Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Contribution of p-glycoprotein mediated-efflux to the epithelial transport of amphotericin b in caco-2… Osei-Twum, Jo-Ann B. 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_spring_2014_oseitwum_joann.pdf [ 37.58MB ]
Metadata
JSON: 24-1.0167420.json
JSON-LD: 24-1.0167420-ld.json
RDF/XML (Pretty): 24-1.0167420-rdf.xml
RDF/JSON: 24-1.0167420-rdf.json
Turtle: 24-1.0167420-turtle.txt
N-Triples: 24-1.0167420-rdf-ntriples.txt
Original Record: 24-1.0167420-source.json
Full Text
24-1.0167420-fulltext.txt
Citation
24-1.0167420.ris

Full Text

CONTRIBUTION OF P-GLYCOPROTEIN MEDIATED-EFFLUX TO THE EPITHELIAL TRANSPORT OF AMPHOTERICIN B IN CACO-2 CELLS  by Jo-Ann B. Osei-Twum  B.Sc., The University of British Columbia, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Pharmaceutical Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2014  © Jo-Ann B. Osei-Twum, 2014  ii  Abstract  Background: Amphotericin B (AmB) is a highly efficacious therapeutic for invasive fungal infections (IFIs) and protozoal diseases. Increasing prevalence of these conditions necessitates the development of an oral AmB formulation, with reduced toxicity, improved tissue distribution, and improved affordability. Efflux transporters, such as the ABCB1 gene product P-glycoprotein (P-gp), affect the oral bioavailability and disposition of a diverse range of compounds. It remains to be ascertained whether AmB is a substrate of P-gp mediated efflux. Therefore, the objective of this study was to determine whether P-gp contributes to the epithelial transport of AmB in the enterocyte-like Caco-2 cell model.  Methods: Transient knockdown of ABCB1 was achieved in Caco-2 cells using small interfering RNA. The effect of this knockdown on Caco-2 cell differentiation, transporter expression, and P-gp function were investigated using the measurement of trans-epithelial electrical resistance, Western blot analysis, bi-directional transport and accumulation of Rhodamine 123, a fluorescent P-gp substrate. The interaction between AmB and P-gp was examined using a P-gp ATPase activity and a LDH assay. The ABCB1 transient knockdown Caco-2 cell model and a cell-based AmB HPLC-UV assay were employed to quantify AmB cellular association.    iii  Results: Transfected and non-transfected Caco-2 cells formed confluent and differentiated monolayers. Transient knockdown of ABCB1 reduced P-gp expression and efflux efficiency by approximately 63% compared to non-transfected cells. AmB did not stimulate P-gp ATPase activity and AmB cytotoxicity did not differ between transfected and non-transfected cells. Increased association of AmB was demonstrated for ABCB1 siRNA transfected cells compared to non-transfected cells, at the highest tested AmB concentration (5 µg/mL).  Conclusions: Small interfering RNA is a possible alternative to the physical inhibition of P-gp, as the transient knockdown of ABCB1 in Caco-2 cells decreased P-gp expression and function. Although there was an increased cellular association of AmB with ABCB1 siRNA transfected cells, differences were not observed for P-gp ATPase activity or between AmB cytotoxicity profiles. The data suggested that P-gp has a minimal contribution to the epithelial transport of AmB in Caco-2 cells.  Significance: Clinically, it is unlikely that the oral bioavailability and drug disposition of AmB will be affected by P-gp mediated efflux. iv  Preface  At the time of writing, part of the work presented in this thesis has been published or has been submitted for publication: ! Part of work presented in Chapter 2 has been published. Lee SD, Osei-Twum J-A, Wasan KM. Dose-dependent targeted suppression of P-glycoprotein expression and function in Caco-2 cells. Mol Pharm. 2013 Jun 3;10(6):2323–30. I conducted all the experiments evaluating P-glycoprotein activity, using the cell culture model described in this thesis. I wrote the sections on Rhodamine 123 Uptake and Transmembrane Transport of Rhodamine 123. Dr. Stephen Lee designed the initial experimental protocol and performed RT-PCR, Western blot analysis, and immunofluoresence experiments. Dr. Lee wrote the initial manuscript draft excluding the sections mentioned above. Dr. Kishor Wasan is the advisor and principal investigator on the grant that funded this work. ! A version of Chapter 4 has been submitted for publication. I conducted all the experiments presented in this thesis and wrote the manuscript. Dr. Kishor Wasan is the advisor and principal investigator on the grant that funded this work.  v  Table of Contents  Abstract.......................................................................................................................................... ii!Preface........................................................................................................................................... iv!Table of Contents ...........................................................................................................................v!List of Tables ................................................................................................................................ ix!List of Figures.................................................................................................................................x!List of Abbreviations ................................................................................................................. xiii!Acknowledgements ......................................................................................................................xv!Dedication ................................................................................................................................... xvi!Chapter 1: Introduction ................................................................................................................1!1.1! Invasive Fungal Infections................................................................................................. 2!1.2! Leishmaniasis..................................................................................................................... 4!1.3! Amphotericin B.................................................................................................................. 5!1.3.1! Mechanism of Action.................................................................................................. 5!1.3.2! Drug Properties ........................................................................................................... 5!1.3.3! Therapeutic Limitations .............................................................................................. 6!1.3.4! Formulations ............................................................................................................... 7!1.4! P-glycoprotein.................................................................................................................. 11!1.5! Evidence of Amphotericin B and P-glycoprotein Interaction.......................................... 15!1.6! Implications of Previous Research................................................................................... 20!1.7! Research Hypothesis........................................................................................................ 20!1.8! Aims of the Thesis ........................................................................................................... 20!vi  1.9! Rationale and Significance .............................................................................................. 21!Chapter 2: Transient Knockdown of ABCB1 in Caco-2 Cells.................................................23!2.1! Introduction...................................................................................................................... 23!2.2! Materials and Methods..................................................................................................... 24!2.2.1! Reagents.................................................................................................................... 24!2.2.2! Cell Culture............................................................................................................... 25!2.2.3! Transfection .............................................................................................................. 26!2.2.4! Trans-epithelial Electrical Resistance....................................................................... 27!2.2.5! Rhodamine 123 Bi-directional Transport Studies..................................................... 28!2.2.6! Rhodamine 123 Uptake Studies................................................................................ 29!2.2.7! Protein Quantification............................................................................................... 30!2.2.8! Western Blot Analysis .............................................................................................. 31!2.2.9! Data and Statistical Analysis .................................................................................... 34!2.3! Results.............................................................................................................................. 34!2.3.1! Monolayer Integrity .................................................................................................. 35!2.3.2! Cell Differentiation ................................................................................................... 38!2.3.3! Knockdown of ABCB1 in Caco-2 cells..................................................................... 39!2.3.4! Expression of Other Efflux Transporters.................................................................. 40!2.3.5! Rhodamine 123 Bi-directional Transport Studies..................................................... 41!2.3.6! Rhodamine 123 Uptake Studies................................................................................ 44!2.4! Discussion ........................................................................................................................ 47!Chapter 3: Cell-based Amphotericin B HPLC Assay ..............................................................53!3.1! Introduction...................................................................................................................... 53!vii  3.2! Materials and Methods..................................................................................................... 53!3.2.1! Reagents.................................................................................................................... 53!3.2.2! Amphotericin B Preparation ..................................................................................... 54!3.2.3! High Performance Liquid Chromatography ............................................................. 54!3.2.3.1! Instrumentation and Analytical Conditions ....................................................... 54!3.2.3.2! Lower Limit of Detection and of Quantification ............................................... 55!3.2.3.3! Recovery ............................................................................................................ 56!3.2.3.4! Intra-day Accuracy and Precision...................................................................... 56!3.2.3.5! Inter-day Accuracy and Precision...................................................................... 57!3.2.3.6! Calibration Curve............................................................................................... 57!3.3! Results.............................................................................................................................. 58!3.3.1! Amphotericin B Preparation ..................................................................................... 58!3.3.2! Lower Limit of Detection and of Quantification ...................................................... 59!3.3.3! Recovery ................................................................................................................... 63!3.3.4! Intra-day and Inter-day Accuracy and Precision ...................................................... 64!3.3.5! Calibration Curve...................................................................................................... 66!3.4! Discussion ........................................................................................................................ 67!Chapter 4: Amphotericin B and P-glycoprotein Interaction...................................................69!4.1! Introduction...................................................................................................................... 69!4.2! Materials and Methods..................................................................................................... 69!4.2.1! Reagents.................................................................................................................... 69!4.2.2! P-gp ATPase Activity ............................................................................................... 70!4.2.3! Analysis of Toxicity and Cell Death......................................................................... 74!viii  4.2.4! Cellular Association of AmB.................................................................................... 76!4.2.5! Western Blot Analysis .............................................................................................. 76!4.2.6! Data and Statistical Analysis .................................................................................... 77!4.3! Results.............................................................................................................................. 78!4.3.1! Membrane-based ATPase Assay .............................................................................. 78!4.3.2! Analysis of Toxicity and Cell Death......................................................................... 80!4.3.3! Cellular Association of Amphotericin B................................................................... 87!4.4! Discussion ........................................................................................................................ 89!4.4.1! Membrane-based ATPase Assay .............................................................................. 90!4.4.2! Analysis of Toxicity and Cell Death......................................................................... 91!4.4.3! Cellular Association of Amphotericin B................................................................... 92!Chapter 5: Discussion..................................................................................................................95!5.1! Limitations and Future Directions ................................................................................... 96!5.2! Conclusion ....................................................................................................................... 99!5.3! Significance of Findings .................................................................................................. 99!References...................................................................................................................................101!Appendices..................................................................................................................................115!Appendix A............................................................................................................................. 115!Appendix B ............................................................................................................................. 127! ix  List of Tables  Table 1.1: Geographic distribution, estimated burden, and mortality rates of IFIs commonly treated with Amphotericin B........................................................................................................... 2!Table 2.1. Blocking solutions for Western blot analysis of efflux transporters and a brush border membrane protein in Caco-2 cell lysates. ..................................................................................... 32!Table 2.2. Characteristics of primary antibodies used for the detection of efflux transporters and a brush border membrane protein in Caco-2 cell lysates. ............................................................. 33!Table 2.3. Characteristics of secondary antibodies used to detect efflux transporters and a brush border membrane protein in Caco-2 cell lysates........................................................................... 33!Table 3.1: Signal-to-noise ratio for Amphotericin B standards prepared with Caco-2 cell lysates........................................................................................................................................................ 62!Table 3.2: The % recovery of Amphotericin B for Caco-2 cell lysates........................................ 64!Table 3.3: The intra-day and inter-day accuracy and precision of Amphotericin B in Caco-2 cell lysates............................................................................................................................................ 65!Table 4.1: Trans-epithelial electrical resistance values for transfected and non-transfected Caco-2 cells incubated with Amphotericin B............................................................................................ 86!x  List of Figures  Figure 1.1: Chemical structure of Amphotericin B. ....................................................................... 1!Figure 1.2: Schematic of an intestinal epithelial cell and its associated transporters. .................. 10!Figure 1.3: Model of P-glycoprotein mediated efflux. ................................................................. 12!Figure 2.1: Trans-epithelial electrical resistance values for 200 nM ABCB1 siRNA transfected cells and control cells.................................................................................................................... 36!Figure 2.2: Time dependent measurement of trans-epithelial electrical resistance values for 200 nM ABCB1 siRNA transfected cells and control cells.................................................................. 37!Figure 2.3: Representative figure of the detection of sucrase-isomaltase, a brush border protein, in 200 nM ABCB1 siRNA transfected cells and NTC cells.......................................................... 38!Figure 2.4: Representative figure of the time dependent reduction of P-glycoprotein protein levels in 200 nM ABCB1 siRNA transfected cells and P-glycoprotein levels in NTC cells. ....... 40!Figure 2.5: Protein levels of other transporters in 200 nM ABCB1 siRNA transfected cells and NTC cells. ..................................................................................................................................... 41!Figure 2.6: Flux ratio of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells. .............................................................................................................................................. 43!Figure 2.7: Accumulation of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells (BA).......................................................................................................................... 45!Figure 2.8: Accumulation of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells (AB).......................................................................................................................... 46!Figure 3.1: UV-Vis spectrogram of Amphotericin B. .................................................................. 59!Figure 3.2: Chromatogram of injected blank Caco-2 cell lysates................................................. 60!xi  Figure 3.3: Representative chromatogram for peak separation of Amphotericin B and naphthalene (10 µg/mL)................................................................................................................ 61!Figure 3.4: Representative chromatogram of the LLOD (5 ng/30 µg protein)............................. 62!Figure 3.5: Representative calibration curve for an Amphotericin B cell-based HPLC assay..... 67!Figure 4.1: Measurement of P-gp ATPase activity with the Pgp-Glo™ Assay System............... 71!Figure 4.2: Representative ATP standard curve for the quantification of unconsumed ATP (nmol) in test compounds and controls. ........................................................................................ 73!Figure 4.3: Effect of Amphotericin B on the P-glycoprotein ATPase activity (%) of recombinant human P-glycoprotein membranes. .............................................................................................. 79!Figure 4.4: Cytotoxic effect of Amphotericin B on 200 nM ABCB1 siRNA cells. ...................... 82!Figure 4.5: Cytotoxic effect of Amphotericin B on 200 nM NC siRNA cells. ............................ 83!Figure 4.6: Cytotoxic effect of Amphotericin B on NTC cells..................................................... 84!Figure 4.7: Amount of Amphotericin B (ng/30 µg protein) associated with 200 nM ABCB1 siRNA cells and NTC cells. .......................................................................................................... 88!Figure A.1: Inter-day calibration curve (day 1) for an Amphotericin B cell-based HPLC-UV assay.. .......................................................................................................................................... 115!Figure A.2: Inter-day calibration curve (day 2) for an Amphotericin B cell-based HPLC-UV assay............................................................................................................................................ 116!Figure A.3: Inter-day calibration curve (day 3) for an Amphotericin B cell-based HPLC-UV assay............................................................................................................................................ 117!Figure A.4: Calibration curve for an Amphotericin B cell-based HPLC-UV assay................... 118!Figure A.5: Calibration curve for an Amphotericin B cell-based HPLC-UV assay................... 119!xii  Figure A.6: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 1 µg/mL Amphotericin B for 180 minutes......................................................... 120!Figure A.7: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 2.5 µg/mL Amphotericin B for 180 minutes...................................................... 121!Figure A.8: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 5 µg/mL Amphotericin B for 180 minutes......................................................... 122!Figure A.9: Representative chromatogram for NTC cells incubated with 1 µg/mL Amphotericin B for 180 minutes........................................................................................................................ 123!Figure A.10: Representative chromatogram for NTC cells incubated with 2.5 µg/mL Amphotericin B for 180 minutes. ............................................................................................... 124!Figure A.11: Representative chromatogram for NTC cells incubated with 5 µg/mL Amphotericin B for 180 minutes........................................................................................................................ 125!Figure A.12: Representative chromatogram for peak separation of Amphotericin B and Naphthalene. ............................................................................................................................... 126!Figure B.1: Protein concentration for transfected and non-transfected Caco-2 cells incubated with Amphotericin B........................................................................................................................... 127!Figure B.2: Detection of P-glycoprotein in 200 nM ABCB1 siRNA transfected and non-transfected Caco-2 cells incubated with Amphotericin B (1 µg/mL and 2.5 µg/mL) for 180 minutes on day 5 post-transfection. ............................................................................................ 128! xiii  List of Abbreviations ABC ATP binding cassette ADRs Adverse drug reactions AIDS Acquired immunodeficiency syndrome AmB Amphotericin B AUC Area under the curve BCRP Breast cancer resistance protein BCS Biopharmaceutics Classification System BSA Bovine serum albumin CYP3A4 Cytochrome P450 3A4 DMEM Dulbecco’s Modified Eagle Medium EDTA Ethylenediaminetetraacetic acid FDA Food and Drug Administration HBSS Hanks Balanced Salt Solution HI-FBS Heat inactivated fetal bovine serum HPLC High Performance Liquid Chromatography IFIs Invasive fungal infections INT Tetrazolium salt IS Internal standard L-AmB Liposomal Amphotericin B MDCKII-MDR1 Madin Darby Canine Kidney cells transfected with human MDR1 MDR1 Multidrug resistance protein 1 xiv  MRP1 Multidrug resistance associated protein 1 MRP2 Multidrug resistance associated protein 2 NBD Nucleotide binding domain NC Negative control NCE New chemical entities NTC No transfection control P-gp P-glycoprotein PBS Phosphate buffered saline Rh123 Rhodamine 123 RIPA Radioimmunoprecipitation assay RLU Relative light units RNAi RNA interference ROS Reactive oxidative species SEM Standard error of the mean shRNA short hairpin RNA siRNA Small interfering RNA TBS-T Tris-buffered saline with 0.01% (v/v) Tween-20 TEER Trans-epithelial electrical resistance  TM Transmembrane VL Visceral leishmaniasis  xv  Acknowledgements Many individuals have shaped my academic career at The University of British Columbia. I would like to thank Drs. Jane Roskam and Sunita Chowrira; unknowingly you both inspired me to pursue graduate studies. Thank you to Drs. Neil Reiner and David Speert for the research opportunities. Most importantly, I would like to thank my supervisor, Dr. Kishor Wasan, for his support, guidance, and patience. This has been an invaluable experience; your mentorship and zealous approach to science will forever influence my future scientific endeavours.  