UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The progesterone receptors in human prostate Yu, Yue 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_spring_yu_yue.pdf [ 7.02MB ]
Metadata
JSON: 24-1.0167408.json
JSON-LD: 24-1.0167408-ld.json
RDF/XML (Pretty): 24-1.0167408-rdf.xml
RDF/JSON: 24-1.0167408-rdf.json
Turtle: 24-1.0167408-turtle.txt
N-Triples: 24-1.0167408-rdf-ntriples.txt
Original Record: 24-1.0167408-source.json
Full Text
24-1.0167408-fulltext.txt
Citation
24-1.0167408.ris

Full Text

  THE PROGESTERONE RECEPTORS IN HUMAN PROSTATE     by    YUE YU        A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Reproductive and Developmental Sciences)        THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2014  © Yue Yu, 2014       ii   Abstract The prostate composes of epithelium and stroma, both of which are kept in balance to maintain normal prostate function. The balance between epithelium and stroma can be disrupted by the abnormal growth of stromal cells which results in prostate diseases such as benign prostatic hyperplasia. The epithelial-stromal interaction plays important roles not only in normal prostate homeostasis maintaining but also in prostate cancer development and progression. In prostate tumor, cancer associated fibroblasts enhance the secretions of cytokines and growth factors to favor cancer cells growth and metastasis. Androgen receptors are reported to regulate the development and maintenance the function of prostate. Progesterone receptor (PR) which belongs to the same steroid hormone receptor family as androgen receptors are little known in prostate. PR was reported to express in prostate, but there is no clear conclusion about the localization and function of PR in human prostate.  The objective of this thesis is to investigate the expression and function of PR in human prostate. Two PR isoforms, PRA and PRB, are detected in subsets of the human prostate stromal cells by applying immunohistochemistry assays. Both PR isoforms express specifically in human prostate stromal fibroblasts and smooth muscle cells. Both PRA and PRB are demonstrated to play an inhibitory role in prostate stromal cell proliferation. PR suppresses the expression of cyclin A, cyclin B and cdc25c to delay cell cycle. PRA and PRB are demonstrated to regulate different transcriptomes by gene microarray assay. Immunohistochemistry assays were applied to human prostate cancer tissue biopsies, and PR levels are detected to decrease in the cancer associated stroma compared to the paired normal stroma. The conditioned media from PR positive stromal cell inhibit PC-3 and C4-2B cell motility through down-regulating the secretion of stromal cell derived factor 1 and interleukin 6. We conclude that PRA and PRB express in prostate stromal      iii    cells and inhibit the stromal cells proliferation. Decreased expression of PR in cancer associated stroma contributes to prostate tumor progression.         iv    Preface Chapter 2 was published “ Yu Y, Liu L, Xie N, Xue H, Fazli L, Buttyan R, Wang Y, Gleave M, Dong X. (2013) Expression and Function of the Progesterone Receptor in Human Prostate Stroma Provide Novel Insights to Cell Proliferation Control”. J Clin Endocrinol Metab. 98(7):2887-96. Chapter 3 was published “ Yu Y, Lee JS, Xie N, Li E, Hurtado-Coll A, Fazli L, Cox M, Plymate S, Gleave M, Dong X. (2014) Prostate Stromal Cells Express the Progesterone Receptor to Control Cancer Cell Motility”. PLoS One 9(3):e92714. These works were accomplished by a research team within Vancouver Prostate Centre (VPC). Dr. Xuesen Dong was the senior author this manuscript and directly led the project. Drs. Ralph Buttyan, Martin Gleave, Yuzhuo Wang and Michael Cox provided critical comments and reviewed the work. Robert Bell, Anne Haegert and Shawn Anderson from the Gene Array Facility within VPC performed the microarray and statistical analyses. Estelle Li, Antonio Hurtado-Coll and Rebecca Wu from Pathology Core of VPC prepared human and mouse tissue slides and conducted immunohistochemistry analyses. Dr. Hui Xu contributes the renal capsule graft mouse model. Mrs. Ning Xie and Dr. Liangliang Liu from Dong’s lab trained me with molecular and cellular techniques. I wrote the manuscript, which was revised by my supervisors.  This thesis was approved by the University of British Columbia Clinical Research Ethics Board (Certificate number: H09-01628) and the Animal Research Ethics (Certificate number: A09-0311).      v   Table of Contents Abstract ........................................................................................................................................... ii Preface ............................................................................................................................................ iv Table of Contents ............................................................................................................................ v List of Figures .............................................................................................................................. viii List of Tables .................................................................................................................................. x List of Abbreviations ..................................................................................................................... xi Acknowledgements ....................................................................................................................... xii Dedication .................................................................................................................................... xiii Chapter 1: Background, hypothesis and objective .......................................................................... 1 1.1 Human prostate gland ....................................................................................................... 1 1.1.1 Human prostate anatomy structure and function ...................................................... 1 1.1.2 Cellular components ................................................................................................. 2 1.2 Prostate diseases ............................................................................................................... 4 1.3 Cell cycling ...................................................................................................................... 6 1.4 Steroid receptor superfamily ............................................................................................ 8 1.5 Progesterone and progesterone receptors ......................................................................... 9 1.5.1 Progesterone receptor isoforms ................................................................................. 9 1.6 Objectives ....................................................................................................................... 10 Chapter 2: Expression and function of the progesterone receptor in human prostate stroma provide novel insights to cell proliferation control ....................................................................... 11 2.1 Introduction .................................................................................................................... 11 2.2 Materials and methods ................................................................................................... 12 2.2.1 Human prostate patient samples ............................................................................. 12 2.2.2 Immunohistochemistry ........................................................................................... 12      vi    2.2.3 Human prostate stromal cells and cell culture ........................................................ 13 2.2.4 Renal capsule grafting ............................................................................................. 14 2.2.5 Lentivirus infection ................................................................................................. 15 2.2.6 Cell proliferation assays .......................................................................................... 16 2.2.7 Real-Time qPCR ..................................................................................................... 16 2.2.8 Western blotting ...................................................................................................... 17 2.2.9 Immunofluorescence microscopy ........................................................................... 18 2.2.10 Flow cytometry ....................................................................................................... 19 2.2.11 Gene microarray ...................................................................................................... 19 2.2.12 Statistics .................................................................................................................. 20 2.3 Results ............................................................................................................................ 21 2.3.1 PR is expressed in subset populations of prostate stromal cells ............................. 21 2.3.2 Both PR isoforms inhibit prostate stromal cell proliferation .................................. 22 2.3.3 PR regulates prostate stromal cell cycling .............................................................. 23 2.3.4 PRA and PRB regulate different gene transcription in prostate stromal cells ........ 24 2.4 Discussion ...................................................................................................................... 26 Chapter 3:  Prostate stromal cells express the progesterone receptor to control cancer cell mobility ......................................................................................................................................... 50 3.1 Introduction .................................................................................................................... 50 3.2 Materials and methods ................................................................................................... 51 3.2.1 Human prostate tissues and immunohistochemistry  .............................................. 51 3.2.2 Prostate stromal cell lines and cell culture .............................................................. 52 3.2.3 Collection of conditioned medium  ......................................................................... 53 3.2.4 Wound healing assay .............................................................................................. 53 3.2.5 Cell invasion assay .................................................................................................. 54      vii    3.2.6 Cell migration assay  ............................................................................................... 55 3.2.7 Cell proliferation assay  .......................................................................................... 55 2.2.13 Real-Time qPCR ..................................................................................................... 56 3.2.8 ELISA assay ........................................................................................................... 57 3.2.9 Chromatin immunoprecipitation ............................................................................. 57 3.2.10 Statistical analysis  .................................................................................................. 59 3.3 Results ............................................................................................................................ 59 3.3.1 PR protein levels are decreased in prostate tumors ................................................ 59 3.3.2 Stromal PR inhibits PCa cell migration and invasion ............................................. 60 3.3.3 PR represses SDF-1 and IL-6 expression in prostate stromal cells ........................ 61 3.4 Discussion ...................................................................................................................... 63 Chapter 4:  Conclusion and future directions ............................................................................... 79 References ..................................................................................................................................... 81        viii    List of Figures Figure 1.1 Human prostate anatomy structures ...............................................................................2 Figure 1.2 Cellular components of the human prostate gland .........................................................4 Figure 1.3 Schematic of the cell cycle .............................................................................................7 Figure 1.4 Steroid receptor superfamily ..........................................................................................8 Figure 2.1 Whole mount human prostate .......................................................................................29 Figure 2.2 PR in human prostate tissue  ........................................................................................30 Figure 2.3 PR and a-SMA co-stain in human prostate tissue biopsy  ............................................31 Figure 2.4 PR inhibits prostate stromal cell proliferation  .............................................................32 Figure 2.5 PR regulate WPMY-1 cell cycle  .................................................................................33 Figure 2.6 PRA and PRB isoforms differentially regulate gene transcription  .............................34 Figure 2.7 PR expression was confirmed by various antibodies and block peptide  .....................35 Figure 2.8 PR positive and negative human samples from various organs  ..................................36 Figure 2.9 PR and a-SMA co-stain in five more human prostate tissue  .......................................37 Figure 2.10 PRB and a-SMA co-stain in human prostate tissue ...................................................38 Figure 2.11 PR express in stroma and BPH-1 recombination renal graft  .....................................39 Figure 2.12 PR expression in rat UGM and BPH1 recombination renal graft  .............................40 Figure 2.13 WPMY-1, CAF and HPS-19I over-express PR cell line  ...........................................41 Figure 2.14 PR regulate CAF cell cycle  .......................................................................................42 Figure 2.15 FACS assays for CAF and HPS-19I cell cycle  .........................................................43 Figure 2.16 ER and AR expression in WPMY-1 cell stable lines  ................................................44 Figure 2.17 Gene expressions of AR and PR overexpression WPMY-1 cells  .............................45  Figure 3.1 Measurements of PR protein levels in human prostate tumor tissues  .........................67 Figure 3.2 PR negatively regulates prostate cancer mobility through paracrine pathway  ............68      ix    Figure 3.3 PR negatively regulates prostate cancer invasion through paracrine pathway  ............69 Figure 3.4 PR suppresses SDF-1 expression ligand-independently in prostate stromal cells  ......70 Figure 3.5 PR suppresses IL-6 expression ligand-independently in prostate stromal cells  ..........71 Figure 3.6 PR represses transcription of SDF-1 and IL-6 genes  ..................................................72 Figure 3.7 PR inhibitory effects to cancer cell mobility are mediated by SDF-1 and IL-6 ...........73 Figure 3.8 PR expressions in WPMY-1 cell line  ..........................................................................74 Figure 3.9 PR negatively regulates prostate cancer cell proliferation  ..........................................75 Figure 3.10 bFGF, KGF, HGF and VEGF mRNA levels in hCAFs  ............................................76        x   List of Tables Table 2.1 Gene microarray studies compare AR and PR regulated genes in WPMY-1 cells  ......48 Table 2.2 Antibodies used in this study .........................................................................................49 Table 3.1 Patient information on tissue biopsied used in immunohistochemistry study  ..............77 Table 3.2 Primers used in this study ..............................................................................................78                    xi    List of Abbreviations AR             androgen receptor BPH           benign prostatic hyperplasia CDC25      cell division cycle 25 CDK          cyclin-dependent kinase CZ             central zone DHT          dihydrotestosterone ECM          extracellular matrix EGF           epidermal growth factor ER             estrogen receptor FBS           fetal bovine serum FGF           fibroblast growth factor GR             glucocorticoid receptor IGF            insulin-like growth factor IHC           immunohistochemistry IL-6           interleukin 6 LBD          ligand-binding domain MR            mineralocorticoid receptor NE             neuroendocrine SDF-1       stromal derived factor-1 TZ             transitional zone P4              progesterone PBS           phosphate-buffered saline PCa            prostate cancer PR             progesterone receptor PSA           prostate-specific antigen PZ              peripheral zone TMA         tissue microarray UGM         urogenital sinus mesenchyme a-SMA       alpha-smooth muscle action hCAFs       human cancer associate fibroblasts      xii    Acknowledgements There are so many faculty, staff and fellow students that I would also like to thank for supporting me. First, I would like to express my appreciation to my supervisor, Dr. Xuesen Dong, for his constant supervision, inspiration and enlightening advice over the past two years.  I would also like to thank him for giving me the opportunity to be involved in such an interesting project.  