Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Ocular melanocytes respond to oncogenic GNAQQ209L differently compared to epidermal and dermal melanocytes… Huang, Jenny Li-Ying 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_february_huang_jenny.pdf [ 104.55MB ]
Metadata
JSON: 24-1.0167641.json
JSON-LD: 24-1.0167641-ld.json
RDF/XML (Pretty): 24-1.0167641-rdf.xml
RDF/JSON: 24-1.0167641-rdf.json
Turtle: 24-1.0167641-turtle.txt
N-Triples: 24-1.0167641-rdf-ntriples.txt
Original Record: 24-1.0167641-source.json
Full Text
24-1.0167641-fulltext.txt
Citation
24-1.0167641.ris

Full Text

Ocular melanocytes respond to oncogenic GNAQQ209L differently compared to  epidermal and dermal melanocytes in mice by Jenny Li-Ying Huang B.Sc., The University of British Columbia, 2011   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2014  © Jenny Li-Ying Huang, 2014 ii  Abstract  Somatic mutations in the homologous human oncogenes GNAQ, and GNA11, are frequently found in ocular melanomas of the uvea, blue nevi of the dermis, and melanocytic neoplasias of the central nervous system (CNS), but rarely in cutaneous melanoma located in the epidermis (0.3%). The most common mutation found in GNAQ/11 is the amino acid substitution Q209L in the Ras-like GTPase domain. It causes complete or partial loss of intrinsic GTPase activity thereby locking the protein in a constitutively active form. To compare the downstream signal transduction effects of GNAQQ209L on melanocytes in different locations such as the dermis, the epidermis, ears, eyes and CNS, the mutant gene was conditionally knocked-in to the ubiquitous Rosa26 locus in mice to normalize gene expression among melanocytes. When expression of GNAQQ209L was induced in melanoblasts (immature melanocytes) during embryogenesis, the mice exhibit hyperpigmentation in the dermis of the tail, footpad, trunk, and ears beginning at a young age, with non-cutaneous melanocyte overgrowth in the inner ear and CNS, and metastatic uveal melanoma in older animals. In older adult mice, a progressive loss of melanocytes occurred in the inter-follicular epidermis, which could explain the lack of GNAQ mutations in human cutaneous melanomas located in the epidermis. When expression of GNAQQ209L was induced in mature melanocytes in adult, some of the above phenotypes such as hyperpigmentation in the dermal skin and uveal track thickening in the eyes were observed. When expression of GNAQQ209L was induced in bipotential Schwann cell precursors, there was a decrease in the number of melanoblasts, suggesting that GNAQQ209L blocks the production of melanoblasts from Schwann cell precursors.  iii  Altogether, I developed the first mouse uveal melanoma model driven by oncogenic mutant GNAQQ209L gene. These mice display all three types of lesions driven by constitutively active GNAQ in human: blue nevi, uveal melanoma, and invasive melanocytic neoplasias of the CNS. I show that the downstream effects of GNAQQ209L on melanocytes are strongly dependent upon cellular context, as seen in the differences presented in the epidermis, dermis, uveal and CNS melanocytes. iv  Preface  The research studies presented in this thesis was originally conceived and designed by Dr. Catherine D. Van Raamsdonk. The Rosa26-floxed stop-GNAQQ209L mouse allele was designed by Dr. Catherine Van Raamsdonk and constructed at inGenious Targeting Laboratory (Figure 3.1).  All results in Chapter 3 excluding the tail skin electron microscopy (Figure 3.5) have been submitted to a peer-reviewed journal on October 31, 2014 and we are currently awaiting reply. Dr. Pierre O. Garcin performed the electron microscopy imaging on mouse tail skins (Figure 3.5). I performed all the remaining experiments and analyzed all data presented in this thesis.   Ethics approval was obtained from the Animal Care Committee at the University of British Columbia for animal experiments (Protocol numbers: A09-0893, A11-0061 and A14-0060). Ear notching and weaning were performed by technicians at the Centre for Disease Modeling, UBC. Dr. Tara Arndt from the Animal Care Centre at UBC performed some of the necropsy and histopathological analysis. v  Table of Contents  Abstract .......................................................................................................................................... ii!Preface ........................................................................................................................................... iv!Table of Contents ...........................................................................................................................v!List of Tables .............................................................................................................................. viii!List of Figures ............................................................................................................................... ix!List of Abbreviations ................................................................................................................... xi!Acknowledgements .................................................................................................................... xiv!Chapter 1: Introduction ................................................................................................................1!1.1! The skin .............................................................................................................................. 1!1.2! Melanocyte and pigmentation ............................................................................................ 4!1.2.1! Melanocytes in the skin .............................................................................................. 4!1.2.2! Regulation of pigmentation ......................................................................................... 6!1.2.3! Melanocytes located in other parts of the body .......................................................... 9!Melanocytes in the eyes ...................................................................................................... 9!Melanocytes in the ears ..................................................................................................... 11!Melanocytes located in the cranium and other areas ........................................................ 13!1.3! Melanocyte development ................................................................................................. 14!1.3.1! Melanocyte origin ..................................................................................................... 14!Schwann cell precursors as an origin of melanocytes ...................................................... 15!Melanoblast specification ................................................................................................. 15!1.3.2! Transcription factors involved in melanocyte differentiation ................................... 18!vi  1.3.3! Signaling pathways involved in melanocyte differentiation ..................................... 18!1.4! Hyperactivity of GNAQ and GNA11 cause dark skin in mice ........................................ 19!1.4.1! Overview of heterotrimeric G proteins ..................................................................... 19!1.4.2! Dark skin mutants ..................................................................................................... 21!1.5! GNAQ and GNA11 are oncogenes ................................................................................... 22!1.5.1! GNAQ/11 and uveal melanoma ................................................................................ 22!Uveal melanoma overview ............................................................................................... 22!GNAQ/11 mutations in uveal melanoma .......................................................................... 22!1.5.2! GNAQ/11 mutations in the central nervous system (CNS) ....................................... 23!1.5.3! GNAQ/11 mutations in other types of melanocytic neoplasias ................................ 24!1.6! Other genes mutated in uveal melanoma ......................................................................... 24!1.7! Using Cre/LoxP for conditional mutagenesis .................................................................. 25!1.7.1! Cre/LoxP ................................................................................................................... 25!1.8! Thesis objectives .............................................................................................................. 26!Chapter 2: Materials and Methods ............................................................................................28!2.1! Mouse husbandry ............................................................................................................. 28!2.1.1! Mouse strains ............................................................................................................ 28!2.1.2! Production of Rosa26-floxed stop-GNAQQ209L mice ................................................ 28!2.1.3! Genotyping ................................................................................................................ 29!2.1.4! Tamoxifen induction of CreER activity .................................................................... 29!2.2! -Galactosidase staining ................................................................................................ 30!2.3! Electron microscopy of tail skin ...................................................................................... 30!2.4! Melanocyte primary cell culture ...................................................................................... 31!vii  2.5! Pyrosequencing ................................................................................................................ 32!2.5.1! Sample collection and processing ............................................................................. 32!2.5.2! Generation of biotinylated PCR products ................................................................. 32!2.6! Histology .......................................................................................................................... 33!2.6.1! Hematoxylin and eosin staining ................................................................................ 33!2.6.2! Immunohistochemistry ............................................................................................. 33!Eye .................................................................................................................................... 33!Cultured melanocytes ........................................................................................................ 34!2.7! Auditory brainstem response ........................................................................................... 34!2.8! Statistics ........................................................................................................................... 34!Chapter 3: Results ........................................................................................................................36!3.1! Introduction ...................................................................................................................... 36!3.2! Creation of the Rosa26-floxed stop-GNAQQ209L allele .................................................... 36!3.3! Skin pigmentation changes driven by GNAQQ209L induced by Mitf-cre .......................... 39!3.4! Uveal melanoma driven by GNAQQ209L induced by Mitf-cre .......................................... 49!3.5! GNAQQ209L driven melanoma metastasis and CNS overgrowth induced by Mitf-cre ..... 52!3.6! GNAQQ209L driven impairment of inner ear functioninduced by Mitf-cre ....................... 56!3.7! Rosa26-floxed stop-GNAQQ209L expression levels compared to endogenous Gnaq in melanocytes ............................................................................................................................... 59!3.8! GNAQQ209L driven hyperplasia induced by Tyr-creER in adult mice .............................. 61!3.9! GNAQQ209L effects in Schwann cell precursors ............................................................... 65!Chapter 4: Discussion ..................................................................................................................68!Bibliography .................................................................................................................................73!viii  List of Tables  Table 2.1Primers for pyrosequencing. .......................................................................................... 35!Table 3.1 Efficiency of Mitf-cre at P40. ....................................................................................... 42!Table 3.2 Individual results of auditory brainstem response (ABR) testing. ................................ 58!Table 3.3 Efficiency of Tyr-creER using a 5 day tamoxifen treatment at P71. ............................ 63! ix  List of Figures  Figure 1.1 Structure of the skin. ...................................................................................................... 3!Figure 1.2 Pigmentation differences in the inter-follicular skin between human and mouse. ........ 5!Figure 1.3 Pigment regulatory pathways. ....................................................................................... 8!Figure 1.4 Melanocytes in the eyes. .............................................................................................. 10!Figure 1.5 Melanocytes in the ears. .............................................................................................. 12!Figure 1.6 Melanocytes develop from neural-crest cells (NCC). ................................................. 17!Figure 3.1 A conditional GNAQQ209L allele engineered at theRosa26 locus. ............................... 38!Figure 3.2 Mitf-cre and Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice exhibit reduced body weight........................................................................................................................................................ 43!Figure 3.3 Gross morphology of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. .............................. 44!Figure 3.4 Histology of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. .............................................. 45! Figure 3.5 Electron microscopy of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. ........................... 46!Figure 3.6 Melanocyte loss in the inter-follicular epidermis of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. .................................................................................................................................... 47!Figure 3.7 Coat graying is observed in 5 month-old Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. 48!Figure 3.8 Uveal melanoma in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. ................................ 50!Figure 3.9 Immunohistochemistry of uveal melanoma in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. .............................................................................................................................................. 51!Figure 3.10 Metastasis in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. ......................................... 53!Figure 3.11 Hyper-pigmentation in the brain of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. ...... 54!x  Figure 3.12 Hyperpigmentation of spinal cord meninges in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. .............................................................................................................................................. 55!Figure 3.13 GNAQQ209L expression induced by Mitf-cre causes deafness in mice. ...................... 57!Figure 3.14 Rosa26-fs-GNAQQ209L is expressed at a higher level as compared to endogenous Gnaq in cultured melanocytes. ..................................................................................................... 60!Figure 3.15 Melanocytic overgrowth driven by Rosa26-fs-GNAQQ209L induced with Tyr-creER........................................................................................................................................................ 