I would like to thank my supervisory committee, Dr. Stelvio Bandiera, Dr. Fawziah Lalji, Dr. Marc Levine, and Dr. Wayne Riggs, for their guidance, encouragement, and helpful input throughout the course of this project.  Finally, I would like to thank the members of Dr. Wasan’s laboratory. I am extremely grateful to Dr. Stephen Lee, Dr. Kristina Sachs-Barrable, Dr. Fady Ibrahim, and Ms. Alexis Twiddy. Thank you for your unweavering commitment to scientific excellence, for your tutorage, and most of all for your friendship. My gratitude to past and current members of Dr. Wasan’s laboratory – Dr. Shelia Thornton, Dr. Pavel Gershvokich, Dr. Carlos Leon, Ms. Jinying Zhao, Ms. Olena Sivak, Ms. Jenny Kim, Mr. Ankur Midha, Mr. Jacob Gordon, and Mr. Ian Wong. Thank you to the staff of the Office of Research and Graduate Studies, the Neglected Global Diseases Initiative, and the Faculty of Pharmaceutical Sciences. You have all made this a positive experience.  I would like to express special thanks to Dr. Shafik Dharamsi, Dr. Rodney Squire, Veronica P. Fynn, and Ms. Jodi Price. Your sound advice is eternally appreciated. xvi  Dedication  This is dedicated to my parents, my aunt, Ama deGraft-Johnson, and in memory of Josephine deGraft-Johnson and Gladys Obeng. Your love has sustained me.    1 Chapter 1: Introduction  Amphotericin B (AmB) is a polyene antibiotic (Figure 1.1), used for the treatment of fungal and parasitic infections. Originally isolated from cultures of Streptomyces nodosus (1), AmB was the ‘gold standard’ for the treatment of invasive fungal infections (IFIs) due to its broad spectrum of activity, high cure rates, and few clinical incidences of acquired resistance (2,3). AmB has demonstrated activity against Blastomyces dermatitidis, Cryptococcus neoformans, Coccidiodes species, Histoplasma species, Fusarium species, and Zygomycetes (4-9). Moreover, it is of critical importance for the treatment of invasive candidiasis and aspergillosis, which have a pronounced worldwide burden (Table 1.1).   Figure 1.1: Chemical structure of Amphotericin B. This polyene has seven conjugated double bonds, hydroxyl groups, and a mycosamine group. Amphotericin B is an amphipathic antibiotic with very low solubility in water. Amphotericin B absorbs light within the ultra-violet region of the electromagnetic spectrum due to the presence of this conjugated double bond system. Amphotericin B’s mechanism of action involves the hydroxyl groups, which permit autooxidation, and the mycosamine group, which facilitates binding to sterols (10).    2 Table 1.1: Geographic distribution, estimated burden, and mortality rates of IFIs commonly treated with Amphotericin B (11). The information below is based on available data and as such, are estimates. Disease (IFIs) Geographic Distribution Estimated life-threatening infections/year Mortality rates (% in infected populations) Aspergillosis (Aspergillus fumigatus) Worldwide > 200,000 30 – 95  Blastomycosis (Blastomyces dermatitidis) Midwestern and Atlantic United States ~ 3,000 < 2 – 68  Candidiasis (Candida albicans) Worldwide > 400,000 46 – 75  Coccidiodomycosis (Coccidiodes immitis) Southwestern United States ~ 25,000 < 1 – 70  Cryptococcosis (Cryptococcus neoformans) Worldwide > 1,000,000 20 – 70  Histoplasmosis (Histoplasma capsulatum) Midwestern United States ~ 25,000 28 – 50  Zygomycetes (Rhizopus oryzae) Worldwide > 10,000 30 – 90   1.1 Invasive Fungal Infections For the most part, fungal infections are superficial and non-life threatening. These infections are typically of the skin and nails, with common conditions being athlete’s foot, infections of the   3 nails, and muscosal infections of the oral and genital tracts (11). However, our understanding of fungal species and their propensity to cause disease remains limited. It is estimated that the scientific community has identified only 99,000 of a potential 5.1 million fungal species (12,13). This represents a great public health challenge, due to drug resistance and the lack of adequate diagnostic tools for emerging conditions; thus, hampering treatment efforts.  Recent improvements in healthcare technology in high-income countries have contributed to the changing epidemiology of IFIs. Although the global burden of IFIs is unclear, the literature indicates significant increases in incidence and associated mortality over the past 20 years (14-17). Brown et al., estimate that infections caused by opportunistic invasive fungal species are in excess of 2 million (11). This increase can be attributed to a growing population of at-risk patients, prolonged hospitalization, and better diagnostic tools (17,18). IFIs occur predominately in hospital environments, affecting the elderly, pediatric patients, and immunocompromised individuals (19). Consequently, IFIs further complicate the clinical management of acquired immunodeficiency syndrome (AIDS), cancer, neutropenia, solid organ transplantations, and abdominal surgery (11,16,17,19). Candida species pose the greatest threat to the aforementioned patient populations.  Candida species are responsible for the vast majority of nosocomial fungal bloodstream infections in North America (8,17,20). One multisite study found that Candida species were the causative agent of 73.4% of diagnosed IFIs, with an associated mortality rate of 34.9% (20). It is not solely an increased prevalence of well-documented IFIs that is a concern, but also the emergence of IFIs in previously unaffected areas and the emergence of new conditions (21).   4 Historically, Cryptococcus gattii infections have been confined to the tropics and sub-tropics (22). Cases have now been reported in the Pacific Northwest, and British Columbia now has the highest number of Cryptococcus gattii infected individuals worldwide (23-25).   With this changing epidemiology, emergent fungal species, and reports of antifungal resistance, there is the need for improved diagnostics and better treatment options. Similar challenges are observed with the parasitic disease, Leishmaniasis.  1.2 Leishmaniasis Leishmaniasis is a vector-borne disease caused by an obligate, intramacrophage protozoa (26,27). There are three manifestations of the disease – cutaneous leishmaniasis, mucocutaneous leishmaniasis, and visceral leishmaniasis (VL) – of these, VL is the most severe form and is fatal if left untreated. VL is endemic in 62 countries; however, 90% of all cases occur in Bangladesh, Brazil, India, Nepal, and Sudan (28,29). Current estimates indicate that there are 500,000 new cases each year and a further 200 million individuals are at risk due to migration, urbanization, civil unrest, and co-infection with HIV (28,30). In actuality, this is a conservative estimate of VL prevalence, as VL is often misdiagnosed and unreported.   Treatment options for VL are limited, are administered over a long period of time, and pentavalent antimonial drug resistance has been documented in a number of settings. Now second-line therapies, AmB and pentamidine, are the standard of care in the state of Bihar, India. AmB has dual activity and is effective against Leishmania donovani (L. donovani) and Leishmania infantum, the causative agents of VL. Both conventional AmB and new lipid-based   5 formulations successful treat VL (31), with reported cure rates of 96.3% and 95.7% (32) respectively. Inherently, AmB use is restricted by toxicity, adverse reactions, long treatment periods, and prohibitive costs of lipid-based formulations. It is imperative that effective, affordable, and easy to administer drugs are developed for the treatment of both IFIs and VL.  1.3 Amphotericin B 1.3.1 Mechanism of Action The fungicidal activity of AmB is a consequence of the disruption of the cell membrane and oxidative damage. AmB binds to ergosterol (10,33,34), the most abundant sterol found in fungal and parasitic cell membranes, forming pores that facilitate the loss of ions and cell constituents. Ultimately, this membrane depolarization results in cell lysis and death. Whilst AmB exhibits preferential binding to ergosterol (35), it also binds to cholesterol of mammalian cell membranes. This interaction is thought to be the main reason for the dose-dependent adverse reactions witnessed during AmB therapy. Oxidative damage is another mechanism that leads to cell death (36-39). AmB is prone is autooxidation and thus generates reactive oxygen species (ROS), which cause cell lysis.  1.3.2 Drug Properties AmB has very low solubility in water and many organic solvents (40,41). To circumvent solubility issues, conventional AmB (Fungizone™, Bristol-Myers Squibb) is prepared with sodium deoxycholate (1) and newer formulations of AmB are lipid-based. In addition, AmB is unable to penetrate the brush border membrane of the small intestine and as such gastrointestinal   6 absorption is minimal, < 5% (42). Consequently, all four commercially available formulations of AmB must be administered intravenously.   Following intravenous infusion, conventional AmB distributes primarily to the liver, spleen, lungs, and kidney (43). It is in the kidney that AmB binds to cholesterol causing its signature dose-dependent nephrotoxicity. Peak serum concentrations are considerably low an hour after administration, ranging from 0.45 µg/mL to 3 µg/mL (43,44) and AmB is extensively bound (90 – 95%) to plasma proteins: α1-acid glycoprotein, β-lipoprotein, and albumin (40,45-47). Little is known about the metabolic pathway, metabolites, and the elimination of AmB. The drug is excreted via the liver and kidney, where 2 – 5% of AmB recovered in the urine is not metabolized and remains biologically active (41). The pharmacokinetic profile of lipid-based formulations differs from that of conventional AmB. These differences are briefly discussed below in Section 1.3.4.  1.3.3 Therapeutic Limitations Despite AmB’s broad spectrum of activity, its clinical use is limited by pronounced adverse drug reactions (ADRs) arising from prolonged treatment periods. These ADRs can be classified as infusion-related or dose-related. Infusion-related reactions manifest as fever, chills, anorexia, nausea, vomiting, and headache (42,43). These symptoms are often alleviated by the adminstration of analegics, antihistamines, and steroids. However, it is the dose-related reactions that are the major shortcoming of AmB therapy. Long treatment courses result in nephrotoxicity, with a decrease in glomerular filtration and renal blood flow. Nephrotoxicity may also be accompanied by electrolyte imbalance, hypokalemia, and hypomagnesemia (42). Chronic renal   7 dysfunction may warrant a reduction in the administered dose, if not the discontinuation of therapy. This places patients at risk, as there are few alternative treatment options for IFIs and VL. Attempts to minimize AmB toxicity have focused on pretreating patients with normal saline (42,43). However, the most effective intervention thus far has been the development of lipid-based formulations of AmB.  1.3.4 Formulations Lipid-based formulations of AmB were developed with the aim of improving tissue distribution and reduced toxicity. The lipophilic nature of AmB permits it to be encapsulated in liposomes or bound to lipid complexes (48,49). There are three commercial lipid-based formulations of AmB – AmBisome® (liposomal AmB, L-AmB), Abelcet® (AmB lipid complex, ABLC), and Amphocil® (AmB colloidal dispersion, ABCD), which allow for shorter treatment courses and have reduced toxicity profiles. Lopez-Berestein et al., found that treatment of mice with L-AmB did not result in renal abnormalities and effectively resolved Candida albicans infections (50,51). Furthermore, patients with IFIs administered L-AmB did not experience any severe ADRs and the incidence of infusion-related reactions was less than for patients treated with conventional AmB (52,53). Lipid-based formulations have been shown to have greater tissue distribution (43), result in fewer infusion-related reactions, fewer incidences of nephrotoxicity (48,49,54,55), and improve disease outcomes (56,57).  Whilst these formulations have improved the safety of AmB and shortened the course of therapy, cost is a major barrier to their clinical use. This is of particular concern in low- and middle-  8 income settings, where the per capita health expenditure is negligible. Presently, there are no commercial oral AmB formulations; this is greatly needed.  Recent advances in drug delivery technology have revived efforts to develop an oral AmB formulation. An in vivo experiment demonstrated that treatment with oral cochleates containing AmB resulted in a reduction of colony forming units in the kidney and liver of mice with disseminated candidasis. In addition, the survival rate for the AmB cochleate treatment group was similar to the conventional AmB and L-AmB treatment groups (58). Kayser et al., used a nanosuspension technique as a means of improving AmB oral absorption (59). Here, authors reported a significant reduction (28.6%) in liver parasite load, when mice infected with L. donovani were treated with an AmB nanosuspension, as compared to orally administered L-AmB and conventional AmB. However, this formulation had no curative effect. Similarly, a single dose of 5 mg/kg body weight of AmB functionalized carbon nanotubes resulted in a 95.5 ± 1.2% reduction in the parasite load in the spleen of L. donovani infected hamsters; this was comparable to intraperitoneal L-AmB (97.6 ± 0.9%) (60). These studies are in their preliminary stages and pharmacokinetic studies are required to determine AmB plasma concentrations and tissue distribution.  Italia et al., (61) and Jain et al., (62), used nanoparticles as an oral delivery system for AmB. Both preparations resulted in a higher Cmax and extended release, as compared to conventional AmB administered orally. Negligible changes were observed in blood urea nitrogen and plasma creatinine levels, indicative of an absence of nephrotoxicity. However, researchers are yet to investigate the applicability of these formulations to a fungal and parasitic disease state.   9  Wasan and colleagues have developed an oral lipid-based formulation of AmB. When administered at 10 mg/kg and 20 mg/kg twice daily for 5 days to L. donovani infected mice, a 99.5 ± 0.4% and 99.8 ± 0.2% reduction in parasite load respectively was observed (63,64). Further studies demonstrated that plasma creatinine levels were within a normal range, whilst nephrotoxicity was observed for the conventional AmB treatment group. These data were substantiated by histopathological analysis of the kidney and liver, no toxicity was visible (65-67). Moreover, a curative effect was observed against A. fumigatus and C. albicans in a rat model (63,67).  Current data suggest that a safe and effective oral formulation of AmB is feasible. However, future research must investigate potential obstacles to the oral absorption of such a formulation. The small intestine is the principal site of oral drug absorption but also presents a considerable barrier to absorption. Transporters and metabolizing enzymes modulate the absorption, distribution, metabolism, and elimination of drugs (68). There is a multitude of transporters associated with enterocytes, as illustrated by Figure 1.2. These transporters facilitate the uptake or efflux of drugs, which ultimately can affect drug plasma concentrations and drug concentrations at target sites. Of these transporters, P-glycoprotein (P-gp) is the most extensively studied efflux transporter.    10  Figure 1.2: Schematic of an intestinal epithelial cell and its associated transporters. Transporters are located on the apical and basolateral membranes of enterocytes and are responsible for the uptake or efflux of xenobiotics. P-glycoprotein (MDR1) is localized to the apical membrane and extrudes xenobiotics against their concentration gradient into the intestinal lumen. Permission granted for the reproduction of this image by Solvo® Biotechnology.    11 1.4 P-glycoprotein P-gp is a member of the ATP-binding cassette family (ABC). The human ABC superfamily of membrane proteins includes 48 transporters and is further divided into seven subfamilies (A – G) (68,69). The basic structure of an ABC transporter includes two transmembrane domains (TM), with six transmembrane segments each, and two nucleotide binding domains (NBD). P-gp is a 170 kDa glycosylated efflux transporter encoded by the ABCB1 gene, also known as the multidrug resistance gene 1 (MDR1).   Originally characterized in colchicine-resistant Chinese hamster ovary cells (70), P-gp is associated with the multi-drug resistance phenotype in tumour cells. This resistance to a diverse range of chemotherapeutic agents may be intrinsic or acquired and correlates with poor treatment outcomes. As an efflux transporter, P-gp decreases the intracellular accumulation of xenobiotics through an ATP-dependent efflux (Figure 1.3). P-gp is proposed to function as a ‘flippase’, translocating xenobiotics from the inner to outer membrane of the phospholipid bilayer (71,72). Others have suggested that P-gp may act as a hydrophobic vacuum cleaner. P-gp has a binding affinity for a diverse range of structurally and functionally unrelated substrates (73). These substrates include anticancer agents, immunosuppressants, antiarrhythmics, protease inhibitors, and two antifungals in the azole class (74,75). There are a few commonalities between P-gp substrates: they are generally hydrophobic, amphiphilic, and range in size from 200 Da to 1,900 Da (76). However, it is unclear how one enzyme can bind and transport such a diversity of substrates. This characteristic of P-gp may be partially accounted for by multiple drug binding sites (77).    12  Figure 1.3: Model of P-glycoprotein mediated efflux. P-glycoprotein has 12 transmembrane segments (TM) and two nucleotide binding domains (NBD) found on the cytoplasmic side of the phospholipid bilayer. A) A substrate enters the phospholipid bilayer and interacts with the drug binding pocket of P-glycoprotein. Two ATP molecules, indicated in yellow, bind to the nucleotide binding domains. B) ATP binding results in a conformational change in P-glycoprotein and the subsequent efflux of the substrate across the apical membrane (77). Permission granted for reproduction of this image by the American Association for the Advancement of Science.  P-gp is not only present in tumour cells but is also expressed in normal polarized epithelial cells. It is expressed in the intestine, liver, and kidney as well as at the blood-brain, blood-testis/ovary, and placental barriers (78-80). The physiological function of P-gp remains to be determined; yet, its widespread tissue distribution suggests a protective role against the accumulation of   13 xenobiotics and toxins in vital tissues. Unfortunately, its activity also has important implications for the use of clinically relevant drugs. In the gastrointestinal tract, P-gp prevents the passage of xenobiotics from the lumen into the systemic circulation thereby decreasing plasma concentrations.   Homologous P-gp genes are present in other mammalian species and knockout studies have been crucial for identifying P-gp substrates. There are two genes responsible for the MDR phenotype in mice, mdr1a and mdr1b, with mdr1a corresponding to ABCB1. Knockout mice (mdr1a -/-) were found to have altered absorption and distribution of P-gp substrates, with higher plasma concentrations of and accumulation of ivermectin and vinblastine (81) in intestine and brain samples (76,82). More recently, chemical inhibition of P-gp has been employed to determine whether compounds are subject to efflux. Similar changes in drug distribution have been observed (83).  The advent of P-gp chemical inhibition presented the prospect of reversing the MDR phenotype seen in many cancer patients. As yet, clinical trials have been unsuccessful and no chemical inhibitors are available for concomitant administration. In vitro data indicate that verapamil and cyclosporine A inhibited P-gp activity, restoring sensitivity to chemotherapeutics. Unfortunately, low binding affinity of these first-generation inhibitors prevented P-gp inhibition in clinical trials. High concentrations of inhibitors were required, resulting in toxicity (84). Design of second-generation inhibitors relied upon structural properties of these initial inhibitors; however, improved activity was observed, as lower concentrations were sufficient for the in vitro inhibition of P-gp. Unfortunately, clinical trials highlighted the non-specific nature of second-  14 generation inhibitors, which were found to interact with other transporters as well as the metabolizing enzyme cytochrome P450 3A4 (CYP3A4). Inadvertently, the pharmacokinetic profile of co-administered drugs was altered, increasing plasma concentrations, and causing toxicity. More recent P-gp inhibitors, zosuquidar trihydrochloride (LY335979), tariquidar, laniquidar, and elacridar are currently under investigation in clinical trials. Whilst tariquidar and elacridar have been shown to be substrates of other transporters, in vitro data are promising for LY335979. LY335979 does not interact with the other efflux transporters multidrug resistance-associated protein 1 (MRP1) or breast cancer resistance protein (BCRP/ABCG2) (85).   To complement the physical inhibition of P-gp, researchers have employed RNA interference (RNAi) to inhibit P-gp activity by reducing ABCB1 gene expression. RNAi is a conserved mechanism across species for the degradation of exogenous RNA. Molecular biologists have exploited this mechanism, designing small interfering RNA (siRNA) and short hairpin RNA (shRNA) for the sequence-specific knockdown of genes. This technique provides insight into gene function. The use of siRNA results in the transient knockdown of a gene, where the binding of siRNA to complementary mRNA leads to a temporary change in gene expression. The knockdown of ABCB1 has successfully been accomplished in a number of cell culture lines.  In the development of new chemical entities (NCEs), compounds are often screened for their interaction with transporters. Currently, the US Food and Drug Administration (FDA) recommends screening of Biopharmaceutics Classification System (BCS) class II and IV compounds (86). There are a number of different approaches to determine whether a compound is a substrate for P-gp mediated efflux: calcein AM assay, vesicle transport, photoaffinity assay,   15 and permeability studies. Typically, screening relies on the use of cell lines for permeability studies. Caco-2 cells, Madin Darby Canine Kidney cells stably transfected with human MDR1 (MDCKII MDR1), or porcine kidney human epithelial cells LLC-PK1 are routinely used by academia and the pharmaceutical industry for drug screening. Caco-2 cells have the advantage of being of human origin and cells differentiate into enterocyte-like cells; thus, making this cell line applicable for intestinal absorption studies.  1.5 Evidence of Amphotericin B and P-glycoprotein Interaction The literature is inconsistent on whether AmB is a substrate for P-gp mediated efflux and as yet there have been no studies that have explicitly addressed this question. A body of evidence indirectly suggests that AmB may interact with P-gp.   The ability of AmB to enhance the activity of actinomycin D in resistant HeLa cells was investigated as a possible mechanism to revert the MDR phenotype. HeLa cells became sensitive to actinomycin D following incubation with AmB, as measured by a decrease in cell viability, the inhibition of RNA synthesis by 68%, and changes in cell morphology. It was also demonstrated that co-incubation with AmB increased the accumulation of [3H] actinomycin D in resistant HeLa cells (87). Authors speculate that this enhanced activity was due to AmB’s ability to modify membrane permeability. These results were published prior to the initial report of P-gp presence in resistant cells; however, actinomycin D has since been shown to be a P-gp substrate. One alternative inference is that co-incubation with AmB resulted in the inhibition of P-gp; thus, increasing actinomycin D accumulation and toxicity to resistant HeLa cells. Attempts to determine whether AmB would result in a similar enhancement of actinomycin D toxicity in vivo   16 concluded that sensitive and resistant leukemic mice were affected to the same extent. Increased actinomycin D activity and hence survival of leukemic mice was observed for both treatment groups, when AmB was coadministered. These results suggest that this improved effectiveness of actinomycin D is independent of P-gp levels. Authors contend that AmB increases cell membrane permeability enabling greater uptake of actinomycin D. This conclusion is further supported by in vitro experiments, which sought to investigate whether AmB could inhibit P-gp activity in adriamycin resistant P388 cells. AmB was shown to increase the intracellular retention of adriamycin in both sensitive and resistant cells. Moreover, this accumulation was observed to a greater extent in sensitive cells. Similarly, there were no differences in adriamycin transport in tumour and normal cells following incubation with AmB (88). On the other hand, an incubation with AmB resulted in increased accumulation of nitrogen mustard (a P-gp substrate) in HT29 colon carcinoma cells, SKMES-1 human epidermoid carcinoma cells, and carcinoma cells isolated from a patient (89). It is important to note that experiments exclusively considered the effect of AmB on nitrogen mustard accumulation in MDR cells. However, similar results may have been observed if sensitive cells were co-incubated with nitrogen mustard and AmB.  