I would like to thank, Dr. Anthony Perks, Dr. Peter Leung, Dr. Ralph Buttyan and Dr. Caigan Du for being my advisory committee for instructive discussions and constructive criticism, which improved my research and this thesis. I would like to thank all of the members of Dong Lab for their support. Finally, I would like to thank my family for their love and support.       xiii    Dedication                                                                                                                                                                                To my parents            1  Chapter 1: Background, hypothesis and objective 1.1 Human prostate gland 1.1.1 Human prostate anatomy structure and function The male adult prostate is a male gland specific to mammalian genitalia. It surrounds the urethra at the base of the bladder. The size of the prostate continues to grow throughout adulthood, starting at approximately 1-2 grams at birth to about 20 grams after puberty. The human prostate is composed of three lobs classified by histological characters. They are the peripheral zone (PZ), the transitional zone (TZ) and the central zone (CZ) (Fig.1.1). The PZ is about equivalent to the lateral and posterior lob and comprises 70% of prostatic glandular tissue. The CZ comprises 20% to 25% of prostatic glandular tissue (1). The transition zone surrounds the prostate urethra. The benign prostatic hyperplasia (BPH) occurs frequently in TZ, while prostate cancer mainly occurs in PZ (2). The major function of adult prostate is serving as a secretory gland. It is responsible for secreting prostatic fluid that contributes to 50-75% of semen, which is used to carry and nourish sperms and prolong their liability for fertilization (3).         2    Adapted from http://www.websystem2.com/articles/6w_prostate.htm Figure 1.1 Human prostate anatomy structures. The prostate gland is located below the bladder surrounding the urethra and composed of transitional, central and peripheral zones.  1.1.2 Cellular components  The function of the prostate is achieved by its multiple cellular components. The fully developed adult prostate is composed of epithelium surrounded by stroma. The epithelium consists of three different types of cells including luminal epithelial cells, basal cells and neuroendocrine (NE) cells (Fig.1.2). Luminal epithelial cells to secrete prostatic fluid (4). These cells express high levels of the androgen receptor (AR), which plays important roles for luminal epithelial cell differentiation, proliferation and survival (5). One of the AR targeted gene in these cells is the prostate-specific antigen (PSA), which is an important biomarker to monitor prostate cancer growth and progression in patients (6). Underlying the luminal cells, there are AR negative basal cells and NE cells. Basal cells form the basal layer separating the luminal epithelial cells from the stroma. They express biomarkers, cytokeratin 5 and cytokeratin 14 (7). In addition, a small      3  population of NE cells are also believed to support epithelial cell growth and differentiation through secreting neuropeptides such as bombesin and neurotensin (8). Those peptide hormones are felt to be important for prostate cancer to develop resistance to cancer therapy (8).  The stromal compartment is underlies the epithelium layer. The stroma also consists of multiple cell populations including smooth muscle cells, fibroblasts, vascular endothelial cells, nerve cells and inflammatory cells (9). In addition, stromal cells produce extracellular matrix (ECM) to maintain the structure of stroma (10). Beyond producing ECM, fibroblasts also secret several cytokines and growth factors that regulate the functions of epithelial cells in a paracrine fashion (11, 12). As smooth muscle cells surround the prostate luminal compartment, their contraction expels the prostatic fluid to mix with seminal vehicle fluid and spermatozoa. Vascular endothelial cells help supply vascularization for the entire gland. Therefore, the stromal cellular components provide a microenvironment for embedded epithelial cells to function.  Complex interactions between epithelium and stroma are critical for maintaining homeostasis in normal prostate tissues and are involved in the regulation of growth and differentiation (11, 13). In contrast, an inappropriate balance between epithelium and stroma will result in prostatic disease such as BPH and prostate cancer (14).         4   Adapted from Barron D A, and Rowley D R Endocr Relat Cancer 2012;19:R187-R204 Figure 1.2 Cellular components of the human prostate gland. The prostate is comprised of epithelial and stromal cells. The prostate epithelium includes luminal cells, basal cells and neuroendocrine cells. The prostate stroma includes smooth muscle cells, fibroblasts, vascular endothelial cells, nerve cells and inflammatory cells.  1.2 Prostate diseases There are several common prostate diseases including BPH, prostate cancer and prostatitis etc. BPH is a very common disease that affects aging males (15). It is a non-malignant prostate condition presented as both hyperplasia and hypertrophy of epithelial and stromal cells (16). In addition, it is characterized by a large amount of extracellular matrix deposited in the stroma compartment that increases the stiffness of the tissue (17). BPH is not associated with prostate cancer and mostly occurs at the transitional zone. Clinical symptoms of BPH are caused by compression of the urethra that blocks the normal flow of urine. Usually treated medicinally,      5  surgery is usually reserved for men with severe symptoms. Available drugs include alpha-adrenergic receptor blockers (18) and 5-alpha reductase inhibitors (19). Alpha-adrenergic receptor blockers are to relax smooth muscle tension. Inhibitors to 5-alpha reductase inhibit Testosterone converted into Dihydrotestosterone (DHT), and this shrinks the prostate (20). Prostate cancer is the most common diagnosed cancer for males in Canada (21). One of every 7 men is expected to be diagnosed with prostate cancer during their life time. Males aged 60 to 69 will be the most frequently diagnosed with prostate cancer (21). Typically, prostate cancer grows slowly and remains confined to the gland for many years. During this time, the tumor produces little or no symptoms. As the cancer advances, however, it will spread beyond the prostate into the surrounding tissues and also metastasize throughout the body. Bones are the most preferred metastatic site for prostate cancer (22). In the initial stages, prostate cancer development and growth is dependent on androgens and can be suppressed by androgen ablation therapy, which is the primary treatment for patients with metastasis (23). However, hormone-treated tumors eventually develop into castration resistant prostate cancers, at which stage there is no cure for metastatic prostate cancer. The stroma participate prostate cancer development and progression. Prostatic stromal cells initially act to restrain cancer cell growth (24, 25), when cancer cells remain in a relatively well-differentiated status. As the tumor progress, cancer cells activate cancer associated stroma to create a supportive microenvironment for cancer cell survival, proliferation and invasion (24, 26). This activation of cancer associated stroma starts as early as the carcinoma lesion in in situ stage, before cancer cells invade surrounding stroma (26, 27). The mechanisms that switch the phenotype of normal stromal cells into “activated” cancer stromal cells remain unclear. However, it is known that cancer-associated stroma elevates the releases of several important growth      6  factors and cytokines that promote cancer cell proliferation, repress apoptosis, increase cancer cell motility and invasion and guide angiogenesis for tumor metastasis (28).  1.3 Cell cycling Both BPH and prostate cancer involve aberrant prostatic cell proliferation, during which the process cell cycling is accelerated. The cell cycle can be divided into 3 stages: 1) quiescent, 2) interphase and 3) mitosis. The quiescent state, termed as Gap 0 phase (G0), is the resting phase of cell non-dividing. Interphase state includes the Gap 1 (G1), Synthesis (S) and the Gap 2 (G2) phases, all of which are preparative for Mitosis (M) (Fig.1.3) (29). G1 precedes before the S phase. Here, cells increase in size and express proteins and other factors required for DNA synthesis. DNA is replicated during S phase. G2 precedes M phase, whose step is to make sure that everything is ready for cell mitosis. During M, cells divide into daughter cells, move on to S (30).  Cycling is regulated by many molecules, among which there are two key types of proteins controll cell cycle progression, cyclins and cyclin-dependent kinases (CDKs). Through forming cyclin-CDK complexes, cyclins activate CDKs to phosphorylate other molecules (31). This cyclin-CDK complex signals to determine the entry into S.         7   Adapted from http://cyberbridge.mcb.harvard.edu/mitosis_3.html Figure 1.3 Schematic of the cell cycle.  There are several different cyclins which are active in different phases of the cell cycle. The expression of cyclin D rises during G1 and drives the G1/S phase transition. Therefore, inhibition of cyclin D would lead to a G1 phase cell arrest. Cyclin E drives the transition from G1 to S phase, while Cyclin A can regulate 2 cell cycle pionts. Through binding to different CDKs, Cyclin A appears in S phase and regulates the cell cycling into S phase, and another Cyclin A complex regulates the transition from the G2 to the M phase (32). Cyclin B is necessary for the progression of the cell cycling into and out of the M phase of cell cycle from G2 phase (33). In addition to Cyclins, cell division cycle 25 (cdc25) protein members also play key roles in cell cycling. There are three members of cdc25 proteins including cdc25A, cdc25B and cdc25C. Cdc25A is responsible for cell cycle progression through G1 to S. When cdc25B is activated, the cells are allowed to entry into M phase (34). Cdc25C is responsible for regulating G2/M phase which allows cells to entry M (35).      8  1.4 Steroid receptor superfamily The human prostate is a steroid hormone sensitive organ. The function of steroid hormones are mediated by their cognate receptors called steroid hormone receptors (36). Upon ligand binding, the receptors undergo conformational changes, form a dimer and translocate to nuclei (37, 38). The receptors recognize specific DNA elements, called hormone responsive element (HREs), in the target gene promoter regions (39). The recruitment of receptors then modulates downstream gene transcription rates. The steroid receptor superfamily consists of receptors for progestins (PR), estrogens (ER), androgens (AR), glucocorticoids (GR) and mineralocorticoids (MR) (40). These steroid receptors share high homology in their protein sequences (Fig.1.4). Generally, all of these receptors contains amino-terminal domain, a highly conserved DNA binding domain (DBD), a hinge region, and carboxy-terminal ligand binding domain (LBD) (41).     Adapted from Donita Africander, Nicolette Verhoog, Janet P.  Hapgood Steroids Volume 76, Issue 7 2011 636 – 652 Figure 1.4 Steroid receptor superfamily. Major steroid receptors share similar structure.        9  1.5 Progesterone and progesterone receptors Progesterone is an important intermediate for androgen synthesis in male (42). However, other functions of the hormone are almost unknown. In female, the function of progesterone is mediated by the PR (43). The progesterone/PR signaling is essential for the establishment and maintenance of pregnancy (44). In men, progesterone is synthesized by testes and adrenal glands and its concentration in systemic circulation is in the range of 0.64-4.45nmol/L (http://cclnprod.cc.nih.gov/dlm/testguide.nsf). 1.5.1 Progesterone receptor isoforms In human, there are two major isoforms of PR, PRA and PRB. They derive from the same gene, but are transcribed through two different promoters. Their amino acid sequences are exactly the same, except that PRB has additional 164 amino acids at the N-terminus of the protein, termed  activation domain 3 (AF3) (45). Both isoforms have the same DNA binding domain and ligand binding domain. Although they have the same capability to bind progesterone, PRB is usually a stronger transcriptional activator than PRA due to its AF3 domain. However, PRA can antagonize PRB’s activity through forming a heterodimer with PRB or competing PRB in binding DNA sequences in the targeted gene promoters.   In prostate, steroid receptors such as the AR and ER are reported to be expressed in prostate stromal cells and are important for the development and maintenance the function of prostate(46, 47). PR is a steroid receptor family member and shares high homology in amino acid sequences with AR. 83% of the sequences is identical among PR and AR in the DNA binding domain. The PR was reported to be expressed in prostate (48-53). However, the results from these studies are      10    not consistent and there are no conclusive data to demonstrate the localization of PR protein in the prostate. Due to this ambiguity, the function of PR in the prostate remains unclear. 1.6 Objectives The objective of this thesis is to study the expression and function of the PR in the human prostate. Aim 1.  Characterize PR expression in the various cell compartments of human prostate gland and investigate its function:  a. Measure PR expression and localize the proteins by using immunohistochemistry assay in human prostate biopsies; b. Investigate the impacts of PR on prostate stromal cell growth and whether PR isoforms exert differential effect on prostate stromal cell proliferation by generating prostate stromal cell models;  c. Determine the impacts of PR on prostate stromal cell gene expression and demonstrate whether PRA and PRB regulate gene expression differentially by performing gene microarray. Aim 2.  Investigate PR expression level and function in human prostate cancer:  a. Measure PR protein levels in human prostate tumor tissues and determine any association of PR immunoreactivity with prostate cancer progression;  b.  Study PR function in prostate cancer and determine the impacts of stromal PR on prostate cancer cell migration and invasion;  c.  Investigate whether PR affects cytokines secretion and the prostate cancer cell motility.      11    Chapter 2: Expression and function of the progesterone receptor in human prostate stroma provide novel insights to cell proliferation control 2.1 Introduction The prostate gland consists of not only the epithelium but also supporting stroma hosting smooth muscle cells, fibroblasts, endothelial cells and infiltrated inflammatory cells (54, 55). Reciprocal interactions between the epithelium and stroma are critical for maintaining prostate homeostasis and normal prostate function (55). Aberrantly increased proliferation of smooth muscle cells and fibroblasts disrupt this balance, and this is thought to result in abnormal benign prostate growth referred to as benign prostate hyperplasia. Therefore, it is important to understand the homeostatic mechanisms that control the growth of prostate stromal cells if we want to develop better treatments to prevent or suppress benign prostate hyperplasia. The AR and ER are expressed in prostate stromal cells and play important roles for stromal cell proliferation and differentiation (56-58). Belonging to the same steroid receptor family as AR and ER, the PR was also reported to be expressed in the prostate (48-53), but there is little known regarding its role or function in normal or abnormal prostate growth. PR shares extensive homology with the AR protein including 83% identity in the DNA binding domains (59). P4 is synthesized by testes and adrenal glands, and is used as a precursor for androgen biosynthesis in men. Its concentration in systemic circulation is in the range of 0.64-4.45nmol/L (http://cclnprod.cc.nih.gov/dlm/testguide.nsf), high enough to activate prostatic PR. There are several reports attempt to localize PR protein expression to the various cells of the prostate, but these reports are contradictory since some claim that PR is specific to stromal cells whereas the other finds PR protein in all prostatic cell populations. Radio-ligand binding assays have established that  PR is only present in the cytosol of stromal cells (52). Moreover, efforts to      12    describe PR expression and/or function in prostate cells are complicated by the fact that there are two distinct PR isoforms: full length PRB and the N-terminal truncated isoform PRA that lacks the activation domain 3 (AF3) unique to PRB (60). PRA and PRB differentially regulate gene expression (61) and this further confounds efforts to determine PR functions in the prostate gland. Amongst various functions is the PR’s regulatory role in cell proliferation. P4 treatment of breast cancer cells has both stimulatory and inhibitory effects on their  growth (62). These actions are mediated by PR through modulating the expression of cyclinD, cyclin-dependent kinase inhibitors p21Cip1 and p27Kip1 as well as the kinase activities of CDK2 and CDK4 (63-66). Multiple mechanisms are involved that either directly regulate gene promoters or indirectly through signaling via c-src, EGFR and MAPKs (67, 68). Here, we describe our efforts to better characterize PR expression in the various cell compartments of human prostate gland through using immunohistochemistry and to determine the impacts of PRA or PRB on prostate stromal cell growth and gene expression.  2.2 Materials and methods 2.2.1 Human prostate patient samples Radical prostatectomy specimens from 27 patients were obtained from the prostate tissue bank at The Vancouver Prostate Centre, University of British Columbia. All patients have signed an informed consent to a protocol that was reviewed and approved by the UBC Clinical Research Ethics Board (Certificate #: H09-01628).  In addition, 4 prostate tissue samples shown in Fig.2.2A were freshly collected from patients. 