Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The effect of transcription factor YY1 and small molecules on HIV-1 expression Bernhard, Wendy 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_september_bernhard_wendy.pdf [ 21.38MB ]
Metadata
JSON: 24-1.0167431.json
JSON-LD: 24-1.0167431-ld.json
RDF/XML (Pretty): 24-1.0167431-rdf.xml
RDF/JSON: 24-1.0167431-rdf.json
Turtle: 24-1.0167431-turtle.txt
N-Triples: 24-1.0167431-rdf-ntriples.txt
Original Record: 24-1.0167431-source.json
Full Text
24-1.0167431-fulltext.txt
Citation
24-1.0167431.ris

Full Text

THE EFFECT OF TRANSCRIPTION FACTOR YY1 AND SMALL MOLECULES ON HIV-1 EXPRESSION     by  Wendy Bernhard  B.Sc.H., University of Saskatchewan, 2006  M.Sc.H., University of Saskatchewan, 2008      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF    DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Biochemistry & Molecular Biology)         THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)    September 2014  © Wendy Bernhard, 2014 	   ii	   ABSTRACT  Current therapies to treat patients infected with HIV-1 do not represent a cure. The virus persists as a latent chromosomally integrated provirus in unstimulated helper T-cells that is unaffected by current drugs and can become reactivated upon stimulation of the T-cell receptor. Much research is currently focused on understanding mechanisms that control HIV-1 latency and devising ways to eliminate latent viral populations. In this thesis, I characterize a protein, YY1 that is involved in establishing HIV-1 latency, examine the role of a histone methyltransferase inhibitor on activation of the HIV-1 LTR, and identify lariat peptides that recognize TFII-I to examine the role of an interaction between USF1 and TFII-I on HIV-1 transcription. The transcription factor YY1 has been shown to promote repressive chromatin modifications by the recruitment of histone deacetylases (HDACs). In this thesis, I identify a novel binding site for YY1 on the HIV-1 LTR, near the highly conserved RBEIII element immediately upstream of the enhancer, and show that YY1 dissociates from the LTR in vivo upon T-cell activation. Overexpression of YY1 causes an increase in HIV-1 expression, which illustrates the importance of this factor for establishment of latency. I also show that an inhibitor of the histone methlytransferase SUV39H1, chaetocin, causes induction of latent HIV-1 expression, with minimal cell toxicity and without T-cell activation. The effect of chaetocin is amplified synergistically in combination with histone deacetylase (HDAC) inhibitors. These results indicate that drugs with properties similar to chaetocin may provide a therapy to purge cells of latent HIV-1, possibly in combination with other chromatin remodeling drugs.  In a parallel objective, I sought to identify cyclic lariat peptide inhibitors of TFII-I, an additional 	   iii	  factor shown to be involved in expression of HIV-1 transcription. In these studies, I identified a lariat peptide that binds the R4 domain of TFII-I using a yeast two-hybrid assay. Expression of this peptide in cells was found to activate the HIV-1 LTR 2-fold. This result demonstrates that lariat peptide inhibitors might offer an alternative to small molecule compounds as potential therapies targeting the latent reservoir.  	    	   iv	  PREFACE 	   This thesis is presented in six chapters. A literature review of the research area is presented in Chapter 1. Chapter 2 describes the Materials and Methods used in the experiments presented in this study. A version of Chapter 3 was published with co-authors Kris Barreto, Sheetal Raithatha and Ivan Sadowski (Bernhard W, Barreto K, Raithatha S and Sadowski I. An Upstream YY1 Binding Site on the HIV-1 LTR Contributes to Latent Infection. PLoS One. 2013 Oct 8;8(10):e77052). The viral construct shown in Figure 2A was made by Sheetal Raithatha. All other work shown in this chapter was my own, and I wrote the manuscript. A version of Chapter 4 was published with co-authors Kris Barreto, Amy Saunders, Matthew S. Dahabieh, Pauline Johnson and Ivan Sadowski (Bernhard W, Barreto K, Saunders A, Dahabieh MS, Johnson P and Sadowski I. The Suv39H1 methyltransferase inhibitor chaetocin causes induction of integrated HIV-1 without producing a T-cell response. FEBS Letters 585 (2011) 3549-3554). The viral construct and clonal cell line shown in Figure 1A were produced by Matthew Dahabieh. The IL-2 ELISA and Flow cytometry with anti-CD69 shown in Figure 3A and B were performed by Amy Saunders in Pauline Johnson’s lab. All other work presented in this chapter is my own and I wrote the manuscript.  The TFII-I R4 yeast two-hybrid screen and all resulting assays presented in Chapter 5 represent my own research.  	    	   v	  TABLE OF CONTENTS  ABSTRACT ....................................................................................................................... ii	  PREFACE ......................................................................................................................... iv	  TABLE OF CONTENTS ................................................................................................. v	  LIST OF TABLES ......................................................................................................... viii	  LIST OF FIGURES ......................................................................................................... ix	  LIST OF ABBREVIATIONS ......................................................................................... xi	  ACKNOWLEDGEMENTS .......................................................................................... xiv	  CHAPTER 1: INTRODUCTION .................................................................................... 1	  1.1 HIV-1 overview ....................................................................................................... 1	  1.2 Viral genes and structure of the virion ................................................................. 2	  1.3 Replication cycle of HIV-1 ..................................................................................... 4	  1.3.1 Attachment, fusion and entry ............................................................................. 4	  1.3.2 Uncoating and reverse transcription of the RNA genome ................................. 6	  1.3.3 Transport to the nucleus and integration into the host genome ......................... 8	  1.3.4 Viral expression, assembly and budding ........................................................... 8	  1.4 Signaling in T-cells ................................................................................................ 10	  1.5 Transcriptional regulation ................................................................................... 10	  1.6 Relevant factors for HIV-1 activation ................................................................. 12	  1.6.1 Nuclear factor κB (NFκB) ............................................................................... 12	  1.6.2 NFAT ............................................................................................................... 12	  1.6.3 Ets-1/GABP-α/β1 ............................................................................................ 13	  1.6.4 Sp1 ................................................................................................................... 13	  1.6.5 RBF-2 ............................................................................................................... 14	  1.7 Establishment of latency ...................................................................................... 17	  1.7.1 Integration site ................................................................................................. 17	  1.7.2 Transcription factors regulating repression of HIV-1 ...................................... 18	  1.7.3 Chromatin and regulation of the HIV-1 LTR .................................................. 20	  1.7.4 microRNA and RNA interference of HIV expression ..................................... 22	  1.7.5 The HIV transactivator Tat .............................................................................. 23	  1.7.6 Effects of PTEFb regulation on HIV-1 latency ............................................... 23	  1.8 Current HIV-1 therapies ...................................................................................... 24	  1.8.1 Highly active retroviral therapy (HAART) ...................................................... 24	  1.8.2 Reactivating HIV-1 from latency ..................................................................... 25	  1.9 Potential cyclic lariat peptide inhibitors directed against HIV-specific repressors ..................................................................................................................... 27	  1.10 Objectives ............................................................................................................. 29	  CHAPTER 2: MATERIALS AND METHODS .......................................................... 30	  2.1 Oligonucleotides .................................................................................................... 30	  	   vi	  2.2 Recombinant DNA molecules .............................................................................. 30	  2.3 Recombinant baculovirus ..................................................................................... 33	  2.4 Nuclear extracts and recombinant protein ......................................................... 33	  2.5 Cell culture ............................................................................................................ 34	  2.6 Transfections ......................................................................................................... 34	  2.7 Infections ................................................................................................................ 35	  2.8 Luciferase assays and flow cytometry ................................................................. 35	  2.9 ChIP assays ............................................................................................................ 36	  2.10 EMSA assays ....................................................................................................... 37	  2.11 Yeast strains and media ..................................................................................... 38	  2.12 Propagation and manipulation of yeast ............................................................ 39	  2.13 Yeast two hybrid (Y2H) assay ........................................................................... 39	  2.13.1 Library mating ............................................................................................... 39	  2.13.2 Y2H screening ............................................................................................... 40	  2.14 Statistical Analysis .............................................................................................. 41	  CHAPTER 3: THE ROLE OF YY1 IN HIV-1 LATENCY ........................................ 42	  3.1 Introduction ........................................................................................................... 42	  3.2 YY1 binds the highly conserved RBEIII on the HIV-1 LTR in vitro ............... 43	  3.3 YY1 does not bind to a mutant RBEIII in cells ................................................. 46	  3.4 YY1 does not bind near RBEI or RBEIII in stimulated cells ........................... 48	  3.5 TFII-I is constitutively bound to the HIV-1 LTR in both unstimulated and stimulated cells ............................................................................................................ 53	  3.6 YY1 over-expression prevents reversal of latent HIV-1 infection .................... 54	  3.7 Discussion .............................................................................................................. 58	  CHAPTER 4: REACTIVATING LATENT HIV-1 WITH CHAETOCIN ............... 64	  4.1 Introduction ........................................................................................................... 64	  4.2 Chaetocin can activate an HIV-1 luciferase reporter mini-virus ..................... 65	  4.3 Chaetocin is not toxic to Jurkat cells ................................................................... 66	  4.4 H3K9 trimethylation is down-regulated and acetylation is up-regulated in Jurkat cells exposed to Chaetocin ............................................................................. 67	  4.5 Binding of NFκB p65 is not increased at the LTR in chaetocin treated cells . 69	  4.6 TATA binding protein increases at the HIV-1 LTR in chaetocin treated cells....................................................................................................................................... 70	  4.7 Chaetocin does not cause T-cell activation in Jurkat cells ................................ 71	  4.8 Chaetocin acts synergistically with the HDAC inhibitors TSA and SAHA .... 74	  4.9 Chaetocin causes a slower and weaker response of transient HIV-1 LTR templates ...................................................................................................................... 78	  4.10 Discussion ............................................................................................................ 79	  CHAPTER 5: SCREENING LIBRARIES FOR LARIAT PEPTIDES THAT COULD BE USED TO ALTER HIV-1 LTR EXPRESSION ..................................... 83	  5.1 Introduction ........................................................................................................... 83	  5.2 The R4 domain increases LTR expression ......................................................... 85	  5.3 A screen for lariat peptides that bind the TFII-I R4 domain ........................... 86	  5.4 Analysis of R4-interacting lariats ........................................................................ 88	  	   vii	  5.5 The effect of the R4-interacting lariats on HIV-1 LTR activity in Jurkat cells....................................................................................................................................... 90	  5.6 R4 Lariat screen discussion.................................................................................. 92	  CHAPTER 6: CONCLUSIONS AND FUTURE DIRECTIONS ............................... 95	  6.1 The role of YY1 in HIV-1 latency ........................................................................ 95	  6.2 Reactivating latent HIV-1 with chaetocin ......................................................... 100	  6.3 Lariat peptide inhibitors of TFII-I that affect HIV-1 LTR expression ......... 103	  BIBLIOGRAPHY ......................................................................................................... 106	  	  	    	   viii	  LIST OF TABLES Table 2.1: Oligonucleotides used in this study ............................................................. 31	  Table 5.1: Summary of lariat peptide sequences that interact with the R4 domain of TFII-I ....................................................................................................................... 89	  	   ix	  LIST OF FIGURES Figure 1.1: HIV-1 genome organization and viral protein products. .......................... 3	  Figure 1.2: Diagram of a mature HIV-1 virion. ............................................................. 4	  Figure 1.3: The HIV-1 life cycle. ...................................................................................... 5	  Figure 1.4: HIV-1 reverse transcriptase pathway. ........................................................ 7	  Figure 1.5: Organization of transcription factors on an actively transcribing HIV-1 promoter. ................................................................................................................. 11	  Figure 1.6: Organization of transcription factors on a repressed HIV-1 promoter. 15	  Figure 1.7: Intein splicing. ............................................................................................. 28	  Figure 3.1: YY1 binds to the HIV-1 LTR near RBEIII. ............................................. 43	  Figure 3.2: YY1 expressed from baculovirus binds to the RBEIII probe. ................ 44	  Figure 3.3: Four nucleotides are important for YY1 binding to RBEIII. ................. 45	  Figure 3.4: Schematic representation of the pTY-LAI-dsRed reporter mini virus. . 46	  Figure 3.5: Representation of primers used for ChIP. ................................................ 47	  Figure 3.6: Mutations at RBEIII prevent binding of YY1 in Jurkat-tat cells. .......... 48	  Figure 3.7:YY1 dissociates from the HIV-1 LTR in stimulated Jurkat-tat cells. ..... 49	  Figure 3.8: YY1 expression does not change in stimulated versus unstimulated cells.................................................................................................................................... 50	  Figure 3.9: Jurkat-tat cell infected with virus pTY-LAI-dsRed reporter mini-virus.................................................................................................................................... 51	  Figure 3.10: YY1 is not bound to actively transcribed HIV-1 LTR in unstimulated cells. .......................................................................................................................... 52	  Figure 3.11: TFII-I does not bind to the RBEIII mutant. ........................................... 53	  Figure 3.12: TFII-I binds to RBEIII constitutively. .................................................... 54	  Figure 3.13: Overexpression constructs schematic. ..................................................... 55	  Figure 3.14: Immunoblot of YY1 overexpression constructs. .................................... 55	  Figure 3.15: ChIP of YY1 overexpression constructs. ................................................. 56	  Figure 3.16: YY1 overexpression increases the proportion of virus that maintains latent infection. ........................................................................................................ 57	  Figure 3.17: Multiple transcription factors, including YY1, directly bind near the conserved RBEIII element. .................................................................................... 60	  Figure 3.18: Proposed ‘looping’ DNA structure possibly created by YY1 binding and/or RBF2 complex binding at RBEI and RBEIII. ......................................... 61	  Figure 4.1: Schematic representation of the pTY-LAI-luc reporter virus. ............... 65	  Figure 4.2: Chaetocin activates an integrated HIV-1 minivirus. ................................ 66	  Figure 4.3: Chaetocin is not toxic at concentrations required for HIV-1 LTR activation. ................................................................................................................. 67	  Figure 4.4: Chaetocin affects histone methylation on the HIV-1 LTR. ..................... 68	  Figure 4.5: Chaetocin affects histone acetylation on the HIV-1 LTR. ....................... 69	  Figure 4.6: Chaetocin does not affect NFκb binding on the HIV-1 LTR. ................. 70	  Figure 4.7: Chaetocin affects TATA binding protein (TBP) binding on the HIV-1 LTR. ......................................................................................................................... 71	  Figure 4.8: Chaetocin does not cause T-cell activation as measured by IL-2 production. ............................................................................................................... 72	  	   x	  Figure 4.9: Chaetocin does not cause T-cell activation as measured by CD69 expression................................................................................................................. 73	  Figure 4.10: Chaetocin does not cause clumping of Jurkat T-cells. ........................... 73	  Figure 4.11: Chaetocin causes synergistic activation of the HIV-1 LTR with TSA. 75	  Figure 4.12: Chaetocin in combination with TSA is not toxic. ................................... 76	  Figure 4.13: Chaetocin causes synergistic activation of the HIV-1 LTR with SAHA.................................................................................................................................... 77	  Figure 4.14: Chaetocin in combination with SAHA is not toxic at low concentrations. ........................................................................................................ 78	  Figure 4.15: Chaetocin produces a weaker and slower response with a transiently transfected HIV-1 reporter. ................................................................................... 79	  Figure 5.1: Schematic of TFII-I. .................................................................................... 84	  Figure 5.2: A membrane-permeable-R4 domain fusion, in combination with PMA causes hyper-induction of the HIV-1 LTR. .......................................................... 86	  Figure 5.3: Lariat peptides re-tested for interaction with the TFII-I R4 domain, full length TFII-I and LexA (pEG202). ....................................................................... 87	  Figure 5.4: Immunoblot for analysis of R4 lariat processing in yeast. ...................... 88	  Figure 5.5: Immunoblot for analysis of R4 lariat processing in Cos7 cells. .............. 90	  Figure 5.6: Lariat 189 causes activation of the HIV-1 LTR. ...................................... 91	  Figure 5.7: Several R4-interacting lariat peptides have a toxic affect on Jurkat cells.................................................................................................................................... 92	    	    	   xi	  LIST OF ABBREVIATIONS AIDS Acquired immune deficiency syndrome AP-1 Activating protein-1 ASLV Avian sarcoma leukosis virus  ATP Adenosine triphosphate BAF Brg1/Brm-associated factor BSA Bovine serum albumin C/EBP-α CAAT/enhancer binding protein-alpha CA Capsid CBF Centromere binding factor  CCR5 C-C chemokine receptor type 5 CD4 Cluster of differentiation 4 Cdk Cyclin dependent kinase cDNA Complementary DNA ChIP Chromatin immuno precipitation CTD C-terminal domain CTIP2 Chicken ovalbumin upstream promoter transcription    factor-interacting protein 2 CXCR4 CXC-chemokine receptor type 4 DAG Diacylglycerol DAPI 4',6-diamidino-2-phenylindole DMEM Dulbecco’s modified eagle medium DSIF DRB sensitivity-inducing factor complex DZNep 3-deazaneplanocin A Ebox Enhancer box ELISA Enzyme-linked immunosorbent assay EMSA Electrophoretic mobility shift assay ERK Extracellular signal-regulated kinase ESCRT Endosomal sorting complex required for transport Ets E-twenty six EZH2 Enhancer of zeste 2  FACS Fluorescence activated cell sorting FBS  Fetal bovine serum GABP GA-binding protein GAPDH Glyceraldehyde 3-phosphate dehydrogenase  GFP  Green fluorescent protein gp Glyco protein GR Glucocorticoid receptor H3K9me3 Histone H3 lysine 9 trimethylation HAART Highly active anti retroviral therapy HAT Histone acetyl transferase HDAC Histone deacetylase HDACi Histone deacetylase inhibitor HIV-1 Human immunodeficiency virus-1 HMTI Histone methyltransferase inhibitor 	   xii	  HP1γ Heterochromatin protein 1 gamma IKK Inhibitor of kappa kinase IL Interleukin IN Integrase IP-3 Inositol triphosphate IRF-1 Interferon regulatory factor 1 IκB Inhibitor of kappa B LBP-1 Leader binding protein 1 lck Lymphocyte specific protein kinase  LEDGF Lens epithelium-derived growth factor LEF-1 Lymphoid enhancer factor 1 LSF Late SV40 factor LTR Long terminal repeat MA Matrix MAPK Mitogen-activated protein kinase MBD2 Methyl-CpG binding domain protein 2  MLV Murine leukemia virus  MOI Multiplicity of Infection myb Myeloblastosis myc Myelocytomatosis NaBut Sodium butyrate NC Nucleocapsid Nef Negative regulatory factor NFAT Nuclear factor of activated T-cells NFκB Nuclear factor kappa B NPC Nucleoprotein capsid nuc Nucleosome ORF Open reading frame PE Phycoerythrin PI Propidium iodide PIC Pre-initiation complex PIP Phosphatidylinositol 4,5-bisphosphate PKCθ Protein Kinase C theta PLCγ Phospholipase C gamma PMA Phorbol 12-myristate 13-acetate PMSF Phenylmethylsulfonyl fluoride PTEFb Positive transcription elongation factor qPCR quantitative polymerase chain reaction R Repeat region Raf Rapidly accelerated fibrosarcoma Ras Rat sarcoma RBE Ras-responsive factor binding element RBF Ras-responsive binding factor Rev Regulator of expression of virion proteins RIPA Radioimmuno-precipitation Assay Buffer RNAP RNA polymerase 	   xiii	  RT Reverse transcriptase RTC Reverse transcription complex SAHA Suberoylanilide hydroxamic acid  SP1 Specificity protein 1 Suv39H1 Suppressor of variegation 3-9 homolog 1 SV40 Simian virus 40 SWI/SNF SWItch/sucrose non-fermentable TAR Trans-activation response element Tat Trans-activator TBP TATA binding protein TFII-I Transcription factor II-I TNF-α Tumor necrosis factor alpha TSA Trichostatin A U5 Unique 5' region UBP-1 Upstream binding protein 1 USF1 Upstream stimulatory factor Vif Viral infectivity factor VPA Valproic acid Vpr Viral protein R VSVG Vesicular stomatitis virus YY1 Yin Yang 1 Zap70 Zeta-chain-associated protein kinase 70   	    	   xiv	   ACKNOWLEDGEMENTS  I would like to thank everyone who was involved in contributing to the completion of this thesis. First and foremost I would like to thank Ivan Sadowski for his support and mentorship through the years. Your passion for research has inspired me to persevere in a sometimes difficult environment. Thank you for helping me to develop my writing and presenting skills and for providing a stimulating work environment that allowed me to conduct and explore research experiments independently while being supportive and encouraging. I thank my committee members Dr. Michael Kobor and Dr. Michel Roberge for their support and guidance.  I would like to extend my gratitude to past and present members of the Sadowski lab who have encouraged and supported me through graduate studies. A special thanks goes to my friends Sheetal Raithatha, Ting Cheng-Su, Kristina McBurney and Elizabeth Donohue for their support.   I would like to acknowledge my family for their encouragement and support over the years. Finally I thank Kris for his unconditional and continuous support and inspiration. 	   1	   CHAPTER 1: INTRODUCTION 1.1  HIV-1 overview 	   In 2012, an estimated 35.3 million people worldwide had been reported to be living with HIV-1, with 2.3 million of these being newly infected (1). In 2012 alone 1.6 million people died from AIDS-related causes (1). The overall growth of the epidemic has stabilized in recent years, and new HIV-1 infections have steadily decreased each year since a peak in 2001. Due to the introduction of highly active antiretroviral therapy (HAART), the number of AIDS-related deaths has also declined in the developed world, however, the cost of current therapies is a major issue for underdeveloped countries in Africa and Asia (1). There are three stages of a typical HIV-1 infection in untreated patients (2). The first stage is an acute phase, where viral load peaks approximately 3-4 weeks after infection (3). During acute HIV-1 infection, a large amount of virus is produced primarily in CD4+ T cells causing a rapid decrease in the CD4+ T cell count by virus-dependent cytopathic effects (2). In most patients, the immune system is able to mount an initial response to decrease the level of serum virus, which ultimately results in an increase in the CD4+ cell count at the end of the first phase (2). The second stage of the viral infection is the chronic or asymptomatic stage and can last for six to ten years (2). During this stage the viral load slowly increases while the CD4+ T cell numbers decrease (2, 3). The third stage is representative of acquired immune deficiency syndrome (AIDS), which is associated with failure of the immune system.  	   2	  1.2  Viral genes and structure of the virion 	   The HIV-1 genome contains 9 genes that produce 16 different viral proteins (4). Expression of the HIV-1 genome is controlled by the 5’ LTR (Figure 1.1). Viral proteins Tat (p14), Rev (p19), Nef (p27), Vif (p23), Vpr (p15) and Vpu (p16) are produced from specific sub-genomic spliced transcripts (4). There is also one un-spliced mRNA variant that codes for gag-pol. This precursor is processed by the viral protease into seven polypeptides including four structural proteins (matrix (MA) p17, capsid (CA) p24, nucleocapsid (NC) p7 and p6), and viral enzymes including viral protease (PR p10), reverse transcriptase/RNaseH (RT p66, RNH p51) and integrase (IN p32) (Figure 1.1). The env precursor protein (gp160) is cleaved into the surface protein gp120 and transmembrane protein gp41 by the cellular protease furin (5).  	   