Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effects of insulin gene dosage on body weight and glucose homeostasis Mehran, Arya E. 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_february_mehran_arya.pdf [ 5.21MB ]
Metadata
JSON: 24-1.0167270.json
JSON-LD: 24-1.0167270-ld.json
RDF/XML (Pretty): 24-1.0167270-rdf.xml
RDF/JSON: 24-1.0167270-rdf.json
Turtle: 24-1.0167270-turtle.txt
N-Triples: 24-1.0167270-rdf-ntriples.txt
Original Record: 24-1.0167270-source.json
Full Text
24-1.0167270-fulltext.txt
Citation
24-1.0167270.ris

Full Text

  EFFECTS OF INSULIN GENE DOSAGE ON BODY WEIGHT AND GLUCOSE HOMEOSTASIS  by Arya E. Mehran  B.Sc., University of British Columbia, 2006   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Cell and Developmental Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2014  © Arya E. Mehran, 2014  ii Abstract Obesity is one of the biggest health concerns around the world and is closely associated with insulin hypersecretion. However, the causality relationship between these conditions remains enigmatic. We tested the hypothesis that fasting hyperinsulinemia is necessary for diet-induced obesity by varying the pancreatic-specific Ins1 gene dosage in Ins2-/- mice. Male Ins1+/-:Ins2-/- mice did not exhibit high fat diet-induced fasting hyperinsulinemia, when compared with their Ins1+/+:Ins2-/- littermate controls. This genetic inability to become hyperinsulinemic prevented the expected increase in pancreatic -cell number, confirming a role for insulin in high fat diet-induced β-cell expansion. Male Ins1+/-:Ins2-/- mice were also protected from diet-induced obesity and hepatic steatosis when compared to high fat fed Ins1+/+:Ins2-/- littermate controls in the absence of sustained changes in glucose homeostasis. Genetic prevention of hyperinsulinemia increased energy expenditure while reducing adipose inflammation and fatty acid spillover. Female control Ins1+/+:Ins2-/- mice did not exhibit hyperinsulinemia or weight gain on the high fat diet we employed, so it was not possible to test the same hypothesis in the female mice. The effects of reducing Ins2 gene dosage on the Ins1 null background were also assessed. Male Ins1-/-:Ins2+/- mice had a phenotype that differed strongly between cohorts. In one cohort of the male mice, Ins2 haploinsufficiency was associated with increased food intake of the high fat diet, relative to Ins1-/-:Ins2+/- mice fed the same diet, but no changes in circulating insulin levels. On the other hand, female Ins1-/-:Ins2+/- mice were partially protected from high fat diet-induced obesity relative to their littermate controls. The differences in the consequences of Ins1 versus Ins2 loss prompted analysis of the tissue expression of both insulin genes, focusing on the central nervous system. We demonstrated that, unlike Ins1, Ins2 is expressed in the brain. High fat feeding reduced Ins2 expression in the brain in a region- and sex-specific manner. Collectively, our data provide genetic  iii evidence that circulating hyperinsulinemia can drive obesity in mammals. These findings may be important for understanding the causes of obesity and eventually the development of approaches to prevent or treat it.  iv Preface I performed and analyzed all studies reported in this thesis, unless otherwise noted below. I was principally involved in all aspects of the research from design, data analysis, manuscript preparation, and submission for publication of all the data discussed in this thesis.  Dr. Xiaoke Hu provided technical assistance and training for the in vivo studies. Ms. Micah Piske also provided technical assistance for some of RNA isolations required to produce the data provided in figure 3.9. Dr. Jose Diego Botezelli provided assistance in measuring the liver triglyceride and cholesterol shown in figure 4.12. Dr. Kwan Yi Chu assisted with analyzing PCNA and TUNEL staining in presented in figure 4.3 C and D. Dr. Gareth Lim assisted with PCNA western blot analysis in figure 4.3 D. Mr. Ali Asadi from the laboratory of Dr. Timothy Kieffer stained the Ins1 or Ins2 knockout islets and confirmed of the specificity of isoform-specific insulin antibodies presented in figure 3.6. Dr. G. Stefano Brigidi from the laboratory of Dr. Shernaz Bamji performed the isolation, culturing and staining of hippocampal neurons. The metabolic cage experiment data were collected with the help of Dr. Susanne Clee. The data and concepts presented here were part of the following published articles:  Mehran AE, Templeman NM, Brigidi GS, Lim GE, Chu K-Y, Hu X, Botezelli JD, Asadi A, Hoffman BG, Kieffer TJ, Bamji SX, Clee SM, Johnson JD. 2012. Hyperinsulinemia drives diet-induced obesity independently of brain insulin production. Cell Metabolism 16, 723–737.  Alejandro EU, Lim GE, Mehran AE, Hu X, Taghizadeh F, Pelipeychenko D, Baccarini M, Johnson JD. 2011. Pancreatic beta-cell Raf-1 is required for glucose tolerance, insulin secretion and insulin 2 transcription. FASEB J 25(11):3884-95. Epub 2011 Aug 4.   v We obtained Animal Care Certificates for these studies (number: A07-0442 and A11-0390, approved each year) from the University of British Columbia.  vi Table of contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of contents .......................................................................................................................... vi List of tables....................................................................................................................................x List of figures ................................................................................................................................ xi List of abbreviations .................................................................................................................. xiii Acknowledgements .................................................................................................................. xviii Dedication .....................................................................................................................................xx Chapter 1: Introduction ................................................................................................................1 1.1 The hormone insulin ....................................................................................................... 1 1.1.1 Discovery of insulin .................................................................................................... 1 1.1.2 Insulin and insulin signalling are evolutionarily conserved ....................................... 2 1.1.3 Expression of insulin outside of pancreas ................................................................... 3 1.2 Insulin action ................................................................................................................... 3 1.2.1 Insulin signalling ......................................................................................................... 3 1.2.2 Autocrine insulin signalling ........................................................................................ 4 1.2.3 Insulin action in the periphery .................................................................................... 5 1.2.4 Central actions of insulin ............................................................................................ 7 1.3 Metabolic syndrome...................................................................................................... 10 1.3.1 Diabetes..................................................................................................................... 10 1.3.1.1 Diabetes: A global epidemic ............................................................................. 10  vii 1.3.1.2 Type 1 diabetes mellitus ................................................................................... 11 1.3.1.3 Type 2 diabetes mellitus ................................................................................... 11 1. Obesity .......................................................................................................................... 12 1.4.1 Obesity: A poorly understood disease that is rapidly on the rise .............................. 12 1.4.2 Obesity and energy balance ...................................................................................... 13 1.4.3 Diet and obesity ........................................................................................................ 15 1.4.4 Molecular changes in obesity.................................................................................... 16 1.4.4.1 Obesity and adipose tissue ................................................................................ 16 1.4.4.2 Adipose tissue subtypes .................................................................................... 18 1.4.4.3 Obesity, adipose tissue, and inflammation ....................................................... 20 1.4.4.4 Obesity and liver function ................................................................................. 21 1.4.4.5 Obesity and insulin resistance in skeletal muscle ............................................. 22 1.4.4.6 Obesity and pancreas function .......................................................................... 23 1.4.4.7 Obesity and the central nervous system ............................................................ 24 1.5 Hyperinsulinemia .......................................................................................................... 25 1.5.1 Hyperinsulinemia can precede obesity or insulin resistance .................................... 25 1.6 Thesis investigation ...................................................................................................... 26 Chapter 2: Materials and methods .............................................................................................28 2.1 Experimental animals.................................................................................................... 28 2.2 Glucose tolerance, insulin tolerance, and hormone secretion ....................................... 28 2.3 Metabolic cage analysis ................................................................................................ 29 2.4 Tissue collection and analysis ....................................................................................... 29 2.5 Gene expression analysis .............................................................................................. 31  viii 2.6 Statistical analysis ......................................................................................................... 31 2.7 Tables ............................................................................................................................ 33 Chapter 3: Expression patterns of murine Ins1 and Ins2 ........................................................36 3.1 High fat feeding reduces Ins2 expression in the brains of female mice ....................... 38 3.2 Figures........................................................................................................................... 40 Chapter 4: Systemic hyperinsulinemia is a causal factor in diet-induced obesity .................60 4.1 Reduced Ins1 prevents diet-induced -cell growth and fasting hyperinsulinemia ....... 60 4.2 Glucose homeostasis in mice with reduced insulin gene dosage .................................. 61 4.3 Reduced circulating pancreatic Ins1 gene dosage prevents diet-induced obesity ........ 62 4.4 Ins1 is a negative regulator of uncoupling, lipolytic, and inflammatory genes in white adipose tissue ............................................................................................................................ 63 4.5 Reduced pancreatic Ins1 protects mice from lipid spillover and fatty liver ................. 65 4.6 Circulating insulin levels in female mice Ins1+/-:Ins2-/- mice ....................................... 66 4.7 Figures........................................................................................................................... 68 4.8 Tables ............................................................................................................................ 94 Chapter 5: Effects of reduced Ins2 gene dosage in Ins1-/- mice ...............................................97 5.1 Glucose homeostasis, insulin tolerance, and insulin levels in Ins1-/-:Ins2+/- mice ........ 97 5.2 Cohort dependent effects of Ins2 gene dosage on diet-induced obesity ....................... 98 5.3 Diet-induced weight gain in female Ins1-/-:Ins2+/- mice .............................................. 101 5.4 Figures......................................................................................................................... 102 Chapter 6: Discussion ................................................................................................................120 6.1 Pancreatic Ins1 hyper-secretion promotes fat storage and reduces fat burning .......... 120 6.2 Diet-induced -cell expansion is regulated by insulin in vivo .................................... 121  ix 6.3 Tissue-specific roles for Ins1 and Ins2: Relevance to human INSULIN .................... 122 6.4 Changes in Ins2 gene dosage may potentially affect food intake ............................... 123 6.5 High fat feeding affects central insulin expression ..................................................... 125 6.6 Summary ..................................................................................................................... 126 6.7 Limitation of the studies and future directions ........................................................... 128 6.8 Summary Figure.......................................................................................................... 132 Bibliography ...............................................................................................................................134 Appendices ..................................................................................................................................205 Appendix A Effect of Diets with Lard as The Source of Fat on Glucose Tolerance ............. 205 A.1 High Fat Diet Induced Glucose Intolerance ............................................................ 205   x List of tables  Table 2.1 Primers used for genotyping the presence or absence of Ins1 or Ins2 alleles. ............. 33 Table 2.2 Comparison of the control medium fat and the high fat diets. ..................................... 34 Table 2.3 Quantitative PCR Taqman primers used to measure the levels of Ins1 and Ins2 gene expression. .................................................................................................................................... 35 Table 4.1 List of the genes studied in the mini-array. .................................................................. 94   xi List of figures  Figure 3.1 Validation of Taqman real-time RT-qPCR primer/probe sets specific to each rodent Insulin gene. .................................................................................................................................. 41 Figure 3.2 Central nervous system expression of Ins2, but not Ins1. ........................................... 43 Figure 3.3 Ins1 and Ins2 expression at different stages of development in mice. ........................ 45 Figure 3.4 Comparison of Ins2 mRNA levels in islets and brain. ................................................ 47 Figure 3.5 Detection of INSULIN mRNA in brain. ...................................................................... 49 Figure 3.6 Validation of specific Ins1 and Ins2 protein detection tools. ...................................... 51 Figure 3.7 Central nervous system expression of Ins2, but not Ins1. ........................................... 53 Figure 3.8 β-Gal expression in Ins2-/- islets. ................................................................................. 55 Figure 3.9 High fat diet reduces Ins2 expression in wildtype female mice. ................................. 57 Figure 3.10 High fat diet reduces Ins2 expression in Ins1-/-:Ins2+/+ female mice. ....................... 59 Figure 4.1 Experimental design for mice with varying Ins1 gene dosage on an Ins2 null background. ................................................................................................................................... 69 Figure 4.2 Reduced Insulin gene dosage results in reduced islet insulin mRNA and peptide. .... 71 Figure 4.3 Reduced Insulin gene dosage prevents the compensatory expansion of β-cell numbers in the context of a high fat diet. .................................................................................................... 73 Figure 4.4 Reduced Insulin gene dosage prevents sustained hyperinsulinemia on a high fat diet........................................................................................................................................................ 75 Figure 4.5 Glucose stimulated insulin release in mice with reduced Insulin gene dosage. .......... 77 Figure 4.6 Glucose homeostasis and insulin sensitivity in mice with reduced Insulin gene dosage........................................................................................................................................................ 79  xii Figure 4.7 Mice with reduced fasting insulin are protected from high fat-induced weight gain. . 81 Figure 4.8 Mice with reduced fasting insulin have increased energy expenditure. ...................... 83 Figure 4.9 Gene expression profile of white adipose tissue. ........................................................ 85 Figure 4.10 Gene expression profile of brown adipose tissue. ..................................................... 87 Figure 4.11 Gene expression profile of skeletal muscle. .............................................................. 89 Figure 4.12 Ins1+/-:Ins2-/- mice are protected from lipid spill over, fatty liver and ER-stress. ..... 91 Figure 4.13 Lack of fasting hyperinsulinemia and weight gain in high fat fed female Ins1+/-:Ins2-/- or Ins1+/+:Ins2-/- mice. ................................................................................................................ 93 Figure 5.1 Experimental design for mice with varying Ins2 gene dosage on an Ins1 null background. ................................................................................................................................. 103 Figure 5.2 Reduced Ins2 expression in Ins1-/-:Ins2+/- mice. ....................................................... 105 Figure 5.3 Circulating insulin is not reduced in Ins1-/-:Ins2+/- mice. .......................................... 107 Figure 5.4 Insulin secretion and glucose homeostasis in high fat fed Ins1-/-:Ins2+/- mice. ......... 109 Figure 5.5 . Cohort-dependent and diet-dependent effects on body weight in Ins1-/-:Ins2+/- mice on high fat diet. ........................................................................................................................... 111 Figure 5.6. A cohort of Ins1-/-:Ins2+/- mice exhibit high fat diet-dependent adiposity. .............. 113 Figure 5.7 Food intake and metabolic parameters in a cohort of Ins1-/-:Ins2+/- mice. ................ 115 Figure 5.8 Gene expression profile of liver of Ins1-/-:Ins2+/- and Ins1-/-:Ins2+/+ mice. ................ 117 Figure 5.9 Female Ins1-/-:Ins2+/+ mice show trends towards increased fasting hyperinsulinemia and weight gain due to high fat diet intake. ................................................................................ 119 Figure 6.1 Revisiting the central model of obesity and type 2 diabetes. .................................... 133   xiii List of abbreviations 18S 18 S ribosomal RNA Acacb Acetyl coa carboxylase  Actb β-actin Acyl ATP citrate lyase  Adipoq Adiponectin Adipor Adiponectin receptor Adpn Patatin-like phospholipase domain containing 3 AgRP Agouti-related peptide  ANOVA Analysis of variance  AOC Area over the curve ARC Arcuate nucleus  Atf3 Activating transcription factor 3  Atgl Phospholipase domain containing 2  ATP Adenosine Triphosphate AU Arbitrary unit AUC Area under the curve BAT Brown adipose tissue BMI Body mass index Ca2+ Calcium cAMP Cyclic adenosine monophosphate CART Cocaine- and Amphetamine-regulated transcript  xiv cDNA Complementary DNA Cebpa CCAAT/enhancer binding protein  Chop DNA-damage inducible transcript 3  Chrebp Carbohydrate-responsive element-binding protein CNS Central nervous system CSP Cerebrospinal fluid Ct Threshold cycle DAPI 4',6-diamidino-2-phenylindole DNA Deoxyribonucleic acid Egr1 Early growth response 1 ELISA  Enzyme-linked immunosorbent assay Emr1 EGF-like module-containing mucin-like hormone receptor-like 1 ERK Extracellular regulated kinases Fasn Fatty acid synthase Fgf21 Fibroblast growth factor 21 Foxa2 Forkhead box a2  Foxc2 Forkhead box c2  Foxo1 Forkhead box o1  Fto Alpha-ketoglutarate-dependent dioxygenase GFP Green fluorescent protein GLUT Glucose transporter protein Glut4 Solute carrier family 2 member 4  xv Grb2 Receptor-bound protein-2 H&E Hematoxylin and eosin H3K4me1 Monomethylation of the 4th residue (lysine) from the start of the H3 protein HDL  Low high-density lipoprotein HNE 4‐hydroxy‐2‐nonenal  Hprt1 Hypoxanthine guanine phosphoribosyl transferase 1 HSD Honest significant difference Hsl Hormone sensitive lipase IGF Insulin-like growth factor Igfbp Insulin-like growth factor binding protein IKKβ Inhibitor of nuclear factor kappa-B kinase subunit beta IL-6 Interleukin 6 Ins1 Insulin 1 Ins2 Insulin 2 Insr Insulin receptor IRS Insulin receptor substrate JNK1 JUN-N terminal Kinase 1 KATP ATP-sensitive potassium channel Klf15 Kruppel-like factor 15  Krox20 Early growth response 2 LacZ β-galactosidase gene Lep Leptin  xvi Lepr Leptin receptor LTD Long-term depression  Lxr Nuclear receptor subfamily 1 MAPK Mitogen-activated protein kinase MEK MAPK kinase MRI Magnetic resonance imaging  mRNA Messenger ribonucleic acid NaCl Sodium chloride Neo Neomycin NeuN Neuronal nuclei NMR  Nuclear magnetic resonance NPY Neuropeptide Y  Nrip1  Nuclear receptor interacting protein 1  P Probability of significance PCR Polymerase chain reaction PDE Phosphodiesterase PDK Pyruvate dehydrogenase kinase  PFA Paraformaldehyde PI3K Phosphoinositide 3-kinase  PIP3  Phosphatidylinositol (3,4,5)-trisphosphate PKA Protein kinase A PKB Protein kinase B   xvii PKC Protein kinase C Pomc Pro-opiomelanocortin  Pnpla2 Adipose triglyceride lipase Ppara Peroxisome proliferator activated receptor alpha Pparg Peroxisome proliferator activated receptor gamma Ppargc1a Proxisome proliferative gamma coactivator 1 alpha Ptpn1 Protein tyrosine phosphatase  qPCR Quantitative polymerase chain reaction   xviii Acknowledgements  First and foremost, I send my thanks and prayers to Allah for having blessed me with everything good that I could have imagined. Even when things seemed hard to handle, I have always realized later that it was for the best. He has always challenged me to learn, grow and become stronger. Yet, he has always been there to keep me from being misguided by putting good people in my way. I would also like to thank my graduate school research supervisor Dr. James D. Johnson for taking me under his wings and supporting me throughout my research. He was with me through ups and downs, personal matters or work, and gave me support and encouragement. Of course, I would also like to thank my family and friends who have been with me throughout my entire journey. This work is not the result of my efforts alone but also the result of their support and love. I hope I can always be there for them as they have always been there for me.  However, we learn from almost everyone we meet in our lives, young or old, wealthy or poor, educated or experienced, good or misguided. Thus, truly one needs to thank everyone who they have encountered in their life, regardless of how lengthy or short the interactions may have been. I believe that those in academia are more responsible than teaching a certain subject or studying it. It is our duty to set a good example for the rest of the society. We need to seek not just intelligence, but also wisdom. We must understand and explain science, literature, art, love, compassion, and simply how to be human and a good one at that. I only mention this to end this section by acknowledging one of the many quotes that have been a role model for me on my quest to achieve these, especially because of my endeavor to become a scientist and an educator:  xix “When we look at modern man, we have to face the fact that modern man suffers from a kind of poverty of the spirit, which stands in glaring contrast to his scientific and technological abundance; We've learned to fly the air like birds, we've learned to swim the seas like fish, and yet we haven't learned to walk the Earth as brothers and sisters.” Dr. Martin Luther King Jr.  xx Dedication                To my loving family and friends.   1 Chapter 1: Introduction 1.1 The hormone insulin 1.1.1 Discovery of insulin One of the biggest discoveries in the history of medicine is the discovery of insulin as a glucose regulating hormone produced by the pancreatic islets. Several key observations led to today’s understanding of this hormone. In 1869 a medical student from Germany, Paul Langerhans, discovered clumps of cells scattered throughout the pancreas. These clumps of cells became known as ‘Islets of Langerhans’ 1. Then, Dr. Frederick Banting 92 years ago, with the help from a medical student Charles Best and support from John J. R. Macleod, began studies that led to the extraction, purification and discovery of insulin from these islets 1,2. They observed that surgically preventing the flow of digestive pancreatic secretions from reaching the digestive system did not cause diabetes. However, if the pancreas were removed, dogs would begin drinking and urinating excessively, lose weight and become progressively weaker. These two pieces of evidence led them to believe that the anti-diabetic secretions of the pancreas were not in the digestive secretions. They ligated pancreatic ducts causing the pancreas to degenerate and lose the ability to secrete digestive secretions. They then removed the pancreata and sliced them in a mixture of salts and water. The ground slices were filtered, resulting in a substance named “isletin”. They observed that infusion of isletin into diabetic dogs resulted in a sharp improvement in their health and that a few injections of this extract per day allowed the dogs to live longer. Later in 1921 they were joined by a biochemist, Bertram Collip, and continued their studies to extract and purify insulin for human use 1,2.   2 1.1.2 Insulin and insulin signalling are evolutionarily conserved Certain genes and pathways are evolutionarily conserved. This usually means that these genes are essential to the organism’s survival. Insulin and insulin-like peptides, such as insulin-like growth factors (IGF), and their signalling pathways are among those that are highly conserved 3,4. Caenorhabditis elegans have forty insulin-like genes and Drosophila melanogaster have seven. Humans and most mammals have eight insulin and insulin-like genes expressed that are closely related 5-18. Almost all of these are involved in similar functions such as metabolism, energy balance, and growth 10-13,19-32. For example, in C. elegans, mutation in daf-28, which encodes an insulin-like peptide, leads to dauer arrest and downregulation of DAF-2, an insulin receptor-like peptide, signalling 33. In Drosophila, it has been shown that diet restriction increases lifespan and restoring the food intake to normal levels abolishes this effect 11. However, partial ablation of median neurosecretory cells, which are responsible for production of three of the insulin-like peptides, protected against the decrease in lifespan when diet restriction was ended and food intake was returned to normal levels 11. However, another study showed that ablating insulin producing cells that express four of the five genes that have significant similarity with mammalian insulin, dilp1, -2, -3, and -5, in flies leads to growth retardation and elevated circulating carbohydrate levels in hemolymph 12. Collectively, these studies point to important conserved roles for insulin like peptides in longevity and energy homeostasis. However, to date, similar studies where insulin genes are manipulated in mammals have not been reported in the context of energy homeostasis and longevity.   3 1.1.3 Expression of insulin outside of pancreas Insulin is best known for its role in glucose homeostasis. Indeed, the pancreatic islets of Langerhans are the sole site for the production of the insulin in the circulation that fulfills its endocrine function. Insulin expression is highly controlled at the transcriptional level in the 5’ flanking region of its gene 34. However, insulin production outside of the pancreas has also been reported 35-115. Two major non-pancreatic sites of insulin production are the thymus and the central nervous system (CNS) 35-115, the latter being more controversial and discussed later as a part of this research. However, insulin expression in thymus is well accepted and is thought to play a role in the pathogenesis of type 1 diabetes 116. There are reports of other tissues, such as adipose tissue, spleen, bone marrow, and liver, producing minute amounts insulin, or proinsulin, under pathological circumstances 108. Moreover¸ different isoforms of insulin can have different expression patterns within the same species. For example, unlike humans, mice have two insulin genes, Ins1 and Ins2 117. Most studies have shown that Ins1 is restricted to pancreatic β-cells, where it contributes to approximately 1/3 of the expressed and secreted insulin 117. The peptide product of the Ins1 gene differs from that of the Ins2 gene by two amino acids in the β-chain, at the B9 and B29 location, and is missing two amino acids in the connecting C-peptide 118. Ins1 also lacks an intron present in Ins2 118. Ins2 is the ancestral gene, with gene structure, parental imprinting, and a broad tissue distribution similar to human INSULIN 47,117.  1.2 Insulin action 1.2.1 Insulin signalling Insulin is an important regulator of cellular growth and survival, glucose homeostasis, energy metabolism, appetite and food seeking behavior and more 23,24,119-127. Insulin receptors,  4 located on the plasma membrane, are activated upon binding with their cognate ligand. Upon binding of insulin, the insulin receptor’s tyrosine kinase activity is initiated and leads to auto-phosphorylation at tyrosine residues. The resulting conformational change allows the activated insulin receptor to attract its downstream factors, insulin receptor substrate proteins (IRS1, IRS2, IRS3 and IRS4) and SH2-containing protein (Shc). IRS proteins, in turn, activate other proteins further downstream of insulin receptor 23,128. There are two main pathways downstream of IRS proteins. In one pathway, phosphoinositide 3-kinase (PI3K), protein kinase B (PKB) are sequentially activated, resulting in the deactivation and exclusion of the forkhead family of transcription factors (FOXO) from the nucleus, thus changing gene transcription profiles among other effects 24,129. In the other pathway, IRS proteins activate growth factor receptor-bound protein-2 (Grb-2), rat sarcoma (Ras), RAF proto-oncogene serine/threonine-protein kinase-1 (Raf-1), MAPK kinase (MEK), and ultimately lead to activation and translocation of extracellular regulated kinases (ERK1-2) into the nucleus where they can promote gene transcription 23.  1.2.2 Autocrine insulin signalling Hormones are generally known for their ability to enter the bloodstream and reach other tissues. However, virtually all hormones are known to affect the same cell they are produced from as well as the surrounding cells 130. Insulin is also believed to have such effects on insulin producing pancreatic β-cells 23,27,131. In particular, insulin activates pro-survival pathways and inhibits pro-apoptotic pathways in insulin producing β-cells in face of cellular stress 23,24,31,132. The endocrine pancreas continues to reshape and remodel itself throughout life in response to anti-apoptotic and pro-apoptotic signals 133-135. Insulin can bind to its own receptor on the β-cells and affect β-cell growth and survival through the Raf/MEK/ERK pathway 23,27,131. In fact, it has been  5 shown, by studies involving insulin receptor knockout mice, that insulin’s local action on the β-cells is the key factor that allows for expansion of β-cell mass, particularly in response to peripheral insulin resistance 27,136.  Insulin’s autocrine actions are also important for pancreatic β-cell function 23. Study of mice lacking insulin receptors specifically in β-cells (βIRKO) has shown that lack of insulin signalling in β-cells leads to reduced insulin secretion in response to glucose and progressive glucose homeostasis impairment 27,131. These effects are thought to be in part due to the reduction in expression of key genes such as glucokinase and solute carrier family 2 member 2 (GLUT2) 131. In βIRKO mice, β-cells also show reduced ability to increase their internal calcium (Ca2+) concentration that is required for insulin release 131. Together, these studies show that insulin’s autocrine actions are important for proper functioning of the pancreatic β-cells as well as their ability to respond to pathological conditions such as peripheral insulin resistance.  