2.2.2 Immunohistochemistry Human prostate tissue samples were fixed in 10% neutral buffered formalin overnight,      13    embedded in paraffin as whole mounts, stained with H&E and selected by a pathologist (L.F.) based on the presence of normal prostate, prostatic intraepithelial neoplasia and cancer prostate. The whole mounts were cut in half. And the thin sections were mounted on standard microscope slides. Immunostaining was performed by Ventana Discovery XT autostainer (Ventana). Slides in citrate buffer (pH=6) were heated in a steamer for 30min. After cooling for 30min and washing, the slides were incubated in 3% H2O2 for 10min, blocked with 3% BSA for 30min and then incubated with the PR antibody for 2 hours at room temperature. The slides were washed extensively with phosphate-buffered saline (PBS) and examined with UltraMap kit (Ventana). The sections were counterstained with hematoxylin and mounted with coverslips using the xylene-based mounting medium, Cytoseal (Stephen Scientific, Riverdale, NJ). Normal IgG antibodies (Santa Cruz) were used as negative controls. PR blocking peptide was Flag-PR, and negative control blocking peptide was Flag-PSF purified from 293T cells as we reported. Using identical microscopic and camera settings (RT color-SPOT high-resolution digital camera (Diagnostic Instruments, Inc., Tampa, FL) mounted on an Olympus System light microscope, model BX51), digital images were taken. A multiple tumour tissue microarray was obtained from Dr. David Huntsman (BC Cancer Agency) and used as both positive and negative tissue controls for IHC studies with the PR antibodies.   2.2.3 Human prostate stromal cells and cell culture Human primary stromal cells, PrSC (cat#: CC-2508), were purchased from Lonza (Walkersville, USA) and cultured in SCGM medium (CAT No. CC3205). Human primary prostate stromal cells, HPS-19I, HPS-19B and HPS-33F, were generously provided by Rowley lab (Baylor College of Medicine). They were cultured in in DMEM-HG (CAT No. 11875, Invitrogen, Burlington, Canada) medium containing 5% fetal bovine serum (FBS), 5%      14    Nu-serum (CAT No. 355504, BD Biosciences), 5ug/ml insulin, 0.5ug/ml testosterone. Cancer associated fibroblasts (CAF) and BPH-1 cells were from Hayward lab (Vanderbilt University Medical Center). They were cultured in DMEM-HG medium from Invitrogen with 10% FBS. Human benign prostatic stromal cell line, WPMY-1 (cat#: CRL2854), was from ATCC (Manassas, USA).  HPS and WPMY-1cells were kept in DMEM medium with serum in 10cm culture plate. To passage cells, cell was washed with PBS twice and incubated with 2 ml trypsin that covered the whole dish by rolling plate forward and backward. After the trypsin was removed, the cell plate was kept at 37°C. After 1 minute’s incubation, cell was mixed with 10ml DMEM medium with serum and suspended with pipette. The re-suspend cell then was transferred to a new culture plate and was cultured with fresh DMEM medium. For the passage of CAF cells, cells were washed with PBS twice and added 2 ml trypsin which covered the whole dish. The cell plate was kept at 37°C. After 3 minutes incubation, cells were mixed with 10ml DMEM medium with FBS and suspended with pipette. Cell suspension was transferred into 15ml tube and centrifuged at 1,000g for 3 minutes. After centrifuge, medium was removed to keep the cell pellet.  The cell pellets then were re-suspended in fresh DMEM medium with FBS and were grown in new culture plates.  2.2.4 Renal capsule grafting  In cell recombination grafting experiments, one million of WPMY1, CAF or HPS19I cells were mixed with 0.5 million of BPH-1 cells in collagen gel, followed by grafting into renal capsules of SCID mice as previously reported (69). Rat UGM combined with BPH1 cells (350,000 cells/graft) were also grafted into renal capsules of SCID mice; mice were treated with vehicle or Testosterone plus Estradiol as previously reported (70).      15    2.2.5 Lentivirus infection  Lentiviral constructs encoding Flag-PRA or Flag-PRB genes were constructed by using the FUGWBW vector as the backbone. Invitrogen gateway system was used to package lentivirus. Briefly, 293T cells were seeded in a 10cm plate that could be 80-90% confluence next morning. In the second day, 3μg of each lentiviral vector (pFUGWBW mock vector, Flag-PRA or Flag-PRB) together with 9μg of the ViraPower packaging mix (Invitrogen) were transfected into 293T cells, using Lipofectamine 2000 according the manual instruction. Briefly, lentiviral vector and ViraPower were mixed in 800ul DMEM for 5 minutes at room temperature. Lipofectamine 2000 was mixed gently and thoroughly with 800ul DMEM for 5 minutes at room temperature. These mixtures were combined together and mixed gently for 20 minutes at room temperature. 5.4 ml DMEM medium were added to mixture, mixed and added to 293T cell cultures gently. The plate was incubated at 37°C and 5% CO2. Early in the third day morning, the medium were replaced with 10 mL DMEM with 10% FBS. The stromal cells were seeded in a 24 well plate with about 20-40% confluence. Lentiviral particles were harvested by removing medium 48 hours after transfection and used to infect WPMY-1, CAF and HPS-19I cells. In the fourth day, the medium with virus were collected and centrifuged at 2000rpm for 15 minutes. The supernatant filtered through a 0.45 filter and was used to infect stromal cells including WPMY-1, CAF and HPS-19I cells by incubating cells with 1ml virus medium. In the fifth day, virus medium were replaced with DMEM with 10% FBS for 24 hours transfection. After two days, the cells were passage to 6 well plates. Lentivirus-infected stromal cells were exposed to 10ng/ul blasticidin for 3 weeks to select stably infected cells. The cells were passaged to 10cm plates and then selected for in 96-well plates. Polyclonal and antibiotic resistant cells were pooled and labeled as Mock, PRA or PRB.       16    2.2.6 Cell proliferation assays   The WPMY-1, CAF and HPS-19I cells were maintained in DMEM-HG phenol red free culture medium containing 5% charcoal stripped serum (CSS). After 48 hours, cells were washed twice with warmed PBS, trypsined and seeded in 96-well plates (500 cells/well)  in 100ul DMEM phenol red free medium with 5% CSS. Two wells containing medium without cells in each plate were used as blank controls. Next day, cells were treated with vehicle or 10nM progesterone (P4) for 0-8 or 0-16 days. Each treatment contains 6 replicate wells. The reagent of 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium (Promega, Madison, WI) was added at the indicated days. Cell proliferation rates were measured according to the manufacturer’s protocol. By using repeat pipettes, 20ul reagent was added in each well. The plate was incubated in 37°C for 2 hours in a humidified with 5% CO2, and the absorbance was read at 490um using a microplate reader. 2.2.7 Real-Time qPCR  Total RNA was extracted using Purelink RNA mini kit (Invitrogen) according to the manufacturer’s instructions. Briefly, in the collection step, cells were washed with cold PBS twice. Then PBS was removed thoroughly and 300-600ul Lysis/Binding solution was added to the cell culture plate. The cell lysate was collected with a rubber spatula and pipeted into an autoclaved tube. To lyse and homogenate the cells, tube was vortex vigorously for 20 seconds. miRNA homogenate additive was added to cell and mixed well by vortex and incubated the mixture on ice for 10 minutes. The equal amount of acid-phenol: chloroform was added and then mixed by vortex for 60 seconds. The tube was centrifuged for 5 minutes at 10,000g at room temperature to separate the aqueous and organic phases. Then the upper aqueous phase was carefully removed without disturbing the lower phase and the aqueous phase was      17    transfered to a new tube. One and a quarter volumes of the aqueous phase of 100% ethanol were added. A filter cartridge was placed to the collection tube and the lysate/ethanol mixture were pipeted though the filter. Centrifuging at 10,000g for 15 seconds, the mixture was passed thought a filter and then discarded the filtrate. This centrifugation and discarding step were repeated until all the mixture passed the filter. Seven hundred microliter miRNA wash solution 1was added to the filter, and centrifuged for 15 seconds. The filtrate was discarded the filtrate. Five hundred microliter wash solution 2/3 was applied and eluted through the filter cartridge in the same procedure as did for the previous step condition. This step was repeated with another 500ul aliquot of wash solution 2/3 as the final wash. The filtrate was discarded from the last wash. The filter tube then was spin assemble for 1 minute to remove residual fluid from the filter and then transferred into a fresh collection tube. One hundred microliter of preheated elution solution or nuclease-free water was applied to the center of the filter. Spinning for 30 seconds at full speed, RNA was recovered and collected in the tube. The RNA concentration was measure by a Nanodrop. Two micrograms of total RNA was subjected to a random-primed reverse transcription using M-MLV reverse transcriptase (Invitrogen). Real-time qPCR was conducted in triplicates using Applied Biosystems7900HT with 5ng of cDNA, 1µM of each primer pair and SYBR Green PCR master mix (Roche). The sequences of primers were shown below. Relative mRNA levels were normalized to Glyceraldehyde 3-phosphate dehydrogenase.   2.2.8 Western blotting  Cells were washed with PBS twice in the plate to remove the cell culture medium. Cells were collected with a rubber spatula and pipetted into a tube. Centrifuge the tube and then carefully remove the supernatant with a vacuum. Cell pellet was lysed in lysis buffer (50mM Tris-HCl, pH 7.4; 10mM EDTA; 5mM EGTA; 0.5% NP40; 1% Triton X-100 plus protease inhibitor (Roche)).      18    Protein concentration was measured by Pierce BCA protein assay kit (Thermo) with sonication. Cell lysis was centrifuged at 13,000g for 10 minutes, and then the supernatant was transferred to a new eppendorf tube. Protein samples (40-60ug) were mixed with sample buffer loading dye, boiled and loaded on SDS-PAGE gel. After transferring onto PVDF membranes, proteins were blotted with primary antibody in TBST (50 mM Tris/pH 7.5, 0.15 M NaCl, and 0.05% Tween-20) plus 5% fat free milk, washed and then with the HRP-conjugated IgG for 1 hour. Membranes were then treated with ECL reagent (GE healthcare) and exposed to x-ray film. Vinculin or b-Actin was used as the protein loading control.  2.2.9 Immunofluorescence microscopy Cells were grown on glass coverslips in a 12-well plate in steroid depletion culture medium for 48 hours, before treated with vehicle or P4 for 1hour. After 1 hour treatment, PBS was used to wash the cells and then cells were fixed with cold 3% acetone in methanol for 10 minutes at -20C. After reagent was removed, 1ml PBS per well was used to wash the cells twice for 5min each time at room temperature. The cells were permeabilized in 0.2% Triton in PBS for 10 minutes at room temperature. After Triton was removed, cell was washed with 1ml PBS twice for 5min each. The slides were incubated in a blocking solution, 5% bovine serum albumin in PBS for 1 hour and then incubated with Flag antibody at 4°C for overnight. The second day, primary antibody was discarded and the cell was washed with 1ml PRB 5 times at room temperature. The secondary fluorescent antibody (Alexa Fluor 568 Goat anti-rabbit) was added for 1 hour at room temperature in dark and then washed with 0.1% Triton in PBS three times 5min each. Finally, cells were counterstained and mounted with coverslips using Vectashield mounting medium containing 4′, 6′diaminido-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA, USA). Images were captured using a Zeiss LMS780 Confocal microscope      19    (Carl Zeiss Instruments, Oberkochen, Germany) at ×40 magnifications.  2.2.10 Flow cytometry Cell cycle analysis by using fluorescence-activated cell sorting (FACS) with 40 ug/mL propidium iodide staining was performed following a standard protocol. Briefly, the cells were washed with PBS and trypsin for 1 minute. Then the cells were harvested by centrifuging at 1,500g for 5 minutes with 15ml tube. After removing the supernatant, cell pellets were collected and mixed with 250ul 70% EtOH with gently vortex. The cells were kept on ice 1 hour or at -20C overnight. Following this step, the supernatant was removed after centrifugation at 2,500g for 5 minutes. One hundred of a buffer solution (0.1M citric acid: 0.2M Na2HPO4=1:24) were added to the cell pellets and vertex for 5 minutes, followed by washing with 200ul cold PBS and treating with 200ul PBS with 500ug/ml RNase 30 minutes at 37°C. After removed supernatant, cell pellets were added 1ml PBS containing 10ul of 5mg/ml propidium iodide and incubated at room temperature in darkroom for 30 minutes. The cells then were kept on ice, prior to analysis. The cells were filtered by using a cell strainer (BD Falcon 352340). Approximately at least 10,000 cells with 200ul relative DNA contents were analyzed by FACS CantoII flow cytometer and BD FACS Diva software v5.0.3 (Becton Dickinson, Franklin, NJ, USA). All experiments were carried out in triplicates. 2.2.11 Gene microarray WPMY-1 cells expressing mock, PRA, or PRB were maintained in DMEM medium with 5% charcoal stripped serum for 2 days, before treated with vehicle or 10nM P4 for 24 hours. Total RNA was extracted by using the mirVana RNA Isolation Kit (Ambion) from three independently repeated experiments and each of the RNA samples (total of 18 samples) was      20    hybridized onto the microarray. The quality and quantity of RNA were assessed with an Agilent 2100 Bioanalyzer (Caliper Technologies Corp., CA). Agilent one-color gene expression assay was performed by the Vancouver Prostate Centre Microarray Facility. Total RNA was initially converted into cDNA using a T7 polymerase primed reverse transcriptase reaction to synthesize first and second strands of cDNA. This cDNA then served as a template for cDNA synthesis by T7 RNA polymerase in the presence of cyanine3-labeled CTP (Cy3). cRNA yield and specific activity (pmol dye/ug cRNA) were measured with the NanoDrop1000 to ensure that the yield was >1.65ug and specific activity was .8.0pmol Cy3. Cy3-labeled cRNA (1.65ug) was hybridized to human GE 4x44K v2 gene expression microarray (Agilent) at 65C for 17 hours. Following hybridization, slides were washed and preliminary fluorescence data was extracted from each microarray by the Agilent DNA Microarray Scanner. The resulting data were processed by the Agilent Feature Extraction software. For statistical analyses, comparisons were performed between RNA samples with vehicle vs P4 treatment, mock vs PRA, and mock vs PRB. Unpaired t-test with P value cut-off of 0.05, a fold change cut-off of 2.0, and a Benjamini-Hochberg multiple testing correction were applied. The online microarray analysis tool from DAVID Bioinformatics Resources was used to annotate gene ontology classification on PR regulated genes. 2.2.12 Statistics  Results are expressed as the mean ± standard error of the mean. To determine differences between groups, one-way ANOVA or student t-test was carried out using GraphPad Prism (version 4) with the level of significance set at P<0.05 as *, P<0.01 as ** and P<0.001 as ***.      21    2.3 Results  2.3.1 PR is expressed in subset populations of prostate stromal cells Immunohistochemistry (IHC) with the PR antibody (SP2, AbCam) was performed on human prostate biopsy samples (n=27) from radical prostatectomy specimens containing either benign or well-differentiated prostate cancer tissues. Morphological analyses showed that among all these regions, PR was expressed only in the nuclei of a subset of prostate stromal cells (Fig.2.1). The luminal and basal epithelium as well as inflammatory and endothelial cells in the prostate stroma were PR negative. This observation was consistent in all specimens. This selective IHC signal was blocked by the presence of a PR-derived peptide corresponding to the immunogen used to derive the antibody, but not by a control peptide (Fig.2.7A). Additionally, three other commercially available anti-PR antibodies all showed the same stromal-specific localization of PR (Fig.2.7B).  Finally, the anti-PR SP2 antibody detected different PR levels on a human tissue microarray containing tumors with differing PR protein levels (Fig.2.8). Western blots showed the presence of both PR isoforms in homogenates of various prostate tissue samples (Fig.2.2A). PR expression varied among patient samples, possibly due to different ratios of stroma : epithelium or the amounts of extracellular matrix in each specimen. Since the PR antibody detected both PRA and PRB isoforms, we also performed IHC on whole mount sections (n=27) with the PRB specific antibody (clone C1A2, Cell Signaling). Similar to total PR IHC signals, PRB was also expressed only in the nuclei of a subset of prostate stromal cells (Fig.2.2B). Currently, there is no PRA specific antibody available. Since only a subset of prostate stromal cells were PR positive, we co-stained prostate tissue slides with PR and smooth muscle a-Actin (a-SMA) antibodies to further characterize the phenotype of PR positive stromal cells (Fig.2.3 and Fig.2.9). Alpha-SMA is a protein marker for      22    cells with smooth muscle phenotype. We observed three distinct groups of stromal cells expressing 1) both PR and a-SMA, 2) PR only and 3) a-SMA only. These observations were consistent in both cancer and benign stroma in our specimens, suggesting that PR was expressed in stromal cells with fibroblast and/or smooth muscle phenotypes. Similar observations were also obtained in tissues co-stained with PRB and a-SMA antibodies (Fig.2.10).  