UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Campylobacter jejuni metabolism in survival and host cell interactions Pryjma, Mark Christopher 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_september_pryjma_mark.pdf [ 3.47MB ]
Metadata
JSON: 24-1.0167574.json
JSON-LD: 24-1.0167574-ld.json
RDF/XML (Pretty): 24-1.0167574-rdf.xml
RDF/JSON: 24-1.0167574-rdf.json
Turtle: 24-1.0167574-turtle.txt
N-Triples: 24-1.0167574-rdf-ntriples.txt
Original Record: 24-1.0167574-source.json
Full Text
24-1.0167574-fulltext.txt
Citation
24-1.0167574.ris

Full Text

Campylobacter jejuni metabolism in survival and host cell interactions  by  Mark Christopher Pryjma  B.Sc.H., University of Toronto, 2007  A thesis submitted in partial fulfillment of  the requirements for the degree of   Doctor of Philosophy in  The Faculty of Graduate and Postdoctoral Studies (Microbiology and Immunology)  The University of British Columbia  (Vancouver) July 2014  ©Mark Christopher Pryjma, 2014 ii  Abstract Campylobacter jejuni is a leading cause of foodborne bacterial gastroenteritis in both developed and developing nations. Although C. jejuni is a common environmentally acquired pathogen, it is quite fastidious, rapidly losing viability in aerobic conditions. Genome sequence analyses have failed to identify classical virulence factors, making the pathogenic success of C. jejuni a mystery. Mutational analysis described herein identified novel metabolic factors that are important for infection of human epithelial cells as well as generation of oxidative stress in C. jejuni during aerobic incubation. Investigation of a novel operon, fdhTU, induced during C. jejuni epithelial infection, showed that FdhTU positively regulates formate dehydrogenase. Subsequent analyses found that fdhTU and formate dehydrogenase are important for recovery of C. jejuni from epithelial cells. Further work showed that intracellular C. jejuni are undergoing oxidative stress, and that neutralization of oxidative stress with sulfite or catalase could significantly enhance recovery of C. jejuni following epithelial cell infection. Analyses of other respiratory dehydrogenases failed to identify other systems important for recovery of C. jejuni from epithelial cells, but did identify a role for gluconate dehydrogenase in reducing necrosis in T84 epithelial cells in a reactive oxygen species- and calpain-dependent manner. In addition to the importance for epithelial cell infection, metabolic features were also found to be involved in causing oxidative stress in C. jejuni under aerobic conditions. C. jejuni was found to produce H2O2 when incubated in aerobic but not microaerobic conditions at 37ºC but not 4ºC, with formate dehydrogenase and sulfite oxidoreductase dependent respiration important for H2O2 production. Sulfite and cysteine could reduce C. jejuni loss of viability in aerobic conditions in a manner dependent on the sulfur assimilation pathway protein Atps. Atps was identified as important for aerobic survival, H2O2 resistance, and in reducing H2O2 produced by formate dehydrogenase dependent respiration. Characterization of the role of multiple respiratory systems in C. jejuni, a bacterial model that shares little with other iii  common pathogenic bacteria, has identified a central role of respiration in epithelial cell infection and environmental survival.     iv  Preface  All chapters are based on experimental design from Mark Pryjma and Professor Dr. Erin Gaynor. All experiments were performed by Mark Pryjma in the laboratory of Dr. Erin Gaynor (Department of Microbiology and Immunology, UBC, Vancouver BC) unless otherwise stated.  Data presented in chapter 2 have been published (Pryjma et al. 2012. “FdhTU-modulated formate dehydrogenase expression and electron donor availability enhance recovery of Campylobacter jejuni following host cell infection”. J. Bacteriol. 194(15):3803-13). Microarray analysis of differential gene regulation in an fdhU background described in chapter 2 was performed by Steven Huynh and Dr. Craig Parker at the United States Department of Agriculture (USDA) Western Research Center in Albany, CA. Measurement of oxygen consumption with a Clark type electrode was performed by Mark Pryjma in the lab of Dr. Lindsay Eltis (Department of Microbiology and Immunology, UBC, Vancouver BC) with help from Jenna Capyk. The Olympus Fluoview FV1000 laser scanning confocal microscope from Dr. Robert Nabi’s lab (Department of Cellular & Physiological Sciences UBC, Vancouver BC) was used with equipment training conducted by Pascal St. Pierre.  Data presented in chapter 3 are in late stages of preparation for publication (Title pending). All experiments were performed by Mark Pryjma. Where appropriate the Varioskan Flash luminometer plate reader from Dr. Steven Hallam’s lab (Department of Microbiology and Immunology, UBC, Vancouver BC), and the Olympus Fluoview FV1000 laser scanning confocal microscope from Dr. Robert Nabi’s lab.  Data presented in chapter 4 are in late stages of preparation for publication (Title pending). All experiments were performed by Mark Pryjma. Where appropriate, the Varioskan Flash luminometer plate reader from Dr. Steven Hallam’s lab was utilized.  v  In addition, Mark Pryjma was an author on the following additional publications during his Ph.D. studies: Naito, M., Frirdich, E., Fields, J., Pryjma, M., Li, J., Cameron, A., Gilbert, M., Thompson, S.T., Gaynor, E.C. 2010. “Effects of sequential Campylobacter jejuni 81-176 lipooligosaccharide core truncations on biofilm formation, stress survival, and pathogenesis”. J Bacteriol. 192(8):2182-92. Apel, D., Ellermeier, J., Pryjma, M., DiRita, V.J.., Gaynor, E.C. 2012. “Characterization of Campylobacter jejuni RacRS reveals roles in the heat shock response, motility, and maintenance of cell length homogeneity”. J Bacteriol. 194(9):2342-54. Svensson, S.L., Pryjma, M., Gaynor, E.C. “Flagella-mediated adhesion and extracellular DNA release contribute to biofilm formation and stress tolerance of Campylobacter jejuni”. In revision, PLOS One.  Frirdich E., et al. Title in progress (Campylobacter jejuni transition to coccoid morphology). In preparation.                   vi   Table of Contents  Abstract ......................................................................................................................................................... ii Preface ......................................................................................................................................................... iv Table of Contents ......................................................................................................................................... vi List of Tables ................................................................................................................................................. x List of Figures ............................................................................................................................................... xi List of Abbreviations ...................................................................................................................................xiii Chapter 1:...................................................................................................................................................... 1 General introduction ..................................................................................................................................... 1 1.1: Characteristics, prevalence and treatment of Campylobacter jejuni ................................................ 1 1.1.1: Disease caused by C. jejuni ......................................................................................................... 1 1.1.2: Epidemiology of C. jejuni ............................................................................................................. 2 1.1.3: Sources of C. jejuni infection and treatment .............................................................................. 3 1.2: General characteristics of C. jejuni that contribute to pathogenesis ................................................ 3 1.2.1: Flagella, motility and chemotaxis ............................................................................................... 4 1.2.2: Surface polysaccharides .............................................................................................................. 5 1.3: Host cell invasion and intracellular survival in C. jejuni infection ...................................................... 5 1.3.1: CadF-mediated invasion of epithelial cells through membrane ruffling .................................... 6 1.3.2: Intracellular localization of C. jejuni in host epithelial cells ........................................................ 7 1.4: The electron transport chain and respiratory dehydrogenases ........................................................ 8 1.4.1: C. jejuni has an intact but atypical electron transport chain ...................................................... 9 1.4.2: C. jejuni electron donors and acceptors ................................................................................... 10 1.5: C. jejuni regulators of metabolism ................................................................................................... 13 1.6: Host cell death pathways ................................................................................................................. 15 1.6.1: Induction of necrosis through the necrosome ......................................................................... 15 1.6.2: Initiation of mitochondrial oxidative stress and its role in necrosis ......................................... 17 1.6.3: Calcium, calpain and cellular modification ............................................................................... 18 1.7: Generation of ROS in bacteria ......................................................................................................... 20 vii  1.8: C. jejuni oxidative stress resistance ................................................................................................. 22 1.9: Sulfur assimilation pathway ............................................................................................................. 24 1.10: Rationale and aims ......................................................................................................................... 25 Chapter 2:.................................................................................................................................................... 28 FdhTU-modulated formate dehydrogenase expression and electron donor availability enhance recovery of Campylobacter jejuni following host cell infection................................................................................. 28 2.1: Introduction and synopsis ................................................................................................................ 28 2.2: Materials and methods .................................................................................................................... 29 2.2.1: Bacterial strains and growth conditions ................................................................................... 29 2.2.2: Construction of ΔfdhU, ΔfdhT, ΔfdhA, and ΔfdhUΔfdhA mutants and ΔfdhUC and ΔfdhTC complemented strains ........................................................................................................................ 29 2.2.3: Generation of cDNA for microarray and RT-PCR analyses ........................................................ 31 2.2.4: Transcript analysis of cDNA ...................................................................................................... 31 2.2.5: Construction and analysis of the C. jejuni DNA microarray ...................................................... 31 2.2.6: Gentamicin assay for adherence and invasion of host epithelial cells ..................................... 32 2.2.7: Processing of C. jejuni for confocal microscopy ........................................................................ 33 2.2.8: Measurement of respiration rates by oxygen uptake .............................................................. 34 2.3: Results .............................................................................................................................................. 35 2.3.1: fdhT and fdhU are co-transcribed and selectively conserved in a range of bacterial species .. 35 2.3.2: ΔfdhU and ΔfdhT mutants exhibit apparent host cell adherence and/or invasion defects by colony-forming unit (CFU) enumeration but not by direct microscopic counts of intracellular bacteria ............................................................................................................................................... 38 2.3.3: Transcript analysis reveals down-regulation of genes required for Fdh activity in the ΔfdhU mutant strain ...................................................................................................................................... 42 2.3.4: fdhU is required for respiration-dependent oxygen consumption using formate as an electron donor ................................................................................................................................................... 43 2.3.5: The ΔfdhA mutant displays similar cell infection phenotypes as ΔfdhU .................................. 44 2.3.6: Supplementation of recovery plates with sulfite enhances CFU counts of C. jejuni following host cell infection and leads to equivalent recovery of WT, ΔfdhU and ΔfdhA strains ...................... 45 2.4: Discussion ........................................................................................................................................ 47 Chapter 3:.................................................................................................................................................... 52 The role of sulfite in enhanced recovery of C. jejuni from host cells and the importance of gluconate dehydrogenase in inducing enhanced host cell necrosis. .......................................................................... 52 viii  3.1: Introduction and synopsis ................................................................................................................ 52 3.2: Materials and methods .................................................................................................................... 53 3.2.1: Reagents.................................................................................................................................... 53 3.2.2: Bacterial growth conditions ...................................................................................................... 53 3.2.3: Construction of strains .............................................................................................................. 54 3.2.4: Passaging of Caco2 and T84 epithelial cells .............................................................................. 55 3.2.5: Infection assay of epithelial cells .............................................................................................. 55 3.2.6: Assessment of intracellular transcription of C. jejuni genes ..................................................... 57 3.2.7: Assessment of extracellular H2O2 and intracellular ROS production from host cells ............... 58 3.2.8: Assessment of IL-8 and TNF-α expression from infected T84 cells ........................................... 58 3.2.9: Assessment of epithelial cell death by LDH release assay ........................................................ 59 3.3: Results .............................................................................................................................................. 59 3.3.1: Enhanced recovery of C. jejuni from tissue culture cells on sulfite recovery media is due to neutralization of H2O2 produced by the host cells .............................................................................. 59 3.3.2: Inactivation of gluconate dehydrogenase increased non-apoptotic lysis of host cells ............ 64 3.3.3: A Δgdh mutant induces lower transcription of IL-8 and TNF-α, but enhances host cell death in T84 cells............................................................................................................................................... 67 3.3.4: Host cell death initiated by WT and Δgdh C. jejuni shows characteristics of programmed necrosis ............................................................................................................................................... 70 3.3.5: Induction of programmed necrosis is dependent on mitochondrial ROS but independent of Rip1 ..................................................................................................................................................... 73 3.4: Discussion ........................................................................................................................................ 74 Chapter 4:.................................................................................................................................................... 82 Campylobacter jejuni produces formate dehydrogenase- and sulfite oxidoreductase-dependent H2O2 in aerobic conditions, and the sulfur assimilation pathway is important for aero-tolerance. ....................... 82 4.1: Introduction and synopsis ................................................................................................................ 82 4.2: Materials and Methods .................................................................................................................... 83 4.2.1: Bacterial growth conditions ...................................................................................................... 83 4.2.2: Generation of deletion strains .................................................................................................. 83 4.2.3: Assessment of C. jejuni viability in the presence of metabolites or H2O2 ................................. 84 4.2.4: Determination of H2O2 concentration ....................................................................................... 84 4.2.5: Caco2 epithelial cell infection ................................................................................................... 85 4.3: Results .............................................................................................................................................. 85 ix  4.3.1: C. jejuni produces enhanced H2O2 during incubation in aerobic but not microaerobic conditions, and at 37ºC but not 4ºC .................................................................................................... 85 4.3.2: Aerobic incubation of C. jejuni with formate enhanced H2O2 production dependent on Fdh and correlates with enhanced aero-tolerance of ΔfdhA .................................................................... 88 4.3.3: Sulfite and cysteine supplementation can prevent the loss of C. jejuni viability under aerobic growth and is dependent on Sor activity ............................................................................................ 90 4.3.4: H2O2 formation in the presence of sulfite is dependent on Sor ............................................... 92 4.3.5: The sulfur capture system is important for aerobic survival as well as enhanced aerobic survival with sulfite and cysteine ........................................................................................................ 95 4.3.6: The Δatps mutant is defective for infection of host cells ......................................................... 98 4.4: Discussion ........................................................................................................................................ 99 Chapter 5:.................................................................................................................................................. 106 General discussion .................................................................................................................................... 106 5.1: Summary ........................................................................................................................................ 106 5.2: FdhTU is important for regulation of fdh and recovery from host epithelial cells ........................ 107 5.3: C. jejuni metabolism in infection and induction of necrosis .......................................................... 110 5.4: C. jejuni produces ROS species in aerobic conditions .................................................................... 113 5.5: Role of sulfur assimilation in aero-tolerance ................................................................................. 115 5.6: Final thoughts ................................................................................................................................ 116 References ................................................................................................................................................ 117 Appendix 1: Primer List ............................................................................................................................. 135 Appendix 2: List of Plasmids ..................................................................................................................... 139 Appendix 3: List of Strains ......................................................................................................................... 140         x  List of Tables  Table 1.1: Host infection and colonization phenotypes of respiratory dehydrogenase mutants from previous work ............................................................................................................................................. 13 Table 2.1: FdhT and FdhU are conserved in a variety of bacterial species. Shown are select homologs derived from BLAST searches of FdhT and FdhU against other bacterial genomes. .................................. 37                      xi   List of Figures  Figure 1.1. Signaling cascade activated by C. jejuni cell surface binding ...................................................... 7 Figure 1.2. Intracellular lifecycle of C. jejuni in epithelial cells ..................................................................... 8 Figure 1.3. Flux of electrons from pyruvate flavin oxidoreductase (PFOR) to Complex I NADH dehydrogenase (Nuo/Comp. I) ................................................................................................................... 10 Figure 1.4. Electron acceptors and donors of the respiratory chain in C. jejuni ........................................ 13 Figure 1.5. The different complexes associated with the tumor necrosis factor receptor (TNFR) ............ 17 Figure 1.6. Steps associated with the induction and progression of necrosis ........................................... 20 Figure 1.7. ROS production in bacteria ....................................................................................................... 22 Figure 1.8. The sulfur assimilation pathway. .............................................................................................. 25 Figure 2.1. The genomic organization and co-transcription of fdhT and fdhU. ......................................... 36 Figure 2.2. The effect of FdhU and FdhT on intracellular survival and association with Caco2 cells ......... 39 Figure 2.3. The role of FdhU and FdhT in invasion of Caco2 cells .............................................................. 42 Figure 2.4. Regulation of fdhA, fdhT and fdhU operons in ΔfdhU and ΔfdhT mutant strains .................... 43 Figure 2.5. Respiration-dependent oxygen consumption in the presence of formate in WT, ΔfdhU, ΔfdhUC and ΔfdhA strains ............................................................................................................................ 44 Figure 2.6. The intracellular survival and association with Caco2 cells in C. jejuni WT, ΔfdhU, ΔfdhA and ΔfdhUΔfdhA  strains .................................................................................................................................... 45 Figure 2.7. Intracellular recovery of viable WT, ΔfdhU and ΔfdhA strains from Caco2 cells on plates supplemented with the alternative electron donor sodium sulfite ........................................................... 47 Figure 3.1. Intracellular survival, association and GM130 colocalization of ΔsorA in Caco2 cells and the effect of SorA on recovery from host cells when plated on sulfite ............................................................ 61 Figure 3.2. The expression of C. jejuni oxidative stress genes in intracellular C. jejuni, the production of H2O2 by Caco2 cells infected with C. jejuni and the effect of H2O2 scavengers on recovery of C. jejuni from Caco2 cells ................................................................................................................................................... 63 Figure 3.3. Intracellular survival, association, and GM130 colocalization of Δgdh in Caco2 cells ............. 65 Figure 3.4. Intracellular survival, association and GM130 colocalization of Δmdh, ΔputA, and ΔhydB in Caco2 cells ................................................................................................................................................... 67 Figure 3.5. The role of Δgdh on induction of host cell death in C. jejuni infected T84 cells and the regulation of hypoxia regulated genes during C. jejuni infection ............................................................... 69 Figure 3.6. The differential transcription of the genes encoding TNF-α and IL-8 in T84 cells infected with WT, Δgdh and Δgdh-C C. jejuni ................................................................................................................... 70 Figure 3.7. The effect of death pore blockers and calpain inhibition on induction of host cell death in T84 cells infected with WT and Δgdh C. jejuni and the role of calpain inhibitor ALLN in apoptosis in infected cells. ............................................................................................................................................................ 72 Figure 3.8. The effect of inhibition of the necrosome and mitochondrial ROS production on induction of cell death in T84 cells infected with WT and Δgdh C. jejuni ....................................................................... 74 xii  Figure 4.1. Temperature and O2-dependence of H2O2 accumulation and cell viability in cultures of C. jejuni. ........................................................................................................................................................... 87 Figure 4.2. Effect of formate and Fdh on C. jejuni H2O2 production and viability in aerobic conditions. .. 89 Figure 4.3. The effect of SorA, CydA, and Cj0358/Cj0020 on C. jejuni aerobic viability with sulfite and cysteine media supplementation ............................................................................................................... 92 Figure 4.4. Effect of sulfite and SorA on H2O2 production by C. jejuni in microaerobic or aerobic conditions .................................................................................................................................................... 94 Figure 4.5. The effect of Atps and CysM on C. jejuni viability in aerobic conditions with sulfite and cysteine media supplementation, and the effect of AtpS on C. jejuni H2O2 sensitivity, peroxidase activity and H2O2 production. .................................................................................................................................. 97 Figure 4.6. The effect of Atps on C. jejuni infection of Caco2 intestinal epithelial cells............................. 99                   xiii  List of Abbreviations  5-ASA 5-Amino sialic acid AEBSF 4- benzenesulfonyl fluoride hydrochloride AhpC Alkylhydroperoxidase ALLN Ac-LLnL-CHO, MG-101, N-Acetyl-L-leucyl-L-leucyl-L-norleucinal APS Adenine phosposulfate Apsk Adenine phosposulfate kinase ArgT lysine/arginine/ornithine transport protein AtpF ATP synthetase F subunit Atps ATP sulfurylase BAPTA-AM 1,2-Bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester) Caco2 Colorectal adenocarcinoma cells CadF Fibronectin binding protein Campto camptothecin CcoNPQRS cytochrome c oxidase terminal oxidase CCV Campylobacter containing vesicle Cdc42 Cell division control protein 42 cDNA complementary DNA CFU Colony forming units CosR Campylobacter oxidative stress regulator  CprRS Campylobacter planktonic regulator CydAB Cytochrome bd oxidase CYLD Cylindromatosis protein CysM Cysteine synthase CysTWAM Cysteine importer DAPI 4',6-diamidino-2-phenylindole DMEM Delbacco's modified essential media Dock180 Dedicator of cytokinesis 180  Dps DNA-binding proteins from starved cells protein EEA1 Early endosome antigen 1 EGFR Epidermal growth factor receptor F12 Ham's F12 nutrient mixture FAK Focal adhesion kinase FBS Fetal bovine serum Fdh Formate dehydrogenase FdhT Fdh transporter FdhU Fdh regulator FlaA Flagellin A FlaB Flagellin B GAPDH Glyceraldehyde 3-phosphate dehydrogenase  GBS Guillain–Barré syndrome Gdh Gluconate dehydrogenase gDNA Genomic DNA GFP Green fluorescent protein xiv  Glut-1 Glucose transporter member 1 GM130 130kDa Golgi matrix protein HrcA Heat regulation at CIRCE regulator  HspR Heat shock protein repressor  HtrA High temperature requirement HydAB Hydrogenase IBD Inflammatory bowel disease IBS Irritable bowel syndrome IL-8 Interleukin-8 INT407 Human intestinal cell line KatA Catalase LAMP1 Lysosomal-associated membrane protein 1  LB Luria broth LDH Lactate dehydrogenase LysR LysA regulator  Mdh Malate dehydrogenase MDL-28170 N-[(1S)-1-[[(1-formyl-2-phenylethyl)amino]carbonyl]-2-methylpropyl]-carbamic acid, Phenylmethyl ester MEM Minimal essential media MH-TV Muller-Hinton broth with trimethoprim and vancomicin MLKL Mixed lineage kinase domain-like protein MsrAB Methionine sulphoxide reductases NADH Nicotinamide adenine dinucleotide NADPH Nicotinamide adenine dinucleotide phosphate NFĸB nuclear factor ĸ-light-chain-enhancer of activated B cells NMR Nuclear magnetic resonance NOX NADPH oxidase Nuo NADH:Ubiquinone oxidoreductase OOR Oxaloacetate oxido-reductase PAP Phospho-adenosine phosphate PAPS Phospho-adenosine phosphosulfate Papsr Phospho-adenosine phosphosulfate reductase PBS Phosphate buffered saline PD-15060 (2Z)-3-(4-iodophenyl)-2-mercapto-2-Propenoic acid, 3-(4-iodophenyl)-2-mercapto-(Z)-2-propenoic acid PEG6000 Polyethyleneglycol 6000 PEG8000 Polyethyleneglycol 8000 PerR Peroxide stress regulator PFA Paraformaldehyde PFOR Pyruvate flavin oxidoreductase PI3K Phosphoinositide 3-kinase Ppi Polyphosphate PutA Proline dehydrogenase PutP Proline uptake transporter RacRS Reduced ability to colonize regulator Rip1 Receptor interacting protein 1 Rip3 Receptor interacting protein 3 RNS Reactive nitrogen species xv  ROS Reactive oxygen species RpoA RNA polymerase RT-qPCR Reverse transcription-quantitative PCR Se Selenium SirA Sporulation inhibitor of replication family protein SodB Superoxide dismutase SorAB Sulfite oxidoreductase SpoT Stringent response regulator Src Src family kinase  SSIII SuperScript III T84 Metastatic colon tumor cell line TE Buffer Tris EDTA buffer TLR Toll like receptor TNF Tumor necrosis factor TNFR Tumor necrosis factor receptor TsdA Thiosulphate dehydrogenase TusA tRNA 2-thiouridine synthesizing protein  Vav2 Vav family protein 2 VEGF Vascular endothelial growth factor WT Wild type XO-1 Xanthine oxidase Z-VAD-FMK N-Benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone   1  Chapter 1:  General introduction 1.1: Characteristics, prevalence and treatment of Campylobacter jejuni Campylobacter jejuni is a helical, motile, Gram-negative bacterium. It was first described as a pediatric infectious disease as early as the 1970’s (37, 126), and since then has been established as a major emerging pathogen and a leading source of bacterial gastroenteritis in many areas. Up to 1% of the population of the developed world contracts a new C. jejuni infection each year (26, 130, 269). C. jejuni belongs to the diverse Campylobacteraceae family which includes the human pathogens C. coli and C. concisus, as well as the important animal pathogen C. fetus (188).  C. jejuni is a member of the epsilon class of Proteobacteria along with Helicobacter pylori, a broad colonizer of human gastric linings and a causative agent of gastric ulcers and gastric cancer (2, 174), and extremophiles, such as Sulfurovum lithotrophicum and Nitratiruptor tergarcus  that live in deep sea hydrothermal vents (200). It has been hypothesized that many of the atypical metabolic pathways present in C. jejuni may be due to an evolutionary lineage originating in extremophiles.   1.1.1: Disease caused by C. jejuni Over the last 30 years, C. jejuni has emerged as a major source of morbidity in the developed world (306). The most common disease associated with C. jejuni infection is watery to bloody diarrhea lasting 1-10 days (36, 47). Post-infectious sequelae associated with infection can also occur and result in minor to severe pathologies. C. jejuni is the most common cause of Guillain–Barré Syndrome (GBS), causing about 40% of cases annually. GBS is an acute ascending bilateral paralysis that can lead to severe respiratory problems, and in 3.9% of afflicted individuals results in death (104, 114, 280, 287). In addition, C. jejuni is now known to be a source of inflammatory bowel disease relapse (31, 194) as well 2  as a persistent cause of reactive arthritis (243). Of increasing concern is the spread of newly identified strains of C. jejuni associated with abortions in livestock. Traditionally, C. jejuni infections in livestock were asymptomatic; the reason for this apparent change of pathogenicity in livestock is unknown.  These strains cause significant  economic loss and may become a potential source of C. jejuni-associated septicemia, a complication that has been rare to this point (300).  1.1.2: Epidemiology of C. jejuni In the United States and Canada, C. jejuni is thought to infect 1% of the population each year (197) with  numbers higher in Europe (274, 288). However, due to under-reporting of infection, the actual rate of infection is thought to be much higher (197). Despite a basal rate of infection in many areas of the world, there are frequent outbreaks of C. jejuni (1, 94), with one of the best publicized being the C. jejuni and Escherichia coli O157:H7 Walkerton outbreak in Ontario, Canada (42). Infection with C. jejuni also usually has a seasonal distribution: the greatest incidence occurs in the summer months in warmer climates and peaks in winter in northern climates (178). Of the individuals infected, children around age 4 are a peak infected group, as are adults around 20-29 years old (204). Pregnant women infected with C. jejuni can develop bacteremia and other complications leading to abortion. However, secondary complications during C. jejuni infection in the fetus such as GBS and reactive arthritis are believed to be non-existent (252). Nonetheless, infection with C. jejuni during childbirth is a concern, as the infant can passively acquire C. jejuni during the birthing process and develop bacteremia, neonatal enteritis, or meningitis (252). C. jejuni is also a major risk factor in adult immunocompromised patients (222), such as people with HIV (144). Fortunately highly active antiretroviral therapy HIV treatment appears to reduce patient susceptibility to C. jejuni bacteremia to a non-significant level (65).  3  1.1.3: Sources of C. jejuni infection and treatment C. jejuni human infection is rarely associated with human-to-human transmission and is instead transmitted from environmental reservoirs and food sources, primarily through the consumption of contaminated poultry that has been undercooked (306). C. jejuni is highly prevalent in chicken flocks; up to 100% of broiler chickens can be contaminated in the same flock (239). Generally, once one chicken is colonized with C. jejuni, the rest of the flock quickly becomes colonized due to coprophagy. Colonization typically lasts for the entire lifespan of the chicken (239). These factors may account for why C. jejuni is so widespread. Antibiotic treatment can reduce flock colonization; however, this has led to the emergence of antibiotic resistant C. jejuni strains in flocks and is not a permanent solution to reducing C. jejuni colonization (176, 179, 266). C. jejuni infection can also arise from other sources such as ducks, cattle, pigs, rodents and dogs (3, 59, 202), and from the ingestion of improperly pasteurized milk (118) or contaminated water (296). Once in the environment, C. jejuni can survive under cold damp conditions, and on refrigerated meat for long periods of time until ingestion (296). C. jejuni infection usually results in a self-limiting disease. Treatment includes fluid replacement and rest, with antibiotics rarely being recommended and usually reserved for extreme cases, such as patients suffering from bacteremia or for those that are immunocompromised (136). Antibiotic treatment can reduce mean infection time slightly, but is more effective when taken early during infection (273).  1.2: General characteristics of C. jejuni that contribute to pathogenesis The determination of the genome sequences of C. jejuni strain 11168 (217), and the strain used in our laboratory and described in this thesis, 81-176 (227), the latter of which is associated with a greater intensity of disease, led researchers to mine for novel virulence factors. Genomic analyses of sequenced C. jejuni strains revealed minimal evidence of classical virulence factors such as type III secretion 4  systems, or toxins that could be directly linked to pathogenesis. Strain 81-176 was found to harbor a plasmid containing a putative type IV secretion system (16).  