Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Community analysis and mixotrophic study of one-stage Anammox system Kang, John 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_september_kang_john.pdf [ 2.1MB ]
Metadata
JSON: 24-1.0167531.json
JSON-LD: 24-1.0167531-ld.json
RDF/XML (Pretty): 24-1.0167531-rdf.xml
RDF/JSON: 24-1.0167531-rdf.json
Turtle: 24-1.0167531-turtle.txt
N-Triples: 24-1.0167531-rdf-ntriples.txt
Original Record: 24-1.0167531-source.json
Full Text
24-1.0167531-fulltext.txt
Citation
24-1.0167531.ris

Full Text

   COMMUNITY ANALYSIS AND MIXOTROPHIC STUDY  OF ONE-STAGE ANAMMOX SYSTEM  by  John Kang  B.A.Sc (Chemical Engineering), University of Toronto, 2010  A THESIS SUBMITED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF MASTER OF APPLIED SCIENCE in The Faculty of Graduate and Postdoctoral Studies (Civil Engineering)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2014    © John Kang, 2014 ii  Abstract A knowledge gap exists regarding the kinetics and the microbial community of a combined partial nitritation/anaerobic ammonium oxidation (Anammox) system. In this study, a combined system was enriched for a period of 1 year in a SBR setup using synthetic reject water. The system successfully washed out the nitrite oxidizing bacteria (NOB) population using a combination of temperature control, dissolved oxygen (DO) control and sludge wasting. The reduction in NOB population was confirmed through the reduction in the effluent nitrate concentration and fluorescence in-situ hybridization (FISH) studies. With a 50 day sludge retention time (SRT) period, the system achieved a nitrogen removal efficiency between 80 – 90%, corresponding to a loading rate of 0.26 kg N/m3-d.  FISH was conducted throughout the study to investigate the spatial analysis in floc/granular forms and the relative volumetric fractions of ammonia oxidizing bacteria (AOB), NOB and Anammox. The spatial analysis revealed that the AOB and the Anammox population are evenly dispersed in the granule rather than the inner/outer layer model discussed in literature. The volumetric fraction for Anammox was 33.2% ± 12.3% at 55 day SRT and 31.3% ± 10.7% at 30 day SRT. For AOB, the volumetric fraction was 36.3% ± 9.4% at 55 day SRT and 25.6 ± 7.0% at 30 day SRT. The NOB population was < 6% throughout the study. FISH could not account for the majority of the bacteria as the unaccounted fraction consisted of up to 39%. Volumetric fractions of Anammox sludge enriched in non-synthetic reject water were 26.9% ± 8.3% and 11.2% ± 3.8% for Anammox and AOB, respectively. The unaccounted fraction was higher at 55%.  Mixotrophic tests were conducted using acetate, propionate and primary effluent as electron donors. Both nitrate and nitrite, as electron acceptors, caused the oxidation of the electron donors. The presence of a lag response is likely attributed to the fact that the Anammox sludge was not metabolically active to the presence of the electron donors until the onset of the batch study. Methanol inhibition studies confirmed that the oxidation of the electron donors was not due to heterotrophic activity.  iii  Table of Contents Abstract ........................................................................................................................................... ii Table of Contents ........................................................................................................................... iii List of Tables ................................................................................................................................. vi List of Figures ............................................................................................................................... vii List of Abbreviations ..................................................................................................................... ix Acknowledgement ......................................................................................................................... xi 1. INTRODUCTION .................................................................................................................. 1 1.1. Background ..................................................................................................................... 1 1.2. Research Objectives ........................................................................................................ 2 2. LITERATURE REVIEW ....................................................................................................... 4 2.1. Nitrogen Cycle ................................................................................................................ 4 2.2. Conventional Biological Nitrogen Removal Process: Nitrification-Denitrification ....... 5 2.2.1. Nitrification ............................................................................................................... 6 2.2.2. Denitrification ........................................................................................................... 8 2.3. Anaerobic Ammonium Oxidation (Anammox) .............................................................. 9 2.3.1. Discovery of Anammox Bacteria.............................................................................. 9 2.3.2. Characterisation of Anammox Bacteria .................................................................. 11 2.3.2.1. Phylogenetic Biodiversity................................................................................ 11 2.3.2.2. Overall Reaction Stoichiometry of Anammox ................................................ 13 2.3.2.3. Physiology of Anammox Bacteria ................................................................... 13 2.3.2.4. Theorized Anammox Metabolic Pathway ....................................................... 14 2.4. Application of the Anammox Process .......................................................................... 15 2.4.1. Relevant Kinetic Parameters ................................................................................... 16 2.4.2. Key System Conditions in a Partial Nitritation - Anammox System...................... 17 2.4.2.1. pH Influence on Chemical Equilibria and Activity ......................................... 17 2.4.2.2. Effect of Nitrite Inhibition on Anammox ........................................................ 19 2.4.2.3. Dissolved Oxygen............................................................................................ 21 2.4.2.4. Alkalinity ......................................................................................................... 22 2.4.2.5. Temperature ..................................................................................................... 22 2.4.2.6. Sludge Retention Time .................................................................................... 24 2.4.2.7. Presence of Organic Matter and Volatile Fatty Acids ..................................... 24 2.4.3. Reactor Configurations for Anammox.................................................................... 25 2.4.3.1. Completely Autotrophic Nitrogen Removal over Nitrite (CANON) .............. 26 2.4.3.1.1. Deammonification (DEMON)........................................................................ 27 2.4.3.2. Single Reactor System for High-Rate Ammonium Removal Over Nitrite (SHARON)-Anammox ..................................................................................................... 28 2.4.3.3. Reactor Designs for Anammox ....................................................................... 29 3. EXPERIMENTAL DESIGN, MATERIALS and METHODS ............................................ 31 3.1. Sequencing Batch Reactor (12L) for One-Stage N Removal ....................................... 31 3.1.1. Experimental Set-Up ............................................................................................... 31 3.1.2. Synthetic Reject Water ........................................................................................... 34 3.1.3. Monitoring Parameters and Sampling Plan ............................................................ 35 3.2. Analytical Methods ....................................................................................................... 37 3.3. Fluorescence in-situ Hybridization (FISH) ................................................................... 39 3.3.1. FISH Background ................................................................................................... 39 iv  3.3.2. Applicability of FISH for Anammox Research ...................................................... 40 3.3.3. FISH Probe Selection .............................................................................................. 41 3.3.4. FISH Experimental Methodology ........................................................................... 43 3.3.4.1. Preparation of Fixative Solution (Paraformaldehyde 4% w/v) ....................... 43 3.3.4.2. Fixation of Activated Sludge Sample .............................................................. 43 3.3.4.3. Hybridization of Oligonucleotide Probes to Fixed Cells................................. 43 3.3.4.4. Washing Step for Fixed Cells .......................................................................... 44 3.3.4.5. Pre-analysis Treatment with DAPI and DABCO ............................................ 45 3.3.4.6. CLSM and FISH Imaging................................................................................ 45 3.3.4.7. Volumetric Quantification in DAIME ............................................................. 48 3.4. Specific Activity Analysis (Kinetics and Mixotrophic Tests) ...................................... 48 4. RESULTS AND DISCUSSION ........................................................................................... 50 4.1. One-Stage Anammox SBR System Operation ............................................................. 50 4.1.1. Acclimation Stage (October - December) ............................................................... 53 4.1.1.1. Nitrate Build-Up and Anammox Activity Recovery ....................................... 53 4.1.2. Phase 1 - 55 day SRT (December - May) ............................................................... 54 4.1.3. Phase 2 - 30 day SRT (May - October)................................................................... 55 4.1.4. Sludge Granule Size ................................................................................................ 55 4.2. Mixed Community Analysis of One-Stage ANAMMOX System using FISH ............ 56 4.2.1. Research Questions ................................................................................................. 56 4.2.2. Troubleshooting FISH Methodology ...................................................................... 56 4.2.3. Control Results Using Blanks and NONEUB Probe .............................................. 57 4.2.4. Granular Structure Analysis - AOB and Anammox Spatial Distribution ............... 57 4.2.5. Volumetric Fraction Analysis - 55 Day and 30 Day SRT ...................................... 61 4.2.6. Volumetric Fraction Analysis - Annacis Sludge .................................................... 64 4.3. Determination of Anammox Kinetic Parameters .......................................................... 66 4.3.1. Research Questions ................................................................................................. 66 4.3.2. Double Substrate Monod Model ............................................................................. 66 4.3.3. Observed Yield Determination ............................................................................... 67 4.3.4. Specific Anammox Activity - Ammonium Limiting .............................................. 67 4.3.5. Specific Anammox Activity - Nitrite Limiting ....................................................... 69 4.4. Mixotrophic Analysis of Anammox Sludge ................................................................. 70 4.4.1. Research Questions ................................................................................................. 70 4.4.2. Control Tests ........................................................................................................... 71 4.4.3. Mixotrophic Analysis with Nitrate and Anammox Sludge Enriched in SBR ........ 72 4.4.4. Mixotrophic Analysis with Nitrite and Anammox Sludge Enriched in SBR ......... 74 4.4.5. Mixotrophic Analysis with Anammox Sludge Enriched in Pilot System............... 75 4.4.6. Mixotrophic Analysis using Primary Effluent with Anammox Sludge Enriched in Pilot System .......................................................................................................................... 79 4.4.7. Summary of Mixotrophic Results and Implications ............................................... 80 5. CONCLUSIONS AND RECOMMENDATIONS ............................................................... 82 5.1. Conclusions ................................................................................................................... 82 5.2. Recommendations ......................................................................................................... 85 Bibliography ................................................................................................................................. 87 Appendix ....................................................................................................................................... 96 Appendix A: Calculations used in the study ............................................................................. 97 v  Appendix B: Synthetic Feed Data ............................................................................................. 98 Appendix C: SBR System Data ................................................................................................ 99 Appendix D: Volumetric Fraction Analysis Data ................................................................... 108 Appendix E: Kinetics Analysis Data ...................................................................................... 114 Appendix F: Mixotrophic Test Data ....................................................................................... 120    vi  List of Tables Table 2.1 Phylogeny of Anammox bacteria discovered to date. Adapted from (Ding, et al., 2013)....................................................................................................................................................... 11 Table 2.2 Comparison of nitrogen removal processes ................................................................. 15 Table 2.3 Reported values for nitrite inhibition on the Anammox process. Adapted from (Lotti, et al., 2012) ................................................................................................................................... 20 Table 2.4 Literature findings of Anammox systems .................................................................... 30 Table 3.1  Synthetic reject water feed composition (per litre basis) ............................................ 34 Table 3.2 Trace element solution composition (per litre basis) ................................................... 34 Table 3.3 Average reject water parameters and synthetic reject water used for lab SBR ........... 35 Table 3.4 Sampling plan for the SBR system .............................................................................. 35 Table 3.5 FISH oligonucleotide probes used in the one-stage Anammox study ......................... 42   vii  List of Figures Figure 2.1 Overview of the nitrogen cycle. Adapted from (Schnell, et al., 2003) ......................... 4 Figure 2.2 Schematic of the Anammox cell (left) and the postulated anaerobic ammonium oxidation pathway (right). Adapted from (van Niftrik, et al., 2008) ............................................ 13 Figure 2.3 Minimum SRTs with respect to temperature for AOB and NOB. Adapted from (Hellinga, et al., 1998) .................................................................................................................. 23 Figure 2.4 Overview schematic of the CANON/SNAP process .................................................. 27 Figure 2.5 Control scheme of the DEMON process Adapted from (Wett, et al., 2007b) ............ 28 Figure 2.6 Overview schematic of SHARON-Anammox process .............................................. 29 Figure 3.1 Schematic of the deammonification SBR system....................................................... 31 Figure 3.2 Deammonification SBR system and equipments ....................................................... 32 Figure 3.3 SBR system during (A) aeration/mix phase, (B) decant phase .................................. 33 Figure 3.4 Dissolved oxygen meter (A) and pH meter (B) used for monitoring SBR performance....................................................................................................................................................... 36 Figure 3.5 Colorimetric analysis for nitrite. (A) the colour chart with test solution (B) sample . 37 Figure 3.6 Olympus Fluoview FV1000 for FISH imaging .......................................................... 46 Figure 3.7 Olympus Fluoview software for fluorescence image adjustment .............................. 47 Figure 4.1 Nitrogen removal performance of the SBR system based on influent ....................... 51 Figure 4.2 Effluent concentration measured during the SBR operation ...................................... 52 Figure 4.3 Sludge comparison between (A) actual reject water, (B) synthetic reject water ........ 56 Figure 4.4 FISH image of Anammox granule at 100x objective. Red = Anammox, Green = All bacteria. Image taken every 5um intervals in the z-direction from (A) to (D) ............................. 59 Figure 4.5 FISH image of Anammox granule at 100x objective. Yellow = AOB, Green = All bacteria. Image taken every 5um intervals in the z-direction from (A) to (D) ............................. 60 Figure 4.6 Volumetric population distribution from a 55 day SRT Anammox system ............... 63 Figure 4.7 Volumetric population distribution from a 30 day SRT Anammox system ............... 63 Figure 4.8 Volumetric population distribution of homogenized Anammox sludge from Annacis....................................................................................................................................................... 64 Figure 4.9 Volumetric population distribution of Anammox sludge from Annacis (Granular portion) .......................................................................................................................................... 65 Figure 4.10 Volumetric population distribution of Anammox sludge from Annacis (Effluent) . 66 viii  Figure 4.11 Specific Anammox activity under ammonium limited conditions (NO2--N at 10 - 12 mg/L)............................................................................................................................................. 68 Figure 4.12 Specific Anammox activity under ammonium limited conditions, test 2 (NO2--N at 12 mg/L)........................................................................................................................................ 69 Figure 4.13 Specific Anammox activity under nitrite limited conditions, test 1 (NH4+-N > 200 mg/L)............................................................................................................................................. 69 Figure 4.14 Specific Anammox activity under nitrite limited conditions, test 2 (NH4+-N > 200 mg/L)............................................................................................................................................. 70 Figure 4.15 Control tests with Anammox enriched in SBR ........................................................ 72 Figure 4.16 Mixotrophic tests with nitrate and Anammox biomass from SBR ........................... 73 Figure 4.17 Mixotrophic tests with nitrite and Anammox biomass from SBR ........................... 75 Figure 4.18 Mixotrophic tests with Anammox biomass from pilot-scale reactor (Higher VSS than lab-scale reactor) ................................................................................................................... 78 Figure 4.19 Mixotrophic tests using primary effluent with Anammox biomass from pilot-scale reactor (Higher VSS than lab-scale reactor) ................................................................................. 79   ix  List of Abbreviations ∆Gº AMO ATPase ATP Anammox AOA Gibbs free energy Ammonia monooxygenase Adenosine triphosphatase Adenosine triphosphate Anaerobic ammonia oxidation Ammonia oxidizing archaea AOB Ammonia oxidizing bacteria BOD BNR Biochemical oxygen demand (mg L-1) Biological nutrient removal ºC Degree Celsius cBOD Carbonaceous biochemical oxygen demand CaCO3 Alkalinity (expressed as calcium carbonate equivalent) CANON Complete Autotrophic Nitrogen Removal Over Nitrite CLSM CoA CO2 COD DABCO Confocal laser scanning microscope Coenzyme A Carbon dioxide Chemical oxygen demand 1,4-diazabicycloe[2.2.2.] octane DAPI DEMON 4,6-diamidino-2-phenylindole Deammonification DO Dissolved oxygen FISH Fluorescence in situ hybridization ΔG° Gibbs free energy Hh HNO2 HRT Hydrazine hydrolase Nitrous acid Hydraulic retention time (d) IC50 J 50% inhibition concentration Joules Ks Affinity constant or half-saturation coefficient (mg L-1) MBR Membrane bioreactor MLSS Mixed liquor suspended solids (mg L-1) MLVSS Mixed liquor volatile suspended solids (mg L-1) N Nitrogen N2 Molecular nitrogen gas NH3 Un-ionized ammonia NH3-N Un-ionized ammonia-nitrogen NH4+ Ionized ammonia or ammonium NH4+-N Ammonium-nitrogen Nir NO N2O Nitrite reductase Nitric oxide Nitrous oxide NO2- Nitrite NO2--N Nitrite-nitrogen NO3- Nitrate NO3--N Nitrate-nitrogen NOB Nitrite oxidizing bacteria NOR RATS Nitrite oxidoreductase Robust Automated Threshold Selection x  RBC SBR Rotating biological contactor Sequencing batch reactor SDS SHARON Sodium dodecyl sulfate Single Reactor System for High Activity Ammonium Removal Over Nitrite SMP SNAP SRT Soluble microbial product Single-Stage Nitrogen Removal Using Anammox and Partial Nitritation Solids retention time (d) TAN TNO2 TOC Total ammonia nitrogen = ammonium + free ammonia Total nitrite (nitrite + nitrous acid) Total organic carbon (mg L-1) TSS Total suspended solids (mg L-1) UASB VSS Upflow anaerobic sludge blanket Volatile suspended solids (mg L-1) WWTP Y µmax Wastewater Treatment Plant Yield Maximum specific growth rate    xi  Acknowledgement Many people have significantly assisted and contributed during my thesis research. First, I want to thank Dr. Babak Rezania and Dr. Donald Mavinic for making my research possible. They provided valuable contribution and guidance throughout my research. It is only through their supervision and support that I am able to complete my graduate studies.  I would like to acknowledge Dr. William Ramey for providing me with feedback and guidance at the conceptual phase of my thesis research. Special thanks to Dr. Steven Hallam for allowing me access to use the LSC laboratory. I am also thankful for Dr. Dean Shiskowski for assisting me with my project and also providing me guidance.  I want to also extend my gratitude for Dr. Holger Daims for giving me the permission to use the DAIME software for my research. Without the access to the software, I would not have been able to conduct my FISH analysis.  I am tremendously grateful for Paula Parkinson and Timothy Ma for the invaluable work and knowledge they provided in the laboratory as well as helping me design my system. I also want to acknowledge my fellow colleagues, especially Patrick Tsao and Chris Lawson, for all their support during my research. Also, I want to thank my family for all their encouragement throughout my graduate studies.  Finally, I NSERC (National Sciences and Engineering Research Council of Canada) and BCIC (British Columbia Innovation Council) funding made this study possible.   1  1. INTRODUCTION 1.1. Background The global nitrogen (N) cycle consists of changes in the oxidation state of nitrogen from +5 to -3 and is distributed to all facets of the environment from the ocean, soil to the atmosphere. With technological advances, anthropogenic activities have started to play a role within the nitrogen cycle. One of these activities is within the context of wastewater treatment where influent nitrogen, existing as NH3/NH4+ or as part of organic molecules, must be treated through oxidation to nitrogen gas. Nitrogen, left untreated in the effluent, can cause eutrophication, increase oxygen demand in the receiving water, and exhibit toxicity.  Traditionally, wastewater treatment plants (WWTP) uses conventional nitrification/denitrification processes to oxidize the ammonia to nitrate and then reduce the nitrate to nitrogen gas. In the mid 1990s, the anaerobic ammonium oxidation (Anammox) process was discovered. The stoichiometry for the Anammox pathway consumes ammonium and nitrite to produce nitrogen gas. It is theorized that the anammoxosome compartment is responsible for carrying out the Anammox mechanism with hydrazine (N2H4) as the intermediate chemical.  Compared to the traditional nitrification-denitrification method, the Anammox pathway uses no carbon source, at least 50% less oxygen and produces less sludge for disposal. However, the Anammox bacteria have a low maximum specific growth rate ranging between 0.001 h-1 to 0.0027 h-1. The doubling time is ~11 days which is significantly higher than the nitrifiers and the heterotrophs present in the nitrification/denitrification process. Nonetheless current studies are focused on a more thorough understanding of optimization of the Anammox mechanisms at full-scale. Anammox systems are suitable for the treatment of reject water from anaerobic digestion processes as this stream contains high nitrogen concentrations with limited readily biodegradable COD which are suitable conditions for Anammox activity. Although the reject water accounts for ~5% of the total influent flow rate, it can account for as much as 30% of the total nitrogen load. If effluent total nitrogen requirements are imposed and supplemental carbon is needed for traditional nitrification/denitrification, the adoption of Anammox side-stream treatment option   2  was modelled to show economic benefits (Shiskowski, 2013). Since the reject water contains low concentrations of nitrite and nitrate, the ammonium must undergo partial nitritation to nitrite prior to the Anammox step. This can be done in two separate reactors or in a combined single sludge system. Both configurations have been successfully adopted at full-scale for side-stream treatment of reject water derived from anaerobic digestion. Current studies are investigating the use of Anammox for main-stream treatment, specifically with challenges associated with its operation at low temperature and understanding the mechanisms involved with carbon oxidation.  Although Anammox bacteria were thought to be strictly chemolithotrophs, recent evidence provided that Candidatus Brocadia fulgida and Candidatus Anammoxoglobus propionicus are specialized in oxidizing acetate and propionate, respectively. Furthermore, the capacity for the oxidation of organic matter are evidenced to be present in most Anammox bacteria.   1.2. Research Objectives This research focuses on the investigation of the community structure within a combined partial-nitritation Anammox system and the heterotrophic activity of Anammox bacteria under the presence of suitable electron donors. In the initial phase of the research, the one-stage Anammox system was operated as a sequencing batch reactor (SBR) with synthetic feed and seed sludge obtained from the pilot-scale system at the Annacis WWTP. It was necessary to use synthetic feed composition that is analogous to the properties of reject water in order to maintain consistent feed properties throughout the study and limit variability that may be observed with plant reject water. Two SRTs were used for this study, 55 days and 30 days, to determine how the system performance and the microbial community would be affected. Throughout the study, it was necessary to conduct FISH to determine how the volumetric fraction of the three key players (AOB, NOB and Anammox) is influenced by the system parameters. The estimation of the Anammox population was needed to determine the fraction of VSS responsible for Anammox activity during the batch studies used in the kinetics and mixotrophic study. In summary, the main research objectives were as follows:    3   Demonstrate how the system parameters within a one-stage partial nitritation/Anammox system influence the microbial community between the AOB, NOB and Anammox bacteria  Determine how the system performance affects the spatial distribution of the key microbial players within a sludge sample  Determine the kinetic parameters, yield (Y), maximum growth rate (µmax) and affinity constants (KS) for the Anammox bacteria, using a double substrate Monod model  Using Anammox sludge enriched in the absence of organic carbon, determine whether Anammox bacteria can oxidize electron donors acetate, propionate and primary effluent in the presence of electron acceptors nitrite and/or nitrate.      4  2. LITERATURE REVIEW 2.1. Nitrogen Cycle Nitrogen is a versatile element, possessing an oxidation state ranging from +5 to -3. It is not only the main component of air, comprising 78% of the volume, but also one of the key constituents of living organisms for nucleic acids, proteins and cellular processes. In the environment, it typically exists as one of five major forms: NH3, NH4+, N2, NO2- and NO3-. The nitrogen cycle is a collection of processes that encompasses the versatility of nitrogen and its transition from one chemical form to another. The processes, within the global nitrogen cycle, are mainly biological but anthropogenic influences, such as the Haber-Bosch process for industrial fixation, have certainly made an impact. An overview of the nitrogen cycle is summarized in Figure 2.1.   Figure 2.1 Overview of the nitrogen cycle. Adapted from (Schnell, et al., 2003)    5  2.2. Conventional Biological Nitrogen Removal Process: Nitrification-Denitrification In the context of wastewater treatment, nitrogenous compounds originate from anthropogenic sources which include municipal waste, industrial waste, agricultural run-offs, landfill leachate and others. The nitrogen in municipal wastewater mainly exist as NH3/NH4+ or as part of organic molecules, like proteins. Complex colloids remain suspended in the water, while simple amino acids undergo deamination, resulting in the release of amino groups (Gerardi, 2006). The liberated amino groups form NH3 and NH4+, which is in chemical equilibrium based on the pH and temperature. In a typical domestic wastewater, the composition of nitrogen is approximately 60% in the organic form and 40% in the inorganic form (Gerardi, 2002).  