1.2.3  Insulin action in the periphery Insulin is a very important hormone with varied effects on many tissues. Insulin receptors are found throughout the body and one of their main functions is to promote uptake of glucose from the circulation into different cell types, such as the adipose tissue and muscle 120. Once insulin binds to its receptor, the downstream signalling leads to translocation of glucose transporter proteins, mainly solute carrier family 2 member 4 (GLUT4), to the plasma membrane. This allows active transport of glucose from the bloodstream, across the plasma membrane and into the cytosol 120,137-139. Although the adipose tissue is a target tissue for insulin stimulated glucose uptake, euglycemic and hyperglycemic insulin clamp studies have shown that the skeletal muscle is responsible for the majority of the insulin-dependent glucose uptake 140-142. Glucose uptake from  6 the circulation is very important, not only because cells require glucose for their metabolism and survival, but also because hyperglycemia can have adverse health effects 143-147. Although insulin is not the only factor, it is arguably the most important factor that allows different cell types to take the glucose from the circulation 137-139,148-151. In the white adipose tissue, where energy is stored as fat, insulin signalling allows for lipogenesis and prevents lipolysis 152. This allows the excess energy to be safely stored as fat 153. Fat is released from the adipocyte through the process of lipolysis 152. One of the major pathways in lipolysis starts at the plasma membrane of the adipocyte. When adenylyl cyclase is activated, by such factors as catecholamine-activated β1,2 adrenergic receptors, and leads to increased cyclic-adenosine monophosphate (cAMP) levels within the adipocyte 152,154. cAMP then activates protein kinase A (PKA) which in turn phosphorylates and activates lipolytic factors such as hormone sensitive lipase (HSL), adipose triglyceride lipase (ATGL), monoglyceride lipase (MGL), and perilipin 155-158. Insulin hinders lipolysis by activating phosphodiesterase-3B in an IRS1/PI3K/PKB manner, which hydrolyses cAMP into 5’AMP thus deactivating PKA 159. Insulin induced activation of phosphodiesterase-3B has also been reported to stimulate GLUT4 translocation to the plasma membrane of adipocytes thus increasing glucose uptake and lipogenesis 160,161. In the liver, where energy can be safely stored in the form of glycogen, insulin works to inhibit glycogenolysis and gluconeogenesis 162,163. Insulin increases the expression of genes, at the transcriptional level, involved in glycogen and lipid synthesis, such as glucokinase, phosphofructokinase, pyruvate kinase, acetyl-CoA carboxylase, and fatty-acid synthase 164. In contrast, insulin decreases the expression of genes that are involved in gluconeogenesis, such as glucose-6-phosphatase, fructose-1,6-bisphosphatase, and phosphoenolpyruvate carboxykinase 164.  7 Insulin also plays a role in phosphorylation and activation of enzymes that promote glycogen and lipid synthesis such as glycogen synthase and citrate lyase 164. Thus, insulin works on multiple tissues to allow for clearance of glucose from the bloodstream and safe storage of energy in appropriate tissues 52.  1.2.4 Central actions of insulin The brain responds to many central and peripheral signals. There are specialized receptors on the blood brain barrier that actively transport only insulin, with the exception of minute amounts of IGF-1, from the circulation into the brain 165,166. The amount of insulin crossing into the brain can change depending on the amount of circulating insulin 167. However, there is a point at which these receptors can be saturated, which restricts the further increase of insulin crossing into the brain 165,167,168. However, sites such as the median eminence are structured in such a way that the neuronal processes are in direct contact with the circulation 169. The hypothalamus, one of the major sites of insulin action in the brain, is situated near this area 169. Moreover, insulin receptors are expressed on many components of neurons, including neuronal processes and synapses 165,170. Thus, increasing insulin in the circulation, beyond the saturation of the insulin transporters, could potentially affect the hypothalamus differently than the rest of the brain 165,168.  Insulin that crosses from the circulation into the brain is not the only source of insulin within the brain. In some model systems, such as C. elegans and Drosophila, it is known that neurons are the cells responsible for the production of insulin-like peptides 10,11,14,18,33,171,172. In mammalian systems, elegant studies have shown expression of insulin in neurons, especially those of hippocampus and olfactory bulb, in vitro 44,48,60,173. In fact, in one study it was suggested that not only neurons are able to express one of the murine Insulin genes, but also that the lack of  8 expression of the murine Ins1 gene, but not the Ins2 gene, is because the Ins1 gene is actively silenced 173. However, one can argue that the in vitro expression of insulin can be an artifact of the cells having been removed from their natural setting and being cultured in an artificial environment. On the other hand, in vivo, it is hard to distinguish whether the insulin peptide in the brain has crossed into the central nervous system from the periphery or if it has been produced locally in the brain. In a recent study, a role for central insulin production was indirectly suggested by ablating neurons with ‘rat insulin promoter’, an Ins2 specific promoter, activity 174.  It has long been debated whether insulin is produced locally in the CNS in vivo, but due to lack of proper controls (such as comparing mice lacking either the pancreas-specific Ins1 or the multi-tissue-expressed Ins2), the debate continues 38-115. It is well accepted that within the brain, insulin plays key regulatory roles. Insulin can promote growth, survival, healthy function in neurons and memory 175. There are strong links between neurodegenerative diseases, such as Alzheimer’s, and metabolic diseases such as obesity, insulin resistance, and diabetes. In fact, people with metabolic disorders have much higher risk for Alzheimer’s disease or other neurodegenerative pathologies 176-214. Many trials have started, some with promising results so far, to test the effectiveness of treating dementia and memory loss by administration insulin nasally suggesting insulin has therapeutic potential for these disorders 190,199,215-237. Insulin also plays a key role in in the central nervous system in reward sensation, energy intake, storage and expenditure 238-240. In the arcuate nucleus of hypothalamus (ARC) there are populations of neurons that produce orexigenic neuropeptide Y (NPY) and agouti-related peptide (AgRP) as well as anorexigenic pro-opiomelanocortin (POMC) and cocaine- and amphetamine-regulated transcript (CART) 241,242. In all of these neurons, insulin’s binding to its receptor leads  9 to phosphorylation of PKB and its translocation to the nucleus. Then PKB phosphorylates FOXO1 leading to its exclusion from the nucleus. FOXO1 inhibits expression of anorexigenic genes and promotes expression of orexigenic genes. PKB has the opposite effect to FOXO1 with respect to the expression of these genes. Thus, insulin works in these neurons by promoting satiety and decreasing food intake 129,243-246. Leptin’s action on these neurons with regards to gene expression is similar to that of insulin 246,247. One puzzling fact about the effect of insulin on these neurons is that, unlike leptin, insulin decreases the firing rate of the anorexigenic neurons and increases the firing rate of the orexigenic neurons 248,249. Potentially, a balance between them provides even a greater control on whole body energy control. Insulin can also play a role in decreasing food intake by reducing the perceived reward from food intake. Insulin receptors are found on ventral tegmental area (VTA) neurons. The VTA is an important site for reward-seeking behavior that leads to increased food intake. Insulin can, through a retrograde endocannabinoid signalling, cause long-term depression (LTD) in excitatory neurons that synapse onto VTA, thus reducing food intake 250,251. Insulin in the brain is also important for whole body glucose sensing. Activation of insulin receptors in medial basal hypothalamus activates the ATP-sensitive potassium (KATP) channels of steroidogenic factor-1 (SF-1) neurons in a PI3K, phosphatidylinositol (3,4,5)-trisphosphate (PIP3)-dependent manner 252,253. This leads to inhibition of firing in these neurons. It then leads to a signal from the dorsovagal complex of the hindbrain, which is transmitted to the liver via the vagus nerve 253. This then leads to inhibition of gluconeogenesis in the liver through an IL-6 and STAT3 dependent pathway 248,249,252,254,255. Thus, insulin acts on the brain as a key signal for the preservation of energy balance and glucose homeostasis.   10 1.3 Metabolic syndrome Metabolic syndrome is a disorder of imbalance in energy storage and utilization. It is a collection of interrelated risk factors that promote the risk for obesity, heart disease, stroke, and type 2 diabetes 256. For a person to be diagnosed with metabolic syndrome, they will have to meet three of the five following criteria: 1) abdominal obesity with waist circumference of more than 102 cm in men and 88 cm in women, 2) hypertriglyceridemia of equal or more than 150 mg/dL (1.69 mmol/L), 3) low high-density lipoprotein (HDL) cholesterol of less than 40 mg/dL (1.04 mmol/L) in men and 50 mg/dL (1.29 mmol/L) in women, 4) high blood pressure of equal to or more than 130/85 mm Hg, and 5) high fasting glucose of equal to or more than 110 mg/dL (≥6.1 mmol/L) 257. With abundance of high energy food and increasingly sedentary lifestyle, metabolic syndrome is increasing at an alarming rate causing a great load on health care and decreasing the quality of life for many 256.  1.3.1 Diabetes 1.3.1.1 Diabetes: A global epidemic It is well established that obesity is a strong risk factor for diabetes, especially type 2 diabetes 258-261. The incidences of both major types of diabetes are also dramatically on the rise 262,263. Moreover, what used to be considered mainly an adult and elderly disease, is now also a concern for children and adolescents 264. In Canada, it is projected that the cost of dealing with diabetes and related complications will rise to nearly $17 billion by 2020, putting a great burden on the Canadian economy and health care 265. Diabetes mellitus is a complex disease and is divided into two main categories, type 1 and type 2. Both of these pathologies are mainly marked by  11 reduced functional β-cell mass; when β-cells can no longer efficiently produce, process, and release insulin efficiently, an inability to control glucose homeostasis is the result 266.  1.3.1.2 Type 1 diabetes mellitus Type 1 diabetes is the less prevalent of the two main types of diabetes. Although the exact cause of it is unknown, it is known to be an autoimmune disorder 116. Studies in non-obese diabetic mice have shown that, in contrast to the pancreas-specific Ins1 gene, the Ins2 gene expression in the thymus plays a protective role in a dose dependent manner in the pathology of type 1 diabetes mellitus 36,267. The human INSULIN gene has also been reported to be expressed in the thymus and is associated with protection from type 1 diabetes 268. Normally the thymus tolerizes the body’s immune system towards insulin 35,269, meaning that the immune system correctly recognizes insulin as a ‘self’ peptide and thus will not launch an immune reaction towards it. However, in some people, the immune system will incorrectly recognize insulin as foreign and will initiate an autoimmune response 270. In this case, the immune cells attack insulin-producing β-cells and kill them. This destroys a majority of the body’s insulin producing cells, leaving a person with type 1 diabetes almost completely insulin deficient and unable to control blood glucose homeostasis 269,271. This is most commonly treated clinically by regular blood glucose level monitoring and insulin injections by the patient 116,266,272, although other successful treatment avenues such as islet transplantation also exist 273.  1.3.1.3 Type 2 diabetes mellitus Type 2 diabetes constitutes the majority of cases of diabetes mellitus 262,263. Unlike type 1 diabetes, type 2 diabetes is generally characterized by resistance to actions of insulin and abnormal  12 and/or increased insulin secretion. Type 2 diabetic patients are initially not insulin-dependent 119,120. In response to increasing insulin resistance, β-cells release more insulin in an effort to maintain glucose homeostasis and prevent hyperglycemia. This can lead to insulin depletion, release of immature insulin peptide, loss of insulin secretion pulsatility, increase in β-cell mass, and ultimately β-cell exhaustion and death 27,136,274-281. Aside from lifestyle changes, such as diet and exercise, many patients are also treated with a variety of insulin sensitizing agents such as Metformin 282. Though only in some cases, late stage type 2 diabetes with β-cell exhaustion and apoptosis, insulin therapy is required, some believe insulin therapy actually prevents β-cell exhaustion 119,135,283-290.  1.4 Obesity 1.4.1 Obesity: A poorly understood disease that is rapidly on the rise Obesity is a worldwide epidemic with increasing prevalence, and it is a major independent risk factor for heart disease, hypertension, stroke, type 2 diabetes, cancer, hepatic steatosis, and many other diseases 291,292. The molecular causes of obesity remain largely unexplained, despite the identification of common gene variants that contribute modest risk 293. Obesity is defined as having excess body fat and is frequently quantified using the body mass index (BMI); a BMI over 25 and below 30 is considered overweight and a BMI over 30 is considered obese 294. The adipose tissue serves a very important role as the storage site for excess energy 152,294-296. If the energy intake is greater than that of energy expenditure, the body must safely store these extra calories for when they are needed 297. It is thought that this mechanism evolved to protect against starvation when food is scarce 297-300. However, in many of today’s societies, energy-dense foods are freely available and people’s lifestyles are becoming increasingly sedentary. Thus, even a small  13 imbalance (a net positive balance) in energy intake and expenditure over time can lead to over-storage of energy as fat and ultimately to obesity 294,300.  1.4.2 Obesity and energy balance Energy intake is essential to the survival of any organism. When food is ingested it is transformed into a usable form for the body and used to fuel bodily functions and desired activity and excess energy is stored for later use 130. Thus, carbohydrates, as well as amino acids, free fatty acids, and ketone bodies, are converted to adenosine triphosphate (ATP) through cellular respiration in the mitochondria within the cells 130,301. The ATP produced can then be used to fuel all of our activities. Energy expenditure is measured by calorimetry and is generally looked at in two ways, direct and indirect calorimetry. Direct calorimetry refers to the amount of heat produced and indirect calorimetry is the amount of oxygen consumed 301. Energy expenditure can be grouped in three main categories: 1) obligatory energy expenditure, 2) adaptive thermogenesis, and 3) physical activity 130,301.  Obligatory energy expenditure is generally responsible for the majority of the total energy expenditure in a relatively sedentary adult 130. Obligatory thermogenesis and basal metabolic rate (BMR) belong to this category. BMR defines the amount of energy required to perform the cellular and organ function of a resting organism at a thermo-neutral environment, which is approximately at 28°C for adult humans. BMR is also referred to as resting metabolic rate 301,302. For mice, the thermo-neutral environment is approximately at 30°C 303. Adaptive thermogenesis is dynamically controlled and can respond quickly to the environment and internal body state 304-307. For example, exposure to cold can effectively and significantly increase adaptive thermogenesis, with a two to four fold increase in oxygen consumption 304,305. The acute response to cold exposure can include  14 shivering 306. However, with continued cold exposure the organism adapts and shivering is replaced by non-shivering thermogenesis 304-306. Adaptive thermogenesis is the increased heat production from cellular respiration 308,309. The heat produced is due to increase in ‘futile cycles’ or ‘mitochondrial uncoupling’ and the uncoupling protein 1 (UCP1) is a key factor in this process 308,310. UCP1 is a protein on the inner mitochondrial membrane and allows for the leakage of protons from the mitochondrial matrix. Other variations of this protein, such as UCP2 and UCP3, also exist but some studies suggest that they do not contribute significantly to whole body adaptive thermogenesis and weight control in mammals 311. Elimination of the proton gradient allows for heat production instead of ATP synthesis 302. The main tissue responsible for adaptive thermogenesis is the brown adipose tissue (BAT), however, mitochondrial uncoupling does take place in other tissues such as skeletal muscle 306.  Adaptive thermogenesis is highly regulated by the brain, specifically the sympathetic nervous system (SNS) 312-316. Studies have shown that treatment with sympathomimetic agents, such as β-adrenergic receptor agonists increases adaptive thermogenesis in amounts comparable to that of cold exposure 312,313,317. Conversely, administration of SNS blockers hindered the cold-induced increase in adaptive thermogenesis 28. Similarly, knocking out the dopamine β-hydroxylase gene, responsible for expression adrenaline and noradrenaline, also prevented cold-induced thermogenesis 317,318. This central control of adaptive thermogenesis could have very important implications in understanding the physiological basis of obesity. For example, hypothalamus is often studied for its role in control of food intake. However, studies have shown that hypothalamic lesions can also lead to obesity even if the food intake is restricted to equal that of control subjects 319. It is believed that leptin, an adipocyte derived hormone, plays an important role in this process. Leptin is released in proportion to the amount of body fat. Thus, it serves as a  15 signal of the available energy stored in fat 320. There also is a role played by the hypothalamic-pituitary-thyroid axis on adaptive thermogenesis. Changes in thyroid hormone levels parallel those in energy expenditure, which is partly mediated by changing leptin levels that mediate the expression of the hypothalamic thyrotropin-releasing hormone 321-323. These studies show that there is a very important physiological link between obesity and adaptive thermogenesis. Physical movement, such as exercise, is another way of expending energy. Active muscles can efficiently take up fuels from their surroundings and convert them to the ATP that is required by the muscle fiber to produce movement 130,324. Exercise increases the daily skeletal muscle-induced energy expenditure from 15% in sedentary subjects up to 40% of the total daily energy expenditure in athletes, reducing energy surplus and its storage as fat 325. However, some studies have suggested that, unlike normal weight subjects, patients with obesity and the elderly show a compensatory reduction in non-exercise activity thermogenesis 326,327. Non-exercise activity thermogenesis is the energy we expend for anything other than sleeping, eating, and exercise 328. By doing so, exercise did not significantly contribute to weight management in obese patients and the elderly 326,327. In summary, the three main categories of energy expenditure, obligatory energy expenditure, adaptive thermogenesis, and physical activity, constitute how energy is expended. If the energy intake exceeds its expenditure it will lead to increased internal energy storage and increased weight gain.   1.4.3 Diet and obesity While heritability can have a strong effect on obesity 297,299,300,329-332, the type of food, such as diets high in long-chain saturated fatty acids, that is consumed can greatly affect weight gain 333-336. Food consumption is also needed to provide the body with the essential macromolecules,  16 such as amino acids, that are needed for protein synthesis. To some extent, the body regulates the intake of different nutrients differently. For example, if a low-protein diet is consumed, the organism will increase its food intake to ingest enough protein to sustain protein synthesis, which will lead to increase in total energy intake 337,338. Similarly, if a high-fat diet is consumed, the body cannot readily and acutely change its pattern of fuel oxidation and more food will be ingested until appropriate amount of energy is consumed 339. Moreover, fat has a lower metabolic efficiency than carbohydrates; thus, a larger amount of a high-fat diet is needed to be consumed, compared to a calorie-matched diet with higher carbohydrate ratio, to produce the same amount of usable energy for the body 340. Thus, to achieve energy homeostasis without over-consumption, the appropriate amounts of different necessary nutrients are needed in a healthy diet. In addition to the physiological need for different nutrients, there is also an evolutionarily conserved hedonic aspect to food consumption 341.  1.4.4 Molecular changes in obesity 1.4.4.1 Obesity and adipose tissue Obesity is defined by excessive fat accumulation in the body 294. Fat can accumulate in a variety of organs, but it is ideally stored in the white adipose tissue. While the adipose tissue is known for its role in energy storage, it is also an important endocrine organ 342. Adipose tissue is responsible for releasing different metabolites, hormones and other factors, whose production and release can change in obesity 342-344. Increased release of non-esterified fatty acids from adipocytes is thought to negatively affect insulin sensitivity and overall health 345,346. It has been shown that insulin sensitivity can be greatly decreased within hours by acutely increasing circulating fatty acids 347. Conversely, if anti- 17 lipolytic agents are administered and fatty acids levels are decrease acutely, enhanced insulin sensitivity results 348. Increased delivery of fatty acids to different tissues such as the liver, muscle, and fat can cause insulin resistance 349,350. Increased circulating fatty acids can increase intracellular fatty acid metabolites, such as diacyl glycerol, that activate protein kinase C (PKC) 351,352. This leads to decreased insulin sensitivity by activating various serine/threonine kinases that can block activation of IRS-1 and IRS-2 352-354. Activation of PKC also activates factors such as JUN-1 terminal Kinase 1 (JNK1), inhibitor of nuclear factor kappa-B kinase subunit beta (IKKβ), and p38 mitogen-activated protein kinase (MAPK) that can both directly inhibit insulin signalling by phosphorylating IRS proteins at their inhibitory sites or by inducing expression of suppressor of cytokine signalling 3 (SOCS3) that also has the same inhibitory effect on IRS proteins 343,355,356. Moreover, increased circulating fatty acids can activate toll-like receptor 4 (TLR-4) and elicit similar effects through JNK1, IKKβ, and MAPK 357-360. Another factor that can activate TLR-4 pathway is the presence of the reactive oxygen species, which also reduces insulin signalling 357-360. An increase in intracellular fatty acid concentrations leads to their usage in mitochondrial uncoupling and β-oxidation, thus producing increasing amounts of reactive oxygen species and ultimately activating aforementioned insulin desensitizing factors 361-363.  The adipose tissue also secretes hormones such as leptin and adiponectin 364-369. Leptin is released in proportion to the body’s fat stores, and is thought to control energy balance by affecting the central nervous system 246,247. As shown in models of diet-induced obesity, chronically high levels of circulating leptin can lead to central and peripheral leptin resistance, decreased activation of Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway 370-376. Leptin resistance is associated with increased SOCS3 activity 370-376. Studies have shown that SOCS3 activity is a key factor in leptin resistance; for example, in the case of the Tyr-985 mutation  18 in the leptin receptor which is a SOCS3 binding site, leads to increased leptin sensitivity resistance to diet-induced obesity 370,373,374,377-379.  Adiponectin is released in amounts that are inversely proportional to fat stores, and can have insulin-sensitizing effects 380-382. A recent study has suggested that reduced adiponectin levels in obesity are related to the amount of bone marrow adipose tissue, which is inversely proportional to whole-body adiposity. Thus, the authors suggested that marrow adipose tissue has a higher influence on circulating adiponectin levels leading to decreased circulating adiponectin in obesity 383.   1.4.4.2 Adipose tissue subtypes The two biggest subcategories of adipose tissue are the white and brown adipose tissue. These different types of fat tissue have very distinct histological features, as well as partially distinct developmental origins 384. Brown adipocytes generally are multilocular (have multiple fat droplets) and have a very high number of mitochondria, whereas the white adipocytes are unilocular 384. In fact, it is reported that brown adipocytes, like skeletal muscles, arise from central dermomyotomes, since they express the transcription factor Myf5. This potential shared origin with muscle may be related to the propensity of brown adipose tissue to have high numbers of mitochondria, which leads to high energy consumption; features that are not shared with the white adipocytes 385-387. Although this notion has been recently challenged that neither all brown adipocytes come from a Myf5-positive background nor do all white adipocytes come from a Myf5-negative background 388. Moreover, other gender- or depot-specific factors may play a role in directing the fate of the adipocytes 388. Nonetheless, whereas white adipocytes are generally responsible for the storage of energy, the UCP1-expressing brown adipocytes can play a major  19 role in producing heat and therefore consume energy 384. A high-fat diet can stimulate the brown adipocytes to increase their energy consumption and diet-induced thermogenesis, to preserve energy balance 389.  White adipocytes are derived from mesenchymal stem cells 390,391. Two genes whose lack of expression in white adipocyte, either visceral or subcutaneous, is reported to differentiate them from brown adipocytes in mice are HoxC4 and HoxA1 390. Similar pattern of gene expression is also seen in human white and brown adipocytes 390. In mature adipocytes, expression of Leptin is a hallmark of white adipocytes 390. The leptin-producing white adipocytes generally play a predominant role in storing energy for later use 384. The distribution of the white adipose tissue (WAT) within the body is also of great importance. Central adipose depots, mainly abdominal, have been established to have more deleterious effects on insulin sensitivity than peripherally distributed adipose depots 392. Men are reported to have a more central distribution of fat, also known as “apple shaped” and women are reported to have more peripheral, or “pear shaped” fat distribution 393. Intra-abdominal adipose depots are larger, are more lipolytic, and are less responsive to the anti-lipolytic effects of insulin compared to subcutaneous adipose depots 394. Moreover, in intra-abdominal obesity, fatty acids released from centrally located white adipocytes will be directly delivered to the liver via the portal vein thus having a greater pathophysiological impact on this organ 394,395. There is a third type of adipocyte that is known as beige, bright, or brown-in-white adipocytes. These cells are more prominent within the subcutaneous tissue than in other WAT depots. These cells share some features with brown adipocytes, including being rich in mitochondria rich and a multilocular structure 396-398. These cells can also express genes, such as UCP1, that are normally expressed virtually exclusively in brown adipocytes 396. The emergence  20 of bright adipocytes are induced via various factors such as cold, peroxisome proliferator-activated receptor gamma (PPARγ) or β-adrenergic agonists, and factors that lead to the increase of cyclic-guanosine monophosphates like PDE5 inhibitors 396-399. The beige adipocytes can either transdifferentiate from white adipocytes or differentiate from progenitor cells 400. Moreover, it has been suggested that the browning of white adipocytes is an important factor that can contribute to the regulation of whole body metabolism and can ameliorate high fat diet-induced obesity 387,401-404.  1.4.4.3 Obesity, adipose tissue, and inflammation Adipose tissue is also responsible for the release of other factors, such as retinol binding protein-4, plasminogen activator inhibitor-1, resistin, interleukin-6 (IL-6) and tumor necrosis factor-α (TNFα), that are increased in obesity and counter insulin’s actions in its target tissues 355,405-412. The last two factors, IL-6 and TNFα, are pro-inflammatory cytokines that also induce systemic inflammation by inducing their own expression and increased release from both adipocytes as well as adipose tissue macrophages 408-412. The obesity-induced inflammation is milder and more prolonged than the inflammatory response to infectious disease 408-412. Though adipocytes are capable of producing pro-inflammatory cytokines, the majority of the cytokines are produced by the adipose tissue macrophages, whose recruitment to the adipose tissue is increased in obesity 413,414. Thus, in obesity there is an increase in inflammation of the adipose tissue and increased infiltration of immune cells, which may ultimately promote insulin resistance 413.   21 1.4.4.4 Obesity and liver function The liver plays a key role in glucose homeostasis, and liver function is affected in obesity 350106,125,126. Insulin plays an important role in the liver to promote glycogen synthesis and inhibit glucose production by reducing the activity of glycogen synthase kinase-3 and therefore increasing the activity of glycogen synthase, as well as decreasing the activity of the transcription factor FOXO1, which promotes expression of gluconeogenic genes 120,415,416. Increased inflammation can lead to hepatic insulin resistance and thus dysregulation of glycogen synthesis and glucose production in the liver 120,413,415. Moreover, as a result of large amounts of fatty acids delivered to the liver in obesity, lipid accumulation as well as oxidation is increased in this organ 350. The increased mitochondrial lipid oxidation in liver results in the production of reactive oxygen species 361-363. Increased levels of cellular reactive oxygen species can activate pathways involving JNK1, IKKβ, and p38 MAPK 357-360. These then stimulate expression of genes, such as SOCS-3, that ultimately lead to phosphorylation of serine/threonine inhibitory sites on the IRS-1 and IRS-2 proteins leading to insulin resistance in hepatocytes 361-363. This insulin resistance then results in an increase in expression of genes such as sterol regulatory element binding protein 1, a transcription factor that works to direct fatty acids away from the mitochondria, promotes the synthesis and accumulation of lipids in the liver, and ultimately leads to hepatic steatosis 417-420. Moreover, increased accumulation of reactive oxygen species can lead to deceased cellular antioxidant defenses in the hepatocytes 421. When the cellular defenses fail to reduce the level of reactive oxygen species, mitochondria are among the first organelles to be damaged which leads to peroxisomal fatty acid oxidation, thus increasing the amount of reactive oxygen species and exacerbating the situation 421-423. This can potentially increase the cellular stress enough to activate apoptotic sequences in the hepatocytes 424. This can lead activation of hepatic Kupffer cells, which  22 are responsible for production of pro-inflammatory factors in liver 425, such as chitotriosidase 426,427. Chitotriosidase in turn stimulates the hepatic stellate cells to produce collagen leading to hepatic cirrhosis 428. Adipokines also play a role in hepatic metabolism. For example, leptin is involved in expression of hepatic lipogenic genes in liver, promote oxidation of fatty acids and increase resistance to hepatic steatosis 429-432. Thus, in the state of metabolic stress, such as obesity, leptin resistance, proper lipid metabolism in liver could potentially be hindered 433,434. Adiponectin, another important adipokine, works to reduce lipid accumulation in the liver and its reduced levels in obesity can contribute to hepatic steatosis 435.  1.4.4.5 Obesity and insulin resistance in skeletal muscle Approximately 70-90% of insulin-dependent glucose is taken up by the skeletal muscles 142,436. Glucose uptake is promoted by insulin through translocation of glucose transporter proteins 4 (GLUT4) to the plasma membrane in a PI3K/PKB-dependent manner 436. Obesity-induced inflammation has been reported to be one of the major contributors to insulin resistance in muscle, which is one of the earliest defects detected in those who may go on to progress to type 2 diabetes 349,436,437. Since muscle is one of the major tissues responsible for insulin stimulated glucose uptake, it is logical to think that insulin resistance in muscle would have deleterious effects on whole body physiology. Using muscle-specific insulin receptor mice, it was shown that muscle insulin resistance leads to increased adiposity and circulating fatty acids and triglycerides 438. This is probably due to carbohydrates being shunted away from muscles and ultimately taken up by the adipose tissue. Although reduced glucose uptake is one of the most studied changes in skeletal muscle in the context of obesity, other unfavourable changes do take place. For example, leptin promotes fatty acid oxidation and reduced lipid accumulation in the skeletal muscle through an  23 AMPK-dependent pathway 430,439-441. Thus, peripheral leptin resistance, as seen in obesity, can adversely affect metabolism and lipid accumulation in skeletal muscle 373,439.  