64!Figure 3.16 Rosa26-fs-GNAQQ209L expression induced with Plp1-creER inhibits melanoblast production. .................................................................................................................................... 67! xi  List of Abbreviations 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-gal) α melanocyte stimulating hormone (αMSH) Adrenocorticotropic hormone (ACTH) Agouti signaling peptide (Asip) Auditory brainstem response (ABR) B-cell lymphoma 2 (Bcl2) Basic helix-loop-helix leucine zipper (b-HLH-Zip) Bone morphogenic protein (BMP) BRCA1-associated protein-1 (BAP1) B-Raf proto-oncogene (BRAF) Catalogue of Somatic Mutations in Cancer (COSMIC) cAMP responsive-element-binding protein (CREB) Central nervous system (CNS) Chronically sun damaged (CSD) Cyclic adenosine monophosphate (cAMP) Dark skin (Dsk) Diacyl glycerol (DAG) Dihydroxyphenylalnine (L-Dopa) Dopachrome tautomerase (Dct/Tyrp2) Embryonic stem (ES) Endocochlear potential (EP) Endothelin-3 (Edn3) xii  Endothelin-B receptor (Ednrb) Epithelial-to-mesenchymal transition (EMT) Extracellular matrix (ECM) Extracellular signal-regulated kinase (ERK) G-protein-coupled receptors (GPCRs) Homeobox transcription factor (Hmx1) Inositol 1,4,5-trisphosphate (IP3) Kit ligand (Kitl/SCF/Mgf/Steel) Lipocalin-type prostaglandin D synthase (L-PGDS) Locus of crossing [x] over P (LoxP) Lymphoid enhancer-binding factor 1 (Lef1/TCF) Mammalian target of rapamycin (mTor) Mast cell growth factor (Mgf/Kitl/SCF/Steel) Melanocortin 1 receptor (Mc1r) Microphthalmia transcription factor (Mitf) Mitogen-activated protein kinase (MAPK) Mitogen-activated protein-kinase kinase (MEK/MAPKK) N-ethyl-N-nitrosourea (ENU) Neural-crest cells (NCC) Neuregulin 1 (NRG1) Neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS) Optimal cutting temperature (OCT) Paired-box 3 (Pax3) xiii  Peripheral nervous system (PNS) Phosphatidylinositol 4, 5-bisphophate (P1P2) Phospholipase C (PLC) Photodynamic therapy (PDT) Protein kinase C (PKC) Proteolipid-protein 1 (Plp1) Reactive oxygen species (ROS) Retinal-pigmented epithelium (RPE) Schwann cell precursors (SCP) Sex-determining region Y (Sry)-box 10 (Sox10) Short interfering RNAs (siRNAs) Splicing factor 3B subunit 1 (SF3B1) Standard error of mean (SEM) Stem cell factor (SCF/Kitl/Mgf/Steel) Transgenic (tg) Tyrosinase (Tyr) Tyrosinase kinase receptor Kit (c-kit) Tyrosinase-related protein-1 (Tyrp1) Tyrosine-protein kinase erbB-2 (ErbB2) Tyrosine-protein kinase erbB-3 (ErbB3) Wing-less type (Wnt) X-linked eukaryotic translation initiation factor 1A (EIF1AX) Yes-associated protein 1 (YAP/YAP1/YAP65) xiv  Acknowledgements  First I would like to express my gratitude to my supervisor Dr. Catherine D. Van Raamsdonk for her guidance and support throughout my degree. I would also like to thank her for her patience and help during the preparation of the manuscript and thesis. I am grateful to my committee members Dr. Elizabeth M. Simpson and Dr. Gregg Morin for their insights and helpful feedback regarding my project. I would like to thank Dr. Philippe Soriano (Icahn School of Medicine) for the gift of the pROSA26-1 plasmid, Dr. Gregory S. Barsh (Stanford University) for the gift of the Mitf-cre mice, Dr. Marcus Bosenberg (Yale University) for the gift of the Tyr-creER mice, and Dr. Ian Jackson (Institute of Molecular Medicine) for the gift of the Dct-LacZ mice. Without their help, this project would have not been possible. I would also like to thank Ailan Lu (inGenious Targeting Laboratory) for the construction of the Rosa26-floxed stop-GNAQQ209L mouse allele. I am very grateful to the technicians at the Centre for Disease Modeling (University of British Columbia); I would like to especially thank Elena Bernardi and Erin Limber for their hard work.  I want to thank all present and past members of the Van Raamsdonk lab, especially Grace T. Tharmarajah for her encouragement and support throughout. I am grateful to Aaron Bogutz and Karen Jacob from the Lefebvre lab for offering valuable advice and techniques that were beneficial to my project. I thank Christine Yang from the Brown lab for helping me with pyrosequencing.  I thank Dr. Pierre O. Garcin for his help with electron microscopy and for providing helpful discussions in regards to my project.   Last but not least, I thank my friends and family for their support during my time as a graduate student.  I am forever grateful to my grandparents for always being there for me. I thank my mother and father for believing in me, they have truly been my source of comfort. 1  Chapter 1: Introduction  1.1 The skin The mammalian skin is the largest organ of the body, and it serves as a mechanical barrier to the damages introduced from the outside environment. The skin forms an active barrier that prevents water loss, and protects from ultraviolent radiation, physical trauma and toxic reagents, and is the first line of defense against pathogens (Fuchs and Raghavan, 2002; Pasparakis et al., 2014). The skin consists of three major components, the epidermis, the dermis, and the hypodermis (subcutaneous tissues) (Figure 1.1) (Quevedo and Holstein, 2007).  The epidermis is a stratified squamous epithelia that is composed of five cell layers and consists primarily of keratinocytes and melanocytes (Costin and Hearing, 2007). The stratum basale (also known as the stratum germinativum) is a single cell layer that is attached to the non-cellular basement membrane that divides the epidermis from the dermis (Costin and Hearing, 2007). This basal layer consists mostly of basal keratinocytes, which proliferate to generate cells that undergo keratinocyte maturation (keratinization) and forms the different outer layers (Fuchs, 2007). Within the basal layer also reside two different types of neural crest-derived cells: melanocytes and Merkel cells (Costin and Hearing, 2007). Melanocytes are pigment-producing cells that transfer melanosomes (which contain melanin) through their dendrites to keratinocytes, where they can effectively absorb ultraviolet radiation from the outside environment, thus reducing UV-induced DNA damage (Costin and Hearing, 2007). Merkel cells are neuroendocrine cells that function as part of the somatosensory apparatus, which can transmit sensory information such as temperature, pressure, pain, and vibration (Fradette et al., 2003; 2  Moll et al., 2005). Langerhans cells also exist in the epidermis and their primary function as antigen-presenting cells is to regulate the immune reactions in the skin (Costin and Hearing, 2007). Hair follicles are epidermal appendage composed of keratinocytes that produce hair keratins (Fuchs, 2007).  The dermis provides structural support for the skin with its abundant loose connective tissues (Ouevedo et al. 2007 ref). It is composed primarily of fibroblast cells, which are responsible for the synthesis and degradation of the extracellular matrix (ECM) (Costin and Hearing, 2007). The dermis is host to many multifunctional cells of the immune system such as mast cells and macrophages, as well as somatosensory cells such as Merkel cells (Costin and Hearing, 2007; Moll et al., 2005). In some mammals such as mice, melanocytes are present in the dermis, but do not transfer their melanosomes (Quevedo and Holstein, 2007). The dermis also contains an extensive network of sensory and autonomic nerve fibers, Schwann cells, excretory and secretory glands, such as sweat and sebaceous glands (Costin and Hearing, 2007).   The final layer of the skin is the hypodermis (subcutaneous tissue); it serves as an important fat storage and is composed primarily of loose connective tissue, adipocytes and blood vessels (Quevedo and Holstein, 2007). The function of this layer is to provide cushioning and thermoregulation through insulation (Quevedo and Holstein, 2007).   3   Figure 1.1 Structure of the skin. The skin is composed of three main layers: the epidermis, the dermis, and the hypodermis. The epidermis is a stratified squamous epithelia that consists primarily of keratinocytes, melanocytes, Langerhans cells, and immune cells. The dermis contains fibroblasts, macrophages, dermal dendritic cells (DC), Schwann cells, immune cells and in some mammals such as mice, melanocytes. The dermis also contains sweat glands, and blood vessels. The hypodermis contains adipose tissue, blood vessels, lymphatic vessels and nerves.    4  1.2 Melanocyte and pigmentation 1.2.1 Melanocytes in the skin In the mammalian pigmentary system, melanocytes can be found in the dermis, inter-follicular epidermis and/or hair follicles. In mice, melanocytes are located in both the dermis and the epidermis of the glabrous skin (ears, foot, and tail). However, in the non-glabrous skin (rest of the body) melanocytes are located in the hair follicles with sparse number in the dermis and no melanocytes in the inter-follicular epidermis. In humans, melanocytes are located in the epidermis in both the glabrous and non-glabrous skin. Dermal melanocytes are not normally found in humans, but there are many several types of dermal melanocytosis such as blue nevi and nevus of Ota (Gleason et al., 2008) (Figure 1.2).   5   Figure 1.2 Pigmentation differences in the inter-follicular skin between human and mouse. In glabrous skin of mice (ears, foot, and tail), there are melanocytes in both the epidermis and dermis. However in non-glabrous skin of humans, melanocytes can be found in only the epidermis. In non-glabrous skin in mice, melanocytes are sparsely present in the dermis. In human non-glabrous skin, melanocytes are found only in the epidermis.    6  1.2.2 Regulation of pigmentation Melanocytes synthesize two different types of melanin, eumelanin and pheomelanin, within a membrane-bound organelle called melanosomes (Jablonski, 2004). Eumelanin is black or brown and pheomelanin is red or yellow (Thody et al., 1991). Three main enzymes are known to be involved in the melanin biosynthesis process in mammals: tyrosinase (Tyr), tyrosinase-related protein-1 (Tyrp1) and dopachrome tautomerase (Dct, also known as Tyrp2) (Kobayashi et al., 1994). The first step of melanin biosynthesis is catalyzed by tyrosinase; oxidizing L-tyrosine to dihydroxyphenylalnine (L-Dopa) (Slominski et al., 2004). Following this step, L-Dopa is oxidized to dopaquinone and can be used in a series of oxidoreduction reactions to produce both types of melanin (Slominski et al., 2004).  Further metabolism of dopaquinone involving Tyrp1 and Dct results in the synthesis of eumelanin (Costin and Hearing, 2007). The synthesis of pheomelanin also begins with dopaquinone but requires amino acid cysteine or glutathione to yield cyestinyldopa and glutathionyldopa in the transformation (Costin and Hearing, 2007).  Eumelanogenesis requires a greater level of tyrosinase activity, whereas a lower level of tyrosinase activity is sufficient for pheomelanogensis (Scherer and Kumar, 2010) (Figure 1.3). The ratio of eumelanin and pheomelanin synthesis is also governed through the signaling of melanocortin 1 receptor (Mc1r), a G-protein coupled receptor that mediates tyrosinase activity (Lin and Fisher, 2007). Mc1r is coupled to adenylyl cyclase and when it binds to an agonist, such as α melanocyte stimulating hormone (αMSH) or adrenocorticotropic hormone (ACTH), it increases the production of cyclic adenosine monophosphate (cAMP) in the cell and in turn stimulates eumelanin production (Lin and Fisher, 2007). In contrast, binding of an antagonist of Mc1r such as the agouti signaling peptide (Asip) results in pheomelanin synthesis (Lin and Fisher, 2007).  7  The production of cAMPalso leads to the phosphorylation of cAMP responsive-element-binding protein (CREB) transcription factor family members (Lin and Fisher, 2007). CREB then transcriptionally activate various genes, including microphthalmia transcription factor (Mitf) (Levy et al., 2006). Mitf is known as a master regulator in melanocyte development, regulating expressions of many important melanocyte genes such as Mc1r, Dct, Tyrp1, Tyr, endothelin-B receptor (Ednrb) and B-cell lymphoma 2 (Bcl2) (Levy et al., 2006; Lin and Fisher, 2007).   8   Figure 1.3 Pigment regulatory pathways. Melanocytes synthesize two different types of melanin, eumelanin, which is black/brown and pheomelanin, which is red/yellow. Melanocytes in the epidermis transfer melanosomes to keratinocytes via phagocytosis.   9  1.2.3 Melanocytes located in other parts of the body Melanocytes are also found in the eyes, inner ears, brain, and more esoteric locations in mammals.   Melanocytes in the eyes Melanocytes in the eye reside in the uveal tract (consisting of iris, ciliary body, and choroid) (Bharti et al., 2006) (Figure 1.4). Melanocytes in the iris give rise to the eye color. The melanocytes residing in the choroid are thought to protect against oxidative damage (Colombo et al., 2011). The choroid is highly vascularized and is the major supply of oxygen to the outer retina (Nickla and Wallman, 2010). Melanocytes are also found in the Harderian gland, a structure surrounding the orbit of the eye and may play a role in photoreception (Payne, 1994).  The retinal-pigmented epithelium (RPE) is composed of neurons, which produce pigment, and is generated directly from the optic neuroepithelium during development (Bharti et al., 2006). During embryogenesis, RPE cells contribute to iris and ciliary body formation, retinal neurogenesis, ganglion cell projections, control the closure of the optic fissure and are involved in the regulation of the chorodial vasculature (Chow and Lang, 2001). The RPE has many functions, such as the absorbance of stray light, the maintenance of the retina in a proper state of dehydration (net movement of ions and water in the retinal to choroidal direction) and the responsibility of phagocytosis and turnover of rod and cones (Bok, 1993).  10   Figure 1.4 Melanocytes in the eyes. Neural crest-derived melanocytes populate the iris, ciliary body and choroid, which compose the uveal tract of the eye. At the back of the eye, a specialized pigmented monolayer, the retinal-pigmented epithelium (RPE), lies adjacent to the choroid. The RPE is not derived from the neural crest but directly from optic neuroepithelium during embryogenesis.    11  Melanocytes in the ears Melanocytes present in the inner ear are called intermediate cells. Intermediate cells are similar to melanocytes and arise from the neural crest, whose development requires expression of the Microphthalmia associated transcription factor (Mitf), the Paired-box 3 transcription factor (Pax3), the Sex-determining region Y (Sry)-box 10 transcription factor (Sox10) and tyrosinase kinase receptor Kit (c-kit) genes (Cable et al., 1994; Hozumi et al., 2012; Kim et al., 2014b; Navarrete et al., 1995; Wakaoka et al., 2013). The intermediate cells are located in the cochlea and vestibular structures (Meyer zum Gottesberge, 1988) (Figure 1.5). The intermediate cells present in the cochlea, the organ responsible for hearing, are located within the stria vascularis and the modiolus (Cable and Steel, 1991). The stria intermediate cells express ion channels and are responsible for the generation of potassium-rich endolymph, which has a positive resting or endocochlear potential (EP) (80-100 mV) thus creating action potentials (Cable and Steel, 1991). Changes in the potential in response to sound triggers hair cells to release neurotransmitters that excite afferent nerves, which is required for normal hearing. In the modiolus, intermediate cells are located in the perivascular and perinuclear spaces (Meyer zum Gottesberge, 1988). The intermediate cells in the vestibular structure are present in basement membrane between the connective tissue cells and are known to play an important role in equilibrium functions such as maintaining proper balance (Meyer zum Gottesberge, 1988; Mota and Santos, 2010). Hearing impairment is associated with various types of hypopigmentation disorders such as Waardenburg syndrome, Tietz syndrome and Vogt-Koyanagi-Harada syndrome where one or more of several important transcription factors for melanocyte development are reduced (Takeda et al., 2007). In particular, the destruction of melanocytes found in the inner ear in Vogt-Koyanagi-Harada syndrome cause a variety of hearing and balance disorders (Mota and Santos, 2010).  