3	  	  	  Figure 1.1: HIV-1 genome organization and viral protein products. Shown: glycoprotein 120 (gp120), glycoprotein 41 (gp41), gag, capsid protein 24 (CA p24), gag, membrane matrix-associated protein 17 (MA p17), protease protein 10 (PR p10), positive sense RNA (+sRNA), nucleocapsid protein 7 (NC p7), integrase protein 32 (IN p32), reverse transcriptase (RT) and RNase H protein 66 (RNH p66), viral infectivity factor (Vif), viral protein U (Vpu), viral protein R (Vpr), negative regulatory factor (Nef) and long terminal repeat (LTR). Adapted from: (http://www.stanford.edu/group/virus/retro/2005gongishmail/HIV.html).    The outer HIV-1 envelope is made up of a lipid bilayer that contains the glycoproteins gp120 and gp41 (Figure 1.2) (6). Inside the envelope is the viral protein p17, which makes up a matrix that surrounds the capsid (6). The matrix contains the viral enzymes reverse transcriptase (RT), integrase (IN) and protease (PR). The capsid protein p24 is also contained within the matrix and encloses two copies of the single stranded viral RNA genome (Figure 1.2) (7, 8). The viral mRNA genome is tightly bound by the nucleocapsid proteins p7 and p6, which protects the genome from nucleases. The accessory proteins Vpr, Vif and Nef and the viral protease are also enclosed within the viral particle. 	     ·/75 Gag Pol Vif VprEnv5HY7DW·/751HIMA CA NCp17 p24 p7 p635 5751+ INp10p51p66 p32gp120 gp41VWUXFWXUDOSURWHLQVHQ]\PHVFRDWSURWHLQV9SX1HI7DWVprVif 9SX 5HYDFFHVVRU\DQGUHJXODWRU\SURWHLQV	   4	   Figure 1.2: Diagram of a mature HIV-1 virion. Shown: glycoprotein 120 (gp120), glycoprotein 41 (gp41), gag, capsid protein 24 (CA p24), gag, membrane matrix-associated protein 17 (MA p17), protease protein 10 (PR p10), positive sense RNA (+sRNA), nucleocapsid protein 7 (NC p7), integrase protein 32 (IN p32), reverse transcriptase (RT) and RNase H protein 66 (RNH p66). Adapted from (63).  1.3 Replication cycle of HIV-1 1.3.1 Attachment, fusion and entry The HIV-1 replication cycle is initiated with viral entry, which involves attachment of gp120 of the HIV virion to the CD4 receptor on the surface of immune cells (Figure 1.3). HIV-1 primarily infects CD4+ T-cells and macrophages but can also infect dendritic and microglia cells. After the attachment of gp120 to the CD4 receptor, gp120 undergoes a conformational change inducing the formation of a bridge between the inner and outer domains of the gp120, exposing the hydrophobic fusion domain of gp41 (9). This likely allows binding of gp41 and/or the chemokine receptors (9, 10) and gp120 gp41 CA p24 MA p17 +sRNA & NC p7 PR p10 RT p66 & RNH p51 IN p32 Lipid bilayer	   5	  leads to the fusion between the host cell and viral membranes (11, 12). The chemokine receptor used by the virus for infection varies throughout the course of disease progression. CCR5 is used primarily during transmission and the asymptomatic phase of infection (13), whereas CXCR4 is typically used during later stages of the infection.    Figure 1.3: The HIV-1 life cycle. The HIV-1 virion attaches to the CD4+ receptor on the outside of a cell shown in red. The nucleoprotein capsid (NPC) is shown in green. The virion fuses with the host cell and releases its contents into the cell. The viral particles are uncoated, the RNA genome is reverse transcribed and localized to the nucleus. In the nucleus the viral DNA will be integrated into the host genome. Upon activation the viral DNA will be expressed and translated to produce new viral particles, which will bud from the host cell and infect new cells. RT is reverse transcriptase. Adapted from (63).   Attachment RT Fusion   Uncoating Transcription  Integration Nuclearlocalization Nuclear membrane Cellular membrane  mRNA nuclearexport  Translationand assembly  Budding 	   6	  1.3.2 Uncoating and reverse transcription of the RNA genome  Once inside the cell, the capsid is uncoated to release the RNA genome, along with the viral enzymes protease, reverse transcriptase and integrase into the cytoplasm (Figure 1.3). Uncoating of the capsid is not well understood and it is controversial when it takes place after infection, but has been shown to be required for formation of the reverse transcription complex (8). Some studies suggest that uncoating occurs at the plasma membrane soon after the capsid is transferred to the cytoplasm and is required for initiation of reverse transcription (8). Uncoating could be triggered by the change in environment from inside the virion to the cytoplasm, or a consequence of loss of free capsid molecules, which has been shown to keep the capsid core stable (14). Other studies indicate that uncoating takes place while the capsid core is transported to the nucleus (15). It has also been suggested that the capsid remains intact until it reaches the nuclear membrane where uncoating occurs after reverse transcription (16). Regardless of when exactly uncoating takes place, it is agreed that uncoating and reverse transcription take place in the cytoplasm, because most of the capsid, matrix and reverse transcriptase proteins dissociate from the reverse transcription complex shortly after infection (17).  Reverse transcription of the viral RNA genome takes place in the cytoplasm but the exact location, or whether the capsid is involved, is unknown (Figure 1.3) (8). Reverse transcription to cDNA is primed by the tRNALys,3 annealing to the primer binding site initiating within the U5 region and extending to the end of the R (repeat) region of the viral RNA (Figure 1.4). This step is followed by a strand transfer, where the newly synthesized R cDNA anneals to the 3’ R repeat of the viral RNA. Synthesis of the minus strand DNA is then completed, followed by degradation of the RNA template (18, 19).  	   7	                      Figure 1.4: HIV-1 reverse transcriptase pathway.  The primer tRNA is lysine encoding. Also indicated are the primer binding site (PBS), repeat region (R), unique at the 3’ terminus (U3), unique at the 5’ terminus (U5) and the poly purine tract (PPT). Adapted from (63).  R U5 RU3Retroviral RNAPBStRNA·· ·R U5 RU3Retroviral RNAPBStRNA· ·RU3Retroviral RNAPBS· ·tRNARU3Retroviral RNAPBS ·tRNAR U5R U5R U5RU3Retroviral RNAPBS ·tRNAR U5R U5PPTU3U3R U5PPTU3RU3 U5RU3 U5 PBS······R U5PPTU3RU3 U5RU3 U5 PBS·RU3 U5 PBSRetroviral DNARetroviral DNARetroviral DNARetroviral DNARetroviral DNAtRNAR U5U3· Retroviral DNAR U5PPTU3RU3 U5 PBS· Retroviral DNA	   8	  After reverse transcription takes place, the pre-integration complex (PIC) is formed and translocated into the nucleus (Figure 1.3) (8). 1.3.3 Transport to the nucleus and integration into the host genome The PIC is composed of integrase and possibly other viral proteins, including nucleocapsid (p7), matrix (p17), reverse transcriptase (RT) and Vpr (20). Since HIV-1 can infect dividing and non-dividing cells, the PIC must be capable of crossing the nuclear envelope. It is thought to do this by passing through the nuclear pore complex, which is a gate for transport between the cytoplasm and nucleus (21). Due to the large size of the PIC, and the nuclear localization signals on some of the proteins found within the PIC, it is believed that import involves active transport, and that matrix, Vpr and integrase may interact with importin and nucleoporins, which partly make up the nucleoprotein capsid (NPC) (20). In the nucleus, the HIV-1 integrase cuts the host chromosomal DNA and catalyzes a strand transfer step to join the proviral DNA to the host chromosomal DNA (22). Once integrated into the host cell genome, the viral DNA can become silenced, or transcribed and expressed (Figure 1.3).  1.3.4 Viral expression, assembly and budding The HIV-1 genome encodes nine polyproteins, some of which are expressed from alternative splicing of the genomic RNA (4). The HIV-1 mRNA primary transcript undergoes complex alternative splicing to produce all the viral proteins required for HIV-1 replication (23). There are four different 5’ splice sites and 8 different 3’ splice sites to produce over 40 alternatively spliced mRNA transcripts (23). Transcripts encoding Tat, Rev and Nef are the first mRNAs produced. They are fully spliced and are exported out of the nucleus by the host cell’s regular mRNA export pathway. Other viral proteins are 	   9	  required later during infection for assembly of infectious virions. These transcripts are partially spliced, encoding Vif and Vpr, and unspliced encoding Gag/Gag-Pol (23). Unspliced full genomic HIV transcripts are transported to the cytoplasm by Rev, which can overcome the requirement of splicing prior to nuclear export. In the cytoplasm the viral mRNA is translated and assembled into new virions. The components making up the new virions include two copies of the positive sense genomic viral RNA, cellular tRNALys,3, the envelope protein, the Gag polyprotein and the three viral enzymes: protease, reverse transcriptase and integrase (24).  Viral packaging and assembly occurs at the plasma membrane (Figure 1.3) (24). Insertion of Gag into spheres on the membrane surface initiates the assembly process and causes distortion of the membrane away from the cytoplasm, wrapping around the assembling viral particle (Figure 1.3) (25). gp120 and gp41 are expressed on the surface of the viral particle and are involved in attachment. The N-terminal matrix domain is responsible for directing Gag to the cell membrane for virion assembly. The capsid oligomerizes during viral assembly to contain the RNA genome. The nucleocapsid binds the + strand mRNA to aid in packaging of the genome during assembly and protect the genome from nucleases. The C-terminal domain of Gag contains short peptide docking sites for ESCRT and ESCRT-associated proteins required for budding (25). During assembly, Gag binds to components involved in the ESCRT pathway and completes assembly separating the virion from the cell membrane (25). The ESCRT pathway proteins ESCRT-I and ESCRT-II induce bud formation and stabilize the bud neck (26), while ESCRT-III is responsible for membrane scission (26). The released viral particle is then able to spread the infection to other cells (Figure 1.3). 	   10	  1.4 Signaling in T-cells  One of the main cell populations harboring latent HIV-1 is CD4+ T-lymphocytes. In these cells, viral transcription is mainly regulated by three signaling pathways downstream of the T-cell receptor, which include the Ras/Raf/MAPK/ERK, PKCθ-/IKK/NFκB, and the calcineurin/NFAT pathways. Upon stimulation through engagement of the T-cell receptor during antigen presentation, the tyrosine kinases lymphocyte specific protein kinase (Lck) and Zeta-chain-associated protein kinase 70 (Zap70) are activated, which in turn phosphorylate phospholipase-Cγ (PLCγ) (27, 28). PLCγ then hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP) into diacylgylcerol (DAG) and inositol triphosphate (IP-3). DAG and IP-3 activate two pathways with different transcriptional targets. DAG activates the NFκB and Ras/Raf/MAPK/ERK pathways (28), while IP-3 causes release of intracellular calcium and activation of the calcineurin/NFAT pathway. There are many other host cell transcription factors not involved in these pathways that also bind the HIV-1 LTR in activated T-cells (Pereira 2000; Pereira 2002). In addition, Tat viral protein binds to the TAR stem loop RNA transcript to recruit the necessary transcriptional machinery to allow elongation of RNA Pol II past the TAR region (23). Some of the transcription factors important for this study are discussed below. 1.5 Transcriptional regulation 	   A number of host cell transcription factors bind to the 5’ HIV-1 LTR (Figure 1.5), representing the viral promoter, and promote transcription in response to T-cell signaling. Many transcription factors shown to activate the HIV-1 LTR are involved in recruiting or 	   11	  interacting with histone acetyltransferases (HATs) (Figure 1.5). These factors include, but are not limited to NFκB p65 (29), interferon regulatory factor 1 (IRF-1) (30), nuclear factor of activated T-cells (NFAT) (31), E-twenty six 1 (Ets-1), Sp1 (32), AP-1, cMyb, glucocorticoid receptor (GR), CCAAT enhancer binding protein (C/EBP) and lymphoid enhancer factor 1 (LEF-1) (33), of which have been shown to interact and/or function with HATs.    Figure 1.5: Organization of transcription factors on an actively transcribing HIV-1 promoter. Shown: Nucleosomes 0 (Nuc0), acetylation (ac), upstream stimulatory factors 1 and 2 (USF1/2), transcription factor II-I (TFII-I), ras-binding element I and III (RBEI/III), histone acetyltransferase (HAT), nuclear factor of activated T-cells (NFAT), specificity protein 1 (SP1), TATA binding protein (TBP), RNA polymerase II (RNPII), general transcription factors (GTFs), trans-activation response element (TAR), cyclin dependent kinase (CDK9), positive elongation transcription factor b (P-TEFb), repeat region (R) and unique at the 3’ terminus (U3). Adapted from (171).  RBEIRBF-2 TFII-I USF1 USF2 Nuc0RBEIIIRBF-2 TFII-I USF1 USF2 SP1p65 p50HAT HATacac acacTBPGTFsRNAPIIU3-454 +1-78-105basal/core   promoter    core enhancermodulatory     regionU3 RNFATTatTarCyclinT1             P-TEFbCDK9	   12	  1.6 Relevant factors for HIV-1 activation 1.6.1 Nuclear factor κB (NFκB) NFκB is one of the main transcription factors involved in HIV-1 activation. NFκB subunits exist as multiple isoforms that generate various combinations of homo- and heterodimers. The RelA p65 subunit binds DNA as a heterodimer with p50, and is involved in HIV-1 activation (Figure 1.5). The p65 subunits are normally sequestered in the cytoplasm, however after T-cell receptor engagement the second messenger DAG activates protein kinase C θ (PKCθ), which in turn activates inhibitor of kappa kinase (IκK) (28). IκK phosphorylates the inhibitor of κB (IκB), which releases NFκB (34). NFκB translocates into the nucleus where it binds to the HIV-1 LTR promoter and activates transcription through HAT recruitment (35). In resting cells a p50 homodimer occupies the same element as the p65/p50 heterodimer but instead causes transcriptional repression by recruitment of HDACs (36).  1.6.2 NFAT NFAT is another of the key inducible transcription factors involved in activating the HIV-1 LTR. In resting cells NFAT is sequestered in the cytoplasm, but translocates to the nucleus upon T-cell activation. NFAT has been shown to bind to two sites on the HIV-1 LTR, between -216 and -254 (37) in addition to sites overlapping those for NFκB within the enhancer (38) (Figure 1.5). Mutations of the upstream sites had no effect on viral expression (37). NFAT binding to the NFκB sites has been shown to act synergistically with NFκB to enhance HIV-1 expression (39), however, NFAT is activated independently of NFκB through the calcium/calcineurin pathway during T-cell 	   13	  signaling (40). NFAT binding to the NFκB sites on the HIV-1 LTR has also been shown to be involved in bending the DNA (41). 1.6.3 Ets-1/GABP-α/β1 Multiple Ets proteins have been shown to physically interact with NFκB and NFAT on the HIV-1 LTR (42). The interaction between these proteins is important for activating the HIV-1 LTR. GABP-α/β1 is an Ets family member that is activated through the Ras/Raf pathway downstream of the T-cell receptor (43). Binding sites for GABP-α/β1 have been identified within the NFκB/NFAT binding sites in the HIV-1 LTR enhancer region (-90 to -104), and GABP-α/β1 was shown to comprise the RBF-1 complex that binds these sites (44, 45). Ets-1 was shown to interact with USF1 near the Ebox on the HIV-1 LTR and this interaction is required for HIV-1 transcriptional activation (46). Also, a screen using a luciferase reporter with a mutant NFκB binding site and human splenocyte cDNA expression library identified a splice variant of Ets-1 (ΔVII-Ets-1) that could bind and activate the HIV-1 LTR independent of NFκB and the T-cell response (47). 1.6.4 Sp1 Sp1 has been shown to have multiple roles in HIV transcription. Three Sp1 binding sites exist on the HIV-1 LTR immediately 3’ of the NFκB sites and just upstream of the core promoter (-77 to -45) (Figure 1.5) (48). Mutations in these sites were shown to prevent Sp1 binding and cause a 10-fold decrease in transcription (48). LTR bound Sp1 may also recruit P-TEFb to the LTR through interaction with its Cyclin T1 subunit. Sp1 was also shown to interact with Tat to activate the HIV-1 LTR (49). In another study Sp1 	   14	  was shown to recruit c-Myc, which in turn recruits HDAC1 to repress the HIV-1 LTR (50).  1.6.5 RBF-2 Within the HIV-1 LTR there are four highly conserved cis-elements required for LTR expression in response to v-Ras (44) known as Ras-response factor binding elements I-IV (RBE1-1V). RBEIII is highly conserved in HIV-1 LTRs from patients with AIDS (51) highlighting the importance of this element for HIV pathogenesis. The protein complex Ras-element binding factor-2 (RBF-2) binds RBEIII at -120 as well as RBEI near the core promoter (Figure 1.5, Figure 1.6) (51, 52). The RBF-2 protein complex is made up, minimally, of proteins including transcription factor II-I (TFII-I), upstream stimulatory factor 1 (USF1) and upstream stimulatory factor 2 (USF2) (which bind as a heterodimer) (53). 1.6.5.1 Transcription factor II-I (TFII-I) 	   TFII-I is an important protein for multiple processes including transcription and signal transduction. Hemizygosity for TFII-I is associated with the neurodegenerative disorder Williams-Beuren syndrome (54). TFII-I has four different isoforms (alpha, beta, delta and gamma), which are generated by alternative splicing (55, 56). On the c-fos promoter, the beta isoform was shown to associate in an inactive state in growth factor starved cells, while during serum stimulation, the delta isoform becomes tyrosine phosphorylated, enters the nucleus and replaces the beta isoform at the c-fos promoter to 	    	   15	    Figure 1.6: Organization of transcription factors on a repressed HIV-1 promoter.  Shown: Nucleosomes 0 and 1 (Nuc0 and Nuc1), methylation (me), upstream stimulatory factors 1 and 2 (USF1/2), transcription factor II-I (TFII-I), Ras-response-binding element I and III (RBEI/III), histone deacetyltransferase (HDAC), Yin Yang 1 (YY1), Specificity protein 1 (SP1), COUP-TF interacting protein 2 (CTIP2), late simian virus 40 transcription factor (LSF), repeat region (R) and unique at the 3’ terminus (U3). Adapted from (171).  activate transcription (57). Studies shown in this thesis involving TFII-I were performed exclusively with the delta isoform. TFII-I has been shown to be required for HIV-1 expression (53, 58). Upon T-cell receptor engagement, diacylglycerol (DAG) activates the Ras/Raf/MEF/ERK pathway, through the function of Ras-GRP. TFII-I has been shown to interact with extracellular signal-related kinase (ERK), and this interaction is required for transcriptional activation (59). It is unknown how TFII-I activates transcription from the HIV-1 LTR, however the protein is constitutively bound to the LTR in both unstimulated and stimulated T-cells Nuc1RBEITFII-I USF1 USF2 Nuc0RBEIIITFII-I USF1 USF2 SP1p50p50HDAC3 HDAC3YY1HDAC1HDAC1/2HDAC1CTIP2SUV39H1 mememe mememeYY1LSFHDAC1U3-454 +1-78-105basal/core   promoter    core enhancermodulatory     regionU3 R	   16	  and was previously linked to recruitment of HDAC3 for repression of cellular promoters (60, 61).  On the HIV-1 LTR, TFII-I was shown to bind RBEIII cooperatively with USF1 (53). Disruption of cis sequences that bind TFII-I near the RBEIII site prevents induction of the HIV-1 LTR by T-cell signaling (58). Overexpression of a dominant negative TFII-I (p70 - containing amino acids 606-735, including the tail end of the R4 domain) (62), which binds DNA but lacks the activation domain, prevents activation from the HIV-1 LTR by T-cell signaling (53). USF1 and TFII-I were shown to interact through the R4 domain on TFII-I (63).  1.6.5.2 Upstream stimulatory factors 1 and 2 (USF1 and USF2) 	   USF was identified as a cellular factor that binds the enhancer sequence (E-box) on the adenovirus major late promoter (64). Purified USF contains the proteins USF1 and USF2. These proteins are ubiquitously expressed in all tissues (65), and typically bind to promoters as heterodimers, and in rare circumstances homodimers (65, 66). USF has been shown to be involved in repressing and activating multiple genes. The dual roles of USF may be attributed to protein modifications such as phosphorylation (53, 67), splice variants (66, 68), interactions with other transcription factors (53, 69, 70) and interaction and/or association with histone modifying proteins and acetylated histones (71-73). It is possible that one or more of these mechanisms is involved in regulation of the HIV-1 LTR by USF. USF binds constitutively to the HIV-1 LTR in a complex with TFII-I to produce a factor known as RBF2 (53). RBF2 binds two sites on the HIV-1 LTR, RBEI (52) and RBEIII (53). Overexpression of a dominant negative USF, representing the C-terminal 94 	   17	  amino acids, containing the leucine zipper and the HLH E-box DNA binding domain (74), prevents activation from the HIV-1 LTR by T-cell signaling (53). Disruption of the USF binding sites on the LTR also prevents activation, and decreases transcription and virion production (52, 58). USF1 was shown to specifically interact with the R4 domain on TFII-I (63). Binding of USF1/2 - TFII-I complexes to the LTR seems to be important for HIV-1 activation, however it is unknown whether a transcriptional activation domain within the USF or TFII-I proteins themselves is necessary for this function (58). 1.7 Establishment of latency 1.7.1 Integration site HIV-1 predominantly integrates within transcriptionally active genes in CD4+ cells from HIV-1 infected patients (75, 76) and infection of primary T-cells in vitro (77). A study comparing HIV-1 to Avian sarcoma leukosis virus (ASLV) and murine leukemia virus (MLV) integration sites suggests that specific sequences at the ends of the HIV-1 viral cDNA are required to target integration to gene-rich regions (78). Sequencing of infected primary T-cells also showed that HIV-1 had a preference for integrating into the same orientation as the host gene (77), and Han et al showed that orientation had more than a ten-fold effect on HIV-1 gene expression (79). A study looking at integration sites in resting CD4+ T-cells from patients, identified integrations within the coding region of host genes (80). HIV integration seems to be favored at gene-dense regions in sites of active transcription (75, 78). These areas contain active histone modifications such as H3 acetylation, H4 acetylation and H3 K4 methylation (81). In contrast, HIV-1 integrations are rarely found in regions with transcription inhibitory modifications such as H3K27 trimethylation and DNA CpG methylation (81). When the viral DNA is integrated into 	   18	  these regions, latency can result due to spreading of repressive chromatin marks, which may inhibit access of transcription factors that activate the LTR.  1.7.2 Transcription factors regulating repression of HIV-1 A number of host cell transcription factors have been shown to be involved in repressing HIV-1 expression (Figure 1.6). Most of these factors repress the HIV-1 LTR by recruiting histone deacetylases (HDACs) and include, but are not limited to Yin Yang 1 (YY1), late SV40 factor (LSF) (82, 83), transcription factor II-I (TFII-I) (60, 84), activating enhancer binding protein 4 (AP-4) (85), nuclear factor kappa B (NFκB) p50/p50 homodimers (86), C-promoter binding factor 1 (CBF-1) (87), c-Myc (50), and specificity protein 1 (Sp1) (50). Other transcription factors such as heterochromatin protein 1 gamma (HP1γ) (88) and CTIP2 (89) have been shown to recruit histone methyltransferases such as Suv39H1 to repress the LTR. Two repressive transcription factors important in this thesis, YY1 and LSF will be discussed below. 1.7.2.1 Ying yang-1 (YY1) 	   YY1 is a highly conserved, ubiquitously expressed protein that has been shown to activate or repress transcription based on its acetylation status (90) and the promoter context (91). YY1 is important in many different biological pathways and interacts with a number of transcription factors and histone modifying proteins (92). Not surprisingly, because it is involved in so many pathways, YY1 is also associated with a number of different cancers (92), and is necessary for development, since a knock out of the gene is lethal in mice (93). There are also a number of viruses whose gene expression is regulated by YY1; these include adenovirus (94), Epstein-Barr virus (95), hepatitis B and C (96, 97), herpes virus (98), human papillomavirus (99) and parvovirus (100). 	   19	  YY1 was first identified with respect to HIV-1 transcription to associate with the –16 to +27 region on the HIV-1 LTR, in a complex with the late simian virus 40 (LSF) protein Figure 1.6 (82, 101). YY1 seems to repress the HIV-1 LTR through recruiting histone deacetylase 1 (HDAC1) (102). In addition to interaction with this site near the core promoter, previous work in our lab identified a protein complex that was sensitive to the addition of YY1 antibodies in EMSA reactions with Jurkat nuclear extracts, using probes spanning the highly conserved RBF-2 (USF1/2-TFII-I) binding site called RBEIII (-120 to -140) upstream of the enhancer region of the LTR (58). In this previous study it was also shown that deletion of sequences 3’ of the core ACTGCTGA RBEIII element prevented formation of the putative YY1 complex. The role of YY1 for the HIV-1 life cycle may go beyond direct transcriptional regulation of the LTR, since it has also been shown to repress CXCR4 expression, which is a co-receptor used early during infection for HIV-1 entry (103), and has also been shown to interact with HIV-1 integrase (104). 1.7.2.2 Late simian factor 40 (LSF) 	   LSF (also known as LBP-1, UBP-1 and CP-1) (105) was first identified as a factor bound to the SV40 late promoter necessary to initiate the late mode of transcription (106). LSF is regulated through phosphorylation, which increases or decreases its DNA binding depending on the promoter (105, 107). To bind DNA, LSF forms dimers or tetramers with itself, proteins from the same family, or unrelated proteins (105). LSF can act as an activator or a repressor, and has been shown to be involved in regulating genes related to cell cycle, growth, survival and differentiation (105). It binds to both cellular and viral promoters including α-globin (108), α-crystallin (109), Simian Virus 40 (SV40) (106) and HIV-1 (110). On most promoters, LSF acts as an activator through interaction 	   20	  with the TATA binding protein (TBP) and TFIIB (105). LSF binds to sites located at -10 to +27 on the HIV-1 promoter (Figure 1.6) (102) and has been shown to repress transcription on the HIV-1 LTR through steric hindrance (111), inhibition of transcriptional elongation (112) and HDAC1 recruitment in a complex with YY1 (102).  1.7.3 Chromatin and regulation of the HIV-1 LTR  1.7.3.1 Chromatin modifications associated with activation of the HIV-1 LTR 	   Two nucleosomes are strongly positioned within the regulatory region of the HIV-1 LTR in unstimulated cells (Figure 1.6). Nucleosome 0 (nuc-0) is positioned upstream of the enhancer region at -415 to -255 with respect to the transcription start site. Nucleosome 1 (nuc-1) is positioned immediately downstream of the transcription initiation site (-3 to +141) and essentially blocks transcription elongation (113). Upon T-cell activation, nuc-1 is disrupted through acetylation of histone tails (Figure 1.5) (113, 114) and/or through ATP-dependent chromatin remodeling (115, 116) to allow transcription. Acetylation of lysine residues on histone tails by HATs promotes an open chromatin conformation allowing the general transcriptional machinery to bind the LTR and initiate transcription. A number of cellular transcription factors (NFκB, NFAT, AP-1, SP1, USF1) as well as viral Tat have been shown to recruit HATs to the HIV-1 LTR (29, 33). Tat has also been shown to recruit the SWI/SNF chromatin-remodeling complex for ATP-dependent chromatin remodeling (115, 116). Phosphorylation of histone H1 has also been shown to be important for activation of HIV-1 expression (117).   	   