Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The potential role of MMP2 in the response of tendons to mechanical stimulation Huisman, Elise Suzanne 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2016_february_huisman_elise.pdf [ 1.81MB ]
Metadata
JSON: 24-1.0215911.json
JSON-LD: 24-1.0215911-ld.json
RDF/XML (Pretty): 24-1.0215911-rdf.xml
RDF/JSON: 24-1.0215911-rdf.json
Turtle: 24-1.0215911-turtle.txt
N-Triples: 24-1.0215911-rdf-ntriples.txt
Original Record: 24-1.0215911-source.json
Full Text
24-1.0215911-fulltext.txt
Citation
24-1.0215911.ris

Full Text

THE POTENTIAL ROLE OF MMP2 IN THE RESPONSE OF TENDONS TO MECHANICAL STIMULATIONbyElise Suzanne HuismanM.Sc., Eindhoven University of Technology, 2010A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDoctor of PhilosophyinThe Faculty of Graduate and Postdoctoral Studies(Rehabilitation Sciences)THE UNIVERSITY OF BRITISH COLUMBIA(Vancouver)October 2015© Elise Suzanne Huisman, 2015iiAbstractTendinopathy is a common problem in the population leaving people in pain, unable to work or bephysically active. High levels of musculotendinous strain (resulting from heavy lifting or obesity) andrepetitive movements are risk factors for tendinopathy. Because MMPs and TIMPs play a crucial role inthe repair, remodeling, and degeneration of collagen fibers in tendon, the aim of this dissertation was toidentify the potential roles of MMPs, TIMPs and collagens type I and III, using in-vitro and in-vivomodelsof overuse and repair. Having identified a potential role of MMP2 in these laboratory models, a clinicalstudy was also conducted to evaluate the serum levels of MMPs and TIMPs in patients who hadexperienced Achilles tendon rupture.Cultured tendon cells, controlled by high frequency or high strain stimulation, simulating overuse,increased MMP2 mRNA expression. Collagen type I mRNA and protein levels were increased in culturedtendon cells by controlled mechanical stimulation with intermittent rest periods compared tocontinuous mechanical stimulation.In both the normal healthy rabbit and an overuse model of the rabbits’ Achilles tendon, regionaldifferences in mRNA expression and histological structure were observed.  After two weeks of repetitivetendon loading, collagen intensity, measured by second harmonic generation microscopy, wasdecreased in the flexor digitorum superficialis (FDS) tendon compared to the contralateral FDS tendonand healthy control FDS tendon, indicating damage or remodelling of the collagen in response tooveruse. Structural changes were observed locally, combined with elevated tissue MMP2 protein levelssuggesting a possible contribution of MMP2 to the development of early collagen degradation.iiiMMP2 appears to play a role early in the response of tendon to repetitive loading. It is detectable inserum after 1 week of overuse, and high repetition number and high strain level are independentmodulators of MMP2 expression in tenocytes. However, MMP2 levels in serum decline to baseline after2 weeks in the animal model, and were downregulated compared to controls in patients with a moreAchilles tendon rupture. Further research into the specific processes of tendon injury and repair playedby MMP2 are warranted.ivPrefaceA version of Chapter 3 has been published:Huisman E, Lu A, McCormack RG, Scott A. Enhanced collagen type I synthesis by human tenocytessubjected to periodic in-vitromechanical stimulation. BMC Musculoskelet Disord. 2014 Nov21;15(1):386.Elise Huisman designed and carried out the experiments, designed the quantitative image analysis,performed the statistical analysis and wrote the manuscript. Alex Lu performed theimmunocytochemistry and designed and carried out the quantitative image analysis. Dr. R. McCormackdesigned and administered the clinical protocol for screening patients and collecting human tendontissue and clinical data. Dr. Alex Scott conceived of the study, designed experiments and helped writingthe manuscript. All authors read and approved the final manuscript.A version of Chapter 4 has been published:Huisman ES, Andersson G, Scott A, Reno CR, Hart DA , Thornton GM. Regional molecular and cellulardifferences in the female rabbit Achilles tendon complex: potential implications for understandingresponses to loading. J Anat. 2014 May;224(5):538–47.This Chapter was collaboration between the Scott lab at the Centre for Hip Health and Mobility at theUniversity of British Columbia (UBC), Vancouver, BC, Canada and McCaig Institute for Bone and JointHealth at the University of Calgary, Calgary, AB, Canada.vElise Huisman designed the study, carried out experiments, performed statistical analysis, wrote themanuscript and approved the final manuscript. Dr. Gustav Andersson designed the study, carried outexperiments, helped writing the manuscript and approved the final manuscript. Carol R. Reno carriedout experiments and approved the final manuscript. Dr. Alex Scott and Dr. David A. Hart read andapproved the final manuscript. Dr. Gail M. Thornton designed the study, helped writing the manuscriptand approved the final manuscript.Approval was obtained from the UBC Clinical Research Ethics Board for the studies described inChapters 2 and 3 with certificate number: H10-0020Approval was obtained from the UBC animal care committee for the study described in Chapter 4 withcertificate number: A12-0265.Approval was obtained from the UBC animal care committee for the study described in Chapter 5 withcertificate number: A12-0265.Approval was obtained from the UBC Clinical Research Ethics Board for the study described in Chapter 6with certificate number: H11-00933viTable of ContentsAbstract ...................................................................................................................................................... iiPreface....................................................................................................................................................... ivTable of Contents ...................................................................................................................................... viList of Tables.............................................................................................................................................. xiList of Figures............................................................................................................................................ xiiList of Abbreviations.................................................................................................................................xiv1. Introduction ...................................................................................................................................... 11.1 Tendon structure............................................................................................................21.2 Anatomy.........................................................................................................................21.2.1 Cell population ............................................................................................................... 41.2.2 Matrix............................................................................................................................. 61.2.3 Junctions ........................................................................................................................ 71.2.4 Tendon marker............................................................................................................... 71.3 Collagen..........................................................................................................................81.3.1 Synthesis ........................................................................................................................ 81.4 Tendon injuries ..............................................................................................................91.4.1 Pathology ....................................................................................................................... 9Clinical presentation ...................................................................................................... 9Microscopic presentation ............................................................................................10Chronic vs acute injury.................................................................................................12Different types of tendon injuries................................................................................131.4.2 Tendon repair............................................................................................................... 141.4.3 Inflammation................................................................................................................ 141.4.4 Adiposity and tendon tissue......................................................................................... 151.5 Mechanical stimulation................................................................................................161.5.1 Stress deprivation ........................................................................................................ 161.5.2 Cytokines and growth factors in response to mechanical loading .............................. 171.5.3 Exercise as tendon rehabilitation................................................................................. 191.6 Matrix metalloproteinases and tissue inhibitors of metalloproteinases.....................201.6.1 Synthesis and activity................................................................................................... 211.6.2 MMPs behavior in tendons.......................................................................................... 221.7 Experimental models to study tendon overuse...........................................................27vii1.7.1 In-vitro.......................................................................................................................... 271.7.2 In-vivo........................................................................................................................... 27Human models .............................................................................................................27Animal models..............................................................................................................28Rabbit model................................................................................................................301.8 Summary ......................................................................................................................311.9 Research questions and hypotheses............................................................................342. MMP2 expression in mechanically stimulated human tendon cells is modulated by frequency andstrain…………………………………………………………………………………………………………………………………………………..372.1 Background ..................................................................................................................372.2 Methods .......................................................................................................................392.2.1 Cell culture ................................................................................................................... 392.2.2 Mechanical stretching.................................................................................................. 392.2.3 RNA extraction and quantitative polymer chain reaction ........................................... 412.2.4 Human total MMP2 protein assay ............................................................................... 422.2.5 Zymography ................................................................................................................. 422.2.6 Immunocytochemistry (ICC) for pro-collagen types I and III ....................................... 432.2.7 Image Acquisition......................................................................................................... 442.2.8 Automated Image Analysis .......................................................................................... 442.2.9 Statistics ....................................................................................................................... 452.3 Results ..........................................................................................................................462.3.1 Frequency..................................................................................................................... 472.3.2 Strain ............................................................................................................................ 542.3.3 Strain and frequency interaction ................................................................................. 562.3.4 Protein activity ............................................................................................................. 562.3.5 Cell morphology ........................................................................................................... 572.4 Discussion.....................................................................................................................592.4.1 Frequency dependent mRNA expression..................................................................... 602.4.2 Strain magnitude dependent mRNA expression.......................................................... 613. Enhanced collagen type I synthesis by human tenocytes subjected to periodic in-vitromechanicalstretching..................................................................................................................................................653.1 Background ..................................................................................................................653.2 Methods .......................................................................................................................683.2.1 Cell culture ................................................................................................................... 68viii3.2.2 Mechanical stretching.................................................................................................. 683.2.3 RNA extraction and quantitative polymer chain reaction ........................................... 683.2.4 Immunocytochemistry and cell morphology analysis for pro-collagen types I and III 693.2.5 Statistics ....................................................................................................................... 693.3 Results ..........................................................................................................................703.3.1 Mechanical stretching of human tendon cells compared to control cells................... 703.3.2 Rest-inserted vs continuous stretching........................................................................ 713.3.3 Low vs high cycle number ............................................................................................ 733.3.4 Cell Morphology........................................................................................................... 753.4 Discussion.....................................................................................................................764. Regional molecular and cellular differences in the female rabbit Achilles tendon complex:potential implication for understanding responses to loading................................................................804.1 Background ..................................................................................................................804.2 Methods .......................................................................................................................834.2.1 Dissection and definition of regions ............................................................................ 844.2.2 RNA extraction and Reverse Transcription-Polymerase Chain Reaction..................... 844.2.3 Statistical analysis ........................................................................................................ 864.3 Results ..........................................................................................................................874.3.1 Anatomical findings – Macroscopic examination ........................................................ 874.3.2 Analysis of tendons from intact normal rabbits........................................................... 87Regional differences in tendon morphology................................................................87Regional differences in mRNA expression ...................................................................89Distal gastrocnemius ....................................................................................................89Distal flexor digitorum superficialis .............................................................................89Paratenon.....................................................................................................................894.3.3 Analysis of tendons from OVH rabbits ......................................................................... 90Regional differences in mRNA expression ...................................................................90Distal gastrocnemius ....................................................................................................90Distal flexor digitorum superficialis .............................................................................90Proximal medial gastrocnemius...................................................................................90Paratenon.....................................................................................................................904.3.4 Comparisons of tendons from both intact normal and OVH rabbits........................... 944.4 Discussion.....................................................................................................................96ix4.4.1 Influence of tendon region on mRNA expression ........................................................ 964.4.2 OVH effects on mRNA expression................................................................................ 985. Repetitive motion of the rabbit Achilles tendon complex induces changes in MMP2 levels ......1015.1 Background ................................................................................................................1015.2 Materials and methods ..............................................................................................1035.2.1 Animals....................................................................................................................... 1035.2.2 Experimental design................................................................................................... 1045.2.3 Blood samples ............................................................................................................ 1055.2.4 Achilles tendon dissection and definition of regions ................................................. 1055.2.5 RNA extraction and qPCR........................................................................................... 1075.2.6 Protein extraction ...................................................................................................... 1075.2.7 Zymography ............................................................................................................... 1085.2.8 Second harmonic generation (SHG) microscopy ....................................................... 1085.2.9 Statistics ..................................................................................................................... 1085.3 Results ........................................................................................................................1095.3.1 Histology..................................................................................................................... 1095.3.2 mRNA expression ....................................................................................................... 1105.3.3 MMP2 activity ............................................................................................................ 1125.4 Discussion...................................................................................................................1155.4.1 Regional patterns of MMP expression, activity, and injury ....................................... 1155.4.2 Effect of exercise on the Achilles tendon complex .................................................... 1166. Serum MMP, TIMP and lipid levels in patients with Achilles tendon rupture..............................1196.1 Background ................................................................................................................1196.2 Methods .....................................................................................................................1216.2.1 Participants ................................................................................................................ 1216.2.2 Blood samples ............................................................................................................ 1226.2.3 MMPs and TIMPs presence........................................................................................ 1226.2.4 IPAQ questionnaire and antemorphometrics ............................................................ 1236.2.5 Statistical analysis ...................................................................................................... 1236.3 Results ........................................................................................................................1246.3.1 Participants ................................................................................................................ 1246.3.2 Serum lipid levels ....................................................................................................... 1256.3.3 Serum MMP and TIMP levels ..................................................................................... 128x6.3.4 Self-reported physical activity.................................................................................... 1296.3.5 Relation between serum lipid levels and anthropometric measures ........................ 1296.4 Discussion...................................................................................................................1307. Discussion......................................................................................................................................1357.1 Summary of study conclusions...................................................................................1357.2 Strengths and limitations of the reported research with suggestions for future work………………………………………………………………………………………………………………………………1417.2.1 Mechanical stretching of cells.................................................................................... 1417.2.2 Suitability of the Backman model .............................................................................. 1427.2.3 Achilles tendon rupture study.................................................................................... 1437.2.4 Potential roles of other enzymes and matrix proteins not studied in the current thesis………………………………………………………………………………………………………………………………1447.2.5 Possible events upstream or downstream of MMP2 activity .................................... 145Clearance of MMP2....................................................................................................1497.2.6 Can MMP2 be directly manipulated in tendon cells to prove an effect on tendon? 1497.2.7 Potential ex-vivo experiments ................................................................................... 1517.2.8 Potential role(s) of MMP2 in tendon pathology, and the importance of both load andrepetition in the induction of MMP2 in human tendon cells ....................................................... 1527.2.9 Incorporation of rest periods during exercise may be a novel approach to tendonrehabilitation................................................................................................................................. 1527.2.10 The different regions of the rabbit Achilles tendon require separate analysis ......... 1537.2.11 MMP2 activity is increased locally and is also measurable in the circulation ........... 1547.2.12 Tendon rupture lipid levels and MMPs...................................................................... 1547.3 Does optimal loading for tendon repair exist? ..........................................................155Bibliography............................................................................................................................................157xiList of TablesTable 1.1 The main role of MMPs role in tendinopathy and rupture.........................................................24Table 1.2 The main role of TIMPs role in tendinopathy and rupture. ........................................................26Table 2.1 The loading protocol for load and frequency variation experiments. ........................................41Table 2.2  RT-qPCR primers.........................................................................................................................42Table 2.3 Pro-collagen type I and III protein levels from ICC......................................................................51Table 2.4 The relative intensity of MMP2 protein activity in the conditioned media of mechanicallystimulated cells and their controls on days 2 and 4 from zymography......................................................53Table 3.1 RT-qPCR primers..........................................................................................................................69Table 3.2 The effect of mechanical stretching on mRNA expression compared with controls..................71Table 4.1 RT-PCR Primers............................................................................................................................85Table 4.2 mRNA expression differences in regions of tendon of intact normal and OVH rabbits. ............91Table 4.3 mRNA expression data for tendons from intact normal and OVH rabbits of the genes thatexhibit significant differences between the rabbit groups.........................................................................95Table 5.1 qPCR primers.............................................................................................................................107Table 5.2 The serum MMP2 activity of the exercised and control rabbits analyzed by zymography. .....113Table 6.1 Participant antemorphometrics. ...............................................................................................125Table 6.2 Serum lipid values for subjects with ATR and controls. ............................................................126Table 6.3 The relation between lipid levels and anthropometric measures. ...........................................130xiiList of FiguresFigure 1.1 A schematic overview of tendon structure..................................................................................4Figure 1.2 Histological images of healthy (A) and two week overused (B) rabbit FDS tendon, 100xmagnification. .............................................................................................................................................11Figure 1.3 Flow chart of the development of the different routes of tendon pathology...........................32Figure 2.1 The MMP2 protein level (ng/ml) comparing controls and all four mechanically stimulatedgroups (Experiment) pooled on day 2 (p<0.05) and day 5 measured by the total MMP2 protein assay. .47Figure 2.2 The influence of high and low frequency stimulation on the mRNA expression of collagen typeI, III, MMP14, MMP2 and TIMP2 by day measured by qPCR. .....................................................................48Figure 2.3 The MMP2 protein level comparing A) High and low frequency stretched cells and B) high andlow strain stretched groups combined on days 2 and 5 analyzed by the total MMP2 protein assay........50Figure 2.4 Zymography of the conditioned media of the controls High Frequency – High Strain and LowFrequency –Low Strain on days 2 and 4. ....................................................................................................53Figure 2.5 The influence of high and low strain after 1-5 days of mechanical stretching on the mRNAexpression of collagen type I, III, MMP14, MMP2 and TIMP2 measured by qPCR. ...................................55Figure 2.6 Immunocytochemistry images of pro-collagen III, 10x magnification.......................................58Figure 3.1 Effect of rest-inserted stretching vs continuous stretching on mRNA expression (A, B) andprotein levels (C) of collagen type I and III. ................................................................................................72Figure 3.2 Effect of cycle number on mRNA expression (A, B) and protein levels (C) of collagen type I andIII. ................................................................................................................................................................74Figure 3.3 Immunocytochemistry images (pro-collagen type III), 10x magnification. ...............................75Figure 4.1 Posterior view of the rabbit calf-muscles and tendons. ............................................................82Figure 4.2 Haematoxylin and eosin stained intact normal rabbit Achilles tendon complex at a 20xmagnification. .............................................................................................................................................88Figure 5.1 Posterior view of the rabbit calf-muscles and tendons. ..........................................................106Figure 5.2 The collagen density (AU), by SHG microscopy, of the contralateral and exercised Achillestendon complex, by individual region. .....................................................................................................110Figure 5.3 The mRNA expression of MMP14, MMP2 and TIMP2 of the contralateral and exercisedAchilles tendon complex displayed by region, analyzed by qPCR. ...........................................................111Figure 5.4 The mRNA expression of MMP14, MMP2 and TIMP2 of the four examined regions of theAchilles tendon complex displayed by experimental condition, analyzed by qPCR.................................112xiiiFigure 5.5 Serum zymography of two rabbits (control and experiment) before (pre), after one week (W1)and after two weeks (W2). .......................................................................................................................113Figure 5.6 The MMP2 protein activity (AU) of the exercised Achilles tendon tissue measured byzymography...............................................................................................................................................114Figure 5.7 Zymography of the FDS, LG, MG and P from the contralateral (left) and exercised leg (right)...................................................................................................................................................................114Figure 5.8 SHG microscopy images of the rabbit Achilles tendon complex, 20x objective. The scale barrepresents 100 μm....................................................................................................................................118Figure 6.1 Serum lipid profiles of ATR and controls. ................................................................................127Figure 6.2 The serum A) MMP and B) TIMP concentrations of the ATR and control groups. ..................128Figure 7.1 A simplified scheme of the signaling pathways believed to be involved in the response totensile stress. ............................................................................................................................................146Figure 7.2 Schematic representation of MMP activation. ........................................................................147Figure 7.3 Schematic representation of mitogen activation protein kinase (MAPK) pathways for MMPexpression and activity. ............................................................................................................................148xivList of AbbreviationsA2 M - α-2—macroglobulinAFU - Arbitrary fluorescent unitAGE - Advanced glycation end productAKT - protein kinase BAT - Achilles tendonATR - Achilles tendon ruptureAU - Arbitrary unitsBFGF - Basic fibroblast growth factorBMI - Body mass indexCI - Confidence intervalCOL - CollagenCOMP - Cartilage oligomeric matrix proteinCOX - CyclooxygenaseCSA - Cross sectional areaCT - Calcaneal tendonCTGF - Connective tissue growth factorxvDDFT - Deep digital flexor tendonDFDS - Distal flexor digitorum superficialisDG - Distal gastrocnemiusDNA - Deoxyribonucleic acidECM - Extracellular matrixERK - Extracellular signal-regulated kinaseFAK - Focal adhesion kinaseFDP - Flexor digitorum profundusFDS - Flexor digitorum superficialisFGF - Fibroblast growth factorGAG - GlycosaminoglycanGAPDH - Glyceraldehyde 3-phosphate dehydrogenaseHDL-C - High density lipoproteinH&E - Haematoxylin and eosinHGF - Hepatocyte growth factorHP - HydroxylysylpryridinolineHRT - Hormone replacement therapyxviHSR - Heavy slow resistanceICC - ImmunocytochemistryICTP - COOH terminal telopeptide region of collagen type IIFNϒ - InterferonϒIGF - Insulin like growth factorIGF-BP - Insulin like growth factor binding proteinsIL - InterleukinJNK - c-Jun-N-terminal kinaseKO - Knock outLDL-C - Low density lipoprotein cholesterolLG - Lateral gastrocnemiusLMM - Linear mixed modelsLP - LysylpyridinolineLRP - Low density lipoprotein receptor related proteinMAPK - Mitogen activated protein kinaseMG - Medial gastrocnemiusMMP - Matrix metalloproteinasexviiNO - Nitric oxide, (i = inducible, e = endothelial, n = neuronal)NOS - Nitric oxide synthaseOVH - Ovaryhysterectomyox-LDL - oxidized LDLP - ParatenonPCM - Pericellular matrixPFDS - Proximal flexor digitorum superficialisPG – ProteoglycanPGE - ProstaglandinPI3K - phosphoinositide 3-kinasePICP - COOH terminal pro-peptide of collagen type IPLG - Proximal lateral gastrocnemiusPMG - Proximal medial gastrocnemiusPT - Patellar tendonqPCR - Quantitative polymer chain reactionRC - Rotator cuffRNA - ribonucleic acid (m = messenger, si = silencing)xviiiRQ - Relative quantitySCX - ScleraxisSE - Standard ErrorSFT - Superficial flexor tendonSHG - Second harmonic generationSLRP - Small leucine rich proteoglycanSMC - Smooth muscle cellSP - Substance PSPSS - Statistical package for social sciencesSST - Supraspinatus tendonTC - Total cholesterolTIMP - Tissue inhibitor of metalloproteinasesTGF-β - Tissue Growth Factor betaTN - Tenascin-CTNF-α - Tumor necrosis factor alphaTS2 - ThrombospondinVEGF - Vascular endothelial growth factor11. IntroductionTendons transmit force between bone and muscle and are thus essential for any physical movement1.Overexertion2 and repetitive movements2,3, both problematic in the workplace and during sportsactivities, can cause tendon injuries. A sedentary life style (physical inactivity) often leads to increasedweight 4 that results in: 1) higher loads in the tendon and, 2) may result in fatty infiltration in the tendonand thus loss of tendon strength5.Major load-bearing tendons such as the Achilles tendon, lateral elbow tendons, and the rotator cufftendons, are frequently injured at the workplace. The cost associated with workplace injuries in the USwas $127 billion USD in 2004; 34% of this amount was attributed to musculoskeletal injuries includingthe major tendons3.Tendon overuse accounts for 30-50% of all sport injuries6. The incidence of Achilles overuse injuries inthe general population has been reported to be 2.35 per 10007 while in runners the incidence of Achillestendon injuries ranges between 6-18%6,8,9; many recreational athletes also suffer from Achilles tendonproblems10.  Tendon overuse is associated with pain and potential swelling as the tendon structuredeteriorates, although significant structural deterioration may also be present in the absence ofsymptoms 11.  A tendon that degenerates becomes weaker12 and thus may eventually reach the pointwhere it cannot withstand loads caused by daily activities without pain.A tendon is a complex structure that needs the appropriate amount and type of mechanical loadthrough physical activity to remain healthy. This thesis is primarily focused on the effects of tendonoveruse (characterized predominantly by mechanical stimulation such as overuse or repetitive2stretching). Basic tendon principles will be described first, after which the focus will shift to mechanicalstimulation and its effects on the tendon.Tendinopathy is a generic description of pathologies that occur in and around tendons mainly fromoveruse13,14. It is defined as a clinical syndrome of tendon pain and thickening, diagnosed according tospecific signs and symptoms13. Apart from tendinopathy, tendon rupture occurs as well and in this thesisthe term tendon rupture is used specifically for tendons that manifest with full or partial ruptures of thetendon.1.1 Tendon structureTendons are subjected to compressive and/or tensile forces, dependent on the location within the body.Their strength is typically greater than ligaments15 and they can experience up to six to twelve times thebody weight during physiological movements16.Tendons mainly consist of collagen type I – the most abundant protein in the body - which has a fiber-like structure. The tendon also contains proteoglycans (PG) – which are proteins that can attract water(further explained in 1.1.3). Collagens and PG together form the extracellular matrix (ECM). Thecomponents of the ECM are produced by tendon cells - which are embedded in the ECM - and releasedinto the ECM. Tendon ECM can be seen as a flexible, viscoelastic network that allows for biochemicaland biophysical processes and is able to convert mechanical stimuli into molecular signals bytransmitting the signal to the cells17. Remodeling and formation of ECM are also essential for processeslike wound healing.1.2 AnatomyCollagen type I is the most abundant collagen in tendon tissue and accounts for approximately 95% oftotal collagen content. Collagen types III and V make up the majority of the remaining 5%. Collagen type3III is smaller and thus weaker than collagen type I and is mostly associated with tendon repair, or withassociated loose connective tissues18. Mature, cross-linked collagen gives the tendon its high tensilestrength19,20. Five tropocollagen units form fibrils and several fibrils together a collagen fiber (Figure 1.1).Several fibers comprise a primary bundle, also known as a subfascicle (Figure 1.1). Multiple subfasciclestogether are known as a secondary bundle (fascicle) and combining multiple fascicles results in a tertiarybundle (Figure 1.1). The subfasicles, fascicles and tertiary fiber bundles are surrounded by endotenon,also referred to as paratenon, which is a sheet of loose connective tissue1,20–22.  