Nitrogen, left remaining in the effluent, can cause eutrophication, increase oxygen demand in the receiving water, induce toxicity, and result in production of nitrous oxide, a powerful greenhouse gas. For these reasons, regulations are in place to limit the presence of nitrogen in the effluent. The Wastewater Systems Effluent Regulations limits in-stream levels of un-ionized ammonia to 0.016 mg N/L (Environment Canada, 2012). In British Columbia, the Municipal Wastewater Regulation requires the concentration of NO3-N and total N in class A municipal effluent to be less than 10 mg/L and 20 mg/L, respectively (Ministry of Environment, 2012).  Removal of nitrogenous compounds is generally achieved through biological nutrient removal (BNR) processes, which involve the use of activated sludge systems with aerobic, anoxic and/or anaerobic zones. The principal biological process is the nitrification-denitrification process, which involves the oxidation of ammonia to nitrate and subsequently, the reduction of nitrate to dinitrogen gas. It should be noted that a fraction of the nitrogen is removed through assimilation associated with the growth of the biomass. Nitrification-denitrification can be carried out in numerous design configurations (oxidation ditch, modified Ludzack-Ettinger process (MLE), four-stage Bardenpho, and others) to reduce nitrogen concentration to acceptable levels in the effluent prior to discharge into the receiving water (Grady, et al., 2011).    6  2.2.1. Nitrification Nitrification, in the context of wastewater systems, is mediated primarily by chemolithoautotrophic bacteria that derive energy from the oxidation of ammonia or nitrite and organic carbon for cellular growth from carbon dioxide fixation via the Calvin cycle (Head, et al., 1993). It occurs as a two-step process that involves ammonium oxidation to nitrite and nitrite oxidation to nitrate, by two distinct groups of bacteria. Thus far, no single autotrophic bacterium capable of oxidation of ammonium directly to nitrate has been found (Grady, et al., 2011).  The bacteria, responsible for the oxidation of ammonia to nitrite, are collectively referred to as ammonia-oxidizing bacteria (AOB) and confined to two monophyletic lineages within the Proteobacteria (Norton, et al., 2001; Bitton, 2011; Purkhold, et al., 2000). Nitrosococcus oceani  is affiliated with the γ-subclass of the Proteobacteria (Purkhold, et al., 2000). Nitrosomonas, Nitrosospira, Nitrosolobus and Nitrosovibrio belong to the β-subclass of the Proteobacteria (Purkhold, et al., 2000). Members of the genus Nitrosomonas are commonly detected in wastewater treatment plants by 16S rRNA and amoA sequence analysis, the gene that encodes for the α-subunit of the AMO (Purkhold, et al., 2000). Therefore, Nitrosomonas is considered the most important AOB in wastewater treatment. In fact, the same analyses provided insight into the phylogenetic diversity of AOB and the discovery of the ammonia-oxidizing archaea (AOA) (Treusch, et al., 2005).   The oxidation of ammonia to nitrite occurs with a hydroxylamine intermediate (NH2OH) as a two-step process. The formation of hydroxylamine is catalyzed by a membrane-bound ammonia monooxygenase (AMO) enzyme (Equation 2-1). The molecular oxygen acts as the terminal electron acceptor and is also incorporated into hydroxylamine. Hydroxylamine is further oxidized by a hydroxylamine oxidoreductase (HAO) enzyme to nitrite (Equation 2-2) (Hollocher, et al., 1981; Andersson & Hooper, 1983). Finally, the oxygen is consumed by the terminal oxidase from the electron transport, which generates adenosine triphosphate (ATP) for cellular metabolism (Equation 2-3) (Chain, et al., 2003). Due to the small amount of energy produced from the oxidation process, AOB are characterized with low growth rates and yields, which make isolation difficult (Bollmann, et al., 2011). Furthermore, it was demonstrated that   7  ammonia is the actual substrate for AMO, rather than ammonium, from studies done on the pH dependence of the reaction rate and cell membrane permeability (Suzuki, et al., 1974; Kleinder, 1985).               -                        -               (Equation 2.1)                   -       -         -                (Equation 2.2)             -       (Equation 2.3)  The second-step of nitrification involves the oxidation of nitrite to nitrate by bacteria collectively referred to as nitrite-oxidizing bacteria (NOB). NOB are spread over five genera, scattered among the phylogenetic tree, which include Nitrobacter, Nitrococcus, Nitrospina, Nitrospira, and Nitrotoga (Daims, et al., 2001; Spieck & Lipski, 2011). Nitrobacter can exhibit heterotrophic activity – being able to grow in the presence of acetate, formate or pyruvate – while the other genera mostly exhibit lithotrophic activity (Grady, et al., 2011; Spieck & Lipski, 2011).  The oxidation of nitrite to nitrate is catalyzed by the nitrite oxidoreductase (NOR) and is known to be a reversible process under anaerobic conditions (Equation 2-4). The significance of the reversible process in nature is still unknown (Ward, 2011), but it occurs in the absence of oxygen. The electrons released in the reaction are transferred to oxygen via a respiratory chain with a terminal oxidase (Equation 2-5). During complete nitrification, alkalinity decreases by 7.14 mg of CaCO3 per mg of NH4+-N oxidized to nitrate (van Rijn, et al., 2006).                      -      (Equation 2.4)         -          (Equation 2.5)  Although Nitrobacter is the most studied in wastewater treatment plants and other environments, Nitrospira is often detected in nitrifying biofilms and activated sludge samples using FISH and is sometimes the dominant NOB genus in wastewater environments. One possible reason for this is   8  that Nitrospira is a K-strategist that can thrive under low NO2- concentration, while Nitrobacter requires higher nitrite concentrations (Schramm, et al., 1996).  2.2.2. Denitrification The second step of biological N removal is denitrification, an anoxic process involving the dissimilatory reduction of nitrite and nitrate to the gaseous oxides, nitric oxide (NO) and nitrous oxide (N2O), which can further be reduced to N2 gas. The bacterial process is nearly exclusively a facultative trait, being triggered under the absence of oxygen and availability of oxidized N species (Zumft, 1997). Although more than one enzymatic reduction pathway exists, it generally follows the sequence shown in Equation 2-6. It should be noted that denitrifiers can perform the entire or parts of the pathway, depending on affinities, presence of inhibitors, environmental favors and other conditions.     -                          -                                                                                             (Equation 2.6)  Denitrifiers are spread over numerous taxonomic groups and can use various energy sources (organic chemicals, inorganic chemicals and light). Currently, there are more than 50 genera and 130 species of denitrifers in the domain of Bacteria and Archaea (Zumft, 1997). Denitrification is predominantly carried out by heterotrophic bacteria, but autotrophic denitrifiers also exist. Well-known genera include Acetobacter, Pseudomonas, Alcaligenes, Thiobacillus, Rhizobium, Spirillum and others (Bitton, 2011).  Organic carbon compounds are most commonly used as a source of electron donors and carbon to carry out heterotrophic denitrification. Sources include pure organic compounds (e.g. acetate, propionate, methane, methanol, ethanol), raw influent, waste from food industries (e.g. brewery waste, pickling waste), endogenous decay products and others. Autotrophic denitrification use inorganic compounds, such as Mn2+, Fe2+, sulfur and H2 as electron sources while deriving carbon from the alkalinity (van Rijn, et al., 2006). In the context of wastewater treatment, heterotrophic denitrification is dominant. During heterotrophic denitrification, the organic   9  substrates are completely oxidized to carbon dioxide. In this way, alkalinity consumed during nitrification is partially replenished by denitrification at a stoichiometric ratio of 3.57 mg CaCO3 per mg of NO3-N denitrified (van Rijn, et al., 2006). An example equation using methanol as the carbon source is shown in Equation 2-7 (Grady, et al., 2011).                               (Equation 2.7)  The C/N ratio in denitrification is particularly important with regard to whether complete nitrate reduction to elemental nitrogen is achieved. For readily consumable organic carbon sources, a COD/NO3--N (w/w) ratio from 3 – 6 allowed for a complete reduction of nitrate to dinitrogen gas (Montieth, et al., 1979; Skinde & Bhagat, 1982). Below this range, carbon becomes limited and the accumulation of intermediate products, nitric oxide and nitrous oxide, occurs (Itokawa, et al., 2001). The production of nitrous oxide should be avoided as it is a greenhouse gas and is about 300 times more potent in trapping heat, on a weight basis, than carbon dioxide (EPA, 2013).   2.3. Anaerobic Ammonium Oxidation (Anammox) 2.3.1. Discovery of Anammox Bacteria Prior to the discovery of Anammox bacteria, the global nitrogen cycle - involving changes in the oxidation state and chemical forms of N - was centered on four underlying processes: fixation, ammonification, nitrification, and denitrification. Furthermore, it was believed that the oxidation of ammonia was restricted to oxic environments (i.e. nitrification). Recent discoveries of ammonia oxidation within the domain Archaea and anaerobic ammonium oxidation have changed the traditional 'linear' approach to the global nitrogen cycle (Francis, et al., 2007), providing insight into the complex microbial players and pathways that were previously unknown.   The theoretical pathway for Anammox was hypothesized as early as 1920s. Carrying out such a pathway by biological means was first proposed in 1977 by Broda, who stated that "two kinds of lithotrophs are missing in nature" based on thermodynamic grounds (Broda, 1977). By then, it was well established by microbiologists that prokaryotes are versatile in their energy metabolism   10  through the use of enzymes. Calculations based on Gibbs free energy showed that photolithotrophs and chemolithotrophs, capable of generating N2 from ammonium, may exist in nature. The discovery of Anammox bacteria confirmed the existence of the hypothesized chemolithotrophs, but the photolithotrophs are yet to be found.  Mulder et al. provided the first evidence of Anammox in a wastewater system through studies done on a denitrifying fluidized bed reactor treating effluent from a methanogenic reactor (Mulder, et al., 1995). Prior to this study, the oxidation of ammonium was thought to only occur under aerobic conditions. However, anaerobic fed-batch studies, using biomass collected from the fluidized bed reactor, showed that ammonium loss coincided with the removal of nitrate and gas production. Providing the first evidence of 'anaerobic ammonium oxidation,' the term Anammox was coined to describe the process. Based on the initial discovery, the following stoichiometry was proposed (Equation 2-8) (Mulder, et al., 1995).            -                      -               (Equation 2.8)  From a thermodynamic point of view, it was postulated that the exergonic reaction (ΔG° = -297 kJ / mol NH4+), based on Equation 2.8, can supply the energy for cellular growth, providing evidence for a biologically mediated process. Van de Graaf et al. (1995) proved that Anammox is indeed a biological process by showing that ammonium removal did not occur when the biomass was subjected to inhibition, heat-inactivation and irradiation. Furthermore, tracer studies conducted using 15N showed that nitrite is the direct oxidizing agent, rather than nitrate (van de Graaf, et al., 1997). Thus, the refined Anammox stoichiometry accepted today is shown in Equation 2-9 (van de Graaf, et al., 1997).          -                 -                (Equation 2.9)  In nature, Anammox bacteria has shown to be an active player in the global nitrogen cycle; studies on nitrogen turnover within marine environments estimate that Anammox mechanism   11  may be responsible for 30 - 50% of N2 production in the ocean (van de Graaf, et al., 1996; Kuypers, et al., 2006; Lam & Kuypers, 2011). High-resolution nutrient profiles, 15N sediment incubations, ladderane lipid analysis and 16S rRNA techniques have showed that Anammox bacteria are active in a variety of environments, including the suboxic zone of the Black Sea (Kuypers, et al., 2003), the Benguela oxygen minimum zone off the Namibian coast (Kuypers, et al., 2006), and temperate and arctic sediments (Thamdrup & Dalsgaard, 2002; Rysgaard, et al., 2004). It is clear that Anammox is a active player in the global nitrogen cycle and thus, current studies are aimed at better understanding how Anammox activity can be harnessed for wastewater applications.   2.3.2. Characterisation of Anammox Bacteria 2.3.2.1. Phylogenetic Biodiversity Anammox bacteria constitute a deeply branching monophyletic group within the phylum Planctomycetes (Strous, et al., 1999; Jetten, et al., 2009). Five genera of Anammox bacteria have been discovered so far as outlined in Table 2.1: Candidatus Brocadia, Candidatus Kuenenia,  Candidatus Scalindua, Candidatus Anammoxoglobus and Candidatus Jettenia (Schmid, et al., 2005; Kartal, et al., 2007; Ding, et al., 2013). The Candidatus status comes from the fact that no Anammox bacteria have been isolated in pure culture form. Within the five Anammox genera, the following species have been identified with 16S rRNA gene sequence identities of the species ranging between 87% and 99% in similarity (Jetten, et al., 2009):  Table 2.1 Phylogeny of Anammox bacteria discovered to date. Adapted from (Ding, et al., 2013) Genus Species Electron acceptors References Brocadia Candidatus Brocadia anammoxidans NO2- (Jetten, et al., 2001)  Candidatus Brocadia fulgida NO2- (Kartal, et al., 2008)  Candidatus Brocadia sinica NO2- (Hu, et al., 2010) Kuenenia Candidatus Kuenen stuttgartiensis NO2- (Schmid, et al., 2000) Scalindua Candidatus Scalindua brodae  NO2- (Schmid, et al., 2003)  Candidatus Scalindua wagneri NO2- (Schmid, et al., 2003)  Candidatus Scalindua sorokinii  NO2- (Kuypers, et al., 2003)   12  Genus Species Electron acceptors References  Candidatus Scalindua arabica  NO2- (Woebken, et al., 2008)  Candidatus Scalindua sinooifield NO2- (Li, et al., 2010)  Candidatus Scalindua zhenghei NO2- (Hong, et al., 2011)  Candidatus Scalindua richardsii NO2- (Fuchsman, et al., 2012) Jettenia Candidatus Jettenia asiatica NO2- (Tsushima, et al., 2007) Anammoxoglobus Candidatus Anammoxoglobus propionicus  NO2- (Kartal, et al., 2007)  Candidatus Anammoxoglobus sulfate  SO42- (Liu, et al., 2008)  Notable facts about specific Anammox species are shown:  The 4.2-megabase genome of the Kuenenia stuttgartiensis was sequenced (Strous, et al., 2006), providing information on the intricate Anammox biochemical pathway.  Anammoxoglobus propionicus co-oxidizes propionate and ammonium (Kartal et al. 2007), whereas Brocadia fulgida co-oxidizes acetate and ammonium (Kartal, et al., 2008). Although these two species represent an ecological niche for organic matter, the ability to oxidize organic carbon has been seen in other Anammox bacteria.  Scalindua sorokinii and Scalindua arabica have been found in the seawater while Scalindua brodae and Scalindua wagneri have been found in wastewater facilities (Schmid, et al., 2007).       13  2.3.2.2. Overall Reaction Stoichiometry of Anammox The stoichiometry for Anammox metabolism has been determined experimentally by (Strous, et al., 1998), as shown in Equation 2-10.                                                  -                            (Equation 2.10)  Based on experiments, the complete Anammox stoichiometry requires about 30% more nitrite than ammonium and they oxidize 11% of the initial total nitrogen to nitrate. The excess nitrite is used for the fixation of carbon dioxide through the acetyl-CoA pathway (Strous, et al., 2006), leading to the production of nitrate.  2.3.2.3. Physiology of Anammox Bacteria Anammox bacteria are coccoid with a diameter of less than 1 µm (van Niftrik, et al., 2004). A feature shared among the phylum Planctomycetes, to which the Anammox bacteria belong, is the differentiated cytoplasm (Lindsay, et al., 2001). As evidenced through electron microscopy, the differentiation is particularly unique in Anammox bacteria, and is broken down into three compartments by three individual bi-layer membranes. From outside to inside, they are the paryphoplasm, riboplasm, and the anammoxosome compartment (van Niftrik, et al., 2010). The Anammox cell layout is illustrated in Figure 2.2.   Figure 2.2 Schematic of the Anammox cell (left) and the postulated anaerobic ammonium oxidation pathway (right). Adapted from (van Niftrik, et al., 2008)   14  This unique Anammox cell plan was conserved among all four genera using transmission electron microscopy and electron tomography (van Niftrik, et al., 2008), suggesting that the principal function across the genera are consistent.   Unique to Anammox bacteria is the presence of an extra membrane-surrounded intracellular compartment, called the anammoxosome. It comprises the majority of the cell volume, and is theorized to be functionally equivalent, as an energy producing organelle, to mitochondria in eukaryotic cells (van Niftrik, et al., 2008). The cell wall of the anammoxosome is dense, containing membrane lipids with ladderane moieties (linearly concatenanted cyclobutane rings). Despite up to 87% difference in 16S rRNA gene identity, all four genera of Anammox bacteria have relatively unchanged ladderane fatty acid biosynthesis (Rattray, et al., 2008).  The ladderane lipids reduce the permeability across the anammoxosome membrane, an essential feature in limiting the passive diffusion of hydrazine (N2H4) which readily diffuse in normal biomembranes (Sinninghe Damste, et al., 2005). From a bioenergetics perspective, limiting the loss of the hydrazine intermediate is essential in maintaining an efficient metabolic process. Hydrazine is also known to be toxic and mutagenic, thus containing the intermediate within the anammoxosome would prevent damage to DNA (van Niftrik, et al., 2004). The current theory on the metabolic pathway suggests that the ladderane membrane is able to generate and maintain a electrochemical proton gradient for energy generation and anabolic activities (van Niftrik, et al., 2004). This is supported by recent studies on cultures of Kuenenia stuttgartiensis looking at the intracellular pH gradient (van der Star, et al., 2010), which found a pH difference of 1.0 between the anammoxosome and the cytoplasm. The pH difference could potentially generate up to 60mV of proton motive force.   2.3.2.4. Theorized Anammox Metabolic Pathway The current biochemical pathway on Anammox reaction, based on the genome of Kuenenia stuttgartiensis, is summarized in Figure 2.2. Nitrite is first reduced to nitric oxide by a nitrite reductase (nir). Nitric oxide is combined with ammonium to form hydrazine catalyzed by the enzyme hydrazine hydrolase (hh). Finally hydrazine is oxidized to N2 by   15  hydrazine/hydroxylamine oxidoreductase (hao). The Anammox reaction creates a proton gradient, generating a proton motive force, by the movement of protons from the riboplasm into the anammoxosome (Lindsay, et al., 2001). In theory, the gradient would allow protons to flow back to the riboplasm through the membrane-bound adenosine triphosphatases (ATPase), generating ATP in the riboplasm. This is thought to be similar to respiratory oxidative phosphorylation and photosynthetic phosphorylation (van Niftrik, et al., 2004).  2.4. Application of the Anammox Process As Anammox is catalyzed by strictly anaerobic and autotrophic bacteria, significant costs for aeration and carbon sources can be saved if the process is adapted for wastewater treatment. Compared to the conventional nitrification-denitrification process, Anammox provides operational cost benefits as follows (Table 2.2):  Table 2.2 Comparison of nitrogen removal processes   Conventional nitrification / denitrification Nitritation -denitritation  Partial nitritation (50%)  -Anammox (two reactors)  Partial nitritation  -Anammox (single reactor)  Number of reactors 2 2 2 1 Main bacteria involved AOB and NOB / denitrifiers AOB / denitrifiers AOB / Anammox AOB + Anammox Oxygen demand 1 [g O2 /g N] 4.1 - 4.6 / 0 3.16 / 0 1.72-2.06 / 0 1.94 % O2 saving 1 - 24.9% 62.6% 57.5% Alkalinity consumed 1 [g CaCO3 / g N] 7.07 / -3.57 7.07 / -3.57 3.68 3.68 COD / N ratio 2 [g COD / g N] 3 - 6 2 - 4 0 0 Sludge production 2 [g dry weight / g N] 1-1.2 0.8-0.9 <0.1 <0.1 1 (Ahn, 2006) 2 Values based on using methanol as the carbon source (van Hulle, et al., 2010)   100% reduction in biodegradable organic carbon  At least 50% less oxygen (by stoichiometry, 0.85 mols of O2/mol NH4+ for anammox compared to 2 mols of O2/mol NH4+ for conventional nitrification/denitrification)   16   Generally no need for pH control when treating reject water, since the alkalinity available in reject water allows approximately half the ammonium to be oxidized (Jetten, et al., 2002)  Low production of excess sludge  Reduction of CO2 emission due to autotrophic nature of partial nitritation and Anammox (Mulder, 2003)  Although the volumetric flow of reject water from anaerobic digesters is below 5%, compared to the inflow to a WWTP, it can account for as much as 30% of the total N-load to the treatment plant (Thornton, et al., 2007; Henze, et al., 2008). Reject water is characterized with high ammonium concentration and high temperature (20 - 35°C), which are suitable for Anammox activity when combined with a partial nitritation. Although COD is present in reject water, it typically exists as a slow biodegradable organic (van Hulle, et al., 2010), since the fast biodegradable organic matter is converted to biogas during anaerobic digestion. Thus, there is insufficient organic matter to support denitrification and through the application of Anammox, out-competition by denitrifiers can be avoided. Implementation of Anammox for side-stream treatment can lower the TKN values in the main-stream effluent - ideal for plants needing to meet more stringent discharge regulations - and also reduce operational costs compared to nitrification-denitrification.  2.4.1. Relevant Kinetic Parameters Due to the recent discovery of the Anammox process, kinetic parameters in the literature are quite limited and also variable. The maximum specific growth rate varies from 0.001 h-1 (van de Graaf, et al., 1996), 0.0027 h-1 (Strous, et al., 1998) and 0.0016 h-1 (Isaka, et al., 2006). These have all been determined from mixed cultures, as pure cultures of Anammox have not yet been isolated. The biomass yield is approximately 0.11 - 0.13 g VSS/g NH4+-N and the doubling time is  ~11 days (Strous, et al., 1997). However, van der Star et al. (2008) enriched Anammox in a MBR reactor as free cells, showing a doubling time as low as 5.5 - 7.5 days. Nonetheless, the inherent slow growth rates require a long start-up period, if insufficient seed sludge is available (Trigo, et al., 2006).    17  Strous et al. (1999), found the affinity constants, KNH4+ and KNO2- to be both less than 0.1 mg/L. The study used biomass aggregates enriched in synthetic feed obtaining equimolar ratios of NH4+ and NO2-. The aggregates were disrupted using magnetic stirring to reduce the aggregate diameter to <50µm. At the low substrate concentrations, a deviation from zero-order kinetics was observed which could have been caused by the approach to the affinity constant or mass transfer limitations. Thus it was concluded that the affinity constants must be equal or less than 0.1 mg/L.  2.4.2. Key System Conditions in a Partial Nitritation - Anammox System The treatment of reject water requires a two-step process consisting of partial nitritation, followed by Anammox. The partial nitritation step oxidizes over 50% of the ammonium to nitrite to meet the NH4+:NO2- ratio of 1:1.32 needed for the subsequent Anammox step. In practice, the two steps can be done in separate systems or as a single sludge system. General guidelines for deammonification system are as follows:  System conditions, such that the growth rate of AOB is greater than the growth rate of NOB (high temperature, low dissolved oxygen, high pH). Sludge management should be done to wash out NOB population over time.  Ensure the maximum growth conditions for Anammox, which are characterized with a slow growth rate. The system must be designed for high biomass retention.  Prevent inhibiting conditions for AOB and Anammox (e.g. high NO2-, heavy metals, etc)  2.4.2.1. pH Influence on Chemical Equilibria and Activity Nitrification The equilibria between NH4+ / NH3 and NO2- / HNO2 are a function of both pH and temperature, as shown by Equation 2-11 and Equation 2-12.                                      (Equation 2.11)                -   -               -    (Equation 2.12)    18  With constant temperature and rise in pH, the concentration of ammonia increases while the concentration of nitrous acid decreases. This promotes AOB activity but suppresses NOB activity. Based on this theory, NOB can be outcompeted between pH range of 7.5-8. Higher than pH of 8, ammonia is the main inhibitor to nitrification, while below pH of 7.5, nitrous acid is the main inhibitor (van Hulle, et al., 2010). However, determining the ideal pH conditions for partial nitritation is complex, as studies have shown that both AOB and NOB can acclimate to inhibiting concentration of ammonia and nitrous acid (Anthonisen, et al., 1976; Prakasam & Loehr, 1972; Turk & Mavinic, 1989).  High concentrations of the substrates are not beneficial. Anthonisen et al. (1976) showed that NH3-N concentration that inhibits microbial function is between 10–150 mg/L and 0.1–10 mg/L for Nitrosomonas and Nitrobacter, respectively. Furthermore, inhibition of nitrifying bacteria was observed at nitrous acid concentration of 0.22–2.8 mg/L. As nitrification proceeds, the pH of the system decreases, shifting the equilibrium towards nitrous acid; total NO2-/HNO2 concentration must be maintained low to prevent inhibition. The mechanism of direct toxicity by nitrite and nitrous acid is believed to be due to increase in proton permeability across the cellular membrane which inhibits exchange reactions catalyzed by the ATPase (Almeida, et al., 1995a; Rottenberg, 1990). Another theory is the formation of radicals from nitrite reduction metabolites, which can form metal-nitroxyl complexes within the bacterium (Stein & Arp, 1998; Zumft, 1993).  To ensure nitrite accumulation, NOB must be selectively washed out in a deammonification system. Hellinga et al. (1998) showed that the growth rate of AOB and NOB is dependent on pH; growth rate of NOB diminishes with rising pH and growth rate of AOB increases with rising pH. Furthermore, it is known that below a pH of 7.0, nitrification rates are significantly reduced. Reduction of nitrification rates can negatively affect the overall nitrogen removal rate in a deammonification system as the production of NO2- is the limiting condition for Anammox activity. Thus, the addition of alkalinity should be considered in order to maintain a pH of 7-8 in the system.    19  Anammox The optimal pH range for Anammox is 6.7 - 8.3 with an optimum of 8.0 (Strous, et al., 1999).   2.4.2.2. Effect of Nitrite Inhibition on Anammox Nitrite is an important parameter for Anammox activity, both as a electron acceptor substrate and a potentially inhibiting compound. Despite numerous studies conducted on the inhibition effects of nitrite, no uniformity has been found regarding the nitrite concentration threshold nor the  reversibility of the inhibition. Studies have reported that the inhibition can be overcome by the addition of Anammox intermediates: hydrazine and hydroxylamine (Strous, et al., 1999; Li, et al., 2004). Literature values for the inhibition of Anammox by nitrite are listed in Table 2.3.  Biofilm or granule thickness likely influences the concentration at which nitrite inhibits Anammox bacteria. A thick biofilm/granule provides a slow diffusion of nitrite to the inner Anammox layer, providing a concentration gradient that provides protection. Vazquez-Padin et al. (2009) observed no negative effects, despite operating at a mean nitrite concentration of 25 mg N/L over the first 100 days of operation.    20  Table 2.3 Reported values for nitrite inhibition on the Anammox process. Adapted from (Lotti, et al., 2012) Reference Nitrite level [mg N/L] Determination method Batch (B) or reactor (R) Anammox taxonomy Aggregation status Process configuration 1 Reactor volume (L) 2 pH Normal operation nitrite level [mg N/L] (Strous, et al., 1999) 100 (“complete inhibition”) NO2- conversion rate B Candidatus Brocadia anammoxidans homogenized aggregates 2 10 7, 7.4, 7.8 0-1.4 (Dapena-Mora, et al., 2007) 350 (IC50) manometric B Candidatus Kuenenia Stuttgartiensis flocculent 2 1 7.8 0-15c (Lopez, et al., 2008) 100 (inhibition) nitrite accumulation R Candidatus Brocadia anammoxidans granular 2 15 7.5-8.2 “close to zero” (Fernandez, et al., 2012) ≈350 (IC50) manometric B Candidatus Kuenenia Stuttgartiensis biofilm on support 2 5 7.8 0-25 (Fernandez, et al., 2012) ≈120 (IC50) manometric B Candidatus Kuenenia Stuttgartiensis flocculent 2 1 7.8 0-15 (Kimura, et al., 2010) >300 (37% loss at 430) NO2- conversion rate B Candidatus Brocadia anammoxidans gel carriers 2 0.5 n.d. 0-60 (Oshiki, et al., 2011) 224 (IC50) NO2- conversion rate B Candidatus Brocadia sinica Flocculent3 2 0.8 7.0-7.5 n.r. (Lotti, et al., 2012) 400 (IC50) manometric (batch) B Candidatus Brocadia anammoxidans granular 2 70000 7.5 0-85 1 Nitritation and Anammox processes in a single reactor (1) or in separate reactors (2) 2 When experiment are conducted in batch this column reports information on the origin of the biomass used 3 Biofilm samples were dispersed by magnetic stirring for 2h (aggregates diameter <100 μm) n.r. not reported; n.d. not determined   21  2.4.2.3. Dissolved Oxygen Nitrification Maintaining low oxygen concentration favours the growth of AOB over NOB; NOB have a lower oxygen affinity than AOB (Blackburne, et al., 2008). The oxygen half saturation constant, Ko, for enriched AOB (identified as Nitrosomonas) and NOB (identified as Nitrobacter) were 0.033 ± 0.003 mg O2/L and 0.43 ± 0.08 mg O2/L, respectively. In the same study, a continuous process at a DO concentration of 0.4 mg/L and dilution rate of 0.42 d-1 showed that NOB was washed out while the AOB was retained, leading to the build-up of nitrite. Other studies find that the half-saturation coefficient for AOB and NOB vary in the range of 0.25 - 0.5 mg O2/L and 0.34 - 2.5 mg O2/L, respectively (Barnes & Bliss, 1983). This has been attributed to the fact that the concentration of O2 in the bulk system is typically different from that within biofilms and flocs.  