21	  1.7.3.2 Repression of the LTR through chromatin and DNA modifications 	   As mentioned above, Nuc-1 is positioned on the HIV-1 LTR in unstimulated cells near the transcription initiation site, which blocks transcription elongation (113). Brg1/Brm-associated factor (BAF) has been shown to be required for positioning of the repressive nuc-1 on the HIV-1 LTR (118). Histone acetylation causes remodeling of nuc-1 prior to transcriptional activation, and in contrast when these acetylations are removed by HDACs, accessibility of the core promoter is diminished to prevent transcription. HDAC1 in particular has been shown to be recruited by a number of host cell transcription factors, including YY1 (102), LSF, AP-4 (85), c-Myc (50), SP1, CTIP2 (89), centromere binding factor (CBF1) (87), and NFκB p50 (86). HDAC2 (84, 89) and HDAC3 are recruited to the LTR to cause repression (84). Perhaps related to these effects, HDAC4 has been shown to be down-regulated in cells restricted of essential amino acids, resulting in transcriptional de-repression of silenced transgenes including the HIV-1 LTR (119). Once acetylation has been removed from lysine residues, the histones can undergo further modification by methylation. Histone methylation is associated with both transcriptional activation and repression. Histone methylation at H3K9 and H3K27 has been linked to HIV-1 LTR repression (120), whereas methylation of H3K4 is associated with transcriptional activation. The Suv39H1 methyltransferase is recruited to the LTR by HP1gamma and CTIP2 where it causes tri-methylation of H3K9 (121). Similarly, G9a causes dimethylation of H3K9, which also contributes to HIV-1 repression (122), and the histone methyltransferase enhancer of Zeste 2 (EZH2) has been shown to be linked to repression of HIV transcription through H3K27 trimethylation (123). Recently, Tyagi et 	   22	  al. have reported that CBF-1 may be responsible for recruiting EZH2 to the HIV-1 LTR (124).  DNA methylation is generally associated with transcriptional silencing, and was shown to be involved in repression of the HIV-1 LTR. Methylation of DNA seems to be established as a later event during latency, and acts as an extra barrier to reactivation of HIV-1 from latent cells (125). Two CpG islands have been identified in the HIV-1 LTR that contribute to HIV-1 repression (126). Methyl-CpG binding domain protein 2 (MBD2) and HDAC2 have been found to be associated with DNA methylation on the LTR in association with HIV-1 repression (126). 1.7.4 microRNA and RNA interference of HIV expression Mature microRNAs are generated by the RNases III Drosha and Dicer, and can interact with complementary transcripts or sequences from the 3’ untranslated region of their target mRNA, resulting in degradation of the mRNA and/or inhibition of translation (127). microRNAs have also been shown regulate gene expression by inducing DNA methylation on promoters and remodeling of chromatin near promoters (128, 129). A cluster of cellular microRNAs that target the 3’ end of HIV-1 mRNA in resting CD4+ T-cells were shown to suppress translation of Tat and Rev (73). Nef-encoding transcripts are also targeted by cellular miRNA hsa-miR29a, which contributes to latency (130). Studies have also shown that the HIV-1 transactivating response element (TAR) (131, 132) and Nef transcripts are processed into microRNA, which have been proposed to contribute to HIV-1 latency by repressing expression from the LTR (133, 134).  	   23	  1.7.5 The HIV transactivator Tat The HIV-1 transactivator Tat functions by binding to the transactivation-responsive element (TAR), an RNA stem-loop structure located at the 5’ end of the viral transcript (135). PTEFb binds to the Tat-TAR complex, which promotes elongation of RNA PolII transcription. HIV-1 latency can occur when levels of Tat decrease below threshold levels, thereby preventing recruitment of PTEFb and synthesis of viral transcripts (135). In unstimulated cells, levels of Tat eventually are diminished by a decrease in transcriptional initiation, caused by the loss of activation and accumulation of repressive chromatin on the 5’LTR. 1.7.6 Effects of PTEFb regulation on HIV-1 latency Binding of PTEFb to TAR/Tat is required for elongation of HIV-1 transcription past the TAR element. The PTEFb complex contains Cyclin T1 and CDK9, which phosphorylates the C-terminal domain of RNA Pol II to promote transcriptional elongation (135). There are a number of different mechanisms that control the activity of PTEFb that can contribute to latency of the HIV-1 provirus. Decreased levels of Cyclin T1 in unstimulated T-cells and sequestration of PTEFb by the HEXIM/7SK ribonuclear complex in the cytoplasm (136) also reduce the activity of PTEFb on HIV-1 transcription. It was shown that there is very low expression of CDK9 and Cyclin T1 in unstimulated primary CD4+ T-cells, but levels were increased upon T-cell receptor engagement, which suggests that PTEFb levels are limited in latently infected cells (136-140). Levels of Cyclin T1 are also decreased by the microRNA miR-198 (141).  Phosphorylation of CDK9 on T186, at the active site, is necessary for kinase activity (138); phosphorylation of this residue is almost undetectable in resting CD4+ T-	   24	  cells (139). Low levels of CDK9 activity prevents Ser2 phosphorylation on the CTD of RNA Pol II, which limits transcription elongation and contributes to HIV-1 latency (139).  1.8  Current HIV-1 therapies 1.8.1 Highly active retroviral therapy (HAART) Since the introduction of highly active anti-retroviral therapy (HAART), which can suppress viral loads to undetectable levels, HIV-1/AIDS has become a more manageable disease. During infection, a population of latently infected cells becomes established, which are not affected by HAART. Unfortunately, the latently infected population decays very slowly, making eradication of infection with this therapy improbable (142). Since HAART targets actively replicating virus but does not affect latent provirus, these drugs do not represent a cure of the disease. Patients on HAART will have to remain on therapy for the rest of their lives since removal of treatment allows viral loads to rebound within weeks (143, 144). There are other problems associated with HAART, including the high cost of medication (145), metabolic disease and toxicity (146). In addition, there is already the appearance of mutations resistant to some of the antiretroviral drugs (147), which requires close monitoring of patients and alteration of therapy as necessary (148). Due to these issues, there is a need to continually improve the current HAART, in addition to finding other ways of treating HIV-1/ AIDS. A variety of strategies have been considered to force expression of latent HIV with the objective of “purging” this otherwise impenetrable infection, collectively known as the “shock and kill” strategy (149).  	   25	  1.8.2 Reactivating HIV-1 from latency 1.8.2.1 T-cell activation 	   Since HAART does not ‘cure’ HIV, but simply decreases actively replicating virus, a strategy to cure HIV/AIDS infection is an important area of research. Current studies have focused on targeting the latent population by activating the provirus and forcing expression of latent HIV with the objective of “purging” the virus from the latent reservoir (150, 151). Initial studies into elimination of HIV-1 latently infected cells have used non-specific T-cell activation with interleukin 2 (IL-2) (144) and/or anti-CD3 antibodies (152). Global T-cell activation, however, causes toxicity due to the ‘cytokine storm’ effect, which has resulted in research into alternative strategies to force activation the LTR without causing T-cell activation. 1.8.2.2 HDAC inhibitors (HDACi) 	   Histone deacetylase inhibitors (HDACi) have been given a lot of attention as possible agonists for purging the latent HIV-1 reservoir. HDACi are attractive molecules for this purpose because they cause remodeling of nucleosomes at the LTR and force increased expression (153-155) without causing T-cell activation (156). HDACi have also been shown to potentially inhibit CD4 T-cell proliferation (157) and repress the CXCR4 chemokine receptor expression (158). HDACi have been used effectively in a broad spectrum of cell lines and HIV-1 subtypes (159) and have been administered to patients for a number of diseases, since they are relatively non-toxic to normal cells (160). The first report using HDACi for activating HIV-1 latent expression involved trapoxin and TSA, class I and II HDACi (114). Because activation of latent HIV-1 has been demonstrated using the class I and II HDACi valproic acid (VPA), suberoylanilide 	   26	  hydroxamic acid (SAHA), trichostatin A (TSA), and sodium butyrate in a number of latency models, and cells from HIV-1 infected patients (154, 159, 161-165), several HDACi have been tested for reactivation of latent provirus in HIV-1 patients. One study reported using VPA with intensified HAART, which caused a significant decrease in the population of latently infected cells, indicating accelerated clearance (153) SAHA has also been used in patients and was shown to reactivate HIV-1 (166). Another study showed that prolonged VPA treatment did not reduce the size of the latent HIV-1 population (167). A number of new HDACi have recently been identified (ITF2357, CG05, CG06, NCH-51, MC1293, AV6) and shown to reactivate HIV-1 in infected cell lines (155, 164, 168-170). Consequently, HDACi show some promise for purging latently infected cells; however, they seem to induce viral expression from only a limited fraction of the total latent population (167). Also, since latent HIV genomes are silenced by multiple mechanisms associated with heterochromatin (149, 171) it is unlikely that HDACi alone will be capable of purging the entire population of latently infected cells. 1.8.2.3 Histone methyltransferase inhibitors (HMTI) 	   More recently HMTI have been used for reactivation of latent HIV-1. Methylation at H3K9 and H3K27 is associated with repressive heterochromatin, which must be removed to allow transcription. This can be encouraged by treatment with HMTIs. The HMTI BIX01294 inhibits the methyltransferase G9a responsible for dimethylation of H3K9, and has been shown to reactivate HIV-1 latency (122). Similar results were obtained by inhibiting the enhancer of zeste homolog 2 (EZH2), which causes H3K27 trimethylation (123). A broad-spectrum HMTI, DZNep, was also shown to activate the HIV-1 LTR (123). HMTIs may be attractive candidates for reactivating latent HIV because they can 	   27	  act synergistically with HDACi. Accordingly, BIX01294, specific for G9a, and the broad-spectrum inhibitor DZNep, were shown to act synergistically with SAHA to induce HIV-1 (122, 123, 172).  1.9 Potential cyclic lariat peptide inhibitors directed against HIV-specific repressors 	   The traditional approach towards development of novel drugs involves screening of small molecule libraries, and reports of several such screens have revealed potentially novel inducers of latent proviral expression (47, 170, 173-176). An alternative towards development of protein function inhibitors involves randomized lariat peptide aptamers produced using a novel technology involving inteins (177, 178). This technology was previously used to specifically inhibit the Abl kinase SH1 domain, and LexA autoproteolysis (177, 178). Inteins are naturally occurring proteins that undergo a self-splicing reaction (179). Inteins are the protein analogue of introns; they interrupt mature proteins and remove themselves post-transcriptionally (180) (Figure 1.7A), while exteins are the mature protein equivalent of an exon (179). Inteins contain N-Intein and C-Intein domains; when expressed together the intein acts in cis (Figure 1.7A) (179). Naturally occurring inteins can also be separately expressed to act in trans (Figure 1.7B). The inteins used in this study are trans-splicing, and have been permutated to produce amide-cyclized (lactam) peptides (181) (Figure 1.7C). The lariat portion of the cyclic peptide is created by stalling the intein cyclizing reaction by mutation of an asparagine residue to alanine in the asparagine cyclization step of the intein cyclic peptide reaction (177). In this way, a tail or tag can be added to the cyclic peptide resulting in a lariat formation.  	   28	   Figure 1.7:Intein splicing. A) Cis-splicing inteins. The N terminal and C terminal domains of the intein are flanked by the extein sequence to be joined by the splicing reaction. The intein domains perform the self-excising reaction and are removed from the protein, joining the two extein domains by a peptide bond. B) trans-splicing inteins. The intein domains are expressed separately with an extein domain. The intein domains catalyze a self-splicing reaction and are excised out of the protein, ultimately joining the exteins by a peptide bond. C) Intein mediated protein cyclization. When the protein/ peptide to be cyclized is placed between the two intein domains where the N- and C-intein domains are swapped, the intein domains catalyze a self-splicing reaction to form a cyclized substrate.  N-Extein N-Intein C-Intein C-ExteinPrecursor ProteinN-Intein C-Intein N-Extein C-ExteinProtein cis-splicingExcised Intein Excised ProteinN-Intein C-Intein N-Extein C-ExteinExcised Intein Excised ProteinPrecursor ProteinsProtein trans-splicingN-Extein N-Intein C-Intein C-ExteinN-Intein(C-InteinExcised InteinCyclized ProteinProtein splicing in transN-InteinC-Intein Extein (or Protein)Precursor ProteinABC	   29	  1.10 Objectives 	   The overall goal for this thesis was to characterize mechanisms for the production of HIV-1 provirus and investigate possible means for inducing the latent population. I characterized the function of a defined repressor of the LTR, YY1, examined the effect of a novel chromatin modifying drug, chaetocin on HIV expression, and initiated experiments using the novel lariat technology towards development of therapies that could reactivate latent HIV. YY1 is a ubiquitous protein that has many different roles on various promoters. The goal of my work was to characterize the potential role of a YY1 binding site directly adjacent the RBEIII element on the HIV-1 LTR, 120 nucleotides upstream of the transcription start site. My results have indicated that YY1 bound to this site, in addition to a previous site near the LTR core promoter is important for establishment of latency, and that a better understanding of YY1 function will help in the development of therapeutics to treat the disease and ultimately eradicate the virus. Interest in HMTIs for purging of HIV-1 latency is increasing, due to their ability to activate the HIV-1 LTR and produce synergy with HDACi. The objective of a subset of my experiments was to examine whether chaetocin could activate the HIV-1 LTR by inhibiting the histone methyltransferase SUV39H1, and to examine the mode of action during viral activation. Development of new molecules that can purge the HIV-1 latent viral reservoir will help us to understand the role of chromatin in HIV-1 latency, and hopefully enable decreasing or eliminating the latent reservoir in hopes of ultimately curing HIV-1/ AIDS.   	    	   30	  CHAPTER 2: MATERIALS AND METHODS  2.1  Oligonucleotides 	   Oligonucleotides were synthesized on an Applied Biosystems 394 DNA synthesizer or by IDT DNA. For EMSA assays, oligonucleotides were annealed at a final concentration of 100 µM in New England Biolab (NEB) buffer 2 (50mM NaCl, 10mM Tris-HCl, pH 7.9, 10mM MgCl2, 1mM DTT) at 100°C for 5 minutes, and then cooled slowly to room temperature. The sequences of oligonucleotides used in this study are shown in Table 2.1.  2.2 Recombinant DNA molecules 	   The YY1 ORF, produced by PCR using oligonucleotides WB005 and WB006 (Table 2.1) was cloned into the pFastbac plasmid (Invitrogen) at the EcoRI and XhoI restriction sites. The pTY-LAI HIV-1 LTR mini-virus reporter was produced from the lentiviral vector pTY-EFeGFP (NIH AIDS Reagent Program). The luciferase ORF was cloned into the NsiI/SwaI sites, and a wild type 3’ LTR fragment, generated by PCR from the HIV-1 pLAI clone with oligonucleotides MD027 and TM0238 (Table 2.1), inserted into the EcoRI/ KpnI sites to produce pTY-LAI-luc. pTY-LAI-dsRed was generated by replacing the luciferase gene with the gene coding dsRed. The dsRed ORF was amplified with oligonucleotides SAR17 and SAR18 and inserted into the NsiI and SwaI sites. The HIV-1 LTR YY1 binding site mutant (ACTGCTGA to ACTGCact) was produced using site directed mutagenesis with oligonucleotides TM237, TM238, WB140 and WB141.     	   31	  Table 2.1: Oligonucleotides used in this study  Name SequenceWB001 GCGGTTGGGGTTATTCGCAACGGCGACTGGCTGGAATTCGCGAAAGAAGATTGGAATGTWB002 AATTCGCCCGGAATTAGCTTGGCTGCAGGTCGACTCGAGTCGAGCGGTTAAGGAGGCAAWB005 ATCGGAATTCATGGCCTCGGGCGWB006 ATCGCTCGAGTCACTGGTTGTTTTTGGCCTWB011 ATCGGAATTCGATGAAGGGGCAGCAGAAAACWB012 CGATCTCGAGTTAGTTGCTGTCATTCTTGAWB016 GAAATGACGTAATTGTCCGCCATCTTGTACCGGWB017 ACTTCCGGTACAAGATGGCGGACAATTACGTCAWB042 GCGGTTGGGGTTATTCGCAACGGCGACTGGCTGGAATTCATGGCCCAAGTTGCAATGTCWB043 AATTCGCCCGGAATTAGCTTGGCTGCAGGTCGACTCGAGTTACAGCGACGCATAGTCAGGWB054 GATCCTTCACGAACTGCAGACATCGAGC CATCGAGCTTWB055 GAGAAAGCTCGATGGCTCGATGTCTGCAGTTCGTGAAGWB056 GATCCTTCACGAACTGCTCACATCGAGC CATCGAGCTTWB057 GAGAAAGCTCGATGGCTCGATGTGAGCAGTTCGTGAAGWB058 GATCCTTCACGAACTGCTGTCATCGAGC CATCGAGCTTWB059 GAGAAAGCTCGATGGCTCGATGACAGCAGTTCGTGAAGWB083 ATCCACTAGTGG GCAGGTGCTCGAACTTATGAGCAAGGGCGAGGAGCTWB084 AGCTGCGGCCGCCTTGTACAGCTCGTCCATGCCWB116 CGAACCATGGGCGACTATAAGGACGACGATGACAAAGGAWB117 CTTGTCCTTTGTCATCGTCGTCCTTATAGTCGCCCATGGTTCGGTACWB129 AGCCGCCTAGCATTTCATCWB130 CAGCGGAAAGTCCCTTGTAGWB131 AGTGGCGAGCCCTCAGATWB132 AGAGCTCCCAGGCTCAAATCWB133 TTTCCGCTGGGGACTTTCWB134 CCAGTACAGGCAAAAAGCAGWB136 AAA GGA CTA GTC ATG GCCTCGGGCGACWB140 GGAGTACTTCAAGAACTGCACTCATCGAGCTTGCTACAAGGGACTTTCWB141 GAAAGTCCCTTGTAGCAAGCTCGATGAGTGCAGTTCTTGAAGTACTCCWB146 CGAAGAATTCGTTACTGGTTGTTTTTGGWB149 CAGCCTCAAGATCATCAGCAWB150 TGTGGTCATGAGTCCTTCCAWB153 CTAGTCGGAATGGGTGCTCCTCCAAAAAAGAAGAGAAAGGTAGCTGGACGWB154 AATTCGTCCAGCTACCTTTCTCTTCTTTTTTGGAGGAGCACCCATTCCGAWB196 ACTTCTTGTTGCCCGGGTCCGCCACGGTGACCAGCGTTTWB197 AAACGCTGGTCACCGTGGCGGACCCGGGCAACAAGAAGTTM237 GGAATTCCTCGAGACCTGGAAAAACATGGTM238 GGGGTACCCCCTTTATTGAGGCTTAAGCAGTSAR17 GAGGATGCATTTATGGCCTCCTCCGAGGACGTCSAR18 GAGATTTAAATCTTACAGGAACAGGTGGTGGCGTM102 GATCCTTCACGAACTGCTGACATCGAGCCATCGAGCTTTM103 GAGAAAGCTCGATGGCTCGATGTCAGCAGTTCGTGAAGTMK fwd GATCCTTCACGAACTGCTGAGATCGAGCCATCGAGCTTTMK rvs GAGAAAGCTCGATGGCTCGATCTCAGCAGTTCGTGAAGTML fwd GATCCTTCACGAACTGCTGACTTCGAGCCATCGAGCTTTML rvs GAGAAAGCTCGATGGCTCGAAGTCAGCAGTTCGTGAAGTMM fwd GATCCTTCACGAACTGCTGACAACGAGC CATCGAGCTTTMM rvs GAGAAAGCTCGATGGCTCGTTGTCAGCAGTTCGTGAAGTMN fwd GATCCTTCACGAACTGCTGACATGGAGCCATCGAGCTTTMN rvs GAGAAAGCTCGATGGCTCCATGTCAGCAGTTCGTGAAGMD027 AAAGAATTCTTTAAGACCAATGACTTACAAGGC	   32	  A Flag tag-encoding fragment was cloned into pEF4-his/myc using oligonucleotides WB089 and WB090, inserted into the Kpn1 and SpeI restriction sites to create pEFlag. The wild type YY1 ORF was amplified using oligonucleotides WB104 and WB137 and cloned into the SpeI and EcoRI restriction sites of pEFlag to produce pEFlag-YY1. The YY1 glycine/alanine/lysine mutant was created by deleting amino acids 155-198 in a two-step PCR reaction first by amplifying 5’ and 3’ fragments using oligonucleotides WB104/ WB196 and WB197/ WB137 in a second reaction. The two products were mixed together in a second reaction, amplified with oligonucleotides WB104 and WB137, and then cloned into the SpeI and EcoRI restriction sites of pEFlag to produce the product pEFlag-g/a/k. pGL3-basic (Promega) and pGL3-HIV-1 (53) were used for transient transfections.  The TFII-I bait and R4-pEG202 bait for the yeast two hybrid screens were generated by amplifying the full TFII-I ORF, or the region encoding the TFII-I R4 domain using WB042 and WB043, WB001 and WB002, respectively. These fragments were cloned into the EcoRI and XhoI sites of pEG202. The USF1-pIL500 prey was generated by amplifying the USF1 ORF with oligonucleotides WB011 and WB012 and cloning into the EcoRI and XhoI sites of pIL500. The lariat peptide-encoding fragments, used for transfection into Jurkat-Tat cells bearing the luciferase reporter mini-virus, were amplified using WB083 and WB084, and cloned into the NotI and EcoRI sites of the pEFlag vector. A nuclear localization signal-encoding DNA fragment was inserted into pFlag by annealing oligonucleotides WB153 and WB154 and cloning into the SpeI and EcoRI sites.  	   33	  2.3 Recombinant baculovirus 	    The YY1-pFastbac transfer plasmid was transformed into DH10Bac E. coli and the recombinant baculovirus vector was selected according to the Invitrogen Bac-to-Bac Expressions System manual. The recombinant bacmid DNA was transfected into 75% confluent Sf9 insect cells.  The resulting virus produced from the transfected cells was titred using the BACPAK Baculovirus Rapid titre kit (Clontech), expanded and used to infect Sf9 insect cells that were 80% confluent. Infected cells were incubated for 48 hours at 25°C, and then collected for preparation of cell extracts as described below. 2.4  Nuclear extracts and recombinant protein  	   Sf9 insect cells infected for 48 hours with YY1-expressing baculovirus were collected and washed 3 times with 1X PBS. The cells were suspended in 0.3 packed cell volume (PCV) of buffer C (20mM HEPES pH 7.9, 20% [v/v] glycerol, 420 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) and 0.7 PCV of buffer D (20 mM HEPES pH 7.9, 20% [v/v] glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF), and lysed by passing through a 27 ½ gauge needle 10 times with a syringe. The resulting total cell lysate was cleared by centrifugation at 13 000 rpm for 15 minutes at 4°C.  For preparation of nuclear extracts, Jurkat cells were collected at ~ two million cells per mL and washed 3X with 1X PBS.  The cell pellet was suspended in 2 PCV of cold buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT) and passed gently through a 27-½ gauge needle 10 times on ice. The nuclei were collected by pulse centrifugation at 4°C. The supernatant was removed and the nuclear pellet was suspended in 0.6 PCV of buffer C (20 mM HEPES pH 7.9, 20% [v/v] glycerol, 40 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) and incubated on 	   34	  ice for 15 minutes. Buffer D was added to one equivalent volume and the resulting lysate was clarified by centrifugation at 13 000 rpm for 15 minutes at 4°C.  2.5  Cell culture 	   Sf9 insect cells and Human embryonic kidney (HEK) 293T cells were obtained from the American Type Culture Collection (ATCC). Jurkat and Jurkat-Tat cells were obtained through the NIH AIDS Research and Reference Reagent Program. Sf9 insect cells were grown in TC-100 Insect Media + 10% FBS (Gibco-BRL) and maintained at 25°C. HEK 293T were grown in DMEM (Sigma) with 10% fetal bovine serum (Gibco-BRL) supplemented with penicillin (100 U/mL) and streptomycin (100 U/mL). Jurkat-Tat cells were grown in RPMI 1640 (Sigma) with 10% fetal bovine serum (Sigma) supplemented with penicillin (100 U/mL), streptomycin (100 mg/mL) (Gibco), and Gentecin (0.8 mg/mL) (Invitrogen) and maintained in a humidified 37 °C, 5% CO2 atmosphere.  Jurkat-Tat cells were stimulated with 50 nM PMA (Sigma) for four hours, 50 nM chaetocin (Sigma) for 8 hours, 50 ng/mL TSA (Sigma), 10 ng/mL TNFα (Sigma) or 10 µM SAHA (Toronto Res. Chemicals) for 24 hours. Data from FACS was analyzed using FlowJo analysis software (Tree Star).  2.6  Transfections 	   One million Jurkat-Tat cells were transfected with 2 µg of plasmid DNA using an Amaxa Nucleofector (Lonza) according to the manufacture’s instructions. Stable cell lines expressing YY1, YY1 g/a/k mutant or the pFlag control were selected using 0.15 mg/mL Zeocin (Invitrogen). In a 10 cm dish 50-60% confluent HEK 293T cells were transfected using 6 µg/mL polyethylenimine (PEI) and 10 µg total plasmid DNA. The 	   35	  PEI and plasmid DNA were incubated for 20 minutes in 1 mL of OptiDMEM and then added to the cells drop-wise. The cells were incubated for 48 hours before the supernatant containing virus was collected for infection. 2.7  Infections 	   VSV-G pseudo typed pTY-LAI-dsRed virus was produced by co-transfection of HEK 293T with 2 µg of each pTY-LAI, pLP1-HIV-1 gag/pol, pRSV-Tat, pLP-VSV-G and pLP2-HIV1 Rev. VSV-G pseudo typed HIV-1 are 10-130-fold more infectious than non-pseudotyped HIV-1 and suppresses the requirement for Nef (182). The plasmids pLP1-HIV-1 gag/pol, pRSV-Tat, pLP-VSV-G and pLP2-HIV1 Rev were obtained from Pauline Johnson. Viral stocks were purified through a 0.2 µM Whatman puradisc syringe filter and concentrated by centrifugation in Amicon Ultra-4 Centrifugal Filter Units (Millipore). Jurkat-Tat cell infections were monitored for eGFP expression by flow cytometry, and clones were isolated using fluorescent activated cell sorting (FACS).  Jurkat cells were transiently transfected using an Amaxa Nucleofector (Lonza). One million Jurkat-Tat cells were infected with 40 µL of concentrated virus (to yield ~ 10% infection rate as determined by expression of GFP) by spinoculation for 1 hour.  2.8  Luciferase assays and flow cytometry 	   For luciferase assays, cells were plated at 1 x 106 cells/mL and induced with PMA (Sigma), chaetocin (Sigma) and/or SAHA (Toronto Res. Chemicals) for the indicated times. Reporter gene expression was determined using the Bright-Glo System (Promega). Cell viability was determined by staining with Hoechst (0.5 µg/ mL) and propidium iodide (PI, 0.25 µg/mL) in 96 well plates. After 30 minutes at 37°C the plates were scanned in a CellomicsTM Arrayscan VTI fluorescence imager; Hoechst and TRITC 	   36	  channels were used to determine total cell numbers and PI positive (dead) cells, respectively.  To determine CD69 expression, cells were first blocked with 2.4G2 antibody, and then stained on ice for 30 minutes with 5 µl of anti-human CD69 antibody conjugated to R-phycoerythrin (PE) or PE conjugated mouse IgG1 isotype control antibody (BD Biosciences).  The cells were then washed and stained with 25 ng/ml 4',6-diamidino-2-phenylindole (DAPI) to distinguish live cells before analysis on an BD Biosciences flow cytometer.  Data were analyzed using FlowJo analysis software (Tree Star).  To measure IL-2 production, culture supernatants were collected and assayed by ELISA using an human IL-2 ELISA System (eBioscience). Infected Jurkat-Tat cells were monitored for GFP and dsRed expression by BD Bioscience Flow cytometry. Cells were sorted using a BD Influx cell sorter. 2.9  ChIP assays 	   Nuclei from Jurkat-Tat cells, treated or untreated, were extracted by suspending 3 x 107 cells in NP40 lysis buffer (0.5% NP40, 10 mM Tris HCl, pH 7.8, 3 mM MgCl2), 1 x protease inhibitor cocktail (Roche) and incubated on ice for 5 minutes. The nuclei were pelleted for 5 minutes at 500 x g at 4°C, and suspended in 1 mL of RPMI, 3 mM MgCl2, 1 x protease inhibitor cocktail and 1 % formaldehyde. The nuclei were cross-linked at room temperature for 10 minutes and the reaction was stopped with 125 mM glycine and incubation for 5 minutes. The nuclei were pelleted as above and washed in cold PBS. The nuclei were suspended in sonication buffer (10 mM Tris, pH 7.8, 10 mM EDTA, 0.5% SDS) and sonicated to obtain DNA fragments < 200 base pairs. The supernatant was cleared by centrifugation at 13 000 rpm for 10 minutes. The cleared supernatant was incubated with antibody overnight. 20 µL of protein A or protein G agarose beads 	   37	  (Millipore) were added to the supernatant and antibody, and incubated for 90 minutes at 4°C. The beads were washed 3X with wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH 8, 150 mM NaCl and 20 mM Tris-HCl pH 8) and once with final wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH 8, 500 mM NaCl and 20 mM Tris-HCl pH 8). The protein-chromatin complexes were eluted from the beads with elution buffer (1% SDS and 100 mM NaHCO3) and incubation at 30°C for 15 minutes. Five µL of Proteinase K (Fermentas) was added to each sample and incubated at 65°C overnight. The resulting DNA was cleaned up with an Epoch column according to the manufacture’s instructions. QPCR reactions were performed with IQSybr (Biorad) according to the manufacture’s instructions. Antibodies used for ChIP assays are as follows: α-YY1 (Abcam), α-TFII-I (Santa Cruz) and α-Flag (Ablab, UBC). Oligonucleotides used for qPCR reactions were as follows: RBEI: WB131 and WB132, ER: WB133 and WB134, RBEIII: WB129 and WB130 GAPDH: WB149 and WB150. A clonal cell population was used for the PMA-induced ChIP assay. All other ChIP assays were performed with mixed cell populations. Statistical analysis using Student’s T-tests were performed using R 2.15.1. 