1.4.4.6 Obesity and pancreas function The endocrine pancreas is another organ that can be affected by obesity. In general, the pancreatic islets are able to respond to increased insulin demand from obesity-induced insulin resistance 442-444. Pancreatic islets can effectively respond and increase in size through β-cell hyperplasia and hypertrophy.  Increases in both cell number and cell size have been reported in obese humans, but an increase in beta-cell number is most often reported in rodent models 445-447. Uptake of glucose and its metabolism is key in inducing insulin secretion in β-cells. In obesity and insulin resistance, glucose metabolism is increased to allow for increased insulin release through increased activity of glucokinase, the rate-limiting enzyme in glucose metabolism 448,449. Fatty acids potentiate insulin release from β-cells by either binding to the G-protein coupled receptor 40 or leading to increased intracellular acyl-CoA concentration, both of which result in increased intracellular Ca2+ concentration 284,450,451. However, chronic exposure of β-cells to high levels of fatty acids can lead to both impaired glucose-stimulated insulin release as well as reduced insulin biosynthesis, thus impairing the function of the endocrine pancreas 452,453. For example, with increased demand for insulin and chronic high release of insulin from β-cells, the usual pulsatility seen in insulin release is lost and a continues pattern of insulin release could potentially contribute to further exacerbate insulin resistance 274. Moreover, chronic increase in insulin release will also disproportionately increase the β-cell levels of immature proinsulin and also its release which can also contribute to reduced insulin action 454. Our laboratory has previously shown that exposing primary human pancreatic β-cells and MIN6 cells to high levels of the fatty acid palmitate  24 leads to decreased protein levels of carboxypeptidase E, a key enzyme in the insulin processing pathway 121. Our laboratory showed that palmitate-induced decrease in carboxypeptidase E leads to a disproportionate increase in proinsulin to insulin ratio as well as endoplasmic reticulum stress and β-cell apoptosis 121. Loss-of-function mutations in carboxypeptidase E have been shown to lead to obesity, β-cell malfunction and failure, and type 2 diabetes in mice 121,455-458. Obesity is a strong risk factor islet health and function as it can lead to impaired β-cells function and ultimately failure. In fact, the majority, ~90%, of those with type 2 diabetes are also either overweight or obese 259-261.  1.4.4.7 Obesity and the central nervous system Central nervous system structures, such as the hypothalamus, play key roles in energy balance, are also affected in diet-induced obesity. High-fat feeding is associated with increased CNS levels of pro-inflammatory genes, such as TNFα, Il-6, JNK, IKK, and SOCS3, in the hypothalamus. These pro-inflammatory cytokines then act to inhibit the energy-balancing effects of insulin and leptin in the brain 247,459-464. Moreover, the hypothalamus also plays a role in glucose homeostasis through its effect on the control of gluconeogenesis in the liver. High fat diets have been shown to reduce the accumulation of long chain fatty acid-CoAs in the hypothalamus that is required for control of hepatic glucose production 465,466. This is believed to be due to ability of the high fat diet to reduce the hypothalamic expression of malonyl-CoA which leads to increase in hypothalamic carnitine palmitoyltransferase I and ultimately reduction in hypothalamic long chain fatty acid-CoAs 465,466. Thus, multiple organs, peripheral or central, can be impaired due to high fat diet or obesity and exacerbate its associated pathophysiological state.   25 1.5 Hyperinsulinemia 1.5.1 Hyperinsulinemia can precede obesity or insulin resistance Obesity research has benefited from animal models, where genetic and environmental factors can be manipulated in ways that are impossible with humans. The ob/ob and db/db mice are such examples. The underlying cause of their phenotype is lack of leptin or its receptor, respectively 365,467. There are also reports of humans with mutations in their leptin gene, who are also obese and hyperinsulinemic and their symptoms are normalized with leptin treatment 468-472. Both the ob/ob and the db/db mice also show notable hyperphagia, insulin resistance, and hyperinsulinemia 467,473-475. Since obesity can promote insulin resistance, it is logical to think that these mice become hyperinsulinemic to compensate for the obesity-induced insulin resistance. However, hyperinsulinemia in these mouse models is observed prior to any deviation from expected normal weight or glycemia compared to littermate controls 476. This existence of hyperinsulinemia prior to obesity, insulin resistance, or hyperglycemia has been documented in other animal models of obesity, such as Zucker fatty rats 477. Similarly, results from numerous human studies have also suggested that an increased insulin level is correlated with risk of later development of obesity 25,478-487. Moreover, some studies suggested that humans with class I allele VNTR in the INSULIN gene produce and release more insulin from the pancreatic islets and are also more susceptible to obesity 488-490, though this observation remains controversial 491. On the other hand, studies of invertebrates with reduced insulin or insulin signalling have reported leaner, smaller bodies, along with increased lifespan 33,171. Similarly, studies in mammalian models, such as the Zucker fatty rats, have also shown that treatment with diazoxide results in decreased insulin secretion, reduced weight and improved glucose intolerance 492-498. Similarly, treatment of obese patients with diazoxide, a compound that reduces insulin secretion, is associated with weight loss  26 in some small clinical trials 499,500. Lustig and his group found similar results using Octreotide, a somatostatin agonist that binds the sst5 somatostatin receptor, found on -cells, which inhibits insulin release 501-503. Therefore, such observations have raised the question of whether hyperinsulinemia itself is a primary defect in obesity.  1.6 Thesis investigation Insulin and insulin-like peptides are some of the most studied hormones across species and have pivotal physiological roles, such as glucose homeostasis, control of adipose tissue form and function, energy balance, and control of food intake 35,119,120,238-240,269. In mice, two insulin genes exist, and studies have suggested that they are partially redundant and capable of compensating for the loss of the other 504. Other studies, such as those comparing the effect of the expression of the Ins1 versus Ins2 in the thymus in the context of type 1 diabetes have shown that the two genes are not entirely redundant 184,430. Studies in other model systems, such as C. elegans and Drosophila melanogaster, have pointed to a role for insulin-like peptides in promoting weight gain and reducing longevity 171,505. However, the effects of Ins gene dosage, and ultimately insulin levels, on glucose homeostasis and obesity have not been tested in mammals in a normal physiological context. Studies in mammals have pointed to cell type-specific roles for the insulin receptor in diet-induced obesity. For example, fat-specific insulin receptor knockout mice are protected from diet-induced obesity and have extended longevity 29,506, while eliminating insulin receptors from the brain has the opposite effect 507. The interpretation of studies involving insulin receptor ablation is confounded by compensation between tissues and disruption of insulin-like growth factor signalling involving hybrid receptors 25,29. Moreover, knockout of the insulin receptor, by  27 definition, induces tissue-specific insulin resistance, which alone can promote hyperglycemia and insulin hypersecretion 25,85. Studies of fat-specific insulin receptor knockout mice, though elegant, were unable to specifically determine the role of hyperinsulinemia on obesity in the absence of confounding insulin resistance. We aimed to study both the peripheral and central role of insulin by genetically manipulating insulin gene dosage and also importantly without causing any global or tissue specific insulin resistance. We took advantage of the pancreas-specific expression of the murine Ins1 gene to demonstrate that diet-induced hypersecretion of pancreatic insulin promotes obesity and its associated complications.  28 Chapter 2: Materials and methods 2.1 Experimental animals Ins1-/- and Ins2-/- mice were previously generated and described by the group of Jacques Jami (INSERM) in 1997 504. Ins1 was disrupted and most of its sequence was replaced by a neo cassette. Most of the Ins2 sequence was replaced by a LacZ/neo cassette as described 504. For genotyping, tail samples were collected and the DNA was isolated using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Details of the genotyping primers can be found in Table 2.1. For the studies described herein, groups of mice were divided into two diet groups at weaning (3 weeks), one group was kept on the control diet (total calories = 3.81 kcal/g; 25.3% calories from fat, 19.8% calories from protein, 54.9% calories from carbohydrate; Catalog #5015 Lab Diets, Richmond, IN) and the other group was put on a high-fat diet (total calories = 5.56 kcal/g; 58.0% calories from fat, 16.4% calories from protein, 25.5% calories from carbohydrate; Catalog # D12330 Open Source Diets/Research Diets, New Brunswick, NJ). Diets are compared in more detail in Table 2.2. After 52 weeks of age, mice were scanned for whole body fat to lean mass ratio using NMR Spectroscopy at the 7T MRI Research Center at the University of British Columbia (Vancouver, BC).  2.2 Glucose tolerance, insulin tolerance, and hormone secretion Body weight and fasting glucose (OneTouch glucometer, LifeScan Canada, Burnaby, BC) were examined weekly after a 4-hour fast. Mice were fasted at approximately 8 am (one hour after the start of light cycle). Glucose tolerance was examined after intraperitoneal injection with 11.1 µL per gram of body weight of 18% glucose in 0.9% NaCl saline. Insulin tolerance tests were assessed after injecting 0.75 U of insulin (Lispro Humalog VL-7510 in 0.9% NaCl solution) per gram of body weight. Serum insulin levels were measured using ultrasensitive mouse insulin ELISA kit (80-INSMSU-E01; ALPCO Diagnostics,  29 Salem, NH) and leptin levels were measured using mouse leptin ELISA kit (90030) from CrystalChem Inc. (Downers Grove, IL). Blood samples were collected from tail vein.  2.3 Metabolic cage analysis At 8 and 24 weeks of age, mice (n = 3-5 per genotype) were individually housed in PhenoMaster metabolic cages (TSE Systems Inc., Chesterfield MO) for indirect calorimetry. The cages were also equipped with food, drink and body weight monitors and an infrared beam grid to monitor activity in the x, y and z axes. Cages were placed in an environmental chamber to maintain constant temperature (21°C), with room lighting cycles (12 hr light, 7 am - 7 pm). Animals remained in the cages for 76 hours. Data from the first 4 hours were not used in analysis. Results from each of the 3 days were averaged and presented as a prototypical day for each genotype.   2.4 Tissue collection and analysis Mice were euthanized and tissues were collected and some samples were frozen instantly in liquid nitrogen and transferred to -80°C freezer for storage, while other samples were fixed in 4% paraformaldehyde (PFA) for tissue sectioning. Some brain samples were, post-PFA fixation, also dipped in optimal cutting temperature compound (OCT) and were frozen in an isopropanol/dry ice bath. Tissues collected were as follows: pancreas, epididymal fat pads, soleus muscle, liver, brain, kidney, spleen, heart, thymus and tibia. Tibias were placed in 2% KOH for removal of non-bone tissue for physical measurements. Serial paraffin sections were made at 5 µm thickness and serial frozen sections were made at 14 µm thickness. Tissue sections were prepared at Child and Family Research Institute Histology Core Facility (Vancouver, BC). Pancreatic islet morphology and hormone expression were approximated using the insulin positive area from three tissue sections 200 µm apart stained with guinea pig anti-insulin and rabbit anti glucagon (Linco/Millipore).  30 Alexa Fluor 488 and 594 raised in goat were used as secondary antibodies of choice (Life Technologies, Abtenau, Austria). Primary antibodies were diluted 1:100 and secondary antibodies were diluted 1:400. Incubations with primary antibodies were done overnight at 4 °C and secondary antibody incubations were done for one hour at room temperature. Sections were mounted in Vectashield solution with DAPI (Reactolab SA, Switzerland) and imaged through a Zeiss 200M inverted microscope equipped with a 10x (1.45 numerical aperture) objective, individual filter cubes for each color, and a CoolSnap HQ2 Camera (Roper Scientific). Images were analyzed using Slidebook software (Intelligent Imaging Innovations) as previously described 121.  For the analysis of cultured hippocampal neurons, pregnant mice or rats were euthanized 1 day before timed birth and their hippocampi collected, cultured and fixed using paraformaldehyde. Slides were stained with rabbit anti-C-peptide 2 which would be expected to recognize C-peptide 2 as well as proinsulin 2 (Millipore catalog # 4020-01). It was confirmed independently, using islets from our knockout mice as negative controls, that this antibody specifically recognizes the C-peptide of insulin 2 but not insulin 1 (Fig. 3.6). In some studies, we also employed an antibody that only recognizes mature insulin (Biodesign, mAB1)508, and a guinea pig antibody expected to recognize mature and immature forms of insulin (Sigma). In order to determine whether insulin was being produced by neurons, we identified the endoplasmic reticulum using a calnexin antibody (Sigma). Neurons were marked with a mouse anti-NeuN antibody or identified morphologically after transfection with Green Fluorescent Protein (GFP).   31 2.5 Gene expression analysis Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Valencia, CA, Biosciences). 100 µg of RNA was used and cDNA was synthesized using qScript cDNA synthesis kit (Quanta, Biosciences). cDNA was subjected to Taqman real-time PCR (StepOnePlus, Applied Biosystems). PerfeCta qPCR supermix (Quanta, Biosciences) was used to perform the PCR in StepOnePlus real-time PCR system (Applied Biosystems). Primers and probes are listed in Table 2.3. PCR conditions were 2 min at 50 °C, 10 min at 95 °C and followed by 40 cycles of 15 sec at 95 °C, 1 min at 60 °C. Actb was used as the internal control. Reverse log of the raw values were used for analysis. The mouse brain cDNA panel (MDRT101) and human brain cDNA panel (HBRT101) were purchased from Origene (Rockville, MD). The human INSULIN probe set (Hs00355773-m1) was from Applied Biosystems. Analysis of gene expression patterns in WAT, liver, and skeletal muscle was performed using custom Taqman mini-arrays. Each 96-well PCR plate was divided in half with 45 genes of interest and 3 internal controls (18S, β-actin/Actb, hypoxanthine guanine phosphoribosyl transferase 1/Hprt1). Genotypes, from the same diet group, were then compared on the same plate, side-by-side. We chose genes involved in lipid metabolism, insulin signalling, as well as several adipokines, inflammatory factors, and other genes believed to play a role in the pathogenesis of obesity. These genes are listed in Table 4.1.  2.6 Statistical analysis All results are expressed as means ± SEM. For glucose tolerance, insulin tolerance and insulin secretion tests statistical analysis was performed on values obtained from measuring area under the curve (AUC). The AUC is the area between the x-axis and line formed by connecting  32 the y-values. For insulin tolerance studies area over the curve (AOC) was used. Since the insulin tolerance studies are presented as percentage change from the basal four-hour fasted values, the AOC is the area between the y-values and a line drawn at y = 100. Statistical analysis was performed using Prism 5 (Graphpad). Two tailed t-test or two way ANOVA or one-way ANOVA followed by Tukey's HSD was used where appropriate. For all experiments p < 0.05 was considered to be significant.    33 2.7 Tables Table 2.1 Primers used for genotyping the presence or absence of Ins1 or Ins2 alleles. Gene Sequence 5'-3' Anealing Temperature °C PCR Product (bp) Ins1 & Neo CCAGATACTTGAATTATTCCTGGTGTTTTATCAC 60 273 Ins1 & 550 Neo GCT GCA CCA GCA TCT GCT CCC TCT ACC TTC TCG GCA GGA GCA AGG TGA GAT GAC Ins2 TGC TCA GCT ACT CCT GAC TG 54 193 GTG CAG CAC TGA TCT ACA AT LacZ ACG GCA CGC TGA TTG AAG CA 59 420 CCA GCG ACC AGA TGA TCA CA      34 Table 2.2 Comparison of the control medium fat and the high fat diets. Diet 5015 (CD) D12330 (HFD) Protein 19.805 kCal% 16.4 kCal% Carbohydrate 54.858 kCal% 25.5 kCal% Fat 25.337 kCal% 58.0 kCal% Total Calories 3.81 kCal/g 5.55 kCal/g Type of Fat Lard Hydrogenated Coconut Oil                   35 Table 2.3 Quantitative PCR Taqman primers used to measure the levels of Ins1 and Ins2 gene expression. Gene Description Sequence Ins1 Forward GAA GTG GAG GAC CCA CAA GTG Reverse ATC CAC AAT GCC ACG CTT CT Probe /56-FAM/CCC GGG GCT TCC TCC CAG CT/3IABlk_FQ/ Ins2 Forward GAA GTG GAG GAC CCA CAA GTG Reverse GAT CTA CAA TGC CAC GCT TCT G Probe /56-FAM/CCT GCT CCC GGG CCT CCA /3IABlk_FQ/ Actb Forward CAG TAA CAG TCC GCC TAG AA Reverse CTA GCA CCA TGA AGA TCA AGA Probe /56-FAM/ACA CAG AGT ACT TGC GCT CAG GA/3IABlk_FQ/   36 Chapter 3: Expression patterns of murine Ins1 and Ins2  Rodents have become a very useful research tool for understanding mammalian biology as well as the biology of human disease. For example, the study of diabetes and obesity has benefited vastly from the use of mice and rats. There are some differences in between humans and rodent models. For example, mice and rats differ from humans, with respect to insulin. Mice have two insulin genes, Ins1 and Ins2, whereas humans and virtually all other mammals have only a single INSULIN gene 117. As a first step to understanding the in vivo biology of Ins1 and Ins2 in the mouse, we assessed the expression pattern of both genes and their corresponding proteins in selected tissues. While it is clear that pancreatic β-cells are the only significant source of circulating hormonal insulin34,127, it is known that some cells outside the pancreas express smaller amounts of Ins2/INS. For example, Ins2 production in the thymus is required for immune tolerance 35,37. Over 80 reports have suggested that insulin can be produced in the brain (e.g. 38,39,42,47,50,51,509). Our collaborator, Dr. Brad Hoffman, provided us with chromatin immunoprecipitation data with antibodies to methylated histones (H3K4me1, marking regions of active transcription at protein-coding promoters) followed by direct sequencing that pointed to the presence of active transcription around the Ins2 gene, but not the Ins1 gene, in cerebral cortex and cerebellum 127. In contrast, both genes had activity marks in pancreatic islets 127. Interestingly, the active chromatin regions near the Ins2 locus in brain were distinct from those in islets 127. In contrast, both genes had activity marks in pancreatic islets 127. The observations of central Ins2 gene activity and expression prompted us to employ Taqman qPCR primers, validated in islets from Ins2-/- or Ins1-/- mice (Fig. 3.1), to further elucidate the expression pattern of insulin in the brain. We observed brain expression of Ins2 mRNA, significantly above the background seen in Ins2-/- brain tissue (Fig. 3.2). Ins1 mRNA was absent  37 according to these criteria. Using an array with cDNA from multiple mouse brain regions, we found Ins2 expression was highest in the hippocampus and Ins1 was virtually absent (Fig. 3.3). Quantitative analysis (Fig. 3.4) confirmed that Ins2 expression in hippocampal neurons is much lower than in pancreatic islets, which must deliver insulin to the entire body. Taqman RT-qPCR analysis of human brain cDNA array confirmed INS expression in several regions, including hippocampus (Fig. 3.5). Public gene expression databases also show expression of Ins2/INS, albeit at relatively low levels, in the rodent and human central nervous system (www.gate2biotech.com/genenote), including expression the hippocampal formation (www.brain-map.org). Interestingly, the active regions near the Ins2 locus in brain were distinct from those in islets. Collectively, these observations are consistent with many reports that Ins2 promoters, but not Ins1 promoters, have robust activity in the brain 509,510.  Next, we studied the localization of insulin protein throughout the brain, using antibodies validated in Ins2-/- or Ins1-/- islets, as well as Ins1-/-:Ins2-/- neurons (Fig. 3.6). Specific insulin immunoreactivity and C-peptide immunoreactivity were observed in the hippocampus, anterior olfactory nucleus, cerebral cortex, cerebellar Purkinje neurons, and several other discrete nuclei (Fig. 3.7 A-D). Next, we took advantage of the fact that the Ins2-/- mice used in our studies possess a LacZ knock-in in their endogenous Ins2 locus (Fig. 3.8). We found that the same adult neurons positive for -Gal also stained robustly for insulin in Ins1-/-:Ins2+/-(gal) mice (Fig. 3.7 C). To rule out the possibility that insulin immunoreactivity arose from insulin taken up into these neurons via endocytosis, we cultured hippocampal neurons in defined insulin-free media. Indeed, using an antibody that recognizes mouse C-peptide 2, but not mouse C-peptide 1 (Fig. 3.6 A), we identified robust endoplasmic reticulum staining in cultured hippocampal neurons (Fig. 3.7 D). These observations strongly suggest that insulin is actively produced in these neurons. The diffuse  38 staining pattern of insulin distribution, also observed with an antibody to fully processed mature insulin, suggests a constitutive release expected for a local trophic factor (rather than being concentrated and stored in granules for triggered release, as in pancreatic -cells). Together, these data demonstrate that Ins2 is produced in the brain by a subset of neurons. Previous reports of insulin produced in the brain were highly controversial because it was difficult to distinguish low levels of insulin from background signal in the absence of ideal negative controls (i.e. Ins2-/- and/or Ins1-/- mice) and positive controls (i.e. Ins1-/-:Ins2+/-(gal) mice). Our data confirm that the expression of insulin in neurons is evolutionarily conserved; neurons were the original insulin-producing cells 12. The differential expression of two murine insulin genes and the availability of Ins1 or Ins2 knockout mice presents a unique opportunity to specifically dissect the roles of circulating Ins1 derived from the pancreas and Ins2 found in the brain.  3.1 High fat feeding reduces Ins2 expression in the brains of female mice It is well established that insulin plays an important role in the brain with respect to balancing energy homeostasis, among other roles 129,238-240,243-246. It is also widely accepted that diabetes and obesity are associated with insulin resistance in multiple tissues including the central nervous system 168,191,199,225,511-525. We tested if environmental factors, specifically dietary differences, can affect insulin expression in the brain. To do this, we quantified the expression of Ins2 in multiple brain regions of control and high fat fed wildtype male and female mice. In female mice high fat diet significantly reduced Ins2 expression in hypothalamus compared to female mice on control diet (Fig. 3.9A). Though the difference was not significant, a similar and trend was observed in the cortex of these female mice (Fig. 3.9B). Interestingly, high fat feeding did not alter central Ins2 expression in the male mice we examined (Fig. 3.9C and D).  39 We also tested the effect of high fat diet in more brain regions in the Ins1-/-:Ins2+/+ mice. Similar to the wildtype mice, Ins2 expression was reduced in the hippocampus of high fat fed female mice (Fig. 3.10A). Ins2 expression was also significantly reduced in the olfactory bulb of high fat fed female mice (Fig. 3.10A). High fat diet did not significantly alter Ins2 expression in hypothalamus, cortex or cerebellum of the female mice (Fig. 3.10A). Also similar to the wildtype mice, high fat feeding did not alter Ins2 expression in any of the tested brain regions in the male mice (Fig. 3.10B). Together these data suggest that Ins2 expression is affected in certain regions of the brain in response to a high fat diet challenge. It has been reported in numerous studies that intake of high calorie and high fat diets as well as obesity are risk factors that contribute to central insulin resistance 329,348,356,382,483-497. Moreover, these types of diets have been reported to be risk factors that promote neurodegenerative diseases 176-178. Lastly, in early stages of Alzheimer’s disease decrease in cerebrospinal fluid has been reported 205,207,520. Our data help provide insight, with regards to changes in central insulin levels in response to high fat diet, that can potentially be related to increased risk of neurodegenerative disease such as Alzheimer’s disease due to high fat diet intake 526-529.     40 3.2 Figures                41 Figure 3.1 Validation of Taqman real-time RT-qPCR primer/probe sets specific to each rodent Insulin gene. Raw Taqman real-time RT-qPCR data showing specific amplification Ins1 (blue traces; absent in Ins1-/-:Ins2+/+ mice) and Ins2 (red traces; absent in Ins1+/+:Ins2-/- mice) in isolated islets. Beta-actin (yellow traces) is shown as a control.                        42                 43 Figure 3.2 Central nervous system expression of Ins2, but not Ins1. (A) Analysis of Ins2 and Ins1 mRNA expression (relative to the Actb control gene) in the hypothalamus, posterior brain and anterior brain of 6 month-old wildtype C57Bl6/J mice. (B) No significant compensatory up-regulation of either insulin gene in Ins1-/-:Ins2+/+ or Ins1+/+:Ins2-/- mice (these mice also provide ideal negative controls for the RT-qPCR).   44     45 Figure 3.3 Ins1 and Ins2 expression at different stages of development in mice. Ins1 and Ins2 gene expression assessed by Taqman real-time qPCR in arrayed cDNA from multiple murine brain regions at multiple stages of developing and post-natal brain.    46                     47 Figure 3.4 Comparison of Ins2 mRNA levels in islets and brain. Comparison of Ins2 mRNA levels in islets and brain regions using Taqman RT-qPCR (red, hippocampus; orange, cortex; yellow, remainder of brain; green, cerebellum; blue, olfactory bulb; purple, hypothalamus; in each case tissues were micro-dissected from a single male mouse brain). Data are presented as relative mRNA amounts per isolated tissue (i.e. not normalized for the amount of tissue/cells). Ins2 mRNA was serially diluted from a sample of 236 hand-picked wildtype mouse islets to generate a standard curve. Thus, hippocampi from a single adult wildtype mouse has less than 1,000 times the amount of insulin mRNA when compared with 236 islets (with number of islets had roughly 8 times fewer cells than the hippocampi based on the nucleic acid recovered from the samples). Based on published estimations each islet would be composed of 1260 β-cells 530 and each β-cell has ~50,000 copies of Ins2 mRNA.                48     49 Figure 3.5 Detection of INSULIN mRNA in brain. Taqman real-time RT-qPCR data showing amplification of human insulin from some brain regions (relative to the Actb control gene) in a commercial panel of brain cDNAs (OriGene, Rockville, MD, USA).                       50      51 Figure 3.6 Validation of specific Ins1 and Ins2 protein detection tools. (A) Millipore anti-C-peptide (# 4020-01) fails to stain Ins2 knockout islets, demonstrating its specificity for the Ins2 gene product. (B) Confocal imaging of cultured hippocampal neurons from Ins1-/-:Ins2-/- mice show no C-peptide 2 or (pan) Insulin immunoreactivity. MAP2 staining (far red) and DAPI (blue) are used to delineate the neurons.                        52     53 Figure 3.7 Central nervous system expression of Ins2, but not Ins1. (A) Distribution of neurons expressing insulin protein in the hippocampus of 12 week-old mice. The inset shows a hippocampal image from the identical staining except that primary antibody was omitted. The antibodies were validated using Ins1-/-:Ins2+/+ and Ins1+/+:Ins2-/- mice. (B) Close-up view of individual insulin neurons in the rostral cortex. (C) Colocalization of insulin (green-cell bodies and axons) and β-galactosidase (red-nuclear; knocked into the endogenous Ins2 gene locus) in cortical neurons (i), anterior olfactory nucleus neurons (ii), and cerebellar Purkinje neurons (iii) from 12 week-old Ins1-/-:Ins2+/-(βGal) mice. (D) Confocal imaging of a morphologically identified neuron showing punctate and reticular C-peptide 2 immunoreactivity (red) within calnexin-positive endoplasmic reticulum (ER; green) and in the somas of cultured rat hippocampal neurons (approximately half of the cells were positive). EGFP transfection was used to outline the boundaries and morphological health of individual neurons.               54      55 Figure 3.8 β-Gal expression in Ins2-/- islets. Pancreatic islets from Ins1-/-:Ins2+/+ mice express insulin but are negative for β Gal, while Ins1-/-:Ins2-/- mice are negative for insulin but shown immunoreactivity for β-Gal. In Ins2 gene was replaced with the LacZ gene in our Ins2-/- mice. In other words, the Ins1-/-:Ins2-/- mice are also Ins1-/-:Ins2betaGal/betaGal mice. The Ins1-/-:Ins2-/- mice were generated by breeding Ins1-/-:Ins2+/- mice together. The fully knockout mice were kept alive with daily (twice per day) insulin injections and these sections were collected at 4 weeks of age.    56            57 Figure 3.9 High fat diet reduces Ins2 expression in wildtype female mice. Levels of Ins2 messenger RNA in one year-old wildtype female (A) Hippocampus, and (B) Cortex. Levels of Ins2 messenger RNA in one year old wildtype male (C) Hippocampus, and (D) Cortex. Measured by Taqman real-time RT-qPCR assay. n = 7 for female mice and n = 8 for male mice at 1 year of age. * denotes p < 0.05. The wildtype mice were derived from crossing the Ins1+/+:Ins2-/- mice and Ins1-/-:Ins2+/+ mice and their progeny with the needed genotypes thereafter. CD refers to our control diet with 25% fat and HFD refers to our high fat diet with 58% fat.                  58   59 Figure 3.10 High fat diet reduces Ins2 expression in Ins1-/-:Ins2+/+ female mice. Expression of Ins2 messenger RNA in different brain regions of one year-old Ins1-/-:Ins2+/+ (A) female, and (B) male mice. n = 8 or 9. Measured by Taqman real-time RT-qPCR assay. All samples were collected from 1 year-old mice. * denotes p < 0.05. CD refers to our control diet with 25% fat and HFD refers to our high fat diet with 58% fat.    60 Chapter 4: Systemic hyperinsulinemia is a causal factor in diet-induced obesity 4.1 Reduced Ins1 prevents diet-induced -cell growth and fasting hyperinsulinemia  It is well accepted that hyperinsulinemia and obesity are strongly linked and many studies, both in humans and animal models, have reported hyperinsulinemia before any signs of obesity, insulin resistance, or glucose intolerance 476,477,488,490,531. To test the hypothesis that peripheral, pancreas-derived insulin drives diet-induced obesity, we endeavored to selectively lower circulating insulin by generating mice null for the brain-expressed Ins2 gene and modulating the gene dosage of pancreas-specific Ins1 (Fig. 4.1). It was critical to first test whether removing one Ins1 allele in Ins2-/- mice would result in a proportional reduction in Ins1 mRNA and circulating insulin. Indeed, Ins1+/-:Ins2-/- mice exhibited a ~50% reduction in islet Ins1 mRNA compared to Ins1+/+:Ins2-/- mice (Fig. 4.2A). Analysis of insulin content in islets at 8 weeks revealed some post-transcriptional compensation (Fig. 4.2B). By one year, insulin immunostaining (Fig. 4.2C), islet area (Fig. 4.3A) and fasting circulating insulin (Fig. 4.4), and glucose-stimulated insulin secretion (Fig. 4.5) were markedly decreased in mice with reduced Ins1 gene dosage. Because Ins2 is the primary contributor to islet insulin synthesis 117, fasting insulin was near or below the limit of ELISA detection in young Ins1+/+:Ins2-/- and Ins1+/-:Ins2-/- mice, making detailed analysis of glucose-stimulated insulin secretion in these mice unfeasible. Although the Ins1+/+:Ins2-/- control mice used in these experiments have been reported to be indistinguishable from wildtype on a control diet 504,532, it was essential to determine if they would respond to a high fat diet with a similar hyperinsulinemia and -cell mass increase seen in other control strains 136. Relative to chow-fed controls, Ins1+/+:Ins2-/- mice fed a 58% fat diet since weaning developed age-dependent, high fat diet-induced fasting hyperinsulinemia (Fig. 4.4),  61 similar to what is observed in other strains of mice and in humans. Critically, persistent hyperinsulinemia was dependent on the full expression of both Ins1 alleles. The fasting hyperinsulinemia in high fat fed Ins1+/+:Ins2-/- mice was associated with a ~2 fold increase in fractional -cell area, compared with mice fed a control diet (Fig. 4.3A and E). However, -cell area was equivalent to control diet levels in high fat fed Ins1+/-:Ins2-/- mice, pointing to a critical role for basal circulating insulin in this process (Fig. 4.3A and E). Analysis of programmed cell death and proliferation in -cells from Ins1+/-:Ins2-/- mice suggested that circulating insulin had gene dosage-dependent anti-apoptotic and pro-proliferative autocrine effects in the context of a high fat diet (Fig. 4.3B-D). These observations are consistent with studies showing that mice lacking insulin receptors on their -cells fail to increase -cell mass due to a defect in proliferation and increased apoptosis 136. Thus, the long-term diet-induced fasting hyperinsulinemia was completely prevented in Ins1+/-:Ins2-/- mice (Fig. 4.4), which is associated with a complete lack of high fat diet-induced compensatory -cell expansion (Fig. 4.3A and E). In other words, we generated mice that are genetically incapable of high fat diet-induced hyperinsulinemia.  