A few tertiary bundlestogether form a tendon which is enveloped by paratenon which is a fatty, areolar tissue where the bloodvessels and nerves are concentrated. Tendons are innervated and a rich nerve system is present in theparatenon which can branch into the epitenon and endotenon13,23,24. The blood supply of tendons variesdepending on the anatomical location, but small capillaries generally run longitudinally in theendotendon.4Figure 1.1 A schematic overview of tendon structure.Wang 2006, reproduced with permission 20.1.2.1 Cell populationTendons contain many different cell types; however, the most prevalent cell type in tendons is thetenocyte. Tenocytes are a type of fibroblast – a connective tissue cell that mainly produces collagen -that are thought to be distinct from other connective tissue cells, however no specific markers fortenocytes or tendon have been discovered19. They are spindle shaped and have a sparse cytoplasm.Tenocytes continuously produce the components of the ECM and are located between collagen fibers inlongitudinal arrays that are linked by functional gap junctions20,25–27. Tenoblasts are immature tenocytes.5They are spindle shaped and contain many cytoplasmic organelles that reflect their high metabolicactivity. With age, they become elongated and transform into tenocytes 22. Tendon cells are organizedinto linear arrays along the axis of force between and parallel to the fascicles28. These cells live withinthe pericellular matrix (PCM) which is a specialized matrix within the ECM28. Type VI collagen, fibrillin-2 –a protein that is essential in the synthesis of elastic fibers and versican – a type of PG; are abundantthroughout the PCM28. Some areas of tendons, mainly the superficial and insertional regions, have acartilage like structure; fibrochondrocytes – a cartilage like cell that can produce fibers- are arranged incolumns in those locations15. Adipocytes – fatty tissue cells - are present in tendons as well, they havemainly been found on the superficial aspect of the tendon29,30. Endothelial cells – thin flattened cells thatline the inner layer of blood or lymph vessels - and smooth muscle cells are found in the endo- andparatenon and are mostly associated with blood vessels20,31,32. Synoviocytes are also found lining theinner layer of the paratenon31,33.Inflammatory cells – the variety of cells that participate in the inflammatory response - are also presentin tendon tissue, predominantly when the tendons are injured as they play a key role in the tendonhealing process34. Mast cells are observed in injured rotator cuff 35, patellar36 and Achilles tendons, aswell as in the paratenon37. Mast cells contain a wide variety of inflammatory mediators and growthfactors that can induce inflammation, excessive cell proliferation and inappropriate matrix remodeling38.Macrophages are another type of inflammatory cell that lyse debris at the injury site and secrete a rangeof modulatory cytokines and growth factors. Human and murine tendon stem progenitor cells (TSPCs)have also been putatively identified in a unique niche within the ECM of tendons. Characteristicsexhibited by TSPCs were clonogenicity, multipotency and self-renewal39.61.2.2 MatrixPGs are glycosylated proteins and are located in the tendon ECM. Tendon ECM contains two main typesof PG: 1) the small leucine-rich PGs (SLRPs) such as decorin and biglycan, and 2) the large aggregatingPGs like aggrecan and versican40. The functions of each PG are determined by the structure of theprotein core and the glycosaminoglycan (GAG) chain (the water binding unit in the PG structure). Ingeneral, PGs are thought to facilitate fibrillar slippage – the sliding of adjacent fibrils parallel to the axisof deformation – in areas prone to friction e.g. gliding over bony prominences20,41. They also modulatethe formation of the collagen type I fibrils42,43. The expression of PGs varies among and within tendons,and is related to the location and function of the tendon 29. It has been shown that in a tendon injury theamount of GAG increases as well as the levels of SLRPs and large aggregating proteoglycans36,41.Decorin constitutes 80% of the PG content in the tensional regions of the tendon. Aggrecan and versicanare members of the large aggregating PGs found in the tensional regions of the tendon. Both PGs attractand bind water due to negatively charged GAG chains that are attached to the core protein40. Aggrecan,includes many hydrophilic GAG molecules, is a PG common in tissues that are subject to compression,such as cartilage, but which is also present in tendons, particularly in compressed regions20,40. Decorinmodulates collagen fibril formation through its interaction with collagen fibers. The distal region of theAchilles tendon has a fibrocartilagenous structure and contains increased levels of aggrecan andbiglycan in comparison to the proximal regions40. The distal region may also contain increased levels oflarge PG to perform a lubricating role17,40,44. The predominant PG in the proximal tensional regions oftendon is the small leucine-rich PG decorin44. In addition, Vogel et al. have demonstrated the presenceof low levels of the large aggregating PG aggrecan within tensional regions of tendon45.7Besides the collagens and PGs there is a small amount of elastin present46. Tendon also contains smallquantities of tenascin-C embedded in the ECM19,20. Tenascin-C is mostly present in compressed regionsand has anti-adhesive properties47.1.2.3 JunctionsAs muscle and tendon are attached to each other in series, great forces are transmitted from the muscleto the tendon via the myotendinous junction, making the junctions a critical area for proper functioningof the musculoskeletal system1,23.The osteotendinuous junction is a transition zone from fibrocartilage to lamellar bone; the zone consistsof four parts that occupy just 1mm of the tendon’s length23. Tendon near the junction is infiltrated withchondrocytes which are located in the unmineralized fibrocartilage region. This zone graduallytransitions into a mineralized fibrocartilage zone followed by lamellar bone1,23. The collagen fibers insertbetween the lamellae of cortical bone however, they do not merge with the individual collagen systemof the lamellae48. Blood vessels are minimal in this area, however enough to be visible on color Dopplerultrasound1,49. Collagen fibers from the tendon join with sarcolemma – the membrane of the musclecell48. This area is considered the growth plate of the tendon as cells elongate rapidly and depositcollagen in this region during growth1,23.1.2.4 Tendon markerA tendon-specific marker – a unique identifier, such as a receptor or transcription factor - has not beendetected; however, several studies have attempted to characterize the phenotype of tenocytesaccording to cell proliferation rate, morphology, and expression of specific collagens, integrins andproteoglycans. A tendon-specific marker would make it easier to monitor tendon injury and healing, and8to isolate or characterize cultured tendon cells. Tenocytes of many species have been cultured, andcollagen levels have been used to assess proper functioning of the cells at different passages. Healthyhuman tendon cells and  tenocytes from pathological human tendons have been cultured up to passage950. With increasing passage number, cells became more rounded, were more widely spaced, andconfluent cell density declined. The ratio of collagen type III to collagen type I increased from passage 1-850. Decorin expression significantly decreased with passage number while integrin subunit β1 did notchange51. Therefore, using early passage tenocytes can more closely maintain key aspects of thetenocyte phenotype when designing in-vitro experiments50. Tenomodulin is expressed in tendons,ligaments and in the eyes. It appears to regulate tenocyte proliferation and is involved in collagen fibrilmaturation52. Scleraxis (SCX) is another potential tenocyte marker. SCX plays a key role in embryonictendon: SCX knock-out (KO) mice did not form load bearing tendons, only a small and fragile fiber likestructure53. Substances like tenomodulin and SCX are crucial for the development of healthy functioningtendons; however they are not unique identifiers for tendon; SCX is also expressed in cartilage, bone,muscle, and meniscus. Lung or liver expresses negligible amounts of SCX54. SCX is a crucial molecule forthe differentiation of all force-transmitting and intermuscular tendons and for the activation of thecollagen type IaI gene in mouse tendon fibroblasts.1.3 Collagen1.3.1 SynthesisCollagen is the main component of tendons and gives the tendon its tensile strength. Collagen synthesisstarts in the cell nucleus with transcription of mRNA, following which pre-procollagen (polypeptide α-chains) is formed on tenocyte ribosomes. Three polypeptide α-chains bind together by the formation of9disulphide bonds between the ends of the polypeptide α-chains, also known as the registration site. Thethree polypeptide α-chains form a triple helical structure; the pro-collagen molecule. Pro-collagen isreleased by the cell into the extracellular space where the registration site is cleaved off; the moleculethat remains is known as tropo-collagen. Through crosslinking of the tropo-collagen molecules, a stablecollagen fibril is formed. Initially, crosslinks are formed between two amino acids. With aging tissue,these crosslinks connect with another adjacent amino acid to form mature trifunctional crosslinks. Wellknown crosslinks are the hydroxylysylpryridinoline (HP) and lysylpyridinoline (LP) which connect threeadjacent collagen molecules55,56. Multiple collagen fibrils link together at a periodicity of 64nm, givingrise to a striated appearance under the electron microscope1,17,23. Collagen type I in tendon ispredominantly deposited in the direction of tensile force1. Another form of crosslinking is non-enzymaticglycation resulting in the in-vivo formation of irreversible amino acid modifications, known as advancedglycation end products (AGEs). An example of an AGE is pentosidine,  a well-studied fluorescentcrosslink55,56. AGEs accumulate with age, as the collagen half-life is extremely long– a positive correlationof AGE levels with age was found for skin57, lens proteins58,  and cartilage55,59. Pentosidine can serve as asuitable biomarker to estimate age and remodeling of collagen network in tissue55,56.1.4 Tendon injuries1.4.1 PathologyClinical presentationA tendon overuse injury may be visible or felt when palpated60. Tendon thickening is a visible andpalpable finding which can either be localized (e.g., a nodule can sometimes be felt in chronic situations)or along the length of the tendon body (e.g. in acute situations when the tendon is grossly swollen)61.Pain is usually provoked during or after the application of tensile or compressive load through the10tendon. Swelling may not occur in every case, which is one reason that ultrasound or MRI are often usedto help with diagnosis. The main findings on ultrasound and MRI are a disrupted and heterogeneousappearance of the tendon extracellular matrix62.Microscopic presentationThe nature of tendon overuse pathology can be assessed using light or polarized microscopy. To date,two grading systems have been developed: 1) Movin63 and 2) Bonar64, both with modifications49,65–67.These grading systems score different morphological features of tendons between grades 0-4, withgrade 0 a healthy tendon and grade 4 a degenerated tendon. Under the microscope, a healthy tendondisplays a dense, well defined parallel albeit slightly wavy collagen bundle (crimping) (Figure 1.2A). Thecollagen displays a homogenous polarization pattern. With increasing damage, fiber bundles becomeseparated and in the worst cases there is complete loss of architecture and marked separation oftendon bundles. The collagen fiber polarization diminishes and a clear loss of normal polarization isapparent in highly degenerated tendons. Collagen disruption is a sign of tendon damage; the fibersappear disorganized and the collagen density is decreased and the fascicles show more waviness48(Figure 1.2B). Histopathology has shown cell rounding as well as areas of hypo- and hyper-cellularity. Ina healthy tendon, there are discrete and uniformly dense cells. With the development of overuse injurythe tissue becomes hyper-cellular with the cells aligned in runs, and areas of hypo- or hyper- cellularityare apparent.  Tendon cells are normally elongated with spindle shaped nuclei and no obviouscytoplasm. With injury, the cells and nuclei become rounder with conspicuous cytoplasm.  In healthytendons there are inconspicuous blood vessels between the fiber bundles; with increasing tendondamage, capillaries and arterioles proliferate among the fiber bundles. Eventually areas with >3 capillaryclusters per 10 fields are visible, or conversely the pathological area may become relatively a-vascular.11Figure 1.2 Histological images of healthy (A) and two week overused (B) rabbit FDS tendon, 100x magnification.The tendon tissue was stained with heamatoxylin (blue, nuclei) and eosin (pink, collagen).AB12Chronic vs acute injuryTendon injuries can either be acute or chronic and can be caused by intrinsic or extrinsic factors or acombination of both. Intrinsic factors are features of the individual which are thought to predispose toinjury, such as musculoskeletal alignment and biomechanical faults, e.g. hyper-pronation of the feet.Extrinsic factors represent exposures to potentially damaging conditions; overuse and/or excessiveloading falls in the category of extrinsic factors22.Tendon rupture is often a spontaneous acute injury where extrinsic factors dominate, however intrinsicfactors also play a role. Degenerative findings in spontaneously ruptured tendons are present in most ofthe patients22,68. Kannus and Josza analyzed hundreds of ruptured and control tendons using electronmicroscopy and their findings are as follows69. Most spontaneous ruptured tendons demonstratedhypoxic changes characterized by lipid vacuoles, enlarged lysosomes and granulated endoplasmicretinaculum.  Mucoid degeneration was another apparent finding which was characterized by largevacuoles between collagen fibers and between collagen fibrils. The collagen fibrils were irregular in sizeand shape. Tenocytes did not show their characteristic elongated appearance; instead their cytoplasmcontained dilated vacuoles. Lipid cells were found between the collagen fibers and within the tendonproper. Usually the appearances of small, isolated groups of adipocytes were found. In advanced casesthe lipid cells appeared to disrupt the continuity of the collagen fibers.  Calcium deposits were alsoobserved however in only 5% of the tendons. Vascular changes were observed in 62% of the rupturedtendons; these changes included proliferative arteries and arterioles. Control tendons also showeddegenerative changes, which is in line with other research65,69,70.13Different types of tendon injuriesTendon pathology can differ depending on the location of injury: the tendon body, the paratenon or thesynovial sheath. Moreover, the structure, composition and cell phenotype of the tendon are related toits functional demands which is determined by its location within the body19. Some tendons mostlyexperience tensile loads while others experience compressive loads or a combination of both. Manytendons of the hand, foot, wrist and ankle are surrounded by a synovial sheath, while the Achilles,patellar and rotator cuff tendons do not have a synovial sheath. The Achilles and patellar tendonsexperience predominantly tensile loads while the rotator cuff experiences large compressive loads aswell71. For these reasons the pathology may differ. Paratenonitis is more likely to occur in synovialtendons; edema, swelling, hyperemia and infiltration of inflammatory cells are common signs of acutetenosynovitis. Within a few hours to several days, the exudate spreads to the tendon tissue resulting inimpaired movement of the tendon. In the chronic condition, fibroblasts proliferate and infiltration oflymphocyte is observed. The peritendinous tissue thickens and new connective tissue and adhesions arevisible, this creates friction in tendon movement. Ultimately this may become a chronic conditioncharacterized by triggering of the tendon due to a sudden release of the tendon from the thickenedtendon sheath71,72.Injury of the osseotendinous junction has a different pathology than of the tendon proper. Two typescan commonly be distinguished: 1) inflammation of a deep bursa, e.g. between the Achilles tendon andthe calcaneus and 2) inflammation of a superficial bursa, e.g. between the skin and Achilles tendon. Thefibrocartilaginous zone or adjacent bone can also become injured. The pathology of the rotator cufftendon is similar to that observed in the patellar and Achilles tendons. However, increased14fibrocartilaginous changes are observed in the rotator cuff tendon compared to the Achilles and patellartendons.1.4.2 Tendon repairAfter an acute injury at a defined point in time, tendons experience three overlapping healing phases22.The first phase is the inflammatory phase that typically lasts for a few days. This is demonstrated by aninvasion of monocytes, neutrophils, erythrocytes and macrophages. Tenocytes proliferate and migrateto the injured site to synthesize ECM components, collagen type III is mostly formed22. The inflammatoryphase is followed by the proliferative phase. In the proliferative phase, pro-inflammatory cytokines thatwere released or induced by macrophages signal to tendon cells to produce collagen type III and otherECM components; they are randomly arranged within the ECM, essentially forming a type of scar tissue.Neovascularisation – the formation of new blood vessels occurs during this phase.  The final phaseconsists of collagen cross-link maturation and ECM remodeling. The randomly deposited ECMcomponents are progressively re-organized to become more oriented with the direction of appliedtensile stress. Finally, a decrease in cellularity and vascularity occurs. This process can take up to oneyear or more22,73.1.4.3 InflammationInflammation was considered to be the cause of tendon pain with tendon overuse injuries before the1990s. Though, continued tendon research failed to detect appreciable quantities of inflammatorymediators or cells in painful tendons, and for that reason inflammation was assumed to be absent intendon overuse injuries74. However, with development of improved techniques and quantitativemethods, inflammatory cells –macrophages, T and B lymphocytes- were demonstrated to be present in15chronic human Achilles tendinopathy75. The presence of granulocytes was reported in ruptured tendonsthat were asymptomatic prior to rupture however, macrophages and T and B lymphocytes wereminimally present76,77. Multiple studies of chronic tendinopathic tissues in humans and animals havenow demonstrated an increased presence of inflammatory mediators, such as interleukins 1 and 6 (IL),cyclooxygenases 1 and 2 (COX) which produce prostaglandins, transforming growth factor beta isoforms(TGF-β), substance P (SP)78,79. In addition, tenocytes become more metabolically active and respond tocytokines and growth factors74,76. Particularly in the early phases of a tendon overuse injury,inflammation can be present. It has been shown that prostaglandin E2 (PGE2), a substance that isinvolved in the inflammatory process, is increased in the peritendinous space of human Achilles tendonafter exercise 80. Long term increases of PGE1 in the peritendon have been seen to result in degenerationand may cause inflammatory processes in the tendon78,81. Inflammatory changes may be initiated in theepitenon and paratenon. These tissues are more highly vascularized and thus have the potential todemonstrate greater inflammatory changes.1.4.4 Adiposity and tendon tissueA higher BMI or waist-hip ratio, mostly caused by increased adiposity, are risk factors for tendonpathology5. A higher body weight leads to increased tendon strains, contributing to overloadpathology82. Being overweight usually coincides with having increased lipid levels in the circulation oftenin the form of elevated cholesterol concentrations83. Low lipoprotein cholesterol (LDL-C) in thecirculation not only adheres to the vessel wall, but its by-products are deposited in tendons causing aweakened tendon structure making it susceptible to rupture84–86. LDL-C binds to sulphatedglycosaminoglycans, that are prevalent in tendon tissue and become oxidized87. Oxidzed LDL (OxLDL-C)can initiate signaling events in tendon cells including reduced type I collagen and increased matrix16metalloproteinase 2 (MMP2) expression88. It has been postulated that inflammation is a process thatneeds to occur for tendon tissue repair to occur22,34. However, inflammation is also present in othersituations, e.g. chronic diseases such as arthritis and obesity89. The bodies of heavily overweight ordiabetic people are in a chronic inflammatory state90–92 due in part to increased circulating amounts ofpro-inflammatory cytokines like tumor necrosis factor alpha (TNF-α) and IL-6 produced by excessiveadipocytes. These inflammatory responses could impair or prolong the healing of a tendon injury91.1.5 Mechanical stimulationTenocytes are sensitive to mechanical stimuli. Mechanotransduction is the process that transmitsmechanical stimuli to the cell, which then reacts by altering its mRNA expression. Tendons continuouslyexperience loads, and the tendon ECM is in a state of ongoing remodeling, which consists of a balance ofanabolic and catabolic processes that are in homeostasis in a healthy tendon61,93–96. Several theoriesexist which attempt to explain the role of mechanical stimulation in the development of tendon overuseinjuries.1.5.1 Stress deprivationOveruse is often referred to as the cause for tendon injuries; however, at a microscopic level, failure ofcollagen fibers as a result of inadequate cell-matrix response  could lead to the development of regionswithin the tendon that have micro-ruptured, and therefore no longer experience tensile load. Thisunder-stimulation of tendon cells is hypothesized to induce a more catabolic phenotype, includingincreased expression of MMPs that could contribute to further progression of injury and loss of tendonfunction97.171.5.2 Cytokines and growth factors in response to mechanical loadingSeveral studies reported that mechanical stimulation of the tendon or tendon cells leads to changes inthe release of substances which may be related to tendon degeneration or inflammation. Varyingmodels from in-vitro using tendon cells to ex-vivo using tendon to in-vivo using rabbit models are usedto study the release of cytokines in response to mechanical stimulation. For example, cyclic mechanicalloading stimulates the expression of COX1/ 2, enzymes responsible for the production of PGE298. COX1 isexpressed in many tissues and is thought to play a role in the maintenance of basal levels of PGE2. COX2is upregulated by inflammatory response in many tissues96,99–101. IL6, vascular endothelial growth factor(VEGF), TGF-β and fibroblast growth factor (FGF) are also either released or activated to a greater extentfollowing mechanical loading98. IL6 induces (VEGF) expression and it supports tendon healing andinduces IL-10 as well. VEGF is involved in neovascularization, can improve mechanical properties andplays a role in neovascularization and remodeling of the tendon102.TGF-β1 is necessary for normal tendon development and tendon repair. It is involved in fetaldevelopment of tendons, modulation of scar tissue formation after wound, ligament and tendon tobone healing. Expression increases during the inflammatory phase and promotes proliferation andmigration of tendon healing and acts to stimulate collagen synthesis103. However an upregulation ofTGF-β can lead to scar formation by collagen type III formation that in turn leads to a weakenedtendon103–105. Thus, when elevated levels of TGF-β1 are present it is likely to have a degenerative effecton the tendon.Insulin like growth factor (IGF)-1 is upregulated in the early stages of the inflammatory process oftendon healing. It is involved in chemotaxis and proliferation of fibroblasts and inflammatory cells to thesite of injury. IGF-1 increases deoxyribonucleotide acid (DNA) synthesis in tenocytes as well as in-vivo18healing by increasing cell proliferation, enhancing matrix synthesis and improving tendon mechanicalproperties, and reducing time to recovery103. Administration of IGF-1 after Achilles tendon transection inrat, accelerated functional recovery with no biomechanical property impairments105. Thus far, IGF-1 hasshown to be beneficial to tendon repair.FGF plays a role in angiogenesis. FGF-2 is expressed by fibroblasts and inflammatory cells at the site oftendon repair and is associated with cell proliferation, migration, collagen production and angiogenesis.Several studies examining FGF expression in tendon cells and tendon tissue have been conducted. Thesestudies mostly reported the restorative capacity of FGF indicated by optimal biomechanical performanceof tendon tissue106–110. However, Chan et al. reported no improvements in mechanical or functionalproperties in response to FGF when administered to a small transection in the rat patellar tendon111.Cytokines such as IL1α, IL1β, TNFα and INFϒ, are present in higher quantity in inflamed tendon comparedto healthy tendon112 and capable of stimulating MMP expression113. Inflammatory cells can alsosynthesize MMPs or TIMPs or induce their synthesis by neighbouring cell types. Macrophage-like cells ormacrophages that contain lipids (e.g. in atherosclerotic plaques) can produce high levels of interstitialcollagenase and stromelysin (MMP1/ 3)114. T-cells can stimulate the production of metalloproteinases bymononuclear phagocytes114. Macrophages continuously secrete TIMP2 in low levels115. A variety ofsignaling molecules involved in inflammation and repair such as IL-1β and TGFβ influence TIMP1expression by fibroblasts114. Cyclic stretching of 300 or 1800 cycles (1-10% strain, 1Hz followed by 24h ofstatic strain of 1% )of the deep digital flexor tendon (DDFT) of the forelimb of cows resulted in anincreased number of histological areas that showed COX2, IL6, MMP3/ 13  compared to controls 116.Injection of pro-inflammatory carrageenan near the DDFT of rats resulted in the presence of both latentand active forms of MMP9 at 12h which disappeared 24h after injection. The levels of  latent or activeMMP2 were not different from controls117.19Taken together, the evidence demonstrates that many cytokines and immunoregulatory cytokines andgrowth factors are continuously released or activated by mechanically stimulated tendon cells, howevertheir individual contributions to either degenerative/scarring or regenerative/healing responses remaincontroversial.1.5.3 Exercise as tendon rehabilitationTendon tissue adapts to mechanical loading to withstand mechanical loads during daily activities118. Toomuch load or load deprivation will cause degenerative changes; however, exercise has been shown tostrengthen tendons. Eccentric exercise – lengthening contraction of muscle and tendon- alone or incombination with concentric exercise –shortening contraction of the muscle - has been the foundationof rehabilitation programs mostly for Achilles and patellar tendinopathy9,119,120. Heavy slow resistancetraining led to increased collagen synthesis, as indicated by electron microscopic analysis of collagenfibril size and number121. Collagen synthesis can also increase after exercise which is more strenuousthan a typical rehabilitation protocol; an increased production of collagen type I after 1h of treadmillrunning at 12km/h, measured by ascertaining peritendinous COOH terminal pro-peptide of collagentype I (PICP) levels, was observed122. Longer duration exercise; 36km80 and marathon running, alsoincreased PICP levels at 72h123 and 96h post-run. Similarly, circulatory levels of PICP were elevated at72h after exercise as well123. However, increased collagen synthesis after exercise is not guaranteed, andmay be dependent on the parameters of mechanical stimulation. Shorter, more intense bouts of 67%maximum workload kicking exercise demonstrated a reduced synthesis rate 72h after exercise inpatellar tendon tissue124. The above studies also indicate that collagen synthesis can be measured inlocal fluid, circulation and tissue.20Another indication of tendon strengthening or weakening is its size and mechanical properties.Professional fencing and badminton players had an increased patellar tendon size and mechanicalproperties in the dominant leg125. Exercising the Achilles tendon at a strain of 4.55% resulted in anincrease of the stiffness and the elastic modulus126.  A 12 week heavy-slow-resistance (HSR) trainingprogram for the patellar tendon resulted in declined stiffness, a higher fibril density, and mean fibril areadecreased in tendinopathic tendons127. Another study using HSR resulted in reduced pain, highercollagen network turnover and a higher patient satisfaction immediately after and also at the half yearfollow-up121. Heavy and light resistance training increased the cross-sectional area (CSA) of the patellartendon at the distal location by 6% and 4%, respectively. The stiffness increased with heavy resistancetraining but not with light resistance training 128. Pain tends to increase during the exercise programs,however the pain is decreased at the end of the program and a long term pain reduction is seen aswell121,127.In summary, exercise can result in an increase in tendon cross-sectional area, collagen content, modulusand strength. Several studies have shown that in response to exercise, collagen synthesis increases andthere is an improvement in tendon mechanical properties and a reduction in pain. As such, exercise isincorporated in rehabilitation protocols, however protocols vary and the ideal exercise prescription hasnot yet been identified.1.6 Matrix metalloproteinases and tissue inhibitors of metalloproteinasesMMPs are a part of a larger zinc-dependent endopeptidase family. Because they are involved in thedegradation of the ECM in normal or pathological conditions, they are potentially important substancesto monitor in tendon injury studies. In total, 23 MMPs exist that can be subdivided into four categories,based on activity (Table 1.1). The collagenases cleave collagens in the ECM, the gelatinases cleavegelatin and collagen, the membrane-type MMPs are located on the membrane and the stromeleysins21cleave the non-collagenous components of the ECM. MMP activity is regulated by interaction with tissueinhibitors of MMPs (TIMPs). Four TIMPS exist; each MMP is specifically inhibited by a TIMP. Forexample, TIMP2 and TIMP3 effectively inhibit membrane-type MMPs (MT-MMPs), a function TIMP1cannot fulfill129. TIMP2 and TIMP4 can bind to pro-MMP2, while TIMP1 forms a complex withproMMP9129.1.6.1 Synthesis and activityMost cells synthesize and immediately secrete MMPs into the ECM; inflammatory cells however, canstore MMPs in neutrophil granules130,131. Tissue distribution of MMPs varies widely; some MMPs areconstitutively synthesized including MMP2, while others are synthesized mainly upon specificstimulation132. Within the cell, MMPs are synthesized as pro-peptides; they are inactive (latent). TheMMPs are kept in latent form by their cysteine residue that binds to zinc on the active site of theenzyme. Proteolytic removal of the pro-peptide will activate the MMP.There are four steps to the regulation of MMP activity: mRNA expression, compartmentalization,proenzyme activation and enzyme inactivation132. MRNA expression changes in response to mechanicalor chemical stimulation followed by the synthesis of latent MMPs. Compartmentalization is thesecretion and anchoring of the pro-MMP to the cell membrane. Locally, a high enzyme concentrationdevelops and targets the catalytic activity to specific substrates within the pericellular space132. Theactivation of MMPs is a critical control point. Insufficient degradation of the ECM would prevent normalcell migration while excessive degradation would result in loss of cell attachment to the ECM as well aspathologic destruction of connective tissue.22Latent gelatinases, pro-MMP2 (and pro-MMP9) are unique in that they can form a complex with TIMP2by binding to its hemopexin domain, for activation. This complex then binds to the active site of MMP14or membrane type 1-MMP (MT1-MMP). The complex, MT1-MMP/Pro-MMP2/TIMP2, is then cleaved byanother MT1-MMP. This activation process is completely different from the inhibition complex thatMMP2/TIMP2 form as the binding sites are different132–134.1.6.2 MMPs behavior in tendonsAs MMPs and TIMPS are among the main players that have so far been investigated in relation totendon homeostasis, it is important to understand their behavior in response to mechanical loading(Table 1.1).A study performed by Sun et al., utilizing female adult Sprague-Dawley rats, examined the changes inmRNA expression in the patellar tendon in response to low (100) and high (7200) number of cycles (withsame load magnitude)135. One day post loading, the tendons showed an increase in mRNA expression ofMMP2/ 3/ 13/ 14, TIMP1/ 3 and collagen type 2 alpha 1 in the low cycle group compared with the othergroups. In the high cycle group TIMP2, collagen type 3 alpha1 and collagen type 5 alpha1 were increasedcompared to the control and low cycle groups135. The authors suggested that their findings illustrate thatlow cycle fatigue induces a repair response while high-cycle fatigue results in a more degenerativeresponse135. Ruptured human Achilles tendon tissue contained mRNA expression and protein activity ofMMP2 and MMP9 in higher quantities than control tissue136. Karousou et al. took biopsies from twolocations within the ruptured tendon 3.7 days (average, range 1-19 days) after rupture. The first locationwas from the ruptured site and the second location from healthy looking tissue136. Even though theresults indicated the critical role of MMPs in tendon rupture, the small sample size, the relatively widerange of time to surgery and the control sample from within the ruptured tendon may have influenced23these results. De Mos et al. studied tendinopathic tissue obtained from debridement surgery from 10patients with chronic symptoms (9-48 months) and included healthy control tissue obtained from otherpersons137. Low pentosidine levels in the ruptured tendon indicated the relatively young collagen tissuein the ruptured samples. Of the MMPs, only MMP3 displayed significantly lower levels in thetendinopathic area and also in a biopsy adjacent to the tendinopathic tissue, compared to controls. Thecollagen type I and III expression is upregulated in the tendinopathic compared to healthy tissue137.Despite the differences observed, this study only included 10 subjects, of which two had corticosteroidinjections to the tendon and no MMP activity levels were analyzed.  After a period of 18 weeks,circulatory MMP2 levels were elevated in rats undergoing low force, high repetition gripping taskscompared to controls138. Tendinopathic posterior tibialis of humans have shown higher mRNAexpression of MMP2/ 13, collagen type I and III and lower pentosidine concentrations compared tohealthy control tendons 139. These findings are in line with other studies, however the posterior tibialistendon exhibits a different function than the e.g. the Achilles or patellar tendon and thus this studyshould be repeated in Achilles or patellar tendon. The study of Alfredson et al. reported elevated MMP2mRNA expression in chronic painful Achilles tendinopathy in five females140. In future, a morerepresentative and larger subset of patients would be needed to further study the MMP2 expression inchronic painful Achilles tendinopathy.In summary, the presence of MMPs and TIMPs changes at the mRNA expression, protein and circulatorylevels when the tendon is exposed to loading making these suitable genes to detect tendon damage.Despite the evidence provided, more studies are needed to verify the MMP2 function in tendons. Thedifferent tendon conditions can result in a different MMP and TIMP expression and activity pattern(Table 1.1).24Table 1.1 The main role of MMPs role in tendinopathy and rupture↑ indicates increases, ↓ indicates decreases. 132,141,142MMP or TIMP Degrades Tendinopathy Rupture OtherMMP1Collagenase1Collagens type I, II,III, VII, VIII, X activity in human PT cellsfrom tendinosis lesions143↑ human AT144↑ human SST145↑ MMP1 mRNA expressionin 24h stress deprived rattail tendons cells. Cyclicalstrain at 1, 3, 6% at 0.017Hzor frequencies of 0.017Hz,0.17Hz or 1Hz at 1% strainfor 24h eliminated theelevated MMP1 levels fromstress deprivation.146↑ MMP1 mRNA expressionand protein levels with exvivo load deprivation of rattail tendon for 24h147MMP2Gelatinase AGelatin, collagenstype I, II, IV, V, VII,X, XII, fibronectin,elastin, PGs↑ human AT140↑ rabbit RC148↑ human PTT139↓ human SST145↑ human AT 136Synergystic with MMP1 1411:1:1 stoichiometric relationwith MMP14 and TIMP2132↑MMP2 protein activityand mRNA expression in ratSST following daily downhilltreadmill running after 2 and4 weeks 149MMP3Stromelysin1,procollagenactivatingfactorPGs, laminin,fibronectin, gelatin,collagens type III,IV, V, IX↓ human AT144↓human PTT, FDLT139↓ human AT144↓ human SST145↓ human RC150Broad substrate specificity,activates pro-MMPs 1/ 7141and mRNA expression in ratSST following daily downhilltreadmill running after 2weeks 149MMP7MatrilysinGelatin, PGs,fibronectin, elastin,caseinNo change in mRNAexpression of humantendinopathic tendons (PT,AT, SST)151↓ human AT144 Activates pro-MMP114125MMP Degrades Tendinopathy Rupture OtherMMP8Collagenase2,NeutrophilcollagenaseCollagens type I, II,III, aggrecanNo change in mRNAexpression of humantendinopathic tendons (PT,AT, SST)151↑ human AT144 Fatigue loading of rat PTlead to a correlatedexpression of MMP8 withTIMP4.152MMP9Gelatinase BGelatin, collagenstype IV, V, X, XINo change in mRNAexpression of humantendinopathic tendons (PT,AT, SST)151↑ human AT144 ↑ human Achilles tendonstem/progenitor cells withmechanical stimulation153MMP10Stromelysin2Gelatin, fibronectin,collagens type III,IV, V↓ human AT144No change in humantendinopathic tendons (PT,AT, SST)151↑ human AT144 Activates pro-MMP1141MMP12macrophagemetalloelastaseElastin, collagenstype I, IV, aggrecan,fibronectin,laminin, fibrilinNo change in mRNAexpression of humantendinopathic tendons (PT,AT, SST)151↑ human AT144 ↓ after cyclic straining of rattail tendon fascicles for24h154MMP13Collagenase3Collagens type I, II,III, gelatin↑ human PTT139 ↑ human RC150 ↑ human Achilles tendonstem/progenitor cells withmechanical stimulation153MMP14MT-MMP1Activates MMP2/13↑ human PTT139 ↑ human AT144 Forms complex with MMP2,TIMP2 and cleavesproMMP2↑ MMP14 mRNA expressionin rat SST following dailydownhill treadmill runningafter 2 weeks 14926Table 1.2 The main role of TIMPs role in tendinopathy and rupture.↑ indicates increases, ↓ indicates decreasesTIMP Inhibits Tendinopathy Rupture OtherTIMP1(produced bymacrophages)MMP1/ 2/3/ 9, bothpro and active forms↓human AT155↓mRNA and enzymaticactivity in human PTcells from tendinosislesions143↑ rabbit RC148↑ human AT144In AT dialysate TIMP1inhibited MMP2 in healthymen after 1 and 3 days ofexercise that consisted ofuphill (3%) treadmill running1h/day156↑ TIMP1 mRNA expressionand protein activity in ratSST following daily downhilltreadmill running after 4weeks 149TIMP2(produced bymacrophages)MMP2/ 9, both pro andactive formsNo change in mRNAexpression of humantendinopathic tendons(PT, AT, SST)151↓ human AT144↓ human RC150In AT dialysate TIMP2inhibited MMP2 in healthymen after 1 day of exercisethat consisted of uphill (3%)treadmill running 1h/day 156↑ TIMP2 mRNA expressionand protein activity in ratSST following daily downhilltreadmill running after 4weeks 149TIMP3 MMP1Located in ECM↓ human AT144 ↓ human AT144↓ human RC150↑ TIMP3 mRNA expressionand protein activity in ratSST following daily downhilltreadmill running after 4weeks 149TIMP4 Pro-MMP9Binds to MMP14↓ human AT155 ↓ human RC150 Fatigue loading of rat PTlead to a correlatedexpression of MMP8 withTIMP4.152271.7 Experimental models to study tendon overuse1.7.1 In-vitroIn-vitromodels exist to study the cellular response to stimuli that can either be chemical or mechanical.In our experiments we studied the influence of mechanical loading on tendon cells obtained fromhuman hamstring tendons. The tendon tissue was obtained during ACL reconstruction surgery. In-vitrostudies have the benefit of studying different cellular processes, e.g. mRNA, proteins in the supernatantor with immunocytology, apoptosis and cell differentiation157–162. The cells can be stretched by seedingthem on a flexible membrane, which is then placed on a loading post which constrains the movement ofthe membrane in response to an applied vacuum, resulting in a stretching force of known %, shape,frequency and duration. Inherent to this system there is a disadvantage, as the cells are grown on aflexible membrane, and not embedded in a mature, three-dimensional ECM. Nevertheless, in-vitrostudies remain essential to study cellular responses. Follow-up studies in ex-vivo or in-vivo systemsremain necessary163.1.7.2 In-vivoHuman modelsLongitudinal imaging studies have shown that many individuals demonstrate asymptomatic areas oftendon damage11,70,164. Some studies have shown that the presence of these damaged (injured orremodeled or degenerated) areas predisposes to the later development of overuse tendinopathy11.From the researcher’s point of view, this creates a special challenge when trying to examine the earlypathophysiology of tendinopathy, as the existence of an asymptomatic period of variable length makesit impossible to study the time course of early events with any certainty. This is particularly true, given28that inflammatory cell populations and signaling molecules are regulated over the course of hours ordays, whereas the onset of tendinopathy is often insidious and variable over the course of weeks ormonths. A similar problem exists when studying frank tendon rupture, as current thinking suggests thatthere is an undefined period of degenerative changes (usually asymptomatic) which precedes rupture69.Biopsies from ruptured tendons are generally possible as most people will undergo surgical repair,which can require damaged areas to be trimmed or debrided. Biopsies from tendinopathic tendons arerare; however, some researchers were able to obtain biopsies though usually from a limited number ofpatients140. The tendon is relatively a-cellular and by taking a biopsy, tendon healing is prolonged orincomplete, and actually results in a failed healing response not dissimilar to the appearance ofsymptomatic tendinopathy165.  The same limitation exists when trying to obtain interstitial fluid fromtendon by microdialysis. Most researchers have placed the needle closely adjacent to the tendon ratherthan intratendinously, due to concerns about injuring the tendon166,167. Microdialysis studies are few innumber, and typically demonstrate considerable individual differences, as gauged by wide error bars168.Studying the biology underlying the natural degeneration of the tendon would therefore require alongitudinal study of a very large population with regular imaging changes of sufficient sensitivity toidentify small, early lesions, and improved ability to obtain biological samples from the lesions. Withcurrent technologies, this study is not feasible. Thus, animal models are a necessity for the study oftendon degeneration.Animal modelsAnimal models that naturally develop tendinopathy are rare; race horses may develop tendinopathies ora tendon rupture169. However, this select animal group is not easily accessible for most researchers.29Genetically altered viable animal models whose phenotype includes the development of tendinopathyor tendon rupture do not exist to the writer’s knowledge. Chemical and mechanical tendinopathymodels exist.  