2.10  EMSA assays 	   Annealed oligonucleotide probes were labeled for 15 minutes at room temperature with 32P-dNTPs and 2 U of Klenow DNA Polymerase I in New England Biolabs Buffer  2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9). The unincorporated label was removed using Sephadex G-50 spin columns (BD). Five micrograms of Jurkat nuclear extract or Sf9 insect cell extracts expressing YY1 protein was incubated on ice for 20 minutes with 1 µg dIdC and 120 ng BSA in EMSA binding 	   38	  buffer (20mM HEPES pH 7.9, 100 mM KCl and 5 mM MgCl2). Each reaction was incubated with 1 pmol of 32P-labeled oligonucleotide for 20 minutes in 20 µL. The reaction was resolved on a 4.5% non-denaturing polyacrylamide gel at 200 volts for 3 hours in 0.5X Tris-borate-EDTA (TBE) and 1% glycerol. Antibodies used for super-shift assays are as follows: α-TFII-I (Santa Cruz), α-USF1 (Santa Cruz), α-USF2 (Santa Cruz), α-YY1 (Abcam). Double stranded oligonucleotides used for EMSA are listed below (Table 2.1): RBEIII probe: TM102 and TM103 and known YY1 binding sequence competitor oligonucleotide: WB016 and WB017. Point mutation primers for EMSA were as follows: WB054, WB055, WB056, WB057, WB058, WB059, TMK fwd, TMK rvs, TML fwd, TML rvs, TMM fwd, TMM rvs, TMN fwd and TMN rvs. 2.11  Yeast strains and media 	   EY93 has the genotype: MATa, ura3, his3, trp1, leu2, ade2::URA3. EY111 has the genotype: MATα, his3, trp1, ura3::LexA8op-LacZ, ade2::URA3-LexA8op-ADE2, leu2::LexA6op-LEU2. Media was prepared as described by Geyer and Brent (183). Synthetic media was designated by an S, followed by the type of sugar followed by any modifications to the media. A negative sign indicates a dropout or removal of an amino acid or nitrogenous base. A plus sign indicates a media supplement. For example, a typical prey selection plate was SD W-, meaning the synthetic media was supplemented with dextrose (D) and lacked tryptophan (W-). A typical Y2H full selection plate was SGR H-W-L-A- X-gal+, indicating that the synthetic media contained galactose and raffinose, the chromogenic substrate x-gal and lacked amino acids histidine, tryptophan, and leucine and the nitrogenous base adenine. 	   39	  2.12  Propagation and manipulation of yeast 	   Standard procedures were used to culture and propagate yeast (183). Lithium acetate transformations were used to transfer plasmids into yeast or to clone DNA fragments into plasmids by in vivo homologous recombination (184). Yeast frozen competent cells were prepared according to the procedure reported by Gietz and Schiestl (185). Lithium acetate competent cells were prepared from a 10 mL overnight culture in the appropriate media and grown at 30°C with shaking to an OD600 of 0.6-0.8. Cells were collected by centrifugation at 4 000 x g at room temperature and washed once in 25 mL dH2O. The pellet was suspended in 1 mL of 100 mM LiOAc. The cells were centrifuged for one minute at 4 000 x g and suspended in 500 µL of 100 mM LiOAc and dispersed into ten 50 µL aliquots. The aliquots were centrifuged and the pellets were overlaid with 240 µL polyethylene glycol (50% (w/v) PEG-3500), 36 µL of 1 M LiOAc, 25 µL of 2 mg/mL single-stranded DNA, plasmid DNA and PCR insert (optional). The mixture was votexed rapidly to suspend the pellet and the mixtures were incubated for 30 minutes at 30°C and then heat shocked at 42°C for 15 minutes. The samples were centrifuged at 4 000 x g and the pellet was suspended in dH2O and plated on appropriate media.  2.13  Yeast two hybrid (Y2H) assay 2.13.1  Library mating DNA fragments encoding target proteins were cloned into the pEG202 bait plasmid, which has an auxotrophic selection marker for histidine (HIS3). The bait plasmid was transformed into EY111 and grown in 1 L of SDH-A+ to an OD600 of 0.6-1.0. USF1 and lariat encoding fragments were cloned into the pIL500 plasmid. Prey plasmids have the tryptophan auxotrophic selection marker (TRP1). Prior to mating, the 	   40	  titer of the lariat library was determined by plating serial dilutions of the transformed library onto SD W- plates. Approximately 20 library copies were diluted in 50 mL of SDW-. The library was grown for 2-4 hours at 30°C and the OD600 was determined. Cells transformed with the bait and prey libraries were mixed at a bait to prey ratio of 20:1 and spread on YPDA plates. The plates were incubated at 30°C for 24-48 hours. The mated cells were scraped off and washed three times in PBS. The pellet was suspended in glycerol freeze down solution (25 mM Tris-HCl pH 8.0, 65% glycerol, 0.1 M MgSO4) and stored at -80°C. A sample of the library was thawed and serial dilutions were plated onto SDW-, SDH- and SDH-W- to determine the number of diploids per microliter, and the mating efficiency. The diploids per microliter were calculated directly by measuring the CFU/µL on the SDH-W- plates. The mating efficiency was calculated by dividing the number of CFU/µL on the SDW- plated by the number of diploids or CFU/µL on the SDH-W-. A trial screen on SDH-W-L-A- X-gal plates was done to estimate the number of interactions/µL and to determine the optimal cell density to screen the mated library. 2.13.2  Y2H screening An aliquot of the mated library cells was thawed and incubated at 30°C in 50 mL of SGR H-W- to allow the cells to recover and start expressing the bait and prey fusions. Cells were plated at a density of 100,000 to 1,000,000/plate onto SGR H-W-L- plates and incubated at 30°C for five days. Serial dilutions of the library were also plated onto the SDH-W- to determine the number of diploids/µL, which was used to determine the total number of diploids screened. 	   41	  Colonies that formed on the SGRH-W-L- were replica plated onto SGR H-W-A- X-gal after five days using velvets. Replicated plates were incubated at 30°C for five days. Blue colonies that formed the earliest were picked and the plasmids recovered checked again for interaction against the bait upon retransformation. 2.14 Statistical Analysis 	   Values were calculated as mean  +/- standard deviation. P-values were calculated using an unpaired two-tailed student’s t test in R: A Language and Environment for Statistical Computing v2.15.1 or GraphPad Prism version 6 for Mac OS X.    	   42	  CHAPTER 3: THE ROLE OF YY1 IN HIV-1 LATENCY 3.1 Introduction 	   Many host cell transcription factors have been shown to be involved in negatively regulating transcription from the HIV-1 LTR (186). One factor shown to be of particular importance for repression of HIV transcription is Yin Yang 1 protein (YY1) (101). YY1 was first identified with respect to HIV transcription to associate with a sequence within the –16 to +27 region on the HIV-1 LTR, although indirectly to DNA in a complex with the late simian virus 40 (LSF) protein. This study showed that YY1, in association with LSF bound near the core promoter is involved in repression of HIV-1 transcription by recruitment of histone deacetylase 1 (HDAC1) (102).  When I started this project, our lab had evidence showing that YY1 was also bound near a highly conserved element on the HIV-1 LTR called RBEIII. We observed a protein complex that was sensitive to the addition of YY1 antibodies in EMSA reactions with Jurkat nuclear extracts using probes spanning the highly conserved RBF-2 (USF1/2-TFII-I) RBEIII site (-120 to -140) upstream of the enhancer region of the LTR (58). In this study it was also shown that deletion of sequences 3’ of the core ACTGCTGA RBEIII element prevented formation of the putative YY1 complex.  In this chapter I show that YY1 directly binds to the HIV-1 LTR near RBEIII. I show that YY1 becomes dissociated from the HIV-1 LTR in activated T-cells and that binding of YY1 occurs in the population of cells that produce a latent infection shortly after the cells are infected. Overexpression of YY1, but not a mutant defective for recruitment of HDAC1, prevents escape of immediately silenced HIV provirus towards active transcription upon infection of T-cells. Taken together these results show that YY1 plays 	   43	  an important role in establishing and maintaining immediate latency and thereby this protein may be a potential therapeutic target for preventing the formation of latent HIV reservoirs in AIDS patients. 3.2 YY1 binds the highly conserved RBEIII on the HIV-1 LTR in vitro 	   To analyze binding of YY1 to the HIV-1 LTR in detail I used a radiolabeled oligonucleotide spanning the RBEIII site in EMSA with Jurkat nuclear extracts. I observed a complex that is sensitive to the addition of antibodies against YY1 (Figure 3.1, lane 5), but not antibodies against TFII-I, USF1 or USF2 (Figure 3.1, lanes 2-4). This confirmed the previous observations from our lab (58) indicating that YY1 is capable of forming a complex near the RBEIII element.   	  Figure 3.1: YY1 binds to the HIV-1 LTR near RBEIII.  EMSA was performed with Jurkat nuclear extracts and radiolabeled RBEIII probe (core RBEIII site highlighted in red). Lane 1 contains no antibody. Antibodies to TFII-I (lane 2), USF1 (lane 3), USF2 (lane 4), or YY1 (lane 5) were added to analyze the complex components. Free probe (FP) is shown in lane 6. Non-specific band is indicated (NS).  1   2  3  4   5  6       RBEIII probe: GATCCTTCAAGAACTGCTGACATCGAGCTTTCTCYY1NSFP	   44	  To determine if YY1 is capable of binding directly to the HIV-1 LTR at this position, I expressed recombinant YY1 protein in insect cells using baculovirus (Figure 3.2A). I found that the recombinant YY1 produced a complex in EMSA reactions with the RBEIII oligonucleotide probe that migrates identically with the YY1 antibody-sensitive protein complex produced in Jurkat nuclear extracts (Figure 3.2B, compare lanes 1 and 4).    Figure 3.2: YY1 expressed from baculovirus binds to the RBEIII probe.  Panel A: An extract from Sf9 cells infected with a baculovirus expressing YY1 was separated on 12% SDS-PAGE and analyzed by immunoblotting with YY1 antibody (lane 2). Lane 1 contains a high molecular weight protein ladder. Panel B: EMSA was performed with recombinant YY1 produced by baculovirus (lanes 1 and 2) or Jurkat nuclear extracts (lane 4) with the radiolabeled RBEIII probe. The RBF2 complex in lane 4 is shown. YY1 antibody was added to the reaction in lane 2 and the super shifted YY1 complex is indicated (ssYY1). Free probe is shown in lane 3.  Furthermore, I found that the complex produced with recombinant YY1 from baculovirus was dissociated with YY1 antibody (Figure 3.2B, lane 2). A faint band was also observed 6050kDaA 1        2B 1  2  3  4           YY1RBF2ssYY1YY1FP	   45	  in Figure 3.2B, lane 2 which could correspond to a super-shift of the YY1-DNA complex. Binding of recombinant YY1 to the RBEIII oligonucleotide was also strongly competed by unlabeled competitor oligonucleotide bearing a previously defined YY1 binding sequence from the B19 parvovirus promoter (100) (Figure 3.3, lane 2).    Figure 3.3: Four nucleotides are important for YY1 binding to RBEIII.  (Right) EMSA was performed with recombinant YY1 and labeled RBEIII probe (lane 1), unlabeled competitor oligonucleotides were added to the reactions at 100-fold molar excess (lanes 2-10). (Left) Sequences of unlabeled competitor probes; 2, a known YY1 binding sequence oligonucleotide from the parvovirus promoter; 3, wild type RBEIII probe; 4-5, three nucleotide substitutions; 6-12, point substitutions of the RBEIII probe; 13, free probe (FP). Non-specific (NS) bands are also shown. Substitutions are indicated in lower case.  To identify nucleotides that are required for interaction of YY1 with the RBEIII oligonucleotide, I used competition experiments with unlabeled mutant oligonucleotides  1    2   3   4    5   6   7   8   9   10  11 12 13          Unlabeled competitor Unlabeled competitor probe:2  GAAATGACGTAATTGTCCGCCATCTTGTACCGG3  GATCCTTCAAGAACTGCTGACATCGAGCTTTCTC4  GATCCTTCAAGAACTGCactCATCGAGCTTTCTC5  GATCCTTCAAGAACTGcTGACATCGAGCTTTCTC6  GATCCTTCAAGAACTGCaGACATCGAGCTTTCTC7  GATCCTTCAAGAACTGCTcACATCGAGCTTTCTC8  GATCCTTCAAGAACTGCTGtCATCGAGCTTTCTC9  GATCCTTCAAGAACTGCTGAgATCGAGCTTTCTC10 GATCCTTCAAGAACTGCTGACtTCGAGCTTTCTC11 GATCCTTCAAGAACTGCTGACAaCGAGCTTTCTC12 GATCCTTCAAGAACTGCTGACATgGAGCTTTCTCYY1FPNSRBEIII probe: 1  GATCCTTCAAGAACTGCTGACATCGAGCTTTCTC	   46	  in EMSA with the labeled wild type RBEIII probe (Figure 3.3, lanes 3-10). In these experiments I found four nucleotides that seem to be particularly important for binding of YY1 to this region, including the 3’ TG residues within the RBEIII core sequence (ACTGCTGA), in addition to the CA residues in the –CAT- sequence directly 3’ of the RBEIII site (Figure 3.3). YY1 recognition sequences on other promoters were previously shown to contain a conserved –CAT- motif, which was shown to be the core consensus sequence for YY1 binding (91, 187-189). Interestingly, YY1 was previously found to bind an element containing the exact TGACAT sequence on an Epstein Barr virus promoter (190). Also, YY1 was found to bind an element containing the sequence ACAT on a human papillomavirus promoter (191). 3.3 YY1 does not bind to a mutant RBEIII in cells 	   To examine whether YY1 is capable of binding the HIV-1 LTR in cells near RBEIII, I constructed a double-labeled mini-virus reporter. The double-labeled virus allows detection of cells containing integrated provirus independently of LTR activity; eGFP is expressed from an internal EIF1α promoter and dsRed is expressed from the 5’ LTR as a fusion with p24Gag (Figure 3.4).    Figure 3.4: Schematic representation of the pTY-LAI-dsRed reporter mini virus.  The 5’ LTR controls expression of a p24 capsid-dsRed fusion. The E1Fα promoter constitutively expresses eGFP.   ·/75 ()њ ·/75GV5HG H*)3S&DSVLG	   47	  In this vector I introduced a substitution of three nucleotides of the LTR shown to prevent binding of YY1 to the RBEIII oligonucleotide in vitro (Figure 3.3). Virus was produced for both the wild type and RBEIII/YY1 mutant LTR reporter constructs and used to infect Jurkat-tat cells. Infected pools of cells, and individual clones, were isolated using FACS for GFP expression. Because it was previously shown that YY1 is recruited to the LTR flanking the transcription start site through interaction with LSF (101), near an additional binding site for RBF-2 designated RBEI (52), I designed primers for ChIP to separately measure interaction of YY1 with the core promoter/ RBEI region, the upstream RBEIII region, and the enhancer region between these two elements (Figure 3.5).    Figure 3.5: Representation of primers used for ChIP. Analysis of the upstream RBEIII region, enhancer region (ER), and RBEI/ transcription start site region.  For ChIP assays, to enable detection of separate interactions with these regions I sheared the genomic DNA from cross-linked infected cells to less than ~200 nucleotides. Using ChIP analysis with YY1 immunoprecipitated complexes, I observed a 2-fold lower signal with the primer set that amplifies the enhancer region of the LTR relative to the primer sets that amplify the RBEI/core promoter and RBEIII regions. This indicates preferential binding of YY1 with the two regions flanking the enhancer region (Figure 3.6, closed bars). I also observed a 4-fold decrease in YY1 occupancy at the RBEIII site RBEIII-130 +10-110 -90 -70 -50 -30 -10RBEIYY1-190ER+40LSFYY1	   48	  in cells bearing the RBEIII/YY1 LTR mutation (Figure 3.6, RBEIII). Interestingly, the amount of YY1 bound near the transcription start site was also decreased by approximately one half when the upstream RBEIII/YY1 site was mutated. This indicates that there may be cooperative binding between the RBEI/transcription start site and the RBEIII site.  Figure 3.6: Mutations at RBEIII prevent binding of YY1 in Jurkat-tat cells.  A representative pool of cells infected with the wild type and RBEIII/YY1 mutant reporter virus were sorted for GFP+ cells and used for ChIP analysis with YY1 antibody. (Top) the core RBEIII sequence is shown in red and substitutions in the RBEIII/YY1 mutant indicated in lowercase. (Bottom) Representative pools of cells infected with the wild type reporter virus or mutant RBEIII cell lines were used for ChIP analysis with YY1 antibody, using the primer sets indicated in Figure 3.5.  Error bars represent the standard deviation. ** represents P values ≤ 0.01.  3.4 YY1 does not bind near RBEI or RBEIII in stimulated cells  	   YY1 was previously shown to interact with LSF near the transcription start site where it contributes to repression of transcription from the HIV-1 LTR (101). Consequently, I examined whether binding of YY1 to the elements flanking the enhancer was affected in stimulated T-cells. Phorbol-12-myristate-13-acetate (PMA) causes activation of T-cells 00.10.20.30.40.5RBEIII ER RBEI% Inputwt LTR:    ACTGCTGACATCGAGmt RBEIII: ACTGCactCATCGAG** ******	   49	  by stimulating the RAS-MAPK and PKC-IKK pathways downstream of the T-cell receptor, which causes activation of transcription from the HIV-1 LTR by the GABP/ Ets, AP1 and NF-kB transcription factors (171). Accordingly, PMA treatment of Jurkat-Tat cells infected with the wild type HIV-1 LTR-dsRed reporter mini-virus (Figure 3.4) causes induction of dsRed expression as detected by FACS analysis (Figure 3.7A). Using ChIP, I examined binding of YY1 to the HIV-1 LTR in activated and resting cells (Figure 3.7B).    Figure 3.7:YY1 dissociates from the HIV-1 LTR in stimulated Jurkat-tat cells. Panel A: Flow analysis of the untreated control (left) and PMA (right) induced cells bearing integrated pTY-LAI-dsRed reporter mini-virus. Expression of eGFP is indicated on the x-axis and dsRed expression on the y-axis. Panel B: Representative clones of cells infected with the wild type reporter virus and sorted for GFP+ cells were induced with PMA (white bars) or untreated (control, black bars) were used for ChIP analysis with YY1 antibody, using the primers indicated in Figure 3.5. * represents P values ≤ 0.05, ** represents P values ≤ 0.01, *** represents P values ≤ 0.001. 00.10.20.30.40.50.6RBEIII ER RBEI% InputControlPMAA*** ****  *0 102 103 104 105()њeGFP0102103104105 0 12.75829.20 102 103 104 1050102103104105 0.976 89.74.714.58Control PMAB/75dsRed	   50	  I found that association of YY1 with the LTR was decreased by approximately 6-fold at the RBEIII site in cells stimulated with PMA. Binding of YY1 near the transcription start site was also decreased significantly in cells treated with PMA. This indicates that YY1 must become dissociated from the HIV-1 LTR to allow transcriptional activation, and supports its role as a repressor in establishment of latent proviral populations. To determine if the loss of YY1 at the HIV-1 LTR was due to an alteration in YY1 stability or expression, I performed Western blots on untreated and PMA treated cells, but did not observe a change in YY1 abundance between the two populations (Figure 3.8). This indicates that dissociation of YY1 from its binding sites on the HIV-1 LTR is likely caused by a post-translational modification of YY1 rather than targeted degradation. Consistent with this notion, it was shown previously that acetylation in the zinc fingers of YY1 decreases its binding to DNA (90). It is possible other transcription factors such as LSF may be modified in stimulated cells to decrease its bingind to DNA at RBEI or association with YY1.    Figure 3.8: YY1 expression does not change in stimulated versus unstimulated cells.  Immunoblots of control and PMA induced Jurkat-tat cell lysates with YY1 antibody. Also shown is GAPDH loading control.   Upon infection of unstimulated cells with the double reporter mini-virus, we find that the majority of cells expressing GFP (indicating viral integration) do not express dsRed from the LTR promoter, indicating early transcriptional latency. The remaining cells of Control PMAњ<<њ*$3'+	   51	  the infected population are found to express various levels of dsRed (Figure 3.9). Considering the results shown above, indicating that YY1 is dissociated from the LTR in stimulated cells, I wondered whether YY1 would be associated with the LTR in unstimulated cells containing virus that had remained transcriptionally active after infection.    Figure 3.9: Jurkat-tat cell infected with virus pTY-LAI-dsRed reporter mini-virus. The x-axis shows eGFP expression, which indicates infection rate. Cell only expressing eGFP (green box) are silently infected, not expressing the HIV-1 LTR. The y-axis shows expression of dsRed, which indicates active LTR. Double positive (red box) indicate infected cells with actively expressing virus.  For this experiment, I infected cells with the double reporter mini-virus and used FACS to sort out infected cells with active LTR transcription (GFP and dsRed positive cells) and infected cells without LTR expression (GFP only) (Figure 3.10A). Since we used an HIV-1 mini-virus that does not express most of the viral gene products which can cause cell toxicity, we were able to expand these two cell populations in order to analyze and compare YY1 binding to the LTR by ChIP. The amount of YY1 present on the HIV-1 LTR at both the RBEIII site and the transcriptional start site in cells expressing only 0 102 103 104 105()њeGFP0102103104105 0 12.75829.2/75dsRedActiveInfected	   52	  GFP, with an inactive LTR, was approximately 5-fold higher than the amount of YY1 present on the active LTR in the double positive (GFP and dsRed positive) cells (Figure 3.10B). This indicates that YY1 is not present on the HIV-1 LTR in cells that have established active HIV-1 infections, and supports a view that association of YY1 with the LTR has an important role in negatively regulating the HIV-1 LTR when bound at both positions.   Figure 3.10: YY1 is not bound to actively transcribed HIV-1 LTR in unstimulated cells.  Panel A: A representative population of cells infected with the wild type reporter virus was sorted using by FACS and populations of cells expressing only eGFP (green) or both eGFP and dsRed (red) were collected and expanded in culture. Panel B: ChIP analysis was performed on the expanded populations of cells expressing eGFP (green bars) or both eGFP and dsRed (red bars) using YY1 antibodies and the primer sets as described in Figure 3.5. ** Represents P values ≤ 0.01, *** represents P values ≤ 0.001. 00.050.10.150.2RBEIII ER RBEI% InputGFPdsRed/GFP**********0.196 0.8165.6793.3dsRed/GFPGFPAB01021031041050 102 103 104 105	   53	  3.5 TFII-I is constitutively bound to the HIV-1 LTR in both unstimulated and stimulated cells 	   TFII-I was previously shown to bind to the RBEIII and RBEI sites in association with USF1/2 (52, 53). TFII-I was shown to bind nucleotides on the HIV-1 LTR overlapping those I have identified for binding of YY1 (192). I used ChIP to examine the effect of the triple mutation at RBEIII (Figure 3.11), shown above to cause dissociation of YY1, for binding of TFII-I to the LTR. Interestingly, the mutation caused a 10-fold decrease in association of TFII-I binding to the mutant RBEIII LTR, at both the upstream RBEIII element and at the RBEI site near the transcriptional start (Figure 3.11). This is similar to what was observed with binding of YY1 to the LTR and suggests that there may be cooperative binding of these factors for these sites or mutation of this site may be disrupting binding of a larger complex.   Figure 3.11: TFII-I does not bind to the RBEIII mutant.  A representative pool of cells infected with the wild type (black bars) and RBEIII/YY1 mutant (white bars) reporter virus were used for ChIP analysis with TFII-I antibody.  The primers used are specific for RBEIII, the enhancer region (ER) and the RBEI site as described in Figure 3.5. ** represents P values ≤ 0.01.   ****** **0.000.050.100.150.200.250.300.350.40RBEIII ER RBEI% Inputwt LTRmt RBEIII	   54	  Since YY1 is associated with the HIV-1 LTR in unstimulated cells, and TFII-I binds the same site as YY1, I wanted to see if TFII-I binds under the same conditions as YY1. I examined association of TFII-I with the LTR in unstimulated cells, and cells stimulated with PMA (Figure 3.12). Unlike YY1, TFII-I was bound to the HIV-1 LTR in both stimulated and unstimulated cells at both the RBEI and RBEIII sites, consistent with previous observations (192). Consequently, because it is constitutively present on the HIV-1 LTR, TFII-I may play a role in both repression and activation of transcription, unlike YY1 whose association with the LTR is primarily consistent with the function of a transcriptional repressor.   Figure 3.12: TFII-I binds to RBEIII constitutively. A representative clone of cells infected with the wild type reporter virus was induced with PMA or left untreated (control) and used for ChIP analysis with TFII-I antibody, and the primers specific for RBEIII, the enhancer region (ER) and the RBEI site as described in Figure 3.5. * represents P values ≤ 0.05, ** represents P values ≤ 0.01.  3.6 YY1 over-expression prevents reversal of latent HIV-1 infection 	   To further examine the role of YY1 in causing the immediate repression of HIV-1 expression in infected cells, I examined the effect of over-expressing YY1 in Jurkat-Tat 0.000.050.100.150.200.25RBEIII ER RBEI% InputControlPMA***	   55	  cells. For these experiments I transfected Jurkat-Tat cells with expression plasmids producing wild type YY1 (pEFlag-YY1) and a YY1 mutant bearing a deletion of the glycine/alanine/lysine rich region of YY1, shown to interact with HDACs (102) (pEFlag-g/a/k), and a vector control (pEFlag) (Figure 3.13).    Figure 3.13: Overexpression constructs schematic.  Schematic representation of expression constructs: wild type YY1 (YY1), a YY1 deletion mutant lacking the HDAC1 interaction (glycine/alanine/lysine) rich regions (g/a/k) and vector control (pEFlag) used to produce stable cell lines. Indicated are a histidine rich region (His), the glycine/alanine (GA) and glycine/lysine (GK) rich regions, and the zinc finger domains (ZF) DNA binding domain.   Stably transfected lines were isolated by selection with zeocin. Over-expression of wild type YY1 and the YY1 g/a/k mutant was verified by immunoblotting with α-Flag (Figure 3.14).   Figure 3.14: Immunoblot of YY1 overexpression constructs.  Immunoblot of cell extracts from stable lines transfected with the YY1 (lane 1), g/a/k YY1 mutant (lane 2) and vector control (lane 3) blotted with Flag antibody.  ZFZF ZF ZFGA GKHisYY1 FlagZFZF ZF ZFHisFlagFlagpEFlagYY1 mt g/a/k  YY1   g/a/k  pEFlag     1        2         3 	   56	  When analyzed by ChIP, both the wild type YY1 and the YY1 g/a/k mutant bound to the RBEI and RBEIII sites (Figure 3.15).    Figure 3.15: ChIP of YY1 overexpression constructs.  ChIP was performed on pools of stably transfected cells overexpressing YY1, the g/a/k YY1 mutant or the vector control, infected with the wild type reporter virus using Flag antibody and the primer sets as described in Figure 3.5. * Represents P values ≤ 0.05, ** represents P values ≤ 0.01, *** represents P values ≤ 0.001, represents P values ≤ 0.0001.  The cell lines stably expressing the YY1 constructs were infected with the HIV-1 double reporter mini-virus. GFP and dsRed expression was analyzed by flow cytometry every 24 hours for the first four days, and once a week thereafter for a month. The percent of infected cells with actively transcribed virus was calculated as a percent of dsRed expression relative to the total GFP-expressing population. Approximately 5% of infected cells with the vector control express dsRed 24 hours post infection. This proportion of cells with actively transcribing virus rises to ~20-25% within a week and remains stable for at least a month (Figure 3.16, pEFlag). In cells overexpressing the YY1 g/a/k deletion mutant, the result is nearly identical to cells bearing the vector 0.000.100.200.300.40RBEIII ER RBEI% Input YY1g/a/kpEFlag*********************	   57	  control, where ~5% of infected cells express dsRed one day post infection, a proportion which increases to 20-25% after a week (Figure 3.16, g/a/k). In contrast, with the cells over-expressing YY1, although ~5% of infected cells express dsRed at one day post infection, nearly identical to the control cells, this proportion does not increase throughout the course of culturing these cells for a month (Figure 3.16, YY1). This supports the notion that YY1 plays an important role in repression of the LTR to produce latently infected cells. These results suggests that YY1’s role in repressing transcription from the HIV-1 LTR and establishment of latency early after infection may involve its function in recruiting histone deacetylases.   Figure 3.16: YY1 overexpression increases the proportion of virus that maintains latent infection.  