4.2 Glucose homeostasis in mice with reduced insulin gene dosage  Insulin is an essential hormone for the maintenance of glucose homeostasis. Surprisingly, despite the observation that glucose-stimulated insulin release was reduced in Ins1+/-:Ins2-/- mice (Fig. 4.5), we observed only transient differences in fasting glucose between Ins1+/-:Ins2-/- and Ins1+/+:Ins2-/- mice (Fig. 4.6A). Significant worsening of glucose homeostasis in Ins1+/-:Ins2-/- mice was only observed in a small subset of high fat fed mice (2 mice) during the period of rapid somatic growth around 11 weeks of age and was not observed later in life or on the chow diet (Fig. 4.6B).  62 We did not observe any immune system activity near the pancreatic islets of the diabetic mice by immuno-staining for immune cell markers (data not shown). Insulin sensitivity was generally similar between the genotypes and diets (Fig. 4.6C). Therefore, comparing Ins1+/+:Ins2-/- mice and Ins1+/-:Ins2-/- mice enabled us to test the effects of genetically reduced pancreatic insulin secretion on obesity, in the absence of hyperglycemia or insulin resistance. To date, this is the only such model where the effect of a sustained reduction in circulating fasting insulin can be investigated in the absence of chronic differences in glucose homeostasis.  4.3 Reduced circulating pancreatic Ins1 gene dosage prevents diet-induced obesity Insulin is a lipogenic hormone and its increased secretion has been associated with obesity 353,354,365,367,393. We directly tested the hypothesis that pancreatic insulin hyper-secretion is required for diet-induced obesity by tracking body weight of Ins1+/+:Ins2-/- mice and Ins1+/-:Ins2-/- mice, fed a control diet or an obesity-inducing high fat diet (Fig. 4.1). We observed robust adult-onset obesity in high fat fed Ins1+/+:Ins2-/- control mice with all the expected hallmarks, including increased fat-to-lean ratio measured by NMR, increased fat pad weight, increased size of individual adipocytes, as well as increased inflammation markers in white adipose tissue (Fig. 4.7). In striking contrast, Ins1+/-:Ins2-/- mice were completely protected from diet-induced adult-onset weight gain for the duration of these 1-year long experiments (Fig. 4.7A). The high fat diet-induced increase in epididymal fat pad weight was completely prevented (Fig. 4.7B), resulting in reduced circulating leptin (Fig. 4.7C). Whole body growth, measured by tibial length, was independent of Ins1 gene dosage (Fig. 4.7D). Weights of other organs were not statistically different between any of the groups (Fig. 4.7E). Together with the results above, these data suggest that circulating Ins1 is an adipocyte-specific and -cell-specific growth factor.  63 Next, we sought to determine the physiological mechanisms accounting for the lack of high fat diet-induced adiposity (Fig. 4.7F and G) in the non-hyperinsulinemic Ins1+/-:Ins2-/- mice. Using indirect calorimetry, we found increased energy expenditure preceding the onset of differences in body weight (Fig. 4.8A). The observation of energy expenditure differences prior to differences in body mass was important because the normalization of energy expenditure between mice with different levels of adiposity is complicated 533. Notably, we did not observe significant differences in food intake, physical activity, or respiratory quotient (Fig. 4.8B-E). Collectively, these in vivo data suggest that high fat diet-induced hyperinsulinemia promotes adult adipocyte growth and nutrient storage in the context of a high fat diet. The genetic loss of one Ins1 allele, in Ins2-/- mice, was sufficient to promote reprogramming, as suggested by the resulting changes in expression of thermogenic genes, of white adipose tissue to increase energy expenditure and prevent adiposity.  4.4 Ins1 is a negative regulator of uncoupling, lipolytic, and inflammatory genes in white adipose tissue One of the factors that can play a role in weight gain is increased adaptive energy expenditure as discussed earlier. We expected changes in energy expenditure and fat cell growth over this long time scale to be associated with stable alterations in gene expression patterns and cellular reprogramming, rather than acute signalling events. Indeed, while hyperinsulinemic Ins1+/+:Ins2-/- mice exhibited marked adipocyte hypertrophy, white adipose tissue from high fat fed Ins1+/-:Ins2-/- mice appeared similar to mice fed a control diet (Fig. 4.7H). To determine the molecular mechanisms underlying the protective effects of reduced fasting insulin, we designed a Taqman real-time PCR mini-array of 45 key metabolic, inflammatory, and insulin target genes (Table 4.1). In white adipose tissue, there were remarkably few differences between the two groups  64 of mice on the low fat diet, although insulin receptor mRNA was robustly lowered in mice with reduced Ins1 (Fig. 4.9). In keeping with the lean phenotype and increase in energy expenditure, we observed a gene expression pattern associated with energy expenditure and lipid mobilization, including increased expression of uncoupling proteins and Pnpla2 (adipose triglyceride lipase), in white adipose tissue from high fat fed Ins1+/-:Ins2-/- mice versus high fat fed Ins1+/+:Ins2-/- mice (Fig. 4.9). Perhaps the most notable observation was an increase in Ucp1 gene expression in white adipose tissue isolated from high fat fed Ins1+/-:Ins2-/- mice, suggesting brown adipose tissue-like features similar to what has been observed in other lean models, including mice lacking Nrip1 (RIP140), a corepressor that suppresses Ucp1 expression in white adipose tissue 534,535. Ppargc1a (Pgc1) and Ppar, positive regulators of energy expenditure and Ucp1, were also up-regulated in white adipose tissue from high fat fed Ins1+/-:Ins2-/- mice. Furthermore, we observed down-regulation of factors previously shown to promote obesity and adipocyte differentiation in the white adipose of high fat fed Ins1+/-:Ins2-/- mice, including the insulin target genes, Egr2 (Krox20) and Nrip1 (Fig. 4.9). Interestingly, none of the uncoupling proteins were differentially expressed between brown adipose tissue of high fat fed Ins1+/-:Ins2-/- mice and high fat fed Ins1+/+:Ins2-/- mice (Fig. 4.10). However, we did not measure the weight for BAT and thus cannot be sure if there were any differences in the size of BAT depots that could contribute to overall energy expenditure in these mice. We observed a tendency for a gene expression profile promoting energy expenditure in skeletal muscle from high fat fed Ins1+/-:Ins2-/- mice, although these effects were not statistically significant (Fig. 4.11).  In collaboration with Ms. Templeman, we selected several differentially expressed genes with known roles in insulin signalling and/or adipocyte differentiation for additional analysis at the protein level. Immunocytochemistry suggested enhanced Ucp1 protein in white adipose tissue  65 from high fat fed Ins1+/-:Ins2-/- mice compared with high fat fed Ins1+/+:Ins2-/- littermates 127. A significant increase in Ucp1 levels in high fat fed Ins1+/-:Ins2-/- mice was confirmed and quantified by immunoblot of white adipose tissue 127. We also observed elevated protein levels of Ppar and Srebf1/SREBP-1c 127. Immunoblot also confirmed a significant decrease in Egr2 protein in high fat fed Ins1+/-:Ins2-/- mice 127, mirroring the effects on its mRNA and suggesting a possible de-differentiation of white adipocytes. These quantitative data clearly demonstrate that the pancreas-specific Ins1 gene, and by extension the circulating insulin hormone, controls the expression of a large number of key metabolic genes in white adipose tissue, including those responsible for energy expenditure.  It is well established that obesity is associated with chronic low-grade inflammation of multiple tissues, including white fat 408-412. However, the cause and effect relationship between this phenomenon and hyperinsulinemia has not been fully established. Our Taqman RT-qPCR analysis revealed a broad reduction in inflammatory markers, including Tnf and Emr1 (F4/80; macrophages) in white adipose tissue from high fat fed Ins1+/-:Ins2-/- mice compared with high fat fed Ins1+/+:Ins2-/- littermates. These data suggest that insulin regulates adipose inflammation either directly, or indirectly via fat cell size.   4.5 Reduced pancreatic Ins1 protects mice from lipid spillover and fatty liver Ins1+/-:Ins2-/- mice were protected from elevated circulating free fatty acids when compared to their high fat fed Ins1+/+:Ins2-/- littermate controls (Fig. 4.12A). In accordance with the lack of lipid spillover, livers of high-fat fed Ins1+/-:Ins2-/- mice were completely protected from diet-induced hepatic steatosis (Fig. 4.12B). Quantitative PCR analysis of liver showed that most of the differences were related to diet (reduced Ddit3, Pparg, Ptpn1, Il6, Igfbp1, Egr1, Egr2; increased  66 Glut4, Srebf1, Ppargc1a, Pck1), rather than between the two genotypes on the high fat diet (Fig. 4.12C). Some notable differences in inflammation markers prompted us to examine the gene expression of IL1, TLR4, IL4 and interferon in bulk liver tissue (Fig. 4.12C). The reduction in the stress marker Atf3 (Fig. 4.12C) prompted us to evaluate markers of oxidative stress and lipid peroxidation in this tissue, but the levels of genes coding for proteins carbonyl and 4‐hydroxy‐2‐nonenal (HNE) were not different between high fat-fed Ins1+/-:Ins2-/- mice and their high fat fed Ins1+/+:Ins2-/- littermates (Fig. 4.12C). Our data support a paradigm whereby high fat consumption leads to chronic basal insulin hyper-secretion (perhaps via direct insulinotropic effects of fatty acids), which then increases adipocyte size and lipid accumulation in adipose tissue. The spillover of free fatty acids subsequently leads to steatosis and ER-stress in the liver, which may eventually result in insulin resistance when combined with additional factors.  4.6 Circulating insulin levels in female mice Ins1+/-:Ins2-/- mice This experiment was also conducted on female control Ins1+/+:Ins2-/- mice and experimental Ins1+/-:Ins2-/- mice. In contrast to male mice, reduction in Ins1 gene dosage did not lead to a reduction in circulating insulin (Fig. 4.13A). There was no difference between the two genotypes in the female mice with respect to body weight (Fig. 4.13B). The only slight difference was between the different diets irrespective of their genotype. Mice on high fat diet had slightly higher circulating insulin and were also slightly heavier, but none of these differences were statistically significant in this study (Fig. 4.13B). Intraperitoneal glucose challenge showed that female mice in all four groups were able to equally control their blood glucose. However, at 12 and 26 weeks of age, female mice on high fat diet showed reduced responses to an intraperitoneal insulin challenge (Fig. 4.13C). This, however, was absent at either six or 52 weeks of age (Fig.  67 4.13D). These data are still consistent with our hypothesis that diet-induced hyperinsulinemia is upstream of obesity.    68 4.7 Figures   69 Figure 4.1 Experimental design for mice with varying Ins1 gene dosage on an Ins2 null background. Experimental design to test the role of circulating insulin on diet-induced obesity in the absence of Ins2, which can be expressed outside of the pancreas, including in the brain.                       70   71 Figure 4.2 Reduced Insulin gene dosage results in reduced islet insulin mRNA and peptide. (A) Taqman RT-qPCR for Ins1 mRNA in islets from 12-week old mice (n = 3-5). (B) Islet insulin content from 30 handpicked islets from 8 week-old mice (n = 3). (C) Representative staining using anti-insulin (green) and anti-glucagon (red) antibodies in pancreas tissue sections from 12 month-old mice. * denotes significant difference between HFD mice.                        72        73 Figure 4.3 Reduced Insulin gene dosage prevents the compensatory expansion of β-cell numbers in the context of a high fat diet. (A) Ins1+/-:Ins2-/- mice failed to increase β-cell mass in response to a high fat diet (n = 3). (B) Programmed cell death was assessed by counting the number of TUNEL positive β-cells in pancreatic sections from 8 week-old mice (n = 3-5). (C,D) Proliferation was estimated by quantifying the percentage of PCNA-positive β-cells in pancreata from 8 week-old mice (n = 3) and by performing PCNA immunoblot in islets isolated from 12 week-old mice (n = 4-6). (E) Representative staining using anti-insulin (green), anti-glucagon (red) and DAPI (white) antibodies in pancreas tissue sections from 12 month-old mice * denotes significant difference between HFD mice. * denotes p < 0.05.                  74     75 Figure 4.4 Reduced Insulin gene dosage prevents sustained hyperinsulinemia on a high fat diet. Age-dependent high fat diet-induced fasting hyperinsulinemia was prevented in Ins1+/-:Ins2-/- mice (n = 6-16). * denotes significant difference between HFD mice. ** denotes significant difference between CD mice.                        76        77 Figure 4.5 Glucose stimulated insulin release in mice with reduced Insulin gene dosage. Insulin release in response to intraperitoneal injection of 18% glucose in 53 week-old mice (n = 6). * denotes p < 0.05.                       78      79 Figure 4.6 Glucose homeostasis and insulin sensitivity in mice with reduced Insulin gene dosage.  (A) Four-hour fasted glucose levels measured weekly over the 1st year of life. (B) Intraperitoneal glucose tolerance is impaired in young, but not old Ins1+/-:Ins2-/- mice. Insets show area under the curve (AUC). (C) Insulin tolerance is statistically similar between all groups at all ages studied. Insets show area over the curve (AOC). All data are represented as means of at least 5 male mice in each group at all time points. * denotes statistical significance (p < 0.05).                   80     81 Figure 4.7 Mice with reduced fasting insulin are protected from high fat-induced weight gain. (A) Body weight tracked weekly over 1 year, in multiple independent cohorts (assessed over several years; n = 5-11). (B) Epididymal fat pad weight in 1 year-old mice (n = 5-11). (C) Circulating leptin levels (n = 3). (D,E) Tibial length and organ weight were measured at 1 year as indexes of somatic growth (n = 5-11). (F,G) NMR spectroscopy (n = 3). (H) Hematoxylin and eosin-stained epididymal fat pad (n = 5-11).                      82      83 Figure 4.8 Mice with reduced fasting insulin have increased energy expenditure. (A, B) Energy expenditure was measured by indirect calorimetry in high fat fed mice at 20 weeks of age, prior to significant differences in weight gain (n = 5). (C-E) We did not note significant differences in activity, food intake, or respiratory quotient (n = 3-5).                         84     85 Figure 4.9 Gene expression profile of white adipose tissue. Taqman real-time qPCR quantification of 45 genes in epididymal white adipose tissue from 1 year-old mice. Results are sorted according to the magnitude of the difference between high-fat fed Ins1+/-:Ins2-/- mice and high-fat fed Ins1+/+:Ins2-/- littermates (# denotes p < 0.05). Genes with a large negative relative expression are colored red; genes with increased expression are green. $ denotes significant difference between diets in the Ins1+/-:Ins2-/- mice. & denotes significant differences between Ins1+/-:Ins2-/- mice compared with Ins1+/+:Ins2-/- mice on the control diet. Data are from 1-year old mice (n = 5-7).                    86     87 Figure 4.10 Gene expression profile of brown adipose tissue. Taqman qPCR of intra-scapular brown adipose tissue in high fat fed Ins1+/+:Ins2-/- and Ins1+/-:Ins2-/- mice. Data are ranked by numerical differences between conditions. No statistical significance was detected (n = 5-7).                         88     89 Figure 4.11 Gene expression profile of skeletal muscle. Taqman qPCR of gastrocnemius skeletal muscle in high fat fed Ins1+/+:Ins2-/- and Ins1+/-:Ins2-/- mice. Data are ranked by numerical differences between conditions. No statistical significances were detected (n = 7,5).                         90     91 Figure 4.12 Ins1+/-:Ins2-/- mice are protected from lipid spill over, fatty liver and ER-stress. (A) Circulating free fatty acids levels at one year of age. * denotes p < 0.05. (B) Low and high magnification of H&E-stained liver. (C) Taqman real-time qPCR quantification of 49 genes in liver from 1 year-old mice (n = 3-7 individual mice). Results are sorted as in Figure 4.9. # denotes p < 0.05 t-test between high-fat fed Ins1+/-:Ins2-/- mice versus high fat fed Ins1+/+:Ins2-/- mice. $ denotes significant difference between diets within the Ins1+/-:Ins2-/- mice. & denotes differences between Ins1+/-:Ins2-/- mice versus Ins1+/+:Ins2-/- mice on the control diet. (D, E) Liver cholesterol and triglyceride measurements (n = 3-5). * denotes p < 0.05.                  92    93 Figure 4.13 Lack of fasting hyperinsulinemia and weight gain in high fat fed female Ins1+/-:Ins2-/- or Ins1+/+:Ins2-/- mice. (A) 4-hour fasting insulin was measured in female mice at the ages indicated (n = 3). (B) Body weight tracked weekly (n = 7-8 per group). (C) Glucose tolerance tests, and area under the curve insets (n = 7-8). (D) Insulin tolerance tests, and area over the curve insets (n = 7-8).                    94 4.8 Tables Table 4.1 List of the genes studied in the mini-array. Symbol Name 18S 18S ribosomal subunit Acacb Acetyl-CoA carboxylase Acly ATP citrate lyase Actb Actin, beta Adipoq Adiponectin, C1Q and collagen domain containing Adipor1 Adiponectin receptor 1 Adipor2 Adiponectin receptor 2 Atf3 Activating transcription factor 3 Cd36 Cluster of differentiation 36 Cebpa CCAAT/enhancer-binding protein alpha Ddit3 DNA damage-inducible transcript 3 Egr1 Early growth response 1 Egr2 Early growth response 2 Emr1 EGF-like module-containing mucin-like hormone receptor-like 1 Fabp4 Fatty acid binding protein 4 Fasn Fatty acid synthase Foxo1 Forkhead box protein O1 Fto Fat mass and obesity-associated   95 Symbol Name Hprt1 Hypoxanthine guanine phosphoribosyl transferase 1 Ikbkb Inhibitor of nuclear factor kappa-B kinase subunit beta Il6 Interleukin-6 Insr Insulin receptor Lepr Leptin receptor Lipe Hormone sensitive lipase Klf15 Krüppel-like factor 15 Mlxipl MLX interacting protein-like Nr1h3 Nuclear receptor subfamily 1 Nrip1 Nuclear receptor-interacting protein 1 Pck1 Phosphoenolpyruvate carboxykinase 1 Pnpla2 Patatin-like phospholipase domain containing 2 Pnpla3 Patatin-like phospholipase domain containing 3 Ppara Proliferator-activated receptor alpha Pparg Proliferator-activated receptor gamma Ppargc1a Peroxisome proliferator-activated receptor gamma coactivator 1 alpha Ptpn1 Protein tyrosine phosphatase non-receptor type 1 Rbp4 Retinol binding protein 4 Scd1 Stearoyl-CoA desaturase-1    96 Symbol Name Sirt1 Sirtuin 1 Slc2a4 Solute carrier family 2 member 4 Srebf1 Sterol regulatory element binding transcription factor 1 Tnf Tumor necrosis factor Ucp1 Uncoupling protein 1 Ucp2 Uncoupling protein 2 Ucp3 Uncoupling protein 3   97 Chapter 5: Effects of reduced Ins2 gene dosage in Ins1-/- mice 5.1 Glucose homeostasis, insulin tolerance, and insulin levels in Ins1-/-:Ins2+/- mice The studies in the preceding chapter demonstrate that the pancreas-specific Ins1 gene is adipogenic (Figures from chapter 4), but they do not address the specific functions of the Ins2 gene, which is more widely expressed (including in the brain), and more closely related to the human INSULIN gene. To assess the role of Ins2 in obesity, we varied the Ins2 gene dosage in mice lacking both alleles of Ins1 (Fig. 5.1). Deleting one of the two alleles of the Ins2 gene allowed us to successfully reduce the Ins2 mRNA levels in the Ins1-/-:Ins2+/- mice (Fig. 5.2A). However, we were not able to detect significant differences in the circulating insulin levels in Ins1-/-:Ins2+/- mice compared to control Ins1-/-:Ins2+/+ mice (Fig. 5.2B). Surprisingly, immunofluorescent staining of the islets showed only decreased signal in Ins1-/-:Ins2+/- male mice on control diet (Fig. 5.2C). In contrast to the previously discussed Ins1+/-:Ins2-/- male mice, we were unable to measure significant differences in pancreatic β-cell area or fasting insulin (Fig. 5.3). There were also no significant differences in fasting blood glucose levels throughout the entire experiment in the cohort of mice we tested (Fig. 5.4A). The glucose-stimulated insulin secretion was lower in the control diet fed Ins1-/-:Ins2+/- mice compared to Ins1-/-:Ins2+/+ littermate controls on the same diet at seven weeks of age but not later (Fig. 5.4B). However, high fat fed Ins1-/-:Ins2+/- mice showed similar glucose-stimulated insulin secretion when compared to high fat fed Ins1-/-:Ins2+/+ littermate controls (Fig. 5.4B). This indicates that a single allele of the Ins2 gene is sufficient to generate enough insulin to mount an appropriate response to glucose in the context of a high fat diet (unlike the Ins1+/-:Ins2-/- mice described in the previous chapter). Mice in all groups, regardless of diet or genotype, showed normal glucose tolerance (Fig. 5.4C). On a control diet, 7 week-old mice with reduced Ins2 gene dosage were hypersensitive to exogenous insulin, although this was not  98 observed in older mice (Fig. 5.4D). This group of high fat fed Ins1-/- mice (regardless of Ins2 gene dose) were paradoxically insulin hypersensitive at all of the time points beyond 12 weeks (Fig. 5.4D). Collectively, these data suggests that the Ins1 gene may be required for the deleterious effects of high fat diet on insulin resistance, although it would be important to replicate these findings in additional cohorts. Since there were no significant differences in peripheral circulating insulin, this model could potentially allow the effects of brain insulin (Ins2) on obesity to be evaluated in the absence of potentially confounding effects of hyperglycemia or insulin resistance.  5.2 Cohort dependent effects of Ins2 gene dosage on diet-induced obesity Comparing the effects of a control diet and high fat feeding of Ins1-/-:Ins2+/- mice and control Ins1-/-:Ins2+/+ mice revealed a complex, cohort-dependent gene-environment interaction. In the first cohort, the control diet fed Ins1-/-:Ins2+/- mice were lighter throughout life than their Ins1-/-:Ins2+/+ littermate controls (Fig. 5.5A and C), suggesting the potential for general growth factor roles for the conserved Ins2 gene in the context of moderate fat intake. We also found that Ins1-/-:Ins2+/+ mice did not gain weight on a high fat diet in this cohort (Fig. 5.5A and C), leading us to speculate that the hypersecretion of the Ins1 gene product may be required for the proper storage of lipids in adipose tissue. Remarkably, in the first cohort a majority of Ins1-/-:Ins2+/- mice exhibited striking weight gain on the high fat diet (Fig. 5.5 A and C). Surprisingly, these somewhat paradoxical effects were not observed in a second cohort (Fig. 5.5 B and D). Weight gain the first cohort in high fat fed Ins1-/-:Ins2+/- mice relative to the other groups was due to a combination of increased adiposity (Fig. 5.6A and B) and increased somatic growth, assessed by tibial length and organ measurement (Fig. 5.6C and F). An unusual heterogeneity in adipocyte size was observed in all groups of Ins1-/- mice (Fig. 5.6A), reminiscent of mice lacking adipocyte insulin receptors  99 29,506. Circulating leptin was proportional to fat-pad weight and fat-to-lean ratio (Fig. 5.6D). We also did not detect differences in the circulating free fatty acids between groups in this cohort (Fig. 5.6E). Together, these data suggest that, in some currently un-defined conditions, Ins2 may suppress body weight via a mechanism that is active specifically in the context of a high fat diet. Given the similarity in circulating insulin levels, these data suggest the possibility of altered local effects of Ins2 in the brain. However, these data have to be looked at with caution as the differences observed were only found in the first cohort. The animal facility where this work was done no longer exists, so it is impossible to formally repeat these studies in the same environment. More studies, beyond the scope of this thesis, are in progress by another graduate student, in a different facility, to assess a potential role of Ins2 gene dosage in obesity. In these studies, similar cohort-dependent variability has been observed (personal communication, Nicole Templeman). Collectively, the experience of our laboratory is that modulation of the Ins2 gene, in the absence of Ins1, leads to striking diet-dependent variability in body weight. The source of this variability will be investigated by our collaborators specializing in epigenetics. It is well established that insulin can act in the brain as a satiety factor 215,536. We have confirmed that Ins2 is expressed in multiple regions of the brain that can potentially control and project to feeding, reward and memory centers, raising the possibility that central Ins2 gene expression may regulate food intake. We only conducted food intake and metabolic cage studies in our first cohort. In this cohort, reducing Ins2 gene dosage changed body weight by significantly decreasing the ability to reduce food intake in response to high amounts of fat in diet (Fig. 5.7A). Importantly, the intake of the control diet was not different between Ins1-/-:Ins2+/- mice and Ins1-/-:Ins2+/+ littermate controls. Other parameters such as activity and energy expenditure were also not different between any of the Ins1-/- groups (Fig. 5.7B-E).   100 Quantitative PCR analysis of the liver (Fig. 5.8) showed a significant decrease in the expression of the Fto, Fasn, and Insr genes in the Ins1-/-:Ins2+/- mice compared to the Ins1-/-:Ins2+/+ littermate controls on the high fat diet. A variant of the Fto gene has been reported to be associated with the risk of being predisposed to obesity 293,537. Furthermore, inactivation of the Fto gene has been reported to protect against obesity due to increased energy expenditure 538. Fatty acid synthase, the peptide product of the Fasn gene, is a key component in lipogenesis that plays a role in the maximal rate of fatty acid synthesis, particularly in the liver 539. However, it is reported that knocking out the Fasn gene leads to hepatic steatosis 540. It is possible that in our case, and combined with changes in other genes, reduced, but not completely lost, Fasn expression has played a protective role in the context of high fat diet-induced hepatic steatosis. Lastly, we observed a reduction in the expression of the insulin receptor, Insr gene, in the liver. As we showed previously in chapter 4 (Fig. 4.12B), reduced circulating insulin level is associated with protection from high fat diet-induced hepatic steatosis 127. Therefore, reduced insulin action in the liver could have also contributed to the reduced hepatic steatosis in the Ins1-/-:Ins2+/- mice compared to the Ins1-/-:Ins2+/+ littermate controls on the high fat diet. Moreover, we observed up-regulation, though not significant, in the expression of genes such as Fgf21 and Pnpla3 in the high fat fed Ins1-/-:Ins2+/- mice compared to the Ins1-/-:Ins2+/+ littermate controls. Collectively the aforementioned changes in the gene expression profile in the liver can potentially explain the lack of fat accumulation in the liver of the Ins1-/-:Ins2+/- mice compared to the Ins1-/-:Ins2+/+ mice as observed in histological analysis of the liver (data not shown). However, the fat accumulation seen in the high fat fed Ins1-/-:Ins2+/+ mice was much less than that of observed in the high fat fed Ins1+/+:Ins2-/- mice explained in the previous section.   101 5.3 Diet-induced weight gain in female Ins1-/-:Ins2+/- mice We also conducted an identical study on female control Ins1-/-:Ins2+/+ mice and experimental Ins1-/-:Ins2+/- mice. Similar to mice in the previous chapter, reduction in Ins2 gene dosage did not lead to a significant reduction in basal circulating insulin (Fig. 5.9A). Similarly, there were no significant differences between the two genotypes in the female mice with respect to their body weight (Fig. 5.9B). However, in this group of female mice, the high fat diet led to a significant increase in circulating insulin levels 15 minutes after an intraperitoneal glucose challenge on either genotype (Fig. 5.9A). Control Ins1-/-:Ins2+/+ mice gained the most weight on a high fat diet when compared to the mice on control diet of the identical genotype (Fig. 5.9B). There was a tendency for Ins1-/-:Ins2+/- mice to gain less weight over the ~1 year period, although the study was underpowered to detect small differences (Fig. 5.9B). Another student has repeated this study with more mice, though in different facility, and her mice were protected to the level of statistical significance (personal communication, Nicole Templeman). Intraperitoneal glucose challenge showed that female mice in all four groups were able to equally control their blood glucose (Fig 5.9D). There were also no significant differences in these mice with respect to intraperitoneal insulin challenge (Fig. 5.9E). These data are also consistent with the notion that increased circulating insulin levels promote weight gain. High fat fed mice only transiently showed trends towards increased fasting blood glucose levels close to one year of age (Fig. 5.9F).     102 5.4 Figures   103 Figure 5.1 Experimental design for mice with varying Ins2 gene dosage on an Ins1 null background. Experimental design for study testing the role of insulin 2 on diet-induced obesity.                      104                          105 Figure 5.2 Reduced Ins2 expression in Ins1-/-:Ins2+/- mice. (A) Proportionally reduced Ins2 mRNA in Ins1-/-:Ins2+/- mice regardless of diet (n = 3-4; 8 week old mice). As expected, Ins1 mRNA was not found in these samples (not shown). (B) Insulin protein content in 30 size-matched islets isolated from 8 week old mice (n = 3-4). (C) Reduced insulin immunoreactivity in control diet fed Ins1-/-:Ins2+/- mice, but compensatory insulin production in Ins1-/-:Ins2+/- mice fed a high fat diet. Data are collected from cohort 1.                       106       107 Figure 5.3 Circulating insulin is not reduced in Ins1-/-:Ins2+/- mice. (A) We were unable to find differences in β-cell area (n = 3). (B) Fasting insulin was not significantly different between groups; data is from a combination of both cohorts (n = 6). The yellow area shows the detection limit for the ELISA kit. Data are collected from the first of the two cohorts, unless otherwise specified.                    108                         109 Figure 5.4 Insulin secretion and glucose homeostasis in high fat fed Ins1-/-:Ins2+/- mice. (A) Weekly blood glucose after a 4-hour fast. (B) Glucose-stimulated insulin release. Insets show area under the curve (AUC). (C) Intraperitoneal glucose tolerance. (D) Insulin tolerance (0.75 U/g) after four hours of fasting. Insets show area over the curve (AOC). n = 6-14 unless otherwise specified. All data are from the average of results from both cohorts.                     110           111 Figure 5.5 Cohort-dependent and diet-dependent effects on body weight in Ins1-/-:Ins2+/- mice on high fat diet. Pooled body weight tracked weekly for 1 year in cohort 1 (A) and cohort 2 (B). Individual body weight tracked weekly for 1 year in cohort 1 (C) and cohort 2 (D). In cohort 1 (n = 6-8) and in cohort 2 (n = 3). * denotes p < 0.05 (ANOVA).                    112     113 Figure 5.6. A cohort of Ins1-/-:Ins2+/- mice exhibit high fat diet-dependent adiposity. (A) H&E-stained epididymal fat revealed heterogeneity in adipocyte size. (B) Whole body fat to lean ratio measure with NMR. (C) Tibial length was measured as an indicator somatic growth. (D) Circulating leptin levels (n = 3). (E) Serum free fatty acids. (F) Weights of indicated tissues. Data are from 1 year-old mice (n = 6-8). *denotes p<0.05 (ANOVA). Data are collected from cohort 1.                    114          115 Figure 5.7 Food intake and metabolic parameters in a cohort of Ins1-/-:Ins2+/- mice. (A) Food intake, (B) activity, and energy expenditure was measured by indirect calorimetry (C) oxygen consumption normalized to body weight and (D) total oxygen consumption in 8 week old male mice. n = 5-14 and * denotes p < 0.05. Data are collected from cohort 1.                     116    117 Figure 5.8 Gene expression profile of liver of Ins1-/-:Ins2+/- and Ins1-/-:Ins2+/+ mice. Taqman real-time qPCR quantification of 45 genes in epididymal white adipose tissue from 1 year-old mice. Results are sorted according to the magnitude of the difference between high-fat fed Ins1-/-:Ins2+/- mice and high-fat fed Ins1-/-:Ins2+/+ littermates (# denotes p < 0.05). Genes with a large negative relative expression are colored red; genes with increased expression are green. $ denotes significant difference between diets in the Ins1-/-:Ins2+/- mice. & denotes significant difference between diets in the Ins1-/-:Ins2+/+ mice. * denotes significant differences between Ins1-/-:Ins2+/- mice compared with Ins1-/-:Ins2+/+ mice on the control diet. Data are from 1-year old mice (n = 5-11). Data are collected from cohort 1.                