014).#When#it#is#normally#expressed#surrounding#the#efferent#pathway#of#DRG#neurons,#it#therefore#functions#to#promote#pathway#extension.#On#the#other#hand,#it#is#also#expressed#around#the#notochord,#an#area#the#DRG#axons#do#not#enter,#acting#as#a#repellant#cue#(Masuda#et#al.,#2014).#This#bifunctional#nature#of#Sema5A#was#likewise#shown#in#the#developing#rat#midbrain#where#interactions#between#the#TSR#domain#of#Sema5A#and#two#coXreceptors,#chondroitin#sulfate#proteoglycan#(CSPG)#and#heparan#sulfate#proteoglycan#(HSPG)#were#! 31!shown#to#determine#whether#Sema5A#acts#as#a#permissive#or#repellent#cue#(Kantor#et#al.,#2004).#CSPGs#mediate#the#inhibitory#action#of#Sema5A;#whereas,#interaction#with#HSPGs#provides#an#attractive#cue#for#axon#guidance.####Circuit#Development##In#addition#to#axon#outgrowth#and#pathfinding,#class#5#semaphorins#function#in#neural#circuit#development#by#restricting#dendrite#arborization#within#specific#layers.#For#example,#class#5#semaphorins#are#important#for#proper#lamination#during#retinal#development.#Dendrite#outgrowth#from#retinal#ganglion#cells#(RGCs)#and#amacrine#cells#in#cocultures#with#HEK293#cells#expressing#Sema5A#or#Sema5B#was#decreased#by#approximately#50#percent#(Matsuoka#et#al.,#2011).#This#finding#is#consistent#with#in'vivo#results#where#mice#lacking#both#Sema5A#and#Sema5B#display#aberrant#neural#connectivity#of#RGCs,#amacrine#cells#and#bipolar#cells#and#abnormally#increased#spontaneous#activity#of#RGCs#(Matsuoka#et#al.,#2011).#This#suggests#dysfunctional#development#of#circuits#can#lead#to#decreased#inhibition#and#abnormal#circuit#activity.###Synapse#Plasticity## The#activities#of#semaphorins#at#synapses#are#just#beginning#to#be#explored,#especially#those#of#the#class#5#semaphorins.#In#primary#hippocampal#cultures,#Sema5B#overexpression#decreases#synapse#density;#whereas,#reducing#Sema5B#expression#through#shRNAXmediated#knockdown#increases#synapse#density#(O’Connor#et#al.,#2009).#With#timeXlapse#imaging,#this#reduction#in#synapse#density#was#determined#to#be#due#to#elimination#of#existing#synapses#rather#than#a#decreased#amount#of#synapse#formation#(O’Connor#et#al.,#2009).#Similarly,#mice#lacking#Sema5A#in#dentate#granule#cells#of#the#hippocampus#had#increased#spine#density#and#excitatory#but#not#inhibitory#synapse#! 32!density,#indicating#that#Sema5A#inhibits#excitatory#synapse#formation#(Duan#et#al.,#2014).#Interestingly,#in#this#same#study,#Sema5B#knockout#mice#had#similar#granule#cell#spine#density#as#controls.##%1.4.7%%Sema5A%and%Autism%Autism#Spectrum#Disorder#(ASD)#is#defined#in#the#Diagnostic#and#Statistical#Manual#of#Mental#Disorders#(DSMX5;#American#Psychiatric#Association,#2013)#as#a#neurodevelopmental#disorder#characterized#by#impaired#social#communication#and#interaction#and#the#presence#of#repetitive#behaviours.#It#is#a#growing#public#health#concern#as#approximately#1#in#68#children#are#diagnosed#with#the#disorder#(Autism#and#Developmental#Disabilities#Monitoring#Network,#2014)#and#the#prevalence#is#increasing#while#the#causes#and#treatments#remain#unclear#(Schmitz#&#Rezaie,#2008;#Won,#Mah#&#Kim,#2013).###Twin#studies#highlight#the#importance#of#genetics#in#the#etiology#of#ASD,#as#monozygotic#twins#are#much#more#likely#than#dizygotic#twins#to#both#have#an#ASD#diagnosis#(Bailey#et#al.,#1995;#Folstein#&#Rutter,#1977;#Steffenburg#et#al.,#1989).#In#addition,#evidence#from#several#genomeXwide#studies#indicates#multiple#gene#loci#are#associated#with#ASD#(International#Molecular#Genetic#Study#of#Autism#Consortium,#2001;#Philippe#et#al.,#1999;#Risch#et#al.,#1999)#and#to#date,#various#genes#have#been#linked#to#ASD#(Won,#Mah#&#Kim,#2013).#One#study#estimated#that#genetic#variation#accounts#for#60%#of#the#variation#in#ASD#risk,#a#substantial#proportion#(Gaugler#et#al.,#2014).#However,#although#ASD#is#highly#heritable,#the#known#susceptibility#genes#account#for#only#a#small#proportion#of#the#risk#(Won,#Mah#&#Kim,#2013).##! 33!Recently,#Sema5A#has#been#geneticallyXlinked#to#the#development#of#ASD.#In#a#genomeXwide#linkage#and#association#study#of#more#than#1500#affected#members#of#families#with#autism,#a#singleXnucleotide#polymorphism#(SNP)#near#the#Sema5A#gene#was#associated#with#ASD#susceptibility#(Weiss#et#al.,#2009).#A#followXup#study#showed#overlap#between#Sema5A#associated#regulatory#genes#and#rare#SNPs#and#copyXnumber#variations#(CNVs)#associated#with#previous#autism#candidate#genes#(Cheng#et#al.,#2013).#Furthermore,#two#studies#show#that#Sema5A#gene#expression#is#downXregulated#in#brain#tissue#(Weiss#et#al.,#2009)#and#blood#(Melin#et#al.,#2006)#of#people#with#autism,#which#strengthens#the#association#between#Sema5A#and#ASD.############1.5%%Overall%Objective%%# The#overall#objective#of#the#study#is#to#investigate#the#impact#of#activity#on#Sema5A#expression#and#localization#and#whether#Sema5A#mediates#activityXdependent#synapse#elimination.##1.6%%Hypothesis%#We#hypothesize#that#LTD#induces#synapse#elimination#through#regulation#of#the#expression#and#localization#of#Sema5A.#%%# #! 34!CHAPTER%2:%MATERIALS%AND%METHODS%2.1%%DNA%Constructs%SEPXGluA1#was#obtained#from#Addgene#(24000)#and#originally#developed#by#Dr.#Roberto#Malinow#(University#of#California,#San#Diego,#CA).#PSDX95XRFP#was#a#kind#gift#from#Dr.#David#Bredt#(University#of#California,#San#Diego,#CA).#Class#5#semaphorin#constructs#(Human#Sema5AXHA,#Rat#Sema5AXHA,#Mouse#Sema5BXHA)#and#Sema5A#shRNA#were#kind#gifts#from#Dr.#Timothy#O’Connor#(University#of#British#Columbia#(UBC),#Vancouver,#Canada).#The#Sema5A#shRNA#was#designed#against#the#target#sequence:#5’XCACCCCGTCGTCTCCTACAX3’.#The#empty#shRNA#vector,#pLL3.7,#was#obtained#from#Addgene#(11795)#and#originally#developed#by#Dr.#Luk#Parijs.#Other#DNA#used#include:#GFP,#BFP,#and#DsRed.#2.2%%Hippocampal%Culture%and%Transfection%Primary#hippocampal#cultures#were#prepared#from#embryonic#day#18#(E18)#Sprague#Dawley#rats#as#previously#published#(Xie#et#al.,#2000).#Briefly,#Hippocampi#were#dissected,#incubated#for#20#min#with#0.25%#Trypsin#(Worthington)#and#dissociated#by#trituration.#Cells#were#plated#at#a#density#of#130#cells#per#mm2#on#coverslips#coated#with#polyXLXlysine#(Sigma)#in#minimum#essential#medium#(MEM;#Gibco)#supplemented#with#10%#(vol/vol)#heat#inactivatedXfetal#bovine#serum,#0.5%#glucose,#sodium#pyruvate#(Gibco),#GlutaMAX#(Gibco),#and#Pen/Strep#(Gibco).#Plating#media#was#switched#with#maintenance#media#(Neurobasal#medium#(Gibco)#supplemented#with#NeuroCult#SM1#(StemCell,#instead#of#B27#supplement),#GlutaMAX#(Gibco),#and#Pen/Strep#(Gibco))#3#hours#after#cells#were#plated.#Cultures#were#maintained#at#37°C#and#5%#CO2.#Neurons#were#transfected#at#9X11#days#in'vitro'(DIV)#! 35!using#Lipofectamine#2000#(Invitrogen)#following#the#manufacturer’s#protocol#and#used#for#experiments#at#12X15#DIV.#####2.3%%Neuronal%Stimulation%Neuronal#activity#was#enhanced#using#a#previously#described#chemical#LTP#(cLTP)#protocol#(Lu#et#al.,#2001).#Briefly,#maintenance#media#was#replaced#with#preXglycine#solution#composed#of#Mg2+Xfree#extracellular#solution#(Mg2+Xfree#ECS;#140mM#NaCl,#5.4mM#KCl,#1.3mM#CaCl2,#25mM#HEPES,#and#33mM#DXGlucose,#pH#7.35)#supplemented#with#0.5μM#Tetrodotoxin#(TTX;#Alamone#Labs)#and#20μM#Bicuculline#methiodide#(Fluka#BioChemika)#and#cells#were#incubated#for#20#minutes.#Fresh#preXglycine#solution#supplemented#with#200μM#glycine#(Roche)#was#then#added#for#3#min#to#stimulate#LTP.#Cells#were#washed#once#with#the#preXglycine#solution#then#imaged#or#incubated#(at#37°C#and#5%#CO2)#for#the#indicated#amount#of#time#prior#to#experimentation.#Media#of#controls#was#changed#the#same#number#of#times#as#experimental#groups#but#no#glycine#was#added.##Neuronal#activity#was#decreased#using#a#previously#described#chemical#LTD#(cLTD)#protocol#(Lee#et#al.,#1998).#Briefly,#cells#were#washed#with#Mg2+Xfree#ECS#twice#then#incubated#in#Mg2+Xfree#ECS#supplemented#with#20μM#NMDA#(Abcam)#and#10μM#glycine#(Roche)#for#3#min#to#stimulate#LTD.#Cells#were#washed#once#with#fresh#Mg2+Xfree#ECS#and#then#imaged#or#incubated#(at#37°C#and#5%#CO2)#for#the#indicated#amount#of#time#in#ECS#containing#2mM#MgCl2.#Like#in#cLTP,#control#cell#media#was#changed#according#to#the#protocol#for#experimental#groups#but#no#NMDA#or#glycine#was#added.##%%! 36!2.4%%Immunohistochemistry%Neurons#were#fixed#in#4%#paraformaldehyde#(PFA)#with#4%#sucrose#in#phosphate#buffered#saline#(PBS;#137mM#NaCl,#2.7mM#KCl,#4.3mM#Na2HPO4,#1.4mM#KH2PO4#in#H20)#for#10#min,#followed#by#permeabilization#in#0.1%#TritonXX#100#for#10#min.#A#blocking#solution#of#10%#goat#serum#in#PBS#was#applied#for#1#hour#at#room#temperature#to#prevent#unspecific#antibody#binding.#Primary#and#secondary#antibodies#were#diluted#in#PBS#with#1%#goat#serum#and#incubated#overnight#at#4°C#or#for#1#hour#at#room#temperature#respectively.#Primary#antibodies#used:#mouse#antiXPSDX95#(Abcam),#guinea#pig#antiXVGlut1#(Millipore),#and#rabbit#antiXHA#(Cell#Signaling#Technology).#Secondary#antibodies#used:#Alexa#633X,#Alexa#568X,#Alexa#405Xconjugated#goat#antiXmouse,#antiXguinea#pig,#or#antiXrabbit#(Life#Technologies).#Cells#were#washed#3#times#with#PBS#for#10#minutes#each#following#primary#and#secondary#antibody#incubations,#then#coverslips#were#mounted#on#microscope#slides#with#ProLong#Gold#(Molecular#Probes).#2.5%%Image%Acquisition%# All#neurons#were#imaged#using#an#Olympus#Fluoview#1000#inverted#confocal#microscope#(60x/1.4#Oil#PlanXApochromat).#When#imaging#fixed#cells,#the#acquisition#parameters#were#set#on#control#group#cells#and#maintained#for#neurons#across#all#experimental#groups.#For#imaging#of#SEPXGluA1#and#Sema5AXSEP#membrane#insertion,#acquisition#parameters#were#set#for#the#baseline#image#of#individual#cells#to#account#for#differences#in#SEPXGluA1/Sema5AXSEP#expression#and#maintained#across#all#subsequent#time#points.##%! 37!2.6%%Image%Analysis%and%Quantification%2.6.1%%cLTD%Validation%At#10#DIV,#neurons#were#transfected#with#SEPXGluA1#and#DsRed.#Cells#were#live#imaged#at#37°C#at#13X14#DIV,#immediately#after#(0#min)#and#5,#10,#20,#40,#60#minutes#after#cLTD#stimulation.#For#each#cell,#Adobe#Photoshop#was#used#to#make#a#mask#of#the#inXfocus#dendrites#on#the#DsRed#channel.#This#mask#was#overlaid#onto#the#SEPXGluA1#channel#to#define#the#area#of#analysis.##A#threshold#for#SEPXGluA1#puncta#was#determined#on#the#0#minute#picture#using#Image#J#and#this#threshold#was#used#to#analyze#SEPXGluA1#images#at#all#timepoints.#Image#J#was#used#to#determine#puncta#density#of#SEPXGluA1#on#thresholded#images#at#all#timepoints.#After#we#determined#that#the#decrease#in#puncta#density#was#significant#at#60#min#post#cLTD#stimulation,#we#calculated#the#change#in#integrated#density#(IntDens;#the#product#of#area#and#mean#gray#value)#at#60#min#as#a#percentage#of#initial#SEPXGluA1#IntDens#for#each#cell.##2.6.2%%Sema5A2SEP%Validation%%To#validate#the#pHXdependent#fluorescence#changes#of#SEP#in#the#Sema5AXSEP#construct,#cells#were#transfected#with#Sema5AXSEP#and#DsRed.#At#13#DIV,#cells#were#live#imaged#at#37°C#in#Mg2+Xfree#ECS#to#obtain#a#baseline#picture#of#Sema5AXSEP#fluorescence.