2.3.2 Both PR isoforms inhibit prostate stromal cell proliferation To study PR function, we collected primary cultured human prostate stromal cells from various donors including commercially available PrSC cells (Lonza) and laboratory original HPS-19I, HPS-19B and HPS-33F cells (71). Two other immortalized human prostate stromal cells are WPMY-1 (ATCC, Manassas, VA) and CAF (25). PR protein was not detected in any of these cells (Fig.2.4A), though various levels of a-SMA and Vimentin were expressed. However, when WPMY-1, CAF or HPS-19I cells were combined with BPH-1 cells and grafted under the renal capsule of immunodeficient mice, PR protein expression was restored as was demonstrated by IHC (Fig.2.4B and Fig.2.11). Additionally, rat urogenital sinus mesenchyme (UGM)/BPH-1 cell tissue recombinants retrieved from subrenal xenografts of immunodeficient mice also showed that many cells in the stroma of the tissue recombinant were PR positive (Fig.2.12). Based on our ability to observe restoration of PR expression in stromal cells of tissue recombinants, we then attempted to introduce exogenous PR to our PR negative prostate stromal cell lines to identify their effects on cell growth and gene expression.     We chose WPMY-1, CAF and HPS-19I cells to further characterize PR function as they expressed different levels of a-SMA and Vimentin. WPMY-1 has the lowest level of a-SMA, HPS-19I expresses no Vimentin and CAF has relatively high levels of a-SMA and Vimentin. To study the function of each PR isoform amongst these different prostate stromal cells, we      23    exogenously expressed PRA or PRB through transduction using lentiviral expression vectors. Stable transduced WPMY-1 and CAF cells were obtained following antibiotic expression, while HPS-19I cells were transiently transduced with PRA or PRB lentivirus. PR isoform expression post transduction was confirmed by Western blotting (Fig.2.13). Transcriptional activities and cellular localization of each PR isoform in the presence of -/+P4 were also tested in these cells. Cell proliferation assays showed that both PR isoforms inhibited cell proliferation rates in all three types of stromal cells, indicating the general inhibitory impacts of PR to stromal cell growth (Fig.2.4C-E). These PR actions were not affected by P4 treatment.  2.3.3 PR regulates prostate stromal cell cycling Next, we applied Western blotting and real-time qPCR techniques to measure expression levels of cyclins and cell division cycle 25 (cdc25) family members. PRA inhibited cyclinA, cyclinB and cdc25c in both protein and mRNA levels in WPMY-1 cells independent of P4 treatment (Fig.2.5A-F). Similar observations were also noted from CAF cells (Fig.2.14A). PRB inhibited cyclinA and cyclinB in both mRNA and protein levels ligand-independently, but only suppressed cdc25c in the presence of P4. Overexpression of PRA and PRB had no impact on cyclinE, cdc25a and cdc25b protein levels (Fig.2.14B-E). Interestingly, PRA dramatically increased cyclinD expression in these cells, but did not affect cell populations at the G1 phase of the cell cycle, possibly representing a compensative response by stromal cells.     FACS analyses were used to determine the effects of PR expressions on cell cycle progression of these cells. WPMY-1 cells (mock transduced or PRA or PRB expressing) were synchronized at G0/G1 by serum starvation for 48 hours. Cells were then replenished with 5% charcoal stripped serum plus -/+P4 for 0-28 hours. FACS assays measured the cell populations at each cell cycle phase and data were plotted over the time course. Decreased G0/G1 cell population represented      24    the G1-S cell cycling transition, while increased G2/M population represented the S-G2 phase transition (Fig.2.5G). Expression of PRA and PRB expression did not delay of the G1-S phase transition of WPMY-1 cells until 24 hours in the absence of P4. PRB expression delayed the G1-S transition starting at 20 hours after P4 treatment. Consistently, PRA and PRB also delayed the S-G2 phase transition at both the 24 and 28 hour time points (Fig.2.5H). These PR effects were not altered by P4, consistent with repression of cyclinA expression by both isoforms independent of ligand. These same cells were also synchronized at G2/M phase by Nocodazale treatment and then released for an additional 0 to 6 hours. PRA expression delayed M-G1 transition at 1 and 3 hours but by 6 hours, there was no significant difference compared to mock cells. PRB also inhibited the M-G1 phase transition but only at the 1 hour time point. FACS assays also measured G2/M cell populations and were plotted over the time course. Decreased cell population at G2/M phases represented the M-G1 phase transition. PRA expression delayed the M-G1 transition at the 1 and 3 hour time points, and lost its impact at the 6 hour time point (Fig.2.5I). PRB also inhibited the M-G1 phase transition but only at the early 1 hour time point. Those PR impacts were consistent with the effects of PR expression on cyclinB levels in these cells. Treatment with P4 further delayed the M-G1 phase transition at all-time points in PRB expressing cells, supporting PR inhibition of cdc25c expression. Similar PR inhibitory effects on cell cycling were also observed in CAF and HPS-19I cells (Fig.2.15). Together, these results showed that both PR isoforms targeted the S and M phases to inhibit prostate stromal cell cycling.   2.3.4 PRA and PRB regulate different gene transcription in prostate stromal cells Next, we applied gene microarray technology to profile the transcription regulated by each PR isoform in prostate stromal cells. WPMY-1 cells expressing mock, PRA and PRB were treated with -/+P4 for 24 hours. Global gene expression profiles compared PRA or PRB expressing      25    WPMY-1 cells with mock infected WPMY-1 cells using the GeneSpring microarray expression analysis software. P4 treatment did not significantly affect gene expression in mock transduced WPMY-1 cells. Comparing to mock transduced cells, 5456 genes were significantly affected by expression of PRA or PRB in the presence or absence of P4. A Venn diagram (Fig.2.6A) showed that PRA and PRB regulated different transcriptions in the WPMY-1 cells, with less than 10% of the genes commonly regulated by both PR isoforms. Real-time qPCR measured eight representative genes regulated by each PR isoform in the presence of -/+P4 and the outcomes confirmed the results predicted by our microarray studies (Fig.2.6B).  Gene ontology (GO) analysis further characterized the key cellular processes regulated by each PR isoform. Among the 5456 PR-regulated genes, 32 GO annotation terms were enriched in PRA regulated genes (P<0.001) and 93 GO annotation terms were enriched in PRB-regulated genes (P<0.001). All gene ontology terms represented at least 20 genes in each gene group. Top ranked 15 GO annotated gene groups were listed in Fig.2.6C-D. Interestingly, although PRA and PRB regulated different transcriptions, one of the most top ranked gene groups affected by both PR isoforms were involved in regulation of cell proliferation (GO:0042127). Within this gene group, 87 genes were regulated by PRA (P=1.5x10-6) and 160 genes were regulated by PRB (P=1.2x10-8). Top 20 gene information was listed in Fig.2.6F. Other commonly regulated gene groups by both PR isoforms were those involved in regulation of cell death (GO: 0010941), cell adhesion (GO: 0007155), cell motion (GO: 0006928), response to wounding (GO: 0009611) and response to hormone stimulus (GO: 0009725). These affected gene groups suggest that both PR isoforms modulate prostate stroma growth and structural remolding in responses to external stimuli. In addition, we also observed distinct gene signatures that were not shared by the two PR isoforms. Genes involved in vascular development were preferentially regulated by PRA, while      26    genes involved in intracellular signaling and nitrogen compound metabolism were differentially regulated only by PRB.  2.4 Discussion Our IHC studies confirm that both PR isoforms are expressed in a subset of prostate stromal cells. These PR positive stromal cells can be further classified by their phenotypes of either smooth muscle and or fibroblast. AR and ER were shown to be expressed in a subset of prostate stromal cells and play important roles in prostate development and disease processes. We are now trying to determine whether this subset of PR positive prostate stromal cells also expresses AR or ER. However, based upon our evidence that PR expression has functional consequences on prostate stromal cell proliferation and gene expression, we propose that PR likely functions through its effects on the mixed stromal cell compartment of the tissue and/or the cross-talk between these cells and prostate epithelial cells. When exogenous PR was introduced into the cultured prostate stromal cells, PR expressing cells do not proliferate as robustly as cells that do not express PR. Further studies manifested the suppressive effects of PR on stromal cell cycle S-G2 phase transition and the expression of cyclinA, cyclinB and cdc25c in the cells. In contrast, prolonged P4 treatment also decreases breast cancer cell proliferation, but through modulating cyclinD and CDK2 inhibitors, resulting in G1 cell cycle arrest (72). The possible explanation for these different PR signaling could be that prostate stroma is differentiated from the mesoderm, while breast epithelium is developed from endoderm during embryo development. Moreover, PRA inhibited the expression of cyclinA, cyclinB and cdc25c in a ligand-independent manner, while PRB inhibited the levels of these proteins in both ligand-dependent and ligand-independent fashions. Together with gene microarray data, our results suggest that PRA or PRB expression can slow prostate stromal cell      27    cycle progression through different mechanisms. PR suppressive effects on prostate stromal cell proliferation may also explain why none of our cultured prostate stromal cells express PR protein.  Culture conditions may select for the most robustly growing stromal cells that lack PR expression. The evidence that tissue recombinants (under the renal capsule) created from prostate stromal cells admixed with BPH-1 cells showed that the stromal cells re-acquire PR expression. It suggests that the epithelium-stroma interactions may be important for maintaining PR expression in the stromal cells. Collectively, our results support the idea that the presence of functional PR in prostate stromal cells may be involved in homeostatic regulation of adult prostate tissue. If so, it will be especially interesting to determine whether prostate stromal PR expression is diminished or lost in abnormal prostate growth diseases such as BPH.  Exogenous expression of PRA or PRB also has differential effects on the transcriptomes of prostate stromal cells.  Our microarray gene profiling results showed that less than 10% of PR-targeted genes were commonly regulated by both PR isoforms (Fig.2.6A). But it is of further interest that, even though the overwhelming majority of genes changed by PR expression are different between the A and B isoforms, one of the main gene groups commonly regulated by both PR isoform is the one associated with the control of cell proliferation (Fig.2.6C). Differential activities of PRA and PRB were reported in several other cell contexts and knockout mouse models (61, 73). These differences were previously shown to be related to the presence of the two leucine motifs within the C-terminal AF3 domain of PRB that changes its affinity for co-activator binding, resulting in different transcription activities when compared to PRA (74-76).  In uterine mesenchymal cells, P4/PR signaling stimulates leiomyoma cell proliferation under estradiol primed conditions (77). Clinical trials using anti-progestins effectively reduced leiomyoma tumor sizes, suggesting mitotic effects of PR in myometrial cells (78). Using PR      28    knockout mice and tissue recombination technologies, stromal PR was shown to exert inhibitory effects on endometrial epithelium (79). We also observed that ER and PR were co-expressed in stromal cell lines and both receptors were reported to be expressed in prostate stromal tissues (Fig.2.16). It is possible that PR antagonizes ER mitotic effects in prostate stromal cells in a similar way to that in breast cancer cells. PR may also regulate expressions of secreted factors by stromal cells and may impact both stromal and epithelial cell proliferation through a paracrine pathway. To add to the complexity, AR is also expressed in prostate stromal tissue. Although no studies report co-expression of AR and PR in prostate stromal cells, these two steroid receptors share very high homology in their DNA binding domains and presumably regulate common downstream targeted gene transcription. However, enhanced AR signaling in WPMY-1 cells did not affect mRNA levels of genes that were strongly regulated by PR (Fig.2.17A-B), nor did proliferation rates of WPMY-1 cells alter over 4 day DHT treatment (Fig. 2.17C). Furthermore, when comparing gene microarray data between AR and PR regulated genes in the same WPMY-1 cell context, there were only partial overlaps between AR and PRB targeted genes (Fig.Table). These data suggest that AR and PR exert different functions in prostate stroma. To further decipher the complicated steroid receptor signaling, multiple animal knockout models, tissue recombination grafts plus in vitro cell models will be required.                          In summary, we defined the expression of PR in the human prostate and provided new insights into PR functions in controlling prostate stromal cell proliferation. The P4/PR signaling was well known for its wide ranges of other functions including differentiation, anti-inflammatory action and prevention of uterine smooth muscle from contraction during pregnancy (73, 80, 81). Whether those PR functions are also effective in the prostate and have any association with prostate diseases such as BPH and prostate cancer will be the next stage of our investigation.      29      Figure 2.1 Whole mount human prostate. Whole mount sections of human prostate biopsies (n=27) was stained with the PR (SP2) antibody by immunohistochemistry. Four regions within one of the sections were amplified: peripheral zone (benign prostate), peripheral zone (cancer prostate), transitional zone and ejaculatory duct.           30     Figure 2.2 PR in human prostate tissue. (A) Four prostate tissue samples from transition zones were collected to extract whole cell proteins. Protein extracts (100 ug) were separated on a protein gel together with 5ug of protein lysates from T47D cells and Western blotted with PR antibody. Information on these 4 tissue samples is also described. (B) Whole mount sections of human prostate biopsies (n=27) were stained with PRB specific antibody (C1A2). Four regions within the section (ID#: 7219) were amplified: peripheral zone (benign prostate), peripheral zone (cancer prostate), transitional zone and ejaculatory duct.        31      Figure 2.3 PR and a-SMA co-stain in human prostate tissue. A whole mount section of human prostate tissue (ID#:7219) was costained with PR and a-SMA antibodies by immunohistochemistry (A) or by immunofluorescence (B). In immunohistochemistry studies, PR antibody was detected by UltraMap Anti-Rb HRP, while a- SMA antibody was detected by UltraMap Anti-Ms Alk Phos (Ventana Medical Systems). In immunofluorescence studies, PR antibody was detected by Alexa Fluor 568, while a-SMA antibody was detected by Alexa Fluor 488 (Invitrogen).        32     Figure 2.4 PRs inhibit prostate stroma cell perliferation. (A) Whole cell lysates from human prostate stromal cells (60ug) and T47D breast cancer cells (5ug) were separated on a protein gel and Western blotted with antibodies against PR, a-SMA, Vimentin. Vinculin and a-actin levels were used as loading controls. (B) One million WPMY-1 cells were recombined with 0.5 million BPH-1 cells and grafted under renal capsule in SCID mice for 2 or 4 weeks (n=3/time point). Xenograft tissues were fixed and immunostained with PR (SP2) antibody. Note: SP2 antibody only recognizes PR protein from human or rat. (C-D) WPMY-1 and CAF cells were infected with lentivirus to express mock, PRA or PRB. Cells were maintained in phenol red free medium containing 5% charcoal stripped serum for 48 hours and then seeded in 96 well culture plates for proliferation assay over 0-8 days. (E) Human primary cultured HPS-19I cells were transiently infected with lentivirus encoding mock, PRA or PRB. Cells were then seeded in 96 well culture plates in the presence of -/+ P4. Cell proliferation rates were measured over 0-16 days.        33     Figure 2.5 PR regulate WPMY-1 cell cycle. (A-F) Lentivirus infected WPMY-1 cells expressing mock, PRA or PRB were maintained in phenol red free medium containing 5% charcoal stripped serum for 48 hours. Cells were treated with either vehicle or 10nM P4 for 24 hours. Real-time qPCR and Western blotting assays measured mRNA and protein levels of cyclinA, cyclinB and cdc25c. (G-H) Cells were synchronized by serum starvation for 48 hours and then were supplemented with 5% charcoal stripped serum plus -/+10nM P4 for 0-28 hours. Cells were collected at each time point and subjected to FACS assays. G0/G1 and G2/M cell populations were counted and plotted over the time course. (I) Cells were synchronized by 0.1ug/ml Nocodazale for overnight and then released for 0-6 hours. G2/M cell population was counted and plotted over the time course. Note: one-way ANOVA analyses compared among cells expressing mock, PRA and PRB with P<0.05 shown as *. Comparisons between -/+P4 treatments with P<0.05 were shown as #.        34     Figure 2.6 PRA and PRB isoforms differentially regulate gene transcription. (A) Venn diagram showed gene transcription regulated by either PRA or PRB in the presence of -/+ 10nM P4 treatment from gene microarray analyses. Unpaired t-test with P value <0.05, a fold change >2.0, and a Benjamini-Hochberg multiple testing correction were applied. (B) Validation of 8 representative genes regulated by either PRA or PRB in the presence of -/+ 10nM P4 was performed by real-time qPCR. (C) Gene ontology (GO) analysis on the 5654 genes regulated by either PRA or PRB was performed by using the online tool from DAVID Bioinformatics Resources. Both gene numbers and P values of specific gene group were listed. (D) Within the gene group of regulation of cell proliferation, top ranked 15 genes regulated by PRA or PRB in the presence of -/+ 10nM P4 were listed.        