Overall, AOB and NOB share a symbiotic relationship since, AOB product the nitrite required as substrate by the NOB, which in turn prevent the accumulation of nitrite which can be toxic to AMO function (Stein & Arp, 1998). However, under oxygen limited environments, AOB and NOB both compete for O2 to carry out the oxidation of NH3 and nitrite, respectively. In particular, a low oxygen, high ammonium environment resulted in the washout of NOB and the formation of nitrite, as well as nitric oxide and nitrous oxide (Sliekers, et al., 2005). In a fluctuating dissolved oxygen system, alternating between oxic and anoxic states, AOB has been shown to endure the fluctuations while the NOB did not (Peng, et al., 2000; Peng, et al., 2004; Yoo, et al., 1999). Nitrite concentration peaks can be seen from switching the system from the anoxic to the oxic phase, which is indicative of a lag time present within nitrification. The lag time may allow nitrite to be reduced by Anammox activity rather than oxidized by NOB.     The complexities of DO control is magnified when considering the autotrophic nitrous oxide (N2O) generation by AOB under low dissolved oxygen conditions (Shiskowski, et al., 2004). In this study, AOB competed with NOB for exogenous nitrite for N2O generation under DO concentrations below 0.5 mg/L. Autotrophic N2O generation would limit the oxidation of nitrite via Anammox pathway and produce greenhouse gases which are undesirable.   22  Anammox Anammox bacteria is inhibited by oxygen partial pressure of only 0.5% of air saturation (Strous, et al., 1997), but the inhibition is thought to be reversible if anaerobic conditions are established. In one-stage systems, Anammox bacteria generally form granules or biofilms with AOB growth on the surface, acting as a protective barrier for Anammox bacteria for dissolved oxygen (Tsushima, et al., 2007). The segregation of the two bacterial groups provides an oxygen concentration gradient for dissolved oxygen, while maintaining spatial proximity for nitrite uptake by Anammox bacteria.  2.4.2.4. Alkalinity Since nitrification is an autotrophic process, the deficiency of inorganic carbon substrate is thought to result in a decrease in process rate as it would be for other substrates such as ammonium or oxygen (Guisasola, et al., 2007; Wett & Rauch, 2003). When total inorganic carbon (TIC) was below 3 mM, limitation on nitrification activity was observed with AOB activity being more significantly affected than NOB activity (Guisasola, et al., 2007). Since nitrification lowers the pH and causes CO2 stripping, you need at least 3.68 g CaCO3/g N to ensure complete oxidation of influent ammonium without pH loss.  2.4.2.5. Temperature Nitrification Temperature is an important parameter in nitrification as it influences mass transfer, chemical equilibrium and the growth rate of AOB and NOB (van Hulle, et al., 2010). A temperature has two opposite effects in terms of optimally performing nitrification: increased ammonia inhibition and higher activity of AOB.  Studies based on pure cultures showed that the optimal temperature for AOB and NOB are 35ºC and 38ºC, respectively (Grunditz & Dalhammar, 2001). Temperatures higher than 40ºC should be avoided as it leads to degradation (Hellinga, et al., 1999).      23  In a deammonification system, maintaining the system temperature above 25°C, with an appropriate SRT, leads to the selective washout of NOB, as shown in Figure 2.4.   Figure 2.3 Minimum SRTs with respect to temperature for AOB and NOB. Adapted from (Hellinga, et al., 1998)  Higher temperatures also increase the ammonia concentration according to Equation 2-11. Thus operating at a higher temperature can preferentially inhibit the NOB population, which are inhibited at lower ammonia concentrations than AOB (Fdz-Polanco, et al., 1996).  Anammox The optimum temperature for Anammox systems is reported to be between 30 - 40ºC (Strous, et al., 1999; Egli, et al., 2003). Temperature of 45ºC caused an irreversible reduction in activity due to cell lysis. Optimum temperature with regard to specific species showed that Kuenenia Stuttgartiensis has the highest activity at 37ºC, while Brocadia anammoxidans have the highest activity at 37ºC at a pH of 8.    24  Anammox process is also applicable under moderate temperatures (Isaka, et al., 2007; Cui, 2012). Isaka et al. (2007) studied a fixed-bed system maintained at a temperature range of 20 - 22ºC. For over 1.5 years, the system operated steadily, achieving a nitrogen conversion rate of 8.1 kg N / m3-d. Cui (2012) operated a CANON system at 15ºC. Despite a higher growth rate of NOB than AOB at this temperature, limiting the dissolved oxygen concentration provided limitations to NOB growth.  2.4.2.6. Sludge Retention Time Nitrification The minimum doubling time for AOBs is 7-8h and for NOBs 10-13h (Bock, et al., 1986). The full-scale experience in a SHARON system shows that an SRT between 1 and 2.5 days, at temperatures of 30 - 35℃, can maintain partial nitritation (van Kempen, et al., 2001). In contrast, an extended SRT system has also shown success in performing partial nitritation. Pollice et al. (2002) selectively inhibited NOB activity by maintaining a low dissolved oxygen concentration, independent of the sludge age ranging from 10 to 40 days.  Anammox Applying a high SRT is beneficial for the enrichment of Anammox bacteria, as it has a slow growth rate. The use of carrier materials, resulting in the development of biofilms, has shown success in the retention of Anammox bacteria in both lab-scale and full-scale systems. Attached growth systems provide stability to the bacteria population by limiting washout. As a result, these systems are beneficial for the slow growth rate associated with Anammox bacteria.   2.4.2.7. Presence of Organic Matter and Volatile Fatty Acids Nitrification The following volatile fatty acids inhibited NOB but had no effect on AOB: formic acid, acetic acid, propionic acid an n-butyric acid (Eilersen, et al., 1994). The critical concentration, above which the activity of the NOB ceases, was determined to be 115mM for acetic, 68mM for propionic and 33mM for n-butyric acid. Another study by Takai et al. (1997) found that nondissociated fatty acids is responsible for inhibiting NOB, while having no effect on AOB.    25    Anammox Although Anammox can exhibit mixotrophic growth (Guven, et al., 2005; Kartal, et al., 2007; Kartal, et al., 2008), Anammox can be directly inhibited by certain organic compounds. Exposure of Anammox bacteria to alcohols, especially methanol, should be prevented as the inhibition is non-reversible (Guven, et al., 2005). Methanol and ethanol concentrations as low as 15 mg/L led to the immediate and irreversible inhibition of the Anammox process. It is theorized that methanol inhibition occurs due to the formation of formaldehyde by the hydroxylamine oxidoreductase (Paredes, et al., 2007). Even with acetate or propionate, which can be used as substrates by Anammox bacteria, the COD/N ratio must be generally below 1, in order to prevent out-competition by heterotrophic denitrifiers (Chamchoi, et al., 2008).  Interestingly, studies have shown that Anammox bacteria can adapt to the presence of toxic compounds. Toh and Ashbolt (2002) successfully acclimated Anammox bacteria to synthetic coke-oven wastewater characterizied with high COD (2000 - 2500 mg/L COD) and toxic compounds (phenol, 300 - 800 mg/L; cyanides, 10 - 90 mg/L; thiocyanates, 300 - 500 mg/L). However, the acclimation process had to be stepwise and it took 15 months to achieve an ammonium removal rate of 0.062 kg N / m3-d.  2.4.3. Reactor Configurations for Anammox Anammox has been proven to be successful in treating anaerobic digestor reject streams, which are rich in ammonium and alkalinity but low in COD. Both partial nitritation and Anammox must be carried out. The two reaction steps can either be conducted two ways:  Partial nitritation and Anammox are done in two reactors in series, operating under different SRTs and reactor conditions (Combined SHARON-Anammox process). Partial nitritation occurs in the first unit in an aerobic system. The nitrite produced is the influent to the second unit, which is operated under anoxic conditions to perform Anammox. Part of the influent to the overall system must be bypassed to the Anammox step, to provide the required ammonium.   26   Partial nitritation and Anammox are conducted in a single-sludge system (CANON or SNAP process) (Sliekers, et al., 2002). Since both steps are occurring in the same system, aeration process control must be in place to prevent build-up of nitrite, which can inhibit Anammox activity (Egli, et al., 2003).  Single-stage processes show higher volumetric nitrogen removal rate and lower capital costs than the two reactor design. However, the two reactor design is known to have a more stable performance with higher level of control (Veys, et al., 2010). Due to the slow growth rate of the Anammox bacteria, a full-scale process requires a reactor system with very efficient biomass retention.  Examples of such reactors include sequencing batch reactors (SBR), gas-lift reactors, fixed-bed reactors rotating biological contactors (RBC) and upflow anaerobic sludge blanket (UASB) reactors.   2.4.3.1. Completely Autotrophic Nitrogen Removal over Nitrite (CANON) CANON or SNAP (Single-stage nitrogen removal using Anammox and partial nitritation) processes operate with AOB and Anammox bacteria in a single activated sludge system (Third, et al., 2001). Within the CANON design, various configurations are possible (DEMON, UASB, attached growth, etc). CANON is typically run in a SBR (Sequencing batch reactor) configuration or a chemostat, both being able to achieve similar nitrogen removal rates. Unlike the SHARON-Anammox process, the NOB are constrained with a double limitation of oxygen and nitrite; NOB must compete with AOB for dissolved oxygen and with Anammox for nitrite. The growth limiting condition for NOB leads to their washout over time, allowing the system to be mainly dominated by AOB and Anammox bacteria. Figure 2.5 shows the overview schematic for the CANON process.   27   Figure 2.4 Overview schematic of the CANON/SNAP process  The CANON system is sensitive to low concentrations of ammonium, which lowers the activity of AOB and consequently increases the dissolved oxygen concentration. Aside from inhibition to the Anammox population, the increased dissolved oxygen concentration allows for the undesired growth of NOB.  AOB and Anammox bacteria form a symbiotic relationship where AOB are found in the outer portion of the biofilm or granule, to provide nitrite to Anammox bacteria in the oxic-anoxic interface. Nielsen et al. (2005) revealed that the AOB population of N. europaea was limited to <0.1mm thin surface layer of the granules, with Anammox occuring in the deeper anoxic layers. Steady state dissolved oxygen levels are theorized to dictate the biofilm thickness, with higher dissolved oxygen concentrations leading to thicker biofilm and vice versa (Hao, et al., 2002a; Hao, et al., 2002b).   2.4.3.1.1. Deammonification (DEMON) DEMON is a CANON based system with a control strategy designed to perform partial-nitritation with Anammox, while preventing ammonia inhibition, nitrite toxicity and inorganic carbon limitations (Wett, 2007a). The three main control mechanisms in the system are time, pH and DO. The control scheme of the DEMON process is outlined in Figure 2.6.   28   Figure 2.5 Control scheme of the DEMON process Adapted from (Wett, et al., 2007b)  Full-scale implementation has been done (Strass WWTP, Austria, Glarnerland WWTP, Switzerland and others) where nitritation/denitritation SBR systems were converted to DEMON systems (Wett, 2007a). The systems achieved over 90% ammonium removal and decreased the energy demand by 65-70% in terms of energy input per N treated. A key barrier to widespread, full-scale implementation of Anammox systems is the concern of biomass loss through inhibition, washout or general system failures. With a robust control strategy, DEMON systems have shown to overcome full-scale operational challenges.  2.4.3.2.  Single Reactor System for High-Rate Ammonium Removal Over Nitrite (SHARON)-Anammox In the SHARON-Anammox process, partial nitritation and Anammox processes occur in two separate systems. In the SHARON step, partial nitritation is achieved such that the effluent contains 50% of the ammonium and 50% of the nitrite. It operates as a chemostat with no biomass retention, under process conditions that selectively favours AOB growth over NOB. In that sense, the effluent concentration is only dependent on the growth rate (1/SRT) (van Dongen, et al., 2001). The system temperature is between 25 - 35ºC, a range where AOB growth rate is higher than that of NOB. At the operational temperature of 35ºC, the maximum specific growth   29  rate of NOB is approximately half of that of AOB (0.5 and 1.0 d-1, respectively). The HRT is set to be higher than the maximum growth rate of NOB but lower than that of AOB, resulting in the washout of NOB population with time. The effluent from the first stage has approximately equimolar ratios of ammonium to nitrite, which is subsequently fed in to the Anammox system operating under anoxic conditions. The NH4+:NO2- ratio in the effluent is influenced by the pH in the system, allowing a pH control system to be used to achieve a desired ratio (Hellinga, et al., 1999). The Anammox step is carried out in many configurations: fixed-bed, fluidized-bed, SBR, gas-lift, UASB, upflow, MBR and others. The overall schematic of the SHARON-Anammox is shown in Figure 2.7.   Figure 2.6 Overview schematic of SHARON-Anammox process  The process is ideal for sludge liquors which can provide high temperatures required to perform the SHARON process. Furthermore, since there is no sludge retention and the system operates with a fixed HRT, the volumetric loading to the reactor depends on the ammonium concentration in the influent.  2.4.3.3. Reactor Designs for Anammox Anammox process can be implemented in numerous reactor designs as shown in Table 2.4.  30  Table 2.4 Literature findings of Anammox systems Reactor type Influent Support material / type of biomass Maximum N removal capacity Specific reaction rates References Fixed-bed Synthetic medium Glass beads / biofilm 1.1 kg N / m3-d nd (Strous, et al., 1997) Synthetic medium PCV / PP 0.35 / 0.35 kg N / m3-d nd (Fux, et al., 2004) Fluidized-bed Synthetic medium Sand / biofilm 1.8 kg N / m3-d 0.18 kg N / kg VSS-d (Strous, et al., 1997) Sludge digestion effluent Sand / biofilm 1.5 kg N / m3-d 0.15 kg N / kg VSS-d (Strous, et al., 1997) Synthetic medium / sludge liquor Sand / biofilm 5.1 kg N / m3-d 0.04 - 0.26 kg N / kg SS-d (Jetten, et al., 1997) Rotating biological contactor Leachate PVC disc / biofilm nd 0.4 - 1.2 g N / m2-d (Siegrist, et al., 1998) Leachate PVC disc / biofilm nd nd (Hippen, et al., 2001) Synthetic medium PVC disc / biofilm nd 1.55 g N / m2-d (Pynaert, et al., 2002) Moving-bed system Sludge liquor Kaldnes rings / biofilm nd 2.2 g N / m2-d (Hippen, et al., 2001) Sludge liquor Kaldnes rings / biofilm nd 2.0 g N / m2-d (Rosenwinkel & Cornelius, 2005) SBR and DEMON  Partial SHARON effluent / sludge liquor Granular sludge 0.75 kg N / m3-d 0.18 kg N / kg TSS-d (van Dongen, et al., 2001) Partial nitritation effluent / sludge liquor Activated sludge 2.4 kg N / m3-d 0.3 kg N / kg TSS-d (Fux, et al., 2002) Synthetic medium Activated sludge + zeolite carrier material 52 - 130 g N / m3-d 0.30 - 0.34 g N / g VSS-d (Dapena-Mora, et al., 2005) Synthetic medium Granular sludge nd 0.65 kg N / kg TSS-d (Dapena-Mora, et al., 2004) Apeldoorn centrate (DEMON) Granular sludge 0.66 kg N / m3-d nd (AECOM, 2012) Strass centrate (DEMON) Granular sludge 1.20 kg N / m3-d nd (AECOM, 2012) Gas-lift reactor Synthetic medium Granular sludge nd 1.15 kg N / kg TSS-d (Dapena-Mora, et al., 2004) Synthetic medium Granular sludge 8.9 kg N / m3-d nd (Sliekers, et al., 2003) UASB Piggery waste Granular sludge 0.7 kg N / m3-d 0.08 kg N / kg VSS-d (Ahn & Kim, 2004) Effluent from paper mill Granular sludge 0.14 kg NH4+-N / m3-d nd (Schmidt, et al., 2004) MBR Digester effluent Anammox biomass 0.55 kg N / m3-d nd (Wyffels, et al., 2004) Synthetic medium Granular sludge 0.71 kg N / m3-d 0.45 kg N / kg VSS-d (Trigo, et al., 2006) nd = no data   31  3. EXPERIMENTAL DESIGN, MATERIALS and METHODS 3.1. Sequencing Batch Reactor (12L) for One-Stage N Removal 3.1.1. Experimental Set-Up The SBR design was chosen for the research due to its simplicity, efficient biomass retention, reliable operability and ability to achieve a homogenous mixture in the reactor. Literature work with SBR design has successfully achieved Anammox bacteria enrichment (Strous, et al., 1998; Jetten, et al., 1999). The schematic of the SBR setup is shown in Figure 3.1.  Figure 3.1 Schematic of the deammonification SBR system  The lab-scale SBR had a working volume of 11.5 L, with a diameter of 20 cm and height of 45 cm. Approximately 2L of seed sludge was obtained for start-up from the pilot-scale Anammox system from Annacis WWTP. The system was maintained at 33 - 34°C with a submerged heater. The pH was not controlled during the SBR cycle and it ranged from 7.8, after the addition of feed , to 6.0, at the end of the cycle. The HRT was fixed at 2.6 days and the fill volume during   32  the feed cycle was set by the high level switch (which regulated the feed pump). A 1-100 RPM Masterflex pump was used for the feed, while a 6-600 RPM Masterflex pump was used for the effluent. The reactor was mixed at 55 RPM with a paddle stirrer. The reactor was supplied with air through a porous stone, fine-bubble diffuser mounted at the bottom of the reactor. The diffuser volumetric flow rate was set to 300 mL/min and air was delivered intermittently, with an on time of 4 min and off time of 1 min. The DO ranged between 0.05 - 0.30 mg/L durin the study. Intermittent aeration was done in order to maintain anoxic/anaerobic conditions and limit NOB activity which have higher dissolved oxygen affinity constant than AOB. The air flow control was maintained with a solenoid valve coupled to a multifunctional timer (H3CR, OMRON).  The air was provided to the system using an air pump (Maxima, Hagen) with a max capacity of 2600 cm3/min. The SBR setup is shown Figure 3.2.  Figure 3.2 Deammonification SBR system and equipments Controller Mixer Heater Sludge  wasting port pH meter Effluent draw Solenoid valve Flowmeter Aeration timer Aeration pump   33  SBR cycle operation The reactor was operated in cycles of 13 hours, controlled by a PLC timer (Chrontrol XT Timer, Chrontrol Corporations). Each cycle had five phases: 1) Feed phase (0.3 h), the reactor was fed with the synthetic medium with only the mixer and heater on; 2) Aeration phase (12 h), the mixer and heater were on with intermittent aeration; 3) Settling phase (0.3 h),  the mixer, heater and diffuser were off to allow the sludge to settle; 4) Decant phase (0.3h),  the supernatant was pumped out of the reactor; 5) Idle phase (0.1h), sludge was removed as necessary from the reactor. The aeration and the decant phase pictures are shown in Figure 3.3.     Figure 3.3 SBR system during (A) aeration/mix phase, (B) decant phase  Pulse aeration with timer The aeration was controlled by a solenoid valve and done intermittently using a on/off timer that controlled the valve. Vazquez-Padin et al. (2009) showed that pulse air flow can be advantageous (A) (B)   34  compared to the continuous mode, due to the reduction of the aeration costs and better control of target dissolved oxygen concentration. Furthermore, AOB bacteria has shown to be more responsive than NOB bacteria in the transition from anoxic to oxic conditions during the aeration phase. Thus, NOB activity can be effectively minimized by controlling the duration and flow rate of air during the pulse cycles. Furthermore, granular systems can suffer from mass transfer resistance, which can be aided by pulse aeration that momentarily increases the bulk dissolved oxygen concentration (Vazquez-Padin, et al., 2009).  3.1.2. Synthetic Reject Water The synthetic feed composition was based on a modified version of the medium by Van de Graaf et al. (1996) that was modified to fit the chemical compositions of reject water found at the Annacis WWTP. The main reason for the use of Synthetic reject water was to achieve consistent influent conditions to the system and maintain steady state conditions. Table 3.1 lists the feed composition on a per litre basis while Table 3.2 outlines the trace element solution composition.  Table 3.1  Synthetic reject water feed composition (per litre basis) NH4Cl NaHCO3 Na2CO3 KH2PO4 CaCl2•2H2O MgSO4•7H2O FeSO4 EDTA Trace solution 3g 4.2g 0.8g 0.3g 0.17g 0.3g 0.005g 0.005g 1mL  Table 3.2 Trace element solution composition (per litre basis) EDTA ZnSO4∙7H2O CoCl2∙7H2O MnCl2∙4H2O CuSO4∙5H2O NaMoO4∙2H2O NiCl2∙2H2O 15g 0.43g 0.24g 0.99g 0.25g 0.22g 0.19g NaSeO4∙10H2O NaWO4∙2H2O H3BO4 0.21g 0.050g 0.014g  The system parameters found at the Annacis reject water and the synthetic feed used in this study are shown in Table 3.3 Note that the low BOD content of the reject water implies that the organics present in the reject water are not readily biodegradable. Furthermore, the dewatering process at the Annacis WWTP is known to produce relatively high TSS/VSS in the reject water, compared to other plants. In general, it is expected that the solids content in the reject water is low. Furthermore, the nitrite and nitrate was also negligible, making the partial nitritation step necessary prior to the Anammox step.   35  Table 3.3 Average reject water parameters and synthetic reject water used for lab SBR  NH4+-N (mg/L) NO2--N (mg/L) NO3--N (mg/L) pH TSS (mg/L) VSS (mg/L) COD (mg/L) BOD (mg/L) Alk. (mg CaCO3/L) Annacis reject water (average) 1 910.5 0.6 0.3 8.2 280 218.1 429 18 3019 Synthetic reject water (used for study) 786.4 < 0.5 < 0.5 8.0 < 1 < 1 < 2 - 2886 1 Reject water parameters obtained from thesis work by Chumeng Wu (Wu, 2012)  3.1.3. Monitoring Parameters and Sampling Plan To check for Anammox activity, optimized ammonium removal and monitoring system performance, sampling was conducted routinely. Table 3.4 lists the parameters that were sampled and monitored for the SBR system.  Table 3.4 Sampling plan for the SBR system  NH4+-N NO2--N NO3--N pH TSS VSS DO Temp. Alkalinty Feed 1-2/week 1/month 1/month 1-2/week 1/month 1/month nd nd 1-2/week Start of cycle 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week Effluent 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week 3-5/week nd nd 3-5/week nd = not determined  On-line monitoring Dissolved oxygen, temperature and pH were obtained using in-situ probes maintained inside the system throughout the study. The dissolved oxygen and temperature were monitored using a DO meter (YSI Incorporated, model 59). The pH was monitored continuously with a Oaktron pH probes connected to a pH meter (Beckman). Figure 3.4 shows the dissolved oxygen and pH meter used in the study. The dissolved oxygen probe was calibrated daily using a sealed cap with a wetted cotton ball. The ionized solution within the probe was changed once every 3-4 months. The pH meter was calibrated bi-weekly using standard buffer solutions of pH 4, pH 7 and pH 10.    36     Figure 3.4 Dissolved oxygen meter (A) and pH meter (B) used for monitoring SBR performance  Nitrite colorimetric test The build-up of nitrite in the system can have inhibiting effects on the Anammox population and reduce the total nitrogen removal activity. The inhibition is a positive feedback process since the inhibition to a fraction of Anammox population reduces the uptake of bulk nitrite concentration, consequently leading to further inhibition. Thus, nitrite was routinely checked using a colorimetric test to ensure that nitrite concentrations were below 25 mg N/L. This value was based on past experience in the pilot system at the Annacis WWTP where reduced ammonium removal activity was observed when the nitrite concentration was higher than 25 mg N/L, indicating partial inhibition. Furthermore, limiting the nitrite concentration below the inhibiting concentrations shown in Table 2.3, allows  a level of safety factor to exist without limiting Anammox performance (affinity constant < 0.1 mg NO2--N/L).  (A) (B)   37     Figure 3.5 Colorimetric analysis for nitrite. (A) the colour chart with test solution (B) sample  3.2. Analytical Methods Ammonia-nitrogen (NH3-N)  SMEWW 4500-NH3 (SMEWW.4500, 2011)  Flow injection analysis on Lachat QuickChem 8000  Samples were filtered through a 0.45 micron HA filters (Millipore), diluted, preserved with 1 drop of 5% H2SO4 and stored at 4°C, dark until analysis  Nitrite (NO2--N) and nitrate (NO3--N)  SMEWW 4500-NO2- (SMEWW.4500, 2011) and SMEWW 4500-NO3- (SMEWW.4500, 2011)  Flow injection analysis on Lachat QuickChem 8000  Samples were filtered through a 0.45 micron HA filters (Millipore), diluted, preserved with 1 drop of phenyl mercuric acetate and stored at 4°C, dark until analysis  Orthophosphate (PO4-)  SMEWW 4500-P (SMEWW.4500, 2011)  Flow injection analysis on Lachat QuickChem 8000  Samples were filtered through a 0.45 micron HA filters (Millipore), diluted, preserved with 1 drop of phenyl mercuric acetate and stored at 4°C, dark until analysis (A) (B)   38  Alkalinity (as mg/L CaCO3)  SMEWW 2320 (SMEWW.2320, 2011)  pH meter, and a burette containing 0.02N H2SO4  Collected samples were diluted (to reduce acid requirements) and titrated with a 0.02N H2SO4 solution until a final pH of 4.5 was reached. Calculations were done as follows:                                              where A = mL of H2SO4 acid used to reach pH 4.5; N = normality of standard  Solids (TSS and VSS)  SMEWW 2540 (SMEWW.2540, 2011)  The system was thoroughly mixed with a manual paddle then samples were drawn from the middle port in the system. Using a pre-weighed glass microfiber filter (934-AH, GE), a known volume of sample was filtered, and dried in a 100ºC oven (Fischer Scientific). For VSS (volatile suspended solids) determination, the dried samples were placed in a 550 ºC furnace (Lindberg). Calculations were done as follows:      (mg  )   r  weight                       m  of sample     (mg  )   r  weight                            m  of sample  Total organic carbon (TOC)  SMEWW 5310 (SMEWW.5310, 2011)  Shimadzu TOC-500 analyzer  Samples were filtered through a 0.45 micron HA filters (Millipore), preserved with 1 drop of 50% phosphoric acid and stored at 4°C, dark until analysis     39  Chemical oxygen demand (COD)  SMEWW 5220 (SMEWW.5220, 2011)  Hach DR/2000 spectrophotometer at 600nm, COD digester in a fume hood  Samples were filtered through a 0.45 micron HA filters (Millipore). The COD reagent was premade using a stock solution of potassium dichromate (K2CrO7), sulfuric acid (H2SO4), mercuric sulfate (HgSO4) following the standard methods protocol. Two millimeters of the sample were pipetted into the digestion vessel then the vessel was capped and placed in the COD digester for 2 hours. After 2 hours, the samples were cooled, cleaned with a tissue then measured using a spectrophotometer set at 600nm wavelength. Each sample was measured 3 times and the lowest reading was taken.  3.3. Fluorescence in-situ Hybridization (FISH) 3.3.1. FISH Background Fluorescence in-situ Hybridization (FISH) was originally developed by DeLong et al. (1989) and has since grown as an analytical tool for both the identification, quantification and spatial analysis of cells, without the need for cell cultivation (Amann, et al., 2001). FISH involves the use of rRNA-targeted oligonucleotide probes (15-30 nucleotides) which have a fluorescent dye molecule attached on the 5'- end (FITC, cy3, c5, etc). Due to the small size, probes can easily penetrate fixed cells, without disturbing the integrity of the cell structure and microbial community. The technique utilizes the fact that ribosomes are abundant in an active cell (methods such as CARD-FISH is used for low ribosome cells), resulting in fluorescent cells when viewed under a fluorescence microscope.  Ribosomal RNA make ideal target molecules for FISH for several reason: they are found in all living organisms; they are relatively stable and occur in high numbers; and they contain both variable and conserved sequence domains (Amann, et al., 1990; Amann, et al., 1995). In other words, FISH probes can be designed for the entire taxonomic spectrum, targeting at the genera level (e.g. all Anammox bacteria), to specific species (Kuenenia stuttgartiensis) (Amann, et al., 2001). Furthermore, a comprehensive database exists for the 16S subunit for most species and can be accessed at ProbeBase (http://www.microbial-ecology.net/probebase/).    40   Existing methods, such as plate counts or Most-Probable Number, are culture-dependant and only a very small fraction of microbes are cultivable. In comparison, FISH can be designed for any bacteria, as long as there's a background understanding of what bacteria may be present in the system. Most known functional microorganisms in wastewater systems can be reliably identified and quantified by this method (Nielsen, et al., 2009).  FISH involves the use of a DNA probe, typically with a fluorophore, and a target sequence (e.g. 16S region). Prior to hybridization, both the target and the probe sequence must be denatured with heat or chemicals or a combination of both. A common practice is to use a combination of formamide and a 46°C oven, as done in this study. The labeled probes anneal with the complementary sequence and unbound probes are washed. Different fluorophores have different maximum absorbance and emission wavelengths, allowing cells to be viewed under a epi fluorescence or a confocal laser scanning microscope (CLSM).  Another well known molecular method for the quantification of microbes is quantitative PCR (q-PCR), which have become more accessible and efficient due to advances in DNA polymerase purification and automated thermal cyclers. q-PCR is based on measuring the quantification of marker genes from nucleic acid extraction. Although both q-PCR and FISH are viable techniques today for quantification of microbes, q-PCR does not allow you to observe the cells in-situ. Since one of the objectives of this study is to study the dynamic community structure, ecophysiology and population dynamics of AOB, NOB and Anammox bacteria in a one-stage system, FISH is more applicable.  