Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Laccase-dependent lignification of secondary cell walls of protoxylem tracheary elements in Arabidopsis… Benske, Anika 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2014_november_benske_anika.pdf [ 163.43MB ]
Metadata
JSON: 24-1.0167365.json
JSON-LD: 24-1.0167365-ld.json
RDF/XML (Pretty): 24-1.0167365-rdf.xml
RDF/JSON: 24-1.0167365-rdf.json
Turtle: 24-1.0167365-turtle.txt
N-Triples: 24-1.0167365-rdf-ntriples.txt
Original Record: 24-1.0167365-source.json
Full Text
24-1.0167365-fulltext.txt
Citation
24-1.0167365.ris

Full Text

LACCASE-DEPENDENT LIGNIFICATION OF SECONDARY CELL WALLS OF PROTOXYLEM TRACHEARY ELEMENTS IN ARABIDOPSIS THALIANA by  Anika Benske  B.Sc., The University of Wisconsin-Madison, 2012  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2014  © Anika Benske, 2014 ii  Abstract Lignin is a phenolic polymer that plays important roles in the structural integrity of plants. Both peroxidases and laccases have been implicated in the polymerization of lignin, and mutant analyses have conclusively demonstrated a role for laccases in lignification of Arabidopsis thaliana stems. However, the oxidative enzymes that polymerize lignin in protoxylem tracheary elements (TEs) have not been defined. Induction of the master transcription factor VASCULAR RELATED NAC-DOMAIN 7 (VND7) causes systemic trans-differentiation into protoxylem TEs, providing an inducible-experimental model system to study protoxylem TE differentiation. The transcriptome of these lines has been well characterized, and two laccases, LAC4 and LAC17, are strongly expressed following induction of protoxylem TE development. To test if LAC4 and LAC17 are necessary for the lignification of protoxylem TEs, the inducible VND7 construct was transformed into the lac4-2/lac17 double mutant background  and fluorescently labeled monolignols were exogenously applied to differentiating protoxylem TEs. Labeled polymerized lignin was only detected in the wild-type protoxylem TEs, but not in lac4-2/lac17 protoxylem TEs. To test if laccases alone are sufficient to promote lignification, the constitutive 35S promoter was used to drive either LAC4 or LAC17 in wild-type plants, resulting in strong ectopic lignification of primary cell walls upon application of fluorescently labeled monolignols. Fluorescently tagged laccases were transformed into the inducible protoxylem TEs system, where they specifically localize to the secondary, but not primary, cell walls of protoxylem tracheary elements. This research shows that LAC4 and LAC17 are necessary and sufficient for the lignification of secondary cell wall domains of protoxylem TEs and that they are specifically localized to these domains.   iii  Preface  The VND7-GR construct was provided by Dr. Taku Demura (NAIST, Japan). Table 1.1 is a subset of published microarray expression data of targeted gene expression when VND7-GR is induced  (Yamaguchi et al., 2011).  The anti-LAC4 antibody and the laccase mutant lines were provided to our lab by Dr. Richard Sibout and Dr. Lise Jouanin (INRA, France). The single and double mutant lines were originally characterized in Berthet et al. (2011), and I confirmed the irregular xylem phenotype, as shown in Figure 1.2.  In Chapter 3, I transformed VND7-GR into lac4-2/lac17 background and performed the UV autofluorescence study. Dr. Mathias Schuetz performed the fluorescently tagged monolignol experiment and performed the subsequent imaging. Fluorescently tagged monolignols (NBD-CA) were provided to our lab by Dr. John Ralph (UW-Madison).  In Chapter 4, I generated the p35S:LAC4 and p35S:LAC17 constructs and transformed into Col-0 and lac4-2/lac17. The fluorescently tagged monolignol experiment and subsequent imaging was completed with the assistance of Dr. Mathias Schuetz.   In Chapter 5, I generated the pLAC17:LAC17-mCherry construct and performed subsequent transformation into VND7-GR and lac4-2/lac17, and Dr. Mathias Schuetz generated the pLAC4:LAC17-mCherry construct and transformed into the same backgrounds. I performed all subsequent confocal imaging and histochemical staining presented in this chapter.    iv  Table of Contents  Abstract.......................................................................................................................................... ii	  Preface........................................................................................................................................... iii	  Table of Contents ......................................................................................................................... iv	  List of Tables .............................................................................................................................. viii	  List of Figures............................................................................................................................... ix	  List of Abbreviations ................................................................................................................... xi	  Acknowledgements .................................................................................................................... xiii	  Chapter 1: Introduction ................................................................................................................1	  1.1	   Introduction to plant cell walls .......................................................................................... 1	  1.1.1	   Cell wall composition and significance ...................................................................... 1	  1.1.2	   Patterned deposition of secondary cell walls .............................................................. 2	  1.2	   Regulation of secondary cell wall deposition and lignification......................................... 3	  1.3	   Radical polymerization of lignin via oxidative enzymes................................................... 7	  1.3.1	   Monolignol radical generation and coupling .............................................................. 7	  1.3.2	   Peroxidases ................................................................................................................. 8	  1.3.3	   Laccases ...................................................................................................................... 9	  1.4	   Research questions and objectives................................................................................... 13	  Chapter 2: Materials and methods.............................................................................................16	  2.1	   Plant material and growth conditions .............................................................................. 16	  2.2	   DNA Extraction ............................................................................................................... 16	  2.3	   Genotyping lac mutant lines ............................................................................................ 17	  v  2.4	   Stem sectioning and staining for phenotyping................................................................. 18	  2.4.1	   Toluidine blue ........................................................................................................... 18	  2.4.2	   Phloroglucinol staining for lignin ............................................................................. 18	  2.5	   Induction of Arabidopsis VND7-GR lines ...................................................................... 18	  2.6	   Cloning of constructs ....................................................................................................... 19	  2.6.1	   Overexpression construct p35S:LAC4 and p35S:LAC17.......................................... 19	  2.6.2	   Fluorescently tagged laccase: pLAC17:LAC17-mCherry ......................................... 20	  2.7	   Preparation and transformation of competent cells ......................................................... 21	  2.7.1	   Escherichia coli ........................................................................................................ 21	  2.7.2	   Agrobacterium tumefaciens ...................................................................................... 22	  2.8	   Agrobacterium-mediated transformation of Arabidopsis ................................................ 23	  2.9	   Exogenous feeding of monolignols ................................................................................. 23	  2.10	   Disruption of microtubules with oryzalin ...................................................................... 24	  2.11	   Western blot ................................................................................................................... 24	  2.12	   Fixing samples with high pressure freezing................................................................... 26	  2.13	   Brightfield light microscopy .......................................................................................... 27	  2.14	   Epifluorescence microscopy .......................................................................................... 27	  2.15	   Spinning disc confocal microscopy ............................................................................... 27	  2.15.1	   Detecting signal from NBD-CA in polymerized lignin.......................................... 27	  2.15.2	   Localization of LAC-mCherry................................................................................ 28	  2.15.3	   Thick section immunolabeling................................................................................ 28	  2.15.4	   Whole mount immunolabeling ............................................................................... 29	  2.16	   Transmission electron microscopy immunogold labeling ............................................. 30	  vi  Chapter 3: LAC4 and LAC17 are necessary for the lignification of secondary cell wall domains of protoxylem tracheary elements...............................................................................32	  3.1	   Introduction...................................................................................................................... 32	  3.2	   Results.............................................................................................................................. 33	  3.2.1	   Detecting lignin with autofluorescence in lac4-2/lac17 protoxylem tracheary elements ................................................................................................................................ 35	  3.2.2	   Detecting lignin with fluorescently labeled NBD-CA in lac4-2/lac17 protoxylem tracheary elements ................................................................................................................ 37	  3.3	   Discussion ........................................................................................................................ 38	  Chapter 4: Ectopic expression of LAC4 or LAC17 is sufficient for lignification of primary cell wall domains ..........................................................................................................................41	  4.1	   Introduction...................................................................................................................... 41	  4.2	   Results.............................................................................................................................. 42	  4.2.1	   35S:LAC overexpression constructs partially rescue lac4-2/lac17 stem phenotype 42	  4.2.2	   Primary cell wall lignification assay in LAC overexpression lines using UV autofluorescence ................................................................................................................... 45	  4.2.3	   Primary cell wall lignification assay in LAC overexpression lines using fluorescently labeled monolignols .............................................................................................................. 50	  4.3	   Discussion ........................................................................................................................ 54	  Chapter 5: Laccase localization in developing tracheary elements.........................................56	  5.1	   Introduction...................................................................................................................... 56	  5.2	   Results.............................................................................................................................. 58	  5.2.1	   LAC4-mCherry and LAC17-mCherry complement lac4-2/lac17............................ 58	  vii  5.2.2	   Localization of LAC4-mCherry and LAC17-mCherry ............................................ 60	  5.2.3	   Subcellular localization of LAC4 ............................................................................. 62	  5.2.4	   Localization of LAC4-mCherry or LAC17-mCherry in protoxylem tracheary elements with disrupted microtubule function...................................................................... 66	  5.2.5	   Localization of xylan in protoxylem tracheary elements with disrupted microtubule function ................................................................................................................................. 69	  5.3	   Discussion ........................................................................................................................ 70	  Chapter 6: Conclusion.................................................................................................................75	  Bibliography .................................................................................................................................80	   viii  List of Tables Table 1.1 Microarray analysis of gene expression in induced VND7-GR seedlings ................... 15	  Table 2.1 Primers used to genotype lac mutant lines ................................................................... 17	  Table 2.2 Primers used to amplify LAC4 or LAC17 with attB adapters...................................... 20	  Table 2.3 Primers used to amplify pLAC17-LAC17 with attB adapters ....................................... 21	  ix  List of Figures  Figure 1.1 Trans-differentiation of protoxylem tracheary elements in the hypocotyl .................... 6	  Figure 1.2 Characterization of stem cross-sections of laccase mutant lines ................................ 12	  Figure 3.1 pLAC-GUS expression in seedlings............................................................................. 33	  Figure 3.2 Characterization of stem cross-sections of laccase double mutant expressing VND7-GR ............................................................................................................................... 34	  Figure 3.3 Detecting lignin with autofluorescence in lac4-2/lac17 protoxylem tracheary elements..................................................................................................................................... 36	  Figure 3.4 Detecting fluorescently labeled lignin in lac4-2/lac17 protoxylem tracheary elements..................................................................................................................................... 38	  Figure 4.1 Characterizing stem cross-sections of lines expressing 35S:LAC4 ............................. 43	  Figure 4.2 Characterizing stem cross-sections of plants expressing 35s:LAC17 ......................... 44	  Figure 4.3 Detecting lignin autofluorescence in wild-type........................................................... 47	  Figure 4.4 Detecting lignin autofluorescence in plants expressing 35S:LAC4............................. 48	  Figure 4.5 Detecting lignin autofluorescence in plants expressing 35S:LAC17........................... 49	  Figure 4.6 Detecting lignin polymerized from fluorescently labeled NBD-CA in wild-type ...... 51	  Figure 4.7 Detecting lignin polymerized from fluorescently labeled NBD-CA in plants expressing 35S:LAC4.................................................................................................. 52	  Figure 4.8 Detecting lignin polymerized from fluorescently labeled NBD-CA in plants expressing 35S:LAC17................................................................................................ 53	  Figure 5.1 Characterizing stem cross-sections of plants expressing pLAC17-mCherry............... 59	  Figure 5.2 Localization of LAC4-mCherry in protoxylem tracheary elements............................ 61	  x  Figure 5.3 Localization of LAC17-mCherry in protoxylem tracheary elements.......................... 61	  Figure 5.4 TEM immuno-gold labeling of xylan and LAC4 in protoxylem tracheary elements . 63	  Figure 5.5 Western blot detecting mCherry from LAC4-mCherry VND7-GR plants ................. 64	  Figure 5.6 Immunofluorescence using polyclonal mCherry antibody to label LAC4-mCherry in protoxylem tracheary elements ................................................................................... 65	  Figure 5.7 Localization of LAC4-mCherry in protoxylem tracheary elements when microtubule function is disrupted.................................................................................................... 67	  Figure 5.8 Localization of LAC17-mCherry in protoxylem tracheary elements when microtubule function is disrupted.................................................................................................... 68	  Figure 5.9 Whole seedling immunolabeling of xylan and cellulose in protoxylem tracheary elements when microtubule function is disrupted ...................................................... 