The studies described in this thesis are primarily focused on mechanical stimulation toinduce tendon pathology. Though, in short a few studies on tendon inflammation will be described.Animal models to study inflammation of tendon tissues are mostly chemical as these models rely oninjection of substances that induce an inflammatory response. The injection of collagenase leads tomacrophage and neutrophil infiltration170. Injection of 1% carrageenan near the deep digital flexor of thepaw in rats resulted in histological evidence of inflammatory cellular infiltration near the injection site aswell as elevated MMP9 protein levels 117. Weekly injections of PGE1 into the Achilles tendons of ratresulted in acute inflammation in some of the animals while others  demonstrated fibrosis of theparatenon and adhesions and degeneration after 3 weeks78. Fluoroquinolones have been injected in theAchilles tendons of rats, causing edema and mononuclear cell infiltration and disorganization of thecollagen171.In the SDFT of horses inflammatory substances have been detected. Hosaka et al. compared normal andinjured tissue of young (1-7 year old) SDFT tendon of horses and found histological evidence of IL1α,IL1β, TNFα and IFNϒ in the injured SDFT compared to no or very minimal in the healthy tendon112. Dakinet al. demonstrated granular tissue in horse (4 year old) SDFT 3 weeks post injury, with a marginallythickened paratenon surrounding the SDFT. Hemorrhage was visible as well as cellular infiltration.Chronically injured SDFT (>3 months post-injury, 12 year old) demonstrated a much thickenedparatenon. The cellularity was increased near the peri-vascular regions. Both the sub-acute and chronicSDFT demonstrated the presence of macrophages. The sub-acute tissue demonstrated a larger quantityof macrophages compared to chronic SDFT tissue172. Cyclic loading of equine SDFT tendon fibers, in-vitroresulted in the upregulation of degradative and inflammatory processes. Fluorescent staining30demonstrated an increased number of inflammatory mediators COX2 and IL6 in tendon cells comparedto static loaded tendons and controls. MMP13 fluorescent staining increased in the loaded tendontissue. Collagen degradation marker C1,2C levels were increased in the loaded SDFT. MMP1 separatelydid not change; however, co-localization of MMP1 with C1,2C was observed in most SDFT tissue thatwas loaded compared to static loaded and controls173.Rabbit modelThe Backman model induces overuse in the rabbit Achilles tendon by means of mechanical stimulationof one rabbit hind limb in combination with electrical pulses of the triceps surrae174,175. Thesimultaneous electrical stimulation makes this model an active stimulation model. The advantage of theBackman model is the controlled mechanical stimulation resulting in a lesion that shares many featuresof human Achilles tendinopathy (paratendonitis with accompanying tendinosis). In previous studies, therabbits underwent stimulation 3x per week, for 2h with 150 repetitions per minute for a period of 6weeks. Overuse led to tenocyte rounding and irregular collagen at 3 weeks with more pronouncedchanges after 6 weeks of stimulation175–177. Nakama used a similar model for stimulation of the flexordigitorum profundus and observed micro tears in the stimulated limb178. Others, however, were not ableto reproduce the histological changes observed previously possibly due to the 2x reduced frequencyused179.Overall the Backman model is a suitable model to induce an overuse injury in one Achilles tendon of therabbit.311.8 SummaryTendons are essential for physical movement as they transmit forces between bone and muscle1. Thetendon is a complex hierarchical structure that predominantly consists of fibrillar collagen1,22,23. Tendonsneed the appropriate amount of load through physical activity to remain healthy97.Figure 1.3 demonstrates the proposed effects of varying amounts of mechanical stimulation on tendons.This model is focused on the research performed in this thesis, i.e. it does not encompass all possibleoutcomes or pathways. The green route demonstrates that healthy amounts of mechanical stimulationas typically experienced by a healthy individual do not result in structural changes. The tendon is inhomeostasis, with a balance in the production and degradation of collagen fibers and associatedextracellular matrix. The blue route shows that loads on the higher end of the healthy load range(‘optimized’) can lead to tendon adaptation; or tendon strengthening characterized by a net increase intype I collagen production.  The purple route shows the route of mechanical loads that exceed thehealthy load range when loads are applied to the tendon, either in strain magnitude or repetitionnumber. This causes structural changes, a failed healing response and injury. MMPs may play a role atseveral points in this process.  A high BMI or a high waist-hip ratio (orange route) can be associated withelevated LDL-C in the circulation, resulting in lipid infiltration thereby weakening the tendon via MMPactivity 88. When mechanically stimulating the tendon, loads which were previously in the healthy rangenow exceed the healthy load range as the tendon is weakened, predisposing it to damage. People whoare overweight have higher average systemic levels of inflammation and, thus inflammation andinflammatory substances may modulate the tendon injury and repair processes. MMP activity may alsoplay a role in the earliest response to loading that exceeds the healthy loads (load-induced MMP activityin tenocytes), or in the failed repair response which develops later (MMP expression associated withinflammation-repair processes). In addition, through loads that exceed the healthy range, micro tears32due to fatigue failure may occur in the fibrils creating sub-regions of tendon that experience diminishedloads,  thereby initiating a cascade of cellular responses related to underuse including MMP activationand tendon degeneration97.Figure 1.3 Flow chart of the development of the different routes of tendon pathology.An ↑ indicates increased levels. Ch. indicates the chapter where a study related to that route of tendonpathology is described.Tenocytes continuously remodel the tendon. In a healthy tendon there is a fine homeostatic balance61,93–96. The tenocytes sense mechanical stimuli and respond by releasing compounds that are involved inanabolic and catabolic processes141,180. Overuse can disturb the balance of these processes by exceedingthe tendons adaptive capability– resulting in altered composition and function of the tendon, and analtered biochemical milieu in the local fluid or the general circulation. Overuse (loading which exceeds33the adaptive capacity of the tendon) can be considered to result either from too many repetitiveactivities and/or high force movements3,181. Chapter 2 reports in more detail MMP mRNA expression asa result of repetitive and/or forceful movements.Even though overuse is characterized as the main cause of tendinopathy, exercise is key in tendonrehabilitation182. Chapter 3 aims to give a better molecular understanding of why exercise not onlyresults in damaged tendon but also leads to tendon repair especially when periods of rest are inserted inthe stimulation program162.The rabbit Achilles tendon consists of three tendons that are situated closely together. They form acomplex183 - the Achilles tendon complex. As tendon mRNA expression is dependent on the function ofthe tendon it is of importance to describe the mRNA expression of each of the three tendons in theAchilles tendon complex of the rabbit. Chapter 4 reports on the mRNA expression pattern of the rabbitsAchilles tendon complex29.Tendon injuries are usually discovered at the onset of pain. Before any overt symptoms the tendon canbe substantially degenerated11,164 which leads to long and costly rehabilitation. Chapter 5 reportsfindings on whether substances of tendon degeneration can be detected in an early overuse model. Theoveruse model used is the Backman model which induced Achilles tendon injuries in one hind limb of arabbit175–177,179.Tendon rupture is thought to be preceded by (pain-free) tendinopathy, judging by the degenerativehistological findings reported in literature11,26,184. Adipose tissue infiltration in the ruptured tendon isoften observed during surgery or in histological studies as well184–186. The findings on the release of34MMPs in the circulation after a tendon rupture are reported in Chapter 6 as well as findings on lipidlevels as they may play a role in disrupting the tendon structure, predisposing the tendon to rupture.The overall aim and study specific goals for each research Chapter are described in the next paragraph.1.9 Research questions and hypothesesThe purpose of this thesis is to identify the potential role of MMPs, with special focus on MMP2 ondegradative activity in relevant experimental models. As initial steps in pursuing this overall purpose, thethesis will address inter-related research questions in a variety of experimental models.In-vitroStudy 1 in Chapter 2 – MMP2 expression in mechanically stimulated human tendon cells is modulatedby frequency and strainResearch question:Will stretching of tendon cells, in different conditions, correlate with changes in the expression of genesinvolved in the regulation of collagen degradation?Hypothesis:More intense stretching protocols are anticipated to have a greater effect on the mRNA expression ofMMP2, TIMP2 and collagen as well as the MMP2 activity.Study 2 in Chapter 3 – MMP2 expression in mechanically stimulated human tendon cells is modulatedby frequency and strainResearch question:Will periods of rest inserted in the loading protocol induce a greater degree of collagen production?Hypothesis35Rest insertion is expected to increase collagen production in tenocytes. Rest insertion in more intensestretching protocols is anticipated to produce more collagen.Combination of Studies 1 and 2 in Chapters 2 and 3Research question:Will stretching of tenocytes with and without rest insertion influence cell organization and shape?Hypothesis:More severe stretching is expected to result in a more disorganized deposition of cells and collagen.In-vivoStudy 3 in Chapter 4 – Regional molecular and cellular differences in the female rabbit Achilles tendoncomplex: potential implication for understanding responses to loadingResearch question:Are there differences in mRNA expression in genes involved in ECM homeostasis in the Achilles tendoncomplex?HypothesisIt is expected that each the tendon regions in the complex has a different mRNA expression likely basedon the individual location.Study 4 in Chapter 5 – Repetitive movements of the Rabbit Achilles tendon complex induces changes inMMP2 levelsResearch question36Is it possible to track the development of early phase collagen degradation activity in-vivo in thecirculation?Hypotheses:It is hypothesized that MMP2 and TIMP2 will be present in altered concentrations in the circulation dueto local production and release from mechanically loaded tendon.It is expected that the exercised rabbits will have a higher level of MMPs and TIMPs in the circulationcompared with the control group.Study 5 in Chapter 6 – Altered serum MMP, TIMP and lipid levels in patients with Achilles tendonruptureResearch question:Are elevated circulatory lipid, MMP and TIMP levels present in people with an Achilles tendon rupture?Hypothesis:Achilles tendon rupture patients are expected to have elevated levels of MMP2 and blood lipid levels inthe circulation.372. MMP2 expression in mechanically stimulated human tendon cells ismodulated by frequency and strain2.1 BackgroundWorkplace related injuries were an economic burden of $127 billion in the US in 20043,187. In 2012,musculoskeletal disorders (MSDs) accounted for 34% of all workplace related injuries2. A major riskfactor for MSDs is overexertion (e.g. freight moving),  which accounted for 63% of the total MSDs2. Thehighest absence of all workplace injuries was caused by repetitive movements injuries, which is anotherkey threat for MSDs development2,3. Tendinopathy is one of the frequent diagnoses in workplaceMSDs3,181 with major tendons such as the Achilles, lateral elbow and the rotator cuff susceptible tooveruse188,189.Chronic injury from both repeated reaching and gripping, or from activities that result in heavier loadsexperienced by the body such as running or jumping lead to histological and mechanical evidence ofdegeneration155,156,178,190–192. Matrix metalloproteinases (MMPs) and tissue inhibitors of matrixmetalloproteinases (TIMPs) regulate tendon extracellular matrix (ECM) homeostasis. Injured tissuerequires proteolytic activity to facilitate repair and remodeling193 however an imbalance of proteolyticactivity, caused by sustained injury, results in ongoing ECM lysis61,94,96,97,113. Strongly implicated in tendonECM lysis are MMP2, MMP14 as well as TIMP2. MMP14 is a membrane type MMP (MT-MMP1) andcleaves latent (pro-) MMP2 into active MMP2 which in turn further degrades collagen fibers194. TIMP2plays a critical role as it regulates the amount of active MMP14 on the cell surface134 consequentlyTIMP2 regulates the activation of MMP2194,195. Normal, painful and ruptured human Achilles tendonsdisplay a distinct mRNA expression pattern, with MMP2, TIMP2 and COL3A1 mRNA highly expressedcompared to other genes144.  Overuse of the supraspinatus tendon of rat caused by downhill treadmill38running led to upregulated active MMP2 protein activity after 2 and 4 weeks of training149. MMP2,MMP14 as well as collagen type I and III mRNA expression were upregulated with 5-7500 fatigue loadingcycles in a rat patellar tendon model compared to controls152,196. Taken together, the evidence suggestthat MMP2/ 14, TIMP2, collagen type I and III mRNA expression are altered by mechanical stimulationand are associated with the development of overuse tendinopathy, making them appropriate genes tostudy the effect of frequency and strain variation.Repetition and force are often thought as two independent risk factors contributing to the developmentof MSDs. Each of the factors are damaging, however the combination of force and repetition can havean additional detrimental effect. A systematic review demonstrated that 10 of 12 tendon studiesreported interaction of force and repetition on the development risk of MSDs3. Their finding was thatwith increased repetition in low force tasks resulted in a modest MSD risk while increased repetition inhigh-force tasks it lead to consistent substantial increase in MSD risk3,181. An in-vivo reach and grippingrat model showed that active MMP2 was found in increased amounts in serum and flexor digitorumtendons of the forearm with 18 weeks of high repetition at low force138. Understanding the particularcellular response on frequency and strain and a combination thereof remains of considerable interest.In response to increased mechanical loading, tendon cells change their shape from elongated to a morerounded morphology with a more prominent cytoplasm197, which in turn could influence the mRNAexpression and protein production198. The relation between tendon cell shape and mechanicalstimulation has not been widely investigated in an in-vitro tenocyte model, but could provide additionalinsight into morphological changes observed in overused tendons.In the current study, human tenocytes were mechanically stimulated to test the hypothesis that highstrain (10%) and high frequency (1Hz) stretching compared to low strain (2%) and low frequency39(0.33Hz) stimulation would result in: (1) greater mRNA expression and protein level of MMP2, collagentype I and III, and (2) greater mRNA expression of MMP14 and TIMP2. Quantitative polymer chainreaction (qPCR) was performed to assess mRNA expression; ELISA and immunocytochemistry (ICC) wereused to detect protein levels. As a secondary question, cell shape and branching were assessed bymeans of automated image analysis.2.2 Methods2.2.1 Cell cultureHuman hamstring tendon pieces were obtained from ACL reconstruction surgery after informed consentwas in place. The tendon cells were obtained from two females age 12, 38 and 3 males of age 24, 27, 40.Ethics approval was obtained from the University of British Columbia. The muscle and fat were removedfrom the tendon, which was then washed with phosphate buffered saline (PBS) and enzymaticallydigested with filtered 1.5 mg/ml collagenase (Clostridopeptidase A; Sigma, Oakville, Ontario, Canada) inserum-free Dubecco’s Modified Eagle Medium (DMEM; HyClone, South Logan, Utah, USA) for 30minutes at 37⁰C with shaking; for 5 additional minutes, trypsin (1x TrypLETM Select, Gibco, LifeTechnologies, Burlington, ON, Canada) was added. The mixture was centrifuged at 1,200 rpm for 5minutes and the cell pellet was resuspended. Tenocytes were cultured in 200mm dishes using HycloneDMEM/HIGH glucose supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin(Thermo Scientific, Ottawa, ON, Canada). Cells that were not viable were discarded.2.2.2 Mechanical stretchingCells were passaged at a concentration of 65,000 cells/2ml onto 6-well BioFlex® - collagen Type I cultureplates (Flexcell International Corp., Hillsborough, NC). After 2 days of adhering the cells were allocated40to either a control group, or to one of the four mechanical stretching experiments as outlined in table2.1. Experiments 1 and 4 (table 2.1) were also performed on cells grown in 1ml DMEM/HIGH glucosesupplemented with 4% SerumFree Life Factors Kit (FibroLife, LS-1010) and 1% penicillin/streptomycin(Thermo Scientific, Ottawa, ON, Canada). These experiments were performed in biological triplicatesusing tendon cells from three different patients. At the finish of the mechanical stretching protocol,media was collected and stored at -20°C until further processing. The cells were lysed using lysis buffer(Thermo Scientific, Ottawa, ON, Canada) with 1% beta mercaptoethanol and stored at -80°C until furtherprocessing.41Table 2.1 The loading protocol for load and frequency variation experiments.2.2.3 RNA extraction and quantitative polymer chain reactionUsing GeneJet RNA purification kit, ribonucleic acid (RNA) was extracted according manufacturer’sinstructions (Thermo Scientific, Ottawa, ON, Canada) and stored at -80°C until further processing. A100mM dNTP set (Life Technologies, Burlington, ON, US) was used to synthesize complementarydeoxyribonucleic acid (cDNA) and stored at -20°C. qPCR was performed in technical triplicates usingSYBR Green (FastStart Universal SYBR Green Master ROX, Roche Diagnostics Corporation, Indianapolis,IN, US) on a 7500 Fast Real – Time PCR System (Applied Biosystems, Life Technologies, Burlington, ON,Canada). The primers used (Table 2.2) were designed for the target human genes. Values for genes werenormalized to corresponding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) values.Group Frequency (Hz) Strain (%) DurationHigh frequency – High strain (HF-HS) 1 105 days with each day consisting of 8h ofmechanical stretching divided in blocks of2h with 30 min rest – total 13.5hHigh frequency – Low strain (HF-LS) 1 2Low frequency – High strain (LF-HS) 0.33 10Low frequency – Low strain (LF-LS) 0.33 2Controls 0 0 13.5h42Table 2.2 RT-qPCR primers.Target Forward Primer Reverse PrimerGAPDH TCTTTTGCGTCGCCAGCCGAG TGACCAGGCGCCCAATACGACCollagen type I TGTTCAGCTTTGTGGACCTCCG CGCAGGTGATTGGTGGGATGTCTCollagen type III AATCAGGTAGACCCGGACGA TTCGTCCATCGAAGCCTCTGMMP2 GAGTGCATGAACCAACCAGC GTGTTCAGGTATTGCATGTGCTMMP14 GAGCATTCCAGTGACCCCTC ACCCTGACTCACCCCCATAATIMP2 GTTTATCTACACGGCCCCCT TCGGCCTTTCCTGCAATGAG2.2.4 Human total MMP2 protein assayConditioned media, collected during the experiments with cells on 2ml DMEM/HIGH glucosesupplemented with 10% FBS and 1% penicillin/streptomycin (Thermo Scientific, Ottawa, ON, Canada)and  was handled and analyzed for total MMP2 according to manufacturer’s instructions (Human MMP2Activity Assay, Quickzyme Biosciences, Leiden, the Netherlands).2.2.5 ZymographyConditioned media of cells on 1ml DMEM/HIGH glucose supplemented with 4% SerumFree LifeFactors(FibreLife, LS-1010) and 1% penicillin/streptomycin (Thermo Scientific, Ottawa, ON, Canada), stimulatedby the HF-HS and LF-LS regimen, was collected and concentrated at 3000g, for 45min at 4⁰C, using 9kMWCO concentrator tubes (Thermo Scientific, Rockford, IL, USA). Samples of 8.3mg/ml were loaded in9% SDS-PAGE gel with 0.2% gelatin, in the presence of reducing agents. Simultaneously, 15μl of SpectraMulticolor Broad Range Protein Ladder (Thermo Scientific, Ottawa, ON, Canada) was included to allowidentification of active MMP2 based on its predicted molecular weight of 63kDa in the samples and pro-43MMP2 at 72kDa. The gel was washed at room temperature for 1h in 2.5% Triton X-100 solution andincubated for 36h at 37⁰C in 50mM Tris HCl, 0.15M NaCl, 10mM CaCl2, and pH-7.8 buffer. The gel wasstained with 0.05% Coomassie Blue G-250 and imaged using a scanner. Proteolysis was detected as awhite area in the blue background. ImageJ (National Institute of Health, MD, USA) was used formeasuring the intensity of the bands. To compare between gels, all samples were normalized to loadingcontrol trypsin. The protein activity of the conditioned media of the HF-HS and the LF-LS groups of eachday were then normalized by the control (unstrained) samples from the same day199,200. Measures ofMMP2 activity are given in arbitrary units (AU).2.2.6 Immunocytochemistry (ICC) for pro-collagen types I and IIIStandard immunocytochemistry procedures were conducted upon cells that were fixated on a Bioflexstretchable substance plate. Cells were originally fixed in 4% paraformaldehyde for 15 minutes at roomtemperature, then stored at 4°C until immunocytochemistry was ready to be performed. Four sectionsof 1x1 cm, from the middle of the membrane (thereby avoiding the edges of the stretchable membranewhere strain values may be higher), were cut from each Bioflex plate for each mechanically stimulatedgroup, and were then mounted on a glass slide. Sections were permeabilized in 0.4% Triton X-100 for 5minutes. Sections were then blocked for 1 hour with a PBS +1% BSA +0.2% Tween 20 blocking buffer. Amixture of primary antibodies including pro-collagen type I (Developmental Studies Hybridoma Bank.Iowa City, IA, USA) and pro-collagen type III (Acris Antibodies, Inc. San Diego, CA, USA) at dilutions 1:500were applied for 1 hour at room temperature in a darkened humidified chamber. Sections were washedwith blocking buffer, and secondary antibodies (a mixture of Alexa Fluor 488 goat anti-rabbit and AlexaFluor 596 goat anti-mouse at 1:500 concentration, Life Technologies, Burlington, ON, USA) were appliedfor 30 minutes at room temperature in a darkened humidified chamber. Finally, a Hoescht nuclei44counterstain at 1:10,000 concentration in distilled water (33342 Thermo Scientific, Rockford, IL, USA)was applied for two minutes. Measures of intensity are given in arbitrary fluorescence units (AFU).2.2.7 Image acquisitionA Zeiss Axio Observer.A1 (Zeiss, Oberkochen, Germany) was used to visualize the stained sections.Fluorescent micrographs were taken with a 10x objective lens. Three images representing the nuclei,pro-collagen I and pro-collagen III were acquired for each field of view, resulting in a total of 12 imagesper fluorescent channel.2.2.8 Automated image analysisCellProfilerTM software was used to threshold and identify the nuclei, the pro-collagen I and pro-collagenIII immunoreactions associated with each unique cell in every field of view. The intensities of pro-collagen I and pro-collagen III immunoreaction were measured by scaling the intensity of the image from0 to 1 (where 0 is the darkest pixel and 1 is the brightest pixel), then averaging the values of all pixelintensity values for each fluorescent channel to obtain the mean intensity. The solidity and major/minoraxis ratio were also derived for each pro-collagen III stain as indicators of shape. Solidity was obtainedby drawing a convex hull around each cell, then taking the ratio of surface area of the stain to thesurface area of the convex hull. The solidity effectively describes how regular the cell was in shape, withmore branched cells having a lower solidity. The major and minor axes were obtained by fitting anellipse with the same second-moments as the pro-collagen III stain, then measuring the major and minoraxes of said ellipse. Major-to-minor axis effectively describes the elongation of the cell, with a higherratio indicating a more elongated cell. Thresholded images were evaluated to manually filter the45datasets by deleting misidentified cells caused by background noise, image artefacts, or excessiveoverlap of stains.2.2.9 StatisticsLinear mixed model (LMM) analysis was performed using SPSS (SPSS Inc., Chicago, IL, USA) to detectstatistically significant differences of MMP2 and TIMP2 mRNA expression between the types ofstimulation as well as interactions between the stimulation types. MMP2 protein level and activity wasalso analyzed with LMM. All the data from the different mechanically stimulated conditions wereentered into the model, to allow the significance of each main effect (stretching vs control, high vs lowstrain, high vs low frequency, duration in days) to be evaluated. Repeated Generalized EstimatingEquations (RGEE) within Generalized Linear Models using SPSS was used to determine collagen type Iand III protein level, cell solidity and ratio of major/minor axis among the groups. All data analyzed withLMM and RGEE were log transformed beforehand to obtain a normal distribution. The control groupwas compared with all the mechanically stimulated groups (all four groups) combined. The comparisonof mechanically stimulated conditions was done by combining the high frequency (two groups), highstrain (2 groups), low frequency (two groups) and low strain (2 groups) with each other. The qPCR isdisplayed in relative quantity (RQ) – a measure of gene expression, and total MMP2 protein level resultsare given as the mean difference between the compared locations with a 95% confidence interval of thedifferences (CI). The MMP2 activity is described in mean (SE) in arbitrary units (AU). The pro-collagentype I and III protein levels and cell morphology results were reported as mean and 95% CI. CIadjustments were made using Sidak correction for both methods. A p value of ≤ 0.05 was consideredstatistically significant for both tests.462.3 ResultsMechanical stretching of human tendon cells in two-dimensional cultures resulted in no change in (nosignificant change in CT value) expression of housekeeping gene GAPDH. Overall, the stretched cells (allregimen combined) expressed a higher mRNA expression of MMP2 resulting in a mean difference (CI ofdifference) of 1.43(1.18-1.72), MMP14 1.16(1.02-1.33) compared to the controls (p<0.05). The MMP2protein level was elevated (p<0.05) in cell cultures which were mechanically stimulated 1.42(0.38-2.47)ng/ml compared to the control group 0.86(-0.15-1.86 ng/ml) on day 2 (Figure 2.1). Protein levels of pro-collagen type III were greater (p<0.01) with mechanical stretching 0.238(0.237-0.239) compared tocontrols 0.226(0.225-0.227). The pro-collagen type I protein levels were also elevated (p<0.01) bymechanical stretching while the control group displayed a mean of 0.182(0.180-0.183).The control group counted 52(20-83) cells/image and in the mechanically stimulated group 53(21-85)cells/image. The number of cells remained the same (p<0.883) throughout the duration of theexperiment, as indicated by automated cell counts.47Figure 2.1 The MMP2 protein level (ng/ml) comparing controls and all four mechanically stimulated groups(Experiment) pooled on day 2 (p<0.05) and day 5 measured by the total MMP2 protein assay.Values are mean ± SE. * indicates a p<0.05. The bars and error bars represent data of biologicaltriplicates.2.3.1 FrequencyThere was a small, but consistent and significant influence of the loading frequency on several of thegenes and proteins of interest. MMP2 mRNA expression in the high frequency regimen on day 2 weregreater than the mRNA expression of the low frequency stimulation group, resulting in a meandifference (CI of difference) of [3.57(2.45-5.19), p<0.01, Figure 2.2]. Similarly, on the 3rd day, highfrequency stimulation led to greater MMP2 mRNA expression with a mean difference of [2.12(1.27-3.53), p<0.01, Figure 2.2] compared to low frequency stimulation.*48The influence of frequency on MMP14 and TIMP2 mRNA expression was statistically significant, butsmall and variable over time (Figure 2.2). Collagen type I and III mRNA expression did not varysubstantially between high and low frequency stimulation (Figure 2.2).Figure 2.2 The influence of high and low frequency stimulation on the mRNA expression of collagen type I, III,MMP14, MMP2 and TIMP2 by day measured by qPCR.Values are mean RQ ± SE. Asterisks denote changes that are both statistically significant (p<0.05, byLMM), and > 0.5 RQ in magnitude. The bars and error bars represent data of biological triplicates.49On day 2 of the loading regimen high frequency stimulation resulted in a greater MMP2 protein level(1.52(0.05-2.99) ng/ml, p<0.01, Figure 2.3A) compared to low frequency stretching 1.34(-0.53-3.21)ng/ml, however there was considerable overlap of the confidence intervals between these twoconditions. Low frequency stimulation 5.25(1.07-9.42) ng/ml led to a greater MMP2 protein levelcompared to high frequency stimulation 3.92(-0.30-8.15) ng/ml at day 5 (p<0.01), which was theopposite trend to that observed at the mRNA level. At the later time point (5 days), the difference inMMP2 protein level induced by low vs high frequency stretching was of a greater magnitude than thatobserved at the earlier time point (2 days).50Figure 2.3 The MMP2 protein level comparing A) High and low frequency stretched cells and B) high and lowstrain stretched groups combined on days 2 and 5 analyzed by the total MMP2 protein assay.LMM analysis was used. Values are mean ± SE. * indicates a p< 0.05. The bars and error bars representdata of biological triplicates.AB51At day 1 of high or low frequency stimulation, the pro-collagen type III protein levels were greater withhigh frequency stimulation (p<0.01, Table 2.3,) but this pattern shifted so that on days 2-5, pro-collagentype III protein levels were consistently lower in the high frequency stimulated group (p<0.01, day 2, 3, 4and 5, Table 2.3). Pro-collagen type I protein levels were also lower with high frequency stimulation ondays 1, 3-5 compared to low frequency stimulation (p<0.01; Table 2.3).Table 2.3 Pro-collagen type I and III protein levels from ICC.The values are given in mean and confidence interval of pro-collagen type I and III. LMM analysis wasused. A significant difference between high and low values of either frequency or strain at the same dayis indicated by * p<0.05, Ɨ p<0.01 beside the highest value. The mean and CI represent data of biologicaltriplicates.Pro-collagen type I intensityStrain FrequencyTime point Condition Mean95% Confidence Interval 95% Confidence IntervalLowerBound Upper Bound Mean Lower Bound Upper BoundDay 1 High .891Ɨ -.935 2.718 .653 -1.171 2.477Low .658 -1.171 2.487 .896Ɨ -.934 2.726Day 2 High .933 .576 1.291 .946Ɨ .595 1.298Low .923 .599 1.246 .910 .584 1.235Day 3 High 1.040Ɨ .847 1.233 0.948 .774 1.121Low 1.017 .779 1.255 1.109Ɨ .853 1.365Day 4 High 1.023 .268 1.777 .901 .151 1.651Low .895 .150 1.641 1.017Ɨ .267 1.768Day 5 High .965 .460 1.471 .931 .393 1.469Low .992Ɨ .454 1.530 1.026Ɨ .520 1.53352Pro-collagen type III intensityStrain FrequencyTime pointCondition Mean95% Confidence Interval 95% Confidence IntervalLowerBound Upper Bound Mean Lower Bound Upper BoundDay 1 High 1.159Ɨ .662 1.657 1.134Ɨ .642 1.627Low 1.036 .513 1.558 1.061 .537 1.585Day 2 High 1.343Ɨ .572 2.115 1.032 .271 1.793Low .793 .041 1.545 1.104Ɨ .350 1.858Day 3 High 1.023Ɨ -.152 2.198 .908 -.263 2.079Low .938 -.236 2.112 1.053Ɨ -.124 2.230Day 4 High .998 .940 1.056 .921 .873 .970Low 1.000 .951 1.049 1.077Ɨ 1.016 1.138Day 5 High 1.057Ɨ 1.045 1.070 .950 .940 .961Low .943 .933 .953 1.050Ɨ 1.038 1.06253Table 2.4 The relative intensity of MMP2 protein activity in the conditioned media of mechanically stimulatedcells and their controls on days 2 and 4 from zymography.LMM was used to analyze the data. The relative intensity (SE) (Arbitrary Units), MMP2 protein activity ofcells stimulated by LF-LS (A) and HF-HS (B) and their controls on days 2 and 4. The values represent dataof biological triplicates.A MMP2 activity (AU)Day 2 Day 4Low frequency – Low strain (LF-LS) 1.09(0.11) 0.76(0.09)Controls 0.81(0.15) 0.56(0.18)Figure 2.4 Zymography of the conditioned media of the controls High Frequency – High Strain and LowFrequency –Low Strain on days 2 and 4.Some lanes were removed to create these images. All the zymography gels were run with the exactsame protocol and trypsin as a control to allow for comparison.B MMP2 activity (AU)Day 2 Day 4High frequency – High strain (HF-HS) 1.30(0.70) 1.26(0.47)Controls 1.02(0.13) 0.77(0.39)MMP2 62 kDa542.3.2 StrainVariations in the degree of strain applied to human tendon cell cultures significantly influenced theobserved levels of mRNA and protein. The high strain groups displayed a significantly higher MMP2mRNA level compared to the low strain stimulated group at day 2 and day 3 with a mean difference (CIof difference) of respectively [1.64(1.12-2.39), p<0.05] and [1.74(1.04-2.90), p<0.05, Figure 2.5]. Highstrain (10%) stimulation led to a greater MMP2 (p<0.05, 2.90(2.08-3.72)) mRNA expression comparedwith control MMP2 mRNA expression (1.17(0.91-1.43), Figure 2.6C). Nevertheless, cells stimulated withlow strain (2%) still displayed a higher expression of MMP2 mRNA 1.85(1.34-2.29) compared to controls[1.16(1.01-1.30), (p<0.05), Figure 2.6D] and a lower TIMP2 mRNA expression [0.96(0.87-1.04) vs.1.16(1.01-1.30), Figure 2.6D). Comparing the MMP14 mRNA expression of high strain with low strainstimulation, MMP14 mRNA expression was found to be higher in cells stimulated with high strain on day1 [1.39(1.11-1.73), p<0.01], day 4 [1.74(1.00-3.00), p<0.05] and day 5 [3.47(1.20-10.01), p<0.05, Figure2.1]. In keeping with the trend in mRNA expression, MMP2 protein level was greater (p<0.01) with highstrain stimulation 5.97(-0.92-12.86) ng/ml compared to low strain stimulation 3.67(0.65-6.70) ng/ml onday 5 (Figure 2.5B).55Figure 2.5 The influence of high and low strain after 1-5 days of mechanical stretching on the mRNA expressionof collagen type I, III, MMP14, MMP2 and TIMP2 measured by qPCR.LMM was used for analysis. Values are RQ mean ± SE of biological triplicates. Asterisks denote changesthat are both statistically significant (p<0.05), and > 0.5 RQ in magnitude.56The protein level of pro-collagen type I was greater (p<0.01, Table 2.3) with high strain compared to lowstrain stimulation on days 1 and 3. Pro-collagen type III protein levels were greater in the cellsstimulated with high strain compared to low strain on all days except day 4 (p<0.01, Table 2.3). On day4, the low strain regimen resulted in greater (p<0.05, Table 2.3) collagen type I protein levels comparedto high strain stimulation.2.3.3 Strain and frequency interactionOn the mRNA expression level, statistically significant interactions between strain and frequency wereobserved for MMP2, TIMP2, and MMP14. On day 2, the interaction between low frequency and lowstrain (LF-LS) caused a significant lower MMP2 (p<0.01) and TIMP2 (p<0.05) RQ, compared to all otherpossible interactions of frequency and strain (HF-HS, HF-LS, LF-HS). The interaction between lowfrequency and high strain (LF-HS) resulted in a higher RQ of MMP14 (p<0.01) compared to the otherfrequency and strain combinations on day 5.2.3.4 Protein activityZymography was performed on conditioned media of the HF-HS and LF-LS stretched cells and comparedafter 2 or 4 days of mechanical stretching. Active MMP2 was present in the majority of samples. TheMMP2 activity tended to be higher in mechanically loaded cells (both LF-LS and HF-HS) (Table 2.4, Figure2.4) compared to control cells, and the highest AU values were seen in the HF-HS group.572.3.5 Cell morphologyComparing the controls (Figure 2.6A) with mechanically stimulated groups (Figure 2.6B-D), the datashowed that overall the mechanically stretched cells had a higher mean major/minor axis ratio (p<0.01)giving them a more elongated appearance. However, solidity was greater with high strain (Figure 2D)than low strain stimulation (Figure 2C) on days 1-4, indicating that the cells show less branching withhigh strain (p<0.01, Figure 2.6D). High frequency stimulation elevated solidity values compared to lowfrequency stretching on days 2 and 3 (p<0.01). When comparing the effects of high vs low strainmechanical stretching on major/minor axis ratio, the changes were small and variable from day to day(Figure 2.6D).58Figure 2.6 Immunocytochemistry images of pro-collagen III, 10x magnification.With A) control cells, B) high frequency and high strain stretched cells, C) high frequency stretched cells,D) high strain stretched cells. The control cells were rounder (A) compared with the cells stimulated withhigh frequency and strain (B).592.4 DiscussionThe main finding of this study is that either high frequency or high strain stimulation both resulted in anelevated mRNA expression of MMP2 compared with either low frequency or low strain stimulation, withMMP2 protein levels significantly greater with high strain stimulation than with low strain stimulation;however the frequency showed varying results. MMP2 has been found to be upregulated in numerousmodels of tendon overuse, including at both earlier and later stages135,136,138,149,201,202, and it has beenpreviously noted that both high levels of strain and repetition are identifiable risk factors for developingoveruse tendinopathy3,203. Therefore, the current experiments support the hypothesis that strain andfrequency-induced MMP2 may be related to the development of tendinopathy.In their normal environment tendon cells continuously experience load generated caused by mechanicalstimulation such as physical activity147. A variety of mechanical stimulation types including dynamicstretching; static stretching and load deprivation are used to study the mRNA expression response oftendons. The loss of homeostatic tension following load deprivation can occur when tendons tear, andthis loss of tension results in an immediate catabolic response204 as well as apoptosis205. A study applyingvarying static loads smaller than 3% strain (toe region), reported that higher static loads resulted inlower MMP1 mRNA expression, implying that loading that is within the toe region tends to minimize thecatabolic activity but load deprivation will result in an increased catabolic tendon response147. In cyclicstretching or overuse experiments, a frequency of 1Hz is generally used while strains typically rangebetween 2-10%. Overuse of tendons is thought to be a major cause of tendinopathy and can occur whenrepeated loading deviates from the normal mechanical loading by differences in magnitude, frequency,duration and/or direction206. Proposed mechanisms of overuse injury include tensile, compressive, shearloading or combinations thereof which either exceed the physiological limits of the tissue, or induce amaladaptation or injury to the cells20,207–212.60MMP2 is a widely used indicator of tendon degeneration, usually in combination with other genes suchas collagens and other MMPs or TIMPS. A study of ruptured human Achilles tendon demonstrated thatmRNA expression of MMP2 and TIMP2 were significantly elevated in the rupture tissue compared to thecontrol tissue (p<0.05)136. Protein activity of both MMP2 and MMP9 was found present in the rupturedAchilles tendon tissue136. Another study investigating ruptured human Achilles tendon found smallmRNA expression changes, however significantly increased levels of MMP2 and MMP9 activitycompared to control tissue137. A high-repetition, low-force gripping task in rats lead to increased MMP2level and activity in serum and flexor digitorum tendon tissue compared to controls after a period of 18weeks138. Corps et al. compared human symptomatic stage II posterior tibialis tendon (PTT) with healthyPTT and healthy flexor digitorum longus tendon  and found significantly higher mRNA expression in thetendinopathic tendon compared to the healthy tendons139. A comparison of chronic tendinosis Achillestendon tissue of human females with controls resulted in a 6-fold higher MMP2 RT-qPCR levels140. Cyclicloading of rat patellar tendon, at 50% of the maximal load and a frequency of 1Hz, lead to a greaterMMP2 mRNA expression for low cycle number compared to high cycle number135. A variety of in-vivo,in-vitro and ex-vivo human and/or animal studies illustrated the upregulation of MMP2 in the presenceof tendinosis, ruptured tendon and overuse, indicating it is a suitable gene of interest for tendondegeneration.2.4.1 Frequency dependent mRNA expressionThe effect of loading frequency on MMP expression has not been researched widely. In our study thecells stimulated with high frequency loading (1Hz), expressed a significantly higher MMP2 mRNAexpression compared to low frequency stimulation (0.33Hz). Wang et al. demonstrated a frequencydependent elevation of prostaglandin-E2 (PGE2) and cyclooxygenase (COX) 1 and COX2 in patellar tendon61cells158. Petersen et al. reported a frequency dependent rise in VEGF as well102. A study on cartilagedemonstrated that a higher frequency of cyclic mechanical loading upregulated the proteoglycancontent compared to lower frequency loading213. However, Lavagnino et al. found that MMP1 mRNAexpression was down regulated with higher frequency compared to lower frequency146. A few studieshave shown a frequency dependent increase of substances that degrade the ECM in tendons while theeffect of strain on mRNA expression has been studied to a larger extent.The MMP2 protein level was significantly greater at high frequency at day 2 but greater at lowfrequency at day 5 (Figure 2.3). It may take longer (5 days) for low frequency stimulation to result inMMP2 protein level increases. Whereas high frequency stimulation may result faster (2 days) in greaterMMP2 protein level. The TIMP2 mRNA expression was greater with high frequency at day 2 (Figure 2.2).This is in line with MMP2 MRNA expression and MMP2 protein level at high frequency stimulation, atthe same day (Figure 2.2). TIMP2 inhibits MMP2 and may be upregulated as MMP2 mRNA isupregulated. MMP2 protein level increases may be a direct result of the greater MMP2 mRNAexpression.  MMP2 mRNA is increased at day 3 and TIMP2 mRNA at day 4, with high frequency (Figure2.2).  TIMP2 mRNA expression (Figure 2.2) may be a delayed effect of the greater MMP2 mRNAexpression. TIMP2 mRNA (Figure 2.2) and MMP2 protein level (Figure 2.3) are greater with lowfrequency stimulation at day 5. Even though these significant differences were observed, it is noticeablethat MMP2 mRNA expression with low frequency stimulation at day 5 is of similar RQ. And this mayhave led to the greater MMP2 protein level on day 5 (Figure 2.3).2.4.2 Strain magnitude dependent mRNA expressionSeveral studies have researched strain-dependent substance release; however strain-dependent MMP2expression has not been extensively investigated.  