3.3.2. Applicability of FISH for Anammox Research Despite the adoption of deammonification systems for sidestream treatment, there are limited studies regarding the dynamics between active microbial populations and its influence on process performance. The slow growth of Anammox is an issue during start-up, where populations are low, and during process failures, where populations may decline for unknown reasons. Thus, it becomes tremendously useful to have a method to detect and quantify the Anammox bacteria   41  both, at a research level and full-scale level, where it can be utilized to check for system performance.  3.3.3. FISH Probe Selection The probes used in this study were ordered from IDT-DNA and are listed in Table 3.5. The fluorophores used to detect the hybridized rRNA were fluorescein (absorbance max 495nm, emission max 520nm), Cy3 (absorbance max 550nm, emission max 570nm) and Cy5 (absorbance max 649nm, emission max 670nm). The fluorescein and Cy5 were used for the EUB338 probes, while the specific target probes used the Cy3 fluorophore. In conjunction with FISH hybridization, cells were stained with 4,6-diamidino-2-phenylindole (DAPI) as a background stain for all cells. DAPI has an absorption maximum wavelength at 358nm with an emission maximum wavelength at 461nm. DAPI binds to DNA and is typically used as a background staining technique for all active cells present in a sample.  To prevent the nonspecific hybridization of a FISH probes to non-target sequences with a single mismatch to the specific probe, unlabelled competitor probes were mixed in equimolar ratios as labelled probes. Thus, competitor probes are fully complementary to the mismatch containing non-target sequence. They are labelled with a lower-case c as shown in Table 3.5.    42  Table 3.5 FISH oligonucleotide probes used in the one-stage Anammox study Probe OPD designation 1 Target Site Probe Sequence (5'-3') Specificity % Formamide / mM [NaCl] 2 Reference Amx368 S-*-Amx-0368-a-A-18 368-385 CCTTTCGGGCATTGCGAA All Anammox organisms 15/338 (Schmid, et al., 2003) Amx820 S-*-Amx-0368-a-A-22 820-841 AAAACCCCTCTACTTAGTGCCC Brocadia anammoxidans, Kuenenia stuttgartiensis 40/56 (Schmid, et al., 2000) Ntspa662 S-G-Ntspa-662-a-A-18 662-679 GGAATTCCGCGCTCCTCT Genus Nitrospira 35/80 (Daims, et al., 2001) cNtspa662 GGAATTCCGCTCTCCTCT Competitor for Ntspa662 35/80 (Daims, et al., 2001) NIT3 S-G-Nbac-1035-a-A-18 1035-1052 CCTGTGCTCCATGCTCCG Genus Nitrobacter 35/80 (Wagner, et al., 1996) cNIT3 CCTGTGCTCCAGGCTCCG Competitor for NIT3 35/80 (Wagner, et al., 1996) Nso190 S-F-bAOB-0189-a-A-19 189-207 CGATCCCCTGCTTTTCTCC Ammonia-oxidizing β-Proteobacteria 35/80 (Mobarry, et al., 1996) Nso1225 S-P-Betao-1224-a-A-20 1224-1243 CGCCATTGTATTACGTGTGA Ammonia-oxidizing β-Proteobacteria 35/80 (Mobarry, et al., 1996) EUB338 S-D-Bact-0338-a-A-18 338 355 GCTGCCTCCCGTAGGAGT Many but not all Bacteria 0/900 (Amann, et al., 1990) EUB338 II S-D-Bact-0338-b-A-18 338-355 GCAGCCACCCGTAGGTGT To be used in combination with probe EUB338 0/900 (Daims, et al., 1999) EUB338 III S-D-Bact-0338-c-A-18 338-355 GCTGCCACCCGTAGGTGT To be used in combination with probe EUB338 0/900 (Daims, et al., 1999) 1 Oligonucleotide probe database 2 Percent formamide in the hybridization buffer and concentration of NaCl in the washing buffer   43  3.3.4. FISH Experimental Methodology 3.3.4.1. Preparation of Fixative Solution (Paraformaldehyde 4% w/v) 20µL of 10M NaOH and 2g paraformaldehyde was added to 33mL of ddH2O water. Using a fume hood, the solution was mixed gently at 65°C for 20 minutes. After the solution has dissolved 17mL of 3x phosphate buffered saline (PBS) solution was added and allowed to cool to room temperature. The pH of the solution was adjusted to 7.2 with 1M HCl, then filtered through a 0.2µm cellulose filter. The filtrate was stored in the dark and used within 48 hours.  3.3.4.2. Fixation of Activated Sludge Sample After thoroughly mixing the SBR system, approximately 10mL of the activated sludge sample was obtained. Prior to fixation, the sample was passed through a glass homogenizer 25-30 times to break-up the granules. The sample was then passed through a 26G needle 30-40 times to achieve a semi-homogeneous sludge solution. Using a microcentrifuge tube, 0.3mL of the sample was fixed with 0.9mL of the prepared fixative solution, to achieve a 3% paraformaldehyde solution. The mixed solution was incubated for 1.5-2 hours at room temperature with gentle mixing every 10-15 minutes. After fixation, 100µL of the sludge/fixative suspension filtered through a white polycarbonate filter (pore size 0.2µm; diameter 15mm) with 30mL of distilled water to collect the cells on the filter. The filters were stored at -80°C until the hybridization step. To analyze the microbial community and structure of the granules, the same procedures were followed except the samples were not broken by a homogenizer or a needle. In other words, samples were fixed and hybridized without shearing the floc or granular structure.  3.3.4.3. Hybridization of Oligonucleotide Probes to Fixed Cells Preparation of the oligonucleotide probe solutions The probes were received in dry form in centrifuge tubes. The probes were made into a solution with ddH2O water to achieve a 40µM solution (molar weight of each probe is known and listed under ProbeBase). A mixture of probes was done in equimolar amounts (e.g. NIT3 with competitor probe cNIT3). The probe solutions were stored in 10µL aliquots and stored at -80°C. Prior to the hybridization step, the oligonucleotide probe vials were thawed on ice and covered   44  with foil, to prevent damage from light exposure. Remaining oligonucleotide probe vials were not re-used as the thaw-freeze cycle affects the probe quality (Pernthaler, et al., 1998).   Preparation of the hybridization buffer To prepare the hybridization buffer, a specific volume of formamide was used to achieve a final formamide concentration as shown in Table 3.5. For example, to prepare a 35% formamide hybridization buffer measuring 10mL, 3mL of the formamide was used. The 10mL hybridization buffer consisted of 5mL of 1.8M NaCl, 0.2mL of 1M Tris-HCl (pH 7.2), 10µL of 10% sodium dodecyl sulfate (SDS), calculated volume of formamide and the remaining volume as ddH2O water. The hybridization buffer was stored at room temperature until ready to be mixed with the oligonucleotide probes.   Hybridization with fixed cells The polycarbonate filter containing the fixed cells were cut into quarters and labeled with a pencil in the outer edge, to identify the probe solution to be applied to each piece of the filter. 0.5µL of the probe solution was mixed with 15.5µL of the hybridization buffer, then applied on the filter slice containing the fixed cells. The filter slices were placed on a glass slide, placed inside a 50mL tube and capped. Inside the chamber is a wet tissue paper containing 2mL of the hybridization buffer (without probes) to prevent the filter papers from drying out. The 50mL tubes were placed in an incubation oven at 46°C overnight (typically 20 - 24 hours). Formamide lowers the melting point of the nucleic acid, allowing the annealing of the oligonucleotide probes to the completementary sequences present in the 16S region.  3.3.4.4. Washing Step for Fixed Cells Preparation of the wash buffer To prepare the wash buffer, a specific volume of 1.8M NaCl stock solution was used to achieve a final NaCl concentration as shown in Table 3.5. The 40mL wash buffer consisted of 0.8mL of 1M Tris-HCl (pH 8.0), 40µL of 10% SDS, calculated volume of 1.8M NaCl and the remaining volume as ddH2O water. The washing buffers were pre-heated to 46°C prior to the washing step.    45  Washing of fixed cells The filters were gently washed 2-3 times with 1mL of the pre-heated wash buffer to remove most of the unbound oligonucleotide probes. The filters were then placed inside the wash buffer tube and incubated at 48°C for 20 minutes. Since the formamide is effectively washed away, the annealed oligonucleotide probe will not denature with the complementary sequence. After the incubation period, the filter slices were rinsed 2 - 3 times with distilled water, then air dried for 30 minutes.  3.3.4.5. Pre-analysis Treatment with DAPI and DABCO  Preparation of DABCO 1,4-diazabicyclo[2.2.2] octane (DABCO) is an antifading chemical that prevents the rapid decay of fluorophores when viewed under a CLSM. Thus, DABCO allows the FISH images to be consistent over one image session. DABCO antifading solution consists of: 0.466g DABCO, 400µL of 1M Tris-HCl (pH 8.0), 1.6 mL of ddH2O water and 18mL glycerol solution. The mixture was heated to 70°C until dissolved then vortexed. The DABCO solution was aliquoted and stored at -80°C.  DAPI staining and DABCO treatment The dried filter papers were placed on a microscope slide, treated with 20µL of DAPI solution (1 µg/mL concentration) and incubated at room temperature in the dark for 5 minutes. The filter was then rinsed 2 - 3 times with ddH2O then air dried for 30 minutes. 4 - 5µL of the thawed DABCO solution was applied on the filter then secured on a cleaned microscope slide with a No.1 cover slip (0.12 - 0.16mm thick). The edges of the cover slip were sealed with a clear fingernail polish. 3 - 4 filter images were secured per microscope slide and the slides were stored at 4°C until quantification under a CLSM.  3.3.4.6. CLSM and FISH Imaging FISH imaging was done by a CLSM (Olympus Fluoview FV1000) containing both epi fluorescence and laser capability, as shown in Figure 3.6. Three filters options were available for epi fluorescence: DAPI, FITC and TRITC. The CLSM had a multi-line argon laser (457nm,   46  488nm and 515nm), a 405nm diode laser, 543nm and 633nm HeNe lasers. Thus, the wavelengths used for imaging were the ones closest to the maximum absorbance wavelength for the specific fluorophores: 488nm for fluorescein, 543nm for Cy3 and 633nm for Cy5. The CLSM is connected to a desktop computer containing Olympus Fluoview (version 3.1b) software for adjustment of laser strength, image filters, magnification and image capture functionality.   Figure 3.6 Olympus Fluoview FV1000 for FISH imaging  The magnification used during the study is 60x for granule analysis and 100x for community analysis. The microscope slides were mounted inside the incubator with magnification oil. With the lights turned off, the first step consisted of a course adjustment under DAPI epi fluorescence to bring the cells into focus. All samples used in this study were DAPI stained as outlined in the methodology; thus DNA, can be detected under the DAPI setting. Once the cells were brought   47  into focus, the light emission source was changed from epi fluorescence to a laser with the specific wavelength of interest (e.g. 488nm for fluorescein detection). In the software, the following settings were adjusted to improve the image quality: fine focus adjustment, laser intensity, offset (filter mechanism) and HV. Obtaining a high quality image - by differentiating between cells under fluorescence and the background - allows a more consistent result to be achieved during quantification.   Figure 3.7 Olympus Fluoview software for fluorescence image adjustment  Under a single field-of-view, at least three images were taken without adjusting the focus: the specific target population from Cy3 (for the AOB, NOB and Anammox population), the general population from Cy5 or fluorescein (for all bacteria using EUB338 mixture), and a reference background from DAPI (targets DNA). Once the three images were taken, the field-of-view was   48  manually adjusted randomly in the x- and y- axis then a new set of images were captured. The field of views were not adjusted in the z-axis as cells would go out of focus. For volumetric quantification, approximately 25 - 30 images were taken for each target population for each imaging session.   3.3.4.7. Volumetric Quantification in DAIME The quantification of cells was done using the DAIME software after the image capture process. The steps for quantification consist of the following: 1) Upload the images to DAIME software under grey-scale for both the target population and the general population 2) Filter the images to remove background noise and biomass detection. The detection of cells was done through the robust automated threshold selection (RATS) algorithm then each image was visually checked for QC. When necessary, the images were manually adjusted using Photoshop. 3) Use the biovolumetric function which compares the area covered by the general population probe and compares it to the area covered by the target population probe (pixel by pixel comparison). The overlapping area is considered to be the volumetric fraction of the specific population. 4) All the collected images are processed in the same manner, then the results are aggregated to calculate the mean volumetric fraction and the standard deviation.  3.4. Specific Activity Analysis (Kinetics and Mixotrophic Tests) Preparation of sludge for batch analysis As part of the community analysis, the activity of AOB and Anammox were tested through batch analysis. The wash step of the collected waste sludge consisted of the following steps: centrifuge at 2500 RPM for 8 - 10 minutes; drain the supernatant; re-suspend with a modified feed solution containing no nitrogenous compounds. The wash step was repeated 3 times, in order to remove any present ammonium, nitrite and nitrate.     49   Preparation of water bath The batch tests were performed as three replicates (unless specified) in sealed 500 mL volumetric flasks. The volumetric flasks were placed in a gyrotory water bath shaker (G76, New Brunswick Scientific) and pre-heated to 33 - 34ºC (same as SBR temperature). The washed sludge was re-suspended in the modified feed solution then sparged with dinitrogen gas for 8 - 10 minutes, if an anaerobic condition was required.  Batch analysis with spike addition of substrate The re-suspended sludge solution was spiked with a known amount of substrate (ammonium, nitrite, nitrate and/or organic matter). If the system needed to be anaerobic, the flask was sealed with a cap connected to a nitrogen gas rubber balloon. At specific time intervals, samples were drawn with a 50mL syringe through a 3-way valve such that the valve can be closed after sample collection. The volumetric flasks were thoroughly mixed prior to collection of samples.  Sample analysis The collected samples were centrifuged to separate the biomass from the bulk liquid. The supernatant was collected and filtered using a 0.45micron HA filter (Millipore). The bulk liquid was then analyzed for pH, NH4+-N, NO3--N, NO2--N, alkalinity, and COD (if needed). At the end of the batch analysis, the remaining sludge solution was used for solids analysis.       50  4. RESULTS AND DISCUSSION 4.1. One-Stage Anammox SBR System Operation The operation of the SBR was divided into three parts: 1) start-up and acclimation of Anammox bacteria to synthetic reject water, 2) operate the system under 55 day SRT, 3) operate the system under a 30 day SRT. Figure 4.1 and Figure 4.2 outline the overall reactor performance during the study. The seed sludge was obtained from Annacis WWTP, one-stage Anammox system enriched in anaerobic digester reject water. In the acclimation phase, the system parameters were adjusted to optimize Anammox activity which is further discussed in Chapter 4.2. In phase 1 of the SBR operation, the SRT was maintained at a 55 day SRT while in phase 2, the system was maintained at a 30 day SRT.    51   Figure 4.1 Nitrogen removal performance of the SBR system based on influent  ( Ammonium removal %, Nitrate production %)     52   Figure 4.2 Effluent concentration measured during the SBR operation ( NH4+-N,  NO3--N,  NO2--N) 0 20 40 60 80 100 120 0 100 200 300 400 500 600 700 18/10/2012 07/12/2012 26/01/2013 17/03/2013 06/05/2013 25/06/2013 14/08/2013 03/10/2013 NO2--N (mg N/L) NH4-N , NO3-N (mg N/L) Date Aeration flow  rate reduction Nitrite build-up Anammox recovery   53  4.1.1. Acclimation Stage (October - December) During the acclimation period (Figure 4.1), the total ammonium removal efficiency was between 20 - 40% with relatively high production of nitrate, at 20 - 35%, based on influent conditions. This is likely due to the fact that the seed sludge was obtained during the period when NOB activity was high at the Annacis pilot plant. It is unclear why the NOB activity was high as the pilot system typically operates around 0.5 mg/L DO; the affinity constant for AOB and Anammox are lower than that of NOB. During the start-up period, the average DO was higher than 0.25 mg/L with 5 min on, 5 min off cycle at a flow rate of 390 mL/min. After a week, this was reduced to 4 min on, 1 min off cycle. From day 24 - 39, the aeration flow rate was reduced from 300 mL/min to 200 mL/min, which reduced the average DO to 0.15 mg/L. This period coincides with the first reduction in nitrate shown in Figure 4.2. However, when the aeration flow rate was reverted back to 300 mL/min on day 40, the effluent nitrate concentration increased again. It was postulated that the NOB population was being retained in the system and thus, the sludge was preferentially wasted from day 38 - 60, while maintaining the system DO under 0.2 mg/L. The preferential wasting was done during the settling phase of the SBR, by draining the top 'floc' portion while ensuring that the granular portion was retained. This was based on the assumption that the granular portion would be mainly composed of AOB and Anammox population, as commonly seen in one-stage systems (Sliekers, et al., 2002; Nielsen, et al., 2005; Tsushima, et al., 2007), while the non-granular portion would be dominated by the AOB/NOB population. Based on Figure 4.2, the nitrate level declined over time during this period.  4.1.1.1. Nitrate Build-Up and Anammox Activity Recovery The build-up of nitrate in the effluent during the start-up period (Figure 4.1) is likely a combination of high NOB activity and a suppressed Anammox activity. The reduced Anammox activity may be due to higher salinity in the synthetic reject water, than the Annacis reject water. It is known that freshwater species of Anammox have difficulty adapting to salt concentrations greater than 30 g/L without losing its activity (Kartal, et al., 2006; Liu, et al., 2009). In the adaptation studies, the salt concentration is increased in a step-wise manner, in order to allow the bacteria to acclimatize. Liu et al. (2009) observed that the Anammox activity decreased   54  temporarily for a period of 1 - 2 weeks during the step-wise salt concentration changes before re-establishing the activity. In this study, meeting the ammonium and alkalinity concentrations in the synthetic reject water required the addition of NH4Cl and NaHCO3, respectively. Consequently, the salt concentrations (NaCl) were higher than typical values present in the anaerobic digester effluent; Measurement of the conductivity showed 10 - 12 mS/cm for the synthetic feed and 5 - 6 mS/cm for the Annacis reject water. Thus, the Anammox bacteria from the seed sludge likely required an acclimation phase (showing suppressed activity), similar to adaptation studies previously mentioned. The poor system performance during start-up can be attributed to limited nitrite substrate for the Anammox population as well as high NOB activity. Washing out the NOB population through selective wasting and acclimatization allowed Anammox activity to re-establish after 2 months in this study.  4.1.2. Phase 1 - 55 day SRT (December - May) During phase 1, the sludge was wasted once a day such that the weekly average sludge wasting could achieve a 55 day SRT. It should be noted that steady state performance was not reached until about 3 months into phase 1 which is equivalent to just under 2 SRT periods. Studies pertaining to the higher SRT phase was conducted when the steady state performance was maintained. The wasting volume was based on the average TSS in the system and the calculations are shown in Appendix A. During this period, the nitrate production continued to decrease to mid March, where the NO3--N in the effluent was maintained between 75 - 100 mg/L (Figure 4.2). The nitrate production rate of 10% during this period corresponds to the Anammox stoichiometry (Strous, et al., 1998). The ammonium removal efficiency was between 80 - 90%, corresponding to a loading rate of 0.26 kg N/m3d. During this period, the HRT was maintained at 2.64 days with an average DO of 0.15 mg/L. In comparison to other Anammox systems (Table 2.4), the loading rate is low. The DO is well below the required DO setting of < 0.5 mg/L, thus in theory, the nitrogen loading rate could have been higher by increasing the aeration and concurrently reducing the aeration cycle.    55  4.1.3. Phase 2 - 30 day SRT (May - October) In the shorter SRT period (Figure 4.2), Anammox activity was maintained until mid-June. In day 239, the NO2--N increased to 86.3 mg/L. To reduce the nitrite concentration, the sludge was settled for 1 hour then the supernatant was drained and re-suspended with modified feed solution (no nitrogenous species). Initially, the nitrite concentration was reduced but on day 246, the NO2--N increased to 107.5 mg/L. During this period, the aeration was changed to 1 min on, 3 - 6 min off with 100 mL/min aeration flow rate in order to maintain anaerobic conditions and re-establish Anammox activity. Despite maintaining a DO less than 0.1 mg/L in the system, nitrite concentration still ranged from 5.0 - 25.0 mg/L. Despite reduced activity during this period, the nitrogen removal efficiency began to increase towards the end of the study. If wasting was ceased, it is likely that the system performance would have improved in a shorter timeframe. Nonetheless, applications of Anammox continues to be a concern at full-scale, since a sudden build-up of nitrite, as shown in this study, can severely limit the performance of the nitrogen removal capacity.   4.1.4. Sludge Granule Size Over the duration of the 1 year study, the sludge characteristics of the system changed in morphology from the seed sludge, as it can be seen in Figure 4.3. The granular size distribution was not measured in this study. Visually, the large granules present in the seed sludge reduced in diameter over time. Nielsen et al. (2005) showed a positive correlation between bulk DO concentration and biofilm thickness. The seed sludge was operating under a DO setpoint of 0.5 mg/L, whereas the SBR system was typically measured between 0.1 - 0.15 mg/L (<0.1 mg/L with a LDO probe).  This likely resulted in the reduction in granular size over time in order to reduce the mass transfer resistance that would exist with a thicker granule. Furthermore, the granule size reduction can be attributed to shear forces imposed by the high mixing speed present in the system. The impeller speed in the SBR was maintained at 50-60 RPM while the pilot system operated under a lower RPM of 20 - 25 RPM. A combination of these two factors likely contributed to the reduction in granule size with respect to time.    56   Figure 4.3 Sludge comparison between (A) actual reject water, (B) synthetic reject water  4.2. Mixed Community Analysis of One-Stage ANAMMOX System using FISH 4.2.1. Research Questions The FISH studies were conducted to address the following questions:  What is the spatial distribution between AOB, NOB and Anammox in the granular structure and how does it relate to the system parameters?  What is the relative population distribution among AOB, NOB and Anammox with regard to: 1) Changes in the system SRT 2) Granular versus non-granular sludge (floc matter) 3) Synthetic reject water sludge versus actual anaerobic digester reject water sludge  4.2.2.  Troubleshooting FISH Methodology While conducting FISH, several iterations of the procedure had to be done with modifications in order to achieve a consistent image for analysis in the DAIME software. Troubleshooting was done as follows: 1) Nso1225 emission signals under fluorescence were inconsistent and too weak to capture. The faint signals registered as 'non-cells' under the DAIME software, which resulted in the under representation of the volumetric fraction. The Nso190 probes, which target the same domain (Ammonia-oxidizing betaproteobacteria), produced strong signals during image capture and DAIME analysis.   57  2) Amx368 produced low emissions that could not be captured. It may have been due to the combination of low fixation time and hybridization time used at the onset of the FISH analysis. Amx820 probe was used as a replacement (targeting Kuenenia stuttgartiensis and Brocadia anammoxidans).  3) This particular CLSM had previous issues dealing with fluorophores with higher maximum absorbance wavelengths (Cy5). Thus, the EUBMix (EUB338, EUB338 I and EUB 338 II) produced weak signals relative to the target population probes. To correct this issue, fluorescein fluorophore was used for the EUB338, probes which have a lower maximum absorbance wavelength. This resulted in stronger signals for the EUBMix probes and produced more consistent results for the comparison of the general population against the specific population.  4.2.3. Control Results Using Blanks and NONEUB Probe Blank tests, following the FISH protocol without the addition of oligonucleotide probes, did not product any fluorescence when viewed under the CLSM. This indicated that there were no cellular materials or compounds in the sludge sample that produced auto-fluorescence under the wavelengths used during the study. A NONEUB probe, complementary to EUB338, was also used to test for non-specific binding of the probe to the cellular matrix. Fixed and hybridized filters containing the NONEUB probes showed no fluorescence when viewed under the CLSM, showing that the oligonucleotide probes did not bind to non-16S regions.  4.2.4. Granular Structure Analysis - AOB and Anammox Spatial Distribution Anammox population in granule Unbroken sludge samples were fixed and hybridized with the specific probes in order to investigate the granular structure typical of one-stage Anammox systems. The microscope was set such that an image was taken every 5 µm, thus being able to obtain a 3-D image of a specific field of view going through the granular structure. The FISH image of Anammox, as the target population, is shown in Figure 4.4. It is well known that the outer AOB layer acts as a diffusive boundary layer for the aggregate, providing local nitrite and dissolved oxygen concentrations that are significantly different compared to the bulk concentration (Nielsen, et al., 2005). AOB   58  population is typically limited the <0.1 mm of the surface of the deammonification granule, although the exact thickness that constitutes the active AOB layer is unclear. Interestingly, Pynaert et al. (2003) observed that both AOB and Anammox bacteria were found throughout the biofilm, rather than as a segregated community despite having a bulk DO concentration of 0.5 mg/L. Similarly, granules observed in this study exhibited no clear boundary between the aerobic AOB layer and the anoxic Anammox layer. Both populations seem to co-exist even at the boundary of the granule. Since the DO in the system was generally below 0.15 mg/L, it is likely that DO plays a factor in the determination of the granule size and the spatial dynamics of the AOB and Anammox bacteria. Furthermore, the current model of Anammox granules in a single sludge system, which is composed of an inner and an outer layer, may not be so strictly followed in nature as evidenced in this study. The existence of Anammox population at the boundary suggests that Anammox bacteria may not be completely inhibited by bulk DO as previously thought. Furthermore, an even distribution of AOB and Anammox provides a competitive advantage in substrate uptake since the nitrite produced by partial nitritation can be readily utilized due to spatial proximity. This is further analyzed in the volumetric fraction analysis given in Section 4.3.5.    59   Figure 4.4 FISH image of Anammox granule at 100x objective. Red = Anammox, Green = All bacteria. Image taken every 5um intervals in the z-direction from (A) to (D)    A B C D   60  AOB population in granule The FISH image of AOB as the target population is shown in Figure 4.5. As previously mentioned, both the AOB and Anammox population are equally distributed across the aggregate. However, Anammox bacteria are generally in more compact clusters, whereas the AOB population are dispersed in multiples of 2 or 4 cells. This ties in to the nature of the one-stage Anammox system, in which the AOB population does not experience significant 'stress' that may influence its activity and/or growth. Thus, being dispersed, rather than forming tight clusters, may assist in the uptake of bulk DO.   Figure 4.5 FISH image of Anammox granule at 100x objective. Yellow = AOB, Green = All bacteria. Image taken every 5um intervals in the z-direction from (A) to (D)  A B C D   61  4.2.5. Volumetric Fraction Analysis - 55 Day and 30 Day SRT The sludge samples were collected 3 times during the 55 day SRT period, on a bi-weekly basis and 2 times during the 30 day SRT. The summary of volumetric fraction for both SRT periods is shown in Figure 4.6 and Figure 4.7.  The volumetric fraction for Anammox was 33.2% ± 12.32% at 55 day SRT and 31.3% ± 10.7% at 30 day SRT. For AOB, the volumetric fraction was 36.3% ± 9.4% at 55 day SRT and 25.6 ± 7.0% at 30 day SRT. This supports the finding that the AOB fraction is not just limited to the granular portion of the activated sludge in deammonification systems. Despite mixing, sludge wasting is selective to the non-granular portion, as heavy aggregates tend to settle within an order of seconds. The smaller aggregates, which typically have a higher AOB and NOB fraction (Nielsen, et al., 2005), will experience a higher population loss than Anammox bacteria. As expected, the NOB fraction was low in comparison to AOB and Anammox fraction (< 6%), indicating the washout of NOB fraction over time. The volumetric fraction analysis was not performed during the acclimation period, but the NOB fraction was likely higher at the start of the study.  The standard deviation is high due to the fact that achieving a homogenous sludge sample is difficult. Passing the sample through the 26G needle does not sufficiently break up the Anammox floc, resulting in certain fields of view exhibiting high/low concentrations of Anammox bacteria. Mitigating this issue, through the acquisition of more fields of view, only marginally reduced the standard deviation.  Based on the results, the AOB, NOB and Anammox bacteria do not account for all the bacteria in the sample. In fact, the unaccounted fraction increased with a shorter SRT period (See Figure 4.6 and 4.7). This may be due to a combination of factors:  1) The oligonucleotide probes selected for the study do not capture all the target populations. Probes for Anammox, Amx820, only targets Kuenenia stuttgartiensis and Brocadia anammoxidans, which are not exclusive to wastewater treatment. Scalindua brodae and   62  Scalindua wagneri have been found in wastewater facilities (Schmid, et al., 2007), and they would not be captured by the Amx820 probe. The Scalindua genera consist of marine species, tolerant to salt concentrations. Kartal et al. (2006) has shown that Scalindua wagneri and Kuenenia stuttgartiensis co-exist in a high salt concentration Anammox system. Since the salt concentration of this particular system was higher than what is typically expected from anaerobic digester effluent, it is plausible that Scalindua wagneri may exist. However, species specific probes were not used to test this hypothesis.   