70	   xi  List of Abbreviations 2CW  secondary cell wall CESA  cellulose synthase ABC  ATP-binding cassette bp  base pairs BSA   bovine serum albumin CA  coniferyl alcohol CASP  Casparian strip membrane domain protein Col  columbia   CSC  cellulose synthase complex DEX  dexamethasone DNA  dioxyribose nucleic acid ER  endoplasmic reticulum  GFP  green fluorescent protein GUS  β-glucuronidase IFF  interfascicular fiber  irx  irregular xylem LAC  laccase LB   Luria-Bertani LR   London Resin MAP  microtubule associated protein MeOH  methanol MS   Murashige and Skoog   xii  MT  microtubule NBD-CA γ-nitrobenzofuran-tagged coniferyl alcohol p   promoter PCD  programmed cell death PCR  polymerase chain reaction PIPES  piperazine-N,N′-bis(2-ethanesulfonic acid) PRX  peroxidase PVDF  polyvinylidene difluoride RFP  red fluorescent protein rpm  revolutions per minute S4B  Pontamine Fast Scarlet SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis  T-DNA transfer DNA TBS  tris-buffered saline  TBST  tris-buffered saline and Tween 20 TEM  transmission electron microscopy TE  tracheary element TMB   3,3’,5,5’-tetramethylbenzidine tt   transparent testa  UTR  untranslated region UV  ultraviolet  VND  vascular related NAC-domain YEB  yeast extraction broth  xiii  Acknowledgements I am sincerely appreciative to my research supervisors, Dr. Brian Ellis and Dr. Lacey Samuels, for their immeasurable support throughout my studies. Their knowledge and passion for science is an inspiration, and I am honored they have shared their expertise. I am also grateful for the advice and guidance from the other member of my supervisory committee, Dr. Carl Douglas.  I would like to thank my colleagues in the Ellis and Samuels labs, who provided training on specialized lab techniques and were always available to answer my questions. I am extremely grateful for the support of Dr. Mathias Schuetz, who has been an incredible research mentor and spent countless hours providing guidance on molecular cloning and fluorescence microscopy techniques.  I would also like to thank Dr. Heather McFarlane and Dr. Rebecca Smith for patiently providing electron microscopy training. My further gratitude to members of the Wasteneys lab, especially Ryan Eng and Dr. Miki Fujita, for their advice on molecular cloning and microscopy. I am eternally thankful to the Botany department faculty, staff, and fellow graduate students at UBC, who have provided incredible support and inspiration in my studies. My sincere gratitude to the UBC Bioimaging Facility staff (Bradford Ross, Derrick Horne, Kevin Hodgson, and Garnet Martens) for providing training and support for sample preparation and advance imaging techniques. I would like to acknowledge the NSERC CREATE grant, Working on Walls, for the wonderful training and collaborative research opportunities.   Finally, I’d like to express my gratitude to my family, who has given me incredible support and encouragement throughout the years.  xiv      Dedicated to my friends and family  1  Chapter 1: Introduction 1.1 Introduction to plant cell walls 1.1.1 Cell wall composition and significance The presence of a rigid cell wall lying outside the plasma membrane is a fundamental difference between plant and animal cells. There are two types of plant cell walls, primary and secondary. All cells contain a primary cell wall, which are thinner than secondary walls, and are characteristic of expanding cells. Secondary cell walls (2CWs) are deposited in some specialized cell-types that have finished elongative growth and are typically nearing maturity.  The primary cell wall is composed of cellulose microfibrils embedded in a matrix of hemicellulose and pectin. This gel-like matrix provides strength, while still allowing cell expansion to occur (Carpita and Gibeaut, 1993; reviewed Bashline et al., 2014). Cellulose microfibrils are composed of chains of β-1,4-glucans that are synthesized at the plasma membrane (PM) by cellulose synthase (CESA) complexes (CSCs) (Mueller and Brown, 1980; Kimura et al., 1999). Other cell wall carbohydrates are synthesized within the Golgi and are secreted to the cell wall in Golgi-derived vesicles (Driouich et al., 1993).  Unlike primary cell walls, many 2CWs are incredibly rigid due to the presence of the phenolic polymer, lignin. The ability to synthesize this strong polymer is thought to have played an important role in plant adaption to life on land. Ultimately, this is polymer that allows trees to grow to phenomenal heights (Zhong et al., 1997). 2CWs are not deposited in all cell types, but are only found in cell-types that require structural reinforcement (Cosgrove, 2005). As a major polymer in the 2CW, lignin provides mechanical strength that allows tracheary elements (TEs) to keep their shape under the negative pressure resulting from water transportation, while its hydrophobicity restricts water loss from the vasculature. Furthermore, the ability of plant cells to 2  deposit lignin at the sites of pathogen invasion aids in disease resistance (Lauvergeat	   et	   al.,	  2001).  In addition to the important physiological functions of cell wall components, they are also used as raw material for several industries including paper, textiles, and biofuels. From the perspective of industrial utilization of plant feedstocks, the resistance of lignin to chemical or enzymatic degradation impedes access to cell wall carbohydrates (Ragauskas et al., 2014). For these reasons, lignin biosynthesis has been an active area of research. From genetic and biochemical studies, most of the genes involved in the biosynthesis of the lignin precursors, the monolignols, have been identified, leading to a broad understanding of lignin biogenesis in Arabidopsis thaliana (reviewed in Bonawitz & Chapple, 2010; Vanholme et al., 2013).  1.1.2 Patterned deposition of secondary cell walls  Lignifying tissues in plants include the root endodermis, vascular tissue and fibers, and the anther endothecium. Within the vascular tissue, three xylem cell types produce lignified 2CWs in which the secondary wall thickenings are deposited in distinct patterns. Protoxylem TEs are the first xylem vessels formed, and they have 2CWs deposited in a helical or annular pattern. This pattern allows for axial elongation of these water-conducting vessels even after 2CW deposition has provided added mechanical strength. Metaxylem TEs have a larger diameter than protoxylem TEs and contain a 2CW that is laid down in a pitted or reticulate pattern. Both of these cell types undergo programmed cell death (PCD) during development, leaving contiguous hollow tubes that provide channels for water transport (McCann, 1997). The third type of xylem cell with a thickened 2CW is the fiber cell, which provides structural support to the plant. Fibers have delayed PCD leading to the deposition of a much thicker, un-patterned 2CW.  3  Cytoskeleton components are known to play a role in determining patterning of 2CWs. Cortical microtubules (MTs) line the plasma membrane at sites preceding 2CW deposition, and drug-induced depolymerization of MTs results in highly disorganized cell wall patterns. MTs have also been shown to regulate the localization of CSCs in xylem vessels (Wightman and Turner, 2008).   Recently, MT-associated proteins (MAPs) related to the regulation of 2CW deposition were identified in Arabidopsis. The MAP70 family was demonstrated to regulate 2CW boundaries in suspension cultures of TE-like cells. Pesquet et al. (2010) demonstrated that 2CW patterned deposition was dependent on expression levels of MAP70-5 and its binding partner, MAP70-1. Overexpression of these genes led to more cells exhibiting a helical secondary cell pattern, while decreased expression via RNAi knockdown led to more cells exhibiting a pitted 2CW pattern. Furthermore, it was demonstrated that MIDD1/RIP3 promotes MT depolymerization at sites of future 2CW pits (Oda and Fukuda, 2012).  1.2 Regulation of secondary cell wall deposition and lignification In Arabidopsis, a network of transcription factors has been identified as regulators of genes involved in 2CW formation and PCD (Kubo et al., 2005; Zhong et al., 2008). Microarray analysis of suspension culture cells differentiating into TE-like cells identified many proteins involved in 2CW deposition and PCD.  Three “master regulator” transcription factors have been identified as differentially controlling the three xylem cell-types described above. The development of TEs is correlated spatially and temporally with the expression of VASCULAR-RELATED NAC DOMAIN6 and 7 (VND6 and VND7). More specifically, VND7 controls protoxylem differentiation, while VND6 controls metaxylem differentiation. Plants in which the VND6 or VND7 transcription factors were overexpressed displayed ectopic differentiation of various non-vascular cell types into the specified TE (Kubo et al., 2005). The establishment of 4  such transgenic lines provides an important tool for research into TE development. However, the transdifferentiating cells also rapidly undergo PCD, which makes maintenance of the plant lines problematic. Yamaguchi et al. (2010) developed an elegant solution to this problem by placing the VND7 transcription factor under the control of a glucocorticoid-mediated induction system (Panel A, Figure 1.1). In this system, 35S:VND7:VP16:GR (VND7-GR) is expressed in all cells, but the protein is unable to enter the nucleus to act as a transcription factor due to the glucocorticoid receptor binding to a cytoplasmic, endogenous heat-shock protein. When a glucocorticoid, such as dexamethasone (DEX), is applied, the heat shock protein disassociates from the complex, and VND7-GR is able to enter the nucleus and act on its targeted genes. The result of this induction is the differentiation of approximately 80% of cells into protoxylem tracheary-like elements with helical 2CW formation (Panel B, Figure 1.1).  The transcription factor regulatory network operating downstream of VND6/7 drives the expression of genes involved in both 2CW synthesis and deposition, and lignification (Zhong et al., 2010; Ohashi-Ito et al., 2010). At the cellular level, the deposition of lignin is controlled both spatially and temporally. In TEs, for example, cell wall lignification is initiated at the cell corners. Lignification proceeds slowly as the 2CW is being formed and the TE is still alive (Kaneda et al., 2008; Smith et al., 2013).  The cell then undergoes a rapid lignification process, in which the discrete 2CW domains become thickened and permeated with lignin (reviewed by Donaldson, 2001).  The composition of the lignin being deposited differs developmentally and among different cell types. Lignin is primarily composed of two main subunits derived from the monolignols, coniferyl alcohol and sinapyl alcohol, which lead to lignin polymers commonly referred to as G and S lignin, respectively (Ralph et al., 2004). In some specific instances, a third 5  monolignol, p-coumaryl alcohol, can make a significant contribution to the lignin polymer, which is then referred to as H lignin. All three monolignols are synthesized from L-phenylalanine via the phenylpropanoid pathway, which is initiated by deamination followed by subsequent hydroxylation and O-methylation on the aromatic ring, and lastly, the reduction of the side chain carboxyl group to the alcohol. As different domains of cell lignify, the composition of the deposited lignin changes. Early lignification in the middle lamella has higher p-coumaryl composition, while later lignifying domains have higher guaiacyl lignin, as in conifers, or higher guaiacyl-syringyl lignin, as in angiosperms (Donaldson, 2001). Lignin polymerization is significantly different from other 2CW components in that a racemic polymer is formed from radical coupling reactions between phenolic radicals (Ralph et al., 1999). The monolignol subunits are synthesized in the cytoplasm in proximity to the endoplasmic reticulum (ER), as both cytosolic- and ER-localized enzymes are required for their synthesis (reviewed in Bonawitz and Chapple, 2010). It is unclear how monolignols are transported to the cell wall, although some evidence supports transport through the plasma membrane via ATP-binding cassette (ABC) transporters (Miao and Liu, 2010; Alejandro et al., 2012). Once in the cell wall, oxidative enzymes are responsible for generating monolignol radicals that will randomly couple to generate a growing lignin polymer.  6  Figure 1.1 Trans-differentiation of protoxylem tracheary elements in the hypocotyl (A) Inducible construct modified from Yamaguchi et al. (2010). (B) Illustration of posttranslational induction system of VND7-GR with the glucocorticoid, dexamethasone (DEX). Autofluorescent images detecting UV-autofluorescent lignin in 2CWs of uninduced seedlings in native TE (left) or induced seedling in induced and native TEs (right).  35S$ VND7$ VP16$ GR$ NOS$HSP90$VND7$VP16$ GR$HSP90$DEX$+DEX$VND7$VP16$ GR$DEX$AAAAA$48$hr$A.$B.$7  1.3 Radical polymerization of lignin via oxidative enzymes  The earliest proposed lignin polymerization mechanism involved random, radical coupling of monolignols catalyzed by oxidative enzymes (Freudenberg, 1959). Several classes of oxidative enzymes have been implicated in the generation of monolignol radicals including peroxidases, laccases, polyphenol oxidases, and coniferyl alcohol oxidase (Boerjan et al., 2003). There is considerable in vitro evidence that both purified peroxidases and laccases can catalyze the polymerization of monolignols (Freudenberg, 1959; Ralph et al., 2004; Sterjiades et al., 1992; Bao et al., 1993; Takahama, 1995; Richardson et al., 1997). Large families of these enzymes are found in all plant species, which makes it difficult to establish which specific family members might be involved in lignification in vivo. Presumably, in order for these enzymes to promote lignin polymerization, the catalyst(s) will be cell wall-associated with their presence being positively correlated with the time and place of lignification, as well as being able to polymerize monolignols. 1.3.1 Monolignol radical generation and coupling While peroxidases and laccases can both produce monolignol radicals, they use different substrates and metal oxidation centers to do so. Peroxidases (PRXs) contain iron oxidation centers and use hydrogen peroxide (H2O2), while laccases (LACs) contain copper oxidation centers and reduce oxygen (O2) to water (H2O). The laccase withdraws an electron from the monolignol substrate, and after receiving four electrons in its ion centers, the enzyme donates them to molecular oxygen, reducing it to two molecules of water (Bourbonnais et al., 1997).  Monolignol radicals are relatively stable due to electron delocalization to the β-position of the side chain (Önnerud, 2002; Boerjan et al., 2003). Covalent linkages are made when monolignol radicals are coupled to a radical at the end of a growing lignin polymer. However, 8  this reaction is radical-quenching, as extension of the polymer will require the dehydrogenation of the two new coupling partners. The radicals required at the growing end of the polymer are thought to be generated by radical transfer from monolignol radicals or other radical intermediate products (Boerjan et al., 2003). The various linkages observed in natural lignin, as well as synthetic dehydrogenation polymers, can be explained chemically by the various resonance forms that can occur, both on the radical at the end of a growing lignin polymer and the monolignol radical.  1.3.2 Peroxidases Previous studies in various plant species have identified specific peroxidases that appear to contribute to lignification. Blee et al. (2003) showed that down-regulation of NtPRX60 using RNAi in tobacco (Nicoiana tabacum) led to a 50% reduction of lignin content. A similar strategy in transgenic aspen showed that down-regulation of a specific anionic peroxidase (PRXA3a) led up to a 20% reduction of lignin, in addition to a change in the monolignol composition ratio (Li et al., 2003).  Recently, lignin-specific peroxidases in Arabidopsis were predicted based on homology to the lignin-specific peroxidase purified from transdifferentiating cultures of Zinnia elegans (Herrero et al., 2013; Gabaldón, 2005). The peroxidase family in Arabidopsis consists of 73 members, and four candidate peroxidases were predicted: PRX4, PRX52, PRX49, and PRX72. However, no genetic studies have been published demonstrating a role for these peroxidases in lignin polymerization. Other studies in Arabidopsis have demonstrated the role of other peroxidases in lignification. A mutant line overexpressing PRX53 showed an increase of lignification in the vascular tissue (Østergaard et al., 2000). Recently it was demonstrated that PRX64 was required for forming the lignified Casparian strip in endodermal cells, and PRX64 9  was specifically localized to these domains by CASPARIAN STRIP DOMAIN PROTEIN1 (CASP1) (Lee et al., 2013). While these studies demonstrate the lignin-specific role that peroxidases can play, the members of this large family have overlapping localization and potentially redundant function, making it difficult to associate significant changes in lignin content and/or composition with specific family members.  1.3.3 Laccases While both peroxidases and laccases were initially proposed to contribute to polymerization, two early studies challenged the possible role of laccases. Laccases purified from Rhus vernicifera were unable to oxidize CA to form lignin in vitro (Nakamura, 1967), and histochemical staining of lignifying tissues in green ash failed to detect laccase activity (Harkin and Obst, 1973). These negative results led researchers to focus, instead, on the role of peroxidases. It was not until the 1990s that the role of laccases in lignification was actively investigated again. As with peroxidases, the role of putative lignin-specific laccases has been demonstrated in several plant species. In 1992, two groups demonstrated that laccases purified from sycamore maple (Acer pseudoplatanus) were able to catalyze polymerization of all three monolignols in vitro, and they were able to localize this laccase activity to the 2CW using transmission electron microscopy (TEM) (Driouichit et al., 1992; Sterjiades et al., 1992). Shortly after, Bao et al. (1993) demonstrated that laccases purified from loblolly pine were able to polymerize monolignols in vitro and showed that their localization was correlated with the time and place of lignification in pine xylem tissue. Histochemical staining of Zinnia stems demonstrated that cells actively undergoing lignification correlated more closely with laccase activity than peroxidases activity (Liu et al., 1994). This was detected using chromogenic substrates previously used to 10  differentiate laccase and peroxidase activity, with peroxidase detection requiring the exogenous application of H2O2 (Savidge and Udagama-Randeniya, 1992; Sterjiades et al., 1993; and Bao et al., 1993). Although the laccases family is much smaller than the peroxidase family, a similar functional redundancy issue exists when attempting to demonstrate the role of a specific member of the family. Purified LAC90 and LAC110 from Populus euramericana were able oxidize CA in vitro (Ranocha et al., 1999), but in RNAi lines of Populus trichocarpa, reduction of laccase activity did not affect overall lignin content in the wood. However, one of these transgenic lines, lac3AS, did display increased soluble phenolics and deformed xylem fiber development (Ranocha et al., 2002). Researchers attributed the lack of a lignin phenotype in these specific RNAi lines to the presence of a large laccase gene family and potential functional redundancy.  