#Cells#were#then#treated#with#a#solution#containing#2X(NXmorpholino)ethanesulfonic#acid#(MES;#pH#5.2)#and#imaged.#Cells#were#washed#with#Mg2+Xfree#ECS#and#then#treated#with#a#solution#containing#NH4Cl#(pH#7.4)#before#subsequent#imaging.#For#the#solution#containing#NH4Cl,#Mg2+Xfree#ECS#was#used#with#50mM#NH4Cl#substituted#for#50mM#NaCl;#all#other#components#remained#the#same.#For#the#acidic#MES#solution,#the#HEPES#in#Mg2+Xfree#ECS#was#replaced#with#MES#and#all#! 38!other#components#remained#the#same.#For#both#solutions,#pH#was#adjusted#to#the#indicated#amount.#Cells#were#imaged#5#minutes#after#treatment#with#either#NH4Cl#or#MES#solution.##2.6.3%%RNA%Extraction%and%qPCR%%# At#15#DIV,#hippocampal#neurons#were#stimulated#to#induce#LTD#(or#LTP)#and#mRNA#was#collected#after#30,#120,#and#240#minutes.#Control#cells#were#not#stimulated#with#NMDA#(LTD)#or#glycine#(LTP).#Maintenance#media#was#removed#and#0.6#mL#Lysis#Buffer#with#1%#2Xmercaptoethanol#was#added.#This#was#pipetted#in#and#out#3#times#to#wash#over#the#cells#and#suspend#RNA#in#solution#before#it#was#collected.#Lysate#was#passed#through#a#26Xgauge#needle#6#times.#RNA#was#purified#with#the#PureLink#RNA#Mini#Kit#(Life#Technologies)#according#to#the#manufacturer’s#instructions.#cDNA#was#made#from#the#RNA#collected#with#the#Verso#cDNA#Synthesis#Kit#(Thermo#Scientific)#using#anchored#Oligo#dT#primers#and#200ng#of#template#RNA.#cDNA#synthesis#was#done#at#42°C#for#45#min#followed#by#2#minutes#of#inactivation#at#95°C.#RealXtime#quantitative#PCR#(qPCR)#amplification#and#analysis#was#performed#at#the#Biomedical#Research#Center#at#UBC#using#a#7900HT#RealXTime#PCR#thermocycler#machine#(Applied#Biosystems)#with#Sequence#Detection#Systems#software#(version#2.3).#The#TaqMan#Probe#master#mix#was#used#with#the#following#primers:#Rat#Sema5A#(forward:#5'–#AGAAGTGTCTGTGGCAAGATC#–3’;#reverse:#5'–#GCAGTAGGTGTAGACAAGCAG#–3’);#Rat#Sema5B#(forward:#5'–#AGGAGGCACTATGTGCTAC#–3’;#reverse:#5'–#GCAGGCAGGATGACAGGAAT#–3’);#Rat#GAPDH#(forward:#5'–#AACGACCCCTTCATTGAC#–#3’;#reverse:#5'#–#TCCACGACATACTCAGCAC#–#3’;#Tsankova,#et#al.,#2004).#Comparative#quantification#was#done#by#the#ΔΔCt#method#with#the#following#equation:#! 39!Ct#(Gene#of#Interest,#in#this#case#Sema5A#or#Sema5B)#–#Ct#(Normalizing#Gene,#in#this#case#GAPDH)#=#ΔCt#ΔCt#(Experimental#or#in#this#case#“With#Activity”)#–#ΔCt#(Calibrator#or#in#this#case#Control)#=#ΔΔCt#Relative#quantity#=#2XΔΔCt##2.6.4%%Live%Imaging%of%Sema5A2SEP%At#10X11#DIV,#neurons#were#coXtransfected#with#Sema5AXSEP,#PSDX95XRFP,#and#BFP.#Cells#were#live#imaged#at#37°C#at#12X14#DIV.#TimeXlapse#imaging#was#performed#immediately#following#LTD#stimulation#and#every#10#minutes#for#80#minutes.#For#each#cell,#Adobe#Photoshop#was#used#to#make#a#mask#of#the#inXfocus#dendrites,#excluding#the#cell#body,#on#the#BFP#channel.#This#mask#was#overlaid#onto#the#Sema5AXSEP#and#PSDX95XRFP#channels#to#define#the#area#of#analysis.#Image#analysis#was#done#in#MATLAB#(Mathworks).#Sema5AXSEP#mean#fluorescence#was#determined#for#each#cell#at#each#timepoint#and#normalized#to#the#0#timepoint#to#determine#change#in#fluorescence#relative#to#baseline.#To#analyze#Sema5AXSEP#mean#fluorescence#at#PSDX95XRFP#puncta,#the#PSDX95XRFP#puncta#that#were#visible#at#all#timepoints#were#identified#and#tracked#in#MATLAB.#These#puncta#were#used#to#make#a#mask#of#the#Sema5AXSEP#image#at#each#timepoint.#Mean#fluorescence#of#Sema5AXSEP#was#calculated#at#each#puncta#at#each#timepoint#and#normalized#to#the#average#fluorescence#of#all#the#puncta#for#that#cell#at#baseline.#We#also#used#the#mask#of#PSDX95XRFP#puncta#to#determine#the#mean#fluorescence#of#Sema5AXSEP#not#located#at#synapses#by#analyzing#the#area#on#the#Sema5AXSEP#image#outside#of#PSDX95XRFP#puncta.##2.6.5%%Synapse%Density%Experiments%For#Sema5A#and#Sema5B#overexpression#experiments,#cells#were#transfected#at#10#DIV#with#GFP#and#either#pDisplay#vector,#human#Sema5AXHA,#or#mouse#Sema5BXHA.#For#Sema5A#knockdown#experiments,#cells#were#transfected#at#10#DIV#as#follows:#! 40!control#–#pLL3.7#&#pDisplay;#knockdown#–#Sema5A#shRNA#&#pDisplay;#and#rescue#–#Sema5A#shRNA#&#human#Sema5AXHA.#Cells#were#stimulated#for#LTD#(or#LTP)#at#13#DIV#and#5#hours#after#stimulation#were#fixed#and#immunolabeled#as#described#above.#Antibodies#against#PSDX95#and#VGluT#were#used#to#identify#preX#and#postsynaptic#compartments#and#an#antibody#against#HA#was#used#to#identify#cells#with#Sema5A#or#Sema5B#overexpression.#GFP#was#not#used#for#cells#of#the#knockdown#experiment#because#the#Sema5A#shRNA#vector#expresses#GFP#itself#and#this#identifies#cells#that#have#reduced#expression#of#Sema5A.#####For#analysis#of#synapses#specifically#within#dendrites#of#transfected#neurons,#Adobe#Photoshop#was#used#to#generate#a#mask#on#the#GFP#channel,#which#was#overlaid#onto#the#PSDX95#and#VGluT#images.#Using#the#paintbrush#and#magic#wand#tools,#the#dendrite#was#manually#highlighted#by#removing#the#cell#body#and#background#neurites.##Using#ImageJ#software,#confocal#images#of#control#cells#were#used#to#determine#an#appropriate#threshold#for#all#neurons#within#an#experiment.#Puncta#were#defined#as#a#fluorescence#cluster#above#the#set#threshold#with#an#area#between#0.05#and#3#μm2.#Puncta#area#and#integrated#density#(IntDens)#were#calculated#by#ImageJ.#The#number#of#synapses#was#determined#using#an#ImageJ#colocalization#plugin#(found#at:#>4#pixels#in#size#where#a#puncta#on#the#PSDX95#channel#overlaps#with#a#puncta#on#the#VGluT#channel#(with#>50#intensity#ratio#between#the#channels).##%%%! 41!2.7%%Statistical%Analysis%All#data#values#are#expressed#as#mean#±#SEM.#For#all#imaging#experiments,#the#“n”#specified#in#the#figure#legends#refers#to#the#number#of#cells#analyzed#per#condition,#over#at#least#3#separate#cultures,#except#for#figure#3.5d#where#“n”#refers#to#the#number#of#PSDX95XRFP#puncta.#Data#were#analyzed#using#Prism#software#and#statistical#significance#was#determined#using#Student’s#tXtest,#oneXway#ANOVA,#or#repeated#measures#ANOVA#with#Bonferroni’s#post'hoc'tests,#as#indicated#in#figure#legends.#Statistical#significance#was#assumed#when#p<0.05#and#p#values#were#indicated#in#all#figures#as:#‘*’#p<0.05,#‘**’#p<0.01,#and#‘***’#p<0.001.### #! 42!CHAPTER%3:%RESULTS%3.1%%Sema5A%Mediates%Synapse%Elimination%in%Hippocampal%Neurons%Sema5B,#closely#related#to#Sema5A,#was#previously#shown#to#increase#synapse#elimination#in#cultured#hippocampal#neurons#(O’Connor#et#al.,#2009).#Our#results#indicate#that#Sema5A,#when#overexpressed#in#neurons#in#culture,#decreases#synapse#density,#similar#to#Sema5B#(Figure#3.1).#Furthermore,#when#Sema5A#expression#is#reduced#through#short#hairpin#RNA#(shRNA)Xmediated#knockdown,#there#is#an#increase#in#synapse#density.#Our#collaborators#bath#applied#Sema5A#to#cultured#neurons#and#observed#decreases#in#PSDX95XRFP#puncta#density#overtime#(Wei#Xio,#O’Connor#Lab,#UBC),#indicating#that#this#decrease#in#synapse#density#was#due#to#enhanced#synapse#elimination#and#not#deficient#synapse#formation.#Taken#together,#this#indicates#that#Sema5A,#like#Sema5B,#mediates#synapse#elimination#in#hippocampal#neurons.##%%Figure%3.1.%Sema5A%overexpression%decreases%synapse%density%and%Sema5A%knockdown%increases%synapse%density.#Quantification#of#colocalized#PSDX95#and#VGluTX1#puncta#density#(excitatory#“synapse#density”)#in#cells#transfected#with#Sema5A#(overexpression)#or#5A#shRNA#(knockdown).#(Control,#Sema5A,#5A#shRNA,#n#=#57,#26,#23#cells#respectively,#in#3#separate#cultures;#oneXway#ANOVA#p<0.0001,#with#post'hoc#Bonferroni’s#test:#*#p<0.05,#**#p<0.01#compared#to#Control#group).#Control#group#is#transfected#with#empty#“vector”#pDisp#and#pLL3.7.#%! 43!3.2%%Effect%of%LTP%and%LTD%on%Expression%of%Class%5%Semaphorins%3.2.1%%Validation%of%Chemical%LTD%Protocol%As#synapse#elimination#has#been#shown#to#accompany#LTD#(Nagerl#et#al.,#2004;#Zhou#et#al.,#2004;#Shinoda#et#al.,#2010)#and#our#findings#indicated#that#class#5#semaphorins#mediate#synapse#elimination,#we#sought#to#determine#whether#LTDXinducing#stimulation#has#an#effect#on#Sema5A#and#Sema5B#expression.#We#first#established#the#efficacy#of#a#previously#published#chemical#LTD#(cLTD)#induction#protocol#(Lee#et#al.,#1998)#for#use#in#our#experiments.#Specifically,#neurons#in#primary#culture#were#treated#with#a#solution#of#NMDA#and#glycine#for#3#minutes,#which#is#thought#to#activate#NMDARs,#resulting#in#the#expression#of#LTD#similar#to#that#induced#by#lowXfrequency#stimulation,#including#the#internalization#of#AMPARs#(Lee#et#al.,#1998).#To#visualize#AMPARs#at#the#synaptic#membrane,#we#transfected#neurons#with#a#GluA1#construct#extracellularly#tagged#with#super#ecliptic#pHluorin#(SEP;#SEPXGluA1),#a#pHXsensitive#fluorophore,#wellXestablished#as#a#marker#for#endoX#and#exocytosis#(Miesenböck,#De#Angelis#&#Rothman,#1998).#The#fluorescence#of#SEP#is#quenched#at#pH#<6;#therefore,#when#it#is#located#in#an#acidic#secretory#vesicle#lumen#(pH#~5.5)#the#SEPXtagged#protein#is#not#visible#(Figure#3.2a).#Upon#exocytosis,#when#the#vesicle#fuses#with#the#plasma#membrane,#a#rapid#pH#increase#occurs#(to#~pH#7.4)#resulting#in#the#unquenching#of#SEP#fluorescence#and#visibility#of#the#SEPXtagged#protein#in#its#new#location#in#the#plasma#membrane.#Subsequently,#when#the#protein#is#internalized,#the#low#pH#of#the#vesicle#lumen#quenches#SEP#fluorescence#(Sankaranarayanan#&#Ryan,#2000;#Figure#3.2a).#Therefore,#insertion#of#AMPARs#into#the#plasma#membrane#would#! 44!be#visualized#as#an#increase#in#SEP#fluorescence;#whereas,#internalization#of#AMPARs#would#be#visualized#as#a#decrease#in#SEP#fluorescence.##At#10#DIV,#hippocampal#neurons#were#transfected#with#SEPXGluA1#and#at#13X14#DIV,#LTD#was#induced.#Neurons#were#liveXimaged#overtime#following#LTD#stimulation.#We#observed#a#significant#decrease#in#the#puncta#density#(Figure#3.2c;#2Xway#ANOVA#p<0.001)#and#in#the#integrated#density#of#SEPXGluA1#puncta#at#60#minutes#following#LTD#stimulation#compared#to#baseline#(Figure#3.2d;#Student’s#TXtest#p<0.05),#indicating#that#AMPARs#were#internalized#following#chemical#stimulation#with#NMDA#and#glycine#(cLTD).#We#therefore#determined#that#this#form#of#cLTD#was#valid#for#modulating#synaptic#activity#in#subsequent#experiments.#####! 45!%Figure% 3.2.% Validation% of% cLTD% protocol.% (a)# Diagram# of# SEPXGluA1# pHXdependent# fluorescence#quenching# and# unquenching.# (b2d)# validation# of# cLTD# protocol# through# imaging# of# SEPXGluA1#internalization.#(b)#Confocal#images#of#13#DIV#hippocampal#neurons#transfected#with#SEPXGluA1#and#DsXRed#immediately#following#and#60#minutes#after#cLTD#stimulation#with#20#μM#NMDA#and#10#μM#glycine.#Scale# bar# =# 2# μm).# (c)# cLTD# treatment# significantly# decreased# the# density# of# SEPXGluA1# puncta# at# 60#minutes#following#stimulation#when#compared#to#control#treatment#(n#=#11#and#15#cells,#respectively#from#6#separate#cultures;#2Xway#ANOVA,#p<0.001#with#post'hoc#Bonferroni’s#test:#**#p<0.01).#(d)#cLTD#treatment#significantly#decreased#the#IntDens#of#SEPXGluA1#puncta#at#60#minutes#following#stimulation#compared#to#controls#(Student’s#tXtest:#*##p<0.05).