35     Figure 2.7 PR expression was confirmed by various antibodies and block peptide. (A) PR antibody (SP2) was pre-incubated with either PR-specific blocking peptide or control peptide before applying onto human prostate tissue slides to perform IHC. (B) Human prostate tissue slides were immunostained with four indicated PR antibodies.        36      Figure 2.8 PR positive and negative human samples from various organs. A tissue microarray containing human tumor samples from multiple organs was immunostained with PR antibody. Representative tissue samples with strong, medium and negative PR staining signal were presented.           37      Figure 2.9 PR and a-SMA co-stain in five more human prostate tissue. Five more human prostate tissue slides was co-stained with PR and a-SMA antibodies, showing consistent results as presented in Fig. 2.2. Patient sample IDs were listed below each image.       38      Figure 2.10 PRB and a-SMA co-stain in human prostate tissue. Whole mount sections of human prostate tissue slide were co-stained with PRB and a-SMA antibodies. Two regions containing benign and cancer prostates were amplified. The presented images match the same region presented in Fig. 2.3.        39      Figure 2.11 PR express in stroma and BPH1 recombination renal graft. One million CAF cells (A) or HPS-19I cells (B) were recombined with 0.5 million BPH-1 cells and grafted under renal capsule in SCID mice for 2 or 4 weeks (n=3/time point). Xenograft tissues were fixed and immunostained with PR (SP2) antibody. Note: SP2 antibody only recognizes PR protein from human or rat.       40     Figure 2.12 PR expression in rat UGM and BPH1 recombination renal graft. Rat UGM were combined with prostate BPH-1 cells and grafted under renal capsule in SCID mice. These mice were treated with vehicle or testosterone plus estradiol as reported (69, 70). Tissue grafts were fixed and immunostained with PR antibody.       41     Figure 2.13 WPMY-1, CAF and HPS-19I over-express PR cell line. (A-B) WPMY-1 and CAF cells were infected with lentivirus to express mock, PRA or PRB. (C)  HPS-19I cells were transiently infected with lentivirus encoding mock, PRA or PRB. Western blotting confirmed PR protein expression in those cells with both PR and Flag tag antibody. (D) PR transcriptional activities were tested by using MMTV-Luc luciferase reporter gene with -/+P4 treatments. Luciferase activities were measured and calibrated with renilla luciferase activities. (E) PRA and PRB cellular localizations in WPMY-1 cells were detected by PR antibody by immunofluorescence staining.        42      Figure 2.14 PR regulate CAF cell cycle. (A) CAF cells were infected by lentivirus to express mock, PRA or PRB. Cells were maintained in phenol red free culture medium containing 5% charcoal stripped serum for 48 hours. Cells were treated with either vehicle or 10nM P4 for 24 hours. Protein levels of CyclinA and CylcinB were measured by Western blotting assays. (B-E) WPMY-1 cells expressing mock, PRA or PRB were maintained in phenol red free culturing medium containing 5% charcoal stripped serum for 48 hours. Cells were treated with vehicle or 10nM P4 for 24 hours. Real-time qPCR and Western blotting assays measured mRNA and protein levels of cyclinD, cyclinE, cdc25a and cdc25b. Note: one-way ANOVA analyses compared among cells expressing mock, PRA and PRB with P<0.05 shown as *. Comparisons between -/+P4 treatments with P<0.05 were shown as #.      43     Figure 2.15 FACS assays for CAF and HPS-19I cell cycle. (A-B) CAF cells and (C-D) HPS-19I cells were synchronized by serum starvation for 48 hours and then supplemented with 5% charcoal stripped serum plus -/+10nM P4 for 0-36 hours. Cells were collected at each time point and subjected to FACS assays. G0/G1 (A and C) and G2/M (B-D) cell populations were counted and plotted over the time course. Note: one-way ANOVA analyses compared among cells expressing mock, PRA and PRB with P<0.05 shown as *, P<0.01 shown as ** and P<0.001 shown as ***.      44      Figure 2.16 ER and AR expression in WPMY-1 cell stable lines. (A) Total RNA was extracted from WPMY-1 and CAF cells. Regular RT-PCR were performed using primers to amplify specifically PR total and PRB mRNA. PCR products were separated on 1.5% Agarose gel together with a DNA ladder.  (B-C) WPMY-1 cells and (D-E) CAF cells were maintained in phenol red free medium containing 5% charcoal stripped serum for 48 hours. Cells were then treated with 10nM estradiol for 24 hours. Total RNA was extracted and real-time qPCR was performed to measure PR total and PRB mRNA levels relative to GAPDH. (F-G) WPMY-1 stable cell lines expressing mock, PRA and PRB were treated with vehicle or 10nM P4 for 24 hours. Protein lysates were extracted and immunoblotted with antibodies against ERa and AR.         45      Figure 2.17 Gene expression of AR and PR overexpression WPMY-1 cells (A) WPMY-1 cells were transfected with either mock or AR expression vector and treated with -/+ 10nM DHT for 24 hours. Total RNA were extracted and used to perform real-time qPCR to measure 8 representative genes regulated by PRs. Data were presented in parallel with data from Fig.6B.  (B) Overexpression of AR at mRNA levels in WPMY-1 cells was confirmed by real-time qPCR. (C) WPMY-1 cells overexpressing mock or AR were seeded in 96 well culture plates in the presence of -/+ 10nM DHT. Cell proliferation rates were measured over 0 and 4 days.         46           47             48       Table 2.1 Gene microarray studies compare AR and PR regulated genes in WPMY-1 cells. Gene microarray studies identified top ranked 54 up-regulated and 82 down-regulated genes by DHT treatment in WPMY (AR) cells that were reported by PLoS One. 2011 Jan 18; 6(1):e16027. Same gene sets were extracted from our microarray data from WPMY (PRA) or WPMY (PRB) cells treated with P4 and were listed in parallel. Gene expressions were deemed unchanged and presented as “-“, if fold change value < 2 or P value > 0.05.       49     Table 2.2 antibodies used in this study     50    Chapter 3:  Prostate stromal cells express the progesterone receptor to control cancer cell mobility 3.1 Introduction Prostate tumors have multiple cell populations. Cancer cells are surrounded by non-epithelial cellular environment consisting of fibroblasts, smooth muscle cells and myofibroblasts. Accumulated evidence shows that reciprocal epithelium-stroma interactions are critical for tumor development, growth and metastasis (82, 83). For example, the benign prostatic epithelial cell line BPH-1 is usually non-tumorigenic in nude mice. However, when combined with carcinoma associated fibroblasts (CAFs) and grafted into renal capsule, BPH-1 cells formed tumors (70). These findings demonstrate that stromal cells play crucial roles in malignant transformation. Through secretion of cytokines and growth factors, CAFs also provide a supportive microenvironment to facilitate tumor growth, invasion and metastasis (26, 27). However, despite these critical roles of stroma in prostate cancer (PCa), the therapeutic strategy of targeting prostate stroma is greatly under appreciated. This reflects our limited knowledge of stroma-epithelium interactions at the cellular and molecular levels.  It is known that cancer-associated stroma enhances secretion of multiple cytokines, which are important components of the tumor microenvironment (84). Stromal cell-derived factor 1(SDF-1) is secreted by stromal fibroblasts and acts by binding to its receptor, CXCR4, on the membrane of epithelial cells to trigger multiple signal pathways (28, 85-87). The SDF-1/CXCR4 axis has been shown to facilitate cancer cell invasion, tumor angiogenesis (88, 89), stimulate cell proliferation (90, 91), and protect cells from chemotherapeutic drug-induced apoptosis (92-94). SDF-1 mRNA levels are increased in cancer tissues when compared with adjacent benign tissues (95), and are highest in metastatic PCa (96). Moreover, CXCR4 expression is also elevated in      51    PCa tissues (96), further amplifying SDF-1 actions. Interleukin 6 (IL-6) is also an important cytokine that can stimulate the Janus Kinases/Signal Transducer and Activator Transcription 3 pathway in cancer cells (97). Both SDF-1 and IL-6 can activate the AR at low levels of androgens in PCa cells and contribute to tumor progression to the castration resistant stage (98-100). IL-6 has been reported to enhance PCa cell proliferation and protect cells from apoptosis in tumor xenografts (101, 102). Elevated serum IL-6 levels are shown as a poor prognosis marker (103, 104).      Prostate stromal cells also express several steroid receptors including the androgen and the estrogen receptors. These receptors have been reported to be important for stromal cells to direct PCa development through modulating expression of cytokines/chemokines (105-107). We recently reported that both progesterone receptor (PR) isoforms, PRA and PRB, were expressed specifically in prostate stroma and negatively regulated stromal cell proliferation (108). In this study, we expanded our efforts to measure PR protein levels in PCa and PR regulation of SDF-1 and IL-6 expression in prostate stromal cells.    3.2 Materials and methods 3.2.1 Human prostate tissues and immunohistochemistry  Twenty seven whole mount sections of human prostate tissue biopsies were obtained from radical prostatectomy. Detailed information on each tissue sample was listed Table 1. All patients signed an informed consent to a protocol that was reviewed and approved by the UBC Clinical Research Ethics Board (Certificate #: H0901628). Immunohistochemistry (IHC) assay was performed by Ventana Discovery XT autostainer (Ventana) with antibodies against PR (AbCam) and PRB (Cell Signaling) as previous report (109). Digital images of tissue slides were      52    scanned by a BLISS scanner system (Bacus Lab Inc). Totally 5 stromal fields (>1000 nuclei) of paired benign and cancerous stroma in the PZ of the prostate plus 5 fields of stroma in the transition zones were chosen by pathologist (L.F.). The pathological scores were achieved by the software Digital Image Hub (Leica biosystem) to calculate the percentage of stained nuclei and the staining intensity. The relative levels of PR and PRB were calculated as the index of HSCORE=Σpi(i+1), where i=the intensity of staining, and pi=the percentage of stained cells. HSCOREs were used to compare PR and PRB levels between normal and cancer stroma and between peripheral zones and transition zones.  3.2.2 Prostate stromal cell lines and cell culture Human prostatic stromal cell line (WPMY-1) and PCa cell lines LNCaP and PC-3 were purchased from American Type Culture Collection (Manassas, VA). LNCaP derived C4-2B cells were purchased from Urocore (Oklahoma City, OK, USA). LNCaP, C4-2B and PC-3 cells express undetectable levels of PR mRNA and protein. Human cancer associated fibroblasts (hCAFs) were kindly provided by Dr. Simon Hayward (Vanderbilt University). They were derived from human primary cultured cancer associated fibroblasts. Human primary prostate stromal cells, HPS-19I, were generously provided by Dr. David Rowley (Baylor College of Medicine). Exogenous PRA and PRB were introduced into WPMY-1, hCAF and HPS-19I by lentivirus as described (109). The passage procedure of WPMY-1, hCAF and HPS-19I is described as in chapter 2.2.3. LNCaP were kept in RPMI medium with 10% FBS in 10cm culture plate. To passage LNCaP cells, cells were washed with PBS twice and incubated with 2ml trypsin that covered the whole dish by rolling forward and backward. After the trypsin was removed, the cells cultures were kept in 37°C. After 3 minutes incubation, cell was mixed with 10ml RPMI medium with 10% FBS and suspended with pipette. The re-suspend cell then was      53    transfer to a 15ml tube and centrifuged at 1,000g for 3 minutes. After supernatant was removed, the cell pellet then was re-suspended in fresh RPMI medium with serum to grow in new culture plate in a desired ratio. PC-3 and C4-2B were kept in RPMI medium with 10% FBS in 10cm culture plate. To passage LNCaP cells, cells were washed with PBS twice and incubated with 2ml trypsin that covered the whole dish by rolling forward and backward. . After the trypsin was removed, the cells cultures were kept in 37°C. After 1 minutes incubation, cell was mixed with 10ml RPMI medium with 10% FBS and suspended with pipette. The re-suspend cell then was transferred to a new culture plate and was cultured with fresh medium with serum. Protein expression levels as well as cellular localization of PRA and PRB were confirmed (Fig.3.8). All experiments using hCAFs were within 8-10 cell passages and HPS-19I cells were within 5-6 passages upon received from providers.  3.2.3 Collection of conditioned medium  Ninety percent confluent hCAFs, WPMY-1 and HPS-19I stromal cells were washed twice with PBS and replenished with serum free DMEM media in the presence of vehicle, P4 or PR antagonist RU486 for 48 hours. Protein concentrations of conditioned media (CM) were measured by Bicinchoninic Acid assay (Thermo Scientific). The same amount of CM from PR positive and negative cells was used to treat PCa cells for cell migration, invasion and proliferation assays.   3.2.4 Wound healing assay  PC3 cells were grown in DMEM mediums containing 5% charcoal stripped serum in 6-well plates till 100% confluence as a monolayer. The 6-well plate was marked with 3 straight lines on the outside of the bottom of the plate as reference point during image acquisition. A 20µl pipette      54    tip was used to scratch vertically and create a wound in the confluent monolayer at the center of dishes. The tip should be perpendicular to the bottom of the well, resulting an equal gap distance in the scratch sites. Detached cells were removed by washing with PBS buffer twice. Cells were replenished with 300ug of CMs from hCAFs or 1400ug of CMs from WMPY1 cells. Cell migrations were subsequently captured via an inverted microscope (Axiovert 200M, Germany) at 0h and 24h time points post wound scratch. Wound healing rates was calculated as (wound width at 0h wound width at 24h) / wound width at 0h. Experiments were performed in triplicate and repeated three times.  3.2.5 Cell invasion assay PCa cell invasion was assessed using BD Matrigel invasion chamber (BD Biosciences) according manufacturer’s protocol. Briefly, the matrigel chamber was rehydrated for 2 hours in in a humidified tissue culture incubator (37°C, 5% CO2) by adding medium to the interior of the inserts and the bottom of wells. After rehydration, the medium were carefully removed with the pipette without disturbing matrigel layer. PC3 or C4-2B ccells were suspended in serumfree DMEM medium. One hundred micrograms of CMs from hCAFs or 500ug CMs from WMPY1 cells were added to the bottom 24-well plate. By using the sterile forceps, the matrigel chambers and control inserts were transferred to the 24-well plate with CM. PC-3 cells (2.5×104/well) or C4-2B cells (5.0×104/well) were seeded in the Transwell filters coated with and without Matrigel immediately. Cell invasion were allowed for 18 hours at 37°C with 5% CO2. Non-invading cells in the upper surface of the membrane were gently wiped off with cotton swabs after 18 hours. Cells invaded to the lower were fixed with 100% methanol for 10 minutes, stained with mounting medium containing 4',6-diamidino-2-phenylindole (DAPI, Vector Laboratories, USA) and photographed under an inverted microscope (Axiovert 200M, Germany). Invaded cell      55    numbers were counted by the Image J software. Cell invasion rate was calculated by the number of cells invading through BD Matrigel / the number of cells migrating through uncoated insert membrane. Experiments were performed in in triplicate and repeated three times.  3.2.6 Cell migration assay  PC-3 cells (2.5×104/well) or C4-2B cells (5.0×104/well) were suspended in serum-free DMEM medium and seeded in the BD control chamber without Matrigel (BD Biosciences). Five hundred micrograms of CM from WPMY-1 cells were added to the bottom chamber. After incubation at 37°C with 5% CO2 for 18 hours, non-migratory cells in the upper chamber were gently removed by cotton swabs. Cells that reached the lower chamber were fixed, stained with mounting medium containing DAPI (Vector Laboratories, USA) and photographed under an inverted microscope (Axiovert 200M, Germany). Cell numbers were counted by the Image J software. Cell migration rate was calibrated to the number of cells incubated with CM from parental WPMY-1 cells as one. Experiments were performed in triplicate and repeated three times.  3.2.7 Cell proliferation assay  Cell proliferation assays were performed as descripted at chapter 2.2.6. Briefly, LNCaP cells were maintained in steroid depletion condition for 48 hours before seeded in 96well plates (3000 cells/well) and treated with either 10ug of CMs from hCAFs or 50ug CMs from WMPY1 cells for 0 and 4 days. The reagent of 3-(4, 5dimethylthiazol2yl)-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)-2-Htetrazolium (Promega, Madison, WI) was added to cell cultures and cell proliferation rates were measured as pervious described.       56    2.2.13 Real-Time qPCR  Total RNA was extracted using Trizaol (Invitrogen) according to the manufacturer’s instructions. Briefly, cell medium were removed by vacuum and cells were washed twice with PBS. 1ml trizol reagent was added for cells in 6cm plate. By pipetting the cell and trizol reagent in the culture dish, cells were lysed directly. After pipetting, cell lysis were transferred to a 1.5 ml effendorf tube, and allowed to homogenize by incubating 5 minutes at room temperature. 