The type IV secretion system is not uniformly distributed amongst C. jejuni strains, and its low correlation with disease brings into question its requirement for virulence. C. jejuni produces a cytolethal distending toxin which, when purified, induced double stranded breaks in human DNA (119). However, despite strong activity of the purified toxin against tissue cultured epithelial cells in vitro, cytolethal distending toxin has yet to be shown to be associated with C. jejuni pathogenesis in vivo (190). Despite a lack of classic virulence factors, analysis of the C. jejuni genome has revealed many factors vital to C. jejuni pathogenesis which will be discussed below. 1.2.1: Flagella, motility and chemotaxis C. jejuni is highly motile and expresses a single flagellum at each pole. Motility is one of the most important C. jejuni colonization factors, as non-motile strains cannot colonize chickens or suckling mice (189, 198, 205). Furthermore, unbiased genetic screens for factors important for colonization and infection have consistently returned genes involved in flagellar biosynthesis and motility (93, 117). The flagella of C. jejuni harbor similarities to flagella of other bacteria (156). The two main flagellar structural components are FlaA and FlaB, with FlaA being the major component (156). In humans, Toll-Like Receptor 5 (TLR5) is involved in recognition of bacterial flagella during immune surveillance. The TLR5 recognition domain of C. jejuni FlaA contains mutations making it non stimulatory to TLR5 (10), although the effect of this on C. jejuni host infection is unknown. Chemotaxis has also emerged as a major colonization factor. C. jejuni possesses seven integral membrane and three soluble methyl accepting chemotaxis receptors that are involved in taxis to a variety of stimuli (156). Stimuli include fucose, pyruvate, fumarate, aspartate, and formate, with aspartate and formate chemotaxis being important for host colonization (90, 92, 102, 270, 285).   5  1.2.2: Surface polysaccharides C. jejuni is a highly glycosylated bacterium due to the number of different polysaccharide moieties decorating its surface; these include: capsular polysaccharide, lipooligosaccharide, O-linked and N-linked glycoproteins.  The C. jejuni capsular polysaccharide has been shown to be important for resisting complement and antimicrobial peptide killing, preventing excessive cytokine production from dendritic cells, and enhancing host cell invasion (15, 132, 237), yet its influence in human colonization and disease is still unknown. The lipid A of C. jejuni is decorated by a short sugar chain or lipooligosaccharide. Studies of lipooligosaccharide truncation mutants have revealed the importance of the full-length lipooligosaccharide in resistance to antimicrobial peptides, human serum and bile, and in host cell invasion and colonization of chicks and mice (113, 199). N-linked glycosylation of proteins by PglB is also important for protection of these proteins from host proteases (7), and thereby maintaining bacterial fitness during infection (7). The role of O-linked polysaccharides in virulence has not been explored in depth in C. jejuni; however, O-linked glycosylation of FlaA and the major outer membrane protein (MOMP) has been associated with chick colonization and adherence to human epithelial cells (168).  1.3: Host cell invasion and intracellular survival in C. jejuni infection C. jejuni is primarily an extracellular pathogen, but it is able to invade host epithelial cells and survive intracellularly. C. jejuni  invasion and intracellular survival correlate with disease-associated phenotypes such as enhanced IL-8 induction, destruction of tight junctions/barrier functions, and induction of epithelial cell death (19, 95, 123). These observations have resulted in a large number of studies assessing the dynamics of C. jejuni-host cell interactions. It is unknown why C. jejuni adapted to an intracellular lifecycle but may be related to C. jejuni’s acquiring adaptations to infect amoeba’s when in the environment (35, 211).    6  1.3.1: CadF-mediated invasion of epithelial cells through membrane ruffling The current model describing C. jejuni host cell invasion is described below. Invasion is thought to begin with the cholesterol-dependent binding of C. jejuni to the surface of host epithelial cells at lipid rafts rich in caveolin-1, with depletion of host membrane cholesterol or disruption of caveolin-1 significantly inhibiting invasion (292). The C. jejuni surface protein fibronectin binding protein (CadF) is involved in adherence to epithelial cell surfaces through fibronectin binding and is also important for invasion (138, 139, 191, 203, 209). CadF binding and clustering of fibronectin in lipid rafts causes activation of alpha1-beta5-integrin, a protein involved in membrane ruffling. Activation of integrin causes phosphorylation of both focal adhesion kinase (FAK) and src family kinase (Src) which initiate a series of intracellular signaling events. Signaling results in the activation of platelet derived growth factor receptor (PDGFR) and epidermal growth factor receptor (EGFR) stimulating phosphoinositide 3-kinase (PI3K). PI3K activation activates and recruits  the vav family of guanine nucleotide exchange factors 2 protein (Vav2) and then cell division control protein 42 (Cdc42) to the site of invasion, resulting in downstream remodeling of host actin and microtubules, membrane ruffling, and the engulfment of C. jejuni by the host cell (Figure 1.1)(203, 209).  An alternative pathway for induction of membrane ruffling during invasion has also been proposed. In this pathway, signaling through integrin and FAK instead activates paxillin and the dedicator of cytokinesis 180 (dock180)/ T-cell lymphoma invasion and metastasis 1 (Tiam-1)/ Engulfment and Cell Motility (Elmo) complex. This complex catalyzes the conversion of Rac1-GDP to Rac1-GTP. Activated Rac1-GTP triggers cytoskeletal rearrangements, initiating ruffling in the host cell membrane and bacterial engulfment (Figure 1.1) (203, 209). It is unknown if both pathways occur simultaneously and if they are differentially induced in different host cell types.     7   Figure 1.1. Signaling cascade activated by C. jejuni cell surface binding  Fibronectin-dependent signaling through integrin after C. jejuni binding causes activation of two pathways necessary for C. jejuni host epithelial cell invasion. In pathway 1, FAK and Paxallin dependent signaling causes the downstream conversion of inactive Rac1-GDP to active Rac1-GTP. This is required for actin and microtubule rearrangements resulting in membrane ruffling and invasion. In pathway 2, Src kinase and EGFR signaling results in downstream activation of Vav2 and Cdc42 which facilitates actin and microtubule rearrangements leading to membrane ruffling and invasion (60, 145).   1.3.2: Intracellular localization of C. jejuni in host epithelial cells  Little is known about the fate of C. jejuni following invasion. It can invade epithelial cells and monocytes and persist intracellularly for several days, with the length of intracellular survival depending on host cell type (64, 205, 206, 250). After invasion, the numbers of intracellular bacteria decrease over time, suggesting that the intracellular compartment is not a replicative niche. C. jejuni resides in the endocytic pathway immediately after invasion, as assessed by co-localization with the early endocytic marker dextran, and then begins to diverge from lysosomal trafficking (292). The early endocytic markers EEA-1, Rab4 and Rab5 are initially transiently co-localized with C. jejuni. These markers are lost 120 min post-infection. After this point only general details are known as to how C. jejuni trafficks within infected cells (292). The endocytic marker Rab7 then transiently co-localizes with C. jejuni, followed by the late lysosomal marker LAMP-1 (Figure 1.2a). Neither the lysosomal markers cathepsin nor phagocytosed 8  bovine serum albumin co-localized with C. jejuni during late points of infection (292), suggesting that live C. jejuni do not reside in a lysosomal compartment and must diverge from lysosomal trafficking to survive. Co-localization studies with other organelles determined that C. jejuni resides in a compartment that is near, but not within, the Golgi apparatus (Figure 1.2b). More detailed information about C. jejuni intracellular trafficking is not known, except that co-localization near the Golgi apparatus is dependent on proper microtubule dynamics (292).  Figure 1.2. Intracellular lifecycle of C. jejuni in epithelial cells  A) Depiction of intracellular markers that co-localize with the C. jejuni containing vesicle (CCV) during different stages of intracellular infection. B) Fluorescent photo of the mature CCV co-localizing near, but not with the Golgi apparatus of INT407 intestinal epithelial cells. Blue: Nucleus. Red: C. jejuni. Green: Golgi-apparatus marker GM130 (292).   1.4: The electron transport chain and respiratory dehydrogenases     Analyses of published C. jejuni genome sequences revealed that a large proportion of the genome encodes for metabolic genes. This is intriguing in light of the emergence of “metabolic virulence” as being important for pathogenesis in other bacteria. More specifically, differential utilization of metabolites has been shown to confer a competitive growth advantage for some bacteria in the 9  intestinal tract by enabling them to utilize a greater range of nutrients(4, 298). Studies on the central metabolism of C. jejuni have yielded much insight into how it colonizes its hosts (21, 99, 127, 213, 271, 293). 1.4.1: C. jejuni has an intact but atypical electron transport chain C. jejuni normally resides deep in colonic crypts and, as such, has adapted its core metabolism to persisting in this niche. C. jejuni relies on amino acids as a primary energy, carbon, and nitrogen source instead of carbohydrates (260). C. jejuni lacks the 6-phosphofructokinase enzyme that is required for the phosphorylation of fructose-6-phosphate to fructose-1,6-diphosphate of the glycolytic pathway, thus preventing utilization of glucose for energy generation (260). C. jejuni is still able to utilize pyruvate, likely generated through amino acid catabolism, using a pyruvate flavodoxin oxidoreductase (PFOR). Two of the major electron donors, PFOR and oxaloacetate oxidoreductase (OOR), generate energy by reducing the electron carrier flavodoxin (FldA) instead of NAD+ like in E. coli (50, 103, 259)(Figure 1.3). C. jejuni oxidizes flavodoxin with an atypical electron transport chain (ETC) Complex I/NADH dehydrogenase (259, 294). Reduced FldA is able to reduce the electron carrier proteins Cj1574c and Cj1575c, which act as the entry point of electrons into the ETC Complex I (Figure 1.3)(294). Electrons can also enter the ETC through the non-reversible Complex II (succinate dehydrogenase) and reversible fumarate reductase that can drive inter-conversion of succinate to fumarate. The other major members of the C. jejuni  ETC, Complex III and cytochrome c, are well conserved compared to those of  E. coli and other well-known model bacterial species and will not be addressed further here.  C. jejuni possesses two functional terminal oxidases, the cyanide sensitive CcoNPQRS system and the cyanide resistant CydAB system (115). The CydAB system has been shown to have low affinity to oxygen and is not involved with the translocation of hydrogen ions across the inner bacterial membrane and ATP generation, unlike CcoNPQRS which is the major ETC hydrogen ion pump in C. jejuni (115). The affinity of CydAB for oxygen is such that it is not active at micro-aerobic oxygen concentrations, causing it to only 10  be active at higher oxygen tensions. CcoNPQRS, on the other hand, has a high affinity for oxygen and is saturated at lower oxygen tensions (115).    Figure 1.3. Flux of electrons from pyruvate flavin oxidoreductase (PFOR) to Complex I NADH dehydrogenase (Nuo/Comp. I)  PFOR and oxaloacetate oxidoreductase (OOR; not shown) reduce flavodoxin (FldA) as an electron carrier for electrons entering the electron transport chain (ETC) which in turn reduces the Cj1574c/Cj1575c electron carrier protein complex. Reduced Cj1574c/Cj1575c reduces the Nuo/Complex1. This cycle is important for entry of electrons into the ETC by certain components of the citric acid cycle. Electrons can also enter the ETC through other enzyme complexes.  1.4.2: C. jejuni electron donors and acceptors C. jejuni is known to have a branched ETC able to use a wide variety of electron donors and acceptors. The C. jejuni genome sequence predicts the existence of genes that encode terminal reductases that use alternative electron acceptors, including fumarate, nitrate, nitrite, dimethyl sulfoxide and trimethylamine N-oxide (Figure 1.4.a) which may be involved in anaerobic respiration when in intestinal crypts (246). However, C. jejuni supplemented with any of these terminal electron acceptors still does not allow anaerobic growth, with O2 still being required (246). The use of tetrathionate by C. jejuni TsdA as an electron acceptor has been identified (162), which is interesting as it has been reported that Salmonella spp. may use tetrathionate to gain a competitive advantage over other gut bacteria during inflammation (162, 298). It remains to be seen if the same is true for C. jejuni. C. jejuni also encodes numerous respiratory dehydrogenases and a well-studied energy conservation pathway (generation of 11  proton motive force without using molecules that can be used as a carbon source; Figure 1.4.b). Formate, gluconate, sulfite, hydrogen gas, and lactate can all act as efficient electron donors in this pathway (196, 213, 229, 275, 293). C. jejuni respiratory dehydrogenases that have been identified to date have lower than expected amino acid sequence similarity to homologs in typical enteric pathogens, so it is expected that additional dehydrogenases will be annotated in the future.  The presence of different electron donors and acceptors can impact the ability of C. jejuni to invade epithelial cells and colonize commensal chicken species. The intestines of most animals are colonized with a wide variety of commensal organisms that utilize the available host nutrients. For C. jejuni to colonize or infect a host in such a competitive environment, it likely relies in part on metabolic enzymes to give it a competitive advantage. Studies conducted on respiratory enzymes, such as hydrogenase and gluconate dehydrogenase (213, 293), have found that many of them are required for animal colonization. In addition, respiratory systems like formate dehydrogenase (Fdh) and sulfite oxidoreductase (Sor) have been found to be important for host cell infection (229, 271). A complete list of how C. jejuni respiratory dehydrogenases affect colonization is included in Table 1.1.       12     13  Figure 1.4. Electron acceptors and donors of the respiratory chain in C. jejuni  A) The known C. jejuni electron acceptor systems and where electrons from the electron transport chain (ETC) feed them. Nitrate reductase (NapAB) and nitrite reductase (NrfA) can accept electrons from menaquinone (MK). TMAO/DMSO oxidoreductase (TorA), thiosulphate dehydrogenase (TsdA), and the cytochrome peroxidases (Cj0020/Cj0358) accept electrons through cytochrome c. For simplicity, the two terminal oxidases (CydAB and CcoNOQP) are depicted as a single complex. B) The known C. jejuni respiratory dehydrogenases and how they feed into the ETC. Formate dehydrogenase (Fdh), malate dehydrogenase (Mdh), hydrogenase (Hyd), and lactate dehydrogenase (LDH) all directly reduce MK. Sulfite oxidoreductase (Sor) and gluconate dehydrogenase (Gdh) bypass MK and reduce cytochrome c. The reactions and redox-active metallocentres of C) formate dehydrogenase subunit FdhA and D) sulfite oxidoreductase subunit SorA are depicted with the electron acceptor and the prosthetic groups catalyzing the reaction.  (85, 93, 99, 162, 196, 213, 225, 246, 275, 293, 294).   Table 1.1: Host infection and colonization phenotypes of respiratory dehydrogenase mutants from previous work Gene Tissue culture mutant defects Animal colonization mutant defects Sulfite oxidoreductase Defective for adherence and invasion (271) No data Gluconate dehydrogenase No data Defective for chick intestine colonization (213) Proline dehydrogenase No data Defective for mouse intestine colonization (99) Lactate dehydrogenase No data No data Formate dehydrogenase No data Defective for chick intestinal colonization.  Unable to invade deeper tissues in mice. (21, 293) Hydrogenase Defective for adherence and invasion (127) Defective for chick colonization (293)  1.5: C. jejuni regulators of metabolism As in all bacteria, regulation of metabolism is controlled through a variety of systems that either repress or activate transcription of metabolic genes. C. jejuni lacks such key factors as the Cyclic AMP Receptor Protein (CRP) for regulating glucose uptake and catabolism (since C. jejuni does not use glucose as a carbon or energy source); however, it does have a diverse set of regulatory proteins that control gene transcription. C. jejuni possesses a homologue of the Carbon Starvation Regulator (CsrA); however, it is 14  not known what metabolic features it controls (67). Several metabolic genes are controlled by the two-component response regulators reduced ability to colonize regulator (RacRS) and Campylobacter planktonic regulator CprRS (Svensson, Gaynor, et al, unpublished data). The heat shock regulators heat shock protein repressor (HspR) and heat regulation at CIRCE regulator (HrcA) have also been linked to the regulation of succinate dehydrogenase and aspartate aminolyase (100). An important regulator of C. jejuni metabolism, as well as controlling other genes associated with C. jejuni stress survival, is the stringent response regulator (SpoT) (80). SpoT was found to regulate many different metabolic components including lactate dehydrogenase, nitrate reductases, and many components in the NAD(P)H dehydrogenase/Complex I proteins (80).  Many regulators that are involved in regulation of oxidative stress are also important in regulation of metabolism. This includes LysA regulator (LysR), which regulates succinate dehydrogenase, fumarate reductase, Sor and aspartate aminolyase (55), and the peroxide stress regulator (PerR), a master regulator of oxidative stress responses, and key metabolic genes like the iron sulfur containing oxaloacetate oxidoreductase (214).  Many C. jejuni enzymes require trace cofactors that must be imported in small amounts for proper enzyme function. The molybdenum regulator (ModE) is vital for the import of both tungsten and molybdenum via regulation of the tungsten uptake transporters (TupABC) and molybdenum transporter (ModABC) complexes, respectively (272). Tungsten and molybdenum are important for the proper function of enzymes important for host cell infection and host intestinal colonization, like Fdh, Sor, and nitric oxide reductase.  Zinc import via the zinc-uptake importer (ZnuA) is important for growth in low zinc media, as well as chick colonization (48). Transcription of znuA is zinc dependent, but no regulator has been identified to date (48). Given that regulation of uptake of specific metal cofactors can be directly related to regulation of the enzymes for which they are cofactors, it is important to understand cofactor uptake and incorporation to understand enzyme activity.  15  1.6: Host cell death pathways The first attempt at classifying human cell death pathways was accomplished by Schweichel and Merker, who categorized cell death into four classes: apoptotic, pyroptotic, autophagic, and necrotic (236). Programmed cell death studies have historically focused in a large part on the apoptotic pathway. Apoptosis is a programmed cell death pathway carried out by the caspase family of proteins (23, 148, 151). Apoptosis results in non-inflammatory death associated with cell blebbing and shrinking, and condensation and fragmentation of chromatin (23, 148, 151). Recently, apoptosis has been subdivided into another class of cell death, pyroptosis, that undergoes many of the same markers as apoptosis. Unlike apoptosis, pyroptosis involoves the maturation of pro-IL-1β by the pyroptosis executioner caspase, caspase-1, resulting in ‘apoptosis’ with a pro-inflammatory profile(70). The well described necrotic pathway was assumed to be an accidental process arising when damage to the cell is so severe that cellular processes stop before initiation of a programmed death cascade. However, in 1988 the notion of there being no program associated with necrosis was challenged when it was observed that different cell types could succumb to the same trigger, tumor necrosis factor (TNF), with cellular morphologies distinctive of apoptosis or necrosis (152). Recent work has found that necrosis is not accidental in all cases, and can be a programmed event with a complex and precise signaling cascade.  1.6.1: Induction of necrosis through the necrosome In light of the view that necrosis can be either un-programmed or programmed, the term necroptosis was adopted for programmed necrosis. Necroptosis refers to the mode of cell death in which death receptors on the membrane are initiated, leading to induction of death (88, 283). When the TNF receptor (TNFR) binds to TNF-alpha, it causes assembly and activation of complex I containing poly-ubiquinated Receptor-interacting protein 1 (RIP1) and leads to NFĸB activation and pro-survival signaling, so host cell death does not occur (88, 283) (Figure 1.5). However, under certain conditions, RIP1 can be deubiquinated by cylindromatosis (CYLD) which causes the transition of the TNFR complex I 16  to TNFR complex II (Figure 1.5). In complex II, the TNFR complex becomes associated with the apoptosis initiator protease caspase 8 (casp-8) which becomes activated (88, 283). Active casp-8 cleaves and inactivates de-ubiquinated RIP1 resulting in inhibition of necrosis and induction of apoptosis. However, in some cases casp-8 and apoptosis can be inhibited (88, 283). Casp-8 inhibition leads to a lack of cleavage of RIP1 which can then oligomerize with RIP3 to form the necrosome complex (complex IIb)(Figure 1.5)(88, 283). It is not fully understood how necrosome oligomerization leads to necrosis activation; however, many have hypothesized that the necrosome causes induction of mitochondrial free radicals, or an influx in cytoplasmic calcium levels  (88, 283). There is growing evidence that RIP1 is not necessary for induction of necrosis, and the only essential component of necroptosis is RIP3 (257). This was observed in a study which found that necroptosis can occur when RIP3 oligomerizes with the mixed lineage kinase domain-like protein (MLKL) independent of RIP1. For example, it has been found that TLRs can activate the RIP3/MLKL complex and induce necrosis in a manner independent of RIP1(122). Since the necroptosis field is in its infancy, it is not completely known what the essential steps are.    17   Figure 1.5. The different complexes associated with the tumor necrosis factor receptor (TNFR)  Each complex depending on the conditions associates with a different set of proteins resulting in different outcomes. Complex 1: Interaction of ubiquinated (Ub) RIP1 with TNFR causes NFĸB signaling followed by inflammation and pro-survival signals. Complex 2: If Rip1 is de-ubiquinated it cannot interact with TNFR when TNFR is activated. Caspase 8 (Casp8) will be recruited which degrades de-ubiquinated RIP1. Caspase 8 activation leads to apoptosis and inhibits necrosis. Complex IIb: If Rip1 is deubiquinated and caspase 8 is inhibited, the Rip1/Rip3/MLKL necrosome will form and necrosis will be induced.   1.6.2: Initiation of mitochondrial oxidative stress and its role in necrosis Although induction of reactive oxygen species (ROS) in programmed necrosis is not a prerequisite, it is documented to be associated with necrosis under many different conditions. A wide range of work has documented that quenching of mitochondrial ROS can reduce necrosis (69). However, it is not completely known how ROS lead to necrosis. Production of ROS by the mitochondria has been suggested to be a result of TNF-alpha treatment leading to necrosis (244). Production of ROS in the mitochondria can also lead to changes in the ultrastructure of both the endoplasmic reticulum and mitochondria, which can further damage normal cellular functions resulting in ATP depletion and increases in cytosolic calcium levels (66, 244). NADPH oxidase (NOX) could be directly activated by forming a complex with the necrosome components TNFRSF1A-associated via death domain protein (TRADD), RIP1 and Rac1 during necrosis (135, 304). ROS generated from NOX proteins may cause lipid 18  peroxidation in the mitochondria which interferes with the respiratory components and leads to a rapid depletion of ATP which is characteristic of necrosis (284). Such ROS mediated damage to the mitochondria can also enhance production of mitochondrial ROS production, as well as reactive nitrogen species (RNS) which may cause an oxidative damage positive feedback loop (228). It should be noted that ROS production is not an essential step in necrosis or necroptosis, and its role in the progression towards cell death is likely cell line and death signal dependent (135). However, the role of ROS in necrosis is important in microbial pathogenesis, and ROS mediated host cell death may facilitate bacterial dissemination. For example, TNF related ROS production during Mycobacterium tuberculosis infection is associated with the eventual induction of necrosis and dissemination in the zebrafish model of infection (236).    1.6.3: Calcium, calpain and cellular modification  Like the caspase proteins in apoptosis, necrosis has its own set of effector proteins that carry out some of the steps in the pathway leading to necrosis (253). This family of proteins are the calcium activated cysteine proteases called calpains. It is not known what comprises the exact steps that link upstream signals, such as mitochondrial ROS- and TNF- induced necrosis to the activation of calpain; however, a strong link to calcium levels has been observed. Calpains contain a calcium binding domain that, upon the binding of calcium, induces a structural change that causes auto-cleavage and subsequent activation (253). It is not known how the rise in cytoplasmic calcium occurs; however, it has been hypothesized that calcium stored in the endoplasmic reticulum is released when the ER is damaged by mitochondrial (or other) ROS (116). Another hypothesis is that ATP depletion resulting from mitochondrial dysfunction prevents the activity of the ATP-dependent calcium transporters like sarcoendoplasmic reticulum calcium transport ATPase (SERCA) which transports calcium to the sarcoplasmic reticulum from the cytoplasm (89).  19  Once calcium reaches a certain critical threshold, the auto-cleavage of the calpain inhibitory domain occurs and domain II active site is activated (253). The two main calpains in humans are m-calpain and µ-calpain, which are ubiquitously expressed in many different human tissues and named after their activities in micromolar (µ) and millimolar (m) concentrations of calcium (253). Activity can be controlled by the calpian inhibitor calpastatin, which contains multiple copies of the calpain inhibitor domain and is able to inhibit multiple copies of active calpain simultaneously (253). Calpastatin expression is transcriptionally regulated by a variety of signaling pathways, such as NFĸB, and has been found to be up-regulated in Mycoplasma hyorhinis infected cells to inhibit necrosis (58). It can also be up-regulated via TLR2 through the MEK1/ELK1 pathway in a NFĸB independent manner (277).   Once calpain becomes active, it is responsible for the downstream cleavage of several proteins. Although several known calpain-specific cleavage sites have been determined, there are no specific recognition sequences, and the nature of calpain recognition is unknown. Determination of a defined cleavage sequence has also been complicated by the fact that calpain activation leads to disruption of lysosomes, resulting in the leakage of lysosomal products into the cytoplasm, such as cathepsins, which cause peptide cleavage in many different proteins. The known targets of calpain are diverse and include signaling molecules, membrane proteins, intracellular enzymes, and structural proteins (161). Amongst these are spectrin, paxillin, vinculin, talin and alpha-actinin proteins, which are all structural genes (27, 160, 186, 248).  It is thought that cleavage of these structures causes inhibition of the structural integrity of the cell, resulting in the characteristic features of necrosis like cell rounding. One of the hallmarks of necrosis is the loss of membrane integrity and the release of cytoplasmic contents. This process was initially thought to be an all-or-nothing event, but there is evidence that it is a stepwise process, with smaller pores opening first followed by larger ones (161). This pore opening seems to coincide with the cleavage of cytoskeletal components (160). However, a direct link between the two has yet to be found. A schematic representation of the steps involved in the necrosis progression is shown in Figure 1.6.  20   Figure 1.6. Steps associated with the induction and progression of necrosis  Necrosis is thought to initiate with the induction of mitochondrial dysfunction, possibly due to damage by NADPH oxidase (NOX) generated reactive oxygen species (ROS). This leads to increases in cytosolic calcium followed by calpain activation. Activation of calpain results in terminal death processes, such as lysosome rupture and cytoskeleton cleavage. Dashed arrows refer to steps that are not essential, but are induced in many forms of programmed necrosis. Solid arrows refer to steps thought to be essential in activation of calpain-dependent necrosis.  1.7: Generation of ROS in bacteria Tolerance to oxygen varies amongst bacteria. Some, like C. jejuni, are microaerophilic, growing optimally at sub-atmospheric concentrations of oxygen. Others, such as E. coli, are fully aerobic, growing optimally under atmospheric conditions (~21% oxygen). However, hyperoxia can be toxic to all organisms and can induce growth defects and mutations (28). Toxicity arises from the production of the reactive oxygen species (ROS) such as superoxide (O2-) and hydrogen peroxide (H2O2) that are primarily created adventitiously by the one-electron reduction of oxygen in the active sites of redox-active enzymes (Figure 1.7a)(111). ROS are bio-reactive molecules that are extremely toxic to cells by preferentially damaging enzyme iron sulfur clusters and other metalloproteins, inhibiting metabolic functions as well 21  as damaging protein thiols (109). Since the generation of O2- and H2O2 production is dependent on oxygen, higher oxygen tensions result in faster rates of ROS production (Figure 1.7b) (111). Within bacteria, O2- is dismutated to H2O2 and O2 by superoxide dismutase (SodB) (111); however, H2O2 can also be generated directly by respiratory enzymes by the transfer of a second electron to O2- if the O2- does not dissociate from the enzyme active site rapidly enough (Figure 1.7c).   Attempts to determine the physiologically relevant ROS-generating enzymes in E. coli originally focused on components of the respiratory chain due to the association of mitochondrial complex I with ROS production (147). The rate of production of ROS from respiratory enzymes is dependent on solvent exposure, the redox  potential, and the electron residency time on the redox center (182). In E. coli, an increase in H2O2 occurs when E. coli transitions from an anaerobic to an aerobic environment; however, H2O2 production quickly slows down during prolonged aerobic incubation (124). In vitro studies looking at membrane vesicles determined that fumarate reductase, sulfite reductase, and NADH dehydrogenase II (but not NADH dehydrogenase I) could all reduce O2 to O2-, generating significant ROS species (110, 181). However, deletion of these ROS-generating enzymes did not significantly reduce the rate of ROS production under aerobic conditions, suggesting that non-respiratory dehydrogenases are the actual source of ROS production (245). This is due to the fact that respiratory dehydrogenases that are predisposed to ROS formation are down-regulated under higher oxygen tensions. An example of this is E. coli fumarate reductase that is repressed shortly after exposure to higher oxygen concentrations (218). Non-respiratory sources of ROS have since been identified in E. coli and include L-aspartate oxidase (NadB) which is involved in aspartate turnover, as well as glutamate synthase, a flavin-containing protein producing glutamate from glutamine and α-ketoglutarate (81, 143). Presumably, ROS production is not deleterious if the rate of production does not exceed the capacity of ROS-scavenging systems. C. jejuni is a microaerophilic bacterium and may not have adapted to rapidly down-regulate 22  ROS producing enzymes when transitioning to aerobic environments. No work on the origin of ROS in C. jejuni has been published to date.    Figure 1.7. ROS production in bacteria  A) Representation of how ROS are produced. A reduced substrate can reduce the active site (AS) of a protein containing a metal center or flavin. In rare cases, if the electron is unable to leave the active site of the enzyme, then the reduced active site (Re AS) can reduce O2 to produce an ROS. B) The rate of change of O2- concentration with respect to time is dependent on the concentration of O2 and reduced electron donor (EDRD). As the concentration of O2 increases, the rate of O2- production will increase. C) The Fenton reaction involved in producing hydroxyl radicals (OH-) from O2. EDRD, SOD (superoxide dismutase), KatA (catalase).  1.8: C. jejuni oxidative stress resistance During aerobic incubation, as well as during exposure to ROS produced by neutrophils and other immune cells during infection, C. jejuni must deal with significant oxidative stress. It has been hypothesized that ROS-mediated loss of viability in C. jejuni is due to the destruction of the iron sulfur clusters in Por and Oor enzymes which shuts down the citric acid cycle (131). In addition, the reaction of 23  H2O2 with iron sulfur clusters leads to the production of hydroxyl radicals (Figure 1.7b) which can react with and cleave DNA (109) and ROS stress can induce lipid peroxidation which disrupts membrane homeostasis and can induce DNA mutations (109, 111). To counteract the effects of ROS, C. jejuni has several ROS detoxification systems. These include single copies of genes encoding superoxide dismutase (sodB)(220, 231), catalase (katA)(84) and alkylhydroperoxidase (ahpC)(18) which are all involved in reducing ROS to non-toxic products. In addition, C. jejuni contains two thiol peroxidases, thiol peroxidase (Tpx) and the bacterioferritin containing protein (BCP), that have been shown to have peroxidase activity (13). To minimize the toxic effect of ROS species, C. jejuni contains iron binding proteins Cft and Dps which sequester free cytosolic iron preventing hydroxyl radical formation(112, 289). C. jejuni also encodes several systems capable of repairing oxidative damage, such as methionine sulphoxide reductases (MsrA/MsrB), which repair methionine oxidation (14), and the high temperature requirement (HtrA) chaperone, which assists in degrading proteins denatured by ROS (34). C. jejuni also has systems that help resist damage from oxidative stress, such as DNA-binding proteins from starved cells protein (Dps)(112) and the Campylobacter ferritin-encoding gene protein (Cft) (289), which bind free intracellular iron, and hemerythrin A (HerA)(131) which has a yet unknown role in resisting oxidative stress. C. jejuni lacks known glutathione synthesis genes that are present in several aerobic organisms such as E. coli (9) and help scavenge trace ROS. Regulation of the oxidative stress response is also very important for survival in the environment, and C. jejuni contains several regulators important for aerotolerance. The PerR (214, 282), LysR (55), Cj1556(87), and the Campylobacter oxidative stress regulator CosR (106, 107) all control expression of important antioxidant genes such as katA and ahpC. Even with functioning catalases and peroxidases, C. jejuni can rapidly lose viability in an aerobic environment. Therefore, it is likely that the C. jejuni scavenging enzymes are detoxifying ROS at a rate that is less than the rate of ROS production, reflecting C. jejuni’s need for environments with lower oxygen tensions for growth.  24  1.9: Sulfur assimilation pathway Sulfur homeostasis plays an important role in aerobic survival. Sulfur-containing compounds like glutathione and mycothiol have been shown to be important ROS scavengers in bacterial systems like E. coli and Mycobacterium, respectively (61). In cysteine-limited media, the sulfur assimilation pathway can incorporate sulfate through a series of steps into O-acetylserine to generate cysteine. This  pathway is well conserved in prokaryotes and eukaryotes ((91); Figure 1.8). The sulfur assimilation pathway is energetically demanding, requiring 2 ATPs and 6 electrons to reduce sulfate to sulfide. As such, the pathway is highly regulated in many organisms (91, 180, 221). In M. tuberculosis, the sulfur assimilation pathway has been found to be up-regulated by H2O2, as well as menadione (an antibiotic that induces ROS production), and is thought to reflect a need for sulfur assimilation during macrophage infection and transition to latent phase macrophage infection (91). No studies have examined the role of the sulfur assimilation pathway in C. jejuni. The C. jejuni genome was searched for possible homologs of sulfur assimilation proteins previously (6). Homologues of ATP sulfurylase (Atps), and adenosine phospo-sulfate (APS) kinase were identified (Figure 1.8); however, C. jejuni lacks obvious homologues of phospho-adenosine-phosphosulfate (PAPS) reductase, and sulfite reductase (Figure 1.8). It is unknown if PAPS reductase and sulfite reductase homologs exist in the C. jejuni genome, but they would be needed for de novo cysteine synthesis as sulfide that is generated by the activity of these enzymes serves as the substrate for CysM (78). CysM can also incorporate thiosulfate into O-acetyl-serine to generate cysteine independent of sulfide, thus sulfite reductase may not be needed to generate cysteine (201).  25   Figure 1.8. The sulfur assimilation pathway.  