118                         119 Figure 5.9 Female Ins1-/-:Ins2+/+ mice show trends towards increased fasting hyperinsulinemia and weight gain due to high fat diet intake. (A) Intraperitoneal glucose stimulated insulin release at 5 and 50 weeks of age. (B) Weekly body weight. (C) Serum free fatty acids at one year of age. (D) IPGTT after a four-hour fast. (E) ITT after a four-hour fast. (F) Four-hour fasting glucose.  For all data in this figure (n = 8-11) except for (A) and (C) for which (n = 6).       120 Chapter 6: Discussion 6.1 Pancreatic Ins1 hyper-secretion promotes fat storage and reduces fat burning A canon of diabetes and obesity research is that obesity-associated insulin resistance causes hyperinsulinemia as a compensatory mechanism because the pancreatic -cells are hyperstimulated to release more insulin 442,443. However, the possible physiological mechanisms for this hyperstimulation remain unclear, since it often occurs prior to hyperglycemia 476,477. Our data demonstrate for the first time that prevention of high fat diet-induced hyperinsulinemia through partial ablation of the pancreas-specific Ins1 gene protects mice from diet-induced obesity and associated complications 127. Genes that mobilize lipids were up-regulated and increased mitochondrial uncoupling producing heat from calories stored in white adipose tissue, and down-regulated genes required for adipocyte differentiation. Specifically, we proposed a model for diet-induced obesity whereby hyperinsulinemia negatively regulates white adipose tissue Ucp1 expression, via a gene network involving Ppar and Nrip1, to suppress energy expenditure 127. This is consistent with a well-established general anabolic role for insulin and the observation that reducing circulating insulin with diazoxide promotes weight loss in obese mice via an increase in basal metabolic rate 541. Our in vivo data place the pancreas-specific Ins1 gene ‘functionally upstream’ of obesity, and establish the causality of circulating hyperinsulinemia in adult fat growth in the absence of insulin resistance or hyperglycemia (Fig. 7.1). In our study, increased basal insulin secretion occurred without hyperglycemia or hypoglycemia. Indeed, both insulin resistance and insulin hypersecretion can occur in normoglycemic humans (including at and before birth), preceding obesity and insulin resistance 25,478,480,484,485,487,490. It is notable that early hyperinsulinemia was the strongest predictor of type 2 diabetes in a 24-year study 542. Insulin resistance and obesity can also be uncoupled in human lipodystrophies 543 and in many knockout  121 mouse models 70,544-547. Further evidence for the concept that hyperinsulinemia can be a primary factor in the metabolic syndrome in humans can be found in the increased risk of childhood weight gain observed in individuals with elevated pancreatic insulin production and release caused by inheritance of class I alleles of the human INSULIN gene 490. Genetics and epigenetics likely combine with environmental and dietary factors that stimulate insulin hypersecretion early in life, including in utero, promoting fat growth and eventually complications including type 2 diabetes. The therapeutic potential of drugs that inhibit circulating insulin has previously been demonstrated 499,541,548, but here we provide insight into the molecular mechanism of these clinical observations. Our study provides additional rationale for efforts to therapeutically block some peripheral insulin, as tested here by the changes in the pancreatic specific Ins1 gene dosage, action to combat obesity.  6.2 Diet-induced -cell expansion is regulated by insulin in vivo Previous studies have suggested that insulin receptor signalling modulates post-natal -cell mass expansion in response to a high fat diet 136, but this concept has remained controversial. The lack of -cell mass ‘compensation’ in Ins1+/-:Ins2-/- mice provides the first direct in vivo evidence that insulin, in this case the pancreas-specific Ins1 gene, plays a role in -cell growth and survival under stressed conditions. Importantly, our results demonstrate that -cell mass can increase in the absence of sustained hyperglycemia. Moreover, our results from chapter 5 demonstrated that in Ins1-/-:Ins2+/- mice, which also only had insulin expression from only one allele, no significant changes in in circulating insulin levels or islet mass was observed. In the past, in vitro cultures of dispersed primary islet cells, a system where insulin and glucose can be clamped independently of each other, have been used to demonstrate that insulin but not glucose stimulates -cell proliferation 24,132. We have also shown that glucose-stimulated ERK activation is proportionally  122 reduced in islets with reduced insulin gene dosage 31, strongly suggesting that glucose acts mainly via local autocrine/paracrine insulin signalling. Indeed, >80% of the effects of glucose on -cell gene expression are lost in cultured -cells with insulin receptor knockdown 549. Together, these lines of evidence from multiple groups demonstrate conclusively that insulin acts via insulin receptors to mediate the compensatory increase in -cell mass and basal insulin release in the context of high fat diet. This has implications for efforts to increase -cell mass in both type 1 and type 2 diabetes.  6.3 Tissue-specific roles for Ins1 and Ins2: Relevance to human INSULIN Insulin is the most studied hormone in biology, yet the present study provides new integrated insight into its localization and physiological functions. Clinically, insulin insufficiency resulting from a loss of greater than ~80% of -cell mass results in diabetes, promoting the prevailing mindset that insulin’s roles are predominately positive 550,551. However, elegant studies in flies and worms have demonstrated that deleting insulin genes, or blocking elements of the insulin signalling pathway, dramatically increases lifespan and prevents diseases associated with adiposity 33,171. These model systems also clearly indicate that individual insulin-like peptide genes have distinct physiological functions despite signalling through a single receptor 33,171. It has been previously shown that the mouse Ins1 and Ins2 genes have opposing effects on type 1 diabetes incidence in the NOD mouse due to the induction of thymic tolerance by Ins2, 44,49. Specifically, Ins2 expression was associated with reduced incidences of type 1 diabetes and the reverse was true for the expression of the Ins1 gene 44,49. Our observation that the pancreatic-specific Ins1 is dose-dependently required for diet-induced obesity, defines the first specific role for Ins1 outside the context of type 1 diabetes. It is noteworthy that these Ins1+/+:Ins2-/- and Ins1+/-:Ins2-/- mice are  123 missing the Ins2 gene and by definition are hypoinsulinemic compared to a wildtype Ins1+/+:Ins2+/+ mouse. However, the relative systemic hyperinsulinemia observed in the, Ins1+/+:Ins2-/- mice compared to the Ins1+/-:Ins2-/- allowed us to understand the causal role for high fat diet-induced increase in circulating insulin in the pathogenesis of obesity. We elucidated the tissue-specific expression patterns of Ins1 and Ins2. Using multiple approaches, we found that Ins2 is clearly present in neurons of the CNS, at both the mRNA and protein level. Importantly, we present both negative and positive controls arguing against qPCR or staining artifacts. Through work with our collaborators, we also provided information on distinct active chromatin marks on the Ins2 gene in the CNS 127. Given the conservation between the rodent Ins2 gene and the human INS gene, we were not surprised to find preliminary evidence for insulin production in the human brain. In both human and rodent brains, we found robust insulin expression in the hippocampus, pointing to potential roles in memory and cognition 351,360,376-398. It is interesting to note the recent interest in clinical trials using nasal insulin to deliver this putative central neurotrophic factor for the treatment of Alzheimer’s disease 351,360,376-398. A complete understanding of the role of Ins2 in the CNS will require conditional Ins2 knockout mice.   6.4 Changes in Ins2 gene dosage may potentially affect food intake The central nervous system oversees many physiological functions in the periphery, one of which is energy homeostasis 238-240. Insulin, regardless of its origin, is thought to play a key regulatory role in central control of energy intake and expenditure 238-240. Brüning et al. showed that knocking out the insulin receptor specifically in the central nervous system leads to hyperphagia and obesity 507. The presence of small amounts of insulin protein and mRNA in the mammalian brain has long been reported 552. However, we showed, unlike previous studies that  124 lacked high fidelity molecular methods and ideal negative controls such as the insulin knockout mice, that the Ins2 gene is expressed in multiple regions of the brain, most notably in hippocampal neurons. Furthermore, we also provided the first evidence that Ins2 mRNA in the brain is regulated by high fat feeding. Since insulin has been proposed to be a satiety factor 553, downregulation of insulin expression and/or action may be expected to increase food intake. Consistent with this notion, Ins1-/-:Ins2+/- mice in our first cohort had increased high fat food intake and were obese when compared to the control high-fat fed Ins1-/-:Ins2+/+ mice. Although our experimental treatment was expected to reduce Ins2 gene dosage in multiple tissues, including the pancreas, thymus and brain, several lines of evidence could potentially hint that a partial reduction of brain Ins2 was associated with the diet-dependent hyperphagia and obesity, at least in some specific conditions. In our studies, circulating insulin levels were not different between Ins1-/-:Ins2+/- mice and Ins1-/-:Ins2+/+ mice on the high fat diet. Other investigators have shown that Ins2 knockout in the thymus had no effect on body weight 61. On the other hand, it has been reported that insulin receptor knockout in the brain leads to increased high fat food intake and obesity 507, suggesting the possible presence of a local signalling network. Our work should open new avenues for investigating the biology of insulin in neurons and their connections. However, it is imperative that these data are interpreted with caution as we observed conflicting results in a second cohort. This observed variability in response to changes in Ins2 gene dosage is currently being studied by another graduate student in our laboratory in a new animal housing facility and is beyond the scope of this thesis (personal communications, Nicole Templeman).   125 6.5 High fat feeding affects central insulin expression Neurodegenerative diseases are on the rise, similar to the ascendance of obesity and diabetes. In particular Alzheimer’s disease and dementia are strongly correlated with obesity and insulin resistance 526-529. Thus, the rising numbers of patients with obesity and insulin resistance are also at risk for these neurodegenerative diseases, which reduce cognitive function and the ability to form memories 176-178. It is established that obesity and a high fat diet regimen can lead to central insulin resistance 168,191,199,225,511-525. High calorie diets with excess fat and carbohydrates are also noted as important environmental factors that can increase the risk of these neurodegenerative diseases 176-178. Animal studies have also shown that such dietary regimes can have adverse cognitive health outcomes 176,180-185. Moreover, it is reported that during the early stages of the Alzheimer’s disease there is a notable decrease in the levels of insulin in the cerebrospinal fluid 68,70,554. We have been able to show, for the first time and through reliable and precise molecular methodology, that high fat diet can reduce the expression of central murine Ins2 gene. Remarkably, this reduction is apparent in both the hippocampi and the olfactory bulbs (Fig. 3.9 and 3.10). The hippocampus is responsible for memory formation and neuronal death in this region is a key factor in Alzheimer’s disease 526-529. Both the olfactory bulb and the hippocampus are similar in that they both receive new cells from neuronal stem cell depots, dentate gyrus in case of hippocampus and the subventricular zone in case of the olfactory bulb 555-559. Being a pro-survival/anti-apoptotic factor 23, insulin fits as an important factor to promote differentiation of these stem cells and protection of the existing neurons. This notion is also in agreement with the result of the studies of intranasal insulin therapy that is currently being tested for treating Alzheimer’s disease with promising results 190,199,215-237. Our data adds to our understanding of these neurodegenerative diseases by showing that insulin is being produced at these brain regions.  126 Thus, for fully understanding these diseases, and inventing new therapeutic means, it is crucial to consider the role of the centrally expressed insulin.  6.6 Summary In the present studies, we have used genetic partial reduction of pancreatic insulin to demonstrate a causal role for insulin in obesity. Studies have shown that the loss of the Ins2 gene, compared to the Ins1 gene, has a more pronounced effect on islet function, insulin production and glucose homeostasis, which is expected since Ins2 constitutes the major insulin isoform in the pancreas 504,560-562. Moreover, it has been shown that there is a striking increase in the incidences of early-onset diabetes, due to depletion of insulin in the islets as opposed to autoimmunity towards insulin, in the male Ins1+/-:Ins2-/-, but not in Ins1+/+:Ins2-/-, Ins1-/-:Ins2+/-, or Ins1-/-:Ins2+/+, mice on a non-obese diabetic background 561. Our results are also in line with these findings that although there is compensation in expression from the remaining Ins gene when one of the two murine Ins genes is ablated, expression from only one allele of the Ins1 gene may not be able to adequately compensate for the missing alleles. However, we and others 561 observed that once past the early stage of life, after approximately ten weeks of age, Ins1+/-:Ins2-/- male mice are able to control their glucose homeostasis despite reduced insulin levels. The fact that the adult male Ins1+/-:Ins2-/- mice are able to maintain their glucose homeostasis despite reduced insulin levels was a key factor in the interpretation of our data. Because of this, we were able to study the causal role of systemic hyperinsulinemia in the pathogenesis of diet-induced obesity by comparing male Ins1+/-:Ins2-/- and Ins1+/+:Ins2-/-, but not Ins1-/-:Ins2+/- and Ins1-/-:Ins2+/-, mice; as expression from even one allele of the Ins2 gene proved capable of preventing changes in circulating insulin levels. Using the male Ins1+/-:Ins2-/- and Ins1+/+:Ins2-/-, we were able to conclusively show that hyperinsulinemia is causal  127 to the changes in adiposity, independent of glucose tolerance, as previously suggested by numerous other studies 102,104,476,480,492,494-499,541. Our studies are also in agreement with previous studies showing that reduced systemic insulin is associated with increased metabolic rate and reduced adiposity 495,496,498. However, our studies do not allow us to confirm or rule out that there also may be functional and isoform-specific effect difference(s) between the two murine insulin peptides. In contrast to the male mice, we were unable to detect any significant changes in insulin levels in response to reduction in Ins gene dosage in female mice. Notably, we did not encounter any cases of diabetes in the female mice. The interpretations of these data are more complex and some of its aspects, such as the variability observed in male Ins1-/-:Ins2+/+ and Ins1-/-:Ins2+/- mice, are being studied by another student in our laboratory (personal communication, Nicole Templeman). However, generally, there are differences between males and females that can affect adiposity, fat distribution, inflammation, and insulin sensitivity. For example, higher levels of estrogen in females have been associated with a healthier physiological state compared to males such as lower visceral and higher peripheral adiposity, higher adiponectin levels, increased lipid oxidation, reduced production of reactive oxygen species, better insulin sensitivity and protection of β-cell health and function during metabolic stress 393,563-570. These factors could potentially contribute to the lack of differences in the circulating insulin levels due to changes in Ins gene dosage in our studies. The only non-significant trends observed in the female mice, with respect to changes in circulating insulin levels and weight gain, was observed in Ins1-/-:Ins2+/+ and Ins1-/-:Ins2+/- mice. Both of these groups of female mice showed higher circulating levels and trends towards higher weight that was high fat diet-dependent regardless of their genotype. In agreement with this observation, it has been previously shown that women are more affected by the type of food they eat compared to men 571.  128 Interestingly, the phenotypes presented in chapter 5 appear to be variable, sex-dependent, and context-dependent with respect to reduction of the Ins2 gene. We also provide evidence that insulin is produced locally in the brain, where it may have potential effects on satiety 553. Moreover, Ins2 expression was reduced in certain parts of the high fat fed female, but not male, brain and that could potentially be associated with the aforementioned diet-dependent differences observed in the Ins1 null female mice. Our data provide strong rationale to investigate approaches to limit peripheral hyperinsulinemia and augment the central effects of insulin for not only the prevention and treatment of obesity, but also neurodegenerative disease in humans.  6.7 Limitation of the studies and future directions Although our studies provided some insights into the effects of changes in insulin gene dosage in mice, there are improvements that can be made. These studies were conducted using diets that, though almost calorically matched, contained different sources for the type of fat. The high fat diet contained 58% coconut oil whereas the control diet contained 25% lard (Table 2.3). Coconut oil is believed to be less deleterious than lard and it can also increase the amount of beneficiary HDL cholesterol 572. Thus this may have introduced confounding effects in the results that may have not been accounted for. However, usage of a high fat diet that contains 60% lard produces dramatic glucose intolerance (Appendix A) compared to the 58% coconut oil where glucose tolerance was unaffected (Figs. 4.6B and 5.4C). Thus, the diet-induced glucose resistance would have prevented us from studying the role of reduced circulating insulin in the absence of glycemic abnormalities. To avoid this issue, it is best that in future studies a control diet is chosen with lower amounts of coconut oil.  129 Although the studies above hinted at a role for insulin expression in the brain for controlling food intake, the reduction in Ins2 gene dosage was made globally throughout the body. Thus, it is imperative to isolate the Ins2 gene deletion to the central nervous system, leaving it intact elsewhere, especially in the pancreas and thymus. To test the role of local insulin expression in food intake we can utilize the Cre-Lox recombination system. This system is derived from bacteriophage P1 573. Since this system does not naturally exist in mammals, it can be used to efficiently remove specific genes from mammalian models 573. The enzyme Cre recombinase finds and excises any floxed, flanked by two LoxP sequences, DNA sequence 573. We can use mice with a floxed Ins2 gene on an Ins1 null background, which are available in our laboratory. Our earlier experiments show that there is no compensatory expression from the Ins1 allele in the absence of Ins2 in the brain. However, to prevent any potential compensation from the other murine Ins gene, we can use mice on an Ins1 null background. This ensures that when Ins2 is removed, compensatory Ins1 expression will not confound the results. Keeping in mind that the Ins2 gene is capable of sufficiently compensating for the lack of the pancreatic-specific Ins1 gene 560. To knock out Ins2 specifically in the neurons we can use a mouse line that expresses Cre recombinase under the control of a CNS-specific promoter. Normally the Nestin gene is used for this purpose. Nestin is expressed in a plethora of cell types, such as neurons, cartilage, bone, skin, skeletal muscle, pancreas, kidney and heart, both during embryonic development and adult life 574-576. However, a specific NestinCre line, developed by R. Klein, has increased specificity to central and peripheral neurons 577. This specificity is due to the fact that this mouse line has transgene that carries the neuron specific enhancer element of the intron 2 of the Nestin gene 577,578. We did attempt this method, with a similar but not identical NestinCre deleter mouse from Ruth Slack at the University of Ottawa, but unfortunately we did not observe changes in central Ins2 expression between Ins1- 130 /-:Ins2fl/fl:CreNes and control Ins1-/-:Ins2fl/fl or Ins1-/-:Ins2+/+:CreNes mice. There are reports, through lineage-tracing studies, that in the pancreas Nestin and Insulin are not expressed in the same cells 579. This could potentially explain the negative results we have in our attempt, as Nestin may also not be expressed in the same neurons that Ins2 is expressed. A different Cre-expressing mouse line that could be used to conduct a similar experiment would be mice that produce Cre under the control of the Synapsin promoter which is expressed in neurons of the brain and spinal cord 580-582. Moreover, we are not aware of any study indicating that Synapsin and Insulin are not expressed in the same cells. Future studies, including those using Ins2:GFP knock-in mice, are required to clearly map the distribution of brain insulin relative to the domains of the various Cre lines available. Insulin’s effect on satiety largely depends on the population of neurons in the arcuate nucleus of the hypothalamus that express orexigenic and anorexigenic peptides such as POMC and AgRP/NPY, respectively. However, it has been shown that if the genes that express these peptides are knocked out from the embryonic stages, the brain can completely compensate for their absence 583. Thus, to study the role of local brain insulin expression on food intake, insulin must be knocked out acutely and postnatally. This can be achieved by injecting, through stereotactic surgery, the Ins1-/-:Ins2fl/fl mice with a Cre expressing virus. We also tried this approach. We were able to successfully inject the mice in desired locations as tested by injecting a dye into the third ventricle. We injected both a virus that expressed Cre and GFP (Vector Biolabs catalog # 7088, Philadelphia, USA), and another virus that expressed only GFP (Vector Biolabs catalog # 7006, Philadelphia, USA). However, the Cre-expressing virus used failed to infect as we were unable to detect any significant GFP expression in the brain using fluorescent microscopy (data not shown). We tested the virus in vitro as well and found no signs of successful infection (i.e. GFP expression) using  131 fluorescent microscopy (data not shown). It was recently also reported that acutely killing hypothalamic cells with Ins2 promoter activity can alter food intake and weight gain 174. However, their approach is confounded by the fact that the cells with Ins2 promoter activity could have other non-insulin dependent functions. Thus, the specific Ins2 gene knockout approaches we have suggested here will allow studying only the effects of removing central Ins2 gene. Moreover, a similar method can be used by studying the role of local insulin expression in the hippocampus and its effect on memory and learning by bilaterally injecting the Cre-expressing virus in the hippocampi.   There are numerous reports indicating that there is a link between insulin and longevity 4,13,584,585. In our studies, we allowed one cohort of Ins1+/-:Ins2-/-, and littermate control Ins1+/+:Ins2-/-, mice to age. We noticed that Ins2-/- mice with reduced Ins1 gene dosage and on a control diet had about 30 percent higher survival rate at 2 years (data not shown). Additional studies are underway in the laboratory to more thoroughly evaluate the relationship between insulin and longevity. The tools we have at our disposal, the insulin knockout mice, allow us to study the relation between insulin and longevity without adding any confounding factor such as caloric restriction or inducing insulin resistance.  Despite these caveats, we have been able to show that high fat diet-induced hyperinsulinemia is a causal factor in the pathogenesis of high fat diet-induced obesity and that prevention of hyperinsulinemia is an effective way to prevent high-fat diet induced obesity. Moreover, using knockout controls we were able to show that in mice, unlike the Ins1 gene, the Ins2 gene is expressed in the brain like that of the human INSULIN gene; this can potentially help for further research for treatment of cognitive disorders that are related to reduced central insulin levels or action.   132  6.8 Summary Figure                       133  Figure 6.1 Revisiting the central model of obesity and type 2 diabetes. (A) The most widely accepted model of the causality relationships in the pathogenesis of obesity and type 2 diabetes dictates that a high fat diet leads to obesity, which via multiple factors including a chronic state of inflammation, which results in insulin resistance. Insulin resistance leads to hyperinsulinemia then β-cell exhaustion then type 2 diabetes. The accepted model is incompatible with our results that put the hypersecretion of pancreatic insulin 1 genetically upstream of obesity. (B) Specifically, our data suggest a model whereby low levels of insulin are required to maintain energy expenditure in white adipose tissue via the expression of Ucp1 (perhaps in a Nrip1-dependent manner). Our data also suggest that central insulin 2 may play an anti-obesity role by suppressing the intake of high fat food. This satiety signal could be alleviated by the reduction of brain insulin 2 in the context of a high fat diet, suggesting an additional vicious cycle. Our data do not address the order of subsequent events after obesity (outside the yellow box), such as insulin resistance and/or type 2 diabetes, since they were not observed in our studies.           134 Bibliography 1 Nobelprize.org. The Discovery of Insulin, <http://www.nobelprize.org/educational/medicine/insulin/discovery-insulin.html> (2014). 2 Roth, J. et al. Insulin's discovery: new insights on its ninetieth birthday. Diabetes/metabolism research and reviews 28, 293-304, doi:10.1002/dmrr.2300 (2012). 3 Ferrannini, E. et al. Insulin: new roles for an ancient hormone. European Journal of Clinical Investigation 29, 842-852 (1999). 4 Cohen, E. & Dillin, A. The insulin paradox: aging, proteotoxicity and neurodegeneration. Nat Rev Neurosci 9, 759-767, doi:nrn2474 [pii]10.1038/nrn2474 (2008). 5 Lok, S. et al. Identification of INSL6, a new member of the insulin family that is expressed in the testis of the human and rat. Biol Reprod 62, 1593-1599 (2000). 6 Brailoiu, G. C. et al. Insulin-like 6 immunoreactivity in the mouse brain and testis. Brain Research 1040, 187-190, doi:10.1016/j.brainres.2005.01.077 (2005). 7 Ma, S. et al. Relaxin-3 in GABA projection neurons of nucleus incertus suggests widespread influence on forebrain circuits via G-protein-coupled receptor-135 in the rat. Neuroscience 144, 165-190, doi:10.1016/j.neuroscience.2006.08.072 (2007). 8 Brailoiu, E. et al. C-peptide of preproinsulin-like peptide 7: localization in the rat brain and activity in vitro. Neuroscience 159, 492-500 (2009). 9 Ma, S. et al. Modulation of hippocampal theta oscillations and spatial memory by relaxin-3 neurons of the nucleus incertus. Learn Mem 16, 730-742, doi:10.1101/lm.1438109 (2009).  135 10 Broughton, S. & Partridge, L. Insulin/IGF-like signalling, the central nervous system and aging. Biochem J 418, 1-12, doi:BJ20082102 [pii]10.1042/BJ20082102 (2009). 11 Broughton, S. J. et al. DILP-producing median neurosecretory cells in the Drosophila brain mediate the response of lifespan to nutrition. Aging Cell 9, 336-346, doi:10.1111/j.1474-9726.2010.00558.x (2010). 12 Rulifson, E. J., Kim, S. K. & Nusse, R. Ablation of insulin-producing neurons in flies: growth and diabetic phenotypes. Science 296, 1118-1120, doi:10.1126/science.1070058 296/5570/1118 [pii] (2002). 13 Narasimhan, S. D., Yen, K. & Tissenbaum, H. A. Converging pathways in lifespan regulation. Curr Biol 19, R657-666, doi:S0960-9822(09)01252-4 [pii] 10.1016/j.cub.2009.06.013 (2009). 14 Oda, S., Tomioka, M. & Iino, Y. Neuronal plasticity regulated by the insulin-like signaling pathway underlies salt chemotaxis learning in Caenorhabditis elegans. J Neurophysiol 106, 301-308, doi:10.1152/jn.01029.2010 (2011). 15 You, Y. J., Kim, J., Raizen, D. M. & Avery, L. Insulin, cGMP, and TGF-beta signals regulate food intake and quiescence in C. elegans: a model for satiety. Cell metabolism 7, 249-257, doi:10.1016/j.cmet.2008.01.005 (2008). 16 Kodama, E. et al. Insulin-like signaling and the neural circuit for integrative behavior in C. elegans. Genes Dev 20, 2955-2960, doi:10.1101/gad.1479906 (2006). 17 Hwangbo, D. S., Gershman, B., Tu, M. P., Palmer, M. & Tatar, M. Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature 429, 562-566, doi:10.1038/nature02549 (2004).  136 18 Hua, Q. X. et al. A divergent INS protein in Caenorhabditis elegans structurally resembles human insulin and activates the human insulin receptor. Genes Dev 17, 826-831, doi:10.1101/gad.1058003 (2003). 19 Kulkarni, R. N. et al. Altered function of insulin receptor substrate-1-deficient mouse islets and cultured beta-cell lines. The Journal of clinical investigation 104, R69-75 (1999). 20 Kulkarni, R. N. et al. beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta-cell mass. Nat Genet 31, 111-115 (2002). 21 Kahn, C. R., Bruning, J. C., Michael, M. D. & Kulkarni, R. N. Knockout mice challenge our concepts of glucose homeostasis and the pathogenesis of diabetes mellitus. J Pediatr Endocrinol Metab 13 Suppl 6, 1377-1384 (2000). 22 Beith, J. L., Alejandro, E. U. & Johnson, J. D. Insulin Stimulates Primary beta-cell Proliferation via Raf-1 Kinase. Endocrinology (2008). 23 Johnson, J. D. & Alejandro, E. U. Control of pancreatic beta-cell fate by insulin signaling: The sweet spot hypothesis. Cell Cycle 7, 1343-1347, doi:5865 [pii] (2008). 24 Johnson, J. D. et al. Insulin protects islets from apoptosis via Pdx1 and specific changes in the human islet proteome. Proc Natl Acad Sci U S A 103, 19575-19580, doi:0604208103 [pii] 10.1073/pnas.0604208103 (2006). 25 Kitamura, T., Kahn, C. R. & Accili, D. Insulin receptor knockout mice. Annu Rev Physiol 65, 313-332, doi:10.1146/annurev.physiol.65.092101.142540092101.142540 [pii] (2003).  137 26 Otani, K., Kulkarni, R. N., Baldwin, A. C., Kahn, C. R. & Polonsky, K. S. Defective insulin secretion in mice lacking insulin receptors on pancreatic beta cells. Diabetes 50, A401-A402 (2001). 27 Kulkarni, R. N. et al. Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96, 329-339 (1999). 28 Ueki, K. et al. Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes. Nat Genet 38, 583-588 (2006). 29 Bluher, M. et al. Adipose tissue selective insulin receptor knockout protects against obesity and obesity-related glucose intolerance. Dev Cell 3, 25-38, doi:S1534580702001995 [pii] (2002). 30 Bluher, M. et al. Role of insulin action and cell size on protein expression patterns in adipocytes. Journal of Biological Chemistry 279, 31902-31909, doi:10.1074/jbc.M404570200M404570200 [pii] (2004). 31 Alejandro, E. U. et al. Acute insulin signaling in pancreatic beta-cells is mediated by multiple Raf-1 dependent pathways. Endocrinology 151, 502-512, doi:en.2009-0678 [pii]10.1210/en.2009-0678 (2010). 32 Kido, Y., Nakae, J. & Accili, D. Clinical review 125: The insulin receptor and its cellular targets. J Clin Endocrinol Metab 86, 972-979 (2001). 33 Li, W., Kennedy, S. G. & Ruvkun, G. daf-28 encodes a C. elegans insulin superfamily member that is regulated by environmental cues and acts in the DAF-2 signaling pathway. Genes Dev 17, 844-858, doi:10.1101/gad.1066503 (2003).  138 34 Ohneda, K., Ee, H. & German, M. Regulation of insulin gene transcription. Seminars in cell & developmental biology 11, 227-233, doi:10.1006/scdb.2000.0171 (2000). 35 Pugliese, A. et al. The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat Genet 15, 293-297, doi:10.1038/ng0397-293 (1997). 36 Fan, Y. et al. Thymus-specific deletion of insulin induces autoimmune diabetes. Embo j 28, 2812-2824, doi:10.1038/emboj.2009.212 (2009). 37 Fan, Y. et al. Type 1 Diabetes Induced by Thymus-Specific Deletion of Insulin. Diabetes 59, A89-A89 (2010). 38 Havrankova, J., Schmechel, D., Roth, J. & Brownstein, M. Identification of insulin in rat brain. Proc Natl Acad Sci U S A 75, 5737-5741 (1978). 39 Lamotte, L. et al. Knock-in of diphteria toxin A chain gene at Ins2 locus: effects on islet development and localization of Ins2 expression in the brain. Transgenic Res 13, 463-473 (2004). 40 de la Monte, S. M., Tong, M., Lester-Coll, N., Plater, M., Jr. & Wands, J. R. Therapeutic rescue of neurodegeneration in experimental type 3 diabetes: relevance to Alzheimer's disease. Journal of Alzheimer's disease : JAD 10, 89-109 (2006). 41 de la Monte, S. M., Tong, M., Bowling, N. & Moskal, P. si-RNA inhibition of brain insulin or insulin-like growth factor receptors causes developmental cerebellar abnormalities: relevance to fetal alcohol spectrum disorder. Mol Brain 4, 13, doi:10.1186/1756-6606-4-13 (2011). 42 de la Monte, S. M. & Wands, J. R. Alzheimer's disease is type 3 diabetes-evidence reviewed. J Diabetes Sci Technol 2, 1101-1113 (2008).  