In some in vitro systems, AmB did not affect the cytotoxicity of chemotherapeutic agents in resistant cell lines. The development of the orally administered classes of antifungal agents, triazoles and echinocandins, warranted the study of interactions with P-gp and CYP3A4. AmB did not restore the sensitivity of Hvr100-6 (resistant HeLa cells) to a number of chemotherapeutic agents, as measured by IC50 values. In addition, the IC50 value of AmB did not differ between HeLa (sensitive) and Hvr100-6 (resistant) cells, suggesting that P-gp levels do not affect AmB cytotoxicity. Nevertheless, authors remark that data on the interaction between   17 antifungal drugs and P-gp is variable depending on the experimental system (90) and so these results may be specific to HeLa cells. Sakaeda et al., assessed the effect of AmB on P-gp activity in the resistant porcine kidney epithelial cell line, LLC-GA5-COLI50, by measuring the transport of [3H] digoxin, a known P-gp substrate (91). Net efflux of [3H] digoxin was confirmed; however, a 4-hour incubation with 5 µM – 25 µM AmB had no effect on the net basolateral-to-apical transport of [3H] digoxin. Given the population of patients subject to AmB therapy, there is the possibility that drug-drug interactions may occur. Investigating the effect of commonly used supportive therapy for acute myeloid leukemia on two P-gp substrates, Möllard et al., found that AmB did not increase the accumulation of Rhodamine 123 (Rh123) in resistant cell lines (92). On the other hand, AmB was shown to enhance the cytotoxic effect of daunorubicin in this same system. This discrepancy in results led researchers to conclude that P-gp inhibition by AmB was not the mechanism responsible for differences in daunorubicin cytotoxicity.  More recent in vivo studies contradict previous findings. Using male Wistar rats, Ishizaki et al., sought to elucidate the underlying mechanism for decreased cyclosporine A plasma concentrations, following the administration of AmB (93). Administration of 1.5 mg/kg and 3.0 mg/kg AmB for 4 days prior to cyclosporine A treatment changed the drug’s pharmacokinetic profile. A significant decrease in area under the curve (AUC0-24h) compared to the control group was observed and AmB reduced the oral bioavailability of cyclosporine A to 67% (1.5 mg/kg) and 46% (3.0 mg/kg) of the control. Further investigation found that co-administration of AmB increased mdr1a and mdr1b expression in the duodenum and this translated into elevated P-gp protein levels. Taken together, this data implies that AmB induced the expression of P-gp in the   18 small intestine of rats, which in turn increased the efflux of cyclosporine A into the lumen; thus, decreasing plasma levels.  AmB has poor penetration into the brain. To increase AmB targeting to the brain and subsequent clinical outcomes for IFIs such as cryptococcal meningitis, Shao et al., developed a micellular formulation of AmB (94). Researchers questioned whether P-gp would affect the transport of AmB, as there are high expression levels of the transporter at the blood-brain barrier. In vivo studies demonstrated that this Angiopep-PEG-PE AmB formulation increased the amount of AmB in brain tissue and effectively reduced the number of colony forming units, as compared to the untreated control. Brain capillary endothelial cells were incubated with various formulations of AmB and assessed for AmB accumulation. The addition of verapamil, a P-gp inhibitor at high concentrations, increased the amount of conventional AmB in cells compared to cells that were not incubated with verapamil. This increase was not seen for the liposomal or micellular formulations of AmB. This result led researchers to speculate that these formulations exert a protective effect, thereby preventing P-gp from interacting with AmB. However, the amount of AmB in cells in the absence of verapamil for these formulations did not differ from that of conventional AmB, as would be expected if liposomal and micellular formulations did indeed exert a protective effect.  The overexpression of ABC transporters in fungal and parasitic cells has also been identified as one mechanism responsible for antifungal drug resistance. Recently, an AmB resistant L. donovani strain was isolated from a patient in Bihar, India (95). Investigators sought to determine the molecular basis of this resistance. A number of differences between sensitive and   19 resistant L. donovani parasites were noted. Compared to AmB sensitive parasites, membrane fluidity was greater for resistant parasites; resistant parasites lacked ergosterol in their cell membrane, expressed higher levels of sterol biosynthesis enzymes, had a four-fold increase in MDR1 (homologous to mammalian P-gp), whilst levels of PgPA (homologous to mammalian MRP) were unchanged. Efflux of AmB was greater for resistant parasites and the addition of verapamil resulted in a reduction to levels observed for sensitive parasites. Furthermore, incubation with verapamil was found to partially reduce AmB IC50 in resistant parasites whilst having no effect on AmB IC50 in sensitive parasites. As only a partial reversion in resistance was observed by the addition of verapamil, authors proposed multiple mechanisms to explain this finding: 1) impaired binding due to the loss of ergosterol, 2) involvement of ROS scavenging machinery, and 3) enhanced efflux by MDR1, working in unison to generate this AmB resistance phenotype.  Through a series of experiments, Wasan and colleagues suggested that AmB was a substrate for P-gp mediated efflux (96-99). Using a Caco-2 cell model, researchers demonstrated that P-gp expression and function were affected by the lipid excipient Peceol® and its glyceride components (96-98). Monoglycerides decreased P-gp protein levels after a 24-hour incubation. Secretory transport of Rh123 was also decreased and was accompanied by an increase in Rh123 accumulation, which was comparable to levels of the verapamil treatment group. Similar results were obtained when Caco-2 cells were incubated with 10% Peceol® (98). These data suggest that Peceol® is a P-gp inhibitor. Subsequent in vivo studies with AmB formulated with Peceol® demonstrated an increase in AUC0-24h, a higher Cmax, undetectable levels of AmB in kidney tissue, and higher levels in liver tissue (99). Authors proposed increased lymphatic transport and   20 decreased P-gp efflux of AmB due to inhibition by Peceol®, as possible underlying mechanisms for this observed change in AmB’s pharmacokinetic profile.  1.6 Implications of Previous Research Results from initial studies suggest that AmB is not a P-gp modulator, as its ability to enhance the activity of chemotherapeutic agents was not dependent on P-gp levels. These results prompted researchers to dismiss the notion that AmB could improve clinical outcomes for cancer patients with a MDR phenotype. Subsequent studies indirectly imply that AmB is a P-gp substrate. In particular, researchers have demonstrated that 1) the P-gp inhibitor verapamil increased the accumulation of AmB in brain capillary endothelial cells, 2) verapamil decreased the efflux of AmB from resistant L. donovani parasites, and 3) decreased expression of P-gp correlated with an increased AmB plasma concentration in rats. If AmB were indeed a P-gp substrate, then its oral bioavailability would decrease, resulting in less AmB in the systemic circulation.  1.7 Research Hypothesis AmB is a substrate of P-gp efflux-mediated transport; therefore, the reduced expression of P-gp will increase the intracellular accumulation of AmB in epithelial cells.  1.8 Aims of the Thesis The overall aim of this thesis was to study the contribution of P-gp, an efflux transporter, to the epithelial transport of AmB, using an in vitro experimental model. The specific aims were to:   21 ! To confirm the efficiency of RNAi targeting ABCB1 in Caco-2 cells, via the examination of markers for monolayer integrity, cell differentiation and polarization, and P-gp expression and function. The methods and results for this aim are presented in Chapter 2. ! To develop and validate a cell-based AmB HPLC assay. The methods and results for this aim are presented in Chapter 3. ! To determine the cytotoxic effect of AmB on transiently transfected with ABCB1 targeting siRNA and non-transfected Caco-2 cells. The methods and results for this aim are presented in Chapter 4. ! To examine the effect of transient ABCB1 knockdown in Caco-2 cells on the cellular association of AmB. The methods and results for this aim are presented in Chapter 4.  1.9 Rationale and Significance As discussed above, AmB is a highly efficacious drug for the treatment of IFIs, which represent an ever-increasing problem among a sizable population of immunocompromised individuals. In addition, AmB has demonstrated antiparasitic activity and is critical for the treatment of VL. However, its clinical use is limited by route of administration, suboptimal concentrations at target sites, infusion- and dose-related reactions, and prohibitive costs for liposomal formulations. An oral formulation addressing these shortcomings would greatly improve clinical outcomes. Understanding the influence of transporters on the epithelial transport of AmB is important for the future development of such an oral formulation. Indirect evidence from Dr. Wasan’s laboratory and other research groups suggests that AmB interacts with the efflux transporter P-gp. However, the literature on the interaction between AmB and P-gp is contradictory and inconclusive. As the development of an oral AmB formulation continues, it is   22 imperative to determine the contribution of P-gp to the epitheial transport of AmB. This research will have important clinical implications if the results presented in this thesis support the research hypothesis. If AmB were a P-gp substrate, then this would affect the oral absorption and disposition of AmB. Furthermore, drug-drug interactions may occur; thus, the need for caution when administering AmB with drugs that are P-gp substrates. Research outcomes may also inform drug development strategies for an oral AmB drug formulation, as the lipid composition could be altered to further protect AmB from P-gp.   23 Chapter 2: Transient Knockdown of ABCB1 in Caco-2 Cells  2.1 Introduction With the imminent completion of preclinical experiments for the novel lipid-based oral formulation of AmB from Dr. Wasan’s laboratory, we sought to investigate potential barriers to the oral absorption and drug disposition of AmB. Our aim was to determine the contribution of P-gp to the epithelial transport of AmB in Caco-2 cells.   Caco-2 cells are derived from a human colorectal adenocarincoma (100). Although of colon origin, Caco-2 cells spontaneously differentiate into polarized intestinal epithelial cells with microvilli. Once differentiated, cells form tight junctions, express brush border enzymes, and transporters (101). Studies have demonstrated that transporter levels in Caco-2 cells are comparable to the human jejunum (102) and that P-gp is the primary efflux transporter in Caco-2 cells (103). Caco-2 cells are routinely grown on semi-permeable membranes to conduct permeability studies. Here, secretory (basolateral-to-apical) transport and absorptive (apical-to-basolateral) transport of a compound is measured and can be presented as a flux ratio. Flux ratios greater than 2 (104) are indicative of net efflux, whereas values close to unity suggest minimal involvement of efflux transporters. This cell model has greatly enhanced the investigation of oral drug transport; however, culture times of approximately 21 days limit the use of this cell line and prevent high throughput screening. This also complicates the use of siRNA, as transient knockdown cannot be maintained for this duration of time.    24 This chapter describes the development of an accelerated ABCB1 siRNA transfected Caco-2 cell model. Experiments were conducted to ensure Caco-2 cell monolayer integrity, cell differentiation, expression of three transporters, and the reduction in P-gp efflux efficiency.  2.2  Materials and Methods 2.2.1 Reagents β-Mercaptoethanol, bovine serum albumin (BSA), Breathe-Easy® sealing membrane, ethylenediaminetetraacetic acid (EDTA), glycine, phenylmethylsulfonyl fluoride (PMSF), protease inhibitor cocktail, Rhodamine 123 (Rh123), sodium bicarbonate, sodium deoxycholate, Triton™ X-100, Trizma® base, Trizma® hydrochloride, and Tween® 20 were purchased from Sigma-Aldrich® (St. Louis, MO, USA). Dulbecco’s Modified Eagle Medium powder (DMEM), Hank’s Balanced Salt Solution (HBSS), heat-inactivated fetal bovine serum (HI-FBS, A12618DJ Lot # 792397), Opti-MEM® Reduce Serum Medium, 100X penicillin-streptomycin, liquid (10,000 units of penicillin and 10,000 µg of streptomycin per mL), Phosphate Buffered Saline 1X (PBS), Stealth RNAi™ siRNA ABCB1 duplex (HSS182278), Stealth RNAi™ siRNA Negative Control LO GC duplex, and 0.25% Trypsin-EDTA (1X) were purchased from Invitrogen, Life Technologies (Carlsbad, CA, USA). The chemical P-gp inhibitor, Zosuquidar trihydrochloride (LY335979) was obtained from CEDARLANE (Burlington, ON, Canada). Transwell® Permeable Supports (12-well plates; pore size: 0.4 µm; 12 mm diameter; 1.12 cm2 growth area) were purchased from Corning Incorporated (Corning, NY, USA). Albumin standard and SuperSignal West Pico Chemiluminescent Substrate were obtained from Thermo Scientific (Waltham, MA, USA) and octylphenoxypolyethoxylethanol (Nonidet P-40) was purchased from Roche Applied Sciences (Penzberg, Germany). DC™ Protein Assay Reagent A, B, and S,   25 nitrocellulose membrane (0.45 µm pore size), Precision Plus Protein™ Standards, Ready Gel® Tris-HCl Precast Gels, siLentFect Lipid Reagent for RNAi, and sodium dodecyl sulphate powder were purchased from Bio-Rad (Hercules, CA, USA).  Primary and conjugated horseradish peroxidase secondary antibodies for Western blot analysis were obtained from Santa Cruz Biotechnology®, Inc. (Santa Cruz, CA) and Covance (Princeton, NJ).   2.2.2 Cell Culture Caco-2 cells, derived from a human colorectal adenocarcinoma, were obtained from the American Type Culture Collection (Manassas, VA) at passage number 18 and were used between passage numbers 28 and 38. Caco-2 cells were maintained in tissue culture treated 75 cm2 flasks at 37 °C in DMEM (high glucose 4500 mg/L, L-glutamine, and phenol red), supplemented with 10% HI-FBS and 1% penicillin-streptomycin, under 5% CO2 and a humidified environment. For complete media, DMEM powder was dissolved with 1500 mg NaHCO3 in 1 L distilled water and pH adjusted to pH 7.2. Under sterile conditions, 50 mL HI-FBS and 5 mL penicillin-streptomycin were added to 445 mL of the solution prior to filter sterilization (Stericup Sterile Vacuum Filter Units 0.22 µm, Millipore Corporation, Billerica, MA). The final media composition was 1500 mg/L NaHCO3, 10% HI-FBS, 100 U/mL penicillin and 100 µg/mL streptomycin. Media and all other cell culture solutions were stored at 4 °C until ready for use.  Cell culture media was replaced every other day and cells were routinely subcultured at 90% confluency. Briefly, Caco-2 cells were initially rinsed with 10 mL HBSS. Cells were dissociated with 4 mL 0.25% Trypsin-EDTA for 5 minutes at 37 °C, after which 6 mL of pre-warmed fresh   26 media was added to each flask. Cell debris was removed by centrifugation at 290 x g and resuspended in DMEM for counting. Cells were seeded in 75 cm2 flasks at 4 x 103 cells/cm2 or seeded on Transwell® Permeable Supports, as described below. Cell culture was regularly assessed for Mycoplasma contamination using the MycoAlert™ mycoplasma detection kit (Lonza, Basal, Switzerland) and other contamination via visual inspection.  2.2.3 Transfection Caco-2 cells were transfected with ABCB1-specific siRNA as previously described (105). In a sterile polystyrene plate, the 20 µM stock solutions of siRNA constructs (HSS182278 and siRNA Negative Control LO GC duplex) were diluted with Opti-MEM® to a concentration 10X higher than the desired final concentration. Solutions were incubated at room temperature for a minimum of 5 minutes. In a separate well, the siLentFect reagent was diluted with Opti-MEM®, (4:21, v/v) and incubated at room temperature for 5 minutes. An equivalent amount of diluted siLentFect reagent was added to each siRNA solution. Solutions were mixed by pipetting and were incubated for 25 minutes at room temperature. Concurrently, Caco-2 cells were dissociated from three tissue culture treated 75 cm2 flasks as discussed above. The wash step was repeated three times with 10 mL Opti-MEM® and the cells were resuspended in 5.5 mL Opti-MEM® and counted for a final dilution of 933,333 cells/mL. These washing steps ensured that cells were serum and antibiotic free. Caco-2 cells were seeded on Transwell® Permeable Supports at 375,000 cells/cm2 in a volume of 450 µL and 50 µL aliquots of siRNA – siLentFect complex were added to cells in suspension. Opti-MEM® (1.5 mL) was added to the basolateral chamber and plates were then sealed with Breathe-Easy® sealing membrane to prevent cell contamination. Transwell® plates were incubated at 37 °C for 240 minutes, after which Opti-  27 MEM® was aspirated and replaced with complete DMEM. The final transfection conditions were 200 nM HSS182278 (200 nM ABCB1 siRNA construct 1), 200 nM Negative Control LO GC duplex (200 nM NC siRNA), and no transfection control (NTC). The Negative Control LO GC siRNA construct had a low guanine and cytosine content, matching the GC content of the HSS182278 duplex. The nucleotide sequence for the duplex HSS182278 was: GCAGCUUAUGAAAUCUUCAAGAUAA and UUAUCUUGAAGAUUUCAUAAGCUGC.  2.2.4 Trans-epithelial Electrical Resistance Tight junction formation and monolayer integrity were indirectly assessed using trans-epithelial electrical resistance (TEER) values. TEER values of Caco-2 cells seeded on Transwell® Permeable Supports were measured before, 48, 72, 96, 120 hours post-transfection, and after experiments with an epithelial volt-ohm meter and electrodes (Millicell®-ERS, EMD Millipore Corporation, Billerica, MA). TEER values were calculated according to Equation 1. Equation 1: € TEER (Ω • cm2) =  (RTotal- RBlank) ×  A  RTotal was the measured resistance (Ω) of Caco-2 cells seeded on Transwell® Permeable Supports, RBlank was the measured resistance (Ω) of Transwell® Permeable Supports solely with buffer (PBS 1X), and A (cm2) was the area of Transwell® Permeable Supports (1.12 cm2). All experiments were conducted with Caco-2 monolayers with TEER values greater than 250 Ω • cm2 (106).    28 2.2.5 Rhodamine 123 Bi-directional Transport Studies Rhodamine 123 (Rh123), a fluorescent P-gp substrate, was used to assess P-gp efflux efficency in this ABCB1 siRNA knockdown system. Bi-directional transport studies were conducted to investigate the effect of ABCB1 knockdown on P-gp efflux efficiency. Caco-2 cells were transfected with 200 nM ABCB1-specific and Negative Control LO GC siRNA, as described in Section 2.2.3. On day 4 post-transfection, TEER values were measured and NTC cells were pre-incubated with 1% (v/v) control, 10 µM LY335979, for 24 hours. TEER values were measured prior to the experiment on day 5 post-transfection. Media was aspirated and Caco-2 cells were rinsed once with HBSS (transport buffer). Cells were incubated with 5 µM Rh123, prepared with transport buffer, for 120 minutes in a humidified 37 °C incubator with a 5% CO2 atmosphere. Rh123 was added to either the apical or basolateral chamber, with transport buffer in the corresponding receiver chamber. NTC cells were co-incubated with 1% control, for a final concentration of 100 nM LY335979 (107). At 30-minute intervals 50 µL aliquots were sampled, with replacement, from the receiving chamber and transferred to a 96-well plate. Plates were protected from light and sampling occurred in the dark to ensure Rh123 stability. TEER values were measured at the end of the experiment to confirm monolayer integrity. Rh123 concentrations were quantified using a Fluoroskan Ascent fluorometer (Thermo Electron Corporation, Waltham, MA) (Excitation = 485 nm and Emission = 538 nm) and Rh123 standards prepared by five-fold serial dilution with transport buffer. The apparent permeability coefficient and efflux ratio were calculated under sink conditions, using Equation 2 and Equation 3: Equation 2: € Papp=dQdt" # $ % & ' ×1A • C0" # $ % & '    29 Q was the cumulative amount transferred from the donor chamber (moles), A (cm2) was the area of the Transwell® Permeable Supports (1.12 cm2), and C0 was the initial concentration of Rh123 in the donor chamber (nM).  Equation 3: € Efflux ratio =  Papp B→A( )Papp A→B( )   2.2.6 Rhodamine 123 Uptake Studies Rh123 uptake studies were performed to determine whether 200 nM ABCB1-specific siRNA would alter the intracellular accumulation of Rh123 in Caco-2 cells. Cells were transfected as described in Section 2.2.3 and NTC cells were pre-incubated with 1% (v/v) control, 10 µM LY335979, for 24 hours. On day 5 post-transfection, TEER values were measured and cells were rinsed with HBSS. Cells were then incubated with 5 µM Rh123 for 180 minutes in a humidified 37 °C incubator, with a 5% CO2 atmosphere. Rh123 was added to either the apical or basolateral face of the monolayer, with transport buffer in the corresponding receiver chamber. NTC cells were co-incubated with 1% (v/v) control, for a final concentration of 100 nM LY335979. After 180 minutes, TEER values were measured; cells were washed with transport buffer and then stored at -20 °C. To determine Rh123 uptake, polycarbonate membranes were excised from Transwell® Permeable Supports and cells were lysed on ice with 0.25 mL cold modified Radioimmunoprecipitation assay (RIPA) buffer containing 1% protease inhibitors (50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% Na deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM Na3VO4, 1 mM NaF, 1 µg/mL aprotinin, 1 µg/mL leupeptin, 1 µg/mL pepstatin) and 1%   30 PMSF, for 30 minutes. Fluorescence was measured in 50 µL aliquots with a Fluoroskan Ascent fluorometer (Excitation = 485 nm and Emission = 538 nm) and Rh123 concentrations were determined using Rh123 standards. Concentrations were normalized with respect to protein content.  2.2.7 Protein Quantification Polycarbonate membranes were excised from Transwell® Permeable Supports and cells were lysed using either physical disruption or a detergent-based buffer; both were performed at 4 °C. For physical disruption, cells were detached with a cell scraper in the presence of 0.3 mL PBS and cell suspensions were transferred to 1.5 mL microcentrifuge tubes. Suspensions were sonicated three times for 10 seconds using a Branson Sonifier 450 (pulsed mode, duty cycle 50%, output control 2). Protein concentration was determined as described below. For detergent-based cell lysis, cells were lysed on ice with 0.25 mL cold modified RIPA buffer containing 1% protease inhibitors and PMSF, for 30 minutes. Cells were then scraped from membranes, transferred to 1.5 mL microcentrifuge tubes and total protein was separated from cell debris by centrifugation at 14,000 x g for 15 minutes at 4 °C using an Eppendorf Centrifuge 5810R (Eppendorf, Hamburg, Germany). The clear supernatant was collected for quantification of total protein and AmB. Protein levels in cell lysates were quantified in triplicate with the Bio-Rad DC™ Protein Assay. The manufacturer’s protocol was followed, with minor modifications. Bovine serum albumin (BSA) protein standards were prepared in cold PBS or cold modified RIPA in accordance with the cell lysis method. Samples (20 µL instead of 5 µL) were transferred to a clean 96-well plate and 25 µL reagent A or A’ (reagent A and 20 µL of reagent S/mL was used for samples that contained detergent) and 200 µL reagent B were added to each well.   31 Samples were incubated at room temperature for 15 minutes and absorbance values were measured at 650 nm using a Multiskan Ascent plate reader (MTX Lab Systems Inc., Vienna, VA). Cell lysates were used for either Western blot analysis or reverse-phase High Performance Liquid Chromatography (HPLC) to quantify the cellular association of AmB.  2.2.8 Western Blot Analysis Whole cell lysates (20 µg) were denatured and reduced by the addition of 6X Laemmli buffer, containing β-mercaptoethanol, and warmed at 65 °C for 3 minutes. Samples were centrifuged for 1 minute at 9,300 x g prior to protein separation by gel electrophoresis with Ready Gel® Tris-HCl Precast Gels (4 - 15% gradient gels). Proteins were separated using a constant voltage (100 V) for approximately 75 minutes. Proteins were transferred to nitrocellulose membranes using Towbin’s buffer, at a constant voltage (100 V) for 60 minutes after which membranes were cut at approximately 50 kDa, to enable the detection of proteins of different molecular weights. Membranes were incubated with blocking solution for 120 minutes at room temperature. Blocking solutions for various proteins are outlined in Table 2.1. Membranes were incubated with primary antibodies, prepared in blocking solution or Tris-buffered saline with 0.01% (v/v) Tween-20 (TBS-T), overnight at 4 °C. The following day, membranes were rinsed with TBS-T four times for 4 minutes before incubation with secondary antibodies for 60 minutes at room temperature. Membranes were rinsed once again with TBS-T four times for 4 minutes and then incubated for 5 minutes with SuperSignal Substrate. Immunoblots were visualized with Epi Chemi II Darkroom (UVP Laboratory Products).    