In contrast to the Populus trichocarpa genome that contains 51 putative laccases, the model plant, Arabidopsis, possesses a smaller laccase family with only 17 members (Goodstein et al., 2012). The expression pattern of all Arabidopsis laccases was investigated using tissue-specific RT-PCR and promoter-β-glucuronidase (GUS) analyses (Turlapati et al., 2011). When this expression information is integrated with genomic sequence similarity, the laccase family in Arabidopsis can be divided into five groups (Berthet et al., 2012). Groups A, C and D, are expressed in distinct lignifying tissues; Group A is stem-specific and consists of LAC11, LAC4, LAC17, LAC2, LAC10, and LAC23; Group C is root-specific and consists of LAC8, LAC9, LAC13, LAC3, and LAC7; Group D is seed-specific and consists of LAC5 and LAC15. The first demonstrated role of an Arabidopsis laccase in the oxidative polymerization of phenolic compounds was revealed by mutant analysis of the lac15, or transparent testa10 (tt10), mutant. This study demonstrated that the color of the seed coat is altered when LAC15 function is 11  hindered as a result of disrupted flavonoid production (Pourcel et al., 2005). Another study suggested that there was a 30% reduction of extractable lignin content from the tt10 seed coat (Liang et al., 2006). Since the most abundant amount of lignified 2CWs is found in vascular tissue, it is of great interest to identify specific laccases contributing to vascular lignification. To identify potential stem-specific laccases involved in lignification, Berthet et al. (2011) monitored the expression levels of Group A laccases in stem tissue, and found that LAC4 and LAC17 were strongly expressed. Phenotypic characterization of the single and double mutants lac4-1, lac4-2, lac17, lac4-1/lac 17, and lac4-2/lac17 revealed a subtle ‘irregular xylem’ (irx) phenotype in lac4-1 and lac4-2, which became more severe in the lac4-2/lac17 double mutant (Figure 1.2). This irx phenotype is characteristic of an altered 2CW composition (Turner and Somerville, 1997). To investigate this further, the researchers performed Klason lignin analysis, and found that the single and double mutants had modestly reduced lignin content, while lac4-2 lac17 had the greatest reduction of nearly 40%. Further disruption of LAC11 in triple mutants resulted in extremely dwarfed plants with very low lignin in the roots, but normal lignification of the Casparian strip (Zhao et al., 2013). It therefore appears that at least some specific laccases make a substantial contribution to lignin polymerization in Arabidopsis stem tissues. 12   Figure 1.2 Characterization of stem cross-sections of laccase mutant lines laccase single and double mutant lines were previously characterized by Berthet et al. (2011). Fresh stem sections were cut from inflorescence stems and stained with toluidine blue. Arrows point to collapsed xylem vessels. Scale bar = 25µm.  Figure$1.2$Characterizing$stem$crossCsec5ons$of$laccase$mutant$lines$Laccase$single$and$double$mutant$lines$were$previously$characterized$in$Berthet$et#al.#(2011).$Fresh$stem$secQons$were$cu$from$inflorescence$stems$and$stained$with$toluidine.$Arrows$point$to$collapsed$xylem$vessels.$Scale$bar$=$25µm#B$$$$#lac4+1#A$$$$$ColU0$C$$$$#lac4+2# D$$$$#lac17#E$$$$#lac4+1/lac17# F$$$$#lac4+2/lac17#13  1.4 Research questions and objectives Oxidative enzymes, peroxidases and laccases, have been implicated in the polymerization of lignin, and mutant analyses have conclusively demonstrated a role for laccases in lignification of Arabidopsis stems. However, the oxidative enzymes that polymerize lignin in protoxylem TEs have not been defined. Microarray expression data from induced seedlings of VND7-GR indicates that LAC4 and LAC17 are two of the most highly upregulated genes after induction, while there were no corresponding highly upregulated peroxidases  (Table 1.1, modified from Yamaguchi et al., 2011). The following objectives were addressed to test the hypothesis that the spatial and temporal appearance of laccases in developing protoxylem TEs determines localized cell wall lignification of these domains: 1. Determine if laccases are necessary and sufficient for lignification of secondary cell walls of protoxylem TEs (Chapters 3 and 4) 2. Localize laccases to determine if proteins are targeted to lignifying domains (Chapter 5) 3. If laccases do traffic specifically to lignifying domains, establish whether this correlation remains when the deposition of the secondary cell wall domain is disrupted via cytoskeleton disruption. (Chapter 5) The completion of these objectives heavily relied on the inducible system in which protoxylem TE development could be studied using microscopy techniques. With induced VND7-GR plants, epidermal cells that are differentiating into protoxylem TEs could be imaged directly, as opposed to native TEs, which are buried deep within plant tissue.  To address the first objective, I generated plants expressing the VND7-GR construct in the double lac4-2/lac17 mutant background in order to study the lignification of protoxylem TEs that have disrupted 14  laccase function. I also wanted to test that these specific laccases were able to polymerize monolignols independently from other potential oxidative enzymes that are specific to protoxylem TEs. This was achieved by observing the lignification of cells ectopically expressing either LAC4 or LAC17. The major focus of my research aimed to localize laccases in protoxylem TEs by localizing LAC-mCherry fusion proteins in the inducible VND7-GR system. My results demonstrate that the spatial and temporal appearance of laccases in developing protoxylem TEs determines localized cell wall lignification of 2CW domains.  To better understand the targeting components defining the plasma membrane adjacent to 2CW domains, I disrupted MTs to test if 2CW proteins and 2CW carbohydrates, such as xylan, were mislocalized. Localization results confirm that MTs are required for establishing sites of 2CW deposition, but indicate that they are not required to control the deposition of 2CW components to this location.    15    Locus Alias Description 6d/0d AT3G16920 ATCTL2 Chitinase 1965 AT4G35350 XCP1 Cysteine-type endopeptidase 909.25 AT5G600 LAC17 Laccase 858.36 AT1G70500  Polygalacturonase, putative 692.76 AT1G24030  Protein kinase family protein 519.47 AT1G09440  Protein kinase family protein 512 AT3G52900  Unknown protein 489.5 AT2G46760  FAD-binding domain-containing protein 435.75 AT1G20850 XCP2 Cysteine-type peptidase 378.28 AT5G40020  Pathogenesis-related 378 AT3G50220  Unknown protein 357 AT2G27740  Unknown protein 280 AT1G05310  Pectinesterase family protein 261.66 AT4G18780 LEW2, IRX1, CESA8 Cellulose synthase/ transferase 242.92 AT2G380 LAC4, IRX12 Laccase 241.64 Table 1.1 Microarray analysis of gene expression in induced VND7-GR seedlings  Modified Table S2 from Yamaguchi et al. (2011) showing top 15 most up-regulated genes after six days of induction based on expression profiles for 300 putative genes under the control of VND7. 16  Chapter 2: Materials and methods  2.1 Plant material and growth conditions All plants used in this study were the Arabidopsis thaliana ecotype Columbia-0 (Col-0) wild-type. The lac4-1, lac4-2, lac17, lac4-1/lac17, lac4-2/lac17, pLAC4-GUS, and pLAC17-GUS lines were obtained from Dr. Richard Sibout and Dr. Lise Jouanin (INRA, France). Seeds of VND7-GR in wild-type background were obtained from Dr. Taku Demura (NAIST, Japan). Seeds of established homozygous lines were germinated on plates containing ½ MS medium (Murashige & Skoog, 1962) and 8% (w/v) agar. After four days of dark-treatment at 4 ºC, plates were transferred to continuous fluorescent illumination of 75-125 µmol m-2 s-1 at 21 °C. After seven days seedlings were transferred to soil (Sunshine Mix 4; SunGro), and grown in chambers with continuous fluorescent illumination of 230 µmol m-2s-1 at 21 ºC. Transgenic plant lines were selected for growth on ½ MS medium containing either 50 µg/ml kanamycin or 30 µg/ml hygromycin for a period of 7-14 days, until resistant phenotypes were evident. Transgenic lines were propagated as outlined above, until homozygous insertion lines were obtained for each.  2.2 DNA Extraction  DNA was isolated from one to two young rosette leaves by grinding tissue in a 1.5 mL Eppendorf tube containing 300 µl Shorty DNA extraction buffer (200 mM Tris, 400 mM LiCl, 25 mM EDTA, 1% SDS). DNA was precipitated from the supernatant using 300 µl isopropanol, and the pellet was cleaned using 500 µl 70% ethanol. The pelleted DNA was resuspended in 100 µl dH20, yielding concentrations ranging from 72.2 to 358.0 ng/µl.    17  2.3 Genotyping lac mutant lines Single and double mutant laccase lines were obtained from Dr. Richard Sibout and Dr. Lise Jouanin (INRA, France). Corresponding transfer-DNA (T-DNA) lines are listed in Table 2.1. Plants were genotyped to confirm homozygous insertion lines using primers designed by the Salk T-DNA Primer Design tool (http://signal.salk.edu/tdnaprimers.2.html) listed in Table 2.1. This generated gene-specific forward (F) or reverse (R) primers about the T-DNA insertion. Polymerase chain reactions (PCR) were set up using 3 µl extracted DNA in 10 µl MangoMix (Bioline), with 1.0 µM of both gene-specific primers and an insert-specific primer. Salk T-DNA lines were screened using the insert-specific primer LBb1.3, and the GabiKat line was screened using the insert-specific primer p08409. Amplified products were separated on a 1% agarose 1x TAE gel that was run at 95 v for 30 minutes. The presence of the F+R product of approximately 1 kb indicated a copy of the wild-type gene, while smaller fragments of approximately 400-500 bp were observed for T-DNA insertion amplicons. Plants that were homozygous insertion lines were used for subsequent analyses. Insertion line Primers used to screen Sequence 5’-3’ lac4-1 F TCCAAGGGAACATGACTTGAC SALK_051892 lac4-1 R TTCCACTACGAAAGCCACAAAC lac4-2 F ACATGTGAACAACCAAGCATG GABI_720G02 lac4-2 R GGGCTAATCCAGACTTAAGCG lac17 F ATTTCGGAAATTCCCTTCATG SALK_016748 lac17 R TTTGATCAGAACCTGGTCACC Salk insert LBb1.3 F ATTTTGCCGATTTCGGAAC GabiKat insert p08409 F ATATTGACCATCATACTCATTGC Table 2.1 Primers used to genotype lac mutant lines 18  2.4 Stem sectioning and staining for phenotyping Inflorescent stems were harvested from mature Arabidopsis plants. In most cases, tissue samples were fixed overnight in a 6:1 solution of ethanol and glacial acetic acid, before being slowly rehydrated using two subsequent overnight treatments in 50% ethanol and dH20. Hand sections were cut from the base of the stem and placed in dH20 until several sections were prepared for staining. Stained samples were observed using a Leica DMR microscope, and brightfield micrographs were obtained using OpenLab image software and QCapture digital camera (QImaging).  2.4.1 Toluidine blue  Sections were moved from dH20 to a welled-plate containing a 0.01% toluidine blue solution (Ted Pella Inc). Sections were stained for two to three minutes, until tissue turned blue and purple. Sections were washed in dH20 to remove excess stain before being mounted in dH20 for imaging.  2.4.2 Phloroglucinol staining for lignin Sections were placed onto a glass slide with dH20 before two-three drops of 10% phloroglucinol (Sigma Aldrich) in 95% ethanol were added to the slide. Two to three drops of concentrated hydrochloric acid (HCl) were placed on the slide to trigger the staining reaction. Samples were covered with a cover slip and allowed to react for an additional five minutes before being imaged.  2.5 Induction of Arabidopsis VND7-GR lines The inducible VND7-GR line was obtained from our collaborator, Dr. Taku Demura (NAIST; Japan). VND7-GR seedlings were grown on ½ MS media with 0.8% agar medium for seven days before transferring to a ½ MS liquid solution containing 10 µM DEX (DEX). As an 19  induction control, non-induced seedlings were transferred to a liquid ½ MS solution containing an equal amount of the DEX solvent, ethanol. The inducible VND7-GR in lac4-2/lac17 background seedlings were selected for on ½ MS plates containing 50 µg/ml kanamycin for 7-12 days prior to induction. The pLAC4-LAC4-mCherry and pLAC17-LAC17-mCherry in VND7-GR lines were grown on selective ½ MS plates containing 30 µg/ml hygromycin for 7-12 days prior to induction. Induction was performed for 18-72 hours, depending on the specific experimental protocol, while shaking at 80 rpm on an orbital shaker in continuous fluorescent illumination of 74-125 µmol m-2 s-1 at 21 °C.  2.6 Cloning of constructs All constructs were generated using Gateway® cloning technology (Life Technologies; USA).  2.6.1 Overexpression construct p35S:LAC4 and p35S:LAC17 Gene specific sequences were amplified from genomic DNA using KAPA HiFi HotStart ReadyMix (Kapa Biosystems). Full-length Gateway® attB adapter sequences were incorporated using the recommended two-step adapter PCR protocol. LAC-specific primers used in the first PCR amplification are listed in Table 2.3. Amplified products with full-length adapters were gel purified using the Qiagen Gel Extraction Kit (QIAGEN), eluting purified products in 30 µl dH2O. These products were cloned into the pDONR/Zeo vector and subsequently transformed into One Shot® TOP10 Chemically Competent E. Coli cells (Life Technologies) by heat-shocking cells for 30 seconds at 42 °C. Colonies were selected on low-salt Luria-Bertani (LB) solid medium containing 50 µg/ml Zeocin™ (Life Technologies) after overnight growth at 37 °C. Plasmids were extracted from resistant colonies grown in selective liquid media overnight at 37 °C using the QIAprep Spin Miniprep Kit (QIAGEN), and sequenced to verify the correct 20  sequence was in frame. The pDONR/Zeo-LAC4 or pDONR/Zeo-LAC17 vector was used in a subsequent LR reaction to clone the LAC-specific sequence into the pK2GW7 vector (Karimi et al., 2002) to create the final expression vector p35S:LAC4 or p35S:LAC17. The reaction was transformed into One Shot® TOP10 Chemically Competent E. Coli cells as outlined above, and colonies were selected for on media containing 100 mg/ml spectinomycin. Plasmids from resistant colonies were isolated and sequenced before being used in subsequent transformations. Primer Name 5’ – 3’ Sequence 35S LAC4 partial attB1 F AAAAAGCAGGCTGCATGGGGTCTCATATGGTTTG 35S LAC4 partial attB2 R AGAAAGCTGGGTCTTAGCACTTGGGAAGATCCTTAGG 35S LAC17 partial attB1 F AAAAAGCAGGCTGCATGGCGTTACAGCTACTC 35S LAC17 partial attB1 F AGAAAGCTGGGTCTCAGCATTTGGGCAAGTC Table 2.2 Primers used to amplify LAC4 or LAC17 with attB adapters 2.6.2 Fluorescently tagged laccase: pLAC17:LAC17-mCherry Gene-specific sequences were amplified from genomic DNA using KAPA HiFi HotStart ReadyMix (Kapa Biosystems). The recommended two-step adapter PCR protocol was modified using primers listed in Table 2.4 to amplify the pLAC17-LAC17 sequence with attB adapters. The first amplification of genomic DNA used primers located 200 bp upstream and downstream from the targeted sequence. The second amplification used primers with full attB  sequences and the targeted sequences for pLAC17 or the mutated stop codon of LAC17. Amplified products with full-length adapters were gel-purified using the NucleoSpin® Gel Clean-Up Kit (Macherey-Nagel), eluting purified products in 20 µl dH2O. These products were cloned into the pDONR/Zeo vector and subsequently transformed into One Shot® TOP10 Chemically Competent E. Coli cells (Life Technologies) by heat-shocking cells for 30 seconds at 42 °C. 21  Colonies were selected on solid LB medium containing 50 µg/ml Zeocin™ (Life Technologies) after overnight growth at 37 °C. Plasmids were extracted from resistant colonies grown in selective liquid media overnight at 37 °C using the QIAprep Spin Miniprep Kit (QIAGEN), and sequenced to verify the correct sequence was in frame. The pDONR/Zeo-pLAC17:LAC17 vector was used in the subsequent LR reaction to clone the LAC-specific sequence into the pMDC111-mCherry vector (Schuetz et al., Plant Physiology, submitted; Curtis and Grossniklaus, 2003) to create the final expression vector pLAC17:LAC17-mCherry. The reaction was transformed into One Shot® TOP10 Chemically Competent E. Coli cells as outlined above, and colonies were selected for on media containing 50 µg/ml kanamycin. Plasmids from resistant colonies were isolated and sequenced before being used in subsequent transformations.           2.7 Preparation and transformation of competent cells 2.7.1 Escherichia coli Vectors generated using Gateway® cloning technology (Life Technologies) were transformed into One Shot® TOP10 Chemically Competent E. Coli cells (Life Technologies). Cells were stored at -80 °C in 25 µl aliquots until thawing on ice before transformation. The BP  Primer Name Sequence 5’ – 3’ LAC17 Nested F TTCACCTAAAAGGTGGCTAGTT 1st   LAC17 Nested R CAGAAAACAGAGCTGTGCAA attB1 pLAC17 F GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACTTTACTACGTAGTAATTG 2st     No stop LAC17 attB2 R GGGGACCACTTTGTACAAGAAAGCTGGGTCGCATTTGGGCAAGTCT Table 2.3 Primers used to amplify pLAC17-LAC17 with attB adapters 22  or LR reaction was mixed with the thawed cells and allowed to incubate on ice for 30 minutes. Cells were transformed by heat-shocking at 42 °C for 30 seconds and immediately placing back on ice to recover. Liquid LB media (225 ml) was added to cells and cultures were grown on an orbital shaker at 250 rpm at 37 °C for one hour. Aliquoted cultures (50 µl and 250 µl) were spread on solid LB media containing a selective antibiotic (either 50 µg/ml Zeocin™, 50 µg/ml kanamycin, or 100 mg/ml spectinomycin), and resistant colonies were selected for after growing in the dark at 37 °C overnight. Subsequent overnight liquid cultures of resistant colonies were used for plasmid isolation using the QIAprepSpin Miniprep Kit (QIAGEN). Purified vectors were screened for gene-specific sequence and sequenced before subsequent transformations. 