Stably transfected cells overexpressing YY1, the g/a/k YY1 mutant or the vector control were infected with the wild type pTY-LAI-dsRed reporter virus construct. Flow analysis was performed every 24 hours for 4 days and every week for a month post infection. The % active infection was calculated by dividing the number of cells with active HIV-1 LTR (eGFP and dsRed expressing cells) by the number of infected cells (total eGFP expressing cells) and multiplying by 100.  05101520253035400 10 20 30Active Infection (%)YY1 Gly/Ala pEFlagDays	   58	  3.7 Discussion 	   This chapter describes the identification of a novel upstream binding site for YY1 on the HIV-1 LTR. YY1 was one of the first host cell transcription factors demonstrated to be involved in repression of the HIV-1 LTR. It was shown that YY1 interacts with another transcription factor LSF, which binds near the transcription start site (101). More recently YY1 was shown to function in transcriptional repression at this location by recruitment of HDAC1 (102). We previously observed YY1 in complexes from Jurkat nuclear extracts using EMSA reactions with probes spanning the highly conserved upstream RBEIII element (53, 58). I have extended this observation by identification of a novel YY1 binding site that overlaps RBEIII at approximately 130 base pairs upstream from the transcriptional start site. Using EMSA I identified specific nucleotides for direct binding of YY1 to the LTR and have shown using ChIP that mutation of these residues inhibit interaction of YY1 with the HIV-1 LTR promoter in vivo. Interestingly, this upstream binding site for YY1 overlaps the previously described highly conserved RBEIII element, which binds a complex of factors that include USF1, USF2 and TFII-I (designated RBF-2) (53). Nucleotides required for interaction of YY1 are located at the 3’ end of the core RBEIII sequence and include a -CAT- sequence, which was previously shown to be present as a core sequence for binding of YY1 to elements on other promoters (91, 187-189). In fact, the binding site for YY1 I identified in vitro seems to completely overlap that for the RBF-2 co-factor TFII-I (192). However, I found that YY1 is dissociated in cells stimulated with PMA, whereas TFII-I remains constitutively bound in both unstimulated and stimulated cells.  	   59	  The cis-element designated RBEIII was initially identified because of its high conservation on the HIV-1 LTR from patient samples (51) and its requirement for stimulation of LTR transcription by Ras-MAPK signaling (44). Including the results shown here, this region of the HIV-1 LTR, immediately upstream of the enhancer, seems abundantly crowded with multiple factors that bind overlapping elements. USF1/2 binds the ACTGCTGA core RBEIII sequence (53), but only in association with TFII-I, which likely contacts the immediately adjacent CATC residues (192). This 3’ flanking sequence overlaps residues important for binding of YY1 in vitro as described in this chapter (Figure	  3.17). However, I note that overlapping interactions of multiple transcription factors is not without precedent for the HIV-1 LTR. For example, NF-kB and NFAT bind to identical sequences within the enhancer region and these elements overlap binding sites for GABP/ Ets as well as CBF-1 (171). At present, we have not established whether USF1/2 in combination with TFII-I and YY1 can interact at RBEIII simultaneously or whether binding is mutually exclusive. If the latter is true, then it is possible that populations of latent HIV-1 may bind different combinations of factors at this location. As further complication, it was recently shown that HIV subtypes A and C have sequence polymorphisms 3’ flanking the RBEIII site (TGACAca, Figure	  3.17) that form an overlapping AP1 binding site. Based on my studies YY1 should also bind to these two subtypes, which indicates that YY1 and AP1 may have cooperative or redundant roles in repressing the HIV-1 LTR. AP1 was shown to modulate latency upon initial infection, and a deletion of this region in HIV-1 subtype AE causes a decrease in the frequency of latent infection (193), which is consistent with the role of YY1 bound to this region in 	   60	  establishment of latency. These observations might indicate that establishment of latency by different HIV subtypes might involve differing combinations of mechanisms.    Figure 3.17: Multiple transcription factors, including YY1, directly bind near the conserved RBEIII element.  The RBEIII sequence (red) and flanking sequences are shown, indicating the positions bound by USF1/2, TFII-I and YY1. Sequence variations observed in HIV-1 subtypes LAI-B (pTY-LAI-dsRed), LAI-A, LAI-C and LAI-AE are indicated. A binding site for AP1 identified in subtypes A and C is indicated (193).  I found that a mutation that prevents binding of YY1 in vitro at RBEIII also causes a decrease in occupancy of YY1 at both the RBEIII site and near the transcription start site in vivo. A similar effect was observed with TFII-I, which shows a loss of binding at RBEI when RBEIII is mutated. I expect that this may represent cooperative DNA binding between these factors, and consequently this might produce interaction between proteins bound to the two sites resulting in a higher order “loop” of DNA structure (Figure	  3.18). In support of this possibility, YY1 has been shown to bend DNA in vitro (194, 195). Therefore, it is possible that looping between the core promoter and RBEIII site may be representative of a repressive state on the LTR (171). I tried to examine this directly using chromatin conformation capture (3C) but this proved to be technically challenging because of the relatively close spacing between these sites.       LAI - B  - TTCAAGAACTGCTGACATCGAGCTTGCTAC      LAI - E  - ACAAAGGA............AGTTTC.TAA      LAI - AE - TACAAAGACTGCTGACACAGAAGTTGCTGA      LAI - C  - TACAAAGACTGCTGACACAGAAGGGACTTTTFII-IUSFYY1AP1	   61	    Figure 3.18: Proposed ‘looping’ DNA structure possibly created by YY1 binding and/or RBF2 complex binding at RBEI and RBEIII.  (top) YY1 and RBF2 complex (TFII-I, USF1/2) are shown where they bind to RBEI and RBEIII. (bottom) The ~150 base pair (bp) loop formed between co-operative binding between RBEI and RBEIII.  The possibility of higher order structure proposed from this research may not be exclusive to the HIV-1 LTR. There are many viral promoters that contain multiple YY1 binding sites. Also, the role of YY1 in controlling viral latency of the HIV-1 virus seems to extend to other latent viral promoters. There are a number of viruses that form latent infections where YY1 is involved in repression, including but not limited to adenovirus (94), Epstein Barr virus (95), cytomegalovirus (196) and human papilloma virus (99). Most of these contain multiple YY1 binding sites in critical promoters where one of the sites is positioned at the transcription start site and another is upstream. All of these viral promoters contain the core -CAT- YY1 binding sequence, however the upstream YY1 binding sites seem to have more similarity to the site seen at RBEIII (-TGACAT-). For example, the major late adenovirus promoter YY1 binding site is -GACAT- (94), the Epstein barr BRLF1 promoter YY1 binding site is -TGACAT- (190), the cytomegalovirus major immediate early promoter YY1 binding site is -GACAT- (196) RBEIII RBEI1/2TFII-IYY1YY1 LSFTFII-IRBEIII1/2 YY1LSFUSF1/2RBEI Loop ~ 150 bp USF1/2USF1/2 USF1/2	   62	  and the human papilloma virus 16 contains multiple YY1 binding sites in the P97 promoter, all containing the sequence -ACAT- (191). YY1 is a ubiquitously expressed transcription factor that can cause activation or repression of transcription depending on the promoter context. My results extend upon earlier observations indicating that YY1 has a repressive role for HIV-1 transcription (82, 101, 102) and that this factor is a critical determinant for establishment of latency early after infection. YY1 is bound to the LTR, at both the RBEIII and core promoter (RBEI) in unstimulated cells and is dissociated upon stimulation with PMA. Because the amount of YY1 was not reduced in activated cells, dissociation from the LTR may be caused by a post-translational modification, perhaps acetylation of the C-terminal zinc fingers on YY1, which was previously shown to inhibit DNA binding (90).  After infection of unstimulated Jurkat-Tat cells with the dual reporter virus, I found that 5% of the cells show expression from the LTR one day post infection, and this increases to ~ 30% after one week post infection. The proportion of infected cells that actively transcribes the LTR does not change for at least a month in culture. Because I used a mini-virus reporter, which does not express the viral accessory factors, whose expression causes cellular toxicity (197, 198), I was able to separately expand the populations of cells that actively transcribed the LTR and those that harbor latent provirus for ChIP analysis. In this experiment, I found that YY1 is associated with the LTR in the population of cells where the LTR is repressed, but not in the cell population where expression from the LTR has remained active. These results are consistent with previous studies showing a role for YY1 occupancy on the HIV-1 LTR as a contributing mechanism for repression (102, 116) and may suggest that the post-translational state of 	   63	  YY1 at the time of infection may influence establishment of latency. The role of YY1 in controlling HIV-1 latency likely involves recruitment of HDAC1, because overexpression of a YY1 mutant lacking the HDAC1 interaction domain (glycine/alanine/lysine rich region) did not affect the proportion of infected cells that remain latent over the course of one month culture (Figure	  3.16).  The results presented in this chapter suggest that binding of YY1 may cause the formation of higher order structures on the LTR between the upstream RBEIII and transcriptional start site that may be involved in LTR repression, and that YY1 may be a potential target for reactivating the HIV-1 provirus in asymptomatic patients. When the HIV-1 LTR is repressed the cells harboring the provirus are latent and can become active upon stimulation. Since current HIV-1 therapies target only the actively replicating virus there is a need for ways to target this latent population. Currently, strategies to reactivate HIV-1 provirus in latently infected cells are being pursued for eradicating this latent virus population. Drugs that target repressive chromatin are a potential strategy because several such compounds, including HDACi seem to be capable of reactivating latent HIV, without significant toxicity or causing T-cell activation. In Chapter 4, I will discuss the small molecule chaetocin, an inhibitor of histone 3 lysine 9 trimethylation, which I found to also be capable of activating of latent HIV-1 provirus.    	   64	  CHAPTER 4: REACTIVATING LATENT HIV-1 WITH CHAETOCIN  4.1 Introduction 	   During HIV-1 infection, a population of latently infected cells becomes established in unstimulated CD4+ T-helper cells, which are not affected by current anti-viral therapies (199). A variety of strategies have been considered to force expression of latent HIV with the objective of “purging” this otherwise impenetrable infection (149) including the use of histone deacetylase (HDAC) inhibitors to cause remodeling of nucleosomes at the LTR and force increased expression (153-155, 200). Methylation at histone H3 lysine 9 (H3K9) is associated with repressive heterochromatin, which must be removed to allow transcription. This can be encouraged by treatment with histone methyltransferase inhibitors. Chaetocin is a fungal metabolite that has been linked to chromatin modification, and was identified as an inhibitor of the methyltransferase SU(VAR)3-9 from Drosophila melanogaster (201). This compound was recently shown to have anti-cancer activities related to its ability to cause re-expression of tumor suppressor genes (202). These findings prompted me to investigate whether chaetocin could also cause reactivation of latent HIV-1.  When I initiated this work, there had been two other recent studies examining the effect of methyltransferases on HIV provirus expression. In one paper it was shown that inhibition of H3K9 dimethylation, catalyzed by G9a, using BIX01294 could activate the HIV-1 LTR (122). Another study showed that inhibition of H3K27 trimethylation by Zeste could also activate the HIV-1 LTR (123). The goal of this work described in this chapter was to examine whether chaetocin could also cause activation of HIV-1 proviral LTR expression by inhibiting the methyltransferase SUV39H1, which causes H3K9 trimethylation.  My results show that chaetocin is 	   65	  capable of activating transcription from the latent HIV-1 LTR, and I show that activation is accompanied by a loss of H3K9 tri-methylation, and a corresponding increase in H3 acetylation. I also show that chaetocin causes an increase of TBP binding to the LTR core promoter, but does not affect binding of NFκB to the enhancer. I also found that chaetocin does not cause global T-cell activation, as measured by IL-2 and CD69 expression. Furthermore, treatment of Jurkat cells with chaetocin was found to produce a synergistic effect for induction of HIV expression, in combination with the HDACi TSA and SAHA. These results indicate that chaetocin, or compounds with similar targets, in combination with other HIV-1 LTR activating compounds could be used as a therapy to target latently infected cells. 4.2 Chaetocin can activate an HIV-1 luciferase reporter mini-virus 	   To examine whether chaetocin was capable of activating the HIV-1 LTR, I used a Jurkat T-cell line containing an integrated HIV-1 reporter mini-virus with luciferase expressed from the 5’ LTR as an in-frame fusion with p24gag (pTY-LAI-luc) (Figure 4.1).    Figure 4.1: Schematic representation of the pTY-LAI-luc reporter virus.  The 5’ LTR controls expression of a p24 capsid-luciferase fusion. The E1Fα promoter constitutively expresses eGFP.  Chaetocin was added at increasing concentrations, and the relative luciferase activity was measured at various time points. I observed some induction as early as 4 ·/75 ()њ ·/75/XFLIHUDVH H*)3S&DSVLG	   66	  hours post-treatment and peak induction of 25-fold at 8 hours, which was sustained for up to 12 hours of treatment over a concentration range of 12 - 100 nM (Figure 4.2).   Figure 4.2: Chaetocin activates an integrated HIV-1 minivirus.  Jurkat cells with the integrated pTY-LTR-luc mini-virus were left untreated (0 Hours) or stimulated with chaetocin at the indicated concentrations on the x-axis. Luciferase activity was measured after 4, 8, 12 or 24 hours and shown on the y-axis.  4.3 Chaetocin is not toxic to Jurkat cells 	   Chaetocin was previously shown to have potent anti-myeloma activity (203). Consequently, to ensure that chaetocin is not toxic to T-cells at concentrations required for HIV-1 LTR activation I measured viability of cells treated with this compound using PI staining. At 50 nM chaetocin, which was the concentration I observed maximal HIV LTR activation, I found limited cell toxicity (~7%) by PI staining (Figure 4.3). However, there is also a large decrease in activation at 100 nM indicating that this concentration is toxic to the cells. At concentrations higher than 100 nM the proportion of death in chaetocin treated cells increases to drastically 15% at 200 nM and 30% at 400 nM.  05101520253035400 12 25 50 100Fold-Induction[Chaetocin] (nM)  0 Hours  4 Hours  8 Hours12 Hours24 Hours	   67	    Figure 4.3: Chaetocin is not toxic at concentrations required for HIV-1 LTR activation. Cells were stimulated with chaetocin at the indicated concentrations on the x-axis. The percentage of cell death was measured by PI and Hoechst staining.  4.4 H3K9 trimethylation is down-regulated and acetylation is up-regulated in Jurkat cells exposed to Chaetocin 	   Chaetocin was previously shown to inhibit H3K9 trimethylation (202, 204). To corroborate this, I wanted to examine Jurkat cells treated with chaetocin to see if H3K9 trimethylation was decreased on the HIV LTR. For this, I used chromatin immunopreciptiation (ChIP) with specific anti-H3K9me3 antibodies, and found that the ratio of trimethylation at H3K9, relative to total histone H3 at the LTR, was decreased by 70% in cells that were induced with chaetocin for 8 hours (Figure 4.4).  1520253035400 10 100 1000[Chaetocin] (nM)(log scale)Fold-InductionCell Death (%)11050	   68	   Figure 4.4: Chaetocin affects histone methylation on the HIV-1 LTR.   Cells were left untreated or induced with 100 nM chaetocin for 8 hours. ChIP analysis was performed with trimethyl-H3K9 antibodies and H3 antibodies. The error bars represent the standard deviation and ** represents p values < 0.005.  In contrast, histones associated with the LTR in unstimulated cells are relatively not acetylated, but acetylation at H3K9 increases by 90% after 8 hours treatment (Figure 4.5). The finding that chaetocin decreases H3K9 trimethylation, which is accompanied by an increase in acetylation, suggests that this compound causes significant reorganization of chromatin at the LTR.      00.20.40.60.81.01.2Control ChaetocinH3K9Trimethyl/H3**	   69	   Figure 4.5: Chaetocin affects histone acetylation on the HIV-1 LTR.   Cells were left untreated or induced with 100 nM chaetocin for 8 hours. ChIP was performed with acetyl-H3K9 antibodies and H3 antibodies. Error bars represent the standard deviation and ** represents p values < 0.005.  4.5 Binding of NFκB p65 is not increased at the LTR in chaetocin treated cells 	   The activator NFκB plays a significant role for induction of genes downstream of the T-cell receptor (TCR) and is an important transcription factor involved in HIV-1 expression (58). In T-cells, PMA treatment causes translocation of NFκB p65 relA into the nucleus where it binds TCR-responsive gene promoters, including the LTR promoter in HIV-1 infected cells (58). For the “shock and kill strategy” to reactivate latent HIV-1 provirus, it will be important to avoid a corresponding activation of the T-cell response, because global T-cell activation causes considerable toxicity (205). Consequently, I wondered whether NFκB is involved in induction of the LTR in chaetocin-treated cells. Using an NFκb p65 antibody I used ChIP to analyze the amount of NFκb bound to the LTR in untreated and PMA treated cells, and found that, the amount present on the HIV-1 LTR increased by 70% in cells treated with PMA. However, NFκb p65 did not become associated with the LTR in cells treated with chaetocin (Figure 4.6). This suggests that chaetocin does not cause activation of HIV-1 expression through T-cell activation.   00.20.40.60.81.01.21.4Control ChaetocinH3K9 acetyl/H3**	   70	    Figure 4.6: Chaetocin does not affect NFκb binding on the HIV-1 LTR.   Cells were left untreated or induced with 100 nM chaetocin for 8 hours or 50 nM PMA. ChIP was performed with NFκb antibodies. Error bars represent the standard deviation and * represents p values < 0.01.  4.6 TATA binding protein increases at the HIV-1 LTR in chaetocin treated cells 	   Since chaetocin activates the HIV-1 LTR as measured by luciferase expression, I wanted to confirm this result by analyzing the presence of TATA-binding protein (TBP) at the LTR core promoter. I used TBP antibody for ChIP, and found that in contrast to NFκB p65, there was increased recruitment of TBP to the LTR promoter in cells treated with both chaetocin and PMA (Figure 4.7). TBP is part of TFIID, which binds to the TATAA box and is required for assembly of the general transcription factor (GTF) machinery at the core HIV-1 promoter (206). These results indicate that chaetocin must produce an environment on the LTR, which allows recruitment of the GTFs, and activation of transcription by mechanism(s) that bypass stimulation of NFκB. This is consistent with the finding that chaetocin causes loss of H3K9 tri-methylation and  00.20.40.60.81.01.2Control Chaetocin PMA% Input*anti-NF-kb	   71	  accumulation of H3K9 acetylation which indicates significant chromatin remodeling at the LTR.    Figure 4.7: Chaetocin affects TATA binding protein (TBP) binding on the HIV-1 LTR. Cells were left untreated or induced with 100 nM chaetocin for 8 hours or 50 nM PMA. ChIP was performed with TBP antibodies. Error bars represent the standard deviation, and *** represents p values < 0.001.  4.7 Chaetocin does not cause T-cell activation in Jurkat cells 	   As mentioned above, a problem with potential therapies that pursue the goal of activating latent virus is that general T-cell activation produces cytotoxic effects (205). Activated T-cells secrete cytokines such as IL-2, which plays a pivotal role in the immune response. T-cell activation is also characterized by increased surface expression of CD69, which acts in T-cell proliferation and signaling (207). Since chaetocin did not activate the NFκb pathway, I suspected that this compound was not activating the T-cell response. However, I wanted to confirm this observation by directly testing the induction of IL-2 and CD69 in Jurkat cells treated with chaetocin. PMA, SAHA and chaetocin were examined for their effect on IL-2 induction using ELISA. In these experiments I observed 00.10.20.30.40.5Control Chaetocin PMA% Input******anti-TBP	   72	  induction of IL-2 in Jurkat cells treated with PMA, but not in cells treated with chaetocin or SAHA (Figure 4.8).    Figure 4.8: Chaetocin does not cause T-cell activation as measured by IL-2 production.   Cells were induced with PMA for 4 hours, chaetocin for 8 hours and/or SAHA for 8 hours. IL-2 expression in the supernatant was determined by ELISA and is shown on the y-axis. Some of the samples contained IL-2 expression that was too low (<15 pg/mL) for detection were not detectable (ND).   To examine induction of CD69, I used a fluorescently labeled CD69 antibody for flow cytometry. Similar to what I observed for IL-2 expression, I found an increase in CD69 expression in PMA treated cells, but not in cells treated with chaetocin or SAHA (Figure 4.9). This indicates that chaetocin and other chromatin remodeling drugs such as SAHA are capable of inducing HIV-1 expression without causing global T-cell activation. Activated T-cells undergo a variety of morphological changes including decreased aggregation and adherence to the substratum (207).  020406080100120140160IL-2 production (pg/mL)ND ND NDNDND < 15 pg/mL   -     +     -      -     -         -     -     +      -     +         -     -     -      +     +PMAChaetocinSAHA	   73	   Figure 4.9: Chaetocin does not cause T-cell activation as measured by CD69 expression.   Cells were induced with PMA for 4 hours, chaetocin for 8 hours and/or SAHA for 8 hours. Surface expression of CD69 was measured with CD69 antibodies conjugated to R-phycoerythrin (PE) by flow cytometry.   I observed such an effect by microscopic examination of Jurkat cells treated with PMA, where after 2 hours of treatment the cells became dispersed, flattened out and attached to the plate (Figure 4.10). However, I did not observe these effects in cells treated with chaetocin (Figure 4.10).    Figure 4.10: Chaetocin does not cause clumping of Jurkat T-cells.  Photographs were taken after 2 and 4 hours treatment with 50 nM PMA, 50 nM chaetocin or 100 nM chaetocin.  0100200300400500Mean Fluoresence Intensity of CD69    -    +    -    -    -         -    -    +    -    +         -    -    -    +    +PMAChaetocinSAHANegative2 Hours PMA   50 nM Chaetocin  100 nM Chaetocin4 Hours	   74	  4.8 Chaetocin acts synergistically with the HDAC inhibitors TSA and SAHA 	   Chromatin remodeling drugs have been used to activate the HIV-1 LTR in previous studies (114, 154). Since chaetocin seems to cause activation of HIV-1 expression by a mechanism involving chromatin remodeling, we examined whether it produced synergistic effects with other chromatin remodeling drugs. Histone acetylation is a marker of active chromatin, and is increased on the activated HIV LTR (114, 149, 171). The HDACi TSA and SAHA were also previously shown to cause some induction of integrated HIV-1 LTRs (149). Consistent with this, I found that TSA on its own increased expression of the HIV LTR in cells bearing integrations of the pTY-LAI-luc minivirus by 10-fold, at a concentration of 130 nM (Figure 4.11). The effect of TSA was significantly enhanced in combination with 50 and 100 nM chaetocin, where I observe 40 and 90-fold induction, respectively (Figure 4.11A and B).  	   75	   Figure 4.11: Chaetocin causes synergistic activation of the HIV-1 LTR with TSA.  Panel A: Fold induction of luciferase expression was measured in cells treated with TSA at the indicated concentrations alone and in combination with 50 nM and 100 nM of chaetocin. Panel B: Fold induction of luciferase expression was measured in cells treated with SAHA alone and in combination with 50 nM or 100 nM chaetocin. *** represents p values < 0.0005.  Importantly, chaetocin in combination with TSA caused minimal toxicity at concentrations that produce peak induction (Figure 4.12).    A0204060801001200 10 100 1000Fold Induction[TSA] (nM)0 nM Chaetocin50 nM Chaetocin100 nM Chaetocin(log scale)Chaetocin (nM)    0      50     50    100   100TSA (µM)            0.5       0     0.5      0     0.5020406080100120Fold-Induction************B	   76	   Figure 4.12: Chaetocin in combination with TSA is not toxic.  Cell death caused by TSA alone or in combination with 50 nM or 100 nM of chaetocin was determined with PI and Hoechst staining.    Similarly, SAHA on its own caused 14-fold induction at a concentration of 25 µM (Figure 4.13), but I observed 80-fold induction of transcription from the LTR with 100 nM chaetocin in combination with 6.25 µM of SAHA (Figure 4.13A and B).  Treatment with SAHA and chaetocin in combination caused minimal toxicity at concentrations that produce peak induction (Figure 4.14). Higher concentrations of SAHA at 100 µM causes 20% cell death, but this effect is not exaggerated by chaetocin (Figure 4.14). Induction by chaetocin in combination with TSA and SAHA appears to be synergistic, as 100 nM chaetocin in combination with 0.5 µM TSA or 6.25 µM SAHA produces 80-fold induction, whereas these compounds alone cause less than 20-fold stimulation (Figure 4.11 and 4.13).    02468100 10 100 1000Cell Death (%)[TSA] (nM)    0 nM Chaetocin  50 nM Chaetocin100 nM Chaetocin(log scale)	   77	   Figure 4.13: Chaetocin causes synergistic activation of the HIV-1 LTR with SAHA. Panel A: Fold induction of luciferase expression was measured in cells treated with SAHA at the indicated concentrations alone and in combination with 50 nM and 100 nM of chaetocin Panel B: Fold induction of luciferase expression was measured in cells treated with 6.25 µM and 25 µM of SAHA alone and in combination with 50 nM or 100 nM chaetocin. ** represents p values < 0.005, and *** represents p values < 0.0005.   Chaetocin (nM)  0      50      50      0     100    100  SAHA (µM)         25     0        25    6.25    0     6.25************020406080100Fold-InductionAB0204060801000 1 10 100Fold-Induction[SAHA] (µM)    0 nM Chaetocin  50 nM Chaetocin100 nM Chaetocin	   78	   Figure 4.14: Chaetocin in combination with SAHA is not toxic at low concentrations. Cell death caused by SAHA alone or in combination with 50 nM or 100 nM of chaetocin was determined with PI and Hoechst staining.   4.9 Chaetocin causes a slower and weaker response of transient HIV-1 LTR templates 	   In contrast to the above results, I found that an HIV-1 LTR reporter gene introduced into Jurkat T-cells by transient transfection was induced more slowly and to less significant levels, such that I only observed 2-fold induction after 72 hours of treatment (Figure 4.15). It is well documented that transiently transfected reporter genes do not become properly assembled into chromatin (208). Consequently this result supports the view that chaetocin causes activation of the LTR by mechanism(s) which promote formation of transcriptionally permissive chromatin on the integrated virus.  05101520253035400 1 10 100Cell Death (%)[SAHA] (µM)    0 nM Chaetocin  50 nM Chaetocin100 nM Chaetocin(log scale)	   79	   Figure 4.15: Chaetocin produces a weaker and slower response with a transiently transfected HIV-1 reporter.   Jurkat cells were transfected with an HIV-1 LTR-luciferase reporter, and cells were left untreated or treated with PMA (50 nM) or chaetocin (100 nM) for 24, 48 or 72 hours.  Fold induction of luciferase is indicated; ** represents p values < 0.005, and *** represents p values < 0.005.  