32 To assess transfer efficiency to nitrocellulose membranes, gels were stained with Bio-Safe Coomassie G-250 Stain (50 mL per gel) for 60 minutes. Equal protein loading was confirmed by probing membranes for β-actin. In one instance β-actin was not detected and therefore, to detect bands membranes were stained with Ponceau S (0.1% (w/v) Ponceau S in 1% (v/v) acetic acid) for 5 minutes.  Table 2.1. Blocking solutions for Western blot analysis of efflux transporters and a brush border membrane protein in Caco-2 cell lysates. Nitrocellulose membranes were incubated with blocking solutions for 120 minutes, at room temperature. Protein Blocking Solution Actin 3% BSA (w/v) in TBS-T Breast cancer resistance protein (BCRP/ABCG2) 3% BSA (w/v) in TBS-T Multidrug resistance associated protein 2 (MRP2) 5% nonfat milk (w/v) in TBS-T P-glycoprotein 3% nonfat milk (w/v) and 1% BSA (w/v) in TBS-T Sucrase-isomaltase 5% nonfat milk (w/v) in TBS-T          33 Table 2.2. Characteristics of primary antibodies used for the detection of efflux transporters and a brush border membrane protein in Caco-2 cell lysates. Nitrocellulose membranes were incubated with primary antibodies overnight, at 4 °C. Protein MW Antibody Dilution Manufacturer Actin (I-19)  42 kDa Goat Polyclonal  1:200 in blocking solution Santa Cruz (sc-1616) ABCG2 (BXP-21) 75 kDa Mouse Monoclonal  1:20 in blocking solution Santa Cruz (sc-58222) MRP2 (M2 III-6) 190 kDa Mouse Monoclonal  1:20 in blocking solution Santa Cruz (sc-59608) P-glycoprotein 170 kDa Mouse C219 Monoclonal  1:20 in TBS-T Covance (SIG-38710) Sucrase-isomaltase 260 kDa Goat Polyclonal  1:50 in TBS-T Santa Cruz (sc-27603)  Table 2.3. Characteristics of secondary antibodies used to detect efflux transporters and a brush border membrane protein in Caco-2 cell lysates. Secondary antibodies were prepared in TBS-T and nitrocellulose membranes were incubated for 60 minutes, at room temperature before detection with SuperSignal Substrate. Protein Antibody Dilution Actin Bovine anti-goat IgG-HRP (sc-2378) 1:5000 ABCG2 and MRP2 Goat anti-mouse IgG2a-HRP (sc-2061) 1:5000 P-glycoprotein Goat anti-mouse IgG1-HRP (sc-2060) 1:5000 Sucrase-isomaltase Donkey anti-goat IgG-HRP (sc-2020) 1:5000    34 2.2.9 Data and Statistical Analysis All data are presented as arithmetric mean values of independent experiments ± standard error of the mean (SEM). Here, independent experiments are those conducted on different days under the same experimental conditions. For example, the ABCB1 knockdown experiments represent transfections conducted on different days with Caco-2 cells of different passage numbers.  Data were analyzed for statistical significance using SigmaStat (Version 3.5) and parametric statistical tests were performed according to the data. The significance criterion was set a priori at 0.05. Initial assessment for normality and equal variance determined whether data transformation was required.  A one-way analysis of variance (ANOVA) was used to analyze differences in mean flux ratios for Rh123 bi-directional studies and mean accumulation for Rh123 accumulation studies. If the ANOVA revealed that the difference in means was greater than would be expected by chance, then a Dunnett’s post-test was used to determine whether mean values were statistically significant from the NTC treatment group.  2.3 Results Establishing and characterizing an epithelial cell model for transport studies requires the assessment of monolayer integrity, cell differentiation, and transporter functionality. Expression of P-gp and of other transporters was also qualitatively evaluated for this short-term Caco-2 cell model. Dr. Stephen Lee, a former PhD candidate in Dr Wasan’s laboratory, established the transfection protocol and performed the initial siRNA experiments as part of his doctoral work.   35 The optimal and non-toxic siRNA dose for > 70% reduction in ABCB1 mRNA in Caco-2 cells was found to be 200 nM (105). This siRNA dose was used for all transfection experiments.  2.3.1 Monolayer Integrity A preliminary transfection (n = 1) with two different siRNA constructs, HSS182278 (construct 1) and HSS107919 (construct 2), was conducted and TEER values were measured as described in Section 2.2.3 and Section 2.2.4. TEER values for Caco-2 cells transfected with 200 nM ABCB1 siRNA construct 2 were higher than other treatment groups, at each day post-transfection. A TEER value of 1193 Ω•cm2 on day 4 post-transfection was observed for Caco-2 cells transfected with construct 2; TEER values were 263 Ω•cm2 for 200 nM NC siRNA cells and were 547 Ω•cm2 for NTC cells, representing a 4.5- and 2-fold difference, respectively. In contrast, TEER values for Caco-2 cells transfected with construct 1 were similar to 200 nM NC siRNA and NTC cells, 311 Ω•cm2, as shown in Figure 2.1. Whilst these results are only for one experiment, TEER values were consistent with previous observation in our lab and as such, construct 1 was used for all subsequent transfection experiments. The 200 nM ABCB1 siRNA construct 1 treatment group will subsequently be referred to as 200 nM ABCB1 siRNA in this thesis.   36  Figure 2.1: Trans-epithelial electrical resistance values for 200 nM ABCB1 siRNA transfected cells and control cells. Caco-2 cells were independently transfected in suspension with two ABCB1 siRNA constructs and TEER values were measured from day 2 to day 5 post-transfection, with media replacement every other day. TEER values for 200 nM ABCB1 siRNA construct 1 (HSS182278), 200 nM NC siRNA, and NTC cells were similar. Compared to control cells, 200 nM ABCB1 siRNA construct 2 (HSS107919) had higher TEER values on every day post-transfection. Tight junction formation (TEER > 250 Ω•cm2) was observed for all treatment groups by day 4 post-transfection. NC, Negative Control GC matched siRNA; NTC, No Transfection Control; TEER, Trans-epithelial electrical resistance.  Monolayer integrity was determined by measuring TEER values for treatment groups from day 2 to day 8 post-transfection. The formation of a confluent monolayer and tight junctions can indirectly be determined by resistance values. Resistance values represent resistance of monolayers to the paracellular transport of ions. The threshold for monolayer integrity (250   37 Ω•cm2) was consistently achieved by day 5 post-transfection for all treatment groups. As shown in Figure 2.2, TEER values were 361 ± 120 Ω•cm2 for 200 nM ABCB1 siRNA construct 1, 1012 ± 428 Ω•cm2 for 200 nM NC siRNA cells, and 629 ± 64 Ω•cm2 for NTC cells on day 5 post-transfection. In addition, monolayer integrity was not disrupted by continuous culturing (up to day 8 post-transfection) on Transwell® Permeable Supports.  Figure 2.2: Time dependent measurement of trans-epithelial electrical resistance values for 200 nM ABCB1 siRNA transfected cells and control cells. 200 nM ABCB1 siRNA construct 1 was used for all transfections. TEER values were measured from day 2 to day 8 post-transfection, with media placement every other day. Tight junction formation (TEER > 250 Ω•cm2) was observed within five days of culturing. Mean TEER values were calculated for independent transfections conducted on different days (n = 3), under the same experimental conditions. Error bars represent ± SEM. NC, Negative Control GC matched siRNA; NTC, No Transfection Control; TEER, Trans-epithelial electrical resistance.   38  2.3.2 Cell Differentiation Lee et al., previously showed the sub-cellular localization of zonula occluden-1 (ZO-1), a tight junction protein, to cell-cell contact sites by day 4 post-transfection in 200 nM ABCB1 siRNA transfected Caco-2 cells (105). This observation was further supported by the qualitative analysis of sucrase-isomaltase expression in transfected and non-transfected Caco-2 cells (Figure 2.3). Once cell differentiation has occurred, the brush border enzyme sucrase-isomaltase is expressed in a polarized fashion on the apical membrane of epithelial cells. Cell lysates from 200 nM ABCB1 siRNA and NTC treatment groups were analyzed by Western blot from day 3 to day 10 post-transfection. Sucrase-isomaltase was expressed by day 5 post-transfection for both treatment groups and protein levels increased with successive days of culturing. This further supported the rationale for conducting functional studies on day 5 post-transfection. Equal protein loading was confirmed by the detection of β-actin (Figure 2.4).  Figure 2.3: Representative figure of the detection of sucrase-isomaltase, a brush border protein, in 200 nM ABCB1 siRNA transfected cells and NTC cells. Whole cell lysates (20 µg) from day 3 to day 10 post-transfection were   39 separated using linear polyacrylamide gradient gels (4 – 15%) and transferred to nitrocellulose membranes. Nitrocellulose membranes were probed for sucrase-isomaltase (260 kDa) and equal loading was confirmed by the detection of β-actin. These blots are presented in Figure 2.4. Sucrase-isomaltase was present within five days of seeding Caco-2 cells on Transwell® Permeable Supports, indicating cell differentiation and polarization (105). NTC, No Transfection Control.  2.3.3 Knockdown of ABCB1 in Caco-2 cells The effect of ABCB1 targeting siRNA on P-gp levels and the duration of ABCB1 transient knockdown was assessed for 200 nM ABCB1 siRNA transfected cells. As seen in Figure 2.4, 200 nM ABCB1 siRNA was sufficient to decrease P-gp expression by day 5 post-transfection and this knockdown of ABCB1 was sustained until day 10 post-transfection. In contrast, P-gp levels were unchanged for non-transfected cells. β-Actin for both treatment groups was unaffected by the transfection protocol. This suggested that transport studies and other functional studies could be conducted in this Caco-2 cell model between day 5 and day 10 post-transfection.     40  Figure 2.4: Representative figure of the time dependent reduction of P-glycoprotein protein levels in 200 nM ABCB1 siRNA transfected cells and P-glycoprotein levels in NTC cells. The membranes from Figure 2.3 were stripped and re-probed for P-glycoprotein (170 kDa). P-glycoprotein was observed in 200 nM ABCB1 siRNA cell lysates on day 3 post-transfection. Protein levels were not detectable by day 5 post-transfection and this reduction in protein levels was sustained until day 10 post-transfection. P-glycoprotein levels in NTC cells were unchanged. The detection of β-actin confirmed equal protein loading (105). NTC, No Transfection Control.  2.3.4 Expression of Other Efflux Transporters The protein expression of other efflux transporters, multidrug resistance-associated protein 2 (MRP2) and breast cancer resistance protein (BCRP/ABCG2), in transfected and non-transfected Caco-2 cells were examined by Western blot analysis from day 3 to day 8 post-transfection. This analysis was performed to determine the specificity of the ABCB1-targeting siRNA and whether this transfection protocol resulted in compensatory responses, i.e., altered expression of other   41 transporters. No changes were observed for the protein levels of either transporter and protein levels were consistent between treatment groups. Despite stripping and re-probing, β-actin could not be detected by chemiluminescence. Thus, nitrocellulose membranes were stained with Ponceau S stain and equal loading was confirmed (data not shown).  Figure 2.5: Protein levels of other transporters in 200 nM ABCB1 siRNA transfected cells and NTC cells. The specificity of ABCB1 siRNA was qualitatively assessed by Western blot analysis. Protein levels of multidrug resistance-associated protein 2 (190 kDa) and breast cancer resistance protein (75 kDa) were determined for cell lysates (20 µg) from day 3 to day 8 post-transfection. No differences in protein levels were observed for either transporter or between treatment groups. NTC, No Transfection Control.  2.3.5 Rhodamine 123 Bi-directional Transport Studies Functionality of this transiently transfected Caco-2 cell model was evaluated by the bi-directional transport of Rh123, as discussed in Section 2.2.5. Apparent permeability coefficients   42 were calculated for the transport of Rh123 in the basolateral → apical (BA) and apical → basolateral (AB) directions, for the four treatment groups on day 5 post-transfection. Values are presented in Figure 2.6 as mean flux ratios (BA/AB) after a 60-minute incubation. The one-way ANOVA revealed that there was a statistically significant difference (P = 0.002) between mean flux ratios. A significant decrease (P < 0.05) in the flux ratio was observed for 200 nM ABCB1 siRNA cells as compared to NTC cells. The flux ratio was 1.11 ± 0.48, which was approximately 63% less than NTC cells (3.07 ± 0.88) and 200nM NC siRNA cells (3.75 ± 0.20). However, this ratio was comparable to that of cells incubated with the P-gp inhibition positive control, LY335979 (0.85 ± 0.85).      43  Figure 2.6: Flux ratio of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells. On day 5 post-transfection, cells were incubated with 5 µM Rhodamine 123 prepared in transport buffer (HBSS), and 50 µL samples were taken from the receiver chamber with replacement every 30 minutes. Rhodamine 123 transport was assessed for non-transfected cells in the presence and absence of 100 nM LY335979 (P-glycoprotein inhibitor). Apparent permeability coefficients were calculated for BA (efflux) and AB (uptake) transport and flux ratios were determined under sink conditions. After a 60-minute incubation, a statistically significant difference in mean flux ratios was observed (P = 0.002). A significant reduction in flux ratio for 200 nM ABCB1 siRNA cells was observed relative to NTC cells (P < 0.05). This was comparable to the chemical inhibition of P-glycoprotein by 100 nM LY335979 (P < 0.05). Mean flux ratios were calculated from three independent experiments (n = 3). Experiments were conducted on three different days, under the same experimental conditions. Error bars represent ± SEM. Statistical analysis was performed using a one-way ANOVA, with a Dunnett’s post-test, and * denotes a statistically   44 significant difference from NTC cells (P < 0.05) (105). AB, apical → basolateral; BA, basolateral → apical; NC, Negative Control GC matched siRNA; NTC, No Transfection Control.   2.3.6 Rhodamine 123 Uptake Studies Rh123 uptake studies were performed to determine whether differences in mean flux ratios correlated with changes in intracellular accumulation. The accumulation of Rh123 in 200 nM ABCB1 siRNA transfected and control cells, for both BA and AB transport, was quantified following a 180-minute incubation on day 5 post-transfection. Fluorescence measurements were normalized for protein content and expressed as nM/µg protein, as shown in Figure 2.7 and Figure 2.8. The one-way ANOVA revealed that there was a statistically significant difference (P = 0.001 [BA] and P = < 0.001 [AB]) between mean Rh123 intracellular accumulation. The accumulation of Rh123 was significantly greater (86% increase) in 200 nM ABCB1 siRNA cells than in NTC cells (P < 0.05), for both secretory (BA) and absorptive transport (AB). For BA transport, 200 nM ABCB1 siRNA cells were found to accumulate 13.6 ± 3.9 nM/µg protein of Rh123, as compared to 7.3 ± 3.0 nM/µg protein (NTC cells) and 6.7 ± 1.6 nM/µg protein (200 nM NC siRNA cells). The inhibition of P-gp by 100 nM LY335979 similarly increased the intracellular accumulation (11.9 ± 2.9 nM/µg protein) of Rh123 (P < 0.05). For AB transport, 200 nM ABCB1 siRNA cells accumulated 3.1 ± 0.3 nM/µg protein whilst NTC cells accumulated 1.7 ± 0.4 nM/µg protein (P < 0.05) and 200 nM NC siRNA cells accumulated 1.6 ± 0.4 nM/µg protein.   45  Figure 2.7: Accumulation of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells (BA). On day 5 post-transfection, cells were incubated with 5 µM Rhodamine 123 prepared in transport buffer, for 180 minutes. Rhodamine 123 was added to the basolateral side of the membrane. For non-transfected cells, Rhodamine 123 incubation occurred in the presence and absence of 100 nM LY335979 (chemical P-glycoprotein inhibitor). There was a statistically significant difference in mean Rhodamine 123 accumulation (P = 0.001). The intracellular retention of Rhodamine 123 in 200 nM ABCB1 siRNA cells was significantly greater than NTC cells (P < 0.05). This accumulation was comparable to the positive control (100 nM LY335979). Mean values were calculated from six independent experiments (n = 6). Experiments were conducted on six different days, under the same experimental conditions. Error bars represent ± SEM. Statistical analysis was performed using a one-way ANOVA, with a Dunnett’s post-test, and * indicates a statistically significant difference from NTC cells (P < 0.05) (105). BA, basolateral → apical; NC, Negative Control GC matched siRNA; NTC, No Transfection Control.    46   Figure 2.8: Accumulation of Rhodamine 123 in 200 nM ABCB1 siRNA transfected cells and control cells (AB). On day 5 post-transfection, cells were incubated with 5 µM Rhodamine 123 prepared in transport buffer, for 180 minutes. Rhodamine 123 was added to the apical side of the membrane. For non-transfected cells, Rhodamine 123 incubation occurred in the presence and absence of 100 nM LY335979 (chemical P-glycoprotein inhibitor). There was a statistically significant difference in mean Rhodamine 123 accumulation (P = < 0.001). The intracellular retention of Rhodamine 123 in 200 nM ABCB1 siRNA cells was significantly greater than NTC cells (P < 0.05). This accumulation was comparable to the positive control (100 nM LY335979). Mean values were calculated from six independent experiments (n = 6). Experiments were conducted on six different days, under the same experimental conditions. Error bars represent ± SEM. Statistical analysis was performed using a one-way ANOVA, with a Dunnett’s post-test, and * indicates a significant difference from NTC cells (P < 0.05) (105). AB, apical → basolateral; NC, Negative Control GC matched siRNA; NTC, No Transfection Control.    47  2.4 Discussion Cell-based studies are the preferred preclinical method (108) for investigating barriers to oral drug bioavailability. Of the cell culture models available, Caco-2 cells have been extensively used in oral bioavailability studies, as these cells spontaneously differentiate into enterocyte-like cells, form tight junctions, express brush border enzymes, and express transporters at levels comparable to the human jejunum (101,102,109,110). For drug bioavailability studies, chemical modulators are commonly used to inhibit P-gp. Unfortunately, these chemical modulators are not specific for P-gp and have been shown to affect the activity of other transporters (111-113); thus, presenting a challenge in deciphering the contribution of P-gp to secretory transport.   RNAi has been presented as an alternative to the in vitro chemical inhibition of P-gp. Originally observed in Caenorhabditis elegans, this phenomenon of sequence-specific knockdown of target proteins has been achieved in mammalian cells through the use of siRNA and shRNA (114). Wu et al., demonstrated that the knockdown of ABCB1 with siRNA was a plausible substitute for the physical inhibition of P-gp (115). In this thesis, the protocol outlined by Clayburgh et al., was adapted for ABCB1 targeting siRNA experiments in Caco-2 cells (116). The effect of ABCB1 transient knockdown on monolayer integrity, cell differentiation, P-gp expression, and P-gp function were assessed to determine the utility of this model to estimate the contribution of P-gp to epithelial transport of compounds. The experiments presented in this thesis supplement and support those initially conducted by another student in Dr. Wasan’s laboratory (Dr. Stephen Lee).    48 Monolayer integrity was assessed by the measurement of TEER values. In all instances, TEER values exceeded the threshold value, 250 Ω•cm2, by day 5 post-transfection (Figure 2.2) indicating the formation of a confluent monolayer and the assembly of tight junction complexes. This supports previous studies conducted by our research group and others that demonstrated the sub-cellular localization of ZO-1, a tight junction protein, at day 4 post-transfection (105,116). TEER values increased with culture time for all treatment groups. Interestingly, TEER values for 200 nM NC siRNA cells were higher than 200 nM ABCB1 siRNA transfected and non-transfected Caco-2 cells. It is unclear the cause of these high values; however, this observation did not translate into functional differences for Rh123 bi-directional transport and accumulation studies. To our knowledge, there have been no reports of an association between high TEER values and detrimental effects such as loss of cell monolayer integrity or cell toxicity. Furthermore, TEER values were similar to previously reported values (106,117,118) and this variability may represent a higher susceptibility of 200 nM NC siRNA cells to differences in passage number and cell culture conditions (119).  Monitoring the expression of brush border enzymes is sufficient to confirm cell differentiation of Caco-2 cells (101,120). Sucrase-isomaltase, a brush border hydrolase is expressed in a polarized fashion and is localized to the apical membrane of epithelial cells (121,122). We were able to detect the precursor polypeptide (260 kDa) of sucrase-isomaltase in Caco-2 cell lysates. Temporal expression of sucrase-isomaltase was observed for 200 nM ABCB1 siRNA and NTC cell lysates from day 5 to day 10 post-transfection (Figure 2.3). This is in agreement with previous studies that observed the increased expression of sucrase-isomaltase with increasing culture time (123). Unlike other brush border enzymes the apical localization of sucrase-  49 isomaltase correlates with the establishment of a well-defined brush border membrane (124). Costa de Beauregard et al., found that the knockdown of villin in Caco-2 cells disrupted the formation of the brush border membrane and subsequently no surface labeling of sucrase-isomaltase was detected. As such, Figure 2.3 lends further support for the observation that in this cell culture system, transfected and non-transfected Caco-2 cells form confluent differentiated monolayers with tight junctions and a brush border membrane, by day 5 post-transfection.  Previously, the transient knockdown of ABCB1 in Caco-2 cells was shown at the transcriptional level (105). To investigate whether reductions in mRNA levels translated into decreased P-gp levels, we determined the time-dependent expression of P-gp in transfected and non-transfected Caco-2 cells by Western blot analysis. P-gp protein levels were consistent for NTC cells; however, P-gp was undetectable by day 5 post-transfection (Figure 2.4) in 200 nM ABCB1 siRNA cells. Trace levels of P-gp at day 3 and day 4 post-transfection most likely represent endogenous P-gp and this progressive reduction in P-gp expression is consistent with its reported half-life, of 14 – 17 hours in other epithelial cell lines (125-127). P-gp levels were once again detected on day 10 post-transfection, due to the loss of siRNA activity and de novo protein synthesis. The duration of reduction in P-gp protein levels with this model exceeds results observed by Wu et al., (115). The human breast cancer cell lines, MCF-7/Adr and MCF-7/BC-19, were transfected with 200 nM siRNA targeting ABCB1. Upon analyzing P-gp protein levels, the reduction was sustained for a 24-hour period and P-gp protein levels returned to basal levels by 72 hours post-transfection. The difference in duration of reduction in P-gp protein levels described by Wu et al., (115) and the ABCB1 knockdown Caco-2 model above is most likely due to cell line related differences in siRNA efficiency (128).    50  Although chemically synthesized siRNA are designed to target specific mRNA sequences, off-target effects may obscure results (112,129,130). Two approaches were used to determine whether off-target effects occurred with this transfection protocol. Caco-2 cells were transfected with 200 nM NC siRNA, which has no physiological target, and the temporal expression of two other efflux transporters was assessed. The latter also ascertained whether compensatory mechanisms resulted from the loss of P-gp activity. No differences were observed in results obtained for NTC and 200 nM NC siRNA cells, with the exception of TEER values (Figure 2.2 and Table 4.1). No changes in the expression of MRP2 and BCRP/ABCG2 were observed for either transfected or non-transfected Caco-2 cells (Figure 2.5). These results are in agreement with data reported by a number of research groups. Previously, the transient or stable knockdown of ABCB1 in Caco-2 cells was achieved using synthetic siRNA, cDNA expressed from a plasmid, or viral vector-based shRNA (113,115,131,132). Differences in protocol and culture conditions make direct comparisons difficult; nevertheless, protein levels (113,132) and mRNA (131) of MRP2 and BCRP/ABCG2 for transfected Caco-2 cells did not differ from control cells. This suggests that transient knockdown of ABCB1 does not necessarily alter the expression of those two efflux transporters.  