12  Figure 1.5 Melanocytes in the ears. Melanocyte-like cells called intermediate cells exist in the vestibular structure and cochlea of the inner ear. The intermediate cells in the stria vascularis in the chochlea express ionic channels and are responsible for the generation of potassium-rich endolymph, which has a positive resting or endocochlear potential (EP) (80-100 mV) thus creating action potentials that are required for normal hearing. 13  Melanocytes located in the cranium and other areas Melanocytes in the brain are found in the sympathetic cephalic ganglion, leptomeninges, and cerebral capillaries (Colombo et al., 2011). The leptomeninges, a thin layer of membranes, which protect the brain, contain melanocytes concentrated over the ventral aspect of the medulla oblongata (Goldgeier et al., 1984). These resident leptomeningeal melanocytes are responsible for the development of pathological conditions in the central nervous system (CNS) such as meningeal melanocytoma, neurocutaneous melanosis, and primary melaningeal melanoma (Smith et al., 2009). Leptomeningeal melanocytes may have euroendocrine and detoxification functions (Takeda et al., 2007). For example, epidermal melanocytes produce lipocalin-type prostaglandin D synthase (L-PGDS), a potent inducer of sleep, and β-endorphin, an endogenous opioid that regulates respiratory rhythm (Takeda et al., 2007). There is also a type pigment in the brain, called neuromelanin, which is found in dopaminergic neurons of the substantia nigra and in the locus coerulus. Neuromelanin accumulates in the substantia nigra with age (Zecca et al., 2002). Neuromelanin has an unique spherical structure and is composed of a pheomelanin core covered with eumelanin (Zecca et al., 2002). Studies have shown that neuromelanin removes reactive oxygen species (ROS) and heavy metals that could be toxic to neurons (Zecca et al., 2008a; Zecca et al., 2008b; Zecca et al., 2002; Zecca et al., 2004). The loss of neurons containing neuromelanin is associated with neurodegenerative disease, such as Parkinson’s disease, Alzheimer’s disease and Rett syndrome (Zecca et al., 2008b).  Melanocytes have also been found in the valves and the septa of the heart (Yajima and Larue, 2008). Studies show an association between skin color and the amount of cardiac pigmentation (Yajima and Larue, 2008). While these melanocytes require some of the same transcription 14  factors as skin melanocytes such as, Mitf, c-kit, and Tyr, their function in the heart is still unknown (Yajima and Larue, 2008).   1.3 Melanocyte development 1.3.1 Melanocyte origin Origin of migration of melanocytes Melanocytes develop from neural-crest cell precursors. These specialized pluripotent cells arise from the dorsal aspect of the neural tube (Parichy et al., 2007). Through the presence of different cell surface receptors, adhesion molecules and metallopeptidases, the neural-crest cells (NCCs) give rise to melanocytes, neurons, glial cells, adrenal medulla, cardiac cells, and craniofacial tissues (Le Douarin et al., 2004). During the closing of the neural tube around E9.5, melanoblasts are induced by Bone morphogenic protein (BMP) and Wing-less type (Wnt) signaling (Adameyko et al., 2009). These melanoblasts (immature melanocytes) then migrate along the dorsolateral pathway between the dermamyotome and the ectoderm (Lin and Fisher, 2007). Another wave of cells migrate along the ventral medial pathway between the neural tube and the sclerotome become sensory neurons and glial cells of the peripheral nervous system (PNS), including Schwann cells (Figure 1.6) (Adameyko and Lallemend, 2010). Schwann cell precursors (SCP) also give rise to melanoblasts, beginning around embryonic day (E)11.5 (Adameyko and Lallemend, 2010; Adameyko et al., 2009).  Initially, melanoblasts migrate through the developing dermis (Mackenzie, 1997). At E12.5, a subset of melanoblasts invade the epidermis (Lin and Fisher, 2007; Mackenzie, 1997). By E16.5, 15  melanocytes in the epidermis start to enter and populate the developing hair follicles (Lin and Fisher, 2007; Mackenzie, 1997).  Schwann cell precursors as an origin of melanocytes Schwann cell precursors (SCPs) are neural crest-derived cells that are found along peripheral nerves during embryogenesis (Jessen and Mirsky, 2005). SCPs are highly dependent on nerve contact for their survival and in time will mature to give rise to Schwann cells (Jessen and Mirsky, 2005). Some SCPs at the nerve terminals detach from the nerve start to express melanocyte specific transcription factors, and develop into melanocytes (Adameyko et al., 2009). Melanocytes in hair follicles, and dermis can be fate mapped by the SCPs expressed Proteolipid protein 1-cre (Plp1-cre) transgene (Adameyko et al., 2009) (Figure 1.6).  Melanoblast specification Neural-crest cells (NCCs) are multipotent and, depending on their location and environment, these cells become neural cells or non-neural cells such as melanocytes, smooth muscle cells, connective tissue, cartilage and craniofancial bones (Woodhoo and Sommer, 2008). The early induction of NCCs begins with BMP signaling (Woodhoo and Sommer, 2008). NCCs then undergo an epithelial-to-mesenchymal transition (EMT), down regulating cell adhesion molecules such as E-cadherin to allow migration (Woodhoo and Sommer, 2008). Notch activation also plays a very important role in NCCs. For example, notch signaling in pre-migratory NCCs in the trunk prevents them from adopting a neuronal fate, thus preserving an unspecified fate(Cornell and Eisen, 2002). Wnt signaling is also a key player for NCC induction and the activation of beta-catenin promotes a melanocyte fate as opposed to a glial fate (Dorsky 16  et al., 1998). In vitro, it was observed that Wnt signaling promotes the differentiation of melanoblasts (White and Zon, 2008).  SCPs migrate along developing peripheral nerves. The loss of contact with peripheral nerves during development is critical for SCPs to develop a melanoblast fate (Adameyko and Lallemend, 2010). In chick embryos, the knock-down of homeobox transcription factor (Hmx1) using short interfering RNAs (siRNAs) leads to a near complete loss of neurogenesis, but increase of the number of glial cells and melanoblasts (Adameyko et al., 2009). Early on, neuregulin 1 (NRG1) signaling increases proliferation of SCPs (Jessen and Mirsky, 2005). NRG1 signals through receptor tyrosine-protein kinase erbB-2 (ErbB2) and ErbB3 heterodimer complex (Adameyko et al., 2009). The deletion of ErbB3 causes a decrease in the overall number of SCPs with an increased number of melanoblasts around the dorsal spinal nerves at E12 (Adameyko et al., 2009). This shows that NRG1 is required for proliferation, migration and survival of SCPs but suppresses melanocyte differentiation (Adameyko et al., 2009). In another experiment by Adameyko et al., they looked at regions where SCP-derived melanoblasts cluster (the otic vesicle, by the midbrain and hindbrain) in embryos without ErbB3 and observed a decrease in the number of melanocytes near the otic vesicle (Adameyko et al., 2012). ErbB3 signaling between nerve and SCPs balance melanocyte versus glial fate.  17   Figure 1.6 Melanocytes develop from neural-crest cells (NCC). A. Early NCC development. Melanoblasts migrate via the dorsolateral route under the epidermis (red). Neurons and glial migrate along the ventral-medial pathway between the neural tube and the dermamyotome (blue). B. Later NCC development. Melanoblasts directly derived from the dorsal neural tube (1). Melanoblasts derived from SCP’s (2). DRG, dorsal root ganglion; N, notochord; NT, neural tube; S, somites (Adapted from Adameyko et al., 2009).   18  1.3.2 Transcription factors involved in melanocyte differentiation Key genes involved in the process of determining melanocyte cell fate include the Microphthalmia associated transcription factor (Mitf), the Paired-box 3 transcription factor (Pax3), the Sex-determining region Y (Sry)-box 10 transcription factor (Sox10) and the lymphoid enhancer-binding factor 1 transcription factor (Lef1, also known as TCF) (Levy et al., 2006; Lin and Fisher, 2007; Thomas and Erickson, 2009). While many genes play important roles in melanocytes, Mitf is often referred to as the master regulator (Levy et al., 2006). Mitf is a basic helix-loop-helix leucine zipper (b-HLH-Zip), a dimeric transcription factor (Levy et al., 2006). In mice, Mitf deletion causes albinism, and defects in the RPE, osteoclasts, and mast cells (Levy et al., 2006). Mitf regulates melanocyte development, function, and survival via various differentiation and cell-cycle progression genes under its transcription control (Levy et al., 2006). Mitf is expressed prior to migration on the dorsolateral pathway and marks the specification of melanoblasts from unspecified NCCs (Thomas and Erickson, 2008). Mitf also regulates the expression of genes that are required for melanogenesis, including Tyrp, Tyrp-1, and Dct (Thomas and Erickson, 2008). Sox10 and Pax3 are expressed in the dorsal neural tube before the first NCCs start migrating and are important for melanocytes, as well as other NC lineages (Thomas and Erickson, 2008). The binding of Wnt proteins to its receptors results in the interaction of beta-catenin with Lef1 transcription factor, which activates the Mitf promoter (Levy et al., 2006).  1.3.3 Signaling pathways involved in melanocyte differentiation Several signaling pathways have been associated with melanocyte differentiation and migration in development including the G-coupled endothelin B receptor (Ednrb) and its ligand endothelin-19  3 (Edn3), and the tyrosinase kinase receptor Kit (c-kit) and its ligand, Kitl (also known as Steel, stem cell factor (SCF) or mast cell growth factor (Mgf)) (Hou et al., 2000). In mice, Edn3 is essential between E10.5-E12.5 for melanoblast survival and differentiation; its absence during this period results in an almost complete loss of melanocytes (Lee et al., 2003). Edn3 is not needed after this period for normal coat pigmentation (Shin et al., 1999). This suggests that endothelin signaling is not required for the initial specification melanoblasts, but is crucial for survival and proliferation of melanoblasts between E10.5-E12.5 while they are migrating in the dermis (White and Zon, 2008).  Mutation of c-kit or Kitl results in pigment deficiencies in both human and mice (White and Zon, 2008). Kitl expression stimulates survival, proliferation, and migration of melanoblasts (Kunisada et al., 1998). In addition, Kit signaling is involved in melanoblast invasion of the epidermis (Lin and Fisher, 2007). Mature melanocytes in the epidermis require c-kit for survival and proliferation, while melanocyte stem cells in the hair follicles are Kit-independent (Kawaguchi et al., 2008; Lin and Fisher, 2007; Yoshida et al., 2001).  1.4 Hyperactivity of GNAQ and GNA11 cause dark skin in mice 1.4.1 Overview of heterotrimeric G proteins Heterotrimeric G proteins turn on intracellular signaling cascades in the response to the activation of G-protein-coupled receptors (GPCRs) by cellular stimuli (Oldham and Hamm, 2008). All GPCRs have seven transmembrane-α-helices, an intracellular N terminus and an extracellular N terminus and three inter-helical loops on each side of the membrane (Oldham and Hamm, 2008). In humans, there are 21 G-α-subunits, 6 β-subunits and 12 γ-subunits (Downes 20  and Gautam, 1999). During signaling, GDP-bound alpha subunits are stimulated by ligand binding to GPCRs, which causes the alpha subunits to release GDP, bind GTP, and assume an active conformation that can interact with downstream effectors. Using an intrinsic Ras-like GTP hydrolysis (GTPase) domain, the alpha subunit cleaves the gamma phosphate from the GTP molecule to produce GDP and return the alpha subunit to its inactive conformation (Markby et al., 1993). The G-α-subunit together with the bound GTP can then dissociate from the β-subunit and γ-subunit to activate the downstream intracellular signaling proteins (Wettschureck and Offermanns, 2005). Heterotrimeric alpha subunits are divided into four main classes based on sequence similarity: Gαs, Gαi, Gα12 and Gαq (Wettschureck and Offermanns, 2005). Further, there are four members of the Gαq class: GNAQ is ubiquitously expressed in all tested tissues, GNA11 is ubiquitously expressed in all tested tissues except platelets, GNA14 and GNA15/16 is expressed various tissues such as stomach, small intestine, kidney and the skin (Uhlen et al., 2005; Wettschureck and Offermanns, 2005)  GNAQ and GNA11 are 90% identical at the amino acid level and play redundant roles; knocking out any three Gnaq and Gna11 alleles is lethal in mice (Offermanns et al., 1998). Both proteins activate phospholipase C (PLC), which cleaves phosphatidylinositol 4, 5-bisphophate (P1P2) into diacyl glycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). While IP3 is released as a soluble molecule into the cytosol, DAG remains bound to the membrane. Both compounds act as secondary messengers that amplify downstream signaling events, such as the activation of protein kinase C (PKC) and release of intracellular calcium.  21  1.4.2 Dark skin mutants In the 1990’s, several large-scale mutagenesis screens produced a number of new mouse mutants. A N-ethyl-N-nitrosourea (ENU) chemical mutagenesis screen of C3HeB/FeJ mice in Germany recovered 10 mutants with dark skin on the ears, foot, and tail. These were named Dark skin (Dsk 1-10) (Fitch et al., 2003). In all but one mutant, only the epidermis or dermis was affected, not both (Deo et al., 2013; Fitch et al., 2003). Among the dermal dark skin mutants, Dsk1, Dsk7 and Dsk10 are indistinguishable (Van Raamsdonk et al., 2004). Through genetic analysis, it was determined that these three mutations represent gain-of-function alterations: V179M (Gnaq, Dsk1), F335L (Gnaq, Dsk10), and I63V (Gna11, Dsk7) (Van Raamsdonk et al., 2004). Dsk1 and Dsk7 cause an increase in the number of melanoblasts in the dermis beginning at E10.5 (Van Raamsdonk et al., 2004). Dsk1, Dsk7, and Dsk10 are hypermorphic mutations which probably decrease the ability of the alpha subunit to hydrolyze GTP, leaving the protein in an active state longer, thus sending an enhanced signal through downstream components (Van Raamsdonk et al., 2004).  To further investigate Gnaq/11’s involvement in dermal pigmentation, Van Raamsdonk et al. examined the mutational status of GNAQ and GNA11 in various human melanocytic lesions (2009, 2010). Somatic constitutively active mutations in GNAQ and GNA11 were found in blue nevi, and both primary and metastatic uveal melanoma (Van Raamsdonk et al., 2009; Van Raamsdonk et al., 2010). Melanocyte cell lines transduced with the constitutively active forms of GNAQorGNA11exhibit an increase in mitogen activated protein kinase (MAPK) signaling and are tumorigenic in nude mice (Van Raamsdonk et al., 2009; Van Raamsdonk et al., 2010).   22  1.5 GNAQ and GNA11 are oncogenes 1.5.1 GNAQ/11 and uveal melanoma Uveal melanoma overview Uveal melanoma, a malignancy of melanocytes in the uveal tract of the eye is the most common intraocular malignancy in adults, with a 10-year cumulative metastatic rate of 34% (Pereira et al., 2013). The most common site of metastasis is the liver with secondary site being the lungs (Buzzacco et al., 2012). Prognosis for metastatic uveal melanoma is poor with the mortality rate of 87% within 1 year and increasing to 92% at 2 years (Buzzacco et al., 2012). Currently, there are no effective treatment options due to lack of effective systemic therapy. Options for primary uveal melanoma include enucleation to remove the eye, and more conservative treatments, such as photodynamic therapy (PDT) to preserve vision in less advanced cases (Pereira et al., 2013).  