4.10 Discussion 	   In this chapter I show that chaetocin, an inhibitor of SUV39H1, causes induction of an integrated HIV-1 mini-virus. Chaetocin is a fungal metabolite that was first recognized for its anti-myeloma activity (203) and later identified to inhibit the methyltransferase SUV39H1 (204). It was shown soon after that chaetocin was able to activate tumor suppressor genes in acute myelogenous leukemia (202). Since current HIV-1 therapies only target the actively replicating viral populations there has been a move towards purging the latent HIV-1 viral population as a therapy in order to eliminate the virus from patients. Targeting repressive chromatin is one current strategy of this type, since these drugs do not usually cause global T-cell activation. I was interested in chaetocin for this purpose since it was previously shown to activate tumor suppressor genes through 01234Control PMA ChaetocinFold-Induction24 Hours48 Hours72 Hours********** **	   80	  chromatin modifications, mainly through inhibition of the repressive H3K9 trimethylation. Using a luciferase reporter mini-virus I showed that chaetocin can activate the latent proviral HIV-1 LTR. The effect is observed within 8 hours post-treatment and occurs without producing global T-cell activation. Chaetocin produces a synergistic effect on HIV-1 expression in combination with HDACi. Induction is accompanied by loss of trimethylation at H3K9 and a corresponding increase in H3K9 acetylation. These results are similar to a previous study that shows chaetocin is capable of reactivating epigenetically silenced tumor suppressor genes through inhibition of SUV39H1 to produce a decrease in H3K9 trimethylation (202).  There have been two other studies describing the effect of chaetocin on HIV-1 expression. One study showed no significant effect of chaetocin on latent HIV-1 in a Jurkat cell line (123). I note that there are a few differences between the cell line used in this study and the cell line I used, in that the provirus was initially selected for latent infection, whereas my cell line was initially selected as integrated provirus independently of LTR expression, using an internal EIFα promoter. Viral integration sites in the two different cell lines are more than likely different, which has been shown to affect transcriptional activity (209). Indeed, when analyzing responses of various clones of cells bearing different integrations of my mini-virus reporter (Chapter 3), I found that the site of integration strongly influences response of provirus to signaling agonists as well as chromatin modifying compounds. Additionally, it was also shown that an shRNA directed against SUV39H1 caused a small induction of the LTR within a comparable time frame (123). Another more recent study showed that chaetocin induced HIV-1 in a 	   81	  Jurkat cell line, in addition to CD8+ depleted peripheral blood mononuclear cells and resting CD4+ T-cells isolated from HIV-1-infected patients on HAART (172). This study also showed that treatment of cells with chaetocin in combination with SAHA had a synergistic effect in some of the CD4+ cells from patients. T-cells normally become activated by T-cell receptor engagement during antigen presentation (207). This can be mimicked using agonists such as PMA, which stimulate T-cell responses, including enhanced cell adhesion and increased expression of IL-2 and CD69 (207). Cells stimulated with chaetocin and/or the HDACi SAHA do not exhibit these phenotypes. Stimulation of Jurkat cells with PMA causes activation of the HIV-1 LTR through NFκB (210). Consistent with the finding that chaetocin does not cause global T-cell activation, I found that NFκB p65 does not bind the LTR in chaetocin-treated cells. Chaetocin was shown to cause oxidative stress in myeloma cells (203), and oxidative stress of Jurkat cells also induces expression of HIV-1, apparently through activation of NFκB (211). Because we do not observe an effect of chaetocin on association of NFκB p65 with the LTR, it is possible that this compound does not produce a comparable stress response in the Jurkat cell line. TSA and SAHA were also shown to stimulate HIV-1 expression without NFκB activation (154, 155). The HIV-1 LTR is bound by numerous sequence-specific transcription factors that are present in unstimulated T-cells (186). It is well established that latent HIV-1 provirus is produced by repressive chromatin, which would normally preclude activation by these factors (149, 171). Consequently, it seems that chaetocin initiates extensive remodeling of chromatin at the LTR promoter to produce an environment that is permissive for binding of multiple transcriptional activators that must 	   82	  be active in unstimulated T cells. Effective treatment regimes typically involve combinations of drugs because of synergy, where lower concentrations can be used to decrease side effects. In this chapter I show that chaetocin produces synergistic effects on HIV-1 expression in combination with the HDACi TSA and SAHA. Several other histone methyltransferase inhibitors, including BIX1294 specific for G9a, and the broad-spectrum inhibitor DZNep, were also shown to act synergistically with SAHA to induce HIV-1 (122, 123, 172). SUV39H1 shRNA was shown to cause a small increase of HIV-1 expression, and this effect was activated synergistically with shRNA directed against the EZH2 methyltransferase (123).  The studies shown in this chapter support the view that combinations of histone methyltransferase inhibitors, including chaetocin, and HDACi may represent potential therapies for purging latent HIV-1 reservoirs. HDACi have been used briefly in patients in attempts to reactivate latent HIV-1 provirus. Valproic acid was administered to 4 patients on HAART for three months (153). In three out of the four patients they observed a significant decrease in HIV-1 replication competent CD4+ cells (153). SAHA (or Vornistat) was administered to eight patients, which resulted in an increase in H3 acetylation and a corresponding increase in HIV-1 RNA from resting cells, indicating successful viral purging (166). Most of these HDACi were previously identified and approved as cancer drugs, however to find new molecules, the typical approach is to screen libraries of small molecule compounds.  In Chapter 5 I discuss a novel approach towards development of potential latency reversing agents by screening for lariat peptide inhibitors of TFII-I. 	   83	  CHAPTER 5: SCREENING LIBRARIES FOR LARIAT PEPTIDES THAT COULD BE USED TO ALTER HIV-1 LTR EXPRESSION 5.1 Introduction 	   There are many protein interactions on the HIV-1 LTR involved in regulation of HIV-1 expression. Among these, a specific interaction between the transcription factors TFII-I and USF1 has been shown to be required for both activation and repression of HIV-1 expression (53, 58). In Chapter 3, I characterized a role for YY1 on the HIV-1 LTR bound directly to DNA near the highly conserved RBEIII element. I confirmed binding of TFII-I at this site and confirmed that it is constitutively bound at this position in both unstimulated and stimulated Jurkat cells (Figure 3.12). It was shown previously that TFII-I binds the same nucleotides as YY1 immediately 3’ of RBEIII, and that binding requires direct interaction with USF1 (53, 63). Disruption of TFII-I and USF1 binding at RBEIII by mutation of the LTR prevents induction by T-cell signaling (58), and reduces viral replication (52). Over-expression of a dominant negative TFII-I, containing amino acids 606-735, which includes the tail end of the R4 domain, (62) or USF1, represented by the C-terminal 94 amino acids containing the leucine zipper and the HLH domain and most of the Ebox DNA binding domain (74), both of which bind DNA but lack activation function, prevents activation from the HIV-1 LTR (53). USF1 and TFII-I were shown to interact through the R4 repeat domain on TFII-I (Figure 5.1) (63). Binding of these two proteins to the LTR at the RBEIII element seems to be important for HIV-1 activation, and this presumably requires direct interaction of these proteins in vivo (58).  	   84	   Figure 5.1: Schematic of TFII-I.  Indicated are the 6-repeated domains R1, R2, R3, R4, R5 and R6, and two nuclear localization signals (NLS1 and NLS2), and a bromo domain (BR). The R4 domain of TFII-I was shown to directly interact with USF1, and was used as a bait in a yeast-two-hybrid screen (highlighted in red).  The goal of my work described in this section was to screen a cyclic lariat peptide library to identify peptides that bind the R4 domain of TFII-I, with the intention of isolating such peptides that could disrupt the interaction between USF1 and TFII-I, in order to understand the role of this interaction in vivo for HIV gene regulation. TFII-I and USF1 have been shown to interact and bind to other promoters, including the adenovirus major late promoter (69) and the β-globin promoter (70). Mutations of the USF1 and TFII-I binding sites on these promoters significantly decreased transcription (70, 212). In another study it was shown that knocking down USF1 expression decreased β-globin transcription, but knocking down TFII-I caused the opposite effect  (213) indicating that USF1 and TFII-I may have competing roles on this promoter. However, it was shown on the HIV-1 LTR and on the adenovirus major late promoter that TFII-I has an activation function, which would mean that disrupting the interaction between these two proteins would lead to a decrease in expression. USF1 and USF2 on the other hand seem to have roles in both activation and repression likely involving recruitment of HDACs and organization of chromatin through positioning of Nuc0 and Nuc1. Preliminary results from our lab indicate that mutations at the RBEIII site, preventing binding TFII-I, USF1 and USF2 may cause spreading of these nucleosomes onto the enhancer region (Dahabieh R1BRR6R5R4R3R2NLS1 NLS2TFII-I120KDa CN	   85	  and Sadowski, unpublished). The ability to specifically disrupt interaction between TFII-I and USF1 would provide a means to derive insight into the role that these proteins have on HIV-1 LTR expression, and may identify them as a potential drug target. In this chapter I describe the isolation of cyclic lariat peptides that interact with the R4 domain of TFII-I, and show that one of these is capable of causing elevation of HIV-1 LTR expression by 2-fold. I expect that lariats of this type will provide novel information regarding TFII-I and USF function for regulation of the HIV LTR, and may also lead to development of novel latency modulating strategies. 5.2 The R4 domain increases LTR expression 	   It was previously shown in our lab that the R4 domain of TFII-I (Figure 5.1) is responsible for interaction with USF1 in vitro (63). To determine whether the R4 domain expressed on its own could interfere with the USF-TFII-I interaction, I expressed this protein fragment as a fusion with a cell membrane penetrating tag in collaboration with Iprogen Inc. The fusion protein was expressed in E. coli, fused to GFP, and purified.  I assayed the effect of the R4 protein fusion using a Jurkat cell line bearing an integrated HIV-1 LTR with a luciferase reporter construct. The membrane penetrating tag has been used by Iprogen to deliver a variety of proteins intracellularly, by adding a fusion protein to the culture media, and consequently I was able to assess the effect of the R4 domain without toxic affects produced by transfection. When added to the Jurkat reporter cell line at a concentration of 5 µg/mL in combination with 50 nM PMA the R4 fusion protein was found to activate the HIV-1 LTR by 2-fold, and by almost 4-fold at 10 µg/mL (Figure 5.2). This result is consistent with another unpublished result in our lab where overexpression of TFII-I R4 fused to an NLS caused activation of an integrated HIV-	   86	  LTR reporter (Shaw and Sadowski, unpublished), and indicates that the R4 domain has an important role for regulation of transcription from the HIV-1 LTR.   Figure 5.2: A membrane-permeable-R4 domain fusion, in combination with PMA causes induction of the HIV-1 LTR. Jurkat-Tat cells containing the HIV-1 LTR-luciferase reporter provirus were treated with 50 nM PMA, and incubated with varying concentrations of the TFII-I R4 domain fused to GFP or GFP alone. Luciferase activity was measured 24 hours later.  5.3 A screen for lariat peptides that bind the TFII-I R4 domain 	   Given that the R4 domain of TFII-I, expressed on its own or delivered as a cell permeable fusion, could cause activation of the HIV LTR, presumably because of a dominant interfering effect, I was then interested in determining whether peptide inhibitors of the USF-TFII-I interactions could produce a similar effect.  Using randomized lariat peptide technology (177) in combination with the yeast two-hybrid assay (Figure 5.1), I used the R4 domain of TFII-I as a bait fusion with LexA, to screen for 10 amino acid lariats that could bind R4 and potentially disrupt the USF1-TFII-I 0.00.51.01.52.02.53.03.54.00.000.080.160.310.631.252.5 5 10Fold-Induction[Sample] (µg/mL)R4GFP control	   87	  interaction. Forty initial clones expressing potential interacting lariats were picked, the DNA from plasmids encoding these lariats was recovered and retransformed to re-test the interactions; these were numbered according to the original plate and colony number. The initial positive lariats were re-tested for interaction with the R4 domain on its own, as well as a full length LexA-TFII-I bait, and the empty vector pEG202 expressing LexA (Figure 5.3). Ten of the original 40 positive lariats produced an interaction with R4 upon retest; while only six (0-0, 1-5, 2-2, 2-8, 3-1, 5-8) showed interaction with full length TFII-I (Figure 5.3). Positive interactions are indicated by blue color on the SD H-W-L-X-gal plates. The change in color from pink to blue indicates an interaction between the bait and prey plasmids. Colonies that stay pink indicates that there is no interaction.    Figure 5.3: Lariat peptides re-tested for interaction with the TFII-I R4 domain, full length TFII-I and LexA (pEG202). Prey plasmids encoding lariats isolated from the Y2H screen with the LexA-R4 domain bait were re-tested for interaction with R4, full length TFII-I and (pEG202). The transformed yeast bearing LexA ops - LEU2 and β-galactosidase reporters were spotted onto leu- plates containing X-gal.  Positive interactions are scored as blue pigment.     R4TFII-IpEG202Bait2-2 2-8 3-1 4-1 4-2 4-5 4-8 5-8Prey0-0 1-5SDH-W-L- X-gal	   88	  5.4 Analysis of R4-interacting lariats  	  Lariats recovered from the screen were analyzed for intein processing by Western Blot (Figure 5.4). The unprocessed lariat migrates at around 29 kDa on SDS PAGE, whereas the processed lariat will migrate at approximately 17 kDa. Nine of the lariats seemed to process to the desired lariat product but not those encoded by clones 2-8 and 4-5.    Figure 5.4: Immunoblot for analysis of R4 lariat processing in yeast.  Panel A: Lariat peptides were expressed in yeast and immunoblotted with HA antibody. Panel B: Schematic of the lariat peptides: AD, activation domain; HA, hemagluttin epitope tag; Ic, C-terminal domain of the intein; L, variable lariat loop containing 10 random amino acids; IN, N-terminal domain of the intein. The unprocessed lariat contains the IN domain, which is removed upon processing of the lariat.  Clones encoding the lariats were sequenced, and interestingly, from nine independent lariats for which I obtained sequences, I observed five unique peptide sequences (Table 5.1). From these, I carried forward three lariats for further analysis, 0-0 1-3 1-5 2-2 2-8 3-1 4-1 4-2 4-5 4-8 5-82530kDaAD + HA IC L INUnprocessed29 kDaLariat17 kDa12 1214AD + HA IC L12 14VectorAB	   89	  which interact strongly with both the R4 domain and full length TFII-I (renumbered 180, 184 and 189, Figure 5.3, Table 5.1).  One of the lariats produced inconclusive interaction with full length TFII-I and was discarded (Table 5.1). The renumbered clone 184, which does not show interaction with full length TFII-I (Table 5.1) was carried forward as a negative control for subsequent studies.   Table 5.1: Summary of lariat peptide sequences that interact with the R4 domain of TFII-I    To examine the effect of the lariat peptides in vivo, I cloned sequences encoding 180, 182, 184, 189 into the pEFlag vector with a Venus (YFP) fluorescent tag, and examined expression and processing in Cos7 cells by Western blotting with Flag antibody (Figure 5.5). The vector control, encoding a Flag-NLS-Venus fusion produces a protein of ~19 kDa, whereas the unprocessed intein fusions are ~46 kDa and the processed lariats fused to Flag-NLS-Venus are ~34 kDa. Of the two lariats I examined by immunoblotting, I found that lariat clones 184 and 189 both expressed processed Venus-lariat fusions, although lariat 189 was significantly more efficient (Figure 5.5).  Lariat Renamed Sequence Interact0TFII3I Processing2"8 180 SAFHWFISCVF + "3"1,)2"2 182 SYTDFYVLINS + +4"8 184 SLGNLYHTRRT " +0"0,)1"3,)5"8 189 SVERLCDYFVY + +1"5,)4"2 " SVSNVYYEDGP ? +	   90	   Figure 5.5: Immunoblot for analysis of R4 lariat processing in Cos7 cells.  Panel A: Lariat peptides were expressed in Cos7 cells and an equal number of cells were processed, extracts were immunoblotted with Flag antibody. Panel B: Schematic representation of the lariat fusion proteins: F, Flag tag; N, nuclear localization signal; Venus, YFP fluorescent tag; Ic, C-terminal domain of the intein; L, variable lariat loop containing 10 random amino acids; IN, N-terminal domain of the intein. The unprocessed lariat contains the IN domain, which is removed upon processing to the lariat.  5.5 The effect of the R4-interacting lariats on HIV-1 LTR activity in Jurkat cells 	   To examine if the lariat peptides recognizing TFII-I R4 affect HIV-1 LTR activity, I used a Jurkat cell line bearing an integrated mini-virus, where luciferase is expressed from the 5’ LTR (Figure 4.1). This cell line was transfected with plasmids expressing four of the R4-interacting lariats (180, 182, 184 and 189); 48 hours later, luciferase expression was measured, and compared to a mock-transfected sample. The results pEFlag18918425304050kDa N L INUnprocessed~ 46 kDaLariat~ 34 kDa124Venus IC11F271 N L4Venus IC11F271AB	   91	  demonstrated that lariat 189 caused activation of HIV-1 LTR by approximately 2-fold, compared to the control (Figure 5.6), but the other three lariats had no effect.  This result is comparable to that described above with the full R4 domain.   Figure 5.6: Lariat 189 causes activation of the HIV-1 LTR.  One million cells bearing an integrated pTY-LAI-luc mini-virus reporter construct were transfected with the vector control pEFlag, or plasmids expressing the lariat fusions as indicated (180, 182, 184, 189, x-axis). Luciferase activity was measured 48 hours post-transfection and expressed as relative luciferase units (RLU, y-axis).    I also examined whether expression of the lariats produced toxicity in the Jurkat cell line. For these experiments, cells were transfected and the live cell count was measured 48 hours later by staining with trypan blue. I found that lariats 184 and 189 caused a decrease in the live cell count from 1 x 106 cells/mL to 3-4 x 105 cells/mL (Figure 5.7). Previous results from our lab have indicated that interfering with TFII-I function causes considerably toxicity in Jurkat cells ((53), Chen unpublished), and therefore several of the lariats I have identified may be altering activity of TFII-I on other target promoters. We 0.00.51.01.52.02.53.0pEFlag 180 182 184 189Fold ActivationTransfected construct	   92	  are currently working with Iprogen Inc. who will produce recombinant cell permeable versions of lariat effectors with potential to alter HIV provirus expression.    Figure 5.7: Several R4-interacting lariat peptides have a toxic affect on Jurkat cells.  The Jurkat cell line bearing an integrated pTY-LAI-luc mini-virus reporter construct was transfected with pFlag, or plasmids encoding the Venus-lariat fusions as indicated (180, 182, 184, 189, x-axis). Cell viability 48 hours post-transfection was measured by trypan blue exclusion (y-axis). * represents p values < 0.01.   5.6 R4 Lariat screen discussion 	   In this chapter I describe a screen to identify lariat peptides that interact with the R4 domain of TFII-I using a Y2H assay. TFII-I was previously shown to interact with USF1 and bind cooperatively to the HIV-1 LTR  (53, 63). Binding of TFII-I and USF1 is required for activation of HIV-1 transcription (58), and presumably this requires direct interaction between these factors. Consistent with this, USF1 was shown to interact in vitro with the R4 domain of TFII-I (63), and the R4 domain expressed on its own, or introduced as a cell permeable fusion was found to cause elevation of HIV-1 LTR expression, presumably because it causes a dominant interfering effect on the USF1-024681012pEFlag 180 182 184 189Cell Viability(x 1e5 cells/mL)Transfected construct* *	   93	  TFII-I interactions. To examine this possibility in more detail, I screened a randomized lariat library for peptides that interact with the R4 domain of TFII-I. From this effort I isolated clones encoding lariats with five unique sequences, several of which were identified multiple times, indicating that the library screen was approaching saturation. Lariats with three of the five different lariats (180, 182, 189) were found to interact with both the full length TFII-I and the R4 domain alone.  Curiously, however one of these lariat sequences (182) has surfaced in other Y2H screens in our lab using Suv39H1, G9a and HIV-1 integrase baits, indicating that this sequence must produce multiple non-specific interactions. This 182 lariat does not interact with LexA alone, indicating that it may bind at the interface of LexA-fusion proteins, or bind non-specifically to a domain that LexA does not have. I analyzed the effect of the lariats (180, 182, 184 and 189) on HIV-1 LTR activity, and found that one (189) seemed to cause 2-fold activation in otherwise unstimulated cells. This result is similar to the effect produced by the R4 domain on its own, and suggests that the TFII-I-USF1 interaction contributes to repression of the HIV-1 provirus. This is consistent with earlier results from our lab showing that an integrated LTR-reporter gene bearing a mutation at RBEIII displayed higher basal level expression than the wild type LTR (53).  However, mutation of RBEIII in the full virus genome was found to inhibit replication, indicating that TFII-I/ USF bound at this site can produce positive and negative effects on transcription.  It is possible that on the HIV-1 LTR, USF1 has a role in activation from the HIV-1 LTR, and TFII-I has a role in repressing expression as was shown on the β-globin promoter (213). In this case the R4 domain and the R4 binding lariat could block TFII-I activity but not affect USF1 activity. Several of 	   94	  the lariats produced significant toxic effects on Jurkat cells, which was interesting, because if they block the interaction between USF1 and TFII-I this would mean that this combination of factors may be necessary for expression of cellular genes required for cell survival. The other possibility is that the lariats block TFII-I from interacting with other proteins or affect binding to DNA, which may also affect cell viability. Nevertheless, my preliminary results indicate proof of principle, that with optimization, these types of molecules may be useful for modulating expression of the HIV provirus with the goal of purging the latent infection. 	    	   95	  CHAPTER 6: CONCLUSIONS AND FUTURE DIRECTIONS 6.1 The role of YY1 in HIV-1 latency 	   YY1 was one of the first host cell transcription factors found to repress the HIV-1 LTR (101), but initially it was discovered bound indirectly to DNA in a complex with LSF near the transcriptional start site (82). In Chapter 3, I describe a novel DNA binding site for YY1 on the HIV-1 LTR ~120 nucleotides upstream of the transcription start site near the highly conserved RBEIII element. Interestingly, I found that mutation of residues required for YY1 and TFII-I binding near RBEIII cause a decrease in occupancy of these proteins at both the RBEIII site, and near the transcription start site in vivo. These results support a hypothesis that these factors may bind cooperatively to these multiple sites flanking the LTR enhancer. These interactions might produce a higher order “loop” DNA structure of the LTR promoter. In support of this model, USF1 and USF2 also bind at the RBEI and RBEIII sites on the HIV-1 LTR (52, 53), and the leucine zipper domain of USF has been shown to be capable of forming higher order structures in vitro (214). Further support for a looping model is that YY1 has been shown to bend DNA in vitro (194, 195), which might facilitate formation of a loop. Therefore, looping between the core promoter and RBEIII site may be representative of a repressive state on the LTR, which presumably would unfold upon activation of transcription. To test this model I tried to examine looping at the LTR directly using chromatin conformation capture (3C), but this proved to be technically challenging due to the proximity of these sites to each other. In the future it would be interesting to examine whether knocking down LSF expression, or mutation of the LSF binding site near the core promoter inhibits binding of YY1 at the RBEIII site in vivo. This would give insight into whether both 	   96	  binding sites are required for YY1 association. The binding of USF1 and USF2 to the RBEIII mutant virus should also be examined to see if they, like YY1 and TFII-I, become dissociated from the RBEI site by mutations near RBEIII. This would provide further evidence of cooperative binding between factors at these two sites. Additionally, it might be possible to identify further mutations near RBEIII, using EMSA in vitro that would prevent binding of YY1 without affecting binding of TFII-I or USF1/2. The effect of such mutations could then be examined in vivo.  It is also possible the 5’ LTR and 3’ LTR could form an LTR-LTR loop. This type of interaction should be easier to determine using chromosome conformation capture since they are further apart than the RBEI and RBEIII sites. The ability of YY1 and TFII-I to contribute to loop formation between the RBEI and RBEIII sites or the 3’ and 5’ LTRs could also be analyzed in vitro using EM with protein complexes expressed in baculovirus. Finally, it would also be interesting to determine whether YY1 is capable of occupying the RBEIII element simultaneously with TFII-I and USF1/2 or if their binding is mutually exclusive. It should be possible to examine this in vivo for binding to RBEIII using ChIP with YY1 antibody, and then using re-ChIP to analyze the complex with antibodies to TFII-I and/or USF1/2.  It was shown previously that YY1 has a repressive role for HIV-1 transcription (82, 101, 102). Our data supports these previous observations. I have shown that YY1 is bound to the LTR, at both the RBEIII site and transcription start site in unstimulated cells and dissociates upon stimulation of the cells with PMA, or in unstimulated cells that produce an active infection with HIV; this was demonstrated by sorting cells infected with a dual reporter mini-virus. Cells expressing only GFP were found to have 	   97	  significantly more YY1 on the LTR then the GFP/dsRED positive cells. There are two potential issues with this experiment. First is the possibility that GFP expression could be produced by unintegrated 2-LTR circles, however, in our experience non-integrated viral DNA does not contribute to expression of the viral reporter genes because treatment with integrase inhibitors prevents their expression (216). Second, these cell populations were not resorted after they were expanded, which we have shown can result in a mixed population of GFP and GFP/dsRed positive cells (Hashemi and Sadowski unpublished). Analysis of the expanded populations by flow cytometry would be interesting, although I expect that in bulk they will be primarily unchanged.  Another important future experiment will be to explore the mechanisms regulating YY1 binding to the LTR. I show that YY1 expression is unaltered in stimulated Jurkat cells, indicating that dissociation from the LTR may be caused by a post-translational modification, perhaps acetylation of the C-terminal zinc fingers, which was previously shown to inhibit DNA binding (90). It will be important to determine which residues become modified to alter binding to the LTR DNA. This can be accomplished using mass-spectrometry analysis of YY1 purified from JNE using a biotinylated double stranded DNA containing the promoter/enhancer region of the LTR. Alternatively mutations at specific lysine residues could be performed and tested for their ability to bind the LTR in vivo.   