2.7.2 Agrobacterium tumefaciens Starter cultures of A. tumefaciens GV3101 were grown in 5 ml liquid LB media containing 50 µg/ml gentamycin on an orbital shaker at 205 rpm and 28 °C. The next day, 20 µl starter culture was used to inoculate 125 ml liquid LB media with 50 µg/ml gentamycin. Cultures were grown on an orbital shaker at 205 rpm and 28 °C overnight. Cells were pelleted and resuspended in a 20 ml 0.15 M NaCl solution, followed by a subsequent centrifugation and resuspension in 2 mL chilled 20 mM CaCl2. Cells were distributed in 200 µl aliquots and flash frozen in liquid nitrogen before storing at -80 °C. Vectors were transformed into A. tumefaciens using the freeze-thaw method. Cells were allowed to thaw on ice before adding 1-3 µg DNA to the cells and incubating on ice for 30 minutes. Cells were flash-frozen by submerging in liquid nitrogen for approximately ten seconds. Samples were placed at 37 °C until thawed. 1.0 mL liquid LB media was added to the cells, and cultures were grown on a shaker at 28 °C for 2-5 hours. Following this recovery and growth period, aliquots (50 µl and 200 µl) were spread onto solid LB plates containing 50 µg/ml 23  gentamycin and either 50 µg/ml kanamycin or 100 mg/ml spectinomycin. Plates were grown in dark conditions at 28 °C for 2-3 days, when resistant colonies had grown. Transformation of the correct vector into the bacteria was verified before using the transformed strain for Arabidopsis transformation. 2.8 Agrobacterium-mediated transformation of Arabidopsis  Starter cultures were grown by inoculating single strains of transformed A. tumefaciens into 50 ml Yeast Extract Broth media (YEB; 5.0 g bacto-peptone, 1.0 g yeast extract, 5.0 g beef extract, 5.0 g sucrose, 0.5 g MgSO4?7H2O, pH 7.0, dH2O made up to a final volume of 1 L) supplemented with 50 µg/ml gentamycin and either 50 µg/ml kanamycin or 100 mg/ml spectinomycin. Cultures were grown for 2-3 days on an orbital shaker set to 205 rpm and 28 °C. The entire starter culture was used to inoculate 450 ml YEB media before growing on an orbital shaker set to 205 rpm at 28 °C for 8 hours. Silvett L77 (100 µl) was added, and cultures were transferred to a larger beaker. Arabidopsis plants with numerous floral meristems were dipped into the Agrobacterium culture. Dipped plants were kept in dark humid conditions for 18 hours before being transferred back to normal growth conditions, until the plants underwent full senescence. These plants produced the primary transformant seeds, which were selected on solid ½ MS media containing the selection antibiotic.  2.9 Exogenous feeding of monolignols Seedlings ranging from 7 to 14 days old were incubated in liquid ½ MS media containing various concentrations of coniferyl alcohol (CA, Sigma-Aldrich) or γ-nitrobenzofuran-dye coniferyl alcohol (NBD-CA; Tobimatsu et al., 2011).  The induction and supply of NBD-CA to VND7-GR and VND7-GR in lac4-2/lac17 feed was performed by Dr. Mathias Schuetz following the protocol published in Schuetz et al., 2014 (Plant Physiology, submitted). In the CA 24  feed to 35S:LAC lines used for subsequent detection of lignin autofluorescence, 1.0mM CA solution was fed to seven-day-old seedlings for 24 hours while placed under continuous fluorescent illumination of 75-125 µmol m-2 s-1 at 21 ºC. Free monolignols were removed and seedlings were fixed in a 6:1 solution of methanol (MeOH) and glacial acetic acid for 1.5 hours. Following two subsequent rinses in 100% MeOH, samples were gradually rehydrated by transferring to a solution of 50% MeOH, and finally 100% dH2O. For the NBD-CA feed to 35S:LAC lines used for subsequent detection of fluorescently labeled lignin, two different concentrations of monolignol solutions were fed to seven-day-old seedlings for 24 hours while placed under continuous fluorescent illumination of 75-125 µmol m-2 s-1 at 21 ºC: ½ MS media containing either 0.1 mM CA and 0.01 mM NBD-CA, or 1.0 mM CA and 0.1 mM NBD-CA. Following this incubation was subsequent removal of unpolymerized monolignols and sample fixation as outlined above.   2.10 Disruption of microtubules with oryzalin Disruption of MTs with oryzalin treatment was performed on 7- to 14-day-old seedlings of Arabidopsis lines expressing the inducible VND7-GR construct. Simultaneous induction of protoxylem differentiation and disruption of MT function was achieved by growing seedlings in solutions of ½ MS liquid media containing 10 µM DEX and 5 µM oryzalin for 48-72 hours. 2.11 Western blot  Protein was extracted from rosette leaves of three primary transformants containing the pLAC4:LAC4-mCherry in the VND7-GR background. Tissues were induced as outlined above by placing three rosette leaves into 10 µM DEX in ½ MS liquid media for 24 hours before protein extraction was performed on induced tissue samples. Tissue was frozen with liquid nitrogen and ground using a mortar and pestle before being transferred to a 1.5 ml Eppendorf 25  tube.  Protein extraction buffer (1 ml; 100 mM p/Na (K) pH 7.0, 10 mM DTT, proteinase inhibitor tablet, made up to a final volume of 25 mL dH2O) was mixed with ground tissue. Solid material was pelleted using a microcentrifuge at maximum speed (14,200 rpm) at 4 °C, leaving extracted proteins in supernatant. To prepare protein extraction for the SDS-PAGE gel, 40 µl of extracted protein was mixed with 30 µl 5X SDS-PAGE sample buffer (0.312 M TRIS-HCl pH 6.8, 10% SDS, 0.05% bromophenol blue, 25% β-mercaptoethanol), and samples were boiled for five minutes. Cooled sample (25 µl was loaded into an 8% SDS-PAGE gel and it was run at 140 V for 70 minutes. Proteins were transferred from the gel to a polyvinylidene difluoride (PVDF) membrane in a semi-dry transfer system. Components of the transfer apparatus including the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, the PVDF membrane, and two transfer pads were prepared by soaking in SDS-PAGE transfer buffer (2.3 g glycine, 5.8 g TRIS, 0.37 g SDS, to 800 ml dH2O, fill to 1 L with MeOH) for 5-10 minutes. The PVDF membrane was pre-treated in MeOH for several seconds before placing into transfer buffer. Components were arranged as outlined for the Trans-Blot® SD Semi-Dry Transfer Cell (Bio-Rad), and proteins were transferred at 15 V for 40 minutes. Following the transfer, the PVDF membrane was rinsed with dH2O to prepare it for immunolabeling. The membrane was first blocked with a blocking solution of 3% BSA in Tris-buffered saline (TBS) 0.1% (v/v) Tween 20 (TBST) for one hour. Following three rinses in TBST, membranes were incubated overnight at 4 °C in a 1/1000 dilution of the primary antibody, Anti-mCherry Rat Monoclonal Antibody (Life Technologies; USA) diluted in TBST. Free primary label was washed from the membrane with five TBST washes before the membrane was incubated in a 1/2000 dilution of the secondary antibody, Goat anti-Rat IgG-HRP (Santa 26  Cruz Biotechnology) for one hour at room temperature. The membrane was rinsed three times with TBST before reacting with liquid substrate 3,3’,5,5’-tetramethylbenzidine (TMB, Sigma-Aldrich) to visualize bands. 2.12 Fixing samples with high pressure freezing Protocol was adapted from previously published method in Young et al. (2008). Samples of VND7-GR, VND7-GR in lac4-2/lac17, and pLAC4:LAC4-mCherry in VND7-GR were induced for time points ranging from 18-48 hours. Isolated hypocotyl tissue was submerged in the cryoprotectant,1-hexadecene, between two gold or silver A-Hats (Ted Pella).  Samples were high-pressure frozen using a Leica EM HPM 00 high-pressure freezer. Frozen hats and tissue were immediately transferred to frozen cryovials containing freeze substitution medium consisting of either 2% osmium tetroxide in 8% dimethoxypropane in acetone for morphology analyses or 0.25% glutaraldehyde and 2% uranyl acetate in acetone with 8% dimethoxypropane for subsequent immunohistochemistry analysis. Freeze substitution occurred over five days at -80 °C by placing samples in a metal holder submerged in acetone chilled by dry ice. After five days, samples were removed from the acetone and dry ice mix and gradually warmed to room temperature over an 18 hour period. Cryovials were removed from the metal holder, and excess fixative was removed with five rinses in anhydrous acetone. Samples were slowly infiltrated with resin by placing samples in increasing concentrations of resin in acetone over a three-day period. Samples that were fixed with osmium were embedded in Spurr’s resin (Spurr, 1969) in BEEM® capsules (Electron Microscopy Sciences), while samples that were fixed with glutaraldehyde were embedded in LR White resin (LR, London Resin Company) in Snap-Fit® gelatin capsules (Ted Pella).  27  2.13 Brightfield light microscopy Stem sections were stained with toluidine blue or phloroglucinol, as outlined above. Sections of resin-embedded material were heat-fixed to a glass slide, and stained with 1.0% toluidine blue. Samples were visualized using a Leica DMR microscope. Micrographs were taken with OpenLab imaging software and Qcapture digital camera (QImaging), and were subsequently analyzed using ImageJ (Abramoff et al., 2007) 2.14 Epifluorescence microscopy To detect lignin autofluorescence, seedlings were mounted in dH2O and visualized using a Leica DMR microscope equipped with a mercury arc lamp for ultraviolet (UV) excitation at 340-380 nm and filtered emission of wavelengths greater than 450 nm. Micrographs were taken with OpenLab imaging software and Qcapture digital camera (QImaging). 2.15 Spinning disc confocal microscopy The Perkin-Elmer UltraView VoX spinning disc confocal mounted on a Leica DMI6000 inverted microscope was used. Samples were mounted in dH2O and imaged using a Leica oil immersion 63X objective (Plan-Apo, NA 1.4). Micrographs were taken with a Hamamatsu 9100-02 CCD camera and analyzed with Volocity imaging software (Improvision). Excitation and emission filter settings used in specific experiments are listed below.  All images represent compiled Z-stacks unless otherwise noted.  2.15.1 Detecting signal from NBD-CA in polymerized lignin Live or fixed seedlings were mounted on a glass slide in dH2O. Green fluorescent protein (GFP) detection settings were used to detect the fluorescent dye (NBD), with excitation of 488 nm and emission filter of 525 nm. Acquisition settings: exposure = 632 ms, sensitivity = 170, and laser intensity = 13%.  28  2.15.2 Localization of LAC-mCherry Seedlings induced with DEX were mounted on a glass slide in dH2O. Red fluorescent protein (RFP) settings were used to detect the fluorophore from mCherry, with excitation of 561 nm and emission filter of 595 nm. Acquisition settings for LAC4-mCherry: exposure = 1 s, sensitivity = 183, and laser intensity = 20%. Acquisition settings for LAC17-mCherry: exposure = 800 ms, sensitivity = 150, and laser intensity = 15%.  2.15.3 Thick section immunolabeling The immunochemistry technique followed was modified from previously described protocol by Young et al. (2008). The samples were pLAC4:LAC4-mCherry construct plant lines that had been induced with DEX, and high pressure frozen and embedded in LR White resin. Sections were cut at 250 nm thickness on Leica Ultracut UCT Ultramicrotome, and fixed to a Teflon-coated glass slide (Electron Microscopy Sciences) by baking at low temperature (approximately 40 °C). A drop of 3% bovine serum albumin (BSA, Sigma-Aldrich) in TBST was placed into the sample well to block nonspecific protein binding for one hour. After washing away blocking solution with three TBST rinses, samples were incubated in primary antibodies for one hour. The rat-anti-mCherry monoclonal antibody (Life Technologies) and goat-anti-mCherry polyclonal antibody (SICGEN) were used to detect LAC4-mCherry by diluting in TBST at concentrations of 1:20 and 1:200. LM10 (rat-anti-xylan, Plant Probes) primary antibody in dilution of 1:36 was used as a positive control for 2CW labeling (McCartney et al., 2005). Unbound primary antibodies were washed away with five TBST rinses, and secondary antibody dilutions were incubated with samples for one hour. All secondary antibodies used were conjugated to Alexa Fluor® dyes (Life Technology) and used in dilutions of 1:100. The goat-anti-rat Alexa Fluor® 488 antibody was used to label rat-anti-mCherry and LM10 (rat-anti-29  xylan), while the donkey-anti-goat Alexa Fluor® 568 antibody was used to label goat-anti-mCherry. Excess secondary antibody was washed with TBST and slides were mounted in TBS buffer for imaging. Alexa Fluor® 488 signal was detected using GFP settings with an excitation of 488 nm and an emission filter of 525 nm. Acquisition settings for Alexa Fluor® 488: exposure = 685 ms, sensitivity = 159, and laser intensity = 12%. Alexa Fluor® 568 signal was detected using RFP settings with an excitation of 561 nm and an emission filter of 595 nm. Acquisition settings for Alexa Fluor® 568 using primary antibody in 1:20 concentration: exposure = 2 s, sensitivity = 104, and laser intensity = 30%. Acquisition settings for Alexa Fluor® 568 using primary antibody in 1:200 concentration: exposure = 2.5 s, sensitivity = 207, and laser intensity = 30%.  2.15.4 Whole mount immunolabeling  Seven-day-old seedlings of VND7-GR that were induced with DEX, or treated with both DEX and oryzalin, were fixed in a solution of 4% paraformaldehyde, 50 mM PIPES, 5 mM MgSO4, and 5 mM EGTA overnight. Following two washes in TBST, samples were stored in TBST buffer at 4 °C. Fixed samples were prepared for immunolabeling by exposing inner tissues by using a razor blade to make small, randomly placed incisions to help with antibody infiltration and transferring to a 96-well culture plate for incubation and rinses in solution. A 5% BSA blocking solution was used to block nonspecific protein binding for one hour. Samples were rinsed twice before incubating in primary antibody dilutions overnight at 4 °C. To label xylan, a 1:36 dilution of LM10 (rat-anti-xylan) was used (McCartney et al., 2005). Excess primary antibody was washed away in five subsequent rinses with TBST before incubating samples with the secondary antibody, a 1:100 dilution of goat-anti-rat Alexa Fluor® 488, for one hour. After three rinses in 30  TBST, seedlings were stored in the dark in a solution of TBS buffer at 4 °C until imaged. After immunolabeling and prior to fixing, some samples were additionally labeled with Pontamine Fast Scarlet 4B (S4B), a fluorescent dye that specifically binds to cellulose microfibrils and is detected using RFP settings (Anderson et al., 2010). Acquisition settings for Alexa Fluor® 488: exposure = 685 ms, sensitivity = 159, and laser intensity = 12%. Acquisition settings for S4B: exposure = 706 ms, sensitivity = 157, and laser intensity = 10%. 2.16 Transmission electron microscopy immunogold labeling  Thin sections were cut from induced seedlings of VND7-GR or VND7-GR in lac4-2/lac17 embedded in LR White resin at 70 nm thickness on a Leica Ultracut UCT Ultramicrotome using a diamond knife. These were mounted on 200-mesh, fine bar, nickel grids (Ted Pella) coated in 0.3% formvar in 1,2-dichloroethane. Nonspecific protein binding was blocked by floating grids in a drop of 5% BSA solution in TBST for one hour. Excess blocking solution was removed by transferring grids to droplets of TBST for at least 10 seconds each. Primary antibodies were diluted in an antibody solution of 1% BSA in TBST at concentrations of 1:200 and 1:20. Rabbit-anti-LAC4 antibodies were provided to us from Dr. Richard Sibout and Dr. Lise Jouanin (INRA; France), and were previously used in Berthet et al. (2011) for whole-mount immunolabeling. As a positive control of 2CW label, LM10 (rat-anti-xylan) was used (McCartney et al., 2005). Samples incubated with primary antibodies for one hour at room temperature, before being rinsed five times in TBST, and moving to secondary antibody dilutions for an hour. The 10 nm colloidal gold conjugated to goat-anti-rabbit antibody (Ted Pella) was used to detect LAC4 (rabbit-anti-LAC4), while the 10 nm colloidal gold conjugated to goat-anti-rat antibody (Ted Pella) was used to detect xylan (LM10, rat-anti-xylan). Grids were subsequently washed three times in TBST and excessively in dH2O. Samples were post-stained 31  with 2% uranyl acetate in 70% MeOH for four minutes and Reynold’s lead citrate for two minutes. Grids were visualized and photographed using a Hitachi H7600 transmission electron microscope with AMT Advantage charge-coupled device camera. 32  Chapter 3: LAC4 and LAC17 are necessary for the lignification of secondary cell wall domains of protoxylem tracheary elements  3.1 Introduction Previous studies done by Berthet et al. (2011) identified two specific laccases, LAC4 and LAC17, involved in the lignification of the Arabidopsis stem, while Zhao et al. (2013) further demonstrated that a third laccase, LAC11, was also a key player. When T-DNA insertional mutants for LAC4 and LAC17 were characterized, stem-cross sections revealed a weak irx phenotype in lac4-1 and lac4-2 when grown under 24-hour light conditions, and the double mutant lac4-2/lac17 showed an extreme irx phenotype (Berthet et al., 2011). While it is known that these laccases play major roles in lignifying the stem, it is unclear if they serve other roles as oxidative enzymes in lignification in other cell types. Two independent promoter-GUS analyses were done by Berthet et al. (2011) and Turlapati et al. (2011) using pLAC4 and pLAC17 to drive the expression of the GUS reporter gene in order to identify tissues in which the LAC genes may be expressed. A vascular-specific expression pattern of pLAC4-GUS and pLAC17-GUS (Berthet et al., 2011) was also observed in the hypocotyl of seven-day-old seedlings in a previous study done in our lab by Dr. Mathias Schuetz (Figure 3.1). These analyses suggest that pLAC4 and pLAC17 may be active in a variety of tissues, in addition to the lignifying tissues of the stem.  