Jiang et al. found a strain magnitude dependency (4%62and 8%) on the mRNA and protein level for collagen I  compared to  controls in human patellar tendonfibroblasts159. Interleukins 2 and 6 as well as vascular endothelial growth factor mRNA expression weregreater with higher strain compared to lower levels of strain, however no strain dependent differencewas detected159. In contrast, tendon cells in rat tail tendons demonstrated a partly inhibited MMP1mRNA expression in the 1% strain group and completely inhibited in the 3% and 6% strain groups at afrequency of 0.017Hz146, suggesting that physiologic strain levels are required to maintain the tendonstructure. Gardner et al. found a strain magnitude dependent increase of TIMP1214. In the current study,the cells stretched with high strain (10%) exhibited a greater mRNA expression of MMP2 and MMP14compared to the groups stretched on low strain (2%).The MMP2 mRNA expression of cells stretched with high strain was greater on days 2 and 3 comparedto low strain stretching (Figure 2.5), while the MMP2 protein level was greater with high strainstretching at day 5 compared to low strain stretching (Figure 2.3B). Generally mRNA expressionupregulates before protein can be synthesized. This may explain why the MMP2 mRNA expression wasgreater on days 2 and 3, while the MMP2 protein level was greater at day 5.However, the effect of increased frequency intensity on the mRNA expression was stronger, resulting inhigher mRNA values than the effect of increased strain on mRNA expression. The interaction betweenhigh strain and high frequency suggested an additional elevation of MMP2 mRNA expression which mayhave detrimental effect to tendon structure and functioning.Cells experience forces in their natural environment and by motion the forces are altered resulting in acell shape and functional change215,216. Automated cell morphology detection was used to determine thesolidity, a measure of cell branching, and major/minor axis ratio, a measure of cellelongation/roundness. The results showed that the mechanically stimulated cells had a more elongated63appearance (higher major/minor axis ratio) and the controls were more branched (greater solidity). Themajor/minor axis ratio findings suggest that more intense mechanical stretching led to more cellbranching (elevated solidity values) however the cell shape was variable over time. In tendinosis, thecells generally become larger and the shape of nuclei changes from elongated to a roundermorphology64,81,217,218. Surprisingly, our quantitative cell morphology analysis detected more branchingand elongated cells with high strain and frequency stimulation which is a different morphology than thatobserved in tendinosis. One possible explanation is that different cell types migrate from outside intothe tendons when injured, therefore the cell lineage may be altered during injury and repair, resulting inan inherently different morphology219. In addition, a variety of other stressors may be present in thetendinopathic lesion which could contribute to the phenomenon of cell rounding.The Flexcell system is commonly used to mechanically stimulate cells by stretching the membranewhere the cells are adhered. Besides stretching the cells, the mechanical properties of the Flexcellsystem such as strain, frequency, and the shape of the loading pattern (e.g. block, sinusoidal, etc.) maycause a concurrent shear stress caused by the fluid flow. This may also occur during repeated stretch oftendon, as it is a hydrated, viscoelastic material containing displaceable fluid220,221. The effect of fluidflow on rabbit tenocytes was demonstrated by Archambault et al. who reported that MMP1/ 3 andCOX2 genes were upregulated222. Human tenocytes responded to fluid flow by increasing the calciumproduction that in turn co-modulates, gene transcription, cell growth and proliferation, contraction andapoptosis207. Fluid shear stress has also been reported to effect the endothelial cell shape and alignmentto remodel in the direction of flow223. It remains unknown, in both in-vitro and in-vivo, whetherparticular elements of mechanoresponsiveness are attributable to fluid shear stress or to membranestretch. It is likely that tenocytes integrate information from a variety of mechanosensory pathwaysincluding ion channels, integrins, and primary cilia224.64The zymography results were in line with the qPCR results, showing higher levels on day 2, however nosignificant differences were observed with this assay. A possible explanation lies in the integrallimitation of in-vitro experiments which lack a fully developed ECM. The cellular response of cellswithout the ECM may not be as pronounced compared to the response in their natural environment.Nonetheless, in-vitro studies are needed to uniquely identify the effects of stimulation on a cellularlevel.In conclusion, in this study we showed that both frequency and strain induced MMP2 increases on themRNA and protein levels. These results indicate that overuse injuries that are either highly repetitive orforceful in nature, both cause mRNA expression changes of MMP2. Strain is thought to be the mostinfluential parameter for inducing tendon damage while frequency is often overlooked or set as adefault factor. However, the current results reflect that frequency as well as strain influence MMP2mRNA expression and protein level of cells. This suggests that a high number of repetitions of minimalforce might induce catabolic changes in tendon and thereby contribute to the development of earlyfatigue failure and subsequent injury of tendon. Full understanding of all mechanical contributors tooveruse tendinopathy is crucial for new or improved strategies in preventing and treatingtendinopathies.653. Enhanced collagen type I synthesis by human tenocytes subjected toperiodic in-vitro mechanical stretching1In Chapter 2 it was described that human hamstring tendon cells increase their MMP2 mRNA expressionafter mechanical stretching that was either comprised of a high frequency or a high strain. Elevatedlevels of MMP2 in general indicate a degenerative response. A remodeling response was often indicatedby collagen type I or III mRNA increases however these were not observed after the mechanicalstretching exerted on the cells as described in Chapter 2.  In this Chapter we aim to describe the cellularresponse of tendon cells on mechanical stretching with periods of rest during exercise.3.1 BackgroundTendons experience varying loads in their natural environment. Excessive mechanical loading225 on theone hand, or stress deprivation209,214 on the other, can lead to tendon damage or degeneration.Conversely, physiological mechanical stretching promotes ongoing collagen synthesis and repair activityby resident tendon fibroblasts (tenocytes)122. The physiological variables (strain level, frequency,repetition number, etc.) which determine the tissue and cellular responses of tendons to mechanicalstretching have been studied to some extent204, but the optimal conditions to prevent injury or topromote collagen synthesis and repair are incompletely understood.Increased knowledge of the parameters of mechanical stretching which promote collagen synthesis bytenocytes could help to refine exercise prescription, especially when considering that mechanical1 This work is published: Huisman E, Lu A, McCormack RG, Scott A. Enhanced collagen type I synthesis byhuman tenocytes subjected to periodic in-vitromechanical stimulation. BMC Musculoskelet Disord.2014 Nov 21;15(1):386.66stimulation of tendons through exercise is a cornerstone of rehabilitation following acute or chronictendon injury182. An exercise regimen (3 sets of 15 heel drops performed slowly, twice per day, withweight gradually increased to patient tolerance) has been shown to be effective for chronic Achillestendinopathy in both the short and long term182. One proposed mechanism of action of this type ofexercise regimen is a stimulation of collagen type I production by tenocytes which, in the long term,could lead to an increased tendon strength and modulus182.The data have suggested that there may be a window of appropriate mechanical stretching defined byvariables such as repetition number and strain magnitude. A strain magnitude dependency was reportedfor mRNA expression and protein levels of collagen type I159, whereas an inverse strain magnitudedependency was found for MMP1146 (a metalloproteinase with collagenase activity).  Several studieshave shown that tenocytes undergoing mechanical stretching increase their expression of the genes forcollagen type I and III as well regulatory genes and growth factors which influence collagen synthesissuch as TGF-β1 and SCX-A122,135,146,226.Surprisingly, an equivalent magnitude of increase in collagen type I synthesis rate in the human patellartendon was observed following both long distance running (36km) and strength training (10 sets of 10maximal knee extensions)80,227.  This finding has led to the speculation that collagen type I production bytenocytes might plateau after a number of loading repetitions as low as n=100227.  Desensitization tocontinuous load cycles is a phenomenon known to occur in bone cells228. More importantly, theinsertion of recovery periods during the mechanical stimulation restored the mechanosensitivity in bonecells228. The insertion of rest periods during cyclic stretching experiments performed on adolescent andaged murine tibia resulted in enhanced bone formation compared with controls. The level of boneformation observed in response to rest-inserted loading was similar to a loading regimen that doubledthe load and cycle number229,230. This may indicate that a high load and cycle number are not necessaryto elicit a maximal response if rest periods are included. A study of osteogenesis in mice tibia showed67that rest periods inserted in between short bouts of stretching had a larger effect on osteogenesis thancontinuous stretching. While several studies have displayed the positive effects of rest insertion on boneformation228–232, the effect of rest-insertion on the load-induced expression of collagen genes intenocytes has yet to be examined.In-vivo, tenocytes typically display an elongated morphology, oriented along the longitudinal direction ofthe tendon197, while in response to increased mechanical loading, they may adopt a more roundedmorphology with more prominent cytoplasm. In-vitro, it has been shown that mRNA expression andprotein production are influenced by cell attachment and spreading198 . Li et al. reported that moreelongated human tendon fibroblasts expressed higher collagen type I levels compared to less elongatedcells, while the cell spreading area was constant233. Alternately, other studies have shown that tendonfibroblasts may adopt a more rounded shape when more metabolically active. In the human patellartendon, ovoid tendon cells expressed higher levels of TGF-β1 and pro-collagen type I compared toelongated tenocytes25. To our knowledge, the relation of tendon cell shape and collagen mRNAexpression has not been directly investigated in mechanically stimulated tenocytes.Tenocytes were mechanically stimulated to test the hypothesis that rest insertion compared tocontinuous stretching initially up-regulates SCX-A and TGF-β1 mRNA expression22,234,235 and isaccompanied by enhancement of mRNA expression and protein levels of pro-collagen type I and III,whereas low (100) and high (1000) cycle numbers would have equivalent effects on these samevariables. As a secondary question, the influence of mechanical stretching on cell morphological featureswas analyzed.683.2 Methods3.2.1 Cell cultureThe tendon cells used were from the same origin and cultured as described in Chapter 2 and Section2.2.1.3.2.2 Mechanical stretchingCells were passaged at a concentration of 32,500 cells/ml. 65,000 cells per well were plated onto 6-wellBioFlex® - collagen type I coated culture plates (Flexcell International Corp., Hillsborough, NC, USA).After 48 hours, the cells were subjected to mechanical stretching using a sinusoidal waveform at afrequency of 0.1Hz and a strain of 10%. The frequency of 0.1Hz was based on findings of Kongsgaard etal. who demonstrated that slow (e.g. 6-8 second repetition duration), heavy resistance exercise wasbeneficial in the rehabilitation of patellar tendinopathy resulting in enhanced collagen synthesis121. Theequiaxial strain of 10% applied to the BioFlex® plates has been previously reported to result in anaverage strain experienced by the cells of approximately 3-5%161. The study consisted of fourmechanically stretching groups with a combination of low or high cycle number and with or withoutrest. The precise groups were 1) 100 cycles of continuous stretching, 2) 100 cycles with 10s rest afterevery cycle, 3) 1000 cycles of continuous stretching, 4) 1000 cycles with 10s rest after each cycle. Forevery experiment group there was a corresponding control group, which were not stretched but wereotherwise treated identically and harvested at the same time points. All experiments were performed inbiological and technical triplicates.3.2.3 RNA extraction and quantitative polymer chain reactionThe RNA extraction and qPCR analyses were performed as described in Chapter 2 and Section 2.2.3. Theprimers used and their sequence can be found in (Table 3.1).69Table 3.1 RT-qPCR primersTarget Forward Primer Reverse PrimerGAPDHTCTTTTGCGTCGCCAGCCGAG TGACCAGGCGCCCAATACGACCollagen type ITGTTCAGCTTTGTGGACCTCCG CGCAGGTGATTGGTGGGATGTCTCollagen type IIIAATCAGGTAGACCCGGACGA TTCGTCCATCGAAGCCTCTGTGF-β1GCAACAATTCCTGGCGATACC AAAGCCCTCAATTTCCCCTCCSCX- AAGAACACCCAGCCCAAACA TCGCGGTCCTTGCTCAACTT3.2.4 Immunocytochemistry and cell morphology analysis for pro-collagen types Iand IIIThe cells of all mechanically stimulated groups underwent immunocytochemistry procedures forquantifying the protein level of pro-collagen types I and III as well as the cell morphology analysis.  Inthis study 300 tendon cells of each mechanically stimulated and control group were analyzed accordingto the description in 2.2.6-2.2.8.3.2.5 StatisticsLinear mixed model analysis was performed using SPSS (SPSS Inc., Chicago, IL, USA) to test forstatistically significant differences in mRNA expression. Repeated Generalized Estimating Equationswithin Generalized Linear Models using SPSS was used to determine protein level, cell solidity and ratioof major/minor axis among the groups. The model tested for main effects of mechanical stretching vscontrols, rest inserted vs continuous stretching, and low (100) vs high (1000) cycle number. The mRNAdata were expressed as relative quantity (RQ, relative to control tenocytes harvested under identicalconditions at the same time) after normalizing the raw data to the housekeeping gene GAPDH. RQ70values were then log transformed before statistical analysis to obtain normal distributions. A p value of≤ 0.05 was considered statistically significant for all statistical tests. The qPCR results are reported as themean difference between low and high cycle number and continuous and rest inserted mechanicalstretching groups with a 95% confidence interval (CI) of the difference. The protein and cell morphologyresults were reported as mean and 95% CI. For both methods CI adjustments were made using Sidakcorrection. The figures depict the main effects tested by the linear models, with each variable(continuous vs rest-inserted loading, 100 vs 1000 repetitions) depicted in a separate figure.3.3 Results3.3.1 Mechanical stretching of human tendon cells compared to control cellsThe cyclic stretching regimens were well tolerated by the tenocytes (i.e. no evidence of cell death andno difference in RNA concentrations between stimulated and control groups). Overall, mechanicalstretching led to significantly greater collagen type I and SCX-A mRNA expression (p<0.05) comparedwith control cultures (8h, Table 3.2).The immunohistochemistry also indicated that the pro-collagen type I intensity of the stretched groupwas increased after 24h (p<0.01) and had a mean of 0.205(0.203-0.207) while the control groupdisplayed a mean of 0.176(0.174-0.179). The stretched group showed a higher (p<0.01) mean of0.262(0.261-0.264) for pro-collagen type III intensity while the control group had value of 0.238(0.235-0.240).71Table 3.2 The effect of mechanical stretching on mRNA expression compared with controls.The data is displayed as the back transformed mean difference of the mechanically stimulated groupminus control group (confidence interval of difference). Values>1 depict larger values for themechanically stimulated group compared to the control cultures.  The * indicates a significant differenceof p<0.05, the ƚ indicates significant difference of p<0.01. The back transformed means(CI) are notequivalent to means of the original variable due to mathematical twisting236.3.3.2 Rest-inserted vs continuous stretchingRest insertion resulted in a greater protein level of pro-collagen type I [1.421(1.399-1.442)] (24h, p<0.01)compared to continuous stretching [1.303(1.284-1.322)] while pro-collagen type III levels were greaterwith continuous stretching [1.223(1.211-1.235)] compared with the cells stretched in the rest-insertedregimen [(1.142(1.130-1.153), 24h, Figure 3.1, p<0.01]. Overall, periods of rest insertion had a positiveeffect on mRNA expression for collagen type I with a mean difference (CI of difference) of 1.35(1.10-1.65) SCX-A 1.30(1.02-1.65) and TGF-β1 [1.70(1.10-2.65), 8h, p<0.05, Figure 3.1]. Collagen type I mRNAexpression 1.20(1.01-1.43) were increased as early as 4h (p<0.05).Group Collagen Type I Collagen Type III SCX-A TGF-β1Rest 1.15(1.00-1.34)* 0.81(0.59-1.11) 2.62(2.09-3.27)ƚ 1.21(0.83-1.76)Continuous 0.86(0.70-1.05) 0.67(0.46-0.98)* 1.79(1.22-2.64) ƚ 0.80(0.56-1.16)100 cycles 0.90(0.73-1.10) 0.93(0.60-1.55) 3.33(2.93-3.79) ƚ 1.20(0.89-1.63)1000 cycles 1.20(1.03-1.40)* 0.66(0.49-0.89) ƚ 1.43(1.03-1.99)* 0.83(0.50-1.38)72Figure 3.1 Effect of rest-inserted stretching vs continuous stretching on mRNA expression (A, B) and proteinlevels (C) of collagen type I and III.The cells that underwent rest inserted stretching showed an increased mRNA expression of collagentype I (A) at 8h post stretching (p<0.05) compared to continuously loaded cells. Collagen type III mRNAexpression did not significantly change (B). The pro-collagen type I was significantly greater (p<0.05) inthe rest insertion group compared to the continuously loaded, while the continuous group had anincreased (p<0.05) pro-collagen type III value at 24 hours post stretching (C). The continuous groupconsisted of the two groups that were stretched with 100 and 1000 cycles continuously while the restgroup consisted of the two groups that were stretched with 100 and 1000 cycles with periods of restinserted. The * indicates a significant difference of p<0.05, the ƚ indicates significant difference ofA BC73p<0.01, the error bars indicate the standard error. All data points from each group were normalized tocontrols harvested at every time point. The bars and error bars represent data of biological triplicates.3.3.3 Low vs high cycle numberThe pro-collagen type III protein level was greater (p<0.01) in the 100 cycles stretch regimen[1.243(1.231-1.254)] compared to the 1000 cycle group [1.122(1.111-1.134), 24h, Figure 3.2].The cells stimulated for 1000 cycles showed higher expression of TGF-β1 1.49(1.20-1.85), 4h, p<0.01],and collagen type I [1.31(1.07-1.60, 8h, p<0.05] compared to the 100 cycle regimen.74Figure 3.2 Effect of cycle number on mRNA expression (A, B) and protein levels (C) of collagen type I and III.The high cycle number (1000) caused elevated collagen type I mRNA expression (p<0.05). Pro-collagentype III protein levels (C) were upregulated in the 100 cycles regimen (p<0.05, 24h). The 100 cycles barconsisted of the two groups that were stretched with 100 cycles with and without rest insertion whilethe 1000 cycles bar consisted of the two groups that were stretched with 1000 cycles with and withoutperiods of rest inserted. The * indicates a significant difference of p<0.05, the ƚ indicates significantdifference of p<0.01, the error bars indicate the standard error. All data points from each group wereA B75normalized to controls harvested at every time point. The bars and error bars represent data ofbiological triplicates.3.3.4 Cell morphologyThe solidity of tendon cells was greater when subjected to mechanical stretching [0.621(0.618-0.624)]compared with controls [0.601(0.597-0.605)] (p<0.01), indicating increased cell branching withmechanical stretching. The major/minor axis, a measure of cell shape, in mechanically stretchedtenocytes was lower [2.845(2.815-2.875)] than the control group (p<0.01, 3.005(2.958-3.053), Figure3.3) indicating increased cell rounding with mechanical stretching.The major to minor axis ratio was lower (24h, p<0.05, Figure 3.3) with the 1000 cycles stretchingregimen [2.159(1.757-2.561)] compared to the 100 cycle regimen [2.778(2.748-2.808)].Figure 3.3 Immunocytochemistry images (pro-collagen type III), 10x magnification.76With A) control cells, B) 100 cycles continuously stretched cells, C) 1000 continuously stretched cells andD) 1000 cycles rest insertion cells. Mechanically stimulated cells (especially C and D) appear more spreadout, with a correspondingly reduced major/minor axis.3.4 DiscussionThe main finding of this study is that the insertion of rest periods between cycles of mechanicalstretching of tenocytes resulted in greater expression of collagen type I mRNA and protein comparedwith continuously stimulated tenocytes.Mechanical stretching of cells results in mechanotransduction; the transmission and conversion of amechanical stimulus into a biological response, through a variety of mechanisms. There are three mainstages of mechanotransduction: mechanocoupling, cell-to-cell communication, and effector cellresponse. Mechanocoupling is the process whereby the applied load is transmitted through the tissuesand cells, resulting in different types of cellular deformation (strain, compression, fluid flow andshear211), and this deformation is translated into a biochemical response which can include the openingof ion channels such as stretch-activated calcium channels, and the activation of transmembranesignaling proteins such as integrins and G-protein coupled receptors207. The mechanically stimulated cellmay also spread the signal to adjacent cells (cell-to-cell communication, involving the passage of calciumions via gap junction, for instance) thereby amplifying the response237. In response to elevatedintracellular calcium and other signals, protein activity is initiated within the cell (e.g. activation of MAPKfamily members) leading to gene transcription and production of protein which can include newlysynthesized extracellular matrix, or autocrine/paracrine substances like TGF-β1 or IGF-I which furtheramplify the adaptive responses234. Most of these processes have been documented to some extent intendon cells, which are known to be highly mechanoresponsive. The adaptive response of tenocytes hasbeen shown, in-vivo, to be related to the magnitude of applied strain; e.g., exercise in a shortened (lowstrain) position leads to less tendon adaptation than exercise in a lengthened (high strain) position238.77LaMothe et al. researched the effect of rest insertion and showed that rest insertion incorporated inloading protocols had a larger effect on mineral deposition and osteogenesis than loading231,232.Commonly, mechanical stimulation is applied as continuous bout of stretch at a certain frequency 239.The current results suggest that rest incorporation stimulates the expression of collagen type I andcollagen type III mRNA to a greater degree than continuous stimulation.The number of repetitions of applied mechanical stretching can elicit different mRNA expressionpatterns. In this study, at a frequency of 0.1Hz the high cycle number (1000) increased the TGF-β1 (4h)and collagen type I (8h) mRNA expression, while no change in collagen type III was observed. In a humanin-vitro patellar tendon model Bosch et al. showed an increase in amino terminal pro-collagen type IIIpropeptide (P-III-NP) after 1800 and 3600 stretch cycles at a strain of 5% and a frequency of 1 Hz. Thehigher cycle number (3600) resulted in a higher P-III-NP elevation (32%) compared to the lower cyclenumber (1800) which demonstrated a 21% increase.  The carboxyterminal pro-collagen type Ipropeptide levels demonstrated a 50% increase after 3600 cycles of stretching, but not 1800. Thesefindings are in line with our results; a higher cycle number leads to a more increased collagen type ImRNA expression.SCX-A regulates the transcription of collagen type 1a1 and TGF-β1 is known to induce collagen type Iexpression234,235,240. In the current study the cells stretched on a regimen of 1000 cycles upregulatedSCX-A (4h), TGF-β1 (4h) and collagen type I (8h) mRNA expression; this pattern is in line withexpectations of upregulated SCX-A and TGF-β1 preceding elevated levels of collagen type I and collagentype III are present post stimulation.It has been shown that mechanical stresses applied to the cells lead to altered forces within the cellwhich play important roles in the control of cell shape and cell function215,216. For example, theapplication of shear stress e.g. caused by blood flow, to endothelial cells resulted in altered cell shape78from cobblestone to aligned in the direction of the flow and the formation of actin stress fibers223. Theresults indicate that mechanical stretching may induce a more metabolically active tenocyte phenotype,with tendon cells that are less elongated, and more branched, particularly when subjected to cyclicstretching that incorporates rest insertion and longer durations; these same regimens are associatedwith higher expression levels of a tenocyte transcriptional regulator (SCX-A) and a key tendonextracellular matrix protein (collagen type I). These findings are in contrast with those of Li et al., whofound that more elongated cells had a higher collagen type I protein level233, however they are inkeeping with those of Chuen et al. who found less elongated tenocytes to express higher levels ofcollagen type I25.  Clearly, cell shape is dynamically regulated by mechanical stimulation and a clearrelation with mRNA expression is not to be expected. It may also be worth pointing out that older,morphological categorizations of tendon cells based on their shape (e.g. “tenoblasts” being a morerounded subpopulation of tendon cells compared to the elongated tenocytes) may not be valid241, andthat tenocyte rounding, sometimes taken to be a feature of tendinosis242, may in fact be associated withan adaptive response and should not necessarily be interpreted as pathological.A limitation of this study was that the observed changes in mRNA expression were of small magnitude;however, they were in keeping with a significant upregulation at the protein level and with theknowledge that tendon is a relatively slow-adapting tissue. Furthermore, our cell shape observations,although based on automated measurements of many cells, do not account for possible changes in cellthickness.  There is also an inherent limitation of in-vitro studies; the response to stretching may alsohave been more accentuated if the tendon cells were located within their native extracellular matrix,rather than cultured two dimensionally – a condition which likely disturbs integrin-mediated signalingwhich is thought to contribute to mechanoresponsiveness20. Nonetheless, in-vitro studies with tenocytesin two dimensional cultures have replicated many of the mechanically-induced responses that areknown to occur in-vivo and may therefore continue to serve as a useful experimental system.79In this study, we demonstrated that periods of rest insertion are beneficial for collagen synthesis byhuman tenocytes. One implication of these findings is that when using exercise as a rehabilitativemeasure for people with chronic tendinopathy, allowing an adequate time to recovery after everystretch cycle may induce a more substantial adaptive response. Further studies could investigate therole of mechanotransduction pathways in response to rest-inserted stretching (e.g. the role of calciumsignaling) and to examine whether a rest-inserted exercise program (e.g. 10s rest after every repetition)results in improved tendon adaptation in humans. In addition, further optimization of mechanicalproperties capable of stimulating collagen synthesis could be undertaken, including strain rate andfrequency.804. Regional molecular and cellular differences in the female rabbit Achillestendon complex: potential implication for understanding responses to loading2Chapters 2 and 3 described the response of tendon cells to mechanical stretching that was either highlyrepetitive, high strains or rest inserted for long or short durations. To study the cellular response in itsnatural environment in-vivo experiments are needed. The Backman model is an repetitive motion in-vivomodel for repetitive movements of the rabbit Achilles tendon175. Before using the Backman model, moreclarification on the rabbit Achilles tendon is needed as Doherty and co-workers demonstrated that therabbit Achilles tendon consists of three tendons forming a complex183. Thus far the molecularcomposition of these three tendons is not described and if these tendons are affected whenmechanically stimulated using the Backman model.4.1 BackgroundTendons are load-bearing structures that transmit forces from muscle to bone and their structure isrelated to their function, which differs throughout the human body. The Achilles tendon withstandslarge loads, while tendons in the hands exert fine movements21. Tendons or regions within a tendon aresubject to compression, tension, friction or a combination thereof.Tendons primarily consist of collagen type I fibers, tenocytes and PGs (glycosaminoglycan chains withprotein cores)19,107,243. PGs are involved in collagen type I fibrillogenesis and contribute to the structureand mechanical properties of tendon40,43. Two types of PGs are present in tendons: (1) small leucine-rich2 This work is published: Huisman ES, Andersson G, Scott A, Reno CR, Hart DA, Thornton GM. Regionalmolecular and cellular differences in the female rabbit Achilles tendon complex: potential implicationsfor understanding responses to loading. J Anat. 2014 May;224(5):538–47.81PGs (SLRPs) like decorin and biglycan, and (2) large aggregating PGs like aggrecan and versican40,44,244.Increased levels of aggrecan and biglycan were found in compressed regions of tendon; for example,where tendon wraps around bony prominences40,45,245. Increased glycosaminoglycan content incompressed regions compared to tensile regions of tendons have been reported in human tibialisposterior tendons45 and human biceps tendons246. Fibrocartilage metaplasia, a structural change, isoften seen after tendon injury; therefore, it is important to understand the baseline phenotypicvariations in tendon tissue.Men and women experience tendon conditions/injuries with different frequency81,164,247. Also, men andwomen have differences in tendon collagen properties. In human patellar tendon, collagen (proline)fractional synthesis rate was lower for women than men248 and collagen (hydroxyproline) contenttended to be lower for women than men when normalized to wet weight but not to dry mass249. Theultimate stress of isolated collagen fibrils from the patellar tendons of women was lower than that ofmen248. In women, Achilles tendon ruptures demonstrated a steady increase after age 60 with a peakincidence at age 80 or older, and the authors commented that the rate of rupture starts to increaseafter menopause250. Hormones may have an influence on tendon development, injury and tendonhealing. Estrogen receptors or their transcripts have been detected in human skeletal muscle251 andanterior cruciate ligament252 and rabbit flexor digitorum longus, extensor digitorum, patellar andAchilles tendons253,254. In rabbit tendons, the impact of pregnancy or ovariohysterectomy (OVH) wasdifferent for different tendons when evaluated using mRNA expression for genes including collagens,PGs, proteinases and inflammatory mediators253,254. As tendons are heterogeneous structures, it is ofsignificance to explore the fundamental variation between intact normal and OVH tendon tissue.The Achilles tendon complex in rabbits consists of tendons from multiple muscles. The tendon from theflexor digitorum superficialis muscle is included into the Achilles tendon complex of the rabbit183 (Figure824.1) and it shares the paratenon - a loose areolar connective tissue that allows the tendon to move withminimal friction183,218,255 - with the medial and lateral gastrocnemius tendons. The Achilles tendoncomplex rotates on its way from the muscle origin to the insertion at the calcaneus183. The tendon of thesoleus muscle in the rabbit has been shown to have a negligible amount of fibers in the Achilles tendoncomplex183. It has not been described whether these different parts of the Achilles tendon complex havevarying mechanical properties or expression patterns.Figure 4.1 Posterior view of the rabbit calf-muscles and tendons.The dashed line represents the dissection location where the distal part was separated from theproximal part. Inset corresponding to areas marked A and B: The six regions of the Achilles tendon83complex; DG: distal gastrocnemius (fused lateral and medial); DFDS: Distal flexor digitorum superficialis;PLG: proximal lateral gastrocnemius; PMG: proximal medial gastrocnemius; PFDS: proximal flexordigitorum superficialis; P: paratenon. Original art by Gustav Andersson. Huisman 201429, reproducedwith permission.In this study, the expression of genes in different anatomical regions within the rabbit Achilles tendoncomplex were compared. We hypothesized that compressed (distal) tendon regions would demonstratea higher level of expression of PGs compared to the tensile (proximal) regions. The paratenon is likely toshow a unique expression phenotype for certain genes due to the presence of vascularization22 and theincreased number of cells compared to the tendon proper179.Differences in mRNA expression between intact normal and OVH rabbits were also studied in order toexamine the potential effect of estrogen on mRNA expression in the Achilles tendon complex. Wehypothesized that differences in mRNA expression between intact normal and OVH rabbits will bepresent. Collagens and genes associated with collagen regulation such as MMPs and TIMPs may exhibitdifferential expression between tendons from intact normal and OVH rabbit groups.4.2 MethodsExperiments were conducted in accordance with animal care committee approvals from University ofCalgary and University of British Columbia. Achilles tendon complexes from twelve female New ZealandWhite rabbits (5.6±0.7kg; Riemens, St. Agatha, ON, Canada) that were a minimum of 48 weeks of agewere used for the analysis of regional mRNA expression patterns and morphological characterization.Four rabbits were intact normal rabbits and eight rabbits had undergone ovariohysterectomy surgery at15 weeks of age.  All animals were euthanized using an overdose of pentobarbital (Euthanyl, MTCPharmaceuticals, Cambridge, ON, Canada).844.2.1 Dissection and definition of regionsSix regions of the Achilles tendon complex were defined: distal gastrocnemius (DG), distal flexordigitorum superficialis (DFDS), proximal lateral gastrocnemius (PLG), proximal medial gastrocnemius(PMG), proximal flexor digitorum superficialis (PFDS), and paratenon. The anatomy of the rabbit Achillescomplex is illustrated in Figure 4.1. The Achilles tendon complex of the hind limb was dissected from thecalcaneal insertion to 3cm proximal. The paratenon was collected separately followed by splitting theAchilles tendon complex into two parts. The distal part consisted of two tendons: the fusedgastrocnemius tendons or distal gastrocnemius (DG), and the distal flexor digitorum superficialis (DFDS)tendon. The proximal part consisted of three tendons: the proximal lateral gastrocnemius (PLG), theproximal medial gastrocnemius (PMG), and the proximal flexor digitorum superficialis (PFDS) (Figure4.1).  The samples for molecular analysis were snap frozen using liquid nitrogen and stored at -80°C untilfurther analysis. The samples for histological analysis were fixed in 10% formalin in phosphate bufferedsaline.4.2.2 RNA extraction and reverse transcription-polymerase chain reactionRNA was extracted using the TRIspin method; this process has been previously described in detail (Renoet al. 1997). Frozen tendon tissues were pulverized using a Braun Mikro-Dismembrator (B. Braun BiotechInc., Allentown, PA, USA). To thaw the powdered tendon tissue, 1 ml of TRIzol Reagent (LifeTechnologies Inc., Gaithersburg, MD, USA) was added to each sample. When thawed, the samples weretransferred to 1.5ml Eppendorf tubes. Chloroform, 0.2ml, was added followed by vortexing andcentrifuging to separate the aqueous and organic phases. The RNA in the aqueous phase was purifiedusing the RNeasy Total RNA isolation kit (Qiagen Inc., Chatsworth, CA, USA). Quantification of total RNAwas completed using SYBR Green II (FMC BioProducts, Rockland, ME, USA) fluorescent dye andcomparing experimental values to standard calf liver ribosomal RNA concentrations on a Turner 45085fluorescence spectrofluorometer (Barnstead/Thermolyne, Dubuque, IA, USA). Total RNA (1 μg) wasconverted to cDNA using Qiagen Omniscript RT kit (Qiagen Sciences) enzyme reverse transcriptase. Real-time reverse transcriptase qPCR was performed in duplicate on 19 genes (Table 4.1) using a BioRadiCycler (Bio-Rad, Hercules, CA, USA). The primers used (Table 4.1 RT-PCR Primers.) were designed for thetarget rabbit genes. Values for genes were normalized to corresponding 18S values.For morphological characterization, haematoxylin and eosin (H&E) staining was performed on 5µmsections of tissues in the six regions of the Achilles tendon complex from one intact normal rabbit.Table 4.1 RT-PCR Primers.Target genes Forward Primer (5’-3’) Reverse Primer (5’-3’) Base pair sizes18S TGGTCGCTCGCTCCTCTCC CGCCTGCTGCCTTCCTTGG 360Aggrecan GAGGAGATGGAGGGTGAGGTCTTT CTTCGCCTGTGTAGCAGATG 313Biglycan GATGGCCTGAAGCTCAA GGTTGTTGAAGAGGCTG 406Collagen type I GATGCGTTCCAGTTCGAGTA GGTCTTCCGGTGGTCTTGTA 312Collagen type III TTATAAACCAACCTCTTCCT TATTATAGCACCATTGAGAC 255Collagen type V GAGGAGAACCAGGAATAACC GCACCTTTCTCTCCGATGCC 215COX-2 CAAACTGCTCCTGAAACCCACTC GCTATTGACGATGTTCCAGACTCC 82Decorin TGTGGACAATGGTTCTCTGG CCACATTGCAGTTAGGTTCC 419IL-6 CCTGCCTGCTGAGAATCACTT CGAGATACATCCGGAACTCCAT 51IL-8 CAACCTTCCTGCTGTCTCTG GGTCCACTCTCAATCACTCT 145MMP2 CTTCCCCCGCAAGCCCAAGTGGG GGTGAACAGGGCTTCATGGGGGC 51086Target genes Forward Primer (5’-3’) Reverse Primer (5’-3’) Base pair sizesMMP3 GCCAAGAGATGCTGTTGATG AGGTCTGTGAAGGCGTTGTA 363MMP13 TTCGGCTTAGAGGTGACAGG ACTCTTGCCGGTGTAGGTGT 527PRG-4 GAACGTGCTATAGGACCTTC CAGACTTTGGATAAGGTCTGCC 287TGF-β CGGCAGCTGTACATTGACTT AGCGCACGATCATGTTGGAC 271TIMP-2 GTAGTGATCAGGGCCAAAG TTCTCTGTGACCCAGTCCAT 416VEGF GGAGTACCCTGATGAGATCGA CTTTGGTCTGCATTCACATTTGT 211Versican GATGTGTATTGTTATGTGGATCA CATCAAATCTGCTATCAGGG 3104.2.3 Statistical analysisLinear mixed model analysis was performed using SPSS (SPSS Inc., Chicago, IL, USA) to detect statisticallysignificant differences between the six tendon regions or the two rabbit groups. For molecular analysis,tendon tissues from both hind limbs of three intact normal rabbits were analyzed. In the OVH group,tendon tissues from one hind limb of eight OVH rabbits were analyzed with some exclusions: DG (n=8),DFDS (n=8), PLG (n=7), PMG (n=7), PFDS (n=7), paratenon (n=6).  All data were log transformed beforestatistical analysis to obtain normal distribution. After analysis, the data was transformed back to obtainits original format: fold change. A p value of ≤ 0.05 was considered statistically significant for both tests.Results are given as a mean difference between the compared locations with a 95% confidence interval(CI). CI adjustments were made using Sidak correction.874.3 Results4.3.1 Anatomical findings – macroscopic examinationWhen dissecting the rabbit hind limbs, the medial and lateral heads of the gastrocnemius were shown togive rise to two independent tendons which shared paratenon with the tendon from the flexordigitorum superficialis muscle. The soleus muscle was clearly seen on the ventral side of thegastrocnemius muscle, showing a slender, spindle-shaped muscle that arose from the lateral-posterioraspect of the tibia. It inserted into the Achilles tendon complex, but very few – if any – fibers extendeddown towards the calcaneus. At the proximal part of the Achilles tendon complex, the three individualtendons were macroscopically discernable (lateral gastrocnemius, medial gastrocnemius and flexordigitorum superficialis), but at the calcaneal insertion (distal part) the gastrocnemius tendons werefused into one tendon, found ventrally of the flexor digitorum longus tendon (Figure 4.1). At this distalpart, the flexor digitorum superficialis did not insert into the calcaneus but continued to course aroundand under the calcaneus.4.3.2 Analysis of tendons from intact normal rabbitsRegional differences in tendon morphologyHistology was performed on intact normal rabbit tissue. Fibrocartilage consists of collagen fibers with arandom network of interfibrillar matrix that contains high amounts of PG 240. There are various forms offibrocartilage suggesting that there is a spectrum between dense fibrous connective tissue and hyalinecartilage (Benjamin & Ralphs, 1998). The DG (Figure 4.2E) showed the most prominent fibrocartilagestructure; in between the chondrocytes, collagen bundles were positioned in multiple orientations. TheDFDS (Figure 4.2D) fibrocartilage appeared highly cellular and did not show a prominent fiber structure.88In the PLG (Figure 4.2B), tendon tissue, as well as regions of loose connective tissue, adipose tissue andfibrocartilage, was observed. The fibrocartilage in the PFDS (Figure 4.2A) had a less cellular appearancewith this region also containing more adipose tissue compared to the DG (Figure 4.2E). The PMG (Figure4.2C) displayed a fibrocartilage area that appeared structurally similar to the PFDS; however, it was lesscellular and a clear peritenon was visible.  