GNAQ/11 mutations in uveal melanoma Mutations in GNAQ and GNA11 occur with a mutually exclusive, combined frequency of ~80% in both class I and the more aggressive class II uveal melanomas (Martin et al., 2013; Van Raamsdonk et al., 2010). There are two oncogenic hotspots in GNAQ and GNA11: glutamine (Q)209 and arginine (R)183(Van Raamsdonk et al., 2009; Van Raamsdonk et al., 2010). Q209 and R183 lie in the GTPase domain and directly position the gamma phosphate for cleavage (Sondek et al., 1994). Substitution mutations at these two highly conserved residues allow for GTP binding, but greatly reduce the rate of GTP hydrolysis, therefore generating constitutive active signaling (Landis et al., 1989; Weinstein et al., 1991). In uveal melanoma, mutations at Q209 are found 13 times more frequently than mutations at R183 (Van Raamsdonk et al., 2010). Q209 mutations are also slightly more potent in tumorigenesis assays in nude mice injected with 23  transformed cells (Van Raamsdonk et al., 2010). Although it has been suggested that GNAQ/11 activates the MAPK pathway, the actual mechanism of action is not clear (Van Raamsdonk et al., 2009). In a series of recent studies, it was reported that GNAQ/11 mutations in uveal melanoma promotes tumorigenesis by activating the transcriptional coactivator Yes-associated protein (YAP) in the Hippo tumor suppressor pathway (Field and Harbour, 2014a; Field and Harbour, 2014b; Yu et al., 2014). These findings suggest perhaps there is more than one pathway involved in GNAQ/11 induced tumorigenesis.  1.5.2 GNAQ/11 mutations in the central nervous system (CNS) Melanocytic tumors in the CNS include metastatic melanoma and primary melanocytic tumors, which usually arise from melanocytes of the leptomeninges (Murali et al., 2012). Primary melanocytic tumors are classified as: melanocytomas, intermediate grade melanocytoma, and malignant melanomas (Murali et al., 2012). These melanocytic neoplasias are pigmented and typically appear in the spine, brain, or limbs (Kusters-Vandevelde et al., 2010a). Mutations in GNAQ and GNA11 at Q209 are commonly found in primary melanocytic neoplasias of the CNS (~50%) (Gessi et al., 2013; Kusters-Vandevelde et al., 2010a; Kusters-Vandevelde et al., 2010b; Murali et al., 2012). There is however a single case of melanocytoma found in the spine with a GNAQ mutation at site R183 (Murali et al., 2012). 8.5% of primary melanocytic tumors of the CNS have a GNA11Q209L mutation (n=47) (Gessi et al., 2013; Kusters-Vandevelde et al., 2010a; Kusters-Vandevelde et al., 2010b; Murali et al., 2012). 24  1.5.3 GNAQ/11 mutations in other types of melanocytic neoplasias Mutations in GNAQ and GNA11 are also found in blue nevi (63%), which are located within the dermis (Gessi et al., 2013; Kusters-Vandevelde et al., 2010a; Kusters-Vandevelde et al., 2010b; Murali et al., 2012; Van Raamsdonk et al., 2010). They are very rare among melanoma and nevi located in the epithelium. Initially, Van Raamsdonk et al. reported a single GNAQQ209L mutation among 27 cutaneous melanomas on chronically sun damaged (CSD) skin (2009), however, they found no additional mutations in a much larger CSD sample set, or in any non-CSD cutaneous melanomas (n=164) (Van Raamsdonk et al., 2010). The Catalogue of Somatic Mutations in Cancer (COSMIC) database v70 reports one additional GNAQ mutation among 543 malignant melanoma samples of the skin (Forbes et al., 2011). The rest are blue nevi. Therefore, the functional significance of GNAQQ209L in non-blue skin lesions is unclear. Furthermore, GNAQ and GNA11 mutations have not been found in acral or conjunctival melanoma (Dratviman-Storobinsky et al., 2010; Lamba et al., 2009; Van Raamsdonk et al., 2009; Van Raamsdonk et al., 2010). A GNAQQ209P mutation was recently reported in a single case of mucosal melanoma (Kim et al., 2014a).  1.6 Other genes mutated in uveal melanoma The genes mutated in cutaneous and conjunctival melanomas, B-Raf proto-oncogene (BRAF) and neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS), are rarely mutated in uveal melanoma(Van Raamsdonk et al., 2009). Recent studies in large-scale exome and whole genome sequencing projects in uveal melanoma have identified recurrent mutations in the BRCA1-associated protein-1 (BAP1), the X-linked eukaryotic translation initiation factor 1 A (EIF1AX), and the Splicing factor 3B subunit 1 (SF3B1) (Abdel-Rahman et al., 2011; Dono et al., 2014; 25  Furney et al., 2013; Harbour et al., 2010; Martin et al., 2013). Based upon chromosomal analysis of uveal melanoma, the copy number status of chromosome 3 directly correlates with patient survival (Martin et al., 2013). Metastasis of uveal melanoma is strongly associated with the loss of one copy of chromosome 3 (monosomy 3) in the tumor (Harbour et al., 2010). BAP1, a deubiquitinating enzyme that is involved in regulation of transcription, and regulation of cell cycle and growth is frequently mutated (84%) in the more aggressive class II uveal melanomas and commonly found in tumors with monosomy 3 (Abdel-Rahman et al., 2011; Harbour et al., 2010). EIF1AX, a transcription initiating factor involved in the transfer of the initiator Met-tRNAf, is mutated in 24% of uveal melanoma samples (including 1 case of uveal melanoma with monosomy 3) (Martin et al., 2013). SF3B1, a splicing factor, is mutated in 15% of uveal melanoma samples (including 1 case of uveal melanoma monosomy 3) (Martin et al., 2013). Mutations between EIF1AX and SF3B1 appear to be mutually exclusive (Martin et al., 2013). BAP1 mutations seem to occur later in the development of uveal melanoma, which suggests they may be involved in the onset of metastatic behavior (Harbour et al., 2010). In class II uveal melanoma, both GNAQ andGNA11 mutations co-occur with BAP1 mutations (Harbour et al., 2010; Onken et al., 2004).  1.7 Using Cre/LoxP for conditional mutagenesis 1.7.1 Cre/LoxP Cre-LoxP recombination is a site-specific recombination technology that allows DNA modification to be targeted to a specific cell type or to be triggered by specific external stimuli. The system consists of Cre recombinase (an enzyme) and two 34bp LoxP sequences, derived from bacteriophage P1. Each LoxP site contains two 13bp palindromic sequences with an 8bp 26  asymmetric linker sequence. When present, Cre recombinase binds the two LoxP sites, deleting the intervening sequence, leaving a single LoxP site. LoxP sites are introduced using homologous recombination in embryonic stem (ES) cells, while Cre recombinase is expressed under a tissue specific promoter in transgenic lines produced by pronuclear injection. The final step is to cross the Cre and LoxP mice together.  Another type of Cre molecule is CreER. CreER is a fusion protein between Cre and a modified estrogen receptor. Without tamoxifen, the CreER fusion protein is localized to the cytoplasm. When tamoxifen is introduced, it binds to CreER and the complex translocates to the nucleus, where it can recombine LoxP sites (Feil, 2007; Feil et al., 2009). Tamoxifen is administered through water, topically, or by intraperitoneal injection. With CreER, recombination can be triggered at any time point depending on when tamoxifen is introduced. The Cre/LoxP system has also been used to induce conditional expression through a floxed synthetic transcriptional “stop” cassette (STOP) (Dragatsis and Zeitlin, 2001). The floxed STOP cassette is inserted between the promoter and coding sequence of a locus (Dragatsis and Zeitlin, 2001). In the presence of Cre, recombination at the LoxP sites deletes the STOP cassette, thus activating expression of the transgene (Dragatsis and Zeitlin, 2001). On the other hand, in the absence of Cre recombinase, expression of the targeted allele is suppressed (Dragatsis and Zeitlin, 2001).  1.8 Thesis objectives The overall goal of my thesis is to investigate how conditional GNAQQ209L expression from the Rosa26 locus affects dermal, epidermal, ear, eye, and CNS melanocytes. I will describe the result 27  of inducing GNAQQ209L expression using Mitf-cre, Tyr-creER, and Plp1-creER. I studied melanocyte development and tumor formation in the mice. 28  Chapter 2: Materials and Methods  2.1 Mouse husbandry 2.1.1 Mouse strains All mouse strains were crossed to the C3HeB/FeJ genetic background for at least 6 generations before use. The Mitf-cre (Tg(Mitf-cre)7114Gsb) mice were obtained from Dr. Gregory S. Barsh (Stanford University, USA) (Alizadeh et al., 2008). The Tyr-creER (Tg(Tyr-cre/ERT2)13Bos/J) mice were obtained from Dr. Marcus Bosenberg (Yale University, USA) (Bosenberg et al., 2006). The Dct-LacZ (Tg(Dct-LacZ)A12Jkn) mice were obtained from Dr. Ian Jackson (Institute of Molecular Medicine, UK) (Mackenzie, 1997). The Plp1-creER (Tg(Plp1-cre/ERT)3Pop) and Rosa26-floxed stop-LacZ (Gt(Rosa)26Sortm1Sor/J) mice were obtained from the Jackson Laboratories (Doerflinger et al., 2003; Soriano, 1999). In timed matings, noon of the day of plug discovery is designated as E0.5. All experiments were carried out under the approval of the Animal Care Committee at the University of British Columbia.  2.1.2 Production of Rosa26-floxed stop-GNAQQ209L mice The Rosa26-floxed stop-GNAQQ209L allele was generated at inGenious Targeting Laboratory (Ronkonkoma, New York, USA). Using pROSA26-1, pSABgeo, and PGKneotpAlox2 plasmids and a human GNAQQ209L cDNA (UMR cDNA Resource Center), a construct was built that contains the minimal adenovirus type 2 major late splice acceptor, a LoxP-flanked neo stop cassette, human GNAQQ209L, and a bovine growth hormone polyadenylation signal, all flanked by 1.08 kb and 4.34 kb Rosa26 homology arms, upstream and downstream of the cassette, respectively. The targeting vector was linearized by SacII and then transfected by electroporation 29  of BA1 (C57BL/6 x 129/SvEv) hybrid embryonic stem cells. Following homologous recombination, positive ES cell clones were identified by Southern blotting and PCR and were injected into C57BL/6 blastocysts to produce chimeras, which successfully transmitted the mutant allele to the germline.   2.1.3 Genotyping For genotyping, DNA from ear notch or embryonic membrane samples were obtained from cell lysates using DNeasy columns (Qiagen, Hilden, Germany) and amplified using PCR. Mitf-cre (Tg(Mitf-cre)7114Gsb), Tyr-creER (Tg(Tyr-cre/ERT2)13Bos/J), Dct-LacZ (Tg(Dct-LacZ)A12Jkn), Plp1-creER (Tg(Plp1-cre/ERT)3Pop) and Rosa26-floxed stop-LacZ (Gt(Rosa)26Sortm1Sor/J) transgenic strains, primers and reaction conditions are as previously described (Alizadeh et al., 2008; Bosenberg et al., 2006; Deo et al., 2013; Leone et al., 2003; Mackenzie et al., 1997). The PCR reaction components to genotype the Rosa26-floxed stop-GNAQQ209L allele are 0.25 mM each dNTP, 1 U HotstarTaq (Qiagen, Hilden, Germany), 1X HotstarTaq buffer, and 0.5 µM of each primer in 25 µL total volume. The reaction consists of 40 cycles of 95°C (30 seconds), 57°C (1 minute), and 72°C (1 minute), using 5’-CCGAAAATCTGTGGGAAGTC and 5’- TGGGCTCTATGGCTTCTGAG as primers, which amplify a product of 180 base pairs.   2.1.4 Tamoxifen induction of CreER activity For Plp1-creER experiments, tamoxifen (Sigma T5648) was dissolved in a corn oil/ethanol (10:1) mixture at a concentration of 10 mg/ml. Pregnant females were injected intraperitoneally with 1mg at E11.5. For Tyr-creER experiments, 2 month-old adult animals were injected for 5 30  consecutive days, as above, coupled with topical tail skin administration (25-mg/ml solution of 4-Hydroxytamoxifen≥70% Z isomer (remainder primarily E-isomer) (Sigma Adrich H6278) in dimethylsulfoxide.  2.2 β-Galactosidase staining X-gal staining solution was used to label LacZ positive cells in the transgenic mouse strainsDct-LacZand Rosa26-floxed stop-LacZ. Various tissue samples were incubated with X-gal staining solution (100 mM sodium phosphate (pH 7.3), 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% NP-40, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 1 mg/ml 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-gal), and 2.5% dimethyl-formamide) for 16-48 hours at room temperature with gentle agitation. For some skin samples, the dermis and epidermis was then separated using 2M sodium bromide incubation for 2 hours at 37 °C. The number of LacZ-positive cells was counted in 10-15 epidermal tail scales or on the flank (depending upon the experiment) and the area of the counted region was determined using Image J software (National Institutes of Health, Bethesda, MD, USA). Experiments involving whole tissue such as embryos were fixed at 4% paraformaldehyde at 4°C for 1 hour first before X-gal incubation.  2.3 Electron microscopy of tail skin Tail skin tissues were fixed with 1.5% glutharaldehyde, 1.5% paraformaldehyde in 0.1 M sodium cacodylate for 3 hour at room temperature. After post-fixation with 1% osmium tetroxide in 0.1 M sodium cacodylate for 1 hour at 4°C, the samples were stained en bloc in 1% uranyl acetate for 1 hour at room temperature. Samples were then progressively dehydrated through an ethanol series (30%, 50%, 70%, 90%, 95% for 10 minutes each, then thrice in 100% for 10 minutes) 31  followed by acetone (once for 10 minutes). Samples were infiltrated overnight in a mixture of Epon/acetone (1:1), then twice in pure Epon for 3 hours, and finally embedded in Epon 812 (Fluka). Ultrathin cross sections (about 60 nm) were cut on a Leica Ultramicrotome and positively stained with 2% uranyl acetate and 2% lead citrate. Pictures were taken using a FEI Tecnai G2 transmission electron microscope operated at an acceleration voltage of 120 kV. Micrographs were digitally recorded using an Eagle 4k CCD camera (FEI).  2.4 Melanocyte primary cell culture The primary melanocyte cell culture from mouse-tail skin was adapted from (Sviderskaya et al., 1997). Whole tails from 6 day-old animals were removed immediately following sacrifice and immersed in 70% ethanol for 5-10 seconds. The tail tissues were washed with Dulbecco's phosphate-buffered saline and the tailbones were removed. The tail skins were incubated in 0.5mg/mL trypsin (powder, Life Technologies) in Dulbecco's phosphate-buffered saline at 37°C under 5% CO2 for 30 minutes and then the dermis was separated from the epidermis using forceps. The dermis was cut into small pieces, incubated in 0.25% trypsin at 37°C in 5% CO2 for 5-10 minutes, and then transferred to a recovery media (RPMI, 10% fetal bovine serum, 5ug/ml soybean trypsin inhibitor) and incubated at 37°C in 5% CO2 overnight. After the cells adhered to the plate, the media was changed to a melanocyte supporting media (RPMI, 10% fetal bovine serum, 40nM tissue plasminogen activator and 250nM α-melanocyte-stimulating hormone) and incubated at 37°C in 10% CO2. The media was changed every three days during the experiment. The cells were grown for 2 weeks before collection for pyrosequencing.  32  2.5 Pyrosequencing 2.5.1 Sample collection and processing RNA was extracted from primary dermal melanocyte cell cultures using the RNAqueous-4PCR Kit (Ambion) The RNA obtained was then reverse transcribed into complementary DNA (cDNA) using a random primers (Superscript VILO cDNA synthesis kit, Life Technologies). The yield for cDNA was roughly 1.5µg per sample.  2.5.2 Generation of biotinylated PCR products Primers were designed to amplify theQ209codon region from both human and mouse GNAQ/Gnaq. Two sequential PCR reactions were then performed. First, cDNA from wild-type and mutant cultures was used for PCR using a GNAQ specific primer, one of which contains an M13 tail. A second PCR reaction was then preformed to produce amplicons in which the M13 sequence was incorporated into both strands, using a biotinylated complementary M13 primer. The PCR reactions were as follows: 0.25 mM each dNTP, 1 U HotstarTaq (Qiagen, Hilden, Germany), 1X HotstarTaq buffer, and 0.5 µM of each primer in 20µL total volume. The first PCR step consisted of 15 cycles of 95°C (30 seconds), 58.3°C (1 minute), and 72°C (1 minute). The second PCR step was the same, but was performed for 20 cycles. Primer sequences are in Table 2.1.  Next, strepavidin coated beads were used to immobilize all biotinylated amplicons and pyrosequencing was performed using Qiagen PyroMark equipment and buffers, protocol adapted from (Royo et al., 2007).The sequencing primer annealing plate was prepared by adding 1µM of GNAQ sequencing primer, which binds just upstream of the Q209 codon site, in 40µl annealing 33  buffer for each sample, according to the instructions provided for the PyroMark Q96 MD pyrosequencer (Qiagen) using PyroMark assay kits (Qiagen).   2.6 Histology 2.6.1 Hematoxylin and eosin staining For paraffin embedded samples, tissues were fixed in 10% formalin at 4°C for 1-2 days depending on the size of the sample, except for intact cranium and inner ears, which were fixed in 10% formalin, followed by decalcification (10% formalin, 88% formic acid and distilled water) for several days. For optimal cutting temperature (OCT) embedded samples, tissues were fixed at 4% paraformaldehyde at 4°C overnight. The intact cranium (whole head) sections were performed by Wax-it Histology Services (University of British Columbia). For histological analysis, 8-10 µm sections were cut, stained with hematoxylin and eosin, and examined by the Zeiss Axioplan bright-fiend microscope. For all experiments, at least three individuals of each genotype were examined.  