2) DAIME image processing algorithm may have overcompensated for cell detection. During the image capture process, not all the cells are in focus with the microscope, producing a background 'blur' that must be filtered by the microscope software and/or through the DAIME quantification software. The RATS algorithm, while being able to distinguish cells for the most part, is not perfect, as with any other image segmentation algorithm. Under the algorithm, the 'blur' area may be eliminated during the image segmentation process (depends on the intensity of the area), resulting in the under-representation of the volumetric fraction.   3) Based on the images, there is an abundance of filamenteous bacteria (See Figure 4.4 and 4.5) that are detected by the general population probe, EUB338, but not by any of the specific probes.  Filamentous bacteria should be considered as normal members of the activated sludge communities, primarily involved in degradation of organic material. Ni et al. (2012) observed that heterotrophs accounted for more than 23% of the total bacteria in an Anammox biofilm, solely depending on SMP production for growth. Kindaichi et al. (2004) observed similar results where an autotrophic nitrifying biofilm supported up to 50% heterotrophic bacteria.      63   Figure 4.6 Volumetric population distribution from a 55 day SRT Anammox system   Figure 4.7 Volumetric population distribution from a 30 day SRT Anammox system   33.2 36.3 2.2 3.9 24.3 0 5 10 15 20 25 30 35 40 45 50 Volume Fraction % Anammox AOB Nitrospira Nitrobacter Other 31.3 25.6 1.4 2.7 39.0 0 5 10 15 20 25 30 35 40 45 50 Volume Fraction % Anammox AOB Nitrospira Nitrobacter Other   64  4.2.6. Volumetric Fraction Analysis - Annacis Sludge As part of the volumetric fraction analysis using FISH, the sludge samples from the Annacis pilot reactor operating were analyzed in three areas: a homogenous sample (Figure 4.8), the granular portion (Figure 4.9) and the effluent (Figure 4.10).  The volumetric fractions for Anammox bacteria and AOB were 26.9% ± 8.3%, 11.2% ± 3.8%, respectively. Compared to the synthetic system, the AOB fraction was 14 - 25% less. The pilot system operates at a higher DO setpoint of 0.5 mg/L and since the affinity constant KO2 for AOB is 0.033 ± 0.003 mg O2/L, the overall activity of the AOB is higher than the SBR system, operating at the < 0.15 mg/L setpoint. In that case, the oxidation of ammonia to nitrite needed to sustain Anammox activity can be maintained with an overall lower AOB population.  Depending on the anaerobic digestion and dewatering process, reject water can be characterized with high COD content containing mostly slowly biodegradable organics, but also small quantities of fast biodegradable organics. In that case, heterotrophic activity can be sustained with a combination of SMP and organic matter present in the reject water.   Figure 4.8 Volumetric population distribution of homogenized Anammox sludge from Annacis 26.9 11.2 5.2 1.8 54.9 0 10 20 30 40 50 60 70 80 Volume Fraction % Anammox AOB Nitrospira Nitrobacter Other   65  In the granular portion, Anammox accounted for 38.5% ± 5.7%, the AOB accounted for 8.8% ± 1.8% and 50.9% were unidentified. In the effluent, Anammox accounted for only 2.9% ± 1.9±, the AOB accounted for 11.6% ± 4.2% and 81.2% were unidentified. Denammox, which combines denitrification and anammox, has shown that Anammox and denitrifiers, can co-exist provided that the COD concentration is low. They may make up the bulk of the unidentified fraction in the effluent. Denitrifiers have a high growth rate; therefore, despite losing a large fraction of the total bacteria potentially as denitrifiers in the effluent, they still benefit the overall process by being able to consume nitrate. This is evident in Anammox systems in literature in which the nitrate production in the effluent is below the expected values based on the stoichiometry. Sliekers et al. (2003) reported a nitrate production/ammonium consumption ratio below the expected ratio of 0.2 based on the stoichiometry in a synthetic feed system. It was postulated that the denitrifiers are partially consuming the nitrate produced from the Anammox stoichiometry.    Figure 4.9 Volumetric population distribution of Anammox sludge from Annacis (Granular portion)  38.5 8.8 1.0 0.8 50.9 0 10 20 30 40 50 60 70 80 Volume Fraction % Anammox AOB Nitrospira Nitrobacter Other   66    Figure 4.10 Volumetric population distribution of Anammox sludge from Annacis (Effluent)  4.3. Determination of Anammox Kinetic Parameters 4.3.1. Research Questions Past kinetics studies on Anammox systems were performed on enriched Anammox cultures maintained under anaerobic conditions and fed with synthetic feed containing equimolar ratios of ammonium and nitrite (van de Graaf, et al., 1996; Strous, et al., 1998; Isaka, et al., 2006). Thus far, no study has analyzed the kinetic parameters of Anammox bacteria in a deammonification system in which the AOB and Anammox population co-exist. Thus, the kinetics studies were conducted to compare the kinetic parameters from this study to that in the literature.  4.3.2. Double Substrate Monod Model To determine the kinetics of Anammox pathway, a double substrate Monod model was applied, with ammonium and nitrite as the two substrates, as seen in Equation 4.1.                                                                                   (Equation 4.1) 2.9 11.6 0.8 3.6 81.2 0 10 20 30 40 50 60 70 80 90 100 Volume Fraction % Anammox AOB Nitrospira Nitrobacter Other   67   kNH4,NH = maximum utilization rate of ammonium by Anammox; g NH4/g microorganisms∙d X = Anammox biomass concentration; g/m3 KNH4,NH = half-saturation constant of NH4+ for Anammox bacteria; g/m3 KNO2,NH = half-saturation constant of NO2- for Anammox bacteria; g/m3  4.3.3. Observed Yield Determination The initial plan was to operate the SBR system under a series of different SRTs in order to determine the endogenous decay coefficient and the yield coefficient for Anammox bacteria. However, due to the inhibition observed from the build-up of nitrite during the 30 day SRT period, the observed yield coefficient was estimated during a stable period of operation during the 55 day SRT. The calculations for the determination of the observed yield is shown in Appendix A. The observed yield was determined to be 0.093 ± 0.019 g VSS/g NH4-N, which is much lower than the theoretical yield of 0.11 - 0.13 g VSS/g NH4+-N reported by Strous et al. (1998). The calculated observed yield was likely lower that the theoretical yield since it takes into account the endogenous decay coefficient. It cannot be concluded whether the combined deammonification system would influence the yield coefficient based on the results obtained from this study.  4.3.4. Specific Anammox Activity - Ammonium Limiting Anammox specific activity tests were done in batch analysis using a sealed anaerobic chamber placed in a gyrotory water bath to maintain constant temperature. To determine the half-saturation constant with respect to ammonium, nitrite was spiked to 10 - 12 mg N/L, while the ammonium concentrations were varied under limiting conditions. The spike concentration of nitrite was chosen based on the nitrite limiting tests which showed maximum Anammox activity at the concentrations between 10 - 12 mg N/L. The consumption of ammonium was plotted as a function of time and VSS in the batch sample (calculated based on volumetric fraction analysis of 33%). The tests were done in two sets, as shown in Figure 4.11 and Figure 4.12. A least-squares regression method was used to predict kNH4,NH and KNH4,NH. Based on a correlation of 91%, the following results were obtained: kNH4,NH = 0.58 ± 0.03 mg NH3-N / mg VSS and   68  KNH4,NH = 0.49 ± 0.06 mg/L. Using the theoretical yield of 0.11 mg VSS / mg NH3-N (Strous, et al., 1998), the maximum specific growth rate is 0.064 d-1, which is in agreement with the literature value 0.0648 d-1 (Strous, et al., 1998).   Figure 4.11 Specific Anammox activity under ammonium limited conditions (NO2--N at 10 - 12 mg/L)  \ 0 0.1 0.2 0.3 0.4 0.5 0.6 0.00 5.00 10.00 15.00 20.00 dN/(dt*VSS) (d-1) NH4-N (mg/L) 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.00 2.00 4.00 6.00 8.00 10.00 12.00 dN/(dt*VSS) (d-1) NH4-N (mg/L)   69  Figure 4.12 Specific Anammox activity under ammonium limited conditions, test 2 (NO2--N at 12 mg/L)  4.3.5. Specific Anammox Activity - Nitrite Limiting Under nitrite limiting conditions, inhibition reduced the Anammox activity at a NO2--N concentration higher than 12 mg N/L. The ammonium was spiked to > 200 mg N/L, so that only the nitrite was the limiting condition. The tests were done in two sets, as shown in Figure 4.13 and Figure 4.14. Due to inhibition, only the data points that followed the Monod curve were used for the determination of the half-saturation coefficient. Modelling the results, based on the Haldane kinetics model, was attempted but the results did not produce a strong correlation (below 40%). Similar to the ammonium limiting tests, the parameters were predicted using a least squares regression method. With a correlation of 93% (Note that due to the limited number of data points used, the correlation may not be reliable), KNO2,NH = 0.30 ± 0.08 mg/L.   Figure 4.13 Specific Anammox activity under nitrite limited conditions, test 1 (NH4+-N > 200 mg/L)  0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 dN/(dt*VSS) (d-1) NO2-N (mg/L)   70   Figure 4.14 Specific Anammox activity under nitrite limited conditions, test 2 (NH4+-N > 200 mg/L)  The affinity constants for ammonium and nitrite are both higher than 0.1 mg N/L reported by Strous et al. (1999). Strous et al. disrupted the granules using magnetic stirring whereas this study did not. Mass transfer limitations likely played a role, considering that granules have been observed to be as much as 0.1 - 0.3 mm thick (based on this study and observations made on the pilot-scale system at Annacis). The homogenization of the sludge, prior to the batch analysis, may have resulted in lower affinity constants.  4.4. Mixotrophic Analysis of Anammox Sludge 4.4.1. Research Questions The mixotrophic studies were conducted to address the following questions:  Investigate the oxidation potential and temporal response of Anammox bacteria from a deammonification system with acetic acid, propionic acid and primary effluent as candidate electron donors. Two enriched sludges were tested: 1) Anammox bacteria grown in a lab-scale system with synthetic feed 2) Anammox bacteria grown in a pilot system with reject water feed 0 0.2 0.4 0.6 0.8 1 1.2 0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 dN/(dt*VSS) (d-1) NO2-N (mg/L)   71   Using methanol, a known Anammox inhibitor (Isaka, et al., 2008), determine whether heterotrophic activity would be present. This was to confirm if the consumption of the organic acids was due to Anammox activity or heterotrophic activity.   4.4.2. Control Tests Control tests were performed to determine whether changes in the electron donor concentrations, as represented by soluble chemical oxygen demand (sCOD), or fixed nitrogen concentrations would occur on their own. The biomass was obtained from the lab-scale system. Control tests sCOD remained relatively constant over 15+ hour duration of batch reaction in the absence of fixed nitrogen. This indicated that organic carbon was not oxidized in the absence of fixed nitrogen (Figure 4.15). Initial acetate sCOD concentration was 82.5 ± 3.5 mg/L and after 16 hours, 67.5 ± 17.7 mg/L. Initial propionate sCOD concentration was 363.8 ± 8.8 mg/L and after 20 hours, 383.8 ± 8.8 mg/L. It is unclear why the sCOD concentration increased during the duration of the study. Initial primary effluent sCOD concentration was 55 ± 1.5 mg/L and after 20 hours, 30 ± 3.7 mg/L. Similarly, fixed nitrogen concentrations remained relatively constant in the absence of organic carbon (Figure 4.15). First control test, in the absence of electron donors, consisted of only ammonium and nitrate. The second control test was done only with nitrite. From the first control test, the initial nitrate concentration was 24.6 ± 0.1 mg N/L and after 17 hours, 23.5 ± 1.6 mg N/L. From the same test, the initial ammonium concentration was 45.4 ± 7.8 mg N/L and after 17 hours, 36.4 ± 5.9 mg N/L.  The nitrite concentration did increase to ~5 mg N/L after 17 hours in the first test (not shown), likely explaining why the ammonium concentration seemed to decrease in graph B of Figure 4.15. Furthermore, ammonia reduction could be partially attributed to off-gasing of un-ionized ammonia although area was not investigated. For the second control test, in which only nitrite was added, the nitrite concentration was initially 11.8 ± 2.3 mg N/L and after 16 hours, 10.5 ± 2.3 mg N/L. Based on the control test, it was established that electron donor consumption is negligible in the absence of fixed nitrogen species.    72   Figure 4.15 Control tests with Anammox enriched in SBR (A) Conversion of propionate (▲), acetate (○) and primar  effluent (♦) in the absence of fixed nitrogen. (B)  onversion of ammonium (○), nitrate (▲) and nitrite (♦) in the absence of electron donors. Graph B is the result of two separate tests in which one test is performed with ammonium and nitrate and the other test is performed only with nitrite. (n=2 for all conditions where n represents number of replicate tests; standard deviation is low and not shown)  4.4.3. Mixotrophic Analysis with Nitrate and Anammox Sludge Enriched in SBR sCOD measurements of acetic acid and propionic acid did not show a significant change in the first 2 - 5 hours (Figure 4.16). Prolonged reactions allowed to run overnight, however, showed a reduction in sCOD for both acetic acid and propionic acid. The nitrate decreased from 22.8 ± 0.5 mg N/L to 10.2 ± 0.2 mg N/L after 14 hours, coinciding with a reduction in sCOD based on acetate addition from 366 ± 16.6 mg/L to 91.7 ± 3.8 mg/L after 14 hours. In the propionate system, the nitrate decreased from 20.0 ± 0.3 mg N/L to 17.1 ± 1.8 mg N/L, with the reduction in sCOD from 399± 7.2 mg/L to 253 ± 67 mg/L after 15 hours. A similar trend was also seen with primary effluent / nitrate system, in which the nitrate decreased from 25.2 ± 0.4 mg N/L to 8.8 ± 0.6 mg N/L with a decrease in sCOD from 94.2 ± 12.6 mg/L to 22.7 ± 2.0 mg/L. In the primary effluent test, nitrite gradually increased to 2 mg N/L (not shown) by hour 11 which coincides with the reduction of nitrate. It should be noted that the rate of consumption of nitrate was higher than the production of nitrite. If nitrite is the intermediate production in the reduction pathway of nitrate, it is likely that nitrite is also reduced immediately. The time delay may have been due to the gene expression required for the synthesis of enzymes needed for the consumption of the 0 100 200 300 400 500 0 5 10 15 20 COD (mg/L) Time (hours) A 0 10 20 30 40 50 0 5 10 15 20 NH4+, NO3- , NO2-  (mg N/L) Time (hours) B   73  electron donors, since the synthetic feed did not contain any COD. Despite sludge enrichment in the absence of electron donors, the results shown from the study show that the time response to the addition of electron donors is in the order of hours. However, more samples should have been taken throughout the duration of the batch studies to determine the time delay associated with the presence of the electron donor and the consumption of the nitrate.    Figure 4.16 Mixotrophic tests with nitrate and Anammox biomass from SBR (A) 2-hour test with acetate (♦) and nitrate (○). (B) 14-hour test with acetate (♦) and nitrate (○). (C) 16-hour test with propionate (♦) and nitrate (○). (D) 18-hour test with primary effluent (♦) and nitrate (○). (n=3 for all conditions where n represents number of replicate tests)  0 100 200 300 400 500 0 4 8 12 16 20 24 28 0 1 2 COD (mg/L) NO3-  (mg N/L) Time (hours) A 0 75 150 225 300 375 450 0 5 10 15 20 25 0 5 10 15 COD (mg/L) NO3-  (mg N/L) Time (hours) B 0 100 200 300 400 500 600 0 5 10 15 20 25 0 4 8 12 16 COD (mg/L) NO3-  (mg N/L) Time (hours) C 0 25 50 75 100 125 150 0 5 10 15 20 25 30 0 10 20 COD (mg/L) NO3-  (mg N/L) Time (hours) D   74  4.4.4. Mixotrophic Analysis with Nitrite and Anammox Sludge Enriched in SBR To further investigate the oxidative capacity of Anammox bacteria in the presence of organic carbon, nitrite was added to the system to observe the change in nitrite and sCOD over time (Figure 4.17). If nitrite is the intermediate nitrogen species in the reduction pathway of nitrate to nitrogen gas, then consumption of the electron donors and the nitrite should be observed. The acetate batch analysis showed a reduction in nitrite from 18.9 ± 0.2 mg N/L to 15.8 ± 0.9 mg N/L, with sCOD reduction from 334 ± 17 mg/L to 163 ± 30 mg/L after 15 hours. In the propionate test, however, the nitrite stayed relatively constant (graph B of Figure 4.17) and it cannot be said that nitrite decreased, based on the standard deviation of the initial and final measurement.  One reason why the reduction cannot be seen is that the average VSS of the Anammox sludge was only 203 mg/L, which was relatively lower than other mixotrophic tests conducted. In running the test as a triple replicate, one batch test - that had higher VSS than the other two tests - did show a reduction in nitrite and sCOD. This suggests that there may simply not have been enough Anammox bacteria present to induce a noticeable reduction in the nitrite or sCOD concentrations. Based on the consumption of nitrite in presence of organic carbon, nitrite may be an intermediate chemical in the reduction pathway of nitrate. Guven et al. (2005) reported similar results in which propionate oxidation occurred via both nitrate and nitrite and the electron acceptor.    75   Figure 4.17 Mixotrophic tests with nitrite and Anammox biomass from SBR (A) 15-hour test with acetate (♦) and nitrite (○) (Note scale). (B) 17-hour test with propionate (♦) and nitrite (○) (Note scale). (n=3 for all conditions where n represents number of replicate tests)  4.4.5. Mixotrophic Analysis with Anammox Sludge Enriched in Pilot System In addition to using Anammox sludge obtained from the lab-scale SBR, the enriched Anammox sludge from the pilot-scale SBR was tested for mixotrophic conditions (Figure 4.18). The granular Anammox sludge obtained from the pilot-scale SBR had higher VSS concentrations (~1000 mg/L) than the tests performed with the Anammox system, enriched with synthetic feed (250 - 400 mg/L). In the test with acetate and propionate, the initial ammonium concentration was ~43 mg N/L, despite washing the sludge. Within 2.5 hours, the ammonium concentration decreased to 2.9 mg/L and 2.2 mg/L for acetate and propionate, respectively. During this period, the nitrate concentration decreased from 11.7 mg N/L initially to 7.12 mg N/L, with the nitrite concentration increasing from 0.9 mg N/L initially to 16.4 mg N/L in the acetate system. With the propionate system, the nitrate concentration decreased from 12.3 mg N/L initially, to 6.1 mg N/L, with the nitrite concentration increasing from 2.0 mg N/L to 8.3 mg N/L. Furthermore, the COD decreased by ~20 mg/L for both systems, in the initial 2.5 hours.   The reduction in nitrate concentration, coupled with an increase in nitrite concentration, may suggest that nitrite is, indeed, an intermediate of the organic carbon oxidation. Guven et al. 0 75 150 225 300 375 0 5 10 15 20 25 0 5 10 15 COD (mg/L) NO2-  (mg N/L) Time (hours) A 0 50 100 150 200 250 5 10 15 20 0 5 10 15 20 COD (mg/L) NO2-  (mg N/L) Time (hours) B   76  (2005) suggested that anaerobic ammonium oxidation occurs simultaneously with organic carbon oxidation, which possibly suggests why the ammonium concentration decreased during this period. Going with the known stoichiometry of the Anammox pathway, the molar ratio consumption of ammonium to nitrite should be 1:1.32. Even if the assumption is made that nitrite is the intermediate chemical in the reduction pathway of nitrate, it does not explain the rapid consumption of ammonium observed in these results.  After 2.5 hour to the end of the experiment at 18 hour, propionate and acetate continued to decline with respect to time. Compared to the tests conducted with the lab-scale sludge shown in Section 4.4.3, there was a higher consumption of COD between the 2.5 hour mark to 18 hours despite the limited availability of nitrate and nitrite for the reduction pathway. Based on FISH results, it is evident that the relative population of other species than Anammox, AOB and NOB is higher in the pilot system sludge. Higher relative population of heterotrophs may account for higher consumption of the COD during this period. In this case, it may be difficult to assess the reduction stoichiometry of nitrate in the presence of electron donors since pure cultures of Anammox have not been cultured; distinction of COD oxidation between hetrotrophic activity and Anammox activity needs to be considered.  The pilot-scale SBR had unusually high COD in the reject water (average 1370 mg/L). Although much of the COD can be attributable to polymeric substances used during the dewatering process of anaerobically digested sludge, potential denitrifier activity must be elucidated to confirm that Anammox bacteria are responsible for the oxidation of VFAs. To test this, the Anammox sludge was spiked with a 1:1 molar ratio of methanol and acetate with nitrate (Figure 4.18). During the 18-hour batch analysis, the COD, ammonium and nitrate concentration remained relatively the same. This result is interesting since in Section 4.2, a significant population was unaccounted for during the volumetric fractional analysis. If heterotrophs are present in the system, then methanol should be readily consumed in conjunction with nitrate.  Interestingly, the incubation tests performed with the Anammox sludge obtained from the reject water feed revealed a more immediate response in the reduction of nitrate and the electron donor,   77  compared to the tests performed with the lab sludge enriched with synthetic feed. One possibility is that, since the reject water used for this study contained unusually high levels of COD, the Anammox bacteria may actively have enzymes responsible for the consumption of the electron donors. The transient build-up of NO2- is characteristic of Candidatus 'Kuenenia stuttgartiensis' activity and was also observed in a previous study by Kartal et al. (Kartal, et al., 2007). The fact that there was more immediate build-up of NO2- with the acetate, compared to propionate, suggests that the oxidation of electron donors may be slower with more complex carbon chains. There is also a possibility that Candidatus 'Anammoxoglobus propionicus' and Candidatus 'Brocadia fulgida' may be present in Anammox systems running on reject water, but no tests were done in this study to confirm their presence.      78    Figure 4.18 Mixotrophic tests with Anammox biomass from pilot-scale reactor (Higher VSS than lab-scale reactor) (A) 18-hour test with acetate (♦), ammonium (□), nitrate (○) and nitrite (▲). (B) 18-hour test with propionate (♦), ammonium (□), nitrate (○) and nitrite (▲). (C) 18-hour inhibition test 1 with methanol + acetate (♦), ammonium (□), nitrate (○) and nitrite (▲). (D) 18-hour inhibition test 2 with methanol + acetate (♦), ammonium (□), nitrate (○) and nitrite (▲)    0 50 100 150 200 250 300 350 400 0 10 20 30 40 0 10 20 COD (mg/L) NH4+, NO3-, NO2- (mg N/L) Time (hours) A 0 50 100 150 200 250 300 350 400 0 10 20 30 40 0 10 20 COD (mg/L) NH4+, NO3-, NO2- (mg N/L) Time (hours) B 0 100 200 300 400 500 600 700 800 0 10 20 30 40 50 60 0 10 20 COD (mg/L) NH4+, NO3- , NO2-  (mg N/L) Time (hours) C 0 100 200 300 400 500 600 700 800 0 10 20 30 40 50 60 0 10 20 COD (mg/L) NH4+, NO3- , NO2-  (mg N/L) Time (hours) D   79  4.4.6. Mixotrophic Analysis using Primary Effluent with Anammox Sludge Enriched in Pilot System Anammox sludge obtained from the pilot-scale SBR was mixed with primary clarifier effluent in a 1:1 volumetric ratio and spiked with nitrate, in test A and nitrite in test B (Figure 4.19).Over the 5.5-hour test period, test A showed a nitrate concentration decrease from 18.9 mg/L to 10.4 mg/L. During the same period, the sCOD decreased from 168 mg/L to 142 mg/L. The decrease in nitrate concentration, with a simultaneous decrease in sCOD, is analogous to the trend observed with acetate and propionate batch analyses. The primary clarifier effluent found at the UBC pilot plant is known to have acetate present in the system and may explain the trend. However, as the wastewater was not characterized prior to the analysis, it is difficult to conclude what organic matter present in the wastewater contributed to nitrate reduction. At this point, it is unclear whether the organic matter was truly oxidized or simply taken up and stored internally as PHA. The fact that there seems to be a coupled relationship between changes in nitrate and COD concentrations shows that an in-depth investigation is highly relevant for considerations of using Anammox technology for mainstream treatment.     Figure 4.19 Mixotrophic tests using primary effluent with Anammox biomass from pilot-scale reactor (Higher VSS than lab-scale reactor) (A) 5.5-hour nitrate spike test with primary effluent (♦), nitrate (○) and nitrite (▲). (B) 5.5-hour nitrite spike test with primary effluent (♦), nitrate (○) and nitrite (▲) 0 50 100 150 200 0 4 8 12 16 20 0 1 2 3 4 5 6 COD (mg/L) NO3- , NO2-  (mg N/L) Time (hours) A 0 50 100 150 200 0 3 6 9 12 15 0 1 2 3 4 5 6 COD (mg/L) NO3- , NO2-  (mg N/L) Time (hours) B   80  4.4.7. Summary of Mixotrophic Results and Implications Enriched Anammox bacteria grown in the absence of organic carbon source - as confirmed through FISH analysis - showed COD reduction with the introduction of acetate, propionate and primary effluent in batch test conditions. COD reduction was observed over a period of several hours for both biomass collected from a synthetic feed system which contains no COD and a pilot-scale system utilizing rejectwater feed.  Heterotrophic denitrification was shown not to be responsible for the oxidation of organic carbon and reduction of nitrate since the batch analysis involving the addition of methanol, as the sole organic carbon source, showed no change in COD or nitrate concentration. Similar to previous studies (Guven, et al., 2005; Kartal, et al., 2007; Kartal, et al., 2008), acetate and propionate consumption was detected with Anammox bacteria.   Interestingly, the growth conditions for the two biomass sources (synthetic feed system and reject water feed system), seem to influence how readily the organic carbon are metabolized. Incubation studies with lab sludges enriched with synthetic feed which contain no COD, showed a lag phase - generally in the order of several hours - in the consumption of the electron donors. However, incubation studies with pilot sludge enriched with reject water showed a more immediate response, with nitrate and sCOD reduction being seen immediately. Despite low concentrations of fast biodegradable organic matter in reject water, the Anammox bacteria are still metabolically active for the use of organic carbon as substrates. A characterization study of the organic matter present in the Annacis reject water would have been useful as it would reveal whether fast biodegradable organic matter is present.   Results in this study suggest that side-stream Anammox systems can readily consume organic loading, provided that the main electron donors are characterized. The heterotrophic mechanism may be beneficial for the overall performance since it leads to higher nitrogen turnover; introduction of fermentation products to side-stream Anammox systems can achieve more complete nitrogen removal through the reduction of nitrate present in the effluent. Previous studies have already shown that Anammox bacteria can out-compete heterotrophic denitrifiers provided that the COD is low (COD/N ratio of < 1) (Chamchoi, et al., 2008). With higher COD/N ratios, the Anammox activity is suppressed but can co-exist with denitrifiers.    81   The mixotrophic tests using primary effluent as the sole organic carbon source also showed COD reduction. This is a promising result for the adoption of Anammox for main-stream wastewater treatment. However, studies regarding low ammonium concentrations and low temperature issues must be addressed before Anammox technology can be sufficiently adopted for main-stream treatment. In one pilot scale study, long term operation of a deammonification system, using aerobic granular sludge, was achieved in which acetate was oxidized with recycled effluent nitrate  under ambient temperature of 18°C ± 3 (Winkler, et al., 2012). This study used synthetic feed and achieved stable volumetric removal rates of 900 g N2-N / m3-d and 600 g COD / m3-d. Interestingly, there was a population shift towards Candidatus Brocadia fulgida which may be attributed to the acetate used as the source of the COD as in work by Kartal et al. (2008). Heterotrophic activity was found to be not responsible for the removal of COD based on the results of FISH and up to 5 fold lower sludge production than expected under heterotrophic growth. Provided that the COD/N ratio is sufficiently low at 0.5, Anammox bacteria can successfully couple oxidation of organic acids with the reduction of nitrate even in ambient temperature.     82  5. CONCLUSIONS AND RECOMMENDATIONS 5.1. Conclusions This study used a deammonification system fed with synthetic reject water to investigate three key areas: 1) microbial community and volumetric fraction, 2) kinetics and 3) mixotrophic effects. Thus far, most literature investigated a purely Anammox system in which the system operated under a strictly anaerobic setting with feed containing ammonium and nitrite in equimolar ratios. The application of the Anammox technology for side-stream treatment, however, requires a partial nitritation step (as a one-stage or two-stage system) to partially oxidize the ammonium to nitrite. Understanding the dynamics within this combined system was the focus of this study. A SBR system was operated for approximately 1 year consisting of an acclimation phase followed by the operation under a long SRT (55 days) and short SRT (30 days). During this phase, sludge samples were taken for FISH analysis and batch studies to investigate the kinetics and the heterotrophic activity of Anammox bacteria.  