The pathway for the incorporation of inorganic sulfur into cysteine. Enzymes involved in the pathway are boxed. CysDN (ATP sulfurylase), CysC (APS kinase), CysH (PAPS reductase), CysJI (sulfite reductase), and CysM/CysK (Cysteine synthase). Abbreviations: APS (, PAPS, PAP and O-acetyl-serine.  Enzymes for which no C. jejuni homologs have been identified are denoted with a ‘?’.  Solid arrows indicate intermediate steps in the cysteine synthesis pathway and the dashed lines represent the activity of sulfotransferases that transfer the sulfur group from intermediates to a specific target. Examples of the end products of these sulfotransferases include the NodRm-IV nodulation factor of Rhizobium melitoli, and sulfolipid-1 of M. tuberculosis (193, 232). 1.10: Rationale and aims   The initial objective for this thesis was to identify new factors important for C. jejuni infection of human epithelial cells through analysis of uncharacterized C. jejuni genes that were previously identified as up-regulated during interaction with INT407 cells (80). The resulting mutational and phenotypic analyses, comprising Aim 1 (see below) and described in Chapter 2, revealed the importance of two novel proteins, FdhT and FdhU, as regulators of fdh gene expression and Fdh activity. This work also demonstrated an importance for FdhTU and the Fdh complex in the interaction of C. jejuni with epithelial cells - most notably, for recovery of C. jejuni following cell infection. It also led to the unexpected observation that supplementation of post-cell infection recovery plates with sulfite not only 26  abrogated apparent invasion and intracellular survival defects for fdhTU and fdhA mutants, but also dramatically enhanced recovery of wild-type C. jejuni. From this preliminary analysis, I hypothesized that metabolic enzymes, specifically respiratory dehydrogenases, play a crucial role in C. jejuni interaction with epithelial cells and in aerobic survival dynamics. The research described herein has three specific aims. As described above, Aim I (Chapter 2) was to determine the role of fdhTU in host cell infection by mutational analysis, and assess its role in adherence, invasion and recovery from host epithelial cells. In addition, microarray analysis was undertaken to determine genes differentially regulated in a ΔfdhU strain. The role of the FdhTU-regulated operon Fdh in epithelial cells was assessed as was performed for FdhTU.  To expand on the work presented in Chapter 2, I then hypothesized that metabolic enzymes, specifically respiratory dehydrogenases, play a crucial role in C. jejuni interaction and recovery from epithelial cells.  As such, Aim II (Chapter 3) was to study the role of Sor in enhanced recovery of C. jejuni from epithelial cells when plating on sulfite, and determine the role of sulfite in enhancing recovery of C. jejuni from epithelial cells. Related to this, I wished to determine if other respiratory dehydrogenases are involved in the recovery of C. jejuni from the intracellular niche, host cell infection, and in the induction of host cell necrosis by mutational analysis and quantification of host cell death during infection. Pursuing Aim II also resulted in the identification of several host factors important to the progression of necrosis during C. jejuni infection by analyzing host cell death in the presence of different chemical inhibitors. Finally, Aim III (Chapter 4) sought to identify factors that affect the environmental survival of C. jejuni. This builds on the previous identification of respiratory dehydrogenase redox cofactors as the site of ROS generation in aerobic conditions (110, 182, 245). Production of ROS by C. jejuni redox centers may explain the loss of viability observed under atmospheric oxygen concentrations. As described in Chapter 4, I showed the production of H2O2 by C. jejuni in aerobic conditions under different conditions to explore factors likely involved in why C. jejuni is not aero-tolerant. Furthermore, I investigated the relationship of several respiratory dehydrogenases with H2O2 27  production by C. jejuni.  In addition, the role of two sulfur metabolites, sulfite and cysteine, in enhancing aerobic survival was investigated by mutational analysis of the sulfur assimilation pathway. The role of Atps in aerobic survival, sensitivity to ROS, and the rate at which it detoxifies or accumulates H2O2 was investigated to determine if there is a relation between sulfur homeostasis and aerobic survival in C. jejuni.                  28  Chapter 2: FdhTU-modulated formate dehydrogenase expression and electron donor availability enhance recovery of Campylobacter jejuni following host cell infection 2.1: Introduction and synopsis A microarray-based screen to identify C. jejuni  genes with enhanced expression during cell infection previously identified SpoT, PaqPQ, and the two-component response regulator system CprRS as important for various aspects of the pathogen-host cell interaction (80, 157, 265). Also up-regulated were two other uncharacterized genes, designated Cj1500 and Cj1501 in the first sequenced C. jejuni strain, 11168, and CJJ81176_1492 and CJJ81176_1493 in the virulent, invasive strain 81-176 used in our laboratory. I designated these genes fdhT (CJJ81176_1492) and fdhU (CJJ81176_1493) based on data presented in this chapter describing their function as a putative regulator and transmembrane protein required for Fdh activity. As will be described, I found that fdhT, fdhU, and fdhA were important for C. jejuni recovery following infection of human epithelial cells, but not for adherence, invasion, or intracellular survival. Microarray, RT-qPCR, biochemistry, and double mutant analyses suggest that the effect of FdhU on Fdh activity was responsible for FdhU effects on host cell interactions. Supplementation of growth media used for post-cell infection recovery with sulfite rescued the defects observed for ΔfdhU and ΔfdhA mutants and enhanced recovery of wild-type  (WT) C. jejuni. These findings established roles for each of these genes in an underexplored aspect of the pathogen-host cell interaction.   29  2.2: Materials and methods  2.2.1: Bacterial strains and growth conditions  All experiments were performed using the C. jejuni strain 81-176 background. All strains were grown in/on Mueller Hinton (MH) broth (Oxoid Ltd.) or agar plates at 38°C in a standard C. jejuni growth atmosphere of 6% O2 and 12% CO2 generated using a Sanyo tri-gas incubator (for plate growth) or using the Oxoid CampyGen system (for shaking broth cultures). All media used to culture C. jejuni were supplemented with 10 mg/mL vancomycin (Toku-E) and 5 mg/mL trimethoprim (Sigma) and is referred to hereafter as MH media. Where appropriate, MH media was supplemented with 50µg/mL kanamycin (Toku-E), 30µg/mL chloramphenicol (Sigma), or 20 mM sodium sulfite (Sigma). All genetic manipulations were performed in E. coli DH5α cells grown on LB plates or broth (Sigma) supplemented with 100 µg/mL ampicillin (Sigma), 25 µg/mL kanamycin, or 30 µg/mL chloramphenicol.  2.2.2: Construction of ΔfdhU, ΔfdhT, ΔfdhA, and ΔfdhUΔfdhA mutants and ΔfdhUC and ΔfdhTC complemented strains  All enzymes used for generation of C. jejuni mutant and complemented strains were purchased from New England Biolabs. Primers used are listed in Appendix 1. PCR amplification of fdhT, fdhU, and fdhA was performed with fdhT-Fw + fdhT-Rv, fdhU-FW + fdhU-Rv, or fdhA-Fw + fdhA-Rv primers, respectively, using iProof DNA polymerase. Purified PCR fragments were A tailed using Taq DNA polymerase and ligated into the pGem vector (plasmids used in this study are listed in Appendix 2). Generation of unique internal restriction sites in fdhU was performed by inverse PCR using primers fdhU-iPCR-Fw + fdhU-iPCR-Rv to introduce XbaI sites. The fdhT gene has an endogenous XbaI site, and fdhA has an endogenous PstI site. The non-polar aphA-3 cassette encoding a kanamycin resistance gene (212) was digested out of plasmid pUC18K-2 using XbaI and ligated into XbaI-digested fdhU inverse PCR product and pGem-fdhT. fdhA was disrupted with the aphA-3 kanamycin resistance cassette or the CAT chloramphenicol 30  resistance cassette. For generation of the aphA-3 disruption construct, pGem-fdhA was digested with PstI, and XbaI- digested aphA-3 was ligated into pGem-fdhA as above. For generation of the CAT disruption construct, pGem-fdhA was digested with PstI and treated with the Klenow fragment to blunt-end the DNA. The CAT cassette was digested out of plasmid pRY109 (303) with SmaI and ligated into pGem-fdhA. All ligations were transformed into DH5α, colonies were screened by PCR, and plasmids from positive clones were purified. C. jejuni was naturally transformed  by double recombination with each plasmid and plated on MH agar supplemented with kanamycin or chloramphenicol for 48h to recover colonies. PCR and sequencing confirmed correct insertion in the chromosome by homologous recombination. All experiments were conducted with the aphA-3-disrupted strains except for double mutant analysis which required the use of CAT-disrupted ΔfdhA. The ΔfdhUΔfdhA mutant was constructed by isolating genomic DNA from the CAT-disrupted ΔfdhA strain, transformation into the aphA-3-disrupted ΔfdhU strain, and selection on chloramphenicol. Presence of both mutations was confirmed by PCR and sequencing. All C. jejuni strains used in this study are listed in Appendix 3.   Complementation was achieved by amplification of fdhT and fdhU using primers fdhU-C-Fw + fdhU-C-Rv and fdhT-C-Fw + fdhT-C-Rv, respectively, which also introduced a PstI site into the 5’ end and a MfeI site to the 3’ end of each gene. PCR products were digested with PstI and MfeI and purified. The genomic integrative plasmid pRRC (125) was digested with MfeI and XbaI and ligated with the digested fdhU-C and fdhT-C fragments. Insert expression was driven off the pRRC promoter. Plasmids were transformed into DH5α and selected on chloramphenicol. Colonies were screened by PCR, and plasmids from positive clones were purified and used to transform C. jejuni ΔfdhU and ΔfdhT mutants by natural transformation double recombination. Insertion of fdhT or fdhU in the rRNA spacer regions was confirmed by PCR using primers ak233, ak234, ak235 and ak237. 31  2.2.3: Generation of cDNA for microarray and RT-PCR analyses  Overnight C. jejuni cultures were diluted to an O.D.600 of 0.05. Bacteria were harvested either at mid-log phase (for RT-PCR) or after 3, 6, 9, and 12 hours (for microarray and RT-qPCR) and immediately placed into 10X stop solution (95% ethanol plus 5% phenol) on ice prior to centrifugation and flash-freezing in a dry ice-ethanol bath. RNA was prepared as previously described (80). cDNA generation was performed using SuperScript III (SSIII; Invitrogen) as per the manufacturer’s instructions and purified with a PCR clean up kit (Zymo Research). RNA purity was confirmed by PCR and concentration was assessed using a ND-1000 spectrophotometer (Wilmington, DE).  2.2.4: Transcript analysis of cDNA Establishment of fdhT and fdhU co-transcription was performed using cDNA generated from log-phase WT C. jejuni as above. PCR with Taq polymerase was performed using combinations of primers A, B, C, and D, and bands were resolved by gel electrophoresis. Quantitative PCR of cDNA was performed with the SYBR green (Biorad) q-PCR system using primers fdhT-q-Fw + fdhT-q-Rv, fdhA-q-Fw + fdhA-q-Rv, and rpoA-q-Fw + rpoA-q-Rv  as per the manufacturer’s instructions. Reactions were run with 4ng cDNA, 0.3µM each primer, and 50% SYBR green mix per reaction. Increases in SYBR green fluorescence were measured using a Biorad CFX96 C1000 real time system thermocycler. The fold differences in amplifications between samples were calculated using the comparative threshold cycle (ΔΔCT) method as previously described (215).  2.2.5: Construction and analysis of the C. jejuni DNA microarray  Construction of the DNA microarray was performed essentially as previously described (170). In addition, ORFs specific to strain 81-176 were included on the array using primers from Operon Technologies (Alameda, CA) designed with ArrayDesigner 2.0 (Premier Biosoft, Palo Alto, CA). All PCR products were purified with a Qiagen 8000 robot and the QIAquick 96-well Biorobot kit (Qiagen). Purified amplicons were spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) 32  using an OmniGrid Accent (GeneMachines, Ann Arbor, MI). After printing, the microarrays were immediately UV cross-linked at 300 mJ using a Stratalinker UV Cross-linker 1800 (Stratagene, La Jolla, CA) and stored in a desiccator. Prior to use, microarrays were blocked with Pronto! prehybridization solution (Corning Inc.) used according to the manufacturer's specifications. Gene expression comparison was performed indirectly by comparing expression profiles of C. jejuni WT bacteria ΔfdhU and ΔfdhUC strains separately on different slides (170). Comparison between strains was done for cultures grown in shaking broth for 3h, 6h, 9h, and 12h in MH broth at 38ºC. C. jejuni WT, ΔfdhU and ΔfdhUC cDNA was labeled with Cy3-dUTP and mixed with Cy5-dUTP labeled reference genomic DNA from strain C. jejuni 81-176 before being hybridized to the cDNA array. Arrays were scanned using an Axon GenePix 4000B microarray laser scanner (Axon Instruments, Union City, CA). The array was done with two technical replicates per array for each time point. GenePix 4.0 software was used to process spot and background intensity, and data normalization was performed to compensate for differences in the amount of template amount or unequal Cy3 or Cy5 dye incorporation as previously described (170). GeneSpring 7.3 software (Silicon Genetics, Palo Alto, CA) was used to analyze normalized data and a parametric statistical t test was used to determine the significance of the centered data at a P value of <0.05, adjusting the individual P value with the Benjamini-Hochberg false discovery rate multiple test correction in the GeneSpring analysis package. 2.2.6: Gentamicin assay for adherence and invasion of host epithelial cells Cells from the human intestinal cell line Caco2 were acquired from the ATCC and passaged in Minimum Essential Media (MEM; Gibco) supplemented with 20% fetal bovine serum (Gibco) and 1X Penicillin-Streptomycin (Pen-Strep; Gibco). Caco2 cells were grown in a humidified air incubator at 37°C with 5% CO2. Assessment of C. jejuni adherence and invasion into Caco2 cells was performed essentially as previously described (80). Caco2 cells were grown to semi-confluence and seeded into 24 well plates without Pen-Strep at 105 cells per well and incubated for 24h. Mid-log phase C. jejuni grown with 33  shaking overnight in MH broth were centrifuged and suspended in MEM at an O.D.600 of 0.002 (~107 C. jejuni/mL). 1mL of this suspension (MOI ~100) was used to inoculate Caco2 cells. To assay ‘adherence and invasion,’ 3h after inoculation cells were washed two times with 1mL MEM before addition of 1mL distilled water. Caco2 cells were disrupted by syringe lysis to recover C. jejuni and enumerated by plating on MH plates under standard C. jejuni growth conditions. Where noted, strains were also plated on MH + 20mM sodium sulfite. To assess ‘invasion,’ 3h following inoculation fresh MEM containing 150 µg/mL gentamicin was added to each well for 2h to kill extracellular bacteria. The Caco2 cells were washed three times with MEM and lysed and plated as above. To asses ‘intracellular survival,’ 2h post gentamicin treatment the media was removed and replaced with MEM containing 3% FBS and 10µg/mL gentamicin. The cells were incubated for 3h and Caco2 cells were washed three times with MEM and lysed and plated as above. All experiments utilizing the gentamicin protection assay were repeated a minimum of three times, with each strain assayed in triplicate in each experimental trial. Data shown are from a representative experiment with similar findings consistently observed in each trial. 2.2.7: Processing of C. jejuni for confocal microscopy Caco2 cells were grown to semi-confluence and seeded onto glass coverslips (Fisher) at 1.5x105 cells per well for 24h. Caco2 cells were inoculated with mid log phase C. jejuni as above at an MOI of 10 in MEM. Infection and gentamicin treatment were performed as above. At the ‘adherence and invasion’ and ‘invasion’ time points, monolayers were washed 2 times with PBS before fixation with 4% paraformaldehyde (Canemco) in PBS. When noted, monolayers were treated with 0.1% Triton-X100 (Fisher) to permeabilize cells. For immunofluorescence, samples were blocked in 10% goat serum with 1% Bovine serum albumin in PBS, washed 3 times with PBS, incubated with a 1:200 dilution of an anti-C. jejuni rabbit IgG antibody (US. Biological) in PBS, washed 3 times with PBS, incubated with a 1:500 dilution of anti-rabbit goat IgG antibody conjugated to Alexa 568 (Invitrogen) in PBS, and washed 3 times with PBS. All samples for microscopy were mounted using Prolong Gold Antifade with DAPI (Invitrogen). 34  Imaging was performed with an Olympus Fluoview FV1000 laser scanning confocal microscope using the FV10-ASW 2.0 Viewer software to adjust images. For enumeration of GFP-labeled bacteria, 6 independent fields of view for each strain were counted. For permeabilization studies to differentiate between internalized vs. extracellular bacteria, 3 fields of view containing ~50 Caco2cells apiece were visualized for each strain, with 3 independent experimental replicates. As almost no bacteria were observed to react with the antibody without cell permeabilization for any strain (making statistical comparisons between mutant and WT difficult), and given the data shown in the sulfite recovery experiment, precise numerical analyses for this experiment were not performed. 2.2.8: Measurement of respiration rates by oxygen uptake Assays for formate oxidation were performed as previously described (196) by measuring oxygen depletion using a Clarke-type oxygen electrode (model 5301; Yellow Springs Instruments), an O2 meter, and a microcomputer. Calibration was performed with oxygen-saturated PBS as an upper baseline and sodium dithionate in PBS as a bottom baseline. Cell-free extracts were generated from 100mL of C. jejuni grown for 16h in shaking liquid culture. Bacteria were harvested at 10,000 rpm for 10 min and re-suspended in PBS. The bacteria were washed three times with PBS, re-suspended in 5mL PBS, and sonicated 6 times for 15s. Unlysed cells and cellular debris were removed by centrifugation at 10,000 rpm for 15min. The supernatant was removed and used as the cell-free extract and adjusted with PBS to bring all samples to the same protein concentration. A total of 1mL of cell-free extract was added to the electrode and equilibrated at room temperature, after which formate dissolved in PBS was injected through the central pore to a final concentration of 12.5mM. These experiments were repeated twice with identical results; the data shown are representative results from one experimental trial.  35  2.3: Results 2.3.1: fdhT and fdhU are co-transcribed and selectively conserved in a range of bacterial species  The genomic organization of fdhT and fdhU (CJJ81176_1492 and CJJ81176_1493) is shown in Figure 2.1A. To test if fdhT and fdhU are co-transcribed, RT-PCR was performed on RNA isolated from C. jejuni strain 81-176 using primers annealing to specific regions within the predicted fdhT and fdhU coding regions (Figure 2.1A). When reverse transcriptase was included in the reactions, amplicons of the expected size, as determined by positive control PCR reactions using genomic DNA, were observed for primer sets both within fdhT (A and B) and fdhU (C and D) and also for primers spanning fdhT and fdhU (A and D) (Figure 2.1B). Amplicons were not observed using any of the fdhT or fdhU primers in combination with primers annealing to neighboring genes (not shown), or from control reactions without reverse transcriptase. This demonstrated that fdhT and fdhU are transcribed as a single operon.         36   Figure 2.1. The genomic organization and co-transcription of fdhT and fdhU.  A) Genomic organization of fdhT and fdhU (CJJ81176_1492 and CJJ81176_1493 in C. jejuni strain 81-176). Approximate sites of primer annealing for RT-PCR are shown as arrows labeled A, B, C, and D. Gene lengths are not to scale. B) PCR on C. jejuni cDNA with reverse transcriptase SuperScript III (+SSIII), without SuperScript III (-SSIII), or using genomic DNA (gDNA). Primer sequences are in Appendix 1.    In silico analyses of FdhU indicated that the entire predicted protein comprises a conserved domain found in the SirA_YedF_YeeD superfamily of transcription regulators. SirA regulators in Salmonella spp. and Vibrio cholerae contain N-terminal phosphorylation and C-terminal DNA binding domains and are ~220 residues in length, while FdhU is 76 residues. FdhU homology extends from aa42 to aa118 of SirA, lacking the canonical SirA DNA binding domain but harboring an N-terminal CPxP motif thought to stabilize the first helix of the protein (173). FdhU is closer in size and overall similarity (24% identity) to the ~81residue E. coli SirA/YhhP/TusA proteins, one of which has been shown to be involved in tRNA modification (108). NMR studies of YhhP/TusA also indicate potential mRNA interaction domains (129). In silico analyses of FdhT predict a 402residue, 10-transmembrane domain, inner membrane protein, and a conserved domain of unknown function found in the YeeE/YedE family of proteins which likewise have unknown function (76, 173).  37  Although the in silico analyses of FdhT and FdhU described above revealed some conserved domains found in previously identified proteins, BLAST analyses revealed significant homology to a number of uncharacterized gene pairs in a variety of other bacterial species. Representative examples are shown in Table 2.1. Among the other Campylobacters, FdhT and FdhU were highly conserved in C. coli and C. fetus (88% and 65% identity for FdhT, 92% and 73% identity for FdhU, respectively) species but were absent from C. concisus and C. curvus. Within other epsilon-proteobacteria, homologs were not found in Wolinella and Sulfurospirillum species but were present in Arcobacter butzleri (48% identity for FdhT, 66% identity for FdhU). Among the Helicobacters, homologs were absent from H. pylori but did occur in H. hepaticus and H. musteleae (48% and 47% identity for FdhT, 68% and 57% identity for FdhU, respectively). Homologs were also found in many other Gram-negative pathogens, including Salmonella enteric serovar Typhimurium, Pseudomonas aeruginosa, and Shigella flexneri, and the Gram-positive Lactobacillus oris and Thermincola potens (Table 2.1), as well as in many other species (data not shown). In all observed cases, fdhT and fdhU were adjacent on the chromosome. The conservation of these two co-occurring genes in multiple different bacterial species suggests FdhT and FdhU function in the same pathway or functional unit.  Table 2.1: FdhT and FdhU are conserved in a variety of bacterial species. Shown are select homologs derived from BLAST searches of FdhT and FdhU against other bacterial genomes.  Identity Similarity Coverage E Value Accession Number Identity Similarity Coverage E Value Accession NumberCampylobact r coli 88% 94% 99% 0.00 ZP_07401456.1 92% 99% 100% 3.00E-50 ZP_07401457.1Cam ylobacter fetus 65% 78% 98% 0.00 YP_891776.1 73% 92% 98% 4.00E-41 YP_891777.1Helicobacter hepaticus 48% 67% 99% 5.00E-135 NP_860829.1 68% 86% 96% 2.00E-34 NP_860830.1Arcobac e  butzleri 48% 65% 99% 1.00E-136 ZP_07890639.1 66% 83% 93% 5.00E-34 ZP_07890640.1Helico act r m stelae 47% 65% 99% 1.00E-118 YP_003516553.1 57% 75% 96% 3.00E-28 YP_003516552.1Ent r bacter a rogenes 46% 63% 99% 1.00E-126 YP_004593790.1 67% 83% 93% 3.00E-35 YP_004593789.1Kleb iell  p umoniae 45% 62% 99% 5.00E-123 YP_001335167.1 64% 83% 93% 5.00E-33 YP_001335166.1Salmonella Typhimuriuma44% 62% 98% 5.00E-123 NP_460918.2 66% 84% 93% 1.00E-34 NP_460919.1Sh g lla fl xneri 44% 62% 99% 2.00E-113 NP_837542.1 66% 84% 93% 6.00E-34 NP_837543.1Citrobacter rodentium 44% 62% 98% 1.00E-122 YP_003365568.1 64% 84% 93% 2.00E-33 YP_003365569.1Pseu omon s aeruginosa 44% 57% 93% 3.00E-92 NP_252323.1 51% 72% 98% 3.00E-26 NP_252322.1Escherichia coli 43% 62% 98% 8.00E-113 NP_416439.1 66% 84% 93% 8.00E-35 NP_416440.1Lactobacillus oris 43% 62% 96% 4.00E-107 ZP_07730384.1 48% 80% 92% 2.00E-27 ZP_07730371.1Yersinia pestis 43% 60% 98% 4.00E-118 NP_667871.1 64% 84% 93% 3.00E-33 NP_667872.1Thermincola potens 41% 56% 99% 2.00E-96 YP_003641387.1 45% 68% 100% 6.00E-22 YP_003641386.1Campylobacter jejuni ZP_02271798 ZP_02271799FdhT FdhU38  2.3.2: ΔfdhU and ΔfdhT mutants exhibit apparent host cell adherence and/or invasion defects by colony-forming unit (CFU) enumeration but not by direct microscopic counts of intracellular bacteria  To assess the importance of fdhT and fdhU in C. jejuni infection of epithelial cells, fdhT and fdhU mutant and complemented (fdhTC and fdhUC) strains were constructed in the invasive C. jejuni strain 81-176 as described in section 2.2.2. Both mutants exhibited WT behavior for motility, growth, and biofilm formation (data not shown). Roles for fdhT and fdhU in adherence and invasion in intestinal epithelial cells were initially investigated with gentamicin protection assays followed by host cell lysis and colony forming unit (CFU) enumeration of recovered C. jejuni. Caco2 epithelial cells were infected with WT, ΔfdhT, and ΔfdhU strains for 3 h, after which bacteria from the ‘adherence and invasion’ time point were harvested. Following a subsequent 2 h gentamicin treatment, cells were washed, and bacteria from the ‘invasion’ time point were harvested.  Significant defects were observed for both mutants at both time points (Figure 2.2A). Complementation (ΔfdhTC and ΔfdhUC) rescued these defects in both mutant strains (Figure 2.2A).  A defect in CFU recovery from cells prior to addition of gentamicin may result solely from an adherence defect, which in turn will influence CFU recovery of invaded bacteria. To investigate whether the above findings specifically reflected adherence defects, WT, ΔfdhT, and ΔfdhU strains were transformed with a plasmid carrying the green fluorescence protein (GFP) expressed from the strong constitutive atpF’ promoter (166) to allow visualization by confocal microscopy. Caco2 cells were grown on glass coverslips and infected with C. jejuni as above; however, rather than harvesting for CFU enumeration, slides were washed and processed for microscopy as described in section 2.2.7. Direct counting of C. jejuni associated with Caco2cells showed no significant differences between WT and the ΔfdhT and ΔfdhU mutant strains at either the ‘adherence and invasion’ or ‘invasion’ time points (Figure 2.2B). This indicated that ΔfdhT and ΔfdhU were not defective for cell association.  39         Figure 2.2. The effect of FdhU and FdhT on intracellular survival and association with Caco2 cells   A) Viability of intracellular C. jejuni WT, ΔfdhU, ΔfdhT, ΔfdhU C and ΔfdhT C strains was assessed in Caco2 cells at the ‘Adherence and Invasion’ or ‘Invasion’ timepoints by CFU enumeration. B) Enumeration of GFP expressing C. jejuni WT, ΔfdhU and ΔfdhT strains associated with Caco2 cells. NS denotes no statistically significant differences between indicated strains. Statistically significant differences (P<0.05) are denoted by an asterisk (*).  To further investigate if ΔfdhT and ΔfdhU were capable of invasion of Caco2cells, cells grown on coverslips were infected with C. jejuni expressing GFP as above. While processing for confocal 40  microscopy, cells were either permeabilized with Triton-X100 or left unpermeabilized. Both permeabilized and unpermeabilized samples were then incubated with a rabbit anti-C. jejuni antibody followed by a goat anti-rabbit antibody conjugated to Alexa568. In unpermeabilized samples, only extracellular (adhered) bacteria will react with the antibody (leading to yellow or red fluorescence depending on the level of GFP also being expressed), whereas all bacteria (adhered and invaded) will fluoresce yellow/red in permeabilized samples. Confocal microscopy (a representative image is shown in Figure 3; see section 2.2.7) showed that similar levels of WT, ΔfdhT and ΔfdhU strains had invaded the Caco2 cells (Figure 2.3). Furthermore, the majority of bacteria from all three strains were internalized even prior to gentamicin treatment (Figure 2.3). This indicates that ΔfdhT and ΔfdhU are capable of proper adherence and invasion of host cells and suggests that the CFU data represent either a rapid decline in intracellular viability or a defect in recovery following host cell infection. 41   42  Figure 2.3. The role of FdhU and FdhT in invasion of Caco2 cells  C. jejuni WT, ΔfdhU, and ΔfdhT strains expressing GFP (green) were used to infect Caco2 cells in a gentamicin protection assay. The ‘Adherence and Invasion’ time point is shown in A), and the ‘Invasion’ time point in B). To differentiate between extracellular and intracellular bacteria, C. jejuni were either permeabilized with Triton-X100 (+TritonX-100) or not permeabilized (-TritonX-100), then labeled with an anti-C. jejuni antibody and visualized using a secondary antibody labeled to Alexa-568 (red). Caco-2 cell nuclei were stained with DAPI (blue).    2.3.3: Transcript analysis reveals down-regulation of genes required for Fdh activity in the ΔfdhU mutant strain The presence of a putative mRNA binding domain found in the YedF family of proteins suggested that FdhU might influence mRNA levels of genes that in turn modulate cell infection phenotypes. RNA from WT, ΔfdhU, and ΔfdhUC strains was harvested from broth cultures over a growth time course to assess global mRNA changes in the ΔfdhU mutant via microarray analyses. Only two genes, fdhA and fdhB, encoding subunits of the Fdh complex, were significantly (>2-fold) dis-regulated compared to WT. Both genes were down-regulated, with fdhA and fdhB displaying 3.4- and 10.5-fold lower levels of mRNA, respectively, in fdhU compared to WT (p<0.001 for both genes) at the 3 h time point. More modest down-regulation was observed at later time points, and WT expression levels were restored in the complemented strain (data not shown).  Microarray results for fdhA were confirmed by RT-qPCR using rpoA as an internal control as previously described (235). RT-qPCR revealed an 8.7-fold reduction of fdhA mRNA in the ΔfdhU mutant and a 9.2 fold-reduction in the ΔfdhT mutant (Figure 2.4). fdhA expression was restored to WT levels in the complemented strains ΔfdhUC and ΔfdhTC (Figure 2.4). RT-qPCR also showed that FdhU affects its own transcript levels, with the ΔfdhU mutant exhibiting 1.7-fold higher mRNA levels of fdhT than WT, and complementation restoring WT mRNA levels. An fdhT promoter-luciferase reporter construct also displayed 3-fold higher activity in an ΔfdhU background compared to WT over 9 h of growth (data not shown). RT-qPCR investigating fdhU mRNA levels in ΔfdhT confirmed that the kanamycin resistance 43  cassette used to disrupt fdhT did not interfere with transcription of fdhU and in fact showed a modest increase in fdhU mRNA levels compared to WT (data not shown).    Figure 2.4. Regulation of fdhA, fdhT and fdhU operons in ΔfdhU and ΔfdhT mutant strains  The mRNA abundance of fdhA (grey bars) and fdhT (white bars) was assessed in various mutant and complemented strains as compared to WT. Statistically significant differences (P<0.05) are denoted by an asterisk (*) above the line connecting the indicated strains.  2.3.4: fdhU is required for respiration-dependent oxygen consumption using formate as an electron donor To test if disruption of fdhU impacted Fdh function, respiration was measured using formate as an electron donor. An ΔfdhA mutant constructed as described in Methods was used as a control. WT, ΔfdhU, ΔfdhUC and ΔfdhA strains grown to mid-log phase were used to prepare cell-free extracts, and respiration-dependent oxygen consumption was measured using a Clark-type electrode. In WT and ΔfdhUC strains, the addition of 12.5mM sodium formate resulted in an immediate decrease in soluble oxygen (Figure 2.5). In contrast, ΔfdhU and ΔfdhA displayed no decrease in oxygen levels. This indicates that disruption of fdhU leads to a severe defect in Fdh activity. 44   Figure 2.5. Respiration-dependent oxygen consumption in the presence of formate in WT, ΔfdhU, ΔfdhUC and ΔfdhA strains  Respiration-dependent oxygen consumption was measured in A) WT, B) ΔfdhU, C) ΔfdhUC and D) ΔfdhA strains by formate-linked oxygen depletion using a Clark-type oxygen electrode. Arrows denote the addition of sodium formate to a total concentration of 12.5 mM.    2.3.5: The ΔfdhA mutant displays similar cell infection phenotypes as ΔfdhU  As most of the genes exhibiting >2-fold down-regulation in ΔfdhU were Fdh-related, I hypothesized that the dramatic effect of FdhU on Fdh activity (Figure 2.5) might also account for the apparent adherence and/or invasion defects observed by CFU enumeration of the ΔfdhU mutant following host cell infection. To test this, Caco2 cells were infected with WT, ΔfdhU, ΔfdhA and ΔfdhUΔfdhA double mutant strains and subjected to a gentamicin protection assay followed by CFU enumeration of bacteria as above.  All three mutants were defective at both the ‘adherence and invasion’ and ‘invasion’ time points (Figure 2.6A). Although the double mutant was slightly more defective than either single mutant at the ‘adherence and invasion’ time point, differences between the strains were not statistically significant. The nearly identical and likewise non-statistically significant defects at the ‘invasion’ time point for ΔfdhU, ΔfdhA and ΔfdhUΔfdhA in particular suggest that FdhU and FdhA function in the same pathway. An ΔfdhA strain expressing GFP was also constructed and used to infect Caco2 cells for analysis by confocal microscopy (Figure 2.6B). Equivalent numbers of WT and ΔfdhA bacteria were associated with Caco2cells at both time points, suggesting no defect in cell association.  45   Figure 2.6. The intracellular survival and association with Caco2 cells in C. jejuni WT, ΔfdhU, ΔfdhA and ΔfdhUΔfdhA  strains  A) C. jejuni strains were used to infect Caco-2 cells and viability of WT, ΔfdhU, ΔfdhA and ΔfdhUΔfdhA strains was assessed at the ‘Adherence and Invasion’ or ‘Invasion’ timepoints using the gentamicin protection assay by CFU enumeration. B) Enumeration of GFP-expressing WT and ΔfdhA C. jejuni associated with Caco-2 cells. Statistically significant differences (P<0.05) are denoted by an asterisk (*) NS denotes no statistically significant differences between indicated strains (P>0.05).     2.3.6: Supplementation of recovery plates with sulfite enhances CFU counts of C. jejuni following host cell infection and leads to equivalent recovery of WT, ΔfdhU and ΔfdhA strains Finally, I wished to reconcile whether the apparent CFU-based adherence and/or invasion defects of ΔfdhT, ΔfdhU, and ΔfdhA mutant strains following infection of Caco2cells reflected a decline in intracellular survival or a decreased ability to resume growth after liberation from the intracellular 46  environment. I hypothesized that mutants defective for Fdh activity may be equally viable as WT in the intracellular environment, but may require post-infection supplementation with an alternative electron donor to enhance recovery in vitro. As sulfite is one of the only known C. jejuni electron donors that is not likely to feed into other metabolic pathways, and as C. jejuni’s sulfite utilization system was previously suggested as potentially important in low-oxygen conditions as would be encountered inside cells (196), I decided to test this hypothesis using recovery plates supplemented with 20 mM sodium sulfite. Caco2cells were infected with WT, ΔfdhU and ΔfdhA strains and assayed for CFU recovery using a gentamicin protection assay as above. In addition to ‘adherence and invasion’ and ‘invasion’ time points, I also assessed an ‘intracellular survival’ time point (3 h infection, 2 h gentamicin treatment, 3 h additional incubation with fresh tissue culture media). Recovered C. jejuni were enumerated by CFU counts on MH agar plates +/- 20mM sodium sulfite. On plates supplemented with sulfite, no significant differences in CFU recovery were observed between WT, ΔfdhU, and ΔfdhA strains (Figure 2.7A). This was in contrast to plating on MH media alone which, as expected, showed a significantly lower recovery of ΔfdhU and ΔfdhA compared to WT. Unexpectedly, recovery of WT C. jejuni on sulfite-supplemented plates was 5-fold higher at the ‘invasion’ time point and 11-fold higher at the ‘intracellular survival’ time point compared to plating on unsupplemented MH media, with even more dramatic differences seen for the mutant strains (Figure 2.7A,B). Enhanced recovery of WT on supplemented versus unsupplemented plates was not observed for the inoculum or at the ‘adherence and invasion’ time point, nor were the mutant inoculum enhanced for recovery on supplemented plates. Plating C. jejuni on MH media supplemented with 10mM sodium formate yielded no significant differences in recovery of any strain compared to MH media (data not shown). Collectively, this suggests that each apparent defect for the ΔfdhU and ΔfdhA mutants observed by CFU enumeration on MH media was due to post-infection recovery, and not to defects in adherence, invasion, or intracellular survival. Enhanced recovery of all 47  strains on sulfite-supplemented plates further suggests that C. jejuni undergoes metabolic changes inside host cells.    Figure 2.7. Intracellular recovery of viable WT, ΔfdhU and ΔfdhA strains from Caco2 cells on plates supplemented with the alternative electron donor sodium sulfite A) Viability of intracellular C. jejuni WT, ΔfdhU, and ΔfdhA strains at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints was determined by CFU enumeration by plating on MH agar plates or MH agar plates supplemented with 20mM sodium sulfite. Relevant statistically significant differences (P<0.05) are denoted by an asterisk (*). B) Shown are the fold differences for select strains between CFU recovered on sulfite-supplemented plates (“+S”) compared to non-supplemented plates.    