This raises the question whether LAC4 and LAC17 are the major oxidative enzymes involved in lignification of other cell-types that develop 2CWs. In xylem tissue there are three cell types that develop a lignified 2CW with specific deposition patterns. Two of these three types, metaxylem vessels and xylary fibers, were represented in the earlier studies.  The objective of this study was to test if LAC4 and LAC17 are required for lignification of the third 33  xylem cell type, protoxylem TEs. The earlier studies in Arabidopsis stem analyzed the whole xylem tissue of stems, as well as extra-xylary fibers, cells with thick 2CWs over most of their surface.  In contrast, in protoxylem TEs, lignified 2CWs form spiral or annular patterns, with extensible primary cell wall between them.  In these cells, lignin polymerization must be restricted to the 2CW domains only, to permit expansion. Figure 3.1 pLAC-GUS expression in seedlings GUS (blue) detected in vascular tissue of hypocotyl when driven by 2-kb pLAC4 (A) or pLAC17 (B). Lines were provided by Dr. Richard Sibout and Dr. Lise Jouanin  (INRA, France).  3.2 Results To test if LAC4 and LAC17 are necessary for the lignification of protoxylem TEs, the VND7-GR inducible construct was transformed into the lac4-2/lac17 double mutant background. Stems were cut into cross-sections and subsequently stained using Toluidine Blue to confirm that the irx phenotype persisted with expression of the inducible construct (Figure 3.2). The degree of lignification of 2CW domains of induced protoxylem TEs in the mutant background was observed using two different techniques. First, UV autofluorescence was used to qualitatively A$ B$pLAC4:GUS* pLAC17:GUS*Col+0$ lac402/lac17* VND7+GR$in$lac402/lac17*A$ B$ C$34  assess if any differences could be seen between the autofluorescence signal from lignin in 2CW domains of induced VND7-GR compared to induced VND7-GR in lac4-2/lac17. Additionally the lignification of these induced lines was observed by detecting fluorescently labeled monolignols (NBD-CA) exogenously applied to the mutant lines, and observing the fluorescence of the NBD tag.  The inducible VND7-GR construct was provided to our lab by our collaborator Dr. Taku Demura (NAIST, Japan). I transformed the inducible construct into the lac4-2/lac17 background, with double mutant seeds provided to our lab by Dr. Richard Sibout and Dr. Lise Jouanin (INRA, France). I imaged the lignin autofluorescence in the lac4-2/lac17 double mutants, and Dr. Mathias Schuetz performed the NBD-CA feed to lac4-2/lac17 and performed the subsequent imaging.   Figure 3.2 Characterization of stem cross-sections of laccase double mutant expressing VND7-GR Cross-sections of inflorescence stems stained with toluidine blue. Collapsed xylem vessels indicated by arrow. (A) Wild-type, Col-0, shows normal vessel morphology and staining. (B & C) lac4-2/lac17 with or without VND7-GR exhibits collapsed xylem phenotype.  A$ B$pLAC4:GUS* pLAC17:GUS*Col+0$ lac402/lac17* VND7+GR$in$lac402/lac17*A$ B$ C$35  3.2.1 Detecting lignin with autofluorescence in lac4-2/lac17 protoxylem tracheary elements Seven-day-old seedlings carrying VND7-GR in wild-type or lac4-2/lac17 backgrounds were induced with DEX for 72h. Seedlings were imaged with an epifluorescence microscope using UV autofluorescence to qualitatively assess differences in lignin between the two genotypes.  2CWs of induced protoxylem TEs in the lac4-2/lac17 background developed normally, as can be seen in bright field images of samples that showed the spiral or banded wall pattern (Figure 3.3 E & F). The intensity of the blue autofluorescent signal from induced lines of VND7-GR and VND7-GR in the mutant background varied greatly, and similar trends were seen for both. Autofluorescent signal from the 2CW was evident, but signal intensity varied greatly regardless of the genetic background line with no apparent trend (Figure 3.3 A-D). Furthermore, in non-differentiating cells, a diffuse blue autofluorescent signal was often observed in both backgrounds (Figure 3.3 A&B), suggesting that seedlings contain many phenolic compounds that autofluoresce blue whose incorporation is not due to laccase activity. Due to the levels of background autofluorescence and the variability in lignin autofluorescence detected in 2CWs within individual lines, I was unable to conclusively establish whether lignification of 2CWs of protoxylem TEs is affected by the disruption of LAC4 and LAC17. 36  Figure 3.3 Detecting lignin with autofluorescence in lac4-2/lac17 protoxylem tracheary elements Lines of VND7-GR (left) or VND7-GR in lac4-2/lac17 (right) were induced with DEX for 72 hours. Epifluorescence imaged using UV excitation. Intracellular autofluorescence indicated by asterisks (A-B). Arrows indicate 2CW thickening, with corresponding labels in bright field micrographs (E-F). Scale bar = 10 µm. $VND7+GR$$ $VND7+GR$in$lac402/lac17$*$*$A$C$B$D$F$E$37   3.2.2 Detecting lignin with fluorescently labeled NBD-CA in lac4-2/lac17 protoxylem tracheary elements Due to the unclear autofluorescence data regarding lignification of 2CWs of induced protoxylem TEs, confocal microscopy was used to detect fluorescently labeled lignin in induced VND7-GR in lac4-2/lac17 and wild-type backgrounds. A solution of unlabeled CA and fluorescently labeled NBD-CA was fed to seedlings during the DEX-induction phase. Fluorescently labeled monolignols were recently developed by our collaborators at UW-Madison in Dr. John Ralph’s lab (Tobimatsu et al., 2011). Following the monolignol feed, unpolymerized monolignols were washed away using methanol and samples were imaged using spinning disc confocal microscopy. Abundant signal of NBD-CA can be seen in the 2CWs of protoxylem TEs in induced VND7-GR in wild-type (Figure 3.4 A). This demonstrates that the fluorescently labeled monolignols are able to travel freely within the apoplast before polymerizing in the 2CW. Under the same conditions, only a faint signal can be seen in VND7-GR in lac4-2/lac17, indicating that there is a severe reduction in lignification of these protoxylem TEs with disrupted LAC4 and LAC17 function.  These data indicate that LAC4 and LAC17 are required for incorporation of monolignols into protoxylem 2CWs. 38  Figure 3.4 Detecting fluorescently labeled lignin in lac4-2/lac17 protoxylem tracheary elements Seedlings of VND7-GR in wild-type or lac4-2/lac17 genotypes were simultaneously induced with DEX and fed fluorescently tagged monolignol, NBD-CA. Fluorescently labeled lignin was detected after removal of unpolymerized monolignols.   3.3 Discussion It was previously demonstrated that LAC4 and LAC17 play a major role in the lignification of the Arabidopsis stem (Berthet et al., 2011). Expression analysis of these laccase promoters indicated specific expression in lignifying tissues within the stem, as well as vascular tissues in cotyledons and leaves (Berthet et al., 2011; Turlapati et al., 2011; unpublished data from Dr. Mathias Schuetz). Here we demonstrated that these laccases play a major role in lignification of the helica wall thickenings of protoxylem TEs. UV epifluorescence data was inconclusive in detecting any difference between autofluorescence of protoxylem TEs in wild-type and lac4-2/lac17 lines following VND7-GR induction. Regardless of the genetic background, autofluorescent signal detected in the 2CW of protoxylem TEs varied greatly (Compare Figure 3.3A&C and B&D). Furthermore, with the A$ B$VND7+GR$ VND7+GR$in$lac402/lac17$39  epifluorescence compound microscope, autofluorescent signals from many focal planes contribute to the image. The microscope has a thicker image plane, which allows signal from a greater tissue thickness to be detected, but can obscure signals from a single-cell thickness. This was problematic, as non-differentiating cells contained intracellular autofluorescent signal that could skew intensity signals for overlying differentiated cells (Figure 3.3 A&B). These intracellular signals are not unexpected, as members of the Brassicaceae family, including Arabidopsis, are known to accumulate autofluorescent phenolic compounds, such as sinapoyl malate, in epidermal cells (Chapple et al., 1992).  The use of fluorescently labeled monolignols and the use of a confocal microscope meant that the fluorescent signal was specifically lignin-related (and not due to other phenolics) as well as the out of focus fluorescent signals being excluded. Spinning disc confocal microscopy allowed us to isolate the fluorescently labeled lignin for a defined focal plane, so a severe reduction in polymerized NBD-CA fluorescent signal was seen in induced protoxylem TEs when LAC4 and LAC17 function was disrupted. While the fluorescently labeled feed demonstrated that LAC4 and LAC17 are necessary for the lignification of 2CWs of protoxylem TEs, we are still drawing this conclusion on an experiment that relied on an exogenously supplied artificial substrate. While it has been shown that the fluorescently labeled NBD-CA can polymerize into lignified cell walls of Arabidopsis and Pinus radiata plants (Tobimatsu et al., 2013), we could also address our question using a different type of microscopy to detect the UV autofluorescence signal of lignin polymerized from endogenous monolignols in 2CWs of protoxylem TEs. A UV laser could be used in two photon microscopy, where thin focal planes are imaged, minimizing detection of signal from underlying cells. Furthermore, a methanol extraction of the soluble phenolics would help eliminate autofluorescent vacuolar signals from soluble phenolics.   40  Our data demonstrates that LAC4 and LAC17 are necessary for the lignification of the specific xylem cell-type, protoxylem TEs. Promoter-GUS analyses indicated LAC expression occurs in several tissue types that develop lignified 2CWs. It would be of interest to investigate whether LAC4 and LAC17 play a major role in other cell-types, such as metaxylem TEs. This could be investigated in a very similar experiment by inducing trans-differentiation with VND6, and observing the lignification of metaxylem TEs when LAC4 and LAC17 function is disrupted. 41  Chapter 4: Ectopic expression of LAC4 or LAC17 is sufficient for lignification of primary cell wall domains  4.1 Introduction Although LAC4 and LAC17 are necessary for the lignification of protoxylem TEs, we have not shown that either of these laccases can act on their own to cause oxidative radical polymerization of lignin. For instance, these laccases may be generating nucleation sites, but other different oxidative enzymes, such as peroxidases, could be responsible for the bulk lignification.  To address the question of whether either LAC4 or LAC17 is sufficient to mediate lignification, I constitutively expressed LAC4 or LAC17 and tested for ectopic lignification of primary cell wall domains in cell types that do not typically develop a lignified 2CW.  Ectopic overexpression lines were generated using the constitutive 35S promoter to drive the expression of LAC4 or LAC17 in the wild-type, Col-0, background. Lignification of epidermal cell types was qualitatively assessed using fluorescence microscopy in two different approaches. In the first method, an epifluorescent compound microscope, with a mercury arc lamp for UV excitation (340-380 nm) and a long-pass emission filter (>450 nm), was used to detect lignin autofluorescence in any epidermal cells that may have become lignified following a feeding of exogenously supplied CA. The second method used spinning disc confocal microscopy to detect fluorescently labeled lignin that may have polymerized following exogenous application of fluorescently labeled NBD-CA. 42  4.2 Results 4.2.1 35S:LAC overexpression constructs partially rescue lac4-2/lac17 stem phenotype To generate plants that ectopically expressed LAC4 or LAC17, the constitutive 35S promoter was used to drive the expression of each gene. Overexpression constructs, 35S:LAC4 and 35S:LAC17, were transformed into wild-type, Col-0, as well as the lac double mutant (lac4-2/lac17). Stem cross sections were characterized after staining with toluidine blue or phloroglucinol.  Overexpression of LAC4 or LAC17 did not produce an observable phenotype in the stem tissues, as demonstrated by the similarity between wild-type and 35S:LAC4 or 35S:LAC17 sections (Panels A-D, Figure 4.1-4.2). When 35S:LAC4 or 35S:LAC17 was expressed in the lac4-2/lac17 background, partial complementation of the mutant irx phenotype was observed. There were very few partially collapsed xylem vessels observed in mutant lines expressing either 35S:LAC4 or 35S:LAC17 (arrows, Panels G-H, Figures 4.1-4.2). This is a nearly complete complementation, compared to the severely collapsed vessels seen in the double mutant background alone (Panels E-F, Figures 4.1-4.2). Interestingly, the reduced staining of IFFs in the double mutant line persisted when either 35S:LAC4 or 35S:LAC17 was expressed, indicating that the overexpression vectors failed to restore lignification of IFFs in the double mutant background, (asterisks, Figure 4.1 - 4.2).   43   Figure 4.1 Characterizing stem cross-sections of lines expressing 35S:LAC4 Stem cross-sections were stained with the lignin-specific dye, phloroglucinol (left), or toluidine blue (right). Collapsed xylem vessels indicated by arrows and hypolignified IFF indicated by asterisks. Scale bar = 25µm for all panels.  A$$$Col+0$C$$$35S:LAC4$in$Col+0$G$$$35S:LAC4*in$lac402/lac17$*B$$$D$$$H$$$E$$$lac402/lac17$ F$$$*44   Figure 4.2 Characterizing stem cross-sections of plants expressing 35s:LAC17 Stem cross-sections were stained with the lignin-specific dye, phloroglucinol (left), or toluidine blue (right). Collapsed xylem vessels indicated by arrows and hypolignified IFF indicated by asterisks. Scale bar = 25µm for all panels.   A$$$Col+0$*B$$$D$$$H$$$C$$$35S:LAC17$in$Col+0$G$$35S:LAC17$in$lac402/lac17$E$$$lac402/lac17$*F$$$45  4.2.2 Primary cell wall lignification assay in LAC overexpression lines using UV autofluorescence To determine if ectopic lignification was occurring in cells that do not typically lignify, but are ectopically expressing either LAC4 or LAC17, the monolignol CA was fed to 7-day-old 35S:LAC seedlings by growing the plants in the presence of 1 mM CA. Nonpolymerized monolignols were extracted and samples were fixed in a methanol and acetic acid solution. UV autofluorescence of polymerized lignin was detected using an epifluorescent compound microscope (Leica DMR) equipped with a mercury arc lamp capable of UV excitation. When seedlings were grown in the absence of exogenously supplied monolignols, no apparent differences in autofluorescent signals were detected between wild-type and either overexpression line. Under these control conditions, autofluorescent signal was only detected in vascular tissue in wild-type, 35S:LAC4, and 35S:LAC17 lines from endogenous lignin, illustrated by the signal from endogenous lignin in the exposed vascular tissue of the hypocotyl and root (Panel A, Figures 4.3 - 4.5), as well as the diffuse signal in the epidermis of the cotyledon from TEs buried deep within the cotyledon (Panel B, Figures 4.3 - 4.5).  When monolignols were fed to wild-type and overexpression seedlings, ectopic autofluorescent signals were observed in pavement cells of cotyledons of the 35S:LAC4 or 35S:LAC17 line. Autofluorescent signal from primary cell wall domains of pavement cells was detected in many single cells, or patches of cells, in overexpression lines, but very rarely in wild-type plants. A range of fluorescence intensities was observed for primary cell wall domains within any single line, but overall, the fluorescence of either overexpression line was stronger than the signal observed in any of the rare ectopically-lignified pavement cells found in wild-type (compare Panels D-F, Figure 4.3 to Figure 4.4 - 4.5). Signal intensities varied within the 46  primary cell wall domain of a single cell, with greater intensities observed at the inner curved edge of pavement cells (Panels E-F, Figures 4.4 - 4.5). This observation was true for all three lines, but was most prominent in overexpression lines. Furthermore, autofluorescent signal was not limited to the primary cell wall domains in these lignified pavement cells, as some diffuse and punctate intracellular signal was often observed (Panels E-F, Figures 4.3 and Panels D-F, Figures 4.4 - 4.5). These data indicate that ectopic lignification of primary cell wall domains of pavement cells occurs more frequently, and with a more intense autofluorescent signal, in lines ectopically expressing either LAC4 or LAC17 compared to wild-type.   47   Figure 4.3 Detecting lignin autofluorescence in wild-type No difference observed in lignin autofluorescence signal in native protoxylem TE exposed from hypocotyl when monolignols exogenously supplied (C) compared to without (A). No signal detected in pavement cells without exogenously supplied CA (B), but is observed in primary cell walls of pavement cells when CA supplied (D-F). Scale Bar = 25µm for all panels.  A$ B$C$ D$E$ F$48   Figure 4.4 Detecting lignin autofluorescence in plants expressing 35S:LAC4 A more intense autofluorescence signal is observed in native protoxylem TE exposed from the hypocotyl when monolignols (CA) are exogenously supplied (C) compared to without (A). Signal in the primary cell wall and intracellular content of pavement cells is observed when CA supplied (D-F). Scale Bar = 25µm for all panels. K$ L$ R$A$ B$C$ D$E$ F$49  Figure 4.5 Detecting lignin autofluorescence in plants expressing 35S:LAC17 A more intense autofluorescence signal is observed in native protoxylem TE exposed from the hypocotyl when monolignols (CA) are exogenously supplied (C) compared to without (A). Signal in the primary cell wall and intracellular content of pavement cells is observed when CA supplied (D-F). Scale Bar = 25µm for all panels. A$ B$C$ D$E$ F$50   4.2.3 Primary cell wall lignification assay in LAC overexpression lines using fluorescently labeled monolignols A similar method was used to address the question of whether LAC4 or LAC17 are sufficient for ectopic lignification of primary cell wall domains by assaying for fluorescently labeled lignin in wild-type, 35S:LAC4, and 35S:LAC17 lines fed with CA and fluorescently labeled CA, NBD-CA. Fixed samples were imaged using spinning disc confocal microscopy with excitation and emission filter settings for GFP detection. Signal from polymerized NBD-CA was detected in the primary cell wall domains of root epidermal cells in all lines, regardless of monolignol concentration. A much more intense signal was always observed in 35S:LAC4 or 35S:LAC17 lines compared to wild-type (Panels E&I, Figures 4.6-4.8). Fluorescence was detected in primary cell wall domains of pavement cells of 35S:LAC4 or 35S:LAC17 seedlings (Panel K, Figure 4.7 – 4.8), but was absent from wild-type (Figure 4.6 G & K). This observation was only true for seedlings fed the higher concentration of monolignols.  