#%3.2.2%%LTP%and%LTD%Regulate%the%Expression%of%Class%5%Semaphorins%%We#investigated#changes#in#expression#of#Sema5A#and#Sema5B#in#response#to#decreased#activity#by#quantifying#their#mRNA#level#in#hippocampal#neurons#with#or#without#LTD#treatment.#Hippocampal#neurons#at#15#DIV#were#treated#with#the#above#established#cLTD#protocol#and#mRNA#was#collected#30,#120#or#240#minutes#after#stimulation.#Although#there#was#no#difference#in#mRNA#expression#between#control#! 46!treatment#and#LTD#groups#30#minutes#after#stimulation#for#either#Sema5A#or#Sema5B,#there#was#a#significant#increase#in#mRNA#expression#of#Sema5A#(Figure#3.3a)#and#Sema5B#(Figure#3.3b)#120#minutes#following#cLTD#treatment.#Interestingly,#Sema5B#mRNA#levels#returned#to#baseline#240#minutes#after#LTD#induction,#whereas#Sema5A#levels#remained#significantly#elevated,#suggesting#Sema5A#may#have#a#longerXlasting#effect#or#be#involved#in#later#LTDXassociated#processes.###%Figure% 3.3.% LTD% increases% transcription% of% Sema5A% and% Sema5B.% (a)# cLTD# treatment# significantly#increased# Sema5A# mRNA# expression# 120# and# 240# minutes# following# stimulation# when# compared# to#untreated# cells.# (b)# cLTD# treatment# significantly# increased# Sema5B# mRNA# expression# 120# minutes#following#stimulation#when#compared#to#untreated#cells.#OneXway#ANOVA#with#Bonferroni’s#post'hoc#test,#***p<0.001;#n#=#12#(qPCR#reaction#repeated#in#triplicate#from#4#separate#cultures).#%#Collaborators#on#this#project#investigated#the#effect#of#LTP#on#Sema5A#and#Sema5B#transcription.#A#wellXestablished#chemical#stimulation#paradigm#was#used#to#induce#LTP#(cLTP;#Lu#et#al.,#2001)#by#incubating#neurons#with#a#solution#of#glycine#and#bicuculline#for#3#minutes.#LTPXinducing#stimulation#of#neurons#significantly#decreased#Sema5A#and#Sema5B#mRNA#expression#by#56%#(±#8%)#and#82%#(±#2.5%)#respectively,#30#min#after#LTP#induction#compared#to#baseline.#Furthermore,#120#min#after#LTP,#! 47!Sema5A#mRNA#levels#remained#decreased#to#approximately#the#same#extent#(60#±#9%)#whereas,#Sema5B#mRNA#levels#seem#to#be#returning#towards#baseline#as#they#are#only#decreased#by#55%#(±#6%)#at#this#timepont#(data#not#shown;#O’Connor#lab,#UBC).#Taken#together,#these#data#indicate#that#Sema5A#and#Sema5B#transcription#is#bidirectionally#regulated#by#changes#in#neural#activity.###3.3%%Effect%of%LTD%on%Membrane%Localization%of%Sema5A%In#response#to#LTP#and#LTD#stimulation,#activityXregulated#proteins#exert#their#effects#through#changes#in#transcription,#translation,#and#localization#within#the#neuron.#As#Sema5A#is#a#transmembrane#protein,#and#as#LTD#upregulates#Sema5A#transcription,#we#next#investigated#the#affect#of#LTD#on#Sema5A#membrane#insertion#and#whether#Sema5A#is#inserted#into#the#membrane#specifically#at#synapses#in#response#to#LTD#stimulation.##3.3.1%%Sema5A%is%Inserted%Into%the%Membrane%in%Response%to%LTD%To#visualize#Sema5A#membrane#insertion,#we#transfected#neurons#with#a#Sema5A#construct#extracellularly#tagged#with#SEP#(Sema5AXSEP).#Sema5AXSEP#was#diffusely#distributed#(Figure#3.4,#3.5a,#b),#indicating#that#it#is#localized#to#membranes#throughout#the#cell#and#not#specifically#to#synapses.#To#demonstrate#that#Sema5AXSEP#fluorescence#was#an#accurate#indication#of#its#membrane#localization,#cells#were#treated#with#an#acidic#solution#containing#2X(NXmorpholino)ethanesulfonic#acid#(MES)#with#a#pH#of#5.2#to#quench#the#fluorescence#of#extracellular#SEP.#Following#treatment#of#Sema5AXSEP#transfected#neurons#with#MES,#we#observed#a#rapid#and#extensive#decrease#in#Sema5AXSEP#fluorescence#(Figure#3.4).#To#demonstrate#that#some#quantity#of#Sema5AXSEP#fluorescence#is#quenched#due#to#its#localization#in#secretory#vesicles,#! 48!cells#transfected#with#Sema5AXSEP#were#treated#with#a#solution#containing#50#mM#NH4Cl#(pH#7.4),#which#has#been#shown#to#diffuse#across#cell#membranes#and#neutralize#the#acidity#of#vesicles,#thereby#revealing#the#previously#quenched#SEP#fluorescence#(Miesenböck,#De#Angelis#&#Rothman,#1998).#Following#NH4Cl#treatment,#we#observed#a#rapid#increase#in#Sema5AXSEP#fluorescence#(Figure#3.4).#These#results#confirm#our#ability#to#visualize#accurate#localization#of#Sema5AXSEP.###Figure%3.4.%Validation%of%Sema5A2SEP%construct.%Confocal# images#of#13#DIV#hippocampal#neuron#coXtransfected# with# Sema5AXSEP# and# DsRed.# Neurons# imaged# in# Mg2+Xfree# ECS# (“Control”),# 5# minutes#following# MES# treatment# and# 5# minutes# following# treatment# with# NH4Cl.# Sema5AXSEP# fluorescence#decreases# with# MES# treatment# (pH# 5.2)# and# increases# with# NH4Cl# treatment# (pH# 7.4).# Sema5AXSEP#fluorescence#pseudoXcoloured#to#illustrate#fluorescence#intensity,#scale#from#0#(black)#to#1#(white).#Scale#bar#=#5#μm.##! 49!To#determine#whether#LTD#regulates#membrane#insertion#and#localization#of#Sema5AXSEP,#hippocampal#neurons#were#coXtransfected#with#BFP,#PSDX95XRFP,#and#Sema5AXSEP#at#10X11#DIV.#At#12X14#DIV,#cells#were#imaged#in#Mg2+Xfree#ECS#to#obtain#baseline#levels#of#SEP#fluorescence,#stimulated#for#3#minutes#with#a#solution#containing#NMDA#and#glycine#(cLTD#treatment),#then#returned#to#the#original#solution#supplemented#with#2mM#Mg2+#and#imaged#every#10#minutes#for#80#minutes.#We#observed#a#significant#increase#in#average#dendritic#Sema5AXSEP#fluorescence#following#cLTD#treatment#that#peaked#20#minutes#after#stimulation#and#gradually#returned#to#baseline#by#80#minutes#(Figure#3.5a,#c).#In#contrast,#control#treatment#cells#showed#a#slight#but#steady#decrease#in#Sema5AXSEP#fluorescence#overtime#resulting#from#photobleaching#of#the#fluorophore#after#repeated#imaging.#To#account#for#this#photobleaching,#we#removed#a#photobleaching#constant,#calculated#using#the#amount#of#Sema5AXSEP#fluorescence#decrease#in#control#treated#cells,#from#the#Sema5AXSEP#fluorescence#of#cLTD#treated#cells#(Figure#3.5f).#These#graphs#indicate#that#Sema5AXSEP#fluorescence#remains#increased#above#controls#until#at#least#80#minutes#following#LTD#stimulation.### #! 50!#####Figure%3.5.%Sema5A%is%inserted%into%the%plasma%membrane%following%LTD%but%not%specifically%to%the%synaptic%membrane.%(a2b)#Confocal#images#of#13#DIV#hippocampal#neurons#coXtransfected#with#Sema5AXSEP,#PSDX95XRFP#and#BFP# immediately# following#and#20,#40,#60,#80#minutes#after#control# treatment#or#cLTD#stimulation#with#20μM#NMDA#and#10#μM#glycine.#Sema5AXSEP#fluorescence#is#diffuse#throughout#the#dendrite# and# increases# after# cLTD# stimulation.# Sema5AXSEP# fluorescence# pseudoXcoloured# to# illustrate#fluorescence# intensity,#scale# from#0#(black)# to#1#(white).#Scale#bars#=#3.5μm.#(a)#Dendritic#Sema5AXSEP#fluorescence# (b)# PSDX95XRFP#mask# of# Sema5AXSEP# fluorescence# to# determine# fluorescence# changes# at#synapses.#(c)#Quantification#of#dendritic#Sema5AXSEP#fluorescence#overtime#compared#to#fluorescence#at#0#min#in#control#cells#and#following#cLTD#stimulation#(n=4#cells#in#3#separate#cultures;#repeated#measures#ANOVA# p<0.05,# with# post' hoc# Bonferroni’s# test:# 20,# 30,# 40,# 50#minutes# were# significantly# different# at#p<0.05).# (d)# Quantification# of# Sema5AXSEP# fluorescence# at# PSDX95XRFP# puncta# overtime# compared# to#fluorescence#at#0#min#in#control#cells#and#following#cLTD#stimulation#(n=169#and#163#puncta,#respectively#in#4#cells#over#3#separate#cultures;#repeated#measures#ANOVA#p<0.0001,#with#post'hoc#Bonferroni’s#test:#20,#30,#40,#50,#60,#70,#80#minutes#were#significantly#different#at#p<0.01).#(e)#Quantification#of#Sema5AXSEP#fluorescence#outside#of#PSDX95XRFP#puncta#overtime#compared#to#fluorescence#at#0#min#in#control#cells#and#following#cLTD#stimulation#(n=4#cells#in#3#separate#cultures;#repeated#measures#ANOVA#p<0.05,#with#post' hoc# Bonferroni’s# test:# 20,# 30,# 40#minutes# were# significantly# different# at# p<0.05).# (f)# Sema5AXSEP#fluorescence#normalized#for#photobleaching#(“detrended”).#(c2f)#All#graphs#show#mean#±#SEM.#%#! 51!#%%! 52!3.3.2%%LTD%Does%Not%Recruit%Sema5A%to%Synapses%%Sema5AXSEP#baseline#expression#was#diffuse#throughout#the#dendrite,#indicating#it#was#not#specifically#localized#to#synapses#at#basal#conditions.#LTD#treatment#increased#Sema5A#localization#to#the#membrane#(Figure#3.5a,#c)#and#we#sought#to#determine#whether#LTD#specifically#enhances#the#recruitment#of#Sema5A#to#synaptic#or#extrasynaptic#membranes.#To#determine#this,#masks#were#made#of#PSDX95XRFP#puncta#and#overlayed#onto#Sema5AXSEP#images#from#the#same#timepoint#(Figure#3.5b).#We#also#analyzed#dendritic#Sema5AXSEP#fluorescence#that#was#outside#of#the#PSDX95XRFP#mask#to#determine#the#amount#of#Sema5A#inserted#into#the#membrane#at#extrasynaptic#locations.#Sema5AXSEP#fluorescence#was#increased#at#both#synaptic#and#extrasynaptic#regions#and#showed#the#same#pattern#and#magnitude#of#increase#following#cLTD#stimulation#suggesting#that#Sema5A#is#not#recruited#to#specifically#synaptic#or#extrasynaptic#areas#of#the#plasma#membrane.##Similar#experiments#were#done#in#fixed#cells#and#were#consistent#with#our#liveXimaging#results#(data#not#shown;#Riki#Dingwall,#Bamji#Lab,#UBC).#Hippocampal#neurons#were#coXtransfected#with#a#Sema5A#construct#that#has#an#extracellular#HA#tag#(Sema5AXHA)#and#PSDX95XRFP.#Cells#were#fixed#15,#30,#45,#or#60#minutes#after#cLTD#treatment#and#immunolabelled#for#surfaceXlocalized#HA#using#an#immunohistochemistry#protocol#that#does#not#result#in#a#permeabilized#membrane.#cLTD#treatment#resulted#in#increased#surface#localization#of#Sema5AXHA,#which#peaked#at#30#minutes#after#cLTD,#similar#to#the#peak#in#Sema5AXSEP#fluorescence.#Consistent#with#liveXimaging#results,#Sema5A#was#inserted#into#both#synaptic#and#extraXsynaptic#membranes.#Taken#together,#the#liveXimaging#and#fixedXcell#data#indicate#that#Sema5A#undergoes#LTD#! 53!treatmentXinduced#plasma#membrane#insertion#but#does#not#specifically#get#recruited#to#synapses.#As#Sema5B#was#also#found#to#be#upregulated#in#response#to#cLTD#stimulation,#we#wish#to#next#determine#how#cLTD#treatment#effects#the#membrane#localization#of#Sema5B.#We#will#be#following#these#experiments#with#Sema5BXSEP#live#imaging#before#and#after#cLTD#stimulation.##3.4%%Effect%of%Class%5%Semaphorins%on%LTD2Mediated%Elimination%of%Excitatory%Synapses%%%3.4.1%%Sema5B%Overexpression%Abolishes%LTD2Mediated%Synapse%Elimination;%Sema5A%Has%No%Effect#%%% Earlier#results#indicated#that#Sema5A#and#Sema5B#are#involved#in#the#elimination#of#synapses#in#hippocampal#cultures#(Figure#3.1;#Wei#Xiao,#O’Connor#Lab,#UBC;#O’Connor#et#al.,#2009).#Furthermore,#LTD#mediates#the#elimination#of#synapses#and#enhances#the#transcription#of#both#class#5#semaphorins.#Therefore,#we#sought#to#determine#whether#LTD#stimulation#mediates#synapse#elimination#through#the#upregulation#of#Sema5A#and#Sema5B.#Specifically,#we#overexpressed#Sema5A#or#Sema5B#in#hippocampal#neurons#and#fixed#cells#for#imaging#5#hours#after#cLTD#stimulation.#Cells#were#coimmunolabeled#for#PSDX95#and#VGluTX1#and#synapses#were#identified#as#areas#of#colocalization#of#these#two#proteins.#Similar#to#previous#results,#Sema5A#or#Sema5B#overexpression#significantly#decreased#synapse#density,#as#did#cLTD#treatment#alone#(Figure#3.6a,#b).