The key conclusions from this research are as follows:  Nitrite sensitivity:  In the 55 day SRT phase, the nitrite was maintained below 5 mg N/L. The nitrite was the limiting substrate for the Anammox activity, thus, it was feasible to increase aeration to achieve higher overall nitrogen removal in the system during this period. For the AOB population, the AOB activity is limited by the bulk DO concentration, thus increasing the aeration would result in the higher production of nitrite. Nonetheless, it was observed during the 30 day SRT that the build-up of nitrite can have a detrimental effect on the system; a positive feedback loop in which higher nitrite concentration limits the Anammox activity which limits nitrite uptake. Thus, nitrite concentration must always be checked during the operation of the Anammox system to ensure that the Anammox population is not inhibited.     83  Granular size and spatial community:  The reduction of the granule size over the course of the study suggests that low DO conditions and high shear mixing are factors that contribute to the granule size. The Anammox population and the AOB population were dispersed evenly throughout the granule, which differs from the prevailing model of an outer AOB layer and an inner Anammox layer. Furthermore, the NOB population was limited in growth as evidenced by FISH. The NOB population was generally below 6% throughout the study suggesting that they can be washed out over time by limiting their activity.    Population dynamics between AOB, NOB and Anammox:  As expected, FISH results confirmed that the AOB and the Anammox population are strongly represented in the volumetric fraction. Furthermore, the NOB population was negligible, suggesting that temperature control, DO control and selective washing can lead to the washout of the NOB population over time.    AOB, NOB and Anammox population did not fully account for the bacterial composition within the system. From a visual standpoint, filamentous bacteria were readily dispersed through the granule structure. It is likely that even with no COD present in the influent, heterotrophic bacteria may co-exist in the Anammox system. The unaccounted population was significantly higher in the sludge obtained from the pilot system, suggesting a complex interaction between many bacterial groups than just the AOB, NOB and the Anammox population.   FISH provides an inexpensive method to analyze specific populations present in the activated sludge provided that the relevant microbial populations present in the system are known. For Anammox systems, it may be useful for start-ups to determine whether Anammox populations are present within the system. Also as seen in this study, it allowed for the confirmation of NOB washout.    84  Kinetic parameters:  The calculated observed yield coefficient was lower than the theoretical yield coefficient determined by Strous et al. (1998). The initial plan to operate the system under a series of different SRTs could not be completed to estimate the theoretical yield coefficient due to time constraints and poor nitrogen removal performance observed under the 30 day SRT.   The calculated maximum specific growth rate was comparable to literature values. The affinity constants for ammonium and nitrite were higher likely due to mass transfer limitations observed through the use of non-disrupted granules during the batch analysis.  Mixotrophic studies  Acetate, propionate and primary effluent all showed a reduction in the COD concentration over time. Nitrate and nitrite were both reduced under the presence of the electron donors, suggesting that nitrite may be an intermediate compound used in the nitrate reduction pathway. The use of methanol, an inhibitor for Anammox, showed no change in nitrate and COD levels, suggesting that heterotrophs may not be responsible for the consumption of the electron donors used. Nonetheless, the earlier volumetric fraction analysis showed that a significant population were not represented by AOB, NOB and Anammox alone. Further studies are needed to investigate what the other population represents if they are not heterotrophs. The work presented in this study provides early evidence for a facultative capacity of the Anammox bacteria to oxidize electron donors in the presence of nitrate. This provides strong implications for further research into whether Anammox can be adopted for main-stream wastewater treatment processes.    85   5.2. Recommendations The following recommendations are made based on the outcomes from this study: 1. Oligonucleotide probes could be used at a species level to determine what Anammox species are present in the system. It is known that specialization is present among different Anammox species. Thus, a better understanding of how the system parameters play a role at a species level can be made. The alternative approach is to conduct metagenomic studies in order to obtain samples of all genes from the members of the mixed community. This allows for the identification of all microbial players and elucidate the unaccoutned fraction seen through FISH analysis.   2. The standard deviation observed with the volumetric fraction could be reduced through a better method of homogenizing the sludge samples. The standard deviation could have been reduced by taking more fields of view for each sludge sample. However, this would be a time consuming process and literature shows that 30 fields of view should obtain a volumetric fraction with a relatively low standard deviation. Homogenization could be achieved through sonication to disrupt the granules as long as shear forces are kept low to prevent the rupturing of cell walls. In addition, capturing FISH images with higher resolution will reduce the noise seen through the DAIME image processing algorithm and lead to more consistent volumetric fraction results.  3.  The initial goal was to operate the system under a series of sludge retention times in order to determine the endogenous decay coefficient and the yield. Based on the prolonged period needed to achieve a stable influent ammonium removal and SRTs needed in the order of weeks, running several SBR systems simultaneously would have been useful in terms of being able to obtain results under more SRT periods.  4. Although the use of primary effluent for the mixotrophic study showed promising results for the coupling of COD oxidation with nitrate reduction, an in-depth characterization of the primary effluent was not conducted. Thus, it is unknown if the Anammox activity was   86  centered around the oxidation of acetate, propionate or more complex carbon compounds. Characterization of the primary effluent could have allowed a synthetic version of the primary effluent to be used in order to verify if similar results could be obtained for the oxidation of COD and reduction of nitrate.  5. There was a delay of several days in determining the concentration of nitrate and nitrite in the system. Since Anammox systems are sensitive to high nitrite concentrations, this delay is undesirable if the objective is to achieve a stable, long-term operation. Although colourimetric kits were used, the results were inconsistent with analytical results obtained through flow injection analysis. The use of an ORP probe could allow for an indirect method of on-line monitoring of nitrate and nitrite levels.     87  Bibliography Abeliovich, A., 1992. Transformations of Ammonia and the Environmental Impact of Nitrifying Bacteria. Biodegradation, Volume 3, pp. 255-264. Adamczyk, J. et al., 2003. The Isotope Array, a New Tool that Employs Substrate-Mediated Labeling of rRNA for Determination of Microbial Community Structure and Function. Applied and Environmental Microbiology, Volume 69, pp. 6875-6887. AECOM, 2012. Rocky Mountain Water Environment Association. [Online]  Available at: http://www.rmwea.org/tech_papers/metro_pwo/Metro%20PWO%20Seminar%20May%2023,%202012%20Sidestream%20and%20Mainstream%20Deammonification.pdf [Accessed 20 04 2014]. Ahn, Y. H., 2006. Sustainable Nitrogen Elimination Biotechnologies: A Review. Process Biochemistry, Volume 41, pp. 1709-1721. Ahn, Y. H. & Kim, H. C., 2004. Nutrient Removal and Microbial Granulation in an Anaerobic Process Treating Inorganic and Organic Nitrogenous Wastewater. Water Science and Technology, 50(6), pp. 207-215. Almeida, J. S., Julio, S. M., Reis, M. A. & Carrondo, M. J., 1995a. Nitrite Inhibition of Denitrification by Pseudomonas fluorescens. Biotechnology and Bioengineering, Volume 46, pp. 194-201. Amann, R., Fuchs, B. M. & Behren, S., 2001. The Identification or Microorganisms by Fluorescence in situ Hybridisation. Current Opinion in Biotechnology, 12(3), pp. 231-236. Amann, R. I. et al., 1990. Combination of 16S Ribosomal-RNA-Targeted Oligonucleotide Probes with Flow-Cytometry for Analyzing Mixed Microbial-Populations. Applied and Environmental Microbiology, Volume 56, pp. 1919-1925. Amann, R. I., Krumholz, L. & Stahl, D. A., 1990. Fluorescent-Oligonucleotide Probing of Whole Cells for Determinative, Phylogenetic, and Environmental Studies in Microbiology. Journal of Bacteriology, Volume 172, pp. 762-770. Amann, R. I., Ludwig, W. & Schleifer, K. H., 1995. Phylogenetic Identification and in situ Detection of Individual Microbial Cells without Cultivation. Microbiology Review, Volume 59, pp. 143-169. Andersson, K. K. & Hooper, A. B., 1983. O2 and H2O are each the source of one O in NO2- produced from NH3 by Nitrosomonas: 15N-NMR evidence. Federation of European Biochemical Societies, 164(2), pp. 236-240. Anthonisen, A. C., Loehr, R. C., Prakasam, T. B. & Srinath, E. G., 1976. Inhibition of Nitrification by Ammonia and Nitrous Acid. Water Pollution Control Federation, 48(5), pp. 835-852. Barker, D. J. & Stuckey, D. C., 1999. A Review of Soluble Microbial Products (SMP) in Wastewater Treatment Systems. Water Research, Volume 33, pp. 3063-3082. Barnes, D. & Bliss, P. J., 1983. Biological Control of Nitrogen in Wastewater Treatment. New York: E. & F.N. Spon. Bitton, G., 2011. Wastewater Microbiology. 4th ed. Hoboken: John Wiley & Sons Inc.. Blackburne, R., Yuan, Z. & Keller, J., 2008. Partial Nitrification to Nitrite Using Low Dissolved Oxygen Concentration as the Main Selection Factor. Biodegredation, Volume 19, pp. 303-312. Bock, E., Koops, H. P. & Harms, H., 1986. Cell Biology of Nitrifying Bacteria, in: J.I. Prosser (Ed.), Nitrification. Oxford: IRL. Bollmann, A., French, E. & Laanbroek, H. J., 2011. Isolation, Cultivation and Characterization of Ammonia-Oxidizing Bacteria and Archaea Adapted to Low Ammonium Concentrations. Methods in Enzymology, Volume 486, pp. 55-88. Brandes, J. A., Devol, A. H. & Deutsch, C., 2007. New Developments in the Marine Nitrogen Cycle. Chemical Reviews, Volume 107, pp. 577-589. Broda, E., 1977. Two kinds of lithotrophs missing in nature. Zeitschrift fur allgemeine Mikrobiologie, 17(6), pp. 491-493. Canada, E., 2014. Wastewater Systems Effluent Regulations, Ottawa: Ministry of the Environment. Cao, Y. et al., 2013. Mainstream Partial Nitritation-ANAMMOX Nitrogen Removal in the Largest Full-Scale Activated Sludge Process in Singapore: Process Analysis. Vancouver, IWA Specialized Conference, Nutrient Removal and Recovery 2013: Trends in Resource Recovery and Use. 28-31 July, 2013.   88  Chain, P. et al., 2003. Complete Genome Sequence of the Ammonia-Oxidizing Bacterium and Obligate Chemolithoautotroph Nitrosomonas europaea. American Society for Microbiology, 185(9), pp. 2759-2773. Chamchoi, N., Nitisoravut, S. & Schmidt, J. E., 2008. Inactivation of ANAMMOX Communities under Concurrent Operation of Anaerobic Ammonium Oxidation (ANAMMOX) and denitrification. Bioresource Technology, Volume 99, pp. 3331-3336. Chen, H. et al., 2009. The Development of Simultaneous Partial Nitrification, Anammox and Denitrification (SNAD) Process in a Single Reactor for Nitrogen Removal. Bioresource Technology, Volume 100, pp. 1548-1554. Cui, F., 2012. Cold CANON: Anammox at Low Temperatures, Delft: Delft University of Technology. Daims, H. et al., 1999. The Domain-Specific Probe EUB338 is Insufficient for the Detection of All Bacteria: Development and Evaluation of a More Comprehensive Probe Set. Systematic and Applied Microbiology, Volume 22, pp. 434-444. Daims, H. et al., 2001. In Situ Characterization of Nitrospira-Like Nitrite-Oxidizing Bacteria Active in Wastewater Treatment Plants. Applied and Environmental Microbiology, 67(11), pp. 5273-5284. Daims, H. et al., 2000. Novel Nitrospira-like Bacteria as Dominant Nitrite-Oxidizers in Biofilms from Wastewater Treatment Plants: Diversity and in situ Physiology. Water Science and Technology, 41(4-5), pp. 85-90. Dapena-Mora, A. et al., 2004. Stability of the ANAMMOX Process in a Gas-Lift Reactor and a SBR. Journal of Biotechnology, Volume 110, pp. 159-170. Dapena-Mora, A. et al., 2007. Evaluation of Activity and Inhibition Effects on Anammox Process by Batch Tests Based on the Nitrogen Gas Production. Enzyme and Microbial Technology, Volume 40, pp. 859-865. Dapena-Mora, A. et al., 2005. Start-up of Anammox Process: Different Reactor Configurations. Krakow, Poland, IWA Specialized Conference: Nutrient Management in Wastewater Treatment Processes and Recycle Streams. Devol, A. H., 2003. Solution to a marine mystery. Nature, pp. 575-576. Ding, S. et al., 2013. Ecological Characteristics of Anaerobic Ammonia Oxidizing Bacteria. Applied Microbiology and Biotechnology, Volume 97, pp. 1841-1849. Egli, K. et al., 2003. Microbial Composition and Structure of a Rotating Biological Contactor Biofilm Treating Ammonium-Rich Wastewater without Organic Carbon. Microbial Ecology, 45(4), pp. 419-432. Egli, K. et al., 2001. Enrichment and Characterization of an Anammox Bacterium from a Rotating Biological Contactor Treating Ammonium-Rich Leachate. Archive of Microbiology, Volume 175, pp. 198-207. Eilersen, A. M., Henze, M. & Kloft, L., 1994. Effect of Volatile Fatty Acids and Trimethylamine on Nitrification in Activated Sludge. Water Research, 28(6), pp. 1329-1336. Environment Canada, 2012. Wastewater Systems Effluent Regulations. Fisheries Act, Ottawa: Minister of Justice. EPA, 2013. Overview of Greenhouse Gases - Nitroux Oxide Emissions. [Online]  Available at: http://epa.gov/climatechange/ghgemissions/gases/n2o.html [Accessed 15 01 2014]. Fdz-Polanco, F., Villaverde, S. & Garcia, P. A., 1996. Effects Causing Nitrite Build-up in Biofilters. Water Science and Technology, 34(3), pp. 371-378. Fernandez, I. et al., 2012. Short- and Long-Term Effects of Ammonium and Nitrite on the Anammox Process. Journal of Environmental Management, Volume 95, pp. 170-174. Francis, C. A., Beman, J. M. & Kuypers, M. M., 2007. New processes and players in the nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation. International Society for Microbial Ecology, Volume 1, pp. 19-27. Fuchsman, C. A. et al., 2012. Free-Living and Aggregate-Associated Planctomycetes in the Black Sea. FEMS Microbiology Letters, Volume 80, pp. 402-416. Fux, C., 2003. Biological Nitrogen Elimination of Ammonium-Rich Sludge Digester Liquids, PhD Thesis, Switzerland: ETH-Zurich. Fux, C. et al., 2002. Biological Treatment of Ammonium-Rich Wastewater by Partial Nitritation and Subsequent Anaerobic AMmonium Oxidation (Anammox) in a Pilot Plant. Journal of Biotechnology, Volume 99, pp. 295-306. Fux, C., Marchesi, V., Brunner, I. & Siegrist, H., 2004. Anaerobic Ammonium Oxidation of Ammonium-Rich Waste Streams in Fixed-Bed Reactors. Water Science and Technology, 49(11-12), pp. 77-82. Fux, C. et al., 2006. Efficient and Stable Nitritation and Denitritation of Ammonium-Rich Sludge Dewatering Liquor Using an SBR with Continuous Loading. Water Research, 40(14), pp. 2765-2775.   89  Gerardi, M. H., 2002. Nitrification and Denitrification in the Activated Sludge Process. New York: John Wiley and Soncs, Inc.. Gerardi, M. H., 2006. Wastewater Bacteria. Hoboken: John Wiley & Sons Inc.. Gomez, J., Mendez, R. & Lema, J. M., 2000. Kinetic Study of Addition of Volatile Organic Compounds to a Nitrifying Sludge. Applied Biochemistry and Biotechnology, Volume 87, pp. 189-202. Grady, C. L., Daigger, G. T., Love, N. G. & Filipe, C. D., 2011. Biological Wastewater Treatment. 3rd ed. Boca Raton: Taylor & Francis Group/CRC Press. Grunditz, C. & Dalhammar, G., 2001. Development of Nitrification Inhibition Assays Using Pure Cultures of Nitrosomonas and Nitrobacter. Water Research, Volume 35, pp. 433-440. Guisasola, A. et al., 2007. Inorganic Carbon Limitations on Nitrification: Experimental Assessment and Modelling. Water Research, 41(2), pp. 277-286. Guven, D. et al., 2005. Propionate Oxidation by and Methanol Inhibition of Anaerobic Ammonium-Oxidizing Bacteria. Applied and Environmental Microbiology, 71(2), pp. 1066-1071. Guven, D. et al., 2005. Propionate Oxidation by and Methanol Inhibition of Anaerobic Ammonium-Oxidizing Bacteria. Applied and Environmental Microbiology, 71(2), pp. 1066-1071. Hao, X. D., Heijnen, J. J. & van Loosdrecht, M. C., 2002a. Model-Based Evaluation of Temperature and Inflow Variations on a Partial Nitrification-Anammox Biofilm Process. Water Research, 36(19), pp. 4839-4849. Hao, X. D., Heijnen, J. J. & van Loosdrecht, M. C., 2002b. Sensitivity Analysis of Biofilm Model Describing a One-Stage Completely Nitrogen Removal (CANON) Process. Biotechnology and Bioengineering, 77(3), pp. 266-277. Head, I. M., Hiorns, W. D., Martin Embley, T. & McCarthy, A. J., 1993. The phylogeny of autotrophic ammonia-oxidizing bacteria as determined by analysis of 16S ribosomal RNA gene sequences. Journal of General Microbiology, Volume 139, pp. 1147-1153. Hellinga, C. et al., 1998. The SHARON Process: An Innovative Method for Nitrogen Removal from Ammonium-Rich Waste Water. Water Science and Technology, 37(9), pp. 135-142. Hellinga, C., van Loosdrecht, M. C. & Heijnen, J. J., 1999. Model Based Design of a Novel Process for Nitrogen Removal from Concentrated Flows. Mathematical and Computer Modelling of Dynamical Systems, 5(4), pp. 351-371. Henze, M., van Loosdrecht, M., Ekama, G. & Brdjanovic, D., 2008. Biological Wastewater Treatment. Principles, modelling and design. London: IWA Publishing. Hippen, A. et al., 2001. Six Years' Practical Experience with Aerobic/Anoxic Deammonification in Biofilm Systems. Water Science and Technology, 44(2-3), pp. 39-48. Hollocher, T. C., Tate, M. E. & Nicholas, D. J., 1981. Oxidation of Ammonia by Nitrosomonas europaea - Definitive 18O-tracer evidence that hydroxylamine formation involves a monooxygenase. Journal of Biological Chemistry, 256(21), pp. 10834-10836. Holt, J. G. et al., 2000. Aerobic Chemolithotrophic Bacteria and Associated Organisms. In Bergey's Manual or Determinative Bacteriology. 9th ed. Philadelphia: Lippincott Williams & Wilkins. Hong, Y. G., Li, M., Cao, H. L. & Gu, J. D., 2011. Residence of Habitat-Specific Anammox Bacteria in the Deep-Sea Subsurface Sediments of the South China Sea: Analyses of Marker Gene Abundance with Physical Chemical Parameters. Microbial Ecology, Volume 62, pp. 36-47. Hu, B. et al., 2010. Identification and Quantification of Anammox Bacteria in Eight Nitrogen Removal Reactors. Water Research, 44(17), pp. 5014-5020. Innerebner, G., Insam, H., Franke-Whittle, I. H. & Wett, B., 2007. Identification of Anammox Bacteria in a Full-Scale Deammonification Plant Making Use of Anaerobic Ammonium Oxidation. Systematic and Applied Microbiology, Volume 30, pp. 408-412. Isaka, K. et al., 2006. Growth Characteristic of Anaerobic Ammonium-Oxidizing Bacteria in an Anaerobic Biological Filtrated Reactor. Applied Microbiology Biotechnology, Volume 70, pp. 47-52. Isaka, K., Sumino, T. & Tsuneda, S., 2007. High Nitrogen Removal Performance at Moderately Low Temperature Utilizing Anaerobic Ammonium Oxidation Reactions. Journal of Bioscience and Bioengineering, 103(5), pp. 486-490. Isaka, K. et al., 2008. Anaerobic ammonium oxidation (anammox) irreversibly inhibited my methanol. Applied Microbiology Biotechnology, Volume 81, pp. 379-385. Itokawa, H., Hanaki, K. & Matsuo, T., 2001. Nitrous Oxide Production in High-Loading Biological Nitrogen Removal Process under Low COD/N Ratio Condition. Water Research, 35(3), pp. 657-664.   90  Jetten, M. S., Horn, S. J. & van Loosdrecht, M. C., 1997. Towards a More Sustainable Municipal Wastewater Treatment System. Water Science and Technology, 35(9), pp. 171-180. Jetten, M. S., Schmid, M., Schmidt, I. & van Dongen, U., 2002. Improved Nitrogen Removal by Application of New Nitrogen-Cycle Bacteria. Reviews in Environmental Science and Biotechnology, Volume 1, pp. 51-63. Jetten, M. S. et al., 1999. The Anaerobic Oxidation of Ammonium. FEMS Microbiology Reviews, Volume 22, pp. 421-437. Jetten, M. S. et al., 2009. Biochemistry and Molecular Biology of Anammox Bacteria. Critical Reviews in Biochemistry and Molecular Biology, 44(2-3), pp. 65-84. Jetten, M. S. et al., 2001. Microbiology and Application of the Anaerobic Ammonium Oxidation ('anammox') Process. Environmental Biotechnology, Volume 12, pp. 283-288. Juretschko, S. et al., 1998. Combined Molecular and Conventional Analyses of Nitrifying Bacterium Diversity in Activated Sludge: Nitrosococcus mobilis and Nitrospira-like Bacteria as Dominant Populations. Applied and Environmental Microbiology, 64(8), pp. 3042-3051. Kartal, B. et al., 2013. How to make a living from anaerobic ammonium oxidation. FEMS microbiology reviews. Kartal, B. et al., 2006. Adaptation of a Freshwater Anammox Population to High Salinity Wastewater. Journal of Biotechnology, Volume 126, pp. 546-553. Kartal, B. et al., 2007. Anammox bacteria disguised as denitrifiers: nitrate reduction to dinitrogen gas via nitrite and ammonium. Environmental Microbiology, 9(3), pp. 635-642. Kartal, B. et al., 2007. Candidatus "Anammoxoglobus propionicus" a new propionate oxidizing species of anaerobic ammonium oxidizing bacteria. Systematic and Applied Microbiology, Volume 30, pp. 39-49. Kartal, B. et al., 2008. Candidatus 'Brocadia fulgida': an autofluorescent anaerobic ammonium oxidizing bacterium. Federation of European Microbiological Societies, Volume 63, pp. 46-55. Kimura, Y., Isaka, K., Kazama, F. & Sumino, T., 2010. Effects of Nitrite Inhibition on Anaerobic Ammonium Oxidation. Applied Microbiology and Biotechnology, 86(1), pp. 359-365. Kindaichi, T., Ito, T. & Okabe, S., 2004. Ecophysiological Interaction Between Nitrifying Bacteria and Heterotrophic Bacteria in Autotrophic Nitrifying Biofilms as Determined by Microautoradiography-Fluorescence in Situ Hybridization. Applied and Environmental Microbiology, 70(3), pp. 1641-1650. Kleinder, D., 1985. Bacterial Ammonium Transport. FEMS Microbiology Reviews, Volume 32, pp. 87-100. Kuypers, M. M., Lavik, G. & Thamdrup, B., 2006. Anaerobic ammonium oxidation in the marine environment. Past and Present Water Column Anoxia, pp. 311-335. Kuypers, M. M. et al., 2005. Massive Nitrogen Loss from the Benguela Upwelling System Through Anaerobic Ammonium Oxidation. Proceedings of the National Academy of Sciences, 102(18), p. 6478–6483. Kuypers, M. M. et al., 2003. Anaerobic Ammonium Oxidation by Anammox Bacteria in the Black Sea. Nature, Volume 422, pp. 608-611. Lam, P. & Kuypers, M. M., 2011. Microbial Nitrogen Cycling Processes in Oxygen Minimum Zones. Annual Review of Marine Science, Volume 3, pp. 317-345. Lam, P. & Kuypers, M. M., 2011. Microbial Nitrogen Cycling Processes in Oxygen Minimum Zones. Annual review of marine science, Volume 3, pp. 317-345. Leu, H. G., Lee, C. D., Ouyang, C. F. & Tseng, H. T., 1998. Effects of Organic Matter on the Conversion Rates of Nitrogenous Compounds in a Channel Reactor under Various Flow Conditions. Water Research, 32(3), pp. 891-899. Li, H., Chen, S., Mu, B. & Gu, J., 2010. Molecular Detection of Anaerobic Ammonium-Oxidizing (Anammox) Bacteria in High-Temperature Petroleum Reservoirs. Microbial Ecology, 60(4), pp. 771-783. Lindsay, M. R. et al., 2001. Cell Compartmentalisation in Planctomycetes: Novel Types of Structural Organisation for the Bacterial Cell. Archives of Microbiology, Volume 175, pp. 413-429. Liu, C. et al., 2009. Effect of Salt Concentration in Anammox Treatment using Non Woven Biomass Carrier. Journal of Bioscience and Bioengineering, 107(5), pp. 519-523. Liu, S. T. et al., 2008. Application of Anaerobic Ammonium-Oxidizing Consortium to Achieve Completely Autrotrophic Ammonium and Sulfate Removal. Bioresource Technology, Volume 99, pp. 6817-6825. Li, X. et al., 2004. Start Up of Deammonification Process in One Single SBR System. Water Science and Technology, 50(6), pp. 1-8. Lopez, H. et al., 2008. Start-up and Enrichment of a Granular Anammox SBR to Treat High Nitrogen Load Wastewaters. Journal of Chemical Technology and Biotechnology, 83(3), pp. 233-241.   91  Lotti, T. et al., 2012. The Effect of Nitrite Inhibition on the Anammox Process. Water Research, 46(8), pp. 2559-2569. Ministry of Environment, B. C., 2012. Municipal Wastewater Regulation, Victoria: British Columbia Ministry of Environment. Mobarry, B. K. et al., 1996. Phylogenetic Probes for Analyzing Abundance and Spatial Organization of Nitrifying Bacteria. Applied and Environmental Microbiology, June, 62(6), pp. 2156-2162. Molinuevo, B., Garcia, M. C., Karakashev, D. & Angelidaki, I., 2009. Anammox for Ammonia Removal from Pig Manure Effluents: Effects of Organic Matter Content on Process Performance. Bioresource Technology, Volume 100, pp. 2171-2175. Montieth, H. D., Bridle, T. R. & Sutton, P. M., 1979. Evaluation of Industrial Waste Carbon Sources for Biological Denitrification, s.l.: Environment Canada Wastewater Technology Centre Report. Mulder, A., 2003. The Quest for Sustainable Nitrogen Removal Technologies. Water Science and Technology, Volume 48, pp. 67-75. Mulder, A., van de Graaf, A. A., Robertson, L. A. & Kuenen, J. G., 1995. Anaerobic ammonium oxidation discovered in a denitrifying fluidized bed reactor. FEMS Microbiology Ecology, 16(3), pp. 177-183. Mulder, J. W., van Loosdrecht, M. C., Hellinga, C. & van Kempen, R., 2001. Full-Scale Application of the SHARON process for Treatment of Rejection Water of Digested Sludge Dewatering. Water Science and Technology, 43(11), pp. 127-134. Nielsen, H., Daims, H. & Lemmer, H., 2009. FISH Handbook for Biological Wastewater Treatment: Identification and Quantification of Microorganisms in Activated Sludge and Biofilms by FISH. London: IWA Publishing. Nielsen, M. et al., 2005. Kinetics, Diffusional Limitation and Microscale Distribution of Chemistry and Organisms in a CANON Reactor. FEMS Microbiology Ecology, Volume 51, pp. 247-256. Nielsen, P. H., Daims, H. & Lemmer, H., 2009. FISH handbook for biological wastewater treatment. London: IWA Publishing. Norton, J. M., Alzerreca, J. J., Suwa, Y. & Klotz, M. G., 2001. Diversity of ammonia monooxygenase operon in autotrophic ammonia-oxidizing bacteria. Archives of Microbiology, Volume 177, pp. 139-149. Okabe, S., Oozawa, Y., Hirata, K. & Watanabe, Y., 1996. Relationship Between Population Dynamics of Nitrifiers in Biofilms and Reactor Performance at Various C:N Ratios. Water Research, 30(7), pp. 1563-1577. Okabe, S., Satoh, H. & Watanabe, Y., 1999. In Situ Analysis of Nitrifying Biofilms as Determined by in City Hybridization and the Use of Microelectrodes. Applied and Environmental Microbiology, 65(7), pp. 3182-3191. Oshiki, M. et al., 2011. Physiological Characteristics of the Anaerobic Ammonium-Oxidizing Bacterium 'Candidatus Brocadia sinica'. Microbiology, 157(6), pp. 1706-1713. Paredes, D. et al., 2007. New Aspects of Microbial Nitrogen Transformations in the Context of Wastewater Treatment - A Review. Engineering in Life Sciences, 7(1), pp. 13-25. Peng, D. C., Bernet, N., Delgenes, J. P. & Moletta, R., 2000. Effects of Oxygen Supply Methods on the Performance of a Sequencing Batch Reactor for High Ammonium Nitrification. Water Environment Research, 72(2), pp. 195-200. Peng, Y. et al., 2004. Biological Nitrogen Removal in SBRs Bypassing Nitrate Generation Accomplished by Chlorination and Aeration Time Control. Water Science and Technology, 49(5-6), pp. 295-300. Pernthaler, J., Glockner, F. O., Schonhuber, W. & Amann, R., 1998. Fluorescence in situ Hybridization, Methods in Microbiology: Marine Microbiology. London: Academic Press Ltd. Pollice, A., Tandoi, V. & Lestingi, C., 2002. Influence of Aeration and Sludge Retention Time on Ammonium Oxidation to Nitrite and Nitrate. Water Research, 36(10), pp. 2541-2546. Prakasam, T. B. & Loehr, R. C., 1972. Microbial Nitrification and Denitrification in Concentrated Wastes. Water Research, Volume 6, pp. 859-869. Purkhold, U. et al., 2000. Phylogeny of All Recognized Species of Ammonia Oxidizers Based on Comparative 16S rRNA and amoA Sequence Analysis: Implications for Molecular Diversity Surveys. Applied and Environmental Microbiology, 66(12), pp. 5368-5382. Pynaert, K. et al., 2003. Characterization of an Autotrophic Nitrogen-Removing Biofilm from a Highly Loaded Lab-Scale Rotating Biological Contactor. Applied and Environmental Microbiology, June, 69(6), pp. 3626-3635.   