139 43 Devaskar, S. U. et al. Insulin gene expression and insulin synthesis in mammalian neuronal cells. Journal of Biological Chemistry 269, 8445-8454 (1994). 44 Clarke, D. W., Mudd, L., Boyd, F. T., Jr., Fields, M. & Raizada, M. K. Insulin is released from rat brain neuronal cells in culture. Journal of Neurochemistry 47, 831-836 (1986). 45 Alpert, S., Hanahan, D. & Teitelman, G. Hybrid insulin genes reveal a developmental lineage for pancreatic endocrine cells and imply a relationship with neurons. Cell 53, 295-308 (1988). 46 Jones, M. J., Bogutz, A. B. & Lefebvre, L. An extended domain of Kcnq1ot1 silencing revealed by an imprinted fluorescent reporter. Mol Cell Biol 31, 2827-2837, doi:10.1128/MCB.01435-10 (2011). 47 Deltour, L. et al. Differential expression of the two nonallelic proinsulin genes in the developing mouse embryo. Proc Natl Acad Sci U S A 90, 527-531 (1993). 48 Schechter, R., Sadiq, H. F. & Devaskar, S. U. Insulin and insulin mRNA are detected in neuronal cell cultures maintained in an insulin-free/serum-free medium. J Histochem Cytochem 38, 829-836 (1990). 49 Havrankova, J., Schmechel, D., Roth, J. & Brownstein, M. Identification of Insulin in Rat-Brain. Proceedings of the National Academy of Sciences of the United States of America 75, 5737-5741 (1978). 50 Giddings, S. J., Chirgwin, J. & Permutt, M. A. Evaluation of rat insulin messenger RNA in pancreatic and extrapancreatic tissues. Diabetologia 28, 343-347 (1985). 51 Devaskar, S. U., Singh, B. S., Carnaghi, L. R., Rajakumar, P. A. & Giddings, S. J. Insulin II gene expression in rat central nervous system. Regul Pept 48, 55-63 (1993).  140 52 Schechter, R. et al. Immunohistochemical and in situ hybridization study of an insulin-like substance in fetal neuron cell cultures. Brain Research 636, 9-27, doi:0006-8993(94)90170-8 [pii] (1994). 53 Riederer, P., Bartl, J., Laux, G. & Grunblatt, E. Diabetes type II: a risk factor for depression-Parkinson-Alzheimer? Neurotox Res 19, 253-265, doi:10.1007/s12640-010-9203-1 (2011). 54 Plaschke, K. et al. Insulin-resistant brain state after intracerebroventricular streptozotocin injection exacerbates Alzheimer-like changes in Tg2576 AbetaPP-overexpressing mice. J Alzheimers Dis 19, 691-704, doi:Q7752551841H7437 [pii]10.3233/JAD-2010-1270 (2010). 55 Osmanovic, J. et al. Chronic exogenous corticosterone administration generates an insulin-resistant brain state in rats. Stress 13, 123-131, doi:10.3109/10253890903080379 (2010). 56 Salkovic-Petrisic, M., Osmanovic, J., Grunblatt, E., Riederer, P. & Hoyer, S. Modeling sporadic Alzheimer's disease: the insulin resistant brain state generates multiple long-term morphobiological abnormalities including hyperphosphorylated tau protein and amyloid-beta. J Alzheimers Dis 18, 729-750, doi:X7889863357QX387 [pii]10.3233/JAD-2009-1184 (2009). 57 Grunblatt, E., Salkovic-Petrisic, M., Osmanovic, J., Riederer, P. & Hoyer, S. Brain insulin system dysfunction in streptozotocin intracerebroventricularly treated rats generates hyperphosphorylated tau protein. Journal of Neurochemistry 101, 757-770, doi:JNC4368 [pii]10.1111/j.1471-4159.2006.04368.x (2007).  141 58 Grunblatt, E., Koutsilieri, E., Hoyer, S. & Riederer, P. Gene expression alterations in brain areas of intracerebroventricular streptozotocin treated rat. J Alzheimers Dis 9, 261-271 (2006). 59 Salkovic-Petrisic, M., Lackovic, Z., Hoyer, S. & Riederer, P. Central administration of alloxan impairs glucose tolerance in rats. J Neural Transm 112, 1391-1395, doi:10.1007/s00702-005-0360-y (2005). 60 Singh, B. S. et al. Insulin gene expression in immortalized rat hippocampal and pheochromocytoma-12 cell lines. Regul Pept 69, 7-14, doi:S0167011596021209 [pii] (1997). 61 Devaskar, S. U. A review of insulin/insulin-like peptide in the central nervous system. Physiology and Pathophysiology of the Islets of Langerhans 293, 385-396 (1991). 62 de la Monte, S. M. Insulin resistance and Alzheimer's disease. BMB Rep 42, 475-481 (2009). 63 Moroz, N., Tong, M., Longato, L., Xu, H. & de la Monte, S. M. Limited Alzheimer-type neurodegeneration in experimental obesity and type 2 diabetes mellitus. Journal of Alzheimer's disease : JAD 15, 29-44 (2008). 64 de la Monte, S. M. et al. Insulin and insulin-like growth factor resistance in alcoholic neurodegeneration. Alcohol Clin Exp Res 32, 1630-1644, doi:10.1111/j.1530-0277.2008.00731.x (2008). 65 Cohen, A. C., Tong, M., Wands, J. R. & de la Monte, S. M. Insulin and insulin-like growth factor resistance with neurodegeneration in an adult chronic ethanol exposure model. Alcohol Clin Exp Res 31, 1558-1573, doi:10.1111/j.1530-0277.2007.00450.x (2007).  142 66 Soscia, S. J. et al. Chronic gestational exposure to ethanol causes insulin and IGF resistance and impairs acetylcholine homeostasis in the brain. Cellular and molecular life sciences : CMLS 63, 2039-2056, doi:10.1007/s00018-006-6208-2 (2006). 67 Lester-Coll, N. et al. Intracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease. Journal of Alzheimer's disease : JAD 9, 13-33 (2006). 68 Rivera, E. J. et al. Insulin and insulin-like growth factor expression and function deteriorate with progression of Alzheimer's disease: link to brain reductions in acetylcholine. Journal of Alzheimer's disease : JAD 8, 247-268 (2005). 69 de la Monte, S. M., Xu, X. J. & Wands, J. R. Ethanol inhibits insulin expression and actions in the developing brain. Cellular and molecular life sciences : CMLS 62, 1131-1145, doi:10.1007/s00018-005-4571-z (2005). 70 de la Monte, S. M. & Wands, J. R. Review of insulin and insulin-like growth factor expression, signaling, and malfunction in the central nervous system: relevance to Alzheimer's disease. Journal of Alzheimer's disease : JAD 7, 45-61 (2005). 71 Kojima, H., Fujimiya, M., Terashima, T., Kimura, H. & Chan, L. Extrapancreatic proinsulin/insulin-expressing cells in diabetes mellitus: is history repeating itself? Endocr J 53, 715-722, doi:JST.JSTAGE/endocrj/KR-84 [pii] (2006). 72 Schechter, R. et al. Developmental regulation of insulin in the mammalian central nervous system. Brain Research 582, 27-37 (1992). 73 Wozniak, M., Rydzewski, B., Baker, S. P. & Raizada, M. K. The cellular and physiological actions of insulin in the central nervous system. Neurochem Int 22, 1-10 (1993).  143 74 Young, W. S., 3rd. Periventricular hypothalamic cells in the rat brain contain insulin mRNA. Neuropeptides 8, 93-97 (1986). 75 Dorn, A., Bernstein, H. G., Hahn, H. J., Ziegler, M. & Rummelfanger, H. Insulin immunohistochemistry of rodent CNS: apparent species differences but good correlation with radioimmunological data. Histochemistry 71, 609-616 (1981). 76 Rosenzweig, J. L., Havrankova, J., Lesniak, M. A., Brownstein, M. & Roth, J. Insulin is ubiquitous in extrapancreatic tissues of rats and humans. Proc Natl Acad Sci U S A 77, 572-576 (1980). 77 Schechter, R., Holtzclaw, L., Sadiq, F., Kahn, A. & Devaskar, S. Insulin synthesis by isolated rabbit neurons. Endocrinology 123, 505-513 (1988). 78 Stempniak, B. & Guzek, J. W. Insulin-like immunoreactivity (IRI) in the rat hypothalamo-neurohypophysial system: effect of dehydration and haemorrhage. J Physiol Pharmacol 44, 155-159 (1993). 79 Nishimura, M. et al. The effects of insulin and insulin-like materials in the brain on central cardiovascular regulation: with special reference to the central effects of sodium chloride. J Hypertens 9, 509-517 (1991). 80 Dheen, S. T., Tay, S. S. & Wong, W. C. Localization of insulin-like immunoreactive neurons in the rat gracile nucleus. Histol Histopathol 11, 667-672 (1996). 81 Unger, J. et al. Distribution of insulin receptor-like immunoreactivity in the rat forebrain. Neuroscience 31, 143-157 (1989). 82 Birch, N. P., Christie, D. L. & Renwick, A. G. Immunoreactive insulin from mouse brain cells in culture and whole rat brain. The Biochemical journal 218, 19-27 (1984).  144 83 Birch, N. P., Christie, D. L. & Renwick, A. G. Proinsulin-like material in mouse foetal brain cell cultures. FEBS Lett 168, 299-302 (1984). 84 Birch, N. P., Christie, D. L. & Renwick, A. G. Multiple forms of biologically active insulin-like material from mouse fetal brain cells in culture. Neuropeptides 9, 325-331 (1987). 85 Bernstein, H. G., Dorn, A., Reiser, M. & Ziegler, M. Cerebral insulin-like immunoreactivity in rats and mice. Drastic decline during postnatal ontogenesis. Acta Histochem 74, 33-36 (1984). 86 Dorn, A., Bernstein, H. G., Hahn, H. J., Ziegler, M. & Rinne, A. [Immunoreactive insulin in the CNS of human fetuses and newborn infants of metabolically healthy and diabetic mothers--an immunohistochemical study]. Acta Histochem Suppl 30, 281-285 (1984). 87 Dorn, A., Bernstein, H. G., Kostmann, G., Hahn, H. J. & Ziegler, M. An immunofluorescent reaction appears to insulin-antiserum in different CNS regions of two rat species. Acta Histochem 66, 276-278 (1980). 88 Dorn, A., Bernstein, H. G., Rinne, A., Hahn, H. J. & Ziegler, M. Insulin-like immunoreactivity in the human brain- A preliminary report. Histochemistry 74, 293-300 (1982). 89 Dorn, A. et al. Insulin- and glucagonlike peptides in the brain. Anat Rec 207, 69-77, doi:10.1002/ar.1092070108 (1983). 90 Dorn, A., Rinne, A., Bernstein, H. G., Hahn, H. J. & Ziegler, M. Insulin and C-peptide in human brain neurons (insulin/C-peptide/brain peptides/immunohistochemistry/radioimmunoassay). J Hirnforsch 24, 495-499 (1983).  145 91 Dorn, A., Rinne, A., Hahn, H. J., Bernstein, H. G. & Ziegler, M. C-peptide immunoreactive neurons in human brain. Acta Histochem 70, 326-330 (1982). 92 Dorn, A., Ziegler, M., Bernstein, H. G., Dietz, H. & Rinne, A. Concerning the presence of an insulin-related peptide in the human brain: an immunohistochemical reinvestigation by use of monoclonal insulin antibodies. Acta Histochem 74, 81-84 (1984). 93 Raizada, M. K. Localization of insulin-like immunoreactivity in the neurons from primary cultures of rat brain. Exp Cell Res 143, 351-357 (1983). 94 Weyhenmeyer, J. A. & Fellows, R. E. Presence of immunoreactive insulin in neurons cultured from fetal rat brain. Cell Mol Neurobiol 3, 81-86 (1983). 95 Stevenson, R. W. Further evidence for non-pancreatic insulin immunoreactivity in guinea pig brain. Horm Metab Res 15, 526-529, doi:10.1055/s-2007-1018779 (1983). 96 Hill, J. M., Lesniak, M. A., Pert, C. B. & Roth, J. Autoradiographic localization of insulin receptors in rat brain: prominence in olfactory and limbic areas. Neuroscience 17, 1127-1138 (1986). 97 Watanabe, A., Fujiwara, M. & Nagashima, H. Glucagon-like polypeptide and insulin contents in the brain from acute hepatic failure dogs. Res Exp Med (Berl) 186, 203-208 (1986). 98 Gerozissis, K., Rouch, C., Lemierre, S., Nicolaidis, S. & Orosco, M. A potential role of central insulin in learning and memory related to feeding. Cell Mol Neurobiol 21, 389-401 (2001). 99 Orosco, M., Rouch, C. & Gerozissis, K. Activation of hypothalamic insulin by serotonin is the primary event of the insulin-serotonin interaction involved in the control of feeding. Brain Research 872, 64-70 (2000).  146 100 Gerozissis, K., Rouch, C., Nicolaidis, S. & Orosco, M. Brain insulin response to feeding in the rat is both macronutrient and area specific. Physiology & behavior 66, 271-275 (1999). 101 Gerozissis, K., Orosco, M., Rouch, C. & Nicolaidis, S. Insulin responses to a fat meal in hypothalamic microdialysates and plasma. Physiology & behavior 62, 767-772 (1997). 102 Orosco, M., Gerozissis, K., Rouch, C., Meile, M. J. & Nicolaidis, S. Hypothalamic monoamines and insulin in relation to feeding in the genetically obese Zucker rat as revealed by microdialysis. Obesity Research 3 Suppl 5, 655S-665S (1995). 103 Orosco, M., Gerozissis, K., Rouch, C. & Nicolaidis, S. Feeding-related immunoreactive insulin changes in the PVN-VMH revealed by microdialysis. Brain Research 671, 149-158 (1995). 104 Gerozissis, K., Orosco, M., Rouch, C. & Nicolaidis, S. Basal and hyperinsulinemia-induced immunoreactive hypothalamic insulin changes in lean and genetically obese Zucker rats revealed by microdialysis. Brain Research 611, 258-263 (1993). 105 Tahirovic, I. et al. Reduced brain antioxidant capacity in rat models of betacytotoxic-induced experimental sporadic Alzheimer's disease and diabetes mellitus. Neurochem Res 32, 1709-1717, doi:10.1007/s11064-007-9410-1 (2007). 106 Tahirovic, I. et al. Brain antioxidant capacity in rat models of betacytotoxic-induced experimental sporadic Alzheimer's disease and diabetes mellitus. J Neural Transm Suppl, 235-240 (2007). 107 Salkovic-Petrisic, M., Tribl, F., Schmidt, M., Hoyer, S. & Riederer, P. Alzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and  147 hippocampus after damage to the insulin signalling pathway. Journal of Neurochemistry 96, 1005-1015, doi:JNC3637 [pii]10.1111/j.1471-4159.2005.03637.x (2006). 108 Kojima, H. et al. Extrapancreatic insulin-producing cells in multiple organs in diabetes. Proc Natl Acad Sci U S A 101, 2458-2463 (2004). 109 Chen, X. J., Larson, C. S., West, J., Zhang, X. M. & Kaufman, D. B. In Vivo Detection of Extrapancreatic Insulin Gene Expression in Diabetic Mice by Bioluminescence Imaging. PLoS ONE 5, -, doi:ARTN e9397DOI 10.1371/journal.pone.0009397 (2010). 110 Oh, S. H. et al. Adult bone marrow-derived cells trans-differentiating into insulin-producing cells for the treatment of type I diabetes. Laboratory Investigation 84, 607-617, doi:Doi 10.1038/Labinvest.3700074 (2004). 111 Tang, D. Q. et al. In vivo and in vitro characterization of insulin-producing cells obtained from murine bone marrow. Diabetes 53, 1721-1732 (2004). 112 de la Monte, S. M. & Wands, J. R. Chronic gestational exposure to ethanol impairs insulin-stimulated survival and mitochondrial function in cerebellar neurons. Cellular and molecular life sciences : CMLS 59, 882-893 (2002). 113 de la Monte, S. M. et al. Ceramide-mediated insulin resistance and impairment of cognitive-motor functions. Journal of Alzheimer's disease : JAD 21, 967-984, doi:10.3233/JAD-2010-091726 (2010). 114 Tong, M. & de la Monte, S. M. Mechanisms of ceramide-mediated neurodegeneration. Journal of Alzheimer's disease : JAD 16, 705-714, doi:10.3233/JAD-2009-0983 (2009). 115 Tong, M., Dong, M. & de la Monte, S. M. Brain insulin-like growth factor and neurotrophin resistance in Parkinson's disease and dementia with Lewy bodies: potential  148 role of manganese neurotoxicity. Journal of Alzheimer's disease : JAD 16, 585-599, doi:10.3233/JAD-2009-0995 (2009). 116 Kurrer, M. O., Pakala, S. V., Hanson, H. L. & Katz, J. D. Beta cell apoptosis in T cell-mediated autoimmune diabetes. Proc Natl Acad Sci U S A 94, 213-218 (1997). 117 Hay, C. W. & Docherty, K. Comparative analysis of insulin gene promoters: implications for diabetes research. Diabetes 55, 3201-3213 (2006). 118 Soares, M. B. et al. RNA-mediated gene duplication: the rat preproinsulin I gene is a functional retroposon. Mol Cell Biol 5, 2090-2103 (1985). 119 Rhodes, C. J. Type 2 diabetes-a matter of beta-cell life and death? Science 307, 380-384, doi:10.1126/science.1104345 (2005). 120 Saltiel, A. R. & Kahn, C. R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806, doi:10.1038/414799a (2001). 121 Jeffrey, K. D. et al. Carboxypeptidase E mediates palmitate-induced beta-cell ER stress and apoptosis. Proc Natl Acad Sci U S A 105, 8452-8457, doi:0711232105 [pii]10.1073/pnas.0711232105 (2008). 122 Schwartz, M. W. & Porte, D., Jr. Diabetes, obesity, and the brain. Science 307, 375-379, doi:10.1126/science.1104344 (2005). 123 Scherer, T. et al. Brain insulin controls adipose tissue lipolysis and lipogenesis. Cell metabolism 13, 183-194, doi:10.1016/j.cmet.2011.01.008 (2011). 124 Koch, L. et al. Central insulin action regulates peripheral glucose and fat metabolism in mice. The Journal of clinical investigation 118, 2132-2147, doi:10.1172/JCI31073 (2008).  149 125 Schwartz, M. W., Woods, S. C., Porte, D., Jr., Seeley, R. J. & Baskin, D. G. Central nervous system control of food intake. Nature 404, 661-671, doi:10.1038/35007534 (2000). 126 Alejandro, E. U. et al. Pancreatic beta-cell Raf-1 is required for glucose tolerance, insulin secretion, and insulin 2 transcription. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 25, 3884-3895, doi:10.1096/fj.10-180349 (2011). 127 Mehran, A. E. et al. Hyperinsulinemia drives diet-induced obesity independently of brain insulin production. Cell metabolism 16, 723-737, doi:10.1016/j.cmet.2012.10.019 (2012). 128 Youngren, J. F. Regulation of insulin receptor function. Cellular and molecular life sciences : CMLS 64, 873-891, doi:10.1007/s00018-007-6359-9 (2007). 129 Biggs, W. H., 3rd, Meisenhelder, J., Hunter, T., Cavenee, W. K. & Arden, K. C. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci U S A 96, 7421-7426 (1999). 130 Berne, R. M. K. B. M. S. B. A. Berne & Levy physiology, <http://www.clinicalkey.com/dura/browse/bookChapter/3-s2.0-C20090617931> (2010). 131 Otani, K. et al. Reduced beta-cell mass and altered glucose sensing impair insulin-secretory function in betaIRKO mice. American journal of physiology. Endocrinology and metabolism 286, E41-49, doi:10.1152/ajpendo.00533.2001 (2004). 132 Beith, J. L., Alejandro, E. U. & Johnson, J. D. Insulin stimulates primary beta-cell proliferation via Raf-1 kinase. Endocrinology 149, 2251-2260, doi:en.2007-1557 [pii]10.1210/en.2007-1557 (2008).  150 133 Scaglia, L., Cahill, C. J., Finegood, D. T. & Bonner-Weir, S. Apoptosis participates in the remodeling of the endocrine pancreas in the neonatal rat. Endocrinology 138, 1736-1741, doi:10.1210/endo.138.4.5069 (1997). 134 Mandrup-Poulsen, T. beta-cell apoptosis: stimuli and signaling. Diabetes 50 Suppl 1, S58-63 (2001). 135 Poitout, V. & Robertson, R. P. Minireview: Secondary beta-cell failure in type 2 diabetes--a convergence of glucotoxicity and lipotoxicity. Endocrinology 143, 339-342, doi:10.1210/endo.143.2.8623 (2002). 136 Okada, T. et al. Insulin receptors in beta-cells are critical for islet compensatory growth response to insulin resistance. Proc Natl Acad Sci U S A 104, 8977-8982, doi:0608703104 [pii]10.1073/pnas.0608703104 (2007). 137 Atkinson, B. J., Griesel, B. A., King, C. D., Josey, M. A. & Olson, A. L. Moderate GLUT4 overexpression improves insulin sensitivity and fasting triglyceridemia in high-fat diet-fed transgenic mice. Diabetes 62, 2249-2258, doi:10.2337/db12-1146 (2013). 138 Brewer, P. D., Habtemichael, E. N., Romenskaia, I., Mastick, C. C. & Coster, A. C. Insulin-regulated Glut4 Translocation: MEMBRANE PROTEIN TRAFFICKING WITH SIX DISTINCTIVE STEPS. J Biol Chem 289, 17280-17298, doi:10.1074/jbc.M114.555714 (2014). 139 Lizunov, V. A., Stenkula, K., Troy, A., Cushman, S. W. & Zimmerberg, J. Insulin regulates Glut4 confinement in plasma membrane clusters in adipose cells. PLoS One 8, e57559, doi:10.1371/journal.pone.0057559 (2013).  151 140 DeFronzo, R. A. et al. The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes 30, 1000-1007 (1981). 141 Baron, A. D., Brechtel, G., Wallace, P. & Edelman, S. V. Rates and tissue sites of non-insulin- and insulin-mediated glucose uptake in humans. The American journal of physiology 255, E769-774 (1988). 142 Klip, A. & Paquet, M. R. Glucose transport and glucose transporters in muscle and their metabolic regulation. Diabetes Care 13, 228-243 (1990). 143 Newsholme, P. et al. Diabetes associated cell stress and dysfunction: role of mitochondrial and non-mitochondrial ROS production and activity. The Journal of physiology 583, 9-24, doi:10.1113/jphysiol.2007.135871 (2007). 144 Gautier-Stein, A. et al. Glucotoxicity induces glucose-6-phosphatase catalytic unit expression by acting on the interaction of HIF-1alpha with CREB-binding protein. Diabetes 61, 2451-2460, doi:10.2337/db11-0986 (2012). 145 Kim, J. W. et al. miRNA-30a-5p-mediated silencing of Beta2/NeuroD expression is an important initial event of glucotoxicity-induced beta cell dysfunction in rodent models. Diabetologia 56, 847-855, doi:10.1007/s00125-012-2812-x (2013). 146 Kong, X., Yan, D., Wu, X., Guan, Y. & Ma, X. Glucotoxicity inhibits cAMP-PKA-potentiated glucose-stimulated insulin secretion in pancreatic beta-cells. Journal of diabetes, doi:10.1111/1753-0407.12185 (2014). 147 Poungvarin, N. et al. Carbohydrate response element-binding protein (ChREBP) plays a pivotal role in beta cell glucotoxicity. Diabetologia 55, 1783-1796, doi:10.1007/s00125-012-2506-4 (2012).  152 148 Krishnapuram, R. et al. Insulin receptor-independent upregulation of cellular glucose uptake. Int J Obes (Lond) 37, 146-153, doi:10.1038/ijo.2012.6 (2013). 149 Hinkley, J. M. et al. Constitutively active CaMKKalpha stimulates skeletal muscle glucose uptake in insulin-resistant mice in vivo. Diabetes 63, 142-151, doi:10.2337/db13-0452 (2014). 150 Kim, S. H., Hwang, J. T., Park, H. S., Kwon, D. Y. & Kim, M. S. Capsaicin stimulates glucose uptake in C2C12 muscle cells via the reactive oxygen species (ROS)/AMPK/p38 MAPK pathway. Biochem Biophys Res Commun 439, 66-70, doi:10.1016/j.bbrc.2013.08.027 (2013). 151 Zeve, D. et al. Wnt signaling activation in adipose progenitors promotes insulin-independent muscle glucose uptake. Cell metabolism 15, 492-504, doi:10.1016/j.cmet.2012.03.010 (2012). 152 Lafontan, M. & Langin, D. Lipolysis and lipid mobilization in human adipose tissue. Prog Lipid Res 48, 275-297, doi:10.1016/j.plipres.2009.05.001 (2009). 153 Frayn, K. N. Adipose tissue as a buffer for daily lipid flux. Diabetologia 45, 1201-1210, doi:10.1007/s00125-002-0873-y (2002). 154 Lafontan, M. & Langin, D. Lipolysis and lipid mobilization in human adipose tissue. Progress in Lipid Research 48, 275-297, doi:http://dx.doi.org/10.1016/j.plipres.2009.05.001 (2009). 155 Zimmermann, R. et al. Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306, 1383-1386, doi:10.1126/science.1100747 (2004).  153 156 Greenberg, A. S. et al. Perilipin, a major hormonally regulated adipocyte-specific phosphoprotein associated with the periphery of lipid storage droplets. J Biol Chem 266, 11341-11346 (1991). 157 Wang, S. P. et al. The adipose tissue phenotype of hormone-sensitive lipase deficiency in mice. Obes Res 9, 119-128, doi:10.1038/oby.2001.15 (2001). 158 Fredrikson, G., Tornqvist, H. & Belfrage, P. Hormone-sensitive lipase and monoacylglycerol lipase are both required for complete degradation of adipocyte triacylglycerol. Biochimica et biophysica acta 876, 288-293 (1986). 159 Shakur, Y. et al. Regulation and function of the cyclic nucleotide phosphodiesterase (PDE3) gene family. Progress in nucleic acid research and molecular biology 66, 241-277 (2001). 160 Zmuda-Trzebiatowska, E., Oknianska, A., Manganiello, V. & Degerman, E. Role of PDE3B in insulin-induced glucose uptake, GLUT-4 translocation and lipogenesis in primary rat adipocytes. Cellular signalling 18, 382-390, doi:10.1016/j.cellsig.2005.05.007 (2006). 161 Eriksson, J. W., Wesslau, C. & Smith, U. The cGMP-inhibitable phosphodiesterase modulates glucose transport activation by insulin. Biochimica et biophysica acta 1189, 163-167 (1994). 162 Ikezawa, Y. et al. Insulin inhibits glucagon-induced glycogenolysis in perivenous hepatocytes specifically. The Journal of laboratory and clinical medicine 138, 387-392, doi:10.1067/mlc.2001.119434 (2001).  154 163 Peak, M., Rochford, J. J., Borthwick, A. C., Yeaman, S. J. & Agius, L. Signalling pathways involved in the stimulation of glycogen synthesis by insulin in rat hepatocytes. Diabetologia 41, 16-25, doi:10.1007/s001250050861 (1998). 164 Pilkis, S. J. & Granner, D. K. Molecular physiology of the regulation of hepatic gluconeogenesis and glycolysis. Annu Rev Physiol 54, 885-909, doi:10.1146/annurev.ph.54.030192.004321 (1992). 165 Banks, W. A., Jaspan, J. B. & Kastin, A. J. Selective, physiological transport of insulin across the blood-brain barrier: novel demonstration by species-specific radioimmunoassays. Peptides 18, 1257-1262 (1997). 166 Broadwell, R. D. & Sofroniew, M. V. Serum proteins bypass the blood-brain fluid barriers for extracellular entry to the central nervous system. Experimental neurology 120, 245-263, doi:10.1006/exnr.1993.1059 (1993). 167 Woods, S. C. & Porte, D., Jr. Relationship between plasma and cerebrospinal fluid insulin levels of dogs. The American journal of physiology 233, E331-334 (1977). 168 Banks, W. A., Owen, J. B. & Erickson, M. A. Insulin in the brain: there and back again. Pharmacol Ther 136, 82-93, doi:10.1016/j.pharmthera.2012.07.006 (2012). 169 Rodriguez, E. M., Blazquez, J. L. & Guerra, M. The design of barriers in the hypothalamus allows the median eminence and the arcuate nucleus to enjoy private milieus: the former opens to the portal blood and the latter to the cerebrospinal fluid. Peptides 31, 757-776, doi:10.1016/j.peptides.2010.01.003 (2010). 170 Abbott, M. A., Wells, D. G. & Fallon, J. R. The insulin receptor tyrosine kinase substrate p58/53 and the insulin receptor are components of CNS synapses. J Neurosci 19, 7300-7308 (1999).  155 171 Broughton, S. et al. Reduction of DILP2 in Drosophila triages a metabolic phenotype from lifespan revealing redundancy and compensation among DILPs. PLoS One 3, e3721, doi:10.1371/journal.pone.0003721 (2008). 172 Broughton, S. J. et al. Longer lifespan, altered metabolism, and stress resistance in Drosophila from ablation of cells making insulin-like ligands. Proc Natl Acad Sci U S A 102, 3105-3110, doi:0405775102 [pii]10.1073/pnas.0405775102 (2005). 173 Madadi, G., Dalvi, P. S. & Belsham, D. D. Regulation of brain insulin mRNA by glucose and glucagon-like peptide 1. Biochem Biophys Res Commun 376, 694-699, doi:10.1016/j.bbrc.2008.09.054 (2008). 174 Rother, E. et al. Acute selective ablation of rat insulin promoter-expressing (RIPHER) neurons defines their orexigenic nature. Proc Natl Acad Sci U S A 109, 18132-18137, doi:10.1073/pnas.1206147109 (2012). 175 Wada, A., Yokoo, H., Yanagita, T. & Kobayashi, H. New twist on neuronal insulin receptor signaling in health, disease, and therapeutics. Journal of pharmacological sciences 99, 128-143 (2005). 176 Mattson, M. P. Gene-diet interactions in brain aging and neurodegenerative disorders. Ann Intern Med 139, 441-444 (2003). 177 Luchsinger, J. A., Tang, M. X., Shea, S. & Mayeux, R. Caloric intake and the risk of Alzheimer disease. Arch Neurol 59, 1258-1263 (2002). 178 Cao, D., Lu, H., Lewis, T. L. & Li, L. Intake of sucrose-sweetened water induces insulin resistance and exacerbates memory deficits and amyloidosis in a transgenic mouse model of Alzheimer disease. J Biol Chem 282, 36275-36282, doi:10.1074/jbc.M703561200 (2007).  156 179 Morris, M. C. et al. Dietary fats and the risk of incident Alzheimer disease. Arch Neurol 60, 194-200 (2003). 180 Refolo, L. M. et al. Hypercholesterolemia accelerates the Alzheimer's amyloid pathology in a transgenic mouse model. Neurobiol Dis 7, 321-331, doi:10.1006/nbdi.2000.0304 (2000). 181 Shie, F. S., Jin, L. W., Cook, D. G., Leverenz, J. B. & LeBoeuf, R. C. Diet-induced hypercholesterolemia enhances brain A beta accumulation in transgenic mice. Neuroreport 13, 455-459 (2002). 182 Gasior, M., Rogawski, M. A. & Hartman, A. L. Neuroprotective and disease-modifying effects of the ketogenic diet. Behav Pharmacol 17, 431-439 (2006). 183 Ullrich, C., Pirchl, M. & Humpel, C. Hypercholesterolemia in rats impairs the cholinergic system and leads to memory deficits. Mol Cell Neurosci 45, 408-417, doi:10.1016/j.mcn.2010.08.001 (2010). 184 Li, L., Cao, D., Garber, D. W., Kim, H. & Fukuchi, K. Association of aortic atherosclerosis with cerebral beta-amyloidosis and learning deficits in a mouse model of Alzheimer's disease. Am J Pathol 163, 2155-2164 (2003). 185 Ho, L. et al. Diet-induced insulin resistance promotes amyloidosis in a transgenic mouse model of Alzheimer's disease. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 18, 902-904, doi:10.1096/fj.03-0978fje (2004). 186 Bhat, N. R. Linking cardiometabolic disorders to sporadic Alzheimer's disease: a perspective on potential mechanisms and mediators. Journal of Neurochemistry 115, 551-562, doi:10.1111/j.1471-4159.2010.06978.x (2010).  157 187 Biessels, G. J. & Kappelle, L. J. Increased risk of Alzheimer's disease in Type II diabetes: insulin resistance of the brain or insulin-induced amyloid pathology? Biochem Soc Trans 33, 1041-1044, doi:10.1042/BST20051041 (2005). 188 Bosco, D., Fava, A., Plastino, M., Montalcini, T. & Pujia, A. Possible implications of insulin resistance and glucose metabolism in Alzheimer's disease pathogenesis. J Cell Mol Med 15, 1807-1821, doi:10.1111/j.1582-4934.2011.01318.x (2011). 189 Craft, S. Insulin resistance and Alzheimer's disease pathogenesis: potential mechanisms and implications for treatment. Curr Alzheimer Res 4, 147-152 (2007). 190 de la Monte, S. M. Contributions of brain insulin resistance and deficiency in amyloid-related neurodegeneration in Alzheimer's disease. Drugs 72, 49-66, doi:10.2165/11597760-000000000-00000 (2012). 191 Devi, L., Alldred, M. J., Ginsberg, S. D. & Ohno, M. Mechanisms underlying insulin deficiency-induced acceleration of beta-amyloidosis in a mouse model of Alzheimer's disease. PLoS ONE 7, e32792, doi:10.1371/journal.pone.0032792 (2012). 192 Dhikav, V. & Anand, K. Potential predictors of hippocampal atrophy in Alzheimer's disease. Drugs Aging 28, 1-11, doi:10.2165/11586390-000000000-00000 (2011). 193 Holscher, C. Diabetes as a risk factor for Alzheimer's disease: insulin signalling impairment in the brain as an alternative model of Alzheimer's disease. Biochem Soc Trans 39, 891-897, doi:10.1042/BST0390891 (2011). 194 Kroner, Z. The relationship between Alzheimer's disease and diabetes: Type 3 diabetes? Altern Med Rev 14, 373-379 (2009). 195 Kuljis, R. O. & Salkovic-Petrisic, M. Dementia, diabetes, Alzheimer's disease, and insulin resistance in the brain: progress, dilemmas, new opportunities, and a hypothesis to  158 tackle intersecting epidemics. Journal of Alzheimer's disease : JAD 25, 29-41, doi:10.3233/JAD-2011-101392 (2011). 196 Liu, Y., Liu, F., Grundke-Iqbal, I., Iqbal, K. & Gong, C. X. Deficient brain insulin signalling pathway in Alzheimer's disease and diabetes. J Pathol 225, 54-62, doi:10.1002/path.2912 (2011). 197 Messier, C. Diabetes, Alzheimer's disease and apolipoprotein genotype. Exp Gerontol 38, 941-946 (2003). 198 Mody, N., Agouni, A., McIlroy, G. D., Platt, B. & Delibegovic, M. Susceptibility to diet-induced obesity and glucose intolerance in the APP (SWE)/PSEN1 (A246E) mouse model of Alzheimer's disease is associated with increased brain levels of protein tyrosine phosphatase 1B (PTP1B) and retinol-binding protein 4 (RBP4), and basal phosphorylation of S6 ribosomal protein. Diabetologia, doi:10.1007/s00125-011-2160-2 (2011). 199 Morris, J. K. & Burns, J. M. Insulin: an emerging treatment for Alzheimer's disease dementia? Curr Neurol Neurosci Rep 12, 520-527, doi:10.1007/s11910-012-0297-0 (2012). 200 Naderali, E. K., Ratcliffe, S. H. & Dale, M. C. Obesity and Alzheimer's disease: a link between body weight and cognitive function in old age. Am J Alzheimers Dis Other Demen 24, 445-449, doi:10.1177/1533317509348208 (2009). 201 Neumann, K. F. et al. Insulin resistance and Alzheimer's disease: molecular links & clinical implications. Curr Alzheimer Res 5, 438-447 (2008). 202 Nicolls, M. R. The clinical and biological relationship between Type II diabetes mellitus and Alzheimer's disease. Curr Alzheimer Res 1, 47-54 (2004).  159 203 Priyadarshini, M. et al. Alzheimer's disease and type 2 diabetes: exploring the association to obesity and tyrosine hydroxylase. CNS Neurol Disord Drug Targets 11, 482-489 (2012). 204 Qiu, C. Epidemiological findings of vascular risk factors in Alzheimer's disease: implications for therapeutic and preventive intervention. Expert Rev Neurother 11, 1593-1607, doi:10.1586/ern.11.146 (2011). 205 Qiu, W. Q. & Folstein, M. F. Insulin, insulin-degrading enzyme and amyloid-beta peptide in Alzheimer's disease: review and hypothesis. Neurobiol Aging 27, 190-198, doi:10.1016/j.neurobiolaging.2005.01.004 (2006). 206 Rasgon, N. L. et al. Insulin resistance and hippocampal volume in women at risk for Alzheimer's disease. Neurobiol Aging 32, 1942-1948, doi:10.1016/j.neurobiolaging.2009.12.005 (2011). 207 Schuh, A. F., Rieder, C. M., Rizzi, L., Chaves, M. & Roriz-Cruz, M. Mechanisms of brain aging regulation by insulin: implications for neurodegeneration in late-onset Alzheimer's disease. ISRN Neurol 2011, 306905, doi:10.5402/2011/306905 (2011). 208 Taubes, G. Neuroscience. Insulin insults may spur Alzheimer's disease. Science 301, 40-41, doi:10.1126/science.301.5629.40 (2003). 209 Vanitallie, T. B. Preclinical sporadic Alzheimer's disease: target for personalized diagnosis and preventive intervention. Metabolism: clinical and experimental, doi:10.1016/j.metabol.2012.08.024 (2012). 210 Watson, G. S. & Craft, S. The role of insulin resistance in the pathogenesis of Alzheimer's disease: implications for treatment. CNS Drugs 17, 27-45 (2003).  160 211 Blum, D. & Buee, L. Alzheimer's disease risk, obesity and tau: is insulin resistance guilty? Expert Rev Neurother 13, 461-463, doi:10.1586/ern.13.35 (2013). 212 Cholerton, B., Baker, L. D. & Craft, S. Insulin, cognition, and dementia. Eur J Pharmacol, doi:10.1016/j.ejphar.2013.08.008 (2013). 213 Craft, S., Cholerton, B. & Baker, L. D. Insulin and Alzheimer's disease: untangling the web. J Alzheimers Dis 33 Suppl 1, S263-275, doi:10.3233/JAD-2012-129042 (2013). 214 Willette, A. A. et al. Insulin resistance, brain atrophy, and cognitive performance in late middle-aged adults. Diabetes Care 36, 443-449, doi:10.2337/dc12-0922 (2013). 215 Stockhorst, U., de Fries, D., Steingrueber, H. J. & Scherbaum, W. A. Insulin and the CNS: effects on food intake, memory, and endocrine parameters and the role of intranasal insulin administration in humans. Physiology & behavior 83, 47-54, doi:10.1016/j.physbeh.2004.07.022 (2004). 216 Stein, M. S., Scherer, S. C., Ladd, K. S. & Harrison, L. C. A Randomized Controlled Trial of High-Dose Vitamin D2 Followed by Intranasal Insulin in Alzheimer's Disease. Journal of Alzheimer's disease : JAD, doi:10.3233/JAD-2011-110149 (2011). 