YY1 is a critical determinant for establishment of latency early after infection and maintenance of the latent provirus in unstimulated cells. Upon infection of unstimulated cells with the dual reporter virus, I find that ~5% of the cells produce active HIV-1 LTR expression after 24 hours. ChIP analysis indicates that viral LTRs in this population are 	   98	  not bound by YY1, whereas the population of cells bearing transcriptionally repressed virus is associated with YY1. Upon culturing, the proportion of cells with actively transcribing virus increases from 5% to ~ 30% after one week post infection in a cell line overexpressing a mutant YY1 unable to bind HDAC1. However, in a cell line where wild type YY1 is overexpressed, I found that the proportion of cells with active transcription does not increase above 5% for at least a month. Consistent with these observations, HIV-1 subtype AE has a large deletion spanning the RBEIII site where YY1 binds (193, 216). The AE subtype has increased LTR expression compared to other subtypes, possibly because it cannot bind YY1 to cause repression (193, 216). Interestingly, Barton et al. showed that depletion of YY1 caused activation of the HIV-1 LTR, but did not affect occupancy of HDAC1, HDAC2 or HDAC3 (217). Taken together, these observations indicate that YY1 is a critical determinant for establishment of latency early after infection and maintenance of the latent provirus in unstimulated cells. It would be important to analyze HIV-1 subtype AE by ChIP analysis at the RBEI site to see if this naturally occurring deletion decreases latency through preventing YY1 binding.  Another study in our lab showed that deactivation of NFκB also correlated with early establishment of latency (216). The proportion of cells that form productive infection can be enhanced by overexpressing NFκB p65. NFκB is one of multiple factors that bind the LTR in activated T cells and cause activation by recruitment of HATs. It is possible that HAT activity recruited by NFκB p65, or other activators, in stimulated cells may inhibit YY1 DNA binding through lysine acetylation. The role of YY1 in controlling HIV-1 latency likely involves recruitment of HDAC1, however it is possible that other mechanisms contribute to its repressive 	   99	  function. The interaction of YY1 with HDAC1 is required for inhibiting Tat activity on the LTR (83), and YY1 is dissociated from the LTR in response to Tat over-expression (116). This suggests that YY1, by recruiting HDAC1 to the LTR may not only cause repression by deacetylation of histones, but also by causing deacetylation of Tat. Acetylation of Tat contributes to its full function in promoting RNA pol II elongation from the LTR promoter (218). Another mechanism that YY1 could use to regulate HIV-1 expression may involve recruitment of a ncRNA. It was recently shown that inhibiting expression of an HIV-1 antisense long coding RNA caused activation of LTR expression (219). Additionally, Jeon et al. showed that YY1 is responsible for attachment of the long non-coding RNA Xist to the inactive X chromosome (220). The RBEI and RBEIII sites on the HIV-1 LTR, where YY1 is bound, are separated by ~100 bps; interestingly, YY1 localizes Xist through multiple YY1-DNA binding sites also separated by ~100 bps (220). This study also shows that EZH2 becomes associated with Xist upon YY1 binding, which contributes to repression (220). Therefore, it is possible that YY1 not only represses the HIV-1 LTR through recruitment of HDAC1 but also recruitment of EZH2 in association with a non-coding RNA. It would be interesting to analyze the LTR for additional YY1 binding sites, as well as determine whether the LTR antisense long coding RNA interacts through YY1, and if so whether this might cause recruitment of EZH2. A ChIP-exo experiment would identify all the YY1 binding sites on the LTR. A RIP-seq experiment with YY1 from infected and uninfected cells would identify association with HIV-1 RNA sequences as well as cellular RNAs. This might reveal novel functions for YY1 in controlling HIV-1 repression. 	   100	  YY1 may also be involved in nucleosome positioning on the HIV-1 LTR. It was shown that BAF of the SWI/SNF class of chromatin remodeling enzymes contributes to positioning of nucleosome 1, which is involved in the establishment and maintenance of HIV-1 latency (118). Related to this, it was shown by Mohd-Sarip et al. that the Drosophila protein Pleiohomeotic (PHO), related to YY1, can recruit Brahma (BRM) also of the SWI/SNF family to silence genes (221). All of these possibilities could be examined by knocking down expression of YY1, examining recruitment of BAF using ChIP, and monitoring association of nuc0 and nuc1 with the LTR. 6.2 Reactivating latent HIV-1 with chaetocin 	   In Chapter 4, I show that chaetocin, an inhibitor of SUV39H1, causes induction of an integrated HIV-1 mini-virus after 8 hours of treatment, without producing global T-cell activation. Other studies have shown that chaetocin reactivates tumor suppressor genes in cancer cells (202), and genes involved in reactivating the Epsteinn-Barr virus from latency (222). Both of these studies showed that chaetocin decreases H3K9 trimethylation on the target promoters (202, 222), similar to the results I observed. These studies suggest that chaetocin’s activity may be caused by inhibition of SUV39H1, however, as with all small molecule compounds chaetocin has off-target effects (201, 203) and consequently it is possible that this compound may cause induction of HIV expression by an alternative mechanism. In my experiments I observed a corresponding increase in H3K9 acetylation upon treatment with chaetocin. It is possible that this effect could be caused by the fact the chaetocin has a similar structure as HDAC inhibitors (203), however the effect of this compound on histone acetylation has been shown to be cell line-dependent (203). Nevertheless it is possible that chaetocin activates the HIV-1 	   101	  LTR through a possible off-target HDAC inhibitor activity. In this case a potential HDAC inhibitor activity may also function by increasing acetylation of Tat, which would result in elevated HIV-1 LTR transcription (218). However, because I found that chaetocin produces a synergistic effect with the HDACi TSA and SAHA, it would be surprising if chaetocin’s activity towards reactivating expression of HIV-1 was related to an off-target HDAC inhibitor effect. It is also possible that chaetocin may inhibit other histone methyltransferases in addition to Suv39H1. Chaetocin was shown to prevent H3K9 dimethylation (202, 201) through inhibition of the mehtyltransferase G9a, and this could also play a role in activating the LTR (201), since inhibiting and knocking down other methyltransferases such as G9a and EZH2 have been shown to activate the HIV-1 LTR (122, 123, 172).  Chaetocin has also been shown to cause oxidative stress in some myeloma cells, but not in normal leukocytes (203). NFκb is one of the main transcription factors involved in activation of the HIV-1 LTR, and can be activated by oxidative stress (211). In fact, NFκb has been shown to be involved in induction of HIV expression by oxidative stress (226). Although I did not examine the effect of chaetocin on oxidative stress in my cell lines, I did find that NFκb p65 was not bound to the LTR in chaetocin treated cells, indicating that it is not likely activating the LTR by a pathway involving oxidative stress. Alternatives to current FDA approved drugs will be needed to reactivate latent HIV-1. Recently Bullen et al. reported that none of the currently reported latent reactivating drugs caused activation of HIV-1 in various cell lines, or induced viral outgrowth from latently infected cells from patients on HAART (225). In fact the only agents that caused HIV-1 RNA expression in this study also caused T cell activation 	   102	  (225). SAHA was among those drugs tested, and did not induce viral expression, nevertheless, this compound has shown some exciting initial results in HIV-1 patients on HAART in clinical trials. A single dose of SAHA given to eight patients on HARRT resulted in increased cellular acetylation and also HIV-1 RNA expression from CD4+ cells (223). However, a follow up study with five of the initial participants using 22 doses of SAHA showed that treatment caused an increase in HIV-1 RNA in only 3 out of the 5 patients, additionally, histone acetylation and viral expression as measured by a qualitative viral outgrowth assay was unchanged (224).  Chaetocin was shown by another group to cause induction of HIV-1 expression in cells from patients. Surprisingly 86% of resting CD4+ T-cell cultures from HIV-1 patients on HAART were reactivated by chaetocin (172), suggesting that H3K9me3 plays an important role in the latent population of patients on HAART. They also found that chaetocin in combination with SAHA produced a synergistic effect in some of the CD4+ cells from HIV-1 infected patients on HAART (172). These studies indicate that multiple drugs may be needed to activate latent populations in patients, since single drugs will likely only affect provirus at a subset of integration sites.  In the future, it will be interesting to examine the effect of chaetocin on HIV-1 expression in the humanized mouse model. Chaetocin is tolerated at low doses in the RPMI 8226 myeloma severe combined immunodeficiency (SCID) mouse model with an established flank xenograft (203). Toxicity of chaetocin was examined in mice, where intraperitoneal (body cavity) administration caused peritoneal irritation, but there were no adverse affects on organs, feeding behavior or activity of the animals (227). In another study, the anti-leukemic activity of chaetocin was examined in a NOD/ Shi-scid IL2R-	   103	  gamma (null)-SCID mice with intraperitoneal administration of chaetocin three times per week (228). The authors reported that the mice had a normal body weight 16 days post xenograft, indicating that chaetocin is well tolerated (228). Future studies with chaetocin in HIV-1 infected mice models would be informative. 6.3 Lariat peptide inhibitors of TFII-I that affect HIV-1 LTR expression 	   Peptide therapeutics is an emerging field; LEDGF inhibitors (LEDGINs) for example, were designed to target the LEDGF/p75-integrase interaction (230). Most LEDGINs specifically target the LEDGF/p75 binding pocket on integrase, however recently one group used phage display to isolate a cyclic peptide that binds LEDGF/p75 directly to disrupt the LEDGF/p75-integrase interaction (231). This peptide was able to inhibit HIV-1 infection, even with HIV strains resistant to previously described integrase inhibitors. By targeting the specific region of LEDGF/p75 that interacts with integrase, the peptide does not produce off-target effects by disrupting LEDGF/p75 cellular functions (231). Cyclic peptides that bind specific targets seem to be a powerful tool to identify novel therapeutics. Interestingly, humans have been shown to have once encoded an anti-HIV-1 cyclic peptide. Theta-defensins, or retrocylcins are the only known cyclic peptides of animal origin, however, a premature stop codon prevents humans from producing these peptides (232). Interestingly our closest primate relatives (chimpanzee and gorilla) also contain the premature stop codon and cannot make retrocyclins, however the more distant related primate (rhesus macaque) can (232). Some of these retrocyclins have been shown to have affinity for HIV-1 gp120, gp41 and the host CD4 receptor, which inhibits HIV-1-host cell attachment and the fusion step of the viral life cycle (232). Anti-HIV-1 retrocyclins are currently being examined as potential 	   104	  therapeutics. Given these results, it would be interesting to express the sequence from these retrocyclins as lariats to determine whether they affect HIV-1 infectivity. TFII-I was previously shown to interact with USF1 and bind cooperatively to the HIV-1 LTR at RBEIII (53, 63). To assess how the interaction between TFII-I and USF1 controls HIV-1 expression, I screened a lariat peptide library using the R4 domain of TFII-I as a bait in the Y2H system, and identified a lariat peptide (lariat 189) that causes weak activation of the HIV-1 LTR when expressed in Jurkat cells. The proposed mechanism of action is that lariat 189 disrupts interaction between TFII-I and USF1, thereby preventing binding to the LTR.  Interaction between the TFII-I R4 domain and USF-1 was shown to be necessary for binding of USF1/2 and TFII-I to the RBEIII element in vitro and in vivo (53, 63). TFII-I has been shown to recruit HDAC3 to other promoters (61), and so it is possible TFII-I may also recruit HDAC3 to the LTR in unstimulated cells. ChIP could be used to determine if lariat 189 disrupts binding of both TFII-I and to the HIV-1 LTR in vivo.  It would be expected that increasing the affinity of lariat 189 would also increase its effect on the HIV-1 LTR, but this may also cause toxic effects on the cells. Assuming toxic effects of the R4-binding lariats is due to interaction with TFII-I, this would be consistent with previous observations from our lab showing that overexpression of TFII-I is toxic to cells (Chen and Sadowski, unpublished). This may not be surprising since a heterozygous truncation of chromosome band 7q11.23 containing the gene encoding TFII-I is linked to Williams-Beuren Syndrome (54) indicating the requirement for TFII-I in development. Given the ubiquitous nature and toxic effects observed from TFII-I deficiency, this protein may not be useful for specifically targeting the latent provirus.  	   105	  In conclusion, HIV-1 latency is the major barrier to complete HIV-1 eradication. I have approached this problem from different angles, hoping to improve our understanding of how HIV-1 transcription is repressed in unstimulated T cells, and have initiated development of novel strategies with the goal of eliminating the infection. I have increased our understanding of how the HIV-1 LTR promoter is repressed by identifying and characterizing a novel YY1 binding site on the HIV-1 LTR. Overall, my research provides significant novel insight into the mechanisms that control HIV latency. This is important because our understanding of how the HIV-1 LTR is repressed in latently infected cells will provide insight into possible therapeutic targets. 	    	    	   106	  BIBLIOGRAPHY 1. Global Report, UNAIDS report on the global AIDS epidemic. (2013) 2. Centlivre, M., Sala, M., Wain-Hobson, S. & Berkhout, B. In HIV-1 pathogenesis the die is cast during primary infection. AIDS 21, 1-11 (2007). 3. McMichael, A. J., Borrow, P., Tomaras, G. D., Goonetilleke, N., Haynes, B. F., The immune response during acute HIV-1 infection: clues for vaccine development. Nat Rev Immunol 10, 11-23 (2010). 4. Cullen, B. R. Retroviruses as Model Systems for the Study of Nuclear {RNA} Export Pathways. Virology 249, 203 - 210 (1998). 5. Hallenberger, S., Bosch, V., Angliker, H., Shaw, E., et al. Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160. Nature 360, 358-361 (1992). 6. Engelman, A. & Cherepanov, P. The structural biology of HIV-1: mechanistic and therapeutic insights. Nat Rev Microbiol 10, 279-290 (2012). 7. Bukrinsky, M. I., Sharova, N., McDonald, T. L., Pushkarskaya, T., et al. Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection. Proc Natl Acad Sci U S A 90, 6125-6129 (1993). 8. Arhel, N. Revisiting HIV-1 uncoating. Retrovirology 7, 96 (2010). 9. Wyatt, R. & Sodroski, J. The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science 280, 1884-1888 (1998). 10. Hendrickson, W. A., Kwong, P. D., Wyatt, R., Robinson, J., et al. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody Nature 393, 648-659 (1998). 11. Weissenhorn, W., Dessen, A., Harrison, S. C., Skehel, J. J. & Wiley, D. C. Atomic structure of the ectodomain from HIV-1 gp41. Nature 387, 426-430 (1997). 12. Buzon, V., Natrajan, G., Schibli, D., Campelo, F., et al. Crystal structure of HIV-1 gp41 including both fusion peptide and membrane proximal external regions. PLoS Pathog 6, e1000880 (2010). 13. Berger, E. A. HIV entry and tropism: the chemokine receptor connection. AIDS 11 Suppl A, S3-16 (1997). 14. Mortuza, G. B., Haire, L. F., Stevens, A., Smerdon, S. J., et al. High-resolution structure of a retroviral capsid hexameric amino-terminal domain. Nature 431, 481-485 (2004). 15. Warrilow, D., Tachedjian, G. & Harrich, D. Maturation of the HIV reverse transcription complex: putting the jigsaw together. Rev Med Virol 19, 324-337 (2009). 16. Klarmann, G. J., Schauber, C. A. & Preston, B. D. Template-directed pausing of DNA synthesis by HIV-1 reverse transcriptase during polymerization of HIV-1 sequences in vitro. J Biol Chem 268, 9793-9802 (1993). 	   107	  17. Fassati, A. & Goff, S. P. Characterization of intracellular reverse transcription complexes of human immunodeficiency virus type 1. J Virol 75, 3626-3635 (2001). 18. Charneau, P., Alizon, M. & Clavel, F. A second origin of DNA plus-strand synthesis is required for optimal human immunodeficiency virus replication. J Virol 66, 2814-2820 (1992). 19. Charneau, P., Mirambeau, G., Roux, P., Paulous, S., et al. HIV-1 reverse transcription. A termination step at the center of the genome. J Mol Biol 241, 651-662 (1994). 20. Suzuki, Y. & Craigie, R. The road to chromatin - nuclear entry of retroviruses. Nat Rev Microbiol 5, 187-196 (2007). 21. Fahrenkrog, B. The nuclear pore complex, nuclear transport, and apoptosis. Can J Physiol Pharmacol 84, 279-286 (2006). 22. Engelman, A., Mizuuchi, K. & Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell 67, 1211-1221 (1991). 23. Karn, J. & Stoltzfus, C. M. Transcriptional and Posttranscriptional Regulation of HIV-1 Gene Expression. Cold Spring Harb Perspect Med 2, a006916 (2012). 24. Sundquist, W. I. & Kräusslich, H. G. HIV-1 assembly, budding, and maturation. Cold Spring Harb Perspect Med 2, a006924 (2012). 25. Bieniasz, P. D. The Cell Biology of HIV-1 Virion Genesis. Cell Host & Microbe 5, 550 - 558 (2009). 26. Hurley, J. H. & Hanson, P. I. Membrane budding and scission by the ESCRT machinery: it's all in the neck. Nature Reviews Molecular Cell Biology 11, 556-566 (2010). 27. Liu, Y., Witte, S., Liu, Y. C., Doyle, M., et al. Regulation of protein kinase Ctheta function during T cell activation by Lck-mediated tyrosine phosphorylation. J Biol Chem 275, 3603-3609 (2000). 28. Altman, A., Isakov, N. & Baier, G. Protein kinase Ctheta: a new essential superstar on the T-cell stage. Immunol Today 21, 567-573 (2000). 29. Lusic, M., Marcello, A., Cereseto, A. & Giacca, M. Regulation of HIV-1 gene expression by histone acetylation and factor recruitment at the LTR promoter. EMBO J 22, 6550-6561 (2003). 30. Marsili, G., Remoli, A. L., Sgarbanti, M. & Battistini, A. Role of acetylases and deacetylase inhibitors in IRF-1-mediated HIV-1 long terminal repeat transcription. Ann N Y Acad Sci 1030, 636-643 (2004). 31. García-Rodríguez, C. & Rao, A. Nuclear factor of activated T cells (NFAT)-dependent transactivation regulated by the coactivators p300/CREB-binding protein (CBP). J Exp Med 187, 2031-2036 (1998). 32. Sun, H. J., Xu, X., Wang, X. L., Wei, L., et al. Transcription factors Ets2 and Sp1 act synergistically with histone acetyltransferase p300 in activating human interleukin-12 p40 promoter. Acta Biochim Biophys Sin (Shanghai) 38, 194-200 (2006). 	   108	  33. Colin, L., Lint, C. V. & Van Lint, C. Molecular control of HIV-1 postintegration latency: implications for the development of new therapeutic strategies. Retrovirology 6, 111 (2009). 34. Steffan, N. M., Bren, G. D., Frantz, B., Tocci, M. J., et al. Regulation of IkB alpha phosphorylation by PKC- and Ca(2+)-dependent signal transduction pathways. J Immunol 155, 4685-4691 (1995). 35. DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E. & Karin, M. A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388, 548-554 (1997). 36. Kang, S. M., Tran, A. C., Grilli, M. & Lenardo, M. J. NF-kappa B subunit regulation in nontransformed CD4+ T lymphocytes. Science 256, 1452-1456 (1992). 37. Markovitz, D. M., Hannibal, M. C., Smith, M. J., Cossman, R. & Nabel, G. J. Activation of the human immunodeficiency virus type 1 enhancer is not dependent on NFAT-1. J Virol 66, 3961-3965 (1992). 38. Giffin, M. J., Stroud, J. C., Bates, D. L., von Koenig, K. D., et al. Structure of NFAT1 bound as a dimer to the HIV-1 LTR kappa B element. Nat Struct Biol 10, 800-806 (2003). 39. Kinoshita, S., Chen, B. K., Kaneshima, H. & Nolan, G. P. Host control of HIV-1 parasitism in T cells by the nuclear factor of activated T cells. Cell 95, 595-604 (1998). 40. Manninen, A. & Saksela, K. HIV-1 Nef interacts with inositol trisphosphate receptor to activate calcium signaling in T cells. J Exp Med 195, 1023-1032 (2002). 41. Bates, D. L., Barthel, K. K., Wu, Y., Kalhor, R., et al. Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element. Structure 16, 684-694 (2008). 42. Bassuk, A. G., Anandappa, R. T. & Leiden, J. M. Physical interactions between Ets and NF-kappaB/NFAT proteins play an important role in their cooperative activation of the human immunodeficiency virus enhancer in T cells. J Virol 71, 3563-3573 (1997). 43. Flory, E., Hoffmeyer, A., Smola, U., Rapp, U. R. & Bruder, J. T. Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. J Virol 70, 2260-2268 (1996). 44. Bell, B. & Sadowski, I. Ras-responsiveness of the HIV-1 LTR requires RBF-1 and RBF-2 binding sites. Oncogene 13, 2687-2697 (1996). 45. Estable, M. C., Bell, B., Hirst, M. & Sadowski, I. Naturally occurring human immunodeficiency virus type 1 long terminal repeats have a frequently observed duplication that binds RBF-2 and represses transcription. J Virol 72, 6465-6474 (1998). 46. Sieweke, M. H., Tekotte, H., Jarosch, U. & Graf, T. Cooperative interaction of ets-1 with USF-1 required for HIV-1 enhancer activity in T cells. EMBO J 17, 1728-1739 (1998). 	   109	  47. Yang, H. C., Shen, L., Siliciano, R. F. & Pomerantz, J. L. Isolation of a cellular factor that can reactivate latent HIV-1 without T cell activation. Proc Natl Acad Sci U S A 106, 6321-6326 (2009). 48. Jones, K. A., Kadonaga, J. T., Luciw, P. A. & Tjian, R. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232, 755-759 (1986). 49. Jeang, K. T., Chun, R., Lin, N. H., Gatignol, A., et al. In vitro and in vivo binding of human immunodeficiency virus type 1 Tat protein and Sp1 transcription factor. J Virol 67, 6224-6233 (1993). 50. Jiang, G., Espeseth, A., Hazuda, D. J. & Margolis, D. M. c-Myc and Sp1 contribute to proviral latency by recruiting histone deacetylase 1 to the human immunodeficiency virus type 1 promoter. J Virol 81, 10914-10923 (2007). 51. Estable, M. C., Bell, B., Merzouki, A., Montaner, J. S., et al. Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity. J Virol 70, 4053-4062 (1996). 52. Dahabieh, M. S., Ooms, M., Malcolm, T., Simon, V. & Sadowski, I. Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter. Virology 418, 57-66 (2011). 53. Chen, J., Malcolm, T., Estable, M. C., Roeder, R. G. & Sadowski, I. TFII-I regulates induction of chromosomally integrated human immunodeficiency virus type 1 long terminal repeat in cooperation with USF. J Virol 79, 4396-4406 (2005). 54. Pérez Jurado, L. A., Wang, Y. K., Peoples, R., Coloma, A., et al. A duplicated gene in the breakpoint regions of the 7q11.23 Williams-Beuren syndrome deletion encodes the initiator binding protein TFII-I and BAP-135, a phosphorylation target of BTK. Hum Mol Genet 7, 325-334 (1998). 55. Roy, A. L. Biochemistry and biology of the inducible multifunctional transcription factor TFII-I. Gene 274, 1-13 (2001). 56. Roy, A. L. Transcription factor TFII-I conducts a cytoplasmic orchestra. ACS Chem Biol 1, 619-622 (2006). 57. Hakre, S., Tussie-Luna, M. I., Ashworth, T., Novina, C. D., et al. Opposing functions of TFII-I spliced isoforms in growth factor-induced gene expression. Mol Cell 24, 301-308 (2006). 58. Malcolm, T., Chen, J., Chang, C. & Sadowski, I. Induction of chromosomally integrated HIV-1 LTR requires RBF-2 (USF/TFII-I) and Ras/MAPK signaling. Virus Genes 35, 215-223 (2007). 59. Kim, D. W. & Cochran, B. H. Extracellular signal-regulated kinase binds to TFII-I and regulates its activation of the c-fos promoter. Mol Cell Biol 20, 1140-1148 (2000). 	   110	  60. Wen, Y. D., Cress, W. D., Roy, A. L. & Seto, E. Histone deacetylase 3 binds to and regulates the multifunctional transcription factor TFII-I. J Biol Chem 278, 1841-1847 (2003). 61. Tussié-Luna, M. I., Bayarsaihan, D., Seto, E., Ruddle, F. H. & Roy, A. L. Physical and functional interactions of histone deacetylase 3 with TFII-I family proteins and PIASxbeta. Proc Natl Acad Sci U S A 99, 12807-12812 (2002). 62. Cheriyath, V., Novina, C. D. & Roy, A. L. TFII-I regulates Vbeta promoter activity through an initiator element. Mol Cell Biol 18, 4444-4454 (1998). 63. Malcolm, T., The Regulation of HIV-1 Replication by the Transcription Factor USF1, USF2, and TFII-I (RBF-2). Unpublished doctoral dissertation. University of British Columbia, Vancouver, British Columbia (2008) 64. Sawadogo, M. Multiple forms of the human gene-specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF. J Biol Chem 263, 11994-12001 (1988). 65. Sirito, M., Lin, Q., Maity, T. & Sawadogo, M. Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res 22, 427-433 (1994). 66. Viollet, B., Lefrançois-Martinez, A. M., Henrion, A., Kahn, A., et al. Immunochemical characterization and transacting properties of upstream stimulatory factor isoforms. J Biol Chem 271, 1405-1415 (1996). 67. Galibert, M. D., Carreira, S. & Goding, C. R. The Usf-1 transcription factor is a novel target for the stress-responsive p38 kinase and mediates UV-induced Tyrosinase expression. EMBO J 20, 5022-5031 (2001). 68. Shoulders, C. C. & Naoumova, R. P. USF1 implicated in the aetiology of familial combined hyperlipidaemia and the metabolic syndrome. Trends Mol Med 10, 362-365 (2004). 69. Roy, A. L., Meisterernst, M., Pognonec, P. & Roeder, R. G. Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature 354, 245-248 (1991). 70. Leach, K. M., Vieira, K. F., Kang, S. H., Aslanian, A., et al. Characterization of the human beta-globin downstream promoter region. Nucleic Acids Res 31, 1292-1301 (2003). 71. Vettese-Dadey, M., Grant, P. A., Hebbes, T. R., Crane- Robinson, C., et al. Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J 15, 2508-2518 (1996). 72. West, A. G., Huang, S., Gaszner, M., Litt, M. D. & Felsenfeld, G. Recruitment of Histone Modifications by USF Proteins at a Vertebrate Barrier Element. Molecular Cell 16, 453 - 463 (2004). 73. Huang, J., Wang, F., Argyris, E., Chen, K., et al. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat Med 13, 1241-1247 (2007). 	   111	  74. Qyang, Y., Luo, X., Lu, T., Ismail, P. M., et al. Cell-type-dependent activity of the ubiquitous transcription factor USF in cellular proliferation and transcriptional activation. Mol Cell Biol 19, 1508-1517 (1999). 75. Brady, T., Agosto, L. M., Malani, N., Berry, C. C., et al. HIV integration site distributions in resting and activated CD4+ T cells infected in culture. AIDS 23, 1461-1471 (2009). 76. Vatakis, D. N., Kim, S., Kim, N., Chow, S. A. & Zack, J. A. Human immunodeficiency virus integration efficiency and site selection in quiescent CD4+ T cells. J Virol 83, 6222-6233 (2009). 77. Shan, L., Yang, H. C., Rabi, S. A., Bravo, H. C., et al. Influence of host gene transcription level and orientation on HIV-1 latency in a primary-cell model. J Virol 85, 5384-5393 (2011). 78. Mitchell, R. S., Beitzel, B. F., Schroder, A. R., Shinn, P., et al. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol 2, E234 (2004). 79. Han, Y., Lin, Y. B., An, W., Xu, J., et al. Orientation-dependent regulation of integrated HIV-1 expression by host gene transcriptional readthrough. Cell Host Microbe 4, 134-146 (2008). 80. Han, Y., Lassen, K., Monie, D., Sedaghat, A. R., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. J Virol 78, 6122-6133 (2004). 81. Wang, G. P., Ciuffi, A., Leipzig, J., Berry, C. C. & Bushman, F. D. HIV integration site selection: analysis by massively parallel pyrosequencing reveals association with epigenetic modifications. Genome Res 17, 1186-1194 (2007). 82. Romerio, F., Gabriel, M. N. & Margolis, D. M. Repression of human immunodeficiency virus type 1 through the novel cooperation of human factors YY1 and LSF. J Virol 71, 9375-9382 (1997). 