ABCB1 transient knockdown was verified by assessing the efflux efficiency of P-gp. Using Rh123, a fluorescent probe for transport activity, permeability studies were conducted using this Caco-2 cell model. The flux ratio was decreased to one (63% reduction from NTC cells) in 200 nM ABCB1 siRNA cells, indicating the loss of an active transport mechanism (Figure 2.6). A similar reduction (70%) was observed for Caco-2 cells incubated with the chemical inhibitor   51 LY335979. LY335979 has been shown to specifically inhibit P-gp activity in a number of cell lines (133-135) and so the use of 200 nM ABCB1 targeting siRNA presents an excellent surrogate for the in vitro physical inhibition of P-gp. Flux data is further substantiated by the intracellular retention of Rh123. An 86% difference in Rh123 accumulation was observed between transfected and non-transfected Caco-2 cells (Figure 2.7 and Figure 2.8). However, this data does not entirely account for the 63% difference recorded for Rh123 flux ratios. This difference in accumulation and flux data may reflect inter-experimental variability in siRNA efficiency or the involvement of other efflux transporters. Rh123 is also a substrate of multidrug resistance-associated protein 1 (MRP1) (136), an efflux transporter that also confers a multidrug resistance phenotype to various cell lines (137). MRP1 is expressed in the basolateral membrane of enterocytes (138); however, previous studies found low expression levels of MRP1 in Caco-2 cells (102,110,139). Taipalensuu et al., reported that transcript levels of ABCB1 were 13.75 times greater in Caco-2 cells than MRP1 (11.0 x 105 and 0.8 x 105, respectively) (110). Furthermore, work of Hayeshi et al., (139) supports the notion that MRP1 expression was low in this Caco-2 model. Here, authors investigated the expression levels of transporters from 10 different laboratories; MRP1 expression was consistently found to be low. Therefore, the contribution of MRP1 to drug efflux is expected to be minimal for this model. Unfortunately, in this thesis cell lysates were not analyzed for MRP1 protein levels. As such no conclusions can be drawn on its relative expression in 200 nM ABCB1 siRNA cells and NTC cells.  Together, flux (Figure 2.6) and intracellular retention data (Figure 2.7 and Figure 2.8) support the conclusion that P-gp mediated efflux is reduced by the transfection of Caco-2 cells with 200 nM ABCB1 targeting siRNA. In addition, this Caco-2 model will enable researchers to conduct   52 permeability studies prior to day 21 post-seeding. Functional studies can be performed over a 5-day period, when the transient knockdown of ABCB1 is observed. This is an improvement over a previously reported accelerated Caco-2 model.  In summary, the above results demonstrate that this ABCB1 knockdown Caco-2 model is a feasible system for the evaluation of P-gp mediated drug efflux. A comprehensive analysis of parameters related to the functionality of Caco-2 cells in this model was conducted. Caco-2 cells were found to form confluent monolayer with tight junctions. Cells differentiated into enterocyte-like cells expressing the brush border enzyme sucrase-isomaltase. A single incubation with 200 nM ABCB1 targeting siRNA successfully decreased P-gp levels and this was accompanied by a loss in P-gp efflux efficiency.   53 Chapter 3: Cell-based Amphotericin B HPLC Assay  3.1 Introduction An analytical method was required to quantify the amount of AmB (relative to protein amount) associated with 200 nM ABCB1 siRNA transfected and non-transfected Caco-2 cells. Typically, AmB HPLC assays have quantified AmB in tissue and plasma samples. There are few detailed reports on cell-based AmB HPLC assays. This reflects the challenge of developing an assay to quantify AmB in small volumes of cell lysate. A previously established AmB HPLC-UV assay (140) was used here to quantify AmB in Caco-2 cell lysates.  This chapter outlines the development and validation of a cell-based AmB HPLC assay. The LLOD, LLOQ, AmB recovery after an extraction procedure, accuracy, precision, and linearity of the method were determined.  3.2 Materials and Methods 3.2.1 Reagents Amphotericin B powder (AmB, ~80% purity), dimethyl sulphoxide (DMSO), and 1-amino-4-nitronaphthalene were purchased from Sigma-Aldrich® (St. Louis, MO, USA). Acetic acid, acetonitrile, ethanol, isopropanol, methanol, sodium chloride, and water were obtained from Fisher Scientific (Waltham, MA, USA) and were of HPLC grade.     54 3.2.2 Amphotericin B Preparation A 0.5 mg/mL stock solution of AmB was prepared in DMSO and methanol (1:1, v/v) (141), with continuous stirring at 500 rpm for several hours until a translucent yellow solution was formed. The stock solution and all subsequent working solutions of AmB were protected from light and samples were stored in 1.5 mL amber Eppendorf® Safe-Lock® microcentrifuge tubes (Eppendorf, Hamburg, Germany). AmB stability was confirmed by UV-Vis spectrometry (Cary 100 Bio UV-Vis Spectrophotometer, Varian, Santa Clara, CA) on multiple occasions over the course of these experiments.  3.2.3 High Performance Liquid Chromatography 3.2.3.1 Instrumentation and Analytical Conditions HPLC analysis was performed using a Waters™ 600 Controller, Waters™ 717 plus Autosampler, Waters™ 486 Tunable Absorbance Detector (λ = 407 nm), Jones Chromatography Model 7990 oven, and Millennium32 Version 3.20 software. Samples were separated using a BDS Hypersil C18, 5 µm, 250 x 4.6 mm (Lot #: 12339, Thermo Scientific, Waltham, MA) column (142) with a C18 Luna guard column (Phenomenex Inc., Torrance, CA). The composition of the mobile phase was acetonitrile: acetic acid: water, at volume ratios of 57: 4.3: 38.7 (v/v/v), and was initially degassed by sonication in a water bath for 30 minutes. Throughout the analysis, helium sparging at 30 mL/min was used to degas the HPLC grade solvents. Samples were run under isocratic conditions and the column was maintained at 40 oC. The flow rate was 0.8 mL/min and the injection volume was 90 µL, with a total run time of 22 minutes. An internal standard of 1-amino-4-nitronaphthalene (10 µg/mL) (143) was prepared in methanol from a stock solution of 0.5 mg/mL. Amphotericin B and the internal standard were detected via UV-Vis at 407 nm.   55  3.2.3.2 Lower Limit of Detection and of Quantification A cell-based AmB assay was developed and validated using the analytical conditions described above. To standardize results, all samples were prepared with the same amount of Caco-2 cells. The lower limit of detection (LLOD) and quantification (LLOQ) were determined by spiking Caco-2 cells with known concentrations of AmB. The volume equivalent to 30 µg Caco-2 cells was calculated and transferred to 1.5 mL amber microcentrifuge tubes and volume adjusted with PBS 1X to 63 µL. Samples were then spiked in replicate (n = 5) with 7 µL of 48.8 ng/mL, 58.6 ng/mL, 68.4 ng/mL, 78.2 ng/mL, 87.9 ng/mL, 97.7 ng/mL, and 195.0 ng/mL AmB prepared in methanol:water (1:1, v/v). Methanol (140 µL) and the IS (20 µL) were added to each microcentrifuge tube. Samples were vortexed for 30 seconds and cell debris was removed by centrifugation at 10,621 x g for 10 minutes at 10 °C. Samples were then filtered using Ultrafree-MC Centrifugal Filter Units (Durapore® - PVDF 0.22 µm, Millipore, Billerica, MA) at 10,621 x g for 3 minutes at 10 °C and then 110 µL aliquots were transferred to inserts placed in 1 mL clear glass shell vials. Vials were sealed with polyethylene snap caps and loaded into the Waters™ 717 plus Autosampler. Samples (90 µL injection volume) were run under isocratic conditions and the area under the curve (AUC) was determined for IS and AmB from the chromatographs, using the Millennium32 Version 3.20 software. The AmB amount with a defined peak and a signal-to-noise ratio of 3:1 was deemed to be the LLOD and the LLOQ was the amount with a signal-to-noise ratio of 5:1. This was according to guidelines outlined by the FDA.    56 3.2.3.3 Recovery AmB quality controls were prepared from the stock solution (0.5 mg/mL) in methanol:water (1:1, v/v). As discussed in Section 3.2.3.2, 30 µg Caco-2 cells were transferred to 1.5 mL amber microcentrifuge tubes and the volume adjusted with PBS to 63 µL. Samples were prepared in replicate (n = 5) and spiked with 7 µL of 400 ng/mL, 2,000 ng/mL, and 10,000 ng/mL AmB. Similarly, 63 µL distilled water was spiked with AmB. Final amounts were 40 ng/30 µg protein (low quality control), 200 ng/30 µg protein (medium quality control), and 1,000 ng/30 µg protein (high quality control). Methanol (140 µL) and IS (20 µL) were added to each microcentrifuge tube. For Caco-2 cell samples, additional steps were performed to extract AmB. Samples were vortexed for 30 seconds and cell debris was removed by centrifugation at 10,621 x g for 10 minutes at 10 °C. Samples were then filtered using Ultrafree-MC Centrifugal Filter Units (Durapore® - PVDF 0.22 µm, Millipore, Billerica, MA) at 10,621 x g for 3 minutes at 10 °C and 110 µL aliquots transferred to inserts in 1 mL clear glass vials. Samples prepared with distilled water were directly transferred to inserts and 90 µL injected into the HPLC system. Sample recovery with this extraction protocol was calculated using Equation 4: Equation 4: € Recovery (%) =  Mean AUCExtracted AmBAUCNon -extracted AmB" # $ % & ' ×100   3.2.3.4 Intra-day Accuracy and Precision Working solutions of AmB for the calibration curve were prepared by serial dilution with methanol:water (1:1, v/v). Caco-2 cells (30 µg in 63 µL PBS) were spiked with 7 µL of the working solutions and the final amounts were 0 ng/30 µg protein, 9.8 ng/30 µg protein,    57 19.5 ng/30 µg protein, 39.1 ng/30 µg protein, 78.1 ng/30 µg protein, 156 ng/30 µg protein,  312 ng/30 µg protein, 625 ng/30 µg protein, 1,250 ng/30 µg protein, 2,500 ng/30 µg protein, and 5,000 ng/30 µg protein AmB. The four lower amounts were prepared and analyzed in triplicate. In addition, quality controls were prepared in triplicate and the extraction protocol was followed as outlined in Section 3.2.3.3. The intra-day accuracy (RE) and precision (RSD) were calculated for the three quality controls: Equation 5: € RE (%) =  Measured concentration -  spiked concentrationSpiked concentration" # $ % & ' ×100  Equation 6: € RSD (%) =  Standard deviationMean" # $ % & ' ×100  3.2.3.5 Inter-day Accuracy and Precision Standards for the calibration curve and quality controls were prepared in triplicate, as described in Section 3.2.3.4. HPLC analysis was performed on three consecutive days, with one set of quality controls analyzed on each day (n = 1). Replicate samples were stored at 4 °C, until ready for use on subsequent days. The inter-day accuracy and precision were calculated using Equation 5 and Equation 6.  3.2.3.6 Calibration Curve Standards for calibration curves were prepared as discussed in Section 3.2.3.4; however, only one sample was analyzed for each standard (n = 1). The linear range of the calibration curve was   58 determined by fitting the data with trendline generated by linear regression analysis. Standards for calibration curves were also prepared with cell culture media. Here, 63 µL of complete DMEM was spiked with AmB concentrations listed in Section 3.2.3.4. HPLC analysis was performed as described above.  3.3 Results 3.3.1 Amphotericin B Preparation The stability of the stock solution (0.5 mg/mL) of AmB was routinely analyzed, as exposure to light can result in the degradation of AmB (144). Despite extensive use over a number of months, AmB was found to be stable. The stock solution was diluted with a mixture of methanol and water (1:1, v/v) to 500 ng/mL AmB and was analyzed by UV-Vis spectrometry. The spectrum was characteristic of AmB. Three absorption maxima were observed and the λmax was 407 nm (Figure 3.1), which is within the range reported in the literature (144-147).  For cell culture experiments, working solutions of AmB were prepared with DMEM. Solutions were visually inspected to ensure that there were no solubility issues. AmB was found to be soluble in both the Pgp-Glo Assay Buffer and DMEM. Appropriate controls were also assessed for each experiment. The amount of vehicle control (DMSO and methanol, 1:1, v/v) did not exceed 1% of the final incubation volume (0.5 mL) for any given experiment.     59  Figure 3.1: UV-Vis spectrogram of Amphotericin B. Powdered Amphotericin B was solubilized with DMSO and methanol (1:1, v/v) to make a 0.5 mg/mL stock solution. Amphotericin B stability was regularly assessed by UV-Vis spectrometry. Characteristic three absorption maxima were observed for 500 ng/mL Amphotericin B prepared in methanol:water (1:1, v/v). The λmax of 500 ng/mL Amphotericin B was 407 nm. Abs, Absorbance.  3.3.2 Lower Limit of Detection and of Quantification Initial HPLC experiments were conducted to observe chromatographic characteristics, such as baseline signal, peak separation, and retention time of AmB and IS. This analysis was conducted using a Caco-2 cell matrix. As shown in Figure 3.2, the baseline was unperturbed when Caco-2 cells (30 µg) were injected into the system. Peak separation for IS and AmB was successful, with retention times of 6 minutes and 13 minutes respectively, to the nearest minute (Error! Reference source not found.), and there were no interfering peaks at the AmB retention time.   60   Figure 3.2: Chromatogram of injected blank Caco-2 cell lysates. A cell-based HPLC assay was developed and analyte separation was achieved using a BDS Hypersil C18 column, a run time of 22 minutes, temperature of 40 °C, and an injection volume of 90 µL. Caco-2 cell lysate did not interfere with the baseline of the system and the solvent front was observed at approximately 4 minutes. AU, Absorption Units.  The LLOD and LLOQ were determined as outline in Section 3.2.3.2. The signal-to-noise ratios for eight AmB standards are shown in Table 3.1. As seen in  Figure 3.4, LLOD of 5 ng/30 µg protein (signal-to-noise ratio 3:1) was achieved with this method. The LLOQ was 8 ng/30 µg protein (signal-to-noise ratio 5:1).    61  Figure 3.3: Representative chromatogram for peak separation of Amphotericin B and naphthalene (10 µg/mL). Caco-2 cell lysates (30 µg) were spiked with 10,000 ng/mL Amphotericin B, for a final amount of 1,000 ng/30 µg protein. Amphotericin B was extracted from cell lysates by the addition of 140 µL methanol and a series of centrifugation steps. 90 µL was injected into the system and Amphotericin B eluted at 13 minutes and naphthalene (internal standard) had a retention time of 6 minutes (to the nearest minute). AU, Absorption Units.    62  Figure 3.4: Representative chromatogram of the LLOD (5 ng/30 µg protein). Caco-2 cell lysates were spiked with 48.8 ng/mL Amphotericin B. 90 µL of sample was injected into the system and the resulting chromatograms were manually analyzed for peaks. The area under the curve and the signal-to-noise ratio were determined for samples. The LLOD was 5 ng/30 µg protein, with a signal-to-noise ratio of three. AU, Absorption Units.  Table 3.1: Signal-to-noise ratio for Amphotericin B standards prepared with Caco-2 cell lysates. Caco-2 cell lysates were spiked with 48.8 ng/mL, 58.6 ng/mL, 68.4 ng/mL, 78.2 ng/mL, 87.9 ng/mL, 97.7 ng/mL, and 195 ng/mL Amphotericin B, prepared in a 1:1 mixture of methanol and water. Replicate samples (n = 5) were injected. The signal-to-noise ratio was determined for each standard. The LLOD was 5 ng/30 µg protein and the LLOQ was  8 ng/30 µg protein. Standard (ng/30 µg protein) Signal-to-noise ratio 0.0 - 4.9 2.8 5.9 3.5   63 Standard (ng/30 µg protein) Signal-to-noise ratio 6.8 4.5 7.8 5.0 8.8 5.7 9.8 6.5 19.5 13.7  3.3.3 Recovery The % recovery of AmB from Caco-2 cells was assessed to determine the feasibility of using a methanol extraction procedure. The % recovery was calculated from the mean AUC (n = 5) for Caco-2 cells spiked with AmB and the mean AUC for MilliQ water spiked with AmB. Table 3.2 outlines the % recovery and RSD for three quality controls. The recovery was ≥ 80% for the three quality controls. The recovery was 82.3 ± 2.9%, 105.0 ± 3.9%, and 100.0 ± 4.2% for the QC – Low (40 ng/30 µg protein), QC – Medium (200 ng/30 µg protein), and QC – High  (1,000 ng/30 µg protein), respectively. The recovery with a methanol extraction step was adequate over this range; thus, this step was included for all subsequent HPLC analysis.     64 Table 3.2: The % recovery of Amphotericin B for Caco-2 cell lysates. MilliQ water and Caco-2 cell lysates (30 µg) were spiked with low, medium, and high concentrations of Amphotericin B for the final quality controls of  40 ng/30 µg protein, 200 ng/30 µg protein, and 1,000 ng/30 µg protein. Amphotericin B was extracted from spiked Caco-2 cell lysates by the addition of methanol and a series of centrifugation steps. Replicate samples (n = 5) were injected. % Recovery = Mean (AUC Extracted/ Mean AUC Non-extracted) *100. Amphotericin B Quality Control (ng/30 µg protein) Recovery (%) RSD (%) QC – Low (40) 82.3 3.5 QC – Medium (200) 105.0 3.7 QC – High (1,000) 100.0 4.2  3.3.4 Intra-day and Inter-day Accuracy and Precision The intra-day and inter-day accuracy and precision were determined for this cell-based HPLC assay. As seen in Table 3.3, both the intra-day and inter-day relative errors were within ± 15% and the relative standard deviation was < 15%. The method was reproducible within the same day and on different days for all quality controls. It should be noted that for the QC – Low and QC – Medium the method was more accurate on different days than on the same day, 0.57 vs. -1.3 (QC – Low) and -10.4 vs. -12.8 (QC – Medium).  65  Table 3.3: The intra-day and inter-day accuracy and precision of Amphotericin B in Caco-2 cell lysates. Caco-2 cell lysates (30 µg) were spiked with low, medium, and high concentrations of Amphotericin B for final quality controls of 40 ng/30 µg protein, 200 ng/30 µg protein, and 1,000 ng/30 µg protein. Replicate samples (n = 3) were injected for intra-day calculations and samples were injected on three consecutive days for inter-day calculations.  Intra-day Inter-day  Mean ± SD RE (%) RSD (%) Mean ± SD RE (%) RSD (%) QC – Low (40) 39.5 ± 2.3 -1.3 5.9 40.2 ± 5.6 0.6 14.0 QC – Medium (200) 174.4 ± 3.7 -12.8 2.1 179.3 ± 7.5 -10.4 4.2 QC – High (1,000) 988.4 ± 15.7 -1.2 1.6 937.9 ± 72.5 -6.2 7.7   66  3.3.5 Calibration Curve Standards from 9.8 ng/30 µg protein to 5,000 ng/30 µg protein were prepared with Caco-2 cell lysates, as described above. A best-fit line for calibration data was determined using the ‘Trendline’ function in Microsoft Excel®. A linear range of 8 ng/30 µg protein to 2,500 ng/30 µg protein was used for all calculations. The slope of all calibration curves was 0.002 and the coefficient of determination was between 0.9952 – 0.9999. A representative calibration curve can been seen in Figure 3.5 and all other calibration curves are provided Appendix A.  This HPLC-UV assay can also be employed to determine the amount of AmB in spiked cell culture media. This was not the focus of the work presented in this thesis; however, there is the possibility of applying this HPLC-UV assay to future bi-directional transport studies. A representative chromatogram of spiked cell culture media is provided in Appendix A. 67   Figure 3.5: Representative calibration curve for an Amphotericin B cell-based HPLC assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL) and 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B in samples of three quality controls. The corresponding intra-day accuracy and precision were then calculated for each quality control. AmB, Amphotericin B; IS, internal standard.  3.4 Discussion Therapeutic side effects neccessiate clinical monitoring of AmB plasma levels in patients. HPLC assays, for the detection of AmB in biological samples, were initially developed to meet this need and subsequently for the characterization of pharmacokinetic profiles of new AmB 68  formulations.  There are few descriptions of the use of HPLC to quantify AmB in cell samples as the analysis of this matrix presents a number of challenges. The end product of cell culture experiments is often small sample volumes and measures must be taken to prevent sample loss. Sample preparation presented another challenge with this method. Typically, cell lysis is achieved by incubation with detergents. However, components of the lysis buffer such as SDS can damage HPLC columns and so the more laborious method of sonication was employed here.  The above analytical conditions and method were adapted from those previously reported (66,140,142), to accommodate the cell matrix. AmB retention time agreed with the time observed for tissue and plasma samples. It is difficult to compare this assay with others as results are presented as ng AmB per 30 µg protein. To our knowledge, there is only one publication that provides a comprehensive description of a cell-based AmB assay. Campanero et al., developed a method for the quantification of AmB in J774.2 macrophage cells (141). Authors reported an AmB retention time of 4.01 minutes, a LLOD of 0.2 ng/mL, and a precision < 5%. In contrast, the above method had an AmB retention time of 13 minutes, a LLOD of 5 ng/30 µg protein, and the intra-day and inter-day precision was < 15%. Ménez et al., also used HPLC analysis to quantify AmB in Caco-2 cells (148). A retention time of 6 minutes was reported and the linearity of the assay ranged from 10 nM to 20,000 nM AmB. The linear range for the above method was 9.7 ng/30 µg protein to 2,500 ng/30 µg protein. Both these studies suggest that improvements can be made to the HPLC assay described above. Nevertheless, this method was appropriate and yielded results within the range of quantification for the study of AmB associated with Caco-2 cells, as discussed in Sections 4.2.4 and 4.3.2.  69  Chapter 4: Amphotericin B and P-glycoprotein Interaction  4.1 Introduction There are no published data where the specific aim of experiments was to investigate whether AmB is a substrate for P-gp mediated efflux in epithelial cells. As such, current knowledge of AmB and P-gp is inferred from secondary observations of a number of in vitro studies. These studies imply that AmB does not affect P-gp function (90-92). A number of recent studies suggest that either AmB induces P-gp expression (93) or is a substrate for P-gp mediated efflux (94,95,98). Using a number of different experimental approaches, we sought to ascertain whether this antifungal agent is indeed a substrate for this efflux transporter.  This chapter describes three studies (P-gp ATPase assay, AmB cytotoxicity studies, and AmB cellular association studies) that attempt to answer the research question of this thesis. A commercially available P-gp ATPase assay was employed to investigate whether AmB stimulates P-gp activity in artifical membranes. The newly established ABCB1 knockdown Caco-2 cell model was used to determine the cytotoxic effect of AmB. Finally, this cell model and the AmB analytical method were combined to assess the cellular association of AmB.  4.2 Materials and Methods 4.2.1 Reagents Pgp-Glo™ Assay Systems and CytoTox 96® Non-Radioactive Cytotoxicity Assay were purchased from Promega (Madison, WI, USA). Fluorophore conjugated secondary antibodies, 70  IRDye 800CW Goat anti-Mouse and IRDye 650RD Donkey anti-Goat, were purchased from LI-COR Biosciences (Lincoln, NE, USA).  4.2.2 P-gp ATPase Activity P-gp ATPase activity was assessed with the commercially available Pgp-Glo™ Assay Systems (Promega, Madison, WI, USA). This Pgp-Glo™ Assay relies on the ATP dependent light-generating reaction of firefly luciferase to determine whether or not a test compound is a stimulator of P-gp ATPase activity. With this assay, test compounds are compared with the selective P-gp inhibitor, sodium orthovanadate (100 µM Na3VO4). Orthovanadate irreversibly binds to the nucleotide-binding domain of P-gp resulting in the loss of ATPase activity (149). Subsequently, there is no consumption of ATP; thus, no changes in luminescence are observed (Figure 4.1). Compounds that are P-gp substrates will stimulate ATPase activity and as such, less luminescence will be detected. 71   Figure 4.1: Measurement of P-gp ATPase activity with the Pgp-Glo™ Assay System. P-gp substrates, such as verapamil, will bind to the efflux transporter and stimulate P-glycoprotein ATPase activity. Any remaining ATP will react with luciferin and the resulting luminescence can be quantified. The generated light is proportional to the amount of unconsumed ATP; hence, representing the extent of P-glycoprotein ATPase stimulation. Permission granted for the reproduction of this image by Promega Corporation.  The assay was performed according to the manufacturer’s protocol, with minor modifications. Briefly, controls and test compounds were prepared with Pgp-Glo™ Assay Buffer and 20 µL of each was loaded in triplicate into white flat bottom polystyrene opaque 96-well microplates (Costar #3912, Corning, NY, USA). Final concentrations of test compounds were 2.5 µg/mL,  72  5 µg/mL, and 10 µg/mL (AmB) and 100 nM (LY335979). LY335979 was assayed as it was used as a positive control for P-gp inhibition for in vitro experiments. Incubation with 200 µM verapamil confirmed P-gp ATPase activity. Samples were incubated with 20 µL recombinant human P-gp membrane fractions (25 µg) for 5 minutes at 37 °C and then with 10 µL of Mg2+-ATP (5 mM) for 60 minutes instead of 40 minutes, at 37 °C. The reaction was stopped by the addition of 50 µL of reconstituted ATP Detection Reagent and luminescence was allowed to develop for 30 minutes at room temperature. Luminescence readings were measured with a Synergy Mx Multi-Mode Reader (BioTEK, Winooski, VT, USA) and converted to amount of ATP using an ATP standard curve (Figure 4.2).  73   Figure 4.2: Representative ATP standard curve for the quantification of unconsumed ATP (nmol) in test compounds and controls. ATP standards were incubated with ATP Detection Reagent for 30 minutes at room temperature and luminescence was measured with a Synergy Mx Multi-Mode Reader. RLU values of test compounds and controls were compared to the standard curve to determine the amount of ATP. RLU, relative light units; ATP, adenosine triphosphate.  