2.4: Discussion It has been established that C. jejuni can invade epithelial cells and persist in an intracellular compartment (51, 140, 169, 238, 292, 306). To date, however, it is poorly understood how C. jejuni 48  survives intracellularly, and what genes and factors are important for the transition back to an extracellular lifestyle. Work by our group and others has identified roles for various regulators in adherence, invasion, and/or intracellular survival (11, 68, 80, 87, 169), indicating the importance of transcript modulation during these transitions. I also previously found, via a microarray-based screen, that several genes up-regulated in C. jejuni during infection of host cells were required for various aspects of the pathogen-host cell interaction (80, 157, 265). An operon I have designated fdhTU was also identified in that screen, leading to the hypothesis that FdhT and FdhU may be important for an aspect of bacterial physiology involved in epithelial cell interactions.   Precise roles for FdhT and FdhU could not be assigned from in silico analyses. However, amino acid sequence similarity suggested that FdhT is an inner membrane transport protein, and the presence of a CPxP motif potentially involved in mRNA interactions (129) and modest similarity to a protein involved in tRNA modification (108) suggested that FdhU may play a regulatory role. Indeed, significantly reduced levels of fdhA and fdhB mRNA were observed in the ΔfdhU strain by both microarray and RT-qPCR analysis. Correspondingly, FdhU was shown to be crucial for Fdh activity, as fdhU deletion caused a severe defect in oxygen-dependent respiration with formate as an electron donor.    Fdh activity is tightly regulated in other bacteria. In E. coli, fdh operons are differentially regulated by anaerobiosis, pH, nitrate, and formate levels (63, 187, 290). Fdh gene expression is regulated by H2 in Methanococcus maripaludis (299) and by formate in Desulfovibrio vulgaris (307). In C. jejuni, fdh genes have been shown to be up-regulated in an animal model of infection and down-regulated in gastric fluid (234, 263), but specific inducing/repressing signals have not been determined. Transcriptional regulators binding directly upstream of Fdh operons have also been identified in other bacteria (210, 290), but homologs are not present in C. jejuni. An independent concurrent study by Shaw and colleagues using two different C. jejuni strains demonstrates a requirement for selenium in C. jejuni Fdh activity, confirms the importance of FdhTU for Fdh function, and suggests that FdhTU modulates Fdh – and possibly its 49  expression – via import of selenium which is then, via the Sel pathway, converted to selenocysteine which is required for FdhA synthesis (247). In some organisms, selenium availability has been postulated to affect mRNA stability (175); future work will determine if this is the case in C. jejuni and also shed light on specific mechanisms by which FdhU affects transcript levels of Fdh-related genes. The conservation of FdhTU among a variety of bacterial species, as well as its absence from others, may also reflect a novel metabolic regulatory mechanism required for navigation through specific niches.  Disruption of fdhT, fdhU, and fdhA and assessments of Caco2 cell adherence and invasion by gentamicin protection assays initially yielded contradictory CFU versus microscopy findings which were reconciled by supplementing post-infection recovery plates with sulfite. For instance, each mutant strain appeared defective for adherence and/or invasion when assessed by CFU recovery on MH media. However, similar assays with GFP-expressing strains followed instead by confocal microscopy showed no difference in the number of cell-associated C. jejuni between WT and mutant strains. Immunofluorescent staining of extracellular versus intracellular C. jejuni further showed that ΔfdhU and ΔfdhT could invade Caco2 cells at WT levels. This experiment also suggested that negligible numbers of cell-associated C. jejuni were extracellular. While these findings differ from numerous previous reports showing higher numbers of adhered vs. invaded C. jejuni using the classic gentamicin protection assay, they are in agreement with more recent microscopy-based work from other groups suggesting that even at time points traditionally assayed to represent “adherence”, the majority of recovered C. jejuni have invaded and/or subvaded (residing beneath host cells)cells (279, 292). Nonetheless, it should also be noted that it is possible that some extracellular bacteria are removed during the processing steps for confocal microscopy (i.e., fixation, antibody washes, etc.), and that the methodologies cannot discriminate between invaded and subvaded bacteria. However, it is also possible that the majority of C. jejuni are internalized at the “adherence” time point but then lose viability or culturability by the traditional “invasion” time point. Double mutant analysis together with data showing defective Fdh activity in the ΔfdhU mutant suggest 50  that loss of Fdh function likely accounts for the ΔfdhU CFU recovery phenotype, although additional effects from disregulation of other genes cannot be completely discounted. My findings showing equal recovery of fdh mutant and WT strains on sulfite-supplemented plates ultimately led us to conclude that the mutants in fact have no obvious defects in adherence, invasion, or intracellular survival, but rather a defect compared to WT for post-cell infection recovery on unsupplemented MH agar.  In addition to equalizing CFU recovery for the fdh mutants compared to WT, I found that sulfite supplementation dramatically enhanced recovery of all assayed C. jejuni strains following liberation from the intracellular environment. This suggests that C. jejuni undergoes metabolic changes when it is intracellular, consistent with previous work demonstrating that anaerobic incubation of C. jejuni upon liberation from epithelial cells can also enhance CFU recovery (292). C. jejuni has a branched respiration system and is able to use a wide range of compounds as electron donors and acceptors (85, 98, 213, 275, 293). Furthermore, formate, sulfite, and hydrogen gas are abundant as byproducts of commensal bacterial fermentative metabolism, from normal metabolism of amino acids, and as food additives (43, 56, 278). This suggests that both the metabolic potential and the role(s) of various dehydrogenases for C. jejuni in vivo may be very complex.  Shifts in metabolic potential during intracellular survival have been observed in other bacteria [i.e., as reviewed in (57, 62)].  Specific examples include S. flexneri and S. enteric serovar Typhimurium, which down-regulate the Krebs cycle (165) and up-regulate the arginine importer ArgT (46), respectively. Numerous changes also occur in intracellular M. tuberculosis, including enhanced lipid metabolism, cell wall synthesis, and iron uptake, and down-regulation of ATP synthesis systems (195, 241). Future work in chapter 3 will elucidate why sulfite supplementation yielded significant increases in C. jejuni culturability post-cell infection, and whether this effect is specific to sulfite. My data indicate that enumeration of intracellular C. jejuni via CFU counts following gentamicin protection assays may result in an underestimation of viable intracellular organisms.      51  In summary, I have identified a novel operon required for proper expression and function of Fdh and demonstrated the importance of both FdhTU and Fdh in recovery following epithelial cell infection. To the best of my knowledge, these are the first proteins shown to impact this aspect of the C. jejuni-host cell interaction. My findings likely have implications for C. jejuni-host cell interactions in vivo as well, elucidation of which will be the focus of later chapters in this thesis, and further support the need to better understand survival and metabolic strategies of bacterial pathogens, particularly for organisms such as C. jejuni which lack canonical virulence factors. This generally emerging theme also applies to other pathogens, as increased understanding of metabolic changes during intracellular existence may yield insights into new treatment strategies.    52  Chapter 3:  The role of sulfite in enhanced recovery of C. jejuni from host cells and the importance of gluconate dehydrogenase in inducing enhanced host cell necrosis.  3.1: Introduction and synopsis I previously found in chapter 2 that upon liberation of C. jejuni from host epithelial cells at the invasion or intracellular survival time-points, the numbers of recovered C. jejuni could be enhanced by plating C. jejuni for CFU on media supplemented with sulfite. In addition, I found that Fdh is important for recovery of C. jejuni from host cells. As such, I was left with two remaining questions: (1) how does sulfite enhance recovery of C. jejuni from epithelial cells, and (2) are other respiratory dehydrogenases important for host cell infection, recovery from host cells, or other pathogenesis-related phenotypes. Analyses herein determined that enhanced recovery of intracellular C. jejuni on sulfite is independent of the use of sulfite as an electron donor by Sor, the sole C. jejuni sulfite oxidoreducatase that interacts with the ETC (196). Instead, intracellular C. jejuni appeared to be under oxidative stress produced by host cells, and the enhanced recovery of C. jejuni from host cells when plated on sulfite was due to the ROS scavenging activity of sulfite. With the finding that ΔfdhA is defective in host cell recovery, and not adherence or invasion as previously believed, I decided to re-visit roles for this in other dehydrogenase systems. In addition to assessing the nature of epithelial cell infection defects, I also assessed pathogen related phenotypes such as cytokine transcription and necrosis. The mutant strains Δgdh, ΔputA, Δmdh, and ΔhydB were found to be defective for intracellular survival in Caco2 intestinal epithelial cells as assessed by CFU enumeration after gentamicin treatment, but not significantly defective for adherence or proper intracellular trafficking as assessed by confocal microscopy. All strains could be partially 53  enhanced for recovery from epithelial cells by plating on sulfite, but none could be rescued to WT+sulfite levels, suggesting that defects are not strictly recovery related.   Analysis of pathogenesis-related phenotypes in infected T84 intestinal epithelial cells showed that the Δgdh mutant caused reduced TNF-α/IL-8 transcription and enhanced host cell death as compared to WT. Host cell death induced by both WT and Δgdh shared features consistent with necrosis. Inhibition of death pores and calpain activation significantly inhibited killing of host cells by WT and Δgdh strains. Activation of necrosis and calpain is likely linked to toxicity from ROS, as a mitochondrial scavenger of ROS species as well as inhibition of NADPH oxidase (NOX) family of proteins significantly reduced host cell death by WT and Δgdh C. jejuni. A better understanding of the steps leading to induction of necrosis by C. jejuni may help elucidate how C. jejuni initiates gastrointestinal distress. In addition, discovering why Δgdh causes enhanced induction of necrosis may reveal new information on how bacterial metabolism can impact pathogenesis as well as severity of disease.      3.2: Materials and methods 3.2.1: Reagents  Necrostatin-1 and Z-VAD-FMK (N-Benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone) were purchased from ENZO Life Science. Bovine catalase, camptothecin, ALLN (Ac-LL-Norleucinal) and allopurinol were purchased from Sigma, MDL-28170 (N-[(1S)-1-[[(1-formyl-2-phenylethyl)amino]carbonyl]-2-methylpropyl]-carbamic acid, phenylmethyl ester), PD150606 ((2Z)-3-(4-iodophenyl)-2-mercapto-2-Propenoic acid, 3-(4-iodophenyl)-2-mercapto-(Z)-2-propenoic acid), mito-tempo, AEBSF (4- benzenesulfonyl fluoride hydrochloride), and apocynin were purchased from Santa Cruz Biotech.  3.2.2: Bacterial growth conditions All experiments were performed using the C. jejuni strain 81-176. Strains were grown in Mueller-Hinton (MH) media (Oxoid, Ltd) on agar plates at 38ºC in a Sanyo Tri-Gas Incubator at 6% O2 and 12% CO2 or in 54  shaking broth at 38ºC using the Oxoid CampyGen system. All MH media were supplemented with 10µg/ml of vancomycin (Toku-E) and 5µg/ml trimethoprim. When indicated, media was supplemented with 50µg/ml kanamycin or 25µg/ml chloramphenicol (Sigma). All DNA manipulations prior to C. jejuni were done in E. coli DH5α on LB media (Sigma) plates or broth supplemented with 100µg/ml ampicillin (Sigma), 25µg/ml kanamycin, or 30µg/ml chloramphenicol.  3.2.3: Construction of strains All enzymes used for generation of C. jejuni mutant and complemented strains were purchased from New England Biolabs. Primers used are listed in Appendix 1. PCR amplification of sorA, gdh, mdh, putA and hydA was performed with sorA-Fw + sorA-Rv, gdh-FW + gdh-Rv, mdh-Fw + mdh-Rv, putA-Fw + putA-Rv and hydA-Fw + hydA-Rv primers, respectively, using iProof DNA polymerase. Purified PCR fragments were A tailed using Taq DNA polymerase and ligated into the pGem vector. Generation of unique internal SmaI restriction sites in sorA, gdh, mdh, putA and hydA was performed by inverse PCR using primers sorA-iPCR-Fw + sorA-iPCR-Rv, gdh-iPCR-Fw + gdh-iPCR-Rv, mdh-iPCR-Fw + mdh-iPCR-Rv, putA-iPCR-Fw + putA-iPCR-Rv, and hydA-iPCR-Fw + hydA-iPCR-Rv respectively. The non-polar aphA-3 cassette encoding a kanamycin resistance gene (2) was digested out of plasmid pUC18K-2 using SmaI and ligated into SmaI-digested sorA, gdh, mdh, putA and hydA inverse PCR products. All ligations were transformed into DH5α, colonies were screened by PCR, and plasmids from positive clones were purified. C. jejuni was naturally transformed by double recombination with each plasmid and plated on MH agar supplemented with kanamycin or chloramphenicol for 48h to recover colonies. PCR and sequencing confirmed correct insertion in the chromosome by homologous recombination.   Complementation was achieved by amplification of gdh and mdh using primers gdh-C-Fw + gdh-C-Rv and mdh-C-Fw + mdh-C-Rv which introduced an XbaI site into the 5’ end and an MfeI site to the 3’ end of each gene. PCR products were digested with XbaI and MfeI and purified with the DNA clean and 55  concentrator kit (Zymo Research). The genomic integrative plasmid pRRC (1) was digested with MfeI and XbaI and ligated with the digested gdh-C and mdh-C fragments. Insert expression was driven off the pRRC promoter. Plasmids were transformed into DH5α and selected on kanamycin. Colonies were screened by PCR, and plasmids from positive clones were purified and used to transform Δgdh and Δmdh by natural transformation double recombination. All strains are listed in Appendix 3 3.2.4: Passaging of Caco2 and T84 epithelial cells The human colonic cell lines Caco2 and INT-407 was passaged and maintained in minimal essential media (MEM; Gibco) supplemented with 10% FBS 1% penicillin-streptomycin (Pen-Strep; Gibco) in a humidified air incubator at 37ºC with 5% CO2. 24h before experiments, Caco2 or INT-407 cells were harvested and seeded into 24 well plates at 105 cells per well. The human colonic cell line T84 was passaged and maintained in in DMEM/F12 media (Gibco) supplemented with 10% FBS with 1% penicillin-streptomycin (Gibco). 24h before experiments, T84 cells were harvested and seeded into 24 well plates at 105 cells per well.  3.2.5: Infection assay of epithelial cells Assessment of C. jejuni adherence and invasion into Caco2 cells was performed essentially as previously described in Chapter 2. Mid-log phase C. jejuni grown shaking overnight in MH broth were centrifuged and suspended in MEM at an OD of 0.002 (~107 C. jejuni/mL). 1mL of this suspension (MOI ~100) was used to inoculate Caco2 cells. To assay ‘adherence and invasion,’ 3h after inoculation cells were washed two times with 1mL MEM before addition of 1mL distilled water. Caco2 cells were disrupted by syringe lysis to recover C. jejuni and enumerated by plating on MH plates under standard C. jejuni growth conditions. Where noted, strains were also plated on MH + 20mM sodium sulfite. To assess ‘invasion,’ 3h following inoculation fresh MEM containing 150 µg/mL gentamicin was added to each well for 2h to kill extracellular bacteria. The Caco2 cells were washed three times with MEM and lysed and plated as 56  above. To asses ‘intracellular survival,’ 2h post gentamicin treatment the media was removed and replaced with MEM containing 3% FBS and 10µg/mL gentamicin. The cells were incubated for 3h and Caco2 cells were washed three times with MEM and lysed and plated as above. All experiments utilizing the gentamicin protection assay were repeated a minimum of three times, with each strain assayed in triplicate in each experimental trial. Data shown are from a representative experiment with similar findings consistently observed in each trial.  To assess adherence or GM130 localization of C. jejuni into Caco2 cells or INT-407 cells by confocal microscopy, cells were grown to semi-confluence and seeded onto glass coverslips (Fisher) at 1.5x105 cells per well for 24h. To assess adherence of C. jejuni to Caco2 cells, Caco2 cells were infected with mid-log phase C. jejuni strains expressing pRY112-atpF::GFP plasmid (12, 229) at an MOI of 10 in MEM. Infection and gentamicin treatment were performed as above. After co-incubation for 3h, monolayers were washed 2 times with PBS before fixation with 4% paraformaldehyde (Canemco) in PBS. To assess co-localization of C. jejuni with GM130, INT-407 cells were inoculated with mid-log phase C. jejuni at an MOI of 10 in MEM for 1h followed by replacement of media with MEM containing 150µg/ml gentamicin for 5h. Cells were washed twice with PBS and fixed in 4% paraformaldehyde. Cells were permeabilized with 0.1% Triton-X100 (Fisher) and blocked in 10% goat serum with 1% Bovine serum albumin in PBS, primary labeling was done with a 1:200 dilution of an anti-C. jejuni rabbit IgG antibody (US. Biological) and 1:200 dilution of anti-GM130 mouse IgG antibody (BD Bioscience) in PBS. Secondary labeling was done with a 1:500 dilution of anti-rabbit goat IgG antibody conjugated to Alexa 568 (Invitrogen) in PBS and 1:500 dilution of anti-mouse goat igG antibody conjugated to Alexa 488 in PBS. All samples for microscopy were mounted using Prolong Gold Antifade with DAPI (Invitrogen). Imaging was performed with an Olympus Fluoview FV1000 laser scanning confocal microscope using the FV10-ASW 2.0 Viewer software to adjust images. For enumeration of GFP-labeled bacteria and GM130 co-localization, 6 57  independent fields of view for each strain were counted, and each experiment was repeated three times.  3.2.6: Assessment of intracellular transcription of C. jejuni genes  Caco2 cells were seeded into fifteen 70ml tissue culture flasks and allowed to grow until ~70% confluent. Caco2 cells were co-incubated with 20ml mid log phase C. jejuni at an OD=0.002. ‘Adherence and invasion’, ‘invasion’, and ‘intracellular survival’ were assessed as above. At the designated time-points, flasks were washed twice with warm PBS and lysed with 5ml lysis stop solution (1%triton X-100, 1% phenol, 19% ethanol in PBS) for 45min. The resulting lysate was removed and centrifuged at high speed to pellet intracellular C. jejuni, and the resulting pellet was washed twice in lysis stop solution. Extraction of C. jejuni RNA was done as previously (229). Pellets were re-suspended in 200ul TE buffer containing 0.4mg/ml lysozyme for 5min. To this, 950ul Trizol was added and vortexed on high speed before addition of 200ul chloroform. The solution was centrifuged at 10000rpm for 1min and the top aqueous fraction was removed to a new tube containing equal volumes of 70% ethanol. The resulting extract was added directly to the RNeasy spin column as per the manufacturer’s instructions. cDNA generation was performed using SuperScript III (SSIII; Invitrogen) as per the manufacturer’s instructions and purified with a PCR clean up kit (Zymo Research). RNA purity was confirmed by PCR and concentration was assessed using a ND-1000 spectrophotometer (Wilmington, DE). Quantitative PCR of cDNA was performed with the SYBR green (Biorad) q-PCR system using primers katA-qPCR-FW + kata-qPCR-RV, sodB-qPCR-FW + sodB-qPCR-RV, dps-qPCR-FW + dps-qPCR-RV as per the manufacturer’s instructions. Reactions were run with 8ng cDNA, 0.3µM each primer, and 50% SYBR green mix per reaction. Increases in SYBR green fluorescence were measured using a Biorad CFX96 C1000 real time system thermocycler. The fold differences in amplifications between samples were calculated using the comparative threshold cycle (ΔΔCt) method as previously described using rpoA as an internal control (229). 58  3.2.7: Assessment of extracellular H2O2 and intracellular ROS production from host cells  The accumulation of extracellular H2O2 in Caco2 cells was assessed with the Amplex Red reagent (Invitrogen). Infection of Caco2 cells was done as above with modification. MEM with glucose was found to produce a high background signal due to the non-enzymatic reaction between glucose and media salts to produce H2O2. To avoid this, all experiments were performed in RPMI media with no glucose. Amplex Red buffer and reagent was prepared in RPMI media without glucose as per the manufacturer’s instructions, and C. jejuni was added when appropriate to a final OD of 0.002. At the specified time points, 50µl of supernatant was removed and the fluorescence was read in a Varioskan Flash luminometer plate reader at 530nm excitation and 560nm emission. Concentrations of H2O2 were calculated by comparing to a standard curve of known H2O2 concentrations ranging from 1µM to 5µM.  3.2.8: Assessment of IL-8 and TNF-α expression from infected T84 cells  To assess transcription levels of IL-8 and TNF-α, 105 T84 cells were infected with C. jejuni for 6h. The infected cells were washed twice with PBS, and RNA was collected using the RNeasy spin kit. Preparation of cDNA was done using the enhanced Avian First Strand Kit (Sigma) as per the manufacturer’s instructions. The cDNA was diluted 1:5 in water, and quantitative PCR of cDNA was performed with the SYBR green (Biorad) q-PCR system using primers TNF-alpha-qPCR-FW + TNF-alpha-qPCR-RV and IL-8-qPCR-FW + IL-8-qPCR-RV as per the manufacturer’s instructions. Reactions were run with 4µl cDNA, 0.3µM each primer, and 50% SYBR green mix per reaction. Increases in SYBR green fluorescence were measured using a Biorad CFX96 C1000 real time system thermocycler. The fold differences in amplifications between samples were calculated using the comparative threshold cycle (ΔΔCt) method as previously described using GAPDH as an internal control (229). 59  3.2.9: Assessment of epithelial cell death by LDH release assay  To assess epithelial cell death, T84 cells were infected by C. jejuni at an MOI of 100 as above without gentamicin treatment using the CytoTox-ONE™ Homogeneous Membrane Integrity Assay (Promega). At designated time points the media above infected cells was pipetted vigorously and 50µl of media was added to 50µl LDH assay reagent and incubated at room temperature for 30 min before measuring fluorescence. The fluorescence was assessed in a Varioskan Flash luminometer plate reader at 530nm excitation and 620nm emission and % lysis of infected cells was calculated by %lysis=(fluorescence of infected cell- fluorescence of uninfected cell)/ fluorescence of total cell lysate*100. A negative %lysis reflects a sample that has lower LDH release than the control uninfected sample and was expressed as BD for below detection.    3.3: Results 3.3.1: Enhanced recovery of C. jejuni from tissue culture cells on sulfite recovery media is due to neutralization of H2O2 produced by the host cells  In a previous study (and as described in chapter 2), I had reported that when enumerating C. jejuni from host cells after gentamicin protection assays, a significantly higher number of bacteria could be recovered if the plating media were supplemented with sulfite. The initial hypothesis was that a metabolic switch in C. jejuni had occurred when the bacteria were intracellular, causing preferential usage by C. jejuni of sulfite or other energy conservation system substrates. If intracellular C. jejuni were preferentially using sulfite or other electron donor substrates, they could require them in the media to resume growth post-infection. However, supplementation of plating media with other electron donors such as proline, gluconate, formate, or malate did not enhance recovery (data not shown). To determine if sulfite is important due to its use as an electron donor, I investigated if a ΔsorA mutant had enhanced recovery when plated on sulfite-containing media, since a ΔsorA mutant is unable to use sulfite as an 60  electron donor for the ETC (196). Consistent with previous reports, ΔsorA had a defect in recovery from host epithelial cells (Figure 3.1A). Unlike the ΔfdhA data reported in chapter 2, supplementation of plating media with sulfite did not allow recovery of the ΔsorA strain up to WT+sulfite levels. However, supplementation of enumeration plates still caused a significant increase in the amount of recoverable ΔsorA mutant bacteria suggesting that enhanced recovery with sulfite is independent of it being a metabolite. Previous reports had suggested that a ΔsorA strain had an adherence defect for epithelial cells (271), thus I hypothesized that the lower amounts of epithelial cell-associated C. jejuni may account for why a ΔsorA  mutant could not be recovered to WT + sulfite levels. However, contrary to previous reports which suggested that ΔsorA had an adherence defect, there was no observable difference between WT and ΔsorA for adherence to Caco2 cells as assessed by confocal microscopy (Figure 3.1B). In addition, when assessing co-localization with the host marker GM130, a marker for invasion and intracellular trafficking, no observable differences were observed between WT and ΔsorA (Figure 3.1C). This suggests that ΔsorA is defective for intracellular survival rather than adherence, and that sulfite supplementation could enhance recovery of C. jejuni in a manner that is independent of Sor activity.  61   Figure 3.1. Intracellular survival, association and GM130 colocalization of ΔsorA in Caco2 cells and the effect of SorA on recovery from host cells when plated on sulfite  A) C. jejuni intracellular viability in Caco2 cells for WT and ΔsorA strains was assessed at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints using a gentamicin protection assay. Viability was calculated by CFU enumeration on MH media plates with or without supplementation with 20mM sulfite. B) Association of GFP-expressing C. jejuni WT and ΔsorA with Caco2 cells C) Colocalization of WT and ΔsorA with the Golgi marker GM130 in INT407 cells. All experiments were done in triplicate and figures depict one experiment with three technical replicates for A) or six fields of view for B) and C). The asterisk (*) denotes a statistically significant difference (p <0.05). 62  Sulfite is capable of scavenging H2O2 which may be important for recovery of C. jejuni if C. jejuni is under oxidative stress when intracellular, or under oxidative stress when transitioning to an extracellular environment.  To determine if intracellular C. jejuni were undergoing oxidative stress, RT-qPCR was performed to determine if the transcription of C. jejuni oxidative stress regulated genes were up-regulated during infection of Caco2 cells. The genes dps, katA and sodB were all found to be initially down-regulated when C. jejuni infected Caco2 cells at the ‘adherence and invasion’ time-point; however, transcription progressively increased through the ‘invasion’ and ‘intracellular survival’ time-points, suggesting an increase in oxidative stress as the bacteria remain intracellular (Figure 3.2A). To determine if host cells are generating ROS during C. jejuni infection, the concentration of H2O2 was measured in the media above cells. I observed a significant increase in H2O2 production during infection with C. jejuni (Figure 3.2B). Sulfite is able to react with H2O2 in a neutralization reaction yielding water and sulfate, and catalase directly neutralizes H2O2 to H2O and oxygen. I hypothesized that intracellular C. jejuni may be under oxidative stress which sulfite is able to alleviate. To test this, I supplemented host cell lysates containing the liberated C. jejuni with 100U/ml catalase, 10mM sulfite, or both, to determine if neutralization of ROS in the lysate is sufficient to enhance recovery of C. jejuni from epithelial cells. Lysates supplemented with sulfite, catalase, or both significantly enhanced recovery of C. jejuni from host cells (Figure 3.2C). There was no significant difference in recovery of C. jejuni between samples supplemented with sulfite, catalase, or both, suggesting that there was no additive effect of supplementing recovery media with both catalase and sulfite.  63     Figure 3.2. The expression of C. jejuni oxidative stress genes in intracellular C. jejuni, the production of H2O2 by Caco2 cells infected with C. jejuni and the effect of H2O2 scavengers on recovery of C. jejuni from Caco2 cells  A) Transcription levels of sodB, katA and dps in intracellular C. jejuni at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints were compared to transcription levels of C. jejuni growing in the supernatant above Caco2 cells for 3h. B) The production of H2O2 from uninfected or C. jejuni infected Caco2 cells. C) The recovery of WT C. jejuni from Caco2 cells at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints using a gentamicin protection assay with supplementation of Caco2 cell lysates with 10mM sulfite, 100U/ml catalase or both when appropriate. Viable C. jejuni were assessed by CFU enumeration. All experiments were done in triplicate and figures depict one experiment with three technical replicates. The asterisk (*) denotes a statistically significant difference (p <0.05) and BD denotes values below detection. 64  3.3.2: Inactivation of gluconate dehydrogenase increased non-apoptotic lysis of host cells Given that that ΔfdhA had a recovery defect from epithelial cells after infection, and a ΔsorA mutant had a possible intracellular survival defect, I decided to investigate if other respiratory dehydrogenases had epithelial cell infection-related defects. I constructed Δgdh (gluconate dehydrogenase), ΔputA (proline dehydrogenase), Δmdh (malate dehydrogenase) and ΔhydB (hydrogenase) mutants and assessed if they had defects in infection as assessed by CFU enumeration, and/or adherence and intracellular trafficking defects as assessed by confocal microscopy analyses. I found that Δgdh (Figure 3.3a-b), Δmdh (Figure 3.4a), ΔputA (Figure 3.4d), and ΔhydB (Figure 3.4g) all had recovery defects from Caco2 cells as assessed by CFU enumeration after gentamicin treatment. Each mutant could be significantly enhanced for recovery on media supplemented with sulfite, but not to WT+sulfite levels. The recovery defects were partially complemented in Δgdh (Figure 3.3a) and Δmdh (data not shown) strains at the invasion timepoint. However, complementation of Δgdh was not observed at the short term survival timepoint which may reflect the fact that the pRRC promoter driving gdh expression was not active while intracellular. There was no observable defect for adherence to host cells for Δgdh (Figure 3.3c), Δmdh (Figure 3.4b), ΔputA (Figure 3.4e), or ΔhydB (Figure 3.4h) as assessed by microscopic enumeration of GFP-expressing C. jejuni associated with host cells.  Determination of proper intracellular trafficking as assessed by microscopic analysis of co-localization of C. jejuni with the Golgi marker GM130 revealed no obvious intracellular trafficking defect for Δgdh (Figure 3.3d), Δmdh (Figure 3.4c), ΔputA (Figure 3.4f), or ΔhydB (Figure 3.4i) strains.  65   Figure 3.3. Intracellular survival, association, and GM130 colocalization of Δgdh in Caco2 cells  A) C. jejuni WT, Δgdh, Δgdh-Complement (Δgdh-C) strains were used to infect Caco2 cells and viability was assessed at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints using a gentamicin protection assay by CFU enumeration. B) C. jejuni WT and Δgdh were used to infect Caco2 cells as in A), but CFU enumeration was performed by plating on MH media with or without supplementation with 20 mM sulfite. C) Association of GFP-expressing WT and Δgdh with Caco2 cells. D) Colocalization of WT and Δgdh with the Golgi marker GM130 in INT407 cells. All experiments were done in triplicate and figures depict one experiment with three technical replicates for A) and B) or six fields of view for C) and D). The asterisk (*) denotes a statistically significant difference (p <0.05). 66    67   Figure 3.4. Intracellular survival, association and GM130 colocalization of Δmdh, ΔputA, and ΔhydB in Caco2 cells  C. jejuni WT  and strains A) Δmdh, D) ΔputA, or G) ΔhydB were used to infect Caco2 cells and viability was assessed at the ‘Adherence and Invasion’, ‘Invasion’, and ‘Intracellular Survival’ timepoints using a gentamicin protection assay by CFU enumeration on MH agar or MH agar with 20 mM sulfite. Association of GFP-expressing C. jejuni with Caco2 epithelial cells was assessed for B) Δmdh, E) ΔputA, or H) ΔhydB. The % colocalization of C. jejuni with the Golgi marker GM130 in INT407 cells was assessed for C) Δmdh, F) ΔputA, or I) ΔhydB. All experiments were done in triplicate and figures depict one experiment with three technical replicates for A), D) and G) or six fields of view for B), C), E), F), H) and J). The asterisk (*) denotes a statistically significant difference (p <0.05). 3.3.3: A Δgdh mutant induces lower transcription of IL-8 and TNF-α, but enhances host cell death in T84 cells  The Caco2 cell line is useful for assessing intracellular survival defects and host cell interactions; however, it expresses inflammatory cytokines poorly in response to C. jejuni, and does not undergo programmed cell death pathways upon C. jejuni infection (data not shown). Thus, to look at host cell death pathway activation in response to C. jejuni infection, the T84 intestinal epithelial cell line was utilized. A previous report found that co-incubation of T84 cells with C. jejuni causes non-apoptotic host cell death consistent with necrosis when gentamicin is not added to the media (123). Host cell death was not different from WT when infected with ΔputA and ΔhydB, and reduced when infected with Δmdh. The latter likely a reflection of the fact that Δmdh grows slower than WT in both MH-TV media and in the supernatant above infected epithelial cells (data not shown). Conversely, infection with Δgdh enhanced induction of host cell death in T84 cells (Figure 3.5a). Enhanced host cell death from Δgdh was not due to apoptosis, as the pan-caspase inhibitor Z-VAD-FMK did not reduce host cell death during infection by Δgdh (Figure 3.5b).  To ensure that C. jejuni were not inducing death by depleting the media, and thus T84 cells, of oxygen or nutrients, transcription of the hypoxia regulated genes VEGF and Glut-1 were investigated. There was no significant up-regulation of these genes when infected with WT or Δgdh C. jejuni compared to uninfected cells, suggesting T84 cells were not undergoing oxygen or 68  nutrient limitation (Figure 3.5c). Production of inflammatory cytokines by C. jejuni infected cells is a marker of infection and plays an important role in pathogenesis (17, 105, 146). The transcription of pro-inflammatory cytokines TNF-α and IL-8 were assessed in T84 cells infected with C. jejuni. Although both WT and Δgdh induced transcription of TNF-α and IL-8 above uninfected levels, transcription was reduced in Δgdh infected cells compared to WT (Figure 3.6).       69   Figure 3.5. The role of Δgdh on induction of host cell death in C. jejuni infected T84 cells and the regulation of hypoxia regulated genes during C. jejuni infection  A) The %lysis in T84 cells infected with WT, Δgdh, Δgdh-C, ΔputA, ΔhydB, and Δmdh strains was calculated 6h or 12h post infection. B) T84 cells were infected with WT or Δgdh in the presence of 125µM caspase inhibitor Z-VAD-FMK. As a positive control for apoptosis cells were incubated with 10µM camptothecin (Campt). Cell death was assessed at 6h or 12h post infection C) The fold difference in transcription of the hypoxia induced genes vegf and glut-1 as compared to uninfected samples were assessed when T84 cells were infected by WT, Δgdh or Δgdh-C for 9h. All experiments were done in triplicate and figures depict one experiment with three technical replicates. The asterisk (*) denotes a statistically significant difference (p <0.05) and BD denotes below detection.  70   Figure 3.6. The differential transcription of the genes encoding TNF-α and IL-8 in T84 cells infected with WT, Δgdh and Δgdh-C C. jejuni  The fold difference in transcription of tnf-α and il-8 in T84 cells infected with C. jejuni for 6h was assessed as compared to uninfected cells. All experiments were done in triplicate and figures depict one experiment with three technical replicates. The asterisk (*) denotes a statistically significant difference (p <0.05). 3.3.4: Host cell death initiated by WT and Δgdh C. jejuni shows characteristics of programmed necrosis Necrotic cell death in T84 cells was previously described, but a programmed pathway to necrosis was not (123). To investigate how a Δgdh mutant induces enhanced necrosis, several different mediators of necrosis were investigated. The terminal stage of programmed necrosis involves opening of ‘death pores’ that allow water to enter the cytoplasm causing a swelling morphology. Death pores can be blocked by small molecules such as polyethylene glycols, or lysis can be inhibited by altering the osmolarity of the media with glycine or sucrose which can prevent water influx into the epithelial cells. Co-incubation of C. jejuni-infected T84 cells with glycine, sucrose or PEG8000 significantly reduced host cell death in both WT and Δgdh backgrounds (Figure 3.7a). There was no toxicity in C. jejuni or in T84 71  cells with glycine, sucrose and PEG8000 co-incubation alone, nor did they inhibit the ability of C. jejuni to invade host cells (data not shown).   