#Sema5B#overexpression#blocked#further#decreases#in#synapse#density#in#response#to#cLTD#stimulation.#Interestingly,#Sema5A#overexpression#in#addition#to#cLTD#stimulation#did#result#in#a#further#significant#decrease#in#synapse#density#compared#to#Sema5A#overexpression#alone.#The#percent#difference#in#synapse#density#between#the#Sema5A#overexpression#group#and#the#! 54!Sema5A#overexpression#plus#cLTD#group#was#not#significantly#different#from#the#percent#decrease#observed#due#to#cLTD#in#the#control#treatment#group#(Figure#3.6c).#Therefore,#overexpression#of#Sema5A#has#no#effect#on#LTDXtreatment#induced#decreases#in#synapse#density.##Experiments#of#collaborators#used#cLTP#instead#of#cLTD#stimulation#in#a#similar#experimental#design#to#examine#the#role#of#enhanced#activity#and#Sema5A#or#Sema5B#overexpression#on#synapse#density.#Their#results#demonstrate#that#overexpression#of#Sema5A#or#Sema5B#blocks#LTPXtreatment#induced#increases#in#synapse#density#(data#not#shown;#Wei#Xiao,#O’Connor#Lab,#UBC).#########%%%%%%! 55!%%Figure% 3.6.% % Sema5A% overexpression% has% no% effect% on% LTD2mediated% decreased% synapse% density,%while%Sema5B%overexpression%abolishes%the%effect%of%LTD.%(a)#Confocal#images#of#13#DIV#hippocampal#neurons#coXtransfected#with#GFP#and#pDisplay#(pDisp)#or#rat#Sema5AXHA#(Sema5A)#or#mouse#Sema5BXHA#(Sema5B).#Neurons#coimmunostained#for#endogenous#PSDX95#and#VGluTX1.#Cells#were#fixed#5#hours#after#cLTD# (or# control)# treatment.# GFP# image# used# to#mask# PSDX95# and# VGluT# images# to# analyze# synapses#localized#to#dendrites#of#transfected#neurons.#Scale#bar#=#5#μm.#(b)#Quantification#of#colocalized#PSDX95#and#VGluTX1#puncta#density#(excitatory#“synapse#density”)#in#cells#overexpressing#Sema5A#or#Sema5B#with#and#without#cLTD#stimulation#(n#=#20X26#cells#in#3#separate#cultures;#oneXway#ANOVA#p<0.001,#with#post'hoc#Bonferroni’s#test:#***#p<0.001#compared#to#pDisp#group#with#no#LTD#stimulation,# ##p<0.01#compared#to#Sema5A#group#with#no#LTD#stimulation).#(c)#Quantification#of#the#%#change#in#synapse#density#due#to#LTD#treatment#in#the#control#group#(pDisp),#Sema5A#overexpression#group,#and#Sema5B#overexpression#group.# There# is# no# significant# difference# in# the# effect# of# LTD# between# the# Sema5A# and# control# groups#(Student’s#tXtest#p#>#0.05).%%%%! 56!3.4.2%%Sema5A%is%Not%Required%for%LTD2Mediated%Decreases%in%Synapse%Density%%To#further#clarify#whether#LTD#stimulation#results#in#the#elimination#of#synapses#through#the#upregulation#and#membrane#recruitment#of#Sema5A,#we#examined#whether#LTDXinduced#synapse#elimination#is#abrogated#in#cells#lacking#Sema5A.#Hippocampal#neurons#were#transfected#with#shRNAs#against#Sema5A#to#knockdown#endogenous#expression#of#Sema5A.#Knockdown#of#Sema5A#increased#synapse#density#compared#to#control#cells#and#the#knockdown#effect#was#successfully#rescued#with#an#shRNAXresistant#Sema5A#construct#expressing#human#Sema5A#(h5A;#Figure#3.7a,b;#oneXway#ANOVA,#p<0.001).#cLTD#treatment#decreased#synapse#density#by#approximately#23%#in#control#cells#and#19%#in#KD#cells#which#is#not#significantly#different#(p=0.11;#Figure#3.7c).#Taken#together,#this#indicates#that#Sema5A#is#not#necessary#for#LTDXmediated#synapse#elimination.##! 57!%Figure%3.7.% %Sema5A%is%not%required% for%LTD2mediated%decreases% in%synapse%density.%(a)#Confocal#images#of#13#DIV#hippocampal#neurons#coXtransfected#with#pLL3.7#and#pDisplay#(“pLL3.7”,#control#cells)#or#Sema5A#shRNA#and#pDisplay#(“5A#shRNA”;#knockdown#cells)#or#Sema5A#shRNA#and#human#Sema5AXHA#(5A#shRNA#+#h5A;#rescue#cells).#Neurons#coimmunostained#for#endogenous#PSDX95#and#VGluTX1.##Cells#were#fixed#5#hours#after#cLTD#(or#control)#treatment.#GFP#expressed#by#pLL3.7#and#Sema5A#shRNA#vectors.#GFP#image#used#to#mask#PSDX95#and#VGluT#images#to#analyze#synapses#localized#to#dendrites#of#transfected#neurons.#Scale#bar#=#5#μm.#(b)#Quantification#of#colocalized#PSDX95#and#VGluTX1#puncta#density#(excitatory#“synapse# density”)# in# cells# with# and# without# decreased# Sema5A# expression,# with# and# without# cLTD#stimulation#(n#=#23X57#cells#in#3#separate#cultures;#oneXway#ANOVA#p<0.01,#with#post'hoc#Bonferroni’s#test:#**# p<0.01,# ***# p<0.001# compared# to# pLL3.7# group#with# no# LTD# stimulation,# ## p<0.05# compared# to# 5A#shRNA#group#with#no#LTD#stimulation).#(c)#Quantification#of#the#%#change#in#synapse#density#due#to#LTD#treatment#in#control#groups#and#Sema5A#shRNA#groups#shows#no#significant#difference#in#the#effect#of#LTD#between#the#groups#(Student’s#tXtest#p#>#0.05).### #! 58!CHAPTER%4:%DISCUSSION%The#present#study#demonstrates,#for#the#firstXtime,#that#neural#activity#regulates#class#5#semaphorins.#Specifically,#we#have#shown#that#activity#bidirectionally#regulates#Sema5A#and#Sema5B#transcription.#Furthermore,#Sema5A#undergoes#NMDARXLTDXtreatment#induced#plasma#membrane#insertion.#We#also#determined#that,#despite#our#independent#findings#of#LTD#stimulationXinduced#Sema5A#upregulation#and#membrane#insertion#and#Sema5AXmediated#synapse#elimination,#Sema5A#is#not#required#for#NMDARXLTDXmediated#synapse#elimination.#For#the#purpose#of#clarity#in#this#discussion,#NMDARXLTD#will#be#hereafter#referred#to#as#LTD.##4.1%%Sema5A,%like%Sema5B,%Mediates%Synapse%Elimination%of%Mature%Synapses%%Previous#work#demonstrated#that#Sema5A#(Duan#et#al.,#2014)#and#Sema5B#(O’Connor#et#al.,#2009)#function#at#the#mature#synapse#in#addition#to#their#developmental#effects#on#axon#pathfinding#(Goldberg#et#al.,#2004;#Hilario#et#al.,#2009;#Lett#et#al.,#2009;#Liu#et#al.,#2014;#Masuda#et#al.,#2014;#Oster#et#al.,#2003)#and#dendritic#arborization#(Matsuoka#et#al.,#2011).#Our#finding#that#Sema5A#or#Sema5B#overexpression#results#in#decreased#synapse#density#is#consistent#with#work#on#Sema5B#by#O’Connor#and#colleagues#(2009),#who#showed#that#overexpression#of#Sema5B#decreases#synapse#density#and#knockdown#of#Sema5B#increases#synapse#density#in#hippocampal#cultures.##A#recent#study#explored#in–depth#the#function#of#Sema5A#at#granule#cell#(GC)#synapses#in#the#dentate#gyrus#(DG)#of#the#hippocampus#in'vitro#and#in'vivo#(Duan#et#al.,#2014).#Researchers#demonstrated#that#Sema5A,#but#not#Sema5B,#knockout#mice#have#increased#GC#spine#density#with#no#altered#spine#density#of#CA1#neurons.#Much#of#their#! 59!data#supports#our#findings#in#hippocampal#cultures.#For#example,#Duan#and#colleagues#cultured#primary#hippocampal#neurons#from#Sema5AX/X#mice#and#used#a#marker#of#GCs#to#specifically#analyze#synapse#density#in#these#cells.#Sema5A#knockout#increased#spine#density#by#approximately#a#third#compared#to#controls,#which#is#similar#to#but#more#than#the#increase#in#synapse#density#we#observed#with#our#Sema5A#knockdown#(~26%).#As#there#is#some#endogenous#Sema5A#that#remains#within#cells#in#our#knockdown#system,#this#result#is#satisfactorily#close#to#the#effect#of#a#complete#lack#of#Sema5A.#Furthermore,#when#researchers#expressed#recombinant#Sema5A#in#wildXtype#cells,#they#observed#a#decrease#in#spine#density#by#approximately#one#third,#very#similar#to#our#results#for#synapse#density#when#Sema5A#was#overexpressed.#It#is#interesting#though,#that#these#researchers#found#no#in'vivo#effect#of#Sema5B#knockout#as#our#results#and#a#previous#study#(O’Connor#et#al.,#2009)#support#a#role#for#Sema5B#in#negatively#regulating#hippocampal#synapse#density.#Another#interesting#difference#is#that#our#experimental#system#does#not#differentiate#between#DG#and#CA1#or#CA2#neurons,#yet#Duan#and#colleagues#found#no#effect#of#Sema5A#knockout#on#spine#density#in#CA1.#It#is#possible#this#inconsistency#results#from#using#different#measures#(i.e.#spine#density#vs.#synapse#density)#or#from#averaging#results#across#many#types#of#hippocampal#neurons#in#our#case.#Our#findings#demonstrate,#in#agreement#with#Duan#et#al.#(2014),#that#Sema5A#is#an#important#negative#regulator#of#synapse#formation,#functioning#in#development#to#constrain#synapse#density.#This#effect#on#synapse#density#could#be#due#to#enhanced#synapse#elimination#or#deficient#synapse#formation.#In#conjunction#with#the#present#! 60!study,#colleagues#determined#through#timeXlapse#imaging#that#Sema5A#functions#to#eliminate#synapses#(Wei#Xio,#O’Connor#Lab,#UBC).##4.2%%Class%5%Semaphorins%are%Regulated%by%Activity% # #We#established#for#the#first#time#in#mammalian#cells#that#class#5#semaphorins#are#directly#activityXregulated.#Two#studies#have#previously#demonstrated#a#possible#link#between#activity#and#semaphorin#signaling.#A#study#in#drosophila#showed#that#correct#synaptic#target#selection#in#motor#axon#guidance#requires#presynaptic#activity,#SemaX2a,#presynaptic#calcium#increase,#and#CaMKII#function#(Carrillo#et#al.,#2010).#Additionally,#in#rat#hippocampal#cells,#blocking#neural#activity#with#TTX#was#shown#to#inhibit#the#effect#of#Sema3A#on#dendritic#complexity#(Cheadle#&#Biederer,#2014).#Here,#we#have#specifically#determined#that#LTD#stimulation#increases#both#Sema5A#and#Sema5B#mRNA#transcription#and,#in#contrast,#LTP#stimulation#decreases#transcription#of#both#class#5#semaphorins.#This#demonstrates#a#consistent#bidirectionality#of#class#5#semaphorin#response#to#activity,#suggesting#they#are#important#for#processes#related#to#LTD#and#therefore#need#to#be#upXregulated;#whereas,#they#may#hinder#processes#related#to#LTP#and#therefore#need#to#be#downXregulated.#Whether#the#increase#in#transcription#associated#with#LTD#stimulation#leads#to#enhanced#translation#and#synthesis#of#Sema5A#and#Sema5B#protein#remains#to#be#seen.#Likewise,#whether#the#downXregulation#in#transcription#associated#with#LTP#stimulation#leads#to#reduced#Sema5A#and#Sema5B#protein#levels#should#be#investigated.##%It#is#interesting#that#Sema5A#transcription#remains#elevated#until#4#hours#following#LTD#stimulation;#whereas,#Sema5B#transcription#returns#to#baseline#levels#by#this#timepoint.#This#indicates#a#differentiation#of#function#between#the#two#proteins#and#! 61!suggests#that#Sema5A#may#be#involved#in#longer#lasting#LTDXassociated#processes#than#Sema5B.#However,#what#those#processes#are#remains#to#be#determined.### To#further#explore#the#activityXmediated#regulation#of#class#5#semaphorins,#we#investigated#the#effect#of#LTD#on#membrane#localization#of#Sema5A.#We#determined#that#LTDXstimulation#increases#the#membrane#localization#of#Sema5A#and#that#it#is#a#rapid#response#to#stimulation#as#it#peaks#20#minutes#following#LTD#induction.#Interestingly,#the#upXregulation#of#Sema5A#transcription#in#response#to#LTD#stimulation#occurs#after#the#peak#of#Sema5A#membrane#insertion.#This#could#indicate#that#existing#Sema5A#functions#in#early#LTD#processes#through#changes#in#localization;#whereas,#synthesis#of#de'novo#Sema5A#protein#is#required#for#later#stages#of#LTD#expression.#Another#important#finding#of#this#study#is#that#Sema5A#is#not#specifically#recruited#to#synapses#in#response#to#LTD,#indicating#it#can#function#in#signaling#along#the#length#of#the#dendrite,#in#both#synaptic#and#extrasynaptic#locations.