92  Pynaert, K. et al., 2002. Oxygen-Limited Nitrogen Removal in a Lab-Scale Rotating Biological Contactor Treating an Ammonium-Rich Wastewater. Water Science and Technology, 45(10), pp. 357-263. Rattray, J. E. et al., 2008. Ladderane Lipid Distribution in Four Genera of Anammox Bacteria. Archives of Microbiology, Volume 190, pp. 51-66. Rittmann, B. E., Regan, J. M. & Stahl, D. A., 1994. Nitrification as a Source of Soluble Organic Substrate in Biological Treatment. Water Science and Technology, 30(6), pp. 1-8. Rosenwinkel, K. H. & Cornelius, A., 2005. Deammonification in the Moving-Bed Process for the Treatment of Wastewater with High Ammonia Content. Chemical Engineering and Technology, 28(1), pp. 49-52. Rottenberg, H., 1990. Decoupling of Oxidative Phosphorylation and Photo-Phosphorylation. Biochimica et Biophysica Acta, Volume 1018, pp. 1-17. Rysgaard, S., Glud, R. N., Risgaard-Petersen, N. & Daalsgard, T., 2004. Denitrification and Anammox Activity in Arctic Marine Sediments. Limnology and Oceanography, Volume 49, pp. 1493-1502. Schmid, M. C. et al., 2005. Biomarkers for In Situ Detection of Anaerobic Ammonium-Oxidizing (Anammox) Bacteria. American Society for Microbiology, 71(4), pp. 1677-1684. Schmid, M. C. et al., 2007. Anaerobic ammonium-oxidizing bacteria in marine environments: widespread occurrence but low diversity. Environmental Microbiology, 9(6), pp. 1476-1484. Schmid, M. et al., 2000. Molecular Evidence for Genus Level Diversity of Bacteria Capable of Catalyzing Anaerobic Ammonium Oxidation. Systemic and Applied Microbiology, Volume 23, pp. 93-106. Schmid, M. et al., 2003. Candidatus "Scalindua brodae", sp. nov., Candidatus "Scalindua wagneri", sp. nov., Two New Species of Anaerobic Ammonium Oxidizing Bacteria. Systematic and Applied Microbiology, Volume 26, pp. 529-538. Schmidt, J. E., Batstone, D. J. & Angelidaki, I., 2004. Improved Nitrogen Removal in Upflow Anaerobic Sludge Blanket (UASB) Reactors by Incorporation of Anammox Bacteria into the Granular Sludge. Water Science and Technology, 49(11-12), pp. 69-76. Schnell, A. et al., 2003. Treatment Processes for the Removal of Ammonia from Municipal Wastewater. s.l.:Environment Canada. Schramm, A., de Beer, D., Wagner, M. & Amann, R., 1998. Identification and Activities in situ of Nitrosospira and Nitrospira spp. as Dominant Populations in a Nitrifying Fluidized Bed Reactor. Applied and Environmental Microbiology, 64(9), pp. 3480-3485. Schramm, A. et al., 1996. Structure and function of a nitrifying biofilm determined by in situ hybridization and use of microelectrodes. Applied and Environmental Microbiology, Volume 62, pp. 4641-4647. Shiskowski, D. M., 2013. Becoming Energy-Neutral or Beyond: A Prespective on the Role of Anammox Systems in Canadian WWTFs. Toronto, WEAO 2013 Technical Conference. Shiskowski, D. M., Simm, R. A. & Mavinic, D. S., 2004. An Experimental Procedure for Identifying the Aerobic-Phase Biological Source of Nitrous Oxide in Anoxic-Aerobic Wastewater Treatment Systems. Journal of Environmental Engineering Science, 3(6), pp. 549-533. Siegrist, H., Reithaar, S., Koch, G. & Lais, P., 1998. Nitrogen Loss in a Nitrifying Rotating Contactor Treating Ammonium-Rich Wastewater Without Organic Carbon. Water Science and Technology, 38(8-9), pp. 241-248. Sinninghe Damste, J. S. et al., 2005. Structural Identification of Ladderane and Other Membrane Lipids of Planctomycetes Capable of Anaerobic Ammonium Oxidation. Federation of European Microbiological Societies, 272(16), pp. 4270-4283. Skinde, J. R. & Bhagat, S. K., 1982. Industrial Wastes as Carbon Sources in Biological Denitrification. Water Pollution Control Federation, 54(4), pp. 370-377. Sliekers, A. O. et al., 2002. Completely Autotrophic Nitrogen Removal over Nitrite in One Single Reactor. Water Research, Volume 36, pp. 2475-2482. Sliekers, A. O. et al., 2003. CANON and Anammox in a Gas-Lift Reactor. FEMS Microbiology Letters, Volume 218, pp. 339-344. Sliekers, O. A. et al., 2002. Completely Autotrophic Nitrogen Removal over Nitrite in One Single Reactor. Water Research, 36(10), pp. 2475-2482. Sliekers, O. et al., 2005. Competition and Coexistence of Aerobic Ammonium and Nitrite-Oxidizing Bacteria at Low Oxygen Concentrations. Applied Microbiology Biotechnology, Volume 68, pp. 808-817. SMEWW.2320, 2011. Standard Methods for the Examination of Water and Wastewater. Method 2320 Alkalinity. [Online]    93  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.2540, 2011. Standard Methods for the Examination of Water and Wastewater. Method 2540 Solids. [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.4500, 2011. Standard Methods for the Examination of Water and Wastewater. Method 4500-NH3 Nitrogen (Ammonia). [Online]  Available at: http://standardmethods.org/ [Accessed 01 10 2012]. SMEWW.4500, 2011. Standard Methods for the Examination of Water and Wastewater. Method 4500-NO2- Nitrogen (Nitrite). [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.4500, 2011. Standard Methods for the Examination of Water and Wastewater. Method 4500-NO3- Nitrogen (Nitrate). [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.4500, 2011. Standard Methods for the Examination of Water and Wastewater. Method 4500-P Phosphorus. [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.5220, 2011. Standard Methods for the Examination of Water and Wastewater. Method 5220 Chemical Oxygen Demand (COD). [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. SMEWW.5310, 2011. Standard Methods for the Examination of Water and Wastewater. Method 5310 Total Organic Carbon (TOC). [Online]  Available at: standardmethods.org [Accessed 1 10 2012]. Spieck, E. & Lipski, A., 2011. Cultivation, Growth Physioogy, and Chemotaxonomy of Nitrite-Oxidizing Bacteria. Methods in Enzymology, Volume 486, pp. 109-130. Stein, L. Y. & Arp, D. J., 1998. Loss of Ammonia Monooxygenase Activity in Nitrosomonas europaea upon Exposure to Nitrite. Applied and Environmental Microbiology, 64(10), pp. 4098-4102. Strous, M. et al., 1999. Missing Lithotroph Identified as a New Planctomycete. Nature, 400(6743), pp. 446-449. Strous, M., Gerven, E., Kuenen, J. G. & Jetten, M. S., 1997. Effects of Aerobic and Microaerobic Conditions on Anaerobic Ammonium-Oxidizing (Anammox) Sludge. Applied and Environmental Microbiology, 63(6), pp. 2446-2448. Strous, M., Heijnen, J. J., Kuenen, J. G. & Jetten, M. S., 1998. The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Applied Microbiology Biotechnology, Volume 50, pp. 589-596. Strous, M., Heijnen, J. J., Kuenen, J. G. & Jetten, M. S., 1998. The Sequencing Batch Reactor as a Powerful Tool for the Study of Slowly Growing Anaerobic Ammonium-Oxidizing Microorganisms. Applied Microbiology and Biotechnology, 50(5), pp. 589-596. Strous, M., Kuenen, J. G. & Jetten, M. S., 1999. Key Physiology of Anaerobic Ammonium Oxidation. Applied and Environmental Microbiology, 65(7), pp. 3248-3250. Strous, M. et al., 2006. Deciphering the Evolution and Metabolism of an Anammox Bacterium from a Community Genome. Nature, Volume 440, pp. 790-794. Suzuki, I., Dular, U. & Kwok, S., 1974. Ammonia or ammonium ion as substrate for oxidation by Nitrosomonas europaea cells and extracts. Journal of Bacteriology, Volume 120, pp. 556-558. Takai, T., Hirata, A., Yamauchi, K. & Inamori, Y., 1997. Effects of Temperature and Volatile Fatty Acids on Nitrification Denitrification Activity in Small Scale Anaerobic Aerobic Recirculation Biofilm Process. Water Science and Technology, 35(6), pp. 101-108.   94  Tang, C. J., Zheng, P., Wang, C. H. & Mahmood, Q., 2010. Suppression of Anaerobic Ammonium Oxidizers under High Organic Content in a High-Rate Anammox UASB Reactor. Bioresource Technology, Volume 101, pp. 1762-1768. Texier, A. C. & Gomez, J., 2007. Simultaneous Nitrification and P-cresol Oxidation in a Nitrifying Sequencing Batch Reactor. Water Research, 41(2), pp. 315-322. Thamdrup, B. & Dalsgaard, T., 2002. Production of N2 through Anaerobic Ammonium Oxidation Coupled to Nitrate Reduction in Marine Sediments. Applied and Environmental Microbiology, Volume 68, pp. 1312-1318. Third, K. A., Sliekers, A. O., Kuenen, J. G. & Jetten, M. S., 2001. The CANON System (Completely Autotrophic Nitrogen Removal Over Nitrite) Under Ammonium Limitation: Interaction and Competition between Three Groups of Bacteria. Systematic Applied Microbiology, Volume 24, pp. 588-596. Thornton, A., Pearce, P. & Parsons, S. A., 2007. Ammonium Removal from Digested Sludge Liquors using Ion Exchange. Water Research, 41(2), pp. 433-439. Toh, S. K. & Ashbolt, N. J., 2002. Adaptation of Anaerobic Ammonium-Oxidising Consortium to Synthetic Coke-Ovens Wastewater. Applied Microbiology and Biotechnology, 59(2-3), pp. 344-352. Toh, S. K., Webb, R. I. & Ashbolt, N. J., 2002. Enrichment of Autotrophic Anaerobic Ammonium-Oxidizing Consortia from Various Wastewaters. Microbial Ecology, Volume 43, pp. 154-167. Treusch, A. et al., 2005. Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling. Environmental Microbiology, Volume 7, pp. 1985-1995. Trigo, C., Campos, J. L., Garrido, J. M. & Mendez, R., 2006. Start-up of the Anammox Process in a Membrane Bioreactor. Journal of Biotechnology, 126(4), pp. 475-487. Tsushima, I. et al., 2007. Development of high-rate anaerobic ammonium-oxidizing (anammox) biofilm reactors. Water Research, April, 41(8), pp. 1623-1634. Tsushima, I. et al., 2007. Development of High-Rate Anaerobic Ammonium-Oxidizing (Anammox) Biofilm Reactors. Water Research, Volume 41, pp. 1623-1634. Turk, O. & Mavinic, D. S., 1989. Maintaining Nitrite Buildup in a System Acclimated to Free Ammonia. Water Research, Volume 23, pp. 1383-1388. Udert, K. M. et al., 2008. Effect of Heterotrophic Growth on Nitritation/Anammox in a Single Sequencing Batch Reactor. Water Science and Technology, 58(2), pp. 277-284. van de Graaf, A. A. et al., 1996. Autotrophic growth of anaerobic ammonium-oxidizing micro-organisms in a fluidized bed reactor. Microbiology, Volume 142, pp. 2187-2196. van de Graaf, A. A. et al., 1995. Anaerobic oxidation of ammonium is a biologically mediated process. Applied and Environmental Microbiology, 61(4), pp. 1246-1251. van de Graaf, A. et al., 1997. Metabolic Pathway of Anaerobic Ammonium Oxidation on the Basis of 15N Studies in a Fluidized Bed Reactor. Microbiology, Volume 143, pp. 2415-2421. van der Star, W. R. et al., 2010. An Intracellular pH Gradient in the Anammox Bacteria Kuenenia stuttgartiensis as evaluated by 31P NMR. Applied Microbiology and Biotechnology, Volume 86, pp. 311-317. van der Star, W. R. et al., 2008. The Membrane Bioreactor: A Novel Tool to Grow Anammox Bacteria as Free Cells. Biotechnology and Bioengineering, Volume 101, pp. 286-294. van Dongen, U., Jetten, M. S. & van Loosdrecht, M. C., 2001. The SHARON-Anammox Process for Treatment of Ammonium Rich Wastewater. Water Science and Technology, 44(1), pp. 153-160. van Hulle, S. W. et al., 2010. Engineering Aspects and Practical Application of Autotrophic Nitrogen Removal from Nitrogen Rich Streams. Chemical Engineering Journal, Volume 162, pp. 1-20. van Kempen, R., Mulder, J. W. & van Loosdrecht, M. C., 2001. Overview: Full Scale Experience of the SHARON Process for Treatment of Rejection Water of Digested Sludge Dewatering. Water Science & Technology, Volume 44, pp. 145-152. van Niftrik, L. A. et al., 2004. The Anammoxosome: an Intracytoplasmic Compartment in Anammox Bacteria. FEMS Microbiology Letters, Volume 233, pp. 7-13. van Niftrik, L. et al., 2008. Linking Ultrastructure and Function in Four Genera of Anaerobic Ammonium-Oxidizing Bacteria: Cell Plan, Glycogen Storage, and Localization of Cytochrome c Proteins. Bacteriology, Volume 190, pp. 708-717. van Niftrik, L. et al., 2010. Intracellular Localization of Membrane-Bound ATPases in the Compartmentalized Anammox Bacterium 'Candidatus Kuenenia stuttgartiensis'. Molecular Microbiology, 77(3), pp. 701-715.   95  van Rijn, J., Tal, Y. & Schreier, H. J., 2006. Denitrification in Recirculating Systems: Theory and Applications. Aquacultural Engineering, Volume 34, pp. 364-376. Vazquez-Padin, J. R. et al., 2009. Post-Treatment of Effluents from Anaerobic Digesters by the Anammox Process. Water Science & Technology, Volume 60, pp. 1135-1143. Vazquez-Padin, J. R. et al., 2009. Treatment of Anaerobic Sludge Digester Effluents by the CANON Process in an Air Pulsing SBR. Journal of Hazardous Materials, Volume 166, pp. 336-341. Veys, P. et al., 2010. Performance Analysis and Optimization of Autotrophic Nitrogen Removal in Different Reactor Configurations: A Modelling Study. Environmental Technology, 31(12), pp. 1311-1324. Wagner, M. et al., 1996. In Situ Analysis of Nitrifying Bacteria in Sewage Treatment Plants. Water Science and Technology, Volume 34, pp. 237-244. Ward, B., 2011. Measurement and Distribution of Nitrification Rates in the Oceans. Methods in Enzymology, Volume 486, pp. 307-323. Wett, B., 2007a. Development and Implementation of a Robust Deammonification Process. Water Science and Technology, 56(7), pp. 81-88. Wett, B. et al., 2007b. Key Parameters for Control of DEMON Deammonification Process. Baltimore, Nutrient Removal - Water Environment Federation. Wett, B. & Rauch, W., 2003. The Role of Inorganic Carbon Limitation in Biological Nitrogen. Water Research, 37(5), pp. 1100-1110. Winkler, M. K., Kleerebezem, R. & van Loosdrecht, M. C., 2012. Integration of Anammox into the Aerobic Granular Sludge Process for Main Stream Wastewater Treatment at Ambient Temperatures. Water Research, Volume 46, pp. 136-144. Woebken, D. et al., 2008. A Microdiversity Study of Anammox Bacteria Reveals a Novel Candidatus Scalindua Phylotype in Marine Oxygen Minimum Zones. Environmental Microbiology, 10(11), pp. 3106-3119. Wu, C., 2012. Effects of Varying Environmental Conditions on Performance of Completely Autotrophic Nitrogen Removal from Digested Sludge Liquors, Vancouver: University of British Columbia. Wyffels, S. et al., 2004. Nitrogen Removal from Sludge Reject Water by a Two-Stage Oxygen-Limited Autotrophic Nitrification Denitrification Process. Water Science & Technology, 49(5-6), pp. 57-64. Yoo, H. et al., 1999. Nitrogen Removal from Synthetic Wastewater by Simultaneous Nitrification and Denitrification (SND) via Nitrite in an Intermittently-Aerated Reactor. Water Research, 33(1), pp. 145-154. Zhang, T. C., Fu, Y. C. & Bishop, P. L., 1995. Competition for Substrate and Space in Biofilms. Water Environment Research, Volume 67, pp. 992-1003. Zumft, W. G., 1993. The Biological Role of Nitric Oxide in Bacteria. Archives of Microbiology, Volume 160, pp. 253-264. Zumft, W. G., 1997. Cell Biology and Molecular Basis of Denitrification. Microbiology and Molecular Biology Reviews, Volume 61, pp. 533-616.    96  Appendix Appendix A: Calculations used in the study Appendix B: Synthetic reject water feed measurements & trace element solution measurements Appendix C: SBR system parameters: influent, start of SBR cycle, effluent Appendix D: Volumetric fractions for AOB, NOB and Anammox bacteria Appendix E: Specific activity test results Appendix F: Mixotrophic test results    97  Appendix A: Calculations used in the study  Nitrogen removal efficiency:    -         -    -             -             -             -           Nitrogen loading rate:    -         -    -             -             -               Sludge wasting rate (Calculated on a weekly basis): If a 55 day SRT needs to be maintained,                                  Where V = Reactor volume (L) S = Reactor volume suspended solids (mg/L) (averaged over 7 days) Q = Average flow rate (L/d) Se = Effluent suspended solids (mg/L) (averaged over 7 days)   Observed yield calculation: The data obtained were from dates January 7th to April 9th:  Average effluent NH4+-N = 91.37 ± 45.02 mg/L  Average NH3-N removed from influent = 698 ± 45.02 mg/L  Average NH3-N removal rate by Anammox bacteria (based on 1:1.32 stoichiometry) =     -         -   -                  = 109.5 ± 7.06 mg/L/day   Total NH3-N removed by Anammox bateria per day = 1260 ± 81.1 mg/day  Total VSS removed / day (Based on effluent + wasting) = 353 ± 67 mg/day Anammox VSS removed / day (Based on average 33% vol. frac.) = 117 ± 22.2 mg/day  Observed yield coefficient =                                              = 0.0926 ± 0.0186 mg VSS/ mg N  98  Appendix B: Synthetic Feed Data Appendix B-1: Synthetic reject water feed composition and trace element solution weights (For 60L feed tank)  Date (NH4)2SO4 (g) NH4Cl (g) NaHCO3 (g) Na2CO3 (g) KH2PO4 (g) CaCl2 - 2H2O (g) MgSO4 - 7H2O (g) FeSO4 (g) EDTA (g) Trace  Solution (mL) Feed 1 Oct-22-2012 227.0000 - 300.0000 - 24.0000 108.0000 72.0000 2.2500 2.2500 120 Feed 2 Nov-04-2012 227.2119 - 201.4285 60.2217 24.0773 60.2196 50.0000 2.2679 2.3232 120 Feed 3 Nov-15-2012 227.5106 - 250.2728 40.0810 24.2956 40.0415 30.0470 2.5280 2.5596 200 Feed 4 Dec-01-2012 227.1691 - 250.2153 39.9412 24.0697 30.3042 20.3502 2.5293 2.5104 200 Feed 5 Dec-11-2012 - 184.3221 169.9618 79.9622 24.2620 15.4400 10.4697 2.2422 2.2558 200 Feed 6 Dec-23-2012 - 182.6618 249.0048 40.1168 30.3339 15.0769 10.0003 2.2422 2.5576 200 Feed 7 Jan-05-2013 - 184.2404 293.4019 21.3386 30.0726 15.0043 10.0241 2.5378 2.5367 200 Feed 8 Jan-20-2013 - 185.0599 250.1292 50.0027 30.0930 14.9852 10.0192 2.5220 2.5269 200 Feed 9 Feb-03-2013 - 185.3597 250.1410 50.0246 30.0880 15.0015 10.0610 1.3734 2.5243 200 Feed 10 Feb-15-2013 - 194.9317 250.0177 60.2023 29.9371 14.9789 10.6273 2.0676 2.4376 200 Feed 11 Mar-04-2013 - 190.0644 251.2267 55.8257 30.0538 15.0095 10.1689 1.1870 2.5196 120 Feed 12 Mar-17-2013 - 185.2582 260.2904 55.0550 30.0835 12.0492 8.8416 1.1577 2.1003 120 Feed 13 Apr-01-2013 - 184.5602 250.1666 55.1224 30.0077 12.0086 9.7134 1.9159 2.0901 120 Feed 14 Apr-15-2013 - 184.1687 246.8657 54.1712 30.1441 15.2299 10.0272 1.8681 2.4141 120 Feed 15 Apr-27-2013 - 178.0185 240.1033 52.1262 29.06 12.9071 9.4014 1.8761 2.337 120 Feed 16 May-10-2013 - 177.4818 242.3244 50.1131 30.1102 14.7134 10.2186 1.7552 2.3009 120 Feed 17 May-24-2013 - 180.1501 245.3115 53.0637 20.1118 14.0118 10.0158 1.8235 2.3132 120 Feed 18 Jun-04-2013 - 175.6203 260.2892 51.0134 28.037 14.0655 9.9876 1.902 2.3155 100 Feed 19 Jun-18-2013 - 180.1278 249.8801 49.9779 19.8922 14.9585 9.8932 1.9179 2.521 100 Feed 20 Jul-02-2013 - 175.024 227.4268 49.88234 19.9473 14.9029 10.2416 1.8705 2.3263 120 Feed 21 Jul-15-2013 - 175.225 230.8342 - 20.1361 15.0378 10.1385 1.8106 2.8249 120 Feed 22 Jul-26-2013 - 173.7532 219.8737 - 20.1049 15.0265 10.2711 1.8897 2.5195 100 Feed 23 Aug-22-2013 - 170.3591 213.6873 - 20.5244 14.9088 10.0334 1.7763 1.9918 100 Feed 24 Sep-03-2013 - 100.28 167.653 - 1.638 9.9469 18.1784 0.3039 0.3352 60 Appendix B-2: Trace element solution composition Trace Elements Solution Aug-16-2012 Sep-25- 012 Dec-11-2013 Dec-11-2013 Jun-14-2013 Jun-14-2013 EDTA (g) 15.0158 11.2913 15.011 15.0183 15.0211 15.0312 ZnSO4 - 7H2O (g) 0.4326 0.4346 0.4626 0.4618 0.4636 0.4589 CoCl2 - 7H2O (g) 0.2486 0.2496 - - - - MnCl2 - 4H2O (g) 1.0028 0.9916 1.0278 1.0361 1.0225 1.0332 CuSO4 - 5H2O (g) 0.2531 0.2524 0.2608 0.2551 0.2701 0.2541 NaMoO4 - 2H2O (g) 0.229 0.2259 0.2271 0.2153 0.2219 0.2113 NaSeO4 - 10H2O (g) SeO2: 0.03 SeO2: 0.0272 0.2019 0.2131 0.2119 0.2091 H3BO3 (g) 0.0143 0.0219 0.0208 0.0144 0.0211 0.0113 NaWO4 - 2H2O (g) 0.053 0.0536 0.0523 0.0485 0.0499 0.0477   99  Appendix C: SBR System Data Appendix C-1: Sequencing batch reactor system parameters  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alk. (mg/L) D.O. (mg/L) pH (start) pH (end) T (°C) TSS (mg/L) VSS (mg/L) Mixer RPM Air flow (mL/min) Air on/off (min) Mix/aerate time (hr) Fill/Decant vol. (L) HRT (d) 22/10/2012 358.33 1.81 119.19 - 0.15 7.4 - 32.8 - - 50 390 5|5 12 1.4 4.66 23/10/2012 356.47 1.63 109.24 - 0.20 7.3 7.1 33.2 - - 50 390 5|5 12 1.4 4.66 24/10/2012 - - - - 0.25 7.25 - 33.2 - - 50 390 5|5 12 1.4 4.66 25/10/2012 - - - - 0.50 6.77 5.9 33.2 - - 50 295 4|1 12 2.4 2.69 26/10/2012 281.67 1.39 102.61 - 0.20 6.897 5.71 33.4 - - 50 295|395 4|1 12 2.4 2.69 27/10/2012 287.33 1.61 122.39 - 0.33 6.959 - 33.6 - - 50 395 4|1 12 2.4 2.69 28/10/2012 - - - - - - - - - - 50 395 4|1 12 2.4 2.69 29/10/2012 294.67 2.00 153.00 - 0.30 7.15 5.32 33.3 2280 1775 50 395 4|1 12 2.4 2.69 30/10/2012 311.33 1.34 162.56 - 0.21 7.06 5.34 33.4 - - 50 395|275 4|1 12 2.4 2.69 31/10/2012 299.00 1.29 154.41 - 0.28 7.21 5.58 33.4 - - 50 275 4|1 12 2.4 2.69 01/11/2012 309.00 0.24 161.75 - 0.14 7.28 6.34 33.2 - - 50 275 4|1 12 2.4 2.69 02/11/2012 318.33 0.39 160.41 - 0.20 7.31 6.43 33.4 - - 50 275 4|1 12 2.4 2.69 03/11/2012 305.33 0.26 153.61 - 0.18 7.39 6.12 33.2 - - 50 295 4|1 12 2.4 2.69 04/11/2012 319.33 0.22 154.42 - 0.15 7.41 5.98 33.4 - - 50 295 4|1 12 2.4 2.69 05/11/2012 324.67 0.31 158.96 - 0.21 7.26 5.48 33.2 2220 1705 50 295 4|1 12 2.4 2.69 06/11/2012 290.00 1.98 165.80 - 0.18 7.38 7.38 33.4 - - 50 295|275 4|1 12 2.4 2.69 07/11/2012 - - - - 0.28 7.34 6.12 33.6 - - 50 275 4|1 12 2.4 2.69 08/11/2012 305.00 2.01 157.80 - 0.35 7.35 6.44 33.5 - - 50 275 4|1 12 2.4 2.69 09/11/2012 296.67 1.99 154.80 - 0.49 7.44 6.26 33.2 3520 2055 50 275 4|1 12 2.4 2.69 12/11/2012 317.33 2.04 179.40 - 0.14 7.84 6.46 33.4 2315 1755 50 275|305 4|1 12 2.3 2.80 13/11/2012 321.67 1.57 170.83 - 0.12 7.74 5.72 33.4 - - 50 305|255 4|1 12 2.3 2.80 14/11/2012 343.33 1.66 175.43 - 0.13 7.72 5.69 33.3 1990 1645 50 255|195 4|1 12 2.3 2.80 15/11/2012 346.00 1.42 204.79 - 0.11 7.78 6.895 33.3 - - 50 195 4|1 12 2.3 2.80 16/11/2012 376.33 1.33 188.02 - 0.14 7.36 6.407 33.3 2620 2010 50 195 4|1 12 2.3 2.80 17/11/2012 413.33 1.33 186.95 - 0.10 7.45 7.214 33.4 - - 50 195 4|1 12 2.3 2.80 19/11/2012 471.67 1.09 208.01 - 0.10 7.58 7.25 33.4 2605 1885 50 195 4|1 12 2.3 2.80 20/11/2012 456.33 0.52 201.09 - 0.13 7.56 7.42 33.4 - - 50 195|215 4|1 12 2.3 2.80 21/11/2012 413.00 0.55 219.72 - 0.14 7.55 7.25 33.4 3310 2090 50 215 4|1 12 2.3 2.80 26/11/2012 412.00 2.51 194.00 - 0.17 7.90 7.25 33.4 - - 50 215 4|1 12 2.3 2.80 27/11/2012 396.33 1.48 194.00 - 0.16 7.64 7.04 33.3 2090 1730 50 215 4|1 12 2.3 2.80 28/11/2012 363.33 1.55 195.00 - 0.24 7.50 6.81 33.4 2265 1820 50 215 4|1 12 2.3 2.80 29/11/2012 339.33 4.70 164.00 - 0.16 7.49 6.63 33.3 - - 50 215|265 4|1 12 3 2.15 02/12/2012 431.33 1.49 151.00 940 0.25 7.51 6.90 33.4 2010 1680 50 265 4|1 12 3 2.15 04/12/2012 486.33 1.50 137.84 1300 0.17 7.69 7.01 33.4 1995 1665 48 265|290 4|1 12 3 2.15 05/12/2012 448.67 1.57 163.00 1020 0.17 7.58 7.35 33.4 - - 48 290 4|1 12 2.3 2.75 07/12/2012 377.00 1.52 204.23 530 0.15 7.42 6.82 33.2 1960 1665 48 290|315 4|1 12 2.3 2.75 09/12/2012 371.67 1.64 223.70 620 0.14 7.51 5.30 33.2 - - 52 315|295 4|1 12 2.3 2.75   100  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alk. (mg/L) D.O. (mg/L) pH (start) pH (end) T (°C) TSS (mg/L) VSS (mg/L) Mixer RPM Air flow (mL/min) Air on/off (min) Mix/aerate time (hr) Fill/Decant vol. (L) HRT (d) 15/12/2012 369.33 2.14 203.21 570 0.14 7.45 6 33.30 2390 1790 52 295 4|1 12 2.3 2.75 20/12/2012 342.67 2.38 166.61 800 0.13 7.71 7.04 33.4 1920 1640 50 295 4|1 12 2.3 2.75 21/12/2012 332.33 2.04 140.62 800 0.13 7.72 7.03 33.4 - - 50 295 4|1 12 2.3 2.75 23/12/2012 346.67 2.19 137.56 740 0.24 7.52 7.02 33.4 1960 1665 50 295 4|1 12 2.3 2.75 27/12/2012 287.67 2.26 123.03 700 0.14 7.40 6.95 33.4 2025 1720 52 295 4|1 12 2.3 2.75 02/01/2013 282.00 2.32 108.43 600 0.11 7.32 6.40 33.3 2490 2125 50 295 4|1 12 2.3 2.75 03/01/2013 230.00 2.07 138.79 500 0.12 7.30 6.12 33.4 - - 50 295 4|1 12 2.3 2.75 04/01/2013 197.33 2.24 141.80 480 0.14 7.31 5.81 33.4 - - 50 295 4|1 12 2.3 2.75 07/01/2013 199.33 2.06 156.86 550 0.12 6.97 5.72 33.4 2000 1690 50 295 4|1 12 2.3 2.75 08/01/2013 233.67 2.08 142.94 660 0.12 7.13 6.35 33.4 - - 45 295 4|1 12 2.3 2.75 09/01/2013 267.00 2.16 127.97 800 0.12 7.35 7.00 33.4 2150 1730 45 285 4|1 12 2.3 2.75 11/01/2013 317.00 2.17 106.84 1040 0.17 7.45 7.34 33.5 2335 1830 45 295 4|1 12 2.3 2.75 14/01/2013 332.00 6.01 114.59 - 0.13 7.37 6.25 33.4 2080 1760 45 295 4|1 12 2.3 2.75 17/01/2013 233.80 2.60 120.14 660 0.13 7.43 6.47 33.3 2223 1830 45 295 4|1 12 2.3 2.75 18/01/2013 190.00 2.14 116.00 520 0.12 7.43 6.23 33.2 - - 45 295 4|1 12 2.3 2.75 20/01/2013 232.67 2.10 107.03 680 0.22 7.45 6.45 33.8 2270 2030 45 295 4|1 12 2.3 2.75 21/01/2013 257.00 2.09 105.43 800 0.19 7.34 6.75 33.4 2080 1685 45 295 4|1 12 2.3 2.75 22/01/2013 259.33 2.45 111.58 740 0.23 7.42 6.92 33.5 - - 45 295 4|1 12 2.3 2.75 23/01/2013 231.33 2.09 119.10 800 0.16 7.44 6.56 33.4 1790 1590 45 295 4|1 12 2.3 2.75 25/01/2013 256.33 1.84 104.42 780 0.15 7.38 6.75 33.2 1935 1565 45 311 4|1 12 2.3 2.75 28/01/2013 232.33 1.86 101.80 690 0.170 7.24 6.10 33.3 2090 1725 45 311 4|1 12 2.3 2.75 30/01/2013 188.00 2.11 105.27 440 0.18 7.05 5.80 33.4 2090 1725 45 311 4|1 12 2.3 2.75 31/01/2013 198.33 1.89 106.42 500 0.17 7.28 6.08 33.3 - - 45 311 4|1 12 2.3 2.75 04/02/2013 195.33 1.91 108.81 640 0.15 7.24 6.32 33 2120 1765 45 311 4|1 12 2.3 2.75 05/02/2013 225.33 0.54 109.68 600 0.13 7.17 6.41 33.1 - - 45 311 4|1 12 2.3 2.75 07/02/2013 224.33 0.80 99.67 600 0.14 7.27 6.50 33.3 2055 1735 45 311 4|1 12 2.3 2.75 08/02/2013 245.00 1.01 101.29 630 0.14 7.40 6.69 33.3 2170 1820 45 311 4|1 12 2.3 2.75 12/02/2013 259.00 0.57 89.89 760 0.13 7.45 6.80 33.2 2010 1730 45 311 4|1 12 2.3 2.75 14/02/2013 251.00 1.00 87.74 800 0.16 7.72 7.11 33.2 2030 1665 45 311 4|1 12 2.3 2.75 15/02/2013 239.67 0.88 89.22 980 0.20 7.83 7.31 33.2 1965 1635 45 311 4|1 12 2.3 2.75 18/02/2013 193.00 4.77 102.29 660 0.18 7.54 6.96 33.2 2150 1755 45 311 4|1 12 2.3 2.75 20/02/2013 233.67 1.46 92.64 710 0.15 7.49 6.93 33.3 2035 1705 45 311 4|1 12 2.3 2.75 21/02/2013 234.00 1.46 84.03 780 0.13 7.52 6.87 33.3 - - 45 311 4|1 12 2.3 2.75 25/02/2013 239.67 2.23 79.23 800 0.17 7.50 6.79 33.3 1635 1460 45 311 4|1 12 2.3 2.75 26/02/2013 260.67 1.55 69.86 840 0.2 7.71 6.75 33.2 2295 1765 45 311 4|1 12 3.3 1.92 27/02/2013 226.33 2.34 70.56 900 0.19 7.79 7.13 33.3 2240 1865 45 311 4|1 12 2.4 2.64 01/03/2013 195.33 1.58 80.21 860 0.09 7.78 7.00 33.3 2193 1770 45 311 4|1 12 2.4 2.64 04/03/2013 157.30 1.59 75.62 750 0.15 7.48 6.82 33.4 2120 1790 45 311 4|1 12 2.4 2.64 07/03/2013 238.00 1.47 70.43 840 0.13 7.52 7.03 33.2 2105 1740 45 332 4|1 12 2.4 2.64 08/03/2013 218.00 1.58 75.32 760 0.12 7.48 7.01 33.2 2040 1690 - 332 4|1 12 2.4 2.64 11/03/2013 232.00 2.84 72.56 800 0.19 7.53 6.86 33.2 2655 2020 45 332 4|1 12 2.4 2.64   101  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alk. (mg/L) D.O. (mg/L) pH (start) pH (end) T (°C) TSS (mg/L) VSS (mg/L) Mixer RPM Air flow (mL/min) Air on/off (min) Mix/aerate time (hr) Fill/Decant vol. (L) HRT (d) 13/03/2013 172.30 2.21 75.93 560 0.11 7.45 6.92 33.2 2500 1920 45 332 4|1 12 2.4 2.64 14/03/2013 221.00 3.27 71.81 700 0.12 7.47 6.68 33.2 - - 45 332 4|1 12 2.4 2.64 15/03/2013 211.70 2.07 72.40 640 0.21 7.33 6.33 33.2 - - 45 332 4|1 12 2.4 2.64 18/03/2013 208.70 1.54 75.63 740 0.12 7.29 6.37 33.2 2575 1805 45 332 4|1 12 2.4 2.64 22/03/2013 228.30 0.90 68.59 860 0.15 7.54 6.96 33.2 2290 1730 45 332 4|1 12 2.4 2.64 26/03/2013 194.00 1.21 69.34 780 0.17 7.41 6.42 33.3 2620 1845 45 332 4|1 12 2.4 2.64 27/03/2013 181.00 1.08 70.07 720 0.15 7.52 6.29 33.2 2645 1885 45 332 4|1 12 2.4 2.64 28/03/2013 185.30 2.37 68.99 780 0.13 7.48 6.49 33.3 - - 45 332 4|1 12 2.4 2.64 01/04/2013 138.30 6.91 65.10 860 0.16 7.70 7.12 33.4 2590 1830 45 332 4|1 12 2.4 2.64 02/04/2013 167.00 3.39 65.64 880 0.13 7.89 7.19 33.4 - - 45 332 4|1 12 2.4 2.64 03/04/2013 195.00 1.68 58.98 860 0.12 7.38 6.94 33.2 2380 1745 45 332 4|1 12 2.7 2.34 04/04/2013 215.30 1.89 55.21 920 0.13 7.40 6.95 33.4 - - 45 332 4|1 12 2.7 2.34 05/04/2013 240.30 4.48 63.90 940 0.14 7.60 7.07 33.4 2090 1590 45 332 4|1 12 2.7 2.34 08/04/2013 241.30 1.80 56.23 980 0.11 7.65 7.12 33.4 2020 1460 45 332 4|1 12 2.4 2.64 09/04/2013 235.30 2.18 58.85 1060 0.13 7.55 7.12 33.4 - - 45 332 4|1 12 2.4 2.64 10/04/2013 212.70 1.70 53.02 720 0.14 7.36 6.71 33.4 2205 1555 45 332 4|1 12 2.4 2.64 12/04/2013 181.00 2.42 57.24 680 0.13 7.47 6.91 33.4 2355 1585 45 332 4|1 12 2.4 2.64 15/04/2013 191.70 1.61 47.46 700 0.12 7.34 6.59 33.3 2855 1790 45 332 4|1 12 2.4 2.64 16/04/2013 212.70 2.17 47.36 800 0.16 7.40 6.95 33.4 - - 45 332 4|1 12 2.4 2.64 17/04/2013 280.00 2.03 50.17 1050 0.14 7.70 7.42 33.4 2225 1555 45 332 4|1 12 2.4 2.64 18/04/2013 197.33 2.06 52.65 880 0.23 7.60 7.35 33.4 - - 45 332 4|1 12 2.4 2.64 19/04/2013 242.00 2.12 53.65 850 0.21 7.58 7.17 33.4 2765 1665 45 332 4|1 12 2.4 2.64 22/04/2013 215.33 2.70 34.53 785 0.13 7.56 7.01 33.4 2400 1480 45 332 4|1 12 2.4 2.64 23/04/2013 204.00 2.36 55.94 720 0.15 7.53 6.91 33.2 - - 45 332 4|1 12 2.4 2.64 24/04/2013 97.40 2.15 42.54 480 0.13 7.41 6.79 33.1 2600 1550 45 332 4|1 12 2.4 2.64 25/04/2013 144.67 1.95 48.38 680 0.15 7.58 6.59 33.2 - - 45 332 4|1 12 2.4 2.64 26/04/2013 178.67 1.90 50.00 720 0.17 7.68 6.84 33.3 2460 1520 45 332 4|1 12 2.4 2.64 29/04/2013 149.30 10.07 56.81 630 0.17 7.19 5.96 33.3 2055 1315 45 332 4|1 12 2.4 2.64 30/04/2013 171.70 1.79 59.75 660 0.17 7.30 6.22 33.2 - - 45 332 4|1 12 2.4 2.64 01/05/2013 145.00 2.94 40.54 670 0.17 7.41 6.39 33.2 2940 1650 50 332 4|1 12 2.4 2.64 02/05/2013 196.67 1.73 55.60 720 0.14 7.43 6.61 33.2 - - 50 332 4|1 12 2.4 2.64 06/05/2013 193.67 2.31 56.71 650 0.17 7.50 6.84 33.2 2745 1540 60 332 4|1 12 2.4 2.64 07/05/2013 180.00 1.66 58.12 700 0.21 7.54 6.81 33.2 - - 60 332 4|1 12 2.4 2.64 08/05/2013 143.33 2.60 32.22 920 0.17 7.70 7.50 33.2 2515 1490 60 332 4|1 12 2.4 2.64 13/05/2013 186.67 1.80 63.45 670 0.17 7.18 6.23 33.2 2365 1440 60 332 4|1 12 2.4 2.64 14/05/2013 162.00 5.10 66.46 560 0.17 7.12 5.98 33.2 - - 63 332 4|1 12 2.4 2.64 17/05/2013 165.33 1.80 71.91 550 0.25 7.05 5.69 33.2 2435 1480 63 332 4|1 12 2.4 2.64 21/05/2013 152.67 2.00 80.65 430 0.30 7.15 5.71 33.2 2450 1485 63 295 4|1 12 2.4 2.64 22/05/2013 198.33 1.51 69.26 700 0.07 7.50 6.54 33.3 2510 1485 63 295 4|1 12 2.4 2.64 24/05/2013 158.00 4.26 70.24 700 0.08 7.70 6.91 33.3 2840 1630 63 295 4|1 12 2.4 2.64 27/05/2013 226.00 4.04 53.96 940 0.13 7.71 7.31 33.3 2455 1355 65 332 4|1 12 2.4 2.64   102  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alk. (mg/L) D.O. (mg/L) pH (start) pH (end) T (°C) TSS (mg/L) VSS (mg/L) Mixer RPM Air flow (mL/min) Air on/off (min) Mix/aerate time (hr) Fill/Decant vol. (L) HRT (d) 29/05/2013 225.00 2.14 37.38 960 0.07 7.91 7.68 33.3 2180 1250 65 332 4|1 12 2.4 2.64 31/05/2013 315.33 1.94 41.19 940 0.10 8.01 7.68 33.3 2370 1295 65 332 4|1 12 2.4 2.64 03/06/2013 234.33 1.24 45.24 870 0.10 7.89 7.23 33.3 2300 1302 65 332 4|1 12 2.4 2.64 05/06/2013 202.33 1.70 50.35 820 0.20 7.59 7.08 33.3 2635 1290 62 332 4|1 12 2.4 2.64 07/06/2013 245.50 10.85 36.41 970 0.24 7.67 7.30 33.3 2485 1260 62 332 4|1 12 2.4 2.64 10/06/2013 181.00 11.50 41.42 800 0.23 7.70 6.98 33.3 2400 1280 62 332 4|1 12 2.4 2.64 12/06/2013 140.50 20.10 48.04 620 0.33 7.51 6.90 33.3 2225 1130 62 332 4|1 12 2.4 2.64 14/06/2013 160.60 19.21 47.58 540 0.23 7.46 6.81 33.3 2605 1305 62 332 4|1 12 2.4 2.64 17/06/2013 98.95 58.25 39.24 300 0.18 7.11 6.51 33.3 2175 1175 62 195 1|4 12 2.4 2.64 19/06/2013 325.50 2.91 34.78 1300 0.18 8.11 7.90 33.3 2295 1190 62 195 3|3 12 2.4 2.64 21/06/2013 325.00 32.9 40.52 1200 0.20 7.82 7.39 33.3 2275 1185 62 195 3|3 12 2.4 2.64 24/06/2013 357.00 53.45 22.75 800 0.20 7.74 7.67 33.3 2120 1140 62 195 1|8 12 2.4 2.64 26/06/2013 423.00 7.40 21.23 1610 0.21 8.01 7.92 33.3 2855 1380 62 165 1.5|3 12 2.4 2.59 28/06/2013 529.50 28.90 23.82 1800 0.16 8.09 8.011 33.3 2330 1075 62 165 1|4 12 2.4 2.59 03/07/2013 238.50 13.10 9.68 860 0.11 8.03 8.176 33.3 1940 945 62 95 1|3.5 12 2.4 2.60 05/07/2013 441.00 2.69 11.80 1620 0.16 8.00 7.91 33.3 1810 910 62 175 1|3 12 2.4 2.60 08/07/2013 560.67 27.67 12.22 1790 0.14 8.01 7.56 33.3 1795 785 62 175 1|3 12 2.4 2.60 10/07/2013 529.36 1.88 13.22 1560 0.11 7.90 7.45 33.3 1710 795 62 175 1|3 12 2.4 2.60 11/07/2013 606.33 12.80 6.39 - - - - - - - - - - - - - 12/07/2013 347.33 4.01 8.52 1440 0.17 7.94 7.861 33.3 1580 765 62 175 1.5|2.5 12 2.4 2.60 15/07/2013 542.00 3.56 11.49 1600 0.18 7.71 7.97 33.3 1430 695 62 175 1.5|5 12 2.4 2.60 17/07/2013 585.50 6.24 10.91 1620 0.19 7.70 7.92 33.3 1520 715 62 95 1.5|3.5 12 2.4 2.60 19/07/2013 591.50 6.32 10.69 1580 0.18 7.91 7.99 33.3 1720 735 62 95 1.5|4.5 12 2.4 2.60 22/07/2013 620.00 18.25 9.20 1340 0.17 7.81 8.02 33.3 2045 840 62 95 1.5|5 12 2.4 2.60 24/07/2013 574.00 - 40.15 1460 0.17 7.82 7.99 33.3 1680 665 62 95 1.5|6 12 2.4 2.60 26/07/2013 443.00 - 12.35 1180 0.14 7.71 7.86 33.3 1570 685 70 95 1.5|6 12 2.4 2.60 01/08/2013 502.00 5.85 21.60 1120 0.11 7.75 7.76 33.3 1510 735 70 95 1.5|5 12 1.5 2.60 02/08/2013 - - - - - - - - - - - - - - - - 05/08/2013 519.00 26.95 31.85 1025 0.11 7.83 7.81 34.1 1220 630 70 95 1.5|5 12 1.5 2.60 06/08/2013 519.00 24.90 28.25 - - - - - - - - - - - - - 12/08/2013 401.33 7.82 20.73 425 0.11 7.36 7.34 34.4 1150 605 60 332 1.3|8 12 1 2.60 13/08/2013 397.00 7.51 23.53 350 0.11 7.30 7.21 34.4 - - 60 332 1.3|8 12 1 2.60 14/08/2013 389.30 7.07 24.52 350 0.18 7.23 7.12 34.4 1395 625 60 332 1.3|8 12 1 2.60 20/08/2013 268.00 31.85 20.29 225 0.11 6.84 6.41 34.2 1225 585 