Opening of death pores in programmed necrosis is thought to be initiated by cytoskeletal cleavage by the calpain family of calcium activated cysteine proteases (160). A rise in cytoplasmic calcium causes activation of the calcium binding site leading to autocleavage and activation of calpain protease activity. Proteolytic cleavage of a variety of cellular proteins by calpain ensues, as well as rupture of lysosomes which releases cathepsin B and other proteases. Calpain activity can be chemically inhibited in two ways: with calcium binding domain inhibitors (PD150606), or with calpain protease binding site inhibitors (MDL2810 and ALLN). Co-incubation of C. jejuni-infected T84 cells with PD150606 and MDL2810 caused a significant reduction in the amount of host cell death in both WT- and Δgdh-infected cells (Figure 3.7b). The inhibitor ALLN, however, did not cause a reduction in host cell death, with microscopic analysis of infected cells showing a distinct apoptotic morphology (data not shown). Treatment of C. jejuni-infected T84 cells with both ALLN and the pan-caspase inhibitor Z-VAD-FMK caused a significant reduction in host cell death in both WT- and Δgdh-infected cells suggesting that ALLN caused a switch from programmed necrosis to apoptosis (Figure 3.7c). ALLN may have a secondary target besides calpain that is causing this switch to apoptosis.  Activation of calpain can be induced by influx of calcium into the cytoplasm and inhibited by the intracellular calcium chelator BAPTA-AM or the extracellular calcium chelator EGTA. Co-incubation of BAPTA-AM with C. jejuni-infected T84 cells caused an increase in T84 cell death that could be partially inhibited by the apoptosis inhibitor Z-VAD-FMK (data not shown). I concluded that intracellular calcium chelation with BAPTA-AM was causing a switch to apoptosis when infected with C. jejuni. However, even with Z-VAD-FMK incubation I could not significantly reduce host cell death below C. jejuni-only infection levels. As such, the role of calcium in host cell death when infected with C. jejuni remains inconclusive.  72   Figure 3.7. The effect of death pore blockers and calpain inhibition on induction of host cell death in T84 cells infected with WT and Δgdh C. jejuni and the role of calpain inhibitor ALLN in apoptosis in infected cells.  A) T84 cells infected with C. jejuni were co-incubated with death pore blockers 200 mM sucrose, 100 mM glycine, 30 mM PEG6000, or 30 mM PEG8000 and %lysis was assessed. B) T84 cells infected with C. jejuni were co-incubated with 125 µM MDL28170 or 70 µM PD150606 and %lysis was assessed. C) T84 cells infected with C. jejuni were co-incubated with 100 µM ALLN and 125µM caspase inhibitor Z-VAD-FMK when applicable and %lysis was assessed. All experiments were done in triplicate and figures depict one experiment with three technical replicates. The asterisk (*) denotes a statistically significant difference (p <0.05) and BD denotes below detection. 73  3.3.5: Induction of programmed necrosis is dependent on mitochondrial ROS but independent of Rip1 No work to date has focused on the upstream signals induced by C. jejuni that lead to necrosis. Work in other systems has implicated TNFR-mediated Rip1 signaling in complex IIb of necroptosis (Figure 1.5) with induction of excessive mitochondrial O2- species in the initiation of necrosis (236, 291). I found that inhibition of Rip1 activity with necrostatin-1 could not inhibit host cell death by either WT or Δgdh strains, suggesting host cell death is independent of the necrosome (Figure 3.8a). However, quenching of mitochondrial O2- with the mitochondrial targeting ROS scavenger Mito-Tempo caused a significant reduction in host cell death in both WT- and Δgdh-infected T84 cells, suggesting that C. jejuni is inducing mitochondrial oxidative stress and death (Figure 3.8a). Mitochondrial dysfunction may account for the depletion of ATP in T84 cells infected with C. jejuni reported by the Buret group (123). Mitochondrial O2-  can be induced in infected cells primarily by two separate complexes, the NADPH reductase complex NOX, or by Xanithine Oxidase, XO-1 (154, 226). Co-incubation of C. jejuni-infected T84 cells with the XO-1 inhibitor allopurinol caused no significant reduction in host cell death. However, significant inhibition of cell death was observed when C. jejuni-infected T84 cells were co-incubated with the NOX inhibitors apocynin and AEBSF Hydrochloride for both WT and Δgdh strains (Figure 3.8b). Apocyanin inhibits the active site of NOX, whereas AEBSF HCl is a serine protease inhibitor which inhibits the assembly of the active NOX complex. This suggests that ROS production from the NOX family of proteins is one of the main initiators leading to host cell death upon C. jejuni infection.   74   Figure 3.8. The effect of inhibition of the necrosome and mitochondrial ROS production on induction of cell death in T84 cells infected with WT and Δgdh C. jejuni  A) T84 cells infected with WT or Δgdh C. jejuni were co-incubated with 75µM necrostatin-1 or 200µM MitoTempo and %lysis was assessed. B) T84 cells infected with C. jejuni were co-incubated with 1mM allopurinol, 1mM apocynin or 500µM AEBSF hypochloride and %lysis was assessed. All experiments were done in triplicate and figures depict one experiment with three technical replicates. The asterisk (*) denotes a statistically significant difference (p <0.05) and BD denotes below detection. 3.4: Discussion Previous studies have found that global transcriptional changes occur in C. jejuni when it transitions from an extracellular to intracellular niche (80, 159). In chapter 2, it was discovered that supplementation of recovery media with sulfite could enhance the amount of C. jejuni recovered from Caco2 epithelial cells. It was hypothesized that intracellular C. jejuni may up-regulate certain metabolic systems, such as sulfite oxidoreductase, and the metabolites used by these enzymes may be important when transitioning to an extracellular environment. This is consistent with semi-quantitative mass spectrometry results by another group that showed that protein levels of SorA were relatively well-expressed in intracellular C. jejuni compared to other respiratory proteins (159). However, the enhanced recovery of C. jejuni from Caco2 cells on media containing sulfite was not due to its use as an electron donor, as a ΔsorA mutant was also enhanced for recovery from Caco2 cells when plated on sulfite. The 75  activity of Sor was required for recovery from epithelial cells in the absence of sulfite supplementation. Previously, lower recovery of a Δsor mutant from Caco2 epithelial cells was attributed to a perceived adherence defect preventing proper invasion(196). However, in this chapter I showed that Sor activity is not required for adherence and is likely involved in some aspect of intracellular survival. This is based on observations that show a ΔsorA mutant is able to adhere and invade to WT levels, but could not be enhanced to WT levels when plated on sulfite, ruling out a defect in recovery. However, I cannot rule out the possibility that a ΔsorA mutant may be recovered to WT levels if recovery plates are supplemented with some other unknown metabolite besides sulfite. Transcriptional analysis of oxidative stress-regulated genes sodB, katA and dps in intracellular C. jejuni accompanied by measurements of H2O2 produced by infected Caco2 cells suggested that intracellular C. jejuni were under oxidative stress at the ‘invasion’, and ‘intracellular survival’ time-points. This is consistent with the observation that catalase or sulfite addition to host cell lysates could enhance recovery of intracellular C. jejuni. This indicates that adaption to ROS is a significant burden needed to be overcome by C. jejuni when intracellular or when transitioning back to an extracellular environment. Presumably, intracellular C. jejuni would be subjected to ROS species when in an infected host, so it is unknown why C. jejuni would initially down-regulate ROS scavenging systems. The bulk of the ROS species generated in the intestine during C. jejuni infection are likely to be generated by activated neutrophils. Host cytoplasmic superoxide dismutases, catalases, and glutathione in the infected epithelial cells may initially detoxify the ROS produced by neutrophils before they reach intracellular C. jejuni, thus limiting the need for high transcription levels of intracellular oxygen scavengers. Enhanced production of H2O2 is observed by Caco2 cells during prolonged C. jejuni infection. The enhanced transcription of C. jejuni ROS scavenging enzymes later in infection may be reflective of this enhanced ROS production by the host cells.  A ΔfdhA mutant was previously shown to have an infection defect in epithelial cells by several groups. However, I found that supplementation of recovery media with sulfite could enhance recovery of ΔfdhA, 76  and mutants in its putative regulator ΔfdhTU, up to WT+sulfite levels. Adherence, invasion, and intracellular survival defects have been reported in a wide range of C. jejuni genes. I wished to discover if other respiratory dehydrogenase mutants besides ΔfdhA were defective for infection of epithelial cells, and if any recovery defects could be abolished by addition of sulfite to recovery media. I found that ΔsorA, Δgdh, ΔputA, Δmdh, and ΔhydB are all defective for infection of Caco2 epithelial cells, but not for adherence, invasion, or intracellular trafficking. In addition, these strains could be partially rescued by plating on sulfite-containing media, but not to WT+sulfite levels which suggests they have an intracellular survival defect. As is the case with ΔsorA it is not known if ΔsorA, Δgdh, ΔputA, Δmdh, and ΔhydB have a genuine intracellular survival defect or are just defective for recovery. A previous study employed a propidium iodide based live/dead assay to determine the number of live intracellular C. jejuni (292). Such a method may be useful here to better distinguish if intracellular mutants are indeed not viable, but propidium iodide based assessment of viability have been found to overestimate dead C. jejuni due to non-specific uptake of the dye. A better live/dead assay methodology has not been described for C. jejuni.  Metabolic virulence has recently emerged as an exciting new area of study, and defining what metabolites bacteria exploit during infection has yielded information on new and exciting biosynthetic pathways. In S. flexneri, glucose and glycerol seem to be the primary carbon sources depending on strain (83, 165), and Salmonella spp. preferentially utilizes glucose as its main carbon source, although it is able to utilize other compounds (83). M. tuberculosis utilizes fatty acids, glycerol and cholesterol during infection (57, 216, 281), and accumulation of cholesterol in Mycobacterium leprae-infected macrophages is important for intracellular survival (177). Mass spectrometry assessing protein levels has yielded some insight into gene expression and metabolism in intracellular C. jejuni. However, these studies have shown a generally lower abundance of all proteins, making it difficult to define which systems are important. Mutational analysis of metabolic systems is still the best method to investigate if 77  certain pathways are important for C. jejuni infection. My findings that ΔsorA, Δgdh, and ΔhydB are defective for intracellular survival suggests the importance of respiratory dehydrogenases in infection, while the importance of mdh in intracellular survival suggests a fully functional Krebs cycle is important as well. It is possible that utilizing respiratory dehydrogenases may allow C. jejuni to conserve scavenged amino acids for protein turnover instead of for ATP generation. In this study, putA was found to be important for intracellular survival, and a previous study found genes involved in aspartate, lysine and arginine utilization were also important for epithelial cell infection (209). The need for amino acids in intracellular C. jejuni is not surprising given it primarily utilizes amino acids as the major carbon and energy source. The intracellular pathogen Legionella pneumophila also primarily utilizes amino acids as carbon and energy sources while intracellular and detects amino acid availability to modulate virulence factors through regulators SpoT and ArgR (73). It is possible that amino acid levels in intracellular C. jejuni may modify its virulence program or its ability to survive inside cells. C. jejuni does not replicate when intracellular, but rather seems to simply persist much like Chlamydia elementary bodies, Staphylococcus aureus, and latent M. tuberculosis (24, 29, 79, 101, 163, 242). Mutation of respiratory elements may break metabolic homeostasis and lead to detection and enhanced clearance by the invaded cells. Given that my studies indicate that intracellular C. jejuni are undergoing oxidative stress, a role of metabolism in resisting oxidative stress may be important. A recent study suggested that electron acceptors and proper flux through the ETC in C. jejuni is important for resisting oxidative stress (72). The importance of these different systems in intracellular survival and in resisting host-generated ROS when C. jejuni is intracellular is still unknown. Regardless, this study provides a preliminary analysis of the respiratory systems used by C. jejuni when intracellular, but no data to date has established what the primary energy source is for C. jejuni in an intracellular environment and what the metabolic hierarchy is.  78  This study also found that there are significant differences between tissue culture cell lines in terms of the fate of intracellular C. jejuni. Enhanced recovery of C. jejuni on media containing sulfite was evident when infecting Caco2 cells; however, equal recovery of C. jejuni on media with or without sulfite was achieved when harvesting C. jejuni from T84 cells (data not shown). In contrast, C. jejuni Δgdh was defective for intracellular survival in Caco2 cells, but was not defective for survival in T84 cells (data not shown). The rate of death of intracellular C. jejuni is also more rapid in Caco2 cells compared to T84 cells suggesting Caco2 cells are more efficient at clearing infection after gentamicin treatment of the media. This may be related to the fact that T84 cells produce reduced H2O2 compared to Caco2 cells when infected with C. jejuni (Data not shown). It is tempting to think the enhanced H2O2 mediated killing of intracellular C. jejuni in Caco2 cells may be related to the reason they do not undergo necrosis during prolonged infection. The reasons for these differences are unknown, but tissue culture cells are derived from different progenitor sources. The intestinal epithelia are also composed of different cell types, and the differences I observed in tissue culture cell types during infection may reflect differences in the fate of different cell types in the host intestinal tract. It would be interesting to study, in future work beyond the scope of this thesis, if C. jejuni induces different pathologies in different cells during human infection. However, given that the carcinoma cell lines used in this study likely contain mutations that provide pro-survival signals, the differences observed between cell lines may be reflective of different mutations acquired during passaging. Reproducing these findings in human biopsies would give greater clarity to the nature of host cell death induced by C. jejuni.   The metabolism of bacteria, besides being important for intracellular survival, can also be very important for differential induction of pathogenesis in infected cells (29, 57, 73). Analysis of Δgdh, ΔputA, Δmdh, and ΔhydB revealed that Δgdh causes enhanced induction of host cell death and reduced cytokine transcription. A previous study in Listeria monocytogenes showed that a Δgdh mutant induced enhanced IFN-beta and possibly activation of the host surveillance system (45). It was previously 79  unknown how C. jejuni induces T84 epithelial cell death, but analysis of T84 cells infected with C. jejuni showed a progressive release of LDH, indicative of membrane rupture which could be inhibited with pore blockers as well as by calpain inhibition. This work provides the first evidence that C. jejuni induces programmed necrotic death in T84 cells. Induction of necrosis through calpain activation has been reported during infection with other bacteria such as S. aureus, S. flexneri, and Enteropathogenic E. coli (EPEC)(22, 52, 254). The consequences of activating calpain are unknown; however, calpain activation is essential in Coxsackie virus escape from the cytoplasm and S.aureus dissemination (33, 255). Given that C. jejuni infection of T84 cells has been shown to result in occludin cytoskeletal depletion, and given that occludin is cleaved by calpain, it is tempting to speculate that necrotic pathways may also increase epithelial barrier permeability leading to C. jejuni transmigration to deeper tissues (38, 40). Evidence that mitochondrial ROS production in C. jejuni-infected T84 cells leads to necrosis is also novel. It is not well defined what links upstream signals in necrosis to calpain activation, but a rise in intracellular calcium are strongly linked to calpain activation. Further studies are needed to link cytosolic calcium levels to necrosis. Induction of ROS and mitochondrial ROS by C. jejuni independent of RIP1 is also interesting, as the up-steam signal leading to ROS production is unknown. C. jejuni is known to activate TLRs which have been associated with ROS production and necrosis activation through the common adaptors MLKL and RIP3 (Figure 1.5)(122). Further analysis is needed to determine if these components are involved in C. jejuni-dependent necrosis. A study involving Salmonella spp.-infected macrophages found that enhanced host cell death through pyroptosis was enhanced in Salmonella spp.harboring TCA cycle mutants. The accumulation of citrate was hypothesized to cause increased inflammasome activation by an increase in mitochondrial ROS production in a yet not understood manner (301). It is tempting to postulate that T84 cells infected by Δgdh may be undergoing an analogous fate.  Calpain activation and necrosis may have a vital role in onset of pathogenesis, however, induction of necrosis may have evolved to facilitate C. jejuni egress from infected cells. Many bacterial species 80  initiate apoptosis or necrosis in infected cells to escape the intracellular niche they are inhabiting. For example, M. tuberculosis induction of necrosis is needed to exit macrophages (258) and L. pneumophila will initiate pore formation and necrosis in infected epithelial cells when the bacterial replication phase is terminated (8). The finding that a Δgdh mutant causes altered pathology in infected T84 epithelial cells was unexpected but reflects the complicated interplay between host and pathogens. Despite finding key elements that contribute to induction of necrosis in T84 cells, the reason Δgdh induces enhanced cell death still awaits discovery. One hypothesis relates to the fact that gluconate is an intermediate in the pentose phosphate pathway (PPP), which is important for production of purines, but is also a major source of NADPH in human cells (261). Cellular NADPH is vital for many different processes, including generation of O2- from the NADPH oxidases (or H2O2 in the case of NOX4) as well as supplying reducing power for glutathione reductase (150, 305). In this regard, the PPP is important for controlling redox state and ROS levels inside human cells. Infection with Δgdh may result in higher host NADPH levels as compared to infection with WT C. jejuni due to decreased consumption of host gluconate. The elevated NADPH levels in a Δgdh-infected host cell may lead to increased NOX activity resulting in higher ROS burden. This higher oxidative stress burden may account for the enhanced host cell death seen during infection with a Δgdh mutant. However, a larger pool of NADPH has also been associated with a larger pool of reduced glutathione which is protective against oxidative stress (53). Measurements of O2-, reduced glutathione and NADPH levels in Δgdh verses WT infected cells may yield information on how Δgdh and the PPP affects host cell death.            In this study, and thesis chapter, I found that there is a complicated interaction between C. jejuni metabolism and host cell infection as well as host cell death. Given that C. jejuni invasion of epithelial 81  cells is one of the only ways to assess virulence in the absence of a readily testable disease model, it is worth further investigating the interaction of C. jejuni metabolic mutants with epithelial cells.                    82  Chapter 4: Campylobacter jejuni produces formate dehydrogenase- and sulfite oxidoreductase-dependent H2O2 in aerobic conditions, and the sulfur assimilation pathway is important for aero-tolerance  4.1: Introduction and synopsis C. jejuni is a microaerophilic bacterium that grows at oxygen levels of 5-15% (133). More particularly, C. jejuni rapidly loses viability under aerobic culture conditions in the lab, yet is able to persist under atmospheric conditions (~21% O2), often surviving on contaminated poultry and in water for weeks before human consumption (41, 54, 208). How it is able to do so is not well understood and is an important question to answer in order to decrease rates of C. jejuni human infection. Research on C. jejuni oxidative stress has focused on identifying the C. jejuni genes involved in regulating the oxidative stress response, ROS detoxification and oxidative stress repair. The rates of ROS production under microaerophilic and aerobic conditions and the primary sites of ROS formation have not been previously described. Here we report that C. jejuni produces H2O2 after exposure to aerobic conditions at 37ºC, but not at 4ºC, and dependent on Fdh and Sor, the enzymes responsible for using formate and sulfite, respectively, as electron donors for the electron transport chain. Further analysis found that sulfite and cysteine could enhance C. jejuni aero-tolerance and that this was dependent on the activity of both Sor and ATP sulfurylase (Atps). An Δatps mutant, the gene responsible for the first step of the sulfur assimilation pathway, was found to have a significant defect in aero-tolerance and H2O2 resistance, and had decreased recovery after intracellular intestinal epithelial cell infection. These results are the first to demonstrate that sulfur homeostasis is important for the aerobic survival of C. jejuni. 83  4.2: Materials and methods 4.2.1: Bacterial growth conditions All experiments were performed using the C. jejuni strain 81-176 (141). C. jejuni strains were grown in Mueller-Hinton (MH) media (Oxoid, Ltd) on agar plates at 38ºC in a Sanyo Tri-Gas Incubator at 6% O2 and 12% CO2 or in shaking broth at 38ºC using the Oxoid CampyGen system unless otherwise specified. All MH media was supplemented with 10 µg/ml of vancomycin (V) and 5 µg/ml trimethoprim (T) (MH-TV). Media was supplemented with 50 µg/ml kanamycin, 25 µg/ml chloramphenicol, 10 mM sodium sulfite, cysteine, methionine, glutamine, proline, gluconate, or sodium formate (Sigma) as indicated. E. coli DH5α used for DNA manipulations were grown on LB (Sigma) plates or broth supplemented with 100 µg/ml ampicillin (Sigma), 25 µg/ml kanamycin, or 30 µg/ml chloramphenicol as required.  4.2.2: Generation of deletion strains All enzymes used for DNA manipulations were purchased from New England Biolabs. Primer sequences are listed in Appendix 1. Construction of the ΔfdhA mutant is described in chapter 2 and construction of ΔsorA is described in chapter 3. Deletion mutations in genes cj0200, cj0358, cydA, cysM, and atps were carried out by first PCR amplification of the genes from C. jejuni 81-176 genomic DNA with primers cj0020-Fw + cj0020-Rv, cj0358-FW + cj0358-Rv, cydA-Fw + cydA-Rv, cysM-Fw + cysM-Rv and atps-Fw + atps-Rv primers, respectively. Purified PCR fragments were A tailed and ligated into pGem (Promega). Generation of unique internal SmaI restriction sites in cj0020, cj0358, cydA, cysM and atps was performed by inverse PCR using primers cj0020-iPCR-Fw + cj0020-iPCR-Rv, cj0358-iPCR-Fw + cj0358-iPCR-Rv, cydA-iPCR-Fw + cydA-iPCR-Rv, cysM-iPCR-Fw + cysM-iPCR-Rv, and atps-iPCR-Fw + atps -iPCR-Rv, respectively. The non-polar aphA-3 cassette encoding a kanamycin resistance gene (2) was digested out of plasmid pUC18K-2 using SmaI and ligated into SmaI-digested cj0020, cydA, and cysM inverse PCR products. The chloramphenicol resistance cassette (CAT) was digested out of plasmid pRY109 (4) with 84  SmaI and ligated into SmaI digested cj0358 and atps inverse PCR products. All ligations were transformed into DH5α, colonies were screened by PCR, and plasmids from positive clones were purified. Plasmids were introduced into C. jejuni by natural transformation double recombination and plated on MH agar supplemented with kanamycin or chloramphenicol for 48h to recover colonies. PCR and sequencing confirmed correct insertion in the chromosome by homologous recombination.   Complementation was achieved by amplification of atps using primers atps-C-Fw  + atps-C-Rv to introduce an XbaI site at the 5’ end and an MfeI site at the 3’ end of the gene. PCR products were digested with XbaI and MfeI and ligated to the similarly digested genomic integrative plasmid pRRK (1). Insert expression was driven off the pRRK promoter. Plasmids were transformed into DH5α and selected on kanamycin. Colonies were screened by PCR, and plasmids from positive clones were purified and used to transform Δatps by natural transformation double recombination. Insertion of atps in the rRNA spacer regions was confirmed by PCR using primers ak233, ak234, ak235 and DL3. 4.2.3: Assessment of C. jejuni viability in the presence of metabolites or H2O2 An 18h culture of C. jejuni was diluted to an OD of 0.01 in MH-TV media supplemented with sulfite, cysteine, methionine, glutamine, proline, gluconate or formate at 10 mM, or MH-TV alone. Cultures were incubated aerobically at 38ºC with shaking. At each timepoint, culture aliquots were removed and serially plated for colony forming units (CFUs) under standard growth conditions. To assess viability in H2O2, an 18 h broth culture of C. jejuni was resuspended at an OD of 0.01 in MH-TV media containing H2O2  and  incubated at 38ºC for 1 h microaerobically. CFUs were determined by serial dilution.  4.2.4: Determination of H2O2 concentration The concentration of H2O2 in solution was determined using the Amplex Red assay kit (Invitrogen). Since H2O2 can form non-enzymatically in the presence of glucose and high salt concentrations, RPMI media lacking glucose (RPMI-G) was used. Prior to the experiment, Amplex Red assay buffer was prepared in 85  RPMI-G. An 18 h culture of C. jejuni was washed two times in RPMI-G and diluted in fresh RPMI-G to a final OD of 0.2. Cultures were supplemented with 20 mM sodium sulfite or sodium formate where indicated. Fifty µl of bacterial culture in RPMI-G at an OD of 0.2 was added to each well of a black 96 well plate (Greiner Bio-One) followed by 50 µl of Amplex Red assay buffer. The plates were incubated under conditions specific to each experiment and at each timepoint were measured with a Varioskan Flash luminometer plate reader at 530nm excitation and 560nm emission. Concentrations of H2O2 were determined by comparison to a standard curve of known H2O2 ranging from 0-10µM. The values are presented as Δ[H2O2] which represents the concentration of H2O2 minus the blank values, the latter of  which are assays incubated without C. jejuni. Aqueous media contain a basal amount of H2O2 which will be detoxified by C. jejuni. Detection of basal levels of H2O2 in the blank can result in the Δ[H2O2] being negative during the early stages of aerobic incubation with C. jejuni.   4.2.5: Caco2 epithelial cell infection The human colonic cell line Caco2 was passaged and maintained in minimal essential media (MEM; Gibco) supplemented with 10% FBS and 1% penicillin-streptomycin (Pen-Strep; Gibco) in a humidified air incubator at 38ºC with 5% CO2. 24 h prior to the experiment, Caco2 cells were harvested and seeded into 24 well plates at 105 cells per well. Assessment of C. jejuni adherence, invasion, and short term survival was performed as previously described (229). Enumeration of C. jejuni for CFUs was done on both MH-TV agar and MH-TV agar supplemented with 20 mM sulfite.    4.3: Results 4.3.1: C. jejuni produces enhanced H2O2 during incubation in aerobic but not microaerobic conditions, and at 37ºC but not 4ºC  C. jejuni is a microaerophilic bacterium that rapidly loses viability in atmospheric oxygen, suggesting the accumulation of lethal levels of ROS. The extracellular accumulation of H2O2 was measured in cultures of 86  C. jejuni incubated under aerobic (~21% O2) and microaerobic (6% O2) conditions (Figure 4.1A). Initial experiments in MH, the standard C. jejuni growth media used in our laboratory, resulted in a high level of non-specific H2O2 formation due to the reaction between glucose and salts in the media. Therefore, WT C. jejuni was grown in RPMI-G to prevent background H2O2 formation. C. jejuni does not use glucose as a carbon or energy source, thus media lacking glucose has no effect on its growth rate. Assessment of H2O2 concentrations with the Amplex Red H2O2 assay reagent showed a significant accumulation of H2O2 in the media over time under aerobic, but not microaerobic conditions (Figure 4.1A). As mentioned in section 4.2.4, a negative [H2O2] reflects the fact that the concentration of H2O2 is lower in the sample than in the blank. This is due to detoxification of basal levels of H2O2 present in the media that forms non-enzymatically by C. jejuni peroxidases present in viable bacteria. The H2O2 production was slightly but significantly increased in a catalase (ΔkatA) mutant in comparison to WT grown aerobically, suggesting that catalase is partially involved in H2O2 detoxification during aerobic growth, although it likely is not the major scavenging enzyme due to the marginal increase in H2O2 production.  C. jejuni is often found on refrigerated meat and is able to survive for long periods of time under these conditions, with refrigeration having been reported to decrease the loss of C. jejuni viability (77). The rate of H2O2 production during C. jejuni aerobic incubation at 4ºC was determined to ascertain whether reduced H2O2 production might be at least partially responsible for increased survival at 4ºC. Aerobic incubation of C. jejuni at 4ºC resulted in no detectable accumulation of H2O2 (Figure 4.1B), similar to C. jejuni grown microaerobically at 37ºC (compare to Fig. 4.1A), and resulted in a slower loss of viability in comparison to 37ºC (Figure 2C). The Amplex Red dye used to determine H2O2 concentrations reacted at 4ºC equally as well as at 37ºC (results not shown).            87                                         Figure 4.1. Temperature and O2-dependence of H2O2 accumulation and cell viability in cultures of C. jejuni.  A) WT and a ΔkatA mutant were incubated at 37ºC under aerobic (21% O2) or microaerobic (6% O2) conditions for 12 h and production of H2O2 was measured. B) WT was incubated aerobically at 37ºC or at 4ºC for 12 h and production of H2O2 was measured. C) C. jejuni WT was incubated in aerobic conditions at 37ºC or 4ºC and viability was assessed by enumerating CFUs at each timepoint. Experiments were 88  done in triplicate. Figures depict one representative experiment with three technical replicates. Asterisks (*) and (**) denote a statistically significant difference of p <0.05 and p <0.001, respectively. 4.3.2: Aerobic incubation of C. jejuni with formate enhanced H2O2 production dependent on Fdh and correlates with enhanced aero-tolerance of ΔfdhA   It was previously postulated that respiratory dehydrogenases can be a source of H2O2 during aerobic growth if the active site has a redox-active group, such as a flavin or metal ion capable of donating an electron to O2 (245); this is consistent with FdhA which contains a solvent exposed iron sulfur cluster which has been associated with ROS formation (109). On the other hand, previous work from another group also suggested Fdh activity may be important for resistance to exogenous H2O2 (128). Incubation of C. jejuni with formate, the substrate for Fdh, caused significantly enhanced accumulation of H2O2 (Figure 4.2A). To determine if the higher rate of H2O2 associated with aerobic incubation with formate is dependent on Fdh, H2O2 production in an ΔfdhA mutant constructed previously (229) was examined. Fdh is a multi-subunit enzyme, and disruption of fdhA disrupts all Fdh activity. The accumulation of H2O2 with formate addition during aerobic incubation was significantly reduced in ΔfdhA as compared to WT (Figure 4.2A). H2O2 production was also significantly lower in an ΔfdhA strain than in WT (Figure 4.2A). This shows that the presence of Fdh is important for production of ROS during aerobic growth. To determine if the Fdh dependent H2O2 formation in aerobic conditions is associated with loss of viability, WT and ΔfdhA were incubated aerobically for 12h and viability was assessed by plating for CFUs (Figure 4.2B). The ΔfdhA mutant exhibited a slower loss of viability in oxygen compared to WT. This indicates that Fdh dependent generation of H2O2 is at least partially responsible for loss of C. jejuni viability under aerobic conditions.  89   Figure 4.2. Effect of formate and Fdh on C. jejuni H2O2 production and viability in aerobic conditions. A) WT and ΔfdhA were incubated aerobically at 37ºC with or without media supplementation with 10 mM formate and H2O2 was measured. B) WT and ΔfdhA were incubated in aerobic conditions at 37ºC and viability was determined by CFU enumeration at each time-point. All experiments were done in triplicate and figures depict one experiment with three technical replicates. Asterisks (*) and (**) denote a statistically significant difference of p <0.05 and p <0.001, respectively.   90  4.3.3: Sulfite and cysteine supplementation can prevent the loss of C. jejuni viability under aerobic growth and is dependent on Sor activity  Previously we reported that supplementation of growth media with sulfite could enhance recovery of C. jejuni from host epithelial cells after host cell infections (229). Other groups have reported that sulfite, pyruvate, and bisulfate could also prevent the loss of viability associated with C. jejuni incubation in atmospheric oxygen (39, 137, 286). Those groups postulated that these compounds are antioxidants capable of detoxifying ROS produced by C. jejuni. While sulfite may be able to neutralize extracellular H2O2, it would be unable to neutralize intracellular H2O2 unless imported. To determine if any other metabolic additives could increase the aero-tolerance of C. jejuni, bacteria were grown in shaking broth at 37ºC under aerobic conditions in the presence of glutamine, proline, methionine, gluconate, sulfite or cysteine. Both sulfite and cysteine prevented loss of viability associated with aerobic growth with a 3.9 log and 1.9 log fold increase in survival at 12 h, respectively (Figure 4.3A). Supplementation with glutamine, proline, methionine, or gluconate had no significant effect on aerobic survival (data not shown). Sulfite can be oxidized by Sor in C. jejuni (196), therefore the role of sulfite as a metabolite was investigated by constructing a ΔsorA mutant to determine whether SorA is required to enhance C. jejuni aerobic survival. Sor is a multi-subunit enzyme and disruption of sorA eliminates all Sor activity(196). The aerobic survival of a ΔsorA mutant was still enhanced in media supplemented with sulfite and cysteine; however, the enhanced survival was significantly diminished in comparison to WT (Figure 4.3B). The role of sulfite as an electron donor can therefore only partially explain sulfite-enhanced aerobic survival of C. jejuni.  C. jejuni possesses two terminal oxidases, CydAB and CcoNOQP (115), which transfer electrons from the electron transport chain to oxygen to generate water. This lowers the concentration of dissolved oxygen in the media and should reduce the rate of H2O2 generation. In addition, C. jejuni possesses two putative cytochrome c peroxidases (Cj0020 and Cj0358) that use electrons from the electron transport chain 91  system to eliminate H2O2 by converting to water. To determine if the electrons liberated from sulfite by Sor are being used by the terminal oxidases and peroxidases, a mutant in the cydA terminal oxidase was constructed, as well as a Δcj0020Δcj0358 double mutant in which both predicted cytochrome c peroxidase-encoding genes were deleted. The terminal oxidase CcoNOQP is essential for growth, and a deletion was previously shown to be lethal in C. jejuni (115). Although ΔcydA was found to have a defect in survival in aerobic conditions, it was rescued up to WT levels by sulfite and cysteine supplementation (Figure 4.3C). The Δcj0020Δcj0358 mutant also displayed enhanced survival in the presence of sulfite and cysteine similar to WT (Figure 4.3C). This suggests that the role of sulfite in preventing loss of viability in aerobic conditions is independent of these electron transport chain components, but is partially dependent on Sor.     92   Figure 4.3. The effect of SorA, CydA, and Cj0358/Cj0020 on C. jejuni aerobic viability with sulfite and cysteine media supplementation A) Viability of C. jejuni in MH-TV media unsupplemented, or supplemented with 10 mM of sulfite or cysteine was assessed for cultures incubated at 37ºC in aerobic conditions by CFU enumeration. B) The viability of WT and ΔsorA mutants, or C) WT, Δcj0020Δcj0358 double mutant or ΔcydA mutant was determined 12 h post inoculation in MH-TV media at 37ºC in aerobic conditions unsupplemented (-) or supplemented with 10 mM sulfite (S) or cysteine (C) by CFUs enumeration. All experiments were done in triplicate and figures depict one experiment with three technical replicates. Asterisks (*) and (**) denote a statistically significant difference of p <0.05 and p <0.001, respectively. 