217 Marks, D. R., Tucker, K., Cavallin, M. A., Mast, T. G. & Fadool, D. A. Awake intranasal insulin delivery modifies protein complexes and alters memory, anxiety, and olfactory behaviors. J Neurosci 29, 6734-6751, doi:10.1523/JNEUROSCI.1350-09.2009 (2009). 218 Henkin, R. I. Intranasal insulin: from nose to brain. Nutrition 26, 624-633, doi:10.1016/j.nut.2009.08.003 (2010). 219 Kern, W., Born, J., Schreiber, H. & Fehm, H. L. Central nervous system effects of intranasally administered insulin during euglycemia in men. Diabetes 48, 557-563 (1999).  161 220 Chapman, C. D. et al. Intranasal Treatment of Central Nervous System Dysfunction in Humans. Pharm Res, doi:10.1007/s11095-012-0915-1 (2012). 221 Yang, Y. et al. Intranasal Insulin Ameliorates Tau Hyperphosphorylation in a Rat Model of Type 2 Diabetes. Journal of Alzheimer's disease : JAD, doi:10.3233/JAD-2012-121294 (2012). 222 Subramanian, S. & John, M. Intranasal administration of insulin lowers amyloid-beta levels in rat model of diabetes. Indian J Exp Biol 50, 41-44 (2012). 223 Shemesh, E., Rudich, A., Harman-Boehm, I. & Cukierman-Yaffe, T. Effect of intranasal insulin on cognitive function: a systematic review. The Journal of clinical endocrinology and metabolism 97, 366-376, doi:10.1210/jc.2011-1802 (2012). 224 Schioth, H. B., Frey, W. H., Brooks, S. J. & Benedict, C. Insulin to treat Alzheimer's disease: just follow your nose? Expert Rev Clin Pharmacol 5, 17-20, doi:10.1586/ecp.11.70 (2012). 225 Schioth, H. B., Craft, S., Brooks, S. J., Frey, W. H., 2nd & Benedict, C. Brain insulin signaling and Alzheimer's disease: current evidence and future directions. Molecular neurobiology 46, 4-10, doi:10.1007/s12035-011-8229-6 (2012). 226 Ott, V., Benedict, C., Schultes, B., Born, J. & Hallschmid, M. Intranasal administration of insulin to the brain impacts cognitive function and peripheral metabolism. Diabetes, obesity & metabolism 14, 214-221, doi:10.1111/j.1463-1326.2011.01490.x (2012). 227 Benedict, C. et al. Intranasal insulin as a therapeutic option in the treatment of cognitive impairments. Exp Gerontol 46, 112-115, doi:10.1016/j.exger.2010.08.026 (2011).  162 228 Patel, M. M., Goyal, B. R., Bhadada, S. V., Bhatt, J. S. & Amin, A. F. Getting into the brain: approaches to enhance brain drug delivery. CNS Drugs 23, 35-58, doi:10.2165/0023210-200923010-00003 (2009). 229 Laron, Z. Insulin and the brain. Arch Physiol Biochem 115, 112-116, doi:10.1080/13813450902949012 (2009). 230 Hallschmid, M. & Schultes, B. Central nervous insulin resistance: a promising target in the treatment of metabolic and cognitive disorders? Diabetologia 52, 2264-2269, doi:10.1007/s00125-009-1501-x (2009). 231 Hanson, L. R. & Frey, W. H., 2nd. Intranasal delivery bypasses the blood-brain barrier to target therapeutic agents to the central nervous system and treat neurodegenerative disease. BMC Neurosci 9 Suppl 3, S5, doi:10.1186/1471-2202-9-S3-S5 (2008). 232 Hallschmid, M., Benedict, C., Born, J. & Kern, W. Targeting metabolic and cognitive pathways of the CNS by intranasal insulin administration. Expert Opin Drug Deliv 4, 319-322, doi:10.1517/17425247.4.4.319 (2007). 233 Benedict, C., Hallschmid, M., Schultes, B., Born, J. & Kern, W. Intranasal insulin to improve memory function in humans. Neuroendocrinology 86, 136-142, doi:10.1159/000106378 (2007). 234 Benedict, C. et al. Intranasal insulin improves memory in humans: superiority of insulin aspart. Neuropsychopharmacology 32, 239-243, doi:10.1038/sj.npp.1301193 (2007). 235 Benedict, C. et al. Intranasal insulin improves memory in humans. Psychoneuroendocrinology 29, 1326-1334, doi:10.1016/j.psyneuen.2004.04.003 (2004). 236 Chapman, C. D. et al. Intranasal treatment of central nervous system dysfunction in humans. Pharm Res 30, 2475-2484, doi:10.1007/s11095-012-0915-1 (2013).  163 237 Freiherr, J. et al. Intranasal insulin as a treatment for Alzheimer's disease: a review of basic research and clinical evidence. CNS Drugs 27, 505-514, doi:10.1007/s40263-013-0076-8 (2013). 238 Labouebe, G. et al. Insulin induces long-term depression of ventral tegmental area dopamine neurons via endocannabinoids. Nat Neurosci 16, 300-308, doi:10.1038/nn.3321 (2013). 239 Baskin, D. G. et al. Insulin and leptin: dual adiposity signals to the brain for the regulation of food intake and body weight. Brain Res 848, 114-123 (1999). 240 Mayer, C. M. & Belsham, D. D. Insulin directly regulates NPY and AgRP gene expression via the MAPK MEK/ERK signal transduction pathway in mHypoE-46 hypothalamic neurons. Mol Cell Endocrinol 307, 99-108, doi:10.1016/j.mce.2009.02.031 (2009). 241 Munzberg, H. & Myers, M. G., Jr. Molecular and anatomical determinants of central leptin resistance. Nat Neurosci 8, 566-570, doi:10.1038/nn1454 (2005). 242 Niswender, K. D., Baskin, D. G. & Schwartz, M. W. Insulin and its evolving partnership with leptin in the hypothalamic control of energy homeostasis. Trends Endocrinol Metab 15, 362-369, doi:10.1016/j.tem.2004.07.009 (2004). 243 Tsai, W. C., Bhattacharyya, N., Han, L. Y., Hanover, J. A. & Rechler, M. M. Insulin inhibition of transcription stimulated by the forkhead protein Foxo1 is not solely due to nuclear exclusion. Endocrinology 144, 5615-5622, doi:10.1210/en.2003-0481 (2003). 244 Cheatham, B. & Kahn, C. R. Insulin action and the insulin signaling network. Endocr Rev 16, 117-142, doi:10.1210/edrv-16-2-117 (1995).  164 245 White, M. F. Insulin signaling in health and disease. Science 302, 1710-1711, doi:10.1126/science.1092952 (2003). 246 Carvalheira, J. B. et al. Cross-talk between the insulin and leptin signaling systems in rat hypothalamus. Obes Res 13, 48-57, doi:10.1038/oby.2005.7 (2005). 247 Romanatto, T. et al. TNF-alpha acts in the hypothalamus inhibiting food intake and increasing the respiratory quotient--effects on leptin and insulin signaling pathways. Peptides 28, 1050-1058, doi:10.1016/j.peptides.2007.03.006 (2007). 248 Choudhury, A. I. et al. The role of insulin receptor substrate 2 in hypothalamic and beta cell function. The Journal of clinical investigation 115, 940-950, doi:10.1172/jci24445 (2005). 249 Cowley, M. A. et al. Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 411, 480-484, doi:10.1038/35078085 (2001). 250 Labouebe, G. et al. Insulin induces long-term depression of ventral tegmental area dopamine neurons via endocannabinoids. Nat Neurosci 16, 300-308, doi:10.1038/nn.3321 (2013). 251 Mebel, D. M., Wong, J. C., Dong, Y. J. & Borgland, S. L. Insulin in the ventral tegmental area reduces hedonic feeding and suppresses dopamine concentration via increased reuptake. Eur J Neurosci 36, 2336-2346, doi:10.1111/j.1460-9568.2012.08168.x (2012). 252 Plum, L., Belgardt, B. F. & Bruning, J. C. Central insulin action in energy and glucose homeostasis. The Journal of clinical investigation 116, 1761-1766, doi:10.1172/jci29063 (2006). 253 Yue, J. T. & Lam, T. K. Lipid sensing and insulin resistance in the brain. Cell metabolism 15, 646-655, doi:10.1016/j.cmet.2012.01.013 (2012).  165 254 Lam, T. K. Neuronal regulation of homeostasis by nutrient sensing. Nat Med 16, 392-395, doi:10.1038/nm0410-392 (2010). 255 Lam, T. K. Brain Glucose Metabolism Controls Hepatic Glucose and Lipid Production. Cellscience 3, 63-69 (2007). 256 Alberti, K. G. et al. Harmonizing the metabolic syndrome: a joint interim statement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity. Circulation 120, 1640-1645, doi:10.1161/CIRCULATIONAHA.109.192644 (2009). 257 National Cholesterol Education Program Expert Panel on Detection, E. & Treatment of High Blood Cholesterol in, A. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) final report. Circulation 106, 3143-3421 (2002). 258 Versini, M., Jeandel, P. Y., Rosenthal, E. & Shoenfeld, Y. Obesity in autoimmune diseases: Not a passive bystander. Autoimmunity reviews 13, 981-1000, doi:10.1016/j.autrev.2014.07.001 (2014). 259 Kahn, B. B. & Flier, J. S. Obesity and insulin resistance. The Journal of clinical investigation 106, 473-481, doi:10.1172/JCI10842 (2000). 260 Ye, J. Mechanisms of insulin resistance in obesity. Frontiers of medicine 7, 14-24, doi:10.1007/s11684-013-0262-6 (2013).  166 261 James, W. P. OBESITY AND OVERWEIGHT, <http://www.who.int/dietphysicalactivity/media/en/gsfs_obesity.pdf> (2003). 262 Federation, I. D. International Diabetes Federation Diabetes Atlas, <http://www.idf.org/diabetesatlas/> (2013). 263 Promotion, N. C. f. C. D. P. a. H. Maps of Trends in Diagnosed Diabetes and Obesity, <http://www.cdc.gov/diabetes/statistics/> (2011). 264 Type 2 diabetes in children and adolescents. American Diabetes Association. Diabetes Care 23, 381-389 (2000). 265 Association, C. D. An Economic Tsunami: the cost of diabetes in Canada, <http://www.diabetes.ca/publications-newsletters/advocacy-reports/economic-tsunami-the-cost-of-diabetes-in-canada> (2009). 266 Donath, M. Y. & Halban, P. A. Decreased beta-cell mass in diabetes: significance, mechanisms and therapeutic implications. Diabetologia 47, 581-589, doi:10.1007/s00125-004-1336-4 (2004). 267 Moriyama, H. et al. Evidence for a primary islet autoantigen (preproinsulin 1) for insulitis and diabetes in the nonobese diabetic mouse. Proc Natl Acad Sci U S A 100, 10376-10381, doi:10.1073/pnas.1834450100 (2003). 268 Noso, S. et al. Insulin transactivator MafA regulates intrathymic expression of insulin and affects susceptibility to type 1 diabetes. Diabetes 59, 2579-2587, doi:10.2337/db10-0476 (2010). 269 Bach, J. F. Insulin-dependent diabetes mellitus as an autoimmune disease. Endocr Rev 15, 516-542, doi:10.1210/edrv-15-4-516 (1994).  167 270 Kawasaki, E. Type 1 diabetes and autoimmunity. Clinical pediatric endocrinology : case reports and clinical investigations : official journal of the Japanese Society for Pediatric Endocrinology 23, 99-105, doi:10.1297/cpe.23.99 (2014). 271 Eisenbarth, G. S. & Jeffrey, J. The natural history of type 1A diabetes. Arquivos brasileiros de endocrinologia e metabologia 52, 146-155 (2008). 272 O'Brien, B. A., Harmon, B. V., Cameron, D. P. & Allan, D. J. Apoptosis is the mode of beta-cell death responsible for the development of IDDM in the nonobese diabetic (NOD) mouse. Diabetes 46, 750-757 (1997). 273 Bruni, A., Gala-Lopez, B., Pepper, A. R., Abualhassan, N. S. & Shapiro, A. J. Islet cell transplantation for the treatment of type 1 diabetes: recent advances and future challenges. Diabetes, metabolic syndrome and obesity : targets and therapy 7, 211-223, doi:10.2147/dmso.s50789 (2014). 274 Hellman, B. Pulsatility of insulin release--a clinically important phenomenon. Upsala journal of medical sciences 114, 193-205, doi:10.3109/03009730903366075 (2009). 275 Roder, M. E., Porte, D., Jr., Schwartz, R. S. & Kahn, S. E. Disproportionately elevated proinsulin levels reflect the degree of impaired B cell secretory capacity in patients with noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab 83, 604-608, doi:10.1210/jcem.83.2.4544 (1998). 276 Sako, Y. & Grill, V. E. Coupling of beta-cell desensitization by hyperglycemia to excessive stimulation and circulating insulin in glucose-infused rats. Diabetes 39, 1580-1583 (1990). 277 Leahy, J. L., Bumbalo, L. M. & Chen, C. Diazoxide causes recovery of beta-cell glucose responsiveness in 90% pancreatectomized diabetic rats. Diabetes 43, 173-179 (1994).  168 278 Moran, A. et al. Differentiation of glucose toxicity from beta cell exhaustion during the evolution of defective insulin gene expression in the pancreatic islet cell line, HIT-T15. The Journal of clinical investigation 99, 534-539, doi:10.1172/jci119190 (1997). 279 Gleason, C. E., Gonzalez, M., Harmon, J. S. & Robertson, R. P. Determinants of glucose toxicity and its reversibility in the pancreatic islet beta-cell line, HIT-T15. American journal of physiology. Endocrinology and metabolism 279, E997-1002 (2000). 280 Pick, A. et al. Role of apoptosis in failure of beta-cell mass compensation for insulin resistance and beta-cell defects in the male Zucker diabetic fatty rat. Diabetes 47, 358-364 (1998). 281 Donath, M. Y., Gross, D. J., Cerasi, E. & Kaiser, N. Hyperglycemia-induced beta-cell apoptosis in pancreatic islets of Psammomys obesus during development of diabetes. Diabetes 48, 738-744 (1999). 282 Foretz, M., Guigas, B., Bertrand, L., Pollak, M. & Viollet, B. Metformin: From Mechanisms of Action to Therapies. Cell metabolism 20, 953-966, doi:10.1016/j.cmet.2014.09.018 (2014). 283 Porte, D., Jr. Clinical importance of insulin secretion and its interaction with insulin resistance in the treatment of type 2 diabetes mellitus and its complications. Diabetes/metabolism research and reviews 17, 181-188 (2001). 284 Prentki, M., Joly, E., El-Assaad, W. & Roduit, R. Malonyl-CoA signaling, lipid partitioning, and glucolipotoxicity: role in beta-cell adaptation and failure in the etiology of diabetes. Diabetes 51 Suppl 3, S405-413 (2002). 285 Leahy, J. L. Pathogenesis of type 2 diabetes mellitus. Archives of medical research 36, 197-209, doi:10.1016/j.arcmed.2005.01.003 (2005).  169 286 Glaser, B. & Cerasi, E. Early intensive insulin treatment for induction of long-term glycaemic control in type 2 diabetes. Diabetes Obes Metab 1, 67-74 (1999). 287 Garvey, W. T., Olefsky, J. M., Griffin, J., Hamman, R. F. & Kolterman, O. G. The effect of insulin treatment on insulin secretion and insulin action in type II diabetes mellitus. Diabetes 34, 222-234 (1985). 288 Ilkova, H., Glaser, B., Tunckale, A., Bagriacik, N. & Cerasi, E. Induction of long-term glycemic control in newly diagnosed type 2 diabetic patients by transient intensive insulin treatment. Diabetes Care 20, 1353-1356 (1997). 289 Kayashima, T. et al. Effects of early introduction of intensive insulin therapy on the clinical course in non-obese NIDDM patients. Diabetes research and clinical practice 28, 119-125 (1995). 290 Palumbo, P. J. The case for insulin treatment early in type 2 diabetes. Cleveland Clinic journal of medicine 71, 385-386, 391-382, 394 passim (2004). 291 Olshansky, S. J. et al. A potential decline in life expectancy in the United States in the 21st century. N Engl J Med 352, 1138-1145, doi:352/11/1138 [pii]10.1056/NEJMsr043743 (2005). 292 Despres, J. P. & Lemieux, I. Abdominal obesity and metabolic syndrome. Nature 444, 881-887 (2006). 293 Frayling, T. M. et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316, 889-894 (2007). 294 Haslam, D. W. & James, W. P. Obesity. Lancet 366, 1197-1209, doi:10.1016/s0140-6736(05)67483-1 (2005).  170 295 Guan, H. P. et al. A futile metabolic cycle activated in adipocytes by antidiabetic agents. Nat Med 8, 1122-1128, doi:10.1038/nm780 (2002). 296 Flier, J. S. The adipocyte: storage depot or node on the energy information superhighway? Cell 80, 15-18 (1995). 297 Damcott, C. M., Sack, P. & Shuldiner, A. R. The genetics of obesity. Endocrinol Metab Clin North Am 32, 761-786 (2003). 298 Arner, P. Obesity--a genetic disease of adipose tissue? Br J Nutr 83 Suppl 1, S9-16 (2000). 299 Bell, C. G., Walley, A. J. & Froguel, P. The genetics of human obesity. Nat Rev Genet 6, 221-234, doi:10.1038/nrg1556 (2005). 300 Barsh, G. S., Farooqi, I. S. & O'Rahilly, S. Genetics of body-weight regulation. Nature 404, 644-651, doi:10.1038/35007519 (2000). 301 Lowell, B. B. & Spiegelman, B. M. Towards a molecular understanding of adaptive thermogenesis. Nature 404, 652-660, doi:10.1038/35007527 (2000). 302 Rolfe, D. F. & Brown, G. C. Cellular energy utilization and molecular origin of standard metabolic rate in mammals. Physiological reviews 77, 731-758 (1997). 303 Speakman, J. R. & Keijer, J. Not so hot: Optimal housing temperatures for mice to mimic the thermal environment of humans. Molecular metabolism 2, 5-9, doi:10.1016/j.molmet.2012.10.002 (2012). 304 Depocas, F., Hart, J. S. & Heroux, O. Cold acclimation and the electromyogram of unanesthetized rats. Journal of applied physiology 9, 404-408 (1956).  171 305 Davis, T. R., Johnston, D. R., Bell, F. C. & Cremer, B. J. Regulation of shivering and non-shivering heat production during acclimation of rats. The American journal of physiology 198, 471-475 (1960). 306 Foster, D. O. & Frydman, M. L. Tissue distribution of cold-induced thermogenesis in conscious warm- or cold-acclimated rats reevaluated from changes in tissue blood flow: the dominant role of brown adipose tissue in the replacement of shivering by nonshivering thermogenesis. Canadian journal of physiology and pharmacology 57, 257-270 (1979). 307 Dauncey, M. J. Influence of mild cold on 24 h energy expenditure, resting metabolism and diet-induced thermogenesis. Br J Nutr 45, 257-267 (1981). 308 Nicholls, D. G. & Locke, R. M. Thermogenic mechanisms in brown fat. Physiological reviews 64, 1-64 (1984). 309 Samec, S., Seydoux, J. & Dulloo, A. G. Role of UCP homologues in skeletal muscles and brown adipose tissue: mediators of thermogenesis or regulators of lipids as fuel substrate? FASEB journal : official publication of the Federation of American Societies for Experimental Biology 12, 715-724 (1998). 310 Enerback, S. et al. Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387, 90-94, doi:10.1038/387090a0 (1997). 311 Harper, M. E. & Himms-Hagen, J. Mitochondrial efficiency: lessons learned from transgenic mice. Biochimica et biophysica acta 1504, 159-172 (2001). 312 Arch, J. R. et al. Atypical beta-adrenoceptor on brown adipocytes as target for anti-obesity drugs. Nature 309, 163-165 (1984).  172 313 Strosberg, A. D. & Pietri-Rouxel, F. Function and regulation of the beta 3-adrenoceptor. Trends Pharmacol Sci 17, 373-381 (1996). 314 Susulic, V. S. et al. Targeted disruption of the beta 3-adrenergic receptor gene. J Biol Chem 270, 29483-29492 (1995). 315 Champigny, O. et al. Beta 3-adrenergic receptor stimulation restores message and expression of brown-fat mitochondrial uncoupling protein in adult dogs. Proc Natl Acad Sci U S A 88, 10774-10777 (1991). 316 Fisher, M. H. et al. A selective human beta3 adrenergic receptor agonist increases metabolic rate in rhesus monkeys. The Journal of clinical investigation 101, 2387-2393, doi:10.1172/jci2496 (1998). 317 Landsberg, L., Saville, M. E. & Young, J. B. Sympathoadrenal system and regulation of thermogenesis. The American journal of physiology 247, E181-189 (1984). 318 Thomas, S. A. & Palmiter, R. D. Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387, 94-97, doi:10.1038/387094a0 (1997). 319 Elmquist, J. K., Elias, C. F. & Saper, C. B. From lesions to leptin: hypothalamic control of food intake and body weight. Neuron 22, 221-232 (1999). 320 Frederich, R. C. et al. Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1, 1311-1314 (1995). 321 al-Adsani, H., Hoffer, L. J. & Silva, J. E. Resting energy expenditure is sensitive to small dose changes in patients on chronic thyroid hormone replacement. J Clin Endocrinol Metab 82, 1118-1125, doi:10.1210/jcem.82.4.3873 (1997). 322 Ahima, R. S. et al. Role of leptin in the neuroendocrine response to fasting. Nature 382, 250-252, doi:10.1038/382250a0 (1996).  173 323 Legradi, G., Emerson, C. H., Ahima, R. S., Flier, J. S. & Lechan, R. M. Leptin prevents fasting-induced suppression of prothyrotropin-releasing hormone messenger ribonucleic acid in neurons of the hypothalamic paraventricular nucleus. Endocrinology 138, 2569-2576, doi:10.1210/endo.138.6.5209 (1997). 324 Ferrannini, E. et al. Insulin: new roles for an ancient hormone. Eur J Clin Invest 29, 842-852 (1999). 325 McArdle, W. D. & Katch, V. L. Exercise Physiology: Energy, Nutrition, and Human Performance. 5th edn,  (Lippincott Williams & Wilkins, 2001). 326 Kempen, K. P., Saris, W. H. & Westerterp, K. R. Energy balance during an 8-wk energy-restricted diet with and without exercise in obese women. Am J Clin Nutr 62, 722-729 (1995). 327 Goran, M. I. & Poehlman, E. T. Endurance training does not enhance total energy expenditure in healthy elderly persons. The American journal of physiology 263, E950-957 (1992). 328 Levine, J. A. Nonexercise activity thermogenesis (NEAT): environment and biology. American journal of physiology. Endocrinology and metabolism 286, E675-685, doi:10.1152/ajpendo.00562.2003 (2004). 329 Loos, R. J. F. & Bouchard, C. Obesity- is it a genetic disorder? J Intern Med 254, 401-425 (2003). 330 Farooqi, I. S. & O'Rahilly, S. Monogenic obesity in humans. Annu Rev Med 56, 443-458 (2005). 331 Ravussin, E. & Bogardus, C. Energy balance and weight regulation: genetics versus environment. Br J Nutr 83, S17-20 (2000).  174 332 Walley, A. J., Blakemore, A. I. & Froguel, P. Genetics of obesity and the prediction of risk for health. Hum Mol Genet 15, R124-130 (2006). 333 Buettner, R. et al. Defining high-fat-diet rat models: metabolic and molecular effects of different fat types. Journal of molecular endocrinology 36, 485-501, doi:10.1677/jme.1.01909 (2006). 334 Winzell, M. S. & Ahren, B. The High-Fat Diet-Fed Mouse: A Model for Studying Mechanisms and Treatment of Impaired Glucose Tolerance and Type 2 Diabetes. Diabetes 53, S215-219, doi:10.2337/diabetes.53.suppl_3.S215 (2004). 335 Lin, S., Thomas, T. C., Storlien, L. H. & Huang, X. F. Development of high fat diet-induced obesity and leptin resistance in C57Bl/6J mice. International journal of obesity and related metabolic disorders : journal of the International Association for the Study of Obesity 24, 639-646 (2000). 336 Costa, A. G., Bressan, J. & Sabarense, C. M. [Trans fatty acids: foods and effects on health]. Archivos latinoamericanos de nutricion 56, 12-21 (2006). 337 Kevonian, A. V., Vander Tuig, J. G. & Romsos, D. R. Consumption of a low protein diet increases norepinephrine turnover in brown adipose tissue of adult rats. J Nutr 114, 543-549 (1984). 338 Rothwell, N. J. & Stock, M. J. Effect of environmental temperature on energy balance and thermogenesis in rats fed normal or low protein diets. J Nutr 117, 833-837 (1987). 339 Flatt, J. P., Ravussin, E., Acheson, K. J. & Jequier, E. Effects of dietary fat on postprandial substrate oxidation and on carbohydrate and fat balances. The Journal of clinical investigation 76, 1019-1024, doi:10.1172/jci112054 (1985).  175 340 Winzell, M. S. & Ahren, B. The high-fat diet-fed mouse: a model for studying mechanisms and treatment of impaired glucose tolerance and type 2 diabetes. Diabetes 53 Suppl 3, S215-219 (2004). 341 Palmiter, R. D. Is dopamine a physiologically relevant mediator of feeding behavior? Trends in neurosciences 30, 375-381, doi:10.1016/j.tins.2007.06.004 (2007). 342 Scherer, P. E. Adipose tissue: from lipid storage compartment to endocrine organ. Diabetes 55, 1537-1545, doi:10.2337/db06-0263 (2006). 343 Wellen, K. E. & Hotamisligil, G. S. Inflammation, stress, and diabetes. The Journal of clinical investigation 115, 1111-1119, doi:10.1172/jci25102 (2005). 344 Shoelson, S. E., Lee, J. & Goldfine, A. B. Inflammation and insulin resistance. The Journal of clinical investigation 116, 1793-1801, doi:10.1172/jci29069 (2006). 345 Boden, G. Role of fatty acids in the pathogenesis of insulin resistance and NIDDM. Diabetes 46, 3-10 (1997). 346 Reaven, G. M., Hollenbeck, C., Jeng, C. Y., Wu, M. S. & Chen, Y. D. Measurement of plasma glucose, free fatty acid, lactate, and insulin for 24 h in patients with NIDDM. Diabetes 37, 1020-1024 (1988). 347 Roden, M. et al. Mechanism of free fatty acid-induced insulin resistance in humans. The Journal of clinical investigation 97, 2859-2865, doi:10.1172/jci118742 (1996). 348 Santomauro, A. T. et al. Overnight lowering of free fatty acids with Acipimox improves insulin resistance and glucose tolerance in obese diabetic and nondiabetic subjects. Diabetes 48, 1836-1841 (1999). 349 Kahn, S. E., Hull, R. L. & Utzschneider, K. M. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 444, 840-846 (2006).  176 350 McCullough, A. J. Pathophysiology of nonalcoholic steatohepatitis. Journal of clinical gastroenterology 40 Suppl 1, S17-29, doi:DOI: 10.1097/01.mcg.0000168645.86658.22 (2006). 351 Shulman, G. I. Cellular mechanisms of insulin resistance. The Journal of clinical investigation 106, 171-176, doi:10.1172/jci10583 (2000). 352 Dresner, A. et al. Effects of free fatty acids on glucose transport and IRS-1-associated phosphatidylinositol 3-kinase activity. The Journal of clinical investigation 103, 253-259, doi:10.1172/jci5001 (1999). 353 Griffin, M. E. et al. Free fatty acid-induced insulin resistance is associated with activation of protein kinase C theta and alterations in the insulin signaling cascade. Diabetes 48, 1270-1274 (1999). 354 Kim, J. K. et al. PKC-theta knockout mice are protected from fat-induced insulin resistance. The Journal of clinical investigation 114, 823-827, doi:10.1172/jci22230 (2004). 355 Fain, J. N., Madan, A. K., Hiler, M. L., Cheema, P. & Bahouth, S. W. Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans. Endocrinology 145, 2273-2282, doi:10.1210/en.2003-1336 (2004). 356 Mooney, R. A. et al. Suppressors of cytokine signaling-1 and -6 associate with and inhibit the insulin receptor. A potential mechanism for cytokine-mediated insulin resistance. J Biol Chem 276, 25889-25893, doi:10.1074/jbc.M010579200 (2001).  177 357 Matsuzawa, A. et al. ROS-dependent activation of the TRAF6-ASK1-p38 pathway is selectively required for TLR4-mediated innate immunity. Nature immunology 6, 587-592, doi:10.1038/ni1200 (2005). 358 Shi, H. et al. TLR4 links innate immunity and fatty acid-induced insulin resistance. The Journal of clinical investigation 116, 3015-3025, doi:10.1172/JCI28898 (2006). 359 Suganami, T. et al. Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice carrying a Toll-like receptor 4 mutation. Biochem Biophys Res Commun 354, 45-49, doi:10.1016/j.bbrc.2006.12.190 (2007). 360 Suganami, T. et al. Role of the Toll-like receptor 4/NF-kappaB pathway in saturated fatty acid-induced inflammatory changes in the interaction between adipocytes and macrophages. Arterioscler Thromb Vasc Biol 27, 84-91, doi:10.1161/01.ATV.0000251608.09329.9a (2007). 361 Wojtczak, L. & Schonfeld, P. Effect of fatty acids on energy coupling processes in mitochondria. Biochimica et biophysica acta 1183, 41-57 (1993). 362 Carlsson, C., Borg, L. A. & Welsh, N. Sodium palmitate induces partial mitochondrial uncoupling and reactive oxygen species in rat pancreatic islets in vitro. Endocrinology 140, 3422-3428, doi:10.1210/endo.140.8.6908 (1999). 363 Rao, M. S. & Reddy, J. K. Peroxisomal beta-oxidation and steatohepatitis. Seminars in liver disease 21, 43-55 (2001). 364 Ingalls, A. M., Dickie, M. M. & Snell, G. D. Obese, a new mutation in the house mouse. The Journal of heredity 41, 317-318 (1950). 365 Zhang, Y. et al. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432, doi:10.1038/372425a0 (1994).  178 366 Choi-Miura, N. H. et al. Purification and characterization of a novel hyaluronan-binding protein (PHBP) from human plasma: it has three EGF, a kringle and a serine protease domain, similar to hepatocyte growth factor activator. Journal of biochemistry 119, 1157-1165 (1996). 367 Hu, E., Liang, P. & Spiegelman, B. M. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 271, 10697-10703 (1996). 368 Maeda, K. et al. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun 221, 286-289, doi:10.1006/bbrc.1996.0587 (1996). 369 Scherer, P. E., Williams, S., Fogliano, M., Baldini, G. & Lodish, H. F. A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270, 26746-26749 (1995). 370 Gamber, K. M. et al. Over-expression of leptin receptors in hypothalamic POMC neurons increases susceptibility to diet-induced obesity. PLoS One 7, e30485, doi:10.1371/journal.pone.0030485 (2012). 371 El-Haschimi, K., Pierroz, D. D., Hileman, S. M., Bjorbaek, C. & Flier, J. S. Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. The Journal of clinical investigation 105, 1827-1832, doi:10.1172/jci9842 (2000). 372 Matheny, M., Shapiro, A., Tumer, N. & Scarpace, P. J. Region-specific diet-induced and leptin-induced cellular leptin resistance includes the ventral tegmental area in rats. Neuropharmacology 60, 480-487, doi:10.1016/j.neuropharm.2010.11.002 (2011).  179 373 Knight, Z. A., Hannan, K. S., Greenberg, M. L. & Friedman, J. M. Hyperleptinemia is required for the development of leptin resistance. PLoS One 5, e11376, doi:10.1371/journal.pone.0011376 (2010). 374 de Lartigue, G., Barbier de la Serre, C., Espero, E., Lee, J. & Raybould, H. E. Diet-induced obesity leads to the development of leptin resistance in vagal afferent neurons. American journal of physiology. Endocrinology and metabolism 301, E187-195, doi:10.1152/ajpendo.00056.2011 (2011). 375 Wang, M. Y., Orci, L., Ravazzola, M. & Unger, R. H. Fat storage in adipocytes requires inactivation of leptin's paracrine activity: implications for treatment of human obesity. Proc Natl Acad Sci U S A 102, 18011-18016, doi:10.1073/pnas.0509001102 (2005). 376 Brabant, G. et al. Hepatic leptin signaling in obesity. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 19, 1048-1050, doi:10.1096/fj.04-2846fje (2005). 377 Wang, Z. et al. Leptin resistance of adipocytes in obesity: role of suppressors of cytokine signaling. Biochem Biophys Res Commun 277, 20-26, doi:10.1006/bbrc.2000.3615 (2000). 378 Bjorbak, C. et al. SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J Biol Chem 275, 40649-40657, doi:10.1074/jbc.M007577200 (2000). 379 Bjornholm, M. et al. Mice lacking inhibitory leptin receptor signals are lean with normal endocrine function. The Journal of clinical investigation 117, 1354-1360, doi:10.1172/jci30688 (2007). 380 Chandran, M., Phillips, S. A., Ciaraldi, T. & Henry, R. R. Adiponectin: more than just another fat cell hormone? Diabetes Care 26, 2442-2450 (2003).  180 381 Berg, A. H., Combs, T. P., Du, X., Brownlee, M. & Scherer, P. E. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7, 947-953, doi:10.1038/90992 (2001). 382 Kubota, N. et al. Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 277, 25863-25866, doi:10.1074/jbc.C200251200 (2002). 383 Cawthorn, W. P. et al. Bone Marrow Adipose Tissue Is an Endocrine Organ that Contributes to Increased Circulating Adiponectin during Caloric Restriction. Cell metabolism 20, 368-375, doi:10.1016/j.cmet.2014.06.003 (2014). 384 Pfeifer, A. & Hoffmann, L. S. Brown, Beige, and White: The New Color Code of Fat and Its Pharmacological Implications. Annual review of pharmacology and toxicology, doi:10.1146/annurev-pharmtox-010814-124346 (2014). 385 Atit, R. et al. Beta-catenin activation is necessary and sufficient to specify the dorsal dermal fate in the mouse. Dev Biol 296, 164-176, doi:10.1016/j.ydbio.2006.04.449 (2006). 386 Cannon, B. & Nedergaard, J. Developmental biology: Neither fat nor flesh. Nature 454, 947-948, doi:10.1038/454947a (2008). 387 Seale, P. et al. PRDM16 controls a brown fat/skeletal muscle switch. Nature 454, 961-967, doi:10.1038/nature07182 (2008). 388 Sanchez-Gurmaches, J. & Guertin, D. A. Adipocytes arise from multiple lineages that are heterogeneously and dynamically distributed. Nature communications 5, 4099, doi:10.1038/ncomms5099 (2014). 389 Rothwell, N. J. & Stock, M. J. A role for brown adipose tissue in diet-induced thermogenesis. Nature 281, 31-35 (1979).  181 390 Gesta, S., Tseng, Y. H. & Kahn, C. R. Developmental origin of fat: tracking obesity to its source. Cell 131, 242-256, doi:10.1016/j.cell.2007.10.004 (2007). 391 Lee, Y. H., Mottillo, E. P. & Granneman, J. G. Adipose tissue plasticity from WAT to BAT and in between. Biochimica et biophysica acta 1842, 358-369, doi:10.1016/j.bbadis.2013.05.011 (2014). 392 Cnop, M. et al. The concurrent accumulation of intra-abdominal and subcutaneous fat explains the association between insulin resistance and plasma leptin concentrations : distinct metabolic effects of two fat compartments. Diabetes 51, 1005-1015 (2002). 393 Kvist, H., Chowdhury, B., Grangard, U., Tylen, U. & Sjostrom, L. Total and visceral adipose-tissue volumes derived from measurements with computed tomography in adult men and women: predictive equations. Am J Clin Nutr 48, 1351-1361 (1988). 394 Montague, C. T. & O'Rahilly, S. The perils of portliness: causes and consequences of visceral adiposity. Diabetes 49, 883-888 (2000). 395 Kim, S. P., Ellmerer, M., Van Citters, G. W. & Bergman, R. N. Primacy of hepatic insulin resistance in the development of the metabolic syndrome induced by an isocaloric moderate-fat diet in the dog. Diabetes 52, 2453-2460 (2003). 396 Lo, K. A. & Sun, L. Turning WAT into BAT: a review on regulators controlling the browning of white adipocytes. Bioscience reports 33, doi:10.1042/bsr20130046 (2013). 397 Rosen, E. D. & Spiegelman, B. M. What we talk about when we talk about fat. Cell 156, 20-44, doi:10.1016/j.cell.2013.12.012 (2014). 398 Frontini, A. & Cinti, S. Distribution and development of brown adipocytes in the murine and human adipose organ. Cell metabolism 11, 253-256, doi:10.1016/j.cmet.2010.03.004 (2010).  182 399 Mitschke, M. M. et al. Increased cGMP promotes healthy expansion and browning of white adipose tissue. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 27, 1621-1630, doi:10.1096/fj.12-221580 (2013). 400 Lee, Y. H., Petkova, A. P., Mottillo, E. P. & Granneman, J. G. In vivo identification of bipotential adipocyte progenitors recruited by beta3-adrenoceptor activation and high-fat feeding. Cell metabolism 15, 480-491, doi:10.1016/j.cmet.2012.03.009 (2012). 401 Cederberg, A. et al. FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Cell 106, 563-573 (2001). 402 Leonardsson, G. et al. Nuclear receptor corepressor RIP140 regulates fat accumulation. Proc Natl Acad Sci U S A 101, 8437-8442, doi:10.1073/pnas.0401013101 (2004). 403 Vegiopoulos, A. et al. Cyclooxygenase-2 controls energy homeostasis in mice by de novo recruitment of brown adipocytes. Science 328, 1158-1161, doi:10.1126/science.1186034 (2010). 404 Cohen, P. et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 156, 304-316, doi:10.1016/j.cell.2013.12.021 (2014). 405 Yang, Q. et al. Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature 436, 356-362, doi:10.1038/nature03711 (2005). 406 Mertens, I. & Van Gaal, L. F. Obesity, haemostasis and the fibrinolytic system. Obes Rev 3, 85-101 (2002). 407 Juhan-Vague, I., Alessi, M. C., Mavri, A. & Morange, P. E. Plasminogen activator inhibitor-1, inflammation, obesity, insulin resistance and vascular risk. Journal of thrombosis and haemostasis : JTH 1, 1575-1579 (2003).  