The distal regions showed a more pronounced fibrocartilagestructure compared to the proximal regions and paratenon (Figure 4.2F).Figure 4.2 Haematoxylin and eosin stained intact normal rabbit Achilles tendon complex at a 20x magnification.Fibrocartilage of the proximal regions (A) PFDS, (B) PLG, (C) PMG, and the distal regions (D) DFDS, (E) DG.Image (F) displays the paratenon. The fibrocartilage of the proximal regions (A, B, C) had a less cellularappearance with the PFDS fibrocartilage containing adipose tissue, compared with the distal regions (D,E). The black arrows in (A) indicate tenocytes and the green arrows in (E) indicate chondrocytes. Theasterisks in (A) indicate adipose tissue.89Regional differences in mRNA expressionDistal gastrocnemiusThe DG had increased aggrecan expression compared to all of the proximal regions (PLG, PMG andPFDS) in tendons from intact normal rabbits (p<0.01; table 4.2).  The expression levels of collagen type I,MMP2, IL-6 and IL-8 were significantly lower in the DG compared to the PLG and PFDS (p<0.05; Table4.2).  Additionally, IL-6 expression was lower in the DG compared to the PMG (p<0.01,). Tenascin Cexpression was lower in the DG compared to the PMG and PFDS (p<0.01; Table 4.2).Distal flexor digitorum superficialisThe DFDS had increased aggrecan expression compared to all of the proximal regions (PLG, PMG andPFDS) in tendons from intact normal rabbits (p<0.01; Table 4.2).  The expression of biglycan was greaterin the DFDS compared to the PMG (p<0.05; Table 4.2).ParatenonThe paratenon had lower expression levels of aggrecan compared to the two distal regions (DG andDFDS) and the three proximal regions (PLG, PMG, and PFDS) in tendons from intact normal rabbits(p<0.01; Table 4.2). The expression of biglycan was lower in the paratenon than the DFDS.  Expression ofIL-8 and MMP2 were greater in the paratenon compared to the DG, DFDS and PMG (p<0.05; Table 4.2).Paratenon expression of IL-6 was greater than the DG. The expression of TGF-β was greater in theparatenon than the PMG.904.3.3 Analysis of tendons from OVH rabbitsRegional differences in mRNA expressionDistal gastrocnemiusIn tendons from OVH rabbits, aggrecan expression was higher in the DG compared to the PMG (p<0.01;Table 4.2).  Additionally, the DG exhibited an increased expression compared to the PMG for collagentype III, collagen type V, decorin and MMP3 (p<0.05; Table 4.2).Distal flexor digitorum superficialisThe DFDS had increased aggrecan expression compared to the PLG and PMG in tendons from OVHrabbits (p<0.05; Table 4.2).  Also, the DFDS demonstrated increased expression of collagen type III,collagen type V, and decorin compared to the PMG (p<0.01; Table 4.2).Proximal medial gastrocnemiusThe PMG had decreased expression of collagen type III, collagen type V and decorin compared to boththe PFDS and PLG in tendons from OVH rabbits (p<0.05; Table 4.2).ParatenonThe paratenon had decreased expression of aggrecan compared to both distal regions (DG and DFDS) intendons from OVH rabbits (p<0.01; Table 4.2). Additionally, aggrecan expression was lower in theparatenon compared to the PLG and PFDS (p<0.05; Table 4.2). The expression of biglycan was greater inthe paratenon than the DG (p<0.01; Table 4.2). Expression of MMP2 and TGF-β were greater in theparatenon compared to the PMG (p<0.05; Table 4.2). The expression of collagen type III and collagentype V was greater in the paratenon than the PMG.  Additionally, the expression of collagen type V wasgreater in the paratenon than the DG (p<0.01; Table 4.2).91Table 4.2 mRNA expression differences in regions of tendon of intact normal and OVH rabbits.Mean differences of the regions are displayed for both rabbit groups. *p<0.01, †p<0.05.Intact Normal Rabbits Ovariohysterectomized (OVH) RabbitsGene Location Mean difference (CI) Location Mean difference (CI)Aggrecan DG vs. PFDS PLG PMG ParatenonDFDS vs. PFDS PLG PMG ParatenonPFDS vs. ParatenonPLG vs. ParatenonPMG vs. Paratenon12.4 (2.6-57.8)*29.7 (6.3-138.6)*55.3 (11.84-259.19)*609.5 (130.3-2851.8)*12.9 (2.8-60.3)*30.9 (6.6-144.6)*57.8 (12.4-270.3)*635.3 (135.9-2974.7)*49.3 (10.6-230.9)*20.6 (4.4-96.3)*11.0 (2.4-51.5)*DG vs. PMG ParatenonDFDS vs. PLG PMG ParatenonPFDS vs. ParatenonPLG vs. Paratenon11.9 (1.9-73.6)*36.0 (5.4-241.0) *7.5 (1.2-45.9) †20.2 (3.3-125.0) *61.0 (9.1-409.1) *16.9 (2.4-119.1) *8.2 (1.2-57.4) †Biglycan DFDS vs. PMG Paratenon3.7 (1.0-12.9) †4.1 (1.2-14.3) †Paratenon vs. DG 3.3 (1.1-10.9) †IL-8 PFDS vs. DGPLG vs.5.3 (1.3-22.3) †92Intact Normal Rabbits Ovariohysterectomized (OVH) RabbitsGene Location Mean difference (CI) Location Mean difference (CI) DGParatenon vs. DFDS DG PMG5.2 (1.2-22.1) †5.5 (1.3-23.3) †15.0 (3.6-63.3)*5.2 (1.2-21.7) †Paratenon vs. DFDS DG PMG PFDS PLG4.3 (1.6-11.2) *4.0 (1.5-10.5) *8.3 (3.1-22.1) *5.4 (2.0-14.3) *4.4 (1.6-11.9) *MMP2 PFDS vs. DGPLG vs. DGParatenon vs. DFDS DG PMG5.2 (1.5-8.6)*3.9 (1.1-13.9) †3.8 (1.1-13.5) †10.5 (3.0-37.1)*6.4 (1.8-22.7) †Paratenon vs. PMG 4.8 (1.3-18.6) †TGF-β Paratenon vs. PMG 4.7(1.0-21.3) †Paratenon vs. PMG 2.4 (1.0-5.5) †Collagen type I PFDS vs. DGPLG vs. DG10.2 (2.2-47.5)*5.7 (1.2-26.3) †No statistical differencesIL-6 PFDS  vs. DGPLG vs. DG9.1 (2.0-42.1)*6.2 (1.3-28.5) †No statistical differences93Intact Normal Rabbits Ovariohysterectomized (OVH) RabbitsGene Location Mean difference (CI) Location Mean difference (CI)PMG vs. DGParatenon vs. DG4.9 (1.1-22.8) †8.7 (1.9-40.4)*Tenascin-C PFDS vs. DGPMG vs. DG7.0 (1.5-32.0)*6.5 (1.0-21.3)*No statistical differencesCollagen type III No statistical differences DFDS vs. PMGDG vs. PMGPFDS vs. PMGPLG vs. PMGParatenon vs. DG PMG4.8 (1.9-12.5) *2.8 (1.1-7.3) †5.0 (1.9-13.4) *4.3 (1.5-10.7) *2.8 (1.0-7.8) †7.9 (2.8-22.2) *Collagen type V No statistical differences DFDS vs. PMGDG vs. PMGPFDS vs. PMG3.7 (1.4-9.5) *3.2 (1.2-8.2) *3.1 (1.2-8.3) *94Intact Normal Rabbits Ovariohysterectomized (OVH) RabbitsGene Location Mean difference (CI) Location Mean difference (CI)PLG vs. PMGParatenon vs. PMG Medial proximal2.8 (1.1-7.5) *4.9 (1.9-13.1) *Decorin No statistical differences DFDS vs. PMGPFDS vs. PMGPLG vs. PMG4.8 (1.8-12.7) *3.0 (1.1-8.1) †3.0 (1.1-8.1) †MMP3 No statistical differences DG vs. PMG 7.8 (1.7-35.0) *4.3.4 Comparisons of tendons from both intact normal and OVH rabbitsTo test whether the surgical menopause had an effect on mRNA expression values, expression levels forthe genes in question were compared between the intact normal and OVH groups. Per gene, the datafor the proximal regions (PLG, PMG and PFDS) were pooled and compared with the pooled distal regions(DG and DFDS) data. A significantly lower expression of ten genes of the eighteen investigated wasdetected in the OVH rabbits (Table 4.3).95Table 4.3 mRNA expression data for tendons from intact normal and OVH rabbits of the genes that exhibitsignificant differences between the rabbit groups.. Non-significant differences in mRNA expression were not reported in this table.Gene Mean Intact Normal (CI) Mean OVH (CI)Aggrecan 297.2 (145.9 – 606.7) 28.9 (15.1 - 55.5)*Biglycan 9.5  (6.5 – 13.9) 5.3 (4.1 – 7.0) †Collagen type I 19.9 (12.1 – 32.8) 7.1 (5.0 – 10.2)*COX-2 14.7 (6.8 - 32.1) 4.7 (2.9 – 7.7) †Decorin 25.1 (11.5 - 54.8) 6.1 (3.7 – 10.1) †IL-6 27.4 (11.6 - 64.7) 8.8 (5.1 – 15.2) †TGF-β 10.2 (5.5 - 18.9) 4.0 (2.7 – 6.0) †TIMP-2 8.8 (5.5 – 14.1) 4.4 (3.2 – 6.0) †Versican 10.8 (6.5 – 17.7) 2.2 (1.6 – 3.0)*VEGF 7.4 (4.6 – 11.9) 4.2 (3.0 – 5.8)†A tenfold lower expression of aggrecan in mean relative quantity was found in the OVH group. Biglycanshowed almost a twofold decrease in the mRNA expression in the OVH rabbits. The other PGs; decorinand versican, demonstrated four and five times less mRNA in the OVH group. The collagen type Iexpression was two and a half times lower in the OVH rabbit tissue. The enzyme COX-2 was down-regulated approximately three times more in the OVH group. Interleukin 6 was detected in a lowerquantity in the OVH group compared to the normal group. A twofold decrease in mRNA expression ofTIMP-2 was observed in the OVH tendon tissue. TGF-β and VEGF mRNA were also detected in loweramounts in the OVH versus intact normal group.96Despite these lower levels of expression, consistent regional variations were observed between the tworabbit groups (Table 4.3). Aggrecan expression was greater in the DG compared to the PMG, and in theDFDS compared to the PLG and PMG for both intact normal and OVH rabbits (Table 4.2). In both rabbitgroups, aggrecan expression was lower in the paratenon than in the DG, PLG, DFDS and PFDS. Theexpression of MMP2, TGF-β and IL-8 was greater in the paratenon than the PMG. In addition, theexpression of IL-8 was greater in the paratenon than in both distal regions (DG and DFDS).No statistically significant differences were detected in mRNA expression values between the tendonsfrom the left and right hind limb of the rabbits in either the intact normal or OVH rabbits. Therefore, thespecific hind limb used was not considered a factor of importance.4.4 DiscussionDifferences were found in mRNA expression in the various regions of the Achilles tendon complex inboth rabbit groups, which may be related to the loads experienced in the various regions, in otherwords, their tensile and compressive environments. The compressed (distal) regions of the intact normalAchilles tendon complex displayed a more fibrocartilaginous phenotype, as evidenced by higheraggrecan and biglycan expression levels as well as fibrocartilaginous tissue morphology compared to thetensile (proximal) regions. The mRNA expression of the tendons from the OVH rabbits displayed reducedexpression of 10 of 18 genes examined, which suggests that systemic estrogen may have a generaleffect on tenocyte metabolism.4.4.1 Influence of tendon region on mRNA expressionThe area of tendons that wrap around bony prominences, thus experiencing compression, have beenshown to exhibit increased levels of aggrecan and biglycan40,45,245 Fibrocartilaginous morphology isassociated with compressed regions40,245 and this is also illustrated in Figure 4.2 where a more cartilagelike structure is displayed in the compressed (distal) regions. In the present study, in both rabbit groups,97aggrecan exhibited increased expression levels in the distal regions compared with most of the proximalregions. This increase can likely be attributed to its location in the Achilles tendon complex as both distalregions are in closely situated to the bone and partly compressed by it during loading.The findings presented are consistent with previous findings examining the calcaneal tendon of malerats257. The expression levels of collagen type I and MMP2 were increased in the proximal regioncompared to the distal region of the calcaneal tendon for male rats in their sedentary group 257. In thecurrent study, the expression levels of collagen type I and MMP2 were increased in the PLG compared tothe DG for female rabbits in the intact normal group. In addition to regional differences in mRNAexpression, the rat calcaneal tendon model has been used to investigate regional differences in totalMMP2 activity. In the rat calcaneal tendon, total MMP2 activity was not different comparing theproximal to distal region for male rats258, lower in the proximal compared to distal region for femalerats259 and higher in the proximal compared to distal region for ovariectomized female rats259. Theseactivity findings emphasize the importance of gender/hormonal effects on tendon regional differences.Collagen type III and V expression levels were lower in the PMG compared with most other regions inthe OVH rabbits. Similarly, the PMG displayed a decrease in decorin expression compared to the PLG,PFDS and DFDS in the OVH rabbits, which may have an influence on collagen allignment260. Remarkableis that of the three proximal tendon regions, the PMG is the only region exhibiting a lower expression ofcollagen type III, collagen type V and decorin compared to most other regions. This could be due to thelocation of the PMG tendon; it initiates between the PLG and PFDS and rotates to the side of the Achillestendon complex. Decorin is the most abundant PG in tensile regions of tendon40,261 and the PMG maynot be experiencing the same amount of tensile force as the PLG and PFDS.984.4.2 OVH effects on mRNA expressionThe effect of estrogen on PG levels in tendon, to our knowledge, has not been researched extensively.Among the genes investigated in this study, the aggrecan mRNA expression showed the biggestdifference between the two groups, even though regional variations were preserved. Aggrecan had atenfold lower expression in the tendons from OVH rabbits compared to the intact normal rabbits.Interestingly, all of the other PGs investigated, biglycan, decorin and versican, also had decreasedexpression in the tendons from OVH rabbits compared to those from intact normal rabbits.In a longitudinal study, Maffulli et al. commented that the rate of Achilles tendon rupture starts toincrease after menopause250. This likely suggests that systemic estrogen may play a protective role fortendon injuries. Comparing patellar tendons from postmenopausal women using hormone replacementtherapy (HRT) to those from non-users of HRT, collagen (proline) fractional synthesis rate was increasedbut collagen type I (pro-collagen type I N-terminal propeptide: PINP) synthesis was not262. This mayindicate differences in the synthesis rates of soluble and insoluble collagen or collagen type I andcollagen type III262,263. In our study, the collagen type I mRNA level in the Achilles tendon complex of theOVH rabbits were significantly reduced compared to intact normal tendon levels.IL-6 production is repressed by estrogen due to binding of activated estrogen to transcription factorsthat prevent binding to DNA as demonstrated in human osteoblasts and bone marrow stromal cells264.In human Achilles tendon peritendinous tissue, collagen type I (PINP) synthesis was increased withinfusion of IL-6265. Serum IL-6 concentrations were significantly lower in postmenopausal women usingHRT compared to non-users of HRT266. However, Maret et al. showed that estrogen had no effect on IL-6production in rat smooth muscle cells267. The role of IL-6 may be species and tissue/cell specific as thecurrent study found three times lower mRNA expression of IL-6 in the Achilles tendon complex fromOVH rabbits compared to intact normal rabbits.99This study focused on the mRNA expression differences in the different regions of the rabbit Achillestendon complex.  It remains to be seen whether such regional differences are observed when analyzingprotein levels or protein activity.  In the rat calcaneal tendon model, regional differences in total MMP2activity were observed258,259. In human patellar tendon collagen fascicles, regional (anterior versusposterior) differences in mechanical properties were observed268. A larger future study couldincorporate mRNA expression, protein activity, protein level and mechanical property assessments toincrease our understanding of these regional differences and their relationship to mechanical loadingenvironments.In agreement with the hypotheses, changes in mRNA expression between tendon regions and betweenrabbit groups were demonstrated even though small sample size was a limitation of this study. Thecompressed regions showed higher mRNA expression of PGs compared with the tensile regions.Expression of collagen type I, which plays a role in tensile load-bearing, was greater in the tensile PLGregion compared to the compressed DG region. These findings suggest that the mRNA expression differin the tendon regions, based on the type of load experienced in those regions. All PGs examined in thisstudy displayed a lower mRNA expression in the OVH group, despite preserving the regional differences,illustrating that estrogen likely plays a role in the expression of genes that are important for tendonhomeostasis.In summary, the different regions of the Achilles tendon complex in rabbits have different mRNAexpression related to the type of load that is exerted upon them. This should be taken into considerationwhenever the tendon is used in research as biopsies may differ depending on where in the tendoncomplex it is taken. One should be careful in applying the findings of these regional differences in therabbit to the human Achilles tendon as the basic anatomy differs, most notably the lack of a flexordigitorum superficialis tendon and the more pronounced supply of tendon fibres from the soleus100muscle, in the human Achilles tendon complex. In order to delineate regional differences in the humanAchilles tendon, further studies are required. A recent study where human Achilles tendons werebiopsied from a more proximal region within the same tendon for healthy tissue to be compared withtendinopathic tissue from a more distal region of the same tendon suggests that such regionaldifference studies could be of clinical interest263.1015. Repetitive motion of the rabbit Achilles tendon complex induces changesin MMP2 levelsChapter 4 described the molecular components of the different tendons that comprise the rabbitsAchilles tendon complex, which is of importance when using the Backman model for inducing anoveruse injury to the Achilles tendon complex.5.1 BackgroundThe Achilles tendon is one of the largest tendons in the body, bearing repetitive tensile loads of up to 12times body weight during physical activities such as jumping16. Although the Achilles tendon is adaptedto store and release energy during weight bearing activity, it is prone to overuse injury (tendinopathy).Achilles tendinopathy is characterized by localized tendon pain and thickening which limits the ability toengage in physical activity. The causes of Achilles tendinopathy may be multifactorial, with two majorrisk factors being repetitive loading, and advancing age269. The incidence of Achilles tendinopathy in thegeneral population is 2.35 per 10007 while the rate is higher in elite runners  with a reported annualincidence of 7-9%6. The rate of Achilles tendinopathy is also high among individuals who pursue exercisefor recreational or health benefits270.  Once Achilles tendinopathy has developed, it frequently takes along time to resolve, with a reported 80% rate of recovery after 1 year of conservative treatment271.Achilles tendinopathy shares many features with other activity-related tendinopathies such as tenniselbow or rotator cuff disease13.It has been suggested that it may be possible to prevent a tendon injury from becoming chronic if it canbe detected before it becomes symptomatic272. Long distance runners whose Achilles tendons containasymptomatic areas of damage identified by power Doppler ultrasound, have a high odds ratio [6.9] of102developing Achilles tendinopathy within the next year273. In addition to imaging, it would be useful tohave confirmatory laboratory tests related to the pathology. Matrix metalloproteinases (MMPs) andtissue inhibitors of matrix metalloproteinases (TIMPs) are key players in the maintenance and repair ofload-bearing tendon tissue19.  Tendon overuse and tendon trauma, have both been postulated to alterthe local activities of MMPs which may contribute to further tissue degeneration or failure to heal.MMP1 and MMP3 are upregulated at the protein level in acute human supraspinatus tendon tears145 aswell as in chronic human patellar tendinopathy143, which suggests that MMPs may play a role at bothearly and late points in the disease process. A pilot study has shown that serum MMP2 and MMP7 levelsmay be elevated, compared to controls, in individuals with a previous history of Achilles tendonrupture201. In patients undergoing surgery for Achilles tendinopathy, MMP activities predominantlyMMP2 /3 /9/ 13 were elevated in the Achilles tendon, and MMP2/ 9 mRNA also tended to be higher137.Some of these observed differences in the levels of MMP protein and/or protein activity in the region oftendon damage may be regulated locally at the mRNA expression level. In human rotator cuff tears,MMP3 mRNA is down regulated, while MMP13 mRNA is upregulated150. TIMP1, a protein which inhibitsthe activity of MMP1, is down regulated at the mRNA level in patellar tendinopathy274.  MMP2 andTIMP1 mRNA and protein levels are increased in the torn rabbit supraspinatus tendon148. Ireland et al.demonstrated that in chronic human Achilles tendinopathy MMP3 and TIMP3 mRNA were down-regulated, while MMP14 was increased155. MMP2 and MMP3 mRNA were also reported to beupregulated in human Achilles tendinopathy140. Thus, the MMP family, particularly MMP2, has beenconsistently implicated in tendon pathology, though studies have often focused on the mRNAexpression, rather than protein level or protein activity.Although studies using human biopsy material, described above, have certainly implicated MMPs in thepathophysiology of chronic Achilles tendon injury, it remains unknown whether MMPs are (a) present inthe earliest stages of the tendon’s response to overuse, and/or (b) detectable in the general circulation103at the protein level, as a potential indicator of tendon degradative activity during a period of intensetendon loading. With regard to mechanical loading as a potential regulatory factor, it is known thatperitendinous MMP 9 protein levels are upregulated after exercise in humans140,156. Protein activity ofMMP2 was increased in a rat Achilles tendon training model94.  An in-vitro study that exposed rabbittendon cells to shear stress resulted in upregulated mRNA MMP1 levels222. Previous research hasdemonstrated that MMP2/ 14 and TIMP2 are implicated in the response of human tendon cells torepetitive tensile loading, with both high strain and high frequency contributing to elevations in MMP2mRNA162.  MMP14 is a membrane type MMP (MT-MMP1) which cleaves latent (pro-) MMP2 into activeMMP2 under the influence of TIMP2, resulting in further collagen deterioration194.In the current study, our main question was whether MMP2 mRNA, protein, and activity are increased inresponse to acute Achilles tendon overuse. One hind limb of the rabbit was mechanically and electricallystimulated. The resulting damage of the exercised tendon was quantified using second harmonicgeneration microscopy and compared with the contralateral tendon.  RNA was extracted from Achillestendon tissue to examine mRNA expression (MMP2/ 14 and TIMP2), while samples of peritendinousAchilles tendon fluid were used to examine the protein activity of MMP2.   We hypothesized that thesemeasurements would be increased in the stimulated limb compared with the contralateral limb aftertwo weeks of exercise. We also hypothesized that the serum MMP2 levels of animals subjected toAchilles tendon overuse would be higher than that of control animals (no exercise).5.2 Materials and methods5.2.1 AnimalsExperiments were conducted with the approval of the animal care committee of the University of BritishColumbia. Twelve male New Zealand White rabbits with an age of 6-10 months and a weight between 2-2.5kg, were used. Two groups of six animals each were randomly assigned to either 1) repetitive motion104group or 2) the control group. The rabbits were single housed in cages with hay and enrichmentsincluding, chewing blocks and plastic tubing. A 12:12 hour light dark cycle was followed.5.2.2 Experimental designA repetitive motion machine, previously designed and employed for rabbit single hind limb overuse byBackman and collaborators, was used175. Positioning the rabbits supine, the machine achieves passivedorsiflexion and plantar flexion of the exercised joint. One leg was attached to the pneumatic pistonthat moved 9.5cm inducing a 20-25⁰ dorsiflexion and 35-40⁰ plantar flexion. The exercised legunderwent 130 repetitions/min. The contralateral leg was unstimulated. To relieve the pressure on theback and prevent excessive movements a band was tied around the pelvis.Surface electrodes (Self-adhesive rectangular ProActivetm, AMG Medical, Montreal, Canada) werepositioned on the triceps surea of the exercised leg to provide muscle contraction synchronized with theplantar flexion movement by a microswitch (type 14E; Disa Elektronik A/S Herlev, Denmark) in thepiston. Muscle contraction occurred with an impulse of 0.2ms duration, 85ms after the initiation of theplantar flexion. The electrical stimulation parameters were selected to mimic the Achilles tendon loadduring running. The pulse had an amplitude of 35-50V.The session of repetitive motion lasted 2h, 3x per week for a total of 2 weeks. Anesthesia was inducedby an intramuscular injection of Xelazine hydrochloride (2.5-5mg/kg, Bayer Inc. Mississauga ON, Canada)and ketamine hydrochloride (20-22mg/ml, Bioniche Animal Health, Belleville, ON, Canada), total volume0.6-0.9ml using a 25 Gauge needle in the quadriceps muscle. This was followed by mask inhalation ofisoflurane (2-3%, Baxter Corp, Deerfield, IL, USA), in order to facilitate intubation. Rabbits wereintubated and mechanically ventilated. The control rabbits underwent mask inhalation of isofluraneanesthesia for a 2h period, 3x per week for a total of 2 weeks, while lying supine. Before each session,60ml of supplemental fluid (Saline, Baxter Corp, Deerfield, IL, USA) were delivered subcutaneously.105Buprenorphine (0.02-0.05mg/kg, Bioniche Animal Health, Belleville, ON, Canada) was administered onan as needed basis. To maintain body temperature, the rabbits were laid on a heating pad and coveredwith towels. Heart rate and oxygen saturation were continuously monitored. The rabbits in both groupswere sacrificed using intravenous Euthanyl (110mg/kg, Bimeda-MTC Animal Health Inc., Cambridge, ON,Canada) after 2 weeks.5.2.3 Blood samplesBlood samples were taken before, and after 1 or 2 weeks of repetitive motion, in single serum tubescoated with a silicone layer (5ml) (Vacutainer system, Becton Dickinson, NJ, USA). After clotting 30 minat room temperature, the serum samples were centrifuged at 4500 rpm for 10 min. Sera were extractedfrom the samples and stored in -80⁰C until further processing.5.2.4 Achilles tendon dissection and definition of regionsThe Achilles tendon undergoing repetitive motion is hereafter called ‘exercised Achilles tendon’. Thecontralateral Achilles tendon is the Achilles tendon of the leg not undergoing repetitive motion. Thecontrol Achilles tendon comes from the rabbits that were not subjected to repetitive motion at eitherAchilles tendon. Four regions of the Achilles tendon complex were defined: lateral gastrocnemius (LG);medial gastrocnemius (MG); flexor digitorum superficialis (FDS) and the paratenon (Figure 5.1). TheAchilles tendon complex of the hind limb was dissected from the calcaneal insertion. Tendon tissue ofeach region  (LG, MG and FDS) were taken at 3 cm proximal of the calcaneus, this is the location thatwas anticipated to be most affected by the repetitive motion as discussed by Backman et al.175. Theparatenon was collected separately followed by splitting the Achilles tendon complex in the LG, MG andFDS as described in Chapter 4, Section 4.2.1.The tissue sample collected in this study were taken fromthe proximal areas respectively and thus differ from the study outlined in Chapter 4, Section 4.2.1 where106samples were taken from the distal area also. The samples for mRNA expression and protein levelanalysis were snap frozen using liquid nitrogen and stored at -80°C until further analysis. The samplesfor histological analysis were fixed in 10% formalin in phosphate-buffered saline.Figure 5.1 Posterior view of the rabbit calf-muscles and tendons.The four regions of the Achilles tendon complex; FDS: flexor digitorum superficialis; LG: proximal lateralgastrocnemius; MG: proximal medial gastrocnemius; P: paratenon. Original art by Gustav Andersson.Huisman 201429, reproduced and adapted with permission.1075.2.5 RNA extraction and qPCRFrozen tendon tissue was pulverized using a Sartorius Mikro-Dismembrator (Sartorius, Germany). TRIzol,1ml, was added and the samples were shaken for 1min to stimulate solubilization. Chloroform, 0.2mlwas added, followed by vortexing and centrifuging to separate the aqueous and organic phases.  Theaqueous phase was then used to obtain ribonucleic acid (RNA). The RNA was extracted and purified asdescribed in Chapter 2 and Section 2.2.3. The primers used were designed for the target human genes(Table 5.1). Values for genes were normalized to corresponding glyceraldehyde 3-phosphatedehydrogenase (GAPDH) values.Table 5.1 qPCR primers.5.2.6 Protein extractionFrozen tendon tissue was pulverized using a Sartorius Mikro-Dismembrator (Sartorius, Germany) afterwhich the powder was solubilized with tissue protein extraction reagent 1:20 (T-PER, Thermo FisherScientific Inc., IL, USA) for 30min on ice with 30 sec of vortexing every 10min. The samples were thensonicated on ice, 4 times 5 sec after which they were centrifuged at 10,000g for 20min at 4°C. Thesupernatant were collected and frozen at -80°C until further processing.Target Forward Primer Reverse PrimerGAPDH TGACGACATCAAGAAGGTGGTG GAAGGTGGAGGAGTGGGTGTCMMP2 GCGGTTTTCTCGAATCCACG TATCCGTCTCCATGCTCCCAMMP14 CAGTATGGCTACCTGCCTCCAG CATGGCCTTCATGGTGTCTGTATCTIMP2 CACGCAGAAGAAGAGCCTGA AGAGGAGATGTAGCACGGGA1085.2.7 ZymographySerum, microdialysis and protein samples were analyzed for MMP2 activity. At a concentration of6.2mg/ml each sample was loaded in 9% SDS-PAGE gel with 0.2% gelatin, in the presence of reducingagents (0.4mol/L Tris, pH6.8, 5% SDS, 20% glycerol, 0.03% bromophenol blue). One lane of every gel wasloaded with 10μl trypsin, to serve as a control (0.025% trypsin, 0.01% EDTA, pH 7.4, 1x TrypLETM Select,Gibco, Life Technologies, Burlington, ON, Canada). The remainder of the protocol is described inChapter 2, Section 2.2.5.5.2.8 Second harmonic generation (SHG) microscopyHematoxylin and eosin (H&E) staining was performed on formalin fixed 5μm sections of tissues in thefour regions of the Achilles tendon complex from intact normal and exercised rabbits. The tendon tissuewas not pre tensioned before formalin fixing. 1 slide, containing 2 sections, per animal, per region wasused. From each H&E stained section, two SHG images were taken. The SHG imaging method andexperimental set-up has been described in detail previously242. The images were analyzed using Image J(Fiji plugin) to determine the average intensity of SHG signal (in arbitrary units / AU), which isproportional to the density of fibrillar collagen. This measurement was taken at 5 predefined locationson each SHG image.  The locations were predefined as the 2 healthiest and 3 most damaged-appearingareas observed.5.2.9 StatisticsSPSS (SPSS Inc. version 19.0, Chicago, IL, USA) was used for analysis. Statistically significant differences inthe mRNA expression, protein activity of the tissue and histological findings were analyzed using thelinear mixed models (LMM) method. To test the hypothesis that Achilles tendon tissue MMP2 activity ishigher in the exercised rabbits compared to the controls, a paired one-tailed t-test was conducted. The109normalized mRNA expression (MMP2, MMP14 and TIMP2), the MMP2 activity and the collagen density(SHG signal) of each Achilles tendon region were compared side to side (exercised and the contralateralleg). The MMP2 activity in the serum and microdialysis fluid of the exercised animals and the controlgroup were compared. A log transformation –to obtain a normal distribution- of all the data occurredbefore they were analyzed. The mRNA data in the text is reported as the mean difference between thecompared conditions and locations with a 95% confidence interval of the difference (CI) of the logtransformed values. Figures 5.2, 5.3, 5.4 and 5.5 show values that were normalized to non-exercisedcontrols, and the standard error of the data is displayed by the bars on the graphs. A p value of ≤ 0.05was considered statistically significant for all statistical tests.5.3 Results5.3.1 HistologyTwo weeks of intensive repetitive motion on one leg (referred to as ‘exercised Achilles tendon’ fromhere on) led to a deterioration in the structure of the rabbit Achilles tendon, as indicated by a reducedcollagen density (SHG intensity) of the exercised Achilles tendon compared to the contralateral Achillestendon; this deterioration appeared to be confined to the FDS and MG regions of the exercised Achillestendon complex (p<0.01, Figure 5.2).110Figure 5.2 The collagen density (AU), by SHG microscopy, of the contralateral and exercised Achilles tendoncomplex, by individual region.LMM was used for analysis. A Ɨ represents a p<0.01. The data is represented in mean(SE) that includesthe data of 6 rabbits.5.3.2 mRNA expressionA higher expression of MMP2 and TIMP2 mRNA was detected in the exercised Achilles tendon whencompared to the contralateral Achilles tendon; these elevated levels were observed in the MG region(Figure 5.3).  Differences in mRNA expression of MMP2 and MMP14 among the different regions of theAchilles tendon complex were observed in the exercised Achilles tendon (Figure 5.4). The mRNAexpression of MMP14 and MMP2 were higher in the paratenon compared to the MG and the FDSregions in the exercised Achilles tendon (Figure 5.4).  The LG region in the exercised Achilles tendondemonstrated lower levels of MMP2 and MMP14 compared to the FDS region (p<0.05, Figure 5.4) and111the paratenon (p<0.01, Figure 5.4). The contralateral Achilles tendons also demonstrated significantregional variations, with the MMP2 mRNA expression being highest in the paratenon (Figure 5.4).Figure 5.3 The mRNA expression of MMP14, MMP2 and TIMP2 of the contralateral and exercised Achillestendon complex displayed by region, analyzed by qPCR.LMM was used for statistical analysis. Values are RQ±SE. * represents p<0.05, Ɨ indicates p<0.01.  Thechanges indicated are both statistically significant and >0.5 RQ in magnitude difference.112Figure 5.4 The mRNA expression of MMP14, MMP2 and TIMP2 of the four examined regions of the Achillestendon complex displayed by experimental condition, analyzed by qPCR.LMM was used for statistical analysis. Values are RQ±SE. * represents p<0.05, Ɨ indicates p<0.01.  Thechanges indicated are both statistically significant and >0.5 RQ in magnitude difference.5.3.3 MMP2 activityMMP2 activity was examined in the serum samples of rabbits in the control and repetitive motiongroups before repetitive motion, and after 1 and 2 weeks of exercise. After 1 week of repetitive motion,the MMP2 activity in the serum was significantly increased, with the repetitive motion group havinghigher MMP2 activity levels than control animals (p<0.05, Table 5.2, Figure 5.5). This differenceappeared to be short-lived, as the MMP2 activity after 2 weeks had returned to baseline.MMP2 activity was also examined in the exercised Achilles tendon after 2 weeks of repetitive motion,and compared to the contralateral tendon. The MMP2 activity was found to be increased in theExercisedContralateralConditionTendonFDSLGMGP113exercised Achilles tendon, compared to the contralateral Achilles tendon, however this increase inMMP2 activity was apparently confined to the FDS tendon (p<0.05, Figure 5.6, Figure 5.7).Table 5.2 The serum MMP2 activity of the exercised and control rabbits analyzed by zymography.A paired one tailed t-test was used for statistical analysis. The activity is given in mean AU with (SE). An *indicates a p<0.05.Exercised ControlBaseline 0.31(0.05) 0.28(0.05)Week 1 0.37(0.08)* 0.19(0.01)Week 2 0.26(0.06) 0.21(0.02)Figure 5.5 Serum zymography of two rabbits (control and experiment) before (pre), after one week (W1) andafter two weeks (W2).MMP2 62 kDa114Figure 5.6 The MMP2 protein activity (AU) of the exercised Achilles tendon tissue measured by zymography.LMM used for analysis. An * indicates a p<0.05. The data is represented in mean(SE) that includes dataof 6 rabbits.Figure 5.7 Zymography of the FDS, LG, MG and P from the contralateral (left) and exercised leg (right).The samples belonging to each tendon (FDS, LG, MG, P) were run on separate zymography gels.*LG PMGExercisedContralateralFDSExercisedContralateralExercisedContralateralExercisedContralateralMMP2          62kDa1155.4 DiscussionIn the rabbit Achilles tendon repetitive motion model, tendon structure was deteriorated in themechanically loaded FDS and MG regions, compared to the contralateral side. The FDS regiondemonstrated higher MMP2 and MMP14 mRNA expression of the exercised Achilles tendon. HigherMMP2 mRNA expression and MMP2 protein levels were also observed in the exercised Achilles tendoncompared to the contralateral Achilles tendon. This study suggests that 2 weeks of repetitive motionusing the Backman model induces initial regionally located structural changes, associated with increasedlocal MMP2 protein activity.5.4.1 Regional patterns of MMP expression, activity, and injuryThe MMP2 mRNA expression and activity were upregulated in the exercised rabbit AT compared to thecontralateral Achilles tendon (Figure 5.2) however there was significant regional variation in the locationof these changes (Figure 5.6).  The mid portion of the Achilles tendon, the primary location of injuryexamined by previous users of the Backman model175, was investigated for all tendons (FDS, LG, MG)and the paratenon. There was a visible trend in the mRNA expression towards higher expression of allgenes studied in the paratenon for both the contralateral and exercised Achilles tendon (Figure 5.4),which may be due to the more cellular nature of paratenon compared to the other tendons179.  ThemRNA expression variations between the four regions of the AT complex observed in the current studymay also reflect the different types of mechanical load each of these tendons experience. The MMP2protein activity remained was unchanged within the MG tendon in the exercised and contralateralAchilles tendon, while the MMP2 activity was upregulated in the exercised FDS tendon. The mRNA datadisplay a higher MMP2 and TIMP2 mRNA expression in the MG tendon only. The SHG datademonstrated that both the FDS and MG tendons exhibited a lower density in the exercised groups(Figure 5.2). The SHG finding is in partial agreement to the location of greatest MMP2 mRNA expressionupregulation; the MG tendon. It may be possible that the MMP2 mRNA expression and protein activity116of the FDS and MG tendon were altered at different time points in the mechanical loading process,possibly due to a different amount of loads experienced. It is likely that changes in both the mRNAexpression and protein activity occurred as the SHG data demonstrated a reduced density in both theFDS and MG tendon.5.4.2 Effect of exercise on the Achilles tendon complexThe exercised Achilles tendon complex exhibited a higher MMP2 mRNA expression compared to thecontralateral Achilles tendon; this increase was confined to the MG tendon (Figure 5.3). This observationis in line with a rat patellar tendon model that found elevated MMP2 levels 1 day post stretching,although the stretching regime in that study was of a more severe nature135. In the current study, areasof localized damage to collagen fibrils were observed in the tendons after two weeks of repetitivemotion (Figure 5.8b, c). The contralateral Achilles tendon (Figure 5.8b) demonstrated structural changeshowever to a lesser extent than the exercised Achilles tendon (Figure 5.8c). To obtain active musclecontraction, the rabbits undergo electro pulses besides the repetitive motion. These pulses may havecaused a nerve response, leading to structural changes in the contralateral Achilles tendon176. Anotherpossibility may be the passive movement the rabbit undergoes while being exercised in one leg. In clinic,it has been seen that patients undergo treatment for unilateral Achilles tendinopathy and developsymptoms on the contralateral side275,276. Andersson et al. reported more pronounced changes,compared to the changes observed in this study, however at the 6 week time point176. Serum MMP2activity levels were elevated after one week of exercise conversely not after 2 weeks. The timing of thiseffect suggests that there may be an early, but short-lived, inflammatory response in the tendon.However, this was not examined in the current study. In an equine study, Dakin et al. demonstratedhigher inflammatory substances in the tendon before 6 weeks post injury277.117In this study we investigated whether MMP2 protein activity could be detected in the general circulationafter two weeks of intensive repetitive motion. MMPs and their activity have been demonstrated intendon tissue or cultured tendon cells, most commonly at the mRNA and protein level136,139,140,148,149. Anearlier study detected increased MMP2/ 7 in blood samples of people with a previously (3 years prior)ruptured Achilles tendon compared to healthy controls201. Conversely, the current study demonstratedthat MMP2 activity was significantly higher after 1 week of exercise in the exercised rabbit compared tothe controls, however this increase was not present after 2 weeks of repetitive motion. Although therepetitive motion in this model is relatively intense, it does not duplicate the extent or severity of someclinical Achilles lesions, especially partial or complete ruptures. Nevertheless, the fact that MMP2activity is detectable in the circulation, in response to repetitive motion of the Achilles tendon, doesprovide rationale for further examination of this variable in a clinical research setting.The collagen density was reduced in the exercised FDS and MG tendon of the Achilles tendon complexindicating structural damage, however the MMP2 mRNA increased in the MG tendon while thesignificant changes observed on the protein level was confined to the FDS tendon. Loads experiencedand timing of up and down regulation of mRNA and protein may explain these differences. The FDStendon is situated over top of the other tendons and the calcaneus and may for that reason experiencemore and/or heavier loads compared to the LG and MG tendons and thus increase the mRNA expressionand protein levels earlier in the overuse process.  