0.2ml of chloroform was added and shaked vigorously by hand for 15 seconds. After 3 minutes incubation at room temperature, cell lysis in tube was centrifuged at 13,000g for 15 minutes at 4°C. The upper aqueous phase of the mixture was transfer to a new tube by carefully pipetting the solution out. This chloroform abstraction step was repeated once. 0.5ml of 100% isopropanol was added to the aqueous phase and incubated for 10 minutes at room temperature. With centrifuge at 12,000g for 10 minutes and remove the supernatant, RNA pellet was collected. 1ml 70% ethanol was used to wash the RNA pellet. By centrifuging at 7,500g for 5 minutes, wash ethanol was remove. RNA pellet was allowed to air dry for 5-10 minutes. After complete dry, 20-50ul RNase-free water was applied to re-suspend RNA pellet. The RNA mixture was incubated at 60°C for 10 minutes. The concentrate of the RNA was measured with NanoDrop. Two micrograms of total RNA was subjected to a randomprimed reverse transcription using SuperScritpt 2 reverse transcriptase (Invitrogen). Quantitative realtime PCR was conducted in triplicates using Applied Biosystem 7900HT with 5ng of cDNA, 11M of each primer pair and SYBR Green PCR master mix (Roche). The sequences of primers were shown in Suppl. Table. Relative mRNA levels were normalized to GAPDH. SiRNA targeting PR was purchased from Thermo Fisher (Cat N. J-003433-08-0005).      57    3.2.8 ELISA assay  SDF1 and IL6 concentrations in CMs were measured by commercial ELISA kit following manufacturer’s protocol. Briefly, samples and standards were diluted into +working concentration with the diluent reagent. Diluent reagent was added to each well of microplate. Working standard or sample was added to each well. Then the plate was covered with the adhesive strip immediately and incubated at room temperature for 2 hours on a horizontal shaker with about 500rpm. 2 hours later, adhesive strip was taken off and the plate was aspirated and washed by filling each well with wash buffer. These aspiration and wash procedure were repeated 3 times. To completed remove the wash buffer at each well, the plate was converted and blotted against paper towels 3 times. After the wash step, conjugate reagent was added to each well. The plate was covered with a new adhesive strip immediately and incubated in the same condition as described before. The aspiration and wash step were repeated 4 times in total to remove liquid completely which is essential to good results. The substrate solution was added to each well and incubated for 30 minutes at room temperature on a shelf without light. To stop the reaction, a stop solution was added to each well after 30 minutes. By tapping the plate to gently make the reagent mix thoroughly. The colour of each well changed from blue to yellow. Then the plate was read in a mocroplate reader in 450nm. Both SDF-1 and IL-6 kits were purchased from R&D systems (Cat#: DSA00 and D6050).  3.2.9 Chromatin immunoprecipitation Chromatin immunoprecipitation assays were performed as previously described (110, 111) with following modifications. WPMY-1 cells were grown on 10cm dishes in DMEM media with 10% FBS for 2 days until 70% confluence. 24 hours prior to progesterone treatment, cells medium were replaced to steroid-depleted media (DMEM with 5% CSS). The cell was treated with or      58    without 10 nM P4. 24 hours later after treatment, formaldehyde was added directly to culture medium at a final concentration of 1% and incubated at room temperature for 10 minutes to cross-link histone proteins to DNA. Cells were washed with ice-cold PBS buffer, detached and pelleted by centrifugation for 4 min at 2000rpm. The cell pellet was then subjected to immunoprecipitation by re-suspending in lysis buffer and sonicated to shear DNA length. Samples were then centrifuged at 13,000 rpm for 10 min. The supernatant was decanted and diluted 10-fold in dilution buffer. To pre-clear chromatin solution, 60 μl of salmon sperm DNA/protein A-agarose beads was added to sample and rotated for 1 hour at 4°C. The supernatant was collected. For immunoprecipitation, 2 μg antibodies were added to 1 ml of the purified chromatin sample and incubated overnight at 4°C with rotation. Immunocomplexes were recovered by adding 60 μl of protein A-agarose for 1 h at 4°C with rotation. Beads were washed in the order of low salt, high salt and Licl buffers and TE buffer (pH 8). Immunocomplexes were eluted by adding 250 μl of elution buffer (1% SDS and 0.1m NaHCO3) to beads and subsequently heated for 4 h at 64°C to reverse formaldehyde-induced cross-links. DNA was then extracted by phenol/chloroform. RT-PCR was performed.  Formaldehyde cross-linked chromatin was immunoprecipitated with acetylated Histone 3 antibody (AbCam). Eluted DNA fragments were used as the template to perform real-time PCR on the ABI PRISM 7900 HT system (Applied Biosystems) using the FastStart Universal SYBR Green Master (Roche). Enrichments of immunoprecipitated DNA fragments were determined by the threshold cycle (Ct) value. Data were calculated as a percentage of input. ChIP data were derived from three independent experiments with samples in triplicate. Primers for SDF-1 promoter are 5’: tggctctcccctctaagc and 3’: ggctgacggagagtgaaagt. Primers for GAPDH promoter are 5’: agtgcctaggctccagatca and 3’: ctcttcccacaaatgctggt.      59    3.2.10 Statistical analysis  Data were presented as means + the standard error of the mean that were calculated from three or more different experiments. Statistical significances were calculated by using one-way ANOVA and paired Student’s t-test using GraphPad Prism (version 4) with the level of significance set at P<0.05 as *, P<0.01 as ** and P<0.001 as ***. 3.3 Results 3.3.1 PR protein levels are decreased in prostate tumors  We have collected 27 whole mount sections of human prostate tissue biopsies from patients treated with radical prostatectomy (Table 3.1). The patients are 46 to 88 years in age, with Gleason scores from 6 to 9 and tumor stages ranging from T2A to T3B. Using IHC assays, both total PR and PRB isoforms were detected in the nuclei of a portion of prostate stromal cells (Fig.3.1A-B). However, HSCORE of PR (combined calculation of intensity and percentile of positive nuclei) was 41% lower (P=0.001) in cancer associated stroma when compared with paired normal stroma in prostate peripheral zones (Fig.3.1C). In addition, HSCORE of PRB in cancer associated stroma was about 44% lower than that in normal stroma (P=0.004) (Fig.3.1D). Currently, there is no specific antibody to detect PRA isoform. Given the fact that both total PR and PRB decreased in similar degrees, it was likely that the PRA expression levels followed the same trend as PRB. There were no significant differences in either PR or PRB HSCORE between benign peripheral zones and transition zones (Fig.3.1C-D). There were no statistical differences of total PR or PRB protein levels in association with Gleason score and serum PSA concentrations among these 27 patients. Together, these results indicated that PR levels were decreased in cancer associated stroma.       60    3.3.2 Stromal PR inhibits PCa cell migration and invasion  In order to further characterize PR functions at the cellular level, we have applied several human prostatic stromal cell models including hCAF, WPMY-1 and HPS19-I. These cells express low levels of PR mRNA but undetectable level of PR protein. We introduced exogenous PRA or PRB isoform into these cells by lentiviral approach as reported (108), which allowed us to study the function of each PR isoform. Although WPMY-1 cells are derived from primary cultured stromal cells from BPH tissues, these cells are immortalized by SV40 large-T antigen. They have similar tumorigenic capacity as hCAFs when recombined with BPH-1 cells and grafted under mouse renal capsule (unpublished data).  To determine the impact of PR in stromal cells on PCa cell migration, we performed wound healing assays. CM collected from PR-positive and PR-negative hCAFs and WPMY-1 cells in the presence of vehicle or 10nM P4 were used to incubate with PC-3 cells. Wound healing assays showed that CM from PR positive cells resulted in significantly decreased cell migration (Fig.3.2A-B). P4 treatment to stromal cells had no impact to the migration rate of PC-3 cells. Fig.2A-B showed representative images from one of three independent experiments. We had also performed cell migration assays to further confirm the ligand-independent action of PR in controlling cancer cell migration. PR positive WPMY-1 cells were treated with increasing doses of P4, and their CM were collected and incubated with PC-3 cells in cell migration assays (Fig.3.2C). We observed that P4 had no impact on PC-3 cell migration rate, neither did PR antagonist RU486 (Fig.3.2D). These results were repeatable when we replaced PC-3 cells with the bone metastatic LNCaP-derived C4-2B cells (Fig.3.2E-F).  To determine the impact of PR in stromal cells on PCa cell invasion, we applied Matrigel invasion assays. CM were collected from PR-positive and PR-negative WPMY-1 cells treated      61    with vehicle, 10nM or 100nM of P4 (Fig.3.3A). We observed that CM collected from PR positive WPMY-1 cells resulted in 50-75% of decrease in PC-3 cell invasion. This PR function was not altered by P4 or by RU486 (Fig.3.3A-B). In addition, similar results were also observed when C4-2B cell were used in Matrigel invasion assays (Fig.3.3C-D). Furthermore, we also repeated the experiments with CM collected from two other prostate stromal cells, hCAFs and HPS-19I. We showed that CM from PR positive hCAFs or HPS-19I cells resulted in ~20-30% of decrease in PC-3 cell invasion, which PR function was also independent to P4 (Fig.3.3E-F). Together, these results indicated that PR possessed suppressive function to PCa cell migration and invasion in a ligand-independent manner.   To study the role of stromal PR on PCa cell growth in vitro, we performed cell proliferation assays (Fig.3.9). LNCaP cells express a mutant AR that can be stimulated by P4. Treating LNCaP cells directly with P4 in culture medium resulted in 3 fold induction of cell proliferation. CM collected from PR positive hCAFs in the absence of P4 had statistically significant but very mild inhibitory effects on LNCaP cell growth. Similarly, mild suppressive effects were also observed when using CM collected from PR positive WPMY-1 cells in the presence of P4.     3.3.3 PR represses SDF-1 and IL-6 expression in prostate stromal cells  Since PR protein level is decreased in cancer associated stroma and CM from PR positive stromal cells inhibits PCa cell invasion and migration in vitro, we hypothesize that PR may function to supress secretory factors synthesized by stromal cells and regulate prostate epithelium in a paracrine fashion. In order to test this hypothesis and identify such secretory factors, we have re-visited our published gene microarray data profiling PR regulated genes in prostate stromal cells (108). By stratifying all of the cytokines and growth factors, we identified SDF-1 and IL-6 as the top ranked genes whose mRNA levels were inhibited by PR. To confirm      62    these findings, we performed real-time PCR and showed that PRA inhibited 70%, while PRB inhibited 80% of SDF-1 mRNA level in hCAFs (Fig.3.4A-B). This PR action was ligand independent, as neither P4 nor RU486 had any impact on PR suppression to SDF-1 mRNA levels. Importantly, suppressed SDF-1 mRNA levels by PR resulted in decreased SDF-1 secretion by prostate stromal cells when measured by ELISA (Fig.3.4C). Furthermore, PR inhibitory action on SDF-1 expression was observed not only in hCAFs, but also in WPMY-1 (Fig.3.4D-E) and HPS-19I cells (Fig.3.4F). We also observed similar inhibitory effects of PR to IL-6 mRNA and protein levels in a ligand-independent manner (Fig.3.5). It is important to be noticed that PR does not present a general suppressive effect to all cytokines or growth factors. Several growth factors including bFGF, HGF, VEGF and KGF are either up-regulated or not altered by PR and/or P4 treatment (Fig.3.10). To confirm PR mediated direct inhibition to SDF-1 and IL-6 gene expression, we transiently transfected prostate stromal cells with siRNA against PR (Fig.3.6A-B). Acute PR knockdown dramatically reversed the inhibitory effects of PR to both SDF-1 and IL-6 mRNA levels. In addition, PR exerted its inhibitory effects directly to SDF-1 and IL-6 gene transcription and did not require other protein synthesis, as PR remained suppressive even in the presence of cycloheximide treatment (Fig.3.6C-D). We also performed chromatin immunoprecipitation assay to show that histone acetylation levels at the SDF-1 promoter region were dramatically reduced in PR positive stromal cells. These changes were in contrast to histone acetylation status at the GAPDH promoter (Fig.3.6E). Together, these results support that PR plays a direct role in repressing promoter activities of SDF-1 and IL-6 genes and inhibits their gene transcription.       In order to demonstrate that PR-mediated suppression of SDF-1 and IL-6 expression is the major mechanism that reduces PCa cell invasion and migration capacity, we have transiently knocked      63    down PR expression and observed the migration and invasion rates of PC-3 (Fig.3.7A-C) and C4-2B (Fig.3.7B-D) cells were recovered. In addition, when recombinant SDF-1 or IL-6 peptide were added to CM, we observed that exogenous SDF-1 or IL-6 abolished PR suppressive effects to PC-3 cell invasion (Fig.3.7E). Together these results support that PR-mediated suppression to PCa cell mobility is mainly through inhibiting SDF-1 and IL-6 gene expression.     3.4 Discussion Our studies demonstrate that PR protein levels are decreased in cancer associated stroma and that PR exerts inhibitory impacts to PCa cell mobility through modulating the expression of two important cytokines, SDF-1 and IL-6. These observations suggest that reduced PR expression in cancer associated stroma alters the balanced prostatic microenvironment, which may contribute to PCa cell invasion and metastasis.   The observation that decreased PR expression in cancer associated stroma is similar to what was reported with other steroid receptors such as AR and ER-β (112-114), suggesting a general principle that loss of steroid receptors may be required for prostate stroma to be re-activated and to build a supportive microenvironment for PCa. In favoring this hypothesis, stromal AR was shown to suppress PCa cell proliferation and invasion (115). ER-β agonist enhanced apoptosis of prostate stromal and epithelial cells in aromatase knock-out mice (46). Although PR and AR share high homology in their DNA binding domains, gene microarray studies have showed different gene profiles regulated by these two receptors (108, 116). However, they regulate different transcriptome. One explanation could be that PR exerts its transcriptional activity through protein interactions with other transcriptional factors (117, 118).       64    The mechanism by which PR expression levels are decreased in PCa cells is unknown. Both the intensity of PR staining and the percentile of PR positive nuclei are lower in PCa tissues. Since not all prostate stromal cells express PR, it is unclear whether the PR negative stromal cell population becomes dominant, or whether PR positive cells lose its expression during tumor progression. Our previous work showed that PR positive stromal cells proliferated much slower than PR negative cells (108). However, it could also be possible that cancer cells might exert paracrine impacts to re-activate prostate stromal cells by supressing their PR expression. These possibilities are not exclusive to each other and may co-exist during cancer development.     Our IHC analyses were applied on whole mount sections of prostate biopsies, rather than tissue microarray (TMA), to measure stromal protein markers. The heterogeneity of prostate stroma requires multiple areas per patient slide to be analyzed by pathologist. This is a crucial standard that cannot be satisfied if using TMA. Due to the small sizes of the tissue cores on TMAs, it is technically difficult to capture representative paired benign and cancer associated stroma and perform pathological comparison analyses. Ligand-independent actions of PR on gene transcription were reported in several studies (80, 119). Both liganded and unliganded PR can be located in the cell nucleus, but in different sub-nuclear compartments (120, 121). Posttranslational modifications such as phosphorylation or sumoylation are also attributed to activate PR in the absence of progestin (122). Interestingly, it has been recently reported that AR ligand-independently regulates c-myc expression, which contributes to castration resistant progression of PCa (123). These findings together suggest that there may be a broader range of genes that are regulated by steroid receptors independent to receptor ligands. These targeted genes may therefore represent a group of novel molecular targets to block signaling mediated by steroid receptors in PCa.           65    We identify that SDF-1 and IL-6 are the two important genes, which mediate repressive actions of stromal PR to cancer cells. Decreased PR expression in prostate tumors may result in relatively higher levels of SDF-1 and IL-6 secreted by stromal cells, consistent with the reports that SDF-1 and IL-6 levels are elevated in cancer tissue samples (95, 96). Consistent to the roles of SDF-1 and IL-6 in enhancing tumor cell mobility, we observed that CM from PR positive cells inhibited not only PCa cell migration, but also invasion. In addition, PR has a mild impact on PCa cell growth in vitro. LNCaP cell growth is highly dependent upon androgen/AR signaling. Since CM was collected with androgen depleted and serum free medium, cells proliferate at lower rates under such conditions. It is therefore difficult to observe further suppression by CM from PR positive stromal cells. It is also possible that PR may positively regulate other growth hormones, e.g. FGF or HGF, which may neutralize the effects by SDF-1 and IL-6 in cell proliferation.   