2.6.2 Immunohistochemistry Eye Whole eyes were fixed in 4% paraformaldehyde for 1 hour, washed in 8%, 12%, 18%, and 20% sucrose (15 minutes each), incubated in 25% sucrose overnight, and embedded in OCT. Eyes were then sectioned in a transverse orientation at 8-12 µm. For immunofluorescence, the sections were blocked with 1:25 M.O.M (Vector Labs), incubated with mouse Anti-RPE65 antibody (1:250 dilution, Abcam13826) overnight at 4°C, and then incubated for 1 hour at room temperature with Alexa594 conjugated goat anti-mouse antibody (1:500 dilution, Invitrogen). 34  For immunohistochemistry, sections were bleached with 0.5% potassium permanganate for 20 minutes, 2% oxalic acid for 3 minutes, and then incubated in 0.3% hydrogen peroxide for 30 minutes to inactivate endogenous peroxides. These sections were blocked with serum containing 1:25 M.O.M, incubated with mouse Anti-Melanoma antibody cocktail (HMB45 + DT101 + BC199) (1:50 dilution, Abcam732) overnight at 4°C, and then incubated 30 minutes with goat-anti-mouse-HRP secondary antibody (1:200, Lifetechnology). Sections were washed and stained with DAB for 5 minutes.   Cultured melanocytes Dermal melanocyte primary cells were grown on coverslips overnight to several days. The coverslips were washed with 10 mM sodium phosphate (pH 7.3) buffer and then fixed in 4% paraformaldehyde at 4°C for 10 minutes. The cells were blocked with 1:25 M.O.M, incubated with mouse Anti- β-Galactosidase (1:400, Promega, Z3781) overnight at 4°C, and then incubated for 1 hour at room temperature with Alexa594 conjugated goat anti-mouse antibody (1:500 dilution, Invitrogen). All immunofluorescence images were taken on the Leica DMI 6000B epifluorescence microscope.  2.7 Auditory brainstem response Auditory brainstem response tests were performed by the Mouse Biology Program at University of California, Davis with 5 Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals and 5 +/+;Mitf-cre/+ control littermates at two time points, 5 and 10 weeks.  2.8 Statistics Data was analyzed with either ANOVA or student T-Tests using Prism.35   Primer name Sequence M13 biotinylated sequence + Forward GNAQQ209L pyro primer: 5'-CGCCAGGGTTTTCCCAGTCACGACTCATTTTCAGAATGGTCGATGTA-3’ Reverse GNAQQ209L pyro primer: 5’-AGCAGTGTATCCATTTTCTTCTCT-3’ GNAQQ209L sequencing primer: 5’-TTTTCTTCTCTCTGACCTT-3’ Table 2.1 Primers for pyrosequencing. The M13 biotinylated sequence is underlined and incorporated into the forward GNAQQ209L pyro primer sequence.36  Chapter 3: Results  3.1 Introduction Intrigued by the rarity of GNAQ and GNA11 mutations in melanoma and nevi located in the epidermis compared to the dermis, we asked what would happen if epidermal melanocytes were forced to express constitutively active GNAQ in mice. We engineered a floxed-stop GNAQQ209L conditional knock-in allele at the ubiquitous Rosa26 locus in mice to test this. I report here that the expression of the Rosa26-floxed stop-GNAQQ209Lallele induced by the melanocyte driver, Mitf-cre, caused the rapid development of uveal melanoma with lung metastases, as well as melanocytic hyperplasia in the central nervous system (CNS), inner ear, dermis, and hair follicles. Paradoxically, GNAQQ209L expression progressively eliminated melanocytes from the adult inter-follicular epidermis, which could account for the paucity of GNAQ mutations in human melanomas located in the epithelium. In addition, the expression of GNAQQ209L in Schwann cell precursors inhibited the production of melanocytes during development. I conclude that cellular context strongly influences the downstream response that melanocytes have to GNAQQ209L expression.  3.2 Creation of the Rosa26-floxed stop-GNAQQ209L allele We engineered a conditional allele in which GNAQQ209L is expressed from the ubiquitous Rosa26 locus following the removal of a LoxP flanked stop cassette that prevents transcription (Soriano, 1999). Using the pROSA26-1, pSAβgeo, PGKneotpAlox2, and human GNAQQ209L cDNA plasmids, we built a construct that contains a splice acceptor, a LoxP-flanked stop cassette, human GNAQQ209L, and a bovine growth hormone polyadenylation signal, all flanked by 1.08 kb and 4.34 kb Rosa26 homology arms, upstream and downstream of the cassette, respectively (Figure 3.1). This allele drives continuous expression of constitutively active GNAQ in cells that undergo Cre-mediated recombination and in all of the descendents of these cells. The resulting Rosa26-floxed stop-GNAQQ209Lmice were crossed to the C3HeB/FeJ genetic background for 6 generations before analysis. Rosa26-floxed stop-GNAQQ209L mice were healthy and breed with 37  normal efficiency. By crossing Rosa26-floxed stop-GNAQQ209L to different Cre mice, the downstream effects of GNAQQ209L on melanocytes in different locations during development will be observable.38  Figure 3.1 A conditional GNAQQ209L allele engineered at the Rosa26 locus. A. The target allele contains a splice acceptor, a LoxP-flanked stop cassette (PGKneo3xpAlox2), a human GNAQQ209LcDNA, and a bovine growth hormone polyadenylation signal, all flanked by 1.08 kb and 4.34 kb of Rosa26 homology arms. After the LoxP sites are recombined by Cre recombinase, GNAQQ209L is expressed in the cell and all of its descendents (Activated allele). The location of the PCR amplicon for genotyping is shown in green. B-C. To confirm correct homologous recombination during allele construction, Southern blot analysis was performed on ES cell cloneDNA digested with EcoRI and probed with PB3/4 (B) and using digestion with EcoRV and probing with AT1/AT2 (C). Successful homologous recombination occurred in 5 BA1 (C57BL/6 x 129/SvEv) hybrid embryonic stem cell clones (114, 132, 133, 242, 263).  R, EcoRI; RV, EcoRV; H, HindIII; SA, splice acceptor; pA, polyadenylation signal. Triangles indicate  LoxP sites.39  3.3 Skin pigmentation changes driven by GNAQQ209L induced by Mitf-cre To examine the effects of GNAQQ209L expression initiated in melanoblasts (immature melanocytes) during embryogenesis, I obtained Mitf-cre transgenic mice, which express Cre recombinase under the control of the melanocyte specific promoter of the Microphthalmia gene (Alizadeh et al., 2008). Mitf-cre is the earliest Cre driver expressed specifically in melanocytes. Expression of the transgene began at E10.5 of mouse development in the first committed melanoblasts. Mitf-cre has an efficiency of 25% at E15.5 (Deo et al., 2013) and 68% at P71 (Table 3.1). On the C3HeB/FeJ genetic background, Mitf-cre animals were smaller than non-transgenic animals (Figure 3.2) and 60% exhibited microphthalmia (n=35) (Figure 3.8B). The cause of these phenotypes is unknown; however, there was no change in epidermal or dermal skin pigmentation in Mitf-cre/+ mice (Alizadeh et al., 2008).  Mitf-cre is expressed in epidermal, dermal, and follicular melanocytes of the tail and trunk skin (Alizadeh et al., 2008; Deo et al., 2013). Expression in uveal, otic, or leptomeningeal melanocytes of the CNS and spinal cord has not been previously reported.   I crossed Rosa26-floxed stop-GNAQQ209L/+ animals to Mitf-cre/+ animals and obtained the expected percentage of double heterozygous progeny. Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals could be distinguished from their littermates a few days after birth, because they exhibit early stages of tail darkening (Figure3.3A). Separation of the dermis and the epidermis at 3 weeks of age indicated that the darkening is restricted to the dermis (Figure 3.3B). Melanocytes in the tail dermis of Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice contained a large number of melanosomes (pigment producing organelles), consistent with the very dark appearance of the dermis in histological analysis (Figure 3.4A, Figure 3.5A). Hyper-pigmentation could be seen extending into the hypodermis in both histological and electron microscopy images (Figure 3.4B, Figure 3.5B). The trunk dermis also contained abundant melanin, even though this area is usually sparsely pigmented (Figure 3.3C, Figure 3.4B).   In addition, I observed a melanocytic lesion on the trunk of two Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals (Figure 3.3E). Another lesion was found on the head of oneRosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mouse (Figure 3.3D). Although rare, these 40  lesions were never observed in any mice in the control colony. I note that the location of these lesions on the trunk and head was different from transgenic mice over-expressing the G protein coupled glutamate 1 receptor, Grm1, which might activate Gnaq/11 (Pollock et al., 2003). Instead, Dct-Grm1 mice exhibit lesions on the tail and ears.  In young Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals, the amount of melanin in the tail epidermis appeared to be normal (Figure 3.3B). To quantify the number of melanocytes in the epidermis, I obtained the melanocytic reporter line, Dopachrome tautomerase (Dct)-LacZ, and crossed it to Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice. Dct-LacZ labels melanocytes beginning at E10.5 (Mackenzie et al., 1997). In the epidermis, Dct-LacZ labels melanocytes in both the tail scales and hair follicles (Mackenzie et al., 1997). At 3 weeks of age, I found no significant difference in the number of LacZ-positive cells in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ tail scales as compared to Mitf-cre/+, supporting the observations of the melanin content (Figure 3.6A).   However, in older animals, melanin content in the tail epidermis was significantly reduced (Figure 3.6C). I used the Rosa26-floxed stop-LacZ reporter allele to identify cells in which Cre had been expressed in sufficient levels to mediate recombination of LoxP sites (Soriano, 1999). At 5 weeks of age, I found numerous LacZ-positive cells in the Rosa26-floxed stop-LacZ/+; Mitf-cre/+ tail epidermis, as expected (Alizadeh et al., 2008). However, there were 39% fewer LacZ-positive cells in the Rosa26-floxed stop-LacZ/Rosa26-floxed stop-GNAQQ209L; Mitf-cre/+ tail scales as compared to the Rosa26-floxed stop-LacZ/+; Mitf-cre/+ controls (p=0.018, students T-test) (Figure 3.6B). This indicated that the expression of GNAQQ209L negatively impacted the survival/proliferation of inter-follicular epidermal melanocytes.  Hair follicles are epidermal appendages. Melanocytes actively producing pigment are located at the base of hair follicles, where they transfer melanosomes to specialized keratinocytes of the growing hair. Unlike the epidermal scales (above), follicular melanocytes respond to GNAQQ209Lby overgrowth. The hair follicle bulbs of Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ trunk (Figure 3.4B) and tail (Figure 3.6C) develop dark, ectopic pigmentation. Despite 41  this, the coat grays by 5 months, suggesting that GNAQQ209L expression directly or indirectly disrupted normal melanosome transfer to keratinocytes (Figure 3.7).  42   Genotype Average number of LacZ+ cells per scale Dct-LacZ/+  Animal 1 94.2± 5.8 Animal 2 94.5± 6.7 Animal 3 120.6± 6.2 Average 103.1± 10.7 Rosa26-fs-LacZ/+; Mitf-cre/+  Animal 1 81.4± 5.0 Animal 2 73.9± 7.7 Animal 3 50.8± 7.3 Animal 4 73.0± 7.8 Average 69.7± 7.6 Percentage of efficiency  67.7% Table 3.1 Efficiency of Mitf-cre at P40. Dct-LacZ/+ (n=3) and Rosa26-fs-LacZ/+; Mitf-cre/+ (n=4) tail skins were stained with X-gal and the epidermis was split from the dermis. The number of LacZ-positive cells was counted in one row of epidermal scales per sample. ± standard error of the mean (SEM).  43    Figure 3.2 Mitf-cre and Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice exhibit reduced body weight. Male littermates were weighed at 3 months of age. Wild-type versus Mitf-cre/+ (p=0.0468), Mitf-cre/+ versus Rosa26-floxed stop “fs”-GNAQQ209L/+; Mitf-cre/+ (p=0.0423), and wild-type versus Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ (p=0.0018). Graph displays mean ± SEM, n=number of animals.   44   Figure 3.3 Gross morphology of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. A. Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ exhibit tail darkening (red arrow) starting 5 days after birth. B. The tail dermis of 3 week-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals exhibited non-uniform hyperpigmentation, while the epidermis appeared to be pigmented normally. C. The ears, footpad, trunk, and tail skin of 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice (right side of each subpanel) were hyper-pigmented. D. A pigmented lesion (red arrow) was found on the head of a 5 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mouse. E. A dermal lesion (red arrowhead) on the trunk of a 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mouse.   45   Figure 3.4 Histology of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. A. Hematoxylin and eosin (H&E) staining of 8 microns thick tail sections revealed heavy hyperpigmentation in the dermis at 3 months of age. B. X-gal and eosin staining of Rosa26-floxed stop-GNAQQ209L/+; Dct-LacZ/+; Mitf-cre/+ 5 month-old trunk skin revealed hyper-pigmentation of the hair follicles and dermis (white arrowheads). LacZ-positive cells (blue) were much more numerous in the Rosa26-floxed stop-GNAQQ209L/+; Dct-LacZ/+; Mitf-cre/+ hair follicles as compared to Dct-LacZ/+; Mitf-cre/+. D, dermis; E, epidermis; HF, hair follicle.   46   Figure 3.5 Electron microscopy of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ skin. A. Electron microscopy of 3 month-old tail skin showed increased melanocytes in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ (n=3) compared to Mitf-cre/+ controls (n=3), n=the number of animals examined. B. Electron microscopy of 3 month-old tail skin showed invasion into the hypodermal layer in the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ (n=3). Ad, adipocytes. 47   Figure 3.6 Melanocyte loss in the inter-follicular epidermis of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A. There was no significant difference in the average number of LacZ-positive cells per scale in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice at P21 (left) (mean ± SEM; p=0.702 by T-test). n=the number of animals examined. Representative whole mount stained scales are shown (right). B. There was a significant decrease in the average number of LacZ-positive cells per scale in Rosa26-floxed stop-GNAQQ209L/Rosa26-floxed stop-LacZ; Mitf-cre/+ animals at P40 (left) (mean ± SEM; p=0.018 by T-test). n=the number of animals examined. Representative whole mount stained scales are shown (right). Note that Rosa26-LacZwas expressed more weakly than Dct-LacZ in melanocytes. C. Epidermal sheets of 5 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice exhibited extensive depigmentation of the tail scales. Hyper-pigmented hair follicles were visible (3 per scale, arrowhead).  48   Figure 3.7 Coat graying is observed in 5 month-old Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A. Hair color lightening was observed in 5 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals, despite the fact that there was melanocyte overgrowth in the hair follicles. B. Uneven pigmentation or a complete lack of pigmentation was observed in two representative hairs plucked from 5 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals. Pigmented septules were visible in the control Mitf-cre/+ hair in the upper left panel.  49  3.4 Uveal melanoma driven by GNAQQ209L induced by Mitf-cre I selected Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice without severe microphthalmia for histological analysis at 3 weeks, 5 weeks, and 3 months of age. At 3 months of age, obvious melanocytic neoplasias were present with 100% penetrance in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals (n=15). In younger animals, the uveal tract was thickened throughout, with a mass forming at the anterior of the eye (Figure 3.8A left). Older animals exhibited bulging eyes and bigger tumors that largely filled the vitreous space (Figure 3.8). At 6 weeks of age, I performed immunofluorescence using anti-RPE65 (Abcam 13826), an antibody specific to the retinal pigmented epithelium (RPE) (Figure 3.9A). I also performed immunohistochemistry using the anti-melanoma antibody cocktail HMB45 + DT101 + BC199 (Abcam732), which labels highly proliferative melanocytes (Figure 3.9B). The ocular tumors were positive for the anti-melanoma antibody and negative for the RPE antibody, which suggested that they were melanocytic tumors derived from the uveal tract, not the pigmented retina. I conclude that Rosa26-floxed stop-GNAQQ209L drives uveal melanoma with a very short latency period when induced by Mitf-cre.  50  Figure 3.8 Uveal melanoma in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A.Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice exhibited thickening of the uveal tract at 3 weeks of age (left). Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice developed bilateral ocular lesions (*) and hyper-pigmentation of the Harderian gland at 5 weeks of age or later (right). B. 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animal exhibited eye bulging (red arrowhead). The Mitf-cre/+ control mouse was microphthalmic. Hg, harderian gland; Nc, nasal cavity.  51  Figure 3.9 Immunohistochemistry of uveal melanoma in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A. The retinal-pigmented epithelium (RPE) was directly adjacent to the uveal tract, which are composed of melanocytes and other cell types (top row). Immunofluorescence for anti-RPE65 (red) and DAPI (blue) was used to identify the retinal pigmented epithelium in 3 week-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ eye sections (bottom row right). The thickened, darkly pigmented tissue visible in the light microscopy image (bottom row middle and left) was negative for RPE65. B. Samples were bleached before staining with the anti-melanoma antibody cocktail HMB45 + DT101 + BC199 using DAB (brown). A section of the eye before bleaching is shown (left). The tumor tissue was positive for the anti-melanoma antibody cocktail HMB45 + DT101 + BC199 at 5 months of age, counterstained with hematoxylin (middle). Without counterstaining, the tumor was much darker than the negative control incubated without primary antibody (left).  52  3.5 GNAQQ209L driven melanoma metastasis and CNS overgrowth induced by Mitf-cre I next performed necroscopy on 2-3.5 month old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice. Multiple heavily pigmented and enlarged lymph nodes were present in every animal in the neck and trunk (Figure 3.10A). Histological analysis showed that the capsule of the lymph nodes was very dark, with less pigmentation internally (Figure 3.10A). 94% of the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice (n=19) exhibited at least one pigmented tumor in the lungs (Figure 3.10B). The size of the lung neoplasias ranged from 200 microns-6 mm in diameter, with 4-18 tumors per mouse. No pigmented neoplasias were found in the liver, another frequent site of uveal melanoma metastasis in humans (Singh et al., 2011). In addition, we found extensive hyper-pigmentation within the cranium of Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice (n=28). This was due to melanocytic overgrowth within the leptomeninges, which invaded the medulla oblongata of the brain (Figure 3.11A, B). In one animal, a darkly pigmented lesion was also recovered from the brain surface (Figure3.11C). Spinal cord meninges were heavily pigmented in all animals (Figure 3.12). Finally, I note that Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals weighed less than +/+; Mitf-cre/+ controls (Figure 3.2).  53  Figure 3.10 Metastasis in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A. Lymph nodes from 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+mice were enlarged and hyper-pigmented (top right). H&E stained sections are shown below. B. Multiple pigmented lesions were located in the lungs of a 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mouse (red arrowheads) (left). An H&E stained lung section is shown to the right.  A Rosa26-fs-GNAQQ209L/+;Mitf-cre/+Mitf-cre/+Front view Back viewB1 cm 50 ȝm25 mm100 ȝm54  Figure 3.11 Hyper-pigmentation in the brain of Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. A. Hyper-pigmentation was present on the surface of the brain in a 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+mouse, but not in the control (left and middle). A coronal section of a 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+brain revealed invasion the frontal lobe (*) (right bottom) compared to the control (right top). B. Whole head section and H&E staining revealed thickened and hyper-pigmented leptomeninges in the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+brain (middle and right top) as compared to the control (left). There was invasion of the cerebellum and the medulla oblongata (middle and right bottom) in the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ brain. In a 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mouse, a large (5 mm) lesion was found on the surface of the brain (right). The location of the lesion is indicated by an indentation (red arrowhead) visible after the lesion was removed (left). CB, cerebellum; LM, leptomeninges; OF, olfactory bulb; OFC, orbitalfrontal cortex; MO, medulla oblongata.  55   Figure 3.12 Hyperpigmentation of spinal cord meninges in Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ mice. Spinal cord meninges were heavily pigmented in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals (red arrowheads). The trunk skin was removed.  56  3.6 GNAQQ209L driven impairment of inner ear function induced by Mitf-cre I noticed that some older Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice failed to startle in response to loud noises. I sent 5 Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals and 5 +/+; Mitf-cre/+ control littermates to the University of California, Davis’ Mouse Biology Program for auditory brainstem response (ABR) testing at two time points, P34 and P76. I found that at P76, there was a significant increase in the threshold needed to produce a brainstem response in Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice compared to +/+; Mitf-cre/+ mice over a broad range of frequencies (ABR click test, Figure 3.13A), with individual Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice being worse in their ability to respond to auditory stimulus with age (Table 3.2).  Beginning between 1-3 months of age, Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice developed abnormal behaviors that were suggestive of balance deficiencies. These behaviors included head tossing, head tilting, and flipping onto the back. This became severe enough by 3-5 months to require humane endpoint. I preformed histological analysis of the ears at 3 months and discovered an extensive over-growth of pigmented cells, which filled the spaces in the cochlea and vestibulary system (Figure 3.13B). These experiments indicated that Mitf-cre drives Cre expression in the melanocyte-like cells of the inner ear and that unregulated activity of GNAQ significantly impacts normal inner ear function.   57  Figure 3.13 GNAQQ209L expression induced by Mitf-cre causes deafness in mice. A. ABR click testing showed no significant difference between Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals and controls at P34 (left), but revealed an increase in the decibel required for sound detection at P76 in the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ animals (right) (mean ± SEM; p=0.249 at P34, p=0.044 at P76). Individual points represent the value for each animal. See Table 3.2 for the ABR results at specific frequencies. B. Pigmented cells fill the spaces in the cochlea and vestibular structure of the inner ears of 3 month-old Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice, visible in H&E stained sections. Co, cochlea; V, vestibular structure. 58    Table 3.2 Individual results of auditory brainstem response (ABR) testing. ABR-testing was performed on the same animals in each genotype twice, once at P34 and then again at P76.The highest sound pressure level (SPL) tested was 90 dB, if the animal still did not respond it was labeled as NR. NR: Non-responsive.   Mitf-cre/+ animals at P34 6kHz (dB) 12kHz (dB) 18kHz (dB) 24kHz (dB) 30kHz (dB) Animal 1 35 10 20 25 35 Animal 2 35 15 15 20 30 Animal 3 35 15 25 25 45 Animal 4 35 25 20 30 45 Animal 5 65 25 20 35 55  Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ animals atP34 6kHz (dB) 12kHz (dB) 18kHz (dB) 24kHz (dB) 30kHz (dB) Animal 6 35 10 10 25 35 Animal 7 45 15 15 25 45 Animal 8 65 25 20 35 55 Animal 9 75 20 25 30 45 Animal 10 NR 65 75 85 NR Mitf-cre/+ animals at P76 6kHz (dB) 12kHz (dB) 18kHz (dB) 24kHz (dB) 30kHz (dB) Animal 1 30 15 15 25 40 Animal 2 30 15 20 25 40 Animal 3 30 20 20 35 40 Animal 4 35 15 20 20 40 Animal 5 75 40 30 50 55  Rosa26-fs-GNAQQ209L/+; Mitf-cre/+ animals at P76 6kHz (dB) 12kHz (dB) 18kHz (dB) 24kHz (dB) 30kHz (dB) Animal 6 45 15 20 25 35 Animal 7 75 30 40 60 85 Animal 8 75 40 35 40 55 Animal 9 NR 80 85 90 NR Animal 10 NR 80 80 NR NR 59  3.7 Rosa26-floxed stop-GNAQQ209L expression levels compared to endogenous Gnaq in melanocytes To estimate the expression level of Rosa26-floxed stop-GNAQQ209Lcompared to endogenous Gnaq, I cultured melanocytes from 8.5 day-old mouse tails. I developed primary cultures from the dermis of 3 different Rosa26-floxed stop-LacZ/Rosa26-floxed stop-GNAQQ209L; Mitf-cre/+ animals. After 2 weeks of primary cell growth, I performed immunofluorescence on the cells using a LacZ antibody to calculate the percentage of cells expressing GNAQQ209L. I found that 100% of the cells were LacZ-positive, likely through an increased growth advantage in culture provided by the GNAQQ209L allele (Figure 3.14A) (Van Raamsdonk et al., 2009).   I then performed pyrosequencing on cDNA isolated from the cultured melanocytes using primers designed to amplify the codon Q209 region from both the transgenic GNAQQ209L and endogenous Gnaq loci. The T variant present in the GNAQQ209L allele comprised on average 96.8% of the pyrosequencing signal, which indicated a 31-fold increase in expression compared to the two endogenous Gnaq alleles together (Figure 3.14B). The caveats to this experiment are that 1) there could be feedback mechanisms dampening endogenous Gnaq expression that would not apply to GNAQ expressed from the Rosa26 promoter, and 2) Gna11 plays a redundant role to Gnaq and was not measured in the experiment (Offermanns et al., 1998). Regardless, over-expression of GNAQ could contribute to oncogenesis in Rosa26-floxed stop-GNAQQ209L mice, in addition to the effect of the Q209L mutation itself.  A more accurate uveal melanoma model would rely on the endogenous Gnaq promoter, as has been done for BrafV600E (Dhomen et al., 2009). However, in this study, the original objective was to drive expression of GNAQQ209L in epidermal melanocytes. To achieve this, GNAQQ209L was expressed from a ubiquitous promoter. 60  Figure 3.14 Rosa26-fs-GNAQQ209L is expressed at a higher level as compared to endogenous Gnaq in cultured melanocytes. A. Primary melanocyte cell cultures were obtained from 8.5 day-old Rosa26-floxed stop-LacZ/Rosa26-fs-GNAQQ209L; Mitf-cre/+ animals. After 2 weeks in culture, 100% of the cells expressed LacZ, indicating a uniform melanocyte population at the time of RNA extraction. B. Pyrosequencing traces of 3 independent melanocyte cultures indicated that 97% of the amplicons were derived from the Rosa26-floxed stop-GNAQQ209L allele and 3% from the endogenous Gnaq alleles.   61  3.8 GNAQQ209L driven hyperplasia induced by Tyr-creER in adult mice To determine whether Rosa26-floxed stop-GNAQQ209Lhas similar effects when induced in adulthood, I obtained Tyrosinase(Tyr)-creER mice (Bosenberg et al., 2006). In this transgene, Cre recombinase is fused to the estrogen receptor and requires tamoxifen for the CreER protein to be transported to the nucleus for activity. Tyr-creER expression initiates in melanoblasts at around E17.5 of mouse development (Bosenberg et al., 2006). To administer tamoxifen, I treated 8 week old mice with 1 mg tamoxifen by intraperitoneal injection and also dipped the bottom half of the tail in a solution of 25 mg/mL 4-hydroxytamoxifen for 5 seconds. This treatment was repeated daily for 5 days. In addition to being absorbed through the skin, topically applied tamoxifenis also known to be consumed by mice during grooming. The efficiency of Cre recombination in epidermal melanocytes of the tail using these combined methods was 39% as determined 7 days following the last dose of tamoxifen (Table 3.3).   3 Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ and 3 +/+; Tyr-creER/+ littermates were treated with tamoxifen (as described above) at 8 weeks of age. The Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ mice exhibited skin darkening and bilateral bulging of the eyes 2 months after tamoxifen treatment (Figure 3.15A). Histological analysis at this time point revealed thickening of the uveal tract in 100% of tamoxifen treated Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ eyes (n=4). A similar phenotype was observed in the eyes of one Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ animal 6.5 months after tamoxifen treatment (Figure 3.15C). In contrast, at the two time points, treated +/+; Tyr-creER/+ and untreated Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ controls were normal (Figure 3.15B, D). The bulging eye phenotype might be due to dispersed melanin, which, if it accumulates within the ocular drainage structures, causes elevated intraocular pressure (Anderson et al., 2006).  This experiment showed that the expression of GNAQQ209L beginning in adulthood could promote melanocytic overgrowth in the eye and skin. However, these mice did not develop uveal melanoma within the time-frame examined. I also note that in the Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ mice, leptomeningeal and inner ear melanocytic overgrowth was 62  absent, behavior was normal, and pigmented neoplasias in the lungs were not present (data not shown).   63  Genotype Average number of LacZ+ cells per scale Dct-LacZ/+  Animal 1 121.3± 6.3 Animal 2 117.2± 6.3 Animal 3 105.0± 4.8 Average 114.5± 6.0 Rosa26-fs-LacZ/+; Tyr-creER/+  Animal 1 50.4± 4.4 Animal 2 43.3± 4.6 Animal 3 40.9± 3.7 Average  44.8± 3.5 Percentage of efficiency  39.2%  Table 3.3 Efficiency of Tyr-creER using a 5 day tamoxifen treatment at P71. Dct-LacZ/+ (n=3) and tamoxifen treated Rosa26-fs-LacZ/+; Tyr-creER/+ (n=3) tail skins were stained with X-gal and the epidermis was split from the dermis. The number of LacZ-positive cells was counted in two rows of epidermal scales per sample (± SEM).  64  Figure 3.15 Melanocytic overgrowth driven by Rosa26-fs-GNAQQ209L induced with Tyr-creER. A.Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ and +/+; Tyr-creER/+ controls were treated with tamoxifen at 8 weeks of age to activate CreER. At 4 months of age the eyes of Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ exhibited bilateral bulging (red arrowheads) (left). The ear and tail skin was also hyper-pigmented (red arrowheads) (right). B. Wild-type (+/+), tamoxifen treated Tyr-creER/+, and untreated Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ control genotypes exhibited normal skin pigmentation. C. Sections of the eyes showed thickening and hyper-pigmentation of the uveal tract in the Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ animals. D. 8.5 month-old Rosa26-fs-GNAQQ209L/+; Tyr-creER/+ mouse treated with tamoxifen at 2 months of age exhibited melanocytic overgrowth in the uveal tract, while the untreated Rosa26-floxed stop-GNAQQ209L/+; Tyr-creER/+ littermate is normal (H&E).65  3.9 GNAQQ209L effects in Schwann cell precursors Plp1-creER transgenic mice exhibit an efficiency of Cre excision ~60% in melanoblasts near nerves when tamoxifen is provided by intraperitoneal injection of the mother at E1l.5 (Adameyko et al., 2009; Leone et al., 2003). This single injection produces only a temporary activation of creER. Plp1-creER expression is also down-regulated in melanoblasts after they detach from the nerves (Adameyko et al., 2009). Tamoxifen injection at E11.5 fate maps Schwann cells and melanocytes that reside in the postnatal dermis, as well as melanocytes in hair follicles (Adameyko et al., 2009; Deo et al., 2013).  