Systemic (serum) findings may not reflect changes ofthe tendon only; changes to the muscle fiber bundles or other musculoskeletal tissues that are affectedby the stimulation (e.g. cartilage, ligament) could also influence the serum levels. Despite theselimitations, this study suggests that future research could examine the location of MMP2 in the Achillestendon complex with immunohistochemistry.Two weeks of repetitive motion of the Achilles tendon led to histological changes corresponding totendon damage, and this damage was accompanied by increased MMP2 mRNA, protein, and serum118activity. Future research could include collagen degradative markers as well as examine a wider varietyof genes and proteins in various musculoskeletal tissues to better interpret the origin and degree ofdamage.Figure 5.8 SHG microscopy images of the rabbit Achilles tendon complex, 20x objective. The scale bar represents100 μm.With A) the control FDS tendon, B) the contralateral FDS tendon and C) the exercised FDS tendon.1196. Serum MMP, TIMP and lipid levels in patients with Achilles tendonruptureIn the previous Chapters it was demonstrated that MMP2 mRNA expression and protein level or activitywere increased with overuse by mechanical stretching and repetitive motion in in-vitro and in-vivosettings at early time points and was also measurable in blood samples. In this Chapter we investigatedblood samples of Achilles tendon rupture patients on MMP, TIMP and lipid levels.6.1 BackgroundMost people who sustain a spontaneous unilateral Achilles tendon rupture (ATR) - an injury that has anincidence of 2.35 in 1000 in the general population7, have not had any prior symptoms278. Howeverhistology and ultrasound of ruptured tendons have shown degenerative changes including irregular anddegenerated collagen279. It has been observed in several studies that ATR mostly occurs during physicalactivity, is more prevalent in men and occurs most often within the age range of 30-49 years250,280–283.The exact cause of ATR is unknown however given the histological findings, the tendons were most likelypredisposed to degenerating conditions69. Predisposing factors to chronic tendon problems include twotypes of causes 1) intrinsic factors such as male gender, advancing age, being overweight, andanatomical issues such as alignment or biomechanical faults e.g. hyper-pronation of feet and, 2)extrinsic factors including use of certain medications, prolonged training or increase in training load,excessive loads, or a combination of the latter250,284. Chronic degenerative changes are likely to precedethe rupture, and elevated lipid levels in the blood may contribute to this degeneration69,88,186,285.In ATR, lipid depositions are regularly found during histological examination as well as macroscopicallyobserved at surgery69,185. Low lipoprotein cholesterol (LDL-C) from the circulation have been implicated120in the formation of tendon xanthomas (lipid depositions), resulting in a weakened tendon and making itmore susceptible to rupture85,286. Hypercholesterolemia - total cholesterol (TC) levels in blood>6.2mmol/L- is a risk factor for coronary disease, and has also been associated with ATR84,287.Hypercholesterolemia is thought to result in impaired healing of the tendon by reduced synthesis ofnon-collagenous components of the ECM286. Abboud et al. found an association between RC rupture andhypercholesterolemia288. In addition, oxidized LDL has been shown to accumulate in tendon tissue,prompting the tenocytes to adopt a matrix degrading phenotype, including increased expression ofMMP288. Premature coronary disease results in elevated levels of MMP9 and TIMP1 while MMP2/ 3,TIMP2 were significantly lower compared to controls289. Dyslipidemia – LDL-C  >4.1mmol/L and highlipoprotein cholesterol (HDL-C) <1.0mml/L - was also found in patients with torn rotator cuff tendons288.In patients with combined dyslipidemia (high TC and triglyceride levels, low HDL-C levels) elevatedserum levels of MMP2/ 9, TIMP1/ 2 were observed compared to controls290. Taken together, a relationbetween tendon rupture and an abnormal lipid profile has been observed, and elevated lipidconcentrations in the circulation may influence MMP and TIMP levels.The ECM of tendons are degraded and remodeled by MMPs 145. Located within the ECM are the tendoncells that are mainly responsible for the local synthesis and regulation of TIMPs. A healthy tendon hasbalanced levels of MMPs and TIMPs, with very little ongoing turnover of collagen55,136,141. Biopsies oftendinopatic Achilles tendon tissues have demonstrated that MMP2 mRNA expression140 and MMP2/ 3/9/ 13 protein activity levels137 that were higher compared to clinically normal tissue of the same tendon.Ruptured human supraspinatus tendon tissue demonstrated lower MMP2 protein levels, while higherMMP1 mRNA expression were observed compared to control145.  Biopsies of the ruptured humanAchilles tendon displayed an elevated presence of MMP2 and TIMP1/ 2 mRNA as well as active MMP2/9 protein compared to control136. MMPs and TIMPs have been detected in varying presence in healthy,tendinopathic and ruptured tendon tissue as well as in cell models that mimicked overuse136,144,145,147,209.121The evidence for circulatory MMPs and TIMPs in relation to tendon overuse and rupture has beenminimally studied. Studies that analyzed peritendinous fluid of the Achilles tendon observed elevatedMMP9 levels after exercise of individuals156,291. This suggests that the elevated MMP and TIMP levels arenot confined to the tissue but can also be found in local fluid. A study using the Backman model, foundelevated levels of MMP2 in the serum after 1 week of repetitive movements (Chapter 5, Huisman,unpublished). Pasternak et al. demonstrated that in patients with a previous Achilles tendon rupture theserum MMP2 protein levels were increased201, however this was a pilot study with only 8 patientsenrolled.In this study we investigated the serum levels of MMPs (1/ 2/ 3/ 7/ 8/ 9/ 10/ 12/ 13), TIMPs (1/ 2/ 3/ 4)and lipid levels in the circulation after Achilles tendon rupture in comparison with healthy controls. Therelation between serum lipid levels and Achilles tendon rupture, serum MMP levels and Achilles tendonrupture and the relation between the lipid and MMP levels were explored. It was hypothesized that theATR participants would have elevated MMP2/ 14 and TIMP 1 and MMP3 lower than the controls.6.2 Methods6.2.1 ParticipantsEthical approval was obtained from the University of British Colombia clinical research ethics board. Allparticipants received oral and written information about the purpose of the study and providedinformed consent. Thirty-three people (27M, 6F, age 27-59, Table 6.1) with a unilateral Achilles tendonrupture were recruited at the orthopeadic pre-operative unit at Vancouver General Hospital (VGH),Vancouver, Canada from July 2011-August 2014. Control participants (27M/7F, age 24-59, Table 6.1)were recruited June-October 2014. Exclusion criteria were inability to provide a blood sample, unable tocomplete International Physical Activity questionnaire, oral glucocorticoids or fluroquinolones within thelast 6 months ( diabetes type I or II, chronic inflammatory disorders (e.g. rheumatoid arthritis),122connective tissue diseases (e.g. Ehlers-Danlos syndrome, Marfan’s syndrome), and nerve or vascularproblems affecting the injured limb. All but 1 female ATR patients received surgery (open repair). Noneof the patients had previously experienced an ipsilateral tendon rupture. One patient had previouslyruptured the contralateral Achilles tendon more than one year ago.6.2.2 Blood samplesTwo fasting blood samples were taken from the control participants and the ATR patients at their firstpost-surgical follow-up visit which was between two to six weeks after surgery. For the majority ofpatients the surgery took place within 2 days after the ATR occurred. Blood samples were taken in oneserum tube that had a silicone-coated interior (5ml) and one plasma tube that had a heparin coating(5ml Vacutainer system, Becton Dickinson, NJ, USA). The blood sample in the plasma tube was analyzedfor total cholesterol (TC), high lipoprotein cholesterol (HDL-C), low lipoprotein cholesterol (LDL-C),triglycerides, nonHDL-C and the TC/HDL-C ratio in the laboratory of Vancouver General Hospital. Afterclotting, the serum samples were centrifuged at 4500 rpm for 10 min. Sera was extracted from samplesand stored in -80⁰C until further processing.6.2.3 MMPs and TIMPs presenceThe MMP and TIMP levels in the serum samples were analyzed using the Bio-Plex sandwich Pro HumanMMP and TIMP immunoassays (Bio Rad Laboratories Ltd, ON, Canada) according to manufacturer’sinstructions. MMP1/ 2/ 3/ 7/ 8/ 9/ 10/ 12/ 13 and TIMP1/ 2/ 3/ 4 were assessed. Fluorescently dyedmagnetic microspheres were labelled with a capture antibody specific to one of the MMPs or TIMPs.The antibodies capture the specific target from the serum in a 1:10 dilution for the MMPs and in a 1:50dilution for the TIMPs.  Unbound proteins were washed away and a biotinylated detection antibody was123added. The streptavidin-phycoerythrin reporter was added as the final detection complex. The plate wasread using a Bio-Plex 100 reader (Luminex Corp., Austin, TX, USA). Each sample was tested in duplicate.6.2.4 IPAQ questionnaire and antemorphometricsThe International Physical Activity Questionnaire (IPAQ) long version was used to determineparticipants’ physical activity levels. All ATR participants were asked to fill in the questionnaire based ontheir activity a week prior to the Achilles tendon rupture. The control participants filled in thequestionnaire based on their activity levels a week prior to their blood withdrawal. The IPAQ includesactivity levels within four domains; transportation, leisure, work and housework. Vigorous physicalactivity levels are calculated within each domain and converted to MET minutes, a caloric measure, toestimate the total activity levels across domains. Cleaning of the data and processing was carried out inaccordance to the IPAQ scoring protocol292. The weekly total physical activity MET minutes was chosento determine activity of the groups.The weight and height of each participant was given. The body mass index (BMI) was calculated asfollows: (height (m))2/weight(kg).6.2.5 Statistical analysisSPSS® (Statistical Package for Social Sciences; Chicago, IL) was used for statistical analysis. A MannWhitney U test with was performed to compare the blood lipid, MMP, TIMP, height, weight, the bodymass index (BMI) and activity levels between the control and ATR groups. An outlier was defined as avalue larger than 1.5 the interquartile range above or below the median value293, and removed from theanalysis when detected. Analysis of the MMP and TIMP activity was performed on log transformedconcentrations.124For each dependent variable, blood lipid levels: TC, LDL-C, HDL-C, triglycerides, nonHDL-C and the ratioTC:HDL-C , MMP1/ 2/ 3/ 7/ 8/ 9/ 10/ 12/ 13 and TIMP1/ 2/ 3/ 4 a multiple regression model was fit todetermine if age, gender, BMI, ATR or total physical activity were significantly related to theresponse. For each lipid level a multiple regression model was fit to determine if MMP1/ 2/ 3/ 7/ 8/ 9/10/ 12/ 13 and TIMP1/ 2/ 3/ 4 were significantly related to the response. Analysis for collinearity of thedependent variables was run and the variable was excluded when found collinear294. The coefficient ofdetermination (R2) and the adjusted R2 were given for the linear regression analyses. A significance levelof p<0.05 was used for all statistical tests.6.3 ResultsThe circulating MMP, TIMP and lipid levels of the ATR group demonstrated significant differences fromthe controls, while the physical activity and anthropometric measures were comparable between thegroups.6.3.1 ParticipantsData was collected from 66 participants; 33 ATR and 33 controls (Table 6.1). ATR occurred in 27 men(81%), and in 6 women (19%, Table 6.1). No statistically significant difference was observed in BMI orweight between the groups. The participants in the control group were taller 174(170.0-178cm)compared to the ATR patients 181(177-183cm, p<0.01,Table 6.1). Most participants were engaged inphysical activity when rupturing their Achilles tendon (30 of 33 cases, 94%). A fall resulted in ATR for twopatients, while for 1 patient the reason of ATR is unknown.125Table 6.1 Participant antemorphometrics.Significance levels are indicated by ƚ indicating a p<0.01.6.3.2 Serum lipid levelsThe LDL-C and TC:HDL-C ratio values of respectively 13(39) and  9(27%) of the ATR patients exceededthe recommended values, while respectively 9(27%) and 8(24%) of the controls had higher thanrecommended concentrations (Table 6.2). The TC levels of the ATR group were higher 5.03(3.64-6.24mmol/L) than the control group (4.56(2.99-5.95mmol/L), p<0.05, Figure 6.1), however there wassubstantial overlap in the range of values for both groups. The ATR patients had higher levels oftriglycerides 1.08(0.38-2.20 mmol/L) compared with the healthy controls (0.72(0.38-1.62 mmol/L),p<0.05, Figure 6.1, Table 6.2). The ratio TC:HDL-C ratio was elevated in the ATR group 4.03(2.47-5.91mmol/L) compared to the control group (2.92(1.83-4.78 mmol/L), p<0.01, Figure 6.1). A lower HDL-Clevel was found in the ATR group 1.27(0.94-1.85 mmol/L) compared with the control group (1.53(1.08-Variable - mean(range) ATR ControlsAge (years) 41.1(27-59) 40.0(24-59)Number of Males/Females 27/6 27/6Height (cm) 174(155-193) 180(165-189)ƚWeight (kg) 76.1(51-93) 79.1(52-107)BMI 24.9(23.7-26.2) 24.2(23.1-25.3)Total weekly Physical activity (MET minutes) 5634(2864-11064) 5129(3699-7896)1262.37 mmol/L), p<0.01, Figure 6.1, Table 6.2). The LDL-C and NonHDL-C levels did not differ significantlybetween the groups, however a visible trend that the ATR group had higher levels was observed (p<0.1).Table 6.2 Serum lipid values for subjects with ATR and controls.Significant higher levels are indicated by ƚ p<0.01, *p<0.05.Lipids (normal range/value)ATR ControlsMedian RangeNumberparticipantsabnormal values(%) Median RangeNumberparticipantsabnormalvalues (%)TC (3.8-5.2 mmol/L) 5.03* 3.64-6.24 13 (39%) 4.56 2.99-5.958 (24%)HDL-C (0.90-1.6 mmol/L)1.27 0.94-1.852 (3%)1.53 ƚ 1.08-2.371 (3%)LDL-C (2.0-3.0 mmol/L)3.31 2.01-4.1513 (39%)2.67 1.44-4.139 (27%)Triglycerides (<1.7 mmol/L)1.08* 0.38-2.206 (18%)0.72 0.38-1.621 (3%)TC:HDL-C (<3.4 mmol/L)4.03ƚ 2.47-5.919 (27%)2.92 1.83-4.788 (24%)non HDL-C (<4.0 mmol/L)3.79 2.35-4.765 (15%)3.06 1.62-4.481 (3%)127Figure 6.1 Serum lipid profiles of ATR and controls.The TC, triglyceride and TC:HDL-C levels are higher in the ATR group compared to the controls, while theHDL-C level is significantly lower. The median value for each group is indicated by the line. Significancelevels are indicated by ƚ p<0.01, *p<0.05.1286.3.3 Serum MMP and TIMP levelsContrary to our hypothesis, the ATR patients had a significantly lower serum MMP2 level, 54,184(38,229- 70,139pg/mL, p<0.01, Figure 6.2), compared to the controls, 123,750(77,014 - 170,484pg/mL). Therewas minimal overlap in MMP2 values for both groups. The serum MMP3 concentration was also lower inthe ATR group, 49,464(41,617 - 57,311pg/mL, p<0.01, Figure 6.2) compared to the controls,126,536(88,872 - 164,200pg/mL). The ATR patients also had a lower MMP13 level of 117(105 -128pg/mL, p<0.01, Figure 6.2) than the controls, 166(144 - 187pg/mL).  TIMP3 levels of the ATR groupwere lower, 8,647(6,125 - 11,169pg/mL, p<0.05, Figure 6.2) compared to the controls, 11,500(9,689 -13,310pg/mL).Figure 6.2 The serum A) MMP and B) TIMP concentrations of the ATR and control groups.Significance levels are indicated by ƚ p<0.01, *p<0.05.A B1296.3.4 Self-reported physical activityThe self-administered IPAQ questionnaire was used to report the activity levels of the 7 days prior torupture (ATR group) or the 7 days before the blood sample was taken (control group). There were nodifferences found in the total weekly physical activity (Table 6.1).6.3.5 Relation between serum lipid levels and anthropometric measuresLinear regression was used to examine the potential relations between each of the serum lipid valuesand gender, age, BMI, rupture and physical activity. A number of relations were of statisticalsignificance, but small magnitude, were observed. There was a relation between ATR and the HDL-Clevel (R2=0.25, p<0.01, Table 6.3) and ATR and the ratio TC:HDL-C (R2=0.30, p<0.05, Table 6.3). A relationwas also found between age and TC (R2=0.28, p<0.01, Table 6.3), age and LDL-C (R2=0.26, p<0.01, Table6.3), and age and nonHDL-C (R2=0.26, p<0.01, Table 6.3). BMI and LDL-C (R2=0.26, p<0.05, Table 6.3), aswell as BMI and nonHDL-C (R2=0.26, p<0.05, Table 6.3) were found to have a relation. No relation wasfound between any of the lipid levels and gender or physical activity. Triglyceride levels were also notfound to have a relation with any of the independent variables. No collinearity was observed.None of the MMPs and TIMPs were found to relate to any of the lipid levels.130Table 6.3 The relation between lipid levels and anthropometric measures.The relation is displayed in coefficient of determination R2 and adjusted R2, between each of theindependent variables: the lipids, with the dependent variables: the anthropometric measures.Significance levels are indicated by ƚ p<0.01, *p<0.05.6.4 DiscussionHigher TC, triglyceride, TC:HDL-C values and lower HDL-C levels were observed in ATR patientscompared to the controls in agreement with the hypothesis. Lower circulating levels of MMP2/ 3/ 13and TIMP3 compared to the control group.The ATR patient group in the current study resembles patient characteristics of other ATR studies. Thepercentage males to females observed in this study was 82% and 18%. This is comparable to thedistribution observed in other studies280,281,283. The mean age of ATR participants in a Finnish study was42.2280, a Danish study showed 42.1283a study in Edmonton found a mean age of 40.6282 while a SwedishLipid Variable R2 R2adjustedTC Ageƚ 0.28 0.20HDL-C ATRƚ 0.25 0.16LDL-C Ageƚ 0.26 0.18BMI* 0.26 0.18Ratio TC:HDL-Cƚ ATR* 0.30 0.22nonHDL-C Ageƚ 0.26 0.18BMI* 0.26 0.18131study found their male participants mean age of 42 whereas the females mean age was significantlyhigher at 52 years of age (p<0.01)281. These findings are comparable to ours; the mean age of the ATRparticipants was 41 years old with men 38 and woman 43 years of age. Physical activity caused 94% ofthe unilateral ATR in this study which is higher nevertheless in line with observed findings in otherstudies where the majority of ruptures were sports related as well with 73%283, 75%282and 64%281respectively.The ATR group demonstrated significantly elevated lipid levels compared to controls. TC, triglycerideand TC:HDL-C levels were higher in the ATR group compared to the controls, while the HDL-C levels werelower in the ATR group compared to the controls. Ozgurtas et al. observed similar findings; the ATRgroup in their study demonstrated elevated TC, triglycerides levels and lower HDL-C levels compared tothe controls295. A similar study on rotator cuff rupture patients found elevated TC and triglyceride levelswhile HDL-C was lower compared to controls288. In addition, TC levels were elevated in 69% of the ATRpatients and 28% of the controls288. In the latter study, the difference between ATR patients andcontrols was more marked than in the current study. Mathiak et al. found elevated TC levels in 83%participants who sustained an ATR296, while Haacke et al.297 found that only 15% of ATR people hadelevated TC levels, however controls were not included in these studies296,297. We found that 39% of theATR patients had elevated TC levels, compared to 24% of the controls. It is not yet clear whether thisdifference is of sufficient magnitude to recommend lipid profiling on all patients who present with ATR.In the current study, blood samples were taken two to six weeks after surgical repair and thus afterrupture of the Achilles tendon. Circulatory levels of MMP2/ 3/ 13 and TIMP3 were lower in the ATRgroup than of the healthy controls.  These results are in line with a studies that demonstrated lowerlevels of MMP3144,150 and TIMP3144,150 in painful human Achilles tendon tissue144 and human rotator cufftendons150. However in contrast with MMP13 that was increased in findings of Lo et al. who132demonstrated elevated levels in rotator cuff tendon150(Table 1.1). Nonetheless the current findings arein contrast to findings by Pasternak et al.201 who demonstrated increased MMP2/ 7 in the serum ofpatients with a history of Achilles tendon rupture. The contradicting findings may be explained by thedifference in moment of blood sample collection after rupture; namely two to six weeks post rupture vs.3 years post rupture201. The current findings are partly in accordance with data of ruptured Achillestendon tissue that showed lower levels of MMP3/ 7, TIMP2/ 3/ 4 and higher levels of MMP1/ 9 andTIMP1 compared to normal tendons144 (Table 1.1). Injured supraspinatus tendon (SST) tissue displayed adecreased activity of MMP2/ 3145, which is in keeping with our observations at the serum level (Table1.1). However Riley et al. reported higher MMP13 levels in ruptured human SST, which is in contrast toour findings145(Table 1.1). However Choi et al. found elevated tissue MMP2 activity levels 2-4 weeksafter and TIMP2 levels 2 weeks after a full thickness surgical SST tear in rabbits148 and MMP2 proteinactivity was increased in ruptured human Achilles tendon tissue136 (Table 1.1). A number of differencesin the previous studies (location of tendon, time since rupture, tissue vs serum measurement) limit ourability to draw firm conclusions regarding the role of MMPs and TIMPs in human Achilles tendonrupture. To our knowledge, the current study is the first to report circulating serum MMP levels at anearly time point in the ATR healing process in humans.The results of this study highlight the fact that MMPs may play important physiological roles in injuredand healing tendons. In response to overuse (rabbit Achilles model), MMP2 levels are upregulated in theAchilles tendon, and detectable in the circulation after only 1 week (Chapter 5). In wounds, both MMP2and MMP9 levels are elevated298–303. Inhibition of MMP2 in treatment of a nerve injury in diabetics, leadto a reduced neurotrophin availability while addition of active MMP2 assisted the regrowth of nerves intreatment of diabetic nerve problems304. This indicates the potential importance of these substances forhealing. Moreover inhibition of MMP2 in keratinocytes resulted in a reduction of keratinocyte growth305.More specific to the musculoskeletal system, clinical trials that tested broad spectrum MMP inhibitors133Batimastat and Marimastat for cancer treatment, that are especially potent inhibitor of MMP2/ 9, led toreversible musculoskeletal pain and tendinopathy mostly of the Achilles tendon306–310. These findingssuggest that MMPs and TIMPs are needed to prevent tendinopathy. As a possible explanation of thelower MMP2 levels in ATR patients in the current study, perhaps the individuals with lower MMP2expression are less able to induce an adaptive or repair response in the tendons after repetitive activity-related damage, which then predisposes their Achilles tendons to rupture. Alternately, perhaps theperiod of relative inactivity (the foot is in a non-load bearing cast) following injury leads to reducedloading of tendon and other musculoskeletal tissues, and hence, lowers serum MMP2.It is known that people over-estimate their physical activity levels and under-estimate their sittingtime311,312. For that reason, the values reported in this study may exceed the reality. Both groups self-reported and thus both groups may have equally over-estimated physical activity values, however this isnot known. The height and weight of the controls was self-reported as well. For a more accuratedescription, actual anthropometric and activity measurements would have been more precise. Eventhough BMI is an anthropometric indicator related in part to the amount of adipose tissue, studies haveshown that waist measurements were more related to patellar tendon abnormalities than BMI191,313.The blood sample was collected two to six weeks after rupture. During that period of time the patientswould have had a potentially more sedentary behavior as the leg was immobilized as a consequence ofthe surgery for that same period. This can influence MMP levels as demonstrated by Thornton et al.;where 4h of stress deprivation of rat AT and SST tissue lead to higher levels of MMP13/ 3 and TIMP2than attached and time zero tendons209. This illustrates that a duration of just 4h, the tendon tissueMMP levels can change. The surgery itself can also influence the MMP and TIMP levels in the circulation.Despite this, statistical differences were observed in the lipid levels in this study, even though controlsreported the same average BMI as ATR subjects.134In conclusion, several blood lipids and MMPs levels of people who sustained an Achilles tendon rupturewere different from healthy controls. The ATR group had lower MMP2/ 3/ 13 and TIMP3 levelscompared to controls, higher levels of TC and triglycerides, an elevated ratio TC:HDL-C concentrations,and lower HDL-C concentration compared to controls. These finding suggest that people with ATR arelikely to have higher circulating lipid levels and lower levels of MMP2/ 3/ 13 and TIMP3, which may bean important contributor to reduced tendon healing. Abnormal lipid values may represent a relativelyweak risk factor for Achilles tendon rupture, but one worthy of examining as part of the holistic care ofindividuals with a ruptured Achilles tendon – particularly given the likelihood of a prolonged period ofreduced physical activity following injury.1357. DiscussionThe purpose of this thesis was to identify early indicators of tendon diseases with a focus on MMP2.Finding early indicators for tendon disease is important as tendons need a long time to heal onceinjured92,314–316. The earlier a tendon injury is detected and thus less degraded, the better the chance ofa timely recovery and fully functioning tendon.To address this overall goal, five different studies in-vitro and in-vivo were performed. This section willdiscuss the research questions and outcomes of each study one by one, and then discuss the cumulativecontribution of these individual studies to the overall goal of identifying early indicators of tendondisease.7.1 Summary of study conclusionsStudy 1 in Chapter 2 – MMP2 expression in mechanically stimulated human tendon cells is modulatedby frequency and strainResearch question:Will stretching of tendon cells, in different conditions, correlate with changes in the expression of genesinvolved in the regulation of collagen degradation?Hypothesis:More intense stretching protocols are anticipated to have a greater effect on the mRNA expression ofMMP2, TIMP2 and collagen mRNA as well as the MMP2 activity.To test this research question, an in-vitro study on human hamstring tenocytes was setup under fourdifferent conditions 1) high frequency with high strain, 2) high frequency with low strain, 3) low136frequency with high strain and 4) low frequency with low strain. Respectively, these experimentssimulated conditions ranging from high to low severity, in terms of motion exerted on tendons.Experiments that subjected tenocytes to high frequency or high strain conditions resulted in a highermRNA expression of MMP2 mRNA; however MMP14 and TIMP2 mRNA were not significantly higher.The MMP2 protein activity was higher in the high strain compared to low strain stretching, however notin the high frequency stretching. In practice high repetition and high strain movements are performed incertain occupations and during sports. High repetition movements are generally associated with minimalloads, while movements that require a lot of force are usually not performed very frequently. In tendonresearch it was expected that high loads would cause more damage than high repetitions. However thecurrent experiments have demonstrated that both high repetitions or high strains can be equallyharmful, at least as far as MMP2 expression and activity is concerned.  These findings are in line withrecently identified risk factors for developing overuse tendinopathy3,203.Study 2 in Chapter 3 – MMP2 expression in mechanically stimulated human tendon cells is modulatedby frequency and strainResearch question:Will periods of rest inserted in the loading protocol induce a greater degree of collagen production?HypothesisRest insertion is expected to increase collagen production in tenocytes.  Rest insertion in more intensestretching protocols is anticipated to produce more collagen.In a healthy tendon, cells continuously experience loads from the ECM in which they are embeddedusually caused by physical movements of the body and corresponding ground reaction forces.137Mechanical stimulation or exercise is the cause of many tendon problems. Yet, it can also promotetendon healing. Initially this seems contradictory. However there may be a fine balance of what amountof stimulation leads to repair versus damage.In this rest insertion study, human hamstring tenocytes underwent stretching with or without restperiods. It is well documented in previous literature that tendons adapt to exercise by increasing thecross sectional area (CSA) thus enhancing some mechanical properties of the tendons. We hypothesizedthat inserting periods of rest would further enhance tendon adaption. The cells that underwentstretching with rest periods between mechanical stretching cycles displayed a greater expression ofcollagen type I mRNA expression and pro-collagen type I protein level compared to continuouslystimulated cells. This result demonstrates that in an in-vitro setting, cells benefit from a period of restduring mechanical stretching, suggesting that rest may allow for better adaptation to occur.Combination of Studies 1 and 2 in Chapters 2 and 3Research question:Will stretching of tenocytes with and without rest insertion influence cell organization and shape?Hypothesis:More severe stretching is expected to result in a more disorganized deposition of cells and collagen.Stretching of tenocytes in general resulted in a greater solidity of the tendon cells while the major/minoraxis was lower. From these results, we can state that mechanical stretching resulted in cells thatbranched more and were more rounded - both measures that are indicative of more metabolicallyactive cells. Stretching with 1000 cycles led to a reduced major/minor axis and thus rounder cells. These138results show that mechanical stretching induces a more metabolically active cell that was associatedwith a change in the cell shape.Cell shape is affected by mechanical stretching; this has been shown in both the rest insertion (Chapter3) and the load and frequency experiments (Chapter 2). However, the results of these studies were incontrast with each other. The load and frequency variation experiments (Chapter 2) demonstrated thatmechanical stretching caused cells to elongate and branch more.  The discrepancy on cell elongation androunding may be caused by the differences in stimulation. The cells in the load and frequency variationstudy in general underwent longer stimulation periods up to 5 days, while the cells in the rest insertionstudy were stimulated at most for 8h. The duration of stimulation and the precise stimulation protocolmay have influenced cell shape. When assessing the morphology of tendons that have been subjectedto different exercise or overuse conditions, it should be kept in mind that tenocyte morphology canchange rapidly and dynamically in response to mechanical stretching.Study 3 in Chapter 4 – Regional molecular and cellular differences in the female rabbit Achilles tendoncomplex: potential implication for understanding responses to loadingResearch question:Are there differences in mRNA expression in genes involved in ECM homeostasis in the Achilles tendoncomplex?HypothesisIt is expected that each the tendon regions in the complex has a different mRNA expression likely basedon the individual location.A more fibrocartilaginous phenotype was observed in the distal regions. Aggrecan mRNA expression washigher in the distal regions of the Achilles tendon complex compared with the proximal regions, in the139intact normal rabbit tissue. Collagen type I and MMP2 expression levels were increased in the PLGcompared to the DG in the intact normal rabbit tissue.Study 4 in Chapter 5 – Repetitive movements of the rabbit Achilles tendon complex induces changes inMMP2 levelsResearch questionIs it possible to track the development of early phase collagen degradation activity in-vivo in thecirculation?Hypotheses:It is hypothesized that MMP2 and TIMP2 will be present in altered concentrations in the circulation dueto local production and release from mechanically loaded tendon.It is expected that the exercised rabbits will have a higher level of MMPs and TIMPs in the circulationcompared with the control group.The rabbit overuse study was performed to determine if overuse of a tendon alone could lead todegradative activity and if markers of degradation could be measured in the circulation. In the rabbitoveruse study, one hind limb of the rabbit was mechanically stimulated for two hours, three times perweek for a total of two weeks. Blood and proximal Achilles tendon samples were analyzed for MMP2.After one week of exercise, serum MMP2 activity level was higher compared to controls. However, thisdifference was not present at the 2 week time point. The exercised FDS tendon had higher MMP2protein activity levels compared to control FDS tendon.140Study 5 in Chapter 6 – Altered serum MMP, TIMP and lipid levels in patients with Achilles tendonruptureResearch question:Are elevated circulatory lipid, MMP and TIMP levels present in people with an Achilles tendon rupture?Hypothesis:Achilles tendon rupture patients are expected to have elevated levels of MMP2 and blood lipid levels inthe circulation.We analyzed the blood of patients with an ATR for lipid, MMP and TIMP levels in comparison withcontrols. The ATR participants had lower MMP2/ 3/ 13 and TIMP3 levels relative to controls. The lipidlevel findings were in line with our hypothesis; the rupture group had elevated TC, triglycerides andTC:HDL-C and lower HDL-C (good cholesterol) compared to the controls.Overall, these five research studies were performed to obtain more detailed insights in tendon injury,healing and repair. The in-vitro and in-vivo studies demonstrated that MMP2 was mostly upregulated instimulated situations compared to controls. In the Achilles tendon rupture study, the MMP2 levels werelower in the ruptured group compared to controls, and this could reflect the fact that following tendonrupture injury, patients become less physically active and therefore load-induced MMP2 expression isdecreased compared to controls.1417.2 Strengths and limitations of the reported research with suggestions forfuture work7.2.1 Mechanical stretching of cellsIn tendon research it is commonly suggested that overuse is one of the causes for tendinopathy, ascertain populations such as people occupied in the meat and fish processing industry andprofessional/recreational runners often experience tendinopathy90,203,317–322. Histological evidence shedslight on the structural changes associated with tendinopathy; cellular responses are shown by molecularchanges of mRNA expression. To study cellular responses, in-vitro experiments are essential.To mimic overuse, tendon cells are often subjected to mechanical stretching using a Flexcell® system (ora similar setup)323. These in-vitro setups allow for studying cellular responses after mechanical stretchingwith the possibility of adding substances such as but not limited to medication or growth factors. Timecourses are easier implemented with in-vitro studies in contrast to in-vivo studies.A limitation of in-vitro studies is that the cells are not situated in their natural environment, embeddedin the ECM. For cells to remain attached to the silicon bottom of the Flexcell® plates during stretching,the plates must be coated with collagen type I. The presence of collagen type I may influence thecellular response. However, using non-coated plates for stretching tendon cells is not possible as thecells detach from the bottom of the plate (unpublished E. Huisman). A potential next step for studyingcell response may be embedding cells in an artificial ECM similar to their natural environment orconducting ex-vivo studies where living tendon constructs can be mechanically stimulated.Stretching tenocytes with the Flexcell® system subjects the cells to two types of mechanical forces. Theprimary force is cell stretching through elongation of the flexible membrane and the secondary is shearstress by fluid motion.  As tendon tissue is visco-elastic and thus contains fluid, shear stress is likely to142occur in tissue as well. Human tenocytes are known to respond to fluid flow in ways described by Wall etal.207. It remains unknown how much of the mRNA expression responses measured in theseexperimental setups are attributable to shear stress and how much are attributable to actual strain ofthe tendon cells. It is unlikely that there is an answer to this question as tendon cells are only viablewhen in media.Overall, in-vitro experiments are essential for understanding cellular behavior (e.g. mRNA expressionand pathways). However these experiments cannot fully reproduce natural conditions for tenocytes.Researchers often attempt to simulate the natural environment as much as possible, but compromisesstill must be made.7.2.2 Suitability of the Backman modelThe rabbit Achilles tendon overuse model has been used in several studies. It incorporates an exerciseregimen of exercise three times per week for 2h for a total duration of 6-11 weeks. This particular modelhas the advantage of applying controlled stimulation to the tendon174,175,177,179. Backman et al. foundhistological changes of degenerative nature after 3 and 6 weeks of exercise in the contralateral andexercised leg, that were not present after 1 weeks of exercise175,176. Contrarily, Archambault et al. werenot able to detect degenerative changes in a similar set up, suggesting the force created by the modelwas too low to result in degenerative changes, even though the exercise was performed for 11 weeks179.In the study of Archambault et al. only half the frequency of the initial Backman model was used tosimulate slow hopping.  