183 408 Fernandez-Real, J. M. & Ricart, W. Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev 24, 278-301, doi:10.1210/er.2002-0010 (2003). 409 Bastard, J. P. et al. Adipose tissue IL-6 content correlates with resistance to insulin activation of glucose uptake both in vivo and in vitro. J Clin Endocrinol Metab 87, 2084-2089, doi:10.1210/jcem.87.5.8450 (2002). 410 Hotamisligil, G. S., Shargill, N. S. & Spiegelman, B. M. Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259, 87-91 (1993). 411 Spiegelman, B. M., Choy, L., Hotamisligil, G. S., Graves, R. A. & Tontonoz, P. Regulation of adipocyte gene expression in differentiation and syndromes of obesity/diabetes. J Biol Chem 268, 6823-6826 (1993). 412 Spiegelman, B. M. & Hotamisligil, G. S. Through thick and thin: wasting, obesity, and TNF alpha. Cell 73, 625-627 (1993). 413 Xu, H. et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. The Journal of clinical investigation 112, 1821-1830, doi:10.1172/jci19451 (2003). 414 Weisberg, S. P. et al. Obesity is associated with macrophage accumulation in adipose tissue. The Journal of clinical investigation 112, 1796-1808, doi:10.1172/jci19246 (2003). 415 Taniguchi, C. M., Emanuelli, B. & Kahn, C. R. Critical nodes in signalling pathways: insights into insulin action. Nature reviews. Molecular cell biology 7, 85-96, doi:10.1038/nrm1837 (2006).  184 416 Sparks, J. D. & Dong, H. H. FoxO1 and hepatic lipid metabolism. Curr Opin Lipidol 20, 217-226, doi:10.1097/MOL.0b013e32832b3f4c (2009). 417 Ueki, K., Kadowaki, T. & Kahn, C. R. Role of suppressors of cytokine signaling SOCS-1 and SOCS-3 in hepatic steatosis and the metabolic syndrome. Hepatology research : the official journal of the Japan Society of Hepatology 33, 185-192, doi:10.1016/j.hepres.2005.09.032 (2005). 418 Abu-Elheiga, L. et al. The subcellular localization of acetyl-CoA carboxylase 2. Proc Natl Acad Sci U S A 97, 1444-1449 (2000). 419 Abu-Elheiga, L., Oh, W., Kordari, P. & Wakil, S. J. Acetyl-CoA carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high-carbohydrate diets. Proc Natl Acad Sci U S A 100, 10207-10212, doi:10.1073/pnas.1733877100 (2003). 420 Abu-Elheiga, L., Matzuk, M. M., Abo-Hashema, K. A. & Wakil, S. J. Continuous fatty acid oxidation and reduced fat storage in mice lacking acetyl-CoA carboxylase 2. Science 291, 2613-2616, doi:10.1126/science.1056843 (2001). 421 Sanyal, A. J. et al. Nonalcoholic steatohepatitis: association of insulin resistance and mitochondrial abnormalities. Gastroenterology 120, 1183-1192, doi:10.1053/gast.2001.23256 (2001). 422 Begriche, K., Igoudjil, A., Pessayre, D. & Fromenty, B. Mitochondrial dysfunction in NASH: causes, consequences and possible means to prevent it. Mitochondrion 6, 1-28, doi:10.1016/j.mito.2005.10.004 (2006).  185 423 Diehl, A. M. Lessons from animal models of NASH. Hepatology research : the official journal of the Japan Society of Hepatology 33, 138-144, doi:10.1016/j.hepres.2005.09.022 (2005). 424 Garcia-Ruiz, C. & Fernandez-Checa, J. C. Mitochondrial glutathione: hepatocellular survival-death switch. Journal of gastroenterology and hepatology 21 Suppl 3, S3-6, doi:10.1111/j.1440-1746.2006.04570.x (2006). 425 Bilzer, M., Roggel, F. & Gerbes, A. L. Role of Kupffer cells in host defense and liver disease. Liver international : official journal of the International Association for the Study of the Liver 26, 1175-1186, doi:10.1111/j.1478-3231.2006.01342.x (2006). 426 Malaguarnera, L. et al. Potential role of chitotriosidase gene in nonalcoholic fatty liver disease evolution. The American journal of gastroenterology 101, 2060-2069, doi:10.1111/j.1572-0241.2006.00680.x (2006). 427 Malaguarnera, L. et al. Chitotriosidase gene expression in Kupffer cells from patients with non-alcoholic fatty liver disease. Gut 55, 1313-1320, doi:10.1136/gut.2005.075697 (2006). 428 Bedossa, P., Houglum, K., Trautwein, C., Holstege, A. & Chojkier, M. Stimulation of collagen alpha 1(I) gene expression is associated with lipid peroxidation in hepatocellular injury: a link to tissue fibrosis? Hepatology (Baltimore, Md.) 19, 1262-1271 (1994). 429 Huang, W. et al. Leptin augments the acute suppressive effects of insulin on hepatic very low-density lipoprotein production in rats. Endocrinology 150, 2169-2174, doi:10.1210/en.2008-1271 (2009). 430 Shimabukuro, M. et al. Direct antidiabetic effect of leptin through triglyceride depletion of tissues. Proc Natl Acad Sci U S A 94, 4637-4641 (1997).  186 431 Lee, Y. et al. Liporegulation in diet-induced obesity. The antisteatotic role of hyperleptinemia. J Biol Chem 276, 5629-5635, doi:10.1074/jbc.M008553200 (2001). 432 Huang, W., Dedousis, N., Bandi, A., Lopaschuk, G. D. & O'Doherty, R. M. Liver triglyceride secretion and lipid oxidative metabolism are rapidly altered by leptin in vivo. Endocrinology 147, 1480-1487, doi:10.1210/en.2005-0731 (2006). 433 Myers, M. G., Cowley, M. A. & Munzberg, H. Mechanisms of leptin action and leptin resistance. Annu Rev Physiol 70, 537-556, doi:10.1146/annurev.physiol.70.113006.100707 (2008). 434 Huynh, F. K. et al. A role for hepatic leptin signaling in lipid metabolism via altered very low density lipoprotein composition and liver lipase activity in mice. Hepatology (Baltimore, Md.) 57, 543-554, doi:10.1002/hep.26043 (2013). 435 Buechler, C., Wanninger, J. & Neumeier, M. Adiponectin, a key adipokine in obesity related liver diseases. World journal of gastroenterology : WJG 17, 2801-2811, doi:10.3748/wjg.v17.i23.2801 (2011). 436 Zierath, J. R. & Wallberg-Henriksson, H. From receptor to effector: insulin signal transduction in skeletal muscle from type II diabetic patients. Ann N Y Acad Sci 967, 120-134 (2002). 437 Martin, B. C. et al. ROLE OF GLUCOSE AND INSULIN RESISTANCE IN DEVELOPMENT OF TYPE-2 DIABETES-MELLITUS - RESULTS OF A 25-YEAR FOLLOW-UP-STUDY. Lancet 340, 925-929, doi:10.1016/0140-6736(92)92814-v (1992).  187 438 Bruning, J. C. et al. A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2, 559-569, doi:S1097-2765(00)80155-0 [pii] (1998). 439 Ceddia, R. B. Direct metabolic regulation in skeletal muscle and fat tissue by leptin: implications for glucose and fatty acids homeostasis. Int J Obes (Lond) 29, 1175-1183, doi:10.1038/sj.ijo.0803025 (2005). 440 Carling, D. et al. Bypassing the glucose/fatty acid cycle: AMP-activated protein kinase. Biochem Soc Trans 31, 1157-1160, doi:10.1042/ (2003). 441 Minokoshi, Y. et al. Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415, 339-343, doi:10.1038/415339a (2002). 442 Perley, M. & Kipnis, D. M. Plasma insulin responses to glucose and tolbutamide of normal weight and obese diabetic and nondiabetic subjects. Diabetes 15, 867-874 (1966). 443 Polonsky, K. S., Given, B. D. & Van Cauter, E. Twenty-four-hour profiles and pulsatile patterns of insulin secretion in normal and obese subjects. The Journal of clinical investigation 81, 442-448, doi:10.1172/jci113339 (1988). 444 Kahn, S. E. et al. Quantification of the relationship between insulin sensitivity and beta-cell function in human subjects. Evidence for a hyperbolic function. Diabetes 42, 1663-1672 (1993). 445 Kloppel, G., Lohr, M., Habich, K., Oberholzer, M. & Heitz, P. U. Islet pathology and the pathogenesis of type 1 and type 2 diabetes mellitus revisited. Survey and synthesis of pathology research 4, 110-125 (1985). 446 Butler, A. E. et al. Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110 (2003).  188 447 Hull, R. L. et al. Dietary-fat-induced obesity in mice results in beta cell hyperplasia but not increased insulin release: evidence for specificity of impaired beta cell adaptation. Diabetologia 48, 1350-1358, doi:10.1007/s00125-005-1772-9 (2005). 448 Liu, Y. Q., Jetton, T. L. & Leahy, J. L. beta-Cell adaptation to insulin resistance. Increased pyruvate carboxylase and malate-pyruvate shuttle activity in islets of nondiabetic Zucker fatty rats. J Biol Chem 277, 39163-39168, doi:10.1074/jbc.M207157200 (2002). 449 Chen, C., Hosokawa, H., Bumbalo, L. M. & Leahy, J. L. Mechanism of compensatory hyperinsulinemia in normoglycemic insulin-resistant spontaneously hypertensive rats. Augmented enzymatic activity of glucokinase in beta-cells. The Journal of clinical investigation 94, 399-404, doi:10.1172/jci117335 (1994). 450 Dobbins, R. L. et al. A fatty acid- dependent step is critically important for both glucose- and non-glucose-stimulated insulin secretion. The Journal of clinical investigation 101, 2370-2376, doi:10.1172/jci1813 (1998). 451 Itoh, Y. et al. Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422, 173-176, doi:10.1038/nature01478 (2003). 452 Sako, Y. & Grill, V. E. A 48-hour lipid infusion in the rat time-dependently inhibits glucose-induced insulin secretion and B cell oxidation through a process likely coupled to fatty acid oxidation. Endocrinology 127, 1580-1589, doi:10.1210/endo-127-4-1580 (1990). 453 Zhou, Y. P. & Grill, V. E. Long-term exposure of rat pancreatic islets to fatty acids inhibits glucose-induced insulin secretion and biosynthesis through a glucose fatty acid cycle. The Journal of clinical investigation 93, 870-876, doi:10.1172/jci117042 (1994).  189 454 Roder, M. E., Porte, D., Jr., Schwartz, R. S. & Kahn, S. E. Disproportionately Elevated Proinsulin Levels Reflect the Degree of Impaired B Cell Secretory Capacity in Patients with Noninsulin-Dependent Diabetes Mellitus. J Clin Endocrinol Metab 83, 604-608, doi:10.1210/jc.83.2.604 (1998). 455 Stoy, J. et al. Insulin gene mutations as a cause of permanent neonatal diabetes. Proc Natl Acad Sci U S A 104, 15040-15044, doi:10.1073/pnas.0707291104 (2007). 456 Harding, H. P. & Ron, D. Endoplasmic reticulum stress and the development of diabetes: a review. Diabetes 51 Suppl 3, S455-461 (2002). 457 Fricker, L. D., Berman, Y. L., Leiter, E. H. & Devi, L. A. Carboxypeptidase E activity is deficient in mice with the fat mutation. Effect on peptide processing. J Biol Chem 271, 30619-30624 (1996). 458 Naggert, J. K. et al. Hyperproinsulinaemia in obese fat/fat mice associated with a carboxypeptidase E mutation which reduces enzyme activity. Nat Genet 10, 135-142, doi:10.1038/ng0695-135 (1995). 459 Pereira-da-Silva, M. et al. Hypothalamic melanin-concentrating hormone is induced by cold exposure and participates in the control of energy expenditure in rats. Endocrinology 144, 4831-4840, doi:10.1210/en.2003-0243 (2003). 460 De Souza, C. T. et al. Consumption of a fat-rich diet activates a proinflammatory response and induces insulin resistance in the hypothalamus. Endocrinology 146, 4192-4199, doi:10.1210/en.2004-1520 (2005). 461 De Souza, C. T. et al. Distinct subsets of hypothalamic genes are modulated by two different thermogenesis-inducing stimuli. Obesity (Silver Spring) 16, 1239-1247, doi:10.1038/oby.2008.53 (2008).  190 462 Amaral, M. E. et al. Tumor necrosis factor-alpha activates signal transduction in hypothalamus and modulates the expression of pro-inflammatory proteins and orexigenic/anorexigenic neurotransmitters. J Neurochem 98, 203-212, doi:10.1111/j.1471-4159.2006.03857.x (2006). 463 Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E. & Flier, J. S. Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1, 619-625 (1998). 464 Howard, J. K. et al. Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10, 734-738, doi:10.1038/nm1072 (2004). 465 Morgan, K., Obici, S. & Rossetti, L. Hypothalamic responses to long-chain fatty acids are nutritionally regulated. J Biol Chem 279, 31139-31148, doi:10.1074/jbc.M400458200 (2004). 466 Pocai, A. et al. Restoration of hypothalamic lipid sensing normalizes energy and glucose homeostasis in overfed rats. The Journal of clinical investigation 116, 1081-1091, doi:10.1172/jci26640 (2006). 467 Coleman, D. L. Effects of parabiosis of obese with diabetes and normal mice. Diabetologia 9, 294-298 (1973). 468 Montague, C. T. et al. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903-908, doi:10.1038/43185 (1997). 469 Strobel, A., Issad, T., Camoin, L., Ozata, M. & Strosberg, A. D. A leptin missense mutation associated with hypogonadism and morbid obesity. Nat Genet 18, 213-215, doi:10.1038/ng0398-213 (1998).  191 470 Gibson, W. T. et al. Congenital leptin deficiency due to homozygosity for the Delta133G mutation: report of another case and evaluation of response to four years of leptin therapy. J Clin Endocrinol Metab 89, 4821-4826, doi:10.1210/jc.2004-0376 (2004). 471 Farooqi, I. S. et al. Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N Engl J Med 341, 879-884, doi:10.1056/nejm199909163411204 (1999). 472 Paz-Filho, G., Wong, M. L. & Licinio, J. Ten years of leptin replacement therapy. Obes Rev 12, e315-323, doi:10.1111/j.1467-789X.2010.00840.x (2011). 473 Pelleymounter, M. A. et al. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269, 540-543 (1995). 474 Halaas, J. L. et al. Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269, 543-546 (1995). 475 Campfield, L. A., Smith, F. J., Guisez, Y., Devos, R. & Burn, P. Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269, 546-549 (1995). 476 Genuth, S. M. Hyperinsulinism in mice with genetically determined obesity. Endocrinology 84, 386-391, doi:10.1210/endo-84-2-386 (1969). 477 Bray, G. A. The Zucker-fatty rat: a review. Federation proceedings 36, 148-153 (1977). 478 Odeleye, O. E., de Courten, M., Pettitt, D. J. & Ravussin, E. Fasting hyperinsulinemia is a predictor of increased body weight gain and obesity in Pima Indian children. Diabetes 46, 1341-1345 (1997). 479 Le Stunff, C. & Bougneres, P. Early changes in postprandial insulin secretion, not in insulin sensitivity, characterize juvenile obesity. Diabetes 43, 696-702 (1994).  192 480 Genuth, S. M., Przybylski, R. J. & Rosenberg, D. M. Insulin resistance in genetically obese, hyperglycemic mice. Endocrinology 88, 1230-1238 (1971). 481 Grundleger, M. L., Godbole, V. Y. & Thenen, S. W. Age-dependent development of insulin resistance of soleus muscle in genetically obese (ob/ob) mice. American Journal of Physiology 239, E363-371 (1980). 482 Coleman, D. L. & Hummel, K. P. Hyperinsulinemia in pre-weaning diabetes (db) mice. Diabetologia 10 Suppl, 607-610 (1974). 483 Zarjevski, N., Doyle, P. & Jeanrenaud, B. Muscle insulin resistance may not be a primary etiological factor in the genetically obese fa/fa rat. Endocrinology 130, 1564-1570 (1992). 484 Ishikawa, M., Pruneda, M. L., Adams-Huet, B. & Raskin, P. Obesity-independent hyperinsulinemia in nondiabetic first-degree relatives of individuals with type 2 diabetes. Diabetes 47, 788-792 (1998). 485 Koopmans, S. J., Ohman, L., Haywood, J. R., Mandarino, L. J. & DeFronzo, R. A. Seven days of euglycemic hyperinsulinemia induces insulin resistance for glucose metabolism but not hypertension, elevated catecholamine levels, or increased sodium retention in conscious normal rats. Diabetes 46, 1572-1578 (1997). 486 Zimmet, P., Dowse, G. & Bennett, P. Hyperinsulinaemia is a predictor of non-insulin-dependent diabetes mellitus. Diabete Metab 17, 101-108 (1991). 487 Gray, S. L., Donald, C., Jetha, A., Covey, S. D. & Kieffer, T. J. Hyperinsulinemia precedes insulin resistance in mice lacking pancreatic beta-cell leptin signaling. Endocrinology 151, 4178-4186, doi:en.2010-0102 [pii]10.1210/en.2010-0102 (2010).  193 488 Heude, B. et al. VNTR polymorphism of the insulin gene and childhood overweight in a general population. Obes Res 12, 499-504, doi:10.1038/oby.2004.56 (2004). 489 Le Fur, S. et al. Heterogeneity of class I INS VNTR allele association with insulin secretion in obese children. Physiol Genomics 25, 480-484, doi:00311.2005 [pii]10.1152/physiolgenomics.00311.2005 (2006). 490 Le Stunff, C., Fallin, D. & Bougneres, P. Paternal transmission of the very common class I INS VNTR alleles predisposes to childhood obesity. Nat Genet 29, 96-99, doi:10.1038/ng707ng707 [pii] (2001). 491 Bouatia-Naji, N. et al. INS VNTR is not associated with childhood obesity in 1,023 families: a family-based study. Obesity (Silver Spring) 16, 1471-1475, doi:10.1038/oby.2008.209 (2008). 492 Alemzadeh, R., Holshouser, S., Massey, P. & Koontz, J. Chronic suppression of insulin by diazoxide alters the activities of key enzymes regulating hepatic gluconeogenesis in Zucker rats. European Journal of Endocrinology 146, 871-879, doi:10.1530/eje.0.1460871 (2002). 493 Alemzadeh, R. & Tushaus, K. Modulation of adipoinsular axis in prediabetic ZDF rats by Diazoxide. Diabetes 52, A139-A139 (2003). 494 Alemzadeh, R. & Tushaus, K. M. Modulation of adipoinsular axis in prediabetic Zucker diabetic fatty rats by diazoxide. Endocrinology 145, 5476-5484, doi:10.1210/en.2003-1523 (2004). 495 Alemzadeh, R. & Tushaus, K. M. Suppression of hyperinsulinemia by diazoxide attenuates hepatic lipogenesis in Zucker diabetic fatty rats. Diabetologia 47, A203-A203 (2004).  194 496 Alemzadeh, R., Zhang, J., Tushaus, K. & Koontz, J. Diazoxide enhances adipose tissue protein kinase B activation and glucose transporter-4 expression in obese Zucker rats. Medical Science Monitor 10, BR53-BR60 (2004). 497 Alemzadeh, R. & Tushaus, K. Diazoxide attenuates insulin secretion and hepatic lipogenesis in zucker diabetic fatty rats. Medical Science Monitor 11, BR439-BR448 (2005). 498 Alemzadeh, R., Karlstad, M. D., Tushaus, K. & Buchholz, M. Diazoxide enhances basal metabolic rate and fat oxidation in obese Zucker rats. Metabolism-Clinical and Experimental 57, 1597-1607, doi:10.1016/j.metabol.2008.06.017 (2008). 499 Alemzadeh, R., Langley, G., Upchurch, L., Smith, P. & Slonim, A. E. Beneficial effect of diazoxide in obese hyperinsulinemic adults. J Clin Endocrinol Metab 83, 1911-1915 (1998). 500 van Boekel, G. et al. Weight loss in obese men by caloric restriction and high-dose diazoxide-mediated insulin suppression. Diabetes Obes Metab 10, 1195-1203, doi:DOM878 [pii]10.1111/j.1463-1326.2008.00878.x (2008). 501 Lustig, R. H. et al. Octreotide therapy of pediatric hypothalamic obesity: A double-blind, placebo-controlled trial. Journal of Clinical Endocrinology & Metabolism 88, 2586-2592, doi:10.1210/jc.2002-030003 (2003). 502 Lustig, R. H. et al. Hypothalamic obesity caused by cranial insult in children: Altered glucose and insulin dynamics and reversal by a somatostatin agonist. Journal of Pediatrics 135, 162-168, doi:10.1016/s0022-3476(99)70017-x (1999).  195 503 Mitra, S. W. et al. Colocalization of somatostatin receptor sst5 and insulin in rat pancreatic beta-cells. Endocrinology 140, 3790-3796, doi:10.1210/endo.140.8.6937 (1999). 504 Duvillie, B. et al. Phenotypic alterations in insulin-deficient mutant mice. Proc Natl Acad Sci U S A 94, 5137-5140 (1997). 505 Li, W., Kennedy, S. G. & Ruvkun, G. daf-28 encodes a C. elegans insulin superfamily member that is regulated by environmental cues and acts in the DAF-2 signaling pathway. Genes Dev 17, 844-858, doi:10.1101/gad.1066503 (2003). 506 Katic, M. et al. Mitochondrial gene expression and increased oxidative metabolism: role in increased lifespan of fat-specific insulin receptor knock-out mice. Aging Cell 6, 827-839, doi:ACE346 [pii]10.1111/j.1474-9726.2007.00346.x (2007). 507 Bruning, J. C. et al. Role of brain insulin receptor in control of body weight and reproduction. Science 289, 2122-2125, doi:8841 [pii] (2000). 508 Jeffrey, K. D. et al. Carboxypeptidase E mediates palmitate-induced beta-cell ER stress and apoptosis. Proceedings of the National Academy of Sciences of the United States of America 105, 8452-8457, doi:Doi 10.1073/Pnas.0711232105 (2008). 509 Wicksteed, B. et al. Conditional gene targeting in mouse pancreatic ss-Cells: analysis of ectopic Cre transgene expression in the brain. Diabetes 59, 3090-3098, doi:db10-0624 [pii]10.2337/db10-0624 (2010). 510 Johnson, J. D. A practical guide to genetic engineering of pancreatic b-cells in vivo: Getting a grip on RIP and MIP. Islets 0, 5 (2014). 511 Candeias, E. et al. The impairment of insulin signaling in Alzheimer's disease. IUBMB Life, doi:10.1002/iub.1098 (2012).  196 512 Willette, A. A. et al. Insulin Resistance, Brain Atrophy, and Cognitive Performance in Late Middle-Aged Adults. Diabetes Care, doi:10.2337/dc12-0922 (2012). 513 Craft, S., Cholerton, B. & Baker, L. D. Insulin and Alzheimer's Disease: Untangling the Web. Journal of Alzheimer's disease : JAD, doi:10.3233/JAD-2012-129042 (2012). 514 O'Neill, C., Kiely, A. P., Coakley, M. F., Manning, S. & Long-Smith, C. M. Insulin and IGF-1 signalling: longevity, protein homoeostasis and Alzheimer's disease. Biochem Soc Trans 40, 721-727, doi:10.1042/BST20120080 (2012). 515 Strittmatter, W. J. Alzheimer's disease: the new promise. The Journal of clinical investigation 122, 1191 (2012). 516 Ho, L. et al. Insulin receptor expression and activity in the brains of nondiabetic sporadic Alzheimer's disease cases. Int J Alzheimers Dis 2012, 321280, doi:10.1155/2012/321280 (2012). 517 Musen, G. et al. Resting-state brain functional connectivity is altered in type 2 diabetes. Diabetes 61, 2375-2379, doi:10.2337/db11-1669 (2012). 518 Moll, L. & Schubert, M. The Role of Insulin and Insulin-Like Growth Factor-1/FoxO-Mediated Transcription for the Pathogenesis of Obesity-Associated Dementia. Curr Gerontol Geriatr Res 2012, 384094, doi:10.1155/2012/384094 (2012). 519 Williamson, R., McNeilly, A. & Sutherland, C. Insulin resistance in the brain: an old-age or new-age problem? Biochemical pharmacology 84, 737-745, doi:10.1016/j.bcp.2012.05.007 (2012). 520 Duarte, A. I., Moreira, P. I. & Oliveira, C. R. Insulin in central nervous system: more than just a peripheral hormone. J Aging Res 2012, 384017, doi:10.1155/2012/384017 (2012).  197 521 Talbot, K. et al. Demonstrated brain insulin resistance in Alzheimer's disease patients is associated with IGF-1 resistance, IRS-1 dysregulation, and cognitive decline. The Journal of clinical investigation 122, 1316-1338, doi:10.1172/JCI59903 (2012). 522 Bomfim, T. R. et al. An anti-diabetes agent protects the mouse brain from defective insulin signaling caused by Alzheimer's disease- associated Abeta oligomers. The Journal of clinical investigation 122, 1339-1353, doi:10.1172/JCI57256 (2012). 523 Abdul-Rahman, O. et al. Altered gene expression profiles in the hippocampus and prefrontal cortex of type 2 diabetic rats. BMC Genomics 13, 81, doi:10.1186/1471-2164-13-81 (2012). 524 Chua, L. M. et al. Impaired neuronal insulin signaling precedes Abeta42 accumulation in female AbetaPPsw/PS1DeltaE9 mice. Journal of Alzheimer's disease : JAD 29, 783-791, doi:10.3233/JAD-2012-111880 (2012). 525 de la Monte, S. M. Brain insulin resistance and deficiency as therapeutic targets in Alzheimer's disease. Curr Alzheimer Res 9, 35-66 (2012). 526 Bredesen, D. E., Rao, R. V. & Mehlen, P. Cell death in the nervous system. Nature 443, 796-802, doi:10.1038/nature05293 (2006). 527 Yuan, J. & Yankner, B. A. Apoptosis in the nervous system. Nature 407, 802-809, doi:10.1038/35037739 (2000). 528 Selkoe, D. J. Translating cell biology into therapeutic advances in Alzheimer's disease. Nature 399, A23-31 (1999). 529 Marchesi, V. T. Alzheimer's disease 2012: the great amyloid gamble. Am J Pathol 180, 1762-1767, doi:10.1016/j.ajpath.2012.03.004 (2012).  198 530 Jo, J., Choi, M. Y. & Koh, D. S. Size distribution of mouse Langerhans islets. Biophysical journal 93, 2655-2666, doi:10.1529/biophysj.107.104125 (2007). 531 Le Stunff, C., Fallin, D., Schork, N. J. & Bougneres, P. The insulin gene VNTR is associated with fasting insulin levels and development of juvenile obesity. Nat Genet 26, 444-446, doi:10.1038/82579 (2000). 532 Leroux, L. et al. Compensatory responses in mice carrying a null mutation for Ins1 or Ins2. Diabetes 50 Suppl 1, S150-153 (2001). 533 Himms-Hagen, J. On raising energy expenditure in ob/ob mice. Science 276, 1132-1133 (1997). 534 Leonardsson, G. et al. Nuclear receptor corepressor RIP140 regulates fat accumulation. Proceedings of the National Academy of Sciences of the United States of America 101, 8437-8442, doi:10.1073/pnas.0401013101 (2004). 535 Yamamoto, J. et al. A Kruppel-like factor KLF15 contributes fasting-induced transcriptional activation of mitochondrial acetyl-CoA synthetase gene AceCS2. J Biol Chem 279, 16954-16962, doi:10.1074/jbc.M312079200 (2004). 536 Egecioglu, E. et al. Hedonic and incentive signals for body weight control. Rev Endocr Metab Disord, doi:10.1007/s11154-011-9166-4 (2011). 537 Freathy, R. M. et al. Common variation in the FTO gene alters diabetes-related metabolic traits to the extent expected given its effect on BMI. Diabetes 57, 1419-1426, doi:db07-1466 [pii]10.2337/db07-1466 (2008). 538 Fischer, J. et al. Inactivation of the Fto gene protects from obesity. Nature 458, 894-898, doi:10.1038/nature07848 (2009).  199 539 Chirala, S. S. et al. Fatty acid synthesis is essential in embryonic development: fatty acid synthase null mutants and most of the heterozygotes die in utero. Proc Natl Acad Sci U S A 100, 6358-6363, doi:10.1073/pnas.0931394100 (2003). 540 Chakravarthy, M. V. et al. "New" hepatic fat activates PPARalpha to maintain glucose, lipid, and cholesterol homeostasis. Cell metabolism 1, 309-322, doi:10.1016/j.cmet.2005.04.002 (2005). 541 Alemzadeh, R., Karlstad, M. D., Tushaus, K. & Buchholz, M. Diazoxide enhances basal metabolic rate and fat oxidation in obese Zucker rats. Metabolism 57, 1597-1607, doi:S0026-0495(08)00238-2 [pii]10.1016/j.metabol.2008.06.017 (2008). 542 Dankner, R., Chetrit, A., Shanik, M. H., Raz, I. & Roth, J. Basal-state hyperinsulinemia in healthy normoglycemic adults is predictive of type 2 diabetes over a 24-year follow-up: a preliminary report. Diabetes Care 32, 1464-1466, doi:dc09-0153 [pii]10.2337/dc09-0153 (2009). 543 Hegele, R. A. Monogenic forms of insulin resistance: apertures that expose the common metabolic syndrome. Trends Endocrinol Metab 14, 371-377, doi:S1043276003001425 [pii] (2003). 544 Vijay-Kumar, M. et al. Metabolic syndrome and altered gut microbiota in mice lacking Toll-like receptor 5. Science 328, 228-231, doi:science.1179721 [pii]10.1126/science.1179721 (2010). 545 Wang, F. et al. Brd2 disruption in mice causes severe obesity without Type 2 diabetes. Biochem J 425, 71-83, doi:BJ20090928 [pii]10.1042/BJ20090928 (2010).  200 546 Chen, Z. et al. FKBP12.6-knockout mice display hyperinsulinemia and resistance to high-fat diet-induced hyperglycemia. Faseb Journal 24, 357-363, doi:fj.09-138446 [pii]10.1096/fj.09-138446 (2010). 547 El-Haschimi, K. et al. Insulin resistance and lipodystrophy in mice lacking ribosomal S6 kinase 2. Diabetes 52, 1340-1346 (2003). 548 Lustig, R. H. et al. A multicenter, randomized, double-blind, placebo-controlled, dose-finding trial of a long-acting formulation of octreotide in promoting weight loss in obese adults with insulin hypersecretion. Int J Obes (Lond) 30, 331-341, doi:0803074 [pii]10.1038/sj.ijo.0803074 (2006). 549 Ohsugi, M. et al. Reduced expression of the insulin receptor in mouse insulinoma (MIN6) cells reveals multiple roles of insulin signaling in gene expression, proliferation, insulin content, and secretion. Journal of Biological Chemistry 280, 4992-5003 (2005). 550 Defronzo, R. A. Banting Lecture. From the triumvirate to the ominous octet: a new paradigm for the treatment of type 2 diabetes mellitus. Diabetes 58, 773-795, doi:10.2337/db09-9028 (2009). 551 Saisho, Y. Importance of Beta Cell Function for the Treatment of Type 2 Diabetes. Journal of Clinical Medicine 3, 923-943 (2014). 552 Frolich, L. et al. Brain insulin and insulin receptors in aging and sporadic Alzheimer's disease. J Neural Transm 105, 423-438 (1998). 553 Hallschmid, M., Higgs, S., Thienel, M., Ott, V. & Lehnert, H. Postprandial administration of intranasal insulin intensifies satiety and reduces intake of palatable snacks in women. Diabetes 61, 782-789, doi:10.2337/db11-1390 (2012).  201 554 Steen, E. et al. Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes? J Alzheimers Dis 7, 63-80 (2005). 555 Tatebayashi, Y. [The dentate gyrus neurogenesis: a common therapeutic target for Alzheimer disease and senile depression?]. Seishin shinkeigaku zasshi = Psychiatria et neurologia Japonica 105, 398-404 (2003). 556 Eriksson, P. S. et al. Neurogenesis in the adult human hippocampus. Nat Med 4, 1313-1317 (1998). 557 Schaeffer, E. L., Novaes, B. A., da Silva, E. R., Skaf, H. D. & Mendes-Neto, A. G. Strategies to promote differentiation of newborn neurons into mature functional cells in Alzheimer brain. Progress in neuro-psychopharmacology & biological psychiatry 33, 1087-1102, doi:10.1016/j.pnpbp.2009.06.024 (2009). 558 Yamashima, T., Tonchev, A. B. & Yukie, M. Adult hippocampal neurogenesis in rodents and primates: endogenous, enhanced, and engrafted. Reviews in the neurosciences 18, 67-82 (2007). 559 Taupin, P. Adult neurogenesis and neuroplasticity. Restorative neurology and neuroscience 24, 9-15 (2006). 560 Leroux, L. et al. Compensatory responses in mice carrying a null mutation for Ins1 or Ins2. Diabetes 50, S150-153, doi:10.2337/diabetes.50.2007.S150 (2001). 561 Babaya, N. et al. A new model of insulin-deficient diabetes: male NOD mice with a single copy of Ins1 and no Ins2. Diabetologia 49, 1222-1228, doi:10.1007/s00125-006-0241-4 (2006).  202 562 Greiner, D. L. et al. Humanized mice for the study of type 1 and type 2 diabetes. Ann N Y Acad Sci 1245, 55-58, doi:10.1111/j.1749-6632.2011.06318.x (2011). 563 Machann, J. et al. Age and gender related effects on adipose tissue compartments of subjects with increased risk for type 2 diabetes: a whole body MRI/MRS study. Magma (New York, N.Y.) 18, 128-137, doi:10.1007/s10334-005-0104-x (2005). 564 Moran, A. et al. Changes in insulin resistance and cardiovascular risk during adolescence: establishment of differential risk in males and females. Circulation 117, 2361-2368, doi:10.1161/circulationaha.107.704569 (2008). 565 D'Eon, T. M. et al. Estrogen regulation of adiposity and fuel partitioning. Evidence of genomic and non-genomic regulation of lipogenic and oxidative pathways. J Biol Chem 280, 35983-35991, doi:10.1074/jbc.M507339200 (2005). 566 Herrmann, B. L. et al. Impact of estrogen replacement therapy in a male with congenital aromatase deficiency caused by a novel mutation in the CYP19 gene. J Clin Endocrinol Metab 87, 5476-5484, doi:10.1210/jc.2002-020498 (2002). 567 Louet, J. F., LeMay, C. & Mauvais-Jarvis, F. Antidiabetic actions of estrogen: insight from human and genetic mouse models. Current atherosclerosis reports 6, 180-185 (2004). 568 Carter, S., McKenzie, S., Mourtzakis, M., Mahoney, D. J. & Tarnopolsky, M. A. Short-term 17beta-estradiol decreases glucose R(a) but not whole body metabolism during endurance exercise. Journal of applied physiology (Bethesda, Md. : 1985) 90, 139-146 (2001).  203 569 Carter, S. L., Rennie, C. & Tarnopolsky, M. A. Substrate utilization during endurance exercise in men and women after endurance training. American journal of physiology. Endocrinology and metabolism 280, E898-907 (2001). 570 Baba, T. et al. Estrogen, insulin, and dietary signals cooperatively regulate longevity signals to enhance resistance to oxidative stress in mice. J Biol Chem 280, 16417-16426, doi:10.1074/jbc.M500924200 (2005). 571 Paul, D. R., Novotny, J. A. & Rumpler, W. V. Effects of the interaction of sex and food intake on the relation between energy expenditure and body composition. Am J Clin Nutr 79, 385-389 (2004). 572 Assuncao, M. L., Ferreira, H. S., dos Santos, A. F., Cabral, C. R., Jr. & Florencio, T. M. Effects of dietary coconut oil on the biochemical and anthropometric profiles of women presenting abdominal obesity. Lipids 44, 593-601, doi:10.1007/s11745-009-3306-6 (2009). 573 Sternberg, N. The P1 cloning system: past and future. Mammalian genome : official journal of the International Mammalian Genome Society 5, 397-404 (1994). 574 Dubois, N. C., Hofmann, D., Kaloulis, K., Bishop, J. M. & Trumpp, A. Nestin-Cre transgenic mouse line Nes-Cre1 mediates highly efficient Cre/loxP mediated recombination in the nervous system, kidney, and somite-derived tissues. Genesis 44, 355-360, doi:10.1002/dvg.20226 (2006). 575 Dahlstrand, J., Lardelli, M. & Lendahl, U. Nestin mRNA expression correlates with the central nervous system progenitor cell state in many, but not all, regions of developing central nervous system. Brain research. Developmental brain research 84, 109-129 (1995).  204 576 Wiese, C. et al. Nestin expression--a property of multi-lineage progenitor cells? Cellular and molecular life sciences : CMLS 61, 2510-2522, doi:10.1007/s00018-004-4144-6 (2004). 577 Tronche, F. et al. Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet 23, 99-103, doi:10.1038/12703 (1999). 578 Zimmerman, L. et al. Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12, 11-24 (1994). 579 Treutelaar, M. K. et al. Nestin-lineage cells contribute to the microvasculature but not endocrine cells of the islet. Diabetes 52, 2503-2512 (2003). 580 Zhu, Y. et al. Ablation of NF1 function in neurons induces abnormal development of cerebral cortex and reactive gliosis in the brain. Genes Dev 15, 859-876, doi:10.1101/gad.862101 (2001). 581 Cohen, P. et al. Selective deletion of leptin receptor in neurons leads to obesity. The Journal of clinical investigation 108, 1113-1121, doi:10.1172/jci13914 (2001). 582 Rempe, D. et al. Synapsin I Cre transgene expression in male mice produces germline recombination in progeny. Genesis 44, 44-49, doi:10.1002/gene.20183 (2006). 583 Luquet, S., Perez, F. A., Hnasko, T. S. & Palmiter, R. D. NPY/AgRP neurons are essential for feeding in adult mice but can be ablated in neonates. Science 310, 683-685, doi:10.1126/science.1115524 (2005). 584 Kenyon, C. J. The genetics of ageing. Nature 464, 504-512, doi:nature08980 [pii]10.1038/nature08980 (2010). 585 Kenyon, C. The plasticity of aging: insights from long-lived mutants. Cell 120, 449-460, doi:S0092-8674(05)00110-8 [pii]10.1016/j.cell.2005.02.002 (2005).  205 Appendices Appendix A  Effect of Diets with Lard as The Source of Fat on Glucose Tolerance A.1 High Fat Diet Induced Glucose Intolerance  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0167270/manifest

Comment

Related Items