These data indicate that expression of LAC4 or LAC17 is sufficient for ectopic lignification of primary cell walls of epidermal cells when monolignols are exogenously supplied. 51   Figure 4.6 Detecting lignin polymerized from fluorescently labeled NBD-CA in wild-type Top row images represent root elongation zone. Bottom row images represent cotyledon epidermis. NBD-CA signal images shown in left column micrographs, and corresponding bright field micrographs are shown in the right column. NBD-CA only incorporates into root elongation zone (E & I). Scale bars = 13µm for all panels.   A$ B$ C$C$ D$ F$E$ F$ I$G$ H$ L$I$ J$ O$K$ L$ R$52   Figure 4.7 Detecting lignin polymerized from fluorescently labeled NBD-CA in plants expressing 35S:LAC4 Top row images represent root elongation zone. Bottom row images represent cotyledon epidermis. NBD-CA signal images shown in left column micrographs, and corresponding bright field micrographs are shown in the right column. Intense NBD-CA signal observed when NBD-CA supplied (E & I). Primary cell wall domains of pavement cells incorporate NBD-CA (K). Scale bars = 13µm for all panels.A$ B$ C$C$ D$ F$E$ F$ I$G$ H$ L$I$ J$ O$K$ L$ R$53   Figure 4.8 Detecting lignin polymerized from fluorescently labeled NBD-CA in plants expressing 35S:LAC17 Top row images represent root elongation zone. Bottom row images represent cotyledon epidermis. NBD-CA signal images shown in left column micrographs, and corresponding bright field micrographs are shown in the right column. Intense NBD-CA signal observed when NBD-CA supplied (E & I). Primary cell wall domains of pavement cells incorporate NBD-CA (K). Scale bars = 13µm for all panels.  A$ B$ C$C$ D$ F$E$ F$ I$G$ H$ L$I$ J$ O$K$ L$ R$54  4.3 Discussion By supplying exogenous monolignols to lines overexpressing LAC4 or LAC17, we have shown that ectopic lignification of primary cell walls occurs in cells that do not normally develop a 2CW but express either LAC gene. This demonstrates that both LAC4 and LAC17 are sufficient for lignification given the presence of monolignols. UV autofluorescence data indicated that overexpression of LAC4 or LAC17 led to ectopic lignification of primary cell walls of cotyledon pavement cells fed with CA. While some autofluorescent signal was observed in primary cell walls of pavement cells in wild-type, the autofluorescent signal from primary cell wall domains of pavement cells occurred with greater frequency and greater signal intensity in the overexpression lines.  This suggested that these laccases are sufficient for lignification on their own.   Detecting fluorescently labeled lignin in primary cell walls of cotyledon pavement cells confirmed the results of the first experiment more conclusively by detecting a specific fluorescent probe conjugated to a monomer of the polymerized lignin, and by capturing higher resolution micrographs of this fluorescence signal within a single focal plane in the confocal imaging. This confocal fluorescence microscopy minimized background fluorescent signal compared to fluorescence detected with the epifluorescent compound microscope. While they have been shown to polymerize in vitro, fluorescently labeled monolignols contain compounds not native to the plant. The similar results obtained by feeding native and fluorescently labeled CA were important in showing that fluorescently labeled monolignol was polymerized into the lignin polymer similarly to unlabeled CA.  An interesting trend in both experimental approaches was that ectopically lignified pavement cells tended to give off a more intense signal in some areas of primary cell wall 55  domains, which may indicate a targeting of laccases or other lignification components to specific sub-domains of the cell wall. Mature pavement cells consist of narrower, neck-like regions with alternating balloon-like lobes. The more intense lignin signal was consistently observed in these neck-like regions. Likened to the MT-rich zones of 2CW domains of protoxylem TEs, neck-like regions of pavement cells are characterized as MT-rich zones (Panteris et al., 1993), where abundant cell wall deposition occurs compared to adjacent lobed-domains (Kotzer and Wasteneys, 2006).  As noted in the NBD-CA feeding experiment, root epidermal cells incorporated NBD-CA into cell walls of overexpression lines. Since this was also observed in wild-type, with decreased signal intensity, ectopic lignification probably occurrs in these cells due to other oxidative enzymes that are normally expressed, and not due to LAC4 or LAC17 overexpression alone. If oxidative enzymes are normally expressed in these cells, then ectopic lignification is not unexpected, as it has been demonstrated that NBD-CA can move freely in planta and only becomes polymerized in lignifying domains (Schuetz et al., submitted).  56  Chapter 5: Laccase localization in developing tracheary elements 5.1 Introduction In Chapter 4, I demonstrated that the presence of LAC4 or LAC17 and a supply of monolignols are sufficient for lignification of the primary cell wall domain. Given that the fluorescently tagged monolignol experiments demonstrate that monolignols are mobile within the apoplast prior to polymerization in 2CW domains, it appears that local monolignol concentration is not the determining factor in specifying where lignin is deposited.  An alternative hypothesis is that the presence of LAC4 and LAC17 in the 2CW domains of protoxylem TEs triggers lignification only in these regions. The next objective of my research was to localize these laccases in protoxylem TEs to test if they are found specifically in lignified, 2CW domains.  In order to address this question, fluorescently tagged LAC proteins were generated, which had never been accomplished previously, and the proteins were expressed in plants carrying the inducible VND7-GR construct. The acid-stable red fluorescent protein, mCherry, was fused to the C-terminus of LAC4 or LAC17. The laccase family in Arabidopsis all contain predicted N-terminal secretory signal peptides (Turlapati et al., 2011); fluorescent constructs at the N-terminus are predicted to be cleaved by the removal of the N-terminal signal sequence, and therefore were not generated. Furthermore, it was important to use an acid-stable RFP variant, given the predicted localization of the laccase to the acidic environment of the apoplast.  If the hypothesis is true that LAC4 and LAC17 specifically localize to 2CW domains of protoxylem TEs, and not to primary cell wall domains, then there must be a targeting mechanism that specifically traffics LAC secretion to these domains.  Laccases are glycoproteins, and LAC4 and LAC17 have 14 and 15 predicted N-glycosylation sites, respectively (Turlapati et al., 2011). 57  Secretion and glycosylation of a protein, or protein complex, requires trafficking through the ER and the Golgi apparatus, in addition to post-Golgi vesicle trafficking to the 2CW domains. To test the predicted subcellular localization of LAC4 in the endomembrane system and cell wall, high-resolution localization was performed via immunolabeling techniques using two different approaches: immuno-gold labeling using anti-laccase antibodies, or immunofluorescence labeling using antibodies against the fluorescent protein fusion. One possible targeting mechanism of laccases to the plasma membrane at 2CW domains could be post-Golgi vesicles binding, directly or indirectly, to cortical MTs, as it has long been known that bundles of cortical MTs line the plasma membrane parallel to future sites of 2CW deposition (Hepler & Newcomb, 1964). In Arabidopsis suspension cultures induced for protoxylem TE differentiation, it was demonstrated that these MT bundles are essential in determining patterned 2CWs and in the deposition of the 2CWs (Oda et al., 2005). Furthermore, it was demonstrated that these MT bundles are essential for maintaining the localization of CSCs at 2CW domains of protoxylem TEs during deposition of 2CW cellulose (Wightman & Turner, 2008).  To address the question of whether vesicles containing 2CW components, such as xylan, LAC4 or LAC17, are targeted to 2CWs in a MT-dependent manner, I localized these components in differentiating protoxylem TEs with disrupted MT function. To localize LAC4 or LAC17, the fluorescently tagged proteins LAC4-mCherry or LAC17-mCherry were localized in DEX-induced seedlings of VND7-GR lines expressing either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry while simultaneously treated with the MT-disrupting drug oryzalin. To localize 2CW carbohydrates, LM10 was used in a whole-seedling immunofluorescence labeling of seedlings of VND7-GR that were simultaneously induced and treated with oryzalin. 58  Additionally, S4B was used to post-stain cellulose in the VND7-GR background under the same conditions to observe cellulose deposition.  Much of this work was done in collaboration with Dr. Mathias Schuetz, who cloned the pLAC4-LAC4-mCherry construct and helped with whole-seedling immunolabeling of VND7-GR seedlings. LAC4-mCherry complementation of the lac4-2/lac17 line is described in Scheutz et al. (submitted). The anti-LAC4 antibody used in TEM immunogold labeling or subcellular localization was provided to us by Dr. Richard Sibout and Dr. Lise Jouanin (INRA; France).   5.2 Results 5.2.1 LAC4-mCherry and LAC17-mCherry complement lac4-2/lac17 Constructs using native LAC promoters to drive the expression of genomic LAC sequence and a C-terminal mCherry tag (pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry) were cloned and transformed into VND7-GR or lac4-2/lac17 background. Stem sections of mature plants were characterized after staining with toluidine blue or phloroglucinol. Data for plants expressing pLAC4:LAC4-mCherry were published in Schuetz et al. (submitted), and are described below. Identical results were obtained for plants expressing pLAC17:LAC17-mCherry.  No observable differences from VND7-GR were seen when either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry was expressed in this background (Figure 5.1, Panels A-D). Compared to the lac4-2/lac17 collapsed xylem phenotype (Arrows, Figure 5.1, Panels E-F), plants in this background expressing either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry display restored, round xylem vessels (Figure 5.1, Panels G-H). Furthermore, a significant increase of phloroglucinol stain is observed in the IFFs of lac4-2/lac17 plants expressing pLAC17:LAC17-mCherry compared to the mutant background line (Figure 5.1, compare panels E & G).  59   Figure 5.1 Characterizing stem cross-sections of plants expressing pLAC17-mCherry Stem cross-sections were stained with the lignin-specific dye, phloroglucinol (left), or toluidine blue (right). Collapsed xylem vessels indicated by arrows and hypolignified IFF indicated by asterisks. When pLAC17:LAC17-mCherry was expressed in the mutant background, xylem vessels were round (G-H) and phloroglucinol staining of IFFs was restored (G). Scale bar = 25µm for all panels.   *A$$$VND7+GR$C$$$LAC17+mCherry$in$VND7+GR$G$$$LAC17+mCherry$in$lac402/lac17$B$$$D$$$H$$$E$$$lac402/lac17$ F$$$60  5.2.2 Localization of LAC4-mCherry and LAC17-mCherry  VND7-GR lines expressing either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry were induced for protoxylem differentiation, and mCherry signal was detected using spinning disc confocal microscopy under RFP settings. Signal was exclusive to the 2CWs of native TEs for both LAC4-mCherry and LAC17-mCherry lines (Panel A, Figures 5.2 - 5.3). In hypocotyl cells that had trans-differentiated into induced protoxylem TEs, signal was predominantly observed in the 2CWs (Panels B-C, Figure 5.2 - 5.3). It was evident that LAC-mCherry localization is specific to the 2CW, especially in comparison to the localization of other cell wall components. In VND7-GR seedlings that were induced and stained with the cellulose-specific S4B, predominant signal is seen in 2CW bands, but signal was also detected in the primary cell wall, which can be seen as the diffuse signal in intervening domains (Panel A, Figure 5.9). Unlike cellulose, which is found in both primary and 2CW domains, we only observed the LAC-mCherry signal in the distinct punctae of the 2CW (Panel C, Figure 5.2 – 5.3). This 2CW specificity of LAC-mCherry is very similar to that of the 2CW specific carbohydrate, xylan, which can be seen exclusively in the 2CWs of trans-differentiated protoxylem TEs after immunofluorescence labeling with LM10 (Panel C, Figure 5.9).  The timing of trans-differentiation is quite variable in the VND7-GR system, and LAC-mCherry signal was most obviously detected in 2CWs of cells that had differentiated and undergone PCD. LAC17-mCherry lines exhibited robust differentiation, and most cells had undergone PCD prior to imaging. However, signal from LAC4-mCherry was detected in nascent 2CW thickenings at the earliest differentiation stages when 2CW thickenings and intracellular content were evident in bright field images.  Given that LAC4 and LAC17 are secreted glycoproteins, they require trafficking through the ER and Golgi apparatus; however, LAC-61  mCherry intracellular signal observed in cells early in differentiation did not correspond to either of these organelles. In order confirm the specificity of laccase localization to 2CW domains of protoxylem TEs, and to visualize any post-Golgi trafficking of laccases to 2CW domains, subcellular localization using immunolabeling techniques and high-resolution TEM microscopy was performed on seedlings at early stages of differentiation.   Figure 5.2 Localization of LAC4-mCherry in protoxylem tracheary elements VND7-GR seedlings expressing pLAC4:LAC4-mCherry were induced with DEX for 48 hr. (A) LAC4-mCherry exclusively localizes to the 2CW of native protoxylem TE. (B-C) LAC4-mCherry specifically localizes to 2CW of induced protoxylem TEs of hypocotyl. (C) represents a single optical slice from the compiled z-projection image (B). Scale bar = 13µm.    Figure 5.3 Localization of LAC17-mCherry in protoxylem tracheary elements VND7-GR seedlings expressing pLAC17:LAC17-mCherry were induced with DEX for 48 hr. (A) LAC17-mCherry exclusively localizes to the 2CW of native protoxylem TE. (B-C) LAC17-mCherry specifically localizes to 2CW of induced protoxylem TEs of hypocotyl. (C) represents a single optical slice from the compiled z-projection image (B). Scale bar = 13µm.   A$ B$ C$A$ B$ C$A$ B$ C$A$ B$ C$62  5.2.3 Subcellular localization of LAC4 An antibody raised against LAC4 (anti-LAC4; Berthet et al., 2011) was used in TEM immunogold labeling of sections of VND7-GR or VND7-GR in the lac4-2/lac17 background to detect the endogenous LAC4. As a positive control for the immunogold labeling technique, the antibody LM10 was used to label xylan. LM10 label was detected specifically in 2CWs of induced protoxylem TEs in both VND7-GR and VND7-GR in lac4-2/lac17 backgrounds (Panels A-B, Figure 5.4). LAC4 signal was detected in primary and 2CWs, cytoplasm, and the vacuole. However, no LAC4 signal above background was detected in the negative control, VND7-GR in lac4-2/lac17 (Panels C-D, Figure 5.4).  63   Figure 5.4 TEM immuno-gold labeling of xylan and LAC4 in protoxylem tracheary elements VND7-GR seedlings (left colum) or VND7-GR in lac4-2/lac17 seedlings (right column) were induced with DEX for 24 hours and embedded in LR White Resin. TEM immuno-gold labeling was performed on thin sections, using (A-B) LM10 to label xylan or (C-D) anti-LAC4. Gold conjugates are circled for emphasis.   Immunofluorescence was also used to detect LAC4-mCherry in induced seedlings of pLAC4:LAC4-mCherry in VND7-GR or VND7-GR using primary antibodies specific to mCherry. Immunohistochemistry was performed on thick sections cut from samples of LAC4-mCherry in VND7-GR or VND7-GR embedded in LR White resin.  No signal was detected in A$$VND7>GR$C$B$$VND7>GR$in$lac4&2/lac17$D$cytoplasm$vacuole$1°CW$2°CW$1°CW$2°CW$vacuole$cytoplasm$2°CW$1°CW$cytoplasm$cytoplasm$vacuole$vacuole$LM10$(xylan)$LAC4$64  either background when a monoclonal mCherry antibody (Life Technologies) was used at high concentrations (data not shown).  Western blot analysis using this antibody to detect LAC4-mCherry in protein extracted from leaf tissue of VND7-GR plants, with or without expression of  pLAC4:LAC4-mCherry, revealed that the antibody is able to detect the  mCherry antigen of LAC4-mCherry (arrow, Figure 5.5). When a polyclonal mCherry antibody (SICGEN) was used in the same thick section immunolabeling protocol, signal was observed in the 2CWs of both backgrounds with no difference in signal intensity under the same conditions (Panels A-D, Figure 5.6). This non-specific signal was not observed in either background when no primary antibody was used (Panels E-F, Figure 5.6). The cross-labeling observed was primarily in 2CW domains of induced protoxylem TEs (arrows, Panels A-B, Figure 5.6).   Figure 5.5 Western blot detecting mCherry from LAC4-mCherry VND7-GR plants Protein was extracted from rosette leaves that were induced with DEX for 24 hr. Samples were run on an 8%SDS-PAGE gel before transferring to membrane for western blot analysis. Monoclonal anti-mCherry (Life Technologies) was used to detect LAC4-mCherry, which can be seen around 120 kDa (arrow). kDa$250$130$100$70$LAC4>mCherry$in$VND7>GR$$ VND7>GR$$1$ 2$ 3$65   Figure 5.6 Immunofluorescence using polyclonal mCherry antibody to label LAC4-mCherry in protoxylem tracheary elements VND7-GR seedlings with LAC4-mCherry (right) or without (left) were induced with DEX for 36 hr. Hypocotyls were high pressure frozen and embedded in LR White resin. Immunofluorescence labeling using polyclonal mCherry antibody and Alexa Fluor® 565 on thick sections . Scale bar (A-D) = 13.0 µm. Scale bar (E-F) = 42.0 µm.  