##One#major#caveat#to#our#experimental#approach#for#determining#the#response#of#Sema5A#to#activity#stimulation#was#that#by#using#a#Sema5AXSEP#construct,#we#were#overexpressing#this#protein#in#the#cell,#which#can#cause#changes#to#its#endogenous#behaviour.#However,#this#approach#was#required#because#using#Sema5AXSEP#allowed#us#to#visualize#Sema5A#membrane#localization#overtime#with#live#cell#timeXlapse#imaging.#This#was#important#for#determining#the#time#course#of#the#Sema5A#response#to#activity,#informing#the#design#of#further#experiments.#To#confirm#the#Sema5AXSEP#results,#we#are#subsequently#preforming#a#biotinylation#experiment#to#determine#the#membrane#localization#of#endogenous#Sema5A.#Preliminary#results#(data#not#shown)#show#an#increase#in#endogenous#Sema5A#membrane#insertion#in#response#to#cLTD#stimulation#! 62!in#accordance#with#our#Sema5AXSEP#results#(Riki#Dingwall,#Bamji#Lab,#UBC).#We#would#also#like#to#compare#these#results#to#the#effect#of#LTD#treatment#on#membrane#insertion#of#Sema5B#and#we#will#therefore#be#doing#liveXimaging#and#biotinylation#experiments#with#Sema5B#to#elucidate#any#differences.###4.3%%Sema5B%Overexpression%Abolishes%LTD2Mediated%Synapse%Elimination;%Sema5A%Overexpression%Has%No%Effect## The#elimination#of#extraneous#synapses#is#an#important#part#of#postnatal#development#for#correct#formation#and#functioning#of#neural#networks#(Cowan#et#al.,#1984;#Kano#&#Hashimoto,#2009;#Schuldiner#&#Yaron,#2015).#Furthermore,#much#of#this#developmental#pruning#is#thought#to#be#mediated#by#activity#(Hooks#&#Chen,#2006;#Schafer#et#al.,#2012;#Yu#et#al.,#2013).#As#Sema5A,#Sema5B,#and#LTD#treatment#have#all#been#shown#to#mediate#synapse#elimination#independently#and#as#the#class#5#semaphorins#are#upXregulated#by#LTD#stimulation,#we#sought#to#build#on#our#findings#by#testing#the#hypothesis#that#LTD#treatment#mediates#synapse#elimination#through#the#upXregulation#of#class#5#semaphorins.#%Although#both#Sema5A#and#Sema5B#overexpression#results#in#decreased#synapse#density,#the#effect#of#overexpressing#these#proteins#in#addition#to#LTD#stimulation#has#differing#results,#indicating#they#have#differing#roles#in#LTDXmediated#synapse#elimination.#The#effect#of#LTD#stimulation#on#synapse#density#is#abolished#when#Sema5B#is#overexpressed.#There#are#two#possible#ways#to#explain#this#result.#First,#this#could#indicate#that#Sema5B#is#acting#in#the#same#signaling#pathway#downstream#of#LTD#stimulation#to#mediate#synapse#elimination#(i.e.#LTD#mediates#synapse#elimination#through#Sema5B)#as#artificially#upXregulating#the#downstream#signal#(i.e.#overexpression#of#Sema5B)#can#impede#the#expression#of#the#effect#when#the#! 63!upstream#signal#is#subsequently#induced#(i.e.#LTD#stimulation).#Alternatively,#this#result#could#be#caused#by#a#basement#effect#where#Sema5B#overexpression#decreases#synapse#density#to#such#an#extent#that#a#further#synapse#density#decrease#in#response#to#LTD#stimulation#is#impossible#while#maintaining#a#healthy#neuron.##The#best#way#to#test#which#alternative#is#correct#and#whether#Sema5B#is#required#for#LTDXmediated#synapse#elimination#is#to#do#an#experiment#combining#Sema5B#knockdown#with#cLTD#stimulation.#If#Sema5B#knockdown#prevents#the#synapse#density#decrease#that#normally#occurs#after#LTD#stimulation,#it#is#likely#that#both#LTD#and#Sema5B#mediate#synapse#elimination#through#the#same#pathway.#If#Sema5B#knockdown#has#no#effect#on#LTDXmediated#synapse#elimination,#Sema5B#is#not#required#for#this#specific#effect#of#LTD,#and#is#likely#mediating#synapse#elimination#through#a#different#signaling#pathway.#####In#contrast#to#the#effect#of#Sema5B#on#LTDXmediated#decreases#in#synapse#density,#Sema5A#overexpression#has#no#effect#on#the#extent#of#synapse#density#decrease#associated#with#LTD#stimulation,#as#the#decrease#due#to#LTD#treatment#in#the#Sema5A#overexpression#group#is#not#significantly#different#from#the#LTD#treatmentXinduced#decrease#in#the#control#group.#This#result#indicates#that#LTD#stimulation#does#not#mediate#synapse#elimination#through#the#upXregulation#of#Sema5A.#The#synapse#elimination#mediated#by#Sema5A#appears#to#be#the#result#of#a#separate#signaling#pathway#than#that#mediated#by#NMDARXdependent#LTD#stimulation.#To#better#resolve#the#role#of#Sema5A#in#LTD#stimulationXinduced#synapse#elimination,#we#used#a#knockdown#approach#to#decrease#the#expression#of#Sema5A#in#neurons#and#tested#the#combined#effect#of#LTD#treatment#and#reduced#Sema5A#on#synapse#density.####! 64!4.4%%Sema5A%is%Not%Required%for%NMDAR2LTD2Mediated%Decreases%in%Synapse%Density## When#we#reduced#the#expression#of#Sema5A#with#a#knockdown#experiment,#we#found#no#effect#on#LTDXmediated#synapse#elimination#as#a#similar#decrease#in#synapse#density#resulted#from#cLTD#stimulation#in#both#control#and#Sema5A#knockdown#cells.#Therefore,#when#evidence#from#the#knockdown#and#overexpression#experiments#are#taken#together,#we#show#that#Sema5A#is#not#required#for#LTDXmediated#synapse#elimination;#therefore,#LTD#does#not#mediate#synapse#elimination#through#the#regulation#of#Sema5A.#A#possible#caveat#to#this#finding#is#that#Sema5B#may#be#compensating#for#the#reduction#of#Sema5A.#We#are#currently#addressing#this#question#by#doing#a#dual#knockout#experiment#to#reduce#the#expression#of#both#Sema5A#and#Sema5B#to#determine#the#effect#on#LTDXmediated#synapse#elimination.#It#is#possible#that#Sema5A#is#directly#required#for#other#forms#of#activityXmediated#synapse#elimination#such#as#mGluRXmediated#LTD.#mGluRX#and#NMDARXLTD#stimulation#are#distinct#forms#of#activity#that#result#in#the#internalization#of#different#populations#of#AMPARs#(Casimiro#et#al.,#2011);#yet#both#ultimately#result#in#synapse#elimination.#To#better#elucidate#the#role#of#Sema5A#in#alternative#forms#of#activityXmediated#synapse#elimination,#the#knockdown#and#overexpression#experiments#should#be#repeated#with#other#forms#of#activity#stimulation,#such#as#using#chemical#application#of#(R,S)X3,5Xdihydroxyphenylglycine#(DHPG)#to#stimulate#mGluRXLTD.#Additionally,#since#LTD#stimulation#affects#the#transcription#and#localization#of#Sema5A,#it#is#possible#that#Sema5A#affects#LTDXassociated#process#other#than#synapse#elimination,#for#example#AMPAR#internalization.#To#determine#whether#Sema5A#expression#affects#AMPAR#internalization#associated#with#LTD,#we#could#transfect#neurons#with#SEPX! 65!GluA1#to#visualize#AMPAR#internalization#as#in#our#cLTD#validation#experiment.#Cells#would#be#additionally#transfected#with#Sema5A#(overexpression),#Sema5A#shRNA#(knockdown)#or#an#empty#vector#control#and#liveXimaged#overtime#following#LTD#stimulation.#This#would#allow#us#to#determine#the#effect#of#Sema5A#expression#on#the#rate#and#extent#of#LTD#treatmentXmediated#AMPAR#internalization.##4.5%%Possible%Mechanisms%of%Sema5A%Function##Although#a#determination#of#the#Sema5A#receptor#or#binding#partner#and#other#members#of#the#signaling#pathway#that#are#involved#in#LTDXmediated#Sema5A#function#was#beyond#the#scope#of#the#current#study,#it#is#an#important#area#of#future#investigation.#Sema5A#has#a#small#cytoplasmic#domain#with#no#previously#identified#signaling#motifs#(Adams,#Betz#&#Püschel,#1996);#therefore,#it#is#likely#that#Sema5A#acts#as#a#ligand#or#as#a#coXreceptor.#Previous#work#suggests#that#class#5#semaphorins#function#as#ligands#for#members#of#the#plexin#family,#including#PlexA1,#PlexA3,#and#PlexB3#(Artigiani#et#al.,#2004;#Hilario#et#al.,#2009;#Matsuoka#et#al.,#2011;#Sadanandam#et#al.,#2008;#Sadanandam#et#al.,#2010).#Furthermore,#Duan#and#collegues#(2014)#demonstrated#that#Sema5A#can#signal#through#both#a#cellXautonomous#and#intercellular#interaction#with#PlexA2#to#mediate#its#negative#effect#on#excitatory#synapse#density.#This#interaction#was#shown#to#require#both#the#Sema#domain#of#Sema5A#and#the#cytoplasmic#domain#of#PlexA2#(Duan#et#al.,#2014).#It#is#possible#that#any#of#these#plexins#could#act#as#a#receptor#to#mediate#LTD#stimulationXinduced#Sema5A#effects.#Alternatively,#there#could#be#a#receptor#from#the#neuropilin#family,#which#are#proteins#that#have#also#been#shown#to#interact#with#semaphorins#(Huber#et#al.,#2003).##! 66!A#further#interesting#mechanistic#question#is#determining#the#specific#domain#or#multiple#domains#of#Sema5A#that#are#required#for#LTD#treatmentXinduced#Sema5A#membrane#insertion.#This#could#be#tested#using#Sema5AXSEP#deletion#mutants#that#are#missing#the#TSR#domain#or#the#Sema#domain.#It#is#even#possible#that#Sema5A#responses#to#activity#or#its#activityXmediated#effects#can#be#altered#through#interactions#between#these#domains#and#different#coXreceptors,#similar#to#the#bidirectional#effect#of#Sema5A#through#heparan#and#chondroitin#sulfate#proteoglycans#(Kantor#et#al.,#2004).#We#have#not#yet#examined#the#response#of#Sema5A#to#LTPXinducing#stimulation,#but#it#is#possible#that#Sema5A#membrane#trafficking#displays#a#bidirectional#response#to#increased#or#decreased#activity#similar#to#Sema5A#transcription#and#further#investigation#should#involve#determining#the#effect#of#LTP#treatment#on#Sema5A#membrane#insertion.#####4.6%%Sema5A%and%ASD%Determining#the#function#of#LTD#stimulationXinduced#upXregulation#and#enhanced#membrane#insertion#of#Sema5A#and#the#signaling#molecules#associated#with#this#function#as#well#as#further#investigation#of#the#mechanism#of#Sema5AXmediated#synapse#elimination#may#have#important#implications#for#research#into#the#pathophysiology#of#autism#spectrum#disorder#(ASD).#ASD,#a#prevalent#neurodevelopmental#disorder#characterized#by#impaired#social#communication#and#interaction,#is#an#important#area#of#research#as#the#etiology#and#treatments#remain#unresolved#(Autism#and#Developmental#Disabilities#Monitoring#Network,#2014;#American#Psychiatric#Association,#2013;#Won,#Mah#&#Kim,#2013).#Multiple#twin#studies#have#revealed#the#high#heritability#of#ASD#(Bailey#et#al.,#1995;#Folstein#&#Rutter,#1977;#Steffenburg#et#al.,#1989)#and#genomeXwide#association#studies#have#uncovered#many#! 67!susceptibility#genes#(International#Molecular#Genetic#Study#of#Autism#Consortium,#2001;#Ebert#&#Greenberg,#2013;#Philippe#et#al.,#1999;#Risch#et#al.,#1999);#however,#only#a#fraction#of#the#risk#can,#as#yet,#be#accounted#for#(Gaugler#et#al.,#2014;#Won,#Mah#&#Kim,#2013).#Interestingly#for#our#study,#Sema5A#has#been#geneticallyXlinked#to#ASD#(Cheng#et#al.,#2013;#Weiss#et#al.,#2009).#Furthermore,#the#evidence#of#association#is#strengthened#by#two#studies#that#found#Sema5A#expression#to#be#decreased#in#the#brains#and#blood#of#people#with#autism#(Melin#et#al.,#2006;#Weiss#et#al.,#2009).##A#prevailing#theory#of#the#pathophysiology#of#autism#is#the#development#of#abnormal#neural#connections#with#an#underlying#local#overabundance#of#synapses#and#a#reduction#in#the#connections#between#brain#regions#(Courchesne#et#al.,#2007;#Hazlett#et#al.,#2005;#Just#et#al.,#2007;#Just#et#al.,#2012;#Tang#et#al.,#2014).#Much#of#this#overconnectivity#is#likely#due#to#deficient#pruning#of#extraneous#connections#during#postnatal#development#and#in#response#to#activity.