4.3.4: H2O2 formation in the presence of sulfite is dependent on Sor To determine whether sulfite is involved in suppressing H2O2 concentrations produced by C. jejuni, H2O2 formation in the WT and ΔsorA strains was measured over time in the presence of sulfite under aerobic and microaerobic conditions. Some C. jejuni respiratory dehydrogenases may be a source of ROS 93  formation but the same should not be true for SorAB if it is suppressing H2O2 formation. Sulfite supplementation increased the total production of H2O2 in WT under aerobic but not microaerobic conditions (Figure 4.4A). Sulfite is able to react with H2O2 directly to form sulfate and water, so the presence of sulfite in the media will reduce the H2O2 levels present in Figure 5. Therefore, the values of H2O2 shown in Figure 4.5 are likely an underrepresentation of the actual values. To determine if the enhanced H2O2 production with sulfite supplementation was dependent on Sor, rates of H2O2 formation in aerobic conditions were measured in a ΔsorA mutant (Figure 4.4B). The rate of H2O2 produced by a ΔsorA mutant was identical with or without sulfite supplementation (Figure 4.4B), suggesting that H2O2 formation in the presence of sulfite is dependent on Sor. Complementation of ΔsorA was attempted; however, repeated attempts to generate a PCR product containing 5’ elements of sorA were not achieved, possibly due to secondary structure formation in the DNA upstream.     94   Figure 4.4. Effect of sulfite and SorA on H2O2 production by C. jejuni in microaerobic or aerobic conditions  A) H2O2 production from WT with and without 10 mM sulfite in the media, assessed in aerobic (21% O2) or microaerobic (6% O2) conditions at 37ºC. B) WT and the ΔsorA mutant were incubated under aerobic conditions at 37ºC in the absence or presence of 10 mM sulfite and H2O2 was measured. All experiments were done in triplicate; figures depict one experiment with three technical replicates. An asterisk denotes a statistically significant difference of p <0.05. 95   4.3.5: The sulfur capture system is important for aerobic survival as well as enhanced aerobic survival with sulfite and cysteine  Sor plays an important role in enhancing C. jejuni aerobic survival in the presence of sulfite (Figure 4.3B). Although sulfite appeared to suppress H2O2 production in the absence of Sor (Fig. 4.4B), sulfite actually resulted in greater H2O2 production when Sor was present (Figure 4.4B). This suggests while sulfite can act as an ROS scavenger, it enhances H2O2 production in a Sor-dependent fashion. Enhanced aerobic survival in the presence of cysteine was also Sor-dependent, suggesting a potential role for sulfur cycling in aerobic survival. In other organisms, sulfate is incorporated and converted to cysteine via the sulfur assimilation pathway when environmental cysteine is unavailable (Figure 1.8). Sulfate and ATP are combined to form adenosine-phosphosulfate (APS) by the ATP sulfurylase (Atps) (Figure 1.8). APS can then be used to synthesize cysteine or other sulfur containing molecules that may act as antioxidants. Given that oxidative stress can induce cysteine bradytrophy (20), the role of sulfur assimilation in C. jejuni aerobic survival was examined. Previously atps has not been described in C. jejuni; however, an atps had previously been annotated in the genome of C. jejuni as well as in related species. Although C. jejuni Atps has not been characterized, BLAST analysis showed 20% amino acid sequence identity with the previously studied 180-residue Atps domain of M. tuberculosis CysDN (223). The N terminal 150 residues of C. jejuni Atps has little similarity to known protein domains and is functionally unknown.  A Δatps mutant (Cjj81176_1596) was constructed and displayed a 4-log fold defect for aerobic survival as compared to WT, which was partially rescued in a complemented strain Δatps-C (Figure 4.5A). Addition of sulfite and cysteine only caused a very modest increase in aerobic survival of the Δatps mutant (Figure 4.5A). Sulfate supplementation had no effect on C. jejuni aerobic survival (data not shown). In other organisms, the cysteine synthase CysM has been shown to catalyze the incorporation of sulfide into O-acetyl-serine to produce cysteine. A mutant was constructed in a C. jejuni cysM homolog 96  (Cjj81176_0912c). The ΔcysM mutant displayed a 1.4 log fold defect in aerobic survival compared to WT. Sulfite and cysteine addition enhanced ΔcysM aerobic survival to WT levels (Figure 4.5B).  Given that a Δatps mutant is more sensitive to air, we hypothesized that the mutant either had an enhanced rate of H2O2 production by respiratory dehydrogenases, or lacked peroxidase activity to degrade H2O2. A Δatps mutant was found to have significantly enhanced sensitivity to H2O2 in comparison to WT, which was partially restored in the complemented strain (Figure 4.5C). This suggested there is either a defect in H2O2 detoxification or an inability to repair damage induced by H2O2 stress, leading to a loss of viability. H2O2 detoxification in a Δatps mutant was measured as compared to WT. The half life of H2O2 detoxification was calculated using a first order exponential decay line of best fit. The WT and Δatps strains had non-significant differences in half lives of 0.846 min and 0.66 min respectively, suggesting an Δatps mutant is not defective in H2O2 detoxification (data not shown). To further explore the role of Δatps in ROS sensitivity, WT C. jejuni and a Δatps mutant were incubated in the presence or absence of formate. The formate-dependent production of H2O2 by C. jejuni under aerobic conditions (Figure 4.2) was measured in a Δatps mutant. Incubation of the Δatps mutant in the presence of formate resulted in a significantly increased level of H2O2 production in comparison to WT grown with formate that could be partially rescued by complementation (Figure 4.5D). This suggests that an Δatps mutant may not be defective for H2O2 detoxification, but does produce H2O2 more rapidly in aerobic conditions.  97   Figure 4.5. The effect of Atps and CysM on C. jejuni viability in aerobic conditions with sulfite and cysteine media supplementation, and the effect of AtpS on C. jejuni H2O2 sensitivity, peroxidase activity and H2O2 production.  Viability of  A) WT, Δatps mutant, and the Δatps complemented (Δatps-C) strains, and B) WT and ΔcysM mutant strains was assessed in MH-TV media unsupplemented (-), or supplemented with 10mM sulfite (S) or 10 mM cysteine (C) after incubation for 12h in aerobic conditions at 37ºC. Viability was assessed by CFU enumeration C) Viability of WT, Δatps, and Δatps-C C. jejuni strains was assessed after 1h microaerobic incubation at 37ºC in MH-TV media with different concentrations of H2O2. Viability was assessed by CFU enumeration. D) Production of H2O2 was measured in WT, Δatps or Δatps-C strains with or without formate supplementation of the RPMI-G media in aerobic conditions at 37ºC. All experiments were done in triplicate and figures depict one experiment with three technical replicates. Single (*) and double (**) asterisks denote statistically significant differences of p <0.05 and p <0.001, respectively.  98  4.3.6: The Δatps mutant is defective for infection of host cells Generation of O2- and H2O2 from epithelial and immune cells during infection is one of the first line defenses. If Atps is important for resisting oxidative stress, it may also be important for resisting the effects ROS produced by host cells to prevent infection. Caco2 colonic epithelial cells were infected with the C. jejuni WT, Δatps mutant, and the Δatps complemented strain, and CFU recovery following gentamicin treatment was assessed. The Δatps mutant displayed diminished recovery at the ‘adherence and invasion’, ‘invasion’, and ‘short term survival’ time-points that was restored to WT levels with the complemented strain (Figure 4.6). This suggests that sulfur assimilation is not only important for aerobic survival, but for survival within host cells. A Δatps mutant showed significant enhancement in recovery on MH-TV supplemented with sulfite, although not up to WT levels. This suggests that the enhanced recovery of C. jejuni from host epithelial cells on sulfite is independent of Atps.   99   Figure 4.6. The effect of Atps on C. jejuni infection of Caco2 intestinal epithelial cells   The C. jejuni WT, Δatps and Δatps complemented (Δatps-C) strains were used to infect Caco2 cells and assayed at the ’adherence and invasion‘, ‘invasion’  or ‘short term intracellular survival’ using a gentamicin protection assay. CFUs were determined on MH-TV agar with and without 20 mM sulfite (S). All experiments were done in triplicate and figures depict one experiment with three technical replicates. Asterisks (*) and (**) denote a statistically significant difference of p <0.05 and p <0.001, respectively. 4.4: Discussion C. jejuni must survive in the environment during transmission. An important aspect in understanding this survival is characterizing how C. jejuni responds to aerobic conditions. In E. coli, the rate of ROS production initially increases when E. coli transitions from anaerobic to aerobic conditions and then quickly slows during longer aerobic incubation as enzymes such as fumarate reductase that are predisposed to ROS formation are down-regulated (124, 218). Here, the transition of C. jejuni from a microaerobic to an aerobic environment was also shown to stimulate the production of ROS after a 6h 100  lag phase that correlates with a sharp decrease in viability. In addition, the viability of C. jejuni in aerobic conditions was found to be enhanced at 4ºC versus 37ºC, as shown previously (77). This potentially was due to the lower rate of H2O2 production at 4ºC, and indicates that at lower temperatures in aerobic environments C. jejuni undergoes decreased oxidative stress in comparison to 37ºC commensurate with the bacterium’s reduced metabolic rate at 4ºC.  We postulated that homologs of the E. coli H2O2-producing enzymes may be sources of H2O2 production during aerobic incubation of C. jejuni. For example, a C. jejuni fumarate reductase (MfrA) mutant, despite having a defect in survival in H2O2, was shown previously to survive better than WT under aerobic conditions, suggesting it is a source of ROS (128). Similarly, deletion of Fdh reduced the overall production of H2O2 under aerobic conditions, with a concomitant increase in viability as compared to WT. Incubation of C. jejuni in the presence of formate, the substrate for Fdh, also enhanced aerobic H2O2 production in an Fdh-dependent manner. Production of H2O2 from enzyme-associated redox cofactors can occur when a solvent-exposed cofactor capable of single electron transfer to oxygen comes into contact with O2. Reduced flavins are the most widely reported sources of ROS in many organisms (111), although iron sulfur clusters are also able to reduce oxygen (111). There have been no crystallographic studies on C. jejuni FdhA; however, analysis of E. coli FdhH, which shares 31% amino acid sequence identity with C. jejuni FdhA, contains an iron sulfur cluster at its active site (32). Moreover, C. jejuni FdhA has been reported to contain an iron sulfur cluster (240). However, the iron sulfur ligands are poorly conserved between C. jejuni FdhA and E. coli FdhH, necessitating further work to determine if the iron sulfur group of FdhA is O2-reactive . C. jejuni Fdh also contains a quinone binding site in FdhC which may be a site of ROS production based on studies in mitochondria (96), although such interpretations based on mitochondrial ROS generation should be taken with care. Nevertheless, no studies have linked Fdh to ROS production in bacteria, thus a direct role of the Fdh active site in H2O2 remains unproven.   101  Although reduction of O2 at the FdhA and SorA active site is possible, the data presented here do not establish this. Rather the data show that O2 reduction is dependent on the presence of Fdh and Sor. The increased production of H2O2 after 6h incubation with formate suggests that the enhanced production of H2O2 may be due to the upregulation of the fdh operon. Previous studies found no evidence that fdh is differentially regulated during C. jejuni oxidative stress, suggesting it may not be differentially expressed in 20% oxygen; however, further work is needed to determine how fdh is regulated in aerobic conditions(55, 214). Moreover, no work to date has assessed whether formate regulates fdh transcription, although E. coli fdhGHIF is induced when media is supplemented with formate(290). These experiments are currently underway for C. jejuni. Regardless, upregulation of the fdh operon in the presence of formate may be resulting in an increase in Fdh redox active prosthetic groups which are involved in reduction of oxygen. E. coli FdhH is proposed to involve the oxidation of formate independent of oxygen transfer(25, 134). However, the limited amino acid similarity between FdhH and FdhA makes such interpretations about FdhA difficult. Varying the levels of Fdh by expressing fdh under the control of different strength promoters, thus eliminating the effect of formate-induced upregulation of fdh, could help determine if Fdh alone, or Fdh dependent-respiration of formate is involved in ROS production. A positive correlation between the amount of Fdh produced and the amount of ROS produced in the absence of formate supplementation would argue that Fdh redox cofactors are reactive with O2 and a direct site of ROS formation. An alternate hypothesis is that Fdh-dependent electron flux may increase the level of reduced redox centers such as in fumarate reductase, a known site of O2 reduction(182) or in Fdh itself.  Unpublished data found that a ΔcydA mutant produced less H2O2 when incubated with formate than WT+formate during the first 9h of aerobic incubation (data not shown). Fdh-dependent electron flux through the ETC may be causing enhanced reduction of CydA leading to greater H2O2 production (the role of CcoNOQP has not been investigated). Incubation of C. jejuni with 102  sulfite may be causing analogous increased expression of Sor and increased reduction of ETC reductase redox centers which may be sites of H2O2 production as proposed for Fdh above.  Elevated respiration in the presence of formate will also cause downstream reduction of menaquinone and complex III, which may be potential sources of H2O2. Reduced menaquinone is a known source of H2O2 (142). As noted above, experiments are currently underway to determine the role of menaquinone and terminal oxidases in H2O2 production. The inhibitor HQNO which inhibits the interaction of menaquinone with complex III (196)can be used to determine if enzymes downstream of menaquinone may be a source of enhanced H2O2 production in the presence of formate. If reduced Fdh redox centers or menaquinone are the sites of O2 reduction, then incubation with formate will increase the titre of reduced Fdh redox centers (as well as in menaquinone), thereby enhancing H2O2 production.    The presence of Fdh resulted in increased production of H2O2, and the presence of Fdh decreased C. jejuni aerobic survival, yet other metabolic additives have been reported to have the opposite effect and enhance survival, such as sulfite, bisulfite, pyruvate (mentioned in results) and iron ascorbate (120, 155). It is unknown if these compounds have direct anti-oxidant activity or have important metabolic functions. The two sulfur-containing metabolites, sulfite and cysteine, were able to enhance aerobic survival in a manner that is partially dependent on Sor. Despite this, it was found that H2O2 production was dependent on Sor under aerobic conditions when the media were supplemented with sulfite. Previous  work established that E. coli sulfite reductase is a site of O2 reduction(181); however, C. jejuni Sor is not a homolog of E. coli sulfite reductase and lacks the flavin group which was associated with O2 reduction in E. coli. Interpretation about Sor based on E. coli sulfite reductase data should be done with care. Since sulfite enhanced H2O2 production under aerobiosis, it would be expected to decrease C. jejuni aerobic viability. However, the opposite was observed: sulfite enhanced aerobic survival. We hypothesized that the role of sulfite and cysteine in aerobic survival might be due to a role in sulfur 103  homeostasis instead of as anti-oxidants, as both compounds are intermediates in the sulfur assimilation pathway. The primary role of the sulfur assimilation pathway in many organisms is to convert sulfate into the sulfur-containing amino acid cysteine (Refer to Figure 1.8). The sulfur assimilation pathway is thus far not known to be involved in aerobic survival in other bacteria, but was found to be important for C. jejuni aero-tolerance and partially responsible for the enhanced aerobic survival resulting from sulfite supplementation. To investigate the role of the sulfur assimilation pathway, the first enzyme in the pathway, Atps, and the last enzyme in the pathway, CysM, were mutated. Although a ΔcysM mutant was slightly more sensitive to exposure to oxygen than WT, it was much more resistant to aerobic conditions than an Δatps mutant. The ΔcysM mutant, unlike Δatps, could be rescued to WT+sulfite or WT+cysteine levels of aerobic survival with sulfite or cysteine addition respectively; indicating that the Δatps defect in aero-tolerance is not due to defects in cysteine synthesis. An Δatps mutant was more sensitive to higher levels of H2O2 than WT, and the addition of formate to an Δatps mutant, caused rapid H2O2 accumulation but did not have a defect in H2O2 detoxification compared to WT. The fact that the Δatps mutant is defective for aero-tolerance implicates the sulfur assimilation pathway in oxidative stress management in C. jejuni, although the exact role remains to be determined. These features are also important for host cell infection, as a Δatps mutant was defective for recovery from Caco2 epithelial cells, although this defect was partially abrogated in the presence of sulfite. Previously, we showed that sulfite could enhance recovery of C. jejuni from host epithelial cells (229); however, this is likely not due to a function of the sulfur assimilation pathway, as sulfite still enhanced recovery from epithelial cells in a Δatps background as expected from data presented in chapter 3.  Even though the main role of the sulfur assimilation pathway is to synthesize cysteine, intermediates in the pathway can also be used by sulfotransferases to generate other sulfo-compounds. Examples include: M. tuberculosis sulfolipid-1 shown to be important for virulence, possibly by mediating resistance to antimicrobial peptides (82, 193), and oligosaccharide sulfation that is vital for the 104  production of nodulation factors in Rhizobium species. A sulfocompound synthesized by the activity of a sulfotransferase may be important in mediating aerobic tolerance in C. jejuni. Extensive searches of the C. jejuni genome did not identify homologs of known sulfotransferases, although C. jejuni sulfotranferases may have low sequence similarity to known sulfotransferases. Future work will determine how the sulfur assimilation pathway influences C. jejuni aero-tolerance and whether C. jejuni produces any novel sulfur-containing compounds. It is unknown how sulfate and sulfite cross the C. jejuni plasma membrane as both are charged and unable to cross lipid bilayers. In other bacteria, there is a dedicated sulfate transporter that is absent in C. jejuni (5).  Addition of sulfate to cultures did not enhance survival of C. jeuni in aerobic conditions (data not shown). Previous work has demonstrated that Sor is the only respiratory enzyme that can use sulfite as an electron donor to the electron transport chain(196). However, C. jejuni also possesses another putative sulfite oxidoreductase that was shown to have a role in nitrosative stress (97), although it is unknown if it is important for oxidative stress. It is in the same operon as a putative transmembrane protein with homology to ferric reductase, which may suggest that sulfite oxidation can be coupled to iron reduction in C. jejuni.  A major paradox in C. jejuni biology is why it loses viability rapidly in aerobic conditions, yet is able to persist in the environment for long periods of time. To understand this phenomenon, it is important to understand sources of oxidative stress in C. jejuni and how environmental conditions effect the bacterium’s oxidative stress response. This study determined that Fdh and Sor are involved in H2O2 production. The main source of formate and sulfite in C. jejuni are likely pyruvate formate lyase and cysteine dioxygenase respectively and as such both compounds are likely to be encountered due to endogenous production by C. jejuni. In addition, it was found that H2O2 production is temperature- and oxygen tension-dependent, with production of H2O2 ceasing in microaerobic oxygen conditions and at 4ºC and. This may account for the ability of C. jejuni to persist on refrigerated meat for extended periods of time (296).  105  The role of sulfite in enhancing C. jejuni aerobic survival that we have described also brings up another important issue for the food industry: sulfite is a common food preservative as it produces sulfur dioxide which inhibits the oxidase activity of enzymes (183). However, sulfite may actually be enhancing the aerobic survival of C. jejuni and promote the transmission of C. jejuni to humans. In addition, recent reports have shown that neutrophils release high levels of sulfite during inflammation in humans (184). This may also augment C. jejuni aerobic survival during transmission. The wide use of sulfite and refrigeration in the food industry is unlikely to stop, and strategies to overcome these factors are needed to break transmission of C. jejuni to humans.    106  Chapter 5:  General discussion  5.1: Summary In order to better understand factors that are important for C. jejuni interaction with human epithelial cells, a microarray experiment investigating C. jejuni genes up-regulated when interacting with human cells was analyzed (80). Mutational analysis of a subset of these genes revealed the importance of the fdhTU operon in epithelial cell infection. The operon, encoding a transmembrane importer (fdhT) and an RNA binding regulatory gene (fdhU) were found to be a novel regulator of Fdh. Bioinformatics analysis found the fdhTU operon is conserved across many different bacterial species. A concurrent study found the operon was important for selenium uptake, and confirmed the importance of FdhTU in fdh regulation (247). This is consistent with a previous study that found selenium was an important cofactor in Fdh activity (251).   During studies involving fdhTU, we found that both Fdh and media supplementation with sulfite are important for recovery of C. jejuni from Caco2 epithelial cells. To further investigate how sulfite is able to cause this to occur I analyzed the intracellular transcript levels of ROS stress-regulated genes, measured H2O2 production from Caco2 cells, and the effects of supplementation of host cell lysates with catalase. These experiments revealed that sulfite addition was likely detoxifying ROS, and that C. jejuni is diminished for oxidative stress resistance when transitioning from an intracellular to extracellular niche.  The finding that Fdh is important for recovery from epithelial cells led us to investigate the role of other respiratory dehydrogenases in host cell recovery. Multiple different dehydrogenase mutants were constructed and tested for epithelial cell adherence, invasion, intracellular survival and intracellular trafficking. ΔsorAB, Δgdh, ΔputA, Δmdh, and ΔhydAB were found to all be required for proper 107  intracellular survival of C. jejuni – but, unlike Fdh, likely not required for recovery following cell infection. Further analysis found that a Δgdh mutant induced reduced cytokine secretion and increased induction of host cell necrosis from T84 cells compared to WT infected cells. The induction of necrosis was subsequently found to be due to production of NADPH oxidase-dependent mitochondrial ROS and activation of calpain proteases. A specific role for Δgdh in enhanced induction of necrosis has yet to be determined.  Sulfite not only enhanced survival of C. jejuni from epithelial cells, but was also found to enhance survival under aerobic conditions which are normally toxic to C. jejuni. C. jejuni loss of viability in aerobic conditions correlated with production of H2O2. In E. coli, ROS generation is due to accidental oxidation of respiratory dehydrogenases by O2 (245); Consistent with this, we identified Fdh and Sor enzyme complexes to be significant sources of H2O2 production when C. jejuni were incubated aerobically. Enhanced survival in aerobic conditions was achieved when C. jejuni was supplemented with sulfite or cysteine, and enhanced survival was found to be dependent on the sulfur assimilation pathway gene ATP sulfurylase (atps). An Δatps mutant was found to be severely defective for survival in aerobic conditions, had reduced peroxidase activity and was defective for infection of epithelial cells.  5.2: FdhTU is important for regulation of fdh and recovery from host epithelial cells  Analysis of C. jejuni metabolism has revealed many metabolic systems important for infection and colonization (196, 213, 306). However, regulation of metabolism in C. jejuni is poorly understood. C. jejuni has relatively few regulatory systems, with only twelve response regulators of two component signaling systems (265) and relatively few other annotated regulators (306). Understanding how C. jejuni regulates metabolic potential is vital to understanding how it responds to environmental cues. Work within chapter 2 identified a novel regulator conserved in many bacterial species that is important for 108  regulation of fdh in C. jejuni. This work may shed light on metabolic regulation of Fdh in a wide range of bacteria.    Data presented in chapter 2 showed FdhTU is a regulator of fdh; however, exactly how FdhTU regulates fdh is still unknown. Formate dehydrogenase subunit A (FdhA) contains a selenocysteine residue that is important for enzyme function and is likely incorporated into protein through the SelABCD system (264, 309). In a study concurrent to ours that also assessed the function of FdhTU, it was found that supplementation of media with excess selenium dioxide (selenium redox state +VI) could restore Fdh activity in a ΔfdhU mutant (247). That study reported that fdhT encodes a selenium importer and fdhU is involved in regulating fdh expression in the absence of selenium (247). Incorporation of selenium into selenocysteine requires a complex biochemical pathway that involves incorporation of selenocysteine at the UGA codon downstream of a SECIS sequences (264). Selenocyteine synthesis requires selenide (selenium redox state –II), which is converted to selenophosphate by selenide water dikinase (cjj81176_1496) before incorporation into selocysteine (207, 264). Direct binding of selenium to FdhT or FdhU has not been demonstrated, and the redox state of selenium recognized by the selenium importer FdhT or by the regulatory element FdhU is unknown. How C. jejuni reduces selenium dioxide (IV) to selenide (-II) is also unknown, although glutathione reductase and thioredoxin reductase have been implicated in reduction of selenium in E. coli (164, 267). C. jejuni lacks a glutathione reductase, but does have a thioredoxin reductase, and it would be interesting to determine its role in selenium reduction (121).  Domain architecture of the regulator FdhU found no DNA-binding domain but did find significant amino acid sequence identity to the RNA-binding protein TusA (108, 229). Studies have not determined how FdhU binds to RNA, what the RNA binding consensus sequence is, or how FdhU binding to selenium affects RNA binding. Determination of these characteristics could shed light on how C. jejuni and other 109  bacteria regulate cytoplasmic selenium levels. Given that the fdhTU operon is conserved in Gram negative and Gram positive bacteria knowing how FdhU affects RNA stability in other bacterial systems may provide information about metabolic regulation in those systems. In C. jejuni FdhTU is restricted to regulation of Fdh, which is the only known selenium-containing enzyme (229, 247). However, in other organisms, selenium containing proteins include glycine reductase, NiFeSe hydrogenase, and heterodisulfide reductase (264). Future studies should focus on if FdhTU regulates these proteins in other bacterial species.    How Fdh affects recovery of C. jejuni from host epithelial cells remains to be determined. There were no previous reports in C. jejuni that linked any genes to extracellular recovery after tissue culture infection prior to the work presented in chapter 2. Since plating ΔfdhA and ΔfdhTU mutants on sulfite-containing media allows recovery of ΔfdhA+sulfite and ΔfdhTU+sulfite to WT+sulfite levels, and since sulfite is involved in neutralization of H2O2 when exiting epithelial cells, it is tempting to postulate that ΔfdhA is defective in resisting oxidative stress. However, this is contrary to data in chapter 4, which suggests that Fdh enhances H2O2 production. Generation of endogenous ROS species is different than neutralization of exogenous ROS, and electron flux from Fdh may be required to resist some of the destructive effects of excess ROS species. This is consistent with a report that found that a ΔfdhA mutant is more susceptible to exogenously added H2O2 (127). Generation of enhanced membrane polarity or enhanced generation of ATP is unlikely to account for Fdh mediated resistance to H2O2, since H2O2 is non-polar and easily diffuses through membranes, and supplementation of recovery plates with other metabolites like proline, malate, gluconate and formate did not enhance recovery of C. jejuni from epithelial cells. If Fdh is involved in resisting oxidative stress, then one would expect mutants in ROS scavenging genes like alkyl hydrogen peroxidase (ΔahpC) or catalase (ΔkatA) to have recovery defects coming out of Caco2epithelial cells that can be abolished by sulfite or catalase supplementation to the lysate. Mutants in ΔkatA and ΔsodB were found to be defective for survival in multiple cell lines which may be due to a 110  recovery defect (49, 209). Such studies have not been undertaken and would be interesting to investigate in the future.   5.3: C. jejuni metabolism in infection and induction of necrosis C. jejuni lacks classic virulence factors and must utilize fundamental properties such as metabolic adaptations, surface sugar modification, and motility to infect human hosts (15, 86, 213, 271, 306). The recent discovery that fdh and serine utilization are up-regulated in the sheep abortion-causing ‘SA’ C. jejuni strain further points to nutrient utilization in disease pathology severity (300). Understanding metabolic features that allow C. jejuni to invade and persist in human hosts may shed light on how other pathogenic bacterium persist in human hosts. As part of the work presented in chapter 3, we found that metabolic systems are not only important for epithelial cell infection, but also can alter pathogenesis-associated phenotypes such as cytokine secretion and induction of necrosis. This is analogous to a studies in Salmonella spp. in which TCA cycle mutants accumulated citrate, which caused enhanced induction of NOD-like receptor family, pyrin domain containing protein 3 (NLRP3) and pyroptosis-mediated cell death (301), and in Helicobacter pylori in which gamma glutamyl transpeptidase depleted host glutathione, also inducing epithelial cell death (71). As the C. jejuni metabolic systems investigated here are conserved in other bacteria, we feel that research described here will be relevant to other bacterial systems as well.  Work presented in this thesis show that inhibition of calpain activation can cause inhibition of C. jejuni induced host cell death linking C. jejuni infection to programmed necrosis. Not discussed in detail in chapter 3 is that a major target of activated calpain are cytoskeletal components such as α-fodrin and actin (161). If calpain is activated it can lead to defects in epithelial barrier function due to degradation of tight junction proteins (149, 153, 219, 255). A previous study had shown that prolonged incubation of C. jejuni with T84 cells causes breakdown of occludin protein in tight junctions leading to barrier 111  dysfunction in polarized epithelial cells (38). Investigation of the role of calpain activation in C. jejuni mediated degradation of occludin and tight junction degradation would yield vital knowledge of how intestinal barrier function is compromised during C. jejuni pathogenesis. We found that host cell death was dependent on the production of ROS that could be inhibited by NOX inhibitors or by mitochondrial ROS scavengers. The mechanism of C. jejuni-induced accumulation of ROS in epithelial mitochondria to lethal levels is unknown; however, a Δpgp1 mutant was found to also cause enhanced epithelial cell necrosis compared to WT (not shown). Pgp1 was previously found by our group to modify peptidoglycan, and Δpgp1 peptidoglycan causes enhanced activation of Nod1 (75), which hints at a possible link between Nod activation and necrosis. Nods have been implicated in ROS production and NOX stimulation (158), which may account for why Δpgp1 causes enhanced T84 death. Nod1 and Nod2 stimulation by C. jejuni is important for C. jejuni-induced inflammation (308), although TLR-2 and TLR-4 have also been found to be mediators of C. jejuni inflammation and contributors to ROS production (74, 233, 262). It is unknown if Nods interact with MLKL and RIP3 of the necrososme (for reference please see Figure 1.5) to induce necroptosis, but TLR-4 has been shown to directly stimulate necrosis by interfacing with MLKL and Rip3 independent of Rip1 and the TNF-α receptor (122, 172, 295, 302). It would be interesting to investigate if ROS production is linked to TLR and Nod signaling, and if RIP1-independent oligomerization of MLKL and RIP3 are important for necrosis induction when infected with C. jejuni.  Consistent with the theme of ROS inducing necrosis, the common clinical IBD drugs 5-aminosialic acid (5-ASA) and azathioprine were also found to inhibit C. jejuni-induced host cell death (data not shown) without inhibiting C. jejuni invasion or intracellular survival (data not shown). Azathioprine inhibits Rac1, an important element in NOX activation (30, 185, 268, 276), and 5-ASA is thought to suppress or scavenge ROS in an unknown way (44, 230). The inhibition of C. jejuni induced necrosis with 5-ASA and 112  azathioprine further suggests that ROS generation is an important factor involved in necrosis. This has secondary implications, as the role of 5-ASA and azathioprine are traditionally thought to inhibit T-cells to restore intestinal homeostasis. Inhibition of C. jejuni-mediated host cell death in a T-cell free system argues that 5-ASA and Azathioprine may be also acting directly on intestinal epithelial cells to restore epithelial homeostasis. C. jejuni has been associated in relapse of inflammatory bowel disease and post-infectious irritable bowel syndrome (31, 256); understanding how to restore homeostasis after infection may help prevent GI complications.      The finding that a Δgdh mutant causes altered pathology in infected T84 epithelial cells was unexpected but reflects the complicated interplay between host and pathogens. Despite finding key elements that contribute to induction of necrosis in T84 cells, the reason Δgdh induces enhanced cell death still awaits discovery. One hypothesis relates to the fact that gluconate is an intermediate in the pentose phosphate pathway (PPP), which is important for production of purines, but is also a major source of NADPH in human cells (261). Cellular NADPH is vital for many different processes, including generation of O2- from the NADPH oxidases (or H2O2 in the case of NOX4) as well as supplying reducing power for glutathione reductase (150, 305). In this regard, the PPP is important for controlling redox state and ROS levels inside human cells. Infection with Δgdh may result in higher host NADPH levels in the host as compared to infection with WT C. jejuni due to decreased consumption of host gluconate. The elevated NADPH levels in a Δgdh infected host cell may lead to increased NOX activity resulting in higher ROS burden. This higher oxidative stress burden may account for the enhanced host cell death seen during infection with a Δgdh mutant. However, a larger pool of NADPH has also been associated with a larger pool of reduced glutathione which is protective against oxidative stress (53). Measurements of O2-, reduced glutathione and NADPH levels in Δgdh verses WT infected cells may yield information on how Δgdh and the PPP affects host cell death.            113  The characteristic pathology initiated by C. jejuni during infection is due to the massive influx of neutrophils; however, C. jejuni must first disrupt the intestinal wall barrier to destroy intestinal homeostasis (38, 224, 297). Alterations in epithelial cell barrier function have been noted after C. jejuni infection, but not all the cellular changes have been completely investigated (38, 297). Induction of calpains and necrosis may play an important role in disruption of the intestinal epithelium and migration of C. jejuni to deeper tissues to induce gastroenteritis. Antibiotic therapy for C. jejuni is only effective during the initial stages of infection and only slightly reduces mean disease duration, suggesting that C. jejuni may be inducing runaway inflammation that becomes partially independent of the bacterium (273). This inflammation in susceptible people can cause manifestation of Guillain–Barré syndrome or relapse of IBD (171). Understanding steps during C. jejuni infection that lead to inflammation may help develop treatments to restore intestinal homeostasis more rapidly, or develop intervention for individuals with IBD who are at risk of relapse from C. jejuni.  5.4: C. jejuni produces ROS species in aerobic conditions Previous work on C. jejuni oxidative stress has focused on specific proteins C. jejuni uses for detoxification of reactive oxygen species, as well as how it repairs oxidative damage (14, 18, 84, 231). Despite multiple adaptations to cope with oxidative damage, C. jejuni rapidly loses viability in aerobic conditions, suggesting it is producing ROS faster than it can scavenge them under aerobic oxygen. To date, no studies have shown which enzymes are responsible for ROS generation in C. jejuni. Despite the susceptibility to aerobic conditions, C. jejuni is still a major contaminant of food and water in aerobic conditions. Understanding how C. jejuni survives in the environment and how it succumbs to oxygen toxicity may shed some insights on control strategies.  