To determine the effect of GNAQQ209L specifically on Schwann cell precursor derived melanocytes, we crossed Rosa26-floxed stop-GNAQQ209L/+ females to Plp1-creER/+ males in timed matings and injected 1 mg of tamoxifen into the pregnant females at E11.5. Given that GNAQQ209Lmight negatively impact Schwann cell function and animal viability, I began by collecting newborn mice from these crosses; however, even Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+ mice aged to 5 months exhibited normal behavior (n=3). In terms of pigmentation, the Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+ mice were dramatically different compared to the Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice. First, the majority of the skin of the Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+ mice was pigmented normally. The only pigmentary phenotype I found was a few small patches of dermal hyper-pigmentation on the dorsum of the tail, close to the rump, present in all three Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+ mice at 5 months (Figure 3.16A). The area of skin hyper-pigmentation did not extend during observation between 3 and 5 months. In addition, there was a heavily pigmented, round lesion that adhered directly to the spine of one of the three animals (Figure 3.16A). Similar lesions were never observed in any Rosa26-floxed stop-GNAQQ209L/+; Mitf-cre/+ mice.  To examine what happens immediately after CreER activation in these mice, I crossed Rosa26-floxed stop-GNAQQ209L/+ mice to Plp1-creER/+; Dct-LacZ/+ mice in timed matings. I injected 1 mg of tamoxifen into pregnant females at E11.5 and dissected the resulting embryos at E12.5. I stained the embryos in X-gal overnight and quantified the number of LacZ-positive cells in the flank regions where Schwann cell precursors gave rise to melanoblasts. I found a 30% decrease 66  in the number of LacZ-positive cells in the Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+; Dct-LacZ/+ embryos as compared to +/+; Plp1-creER/+; Dct-LacZ/+ control littermates (p= 0.0005, student T-test) (Figure 3.16B).   I conclude from these experiments that GNAQQ209L expression inhibits Schwann cell precursor-derived melanoblast production. GNAQQ209L expression might eliminate Schwann cell precursors or Schwann cell precursor-derived melanoblasts, or prevent the specification of melanoblasts from Schwann cell precursors, except at the base of the tail. Since not all Schwann cell precursors expressed and activated CreER in these mice, compensation for the missing cells could have been accommodated by the remaining normal cells.    67   Figure 3.16 Rosa26-fs-GNAQQ209L expression induced with Plp1-creER inhibits melanoblast production. A. Plp1-creER was used to induce Rosa26-floxed stop-GNAQQ209L expression in bipotential Schwann cell precursors following Cre activation with tamoxifen at E11.5. The 3 Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+ mice exhibited patches of hyper-pigmented skin at the base of the tail (example shown at 5 months of age in top left subpanel). One animal developed a paraspinal lesion (*) on the tail, which was removed at 8 months of age, revealing hyper-pigmented skin above it (red box) (left bottom). H&E stained sections of the skin (right top) and lesion (right bottom) are shown. B. There was a significant decrease in the number of LacZ-positive melanoblasts 24 hours after tamoxifen treatment in Rosa26-floxed stop-GNAQQ209L/+; Plp1-creER/+; Dct-LacZ/+ embryos. The average number of LacZ-positive cells per mm2 in the flank region (yellow box) is shown in the graph (mean ± SEM), with representative embryos to the right. (** p=0.0061; ***p=0.0005; ANOVA). n=the number of embryos examined.  68  Chapter 4: Discussion Constitutively active mutations in GNAQ and GNA11 are very rare in epithelium localized human melanoma and nevi, but are frequently found in dermal nevi and other non-cutaneous melanoma (Van Raamsdonk et al., 2010). These findings suggest that there are significant underlying differences among cutaneous and non-cutaneous melanocytes; however this interpretation is complicated by differential exposure to environmental mutagens, primarily UV light. Additionally, it is difficult to determine if the absence of a particular oncogenic mutation in a certain type of melanoma is due to lack of expression of the gene or the result of decreased downstream signal transduction. In this study, I have minimized these factors by using the ubiquitous Rosa26 promoter to express GNAQQ209L. This equalizes GNAQQ209L expression levels among melanocytes and prevents built-in feedback transcription expression mechanisms. With this, I could more directly compare the downstream effects of GNAQQ209L.   I show that constitutively active GNAQ expression in melanocytes during early development activated through Mitf-cre/+ mice induced rapid-onset visible skin hyperpigmentation in mice shortly after birth. In glabrous skin (ears, foot, and tail), hyper-proliferation of melanocytes caused the dermis to thicken and melanocytes to invade the hypodermal region. During early development, the tail epidermal melanocytes seemed unaffected by GNAQQ209L expression, however by 3 months of age, the epidermal scales showed a decrease in pigmentation and reduced numbers of melanocytes compared to the control. I speculate that as the animal ages, GNAQQ209L impacts normal cell proliferation, survival, and/or senescence of epidermal inter-follicular melanocytes. Further investigation is required to understand why GNAQQ209L had a 69  different effect on epidermal melanocytes compared to melanocytes in the hair follicles and dermis.   In the CNS, GNAQQ209L drove hyper-proliferation of melanocytes in the leptomeninges of the brain that caused the formation of melanocytic tumors in the cerebellum and medulla. The expression of GNAQQ209L also induced hyper-proliferation of melanocyte-like cells in the cochlear and vestibular system of the inner ear, which caused the mice to lose hearing and balance.  The induction of GNAQQ209L expression in melanocytes during adulthood also drove melanocytic hyperplasia, including skin darkening and bilateral thickening of the uveal tract.  When GNAQQ209L was expressed during early development in biopotential melanocyte-Schwann cell precursors, there were no obvious effects on postnatal pups. As the animals aged, only small patches of dermal hyperpigmentation were observed on the base of the tail and in one animal I found a pigmented lesion attached to the spine. When I dissected embryos at E12.5, one day after inducing GNAQQ209L expression, I found a significant decrease in the number of LacZ-positive cells compared to control littermates. This finding showed that GNAQQ209L prevented the differentiation of melanoblasts from SCPs. I suspect that the melanoblast precursors at the base of the tail are unique and can produce melanoblasts despite expressing GNAQQ209L. These melanoblasts respond with hyper-proliferation like other melanoblasts in the dermis.   I found that GNAQQ209L was extremely oncogenic in uveal melanocytes, but was far less so in dermal melanocytes. Furthermore, GNAQQ209L had completely opposite effects on melanocytes in the hair follicles versus inter-follicular areas of the epidermis and blocked SCPs from 70  differentiating into melanoblasts. I conclude from these observations that the downstream effects of GNAQQ209Lare unpredictably dependent upon cellular context.  These findings have serious implications for the development of uveal melanoma therapeutics, which are based upon targeting signaling components downstream of GNAQ and GNA11. Initially, the MAP kinase pathway was proposed as a therapeutic target, because it was found that the phosphorylation of extracellular signal-regulated kinase (ERK) was linked to GNAQQ209L expression in cultured melanocytes (Khalili et al., 2012; Van Raamsdonk et al., 2009; Van Raamsdonk et al., 2010). However, a small trial of the mitogen-activated protein-kinase kinase (MEK/MAPKK) inhibitor, trametinib, for GNAQ/11-mutant uveal melanoma patients was not successful (Falchook et al., 2012). Now PKC, PI3K, mTor, and YAP inhibitors are all in development, again based solely upon cell culture studies (Ho et al., 2012; Khalili et al., 2012; Wu et al., 2012; Yu et al., 2014). To extrapolate from my results, it is reasonable to assume that melanocytes receive no positional cues in culture, so their response to GNAQ and GNA11 may be different than that of uveal melanocytes in the eye. The search for downstream targets of GNAQ and GNA11 in uveal melanoma would be more precise if there were methods to maintain melanocyte positional identity in culture, such as co-culturing melanocytes with keratinocytes or fibroblasts.  The Rosa26-floxed stop-GNAQQ209L mice is the first mouse mutant to develop uveal melanoma. I note that the expression of Rosa26-floxed stop-GNAQQ209L induced by Mitf-cre was more potent than Rosa26-floxed stop-GNAQQ209L induced by Tyr-creER (Alizadeh et al., 2008; Bosenberg et al., 2006). This might be due to differences in the target population of melanocytes that express 71  these two transgenes. The transcription factor, Mitf, is a critical determinant of melanocyte cell fate and is expressed beginning around E10 (Levy et al., 2006). The expression of the melanogenic enzyme, Tyrosinase, initiates later during development, around E17 (Beermann et al., 1992). Therefore, Mitf might be expressed in cells with a higher proliferative potential such as stem cell populations. Recently, the promoter of another melanogenic enzyme, Dopachrome tautomerase (Dct), was used to drive transgenic GNAQQ209L expression in a tetracycline inducible mouse model beginning at 2 weeks of age (Feng et al., 2014). Like our Tyr-creER induced Rosa26-floxed stop-GNAQQ209L mice; no lesions were reported in these animals. Pigmentation in these mice could not be assessed because they have the FVB genetic background, which is albino. When the tumor suppressors, p16 and p19, were also knocked out, 50% of these mice developed lesions on the trunk by 9 months of age, but there were no reported effects on the eye. Thus, the development of inducible Mitf  transgenic lines might be very useful for refining mouse uveal melanoma models.  In summary, I have developed a mouse model of uveal melanoma and other pigmented neoplasms driven by GNAQQ209L. The rapid metastasis of melanoma cells to the lungs suggests that GNAQQ209L mutations may not only initiate uveal melanoma, but also contribute to tumor progression. Currently, studies on signaling pathways activated downstream of GNAQQ209L are performed using uveal melanoma cell lines, which lack the positional cues present in vivo. I have shown that these cues are very important for determining whether GNAQQ209L has a positive or negative effect on cellular growth/proliferation. The GNAQQ209L mutant mouse can now be used to determine whether GNAQQ209L activates the MAPK and the Hippo tumor suppressor pathway 72  in melanocytes in the uveal tract. Furthermore, the mice could be treated with small molecule inhibitors to test the role of these pathways in uveal melanoma tumorigenesis.  73  Bibliography  Abdel-Rahman, M. H., Pilarski, R., Cebulla, C. M., Massengill, J. B., Christopher, B. N., Boru, G., Hovland, P., and Davidorf, F. H. (2011). Germline BAP1 mutation predisposes to uveal melanoma, lung adenocarcinoma, meningioma, and other cancers. J Med Genet 48, 856-859. Adameyko, I., and Lallemend, F. (2010). Glial versus melanocyte cell fate choice: Schwann cell precursors as a cellular origin of melanocytes. Cell Mol Life Sci 67, 3037-3055. Adameyko, I., Lallemend, F., Aquino, J. B., Pereira, J. A., Topilko, P., Muller, T., Fritz, N., Beljajeva, A., Mochii, M., Liste, I., et al. (2009). Schwann cell precursors from nerve innervation are a cellular origin of melanocytes in skin. Cell 139, 366-379. Adameyko, I., Lallemend, F., Furlan, A., Zinin, N., Aranda, S., Kitambi, S. S., Blanchart, A., Favaro, R., Nicolis, S., Lubke, M., et al. (2012). Sox2 and Mitf cross-regulatory interactions consolidate progenitor and melanocyte lineages in the cranial neural crest. Development 139, 397-410. Alizadeh, A., Fitch, K. R., Niswender, C. M., McKnight, G. S., and Barsh, G. S. (2008). Melanocyte-lineage expression of Cre recombinase using Mitf regulatory elements. Pigment Cell Melanoma Res 21, 63-69. Anderson, M. G., Libby, R. T., Mao, M., Cosma, I. M., Wilson, L. A., Smith, R. S., and John, S. W. (2006). Genetic context determines susceptibility to intraocular pressure elevation in a mouse pigmentary glaucoma. BMC Biol 4, 20. Beermann, F., Schmid, E., and Schutz, G. (1992). Expression of the mouse tyrosinase gene during embryonic development: recapitulation of the temporal regulation in transgenic mice. Proc Natl Acad Sci U S A 89, 2809-2813. Bharti, K., Nguyen, M. T., Skuntz, S., Bertuzzi, S., and Arnheiter, H. (2006). The other pigment cell: specification and development of the pigmented epithelium of the vertebrate eye. Pigment Cell Res 19, 380-394. Bok, D. (1993). The retinal pigment epithelium: a versatile partner in vision. J Cell Sci Suppl 17, 189-195. Bosenberg, M., Muthusamy, V., Curley, D. P., Wang, Z., Hobbs, C., Nelson, B., Nogueira, C., Horner, J. W., 2nd, Depinho, R., and Chin, L. (2006). Characterization of melanocyte-specific inducible Cre recombinase transgenic mice. Genesis 44, 262-267. Buzzacco, D. M., Abdel-Rahman, M. H., Park, S., Davidorf, F., Olencki, T., and Cebulla, C. M. (2012). Long-term survivors with metastatic uveal melanoma. Open Ophthalmol J 6, 49-53. 74  Cable, J., Huszar, D., Jaenisch, R., and Steel, K. P. (1994). Effects of mutations at the W locus (c-kit) on inner ear pigmentation and function in the mouse. Pigment Cell Res 7, 17-32. Cable, J., and Steel, K. P. (1991). Identification of two types of melanocyte within the stria vascularis of the mouse inner ear. Pigment Cell Res 4, 87-101. Chow, R. L., and Lang, R. A. (2001). Early eye development in vertebrates. Annu Rev of Cell and Develop Biol 17, 255-296. Colombo, S., Berlin, I., Delmas, V., and Larue, L. (2011). Classical and Nonclassical Melanocytes in Vertebrates. In Melanins and Melanosomes,  (Wiley-VCH Verlag GmbH & Co. KGaA), pp. 21-61. Cornell, R. A., and Eisen, J. S. (2002). Delta/Notch signaling promotes formation of zebrafish neural crest by repressing Neurogenin 1 function. Development 129, 2639-2648. Costin, G. E., and Hearing, V. J. (2007). Human skin pigmentation: melanocytes modulate skin color in response to stress. FASEB J 21, 976-994. Deo, M., Huang, J. L., Fuchs, H., de Angelis, M. H., and Van Raamsdonk, C. D. (2013). Differential effects of neurofibromin gene dosage on melanocyte development. J Invest Dermatol 133, 49-58. Dhomen, N., Reis-Filho, J. S., da Rocha Dias, S., Hayward, R., Savage, K., Delmas, V., Larue, L., Pritchard, C., and Marais, R. (2009). Oncogenic Braf induces melanocyte senescence and melanoma in mice. Cancer Cell 15, 294-303. Doerflinger, N. H., Macklin, W. B., and Popko, B. (2003). Inducible site-specific recombination in myelinating cells. Genesis 35, 63-72. Dono, M., Angelini, G., Cecconi, M., Amaro, A., Esposito, A. I., Mirisola, V., Maric, I., Lanza, F., Nasciuti, F., Viaggi, S., et al. (2014). Mutation frequencies of GNAQ, GNA11, BAP1, SF3B1, EIF1AX and TERT in uveal melanoma: detection of an activating mutation in the TERT gene promoter in a single case of uveal melanoma. Br J Cancer 110, 1058-1065. Dorsky, R. I., Moon, R. T., and Raible, D. W. (1998). Control of neural crest cell fate by the Wnt signalling pathway. Nature 396, 370-373. Downes, G. B., and Gautam, N. (1999). The G protein subunit gene families. Genomics 62, 544-552. Dragatsis, I., and Zeitlin, S. (2001). A method for the generation of conditional gene repair mutations in mice. Nucleic Acids Res 29, E10. Dratviman-Storobinsky, O., Cohen, Y., Frenkel, S., Pe'er, J., and Goldenberg-Cohen, N. (2010). Lack of oncogenic GNAQ mutations in melanocytic lesions of the conjunctiva as compared to uveal melanoma. Invest Ophthalmol Vis Sci 51, 6180-6182. 