#In#layer#V#pyramidal#neurons#of#the#temporal#cortex,#Tang#and#colleagues#(2014)#found#significantly#increased#spine#density#in#adolescent#ASD#brain#samples#compared#to#same#age#controls#and#this#was#due#to#significantly#decreased#spine#loss#over#the#developmental#timespan#from#childhood#to#adolescence#in#the#ASD#samples.#In#addition,#as#discussed#in#the#introduction,#much#developmental#pruning#is#activityXmediated#(Hooks#&#Chen,#2006;#Yu#et#al.,#2013).#Many#of#the#genes#recently#linked#to#ASD#are#involved#in#signaling#pathways#controlling#synapse#development,#maintenance#and#elimination#and#involve#proteins#that#are#activityXregulated,#including#neurexins,#neuroligins,#SHANKs,#FMRP,#and#TSC1XTSC2#(Ebert#&#Greenberg,#2013).#As#we#have#demonstrated#that#Sema5A#is#activityXregulated,#we#can#now#add#Sema5A#to#this#list.#Moreover,#as#we#have#shown#that#Sema5A#is#! 68!involved#in#synapse#elimination#and#is#modulated#by#activity,#the#reduction#of#Sema5A#expression#in#people#with#ASD#may#help#explain#the#overabundance#of#local#synaptic#connections#associated#with#the#pathophysiology#of#ASD.##%%# #! 69!BIBLIOGRAPHY%%Adams#RH,#Betz#H,#Püschel#AW#(1996)#A#novel#class#of#murine#semaphorins#with#homology#to#thrombospondin#is#differentially#expressed#in#early#embryos.#Mech#Dev#57:33X45.##Akazawa#C,#Shigemoto#R,#Bessho#Y,#Nakanishi#S,#Mizuno#N#(1994)#Differential#expression#of#five#NXmethylX# DXaspartate# receptor# subunit#mRNAs# in# the# cerebellum# of# developing# and#adult#rats.#J#Comp#Neurol#347:150–160.##American#Psychiatric#Association.#(2013).#Diagnostic#and#statistical#manual#of#mental#disorders#(5th#ed.).#Washington,#DC:#Author.##Artigiani#S,#Conrotto#P,#Fazzari#P,#Gilestro#GF,#Barberis#D,#Giordano#S,#Comoglio#PM,#Tamagnone#L#(2004)#PlexinXB3#is#a#functional#receptor#for#semaphorin#5A.#EMBO#Rep#5:710X714.##Autism# and# Developmental# Disabilities# monitoring# Network# (2014)# Community# report# on#autism.###Azevedo#FA,#Carvalho#LR,#Grinberg#LT,#Farfel#JM,#Ferretti#RE,#Leite#RE,#Jacob#Filho#W,#Lent#R,#HerculanoXHouzel#S#(2009)#Equal#numbers#of#neuronal#and#nonneuronal#cells#make#the#human#brain#an#isometrically#scaledXup#primate#brain.#J#Comp#Neurol#513:532X541.##Babiec#WE,#Guglietta#R,#Jami#SA,#Morishita#W,#Malenka#RC,#O’Dell#TJ#(2014)#Ionotropic#NMDA#receptor#signaling# is# required# for# the# induction#of# longXterm#depression# in# the#mouse#hippocampal#CA1#region.#J#Neurosci#34:5285X5290.##Bagri#A,#Cheng#HJ,#Yaron#A,#Pleasure#SJ,#TessierXLavigne#M#(2003)#Stereotyped#pruning#of#long#hippocampal#axon#branches#triggered#by#retraction#inducers#of#the#semaphorin#family.#Cell#113:285X299.##Bailey#A,#Le#Couteur#A,#Gottesman#I,#Bolton#P,#Simonoff#E,#Yuzda#E,#Rutter#M#(1995)#Autism#as#a#strongly#genetic#disorder:#evidence#from#a#British#twin#study.#Psychol#Med#25:63X77.##Baio#J#(2012)#Prevalence#of#autism#spectrum#disorders—Autism#and#Developmental#Disabilities#Monitoring#Network,#14#sites,#United#States,#2008.#MMWR#Surveill#Summ#61,#1–19.##Barria#A,#Muller#D,#Derkach#V,#Griffith#LC,#Soderling#TR#(1997)#Regulatory#phosphorylation#of#AMPAXtype# glutamate# receptors# by# CaMKII# during# longXterm# potentiation.# Science#276:2042–2045.##! 70!Bartlett#TE,#et#al.#(2007)#Differential#roles#of#NR2A#and#NR2BXcontaining#NMDA#receptors#in#LTP#and#LTD#in#the#CA1#region#of#twoXweek#old#rat#hippocampus.#Neuropharmacol#52:60–70.###Bastrikova# N,# Gardner# GA,# Reece# JM,# Jeromin# A,# Dudek# SM# (2008)# Synapse# elimination#accompanies# functional# plasticity# in# hippocampal# neurons.# Proc# Natl# Acad# Sci# USA#105:3123X3127.##Beattie#EC,#et#al.# (2000)#Regulation#of#AMPA#receptor#endocytosis#by#a#signaling#mechanism#shared#with#LTD.#Nat#Neurosci#3:1291X1300.###BenXZvi# A,# Yagil# Z,# Hagalili# Y,# Klein# H,# Lerman# O,# Behar# O# (2006)# Semaphorin# 3A# and#neurotrophins:#a#balance#between#apoptosis#and#survival#signaling# in#embryonic#DRG#neurons.#J#Neurochem#96:585X597.##Bi#GQ,#Poo#MM#(1998)#Synaptic#modifications#in#cultured#hippocampal#neurons:#dependence#on#spike#timing,#synaptic#strength,#and#postsynaptic#cell#type.#J#Neurosci#18:10464X10472.##Bliss#TV,#Lomo#T#(1973)#LongXlasting#potentiation#of#synaptic#transmission#in#the#dentate#area#of#the#anaesthetized#rabbit#following#stimulation#of#the#perforant#path.#J#Physiol#232:331X356.##Bouzioukh# F,# Daoudal# G,# Falk# J,# Debanne# D,# Rougon# G,# Castellani# V# (2006)# Semaphorin3A#regulates# synaptic# function# of# differentiated# hippocampal# neurons.# Eur# J# Neurosci#23:2247X2254.##Brigman#JL,#et#al.#(2010)#Loss#of#GluN2BXcontaining#NMDA#receptors#in#CA1#hippocampus#and#cortex# impairs# longXterm# depression,# reduces# dendritic# spine# density,# and# disrupts#learning.#J#Neurosci#30:4590–4600.###Burkhardt#C,#Müller#M,#Badde#A,#Garner#CC,#Gundelfinger#ED,#Püschel#AW#(2005)#Semaphorin#4B# interacts#with# the#postXsynaptic#density#protein#PSDX95/SAP90#and# is#recruited# to#synapses#through#a#CXterminal#PDZXbinding#motif.#FEBS#Lett#579:3821X3828.##Carrillo#RA,#Olsen#DP,#Yoon#KS,#Keshishian#(2010)#Presynaptic#activity#and#CaMKII#modulate#retrograde#semaphorin#signaling#and#synaptic#refinement.#Neuron#68:32X44.##Casimiro# TM,# Sossa# KC,# Uzunova# G,# Beattie# JB,# Marsden# KC,# Carroll# RC# (2011)# mGluR# and#NMDAR#activation#internalize#distinct#populations#of#AMPARs.#Mol#Cell#Neurosci#48:161X170.##! 71!Castellani#V,#Rougon#G#(2002)#Control#of#semaphorin#signaling.#Curr#Opin#Neurobiol#12:532X541.##Cheadle# L,# Biederer# T# (2014)# ActivityXdependent# regulation# of# dendritic# complexity# by#semaphorin#3A#through#Farp1.#J#Neurosci#34:7999X8009.##Chedotal#A,#Del#Rio#JA,#Ruiz#M,#He#Z,#Borrell#V,#de#Castro#F,#Ezan#F,#Goodman#CS,#TessierXLavigne#M,#Sotelo#C,#Soriano#E#(1998)#Semaphorins#III#and#IV#repel#hippocampal#axons#via#two#distinct#receptors.#Development#125:4313X4323.###Cheng#Y,#Quinn#JF,#Weiss#LA#(2013)#An#eQTL#mapping#approach#reveals#that#rare#variants#in#the#SEMA5A#regulatory#network#impact#autism#risk.#Hum#Mol#Genet#22:2960X2972.##Collingridge#GL,#Kehl#SJ,#McLennan#H#(1983)#Excitatory#amino#acids#in#synaptic#transmission#in#the#Schaffer#collateralXcommissural#pathway#of#the#rat#hippocampus.#J#Physiol#334:33X46.##Collingridge#GL,#Peineau#S,#Howland#JG,#Wang#YT#(2010)#LongXterm#depression#in#the#CNS.#Nat#Rev#Neurosci#11:459X473.##Courchesne#E,# Campbell# K,# Solso# S# (2011)#Brain# growth# across# the# life# span# in# autism:# ageXspecific#changes#in#anatomical#pathology.#Brain#Res#1380:138X145.##Cowan#WM,#Fawcett# JW,#O’Leary#DD,#Stanfield#BB#(1984)#Regressive#events# in#neurogenesis.#Science#225:1258–1265.###Dong#Z,#et#al.#Hippocampal#longXterm#depression#mediates#spatial#reversal#learning#in#the#Morris#water#maze.#Neuropharm#64:65X73.##Duan#Y,#Wang#SH,#Song#J,#Mironova#Y,#Ming#GL,#Kolodkin#AL,#Giger#RJ#(2014)#Semaphorin#5A#inhibits#synaptogenesis#in#early#postnatalX#and#adultXborn#hippocampal#dentate#granule#cells.#eLife#3:#e04390.##Dudek#SM,#Bear#MF#(1992)#Homosynaptic#longXterm#depression#in#area#CA1#of#hippocampus#and#effects#of#NXmethylXDXaspartate#receptor#blockade.#Proc#Natl#Acad#Sci#USA#89:4363X4367.##Ebert#DH,#Greenberg#ME#(2013)#ActivityXdependent#neuronal#signaling#and#autism#spectrum#disorder.#Nature#493:327X337.##! 72!Eickholt#BJ,#Morrow#R,#Walsh#FS,#Doherty#P#(1997)#Structural#features#of#collapsin#required#for#biological# activity# and# distribution# of# binding# sites# in# the# developing# chick.# Mol# Cell#Neurosci#9:358X371.###Engert#F,#Bonhoeffer#T#(1999)#Dendritic#spine#changes#associated#with#hippocampal#longX#term#synaptic#plasticity.#Nature#399:66X70.##Erturk# A,# Wang# Y,# Sheng# M# (2014)# Local# pruning# of# dendrites# and# spines# by# caspaseX3Xdependent#and#proteasomeXlimited#mechanisms.#J#Neurosci#34:1672X1688.##Flavell#SW,#Cowan#CW,#Kim#TK,#Greer#PL,#Lin#Y,#Paradis#S,#Griffith#EC,#Hu#LS,#Chen#C,#Greenberg#ME# (2006)# ActivityXdependent# regulation# of# MEF2# trascription# factors# suppresses#excitatory#synapse#number.#Science#311:1008X1012.##Folstein#S,#Rutter#M#(1977)#Infantile#autism:#a#genetic#study#of#21#twin#pairs.# J#Child#Psychol#Psychiatry#18:297X321.##Gaugler#T,#et#al.#(2014)#Most#genetic#risk#for#autism#resides#with#common#variation.#Nat#Genetics#46:881X885.###Ge#Y,#Dong#Z,#Bagot#RC,#Howland#JG,#Phillips#AG,#Wong#TP,#Wang#YT#(2010)#Hippocampal#longXterm#depression#is#required#for#the#consolidation#of#spatial#memory.#Proc#Natl#Acad#Sci#USA#107:16697X16702.##Gherardi# E,# Love# CA,# Esnouf# RM,# Jones# EY# (2004)# The# Sema# domain.# Curr# Opin# Struct# Biol#14:669X678.###Ginzburg#VE,#Roy#PJ,#Culotti# JG# (2002)#Semaphorin#1a#and#semaX#phorin#1b#are#required# for#correct# epidermal# cell# positioning# and# adhesion# during#morphogenesis# in# C.# elegans.#Development#129:2065X2078.##Goldberg#JL,#Vargas#ME,#Wang#JT,#Mandemakers#W,#Oster#SF,#Sretavan#DW,#Barres#BA#(2004)#An#oligodendrocyte# lineageXspecific#semaphorin,#Sema5A,# inhibits#axon#growth#by#retinal#ganglion#cells.###Granger# AJ,# Nicoll# RA# (2013)# Expression# mechanisms# underlying# longXterm# potentiation:# a#postsynaptic#view,#10#years#on.#Philos#Trans#R#Soc#Lond#B#Biol#Sci#369:#20130136##! 73!Gras#C,#EizXVesper#B,#Jaimes#Y,#Immenschuh#S,#Jacobs#R,#Witte#T,#Blasczyk#R,#Figueiredo#C#(2014)#Secreted# semaphorin# 5A# activates# immune# effector# cells# and# is# a# biomarker# for#rheumatoid#arthritis.#Arthritis#Rheumatol#66:1461X1471.##Greger#IH,#Esteban#JA#(2007)#AMPA#receptor#biogenesis#and#trafficking.#Curr#Opin#Neurobiol#17:289X297.##Hanley# JG,# Henley# JM# (2005)# PICK1# is# a# calciumXsensor# for# NMDAXinduced# AMPA# receptor#trafficking.#EMBO#J#24:3266X3278.##Hayashi#Y,#Shi#SH,#Esteban#JA,#Piccini#A,#Poncer#JC,#Malinow#R#(2000)#Driving#AMPA#receptors#into#synapses#by#LTP#and#CaMKII:#requirement#for#GluR1#and#PDZ#domain#interaction.#Science#287:2262X2267.##Hazlett#HC,#Poe#M,#Gerig#G,#Smith#RG,#Provenzale#J,#Ross#A,#Gilmore#J,#Piven#J#(2005)#Magnetic#resonance#imaging#and#head#circumference#study#of#brain#size#in#autism#birth#through#age#2#years.#JAMA#Psychiatry#62:1366X1376.##Hilario#JD,#RodinoXKlapac#LR,#Wang#C,#Beattie#CE#(2009)#Semaphorin#5A#is#a#bifunctional#axon#guidance#cue#for#axial#motoneurons#in#vivo.#Dev#Biol#326:190X200.##Hooks#BM,#Chen#C#(2006)#Distinct#roles# for#spontaneous#and#visual#activity# in#remodeling#of#retinogeniculate#synapse.#Neuron#52:#281X291.##Huber# AB,# Kolodkin# AL,# Ginty# DD,# Cloutier# JF# (2003)# Signaling# at# the# growth# cone:# ligandXreceptor#complexes#and#the#control#of#axon#growth#and#guidance.#Annu#Rev#Neurosci#26:509X563.##Huganir#RL,#Nicoll#RA#(2013)#AMPARs#and#synaptic#plasticity:#the#last#25#years.#Neuron#80:704X717.##Hung#AY,#Sheng#M#(2002)#PDZ#domains:#structural#modules#for#protein#complex#assembly.#J#Biol#Chem#277:5699X5702.##Hunt#DL,#Castillo#PE#(2012)#Synaptic#plasticity#of#NMDA#receptors:#mechanisms#and#functional#implications.#Curr#Opin#Neurobiol#22:496X508.##Inagaki#S,#Ohoka#Y,#Sugimoto#H,#Fujioka#S,#Amazaki#M,#Kurinami#H,#Miyazaki#N,#Tohyama#M,#Furuyama# T# (2001)# Sema4c,# a# transmembrane# semaphorin,# interacts# with# a# postXsynaptic#density#protein,#PSDX95.#J#Biol#Chem#276:9174X9181.