P-gp ATPase activity was expressed as percent stimulation relative to basal P-gp ATPase activity, using the following series of equations: Equation 7: € ATPNa3VO4[ ]− ATPNT[ ]25µg Pgp ×  60 minutes$ % & & ' ( ) ) = nmol ATP consumed/µg Pgp/minute 74   Equation 8: € ATPNa3VO4[ ]− ATPTC[ ]25µg Pgp ×  60 minutes$ % & & ' ( ) ) = nmol ATP consumed/µg Pgp/minute  Equation 9: € Test Compound activityBasal Pgp activity×100 = % Pgp ATPase Activity   Basal P-gp ATPase activity was calculated using Equation 7, where NT represents the no treatment control (Pgp-Glo Assay Buffer). Equation 8 was used to determine the P-gp ATPase activity of test compounds (TC), which was then expressed relative to basal P-gp activity (Equation 9).  4.2.3 Analysis of Toxicity and Cell Death Caco-2 cells were seeded on Transwell® Permeable Supports as discussed above in Section 2.2.3. The cytotoxic effect of AmB (0 – 20 µg/mL) on 200 nM ABCB1 siRNA cells, 200 nM NC siRNA cells, and NTC cells was determined following a 180-minute incubation on the apical side of the Caco-2 cell monolayer, on day 5 post-transfection, using the CytoTox 96® Non-Radioactive Cytotoxicity Assay. Dilutions of AmB were prepared in complete DMEM and no solubility issues were observed. This assay measures lactate dehydrogenase (LDH), a stable cytosolic enzyme, released as a consequence of damaged cell membranes. LDH quantification occurs via a coupled enzymatic reaction where a tetrazolium salt (INT) is converted to a red formazan product, the intensity of which is proportional to the number of lysed cells. 75  € NAD++  lactate LDH" → "   pyruvate +  NADHNADH +  INTDiaphorase" → " " "  NAD++  formazan  Caco-2 cells were rinsed once with pre-warmed HBSS prior to incubation with AmB. All solutions were prepared with DMEM and cells were also incubated with 1% DMSO and methanol (vehicle control), and 1% Triton X-100 (50 µL 10% Triton X-100 and 450 µL DMEM) as a control for cell death. A LDH positive control, provided with the assay, was used to confirm that the assay was functional (1 µL and 49 µL DMEM) and 50 µL DMEM was used as a blank. LDH release was measured in both the apical and basolateral chambers and Equation 10 was used to calculate percent cytotoxicity: Equation 10: € % Cytotoxicity =  LDHTest -  LDHNegative Control[ ]LDHPositive Control -  LDHNegative Control[ ]×100   LDHNegative Control was the LDH release for transfected and non-transfected Caco-2 cells incubated with complete DMEM, and LDHPostive Control was the LDH release for transfected and non-transfected Caco-2 cells incubated with 1% Triton X-100. Aliquots (200 µL) from both the apical and basolateral chambers were transferred to 1.5 mL amber microcentrifuge tubes and Caco-2 cells were rinsed once with HBSS. Transwell® Permeable Supports were transferred to new 12-well clear TC-treated multiwell plates and stored at -20 °C, until needed for protein quantification and HPLC analysis.  76  4.2.4 Cellular Association of AmB Polycarbonate membranes were excised from Transwell® Permeable Supports and protein concentrations were determined using probe sonication, as summarized in Section 2.2.7. AmB was quantified using a cell-based HPLC assay. Standards for the calibration curves were prepared according to the protocol in Section 3.2.3.4. The volume required for 30 µg cell lysates was calculated for 200 nM ABCB1 siRNA transfected cells and NTC cells incubated with  1 µg/mL, 2.5 µg/mL, and 5 µg/mL AmB for 180 minutes. These volumes were adjusted with PBS for a final volume of 70 µL. From this point, the extraction procedure and HPLC method were consistent with those of Section 3.2.3.3. Samples represented four independent incubation and transfection experiments.  Calibration curves and linear regression analysis were used to quantify AmB in HPLC samples. Amount of cellular associated AmB, for 200 nM ABCB1 siRNA cells and NTC cells, was standardized for protein content and was expressed as ng/30 µg protein.  4.2.5 Western Blot Analysis Due to technical difficulties with the Epi Chemi II Darkroom, final Western blot experiments resorted to the use of fluorescence for the visualization of proteins. Samples were prepared and proteins separated as described in Section 2.2.8. Minor modifications were made to accommodate the use of fluorophores. Following the overnight incubation with primary antibodies, membranes were rinsed twice with TBS-T for 5 minutes and once with TBS for 5 minutes. Membranes were then incubated with fluorophore conjugated secondary antibodies (1:5000) prepared in TBS for 60 minutes at room temperature and protected from light. Rinsing 77  steps were repeated and immunoblots were visualized using the Odyssey CLx (LI-COR, Lincoln, NE, USA).  4.2.6 Data and Statistical Analysis All data are presented as arithmetric mean values of independent experiments ± SEM. Here, independent experiments are those conducted on different days under the same experimental conditions. For example, AmB cytotoxicity data represent incubations that occurred on different days with Caco-2 cells that were transfected on different days.  Data were analyzed for statistical significance using SigmaStat (Version 3.5) and parametric statistical tests were performed according to the data. The significance criterion was set a priori at 0.05. Initial assessment for normality and equal variance determined whether data transformation was required. These criteria of normality and equal variance were not met for data sets in this chapter. A Log10 or square root transformation was sufficient for these criteria to be satisfied.  A one-way analysis of variance (ANOVA) was used to determine whether the difference in mean values were statistically significant for P-gp ATPase activity data and AmB cytotoxicity data. Statistical analysis for P-gp ATPase activity was conducted on Log10 transformed raw data (nmol ATP consumed/µg P-gp/minute); however, data are presented as mean % ATPase activity ± SEM. If the ANOVA revealed that the difference in means was greater than would be expected by chance, then a Dunnett’s post-test was used to determine which treatment group was statistically significant from the NT treatment group. Statistical analysis for AmB cytotoxicity 78  was conducted on Log10 transformed raw data (Figure 4.4 and Figure 4.5) or square root transformed raw data (Figure 4.6). Data are presented as % Cytotoxicity ± SEM. If the ANOVA revealed that the difference in means was greater than would be expected by chance, then a Dunnett’s post-test was used to determine which treatment condition was statistically significant from the Media treatment condition. Finally, statistical analysis for AmB cellular association studies were conducted on Log10 transformed raw data (ng/30 µg protein); however, data are presented as mean amount Amphotericin B (ng/30 µg protein) ± SEM. A two-way ANOVA was used to determine whether the difference in means was statistically significant. If the ANOVA revealed that the difference in means were greater than would be expected by chance, then a Tukey post-hoc test was used to determine which treatment groups and conditions were statistically significant.  4.3 Results 4.3.1 Membrane-based ATPase Assay With the stability of AmB confirmed (Figure 3.1), the ATP consumption of P-gp membranes in the presence of three concentrations of AmB was assessed. The % ATPase activity for  2.5 µg/mL, 5 µg/mL, and 10 µg/mL AmB were 135.0 ± 20.7%, 138.0 ± 14.6%, and 103.0 ± 21.9% respectively. The one-way ANOVA revealed a statistically significant difference in mean P-gp ATPase activity (P < 0.001). A 60-minute incubation with 2.5 µg/mL, 5 µg/mL, and 10 µg/mL AmB did not result in an increased mean ATPase activity compared with the NT treatment group, as shown in Figure 4.3. Similarly, the ATPase activity of the P-gp inhibitor, 100 nM LY335979, (108.0 ± 31.6%) and 1% vehicle control (80.0 ± 14.5%) did not differ from P-gp membranes incubated with Pgp-Glo buffer (NT). A statistically significant increase (P < 0.05) in 79  P-gp ATPase activity was observed for membranes incubated with verapamil (256.0 ± 40.0%), a substrate of P-gp mediated efflux.  Figure 4.3: Effect of Amphotericin B on the P-glycoprotein ATPase activity (%) of recombinant human P-glycoprotein membranes. P-glycoprotein membranes (25 µg) were incubated with three concentrations of Amphotericin B, 2.5 µg/mL, 5 µg/mL, and 10 µg/mL. Membranes and test compounds were incubated with 5 mM Mg2+-ATP for 60 minutes at 37 °C. Luminescence was initiated by the addition of 50 µL ATP Detection Reagent and luminescence signals were measured after 30 minutes. Relative light units were converted to amount of ATP using an ATP standard curve (Figure 4.2) and specific activity relative to NT was calculated. The dotted red line 80  represents basal P-glycoprotein ATPase activity of membranes. There was a statistically significant difference in mean P-gp ATPase activity (P < 0.001). ATPase activity for the three concentrations of Amphotericin B did not differ significantly from basal P-glycoprotein ATPase activity. The mean P-glycoprotein ATPase activity for 200 µM verapamil was significantly greater than basal activity (P < 0.05). Data is presented as mean % activity values from six independent experiments (n = 6). Error bars represent ± SEM. Raw data (nmol ATP consumed/µg P-gp/minute) was Log10 transformed and statistical analysis was performed using a one-way ANOVA, with Tukey post-hoc testing, and * indicates a significant difference from NT, (P < 0.05). NT, No Treatment (Pgp-Glo Assay Buffer); AmB, Amphotericin B.  4.3.2 Analysis of Toxicity and Cell Death The toxicity of AmB on transfected and non-transfected Caco-2 cells was examined to establish the non-toxic range for subsequent cellular association studies. Cytotoxicity that can be attributed to AmB, for each treatment group – 200 nM ABCB1 siRNA, 200 nM NC siRNA, and NTC cells – is represented as a percentage of cell death of positive control cells (1% Triton X-100). As can be seen in Figure 4.4, Figure 4.5, and Figure 4.6, the cytotoxic effect of AmB did not exceed 20% for any of the treatment groups or AmB concentrations. The maximum cytotoxicity observed following a 180-minute incubation, was 9.4 ± 5.8% (10 µg/mL AmB) for 200 nM ABCB1 siRNA cells, 9.1 ± 3.4% (20 µg/mL AmB) for 200 nM NC siRNA cells, and 16.9 ± 4.6% (10 µg/mL AmB) for NTC cells. Minimal cytotoxicity was also observed for the vehicle control (< 5%). The one-way ANOVA for all treatment groups, 200 nM ABCB1 siRNA cells, 200 nM NC siRNA cells, and NTC cells, revealed a statistically significant difference in % Cytotoxicity (P = < 0.001). The cytotoxic effect of all AmB concentrations did not differ significantly from the negative control (Media) for the 200 nM ABCB1 siRNA and 200 nM NC siRNA treatment groups. A statistically significant difference was observed between the positive 81  control (1% Triton X-100) and the negative control (P < 0.05). On the other hand, the % cytotoxicity was significantly greater for NTC cells (P < 0.05) incubated with 10 µg/mL and 20 µg/mL AmB, when compared to the negative control (Media).   Differences in % cytotoxicity for a given AmB concentration for the three treatment groups were also assessed. For example, % cytotoxicity following a 180-minute incubation with 1 µg/mL AmB for 200 nM ABCB1 siRNA cells, 200 nM NC siRNA cells, and NTC cells. No significant differences were found for AmB % cytotoxicity at any AmB concentration for the three treatment groups. The cytotoxicity profile of AmB did not differ between the three treatment groups. Subsequent experiments quantified the amount of AmB associated with transfected and non-transfected Caco-2 cells after incubation with therapeutically relevant concentrations (1 µg/mL and 2.5 µg/mL AmB) (42,44) and one concentration (5 µg/mL AmB) greater than clinically observed plasma concentrations. 82   Figure 4.4: Cytotoxic effect of Amphotericin B on 200 nM ABCB1 siRNA cells. On day 5 post-transfection, transfected cells were incubated (apical face of the cell monolayer) with 0.5 mL of increasing concentrations of Amphotericin B and controls, for 180 minutes at 37 °C. The vehicle control was DMSO and methanol (1:1, v/v). Lactate dehydrogenase release was measured for the apical and basolateral chambers of the Transwell® system. Absorbance values (492 nm) were converted to % Cytotoxicity relative to the positive control, 1% Triton X-100. The mean cytotoxic effect of Amphotericin B was minimal (< 10%) for all concentrations. There was a statistically significant difference in mean % Cytotoxicity (P = < 0.001), but the % cytotoxicity of cells incubated with Amphotericin B did not differ from the negative control (Media). Data are presented as mean % Cytotoxicity calculated for four independent experiments (n = 4). Error bars represent ± SEM. Statistical analysis was performed on Log10 transformed raw data, using a one-way ANOVA, with a Dunnett’s post-test, and * denotes a significant difference from the negative control (P < 0.05). AmB, Amphotericin B. 83    Figure 4.5: Cytotoxic effect of Amphotericin B on 200 nM NC siRNA cells. On day 5 post-transfection, negative control Low GC matched siRNA transfected cells were incubated with 0.5 mL of increasing concentrations for Amphotericin B and controls, for 180 minutes at 37 °C. The vehicle control was DMSO and methanol (1:1, v/v). Lactate dehydrogenase release was measured for both the apical and basolateral chambers of the Transwell® system. Absorbance values (492 nm) were converted to % Cytotoxicity relative to the positive control, 1% Triton X-100. The mean cytotoxic effect of Amphotericin B was minimal (< 10%) for all concentrations. There was a statistically significant difference in mean % Cytotoxicity (P = < 0.001) but % Cytotoxicity of cells incubated with Amphotericin B did not differ from the negative control (Media). Data are presented as mean % Cytotoxicity calculated for four independent experiments (n = 4). Error bars represent ± SEM. Statistical analysis was performed on the Log10 transformed raw data, using a one-way ANOVA, with a Dunnett’s post-test, and * denotes a significant 84  difference from the negative control (P < 0.05). AmB, Amphotericin B; NC, Negative Control Low GC matched siRNA.   Figure 4.6: Cytotoxic effect of Amphotericin B on NTC cells. On day 5 post-transfection, NTC cells were incubated with 0.5 mL of increasing concentrations of Amphotericin B and controls, for 180 minutes at 37 °C. The vehicle control was DMSO and methanol (1:1, v/v). Lactate dehydrogenase release was measured for both the apical and basolateral chambers of the Transwell® system. Absorbance values (492 nm) were converted to % Cytotoxicity relative to the positive control, 1% Triton X-100. There was a statistically significant difference in % Cytotoxicity (P = < 0.001). The cytotoxic effect of Amphotericin B was significantly greater than the negative control (Media), following a 180-minute incubation with 10 µg/mL and 20 µg/mL Amphotericin B (P < 0.05). Data are presented as mean % Cytotoxicity calculated for four independent experiments (n = 4). Error bars represent ± SEM. Statistical 85  analysis was performed on the square root transformed raw data, using a one-way ANOVA, with a Dunnett’s post-test, and * denotes a significant difference from the negative control (P < 0.05). AmB, Amphotericin B; NTC, No Transfection Control.  As with other experiments, TEER values were measured days prior to cytotoxicity studies and at the end of the incubation period. Cell monolayer integrity was maintained for the duration of the incubation, as TEER values were above the threshold value of 250 Ω•cm2, with the exception of the positive control (Table 4.1). The lack of cytotoxicity was further substantiated by cellular protein content, which was consistent across the treatment conditions (Appendix B).  86  Table 4.1: Trans-epithelial electrical resistance values for transfected and non-transfected Caco-2 cells incubated with Amphotericin B. TEER values were measured prior to a 180-minute incubation with Amphotericin B. After the incubation period, TEER values were once again measured and values were above the threshold value of 250 Ω!cm2, with the exception of cells incubated with 1% Triton X-100. As such, Amphotericin B did not disrupt tight junctions and monolayer integrity was maintained. Data are presented as mean TEER values (Ω!cm2) calculated for four independent experiments (n = 4). Error bars represent ± SEM. AmB, Amphotericin B; NC, Negative Control Low GC matched siRNA; NTC, No Transfection Control; TEER, trans-epithelial electrical resistance.  TEER values (Ω!cm2)  200 nM ABCB1 siRNA 200 nM NC siRNA NTC Treatment Before After Before After Before After 0 µg/mL AmB 499 ± 44.3 607 ± 68.9 1117 ± 387 544 ± 26.3 629 ± 16.9 641 ± 86.7 1 µg/mL AmB 477 ± 57.8 667 ± 60.3 1145 ± 313 548 ± 87.6 564 ± 43.0 589 ± 85.7 2.5 µg/mL AmB 483 ± 22.0 645 ± 42.8 1101 ± 337 897 ± 178 526 ± 84.6 427 ± 68.9 5 µg/mL AmB 458 ± 53.1 606 ± 51.1 1293 ± 331 551 ± 98.7 609 ± 70.6 437 ± 106.3 10 µg/mL AmB 549 ± 45.6 561 ± 64.9 1668 ± 398 687 ± 120 631 ± 39.6 463 ± 49.3 20 µg/mL AmB 544 ± 38.6 484 ± 38.9 1446 ± 396 401 ± 42.9 637 ± 68.6 341 ± 26.8 1% vehicle control 544 ± 33.1 572 ± 98.7 1561 ± 393 441 ± 54.3 600 ± 73.9 473 ± 115.3 1% Triton X-100 492 ± 86.0 92 ± 8.8 1438 ± 529 71 ± 14.4 680 ± 30.6 77 ± 23.0  87  4.3.3 Cellular Association of Amphotericin B The cell-based HPLC assay was used to quantify the cellular association of AmB in this pilot study. Transfected and non-transfected Caco-2 cells were incubated with AmB for 180 minutes and cell lysates were analyzed with the assay described above. Representative chromatograms are included in Appendix A. The amount of associated AmB per 30 µg protein for three concentrations of AmB, 1 µg/mL, 2.5 µg/mL, and 5 µg/mL, is shown in Figure 4.7. A two-way ANOVA revealed that there was no statistically significant difference in the mean amount of cellular associated AmB in relation to transfection status (P = 0.152). However, there was a statistically significant difference in the mean amount of cellular associated AmB in relation to AmB concentration (P = < 0.001). Analysis with a Tukey post-hoc test indicated that when incubated with 5 µg/mL AmB, 200 nM ABCB1 siRNA cells had an increased AmB cellular association compared to NTC cells (P < 0.05). This 180-minute incubation resulted in a 28% increase in cellular association of AmB, 89.9 ± 6.3 ng/30 µg protein for NTC cells verses 115.0 ± 12.5 ng/30 µg protein for 200 nM ABCB1 siRNA cells. However, no differences were seen at lower concentrations of AmB. There was no statistically significant interaction between transfection status and AmB concentration (P = 0.174), indicating the effect of AmB concentration on cellular association of AmB does not depend on transfection status.  Western blot analysis confirmed the reduction in P-gp protein levels for 200 nM ABCB1 siRNA cells on day 5 post-transfection, following a 180-minute incubation with 1 µg/mL and 2.5 µg/mL AmB (Appendix B). 88   Figure 4.7: Amount of Amphotericin B (ng/30 µg protein) associated with 200 nM ABCB1 siRNA cells and NTC cells. Transfected and non-transfected Caco-2 cells were incubated with 1 µg/mL, 2.5 µg/mL, and 5 µg/mL Amphotericin B for 180 minutes at 37 °C, on day 5 post-transfection. Cell lysates (30 µg) from 200 nM ABCB1 siRNA and NTC cells were analyzed for associated Amphotericin B. Amphotericin B was extracted from cell lysates by the addition of methanol and centrifugation steps. Each injection was 90 µL, with a run time of 22 minutes. The area under the curve was using Millennium32 Version 3.20 software and values were within the range of quantification. There was no statistically significant difference in mean cellular associated Amphotericin B for transfected and non-transfected Caco-2 cells (P = 0.152). There was a statistically significant difference in mean cellular associated Amphotericin B for the three Amphotericin B concentrations (P = < 0.001). Increased cellular association of Amphotericin B was observed for 200 nM ABCB1 siRNA cells compared with NTC cells, following a 89  180-minute incubation with 5 µg/mL Amphotericin B. A two-way ANOVA did not reveal a statistically significant interaction between transfection status and Amphotericin B concentration (P = 0.174). Data are presented as mean amounts from four independent incubation experiments (n = 4). Error bars represent ± SEM. HPLC analysis for the two treatment groups (200 nM ABCB1 siRNA and NTC cells) occurred on different days. Statistical analysis was performed on Log10 transformed raw data using a two-way ANOVA, with a Tukey post-hoc test, and * indicates a significant difference from NTC cells (P < 0.05). NTC, No Transfection Control.  4.4 Discussion AmB is a highly efficacious therapeutic agent for the treatment of IFIs and parasitic diseases. Despite high cure rates and few documented cases of clinical resistance, its utility is limited by ADRs, such as dose-dependent nephrotoxicity, the route of administration, and high healthcare associated costs. Needless to say, an oral reformulation of AmB could potentially rectify these shortcomings and thus have a profound impact on therapeutic outcomes and patient quality of life. As with drug development, reformulation has its own set of challenges. Important considerations for improving oral drug bioavailability are physicochemical drug properties – gastric stability and solubility in the gastrointestinal tract – interactions with transporters, and metabolism by enzymes. P-gp is the most extensively studied mammalian efflux transporter; however, the literature is inconclusive regarding the interaction between P-gp and AmB. In vitro studies indicate that AmB does not reverse the multi-drug resistance phenotype in a number of resistant cell lines (90-92). However, in vivo data suggest that AmB induces P-gp mediated efflux. In this regard, AmB has been reported to decrease plasma concentrations of cyclosporine A, a P-gp substrate, in Wistar rats. This decrease was accompanied by elevated levels of mdr1a and mdr1b mRNA and P-gp protein levels in the duodenum (93). In addition, indirect evidence from our group implies that AmB is a substrate for P-gp mediated efflux. In vivo studies found 90  an increase in the intestinal absorption and altered disposition of AmB formulated with Peceol® (98,99), a lipid excipient that was subsequently shown to decrease the expression and function of P-gp in Caco-2 cells (96,150). Thus, this altered pharmacokinetic profile of AmB formulated with Peceol® might be explained by a lack of interaction with P-gp. The current study investigated the contribution of P-gp to the epithelial transport of AmB through the establishment of a short-term ABCB1 knockdown Caco-2 cell model and a cell-based HPLC assay.   4.4.1 Membrane-based ATPase Assay There are a variety of methods that can be employed to classify compounds as P-gp substrates. NCEs can be analyzed using a cell-based assay or membrane-based assays that measure ATPase activity, vesicular transport, or drug binding. Here, the Pgp-Glo™ Assay Systems was selected to determine whether AmB stimulates P-gp ATPase activity. This indirect method quantifies ATP consumption by the measurement of changes in luminescence. It was found that AmB, at three concentrations, did not stimulate the ATPase activity of P-gp membranes (25 µg). However, the known P-gp inhibitor LY335979 also did not stimulate the ATPase activity of P-gp membranes; thus, preventing any conclusive statement on the interaction between P-gp and AmB from being made. This result is in agreement with data presented by Dantzig et al., (107) where LY335979 did not affect P-gp ATPase activity at 80 nM and 400 nM. Nevertheless, this highlights one limitation of membrane-based assay systems, the inability to identify P-gp chemical inhibitors (151,152). Furthermore, experimental conditions and the lipid environment affect ATPase activity (152); as such, caution must be exercised when interpreting results.   91  Polli et al., demonstrated the need to compliment one assay with another approach, as the classification of a compound as a P-gp substrate, nonsubstrate, or inhibitor differed depending on the assay used (151). We subsequently proceeded to utilize the short-term ABCB1 knockdown Caco-2 model described above, to address our research question.  4.4.2 Analysis of Toxicity and Cell Death The newly established ABCB1 knockdown Caco-2 cell model was employed to determine the non-toxic range of AmB. Minimal toxicity (< 10%) was observed for all AmB concentrations after a 180-minute incubation (Figure 4.4 and Figure 4.5), suggesting minimal damage to cell membranes and the maintenance of cell integrity. The concentrations used here are similar, if not lower than those described in the literature. In addition, monolayer integrity was not compromised and the protein content for treatment groups was constant. The literature on the effect of AmB on in vitro epithelial transport is scant. Previous Caco-2 studies have predominately documented the influence of AmB on trans-epithelial electrical parameters (153-155). Ménez et al., (148) investigated the isolated and combinational effect of miltefosine, the only oral VL therapeutic, and AmB on the paracellular transport of [C13] mannitol, on their apparent permeability coefficients, and uptake in a Caco-2 cell model. Authors assessed cell viability and experiments were only conducted when viability was more than 90%. In some instances, Caco-2 cells were incubated with 100 µM AmB far exceeding concentrations investigated in this thesis. It was also reported that the permeability of the paracellular marker, mannitol, was not affected by AmB over a range of concentrations (1 µM – 100 µM) suggesting that tight junctions were not disrupted by AmB. There is concordance between this data and our TEER value data (Table 4.1); thus, supporting the conclusion that monolayer integrity was not 92  affected by AmB. It should be noted that AmB is regularly added to cell culture media to prevent cell contamination by yeast and fungi (156,157). The recommended concentration is 2.5 µg/mL (158,159), which is also one of the concentrations (1 µg/mL, 2.5 µg/mL, and 5 µg/mL) investigated in AmB cellular association studies.  