75  Falchook, G. S., Lewis, K. D., Infante, J. R., Gordon, M. S., Vogelzang, N. J., DeMarini, D. J., Sun, P., Moy, C., Szabo, S. A., Roadcap, L. T., et al. (2012). Activity of the oral MEK inhibitor trametinib in patients with advanced melanoma: a phase 1 dose-escalation trial. Lancet Oncol 13, 782-789. Feil, R. (2007). Conditional somatic mutagenesis in the mouse using site-specific recombinases. Handb Exp Pharmacol, 3-28. Feil, S., Valtcheva, N., and Feil, R. (2009). Inducible Cre mice. Methods Mol Biol 530, 343-363. Feng, X., Degese, M. S., Iglesias-Bartolome, R., Vaque, J. P., Molinolo, A. A., Rodrigues, M., Zaidi, M. R., Ksander, B. R., Merlino, G., Sodhi, A., et al. (2014). Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a trio-regulated rho GTPase signaling circuitry. Cancer Cell 25, 831-845. Field, M. G., and Harbour, J. W. (2014a). GNAQ/11 mutations in uveal melanoma: is YAP the key to targeted therapy? Cancer Cell 25, 714-715. Field, M. G., and Harbour, J. W. (2014b). Recent developments in prognostic and predictive testing in uveal melanoma. Curr Opin Ophthalmol 25, 234-239. Fitch, K. R., McGowan, K. A., van Raamsdonk, C. D., Fuchs, H., Lee, D., Puech, A., Herault, Y., Threadgill, D. W., Hrabe de Angelis, M., and Barsh, G. S. (2003). Genetics of dark skin in mice. Genes Dev 17, 214-228. Forbes, S. A., Bindal, N., Bamford, S., Cole, C., Kok, C. Y., Beare, D., Jia, M., Shepherd, R., Leung, K., Menzies, A., et al. (2011). COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer. Nucleic Acids Res 39, D945-950. Fradette, J., Larouche, D., Fugere, C., Guignard, R., Beauparlant, A., Couture, V., Caouette-Laberge, L., Roy, A., and Germain, L. (2003). Normal human Merkel cells are present in epidermal cell populations isolated and cultured from glabrous and hairy skin sites. J Invest Dermatol 120, 313-317. Fuchs, E. (2007). Scratching the surface of skin development. Nature 445, 834-842. Fuchs, E., and Raghavan, S. (2002). Getting under the skin of epidermal morphogenesis. Nat Rev Genet 3, 199-209. Furney, S. J., Pedersen, M., Gentien, D., Dumont, A. G., Rapinat, A., Desjardins, L., Turajlic, S., Piperno-Neumann, S., de la Grange, P., Roman-Roman, S., et al. (2013). SF3B1 mutations are associated with alternative splicing in uveal melanoma. Cancer Discov 3, 1122-1129. Gessi, M., Hammes, J., Lauriola, L., Dorner, E., Kirfel, J., Kristiansen, G., zur Muehlen, A., Denkhaus, D., Waha, A., and Pietsch, T. (2013). GNA11 and N-RAS mutations: alternatives for MAPK pathway activating GNAQ mutations in primary melanocytic tumours of the central nervous system. Neuropathol Appl Neurobiol 39, 417-425. 76  Gleason, B. C., Crum, C. P., and Murphy, G. F. (2008). Expression patterns of MITF during human cutaneous embryogenesis: evidence for bulge epithelial expression and persistence of dermal melanoblasts. J Cutan Pathol 35, 615-622. Goldgeier, M. H., Klein, L. E., Klein-Angerer, S., Moellmann, G., and Nordlund, J. J. (1984). The distribution of melanocytes in the leptomeninges of the human brain. J Invest Dermatol 82, 235-238. Harbour, J. W., Onken, M. D., Roberson, E. D., Duan, S., Cao, L., Worley, L. A., Council, M. L., Matatall, K. A., Helms, C., and Bowcock, A. M. (2010). Frequent mutation of BAP1 in metastasizing uveal melanomas. Science 330, 1410-1413. Ho, A. L., Musi, E., Ambrosini, G., Nair, J. S., Deraje Vasudeva, S., de Stanchina, E., and Schwartz, G. K. (2012). Impact of combined mTOR and MEK inhibition in uveal melanoma is driven by tumor genotype. PLoS One 7, e40439. Hou, L., Panthier, J. J., and Arnheiter, H. (2000). Signaling and transcriptional regulation in the neural crest-derived melanocyte lineage: interactions between KIT and MITF. Development 127, 5379-5389. Hozumi, H., Takeda, K., Yoshida-Amano, Y., Takemoto, Y., Kusumi, R., Fukuzaki-Dohi, U., Higashitani, A., Yamamoto, H., and Shibahara, S. (2012). Impaired development of melanoblasts in the black-eyed white Mitf(mi-bw) mouse, a model for auditory-pigmentary disorders. Genes Cells 17, 494-508. Jablonski, N. G. (2004). The evolution of human skin and skin color. Annu Rev of Anthropol 33, 585-623. Jessen, K. R., and Mirsky, R. (2005). The origin and development of glial cells in peripheral nerves. Nat Rev Neurosci 6, 671-682. Kawaguchi, A., Chiba, K., Tanimura, Y., Motohashi, T., Aoki, H., Takeda, T., Hayashi, S., Shimizu, K., and Kunisada, T. (2008). Isolation and characterization of Kit-independent melanocyte precursors induced in the skin of Steel factor transgenic mice. Dev Growth Differ 50, 63-69. Khalili, J. S., Yu, X., Wang, J., Hayes, B. C., Davies, M. A., Lizee, G., Esmaeli, B., and Woodman, S. E. (2012). Combination small molecule MEK and PI3K inhibition enhances uveal melanoma cell death in a mutant GNAQ- and GNA11-dependent manner. Clin Cancer Res 18, 4345-4355. Kim, C. Y., Kim, D. W., Kim, K., Curry, J., Torres-Cabala, C., and Patel, S. (2014a). GNAQ mutation in a patient with metastatic mucosal melanoma. BMC Cancer 14, 516. Kim, H., Ankamreddy, H., Lee, D. J., Kong, K. A., Ko, H. W., Kim, M. H., and Bok, J. (2014b). Pax3 function is required specifically for inner ear structures with melanogenic fates. Biochem Biophys Res Commun 445, 608-614. 77  Kobayashi, T., Urabe, K., Winder, A., Jimenez-Cervantes, C., Imokawa, G., Brewington, T., Solano, F., Garcia-Borron, J. C., and Hearing, V. J. (1994). Tyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesis. EMBO J 13, 5818-5825. Kunisada, T., Yoshida, H., Yamazaki, H., Miyamoto, A., Hemmi, H., Nishimura, E., Shultz, L. D., Nishikawa, S., and Hayashi, S. (1998). Transgene expression of steel factor in the basal layer of epidermis promotes survival, proliferation, differentiation and migration of melanocyte precursors. Development 125, 2915-2923. Kusters-Vandevelde, H. V., Klaasen, A., Kusters, B., Groenen, P. J., van Engen-van Grunsven, I. A., van Dijk, M. R., Reifenberger, G., Wesseling, P., and Blokx, W. A. (2010a). Activating mutations of the GNAQ gene: a frequent event in primary melanocytic neoplasms of the central nervous system. Acta Neuropathol 119, 317-323. Kusters-Vandevelde, H. V., van Engen-van Grunsven, I. A., Kusters, B., van Dijk, M. R., Groenen, P. J., Wesseling, P., and Blokx, W. A. (2010b). Improved discrimination of melanotic schwannoma from melanocytic lesions by combined morphological and GNAQ mutational analysis. Acta Neuropathol 120, 755-764. Lamba, S., Felicioni, L., Buttitta, F., Bleeker, F. E., Malatesta, S., Corbo, V., Scarpa, A., Rodolfo, M., Knowles, M., Frattini, M., et al. (2009). Mutational profile of GNAQQ209 in human tumors. PLoS One 4, e6833. Landis, C. A., Masters, S. B., Spada, A., Pace, A. M., Bourne, H. R., and Vallar, L. (1989). GTPase inhibiting mutations activate the alpha chain of Gs and stimulate adenylyl cyclase in human pituitary tumours. Nature 340, 692-696. Le Douarin, N. M., Creuzet, S., Couly, G., and Dupin, E. (2004). Neural crest cell plasticity and its limits. Development 131, 4637-4650. Lee, H. O., Levorse, J. M., and Shin, M. K. (2003). The endothelin receptor-B is required for the migration of neural crest-derived melanocyte and enteric neuron precursors. Dev Biol 259, 162-175. Leone, D. P., Genoud, S., Atanasoski, S., Grausenburger, R., Berger, P., Metzger, D., Macklin, W. B., Chambon, P., and Suter, U. (2003). Tamoxifen-inducible glia-specific Cre mice for somatic mutagenesis in oligodendrocytes and Schwann cells. Mol Cell Neurosci 22, 430-440. Levy, C., Khaled, M., and Fisher, D. E. (2006). MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol Med 12, 406-414. Lin, J. Y., and Fisher, D. E. (2007). Melanocyte biology and skin pigmentation. Nature 445, 843-850. Mackenzie, I. C. (1997). Retroviral transduction of murine epidermal stem cells demonstrates clonal units of epidermal structure. J Invest Dermatol 109, 377-383. 78  Mackenzie, M. A., Jordan, S. A., Budd, P. S., and Jackson, I. J. (1997). Activation of the receptor tyrosine kinase Kit is required for the proliferation of melanoblasts in the mouse embryo. Dev Biol 192, 99-107. Markby, D. W., Onrust, R., and Bourne, H. R. (1993). Separate GTP binding and GTPase activating domains of a G alpha subunit. Science 262, 1895-1901. Martin, M., Masshofer, L., Temming, P., Rahmann, S., Metz, C., Bornfeld, N., van de Nes, J., Klein-Hitpass, L., Hinnebusch, A. G., Horsthemke, B., et al. (2013). Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3. Nat Genet 45, 933-936. Meyer zum Gottesberge, A. M. (1988). Physiology and pathophysiology of inner ear melanin. Pigment Cell Res 1, 238-249. Moll, I., Roessler, M., Brandner, J. M., Eispert, A. C., Houdek, P., and Moll, R. (2005). Human Merkel cells--aspects of cell biology, distribution and functions. Eur J Cell Biol 84, 259-271. Mota, L. A., and Santos, A. B. (2010). Vogt-Koyanagi-Harada's syndrome and its multisystem involvement. Rev Assoc Med Bras 56, 590-595. Murali, R., Wiesner, T., Rosenblum, M. K., and Bastian, B. C. (2012). GNAQ and GNA11 mutations in melanocytomas of the central nervous system. Acta Neuropathol 123, 457-459. Navarrete, C. M., Ruah, C. B., Schachern, P., and Paparella, M. M. (1995). Normal and metastatic melanin in the temporal bone. Am J Otolaryngol 16, 33-39. Nickla, D. L., and Wallman, J. (2010). The multifunctional choroid. Prog Retin Eye Res 29, 144-168. Offermanns, S., Zhao, L. P., Gohla, A., Sarosi, I., Simon, M. I., and Wilkie, T. M. (1998). Embryonic cardiomyocyte hypoplasia and craniofacial defects in G alpha q/G alpha 11-mutant mice. EMBO J 17, 4304-4312. Oldham, W. M., and Hamm, H. E. (2008). Heterotrimeric G protein activation by G-protein-coupled receptors. Nat Rev Mol Cell Biol 9, 60-71. Onken, M. D., Worley, L. A., Ehlers, J. P., and Harbour, J. W. (2004). Gene expression profiling in uveal melanoma reveals two molecular classes and predicts metastatic death. Cancer Res 64, 7205-7209. Parichy, D. M., Reedy, M. V., and Erickson, C. A. (2007). Regulation of Melanoblast Migration and Differentiation. In The Pigmentary System,  (Blackwell Publishing Ltd), pp. 108-139. Pasparakis, M., Haase, I., and Nestle, F. O. (2014). Mechanisms regulating skin immunity and inflammation. Nat Rev Immunol 14, 289-301. 79  Payne, A. P. (1994). The harderian gland: a tercentennial review. J Anat 185 ( Pt 1), 1-49. Pereira, P. R., Odashiro, A. N., Lim, L. A., Miyamoto, C., Blanco, P. L., Odashiro, M., Maloney, S., De Souza, D. F., and Burnier, M. N., Jr. (2013). Current and emerging treatment options for uveal melanoma. Clin Ophthalmol 7, 1669-1682. Pollock, P. M., Cohen-Solal, K., Sood, R., Namkoong, J., Martino, J. J., Koganti, A., Zhu, H., Robbins, C., Makalowska, I., Shin, S. S., et al. (2003). Melanoma mouse model implicates metabotropic glutamate signaling in melanocytic neoplasia. Nat Genet 34, 108-112. Quevedo, W. C., and Holstein, T. J. (2007). General Biology of Mammalian Pigmentation. In The Pigmentary System,  (Blackwell Publishing Ltd), pp. 61-90. Royo, J. L., Hidalgo, M., and Ruiz, A. (2007). Pyrosequencing protocol using a universal biotinylated primer for mutation detection and SNP genotyping. Nat Protocols 2, 1734-1739. Scherer, D., and Kumar, R. (2010). Genetics of pigmentation in skin cancer--a review. Mutat Res 705, 141-153. Shin, M. K., Levorse, J. M., Ingram, R. S., and Tilghman, S. M. (1999). The temporal requirement for endothelin receptor-B signalling during neural crest development. Nature 402, 496-501. Singh, A. D., Turell, M. E., and Topham, A. K. (2011). Uveal melanoma: trends in incidence, treatment, and survival. Ophthalmology 118, 1881-1885. Slominski, A., Tobin, D. J., Shibahara, S., and Wortsman, J. (2004). Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol Rev 84, 1155-1228. Smith, A. B., Rushing, E. J., and Smirniotopoulos, J. G. (2009). Pigmented lesions of the central nervous system: radiologic-pathologic correlation. Radiographics 29, 1503-1524. Sondek, J., Lambright, D. G., Noel, J. P., Hamm, H. E., and Sigler, P. B. (1994). GTPase mechanism of Gproteins from the 1.7-A crystal structure of transducin alpha-GDP-AIF-4. Nature 372, 276-279. Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21, 70-71. Sviderskaya, E. V., Bennett, D. C., Ho, L., Bailin, T., Lee, S. T., and Spritz, R. A. (1997). Complementation of hypopigmentation in p-mutant (pink-eyed dilution) mouse melanocytes by normal human P cDNA, and defective complementation by OCA2 mutant sequences. J Invest Dermatol 108, 30-34. Takeda, K., Takahashi, N. H., and Shibahara, S. (2007). Neuroendocrine functions of melanocytes: beyond the skin-deep melanin maker. Tohoku J Exp Med 211, 201-221. 80  Thody, A. J., Higgins, E. M., Wakamatsu, K., Ito, S., Burchill, S. A., and Marks, J. M. (1991). Pheomelanin as well as eumelanin is present in human epidermis. J Invest Dermatol 97, 340-344. Thomas, A. J., and Erickson, C. A. (2008). The making of a melanocyte: the specification of melanoblasts from the neural crest. Pigment Cell Melanoma Res 21, 598-610. Thomas, A. J., and Erickson, C. A. (2009). FOXD3 regulates the lineage switch between neural crest-derived glial cells and pigment cells by repressing MITF through a non-canonical mechanism. Development 136, 1849-1858. Uhlen, M., Bjorling, E., Agaton, C., Szigyarto, C. A., Amini, B., Andersen, E., Andersson, A. C., Angelidou, P., Asplund, A., Asplund, C., et al. (2005). A human protein atlas for normal and cancer tissues based on antibody proteomics. Mol Cell Proteomics 4, 1920-1932. Van Raamsdonk, C. D., Bezrookove, V., Green, G., Bauer, J., Gaugler, L., O'Brien, J. M., Simpson, E. M., Barsh, G. S., and Bastian, B. C. (2009). Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature 457, 599-602. Van Raamsdonk, C. D., Fitch, K. R., Fuchs, H., de Angelis, M. H., and Barsh, G. S. (2004). Effects of G-protein mutations on skin color. Nat Genet 36, 961-968. Van Raamsdonk, C. D., Griewank, K. G., Crosby, M. B., Garrido, M. C., Vemula, S., Wiesner, T., Obenauf, A. C., Wackernagel, W., Green, G., Bouvier, N., et al. (2010). Mutations in GNA11 in uveal melanoma. N Engl J Med 363, 2191-2199. Wakaoka, T., Motohashi, T., Hayashi, H., Kuze, B., Aoki, M., Mizuta, K., Kunisada, T., and Ito, Y. (2013). Tracing Sox10-expressing cells elucidates the dynamic development of the mouse inner ear. Hear Res 302, 17-25. Weinstein, L. S., Shenker, A., Gejman, P. V., Merino, M. J., Friedman, E., and Spiegel, A. M. (1991). Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 325, 1688-1695. Wettschureck, N., and Offermanns, S. (2005). Mammalian G proteins and their cell type specific functions. Physiol Rev 85, 1159-1204. White, R. M., and Zon, L. I. (2008). Melanocytes in development, regeneration, and cancer. Cell Stem Cell 3, 242-252. Woodhoo, A., and Sommer, L. (2008). Development of the Schwann cell lineage: from the neural crest to the myelinated nerve. Glia 56, 1481-1490. Wu, X., Li, J., Zhu, M., Fletcher, J. A., and Hodi, F. S. (2012). Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kappaB pathways. Mol Cancer Ther 11, 1905-1914. 81  Yajima, I., and Larue, L. (2008). The location of heart melanocytes is specified and the level of pigmentation in the heart may correlate with coat color. Pigment Cell Melanoma Res 21, 471-476. Yoshida, H., Kunisada, T., Grimm, T., Nishimura, E. K., Nishioka, E., and Nishikawa, S. I. (2001). Review: melanocyte migration and survival controlled by SCF/c-kit expression. J Investig Dermatol Symp Proc 6, 1-5. Yu, F. X., Luo, J., Mo, J. S., Liu, G., Kim, Y. C., Meng, Z., Zhao, L., Peyman, G., Ouyang, H., Jiang, W., et al. (2014). Mutant Gq/11 promote uveal melanoma tumorigenesis by activating YAP. Cancer Cell 25, 822-830. Zecca, L., Bellei, C., Costi, P., Albertini, A., Monzani, E., Casella, L., Gallorini, M., Bergamaschi, L., Moscatelli, A., Turro, N. J., et al. (2008a). New melanic pigments in the human brain that accumulate in aging and block environmental toxic metals. Proc Natl Acad Sci USA 105, 17567-17572. Zecca, L., Casella, L., Albertini, A., Bellei, C., Zucca, F. A., Engelen, M., Zadlo, A., Szewczyk, G., Zareba, M., and Sarna, T. (2008b). Neuromelanin can protect against iron-mediated oxidative damage in system modeling iron overload of brain aging and Parkinson's disease. J Neurochem 106, 1866-1875. Zecca, L., Tampellini, D., Gatti, A., Crippa, R., Eisner, M., Sulzer, D., Ito, S., Fariello, R., and Gallorini, M. (2002). The neuromelanin of human substantia nigra and its interaction with metals. J Neural Transm 109, 663-672. Zecca, L., Youdim, M. B., Riederer, P., Connor, J. R., and Crichton, R. R. (2004). Iron, brain ageing and neurodegenerative disorders. Nat Rev Neurosci 5, 863-873.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167641/manifest

Comment

Related Items