#! 74!#Innocenti#GM,#Price#DJ# (2005)#Exuberance# in# the#development#of# cortical#networks.#Nat#Rev#Neurosci#6:#955X965.##International#Molecular#Genetic#Study#of#Autism#Consortium#(2001)#A#genome#wide#screen#for#autism:#strong#evidence#for#linkage#to#chromosomes#2q,#7q,#and#16p.#Am#J#Hum#Genet#69:570X581.##Jan#YN,#Jan#LY#(2010)#Branching#out:#mechanisms#of#dendritic#arborization.#Nat#Rev#Neurosci#11:316X328.##Jurado# S,# Biou# V,# Malenka# RC# (2010)# A# calcineurin/AKAP# complex# is# required# for# NMDA#receptorXdependent#longXterm#depression.#Nat#Neurosci#13:1053X1055.###Just# MA,# Cherkassy# VL,# Keller# TA,# Kana# RK,# Minshew# NJ# (2007)# Functional# and# anatomical#cortical# underconnectivity# in# autism:# evidence# from# an# fMRI# study# of# an# executive#function#task#and#corpus#callosum#morphometry.#Cerebral#Cortex#17:951X961.##Just#MA,#Keller#TA,#Malave#VL,#Kana#RK,#Varma#S#(2012)#Autism#as#a#neural#systems#disorder:#a#theory#of#frontalXposterior#underconnectivity.#Neurosci#Biobehav#Rev#36:1292X1313.###Kameyama#K,#Lee#HK,#Bear#MF,#Huganir#RL#(1998)#Involvement#of#a#postsynaptic#protein#kinase#A#substrate#in#the#expression#of#homosynaptic#longXterm#depression.#Neuron#21:1163–1175.###Kandler#K,#Katz#LC,#Kauer#JA#(1998)#Focal#photolysis#of#caged#glutamate#produces# longXterm#depression#of#hippocampal#glutamate#receptors.#Nat#Neurosci#1:119–123.##Kano#M,#Haskimoto#K# (2009)# Synapse# elimination# in# the# central# nervous# system.# Curr#Opin#Neurobiol#19:154X161.##Kantor#DB,#Chivatakarn#O,#Peer#KL,#Oster#SF,#Inatani#M,#Hansen#MJ,#Flanagan#JG,#Yamaguchi#Y,#Sretavan# DW,# Giger# RJ,# Kolodkin# AL# (2004)# Semaphorin# 5A# is# a# bifunctional# axon#guidance# cue# regulated# by# heparan# and# chondroitin# sulfate# proteoglycans.# Neuron#44:961X975.##Karpova# A,#Mikhaylova#M,# Thomas#U,# Knopfel# T,# Behnisch# T# (2006)# Involvement# of# protein#synthesis#and#degradation#in#longXterm#potentiation#of#Schaffer#collateral#CA1#synapses.#J#Neurosci#26:4949X4955.##! 75!Kauer#J,#Malenka#RC#(2007)#Synaptic#plasticity#and#addiction.#Nat#Rev#Neurosci#8:844X858.##Kehoe#LA,#Bellone#C,#De#Roo#M,#Zandueta#A,#Dey#PN#PerezXOtano# I,#Muller#D# (2014)#GluN3A#promotes#dendritic#spine#pruning#and#destabilization#during#postnatal#development.# J#Neurosci#34:9213X9221.##Kerchner#GA,#Nicoll#RA#(2008)#Silent#synapses#and#the#emergence#of#a#postsynaptic#mechanism#for#LTP.#Nat#Rev#Neurosci#9:813X825.##Kim#E,#Sheng#M#(2004)#PDZ#domain#proteins#of#synapses.#Nat#Rev#Neurosci#5:771X781.##Kim#CH,#Chung#HJ,#Lee#HK,#Huganir#RL#(2001)#Interaction#of#the#AMPA#receptor#subunit#GluR2/3#with#PDZ#domains#regulates#hippocampal#longXterm#depression.#Proc#Natl#Acad#Sci#USA#98:11725–11730.##Kolodkin# AL,# Matthes# DJ,# Goodman# CS# (1993)# The# semaphorin# genes# encode# a# family# of#transmembrane#and#secreted#growth#cone#guidance#molecules.#Cell#75:1389X1399.##Kolodkin# AL,#Matthes# DJ,# O'Connor# TP,# Patel# NH,# Admon# A,# Bentley# D,# Goodman# CS# (1992)#Fasciclin# IV:# sequence,# expression,# and# function# during# growth# cone# guidance# in# the#grasshopper#embryo.#Neuron#9:831X845.##Kopec#CD,#Li#B,#Wei#W,#Boehm#J,#Malinow#R#(2006)#Glutamate#receptor#exocytosis#and#spine#enlargement# during# chemically# induced# longXterm# potentiation.# J# Neurosci# 26:2000X2009.##Koppel# AM,# Feiner# L,# Kobayashi# H,# Raper# JA# (1997)# A# 70# amino# acid# region# within# the#semaphorin#domain#activates#specific#cellular#response#of#semaphorin#family#members.#Neuron#19:531X537.###Kumanogoh#A,#Marukawa#S,#Suzuki#K,#Takegahara#N,#Watanabe#C,#Ch’ng#E,#Ishida#I,#Fujimura#H,#Sakoda#S,#Yoshida#K#et#al.#(2002)#Class#IV#semaphorin#Sema4A#enhances#TXcell#activation#and#interX#acts#with#TimX2.#Nature#419:629X633.##Kumanogoh#A,#Watanabe#C,#Lee#I,#Wang#X,#Shi#W,#Araki#H,#Hirata#H,#Iwahori#K,#Uchida#J,#Yasui#T,#et#al.#(2000)#Identification#of#CD72#as#a#lymphocyte#receptor#for#the#class#IV#semaphorin#CD100:#a#novel#mechanism#for#regulating#B#cell#signaling.#Immunity#13:621X631.##Law# JW,# Lee# AY# (2012)# The# role# of# semaphorins# and# their# receptors# in# gliomas.# J# Signal#Transduct#2012:902854.#! 76!Lee# HK,# Kameyama# K,# Huganir# RL,# Bear# MF# (1998)# NMDA# induces# longXterm# synaptic#depression# and# dephosphorylation# of# the# GluR1# subunit# of# AMPA# receptors# in#hippocampus.#Neuron#21:1151X1162.##Lee#HK,#Takamiya#K,#Han#JS,#Man#H,#Kim#CH,#Rumbaugh#G,#Yu#S,#Ding#L,#He#C,#Petralia#RS,#et#al.#(2003)#Phosphorylation#of# the#AMPA#receptor#GluR1# subunit# is# required# for# synaptic#plasticity#and#retention#of#spatial#memory.#Cell#112:631–643.##Lee#HK,#Takamiya#K,#He#K,#Song#L,#Huganir#RL#(2010)#Specific#roles#of#AMPAreceptor#subunit#GluR1#(GluA1)#phosphorylation#sites#in#regulating#synaptic#plasticity#in#the#CA1#region#of#hippocampus.#J#Neurophysiol#103:479X489.###Lett#RL,#Wang#W,#O'Connor#TP#(2009)#Semaphorin#5B#is#a#novel#inhibitory#cue#for#corticofugal#axons.#Cereb#Cortex#19:1408X1421.##Li#Z,# Jo# J,# Jia# JM,#Lo#SC,#Whitcomb#DJ,# Jiao#S,#Cho#K,#Sheng#M#(2010)#CaspaseX3#activation#via#mitochondria#is#required#for#longXterm#depression#and#AMPA#receptor#internalization.#Call#141:859X871.##Lin#DT,#Huganir#RL# (2007)# PICK1# and#phosphorylation# of# the# glutamate# receptor# 2# (GluR2)#AMPA# receptor# subunit# regulates# GluR2# recycling# after# NMDA# receptorXinduced#internalization.#J#Neurosci#27:13903X13908.##Liu#XB,#Low#LK,# Jones#EG,#Cheng#HJ# (2005)#Stereotyped#axon#pruning#via#plexin# signaling# is#associated#with#synaptic#complex#elimination#in#the#hippocampus.#J#Neurosci#25:9124X9134.##Liu#RQ,#Wang#W,#Legg#A,#Abramyan#J,#O’Connor#TP#(2014)#Semaphorin#5B#is#a#repellent#cue#for#sensory# afferents# projecting# into# the# developing# spinal# cord.# Development# 141:1940X1949.###Lu#WY,#Man#HY,#Ju#W,#Trimble#WS,#MacDonald#JF,#Wang#YT#(2001)#Activation#of#synaptic#NMDA#receptors# induces# membrane# insertion# of# new# AMPA# receptors# and# LTP# in# cultured#hippocampal#neurons.#Neuron#29:243X254.###Lu#W,#Shi#Y,#Jackson#AC,#Bjorgan#K,#During#MJ,#Sprengel#R,#Seeburg#PH,#Nicoll#RA#(2009)#Subunit#composition# of# synaptic# AMPA# receptors# revealed# by# a# singleXcell# genetic# approach.#Neuron#62:254X268.##! 77!Luo#Y,#Raible#D,#Raper# JA# (1993)#Collapsin:# a# protein# in# brain# that# induces# the# collapse# and#paralysis#of#neuronal#growth#cones.#Cell#75:217X227.##Madronal#N,#DelgadoXGarcia#JM,#Gruart#A#(2007)#Differential#effects#of#longXterm#potentiation#evoked#at#the#CA3XCA1#synapse#before,#during,#and#after#acquisition#of#classical#eyeblink#conditioning#in#behaving#mice.#J#Neurosci#27:12139X12146.##Makino#H,#Malinow#R#(2009)#AMPA#receptor#incorporation#into#synapses#during#LTP:#the#role#of#lateral#movement#and#exocytosis.#Neuron#64:381–390.##Malenka#RC,#Bear#MF#(2004)#LTP#and#LTD:#an#embarrassment#of#riches.#Neuron#44:5X21.##Malinow#R,#Malenka#RC# (2002)#AMPA# receptor# trafficking# and# synaptic# plasticity.#Annu#Rev#Neurosci#25:103X126.##Malinow# R,# Miller# JP# (1986)# Postsynaptic# hyperpolarization# during# conditioning# reversibly#blocks#induction#of#longXterm#potentiation.#Nature#320:529X530.##Mammen#AL,#Kameyama#K,#Roche#KW,#Huganir#RL#(1997)#Phosphorylation#of#the#alphaXaminoX3XhydroxyX5Xmethylisoxazole4Xpropionic# acid# receptor# GluR1# subunit# by#calcium/calmodulinXdependent#kinase#II.#J#Biol#Chem#272:#32528–32533.##Masuda#T,#Sakuma#C,#Yaginuma#H,#Taniguchi#M#(2014)#Attractive#and#permissive#activities#of#semaphorin#5A#toward#dorsal#root#ganglion#axons#in#higher#vertebrate#embryos.#Cell#Adh#Migr#8:603X606.##Matsuoka#RL,#Chivatakarn#O,#Badea#TC,#Samuels# IS,#Cahill#H,#Katayama#K,#Kumar#SR,#Suto#F,#Chedotal# A,# Peachey# NS,# Nathans# J,# Yoshida# Y,# Giger# RJ,# Kolodkin# AL# (2011)# Class# 5#transmembrane# semaphorins# control# selective# Mammalian# retinal# lamination# and#function.#Neuron#71:460X473.##Matsuzaki# M,# Honkura# N,# EllisXDavies# GC,# Kasai# H# (2004)# Structural# basis# of# longXterm#potentiation#in#single#dendritic#spines.#Nature#429:761X766.##Melin# M,# et# al.# (2006)# Constitutional# downregulation# of# SEMA5A# expression# in# autism.#Neuropsychobiology#54,#64X69.###Meng# Y,# Zhang# Y,# Jia# Z# (2003)# Synaptic# transmission# and# plasticity# in# the# adsence# of# AMPA#glutamate#receptor#GluR2#and#GluR3.#Neuron#39:163X176.##! 78!Miesenböck# G,# De# Angelis# DA,# Rothman# JE# (1998)# Visualizing# secretion# and# synaptic#transmission#with#pHXsensitive#green#fluorescent#proteins.#Nature#394:192X195.##Monyer#H,#Burnashev#N,#Laurie#DJ,#Sakmann#B,#Seeburg#PH#(1994)#Developmental#and#regional#expression#in#the#rat#brain#and#functional#properties#of# four#NMDA#receptors.#Neuron#12:529X540.##Morishita#W,#et#al.#(2007)#Activation#of#NR2BXcontaining#NMDA#receptors#is#not#required#for#NMDA#receptorX#dependent#longXterm#depression.#Neuropharmacol#52:#71–76.###Morris# RG,# Anderson# E,# Lynch# GS,# Baudry# M# (1986)# Selective# impairment# of# learning# and#blockade#of#longXterm#potentiation#by#an#NXmethylXDXaspartate#receptor#antagonist,#AP5.#Nature#319:774X776.##Mulkey# RM,# Herron# CE,# Malenka# RC# (1993)# An# essential# role# for# protein# phosphatases# in#hippocampal#longXterm#depression.#Science#261:1051–1055.##Mulkey# RM,# Endo# S,# Shenolikar# S,# Malenka# RC# (1994)# Calcineurin# and# inhibitorX1# are#components# of# a# proteinXphosphatase# cascade# mediating# hippocampal# LTD.# Nature#369:486–488.##Nakagawa#Y,#Takamatsu#H,#Okuno#T,#Kang#S,#Nojima#S,#Kimura#T,#Kataoka#TR,#Ikawa#M,#Toyofuku#T,# Katayama# I,# Kumanogoh# A# (2011)# Identification# of# semaphoring# 4B# as# a# negative#regulator#of#basophilXmediated#immune#responses.#J#Immunol#186:2881X2888.##Nagerl#UV,#Eberhorn#N,#Cambridge#SB,#Bonhoeffer#T#(2004)#Bidirectional#activityX#dependent#morphological#plasticity#in#hippocampal#neurons.#Neuron#44:759X767.##Negishi#M,#Oinuma#I,#Katoh#H#(2005)#Plexins:#axon#guidance#and#signal#transduction.#Cell#Mol#Life#Sci#62:1363X1371.###Neufeld#G,#Sabag#AD,#Rabinovicz#N,#Kessler#O#(2012)#Semaphorins#in#angiogenesis#and#tumor#progression.#Cold#Spring#Harb#Perspect#Med#2:a006718.##Ng#T,#Ryu# JR,#Sohn# JH,#Tan#T,#Song#H,#Ming#GL,#Goh#EL#(2013)#Class#3#semaphorin#mediates#dendrite# growth# in# adult# newborn# neurons# through# Cdk5/FAK# pathway.# PLoS# One#8:e65572.##! 79!Nicholls# RE,# Alarcon# JM,# Malleret# G,# Carroll# RC,# Grody# M,# Vronskaya# S,# Kandel# ER# (2008)#Transgenic#mice#lacking#NMDARXdependent#LTD#exhibit#deficits#in#behavioral#flexibility.#Neuron#58:104X117.###Nicolas# CS,# et# al.# (2012)# The# JAK/STAT# pathway# is# involved# in# synaptic# plasticity.# Neuron#73:374X390.##O’Connor#TP,#Cockburn#K,#Wang#W,#Tapia#L,#Currie#E,#Bamji#SX#(2009)#Semaphorin#5B#mediates#synapse#elimination#in#hippocampal#neurons.#Neural#Dev#23,#4X18.##Oinuma#I,#Ishikawa#Y,#Katoh#H,#Negishi#M#(2004)#The#Semaphorin#4D#receptor#PlexinXB1#is#a#GTPase#activating#protein#for#RXRas.#Science#305:862X865.##Oster# SF,# Bodeker# MO,# He# F,# Sretavan# DW# (2003)# Invariant# Sema5A# inhibition# serves# an#ensheathing#function#during#optic#nerve#development.