83. He, G. & Margolis, D. M. Counterregulation of chromatin deacetylation and histone deacetylase occupancy at the integrated promoter of human immunodeficiency virus type 1 (HIV-1) by the HIV-1 repressor YY1 and HIV-1 activator Tat. Mol Cell Biol 22, 2965-2973 (2002). 84. Keedy, K. S., Archin, N. M., Gates, A. T., Espeseth, A., et al. A limited group of class I histone deacetylases acts to repress human immunodeficiency virus type 1 expression. J Virol 83, 4749-4756 (2009). 85. Imai, K. & Okamoto, T. Transcriptional repression of human immunodeficiency virus type 1 by AP-4. J Biol Chem 281, 12495-12505 (2006). 86. Williams, S. A., Chen, L. F., Kwon, H., Ruiz-Jarabo, C. M., et al. NF-kappaB p50 promotes HIV latency through HDAC recruitment and repression of transcriptional initiation. EMBO J 25, 139-149 (2006). 	   112	  87. Tyagi, M. & Karn, J. CBF-1 promotes transcriptional silencing during the establishment of HIV-1 latency. EMBO J 26, 4985-4995 (2007). 88. du Chéné, I., Basyuk, E., Lin, Y. L., Triboulet, R., et al. Suv39H1 and HP1gamma are responsible for chromatin-mediated HIV-1 transcriptional silencing and post-integration latency. EMBO J 26, 424-435 (2007). 89. Marban, C., Suzanne, S., Dequiedt, F., de Walque, S., et al. Recruitment of chromatin-modifying enzymes by CTIP2 promotes HIV-1 transcriptional silencing. EMBO J 26, 412-423 (2007). 90. Yao, Y. L., Yang, W. M. & Seto, E. Regulation of transcription factor YY1 by acetylation and deacetylation. Mol Cell Biol 21, 5979-5991 (2001). 91. Hyde-DeRuyscher, R. P., Jennings, E. & Shenk, T. DNA binding sites for the transcriptional activator/repressor YY1. Nucleic Acids Res 23, 4457-4465 (1995). 92. Sui, G. The Regulation of YY1 in Tumorigenesis and its Targeting Potential in Cancer Therapy. Molecular and Cellular Pharmacology 1, 157-176 (2009). 93. Donohoe, M. E., Zhang, X., McGinnis, L., Biggers, J., et al. Targeted disruption of mouse Yin Yang 1 transcription factor results in peri-implantation lethality. Mol Cell Biol 19, 7237-7244 (1999). 94. Shi, Y., Seto, E., Chang, L. S. & Shenk, T. Transcriptional repression by YY1, a human GLI-Krüppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67, 377-388 (1991). 95. Montalvo, E. A., Cottam, M., Hill, S. & Wang, Y. J. YY1 binds to and regulates cis-acting negative elements in the Epstein-Barr virus BZLF1 promoter. J Virol 69, 4158-4165 (1995). 96. Nakanishi-Matsui, M., Hayashi, Y., Kitamura, Y. & Koike, K. Integrated hepatitis B virus DNA preserves the binding sequence of transcription factor Yin and Yang 1 at the virus-cell junction. J Virol 74, 5562-5568 (2000). 97. Mai, R. T., Yeh, T. S., Kao, C. F., Sun, S. K., et al. Hepatitis C virus core protein recruits nucleolar phosphoprotein B23 and coactivator p300 to relieve the repression effect of transcriptional factor YY1 on B23 gene expression. Oncogene 25, 448-462 (2006). 98. Mills, L. K., Shi, Y. & Millette, R. L. YY1 is the cellular factor shown previously to bind to regulatory regions of several leaky-late (beta gamma, gamma 1) genes of herpes simplex virus type 1. J Virol 68, 1234-1238 (1994). 99. Bauknecht, T., Angel, P., Royer, H. D. & zur Hausen, H. Identification of a negative regulatory domain in the human papillomavirus type 18 promoter: interaction with the transcriptional repressor YY1. EMBO J 11, 4607-4617 (1992). 100. Momoeda, M., Kawase, M., Jane, S. M., Miyamura, K., et al. The transcriptional regulator YY1 binds to the 5'-terminal region of B19 parvovirus and regulates P6 promoter activity. J Virol 68, 7159-7168 (1994). 	   113	  101. Margolis, D. M., Somasundaran, M. & Green, M. R. Human transcription factor YY1 represses human immunodeficiency virus type 1 transcription and virion production. J Virol 68, 905-910 (1994). 102. Coull, J. J., Romerio, F., Sun, J. M., Volker, J. L., et al. The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1. J Virol 74, 6790-6799 (2000). 103. Moriuchi, M., Moriuchi, H., Margolis, D. M. & Fauci, A. S. USF/c-Myc enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a coreceptor for HIV-1 entry. J Immunol 162, 5986-5992 (1999). 104. Inayoshi, Y., Okino, Y., Miyake, K., Mizutani, A., et al. Transcription factor YY1 interacts with retroviral integrases and facilitates integration of moloney murine leukemia virus cDNA into the host chromosomes. J Virol 84, 8250-8261 (2010). 105. Veljkovic, J. & Hansen, U. Lineage-specific and ubiquitous biological roles of the mammalian transcription factor LSF. Gene 343, 23-40 (2004). 106. Kim, C. H., Heath, C., Bertuch, A. & Hansen, U. Specific stimulation of simian virus 40 late transcription in vitro by a cellular factor binding the simian virus 40 21-base-pair repeat promoter element. Proc Natl Acad Sci U S A 84, 6025-6029 (1987). 107. Volker,  L., Rameh, E., Zhu, Q., DeCaprio, J. & Hansen, U. Mitogenic stimulation of resting T cells causes rapid phosphorylation of the transcription factor LSF and increased DNA-binding activity. Genes & Development 11, 1435-1446 (1997). 108. Lim, L. C., Swendeman, S. L. & Sheffery, M. Molecular cloning of the alpha-globin transcription factor CP2. Mol Cell Biol 12, 828-835 (1992). 109. Murata, T., Nitta, M. & Yasuda, K. Transcription factor CP2 is essential for lens-specific expression of the chicken alphaA-crystallin gene. Genes Cells 3, 443-457 (1998). 110. Wu, F. K., Garcia, J. A., Harrich, D. & Gaynor, R. B. Purification of the human immunodeficiency virus type 1 enhancer and TAR binding proteins EBP-1 and UBP-1. EMBO J 7, 2117-2130 (1988). 111. Kato, H., Horikoshi, M. & Roeder, R. G. Repression of HIV-1 transcription by a cellular protein. Science 251, 1476-1479 (1991). 112. Parada, C. A., Yoon, J. B. & Roeder, R. G. A novel LBP-1-mediated restriction of HIV-1 transcription at the level of elongation in vitro. J Biol Chem 270, 2274-2283 (1995). 113. Verdin, E., Paras, P. & Van Lint, C. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J 12, 3249-3259 (1993). 114. Van Lint, C., Emiliani, S., Ott, M. & Verdin, E. Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. EMBO J 15, 1112-1120 (1996). 	   114	  115. Agbottah, E., Deng, L., Dannenberg, L. O., Pumfery, A. & Kashanchi, F. Effect of SWI/SNF chromatin remodeling complex on HIV-1 Tat activated transcription. Retrovirology 3, 48 (2006). 116. Mahmoudi, T., Parra, M., Vries, R. G., Kauder, S. E., et al. The SWI/SNF chromatin-remodeling complex is a cofactor for Tat transactivation of the HIV promoter. J Biol Chem 281, 19960-19968 (2006). 117. O'Brien, S. K., Cao, H., Nathans, R., Ali, A. & Rana, T. M. P-TEFb kinase complex phosphorylates histone H1 to regulate expression of cellular and HIV-1 genes. J Biol Chem 285, 29713-29720 (2010). 118. Rafati, H., Parra, M., Hakre, S., Moshkin, Y., et al. Repressive LTR nucleosome positioning by the BAF complex is required for HIV latency. PLoS Biol 9, e1001206 (2011). 119. Palmisano, I., Chiara, G. D., D’Ambrosio, R. L., Huichalaf, C., et al. Amino acid starvation induces reactivation of silenced transgenes and latent HIV-1 provirus via down-regulation of histone deacetylase 4 (HDAC4). Proceedings of the National Academy of Sciences 109, E2284-E2293 (2012). 120. Van Lint, C., Bouchat, S. & Marcello, A. HIV-1 transcription and latency: an update. Retrovirology 10, 67 (2013). 121. du Chéné, I., Basyuk, E., Lin, Y. L., Triboulet, R., et al. Suv39H1 and HP1gamma are responsible for chromatin-mediated HIV-1 transcriptional silencing and post-integration latency. EMBO J 26, 424-435 (2007). 122. Imai, K., Togami, H. & Okamoto, T. Involvement of histone H3 lysine 9 (H3K9) methyltransferase G9a in the maintenance of HIV-1 latency and its reactivation by BIX01294. J Biol Chem 285, 16538-16545 (2010). 123. Friedman, J., Cho, W. K., Chu, C. K., Keedy, K. S., et al. Epigenetic silencing of HIV-1 by the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J Virol 85, 9078-9089 (2011). 124. Tyagi, M, Kashanchi F. New and novel intrinsic host repressive factors against HIV-1: PAF1 complex, HERC5 and others. Retrovirology 9, 19 (2012) 125. Blazkova, J., Trejbalova, K., Gondois-Rey, F., Halfon, P., et al. CpG methylation controls reactivation of HIV from latency. PLoS Pathog 5, e1000554 (2009). 126. Kauder, S. E., Bosque, A., Lindqvist, A., Planelles, V. & Verdin, E. Epigenetic regulation of HIV-1 latency by cytosine methylation. PLoS Pathog 5, e1000495 (2009). 127. Bartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297 (2004). 128. Obbard, D. J., Gordon, K. H., Buck, A. H. & Jiggins, F. M. The evolution of RNAi as a defence against viruses and transposable elements. Philos Trans R Soc Lond B Biol Sci 364, 99-115 (2009). 	   115	  129. Morris, J. P. & McManus, M. T. Slowing down the Ras lane: miRNAs as tumor suppressors? Sci STKE 2005, pe41 (2005). 130. Ahluwalia, J. K., Khan, S. Z., Soni, K., Rawat, P., et al. Human cellular microRNA hsa-miR-29a interferes with viral nef protein expression and HIV-1 replication. Retrovirology 5, 117 (2008). 131. Klase, Z., Kale, P., Winograd, R., Gupta, M. V., et al. HIV-1 TAR element is processed by Dicer to yield a viral micro-RNA involved in chromatin remodeling of the viral LTR. BMC Mol Biol 8, 63 (2007). 132. Ouellet, D. L., Plante, I., Landry, P., Barat, C., et al. Identification of functional microRNAs released through asymmetrical processing of HIV-1 TAR element. Nucleic Acids Res 36, 2353-2365 (2008). 133. Omoto, S., Ito, M., Tsutsumi, Y., Ichikawa, Y., et al. HIV-1 nef suppression by virally encoded microRNA. Retrovirology 1, 44 (2004). 134. Omoto, S. & Fujii, Y. R. Regulation of human immunodeficiency virus 1 transcription by nef microRNA. J Gen Virol 86, 751-755 (2005). 135. Kim, Y. K., Bourgeois, C. F., Isel, C., Churcher, M. J. & Karn, J. Phosphorylation of the RNA polymerase II carboxyl-terminal domain by CDK9 is directly responsible for human immunodeficiency virus type 1 Tat-activated transcriptional elongation. Mol Cell Biol 22, 4622-4637 (2002). 136. Dow, E. C., Liu, H. & Rice, A. P. T-loop phosphorylated Cdk9 localizes to nuclear speckle domains which may serve as sites of active P-TEFb function and exchange between the Brd4 and 7SK/HEXIM1 regulatory complexes. J Cell Physiol 224, 84-93 (2010). 137. Tyagi, M., Pearson, R. J. & Karn, J. Establishment of HIV Latency in Primary CD4+ Cells Is due to Epigenetic Transcriptional Silencing and P-TEFb Restriction. Journal of Virology 84, 6425-6437 (2010). 138. Ramakrishnan, R. & Rice, A. P. Cdk9 T-loop phosphorylation is regulated by the calcium signaling pathway. J Cell Physiol 227, 609-617 (2012). 139. Ramakrishnan, R., Dow, E. C. & Rice, A. P. Characterization of Cdk9 T-loop phosphorylation in resting and activated CD4(+) T lymphocytes. J Leukoc Biol 86, 1345-1350 (2009). 140. Ghose, R., Liou, L. Y., Herrmann, C. H. & Rice, A. P. Induction of TAK (cyclin T1/P-TEFb) in purified resting CD4(+) T lymphocytes by combination of cytokines. J Virol 75, 11336-11343 (2001). 141. Sung, T. L. & Rice, A. P. miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1. PLoS Pathog 5, e1000263 (2009). 142. Sedaghat, A. R., Siliciano, R. F., & Wilke, C. O. Low-level HIV-1 replication and the dynamics of the resting CD4+ T cell reservoir for HIV-1 in the setting of HAART. BMC Infect Dis 8, 2 (2008). 	   116	  143. Harrigan, P. R., Whaley, M. & Montaner, J. S. Rate of HIV-1 RNA rebound upon stopping antiretroviral therapy. AIDS 13, F59-F62 (1999). 144. Davey, R. T., Bhat, N., Yoder, C., Chun, T. W., et al. HIV-1 and T cell dynamics after interruption of highly active antiretroviral therapy (HAART) in patients with a history of sustained viral suppression. Proc Natl Acad Sci U S A 96, 15109-15114 (1999). 145. Gebo, K. A., Fleishman, J. A., Conviser, R., Hellinger, J., et al. Contemporary costs of HIV healthcare in the HAART era. AIDS 24, 2705-2715 (2010). 146. Hester, E. K. HIV medications: an update and review of metabolic complications. Nutr Clin Pract 27, 51-64 (2012). 147. Shafer, R. W. & Schapiro, J. M. HIV-1 drug resistance mutations: an updated framework for the second decade of HAART. AIDS Rev 10, 67-84 (2008). 148. Harris, R. S., Hultquist, J. F. & Evans, D. T. The restriction factors of human immunodeficiency virus. J Biol Chem 287, 40875-40883 (2012). 149. Margolis, D. M. Mechanisms of HIV latency: an emerging picture of complexity. Curr HIV/AIDS Rep 7, 37-43 (2010). 150. Steingrover, R., Pogány, K., Fernandez Garcia, E., Jurriaans, S., et al. HIV-1 viral rebound dynamics after a single treatment interruption depends on time of initiation of highly active antiretroviral therapy. AIDS 22, 1583-1588 (2008). 151. Choudhary, S. K. & Margolis, D. M. Curing HIV: Pharmacologic approaches to target HIV-1 latency. Annu Rev Pharmacol Toxicol 51, 397-418 (2011). 152. Kulkosky, J., Nunnari, G., Otero, M., Calarota, S., et al. Intensification and stimulation therapy for human immunodeficiency virus type 1 reservoirs in infected persons receiving virally suppressive highly active antiretroviral therapy. J Infect Dis 186, 1403-1411 (2002). 153. Lehrman, G., Hogue, I. B., Palmer, S., Jennings, C., et al. Depletion of latent HIV-1 infection in vivo: a proof-of-concept study. Lancet 366, 549-555 (2005). 154. Archin, N. M., Espeseth, A., Parker, D., Cheema, M., et al. Expression of latent HIV induced by the potent HDAC inhibitor suberoylanilide hydroxamic acid. AIDS Res Hum Retroviruses 25, 207-212 (2009). 155. Victoriano, A. F., Imai, K., Togami, H., Ueno, T., et al. Novel histone deacetylase inhibitor NCH-51 activates latent HIV-1 gene expression. FEBS Lett 585, 1103-1111 (2011). 156. Marks, P. A., Richon, V. M. & Rifkind, R. A. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst 92, 1210-1216 (2000). 157. Skov, S., Rieneck, K., Bovin, L. F., Skak, K., et al. Histone deacetylase inhibitors: a new class of immunosuppressors targeting a novel signal pathway essential for CD154 expression. Blood 101, 1430-1438 (2003). 	   117	  158. Crazzolara, R., Jöhrer, K., Johnstone, R. W., Greil, R., et al. Histone deacetylase inhibitors potently repress CXCR4 chemokine receptor expression and function in acute lymphoblastic leukaemia. Br J Haematol 119, 965-969 (2002). 159. Quivy, V., Adam, E., Collette, Y., Demonte, D., et al. Synergistic activation of human immunodeficiency virus type 1 promoter activity by NF-kappaB and inhibitors of deacetylases: potential perspectives for the development of therapeutic strategies. J Virol 76, 11091-11103 (2002). 160. Demonté, D., Quivy, V., Colette, Y. & Lint, C. V. Administration of HDAC inhibitors to reactivate HIV-1 expression in latent cellular reservoirs: implications for the development of therapeutic strategies. Biochemical Pharmacology 68, 1231 - 1238 (2004). 161. Reuse, S., Calao, M., Kabeya, K., Guiguen, A., et al. Synergistic activation of HIV-1 expression by deacetylase inhibitors and prostratin: implications for treatment of latent infection. PLoS One 4, e6093 (2009). 162. Contreras, X., Schweneker, M., Chen, C. S., McCune, J. M., et al. Suberoylanilide hydroxamic acid reactivates HIV from latently infected cells. J Biol Chem 284, 6782-6789 (2009). 163. Huber, K., Doyon, G., Plaks, J., Fyne, E., et al. Inhibitors of histone deacetylases: correlation between isoform specificity and reactivation of HIV type 1 (HIV-1) from latently infected cells. J Biol Chem 286, 22211-22218 (2011). 164. Matalon, S., Rasmussen, T. A. & Dinarello, C. A. Histone deacetylase inhibitors for purging HIV-1 from the latent reservoir. Mol Med 17, 466-472 (2011). 165. Blazkova, J., Chun, T. W., Belay, B. W., Murray, D., et al. Effect of histone deacetylase inhibitors on HIV production in latently infected, resting CD4(+) T cells from infected individuals receiving effective antiretroviral therapy. J Infect Dis 206, 765-769 (2012). 166. Archin, N. M., Vaidya, N. K., Kuruc, J. D., Liberty, A. L., et al. Immediate antiviral therapy appears to restrict resting CD4+ cell HIV-1 infection without accelerating the decay of latent infection. Proc Natl Acad Sci U S A 109, 9523-9528 (2012). 167. Sagot-Lerolle, N., Lamine, A., Chaix, M. L., Boufassa, F., et al. Prolonged valproic acid treatment does not reduce the size of latent HIV reservoir. AIDS 22, 1125-1129 (2008). 168. Choi, B. S., Lee, H. S., Oh, Y. T., Hyun, Y. L., et al. Novel histone deacetylase inhibitors CG05 and CG06 effectively reactivate latently infected HIV-1. AIDS 24, 609-611 (2010). 169. Qu, X., Ying, H., Wang, X., Kong, C., et al. Histone deacetylase inhibitor MC1293 induces latent HIV-1 reactivation by histone modification in vitro latency cell lines. Curr HIV Res (2012). 170. Micheva-Viteva, S., Kobayashi, Y., Edelstein, L. C., Pacchia, A. L., et al. High-throughput screening uncovers a compound that activates latent HIV-1 and acts 	   118	  cooperatively with a histone deacetylase (HDAC) inhibitor. J Biol Chem 286, 21083-21091 (2011). 171. Sadowski, I., Lourenco, P. & Malcolm, T. Factors controlling chromatin organization and nucleosome positioning for establishment and maintenance of HIV latency. Curr HIV Res 6, 286-295 (2008). 172. Bouchat, S., Gatot, J. S., Kabeya, K., Cardona, C., et al. Histone methyltransferase inhibitors induce HIV-1 recovery in resting CD4(+) T cells from HIV-1-infected HAART-treated patients. AIDS 26, 1473-1482 (2012). 173. Wolschendorf, F., Duverger, A., Jones, J., Wagner, F. H., et al. Hit-and-run stimulation: a novel concept to reactivate latent HIV-1 infection without cytokine gene induction. J Virol 84, 8712-8720 (2010). 174. Xing, S., Bhat, S., Shroff, N. S., Zhang, H., et al. Novel structurally related compounds reactivate latent HIV-1 in a bcl-2-transduced primary CD4+ T cell model without inducing global T cell activation. J Antimicrob Chemother 67, 398-403 (2012). 175. Gallastegui, E., Marshall, B., Vidal, D., Sanchez-Duffhues, G., et al. Combination of biological screening in a cellular model of viral latency and virtual screening identifies novel compounds that reactivate HIV-1. J Virol 86, 3795-3808 (2012). 176. Shishido, T., Wolschendorf, F., Duverger, A., Wagner, F., et al. Selected drugs with reported secondary cell-differentiating capacity prime latent HIV-1 infection for reactivation. J Virol 86, 9055-9069 (2012). 177. Barreto, K., Bharathikumar, V. M., Ricardo, A., DeCoteau, J. F., et al. A genetic screen for isolating "lariat" Peptide inhibitors of protein function. Chem Biol 16, 1148-1157 (2009). 178. Bharathikumar, V. M., Barreto, K., Decoteau, J. F. & Geyer, C. R. Allosteric Lariat Peptide Inhibitors of Abl Kinase. Chembiochem (2013). 179. Gogarten, J. P., Senejani, A. G., Zhaxybayeva, O., Olendzenski, L. & Hilario, E. Inteins: structure, function, and evolution. Annu Rev Microbiol 56, 263-287 (2002). 180. Gogarten, J. P. & Hilario, E. Inteins, introns, and homing endonucleases: recent revelations about the life cycle of parasitic genetic elements. BMC Evol Biol 6, 94 (2006). 181. Scott, C. P., Abel-Santos, E., Wall, M., Wahnon, D. C. & Benkovic, S. J. Production of cyclic peptides and proteins in vivo. Proc Natl Acad Sci U S A 96, 13638-13643 (1999). 182. Aiken, C. Pseudotyping human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis virus targets HIV-1 entry to an endocytic pathway and suppresses both the requirement for Nef and the sensitivity to cyclosporin A. J Virol 71, 5871-5877 (1997). 183. Geyer, C. R. & Brent, R. Selection of genetic agents from random peptide aptamer expression libraries. Methods Enzymol 328, 171-208 (2000). 	   119	  184. Hua, S. B., Qiu, M., Chan, E., Zhu, L. & Luo, Y. Minimum length of sequence homology required for in vivo cloning by homologous recombination in yeast. Plasmid 38, 91-96 (1997). 185. Gietz, R. D. & Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2, 31-34 (2007). 186. Pereira, L. A., Bentley, K., Peeters, A., Churchill, M. J. & Deacon, N. J. A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res 28, 663-668 (2000). 187. Hahn, S. The Yin and the Yang of mammalian transcription. Current Biology 2, 152 - 154 (1992). 188. Shrivastava, A. & Calame, K. An analysis of genes regulated by the multi-functional transcriptional regulator Yin Yang-1. Nucleic Acids Res 22, 5151-5155 (1994). 189. Yant, S. R., Zhu, W., Millinoff, D., Slightom, J. L., et al. High affinity YY1 binding motifs: identification of two core types (ACAT and CCAT) and distribution of potential binding sites within the human beta globin cluster. Nucleic Acids Res 23, 4353-4362 (1995). 190. Zalani, S., Coppage, A., Holley-Guthrie, E. & Kenney, S. The cellular YY1 transcription factor binds a cis-acting, negatively regulating element in the Epstein-Barr virus BRLF1 promoter. J Virol 71, 3268-3274 (1997). 191. O'Connor, M. J., Tan, S. H., Tan, C. H. & Bernard, H. U. YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity. J Virol 70, 6529-6539 (1996). 192. Malcolm, T., Kam, J., Pour, P. S. & Sadowski, I. Specific interaction of TFII-I with an upstream element on the HIV-1 LTR regulates induction of latent provirus. FEBS Lett 582, 3903-3908 (2008). 193. Duverger, A., Wolschendorf, F., Zhang, M., Wagner, F., et al. An AP-1 binding site in the enhancer/core element of the HIV-1 promoter controls the ability of HIV-1 to establish latent infection. J Virol 87, 4 (2013). 194. Natesan, S. & Gilman, Z. DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes & Development 7, 2497-2509 (1993). 195. Kim, J. & Shapiro, D. J. In simple synthetic promoters YY1-induced DNA bending is important in transcription activation and repression. Nucleic Acids Res 24, 4341-4348 (1996). 196. Liu, R., Baillie, J., Sissons, J. G. & Sinclair, J. H. The transcription factor YY1 binds to negative regulatory elements in the human cytomegalovirus major immediate early enhancer/promoter and mediates repression in non-permissive cells. Nucleic Acids Res 22, 2453-2459 (1994). 197. Kolesnitchenko, V., King, L., Riva, A., Tani, Y., et al. A major human immunodeficiency virus type 1-initiated killing pathway distinct from apoptosis. J Virol 71, 9753-9763 (1997). 	   120	  198. Casella, C. R., Rapaport, E. L. & Finkel, T. H. Vpu increases susceptibility of human immunodeficiency virus type 1-infected cells to fas killing. J Virol 73, 92-100 (1999). 199. Lewinski, M. K., Bisgrove, D., Shinn, P., Chen, H., et al. Genome-wide analysis of chromosomal features repressing human immunodeficiency virus transcription. J Virol 79, 6610-6619 (2005). 200. Lin, S., Zhang, Y., Ying, H. & Zhu, H. HIV-1 reactivation induced by apicidin involves histone modification in latently infected cells. Curr HIV Res 9, 202-208 (2011). 201. Greiner, D., Bonaldi, T., Eskeland, R., Roemer, E. & Imhof, A. Identification of a specific inhibitor of the histone methyltransferase SU(VAR)3-9. Nat Chem Biol 1, 143-145 (2005). 202. Lakshmikuttyamma, A., Scott, S. A., DeCoteau, J. F. & Geyer, C. R. Reexpression of epigenetically silenced AML tumor suppressor genes by SUV39H1 inhibition. Oncogene 29, 576-588 (2010). 203. Isham, C. R., Tibodeau, J. D., Jin, W., Xu, R., et al. Chaetocin: a promising new antimyeloma agent with in vitro and in vivo activity mediated via imposition of oxidative stress. Blood 109, 2579-2588 (2007). 204. Cherrier, T., Suzanne, S., Redel, L., Calao, M., et al. p21(WAF1) gene promoter is epigenetically silenced by CTIP2 and SUV39H1. Oncogene 28, 3380-3389 (2009). 205. Prins, J. M., Jurriaans, S., van Praag, R. M., Blaak, H., et al. Immuno-activation with anti-CD3 and recombinant human IL-2 in HIV-1-infected patients on potent antiretroviral therapy. AIDS 13, 2405-2410 (1999). 206. Berkhout, B. & Jeang, K. T. Functional roles for the TATA promoter and enhancers in basal and Tat-induced expression of the human immunodeficiency virus type 1 long terminal repeat. J Virol 66, 139-149 (1992). 207. Haas, A., Zimmermann, K. & Oxenius, A. Antigen-dependent and -independent mechanisms of T and B cell hyperactivation during chronic HIV-1 infection. J Virol 85, 12102-12113 (2011). 208. Archer, T. K., Fryer, C. J., Lee, H. L., Zaniewski, E., et al. Steroid hormone receptor status defines the MMTV promoter chromatin structure in vivo. J Steroid Biochem Mol Biol 53, 421-429 (1995). 209. Jordan, A., Defechereux, P. & Verdin, E. The site of HIV-1 integration in the human genome determines basal transcriptional activity and response to Tat transactivation. EMBO J 20, 1726-1738 (2001). 210. Chan, J. K. & Greene, W. C. Dynamic roles for NF-κB in HTLV-I and HIV-1 retroviral pathogenesis. Immunol Rev 246, 286-310 (2012). 211. Schreck, R., Albermann, K. & Baeuerle, P. A. Nuclear factor kappa B: an oxidative stress-responsive transcription factor of eukaryotic cells (a review). Free Radic Res Commun 17, 221-237 (1992). 	   121	  212. Roy, A. L., Carruthers, C., Gutjahr, T. & Roeder, R. G. Direct role for Myc in transcription initiation mediated by interactions with TFII-I. Nature 365, 359-361 (1993). 213. Crusselle-Davis, V. J., Vieira, K. F., Zhou, Z., Anantharaman, A. & Bungert, J. Antagonistic Regulation of β-Globin Gene Expression by Helix-Loop-Helix Proteins USF and TFII-I. Molecular and Cellular Biology 26, 6832-6843 (2006). 214. Ferre-D’Amare, A. R., Pognonec, P., Roeder, R. G. & Burley, S. K., Structure and function of the b/HLH/Z domain of USF. EMBO J 13, 180-189 (1994). 215. Lusic, M., Marini, B., Ali, H., Lucic, B., Luzzati, R. & Giacca, M. Proximity to PML Nuclear Bodies Regulates HIV-1 Latency in CD4+ T Cells. Cell Host & Microbe 13, 665-677 (2013). 216. Dahabieh, M. S., Ooms, M., Simon, V & Sadowski, I. A Doubly Fluorescent HIV-1 Reporter Shows that the Majority of Integrated HIV-1 Is Latent Shortly after Infection. J Virol 87, 4716-4727 (2013). 217. Barton, K. & Margolis, D. Selective Targeting of the Repressive Transcription Factors YY1 and cMyc to Disrupt Quiescent Human Immunodeficiency Viruses. AIDS Res Hum Retroviruses 28, 289-298 (2012). 218. Nakatani, Y. HIV-1 transcription: activation mediated by acetylation of Tat. Structure 10, 443-446 (2002). 219. Saayman, S., Ackley, A., Turner, A. W., Famiglietti, M, et al. An HIV-Encoded Antisense Long Noncoding RNA Epigenetically Regulates Viral Transcription. Mol Ther 28 (2014). Epub ahead of print. 220. Jeon, T. & Lee, J. T. YY1 Tethers Xist RNA to the Inactive X Nucleation Center. Cell 146, 119-133 (2011). 221. Mohd-Sarip, A., Venturini, F., Chalkley, G. E. & Verrijzer, C. P. Pleiohomeotic can link polycomb to DNA and mediate transcriptional repression. Mol Cell Biol 22,  7473-7483 (2002). 222. Imai, K., Kamio, N., Cueno, M. E., Saito, Y., et al. Role of histone H3 lysine 9 methyltransferase Suv39 h1 in maintaining Esteinn-Barr virus latency in B95-8 cells. FEBS J (2014) Epub ahead of print. 223. Archin, N. M., Liberty, A. M., Kashuba, A. D, Choudhary, J. D., et al. Administration of vorinostat disrupts HIV-1 latency in patients on antiretroviral therapy. Nature. 487, 482-485 (2012). 224. Archin, N. M., Bateson, R., Tripathy, M., Crooks, A. M., et al. HIV-1 Expression within Resting CD4 T-Cells Following Multiple Doses of Vorinostat. J Infect Dis (2014) Epub ahead of print 225. Bullen, C. K., Laird, G. M., Durrand, C. M., Siliciano, J. D., Siliciano, R. F. New ex vivo approaches distinguish effective and ineffective single agents for reversing HIV-1 latency in vivo. Nat Med (2014) Epub ahead of print 	   122	  226. Israel, N., Gougerot-Pocidalo, M. A. Oxidative stress in human immunodeficiency virus infection. Cell Mol Life Sci 53, 864-870 (1997). 227. Isham, C. R., Tibodeau, J. D., Bossou, A. R., Merchan, J. R. & Bible, K. C. The anticancer effects of chaetocin are independent of programmed cell death and hypoxia, and are associated with inhibition of endothelial cell proliferation. Br J Cancer 106, 314-323 (2012). 228. Chaib, H., Nebbioso, A., Prebet, T., Castellano, R., et al. Anti-leukemia activity of chaetocin via death receptor-dependent apoptosis and dual modulation of the histone methyl-transferase SUV39H1. Leukemia 26, 662-674 (2012). 229. Bharathikumar, V. M., Barreto, K., Decoteau, J. F., Geyer, C. R. Allosteric Lariat Peptide Inhibitors of Abl Kinase. Chembiochem 4, 2119-2125 (2013). 230. Christ, F., Debyser, A. The LEDGF/p75 integrase interaction, a novel target for anti-HIV therapy. Virology 435 102-109 (2013). 231. Desimmie, B. A., Humbert, M., Lescrinier, E., Hendrix, J., et al. Phage Display-directed Discovery of LEDGF/p75 Binding Cyclic Peptide Inhibitors of HIV Replication. Mol Ther 20, 2064-2075 (2012). 232. Penberthy, W. T., Chari, S., Cole, A. L., Cole, A. M. Retrocyclins and their activity against HIV-1. Cell Mol Life Sci 68, 2231-2242 (2011)  	    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167431/manifest

Comment

Related Items