Researchers hypothesized that the model may not have created a sufficientvolume of loading to cause tendon damage. The other difference in this study was the lower voltage (1-3V instead of 35-50V) compared to the initial study. Additionally, the electrodes were used to directlystimulate the nerve in contrast to the placement of electrodes on the skin surface.A study that focused on SP-levels detected SP-level changes after 1 week of exercise177, a similar finding143to the current study that showed an elevation in MMP2 serum levels after similar duration of exercise.This result may indicate that MMP2 is an early feature of a tendon’s response to mechanical loading,which precedes more severe tendon degeneration. Another rabbit overuse model primarily usedelectrical stimulation by inserting a needle in direct contact to the flexor digitorum profundus of oneforelimb, for two hours, three times per week  with a total duration of 80h over a course of 11 weeks178.This stimulation protocol led to micro-tears in the stimulated limb while the contralateral limb was lessaffected178, however no control limbs were included in this study. Mechanical and/or electricalstimulation can cause degenerative changes in the tendon; the degree of damage increases with longerexposure to stimulation.In some studies174,175,177 the age of the rabbits used was considered too young by some researchers179but others believe the rabbit to be skeletally mature324,325. In the current study, the overuse model reliedupon rabbits at this age being skeletally mature. Our findings using this model are more congruent withobservations of what occurs in the muscle tendon unit as a result of repetitive motion, rather thanchanges that may be partially due to growth and development.Overall, the Backman is a suitable model that recreates a tendon injury even after short periods of time.7.2.3 Achilles tendon rupture studyIn the ATR study weight, height and physical activity were self-reported. It is described in literature thatpeople often over-estimate their physical activity and that weight is often under-estimated and heightover-estimated compared to figures obtained by direct measurement311,312. However, these values wereself-reported in both groups and thus both groups in the ATR study may have similar skew in thesemeasures. In the future, it would be best to measure height, weight and physical activity ourselves aswell as waist-hip ratio as this measurement has been implicated in patellar tendon abnormalities326.144For future study, we suggest the idea of taking tissue and blood samples at the same time to see if thereis a relation between the substances measured without temporal differences. Another recommendationwould be to include collagen type I, III synthesis and degradative markers, to determine the tendon’srepair or degradative phase.7.2.4 Potential roles of other enzymes and matrix proteins not studied in thecurrent thesisThis thesis focused mainly on MMP2/ 14 and TIMP2 as well as collagen type I and III mRNA expressionand protein levels. Other MMPs, TIMPs and proteoglycans were studied to lesser extent. We did notlook at other enzymes and matrix proteins of interest, described below.Mechanical stimulation is known to upregulate TGF-β, which in turn stimulates collagen type I and IIIformation in tendons234,235,240. TGF-β and hepatocyte growth factor (HGF) are released upon tissuedamage. These growth factors are crucial for initial wound healing. In later phases of wound healing, toomuch TGF-β may lead to scar formation by collagen type III formation103–105. In tendon, increasedcollagen type III deposition leads to a weakened tendon structure56. HGF can inhibit collagen type IIIsynthesis in rat ligament fibroblast327. Cui et al. demonstrated that HGF treatment of rat tendon cellslowered the collagen type III mRNA expression and stimulated the MMP2 expression328. Not studied byCui was the collagen type I expression and synthesis; however collagen type I is crucial to effective repairof a tendon.Fibronectin is a glycoprotein that binds ECM substances, such as collagen, fibrin (a protein involved inblood clotting) and PGs to integrins (transmembrane receptor that connects the ECM to the cell). It isimplicated in tissue healing, and stimulates fibroblast migration and adhesion to fibrin329–332. In a studyof the healing of canine flexor tendon, fibronectin was mostly found in the epitenon and endotenon and145to a lesser extent in the tendon body330. After healing, fibronectin disappears77,333,334. Fibronectin wasalso found in necrotic areas of ATR335 and found near micro-tears of degenerated tendons71. Increasedpresence of fibronectin may indicate that the tendon is in sub-optimal condition, either healing ordegenerating. In future research, fibronectin may be used as an indicator of sub-optimal condition of thetendon.Tenascin-C (TN), an anti-adhesion ECM protein, is abundantly expressed during embryogenesis and ispresent in healthy tendon tissue as well336. There is evidence that TN is present at locations where activeECM remodeling occurs336 including, but not limited to wound healing107,337,338 and regeneration ofinjured skeletal muscle339. It is expressed in healing wounds but absent from scar tissue339–341. TN isknown to respond to TGF-β, basic fibroblast growth factor (BFGF), TNF-α and IL-1, these substances inturn respond to mechanical stimulation339,340,342. In the osseotendinous junction it was found that loaddeprivation led to reduced TN protein presence336. mRNA from tendon cells at distal segments expresshigher levels of TN compared to proximal segments suggesting that TN is stimulated by compressiveforces47. Tenascin-C was also observed in degenerate equine superficial digital flexor tendon343.Taken together TGF-β, HGF, fibronectin and TN are other substances involved in tendon repair anddegradation and may be suitable to include in further studies.7.2.5 Possible events upstream or downstream of MMP2 activityMechanical loading is most often one of the first events in the cascade to alter 1) MMP expression andproduction and 2) growth factors (Figure 7.1). Mechanical stimulation is known to involve TGF-β, IGFand IGF-BP, IL1/ 4/ 6/ 10, FGF, PG, TNF-α and VEGF. In turn these substances can modulated theexpression or activity of MMPs17,131. The baseline level of MMPs in tissue is low. Mechanical stimulation,e.g. stretch, will lead to (temporal) ECM deformation. The ECM is connected to the cell through ECM146receptors: integrins. These specialized cell surface receptors are responsible for establishing amechanical continuum by which forces are transmitted from the outside and the inside of the cells andvice versa (Figure 7.1)344. Thus integrins may be actively involved in mechanotransduction and mayactivate or suppress cellular pathways that in turn up/down regulate MMP expression. Consequently , itmay be good to study the involvement of integrins in the altered regulation of MMPs. Katsumi et al.345listed integrins that are activated by responses to strain in multiple cell types; integrins dependentresponses in fibroblasts were suggested to regulated focal adhesion kinase (FAK), paxillin and p130.Downstream these are thought to be involved in alignment346. Extracellular signal-regulated kinase (ERK)and c-Jun N-terminal kinase (JNK) are other integrin dependent responses and they are part of themitogen-activated protein kinase (MAPK) pathway and thought to be involved in ECM remodeling347.More specific are the pathways described in (Figure 7.3) that shows the activation of the differentMMPs. When signals are transmitted by integrins, several pathways can be activated (Figure 7.3). TheMAPK pathway is thought to be involved (Figure 7.1, Figure 7.2).Figure 7.1 A simplified scheme of the signaling pathways believed to be involved in the response to tensilestress.147Chiquet et al. 1999, reproduced with permission344.Figure 7.2 Schematic representation of MMP activation.Chakraborti et al. 2003, reproduced with permission130.MMP2 has been reported to bind to integrin αѵβ3348. MMP2 is regulated by MMP14 (MT1-MMP), whichis expressed in low levels in many cell types and MMP14 is most clearly regulated by cytokines (a proteinthat affects cell-cell interaction such as ILs and TNF-α) and growth factors349. MMP14 may also activatepro-MMP13 either through MMP2 activation or directly350. MMP2 is continuously present in low levels,and is marginally induced or repressed by growth factors and cytokines130,351,352.148Figure 7.3 Schematic representation of mitogen activation protein kinase (MAPK) pathways for MMP expressionand activity.Chakraborti et al. 2003, reproduced with permission130.Nitric oxide (NO) is a free radical produced by nitric oxide synthases (NOSs) upon mechanicalstimulation; it is a messenger molecule that plays an important role in a variety of physiologicalfunctions. Three different isoforms exist 1) inducible form (iNOS), endothelial (eNOS) and neuronal(nNOS). High levels of NOs are often associated with degradative processes including the activation ofMMPs. NOs may be induced by cytokines. However NO is also implicated in healing of soft tissues. In a 4week treadmill running exercise of rats  iNOS and eNOS mRNA expression of the SST were upregulatedcompared to control353. In SMCs NO has shown inhibitory effects on MMP2 and MMP9 activation by149inhibited activation of the NF-қB signaling pathway, as well as an increases in TIMP2 levels (Figure7.2)130,344,354.Clearance of MMP2Besides TIMP2 as an inhibitor for MMP2 thrombospondin (TS2) has been implicated in the inhibition ofMMP2 by clearing it130. TS2 binds both latent and active MMP2 and is normally removed by the lowdensity lipoprotein receptor-related protein (LRP). TS2 deficient mice experience elevated MMP2levels130,355. MMP13 also requires LRP for degradation. Both MMP13 and TS/MMP2 complex areinhibited by 39kDa receptor associated protein (RAP), which in turn also binds and inhibits LRP356.There are numerous other substances up and downstream of MMP2 that are potentially implicated intendon degeneration. Integrins are likely implicated as they are directly involved inmechanotransduction from ECM to the cell. Further downstream are substances implicated in theseveral pathways described (Figure 7.3). Lastly, the clearance process of MMP2 can be potentiallyhelpful for more insights in tendon degeneration.7.2.6 Can MMP2 be directly manipulated in tendon cells to prove an effect ontendon?To examine the precise influence of MMP2 on tendons or tendon cells, several different experimentscan be performed. Causative studies; by the administration of MMP2, on tendon cells/tissue responseare especially important to study degeneration. Other substances that increase the expression of MMP2have been described. Another option is to inhibit MMP2 by using a specific MMP2 inhibitor.No causative studies on tendon tissue or tendon cells have been described to date. A study thatresearched the presence of MMP2 in the development of diabetic retinopathy found that with MMP2150administration in healthy rat retinal endothelial cells in culture, the cells demonstrated acceleratedapoptosis compared to controls. It is believed that oxidative stress pathway is one of the MMP2activators in this condition (also described in Figure 7.3)357.A study on the administration of MMP2 in spinal nerve ligation resulted in allodynia. Blocking MMP2with TIMP2 reversed spinal nerve ligation-induced allodynia 10 days after administration. A morespecific MMP2 inhibitor (synthetic, N-arylsulfonyl-Nalkoxyaminoacetohydroxamic acid compound),diminished allodynia on day 1 and almost completely blocked allodynia in the next 10 days. This anti-allodynia effect lasted for 4 days after the last administration, suggesting a cumulative effect. Usingsilencing (si)RNA for specific MMP2 knockdown also reversed spinal nerve ligation induced allodynia aswell358. Thus administration and blocking of MMP2 is possible as demonstrated in endothelial cells andspinal nerve. In both of these studies, MMP2 was observed to have a deleterious effect while inhibitionhad a positive or repair effect.Ciprofloxacin (an antibiotic) upregulated the MMP2 expression in rat Achilles tendon cells at mRNA andprotein level and concomitant collagen type I degradation was observed. While MMP9, TIMP1/ 2protein activity remained unchanged359.Tendon-bone healing, by collagen type I organization is augmented in surgical supraspinatus tendondetachment in rat when doxycycline (an antibiotic) is administered compared to controls. MMP13 levelswere lower in the animals treated with doxycycline compared to controls360.These studies have shown that antibiotics can lead to varying responses in tendon.Studies with broad spectrum MMP inhibitors have been performed on tendon tissue and tendoncells306,361–364. A study that induced surgical detachment in the supraspinatus tendon of rat, administeredα-2—macroglobulin (A2 M) protein, a universal MMP inhibitor, at the site of injury. This led to greater151fibrocartilage healing, greater collagen organization at 4 weeks and a significant reduction in collagendegradation observed at 2 and 4 weeks after surgery compared to the control group365.MMP2 knock down by the use of siRNA or a specific inhibitor (e.g. TIMP2) can be used in cells toestablish MMP2 function in control tendon cells and mechanically stimulated tendon cells. In a study byChetty et al., MMP2 knockdown in lung cancer cells by siRNA led to inhibited phosphoinositide 3-kinase(PI3K), protein kinase B (AKT)366. AKT mediates a variety of cellular responses including cell growth,transformation, differentiation, motility and cell survival and induces VEGF expression. The inactivationof MMP2 led to reduced VEGF expression366.Transgenic mice with an MMP2 promotor/enhancer reporter construct exist and have been used tostudy the effects of MMP2 in muscle atrophy by injury to the tendon367. This mice model can also beused for overuse or injury studies to determine the (enhanced) effect of MMP2 in those situations.Taken together, there are several different ways to study the presence or absences of MMP2: addingMMP2, blocking MMP2 by broad spectrum inhibitor, specific inhibitor, MMP2 knockdown or transgenicmice. To date little is known on the effects of blocking of MMP2 and the effect on tendon healing ordegeneration.7.2.7 Potential ex-vivo experimentsIn this thesis only in-vitro and in-vivo studies have been performed. To be able to better connect theknowledge obtained in the in-vitro and in-vivo studies the following ex-vivo experiments are proposed.Rat patellar tendon will be extracted under viable conditions and clamped into a Bose® ElectroForce®BioDynamic ®test instrument. The tissue is mechanically stimulated so that the cells initiate a responseand alter the ECM by substance (e.g. MMPs) release. The tendon tissues’ stiffness is measured before152and after mechanical stimulation as an indication of damage. These experiments can be expanded toinclude MMP2 or broad-spectrum MMP inhibitors.7.2.8 Potential role(s) of MMP2 in tendon pathology, and the importance of bothload and repetition in the induction of MMP2 in human tendon cellsIn this report we demonstrated that overuse of tenocytes and tendon tissue can be achieved in the in-vitro and in-vivo experiments we performed. MMP2 expression and activity was increased in responseto mechanical stimulation in both models, indicating a potential role of MMP2 in the observed Achillestendon degeneration after only 2 weeks of overuse. We were able to demonstrate in the strain andfrequency variation study (Chapter 2) that highly repetitive movements were just as capable of inducingMMP2 in tendon cells as high strains were. In future it would strengthen the data by studying thelocalization of MMPs, TIMPs, PGs, interleukins, regulators of the angiogenesis pathways, TGF-β by usingimmunohistochemistry.7.2.9 Incorporation of rest periods during exercise may be a novel approach totendon rehabilitationThe in-vitro study (Chapter 3) demonstrated the increased collagen type I expression with periods of restinserted in back to back loading protocol162. Collagen type I is essential for the ECM as it provide thetendon with strength. Exercise that increased the collagen type I expression can thus be seen asbeneficial for the tendon. To our knowledge this is one of the first studies to demonstrate thisphenomenon in tendon cells.It is crucial that the newly synthesized collagen is deposited in an orderly structure, as only then it willstrengthen the tendon. A follow-up study that would examine the collagen structure after rest inserted153loading regimen as well as measuring the tendon strength prior to any exercise and again after will givea good indication of the effect of rest periods inserted in the exercise or rehabilitation protocol.When these studies are successful; collagen type I is deposited orderly, this could lead to alteredrehabilitation procedures. It is possible that more periods of rest after every stretch exercise is included.7.2.10 The different regions of the rabbit Achilles tendon require separate analysisResearch has been done to highlight the molecular and structural differences within and betweentendons. Chapter 4 provided a more detailed study of both the molecular and structural characteristicsof the rabbit Achilles tendon complex.Tendons do not experience loads uniformly, which can be a result of the CSA differences throughout thelength of the tendon. Smaller areas will absorb larger stresses for a given load368.  Tendon CSA willbecome larger in response to training128,368. An exercise program for strengthening the patellar tendonfound localized increases in the CSA post-training; the CSA of the proximal parts were increased whilethe mid-tendon CSA remained the same128. This suggests that mRNA expression and protein levels aredifferent at proximal and distal areas.The rabbit is a commonly used animal model for Achilles tendon overuse studies175–177,179, as its sizeallows for multiple analyses afterwards: mRNA, protein and histological assessments. The model allowsfor controlled overuse in contrast to treadmill models, where animals can alter their way of moving ordo not adhere to running protocol. The rabbits’ Achilles tendon is in fact a complex consisting of threetendons enveloped by the paratenon and thus differs from human tendons. Marqueti et al.257 researchdemonstrated differences within the rat Achilles tendon, and as the rabbits Achilles tendon complexconsists of three distinct tendons, a significant contribution to existing literature would be a descriptionof the different mRNA profiles of each of these tendons29. For instance, MMP2 expression was not154induced uniformly by overuse in all regions of the rabbit Achilles tendon complex (Chapter 5). If theentire tendon had been analyzed as a whole, we might not have been able to detect this induction.7.2.11 MMP2 activity is increased locally and is also measurable in the circulationThis is the first study to demonstrate that the MMP2 activity is measurable in the circulation after 2weeks of repetitive movements. This MMP2 activity likely originated from injured tissue asdemonstrated by SHG microscopy (Chapter 5), however it cannot be ruled out that the MMP2 isreleased by other musculoskeletal tissues as well.Most studies focused on in-vivo or ex-vivo tendon overuse have looked at mRNA expression and proteinlevels in tissue. Besides that we looked at blood levels and were able to measure MMP2 in thecirculation. Only one study focused on Achilles tendon rupture was able to do that201.The current study was very controlled with the controls and repetitive motion stimulated rabbits havingthe same daily light/dark rhythm, food and anesthetic treatment duration. In future studies it would bebeneficial to analyze local fluid and tissue using microdialysis and immunohistochemistry to build theevidence as to whether the MMP2 originates from the tendon. The muscle release levels of MMP2would be a good additional study, to be able to quantify what amount of MMPs originates from whatstructure.7.2.12 Tendon rupture lipid levels and MMPsA study with mice fed a high fat diet resulted in skin and tendon xanthomas (typically caused by highlevels of circulating lipids) also demonstrated elevated mRNA MMP2 tail tissue levels and reduced thefailure stress and load of the patellar tendon88. These findings suggested a potential relation betweenelevated circulatory lipid levels and MMPs. Our human study that investigated the lipid levels of peoplewith ATR aimed to research this potential relation. To our knowledge this is the first study that155researched the relation between circulating lipid and MMP levels. The ATR group demonstratedsignificantly worse lipid levels (TC, triglycerides, nonHDL and HDL) and significantly lower MMP2/ 3/ 13and TIMP3 concentrations compared to the controls. No relation was observed between any of theMMPs, TIMPs and lipid levels. Our study included 33 ATR patients and perhaps that was too smallsample size to demonstrate a relation. To better examine the relationship, a larger cohort of patientscan be included or alternatively and perhaps a more specific group such as people withhypercholesterolemia and tendon problems. People with the latter condition are known to haveelevated lipid levels and often tendon problems as well, perhaps making it easier to find a relation86,369.However it may also be possible that this suggested relationship is not present.7.3 Does optimal loading for tendon repair exist?Most of the work discussed, has focused on the degeneration of tendon tissue and on measuringindicators of the collagen degenerative process. However, collagen degeneration may be involved intissue remodeling, damage, adverse catabolic response, or adaptive responses, i.e. MMP2 levels maynot be distinctive for a single process in tendon tissue. Collagen type I is the main type of collagen in thetendon, it provides the tendons’ strength. Collagen type I formation can be seen as (remodeling or)repair. Healthy tendons continuously remodel the ECM19,44,261. Cells need to experience the appropriateamount of stimulation to synthesize pro-collagen type I that will be assembled in the ECM to formcollagen type I. It is often seen in healing after acute tendon injury that collagen type III – that is weakerthan collagen type I- gets synthesized before it is turned over in collagen type I65,185,370,371.Ideally research will find an optimal load that only remodels the tendon but does not degenerate it. Theappropriate loads for healing of the tendon of a professional athlete will be different from a sedentaryperson. However, for the Achilles tendinopathy, eccentric exercise has shown to be beneficial for themajority of people9,119,372. Yet it remains unknown what the right amount and type ofstrain/cycles/duration is for optimal healing and how can we measure the repair or degeneration of156tendon tissue with absolute certainty; this is a question that to date has not been adequately answered.157Bibliography1. O’Brien M. 2005. Anatomy of Tendons. In: Maffulli N, Renstrom P, Leadbetter W, editors. TendonInjuries: Basic Science and Clinical Medicine. Springer-Verlag London Limited 2005; p 3–13.2. Bureau of Labor Statistics U.S. 2005. Musculoskeletal disorders [Internet].Occup. Environ. Heal.recognizing Prev. Dis. Inj. :488–516[cited 2014 Feb 24 ] Available from:http://www.bls.gov/opub/ted/2004/mar/wk5/art02.htm.3. Gallagher S, Heberger JR. 2012. Examining the Interaction of Force and Repetition onMusculoskeletal Disorder Risk: A Systematic Literature Review.Hum. Factors J. Hum. FactorsErgon. Soc. 55(1):108–124.4. Pengpid S, Peltzer K, Kassean HK, et al. 2015. Physical inactivity and associated factors amonguniversity students in 23 low-, middle- and high-income countries.Int. J. Public Health :539–549.5. Gaida JE, Ashe MC, Bass SL, Cook JL. 2009. Is adiposity an under-recognized risk factor fortendinopathy? A systematic review.Arthritis Rheum. 61(6):840–849.6. Kannus P. 1997. Tendons - a source of major concern in competitive and recreationalathletes.Scand. J. Med. Sci. Sports 7:53–54.7. De Jonge S, van den Berg C, de Vos RJ, et al. 2011. Incidence of midportion Achilles tendinopathyin the general population.Br. J. Sports Med. 45(April):1026–1028.8. Clement D, Taunton J, Smart G. 1984. Achilles tendinitis and peritendinitis: etiology andtreatment.Am J Sport. Med 12:179–184.9. Silbernagel KG, Thomeé R, Thomeé P, Karlsson J. 2001. Eccentric overload training for patientswith chronic Achilles tendon pain--a randomised controlled study with reliability testing of theevaluation methods.Scand. J. Med. Sci. Sports 11(4):197–206.10. Maffulli N, Wong J. 2003. Rupture of the Achilles and patellar tendons.Clin. Sports Med.22(4):761–776.11. Cook JL, Khan KM, Kiss ZS, et al. 2001. Asymptomatic hypoechoic regions on patellar tendonultrasound: A 4-year clinical and ultrasound followup of 46 tendons.Scand. J. Med. Sci. Sports11(6):321–7.12. Maffulli N, Ewen SW, Waterston SW, et al. 2000. Tenocytes from ruptured and tendinopathicachilles tendons produce greater quantities of type III collagen than tenocytes from normalachilles tendons. An in vitro model of human tendon healing.Am. J. Sports Med. 28(4):499–505.13. Khan KM, Cook JL, Bonar F, et al. 1999. Histopathology of common tendinopathies. Update andimplications for clinical management.Sports Med. 27(6):393–408.15814. Maffulli N, Khan KM, Puddu G. 1998. Overuse Tendon Conditions: Time to Change a ConfusingTerminology.Arthrosopy 14(8):840–843.15. Benjamin M, Ralphs J. 1997. Tendons and ligaments - an overview.Histol Histolpathol 12:1135–1144.16. Komi P, Fukashiro S, Jarvinen M. 1992. Biomechanical loading of Achilles tendon during normallocomotion.Clin. Sports Med. .17. Kjaer M. 2004. Role of extracellular matrix in adaptation of tendon and skeletal muscle tomechanical loading.Physiol. Rev. 84(2):649–698.18. Buckley MR, Evans E, Matuszewski PE, et al. 2013. Distributions of Types I, II and III Collagen byRegion in the Human Supraspinatus Tendon.Connect. Tissue Res. 54(6):374–379.19. Riley G. 2008. Tendinopathy-from basic science to treatment.Nat. Clin. Pract. Rheumatol.4(2):82–89.20. Wang JH-C. 2006. Mechanobiology of tendon.J. Biomech. 39(9):1563–1582.21. Kannus P. 2000. Structure of the tendon connective tissue.Scand. J. Med. Sci. Sports 10(6):312–320.22. Sharma P, Maffulli N. 2006. Biology of tendon injury: healing, modeling and remodeling.J.Musculoskelet. Neuronal Interact. 6(2):181–190.23. O’Brien M. 1997. Structure and metabolism of tendons.Scand. J. Med. Sci. Sports 7(2):55–61.24. Ackermann PW. 2013. Neuronal regulation of tendon homoeostasis.Int. J. Exp. Pathol. 94(4):271–86.25. Chuen FS, Chuk CY, Ping WY, et al. 2004. Immunohistochemical characterization of cells in adulthuman patellar tendons.J. Histochem. Cytochem. 52(9):1151–1157.26. Kannus P, Natri A. 1997. Etiology and pathophysiology of tendon ruptures in sports.Scand. J.Med. Sci. Sports 7(2):107–112.27. McNeilly CM, Banes AJ, Benjamin M, Ralphs JR. 1996. Tendon cells in vivo form a threedimensional network of cell processes linked by gap junctions.J. Anat. 189(3):593–600.28. Ritty TM, Roth R, Heuser JE. 2003. Tendon Cell Array Isolation Reveals a Previously UnknownFibrillin-2-Containing Macromolecular Assembly.Structure 11(9):1179–1188.29. Huisman ES, Andersson G, Scott A, et al. 2014. Regional molecular and cellular differences in thefemale rabbit Achilles tendon complex: potential implications for understanding responses toloading.J. Anat. 224(5):538–547.15930. Adams CWM, Bayliss OB, Baker RWR, et al. 1974. Lipid deposits in aging human arteries, tendonsand fascia.Atherosclerosis 19:429–440.31. Franchi M, Trirè A, Quaranta M, et al. 2007. Collagen structure of tendon relates tofunction.ScientificWorldJournal. 7:404–420.32. Marqueti RC, Paulino MG, Fernandes MN, et al. 2014. Tendon structural adaptations to loadexercise are inhibited by anabolic androgenic steroids.Scand. J. Med. Sci. Sports 24(1):e39–e51.33. Kvist M, Jozsa L, Järvinen M, Kvist H. 1985. Fine structural alterations in chronic Achillesparatenonitis in athletes.Pathol. Res. Pr. 180:416–423.34. Cook JL, Purdam CR. 2009. Is tendon pathology a continuum? A pathology model to explain theclinical presentation of load-induced tendinopathy.Br. J. Sports Med. 43(6):409–416.35. Miller KS, Edelstein L, Connizzo BK, Soslowsky LJ. 2012. Effect of preconditioning and stressrelaxation on local collagen fiber re-alignment: inhomogeneous properties of rat supraspinatustendon.J. Biomech. Eng. 134(031007-1).36. Scott A, Lian Ø, Roberts CR, et al. 2008. Increased versican content is associated with tendinosispathology in the patellar tendon of athletes with jumper’s knee.Scand. J. Med. Sci. Sports18(4):427–435.37. Pingel J, Wienecke J, Kongsgaard M, et al. 2013. Increased mast cell numbers in a calcanealtendon overuse model.Scand. J. Med. Sci. Sports :1–8.38. Behzad H, Sharma A, Mousavizadeh R, et al. 2013. Mast cells exert pro-inflammatory effects ofrelevance to the pathophyisology of tendinopathy.Arthritis Res. Ther. 15:R184.39. Bi Y, Ehirchiou D, Kilts TM, et al. 2007. Identification of tendon stem/progenitor cells and the roleof the extracellular matrix in their niche.Nat. Med. 13(10):1219–1227.40. Parkinson J, Samiric T, Ilic MZ, et al. 2011. Involvement of proteoglycans in tendinopathy.J.Musculoskelet. Neuronal Interact. 11(2):86–93.41. Parkinson J, Samiric T, Ilic MZ, et al. 2010. Change in proteoglycan metabolism is a characteristicof human patellar tendinopathy.Arthritis Rheum. 62(10):3028–3035.42. Zhang G, Young BB, Ezura Y, et al. 2005. Development of tendon structure and function:regulation of collagen fibrillogenesis.J. Musculoskelet. Neuronal Interact. 5(1):5–21.43. Yoon JH, Halper J. 2005. Tendon proteoglycans: biochemistry and function.J. Musculoskelet.Neuronal Interact. 5(1):22–34.44. Rees SG, Flannery CR, Little CB, et al. 2000. Catabolism of aggrecan, decorin and biglycan intendon.Biochem. J. 350 Pt 1:181–188.16045. Vogel KG, Ordog A, Pogany G, Olah J. 1993. Proteoglycans in the compressed region of humantibialis posterior tendon and in ligaments.J. Orthop. Res. 11(1):68–77.46. Jozsa L, Lehto M, Kvist M, et al. 1989. Alterations in dry mass content of collagen fibers indegenerative tendinopathy and tendon-rupture. 9,.Matrix 9:140–146.47. Mehr D, Pardubsky PD, Martin JA, Buckwalter JA. 2000. Tenascin-C in tendon regions subjectedto compression.J. Orthop. Res. 18(4):537–545.48. Scott A, Khan K, Cook J, Duronio V. 2007. Human Tendon Overuse Pathology: Histopathologic andBiochemical Findings. In: Woo SLY, Rensotrom PAFH, Arnoczky SP, editors. Tendinopathy inAthletes, 1st ed. Malden, MA, USA: Blackwell Publishing; p 69–84.49. Fearon A, Dahlstrom JE, Twin J, et al. 2014. The Bonar score revisited: Region of evaluationsignificantly influences the standardized assessment of tendon degeneration.J. Sci. Med. Sport17(4):346–350.50. Yao L, Bestwick C, Bestwick L, et al. 2011. Non-immortalized human tenocyte cultutres as avehicle for understanding cellular aspects to tendinopathy.Transl. Med. 1(1):173–194.51. Yao L, Bestwick C, Bestwick L, et al. 2006. Phenotypic drift in human tenocyte culture.Tissue Eng12(7):1843–1849.52. Docheva D, Hunziker EB, Fa R, Brandau O. 2005. Tenomodulin Is Necessary for TenocyteProliferation and Tendon Maturation.Society 25(2):699–705.53. Murchison ND, Price BA, Conner DA, et al. 2007. Regulation of tendon differentiation by scleraxisdistinguishes force-transmitting tendons from muscle-anchoring tendons.Development134(14):2697–2708.54. Scott A, Danielson P, Abraham T, et al. 2011. Mechanical force modulates scleraxis expression inbioartificial tendons.J. Musculoskelet. Neuronal Interact. 11(2):124–132.55. Bank RA, TeKoppele JM, Oostingh G, et al. 1999. Lysylhydroxylation and non-reduciblecrosslinking of human supraspinatus tendon collagen: changes with age and in chronic rotatorcuff tendinitis.Ann. Rheum. Dis. 58(1):35–41.56. Riley G. 2004. The pathogenesis of tendinopathy. A molecular perspective.Rheumatology(Oxford). 43(2):131–142.57. Sell DR, Monnier VM. 1990. End-stage renal disease and diabetes catalyze the formation of apentose-derived crosslink from aging human collagen.J. Clin. Invest. 85(2):380–384.58. Dyer DG, Blackledge J a., Thorpet SR, Baynes JW. 1991. Formation of pentosidine duringnonenzymatic browning of proteins by glucose: Identification of glucose and other carbohydratesas possible precursors of pentosidine in vivo.J. Biol. Chem. 266(18):11654–11660.16159. Bank RA, Bayliss MT, Lafeber FP, et al. 1998. Ageing and zonal variation in post-translationalmodification of collagen in normal human articular cartilage. The age-related increase in non-enzymatic glycation affects biomechanical properties of cartilage.Biochem. J. 330 ( Pt 1:345–351.60. McShane JM, Ostick B, McCabe F. 2007. Noninsertional Achilles tendinopathy: Pathology andmanagement.Curr. Sports Med. Rep. 6:288–292.61. Maffulli N, Sharma P, Luscombe KL. 2004. Achilles tendinopathy: aetiology and management.J. R.Soc. Med. 97(10):472–476.62. Hughes T. 2005. Imaging of Tendon ailments. In: Maffulli N, Renstrom P, Leadbetter WB, editors.Tendon Injuries - Basic Science and Clinical Medicine. Springer-Verlag London Limited; p 49–61.63. Movin T, Gad A, Reinholt FP, Rolf C. 1997. Tendon pathology in long-standing achillodynia. Biopsyfindings in 40 patients.Acta Orthop. Scand. 68(2):170–175.64. Cook JL, Feller JA, Bonar SF, Khan KM. 2004. Abnormal tenocyte morphology is more prevalentthan collagen disruption in asymptomatic athletes’ patellar tendons.J. Orthop. Res. 22(2):334–338.65. Maffulli N, Barrass V, Ewen SW. 2000. Light microscopic histology of achilles tendon ruptures. Acomparison with unruptured tendons.Am. J. Sports Med. 28(6):857–863.66. Longo UG, Franceschi F, Ruzzini L, et al. 2008. Histopathology of the supraspinatus tendon inrotator cuff tears.Am. J. Sports Med. 36(3):533–538.67. Maffulli N, Testa V, Capasso G, et al. 2004. Similar histopathological picture in males with Achillesand patellar tendinopathy.Med. Sci. Sports Exerc. 36(9):1470–1475.68. Arner O, Lindholm Å. 1959. Subcutaneous rupture of the Achilles tendon: a study of 92cases.Acta Chir Scand. 116(Suppl):1–51.69. Kannus P, Jozsa L. 1991. Histopathological Changes Preceding Spontaneous Rupture of a Tendon -A controlled study of 891 patients.Surgery 73(10):1507–1525.70. Gaida JE, Alfredson H, Kiss ZS, et al. 2010. Asymptomatic Achilles tendon pathology is associatedwith a central fat distribution in men and a peripheral fat distribution in women: a cross sectionalstudy of 298 individuals.BMC Musculoskelet. Disord. 11(41).71. Järvinen M, Józsa L, Kannus P, et al. 1997. Histopathological findings in chronic tendondisorders.Scand. J. Med. Sci. Sports 7(2):86–95.72. Kvist M. 1994. Achilles tendon injuries in athletes.Sport. Med. 18(3):173–201.73. James R, Kesturu G, Balian G, Chhabra AB. 2008. Tendon: biology, biomechanics, repair, growthfactors, and evolving treatment options.J. Hand Surg. Am. 33(1):102–112.16274. Rees JD, Stride M, Scott A. 2013. Tendons - time to revisit inflammation.Br. J. Sports Med. (0):1–7.75. Kragsnaes M, Fredberg U, Stribolt K, et al. 2014. Stereological quantification of immune-competent cells in baseline biopsy specimens from achilles tendons: results from patients withchronic tendinopathy followed for more than 4 years.Am J Sport. Med 42(10):2435–2445.76. Schubert TEO, Weidler C, Lerch K, et al. 2005. Achilles tendinosis is associated with sprouting ofsubstance P positive nerve fibres.Ann. Rheum. Dis. 64:1083–1086.77. Gotoh M, Hamada K, Yamakawa H et al. 1997. Significance of granulation tissue in tornsupraspinatus insertions: an immunohistochemical study with antibodies against interleukin-1beta, cathepsin D, and matrix metalloprotease-1.J Orthop Res (15):33–39.78. Sullo A, Maffulli N, Capasso G, Testa V. 2001. The effects of prolonged peritendinousadministration of PGE1 to the rat Achilles tendon: A possible animal model of chronic Achillestendinopathy.J. Orthop. Sci. 6:349–357.79. Legerlotz K, Jones ER, Screen HRC, Riley GP. 2012. Increased expression of IL-6 family members intendon pathology.Rheumatology (Oxford). 51(7):1161–1165.80. Langberg H, Skovgaard D, Petersen LJ, et al. 1999. Type I collagen synthesis and degradation inperitendinous tissue after exercise determined by microdialysis in humans.J. Physiol. 521 Pt1:299–306.81. Cook JL, Khan KM. 2007. Tendinopathy in Athletes. In: Woo SLY, Renstrom PAFH, Arnoczky SP,editors. Tendinopathy in Athletes. Blackwell Publishing; p 10–28.82. Scott A, Zwerver J, Grewal N, et al. 2014. Lipids, adiposity and tendinopathy: is there amechanistic link? Critical review.Br. J. Sports Med. (0):1–6.83. Williams PT. 1997. Evidence for the incompatibility of age-neutral overweight and age- neutralphysical activity standards from runners.Am. J. Clin. Nutr. 65(5):1391–1396.84. Tsouli SG, Kiortsis DN, Argyropoulou MI, et al. 2005. Pathogenesis, detection and treatment ofAchilles tendon xanthomas.Eur. J. Clin. Invest. 35(4):236–244.85. Von Bahr S, Movin T, Papadogiannakis N, et al. 2002. Mechanism of Accumulation of Cholesteroland Cholestanol in Tendons and the Role of Sterol 27-hydroxylase (CYP27A1).Arterioscler.Thromb. Vasc. Biol. 22(7):1129–1135.86. Beason DP, Abboud J a, Kuntz AF, et al. 2011. Cumulative effects of hypercholesterolemia ontendon biomechanics in a mouse model.J. Orthop. Res. 29(3):380–383.87. Riley GP, Harrall RL, Constant CR, et al. 1994. Tendon degeneration and chronic shoulder pain:changes in the collagen composition of the human rotator cuff tendons in rotator cufftendinitis.Ann. Rheum. Dis. 53(6):359–366.16388. Grewal N, Thornton GM, Behzad H, et al. 2014. Accumulation of Oxidized LDL in the TendonTissues of C57BL/6 or Apolipoprotein E Knock-Out Mice That Consume a High Fat Diet: PotentialImpact on Tendon Health.PLoS One 9(e114214).89. Murphy G, Nagase H. 2008. Reappraising metalloproteinases in rheumatoid arthritis andosteoarthritis: destruction or repair?Nat. Clin. Pract. Rheumatol. 4(3):128–135.90. Abate M, Oliva F, Schiavone C, Salini V. 2012. Achilles tendinopathy in amateur runners: role ofadiposity (Tendinopathies and obesity).Muscles. Ligaments Tendons J. 2(1):44–8.91. Battery L, Maffulli N. 2011. Inflammation in overuse tendon injuries.Sports Med. Arthrosc.19(3):213–217.92. Maffulli N, Longo UG, Loppini M, Denaro V. 2010. Current treatment options fortendinopathy.Expert Opin. Pharmacother. 11(13):2177–2186.93. Arnoczky SP, Lavagnino M, Egerbacher M, et al. 2007. Matrix metalloproteinase inhibitorsprevent a decrease in the mechanical properties of stress-deprived tendons: an in vitroexperimental study.Am. J. Sports Med. 35(5):763–769.94. Marqueti RC, Parizotto NA, Chriguer RS, et al. 2006. Androgenic-anabolic steroids associated withmechanical loading inhibit matrix metallopeptidase activity and affect the remodeling of theachilles tendon in rats.Am. J. Sports Med. 34(8):1274–1280.95. Riley G. 2005. Chronic tendon pathology: molecular basis and therapeutic implications.ExpertRev. Mol. Med. 7(5):1–25.96. Tsuzaki M, Guyton G, Garrett W, et al. 2003. IL-1b induces COX2, MMP1,3,13, ADAMTS 4, IL1band IL-6 in human tendon cells.J. Orthop. Res. 21:256–264.97. Arnoczky SP, Lavagnino M, Egerbacher M. 2007. The mechanobiological aetiopathogenesis oftendinopathy: is it the over-stimulation or the under-stimulation of tendon cells?Int. J. Exp.Pathol. 88(4):217–226.98. Yang G, Im H, Wang J. 2005. Repetitive mechanical stretching modulates IL-1b induced COX2,MMP1 expression and PGE2 production in human patellar tendon fibroblasts.Synthesis (Stuttg).19(363):166–172.99. Narumiya S, Sugimoto Y, Ushikubi F, Conclusions VI. 1999. Prostanoid Receptors : Structures ,Properties , and Functions.79(4):1193–1227.100. Gilroy D, Tomlinson A, Willoughby D. 1998. Differential effects of inhibition of isoforms ofcyclooxygenase (COX-1, COX-2) in chronic inflammation.Inflamm Res 47(2):79–85.101. Lipsky P. 1999. Role of cyclooxygenase-1 and -2 in health and disease.Am J Orthop suppl 28(3):8–12.164102. Petersen W, Varoga D, Zantop T, et al. 2004. Cyclic strain influences the expression of thevascular endothelial growth factor (VEGF) and the hypoxia inducible factor 1 alpha (HIF-1alpha)in tendon fibroblasts.J. Orthop. Res. 22(4):847–853.103. Bedi A, Maak T, Walsh C, et al. 2012. Cytokines in rotator cuff degeneration and repair.J. shoulderElb. Surg. 21(2):218–227.104. Campbell BH, Agarwal C, Wang JHC. 2004. TGF-B1, TGF-B3, and PGE2 regulate contraction ofhuman patellar tendon fibroblasts.Biomech. Model. Mechanobiol. 2(4):239–245.105. Kurtz CA, Loebig TG, Anderson DD, et al. 1999. Insulin-like growth factor I accelerates functionalrecovery from Achilles tendon injury in a rat model.Am. J. Sports Med. 27(3):363–369.106. Oryan A, Moshiri A, Sharifi P. 2012. Advances in injured tendon engineering with emphasis on therole of collagen implants.Hard Tissue 1(2):13–16.107. Sharma P, Maffulli N. 2005. Tendon injury and tendinopathy: healing and repair.J. Bone JointSurg. Am. 87(1):187–202.108. Thomopoulos S, Harwood FL, Silva MJ, et al. 2005. Effect of several growth factors on canineflexor tendon fibroblast proliferation and collagen synthesis in vitro.J. Hand Surg. Am. 30(3):441–7.109. Oryan A, Silver IA, Goodship AE. 2010. Metrenperone enhances collagen turnover andremodeling in the early stages of healing of tendon injury in rabbit.Arch. Orthop. Trauma Surg.:1–7.110. Oryan A, Goodship AE, Silver IA. 2008. Response of a collagenase-induced tendon injury totreatment with a polysulphated glycosaminoglycan (Adequan).Connect. Tissue Res. 49(5):351–360.111. Chan BP, Fu S, Qin L, et al. 2000. Effects of basic fibroblast growth factor (bFGF) on early stages oftendon healing: a rat patellar tendon model.Acta Orthop. Scand. 71(5):513–518.112. Hosaka Y, Kirisawa R, Yamamoto E, et al. 2002. Localization of cytokines in tendinocytes of thesuperficial digital flexor tendon in the horse.J. Vet. Med. Sci. 64(10):945–947.113. Riley GP. 2005. Gene expression and matrix turnover in overused and damaged tendons.Scand. J.Med. Sci. Sports 15(4):241–251.114. Lacraz S, Nicod LP, Chicheportiche R, et al. 1995. IL-10 inhibits metalloproteinase and stimulatesTIMP-1 production in human mononuclear phagocytes.J. Clin. Invest. 96(5):2304–2310.115. Lacraz S, Isler P, Vey E, et al. 1994. Direct contact between T lymphocytes and monocytes is amajor pathway for induction of metalloproteinase expression.J. Biol. Chem. 269(35):22027–22033.165116. Spiesz EM, Thorpe CT, Chaudhry S, et al. 2015. Tendon extracellular matrix damage, degradationand inflammation in response to in-vitro overload exercise.J. Orthop. Res. (June):889–897.117. Vieira CP, De Aro AA, Da Ré Guerra F, et al. 2013. Inflammatory process induced by carrageenanin adjacent tissue triggers the acute inflammation in deep digital flexor tendon of rats.Anat. Rec.296(8):1187–1195.118. Wren TA, Beaupré GS, Carter DR. 2000. Tendon and ligament adaptation to exercise,immobilization, and remobilization.J. Rehabil. Res. Dev. 37(April):217–224.119. Alfredson H, Pietilä T, Jonsson P, Lorentzon R. 1998. Heavy-load eccentric calf muscle training forthe treatment of chronic Achilles tendinosis.Am. J. Sports Med. 26:360–366.120. Malliaras P, Barton CJ, Reeves ND, Langberg H. 2013. Achilles and patellar tendinopathy loadingprogrammes : a systematic review comparing clinical outcomes and identifying potentialmechanisms for effectiveness.Sports Med. 43(4):267–286.121. Kongsgaard M, Kovanen V, Aagaard P, et al. 2009. Corticosteroid injections, eccentric declinesquat training and heavy slow resistance training in patellar tendinopathy.Scand. J. Med. Sci.Sports 19(6):790–802.122. Heinemeier KM, Olesen JL, Haddad F, et al. 2007. Expression of collagen and related growthfactors in rat tendon and skeletal muscle in response to specific contraction types.J. Physiol.582(Pt 3):1303–1316.123. Olesen JL, Heinemeier KM, Gemmer C, et al. 2007. Exercise-dependent IGF-I, IGFBPs, and type Icollagen changes in human peritendinous connective tissue determined by microdialysis.J. Appl.Physiol. 102(1):214–220.124. Miller BF, Olesen JL, Hansen M, et al. 2005. Coordinated collagen and muscle protein synthesis inhuman patella tendon and quadriceps muscle after exercise.J. Physiol. 567(Pt 3):1021–33.125. Couppé C, Hansen P, Kongsgaard M, et al. 2009. Mechanical properties and collagen cross-linkingof the patellar tendon in old and young men.J. Appl. Physiol. 107(3):880–886.126. Arampatzis A, Karamanidis K, Albracht K. 2007. Adaptational responses of the human Achillestendon by modulation of the applied cyclic strain magnitude.J. Exp. Biol. 210(Pt 15):2743–53.127. Kongsgaard M, Qvortrup K, Larsen J, et al. 2010. Fibril morphology and tendon mechanicalproperties in patellar tendinopathy: effects of heavy slow resistance training.Am. J. Sports Med.38(4):749–756.128. Kongsgaard M, Reitelseder S, Pedersen TG, et al. 2007. Region specific patellar tendonhypertrophy in humans following resistance training.Acta Physiol. (Oxf). 191(2):111–121.129. Brew K, Dinakarpandian D, Nagase H. 2000. Tissue inhibitors of metalloproteinases: evolution,structure and function.Biochim. Acta 1477:267–283.166130. Chakraborti S, Mandal M, Das S, et al. 2003. Regulation of matrix metalloproteinases: anoverview.Mol. Cell. Biochem. 