VND7>GR$ LAC4>mCherry$in$VND7>GR$1:20$1:200$!$A$ B$C$ D$E$ F$66  5.2.4 Localization of LAC4-mCherry or LAC17-mCherry in protoxylem tracheary elements with disrupted microtubule function To localize LAC4-mCherry or LAC17-mCherry in cells in which MTs were disrupted, VND7-GR lines expressing either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry were simultaneously induced for protoxylem TE differentiation and treated with 5µM of the MT disrupting drug, oryzalin, for 48 hours. As a control, VND7-GR lines were treated in the same conditions and post-stained with the cellulose-specific stain S4B. mCherry and S4B fluorescent signal was detected using spinning disc confocal microscopy with RFP settings.  mCherry signals detected in VND7-GR lines expressing either pLAC4:LAC4-mCherry or pLAC17:LAC17-mCherry under MT-disrupting conditions were vastly different compared to control conditions (Panels B compared to D&F, Figures 5.7-5.8). For both LAC4-mCherry and LAC17-mCherry, signal detected under normal induction conditions is in distinct 2CW banding patterns (solid arrows, Panel B, Figures 5.7-5.8). However, with oryzalin treatment, signal from both LAC4-mCherry and LAC17-mCherry was detected in the primary cell wall, as well as disorganized strands (dashed arrows, Panels D&F, Figure 5.7 - 5.8). Interestingly, signal was also seen in donut-shaped structures (arrowheads, Panel F, Figure 5.7 – 5.8). In VND7-GR seedlings stained with S4B, similar signal patterns were seen: under normal induction signal was detected primarily in distinct 2CW banding pattern (solid arrows, Panel A, Figures 5.7 – 5.8), but when the seedlings were simultaneously treated with oryzalin, signal was found in disoriented bands (dashed arrows, Panel C, Figures 5.7 – 5.8) or in donut-shaped structures (arrowheads, Panel E, Figures 5.7 – 5.8).  67   Figure 5.7 Localization of LAC4-mCherry in protoxylem tracheary elements when microtubule function is disrupted VND7-GR seedlings with LAC4-mCherry (right column) or without (left column)  Were induced with DEX and oryzalin for 48 hr. Samples of VND7-GR were post-stained for cellulose with S4B. With oryzalin treatment, cellulose and LAC4-mCherry signal is detected in disoriented bands (dashed arrows, C-D), or aberrant donut-shaped structures (arrowheads, E-F). Scale bar = 13 µm.  ^$ ^$^$^$VND7>GR$$+DEX$+DEX$+5μM$Oryzalin$LAC4>mCherry$in$VND7>GR$A$ B$C$ D$E$ F$LAC4(+mCherry)$Cellulose$(S4B)$^$^$^$^$68   Figure 5.8 Localization of LAC17-mCherry in protoxylem tracheary elements when microtubule function is disrupted VND7-GR seedlings with LAC17-mCherry (right column) or without (left column)  Were induced with DEX and oryzalin for 48 hr. Samples of VND7-GR were post-stained for cellulose with S4B. With oryzalin treatment, cellulose signal and LAC1-mCherry signal is detected in disoriented bands (dashed arrows, C-D), or aberrant donut-shaped structures (arrowheads, E-F). Scale bar = 13 µm.  VND7>GR$ LAC17>mCherry$in$VND7>GR$^$^$^$^$ ^$^$^$+DEX$+DEX$+5μM$Oryzalin$Cellulose$(S4B)$A$ B$C$ D$E$ F$LAC17(+mCherry)$69  5.2.5 Localization of xylan in protoxylem tracheary elements with disrupted microtubule function Since laccases, which are thought to be secreted by post-Golgi vesicles, were found in disorganized structures in protoxylem with disrupted MTs, I hypothesized that other post-Golgi cargo such as hemicelluloses would show similar patterns after MTs were disrupted. To localize the 2CW-specific hemicellulose, xylan, in protoxylem TEs, the antibody LM10 was used on VND7-GR seedlings that were simultaneously induced and treated with oryzalin using whole-seedling immunolabeling. Signal was detected using spinning disc confocal microscopy with GFP settings following LM10 treatment and label with secondary antibody tagged with an Alexa Fluor® 488 probe. Under normal induction conditions, xylan was detected in the periphery of the 2CW of induced protoxylem TEs of VND7 (solid arrows, Panel C, Figure 5.9). This signal tracked the cellulose signal observed under the same conditions (Panel E&G, Figure 5.9).  After oryzalin treatment, xylan signal was detected along the periphery of disoriented bands and donut-shaped structures (dashed arrows and arrowheads, Panel D, Figure 5.9). While the localization of the signal was disrupted with oryzalin treatment, co-localization of xylan and cellulose revealed that xylan continued to track the cellulose signal (Panel F&H, Figure 5.9). Given the mislocalization of 2CW proteins and 2CW carbohydrates to similar aberrant donut-shaped structures, this suggests that MTs are required for establishing proper 2CW domains, but are not required for the targeting of cell wall components to these domains. 70   Figure 5.9 Whole seedling immunolabeling of xylan and cellulose in protoxylem tracheary elements when microtubule function is disrupted VND7-GR seedlings were treated with DEX and oryzalin for 48hr. Seedlings were fixed using paraformaldehyde, and immunofluorescence labeling of whole-seedlings was performed using LM10 conjugated to Alexa Fluor® 488. Samples were post-stained for cellulose with fluorescent stain, S4B. Scale bars A-F = 12.0 µm; G-H = 3.02µm.   5.3 Discussion Complementation of the lac4-2/lac17 stem phenotype demonstrated that the fluorescently tagged laccases were functional in planta. Furthermore, expression of pLAC17:LAC17-mCherry in the double mutant background was able to restore lignification of IFFs (Panel G, Figure 5.1), while expression of p35S:LAC17 failed to restore this lignification (Panel G, Figure 4.1-4.2). While we cannot rule out that expression of the fluorescent protein, mCherry, influenced the lignification of IFFs, it is more probable that the native laccase promoter plays a regulatory role in its expression. This is not completely unexpected, as it has been demonstrated that the 3’-UTR A$B$C$D$E$F$G$H$+DEX$+DEX$+Oryzalin$Cellulose$(S4B)$ Xylan$(LM10)$ Overlay$^$^$71  of LAC17 was required for full complementation of the lignin phenotype of the Arabidopsis stem of the mutant (Berthet et al., 2011).   By using fluorescence microscopy to localize fluorescently tagged laccases in the inducible VND7-GR system, I demonstrated that LAC4 and LAC17 specifically localize to the 2CWs of protoxylem TEs. The VND7-GR inducible system allowed high resolution imaging of induced epidermal cells that had differentiated into protoxylem TEs (Panels B-C, Figures 5.2 – 5.3). Typically native TEs are buried deep within the plant tissue; however, the intense fluorescent signal from LAC-mCherry was detected in native TEs that were either close to the surface, or exposed from tissue, confirming the localization specificity of both LAC-mCherry proteins (Panel A, Figures 5.2 – 5.3). This data demonstrates that LAC4 and LAC17 correlate to the time and place of lignification. An anti-LAC4 antibody previously used in immunofluorescence labeling of inflorescent stem sections (Berthet et al., 2011) was not specific enough to detect endogenous LAC4 using TEM immunogold labeling. Xylan was labeled as a positive control for 2CW labeling, and in both backgrounds it was detected specifically in the 2CW, so the technique is effective when the primary antibody is specific (Panels A-B, Figure 5.4). However, signal detected when using the anti-LAC4 antibody to label endogenous LAC4 in induced samples of VND7-GR failed to produce any signal above that observed in the double mutant knockout background (VND7-GR in lac4-2/lac17) (Panels C-D, Figure 5.4). Given that signal was detected in the double mutant background, where LAC4 expression is knocked-out (Berthet et al., 2011), the antibody does not appear to be specific to LAC4.  In a separate effort to address the subcellular localization of LAC4, an additional immunolabeling experiment was performed on thick sections of VND7-GR samples. Instead of 72  localizing endogenous LAC4, we used primary antibodies against mCherry to label LAC4-mCherry in VND7-GR seedlings induced for protoxylem TE differentiation. Neither the monoclonal mCherry antibody (Life Technologies), nor the polyclonal mCherry antibody (SICGEN) had previously been used to immunolabel resin-embedded plant material. Therefore, thick sections of samples were labeled to identify any non-specific labeling before attempting subcellular localization with TEM immunogold labeling. Even with a high primary antibody concentration, no signal was detected for the monoclonal mCherry AB (data not shown). To verify that the antibody was functional, western blot analysis was performed on protein extracts from leaf tissue of VND7-GR plants expressing pLAC4:LAC4-mCherry. Based on the amino acid sequence of LAC4-mCherry, the expected size of the fluorescently tagged protein is 86 kDa. However, given the numerous glycosylation sites predicted for this glycoprotein (Turlapati et al., 2011), a larger size was expected. As seen in the western blot, a band around 120 kDa was detected in three different lines of VND7-GR expressing pLAC4-LAC4-mCherry, and was absent from VND7-GR (Figure 5.5). These data showed that the antibody was able to detect LAC4-mCherry. However, this antibody may not exclusively detect the fluorescent protein, as several non-specific bands of lower weights were detected in all backgrounds, indicating the primary antibody is recognizing an antigen unrelated to mCherry. Given this lack of specificity, it is unusual that no signal above noise was observed when the antibody was used at high concentrations for thick section immunolabeling, as the western blot demonstrated that it is able to recognize several antigens in samples not expressing pLAC4:LAC4-mCherry. Taken together, these data showed that the monoclonal anti-mCherry antibody was functional and able to detect the mCherry antigen with western blot analysis, but was not suitable for immunolabeling of sections. The monoclonal mCherry antibody recognizes a single antigen, so next a polyclonal 73  mCherry antibody was used (SICGEN) to label the same samples in a similar thick section immunofluorescence labeling experiment, as outlined above. Regardless of primary antibody concentration, signal was detected at equal intensities in samples of VND7-GR seedlings expressing pLAC4:LAC4-mCherry and those without mCherry expression (Figure 5.6). This indicates that the polyclonal mCherry antibody is recognizing a non-specific antigen within the VND7-line, and is not suitable for immunolabeling of samples embedded in LR White. This signal was always detected in 2CWs of induced protoxylem TEs, which could mean that the antibody is recognizing a specific 2CW antigen found in all protoxylem TEs.  While I was unable to further confirm the subcellular localization of LAC4, the specific localization of the fluorescently tagged laccases was evident from live-cell imaging alone. This specific secretion to secondary, but not primary, cell wall domains suggests targeted trafficking of LAC4 and LAC17 to these domains. A role for cortical MTs in determining 2CW pattern determination was previously demonstrated (Oda et al., 2005). To investigate if MTs play a role in the targeted secretion of LACs to 2CW domains, we localized fluorescently tagged LACs in VND7-GR plants that were simultaneously induced with DEX and treated with the MT disrupting drug oryzalin. Under these conditions, LAC-mCherry was localized to disoriented, fragmented bands and aberrant, donut-shaped structures (Figure 5.7 -5.8). Since we previously demonstrated that laccases are necessary and sufficient for lignification of cell wall domains given the presence of monolignols (Chapters 3 & 4), we hypothesize that these aberrant domains that LAC-mCherry localizes to would also be lignified. To test this hypothesis, a co-localization study could be performed to detect LAC-mCherry and fluorescently labeled lignin in seedlings of LAC-mCherry in VND7-GR treated with oryzalin, induced with DEX, and fed fluorescently labeled monolignols.  74  Under the MT disrupting conditions, the 2CW carbohydrates, xylan and cellulose, were also co-localized to similar looking, aberrant domains (Figure 5.9). Given that 2CW components are mislocalized to similar aberrant domains when differentiating protoxylem TEs are treated with oryzalin, but 2CW carbohydrates continue to maintain their deposition patterns in these locations, I interpret these data as showing that MT function is required for establishing proper 2CW domains, but once a domain is established, the MTs are not required for the vesicle targeting to these domains.  The mislocalized 2CW components showed a range of phenotypes, some cells contained only disoriented bands, and other only contained donut-shaped structures, but most cells exhibited a mix of both structures. Occasionally individual cells also displayed normal 2CW banding patterns and deposition. Since MTs establish 2CW domain patterns (Oda et al., 2005), it is possible that residual MTs that remain after oryzalin treatment help establish the aberrant structures we observe. In this scenario, the remaining MTs would establish the aberrant 2CW domains, but the targeting mechanism that directs the deposition of 2CW components would still be intact. This could explain the variety of phenotypes we observe, as individual cells would display different phenotypes depending on their resistance to oryzalin disruption. Furthermore, the varieties of phenotypes are likely influenced by the efficiency of protoxylem TE induction. A temporal study of oryzalin treatment on inducing seedlings would make an interesting study to investigate the effects on the deposition of 2CW components if MTs are disrupted prior to protoxylem differentiation (oryzalin treated prior to DEX induction) compared to the deposition if 2CW domains are established prior to MT disruption (DEX induction prior to oryzalin treatment).  75  Chapter 6: Conclusion My MSc research aimed to test the hypothesis that the spatial and temporal appearance of laccases in developing protoxylem TEs determines localized cell wall lignification of these domains. A conclusive role of laccases in the lignification of the Arabidopsis stem was recently demonstrated (Berthet et al., 2011; Zhao et al., 2013). However, the oxidative enzymes that polymerize lignin in protoxylem TEs had not been defined. The major objectives of my research were to: 1. Determine if laccases are necessary for the lignification of secondary cell walls of protoxylem TEs 2. Test if ectopic laccase expression is sufficient for lignification of primary cell walls 3. Localize laccases to determine if proteins are targeted to lignifying domains 4. Elucidate mechanisms involved in the targeted secretion of secondary cell wall components In Chapter 3, I demonstrated that LAC4 and LAC17 are necessary for the lignification of 2CWs in protoxylem TEs. Protoxylem TEs lacking LAC4 and LAC17 function showed a reduced incorporation of fluorescently labeled monolignols in 2CWs. This implies lignification of these domains is reduced, and that LAC4 and LAC17 are necessary for lignification of protoxylem TEs. Given the major role these laccases play in lignification of this specific cell type, it is possible they may also play a major role in the lignification of metaxylem TEs. VASCULAR-RELATED NAC-DOMAIN6 was identified as a master regulator transcription factor leading to metaxylem TE differentiation (Kubo et al., 2005), and an inducible construct, 35S:VND6-GR, was generated (Yamaguchi et al., 2010). To test the hypothesis that laccases determine the lignification of 2CW domains in metaxylem TEs, fluorescently labeled lignin 76  could be detected to qualitatively assess any differences in lignification in plants expressing the inducible VND6-GR in the lac4-2/lac17 background after inducing and supplying with fluorescently labeled monolignols.  To rule out the possibility that LAC4 or LAC17 were simply necessary cofactors in the lignification of protoxylem TEs, in Chapter 4, I demonstrated that laccases are also sufficient to promote lignification in the presence of monolignols in planta. The constitutive 35S promoter was used to drive either LAC4 or LAC17 expression in wild-type plants, resulting in strong ectopic lignification of primary cell wall domains in epidermal cells, when given a supply of monolignols. These data indicate that LAC4 and LAC17 are capable of mediating lignification, and are consistent with the model that they are the primary oxidative enzymes responsible for lignification of 2CWs in protoxylem TEs. A third laccase, LAC11, was recently identified as a redundant oxidative enzyme required for lignification in the stem (Zhao et al., 2013). Unlike LAC4 and LAC17, whose expression is highly upregulated by the protoxylem TE-specific transcription factor, VND7; LAC11 is preferentially activated by the fiber-specific transcription factor SND1 (Ohashi-Ito et al., 2010; Zhao et al., 2013). To rule out the possibility that LAC11 plays a major role in the lignification of protoxylem TEs, lignification of protoxylem TEs lacking LAC11 and LAC4 or LAC17 function could be qualitatively assessed. This could be addressed by inducing protoxylem TE differentiation in double-mutant lines lac4/lac11 and lac11/lac17 expressing VND7-GR that are supplied with fluorescently labeled monolignols (NBD-CA).  In Chapter 5, I localized fluorescently tagged laccases in protoxylem TEs specifically to 2CW domains. This demonstrates the spatial and temporal appearance of laccases in developing protoxylem TEs is perfectly correlated with localized cell wall lignification of these domains. This supports the emerging model in which monolignols are exported to all areas of the apoplast, 77  rather than a specific domain, and only polymerize in the presence of an oxidative enzyme.  