4.4.3 Cellular Association of Amphotericin B The Caco-2 cell model was successfully coupled with the cell-based HPLC assay for the cellular quantification of AmB. As AmB binds to the plasma membrane, it is difficult to determine intracellular accumulation and hence Figure 4.7 represents the uptake and adsorption of AmB. There was a statistically significant difference in mean cellular association of AmB in relation to AmB concentration. No significant difference was observed between mean cellular association of AmB for 200 nM ABCB1 siRNA cells and NTC cells at the lower concentrations of AmB, 1 µg/mL and 2.5 µg/mL. However, a significantly greater amount of AmB was associated with 200 nM ABCB1 siRNA cells than NTC cells, after a 180-minute incubation with 5 µg/mL AmB. The association for higher concentrations of AmB (10 µg/mL and 20 µg/mL) was not investigated, as these are not therapeutically relevant concentrations. As no statistically significant interaction between transfection status and AmB concentration was observed, the effect of AmB concentration on cellular association of AmB does not seem to depend on transfection status. The previous assessment of P-gp protein expression (Figure 2.4) has shown that transfection of Caco-2 cells with 200 nM ABCB1 siRNA correlates with a reduction in P-gp expression. Therefore, P-gp protein expression does not appear to affect the cellular association of AmB in this Caco-2 model.  93   To our knowledge, this pilot study is the first to attempt to directly investigate whether AmB is a substrate for P-gp mediated efflux in epithelial cells. Previous studies have evaluated the ability of AmB to reverse the MDR phenotype in numerous cell lines. Medoff and colleagues (87) reported an increased sensitivity to actinomycin D in HeLa resistant cells when co-incubated with 30 µg/mL AmB. Authors documented changes in cell viability (96% vs 50% for HeLa cells co-incubated with 1 µg/mL actinomycin D and 30 µg/mL AmB), RNA synthesis (inhibited by 68% for HeLa cells co-incubated with actinomycin D and AmB), and uptake of actinomycin D (6-fold increase).  However, the uptake of actinomycin D was not restored to levels observed for sensitive HeLa cells. This suggests that the partial restoration of actinomycin D sensitivity is not primarily through AmB inhibition of P-gp but rather by changes to membrane permeability, which is consistent with this antifungal’s mode of action. This study preceded the first publication identifying P-gp (70); thus, the mechanism underlying the MDR phenotype was not indicated. Krishan et al., (88) demonstrated that a pre-incubation of P388/S and P388/R cells with AmB increased the retention of adriamycin to the same extent. Therefore, this effect was independent of expression levels of this efflux transporter. Other investigators have similarly concluded that the increased sensitivity of resistant cell lines, following incubation with AmB, is due in large part to changes in membrane permeability rather than the inhibition of efflux mechanisms (160).  Experiments conducted with fungal and parasitic models further link results depicted in Figure 4.7 to possible changes in membrane properties. Researchers (95,161) reported differences in membrane sterol composition, fatty acid saturation, and membrane fluidity for sensitive and 94  AmB resistant L. donovani strains. AmB resistant strains of Candida species expressed higher mRNA transcript levels for proteins encoding enzymes of the ergosterol biosynthesis pathway (162-164), suggesting a reduction in AmB binding affinity. It is plausible that the transient knockdown of ABCB1 in Caco-2 cells may also alter membrane properties such as cholesterol content, facilitating AmB binding. P-gp is localized to cholesterol-rich microdomains (165,166). Investigations of the physiological role of P-gp have shown that this efflux transporter is involved in cholesterol homeostasis. Field et al., (167) and Luker et al., (168) reported that increased P-gp expression correlated with an increase in the esterification of plasma membrane cholesterol. This was specific to P-gp, as P-gp modulators successfully inhibited this process (167,168). The present study did not assess the effect of ABCB1-targeting siRNA on cholesterol homeostasis and preliminary data from Dr. Lee was inconclusive due to high inter-experiment variability. Whilst speculative, if P-gp facilitates cholesterol trafficking and regulation of cholesterol homeostasis, we hypothesize that the transient knockdown of ABCB1 will result in decreased cholesterol esterification, greater AmB binding at the plasma membrane, and thus greater cellular association of AmB. For a definitive conclusion to be drawn, future in vitro experiments characterizing membrane properties for this Caco-2 cell model are required.  Taken together, our findings suggest that P-gp has a minimal contribution to the epithelial transport of AmB in Caco-2 cells. Nevertheless, the necessary techniques have been established to conduct future transport studies. 95  Chapter 5: Discussion  Several research groups are attempting to develop an oral AmB formulation with the hope of reducing toxicity, improving tissue distribution, facilitating easy administration, and ultimately improving treatment outcomes. Barriers to oral absorption, such as P-gp mediated efflux, may impact the delivery of AmB to target sites. If AmB is a substrate for P-gp mediated efflux, then it is expected that less drug will enter the systemic circulation. In addition, this could result in drug-drug interactions affecting the distribution of other drugs like protease inhibitors. Previous experiments did not provide sufficient evidence to conclude whether or not AmB is a substrate of P-gp mediated efflux. The experiments conducted as part of this thesis sought to determine the contribution of P-gp to the epithelial transport of AmB. In order to achieve this goal, preliminary models and experimental conditions were established. Caco-2 cells were transfected with ABCB1-targeting siRNA, for the sequence-specific knockdown of the gene encoding P-gp. A cell-based AmB HPLC-UV assay was developed and validated for this purpose. Subsequent experiments were conducted to determine non-toxic but physiologically relevant AmB concentrations, which in due course were employed for cellular association studies. The final experiment quantified the cellular association of AmB for ABCB1 knockdown Caco-2 cells and compared this to non-transfected Caco-2 cells.  In this ABCB1 transient knockdown Caco-2 cell model, cells formed confluent monolayers with tight junctions and expressed the brush border enzyme sucrase-isomaltase, indicative of cellular differentiation. Expression of MRP2 and BCRP/ABCG2 was unaffected by the siRNA protocol, whilst a reduction in P-gp protein levels and efflux efficiency (63% decrease) was observed for 96  200 nM ABCB1 siRNA transfected cells. AmB cytotoxicity was minimal (< 10%) for transfected and non-transfected Caco-2 cells, at physiologically relevant concentrations. AmB did not stimulate P-gp ATPase activity and a cell-based AmB HPLC assay was used to quantify the cellular association of AmB. At the highest concentration (5 µg/mL), more AmB (28% increase) was associated with 200 nM ABCB1 siRNA transfected Caco-2 cells than non-transfected cells. This increased association was not observed at lower concentrations of AmB. These results suggest that P-gp has minimal contribution to the epithelial transport of AmB in Caco-2 cells. It is unlikely at physiologically relevant concentrations that AmB is a substrate for P-gp mediated efflux. That being said, the data presented above are limited in a number of ways.  5.1 Limitations and Future Directions The data suggest that this ABCB1 transient knockdown Caco-2 model can be used in conjunction with chemical inhibitors for drug oral bioavailability studies. The knockdown of ABCB1 reduced P-gp expression and function, whilst maintaining the expression of two other efflux transporters. A systematic analysis of transporters was not conducted and so we cannot rule out the involvement of other transporters such as MRP1 on Rh123 transport. Further studies examining transporter levels, using RT-PCR and Western blot analysis, may provide sufficient evidence to verify the specificity of the siRNA protocol and confirm that Rh123 efflux and accumulation results are a consequence of the knockdown only of ABCB1.   Efforts were made to fully characterize this Caco-2 model; however, it is unclear how this model compares with Caco-2 cells grown under traditional conditions. There are two factors that may affect epithelial properties of Caco-2: the RNAi protocol and the accelerated nature of cell 97  growth. Other accelerated Caco-2 models have been established, as there is the need for high throughput screening of NCEs. Researchers found that P-gp expression was lower and differentiation was not as extensive in accelerated models as compare to traditionally grown Caco-2 cells (169,170). Future studies should assess whether differences exist between this accelerated model and Caco-2 cells grown for 21 days. Using transmission electron microscopy, we will be able to examine the morphological characteristics of all treatment groups to either confirm or refute the conclusion that cell differentiation has occurred in transfected Caco-2 cells by day 5 post-transfection. Moreover, a comparison of the apparent permeability coefficient of mannitol for the two Caco-2 models will provide further evidence of tight junction formation. As preliminary experiments were inconclusive, it would be beneficial to repeat cholesterol trafficking studies. These studies would provide some insight into whether the transient knockdown of ABCB1 had an effect on membrane composition.  The ABCB1 transient knockdown Caco-2 model presents a rapid approach for the assessment of drug oral bioavailability. Reductions in culture time will decrease the number of media changes, the likelihood of cell contamination, and overall will be less labour intensive. Furthermore, the established siRNA protocol presents the opportunity for researchers to investigate the contribution of several efflux transporters to drug transport, either in isolation or simultaneously.  Established guidelines for the validation of bioanalytical assays exist. Due to time constraints, the above HPLC-UV method was only partially validated. Further validation is required if this method will be used in the future. First, precision and accuracy were not determined for the LLOQ, as full calibration curves were not run to the time of this validation step. In addition, 98  quality controls were not within the recommended range. For example, the LQC should be three times the LLOQ. For the above method, this would be 20 ng/30 µg protein; however, an amount of 40 ng/30 µg protein was assayed. It would be beneficial to repeat these two validation steps and conduct stability studies, as in the future samples may be analyzed over a number of months. One potential direction for this assay is the quantification of AmB in cell culture media. This will be critical for AmB permeability studies. Initial experiments quantifying AmB in cell culture media were conducted, demonstrating the feasibility of using this assay method for AmB transport studies.  Whilst a range of concentrations was investigated for AmB cytotoxicity studies, only one time point (180-minute incubation) was assessed. Clinically, AmB is administered over a 30 – 40 day period (conventional AmB) or 3 – 5 day period (L-AmB) and so it would be beneficial to evaluate the cytotoxic effect of AmB on transfected and control Caco-2 cells, following a prolonged incubation period. Differences between treatment groups may be observed after longer incubations of 24 and 48 hours.  A significantly greater amount of AmB (28% increase) was associated with 200 nM ABCB1 siRNA Caco-2 cells at the highest AmB concentration. Unfortunately, a positive control for P-gp inhibition was not included in these experiments; thus, we are unable to attribute this effect to ABCB1 transient knockdown. Agreement between knockdown and chemical inhibition data for Rh123 provided strong evidence for reduced P-gp efflux efficiency. These experiments could be repeated with an additional treatment condition, co-incubation of AmB and 100 nM LY3355979. Permeability studies commonly supplement other approaches for determining P-gp interaction. 99  We developed the necessary tools for such experiments to be conducted with AmB. If AmB is a substrate of P-gp mediated efflux, then the transient knockdown of ABCB1 will decrease the flux ratio as was observed with Rh123. Ultimately, permeability studies will provide strong data to elucidate the nature of the interaction between AmB and P-gp.  5.2 Conclusion In conclusion, an ABCB1 Caco-2 model and a cell-based HPLC assay have successfully been developed and are applicable to future studies. Our findings indicate that AmB did not stimulate P-gp ATPase activity of P-gp membranes. Furthermore, minimal cytotoxicity (< 10%) was observed for a short incubation period with AmB, and ABCB1 transient knockdown did not affect AmB’s cytotoxicity profile. This thesis culminates with cellular association data, which suggests that, at therapeutically relevant AmB concentrations and for a short incubation period, AmB is not a substrate for P-gp mediated efflux. This data does not support the hypothesis of this thesis. The original aims of this thesis were achieved and the above findings have highlighted avenues for further research.  5.3 Significance of Findings The findings suggest that binding to P-gp is not a major barrier to AmB epithelial transport in Caco-2 cells. With continued efforts to develop an oral formulation of AmB, it is not expected that its oral bioavailability and disposition will be affected by P-gp levels. However, the experiments presented here have attempted to investigate one potential barrier to AmB’s oral bioavailability. These findings do not negate the possible involvement of drug metabolizing enzymes and, this presents an area for further research. This is of clinical interest, as obstructed 100  oral absorption will limit the therapeutic concentrations at the target site, resulting in suboptimal care. 101  References 1. Dutcher JD. The discovery and development of amphotericin B. Dis Chest. 1968 Oct;54(Suppl 1):296–8.  2. Drutz DJ, Lehrer RI. Development of amphotericin B-resistant Candida tropicalis in a patient with defective leukocyte function. Am J Med Sci. 1978 Jul;276(1):77–92.  3. Dick JD, Rosengard BR, Merz WG, Stuart RK, Hutchins GM, Saral R. Fatal disseminated candidiasis due to amphotericin-B-resistant Candida guilliermondii. Ann Intern Med. 1985 Jan;102(1):67–8.  4. Ellis D. Amphotericin B: spectrum and resistance. J Antimicrob Chemother. 2002 Feb;49 (Suppl 1):7–10.  5. Roden MM, Zaoutis TE, Buchanan WL, Knudsen TA, Sarkisova TA, Schaufele RL, et al. Epidemiology and outcome of zygomycosis: a review of 929 reported cases. Clin Infect Dis. 2005 Sep 1;41(5):634–53.  6. Ashley E, Lewis R, Lewis JS, Martin C, Andes D. Pharmacology of systemic antifungal agents. Clin Infect Dis. 2006;43(Suppl 1):S28–S39.  7. Smith JA, Kauffman CA. Pulmonary fungal infections. Respirology. 2012 Aug;17(6):913–26.  8. Azie N, Neofytos D, Pfaller M, Meier-Kriesche H-U, Quan S-P, Horn D. The PATH (Prospective Antifungal Therapy) Alliance® registry and invasive fungal infections: update 2012. Diagn Microbiol Infect Dis. 2012 Aug;73(4):293–300.  9. Ariano RE, Mitchelmore BR, Lagacé-Wiens PR, Zelenitsky SA. Successful treatment of pulmonary blastomycosis with continuously infused amphotericin B deoxycholate after failure with liposomal amphotericin B. Ann Pharmacother. 2013 Jun;47(6):e26.  10. Palacios DS, Dailey I, Siebert DM, Wilcock BC, Burke MD. Synthesis-enabled functional group deletions reveal key underpinnings of amphotericin B ion channel and antifungal activities. Proc Natl Acad Sci USA. 2011 Apr 26;108(17):6733–8.  11. Brown GD, Denning DW, Gow NAR, Levitz SM, Netea MG, White TC. Hidden killers: human fungal infections. Sci Transl Med. 2012 Dec 19;4(165):165rv13.  12. O'Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R. Fungal community analysis by large-scale sequencing of environmental samples. Appl Environ Microbiol. 2005 Sep;71(9):5544–50.  13. Blackwell M. The fungi: 1, 2, 3 ... 5.1 million species? Am J Bot. 2011 Mar;98(3):426–38.  102  14. Pfaller MA, Pappas PG, Wingard JR. Invasive fungal pathogens: current epidemiological trends. Clin Infect Dis. 2006;43(Suppl 1):S3–S14.  15. Maschmeyer G. The changing epidemiology of invasive fungal infections: new threats. Int J Antimicrob Agents. 2006 Jun;27(Suppl 1):3–6.  16. Pound MW, Townsend ML, Dimondi V, Wilson D, Drew RH. Overview of treatment options for invasive fungal infections. Med Mycol. 2011 Aug;49(6):561–80.  17. Tuite NL, Lacey K. Overview of invasive fungal infections. Methods Mol Biol. 2013;968:1–23.  18. Perfect JR. Fungal diagnosis: how do we do it and can we do better? Curr Med Res Opin. 2013 Apr;29(Suppl 4):3–11.  19. Eggimann P, Garbino J, Pittet D. Epidemiology of Candida species infections in critically ill non-immunosuppressed patients. Lancet Infect Dis. 2003 Nov;3(11):685–702.  20. Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis. 2004 Aug 1;39(3):309–17.  21. Walsh TJ, Groll A, Hiemenz J, Fleming R. Infections due to emerging and uncommon medically important fungal pathogens. Clin Microbiol Infect. 2004;10(Suppl 1):48–66.  22. Bartlett KH, Kidd SE, Kronstad JW. The emergence of Cryptococcus gattii in British Columbia and the Pacific Northwest. Curr Infect Dis Rep. 2008 Mar;10(1):58–65.  23. Galanis E, Macdougall L. Epidemiology of Cryptococcus gattii, British Columbia, Canada, 1999-2007. Emerging Infect Dis. 2010 Feb;16(2):251–7.  24. Byrnes EJ, Marr KA. The Outbreak of Cryptococcus gattii in Western North America: Epidemiology and Clinical Issues. Curr Infect Dis Rep. 2011 Jun;13(3):256–61.  25. Kronstad JW, Attarian R, Cadieux B, Choi J, D'Souza CA, Griffiths EJ, et al. Expanding fungal pathogenesis: Cryptococcus breaks out of the opportunistic box. Nat Rev Micro. 2011 Mar;9(3):193–203.  26. Herwaldt B. Leishmaniasis. The Lancet. 1999;354:1191–9.  27. Malaviya P, Picado A, Singh SP, Hasker E, Singh RP, Boelaert M, et al. Visceral leishmaniasis in Muzaffarpur district, Bihar, India from 1990 to 2008. PLoS ONE. 2011;6(3):e14751.  28. Guerin PJ, Olliaro P, Sundar S, Boelaert M, Croft SL, Desjeux P, et al. Visceral leishmaniasis: current status of control, diagnosis, and treatment, and a proposed 103  research and development agenda. Lancet Infect Dis. 2002 Aug;2(8):494–501.  29. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Micro. 2007 Nov;5(11):873–82.  30. Desjeux P. Leishmaniasis: current situation and new perspectives. Comp Immunol Microbiol Infect Dis. 2004 Sep;27(5):305–18.  31. Croft SL, Davidson RN, Thornton EA. Liposomal amphotericin B in the treatment of visceral leishmaniasis. J Antimicrob Chemother. 1991;28(Suppl B):111–8.  32. Sundar S, Chakravarty J, Agarwal D, Rai M, Murray HW. Single-dose liposomal amphotericin B for visceral leishmaniasis in India. N Engl J Med. 2010 Feb 11;362(6):504–12.  33. Bolard J. How do the polyene macrolide antibiotics affect the cellular membrane properties? Biochim Biophys Acta. 1986 Dec 22;864(3-4):257–304.  34. Brajtburg J, Powderly WG, Kobayashi GS, Medoff G. Amphotericin B: current understanding of mechanisms of action. Antimicrob Agents Chemother. 1990 Feb;34(2):183–8.  35. Hamilton-Miller JM. Chemistry and biology of the polyene macrolide antibiotics. Bacteriol Rev. 1973 Sep;37(3):407–196.  36. Brajtburg J, Elberg S, Schwartz DR, Vertut-Croquin A, Schlessinger D, Kobayashi GS, et al. Involvement of oxidative damage in erythrocyte lysis induced by amphotericin B. Antimicrob Agents Chemother. 1985;27(2):172–6.  37. Sokol-Anderson ML, Brajtburg J, Medoff G. Amphotericin B-induced oxidative damage and killing of Candida albicans. J Infect Dis. 1986 Jul;154(1):76–83.  38. Warnock DW. Amphotericin B: an introduction. J Antimicrob Chemother. 1991 Oct;28(Suppl B):27–38.  39. Sangalli-Leite F, Scorzoni L, Mesa-Arango AC, Casas C, Herrero E, Gianinni MJSM, et al. Amphotericin B mediates killing in Cryptococcus neoformans through the induction of a strong oxidative burst. Microbes Infect. 2011 May;13(5):457–67.  40. Baginski M, Czub J. Amphotericin B and its new derivatives - mode of action. Curr Drug Metab. 2009 Jun;10(5):459–69.  41. Lemke A, Kiderlen AF, Kayser O. Amphotericin B. Appl Microbiol Biotechnol. 2005 Aug;68(2):151–62.  42. Gallis HA, Drew RH, Pickard WW. Amphotericin B: 30 years of clinical experience. 104  Rev Infect Dis. 1990 Mar;12(2):308–29.  43. Chapman SW, Cleary JD, Rogers PD. Essentials of Clinical Mycology. Essentials of Clinical Mycology; 2011. 15 p.  44. Collette N, van der Auwera P, Lopez AP, Heymans C, Meunier F. Tissue concentrations and bioactivity of amphotericin B in cancer patients treated with amphotericin B-deoxycholate. Antimicrob Agents Chemother. 1989 Mar;33(3):362–8.  45. Brajtburg J, Elberg S, Bolard J, Kobayashi GS, Levy RA, Ostlund RE, et al. Interaction of plasma proteins and lipoproteins with amphotericin B. J Infect Dis. 1984 Jun;149(6):986–97.  46. Ashbee HR, Gilleece MH. Has the era of individualised medicine arrived for antifungals? A review of antifungal pharmacogenomics. Bone Marrow Transplant. 2012 Jul;47(7):881–94.  47. Meletiadis J, Chanock S, Walsh TJ. Defining targets for investigating the pharmacogenomics of adverse drug reactions to antifungal agents. Pharmacogenomics. 2008 May;9(5):561–84.  48. Herbrecht R, Natarajan-Amé S, Nivoix Y, Letscher-Bru V. The lipid formulations of amphotericin B. Expert Opin Pharmacother. 2003 Aug;4(8):1277–87.  49. Antoniadou A, Dupont B. Lipid formulations of amphotericin B: where are we today? J Mycol Med. 2005;15(4):230–8.  50. Lopez-Berestein G, Mehta R, Hopfer RL, Mills K, Kasi L, Mehta K, et al. Treatment and prophylaxis of disseminated infection due to Candida albicans in mice with liposome-encapsulated amphotericin B. J Infect Dis. 1983 May;147(5):939–45.  51. Lopez-Berestein G, Hopfer RL, Mehta R, Mehta K, Hersh EM, Juliano RL. Liposome-encapsulated amphotericin B for treatment of disseminated candidiasis in neutropenic mice. J Infect Dis. 1984 Aug;150(2):278–83.  52. Lopez-Berestein G. Liposomal amphotericin B in the treatment of fungal infections. Ann Intern Med. 1986 Jul;105(1):130–1.  53. Lopez-Berestein G, Bodey GP, Fainstein V, Keating M, Frankel LS, Zeluff B, et al. Treatment of systemic fungal infections with liposomal amphotericin B. Arch Intern Med. 1989 Nov;149(11):2533–6.  54. Walsh TJ, Finberg RW, Arndt C, Hiemenz J, Schwartz C, Bodensteiner D, et al. Liposomal amphotericin B for empirical therapy in patients with persistent fever and neutropenia. National Institute of Allergy and Infectious Diseases Mycoses Study Group. N Engl J Med. 1999 Mar 11;340(10):764–71.  105  55. Walsh TJ, Goodman JL, Pappas P, Bekersky I, Buell DN, Roden M, et al. Safety, tolerance, and pharmacokinetics of high-dose liposomal amphotericin B (AmBisome) in patients infected with Aspergillus species and other filamentous fungi: maximum tolerated dose study. Antimicrob Agents Chemother. 2001 Dec;45(12):3487–96.  56. Hann IM, Prentice HG. Lipid-based amphotericin B: a review of the last 10 years of use. Int J Antimicrob Agents. 2001;17(3):161–9.  57. Barrett JP, Vardulaki KA, Conlon C, Cooke J, Daza-Ramirez P, Evans EGV, et al. A systematic review of the antifungal effectiveness and tolerability of amphotericin B formulations. Clin Ther. 2003 May;25(5):1295–320.  58. Santangelo R, Paderu P, Delmas G, Chen ZW, Mannino R, Zarif L, et al. Efficacy of oral cochleate-amphotericin B in a mouse model of systemic candidiasis. Antimicrob Agents Chemother. 2000 Sep;44(9):2356–60.  59. Kayser O, Olbrich C, Yardley V, Kiderlen AF, Croft SL. Formulation of amphotericin B as nanosuspension for oral administration. Int J Pharm. 2003 Mar 18;254(1):73–5.  60. Prajapati VK, Awasthi K, Yadav TP, Rai M, Srivastava ON, Sundar S. An oral formulation of amphotericin B attached to functionalized carbon nanotubes is an effective treatment for experimental visceral leishmaniasis. J Infect Dis. 2012 Jan 15;205(2):333–6.  61. Italia JL, Yahya MM, Singh D, Ravi Kumar MNV. Biodegradable nanoparticles improve oral bioavailability of amphotericin B and show reduced nephrotoxicity compared to intravenous Fungizone. Pharm Res. 2009 Jun;26(6):1324–31.  62. Jain S, Valvi PU, Swarnakar NK, Thanki K. Gelatin coated hybrid lipid nanoparticles for oral delivery of amphotericin B. Mol Pharm. 2012 Sep 4;9(9):2542–53.  