253(1-2):269–285.131. Del Buono A, Oliva F, Osti L, Maffulli N. 2013. Metalloproteases and tendinopathy.Muscles.Ligaments Tendons J. 3(1):51–57.132. Ra H, Parks W. 2007. Control of Matrix Metalloproteinase Catalytic Activity.Matrix biol26(8):587–596.133. Morgunova E, Tuuttila A, Bergmann U, Tryggvason K. 2002. Structural insight into the complexformation of latent matrix metalloproteinase 2 with tissue inhibitor of metalloproteinase 2.Proc.Natl. Acad. Sci. U. S. A. 99(11):7414–7419.134. Hernandez-Barrantes S. 2000. Binding of Active (57 kDa) Membrane Type 1-MatrixMetalloproteinase (MT1-MMP) to Tissue Inhibitor of Metalloproteinase (TIMP)-2 Regulates MT1-MMP Processing and Pro-MMP-2 Activation.J. Biol. Chem. 275(16):12080–12089.135. Sun HB, Andarawis-Puri N, Li Y, et al. 2010. Cycle-dependent matrix remodeling gene expressionresponse in fatigue-loaded rat patellar tendons.J. Orthop. Res. 28(10):1380–1366.136. Karousou E, Ronga M, Vigetti D, et al. 2008. Collagens, proteoglycans, MMP-2, MMP-9 and TIMPsin human achilles tendon rupture.Clin. Orthop. Relat. Res. 466(7):1577–1582.137. De Mos M, van El B, DeGroot J, et al. 2007. Achilles tendinosis: changes in biochemicalcomposition and collagen turnover rate.Am. J. Sports Med. 35(9):1549–1556.138. Gao HGL, Fisher PW, Lambi AG, et al. 2013. Increased Serum and Musculotendinous FibrogenicProteins following Persistent Low-Grade Inflammation in a Rat Model of Long-Term UpperExtremity Overuse.PLoS One 8(8):e71875.139. Corps AN, Robinson AHN, Harrall RL, et al. 2012. Changes in matrix protein biochemistry and theexpression of mRNA encoding matrix proteins and metalloproteinases in posterior tibialistendinopathy.Ann. Rheum. Dis. 71 (5 ):746–752.140. Alfredson H, Lorentzon M, Bäckman S, et al. 2003. cDNA-arrays and real-time quantitative PCRtechniques in the investigation of chronic Achilles tendinosis.J. Orthop. Res. 21(6):970–975.141. Magra M, Maffulli N. 2005. Matrix metalloproteases: a role in overuse tendinopathies.Br. J.Sports Med. 39(11):789–791.142. Verma RP, Hansch C. 2007. Matrix metalloproteinases (MMPs): Chemical-biological functions and(Q)SARs.Bioorganic Med. Chem. 15(6):2223–2268.143. Fu SC, Chan BP, Wang W, et al. 2002. Increased expression of matrix metalloproteinase 1 (MMP1)in 11 patients with patellar tendinosis.Acta Orthop. Scand. 73(6):658–662.167144. Jones GC, Corps AN, Pennington CJ, et al. 2006. Expression Profiling of Metalloproteinases andTissue Inhibitors of Metalloproteinases in Normal and Degenerate Human AchillesTendon.Arthritis Rheum. 54(3):832–842.145. Riley GP, Curry V, DeGroot J, et al. 2002. Matrix metalloproteinase activities and theirrelationship with collagen remodelling in tendon pathology.Matrix Biol. 21(2):185–195.146. Lavagnino M, Arnoczky SP, Tian T, Vaupel Z. 2003. Effect of Amplitude and Frequency of CyclicTensile Strain on the Inhibition of MMP-1 mRNA Expression in Tendon Cells: An In VitroStudy.Connect. Tissue Res. 44:181–187.147. Arnoczky SP, Tian T, Lavagnino M, Gardner K. 2004. Ex vivo static tensile loading inhibits MMP-1expression in rat tail tendon cells through a cytoskeletally based mechanotransductionmechanism.J. Orthop. Res. 22(2):328–333.148. Choi H-R, Kondo S, Hirose K, et al. 2002. Expression and enzymatic activity of MMP-2 duringhealing process of the acute supraspinatus tendon tear in rabbits.J. Orthop. Res. 20(5):927–933.149. Attia M, Huet E, Gossard C, et al. 2013. Early events of overused supraspinatus tendons involvematrix metalloproteinases and EMMPRIN/CD147 in the absence of inflammation.Am. J. SportsMed. 41(4):908–917.150. Lo IKY, Marchuk LL, Hollinshead R, et al. 2004. Matrix metalloproteinase and tissue inhibitor ofmatrix metalloproteinase mRNA levels are specifically altered in torn rotator cuff tendons.Am. J.Sports Med. 32(5):1223–1229.151. Jelinsky S, Rodeo S, Li J, et al. 2011. Regulation of gene expression in human tendinopathy.BMCMusculoskelet. Disord. 12:86.152. Andarawis-Puri N, Sereysky JB, Sun HB, et al. 2012. Molecular response of the patellar tendon tofatigue loading explained in the context of the initial induced damage and number of fatigueloading cycles.J. Orthop. Res. :1–8.153. Popov C, Burggraf M, Kreja L, et al. 2015. Mechanical stimulation of human tendonstem/progenitor cells results in upregulation of matrix proteins, integrins and MMPs, andactivation of p38 and ERK1/2 kinases.BMC Mol. Biol. 16(1):1–11.154. Maeda E, Fleischmann C, Mein C a, et al. 2010. Functional analysis of tenocytes gene expressionin tendon fascicles subjected to cyclic tensile strain.Connect. Tissue Res. 51(6):434–444.155. Ireland D, Harrall R, Curry V, et al. 2001. Multiple changes in gene expression in chronic humanAchilles tendinopathy.Matrix Biol. 20(3):159–169.156. Koskinen SO, Heinemeier KM, Olesen JL, et al. 2004. Physical exercise can influence local levels ofmatrix metalloproteinases and their inhibitors in tendon-related connective tissue.J. Appl.Physiol. 96(3):861–864.168157. Almekinders LC, Banes AJ, Ballenger CA. 1993. Effects of repetitive motion on humanfibroblasts.Med. Sci. Sport. Exerc. .158. Wang JH-C, Li Z, Yang G, Khan M. 2004. Repetitively Stretched Tendon Fibroblasts ProduceInflammatory Mediators.Clin. Orthop. Relat. Res. 422(422):243–250.159. Jiang C, Shao L, Wang Q, Dong Y. 2012. Repetitive mechanical stretching modulates transforminggrowth factor-β induced collagen synthesis and apoptosis in human patellar tendonfibroblasts.Biochem Cell Biol 674:667–674.160. Archambault J, Tsuzaki M, Banes AJ. 2002. Stretch and interleukin 1b induce matrixmetalloproteinases in rabbit tendon cells in vitro.J. Orthop. Res. 20:36–39.161. Wall ME, Weinhold PS, Siu T, et al. 2007. Comparison of cellular strain with applied substratestrain in vitro.J. Biomech. 40(1):173–181.162. Huisman E, Lu A, McCormack RG, Scott A. 2014. Enhanced collagen type I synthesis by humantenocytes subjected to periodic in vitro mechanical stimulation.BMC Musculoskelet. Disord.15(1):386.163. Dirks RC, Warden SJ. 2011. Models for the study of tendinopathy.J. Musculoskelet. NeuronalInteract. 11(2):141–149.164. Cook J, Khan K, Harcourt P, et al. 1998. Patellar tendon ultrasonography in asymptomatic activeathletes reveals hypoechooic regions: a study of 320 tendons.Clin. J. Sport Med. 8:73–77.165. Svensson M, Kartus J, Christensen LR, et al. 2005. A long-term serial histological evaluation of thepatellar tendon in humans after harvesting its central third.Knee Surgery, Sport. Traumatol.Arthrosc. 13(5):398–404.166. Langberg H, Rosendal L, Kjær M. 2001. Training-induced changes in peritendinous type I collagenturnover determined by microdialysis in humans.J. Physiol. 534(1):297–302.167. Langberg H, Skovgaard D, Karamouzis M, et al. 1999. Metabolism and inflammatory mediators inthe peritendinous space measured by microdialysis during intermittent isometric exercise inhumans.J. Physiol. 515 ( Pt 3:919–27.168. Alfredson H, Thorsen K, Lorentzon R. 1999. In situ microdialysis in tendon tissue: high levels ofglutamate, but not prostaglandin E2 in chronic Achilles tendon pain.Knee Surg. Sports Traumatol.Arthrosc. 7(6):378–81.169. Birch HL, Bailey AJ, Goodship AE. 1998. Macroscopic “degeneration” of equine superficial digitalflexor tendon is accompanied by a change in extracellular matrix composition.Equine Vet. J.30(6):534–539.170. Marsolais D, Côté CH, Frenette J. 2001. Neutrophils and macrophages accumulate sequentiallyfollowing Achilles tendon injury.J. Orthop. Res. 19(6):1203–1209.169171. Kato M, Takada S, Kashida Y, Nomura M. 1995. Histological examination on Achilles tendonlesions induced by quinolone antibacterial agents in juvenile rats.Toxicol. Pathol. 23(3):385–392.172. Dakin SG, Werling D, Hibbert A, et al. 2012. Macrophage sub-populations and the lipoxin A 4receptor implicate active inflammation during equine tendon repair.PLoS One 7(2):e32333.173. Thorpe CT, Chaudhry S, Lei II, et al. 2015. Tendon overload results in alterations in cell shape andincreased markers of inflammation and matrix degradation.Scand. J. Med. Sci. Sports 25:e381–e391.174. Andersson G, Backman LJ, Scott A, et al. 2011. Substance P accelerates hypercellularity andangiogenesis in tendon tissue and enhances paratendinitis in response to Achilles tendonoveruse in a tendinopathy model.Br. J. Sports Med. 45(13):1017–1022.175. Backman C, Boquist L, Friden J, et al. 1990. Chronic Achilles Paratenonitis with tendinosis, an expmodel in rabbits.pdf.:541–547.176. Andersson G, Forsgren S, Scott A, et al. 2011. Tenocyte hypercellularity and vascular proliferationin a rabbit model of tendinopathy: contralateral effects suggest the involvement of centralneuronal mechanisms.Br. J. Sports Med. 45(5):399–406.177. Backman LJ, Andersson G, Wennstig G, et al. 2011. Endogenous substance P production in theAchilles tendon increases with loading in an in vivo model of tendinopathy-peptidergic elevationpreceding tendinosis-like tissue changes.J. Musculoskelet. Neuronal Interact. 11(2):133–140.178. Nakama LH, King KB, Abrahamsson S, Rempel DM. 2005. Evidence of tendon microtears due tocyclical loading in an in vivo tendinopathy model.J. Orthop. Res. 23(5):1199–1205.179. Archambault JM, Hart DA, Herzog W. 2001. Response of rabbit Achilles tendon to chronicrepetitive loading.Connect. Tissue Res. 42(1):13–23.180. John T, Lodka D, Kohl B, et al. 2010. Effect of pro-inflammatory and immunoregulatory cytokineson human tenocytes.J. Orthop. Res. 28(8):1071–1077.181. Barbe MF, Gallagher S, Massicotte VS, et al. 2013. The interaction of force and repetition onmusculoskeletal and neural tissue responses and sensorimotor behavior in a rat model of work-related musculoskeletal disorders.BMC Musculoskelet. Disord. 14(1):1–26.182. Alfredson H, Cook J. 2007. A treatment algorithm for managing Achilles tendinopathy: newtreatment options.Br. J. Sports Med. 41(4):211–216.183. Doherty GP, Koike Y, Uhthoff HK, et al. 2006. Comparative anatomy of rabbit and human achillestendons with magnetic resonance and ultrasound imaging.Comp. Med. 56(1):68–74.184. Järvinen T, Kannus P, Paavola M, et al. 2001. Achilles tendon injuries.Curr. Opin. Rheumatol.13:150–155.170185. Jozsa L, Reffy A, Balint J. 1984. The pathogenesis of tendolipomatosis; an electron microscopicalstudy.Int Orthop. 7(4):251–255.186. Adams C, Bayliss O, Baker R, et al. 1974. Lipid deposits in ageing human arteries, tendons andfascia.Atherosclerosis 19(3):429–40.187. American Academy of Orthopaedic Surgeons. 2008. The Burden of Musculoskeletal Diseases. 1-6p.188. Maffulli N, Longo UG, Denaro V. 2010. Novel approaches for the management of tendinopathy.J.Bone Joint Surg. Am. 92(15):2604–2613.189. Rees JD, Maffulli N, Cook J. 2009. Management of tendinopathy.Am. J. Sports Med. 37(9):1855–1867.190. Heinemeier KM, Kjaer M. 2011. In vivo investigation of tendon responses to mechanical loading.J.Musculoskelet. Neuronal Interact. 11(2):115–123.191. Gaida JE, Cook JL, Bass SL, et al. 2004. Are unilateral and bilateral patellar tendinopathydistinguished by differences in anthropometry, body composition, or muscle strength in elitefemale basketball players?Br. J. Sports Med. 38(5):581–585.192. Karjalainen PT, Soila K, Aronen HJ, et al. 2000. MR imaging of overuse injuries of the Achillestendon.AJR. Am. J. Roentgenol. 175(1):251–260.193. Joseph M. 2008. Molecular Mediators of Tendon Remodeling and Repair: Histological andmolecular analysis of the biceps tendon long head post-tenotomy.194. Deryugina EI, Ratnikov B, Monosov E, et al. 2001. MT1-MMP Initiates activation of pro-MMP2and integrin avb3 promotes maturation of MMP2 in breast carcinoma cells.Exp. Cell Res.263(2):209–223.195. Strongin AY, Marmer BL, Grant GA, Goldberg GI. 1993. Plasma membrane-dependent activationof the 72-kDa type IV collagenase is prevented by complex formation with TIMP-2.J. Biol. Chem.268(19):14033–14039.196. Andarawis-Puri N, Sereysky JB, Jepsen KJ, Flatow EL. 2012. The relationships between cyclicfatigue loading, changes in initial mechanical properties, and the in vivo temporal mechanicalresponse of the rat patellar tendon.J. Biomech. 45(1):59–65.197. Wang JH-C, Jia F, Gilbert TW, Woo SL-Y. 2003. Cell orientation determines the alignment of cell-produced collagenous matrix.J. Biomech. 36(1):97–102.198. McBeath R, Pirone DM, Nelson CM, et al. 2004. Cell shape, cytoskeletal tension, and RhoAregulate stem cell lineage commitment.Dev. Cell 6(4):483–495.171199. 2010. Analyzing gels and western blogs with ImageJ [Internet].[cited 2014 Nov 12 ] Availablefrom: http://lukemiller.org/index.php/2010/11/analyzing-gels-and-western-blots-with-image-j/.200. Hu X, Beeton C. 2010. Detection of functional matrix metalloproteinases by zymography.J. Vis.Exp. :1–4.201. Pasternak B, Schepull T, Eliasson P, Aspenberg P. 2008. Elevation of systemic matrixmetalloproteinases 2 and 7 and tissue inhibitor of metalloproteinase 2 in patients with a historyof Achilles tendon rupture: pilot study.Br. J. Sports Med. 44(9):669–672.202. De Mello Malheiro OC, Giacomini CT, Justulin LA, et al. 2009. Calcaneal tendon regions exhibitdifferent MMP-2 activation after vertical jumping and treadmill running.Anat. Rec. (Hoboken).292(10):1656–6162.203. Barr AE, Barbe MF, Clark BD. 2004. Work-Related Musculoskeletal Disorders of.J Orthop Sport.Phys Ther 34(10):610–627.204. Lavagnino M, Arnoczky SP. 2005. In vitro alterations in cytoskeletal tensional homeostasis controlgene expression in tendon cells.J. Orthop. Res. 23(5):1211–1218.205. Egerbacher M, Arnoczky SP, Caballero O, et al. 2008. Loss of homeostatic tension inducesapoptosis in tendon cells: an in vitro study.Clin. Orthop. Relat. Res. 466(7):1562–1568.206. Thornton GM, Hart DA. 2011. The interface of mechanical loading and biological factors as theypertain to the development of tendinosis.J Musculoskelet Neuronal Interac 11(2):94–105.207. Wall ME, Banes AJ. 2005. Early responses to mechanical load in tendon: role for calciumsignaling, gap junctions and intercellular communication.J. Musculoskelet. Neuronal Interact.5(1):70–84.208. Greve K, Domeij-Arverud E, Labruto F, et al. 2012. Metabolic activity in early tendon repair can beenhanced by intermittent pneumatic compression.Scand. J. Med. Sci. Sports :1–9.209. Thornton GM, Shao X, Chung M, et al. 2008. Changes in mechanical loading lead to tendonspecific alterations in MMP and TIMP expression: influence of stress deprivation and intermittentcyclic hydrostatic compression on rat supraspinatus and Achilles tendons.Br. J. Sports Med.44(10):698–703.210. Fong KD, Trindade MC, Wang Z, et al. 2005. Microarray Analysis of Mechanical Shear Effects onFlexor Tendon Cells.Plast. Reconstr. Surg. 116(5):1393–1404.211. Lavagnino M, Arnoczky SP, Kepich E, et al. 2008. A finite element model predicts themechanotransduction response of tendon cells to cyclic tensile loading.Biomech. Model.Mechanobiol. 7(5):405–416.172212. Maeda E, Hagiwara Y, Wang JH-C, Ohashi T. 2013. A new experimental system for simultaneousapplication of cyclic tensile strain and fluid shear stress to tenocytes in vitro.Biomed.Microdevices 15(6):1067–1075.213. Sauerland K. 2003. Proteoglycan metabolism and viability of articular cartilage explants asmodulated by the frequency of intermittent loading.Osteoarthr. Cartil. 11(5):343–350.214. Gardner K, Arnoczky SP, Caballero O, Lavagnino M. 2008. The effect of stress-deprivation andcyclic loading on the TIMP/MMP ratio in tendon cells: an in vitro experimental study.Disabil.Rehabil. 30(20-22):1523–1529.215. Maniotis AJ, Chen CS, Ingber DE. 1997. Demonstration of mechanical connections betweenintegrins, cytoskeletal filaments, and nucleoplasm that stabilize nuclear structure.Proc. Natl.Acad. Sci. U. S. A. 94(3):849–854.216. Chicurel ME, Chen CS, Ingber DE. 1998. Cellular control lies in the balance of forces.Curr. Opin.Cell Biol. 10(2):232–239.217. Cho NS, Hwang JH, Lee YT, Chae SW. 2011. Tendinosis-like histologic and molecular changes ofthe Achilles tendon to repetitive stress: a pilot study in rats.Clin. Orthop. Relat. Res.469(11):3172–3180.218. Jozsa L, Kannus P. 1997. Human Tendons: Anatomy, Physiology and Pathology, 1st ed.Champaign, IL, USA: Human Kinetics; 1–576 p.219. Jones ME, Mudera V, Brown RA, et al. 2003. The early surface cell response to flexor tendoninjury.J. Hand Surg. Am. 28(2):221–230.220. Yin L, Elliott DM. 2004. A biphasic and transversely isotropic mechanical model for tendon:application to mouse tail fascicles in uniaxial tension.J. Biomech. 37(6):907–916.221. Butler SL, Kohles SS, Thielke RJ, et al. 1997. Interstitial fluid flow in tendons or ligaments: aporous medium finite element simulation.Med. Biol. Eng. Comput. 35(6):742–746.222. Archambault JM, Elfervig-Wall MK, Tsuzaki M, et al. 2002. Rabbit tendon cells produce MMP-3 inresponse to fluid flow without significant calcium transients.J. Biomech. 35(3):303–309.223. Malek AM, Izumo S. 1996. Mechanism of endothelial cell shape change and cytoskeletalremodeling in response to fluid shear stress.J. Cell Sci. 109:713–726.224. Donnelly E, Ascenzi M-G, Farnum C. 2010. Primary cilia are highly oriented with respect tocollagen direction and long axis of extensor tendon.J. Orthop. Res. 28(1):77–82.225. Scott A, Khan KM, Heer J, et al. 2005. High strain mechanical loading rapidly induces tendonapoptosis: an ex vivo rat tibialis anterior model.Br. J. Sports Med. 39(5):1–4.173226. Heinemeier K, Langberg H, Olesen JL, Kjaer M. 2003. Role of TGF-beta1 in relation to exercise-induced type I collagen synthesis in human tendinous tissue.J. Appl. Physiol. 95(6):2390–2397.227. Magnusson SP, Langberg H, Kjaer M. 2010. The pathogenesis of tendinopathy: balancing theresponse to loading.Nat. Rev. Rheumatol. 6(5):262–268.228. Robling AG, Burr DB, Turner CH. 2001. Recovery periods restore mechanosensitivity todynamically loaded bone.J. Exp. Biol. 204(19):3389–3399.229. Srinivasan S, Weimer DA, Agans SC, et al. 2002. Low-magnitude mechanical loading becomesosteogenic when rest is inserted between each load cycle.J. Bone Miner. Res. 17(9):1613–1620.230. Srinivasan S. 2003. Enabling bone formation in the aged skeleton via rest-inserted mechanicalloading.Bone 33:946–955.231. LaMothe JM, Zernicke RF. 2004. Rest insertion combined with high-frequency loading enhancesosteogenesis.J. Appl. Physiol. 96(5):1788–1793.232. Hanson AD, Marvel SW, Bernacki SH, et al. 2009. Osteogenic effects of rest inserted andcontinuous cyclic tensile strain on hASC lines with disparate osteodifferentiation capabilities.Ann.Biomed. Eng. 37(5):955–965.233. Li F, Li B, Wang QM, Wang JHC. 2008. Cell shape regulates collagen type I expression in humantendon fibroblasts.Cell Motil. Cytoskeleton 65(4):332–341.234. Maeda T, Sakabe T, Sunaga A, et al. 2011. Conversion of mechanical force into TGF-β-mediatedbiochemical signals.Curr. Biol. 21(11):933–941.235. Léjard V, Brideau G, Blais F, et al. 2007. Scleraxis and NFATc regulate the expression of the pro-alpha1(I) collagen gene in tendon fibroblasts.J. Biol. Chem. 282(24):17665–17675.236. Tennessee U of. [date unknown]. Stats Design & Analysis Web Guide [Internet].[cited 2014 Dec 5] Available from: http://dawg.utk.edu/diag/interpret_transformed_means.htm.237. Banes AJ, Weinhold P, Yang X. 1999. Gap Junctions Regulate Responses of Tendon Cells Ex Vivo toMechanical Loading.Clin. Orthop. Relat. Res. (367S):356–370.238. McMahon GE, Morse CI, Burden A, et al. 2013. The manipulation of strain, when stress iscontrolled, modulates in vivo tendon mechanical properties but not systemic TGF-β1levels.Physiol. Rep. 1(5):1–16.239. Screen HRC, Shelton JC, Bader DL, Lee D a. 2005. Cyclic tensile strain upregulates collagensynthesis in isolated tendon fascicles.Biochem. Biophys. Res. Commun. 336(2):424–429.240. Robbins JR, Evanko SP, Vogel KG. 1997. Mechanical loading and TGF-beta regulate proteoglycansynthesis in tendon.Arch. Biochem. Biophys. 342(2):203–211.174241. Ippolito E, Natali PG, Postacchini F, et al. 1980. Morphological, Immunochemical and BiochemicalStudy of Rabbit Achilles Tendon at Various AGes.J. Bone Jt. Surg. 62(4):583–589.242. Abraham T, Fong G, Scott A. 2011. Second harmonic generation analysis of early Achillestendinosis in response to in vivo mechanical loading.BMC Musculoskelet. Disord. 12(1):26.243. Scott A, Cook J, Hart D, et al. 2007. Tenocyte Responses to Mehcanical Loading In Vivo: A role forlocal insulin-like growth factor 1 signalin in early tendinosis.Arthritis Rheum. 56(3):871–881.244. Corps AN, Robinson AHN, Movin T, et al. 2006. Increased expression of aggrecan and biglycanmRNA in Achilles tendinopathy.Rheumatology (Oxford). 45(3):291–294.245. Benjamin M, Ralphs J. 1998. Fibrocartilage in tendons and ligaments - an adaptation tocompressive load.J. Anat. 193:481–494.246. Berenson MC, Blevins FT, Plaas AH, Vogel KG. 1996. Proteoglycans of human rotator cufftendons.J. Orthop. Res. 14(4):518–525.247. Taunton J, Ryan M, Clement D, et al. 2002. A retrospective case-control analysis of 2002 runninginjuries.Br J Sport. Med 36:95–101.248. Magnusson SP, Hansen M, Langberg H, et al. 2007. The adaptability of tendon to loading differsin men and women.Int. J. Exp. Pathol. 88(4):237–240.249. LeMoine JK, Lee JD, Trappe TA. 2009. Impact of sex and chronic resistance training on humanpatellar tendon dry mass , collagen content , and collagen cross-linking.Am J Physiol Regul IntegrComp Physiol 296:R119–R124.250. Maffulli N, Waterston S, Squair J, et al. 1999. Changing Incidence of Achilles Tendon Rupture inScotland: A 15-Year Study.Clin. J. Sport Med. 9:157–160.251. Wiik A, Ekman M, Johansson O, et al. 2009. Expression of both oestrogen receptor alpha and betain human skeletal muscle tissue.Histochem. Cell Biol. 131(2):181–189.252. Liu SH, Al-Shaikh R, Panossian V, et al. 1996. Primary immunolocalization of estrogen andprogesterone target cells in the human anterior cruciate ligament.J. Orthop. Res. 14(4):526–533.253. Hart DA, Archambault JM, Kydd A, et al. 1998. Gender and neurogenic variables in tendon biologyand repetitive motion disorders.Clin. Orthop. Relat. Res. (351):44–56.254. Hart D, Frank C, Kydd A, et al. 2005. Neurogenic Mast cell, and Gender variables in TendonBiology: Potential Role in Chronic Tendinopathy. In: Maffulli N, Renstrom P, Leadbetter WB,editors. Tendon Injuries: Basic Science and Clinical Medicine. London: Springer-Verlag; p 40–48.255. Popesko P, Raitová V, Horák J. 1992. A Colour atlas of the anatomy of small laboratory animals:Rabbit, Guinea Pig. London, UK: Wolfe Publishing Ltd.175256. Reno C, Marchuk L, Sciore P, et al. 1997. Rapid Isolation of Total RNA from Small Samples ofHypocellular, Dense, Connective Tissues.Bio Tech. 22:1082–1086.257. Marqueti RC, Marqueti RDC, Heinemeier KM, et al. 2012. Gene expression in distinct regions ofrat tendons in response to jump training combined with anabolic androgenic steroidadministration.Eur. J. Appl. Physiol. 112(4):1505–1515.258. Marqueti RC, Prestes J, Paschoal M, et al. 2008. Matrix metallopeptidase 2 activity in tendonregions: effects of mechanical loading exercise associated to anabolic-androgenic steroids.Eur. J.Appl. Physiol. 104(6):1087–1093.259. Pereira GB, Prestes J, Leite RD, et al. 2010. Effects of ovariectomy and resistance training onMMP-2 activity in rat calcaneal tendon.Connect. Tissue Res. 51(6):459–466.260. Dunkman A a, Buckley MR, Mienaltowski MJ, et al. 2013. The Tendon Injury Response isInfluenced by Decorin and Biglycan.Ann. Biomed. Eng. .261. Samiric T, Ilic MZ, Handley CJ. 2004. Characterisation of proteoglycans and their catabolicproducts in tendon and explant cultures of tendon.Matrix Biol. 23(2):127–140.262. Hansen M, Kongsgaard M, Holm L, et al. 2009. Effect of estrogen on tendon collagen synthesis ,tendon structural characteristics , and biomechanical properties in postmenopausal women.JAppl Physiol 106(4):1385–1393.263. Pingel J, Fredberg U, Qvortrup K, et al. 2012. Local biochemical and morphological differences inhuman Achilles tendinopathy: a case control study.BMC Musculoskelet. Disord. 13(53).264. Stein B, Yang MX. 1995. Repression of the interleukin-6 promoter by estrogen receptor ismediated by NF-kappa B and C/EBP beta.Mol Cell Biol 15(9):4971–4979.265. Andersen MB, Pingel J, Kjær M, Langberg H. 2011. Interleukin-6: a growth factor stimulatingcollagen synthesis in human tendon.J. Appl. Physiol. 110(6):1549–1554.266. Scheidt-Nave C, Bismar H, Leidig-Bruckner G, et al. 2001. Serum interleukin 6 is a major predictorof bone loss in women specific to the first decade past menopause.J. Clin. Endocrinol. Metab.86(5):2032–2042.267. Maret A, Clamens S, Delrieu I, et al. 1999. Expression of the interleukin-6 gene is constitutive andnot regulated by estrogen in rat vascular smooth muscle cells in culture.Endocrinology140(6):2876–2882.268. Haraldsson BT, Aagaard P, Krogsgaard M, et al. 2005. Region-specific mechanical properties ofthe human patella tendon.J Appl Physiol 98:1006–1012.269. Collins M, Raleigh S. 2009. Genetic risk factors for musculoskeletal soft tissue injuries.54:136–149.176270. Maffulli N, Wong J, Almekinders LC. 2003. Types and epidemiology of tendinopathy.Clin. SportsMed. 22(4):675–692.271. Rompe JD, Furia J, Maffulli N. 2009. Eccentric loading versus eccentric loading plus shock-wavetreatment for midportion achilles tendinopathy: a randomized controlled trial.Am. J. Sports Med.37(3):463–470.272. Fredberg U, Bolvig L, Andersen NT. 2008. Prophylactic training in asymptomatic soccer playerswith ultrasonographic abnormalities in Achilles and patellar tendons: the Danish Super LeagueStudy.Am. J. Sports Med. 36(3):451–460.273. Hirschmüller A, Frey V, Konstantinidis L, et al. 2012. Prognostic value of achilles tendon dopplersonography in asymptomatic runners.Med. Sci. Sports Exerc. 44(2):199–205.274. Fu SC, Wang W, Pau HM, et al. 2002. Increased Expression of Transforming Growth Factor beta 1in Patellar Tendinosis.Clin. Orthop. Relat. Res. 400(400):174–183.275. Paavola M, Kannus P, Paakkala T, et al. 2000. Long-Term Prognosis of Patients With AchillesTendinopathy: An Observational 8 year follow-up Study.Am J Sport. Med 28(5):634–642.276. Shalabi A. 2004. Magnetic resonance imaging in chronic Achilles tendinopathy.Acta Radiol SupplSep(432):1–45.277. Dakin SG, Dudhia J, Smith RKW. 2013. Science in brief: Resolving tendon inflammation. A newperspective.Equine Vet. J. 45:398–400.278. Magnusson SP, Qvortrup K, Larsen JO, et al. 2002. Collagen fibril size and crimp morphology inruptured and intact Achilles tendons.Matrix Biol. 21(4):369–377.279. Nehrer S, Breitenseher M, Brodner W, et al. 1997. Clinical and sonographic evaluation of the riskof rupture in the Achilles tendon.Arch. Orthop. Trauma Surg. 116(1-2):14–18.280. Nyyssonen T, Luthje P, Kroger H. 2008. The increasing incidence and difference in sex distributionof achilles Tendon rupture in finland in 1987 – 1999.Scand. J. Surg. 97:272–275.281. Moller A, Westlin NE. 1996. Increasing incidence of Achilles tendon rupture.Acta Orthop Scand67(5):479–481.282. Suchak A, Bostick G, Reid D, et al. 2005. The incidence of Achilles tendon ruptures in Edmonton,Canada.Foot Ankle Int. 26:932–936.283. Houshian S, Tscherning T, Riegels-Nielsen P. 1998. The epidemiology of achilles tendon rupture ina Danish county.Injury 29(9):651–654.284. Maffulli N. 1999. Current Concepts Review - Rupture of the Achilles Tendon.J Bone Jt. Surg81:1019–1036.177285. Abboud J, Beason DP, Soslowsky LJ. 2012. Emerging ideas: the effect of hypercholesterolemia ontendons.Clin. Orthop. Relat. Res. 470(1):317–320.286. Ronnemaa T, Juva K, Kulonen E. 1975. Effect of hyperlipidemic rat serum on the synthesis ofcollagen by chick embryo fibroblasts.Atherosclerosis 21:315–324.287. Kruth HS. 1985. Lipid deposition in human tendon xanthoma.AJP 121(2):311–315.288. Abboud JA, Kim JS. 2010. The effect of hypercholesterolemia on rotator cuff disease.Clin. Orthop.Relat. Res. 468(6):1493–1497.289. Noji Y, Kouji K, Masa-aki, Kawashiri Yasuhiro T, et al. 2001. Circulating Matrix Metalloproteinasesand Their Inhibitors in Premature Coronary Atherosclerosis.Clin. Chem. Lab. Med. 39(5):380–384.290. Derosa G, Salvadeo SAT. 2009. Evaluation of metalloproteinase 2 and 9 levels and their inhibitorsin combined dyslipidemia.Clin Invest Med 32(2):124–132.291. Alfredson H, Lorentzon R. 2003. Intratendinous glutamate levels and eccentric training in chronicAchilles tendinosis: a prospective study using microdialysis technique.Knee Surg. SportsTraumatol. Arthrosc. 11(3):196–9.292. IPAQ. 2005. Guidelines for Data Processing and Analysis of the International Physical ActivityQuestionnaire (IPAQ) – Short and Long Forms [Internet].IPAQ (November):1–15[cited 2014 Jul 3 ]Available from: https://sites.google.com/site/theipaq/scoring-protocol.293. Weiss NA. 2002. Introductory statistics, 6th ed. Addison-Wesley.294. Vittinghoff E, Glidden D V, Shiboski SC, McCulloch CE. 2005. Regression methods in biostatistics -Linear, logistic, survival and repeated measures models. Springer Sience+Business Media Inc.295. Ozgurtas T, Yildiz C, Serdar M, et al. 2003. Is high concentration of serum lipids a risk factor forAchilles tendon rupture?Clin. Chim. Acta 331(1-2):25–28.296. Mathiak G, Wening J V., Mathiak M, et al. 1999. Serum cholesterol is elevated in patients withAchilles tendon ruptures.Arch. Orthop. Trauma Surg. 119(5-6):280–284.297. Haacke H, Parwaresch MR. 1979. Spontaneous Rupture of the Achilles Tendon - A Sign ofHyperlipoproteinaemia ( HLP ) Type II.Klin. Wochenschr. (57):397–400.298. Armstrong DG, Jude EB. 2002. The Role of Matrix Metalloproteinases in WoundHealing.92(1):12–18.299. Bullen EC, Longaker MT, Updike DL, et al. 1995. Tissue inhibitor of metalloproteinases-1 isdecreased and activated gelatinases are increased in chronic wounds.J. Invest. Dermatol.104(2):236–240.178300. Wysocki AB, Staiano-Coico L, Grinnell F. 1993. Wound fluid from chronic leg ulcers containselevated levels of metalloproteinases MMP-2 and MMP-9.J. Invest. Dermatol. 101(1):64–68.301. Yager DR, Zhang LY, Liang HX, et al. 1996. Wound fluids from human pressure ulcers containelevated matrix metalloproteinase levels and activity compared to surgical wound fluids.J. Invest.Dermatol. 107(5):743–748.302. Agren MS. 1994. Gelatinase activity during wound healing.Br. J. Dermatol. 131(5):634–640.303. Ågren MS, Jorgensen LN, Andersen M, et al. 1998. Matrix metalloproteinase 9 level predictsoptimal collagen deposition during early wound repair in humans.Br. J. Surg. 85(1):68–71.304. Ali S, Driscoll HE, Newton VL, Gardiner NJ. 2014. Matrix metalloproteinase-2 is downregulated insciatic nerve by streptozotocin induced diabetes and/or treatment with minocycline: Implicationsfor nerve regeneration.Exp Neurol 261:654–665.305. Mäkelä M, Larjava H, Pirilä E, et al. 1999. Matrix metalloproteinase 2 (gelatinase A) is related tomigration of keratinocytes.Exp. Cell Res. 251(1):67–78.306. Coussens LM, Fingleton B, Matrisian LM. 2002. Matrix metalloproteinase inhibitors and cancer:trials and tribulations.Science 295(5564):2387–2392.307. Giavazzi R, Garofalo A, Ferri C, et al. 1998. Batimastat, a synthetic inhibitor of matrixmetalloproteinases, potentiates the antitumor activity of cisplatin in ovarian carcinomaxenografts.Clin. Cancer Res. 4(April):985–992.308. Pierfitte C, Royer R. 1996. Tendon disorders with fluoroquinolones.Therapie 51:419–420.309. Rasmussen HS, McCann PP. 1997. Matrix metalloproteinase inhibition as a novel anticancerstrategy: A review with special focus on Batimastat and Marimastat.Pharmacol. Ther. 75(1):69–75.310. Drummond AH, Beckett P, Brown PD, et al. 1999. Preclinical and clinical studies of MMPinhibitors in cancer.Ann. N. Y. Acad. Sci. 878(44):228–235.311. Rzewnicki R, Vanden Auweele Y, De Bourdeaudhuij I. 2003. Addressing overreporting on theInternational Physical Activity Questionnaire (IPAQ) telephone survey with a populationsample.Public Health Nutr. 6(3):299–305.312. Montoye HJ, Kemper HGC, Saris WMH WR. 1996. Measuring PA and Energy Expenditure. In:Human Kinetics. Champaign, IL, USA.313. Malliaras P, Cook JL, Kent PM. 2007. Anthropometric risk factors for patellar tendon injury amongvolleyball players.Br. J. Sports Med. 41(4):259–263.314. Molloy T, Wang Y, Murrell GAC. 2003. The roles of growth factors in tendon and ligamenthealing.Sports Med. 33(5):381–394.179315. Rozmaryn. 2005. Tendinopathy in the workplace. In: Tendon Injuries: Basic Science and ClinicalMedicine. p 90–99.316. Buckle PW, Devereux JJ. 2002. The nature of work-related neck and upper limb musculoskeletaldisorders.Appl. Ergon. 33(3):207–217.317. Fedorczyk JM, Barr AE, Rani S, et al. 2010. Exposure-dependent increases in IL-1beta, substanceP, CTGF, and tendinosis in flexor digitorum tendons with upper extremity repetitive straininjury.J. Orthop. Res. 28(3):298–307.318. Maffulli N, Renstrom P, Leadbetter WB, editors. 2005. Tendon Injuries Basic Science and ClinicalMedicine. Springer-Verlag London Limited 2005.319. Descatha A, Dale AM, Jaegers L, et al. 2013. Self-reported physical exposure association withmedial and lateral epicondylitis incidence in a large longitudinal study.Occup. Environ. Med.70(9):670–673.320. Clement DB, Taunton JE, Smart GW. [date unknown]. Achilles tendinitis and peritendinitis:etiology and treatment.Am. J. Sports Med. 12(3):179–184.321. Alfredson H, Lorentzon R. 2000. Chronic Achilles tendinosis: recommendations for treatment andprevention.Sports Med. 29(2):135–146.322. Kujala UM, Sarna S, Kaprio J. 2005. Cumulative incidence of achilles tendon rupture andtendinopathy in male former elite athletes.Clin. J. Sport Med. 15(3):133–135.323. Skutek M, van Griensven M, Zeichen J, et al. 2001. Cyclic mechanical stretching enhancessecretion of Interleukin 6 in human tendon fibroblasts.Knee Surg. Sports Traumatol. Arthrosc.9(5):322–326.324. Maeda E, Tohyama H, Noguchi H, et al. 2010. Effects of maturation on the mechanical propertiesof regenerated and residual tissues in the rabbit patellar tendon after resection of its central one-third.Clin. Biomech. 25(9):953–958.325. Woo SL, Ohland KJ, Weiss J a. 1990. Aging and sex-related changes in the biomechanicalproperties of the rabbit medial collateral ligament.Mech. Ageing Dev. 56(2):129–142.326. Gaida JE, Cook JL, Bass SL. 2008. Adiposity and tendinopathy.Disabil. Rehabil. 30(20-22):1555–1562.327. Jiang D, Jiang Z, Han F, et al. 2008. HGF suppresses the production of collagen type III and alpha-SMA induced by TGF-beta1 in healing fibroblasts.Eur. J. Appl. Physiol. 103(5):489–493.328. Cui Q, Wang Z, Jiang D, et al. 2011. HGF inhibits TGF-C1-induced myofibroblast differentiationand ECM deposition via MMP-2 in Achilles tendon in rat.Eur. J. Appl. Physiol. 111(7):1457–1463.180329. Tillander B, Franzén L, Norlin R. 2002. Fibronectin, MMP-1 and histologic changes in rotator cuffdisease.J. Orthop. Res. 20(6):1358–1364.330. Gelberman RH, Steinberg D, Amiel D, Akeson W. 1991. Fibroblast chemotaxis after tendonrepair.J Hand Surg Am 16(4):686–693.331. Grinnell F, Billingham RE, Burgess L. 1981. Distribution of fibronectin during wound healing invivo.J Invest Dermatol 76(3):181–189.332. Grinnell F. 1984. Fibronectin and wound healing.J Cell Biochem 26(2):107–116.333. Yamanaka K, Fukuda H. 1991. Ageing process of the supraspinatus tendon with reference torotator cuff. In: Watson M, editor. Surgical disorders of the shoulder tears: rotator cuff disorders.Edinburgh: Churchill Livingstone; p 247–258.334. Kurkinen M, Vaheri A, Roberts P, Stenman S. 1980. Sequential appearance of fibronectin andcollagen in experimental granulation tissue.Lab Invest1 43(1):47–51.335. Josza L, Lehto M, Kannus P, et al. 1989. Fibronectin and laminin in Achilles tendon.Acta OrthopScand1 60(4):469–471.336. Järvinen TA, Jozsa L, Kannus P, et al. 1999. Mechanical loading regulates tenascin-C expression inthe osteotendinous junction.J. Cell Sci. 112 Pt 18:3157–3166.337. Schalkwijk J, Steijlen PM, van Vlijmen-Willems IM, et al. 1991. Tenascin expression in humandermis is related to epidermal proliferation.Am. J. Pathol. 139(5):1143–1150.338. Lightner V, Gunkowski F, Bigner D, Erickson H. 1989. Tenascin / Hexabrachion in Human Skin :Biochemical Identification an Localization by light and electron microscopy.J. Cell Biol.108(June):2483–2493.339. Riley GP, Harrall RL, Cawston TE, et al. 1996. Tenascin-C and human tendon degeneration.Am. J.Pathol. 149(3):933–943.340. Mackie EJ, Halfter W, Liverani D. 1988. Induction of tenascin in healing wounds.J. Cell Biol. 107(6II):2757–2767.341. Whitby DJ, Ferguson MW. 1991. The extracellular matrix of lip wounds in fetal, neonatal andadult mice.Development 112(2):651–668.342. Rettig W, Erickson H, Albino A, Garin-Chesa P. 1994. Induction of human tenascin (neuronectin)by growth factors and cytokines: cell-type specific signals and signalling.J Cell Sci 107:487–497.343. Taylor SE, Vaughan-Thomas A, Clements DN, et al. 2009. Gene expression markers of tendonfibroblasts in normal and diseased tissue compared to monolayer and three dimensional culturesystems.BMC Musculoskelet. Disord. 10(27).181344. Chiquet M. 1999. Regulation of extracellular matrix gene expression by mechanical stress.MatrixBiol. 18(5):417–426.345. Katsumi A, Orr WA, Tzima E, Schwartz MA. 2004. Integrins in mechanotransduction.J. Biol. Chem.279(13):12001–12004.346. Sai X, Naruse K, Sokabe M. 1999. Activation of pp60(src) is critical for stretch-induced orientingresponse in fibroblasts.J. Cell Sci. 112:1365–1373.347. MacKenna DA, Dolfi F, Vuori K, Ruoslahti E. 1998. Extracellular signal-regulated kinase and c-JunNH2-terminal kinase activation by mechanical stretch is integrin-dependent and matrix-specific inrat cardiac fibroblasts.J. Clin. Invest. 101(2):301–310.348. Brooks PC, Strömblad S, Sanders LC, et al. 1996. Localization of matrix metalloproteinase MMP-2to the surface of invasive cells by interaction with integrin αvβ3.Cell 85(5):683–693.349. Lohi J, Lehti K, Westermarck J, et al. 1996. Regulation of membrane-type matrixmetalloproteinase-1 expression by growth factors and phorbol 12-myristate 13-acetate.Eur. J.Biochem. 239(2):239–247.350. Knauper V, Will H, Lopez-Otin C, et al. 1996. Cellular mechanisms for human procollagenase-3(MMP-13) activation.J, Biol. Chem. 271(29):17124–17131.351. Salo T, Makela M, Kylmaniemi M. 1994. Expression of matrix metalloproteinase-2 and -9 duringearly human wound healing.Lab Invest 70(176).352. Overall CM, Wrana JL, Sodek J. 1991. Transcriptional and post-transcriptional regulation of 72-kDa gelatinase/type IV collagenase by transforming growth factor-beta 1 in human fibroblasts.Comparisons with collagenase and tissue inhibitor of matrix metalloproteinase gene expression.J.Biol. Chem. 266(21):14064–14071.353. Szomor ZL, Appleyard RC, Murrell GAC. 2006. Overexpression of nitric oxide synthases in tendonoveruse.J. Orthop. Res. 24(1):80–86.354. Dollery CM, McEwan JR, Wang M, et al. 1999. TIMP-4 is regulated by vascular injury in rats.Ann.N. Y. Acad. Sci. 878:740–741.355. Yang Z, Kyriakides TR, Bornstein P. 2000. Matricellular proteins as modulators of cell-matrixinteractions: adhesive defect in thrombospondin 2-null fibroblasts is a consequence of increasedlevels of matrix metalloproteinase-2.Mol. Biol. Cell 11(10):3353–3364.356. Sternlicht MD, Werb Z. 2001. How Matrix Metalloproteinases Regulate Cell Behavior.Annu. Rev.Cell Dev. Biol. 17:463–516.357. Mohammad G, Kowluru R a. 2011. Novel role of mitochondrial matrix metalloproteinase-2 in thedevelopment of diabetic retinopathy.Invest. Ophthalmol. Vis. Sci. 52(6):3832–3841.182358. Kawasaki Y, Xu Z-Z, Wang X, et al. 2008. Distinct roles of matrix metalloproteases in the early-and late-phase development of neuropathic pain.Nat. Med. 14(3):331–336.359. Tsai WC, Hsu CC, Chen CPC, et al. 2011. Ciprofloxacin up-regulates tendon cells to express matrixmetalloproteinase-2 with degradation of type I collagen.J. Orthop. Res. 29(1):67–73.360. Bedi A, Fox AJS, Kovacevic D, et al. 2010. Doxycycline-mediated inhibition of matrixmetalloproteinases improves healing after rotator cuff repair.Am. J. Sports Med. 38(2):308–317.361. Liu J, Xiong W, Baca-Regen L, et al. 2003. Mechanism of inhibition of matrix metalloproteinase-2expression by doxycycline in human aortic smooth muscle cells.J. Vasc. Surg. 38(6):1376–1383.362. Davis ME, Gumucio JP, Sugg KB, et al. 2013. MMP inhibition as a potential method to augmentthe healing of skeletal muscle and tendon extracellular matrix.J. Appl. Physiol. 115(6):884–891.363. Hidalgo M, Eckhardt SG. 2001. Development of matrix metalloproteinase inhibitors in cancertherapy.J. Natl. Cancer Inst. 93(3):178–193.364. Milner JM, Cawston TE. 2005. Matrix metalloproteinase knockout studies and the potential useof matrix metalloproteinase inhibitors in the rheumatic diseases.Curr. Drug Targets. Inflamm.Allergy 4(3):363–375.365. Bedi A, Kovacevic D, Hettrich C, et al. 2010. The effect of matrix metalloproteinase inhibition ontendon-to-bone healing in a rotator cuff repair model.J. Shoulder Elb. Surg. 19(3):384–391.366. Chetty C, Lakka SS, Bhoopathi P, Rao JS. 2010. MMP-2 alters VEGF expression via alphaVbeta3integrin-mediated PI3K/AKT signaling in A549 lung cancer cells.Int. J. Cancer 127(5):1081–1095.367. Skittone LK, Liu X, Tseng A, Kim HT. 2008. Matrix metalloproteinase-2 expression andpromoter/enhancer activity in skeletal muscle atrophy.J. Orthop. Res. 26(3):357–363.368. Kongsgaard M, Aagaard P, Kjaer M, Magnusson SP. 2005. Structural Achilles tendon properties inathletes subjected to different exercise modes and in Achilles tendon rupture patients.J. Appl.Physiol. 99(5):1965–1971.369. Artieda M, Cenarro A, Junquera C, et al. 2005. Tendon xanthomas in familialhypercholesterolemia are associated with a differential inflammatory response of macrophagesto oxidized LDL.FEBS Lett. 579(20):4503–4512.370. Eriksen HA, Pajala A, Leppilahti J, Risteli J. 2002. Increased content of type III collagen at therupture site of human Achilles tendon.J. Orthop. Res. 20(6):1352–1357.371. Kumagai J, Uhthoff HK, Sarkar K, Murnaghan JP. 1992. Collagen type III in rotator cuff tears: Animmunohistochemical study.J. Shoulder Elb. Surg. 1(4):187–192.183372. Langberg H, Ellingsgaard H, Madsen T, et al. 2007. Eccentric rehabilitation exercise increasesperitendinous type I collagen synthesis in humans with Achilles tendinosis.Scand. J. Med. Sci.Sports 17(1):61–66.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0215911/manifest

Comment

Related Items