60 332 1.3|15 12 1 2.60 21/08/2013 301.30 18.30 19.30 205 0.13 6.85 6.90 34.3 - - 60 332 1.3|10 12 2.2 2.60 22/08/2013 345.50 8.98 22.60 - - 6.97 6.62 34.4 1305 655 - - - - 2.2 2.60 26/08/2013 329.00 7.38 35.50 375 0.09 6.80 6.91 34.4 910 545 60 332 1.5|9 12 1.6 2.60 27/08/2013 376.50 7.95 36.48 525 0.10 7.26 7.19 34.4 - - 60 332 1.3|7 12 1.6 2.60 28/08/2013 409.50 7.12 37.46 650 0.11 7.44 7.40 34.4 1070 520 60 332 1.3|7 12 1.6 2.60 29/08/2013 504.00 9.88 33.90 625 0.11 7.45 7.39 34.4 - - 60 332 1.3|7 12 1.6 2.60 30/08/2013 502.00 10.16 32.40 - 0.11 7.48 7.42 34.4 1485 610 60 332 1.3|7 12 1.6 2.60   103  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alk. (mg/L) D.O. (mg/L) pH (start) pH (end) T (°C) TSS (mg/L) VSS (mg/L) Mixer RPM Air flow (mL/min) Air on/off (min) Mix/aerate time (hr) Fill/Decant vol. (L) HRT (d) 03/09/2013 498.00 11.30 34.90 875 0.10 7.56 7.61 34.4 1400 625 60 332 1.3|7 12 1.8 2.60 04/09/2013 440.50 8.50 37.90 675 0.11 7.57 7.51 34.3 935 555 60 332 1.3|7 12 1.8 2.60 05/09/2013 412.00 6.81 34.16 - 0.11 7.58 7.50 34.3 - - 60 332 1.3|7 12 1.8 2.60 06/09/2013 323.00 13.65 30.85 725 0.09 7.62 7.53 34.2 1260 665 60 332 1.3|7 12 1.7 2.60 09/09/2013 298.00 14.30 30.00 675 0.09 7.72 7.72 34.2 990 535 60 332 1.3|6 12 1.7 2.60 10/09/2013 326.00 14.35 28.50 - 0.11 7.71 7.65 34.3 - - 60 332 1.3|6 12 1.7 2.60 11/09/2013 300.50 15.20 27.10 750 0.12 7.79 7.71 34.5 1375 695 60 332 1.3|6 12 1.7 2.60 12/09/2013 312.80 6.86 24.84 - - - - - - - - - - - - - 16/09/2013 272.20 6.90 23.60 775 0.11 7.87 7.72 34.2 1510 635 55 332 1.3|6 12 1.7 2.60 17/09/2013 240.00 8.68 24.62 - - - - - - - - - - - - - 18/09/2013 230.00 4.59 23.94 625 0.13 7.72 7.60 34.5 1430 640 55 332 1.3|6 12 1.7 2.60 23/09/2013 213.00 3.96 23.39 825 0.07 7.61 7.58 34.5 1460 660 55 332 1.3|5 12 1.7 2.60 24/09/2013 233.50 5.65 22.15 - - - - - - - - - - - - - 25/09/2013 245.50 7.50 19.05 - - - - - - - - - - - - - 27/09/2013 273.50 11.34 17.62 850 0.07 7.78 7.71 34.5 1370 675 55 332 1.3|5 12 1.7 2.60 29/09/2013 273.50 19.90 14.25 - - - - - - - - - - - - - 30/09/2013 265.50 24.55 12.95 975 0.08 7.89 7.78 35.2 1420 645 55 332 1.3|9 12 1.7 2.60  Appendix C-2: Feed and effluent parameters  Feed Effluent Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alkalinity (mg/L) pH NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) TSS (mg/L) VSS (mg/L) Alkalinity (mg/L) 22/10/2012 - - - 2850 7.3 - - - - - - 23/10/2012 824.67 0.97 0.00 - 7.3 - - - - - - 24/10/2012 - - - - 7.2 214.67 1.15 141.52 - - - 25/10/2012 - - - - - 185.33 1.75 121.58 - - - 26/10/2012 - - - 2650 - 189.33 3.55 128.11 - - - 27/10/2012 - - - - 7.62 - - - - - - 28/10/2012 - - - - - - - - - - - 29/10/2012 732.50 1.00 0.00 2920 7.71 203.33 2.08 187.59 - - - 30/10/2012 - - - - - 197.33 1.42 200.37 47 33.5 - 31/10/2012 - - - - - 201.00 1.32 194.62 - - - 01/11/2012 - - - - - 210.67 0.18 201.26 - - - 02/11/2012 - - - - - 210.33 0.20 196.60 - - - 03/11/2012 - - - - - 216.67 0.20 196.60 - - - 04/11/2012 - - - - - 202.00 0.49 196.65 - - - 05/11/2012 765.00 0.08 0.30 2810 8.03 209.00 0.09 197.11 - - - 06/11/2012 - - - - 7.98 177.33 1.93 206.44 - - - 07/11/2012 - - - - - - - - - - - 08/11/2012 - - - - - 180.33 1.93 198.90 - - -   104  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alkalinity (mg/L) pH NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) TSS (mg/L) VSS (mg/L) Alkalinity (mg/L) 09/11/2012 779.33 0.00 0.00 2900 8.16 170.33 1.96 193.60 46 37.5 - 12/11/2012 - - - - - 218.00 1.94 219.70 15.5 6.5 - 13/11/2012 - - - - - 220.67 1.81 217.83 - - - 14/11/2012 - - - - - 246.67 1.64 229.27 14 5 - 15/11/2012 - - - - - 262.67 1.31 257.29 - - - 16/11/2012 796.00 0.00 0.00 3080 8.014 287.00 1.31 227.15 17.5 10 - 17/11/2012 - - - - - 327.67 1.37 235.69 - - - 19/11/2012 796.67 0.00 0.00 2820 7.95 377.33 1.34 243.98 76 59 - 20/11/2012 - - - - - 374.00 1.59 257.35 - - - 21/11/2012 - - - - - 344.33 1.25 264.53 48 30 - 26/11/2012 735.83 0.00 0.00 2520 8.34 324.00 2.93 251.00 - - - 27/11/2012 - - - - - 320.67 1.47 244.00 27 20 - 28/11/2012 - - - - - 289.67 1.53 243.00 50.5 36.5 - 29/11/2012 - - - - - 236.67 1.44 219.00 - - - 02/12/2012 877.33 0.00 0.00 3140 8.035 269.67 1.46 200.00 12.6 7 220 04/12/2012 - - - - - 352.33 1.49 187.00 100.2 82.22 530 05/12/2012 - - - - - 346.67 1.42 205.91 - - 520 07/12/2012 808.67 0.00 0.00 2980 8.257 282.67 2.93 246.99 69.2 52.3 190 09/12/2012 - - - - - 258.67 1.39 281.71 - - 2 10/12/2012 - - - - - 244.67 1.43 267.14 15 10 10 13/12/2012 828.67 0.00 0.00 3020 8.31 240.67 2.87 244.52 24 18 40 15/12/2012 - - - - - 264.00 2.13 253.96 23.5 12.5 40 20/12/2012 811.33 0.00 0.00 3040 8.27 249.67 2.16 223.82 19.5 14 290 21/12/2012 - - - - - 222.33 2.06 177.31 - - 260 23/12/2012 825.33 0.00 0.00 3020 7.78 185.00 2.03 163.33 20 8.5 340 27/12/2012 - - - - - 197.33 2.08 145.52 25 17.5 60 02/01/2013 768.67 0.00 0.00 2800 8.23 159.67 2.10 141.79 20 14 100 03/01/2013 - - - - - 139.67 2.13 177.13 - - - 04/01/2013 - - - - - 92.40 2.07 179.53 - - - 07/01/2013 758.00 0.00 0.00 3020 7.82 95.83 1.96 198.20 35.5 23.5 10 08/01/2013 - - - - - 110.33 1.97 181.98 - - 50 09/01/2013 - - - - - 152.00 2.06 163.34 18 11 270 11/01/2013 741.33 0.00 0.00 2900 7.967 210.67 2.07 129.86 95 81 560 14/01/2013 715.33 0.00 0.00 2720 8.21 220.85 3.26 144.43 19 12 - 17/01/2013 752.67 0.00 0.00 3000 8.38 109.67 2.25 144.44 40.5 28 160 18/01/2013 - - - - - - - - - - - 20/01/2013 - - - - - 102.67 2.29 136.94 188.5 155 40 21/01/2013 800.67 0.00 0.00 3120 8.03 119.67 1.94 132.01 23.1 17.97 160 22/01/2013 - - - - - 141.67 2.46 142.24 - - 220 23/01/2013 - - - - - 156.00 2.65 138.85 38.5 29 300 25/01/2013 749.33 0.00 0.00 3000 8.14 122.67 1.95 137.10 67 51 170 28/01/2013 730.67 0.00 0.00 2920 8.12 95.60 1.88 134.51 40 29 80   105  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alkalinity (mg/L) pH NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) TSS (mg/L) VSS (mg/L) Alkalinity (mg/L) 30/01/2013 - - - - - 90.07 2.04 134.30 87 68 20 31/01/2013 - - - - - 77.30 1.88 128.11 - - 40 04/02/2013 748.00 0.00 0.00 2680 8.05 47.34 1.86 135.44 78 33 120 05/02/2013 - - - - - 72.05 0.21 141.67 - - 80 07/02/2013 - - - - - 89.63 0.32 129.38 67 37 80 08/02/2013 831.33 0.00 0.00 2800 8.2 104.33 1.38 124.45 49 39 120 12/02/2013 - - - - - 132.33 0.26 116.93 56 42 240 14/02/2013 777.33 0.00 0.00 2580 8.32 131.00 1.20 110.03 48 37 270 15/02/2013 - - - - - 120.67 0.55 109.32 28 19 430 18/02/2013 - - - - - 80.60 2.09 139.23 50 35 230 20/02/2013 779.33 0.00 0.00 2740 8.257 104.33 1.48 118.94 26 20 220 21/02/2013 - - - - - 105.33 1.37 113.26 - - 220 25/02/2013 - - - - - 96.07 1.13 100.12 26 20 240 26/02/2013 714.00 0.00 0.00 3120 8.52 99.23 1.48 97.77 34 24 170 27/02/2013 - - - - - 118.00 2.24 95.26 57 35 350 01/03/2013 - - - - - 77.37 1.97 97.50 60 40 240 04/03/2013 776.00 0.00 0.00 2950 8.15 31.07 1.76 97.80 41 31 200 07/03/2013 828.00 0.00 0.00 3180 8.12 94.50 1.33 91.19 55 22 100 08/03/2013 - - - - - 100.60 3.54 90.32 82 66 240 11/03/2013 815.30 0.00 0.00 3060 8.23 95.87 2.49 92.65 40 22 220 13/03/2013 - - - - - 76.60 3.13 90.64 57 35 160 14/03/2013 - - - - - 83.83 2.13 91.04 - - 140 15/03/2013 - - - - - 61.47 6.07 90.29 - - 80 18/03/2013 848.70 0.00 0.00 3260 8.16 60.10 0.73 95.86 42 24 80 22/03/2013 826.00 0.00 0.00 3140 8.19 60.10 0.74 86.15 32 24 80 26/03/2013 - - - - - 23.10 1.98 89.45 48 26 100 27/03/2013 830.00 0.00 0.00 2700 8.437 18.73 2.71 88.55 50 30 60 28/03/2013 - - - - - 9.60 5.15 90.86 - - 100 01/04/2013 665.30 0.00 0.00 2460 8.591 7.69 1.75 80.71 37 20 220 02/04/2013 812.70 0.00 0.00 3160 7.974 15.03 1.49 78.13 - - 180 03/04/2013 - - - - - 32.07 1.60 77.07 37 20 280 04/04/2013 - - - - - 62.07 5.66 72.65 - - 320 05/04/2013 - - - - - 88.40 2.21 65.42 55 23 360 08/04/2013 790.70 0.00 0.00 2880 8.31 105.00 2.11 74.22 35 19 380 09/04/2013 - - - - - 85.30 3.51 75.05 - - 280 10/04/2013 - - - - - 68.30 1.61 66.73 85 48 180 12/04/2013 - - - - - 50.40 1.34 71.31 45 28 170 15/04/2013 774.70 0.00 0.00 3120 8.244 31.87 1.58 59.76 68 44 110 16/04/2013 - - - - - 53.77 2.36 60.03 - - 160 17/04/2013 - - - - 8.158 134.70 1.67 57.14 35 14 370 18/04/2013 836.67 0.00 0.00 3000 8.15 104.33 3.19 54.56 - - 370 19/04/2013 - - - - - 95.87 3.01 68.60 47 27 330   106  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alkalinity (mg/L) pH NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) TSS (mg/L) VSS (mg/L) Alkalinity (mg/L) 22/04/2013 838.00 0.00 0.00 3060 8.21 91.30 2.29 68.16 44 22 265 23/04/2013 - - - - - 51.73 2.82 71.02 - - 130 24/04/2013 - - - - - 63.21 2.14 65.32 35 20 120 25/04/2013 - - - - - 6.07 4.08 58.82 - - 100 26/04/2013 - - - - - 41.43 1.60 62.53 29 23 130 29/04/2013 772.70 0.00 0.00 2960 8.147 22.00 8.44 75.96 36 26 50 30/04/2013 - - - - - 27.13 5.45 75.74 - - 50 01/05/2013 - - - - - 31.17 2.26 73.18 46 34 60 02/05/2013 1053.00 0.00 0.00 2840 8.31 47.60 2.09 73.85 - - 120 06/05/2013 714.67 0.00 0.00 2620 8.23 65.00 3.49 71.64 76 43 190 07/05/2013 - - - - - 56.00 2.59 74.18 - - 150 08/05/2013 - - - - - 48.00 4.50 57.79 53 37 530 13/05/2013 772.67 0.00 0.00 2800 7.98 35.07 3.80 80.19 67 41 60 14/05/2013 - - - - - 32.30 7.40 87.38 - - 20 17/05/2013 780.00 0.00 0.00 2520 8.10 33.00 8.90 87.98 49 36 20 21/05/2013 - - - - - 39.20 5.60 98.13 42 34 10 22/05/2013 735.33 0.00 0.00 2580 8.15 50.77 1.60 90.11 75 27 140 24/05/2013 908.67 0.00 0.00 3000 8.33 31.87 3.00 85.52 46 32 210 27/05/2013 - - - - - 74.87 4.61 68.57 59 42 430 29/05/2013 773.33 0.00 2.31 2680 8.41 142.67 3.75 56.60 54 37 520 31/05/2013 - - - - - 179.33 1.55 52.21 63 42 510 03/06/2013 - - - - - 78.41 2.14 58.14 70 48 210 05/06/2013 808.00 0.00 0.00 2700 8.13 68.27 2.62 62.17 76 52 270 07/06/2013 - - - - - 114.50 11.15 49.22 67 43 500 10/06/2013 768.00 0.00 0.00 2620 8.31 26.40 11.45 57.92 73 48 200 12/06/2013 - - - - - 1.73 23.20 63.17 67 37 120 14/06/2013 - - - - - 21.50 23.21 63.12 69 40 100 17/06/2013 - - - - - 36.60 86.35 71.54 61 33 80 19/06/2013 821.00 0.00 0.00 3000 8.20 197.50 3.02 46.10 64 41 830 21/06/2013 - - - - - 234.00 35.21 58.42 63 40 740 24/06/2013 805.00 0.00 0.00 2860 8.33 255.00 107.50 37.91 38 22 920 26/06/2013 - - - - - 379.00 11.50 31.32 45 34 1200 28/06/2013 - - - - - 510.50 33.85 28.44 37 20 1410 03/07/2013 766.00 0.00 0.00 2720 8.18 198.00 19.05 12.89 30 27 700 05/07/2013 781.00 0.00 0.00 2680 8.20 365.00 2.85 14.74 31 16 1310 08/07/2013 - - - - - 542.67 27.47 15.04 34 17 1700 10/07/2013 - - - - - 430.33 2.95 5.09 31 18 1530 11/07/2013 - - - - - 572.00 7.49 16.60 - - - 12/07/2013 764.00 0.00 0.00 2360 8.20 383.33 2.82 11.60 24 13 1160 15/07/2013 814.00 0.00 0.00 2240 7.91 477.50 3.00 14.56 22 15 1300 17/07/2013 803.00 0.00 0.00 2210 7.34 522.50 6.68 14.03 23 13 1340 19/07/2013 783.00 0.00 0.00 2240 7.43 547.00 6.21 14.54 24 18 1250   107  Date NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) Alkalinity (mg/L) pH NH4-N (mg/L) NO2-N (mg/L) NO3-N (mg/L) TSS (mg/L) VSS (mg/L) Alkalinity (mg/L) 22/07/2013 773.00 0.00 0.00 1600 Q 598.00 22.50 11.95 28 13 1160 24/07/2013 - - - - - 514.00 - 51.70 44 12 1210 26/07/2013 770.00 0.00 0.00 2040 7.34 409.00 - 14.10 21 11 960 01/08/2013 797.00 0.00 0.00 2000 7.43 485.50 6.36 25.19 29 21 960 02/08/2013 - - - - - 477.50 11.90 28.60 - - 925 05/08/2013 804.00 0.00 0.00 1875 7.85 503.00 28.25 33.65 32 23 1025 06/08/2013 - - - - - 505.50 28.15 32.70 - - - 12/08/2013 702.00 0.00 0.00 1275 7.527 379.33 8.84 23.26 24 15 275 13/08/2013 - - - - - 371.30 8.70 25.50 - - 275 14/08/2013 - - - - - 361.00 7.00 27.10 28 22 225 20/08/2013 690.00 0.00 0.00 725 7.49 215.00 23.65 24.10 22 11 75 21/08/2013 - - - - - 250.70 3.60 24.13 - - 45 22/08/2013 700.00 0.00 0.00 625 7.47 273.50 6.84 27.10 27 16 - 26/08/2013 - - - - - 291.00 6.06 34.09 24 12 155 27/08/2013 - - - - - 322.00 7.88 35.64 - - 325 28/08/2013 698.00 0.00 0.00 1850 7.75 364.00 7.61 37.13 26 7 425 29/08/2013 - - - - - 464.50 10.50 38.48 - - 400 30/08/2013 812.00 0.00 0.00 1825 7.73 464.00 11.80 38.14 27 13 500 03/09/2013 790.00 0.00 0.00 1675 7.74 490.50 13.55 38.92 41 25 600 04/09/2013 795.00 0.00 0.00 1625 7.70 416.00 9.56 42.78 34 18 475 05/09/2013 - - - - - 392.50 7.89 39.18 - - - 06/09/2013 780.00 0.00 0.00 1650 7.71 300.50 15.35 35.75 29 22 550 09/09/2013 777.00 0.00 0.00 1650 7.71 269.00 14.90 35.90 36 25 500 10/09/2013 - - - - - 277.00 15.75 34.15 - - - 11/09/2013 810.00 0.00 0.00 1375 7.78 267.50 16.20 32.20 37 22 600 12/09/2013 - - - - - 272.90 7.03 28.38 - - - 16/09/2013 807.00 0.00 0.00 1375 8.00 220.00 6.76 27.84 20 11 625 17/09/2013 - - - - - 187.00 8.75 28.40 - - - 18/09/2013 - - - - - 182.00 5.24 27.45 30 14 625 23/09/2013 799.00 0.00 0.00 1700 7.81 167.00 4.49 28.91 20 11 625 24/09/2013 - - - - - 191.00 6.32 26.73 - - - 25/09/2013 - - - - - 207.00 8.49 22.72 - - - 27/09/2013 797.00 0.00 0.00 1502 7.92 235.00 14.25 20.14 18 9 600 29/09/2013 - - - - - 252.50 23.55 17.45 - - - 30/09/2013 789.00 0.00 0.00 1100 8.01 180.20 28.80 16.85 24 15 800      108  Appendix D: Volumetric Fraction Analysis Data Appendix D-1: SBR sludge homogenous volumetric fraction - 55 day SRT Anammox bacteria  (AMX368, AMX820) Ammonia-oxidizing bacteria  (NSO190, NSO1225) Nitrobacter  (NIT3) Nitrospira  (Ntspa662) Mean Stdev  Mean Stdev  Mean Stdev Mean Stdev Total Unaccounted for 33.2168675 12.3248492  36.3329787 9.414623586  2.2375 1.388191 3.88 1.996272388 75.66735 24.33265  19/04/2013  28/04/2013  01/05/2013  19/04/2013  28/04/2013  01/05/2013  19/04/2013    19/04/2013  01/05/2013 19.8 53.1 48.7 48 36.9 30 6  0.9 3.9 21.2 56.5 63.5 39.7 51.2 33.8 1.2  5.5 3 22 60.2 50.1 41.6 37.6 40.3 2.7  2.4 4.4 20.9 65.3 49.4 44.6 32.1 37.8 2.5  3.5 5.6 20.7 47.6 35.1 32.4 30.2 42.1 2.4  1.5 0.9 26.5 14.9 27.3 60.6 40 26.2 3.7  0.9 2.2 28.4 34.9 35.3 33.3 35.1 41.9 4.8  3.2 2.8 25.8 20.1 38.5 62.7 36.8 39.1 1.7  1.4 1.8 37.1 38.1 35.6 51.7 27.7 48.9 2.8  1.5 1.3 31.7 38.9 37.3 43.8 34.8 34.5 1.7  2.8 2.6 25.1 39.2 32.8 26.6 34.7 43.8 4.2  4.6 1.3 22.8 33.3 38.9 36.7 46.7 38.2 1.7  1.7 1.3 28 45.7 57.3 36.3 42.2 26.9 2.9  0.4 2.6 22.7 20.7 37.5 59.6 29.5 38.5 1.2  1.7 3.1 32.1 35.8 43.3 62.9 36.2 36.1 3.8  4.9 2.3 26.7 31 30.4 46.1 40.8 29.5 2.8  2.2 3.8 35.4 37.5 41.1 33.6 37.5 28.5 8.3  2.1 1.9 19.1 34.9 34.4 33.6 29.8 23.6 2  2.1  23.4 34.7 49.1 40.5 36 29.9 4.5  1  18 34.7 51.9 45.9 30 38.2 6  2.8  9.5 23.9 49.9 37.4 39.9 40.7 6.3  1.5  27.1 17.6 34.9 31.3 24.9 37.7 2.8  0.8  33.4 41.6 34.2 35.3 14.4 32.4 6.4  2.6  39.8 30.2 36 39.2 25.5 30.8 2.8  1.3  9.6 14.8 37.6 46.2 20 33.4 4.6  1  4.2 27  38.7 13.9 46.2 4.3  0  23.8 27  34.6 26.5 30.4 8.2  0.6  24.6   48.4 26.5 37.8 4.7  4.7  32   43.5 17.6  2.6  0.3  17.7   43.3 22  6.8  0.6  38.6   29.9 23.6    2.1     29.8 23         40.8          35.9         109  Appendix D-2: SBR sludge homogenous volumetric fraction - 30 day SRT Anammox bacteria (AMX820) Ammonia-oxidizing bacteria (NSO190) Nitrobacter (NIT3) Nitrospira (Ntspa662) Mean Stdev Mean Stdev Mean Stdev Mean Stdev Total Unaccounted for 31.28 10.74385539 25.6253521 7.03557731 1.435294118 1.276685737 2.658823529 1.782224 60.99947 39.00053024  04/07/2013  22/07/2013  04/07/2013  22/07/2013  04/07/2013   04/07/2013  62.9 33.5 36.5 28.4 4.3  3.1  44.6 26.2 29.3 22.7 5.6  4  45.3 76.8 24.3 29.8 1.2  3.8  46.1 26.9 22.5 28.5 3  0.8  57.9 29.2 17.1 22.9 3.2  1.8  12.6 25.5 11.5 26.9 3.7  0.4  32.2 35.7 19.8 26.2 1.6  1.1  44.5 25.6 22.2 23.2 4.5  1  25.8 41.4 28.4 29.1 0.4  0.7  36.8 20.1 12.8 21.6 5.9  1.5  25.4 27.3 34.2 24.5 0.8  0.6  33.3 25 17.8 23.6 1.5  1.5  47.3 34.6 16.9 26.2 0.7  0.5  24.3 26 17.6 23.5 3.6  3  39.3 38.2 25.9 32.1 1.7  0.2  24.2 45 26.1 21.5 0.4  0.4  29.9 29 31 14.8 3.1  0  18.6 45.5 31.1 16.1     21.7 28.5 21.3 30     25.8 45.2  21.6     26.8 21.9  36.4     33.8 23.8  23.9     26.2 28.5  30.3     19 25.9  16     26.1 25.9  27.7     21.5 45.8  20.8     23.8 28.3  16.2     24.6 13.9  29     33.4 27.1  22     31.8 31.5  18.3     48 26.3  22.8     26.9 34.2  21.6     22.4 30.2  25.3     22.1 24.2  16.6       110  Anammox bacteria (AMX820) Ammonia-oxidizing bacteria (NSO190) Nitrobacter (NIT3)  Nitrospira (Ntspa662) 26.3 22.1  48.5     39.7 20.9  25     44.8 30.1  35.6     35.9 18.6  24.2     28.5 15  40      30.9  30.1      27.9  17.5      36  29.3      21  28.1      40.8  31.2      29.8  32.3      32.9  24.4        23        37.5        43.7        24.8        24.7        33.1          111  Appendix D-3: Annacis sludge effluent volumetric fraction Anammox bacteria (AMX820) Ammonia-oxidizing bacteria (NSO190) Nitrobacter (NIT3) Nitrospira (Ntspa662) Mean Stdev Mean Stdev Mean Stdev Mean Stdev Total Unaccounted for 2.886667 1.882197 11.59375 4.204516 0.775 0.812323 3.555 2.883615 18.81042 81.18958 03/09/2013  03/09/2013  03/09/2013  03/09/2013  1.7  11.2  1.1  0.6  3.2  11.5  5.7  0.6  1.6  8.7  2.3  0.5  2.9  19  4.3  0.9  1.6  5.9  0.2  3.4  5.8  12.1  0.6  0.4  3.5  11.4  0.6  0.3  1.9  12.7  1.2  0.3  6.8  16.1  3.8  1.1  2.7  8.1  1.6  1  1.2  10.2  0.6  0.2  2.1  6.1  4.1  0.5  1.6  6.8  2.7  0.5  0.7  19.3  1.1  2.4  6  10.4  3.6  0.1    16  6.5  0.3      7  1      8.1  0.1      10.3  1.1      5.7  0.2       112  Appendix D-4: Annacis sludge granule volumetric fraction Anammox bacteria (AMX820) Ammonia-oxidizing bacteria (NSO190) Nitrobacter (NIT3) Nitrospira (Ntspa662) Mean Stdev Mean Stdev Mean Stdev Mean Stdev Total Unaccounted for 38.505 5.744973 8.795 1.780738 0.966666667 0.443095 0.826315789 0.618099 49.09298 50.90702  05/09/2013   05/09/2013   05/09/2013   05/09/2013  1.7  11.2  0.6  1.1  3.2  11.5  0.6  5.7  1.6  8.7  0.5  2.3  2.9  19  0.9  4.3  1.6  5.9  3.4  0.2  5.8  12.1  0.4  0.6  3.5  11.4  0.3  0.6  1.9  12.7  0.3  1.2  6.8  16.1  1.1  3.8  2.7  8.1  1  1.6  1.2  10.2  0.2  0.6  2.1  6.1  0.5  4.1  1.6  6.8  0.5  2.7  0.7  19.3  2.4  1.1  6  10.4  0.1  3.6    16  0.3  6.5      1  7      0.1  8.1      1.1  10.3      0.2  5.7       113  Appendix D-4: Annacis sludge homogeneous volumetric fraction Anammox bacteria (AMX820) Ammonia-oxidizing bacteria (NSO190) Nitrobacter (NIT3) Nitrospira (Ntspa662) Mean Stdev Mean Stdev Mean Stdev Mean Stdev Total Unaccounted for 26.8935484 8.270104 11.19677419 3.74544 5.15 2.160133 1.833333333 2.487234 45.07366 54.92634  22/07/2013   22/07/2013   22/07/2013   22/07/2013  28.1  9.6  1.6  3.6  25.1  9.1  1.5  6.1  44.3  14.5  0.9  6  23.4  14.2  1.4  4.6  21.4  12.9  0.2  3.2  27.6  8.1  0.5  3  13.8  14.9  7.8  8.3  26.1  12.8  0  3  20.5  8  1.2  3.4  41.6  8.3  0  5.4  24.8  10.2  0.3  3.1  36.4  9  3.1  7.7  36.4  11.9  6.6  9  26.2  9.1  0.7  7.8  41.1  19.7  0.3  2.8  30.2  18.1  1.5  7  36.8  9.8  8  6.1  20.5  8.8  0.1  2.6  23  9.5  1.8    19.3  7.3  0.1    22.9  10.8  0.9    42  7.6      31.8  13.1      24.4  17.9      17.6  10.9      19.8  5.6      24.1  8.9      25.8  7.6      20.5  18.4      25.4  13.8      12.8  6.7         114  Appendix E: Kinetics Analysis Data Appendix E-1: AOB activity batch test results - May 31st, 2013 Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) D.O. (mg/L) 0 3 samples 4.87 0.16 0.53 7.53 1325 470 > 5.0 20 3 samples 3.92 0.25 1.31 7.50    40 3 samples 3.10 0.31 2.15 7.48    60 3 samples 2.31 0.36 2.90 7.44    80 3 samples 1.53 0.35 3.66 7.45    Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) D.O. (mg/L) 0 3 samples 4.94 0.11 0.50 7.61 1730 595 > 5.0 20 3 samples 4.07 0.19 1.30 7.58    40 3 samples 3.25 0.23 2.12 7.51    60 3 samples 2.43 0.31 2.85 7.46    80 3 samples 1.65 0.36 3.58 7.49    Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) D.O. (mg/L) 0 3 samples 5.06 0.13 0.48 7.62 1375 500 > 5.0 20 3 samples 4.07 0.26 1.36 7.60    40 3 samples 3.25 0.28 2.09 7.54    60 3 samples 2.43 0.33 2.85 7.49    80 3 samples 1.64 0.37 3.59 7.51        115  Appendix E-2: NOB activity batch test results - April 24th, 2013 Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 0.15 0.16 10.20 7.67 1665 980 20 3 samples 0.12 0.16 10.15 7.68   40 3 samples 0.07 0.23 10.20 7.77   60 3 samples 0.09 0.31 10.15 7.78   125 3 samples 0.11 0.55 10.10 7.90   185 3 samples 0.35 0.81 9.78 7.94   Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 0.12 0.00 10.90 7.64 1665 980 20 3 samples 0.08 0.00 10.80 7.67   40 3 samples 0.08 0.00 10.80 7.72   60 3 samples 0.08 0.00 10.75 7.75   125 3 samples 0.08 0.23 10.65 7.77   185 3 samples 0.18 0.63 10.40 7.82   Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 0.13 0.00 10.90 7.73 1665 980 20 3 samples 0.14 0.00 10.95 7.77   40 3 samples 0.06 0.00 10.85 7.77   60 3 samples 0.05 0.00 10.80 7.81   125 3 samples 0.14 0.23 10.70 7.94.   185 3 samples 0.08 0.47 10.50 7.98        116  Appendix E-3: Anammox specific activity results - May 02 2013 - high ammonium >200 mg/L, low nitrite 10,20,30 mg/L Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples - 0.16 10.33 7.60 765.00 450.00 30 3 samples - 0.82 7.53 7.86   60 3 samples - 1.45 4.79 7.90   90 3 samples - 1.78 2.35 8.05   120 3 samples - 1.83 0.61 8.12   180 3 samples - 1.58 0.50 8.23   Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples - 0.90 22.80 7.58 755.00 435.00 30 3 samples - 0.86 21.17 7.85   60 3 samples - 0.90 18.87 7.87   90 3 samples - 1.03 16.97 8.04   120 3 samples - 1.40 14.70 8.14   180 3 samples - 2.18 10.57 8.26   Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples - 7.27 32.33 7.77 745.00 430.00 30 3 samples - 6.86 31.67 7.89   60 3 samples - 6.04 31.17 7.97   90 3 samples - 5.71 29.70 8.08   120 3 samples - 5.07 29.05 8.15   180 3 samples - 4.52 27.17 8.23        117  Appendix E-4: Anammox specific activity results - May 05 2013 - low ammonium < 20 mg/L, 12 - 14 mg/L nitrite Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 10.97 0.00 12.23 7.60 630 405 30 3 samples 9.50 0.00 12.43 7.86   60 3 samples 7.91 0.57 11.00 7.90   90 3 samples 6.50 0.92 9.35 8.05   120 3 samples 4.90 1.13 8.90 8.04   Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 6.26 0.90 13.40 7.58 640 395 30 3 samples 4.84 0.86 12.40 7.85   60 3 samples 3.48 0.90 10.70 7.87   90 3 samples 2.47 1.03 8.89 8.04   120 3 samples 1.67 1.18 6.79 7.90   Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 18.70 7.27 14.57 7.77 720 430 30 3 samples 17.09 6.86 14.13 7.89   60 3 samples 15.52 6.04 12.90 7.97   90 3 samples 14.02 5.71 11.07 8.08   120 3 samples 12.62 6.30 9.35 8.09        118  Appendix E-5: Anammox specific activity results - May 12 2013 - low ammonium < 20 mg/L, 11 mg/L nitrite Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 9.02 0.00 11.63 7.94 745 410 30 3 samples 7.40 0.56 9.68 7.95   60 3 samples 5.89 1.14 7.76 8.05   90 3 samples 4.21 1.63 5.83 8.06   120 3 samples 3.45 1.19 4.34 8.14   Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 4.40 0.00 11.15 7.95 745 405 30 3 samples 2.89 0.92 9.78 8.01   60 3 samples 1.67 1.37 7.84 8.14   90 3 samples 1.10 1.78 6.06 8.28   120 3 samples 0.78 1.91 5.09 8.38   Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 13.17 0.45 11.33 7.87 800 435 30 3 samples 11.40 0.96 9.16 7.96   60 3 samples 10.02 1.51 6.94 8.13   90 3 samples 8.20 1.32 4.93 8.08   120 3 samples 6.80 1.99 3.06 8.19       119  Appendix E-6: Anammox specific activity results - May 14 2013 - high ammonium ~200  mg/L, 12, 20, 33 mg/L nitrite Time (min) Test 1 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 191.40 0.65 12.47 7.64 760 420 30 3 samples 200.60 1.15 9.57 7.83   60 3 samples 199.00 1.91 6.80 7.92   90 3 samples 191.40 2.02 4.23 7.99   120 3 samples 186.40 2.15 2.18 8.10   Time (min) Test 2 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 194.20 0.08 20.55 7.69 770 425 30 3 samples 192.00 0.55 18.69 7.74   60 3 samples 188.80 1.05 15.50 7.88   90 3 samples 183.80 1.65 12.43 7.94   120 3 samples 182.20 2.11 9.00 8.00   Time (min) Test 3 NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) pH TSS (mg/L) VSS (mg/L) 0 3 samples 210.00 4.31 32.97 7.69 890 480 30 3 samples 207.40 3.81 31.90 7.79   60 3 samples 204.60 3.16 30.60 7.87   90 3 samples 197.60 2.86 29.17 7.97   120 3 samples 192.00 2.63 27.70 8.05        120  Appendix F: Mixotrophic Test Data Appendix F-1: Control test results (2 separate tests combined) with nitrite, ammonium and nitrate in the absence of electron donors Control: VSS, NO2-N, No E Donor Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 0.441484 0.1 11.8 - 845 275 2 0.559165 0.15 11.83335 -   4 0.5565 0.15 11.7715 -   16 0.24133 1.49665 10.48665 -   Standard deviation  0.065313 0.141421 2.262742     0.396213 0.212132 2.215578     0.403758 0.212132 2.161625     0.03677 0.419526 2.328715    Control: VSS, NH4-N + NO3-N, No E Donor Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 45.3833 24.64784 0.293167 - 432.5 227.5 1 43.20171 24.5495 0.2005 -   2 43.957225 24.75167 0.765 -   4.333333 44.030355 24.72599 1.790665 -   5 44.14116 24.498 2.285335 -   17 36.351325 23.53167 4.338 -   Standard deviation  7.848885271 0.045488 0.034648     2.265160005 0.177017 0.012021     3.89930499 0.054214 0.502046     5.464075728 0.116934 2.261801     6.375501013 0.171587 2.92931     5.877931185 1.586274 0.082024         121  Appendix F-2: Control test results (2 separate tests combined) with electron donors in the absence of fixed nitrogen species Control: VSS, No N, Acetic Acid Control: VSS, No N, Propionic Acid Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 0.510665 0 0.190665 82.5 510 262.5 0 12.35 0.83833 2.925 363.75 367.5 185 2 0.493 0 0.185 84.5   2 12.27 0.8645 2.8995 366   4 0.4845 0 0.182 80   4 12.175 0.835 2.86 363.5   16 0 0 0.139998 67.5   20 12.55015 1.781665 1.735 383.75   Standard deviation Standard deviation  0.014379 0 0.000474 3.535534    0.023617 0.007071 0.007071 8.838835    0.004243 0 0.007071 3.535534    0.46669 0.020506 0.000707 8.485281    0.003182 0 0.007071 2.828427    0.035355 0.035355 0.042426 7.071068    0 0 0.000945 17.67767    0.023829 0.308772 0.384199 8.838835    Control: VSS, No N, Primary Effluent Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 29.2 0 0.1195 55 100 60 1 28.55 0 0.1165 55   2 27.65 0 0.1165 60   3 27.4 0 0.118 55   20 27.2 0 0.1525 30   Standard deviation     1.51231       2.41521       3.25234       2.56232       3.67389       122  Appendix F-3: Mixotrophic test results (3 separate tests combined) with electron donors and nitrate (Lab sludge) VSS, NO3-N, Acetic Acid, Short test - Aug 12 VSS, NO3-N, Acetic Acid, Long test - Aug 20 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 0.44 20.96 0.18 416.67 675.00 275.00 0 0.246111 22.81064 0 365.8333 586.6667 240 0.5 0.45 20.92 0.19 427.50   1 0.224778 22.90426 0 370   1 0.35 20.76 0.21 427.50   2 0.174556 22.79449 0 365.8333   1.5 0.36 20.93 0.24 430.00   3 0.140667 22.7648 0 360   2 0.30 20.89 0.26 420.83   4 0.120089 22.54902 0 360.8333          14 0 10.24153 0 91.66667   Standard deviation Standard deviation  0.052113 0.195334 0.00348 10.10363    0.010421 0.48868 0 16.64582    0.094406 0.277542 0.014992 12.5    0.009714 0.257434 0 10.89725    0.022347 0.316831 0.013548 13.22876    0.0098 0.370599 0 2.886751    0.038351 0.266665 0.029687 10.89725    0.009939 0.169804 0 11.45644    0.040695 0.38919 0.04467 9.464847    0.003741 0.329204 0 9.464847           0 0.234594 0 3.818813    VSS, NO3-N, Propionic Acid, Long test - Aug 8 VSS, NO3-N, Primary Effluent, Long test - Aug 14 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 3.165555 19.95556 0.237778 399.1667 371.6667 181.6667 0 22.2 25.15044 0.471778 94.16667 621.6667 271.6667 0.5 3.226667 20.03333 0.244555 415   1 21.94445 24.72467 0.542 85.66667   1 3.162222 20.06667 0.246333 415   9 19.65556 17.18222 1.551111 72.33333   1.5 3.177778 20.05556 0.241333 430   10 18.16667 15.72333 1.721 72.5   2 3.200001 19.97778 0.235667 420   11 18.18332 15.57556 2.257778 61.66667   2.5 3.096667 20.02222 0.231555 421.6667   18 0.261833 8.793444 0.149778 22.66667   15 0 17.11111 0.574442 253.3333          Standard deviation Standard deviation  0.073511 0.309719 0.006301 7.216878    0.23094 0.362218 0.042171 12.58306    0.175341 0.328293 0.004599 0    0.157527 0.267831 0.01601 7.505553    0.030972 0.43589 0.015588 5    0.784811 0.444838 0.193487 8.736895    0.096973 0.403229 0.036387 21.65064    0.120184 1.561691 0.153593 4.330127    0.205507 0.39768 0.066697 4.330127    0.432386 1.615776 0.699495 2.886751    0.124231 0.401848 0.095513 6.291529    0.238139 0.610718 0.259423 2.020726    0 1.776803 0.21481 66.58328               123  Appendix F-4: Mixotrophic test results (3 separate tests combined) with electron donors and nitrite (Lab sludge) VSS, NO2-N, Acetic Acid, Long test - Sep 05 VSS, NO2-N, Propionic Acid, Long test - Sep 10 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 0.27 0.00 18.90 334.17 628.33 340.00 0 0.093787 0 15.05557 220.8333 401.6667 203.3333 1 0.24 0.00 18.51 334.17   2 0.044567 0 14.9001 222.5   2 0.21 0.00 18.63 330.00   3.5 0.0308 0.48111 12.98443 219.1667   4 0.22 0.00 18.40 324.17   8 0.049767 0.722233 13.9 218.3333   5 0.25 0.00 17.97 318.33   17 0.0749 0.5889 13.88888 197.5   15 0.00 0.16 15.81 162.50          Standard deviation Standard deviation  0.036997 0 0.176383 16.64582    0.053881 0 0.096244 8.036376    0.024044 0 0.203813 22.40722    0.041322 0 0.207958 4.330127    0.019529 0 0.480739 23.84848    0.010124 0.833307 2.835371 7.637626    0.007848 0 0.088317 16.64582    0.039182 1.250945 1.657667 14.2156    0.04034 0 0.351032 19.41863    0.044061 1.020005 2.042442 40.23369    0 0.15031 0.880388 30.31089               124  Appendix F-5: Mixotrophic and inhibition test results with electron donors (acetate, propionate) and fixed nitrogen species (Pilot sludge) VSS, NO3-N, Acetic Acid, Long test - Oct 6 VSS, NO3-N, Propionic Acid, Long test - Oct 6 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 43.80 11.71 0.94 197.50 1530.00 1365 0 42.9 12.32 2.03 305 1575 1430 0.75 33.70 10.23 4.97 190   0.75 23.65 10.68 6.19 302.5   1.5 15.15 8.19 9.95 182.5   1.5 10.8 7.689 3.81 292.5   2.25 2.89 7.12 16.40 177.5   2.25 2.18 6.115 8.285 285   18 0.08 6.59 3.39 80   18 0.4215 4.869 0.5625 70    INHIBITION TEST VSS, NO3-N, Methanol + Acetate - Oct 1 INHIBITION TEST VSS, NO3-N, Methanol + Acetate - Oct 1 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 57.25 19.456 1.86 652.5 1120 1000 0 53.6 17.019 1.52 587.5 880 800 1 56.3 19.081 0.997 640   1 51.65 17.83 2.685 585   2 55.45 17.91 0.4025 650   2 51.3 18.393 1.955 590   3 52.55 18.456 3.19 660   3 50.1 19.165 3.21 590   4 50.65 18.733 4.705 645   4 47.9 18.81533 5.92 570   17 48.4 25.63592 1.995 655   17 45.15 25.68447 2.595 580    Appendix F-6: Mixotrophic test results with primary effluent and fixed nitrogen species (Pilot sludge) VSS, Primary Effluent Test 1 VSS, Primary Effluent Test 2 Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) Time (hr) NH4-N (mg/L) NO3-N (mg/L) NO2-N (mg/L) COD TSS (mg/L) VSS (mg/L) 0 126.05 18.93 0.83 167.50 865.00 785 0 126.914 1.746667 11.08 185 800 740 0.5 125.98 16.86 0.39 152.5   0.5 126.728 1.246667 4.986667 162.5   1 125.67 13.92 0.45 144   1 125.736 0.789333 1.484 155   1.5 125.36 12.33 0.44 145   1.5 125.674 0.764667 0.839333 152.5   2 124.74 11.86 0.42 147.5   2 125.612 0.918667 1.011333 147.5   5.5 124.00 10.42 0.33 142.00   5.5 120.404 2.48 3.34 148    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167531/manifest

Comment

Related Items