It is evident monolignols are free to diffuse through the apoplast, as NBD-CA only incorporated into transdifferentiating leaf mesophyll cells in seedlings of induced VND7-GR. Furthermore, there is no indication that monolignol secretion to the apoplast is targeted to 2CW domains, as neither GFP-tagged monolignol biosynthetic enzymes nor the putative monolignol transporter, ABCG29, specifically localized to 2CW domains (Schuetz et al., Plant Physiology, submitted). The model of specific oxidative enzymes localizing exclusively to lignifying subcellular domains is further supported by the recent characterization of lignification of the Casparian strip. Lee et al. (2013) demonstrated that the Casparian strip was compromised and became permeable, when endodermis-specific artificial micoRNA was used to knockdown expression of PRX64, an endodermis specific peroxidase. They further showed that the subcellular localization of this peroxidase to the lignified domain was dependent on CASP1 suggesting that this oxidative enzyme is required for specific lignification of the Casparian strip and its localization depends on regulatory proteins. Future laccase localization studies should focus on trafficking of laccases to 2CW domains in protoxylem TEs through the secretory pathway by characterizing laccase-containing vesicles. There is a high flux of Golgi-derived vesicle traffic to 2CW domains in developing protoxylem TEs (Wightman and Turner, 2008) that deliver 2CW carbohydrates. Given that laccases are localized to early-development 2CW domains in protoxylem TEs, it is plausible that these 2CW specific proteins are secreted simultaneously with 2CW carbohydrates. While cytoskeleton elements have been demonstrated to play a role in establishing 2CW deposition patterns, the molecular mechanisms that specify targeted vesicle secretion of components to the plasma membrane domains underlying the wall thickenings have not been identified. The 78  increased secretion at these MT-lined domains could represent a transient reorientation of vesicle trafficking during protoxylem TE differentiation, similar to the proposed mechanism for the directed delivery of plasma membrane proteins to the periarbuscular membrane during arbuscular mycorrhizal symbiosis in Medicago (Pumplin et al., 2012).  In Chapter 5, I also demonstrated that 2CW components (proteins and carbohydrates) were mislocalized to similar-shaped aberrant structures when cortical MT function was disrupted in differentiating protoxylem TEs. However, all of the 2CW carbohydrates were similarly mislocalized in their deposition pattern in these locations. This suggests that MTs are required for establishing proper 2CW domains, but are not required for the targeting of cell wall components to these domains. To confirm this hypothesis, temporally regulated studies could be done using oryzalin treatment at various time-points before or after induction of protoxylem TEs. MTs are not the only cytoskeleton component that plays a role in 2CW development in protoxylem TEs. It was demonstrated that either MT-disruption or actin-disruption of developing protoxylem TEs led to the loss of localized CSCs at the plasma membrane beneath the 2CW (Wightman & Turner, 2008). An actin-dependent targeting mechanism of LACs could be tested by localizing LAC-mCherry in seedlings of LAC-mCherry in VND7-GR simultaneously treated with DEX for protoxylem TEs induction, and latrunculin B, for actin-depolymerization.  Actin has been demonstrated to play a role in the trafficking of CSCs to the plasma membrane at 2CWs in protoxylem TEs (Wightman & Turner, 2008). This could be investigated by treating differentiating seedlings of LAC-mCherry VND7-GR with the actin-disrupting drug, latrunculin B, and localizing 2CW specific components, laccases and xylan. The goal of my MSc research was to test the hypothesis that laccases determined the specific deposition of lignin in 2CW thickenings, while intervening primary cell walls remained 79  lignin-free in protoxylem TEs. This specific pattern of deposition is essential for protoxylem TEs to facilitate water transport to young and expanding plant organs. In order to investigate this, two new technologies were used. First, the VND7-GR inducible protoxylem system in Arabidopsis was used, which allowed direct visualization of the lignification process in an experimental system with rich transcriptomic and molecular genetic resources. Furthermore, use of fluorescently tagged monolignols allowed for fluorescence imaging of lignin. Localization of the fluorescently tagged laccase, LAC-mCherry, revealed that these proteins correlate spatially and temporally to lignifying domains. Loss of LAC4 and LAC17 function leads to loss of lignification, while over expressing LAC4 or LAC17 lead to ectopic lignification if exogenous monolignols were supplied. This demonstrated that laccases are necessary and sufficient to determine the spatial distribution of lignin.80  Bibliography Abramoff, M. (2007). ImageJ as an image processing tool and library. Microscopy and Microanalysis, 13(2), 1672 - 1673.  Alejandro, S., Lee, Y., Tohge, T., Sudre, D., Osorio, S., Park, J., et al. (2012). AtABCG29 is a monolignol transporter involved in lignin biosynthesis. Current Biology  : CB, 22(13), 1207–12.  Anderson, C. T., Carroll, A., Akhmetova, L., & Somerville, C. (2010). Real-time imaging of cellulose reorientation during cell wall expansion in Arabidopsis roots. Plant Physiology, 152(2), 787–96.  Bao, W., O’malley, D. M., Whetten, R., & Sederoff, R. R. (1993). A laccase associated with lignification in loblolly pine xylem. Science (New York, N.Y.), 260(5108), 672–674.  Bashline, L., Lei, L., Li, S., & Gu, Y. (2014). Cell wall, cytoskeleton, and cell expansion in higher plants. Molecular Plant, 7(4), 586–600.  Berthet, S., Demont-Caulet, N., Pollet, B., Bidzinski, P., Cézard, L., Le Bris, P., et al. (2011). Disruption of LACCASE4 and 17 results in tissue-specific alterations to lignification of Arabidopsis thaliana stems. The Plant Cell, 23(3), 1124–1137.  Berthet, S., Thevenin, J., Baratiny, D., Demont-Caulet, N., Debeaujon, I., Bidzinski, P., et al. (2012). Role of plant laccases in lignin polymerization. Lignins (61st ed., Vol. 61, pp. 145–172). Elsevier Ltd.  Blee, K. A., Choi, J. W., O’Connell, A. P., Schuch, W., Lewis, N. G., & Bolwell, G. P. (2003). A lignin-specific peroxidase in tobacco whose antisense suppression leads to vascular tissue modification. Phytochemistry, 64(1), 163–176.  Boerjan, W., Ralph, J., & Baucher, M. (2003). Lignin biosynthesis. Annual Review of Plant Biology, 54(1), 519–546.  Bonawitz, N. D., & Chapple, C. (2010). The genetics of lignin biosynthesis: connecting genotype to phenotype. Annual Review of Genetics, 44(1), 337–363.  Bourbonnais, R., Paice, M. G., Freiermuth, B., Bodie, E., & Borneman, S. (1997). Reactivities of various mediators and laccases with kraft pulp and lignin model compounds. Applied and Environmental Microbiology, 63(12), 4627–4632.  Carpita, N. C., & Gibeaut, D. M. (1993). Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. The Plant Journal, 3(1), 1–30.  Chapple, C. C., Vogt, T., Ellis, B. E., & Somerville, C. R. (1992). An Arabidopsis mutant defective in the general phenylpropanoid pathway. The Plant Cell, 4(11), 1413–1424.  Cosgrove, D. J. (2005). Growth of the plant cell wall. Nature Reviews. Molecular Cell Biology, 6(11), 850–861.  Curtis, M. D., & Grossniklaus, U. (2003). A Gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiology, 133(2), 462–469.  81  Donaldson, L. A. (2001). Lignification and lignin topochemistry - an ultrastructural view. Phytochemistry, 57(6), 859–873.  Driouich, A, Faye, L., & Staehelin, L.A. (1993). The plant Golgi apparatus: a factory for complex polysaccharides and glycoproteins. Trends in Biochemical Sciences, 18(6), 210–214.  Driouich, A., Lainé, A.C., Vian, B., & Faye, L. (1992). Characterization and localization of laccase forms in stem and cell cultures of sycamore. The Plant Journal, 2(1), 13–24. Freudenberg, K. (1959). Biosynthesis and constitution of lignin. Nature, 183(469), 1152–1155. Gabaldón, C., Lopez-Serrano, M., Pedreno, M. A., & Barcelo, A. (2005). Cloning and molecular characterization peroxidase isoenzyme from Zinnia elegans, an enzyme involved in lignin biosynthesis. Plant Physiology, 139(3), 1138–1154. Goodstein, D. M., Shu, S., Howson, R., Neupane, R., Hayes, R. D., Fazo, J., et al. (2012). Phytozome: a comparative platform for green plant genomics. Nucleic Acids Research, 40(D1), D1178 - D1186. Harkin, J. M., & Obst, J. R. (1973). Lignification in trees  : indication of exclusive peroxidase participation. Science, 180(4083), 296–298. Hepler, P. K., & Newcomb, E. H. (1964). Microtubules and fibrils in the cytoplasm of Coleus cells undergoing secondary wall deposition. Journal of Cell Biology, 20(3), 529–533. Herrero, J., Esteban-Carrasco, A., & Zapata, J. M. (2013). Looking for Arabidopsis thaliana peroxidases involved in lignin biosynthesis. Plant Physiology and Biochemistry, 67(June 2013), 77–86.  Kaneda, M., Rensing, K. H., Wong, J. C. T., Banno, B., Mansfield, S. D., & Samuels, A. L. (2008). Tracking monolignols during wood development in lodgepole pine. Plant Physiology, 147(4), 1750–1760.  Karimi, M., Depicker, A., & Hilson, P. (2007). Recombinational cloning with plant gateway vectors. Plant Physiology, 145(4), 1144–1154.  Kimura, S., Laosinchai, W., Itoh, T., Cui, X., Linder, C., & Brown, R. (1999). Immunogold labeling of rosette terminal cellulose-synthesizing complexes in the vascular plant Vigna angularis. The Plant Cell, 11(11), 2075–2086.  Kotzer, A. M., & Wasteneys, G. O. (2006). Mechanisms behind the puzzle: microtubule-microfilament cross-talk in pavement cell formation. Canadian Journal of Botany, 84(4), 595–603. Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, J., et al. (2005). Transcription switches for protoxylem and metaxylem vessel formation. Genes & Development, 19(16), 1855–1860.  Lauvergeat, V., Lacomme, C., Lacombe, E., Lasserre, E., Roby, D., & Grima-Pettenati, J. (2001). Two cinnamoyl-CoA reductase (CCR) genes from Arabidopsis thaliana are differentially expressed during development and in response to infection with pathogenic bacteria. Phytochemistry, 57(7), 1187–1195.  82  Lee, Y., Rubio, M. C., Alassimone, J., & Geldner, N. (2013). A mechanism for localized lignin deposition in the endodermis. Cell, 153(2), 402–412.  Li, Y., Kajita, S., Kawai, S., Katayama, Y., & Morohoshi, N. (2003). Down-regulation of an anionic peroxidase in transgenic aspen and its effect on lignin characteristics. Journal of Plant Research, 116(3), 175–182.  Liang, M., Davis, E., Gardner, D., Cai, X., & Wu, Y. (2006). Involvement of AtLAC15 in lignin synthesis in seeds and in root elongation of Arabidopsis. Planta, 224(5), 1185–96.  Liu, L., Dean, J. F. D., Friedman, W. E., & Eriksson, K.-E. L. (1994). A laccase-like phenoloxidase is correlated with lignin biosynthesis in Zinnia elegans stem tissues. The Plant Journal, 6(2), 213–224.  McCann, M. C. (1997). Tracheary element formation: building up to a dead end. Trends in Plant Science, 2(9), 333–338.  McCartney, L., Marcus, S. E., & Knox, J. P. (2005). Monoclonal antibodies to plant cell wall xylans and arabinoxylans. The Journal of Histochemistry and Cytochemistry, 53(4), 543–546.  Miao, Y., & Liu, C. (2010). ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes. Proceedings of the National Academy of Science, 107(52), 22728–22733.  Mueller, S. C., & Brown, R. M. (1980). Evidence for an intramembrane component associated with a cellulose microfibril-synthesizing complex in higher plants. Journal of Cell Biology, 8(2)4, 315–326. Murashige, T., & Skoog, F, (1962). A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Plant Physiology, 15(3), 473-497. Nakamura, W. (1967). Studies on the biosynthesis of lignin - Disproof against the catalytic activity of laccase in the oxidation of coniferyl alcohol. Journal of Biochemistry, 62(1), 54–61. Oda, Y., & Fukuda, H. (2012). Initiation of cell wall pattern by a Rho- and microtubule-driven symmetry breaking. Science, 337(6100), 1333–1336.  Oda, Y., Mimura, T., & Hasezawa, S. (2005). Regulation of secondary cell wall development by cortical microtubules during tracheary element differentiation in Arabidopsis cell suspensions. Plant Physiology, 137(3), 1027–1036.  Ohashi-Ito, K., Oda, Y., & Fukuda, H. (2010). Arabidopsis VASCULAR-RELATED NAC-DOMAIN6 directly regulates the genes that govern programmed cell death and secondary wall formation during xylem differentiation. The Plant Cell, 22(10), 3461–3473.  Önnerud, H., Zhang, L., Gellerstedt, G., & Henriksson, G. (2002). Polymerization of monolignols by redox Shuttle – mediated enzymatic oxidation  : A new model in lignin biosynthesis. The Plant Cell, 14(8), 1953–1962.  83  Østergaard, L., Teilum, K., Mirza, O., Mattsson, O., Petersen, M., Welinder, K. G., et al. (2000). Arabidopsis ATP A2 peroxidase. Expression and high-resolution structure of a plant peroxidase with implications for lignification. Plant Molecular Biology, 44(2), 231–243.  Panteris, E., Apostolakos, P., & Galatis, B. (1993) Microtubules and morphogenesis in ordinary epidermal cells of Vigna sinensis leaves. Protoplasma, 174(3-4), 91-100.  Pesquet, E., Korolev, A. V, Calder, G., & Lloyd, C. W. (2010). The microtubule-associated protein AtMAP70-5 regulates secondary wall patterning in Arabidopsis wood cells. Current Biology, 20(8), 744–749.  Pourcel, L., Routaboui, J.M., Kerhoas, L., Caboche, M., Lepiniec, L., & Debeaujon, I. (2005). TRANSPARENT TESTA10 encodes a laccase-like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat. The Plant Cell, 17(11), 2966–2980.  Pumplin, N., Zhang, X., Noar, R. D., & Harrison, M. J. (2012). Polar localization of a symbiosis-specific phosphate transporter is mediated by a transient reorientation of secretion. Proceedings of the National Academy of Sciences, 109(11), 665–672.  Ragauskas, A. J., Beckham, G. T., Biddy, M. J., Chandra, R., Chen, F., Davis, M. F., et al. (2014). Lignin valorization: improving lignin processing in the biorefinery. Science, 344(6185), 12468431-1246843110.  Ralph, J., Lundquist, K., Brunow, G., Lu, F., Kim, H., Schatz, P. F., et al. (2004). Lignins: Natural polymers from oxidative coupling of 4-hydroxyphenyl-propanoids. Phytochemistry Reviews, 3(1), 29–60.  Ralph, J., Peng, J., Lu, F., Hatfield, R. D., & Helm, R. F. (1999). Are lignins optically active? Journal of Agricultural and Food Chemistry, 47(8), 2991–2996.  Ranocha, P., & Chabannes, M. (2002). Laccase down-regulation causes alterations in phenolic metabolism and cell wall structure in poplar. Plant Physiology, 129(1), 145–155.  Ranocha, P., McDougall, G., Hawkins, S., Sterjiades, R., Borderies, G., Stewart, D., et al. (1999). Biochemical characterization, molecular cloning and expression of laccases - a divergent gene family - in poplar. European Journal of Biochemistry, 259(12), 485–495.  Richardson, A., Stewart, D., & Mcdougall, G. J. (1997). Identifcation and partial characterization of a coniferyl alcohol oxidase from lignifying xylem of Sitka spruce (Picea sitchensis). Planta, 203(1), 35–43. Savidge, R., & Udagama-Randeniya, P. (1992). Cell wall-bound coniferyl alcohol oxidase associated with lignification in conifers. Phytochemistry, 31(9), 2959–2966. Schuetz, M., Benske, A., Smith, R.A., Watanabe, Y., Tobimatsu, Y., Ralph, J., Demura, T., Ellis, B., & Samuels, A.L. (2014). Secondary cell wall-localized laccases are required and sufficient for protoxylem lignification. Manuscript submitted for publication.  Smith, R.A., Schuetz, M., Roach, M., Mansfield, S. D., Ellis, B., & Samuels, L. (2013). Neighboring parenchyma cells contribute to Arabidopsis xylem lignification, while lignification of interfascicular fibers is cell autonomous. The Plant Cell, 25(10), 3988–99.  84  Spurr, A.R. (1969). A low-viscosity epoxy resin embedding medium for electron microscopy. Journal of Ultrastructure Research, 26(1), 31–43. Sterjiades, R., Dean, J. F., & Eriksson, K. E. (1992). Laccase from Sycamore maple (Acer pseudoplatanus) polymerizes monolignols. Plant Physiology, 99(3), 1162–1168.  Takahama, U. (1995). Oxidation of hydroxycinnamic acid and hydroxycinnamyl alcohol derivatives by laccase and peroxidase. Interactions among p-hydroxyphenyl, guaiacyl and syringyl groups during the oxidation reactions. Physiologia Plantarum, 93(1), 61–68. Tobimatsu, Y., Davidson, C.L., Grabber, J.H., and Ralph, J. (2011). Fluorescence-tagged monolignols: synthesis, and application to studying in vitro lignification. Biomacromolecules 12(5), 1752-1761. Tobimatsu, Y., Wagner, A., Donaldson, L., Mitra, P., Niculaes, C., Dima, O., et al. (2013). Visualization of plant cell wall lignification using fluorescence-tagged monolignols. The Plant Journal, 76(3), 357–366.  Turlapati, P. V, Kim, K.-W., Davin, L. B., & Lewis, N. G. (2011). The laccase multigene family in Arabidopsis thaliana: towards addressing the mystery of their gene function(s). Planta, 233(3), 439–470.  Turner, S. R., & Somerville, C. R. (1997). Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall. The Plant Cell, 9(5), 689–701. Vanholme, R., Cesarino, I., Rataj, K., Xiao, Y., Sundin, L., Goeminne, G., et al. (2013). Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science, 341(6150), 1103-1106. Wightman, R., & Turner, S. R. (2008). The roles of the cytoskeleton during cellulose deposition at the secondary cell wall. The Plant Journal  : For Cell and Molecular Biology, 54(5), 794–805.  Yamaguchi, M., Goué, N., Igarashi, H., Ohtani, M., Nakano, Y., Mortimer, J. C., et al. (2010). VASCULAR-RELATED NAC-DOMAIN6 and VASCULAR-RELATED NAC-DOMAIN7 effectively induce transdifferentiation into xylem vessel elements under control of an induction system. Plant Physiology, 153(3), 906–914.  Yamaguchi, M., Mitsuda, N., Ohtani, M., Ohme-Takagi, M., Kato, K., & Demura, T. (2011). VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation. The Plant Journal, 66(4), 579–590.  Young, R. E., McFarlane, H. E., Hahn, M. G., Western, T. L., Haughn, G. W., & Samuels, A.L. (2008). Analysis of the Golgi apparatus in Arabidopsis seed coat cells during polarized secretion of pectin-rich mucilage. The Plant Cell, 20(6), 1623–1638.  Zhao, Q., Nakashima, J., Chen, F., Yin, Y., Fu, C., Yun, J., et al. (2013). LACCASE is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis. The Plant Cell, 25(10), 3976–3987.  85  Zhong, R., Lee, C., Zhou, J., McCarthy, R. L., & Ye, Z.-H. (2008). A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. The Plant Cell, 20(10), 2763–2782.  Zhong, R., Taylor, J. J., & Ye, Z. H. (1997). Disruption of interfascicular fiber differentiation in an Arabidopsis mutant. The Plant Cell, 9(12), 2159–2170.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167365/manifest

Comment

Related Items