63. Wasan EK, Bartlett K, Gershkovich P, Sivak O, Banno B, Wong Z, et al. Development and characterization of oral lipid-based amphotericin B formulations with enhanced drug solubility, stability and antifungal activity in rats infected with Aspergillus fumigatus or Candida albicans. Int J Pharm. 2009 May 8;372(1-2):76–84.  64. Wasan EK, Gershkovich P, Zhao J, Zhu X, Werbovetz K, Tidwell RR, et al. A novel tropically stable oral amphotericin B formulation (iCo-010) exhibits efficacy against visceral Leishmaniasis in a murine model. PLoS Negl Trop Dis. 2010;4(12):e913.  65. Gershkovich P, Sivak O, Wasan EK, Magil AB, Owen D, Clement JG, et al. Biodistribution and tissue toxicity of amphotericin B in mice following multiple dose administration of a novel oral lipid-based formulation (iCo-009). J Antimicrob Chemother. 2010 Dec;65(12):2610–3.  66. Sivak O, Gershkovich P, Lin M, Wasan EK, Zhao J, Owen D, et al. Tropically stable novel oral lipid formulation of amphotericin B (iCo-010): biodistribution and toxicity in 106  a mouse model. Lipids in Health and Disease. 2011;10:135.  67. Ibrahim F, Gershkovich P, Sivak O, Wasan EK, Bartlett K, Wasan KM. Efficacy and toxicity of a tropically stable lipid-based formulation of amphotericin B (iCo-010) in a rat model of invasive candidiasis. International Journal of Pharmaceutics. 2012 Oct 15;436(1-2):318–23.  68. Leslie EM, Deeley RG, Cole SPC. Multidrug resistance proteins: role of P-glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol Appl Pharmacol. 2005 May 1;204(3):216–37.  69. Dean M, Hamon Y, Chimini G. The human ATP-binding cassette (ABC) transporter superfamily. J Lipid Res. 2001 Jul;42(7):1007–17.  70. Juliano RL, Ling V. A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim Biophys Acta. 1976 Nov 11;455(1):152–62.  71. Higgins CF, Gottesman MM. Is the multidrug transporter a flippase? Trends Biochem Sci. 1992;17(1):18–21.  72. Sharom FJ. The P-glycoprotein efflux pump: how does it transport drugs? J Membrane Biol. 1997 Dec 1;160(3):161–75.  73. Gottesman MM, Pastan I. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu Rev Biochem. 1993;62(1):385–427.  74. Marzolini C, Paus E, Buclin T, Kim RB. Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol Ther. 2004 Jan;75(1):13–33.  75. Zhang Y, Benet LZ. The gut as a barrier to drug absorption: combined role of cytochrome P450 3A and P-glycoprotein. Clin Pharmacokinet. 2001;40(3):159–68.  76. Schinkel AH. The physiological function of drug-transporting P-glycoproteins. Semin Cancer Biol. 1997 Jun;8(3):161–70.  77. Aller SG, Yu J, Ward A, Weng Y, Chittaboina S, Zhuo R, et al. Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding. Science. 2009 Mar 27;323(5922):1718–22.  78. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci USA. 1987 Nov;84(21):7735–8.  79. Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM, Pastan I. Expression of a multidrug-resistance gene in human tumors and tissues. Proc Natl Acad Sci USA. 1987 Jan;84(1):265–9.  107  80. Baas F, Borst P. The tissue dependent expression of hamster P-glycoprotein genes. FEBS Letters. 1988 Mar 14;229(2):329–32.  81. Schinkel AH, Smit JJ, Van Tellingen O, Beijnen JH, Wagenaar E, van Deemter L, et al. Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs. Cell. 1994 May 20;77(4):491–502.  82. Kim RB, Fromm MF, Wandel C, Leake B, Wood AJ, Roden DM, et al. The drug transporter P-glycoprotein limits oral absorption and brain entry of HIV-1 protease inhibitors. J Clin Invest. 1998 Jan 15;101(2):289–94.  83. Choo EF, Leake B, Wandel C, Imamura H, Wood AJ, Wilkinson GR, et al. Pharmacological inhibition of P-glycoprotein transport enhances the distribution of HIV-1 protease inhibitors into brain and testes. Drug Metab Dispos. 2000 Jun;28(6):655–60.  84. Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Discov. 2006 Mar;5(3):219–34.  85. Shepard RL, Cao J, Starling JJ, Dantzig AH. Modulation of P-glycoprotein but not MRP1- or BCRP-mediated drug resistance by LY335979. Int J Cancer. 2003 Jan 1;103(1):121–5.  86. Amidon GL, Lennernäs H, Shah VP, Crison JR. A theoretical basis for a biopharmaceutic drug classification: the correlation of in vitro drug product dissolution and in vivo bioavailability. Pharm Res. 1995;12(3):413–20.  87. Medoff J, Medoff G, Goldstein MN, Schlessinger D, Kobayaski GS. Amphotericin B-induced sensitivity to actinomycin D in drug-resistant Hela cells. Cancer Res. 1975 Sep;35(9):2548–52.  88. Krishan A, Sauerteig A, Gordon K. Effect of amphotericin B on Adriamycin transport in P388 cells. Cancer Res. 1985 Sep;45(9):4097–102.  89. Presant CA, Carr D. Amphotericin B (Fungizone®) enhancement of nitrogen mustard uptake by human tumor cells. Biochem Biophys Res Commun. 1980;93(4):1067–73.  90. Iida N, Takara K, Ohmoto N, Nakamura T, Kimura T, Wada A, et al. Reversal effects of antifungal drugs on multidrug resistance in MDR1-overexpressing HeLa cells. Biol Pharm Bull. 2001 Sep;24(9):1032–6.  91. Sakaeda T, Iwaki K, Kakumoto M, Nishikawa M, Niwa T, Jin J-S, et al. Effect of micafungin on cytochrome P450 3A4 and multidrug resistance protein 1 activities, and its comparison with azole antifungal drugs. J Pharm Pharmacol. 2005 Jun;57(6):759–64.  92. Möllgård L, Hellberg E, Smolowicz A, Paul C, Tidefelt U. Interactions between P-glycoprotein and drugs used in the supportive care of acute myeloid leukemia patients. Leuk Lymphoma. 2001 Jun;42(1-2):177–85.  108  93. Ishizaki J, Ito S, Jin M, Shimada T, Ishigaki T, Harasawa Y, et al. Mechanism of decrease of oral bioavailability of Cyclosporin A during immunotherapy upon coadministration of Amphotericin B. Biopharm Drug Dispos. 2008 May;29(4):195–203.  94. Shao K, Wu J, Chen Z, Huang S, Li J, Ye L, et al. A brain-vectored angiopep-2 based polymeric micelles for the treatment of intracranial fungal infection. Biomaterials. 2012 Oct;33(28):6898–907.  95. Purkait B, Kumar A, Nandi N, Sardar AH, Das S, Kumar S, et al. Mechanism of amphotericin B resistance in clinical isolates of Leishmania donovani. Antimicrob Agents Chemother. 2012 Feb;56(2):1031–41.  96. Barta CA, Sachs-Barrable K, Feng F, Wasan KM. Effects of monoglycerides on P-glycoprotein: modulation of the activity and expression in Caco-2 cell monolayers. Mol Pharm. 2008 Sep;5(5):863–75.  97. Sachs-Barrable K, Lee SD, Wasan EK, Thornton SJ, Wasan KM. Enhancing drug absorption using lipids: a case study presenting the development and pharmacological evaluation of a novel lipid-based oral amphotericin B formulation for the treatment of systemic fungal infections. Adv Drug Deliver Rev. 2008 Mar 17;60(6):692–701.  98. Risovic V, Sachs-Barrable K, Boyd M, Wasan KM. Potential mechanisms by which Peceol increases the gastrointestinal absorption of amphotericin B. Drug Dev Ind Pharm. 2004 Aug;30(7):767–74.  99. Risovic V, Boyd M, Choo E, Wasan KM. Effects of lipid-based oral formulations on plasma and tissue amphotericin B concentrations and renal toxicity in male rats. Antimicrob Agents Chemother. 2003 Oct;47(10):3339–42.  100. Fogh J, Wright WC, Loveless JD. Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J Natl Cancer Inst. 1977 Feb;58(2):209–14.  101. Pinto M, Robine-Leon S, Appy MD, Kedinger M, Triadou N, Dussaulx E, et al. Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biology of the Cell. 1983;47:323–30.  102. Hilgendorf C, Ahlin G, Seithel A, Artursson P, Ungell A-L, Karlsson J. Expression of thirty-six drug transporter genes in human intestine, liver, kidney, and organotypic cell lines. Drug Metab Dispos. 2007 Aug;35(8):1333–40.  103. Volpe DA. Variability in Caco-2 and MDCK cell-based intestinal permeability assays. J Pharm Sci. 2008 Feb;97(2):712–25.  104. Tavelin S, Gråsjö J, Taipalensuu J, Ocklind G, Artursson P. Applications of epithelial cell culture in studies of drug transport. Methods Mol Biol. 2002;188:233–72.  105. Lee SD, Osei-Twum J-A, Wasan KM. Dose-dependent targeted suppression of P-109  glycoprotein expression and function in Caco-2 cells. Mol Pharm. 2013 Jun 3;10(6):2323–30.  106. Buzza MS, Netzel-Arnett S, Shea-Donohue T, Zhao A, Lin C-Y, List K, et al. Membrane-anchored serine protease matriptase regulates epithelial barrier formation and permeability in the intestine. Proc Natl Acad Sci USA. 2010 Mar 2;107(9):4200–5.  107. Dantzig AH, Shepard RL, Cao J, Law KL, Ehlhardt WJ, Baughman TM, et al. Reversal of P-glycoprotein-mediated multidrug resistance by a potent cyclopropyldibenzosuberane modulator, LY335979. Cancer Res. 1996 Sep 15;56(18):4171–9.  108. Balimane PV, Chong S. Cell culture-based models for intestinal permeability: a critique. Drug Discov Today. 2005 Mar 1;10(5):335–43.  109. Rousset M. The human colon carcinoma cell lines HT-29 and Caco-2: two in vitro models for the study of intestinal differentiation. Biochimie. 1986 Sep;68(9):1035–40.  110. Taipalensuu J, Törnblom H, Lindberg G, Einarsson C, Sjöqvist F, Melhus H, et al. Correlation of gene expression of ten drug efflux proteins of the ATP-binding cassette transporter family in normal human jejunum and in human intestinal epithelial Caco-2 cell monolayers. J Pharmacol Exp Ther. 2001 Oct;299(1):164–70.  111. Schinkel AH, Jonker JW. Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: an overview. Adv Drug Deliver Rev. 2003 Jan 21;55(1):3–29.  112. Lee SH, Sinko PJ. siRNA- Getting the message out. Eur J Pharm Sci. 2006 Apr;27(5):401–10.  113. Graber-Maier A, Gutmann H, Drewe J. A new intestinal cell culture model to discriminate the relative contribution of P-gp and BCRP on transport of substrates such as imatinib. Mol Pharm. 2010 Oct 4;7(5):1618–28.  114. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411(6836):494–8.  115. Wu H, Hait WN, Yang J-M. Small interfering RNA-induced suppression of MDR1 (P-glycoprotein) restores sensitivity to multidrug-resistant cancer cells. Cancer Res. 2003 Apr 1;63(7):1515–9.  116. Clayburgh DR, Rosen S, Witkowski ED, Wang F, Blair S, Dudek S, et al. A differentiation-dependent splice variant of myosin light chain kinase, MLCK1, regulates epithelial tight junction permeability. J Biol Chem. 2004 Dec 31;279(53):55506–13.  117. Hilgendorf C, Spahn-Langguth H, Rhedin M, Regårdh C-G, Löwenadler B, Langguth P. Selective downregulation of the MDR1 gene product in Caco-2 cells by stable 110  transfection to prove its relevance in secretory drug transport. Mol Pharm. 2005 Jan;2(1):64–73.  118. Sun H, Chow EC, Liu S, Du Y, Pang KS. The Caco-2 cell monolayer: usefulness and limitations. Expert Opin Drug Metab Toxicol. 2008 Apr;4(4):395–411.  119. Yu H, Cook TJ, Sinko PJ. Evidence for diminished functional expression of intestinal transporters in Caco-2 cell monolayers at high passages. Pharm Res. 1997 Jun;14(6):757–62.  120. Hidalgo IJ, Raub TJ, Borchardt RT. Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology. 1989 Mar;96(3):736–49.  121. Hauri HP, Sterchi EE, Bienz D, Fransen JA, Marxer A. Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells. J Cell Biol. 1985 Sep;101(3):838–51.  122. Van Beers EH, Al RH, Rings EH, Einerhand AW, Dekker J, Büller HA. Lactase and sucrase-isomaltase gene expression during Caco-2 cell differentiation. Biochem J. 1995 Jun 15;308(Pt 3):769–75.  123. Beaulieu JF, Quaroni A. Clonal analysis of sucrase-isomaltase expression in the human colon adenocarcinoma Caco-2 cells. Biochem J. 1991 Dec 15;280(Pt 3):599–608.  124. Costa de Beauregard MA, Pringault E, Robine S, Louvard D. Suppression of villin expression by antisense RNA impairs brush border assembly in polarized epithelial intestinal cells. EMBO J. 1995 Feb 1;14(3):409–21.  125. Muller C, Laurent G, Ling V. P-glycoprotein stability is affected by serum deprivation and high cell density in multidrug-resistant cells. J Cell Physiol. 1995 Jun;163(3):538–44.  126. Alemán C, Annereau JP, Liang XJ, Cardarelli CO, Taylor B. P-glycoprotein, expressed in multidrug resistant cells, is not responsible for alterations in membrane fluidity or membrane potential. Cancer Res. 2003;63(6):3084–91.  127. Zhang Z, Wu J-Y, Hait WN, Yang J-M. Regulation of the stability of P-glycoprotein by ubiquitination. Mol Pharmacol. 2004 Sep;66(3):395–403.  128. Huppi K, Martin SE, Caplen NJ. Defining and assaying RNAi in mammalian cells. Mol Cell. 2005 Jan 7;17(1):1–10.  129. Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, et al. Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol. 2003 Jun;21(6):635–7.  111  130. Lage H. MDR1/P-glycoprotein (ABCB1) as target for RNA interference-mediated reversal of multidrug resistance. Curr Drug Targets. 2006 Jul;7(7):813–21.  131. Watanabe T, Onuki R, Yamashita S, Taira K, Sugiyama Y. Construction of a functional transporter analysis system using MDR1 knockdown Caco-2 cells. Pharm Res. 2005 Aug;22(8):1287–93.  132. Li J, Volpe DA, Wang Y, Zhang W, Bode C, Owen A, et al. Use of transporter knockdown Caco-2 cells to investigate the in vitro efflux of statin drugs. Drug Metab Dispos. 2011 Jul;39(7):1196–202.  133. Dantzig AH, Shepard RL, Law KL, Tabas L, Pratt S, Gillespie JS, et al. Selectivity of the Multidrug Resistance Modulator, LY335979, for P-Glycoprotein and Effect on Cytochrome P-450 Activities. J Pharmacol Exp Ther. 1999 Aug 1;290(2):854–62. 134. Green LJ, Marder P, Slapak CA. Modulation by LY335979 of P-glycoprotein function in multidrug-resistant cell lines and human natural killer cells. Biochem Pharmacol. 2001;61:1393–9.  135. Mease K, Sane R, Podila L, Taub ME. Differential selectivity of efflux transporter inhibitors in Caco-2 and MDCK-MDR1 monolayers: a strategy to assess the interaction of a new chemical entity with P-gp, BCRP, and MRP2. J Pharm Sci. Wiley Subscription Services, Inc., A Wiley Company; 2012 May;101(5):1888–97.  136. Twentyman PR, Rhodes T, Rayner S. A comparison of rhodamine 123 accumulation and efflux in cells with P-glycoprotein-mediated and MRP-associated multidrug resistance phenotypes. Eur J Cancer. 1994;30A(9):1360–9.  137. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, et al. Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science. 1992 Dec 4;258(5088):1650–4.  138. Flens MJ, Zaman GJ, van der Valk P, Izquierdo MA, Schroeijers AB, Scheffer GL, et al. Tissue distribution of the multidrug resistance protein. Am J Pathol. 1996 Apr;148(4):1237–47.  139. Hayeshi R, Hilgendorf C, Artursson P, Augustijns P, Brodin B, Dehertogh P, et al. Comparison of drug transporter gene expression and functionality in Caco-2 cells from 10 different laboratories. Eur J Pharm Sci. 2008 Dec 18;35(5):383–96.  140. Gershkovich P, Wasan EK, Lin M, Sivak O, Leon CG, Clement JG, et al. Pharmacokinetics and biodistribution of amphotericin B in rats following oral administration in a novel lipid-based formulation. J Antimicrob Chemother. 2009 Jul;64(1):101–8.  141. Campanero MA, Espuelas MS, Azanza JR, Irache JM. Rapid determination of intramacrophagic amphotericin B by direct injection HPLC. Chromatographia. 112  2000;52(11/12):827–30.  142. Espada R, Josa JM, Valdespina S, Dea MA, Ballesteros MP, Alunda JM, et al. HPLC assay for determination of amphotericin B in biological samples. Biomed Chromatogr. 2008 Apr;22(4):402–7.  143. Hülsewede JW, Dermoumi H. Comparison of high-performance liquid chromatography and bioassay of amphotericin B in serum. Mycoses. 1994;37:17–21.  144. Mechlinski W, Schaffner CP. Separation of polyene antifungal antibiotics by high-speed liquid chromatography. Journal of Chromatography A. 1974;99:619–33.  145. Nilsson-Ehle I, Yoshikawa TT, Edwards JE, Schotz MC, Guze LB. Quantitation of amphotericin B with use of high-pressure liquid chromatography. J Infect Dis. 1977 Mar;135(3):414–22.  146. Golas CL, Prober CG, MacLeod SM. Measurement of amphotericin B in serum or plasma by high-performance liquid chromatography. J Chromatogr. 1983;278:387–95.  147. Brassinne C, Laduron C, Coune A, Sculier JP, Hollaert C, Collette N, et al. High-performance liquid chromatographic determination of amphotericin B in human serum. J Chromatogr. 1987 Aug 7;419:401–7.  148. Ménez C, Buyse M, Besnard M, Farinotti R, Loiseau PM, Barratt G. Interaction between miltefosine and amphotericin B: consequences for their activities towards intestinal epithelial cells and Leishmania donovani promastigotes in vitro. Antimicrob Agents  Chemother. 2006 Nov;50(11):3793–800.  149. Sharom FJ. The P-glycoprotein multidrug transporter. Essays Biochem. Portland Press Ltd; 2011 Sep 7;50(1):161–78.  150. Sachs-Barrable K, Thamboo A, Lee SD, Wasan KM. Lipid excipients Peceol and Gelucire 44/14 decrease P-glycoprotein mediated efflux of rhodamine 123 partially due to modifying P-glycoprotein protein expression within Caco-2 cells. J Pharm Pharm Sci. 2007;10(3):319–31.  151. Polli JW, Wring SA, Humphreys JE, Huang L, Morgan JB, Webster LO, et al. Rational use of in vitro P-glycoprotein assays in drug discovery. J Pharmacol Exp Ther. 2001 Nov;299(2):620–8.  152. Szakács G, Váradi A, Özvegy-Laczka C, Sarkadi B. The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox). Drug Discov Today. 2008 May;13(9-10):379–93.  153. Grasset E, Pinto M, Dussaulx E, Zweibaum A, Desjeux JF. Epithelial properties of human colonic carcinoma cell line Caco-2: electrical parameters. Am J Physiol. 1984 113  Sep;247(3 Pt 1):C260–7.  154. Collington GK, Booth IW, Knutton S. Rapid modulation of electrolyte transport in Caco-2 cell monolayers by enteropathogenic Escherichia coli (EPEC) infection. Gut. 1998 Feb;42(2):200–7.  155. Vieira-Coelho MA, Soares-da-Silva P. Comparative study on sodium transport and Na+, K+-ATPase activity in Caco-2 and rat jejunal epithelial cells: Effects of dopamine. Life Sciences. 2001;69(17):1969–81.  156. Fogh J. Contamination in tissue culture. 1973.  157. Kuhlmann I. The prophylactic use of antibiotics in cell culture. Cytotechnology. 1995 Jun;19(2):95–105.  158. Fedoroff S, Richardson A. Protocols for neural cell culture. 2001.  159. Langdon SP. Cancer cell culture—Methods and protocols. In Vitro Cell Dev Biol-Animal. Springer-Verlag; 2003;39(10):476–6.  160. Valeriote F, Medoff G, Dieckman J. Potentiation of anticancer agent cytotoxicity against sensitive and resistant AKR leukemia by amphotericin B1. Cancer Res. 1979 Jun;39(6 Pt 1):2041–5.  161. Mbongo N, Loiseau PM, Billion MA, Robert-Gero M. Mechanism of amphotericin B resistance in Leishmania donovani promastigotes. Antimicrob Agents Chemother. 1998 Feb;42(2):352–7.  162. White TC. Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus. Antimicrob Agents Chemother. 1997 Jul;41(7):1482–7.  163. Bizerra FC, Nakamura CV, De Poersch C, Estivalet Svidzinski TI, Borsato Quesada RM, Goldenberg S, et al. Characteristics of biofilm formation by Candida tropicalis and antifungal resistance. FEMS Yeast Res. 2008 May;8(3):442–50.  164. Eddouzi J, Parker JE, Vale-Silva LA, Coste A, Ischer F, Kelly S, et al. Molecular mechanisms of drug resistance in clinical Candida species isolated from Tunisian hospitals. Antimicrob Agents Chemother. 2013 Jul;57(7):3182–93.  165. Garrigues A, Escargueil AE, Orlowski S. The multidrug transporter, P-glycoprotein, actively mediates cholesterol redistribution in the cell membrane. Proc Natl Acad Sci USA. 2002 Aug 6;99(16):10347–52.  166. Bacso Z, Nagy H, Goda K, Bene L, Fenyvesi F, Matkó J, et al. Raft and cytoskeleton associations of an ABC transporter: P-glycoprotein. Cytometry A. 2004 Oct;61(2):105–16.  114  167. Field FJ, Born E, Chen H, Murthy S, Mathur SN. Esterification of plasma membrane cholesterol and triacylglycerol-rich lipoprotein secretion in Caco-2 cells: possible role of p-glycoprotein. J Lipid Res. 1995 Jul;36(7):1533–43.  168. Luker GD, Nilsson KR, Covey DF, Piwnica-Worms D. Multidrug resistance (MDR1) P-glycoprotein enhances esterification of plasma membrane cholesterol. J Biol Chem. 1999 Mar 12;274(11):6979–91.  169. Lentz KA, Hayashi J, Lucisano LJ, Polli JE. Development of a more rapid, reduced serum culture system for Caco-2 monolayers and application to the biopharmaceutics classification system. Int J Pharm. 2000 Apr 25;200(1):41–51.  170. Liang E, Chessic K, Yazdanian M. Evaluation of an accelerated Caco-2 cell permeability model. J Pharm Sci. 2000. Mar;89(3):336-45.  115  Appendices  Appendix A  Figure A.1: Inter-day calibration curve (day 1) for an Amphotericin B cell-based HPLC-UV assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL), 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B in three quality controls. The corresponding inter-day accuracy and precision were then calculated for each quality control, following analysis on three consecutive days. AmB, Amphotericin B; IS, internal standard. 116   Figure A.2: Inter-day calibration curve (day 2) for an Amphotericin B cell-based HPLC-UV assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL), 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B in three quality controls. The corresponding inter-day accuracy and precision were then calculated for each quality control, following analysis on three consecutive days. AmB, Amphotericin B; IS, internal standard.  117   Figure A.3: Inter-day calibration curve (day 3) for an Amphotericin B cell-based HPLC-UV assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL), 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B in three quality controls. The corresponding inter-day accuracy and precision were then calculated for each quality control, following analysis on three consecutive days. AmB, Amphotericin B; IS, internal standard. 118   Figure A.4: Calibration curve for an Amphotericin B cell-based HPLC-UV assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL), 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B associated with 200 nM ABCB1 siRNA Caco-2 cells that had been incubated with 1 µg/mL, 2.5 µg/mL, and 5 µg/mL Amphotericin B for 180 minutes. AmB, Amphotericin B; IS, internal standard. 119   Figure A.5: Calibration curve for an Amphotericin B cell-based HPLC-UV assay. Caco-2 cells (30 µg) were spiked with Amphotericin B concentrations (0 ng/mL to 25,000 ng/mL), 140 µL methanol and 20 µL internal standard were added to samples. Amphotericin B was extracted using a series of centrifugation steps and 90 µL was injected into the HPLC system. Calibration data was fitted using linear regression analysis and used to determine the amount of Amphotericin B associated with NTC cells that had been incubated with 1 µg/mL, 2.5 µg/mL, and 5 µg/mL Amphotericin B for 180 minutes. AmB, Amphotericin B; IS, internal standard; NTC, No Transfection Control. 120   Figure A.6: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 1 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as ng/30µg protein. AU, Absorption Units. 121   Figure A.7: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 2.5 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as ng/30 µg protein. AU, Absorption Units. 122   Figure A.8: Representative chromatogram for 200 nM ABCB1 siRNA transfected Caco-2 cells incubated with 5 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as ng/30 µg protein. AU, Absorption Units.  123   Figure A.9: Representative chromatogram for NTC cells incubated with 1 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as  ng/30 µg protein. AU, Absorption Units; NTC, No Transfection Control.  124   Figure A.10: Representative chromatogram for NTC cells incubated with 2.5 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as ng/30 µg protein. AU, Absorption Units; NTC, No Transfection Control. 125   Figure A.11: Representative chromatogram for NTC cells incubated with 5 µg/mL Amphotericin B for 180 minutes. Cell lysates (30 µg) were prepared in PBS 1X. Following the addition of 140 µL methanol and 20 µL internal standard, samples were vortexed for 30 seconds and Amphotericin B extracted by a series of centrifugation steps. The final injection volume was 90 µL and Amphotericin B eluted at 13 minutes, to the nearest minute. Samples from four independent experiments (n = 4) were analyzed. Amount of Amphotericin B in samples was expressed as  ng/30 µg protein. AU, Absorption Units; NTC, No Transfection Control.  126   Figure A.12: Representative chromatogram for peak separation of Amphotericin B and Naphthalene. Complete media (63 µL) was spiked with 6,250 ng/mL Amphotericin B, for a final amount of 625 ng/30 µg protein. Following the addition of 140 µL methanol and 20 µL internal standard, 90 µL was injected into the system and Amphotericin B eluted at 13 minutes and Naphthalene (internal standard) had a retention time of 6 minutes, to the nearest minute. Chromatograms for complete media samples were similar to those of cell samples, with the exception of the solvent front. AU, Absorption Units.               127  Appendix B  Figure B.1: Protein concentration for transfected and non-transfected Caco-2 cells incubated with Amphotericin B. Caco-2 cells were incubated with increasing concentrations of Amphotericin B, for 180 minutes at 37 °C. Protein concentration was determined in cell lysates using the Bio-Rad DC™ Protein Assay. Within treatment groups, protein concentrations were consistent for all concentrations of Amphotericin B and the control. Data is presented as mean protein concentration (µg/mL) for four independent experiments (n = 4). Error bars represent ± SEM. AmB, Amphotericin B; NC, Negative Control GC matched siRNA; NTC, No Transfection Control.  128   Figure B.2: Detection of P-glycoprotein in 200 nM ABCB1 siRNA transfected and non-transfected Caco-2 cells incubated with Amphotericin B (1 µg/mL and 2.5 µg/mL) for 180 minutes on day 5 post-transfection.  P-glycoprotein protein levels were not detected for 200 nM ABCB1 siRNA transfected cells. P-glycoprotein protein levels in NTC cells were unchanged. NTC, No Transfection Control.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167420/manifest

Comment

Related Items