Our results suggest that PR directly targets SDF-1 and IL-6 gene promoters and inhibit these gene transcriptions. This conclusion is supported by the observation that PR remains suppressive in the presence of the protein synthesis inhibitor cycloheximide. PR specifically reduces the histone acetylation status of SDF-1, but not GAPDH promoter. Furthermore, PR repressive action can be alleviated by transient PR knockdown. Up to date, there was no report on the existence of consensus progesterone response elements in SDF-1 and IL-6 gene promoters. However, it was reported that AP-1 or Sp-1 transcription factor could upregulate SDF-1 transcription (124). We propose that PR may form a protein complex with AP-1 or Sp-1 to interfere their transcriptional activities. We have reported a similar PR suppressive action on connexin 43 gene transcription (117, 118).           66    PR positive stromal cells grow much slower than PR negative cells (108), creating an obstacle to study stromal PR functions using PCa xenograft of stromal/epithelial cell recombination. These xenografts require 2-3 weeks to form. Changes in xenograft sizes could be due to altered stromal cell populations by PR or due to suppressed cytokines secretion by PR positive cells. In our in vitro cell migration and invasion assays, we treated cells with the same amount of CM rather than co-culture stromal and epithelial cells in order to eliminate the variations of stromal cell numbers. Thus, in vivo studies may require tissue recombination technique using urogenital sinus mesenchyme from wild type and PR knockout mice. It was shown that tissue recombination of uterine epithelium with stroma had demonstrated successfully the suppressive effects of stromal PR on DNA synthesis in epithelium (79). Similar strategy would provide novel insights on the paracrine action of PR in the prostate.       67      Figure 3.1 Measurements of PR protein levels in human prostate tumor tissues. Whole mount sections of human prostate biopsies (n=27) were immunostained with PR antibody (AbCam) or PRB antibody (Cell Signaling). Representative IHC images of PR (A) and PRB (B) from benign peripheral zones, cancer peripheral zones and transitional zones are shown. IHC staining of PR (C) and PRB (D) protein levels in paired benign vs cancer peripheral zones and in paired benign peripheral vs transition zones from 27 whole mount sections of human prostate biopsies were scored by Digital Image Hub (Leica Biosystem). HSCORE indexes were plotted as +SE. One-way ANOVA and paired student’s t-test calculate the level of significance.            68     Figure 3.2 PR negatively regulates prostate cancer mobility through paracrine pathway. Conditioned media (CM) were collected from parental hCAFs, WPMY-1 or their derived cell lines expressing mock, PRA or PRB in the presence of vehicle or 10nM P4. PC-3 cells were seeded in 6 well plates and incubated with CM from hCAFs (A) or from WPMY-1 (B) cells for 24 hours in wound healing assays. Representative images after 24 hour CM treatment were captured by an inverted microscope. WPMY-1 and its derived cell lines expressing mock, PRA or PRB were treated with 0, 10nM and 100nM of P4 for 24 hours (C and E) or with vehicle, 10nM of P4 and/or 10uM of RU486 for 24 hours (D and F). CM were then collected and incubated with PC-3 cells (C-D) and C4-2B (E-F) in cell migration assays as described in material and methods section. One-way ANOVA and paired student’s t-test calculate the statistical significance set at P<0.05 as * and P<0.001 as ***.       69      Figure 3.3 PR negatively regulates prostate cancer invasion through paracrine pathway.WPMY-1 and its derived cell lines expressing mock, PRA or PRB were treated with 0, 10nM and 100nM of P4 for 24 hours (A and C) or with vehicle, 10nM of P4 and/or 10uM of RU486 for 24 hours (B and D). CM were then collected and incubated with PC-3 (A-B) and C4-2B (C-D) cells in cell invasion assays. hCAFs (E), HPS-19I (F) cells and their derived cell lines expressing mock, PRA or PRB were treated with 0, 10nM and 100nM of P4 for 24 hours. CM were then collected and incubated with PC-3 cells in cell invasion assays. Cell invasion rate was calculated as described in Material and Method section. One-way ANOVA and paired student’s t-test calculate statistical significance set at P<0.05 as * and P<0.001 as ***.          70     Figure 3.4 PR suppresses SDF-1 expression ligand-independently in prostate stromal cells. hCAFs and their derived cell lines expressing mock, PRA or PRB were treated with vehicle, 1nM, 10nM and 100nM of P4 (A) or vehicle, 10nM of P4 and/or 10uM of RU486 (B) for 24 hours. Real-time PCR measured mRNA levels of SDF-1 relative to GAPDH. (C) hCAFs and their derived cell lines expressing mock, PRA or PRB were treated with vehicle or 10nM of P4 for 24 hours. CM were collected and used to measure SDF-1 protein levels by ELISA. WPMY-1 and its derived cell lines expressing mock, PRA or PRB were treated with vehicle, 1nM, 10nM and 100nM of P4 (D) or vehicle, 10nM of P4 and/or 10uM of RU486 (E) for 24 hours. Real-time PCR measured mRNA levels of SDF-1 relative to GAPDH. (F) HPS-19I cells and their derived cells expressing mock, PRA or PRB were treated with vehicle or 10nM of P4 for 24 hours. Real-time PCR measured mRNA levels of SDF-1 relative to GAPDH. One-way ANOVA and followed by student’s t-test calculate the significance set at P<0.01 as * and P<0.001 as ***.       71      Figure 3.5 PR suppresses IL-6 expression ligand-independently in prostate stromal cells. hCAFs and their derived cells expressing mock, PRA or PRB were treated with vehicle, 1nM, 10nM and 100nM of P4 (A) or vehicle, 10nM of P4 and/or 10uM of RU486 (B) for 24 hours. Real-time PCR measured mRNA levels of IL-6 relative to GAPDH. (C) hCAFs and their derived cells expressing mock, PRA or PRB were treated with vehicle or 10nM of P4 for 24 hours. CM were collected and used to measure IL-6 protein levels by ELISA. WPMY-1 cells and their derived cells expressing mock, PRA or PRB were treated with vehicle, 1nM, 10nM and 100nM of P4 (D) or vehicle, 10nM of P4 and/or 10uM of RU486 (E) for 24 hours. Real-time PCR measured mRNA levels of IL-6 relative to GAPDH. (F) HPS-19I cells and their derived cells expressing mock, PRA or PRB were treated with vehicle or 10nM of P4 for 24 hours. Real-time PCR measured mRNA levels of IL-6 relative to GAPDH. One-way ANOVA and student’s t-test calculated the significance set with P<0.01 as * and P<0.001 as ***.           72     Figure 3.6 PR represses transcription of SDF-1 and IL-6 genes. WPMY-1 cells expressing mock, PRA or PRB were transiently transfected with control siRNA or siRNA against PR. SDF-1 (A) and IL-6 (B) mRNA levels relative to GAPDH were measured by real-time PCR. hCAFs expressing mock, PRA or PRB isoform were treated with either control or 20ug/ml of cycloheximide for 16 hours. Real-time PCR assays measured mRNA levels of SDF-1 (C) and IL-6 (D) relative to GAPDH. (E) WPMY-1 cells and their derived cells expressing mock, PRA or PRB were treated with vehicle or 10nM of P4 for 24 hours. Chromatin immunoprecipitation assays were performed using acetyl-Histone 3 antibody. Eluted DNA fragments were subjected to measure the enrichment of acetyl-Histone 3 levels in SDF-1 and GAPDH promoter regions. One-way ANOVA and student’s t-test calculated the significance set with P<0.01 as * and P<0.001 as ***.          73     Figure 3.7 PR inhibitory effects to cancer cell mobility are mediated by SDF-1 and IL-6. WPMY-1 cells expressing mock, PRA or PRB were transiently transfected with control siRNA or siRNA against PR for 24 hours. Cells were washed twice with PBS buffer and replenished with serum free DMEM medium for 48 hours. CM were collected and incubated with PC-3 (A and C) or C4-2B (B and D) cells for cell migration assays (A and B) and Matrigel invasion assays (C and D) as described in Material and Method section. (E) CM were collected from hCAFs in the presence of vehicle or 10nM of P4 and then mixed with vehicle, 10ng/ml of SDF-1 or 10ng/ml IL-6 and incubated with PC-3 cells in Matrigel invasion assays. One-way ANOVA and paired student’s t-test calculate the level of significance set at P<0.05 as * and P<0.001 as ***.          74     Figure 3.8 PR expressions in WPMY-1 cell line. (A) Exogenous PRA or PRB was introduced into WPMY-1 cells by lentiviral approach. Cellular localization of PR was detected by confocal microscopy as we described (108). WPMY-1 cells expressing mock, PRA or PRB were transiently transfected with control siRNA or siRNA against PR for 48 hours.  PR knockdown efficiency was confirmed by western blotting with PR antibody (B) and by real-time PCR (C). Note: multiple protein bands were detected by PR antibody due to alternative translation initiation sites, which were characterized previously in Endocrinology 149(11):5872–588.          75     Figure 3.9 PR negatively regulates prostate cancer cell proliferation. LNCaP cells were maintained in phenol red free medium with 5% charcoal stripped serum for 48 hours and seeded in 96 well plates (3000 cells/well). Cells were then treated with either vehicle or 10nM of P4 or incubated with CM collected from hCAFs (upper) or WPMY-1 cells (bottom) as described in Materials and Methods. MTS assays measured cell proliferation rates over 4 days of treatment.          76     Figure 3.10 bFGF, KGF, HGF and VEGF mRNA levels in hCAFs. hCAFs expressing mock, PRA or PRB were maintained in phenol red free medium containing 5% charcoal stripped serum for 48 hours. Cells were treated with either vehicle or 10nM of P4 for 24 hours. Real-time PCR assays measured mRNA levels of bFGF, KGF, HGF and VEGF relative to GAPDH.            77     Table 3.1 Patient information on tissue biopsied that were used in immunohistochemistry study.           78     Table 3.2 primers used in this study.      79    Chapter 4:  Conclusion and future directions The function of AR had been well studied in the prostate epithelium and stroma. Sharing high homology with AR, the PR was also reported to be expressed in the prostate. However there is no clear conclusion on the localization and function in the prostate. In this thesis, two main findings are reported. Firstly, both PR isoforms are confirmed to be expressed only in a subset of cell populations in human prostate stroma. These PR positive cells are further characterized with smooth muscle and fibroblast phenotypes.  Secondly, this research is the first to study the function of PR in the human prostate. PR plays an inhibitory role in prostate stromal cell proliferation by regulating cell cycling (109). Furthermore, we demonstrate that PR expression is reduced in prostate cancers. In addition, PR also supresses prostate cancer cell migration, invasion and proliferation through a paracrine pathway. These studies demonstrate PR is an important regulator of human prostate physiological function and prostate cancer progression.  As P4/PR signalling modulates numerous physiological processes in a large variety of cell types, PR functions in human prostate should be further studied in the future. Several key cellular processes are regulated by PR, as defined by gene microarray and gene ontology analyses. PR was shown to regulate the transcription of genes associated with inflammatory responses, which is a common feature of prostatitis. Therefore, stromal PR may affect the inflammatory pathway in the prostate. Further studies will also focus on the roles of stromal PR during steroidogenesis in the prostate cells. It has been reported that progesterone and PR prevent uterine smooth muscle from coordinated contraction during pregnancy, which function is important in maintaining myometrium quiescence (81). Further study may focus on whether PR signaling controls the contractility of stromal smooth muscle cells in human prostate. We also find that PR interplays with other receptor signaling pathways. PR signaling up-regulates the expression of      80    ER in the WMYP-1 cells (108). Therefore, future work shall also include investigation on the interactions among steroid receptor (e.g. AR, ER) signaling in human prostate.         81    References 1. Ross MH, Pawlina W. 2010. Histology: A Text and Atlas: Lippincott Williams & Wilkins 2. Akin O, Sala E, Moskowitz CS, Kuroiwa K, Ishill NM, Pucar D, Scardino PT, Hricak H. 2006. Transition zone prostate cancers: features, detection, localization, and staging at endorectal MR imaging. Radiology 239: 784-92 3. Isaacs JT. 1983. Prostatic structure and function in relation to the etiology of prostatic cancer. Prostate 4: 351-66 4. Li H, Tang DG. 2011. Prostate cancer stem cells and their potential roles in metastasis. J Surg Oncol 103: 558-62 5. Hayward SW, Rosen MA, Cunha GR. 1997. Stromal-epithelial interactions in the normal and neoplastic prostate. Br J Urol 79 Suppl 2: 18-26 6. Berry SJ, Coffey DS, Walsh PC, Ewing LL. 1984. The development of human benign prostatic hyperplasia with age. J Urol 132: 474-9 7. Tokar EJ, Ancrile BB, Cunha GR, Webber MM. 2005. Stem/progenitor and intermediate cell types and the origin of human prostate cancer. Differentiation 73: 463-73 8. Lee LF, Guan J, Qiu Y, Kung HJ. 2001. Neuropeptide-induced androgen independence in prostate cancer cells: roles of nonreceptor tyrosine kinases Etk/Bmx, Src, and focal adhesion kinase. Mol Cell Biol 21: 8385-97 9. Barron DA, Rowley DR. 2012. The reactive stroma microenvironment and prostate cancer progression. Endocr Relat Cancer 19: R187-204 10. Hoeben E, Briers T, Vanderstichele H, De Smet W, Heyns W, Deboel L, Vanderhoydonck F, Verhoeven G. 1995. Characterization of newly established testicular peritubular and prostatic stromal cell lines: potential use in the study of mesenchymal-epithelial interactions. Endocrinology 136: 2862-73 11. Cunha GR, Ricke W, Thomson A, Marker PC, Risbridger G, Hayward SW, Wang YZ, Donjacour AA, Kurita T. 2004. Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol 92: 221-36 12. Djakiew D, Pflug B, Onoda M. 1993. Stromal-epithelial paracrine interactions in the neoplastic rat and human prostate. Adv Exp Med Biol 330: 185-202 13. Liu AY, Pascal LE, Vencio RZ, Vencio EF. 2010. Stromal-epithelial interactions in early neoplasia. Cancer Biomark 9: 141-55 14. Webber MM, Trakul N, Thraves PS, Bello-DeOcampo D, Chu WW, Storto PD, Huard TK, Rhim JS, Williams DE. 1999. A human prostatic stromal myofibroblast cell line WPMY-1: a model for stromal-epithelial interactions in prostatic neoplasia. Carcinogenesis 20: 1185-92 15. Untergasser G, Madersbacher S, Berger P. 2005. Benign prostatic hyperplasia: age-related tissue-remodeling. Exp Gerontol 40: 121-8 16. Bushman W. 2009. Etiology, epidemiology, and natural history of benign prostatic hyperplasia. Urol Clin North Am 36: 403-15, v 17. Schauer IG, Rowley DR. 2011. The functional role of reactive stroma in benign prostatic hyperplasia. Differentiation 82: 200-10 18. Roehrborn CG. 2009. Efficacy of alpha-Adrenergic Receptor Blockers in the Treatment of Male Lower Urinary Tract Symptoms. Rev Urol 11: S1-8 19. Andriole G, Bruchovsky N, Chung LW, Matsumoto AM, Rittmaster R, Roehrborn C, Russell D, Tindall D. 2004. Dihydrotestosterone and the prostate: the scientific rationale for 5alpha-reductase inhibitors in the treatment of benign prostatic hyperplasia. J Urol 172: 1399-403 20. Madersbacher S, Marszalek M. 2007. [Benign prostate hyperplasia: success and limitations of pharmacological therapy]. Internist (Berl) 48: 1157-64 21. 2013. Canadian Cancer Statistics 2013, Canadian Cancer Society      82    22. Carlin BI, Andriole GL. 2000. The natural history, skeletal complications, and management of bone metastases in patients with prostate carcinoma. Cancer 88: 2989-94 23. Miyamoto H, Messing EM, Chang C. 2004. Androgen deprivation therapy for prostate cancer: current status and future prospects. Prostate 61: 332-53 24. Basanta D, Scott JG, Fishman MN, Ayala G, Hayward SW, Anderson AR. 2012. Investigating prostate cancer tumour-stroma interactions: clinical and biological insights from an evolutionary game. Br J Cancer 106: 174-81 25. Olumi AF, Grossfeld GD, Hayward SW, Carroll PR, Tlsty TD, Cunha GR. 1999. Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res 59: 5002-11 26. Tuxhorn JA, Ayala GE, Smith MJ, Smith VC, Dang TD, Rowley DR. 2002. Reactive stroma in human prostate cancer: induction of myofibroblast phenotype and extracellular matrix remodeling. Clin Cancer Res 8: 2912-23 27. Yan G, Fukabori Y, McBride G, Nikolaropolous S, McKeehan WL. 1993. Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Mol Cell Biol 13: 4513-22 28. Karlou M, Tzelepi V, Efstathiou E. 2010. Therapeutic targeting of the prostate cancer microenvironment. Nat Rev Urol 7: 494-509 29. GM C. 2000. The cell: a molecular approach.  30. Elledge SJ. 1996. Cell cycle checkpoints: preventing an identity crisis. Science 274: 1664-72 31. Nigg EA. 1995. Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. Bioessays 17: 471-80 32. Pagano M, Pepperkok R, Verde F, Ansorge W, Draetta G. 1992. Cyclin A is required at two points in the human cell cycle. EMBO J 11: 961-71 33. Ito M. 2000. Factors controlling cyclin B expression. Plant Mol Biol 43: 677-90 34. Zou X, Tsutsui T, Ray D, Blomquist JF, Ichijo H, Ucker DS, Kiyokawa H. 2001. The cell cycle-regulatory CDC25A phosphatase inhibits apoptosis signal-regulating kinase 1. Mol Cell Biol 21: 4818-28 35. Ford HL, Pardee AB. 1999. Cancer and the cell cycle. J Cell Biochem Suppl 32-33: 166-72 36. Beato M, Klug J. 2000. Steroid hormone receptors: an update. Hum Reprod Update 6: 225-36 37. Giguere V, Hollenberg SM, Rosenfeld MG, Evans RM. 1986. Functional domains of the human glucocorticoid receptor. Cell 46: 645-52 38. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P. 1987. Functional domains of the human estrogen receptor. Cell 51: 941-51 39. Hollenberg SM, Evans RM. 1988. Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55: 899-906 40. Griekspoor A, Zwart W, Neefjes J, Michalides R. 2007. Visualizing the action of steroid hormone receptors in living cells. Nucl Recept Signal 5: e003 41. Africander D, Verhoog N, Hapgood JP. 2011. Molecular mechanisms of steroid receptor-mediated actions by synthetic progestins used in HRT and contraception. Steroids 76: 636-52 42. Berg JM TJ, Stryer L. 2002. Biochemistry. New York: W H Freeman 43. Evans RM. 1988. The steroid and thyroid hormone receptor superfamily. Science 240: 889-95 44. Spencer TE, Bazer FW. 2002. Biology of progesterone action during pregnancy recognition and maintenance of pregnancy. Front Biosci 7: d1879-98 45. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP. 1994. The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 14: 8356-64 46. McPherson SJ, Hussain S, Balanathan P, Hedwards SL, Niranjan B, Grant M, Chandrasiri UP, Toivanen R, Wang Y, Taylor RA, Risbridger GP. 2010. Estrogen receptor-beta activated      83    apoptosis in benign hyperplasia and cancer of the prostate is androgen independent and TNFalpha mediated. Proc Natl Acad Sci U S A 107: 3123-8 47. Gerdes MJ, Dang TD, Lu B, Larsen M, McBride L, Rowley DR. 1996. Androgen-regulated proliferation and gene transcription in a prostate smooth muscle cell line (PS-1). Endocrinology 137: 864-72 48. Latil A, Bieche I, Vidaud D, Lidereau R, Berthon P, Cussenot O, Vidaud M. 2001. Evaluation of androgen, estrogen (ER alpha and ER beta), and progesterone receptor expression in human prostate cancer by real-time quantitative reverse transcription-polymerase chain reaction assays. Cancer Res 61: 1919-26 49. Bonkhoff H, Fixemer T, Hunsicker I, Remberger K. 2001. Progesterone receptor expression in human prostate cancer: correlation with tumor progression. Prostate 48: 285-91 50. Luetjens CM, Didolkar A, Kliesch S, Paulus W, Jeibmann A, Bocker W, Nieschlag E, Simoni M. 2006. Tissue expression of the nuclear progesterone receptor in male non-human primates and men. J Endocrinol 189: 529-39 51. Mobbs BG, Liu Y. 1990. Immunohistochemical localization of progesterone receptor in benign and malignant human prostate. Prostate 16: 245-51 52. Brolin J, Skoog L, Ekman P. 1992. Immunohistochemistry and biochemistry in detection of androgen, progesterone, and estrogen receptors in benign and malignant human prostatic tissue. Prostate 20: 281-95 53. Wernert N, Gerdes J, Loy V, Seitz G, Scherr O, Dhom G. 1988. Investigations of the estrogen (ER-ICA-test) and the progesterone receptor in the prostate and prostatic carcinoma on immunohistochemical basis. Virchows Arch A Pathol Anat Histopathol 412: 387-91 54. Chung LW, Davies R. 1996. Prostate epithelial differentiation is dictated by its surrounding stroma. Mol Biol Rep 23: 13-9 55. Cunha GR. 2008. Mesenchymal-epithelial interactions: past, present, and future. Differentiation 76: 578-86 56. Ho CK, Habib FK. 2011. Estrogen and androgen signaling in the pathogenesis of BPH. Nat Rev Urol 8: 29-41 57. Yu S, Yeh CR, Niu Y, Chang HC, Tsai YC, Moses HL, Shyr CR, Chang C, Yeh S. 2012. Altered prostate epithelial development in mice lacking the androgen receptor in stromal fibroblasts. Prostate 72: 437-49 58. Ho CK, Nanda J, Chapman KE, Habib FK. 2008. Oestrogen and benign prostatic hyperplasia: effects on stromal cell proliferation and local formation from androgen. J Endocrinol 197: 483-91 59. Zilliacus J, Wright AP, Carlstedt-Duke J, Gustafsson JA. 1995. Structural determinants of DNA-binding specificity by steroid receptors. Mol Endocrinol 9: 389-400 60. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P. 1990. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9: 1603-14 61. Richer JK, Jacobsen BM, Manning NG, Abel MG, Wolf DM, Horwitz KB. 2002. Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J Biol Chem 277: 5209-18 62. Dressing GE, Lange CA. 2009. Integrated actions of progesterone receptor and cell cycle machinery regulate breast cancer cell proliferation. Steroids 74: 573-6 63. Musgrove EA, Hamilton JA, Lee CS, Sweeney KJ, Watts CK, Sutherland RL. 1993. Growth factor, steroid, and steroid antagonist regulation of cyclin gene expression associated with changes in T-47D human breast cancer cell cycle progression. Mol Cell Biol 13: 3577-87 64. Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB. 1998. Progesterone regulates transcription of the p21(WAF1) cyclin- dependent kinase inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273: 10696-701      84    65. Gizard F, Robillard R, Gervois P, Faucompre A, Revillion F, Peyrat JP, Hum WD, Staels B. 2005. Progesterone inhibits human breast cancer cell growth through transcriptional upregulation of the cyclin-dependent kinase inhibitor p27Kip1 gene. FEBS Lett 579: 5535-41 66. Musgrove EA, Swarbrick A, Lee CS, Cornish AL, Sutherland RL. 1998. Mechanisms of cyclin-dependent kinase inactivation by progestins. Mol Cell Biol 18: 1812-25 67. Boonyaratanakornkit V, Bi Y, Rudd M, Edwards DP. 2008. The role and mechanism of progesterone receptor activation of extra-nuclear signaling pathways in regulating gene transcription and cell cycle progression. Steroids 73: 922-8 68. Faivre E, Skildum A, Pierson-Mullany L, Lange CA. 2005. Integration of progesterone receptor mediated rapid signaling and nuclear actions in breast cancer cell models: role of mitogen-activated protein kinases and cell cycle regulators. Steroids 70: 418-26 69. Wang Y, Revelo MP, Sudilovsky D, Cao M, Chen WG, Goetz L, Xue H, Sadar M, Shappell SB, Cunha GR, Hayward SW. 2005. Development and characterization of efficient xenograft models for benign and malignant human prostate tissue. Prostate 64: 149-59 70. Wang Y, Sudilovsky D, Zhang B, Haughney PC, Rosen MA, Wu DS, Cunha TJ, Dahiya R, Cunha GR, Hayward SW. 2001. A human prostatic epithelial model of hormonal carcinogenesis. Cancer Res 61: 6064-72 71. Tuxhorn JA, McAlhany SJ, Yang F, Dang TD, Rowley DR. 2002. Inhibition of transforming growth factor-beta activity decreases angiogenesis in a human prostate cancer-reactive stroma xenograft model. Cancer Res 62: 6021-5 72. Groshong SD, Owen GI, Grimison B, Schauer IE, Todd MC, Langan TA, Sclafani RA, Lange CA, Horwitz KB. 1997. Biphasic regulation of breast cancer cell growth by progesterone: role of the cyclin-dependent kinase inhibitors, p21 and p27(Kip1). Mol Endocrinol 11: 1593-607 73. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM. 2000. Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289: 1751-4 74. Dong X, Challis JR, Lye SJ. 2004. Intramolecular interactions between the AF3 domain and the C-terminus of the human progesterone receptor are mediated through two LXXLL motifs. J Mol Endocrinol 32: 843-57 75. Tung L, Shen T, Abel MG, Powell RL, Takimoto GS, Sartorius CA, Horwitz KB. 2001. Mapping the unique activation function 3 in the progesterone B-receptor upstream segment. Two LXXLL motifs and a tryptophan residue are required for activity. J Biol Chem 276: 39843-51 76. Giangrande PH, Kimbrel EA, Edwards DP, McDonnell DP. 2000. The opposing transcriptional activities of the two isoforms of the human progesterone receptor are due to differential cofactor binding. Mol Cell Biol 20: 3102-15 77. Ishikawa H, Ishi K, Serna VA, Kakazu R, Bulun SE, Kurita T. 2010. Progesterone is essential for maintenance and growth of uterine leiomyoma. Endocrinology 151: 2433-42 78. Donnez J, Tatarchuk TF, Bouchard P, Puscasiu L, Zakharenko NF, Ivanova T, Ugocsai G, Mara M, Jilla MP, Bestel E, Terrill P, Osterloh I, Loumaye E, Group PIS. 2012. Ulipristal acetate versus placebo for fibroid treatment before surgery. N Engl J Med 366: 409-20 79. Kurita T, Young P, Brody JR, Lydon JP, O'Malley BW, Cunha GR. 1998. Stromal progesterone receptors mediate the inhibitory effects of progesterone on estrogen-induced uterine epithelial cell deoxyribonucleic acid synthesis. Endocrinology 139: 4708-13 80. Hardy DB, Janowski BA, Chen CC, Mendelson CR. 2008. Progesterone receptor inhibits aromatase and inflammatory response pathways in breast cancer cells via ligand-dependent and ligand-independent mechanisms. Mol Endocrinol 22: 1812-24 81. Challis JRG, Matthews SG, Gibb W, Lye SJ. 2000. Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 21: 514-50      85    82. Erez N, Truitt M, Olson P, Arron ST, Hanahan D. 2010. Cancer-Associated Fibroblasts Are Activated in Incipient Neoplasia to Orchestrate Tumor-Promoting Inflammation in an NF-kappaB-Dependent Manner. Cancer Cell 17: 135-47 83. Hayward SW, Wang Y, Cao M, Hom YK, Zhang B, Grossfeld GD, Sudilovsky D, Cunha GR. 2001. Malignant transformation in a nontumorigenic human prostatic epithelial cell line. Cancer Res 61: 8135-42 84. Wang J, Wang J, Sun Y, Song W, Nor JE, Wang CY, Taichman RS. 2005. Diverse signaling pathways through the SDF-1/CXCR4 chemokine axis in prostate cancer cell lines leads to altered patterns of cytokine secretion and angiogenesis. Cell Signal 17: 1578-92 85. Ao M, Franco OE, Park D, Raman D, Williams K, Hayward SW. 2007. Cross-talk between paracrine-acting cytokine and chemokine pathways promotes malignancy in benign human prostatic epithelium. Cancer Res 67: 4244-53 86. Chinni SR, Sivalogan S, Dong Z, Filho JC, Deng X, Bonfil RD, Cher ML. 2006. CXCL12/CXCR4 signaling activates Akt-1 and MMP-9 expression in prostate cancer cells: the role of bone microenvironment-associated CXCL12. Prostate 66: 32-48 87. Kukreja P, Abdel-Mageed AB, Mondal D, Liu K, Agrawal KC. 2005. Up-regulation of CXCR4 expression in PC-3 cells by stromal-derived factor-1alpha (CXCL12) increases endothelial adhesion and transendothelial migration: role of MEK/ERK signaling pathway-dependent NF-kappaB activation. Cancer Res 65: 9891-8 88. Singh S, Singh UP, Grizzle WE, Lillard JW, Jr. 2004. CXCL12-CXCR4 interactions modulate prostate cancer cell migration, metalloproteinase expression and invasion. Lab Invest 84: 1666-76 89. Kryczek I, Lange A, Mottram P, Alvarez X, Cheng P, Hogan M, Moons L, Wei S, Zou L, Machelon V, Emilie D, Terrassa M, Lackner A, Curiel TJ, Carmeliet P, Zou W. 2005. CXCL12 and vascular endothelial growth factor synergistically induce neoangiogenesis in human ovarian cancers. Cancer Res 65: 465-72 90. Darash-Yahana M, Pikarsky E, Abramovitch R, Zeira E, Pal B, Karplus R, Beider K, Avniel S, Kasem S, Galun E, Peled A. 2004. Role of high expression levels of CXCR4 in tumor growth, vascularization, and metastasis. FASEB J 18: 1240-2 91. Taichman RS, Cooper C, Keller ET, Pienta KJ, Taichman NS, McCauley LK. 2002. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res 62: 1832-7 92. Domanska UM, Timmer-Bosscha H, Nagengast WB, Oude Munnink TH, Kruizinga RC, Ananias HJ, Kliphuis NM, Huls G, De Vries EG, de Jong IJ, Walenkamp AM. 2012. CXCR4 inhibition with AMD3100 sensitizes prostate cancer to docetaxel chemotherapy. Neoplasia 14: 709-18 93. Hartmann TN, Burger JA, Glodek A, Fujii N, Burger M. 2005. CXCR4 chemokine receptor and integrin signaling co-operate in mediating adhesion and chemoresistance in small cell lung cancer (SCLC) cells. Oncogene 24: 4462-71 94. Sethi T, Rintoul RC, Moore SM, MacKinnon AC, Salter D, Choo C, Chilvers ER, Dransfield I, Donnelly SC, Strieter R, Haslett C. 1999. Extracellular matrix proteins protect small cell lung cancer cells against apoptosis: a mechanism for small cell lung cancer growth and drug resistance in vivo. Nat Med 5: 662-8 95. Wedel SA, Raditchev IN, Jones J, Juengel E, Engl T, Jonas D, Blaheta RA. 2008. CXC chemokine mRNA expression as a potential diagnostic tool in prostate cancer. Mol Med Rep 1: 257-62 96. Sun YX, Wang J, Shelburne CE, Lopatin DE, Chinnaiyan AM, Rubin MA, Pienta KJ, Taichman RS. 2003. Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in vivo. J Cell Biochem 89: 462-73 97. Guo Y, Xu F, Lu T, Duan Z, Zhang Z. 2012. Interleukin-6 signaling pathway in targeted therapy for cancer. Cancer Treat Rev 38: 904-10      86    98. Hobisch A, Eder IE, Putz T, Horninger W, Bartsch G, Klocker H, Culig Z. 1998. Interleukin-6 regulates prostate-specific protein expression in prostate carcinoma cells by activation of the androgen receptor. Cancer Res 58: 4640-5 99. Ueda T, Mawji NR, Bruchovsky N, Sadar MD. 2002. Ligand-independent activation of the androgen receptor by interleukin-6 and the role of steroid receptor coactivator-1 in prostate cancer cells. J Biol Chem 277: 38087-94 100. Kasina S, Macoska JA. 2012. The CXCL12/CXCR4 axis promotes ligand-independent activation of the androgen receptor. Mol Cell Endocrinol 351: 249-63 101. Lee SO, Lou W, Hou M, de Miguel F, Gerber L, Gao AC. 2003. Interleukin-6 promotes androgen-independent growth in LNCaP human prostate cancer cells. Clin Cancer Res 9: 370-6 102. Lee SO, Lou W, Johnson CS, Trump DL, Gao AC. 2004. Interleukin-6 protects LNCaP cells from apoptosis induced by androgen deprivation through the Stat3 pathway. Prostate 60: 178-86 103. George DJ, Halabi S, Shepard TF, Sanford B, Vogelzang NJ, Small EJ, Kantoff PW. 2005. The prognostic significance of plasma interleukin-6 levels in patients with metastatic hormone-refractory prostate cancer: results from cancer and leukemia group B 9480. Clin Cancer Res 11: 1815-20 104. Domingo-Domenech J, Oliva C, Rovira A, Codony-Servat J, Bosch M, Filella X, Montagut C, Tapia M, Campas C, Dang L, Rolfe M, Ross JS, Gascon P, Albanell J, Mellado B. 2006. Interleukin 6, a nuclear factor-kappaB target, predicts resistance to docetaxel in hormone-independent prostate cancer and nuclear factor-kappaB inhibition by PS-1145 enhances docetaxel antitumor activity. Clin Cancer Res 12: 5578-86 105. Cunha GR, Hayward SW, Wang YZ, Ricke WA. 2003. Role of the stromal microenvironment in carcinogenesis of the prostate. Int J Cancer 107: 1-10 106. Lai KP, Yamashita S, Huang CK, Yeh S, Chang C. 2012. Loss of stromal androgen receptor leads to suppressed prostate tumourigenesis via modulation of pro-inflammatory cytokines/chemokines. EMBO Mol Med 4: 791-807 107. Ricke WA, Ishii K, Ricke EA, Simko J, Wang Y, Hayward SW, Cunha GR. 2006. Steroid hormones stimulate human prostate cancer progression and metastasis. Int J Cancer 118: 2123-31 108. Yu Y, Liu L, Xie N, Xue H, Fazli L, Buttyan R, Wang Y, Gleave M, Dong X. 2013. Expression and Function of the Progesterone Receptor in Human Prostate Stroma Provide Novel Insights to Cell Proliferation Control. J Clin Endocrinol Metab  109. Yu Y, Liu L, Xie N, Xue H, Fazli L, Buttyan R, Wang Y, Gleave M, Dong X. 2013. Expression and function of the progesterone receptor in human prostate stroma provide novel insights to cell proliferation control. J Clin Endocrinol Metab 98: 2887-96 110. Dong X, Sweet J, Challis JR, Brown T, Lye SJ. 2007. Transcriptional activity of androgen receptor is modulated by two RNA splicing factors, PSF and p54nrb. Mol Cell Biol 27: 4863-75 111. Liu LL, Xie N, Sun S, Plymate S, Mostaghel E, Dong X. 2013. Mechanisms of the androgen receptor splicing in prostate cancer cells. Oncogene  112. Henshall SM, Quinn DI, Lee CS, Head DR, Golovsky D, Brenner PC, Delprado W, Stricker PD, Grygiel JJ, Sutherland RL. 2001. Altered expression of androgen receptor in the malignant epithelium and adjacent stroma is associated with early relapse in prostate cancer. Cancer Res 61: 423-7 113. Olapade-Olaopa EO, MacKay EH, Taub NA, Sandhu DP, Terry TR, Habib FK. 1999. Malignant transformation of human prostatic epithelium is associated with the loss of androgen receptor immunoreactivity in the surrounding stroma. Clin Cancer Res 5: 569-76 114. Gabal SM, Habib FM, Helmy DO, Ibrahim MF. 2007. Expression of estrogen receptor-B ( ER-B ) in bengin and malignant prostatic epithelial cells and its correlation with the clinico-pathological features. J Egypt Natl Canc Inst 19: 239-48 115. Li Y, Li CX, Ye H, Chen F, Melamed J, Peng Y, Liu J, Wang Z, Tsou HC, Wei J, Walden P, Garabedian MJ, Lee P. 2008. Decrease in stromal androgen receptor associates with androgen-     87    independent disease and promotes prostate cancer cell proliferation and invasion. J Cell Mol Med 12: 2790-8 116. Tanner MJ, Welliver RC, Jr., Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. 2011. Effects of androgen receptor and androgen on gene expression in prostate stromal fibroblasts and paracrine signaling to prostate cancer cells. PLoS One 6: e16027 117. Dong X, Yu C, Shynlova O, Challis JR, Rennie PS, Lye SJ. 2009. p54nrb is a transcriptional corepressor of the progesterone receptor that modulates transcription of the labor-associated gene, connexin 43 (Gja1). Mol Endocrinol 23: 1147-60 118. Xie N, Liu L, Li Y, Yu C, Lam S, Shynlova O, Gleave M, Challis JR, Lye S, Dong X. 2012. Expression and function of myometrial PSF suggest a role in progesterone withdrawal and the initiation of labor. Mol Endocrinol 26: 1370-9 119. Jacobsen BM, Richer JK, Schittone SA, Horwitz KB. 2002. New human breast cancer cells to study progesterone receptor isoform ratio effects and ligand-independent gene regulation. J Biol Chem 277: 27793-800 120. Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL, Hager GL. 1999. Differential localization and activity of the A- and B-forms of the human progesterone receptor using green fluorescent protein chimeras. Mol Endocrinol 13: 366-75 121. Arnett-Mansfield RL, DeFazio A, Mote PA, Clarke CL. 2004. Subnuclear distribution of progesterone receptors A and B in normal and malignant endometrium. J Clin Endocrinol Metab 89: 1429-42 122. Daniel AR, Lange CA. 2009. Protein kinases mediate ligand-independent derepression of sumoylated progesterone receptors in breast cancer cells. Proc Natl Acad Sci U S A 106: 14287-92 123. Gao L, Schwartzman J, Gibbs A, Lisac R, Kleinschmidt R, Wilmot B, Bottomly D, Coleman I, Nelson P, McWeeney S, Alumkal J. 2013. Androgen receptor promotes ligand-independent prostate cancer progression through c-Myc upregulation. PLoS One 8: e63563 124. Sung ML, Wu CC, Chang HI, Yen CK, Chen HJ, Cheng JC, Chien S, Chen CN. 2009. Shear stress inhibits homocysteine-induced stromal cell-derived factor-1 expression in endothelial cells. Circ Res 105: 755-63 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167408/manifest

Comment

Related Items