To better understand why C. jejuni loses viability in oxidative environments, we set out to understand how C. jejuni metabolism affects ROS production. We showed that H2O2 production was dependent on 114  Fdh and Sor and that ΔfdhA survives better in aerobic conditions compared to WT. The redox active sites responsible for H2O2 production are still unknown. One likely candidate, fumarate reductase (MfrA), was shown by another group to survive better than WT in aerobic conditions, which suggests it may be a source of ROS (128). To identify novel sources of ROS, screening of flavin-containing enzymes as sources of ROS production would be a good approach, as they are often a source of ROS in E. coli and other organisms. C. jejuni flavodoxin, for example, may be a good candidate for H2O2 production due to having a solvent exposed flavin (259). As mentioned in chapter 4, FdhA and SorA active site redox centers may not be the direct sources of ROS, but rather, electron flux through these systems may be important for generation of ROS. Electrons from Fdh pass through menaquinone as well as the terminal oxidases CcoNOQP and CydAB, whereas electrons from Sor pass electrons directly to cytochrome c without interfacing with menaquinione (115, 196, 213). Reduced menaquinone can be directly oxidized by O2 to generate O2-; it is usually only produced in low oxygen tension with ubiquinone taking its place under aerobic conditions in E. coli (142). As such, menaquinone reduced by Fdh may be a source of ROS when formate is added to the media. Unfortunately, menaquinone is essential in C. jejuni making direct studies difficult, but inhibition of the menaquinone-cytochrome bc1 complex with the inhibitor HQNO may shed light on components upstream of menaquinone in production of ROS when incubated with formate. The other possible explanation is that redox centers in a terminal oxidase may be the source of ROS, enhances ROS production. The role of CydAB in ROS generation was mentioned in the discussion of chapter 4 and further analysis is needed to determine if it is a source of ROS production. Other groups have suggested that terminal oxidases are not a source of ROS; however, exceptions to this have been observed (111). Given the fact that environmental survival in oxygen is a major stress C. jejuni must cope with between hosts, a better understanding of systems that cause generation of ROS in C. jejuni may help reduce carriage of the bacterium on contaminated consumables.  115  5.5: Role of sulfur assimilation in aero-tolerance Sulfur containing compounds like glutathione, mycothiol and ergothioneine play a major role in ROS detoxification (61). Many new sulfur containing compounds have since been discovered, and functional characterization is being undertaken (61). C. jejuni, however, lacks any known classical sulfur containing antioxidant like glutathione. The importance of Atps and sulfur homeostasis in aerobic survival may point to the existence of an as yet unknown glutathione-like molecule. Discovering how C. jejuni assimilates sulfur, and discovering if C. jejuni produces any novel sulfur containing molecules may shed light on how it survives in the environment under aerobic conditions.  Data in chapter 4 determined that the sulfur assimilation pathway is important for survival of C. jejuni in aerobic conditions in a manner independent of de novo cysteine synthesis. Two major questions remain: does C. jejuni have a functional PAPS reductase and sulfite reductase, and does C. jejuni contain sulfotransferases that can transfer sulfate from PAPS to a recipient compound (please see Figure 1.8 for reference). Homologues in these proteins could not be found in the C. jejuni genome. A previous study attempting to make a C. jejuni minimal media investigated the role of cysteine auxotrophy. In that study, it was found that sulfide (H2S) could be supplemented to allow C. jejuni to grow in the absence of cysteine, but sulfite and sulfate could not restore growth (6). This suggests that C. jejuni may be lacking the sulfite reductase, and PAPS reductase and may rely on sulfide and thiosulfate as sulfur donors for CysM.   APS and PAPS have been previously found to be capable of transferring sulfur groups to other molecules such as lipids and tyrosine residues (82, 193, 249). It is possible that the role of the sulfur assimilation pathway is in generation of a novel ROS scavenger that fulfills the same role as glutathione or mycothiol. However, due to no observable defect in H2O2 removal in an Δatps background, it is questionable if Atps is involved in H2O2 detoxification. It is possible that the pathway may be involved in some other aspect 116  of aero-tolerance that is unknown, such as iron sulfur cluster repair. SILAC analysis using ‘heavy’ sulfite isotopes could help identify molecules that are labeled with heavy isotopes of sulfite. Such an approach was used to identify sulfur containing molecules in M. tuberculosis (192).  Sulfite is a common additive to foods as a preservative and it is secreted by neutrophils during gastroenteritis (167, 184). C. jejuni may be exposed to sulfite during infection or transmission, and assimilating this sulfite may be important for assisting with aero-tolerance. Understanding the sulfur assimilation pathway is important, and understanding its role may help understand and find novel intervention strategies.   5.6: Final thoughts C. jejuni is one of the leading causes of bacterial gastroenteritis worldwide and is a cause of significant disease both due to primary infection as well as secondary complications. Unfortunately, how it causes disease remains an enigma due to challenges with genetic manipulation, and remains difficult to treat clinically due to its propensity to rapidly mutate to generate antibiotic resistance. I feel within this work interesting revelations have been identified about the biology of C. jejuni that may be applicable to other bacterial systems. Future work will need to be conducted to fully explore the phenomena described within. I feel that as a result of this work multiple avenues for future studies have been opened.   117  References  1. 2013. Multistate outbreak of Campylobacter jejuni infections associated with undercooked chicken livers--northeastern United States, 2012. MMWR Morb Mortal Wkly Rep 62:874-6. 2. 1994. Schistosomes, liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7-14 June 1994. IARC Monogr Eval Carcinog Risks Hum 61:1-241. 3. Abid, M., H. Wimalarathna, J. Mills, L. Saldana, W. Pang, J. F. Richardson, M. C. Maiden, and N. D. McCarthy. 2013. Duck liver-associated outbreak of Campylobacteriosis among humans, United Kingdom, 2011. Emerg Infect Dis 19:1310-3. 4. Abu Kwaik, Y., and D. Bumann. 2013. Microbial quest for food in vivo: 'nutritional virulence' as an emerging paradigm. Cell Microbiol 15:882-90. 5. Aguilar-Barajas, E., C. Diaz-Perez, M. I. Ramirez-Diaz, H. Riveros-Rosas, and C. Cervantes. 2011. Bacterial transport of sulfate, molybdate, and related oxyanions. Biometals 24:687-707. 6. Alazzam, B., S. Bonnassie-Rouxin, V. Dufour, and G. Ermel. 2011. MCLMAN, a new minimal medium for Campylobacter jejuni NCTC 11168. Res Microbiol 162:173-9. 7. Alemka, A., H. Nothaft, J. Zheng, and C. M. Szymanski. 2013. N-glycosylation of Campylobacter jejuni surface proteins promotes bacterial fitness. Infect Immun 81:1674-82. 8. Alli, O. A., L. Y. Gao, L. L. Pedersen, S. Zink, M. Radulic, M. Doric, and Y. Abu Kwaik. 2000. Temporal pore formation-mediated egress from macrophages and alveolar epithelial cells by Legionella pneumophila. Infect Immun 68:6431-40. 9. Allocati, N., L. Federici, M. Masulli, and C. Di Ilio. 2009. Glutathione transferases in bacteria. FEBS J 276:58-75. 10. Andersen-Nissen, E., K. D. Smith, K. L. Strobe, S. L. Barrett, B. T. Cookson, S. M. Logan, and A. Aderem. 2005. Evasion of Toll-like receptor 5 by flagellated bacteria. Proc Natl Acad Sci U S A 102:9247-52. 11. Andersen, M. T., L. Brondsted, B. M. Pearson, F. Mulholland, M. Parker, C. Pin, J. M. Wells, and H. Ingmer. 2005. Diverse roles for HspR in Campylobacter jejuni revealed by the proteome, transcriptome and phenotypic characterization of an hspR mutant. Microbiology 151:905-15. 12. Apel, D., J. Ellermeier, M. Pryjma, V. J. Dirita, and E. C. Gaynor. 2012. Characterization of Campylobacter jejuni RacRS reveals roles in the heat shock response, motility, and maintenance of cell length homogeneity. J Bacteriol 194:2342-54. 13. Atack, J. M., P. Harvey, M. A. Jones, and D. J. Kelly. 2008. The Campylobacter jejuni thiol peroxidases Tpx and Bcp both contribute to aerotolerance and peroxide-mediated stress resistance but have distinct substrate specificities. J Bacteriol 190:5279-90. 14. Atack, J. M., and D. J. Kelly. 2008. Contribution of the stereospecific methionine sulphoxide reductases MsrA and MsrB to oxidative and nitrosative stress resistance in the food-borne pathogen Campylobacter jejuni. Microbiology 154:2219-30. 15. Bachtiar, B. M., P. J. Coloe, and B. N. Fry. 2007. Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium-host interactions. FEMS Immunol Med Microbiol 49:149-54. 16. Bacon, D. J., R. A. Alm, D. H. Burr, L. Hu, D. J. Kopecko, C. P. Ewing, T. J. Trust, and P. Guerry. 2000. Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun 68:4384-90. 17. Bahrami, B., S. Macfarlane, and G. T. Macfarlane. 2011. Induction of cytokine formation by human intestinal bacteria in gut epithelial cell lines. J Appl Microbiol 110:353-63. 118  18. Baillon, M. L., A. H. van Vliet, J. M. Ketley, C. Constantinidou, and C. W. Penn. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J Bacteriol 181:4798-804. 19. Beltinger, J., J. del Buono, M. M. Skelly, J. Thornley, R. C. Spiller, W. A. Stack, and C. J. Hawkey. 2008. Disruption of colonic barrier function and induction of mediator release by strains of Campylobacter jejuni that invade epithelial cells. World J Gastroenterol 14:7345-52. 20. Benov, L., N. M. Kredich, and I. Fridovich. 1996. The mechanism of the auxotrophy for sulfur-containing amino acids imposed upon Escherichia coli by superoxide. J Biol Chem 271:21037-40. 21. Bereswill, S., A. Fischer, R. Plickert, L. M. Haag, B. Otto, A. A. Kuhl, J. I. Dashti, A. E. Zautner, M. Munoz, C. Loddenkemper, U. Gross, U. B. Gobel, and M. M. Heimesaat. 2011. Novel murine infection models provide deep insights into the "menage a trois" of Campylobacter jejuni, microbiota and host innate immunity. PLoS One 6:e20953. 22. Bergounioux, J., R. Elisee, A. L. Prunier, F. Donnadieu, B. Sperandio, P. Sansonetti, and L. Arbibe. 2012. Calpain activation by the Shigella flexneri effector VirA regulates key steps in the formation and life of the bacterium's epithelial niche. Cell Host Microbe 11:240-52. 23. Bergsbaken, T., S. L. Fink, and B. T. Cookson. 2009. Pyroptosis: host cell death and inflammation. Nat Rev Microbiol 7:99-109. 24. Betts, J. C., P. T. Lukey, L. C. Robb, R. A. McAdam, and K. Duncan. 2002. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mol Microbiol 43:717-31. 25. Birringer, M., S. Pilawa, and L. Flohe. 2002. Trends in selenium biochemistry. Nat Prod Rep 19:693-718. 26. Blaser, M. J. 1997. Epidemiologic and clinical features of Campylobacter jejuni infections. J Infect Dis 176 Suppl 2:S103-5. 27. Blomgren, K., S. Kawashima, T. C. Saido, J. O. Karlsson, A. Elmered, and H. Hagberg. 1995. Fodrin degradation and subcellular distribution of calpains after neonatal rat cerebral hypoxic-ischemia. Brain Res 684:143-9. 28. Boehm, D. E., K. Vincent, and O. R. Brown. 1976. Oxygen and toxicity inhibition of amino acid biosynthesis. Nature 262:418-20. 29. Bonner, C. A., G. I. Byrne, and R. A. Jensen. 2014. Chlamydia exploit the mammalian tryptophan-depletion defense strategy as a counter-defensive cue to trigger a survival state of persistence. Front Cell Infect Microbiol 4:17. 30. Bourgine, J., A. Garat, D. Allorge, A. Crunelle-Thibaut, J. M. Lo-Guidice, J. F. Colombel, F. Broly, and I. Billaut-Laden. 2011. Evidence for a functional genetic polymorphism of the Rho-GTPase Rac1. Implication in azathioprine response? Pharmacogenet Genomics 21:313-24. 31. Boyanova, L., G. Gergova, Z. Spassova, R. Koumanova, P. Yaneva, I. Mitov, S. Derejian, and Z. Krastev. 2004. Campylobacter infection in 682 bulgarian patients with acute enterocolitis, inflammatory bowel disease, and other chronic intestinal diseases. Diagn Microbiol Infect Dis 49:71-4. 32. Boyington, J. C., V. N. Gladyshev, S. V. Khangulov, T. C. Stadtman, and P. D. Sun. 1997. Crystal structure of formate dehydrogenase H: catalysis involving Mo, molybdopterin, selenocysteine, and an Fe4S4 cluster. Science 275:1305-8. 33. Bozym, R. A., K. Patel, C. White, K. H. Cheung, J. M. Bergelson, S. A. Morosky, and C. B. Coyne. 2011. Calcium signals and calpain-dependent necrosis are essential for release of coxsackievirus B from polarized intestinal epithelial cells. Mol Biol Cell 22:3010-21. 34. Brondsted, L., M. T. Andersen, M. Parker, K. Jorgensen, and H. Ingmer. 2005. The HtrA protease of Campylobacter jejuni is required for heat and oxygen tolerance and for optimal interaction with human epithelial cells. Appl Environ Microbiol 71:3205-12. 119  35. Bui, X. T., K. Qvortrup, A. Wolff, D. D. Bang, and C. Creuzenet. 2012. Effect of environmental stress factors on the uptake and survival of Campylobacter jejuni in Acanthamoeba castellanii. BMC Microbiol 12:232. 36. Butzler, J. P. 2004. Campylobacter, from obscurity to celebrity. Clin Microbiol Infect 10:868-76. 37. Butzler, J. P., P. Dekeyser, M. Detrain, and F. Dehaen. 1973. Related vibrio in stools. J Pediatr 82:493-5. 38. Chen, M. L., Z. Ge, J. G. Fox, and D. B. Schauer. 2006. Disruption of tight junctions and induction of proinflammatory cytokine responses in colonic epithelial cells by Campylobacter jejuni. Infect Immun 74:6581-9. 39. Chou, S. P., R. Dular, and S. Kasatiya. 1983. Effect of ferrous sulfate, sodium metabisulfite, and sodium pyruvate on survival of Campylobacter jejuni. J Clin Microbiol 18:986-7. 40. Chun, J., and A. Prince. 2009. TLR2-induced calpain cleavage of epithelial junctional proteins facilitates leukocyte transmigration. Cell Host Microbe 5:47-58. 41. Chynoweth, R. W., J. A. Hudson, and K. Thom. 1998. Aerobic growth and survival of Campylobacter jejuni in food and stream water. Lett Appl Microbiol 27:341-4. 42. Clark, C. G., L. Price, R. Ahmed, D. L. Woodward, P. L. Melito, F. G. Rodgers, F. Jamieson, B. Ciebin, A. Li, and A. Ellis. 2003. Characterization of waterborne outbreak-associated Campylobacter jejuni, Walkerton, Ontario. Emerg Infect Dis 9:1232-41. 43. Cooper, A. J. 1983. Biochemistry of sulfur-containing amino acids. Annu Rev Biochem 52:187-222. 44. Couto, D., D. Ribeiro, M. Freitas, A. Gomes, J. L. Lima, and E. Fernandes. 2010. Scavenging of reactive oxygen and nitrogen species by the prodrug sulfasalazine and its metabolites 5-aminosalicylic acid and sulfapyridine. Redox Rep 15:259-67. 45. Crimmins, G. T., M. W. Schelle, A. A. Herskovits, P. P. Ni, B. C. Kline, N. Meyer-Morse, A. T. Iavarone, and D. A. Portnoy. 2009. Listeria monocytogenes 6-Phosphogluconolactonase mutants induce increased activation of a host cytosolic surveillance pathway. Infect Immun 77:3014-22. 46. Das, P., A. Lahiri, M. Sen, N. Iyer, N. Kapoor, K. N. Balaji, and D. Chakravortty. 2010. Cationic amino acid transporters and Salmonella Typhimurium ArgT collectively regulate arginine availability towards intracellular Salmonella growth. PLoS One 5:e15466. 47. Dasti, J. I., A. M. Tareen, R. Lugert, A. E. Zautner, and U. Gross. 2010. Campylobacter jejuni: a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. Int J Med Microbiol 300:205-11. 48. Davis, L. M., T. Kakuda, and V. J. DiRita. 2009. A Campylobacter jejuni znuA orthologue is essential for growth in low-zinc environments and chick colonization. J Bacteriol 191:1631-40. 49. Day, W. A., Jr., J. L. Sajecki, T. M. Pitts, and L. A. Joens. 2000. Role of catalase in Campylobacter jejuni intracellular survival. Infect Immun 68:6337-45. 50. de Graef, M. R., S. Alexeeva, J. L. Snoep, and M. J. Teixeira de Mattos. 1999. The steady-state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolic adaptation in Escherichia coli. J Bacteriol 181:2351-7. 51. De Melo, M. A., G. Gabbiani, and J. C. Pechere. 1989. Cellular events and intracellular survival of Campylobacter jejuni during infection of HEp-2 cells. Infect Immun 57:2214-22. 52. Dean, P., S. Muhlen, S. Quitard, and B. Kenny. 2010. The bacterial effectors EspG and EspG2 induce a destructive calpain activity that is kept in check by the co-delivered Tir effector. Cell Microbiol 12:1308-21. 53. Dodson, M., V. Darley-Usmar, and J. Zhang. 2013. Cellular metabolic and autophagic pathways: traffic control by redox signaling. Free Radic Biol Med 63:207-21. 120  54. Doyle, M. P., and D. J. Roman. 1982. Recovery of Campylobacter jejuni and Campylobacter coli from inoculated foods by selective enrichment. Appl Environ Microbiol 43:1343-53. 55. Dufour, V., J. Li, A. Flint, E. Rosenfeld, K. Rivoal, S. Georgeault, B. Alazzam, G. Ermel, A. Stintzi, M. Bonnaure-Mallet, and C. Baysse. 2013. Inactivation of the LysR regulator Cj1000 of Campylobacter jejuni affects host colonization and respiration. Microbiology 159:1165-78. 56. Egert, M., A. A. de Graaf, A. Maathuis, P. de Waard, C. M. Plugge, H. Smidt, N. E. Deutz, C. Dijkema, W. M. de Vos, and K. Venema. 2007. Identification of glucose-fermenting bacteria present in an in vitro model of the human intestine by RNA-stable isotope probing. FEMS Microbiol Ecol 60:126-35. 57. Eisenreich, W., T. Dandekar, J. Heesemann, and W. Goebel. 2010. Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat Rev Microbiol 8:401-12. 58. Elkind, E., T. Vaisid, J. D. Kornspan, S. Barnoy, S. Rottem, and N. S. Kosower. 2012. Calpastatin upregulation in Mycoplasma hyorhinis-infected cells is promoted by the mycoplasma lipoproteins via the NF-kappaB pathway. Cell Microbiol 14:840-51. 59. Ellis-Iversen, J., A. Ridley, V. Morris, A. Sowa, J. Harris, R. Atterbury, N. Sparks, and V. Allen. 2012. Persistent environmental reservoirs on farms as risk factors for Campylobacter in commercial poultry. Epidemiol Infect 140:916-24. 60. Eucker, T. P., and M. E. Konkel. 2011. The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell Microbiol. 61. Fahey, R. C. 2013. Glutathione analogs in prokaryotes. Biochim Biophys Acta 1830:3182-98. 62. Farhana, A., L. Guidry, A. Srivastava, A. Singh, M. K. Hondalus, and A. J. Steyn. 2010. Reductive stress in microbes: implications for understanding Mycobacterium tuberculosis disease and persistence. Adv Microb Physiol 57:43-117. 63. Fasciano, A., and P. C. Hallenbeck. 1991. Mutations in trans that affect formate dehydrogenase (fdhF) gene expression in Salmonella typhimurium. J Bacteriol 173:5893-900. 64. Fauchere, J. L., A. Rosenau, M. Veron, E. N. Moyen, S. Richard, and A. Pfister. 1986. Association with HeLa cells of Campylobacter jejuni and Campylobacter coli isolated from human feces. Infect Immun 54:283-7. 65. Fernandez-Cruz, A., P. Munoz, R. Mohedano, M. Valerio, M. Marin, L. Alcala, M. Rodriguez-Creixems, E. Cercenado, and E. Bouza. 2010. Campylobacter bacteremia: clinical characteristics, incidence, and outcome over 23 years. Medicine (Baltimore) 89:319-30. 66. Festjens, N., M. Kalai, J. Smet, A. Meeus, R. Van Coster, X. Saelens, and P. Vandenabeele. 2006. Butylated hydroxyanisole is more than a reactive oxygen species scavenger. Cell Death Differ 13:166-9. 67. Fields, J. A., and S. A. Thompson. 2012. Campylobacter jejuni CsrA complements an Escherichia coli csrA mutation for the regulation of biofilm formation, motility and cellular morphology but not glycogen accumulation. BMC Microbiol 12:233. 68. Fields, J. A., and S. A. Thompson. 2008. Campylobacter jejuni CsrA mediates oxidative stress responses, biofilm formation, and host cell invasion. J Bacteriol 190:3411-6. 69. Fiers, W., R. Beyaert, W. Declercq, and P. Vandenabeele. 1999. More than one way to die: apoptosis, necrosis and reactive oxygen damage. Oncogene 18:7719-30. 70. Fink, S. L., and B. T. Cookson. 2005. Apoptosis, pyroptosis, and necrosis: mechanistic description of dead and dying eukaryotic cells. Infect Immun 73:1907-16. 71. Flahou, B., F. Haesebrouck, K. Chiers, K. Van Deun, L. De Smet, B. Devreese, I. Vandenberghe, H. Favoreel, A. Smet, F. Pasmans, K. D'Herde, and R. Ducatelle. 2011. Gastric epithelial cell death caused by Helicobacter suis and Helicobacter pylori gamma-glutamyl transpeptidase is mainly glutathione degradation-dependent. Cell Microbiol 13:1933-55. 121  72. Flint, A., Y. Q. Sun, J. Butcher, M. Stahl, H. Huang, and A. Stintzi. 2014. Phenotypic screening of a targeted mutant library reveals Campylobacter jejuni defenses against oxidative stress. Infect Immun. 73. Fonseca, M. V., and M. S. Swanson. 2014. Nutrient salvaging and metabolism by the intracellular pathogen Legionella pneumophila. Front Cell Infect Microbiol 4:12. 74. Friis, L. M., M. Keelan, and D. E. Taylor. 2009. Campylobacter jejuni drives MyD88-independent interleukin-6 secretion via Toll-like receptor 2. Infect Immun 77:1553-60. 75. Frirdich, E., J. Biboy, C. Adams, J. Lee, J. Ellermeier, L. D. Gielda, V. J. Dirita, S. E. Girardin, W. Vollmer, and E. C. Gaynor. 2012. Peptidoglycan-modifying enzyme Pgp1 is required for helical cell shape and pathogenicity traits in Campylobacter jejuni. PLoS Pathog 8:e1002602. 76. Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester, and F. S. Brinkman. 2005. PSORTb v.2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics 21:617-23. 77. Garenaux, A., F. Jugiau, F. Rama, R. de Jonge, M. Denis, M. Federighi, and M. Ritz. 2008. Survival of Campylobacter jejuni strains from different origins under oxidative stress conditions: effect of temperature. Curr Microbiol 56:293-7. 78. Garvis, S. G., S. L. Tipton, and M. E. Konkel. 1997. Identification of a functional homolog of the Escherichia coli and Salmonella typhimurium cysM gene encoding O-acetylserine sulfhydrylase B in Campylobacter jejuni. Gene 185:63-7. 79. Garzoni, C., and W. L. Kelley. 2009. Staphylococcus aureus: new evidence for intracellular persistence. Trends Microbiol 17:59-65. 80. Gaynor, E. C., D. H. Wells, J. K. MacKichan, and S. Falkow. 2005. The Campylobacter jejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol Microbiol 56:8-27. 81. Geary, L. E., and A. Meister. 1977. On the mechanism of glutamine-dependent reductive amination of alpha-ketoglutarate catalyzed by glutamate synthase. J Biol Chem 252:3501-8. 82. Gilmore, S. A., M. W. Schelle, C. M. Holsclaw, C. D. Leigh, M. Jain, J. S. Cox, J. A. Leary, and C. R. Bertozzi. 2012. Sulfolipid-1 biosynthesis restricts Mycobacterium tuberculosis growth in human macrophages. ACS Chem Biol 7:863-70. 83. Gotz, A., E. Eylert, W. Eisenreich, and W. Goebel. 2010. Carbon metabolism of enterobacterial human pathogens growing in epithelial colorectal adenocarcinoma (Caco-2) cells. PLoS One 5:e10586. 84. Grant, K. A., and S. F. Park. 1995. Molecular characterization of katA from Campylobacter jejuni and generation of a catalase-deficient mutant of Campylobacter coli by interspecific allelic exchange. Microbiology 141 ( Pt 6):1369-76. 85. Guccione, E., A. Hitchcock, S. J. Hall, F. Mulholland, N. Shearer, A. H. van Vliet, and D. J. Kelly. 2010. Reduction of fumarate, mesaconate and crotonate by Mfr, a novel oxygen-regulated periplasmic reductase in Campylobacter jejuni. Environ Microbiol 12:576-91. 86. Guerry, P. 2007. Campylobacter flagella: not just for motility. Trends Microbiol 15:456-61. 87. Gundogdu, O., D. C. Mills, A. Elmi, M. J. Martin, B. W. Wren, and N. Dorrell. 2011. The Campylobacter jejuni transcriptional regulator Cj1556 plays a role in the oxidative and aerobic stress response and is important for bacterial survival in vivo. J Bacteriol 193:4238-49. 88. Gunther, C., H. Neumann, M. F. Neurath, and C. Becker. 2013. Apoptosis, necrosis and necroptosis: cell death regulation in the intestinal epithelium. Gut 62:1062-71. 89. Harriman, J. F., X. L. Liu, M. D. Aleo, K. Machaca, and R. G. Schnellmann. 2002. Endoplasmic reticulum Ca(2+) signaling and calpains mediate renal cell death. Cell Death Differ 9:734-41. 122  90. Hartley-Tassell, L. E., L. K. Shewell, C. J. Day, J. C. Wilson, R. Sandhu, J. M. Ketley, and V. Korolik. 2010. Identification and characterization of the aspartate chemosensory receptor of Campylobacter jejuni. Mol Microbiol 75:710-30. 91. Hatzios, S. K., and C. R. Bertozzi. 2011. The regulation of sulfur metabolism in Mycobacterium tuberculosis. PLoS Pathog 7:e1002036. 92. Hendrixson, D. R., B. J. Akerley, and V. J. DiRita. 2001. Transposon mutagenesis of Campylobacter jejuni identifies a bipartite energy taxis system required for motility. Mol Microbiol 40:214-24. 93. Hendrixson, D. R., and V. J. DiRita. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol Microbiol 52:471-84. 94. Heuvelink, A. E., C. van Heerwaarden, A. Zwartkruis-Nahuis, J. J. Tilburg, M. H. Bos, F. G. Heilmann, A. Hofhuis, T. Hoekstra, and E. de Boer. 2009. Two outbreaks of campylobacteriosis associated with the consumption of raw cows' milk. Int J Food Microbiol 134:70-4. 95. Hickey, T. E., A. L. McVeigh, D. A. Scott, R. E. Michielutti, A. Bixby, S. A. Carroll, A. L. Bourgeois, and P. Guerry. 2000. Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun 68:6535-41. 96. Hirst, J., M. S. King, and K. R. Pryde. 2008. The production of reactive oxygen species by complex I. Biochem Soc Trans 36:976-80. 97. Hitchcock, A., S. J. Hall, J. D. Myers, F. Mulholland, M. A. Jones, and D. J. Kelly. 2010. Roles of the twin-arginine translocase and associated chaperones in the biogenesis of the electron transport chains of the human pathogen Campylobacter jejuni. Microbiology 156:2994-3010. 98. Hoffman, P. S., and T. G. Goodman. 1982. Respiratory physiology and energy conservation efficiency of Campylobacter jejuni. J Bacteriol 150:319-26. 99. Hofreuter, D., J. Mohr, O. Wensel, S. Rademacher, K. Schreiber, D. Schomburg, B. Gao, and J. E. Galan. 2012. Contribution of amino acid catabolism to the tissue specific persistence of Campylobacter jejuni in a murine colonization model. PLoS One 7:e50699. 100. Holmes, C. W., C. W. Penn, and P. A. Lund. 2010. The hrcA and hspR regulons of Campylobacter jejuni. Microbiology 156:158-66. 101. Honer zu Bentrup, K., and D. G. Russell. 2001. Mycobacterial persistence: adaptation to a changing environment. Trends Microbiol 9:597-605. 102. Hugdahl, M. B., J. T. Beery, and M. P. Doyle. 1988. Chemotactic behavior of Campylobacter jejuni. Infect Immun 56:1560-6. 103. Hughes, N. J., C. L. Clayton, P. A. Chalk, and D. J. Kelly. 1998. Helicobacter pylori porCDAB and oorDABC genes encode distinct pyruvate:flavodoxin and 2-oxoglutarate:acceptor oxidoreductases which mediate electron transport to NADP. J Bacteriol 180:1119-28. 104. Hughes, R. A., and D. R. Cornblath. 2005. Guillain-Barre syndrome. Lancet 366:1653-66. 105. Huizinga, R., W. van Rijs, J. J. Bajramovic, M. L. Kuijf, J. D. Laman, J. N. Samsom, and B. C. Jacobs. 2013. Sialylation of Campylobacter jejuni endotoxin promotes dendritic cell-mediated B cell responses through CD14-dependent production of IFN-beta and TNF-alpha. J Immunol 191:5636-45. 106. Hwang, S., M. Kim, S. Ryu, and B. Jeon. 2011. Regulation of oxidative stress response by CosR, an essential response regulator in Campylobacter jejuni. PLoS One 6:e22300. 107. Hwang, S., Q. Zhang, S. Ryu, and B. Jeon. 2012. Transcriptional regulation of the CmeABC multidrug efflux pump and the KatA catalase by CosR in Campylobacter jejuni. J Bacteriol 194:6883-91. 108. Ikeuchi, Y., N. Shigi, J. Kato, A. Nishimura, and T. Suzuki. 2006. Mechanistic insights into sulfur relay by multiple sulfur mediators involved in thiouridine biosynthesis at tRNA wobble positions. Mol Cell 21:97-108. 123  109. Imlay, J. A. 2006. Iron-sulphur clusters and the problem with oxygen. Mol Microbiol 59:1073-82. 110. Imlay, J. A. 1995. A metabolic enzyme that rapidly produces superoxide, fumarate reductase of Escherichia coli. J Biol Chem 270:19767-77. 111. Imlay, J. A. 2013. The molecular mechanisms and physiological consequences of oxidative stress: lessons from a model bacterium. Nat Rev Microbiol 11:443-54. 112. Ishikawa, T., Y. Mizunoe, S. Kawabata, A. Takade, M. Harada, S. N. Wai, and S. Yoshida. 2003. The iron-binding protein Dps confers hydrogen peroxide stress resistance to Campylobacter jejuni. J Bacteriol 185:1010-7. 113. Iwata, T., K. Chiku, K. Amano, M. Kusumoto, M. Ohnishi-Kameyama, H. Ono, and M. Akiba. 2013. Effects of lipooligosaccharide inner core truncation on bile resistance and chick colonization by Campylobacter jejuni. PLoS One 8:e56900. 114. Jackson, B. R., J. A. Zegarra, H. Lopez-Gatell, J. Sejvar, F. Arzate, S. Waterman, A. S. Nunez, B. Lopez, J. Weiss, R. Q. Cruz, D. Y. Murrieta, R. Luna-Gierke, K. Heiman, A. R. Vieira, C. Fitzgerald, P. Kwan, M. Zarate-Bermudez, D. Talkington, V. R. Hill, and B. Mahon. 2013. Binational outbreak of Guillain-Barre syndrome associated with Campylobacter jejuni infection, Mexico and USA, 2011. Epidemiol Infect:1-11. 115. Jackson, R. J., K. T. Elvers, L. J. Lee, M. D. Gidley, L. M. Wainwright, J. Lightfoot, S. F. Park, and R. K. Poole. 2007. Oxygen reactivity of both respiratory oxidases in Campylobacter jejuni: the cydAB genes encode a cyanide-resistant, low-affinity oxidase that is not of the cytochrome bd type. J Bacteriol 189:1604-15. 116. Jacobson, J., and M. R. Duchen. 2002. Mitochondrial oxidative stress and cell death in astrocytes--requirement for stored Ca2+ and sustained opening of the permeability transition pore. J Cell Sci 115:1175-88. 117. Javed, M. A., A. J. Grant, M. C. Bagnall, D. J. Maskell, D. G. Newell, and G. Manning. 2010. Transposon mutagenesis in a hyper-invasive clinical isolate of Campylobacter jejuni reveals a number of genes with potential roles in invasion. Microbiology 156:1134-43. 118. Jay-Russell, M. T., R. E. Mandrell, J. Yuan, A. Bates, R. Manalac, J. Mohle-Boetani, A. Kimura, J. Lidgard, and W. G. Miller. 2013. Using major outer membrane protein typing as an epidemiological tool to investigate outbreaks caused by milk-borne Campylobacter jejuni isolates in California. J Clin Microbiol 51:195-201. 119. Johnson, W. M., and H. Lior. 1988. A new heat-labile cytolethal distending toxin (CLDT) produced by Campylobacter spp. Microb Pathog 4:115-26. 120. Juven, B. J., and J. Kanner. 1986. Effect of ascorbic, isoascorbic and dehydroascorbic acids on the growth and survival of Campylobacter jejuni. J Appl Bacteriol 61:339-45. 121. Kaakoush, N. O., M. Raftery, and G. L. Mendz. 2008. Molecular responses of Campylobacter jejuni to cadmium stress. FEBS J 275:5021-33. 122. Kaiser, W. J., H. Sridharan, C. Huang, P. Mandal, J. W. Upton, P. J. Gough, C. A. Sehon, R. W. Marquis, J. Bertin, and E. S. Mocarski. 2013. Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL. J Biol Chem 288:31268-79. 123. Kalischuk, L. D., G. D. Inglis, and A. G. Buret. 2007. Strain-dependent induction of epithelial cell oncosis by Campylobacter jejuni is correlated with invasion ability and is independent of cytolethal distending toxin. Microbiology 153:2952-63. 124. Kargalioglu, Y., and J. A. Imlay. 1994. Importance of anaerobic superoxide dismutase synthesis in facilitating outgrowth of Escherichia coli upon entry into an aerobic habitat. J Bacteriol 176:7653-8. 125. Karlyshev, A. V., and B. W. Wren. 2005. Development and application of an insertional system for gene delivery and expression in Campylobacter jejuni. Appl Environ Microbiol 71:4004-13. 124  126. Karmali, M. A., and P. C. Fleming. 1979. Campylobacter enteritis in children. J Pediatr 94:527-33. 127. Kassem, II, M. Khatri, M. A. Esseili, Y. M. Sanad, Y. M. Saif, J. W. Olson, and G. Rajashekara. 2012. Respiratory proteins contribute differentially to Campylobacter jejuni's survival and in vitro interaction with hosts' intestinal cells. BMC Microbiol 12:258. 128. Kassem, II, M. Khatri, Y. M. Sanad, M. Wolboldt, Y. M. Saif, J. W. Olson, and G. Rajashekara. 2014. The impairment of methylmenaquinol:fumarate reductase affects hydrogen peroxide susceptibility and accumulation in Campylobacter jejuni. Microbiologyopen. 129. Katoh, E., T. Hatta, H. Shindo, Y. Ishii, H. Yamada, T. Mizuno, and T. Yamazaki. 2000. High precision NMR structure of YhhP, a novel Escherichia coli protein implicated in cell division. J Mol Biol 304:219-29. 130. Kendall, E. J., and E. I. Tanner. 1982. Campylobacter enteritis in general practice. J Hyg (Lond) 88:155-63. 131. Kendall, J. J., A. M. Barrero-Tobon, D. R. Hendrixson, and D. J. Kelly. 2013. Hemerythrins in the microaerophilic bacterium Campylobacter jejuni help protect key iron-sulphur cluster enzymes from oxidative damage. Environ Microbiol. 132. Keo, T., J. Collins, P. Kunwar, M. J. Blaser, and N. M. Iovine. 2011. Campylobacter capsule and lipooligosaccharide confer resistance to serum and cationic antimicrobials. Virulence 2:30-40. 133. Ketley, J. M. 1997. Pathogenesis of enteric infection by Campylobacter. Microbiology 143 ( Pt 1):5-21. 134. Khangulov, S. V., V. N. Gladyshev, G. C. Dismukes, and T. C. Stadtman. 1998. Selenium-containing formate dehydrogenase H from Escherichia coli: a molybdopterin enzyme that catalyzes formate oxidation without oxygen transfer. Biochemistry 37:3518-28. 135. Kim, Y. S., M. J. Morgan, S. Choksi, and Z. G. Liu. 2007. TNF-induced activation of the Nox1 NADPH oxidase and its role in the induction of necrotic cell death. Mol Cell 26:675-87. 136. Kirkpatrick, B. D., and D. R. Tribble. 2011. Update on human Campylobacter jejuni infections. Curr Opin Gastroenterol 27:1-7. 137. Koidis, P., and M. P. Doyle. 1983. Survival of Campylobacter jejuni in the presence of bisulfite and different atmospheres. Eur J Clin Microbiol 2:384-8. 138. Konkel, M. E., J. E. Christensen, A. M. Keech, M. R. Monteville, J. D. Klena, and S. G. Garvis. 2005. Identification of a fibronectin-binding domain within the Campylobacter jejuni CadF protein. Mol Microbiol 57:1022-35. 139. Konkel, M. E., S. G. Garvis, S. L. Tipton, D. E. Anderson, Jr., and W. Cieplak, Jr. 1997. Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol Microbiol 24:953-63. 140. Konkel, M. E., S. F. Hayes, L. A. Joens, and W. Cieplak, Jr. 1992. Characteristics of the internalization and intracellular survival of Campylobacter jejuni in human epithelial cell cultures. Microb Pathog 13:357-70. 141. Korlath, J. A., M. T. Osterholm, L. A. Judy, J. C. Forfang, and R. A. Robinson. 1985. A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J Infect Dis 152:592-6. 142. Korshunov, S., and J. A. Imlay. 2006. Detection and quantification of superoxide formed within the periplasm of Escherichia coli. J Bacteriol 188:6326-34. 143. Korshunov, S., and J. A. Imlay. 2010. Two sources of endogenous hydrogen peroxide in Escherichia coli. Mol Microbiol 75:1389-401. 144. Kownhar, H., E. M. Shankar, R. Rajan, A. Vengatesan, and U. A. Rao. 2007. Prevalence of Campylobacter jejuni and enteric bacterial pathogens among hospitalized HIV infected versus non-HIV infected patients with diarrhoea in southern India. Scand J Infect Dis 39:862-6. 125  145. Krause-Gruszczynska, M., M. Boehm, M. Rohde, N. Tegtmeyer, S. Takahashi, L. Buday, O. A. Oyarzabal, and S. Backert. 2011. The signaling pathway of Campylobacter jejuni-induced Cdc42 activation: Role of fibronectin, integrin beta1, tyrosine kinases and guanine exchange factor Vav2. Cell Commun Signal 9:32. 146. Kuijf, M. L., J. N. Samsom, W. van Rijs, M. Bax, R. Huizinga, A. P. Heikema, P. A. van Doorn, A. van Belkum, Y. van Kooyk, P. C. Burgers, T. M. Luider, H. P. Endtz, E. E. Nieuwenhuis, and B. C. Jacobs. 2010. TLR4-mediated sensing of Campylobacter jejuni by dendritic cells is determined by sialylation. J Immunol 185:748-55. 147. Kussmaul, L., and J. Hirst. 2006. The mechanism of superoxide production by NADH:ubiquinone oxidoreductase (complex I) from bovine heart mitochondria. Proc Natl Acad Sci U S A 103:7607-12. 148. Labbe, K., and M. Saleh. 2008. Cell death in the host response to infection. Cell Death Differ 15:1339-49. 149. Lai, Y., K. Riley, A. Cai, J. M. Leong, and I. M. Herman. 2011. Calpain mediates epithelial cell microvillar effacement by enterohemorrhagic Escherichia coli. Front Microbiol 2:222. 150. Lambeth, J. D., and A. S. Neish. 2014. Nox enzymes and new thinking on reactive oxygen: a double-edged sword revisited. Annu Rev Pathol 9:119-45. 151. Lamkanfi, M., and V. M. Dixit. 2010. Manipulation of host cell death pathways during microbial infections. Cell Host Microbe 8:44-54. 152. Laster, S. M., J. G. Wood, and L. R. Gooding. 1988. Tumor necrosis factor can induce both apoptic and necrotic forms of cell lysis. J Immunol 141:2629-34. 153. Lebart, M. C., and Y. Benyamin. 2006. Calpain involvement in the remodeling of cytoskeletal anchorage complexes. FEBS J 273:3415-26. 154. Lee, I. T., and C. M. Yang. 2012. Role of NADPH oxidase/ROS in pro-inflammatory mediators-induced airway and pulmonary diseases. Biochem Pharmacol 84:581-90. 155. Lee, M. H., R. M. Smibert, and N. R. Krieg. 1988. Effect of incubation temperature, ageing, and bisulfite content of unsupplemented Brucella agar on aerotolerance of Campylobacter jejuni. Can J Microbiol 34:1069-74. 156. Lertsethtakarn, P., K. M. Ottemann, and D. R. Hendrixson. 2011. Motility and chemotaxis in Campylobacter and Helicobacter. Annu Rev Microbiol 65:389-410. 157. Lin, A. E., K. Krastel, R. I. Hobb, S. A. Thompson, D. G. Cvitkovitch, and E. C. Gaynor. 2009. Atypical roles for Campylobacter jejuni amino acid ATP binding cassette transporter components PaqP and PaqQ in bacterial stress tolerance and pathogen-host cell dynamics. Infect Immun 77:4912-24. 158. Lipinski, S., A. Till, C. Sina, A. Arlt, H. Grasberger, S. Schreiber, and P. Rosenstiel. 2009. DUOX2-derived reactive oxygen species are effectors of NOD2-mediated antibacterial responses. J Cell Sci 122:3522-30. 159. Liu, X., B. Gao, V. Novik, and J. E. Galan. 2012. Quantitative Proteomics of Intracellular Campylobacter jejuni Reveals Metabolic Reprogramming. PLoS Pathog 8:e1002562. 160. Liu, X., and R. G. Schnellmann. 