#Development#130:775X784.###Paoletti# P,# Bellone# C,# Zhou# (2013)# NMDA# receptor# subunit# diversity# impact# on# receptor#properties,#synaptic#plasticity#and#disease.#Nat#Rev#Neurosci#14:#383X400.##Paradis#S,#Harrar#DB,#Lin#Y,#Koon#AC,#Hauser#JL,#Griffith#EC,#Zhu#L,#Brass#LF,#Chen#C,#Greenberg#ME#(2007)#An#RNAiXbased#approach#identifies#molecules#required#for#glutamatergic#and#GABAergic#synapse#development.#Neuron#53:217X232.###Pasterkamp#RJ,#Giger#RJ#(2009)#Semaphorin#function#in#neural#plasticity#and#disease.#Curr#Opin#Neurobiol#19:263X274.##Peineau#S,#et#al.#(2007)#LTP#inhibits#LTD#in#the#hippocampus#via#regulation#of#GSK3β.#Neuron#53:703–717.###Pfeiffer#BE,#Zang#T,#Wilkerson#JR,#Taniguchi#M,#Maksimova#MA,#Smith#LN,#Cowan#CW,#Huber#KM#(2010)#Fragile#X#mental#retardation#protein#is#required#for#synapse#elimination#by#the#activityXdependent#transcription#factor#MEF2.#Neuron#66:191X197.##Philippe#A,#et#al.#(1999)#GenomeXwide#scan#for#autism#susceptibility#genes.#Hum#Mol#Genetics#8:805X812.##Purohit# A,# Sadanandam# A,# Myneni# P,# Singh# RK# (2014)# Semaphorin# 5A# mediated# cellular#navigation:#connecting#nervous#system#and#cancer.#Biochim#Biophys#Acta#1846:485X493.##! 80!Püschel#AW,#Adams#RH,#Betz#H#(1995)#Murine#semaphorin#D/collapsin#is#a#member#of#a#diverse#gene#family#and#creates#domains#inhibitory#for#axonal#extension.#Neuron#14:941X948.##Qu#X,#Wei#H,#Zhai#Y,#Que#H,#Chen#Q,#Tang#F,#Wu#Y,#Xing#G,#Zhu#Y,#Liu#S,#Fan#M,#He#F# (2002)#Identification,#characterization#and#functional#study#of#the#two#novel#human#members#of#the#semaphoring#gene#family.#J#Biol#Chem#38:35574X35585.##Rabacchi#SA,#Solowska#JM,#Kruk#B,#Luo#Y,#Raper#JA,#Baird#DH#(1999)#CollapsinX1/SemaphorinX11/D#is#regulated#developmentally#in#purkinje#cells#and#collapses#pontocerebellar#mosey#fiber#neuronal#growth#cones.#J#Neurosci#19:4437X4448.##Risch#N,#et#al.#(1999)#A#genomic#screen#of#autism:#evidence#for#a#multilocus#etiology.#Am#J#Hum#Genet#65:493X507.##Rocca#DL,#et#al.#(2013)#The#small#GTPase#Arf1#modulates#Arp2/3Xmediated#actin#polymerization#via#PICK1#to#regulate#synaptic#plasticity.#Neuron#79:293X307.##Roche#KW,#O’Brien#RJ,#Mammen#AL,#Bernhardt#J,#Huganir#RL#(1996)#Characterization#of#multiple#phosphorylation#sites#on#the#AMPA#receptor#GluR1#subunit.#Neuron#16:1179–1188.##Rollmann#SM,#Yamamoto#A,#Goossens#T,#Zwarts#L,#CallaertsXVegh#Z,#Callaerts#P,#Norga#K,#Mackay#TF,# Anholt# RR# (2007)# The# early# developmental# gene# Semaphorin# 5c# contributes# to#olfactory#behavior#in#adult#Drosophila.#Genetics#176:947X56.##Sadanandam#A,#Varney#ML,#Singh#RK#(2008)#Identification#of#semaphorin#5A#interacting#protein#by#applying#apriori#knowledge#and#peptide#complementarity#related#to#protein#evolution#and#structure.#Genomics#Proteomics#Bioinformatics#6:163X174.##Sadanandam#A,#Rosenbaugh#EG,#Singh#S,#Varney#M,#Singh#RK#(2010)#Semaphorin#5A#promotes#angiogenesis# by# increasing# endothelial# cell# proliferation,# migration,# and# decreasing#apoptosis.#Microvasc#Res#79:1X9.##Sahay# A,# Kim# CH,# Sepkuty# JP,# Cho# E,# Huganir# RL,# Ginty# DD,# Kolodkin# AL# (2005)# Secreted#semaphorins# modulate# synaptic# transmission# in# the# adult# hippocampus.# J# Neurosci#25:3613X3620.##Sankaranarayanan#S,#Ryan#TA#(2000)#RealXtime#measurements#of#vesicleXSNARE#recycling# in#synapses#of#the#central#nervous#system.#Nat#Cell#Biol#2:197X204.##! 81!Santos# MS,# Li# H,# Voglmaier# SM# (2009)# Synaptic# vesicle# protein# trafficking# at# the# glutamate#synapse.#Neurosci#158:189X203.###Schafer#DP,#Lehrman#EK,#Kautzman#AG,#Koyama#R,#Mardinly#AR,#Yamasaki#R,#Ransohoff#RM,#Greenberg#ME,#Barres#BA,#Stevens#B#(2012)#Microglia#sculpt#postnatal#neural#circuits#in#an#activity#and#complementXdependent#manner.#Neuron#74:691X705.##Schmitz#C,#Rezaie#P#(2008)#The#neuropathology#of#autism:#Where#do#we#stand?#Neuropathol#Appl#Neurobiol#34,#4X11.##Schuldiner#O,#Yaron#A#(2015)#Mechanisms#of#developmental#neurite#pruning.#Cell#Mol#Life#Sci#72:101X119.####Schultze#W,#Eulenburg#V,#Lessmann#V,#Herrmann#L,#Dittmar#T,#Gundelfinger#ED,#Heumann#R,#Erdmann# KS# (2001)# Semaphorin4F# interacts# with# the# synapseXassociated# protein#SAP90/PSDX95.#J#Neurochem#78:482X489.##Scoville# WB,# Milner# B# (1957)# Loss# of# recent# memory# after# bilateral# hippocampal# lesions.# J#Neurol,#Neurosurg,#Psychiatry#20:11X21.##Seidenman#KJ,#Steinberg#JP,#Huganir#R,#Malinow#R#(2003)#Glutamate#receptor#subunit#2#serine#880#phosphorylation#modulates# synaptic# transmission#and#mediates#plasticity# in#CA1#pyramidal#cells.#J#Neurosci#23:9220X9228.##Semaphorin# Nomenclature# Committee# (1999)# Unified# nomenclature# for# the#semaphorins/collapsins.#Cell#97:551X552.###Selcher#JC,#Xu#W,#Hanson#JE,#Malenka#RC,#Madison#DV#(2012)#Glutamate#receptor#subunit#GluA1#is# necessary# for# longXterm# potentiation# and# synapse# unsilencing,# but# not# longXterm#depression#in#mouse#hippocampus.#Brain#Research#1435:8X14.##Shelly#M,# Cancedda# L,# Lim#BK,# Popescu#AT,# Cheng#P,# Gao#H,# Poo#MM# (2011)# Semaphorin3A#regulates#neuronal#polarization#by#suppressing#axon#formation#and#promoting#dendrite#growth.#Neuron#71:433X446.##Sheng#M,#Hoogenraad#CC#(2007)#The#postsynaptic#architecture#of#excitatory#synapses:#a##more#quantitative#view.#Annu#Rev#Biochem#76:823X847.####! 82!Shi#SH,#Hayashi#Y,#Petralia#RS,#Zaman#SH,#Wenthold#RJ,#Svoboda#K,#Malinow#R#(1999)#Rapid#spine#delivery#and#redistribution#of#AMPA#receptors#after#synaptic#NMDA#receptor#activation.#Science#284:1811X1816.##Shi#S,#Hayashi#Y,#Esteban#JA,#Malinow#R#(2001)#SubunitXspecific#rules#governing#AMPA#receptor#trafficking#to#synapses#in#hippocampal#pyramidal#neurons.#Cell#105:331X343.##Shinoda#Y,#Tanaka#T,#TominagaXYoshino#K,#Ogura#A#(2010)#Persistent#synapse#loss#induced#by#repetitive#LTD#in#developing#rat#hippocampal#neurons.#PLoS#One#5:#e10390.##Steffenburg#S,#Gillberg#C,#Hellgren#L,#Andersson#L,#Gillberg#IC,#Jakobsson#G,#Bohman#M#(1989)#A#twin#study#of#autism#in#Denmark,#Finland,#Iceland,#Norway,#and#Sweden.#J#Child#Psychol#Psychiatry#30:405X416.##Stevens#B,#Allen#NJ,#Vazquez#LE,#Howell#GR,#Christopherson#KS,#Nouri#N,#Micheva#KD,#Mehalow#AK,#Huberman#AD,#Stafford#B,#Sher#A,#Litke#AM,#Lambris#JD,#Smith#SJ,#John#SWM,#Barres#BA# (2007)# The# classical# complement# cascade#mediates# CNS# synapse# elimination.# Cell#131:1164X1178.#####Südhof#TC#(2013)#Neurotransmitter#release:#the#last#millisecond#in#the#life#of#a#synaptic#vesicle.#Neuron#80:675X690.##Takahashi# T,# Nakamura# F,# Jin# Z,# Kalb# R,# Strittmatter# S# (1998)# Semaphorins# A# and# E# act# as#antagonists#of#neuropilinX1#and#agonists#of#neuropilinX2#receptors.#Nat#Neurosci#1:487X493.##Takamori#S#(2006)#VGLUTs:#'exciting'#times#for#glutamatergic#research?#Neurosci#Res#55:343X351.##Tamagnone#L,#Artigiani#S,#Chen#H,#He#Z,#Ming#GI,#Song#H,#Chedotal#A,#Winberg#ML,#Goodman#CS,#Poo#M,#TessierXLavigne#M,#Comoglio#PM#(1999)#Plexins#are#a#large#family#of#receptors#for#transmembrane,#secreted,#and#GPIXanchored#semaphorins#invertebrates.#Cell#99:71X80.##Tang#G,# et# al.# (2014)#Loss#of#mTORXdependent#macroautophagy# causes#autisticXlike# synaptic#pruning#deficits.#Neuron#83:1131X1143.###TessierXLavigne# M,# Goodman# CS# (1996)# The# molecular# biology# of# axon# guidance.# Science#274:1123X1133.###! 83!Tran# TS,# Rubio#ME,# Clem#RL,# Johnson# D,# Case# L,# TessierX# Lavigne#M,# Huganir# RL,# Ginty# DD,#Kolodkin#AL#(2009)#Secreted#semaphorins#control#spine#distribution#and#morphogenesis#in#the#postnatal#CNS.#Nature,#462:1065X1069.##Tsai#NP,#Wilkerson# JR,#Guo#W,#Maksimova#MA,#DeMartino#GN,#Cowan#CW,#Huber#KM#(2012)#Multiple#autismXlinked#genes#mediate#synapse#elimination#via#proteasomal#degradation#of#a#synaptic#scaffold#PSDX95.#Cell#151:1581X1594.##Tsankova#NM,#Kumar#A,#Nestler#EJ#(2004)#Histone#modifications#at#gene#promoter#regions#in#rat#hippocampus# after# acute# and# chronic# electroconvulsive# seizures.# J# Neurosci# 24:5603X5610.##Tsien#JZ,#Huerta#PT,#Tonegawa#S#(1996)#The#essential#role#of#hippocampal#CA1#NMDA#receptorXdependent#synaptic#plasticity#in#spatial#memory.#Cell#87:1327X1338.##Uesaka#N,#Uchigashima#M,#Mikuni#T,#Nakazawa#T,#Nakao#H,#Hirai#H,#Aiba#A,#Watanabe#M,#Kano#M# (2014)# Retrograde# semaphorin# signaling# regulates# synapse# elimination# in# the#developing#mouse#brain.#Science#344:1020X1023.##VarelaXEchavarria# A,# Tucker# A,# Puschel# AW,# Guthrie# S# (1997)# Motor# axon# subpopulations#respond# differentially# to# the# chemorepellents# netrinX1# and# semaphorin# D.# Neuron#18:193X207.###Vickers#CA,#Wyllie#DJA#(2007)#LateXphase#protein#synthesisXdependent#longXterm#potentiation#in#hippocampal#CA1#pyramidal#neurons#with#destabilized#microtubule#networks.#British#J#Pharmacol#151:1071X1077.###Waites#CL,#Craig#AM,#Garner#CC#(2005)#Mechanisms#of#vertebrate#synaptogenesis.#Annu#Rev#Neurosci#28:251X274.###Watanabe#M,#Inoue#Y,#Sakimura#K,#Mishina#M#(1992)#Developmental#changes#in#distribution#of#NMDA#receptor#channel#subunit#mRNAs.#Neuroreport#3:1138X1140.##Weiss#LA,#Arking#DE,#Gene#Discovery#Project#of#Johns#Hopkins,#The#Autism#Consortium#(2009)#A#genomeXwide#linkage#and#association#scan#reveals#novel#loci#for#autism.#Nature#461,#802X808.##Whitlock#JR,#Heynen#AJ,#Shuler#MG,#Bear#MF#(2006)#Learning#induces#longXterm#potentiation#in#the#hippocampus.#Science#313:1093X1097.##! 84!Williams# ME,# de# Wit# J,# Ghosh# A# (2010)# Molecular# mechanisms# of# synaptic# specificity# in#developing#neural#circuits.#Neuron#68:9X18.##Won#H,#Mah#W,#Kim#E#(2013)#Autism#spectrum#disorder#causes,#mechanisms,#and#treatments:#focus#on#neuronal#synapses.#Front#Mol#Neurosci#6:1X26.##Xie# C,#Markesbery#WR,# Lovell#MA# (2000)# Survival# of# hippocampal# and# cortical# neurons# in# a#mixture# of# MEM+# and# B27Xsupplemented# neurobasal# medium.# Free# Radic# Biol# Med#28:665X672.##Xu#W,#et#al.#(2008)#Molecular#dissociation#of#the#role#of#PSDX95#in#regulating#synaptic#strength#and#LTD.#Neuron#57:248X262.##Yagishita# S,# Murayama#M,# Ebihara# T,# Maruyama# K,# Takashima# A# (2015)# Glycogen# synthase#kinaseX3BXmediated# phosphorylation# in# the# most# CXterminal# region# of# protein#interacting#with#C#kinase#1#(PICK1)#regulates#the#binding#of#PICK1#to#glutamate#receptor#subunit#GluA2.#J#Biol#Chem#[In#Press].###Yazdani#U,#Terman#JR#(2006)#The#semaphorins.#Genome#Biol#7:211.##Yoon#BJ,#Smith#GB,#Heynen#AJ,#Neve#RL,#Bear#MF#(2009)#Essential#role#for#a#longXterm#depression#mechanism#in#ocular#dominance#plasticity.#Proc#Natl#Acad#Sci#USA#106:9860X9865.###Yu# X,# Wang# G,# Gilmore# A,# Yee# AX,# Li# X,# Xu# T,# Smith# SJ,# Chen# L,# Zuo# Y# (2013)# Accelerated#experienceXdependent#pruning#of#cortical#synapses#in#EphrinXA2#knockout#mice.#Neuron#80:64X71.##Zeng#H,#et#al.#(2001)#ForebrainXspecific#calcineurin#knockout#selectively#impairs#bidirectional#synaptic#plasticity#and#working/episodicXlike#memory.#Cell#107:617X629.###Zhou#Q,#Homma#KJ,#Poo#MM#(2004)#Shrinkage#of#dendritic#spines#associated#with#longX#term#depression#of#hippocampal#synapses.#Neuron#44:749X757.## #


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items