2003. Calpain mediates progressive plasma membrane permeability and proteolysis of cytoskeleton-associated paxillin, talin, and vinculin during renal cell death. J Pharmacol Exp Ther 304:63-70. 161. Liu, X., T. Van Vleet, and R. G. Schnellmann. 2004. The role of calpain in oncotic cell death. Annu Rev Pharmacol Toxicol 44:349-70. 162. Liu, Y. W., K. Denkmann, K. Kosciow, C. Dahl, and D. J. Kelly. 2013. Tetrathionate stimulated growth of Campylobacter jejuni identifies a new type of bi-functional tetrathionate reductase (TsdA) that is widely distributed in bacteria. Mol Microbiol 88:173-88. 126  163. Loffler, B., L. Tuchscherr, S. Niemann, and G. Peters. 2014. Staphylococcus aureus persistence in non-professional phagocytes. Int J Med Microbiol 304:170-6. 164. Lothrop, A. P., G. W. Snider, E. L. Ruggles, A. S. Patel, W. J. Lees, and R. J. Hondal. 2014. Selenium as an electron acceptor during the catalytic mechanism of thioredoxin reductase. Biochemistry 53:654-63. 165. Lucchini, S., H. Liu, Q. Jin, J. C. Hinton, and J. Yu. 2005. Transcriptional adaptation of Shigella flexneri during infection of macrophages and epithelial cells: insights into the strategies of a cytosolic bacterial pathogen. Infect Immun 73:88-102. 166. MacKichan, J. K., E. C. Gaynor, C. Chang, S. Cawthraw, D. G. Newell, J. F. Miller, and S. Falkow. 2004. The Campylobacter jejuni dccRS two-component system is required for optimal in vivo colonization but is dispensable for in vitro growth. Mol Microbiol 54:1269-86. 167. Magee, E. A., C. J. Richardson, R. Hughes, and J. H. Cummings. 2000. Contribution of dietary protein to sulfide production in the large intestine: an in vitro and a controlled feeding study in humans. Am J Clin Nutr 72:1488-94. 168. Mahdavi, J., N. Pirinccioglu, N. J. Oldfield, E. Carlsohn, J. Stoof, A. Aslam, T. Self, S. A. Cawthraw, L. Petrovska, N. Colborne, C. Sihlbom, T. Boren, K. G. Wooldridge, and D. A. Ala'Aldeen. 2014. A novel O-linked glycan modulates Campylobacter jejuni major outer membrane protein-mediated adhesion to human histo-blood group antigens and chicken colonization. Open Biol 4:130202. 169. Malik-Kale, P., B. H. Raphael, C. T. Parker, L. A. Joens, J. D. Klena, B. Quinones, A. M. Keech, and M. E. Konkel. 2007. Characterization of genetically matched isolates of Campylobacter jejuni reveals that mutations in genes involved in flagellar biosynthesis alter the organism's virulence potential. Appl Environ Microbiol 73:3123-36. 170. Malik-Kale, P., B. H. Raphael, C. T. Parker, L. A. Joens, J. D. Klena, B. Quinones, A. M. Keech, and M. E. Konkel. 2007. Characterization of genetically matched isolates of Campylobacter jejuni reveals that mutations in genes involved in flagellar biosynthesis alter the organism's virulence potential. Applied and Environmental Microbiology 73:3123-3136. 171. Malik, A., D. Sharma, J. St Charles, L. A. Dybas, and L. S. Mansfield. 2013. Contrasting immune responses mediate Campylobacter jejuni-induced colitis and autoimmunity. Mucosal Immunol. 172. Marcato, L. G., A. P. Ferlini, R. C. Bonfim, M. L. Ramos-Jorge, C. Ropert, L. F. Afonso, L. Q. Vieira, and A. P. Sobrinho. 2008. The role of Toll-like receptors 2 and 4 on reactive oxygen species and nitric oxide production by macrophage cells stimulated with root canal pathogens. Oral Microbiol Immunol 23:353-9. 173. Marchler-Bauer, A., S. Lu, J. B. Anderson, F. Chitsaz, M. K. Derbyshire, C. DeWeese-Scott, J. H. Fong, L. Y. Geer, R. C. Geer, N. R. Gonzales, M. Gwadz, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, F. Lu, G. H. Marchler, M. Mullokandov, M. V. Omelchenko, C. L. Robertson, J. S. Song, N. Thanki, R. A. Yamashita, D. Zhang, N. Zhang, C. Zheng, and S. H. Bryant. 2011. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 39:D225-9. 174. Marshall, B. J., and J. R. Warren. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1:1311-5. 175. Matson, E. G., X. Zhang, and J. R. Leadbetter. 2010. Selenium controls transcription of paralogous formate dehydrogenase genes in the termite gut acetogen, Treponema primitia. Environ Microbiol 12:2245-58. 176. Mattheus, W., N. Botteldoorn, K. Heylen, B. Pochet, and K. Dierick. 2012. Trend analysis of antimicrobial resistance in Campylobacter jejuni and Campylobacter coli isolated from Belgian pork and poultry meat products using surveillance data of 2004-2009. Foodborne Pathog Dis 9:465-72. 127  177. Mattos, K. A., V. C. Oliveira, M. Berredo-Pinho, J. J. Amaral, L. C. Antunes, R. C. Melo, C. C. Acosta, D. F. Moura, R. Olmo, J. Han, P. S. Rosa, P. E. Almeida, B. B. Finlay, C. H. Borchers, E. N. Sarno, P. T. Bozza, G. C. Atella, and M. C. Pessolani. 2014. Mycobacterium leprae intracellular survival relies on cholesterol accumulation in infected macrophages: a potential target for new drugs for leprosy treatment. Cell Microbiol. 178. McCarthy, N. D., I. A. Gillespie, A. J. Lawson, J. Richardson, K. R. Neal, P. R. Hawtin, M. C. Maiden, and S. J. O'Brien. 2012. Molecular epidemiology of human Campylobacter jejuni shows association between seasonal and international patterns of disease. Epidemiol Infect 140:2247-55. 179. McDermott, P. F., S. M. Bodeis, L. L. English, D. G. White, R. D. Walker, S. Zhao, S. Simjee, and D. D. Wagner. 2002. Ciprofloxacin resistance in Campylobacter jejuni evolves rapidly in chickens treated with fluoroquinolones. J Infect Dis 185:837-40. 180. Menino, J. F., M. Saraiva, J. Gomes-Rezende, M. Sturme, J. Pedrosa, A. G. Castro, P. Ludovico, G. H. Goldman, and F. Rodrigues. 2013. P. brasiliensis virulence is affected by SconC, the negative regulator of inorganic sulfur assimilation. PLoS One 8:e74725. 181. Messner, K. R., and J. A. Imlay. 1999. The identification of primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli. J Biol Chem 274:10119-28. 182. Messner, K. R., and J. A. Imlay. 2002. Mechanism of superoxide and hydrogen peroxide formation by fumarate reductase, succinate dehydrogenase, and aspartate oxidase. J Biol Chem 277:42563-71. 183. Mischek, D., and C. Krapfenbauer-Cermak. 2012. Exposure assessment of food preservatives (sulphites, benzoic and sorbic acid) in Austria. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 29:371-82. 184. Mitsuhashi, H., Y. Nojima, T. Tanaka, K. Ueki, A. Maezawa, S. Yano, and T. Naruse. 1998. Sulfite is released by human neutrophils in response to stimulation with lipopolysaccharide. J Leukoc Biol 64:595-9. 185. Miyano, K., and H. Sumimoto. 2012. Assessment of the role for Rho family GTPases in NADPH oxidase activation. Methods Mol Biol 827:195-212. 186. Miyoshi, H., K. Umeshita, M. Sakon, S. Imajoh-Ohmi, K. Fujitani, M. Gotoh, E. Oiki, J. Kambayashi, and M. Monden. 1996. Calpain activation in plasma membrane bleb formation during tert-butyl hydroperoxide-induced rat hepatocyte injury. Gastroenterology 110:1897-904. 187. Mnatsakanyan, N., A. Vassilian, L. Navasardyan, K. Bagramyan, and A. Trchounian. 2002. Regulation of Escherichia coli formate hydrogenlyase activity by formate at alkaline pH. Curr Microbiol 45:281-6. 188. Moore, J. E., D. Corcoran, J. S. Dooley, S. Fanning, B. Lucey, M. Matsuda, D. A. McDowell, F. Megraud, B. C. Millar, R. O'Mahony, L. O'Riordan, M. O'Rourke, J. R. Rao, P. J. Rooney, A. Sails, and P. Whyte. 2005. Campylobacter. Vet Res 36:351-82. 189. Morooka, T., A. Umeda, and K. Amako. 1985. Motility as an intestinal colonization factor for Campylobacter jejuni. J Gen Microbiol 131:1973-80. 190. Mortensen, N. P., P. Schiellerup, N. Boisen, B. M. Klein, H. Locht, M. Abuoun, D. Newell, and K. A. Krogfelt. 2011. The role of Campylobacter jejuni cytolethal distending toxin in gastroenteritis: toxin detection, antibody production, and clinical outcome. APMIS 119:626-34. 191. Moser, I., W. Schroeder, and J. Salnikow. 1997. Campylobacter jejuni major outer membrane protein and a 59-kDa protein are involved in binding to fibronectin and INT 407 cell membranes. FEMS Microbiol Lett 157:233-8. 128  192. Mougous, J. D., M. D. Leavell, R. H. Senaratne, C. D. Leigh, S. J. Williams, L. W. Riley, J. A. Leary, and C. R. Bertozzi. 2002. Discovery of sulfated metabolites in mycobacteria with a genetic and mass spectrometric approach. Proc Natl Acad Sci U S A 99:17037-42. 193. Mougous, J. D., C. J. Petzold, R. H. Senaratne, D. H. Lee, D. L. Akey, F. L. Lin, S. E. Munchel, M. R. Pratt, L. W. Riley, J. A. Leary, J. M. Berger, and C. R. Bertozzi. 2004. Identification, function and structure of the mycobacterial sulfotransferase that initiates sulfolipid-1 biosynthesis. Nat Struct Mol Biol 11:721-9. 194. Mukhopadhya, I., J. M. Thomson, R. Hansen, S. H. Berry, E. M. El-Omar, and G. L. Hold. 2011. Detection of Campylobacter concisus and other Campylobacter species in colonic biopsies from adults with ulcerative colitis. PLoS One 6:e21490. 195. Mukhopadhyay, S., S. Nair, and S. Ghosh. 2011. Pathogenesis in tuberculosis: transcriptomic approaches to unraveling virulence mechanisms and finding new drug targets. FEMS Microbiol Rev. 196. Myers, J. D., and D. J. Kelly. 2005. A sulphite respiration system in the chemoheterotrophic human pathogen Campylobacter jejuni. Microbiology 151:233-42. 197. Nachamkin I, B. M. 2000. Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations. ASM Press, Washington, DC  198. Nachamkin, I., X. H. Yang, and N. J. Stern. 1993. Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar mutants. Appl Environ Microbiol 59:1269-73. 199. Naito, M., E. Frirdich, J. A. Fields, M. Pryjma, J. Li, A. Cameron, M. Gilbert, S. A. Thompson, and E. C. Gaynor. 2010. Effects of sequential Campylobacter jejuni 81-176 lipooligosaccharide core truncations on biofilm formation, stress survival, and pathogenesis. J Bacteriol 192:2182-92. 200. Nakagawa, S., Y. Takaki, S. Shimamura, A. L. Reysenbach, K. Takai, and K. Horikoshi. 2007. Deep-sea vent epsilon-proteobacterial genomes provide insights into emergence of pathogens. Proc Natl Acad Sci U S A 104:12146-50. 201. Nakamura, T., Y. Kon, H. Iwahashi, and Y. Eguchi. 1983. Evidence that thiosulfate assimilation by Salmonella typhimurium is catalyzed by cysteine synthase B. J Bacteriol 156:656-62. 202. Nathues, C., P. Gruning, A. Fruth, J. Verspohl, T. Blaha, L. Kreienbrock, and R. Merle. 2013. Campylobacter spp., Yersinia enterocolitica, and Salmonella enterica and their simultaneous occurrence in German fattening pig herds and their environment. J Food Prot 76:1704-11. 203. Neal-McKinney, J. M., and M. E. Konkel. 2012. The Campylobacter jejuni CiaC virulence protein is secreted from the flagellum and delivered to the cytosol of host cells. Front Cell Infect Microbiol 2:31. 204. Nelson, W., and B. Harris. 2011. Campylobacteriosis rates show age-related static bimodal and seasonality trends. N Z Med J 124:33-9. 205. Newell, D. G., H. McBride, and J. M. Dolby. 1985. Investigations on the role of flagella in the colonization of infant mice with Campylobacter jejuni and attachment of Campylobacter jejuni to human epithelial cell lines. J Hyg (Lond) 95:217-27. 206. Newell, D. G., and A. Pearson. 1984. The invasion of epithelial cell lines and the intestinal epithelium of infant mice by Campylobacter jejuni/coli. J Diarrhoeal Dis Res 2:19-26. 207. Noinaj, N., R. Wattanasak, D. Y. Lee, J. L. Wally, G. Piszczek, P. B. Chock, T. C. Stadtman, and S. K. Buchanan. 2012. Structural insights into the catalytic mechanism of Escherichia coli selenophosphate synthetase. J Bacteriol 194:499-508. 208. Norberg, P. 1981. Enteropathogenic bacteria in frozen chicken. Appl Environ Microbiol 42:32-4. 209. Novik, V., D. Hofreuter, and J. E. Galan. 2010. Identification of Campylobacter jejuni genes involved in its interaction with epithelial cells. Infect Immun 78:3540-53. 129  210. Oh, J. I., and B. Bowien. 1999. Dual control by regulatory gene fdsR of the fds operon encoding the NAD+-linked formate dehydrogenase of Ralstonia eutropha. Mol Microbiol 34:365-76. 211. Olofsson, J., D. Axelsson-Olsson, L. Brudin, B. Olsen, and P. Ellstrom. 2013. Campylobacter jejuni actively invades the amoeba Acanthamoeba polyphaga and survives within non digestive vacuoles. PLoS One 8:e78873. 212. Ounissi, H., E. Derlot, C. Carlier, and P. Courvalin. 1990. Gene homogeneity for aminoglycoside-modifying enzymes in gram-positive cocci. Antimicrob Agents Chemother 34:2164-8. 213. Pajaniappan, M., J. E. Hall, S. A. Cawthraw, D. G. Newell, E. C. Gaynor, J. A. Fields, K. M. Rathbun, W. A. Agee, C. M. Burns, S. J. Hall, D. J. Kelly, and S. A. Thompson. 2008. A temperature-regulated Campylobacter jejuni gluconate dehydrogenase is involved in respiration-dependent energy conservation and chicken colonization. Mol Microbiol 68:474-91. 214. Palyada, K., Y. Q. Sun, A. Flint, J. Butcher, H. Naikare, and A. Stintzi. 2009. Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni. BMC Genomics 10:481. 215. Palyada, K., D. Threadgill, and A. Stintzi. 2004. Iron acquisition and regulation in Campylobacter jejuni. J Bacteriol 186:4714-29. 216. Pandey, A. K., and C. M. Sassetti. 2008. Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci U S A 105:4376-80. 217. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Rajandream, K. M. Rutherford, A. H. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665-8. 218. Partridge, J. D., C. Scott, Y. Tang, R. K. Poole, and J. Green. 2006. Escherichia coli transcriptome dynamics during the transition from anaerobic to aerobic conditions. J Biol Chem 281:27806-15. 219. Perrin, B. J., and A. Huttenlocher. 2002. Calpain. Int J Biochem Cell Biol 34:722-5. 220. Pesci, E. C., D. L. Cottle, and C. L. Pickett. 1994. Genetic, enzymatic, and pathogenic studies of the iron superoxide dismutase of Campylobacter jejuni. Infect Immun 62:2687-94. 221. Petti, A. A., R. S. McIsaac, O. Ho-Shing, H. J. Bussemaker, and D. Botstein. 2012. Combinatorial control of diverse metabolic and physiological functions by transcriptional regulators of the yeast sulfur assimilation pathway. Mol Biol Cell 23:3008-24. 222. Pigrau, C., R. Bartolome, B. Almirante, A. M. Planes, J. Gavalda, and A. Pahissa. 1997. Bacteremia due to Campylobacter species: clinical findings and antimicrobial susceptibility patterns. Clin Infect Dis 25:1414-20. 223. Pinto, R., Q. X. Tang, W. J. Britton, T. S. Leyh, and J. A. Triccas. 2004. The Mycobacterium tuberculosis cysD and cysNC genes form a stress-induced operon that encodes a tri-functional sulfate-activating complex. Microbiology 150:1681-6. 224. Pitkanen, T., T. Pettersson, A. Ponka, and T. U. Kosunen. 1981. Clinical and serological studies in patients with Campylobacter fetus ssp. jejuni infection: I. Clinical findings. Infection 9:274-8. 225. Pittman, M. S., and D. J. Kelly. 2005. Electron transport through nitrate and nitrite reductases in Campylobacter jejuni. Biochem Soc Trans 33:190-2. 226. Pohanka, M. 2013. Role of oxidative stress in infectious diseases. A review. Folia Microbiol (Praha) 58:503-13. 227. Poly, F., D. Threadgill, and A. Stintzi. 2005. Genomic diversity in Campylobacter jejuni: identification of C. jejuni 81-176-specific genes. J Clin Microbiol 43:2330-8. 228. Poyton, R. O., K. A. Ball, and P. R. Castello. 2009. Mitochondrial generation of free radicals and hypoxic signaling. Trends Endocrinol Metab 20:332-40. 130  229. Pryjma, M., D. Apel, S. Huynh, C. T. Parker, and E. C. Gaynor. 2012. FdhTU-modulated formate dehydrogenase expression and electron donor availability enhance recovery of Campylobacter jejuni following host cell infection. J Bacteriol 194:3803-13. 230. Punchard, N. A., S. M. Greenfield, and R. P. Thompson. 1992. Mechanism of action of 5-arninosalicylic acid. Mediators Inflamm 1:151-65. 231. Purdy, D., and S. F. Park. 1994. Cloning, nucleotide sequence and characterization of a gene encoding superoxide dismutase from Campylobacter jejuni and Campylobacter coli. Microbiology 140 ( Pt 5):1203-8. 232. Quesada-Vincens, D., M. Hanin, W. J. Broughton, and S. Jabbouri. 1998. In vitro sulfotransferase activity of NoeE, a nodulation protein of Rhizobium sp. NGR234. Mol Plant Microbe Interact 11:592-600. 233. Rathinam, V. A., D. M. Appledorn, K. A. Hoag, A. Amalfitano, and L. S. Mansfield. 2009. Campylobacter jejuni-induced activation of dendritic cells involves cooperative signaling through Toll-like receptor 4 (TLR4)-MyD88 and TLR4-TRIF axes. Infect Immun 77:2499-507. 234. Reid, A. N., R. Pandey, K. Palyada, H. Naikare, and A. Stintzi. 2008. Identification of Campylobacter jejuni genes involved in the response to acidic pH and stomach transit. Appl Environ Microbiol 74:1583-97. 235. Ritz, M., A. Garenaux, M. Berge, and M. Federighi. 2009. Determination of rpoA as the most suitable internal control to study stress response in C. jejuni by RT-qPCR and application to oxidative stress. J Microbiol Methods 76:196-200. 236. Roca, F. J., and L. Ramakrishnan. 2013. TNF dually mediates resistance and susceptibility to mycobacteria via mitochondrial reactive oxygen species. Cell 153:521-34. 237. Rose, A., E. Kay, B. W. Wren, and M. J. Dallman. 2012. The Campylobacter jejuni NCTC11168 capsule prevents excessive cytokine production by dendritic cells. Med Microbiol Immunol 201:137-44. 238. Russell, R. G., M. O'Donnoghue, D. C. Blake, Jr., J. Zulty, and L. J. DeTolla. 1993. Early colonic damage and invasion of Campylobacter jejuni in experimentally challenged infant Macaca mulatta. J Infect Dis 168:210-5. 239. Sahin, O., T. Y. Morishita, and Q. Zhang. 2002. Campylobacter colonization in poultry: sources of infection and modes of transmission. Anim Health Res Rev 3:95-105. 240. Schmitz, R. P., and G. Diekert. 2003. Purification and properties of the formate dehydrogenase and characterization of the fdhA gene of Sulfurospirillum multivorans. Arch Microbiol 180:394-401. 241. Schnappinger, D., S. Ehrt, M. I. Voskuil, Y. Liu, J. A. Mangan, I. M. Monahan, G. Dolganov, B. Efron, P. D. Butcher, C. Nathan, and G. K. Schoolnik. 2003. Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. J Exp Med 198:693-704. 242. Schoborg, R. V. 2011. Chlamydia persistence -- a tool to dissect chlamydia--host interactions. Microbes Infect 13:649-62. 243. Schonberg-Norio, D., L. Mattila, A. Lauhio, M. L. Katila, S. S. Kaukoranta, M. Koskela, S. Pajarre, J. Uksila, E. Eerola, S. Sarna, and H. Rautelin. 2010. Patient-reported complications associated with Campylobacter jejuni infection. Epidemiol Infect 138:1004-11. 244. Schulze-Osthoff, K., A. C. Bakker, B. Vanhaesebroeck, R. Beyaert, W. A. Jacob, and W. Fiers. 1992. Cytotoxic activity of tumor necrosis factor is mediated by early damage of mitochondrial functions. Evidence for the involvement of mitochondrial radical generation. J Biol Chem 267:5317-23. 245. Seaver, L. C., and J. A. Imlay. 2004. Are respiratory enzymes the primary sources of intracellular hydrogen peroxide? J Biol Chem 279:48742-50. 131  246. Sellars, M. J., S. J. Hall, and D. J. Kelly. 2002. Growth of Campylobacter jejuni supported by respiration of fumarate, nitrate, nitrite, trimethylamine-N-oxide, or dimethyl sulfoxide requires oxygen. J Bacteriol 184:4187-96. 247. Shaw FL, M. F., Le Gall G, Porcelli I, Hart DJ, Pearson BM, van Vliet AHM. Submitted. Selenium-dependent biogenesis of formate dehydrogenase in Campylobacter jejuni is controlled by the fdhTU accessory genes. J. Bacteriol. 248. Shi, Y., V. Y. Melnikov, R. W. Schrier, and C. L. Edelstein. 2000. Downregulation of the calpain inhibitor protein calpastatin by caspases during renal ischemia-reperfusion. Am J Physiol Renal Physiol 279:F509-17. 249. Shuguo, H., Z. Wei, Z. Chao, and W. Daoji. 2012. One-step expression and tyrosine O-sulfonation of Ax21 in Escherichia coli. Appl Biochem Biotechnol 166:1368-79. 250. Siegesmund, A. M., M. E. Konkel, J. D. Klena, and P. F. Mixter. 2004. Campylobacter jejuni infection of differentiated THP-1 macrophages results in interleukin 1 beta release and caspase-1-independent apoptosis. Microbiology 150:561-9. 251. Smart, J. P., M. J. Cliff, and D. J. Kelly. 2009. A role for tungsten in the biology of Campylobacter jejuni: tungstate stimulates formate dehydrogenase activity and is transported via an ultra-high affinity ABC system distinct from the molybdate transporter. Mol Microbiol 74:742-57. 252. Smith, J. L. 2002. Campylobacter jejuni infection during pregnancy: long-term consequences of associated bacteremia, Guillain-Barre syndrome, and reactive arthritist. J Food Prot 65:696-708. 253. Smith, M. A., and R. G. Schnellmann. 2012. Calpains, mitochondria, and apoptosis. Cardiovasc Res 96:32-7. 254. Soong, G., J. Chun, D. Parker, and A. Prince. 2012. Staphylococcus aureus activation of caspase 1/calpain signaling mediates invasion through human keratinocytes. J Infect Dis 205:1571-9. 255. Soong, G., F. J. Martin, J. Chun, T. S. Cohen, D. S. Ahn, and A. Prince. 2011. Staphylococcus aureus protein A mediates invasion across airway epithelial cells through activation of RhoA GTPase signaling and proteolytic activity. J Biol Chem 286:35891-8. 256. Spiller, R. C., D. Jenkins, J. P. Thornley, J. M. Hebden, T. Wright, M. Skinner, and K. R. Neal. 2000. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 47:804-11. 257. Sridharan, H., and J. W. Upton. 2014. Programmed necrosis in microbial pathogenesis. Trends Microbiol. 258. Srinivasan, L., S. Ahlbrand, and V. Briken. 2014. Interaction of Mycobacterium tuberculosis with Host Cell Death Pathways. Cold Spring Harb Perspect Med. 259. St Maurice, M., N. Cremades, M. A. Croxen, G. Sisson, J. Sancho, and P. S. Hoffman. 2007. Flavodoxin:quinone reductase (FqrB): a redox partner of pyruvate:ferredoxin oxidoreductase that reversibly couples pyruvate oxidation to NADPH production in Helicobacter pylori and Campylobacter jejuni. J Bacteriol 189:4764-73. 260. Stahl, M., J. Butcher, and A. Stintzi. 2012. Nutrient acquisition and metabolism by Campylobacter jejuni. Front Cell Infect Microbiol 2:5. 261. Stanton, R. C. 2012. Glucose-6-phosphate dehydrogenase, NADPH, and cell survival. IUBMB Life 64:362-9. 262. Stephenson, H. N., C. M. John, N. Naz, O. Gundogdu, N. Dorrell, B. W. Wren, G. A. Jarvis, and M. Bajaj-Elliott. 2013. Campylobacter jejuni lipooligosaccharide sialylation, phosphorylation, and amide/ester linkage modifications fine-tune human Toll-like receptor 4 activation. J Biol Chem 288:19661-72. 132  263. Stintzi, A., D. Marlow, K. Palyada, H. Naikare, R. Panciera, L. Whitworth, and C. Clarke. 2005. Use of genome-wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni. Infect Immun 73:1797-810. 264. Stolz, J. F., P. Basu, J. M. Santini, and R. S. Oremland. 2006. Arsenic and selenium in microbial metabolism. Annu Rev Microbiol 60:107-30. 265. Svensson, S. L., L. M. Davis, J. K. MacKichan, B. J. Allan, M. Pajaniappan, S. A. Thompson, and E. C. Gaynor. 2009. The CprS sensor kinase of the zoonotic pathogen Campylobacter jejuni influences biofilm formation and is required for optimal chick colonization. Mol Microbiol 71:253-72. 266. Takahashi, T., K. Ishihara, A. Kojima, T. Asai, K. Harada, and Y. Tamura. 2005. Emergence of fluoroquinolone resistance in Campylobacter jejuni in chickens exposed to enrofloxacin treatment at the inherent dosage licensed in Japan. J Vet Med B Infect Dis Vet Public Health 52:460-4. 267. Takahata, M., T. Tamura, K. Abe, H. Mihara, S. Kurokawa, Y. Yamamoto, R. Nakano, N. Esaki, and K. Inagaki. 2008. Selenite assimilation into formate dehydrogenase H depends on thioredoxin reductase in Escherichia coli. J Biochem 143:467-73. 268. Takeya, R., and H. Sumimoto. 2006. Regulation of novel superoxide-producing NAD(P)H oxidases. Antioxid Redox Signal 8:1523-32. 269. Takkinen, J., A. Ammon, O. Robstad, and T. Breuer. 2003. European survey on Campylobacter surveillance and diagnosis 2001. Euro Surveill 8:207-13. 270. Tareen, A. M., J. I. Dasti, A. E. Zautner, U. Gross, and R. Lugert. 2010. Campylobacter jejuni proteins Cj0952c and Cj0951c affect chemotactic behaviour towards formic acid and are important for invasion of host cells. Microbiology 156:3123-35. 271. Tareen, A. M., J. I. Dasti, A. E. Zautner, U. Gross, and R. Lugert. 2011. Sulphite : cytochrome c oxidoreductase deficiency in Campylobacter jejuni reduces motility, host cell adherence and invasion. Microbiology 157:1776-85. 272. Taveirne, M. E., M. L. Sikes, and J. W. Olson. 2009. Molybdenum and tungsten in Campylobacter jejuni: their physiological role and identification of separate transporters regulated by a single ModE-like protein. Mol Microbiol 74:758-71. 273. Ternhag, A., T. Asikainen, J. Giesecke, and K. Ekdahl. 2007. A meta-analysis on the effects of antibiotic treatment on duration of symptoms caused by infection with Campylobacter species. Clin Infect Dis 44:696-700. 274. Thibodeau, A., P. Fravalo, S. Laurent-Lewandowski, E. Guevremont, S. Quessy, and A. Letellier. 2011. Presence and characterization of Campylobacter jejuni in organically raised chickens in Quebec. Can J Vet Res 75:298-307. 275. Thomas, M. T., M. Shepherd, R. K. Poole, A. H. van Vliet, D. J. Kelly, and B. M. Pearson. 2011. Two respiratory enzyme systems in Campylobacter jejuni NCTC 11168 contribute to growth on L-lactate. Environ Microbiol 13:48-61. 276. Tiede, I., G. Fritz, S. Strand, D. Poppe, R. Dvorsky, D. Strand, H. A. Lehr, S. Wirtz, C. Becker, R. Atreya, J. Mudter, K. Hildner, B. Bartsch, M. Holtmann, R. Blumberg, H. Walczak, H. Iven, P. R. Galle, M. R. Ahmadian, and M. F. Neurath. 2003. CD28-dependent Rac1 activation is the molecular target of azathioprine in primary human CD4+ T lymphocytes. J Clin Invest 111:1133-45. 277. Vaisid, T., and N. S. Kosower. 2013. Calpastatin is upregulated in non-immune neuronal cells via toll-like receptor 2 (TLR2) pathways by lipid-containing agonists. Biochim Biophys Acta 1833:2369-77. 278. Vally, H., N. L. Misso, and V. Madan. 2009. Clinical effects of sulphite additives. Clin Exp Allergy 39:1643-51. 133  279. van Alphen, L. B., N. M. Bleumink-Pluym, K. D. Rochat, B. W. van Balkom, M. M. Wosten, and J. P. van Putten. 2008. Active migration into the subcellular space precedes Campylobacter jejuni invasion of epithelial cells. Cell Microbiol 10:53-66. 280. van den Berg, B., C. Bunschoten, P. A. van Doorn, and B. C. Jacobs. 2013. Mortality in Guillain-Barre syndrome. Neurology 80:1650-4. 281. Van der Geize, R., K. Yam, T. Heuser, M. H. Wilbrink, H. Hara, M. C. Anderton, E. Sim, L. Dijkhuizen, J. E. Davies, W. W. Mohn, and L. D. Eltis. 2007. A gene cluster encoding cholesterol catabolism in a soil actinomycete provides insight into Mycobacterium tuberculosis survival in macrophages. Proc Natl Acad Sci U S A 104:1947-52. 282. van Vliet, A. H., M. L. Baillon, C. W. Penn, and J. M. Ketley. 1999. Campylobacter jejuni contains two fur homologs: characterization of iron-responsive regulation of peroxide stress defense genes by the PerR repressor. J Bacteriol 181:6371-6. 283. Vandenabeele, P., L. Galluzzi, T. Vanden Berghe, and G. Kroemer. 2010. Molecular mechanisms of necroptosis: an ordered cellular explosion. Nat Rev Mol Cell Biol 11:700-14. 284. Vanlangenakker, N., T. Vanden Berghe, D. V. Krysko, N. Festjens, and P. Vandenabeele. 2008. Molecular mechanisms and pathophysiology of necrotic cell death. Curr Mol Med 8:207-20. 285. Vegge, C. S., L. Brondsted, Y. P. Li, D. D. Bang, and H. Ingmer. 2009. Energy taxis drives Campylobacter jejuni toward the most favorable conditions for growth. Appl Environ Microbiol 75:5308-14. 286. Verhoeff-Bakkenes, L., A. P. Arends, J. L. Snoep, M. H. Zwietering, and R. de Jonge. 2008. Pyruvate relieves the necessity of high induction levels of catalase and enables Campylobacter jejuni to grow under fully aerobic conditions. Lett Appl Microbiol 46:377-82. 287. Vucic, S., M. C. Kiernan, and D. R. Cornblath. 2009. Guillain-Barre syndrome: an update. J Clin Neurosci 16:733-41. 288. Vuckovic, D., P. Gregorovic-Kesovija, G. Brumini, B. Ticac, and M. Abram. 2011. Epidemiologic characteristics of human campylobacteriosis in the County Primorsko-goranska (Croatia), 2003-2007. Coll Antropol 35:847-53. 289. Wai, S. N., K. Nakayama, K. Umene, T. Moriya, and K. Amako. 1996. Construction of a ferritin-deficient mutant of Campylobacter jejuni: contribution of ferritin to iron storage and protection against oxidative stress. Mol Microbiol 20:1127-34. 290. Wang, H., and R. P. Gunsalus. 2003. Coordinate regulation of the Escherichia coli formate dehydrogenase fdnGHI and fdhF genes in response to nitrate, nitrite, and formate: roles for NarL and NarP. J Bacteriol 185:5076-85. 291. Wang, Z., H. Jiang, S. Chen, F. Du, and X. Wang. 2012. The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell 148:228-43. 292. Watson, R. O., and J. E. Galan. 2008. Campylobacter jejuni survives within epithelial cells by avoiding delivery to lysosomes. PLoS Pathog 4:e14. 293. Weerakoon, D. R., N. J. Borden, C. M. Goodson, J. Grimes, and J. W. Olson. 2009. The role of respiratory donor enzymes in Campylobacter jejuni host colonization and physiology. Microb Pathog 47:8-15. 294. Weerakoon, D. R., and J. W. Olson. 2008. The Campylobacter jejuni NADH:ubiquinone oxidoreductase (complex I) utilizes flavodoxin rather than NADH. J Bacteriol 190:915-25. 295. West, A. P., I. E. Brodsky, C. Rahner, D. K. Woo, H. Erdjument-Bromage, P. Tempst, M. C. Walsh, Y. Choi, G. S. Shadel, and S. Ghosh. 2011. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature 472:476-80. 296. Wilson, D. J., E. Gabriel, A. J. Leatherbarrow, J. Cheesbrough, S. Gee, E. Bolton, A. Fox, P. Fearnhead, C. A. Hart, and P. J. Diggle. 2008. Tracing the source of campylobacteriosis. PLoS Genet 4:e1000203. 134  297. Wine, E., V. L. Chan, and P. M. Sherman. 2008. Campylobacter jejuni mediated disruption of polarized epithelial monolayers is cell-type specific, time dependent, and correlates with bacterial invasion. Pediatr Res 64:599-604. 298. Winter, S. E., P. Thiennimitr, M. G. Winter, B. P. Butler, D. L. Huseby, R. W. Crawford, J. M. Russell, C. L. Bevins, L. G. Adams, R. M. Tsolis, J. R. Roth, and A. J. Baumler. 2010. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 467:426-9. 299. Wood, G. E., A. K. Haydock, and J. A. Leigh. 2003. Function and regulation of the formate dehydrogenase genes of the methanogenic archaeon Methanococcus maripaludis. J Bacteriol 185:2548-54. 300. Wu, Z., O. Sahin, Z. Shen, P. Liu, W. G. Miller, and Q. Zhang. 2013. Multi-omics approaches to deciphering a hypervirulent strain of Campylobacter jejuni. Genome Biol Evol 5:2217-30. 301. Wynosky-Dolfi, M. A., A. G. Snyder, N. H. Philip, P. J. Doonan, M. C. Poffenberger, D. Avizonis, E. E. Zwack, A. M. Riblett, B. Hu, T. Strowig, R. A. Flavell, R. G. Jones, B. D. Freedman, and I. E. Brodsky. 2014. Oxidative metabolism enables Salmonella evasion of the NLRP3 inflammasome. J Exp Med. 302. Yang, C. S., J. S. Lee, M. Rodgers, C. K. Min, J. Y. Lee, H. J. Kim, K. H. Lee, C. J. Kim, B. Oh, E. Zandi, Z. Yue, I. Kramnik, C. Liang, and J. U. Jung. 2012. Autophagy protein Rubicon mediates phagocytic NADPH oxidase activation in response to microbial infection or TLR stimulation. Cell Host Microbe 11:264-76. 303. Yao, R., R. A. Alm, T. J. Trust, and P. Guerry. 1993. Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene 130:127-30. 304. Yazdanpanah, B., K. Wiegmann, V. Tchikov, O. Krut, C. Pongratz, M. Schramm, A. Kleinridders, T. Wunderlich, H. Kashkar, O. Utermohlen, J. C. Bruning, S. Schutze, and M. Kronke. 2009. Riboflavin kinase couples TNF receptor 1 to NADPH oxidase. Nature 460:1159-63. 305. Yin, F., H. Sancheti, and E. Cadenas. 2012. Mitochondrial thiols in the regulation of cell death pathways. Antioxid Redox Signal 17:1714-27. 306. Young, K. T., L. M. Davis, and V. J. Dirita. 2007. Campylobacter jejuni: molecular biology and pathogenesis. Nat Rev Microbiol 5:665-79. 307. Zhang, W., D. E. Culley, J. C. Scholten, M. Hogan, L. Vitiritti, and F. J. Brockman. 2006. Global transcriptomic analysis of Desulfovibrio vulgaris on different electron donors. Antonie Van Leeuwenhoek 89:221-37. 308. Zilbauer, M., N. Dorrell, A. Elmi, K. J. Lindley, S. Schuller, H. E. Jones, N. J. Klein, G. Nunez, B. W. Wren, and M. Bajaj-Elliott. 2007. A major role for intestinal epithelial nucleotide oligomerization domain 1 (NOD1) in eliciting host bactericidal immune responses to Campylobacter jejuni. Cell Microbiol 9:2404-16. 309. Zorn, M., C. H. Ihling, R. Golbik, R. G. Sawers, and A. Sinz. 2013. Selective selC-independent selenocysteine incorporation into formate dehydrogenases. PLoS One 8:e61913.      135  Appendix 1: Primer list Primer Name Sequence (5'->3')  Restriction Site Primers: Chapter 2 fdhU-FW GCTTTAGCACTGATTTTTGGTTTTGTTTTTGGC - fdhU-RV CCTTGGATAGCAGGTATTTTACTCAGTGC - fdhT-FW TTGAATTCTTTTAAACAAAAATATTTAATCAATTTTTGGG - fdhT-RV CCTTTAAGTTGATTTTTAAAAAAGTGTTTTTTGTAAAATAC - fdhA-FW CATTTGGTTATGGCGCTATGACAAACC - fdhA-RV CATTTTCCATCCTTACTGATTCTACAAAGCC - fdhU-iPCR-FW GATATCGGTACCCTATAAGTAATTTTCACTGTTTATCCTTTAAGTTG XbaI fdhU-iPCR-RV GATATCGGTACCGTGGACCCACACTAAGATTTTTAATCCAAAAGCC XbaI fdhU-C-FW GATATCTCTAGACAACTTAAAGGATAAACAGTGAAAATTACTTATAG XbaI fdhU-C-RV GATATCCAATTGGAGTTTTGAGAATAAAAGCCTTTTTTAAGGC MfeI fdhT-C-FW GGCACTAGTGATTACATTTTTAGGATCTTTCTTTGAATTCTTTTAAAC XbaI fdhT-C-RV CCGCAATTGCACTGTTTATCCTTTAAGTTGATTTTTAAAAAAGTG MfeI Primer-A GGGAGCATTTTTGTTTGGTTTTGG - Primer-B TATACCTTCTTTAAAAGCTTTTGGTAAAAAG - Primer-C GAAAATTACTTATAGTTTAAATTTACAAGGTGAAGC - Primer-D CGGTTTTTTGCATCTTGAGGTATGG - fdhU-q-FW AACTTTCTCCTGCTGTAGCTGTGG - fdhU-q-RV CCTTCAAAGGCACGATAAGTCCAACC - fdhT-q-FW AGGGCTTAATGGTTGGAGTCCTGA - fdhT-q-RV AGTACTCGCCAGCAACTTCGTCTT - rpoA-q-FW CGAGCTTGCTTTGATGAGTG - rpoA-q-RV AGTTCCCACAGGAAAACCTA - ak233 GCAAGAGTTTTGCTTATGTTAGCAC - ak234 GAAATGGGCAGAGTGTATTCTCCG -       136  Primer Name Sequence (5'->3')  Restriction Site ak235 GTGCGGATAATGTTGTTTCTG - ak237 TCCTGAACTCTTCATGTCGATTG - DL3 ACCCAGCGAACCATTTGAGG - Primers: Chapter 3 sorA-FW: GGTAGAAAAACCATTAAATAGATTAGCATGGC - sorA-RV: CTTTGGGAAACCACAATGGATCC - sorA-iPCR-FW GCATCCCGGGGAATTCCTCTAGCTATACTCTTACAAAACAAAACTC smaI sorA-iPCR-RV GCATCCCGGGCTTGCACTTAAAAACAATGCTAAGATCAATATAATTTTTTTCAT smaI gdh-FW GCAAGACAATATTATTGATCGCAGAA - gdh-RV CTCTCCATATCTGCTAAACCCATAGG - gdh-iPCR-FW GCATCCCGGGCAAGGCTATCAAACTCCTATGCAAC smaI gdh-iPCR-RV GCATCCCGGGCAAGGCTATCAAACTCCTATGCAAC smaI hydB-FW GGTTGTTCTGAGCCTGATTTTTGG - hydB-RV AGCGGTATTTTGCTTGCATAAAATTTAC - hydB-iPCR-FW GCATCCCGGGGGATACTAAGGGCAATAATCTAAGTGAATATAAAGTG smaI hydB-iPCR-RV GCATCCCGGGGCCCTTCAATTCTTGTAATAGGATCTAC smaI mdh-FW ATGAAAATCACTGTTATAGGGGCTG - mdh-RV TTATTCTCCTTTATATTGATATTTGATTAAAGATTTTTC - mdh-iPCR-FW CGATCCCGGGGTCAAAATGTCAAGAGTGGATACAAGAC smaI mdh-iPCR-RV GCTACCCGGGGTTAAAATAATAAAAAGCGGATCTTCTGTAAAATC smaI putA-FW GCTTTAGCCTTAGCTGAAGAATTAC - putA-RV CTGGGGCATAAAGGATTAGATCATG - putA-iPCR-FW CGATCCCGGGGGCAAATTTGCTCCTAATTTAAGTGTACC smaI putA-iPCR-RV GCATCCCGGGTCCGCTATGCCATATTTACTCAAAG smaI gdh-C-FW GCAATCTAGAGGACTAATATAGTCTTGTTTAAATTATTATCAAGGAGAAG XbaI gdh-C-RV GCATCAATTGCATCTACTTTTTTTAATACTTCAGCCATTTTAAC MfeI 137  Primer Name Sequence (5'->3')  Restriction Site mdh-C-FW GGATTCTAGAGTGCAACTTTTAACGCTATTTTAGAAAAAATAG XbaI mdh-C-RV GCATCAATTGGCTTTTGCTTGATACTCATGTATGTTC MfeI katA-qPCR-FW CAAACAGCTATGATAATAGCC - katA-qPCR-RV: GGAGCATATCTTTGTGCTACG - sodB-qPCR-FW: CAAACAGCTATGATAATAGCC - sodB-qPCR-RV: GGAGCATATCTTTGTGCTACG - dps-qPCR-FW: AAAAAGAAAGTGATACTACAACAGCT - dps-qPCR-RV AAGCACCTTGTAAAGTAGCGCCTATC - rpoA-qPCR-FW CGAGCTTGCTTTGATGAGTG - rpoA-qPCR-RV AGTTCCCACAGGAAAACCTA - IL-8-qPCR-FW: GGCACAAACTTTCAGAGACAG - IL-8-qPCR-RV: ACACAGAGCTGCAGAAATCAGG - TNF-alpha-qPCR-FW CCCAGGGACCTCTCTCTAATCA - TNF-alpha-qPCR-RV: AGCTGCCCCTCAGCTTGAG - Gapdh-qPCR-FW CCCCTTCATTGACCTCAACTAC - Gapdh-qPCR-RV GATGACAAGCTTCCCGTTCTC - Primers: Chapter 4 cydA-FW GAACGAACTTAGTAGCGTTGATTGGTC - cydA-RV CTGAAATTACATAACCACTGCCTATGGTATG - cydA-iPCR-FW GCA TCCCGGGGCTATCGGTGTAGCTACAGG SmaI cydA-iPCR-RV GCATCCCGGGGCAAATAATGAAAGCCAAAATTTGGTG SmaI cj0020-FW GATTTTATGTTTATCTTATGCAAATATAGTCTTTGC - cj0020-RV TCATGATATTCTCCTGTTAAGCTTTCTAAG - cj0020-iPCR-FW GCATCCCGGTTAATCACACCAAATTCTCCTTTTGATC SmaI 138  Primer Name Sequence (5'->3')  Restriction Site cj0020-iPCR-RV GCATCCCGGGGGTTGTAGGAGTGTTAAAGGGTTTATC SmaI cj0358-FW GAAAGTAAAATCATTGCTAATCGCATCCTTAG - cj0358-RV GTTCAGGTTTAGGAGTTTTTTCAGTAGAAATAGG - cj0358-iPCR-FW CGATCCCGGGGGCGATGAAAAAGCTTTAACAAAAGAAG SmaI cj0358-iPCR-RV GCATCCCGGGCCACCAAGTCCTACATTATGACAGG SmaI atps-FW ATGAAATCAGCAAGAAAAAATAAAAA - atps-RV CCATCAGTTGGAAAAAGCTCATTATAA - atps-C-FW CCGGTCTAGAAATTACCAAAATATATTTCCTGATACTGATCTTTC XbaI atps-C-RV CCGGCAATTGGAACCTGAATAAAAAAAAGTTAAAAATAATTTTTGCATTTTG MfeI    139  Appendix 2: List of plasmids Plasmid Relevant Characteristics General Use Plasmids pGEM  PCR cloning vector, ampR pRRK  C. jejuni rRNA spacer integration vector, kanR ampR pRRC C. jejuni rRNA spacer integration vector, chlorR ampR pUC18K-2 Kanamycin containing plasmid, kanR pRY109 Chloramphenicol containing plasmid, chlorR Plasmids: Chapter 2 pGem-ΔfdhU::kan fdhU deletion plasmid, kanR pGem-ΔfdhT::kan fdhT insertion plasmid, kanR pGem-ΔfdhA::kan fdhA insertion mutant, kanR pGem-ΔfdhA::chlor fdhA insertion mutant, chlorR pRRK-fdhU fdhU complementation plasmid, chlorR pRY112-GFP GFP expressed from atpF' promoter expression C. jejuni plasmid Plasmids: Chapter 3 pGem-ΔsorA::kan sorA deletion plasmid, kanR pGem-Δgdh::kan gdh deletion plasmid, kanR pGem-ΔhydB::kan hydB deletion plasmid, kanR pGem-ΔputA::kan putA deletion plasmid, kanR pGem-Δmdh::kan mdh deletion plasmid, kanR pRRC-gdh gdh complementation plasmid, chlorR pRRC-mdh mdh complementation plasmid, chlorR Plasmids: Chapter 4 pGem-ΔcydA::kan cydA deletion plasmid, kanR pGem-Δcj0020::kan cj0020 deletion plasmid, kanR pGem-Δcj0358::chlor cj0358 deletion plasmid, chlor pGem-ΔcysM::Kan cysM deletion plasmid, kanR pGem-Δatps::chlor atps deletion plasmid, chlorR pRRC-atps atps complementation plasmid, chlorR        140  Appendix 3: List of strains Strain Relevant characteristics E. coli Strain DH5α E. coli cloning strain Chapter 2 C. jejuni 81-176 Wild Type Strain ΔfdhT fdhT::kan ΔfdhU fdhU::kan ΔfdhU-C fdhU::kan, pRRC-fdhU ΔfdhA fdhA::kan ΔfdhA fdhA::chlor ΔfdhUΔfdhA fdhU::kan fdhA:chlor ΔfdhU-GFP fdhU::kan, pRY112-GFP ΔfdhT-GFP fdhT:kan, pRY112-GFP ΔfdhA-GFP fdhA:kan, pRY112-GFP Chapter 3 ΔsorA sorA::kan Δgdh gdh::kan ΔhydB hydB::kan ΔputA putA::kan Δmdh mdh::kan Δgdh-C gdh::kan pRRC-gdh Δmdh-C mdh::kan pRRC-mdh ΔsorA-GFP sorA::kan pRY112-GFP Δgdh-GFP gdh::kan pRY112-GFP ΔhydB-GFP hydB::kan pRY112-GFP ΔputA-GFP putA::kan pRY112-GFP Δmdh-GFP mdh::kan pRY112-GFP Chapter 4 ΔcydA cydA::kan Δcj0020Δcj0358 cj0020::kancj0358::chlor ΔcysM cysM::kan ΔatpS atps::chlor Δatps-C atps::chlor pRRK-atps  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167574/manifest

Comment

Related Items